#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name	i_deletion_substructures	i_domain	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_header	i_normal_VAF	i_normal_ref_reads	i_normal_var_reads	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_tier	i_title	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_VAF	i_tumor_ref_reads	i_tumor_var_reads	i_type	i_ucsc_cons	i_variant
ACOT11	26027	genome.wustl.edu	37	1	55065065	55065065	+	Silent	SNP	C	C	A			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr1:55065065C>A	ENST00000371316.3	+	8	943	c.861C>A	c.(859-861)atC>atA	p.I287I	ACOT11_ENST00000343744.2_Silent_p.I287I|ACOT11_ENST00000481208.1_3'UTR	NM_015547.3	NP_056362.1	Q8WXI4	ACO11_HUMAN	acyl-CoA thioesterase 11	287	Acyl coenzyme A hydrolase 2.				fatty acid metabolic process (GO:0006631)|intracellular signal transduction (GO:0035556)|response to cold (GO:0009409)|response to temperature stimulus (GO:0009266)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	acyl-CoA hydrolase activity (GO:0047617)|carboxylic ester hydrolase activity (GO:0052689)|lipid binding (GO:0008289)			NS(1)|central_nervous_system(1)|endometrium(6)|large_intestine(3)|lung(5)|ovary(1)	17						TCAAAGCCATCGTGAACAATG	0.597																																					Ovarian(148;1440 1861 22015 32453 51933)												0													167.0	153.0	158.0					1																	55065065		2203	4300	6503	SO:0001819	synonymous_variant	0			AB014607	CCDS592.1, CCDS593.1	1p32.3	2011-09-13	2005-09-08	2005-09-08	ENSG00000162390	ENSG00000162390	3.1.2.-	"""Acyl CoA thioesterases"", ""StAR-related lipid transfer (START) domain containing"""	18156	protein-coding gene	gene with protein product	"""StAR-related lipid transfer (START) domain containing 14"""	606803	"""thioesterase, adipose associated"""	THEA		11696000, 16103133, 16940157	Standard	NM_015547		Approved	STARD14, BFIT, KIAA0707, BFIT1, THEM1	uc001cxl.2	Q8WXI4	OTTHUMG00000009891	ENST00000371316.3:c.861C>A	1.37:g.55065065C>A			B1AQ22|D3DQ50|O75187|Q52LP1|Q53ER9|Q96DI1|Q9H883	Silent	SNP	pfam_START_lipid-bd_dom,pfam_Thioestr_supf,smart_START_lipid-bd_dom,pfscan_START_lipid-bd_dom	p.I287	ENST00000371316.3	37	c.861	CCDS592.1	1																																																																																			ACOT11	-	pfam_Thioestr_supf	ENSG00000162390		0.597	ACOT11-001	KNOWN	basic|CCDS	protein_coding	ACOT11	HGNC	protein_coding	OTTHUMT00000027356.1	-	0.00	154	0	C	NM_015547		55065065	+1	tier1	-	no_errors	ENST00000371316	ensembl	human	known	74_37	silent	5.56	68	4	SNP	0.201	A
ACRC	93953	genome.wustl.edu	37	X	70832394	70832394	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chrX:70832394C>T	ENST00000373695.1	+	11	2477	c.1940C>T	c.(1939-1941)aCt>aTt	p.T647I	ACRC_ENST00000373696.3_Missense_Mutation_p.T647I|ACRC_ENST00000471950.1_3'UTR			Q96QF7	ACRC_HUMAN	acidic repeat containing	647	SprT-like.					nucleus (GO:0005634)				autonomic_ganglia(1)|breast(1)|endometrium(15)|kidney(4)|large_intestine(4)|lung(20)|ovary(5)|prostate(1)|skin(2)|stomach(1)	54	Renal(35;0.156)					TATGAATGTACTGGATGCAAA	0.448																																																	0													64.0	54.0	58.0					X																	70832394		2203	4300	6503	SO:0001583	missense	0			AJ311392	CCDS35326.1	Xq13.1	2010-08-05			ENSG00000147174	ENSG00000147174			15805	protein-coding gene	gene with protein product		300369					Standard	NM_052957		Approved		uc004eae.2	Q96QF7	OTTHUMG00000033327	ENST00000373695.1:c.1940C>T	X.37:g.70832394C>T	ENSP00000362799:p.Thr647Ile		B9EG62	Missense_Mutation	SNP	pfam_SprT-like_domain,smart_SprT-like_domain	p.T647I	ENST00000373695.1	37	c.1940	CCDS35326.1	X	.	.	.	.	.	.	.	.	.	.	C	11.56	1.674564	0.29693	.	.	ENSG00000147174	ENST00000373696;ENST00000373695	T;T	0.45668	0.89;0.89	4.97	-1.17	0.09648	Domain of unknown function SprT-like (2);	.	.	.	.	T	0.44664	0.1304	M	0.64567	1.98	0.09310	N	1	D	0.57257	0.979	P	0.55260	0.772	T	0.33701	-0.9858	9	0.52906	T	0.07	.	1.0406	0.01558	0.2754:0.3805:0.1328:0.2113	.	647	Q96QF7	ACRC_HUMAN	I	647	ENSP00000362800:T647I;ENSP00000362799:T647I	ENSP00000362799:T647I	T	+	2	0	ACRC	70749119	0.001000	0.12720	0.007000	0.13788	0.076000	0.17211	0.229000	0.17833	-0.237000	0.09739	0.422000	0.28245	ACT	ACRC	-	pfam_SprT-like_domain,smart_SprT-like_domain	ENSG00000147174		0.448	ACRC-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ACRC	HGNC	protein_coding	OTTHUMT00000081856.1	-	0.00	122	0	C			70832394	+1	tier1	-	no_errors	ENST00000373695	ensembl	human	known	74_37	missense	6.15	61	4	SNP	0.018	T
ACSF3	197322	genome.wustl.edu	37	16	89199546	89199546	+	Silent	SNP	G	G	T			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr16:89199546G>T	ENST00000317447.4	+	8	1619	c.1242G>T	c.(1240-1242)gtG>gtT	p.V414V	ACSF3_ENST00000378345.4_Silent_p.V149V|ACSF3_ENST00000406948.3_Silent_p.V414V	NM_001127214.2|NM_001243279.1|NM_001284316.1|NM_174917.3	NP_001120686.1|NP_001230208.1|NP_001271245.1|NP_777577.2	Q4G176	ACSF3_HUMAN	acyl-CoA synthetase family member 3	414					fatty acid biosynthetic process (GO:0006633)|fatty acid metabolic process (GO:0006631)|malonate catabolic process (GO:0090410)	mitochondrion (GO:0005739)	acid-thiol ligase activity (GO:0016878)|ATP binding (GO:0005524)|malonyl-CoA synthetase activity (GO:0090409)			central_nervous_system(1)|endometrium(1)|kidney(2)|lung(9)|prostate(1)|urinary_tract(1)	15				BRCA - Breast invasive adenocarcinoma(80;0.0281)		CTCCACAGGTGACCCCAGGGT	0.552																																																	0													71.0	75.0	73.0					16																	89199546		2198	4300	6498	SO:0001819	synonymous_variant	0			AK075499	CCDS10974.1, CCDS73926.1	16q24.3	2013-01-15			ENSG00000176715	ENSG00000176715		"""Acyl-CoA synthetase family"""	27288	protein-coding gene	gene with protein product	"""malonyl-CoA synthetase"""	614245				17762044, 21846720	Standard	XM_005256293		Approved		uc010cig.2	Q4G176	OTTHUMG00000138044	ENST00000317447.4:c.1242G>T	16.37:g.89199546G>T			A8K4J8|C9JQL6|Q6INA0|Q8N2F7	Missense_Mutation	SNP	pfam_AMP-dep_Synth/Lig	p.D365Y	ENST00000317447.4	37	c.1093	CCDS10974.1	16																																																																																			ACSF3	-	NULL	ENSG00000176715		0.552	ACSF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACSF3	HGNC	protein_coding	OTTHUMT00000269919.1		0.00	82	0	G	NM_174917		89199546	+1			no_errors	ENST00000542688	ensembl	human	known	74_37	missense	6.90	54	4	SNP	1.000	T
ACSL3	2181	genome.wustl.edu	37	2	223806251	223806251	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr2:223806251G>T	ENST00000357430.3	+	17	2573	c.2042G>T	c.(2041-2043)cGt>cTt	p.R681L	ACSL3_ENST00000392066.3_Missense_Mutation_p.R681L	NM_004457.3	NP_004448.2	O95573	ACSL3_HUMAN	acyl-CoA synthetase long-chain family member 3	681					brain development (GO:0007420)|fatty acid biosynthetic process (GO:0006633)|long-chain fatty acid import (GO:0044539)|positive regulation of Golgi to plasma membrane protein transport (GO:0042998)|positive regulation of phosphatidylcholine biosynthetic process (GO:2001247)|positive regulation of secretion (GO:0051047)|response to nutrient (GO:0007584)|response to organic cyclic compound (GO:0014070)|very-low-density lipoprotein particle assembly (GO:0034379)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lipid particle (GO:0005811)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|perinuclear region of cytoplasm (GO:0048471)|peroxisome (GO:0005777)	ATP binding (GO:0005524)|long-chain fatty acid-CoA ligase activity (GO:0004467)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			cervix(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(5)|ovary(2)|prostate(1)|skin(2)	22		Renal(207;0.0183)		Epithelial(121;1.28e-10)|all cancers(144;8.06e-08)|Lung(261;0.00834)|LUSC - Lung squamous cell carcinoma(224;0.00864)	Icosapent(DB00159)	GTAAAAATTCGTTTGAGTCCT	0.383			T	ETV1	prostate																																			Dom	yes		2	2q36	2181	acyl-CoA synthetase long-chain family member 3		E	0													71.0	73.0	72.0					2																	223806251		2203	4300	6503	SO:0001583	missense	0			D89053	CCDS2455.1	2q34-q35	2008-02-05	2004-02-19	2004-02-20	ENSG00000123983	ENSG00000123983		"""Acyl-CoA synthetase family"""	3570	protein-coding gene	gene with protein product		602371	"""fatty-acid-Coenzyme A ligase, long-chain 3"""	FACL3			Standard	NM_004457		Approved	ACS3, PRO2194	uc002vnj.3	O95573	OTTHUMG00000133160	ENST00000357430.3:c.2042G>T	2.37:g.223806251G>T	ENSP00000350012:p.Arg681Leu		Q60I92|Q8IUM9	Missense_Mutation	SNP	pfam_AMP-dep_Synth/Lig	p.R681L	ENST00000357430.3	37	c.2042	CCDS2455.1	2	.	.	.	.	.	.	.	.	.	.	G	21.9	4.214314	0.79352	.	.	ENSG00000123983	ENST00000357430;ENST00000392066	T;T	0.10192	2.9;2.9	5.79	5.79	0.91817	.	0.104246	0.64402	D	0.000001	T	0.13884	0.0336	L	0.42487	1.325	0.80722	D	1	P	0.39376	0.67	B	0.40329	0.326	T	0.07809	-1.0753	10	0.18276	T	0.48	-15.325	20.0411	0.97590	0.0:0.0:1.0:0.0	.	681	O95573	ACSL3_HUMAN	L	681	ENSP00000350012:R681L;ENSP00000375918:R681L	ENSP00000350012:R681L	R	+	2	0	ACSL3	223514495	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.398000	0.73244	2.739000	0.93911	0.655000	0.94253	CGT	ACSL3	-	NULL	ENSG00000123983		0.383	ACSL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACSL3	HGNC	protein_coding	OTTHUMT00000256862.2		0.00	52	0	G	NM_004457		223806251	+1			no_errors	ENST00000357430	ensembl	human	known	74_37	missense	5.88	32	2	SNP	1.000	T
ADAM29	11086	genome.wustl.edu	37	4	175899049	175899049	+	Silent	SNP	G	G	A	rs372859702		TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr4:175899049G>A	ENST00000359240.3	+	5	3043	c.2373G>A	c.(2371-2373)acG>acA	p.T791T	ADAM29_ENST00000404450.4_Silent_p.T791T|ADAM29_ENST00000514159.1_Silent_p.T791T|ADAM29_ENST00000445694.1_Silent_p.T791T|RP13-577H12.2_ENST00000507525.1_RNA	NM_001278125.1|NM_014269.4	NP_001265054.1|NP_055084.3	Q9UKF5	ADA29_HUMAN	ADAM metallopeptidase domain 29	791	9 X 9 AA approximate repeats.				spermatogenesis (GO:0007283)	integral component of plasma membrane (GO:0005887)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.T791T(1)		NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(25)|ovary(3)|pancreas(1)|prostate(7)|skin(24)|urinary_tract(2)	93		Breast(14;0.00908)|Melanoma(52;0.00951)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;3.08e-19)|Epithelial(43;6.24e-18)|OV - Ovarian serous cystadenocarcinoma(60;1.78e-09)|STAD - Stomach adenocarcinoma(60;0.00303)|GBM - Glioblastoma multiforme(59;0.0106)|LUSC - Lung squamous cell carcinoma(193;0.0286)		CTCAGTTGACGCCTTCCCAGA	0.572													G|||	1	0.000199681	0.0	0.0	5008	,	,		19223	0.0		0.0	False		,,,				2504	0.001				Ovarian(140;1727 1835 21805 25838 41440)												1	Substitution - coding silent(1)	urinary_tract(1)						G	,,,	0,4406		0,0,2203	163.0	151.0	155.0		2373,2373,2373,2373	-1.5	0.0	4		155	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	ADAM29	NM_001130703.1,NM_001130704.1,NM_001130705.1,NM_014269.4	,,,	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	,,,	791/821,791/821,791/821,791/821	175899049	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	0			AF171929	CCDS3823.1	4q34.1	2012-05-16	2005-08-18		ENSG00000168594	ENSG00000168594		"""ADAM metallopeptidase domain containing"""	207	protein-coding gene	gene with protein product	"""cancer/testis antigen 73"""	604778	"""a disintegrin and metalloproteinase domain 29"""			10644455	Standard	NM_014269		Approved	svph1, CT73	uc031shw.1	Q9UKF5	OTTHUMG00000160764	ENST00000359240.3:c.2373G>A	4.37:g.175899049G>A			Q4W5F3|Q9UHP1|Q9UKF3|Q9UKF4	Silent	SNP	pfam_Peptidase_M12B,pfam_ADAM_Cys-rich,pfam_Peptidase_M12B_N,pfam_Blood-coag_inhib_Disintegrin,superfamily_Blood-coag_inhib_Disintegrin,smart_Blood-coag_inhib_Disintegrin,smart_ADAM_Cys-rich,pfscan_Blood-coag_inhib_Disintegrin,pfscan_Peptidase_M12B,prints_Blood-coag_inhib_Disintegrin	p.T791	ENST00000359240.3	37	c.2373	CCDS3823.1	4																																																																																			ADAM29	-	NULL	ENSG00000168594		0.572	ADAM29-201	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	ADAM29	HGNC	protein_coding		-	0.00	114	0	G			175899049	+1	tier1	-	no_errors	ENST00000359240	ensembl	human	known	74_37	silent	41.38	68	48	SNP	0.005	A
ADAT1	23536	genome.wustl.edu	37	16	75654167	75654167	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr16:75654167T>C	ENST00000307921.3	-	4	380	c.235A>G	c.(235-237)Aac>Gac	p.N79D		NM_012091.3	NP_036223.2	Q9BUB4	ADAT1_HUMAN	adenosine deaminase, tRNA-specific 1	79	A to I editase. {ECO:0000255|PROSITE- ProRule:PRU00240}.				tRNA processing (GO:0008033)		metal ion binding (GO:0046872)|RNA binding (GO:0003723)|tRNA-specific adenosine deaminase activity (GO:0008251)			breast(1)|endometrium(4)|large_intestine(3)|lung(7)|ovary(1)|prostate(1)|skin(1)|stomach(1)	19						TGCTTACCGTTCTTCCTCATT	0.438																																																	0													290.0	230.0	250.0					16																	75654167		2198	4300	6498	SO:0001583	missense	0			AF125188	CCDS10922.1	16q23	2008-02-05			ENSG00000065457	ENSG00000065457			228	protein-coding gene	gene with protein product		604230				10430867	Standard	NM_012091		Approved		uc002feo.2	Q9BUB4	OTTHUMG00000137611	ENST00000307921.3:c.235A>G	16.37:g.75654167T>C	ENSP00000310015:p.Asn79Asp		Q9NVB7|Q9UNG3	Missense_Mutation	SNP	pfam_A_deamin,smart_A_deamin,pfscan_A_deamin	p.N79D	ENST00000307921.3	37	c.235	CCDS10922.1	16	.	.	.	.	.	.	.	.	.	.	T	3.147	-0.175012	0.06421	.	.	ENSG00000065457	ENST00000307921;ENST00000542252	D	0.93247	-3.19	5.45	4.35	0.52113	Adenosine deaminase/editase (3);	0.561776	0.21965	N	0.066532	D	0.82958	0.5150	N	0.10809	0.05	0.20873	N	0.999833	B	0.06786	0.001	B	0.11329	0.006	T	0.65907	-0.6054	10	0.08837	T	0.75	.	10.0206	0.42041	0.0:0.0804:0.0:0.9196	.	79	Q9BUB4	ADAT1_HUMAN	D	79;50	ENSP00000310015:N79D	ENSP00000310015:N79D	N	-	1	0	ADAT1	74211668	0.997000	0.39634	0.940000	0.37924	0.355000	0.29361	3.612000	0.54142	2.185000	0.69588	0.459000	0.35465	AAC	ADAT1	-	pfam_A_deamin,smart_A_deamin,pfscan_A_deamin	ENSG00000065457		0.438	ADAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAT1	HGNC	protein_coding	OTTHUMT00000269027.1		0.00	76	0	T	NM_012091		75654167	-1			no_errors	ENST00000307921	ensembl	human	known	74_37	missense	5.19	73	4	SNP	0.938	C
AGXT2	64902	genome.wustl.edu	37	5	35013131	35013131	+	Silent	SNP	C	C	T			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr5:35013131C>T	ENST00000231420.6	-	11	1316	c.1116G>A	c.(1114-1116)gcG>gcA	p.A372A		NM_031900.3	NP_114106.1	Q9BYV1	AGT2_HUMAN	alanine--glyoxylate aminotransferase 2	372					cellular nitrogen compound metabolic process (GO:0034641)|glycine biosynthetic process, by transamination of glyoxylate (GO:0019265)|glyoxylate catabolic process (GO:0009436)|glyoxylate metabolic process (GO:0046487)|L-alanine catabolic process, by transamination (GO:0019481)|nucleobase-containing small molecule metabolic process (GO:0055086)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	(R)-3-amino-2-methylpropionate-pyruvate transaminase activity (GO:0047305)|alanine-glyoxylate transaminase activity (GO:0008453)|beta-alanine-pyruvate transaminase activity (GO:0016223)|pyridoxal phosphate binding (GO:0030170)			NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(18)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	41	all_lung(31;4.52e-05)		COAD - Colon adenocarcinoma(61;0.174)|Colorectal(62;0.229)	GBM - Glioblastoma multiforme(108;0.181)	Glycine(DB00145)|L-Alanine(DB00160)|Pyruvic acid(DB00119)	GCAGGCATTTCGCCAAAGATT	0.502																																																	0													73.0	59.0	64.0					5																	35013131		1965	3735	5700	SO:0001819	synonymous_variant	0			AJ292204	CCDS3908.1	5p13	2010-05-07	2010-05-07		ENSG00000113492	ENSG00000113492	2.6.1.44		14412	protein-coding gene	gene with protein product	"""beta-alanine-pyruvate aminotransferase"", ""beta-ALAAT II"""	612471	"""alanine-glyoxylate aminotransferase 2"""			15240345	Standard	NM_031900		Approved	AGT2	uc003jjf.3	Q9BYV1	OTTHUMG00000090788	ENST00000231420.6:c.1116G>A	5.37:g.35013131C>T			B7ZM47|E9PDL7|Q53FB4|Q53FY7|Q53G03|Q5W7Q1	Silent	SNP	pfam_Aminotrans_3,superfamily_PyrdxlP-dep_Trfase	p.A372	ENST00000231420.6	37	c.1116	CCDS3908.1	5																																																																																			AGXT2	-	pfam_Aminotrans_3,superfamily_PyrdxlP-dep_Trfase	ENSG00000113492		0.502	AGXT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AGXT2	HGNC	protein_coding	OTTHUMT00000207574.2	-	0.00	79	0	C	NM_031900		35013131	-1	tier1	-	no_errors	ENST00000231420	ensembl	human	known	74_37	silent	38.81	41	26	SNP	0.272	T
ALDOC	230	genome.wustl.edu	37	17	26902474	26902474	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr17:26902474G>A	ENST00000226253.4	-	2	552	c.77C>T	c.(76-78)cCg>cTg	p.P26L	ALDOC_ENST00000395321.2_Missense_Mutation_p.P26L|RP11-192H23.5_ENST00000585189.1_RNA|ALDOC_ENST00000395319.3_Missense_Mutation_p.P26L	NM_005165.2	NP_005156.1	P09972	ALDOC_HUMAN	aldolase C, fructose-bisphosphate	26					aging (GO:0007568)|apoptotic process (GO:0006915)|carbohydrate metabolic process (GO:0005975)|epithelial cell differentiation (GO:0030855)|fructose 1,6-bisphosphate metabolic process (GO:0030388)|fructose metabolic process (GO:0006000)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|organ regeneration (GO:0031100)|protein heterotetramerization (GO:0051290)|protein homotetramerization (GO:0051289)|response to hypoxia (GO:0001666)|response to organic cyclic compound (GO:0014070)|response to organonitrogen compound (GO:0010243)|small molecule metabolic process (GO:0044281)	axon (GO:0030424)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	cytoskeletal protein binding (GO:0008092)|fructose-bisphosphate aldolase activity (GO:0004332)			breast(1)|endometrium(1)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)	11	Lung NSC(42;0.00431)					GCCTTTGCCCGGGGCTACAAT	0.572											OREG0024278	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													101.0	88.0	92.0					17																	26902474		2203	4300	6503	SO:0001583	missense	0			AF054987	CCDS11236.1	17q11.2	2013-09-20			ENSG00000109107	ENSG00000109107	4.1.2.13		418	protein-coding gene	gene with protein product		103870					Standard	XM_005257947		Approved		uc002hbp.3	P09972	OTTHUMG00000132605	ENST00000226253.4:c.77C>T	17.37:g.26902474G>A	ENSP00000226253:p.Pro26Leu	790	B2R5R3|Q3SYL3|Q6FH94|Q6P0L5	Missense_Mutation	SNP	pfam_Aldolase_I	p.P26L	ENST00000226253.4	37	c.77	CCDS11236.1	17	.	.	.	.	.	.	.	.	.	.	G	14.97	2.693687	0.48202	.	.	ENSG00000109107	ENST00000395319;ENST00000226253;ENST00000395321;ENST00000435638	D;D;D;D	0.87256	-2.23;-2.23;-2.23;-2.23	6.07	6.07	0.98685	Aldolase-type TIM barrel (1);	0.000000	0.85682	D	0.000000	D	0.87265	0.6134	M	0.61703	1.905	0.80722	D	1	B;B	0.32324	0.232;0.364	B;B	0.32805	0.072;0.153	D	0.86068	0.1536	10	0.87932	D	0	.	19.4154	0.94694	0.0:0.0:1.0:0.0	.	26;26	A8MVZ9;P09972	.;ALDOC_HUMAN	L	26	ENSP00000378729:P26L;ENSP00000226253:P26L;ENSP00000378731:P26L;ENSP00000398976:P26L	ENSP00000226253:P26L	P	-	2	0	ALDOC	23926601	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	9.869000	0.99810	2.884000	0.98904	0.655000	0.94253	CCG	ALDOC	-	pfam_Aldolase_I	ENSG00000109107		0.572	ALDOC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALDOC	HGNC	protein_coding	OTTHUMT00000255839.4	-	0.00	64	0	G			26902474	-1	tier1	-	no_errors	ENST00000226253	ensembl	human	known	74_37	missense	25.49	38	13	SNP	1.000	A
ANKRD20A5P	440482	genome.wustl.edu	37	18	14219963	14219963	+	IGR	DEL	A	A	-			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr18:14219963delA								RNU6-316P (29158 upstream) : RP11-757O6.1 (24660 downstream)																							TATGCTGCACAAAAAAAATCG	0.274																																																	0																																										SO:0001628	intergenic_variant	0																															18.37:g.14219963delA				RNA	DEL	-	NULL		37	NULL		18																																																																																			ANKRD20A5P	-	-	ENSG00000186481	0	0.274					ANKRD20A5P	HGNC				0.00	208	0	A			14219963	+1	tier1		no_errors	ENST00000580995	ensembl	human	known	74_37	rna	33.49	139	70	DEL	0.296	-
ANKS6	203286	genome.wustl.edu	37	9	101552234	101552234	+	Intron	SNP	C	C	T			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr9:101552234C>T	ENST00000353234.4	-	2	910				ANKS6_ENST00000540940.1_Intron|ANKS6_ENST00000375018.1_Intron|ANKS6_ENST00000375019.2_Intron|ANKS6_ENST00000471846.1_5'UTR			Q68DC2	ANKS6_HUMAN	ankyrin repeat and sterile alpha motif domain containing 6							cilium (GO:0005929)|cytoplasm (GO:0005737)				endometrium(3)|large_intestine(6)|lung(6)|ovary(2)|pancreas(1)|prostate(2)|skin(1)	21		Acute lymphoblastic leukemia(62;0.0527)				gcaatccccccgatacttaag	0.547																																																	0																																										SO:0001627	intron_variant	0			AK094247	CCDS43856.1	9q31.1	2013-09-10	2006-02-17	2006-02-17	ENSG00000165138	ENSG00000165138		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	26724	protein-coding gene	gene with protein product		615370	"""sterile alpha motif domain containing 6"", ""ankyrin repeat domain 14"""	SAMD6, ANKRD14		23793029	Standard	XM_005251793		Approved	FLJ36928, NPHP16	uc004ayu.3	Q68DC2	OTTHUMG00000020347	ENST00000353234.4:c.862+151G>A	9.37:g.101552234C>T			A0SE62|Q5VSL0|Q5VSL2|Q5VSL3|Q5VSL4|Q68DB8|Q6P2R2|Q8N9L6|Q96D62	RNA	SNP	-	NULL	ENST00000353234.4	37	NULL	CCDS43856.1	9																																																																																			ANKS6	-	-	ENSG00000165138		0.547	ANKS6-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	ANKS6	HGNC	protein_coding	OTTHUMT00000277053.1	-	0.00	20	0	C	NM_173551		101552234	-1	tier1	-	no_errors	ENST00000471846	ensembl	human	putative	74_37	rna	41.67	14	10	SNP	0.000	T
AP3S1	1176	genome.wustl.edu	37	5	115205741	115205741	+	Silent	SNP	G	G	C			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr5:115205741G>C	ENST00000316788.7	+	3	746	c.189G>C	c.(187-189)ctG>ctC	p.L63L		NM_001284.2	NP_001275.1	Q92572	AP3S1_HUMAN	adaptor-related protein complex 3, sigma 1 subunit	63					anterograde axon cargo transport (GO:0008089)|anterograde synaptic vesicle transport (GO:0048490)|insulin receptor signaling pathway (GO:0008286)|intracellular protein transport (GO:0006886)	AP-3 adaptor complex (GO:0030123)|AP-type membrane coat adaptor complex (GO:0030119)|Golgi apparatus (GO:0005794)|transport vesicle (GO:0030133)	protein transporter activity (GO:0008565)|transporter activity (GO:0005215)			cervix(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(2)|ovary(1)|pancreas(1)|prostate(1)	12		all_cancers(142;0.00377)|all_epithelial(76;0.000129)|Prostate(80;0.0132)|Ovarian(225;0.0776)|Lung NSC(810;0.245)		OV - Ovarian serous cystadenocarcinoma(64;1.08e-07)|Epithelial(69;1.11e-06)|all cancers(49;5.2e-05)		ACAACAAACTGATTTATAGAC	0.308																																																	0													127.0	124.0	125.0					5																	115205741		2202	4297	6499	SO:0001819	synonymous_variant	0			D63643	CCDS4123.1	5q22	2010-06-29			ENSG00000177879	ENSG00000177879			2013	protein-coding gene	gene with protein product		601507		CLAPS3		8697810, 9118953	Standard	NM_001284		Approved		uc003krl.3	Q92572	OTTHUMG00000128887	ENST00000316788.7:c.189G>C	5.37:g.115205741G>C			O00647|O00676|O00721|O00727|Q53XL4|Q6ICQ2	Silent	SNP	pfam_AP_mu_sigma_su,superfamily_Longin-like_dom,pirsf_AP_complex_ssu	p.L63	ENST00000316788.7	37	c.189	CCDS4123.1	5																																																																																			AP3S1	-	pfam_AP_mu_sigma_su,superfamily_Longin-like_dom,pirsf_AP_complex_ssu	ENSG00000177879		0.308	AP3S1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AP3S1	HGNC	protein_coding	OTTHUMT00000250847.2	-	0.00	74	0	G			115205741	+1	tier1	-	no_errors	ENST00000316788	ensembl	human	known	74_37	silent	6.35	59	4	SNP	0.998	C
AP5Z1	9907	genome.wustl.edu	37	7	4824679	4824679	+	Splice_Site	SNP	C	C	T	rs376075583		TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr7:4824679C>T	ENST00000348624.4	+	7	1025	c.931C>T	c.(931-933)Cga>Tga	p.R311*	AP5Z1_ENST00000401897.1_Splice_Site_p.R311*	NM_014855.2	NP_055670.1	O43299	AP5Z1_HUMAN	adaptor-related protein complex 5, zeta 1 subunit	311					cell death (GO:0008219)|double-strand break repair via homologous recombination (GO:0000724)|endosomal transport (GO:0016197)|protein transport (GO:0015031)	AP-5 adaptor complex (GO:0044599)|AP-type membrane coat adaptor complex (GO:0030119)|cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.R155*(1)|p.R1022*(1)									AAGTAACCGACGTGAGTCCCC	0.687													C|||	1	0.000199681	0.0	0.0	5008	,	,		15177	0.0		0.001	False		,,,				2504	0.0																2	Substitution - Nonsense(2)	endometrium(2)						C	stop/ARG	0,3952		0,0,1976	28.0	33.0	31.0		931	1.6	0.4	7		31	1,8281		0,1,4140	no	stop-gained-near-splice	KIAA0415	NM_014855.2		0,1,6116	TT,TC,CC		0.0121,0.0,0.0082		311/808	4824679	1,12233	1976	4141	6117	SO:0001630	splice_region_variant	0			AB007875	CCDS47528.1	7p22.1	2012-03-20	2012-03-20	2012-03-20	ENSG00000242802	ENSG00000242802			22197	protein-coding gene	gene with protein product		613653	"""KIAA0415"""	KIAA0415		20613862, 22022230	Standard	NM_014855		Approved	SPG48, zeta	uc003sne.3	O43299	OTTHUMG00000151754	ENST00000348624.4:c.931+1C>T	7.37:g.4824679C>T			Q8N3X2|Q96H80	Nonsense_Mutation	SNP	NULL	p.R311*	ENST00000348624.4	37	c.931	CCDS47528.1	7	.	.	.	.	.	.	.	.	.	.	C	17.73	3.461082	0.63513	0.0	1.21E-4	ENSG00000242802	ENST00000348624;ENST00000401897	.	.	.	4.88	1.57	0.23409	.	0.190505	0.42548	D	0.000684	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	7.3985	0.26950	0.4266:0.4827:0.0:0.0907	.	.	.	.	X	311	.	ENSP00000297562:R311X	R	+	1	2	KIAA0415	4791205	0.991000	0.36638	0.363000	0.25875	0.403000	0.30841	2.423000	0.44705	0.432000	0.26286	0.561000	0.74099	CGA	AP5Z1	-	NULL	ENSG00000242802		0.687	AP5Z1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AP5Z1	HGNC	protein_coding	OTTHUMT00000323771.1		0.00	66	0	C		Nonsense_Mutation	4824679	+1			no_errors	ENST00000348624	ensembl	human	known	74_37	nonsense	5.77	49	3	SNP	0.938	T
APOA5	116519	genome.wustl.edu	37	11	116660917	116660917	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr11:116660917C>T	ENST00000227665.4	-	3	1062	c.1028G>A	c.(1027-1029)cGt>cAt	p.R343H	ZNF259_ENST00000227322.3_5'Flank|APOA5_ENST00000542499.1_Missense_Mutation_p.R343H			Q6Q788	APOA5_HUMAN	apolipoprotein A-V	343					acylglycerol homeostasis (GO:0055090)|cellular lipid metabolic process (GO:0044255)|cholesterol homeostasis (GO:0042632)|lipid transport (GO:0006869)|lipoprotein metabolic process (GO:0042157)|organ regeneration (GO:0031100)|positive regulation of fatty acid biosynthetic process (GO:0045723)|positive regulation of lipid catabolic process (GO:0050996)|positive regulation of lipoprotein lipase activity (GO:0051006)|positive regulation of receptor-mediated endocytosis (GO:0048260)|positive regulation of triglyceride catabolic process (GO:0010898)|positive regulation of very-low-density lipoprotein particle remodeling (GO:0010902)|response to hormone (GO:0009725)|small molecule metabolic process (GO:0044281)|tissue regeneration (GO:0042246)|triglyceride catabolic process (GO:0019433)|triglyceride homeostasis (GO:0070328)|triglyceride metabolic process (GO:0006641)|triglyceride-rich lipoprotein particle remodeling (GO:0034370)	chylomicron (GO:0042627)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|high-density lipoprotein particle (GO:0034364)|very-low-density lipoprotein particle (GO:0034361)	enzyme activator activity (GO:0008047)|enzyme binding (GO:0019899)|heparin binding (GO:0008201)|lipase activator activity (GO:0060229)|lipase binding (GO:0035473)|lipid binding (GO:0008289)|lipoprotein lipase activator activity (GO:0060230)|lipoprotein particle receptor binding (GO:0070325)|low-density lipoprotein particle receptor binding (GO:0050750)|phosphatidylcholine binding (GO:0031210)|phospholipid binding (GO:0005543)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(8)|urinary_tract(1)	14	all_hematologic(175;0.0487)	all_cancers(61;3.31e-09)|all_epithelial(67;8.03e-06)|Breast(348;0.0126)|Melanoma(852;0.0153)|Acute lymphoblastic leukemia(157;0.0257)|Medulloblastoma(222;0.0425)|all_hematologic(158;0.0433)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|Epithelial(105;4.93e-06)|all cancers(92;0.000123)|OV - Ovarian serous cystadenocarcinoma(223;0.149)		GTCATCCAGACGGGCCTGCAG	0.612																																																	0													104.0	89.0	94.0					11																	116660917		2201	4296	6497	SO:0001583	missense	0			AF202889	CCDS8376.2	11q23	2013-01-24			ENSG00000110243	ENSG00000110243		"""Apolipoproteins"""	17288	protein-coding gene	gene with protein product		606368				11588264, 11577099	Standard	NM_001166598		Approved	RAP3, APOA-V	uc009yzf.3	Q6Q788	OTTHUMG00000046116	ENST00000227665.4:c.1028G>A	11.37:g.116660917C>T	ENSP00000227665:p.Arg343His		B0YIV9|Q3MIK6|Q6UWK9|Q9UBJ3	Missense_Mutation	SNP	pfam_ApoA1_A4_E	p.R343H	ENST00000227665.4	37	c.1028	CCDS8376.2	11	.	.	.	.	.	.	.	.	.	.	C	21.1	4.092993	0.76756	.	.	ENSG00000110243	ENST00000227665;ENST00000542499	T;T	0.72282	-0.64;-0.64	4.94	4.94	0.65067	Apolipoprotein/apolipophorin (1);	0.000000	0.42821	D	0.000652	T	0.82116	0.4967	M	0.72118	2.19	0.39493	D	0.96808	D;D	0.89917	1.0;1.0	D;D	0.69142	0.962;0.94	D	0.84486	0.0608	10	0.62326	D	0.03	-9.4187	15.0322	0.71717	0.0:1.0:0.0:0.0	.	340;343	B0YIW1;Q6Q788	.;APOA5_HUMAN	H	343	ENSP00000227665:R343H;ENSP00000445002:R343H	ENSP00000227665:R343H	R	-	2	0	APOA5	116166127	0.992000	0.36948	0.989000	0.46669	0.997000	0.91878	2.931000	0.48932	2.553000	0.86117	0.655000	0.94253	CGT	APOA5	-	NULL	ENSG00000110243		0.612	APOA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APOA5	HGNC	protein_coding	OTTHUMT00000106285.2	-	0.00	52	0	C			116660917	-1	tier1	-	no_errors	ENST00000227665	ensembl	human	known	74_37	missense	8.51	43	4	SNP	0.992	T
AQR	9716	genome.wustl.edu	37	15	35222464	35222464	+	Silent	SNP	G	G	A			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr15:35222464G>A	ENST00000156471.5	-	12	1234	c.1009C>T	c.(1009-1011)Cta>Tta	p.L337L		NM_014691.2	NP_055506.1	O60306	AQR_HUMAN	aquarius intron-binding spliceosomal factor	337					mRNA splicing, via spliceosome (GO:0000398)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(10)|lung(18)|ovary(1)|prostate(6)|skin(4)|upper_aerodigestive_tract(2)	57		Lung NSC(122;8.7e-10)|all_lung(180;1.47e-08)		all cancers(64;4.34e-18)|GBM - Glioblastoma multiforme(113;4.59e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0283)		ATTACCTGTAGAGAAGTAATT	0.313																																																	0													124.0	119.0	121.0					15																	35222464		1807	4072	5879	SO:0001819	synonymous_variant	0			AB011132	CCDS42013.1	15q13	2013-09-12	2013-09-12			ENSG00000021776			29513	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 164"""	610548	"""aquarius homolog (mouse)"""			9626505, 16949364	Standard	NM_014691		Approved	KIAA0560, fSAP164, IBP160	uc001ziv.3	O60306		ENST00000156471.5:c.1009C>T	15.37:g.35222464G>A			A0JP17|A5YKK3|Q2YDX9|Q6IRU8|Q6PIC8	Silent	SNP	superfamily_P-loop_NTPase	p.L337	ENST00000156471.5	37	c.1009	CCDS42013.1	15																																																																																			AQR	-	NULL	ENSG00000021776		0.313	AQR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AQR	HGNC	protein_coding	OTTHUMT00000417526.2	-	0.00	48	0	G	NM_014691		35222464	-1	tier1	-	no_errors	ENST00000156471	ensembl	human	known	74_37	silent	38.98	36	23	SNP	0.993	A
ARID1A	8289	genome.wustl.edu	37	1	27106916	27106916	+	Frame_Shift_Del	DEL	A	A	-			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr1:27106916delA	ENST00000324856.7	+	20	6898	c.6527delA	c.(6526-6528)cagfs	p.Q2176fs	ARID1A_ENST00000457599.2_Frame_Shift_Del_p.Q1959fs|ARID1A_ENST00000540690.1_Frame_Shift_Del_p.Q504fs|ARID1A_ENST00000374152.2_Frame_Shift_Del_p.Q1793fs	NM_006015.4	NP_006006.3	O14497	ARI1A_HUMAN	AT rich interactive domain 1A (SWI-like)	2176					androgen receptor signaling pathway (GO:0030521)|ATP-dependent chromatin remodeling (GO:0043044)|cardiac chamber development (GO:0003205)|chromatin remodeling (GO:0006338)|chromatin-mediated maintenance of transcription (GO:0048096)|forebrain development (GO:0030900)|glucocorticoid receptor signaling pathway (GO:0042921)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|nucleosome disassembly (GO:0006337)|nucleosome mobilization (GO:0042766)|optic cup formation involved in camera-type eye development (GO:0003408)|placenta blood vessel development (GO:0060674)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|transcription coactivator activity (GO:0003713)		ARID1A/MAST2_ENST00000361297(2)	NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(13)|central_nervous_system(6)|cervix(2)|endometrium(56)|haematopoietic_and_lymphoid_tissue(8)|kidney(10)|large_intestine(41)|liver(31)|lung(34)|ovary(130)|pancreas(18)|prostate(8)|skin(9)|stomach(14)|upper_aerodigestive_tract(4)|urinary_tract(24)	411		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)		AACCTGGCTCAGGGGGACAGC	0.607			"""Mis, N, F, S, D"""		"""clear cell ovarian carcinoma, RCC"""																																			Rec	yes		1	1p35.3	8289	AT rich interactive domain 1A (SWI-like)		E	0													69.0	67.0	68.0					1																	27106916		2203	4300	6503	SO:0001589	frameshift_variant	0			AB001895	CCDS285.1, CCDS44091.1	1p36.1-p35	2014-09-17	2006-11-08	2004-01-30	ENSG00000117713	ENSG00000117713		"""-"""	11110	protein-coding gene	gene with protein product		603024	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily f, member 1"", ""AT rich interactive domain 1A (SWI- like)"""	C1orf4, SMARCF1		9630625, 9434167	Standard	NM_139135		Approved	B120, P270, C10rf4, BAF250, BAF250a	uc001bmv.1	O14497	OTTHUMG00000004004	ENST00000324856.7:c.6527delA	1.37:g.27106916delA	ENSP00000320485:p.Gln2176fs		D3DPL1|Q53FK9|Q5T0W1|Q5T0W2|Q5T0W3|Q8NFD6|Q96T89|Q9BY33|Q9HBJ5|Q9UPZ1	Frame_Shift_Del	DEL	pfam_DUF3518,pfam_ARID/BRIGHT_DNA-bd,superfamily_ARID/BRIGHT_DNA-bd,superfamily_ARM-type_fold,smart_ARID/BRIGHT_DNA-bd,pfscan_ARID/BRIGHT_DNA-bd	p.Q2176fs	ENST00000324856.7	37	c.6527	CCDS285.1	1																																																																																			ARID1A	-	pfam_DUF3518,superfamily_ARM-type_fold	ENSG00000117713		0.607	ARID1A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ARID1A	HGNC	protein_coding	OTTHUMT00000011437.2		0.00	57	0	A	NM_139135		27106916	+1	tier1		no_errors	ENST00000324856	ensembl	human	known	74_37	frame_shift_del	51.52	16	17	DEL	1.000	-
ASMT	438	genome.wustl.edu	37	X	1746845	1746845	+	Intron	SNP	G	G	A			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chrX:1746845G>A	ENST00000381229.4	+	4	479				ASMT_ENST00000381233.3_Intron|ASMT_ENST00000381241.3_Intron|ASMT_ENST00000509780.1_3'UTR			P46597	ASMT_HUMAN	acetylserotonin O-methyltransferase						cellular nitrogen compound metabolic process (GO:0034641)|indolalkylamine biosynthetic process (GO:0046219)|melatonin biosynthetic process (GO:0030187)|negative regulation of male gonad development (GO:2000019)|small molecule metabolic process (GO:0044281)|translation (GO:0006412)	cytosol (GO:0005829)	acetylserotonin O-methyltransferase activity (GO:0017096)|identical protein binding (GO:0042802)|O-methyltransferase activity (GO:0008171)|protein homodimerization activity (GO:0042803)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(9)|skin(1)	16		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)			Melatonin(DB01065)	TGTTTAAATTGATCAAATTCC	0.463																																																	0																																										SO:0001627	intron_variant	0			M83779	CCDS14117.1, CCDS55364.1	Xp22.3 and Yp11.3	2008-02-05			ENSG00000196433	ENSG00000196433	2.1.1.4	"""Pseudoautosomal regions / PAR1"""	750	protein-coding gene	gene with protein product		300015, 402500				8397829, 7989373	Standard	NM_004043		Approved	HIOMT, ASMTY, HIOMTY	uc010ncy.3	P46597	OTTHUMG00000021065	ENST00000381229.4:c.443+181G>A	X.37:g.1746845G>A			B2RC33|Q16598|Q5JQ72|Q5JQ73	RNA	SNP	-	NULL	ENST00000381229.4	37	NULL		X																																																																																			ASMT	-	-	ENSG00000196433		0.463	ASMT-002	KNOWN	basic|appris_principal	protein_coding	ASMT	HGNC	protein_coding	OTTHUMT00000055612.1	-	0.00	55	0	G	NM_004043		1746845	+1	tier1	-	no_errors	ENST00000509780	ensembl	human	known	74_37	rna	67.65	11	23	SNP	0.006	A
ATM	472	genome.wustl.edu	37	11	108218089	108218089	+	Missense_Mutation	SNP	C	C	G	rs587779874		TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr11:108218089C>G	ENST00000452508.2	+	60	8857	c.8668C>G	c.(8668-8670)Cta>Gta	p.L2890V	ATM_ENST00000525178.1_3'UTR|C11orf65_ENST00000525729.1_Intron|ATM_ENST00000278616.4_Missense_Mutation_p.L2890V|C11orf65_ENST00000526725.1_Intron			Q13315	ATM_HUMAN	ATM serine/threonine kinase	2890	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.		L -> V (in T-prolymphocytic leukemia). {ECO:0000269|PubMed:9288106, ECO:0000269|PubMed:9488043}.		brain development (GO:0007420)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|DNA damage induced protein phosphorylation (GO:0006975)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|heart development (GO:0007507)|histone mRNA catabolic process (GO:0071044)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|lipoprotein catabolic process (GO:0042159)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of B cell proliferation (GO:0030889)|neuron apoptotic process (GO:0051402)|oocyte development (GO:0048599)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|positive regulation of neuron apoptotic process (GO:0043525)|pre-B cell allelic exclusion (GO:0002331)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reciprocal meiotic recombination (GO:0007131)|replicative senescence (GO:0090399)|response to hypoxia (GO:0001666)|response to ionizing radiation (GO:0010212)|signal transduction (GO:0007165)|signal transduction involved in mitotic G2 DNA damage checkpoint (GO:0072434)|somitogenesis (GO:0001756)|telomere maintenance (GO:0000723)	cytoplasmic vesicle (GO:0031410)|nucleoplasm (GO:0005654)|spindle (GO:0005819)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|histone serine kinase activity (GO:0035174)|protein complex binding (GO:0032403)|protein dimerization activity (GO:0046983)|protein N-terminus binding (GO:0047485)|protein serine/threonine kinase activity (GO:0004674)	p.L2890V(3)		NS(4)|breast(23)|central_nervous_system(11)|endometrium(10)|haematopoietic_and_lymphoid_tissue(227)|kidney(19)|large_intestine(53)|liver(5)|lung(62)|ovary(6)|pancreas(4)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	448		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)	Caffeine(DB00201)	ACATATAGATCTAGGTAAGTA	0.313			"""D, Mis, N, F, S"""		T-PLL	"""leukemia, lymphoma, medulloblastoma, glioma"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Ataxia Telangiectasia	TSP Lung(14;0.12)																													yes	Rec	yes	Ataxia-telangiectasia	11	11q22.3	472	ataxia telangiectasia mutated		"""L, O"""	3	Substitution - Missense(3)	haematopoietic_and_lymphoid_tissue(3)											78.0	83.0	81.0					11																	108218089		2201	4297	6498	SO:0001583	missense	0	Familial Cancer Database	AT, Louis-Bar syndrome	AB209133	CCDS31669.1	11q22-q23	2014-09-17	2014-06-17		ENSG00000149311	ENSG00000149311			795	protein-coding gene	gene with protein product	"""TEL1, telomere maintenance 1, homolog (S. cerevisiae)"""	607585	"""ataxia telangiectasia mutated (includes complementation groups A, C and D)"", ""ataxia telangiectasia mutated"""	ATA, ATDC, ATC, ATD			Standard	XM_005271561		Approved	TEL1, TELO1	uc001pkb.1	Q13315	OTTHUMG00000166480	ENST00000452508.2:c.8668C>G	11.37:g.108218089C>G	ENSP00000388058:p.Leu2890Val		B2RNX5|O15429|Q12758|Q16551|Q93007|Q9NP02|Q9UCX7	Missense_Mutation	SNP	pfam_PIK-rel_kinase_FAT,pfam_PI3/4_kinase_cat_dom,pfam_TAN,pfam_FATC,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_PI3/4_kinase_cat_dom,pfscan_PIK_FAT,pfscan_FATC,pfscan_PI3/4_kinase_cat_dom	p.L2890V	ENST00000452508.2	37	c.8668	CCDS31669.1	11	.	.	.	.	.	.	.	.	.	.	C	12.98	2.101439	0.37048	.	.	ENSG00000149311	ENST00000278616;ENST00000452508	D;D	0.81821	-1.54;-1.54	5.52	0.459	0.16678	Protein kinase-like domain (1);Armadillo-type fold (1);Phosphatidylinositol 3-/4-kinase, catalytic (4);	0.000000	0.64402	D	0.000003	D	0.90403	0.6996	M	0.93150	3.385	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.89053	0.3457	10	0.72032	D	0.01	.	10.2885	0.43581	0.0:0.4202:0.0:0.5798	.	2890	Q13315	ATM_HUMAN	V	2890	ENSP00000278616:L2890V;ENSP00000388058:L2890V	ENSP00000278616:L2890V	L	+	1	2	ATM	107723299	0.985000	0.35326	0.962000	0.40283	0.305000	0.27757	0.232000	0.17891	-0.178000	0.10672	-1.327000	0.01280	CTA	ATM	-	pfam_PI3/4_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	ENSG00000149311		0.313	ATM-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ATM	HGNC	protein_coding	OTTHUMT00000389938.1		0.00	26	0	C	NM_000051		108218089	+1			no_errors	ENST00000278616	ensembl	human	known	74_37	missense	6.06	31	2	SNP	0.996	G
ATP11A	23250	genome.wustl.edu	37	13	113485792	113485792	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr13:113485792G>T	ENST00000487903.1	+	13	1413	c.1325G>T	c.(1324-1326)tGc>tTc	p.C442F	ATP11A_ENST00000375645.3_Missense_Mutation_p.C442F|ATP11A_ENST00000283558.8_Missense_Mutation_p.C442F|ATP11A_ENST00000375630.2_Missense_Mutation_p.C442F			P98196	AT11A_HUMAN	ATPase, class VI, type 11A	442					phospholipid translocation (GO:0045332)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(1)|central_nervous_system(3)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(12)|lung(17)|ovary(4)|skin(1)|stomach(1)|urinary_tract(1)	51	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_lung(25;0.134)|all_epithelial(44;0.141)				CACGTCATCTGCAACGGGCAG	0.587																																																	0													160.0	112.0	128.0					13																	113485792		2203	4300	6503	SO:0001583	missense	0			AB028944	CCDS32011.1	13q34	2010-04-20	2007-09-19		ENSG00000068650	ENSG00000068650	3.6.3.1	"""ATPases / P-type"""	13552	protein-coding gene	gene with protein product	"""potential phospholipid-transporting ATPase IH"", ""phospholipid-translocating ATPase"""	605868	"""ATPase, Class VI, type 11A"""			11015572	Standard	NM_032189		Approved	ATPIH, ATPIS, KIAA1021	uc001vsj.4	P98196	OTTHUMG00000017371	ENST00000487903.1:c.1325G>T	13.37:g.113485792G>T	ENSP00000420387:p.Cys442Phe		Q5VXT2	Missense_Mutation	SNP	pfam_ATPase_P-typ_transduc_dom_A,superfamily_HAD-like_dom,superfamily_ATPase_P-typ_cyto_domN,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Plipid-transp,tigrfam_Cation_transp_P_typ_ATPase	p.C442F	ENST00000487903.1	37	c.1325	CCDS32011.1	13	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.54|16.54	3.152242|3.152242	0.57259|0.57259	.|.	.|.	ENSG00000068650|ENSG00000068650	ENST00000418678|ENST00000487903;ENST00000375630;ENST00000375645;ENST00000283558	.|D;D;D;D	.|0.81821	.|-1.54;-1.54;-1.54;-1.54	5.45|5.45	5.45|5.45	0.79879|0.79879	.|ATPase, cation-transporting, domain N (1);HAD-like domain (1);ATPase, P-type, cytoplasmic domain N (1);	.|0.043406	.|0.85682	.|D	.|0.000000	D|D	0.83764|0.83764	0.5325|0.5325	L|L	0.33485|0.33485	1.01|1.01	0.80722|0.80722	D|D	1|1	.|D;P;B	.|0.61697	.|0.99;0.467;0.001	.|P;B;B	.|0.59546	.|0.859;0.246;0.003	D|D	0.84838|0.84838	0.0806|0.0806	5|10	.|0.56958	.|D	.|0.05	.|.	19.2891|19.2891	0.94092|0.94092	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|442;442;442	.|E9PCW5;E9PEJ6;P98196	.|.;.;AT11A_HUMAN	S|F	417|442	.|ENSP00000420387:C442F;ENSP00000364781:C442F;ENSP00000364796:C442F;ENSP00000283558:C442F	.|ENSP00000283558:C442F	A|C	+|+	1|2	0|0	ATP11A|ATP11A	112533793|112533793	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.755000|0.755000	0.42902|0.42902	7.118000|7.118000	0.77137|0.77137	2.570000|2.570000	0.86706|0.86706	0.561000|0.561000	0.74099|0.74099	GCA|TGC	ATP11A	-	superfamily_HAD-like_dom,superfamily_ATPase_P-typ_cyto_domN,tigrfam_ATPase_P-typ_Plipid-transp	ENSG00000068650		0.587	ATP11A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ATP11A	HGNC	protein_coding	OTTHUMT00000045834.3		0.00	88	0	G	NM_015205		113485792	+1			no_errors	ENST00000375630	ensembl	human	known	74_37	missense	5.80	65	4	SNP	1.000	T
ATP8B3	148229	genome.wustl.edu	37	19	1785540	1785540	+	Silent	SNP	G	G	A			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr19:1785540G>A	ENST00000310127.6	-	26	3559	c.3321C>T	c.(3319-3321)ccC>ccT	p.P1107P	ATP8B3_ENST00000525591.1_Silent_p.P1070P|ATP8B3_ENST00000539485.1_Silent_p.P1117P	NM_138813.3	NP_620168.1	O60423	AT8B3_HUMAN	ATPase, aminophospholipid transporter, class I, type 8B, member 3	1107					binding of sperm to zona pellucida (GO:0007339)	acrosomal vesicle (GO:0001669)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(9)|ovary(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	23		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TGAAGCTGGCGGGTCCCGCCG	0.622																																																	0													32.0	40.0	38.0					19																	1785540		2060	4184	6244	SO:0001819	synonymous_variant	0			AA827939	CCDS45901.1, CCDS54196.1	19p13.3	2010-04-28	2010-04-28		ENSG00000130270	ENSG00000130270		"""ATPases / P-type"""	13535	protein-coding gene	gene with protein product	"""aminophospholipid translocase ATP8B3"", ""potential phospholipid-transporting ATPase IK"""	605866	"""ATPase, Class I, type 8B, member 3"", ""ATPase, class I, type 8B, member 3"""			11015572	Standard	NM_138813		Approved	ATPIK	uc002ltw.4	O60423	OTTHUMG00000166189	ENST00000310127.6:c.3321C>T	19.37:g.1785540G>A			Q7Z485|Q8IVB8|Q8N4Y8|Q96M22	Silent	SNP	pfam_ATPase_P-typ_transduc_dom_A,pfam_HAD-like_dom,superfamily_HAD-like_dom,superfamily_ATPase_P-typ_cyto_domN,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Plipid-transp,tigrfam_Cation_transp_P_typ_ATPase	p.P1117	ENST00000310127.6	37	c.3351	CCDS45901.1	19																																																																																			ATP8B3	-	NULL	ENSG00000130270		0.622	ATP8B3-002	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	ATP8B3	HGNC	protein_coding	OTTHUMT00000388279.1	-	0.00	82	0	G	NM_138813		1785540	-1	tier1	-	no_errors	ENST00000539485	ensembl	human	known	74_37	silent	38.57	43	27	SNP	0.000	A
AWAT1	158833	genome.wustl.edu	37	X	69455666	69455666	+	Silent	SNP	A	A	G			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chrX:69455666A>G	ENST00000374521.3	+	2	218	c.177A>G	c.(175-177)ccA>ccG	p.P59P	AWAT1_ENST00000480702.1_3'UTR	NM_001013579.2	NP_001013597.1	Q58HT5	AWAT1_HUMAN	acyl-CoA wax alcohol acyltransferase 1	59					lipid metabolic process (GO:0006629)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	long-chain-alcohol O-fatty-acyltransferase activity (GO:0047196)			breast(2)|central_nervous_system(1)|large_intestine(4)|lung(3)|ovary(4)|skin(1)	15						GGAAGACCCCAGAGCGAGGTA	0.512																																																	0													195.0	153.0	168.0					X																	69455666		2203	4300	6503	SO:0001819	synonymous_variant	0			BC039181	CCDS35321.1	Xq13.1	2010-01-25	2009-02-23	2009-02-23	ENSG00000204195	ENSG00000204195			23252	protein-coding gene	gene with protein product		300924	"""diacylglycerol O-acyltransferase 2-like 3"""	DGAT2L3		14970677, 15671038	Standard	NM_001013579		Approved		uc004dxy.3	Q58HT5	OTTHUMG00000021773	ENST00000374521.3:c.177A>G	X.37:g.69455666A>G			Q5JT21|Q6IEE4	Silent	SNP	pfam_DAGAT	p.P59	ENST00000374521.3	37	c.177	CCDS35321.1	X																																																																																			AWAT1	-	pfam_DAGAT	ENSG00000204195		0.512	AWAT1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	AWAT1	HGNC	protein_coding	OTTHUMT00000057066.3	-	0.00	92	0	A	NM_001013579		69455666	+1	tier1	-	no_errors	ENST00000374521	ensembl	human	known	74_37	silent	68.25	20	43	SNP	0.608	G
B3GNT1	11041	genome.wustl.edu	37	11	66113575	66113575	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr11:66113575C>T	ENST00000311181.4	-	2	1339	c.1193G>A	c.(1192-1194)cGc>cAc	p.R398H	BRMS1_ENST00000425825.2_5'Flank|BRMS1_ENST00000359957.3_5'Flank|RP11-867G23.8_ENST00000531602.1_5'Flank	NM_006876.2	NP_006867.1	O43505	B3GN1_HUMAN	UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 1	398					axon guidance (GO:0007411)|carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|poly-N-acetyllactosamine biosynthetic process (GO:0030311)|protein glycosylation (GO:0006486)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)	N-acetyllactosaminide beta-1,3-N-acetylglucosaminyltransferase activity (GO:0008532)			breast(2)|kidney(1)|large_intestine(2)|lung(6)|urinary_tract(1)	12						TTTGAACTGGCGATATAGGAT	0.502																																																	0													280.0	253.0	262.0					11																	66113575		2200	4295	6495	SO:0001583	missense	0			AF029893	CCDS8136.1	11q13.2	2014-07-08	2006-04-12	2006-04-12	ENSG00000174684	ENSG00000174684	2.4.1.149	"""Beta 3-glycosyltransferases"""	15685	protein-coding gene	gene with protein product	"""N-acetyllactosaminide beta-1,3-N-acetylglucosaminyltransferase"""	605517	"""UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 6"""	B3GNT6		9405606	Standard	NM_006876		Approved	iGNT, iGAT, iGnT, BETA3GNTI, B3GN-T1	uc001ohr.3	O43505	OTTHUMG00000167082	ENST00000311181.4:c.1193G>A	11.37:g.66113575C>T	ENSP00000309096:p.Arg398His		Q4TTN0	Missense_Mutation	SNP	NULL	p.R398H	ENST00000311181.4	37	c.1193	CCDS8136.1	11	.	.	.	.	.	.	.	.	.	.	C	18.72	3.684878	0.68157	.	.	ENSG00000174684	ENST00000311181;ENST00000538757	T	0.24151	1.87	5.29	5.29	0.74685	.	0.000000	0.85682	D	0.000000	T	0.34164	0.0888	M	0.69823	2.125	0.80722	D	1	D	0.54047	0.964	B	0.43680	0.427	T	0.23833	-1.0177	10	0.51188	T	0.08	-17.1806	16.4446	0.83913	0.0:1.0:0.0:0.0	.	398	O43505	B3GN1_HUMAN	H	398;169	ENSP00000309096:R398H	ENSP00000309096:R398H	R	-	2	0	B3GNT1	65870151	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.335000	0.79234	2.482000	0.83794	0.655000	0.94253	CGC	B3GNT1	-	NULL	ENSG00000174684		0.502	B3GNT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	B3GNT1	HGNC	protein_coding	OTTHUMT00000392959.1		0.00	41	0	C	NM_006876		66113575	-1			no_errors	ENST00000311181	ensembl	human	known	74_37	missense	6.12	46	3	SNP	1.000	T
BDH2	56898	genome.wustl.edu	37	4	104012408	104012408	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr4:104012408C>G	ENST00000296424.4	-	5	403	c.283G>C	c.(283-285)Gag>Cag	p.E95Q		NM_020139.3	NP_064524.3	Q9BUT1	BDH2_HUMAN	3-hydroxybutyrate dehydrogenase, type 2	95				E -> V (in Ref. 4; BAF82849). {ECO:0000305}.	epithelial cell differentiation (GO:0030855)|fatty acid beta-oxidation (GO:0006635)|heme metabolic process (GO:0042168)|iron ion homeostasis (GO:0055072)|siderophore biosynthetic process (GO:0019290)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	3-hydroxybutyrate dehydrogenase activity (GO:0003858)|NAD binding (GO:0051287)|oxidoreductase activity, acting on the CH-CH group of donors, NAD or NADP as acceptor (GO:0016628)			breast(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(4)|urinary_tract(1)	10		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;2.02e-08)		CAGTCTTTCTCCTCACAATCC	0.423																																																	0													122.0	104.0	110.0					4																	104012408		2203	4300	6503	SO:0001583	missense	0			AF164790	CCDS3663.1	4q24	2011-09-14			ENSG00000164039	ENSG00000164039	1.1.1.30	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 1"""	32389	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 15C, member 1"""		"""dehydrogenase/reductase (SDR family) member 6"""	DHRS6		16380372, 19027726	Standard	XM_005263140		Approved	UCPA-OR, FLJ13261, UNQ6308, PRO20933, SDR15C1	uc003hwz.3	Q9BUT1	OTTHUMG00000074039	ENST00000296424.4:c.283G>C	4.37:g.104012408C>G	ENSP00000296424:p.Glu95Gln		A8K295|B4DUF6|Q503A0|Q6IA46|Q6UWD3|Q9H8S8|Q9NRX8	Missense_Mutation	SNP	pfam_DH_sc/Rdtase_SDR,prints_Glc/ribitol_DH,prints_DHB_DH,prints_DH_sc/Rdtase_SDR,prints_ADH_insect	p.E95Q	ENST00000296424.4	37	c.283	CCDS3663.1	4	.	.	.	.	.	.	.	.	.	.	C	29.0	4.964801	0.92791	.	.	ENSG00000164039	ENST00000296424;ENST00000504285;ENST00000509245	T;D;D	0.88277	0.93;-2.36;-2.36	4.8	4.8	0.61643	NAD(P)-binding domain (1);	0.096695	0.64402	D	0.000001	D	0.90417	0.7000	L	0.45228	1.405	0.80722	D	1	D	0.67145	0.996	P	0.55824	0.785	D	0.91665	0.5345	10	0.72032	D	0.01	.	17.0029	0.86385	0.0:1.0:0.0:0.0	.	95	Q9BUT1	BDH2_HUMAN	Q	95	ENSP00000296424:E95Q;ENSP00000427442:E95Q;ENSP00000422891:E95Q	ENSP00000296424:E95Q	E	-	1	0	BDH2	104231857	1.000000	0.71417	0.975000	0.42487	0.983000	0.72400	7.062000	0.76706	2.355000	0.79922	0.591000	0.81541	GAG	BDH2	-	pfam_DH_sc/Rdtase_SDR	ENSG00000164039		0.423	BDH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BDH2	HGNC	protein_coding	OTTHUMT00000157159.2		0.00	71	0	C	NM_020139		104012408	-1			no_errors	ENST00000296424	ensembl	human	known	74_37	missense	7.41	50	4	SNP	1.000	G
BRINP1	1620	genome.wustl.edu	37	9	122001026	122001026	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr9:122001026G>T	ENST00000265922.3	-	5	1053	c.592C>A	c.(592-594)Cgc>Agc	p.R198S	BRINP1_ENST00000373964.2_Missense_Mutation_p.R198S	NM_014618.2	NP_055433.2	O60477	BRNP1_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 1	198	MACPF.				cell cycle arrest (GO:0007050)|cell death (GO:0008219)|cellular response to retinoic acid (GO:0071300)|negative regulation of cell cycle (GO:0045786)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	cytoplasm (GO:0005737)											GGCCCAGTGCGTGTCTCTGTG	0.507																																																	0													104.0	77.0	86.0					9																	122001026		2203	4300	6503	SO:0001583	missense	0			AF027734	CCDS6822.1	9q32-q33	2013-08-06	2013-08-06	2013-07-31	ENSG00000078725	ENSG00000078725			2687	protein-coding gene	gene with protein product		602865	"""deleted in bladder cancer chromosome region candidate 1"", ""deleted in bladder cancer 1"""	DBCCR1, DBC1		9175739, 10444335, 15193422	Standard	NM_014618		Approved	FAM5A	uc004bkc.2	O60477	OTTHUMG00000021020	ENST00000265922.3:c.592C>A	9.37:g.122001026G>T	ENSP00000265922:p.Arg198Ser		Q6IPV6|Q6P1A0|Q8WU22	Missense_Mutation	SNP	pfam_MACPF,smart_MACPF	p.R198S	ENST00000265922.3	37	c.592	CCDS6822.1	9	.	.	.	.	.	.	.	.	.	.	G	22.2	4.260403	0.80246	.	.	ENSG00000078725	ENST00000373969;ENST00000265922;ENST00000373964	T;T	0.54479	2.23;0.57	5.91	5.91	0.95273	Membrane attack complex component/perforin (MACPF) domain (1);	0.000000	0.85682	D	0.000000	T	0.71005	0.3289	M	0.64404	1.975	0.80722	D	1	D;D	0.69078	0.996;0.997	D;D	0.79784	0.988;0.993	T	0.66590	-0.5885	10	0.37606	T	0.19	-21.6133	19.2777	0.94039	0.0:0.0:1.0:0.0	.	198;198	O60477-2;O60477	.;DBC1_HUMAN	S	198	ENSP00000265922:R198S;ENSP00000363075:R198S	ENSP00000265922:R198S	R	-	1	0	DBC1	121040847	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.297000	0.72757	2.794000	0.96219	0.655000	0.94253	CGC	BRINP1	-	smart_MACPF	ENSG00000078725		0.507	BRINP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRINP1	HGNC	protein_coding	OTTHUMT00000055440.2	-	0.00	38	0	G	NM_014618		122001026	-1	tier1	-	no_errors	ENST00000265922	ensembl	human	known	74_37	missense	17.24	24	5	SNP	1.000	T
C11orf84	144097	genome.wustl.edu	37	11	63585506	63585506	+	Silent	SNP	C	C	T			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr11:63585506C>T	ENST00000294244.4	+	2	656	c.357C>T	c.(355-357)gaC>gaT	p.D119D		NM_138471.1	NP_612480.1	Q9BUA3	CK084_HUMAN	chromosome 11 open reading frame 84	119										endometrium(3)|kidney(1)|lung(3)|skin(1)	8						ACACCTTGGACCTGAGCCCTT	0.637																																																	0													77.0	77.0	77.0					11																	63585506		2201	4298	6499	SO:0001819	synonymous_variant	0			BC007540	CCDS31594.1	11q13.1	2014-02-10			ENSG00000168005	ENSG00000168005			25115	protein-coding gene	gene with protein product						12477932	Standard	NM_138471		Approved		uc001nxt.3	Q9BUA3	OTTHUMG00000167746	ENST00000294244.4:c.357C>T	11.37:g.63585506C>T			Q68CV7|Q6PHS2|Q96IH0	Silent	SNP	NULL	p.D119	ENST00000294244.4	37	c.357	CCDS31594.1	11																																																																																			C11orf84	-	NULL	ENSG00000168005		0.637	C11orf84-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C11orf84	HGNC	protein_coding	OTTHUMT00000396084.1	-	0.00	46	0	C	NM_138471		63585506	+1	tier1	-	no_errors	ENST00000294244	ensembl	human	known	74_37	silent	10.81	33	4	SNP	1.000	T
C16orf86	388284	genome.wustl.edu	37	16	67702161	67702161	+	Silent	SNP	G	G	A			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr16:67702161G>A	ENST00000403458.4	+	4	767	c.612G>A	c.(610-612)ctG>ctA	p.L204L	ENKD1_ENST00000243878.4_5'Flank|ENKD1_ENST00000602644.1_5'Flank|ENKD1_ENST00000602409.1_5'Flank	NM_001012984.2	NP_001013002.2	Q6ZW13	CP086_HUMAN	chromosome 16 open reading frame 86	204										endometrium(2)|lung(4)	6		Acute lymphoblastic leukemia(13;3.76e-06)|all_hematologic(13;0.000303)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0143)|Epithelial(162;0.047)|all cancers(182;0.228)		ACCCTGAGCTGAACCAGGCAG	0.657											OREG0023886	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													15.0	17.0	16.0					16																	67702161		2187	4291	6478	SO:0001819	synonymous_variant	0				CCDS32468.2	16q22.1	2008-10-30			ENSG00000159761	ENSG00000159761			33755	protein-coding gene	gene with protein product							Standard	NM_001012984		Approved	FLJ41802	uc002ety.3	Q6ZW13	OTTHUMG00000150527	ENST00000403458.4:c.612G>A	16.37:g.67702161G>A		1101	B5MCW6	Silent	SNP	NULL	p.L204	ENST00000403458.4	37	c.612	CCDS32468.2	16																																																																																			C16orf86	-	NULL	ENSG00000159761		0.657	C16orf86-002	KNOWN	basic|appris_principal|CCDS	protein_coding	C16orf86	HGNC	protein_coding	OTTHUMT00000318767.2	-	0.00	82	0	G	NM_001012984		67702161	+1	tier1	-	no_errors	ENST00000403458	ensembl	human	known	74_37	silent	51.14	43	45	SNP	1.000	A
C17orf47	284083	genome.wustl.edu	37	17	56620413	56620413	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr17:56620413G>T	ENST00000321691.3	-	1	1316	c.1135C>A	c.(1135-1137)Ccc>Acc	p.P379T	SEPT4_ENST00000457347.2_5'Flank|SEPT4_ENST00000412945.3_5'Flank|RP11-112H10.4_ENST00000578022.1_RNA|RP11-112H10.4_ENST00000580769.1_RNA|RP11-112H10.4_ENST00000580589.1_RNA	NM_001038704.2	NP_001033793	Q8NEP4	CQ047_HUMAN	chromosome 17 open reading frame 47	379								p.P379T(1)		NS(1)|breast(2)|endometrium(1)|kidney(4)|large_intestine(4)|lung(9)|prostate(1)|skin(1)|urinary_tract(1)	24	Medulloblastoma(34;0.127)|all_neural(34;0.237)					ATTTCTGGGGGTTTTTGGGTT	0.502																																																	1	Substitution - Missense(1)	lung(1)											146.0	132.0	137.0					17																	56620413		2203	4300	6503	SO:0001583	missense	0				CCDS32691.1	17q23.2	2012-10-11			ENSG00000181013	ENSG00000181013			26844	protein-coding gene	gene with protein product							Standard	NM_001038704		Approved	FLJ40121	uc002iwq.2	Q8NEP4	OTTHUMG00000179244	ENST00000321691.3:c.1135C>A	17.37:g.56620413G>T	ENSP00000354874:p.Pro379Thr		Q8N821	Missense_Mutation	SNP	NULL	p.P379T	ENST00000321691.3	37	c.1135	CCDS32691.1	17	.	.	.	.	.	.	.	.	.	.	G	14.26	2.483389	0.44147	.	.	ENSG00000181013	ENST00000321691	T	0.57107	0.42	5.0	2.95	0.34219	.	0.268702	0.26321	N	0.025049	T	0.34861	0.0912	L	0.27053	0.805	0.09310	N	1	P	0.46912	0.886	B	0.42245	0.381	T	0.11743	-1.0575	10	0.27785	T	0.31	-3.7848	6.0238	0.19644	0.0979:0.0:0.7152:0.1869	.	379	Q8NEP4	CQ047_HUMAN	T	379	ENSP00000354874:P379T	ENSP00000354874:P379T	P	-	1	0	C17orf47	53975412	0.002000	0.14202	0.002000	0.10522	0.030000	0.12068	0.490000	0.22403	0.483000	0.27608	0.561000	0.74099	CCC	C17orf47	-	NULL	ENSG00000181013		0.502	C17orf47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C17orf47	HGNC	protein_coding	OTTHUMT00000445443.1	-	0.00	88	0	G	NM_001038704		56620413	-1	tier1	-	no_errors	ENST00000321691	ensembl	human	known	74_37	missense	34.91	69	37	SNP	0.009	T
C17orf70	80233	genome.wustl.edu	37	17	79517802	79517802	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr17:79517802C>A	ENST00000327787.8	-	3	764	c.718G>T	c.(718-720)Gtg>Ttg	p.V240L	C17orf70_ENST00000425898.2_5'Flank|C17orf70_ENST00000537152.1_Missense_Mutation_p.V89L			Q0VG06	FP100_HUMAN	chromosome 17 open reading frame 70	240					DNA repair (GO:0006281)	cytoplasm (GO:0005737)|Fanconi anaemia nuclear complex (GO:0043240)|intermediate filament cytoskeleton (GO:0045111)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|central_nervous_system(1)|endometrium(1)|lung(11)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	19	all_neural(118;0.0878)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0282)|OV - Ovarian serous cystadenocarcinoma(97;0.0371)			CAGAGGACCACAGGTGACTGC	0.647																																																	0													30.0	31.0	31.0					17																	79517802		2203	4300	6503	SO:0001583	missense	0			BC008883	CCDS32765.1, CCDS32765.2	17q25.3	2012-05-30			ENSG00000185504	ENSG00000185504			26171	protein-coding gene	gene with protein product	"""Fanconi anemia-associated protein, 100kDa"""	611301				17396147	Standard	NM_025161		Approved	FLJ22175, FAAP100	uc002kaq.3	Q0VG06	OTTHUMG00000167764	ENST00000327787.8:c.718G>T	17.37:g.79517802C>A	ENSP00000333283:p.Val240Leu		A6NNM1|Q8N3F7|Q9BV13|Q9H6K7|Q9H7E8	Missense_Mutation	SNP	NULL	p.V240L	ENST00000327787.8	37	c.718	CCDS32765.2	17	.	.	.	.	.	.	.	.	.	.	C	12.10	1.836111	0.32421	.	.	ENSG00000185504	ENST00000327787;ENST00000537152;ENST00000541246;ENST00000544302	T;T	0.42131	0.98;1.01	4.34	1.05	0.20165	.	0.246619	0.31685	N	0.007236	T	0.36138	0.0956	M	0.65498	2.005	0.09310	N	0.999998	P	0.35348	0.496	B	0.34242	0.178	T	0.30001	-0.9993	10	0.62326	D	0.03	.	6.9864	0.24731	0.0:0.5985:0.0:0.4015	.	240	Q0VG06	FP100_HUMAN	L	240;89;89;89	ENSP00000333283:V240L;ENSP00000440151:V89L	ENSP00000333283:V240L	V	-	1	0	C17orf70	77128244	0.017000	0.18338	0.013000	0.15412	0.757000	0.42996	1.376000	0.34306	0.476000	0.27440	-0.251000	0.11542	GTG	C17orf70	-	NULL	ENSG00000185504		0.647	C17orf70-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C17orf70	HGNC	protein_coding	OTTHUMT00000396170.1	-	0.00	64	0	C	NM_025161		79517802	-1	tier1	-	no_errors	ENST00000327787	ensembl	human	known	74_37	missense	6.45	58	4	SNP	0.060	A
C5orf17	439936	genome.wustl.edu	37	5	23980951	23980951	+	IGR	SNP	G	G	A			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr5:23980951G>A	ENST00000507936.1	+	0	477							Q8NAS9	CE017_HUMAN	chromosome 5 open reading frame 17																		TAAGCTGAAGGTGAGTGACAC	0.438																																																	0																																										SO:0001628	intergenic_variant	0			AK092155		5p14.2	2011-11-24			ENSG00000248874	ENSG00000248874			26630	protein-coding gene	gene with protein product							Standard			Approved	FLJ34836		Q8NAS9	OTTHUMG00000161911		5.37:g.23980951G>A			Q2I376	Splice_Site	SNP	-	e4+1	ENST00000507936.1	37	c.486+1		5																																																																																			C5orf17	-	-	ENSG00000248874		0.438	C5orf17-002	KNOWN	basic|appris_principal	protein_coding	C5orf17	HGNC	protein_coding	OTTHUMT00000366366.1	-	0.00	52	0	G	NM_173668		23980951	+1	tier1	-	no_errors	ENST00000512559	ensembl	human	known	74_37	splice_site	44.19	24	19	SNP	0.998	A
CACNA1B	774	genome.wustl.edu	37	9	140852080	140852080	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr9:140852080G>T	ENST00000371372.1	+	10	1419	c.1274G>T	c.(1273-1275)aGa>aTa	p.R425I	CACNA1B_ENST00000371357.1_Missense_Mutation_p.R426I|CACNA1B_ENST00000371355.4_Missense_Mutation_p.R426I|CACNA1B_ENST00000277551.2_Missense_Mutation_p.R425I|CACNA1B_ENST00000277549.5_5'UTR|CACNA1B_ENST00000371363.1_Missense_Mutation_p.R425I	NM_000718.3|NM_001243812.1	NP_000709.1|NP_001230741.1	Q00975	CAC1B_HUMAN	calcium channel, voltage-dependent, N type, alpha 1B subunit	425					calcium ion import (GO:0070509)|locomotory behavior (GO:0007626)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|neurotransmitter secretion (GO:0007269)|regulation of blood pressure (GO:0008217)|regulation of calcium ion transport (GO:0051924)|regulation of heart contraction (GO:0008016)|response to pain (GO:0048265)|synaptic transmission (GO:0007268)|transport (GO:0006810)	dendrite (GO:0030425)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|protein C-terminus binding (GO:0008022)|voltage-gated calcium channel activity (GO:0005245)			NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(17)|lung(31)|ovary(1)|prostate(1)|skin(2)|stomach(2)|urinary_tract(2)	80	all_cancers(76;0.166)			OV - Ovarian serous cystadenocarcinoma(145;1.16e-05)|Epithelial(140;0.000476)	Amlodipine(DB00381)|Gabapentin(DB00996)|Levetiracetam(DB01202)|Spironolactone(DB00421)|Verapamil(DB00661)	AAGAAGAGCAGAAATGACCTG	0.587																																																	0													87.0	107.0	100.0					9																	140852080		2128	4244	6372	SO:0001583	missense	0			AB209467	CCDS59522.1, CCDS59523.1	9q34	2013-01-10	2007-02-16		ENSG00000148408	ENSG00000148408		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1389	protein-coding gene	gene with protein product		601012		CACNL1A5		8825650, 16382099	Standard	NM_000718		Approved	Cav2.2, CACNN	uc004cog.3	Q00975	OTTHUMG00000021002	ENST00000371372.1:c.1274G>T	9.37:g.140852080G>T	ENSP00000360423:p.Arg425Ile		B1AQK5	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,pfscan_EF_hand_dom,prints_VDCCAlpha1,prints_VDCC_N_a1su,prints_PKD_2	p.R426I	ENST00000371372.1	37	c.1277	CCDS59522.1	9	.	.	.	.	.	.	.	.	.	.	g	16.48	3.134698	0.56828	.	.	ENSG00000148408	ENST00000371372;ENST00000277551;ENST00000371363;ENST00000371357;ENST00000371355	D;D;D;D;D	0.93426	-3.22;-3.22;-3.22;-3.18;-3.18	5.17	3.07	0.35406	.	0.063063	0.64402	U	0.000009	D	0.86389	0.5921	L	0.34521	1.04	0.80722	D	1	P	0.41748	0.761	B	0.38562	0.276	D	0.83870	0.0273	10	0.66056	D	0.02	.	4.1486	0.10227	0.5056:0.0:0.4944:0.0	.	425	B1AQK6	.	I	425;425;425;426;426	ENSP00000360423:R425I;ENSP00000277551:R425I;ENSP00000360414:R425I;ENSP00000360408:R426I;ENSP00000360406:R426I	ENSP00000277551:R425I	R	+	2	0	CACNA1B	139971901	0.999000	0.42202	0.743000	0.31040	0.833000	0.47200	3.927000	0.56499	1.199000	0.43173	0.299000	0.19835	AGA	CACNA1B	-	NULL	ENSG00000148408		0.587	CACNA1B-001	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	CACNA1B	HGNC	protein_coding	OTTHUMT00000055380.1		0.00	53	0	G	NM_000718		140852080	+1			no_errors	ENST00000371355	ensembl	human	known	74_37	missense	6.52	43	3	SNP	0.985	T
CARS2	79587	genome.wustl.edu	37	13	111296881	111296881	+	Intron	SNP	T	T	C			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr13:111296881T>C	ENST00000257347.4	-	13	1381				CARS2_ENST00000535398.1_Intron	NM_024537.2	NP_078813.1	Q9HA77	SYCM_HUMAN	cysteinyl-tRNA synthetase 2, mitochondrial (putative)						cysteinyl-tRNA aminoacylation (GO:0006423)|gene expression (GO:0010467)|tRNA aminoacylation for protein translation (GO:0006418)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|cysteine-tRNA ligase activity (GO:0004817)|metal ion binding (GO:0046872)			autonomic_ganglia(1)|breast(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(2)|prostate(4)|skin(1)	13	all_lung(23;3.61e-05)|Lung NSC(43;0.00144)|Lung SC(71;0.0753)|all_neural(89;0.077)|Medulloblastoma(90;0.148)		BRCA - Breast invasive adenocarcinoma(86;0.163)		L-Cysteine(DB00151)	TTGATGGCAGTGGGCAAACGG	0.498																																																	0													40.0	39.0	39.0					13																	111296881		2203	4300	6503	SO:0001627	intron_variant	0			BC007220	CCDS9514.1	13q34	2011-07-01	2007-02-22		ENSG00000134905	ENSG00000134905	6.1.1.16	"""Aminoacyl tRNA synthetases / Class I"""	25695	protein-coding gene	gene with protein product	"""cysteine tRNA ligase 2, mitochondrial (putative)"""	612800				15779907	Standard	NM_024537		Approved	FLJ12118	uc001vrd.2	Q9HA77	OTTHUMG00000017347	ENST00000257347.4:c.1318-51A>G	13.37:g.111296881T>C			Q8NI84|Q96IV4	RNA	SNP	-	NULL	ENST00000257347.4	37	NULL	CCDS9514.1	13																																																																																			CARS2	-	-	ENSG00000134905		0.498	CARS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CARS2	HGNC	protein_coding	OTTHUMT00000045772.3	-	0.00	33	0	T	NM_024537		111296881	-1	tier1	-	no_errors	ENST00000542774	ensembl	human	known	74_37	rna	12.90	27	4	SNP	0.000	C
CASP2	835	genome.wustl.edu	37	7	142989412	142989412	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr7:142989412G>T	ENST00000310447.5	+	3	486	c.245G>T	c.(244-246)aGc>aTc	p.S82I	CASP2_ENST00000392925.2_Missense_Mutation_p.S82I|RN7SL535P_ENST00000479087.2_RNA|CASP2_ENST00000493642.1_3'UTR	NM_032982.3|NM_032983.3	NP_116764.2|NP_116765.2	P42575	CASP2_HUMAN	caspase 2, apoptosis-related cysteine peptidase	82	CARD. {ECO:0000255|PROSITE- ProRule:PRU00046}.				aging (GO:0007568)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|brain development (GO:0007420)|cellular response to mechanical stimulus (GO:0071260)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|ectopic germ cell programmed cell death (GO:0035234)|execution phase of apoptosis (GO:0097194)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|luteolysis (GO:0001554)|neural retina development (GO:0003407)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of neuron apoptotic process (GO:0043525)|protein processing (GO:0016485)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|cysteine-type endopeptidase activity involved in apoptotic process (GO:0097153)|enzyme binding (GO:0019899)|protein domain specific binding (GO:0019904)	p.S82I(1)		endometrium(2)|kidney(2)|large_intestine(5)|lung(11)|ovary(1)	21	Melanoma(164;0.059)					GGCAGTTTCAGCCAGAATGTG	0.453																																																	1	Substitution - Missense(1)	lung(1)											119.0	120.0	120.0					7																	142989412		2203	4300	6503	SO:0001583	missense	0			AK096245, BC002427, BM998653, BX537669, CB988674, U13021	CCDS5879.1, CCDS47733.1	7q34-q35	2014-01-20	2008-08-01		ENSG00000106144	ENSG00000106144		"""Caspases"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1503	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 57"""	600639	"""neural precursor cell expressed, developmentally down-regulated 2"""	NEDD2		7789948, 8780721	Standard	NM_032982		Approved	ICH1, PPP1R57, MGC2181	uc003wco.3	P42575	OTTHUMG00000023641	ENST00000310447.5:c.245G>T	7.37:g.142989412G>T	ENSP00000312664:p.Ser82Ile		A8K5F9|D3DXD6|E9PDN0|P42576|Q59F21|Q7KZL6|Q86UJ3|Q9BUP7|Q9BZK9|Q9BZL0	Missense_Mutation	SNP	pfam_Pept_C14_caspase,pfam_CARD,superfamily_DEATH-like_dom,smart_CARD,smart_Pept_C14A_p45_core,pirsf_Caspase_IL-1_beta,pfscan_CARD,pfscan_Pept_C14_p10,pfscan_Pept_C14_ICE_p20,prints_Pept_C14A_p45_core	p.S82I	ENST00000310447.5	37	c.245	CCDS5879.1	7	.	.	.	.	.	.	.	.	.	.	g	16.85	3.235399	0.58886	.	.	ENSG00000106144	ENST00000310447;ENST00000392925;ENST00000392923	T;T	0.25085	1.82;1.82	5.68	1.88	0.25563	DEATH-like (2);Caspase Recruitment (3);	0.583649	0.23396	N	0.048635	T	0.28995	0.0720	L	0.44542	1.39	0.29950	N	0.820285	P;P	0.37612	0.602;0.537	P;P	0.47206	0.478;0.541	T	0.17501	-1.0367	10	0.54805	T	0.06	.	9.4194	0.38541	0.3512:0.0:0.6488:0.0	.	82;82	E9PDN0;P42575	.;CASP2_HUMAN	I	82;82;51	ENSP00000312664:S82I;ENSP00000376656:S82I	ENSP00000312664:S82I	S	+	2	0	CASP2	142699534	0.994000	0.37717	0.995000	0.50966	0.993000	0.82548	0.699000	0.25586	0.078000	0.16900	-0.145000	0.13849	AGC	CASP2	-	pfam_CARD,superfamily_DEATH-like_dom,smart_CARD,pirsf_Caspase_IL-1_beta,pfscan_CARD	ENSG00000106144		0.453	CASP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CASP2	HGNC	protein_coding	OTTHUMT00000059962.3		0.00	54	0	G	NM_032982		142989412	+1			no_errors	ENST00000310447	ensembl	human	known	74_37	missense	5.26	54	3	SNP	0.998	T
CCDC115	84317	genome.wustl.edu	37	2	131097266	131097266	+	Intron	SNP	G	G	A			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr2:131097266G>A	ENST00000259229.2	-	5	654				IMP4_ENST00000259239.3_5'Flank|CCDC115_ENST00000409127.1_Intron|CCDC115_ENST00000437688.2_Missense_Mutation_p.A162V	NM_032357.2	NP_115733.2	Q96NT0	CC115_HUMAN	coiled-coil domain containing 115							endosome (GO:0005768)|lysosome (GO:0005764)|membrane (GO:0016020)				central_nervous_system(1)|large_intestine(2)|lung(3)|prostate(1)	7	Colorectal(110;0.1)					ctcctgttcagcagcagggct	0.572																																																	0																																										SO:0001627	intron_variant	0			AK054693	CCDS2159.1	2q21.1	2010-12-24			ENSG00000136710	ENSG00000136710			28178	protein-coding gene	gene with protein product		613734				21118521	Standard	XM_005263825		Approved	MGC12981, FLJ30131, ccp1	uc002tqy.1	Q96NT0	OTTHUMG00000131631	ENST00000259229.2:c.431-461C>T	2.37:g.131097266G>A			B4DJ47|Q9BR88	Missense_Mutation	SNP	NULL	p.A167V	ENST00000259229.2	37	c.500	CCDS2159.1	2	.	.	.	.	.	.	.	.	.	.	G	11.74	1.727308	0.30593	.	.	ENSG00000136710	ENST00000437688	T	0.22539	1.95	2.71	-0.295	0.12828	.	.	.	.	.	T	0.13457	0.0326	.	.	.	0.09310	N	1	B;B	0.13145	0.007;0.002	B;B	0.16289	0.015;0.005	T	0.30995	-0.9959	8	0.87932	D	0	-20.897	3.0113	0.06045	0.2927:0.2365:0.4708:0.0	.	162;167	B4DJ47;F8WCZ3	.;.	V	162	ENSP00000399756:A162V	ENSP00000399756:A162V	A	-	2	0	CCDC115	130813736	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	0.240000	0.18042	-0.078000	0.12730	0.407000	0.27541	GCT	CCDC115	-	NULL	ENSG00000136710		0.572	CCDC115-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC115	HGNC	protein_coding	OTTHUMT00000254524.2	-	0.00	32	0	G	NM_032357		131097266	-1	tier1	-	no_errors	ENST00000442217	ensembl	human	known	74_37	missense	58.82	7	10	SNP	0.000	A
CCDC88C	440193	genome.wustl.edu	37	14	91744555	91744555	+	Splice_Site	SNP	C	C	T			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr14:91744555C>T	ENST00000389857.6	-	29	4855	c.4769G>A	c.(4768-4770)gGc>gAc	p.G1590D	CCDC88C_ENST00000331194.7_Splice_Site_p.G114D	NM_001080414.3	NP_001073883.2	Q9P219	DAPLE_HUMAN	coiled-coil domain containing 88C	1590					protein destabilization (GO:0031648)|protein homooligomerization (GO:0051260)|regulation of protein phosphorylation (GO:0001932)|Wnt signaling pathway (GO:0016055)		PDZ domain binding (GO:0030165)|protein self-association (GO:0043621)			central_nervous_system(3)|endometrium(2)|kidney(3)|large_intestine(2)|lung(6)|ovary(6)|pancreas(1)|urinary_tract(1)	24		all_cancers(154;0.0468)				CTCGGAGGAGCCTGGGTGTCA	0.617																																																	0													16.0	19.0	18.0					14																	91744555		2021	4184	6205	SO:0001630	splice_region_variant	0				CCDS45151.1	14q32.12	2014-07-30	2007-05-31	2007-05-31		ENSG00000015133			19967	protein-coding gene	gene with protein product	"""Dvl-associating protein with a high frequency of leucine residues"", ""spinocerebellar ataxia 40"""	611204	"""KIAA1509"""	KIAA1509		17185515, 25062847	Standard	NM_001080414		Approved	DAPLE, HkRP2, SCA40	uc010aty.3	Q9P219		ENST00000389857.6:c.4769-1G>A	14.37:g.91744555C>T			Q69YK1|Q7L1M2|Q86SX7|Q8IYG8	Missense_Mutation	SNP	pfam_Hook-related_fam,superfamily_Prefoldin,superfamily_Fum_Rdtase/Succ_DH_flav-like_C	p.G1590D	ENST00000389857.6	37	c.4769	CCDS45151.1	14	.	.	.	.	.	.	.	.	.	.	C	18.44	3.624777	0.66901	.	.	ENSG00000015133	ENST00000389857;ENST00000427583;ENST00000331194	T;T	0.52983	2.37;0.64	5.43	5.43	0.79202	.	0.136994	0.32578	U	0.005912	T	0.69024	0.3065	M	0.72894	2.215	0.58432	D	0.999999	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	T	0.72050	-0.4407	10	0.87932	D	0	.	17.4233	0.87520	0.0:1.0:0.0:0.0	.	1590;114;40	Q9P219;Q9P219-2;Q9P219-3	DAPLE_HUMAN;.;.	D	1590;114;114	ENSP00000374507:G1590D;ENSP00000330332:G114D	ENSP00000330332:G114D	G	-	2	0	CCDC88C	90814308	1.000000	0.71417	1.000000	0.80357	0.235000	0.25334	2.793000	0.47845	2.546000	0.85860	0.455000	0.32223	GGC	CCDC88C	-	NULL	ENSG00000015133		0.617	CCDC88C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC88C	HGNC	protein_coding	OTTHUMT00000411650.1		0.00	63	0	C	XM_029353	Missense_Mutation	91744555	-1			no_errors	ENST00000389857	ensembl	human	known	74_37	missense	7.02	53	4	SNP	1.000	T
CCDC89	220388	genome.wustl.edu	37	11	85396245	85396245	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr11:85396245G>A	ENST00000316398.3	-	1	1075	c.929C>T	c.(928-930)gCg>gTg	p.A310V	CREBZF_ENST00000531515.1_5'Flank|CREBZF_ENST00000534224.1_5'Flank	NM_152723.1	NP_689936.1	Q8N998	CCD89_HUMAN	coiled-coil domain containing 89	310						cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(6)|skin(1)	15		Acute lymphoblastic leukemia(157;4.88e-06)|all_hematologic(158;0.00572)				CCGCTCCAGCGCATGCTTCCT	0.512																																																	0													150.0	118.0	129.0					11																	85396245		2203	4299	6502	SO:0001583	missense	0			AK095478	CCDS8270.1	11q14.1	2006-03-16			ENSG00000179071	ENSG00000179071			26762	protein-coding gene	gene with protein product						12477932	Standard	NM_152723		Approved	FLJ38159	uc001pau.1	Q8N998	OTTHUMG00000166976	ENST00000316398.3:c.929C>T	11.37:g.85396245G>A	ENSP00000320649:p.Ala310Val			Missense_Mutation	SNP	NULL	p.A310V	ENST00000316398.3	37	c.929	CCDS8270.1	11	.	.	.	.	.	.	.	.	.	.	G	14.47	2.546463	0.45383	.	.	ENSG00000179071	ENST00000316398	.	.	.	6.06	6.06	0.98353	.	0.000000	0.85682	D	0.000000	D	0.83179	0.5198	M	0.78049	2.395	0.50813	D	0.999893	D	0.89917	1.0	D	0.77004	0.989	T	0.81538	-0.0887	8	.	.	.	-8.9324	20.6208	0.99490	0.0:0.0:1.0:0.0	.	310	Q8N998	CCD89_HUMAN	V	310	.	.	A	-	2	0	CCDC89	85073893	0.998000	0.40836	0.082000	0.20525	0.119000	0.20118	4.015000	0.57152	2.882000	0.98803	0.655000	0.94253	GCG	CCDC89	-	NULL	ENSG00000179071		0.512	CCDC89-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC89	HGNC	protein_coding	OTTHUMT00000392182.1		0.00	27	0	G	NM_152723		85396245	-1			no_errors	ENST00000316398	ensembl	human	known	74_37	missense	6.25	30	2	SNP	0.883	A
CD163L1	283316	genome.wustl.edu	37	12	7527487	7527487	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr12:7527487C>T	ENST00000313599.3	-	12	3091	c.3034G>A	c.(3034-3036)Gca>Aca	p.A1012T	CD163L1_ENST00000544331.1_5'Flank|CD163L1_ENST00000416109.2_Missense_Mutation_p.A1022T|CD163L1_ENST00000396630.1_Missense_Mutation_p.A1012T			Q9NR16	C163B_HUMAN	CD163 molecule-like 1	1012						extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	scavenger receptor activity (GO:0005044)			breast(5)|central_nervous_system(3)|endometrium(8)|kidney(3)|large_intestine(18)|lung(37)|ovary(8)|prostate(3)|skin(6)|stomach(1)|urinary_tract(4)	96						GATACATTTGCGAGGCATGGA	0.463											OREG0021653	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													79.0	74.0	76.0					12																	7527487		2203	4300	6503	SO:0001583	missense	0			AF264014	CCDS8577.1, CCDS73434.1	12p13.31	2006-03-28	2006-03-28			ENSG00000177675			30375	protein-coding gene	gene with protein product		606079	"""CD163 antigen-like 1"""			11124526, 11086079	Standard	XM_005253348		Approved	M160, CD163B	uc001qsy.3	Q9NR16		ENST00000313599.3:c.3034G>A	12.37:g.7527487C>T	ENSP00000315945:p.Ala1012Thr	642	B4E0G7|C9JHR7|E7EVK4|Q2M3B7|Q6UWC2	Missense_Mutation	SNP	pfam_SRCR,superfamily_Srcr_rcpt-rel,smart_Srcr_rcpt-rel,pfscan_SRCR,prints_SRCR	p.A1012T	ENST00000313599.3	37	c.3034	CCDS8577.1	12	.	.	.	.	.	.	.	.	.	.	C	8.329	0.826051	0.16749	.	.	ENSG00000177675	ENST00000313599;ENST00000416109;ENST00000396630	T;T;T	0.01422	4.95;4.93;4.91	3.4	-5.36	0.02689	.	2.401570	0.02486	U	0.089018	T	0.00754	0.0025	N	0.22421	0.69	0.09310	N	1	P;P	0.47484	0.896;0.881	B;B	0.30316	0.114;0.099	T	0.51919	-0.8644	10	0.23302	T	0.38	.	0.8342	0.01137	0.4525:0.1895:0.1399:0.2181	.	1022;1012	E7EVK4;Q9NR16	.;C163B_HUMAN	T	1012;1022;1012	ENSP00000315945:A1012T;ENSP00000393474:A1022T;ENSP00000379871:A1012T	ENSP00000315945:A1012T	A	-	1	0	CD163L1	7418754	0.000000	0.05858	0.000000	0.03702	0.021000	0.10359	-1.779000	0.01777	-1.030000	0.03312	0.456000	0.33151	GCA	CD163L1	-	NULL	ENSG00000177675		0.463	CD163L1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CD163L1	HGNC	protein_coding	OTTHUMT00000399329.1	-	0.00	74	0	C	NM_174941		7527487	-1	tier1	-	no_errors	ENST00000313599	ensembl	human	known	74_37	missense	6.25	60	4	SNP	0.000	T
CDH12	1010	genome.wustl.edu	37	5	21802277	21802277	+	Splice_Site	SNP	T	T	C			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr5:21802277T>C	ENST00000382254.1	-	10	2341	c.1255A>G	c.(1255-1257)Agg>Ggg	p.R419G	CDH12_ENST00000521384.1_5'UTR|CDH12_ENST00000504376.2_Splice_Site_p.R419G|CDH12_ENST00000522262.1_Splice_Site_p.R379G	NM_004061.3	NP_004052.2	P55289	CAD12_HUMAN	cadherin 12, type 2 (N-cadherin 2)	419	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(2)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(19)|lung(75)|ovary(2)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	120						TTTTCTCACCTAACAGCACTG	0.428										HNSCC(59;0.17)																																							0													66.0	54.0	58.0					5																	21802277		2203	4300	6503	SO:0001630	splice_region_variant	0			L33477	CCDS3890.1	5p14.3	2010-01-26			ENSG00000154162	ENSG00000154162		"""Cadherins / Major cadherins"""	1751	protein-coding gene	gene with protein product		600562				7731968	Standard	NM_004061		Approved	Br-cadherin, CDHB	uc003jgk.2	P55289	OTTHUMG00000090591	ENST00000382254.1:c.1256+1A>G	5.37:g.21802277T>C			B2RBT1|B7Z2U6|Q86UD2	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.R419G	ENST00000382254.1	37	c.1255	CCDS3890.1	5	.	.	.	.	.	.	.	.	.	.	T	17.57	3.421472	0.62622	.	.	ENSG00000154162	ENST00000504376;ENST00000382254;ENST00000522262	T;T;T	0.54279	0.58;0.58;0.58	5.84	1.9	0.25705	Cadherin (4);Cadherin-like (1);	0.093441	0.64402	D	0.000001	T	0.61527	0.2354	M	0.79475	2.455	0.48571	D	0.999673	P;P	0.47484	0.755;0.896	P;P	0.48952	0.593;0.596	T	0.68965	-0.5270	10	0.72032	D	0.01	.	14.0948	0.65013	0.0:0.0:0.5019:0.4981	.	379;419	B7Z2U6;P55289	.;CAD12_HUMAN	G	419;419;379	ENSP00000423577:R419G;ENSP00000371689:R419G;ENSP00000428786:R379G	ENSP00000371689:R419G	R	-	1	2	CDH12	21838034	1.000000	0.71417	0.943000	0.38184	0.820000	0.46376	3.094000	0.50227	0.457000	0.26962	-0.264000	0.10439	AGG	CDH12	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000154162		0.428	CDH12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH12	HGNC	protein_coding	OTTHUMT00000207139.1	-	0.00	41	0	T	NM_004061	Missense_Mutation	21802277	-1	tier1	-	no_errors	ENST00000382254	ensembl	human	known	74_37	missense	38.00	31	19	SNP	0.997	C
CENPT	80152	genome.wustl.edu	37	16	67863987	67863987	+	Silent	SNP	A	A	G			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr16:67863987A>G	ENST00000562787.1	-	12	1415	c.867T>C	c.(865-867)ccT>ccC	p.P289P	CENPT_ENST00000440851.2_Silent_p.P289P|CENPT_ENST00000562947.1_5'Flank|CENPT_ENST00000219172.3_Silent_p.P289P|CENPT_ENST00000564817.1_Silent_p.P289P	NM_025082.3	NP_079358.3	Q96BT3	CENPT_HUMAN	centromere protein T	289	Flexible stalk domain. {ECO:0000250}.				chromosome organization (GO:0051276)|chromosome segregation (GO:0007059)|kinetochore assembly (GO:0051382)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	chromosome, centromeric region (GO:0000775)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|breast(2)|lung(6)|urinary_tract(1)	10		Acute lymphoblastic leukemia(13;0.000299)|all_hematologic(13;0.0184)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.00429)|Epithelial(162;0.019)|all cancers(182;0.124)		CTGGTTTCCCAGGGCCTGAGT	0.582																																																	0													41.0	42.0	42.0					16																	67863987		2024	4199	6223	SO:0001819	synonymous_variant	0			AK056097	CCDS42182.1	16q22.1	2013-11-05	2006-06-15	2006-06-15		ENSG00000102901			25787	protein-coding gene	gene with protein product		611510	"""chromosome 16 open reading frame 56"""	C16orf56		16622420, 16622419	Standard	NM_025082		Approved	FLJ13111, CENP-T	uc002eun.4	Q96BT3		ENST00000562787.1:c.867T>C	16.37:g.67863987A>G			Q96I29|Q96IC6|Q96NK9|Q9H901	Silent	SNP	superfamily_Histone-fold	p.P289	ENST00000562787.1	37	c.867	CCDS42182.1	16																																																																																			CENPT	-	NULL	ENSG00000102901		0.582	CENPT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CENPT	HGNC	protein_coding	OTTHUMT00000422020.1		0.00	71	0	A	NM_025082		67863987	-1			no_errors	ENST00000219172	ensembl	human	known	74_37	silent	5.56	51	3	SNP	0.015	G
CEP135	9662	genome.wustl.edu	37	4	56885624	56885624	+	Missense_Mutation	SNP	A	A	T			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr4:56885624A>T	ENST00000257287.4	+	23	3242	c.3118A>T	c.(3118-3120)Aac>Tac	p.N1040Y		NM_025009.4	NP_079285.2	Q66GS9	CP135_HUMAN	centrosomal protein 135kDa	1040					centriole replication (GO:0007099)|centriole-centriole cohesion (GO:0010457)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	centriole (GO:0005814)|centrosome (GO:0005813)|cytosol (GO:0005829)	protein C-terminus binding (GO:0008022)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(9)|lung(26)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	50	Glioma(25;0.08)|all_neural(26;0.101)					GTTGGCTACAAACAGAGATAA	0.358																																																	0													82.0	78.0	79.0					4																	56885624		2203	4300	6503	SO:0001583	missense	0			AB014535	CCDS33986.1	4q12	2014-02-20	2005-12-02	2005-12-02	ENSG00000174799	ENSG00000174799			29086	protein-coding gene	gene with protein product		611423	"""KIAA0635"", ""centrosomal protein 4"""	KIAA0635, CEP4		9734811, 14654843	Standard	NM_025009		Approved	FLJ13621	uc003hbi.4	Q66GS9	OTTHUMG00000160748	ENST00000257287.4:c.3118A>T	4.37:g.56885624A>T	ENSP00000257287:p.Asn1040Tyr		B2RMY0|O75130|Q58F25|Q9H8H7	Missense_Mutation	SNP	superfamily_Prefoldin,superfamily_EB1_C	p.N1040Y	ENST00000257287.4	37	c.3118	CCDS33986.1	4	.	.	.	.	.	.	.	.	.	.	A	24.1	4.498266	0.85069	.	.	ENSG00000174799	ENST00000257287	T	0.14022	2.54	4.96	4.96	0.65561	.	0.100500	0.64402	D	0.000004	T	0.31734	0.0806	M	0.68952	2.095	0.49389	D	0.999781	D	0.56035	0.974	P	0.59056	0.851	T	0.03619	-1.1019	10	0.59425	D	0.04	.	14.9832	0.71327	1.0:0.0:0.0:0.0	.	1040	Q66GS9	CP135_HUMAN	Y	1040	ENSP00000257287:N1040Y	ENSP00000257287:N1040Y	N	+	1	0	CEP135	56580381	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.135000	0.89608	2.007000	0.58848	0.529000	0.55759	AAC	CEP135	-	NULL	ENSG00000174799		0.358	CEP135-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEP135	HGNC	protein_coding	OTTHUMT00000362092.2	-	0.00	77	0	A	NM_025009		56885624	+1	tier1	-	no_errors	ENST00000257287	ensembl	human	known	74_37	missense	5.97	63	4	SNP	1.000	T
CHAT	1103	genome.wustl.edu	37	10	50828613	50828613	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr10:50828613G>T	ENST00000337653.2	+	4	805	c.652G>T	c.(652-654)Gtg>Ttg	p.V218L	CHAT_ENST00000339797.1_Missense_Mutation_p.V100L|CHAT_ENST00000395562.2_Missense_Mutation_p.V136L|CHAT_ENST00000395559.2_Missense_Mutation_p.V100L|CHAT_ENST00000460699.1_3'UTR|CHAT_ENST00000351556.3_Missense_Mutation_p.V100L|CHAT_ENST00000455728.2_Missense_Mutation_p.V100L	NM_001142929.1|NM_020549.4	NP_001136401.1|NP_065574	P28329	CLAT_HUMAN	choline O-acetyltransferase	218					adult walking behavior (GO:0007628)|dendrite development (GO:0016358)|establishment of synaptic specificity at neuromuscular junction (GO:0007529)|glycerophospholipid biosynthetic process (GO:0046474)|muscle organ development (GO:0007517)|neuromuscular synaptic transmission (GO:0007274)|neurotransmitter biosynthetic process (GO:0042136)|neurotransmitter secretion (GO:0007269)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|rhythmic behavior (GO:0007622)|rhythmic excitation (GO:0043179)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)	choline O-acetyltransferase activity (GO:0004102)			central_nervous_system(3)|endometrium(2)|kidney(2)|large_intestine(11)|lung(34)|prostate(3)|urinary_tract(1)	56		all_neural(218;0.107)		GBM - Glioblastoma multiforme(2;0.000585)	Choline(DB00122)|Nicotine(DB00184)	CAGCCCTGCCGTGATCTTTGC	0.622																																																	0													120.0	94.0	103.0					10																	50828613		2203	4300	6503	SO:0001583	missense	0			AF305907	CCDS7232.1, CCDS7233.1, CCDS44389.1	10q11.2	2010-05-11	2010-05-11		ENSG00000070748	ENSG00000070748	2.3.1.6		1912	protein-coding gene	gene with protein product		118490	"""choline acetyltransferase"""			1840566	Standard	NM_020984		Approved		uc001jhz.2	P28329	OTTHUMG00000018198	ENST00000337653.2:c.652G>T	10.37:g.50828613G>T	ENSP00000337103:p.Val218Leu		A2BDF4|A2BDF5|Q16488|Q9BQ23|Q9BQ35|Q9BQE1	Missense_Mutation	SNP	pfam_Carn_acyl_trans	p.V218L	ENST00000337653.2	37	c.652	CCDS7232.1	10	.	.	.	.	.	.	.	.	.	.	G	13.68	2.309041	0.40895	.	.	ENSG00000070748	ENST00000339797;ENST00000351556;ENST00000395559;ENST00000337653;ENST00000395562;ENST00000455728	T;T;T;T;T;T	0.79141	-1.24;-1.24;-1.24;-1.24;-1.24;-1.24	5.57	3.65	0.41850	.	0.166295	0.53938	N	0.000045	T	0.63010	0.2475	L	0.31420	0.93	0.35660	D	0.812443	B;B	0.13594	0.004;0.008	B;B	0.20384	0.006;0.029	T	0.61058	-0.7139	10	0.56958	D	0.05	-17.2718	4.0967	0.09995	0.1029:0.1409:0.5768:0.1795	.	100;218	F8W8I2;P28329	.;CLAT_HUMAN	L	100;100;100;218;136;100	ENSP00000343486:V100L;ENSP00000345878:V100L;ENSP00000378926:V100L;ENSP00000337103:V218L;ENSP00000378929:V136L;ENSP00000390521:V100L	ENSP00000337103:V218L	V	+	1	0	CHAT	50498619	0.999000	0.42202	0.963000	0.40424	0.806000	0.45545	3.462000	0.53042	0.640000	0.30582	0.561000	0.74099	GTG	CHAT	-	pfam_Carn_acyl_trans	ENSG00000070748		0.622	CHAT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CHAT	HGNC	protein_coding	OTTHUMT00000047997.1	-	0.00	62	0	G	NM_020549		50828613	+1	tier1	-	no_errors	ENST00000337653	ensembl	human	known	74_37	missense	7.41	50	4	SNP	0.894	T
CIRH1A	84916	genome.wustl.edu	37	16	69191113	69191113	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr16:69191113A>G	ENST00000314423.7	+	12	1591	c.1414A>G	c.(1414-1416)Aag>Gag	p.K472E	CIRH1A_ENST00000563094.1_Missense_Mutation_p.K472E|CIRH1A_ENST00000352319.4_Intron			Q969X6	CIR1A_HUMAN	cirrhosis, autosomal recessive 1A (cirhin)	472					maturation of SSU-rRNA (GO:0030490)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)|t-UTP complex (GO:0034455)	poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(1)|kidney(3)|large_intestine(4)|lung(4)|prostate(1)|urinary_tract(1)	16				OV - Ovarian serous cystadenocarcinoma(108;0.125)		AGGAAGCTTCAAGCACCTGCA	0.448																																					Melanoma(69;1156 1278 4951 8715 52012)												0													58.0	53.0	55.0					16																	69191113		2198	4300	6498	SO:0001583	missense	0			AB075868	CCDS10872.1	16q22	2014-04-07			ENSG00000141076	ENSG00000141076		"""WD repeat domain containing"""	1983	protein-coding gene	gene with protein product	"""UTP4, small subunit (SSU) processome component, homolog (yeast)"""	607456				10820129, 20385600	Standard	NM_032830		Approved	NAIC, FLJ14728, KIAA1988, TEX292, CIRHIN, UTP4	uc002ews.4	Q969X6	OTTHUMG00000137570	ENST00000314423.7:c.1414A>G	16.37:g.69191113A>G	ENSP00000327179:p.Lys472Glu		Q8NCD9|Q8TF14|Q96SP0|Q96SR9|Q96SZ9|Q96T13|Q9BWK6	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,superfamily_Quinonprotein_ADH-like_supfam,smart_WD40_repeat,pfscan_WD40_repeat_dom	p.K472E	ENST00000314423.7	37	c.1414	CCDS10872.1	16	.	.	.	.	.	.	.	.	.	.	A	14.60	2.583473	0.46006	.	.	ENSG00000141076	ENST00000314423	T	0.29142	1.58	5.9	3.57	0.40892	WD40/YVTN repeat-like-containing domain (1);Quinonprotein alcohol dehydrogenase-like (1);	0.191449	0.53938	D	0.000054	T	0.21227	0.0511	L	0.39397	1.21	0.38676	D	0.952429	B;B	0.26845	0.03;0.161	B;B	0.30495	0.033;0.116	T	0.06972	-1.0797	10	0.07813	T	0.8	.	7.6127	0.28139	0.7131:0.1468:0.0:0.1401	.	472;472	Q969X6;Q969X6-3	CIR1A_HUMAN;.	E	472	ENSP00000327179:K472E	ENSP00000327179:K472E	K	+	1	0	CIRH1A	67748614	1.000000	0.71417	0.999000	0.59377	0.802000	0.45316	5.318000	0.65829	0.440000	0.26502	0.374000	0.22700	AAG	CIRH1A	-	superfamily_Quinonprotein_ADH-like_supfam,smart_WD40_repeat	ENSG00000141076		0.448	CIRH1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CIRH1A	HGNC	protein_coding	OTTHUMT00000268950.2	-	0.00	43	0	A	NM_032830		69191113	+1	tier1	-	no_errors	ENST00000314423	ensembl	human	known	74_37	missense	8.89	41	4	SNP	1.000	G
CNNM2	54805	genome.wustl.edu	37	10	104809565	104809565	+	Nonsense_Mutation	SNP	G	G	T			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr10:104809565G>T	ENST00000369878.4	+	2	1911	c.1723G>T	c.(1723-1725)Gaa>Taa	p.E575*	CNNM2_ENST00000433628.2_Nonsense_Mutation_p.E575*	NM_017649.4	NP_060119.3	Q9H8M5	CNNM2_HUMAN	cyclin and CBS domain divalent metal cation transport mediator 2	575	CBS 2. {ECO:0000255|PROSITE- ProRule:PRU00703}.				magnesium ion homeostasis (GO:0010960)|magnesium ion transport (GO:0015693)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)	adenyl nucleotide binding (GO:0030554)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(7)|ovary(1)|prostate(2)|urinary_tract(1)	19		Colorectal(252;0.103)|all_hematologic(284;0.152)|Breast(234;0.198)		Epithelial(162;7.89e-09)|all cancers(201;1.82e-07)|BRCA - Breast invasive adenocarcinoma(275;0.215)		TGTGATTGAAGAAATCATCAA	0.388																																																	0													123.0	124.0	123.0					10																	104809565		1871	4116	5987	SO:0001587	stop_gained	0			AF216962	CCDS7543.1, CCDS44474.1, CCDS44475.1	10q24.32	2014-08-08	2014-08-07		ENSG00000148842	ENSG00000148842			103	protein-coding gene	gene with protein product		607803	"""cyclin M2"""	ACDP2		21393841, 24699222	Standard	NM_017649		Approved		uc001kwm.3	Q9H8M5	OTTHUMG00000018976	ENST00000369878.4:c.1723G>T	10.37:g.104809565G>T	ENSP00000358894:p.Glu575*		Q5T569|Q5T570|Q8WU59|Q9H952|Q9NRK5|Q9NXT4	Nonsense_Mutation	SNP	pfam_DUF21,superfamily_cNMP-bd-like	p.E575*	ENST00000369878.4	37	c.1723	CCDS44474.1	10	.	.	.	.	.	.	.	.	.	.	G	39	7.731870	0.98459	.	.	ENSG00000148842	ENST00000457502;ENST00000433628;ENST00000369878;ENST00000345419	.	.	.	5.61	5.61	0.85477	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	19.6562	0.95842	0.0:0.0:1.0:0.0	.	.	.	.	X	575	.	ENSP00000286899:E575X	E	+	1	0	CNNM2	104799555	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	9.363000	0.97131	2.639000	0.89480	0.555000	0.69702	GAA	CNNM2	-	NULL	ENSG00000148842		0.388	CNNM2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CNNM2	HGNC	protein_coding	OTTHUMT00000050113.3	-	0.00	103	0	G	NM_017649		104809565	+1	tier1	-	no_errors	ENST00000369878	ensembl	human	known	74_37	nonsense	33.71	59	30	SNP	1.000	T
COL25A1	84570	genome.wustl.edu	37	4	109862572	109862572	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr4:109862572G>T	ENST00000399132.1	-	9	1044	c.514C>A	c.(514-516)Cat>Aat	p.H172N	COL25A1_ENST00000399126.1_Missense_Mutation_p.H172N|COL25A1_ENST00000399127.1_Intron	NM_198721.2	NP_942014.1			collagen, type XXV, alpha 1											NS(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(8)|lung(19)|ovary(2)|pancreas(1)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	49		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.000173)		AGAAACCCATGATTGATTTTA	0.408																																																	0													110.0	105.0	107.0					4																	109862572		1876	4109	5985	SO:0001583	missense	0			AF293340	CCDS43258.1, CCDS43259.1, CCDS58922.1	4q25	2013-01-16			ENSG00000188517	ENSG00000188517		"""Collagens"""	18603	protein-coding gene	gene with protein product		610004				11927537	Standard	NM_001256074		Approved		uc003hze.2	Q9BXS0	OTTHUMG00000150039	ENST00000399132.1:c.514C>A	4.37:g.109862572G>T	ENSP00000382083:p.His172Asn			Missense_Mutation	SNP	pfam_Collagen	p.H172N	ENST00000399132.1	37	c.514	CCDS43258.1	4	.	.	.	.	.	.	.	.	.	.	G	16.09	3.024538	0.54683	.	.	ENSG00000188517	ENST00000399132;ENST00000333642;ENST00000401873;ENST00000399126	D;D	0.90676	-2.52;-2.71	5.86	5.86	0.93980	.	0.000000	0.85682	D	0.000000	D	0.90239	0.6948	N	0.08118	0	0.58432	D	0.999993	D;D	0.67145	0.996;0.993	D;D	0.75484	0.986;0.968	D	0.89014	0.3430	9	.	.	.	-8.8671	20.5632	0.99335	0.0:0.0:1.0:0.0	.	172;172	Q9BXS0-2;Q9BXS0	.;COPA1_HUMAN	N	172;174;168;172	ENSP00000382083:H172N;ENSP00000382077:H172N	.	H	-	1	0	COL25A1	110082021	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.420000	0.97426	2.937000	0.99478	0.650000	0.86243	CAT	COL25A1	-	NULL	ENSG00000188517		0.408	COL25A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL25A1	HGNC	protein_coding	OTTHUMT00000315938.2	-	0.00	83	0	G	NM_032518		109862572	-1	tier1	-	no_errors	ENST00000399132	ensembl	human	known	74_37	missense	39.29	34	22	SNP	1.000	T
COL9A1	1297	genome.wustl.edu	37	6	70965094	70965094	+	Splice_Site	SNP	C	C	G			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr6:70965094C>G	ENST00000357250.6	-	22	1662		c.e22-1		COL9A1_ENST00000489611.1_Splice_Site|COL9A1_ENST00000320755.7_Splice_Site|COL9A1_ENST00000370499.4_Splice_Site	NM_001851.4	NP_001842.3	P20849	CO9A1_HUMAN	collagen, type IX, alpha 1						axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|growth plate cartilage development (GO:0003417)|organ morphogenesis (GO:0009887)|tissue homeostasis (GO:0001894)	collagen type IX trimer (GO:0005594)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)|metal ion binding (GO:0046872)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(44)|ovary(5)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)	80						CTTGATCACCCTGTATGAAAA	0.368																																																	0													125.0	114.0	118.0					6																	70965094		2203	4300	6503	SO:0001630	splice_region_variant	0				CCDS4971.1, CCDS47447.1	6q13	2013-05-07			ENSG00000112280	ENSG00000112280		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"""	2217	protein-coding gene	gene with protein product		120210				1429648	Standard	NM_001851		Approved		uc003pfg.4	P20849	OTTHUMG00000014988	ENST00000357250.6:c.1504-1G>C	6.37:g.70965094C>G			Q13699|Q13700|Q5TF52|Q6P467|Q96BM8|Q99225|Q9H151|Q9H152|Q9Y6P2|Q9Y6P3	Splice_Site	SNP	-	e22-1	ENST00000357250.6	37	c.1504-1	CCDS4971.1	6	.	.	.	.	.	.	.	.	.	.	C	18.81	3.704024	0.68615	.	.	ENSG00000112280	ENST00000357250;ENST00000320755;ENST00000370499	.	.	.	5.52	5.52	0.82312	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.6295	0.88103	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	COL9A1	71021815	1.000000	0.71417	0.997000	0.53966	0.909000	0.53808	6.370000	0.73114	2.583000	0.87209	0.655000	0.94253	.	COL9A1	-	-	ENSG00000112280		0.368	COL9A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL9A1	HGNC	protein_coding	OTTHUMT00000041131.2	-	0.00	41	0	C		Intron	70965094	-1	tier1	-	no_errors	ENST00000357250	ensembl	human	known	74_37	splice_site	34.09	29	15	SNP	1.000	G
CRTAM	56253	genome.wustl.edu	37	11	122722490	122722490	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr11:122722490G>A	ENST00000227348.4	+	3	330	c.283G>A	c.(283-285)Gtg>Atg	p.V95M		NM_019604.2	NP_062550.2			cytotoxic and regulatory T cell molecule											breast(1)|endometrium(2)|large_intestine(5)|lung(7)|ovary(2)|pancreas(1)|prostate(1)	19		Breast(109;0.00249)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;5.28e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0308)		AGATGAAGGCGTGTACAAGTG	0.458																																																	0													158.0	135.0	143.0					11																	122722490		2202	4299	6501	SO:0001583	missense	0			AF001622	CCDS8437.1	11q24.1	2013-01-11			ENSG00000109943	ENSG00000109943		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"""	24313	protein-coding gene	gene with protein product	"""class I MHC restricted T cell associated molecule"""	612597				10811014, 16300832	Standard	NM_019604		Approved	CD355	uc001pyj.3	O95727	OTTHUMG00000166026	ENST00000227348.4:c.283G>A	11.37:g.122722490G>A	ENSP00000227348:p.Val95Met			Missense_Mutation	SNP	pfam_CD80_C2-set,pfam_Ig_V-set,pfam_Ig_I-set,smart_Ig_sub,pfscan_Ig-like_dom	p.V95M	ENST00000227348.4	37	c.283	CCDS8437.1	11	.	.	.	.	.	.	.	.	.	.	G	9.685	1.150422	0.21371	.	.	ENSG00000109943	ENST00000227348	T	0.68331	-0.32	5.12	-0.122	0.13531	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.624736	0.15332	N	0.267923	T	0.52008	0.1708	M	0.75447	2.3	0.09310	N	0.999997	P	0.49307	0.922	B	0.33392	0.163	T	0.52487	-0.8569	10	0.54805	T	0.06	.	1.7089	0.02888	0.3767:0.1268:0.3664:0.13	.	95	O95727	CRTAM_HUMAN	M	95	ENSP00000227348:V95M	ENSP00000227348:V95M	V	+	1	0	CRTAM	122227700	0.000000	0.05858	0.073000	0.20177	0.620000	0.37586	-0.542000	0.06091	-0.297000	0.08934	0.460000	0.39030	GTG	CRTAM	-	pfam_Ig_V-set,pfam_Ig_I-set,smart_Ig_sub,pfscan_Ig-like_dom	ENSG00000109943		0.458	CRTAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CRTAM	HGNC	protein_coding	OTTHUMT00000387507.1	-	0.00	95	0	G	NM_019604		122722490	+1	tier1	-	no_errors	ENST00000227348	ensembl	human	known	74_37	missense	43.86	64	50	SNP	0.017	A
CSMD2	114784	genome.wustl.edu	37	1	34083116	34083116	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr1:34083116G>T	ENST00000373380.1	-	17	2768	c.2548C>A	c.(2548-2550)Ccg>Acg	p.P850T	CSMD2_ENST00000373388.2_Missense_Mutation_p.P76T|CSMD2_ENST00000373381.4_Missense_Mutation_p.P1977T|CSMD2_ENST00000373377.1_Missense_Mutation_p.P76T			Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	1937	CUB 5. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(5)|breast(5)|central_nervous_system(3)|cervix(2)|endometrium(20)|haematopoietic_and_lymphoid_tissue(4)|kidney(9)|large_intestine(43)|lung(114)|ovary(8)|pancreas(1)|prostate(6)|skin(20)|upper_aerodigestive_tract(5)|urinary_tract(1)	246		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				GCATATCCCGGCTCACACTGG	0.587																																																	0													111.0	84.0	93.0					1																	34083116		2203	4300	6503	SO:0001583	missense	0			AY210418	CCDS380.1, CCDS60082.1	1p34.3	2014-01-28			ENSG00000121904	ENSG00000121904			19290	protein-coding gene	gene with protein product		608398				11472063, 11572484	Standard	NM_001281956		Approved	KIAA1884	uc001bxn.1	Q7Z408	OTTHUMG00000011135	ENST00000373380.1:c.2548C>A	1.37:g.34083116G>T	ENSP00000362478:p.Pro850Thr		B1AM50|E7EUA6|Q53TY4|Q5VT59|Q8N963|Q96Q03|Q9H4V7|Q9H4V8|Q9H4V9|Q9H4W0|Q9H4W1|Q9H4W2|Q9H4W3|Q9H4W4|Q9HCY5|Q9HCY6|Q9HCY7	Missense_Mutation	SNP	pfam_CUB_dom,pfam_Sushi_SCR_CCP,superfamily_CUB_dom,superfamily_Sushi_SCR_CCP,smart_CUB_dom,smart_Sushi_SCR_CCP,pfscan_CUB_dom,pfscan_Sushi_SCR_CCP	p.P1977T	ENST00000373380.1	37	c.5929		1	.	.	.	.	.	.	.	.	.	.	G	26.9	4.786077	0.90282	.	.	ENSG00000121904	ENST00000373381;ENST00000373380;ENST00000373377;ENST00000373388	T;T;T;T	0.65916	-0.18;-0.18;-0.18;-0.18	5.67	5.67	0.87782	Complement control module (2);Sushi/SCR/CCP (3);	0.000000	0.85682	D	0.000000	T	0.75925	0.3916	L	0.49513	1.565	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;1.0	T	0.76413	-0.2968	10	0.62326	D	0.03	.	18.3393	0.90299	0.0:0.0:1.0:0.0	.	850;1937;1977	Q7Z408-2;Q7Z408;E7EUA6	.;CSMD2_HUMAN;.	T	1977;850;76;76	ENSP00000362479:P1977T;ENSP00000362478:P850T;ENSP00000362475:P76T;ENSP00000362486:P76T	ENSP00000241312:P1937T	P	-	1	0	CSMD2	33855703	1.000000	0.71417	0.999000	0.59377	0.997000	0.91878	7.960000	0.87893	2.676000	0.91093	0.655000	0.94253	CCG	CSMD2	-	pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	ENSG00000121904		0.587	CSMD2-002	KNOWN	basic	protein_coding	CSMD2	HGNC	protein_coding	OTTHUMT00000030635.4		0.00	81	0	G	NM_052896		34083116	-1			no_errors	ENST00000373381	ensembl	human	known	74_37	missense	5.56	51	3	SNP	1.000	T
CTBS	1486	genome.wustl.edu	37	1	85020793	85020793	+	Silent	SNP	C	C	A			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr1:85020793C>A	ENST00000370630.5	-	7	1095	c.1047G>T	c.(1045-1047)cgG>cgT	p.R349R	CTBS_ENST00000477677.1_5'UTR	NM_004388.2	NP_004379.1	Q01459	DIAC_HUMAN	chitobiase, di-N-acetyl-	349					chitin catabolic process (GO:0006032)|oligosaccharide catabolic process (GO:0009313)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	chitinase activity (GO:0004568)			breast(1)|endometrium(1)|large_intestine(4)|lung(2)|ovary(1)	9				all cancers(265;0.00727)|Epithelial(280;0.0192)|OV - Ovarian serous cystadenocarcinoma(397;0.166)		TGCCAATGCCCCGTAAGCGAT	0.403																																																	0													142.0	137.0	139.0					1																	85020793		2203	4300	6503	SO:0001819	synonymous_variant	0			M95767	CCDS698.1	1p22	2010-05-04			ENSG00000117151	ENSG00000117151	3.2.1.-		2496	protein-coding gene	gene with protein product		600873		CTB		1549114, 7606925	Standard	NM_004388		Approved		uc001dka.2	Q01459	OTTHUMG00000009922	ENST00000370630.5:c.1047G>T	1.37:g.85020793C>A			Q5VX50	Silent	SNP	pfam_Glyco_hydro18cat,superfamily_Glycoside_hydrolase_SF,smart_Chitinase_II	p.R349	ENST00000370630.5	37	c.1047	CCDS698.1	1																																																																																			CTBS	-	pfam_Glyco_hydro18cat,superfamily_Glycoside_hydrolase_SF,smart_Chitinase_II	ENSG00000117151		0.403	CTBS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTBS	HGNC	protein_coding	OTTHUMT00000027457.2		0.00	81	0	C	NM_004388		85020793	-1			no_errors	ENST00000370630	ensembl	human	known	74_37	silent	5.88	48	3	SNP	0.248	A
CWF19L1	55280	genome.wustl.edu	37	10	101995434	101995434	+	Nonsense_Mutation	SNP	G	G	A			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr10:101995434G>A	ENST00000354105.4	-	13	1548	c.1462C>T	c.(1462-1464)Cag>Tag	p.Q488*	CWF19L1_ENST00000478047.1_5'UTR|RP11-316M21.6_ENST00000444359.1_RNA|CWF19L1_ENST00000370379.1_Nonsense_Mutation_p.Q203*|SNORA12_ENST00000391162.1_RNA	NM_018294.4	NP_060764.3	Q69YN2	C19L1_HUMAN	CWF19-like 1, cell cycle control (S. pombe)	488							catalytic activity (GO:0003824)			cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|liver(1)|lung(4)|pancreas(1)|prostate(1)|stomach(2)	17		Colorectal(252;0.117)		Epithelial(162;3.78e-10)|all cancers(201;3.1e-08)		CTTCCAAACTGCAAAGGAAAA	0.353																																																	0													67.0	65.0	65.0					10																	101995434		2203	4300	6503	SO:0001587	stop_gained	0			AK001860	CCDS7489.1	10q24.31	2008-11-24			ENSG00000095485	ENSG00000095485			25613	protein-coding gene	gene with protein product						14702039	Standard	NM_018294		Approved	FLJ10998	uc001kqq.1	Q69YN2	OTTHUMG00000018901	ENST00000354105.4:c.1462C>T	10.37:g.101995434G>A	ENSP00000326411:p.Gln488*		B4DHX1|D3DR66|Q5W0I3|Q96HC3|Q9H865|Q9NV13	Nonsense_Mutation	SNP	pfam_Cwf19-like_C_dom-1,pfam_Cwf19-like_C_dom-2,superfamily_HIT-like	p.Q488*	ENST00000354105.4	37	c.1462	CCDS7489.1	10	.	.	.	.	.	.	.	.	.	.	G	37	6.180005	0.97352	.	.	ENSG00000095485	ENST00000354105;ENST00000370379	.	.	.	5.29	5.29	0.74685	.	0.051620	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	-9.3323	16.4413	0.83901	0.0:0.0:1.0:0.0	.	.	.	.	X	488;203	.	ENSP00000326411:Q488X	Q	-	1	0	CWF19L1	101985424	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.059000	0.93902	2.490000	0.84030	0.563000	0.77884	CAG	CWF19L1	-	pfam_Cwf19-like_C_dom-2	ENSG00000095485		0.353	CWF19L1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	CWF19L1	HGNC	protein_coding		-	0.00	40	0	G	NM_018294		101995434	-1	tier1	-	no_errors	ENST00000354105	ensembl	human	known	74_37	nonsense	7.41	50	4	SNP	1.000	A
CYFIP2	26999	genome.wustl.edu	37	5	156727797	156727797	+	Silent	SNP	T	T	C			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr5:156727797T>C	ENST00000521420.1	+	5	475	c.384T>C	c.(382-384)tcT>tcC	p.S128S	CYFIP2_ENST00000522463.1_Intron|CYFIP2_ENST00000377576.3_Silent_p.S154S|CYFIP2_ENST00000347377.6_Silent_p.S154S|CYFIP2_ENST00000541131.1_Silent_p.S79S|CYFIP2_ENST00000442283.2_5'UTR|CYFIP2_ENST00000318218.6_Silent_p.S154S					cytoplasmic FMR1 interacting protein 2											breast(1)|endometrium(12)|kidney(2)|lung(23)	38	Renal(175;0.00212)	Medulloblastoma(196;0.0306)|all_neural(177;0.0897)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			ACTTTGTCTCTGAGGCCTACC	0.567																																																	0													103.0	104.0	103.0					5																	156727797		2150	4285	6435	SO:0001819	synonymous_variant	0			AF160973	CCDS75364.1	5q34	2008-07-18				ENSG00000055163			13760	protein-coding gene	gene with protein product	"""p53 inducible protein"""	606323				11438699	Standard	NM_001037333		Approved	PIR121	uc021ygm.1	Q96F07		ENST00000521420.1:c.384T>C	5.37:g.156727797T>C				Silent	SNP	pfam_Cytoplasmic_FMR1-int,pirsf_Cytoplasmic_FMR1-int_sub,prints_Cytoplasmic_FMR1-int	p.S154	ENST00000521420.1	37	c.462		5																																																																																			CYFIP2	-	pirsf_Cytoplasmic_FMR1-int_sub,prints_Cytoplasmic_FMR1-int	ENSG00000055163		0.567	CYFIP2-001	NOVEL	basic	protein_coding	CYFIP2	HGNC	protein_coding	OTTHUMT00000373710.1	-	0.00	50	0	T	NM_001037332		156727797	+1	tier1	-	no_errors	ENST00000318218	ensembl	human	known	74_37	silent	22.22	28	8	SNP	0.031	C
DCAF11	80344	genome.wustl.edu	37	14	24587630	24587630	+	Missense_Mutation	SNP	G	G	A	rs371332713		TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr14:24587630G>A	ENST00000446197.3	+	7	1338	c.611G>A	c.(610-612)gGc>gAc	p.G204D	RP11-468E2.6_ENST00000558325.1_5'Flank|DCAF11_ENST00000560171.1_3'UTR|DCAF11_ENST00000396936.1_Missense_Mutation_p.G104D|DCAF11_ENST00000396941.4_Missense_Mutation_p.G178D|DCAF11_ENST00000559115.1_Missense_Mutation_p.G204D	NM_025230.4	NP_079506.3	Q8TEB1	DCA11_HUMAN	DDB1 and CUL4 associated factor 11	204					protein ubiquitination (GO:0016567)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)											TGCCGATATGGCCGTTTCCGT	0.483																																																	0								G	ASP/GLY,ASP/GLY,ASP/GLY	0,4406		0,0,2203	139.0	131.0	134.0		611,611,533	5.4	1.0	14		134	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense	DCAF11	NM_001163484.1,NM_025230.4,NM_181357.2	94,94,94	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging	204/547,204/547,178/521	24587630	1,13005	2203	4300	6503	SO:0001583	missense	0			AF130070	CCDS9610.1, CCDS41929.1	14q11.2	2013-01-09	2009-07-17	2009-07-17	ENSG00000100897	ENSG00000100897		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	20258	protein-coding gene	gene with protein product		613317	"""WD repeat domain 23"""	WDR23			Standard	NM_025230		Approved	PRO2389, GL014	uc001wlv.3	Q8TEB1	OTTHUMG00000028793	ENST00000446197.3:c.611G>A	14.37:g.24587630G>A	ENSP00000415556:p.Gly204Asp		B3KQ83|D3DS56|Q5D039|Q86U00|Q86U39|Q8NDN2|Q9H2J0|Q9H3A3|Q9H5C9	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pirsf_WD_repeat_p23,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.G204D	ENST00000446197.3	37	c.611	CCDS9610.1	14	.	.	.	.	.	.	.	.	.	.	g	18.51	3.639608	0.67244	0.0	1.16E-4	ENSG00000100897	ENST00000326009;ENST00000446197;ENST00000396936;ENST00000396941	T;T;T	0.77620	-1.11;0.82;0.82	5.4	5.4	0.78164	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	D	0.85097	0.5619	L	0.49640	1.575	0.80722	D	1	D;D;P;P;D	0.89917	0.999;1.0;0.658;0.719;0.999	D;D;B;B;D	0.80764	0.969;0.994;0.286;0.397;0.968	D	0.85590	0.1245	10	0.66056	D	0.02	-22.3621	16.7199	0.85407	0.0:0.0:1.0:0.0	.	127;178;104;204;204	Q59GN6;Q8TEB1-2;Q8TEB1-3;A8K9T2;Q8TEB1	.;.;.;.;DCA11_HUMAN	D	204;178;104;178	ENSP00000415556:G178D;ENSP00000380142:G104D;ENSP00000380146:G178D	ENSP00000323680:G204D	G	+	2	0	DCAF11	23657470	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.016000	0.88706	2.805000	0.96524	0.655000	0.94253	GGC	DCAF11	-	superfamily_WD40_repeat_dom,pirsf_WD_repeat_p23,pfscan_WD40_repeat_dom	ENSG00000100897		0.483	DCAF11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCAF11	HGNC	protein_coding	OTTHUMT00000071907.4		0.00	87	0	G			24587630	+1			no_errors	ENST00000446197	ensembl	human	known	74_37	missense	5.00	95	5	SNP	1.000	A
DCST2	127579	genome.wustl.edu	37	1	154996981	154996981	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr1:154996981C>T	ENST00000368424.3	-	11	1767	c.1709G>A	c.(1708-1710)gGc>gAc	p.G570D	DCST2_ENST00000295536.5_Missense_Mutation_p.G570D	NM_144622.2	NP_653223.2	Q5T1A1	DCST2_HUMAN	DC-STAMP domain containing 2	570						integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(10)|lung(13)|ovary(3)|prostate(1)|skin(1)	38	all_epithelial(22;2.77e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		BRCA - Breast invasive adenocarcinoma(34;0.00034)			ACTTCTGTGGCCCTGGTCAGC	0.577																																																	0													55.0	55.0	55.0					1																	154996981		2203	4300	6503	SO:0001583	missense	0			AK057496	CCDS1082.2	1q22	2008-02-05		2005-08-09	ENSG00000163354	ENSG00000163354			26562	protein-coding gene	gene with protein product							Standard	NM_144622		Approved	FLJ32934	uc001fgm.3	Q5T1A1	OTTHUMG00000037371	ENST00000368424.3:c.1709G>A	1.37:g.154996981C>T	ENSP00000357409:p.Gly570Asp		Q2M2R2|Q8N810|Q96M03	Missense_Mutation	SNP	pfam_DC_STAMP-like	p.G570D	ENST00000368424.3	37	c.1709	CCDS1082.2	1	.	.	.	.	.	.	.	.	.	.	C	1.990	-0.432138	0.04669	.	.	ENSG00000163354	ENST00000368424;ENST00000295536	T;T	0.24723	1.84;1.9	4.14	1.11	0.20524	.	0.753844	0.11793	N	0.528906	T	0.04588	0.0125	N	0.08118	0	0.20764	N	0.999855	D	0.59767	0.986	P	0.48454	0.578	T	0.13575	-1.0504	10	0.15066	T	0.55	-10.5518	4.8706	0.13631	0.0:0.6206:0.1769:0.2026	.	570	Q5T1A1	DCST2_HUMAN	D	570	ENSP00000357409:G570D;ENSP00000295536:G570D	ENSP00000295536:G570D	G	-	2	0	DCST2	153263605	0.103000	0.21917	0.425000	0.26659	0.125000	0.20455	1.073000	0.30691	0.059000	0.16252	-0.379000	0.06801	GGC	DCST2	-	NULL	ENSG00000163354		0.577	DCST2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	DCST2	HGNC	protein_coding	OTTHUMT00000090953.3	-	0.00	50	0	C	NM_144622		154996981	-1	tier1	-	no_errors	ENST00000368424	ensembl	human	known	74_37	missense	6.25	60	4	SNP	0.633	T
DDB2	1643	genome.wustl.edu	37	11	47237962	47237962	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr11:47237962G>A	ENST00000256996.4	+	2	398	c.203G>A	c.(202-204)aGc>aAc	p.S68N	DDB2_ENST00000378601.3_Missense_Mutation_p.S68N|DDB2_ENST00000378603.3_Missense_Mutation_p.S68N|DDB2_ENST00000378600.3_Missense_Mutation_p.S68N	NM_000107.2	NP_000098.1	Q92466	DDB2_HUMAN	damage-specific DNA binding protein 2, 48kDa	68	Required for interaction with DDB1.				DNA repair (GO:0006281)|histone H2A monoubiquitination (GO:0035518)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|protein autoubiquitination (GO:0051865)|protein polyubiquitination (GO:0000209)|pyrimidine dimer repair (GO:0006290)|response to UV (GO:0009411)|UV-damage excision repair (GO:0070914)	Cul4B-RING E3 ubiquitin ligase complex (GO:0031465)|nucleoplasm (GO:0005654)|protein complex (GO:0043234)	damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)			breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)|skin(1)	17						CCATGCCGCAGCATCGTCAGG	0.557			"""Mis, N"""			"""skin basal cell, skin squamous cell, melanoma"""		Direct reversal of damage;Nucleotide excision repair (NER)	Xeroderma Pigmentosum																														yes	Rec		Xeroderma pigmentosum (E)	11	11p12	1643	damage-specific DNA binding protein 2		E	0													65.0	64.0	64.0					11																	47237962		2201	4298	6499	SO:0001583	missense	0	Familial Cancer Database	incl. XPA, XPB, XPC, XPD, XPE, XPF, XPG, XP Variant, XPV		CCDS7927.1, CCDS73284.1	11p12-p11	2014-09-17	2002-08-29			ENSG00000134574		"""WD repeat domain containing"""	2718	protein-coding gene	gene with protein product	"""xeroderma pigmentosum group E protein"", ""UV-damaged DNA-binding protein 2"", ""DDB p48 subunit"""	600811	"""damage-specific DNA binding protein 2 (48kD)"""			8407967, 8530102	Standard	NM_000107		Approved	DDBB, UV-DDB2, FLJ34321	uc001neb.2	Q92466		ENST00000256996.4:c.203G>A	11.37:g.47237962G>A	ENSP00000256996:p.Ser68Asn		B2R875|Q76E54|Q76E55|Q76E56|Q76E57	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.S68N	ENST00000256996.4	37	c.203	CCDS7927.1	11	.	.	.	.	.	.	.	.	.	.	G	9.123	1.009356	0.19277	.	.	ENSG00000134574	ENST00000256996;ENST00000378603;ENST00000378600;ENST00000378601	T;T;T;T	0.80393	-0.94;-0.51;-1.37;0.34	5.01	2.17	0.27698	.	0.000000	0.85682	D	0.000000	T	0.71676	0.3368	L	0.58101	1.795	0.45822	D	0.998694	B;B;B;B	0.17465	0.002;0.022;0.022;0.0	B;B;B;B	0.14578	0.011;0.011;0.011;0.001	T	0.59048	-0.7527	10	0.17369	T	0.5	-10.455	7.7444	0.28860	0.2611:0.0:0.7389:0.0	.	68;68;68;68	Q92466-4;Q92466-3;Q92466-2;Q92466	.;.;.;DDB2_HUMAN	N	68	ENSP00000256996:S68N;ENSP00000367866:S68N;ENSP00000367863:S68N;ENSP00000367864:S68N	ENSP00000256996:S68N	S	+	2	0	DDB2	47194538	0.997000	0.39634	0.765000	0.31456	0.012000	0.07955	1.302000	0.33459	0.316000	0.23135	-0.136000	0.14681	AGC	DDB2	-	NULL	ENSG00000134574		0.557	DDB2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	DDB2	HGNC	protein_coding		-	0.00	81	0	G	NM_000107		47237962	+1	tier1	-	no_errors	ENST00000256996	ensembl	human	known	74_37	missense	6.78	55	4	SNP	0.981	A
DDX46	9879	genome.wustl.edu	37	5	134147505	134147505	+	Missense_Mutation	SNP	A	A	T			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr5:134147505A>T	ENST00000354283.4	+	18	2541	c.2406A>T	c.(2404-2406)caA>caT	p.Q802H	DDX46_ENST00000452510.2_Missense_Mutation_p.Q802H			Q7L014	DDX46_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 46	802					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)			NS(2)|breast(2)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(7)|lung(7)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	30			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			TTGGTCTACAAGATTCAGATG	0.378																																					Colon(13;391 453 4901 21675 24897)												0													127.0	129.0	128.0					5																	134147505		2203	4300	6503	SO:0001583	missense	0				CCDS34240.1, CCDS75306.1	5q31.1	2010-01-25			ENSG00000145833	ENSG00000145833		"""DEAD-boxes"""	18681	protein-coding gene	gene with protein product							Standard	XM_005272142		Approved	KIAA0801, FLJ25329, PRPF5, Prp5	uc003kzw.3	Q7L014	OTTHUMG00000163072	ENST00000354283.4:c.2406A>T	5.37:g.134147505A>T	ENSP00000346236:p.Gln802His		O94894|Q96EI0|Q9Y658	Missense_Mutation	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_RNA_helicase_DEAD_Q_motif	p.Q802H	ENST00000354283.4	37	c.2406	CCDS34240.1	5	.	.	.	.	.	.	.	.	.	.	A	12.71	2.018466	0.35606	.	.	ENSG00000145833	ENST00000452510;ENST00000354283	T;T	0.27402	1.67;1.68	5.07	-0.807	0.10872	.	0.051337	0.85682	D	0.000000	T	0.23210	0.0561	L	0.42487	1.325	0.51482	D	0.999929	B	0.12013	0.005	B	0.17722	0.019	T	0.08146	-1.0736	10	0.51188	T	0.08	-17.8213	10.0814	0.42393	0.517:0.0:0.483:0.0	.	802	Q7L014	DDX46_HUMAN	H	802	ENSP00000416534:Q802H;ENSP00000346236:Q802H	ENSP00000346236:Q802H	Q	+	3	2	DDX46	134175404	0.997000	0.39634	0.999000	0.59377	0.979000	0.70002	0.529000	0.23019	0.013000	0.14918	-0.512000	0.04463	CAA	DDX46	-	NULL	ENSG00000145833		0.378	DDX46-002	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX46	HGNC	protein_coding	OTTHUMT00000371584.1		0.00	99	0	A	NM_014829		134147505	+1			no_errors	ENST00000452510	ensembl	human	known	74_37	missense	5.00	76	4	SNP	0.998	T
DDX55	57696	genome.wustl.edu	37	12	124101146	124101146	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr12:124101146G>T	ENST00000238146.4	+	10	1095	c.1045G>T	c.(1045-1047)Gca>Tca	p.A349S	DDX55_ENST00000421670.3_5'Flank|DDX55_ENST00000541259.1_3'UTR|SNORA9_ENST00000384170.1_RNA|DDX55_ENST00000538744.1_Intron	NM_020936.1	NP_065987.1	Q8NHQ9	DDX55_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 55	349	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.					membrane (GO:0016020)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)			autonomic_ganglia(1)|breast(1)|endometrium(1)|large_intestine(3)|liver(1)|lung(4)|ovary(1)|prostate(1)|skin(1)	14	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000142)|Epithelial(86;0.000637)|all cancers(50;0.00772)		TCCCAGCAATGCAAGGTATGG	0.453																																																	0													155.0	152.0	153.0					12																	124101146		2203	4300	6503	SO:0001583	missense	0			AB046815	CCDS9251.1	12q24.31	2003-06-13			ENSG00000111364	ENSG00000111364		"""DEAD-boxes"""	20085	protein-coding gene	gene with protein product						10997877	Standard	NM_020936		Approved	KIAA1595	uc001ufi.3	Q8NHQ9	OTTHUMG00000168695	ENST00000238146.4:c.1045G>T	12.37:g.124101146G>T	ENSP00000238146:p.Ala349Ser		Q658L6|Q8IYH0|Q9HCH7	Missense_Mutation	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,pfam_Helicase/UvrB_dom,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_RNA_helicase_DEAD_Q_motif	p.A349S	ENST00000238146.4	37	c.1045	CCDS9251.1	12	.	.	.	.	.	.	.	.	.	.	G	37	6.501038	0.97616	.	.	ENSG00000111364	ENST00000238146;ENST00000538449	T	0.74947	-0.89	5.63	5.63	0.86233	Helicase, C-terminal (3);	0.046880	0.85682	D	0.000000	T	0.71779	0.3380	L	0.37507	1.11	0.80722	D	1	B;P	0.38048	0.443;0.616	B;B	0.41135	0.304;0.348	T	0.72272	-0.4342	10	0.49607	T	0.09	-21.1449	19.6805	0.95960	0.0:0.0:1.0:0.0	.	349;349	B4DVE4;Q8NHQ9	.;DDX55_HUMAN	S	349	ENSP00000238146:A349S	ENSP00000238146:A349S	A	+	1	0	DDX55	122667099	1.000000	0.71417	0.193000	0.23327	0.931000	0.56810	9.382000	0.97209	2.670000	0.90874	0.655000	0.94253	GCA	DDX55	-	pfam_Helicase_C,superfamily_P-loop_NTPase,smart_Helicase_C,pfscan_Helicase_C	ENSG00000111364		0.453	DDX55-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX55	HGNC	protein_coding	OTTHUMT00000400616.2	-	0.00	77	0	G			124101146	+1	tier1	-	no_errors	ENST00000238146	ensembl	human	known	74_37	missense	6.10	77	5	SNP	1.000	T
DNAH10	196385	genome.wustl.edu	37	12	124403417	124403417	+	Silent	SNP	G	G	T			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr12:124403417G>T	ENST00000409039.3	+	64	11098	c.11073G>T	c.(11071-11073)ctG>ctT	p.L3691L		NM_207437.3	NP_997320.2	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	3691					microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		AGAAGTCGCTGCCTGATTCCA	0.527																																																	0													72.0	73.0	72.0					12																	124403417		2121	4254	6375	SO:0001819	synonymous_variant	0			AJ132089	CCDS9255.2	12q24	2008-02-05	2006-09-04		ENSG00000197653	ENSG00000197653		"""Axonemal dyneins"""	2941	protein-coding gene	gene with protein product		605884	"""dynein, axonemal, heavy polypeptide 10"""				Standard	NM_207437		Approved	FLJ43808	uc001uft.4	Q8IVF4	OTTHUMG00000154477	ENST00000409039.3:c.11073G>T	12.37:g.124403417G>T			C9JMF5|O95495|Q6ZUC9|Q6ZUP6|Q8N761	Silent	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,pfam_Dynein_heavy_dom-1,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,superfamily_PyrdxlP-dep_Trfase,smart_AAA+_ATPase	p.L3691	ENST00000409039.3	37	c.11073	CCDS9255.2	12																																																																																			DNAH10	-	NULL	ENSG00000197653		0.527	DNAH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH10	HGNC	protein_coding	OTTHUMT00000335420.3	-	0.00	37	0	G			124403417	+1	tier1	-	no_errors	ENST00000409039	ensembl	human	known	74_37	silent	8.16	45	4	SNP	1.000	T
DNAH7	56171	genome.wustl.edu	37	2	196709863	196709863	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr2:196709863C>A	ENST00000312428.6	-	47	8908	c.8808G>T	c.(8806-8808)ttG>ttT	p.L2936F		NM_018897.2	NP_061720.2	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	2936					cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)	axonemal dynein complex (GO:0005858)|cilium (GO:0005929)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|microtubule motor activity (GO:0003777)			NS(4)|breast(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(28)|liver(3)|lung(100)|ovary(4)|prostate(5)|skin(26)|upper_aerodigestive_tract(2)|urinary_tract(3)	205						TTCCTTTGCACAAAGTTGTCC	0.388																																																	0													132.0	118.0	122.0					2																	196709863		1846	4097	5943	SO:0001583	missense	0			AF327442	CCDS42794.1	2q33.1	2013-01-10	2006-09-04		ENSG00000118997	ENSG00000118997		"""Axonemal dyneins"", ""EF-hand domain containing"""	18661	protein-coding gene	gene with protein product		610061	"""dynein, axonemal, heavy polypeptide 7"""			9373155, 11877439	Standard	NM_018897		Approved	KIAA0944	uc002utj.4	Q8WXX0	OTTHUMG00000154438	ENST00000312428.6:c.8808G>T	2.37:g.196709863C>A	ENSP00000311273:p.Leu2936Phe		B8ZZX8|O00433|O95492|Q4G152|Q53QX7|Q53S64|Q53T02|Q68CY5|Q8N1Z2|Q9UMS3|Q9Y2F3	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,superfamily_P-loop_NTPase,superfamily_Signal_recog_particle_SRP9/14,smart_AAA+_ATPase,pfscan_EF_hand_dom	p.L2936F	ENST00000312428.6	37	c.8808	CCDS42794.1	2	.	.	.	.	.	.	.	.	.	.	C	10.58	1.391130	0.25118	.	.	ENSG00000118997	ENST00000312428	T	0.22945	1.93	5.8	-0.00957	0.14000	.	0.502966	0.17478	N	0.172836	T	0.19886	0.0478	L	0.58354	1.805	0.33380	D	0.574744	B	0.15473	0.013	B	0.21546	0.035	T	0.35126	-0.9801	10	0.09590	T	0.72	.	7.6268	0.28216	0.0:0.3298:0.4235:0.2466	.	2936	Q8WXX0	DYH7_HUMAN	F	2936	ENSP00000311273:L2936F	ENSP00000311273:L2936F	L	-	3	2	DNAH7	196418108	0.012000	0.17670	0.461000	0.27105	0.980000	0.70556	-0.249000	0.08842	0.052000	0.16007	-0.133000	0.14855	TTG	DNAH7	-	NULL	ENSG00000118997		0.388	DNAH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH7	HGNC	protein_coding	OTTHUMT00000335202.3	-	0.00	94	0	C	NM_018897		196709863	-1	tier1	-	no_errors	ENST00000312428	ensembl	human	known	74_37	missense	10.13	71	8	SNP	0.002	A
DNAH8	1769	genome.wustl.edu	37	6	38854685	38854685	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr6:38854685G>T	ENST00000359357.3	+	55	7981	c.7727G>T	c.(7726-7728)gGa>gTa	p.G2576V	DNAH8_ENST00000449981.2_Missense_Mutation_p.G2793V|DNAH8_ENST00000441566.1_Missense_Mutation_p.G2540V			Q96JB1	DYH8_HUMAN	dynein, axonemal, heavy chain 8	2576	AAA 3. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(7)|breast(9)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(16)|large_intestine(44)|liver(4)|lung(101)|ovary(7)|pancreas(2)|prostate(8)|skin(28)|stomach(4)|upper_aerodigestive_tract(6)|urinary_tract(4)	260						ATCCACCCTGGAGGTGGTCGA	0.393																																																	0													147.0	135.0	139.0					6																	38854685		2203	4300	6503	SO:0001583	missense	0			Z83806	CCDS75447.1	6p21.2	2012-04-19	2006-09-04		ENSG00000124721	ENSG00000124721		"""Axonemal dyneins"""	2952	protein-coding gene	gene with protein product		603337	"""dynein, axonemal, heavy polypeptide 8"""			9373155	Standard	NM_001206927		Approved	hdhc9	uc021yzh.1	Q96JB1	OTTHUMG00000016253	ENST00000359357.3:c.7727G>T	6.37:g.38854685G>T	ENSP00000352312:p.Gly2576Val		O00438|Q5JYI2|Q5T2M3|Q5T2M4|Q5TG00|Q9UEM4	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.G2576V	ENST00000359357.3	37	c.7727		6	.	.	.	.	.	.	.	.	.	.	G	28.0	4.880156	0.91740	.	.	ENSG00000124721	ENST00000449981;ENST00000327475;ENST00000359357;ENST00000441566	T;T;T	0.34667	1.35;1.35;1.35	5.48	5.48	0.80851	ATPase, AAA+ type, core (1);	0.000000	0.85682	D	0.000000	T	0.71945	0.3400	H	0.97340	3.985	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.82688	-0.0333	10	0.72032	D	0.01	.	19.3374	0.94324	0.0:0.0:1.0:0.0	.	2576	Q96JB1	DYH8_HUMAN	V	2781;2781;2576;2540	ENSP00000333363:G2781V;ENSP00000352312:G2576V;ENSP00000402294:G2540V	ENSP00000333363:G2781V	G	+	2	0	DNAH8	38962663	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.750000	0.98875	2.571000	0.86741	0.561000	0.74099	GGA	DNAH8	-	pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	ENSG00000124721		0.393	DNAH8-001	KNOWN	basic|appris_principal	protein_coding	DNAH8	HGNC	protein_coding	OTTHUMT00000043574.1	-	0.00	50	0	G	NM_001206927		38854685	+1	tier1	-	no_errors	ENST00000359357	ensembl	human	known	74_37	missense	8.47	54	5	SNP	1.000	T
DNTTIP2	30836	genome.wustl.edu	37	1	94342746	94342746	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr1:94342746C>T	ENST00000436063.2	-	2	802	c.745G>A	c.(745-747)Gca>Aca	p.A249T	DNTTIP2_ENST00000460191.1_5'UTR	NM_014597.4	NP_055412.2	Q5QJE6	TDIF2_HUMAN	deoxynucleotidyltransferase, terminal, interacting protein 2	249					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			NS(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(15)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	38		all_lung(203;0.0111)|Lung NSC(277;0.0347)		all cancers(265;0.00679)|GBM - Glioblastoma multiforme(16;0.0278)|Epithelial(280;0.128)		AGAGATCTTGCTTGTAAATGG	0.348																																																	0													111.0	110.0	110.0					1																	94342746		1815	4067	5882	SO:0001583	missense	0			AY394925	CCDS44174.1	1p22.1	2008-02-05			ENSG00000067334	ENSG00000067334			24013	protein-coding gene	gene with protein product	"""acidic 82 kDa protein mRNA"""	611199				15047147	Standard	NM_014597		Approved	HSU15552, ERBP, TdIF2	uc001dqf.3	Q5QJE6	OTTHUMG00000010268	ENST00000436063.2:c.745G>A	1.37:g.94342746C>T	ENSP00000411010:p.Ala249Thr		Q12987|Q53H59|Q5TFJ4|Q6TLI0|Q76MJ8|Q86WX9	Missense_Mutation	SNP	pfam_Fcf2	p.A249T	ENST00000436063.2	37	c.745	CCDS44174.1	1	.	.	.	.	.	.	.	.	.	.	C	3.471	-0.108012	0.06924	.	.	ENSG00000067334	ENST00000436063	T	0.16897	2.31	3.57	0.585	0.17428	.	0.508954	0.16516	N	0.211012	T	0.04770	0.0129	L	0.50333	1.59	0.09310	N	1	B	0.18310	0.027	B	0.15870	0.014	T	0.34725	-0.9817	10	0.52906	T	0.07	.	4.3471	0.11138	0.1565:0.5727:0.0:0.2708	.	249	Q5QJE6	TDIF2_HUMAN	T	249	ENSP00000411010:A249T	ENSP00000352137:A249T	A	-	1	0	DNTTIP2	94115334	0.000000	0.05858	0.159000	0.22649	0.153000	0.21895	0.276000	0.18716	0.026000	0.15269	-0.825000	0.03093	GCA	DNTTIP2	-	NULL	ENSG00000067334		0.348	DNTTIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNTTIP2	HGNC	protein_coding	OTTHUMT00000028317.2		0.00	91	0	C	NM_014597		94342746	-1			no_errors	ENST00000436063	ensembl	human	known	74_37	missense	7.84	47	4	SNP	0.028	T
DOCK2	1794	genome.wustl.edu	37	5	169188391	169188391	+	Intron	SNP	C	C	A			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr5:169188391C>A	ENST00000256935.8	+	25	2527				DOCK2_ENST00000520908.1_Intron|DOCK2_ENST00000523351.1_3'UTR|DOCK2_ENST00000540750.1_Intron	NM_004946.2	NP_004937.1	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2						actin cytoskeleton organization (GO:0030036)|alpha-beta T cell proliferation (GO:0046633)|chemotaxis (GO:0006935)|establishment of T cell polarity (GO:0001768)|immunological synapse formation (GO:0001771)|macropinocytosis (GO:0044351)|membrane raft polarization (GO:0001766)|myeloid dendritic cell activation involved in immune response (GO:0002277)|negative thymic T cell selection (GO:0045060)|positive regulation of phagocytosis (GO:0050766)|positive thymic T cell selection (GO:0045059)|regulation of defense response to virus by virus (GO:0050690)|small GTPase mediated signal transduction (GO:0007264)|viral process (GO:0016032)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|T cell receptor binding (GO:0042608)			NS(2)|breast(5)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(42)|liver(2)|lung(63)|ovary(5)|pancreas(3)|prostate(7)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)	160	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			TGAAGGCTTACCTTGCACCTC	0.453																																																	0																																										SO:0001627	intron_variant	0			BC016996	CCDS4371.1	5q35.1	2008-02-05			ENSG00000134516	ENSG00000134516			2988	protein-coding gene	gene with protein product		603122	"""dedicator of cyto-kinesis 2"""				Standard	NM_004946		Approved	KIAA0209	uc003maf.3	Q92608	OTTHUMG00000130437	ENST00000256935.8:c.2448-132C>A	5.37:g.169188391C>A			Q2M3I0|Q96AK7	RNA	SNP	-	NULL	ENST00000256935.8	37	NULL	CCDS4371.1	5																																																																																			DOCK2	-	-	ENSG00000134516		0.453	DOCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK2	HGNC	protein_coding	OTTHUMT00000252828.2	-	0.00	17	0	C	NM_004946		169188391	+1	tier1	-	no_errors	ENST00000523351	ensembl	human	known	74_37	rna	33.33	6	3	SNP	0.000	A
DPYSL5	56896	genome.wustl.edu	37	2	27121411	27121411	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr2:27121411G>T	ENST00000288699.6	+	2	202	c.44G>T	c.(43-45)gGc>gTc	p.G15V	DPYSL5_ENST00000401478.1_Missense_Mutation_p.G15V	NM_001253724.1|NM_020134.3	NP_001240653.1|NP_064519.2	Q9BPU6	DPYL5_HUMAN	dihydropyrimidinase-like 5	15					axon guidance (GO:0007411)|nervous system development (GO:0007399)|pyrimidine nucleobase catabolic process (GO:0006208)|signal transduction (GO:0007165)	cytosol (GO:0005829)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides (GO:0016812)			breast(1)|endometrium(5)|large_intestine(2)|lung(13)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	27	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					ATCAAGGGAGGCAAGGTGGTG	0.567																																																	0													208.0	181.0	190.0					2																	27121411		2203	4300	6503	SO:0001583	missense	0			AF264015	CCDS1730.1	2p23.3	2008-02-05			ENSG00000157851	ENSG00000157851			20637	protein-coding gene	gene with protein product		608383				10851247, 11034345	Standard	NM_020134		Approved	CRMP5, Ulip6, CRMP-5, CRAM	uc002rhu.4	Q9BPU6	OTTHUMG00000097071	ENST00000288699.6:c.44G>T	2.37:g.27121411G>T	ENSP00000288699:p.Gly15Val		Q8TCL6|Q9NQC4|Q9NRY9	Missense_Mutation	SNP	pfam_Amidohydro_1,superfamily_Metal-dep_hydrolase_composite,tigrfam_Hydantoinase/dihydroPyrase	p.G15V	ENST00000288699.6	37	c.44	CCDS1730.1	2	.	.	.	.	.	.	.	.	.	.	G	23.7	4.451868	0.84209	.	.	ENSG00000157851	ENST00000450961;ENST00000288699;ENST00000401478;ENST00000431402;ENST00000434719	D;D;D;D;D	0.89123	-2.08;-2.47;-2.47;-2.1;-2.08	4.61	4.61	0.57282	Metal-dependent hydrolase, composite domain (1);	0.000000	0.85682	D	0.000000	D	0.94640	0.8272	M	0.82630	2.6	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.95473	0.8553	10	0.87932	D	0	-26.373	16.5828	0.84718	0.0:0.0:1.0:0.0	.	15	Q9BPU6	DPYL5_HUMAN	V	15	ENSP00000407174:G15V;ENSP00000288699:G15V;ENSP00000385549:G15V;ENSP00000399581:G15V;ENSP00000413075:G15V	ENSP00000288699:G15V	G	+	2	0	DPYSL5	26974915	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	9.292000	0.96076	2.286000	0.76751	0.561000	0.74099	GGC	DPYSL5	-	superfamily_Metal-dep_hydrolase_composite,tigrfam_Hydantoinase/dihydroPyrase	ENSG00000157851		0.567	DPYSL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DPYSL5	HGNC	protein_coding	OTTHUMT00000214187.2	-	0.00	57	0	G	NM_020134		27121411	+1	tier1	-	no_errors	ENST00000288699	ensembl	human	known	74_37	missense	7.41	50	4	SNP	1.000	T
DROSHA	29102	genome.wustl.edu	37	5	31409237	31409237	+	Silent	SNP	G	G	A			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr5:31409237G>A	ENST00000511367.2	-	32	4024	c.3780C>T	c.(3778-3780)gaC>gaT	p.D1260D	DROSHA_ENST00000344624.3_Silent_p.D1260D|DROSHA_ENST00000442743.1_Silent_p.D1223D|DROSHA_ENST00000513349.1_Silent_p.D1223D	NM_013235.4	NP_037367.3	Q9NRR4	RNC_HUMAN	drosha, ribonuclease type III	1260	DRBM.|Necessary for interaction with DGCR8 and pri-miRNA processing activity.				defense response to Gram-negative bacterium (GO:0050829)|defense response to Gram-positive bacterium (GO:0050830)|gene expression (GO:0010467)|miRNA metabolic process (GO:0010586)|pre-miRNA processing (GO:0031054)|primary miRNA processing (GO:0031053)|ribosome biogenesis (GO:0042254)|RNA phosphodiester bond hydrolysis (GO:0090501)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|rRNA catabolic process (GO:0016075)	nucleoplasm (GO:0005654)	lipopolysaccharide binding (GO:0001530)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|ribonuclease III activity (GO:0004525)			breast(4)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(19)|lung(33)|ovary(2)|skin(1)	66						GGGATTTGGGGTCATTCCAAT	0.438																																																	0													71.0	67.0	68.0					5																	31409237		1856	4112	5968	SO:0001819	synonymous_variant	0			AF116910	CCDS47194.1, CCDS47195.1	5q11.2	2010-11-17	2010-10-28	2010-10-28	ENSG00000113360	ENSG00000113360	3.1.26.3		17904	protein-coding gene	gene with protein product	"""drosha, ribonuclease type III"", ""drosha, double-stranded RNA-specific endoribonuclease"""	608828	"""ribonuclease type III, nuclear"""	RNASEN		10713462, 10948199	Standard	NM_013235		Approved	RNASE3L, Etohi2, HSA242976, RN3	uc003jhg.2	Q9NRR4	OTTHUMG00000161976	ENST00000511367.2:c.3780C>T	5.37:g.31409237G>A			E7EMP9|Q7Z5V2|Q86YH0|Q9NW73|Q9Y2V9|Q9Y4Y0	Silent	SNP	pfam_RNase_III_dom,pfam_dsRNA-bd_dom,superfamily_RNase_III_dom,smart_RNase_III_dom,smart_dsRNA-bd_dom,pfscan_dsRNA-bd_dom,pfscan_RNase_III_dom	p.D1260	ENST00000511367.2	37	c.3780	CCDS47195.1	5																																																																																			DROSHA	-	pfscan_dsRNA-bd_dom	ENSG00000113360		0.438	DROSHA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	DROSHA	HGNC	protein_coding	OTTHUMT00000366561.3	-	0.00	101	0	G	NM_013235		31409237	-1	tier1	-	no_errors	ENST00000344624	ensembl	human	known	74_37	silent	5.32	89	5	SNP	1.000	A
DSCAML1	57453	genome.wustl.edu	37	11	117352705	117352705	+	Silent	SNP	G	G	A			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr11:117352705G>A	ENST00000321322.6	-	12	2713	c.2712C>T	c.(2710-2712)aaC>aaT	p.N904N	DSCAML1_ENST00000527706.1_Silent_p.N634N	NM_020693.2	NP_065744.2	Q8TD84	DSCL1_HUMAN	Down syndrome cell adhesion molecule like 1	844	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axonogenesis (GO:0007409)|brain development (GO:0007420)|cell fate determination (GO:0001709)|central nervous system development (GO:0007417)|dendrite self-avoidance (GO:0070593)|dorsal/ventral pattern formation (GO:0009953)|embryonic skeletal system morphogenesis (GO:0048704)|homophilic cell adhesion (GO:0007156)|negative regulation of cell adhesion (GO:0007162)	cell surface (GO:0009986)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)			breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(24)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	110	all_hematologic(175;0.0487)	Breast(348;0.0424)|Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)		BRCA - Breast invasive adenocarcinoma(274;9.12e-06)|Epithelial(105;0.00172)		CCTCGTCGCCGTTGTCCTTGG	0.642																																																	0													149.0	103.0	119.0					11																	117352705		2201	4296	6497	SO:0001819	synonymous_variant	0				CCDS8384.1	11q22.2-q22.3	2013-02-11			ENSG00000177103	ENSG00000177103		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	14656	protein-coding gene	gene with protein product		611782				11453658	Standard	NM_020693		Approved	KIAA1132	uc001prh.1	Q8TD84	OTTHUMG00000167071	ENST00000321322.6:c.2712C>T	11.37:g.117352705G>A			Q76MU9|Q8IZY3|Q8IZY4|Q8WXU7|Q9ULT7	Silent	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.N904	ENST00000321322.6	37	c.2712	CCDS8384.1	11																																																																																			DSCAML1	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000177103		0.642	DSCAML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DSCAML1	HGNC	protein_coding	OTTHUMT00000392907.2	-	0.00	49	0	G	NM_020693		117352705	-1	tier1	-	no_errors	ENST00000321322	ensembl	human	known	74_37	silent	50.98	25	26	SNP	0.995	A
DUXA	503835	genome.wustl.edu	37	19	57672115	57672115	+	Nonsense_Mutation	SNP	G	G	A	rs144329847	byFrequency	TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr19:57672115G>A	ENST00000554048.2	-	2	75	c.76C>T	c.(76-78)Cag>Tag	p.Q26*		NM_001012729.1	NP_001012747.1	A6NLW8	DUXA_HUMAN	double homeobox A	26					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(9)|ovary(1)|upper_aerodigestive_tract(1)	17		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0822)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0123)		ATTTTCAACTGTTCTTCTGTG	0.343																																																	0													172.0	166.0	168.0					19																	57672115		2203	4300	6503	SO:0001587	stop_gained	0				CCDS33126.1	19q13.43	2012-10-04			ENSG00000258873	ENSG00000258873		"""Homeoboxes / PRD class"""	32179	protein-coding gene	gene with protein product		611168					Standard	NM_001012729		Approved		uc002qoa.1	A6NLW8	OTTHUMG00000170714	ENST00000554048.2:c.76C>T	19.37:g.57672115G>A	ENSP00000452398:p.Gln26*			Nonsense_Mutation	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom,prints_HTH_motif	p.Q26*	ENST00000554048.2	37	c.76	CCDS33126.1	19	.	.	.	.	.	.	.	.	.	.	G	15.41	2.825236	0.50739	.	.	ENSG00000258873	ENST00000554048	.	.	.	2.96	2.96	0.34315	.	0.000000	0.32204	N	0.006423	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-12.6496	9.6547	0.39919	0.0:0.0:1.0:0.0	.	.	.	.	X	26	.	ENSP00000365415:Q26X	Q	-	1	0	DUXA	62363927	0.408000	0.25360	0.019000	0.16419	0.715000	0.41141	2.198000	0.42705	1.965000	0.57142	0.561000	0.74099	CAG	DUXA	-	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom	ENSG00000258873		0.343	DUXA-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	DUXA	HGNC	protein_coding	OTTHUMT00000410075.3		0.00	79	0	G	NM_001012729		57672115	-1			no_errors	ENST00000554048	ensembl	human	known	74_37	nonsense	5.48	69	4	SNP	0.026	A
DYNC1H1	1778	genome.wustl.edu	37	14	102471558	102471558	+	Silent	SNP	G	G	T			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr14:102471558G>T	ENST00000360184.4	+	26	5582	c.5418G>T	c.(5416-5418)cgG>cgT	p.R1806R		NM_001376.4	NP_001367.2	Q14204	DYHC1_HUMAN	dynein, cytoplasmic 1, heavy chain 1	1806	Stem. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|cytoplasmic mRNA processing body assembly (GO:0033962)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic spindle organization (GO:0007052)|stress granule assembly (GO:0034063)|transport (GO:0006810)	centrosome (GO:0005813)|cytoplasmic dynein complex (GO:0005868)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|poly(A) RNA binding (GO:0044822)			NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(5)|cervix(1)|endometrium(21)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(28)|lung(60)|ovary(9)|pancreas(1)|prostate(6)|skin(7)|stomach(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	166						TCCGAAGGCGGAAGCTAGAAC	0.507																																																	0													99.0	74.0	82.0					14																	102471558		2203	4300	6503	SO:0001819	synonymous_variant	0			AB002323	CCDS9966.1	14q32.31	2006-12-21	2005-11-24	2005-11-24		ENSG00000197102		"""Cytoplasmic dyneins"""	2961	protein-coding gene	gene with protein product		600112	"""dynein, cytoplasmic, heavy polypeptide 1"""	DNECL, DNCL, DNCH1		16260502, 8666668	Standard	NM_001376		Approved	Dnchc1, HL-3, p22, DHC1	uc001yks.2	Q14204		ENST00000360184.4:c.5418G>T	14.37:g.102471558G>T			B0I1R0|Q6DKQ7|Q8WU28|Q92814|Q9Y4G5	Silent	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,superfamily_Thioredoxin-like_fold,superfamily_Glutathione-S-Trfase_C-like,smart_AAA+_ATPase	p.R1806	ENST00000360184.4	37	c.5418	CCDS9966.1	14																																																																																			DYNC1H1	-	NULL	ENSG00000197102		0.507	DYNC1H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DYNC1H1	HGNC	protein_coding	OTTHUMT00000414574.1	-	0.00	53	0	G	NM_001376		102471558	+1	tier1	-	no_errors	ENST00000360184	ensembl	human	known	74_37	silent	7.84	47	4	SNP	1.000	T
EFCAB1	79645	genome.wustl.edu	37	8	49647678	49647678	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr8:49647678G>T	ENST00000262103.3	-	1	113	c.33C>A	c.(31-33)gaC>gaA	p.D11E	EFCAB1_ENST00000433756.1_Missense_Mutation_p.D11E|EFCAB1_ENST00000521002.1_5'UTR|EFCAB1_ENST00000523092.1_Missense_Mutation_p.D11E	NM_024593.3	NP_078869.1	Q9HAE3	EFCB1_HUMAN	EF-hand calcium binding domain 1	11							calcium ion binding (GO:0005509)			endometrium(1)|large_intestine(3)|lung(6)|pancreas(1)|prostate(1)|urinary_tract(2)	14		all_epithelial(80;0.0134)|Lung NSC(129;0.0207)|all_lung(136;0.0464)				TGGTTAAGGTGTCCGTCAGCT	0.617																																																	0													192.0	173.0	179.0					8																	49647678		2203	4300	6503	SO:0001583	missense	0				CCDS6145.1, CCDS47853.1	8q11.21	2013-01-10			ENSG00000034239	ENSG00000034239		"""EF-hand domain containing"""	25678	protein-coding gene	gene with protein product						12477932	Standard	NM_024593		Approved	FLJ11767	uc003xqo.2	Q9HAE3	OTTHUMG00000164203	ENST00000262103.3:c.33C>A	8.37:g.49647678G>T	ENSP00000262103:p.Asp11Glu		B4DSB4|E7EVN7	Missense_Mutation	SNP	pfam_EF_hand_dom,smart_EF_hand_dom,pfscan_EF_hand_dom,prints_Recoverin	p.D11E	ENST00000262103.3	37	c.33	CCDS6145.1	8	.	.	.	.	.	.	.	.	.	.	G	1.251	-0.618622	0.03663	.	.	ENSG00000034239	ENST00000433756;ENST00000262103;ENST00000450553;ENST00000523092	T;T;T	0.71222	-0.55;-0.32;-0.55	5.04	1.94	0.25998	.	0.249076	0.46145	N	0.000304	T	0.35393	0.0930	N	0.01705	-0.755	0.40484	D	0.980471	B;B	0.12630	0.006;0.0	B;B	0.14578	0.011;0.0	T	0.38499	-0.9658	10	0.02654	T	1	.	8.7703	0.34728	0.0:0.1454:0.5551:0.2995	.	11;11	Q9HAE3-2;Q9HAE3	.;EFCB1_HUMAN	E	11	ENSP00000400873:D11E;ENSP00000262103:D11E;ENSP00000430765:D11E	ENSP00000262103:D11E	D	-	3	2	EFCAB1	49810231	0.973000	0.33851	0.999000	0.59377	0.397000	0.30659	-0.036000	0.12185	0.596000	0.29794	0.462000	0.41574	GAC	EFCAB1	-	NULL	ENSG00000034239		0.617	EFCAB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EFCAB1	HGNC	protein_coding	OTTHUMT00000377778.1	-	0.00	63	0	G	NM_024593		49647678	-1	tier1	-	no_errors	ENST00000262103	ensembl	human	known	74_37	missense	6.06	62	4	SNP	1.000	T
EFNB2	1948	genome.wustl.edu	37	13	107164913	107164913	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr13:107164913G>T	ENST00000245323.4	-	2	519	c.370C>A	c.(370-372)Cta>Ata	p.L124I		NM_004093.3	NP_004084.1	P52799	EFNB2_HUMAN	ephrin-B2	124	Ephrin RBD. {ECO:0000255|PROSITE- ProRule:PRU00884}.				anatomical structure morphogenesis (GO:0009653)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cell migration involved in sprouting angiogenesis (GO:0002042)|cell-cell signaling (GO:0007267)|ephrin receptor signaling pathway (GO:0048013)|lymph vessel development (GO:0001945)|negative regulation of keratinocyte proliferation (GO:0010839)|organ morphogenesis (GO:0009887)|positive regulation of cardiac muscle cell differentiation (GO:2000727)|regulation of chemotaxis (GO:0050920)|viral process (GO:0016032)	focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ephrin receptor binding (GO:0046875)			haematopoietic_and_lymphoid_tissue(2)|large_intestine(2)|lung(7)|ovary(1)|skin(1)	13	Lung NSC(43;0.015)|all_neural(89;0.0741)|Lung SC(71;0.14)|Medulloblastoma(90;0.169)					TGAAATTCTAGACCCCAGAGG	0.303																																																	0													94.0	92.0	93.0					13																	107164913		2203	4300	6503	SO:0001583	missense	0			L38734	CCDS9507.1	13q33	2011-03-09			ENSG00000125266	ENSG00000125266		"""Ephrins"""	3227	protein-coding gene	gene with protein product	"""HTK ligand"", ""ligand of eph-related kinase 5"", ""eph-related receptor tyrosine kinase ligand 5"""	600527		EPLG5		7833926	Standard	NM_004093		Approved	LERK5, Htk-L, HTKL, MGC126226, MGC126227, MGC126228	uc001vqi.3	P52799	OTTHUMG00000017324	ENST00000245323.4:c.370C>A	13.37:g.107164913G>T	ENSP00000245323:p.Leu124Ile		Q5JV56	Missense_Mutation	SNP	pfam_Ephrin,superfamily_Cupredoxin,prints_Ephrin	p.L124I	ENST00000245323.4	37	c.370	CCDS9507.1	13	.	.	.	.	.	.	.	.	.	.	G	14.47	2.543668	0.45280	.	.	ENSG00000125266	ENST00000245323	D	0.95205	-3.64	5.41	1.18	0.20946	Ephrin, conserved site (1);Cupredoxin (2);	0.000000	0.85682	D	0.000000	D	0.95928	0.8674	M	0.69358	2.11	0.58432	D	0.999999	B	0.32203	0.36	P	0.57468	0.821	D	0.92305	0.5853	10	0.31617	T	0.26	.	10.3121	0.43714	0.3307:0.0:0.6693:0.0	.	124	P52799	EFNB2_HUMAN	I	124	ENSP00000245323:L124I	ENSP00000245323:L124I	L	-	1	2	EFNB2	105962914	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.814000	0.55643	0.367000	0.24454	0.655000	0.94253	CTA	EFNB2	-	pfam_Ephrin,superfamily_Cupredoxin,prints_Ephrin	ENSG00000125266		0.303	EFNB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EFNB2	HGNC	protein_coding	OTTHUMT00000045733.4		0.00	78	0	G	NM_004093		107164913	-1			no_errors	ENST00000245323	ensembl	human	known	74_37	missense	5.00	76	4	SNP	1.000	T
EIF2B1	1967	genome.wustl.edu	37	12	124114969	124114969	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr12:124114969A>G	ENST00000424014.2	-	3	435	c.227T>C	c.(226-228)aTc>aCc	p.I76T	EIF2B1_ENST00000543940.1_5'UTR|EIF2B1_ENST00000537073.1_Missense_Mutation_p.I76T|EIF2B1_ENST00000539951.1_Missense_Mutation_p.I63T	NM_001414.3	NP_001405.1	Q14232	EI2BA_HUMAN	eukaryotic translation initiation factor 2B, subunit 1 alpha, 26kDa	76					cellular protein metabolic process (GO:0044267)|cellular response to stimulus (GO:0051716)|gene expression (GO:0010467)|negative regulation of translational initiation in response to stress (GO:0032057)|oligodendrocyte development (GO:0014003)|positive regulation of GTPase activity (GO:0043547)|regulation of translational initiation (GO:0006446)|response to glucose (GO:0009749)|response to heat (GO:0009408)|response to peptide hormone (GO:0043434)|translation (GO:0006412)|translational initiation (GO:0006413)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|eukaryotic translation initiation factor 2B complex (GO:0005851)|membrane (GO:0016020)|plasma membrane (GO:0005886)	enzyme regulator activity (GO:0030234)|GDP binding (GO:0019003)|GTP binding (GO:0005525)|translation initiation factor activity (GO:0003743)			breast(1)|kidney(3)|large_intestine(2)|lung(3)|urinary_tract(1)	10	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;6.67e-05)|Epithelial(86;0.000353)|all cancers(50;0.00489)		GGCAAGACTGATGAAGCGGAG	0.537																																																	0													84.0	66.0	72.0					12																	124114969		2203	4300	6503	SO:0001583	missense	0			X95648	CCDS31924.1	12q24.3	1998-10-16	2002-08-29		ENSG00000111361	ENSG00000111361			3257	protein-coding gene	gene with protein product		606686	"""eukaryotic translation initiation factor 2B, subunit 1 (alpha, 26kD)"""	EIF2B			Standard	NM_001414		Approved	EIF-2Balpha, EIF-2B, EIF2BA	uc001ufm.3	Q14232	OTTHUMG00000168696	ENST00000424014.2:c.227T>C	12.37:g.124114969A>G	ENSP00000416250:p.Ile76Thr		A6NLY9|B4DGX0|Q3SXP4	Missense_Mutation	SNP	pfam_IF-2B-related	p.I76T	ENST00000424014.2	37	c.227	CCDS31924.1	12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	24.6|24.6	4.543995|4.543995	0.86022|0.86022	.|.	.|.	ENSG00000111361|ENSG00000111361	ENST00000424014;ENST00000228958;ENST00000539951;ENST00000537073|ENST00000534960	D;D;D;D|.	0.92048|.	-2.96;-2.96;-2.96;-2.96|.	5.25|5.25	5.25|5.25	0.73442|0.73442	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.74688|0.74688	0.3749|0.3749	M|M	0.75447|0.75447	2.3|2.3	0.80722|0.80722	D|D	1|1	D;D;P|.	0.76494|.	0.999;0.998;0.638|.	D;D;D|.	0.91635|.	0.999;0.996;0.92|.	T|T	0.75780|0.75780	-0.3197|-0.3197	10|5	0.52906|.	T|.	0.07|.	-20.31|-20.31	15.1767|15.1767	0.72916|0.72916	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	76;63;76|.	B4DGX0;F5H0D0;Q14232|.	.;.;EI2BA_HUMAN|.	T|P	76;76;63;76|92	ENSP00000416250:I76T;ENSP00000228958:I76T;ENSP00000438060:I63T;ENSP00000444183:I76T|.	ENSP00000228958:I76T|.	I|S	-|-	2|1	0|0	EIF2B1|EIF2B1	122680922|122680922	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.915000|0.915000	0.54546|0.54546	9.170000|9.170000	0.94795|0.94795	1.991000|1.991000	0.58162|0.58162	0.379000|0.379000	0.24179|0.24179	ATC|TCA	EIF2B1	-	pfam_IF-2B-related	ENSG00000111361		0.537	EIF2B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EIF2B1	HGNC	protein_coding	OTTHUMT00000400628.1		0.00	54	0	A	NM_001414		124114969	-1			no_errors	ENST00000424014	ensembl	human	known	74_37	missense	5.00	57	3	SNP	1.000	G
EML2	24139	genome.wustl.edu	37	19	46124822	46124822	+	Silent	SNP	G	G	A	rs148351202		TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr19:46124822G>A	ENST00000245925.3	-	10	965	c.915C>T	c.(913-915)gaC>gaT	p.D305D	EML2_ENST00000536630.1_Silent_p.D452D|EML2_ENST00000586902.1_5'UTR|EML2_ENST00000589876.1_Silent_p.D305D|EML2_ENST00000587152.1_Silent_p.D506D	NM_012155.2	NP_036287.1	O95834	EMAL2_HUMAN	echinoderm microtubule associated protein like 2	305	Tandem atypical propeller in EMLs. {ECO:0000250}.				negative regulation of microtubule polymerization (GO:0031115)|regulation of microtubule nucleation (GO:0010968)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)	microtubule binding (GO:0008017)|tubulin binding (GO:0015631)	p.D305D(1)		NS(1)|breast(2)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(8)|lung(13)|ovary(1)|urinary_tract(1)	31		Ovarian(192;0.179)|all_neural(266;0.224)		OV - Ovarian serous cystadenocarcinoma(262;0.00553)|GBM - Glioblastoma multiforme(486;0.131)|Epithelial(262;0.197)		CCAGCGTCCCGTCCCGCAGGG	0.692																																																	1	Substitution - coding silent(1)	large_intestine(1)							,,	1,4405	2.1+/-5.4	0,1,2202	46.0	47.0	47.0		1518,1356,915	3.2	1.0	19	dbSNP_134	47	2,8594	2.2+/-6.3	0,2,4296	no	coding-synonymous,coding-synonymous,coding-synonymous	EML2	NM_001193268.1,NM_001193269.1,NM_012155.2	,,	0,3,6498	AA,AG,GG		0.0233,0.0227,0.0231	,,	506/851,452/797,305/650	46124822	3,12999	2203	4298	6501	SO:0001819	synonymous_variant	0			AF103939	CCDS12670.1, CCDS54280.1, CCDS59399.1	19q13.32	2013-01-10				ENSG00000125746		"""WD repeat domain containing"""	18035	protein-coding gene	gene with protein product	"""echinoderm MT-associated protein (EMAP)-like protein 70"", ""microtubule-associated protein like echinoderm EMAP"""					11694528, 10521658	Standard	NM_012155		Approved	EMAP2, ELP70, EMAP-2	uc010xxm.2	O95834		ENST00000245925.3:c.915C>T	19.37:g.46124822G>A			B7Z3I2|B7Z3Q9|K7ERL7|Q59EN8|Q8N5A2|Q9UG50	Silent	SNP	pfam_HELP,pfam_WD40_repeat,superfamily_Quinonprotein_ADH-like_supfam,superfamily_Quinoprot_gluc/sorb_DH,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.D506	ENST00000245925.3	37	c.1518	CCDS12670.1	19																																																																																			EML2	-	pfam_WD40_repeat,superfamily_Quinonprotein_ADH-like_supfam,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000125746		0.692	EML2-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	EML2	HGNC	protein_coding	OTTHUMT00000459608.1	-	0.00	110	0	G	NM_012155		46124822	-1	tier1	rs148351202	no_errors	ENST00000587152	ensembl	human	known	74_37	silent	37.25	64	38	SNP	1.000	A
XXbac-BPG154L12.4	0	genome.wustl.edu	37	6	32231726	32231727	+	RNA	INS	-	-	T	rs558617602|rs534644400|rs9281702	byFrequency	TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr6:32231726_32231727insT	ENST00000425033.1	+	0	1569_1570																											ttctttctttCTtttttttttt	0.307													|||unknown(HR)	1163	0.232228	0.2141	0.1225	5008	,	,		16538	0.2917		0.2286	False		,,,				2504	0.2771																0																																												0																															6.37:g.32231737_32231737dupT				RNA	INS	-	NULL	ENST00000425033.1	37	NULL		6																																																																																			XXbac-BPG154L12.4	-	-	ENSG00000225914		0.307	XXbac-BPG154L12.4-001	KNOWN	basic|exp_conf	antisense	ENSG00000225914	Clone_based_vega_gene	antisense	OTTHUMT00000316882.1		0.00	37	0	-			32231727	+1	tier1		no_errors	ENST00000425033	ensembl	human	known	74_37	rna	12.20	36	5	INS	0.372:0.374	T
RP13-492C18.2	0	genome.wustl.edu	37	7	56500213	56500213	+	RNA	DEL	T	T	-			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr7:56500213delT	ENST00000443198.1	-	0	338																											CCCATTGACCTTTTTCATGCT	0.294																																																	0																																												0																															7.37:g.56500213delT				RNA	DEL	-	NULL	ENST00000443198.1	37	NULL		7																																																																																			RP13-492C18.2	-	-	ENSG00000237268		0.294	RP13-492C18.2-002	KNOWN	basic	processed_transcript	ENSG00000237268	Clone_based_vega_gene	pseudogene	OTTHUMT00000343752.1		0.00	11	0	T			56500213	-1	tier1		no_errors	ENST00000443198	ensembl	human	known	74_37	rna	18.18	9	2	DEL	0.783	-
EXO5	64789	genome.wustl.edu	37	1	40981495	40981495	+	3'UTR	SNP	A	A	T			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr1:40981495A>T	ENST00000372703.1	+	0	2353				EXO5_ENST00000296380.4_3'UTR|RP11-656D10.6_ENST00000437060.1_RNA|EXO5_ENST00000358527.2_3'UTR|RP11-656D10.5_ENST00000453437.1_RNA			Q9H790	EXO5_HUMAN	exonuclease 5						DNA catabolic process, exonucleolytic (GO:0000738)|interstrand cross-link repair (GO:0036297)	cytosol (GO:0005829)|nucleus (GO:0005634)	4 iron, 4 sulfur cluster binding (GO:0051539)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|single-stranded DNA 3'-5' exodeoxyribonuclease activity (GO:0008310)|single-stranded DNA 5'-3' exodeoxyribonuclease activity (GO:0045145)										TCCAGGACCAAGGCTCAGGGA	0.448																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AK024797	CCDS453.1	1p34.2	2012-11-02	2012-10-30	2012-10-30	ENSG00000164002	ENSG00000164002			26115	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 176"", ""defects in morphology 1 homolog (S. cerevisiae)"""	C1orf176, DEM1		23095756	Standard	NM_022774		Approved	FLJ21144	uc001cfp.3	Q9H790	OTTHUMG00000007305	ENST00000372703.1:c.*157A>T	1.37:g.40981495A>T			D3DPV4|Q5SWM7|Q5SWM8|Q5SWM9|Q5SWN0|Q5SWN1|Q8WTW9	RNA	SNP	-	NULL	ENST00000372703.1	37	NULL	CCDS453.1	1																																																																																			RP11-656D10.6	-	-	ENSG00000238186		0.448	EXO5-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ENSG00000238186	Clone_based_vega_gene	protein_coding	OTTHUMT00000019087.1	-	0.00	47	0	A	NM_022774		40981495	-1	tier1	-	no_errors	ENST00000437060	ensembl	human	known	74_37	rna	14.29	18	3	SNP	0.002	T
RP11-725P16.2	0	genome.wustl.edu	37	2	133103794	133103794	+	lincRNA	SNP	C	C	T	rs4954311	byFrequency	TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr2:133103794C>T	ENST00000608279.1	-	0	1076																											ATCAAATAGTCTCATCTCTTA	0.323																																																	0																																												0																															2.37:g.133103794C>T				RNA	SNP	-	NULL	ENST00000608279.1	37	NULL		2																																																																																			RP11-725P16.2	-	-	ENSG00000272769		0.323	RP11-725P16.2-001	KNOWN	basic	lincRNA	ENSG00000272769	Clone_based_vega_gene	lincRNA	OTTHUMT00000472122.1	-	0.00	8	0	C			133103794	-1	tier1	rs4954311	no_errors	ENST00000608279	ensembl	human	known	74_37	rna	80.00	1	4	SNP	0.005	T
ERCC6	2074	genome.wustl.edu	37	10	50691461	50691461	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr10:50691461G>T	ENST00000355832.5	-	9	2001	c.1923C>A	c.(1921-1923)caC>caA	p.H641Q	ERCC6_ENST00000542458.1_Missense_Mutation_p.H11Q	NM_000124.2	NP_000115.1	Q03468	ERCC6_HUMAN	excision repair cross-complementation group 6	641	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				activation of JNKK activity (GO:0007256)|activation of JUN kinase activity (GO:0007257)|ATP catabolic process (GO:0006200)|base-excision repair (GO:0006284)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|multicellular organism growth (GO:0035264)|nucleotide-excision repair (GO:0006289)|photoreceptor cell maintenance (GO:0045494)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|positive regulation of protein tyrosine kinase activity (GO:0061098)|pyrimidine dimer repair (GO:0006290)|regulation of DNA-templated transcription, elongation (GO:0032784)|response to gamma radiation (GO:0010332)|response to oxidative stress (GO:0006979)|response to superoxide (GO:0000303)|response to toxic substance (GO:0009636)|response to UV (GO:0009411)|response to UV-B (GO:0010224)|response to X-ray (GO:0010165)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase II promoter (GO:0006366)|transcription-coupled nucleotide-excision repair (GO:0006283)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)|protein N-terminus binding (GO:0047485)|protein tyrosine kinase activator activity (GO:0030296)			breast(5)|central_nervous_system(1)|endometrium(6)|kidney(5)|large_intestine(15)|lung(19)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64						AGATCACATAGTGCCAGTCAT	0.408								Direct reversal of damage;Nucleotide excision repair (NER)																																									0													179.0	150.0	160.0					10																	50691461		2203	4300	6503	SO:0001583	missense	0			L04791	CCDS7229.1	10q11	2014-09-17	2014-03-07		ENSG00000225830	ENSG00000225830			3438	protein-coding gene	gene with protein product	"""Cockayne syndrome B protein"""	609413	"""excision repair cross-complementing rodent repair deficiency, complementation group 6"""	CKN2		1339317, 19179336	Standard	NM_000124		Approved	CSB, RAD26, ARMD5	uc001jhs.5	Q03468	OTTHUMG00000018195	ENST00000355832.5:c.1923C>A	10.37:g.50691461G>T	ENSP00000348089:p.His641Gln		D3DX94|Q5W0L9	Missense_Mutation	SNP	pfam_SNF2_N,pfam_Helicase_C,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.H641Q	ENST00000355832.5	37	c.1923	CCDS7229.1	10	.	.	.	.	.	.	.	.	.	.	G	15.12	2.738591	0.49045	.	.	ENSG00000225830	ENST00000355832;ENST00000374129;ENST00000542458	D;D	0.92647	-3.08;-3.08	5.5	2.41	0.29592	DEAD-like helicase (2);SNF2-related (1);	.	.	.	.	D	0.89774	0.6812	L	0.31804	0.96	0.53688	D	0.999973	P;B	0.51057	0.941;0.051	P;B	0.55577	0.779;0.262	D	0.85399	0.1130	9	0.36615	T	0.2	-19.6825	8.1549	0.31162	0.4316:0.0:0.5684:0.0	.	641;50	Q03468;Q59FF6	ERCC6_HUMAN;.	Q	641;50;11	ENSP00000348089:H641Q;ENSP00000445134:H11Q	ENSP00000348089:H641Q	H	-	3	2	ERCC6	50361467	1.000000	0.71417	0.997000	0.53966	0.974000	0.67602	1.632000	0.37102	0.318000	0.23185	-0.813000	0.03139	CAC	ERCC6	-	pfam_SNF2_N,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,pfscan_Helicase_ATP-bd	ENSG00000225830		0.408	ERCC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ERCC6	HGNC	protein_coding	OTTHUMT00000047990.1	-	0.00	97	0	G	NM_000124		50691461	-1	tier1	-	no_errors	ENST00000355832	ensembl	human	known	74_37	missense	42.00	58	42	SNP	1.000	T
ENTPD1	953	genome.wustl.edu	37	10	97607215	97607215	+	Nonsense_Mutation	SNP	G	G	T			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr10:97607215G>T	ENST00000371205.4	+	7	1109	c.826G>T	c.(826-828)Gaa>Taa	p.E276*	ENTPD1_ENST00000543964.1_Nonsense_Mutation_p.E168*|ENTPD1_ENST00000371207.3_Nonsense_Mutation_p.E288*|ENTPD1_ENST00000453258.2_Nonsense_Mutation_p.E283*|ENTPD1_ENST00000539125.1_Nonsense_Mutation_p.E138*|ENTPD1_ENST00000371203.5_Nonsense_Mutation_p.E138*|RP11-429G19.3_ENST00000433113.1_RNA|ENTPD1-AS1_ENST00000416301.1_RNA			P49961	ENTP1_HUMAN	ectonucleoside triphosphate diphosphohydrolase 1	276					ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell death (GO:0008219)|G-protein coupled receptor signaling pathway (GO:0007186)|platelet activation (GO:0030168)|purine ribonucleoside diphosphate catabolic process (GO:0009181)	basal lamina (GO:0005605)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|nucleoside-diphosphatase activity (GO:0017110)|nucleoside-triphosphatase activity (GO:0017111)			cervix(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(3)|prostate(1)|skin(1)	16		Colorectal(252;0.0821)		Epithelial(162;1.31e-07)|all cancers(201;5.33e-06)		TGCAAGTAATGAAATTCTCAG	0.408																																																	0													114.0	111.0	112.0					10																	97607215		2203	4300	6503	SO:0001587	stop_gained	0			S73813	CCDS7444.1, CCDS53556.1, CCDS53557.1, CCDS53558.1, CCDS41554.1	10q24.1	2014-03-03			ENSG00000138185	ENSG00000138185		"""CD molecules"""	3363	protein-coding gene	gene with protein product		601752		CD39		9226376, 24482476	Standard	NM_001098175		Approved	NTPDase-1, ATPDase, SPG64	uc010qoj.2	P49961	OTTHUMG00000018818	ENST00000371205.4:c.826G>T	10.37:g.97607215G>T	ENSP00000360248:p.Glu276*		A9Z1X8|B4DWB9|B4E1X1|B7Z599|G3XAF6|Q5T561|Q5T562|Q86VV3|Q9UQQ9|Q9Y3Q9	Nonsense_Mutation	SNP	pfam_GDA1_CD39_NTPase	p.E288*	ENST00000371205.4	37	c.862	CCDS7444.1	10	.	.	.	.	.	.	.	.	.	.	G	17.80	3.478523	0.63849	.	.	ENSG00000138185	ENST00000453258;ENST00000371207;ENST00000543964;ENST00000539125;ENST00000371203;ENST00000371205	.	.	.	5.77	3.92	0.45320	.	0.886155	0.10151	N	0.709652	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-1.5621	5.8763	0.18830	0.1598:0.0:0.6867:0.1535	.	.	.	.	X	283;288;168;138;138;276	.	ENSP00000360246:E138X	E	+	1	0	ENTPD1	97597205	0.003000	0.15002	0.001000	0.08648	0.003000	0.03518	1.022000	0.30052	0.905000	0.36596	0.650000	0.86243	GAA	ENTPD1	-	pfam_GDA1_CD39_NTPase	ENSG00000138185		0.408	ENTPD1-008	KNOWN	basic|appris_principal|CCDS	protein_coding	ENTPD1	HGNC	protein_coding	OTTHUMT00000049566.1	-	0.00	70	0	G	NM_001776		97607215	+1	tier1	-	no_errors	ENST00000371207	ensembl	human	known	74_37	nonsense	5.33	71	4	SNP	0.000	T
ERLEC1	27248	genome.wustl.edu	37	2	54040157	54040157	+	Silent	SNP	G	G	A			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr2:54040157G>A	ENST00000185150.4	+	11	1304	c.1173G>A	c.(1171-1173)aaG>aaA	p.K391K	ASB3_ENST00000406625.2_Intron|GPR75-ASB3_ENST00000352846.3_Intron|ERLEC1_ENST00000378239.5_Silent_p.K337K|ASB3_ENST00000498475.2_Intron|ERLEC1_ENST00000405123.3_Silent_p.K391K	NM_015701.4	NP_056516.2	Q96DZ1	ERLEC_HUMAN	endoplasmic reticulum lectin 1	391	PRKCSH 2.				ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)	endoplasmic reticulum lumen (GO:0005788)	glycoprotein binding (GO:0001948)			endometrium(2)|large_intestine(4)|lung(8)|ovary(2)|stomach(1)|urinary_tract(1)	18						AATGGGCTAAGAAGAATACTG	0.393																																																	0													114.0	107.0	109.0					2																	54040157		2203	4300	6503	SO:0001819	synonymous_variant	0			AF131849	CCDS1848.1, CCDS46283.1, CCDS46284.1	2p16	2010-03-19	2009-08-26	2009-08-26	ENSG00000068912	ENSG00000068912			25222	protein-coding gene	gene with protein product	"""erlectin 1"""	611229	"""chromosome 2 open reading frame 30"""	C2orf30		9110174, 8619474, 16531414, 18264092	Standard	NM_015701		Approved	CL25084, XTP3TPB, XTP3-B, ERLECTIN	uc002rxl.3	Q96DZ1	OTTHUMG00000129281	ENST00000185150.4:c.1173G>A	2.37:g.54040157G>A			B2RDB4|B5MC72|O95901|Q6UWN7|Q9NUY7|Q9UQL4	Silent	SNP	pfam_PRKCSH,superfamily_Man6P_isomerase_rcpt-bd_dom	p.K391	ENST00000185150.4	37	c.1173	CCDS1848.1	2																																																																																			ERLEC1	-	pfam_PRKCSH,superfamily_Man6P_isomerase_rcpt-bd_dom	ENSG00000068912		0.393	ERLEC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ERLEC1	HGNC	protein_coding	OTTHUMT00000251404.1	-	0.00	45	0	G	NM_015701		54040157	+1	tier1	-	no_errors	ENST00000185150	ensembl	human	known	74_37	silent	41.94	36	26	SNP	1.000	A
ERLIN1	10613	genome.wustl.edu	37	10	101912010	101912010	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr10:101912010C>T	ENST00000421367.2	-	11	3632	c.925G>A	c.(925-927)Gac>Aac	p.D309N	ERLIN1_ENST00000407654.3_Missense_Mutation_p.D309N	NM_001100626.1|NM_006459.3	NP_001094096.1|NP_006450.2	O75477	ERLN1_HUMAN	ER lipid raft associated 1	307					ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|protein complex (GO:0043234)							Colorectal(252;0.234)		Epithelial(162;3.85e-10)|all cancers(201;3.25e-08)		CATGAGGAGTCCACGAACATG	0.458																																																	0													123.0	119.0	120.0					10																	101912010		2203	4300	6503	SO:0001583	missense	0			AF064093	CCDS7487.2	10q24.31	2014-03-03	2007-01-26	2007-01-26	ENSG00000107566	ENSG00000107566			16947	protein-coding gene	gene with protein product	"""Band_7 23-211 Keo4 (Interim) similar to C.elegans protein C42C1.9"""	611604	"""chromosome 10 open reading frame 69"", ""SPFH domain family, member 1"""	C10orf69, SPFH1		11118313, 16835267, 24482476	Standard	NM_006459		Approved	KE04, Erlin-1, SPG62	uc001kqo.4	O75477	OTTHUMG00000018900	ENST00000421367.2:c.925G>A	10.37:g.101912010C>T	ENSP00000410964:p.Asp309Asn		B0QZ42|Q53HV0	Missense_Mutation	SNP	pfam_Band_7,smart_Band_7	p.D309N	ENST00000421367.2	37	c.925	CCDS7487.2	10	.	.	.	.	.	.	.	.	.	.	C	33	5.201392	0.94997	.	.	ENSG00000107566	ENST00000421367;ENST00000407654	T;T	0.66460	-0.21;-0.21	5.61	5.61	0.85477	.	0.240630	0.39544	U	0.001340	T	0.68229	0.2978	L	0.52573	1.65	0.80722	D	1	P;P	0.41313	0.745;0.745	P;P	0.44394	0.448;0.448	T	0.70256	-0.4922	10	0.59425	D	0.04	-10.4386	17.5007	0.87731	0.0:1.0:0.0:0.0	.	307;309	O75477;D3DR65	ERLN1_HUMAN;.	N	309	ENSP00000410964:D309N;ENSP00000384900:D309N	ENSP00000384900:D309N	D	-	1	0	ERLIN1	101902000	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	7.206000	0.77891	2.815000	0.96918	0.561000	0.74099	GAC	ERLIN1	-	NULL	ENSG00000107566		0.458	ERLIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ERLIN1	HGNC	protein_coding	OTTHUMT00000049840.2	-	0.00	96	0	C	NM_006459		101912010	-1	tier1	-	no_errors	ENST00000407654	ensembl	human	known	74_37	missense	5.33	70	4	SNP	1.000	T
EXT1	2131	genome.wustl.edu	37	8	118811971	118811971	+	Nonsense_Mutation	SNP	G	G	A			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr8:118811971G>A	ENST00000378204.2	-	11	3027	c.2221C>T	c.(2221-2223)Cga>Tga	p.R741*		NM_000127.2	NP_000118.2	Q16394	EXT1_HUMAN	exostosin glycosyltransferase 1	741					axon guidance (GO:0007411)|carbohydrate metabolic process (GO:0005975)|cellular polysaccharide biosynthetic process (GO:0033692)|embryonic skeletal joint development (GO:0072498)|endoderm development (GO:0007492)|gastrulation (GO:0007369)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparan sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process (GO:0015014)|mesoderm development (GO:0007498)|olfactory bulb development (GO:0021772)|ossification (GO:0001503)|protein glycosylation (GO:0006486)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)	acetylglucosaminyltransferase activity (GO:0008375)|glucuronosyl-N-acetylglucosaminyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase activity (GO:0050508)|glucuronosyltransferase activity (GO:0015020)|heparan sulfate N-acetylglucosaminyltransferase activity (GO:0042328)|N-acetylglucosaminyl-proteoglycan 4-beta-glucuronosyltransferase activity (GO:0050509)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|transferase activity, transferring glycosyl groups (GO:0016757)			breast(1)|endometrium(7)|kidney(1)|large_intestine(12)|lung(10)|ovary(3)|prostate(1)|stomach(1)|urinary_tract(2)	38	all_cancers(13;2.36e-26)|Lung NSC(37;5.02e-07)|Ovarian(258;0.0173)		STAD - Stomach adenocarcinoma(47;0.012)			TCAATGTCTCGGTATTTCTTC	0.537			"""Mis, N, F, S"""			"""exostoses, osteosarcoma"""			Langer-Giedion syndrome;Hereditary Multiple Exostoses																														yes	Rec		Multiple Exostoses Type 1	8	8q24.11-q24.13	2131	multiple exostoses type 1 gene		M	0													94.0	87.0	90.0					8																	118811971		2203	4300	6503	SO:0001587	stop_gained	0	Familial Cancer Database	Trichorhinophalangeal syndrome type 2, TRPS II;HME, Hereditary Exostoses, Multiple Osteochondromatosis, Multiple Cartilaginous Exostoses	S79639	CCDS6324.1	8q24.11	2014-09-17	2013-03-01		ENSG00000182197	ENSG00000182197	2.4.1.224, 2.4.1.225	"""Exostosin glycosyltransferase family"""	3512	protein-coding gene	gene with protein product	"""Glucuronosyl-N-acetylglucosaminyl-proteoglycan 4-alpha-N- acetylglucosaminyltransferase"", ""N-acetylglucosaminyl-proteoglycan 4-beta-glucuronosyltransferase"""	608177	"""Langer-Giedion syndrome chromosome region"", ""exostoses (multiple) 1"", ""exostosin 1"""	LGCR, LGS			Standard	NM_000127		Approved	ttv	uc003yok.1	Q16394	OTTHUMG00000059718	ENST00000378204.2:c.2221C>T	8.37:g.118811971G>A	ENSP00000367446:p.Arg741*		B2R7V2|Q9BVI9	Nonsense_Mutation	SNP	pfam_HexNAc_Trfase_a,pfam_Exostosin	p.R741*	ENST00000378204.2	37	c.2221	CCDS6324.1	8	.	.	.	.	.	.	.	.	.	.	G	45	11.835503	0.99608	.	.	ENSG00000182197	ENST00000378204	.	.	.	5.96	4.09	0.47781	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.52501	D	0.999951	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-3.8165	14.8809	0.70531	0.0:0.0:0.7303:0.2697	.	.	.	.	X	741	.	ENSP00000367446:R741X	R	-	1	2	EXT1	118881152	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.796000	0.62496	0.774000	0.33427	0.655000	0.94253	CGA	EXT1	-	NULL	ENSG00000182197		0.537	EXT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EXT1	HGNC	protein_coding	OTTHUMT00000132768.3	-	0.00	74	0	G	NM_000127		118811971	-1	tier1	-	no_errors	ENST00000378204	ensembl	human	known	74_37	nonsense	33.90	39	20	SNP	1.000	A
FAM134A	79137	genome.wustl.edu	37	2	220044907	220044907	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr2:220044907G>T	ENST00000430297.2	+	4	631	c.495G>T	c.(493-495)tgG>tgT	p.W165C	CNPPD1_ENST00000409789.1_5'Flank	NM_024293.4	NP_077269.3	Q8NC44	F134A_HUMAN	family with sequence similarity 134, member A	165						integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(9)|ovary(1)|prostate(2)	19		Renal(207;0.0915)		Epithelial(149;8.92e-07)|all cancers(144;0.000151)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		CTGAGAGCTGGCTCACCTTCC	0.582																																																	0													89.0	86.0	87.0					2																	220044907		2203	4300	6503	SO:0001583	missense	0			AK074983	CCDS2434.1	2q36.1	2008-02-05	2007-05-01	2007-05-01	ENSG00000144567	ENSG00000144567			28450	protein-coding gene	gene with protein product			"""chromosome 2 open reading frame 17"""	C2orf17			Standard	NM_024293		Approved	MGC3035	uc002vjw.4	Q8NC44	OTTHUMG00000154577	ENST00000430297.2:c.495G>T	2.37:g.220044907G>T	ENSP00000395249:p.Trp165Cys		Q6P1P5|Q9H0K7	Missense_Mutation	SNP	pfam_Reticulon	p.W165C	ENST00000430297.2	37	c.495	CCDS2434.1	2	.	.	.	.	.	.	.	.	.	.	G	20.4	3.978449	0.74360	.	.	ENSG00000144567	ENST00000430297	T	0.76060	-0.99	4.53	4.53	0.55603	.	0.123680	0.64402	D	0.000014	D	0.83834	0.5340	L	0.59436	1.845	0.80722	D	1	D	0.76494	0.999	D	0.72982	0.979	D	0.86032	0.1514	10	0.87932	D	0	-6.0165	17.4845	0.87683	0.0:0.0:1.0:0.0	.	165	Q8NC44	F134A_HUMAN	C	165	ENSP00000395249:W165C	ENSP00000395249:W165C	W	+	3	0	FAM134A	219753151	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.654000	0.61469	2.342000	0.79632	0.561000	0.74099	TGG	FAM134A	-	pfam_Reticulon	ENSG00000144567		0.582	FAM134A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM134A	HGNC	protein_coding	OTTHUMT00000336147.2		0.00	57	0	G	NM_024293		220044907	+1			no_errors	ENST00000430297	ensembl	human	known	74_37	missense	5.33	71	4	SNP	1.000	T
FAM184B	27146	genome.wustl.edu	37	4	17782820	17782820	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr4:17782820G>A	ENST00000265018.3	-	1	315	c.103C>T	c.(103-105)Cac>Tac	p.H35Y		NM_015688.1	NP_056503.1	Q9ULE4	F184B_HUMAN	family with sequence similarity 184, member B	35										NS(1)|central_nervous_system(1)|endometrium(1)|prostate(1)	4						ATTTTCACGTGCATCTGGGGA	0.642																																																	0													76.0	67.0	69.0					4																	17782820		692	1591	2283	SO:0001583	missense	0				CCDS47033.1	4p16	2009-04-22			ENSG00000047662	ENSG00000047662			29235	protein-coding gene	gene with protein product						10574462	Standard	NM_015688		Approved	KIAA1276	uc003gpm.4	Q9ULE4	OTTHUMG00000160287	ENST00000265018.3:c.103C>T	4.37:g.17782820G>A	ENSP00000265018:p.His35Tyr			Missense_Mutation	SNP	NULL	p.H35Y	ENST00000265018.3	37	c.103	CCDS47033.1	4	.	.	.	.	.	.	.	.	.	.	G	22.4	4.279292	0.80692	.	.	ENSG00000047662	ENST00000265018	T	0.77750	-1.12	4.58	4.58	0.56647	.	0.081184	0.46145	D	0.000317	D	0.85177	0.5637	M	0.63843	1.955	0.36356	D	0.860365	D	0.89917	1.0	D	0.80764	0.994	D	0.88976	0.3404	10	0.87932	D	0	-18.0748	12.7485	0.57296	0.0:0.0:1.0:0.0	.	35	Q9ULE4	F184B_HUMAN	Y	35	ENSP00000265018:H35Y	ENSP00000265018:H35Y	H	-	1	0	FAM184B	17391918	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.202000	0.65169	2.363000	0.80096	0.655000	0.94253	CAC	FAM184B	-	NULL	ENSG00000047662		0.642	FAM184B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM184B	HGNC	protein_coding	OTTHUMT00000360137.1		0.00	61	0	G	NM_015688		17782820	-1			no_errors	ENST00000265018	ensembl	human	known	74_37	missense	5.45	52	3	SNP	1.000	A
FAT1	2195	genome.wustl.edu	37	4	187554967	187554967	+	Silent	SNP	G	G	A			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr4:187554967G>A	ENST00000441802.2	-	7	4403	c.4194C>T	c.(4192-4194)taC>taT	p.Y1398Y		NM_005245.3	NP_005236.2	Q14517	FAT1_HUMAN	FAT atypical cadherin 1	1398	Cadherin 12. {ECO:0000255|PROSITE- ProRule:PRU00043}.				actin filament organization (GO:0007015)|anatomical structure morphogenesis (GO:0009653)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.Y1398Y(2)		NS(1)|breast(3)|central_nervous_system(3)|endometrium(38)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(33)|lung(88)|ovary(13)|pancreas(2)|prostate(16)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	228						AGTGACTGTCGTAGTTGCCAC	0.418										HNSCC(5;0.00058)																											Colon(197;1040 2055 4143 4984 49344)												2	Substitution - coding silent(2)	lung(2)											157.0	144.0	148.0					4																	187554967		1912	4126	6038	SO:0001819	synonymous_variant	0			X87241	CCDS47177.1	4q35.2	2013-05-31	2013-05-31	2008-10-30	ENSG00000083857	ENSG00000083857		"""Cadherins / Cadherin-related"""	3595	protein-coding gene	gene with protein product	"""cadherin-related family member 8"""	600976	"""FAT tumor suppressor (Drosophila) homolog"", ""FAT tumor suppressor homolog 1 (Drosophila)"""	FAT		8586420	Standard	XM_005262834		Approved	CDHF7, CDHR8	uc003izf.3	Q14517	OTTHUMG00000160320	ENST00000441802.2:c.4194C>T	4.37:g.187554967G>A				Silent	SNP	pfam_Cadherin,pfam_Laminin_G,pfam_EG-like_dom,pfam_EGF-like_Ca-bd_dom,superfamily_ConA-like_lec_gl_sf,superfamily_Cadherin-like,smart_Cadherin,smart_EG-like_dom,smart_Laminin_G,smart_EGF-like_Ca-bd_dom,prints_Cadherin,pfscan_EG-like_dom,pfscan_Laminin_G,pfscan_Cadherin	p.Y1398	ENST00000441802.2	37	c.4194	CCDS47177.1	4																																																																																			FAT1	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000083857		0.418	FAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAT1	HGNC	protein_coding	OTTHUMT00000360209.3		0.00	61	0	G	NM_005245		187554967	-1			no_errors	ENST00000441802	ensembl	human	known	74_37	silent	5.45	52	3	SNP	0.656	A
FBN2	2201	genome.wustl.edu	37	5	127614384	127614384	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr5:127614384T>C	ENST00000508053.1	-	63	8262	c.7288A>G	c.(7288-7290)Act>Gct	p.T2430A	FBN2_ENST00000262464.4_Missense_Mutation_p.T2430A			P35556	FBN2_HUMAN	fibrillin 2	2430	TB 9.				anatomical structure morphogenesis (GO:0009653)|bone trabecula formation (GO:0060346)|embryonic limb morphogenesis (GO:0030326)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|sequestering of TGFbeta in extracellular matrix (GO:0035583)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(37)|liver(1)|lung(89)|ovary(9)|pancreas(2)|prostate(6)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	197		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		TACTGGGCAGTTCCAGGAAGT	0.468																																																	0													112.0	105.0	107.0					5																	127614384		2203	4300	6503	SO:0001583	missense	0			U03272	CCDS34222.1	5q23-q31	2008-08-01	2008-08-01			ENSG00000138829			3604	protein-coding gene	gene with protein product	"""fibrillin 5"""	612570	"""congenital contractural arachnodactyly"""	CCA		1852206, 8120105	Standard	NM_001999		Approved	DA9	uc003kuu.3	P35556		ENST00000508053.1:c.7288A>G	5.37:g.127614384T>C	ENSP00000424571:p.Thr2430Ala		B4DU01|Q59ES6	Missense_Mutation	SNP	pirsf_FBN,pfam_EGF-like_Ca-bd_dom,pfam_EG-like_dom,pfam_TB_dom,superfamily_TB_dom,superfamily_Cadherin-like,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,pfscan_EG-like_dom	p.T2430A	ENST00000508053.1	37	c.7288	CCDS34222.1	5	.	.	.	.	.	.	.	.	.	.	T	27.6	4.844389	0.91197	.	.	ENSG00000138829	ENST00000262464;ENST00000508053	D;D	0.94280	-3.39;-3.39	4.84	4.84	0.62591	Matrix fibril-associated (3);TGF-beta binding (1);	0.000000	0.53938	D	0.000048	D	0.96451	0.8842	M	0.84773	2.715	0.52501	D	0.999954	D	0.57899	0.981	D	0.64321	0.924	D	0.96760	0.9560	10	0.56958	D	0.05	.	14.8763	0.70496	0.0:0.0:0.0:1.0	.	2430	P35556	FBN2_HUMAN	A	2430	ENSP00000262464:T2430A;ENSP00000424571:T2430A	ENSP00000262464:T2430A	T	-	1	0	FBN2	127642283	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	7.776000	0.85560	2.161000	0.67846	0.528000	0.53228	ACT	FBN2	-	pirsf_FBN,pfam_TB_dom,superfamily_TB_dom	ENSG00000138829		0.468	FBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBN2	HGNC	protein_coding	OTTHUMT00000371618.2	-	0.00	59	0	T	NM_001999		127614384	-1	tier1	-	no_errors	ENST00000262464	ensembl	human	known	74_37	missense	28.57	45	18	SNP	1.000	C
FBXW7	55294	genome.wustl.edu	37	4	153247174	153247175	+	Frame_Shift_Ins	INS	-	-	TATT			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr4:153247174_153247175insTATT	ENST00000281708.4	-	10	2856_2857	c.1627_1628insAATA	c.(1627-1629)agafs	p.R543fs	FBXW7_ENST00000393956.3_Frame_Shift_Ins_p.R367fs|FBXW7_ENST00000603841.1_Frame_Shift_Ins_p.R543fs|FBXW7_ENST00000603548.1_Frame_Shift_Ins_p.R543fs|FBXW7_ENST00000296555.5_Frame_Shift_Ins_p.R425fs|FBXW7_ENST00000263981.5_Frame_Shift_Ins_p.R463fs	NM_033632.3	NP_361014.1	Q969H0	FBXW7_HUMAN	F-box and WD repeat domain containing 7, E3 ubiquitin protein ligase	543					cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|lipid homeostasis (GO:0055088)|lung development (GO:0030324)|negative regulation of DNA endoreduplication (GO:0032876)|negative regulation of hepatocyte proliferation (GO:2000346)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of SREBP signaling pathway (GO:2000639)|negative regulation of triglyceride biosynthetic process (GO:0010868)|Notch signaling pathway (GO:0007219)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of oxidative stress-induced neuron intrinsic apoptotic signaling pathway (GO:1903378)|positive regulation of proteasomal protein catabolic process (GO:1901800)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|protein stabilization (GO:0050821)|protein ubiquitination (GO:0016567)|regulation of cell cycle G1/S phase transition (GO:1902806)|regulation of lipid storage (GO:0010883)|regulation of protein localization (GO:0032880)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|sister chromatid cohesion (GO:0007062)|vasculature development (GO:0001944)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Parkin-FBXW7-Cul1 ubiquitin ligase complex (GO:1990452)|protein complex (GO:0043234)|SCF ubiquitin ligase complex (GO:0019005)	cyclin binding (GO:0030332)|identical protein binding (GO:0042802)|protein binding, bridging (GO:0030674)|sequence-specific DNA binding transcription factor activity (GO:0003700)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activator activity (GO:0097027)	p.R543G(2)|p.R543K(1)|p.R463G(1)|p.?(1)|p.R304G(1)		NS(1)|biliary_tract(8)|bone(1)|breast(5)|central_nervous_system(6)|cervix(2)|endometrium(36)|haematopoietic_and_lymphoid_tissue(159)|kidney(6)|large_intestine(155)|lung(31)|ovary(10)|pancreas(3)|prostate(2)|skin(6)|stomach(16)|upper_aerodigestive_tract(9)|urinary_tract(6)	462	all_hematologic(180;0.093)	Acute lymphoblastic leukemia(8;0.000629)|all_hematologic(8;0.067)				TGAATAGACTCTATTAGTATGC	0.406			"""Mis, N, D, F"""		"""colorectal, endometrial, T-ALL"""																																			Rec	yes		4	4q31.3	55294	"""F-box and WD-40 domain protein 7 (archipelago homolog, Drosophila)"""		"""E, L"""	6	Substitution - Missense(5)|Unknown(1)	upper_aerodigestive_tract(4)|large_intestine(1)|haematopoietic_and_lymphoid_tissue(1)																																								SO:0001589	frameshift_variant	0			AF411971	CCDS3777.1, CCDS3778.1, CCDS34078.1, CCDS64082.1	4q31.23	2013-01-09	2012-02-23					"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	16712	protein-coding gene	gene with protein product	"""archipelago homolog (Drosophila)"""	606278	"""F-box and WD-40 domain protein 7 (archipelago homolog, Drosophila)"", ""F-box and WD repeat domain containing 7"""			10531037, 11425854	Standard	NM_018315		Approved	AGO, FLJ11071, SEL-10, SEL10, FBW7, FBX30, CDC4, FBXW6	uc003ims.3	Q969H0		ENST00000281708.4:c.1624_1627dupAATA	4.37:g.153247175_153247178dupTATT	ENSP00000281708:p.Arg543fs		B7ZLP9|Q68DR0|Q96A16|Q96LE0|Q96RI2|Q9NUX6	Frame_Shift_Ins	INS	pfam_WD40_repeat,pfam_F-box_dom,superfamily_WD40_repeat_dom,superfamily_F-box_dom,smart_F-box_dom,smart_WD40_repeat,pfscan_F-box_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.R543fs	ENST00000281708.4	37	c.1628_1627	CCDS3777.1	4																																																																																			FBXW7	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000109670		0.406	FBXW7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXW7	HGNC	protein_coding	OTTHUMT00000469956.1		0.00	98	0	-			153247175	-1	tier1		no_errors	ENST00000281708	ensembl	human	known	74_37	frame_shift_ins	23.53	65	20	INS	1.000:1.000	TATT
FBXW7	55294	genome.wustl.edu	37	4	153247289	153247289	+	Missense_Mutation	SNP	G	G	C	rs149680468		TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr4:153247289G>C	ENST00000281708.4	-	10	2742	c.1513C>G	c.(1513-1515)Cgc>Ggc	p.R505G	FBXW7_ENST00000393956.3_Missense_Mutation_p.R329G|FBXW7_ENST00000603841.1_Missense_Mutation_p.R505G|FBXW7_ENST00000603548.1_Missense_Mutation_p.R505G|FBXW7_ENST00000296555.5_Missense_Mutation_p.R387G|FBXW7_ENST00000263981.5_Missense_Mutation_p.R425G	NM_033632.3	NP_361014.1	Q969H0	FBXW7_HUMAN	F-box and WD repeat domain containing 7, E3 ubiquitin protein ligase	505			R -> L (in an ovarian cancer cell line). {ECO:0000269|PubMed:11565033, ECO:0000269|PubMed:16959974}.		cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|lipid homeostasis (GO:0055088)|lung development (GO:0030324)|negative regulation of DNA endoreduplication (GO:0032876)|negative regulation of hepatocyte proliferation (GO:2000346)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of SREBP signaling pathway (GO:2000639)|negative regulation of triglyceride biosynthetic process (GO:0010868)|Notch signaling pathway (GO:0007219)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of oxidative stress-induced neuron intrinsic apoptotic signaling pathway (GO:1903378)|positive regulation of proteasomal protein catabolic process (GO:1901800)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|protein stabilization (GO:0050821)|protein ubiquitination (GO:0016567)|regulation of cell cycle G1/S phase transition (GO:1902806)|regulation of lipid storage (GO:0010883)|regulation of protein localization (GO:0032880)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|sister chromatid cohesion (GO:0007062)|vasculature development (GO:0001944)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Parkin-FBXW7-Cul1 ubiquitin ligase complex (GO:1990452)|protein complex (GO:0043234)|SCF ubiquitin ligase complex (GO:0019005)	cyclin binding (GO:0030332)|identical protein binding (GO:0042802)|protein binding, bridging (GO:0030674)|sequence-specific DNA binding transcription factor activity (GO:0003700)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activator activity (GO:0097027)	p.R505C(60)|p.R505G(18)|p.R425C(14)|p.R266C(13)|p.R425G(9)|p.R266G(9)|p.R387G(6)|p.R387C(3)|p.R505S(3)|p.R387S(1)|p.?(1)|p.R425S(1)|p.R266S(1)		NS(1)|biliary_tract(8)|bone(1)|breast(5)|central_nervous_system(6)|cervix(2)|endometrium(36)|haematopoietic_and_lymphoid_tissue(159)|kidney(6)|large_intestine(155)|lung(31)|ovary(10)|pancreas(3)|prostate(2)|skin(6)|stomach(16)|upper_aerodigestive_tract(9)|urinary_tract(6)	462	all_hematologic(180;0.093)	Acute lymphoblastic leukemia(8;0.000629)|all_hematologic(8;0.067)				TGAACACAGCGGACTGCTGCA	0.468			"""Mis, N, D, F"""		"""colorectal, endometrial, T-ALL"""																																			Rec	yes		4	4q31.3	55294	"""F-box and WD-40 domain protein 7 (archipelago homolog, Drosophila)"""		"""E, L"""	139	Substitution - Missense(138)|Unknown(1)	haematopoietic_and_lymphoid_tissue(44)|large_intestine(26)|endometrium(20)|urinary_tract(15)|lung(15)|upper_aerodigestive_tract(8)|skin(8)|ovary(2)|biliary_tract(1)											167.0	156.0	160.0					4																	153247289		2203	4300	6503	SO:0001583	missense	0			AF411971	CCDS3777.1, CCDS3778.1, CCDS34078.1, CCDS64082.1	4q31.23	2013-01-09	2012-02-23					"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	16712	protein-coding gene	gene with protein product	"""archipelago homolog (Drosophila)"""	606278	"""F-box and WD-40 domain protein 7 (archipelago homolog, Drosophila)"", ""F-box and WD repeat domain containing 7"""			10531037, 11425854	Standard	NM_018315		Approved	AGO, FLJ11071, SEL-10, SEL10, FBW7, FBX30, CDC4, FBXW6	uc003ims.3	Q969H0		ENST00000281708.4:c.1513C>G	4.37:g.153247289G>C	ENSP00000281708:p.Arg505Gly		B7ZLP9|Q68DR0|Q96A16|Q96LE0|Q96RI2|Q9NUX6	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_F-box_dom,superfamily_WD40_repeat_dom,superfamily_F-box_dom,smart_F-box_dom,smart_WD40_repeat,pfscan_F-box_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.R505G	ENST00000281708.4	37	c.1513	CCDS3777.1	4	.	.	.	.	.	.	.	.	.	.	G	17.95	3.513685	0.64522	.	.	ENSG00000109670	ENST00000281708;ENST00000296555;ENST00000263981;ENST00000393956	T;T;T;T	0.62105	0.05;0.05;0.05;0.05	5.72	4.88	0.63580	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.101576	0.64402	D	0.000001	T	0.78679	0.4321	M	0.75085	2.285	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	T	0.81858	-0.0739	10	0.87932	D	0	-12.0024	15.0746	0.72066	0.0681:0.0:0.9319:0.0	.	329;505;387;425	B7Z2C8;Q969H0;Q969H0-4;Q969H0-2	.;FBXW7_HUMAN;.;.	G	505;387;425;329	ENSP00000281708:R505G;ENSP00000296555:R387G;ENSP00000263981:R425G;ENSP00000377528:R329G	ENSP00000263981:R425G	R	-	1	0	FBXW7	153466739	1.000000	0.71417	1.000000	0.80357	0.556000	0.35491	9.772000	0.98984	1.559000	0.49555	-0.145000	0.13849	CGC	FBXW7	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000109670		0.468	FBXW7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXW7	HGNC	protein_coding	OTTHUMT00000469956.1	-	0.00	59	0	G			153247289	-1	tier1	-	no_errors	ENST00000281708	ensembl	human	known	74_37	missense	51.61	30	32	SNP	1.000	C
LINC01567	400511	genome.wustl.edu	37	16	24674401	24674401	+	lincRNA	SNP	G	G	T			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr16:24674401G>T	ENST00000414816.1	-	0	1248																											GAGGCAAGCAGGGGCCTCTTT	0.453																																																	0													89.0	94.0	92.0					16																	24674401		692	1591	2283			0																															16.37:g.24674401G>T				RNA	SNP	-	NULL	ENST00000414816.1	37	NULL		16																																																																																			AC012317.1	-	-	ENSG00000224310		0.453	AC012317.1-001	KNOWN	basic	lincRNA	FLJ45256	Clone_based_vega_gene	lincRNA	OTTHUMT00000254547.2	-	0.00	46	0	G			24674401	-1	tier1	-	no_errors	ENST00000414816	ensembl	human	known	74_37	rna	18.75	13	3	SNP	0.000	T
FLT4	2324	genome.wustl.edu	37	5	180056281	180056281	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr5:180056281C>A	ENST00000261937.6	-	7	1041	c.963G>T	c.(961-963)gaG>gaT	p.E321D	FLT4_ENST00000393347.3_Missense_Mutation_p.E321D|FLT4_ENST00000424276.2_5'UTR|FLT4_ENST00000502649.1_Missense_Mutation_p.E321D	NM_182925.4	NP_891555.2	P35916	VGFR3_HUMAN	fms-related tyrosine kinase 4	321	Ig-like C2-type 3.				blood vessel morphogenesis (GO:0048514)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|lymph vessel development (GO:0001945)|lymphangiogenesis (GO:0001946)|negative regulation of apoptotic process (GO:0043066)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of JNK cascade (GO:0046330)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of protein kinase C signaling (GO:0090037)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation vascular endothelial growth factor production (GO:0010575)|protein autophosphorylation (GO:0046777)|regulation of blood vessel remodeling (GO:0060312)|sprouting angiogenesis (GO:0002040)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|vascular endothelial growth factor signaling pathway (GO:0038084)|vasculature development (GO:0001944)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|protein phosphatase binding (GO:0019903)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor-activated receptor activity (GO:0005021)	p.E321D(2)		NS(1)|breast(3)|central_nervous_system(2)|endometrium(1)|kidney(6)|large_intestine(5)|liver(2)|lung(37)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_cancers(89;2.21e-05)|all_epithelial(37;5.29e-06)|Renal(175;0.000159)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.114)	all_cancers(40;0.00245)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_hematologic(541;0.163)|Ovarian(839;0.238)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.134)	Axitinib(DB06626)|Pazopanib(DB06589)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	CCTCGGTGCTCTCCCGAAATC	0.602																																					Colon(97;1075 1466 27033 27547 35871)												2	Substitution - Missense(2)	breast(2)											168.0	149.0	155.0					5																	180056281		2202	4299	6501	SO:0001583	missense	0			X68203	CCDS4457.1, CCDS43412.1	5q34-q35	2013-01-29			ENSG00000037280	ENSG00000037280	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3767	protein-coding gene	gene with protein product		136352				1319394	Standard	NM_002020		Approved	VEGFR3, PCL	uc003mlz.4	P35916	OTTHUMG00000130931	ENST00000261937.6:c.963G>T	5.37:g.180056281C>A	ENSP00000261937:p.Glu321Asp		A8K6L4|B5A926|Q16067|Q86W07|Q86W08	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_Ig_I-set,superfamily_Kinase-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom,prints_VEGFR3_rcpt	p.E321D	ENST00000261937.6	37	c.963	CCDS4457.1	5	.	.	.	.	.	.	.	.	.	.	C	2.103	-0.405623	0.04832	.	.	ENSG00000037280	ENST00000261937;ENST00000393347;ENST00000502649;ENST00000376868	T;T;T	0.67523	-0.27;-0.27;-0.27	4.91	0.782	0.18567	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.50188	0.1601	L	0.35341	1.055	0.36088	D	0.843246	B;B;B	0.16166	0.016;0.0;0.0	B;B;B	0.15484	0.013;0.005;0.005	T	0.43180	-0.9407	9	0.15066	T	0.55	.	10.847	0.46748	0.0:0.4023:0.5234:0.0742	.	321;321;321	P35916-3;E9PD35;P35916	.;.;VGFR3_HUMAN	D	321;321;321;131	ENSP00000261937:E321D;ENSP00000377016:E321D;ENSP00000426057:E321D	ENSP00000261937:E321D	E	-	3	2	FLT4	179988887	1.000000	0.71417	0.997000	0.53966	0.198000	0.23893	0.592000	0.23984	-0.075000	0.12798	-0.264000	0.10439	GAG	FLT4	-	pfam_Ig_I-set,smart_Ig_sub,pfscan_Ig-like_dom	ENSG00000037280		0.602	FLT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLT4	HGNC	protein_coding	OTTHUMT00000253527.4		0.00	40	0	C			180056281	-1			no_errors	ENST00000261937	ensembl	human	known	74_37	missense	5.56	34	2	SNP	0.997	A
FMN2	56776	genome.wustl.edu	37	1	240370709	240370709	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr1:240370709C>T	ENST00000319653.9	+	5	2827	c.2597C>T	c.(2596-2598)tCc>tTc	p.S866F		NM_020066.4	NP_064450.3	Q9NZ56	FMN2_HUMAN	formin 2	866	FH1.|Pro-rich.				cellular response to DNA damage stimulus (GO:0006974)|cellular response to hypoxia (GO:0071456)|establishment of meiotic spindle localization (GO:0051295)|formin-nucleated actin cable assembly (GO:0070649)|homologous chromosome movement towards spindle pole involved in homologous chromosome segregation (GO:0051758)|intracellular signal transduction (GO:0035556)|intracellular transport (GO:0046907)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein catabolic process (GO:0042177)|oogenesis (GO:0048477)|polar body extrusion after meiotic divisions (GO:0040038)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cell cortex (GO:0005938)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|microvillus (GO:0005902)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|spindle (GO:0005819)	actin binding (GO:0003779)			NS(1)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(13)|lung(87)|ovary(6)|pancreas(3)|prostate(12)|skin(7)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(2)	178	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)			TGCACAGAGTCCTCCAGCTCC	0.562																																																	0													104.0	100.0	101.0					1																	240370709		2203	4300	6503	SO:0001583	missense	0			AF218942	CCDS31069.2	1q43	2008-02-05			ENSG00000155816	ENSG00000155816			14074	protein-coding gene	gene with protein product		606373				10781961	Standard	NM_020066		Approved		uc010pyd.2	Q9NZ56	OTTHUMG00000039883	ENST00000319653.9:c.2597C>T	1.37:g.240370709C>T	ENSP00000318884:p.Ser866Phe		B0QZA7|B4DP05|Q59GF6|Q5VU37|Q9NZ55	Missense_Mutation	SNP	pfam_FH2_Formin,pfam_Formin_homology_1,smart_FH2_Formin,pfscan_DEP_dom	p.S866F	ENST00000319653.9	37	c.2597	CCDS31069.2	1	.	.	.	.	.	.	.	.	.	.	C	1.726	-0.495383	0.04291	.	.	ENSG00000155816	ENST00000319653	T	0.28666	1.6	3.32	2.4	0.29515	Actin-binding FH2/DRF autoregulatory (1);	1.039030	0.07636	N	0.929441	T	0.19725	0.0474	L	0.29908	0.895	0.09310	N	1	B	0.09022	0.002	B	0.06405	0.002	T	0.27502	-1.0072	9	.	.	.	.	3.2332	0.06756	0.226:0.5476:0.0:0.2264	.	866	Q9NZ56	FMN2_HUMAN	F	866	ENSP00000318884:S866F	.	S	+	2	0	FMN2	238437332	0.000000	0.05858	0.628000	0.29241	0.364000	0.29643	0.532000	0.23067	0.972000	0.38314	0.484000	0.47621	TCC	FMN2	-	smart_FH2_Formin	ENSG00000155816		0.562	FMN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FMN2	HGNC	protein_coding	OTTHUMT00000096217.2	-	0.00	53	0	C	XM_371352		240370709	+1	tier1	-	no_errors	ENST00000319653	ensembl	human	known	74_37	missense	32.79	41	20	SNP	0.000	T
FNBP1	23048	genome.wustl.edu	37	9	132662716	132662716	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr9:132662716C>A	ENST00000446176.2	-	14	1725	c.1539G>T	c.(1537-1539)caG>caT	p.Q513H	FNBP1_ENST00000420781.1_Missense_Mutation_p.Q504H|FNBP1_ENST00000355681.3_Missense_Mutation_p.Q484H|FNBP1_ENST00000443566.2_Missense_Mutation_p.Q141H|FNBP1_ENST00000478129.1_5'UTR	NM_015033.2	NP_055848.1	Q96RU3	FNBP1_HUMAN	formin binding protein 1	513	Interaction with PDE6G. {ECO:0000250}.|Interaction with RND2. {ECO:0000250}.|Required for self-association and induction of membrane tubulation.				endocytosis (GO:0006897)	coated pit (GO:0005905)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|lysosome (GO:0005764)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)|lipid binding (GO:0008289)						Ovarian(14;0.000536)		GBM - Glioblastoma multiforme(294;0.0378)		TCTCACGGTCCTGGGCGCAGT	0.567			T	MLL	AML																																			Dom	yes		9	9q23	23048	formin binding protein 1 (FBP17)		L	0													43.0	48.0	46.0					9																	132662716		2024	4178	6202	SO:0001583	missense	0			AB011126	CCDS48040.1	9q34	2008-02-05			ENSG00000187239	ENSG00000187239			17069	protein-coding gene	gene with protein product		606191				9628581, 11438682	Standard	XM_005251815		Approved	FBP17, KIAA0554	uc004byw.1	Q96RU3	OTTHUMG00000020800	ENST00000446176.2:c.1539G>T	9.37:g.132662716C>A	ENSP00000413625:p.Gln513His		O60301|Q3MIN8|Q5TC87|Q5TC88|Q6P658|Q7LGG2|Q9H8H8|Q9NWD1	Missense_Mutation	SNP	pfam_FCH_dom,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,superfamily_Ribosomal_S20,superfamily_HR1_rho-bd,smart_FCH_dom,smart_SH3_domain,pfscan_FCH_dom,pfscan_SH3_domain	p.Q513H	ENST00000446176.2	37	c.1539	CCDS48040.1	9	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	10.97|10.97	1.501236|1.501236	0.26861|0.26861	.|.	.|.	ENSG00000187239|ENSG00000187239	ENST00000372416;ENST00000446176;ENST00000420781;ENST00000372415;ENST00000443566;ENST00000355681|ENST00000449089	T;T;T;T|.	0.73897|.	-0.79;-0.79;-0.79;-0.79|.	4.24|4.24	-0.917|-0.917	0.10485|0.10485	.|.	0.465551|.	0.22985|.	N|.	0.053277|.	T|T	0.52725|0.52725	0.1752|0.1752	L|L	0.48986|0.48986	1.54|1.54	0.46901|0.46901	D|D	0.99924|0.99924	P;P;P;B;P;P;P;P|.	0.44429|.	0.626;0.74;0.835;0.272;0.739;0.74;0.742;0.626|.	B;B;P;B;P;B;P;B|.	0.52710|.	0.289;0.396;0.707;0.308;0.605;0.289;0.482;0.289|.	T|T	0.43540|0.43540	-0.9385|-0.9385	10|5	0.36615|.	T|.	0.2|.	-34.0939|-34.0939	7.0655|7.0655	0.25149|0.25149	0.0:0.6559:0.1297:0.2144|0.0:0.6559:0.1297:0.2144	.|.	508;503;141;447;484;464;508;513|.	B7ZL12;B7ZL13;E7EPB7;B7ZL14;Q96RU3-3;Q5QP69;Q96RU3-2;Q96RU3|.	.;.;.;.;.;.;.;FNBP1_HUMAN|.	H|M	513;513;504;513;141;484|465	ENSP00000413625:Q513H;ENSP00000407548:Q504H;ENSP00000389117:Q141H;ENSP00000347907:Q484H|.	ENSP00000347907:Q484H|.	Q|R	-|-	3|2	2|0	FNBP1|FNBP1	131702537|131702537	1.000000|1.000000	0.71417|0.71417	0.901000|0.901000	0.35422|0.35422	0.298000|0.298000	0.27526|0.27526	0.728000|0.728000	0.26013|0.26013	-0.206000|-0.206000	0.10203|0.10203	0.313000|0.313000	0.20887|0.20887	CAG|AGG	FNBP1	-	NULL	ENSG00000187239		0.567	FNBP1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	FNBP1	HGNC	protein_coding	OTTHUMT00000054630.2	-	0.00	68	0	C			132662716	-1	tier1	-	no_errors	ENST00000446176	ensembl	human	known	74_37	missense	5.56	67	4	SNP	1.000	A
GALNT15	117248	genome.wustl.edu	37	3	16254213	16254213	+	Silent	SNP	G	G	T			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr3:16254213G>T	ENST00000339732.5	+	6	1838	c.1335G>T	c.(1333-1335)ctG>ctT	p.L445L	GALNT15_ENST00000437509.1_Silent_p.L445L	NM_054110.4	NP_473451.3	Q8N3T1	GLT15_HUMAN	polypeptide N-acetylgalactosaminyltransferase 15	445					cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|transport vesicle (GO:0030133)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)										AGACCTGGCTGGGGTCATTCA	0.562																																																	0													101.0	100.0	100.0					3																	16254213		2203	4300	6503	SO:0001819	synonymous_variant	0			AY358443	CCDS33711.1	3p25.1	2014-03-13	2014-03-13	2013-01-25	ENSG00000131386	ENSG00000131386	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	21531	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 15"""	615131	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 2"", ""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 15"""	GALNTL2		12975309, 14702039, 15147861	Standard	NM_054110		Approved	GALNT7, pp-GalNAc-T15	uc003car.4	Q8N3T1	OTTHUMG00000156893	ENST00000339732.5:c.1335G>T	3.37:g.16254213G>T			A6NMN1|B2R638|F1LIP6|Q86T60|Q96C46|Q96DJ5	Silent	SNP	pfam_Glyco_trans_2,pfam_Ricin_B_lectin,superfamily_Ricin_B_lectin,smart_Ricin_B_lectin,pfscan_Ricin_B_lectin	p.L445	ENST00000339732.5	37	c.1335	CCDS33711.1	3																																																																																			GALNT15	-	NULL	ENSG00000131386		0.562	GALNT15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GALNT15	HGNC	protein_coding	OTTHUMT00000346483.2		0.00	50	0	G	NM_054110		16254213	+1			no_errors	ENST00000339732	ensembl	human	known	74_37	silent	6.25	30	2	SNP	1.000	T
GBP7	388646	genome.wustl.edu	37	1	89599004	89599004	+	Missense_Mutation	SNP	C	C	G	rs571294599	byFrequency	TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr1:89599004C>G	ENST00000294671.2	-	10	1737	c.1599G>C	c.(1597-1599)aaG>aaC	p.K533N		NM_207398.2	NP_997281.2	Q8N8V2	GBP7_HUMAN	guanylate binding protein 7	533						membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(9)|lung(5)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	27		Lung NSC(277;0.0908)		all cancers(265;0.00835)|Epithelial(280;0.0322)		CCCTCTCCATCTTCTTCTTGA	0.443																																																	0													300.0	273.0	282.0					1																	89599004		2202	4300	6502	SO:0001583	missense	0			AK096141	CCDS720.1	1p22.2	2008-02-05			ENSG00000213512	ENSG00000213512			29606	protein-coding gene	gene with protein product		612468					Standard	NM_207398		Approved	FLJ38822, GBP4L	uc001dna.2	Q8N8V2	OTTHUMG00000010659	ENST00000294671.2:c.1599G>C	1.37:g.89599004C>G	ENSP00000294671:p.Lys533Asn			Missense_Mutation	SNP	pfam_Guanylate-bd_N,pfam_Guanylate-bd_C,superfamily_Guanylate-bd_C,superfamily_P-loop_NTPase	p.K533N	ENST00000294671.2	37	c.1599	CCDS720.1	1	.	.	.	.	.	.	.	.	.	.	C	12.26	1.885880	0.33348	.	.	ENSG00000213512	ENST00000294671	T	0.02944	4.1	3.6	-0.697	0.11284	Guanylate-binding protein, C-terminal (3);	0.283896	0.35495	N	0.003170	T	0.07007	0.0178	M	0.93283	3.4	0.09310	N	1	D	0.89917	1.0	D	0.85130	0.997	T	0.04723	-1.0931	10	0.62326	D	0.03	.	3.6926	0.08351	0.0:0.4693:0.1879:0.3428	.	533	Q8N8V2	GBP7_HUMAN	N	533	ENSP00000294671:K533N	ENSP00000294671:K533N	K	-	3	2	GBP7	89371592	0.140000	0.22579	0.003000	0.11579	0.028000	0.11728	0.848000	0.27710	-0.248000	0.09583	-0.229000	0.12294	AAG	GBP7	-	pfam_Guanylate-bd_C,superfamily_Guanylate-bd_C	ENSG00000213512		0.443	GBP7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GBP7	HGNC	protein_coding	OTTHUMT00000029401.1	-	0.00	77	0	C	NM_207398		89599004	-1	tier1	-	no_errors	ENST00000294671	ensembl	human	known	74_37	missense	34.48	38	20	SNP	0.012	G
GCG	2641	genome.wustl.edu	37	2	163000642	163000642	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr2:163000642C>T	ENST00000418842.2	-	5	685	c.431G>A	c.(430-432)cGc>cAc	p.R144H	GCG_ENST00000375497.3_Missense_Mutation_p.R144H	NM_002054.4	NP_002045.1	P01275	GLUC_HUMAN	glucagon	144					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cell proliferation (GO:0008283)|cellular protein metabolic process (GO:0044267)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|feeding behavior (GO:0007631)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of apoptotic process (GO:0043066)|negative regulation of execution phase of apoptosis (GO:1900118)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|positive regulation of calcium ion import (GO:0090280)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of gluconeogenesis (GO:0045722)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0035774)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of protein binding (GO:0032092)|positive regulation of protein kinase activity (GO:0045860)|protein kinase A signaling (GO:0010737)|regulation of insulin secretion (GO:0050796)|response to starvation (GO:0042594)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)|secretory granule lumen (GO:0034774)	glucagon receptor binding (GO:0031769)|hormone activity (GO:0005179)|identical protein binding (GO:0042802)|receptor binding (GO:0005102)			breast(1)|central_nervous_system(1)|large_intestine(3)|lung(9)	14						AGCATGTCTGCGGCCAAGTTC	0.373																																																	0													115.0	111.0	112.0					2																	163000642		1899	4123	6022	SO:0001583	missense	0				CCDS46439.1	2q36-q37	2013-02-26			ENSG00000115263	ENSG00000115263		"""Endogenous ligands"""	4191	protein-coding gene	gene with protein product	"""glicentin-related polypeptide"", ""glucagon-like peptide 1"", ""glucagon-like peptide 2"", ""preproglucagon"""	138030				2753890, 3725587	Standard	NM_002054		Approved	GLP1, GLP2, GRPP	uc002ucc.4	P01275	OTTHUMG00000153892	ENST00000418842.2:c.431G>A	2.37:g.163000642C>T	ENSP00000387662:p.Arg144His		A6NN65|Q53TP6	Missense_Mutation	SNP	pfam_Glucagon_GIP_secretin_VIP,smart_Glucagon_GIP_secretin_VIP,prints_Glucagon_GIP_secretin_VIP	p.R144H	ENST00000418842.2	37	c.431	CCDS46439.1	2	.	.	.	.	.	.	.	.	.	.	C	32	5.133765	0.94517	.	.	ENSG00000115263	ENST00000418842;ENST00000375497	T;T	0.55234	0.53;0.53	5.75	5.75	0.90469	.	0.000000	0.64402	D	0.000003	T	0.76912	0.4054	M	0.84846	2.72	0.47276	D	0.999371	D	0.89917	1.0	D	0.76575	0.988	T	0.79899	-0.1608	10	0.87932	D	0	-19.9316	18.9257	0.92544	0.0:1.0:0.0:0.0	.	144	P01275	GLUC_HUMAN	H	144	ENSP00000387662:R144H;ENSP00000364647:R144H	ENSP00000364647:R144H	R	-	2	0	GCG	162708888	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.502000	0.53332	2.717000	0.92951	0.650000	0.86243	CGC	GCG	-	NULL	ENSG00000115263		0.373	GCG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GCG	HGNC	protein_coding	OTTHUMT00000332860.1	-	0.00	43	0	C	NM_002054		163000642	-1	tier1	-	no_errors	ENST00000375497	ensembl	human	known	74_37	missense	26.09	17	6	SNP	1.000	T
GDF11	10220	genome.wustl.edu	37	12	56142370	56142370	+	Splice_Site	SNP	C	C	T			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr12:56142370C>T	ENST00000257868.5	+	2	483	c.446C>T	c.(445-447)aCg>aTg	p.T149M		NM_005811.3	NP_005802.1	O95390	GDF11_HUMAN	growth differentiation factor 11	149					camera-type eye morphogenesis (GO:0048593)|cell maturation (GO:0048469)|growth (GO:0040007)|mesoderm development (GO:0007498)|metanephros development (GO:0001656)|negative regulation of cell differentiation (GO:0045596)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|palate development (GO:0060021)|pancreas development (GO:0031016)|skeletal system development (GO:0001501)|spinal cord anterior/posterior patterning (GO:0021512)|ureteric bud development (GO:0001657)	extracellular space (GO:0005615)|protein complex (GO:0043234)		p.T149M(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(1)|ovary(2)|prostate(1)|urinary_tract(1)	12						CTCTTATCAGCGGACCCAGCA	0.527																																																	1	Substitution - Missense(1)	endometrium(1)											141.0	147.0	145.0					12																	56142370		2203	4300	6503	SO:0001630	splice_region_variant	0			AF100907	CCDS8891.1	12q13.13	2008-08-01							4216	protein-coding gene	gene with protein product		603936				15988002	Standard	NM_005811		Approved	BMP-11	uc001shq.3	O95390		ENST00000257868.5:c.446-1C>T	12.37:g.56142370C>T			Q9UID1|Q9UID2	Missense_Mutation	SNP	pfam_TGF-b_N,pfam_TGF-b_C,smart_TGF-b_C	p.T149M	ENST00000257868.5	37	c.446	CCDS8891.1	12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	19.01|19.01	3.743542|3.743542	0.69418|0.69418	.|.	.|.	ENSG00000135414|ENSG00000135414	ENST00000546799|ENST00000257868	.|T	.|0.66280	.|-0.2	4.86|4.86	4.86|4.86	0.63082|0.63082	.|Transforming growth factor-beta, N-terminal (1);	.|0.135895	.|0.48286	.|D	.|0.000185	T|T	0.54967|0.54967	0.1891|0.1891	N|N	0.14661|0.14661	0.345|0.345	0.46185|0.46185	D|D	0.998918|0.998918	.|P	.|0.51057	.|0.941	.|P	.|0.51324	.|0.666	T|T	0.54043|0.54043	-0.8352|-0.8352	5|9	.|.	.|.	.|.	.|.	15.8533|15.8533	0.78952|0.78952	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|149	.|O95390	.|GDF11_HUMAN	W|M	122|149	.|ENSP00000257868:T149M	.|.	R|T	+|+	1|2	2|0	GDF11|GDF11	54428637|54428637	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.962000|0.962000	0.63368|0.63368	5.990000|5.990000	0.70595|0.70595	2.438000|2.438000	0.82558|0.82558	0.555000|0.555000	0.69702|0.69702	CGG|ACG	GDF11	-	pfam_TGF-b_N	ENSG00000135414		0.527	GDF11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GDF11	HGNC	protein_coding	OTTHUMT00000407842.3		0.00	55	0	C		Missense_Mutation	56142370	+1			no_errors	ENST00000257868	ensembl	human	known	74_37	missense	6.06	62	4	SNP	1.000	T
GHSR	2693	genome.wustl.edu	37	3	172165753	172165753	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr3:172165753C>T	ENST00000241256.2	-	1	493	c.451G>A	c.(451-453)Gcc>Acc	p.A151T	GHSR_ENST00000427970.1_Missense_Mutation_p.A151T	NM_198407.2	NP_940799.1	Q92847	GHSR_HUMAN	growth hormone secretagogue receptor	151					actin polymerization or depolymerization (GO:0008154)|adult feeding behavior (GO:0008343)|cellular response to insulin stimulus (GO:0032869)|decidualization (GO:0046697)|G-protein coupled receptor signaling pathway (GO:0007186)|growth hormone secretion (GO:0030252)|hormone-mediated signaling pathway (GO:0009755)|negative regulation of inflammatory response (GO:0050728)|negative regulation of insulin secretion (GO:0046676)|negative regulation of interleukin-1 beta production (GO:0032691)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|negative regulation of tumor necrosis factor biosynthetic process (GO:0042536)|positive regulation of appetite (GO:0032100)|positive regulation of fatty acid metabolic process (GO:0045923)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of multicellular organism growth (GO:0040018)|regulation of hindgut contraction (GO:0043134)|regulation of synapse assembly (GO:0051963)|response to food (GO:0032094)|response to hormone (GO:0009725)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|growth hormone secretagogue receptor activity (GO:0001616)|growth hormone-releasing hormone receptor activity (GO:0016520)|peptide hormone binding (GO:0017046)			biliary_tract(1)|breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(6)|lung(16)|ovary(2)|prostate(3)|skin(1)|urinary_tract(1)	33	Ovarian(172;0.00143)|Breast(254;0.197)		Lung(28;3.93e-15)|LUSC - Lung squamous cell carcinoma(14;1.48e-14)|STAD - Stomach adenocarcinoma(35;0.235)			ACCACCTTGGCCCGGAGTGGG	0.627																																					Esophageal Squamous(93;641 1401 20883 29581 34638)												0													55.0	54.0	55.0					3																	172165753		2203	4300	6503	SO:0001583	missense	0			AY429112	CCDS3218.1, CCDS46959.1	3q26.31	2012-08-08			ENSG00000121853	ENSG00000121853		"""GPCR / Class A : Ghrelin receptors"""	4267	protein-coding gene	gene with protein product		601898				8688086	Standard	NM_198407		Approved		uc003fib.2	Q92847	OTTHUMG00000156946	ENST00000241256.2:c.451G>A	3.37:g.172165753C>T	ENSP00000241256:p.Ala151Thr		Q14D12|Q6ISR8|Q92848|Q96RJ7	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_serpentine_rcpt_Srw,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srv,pfscan_GPCR_Rhodpsn_7TM,prints_GHS-R,prints_GPCR_Rhodpsn	p.A151T	ENST00000241256.2	37	c.451	CCDS3218.1	3	.	.	.	.	.	.	.	.	.	.	C	26.6	4.756509	0.89843	.	.	ENSG00000121853	ENST00000241256;ENST00000427970	T;T	0.19669	2.13;2.13	5.58	4.71	0.59529	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.50514	0.1620	M	0.83692	2.655	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	T	0.57802	-0.7748	10	0.56958	D	0.05	-31.2747	15.9864	0.80157	0.1357:0.8643:0.0:0.0	.	151;151	Q92847-2;Q92847	.;GHSR_HUMAN	T	151	ENSP00000241256:A151T;ENSP00000395344:A151T	ENSP00000241256:A151T	A	-	1	0	GHSR	173648447	1.000000	0.71417	0.996000	0.52242	0.886000	0.51366	7.786000	0.85741	1.361000	0.45981	0.455000	0.32223	GCC	GHSR	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_serpentine_rcpt_Srw,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srv,pfscan_GPCR_Rhodpsn_7TM,prints_GHS-R	ENSG00000121853		0.627	GHSR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GHSR	HGNC	protein_coding	OTTHUMT00000346728.1	-	0.00	41	0	C	NM_004122		172165753	-1	tier1	-	no_errors	ENST00000241256	ensembl	human	known	74_37	missense	5.80	64	4	SNP	1.000	T
GLI1	2735	genome.wustl.edu	37	12	57860105	57860105	+	Missense_Mutation	SNP	T	T	A			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr12:57860105T>A	ENST00000228682.2	+	8	936	c.845T>A	c.(844-846)tTc>tAc	p.F282Y	GLI1_ENST00000546141.1_Missense_Mutation_p.F241Y|GLI1_ENST00000543426.1_Missense_Mutation_p.F154Y	NM_005269.2	NP_005260.1	P08151	GLI1_HUMAN	GLI family zinc finger 1	282					cerebellar cortex morphogenesis (GO:0021696)|digestive tract morphogenesis (GO:0048546)|dorsal/ventral pattern formation (GO:0009953)|epidermal cell differentiation (GO:0009913)|lung development (GO:0030324)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|notochord regression (GO:0060032)|osteoblast differentiation (GO:0001649)|pituitary gland development (GO:0021983)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA replication (GO:0045740)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|proximal/distal pattern formation (GO:0009954)|regulation of smoothened signaling pathway (GO:0008589)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in regulation of cerebellar granule cell precursor cell proliferation (GO:0021938)|spermatogenesis (GO:0007283)|ventral midline development (GO:0007418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|primary cilium (GO:0072372)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(8)|lung(22)|ovary(6)|pancreas(2)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	69			GBM - Glioblastoma multiforme(3;3.99e-32)			CTGAGGCCCTTCAAAGCCCAG	0.597																																					Pancreas(157;841 1936 10503 41495 50368)												0													100.0	94.0	96.0					12																	57860105		2203	4300	6503	SO:0001583	missense	0				CCDS8940.1, CCDS53806.1, CCDS53807.1	12q13.2-q13.3	2013-01-25	2009-03-05	2005-01-14		ENSG00000111087		"""Zinc fingers, C2H2-type"""	4317	protein-coding gene	gene with protein product		165220	"""glioma-associated oncogene homolog 1 (zinc finger protein)"", ""glioma-associated oncogene family zinc finger 1"""	GLI		2850480	Standard	NM_005269		Approved		uc001snx.3	P08151		ENST00000228682.2:c.845T>A	12.37:g.57860105T>A	ENSP00000228682:p.Phe282Tyr		D0EUY3|E9PQQ9|F5H6H8|Q8TDN9	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.F282Y	ENST00000228682.2	37	c.845	CCDS8940.1	12	.	.	.	.	.	.	.	.	.	.	T	29.9	5.048841	0.93740	.	.	ENSG00000111087	ENST00000532291;ENST00000543426;ENST00000228682;ENST00000546141;ENST00000528467;ENST00000443131	T;T;T;T;T	0.72167	-0.63;1.27;1.27;1.27;1.27	4.12	4.12	0.48240	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.50627	D	0.000103	D	0.88496	0.6452	H	0.97023	3.925	0.80722	D	1	D	0.76494	0.999	D	0.87578	0.998	D	0.91680	0.5357	10	0.87932	D	0	.	12.5642	0.56300	0.0:0.0:0.0:1.0	.	282	P08151	GLI1_HUMAN	Y	154;154;282;241;241;154	ENSP00000436671:F154Y;ENSP00000437607:F154Y;ENSP00000228682:F282Y;ENSP00000441006:F241Y;ENSP00000434408:F241Y	ENSP00000228682:F282Y	F	+	2	0	GLI1	56146372	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.792000	0.85828	1.862000	0.54008	0.533000	0.62120	TTC	GLI1	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000111087		0.597	GLI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLI1	HGNC	protein_coding	OTTHUMT00000394197.1	-	0.00	74	0	T	NM_005269		57860105	+1	tier1	-	no_errors	ENST00000228682	ensembl	human	known	74_37	missense	6.78	55	4	SNP	1.000	A
GLRA1	2741	genome.wustl.edu	37	5	151266295	151266295	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr5:151266295G>T	ENST00000455880.2	-	3	525	c.239C>A	c.(238-240)gCt>gAt	p.A80D	GLRA1_ENST00000274576.4_Missense_Mutation_p.A80D|GLRA1_ENST00000471351.2_5'UTR|GLRA1_ENST00000545569.1_De_novo_Start_OutOfFrame			P23415	GLRA1_HUMAN	glycine receptor, alpha 1	80					acrosome reaction (GO:0007340)|action potential (GO:0001508)|adult walking behavior (GO:0007628)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|muscle contraction (GO:0006936)|negative regulation of transmission of nerve impulse (GO:0051970)|neuromuscular process controlling posture (GO:0050884)|neuropeptide signaling pathway (GO:0007218)|positive regulation of acrosome reaction (GO:2000344)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of membrane potential (GO:0042391)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|righting reflex (GO:0060013)|startle response (GO:0001964)|synaptic transmission, glycinergic (GO:0060012)|transmembrane transport (GO:0055085)|visual perception (GO:0007601)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|external side of plasma membrane (GO:0009897)|inhibitory synapse (GO:0060077)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	extracellular-glycine-gated chloride channel activity (GO:0016934)|glycine binding (GO:0016594)|taurine binding (GO:0030977)|transmitter-gated ion channel activity (GO:0022824)			breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	23		all_hematologic(541;0.0341)|Medulloblastoma(196;0.0912)	Kidney(363;0.000171)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)		Desflurane(DB01189)|Enflurane(DB00228)|Ethanol(DB00898)|Ginkgo biloba(DB01381)|Glycine(DB00145)|Halothane(DB01159)|Isoflurane(DB00753)|Lindane(DB00431)|Methoxyflurane(DB01028)|Sevoflurane(DB01236)	GGTTGTCTCAGCAATGGAACC	0.468																																																	0													117.0	107.0	111.0					5																	151266295		2203	4300	6503	SO:0001583	missense	0				CCDS4320.1, CCDS54942.1	5q33.1	2012-02-07	2008-01-24		ENSG00000145888	ENSG00000145888		"""Ligand-gated ion channels / Glycine receptors"""	4326	protein-coding gene	gene with protein product	"""startle disease/hyperekplexia"", ""stiff person syndrome"""	138491	"""glycine receptor, alpha 1 (startle disease/hyperekplexia)"""	STHE		1355335, 8298642	Standard	NM_000171		Approved		uc003lut.3	P23415	OTTHUMG00000130121	ENST00000455880.2:c.239C>A	5.37:g.151266295G>T	ENSP00000411593:p.Ala80Asp		B2R6T3|Q14C77|Q6DJV9	Nonsense_Mutation	SNP	NULL	p.C37*	ENST00000455880.2	37	c.111	CCDS54942.1	5	.	.	.	.	.	.	.	.	.	.	G	39	7.462685	0.98299	.	.	ENSG00000145888	ENST00000274576;ENST00000455880	T;T	0.73897	-0.79;-0.79	5.45	5.45	0.79879	Neurotransmitter-gated ion-channel ligand-binding (3);	0.000000	0.85682	D	0.000000	T	0.76183	0.3952	N	0.12611	0.24	0.80722	D	1	D;D	0.71674	0.989;0.998	D;D	0.71870	0.974;0.975	T	0.78899	-0.2022	10	0.44086	T	0.13	.	19.2864	0.94072	0.0:0.0:1.0:0.0	.	80;80	P23415;P23415-2	GLRA1_HUMAN;.	D	80	ENSP00000274576:A80D;ENSP00000411593:A80D	ENSP00000274576:A80D	A	-	2	0	GLRA1	151246488	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.247000	0.95444	2.559000	0.86315	0.655000	0.94253	GCT	GLRA1	-	NULL	ENSG00000145888		0.468	GLRA1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GLRA1	HGNC	protein_coding	OTTHUMT00000373959.1	-	0.00	75	0	G			151266295	-1	tier1	-	no_errors	ENST00000462581	ensembl	human	known	74_37	nonsense	6.33	74	5	SNP	1.000	T
GLTSCR1L	23506	genome.wustl.edu	37	6	42797429	42797429	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr6:42797429G>T	ENST00000314073.5	+	6	1534	c.1358G>T	c.(1357-1359)aGg>aTg	p.R453M	GLTSCR1L_ENST00000394168.1_Missense_Mutation_p.R453M			Q6AI39	GSC1L_HUMAN	GLTSCR1-like	453								p.R453K(1)									AACATGCTCAGGACCAACCAA	0.468																																																	1	Substitution - Missense(1)	skin(1)											176.0	168.0	171.0					6																	42797429		2203	4300	6503	SO:0001583	missense	0			AL833540	CCDS34451.1	6p21.1	2012-11-29	2012-11-29	2012-11-29	ENSG00000112624	ENSG00000112624			21111	protein-coding gene	gene with protein product			"""KIAA0240"""	KIAA0240			Standard	XM_005248972		Approved		uc003osp.1	Q6AI39	OTTHUMG00000014706	ENST00000314073.5:c.1358G>T	6.37:g.42797429G>T	ENSP00000313933:p.Arg453Met		A1L3W2|Q5TFZ3|Q92514	Missense_Mutation	SNP	NULL	p.R453M	ENST00000314073.5	37	c.1358	CCDS34451.1	6	.	.	.	.	.	.	.	.	.	.	G	16.90	3.250698	0.59212	.	.	ENSG00000112624	ENST00000394167;ENST00000536004;ENST00000314073;ENST00000394168	T;T	0.46819	0.86;0.86	5.87	5.87	0.94306	.	0.065121	0.64402	D	0.000004	T	0.58821	0.2149	L	0.51422	1.61	0.51767	D	0.999939	D;P;B	0.76494	0.999;0.604;0.149	D;B;B	0.81914	0.995;0.275;0.05	T	0.48514	-0.9029	10	0.37606	T	0.19	-9.8861	20.5827	0.99408	0.0:0.0:1.0:0.0	.	453;453;453	F5H616;Q6AI39;B7Z2G7	.;K0240_HUMAN;.	M	453	ENSP00000313933:R453M;ENSP00000377723:R453M	ENSP00000313933:R453M	R	+	2	0	KIAA0240	42905407	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.743000	0.62110	2.941000	0.99782	0.655000	0.94253	AGG	GLTSCR1L	-	NULL	ENSG00000112624		0.468	GLTSCR1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLTSCR1L	HGNC	protein_coding	OTTHUMT00000040562.3		0.00	41	0	G	NM_015349		42797429	+1			no_errors	ENST00000314073	ensembl	human	known	74_37	missense	7.14	26	2	SNP	1.000	T
GTF2E1	2960	genome.wustl.edu	37	3	120500159	120500159	+	Nonsense_Mutation	SNP	G	G	T			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr3:120500159G>T	ENST00000283875.5	+	5	1255	c.1162G>T	c.(1162-1164)Gaa>Taa	p.E388*		NM_005513.2	NP_005504.2	P29083	T2EA_HUMAN	general transcription factor IIE, polypeptide 1, alpha 56kDa	388	Asp/Glu-rich (acidic).				gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	intermediate filament cytoskeleton (GO:0045111)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)			NS(1)|breast(3)|endometrium(1)|kidney(1)|large_intestine(6)|lung(9)|ovary(1)	22				GBM - Glioblastoma multiforme(114;0.159)		TGACGAGTTTGAAGAAGTAGC	0.537																																																	0													175.0	169.0	171.0					3																	120500159		2203	4300	6503	SO:0001587	stop_gained	0			S67859	CCDS3002.1	3q21-q24	2010-03-23	2002-08-29		ENSG00000153767	ENSG00000153767		"""General transcription factors"""	4650	protein-coding gene	gene with protein product		189962	"""general transcription factor IIE, polypeptide 1 (alpha subunit, 56kD)"""			1454543, 8162052	Standard	NM_005513		Approved	TFIIE-A, FE	uc003edz.4	P29083	OTTHUMG00000159667	ENST00000283875.5:c.1162G>T	3.37:g.120500159G>T	ENSP00000283875:p.Glu388*		Q16103	Nonsense_Mutation	SNP	pfam_TFIIEa/SarR/Rpc3_HTH_dom,pfam_TFIIE_asu_C,pfam_Znf_TFIIB,smart_TFIIE_asu	p.E388*	ENST00000283875.5	37	c.1162	CCDS3002.1	3	.	.	.	.	.	.	.	.	.	.	G	36	5.847740	0.97023	.	.	ENSG00000153767	ENST00000283875	.	.	.	5.12	4.25	0.50352	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.42905	T	0.14	-39.9907	12.3875	0.55340	0.0818:0.0:0.9182:0.0	.	.	.	.	X	388	.	ENSP00000283875:E388X	E	+	1	0	GTF2E1	121982849	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	9.145000	0.94634	1.385000	0.46445	0.650000	0.86243	GAA	GTF2E1	-	pfam_TFIIE_asu_C	ENSG00000153767		0.537	GTF2E1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GTF2E1	HGNC	protein_coding	OTTHUMT00000356770.1		0.00	27	0	G	NM_005513		120500159	+1			no_errors	ENST00000283875	ensembl	human	known	74_37	nonsense	8.33	44	4	SNP	1.000	T
GYG2	8908	genome.wustl.edu	37	X	2799152	2799152	+	Silent	SNP	C	C	T			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chrX:2799152C>T	ENST00000381163.3	+	12	1686	c.1404C>T	c.(1402-1404)agC>agT	p.S468S	GYG2_ENST00000338623.5_Silent_p.S432S|GYG2_ENST00000542787.1_Silent_p.S397S|GYG2_ENST00000381161.1_3'UTR|GYG2_ENST00000398806.3_Silent_p.S437S	NM_001079855.1|NM_001184702.1|NM_003918.2	NP_001073324.1|NP_001171631.1|NP_003909.2	O15488	GLYG2_HUMAN	glycogenin 2	468					carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|glycogen catabolic process (GO:0005980)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	glycogenin glucosyltransferase activity (GO:0008466)			endometrium(1)|kidney(1)|large_intestine(5)|lung(5)|ovary(1)	13		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				AGGAATTGAGCCCCGAGGAAG	0.562																																																	0													142.0	91.0	108.0					X																	2799152		2203	4298	6501	SO:0001819	synonymous_variant	0			U94361	CCDS14121.1, CCDS48074.1	Xp22.3	2013-02-22			ENSG00000056998	ENSG00000056998	2.4.1.186	"""Glycosyltransferase family 8 domain containing"""	4700	protein-coding gene	gene with protein product	"""glycogenin glucosyltransferase"""	300198				9857012	Standard	NM_001079855		Approved	GN-2	uc004cqs.1	O15488	OTTHUMG00000021079	ENST00000381163.3:c.1404C>T	X.37:g.2799152C>T			B7WNN6|O15485|O15486|O15487|O15489|O15490	Silent	SNP	pfam_Glyco_trans_8	p.S468	ENST00000381163.3	37	c.1404	CCDS14121.1	X																																																																																			GYG2	-	NULL	ENSG00000056998		0.562	GYG2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GYG2	HGNC	protein_coding	OTTHUMT00000055645.1	-	0.00	48	0	C	NM_003918		2799152	+1	tier1	-	no_errors	ENST00000381163	ensembl	human	known	74_37	silent	10.81	33	4	SNP	0.000	T
HERC1	8925	genome.wustl.edu	37	15	63922817	63922817	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr15:63922817G>A	ENST00000443617.2	-	69	12901	c.12814C>T	c.(12814-12816)Cca>Tca	p.P4272S		NM_003922.3	NP_003913.3	Q15751	HERC1_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase family member 1	4272					cerebellar Purkinje cell differentiation (GO:0021702)|negative regulation of autophagy (GO:0010507)|neuromuscular process controlling balance (GO:0050885)|neuron projection development (GO:0031175)|positive regulation of GTPase activity (GO:0043547)|transport (GO:0006810)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(3)|breast(9)|central_nervous_system(4)|endometrium(23)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(22)|liver(1)|lung(36)|ovary(7)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	132						CGCCCCTCTGGCAAGCCTATC	0.443																																																	0													86.0	86.0	86.0					15																	63922817		1927	4133	6060	SO:0001583	missense	0			U50078	CCDS45277.1	15q22	2013-01-10	2012-02-23			ENSG00000103657		"""WD repeat domain containing"""	4867	protein-coding gene	gene with protein product		605109	"""hect (homologous to the E6-AP (UBE3A) carboxyl terminus) domain and RCC1 (CHC1)-like domain (RLD) 1"""			8861955, 9233772	Standard	NM_003922		Approved	p532, p619	uc002amp.3	Q15751		ENST00000443617.2:c.12814C>T	15.37:g.63922817G>A	ENSP00000390158:p.Pro4272Ser		Q8IW65	Missense_Mutation	SNP	pfam_Reg_chr_condens,pfam_HECT,pfam_WD40_repeat,pfam_SPRY_rcpt,superfamily_RCC1/BLIP-II,superfamily_HECT,superfamily_WD40_repeat_dom,superfamily_ConA-like_lec_gl_sf,superfamily_UBA-like,superfamily_ARM-type_fold,smart_SPla/RYanodine_receptor_subgr,smart_WD40_repeat,smart_HECT,pfscan_B30.2/SPRY,pfscan_HECT,pfscan_Reg_chr_condens,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_Reg_chr_condens	p.P4272S	ENST00000443617.2	37	c.12814	CCDS45277.1	15	.	.	.	.	.	.	.	.	.	.	G	19.52	3.843993	0.71488	.	.	ENSG00000103657	ENST00000443617	D	0.84660	-1.88	5.77	5.77	0.91146	Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (2);	0.000000	0.85682	D	0.000000	D	0.90293	0.6964	L	0.55103	1.725	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.85140	0.0980	10	0.13470	T	0.59	.	20.3473	0.98799	0.0:0.0:1.0:0.0	.	4272	Q15751	HERC1_HUMAN	S	4272	ENSP00000390158:P4272S	ENSP00000390158:P4272S	P	-	1	0	HERC1	61709870	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.813000	0.99286	2.884000	0.98904	0.655000	0.94253	CCA	HERC1	-	pfam_Reg_chr_condens,superfamily_RCC1/BLIP-II,pfscan_Reg_chr_condens	ENSG00000103657		0.443	HERC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HERC1	HGNC	protein_coding	OTTHUMT00000418523.1	-	0.00	48	0	G	NM_003922		63922817	-1	tier1	-	no_errors	ENST00000443617	ensembl	human	known	74_37	missense	8.89	41	4	SNP	1.000	A
HIRA	7290	genome.wustl.edu	37	22	19373136	19373138	+	In_Frame_Del	DEL	GCT	GCT	-			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	GCT	GCT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr22:19373136_19373138delGCT	ENST00000263208.5	-	12	1491_1493	c.1235_1237delAGC	c.(1234-1239)cagctg>ctg	p.Q412del	HIRA_ENST00000541063.1_In_Frame_Del_p.Q368del|HIRA_ENST00000340170.4_In_Frame_Del_p.Q412del|HIRA_ENST00000546308.1_In_Frame_Del_p.Q368del	NM_003325.3	NP_003316.3	P54198	HIRA_HUMAN	histone cell cycle regulator	412	Poly-Gln.				anatomical structure morphogenesis (GO:0009653)|chromatin modification (GO:0016568)|DNA replication-independent nucleosome assembly (GO:0006336)|gastrulation (GO:0007369)|muscle cell differentiation (GO:0042692)|osteoblast differentiation (GO:0001649)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(14)|ovary(2)|prostate(1)|skin(1)	37	Colorectal(54;0.0993)					TTCTGGTCCAGCTGCTGCTGCTG	0.581																																																	0																																										SO:0001651	inframe_deletion	0			X75296	CCDS13759.1	22q11.2	2013-05-03	2013-05-03		ENSG00000100084	ENSG00000100084		"""WD repeat domain containing"""	4916	protein-coding gene	gene with protein product	"""DiGeorge critical region gene 1"""	600237	"""HIR (histone cell cycle regulation defective) homolog A (S. cerevisiae)"", ""HIR histone cell cycle regulation defective homolog A (S. cerevisiae)"""	TUPLE1		8111380, 7633437, 9731536	Standard	NM_003325		Approved	DGCR1, TUP1	uc002zpf.1	P54198	OTTHUMG00000150134	ENST00000263208.5:c.1235_1237delAGC	22.37:g.19373145_19373147delGCT	ENSP00000263208:p.Gln412del		Q05BU9|Q8IXN2	In_Frame_Del	DEL	pfam_Hira,pfam_WD40_repeat,pfam_HIRA_B_motif,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.Q412in_frame_del	ENST00000263208.5	37	c.1237_1235	CCDS13759.1	22																																																																																			HIRA	-	NULL	ENSG00000100084		0.581	HIRA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIRA	HGNC	protein_coding	OTTHUMT00000316488.2		0.00	32	0	GCT	NM_003325		19373138	-1	tier1		no_errors	ENST00000263208	ensembl	human	known	74_37	in_frame_del	9.68	28	3	DEL	0.970:0.964:0.994	-
IFRD2	7866	genome.wustl.edu	37	3	50327194	50327195	+	Splice_Site	DEL	CT	CT	-			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	CT	CT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr3:50327194_50327195delCT	ENST00000429673.2	-	6	738		c.e6-1		IFRD2_ENST00000436390.1_Splice_Site|IFRD2_ENST00000336089.4_Splice_Site|IFRD2_ENST00000484043.1_5'Flank|IFRD2_ENST00000417626.2_Splice_Site			Q12894	IFRD2_HUMAN	interferon-related developmental regulator 2							nucleus (GO:0005634)				breast(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)	14				BRCA - Breast invasive adenocarcinoma(193;0.000272)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00607)		CAGAAGCACACTGTTGGGAGAA	0.599																																																	0																																										SO:0001630	splice_region_variant	0			U09585		3p21.3	2008-07-18			ENSG00000214706	ENSG00000214706			5457	protein-coding gene	gene with protein product	"""interferon-related protein"""	602725				9050919	Standard	NM_006764		Approved	SKMc15, SM15, IFNRP	uc011bdp.2	Q12894	OTTHUMG00000156935	ENST00000429673.2:c.739-1AG>-	3.37:g.50327194_50327195delCT			Q9BVB4|Q9UJ88	Splice_Site	DEL	-	e9-1	ENST00000429673.2	37	c.1045-2_1045-1	CCDS46831.1	3																																																																																			IFRD2	-	-	ENSG00000214706		0.599	IFRD2-202	KNOWN	basic|CCDS	protein_coding	IFRD2	HGNC	protein_coding			0.00	39	0	CT	NM_006764	Intron	50327195	-1	tier1		no_errors	ENST00000336089	ensembl	human	known	74_37	splice_site_del	53.85	12	14	DEL	1.000:1.000	-
IL1RAPL1	11141	genome.wustl.edu	37	X	29301302	29301302	+	Silent	SNP	A	A	T			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chrX:29301302A>T	ENST00000378993.1	+	3	1003	c.330A>T	c.(328-330)ctA>ctT	p.L110L	IL1RAPL1_ENST00000302196.4_Silent_p.L110L	NM_014271.3	NP_055086.1	Q9NZN1	IRPL1_HUMAN	interleukin 1 receptor accessory protein-like 1	110	Ig-like C2-type 1.				calcium ion transmembrane transport (GO:0070588)|heterophilic cell-cell adhesion (GO:0007157)|negative regulation of exocytosis (GO:0045920)|neuron differentiation (GO:0030182)|positive regulation of dendrite morphogenesis (GO:0050775)|presynaptic membrane assembly (GO:0097105)|regulation of neuron projection development (GO:0010975)|signal transduction (GO:0007165)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	receptor binding (GO:0005102)|voltage-gated calcium channel activity (GO:0005245)			biliary_tract(1)|breast(1)|endometrium(5)|large_intestine(9)|lung(38)|ovary(3)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	62						CAACATTGCTACAGGACAGTG	0.438																																																	0													101.0	86.0	91.0					X																	29301302		2202	4300	6502	SO:0001819	synonymous_variant	0			AJ243874	CCDS14218.1	Xp22.1-p21.3	2013-01-29	2004-02-13		ENSG00000169306	ENSG00000169306		"""Interleukins and interleukin receptors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5996	protein-coding gene	gene with protein product		300206	"""mental retardation, X-linked 34"", ""mental retardation, X-linked 21"", ""mental retardation, X-linked 10"""	IL1RAPL, MRX34, MRX21, MRX10		10471494, 10757639	Standard	NM_014271		Approved	OPHN4, TIGIRR-2, IL1R8	uc004dby.2	Q9NZN1	OTTHUMG00000021317	ENST00000378993.1:c.330A>T	X.37:g.29301302A>T			A0AVG4|Q9UJ53	Silent	SNP	pfam_TIR_dom,pfam_Ig_I-set,pfam_Immunoglobulin,superfamily_TIR_dom,smart_Ig_sub,smart_Ig_sub2,smart_TIR_dom,pfscan_TIR_dom,pfscan_Ig-like_dom	p.L110	ENST00000378993.1	37	c.330	CCDS14218.1	X																																																																																			IL1RAPL1	-	smart_Ig_sub,pfscan_Ig-like_dom	ENSG00000169306		0.438	IL1RAPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL1RAPL1	HGNC	protein_coding	OTTHUMT00000056155.1	-	0.00	111	0	A	NM_014271		29301302	+1	tier1	-	no_errors	ENST00000302196	ensembl	human	known	74_37	silent	5.33	71	4	SNP	0.091	T
ING1	3621	genome.wustl.edu	37	13	111372209	111372209	+	Frame_Shift_Del	DEL	G	G	-			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr13:111372209delG	ENST00000375774.3	+	2	1661	c.1199delG	c.(1198-1200)cggfs	p.R400fs	ING1_ENST00000375775.3_Frame_Shift_Del_p.R188fs|ING1_ENST00000338450.7_Frame_Shift_Del_p.R213fs|ING1_ENST00000333219.7_Frame_Shift_Del_p.R257fs	NM_005537.4	NP_005528.3	Q9UK53	ING1_HUMAN	inhibitor of growth family, member 1	400					cell cycle (GO:0007049)|chromatin modification (GO:0016568)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|positive regulation of transcription, DNA-templated (GO:0045893)|protein import into nucleus (GO:0006606)|regulation of cell death (GO:0010941)	nucleus (GO:0005634)	methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)			endometrium(4)|large_intestine(6)|lung(1)|ovary(1)	12	all_lung(23;3.61e-05)|Lung NSC(43;0.00144)|Lung SC(71;0.0753)|all_neural(89;0.077)|Medulloblastoma(90;0.148)		BRCA - Breast invasive adenocarcinoma(86;0.188)			CCCAAGTGCCGGGGGGAGAAC	0.557																																																	0													43.0	40.0	41.0					13																	111372209		2203	4300	6503	SO:0001589	frameshift_variant	0				CCDS9515.1, CCDS9516.1, CCDS9517.1, CCDS9518.1	13q34	2013-01-28			ENSG00000153487	ENSG00000153487		"""Zinc fingers, PHD-type"""	6062	protein-coding gene	gene with protein product	"""inhibitor of growth 1"", ""tumor suppressor ING1"", ""growth inhibitor ING1"", ""growth inhibitory protein ING1"""	601566				8944021, 9186514	Standard	NM_198219		Approved	p33ING1, p33ING1b, p24ING1c, p33, p47, p47ING1a	uc001vri.3	Q9UK53	OTTHUMG00000017346	ENST00000375774.3:c.1199delG	13.37:g.111372209delG	ENSP00000364929:p.Arg400fs		O00532|O43658|Q53ZR3|Q5T9G8|Q5T9G9|Q5T9H0|Q5T9H1|Q9H007|Q9HD98|Q9HD99|Q9NS83|Q9P0U6|Q9UBC6|Q9UIJ1|Q9UIJ2|Q9UIJ3|Q9UIJ4|Q9UK52	Frame_Shift_Del	DEL	pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,pfscan_Znf_PHD-finger	p.E402fs	ENST00000375774.3	37	c.1199	CCDS9517.1	13																																																																																			ING1	-	superfamily_Znf_FYVE_PHD,pfscan_Znf_PHD-finger	ENSG00000153487		0.557	ING1-004	KNOWN	basic|CCDS	protein_coding	ING1	HGNC	protein_coding	OTTHUMT00000045770.2		0.00	35	0	G	NM_005537		111372209	+1	tier1		no_errors	ENST00000375774	ensembl	human	known	74_37	frame_shift_del	8.33	33	3	DEL	1.000	-
IPP	3652	genome.wustl.edu	37	1	46184897	46184898	+	Frame_Shift_Del	DEL	AC	AC	-	rs144663569		TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	AC	AC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr1:46184897_46184898delAC	ENST00000396478.3	-	6	1265_1266	c.1163_1164delGT	c.(1162-1164)tgtfs	p.C388fs		NM_005897.2	NP_005888.1	Q9Y573	IPP_HUMAN	intracisternal A particle-promoted polypeptide	388						actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)	actin binding (GO:0003779)			central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(6)|lung(5)|ovary(1)|stomach(2)	20	Acute lymphoblastic leukemia(166;0.155)					TAGCCCCATAACACACACACAC	0.347																																																	0																																										SO:0001589	frameshift_variant	0			BC032544	CCDS30702.1, CCDS44132.1	1p34-p32	2013-01-30			ENSG00000197429	ENSG00000197429		"""Kelch-like"", ""BTB/POZ domain containing"""	6108	protein-coding gene	gene with protein product	"""kelch-like family member 27"""	147485				1905535, 8432546	Standard	NM_005897		Approved	KLHL27	uc001cou.3	Q9Y573	OTTHUMG00000008004	ENST00000396478.3:c.1163_1164delGT	1.37:g.46184907_46184908delAC	ENSP00000379739:p.Cys388fs		A2A6V4|D3DQ11|Q8N5C3	Frame_Shift_Del	DEL	pfam_Kelch_1,pfam_BTB_POZ,pfam_BACK,pfam_Kelch_2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.C388fs	ENST00000396478.3	37	c.1164_1163	CCDS30702.1	1																																																																																			IPP	-	pfam_Kelch_1,smart_Kelch_1,pirsf_Kelch-like_gigaxonin	ENSG00000197429		0.347	IPP-001	KNOWN	mRNA_end_NF|basic|appris_principal|CCDS	protein_coding	IPP	HGNC	protein_coding	OTTHUMT00000021974.3		0.00	52	0	AC	NM_005897		46184898	-1	tier1		no_errors	ENST00000396478	ensembl	human	known	74_37	frame_shift_del	12.12	29	4	DEL	1.000:1.000	-
IQCE	23288	genome.wustl.edu	37	7	2645596	2645596	+	Silent	SNP	C	C	T			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr7:2645596C>T	ENST00000402050.2	+	20	2014	c.1830C>T	c.(1828-1830)tcC>tcT	p.S610S	IQCE_ENST00000438376.2_Silent_p.S594S|IQCE_ENST00000404984.1_Silent_p.S559S|IQCE_ENST00000325979.7_Silent_p.S545S	NM_001100390.1|NM_152558.3	NP_001093860.1|NP_689771.3	Q6IPM2	IQCE_HUMAN	IQ motif containing E	610	IQ 2. {ECO:0000255|PROSITE- ProRule:PRU00116}.					mitochondrion (GO:0005739)				breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(12)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	30		Ovarian(82;0.0112)		OV - Ovarian serous cystadenocarcinoma(56;1.23e-13)		TCATCCAGTCCGCTCTGCGGG	0.697																																																	0													32.0	40.0	37.0					7																	2645596		2125	4236	6361	SO:0001819	synonymous_variant	0			AL136792	CCDS43542.1, CCDS47527.1, CCDS47527.2, CCDS75559.1, CCDS75560.1	7p22.3	2006-04-12			ENSG00000106012	ENSG00000106012			29171	protein-coding gene	gene with protein product						10470851	Standard	XR_242067		Approved	KIAA1023	uc003smo.4	Q6IPM2	OTTHUMG00000152047	ENST00000402050.2:c.1830C>T	7.37:g.2645596C>T			Q4G0P7|Q6P7T4|Q9H0H7|Q9UPX7	Silent	SNP	pfam_IQ_motif_EF-hand-BS,superfamily_P-loop_NTPase,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS	p.S610	ENST00000402050.2	37	c.1830	CCDS43542.1	7																																																																																			IQCE	-	pfam_IQ_motif_EF-hand-BS,superfamily_P-loop_NTPase,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS	ENSG00000106012		0.697	IQCE-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	IQCE	HGNC	protein_coding	OTTHUMT00000325063.2	-	0.00	114	0	C	NM_152558		2645596	+1	tier1	-	no_errors	ENST00000402050	ensembl	human	known	74_37	silent	42.50	92	68	SNP	0.000	T
ITPR1	3708	genome.wustl.edu	37	3	4703790	4703790	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr3:4703790G>C	ENST00000443694.2	+	12	1231	c.1231G>C	c.(1231-1233)Gat>Cat	p.D411H	ITPR1_ENST00000357086.4_Missense_Mutation_p.D426H|ITPR1_ENST00000354582.6_Missense_Mutation_p.D426H|ITPR1_ENST00000544951.1_Intron|ITPR1_ENST00000302640.8_Missense_Mutation_p.D411H|ITPR1_ENST00000456211.2_Missense_Mutation_p.D411H|ITPR1_ENST00000423119.2_Missense_Mutation_p.D426H			Q14643	ITPR1_HUMAN	inositol 1,4,5-trisphosphate receptor, type 1	426	MIR 5. {ECO:0000255|PROSITE- ProRule:PRU00131}.				activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|calcium ion transport (GO:0006816)|endoplasmic reticulum calcium ion homeostasis (GO:0032469)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|negative regulation of calcium-mediated signaling (GO:0050849)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|post-embryonic development (GO:0009791)|regulation of insulin secretion (GO:0050796)|release of sequestered calcium ion into cytosol (GO:0051209)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|voluntary musculoskeletal movement (GO:0050882)	calcineurin complex (GO:0005955)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear inner membrane (GO:0005637)|nucleolus (GO:0005730)|platelet dense granule membrane (GO:0031088)|platelet dense tubular network (GO:0031094)|platelet dense tubular network membrane (GO:0031095)|postsynaptic density (GO:0014069)|sarcoplasmic reticulum (GO:0016529)	calcium channel inhibitor activity (GO:0019855)|calcium ion transmembrane transporter activity (GO:0015085)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|intracellular ligand-gated calcium channel activity (GO:0005218)|phosphatidylinositol binding (GO:0035091)			NS(1)|autonomic_ganglia(1)|breast(10)|endometrium(15)|kidney(6)|large_intestine(27)|liver(1)|lung(27)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|urinary_tract(2)	106				Epithelial(13;0.0199)|OV - Ovarian serous cystadenocarcinoma(96;0.0361)|all cancers(10;0.0982)	Caffeine(DB00201)	TGTGAAGGAGGATAAGGAAGC	0.468																																																	0													131.0	126.0	128.0					3																	4703790		1926	4131	6057	SO:0001583	missense	0			D26070	CCDS46740.1, CCDS46740.2, CCDS54550.1, CCDS54551.1	3p26.1	2014-06-12	2011-04-28			ENSG00000150995		"""Ion channels / Inositol triphosphate receptors"""	6180	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 94"""	147265	"""spinocerebellar ataxia 15"", ""spinocerebellar ataxia 16"", ""spinocerebellar ataxia 29"""	SCA15, SCA16, SCA29		7945203, 7500840, 17590087, 17932120, 22986007	Standard	NM_001099952		Approved	Insp3r1, IP3R1, ACV, PPP1R94	uc003bqc.3	Q14643		ENST00000443694.2:c.1231G>C	3.37:g.4703790G>C	ENSP00000401671:p.Asp411His		E7EPX7|E9PDE9|Q14660|Q99897	Missense_Mutation	SNP	pfam_Ca-rel_channel,pfam_Ins145_P3_rcpt,pfam_MIR_motif,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR_motif,smart_MIR_motif,prints_InsP3_rcpt-bd,pfscan_MIR_motif	p.D411H	ENST00000443694.2	37	c.1231	CCDS54551.1	3	.	.	.	.	.	.	.	.	.	.	G	25.7	4.665903	0.88251	.	.	ENSG00000150995	ENST00000356617;ENST00000302640;ENST00000354582;ENST00000423119;ENST00000357086;ENST00000456211;ENST00000443694	D;D;D;D;D;D	0.88201	-2.35;-2.35;-2.35;-2.35;-2.35;-2.35	5.23	5.23	0.72850	MIR motif (1);MIR (2);	0.000000	0.85682	D	0.000000	D	0.95223	0.8451	M	0.86502	2.82	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.998;1.0;0.994	D	0.94941	0.8091	10	0.45353	T	0.12	.	18.8419	0.92188	0.0:0.0:1.0:0.0	.	411;426;426	E7EPX7;Q14643;G5E9P1	.;ITPR1_HUMAN;.	H	426;411;426;426;426;411;411	ENSP00000306253:D411H;ENSP00000346595:D426H;ENSP00000405934:D426H;ENSP00000349597:D426H;ENSP00000397885:D411H;ENSP00000401671:D411H	ENSP00000306253:D411H	D	+	1	0	ITPR1	4678790	1.000000	0.71417	1.000000	0.80357	0.820000	0.46376	9.787000	0.99055	2.451000	0.82905	0.650000	0.86243	GAT	ITPR1	-	pfam_MIR_motif,superfamily_MIR_motif,prints_InsP3_rcpt-bd,pfscan_MIR_motif	ENSG00000150995		0.468	ITPR1-004	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	ITPR1	HGNC	protein_coding	OTTHUMT00000337982.3	-	0.00	93	0	G	NM_002222		4703790	+1	tier1	-	no_errors	ENST00000302640	ensembl	human	known	74_37	missense	50.79	31	32	SNP	1.000	C
ITPR2	3709	genome.wustl.edu	37	12	26877672	26877672	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr12:26877672C>T	ENST00000381340.3	-	4	699	c.283G>A	c.(283-285)Gct>Act	p.A95T	ITPR2_ENST00000242737.5_Missense_Mutation_p.A95T	NM_002223.2	NP_002214.2	Q14571	ITPR2_HUMAN	inositol 1,4,5-trisphosphate receptor, type 2	95					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|cellular response to cAMP (GO:0071320)|cellular response to ethanol (GO:0071361)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|regulation of insulin secretion (GO:0050796)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	cell cortex (GO:0005938)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet dense tubular network membrane (GO:0031095)|receptor complex (GO:0043235)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion transmembrane transporter activity (GO:0015085)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|phosphatidylinositol binding (GO:0035091)		ETV6/ITPR2(2)	biliary_tract(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(20)|liver(1)|lung(51)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	125	Colorectal(261;0.0847)				Caffeine(DB00201)	AGTTCTGCAGCGTGCTATAAG	0.299																																																	0													136.0	114.0	121.0					12																	26877672		1808	4076	5884	SO:0001583	missense	0			D26350	CCDS41764.1	12p11.23	2014-07-18	2011-04-28		ENSG00000123104	ENSG00000123104		"""Ion channels / Inositol triphosphate receptors"""	6181	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 48"""	600144	"""inositol 1,4,5-triphosphate receptor, type 2"""			8081734	Standard	XM_006719064		Approved	IP3R2, CFAP48	uc001rhg.3	Q14571	OTTHUMG00000169181	ENST00000381340.3:c.283G>A	12.37:g.26877672C>T	ENSP00000370744:p.Ala95Thr		O94773	Missense_Mutation	SNP	pfam_Ca-rel_channel,pfam_Ins145_P3_rcpt,pfam_MIR_motif,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR_motif,superfamily_ARM-type_fold,smart_MIR_motif,prints_InsP3_rcpt-bd,pfscan_MIR_motif	p.A95T	ENST00000381340.3	37	c.283	CCDS41764.1	12	.	.	.	.	.	.	.	.	.	.	C	22.6	4.314208	0.81358	.	.	ENSG00000123104	ENST00000381340;ENST00000242737	D;D	0.98602	-5.02;-5.02	4.96	4.96	0.65561	Inositol 1,4,5-trisphosphate/ryanodine receptor (1);	0.000000	0.85682	D	0.000000	D	0.98061	0.9361	M	0.81239	2.535	0.80722	D	1	D;P	0.62365	0.991;0.93	P;B	0.48795	0.59;0.444	D	0.97808	1.0249	10	0.30854	T	0.27	.	18.4218	0.90594	0.0:1.0:0.0:0.0	.	95;95	Q14571-2;Q14571	.;ITPR2_HUMAN	T	95	ENSP00000370744:A95T;ENSP00000242737:A95T	ENSP00000242737:A95T	A	-	1	0	ITPR2	26768939	1.000000	0.71417	1.000000	0.80357	0.906000	0.53458	7.337000	0.79256	2.572000	0.86782	0.655000	0.94253	GCT	ITPR2	-	pfam_Ins145_P3_rcpt	ENSG00000123104		0.299	ITPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITPR2	HGNC	protein_coding	OTTHUMT00000402732.1	-	0.00	55	0	C	NM_002223		26877672	-1	tier1	-	no_errors	ENST00000381340	ensembl	human	known	74_37	missense	9.76	37	4	SNP	1.000	T
JAKMIP2	9832	genome.wustl.edu	37	5	147015801	147015801	+	Missense_Mutation	SNP	T	T	A			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr5:147015801T>A	ENST00000265272.5	-	12	2128	c.1661A>T	c.(1660-1662)cAg>cTg	p.Q554L	JAKMIP2_ENST00000333010.6_Missense_Mutation_p.Q512L|JAKMIP2_ENST00000507386.1_Intron	NM_001270941.1|NM_014790.4	NP_001257870.1|NP_055605.2	Q96AA8	JKIP2_HUMAN	janus kinase and microtubule interacting protein 2	554						Golgi apparatus (GO:0005794)				NS(1)|autonomic_ganglia(1)|breast(3)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(22)|lung(18)|ovary(3)|pancreas(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)	64			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TAAAAGCTCCTGGTTTCTCTT	0.483																																																	0													112.0	97.0	102.0					5																	147015801		2203	4300	6503	SO:0001583	missense	0			AB011127	CCDS4285.1, CCDS59495.1, CCDS64284.1, CCDS75352.1	5q32	2009-08-13	2009-08-13		ENSG00000176049	ENSG00000176049			29067	protein-coding gene	gene with protein product		611197				9628581	Standard	NM_001270941		Approved	JAMIP2, KIAA0555	uc010jgo.2	Q96AA8	OTTHUMG00000129731	ENST00000265272.5:c.1661A>T	5.37:g.147015801T>A	ENSP00000265272:p.Gln554Leu		A4ZZA7|A8K5G5|B4DSG0|G5E9Y0|O60302|Q548S1	Missense_Mutation	SNP	NULL	p.Q554L	ENST00000265272.5	37	c.1661	CCDS4285.1	5	.	.	.	.	.	.	.	.	.	.	T	23.6	4.430087	0.83776	.	.	ENSG00000176049	ENST00000265272;ENST00000333010	T;T	0.28454	1.61;1.61	6.04	6.04	0.98038	.	0.000000	0.85682	D	0.000000	T	0.52517	0.1739	M	0.75615	2.305	0.80722	D	1	P;P;P	0.48294	0.908;0.908;0.908	P;P;P	0.61397	0.888;0.888;0.888	T	0.45454	-0.9260	10	0.17832	T	0.49	.	16.5885	0.84745	0.0:0.0:0.0:1.0	.	512;554;554	B4DSG0;Q96AA8-3;Q96AA8	.;.;JKIP2_HUMAN	L	554;512	ENSP00000265272:Q554L;ENSP00000328989:Q512L	ENSP00000265272:Q554L	Q	-	2	0	JAKMIP2	146995994	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.235000	0.78143	2.317000	0.78254	0.460000	0.39030	CAG	JAKMIP2	-	NULL	ENSG00000176049		0.483	JAKMIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	JAKMIP2	HGNC	protein_coding	OTTHUMT00000251941.1	-	0.00	52	0	T	NM_014790		147015801	-1	tier1	-	no_errors	ENST00000265272	ensembl	human	known	74_37	missense	7.55	49	4	SNP	1.000	A
KCNA5	3741	genome.wustl.edu	37	12	5155089	5155089	+	Silent	SNP	C	C	T			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr12:5155089C>T	ENST00000252321.3	+	1	2005	c.1776C>T	c.(1774-1776)agC>agT	p.S592S		NM_002234.3	NP_002225.2	P22460	KCNA5_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 5	592					atrial cardiac muscle cell action potential (GO:0086014)|membrane hyperpolarization (GO:0060081)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|negative regulation of potassium ion transport (GO:0043267)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of myoblast proliferation (GO:2000288)|potassium ion export (GO:0071435)|potassium ion homeostasis (GO:0055075)|potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of insulin secretion (GO:0050796)|regulation of membrane potential (GO:0042391)|regulation of potassium ion transport (GO:0043266)|regulation of vasoconstriction (GO:0019229)|response to hypoxia (GO:0001666)|synaptic transmission (GO:0007268)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|intracellular canaliculus (GO:0046691)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|delayed rectifier potassium channel activity (GO:0005251)|outward rectifier potassium channel activity (GO:0015271)|potassium channel inhibitor activity (GO:0019870)|protein kinase binding (GO:0019901)|scaffold protein binding (GO:0097110)|voltage-gated potassium channel activity involved in atrial cardiac muscle cell action potential repolarization (GO:0086089)			NS(1)|breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|liver(1)|lung(21)|ovary(5)|prostate(2)|upper_aerodigestive_tract(2)	52					Dalfampridine(DB06637)	AGGCCAAGAGCAACGTGGACT	0.587																																																	0													42.0	42.0	42.0					12																	5155089		2203	4300	6503	SO:0001819	synonymous_variant	0			M83254	CCDS8536.1	12p13	2012-07-05				ENSG00000130037		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6224	protein-coding gene	gene with protein product		176267				16382104	Standard	NM_002234		Approved	Kv1.5, HK2, HPCN1	uc001qni.4	P22460		ENST00000252321.3:c.1776C>T	12.37:g.5155089C>T			Q4KKT8|Q4VAJ1|Q4VAJ2|Q9UDA4	Silent	SNP	pfam_Ion_trans_dom,pfam_T1-type_BTB,pfam_2pore_dom_K_chnl_dom,pfam_PKD1_2_channel,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl,prints_K_chnl_volt-dep_Kv1.5,prints_K_chnl_volt-dep_Kv1,prints_K_chnl_volt-dep_Kv	p.S592	ENST00000252321.3	37	c.1776	CCDS8536.1	12																																																																																			KCNA5	-	prints_K_chnl_volt-dep_Kv1.5	ENSG00000130037		0.587	KCNA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNA5	HGNC	protein_coding	OTTHUMT00000398925.2		0.00	48	0	C	NM_002234		5155089	+1			no_errors	ENST00000252321	ensembl	human	known	74_37	silent	5.13	37	2	SNP	1.000	T
KCNQ2	3785	genome.wustl.edu	37	20	62103553	62103553	+	Silent	SNP	C	C	T			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr20:62103553C>T	ENST00000359125.2	-	1	438	c.264G>A	c.(262-264)ccG>ccA	p.P88P	KCNQ2_ENST00000354587.3_Silent_p.P88P|KCNQ2_ENST00000344425.5_Silent_p.P88P|KCNQ2_ENST00000360480.3_Silent_p.P88P|KCNQ2_ENST00000344462.4_Silent_p.P88P|KCNQ2_ENST00000357249.2_Silent_p.P88P|KCNQ2_ENST00000370224.1_Silent_p.P88P|KCNQ2_ENST00000359689.1_Silent_p.P88P	NM_172107.2	NP_742105.1	O43526	KCNQ2_HUMAN	potassium voltage-gated channel, KQT-like subfamily, member 2	88					axon guidance (GO:0007411)|nervous system development (GO:0007399)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)|transmission of nerve impulse (GO:0019226)	axon initial segment (GO:0043194)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	ankyrin binding (GO:0030506)|delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)			biliary_tract(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(4)|liver(1)|lung(30)|ovary(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	65	all_cancers(38;1.24e-11)		BRCA - Breast invasive adenocarcinoma(10;1.04e-05)		Amitriptyline(DB00321)|Diclofenac(DB00586)|Ezogabine(DB04953)|Meclofenamic acid(DB00939)	CCCAGCCGCGCGGCCGCTCCA	0.721																																																	0													7.0	8.0	8.0					20																	62103553		2123	4193	6316	SO:0001819	synonymous_variant	0			AF033348	CCDS13518.1, CCDS13519.1, CCDS13520.1, CCDS13521.1, CCDS46629.1	20q13.33	2012-07-05			ENSG00000075043	ENSG00000075043		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6296	protein-coding gene	gene with protein product		602235		EBN, EBN1		9425895, 16382104	Standard	NM_172107		Approved	Kv7.2, ENB1, BFNC, KCNA11, HNSPC	uc002yex.3	O43526	OTTHUMG00000033049	ENST00000359125.2:c.264G>A	20.37:g.62103553C>T			O43796|O75580|O95845|Q4VXP4|Q4VXR6|Q5VYT8|Q96J59|Q99454	Silent	SNP	pfam_K_chnl_volt-dep_KCNQ_C,pfam_Ankyrin-G_BS,pfam_Ion_trans_dom,pfam_2pore_dom_K_chnl_dom,prints_K_chnl_volt-dep_KCNQ2,prints_K_chnl_volt-dep_KCNQ,prints_K_chnl	p.P88	ENST00000359125.2	37	c.264	CCDS13520.1	20																																																																																			KCNQ2	-	NULL	ENSG00000075043		0.721	KCNQ2-003	KNOWN	basic|CCDS	protein_coding	KCNQ2	HGNC	protein_coding	OTTHUMT00000080353.1	-	0.00	75	0	C	NM_172109		62103553	-1	tier1	-	no_errors	ENST00000354587	ensembl	human	known	74_37	silent	32.39	48	23	SNP	0.989	T
KEAP1	9817	genome.wustl.edu	37	19	10602340	10602340	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr19:10602340C>T	ENST00000171111.5	-	3	1785	c.1238G>A	c.(1237-1239)cGt>cAt	p.R413H	KEAP1_ENST00000393623.2_Missense_Mutation_p.R413H|KEAP1_ENST00000588024.1_5'Flank|CTC-429L19.3_ENST00000592671.1_RNA	NM_203500.1	NP_987096.1	Q14145	KEAP1_HUMAN	kelch-like ECH-associated protein 1	413					cellular response to interleukin-4 (GO:0071353)|in utero embryonic development (GO:0001701)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|protein ubiquitination (GO:0016567)|regulation of epidermal cell differentiation (GO:0045604)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|nucleus (GO:0005634)				breast(3)|endometrium(2)|kidney(4)|large_intestine(4)|liver(2)|lung(69)|ovary(2)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	92			OV - Ovarian serous cystadenocarcinoma(20;2.71e-09)|Epithelial(33;2.32e-06)|all cancers(31;1.42e-05)		Dimethyl fumarate(DB08908)	GATGCGGTTACGGGGCACGCT	0.647																																																	0													33.0	28.0	30.0					19																	10602340		2202	4300	6502	SO:0001583	missense	0			AF361886	CCDS12239.1	19p13.2	2013-01-30				ENSG00000079999		"""Kelch-like"", ""BTB/POZ domain containing"""	23177	protein-coding gene	gene with protein product	"""kelch-like family member 19"""	606016					Standard	NM_012289		Approved	KIAA0132, MGC10630, MGC1114, MGC20887, MGC4407, MGC9454, INrf2, KLHL19	uc002mor.1	Q14145		ENST00000171111.5:c.1238G>A	19.37:g.10602340C>T	ENSP00000171111:p.Arg413His		B3KPD5|Q6LEP0|Q8WTX1|Q9BPY9	Missense_Mutation	SNP	pfam_Kelch_1,pfam_BACK,pfam_BTB_POZ,pfam_Kelch_2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.R413H	ENST00000171111.5	37	c.1238	CCDS12239.1	19	.	.	.	.	.	.	.	.	.	.	C	27.5	4.833797	0.91036	.	.	ENSG00000079999	ENST00000171111;ENST00000393623	T;T	0.79554	-1.28;-1.28	5.6	5.6	0.85130	Kelch-type beta propeller (1);	0.000000	0.85682	D	0.000000	D	0.92163	0.7515	M	0.92317	3.295	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.93638	0.6962	10	0.87932	D	0	.	17.1192	0.86697	0.0:1.0:0.0:0.0	.	413	Q14145	KEAP1_HUMAN	H	413	ENSP00000171111:R413H;ENSP00000377245:R413H	ENSP00000171111:R413H	R	-	2	0	KEAP1	10463340	1.000000	0.71417	0.988000	0.46212	0.750000	0.42670	5.913000	0.69957	2.662000	0.90505	0.655000	0.94253	CGT	KEAP1	-	pfam_Kelch_1,smart_Kelch_1,pirsf_Kelch-like_gigaxonin	ENSG00000079999		0.647	KEAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KEAP1	HGNC	protein_coding	OTTHUMT00000452000.1	-	0.00	26	0	C	NM_012289		10602340	-1	tier1	-	no_errors	ENST00000171111	ensembl	human	known	74_37	missense	36.84	24	14	SNP	1.000	T
KHDC1	80759	genome.wustl.edu	37	6	73951401	73951401	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr6:73951401G>T	ENST00000370384.3	-	5	1065	c.565C>A	c.(565-567)Ctg>Atg	p.L189M	KHDC1_ENST00000257765.5_Missense_Mutation_p.L116M|RP11-257K9.8_ENST00000423730.3_Intron	NM_001251874.1	NP_001238803.1	Q4VXA5	KHDC1_HUMAN	KH homology domain containing 1	189						integral component of membrane (GO:0016021)	RNA binding (GO:0003723)			large_intestine(1)|lung(4)|skin(1)	6						GAGGTGACCAGGTCATCGTTG	0.557																																																	0													106.0	107.0	107.0					6																	73951401		2028	4190	6218	SO:0001583	missense	0				CCDS43480.1, CCDS59027.1	6q13	2014-05-15	2007-11-13	2007-11-13	ENSG00000135314	ENSG00000135314			21366	protein-coding gene	gene with protein product		611688	"""chromosome 6 open reading frame 148"""	C6orf148		17913455	Standard	NM_030568		Approved	MGC10818, bA257K9.4, NDG1	uc003pgn.4	Q4VXA5	OTTHUMG00000015030	ENST00000370384.3:c.565C>A	6.37:g.73951401G>T	ENSP00000359411:p.Leu189Met		Q5JSQ7|Q8WTV2|Q96NQ5	Missense_Mutation	SNP	NULL	p.L116M	ENST00000370384.3	37	c.346	CCDS59027.1	6	.	.	.	.	.	.	.	.	.	.	G	12.11	1.838727	0.32513	.	.	ENSG00000135314	ENST00000257765;ENST00000370384	T	0.54479	0.57	2.18	0.317	0.15861	.	.	.	.	.	T	0.47469	0.1447	L	0.58101	1.795	0.09310	N	1	D	0.62365	0.991	D	0.75484	0.986	T	0.26503	-1.0101	9	0.72032	D	0.01	.	4.2459	0.10672	0.3665:0.0:0.6335:0.0	.	189	Q4VXA5	KHDC1_HUMAN	M	116;189	ENSP00000359411:L189M	ENSP00000257765:L116M	L	-	1	2	KHDC1	74008122	0.032000	0.19561	0.011000	0.14972	0.095000	0.18619	0.403000	0.20982	0.051000	0.15978	0.561000	0.74099	CTG	KHDC1	-	NULL	ENSG00000135314		0.557	KHDC1-005	PUTATIVE	basic|appris_candidate_longest|CCDS	protein_coding	KHDC1	HGNC	protein_coding	OTTHUMT00000148103.2	-	0.00	106	0	G	NM_030568		73951401	-1	tier1	-	no_errors	ENST00000257765	ensembl	human	known	74_37	missense	5.38	88	5	SNP	0.014	T
KIAA1551	55196	genome.wustl.edu	37	12	32134340	32134340	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr12:32134340G>A	ENST00000312561.4	+	4	865	c.451G>A	c.(451-453)Gca>Aca	p.A151T	KIAA1551_ENST00000535596.1_Intron	NM_018169.3	NP_060639	Q9HCM1	K1551_HUMAN	KIAA1551	151								p.A151T(1)									CAATATGCCGGCACTACAGAG	0.418																																																	1	Substitution - Missense(1)	large_intestine(1)											75.0	69.0	71.0					12																	32134340		2203	4300	6503	SO:0001583	missense	0			AK001514	CCDS8725.2	12p11.21	2012-08-14	2012-08-14	2012-08-14	ENSG00000174718	ENSG00000174718			25559	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 35"""	C12orf35		10997877	Standard	NM_018169		Approved	FLJ20696, FLJ10652	uc001rks.3	Q9HCM1	OTTHUMG00000128501	ENST00000312561.4:c.451G>A	12.37:g.32134340G>A	ENSP00000310338:p.Ala151Thr		B2RTU5|Q4KN17|Q9NVL6|Q9NWP9	Missense_Mutation	SNP	NULL	p.A151T	ENST00000312561.4	37	c.451	CCDS8725.2	12	.	.	.	.	.	.	.	.	.	.	G	12.64	1.997265	0.35226	.	.	ENSG00000174718	ENST00000312561;ENST00000381054	T;T	0.10192	2.9;2.9	5.35	-5.89	0.02282	.	1.582800	0.03582	N	0.230280	T	0.05960	0.0155	N	0.17082	0.46	0.09310	N	1	B	0.17038	0.02	B	0.17722	0.019	T	0.38478	-0.9659	9	.	.	.	.	6.5861	0.22622	0.4742:0.36:0.1659:0.0	.	151	Q9HCM1	CL035_HUMAN	T	151	ENSP00000310338:A151T;ENSP00000370442:A151T	.	A	+	1	0	C12orf35	32025607	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-0.450000	0.06803	-0.663000	0.05331	0.650000	0.86243	GCA	KIAA1551	-	NULL	ENSG00000174718		0.418	KIAA1551-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1551	HGNC	protein_coding	OTTHUMT00000250307.2		0.00	55	0	G	NM_018169		32134340	+1			no_errors	ENST00000312561	ensembl	human	known	74_37	missense	5.26	54	3	SNP	0.000	A
KIAA1958	158405	genome.wustl.edu	37	9	115422317	115422317	+	Silent	SNP	C	C	A	rs562492705		TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr9:115422317C>A	ENST00000337530.6	+	4	2415	c.2119C>A	c.(2119-2121)Cgg>Agg	p.R707R	KIAA1958_ENST00000536272.1_Silent_p.R735R	NM_133465.2	NP_597722.1	Q8N8K9	K1958_HUMAN	KIAA1958	707										endometrium(1)|large_intestine(9)|lung(10)|prostate(2)|skin(3)	25						TCAGGTCTCCCGGAGGCTTGG	0.622																																																	0													54.0	54.0	54.0					9																	115422317		2203	4300	6503	SO:0001819	synonymous_variant	0			AB075838	CCDS35108.1, CCDS69642.1	9q33.1	2009-09-22			ENSG00000165185	ENSG00000165185			23427	protein-coding gene	gene with protein product							Standard	NM_001287038		Approved	FLJ39294	uc004bgf.1	Q8N8K9	OTTHUMG00000020508	ENST00000337530.6:c.2119C>A	9.37:g.115422317C>A			B7ZKW6|Q2M336|Q5T252|Q8TF43|Q96N02	Silent	SNP	pfam_DUF3504,superfamily_Integrase_Lambda-type_N	p.R735	ENST00000337530.6	37	c.2203	CCDS35108.1	9																																																																																			KIAA1958	-	NULL	ENSG00000165185		0.622	KIAA1958-001	KNOWN	basic|CCDS	protein_coding	KIAA1958	HGNC	protein_coding	OTTHUMT00000053690.1		0.00	39	0	C	NM_133465		115422317	+1			no_errors	ENST00000536272	ensembl	human	known	74_37	silent	5.36	53	3	SNP	1.000	A
L1CAM	3897	genome.wustl.edu	37	X	153132169	153132169	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chrX:153132169T>C	ENST00000370060.1	-	19	2555	c.2366A>G	c.(2365-2367)cAg>cGg	p.Q789R	L1CAM_ENST00000370057.3_Missense_Mutation_p.Q789R|L1CAM_ENST00000538883.1_Missense_Mutation_p.Q791R|L1CAM_ENST00000361699.4_Missense_Mutation_p.Q789R|L1CAM_ENST00000361981.3_Missense_Mutation_p.Q784R|L1CAM_ENST00000543994.1_Missense_Mutation_p.Q791R|L1CAM_ENST00000370055.1_Missense_Mutation_p.Q784R	NM_001278116.1	NP_001265045.1	P32004	L1CAM_HUMAN	L1 cell adhesion molecule	789	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell death (GO:0008219)|cell surface receptor signaling pathway (GO:0007166)|cell-cell adhesion mediated by integrin (GO:0033631)|chemotaxis (GO:0006935)|heterophilic cell-cell adhesion (GO:0007157)|homophilic cell adhesion (GO:0007156)|homotypic cell-cell adhesion (GO:0034109)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|nervous system development (GO:0007399)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of cell-cell adhesion (GO:0022409)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	sialic acid binding (GO:0033691)			NS(1)|breast(4)|central_nervous_system(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(5)|liver(1)|lung(31)|ovary(13)|pancreas(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	81	all_cancers(53;6.72e-15)|all_epithelial(53;3.19e-09)|all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					GTTGACGGCCTGGACTTTGAT	0.627																																																	0													122.0	97.0	106.0					X																	153132169		2203	4300	6503	SO:0001583	missense	0			M74387	CCDS14733.1, CCDS14734.1, CCDS48192.1	Xq28	2014-09-17	2003-04-07		ENSG00000198910	ENSG00000198910		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	6470	protein-coding gene	gene with protein product		308840	"""antigen identified by monoclonal antibody R1"""	HSAS1, SPG1, HSAS, MASA, MIC5, S10			Standard	NM_001278116		Approved	CD171	uc031tks.1	P32004	OTTHUMG00000024221	ENST00000370060.1:c.2366A>G	X.37:g.153132169T>C	ENSP00000359077:p.Gln789Arg		A0AV65|A4ZYW4|B2RMU7|G3XAF4|Q8TA87	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.Q791R	ENST00000370060.1	37	c.2372	CCDS14733.1	X	.	.	.	.	.	.	.	.	.	.	T	26.1	4.705258	0.89018	.	.	ENSG00000198910	ENST00000370060;ENST00000543994;ENST00000370057;ENST00000538883;ENST00000361981;ENST00000370055;ENST00000361699	T;T;T;T;T;T;T	0.57907	0.37;0.37;0.37;0.37;0.37;0.37;0.37	5.28	5.28	0.74379	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.64402	D	0.000020	T	0.70535	0.3235	M	0.74389	2.26	0.80722	D	1	D;P;D	0.56287	0.968;0.76;0.975	D;B;D	0.69142	0.936;0.381;0.962	T	0.73442	-0.3981	10	0.56958	D	0.05	.	13.2172	0.59867	0.0:0.0:0.0:1.0	.	784;789;789	G3XAF4;P32004-2;P32004	.;.;L1CAM_HUMAN	R	789;791;789;791;784;784;789	ENSP00000359077:Q789R;ENSP00000438430:Q791R;ENSP00000359074:Q789R;ENSP00000439645:Q791R;ENSP00000354712:Q784R;ENSP00000359072:Q784R;ENSP00000355380:Q789R	ENSP00000355380:Q789R	Q	-	2	0	L1CAM	152785363	1.000000	0.71417	0.983000	0.44433	0.663000	0.39108	4.892000	0.63193	1.762000	0.52044	0.430000	0.28490	CAG	L1CAM	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000198910		0.627	L1CAM-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	L1CAM	HGNC	protein_coding	OTTHUMT00000061094.2	-	0.00	139	0	T	NM_024003		153132169	-1	tier1	-	no_errors	ENST00000543994	ensembl	human	known	74_37	missense	6.45	58	4	SNP	1.000	C
LGR5	8549	genome.wustl.edu	37	12	71978455	71978455	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr12:71978455G>A	ENST00000266674.5	+	18	2976	c.2665G>A	c.(2665-2667)Gct>Act	p.A889T	LGR5_ENST00000540815.2_Missense_Mutation_p.A865T|LGR5_ENST00000536515.1_Missense_Mutation_p.A817T|RP11-186F10.2_ENST00000546601.1_RNA			O75473	LGR5_HUMAN	leucine-rich repeat containing G protein-coupled receptor 5	889					G-protein coupled receptor signaling pathway (GO:0007186)|inner ear development (GO:0048839)|positive regulation of canonical Wnt signaling pathway (GO:0090263)	integral component of plasma membrane (GO:0005887)|trans-Golgi network membrane (GO:0032588)	G-protein coupled receptor activity (GO:0004930)|transmembrane signaling receptor activity (GO:0004888)		NUP107/LGR5(2)	endometrium(2)|kidney(3)|large_intestine(2)|lung(24)|ovary(1)|pancreas(2)|prostate(1)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(3)	48						GCCATCACCAGCTTATCCAGT	0.458																																																	0													136.0	129.0	131.0					12																	71978455		2203	4300	6503	SO:0001583	missense	0			AF062006	CCDS9000.1, CCDS61194.1, CCDS61195.1	12q22-q23	2012-08-21	2011-01-25	2004-11-12				"""GPCR / Class A : Orphans"""	4504	protein-coding gene	gene with protein product		606667	"""G protein-coupled receptor 49"", ""leucine-rich repeat-containing G protein-coupled receptor 5"""	GPR67, GPR49		9642114	Standard	NM_003667		Approved	HG38, FEX	uc001swl.4	O75473	OTTHUMG00000169543	ENST00000266674.5:c.2665G>A	12.37:g.71978455G>A	ENSP00000266674:p.Ala889Thr		D8MCT0|Q4VAM0|Q4VAM2|Q9UP75	Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_GPCR_Rhodpsn,pfam_LRR-contain_N,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,prints_Gphrmn_rcpt_fam,prints_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	p.A889T	ENST00000266674.5	37	c.2665	CCDS9000.1	12	.	.	.	.	.	.	.	.	.	.	G	9.714	1.157938	0.21454	.	.	ENSG00000139292	ENST00000266674;ENST00000536515;ENST00000540815	T;T;T	0.58358	0.4;0.34;0.48	5.82	2.72	0.32119	.	0.489229	0.20557	N	0.089998	T	0.27697	0.0681	N	0.08118	0	0.26344	N	0.977315	B;B	0.06786	0.001;0.0	B;B	0.08055	0.003;0.001	T	0.12528	-1.0544	10	0.46703	T	0.11	.	5.3716	0.16142	0.1756:0.0:0.4988:0.3256	.	865;889	O75473-2;O75473	.;LGR5_HUMAN	T	889;817;865	ENSP00000266674:A889T;ENSP00000443033:A817T;ENSP00000441035:A865T	ENSP00000266674:A889T	A	+	1	0	LGR5	70264722	0.681000	0.27614	0.113000	0.21522	0.321000	0.28281	1.081000	0.30791	0.786000	0.33708	0.585000	0.79938	GCT	LGR5	-	NULL	ENSG00000139292		0.458	LGR5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LGR5	HGNC	protein_coding	OTTHUMT00000404744.1	-	0.00	62	0	G	NM_003667		71978455	+1	tier1	-	no_errors	ENST00000266674	ensembl	human	known	74_37	missense	7.02	52	4	SNP	0.850	A
LMTK2	22853	genome.wustl.edu	37	7	97821009	97821009	+	Missense_Mutation	SNP	G	G	A	rs531778656		TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr7:97821009G>A	ENST00000297293.5	+	11	1525	c.1232G>A	c.(1231-1233)cGg>cAg	p.R411Q		NM_014916.3	NP_055731.2	Q8IWU2	LMTK2_HUMAN	lemur tyrosine kinase 2	411					early endosome to late endosome transport (GO:0045022)|endocytic recycling (GO:0032456)|negative regulation of catalytic activity (GO:0043086)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|receptor recycling (GO:0001881)|transferrin transport (GO:0033572)	early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)	ATP binding (GO:0005524)|myosin VI binding (GO:0070853)|protein phosphatase inhibitor activity (GO:0004864)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(13)|lung(25)|ovary(1)|pancreas(2)|skin(2)|stomach(3)	59	all_cancers(62;3.23e-09)|all_epithelial(64;7.65e-10)|Lung NSC(181;0.00902)|all_lung(186;0.0104)|Esophageal squamous(72;0.0125)					ACTTACCTGCGGCTGCAGAGC	0.542													G|||	1	0.000199681	0.0	0.0	5008	,	,		15350	0.0		0.0	False		,,,				2504	0.001																0													65.0	60.0	62.0					7																	97821009		2203	4300	6503	SO:0001583	missense	0			AB029002	CCDS5654.1	7q22.1	2014-06-12			ENSG00000164715	ENSG00000164715			17880	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 100"""	610989				15005709	Standard	NM_014916		Approved	KIAA1079, KPI2, KPI-2, cprk, LMR2, BREK, AATYK2, PPP1R100	uc003upd.2	Q8IWU2	OTTHUMG00000154256	ENST00000297293.5:c.1232G>A	7.37:g.97821009G>A	ENSP00000297293:p.Arg411Gln		A4D272|Q75MG7|Q9UPS3	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.R411Q	ENST00000297293.5	37	c.1232	CCDS5654.1	7	.	.	.	.	.	.	.	.	.	.	G	22.5	4.299652	0.81136	.	.	ENSG00000164715	ENST00000297293	T	0.62105	0.05	5.41	5.41	0.78517	Protein kinase-like domain (1);	0.000000	0.85682	D	0.000000	T	0.78729	0.4329	M	0.73598	2.24	0.80722	D	1	D	0.89917	1.0	D	0.71656	0.974	T	0.76782	-0.2832	10	0.37606	T	0.19	.	18.551	0.91065	0.0:0.0:1.0:0.0	.	411	Q8IWU2	LMTK2_HUMAN	Q	411	ENSP00000297293:R411Q	ENSP00000297293:R411Q	R	+	2	0	LMTK2	97658945	1.000000	0.71417	0.829000	0.32907	0.786000	0.44442	9.420000	0.97426	2.710000	0.92621	0.655000	0.94253	CGG	LMTK2	-	superfamily_Kinase-like_dom	ENSG00000164715		0.542	LMTK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LMTK2	HGNC	protein_coding	OTTHUMT00000334560.1	-	0.00	45	0	G	NM_014916		97821009	+1	tier1	-	no_errors	ENST00000297293	ensembl	human	known	74_37	missense	7.14	52	4	SNP	1.000	A
MCCC2	64087	genome.wustl.edu	37	5	70945901	70945901	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr5:70945901G>T	ENST00000340941.6	+	15	1508	c.1379G>T	c.(1378-1380)aGa>aTa	p.R460I	MCCC2_ENST00000323375.8_Missense_Mutation_p.R422I	NM_022132.4	NP_071415.1	Q9HCC0	MCCB_HUMAN	methylcrotonoyl-CoA carboxylase 2 (beta)	460	Carboxyltransferase.				biotin metabolic process (GO:0006768)|branched-chain amino acid catabolic process (GO:0009083)|cellular nitrogen compound metabolic process (GO:0034641)|coenzyme A metabolic process (GO:0015936)|leucine catabolic process (GO:0006552)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|methylcrotonoyl-CoA carboxylase activity (GO:0004485)			endometrium(2)|kidney(15)|large_intestine(2)|lung(9)|ovary(1)|urinary_tract(1)	30		Lung NSC(167;0.000697)|Prostate(74;0.0107)|Ovarian(174;0.0175)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;2.04e-54)	Biotin(DB00121)	CCCAGCCCAAGATTTCTCTAC	0.433																																																	0													89.0	94.0	92.0					5																	70945901		2203	4300	6503	SO:0001583	missense	0			AF310971	CCDS34184.1	5q12-q13	2010-04-30	2010-04-30		ENSG00000131844	ENSG00000131844	6.4.1.4		6937	protein-coding gene	gene with protein product		609014	"""methylcrotonoyl-Coenzyme A carboxylase 2 (beta)"""				Standard	NM_022132		Approved	MCCB	uc003kbs.4	Q9HCC0	OTTHUMG00000162505	ENST00000340941.6:c.1379G>T	5.37:g.70945901G>T	ENSP00000343657:p.Arg460Ile		A6NIY9|Q96C27|Q9Y4L7	Missense_Mutation	SNP	pfam_Carboxyl_trans,pfscan_COA_CT_N,pfscan_COA_CT_C	p.R460I	ENST00000340941.6	37	c.1379	CCDS34184.1	5	.	.	.	.	.	.	.	.	.	.	G	27.6	4.848420	0.91277	.	.	ENSG00000131844	ENST00000340941;ENST00000323375;ENST00000509539	D;D;D	0.97710	-4.5;-4.5;-4.5	5.83	5.83	0.93111	Acetyl-coenzyme A carboxyltransferase, C-terminal (1);Carboxyl transferase (1);	0.000000	0.85682	D	0.000000	D	0.99321	0.9762	H	0.98155	4.16	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98681	1.0692	10	0.87932	D	0	-21.5911	18.8841	0.92368	0.0:0.0:1.0:0.0	.	460	Q9HCC0	MCCB_HUMAN	I	460;422;232	ENSP00000343657:R460I;ENSP00000327308:R422I;ENSP00000425474:R232I	ENSP00000327308:R422I	R	+	2	0	MCCC2	70981657	1.000000	0.71417	0.996000	0.52242	0.748000	0.42578	9.837000	0.99465	2.763000	0.94921	0.655000	0.94253	AGA	MCCC2	-	pfam_Carboxyl_trans,pfscan_COA_CT_C	ENSG00000131844		0.433	MCCC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MCCC2	HGNC	protein_coding	OTTHUMT00000369243.4	-	0.00	55	0	G			70945901	+1	tier1	-	no_errors	ENST00000340941	ensembl	human	known	74_37	missense	6.56	57	4	SNP	0.998	T
MAP1B	4131	genome.wustl.edu	37	5	71494166	71494166	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr5:71494166T>C	ENST00000296755.7	+	5	5282	c.4984T>C	c.(4984-4986)Ttc>Ctc	p.F1662L		NM_005909.3	NP_005900.2	P46821	MAP1B_HUMAN	microtubule-associated protein 1B	1662					axon extension (GO:0048675)|cellular process (GO:0009987)|dendrite development (GO:0016358)|establishment of monopolar cell polarity (GO:0061162)|microtubule bundle formation (GO:0001578)|mitochondrion transport along microtubule (GO:0047497)|negative regulation of intracellular transport (GO:0032387)|positive regulation of axon extension (GO:0045773)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|plasma membrane (GO:0005886)|synapse (GO:0045202)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(42)|liver(1)|lung(28)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	104		Lung NSC(167;0.00202)|Ovarian(174;0.0175)|Prostate(461;0.142)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;7.99e-54)		TGCTATGGACTTCAGTCGACA	0.488																																					Melanoma(17;367 822 11631 31730 47712)												0													106.0	106.0	106.0					5																	71494166		2203	4300	6503	SO:0001583	missense	0			L06237	CCDS4012.1	5q13	2014-06-12			ENSG00000131711	ENSG00000131711			6836	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 102"""	157129				1881920	Standard	NM_005909		Approved	MAP5, PPP1R102	uc003kbw.4	P46821	OTTHUMG00000100952	ENST00000296755.7:c.4984T>C	5.37:g.71494166T>C	ENSP00000296755:p.Phe1662Leu		A2BDK5	Missense_Mutation	SNP	pfam_MAP1B_neuraxin	p.F1662L	ENST00000296755.7	37	c.4984	CCDS4012.1	5	.	.	.	.	.	.	.	.	.	.	T	16.42	3.118580	0.56505	.	.	ENSG00000131711	ENST00000296755	T	0.04317	3.65	5.19	5.19	0.71726	.	0.000000	0.64402	D	0.000003	T	0.09069	0.0224	N	0.08118	0	0.58432	D	0.999997	D;D	0.69078	0.997;0.997	D;D	0.75020	0.985;0.985	T	0.46857	-0.9161	10	0.87932	D	0	-17.9216	15.0421	0.71799	0.0:0.0:0.0:1.0	.	1536;1662	A2BDK6;P46821	.;MAP1B_HUMAN	L	1662	ENSP00000296755:F1662L	ENSP00000296755:F1662L	F	+	1	0	MAP1B	71529922	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.698000	0.84413	1.971000	0.57363	0.260000	0.18958	TTC	MAP1B	-	NULL	ENSG00000131711		0.488	MAP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAP1B	HGNC	protein_coding	OTTHUMT00000218561.6		0.00	47	0	T	NM_005909		71494166	+1			no_errors	ENST00000296755	ensembl	human	known	74_37	missense	6.38	44	3	SNP	1.000	C
MCPH1	79648	genome.wustl.edu	37	8	6289098	6289099	+	Frame_Shift_Ins	INS	-	-	A			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr8:6289098_6289099insA	ENST00000344683.5	+	4	388_389	c.312_313insA	c.(313-315)aaafs	p.K105fs	MCPH1_ENST00000522905.1_Frame_Shift_Ins_p.K105fs|MCPH1_ENST00000519480.1_Frame_Shift_Ins_p.K105fs	NM_024596.3	NP_078872	Q8NEM0	MCPH1_HUMAN	microcephalin 1	105					cerebral cortex development (GO:0021987)|mitotic cell cycle (GO:0000278)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleoplasm (GO:0005654)	identical protein binding (GO:0042802)		AGPAT5/MCPH1(2)	central_nervous_system(1)|large_intestine(4)|skin(1)	6		Hepatocellular(245;0.0663)		Colorectal(4;0.0505)		CAAGCCTAATTAAAAAAAAAGT	0.277																																					Colon(95;1448 1467 8277 34473 35819)												0																																										SO:0001589	frameshift_variant	0			AK022909	CCDS43689.1, CCDS55190.1, CCDS55191.1	8p23.1	2012-11-26	2007-11-26		ENSG00000147316	ENSG00000147316			6954	protein-coding gene	gene with protein product	"""BRCT-repeat inhibitor of TERT expression 1"""	607117	"""microcephaly, primary autosomal recessive 1"""			9683597, 17925396	Standard	NM_024596		Approved	FLJ12847, BRIT1	uc003wqi.3	Q8NEM0	OTTHUMG00000163618	ENST00000344683.5:c.321dupA	8.37:g.6289107_6289107dupA	ENSP00000342924:p.Lys105fs		B4DWW2|E9PGU5|E9PH63|Q66GU1|Q9H9C7	Frame_Shift_Ins	INS	pfam_Microcephalin,pfam_BRCT_dom,superfamily_BRCT_dom,smart_BRCT_dom,pfscan_BRCT_dom,prints_BRCA1	p.R107fs	ENST00000344683.5	37	c.312_313	CCDS43689.1	8																																																																																			MCPH1	-	NULL	ENSG00000147316		0.277	MCPH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MCPH1	HGNC	protein_coding	OTTHUMT00000374532.2		0.00	46	0	-	NM_024596		6289099	+1	tier1		no_errors	ENST00000344683	ensembl	human	known	74_37	frame_shift_ins	11.43	31	4	INS	0.002:0.022	A
MEI1	150365	genome.wustl.edu	37	22	42180664	42180664	+	Silent	SNP	C	C	T			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr22:42180664C>T	ENST00000401548.3	+	26	3262	c.3222C>T	c.(3220-3222)gcC>gcT	p.A1074A	MEI1_ENST00000476893.1_3'UTR|MEI1_ENST00000400107.1_Silent_p.A407A|MEI1_ENST00000300398.4_Silent_p.A82A	NM_152513.3	NP_689726.3			meiosis inhibitor 1											breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(10)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	30						TTTCCTCTGCCCTGGTAGCCC	0.592																																																	0													37.0	39.0	39.0					22																	42180664		1994	4169	6163	SO:0001819	synonymous_variant	0			AK092934	CCDS46718.1	22q13.2	2013-10-11			ENSG00000167077	ENSG00000167077			28613	protein-coding gene	gene with protein product	"""spermatogenesis associated 38"""	608797				16683055	Standard	XM_006724154		Approved	MGC40042, SPATA38	uc003baz.1	Q5TIA1	OTTHUMG00000030083	ENST00000401548.3:c.3222C>T	22.37:g.42180664C>T				Silent	SNP	superfamily_ARM-type_fold	p.A1074	ENST00000401548.3	37	c.3222	CCDS46718.1	22																																																																																			MEI1	-	NULL	ENSG00000167077		0.592	MEI1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	MEI1	HGNC	protein_coding	OTTHUMT00000074937.3		0.00	66	0	C	NM_152513		42180664	+1			no_errors	ENST00000401548	ensembl	human	known	74_37	silent	6.45	58	4	SNP	0.990	T
METTL11B	149281	genome.wustl.edu	37	1	170129813	170129813	+	Silent	SNP	A	A	G			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr1:170129813A>G	ENST00000439373.2	+	2	416	c.309A>G	c.(307-309)aaA>aaG	p.K103K	METTL11B_ENST00000367764.3_3'UTR	NM_001136107.1	NP_001129579.1	Q5VVY1	NTM1B_HUMAN	methyltransferase like 11B	103						nucleus (GO:0005634)	methyltransferase activity (GO:0008168)			NS(1)|breast(2)|endometrium(3)|prostate(2)	8						CCTCTCAGAAATTTCTTAGGA	0.438																																																	0													50.0	46.0	47.0					1																	170129813		692	1591	2283	SO:0001819	synonymous_variant	0			AL445203, CAH72139	CCDS44275.1	1q24.2	2012-11-05	2008-06-11	2008-06-11	ENSG00000203740	ENSG00000203740			31932	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 184"""	C1orf184			Standard	NM_001136107		Approved	HOMT1B	uc009wvv.1	Q5VVY1	OTTHUMG00000035959	ENST00000439373.2:c.309A>G	1.37:g.170129813A>G			B2RXI0	Silent	SNP	pfam_DUF858_MeTrfase_lik,pfam_Methyltransf_11,pirsf_DUF858_MeTrfase_lik	p.K103	ENST00000439373.2	37	c.309	CCDS44275.1	1																																																																																			METTL11B	-	pfam_DUF858_MeTrfase_lik,pirsf_DUF858_MeTrfase_lik	ENSG00000203740		0.438	METTL11B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	METTL11B	HGNC	protein_coding	OTTHUMT00000087586.2	-	0.00	74	0	A	NM_001136107		170129813	+1	tier1	-	no_errors	ENST00000439373	ensembl	human	known	74_37	silent	27.27	79	30	SNP	1.000	G
MIA2	117153	genome.wustl.edu	37	14	39716400	39716400	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr14:39716400C>G	ENST00000280082.3	+	4	821	c.622C>G	c.(622-624)Cgt>Ggt	p.R208G	MIA2_ENST00000556784.1_Missense_Mutation_p.R207G|RP11-407N17.3_ENST00000553728.1_Missense_Mutation_p.R208G	NM_054024.3	NP_473365.3	Q96PC5	MIA2_HUMAN	melanoma inhibitory activity 2	208					cholesterol homeostasis (GO:0042632)|triglyceride homeostasis (GO:0070328)	endoplasmic reticulum exit site (GO:0070971)|extracellular region (GO:0005576)		p.R208C(2)		NS(1)|breast(2)|cervix(1)|kidney(1)|large_intestine(6)|lung(13)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	31	Hepatocellular(127;0.213)		LUAD - Lung adenocarcinoma(48;0.000565)|Lung(238;0.000711)	GBM - Glioblastoma multiforme(112;0.0216)		GGAACAGGATCGTATTCCAGA	0.443																																																	2	Substitution - Missense(2)	NS(1)|prostate(1)											92.0	92.0	92.0					14																	39716400		2203	4300	6503	SO:0001583	missense	0			BC035981	CCDS9672.1	14q13.2	2007-05-01			ENSG00000150526	ENSG00000150526			18432	protein-coding gene	gene with protein product		608001				12586826	Standard	NM_054024		Approved	FLJ22404	uc001wux.3	Q96PC5	OTTHUMG00000028831	ENST00000280082.3:c.622C>G	14.37:g.39716400C>G	ENSP00000280082:p.Arg208Gly		A1L4H0|Q9H6C1	Missense_Mutation	SNP	pfam_SH3_2,superfamily_SH3_domain	p.R207G	ENST00000280082.3	37	c.619	CCDS9672.1	14	.	.	.	.	.	.	.	.	.	.	C	0.981	-0.697050	0.03279	.	.	ENSG00000150526;ENSG00000150526;ENSG00000258941	ENST00000280082;ENST00000556784;ENST00000553728	T;T;T	0.44083	0.93;0.94;3.27	5.11	2.03	0.26663	.	0.764956	0.11164	N	0.592774	T	0.20618	0.0496	N	0.08118	0	0.09310	N	1	B;B	0.10296	0.003;0.001	B;B	0.14023	0.005;0.01	T	0.25467	-1.0131	9	.	.	.	-9.1323	7.3159	0.26501	0.0:0.7011:0.1368:0.1621	.	208;208	Q96PC5;Q96PC5-2	MIA2_HUMAN;.	G	208;207;208	ENSP00000280082:R208G;ENSP00000451934:R207G;ENSP00000452252:R208G	.	R	+	1	0	MIA2;RP11-407N17.3	38786151	0.003000	0.15002	0.010000	0.14722	0.142000	0.21351	1.429000	0.34903	0.668000	0.31126	0.655000	0.94253	CGT	MIA2	-	NULL	ENSG00000150526		0.443	MIA2-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	MIA2	HGNC	protein_coding	OTTHUMT00000276768.3	-	0.00	83	0	C	NM_054024		39716400	+1	tier1	-	no_errors	ENST00000556784	ensembl	human	putative	74_37	missense	31.46	61	28	SNP	0.022	G
MICALCL	84953	genome.wustl.edu	37	11	12315446	12315446	+	Silent	SNP	A	A	G			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr11:12315446A>G	ENST00000256186.2	+	3	759	c.468A>G	c.(466-468)aaA>aaG	p.K156K		NM_032867.2	NP_116256.2	Q6ZW33	MICLK_HUMAN	MICAL C-terminal like	156					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)	mitogen-activated protein kinase binding (GO:0051019)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(5)|lung(5)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)	30				Epithelial(150;0.00177)		ACCGGGAAAAAGGGAGTACTG	0.562																																																	0													61.0	70.0	67.0					11																	12315446		1953	4135	6088	SO:0001819	synonymous_variant	0			BK000463	CCDS41620.1	11p15.3	2005-11-01			ENSG00000133808	ENSG00000133808			25933	protein-coding gene	gene with protein product		612355				12110185	Standard	NM_032867		Approved	FLJ14966	uc001mkg.1	Q6ZW33	OTTHUMG00000165777	ENST00000256186.2:c.468A>G	11.37:g.12315446A>G			Q7RTP7|Q96JU6	Silent	SNP	pfam_DUF3585,smart_ProQ/FinO	p.K156	ENST00000256186.2	37	c.468	CCDS41620.1	11																																																																																			MICALCL	-	NULL	ENSG00000133808		0.562	MICALCL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MICALCL	HGNC	protein_coding	OTTHUMT00000386164.1	-	0.00	69	0	A	NM_032867		12315446	+1	tier1	-	no_errors	ENST00000256186	ensembl	human	known	74_37	silent	6.67	56	4	SNP	0.000	G
MIR130B	406920	genome.wustl.edu	37	22	22007313	22007313	+	RNA	SNP	G	G	T			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr22:22007313G>T	ENST00000385018.1	+	0	0				MIR301B_ENST00000390813.1_RNA	NR_029845.1				microRNA 130b																		GCTCTGAGAAGCAGTGCAATG	0.612																																																	0													47.0	50.0	49.0					22																	22007313		1554	3541	5095			0					22	2011-09-12		2008-12-18	ENSG00000207751	ENSG00000207751		"""ncRNAs / Micro RNAs"""	31515	non-coding RNA	RNA, micro		613682		MIRN130B			Standard	NR_029845		Approved	hsa-mir-130b	uc011aii.1				22.37:g.22007313G>T				RNA	SNP	-	NULL	ENST00000385018.1	37	NULL		22																																																																																			MIR301B	-	-	ENSG00000212102		0.612	MIR130B-201	KNOWN	basic	miRNA	MIR301B	HGNC	miRNA		-	0.00	57	0	G	NR_029845		22007313	+1	tier1	-	no_errors	ENST00000390813	ensembl	human	known	74_37	rna	10.53	34	4	SNP	0.998	T
MMP3	4314	genome.wustl.edu	37	11	102712941	102712941	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr11:102712941C>A	ENST00000299855.5	-	4	825	c.569G>T	c.(568-570)gGg>gTg	p.G190V		NM_002422.3	NP_002413.1	P08254	MMP3_HUMAN	matrix metallopeptidase 3 (stromelysin 1, progelatinase)	190					cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of hydrogen peroxide metabolic process (GO:0010727)|positive regulation of oxidative stress-induced cell death (GO:1903209)|proteolysis (GO:0006508)|regulation of cell migration (GO:0030334)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|endopeptidase activity (GO:0004175)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(3)|large_intestine(3)|liver(1)|lung(7)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	22		all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)		BRCA - Breast invasive adenocarcinoma(274;0.0142)	Marimastat(DB00786)	TCCATTAATCCCTGGCCCAGG	0.383																																																	0													121.0	115.0	117.0					11																	102712941		2203	4299	6502	SO:0001583	missense	0			X05232	CCDS8323.1	11q22.3	2012-10-02	2005-08-08		ENSG00000149968	ENSG00000149968	3.4.24.17		7173	protein-coding gene	gene with protein product		185250	"""matrix metalloproteinase 3 (stromelysin 1, progelatinase)"""	STMY1, STMY			Standard	NM_002422		Approved		uc001phj.1	P08254	OTTHUMG00000048254	ENST00000299855.5:c.569G>T	11.37:g.102712941C>A	ENSP00000299855:p.Gly190Val		B2R8B8|Q3B7S0|Q6GRF8	Missense_Mutation	SNP	pirsf_Pept_M10A_Metazoans,pfam_Pept_M10_metallopeptidase,pfam_Hemopexin-like_repeat,pfam_Peptidoglycan-bd-like,superfamily_Hemopexin-like_dom,superfamily_Peptidoglycan-bd-like,smart_Peptidase_Metallo,smart_Hemopexin-like_repeat,prints_Pept_M10A	p.G190V	ENST00000299855.5	37	c.569	CCDS8323.1	11	.	.	.	.	.	.	.	.	.	.	C	18.26	3.584463	0.65992	.	.	ENSG00000149968	ENST00000299855	T	0.18502	2.21	5.34	4.42	0.53409	Peptidase M10, metallopeptidase (1);Peptidase, metallopeptidase (1);Metallopeptidase, catalytic domain (1);	0.417097	0.17670	N	0.166010	T	0.50990	0.1648	H	0.96943	3.91	0.80722	D	1	D	0.76494	0.999	D	0.70227	0.968	T	0.59762	-0.7393	10	0.87932	D	0	.	7.5882	0.28006	0.0:0.7154:0.1545:0.13	.	190	P08254	MMP3_HUMAN	V	190	ENSP00000299855:G190V	ENSP00000299855:G190V	G	-	2	0	MMP3	102218151	0.326000	0.24669	0.582000	0.28627	0.820000	0.46376	1.259000	0.32956	2.937000	0.99478	0.650000	0.86243	GGG	MMP3	-	pirsf_Pept_M10A_Metazoans,pfam_Pept_M10_metallopeptidase,smart_Peptidase_Metallo	ENSG00000149968		0.383	MMP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MMP3	HGNC	protein_coding	OTTHUMT00000109758.2	-	0.00	94	0	C	NM_002422		102712941	-1	tier1	-	no_errors	ENST00000299855	ensembl	human	known	74_37	missense	36.28	72	41	SNP	0.790	A
MRC2	9902	genome.wustl.edu	37	17	60742085	60742085	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr17:60742085C>T	ENST00000303375.5	+	2	697	c.295C>T	c.(295-297)Cca>Tca	p.P99S	Y_RNA_ENST00000384652.1_RNA	NM_006039.4	NP_006030.2	Q9UBG0	MRC2_HUMAN	mannose receptor, C type 2	99	Ricin B-type lectin. {ECO:0000255|PROSITE-ProRule:PRU00174}.				collagen catabolic process (GO:0030574)|endocytosis (GO:0006897)|osteoblast differentiation (GO:0001649)	focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)|collagen binding (GO:0005518)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(11)|lung(28)|ovary(2)|prostate(1)|skin(3)	53						CACAGGCTGGCCAGGCACCAA	0.612																																																	0													77.0	71.0	73.0					17																	60742085		2203	4300	6503	SO:0001583	missense	0			AB014609	CCDS11634.1	17q23	2011-08-30				ENSG00000011028		"""CD molecules"", ""C-type lectin domain containing"""	16875	protein-coding gene	gene with protein product		612264				9734811, 8702911	Standard	NM_006039		Approved	KIAA0709, ENDO180, CLEC13E, CD280	uc002jad.4	Q9UBG0		ENST00000303375.5:c.295C>T	17.37:g.60742085C>T	ENSP00000307513:p.Pro99Ser		A6H8K4|D3DU08|Q7LGE7|Q9Y5P9	Missense_Mutation	SNP	pfam_C-type_lectin,pfam_FN_type2_col-bd,pfam_Herpes_UL45-like,superfamily_C-type_lectin_fold,superfamily_Ricin_B_lectin,superfamily_Kringle-like,smart_Ricin_B_lectin,smart_FN_type2_col-bd,smart_C-type_lectin,pfscan_FN_type2_col-bd,pfscan_C-type_lectin,pfscan_Ricin_B_lectin,prints_AntifreezeII	p.P99S	ENST00000303375.5	37	c.295	CCDS11634.1	17	.	.	.	.	.	.	.	.	.	.	C	9.360	1.067703	0.20067	.	.	ENSG00000011028	ENST00000303375	T	0.27402	1.67	5.23	5.23	0.72850	Ricin B-related lectin (1);Ricin B lectin (2);	0.426776	0.25885	N	0.027674	T	0.16428	0.0395	N	0.13098	0.295	0.80722	D	1	B	0.26809	0.16	B	0.17979	0.02	T	0.06144	-1.0843	10	0.07175	T	0.84	-25.5424	14.5256	0.67887	0.1471:0.8529:0.0:0.0	.	99	Q9UBG0	MRC2_HUMAN	S	99	ENSP00000307513:P99S	ENSP00000307513:P99S	P	+	1	0	MRC2	58095817	1.000000	0.71417	0.998000	0.56505	0.990000	0.78478	2.538000	0.45710	2.450000	0.82876	0.561000	0.74099	CCA	MRC2	-	superfamily_Ricin_B_lectin,smart_Ricin_B_lectin,pfscan_Ricin_B_lectin	ENSG00000011028		0.612	MRC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRC2	HGNC	protein_coding	OTTHUMT00000445152.1	-	0.00	35	0	C			60742085	+1	tier1	-	no_errors	ENST00000303375	ensembl	human	known	74_37	missense	9.30	39	4	SNP	0.992	T
MRPS2	51116	genome.wustl.edu	37	9	138395958	138395958	+	Silent	SNP	T	T	C			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr9:138395958T>C	ENST00000371785.1	+	5	1079	c.870T>C	c.(868-870)gcT>gcC	p.A290A	C9orf116_ENST00000371791.1_5'Flank|MRPS2_ENST00000241600.5_Silent_p.A290A|RP11-426A6.5_ENST00000415062.1_RNA			Q9Y399	RT02_HUMAN	mitochondrial ribosomal protein S2	290					translation (GO:0006412)	mitochondrion (GO:0005739)|small ribosomal subunit (GO:0015935)	structural constituent of ribosome (GO:0003735)			large_intestine(2)|lung(1)|prostate(2)|urinary_tract(1)	6				OV - Ovarian serous cystadenocarcinoma(145;1.46e-53)|Epithelial(140;2.04e-47)|all cancers(34;1.23e-42)		CTCCTGGGGCTGACATGAGCC	0.652																																																	0													21.0	23.0	22.0					9																	138395958		2201	4300	6501	SO:0001819	synonymous_variant	0			AB051627	CCDS6990.1	9q34	2012-09-13			ENSG00000122140	ENSG00000122140		"""Mitochondrial ribosomal proteins / small subunits"""	14495	protein-coding gene	gene with protein product		611971					Standard	NM_016034		Approved	CGI-91	uc004cfv.5	Q9Y399	OTTHUMG00000020910	ENST00000371785.1:c.870T>C	9.37:g.138395958T>C			Q5T899|Q9BSQ4	Silent	SNP	pfam_Ribosomal_S2,superfamily_Ribosomal_S2_flav_dom,prints_Ribosomal_S2	p.A290	ENST00000371785.1	37	c.870	CCDS6990.1	9																																																																																			MRPS2	-	NULL	ENSG00000122140		0.652	MRPS2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MRPS2	HGNC	protein_coding	OTTHUMT00000054998.1		0.00	54	0	T			138395958	+1			no_errors	ENST00000241600	ensembl	human	known	74_37	silent	8.89	41	4	SNP	0.000	C
MT-ND5	4540	genome.wustl.edu	37	M	14110	14110	+	Missense_Mutation	SNP	T	T	A			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chrM:14110T>A	ENST00000361567.2	+	1	1774	c.1774T>A	c.(1774-1776)Ttc>Atc	p.F592I	MT-TT_ENST00000387460.2_RNA|MT-TS2_ENST00000387449.1_RNA|MT-TL2_ENST00000387456.1_RNA|MT-TP_ENST00000387461.2_RNA|MT-TH_ENST00000387441.1_RNA|MT-CYB_ENST00000361789.2_5'Flank|MT-TE_ENST00000387459.1_RNA			P03915	NU5M_HUMAN	mitochondrially encoded NADH dehydrogenase 5	592					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(4)|endometrium(29)|kidney(33)|pancreas(1)|prostate(7)	74						TCCTCTCTTTCTTCTTCCCAC	0.378																																																	0																																										SO:0001583	missense	0					mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198786	ENSG00000198786	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7461	protein-coding gene	gene with protein product	"""complex I ND5 subunit"", ""NADH-ubiquinone oxidoreductase chain 5"""	516005	"""NADH dehydrogenase 5"""	MTND5			Standard			Approved	ND5, NAD5		P03915		ENST00000361567.2:c.1774T>A	M.37:g.14110T>A	ENSP00000354813:p.Phe592Ile		Q34773|Q8WCY3	Missense_Mutation	SNP	pfam_NADH_UbQ/plastoQ_OxRdtase,pfam_NADH_DH_su5_C,pfam_NADH_UbQ_OxRdtase_chain5/L_N,tigrfam_NADHpl_OxRdtase_5	p.F592I	ENST00000361567.2	37	c.1774		MT																																																																																			MT-ND5	-	pfam_NADH_DH_su5_C	ENSG00000198786		0.378	MT-ND5-201	KNOWN	basic|appris_principal	protein_coding	MT-ND5	HGNC	protein_coding		-	0.00	48	0	T	YP_003024036		14110	+1	tier1	-	no_errors	ENST00000361567	ensembl	human	known	74_37	missense	15.38	22	4	SNP	NULL	A
MTERF1	7978	genome.wustl.edu	37	7	91503128	91503128	+	Missense_Mutation	SNP	T	T	A			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr7:91503128T>A	ENST00000351870.3	-	3	1073	c.980A>T	c.(979-981)aAg>aTg	p.K327M	MTERF_ENST00000406735.2_Missense_Mutation_p.K307M|MTERF_ENST00000419292.1_Missense_Mutation_p.K307M	NM_006980.3	NP_008911.1	Q99551	MTEF1_HUMAN		327	Interaction with DNA.				DNA geometric change (GO:0032392)|DNA-templated transcription, termination (GO:0006353)|gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|termination of mitochondrial transcription (GO:0006393)|transcription from mitochondrial promoter (GO:0006390)	mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	double-stranded DNA binding (GO:0003690)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(4)|liver(1)|lung(2)|skin(1)	14	all_cancers(62;2.28e-09)|all_epithelial(64;1.07e-07)|Breast(17;0.00371)|all_hematologic(106;0.091)|all_lung(186;0.178)|Lung NSC(181;0.235)		STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.0993)|Kidney(17;0.118)|Epithelial(20;0.136)|LUSC - Lung squamous cell carcinoma(200;0.176)			ATCATTAAACTTTTTCTCTGC	0.353																																																	0													72.0	73.0	73.0					7																	91503128		2203	4300	6503	SO:0001583	missense	0																														ENST00000351870.3:c.980A>T	7.37:g.91503128T>A	ENSP00000248643:p.Lys327Met		A4D1E3|Q32NF8|Q53H51|Q9BVR7	Missense_Mutation	SNP	pfam_Mit_transcrip_term-rel,smart_Mit_transcrip_term-rel	p.K327M	ENST00000351870.3	37	c.980	CCDS5621.1	7	.	.	.	.	.	.	.	.	.	.	T	16.70	3.197194	0.58126	.	.	ENSG00000127989	ENST00000419292;ENST00000351870;ENST00000406735	T;T;T	0.13538	2.58;2.58;2.58	4.89	3.64	0.41730	.	0.256644	0.31660	N	0.007261	T	0.27967	0.0689	L	0.57536	1.79	0.40309	D	0.97869	D	0.61080	0.989	D	0.64144	0.922	T	0.01583	-1.1319	10	0.48119	T	0.1	-13.5258	10.9858	0.47520	0.0:0.0:0.156:0.844	.	327	Q99551	MTERF_HUMAN	M	307;327;307	ENSP00000414116:K307M;ENSP00000248643:K327M;ENSP00000384986:K307M	ENSP00000248643:K327M	K	-	2	0	MTERF	91341064	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	2.526000	0.45607	2.142000	0.66516	0.482000	0.46254	AAG	MTERF	-	pfam_Mit_transcrip_term-rel,smart_Mit_transcrip_term-rel	ENSG00000127989		0.353	MTERF-003	KNOWN	basic|CCDS	protein_coding	MTERF	HGNC	protein_coding	OTTHUMT00000342896.1	-	0.00	66	0	T			91503128	-1	tier1	-	no_errors	ENST00000351870	ensembl	human	known	74_37	missense	5.63	67	4	SNP	1.000	A
MUC5B	727897	genome.wustl.edu	37	11	1260766	1260766	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr11:1260766C>A	ENST00000529681.1	+	27	3611	c.3553C>A	c.(3553-3555)Cac>Aac	p.H1185N	MUC5B_ENST00000447027.1_Missense_Mutation_p.H1188N|RP11-532E4.2_ENST00000532061.2_RNA	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	1185	Cys-rich.				cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		CCCCAGTGGGCACTGCCTGGT	0.637																																																	0													43.0	54.0	51.0					11																	1260766		2007	4172	6179	SO:0001583	missense	0			U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.3553C>A	11.37:g.1260766C>A	ENSP00000436812:p.His1185Asn		O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Missense_Mutation	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,pfam_VWF_C,superfamily_TIL_dom,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_VWF_C,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_VWF_C	p.H1188N	ENST00000529681.1	37	c.3562	CCDS44515.2	11	.	.	.	.	.	.	.	.	.	.	C	15.84	2.952983	0.53293	.	.	ENSG00000117983	ENST00000529681;ENST00000447027;ENST00000349637;ENST00000406844	T;T	0.54071	0.59;0.59	4.84	2.72	0.32119	.	.	.	.	.	T	0.37892	0.1020	N	0.20574	0.59	0.09310	N	1	B;B	0.20368	0.015;0.044	B;B	0.14578	0.005;0.011	T	0.36744	-0.9735	9	0.87932	D	0	.	11.1262	0.48320	0.6261:0.3739:0.0:0.0	.	1878;1188	A7Y9J9;E9PBJ0	.;.	N	1185;1188;1186;1255	ENSP00000436812:H1185N;ENSP00000415793:H1188N	ENSP00000343037:H1186N	H	+	1	0	MUC5B	1217342	0.093000	0.21703	0.001000	0.08648	0.971000	0.66376	3.692000	0.54727	0.999000	0.39023	0.462000	0.41574	CAC	MUC5B	-	superfamily_TIL_dom	ENSG00000117983		0.637	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	MUC5B	HGNC	protein_coding	OTTHUMT00000390041.2	-	0.00	135	0	C	XM_001126093		1260766	+1	tier1	-	no_errors	ENST00000447027	ensembl	human	known	74_37	missense	31.34	92	42	SNP	0.037	A
MYL10	93408	genome.wustl.edu	37	7	101256805	101256805	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr7:101256805C>G	ENST00000223167.4	-	8	808	c.631G>C	c.(631-633)Gac>Cac	p.D211H		NM_138403.4	NP_612412.2	Q9BUA6	MYL10_HUMAN	myosin, light chain 10, regulatory	211	EF-hand 3. {ECO:0000255|PROSITE- ProRule:PRU00448}.					mitochondrion (GO:0005739)	calcium ion binding (GO:0005509)			breast(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)	12						TTTCTGTAGTCCAGGTTGCCG	0.557																																					Esophageal Squamous(24;575 709 17516 40384 51639)												0													141.0	122.0	128.0					7																	101256805		2203	4300	6503	SO:0001583	missense	0			BC002778	CCDS34713.1	7q22.1	2013-01-10			ENSG00000106436	ENSG00000106436		"""Myosins / Light chain"", ""EF-hand domain containing"""	29825	protein-coding gene	gene with protein product						1628631	Standard	NM_138403		Approved	MGC3479, MYLC2PL, PLRLC	uc003uyr.3	Q9BUA6	OTTHUMG00000157137	ENST00000223167.4:c.631G>C	7.37:g.101256805C>G	ENSP00000223167:p.Asp211His			Missense_Mutation	SNP	smart_EF_hand_dom,pfscan_EF_hand_dom	p.D211H	ENST00000223167.4	37	c.631	CCDS34713.1	7	.	.	.	.	.	.	.	.	.	.	C	20.8	4.053130	0.75960	.	.	ENSG00000106436	ENST00000223167	T	0.81078	-1.45	4.84	4.84	0.62591	EF-hand-like domain (1);	0.000000	0.64402	D	0.000001	D	0.90147	0.6921	M	0.84585	2.705	0.80722	D	1	D	0.76494	0.999	D	0.72075	0.976	D	0.91908	0.5537	10	0.87932	D	0	.	15.5111	0.75782	0.0:1.0:0.0:0.0	.	211	Q9BUA6	MYL10_HUMAN	H	211	ENSP00000223167:D211H	ENSP00000223167:D211H	D	-	1	0	MYL10	101043525	1.000000	0.71417	1.000000	0.80357	0.786000	0.44442	6.927000	0.75840	2.242000	0.73789	0.650000	0.86243	GAC	MYL10	-	NULL	ENSG00000106436		0.557	MYL10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYL10	HGNC	protein_coding	OTTHUMT00000347575.1	-	0.00	75	0	C	NM_138403		101256805	-1	tier1	-	no_errors	ENST00000223167	ensembl	human	known	74_37	missense	30.36	39	17	SNP	1.000	G
MYO7B	4648	genome.wustl.edu	37	2	128327486	128327486	+	Splice_Site	SNP	G	G	A			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr2:128327486G>A	ENST00000409816.2	+	5	624		c.e5+1		MYO7B_ENST00000389524.4_Splice_Site|MYO7B_ENST00000428314.1_Splice_Site			Q6PIF6	MYO7B_HUMAN	myosin VIIB							extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(46)|ovary(3)|pancreas(1)|prostate(3)|urinary_tract(1)	75	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0753)		ATCCTGGAGGGTAAGCATCAC	0.617																																																	0													31.0	33.0	32.0					2																	128327486		1957	4132	6089	SO:0001630	splice_region_variant	0				CCDS46405.1	2q21.1	2011-09-27			ENSG00000169994	ENSG00000169994		"""Myosins / Myosin superfamily : Class VII"""	7607	protein-coding gene	gene with protein product		606541				8022818, 8884266	Standard	NM_001080527		Approved		uc002top.3	Q6PIF6	OTTHUMG00000153419	ENST00000409816.2:c.592+1G>A	2.37:g.128327486G>A			Q14786|Q8TEE1	Splice_Site	SNP	-	e5+1	ENST00000409816.2	37	c.592+1	CCDS46405.1	2	.	.	.	.	.	.	.	.	.	.	G	21.6	4.179957	0.78564	.	.	ENSG00000169994	ENST00000389524;ENST00000428314;ENST00000409816	.	.	.	5.5	5.5	0.81552	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.7532	0.96277	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	MYO7B	128043956	1.000000	0.71417	1.000000	0.80357	0.692000	0.40212	7.670000	0.83925	2.738000	0.93877	0.555000	0.69702	.	MYO7B	-	-	ENSG00000169994		0.617	MYO7B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MYO7B	HGNC	protein_coding	OTTHUMT00000331124.3		0.00	85	0	G	XM_291001	Intron	128327486	+1			no_errors	ENST00000389524	ensembl	human	known	74_37	splice_site	5.00	76	4	SNP	1.000	A
MYT1	4661	genome.wustl.edu	37	20	62853285	62853285	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr20:62853285G>T	ENST00000328439.1	+	14	2645	c.2281G>T	c.(2281-2283)Gat>Tat	p.D761Y	MYT1_ENST00000360149.4_Missense_Mutation_p.D463Y|MYT1_ENST00000536311.1_Missense_Mutation_p.D788Y	NM_004535.2	NP_004526.1	Q99640	PMYT1_HUMAN	myelin transcription factor 1	0					G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of phosphatase activity (GO:0010923)|regulation of cell cycle (GO:0051726)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of mitosis (GO:0007088)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.D761H(1)		breast(4)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(12)|liver(1)|lung(17)|ovary(5)|prostate(2)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	55	all_cancers(38;1.82e-11)|all_epithelial(29;3.3e-13)|Lung NSC(23;5.21e-10)|all_lung(23;1.92e-09)					TTCTGAAGCAGATGACCAGGA	0.517																																					GBM(59;481 1041 20555 21139 33705)												1	Substitution - Missense(1)	lung(1)											54.0	55.0	55.0					20																	62853285		2203	4300	6503	SO:0001583	missense	0			M96980	CCDS13558.1	20q13.33	2014-03-24			ENSG00000196132	ENSG00000196132		"""Zinc fingers, C2HC-type containing"""	7622	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 2"""	600379		PLPB1		1280325, 9268380	Standard	NM_004535		Approved	MTF1, MYTI, ZC2HC4A, NZF2	uc002yii.3	Q01538	OTTHUMG00000149988	ENST00000328439.1:c.2281G>T	20.37:g.62853285G>T	ENSP00000327465:p.Asp761Tyr		B3KUN8|B4DXD4|D3DUA4|F8W164|I3L1V2|O14731|Q7LE24|Q8TCM9	Missense_Mutation	SNP	pfam_Myelin_TF,pfam_Znf_C2HC	p.D788Y	ENST00000328439.1	37	c.2362	CCDS13558.1	20	.	.	.	.	.	.	.	.	.	.	G	17.95	3.514338	0.64522	.	.	ENSG00000196132	ENST00000360149;ENST00000328439;ENST00000536311	T;T;T	0.51325	0.71;0.71;0.71	5.12	5.12	0.69794	Myelin transcription factor 1 (1);	0.056706	0.64402	D	0.000002	T	0.65811	0.2727	L	0.55481	1.735	0.58432	D	0.999998	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.81914	0.991;0.995;0.979	T	0.68187	-0.5475	10	0.66056	D	0.02	-22.5786	18.5518	0.91068	0.0:0.0:1.0:0.0	.	788;761;463	F5H7M8;Q01538;Q6P6D5	.;MYT1_HUMAN;.	Y	463;761;788	ENSP00000353269:D463Y;ENSP00000327465:D761Y;ENSP00000442412:D788Y	ENSP00000327465:D761Y	D	+	1	0	MYT1	62323729	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.332000	0.96446	2.396000	0.81511	0.655000	0.94253	GAT	MYT1	-	pfam_Myelin_TF	ENSG00000196132		0.517	MYT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYT1	HGNC	protein_coding	OTTHUMT00000080297.1		0.00	51	0	G	NM_004535		62853285	+1			no_errors	ENST00000536311	ensembl	human	known	74_37	missense	5.36	53	3	SNP	1.000	T
NARS2	79731	genome.wustl.edu	37	11	78282480	78282480	+	Missense_Mutation	SNP	G	G	T	rs367584549		TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr11:78282480G>T	ENST00000281038.5	-	2	526	c.151C>A	c.(151-153)Cgt>Agt	p.R51S	NARS2_ENST00000528850.1_5'UTR	NM_001243251.1|NM_024678.5	NP_001230180.1|NP_078954.4	Q96I59	SYNM_HUMAN	asparaginyl-tRNA synthetase 2, mitochondrial (putative)	51					asparaginyl-tRNA aminoacylation (GO:0006421)|gene expression (GO:0010467)|tRNA aminoacylation for protein translation (GO:0006418)	mitochondrion (GO:0005739)	asparagine-tRNA ligase activity (GO:0004816)|ATP binding (GO:0005524)|nucleic acid binding (GO:0003676)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(9)|ovary(2)|prostate(2)|skin(1)	27	all_cancers(14;2.63e-17)|all_epithelial(13;1.85e-19)				L-Asparagine(DB00174)	CGGACAGAACGAATCCATCCC	0.398																																																	0													91.0	83.0	85.0					11																	78282480		2200	4291	6491	SO:0001583	missense	0			BC007800	CCDS8261.1, CCDS58164.1	11q14.1	2011-07-01	2007-02-23		ENSG00000137513	ENSG00000137513	6.1.1.22	"""Aminoacyl tRNA synthetases / Class II"""	26274	protein-coding gene	gene with protein product	"""asparagine tRNA ligase 2, mitochondrial (putative)"""	612803				15779907	Standard	NM_024678		Approved	FLJ23441, SLM5	uc001ozi.3	Q96I59	OTTHUMG00000166702	ENST00000281038.5:c.151C>A	11.37:g.78282480G>T	ENSP00000281038:p.Arg51Ser		G3V178	Missense_Mutation	SNP	pfam_aa-tRNA-synt_II,pfam_NA-bd_OB_tRNA,superfamily_NA-bd_OB-fold,pfscan_aa-tRNA-synth_II,prints_Asp/Asn-tRNA-synth_IIb,tigrfam_Asn-tRNA-ligase	p.R51S	ENST00000281038.5	37	c.151	CCDS8261.1	11	.	.	.	.	.	.	.	.	.	.	G	27.2	4.809184	0.90707	.	.	ENSG00000137513	ENST00000281038;ENST00000529880	T;T	0.21543	2.0;2.0	5.24	5.24	0.73138	Nucleic acid-binding, OB-fold-like (1);Nucleic acid-binding, OB-fold (1);Nucleic acid binding, OB-fold, tRNA/helicase-type (1);	0.000000	0.85682	D	0.000000	T	0.56717	0.2004	M	0.90870	3.155	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	T	0.67086	-0.5759	10	0.87932	D	0	-11.6167	17.9465	0.89040	0.0:0.0:1.0:0.0	.	51	Q96I59	SYNM_HUMAN	S	51	ENSP00000281038:R51S;ENSP00000432240:R51S	ENSP00000281038:R51S	R	-	1	0	NARS2	77960128	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.243000	0.65395	2.605000	0.88082	0.591000	0.81541	CGT	NARS2	-	pfam_NA-bd_OB_tRNA,superfamily_NA-bd_OB-fold,tigrfam_Asn-tRNA-ligase	ENSG00000137513		0.398	NARS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NARS2	HGNC	protein_coding	OTTHUMT00000391138.2		0.00	46	0	G	NM_024678		78282480	-1			no_errors	ENST00000281038	ensembl	human	known	74_37	missense	5.17	54	3	SNP	1.000	T
NCAM2	4685	genome.wustl.edu	37	21	22664561	22664561	+	Splice_Site	SNP	G	G	A			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr21:22664561G>A	ENST00000400546.1	+	5	868	c.619G>A	c.(619-621)Gtg>Atg	p.V207M	NCAM2_ENST00000535285.1_Splice_Site_p.V232M|NCAM2_ENST00000284894.7_Splice_Site_p.V65M	NM_004540.3	NP_004531.2	O15394	NCAM2_HUMAN	neural cell adhesion molecule 2	207					axonal fasciculation (GO:0007413)|neuron cell-cell adhesion (GO:0007158)|sensory perception of smell (GO:0007608)	axon (GO:0030424)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(4)|cervix(2)|endometrium(8)|kidney(6)|large_intestine(22)|liver(4)|lung(49)|ovary(4)|prostate(4)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	108		Lung NSC(9;0.195)		all cancers(11;0.00102)|OV - Ovarian serous cystadenocarcinoma(11;0.00121)|Epithelial(23;0.00147)|Colorectal(24;0.174)		TATTGTTAATGGTAAGCAGTA	0.318																																																	0													140.0	140.0	140.0					21																	22664561		1824	4091	5915	SO:0001630	splice_region_variant	0				CCDS42910.1	21q21	2013-02-11			ENSG00000154654	ENSG00000154654		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7657	protein-coding gene	gene with protein product		602040				9226371	Standard	NM_004540		Approved	NCAM21, MGC51008	uc002yld.2	O15394	OTTHUMG00000078121	ENST00000400546.1:c.619+1G>A	21.37:g.22664561G>A			A8MQ06|B7Z841|Q7Z7F2	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom,prints_Neural_cell_adh	p.V207M	ENST00000400546.1	37	c.619	CCDS42910.1	21	.	.	.	.	.	.	.	.	.	.	G	25.1	4.605452	0.87157	.	.	ENSG00000154654	ENST00000400546;ENST00000284894;ENST00000535285	T;T;T	0.78707	1.59;-1.2;1.59	5.37	5.37	0.77165	.	0.000000	0.85682	D	0.000000	D	0.88415	0.6430	M	0.80847	2.515	0.80722	D	1	D;D;D	0.76494	0.998;0.999;0.999	D;D;D	0.68192	0.956;0.943;0.918	D	0.89635	0.3858	10	0.87932	D	0	-12.9893	18.0179	0.89247	0.0:0.0:1.0:0.0	.	232;65;207	B7Z841;B7Z5K2;O15394	.;.;NCAM2_HUMAN	M	207;65;232	ENSP00000383392:V207M;ENSP00000284894:V65M;ENSP00000441887:V232M	ENSP00000284894:V65M	V	+	1	0	NCAM2	21586432	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	9.391000	0.97249	2.662000	0.90505	0.655000	0.94253	GTG	NCAM2	-	prints_Neural_cell_adh	ENSG00000154654		0.318	NCAM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCAM2	HGNC	protein_coding	OTTHUMT00000170915.1		0.00	55	0	G	NM_004540	Missense_Mutation	22664561	+1			no_errors	ENST00000400546	ensembl	human	known	74_37	missense	8.33	33	3	SNP	1.000	A
NDUFS2	4720	genome.wustl.edu	37	1	161180118	161180118	+	Nonsense_Mutation	SNP	C	C	T			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr1:161180118C>T	ENST00000367993.3	+	9	1253	c.805C>T	c.(805-807)Cga>Tga	p.R269*	NDUFS2_ENST00000465923.1_3'UTR|NDUFS2_ENST00000476409.2_Nonsense_Mutation_p.R171*|NDUFS2_ENST00000392179.4_Nonsense_Mutation_p.R269*	NM_004550.4	NP_004541.1	O75306	NDUS2_HUMAN	NADH dehydrogenase (ubiquinone) Fe-S protein 2, 49kDa (NADH-coenzyme Q reductase)	269					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	4 iron, 4 sulfur cluster binding (GO:0051539)|electron carrier activity (GO:0009055)|metal ion binding (GO:0046872)|NAD binding (GO:0051287)|NADH dehydrogenase (ubiquinone) activity (GO:0008137)|quinone binding (GO:0048038)	p.R269*(1)		breast(2)|endometrium(1)|kidney(2)|large_intestine(3)|lung(8)|prostate(1)|skin(1)	18	all_cancers(52;1.16e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00376)		Doxorubicin(DB00997)	TAGGATCTGGCGAAATCGGAC	0.428											OREG0013941	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					1	Substitution - Nonsense(1)	prostate(1)											136.0	122.0	127.0					1																	161180118		2203	4300	6503	SO:0001587	stop_gained	0			BC008868	CCDS1224.1, CCDS53404.1	1q23.3	2011-07-04	2002-08-29		ENSG00000158864	ENSG00000158864	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7708	protein-coding gene	gene with protein product	"""complex I 49kDa subunit"", ""NADH dehydrogenase [ubiquinone] iron-sulfur protein 2, mitochondrial"""	602985	"""NADH dehydrogenase (ubiquinone) Fe-S protein 2 (49kD) (NADH-coenzyme Q reductase)"""			1832859, 9585441	Standard	NM_004550		Approved	CI-49	uc001fyw.3	O75306	OTTHUMG00000034344	ENST00000367993.3:c.805C>T	1.37:g.161180118C>T	ENSP00000356972:p.Arg269*	1814	D3DVG7|J3KPM7|Q5VTW0|Q969P3|Q9UEV3	Nonsense_Mutation	SNP	pfam_NADH_Q_OxRdtase_suD,tigrfam_NDH1_su_D/H	p.R269*	ENST00000367993.3	37	c.805	CCDS1224.1	1	.	.	.	.	.	.	.	.	.	.	C	37	6.635171	0.97722	.	.	ENSG00000158864	ENST00000367993;ENST00000392179;ENST00000476409	.	.	.	5.29	3.34	0.38264	.	0.491311	0.21033	N	0.081316	.	.	.	.	.	.	0.80722	A	1.000000	.	.	.	.	.	.	.	.	.	.	0.41790	T	0.15	.	12.174	0.54176	0.3321:0.6679:0.0:0.0	.	.	.	.	X	269;269;171	.	ENSP00000356972:R269X	R	+	1	2	NDUFS2	159446742	1.000000	0.71417	0.972000	0.41901	0.984000	0.73092	1.758000	0.38410	0.718000	0.32166	0.655000	0.94253	CGA	NDUFS2	-	pfam_NADH_Q_OxRdtase_suD,tigrfam_NDH1_su_D/H	ENSG00000158864		0.428	NDUFS2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NDUFS2	HGNC	protein_coding	OTTHUMT00000083015.1		0.00	36	0	C	NM_004550		161180118	+1			no_errors	ENST00000367993	ensembl	human	known	74_37	nonsense	10.00	18	2	SNP	0.998	T
NFATC2IP	84901	genome.wustl.edu	37	16	28970072	28970072	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr16:28970072C>T	ENST00000320805.4	+	6	956	c.881C>T	c.(880-882)gCc>gTc	p.A294V	NFATC2IP_ENST00000564978.1_Missense_Mutation_p.A15V|RP11-264B17.2_ENST00000569974.1_RNA|RP11-264B17.2_ENST00000568057.1_RNA|NFATC2IP_ENST00000562977.1_3'UTR|NFATC2IP_ENST00000568148.1_Missense_Mutation_p.A2V|MIR4517_ENST00000578855.1_RNA	NM_032815.3	NP_116204.3	Q8NCF5	NF2IP_HUMAN	nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2 interacting protein	294					cytokine production (GO:0001816)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(1)|endometrium(2)|large_intestine(1)|lung(5)|ovary(2)	11						GACCACATGGCCACCCACCTT	0.572																																																	0													87.0	85.0	86.0					16																	28970072		2197	4300	6497	SO:0001583	missense	0			AK074761	CCDS10645.1	16p11.2	2010-09-13			ENSG00000176953	ENSG00000176953			25906	protein-coding gene	gene with protein product		614525				15698469	Standard	NM_032815		Approved	FLJ14639, NIP45, RAD60, ESC2	uc002dru.3	Q8NCF5	OTTHUMG00000097763	ENST00000320805.4:c.881C>T	16.37:g.28970072C>T	ENSP00000324792:p.Ala294Val		B7Z4G5|Q66K34|Q6NVK1|Q8NFR2|Q96ST9	Missense_Mutation	SNP	pfam_Rad60/SUMO_like,smart_Ubiquitin_dom,pfscan_Ubiquitin_supergroup	p.A294V	ENST00000320805.4	37	c.881	CCDS10645.1	16	.	.	.	.	.	.	.	.	.	.	C	22.2	4.256197	0.80246	.	.	ENSG00000176953	ENST00000320805	T	0.23950	1.88	5.38	5.38	0.77491	Ubiquitin (1);	0.072447	0.53938	D	0.000050	T	0.46833	0.1413	M	0.61703	1.905	0.45415	D	0.998396	D;D	0.71674	0.988;0.998	P;D	0.66196	0.868;0.942	T	0.44050	-0.9353	10	0.87932	D	0	-20.5289	14.6509	0.68797	0.0:1.0:0.0:0.0	.	294;13	Q8NCF5;Q8NCF5-2	NF2IP_HUMAN;.	V	294	ENSP00000324792:A294V	ENSP00000324792:A294V	A	+	2	0	NFATC2IP	28877573	0.987000	0.35691	0.952000	0.39060	0.676000	0.39594	3.524000	0.53495	2.524000	0.85096	0.561000	0.74099	GCC	NFATC2IP	-	smart_Ubiquitin_dom	ENSG00000176953		0.572	NFATC2IP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NFATC2IP	HGNC	protein_coding	OTTHUMT00000214999.2		0.00	50	0	C	NM_032815		28970072	+1			no_errors	ENST00000320805	ensembl	human	known	74_37	missense	5.63	67	4	SNP	0.981	T
NFE2L2	4780	genome.wustl.edu	37	2	178098975	178098975	+	Missense_Mutation	SNP	A	A	T			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr2:178098975A>T	ENST00000397062.3	-	2	624	c.70T>A	c.(70-72)Tgg>Agg	p.W24R	NFE2L2_ENST00000423513.1_Missense_Mutation_p.W8R|NFE2L2_ENST00000464747.1_Missense_Mutation_p.W8R|NFE2L2_ENST00000397063.4_Missense_Mutation_p.W8R|NFE2L2_ENST00000446151.2_Missense_Mutation_p.W8R	NM_006164.4	NP_006155.2	Q16236	NF2L2_HUMAN	nuclear factor, erythroid 2-like 2	24					cellular response to hydrogen peroxide (GO:0070301)|cellular response to laminar fluid shear stress (GO:0071499)|cellular response to tumor necrosis factor (GO:0071356)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902176)|positive regulation of blood coagulation (GO:0030194)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to stress (GO:0036003)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination (GO:0016567)|regulation of embryonic development (GO:0045995)|regulation of removal of superoxide radicals (GO:2000121)|transcription from RNA polymerase II promoter (GO:0006366)	centrosome (GO:0005813)|chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|protein domain specific binding (GO:0019904)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.W24R(2)		central_nervous_system(1)|cervix(4)|endometrium(14)|kidney(5)|large_intestine(4)|liver(13)|lung(71)|oesophagus(29)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	158			Epithelial(96;0.00442)|OV - Ovarian serous cystadenocarcinoma(117;0.00739)|all cancers(119;0.0195)|LUSC - Lung squamous cell carcinoma(2;0.036)|Lung(16;0.0935)			TCTTGCCTCCAAAGTATGTCA	0.348			Mis		"""NSCLC, HNSCC"""					HNSCC(56;0.16)																														Dom	yes		2	2q31	4780	nuclear factor (erythroid-derived 2)-like 2 (NRF2)		E	2	Substitution - Missense(2)	urinary_tract(1)|oesophagus(1)											54.0	48.0	50.0					2																	178098975		1840	4093	5933	SO:0001583	missense	0				CCDS42782.1, CCDS46457.1, CCDS46458.1	2q31	2013-08-23	2013-08-23		ENSG00000116044	ENSG00000116044		"""basic leucine zipper proteins"""	7782	protein-coding gene	gene with protein product	"""NF-E2-related factor 2"""	600492	"""nuclear factor (erythroid-derived 2)-like 2"""			7937919	Standard	NM_006164		Approved	NRF2	uc002ulh.5	Q16236	OTTHUMG00000133620	ENST00000397062.3:c.70T>A	2.37:g.178098975A>T	ENSP00000380252:p.Trp24Arg		B2RBU2|B4E338|E9PGJ7|Q53RW6|Q59HH2|Q96F71	Missense_Mutation	SNP	pfam_bZIP,superfamily_TF_DNA-bd,superfamily_Serpin_dom,smart_bZIP,pfscan_bZIP	p.W24R	ENST00000397062.3	37	c.70	CCDS42782.1	2	.	.	.	.	.	.	.	.	.	.	A	19.52	3.842230	0.71488	.	.	ENSG00000116044	ENST00000397063;ENST00000397062;ENST00000446151;ENST00000449627;ENST00000448782;ENST00000421929;ENST00000423513	T;T;T;T;T;T;T	0.29655	1.56;1.56;1.56;1.56;1.56;1.56;1.56	5.78	5.78	0.91487	.	0.000000	0.85682	D	0.000000	T	0.62258	0.2413	M	0.87180	2.865	0.80722	D	1	D;D;D;D	0.89917	1.0;0.999;1.0;1.0	D;D;D;D	0.91635	0.998;0.997;0.999;0.998	T	0.69461	-0.5139	10	0.87932	D	0	.	16.098	0.81144	1.0:0.0:0.0:0.0	.	8;8;8;24	E9PGJ7;B4DNB0;C9JFL6;Q16236	.;.;.;NF2L2_HUMAN	R	8;24;8;8;8;8;8	ENSP00000380253:W8R;ENSP00000380252:W24R;ENSP00000411575:W8R;ENSP00000391590:W8R;ENSP00000400073:W8R;ENSP00000412191:W8R;ENSP00000410015:W8R	ENSP00000380252:W24R	W	-	1	0	NFE2L2	177807221	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	8.962000	0.93254	2.210000	0.71456	0.460000	0.39030	TGG	NFE2L2	-	NULL	ENSG00000116044		0.348	NFE2L2-001	KNOWN	basic|CCDS	protein_coding	NFE2L2	HGNC	protein_coding	OTTHUMT00000257752.4	-	0.00	31	0	A	NM_006164		178098975	-1	tier1	-	no_errors	ENST00000397062	ensembl	human	known	74_37	missense	54.17	11	13	SNP	1.000	T
NIPA1	123606	genome.wustl.edu	37	15	23049305	23049306	+	Frame_Shift_Ins	INS	-	-	C			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr15:23049305_23049306insC	ENST00000337435.4	-	5	537_538	c.513_514insG	c.(511-516)atgctgfs	p.L172fs	NIPA1_ENST00000538684.1_Frame_Shift_Ins_p.L2fs|NIPA1_ENST00000437912.2_Frame_Shift_Ins_p.L97fs|NIPA1_ENST00000561183.1_Frame_Shift_Ins_p.L97fs	NM_001142275.1|NM_144599.4	NP_001135747.1|NP_653200.2	Q7RTP0	NIPA1_HUMAN	non imprinted in Prader-Willi/Angelman syndrome 1	172					cell death (GO:0008219)	early endosome (GO:0005769)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	magnesium ion transmembrane transporter activity (GO:0015095)			endometrium(2)|kidney(2)|large_intestine(1)|lung(9)|skin(1)	15		all_cancers(20;2.26e-25)|all_epithelial(15;2.1e-22)|Lung NSC(15;3.36e-17)|all_lung(15;1.04e-16)|Breast(32;0.000776)|Colorectal(260;0.0488)		all cancers(64;4.18e-06)|Epithelial(43;3.97e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00165)		AGCAGCAGCAGCATGAGCAGCA	0.604																																																	0																																										SO:0001589	frameshift_variant	0			BK001020	CCDS73691.1, CCDS73692.1	15q11.2	2006-10-06			ENSG00000170113	ENSG00000170113			17043	protein-coding gene	gene with protein product		608145	"""spastic paraplegia 6 (autosomal dominant)"""	SPG6		14508710	Standard	NM_144599		Approved	MGC35570	uc001yvc.3	Q7RTP0	OTTHUMG00000129099	ENST00000337435.4:c.514dupG	15.37:g.23049306_23049306dupC	ENSP00000337452:p.Leu172fs		B2RA76|Q5HYA9|Q7KZB0|Q86XW4	Frame_Shift_Ins	INS	pfam_Mg_trans_NIPA	p.L171fs	ENST00000337435.4	37	c.514_513	CCDS10011.1	15																																																																																			NIPA1	-	pfam_Mg_trans_NIPA	ENSG00000170113		0.604	NIPA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NIPA1	HGNC	protein_coding	OTTHUMT00000251135.2		0.00	46	0	-	NM_144599		23049306	-1	tier1		no_errors	ENST00000337435	ensembl	human	known	74_37	frame_shift_ins	46.15	21	18	INS	1.000:1.000	C
NLRC5	84166	genome.wustl.edu	37	16	57101728	57101729	+	Frame_Shift_Ins	INS	-	-	G			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr16:57101728_57101729insG	ENST00000262510.6	+	36	4712_4713	c.4487_4488insG	c.(4486-4491)ctgaagfs	p.K1497fs	NLRC5_ENST00000308149.7_Frame_Shift_Ins_p.K1468fs|NLRC5_ENST00000436936.1_Frame_Shift_Ins_p.K1497fs|NLRC5_ENST00000539144.1_Frame_Shift_Ins_p.K1468fs	NM_032206.4	NP_115582.4	Q86WI3	NLRC5_HUMAN	NLR family, CARD domain containing 5	1497					defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of type I interferon production (GO:0032480)|negative regulation of type I interferon-mediated signaling pathway (GO:0060339)|positive regulation of interferon-gamma-mediated signaling pathway (GO:0060335)|positive regulation of MHC class I biosynthetic process (GO:0045345)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon-mediated signaling pathway (GO:0060340)|regulation of kinase activity (GO:0043549)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)			NS(2)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(21)|ovary(8)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	75		all_neural(199;0.225)				CTCTCTGAGCTGAAGACATTTC	0.545																																																	0																																										SO:0001589	frameshift_variant	0			AF389420	CCDS10773.1	16q13	2008-02-05			ENSG00000140853	ENSG00000140853		"""Nucleotide-binding domain and leucine rich repeat containing"""	29933	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 5"", ""NOD-like receptor C5"""	613537				12615073	Standard	NM_032206		Approved	NOD27, CLR16.1, FLJ21709	uc021tiu.1	Q86WI3	OTTHUMG00000133470	ENST00000262510.6:c.4488dupG	16.37:g.57101729_57101729dupG	ENSP00000262510:p.Lys1497fs		B5MEF1|C9JMD8|Q6P4A6|Q86VM7|Q8NF42|Q8TEE2|Q8TEJ1|Q969L7	Frame_Shift_Ins	INS	pfam_Leu-rich_rpt,superfamily_P-loop_NTPase,smart_Leu-rich_rpt_RNase_inh_sub-typ,smart_Leu-rich_rpt_Cys-con_subtyp,pfscan_NACHT_NTPase	p.K1497fs	ENST00000262510.6	37	c.4487_4488	CCDS10773.1	16																																																																																			NLRC5	-	smart_Leu-rich_rpt_RNase_inh_sub-typ,smart_Leu-rich_rpt_Cys-con_subtyp	ENSG00000140853		0.545	NLRC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NLRC5	HGNC	protein_coding	OTTHUMT00000257346.1		0.00	64	0	-	NM_032206		57101729	+1	tier1		no_errors	ENST00000262510	ensembl	human	known	74_37	frame_shift_ins	36.00	32	18	INS	1.000:0.994	G
NLRC5	84166	genome.wustl.edu	37	16	57113144	57113144	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr16:57113144A>G	ENST00000262510.6	+	45	5402	c.5177A>G	c.(5176-5178)aAc>aGc	p.N1726S	NLRC5_ENST00000308149.7_Missense_Mutation_p.N1697S|NLRC5_ENST00000436936.1_3'UTR|NLRC5_ENST00000539144.1_Missense_Mutation_p.N1697S	NM_032206.4	NP_115582.4	Q86WI3	NLRC5_HUMAN	NLR family, CARD domain containing 5	1726					defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of type I interferon production (GO:0032480)|negative regulation of type I interferon-mediated signaling pathway (GO:0060339)|positive regulation of interferon-gamma-mediated signaling pathway (GO:0060335)|positive regulation of MHC class I biosynthetic process (GO:0045345)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon-mediated signaling pathway (GO:0060340)|regulation of kinase activity (GO:0043549)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)			NS(2)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(21)|ovary(8)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	75		all_neural(199;0.225)				TTGGCGGAAAACAACCTGGCT	0.627																																																	0													54.0	55.0	55.0					16																	57113144		2198	4300	6498	SO:0001583	missense	0			AF389420	CCDS10773.1	16q13	2008-02-05			ENSG00000140853	ENSG00000140853		"""Nucleotide-binding domain and leucine rich repeat containing"""	29933	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 5"", ""NOD-like receptor C5"""	613537				12615073	Standard	NM_032206		Approved	NOD27, CLR16.1, FLJ21709	uc021tiu.1	Q86WI3	OTTHUMG00000133470	ENST00000262510.6:c.5177A>G	16.37:g.57113144A>G	ENSP00000262510:p.Asn1726Ser		B5MEF1|C9JMD8|Q6P4A6|Q86VM7|Q8NF42|Q8TEE2|Q8TEJ1|Q969L7	Missense_Mutation	SNP	pfam_Leu-rich_rpt,superfamily_P-loop_NTPase,smart_Leu-rich_rpt_RNase_inh_sub-typ,smart_Leu-rich_rpt_Cys-con_subtyp,pfscan_NACHT_NTPase	p.N1726S	ENST00000262510.6	37	c.5177	CCDS10773.1	16	.	.	.	.	.	.	.	.	.	.	A	17.74	3.463731	0.63513	.	.	ENSG00000140853	ENST00000262510;ENST00000308149;ENST00000539144	T;T;T	0.66280	-0.2;-0.2;-0.2	5.47	5.47	0.80525	.	.	.	.	.	T	0.79488	0.4454	M	0.86268	2.805	0.80722	D	1	D	0.76494	0.999	D	0.72625	0.978	T	0.81769	-0.0781	9	0.52906	T	0.07	.	11.9323	0.52853	1.0:0.0:0.0:0.0	.	1726	Q86WI3	NLRC5_HUMAN	S	1726;1697;1697	ENSP00000262510:N1726S;ENSP00000308886:N1697S;ENSP00000441727:N1697S	ENSP00000262510:N1726S	N	+	2	0	NLRC5	55670645	1.000000	0.71417	0.999000	0.59377	0.729000	0.41735	4.148000	0.58085	2.066000	0.61787	0.482000	0.46254	AAC	NLRC5	-	NULL	ENSG00000140853		0.627	NLRC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NLRC5	HGNC	protein_coding	OTTHUMT00000257346.1	-	0.00	114	0	A	NM_032206		57113144	+1	tier1	-	no_errors	ENST00000262510	ensembl	human	known	74_37	missense	33.98	68	35	SNP	1.000	G
NME7	29922	genome.wustl.edu	37	1	169199958	169199958	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr1:169199958G>T	ENST00000367811.3	-	10	1244	c.988C>A	c.(988-990)Cct>Act	p.P330T	NME7_ENST00000472647.1_Missense_Mutation_p.P294T	NM_013330.3	NP_037462.1	Q9Y5B8	NDK7_HUMAN	NME/NM23 family member 7	330					brain development (GO:0007420)|ciliary receptor clustering involved in smoothened signaling pathway (GO:0060830)|CTP biosynthetic process (GO:0006241)|determination of left/right symmetry (GO:0007368)|epithelial cilium movement (GO:0003351)|GTP biosynthetic process (GO:0006183)|intraciliary transport (GO:0042073)|left/right pattern formation (GO:0060972)|UTP biosynthetic process (GO:0006228)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|nucleoside diphosphate kinase activity (GO:0004550)			central_nervous_system(1)|kidney(1)|large_intestine(5)|lung(8)|skin(1)	16	all_hematologic(923;0.208)					TAACTTACAGGATCAGCAGGT	0.318																																																	0													73.0	67.0	69.0					1																	169199958		2203	4299	6502	SO:0001583	missense	0			AF153191	CCDS1277.1, CCDS44274.1	1q24.2	2014-07-31	2012-05-18		ENSG00000143156	ENSG00000143156			20461	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 67"""	613465	"""non-metastatic cells 7, protein expressed in (nucleoside-diphosphate kinase)"""			19852809	Standard	NM_197972		Approved	FLJ37194, NM23-H7, CFAP67	uc001gfu.3	Q9Y5B8	OTTHUMG00000034586	ENST00000367811.3:c.988C>A	1.37:g.169199958G>T	ENSP00000356785:p.Pro330Thr		A8K3T6|A8MY09|B3KSW9|Q5TGZ4	Missense_Mutation	SNP	pfam_Nucleoside_diP_kinase,superfamily_Nucleoside_diP_kinase,smart_Uncharacterised_DM10,smart_Nucleoside_diP_kinase,pirsf_NDK7,prints_Nucleoside_diP_kinase	p.P330T	ENST00000367811.3	37	c.988	CCDS1277.1	1	.	.	.	.	.	.	.	.	.	.	G	20.2	3.941692	0.73557	.	.	ENSG00000143156	ENST00000472647;ENST00000367811	T;T	0.59502	0.26;0.26	4.65	4.65	0.58169	.	0.000000	0.85682	D	0.000000	T	0.77350	0.4117	M	0.93241	3.395	0.44337	D	0.997221	D	0.89917	1.0	D	0.85130	0.997	D	0.83569	0.0111	9	0.72032	D	0.01	-16.4896	12.9204	0.58228	0.0:0.0:1.0:0.0	.	330	Q9Y5B8	NDK7_HUMAN	T	294;330	ENSP00000433341:P294T;ENSP00000356785:P330T	ENSP00000356785:P330T	P	-	1	0	NME7	167466582	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	6.964000	0.76061	2.404000	0.81709	0.650000	0.86243	CCT	NME7	-	pfam_Nucleoside_diP_kinase,superfamily_Nucleoside_diP_kinase,smart_Nucleoside_diP_kinase,pirsf_NDK7	ENSG00000143156		0.318	NME7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NME7	HGNC	protein_coding	OTTHUMT00000083688.1		0.00	54	0	G	NM_013330		169199958	-1			no_errors	ENST00000367811	ensembl	human	known	74_37	missense	5.88	80	5	SNP	1.000	T
NSUN7	79730	genome.wustl.edu	37	4	40778076	40778076	+	Missense_Mutation	SNP	G	G	A	rs368809821		TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr4:40778076G>A	ENST00000381782.2	+	7	1331	c.836G>A	c.(835-837)cGa>cAa	p.R279Q	NSUN7_ENST00000316607.5_Missense_Mutation_p.R279Q|NSUN7_ENST00000463952.1_3'UTR	NM_024677.4	NP_078953	Q8NE18	NSUN7_HUMAN	NOP2/Sun domain family, member 7	279							methyltransferase activity (GO:0008168)|RNA binding (GO:0003723)			NS(1)|autonomic_ganglia(1)|cervix(1)|large_intestine(1)|lung(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	12						GACAAATCTCGAAGTCTTGCT	0.348																																																	0								G	GLN/ARG	1,4403	2.1+/-5.4	0,1,2201	88.0	88.0	88.0		836	5.6	1.0	4		88	0,8596		0,0,4298	no	missense	NSUN7	NM_024677.4	43	0,1,6499	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging	279/719	40778076	1,12999	2202	4298	6500	SO:0001583	missense	0			BC036568	CCDS3461.2	4p14	2013-10-11	2009-11-23		ENSG00000179299	ENSG00000179299		"""NOP2/Sun domain containing"""	25857	protein-coding gene	gene with protein product			"""NOL1/NOP2/Sun domain family, member 7"""			17442852	Standard	NM_024677		Approved	FLJ14001	uc003gvj.4	Q8NE18	OTTHUMG00000128597	ENST00000381782.2:c.836G>A	4.37:g.40778076G>A	ENSP00000371201:p.Arg279Gln		C9JI19|Q8N9K8|Q9H815	Missense_Mutation	SNP	pfam_Fmu/NOL1/Nop2p	p.R279Q	ENST00000381782.2	37	c.836	CCDS3461.2	4	.	.	.	.	.	.	.	.	.	.	G	21.3	4.135702	0.77662	2.27E-4	0.0	ENSG00000179299	ENST00000381782;ENST00000316607	T;T	0.10382	2.88;2.88	5.61	5.61	0.85477	.	0.376793	0.26349	N	0.024896	T	0.21674	0.0522	L	0.56769	1.78	0.39661	D	0.970616	D;D	0.69078	0.997;0.993	P;P	0.56278	0.629;0.795	T	0.00934	-1.1509	10	0.28530	T	0.3	-11.3276	12.6054	0.56521	0.0763:0.0:0.9237:0.0	.	279;279	Q8NE18;Q8NE18-2	NSUN7_HUMAN;.	Q	279	ENSP00000371201:R279Q;ENSP00000319127:R279Q	ENSP00000319127:R279Q	R	+	2	0	NSUN7	40472833	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.405000	0.66351	2.643000	0.89663	0.557000	0.71058	CGA	NSUN7	-	NULL	ENSG00000179299		0.348	NSUN7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NSUN7	HGNC	protein_coding	OTTHUMT00000250454.2		0.00	37	0	G	NM_024677		40778076	+1			no_errors	ENST00000381782	ensembl	human	known	74_37	missense	6.67	28	2	SNP	1.000	A
NUMB	8650	genome.wustl.edu	37	14	73750981	73750981	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr14:73750981G>T	ENST00000355058.3	-	10	1035	c.757C>A	c.(757-759)Ctg>Atg	p.L253M	NUMB_ENST00000555238.1_Missense_Mutation_p.L253M|NUMB_ENST00000359560.3_Missense_Mutation_p.L242M|NUMB_ENST00000356296.4_Missense_Mutation_p.L253M|NUMB_ENST00000554521.2_Intron|NUMB_ENST00000454166.4_Intron|NUMB_ENST00000559312.1_Intron|NUMB_ENST00000535282.1_Missense_Mutation_p.L242M|NUMB_ENST00000555738.2_Intron|NUMB_ENST00000557597.1_Missense_Mutation_p.L242M|NUMB_ENST00000556772.1_Missense_Mutation_p.L109M|NUMB_ENST00000555394.1_Missense_Mutation_p.L253M|NUMB_ENST00000554546.1_Missense_Mutation_p.L242M|NUMB_ENST00000560335.1_Intron|NUMB_ENST00000544991.3_Intron			P49757	NUMB_HUMAN	numb homolog (Drosophila)	253					adherens junction organization (GO:0034332)|axon guidance (GO:0007411)|lateral ventricle development (GO:0021670)|lung epithelial cell differentiation (GO:0060487)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of protein localization to plasma membrane (GO:1903077)|neuroblast division in subventricular zone (GO:0021849)|Notch signaling pathway (GO:0007219)|positive regulation of cell migration (GO:0030335)|positive regulation of neurogenesis (GO:0050769)|positive regulation of polarized epithelial cell differentiation (GO:0030862)	apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|clathrin-coated vesicle (GO:0030136)|early endosome (GO:0005769)|extrinsic component of plasma membrane (GO:0019897)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(4)|lung(8)|ovary(3)|prostate(1)|skin(3)|urinary_tract(1)	28				BRCA - Breast invasive adenocarcinoma(234;0.00471)|OV - Ovarian serous cystadenocarcinoma(108;0.161)		TTCATCTCCAGAGAGGTCGTG	0.532																																																	0													175.0	167.0	170.0					14																	73750981		2203	4300	6503	SO:0001583	missense	0			L40393	CCDS9814.1, CCDS32115.1, CCDS32116.1, CCDS55927.1	14q24.3	2011-11-25	2001-11-28			ENSG00000133961			8060	protein-coding gene	gene with protein product		603728	"""numb (Drosophila) homolog"", ""chromosome 14 open reading frame 41"""	C14orf41			Standard	NM_003744		Approved		uc001xny.1	P49757		ENST00000355058.3:c.757C>A	14.37:g.73750981G>T	ENSP00000347169:p.Leu253Met		B1P2N5|B1P2N6|B1P2N7|B1P2N8|B1P2N9|B4E2B1|Q6NUQ7|Q86SY1|Q8WW73|Q9UBG1|Q9UEQ4|Q9UKE8|Q9UKE9|Q9UKF0|Q9UQJ4	Missense_Mutation	SNP	pfam_Numb_domain,pfam_PTB/PI_dom,pfam_PTB,smart_PTB/PI_dom,pirsf_Numb/numb-like,pfscan_PTB/PI_dom	p.L253M	ENST00000355058.3	37	c.757	CCDS32116.1	14	.	.	.	.	.	.	.	.	.	.	G	8.332	0.826767	0.16749	.	.	ENSG00000133961	ENST00000554546;ENST00000356296;ENST00000557597;ENST00000555238;ENST00000556772;ENST00000355058;ENST00000359560;ENST00000555394;ENST00000535282;ENST00000326018;ENST00000555859;ENST00000555307;ENST00000554394	T;T;T;T;T;T;T;T;T;T;T	0.64803	0.48;0.47;0.86;0.85;1.44;0.85;0.86;0.47;0.86;-0.12;-0.12	5.39	3.55	0.40652	.	0.635366	0.15907	N	0.238804	T	0.47637	0.1456	N	0.22421	0.69	0.29453	N	0.858311	B;B;B;B;B;B	0.29085	0.232;0.002;0.098;0.098;0.004;0.002	B;B;B;B;B;B	0.32465	0.146;0.005;0.046;0.031;0.011;0.005	T	0.47736	-0.9094	10	0.48119	T	0.1	-3.0849	8.4933	0.33112	0.1365:0.188:0.6755:0.0	.	239;242;242;253;242;253	Q86SW5;B2RCI6;P49757-4;P49757-2;P49757-3;P49757	.;.;.;.;.;NUMB_HUMAN	M	242;253;242;253;109;253;242;253;242;217;217;253;253	ENSP00000452416:L242M;ENSP00000348644:L253M;ENSP00000451117:L242M;ENSP00000451300:L253M;ENSP00000451513:L109M;ENSP00000347169:L253M;ENSP00000352563:L242M;ENSP00000451625:L253M;ENSP00000441258:L242M;ENSP00000452357:L253M;ENSP00000451374:L253M	ENSP00000315193:L217M	L	-	1	2	NUMB	72820734	0.995000	0.38212	0.994000	0.49952	0.326000	0.28443	1.998000	0.40796	0.826000	0.34661	0.655000	0.94253	CTG	NUMB	-	pirsf_Numb/numb-like	ENSG00000133961		0.532	NUMB-201	KNOWN	basic|CCDS	protein_coding	NUMB	HGNC	protein_coding	OTTHUMT00000414416.1		0.00	74	0	G			73750981	-1			no_errors	ENST00000355058	ensembl	human	known	74_37	missense	6.25	60	4	SNP	0.994	T
NVL	4931	genome.wustl.edu	37	1	224495770	224495770	+	Missense_Mutation	SNP	T	T	A			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr1:224495770T>A	ENST00000281701.6	-	6	797	c.538A>T	c.(538-540)Agt>Tgt	p.S180C	NVL_ENST00000469075.1_Intron|NVL_ENST00000361463.3_Missense_Mutation_p.S74C|NVL_ENST00000391875.2_Missense_Mutation_p.S74C|NVL_ENST00000340871.4_Intron|RNU6-1008P_ENST00000384160.1_RNA|NVL_ENST00000482491.1_Intron	NM_002533.3	NP_002524.2	O15381	NVL_HUMAN	nuclear VCP-like	180						membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)			breast(3)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(10)|lung(13)|ovary(1)|prostate(1)|skin(4)|soft_tissue(1)|urinary_tract(1)	42				GBM - Glioblastoma multiforme(131;0.00501)		TTCTTTACACTTGGGGTTTTG	0.393																																																	0													134.0	132.0	132.0					1																	224495770		2203	4300	6503	SO:0001583	missense	0			U78772	CCDS1541.1, CCDS1542.1, CCDS58062.1, CCDS58063.1	1q41-q42.2	2010-04-21			ENSG00000143748	ENSG00000143748		"""ATPases / AAA-type"""	8070	protein-coding gene	gene with protein product	"""Nuclear valosin-containing protein-like"", ""nuclear VCP-like protein"""	602426				9286697	Standard	NM_002533		Approved		uc001hok.3	O15381	OTTHUMG00000037536	ENST00000281701.6:c.538A>T	1.37:g.224495770T>A	ENSP00000281701:p.Ser180Cys		B4DMC4|B4DP98|Q96EM7	Missense_Mutation	SNP	pfam_ATPase_AAA_core,pfam_DNA_helicase_Holl-junc_RuvB_N,pfam_ATPase_AAA-2,pfam_ATPase_dyneun-rel_AAA,pfam_Zeta_toxin_domain,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.S180C	ENST00000281701.6	37	c.538	CCDS1541.1	1	.	.	.	.	.	.	.	.	.	.	T	9.873	1.199375	0.22121	.	.	ENSG00000143748	ENST00000281701;ENST00000391875;ENST00000361463;ENST00000492281;ENST00000436927	D;D;D	0.95518	-3.57;-3.58;-3.73	5.78	-2.36	0.06663	.	0.778386	0.12319	N	0.479458	D	0.88669	0.6499	L	0.38175	1.15	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.77056	-0.2729	10	0.45353	T	0.12	-0.0366	1.0754	0.01631	0.189:0.3428:0.1697:0.2986	.	180	O15381	NVL_HUMAN	C	180;74;74;85;76	ENSP00000281701:S180C;ENSP00000375747:S74C;ENSP00000354779:S74C	ENSP00000281701:S180C	S	-	1	0	NVL	222562393	0.000000	0.05858	0.009000	0.14445	0.692000	0.40212	-1.837000	0.01689	-0.317000	0.08677	-0.242000	0.12053	AGT	NVL	-	NULL	ENSG00000143748		0.393	NVL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NVL	HGNC	protein_coding	OTTHUMT00000091453.2	-	0.00	152	0	T	NM_002533		224495770	-1	tier1	-	no_errors	ENST00000281701	ensembl	human	known	74_37	missense	24.56	129	42	SNP	0.005	A
NYAP2	57624	genome.wustl.edu	37	2	226378162	226378162	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr2:226378162G>A	ENST00000272907.6	+	3	710	c.297G>A	c.(295-297)atG>atA	p.M99I	NYAP2_ENST00000409269.2_Intron	NM_020864.1	NP_065915.1	Q9P242	NYAP2_HUMAN	neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 2	99					neuron projection morphogenesis (GO:0048812)|phosphatidylinositol 3-kinase signaling (GO:0014065)												TCATGACAATGCCTGCTCCTC	0.527																																																	0													76.0	83.0	81.0					2																	226378162		2089	4216	6305	SO:0001583	missense	0			AB040919	CCDS46529.1	2q36.3	2011-11-30	2011-11-30	2011-11-30	ENSG00000144460	ENSG00000144460			29291	protein-coding gene	gene with protein product		615478	"""KIAA1486"""	KIAA1486		10819331, 21946561	Standard	NM_020864		Approved		uc002voe.2	Q9P242	OTTHUMG00000153450	ENST00000272907.6:c.297G>A	2.37:g.226378162G>A	ENSP00000272907:p.Met99Ile		A2RRN4|Q96NL2	Missense_Mutation	SNP	NULL	p.M99I	ENST00000272907.6	37	c.297	CCDS46529.1	2	.	.	.	.	.	.	.	.	.	.	G	25.5	4.645384	0.87859	.	.	ENSG00000144460	ENST00000272907	T	0.45276	0.9	5.41	5.41	0.78517	.	0.049208	0.85682	D	0.000000	T	0.62109	0.2401	L	0.60455	1.87	0.80722	D	1	D	0.53745	0.962	D	0.66716	0.946	T	0.60762	-0.7199	10	0.49607	T	0.09	-20.2489	19.1985	0.93699	0.0:0.0:1.0:0.0	.	99	Q9P242	K1486_HUMAN	I	99	ENSP00000272907:M99I	ENSP00000272907:M99I	M	+	3	0	KIAA1486	226086406	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.400000	0.97290	2.532000	0.85374	0.563000	0.77884	ATG	NYAP2	-	NULL	ENSG00000144460		0.527	NYAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NYAP2	HGNC	protein_coding	OTTHUMT00000331258.1	-	0.00	36	0	G	NM_020864		226378162	+1	tier1	-	no_errors	ENST00000272907	ensembl	human	known	74_37	missense	10.81	33	4	SNP	1.000	A
OBSCN	84033	genome.wustl.edu	37	1	228495134	228495134	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr1:228495134C>T	ENST00000422127.1	+	46	12412	c.12368C>T	c.(12367-12369)aCg>aTg	p.T4123M	OBSCN_ENST00000366709.4_Missense_Mutation_p.T1242M|OBSCN_ENST00000570156.2_Missense_Mutation_p.T5080M|OBSCN_ENST00000366707.4_Missense_Mutation_p.T1757M|OBSCN_ENST00000284548.11_Missense_Mutation_p.T4123M	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	4123	Ig-like 42.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				CAGGGGGCCACGCGGGAGCTG	0.657																																																	0													27.0	39.0	35.0					1																	228495134		2143	4226	6369	SO:0001583	missense	0			AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.12368C>T	1.37:g.228495134C>T	ENSP00000409493:p.Thr4123Met		Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Fibronectin_type3,pfam_DH-domain,pfam_IQ_motif_EF-hand-BS,superfamily_Kinase-like_dom,superfamily_DH-domain,superfamily_Fibronectin_type3,superfamily_SH3_domain,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_IQ_motif_EF-hand-BS,smart_DH-domain,smart_Pleckstrin_homology,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_IQ_motif_EF-hand-BS,pfscan_Pleckstrin_homology,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom,pfscan_DH-domain	p.T4123M	ENST00000422127.1	37	c.12368	CCDS58065.1	1	.	.	.	.	.	.	.	.	.	.	C	10.53	1.376046	0.24857	.	.	ENSG00000154358	ENST00000284548;ENST00000422127;ENST00000366707;ENST00000366709	T;T;T;T	0.68624	-0.34;-0.34;-0.34;-0.34	5.81	-9.13	0.00704	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	1.343340	0.04797	N	0.432783	T	0.55417	0.1919	L	0.46670	1.46	0.09310	N	1	B;B	0.27316	0.175;0.022	B;B	0.16722	0.016;0.006	T	0.46484	-0.9188	10	0.45353	T	0.12	.	14.1401	0.65313	0.0:0.203:0.0809:0.716	.	4123;4123	Q5VST9;Q5VST9-3	OBSCN_HUMAN;.	M	4123;4123;1757;1242	ENSP00000284548:T4123M;ENSP00000409493:T4123M;ENSP00000355668:T1757M;ENSP00000355670:T1242M	ENSP00000284548:T4123M	T	+	2	0	OBSCN	226561757	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-0.984000	0.03755	-1.771000	0.01293	-1.327000	0.01280	ACG	OBSCN	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,pfscan_Ig-like_dom	ENSG00000154358		0.657	OBSCN-204	KNOWN	basic|CCDS	protein_coding	OBSCN	HGNC	protein_coding		-	0.00	51	0	C	NM_052843		228495134	+1	tier1	-	no_errors	ENST00000422127	ensembl	human	known	74_37	missense	56.58	33	43	SNP	0.000	T
OR2A2	442361	genome.wustl.edu	37	7	143807603	143807603	+	Missense_Mutation	SNP	A	A	T			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr7:143807603A>T	ENST00000408979.2	+	1	997	c.928A>T	c.(928-930)Atg>Ttg	p.M310L		NM_001005480.2	NP_001005480.2	Q6IF42	OR2A2_HUMAN	olfactory receptor, family 2, subfamily A, member 2	310						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|kidney(1)|large_intestine(2)|lung(13)|prostate(1)|skin(4)	22	Melanoma(164;0.0783)					GAAGAGGTCCATGAGAACGGT	0.428																																																	0													85.0	82.0	83.0					7																	143807603		1888	4117	6005	SO:0001583	missense	0				CCDS43671.1	7q35	2013-09-20		2004-03-10	ENSG00000221989	ENSG00000221989		"""GPCR / Class A : Olfactory receptors"""	8230	protein-coding gene	gene with protein product				OR2A2P, OR2A17P			Standard	NM_001005480		Approved	OST008	uc011ktz.2	Q6IF42	OTTHUMG00000158001	ENST00000408979.2:c.928A>T	7.37:g.143807603A>T	ENSP00000386209:p.Met310Leu		B2RN85|Q8NGT6	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.M310L	ENST00000408979.2	37	c.928	CCDS43671.1	7	.	.	.	.	.	.	.	.	.	.	A	0.087	-1.173323	0.01646	.	.	ENSG00000221989	ENST00000408979	T	0.01043	5.41	3.14	-5.21	0.02815	.	2.229980	0.02879	N	0.132696	T	0.00412	0.0013	N	0.00771	-1.2	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.48468	-0.9033	10	0.15952	T	0.53	.	0.1883	0.00131	0.2365:0.1744:0.2453:0.3438	.	310	Q6IF42	OR2A2_HUMAN	L	310	ENSP00000386209:M310L	ENSP00000386209:M310L	M	+	1	0	OR2A2	143438536	0.000000	0.05858	0.000000	0.03702	0.044000	0.14063	-0.115000	0.10741	-0.907000	0.03862	0.418000	0.28097	ATG	OR2A2	-	NULL	ENSG00000221989		0.428	OR2A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2A2	HGNC	protein_coding	OTTHUMT00000349978.1	-	0.00	42	0	A			143807603	+1	tier1	-	no_errors	ENST00000408979	ensembl	human	known	74_37	missense	7.27	51	4	SNP	0.000	T
OR4A5	81318	genome.wustl.edu	37	11	51412174	51412174	+	Silent	SNP	G	G	A			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr11:51412174G>A	ENST00000319760.6	-	1	274	c.222C>T	c.(220-222)acC>acT	p.T74T		NM_001005272.3	NP_001005272.3	Q8NH83	OR4A5_HUMAN	olfactory receptor, family 4, subfamily A, member 5	74						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(8)|lung(28)|ovary(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	49		all_lung(304;0.236)				TGGGAGAAATGGTAGTGGAAT	0.423																																																	0													58.0	59.0	59.0					11																	51412174		2201	4296	6497	SO:0001819	synonymous_variant	0			AB065506	CCDS73289.1	11p11.12	2012-08-09			ENSG00000221840	ENSG00000221840		"""GPCR / Class A : Olfactory receptors"""	15162	protein-coding gene	gene with protein product							Standard	NM_001005272		Approved		uc001nhi.2	Q8NH83	OTTHUMG00000166764	ENST00000319760.6:c.222C>T	11.37:g.51412174G>A			Q6IF84	Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.T74	ENST00000319760.6	37	c.222	CCDS31497.1	11																																																																																			OR4A5	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000221840		0.423	OR4A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4A5	HGNC	protein_coding	OTTHUMT00000391399.1	-	0.00	52	0	G	NM_001005272		51412174	-1	tier1	-	no_errors	ENST00000319760	ensembl	human	known	74_37	silent	43.64	31	24	SNP	0.076	A
OR4L1	122742	genome.wustl.edu	37	14	20528746	20528747	+	Frame_Shift_Ins	INS	-	-	C	rs35605617		TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr14:20528746_20528747insC	ENST00000315683.1	+	1	543_544	c.543_544insC	c.(544-546)cccfs	p.P182fs		NM_001004717.1	NP_001004717.1	Q8NH43	OR4L1_HUMAN	olfactory receptor, family 4, subfamily L, member 1	182						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(3)|large_intestine(4)|lung(16)|ovary(2)|pancreas(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	34	all_cancers(95;0.00108)		Epithelial(56;4.65e-07)|all cancers(55;2.9e-06)	GBM - Glioblastoma multiforme(265;0.0064)		TTTGTGATCTTCCCCTTGTGAT	0.401																																																	0																																										SO:0001589	frameshift_variant	0				CCDS32029.1	14q11.2	2013-09-23			ENSG00000176246	ENSG00000176246		"""GPCR / Class A : Olfactory receptors"""	15356	protein-coding gene	gene with protein product				OR4L2P			Standard	NM_001004717		Approved		uc001vwn.1	Q8NH43	OTTHUMG00000169492	ENST00000315683.1:c.547dupC	14.37:g.20528750_20528750dupC	ENSP00000319217:p.Pro182fs		Q6IEZ5	Frame_Shift_Ins	INS	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_Olfact_rcpt,prints_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	p.L182fs	ENST00000315683.1	37	c.543_544	CCDS32029.1	14																																																																																			OR4L1	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_Olfact_rcpt,pfscan_GPCR_Rhodpsn_7TM	ENSG00000176246		0.401	OR4L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4L1	HGNC	protein_coding	OTTHUMT00000404381.1		0.00	44	0	-			20528747	+1	tier1		no_errors	ENST00000315683	ensembl	human	known	74_37	frame_shift_ins	32.00	34	16	INS	0.994:0.995	C
OR5B2	390190	genome.wustl.edu	37	11	58190660	58190660	+	Silent	SNP	G	G	A			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr11:58190660G>A	ENST00000302581.2	-	1	126	c.75C>T	c.(73-75)ctC>ctT	p.L25L		NM_001005566.2	NP_001005566.1	Q96R09	OR5B2_HUMAN	olfactory receptor, family 5, subfamily B, member 2	25						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(2)|large_intestine(2)|lung(19)|ovary(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32	Esophageal squamous(5;0.0027)	Breast(21;0.0778)				ACAAGATAAAGAGGGGGATCT	0.453																																																	0													105.0	99.0	101.0					11																	58190660		2201	4295	6496	SO:0001819	synonymous_variant	0			AB065852	CCDS31550.1	11q12.1	2012-08-09			ENSG00000172365	ENSG00000172365		"""GPCR / Class A : Olfactory receptors"""	8323	protein-coding gene	gene with protein product							Standard	NM_001005566		Approved	OST073	uc010rkg.2	Q96R09	OTTHUMG00000167517	ENST00000302581.2:c.75C>T	11.37:g.58190660G>A			B2RNJ6|B9EGY7|Q6IEV7|Q8NGF5	Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L25	ENST00000302581.2	37	c.75	CCDS31550.1	11																																																																																			OR5B2	-	prints_GPCR_Rhodpsn	ENSG00000172365		0.453	OR5B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5B2	HGNC	protein_coding	OTTHUMT00000394887.2	-	0.00	88	0	G	NM_001005566		58190660	-1	tier1	-	no_errors	ENST00000302581	ensembl	human	known	74_37	silent	35.37	53	29	SNP	0.995	A
PAN3	255967	genome.wustl.edu	37	13	28855478	28855478	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr13:28855478G>T	ENST00000380958.3	+	17	2498	c.2346G>T	c.(2344-2346)agG>agT	p.R782S	PAN3_ENST00000282391.5_Missense_Mutation_p.R470S|PAN3_ENST00000399613.1_Missense_Mutation_p.R582S	NM_175854.7	NP_787050.6			PAN3 poly(A) specific ribonuclease subunit											endometrium(1)|kidney(3)|large_intestine(7)|lung(9)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	24	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0262)	Colorectal(13;0.000334)	all cancers(112;0.0102)|Epithelial(112;0.0803)|GBM - Glioblastoma multiforme(144;0.121)|OV - Ovarian serous cystadenocarcinoma(117;0.13)|Lung(94;0.174)		GACTGTTTAGGCTCCTAGCAA	0.299																																																	0													69.0	79.0	75.0					13																	28855478		2202	4300	6502	SO:0001583	missense	0			AK091307	CCDS9329.1, CCDS9329.2	13q12.2	2014-03-27	2014-03-27		ENSG00000152520	ENSG00000152520			29991	protein-coding gene	gene with protein product			"""PAN3 poly(A) specific ribonuclease subunit homolog (S. cerevisiae)"""			14583602	Standard	NM_175854		Approved		uc001urz.3	Q58A45	OTTHUMG00000016645	ENST00000380958.3:c.2346G>T	13.37:g.28855478G>T	ENSP00000370345:p.Arg782Ser			Missense_Mutation	SNP	superfamily_Kinase-like_dom,smart_Znf_CCCH,pfscan_Prot_kinase_dom	p.R782S	ENST00000380958.3	37	c.2346	CCDS9329.2	13	.	.	.	.	.	.	.	.	.	.	G	19.18	3.778590	0.70107	.	.	ENSG00000152520	ENST00000380958;ENST00000399613;ENST00000282391	T;T;T	0.44881	0.91;0.91;0.91	5.76	4.02	0.46733	.	0.000000	0.85682	D	0.000000	T	0.70307	0.3209	H	0.94183	3.505	0.80722	D	1	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.83275	0.996;0.994;0.996	T	0.75991	-0.3122	10	0.87932	D	0	-12.7801	8.9157	0.35581	0.2807:0.0:0.7193:0.0	.	782;470;728	Q58A45;Q58A45-2;Q58A45-3	PAN3_HUMAN;.;.	S	782;582;470	ENSP00000370345:R782S;ENSP00000382522:R582S;ENSP00000282391:R470S	ENSP00000282391:R470S	R	+	3	2	PAN3	27753478	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.530000	0.45641	1.437000	0.47472	0.561000	0.74099	AGG	PAN3	-	NULL	ENSG00000152520		0.299	PAN3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PAN3	HGNC	protein_coding	OTTHUMT00000044318.4	-	0.00	63	0	G	NM_175854		28855478	+1	tier1	-	no_errors	ENST00000380958	ensembl	human	known	74_37	missense	6.78	55	4	SNP	1.000	T
PAPPA2	60676	genome.wustl.edu	37	1	176564652	176564652	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr1:176564652G>A	ENST00000367662.3	+	3	3076	c.1912G>A	c.(1912-1914)Gac>Aac	p.D638N	PAPPA2_ENST00000367661.3_Missense_Mutation_p.D638N	NM_020318.2	NP_064714.2	Q9BXP8	PAPP2_HUMAN	pappalysin 2	638	Metalloprotease.				bone morphogenesis (GO:0060349)|cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|proteolysis (GO:0006508)|regulation of cell growth (GO:0001558)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(3)|breast(3)|central_nervous_system(7)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(19)|lung(136)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|upper_aerodigestive_tract(8)|urinary_tract(1)	226						CATGCTGAACGACTTTGACGA	0.602																																																	0													70.0	76.0	74.0					1																	176564652		2168	4268	6436	SO:0001583	missense	0			BG354569	CCDS41438.1, CCDS41439.1	1q23-q25	2008-05-23	2004-07-07	2004-07-09	ENSG00000116183	ENSG00000116183			14615	protein-coding gene	gene with protein product			"""placenta-specific 3"""	PLAC3		11018262, 11264294	Standard	NM_021936		Approved	PAPPE, PAPP-A2	uc001gkz.3	Q9BXP8	OTTHUMG00000035025	ENST00000367662.3:c.1912G>A	1.37:g.176564652G>A	ENSP00000356634:p.Asp638Asn		A9Z1Y8|Q96PH7|Q96PH8|Q9H4C9	Missense_Mutation	SNP	pfam_Notch_dom,pfam_Sushi_SCR_CCP,pfam_Peptidase_M43,superfamily_ConA-like_lec_gl_sf,superfamily_Sushi_SCR_CCP,superfamily_Fibronectin_type3,superfamily_Notch_dom,smart_LamG-like,smart_Notch_dom,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP,tigrfam_Myxo_disulph_rpt	p.D638N	ENST00000367662.3	37	c.1912	CCDS41438.1	1	.	.	.	.	.	.	.	.	.	.	G	16.06	3.017218	0.54576	.	.	ENSG00000116183	ENST00000367662;ENST00000367661	T;T	0.30182	4.78;1.54	5.42	5.42	0.78866	.	0.000000	0.85682	D	0.000000	T	0.26593	0.0650	L	0.28400	0.85	0.43195	D	0.99503	B;D	0.56968	0.354;0.978	B;P	0.46479	0.044;0.518	T	0.01476	-1.1345	10	0.21014	T	0.42	-25.7887	13.1942	0.59728	0.0769:0.0:0.9231:0.0	.	638;638	Q9BXP8;A9Z1Y8	PAPP2_HUMAN;.	N	638	ENSP00000356634:D638N;ENSP00000356633:D638N	ENSP00000356633:D638N	D	+	1	0	PAPPA2	174831275	1.000000	0.71417	1.000000	0.80357	0.814000	0.46013	3.863000	0.56016	2.542000	0.85734	0.650000	0.86243	GAC	PAPPA2	-	NULL	ENSG00000116183		0.602	PAPPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAPPA2	HGNC	protein_coding	OTTHUMT00000084763.1	-	0.00	59	0	G			176564652	+1	tier1	-	no_errors	ENST00000367662	ensembl	human	known	74_37	missense	30.43	64	28	SNP	1.000	A
PAXIP1	22976	genome.wustl.edu	37	7	154760609	154760611	+	In_Frame_Del	DEL	CTG	CTG	-	rs151102688		TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	CTG	CTG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr7:154760609_154760611delCTG	ENST00000404141.1	-	7	1454_1456	c.1300_1302delCAG	c.(1300-1302)cagdel	p.Q434del	PAXIP1_ENST00000397192.1_In_Frame_Del_p.Q434del|PAXIP1_ENST00000473219.1_5'UTR			Q6ZW49	PAXI1_HUMAN	PAX interacting (with transcription-activation domain) protein 1	434	Gln-rich.				adipose tissue development (GO:0060612)|chorion development (GO:0060717)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|endothelial cell migration (GO:0043542)|histone H3-K4 methylation (GO:0051568)|positive regulation of histone acetylation (GO:0035066)|positive regulation of histone H3-K36 methylation (GO:0000416)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of isotype switching (GO:0045830)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|response to ionizing radiation (GO:0010212)|transcription, DNA-templated (GO:0006351)|vasculogenesis (GO:0001570)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)				NS(1)|breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(9)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(1)	33	all_neural(206;0.119)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.0296)	UCEC - Uterine corpus endometrioid carcinoma (81;0.178)		GCTGAGAGATctgctgctgctgc	0.591																																																	0										67,3215		7,53,1581						-1.6	0.0		dbSNP_134	18	123,6147		12,99,3024	no	coding	PAXIP1	NM_007349.3		19,152,4605	A1A1,A1R,RR		1.9617,2.0414,1.9891				190,9362				SO:0001651	inframe_deletion	0			U80735	CCDS47753.1	7q36	2007-07-06	2005-04-05	2005-04-05	ENSG00000157212	ENSG00000157212			8624	protein-coding gene	gene with protein product		608254	"""PAX transcription activation domain interacting protein 1 like"""	PAXIP1L		9225980	Standard	XM_005249539		Approved	CAGF29, CAGF28, TNRC2, PTIP	uc022aqf.1	Q6ZW49	OTTHUMG00000151322	ENST00000404141.1:c.1300_1302delCAG	7.37:g.154760618_154760620delCTG	ENSP00000384048:p.Gln434del		O15404|Q6N099|Q6ZWH9|Q7Z315|Q86UN0|Q8N4P9|Q96HP2	In_Frame_Del	DEL	pfam_BRCT_dom,superfamily_BRCT_dom,smart_BRCT_dom,pfscan_BRCT_dom	p.Q434in_frame_del	ENST00000404141.1	37	c.1302_1300	CCDS47753.1	7																																																																																			PAXIP1	-	NULL	ENSG00000157212		0.591	PAXIP1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	PAXIP1	HGNC	protein_coding	OTTHUMT00000322223.1		0.00	27	0	CTG	NM_007349		154760611	-1	tier1		no_errors	ENST00000397192	ensembl	human	known	74_37	in_frame_del	11.54	23	3	DEL	0.998:0.998:0.999	-
PBRM1	55193	genome.wustl.edu	37	3	52675972	52675972	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr3:52675972G>T	ENST00000296302.7	-	10	1086	c.1085C>A	c.(1084-1086)gCt>gAt	p.A362D	PBRM1_ENST00000337303.4_Missense_Mutation_p.A362D|PBRM1_ENST00000356770.4_Missense_Mutation_p.A330D|PBRM1_ENST00000394830.3_Missense_Mutation_p.A362D|PBRM1_ENST00000410007.1_Missense_Mutation_p.A362D|PBRM1_ENST00000409767.1_Missense_Mutation_p.A362D|PBRM1_ENST00000409114.3_Missense_Mutation_p.A362D|PBRM1_ENST00000409057.1_Missense_Mutation_p.A362D			Q86U86	PB1_HUMAN	polybromo 1	362					chromatin remodeling (GO:0006338)|heart development (GO:0007507)|mitotic nuclear division (GO:0007067)|negative regulation of cell proliferation (GO:0008285)|placenta development (GO:0001890)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	kinetochore (GO:0000776)|nuclear chromosome (GO:0000228)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			breast(5)|endometrium(5)|kidney(301)|liver(1)|lung(22)|pancreas(1)	335				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		ATGCCTACCAGCTAAAGCAGC	0.388			"""Mis, N, F, S, D, O"""		"""clear cell renal carcinoma, breast"""																																			Rec	yes		3	3p21	55193	polybromo 1		E	0													293.0	277.0	282.0					3																	52675972		2203	4300	6503	SO:0001583	missense	0			BC015323	CCDS43099.1	3p21	2007-03-29			ENSG00000163939	ENSG00000163939			30064	protein-coding gene	gene with protein product		606083				11078522, 11483580	Standard	NM_018313		Approved	BAF180, PB1	uc003der.2	Q86U86	OTTHUMG00000152663	ENST00000296302.7:c.1085C>A	3.37:g.52675972G>T	ENSP00000296302:p.Ala362Asp		A1L381|A1L382|A4FUJ7|Q1RMD1|Q1RMD2|Q96MS2|Q9H2T3|Q9H2T4|Q9H2T5|Q9H301|Q9H314	Missense_Mutation	SNP	pfam_Bromodomain,pfam_BAH_dom,pfam_HMG_box_dom,superfamily_Bromodomain,superfamily_HMG_box_dom,smart_Bromodomain,smart_BAH_dom,smart_HMG_box_dom,pfscan_BAH_dom,pfscan_HMG_box_dom,pfscan_Bromodomain,prints_Bromodomain	p.A362D	ENST00000296302.7	37	c.1085		3	.	.	.	.	.	.	.	.	.	.	G	15.32	2.798964	0.50208	.	.	ENSG00000163939	ENST00000356770;ENST00000394830;ENST00000296302;ENST00000337303;ENST00000409057;ENST00000410007;ENST00000409114;ENST00000409767;ENST00000423351;ENST00000446103	T;T;T;T;T;T;T;T;T;T	0.35048	1.33;1.33;1.38;1.33;1.34;1.33;1.79;1.33;1.34;1.35	5.71	5.71	0.89125	Bromodomain (1);	0.300926	0.37955	N	0.001878	T	0.21427	0.0516	N	0.08118	0	0.54753	D	0.999984	P;P;P;P;B;P;P;P;P	0.43352	0.804;0.634;0.782;0.589;0.386;0.804;0.704;0.763;0.557	B;B;B;B;B;B;B;B;B	0.42386	0.229;0.178;0.299;0.114;0.124;0.386;0.078;0.229;0.167	T	0.06899	-1.0801	10	0.10902	T	0.67	-38.6023	14.6758	0.68978	0.0:0.0:0.8548:0.1452	.	362;362;362;362;362;362;362;330;362	Q86U86-9;Q86U86-6;Q86U86-4;Q86U86-2;Q86U86-8;Q86U86-7;Q86U86;Q86U86-3;Q86U86-5	.;.;.;.;.;.;PB1_HUMAN;.;.	D	330;362;362;362;362;362;362;362;362;306	ENSP00000349213:A330D;ENSP00000378307:A362D;ENSP00000296302:A362D;ENSP00000338302:A362D;ENSP00000386593:A362D;ENSP00000386529:A362D;ENSP00000386643:A362D;ENSP00000386601:A362D;ENSP00000387775:A362D;ENSP00000397662:A306D	ENSP00000296302:A362D	A	-	2	0	PBRM1	52651012	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	5.886000	0.69743	2.700000	0.92200	0.650000	0.86243	GCT	PBRM1	-	superfamily_Bromodomain	ENSG00000163939		0.388	PBRM1-008	KNOWN	basic|appris_candidate_longest	protein_coding	PBRM1	HGNC	protein_coding	OTTHUMT00000327232.1	-	0.00	101	0	G	NM_018165		52675972	-1	tier1	-	no_errors	ENST00000296302	ensembl	human	known	74_37	missense	7.35	62	5	SNP	1.000	T
PGM5P2	595135	genome.wustl.edu	37	9	69117762	69117762	+	RNA	SNP	G	G	T			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr9:69117762G>T	ENST00000591037.1	-	0	832					NR_002836.2				phosphoglucomutase 5 pseudogene 2																		ATCTTCAGTTGGCTGGGCCCA	0.453																																																	0																																												0			BC007887, BC025351		9q12	2014-01-23			ENSG00000227558	ENSG00000277778			18965	pseudogene	pseudogene						12421752, 15233989	Standard	NR_002836		Approved		uc004aff.4		OTTHUMG00000013322		9.37:g.69117762G>T				RNA	SNP	-	NULL	ENST00000591037.1	37	NULL		9																																																																																			PGM5P2	-	-	ENSG00000227558		0.453	PGM5P2-002	KNOWN	basic	processed_transcript	PGM5P2	HGNC	pseudogene	OTTHUMT00000460890.1	-	0.00	159	0	G	NR_002836		69117762	-1	tier1	-	no_errors	ENST00000591037	ensembl	human	known	74_37	rna	5.80	130	8	SNP	0.994	T
PHF2	5253	genome.wustl.edu	37	9	96420441	96420441	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr9:96420441G>T	ENST00000359246.4	+	10	1529	c.1162G>T	c.(1162-1164)Ggg>Tgg	p.G388W	PHF2_ENST00000375376.4_Intron	NM_005392.3	NP_005383.3	O75151	PHF2_HUMAN	PHD finger protein 2	388					liver development (GO:0001889)|negative regulation of chromatin silencing at rDNA (GO:0061188)|protein demethylation (GO:0006482)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|histone demethylase activity (H3-K9 specific) (GO:0032454)|iron ion binding (GO:0005506)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(6)|large_intestine(9)|lung(14)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	40		Myeloproliferative disorder(762;0.0255)		OV - Ovarian serous cystadenocarcinoma(323;9.11e-28)		TCACAAATCTGGGAAGCAGCT	0.562																																																	0													50.0	48.0	49.0					9																	96420441		2203	4300	6503	SO:0001583	missense	0			AF043725	CCDS35069.1	9q22	2013-01-28			ENSG00000197724	ENSG00000197724		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	8920	protein-coding gene	gene with protein product	"""jumonji C domain-containing histone demethylase 1E"", ""centromere protein 35"""	604351				10051327, 20129925	Standard	NM_005392		Approved	KIAA0662, JHDM1E, CENP-35	uc004aub.3	O75151	OTTHUMG00000020253	ENST00000359246.4:c.1162G>T	9.37:g.96420441G>T	ENSP00000352185:p.Gly388Trp		Q4VXG0|Q8N3K2|Q9Y6N4	Missense_Mutation	SNP	pfam_JmjC_dom,pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,smart_JmjC_dom,pfscan_JmjC_dom,pfscan_Znf_PHD-finger	p.G388W	ENST00000359246.4	37	c.1162	CCDS35069.1	9	.	.	.	.	.	.	.	.	.	.	G	14.73	2.621489	0.46736	.	.	ENSG00000197724	ENST00000359246	T	0.50277	0.75	4.51	4.51	0.55191	.	0.247697	0.41500	D	0.000879	T	0.63438	0.2511	M	0.65975	2.015	0.80722	D	1	D	0.76494	0.999	P	0.58520	0.84	T	0.69139	-0.5224	10	0.72032	D	0.01	-31.2114	17.3926	0.87436	0.0:0.0:1.0:0.0	.	388	O75151	PHF2_HUMAN	W	388	ENSP00000352185:G388W	ENSP00000352185:G388W	G	+	1	0	PHF2	95460262	1.000000	0.71417	1.000000	0.80357	0.473000	0.32948	4.783000	0.62403	2.299000	0.77371	0.491000	0.48974	GGG	PHF2	-	NULL	ENSG00000197724		0.562	PHF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHF2	HGNC	protein_coding	OTTHUMT00000053162.1	-	0.00	79	0	G	NM_005392		96420441	+1	tier1	-	no_errors	ENST00000359246	ensembl	human	known	74_37	missense	5.56	68	4	SNP	1.000	T
PHKA1	5255	genome.wustl.edu	37	X	71856232	71856232	+	Nonsense_Mutation	SNP	G	G	T			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chrX:71856232G>T	ENST00000373542.4	-	15	1623	c.1464C>A	c.(1462-1464)tgC>tgA	p.C488*	PHKA1_ENST00000541944.1_Nonsense_Mutation_p.C488*|PHKA1_ENST00000373539.3_Nonsense_Mutation_p.C488*|PHKA1_ENST00000339490.3_Nonsense_Mutation_p.C488*|PHKA1_ENST00000373545.3_Nonsense_Mutation_p.C488*	NM_002637.3	NP_002628.2	P46020	KPB1_HUMAN	phosphorylase kinase, alpha 1 (muscle)	488					carbohydrate metabolic process (GO:0005975)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|glycogen metabolic process (GO:0005977)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)|phosphorylase kinase activity (GO:0004689)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(9)|liver(2)|lung(18)|ovary(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	52	Renal(35;0.156)					TTCTATTGTTGCATCCTGATA	0.338																																																	0													122.0	100.0	107.0					X																	71856232		2203	4300	6503	SO:0001587	stop_gained	0				CCDS14421.1, CCDS48137.1, CCDS55453.1	Xq12-q13	2009-07-10			ENSG00000067177	ENSG00000067177	2.7.11.19		8925	protein-coding gene	gene with protein product		311870		PHKA			Standard	NM_002637		Approved		uc004eax.4	P46020	OTTHUMG00000022696	ENST00000373542.4:c.1464C>A	X.37:g.71856232G>T	ENSP00000362643:p.Cys488*		B7ZL05|B7ZL07|Q2M3D7	Nonsense_Mutation	SNP	pfam_Glyco_hydro_15,superfamily_6-hairpin_glycosidase-like	p.C488*	ENST00000373542.4	37	c.1464	CCDS14421.1	X	.	.	.	.	.	.	.	.	.	.	G	39	7.556507	0.98355	.	.	ENSG00000067177	ENST00000373545;ENST00000373542;ENST00000541944;ENST00000339490;ENST00000373539	.	.	.	5.71	3.96	0.45880	.	0.207311	0.51477	D	0.000083	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.28530	T	0.3	-25.1404	7.3666	0.26776	0.2734:0.0:0.7266:0.0	.	.	.	.	X	488	.	ENSP00000342469:C488X	C	-	3	2	PHKA1	71772957	0.998000	0.40836	0.998000	0.56505	0.155000	0.21991	0.743000	0.26231	0.583000	0.29574	-0.198000	0.12761	TGC	PHKA1	-	pfam_Glyco_hydro_15	ENSG00000067177		0.338	PHKA1-001	KNOWN	basic|CCDS	protein_coding	PHKA1	HGNC	protein_coding	OTTHUMT00000058896.1	-	0.00	55	0	G			71856232	-1	tier1	-	no_errors	ENST00000373539	ensembl	human	known	74_37	nonsense	8.33	44	4	SNP	0.993	T
PHOX2A	401	genome.wustl.edu	37	11	71952305	71952305	+	Silent	SNP	G	G	A			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr11:71952305G>A	ENST00000298231.5	-	2	417	c.246C>T	c.(244-246)tcC>tcT	p.S82S	PHOX2A_ENST00000544057.1_5'UTR	NM_005169.3	NP_005160.2	O14813	PHX2A_HUMAN	paired-like homeobox 2a	82					dopaminergic neuron differentiation (GO:0071542)|locus ceruleus development (GO:0021703)|midbrain development (GO:0030901)|noradrenergic neuron differentiation (GO:0003357)|oculomotor nerve formation (GO:0021623)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of respiratory gaseous exchange (GO:0043576)|somatic motor neuron differentiation (GO:0021523)|sympathetic nervous system development (GO:0048485)|transcription, DNA-templated (GO:0006351)|trochlear nerve formation (GO:0021642)	nuclear chromatin (GO:0000790)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|lung(2)	5						CGTGCAGGCCGGATGGCTCTG	0.652																																																	0													38.0	36.0	37.0					11																	71952305		2200	4293	6493	SO:0001819	synonymous_variant	0			AF022722	CCDS8214.1	11q13.4	2014-09-04	2007-07-12	2003-02-14	ENSG00000165462	ENSG00000165462		"""Homeoboxes / PRD class"""	691	protein-coding gene	gene with protein product		602753	"""aristaless (Drosophila) homeobox, aristaless homeobox (Drosophila), fibrosis of extraocular muscles, congenital, 2, autosomal recessive"", ""paired-like (aristaless) homeobox 2a"""	ARIX, FEOM2		8661014, 11600883	Standard	NM_005169		Approved	PMX2A, CFEOM2	uc001osh.4	O14813	OTTHUMG00000167899	ENST00000298231.5:c.246C>T	11.37:g.71952305G>A			A8K3N0|Q8IVZ2	Silent	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom	p.S82	ENST00000298231.5	37	c.246	CCDS8214.1	11																																																																																			PHOX2A	-	superfamily_Homeodomain-like	ENSG00000165462		0.652	PHOX2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHOX2A	HGNC	protein_coding	OTTHUMT00000396885.1	-	0.00	28	0	G	NM_005169		71952305	-1	tier1	-	no_errors	ENST00000298231	ensembl	human	known	74_37	silent	27.78	13	5	SNP	0.916	A
PIKFYVE	200576	genome.wustl.edu	37	2	209150469	209150469	+	Silent	SNP	A	A	T			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr2:209150469A>T	ENST00000264380.4	+	6	791	c.633A>T	c.(631-633)acA>acT	p.T211T	PIKFYVE_ENST00000407449.1_Silent_p.T211T|PIKFYVE_ENST00000392202.3_Silent_p.T114T|PIKFYVE_ENST00000308862.6_Silent_p.T125T	NM_015040.3	NP_055855.2	Q9Y2I7	FYV1_HUMAN	phosphoinositide kinase, FYVE finger containing	211					cellular protein metabolic process (GO:0044267)|intracellular signal transduction (GO:0035556)|myelin assembly (GO:0032288)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phospholipid metabolic process (GO:0006644)|protein localization to nucleus (GO:0034504)|retrograde transport, endosome to Golgi (GO:0042147)|small molecule metabolic process (GO:0044281)	cell-cell junction (GO:0005911)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|early endosome membrane (GO:0031901)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|late endosome membrane (GO:0031902)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|vesicle membrane (GO:0012506)	1-phosphatidylinositol-3-phosphate 5-kinase activity (GO:0000285)|1-phosphatidylinositol-4-phosphate 5-kinase activity (GO:0016308)|ATP binding (GO:0005524)|phosphatidylinositol-3,5-bisphosphate 5-phosphatase activity (GO:0043813)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(14)|kidney(6)|large_intestine(25)|lung(40)|ovary(7)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	107						GAGCTTGCACATATTGTAGAA	0.358																																																	0													105.0	103.0	104.0					2																	209150469		2203	4300	6503	SO:0001819	synonymous_variant	0			AB023198	CCDS2382.1, CCDS33368.1, CCDS54431.1	2q34	2014-01-15	2009-04-17	2009-04-17	ENSG00000115020	ENSG00000115020		"""Zinc fingers, FYVE domain containing"""	23785	protein-coding gene	gene with protein product	"""zinc finger, FYVE domain containing 29"""	609414	"""phosphatidylinositol-3-phosphate/phosphatidylinositol 5-kinase, type III"""	PIP5K3		9858586, 12270933	Standard	NM_015040		Approved	MGC40423, KIAA0981, PIKfyve, PIP5K, p235, ZFYVE29, FAB1	uc002vcz.3	Q9Y2I7	OTTHUMG00000132945	ENST00000264380.4:c.633A>T	2.37:g.209150469A>T			Q08AR7|Q08AR8|Q53ST3|Q53T36|Q8N5H0|Q8NB67	Missense_Mutation	SNP	NULL	p.H154L	ENST00000264380.4	37	c.461	CCDS2382.1	2																																																																																			PIKFYVE	-	NULL	ENSG00000115020		0.358	PIKFYVE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIKFYVE	HGNC	protein_coding	OTTHUMT00000256477.2	-	0.00	31	0	A	NM_015040		209150469	+1	tier1	-	no_errors	ENST00000443896	ensembl	human	known	74_37	missense	6.56	57	4	SNP	0.929	T
PITPNB	23760	genome.wustl.edu	37	22	28293845	28293845	+	Missense_Mutation	SNP	T	T	A			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr22:28293845T>A	ENST00000335272.5	-	4	309	c.233A>T	c.(232-234)gAg>gTg	p.E78V	PITPNB_ENST00000455418.3_Missense_Mutation_p.E80V|PITPNB_ENST00000320996.10_Missense_Mutation_p.E78V	NM_012399.3	NP_036531.1	P48739	PIPNB_HUMAN	phosphatidylinositol transfer protein, beta	78					glycerophospholipid biosynthetic process (GO:0046474)|in utero embryonic development (GO:0001701)|lipid metabolic process (GO:0006629)|phospholipid metabolic process (GO:0006644)|phospholipid transport (GO:0015914)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)	lipid binding (GO:0008289)			large_intestine(4)|lung(3)|skin(1)	8						CAAGGAGCCCTCGGGAGCAAT	0.493																																																	0													99.0	86.0	90.0					22																	28293845		2203	4300	6503	SO:0001583	missense	0			D30037	CCDS13842.1, CCDS63433.1	22q12.1	2006-12-15			ENSG00000180957	ENSG00000180957			9002	protein-coding gene	gene with protein product		606876				10591208	Standard	NM_012399		Approved	VIB1B	uc003adk.3	P48739	OTTHUMG00000150976	ENST00000335272.5:c.233A>T	22.37:g.28293845T>A	ENSP00000334738:p.Glu78Val		B3KYB8|B7Z7Q0|Q8N5W1	Missense_Mutation	SNP	pfam_PI_transfer,prints_PI_transfer	p.E80V	ENST00000335272.5	37	c.239	CCDS13842.1	22	.	.	.	.	.	.	.	.	.	.	T	33	5.229801	0.95173	.	.	ENSG00000180957	ENST00000335272;ENST00000320996;ENST00000455418;ENST00000415296;ENST00000436663	T;T;T;T;T	0.49432	0.78;0.78;0.78;0.78;0.78	5.95	5.95	0.96441	START-like domain (1);	0.000000	0.85682	D	0.000000	T	0.61912	0.2385	M	0.86573	2.825	0.80722	D	1	B;B;B	0.29085	0.119;0.049;0.232	B;B;B	0.38264	0.196;0.092;0.269	T	0.65582	-0.6133	10	0.72032	D	0.01	-39.2042	15.2477	0.73517	0.0:0.0:0.0:1.0	.	80;78;78	B7Z7Q0;P48739-2;P48739	.;.;PIPNB_HUMAN	V	78;78;80;5;80	ENSP00000334738:E78V;ENSP00000321266:E78V;ENSP00000405179:E80V;ENSP00000406542:E5V;ENSP00000403675:E80V	ENSP00000321266:E78V	E	-	2	0	PITPNB	26623845	1.000000	0.71417	0.998000	0.56505	0.981000	0.71138	7.725000	0.84808	2.279000	0.76181	0.533000	0.62120	GAG	PITPNB	-	pfam_PI_transfer	ENSG00000180957		0.493	PITPNB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PITPNB	HGNC	protein_coding	OTTHUMT00000320740.1	-	0.00	72	0	T			28293845	-1	tier1	-	no_errors	ENST00000455418	ensembl	human	known	74_37	missense	7.46	62	5	SNP	1.000	A
PLEKHG3	26030	genome.wustl.edu	37	14	65210991	65210991	+	3'UTR	SNP	C	C	A			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr14:65210991C>A	ENST00000394691.1	+	0	4377				PLEKHG3_ENST00000484731.2_3'UTR|PLEKHG3_ENST00000247226.7_3'UTR|PLEKHG3_ENST00000471182.2_3'UTR|PLEKHG3_ENST00000492928.1_3'UTR			A1L390	PKHG3_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 3								Rho guanyl-nucleotide exchange factor activity (GO:0005089)			endometrium(5)|kidney(2)|large_intestine(1)|lung(14)|prostate(2)|skin(3)|urinary_tract(2)	29				all cancers(60;0.00802)|OV - Ovarian serous cystadenocarcinoma(108;0.0109)|BRCA - Breast invasive adenocarcinoma(234;0.0485)		GTTGTGCTGACCCTGTGGTTG	0.478																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AB011171	CCDS32098.1	14q23.3	2013-01-10	2004-12-01	2004-12-01	ENSG00000126822	ENSG00000126822		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	20364	protein-coding gene	gene with protein product			"""KIAA0599"""	KIAA0599			Standard	XM_005267511		Approved	ARHGEF43	uc001xhp.2	A1L390	OTTHUMG00000029671	ENST00000394691.1:c.*570C>A	14.37:g.65210991C>A			A1L389|B5MEC9|O60339|Q6GMS3|Q6P4B1|Q7L3S3|Q86SW7|Q8TEF5|Q96EW6|Q9BT82	RNA	SNP	-	NULL	ENST00000394691.1	37	NULL		14																																																																																			PLEKHG3	-	-	ENSG00000126822		0.478	PLEKHG3-010	KNOWN	basic|appris_principal	protein_coding	PLEKHG3	HGNC	protein_coding	OTTHUMT00000412028.1	-	0.00	61	0	C	NM_015549		65210991	+1	tier1	-	no_errors	ENST00000492928	ensembl	human	known	74_37	rna	6.45	58	4	SNP	0.183	A
PLXNA4	91584	genome.wustl.edu	37	7	131913111	131913111	+	Silent	SNP	G	G	A			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr7:131913111G>A	ENST00000359827.3	-	6	2684	c.1722C>T	c.(1720-1722)aaC>aaT	p.N574N	PLXNA4_ENST00000321063.4_Silent_p.N574N			Q9HCM2	PLXA4_HUMAN	plexin A4	574					anterior commissure morphogenesis (GO:0021960)|axon guidance (GO:0007411)|chemorepulsion of branchiomotor axon (GO:0021793)|facial nerve structural organization (GO:0021612)|glossopharyngeal nerve morphogenesis (GO:0021615)|postganglionic parasympathetic nervous system development (GO:0021784)|regulation of axon extension involved in axon guidance (GO:0048841)|regulation of negative chemotaxis (GO:0050923)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|sympathetic nervous system development (GO:0048485)|trigeminal nerve structural organization (GO:0021637)|vagus nerve morphogenesis (GO:0021644)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)	p.N574N(2)|p.N574K(2)		NS(1)|breast(1)|endometrium(3)|kidney(4)|large_intestine(14)|lung(17)|ovary(1)|prostate(2)|skin(1)|stomach(1)	45						TTACCAGCACGTTGTACTGAG	0.592																																																	4	Substitution - Missense(2)|Substitution - coding silent(2)	lung(2)|endometrium(2)											68.0	70.0	69.0					7																	131913111		1967	4151	6118	SO:0001819	synonymous_variant	0			AB046770, AK123428	CCDS5826.1, CCDS43646.1, CCDS43647.1	7q32.3	2007-09-26	2007-09-26	2007-09-26	ENSG00000221866	ENSG00000221866		"""Plexins"""	9102	protein-coding gene	gene with protein product		604280	"""plexin A4, A"", ""plexin A4, B"""	PLXNA4A, PLXNA4B			Standard	NM_181775		Approved	KIAA1550, DKFZp434G0625PRO34003, FAYV2820	uc003vra.4	Q9HCM2	OTTHUMG00000155108	ENST00000359827.3:c.1722C>T	7.37:g.131913111G>A			A4D1N6|E9PAM2|Q6UWC6|Q6ZW89|Q8N969|Q8ND00|Q8NEN3|Q9NTD4	Silent	SNP	pfam_Plexin_cytoplasmic_RasGAP_dom,pfam_Semap_dom,pfam_IPT,pfam_Plexin_repeat,superfamily_Semap_dom,superfamily_Rho_GTPase_activation_prot,superfamily_Ig_E-set,superfamily_Plexin-like_fold,smart_Semap_dom,smart_Plexin-like_fold,smart_IPT,pfscan_Semap_dom	p.N574	ENST00000359827.3	37	c.1722	CCDS43646.1	7																																																																																			PLXNA4	-	NULL	ENSG00000221866		0.592	PLXNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLXNA4	HGNC	protein_coding	OTTHUMT00000338422.2	-	0.00	104	0	G	NM_181775		131913111	-1	tier1	-	no_errors	ENST00000321063	ensembl	human	known	74_37	silent	44.12	57	45	SNP	0.980	A
POLD3	10714	genome.wustl.edu	37	11	74323975	74323975	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr11:74323975G>T	ENST00000263681.2	+	5	441	c.312G>T	c.(310-312)caG>caT	p.Q104H	POLD3_ENST00000532497.1_5'UTR|POLD3_ENST00000527458.1_Missense_Mutation_p.Q65H	NM_006591.2	NP_006582.1	Q15054	DPOD3_HUMAN	polymerase (DNA-directed), delta 3, accessory subunit	104					base-excision repair (GO:0006284)|DNA repair (GO:0006281)|DNA strand elongation involved in DNA replication (GO:0006271)|DNA synthesis involved in DNA repair (GO:0000731)|mismatch repair (GO:0006298)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	delta DNA polymerase complex (GO:0043625)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA-directed DNA polymerase activity (GO:0003887)			breast(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(6)|ovary(1)|skin(1)|stomach(1)	18	Breast(11;3.21e-06)					ACAGCATCCAGAAAGCCATGC	0.443																																																	0													163.0	135.0	145.0					11																	74323975		2200	4293	6493	SO:0001583	missense	0			D26018	CCDS8233.1	11q14	2014-06-13			ENSG00000077514	ENSG00000077514		"""DNA polymerases"""	20932	protein-coding gene	gene with protein product	"""DNA polymerase delta subunit p66"", ""Pol delta C subunit (p66)"", ""protein phosphatase 1, regulatory subunit 128"""	611415				10219083	Standard	NM_006591		Approved	P66, KIAA0039, P68, PPP1R128	uc001ovf.2	Q15054	OTTHUMG00000165621	ENST00000263681.2:c.312G>T	11.37:g.74323975G>T	ENSP00000263681:p.Gln104His		B7ZAI6|Q32MZ9|Q32N00	Missense_Mutation	SNP	pfam_DNA_polymerase_subunit_Cdc27	p.Q104H	ENST00000263681.2	37	c.312	CCDS8233.1	11	.	.	.	.	.	.	.	.	.	.	G	18.49	3.634590	0.67130	.	.	ENSG00000077514	ENST00000528481;ENST00000263681;ENST00000527458;ENST00000538052;ENST00000530511;ENST00000531615	.	.	.	5.68	5.68	0.88126	.	0.060021	0.64402	D	0.000002	T	0.76227	0.3958	M	0.71581	2.175	0.80722	D	1	D	0.57571	0.98	P	0.61201	0.885	T	0.74760	-0.3556	9	0.39692	T	0.17	-29.5304	17.2989	0.87176	0.0:0.0:1.0:0.0	.	104	Q15054	DPOD3_HUMAN	H	65;104;65;104;65;65	.	ENSP00000263681:Q104H	Q	+	3	2	POLD3	74001623	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.202000	0.77856	2.672000	0.90937	0.557000	0.71058	CAG	POLD3	-	pfam_DNA_polymerase_subunit_Cdc27	ENSG00000077514		0.443	POLD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POLD3	HGNC	protein_coding	OTTHUMT00000385376.1	-	0.00	65	0	G	NM_006591		74323975	+1	tier1	-	no_errors	ENST00000263681	ensembl	human	known	74_37	missense	7.27	51	4	SNP	1.000	T
UBE2D4	51619	genome.wustl.edu	37	7	43992213	43992213	+	Intron	SNP	A	A	T			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr7:43992213A>T	ENST00000222402.3	+	7	487				POLR2J4_ENST00000427076.1_RNA|RP5-1165K10.2_ENST00000454572.1_RNA|UBE2D4_ENST00000394798.4_Intron	NM_015983.3	NP_057067.1	Q9Y2X8	UB2D4_HUMAN	ubiquitin-conjugating enzyme E2D 4 (putative)						protein K11-linked ubiquitination (GO:0070979)|protein K27-linked ubiquitination (GO:0044314)|protein K29-linked ubiquitination (GO:0035519)|protein K48-linked ubiquitination (GO:0070936)|protein K6-linked ubiquitination (GO:0085020)|protein K63-linked ubiquitination (GO:0070534)		acid-amino acid ligase activity (GO:0016881)|ATP binding (GO:0005524)|ubiquitin-protein transferase activity (GO:0004842)			endometrium(1)|large_intestine(2)|lung(1)|pancreas(1)	5						GACCATTTCAAGTGAGGGTGT	0.463																																					Esophageal Squamous(27;401 815 16344 30604)												0													133.0	134.0	133.0					7																	43992213		2203	4300	6503	SO:0001627	intron_variant	0			BC004104	CCDS5474.1	7p13	2005-08-11			ENSG00000078967	ENSG00000078967		"""Ubiquitin-conjugating enzymes E2"""	21647	protein-coding gene	gene with protein product						12690205	Standard	NM_015983		Approved	HBUCE1	uc003tja.2	Q9Y2X8	OTTHUMG00000128971	ENST00000222402.3:c.399-36A>T	7.37:g.43992213A>T			A4D1V0	RNA	SNP	-	NULL	ENST00000222402.3	37	NULL	CCDS5474.1	7																																																																																			POLR2J4	-	-	ENSG00000214783		0.463	UBE2D4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POLR2J4	HGNC	protein_coding	OTTHUMT00000250958.2	-	0.00	38	0	A	NM_015983		43992213	-1	tier1	-	no_errors	ENST00000427076	ensembl	human	known	74_37	rna	13.33	26	4	SNP	0.011	T
PPOX	5498	genome.wustl.edu	37	1	161139725	161139725	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr1:161139725G>T	ENST00000367999.4	+	9	1164	c.898G>T	c.(898-900)Gcc>Tcc	p.A300S	PPOX_ENST00000432542.2_Intron|PPOX_ENST00000535223.1_Intron|PPOX_ENST00000352210.5_Missense_Mutation_p.A300S|PPOX_ENST00000495483.1_3'UTR|PPOX_ENST00000544598.1_Intron|B4GALT3_ENST00000470882.1_5'Flank	NM_001122764.1	NP_001116236.1	P50336	PPOX_HUMAN	protoporphyrinogen oxidase	300					heme biosynthetic process (GO:0006783)|oxidation-reduction process (GO:0055114)|porphyrin-containing compound biosynthetic process (GO:0006779)|porphyrin-containing compound metabolic process (GO:0006778)|protoporphyrinogen IX biosynthetic process (GO:0006782)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)	integral component of mitochondrial inner membrane (GO:0031305)|intrinsic component of mitochondrial inner membrane (GO:0031304)|mitochondrial intermembrane space (GO:0005758)|mitochondrial membrane (GO:0031966)	flavin adenine dinucleotide binding (GO:0050660)|oxygen-dependent protoporphyrinogen oxidase activity (GO:0004729)			breast(1)|cervix(1)|endometrium(1)|large_intestine(3)|lung(5)|ovary(1)|urinary_tract(3)	15	all_cancers(52;3.73e-19)|Breast(13;0.000577)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00275)			TGCTGAGGCTGCCCCTCTGGC	0.547																																																	0													76.0	70.0	72.0					1																	161139725		2203	4300	6503	SO:0001583	missense	0			BC002357	CCDS1221.1	1q22	2008-02-05			ENSG00000143224	ENSG00000143224	1.3.3.4		9280	protein-coding gene	gene with protein product		600923	"""variegate porphyria"""	VP		8575762, 10457135	Standard	NM_000309		Approved	PPO	uc001fyg.2	P50336	OTTHUMG00000034342	ENST00000367999.4:c.898G>T	1.37:g.161139725G>T	ENSP00000356978:p.Ala300Ser		D3DVG0|Q5VTW8	Missense_Mutation	SNP	pfam_Amino_oxidase,tigrfam_Protoporphyrinogen_oxidase	p.A300S	ENST00000367999.4	37	c.898	CCDS1221.1	1	.	.	.	.	.	.	.	.	.	.	G	12.14	1.848429	0.32699	.	.	ENSG00000143224	ENST00000352210;ENST00000367999;ENST00000435935	D;D	0.92858	-3.12;-3.12	5.43	3.56	0.40772	Amine oxidase (1);	0.300742	0.35677	N	0.003041	T	0.65974	0.2743	N	0.17838	0.53	0.30189	N	0.799705	B;B;B	0.09022	0.002;0.0;0.0	B;B;B	0.15052	0.012;0.009;0.003	T	0.50964	-0.8765	10	0.06236	T	0.91	-32.6673	6.8768	0.24151	0.0872:0.0:0.7404:0.1724	.	267;138;300	B4DY76;B3KT30;P50336	.;.;PPOX_HUMAN	S	300;300;267	ENSP00000343943:A300S;ENSP00000356978:A300S	ENSP00000343943:A300S	A	+	1	0	PPOX	159406349	0.191000	0.23288	0.044000	0.18714	0.980000	0.70556	2.804000	0.47931	0.841000	0.35020	0.650000	0.86243	GCC	PPOX	-	pfam_Amino_oxidase,tigrfam_Protoporphyrinogen_oxidase	ENSG00000143224		0.547	PPOX-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PPOX	HGNC	protein_coding	OTTHUMT00000082993.1	-	0.00	34	0	G	NM_000309		161139725	+1	tier1	-	no_errors	ENST00000352210	ensembl	human	known	74_37	missense	7.55	49	4	SNP	0.108	T
PRDM10	56980	genome.wustl.edu	37	11	129814909	129814909	+	Splice_Site	SNP	T	T	C			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr11:129814909T>C	ENST00000360871.3	-	6	752		c.e6-2		PRDM10_ENST00000358825.5_Splice_Site|PRDM10_ENST00000528746.1_Splice_Site|PRDM10_ENST00000526082.1_Splice_Site|PRDM10_ENST00000423662.2_Splice_Site|PRDM10_ENST00000304538.6_Splice_Site	NM_199437.1	NP_955469.1	Q9NQV6	PRD10_HUMAN	PR domain containing 10						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)			breast(2)|endometrium(6)|kidney(3)|large_intestine(14)|lung(15)|pancreas(2)|skin(1)|stomach(3)|urinary_tract(2)	48	all_hematologic(175;0.0537)	Breast(109;0.000496)|Lung NSC(97;0.000693)|all_lung(97;0.00151)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.0174)|Lung(977;0.176)|LUSC - Lung squamous cell carcinoma(976;0.185)		CCTCACACCCTGCAAAAGAGA	0.537																																																	0													41.0	41.0	41.0					11																	129814909		2201	4297	6498	SO:0001630	splice_region_variant	0			AF275817	CCDS8484.1, CCDS8485.1, CCDS44771.1, CCDS44772.1	11q24.3	2013-01-08			ENSG00000170325	ENSG00000170325		"""Zinc fingers, C2H2-type"""	13995	protein-coding gene	gene with protein product	"""PRDM zinc finger transcription factor"", ""PR-domain family member 7"", ""tristanin"""					12175877	Standard	NM_020228		Approved	KIAA1231, PFM7, MGC131802	uc001qfm.3	Q9NQV6	OTTHUMG00000165762	ENST00000360871.3:c.521-2A>G	11.37:g.129814909T>C			B7ZL71|G3XAE5|J3KP23|Q17R90|Q2KHR4|Q863Z2|Q9NXI4|Q9ULI9	Splice_Site	SNP	-	e5-2	ENST00000360871.3	37	c.521-2	CCDS8484.1	11	.	.	.	.	.	.	.	.	.	.	T	21.1	4.098313	0.76870	.	.	ENSG00000170325	ENST00000358825;ENST00000304538;ENST00000360871;ENST00000423662;ENST00000528746;ENST00000526082	.	.	.	5.5	5.5	0.81552	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.9079	0.79445	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	PRDM10	129320119	1.000000	0.71417	0.992000	0.48379	0.894000	0.52154	7.655000	0.83696	2.213000	0.71641	0.528000	0.53228	.	PRDM10	-	-	ENSG00000170325		0.537	PRDM10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRDM10	HGNC	protein_coding	OTTHUMT00000386076.1	-	0.00	78	0	T	NM_199437	Intron	129814909	-1	tier1	-	no_errors	ENST00000358825	ensembl	human	known	74_37	splice_site	6.45	58	4	SNP	1.000	C
PRKG1	5592	genome.wustl.edu	37	10	53814276	53814276	+	Silent	SNP	G	G	A			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr10:53814276G>A	ENST00000401604.2	+	6	944	c.750G>A	c.(748-750)agG>agA	p.R250R	PRKG1_ENST00000373975.2_5'UTR|PRKG1_ENST00000373985.1_Silent_p.R238R|PRKG1_ENST00000373980.4_Silent_p.R265R			Q13976	KGP1_HUMAN	protein kinase, cGMP-dependent, type I	250	cGMP-binding, low affinity.				actin cytoskeleton organization (GO:0030036)|blood coagulation (GO:0007596)|cGMP-mediated signaling (GO:0019934)|dendrite development (GO:0016358)|forebrain development (GO:0030900)|negative regulation of platelet aggregation (GO:0090331)|neuron migration (GO:0001764)|protein phosphorylation (GO:0006468)|regulation of GTPase activity (GO:0043087)|relaxation of vascular smooth muscle (GO:0060087)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium channel regulator activity (GO:0005246)|cGMP binding (GO:0030553)|cGMP-dependent protein kinase activity (GO:0004692)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(23)|ovary(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	53		all_cancers(4;2.13e-08)|all_epithelial(4;2.44e-08)|all_lung(4;0.000173)		all cancers(4;1.18e-05)|GBM - Glioblastoma multiforme(4;0.000359)|Epithelial(53;0.00532)|Lung(62;0.0606)		ATATTATCAGGCAAGGTGCAA	0.428																																																	0													106.0	95.0	99.0					10																	53814276		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS7244.1	10q11.2	2009-07-10			ENSG00000185532	ENSG00000185532	2.7.11.1		9414	protein-coding gene	gene with protein product		176894		PRKGR1B, PRKG1B		2792381, 1544322	Standard	NM_001098512		Approved	PGK, PKG	uc001jjo.3	Q13976	OTTHUMG00000018248	ENST00000401604.2:c.750G>A	10.37:g.53814276G>A			A5YM56|B3KSF3|E2PU10|P14619|Q5JP05|Q5JSJ6|Q6P5T7	Silent	SNP	pirsf_cGMP-dependent_protein_kinase,pfam_Prot_kinase_dom,pfam_cNMP-bd_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,prints_cGMP_dep_kinase,prints_cAMP/cGMP_kin,pfscan_cNMP-bd_dom,pfscan_Prot_kinase_dom	p.R265	ENST00000401604.2	37	c.795	CCDS44399.1	10																																																																																			PRKG1	-	pirsf_cGMP-dependent_protein_kinase,pfam_cNMP-bd_dom,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,prints_cAMP/cGMP_kin,pfscan_cNMP-bd_dom	ENSG00000185532		0.428	PRKG1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKG1	HGNC	protein_coding		-	0.00	47	0	G			53814276	+1	tier1	-	no_errors	ENST00000373980	ensembl	human	known	74_37	silent	7.69	48	4	SNP	1.000	A
CERS3	204219	genome.wustl.edu	37	15	101088125	101088126	+	5'Flank	INS	-	-	T	rs532048470|rs574236631|rs111634080	byFrequency	TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr15:101088125_101088126insT	ENST00000560944.1	-	0	0				RP11-526I2.5_ENST00000602585.1_lincRNA			Q8IU89	CERS3_HUMAN	ceramide synthase 3						ceramide biosynthetic process (GO:0046513)|keratinocyte differentiation (GO:0030216)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sphingosine N-acyltransferase activity (GO:0050291)										ACATGCTACAGTTTTTTTTTTC	0.347													|||unknown(HR)	294	0.0587061	0.0204	0.1902	5008	,	,		16134	0.0437		0.0487	False		,,,				2504	0.0429																0																																										SO:0001631	upstream_gene_variant	0				CCDS10384.1	15q26.3	2012-11-19	2011-07-08	2011-07-08	ENSG00000154227	ENSG00000154227		"""Homeoboxes / CERS class"""	23752	protein-coding gene	gene with protein product		615276	"""LAG1 longevity assurance homolog 3 (S. cerevisiae)"", ""LAG1 homolog, ceramide synthase 3"""	LASS3			Standard	NM_178842		Approved	MGC27091	uc002bwb.3	Q8IU89	OTTHUMG00000172568		15.37:g.101088135_101088135dupT	Exception_encountered		Q8NE64|Q8NEN6	RNA	INS	-	NULL	ENST00000560944.1	37	NULL		15																																																																																			RP11-526I2.5	-	-	ENSG00000270127		0.347	CERS3-009	KNOWN	basic	processed_transcript	PRKXP1	Clone_based_vega_gene	protein_coding	OTTHUMT00000417720.1		0.00	30	0	-	NM_178842		101088126	-1	tier1		no_errors	ENST00000602585	ensembl	human	known	74_37	rna	13.51	32	5	INS	0.000:0.000	T
PROSC	11212	genome.wustl.edu	37	8	37633454	37633454	+	Nonsense_Mutation	SNP	G	G	T			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr8:37633454G>T	ENST00000328195.3	+	7	683	c.616G>T	c.(616-618)Gag>Tag	p.E206*		NM_007198.3	NP_009129.1	O94903	PROSC_HUMAN	proline synthetase co-transcribed homolog (bacterial)	206					alpha-amino acid metabolic process (GO:1901605)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|mitochondrion (GO:0005739)	pyridoxal phosphate binding (GO:0030170)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(2)|prostate(1)	7		Lung NSC(58;0.174)	BRCA - Breast invasive adenocarcinoma(5;6.14e-24)|LUSC - Lung squamous cell carcinoma(8;3.5e-10)		L-Proline(DB00172)	GTCCCTCCGGGAGGAGCTGTG	0.512																																																	0													204.0	200.0	201.0					8																	37633454		2203	4300	6503	SO:0001587	stop_gained	0			AB018566	CCDS6096.1	8p11.2	2008-01-07	2001-12-04		ENSG00000147471	ENSG00000147471			9457	protein-coding gene	gene with protein product		604436	"""proline synthetase co-transcribed (bacterial homolog)"""				Standard	NM_007198		Approved		uc003xkh.3	O94903	OTTHUMG00000164024	ENST00000328195.3:c.616G>T	8.37:g.37633454G>T	ENSP00000333551:p.Glu206*		Q6FI94	Nonsense_Mutation	SNP	pfam_Ala_racemase_N,pirsf_UPF0001,tigrfam_UPF0001	p.E206*	ENST00000328195.3	37	c.616	CCDS6096.1	8	.	.	.	.	.	.	.	.	.	.	G	23.3	4.397963	0.83120	.	.	ENSG00000147471	ENST00000328195	.	.	.	6.07	-1.07	0.09968	.	0.839197	0.11400	N	0.567979	.	.	.	.	.	.	0.32339	N	0.559994	.	.	.	.	.	.	.	.	.	.	0.23891	T	0.37	.	7.2884	0.26352	0.388:0.3807:0.2313:0.0	.	.	.	.	X	206	.	ENSP00000333551:E206X	E	+	1	0	PROSC	37752612	0.998000	0.40836	0.511000	0.27724	0.401000	0.30781	1.013000	0.29937	-0.387000	0.07809	-0.122000	0.15005	GAG	PROSC	-	pfam_Ala_racemase_N,pirsf_UPF0001,tigrfam_UPF0001	ENSG00000147471		0.512	PROSC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PROSC	HGNC	protein_coding	OTTHUMT00000376796.1	-	0.00	64	0	G	NM_007198		37633454	+1	tier1	-	no_errors	ENST00000328195	ensembl	human	known	74_37	nonsense	34.00	33	17	SNP	0.187	T
U66059.58	0	genome.wustl.edu	37	7	141988540	141988540	+	lincRNA	SNP	C	C	G			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr7:141988540C>G	ENST00000486508.1	+	0	226				PRSS3P3_ENST00000463748.1_RNA																							CGACTGAGCTCAGCTTAATCA	0.473																																																	0																																												0																															7.37:g.141988540C>G				RNA	SNP	-	NULL	ENST00000486508.1	37	NULL		7																																																																																			PRSS3P3	-	-	ENSG00000242115		0.473	U66059.58-001	KNOWN	basic	lincRNA	PRSS3P3	HGNC	lincRNA	OTTHUMT00000351333.2	-	0.00	115	0	C			141988540	-1	tier1	-	no_errors	ENST00000463748	ensembl	human	known	74_37	rna	34.31	67	35	SNP	1.000	G
PSTPIP1	9051	genome.wustl.edu	37	15	77310844	77310844	+	Missense_Mutation	SNP	C	C	T	rs375063664		TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr15:77310844C>T	ENST00000558012.1	+	3	673	c.184C>T	c.(184-186)Cgg>Tgg	p.R62W	PSTPIP1_ENST00000379595.3_Missense_Mutation_p.R62W|PSTPIP1_ENST00000559295.1_Missense_Mutation_p.R62W|PSTPIP1_ENST00000267939.5_Missense_Mutation_p.R61W	NM_003978.3	NP_003969.2	O43586	PPIP1_HUMAN	proline-serine-threonine phosphatase interacting protein 1	62	FCH. {ECO:0000255|PROSITE- ProRule:PRU00083}.				cell adhesion (GO:0007155)|endocytosis (GO:0006897)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|signal transduction (GO:0007165)	actomyosin contractile ring (GO:0005826)|cell projection (GO:0042995)|cleavage furrow (GO:0032154)|cytosol (GO:0005829)|membrane (GO:0016020)|stress fiber (GO:0001725)		p.R62W(2)		breast(1)|endometrium(3)|lung(2)|ovary(2)|upper_aerodigestive_tract(1)	9						GCAGATCGCACGGAAGGCAGG	0.577																																																	2	Substitution - Missense(2)	endometrium(2)						C	TRP/ARG	0,3954		0,0,1977	32.0	39.0	37.0		184	2.9	1.0	15		37	1,8293		0,1,4146	no	missense	PSTPIP1	NM_003978.3	101	0,1,6123	TT,TC,CC		0.0121,0.0,0.0082	probably-damaging	62/417	77310844	1,12247	1977	4147	6124	SO:0001583	missense	0			U94778	CCDS45312.1	15q24.3	2014-09-17			ENSG00000140368	ENSG00000140368			9580	protein-coding gene	gene with protein product	"""CD2 cytoplasmic tail-binding protein"", ""CD2 antigen-binding protein 1"", ""PEST phosphatase-interacting protein 1"""	606347				9857189	Standard	NM_003978		Approved	PSTPIP, CD2BP1L, CD2BP1, CD2BP1S, H-PIP, PAPAS	uc002bcf.2	O43586	OTTHUMG00000172594	ENST00000558012.1:c.184C>T	15.37:g.77310844C>T	ENSP00000452746:p.Arg62Trp		B5BU74|B5BUK4|O43585|O95657	Missense_Mutation	SNP	pfam_FCH_dom,superfamily_Prismane-like,smart_FCH_dom,pfscan_FCH_dom	p.R127W	ENST00000558012.1	37	c.379	CCDS45312.1	15	.	.	.	.	.	.	.	.	.	.	C	16.34	3.094369	0.56075	0.0	1.21E-4	ENSG00000140368	ENST00000379595;ENST00000267939	T;T	0.47528	0.84;2.43	3.81	2.88	0.33553	Fps/Fes/Fer/CIP4 homology (3);Prismane-like (1);	0.068606	0.64402	D	0.000012	T	0.64983	0.2648	M	0.73962	2.25	0.50171	D	0.999855	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.87578	0.986;0.998;0.991;0.997	T	0.67373	-0.5687	10	0.87932	D	0	-19.9357	10.1872	0.43004	0.3598:0.6402:0.0:0.0	.	62;61;62;62	O43586-2;C9K004;B4E1Z9;O43586	.;.;.;PPIP1_HUMAN	W	62;61	ENSP00000368914:R62W;ENSP00000267939:R61W	ENSP00000267939:R61W	R	+	1	2	PSTPIP1	75097899	0.954000	0.32549	0.979000	0.43373	0.799000	0.45148	1.580000	0.36547	0.947000	0.37659	-0.230000	0.12252	CGG	PSTPIP1	-	pfam_FCH_dom,superfamily_Prismane-like,smart_FCH_dom,pfscan_FCH_dom	ENSG00000140368		0.577	PSTPIP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PSTPIP1	HGNC	protein_coding	OTTHUMT00000419373.2	-	0.00	60	0	C	NM_003978		77310844	+1	tier1	-	no_errors	ENST00000559785	ensembl	human	known	74_37	missense	29.27	29	12	SNP	0.999	T
PTK2B	2185	genome.wustl.edu	37	8	27296648	27296648	+	Splice_Site	SNP	G	G	T			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr8:27296648G>T	ENST00000397501.1	+	24	2552	c.1744G>T	c.(1744-1746)Gcc>Tcc	p.A582S	PTK2B_ENST00000420218.2_Splice_Site_p.A582S|PTK2B_ENST00000544172.1_Splice_Site_p.A582S|PTK2B_ENST00000338238.4_Splice_Site_p.A582S|PTK2B_ENST00000517339.1_Splice_Site_p.A582S|PTK2B_ENST00000346049.5_Splice_Site_p.A582S|PTK2B_ENST00000397497.4_Splice_Site_p.A328S	NM_173174.2	NP_775266.1	Q14289	FAK2_HUMAN	protein tyrosine kinase 2 beta	582	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of Janus kinase activity (GO:0042976)|activation of Rac GTPase activity (GO:0032863)|apoptotic process (GO:0006915)|blood vessel endothelial cell migration (GO:0043534)|bone resorption (GO:0045453)|cell surface receptor signaling pathway (GO:0007166)|cellular defense response (GO:0006968)|cellular response to retinoic acid (GO:0071300)|chemokine-mediated signaling pathway (GO:0070098)|epidermal growth factor receptor signaling pathway (GO:0007173)|focal adhesion assembly (GO:0048041)|glial cell proliferation (GO:0014009)|integrin-mediated signaling pathway (GO:0007229)|ionotropic glutamate receptor signaling pathway (GO:0035235)|long-term synaptic potentiation (GO:0060291)|MAPK cascade (GO:0000165)|marginal zone B cell differentiation (GO:0002315)|negative regulation of apoptotic process (GO:0043066)|negative regulation of bone mineralization (GO:0030502)|negative regulation of cell proliferation (GO:0008285)|negative regulation of muscle cell apoptotic process (GO:0010656)|negative regulation of myeloid cell differentiation (GO:0045638)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of potassium ion transport (GO:0043267)|neuron projection development (GO:0031175)|oocyte maturation (GO:0001556)|peptidyl-tyrosine autophosphorylation (GO:0038083)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of B cell chemotaxis (GO:2000538)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein complex assembly (GO:0006461)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of cell adhesion (GO:0030155)|regulation of cell shape (GO:0008360)|regulation of establishment of cell polarity (GO:2000114)|regulation of inositol trisphosphate biosynthetic process (GO:0032960)|regulation of macrophage chemotaxis (GO:0010758)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000058)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|response to calcium ion (GO:0051592)|response to cAMP (GO:0051591)|response to cocaine (GO:0042220)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to glucose (GO:0009749)|response to hormone (GO:0009725)|response to hydrogen peroxide (GO:0042542)|response to hypoxia (GO:0001666)|response to lithium ion (GO:0010226)|response to mechanical stimulus (GO:0009612)|response to osmotic stress (GO:0006970)|response to stress (GO:0006950)|signal complex assembly (GO:0007172)|signal transduction (GO:0007165)|sprouting angiogenesis (GO:0002040)|stress fiber assembly (GO:0043149)|tumor necrosis factor-mediated signaling pathway (GO:0033209)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	apical dendrite (GO:0097440)|axon (GO:0030424)|cell body (GO:0044297)|cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|lamellipodium (GO:0030027)|membrane raft (GO:0045121)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|postsynaptic density (GO:0014069)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)|signal transducer activity (GO:0004871)			breast(2)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(2)|lung(17)|ovary(4)|skin(12)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Ovarian(32;2.72e-05)		UCEC - Uterine corpus endometrioid carcinoma (27;0.023)|Epithelial(17;6.61e-10)|BRCA - Breast invasive adenocarcinoma(99;0.226)|Colorectal(74;0.229)	Leflunomide(DB01097)	CTATTACAAAGGTGAGGGGGC	0.557																																																	0													72.0	69.0	70.0					8																	27296648		2203	4300	6503	SO:0001630	splice_region_variant	0			U33284	CCDS6057.1, CCDS6058.1	8p21.1	2013-02-18	2013-02-18		ENSG00000120899	ENSG00000120899			9612	protein-coding gene	gene with protein product		601212	"""protein tyrosine kinase 2 beta"", ""PTK2B protein tyrosine kinase 2 beta"""	FAK2		7544443, 7499242	Standard	NM_173174		Approved	CAKB, PYK2, RAFTK, PTK, CADTK	uc003xfp.2	Q14289	OTTHUMG00000102082	ENST00000397501.1:c.1744+1G>T	8.37:g.27296648G>T			D3DST0|Q13475|Q14290|Q16709|Q6PID4	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Focal_adhesion_kin_target_dom,pfam_Prot_kinase_dom,pfam_FERM_central,superfamily_Kinase-like_dom,superfamily_Focal_adhesion_kin_target_dom,superfamily_FERM_central,smart_Band_41_domain,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_FERM_domain,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.A582S	ENST00000397501.1	37	c.1744	CCDS6057.1	8	.	.	.	.	.	.	.	.	.	.	G	26.5	4.739110	0.89573	.	.	ENSG00000120899	ENST00000397501;ENST00000539100;ENST00000338238;ENST00000544172;ENST00000346049;ENST00000420218;ENST00000517339;ENST00000397497	D;D;D;D;D;D;D	0.82255	-1.59;-1.59;-1.59;-1.59;-1.59;-1.59;-1.59	5.66	5.66	0.87406	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.81626	0.4862	N	0.16368	0.405	0.80722	D	1	P;P;B	0.43826	0.818;0.668;0.179	P;P;B	0.54140	0.743;0.587;0.138	T	0.80823	-0.1210	10	0.34782	T	0.22	.	17.2336	0.86991	0.0:0.0:1.0:0.0	.	328;582;582	E9PBI4;Q14289-2;Q14289	.;.;FAK2_HUMAN	S	582;587;582;582;582;582;582;328	ENSP00000380638:A582S;ENSP00000342242:A582S;ENSP00000440926:A582S;ENSP00000332816:A582S;ENSP00000391995:A582S;ENSP00000427931:A582S;ENSP00000380634:A328S	ENSP00000342242:A582S	A	+	1	0	PTK2B	27352565	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	9.843000	0.99491	2.665000	0.90641	0.561000	0.74099	GCC	PTK2B	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000120899		0.557	PTK2B-009	PUTATIVE	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PTK2B	HGNC	protein_coding	OTTHUMT00000219916.1	-	0.00	82	0	G	NM_004103	Missense_Mutation	27296648	+1	tier1	-	no_errors	ENST00000346049	ensembl	human	known	74_37	missense	28.57	40	16	SNP	1.000	T
PTPRJ	5795	genome.wustl.edu	37	11	48131629	48131630	+	Splice_Site	DEL	GT	GT	-			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	GT	GT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr11:48131629_48131630delGT	ENST00000418331.2	+	2	467		c.e2+1		PTPRJ_ENST00000526550.1_Splice_Site|PTPRJ_ENST00000440289.2_Splice_Site	NM_002843.3	NP_002834.3	Q12913	PTPRJ_HUMAN	protein tyrosine phosphatase, receptor type, J						contact inhibition (GO:0060242)|heart development (GO:0007507)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of platelet-derived growth factor receptor signaling pathway (GO:0010642)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of T cell receptor signaling pathway (GO:0050860)|negative regulation of vascular permeability (GO:0043116)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine dephosphorylation (GO:0035335)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive chemotaxis (GO:0050918)|positive regulation of cell adhesion (GO:0045785)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of protein kinase B signaling (GO:0051897)|regulation of cell adhesion (GO:0030155)|vasculogenesis (GO:0001570)	cell projection (GO:0042995)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|delta-catenin binding (GO:0070097)|gamma-catenin binding (GO:0045295)|mitogen-activated protein kinase binding (GO:0051019)|phosphatase activity (GO:0016791)|platelet-derived growth factor receptor binding (GO:0005161)|protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)			breast(3)|endometrium(7)|kidney(7)|large_intestine(5)|lung(15)|ovary(1)|prostate(2)|skin(6)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	52						GCAGGTGGCAGTGAGTACCCTT	0.411											OREG0020960	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0																																										SO:0001630	splice_region_variant	0			U10886	CCDS7945.1, CCDS44596.1	11p11.2	2013-02-11			ENSG00000149177	ENSG00000149177		"""CD molecules"", ""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9673	protein-coding gene	gene with protein product		600925				7937872, 7994032	Standard	NM_001098503		Approved	DEP1, HPTPeta, CD148	uc001ngp.4	Q12913	OTTHUMG00000166573	ENST00000418331.2:c.115+1GT>-	11.37:g.48131629_48131630delGT		952	Q15255|Q6P4H4|Q8NHM2|Q9UDA9	Splice_Site	DEL	-	e2+1	ENST00000418331.2	37	c.115+1_115+1	CCDS7945.1	11																																																																																			PTPRJ	-	-	ENSG00000149177		0.411	PTPRJ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPRJ	HGNC	protein_coding	OTTHUMT00000390525.1		0.00	19	0	GT		Intron	48131630	+1	tier1		no_errors	ENST00000418331	ensembl	human	known	74_37	splice_site_del	37.93	18	11	DEL	0.988:0.998	-
PXDNL	137902	genome.wustl.edu	37	8	52359587	52359587	+	Missense_Mutation	SNP	A	A	T			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr8:52359587A>T	ENST00000356297.4	-	12	1602	c.1502T>A	c.(1501-1503)gTg>gAg	p.V501E	PXDNL_ENST00000543296.1_Missense_Mutation_p.V501E	NM_144651.4	NP_653252	A1KZ92	PXDNL_HUMAN	peroxidasin homolog (Drosophila)-like	501	Ig-like C2-type 3.				hydrogen peroxide catabolic process (GO:0042744)|oxidation-reduction process (GO:0055114)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	endonuclease activity (GO:0004519)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)			NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(6)|lung(25)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	48		all_cancers(86;0.107)|Lung NSC(129;0.00641)|all_epithelial(80;0.00716)|all_lung(136;0.015)				AGTCAGCTGCACAGACACCTT	0.458																																																	0													162.0	161.0	161.0					8																	52359587		2013	4174	6187	SO:0001583	missense	0				CCDS47855.1	8q11.21-q11.22	2013-02-18	2007-01-12		ENSG00000147485	ENSG00000147485		"""Immunoglobulin superfamily / I-set domain containing"""	26359	protein-coding gene	gene with protein product	"""polysomal ribonuclease 1 homolog (Xenopus)"""	615904	"""peroxidasin homolog-like (Drosophila)"""			22543864	Standard	NM_144651		Approved	FLJ25471, PMR1	uc003xqu.4	A1KZ92	OTTHUMG00000164244	ENST00000356297.4:c.1502T>A	8.37:g.52359587A>T	ENSP00000348645:p.Val501Glu		B5ME43|B6CGZ3|H0YBM9|Q6ZMR2|Q96LH9	Missense_Mutation	SNP	pfam_Haem_peroxidase_animal,pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_VWF_C,pfam_Leu-rich_rpt,superfamily_Haem_peroxidase,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,smart_VWF_C,prints_Haem_peroxidase_animal_subgr,pfscan_VWF_C,pfscan_Haem_peroxidase_animal,pfscan_Ig-like_dom	p.V501E	ENST00000356297.4	37	c.1502	CCDS47855.1	8	.	.	.	.	.	.	.	.	.	.	A	11.45	1.642957	0.29246	.	.	ENSG00000147485	ENST00000356297;ENST00000543296	T;T	0.69806	-0.43;-0.43	4.02	1.59	0.23543	Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.79930	0.4531	M	0.88105	2.93	0.27663	N	0.947025	D	0.58970	0.984	D	0.64410	0.925	T	0.68659	-0.5350	9	0.87932	D	0	.	5.4679	0.16654	0.7543:0.0:0.2457:0.0	.	501	A1KZ92	PXDNL_HUMAN	E	501	ENSP00000348645:V501E;ENSP00000444865:V501E	ENSP00000348645:V501E	V	-	2	0	PXDNL	52522140	1.000000	0.71417	0.354000	0.25760	0.051000	0.14879	2.255000	0.43222	0.042000	0.15717	0.383000	0.25322	GTG	PXDNL	-	pfam_Ig_I-set,smart_Ig_sub,pfscan_Ig-like_dom	ENSG00000147485		0.458	PXDNL-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PXDNL	HGNC	protein_coding	OTTHUMT00000377905.1		0.00	54	0	A	NM_144651		52359587	-1			no_errors	ENST00000356297	ensembl	human	known	74_37	missense	5.00	38	2	SNP	0.907	T
REEP6	92840	genome.wustl.edu	37	19	1496413	1496413	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr19:1496413G>T	ENST00000233596.3	+	4	582	c.478G>T	c.(478-480)Ggg>Tgg	p.G160W		NM_138393.1	NP_612402.1	Q96HR9	REEP6_HUMAN	receptor accessory protein 6	160					regulation of intracellular transport (GO:0032386)	apical part of cell (GO:0045177)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)				lung(1)|ovary(1)	2		Acute lymphoblastic leukemia(61;5.61e-13)|all_hematologic(61;2.65e-08)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CGACCTCAGCGGGCGAGCCCT	0.662																																																	0													49.0	54.0	53.0					19																	1496413		2203	4299	6502	SO:0001583	missense	0			BC008201	CCDS12070.1	19p13.3	2012-12-20	2006-02-08	2006-02-07	ENSG00000115255	ENSG00000115255		"""Receptor accessory proteins"""	30078	protein-coding gene	gene with protein product	"""polyposis locus protein 1-like 1"", ""deleted in polyposis 1-like 1"""	609346	"""chromosome 19 open reading frame 32"""	C19orf32		16271481, 15550249	Standard	NM_138393		Approved	DP1L1, FLJ25383	uc002ltc.3	Q96HR9	OTTHUMG00000180072	ENST00000233596.3:c.478G>T	19.37:g.1496413G>T	ENSP00000233596:p.Gly160Trp		B2RE01|D6W5Z0|Q96LM0	Missense_Mutation	SNP	pfam_TB2_DP1_HVA22	p.G160W	ENST00000233596.3	37	c.478	CCDS12070.1	19	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.92|15.92	2.975864|2.975864	0.53720|0.53720	.|.	.|.	ENSG00000115255|ENSG00000115255	ENST00000233596;ENST00000395479|ENST00000395484	T|.	0.44482|.	0.92|.	4.97|4.97	1.62|1.62	0.23740|0.23740	.|.	.|.	.|.	.|.	.|.	T|T	0.31071|0.31071	0.0785|0.0785	L|L	0.36672|0.36672	1.1|1.1	0.09310|0.09310	N|N	1|1	D|.	0.76494|.	0.999|.	D|.	0.71184|.	0.972|.	T|T	0.24476|0.24476	-1.0159|-1.0159	9|6	0.72032|0.23302	D|T	0.01|0.38	-0.2221|-0.2221	5.4786|5.4786	0.16710|0.16710	0.263:0.1477:0.5893:0.0|0.263:0.1477:0.5893:0.0	.|.	160|.	Q96HR9|.	REEP6_HUMAN|.	W|L	160|227	ENSP00000233596:G160W|.	ENSP00000233596:G160W|ENSP00000378865:R227L	G|R	+|+	1|2	0|0	REEP6|REEP6	1447413|1447413	0.081000|0.081000	0.21417|0.21417	0.000000|0.000000	0.03702|0.03702	0.002000|0.002000	0.02628|0.02628	2.210000|2.210000	0.42816|0.42816	0.150000|0.150000	0.19136|0.19136	0.552000|0.552000	0.68991|0.68991	GGG|CGG	REEP6	-	NULL	ENSG00000115255		0.662	REEP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	REEP6	HGNC	protein_coding	OTTHUMT00000449623.1		0.00	84	0	G	NM_138393		1496413	+1			no_errors	ENST00000233596	ensembl	human	known	74_37	missense	5.19	72	4	SNP	0.001	T
RAB11B	9230	genome.wustl.edu	37	19	8455255	8455255	+	5'UTR	SNP	G	G	T	rs372737756		TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr19:8455255G>T	ENST00000328024.6	+	0	173				MIR4999_ENST00000585029.1_RNA|RAB11B_ENST00000601897.1_5'Flank|RAB11B-AS1_ENST00000597785.1_RNA|RAB11B_ENST00000594216.1_5'Flank|RAB11B-AS1_ENST00000593581.1_RNA	NM_004218.3	NP_004209.2	Q15907	RB11B_HUMAN	RAB11B, member RAS oncogene family						cellular response to acidic pH (GO:0071468)|constitutive secretory pathway (GO:0045054)|establishment of protein localization to membrane (GO:0090150)|GTP catabolic process (GO:0006184)|insulin secretion involved in cellular response to glucose stimulus (GO:0035773)|melanosome transport (GO:0032402)|receptor recycling (GO:0001881)|regulated secretory pathway (GO:0045055)|regulation of anion transport (GO:0044070)|regulation of endocytic recycling (GO:2001135)|regulation of protein localization to cell surface (GO:2000008)|retrograde transport, endosome to plasma membrane (GO:1990126)|small GTPase mediated signal transduction (GO:0007264)|transferrin transport (GO:0033572)	cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|phagocytic vesicle (GO:0045335)|recycling endosome (GO:0055037)|recycling endosome membrane (GO:0055038)|synaptic vesicle (GO:0008021)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|myosin V binding (GO:0031489)			large_intestine(2)|lung(1)|ovary(1)	4						TCGGGTGTTTGTGGTGGGGCT	0.687																																																	0													14.0	17.0	16.0					19																	8455255		2180	4265	6445	SO:0001623	5_prime_UTR_variant	0			X79780	CCDS12201.1	19p13.2	2012-07-02			ENSG00000185236	ENSG00000185236		"""RAB, member RAS oncogene"""	9761	protein-coding gene	gene with protein product		604198				7811277	Standard	NM_004218		Approved	H-YPT3	uc002mju.4	Q15907		ENST00000328024.6:c.-46G>T	19.37:g.8455255G>T			A5YM50|B2R7I4|B4DMK0|D6W671|Q2YDT2|Q5U0I1|Q6FHR0|Q6FI42|Q8NI07	RNA	SNP	-	NULL	ENST00000328024.6	37	NULL	CCDS12201.1	19																																																																																			RAB11B-AS1	-	-	ENSG00000269386		0.687	RAB11B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAB11B-AS1	HGNC	protein_coding	OTTHUMT00000460343.2	-	0.00	102	0	G	NM_004218		8455255	-1	tier1	-	no_errors	ENST00000593581	ensembl	human	known	74_37	rna	29.79	66	28	SNP	1.000	T
RFPL3	10738	genome.wustl.edu	37	22	32756307	32756307	+	Nonsense_Mutation	SNP	C	C	T	rs374358387		TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr22:32756307C>T	ENST00000249007.4	+	2	647	c.442C>T	c.(442-444)Cga>Tga	p.R148*	RFPL3S_ENST00000400234.1_3'UTR|RFPL3_ENST00000397468.1_Nonsense_Mutation_p.R119*|RFPL3S_ENST00000382084.4_3'UTR|RFPL3S_ENST00000461833.1_5'Flank|RFPL3_ENST00000382088.3_Nonsense_Mutation_p.R119*	NM_001098535.1	NP_001092005.1	O75679	RFPL3_HUMAN	ret finger protein-like 3	148	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.						zinc ion binding (GO:0008270)			cervix(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|skin(2)|stomach(1)	15						CAGGAGCGTCCGAAGTGGGCT	0.532																																																	0								C	stop/ARG,stop/ARG	1,4405	2.1+/-5.4	0,1,2202	137.0	123.0	128.0		442,355	-0.6	0.0	22		128	0,8600		0,0,4300	no	stop-gained,stop-gained	RFPL3	NM_001098535.1,NM_006604.2	,	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	,	148/318,119/289	32756307	1,13005	2203	4300	6503	SO:0001587	stop_gained	0			AJ010232	CCDS13904.1, CCDS43011.1	22q12	2006-04-25			ENSG00000128276	ENSG00000128276			9980	protein-coding gene	gene with protein product		605970				10508838	Standard	NM_006604		Approved		uc010gwn.3	O75679	OTTHUMG00000030290	ENST00000249007.4:c.442C>T	22.37:g.32756307C>T	ENSP00000249007:p.Arg148*		A2A279|Q6IC03|Q6IC04|Q6NSX3|Q8N5R4	Nonsense_Mutation	SNP	pfam_RDM_domain_RFPL,pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl_sf,smart_PRY,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Znf_RING,prints_Butyrophylin	p.R148*	ENST00000249007.4	37	c.442	CCDS43011.1	22	.	.	.	.	.	.	.	.	.	.	C	13.75	2.329764	0.41297	2.27E-4	0.0	ENSG00000128276	ENST00000397468;ENST00000249007;ENST00000382088	.	.	.	0.664	-0.629	0.11533	.	.	.	.	.	.	.	.	.	.	.	0.27586	N	0.94943	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	4.8667	0.13611	0.0:0.728:0.0:0.272	.	.	.	.	X	119;148;119	.	ENSP00000249007:R148X	R	+	1	2	RFPL3	31086307	0.000000	0.05858	0.010000	0.14722	0.035000	0.12851	-4.159000	0.00283	-0.224000	0.09928	0.194000	0.17425	CGA	RFPL3	-	superfamily_ConA-like_lec_gl_sf,smart_PRY,pfscan_B30.2/SPRY,prints_Butyrophylin	ENSG00000128276		0.532	RFPL3-001	KNOWN	basic|CCDS	protein_coding	RFPL3	HGNC	protein_coding	OTTHUMT00000075172.3	-	0.00	139	0	C	NM_006604		32756307	+1	tier1	-	no_errors	ENST00000249007	ensembl	human	known	74_37	nonsense	44.83	64	52	SNP	0.129	T
RGPD3	653489	genome.wustl.edu	37	2	107074073	107074073	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr2:107074073G>A	ENST00000409886.3	-	3	289	c.202C>T	c.(202-204)Ctt>Ttt	p.L68F	RGPD3_ENST00000304514.7_Missense_Mutation_p.L68F	NM_001144013.1	NP_001137485.1	A6NKT7	RGPD3_HUMAN	RANBP2-like and GRIP domain containing 3	68					protein targeting to Golgi (GO:0000042)					breast(2)|central_nervous_system(1)|endometrium(50)|kidney(4)|lung(11)|ovary(1)|urinary_tract(2)	71						TCATAAAGAAGACCCAGAAAT	0.343																																																	0													2.0	2.0	2.0					2																	107074073		502	1172	1674	SO:0001583	missense	0				CCDS46379.1	2q12.2	2013-01-10			ENSG00000153165	ENSG00000153165		"""Tetratricopeptide (TTC) repeat domain containing"""	32416	protein-coding gene	gene with protein product		612706				15710750, 15815621	Standard	NM_001144013		Approved	RGP3	uc010ywi.1	A6NKT7	OTTHUMG00000153182	ENST00000409886.3:c.202C>T	2.37:g.107074073G>A	ENSP00000386588:p.Leu68Phe		B8ZZM4	Missense_Mutation	SNP	pfam_Ran_bind_dom,pfam_GRIP,pfam_TPR_1,pfam_TPR_2,smart_TPR_repeat,smart_Ran_bind_dom,smart_GRIP,pfscan_GRIP,pfscan_TPR_repeat,pfscan_TPR-contain_dom,pfscan_Ran_bind_dom	p.L68F	ENST00000409886.3	37	c.202	CCDS46379.1	2	.	.	.	.	.	.	.	.	.	.	.	6.552	0.470208	0.12461	.	.	ENSG00000153165	ENST00000409886;ENST00000304514;ENST00000440524	T;T	0.66460	-0.21;-0.21	2.36	1.29	0.21616	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	.	.	.	.	T	0.57489	0.2057	L	0.34521	1.04	0.26609	N	0.972877	P	0.38922	0.651	P	0.44359	0.447	T	0.50004	-0.8878	9	0.38643	T	0.18	-20.7973	7.7928	0.29129	0.0:0.0:0.7535:0.2465	.	68	A6NKT7	RGPD3_HUMAN	F	68;68;11	ENSP00000386588:L68F;ENSP00000303659:L68F	ENSP00000303659:L68F	L	-	1	0	RGPD3	106440505	1.000000	0.71417	1.000000	0.80357	0.347000	0.29111	4.715000	0.61909	1.318000	0.45170	0.194000	0.17425	CTT	RGPD3	-	pfam_TPR_1,pfam_TPR_2,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	ENSG00000153165		0.343	RGPD3-002	KNOWN	not_best_in_genome_evidence|basic|appris_candidate|CCDS	protein_coding	RGPD3	HGNC	protein_coding	OTTHUMT00000329975.1	-	0.00	164	0	G	XM_929931		107074073	-1	tier1	-	no_errors	ENST00000304514	ensembl	human	known	74_37	missense	23.70	103	32	SNP	1.000	A
RNF213	57674	genome.wustl.edu	37	17	78298996	78298996	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr17:78298996G>A	ENST00000582970.1	+	18	3334	c.3191G>A	c.(3190-3192)tGt>tAt	p.C1064Y	RNF213_ENST00000456466.1_Missense_Mutation_p.C1064Y|RNF213_ENST00000508628.2_Missense_Mutation_p.C1113Y	NM_001256071.1	NP_001243000.1	Q63HN8	RN213_HUMAN	ring finger protein 213	1064					ATP catabolic process (GO:0006200)|protein autoubiquitination (GO:0051865)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ATPase activity (GO:0016887)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|central_nervous_system(1)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(23)|lung(36)|ovary(11)|pancreas(2)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	130	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0252)|OV - Ovarian serous cystadenocarcinoma(97;0.057)			TTCAGATTGTGTGGTATGTTT	0.493																																																	0													135.0	97.0	109.0					17																	78298996		692	1591	2283	SO:0001583	missense	0			AK074030	CCDS58606.1	17q25.3	2013-01-09	2007-02-08	2007-02-08		ENSG00000173821		"""RING-type (C3HC4) zinc fingers"""	14539	protein-coding gene	gene with protein product		613768	"""chromosome 17 open reading frame 27"", ""KIAA1618"", ""moyamoya disease 2"", ""Moyamoya disease 2"""	C17orf27, KIAA1618, MYMY2		10997877, 21048783, 21799892	Standard	NM_020954		Approved	KIAA1554, NET57	uc021uen.2	Q63HN8		ENST00000582970.1:c.3191G>A	17.37:g.78298996G>A	ENSP00000464087:p.Cys1064Tyr		C9JCP4|D6RI12|F8WKS1|Q658P6|Q69YK7|Q6MZR1|Q8IWF4|Q8IZX1|Q8IZX2|Q8N406|Q8TEU0|Q9H6C9|Q9H6H9|Q9H6P3|Q9H8A9|Q9HCF4|Q9HCL8	Missense_Mutation	SNP	superfamily_P-loop_NTPase,smart_AAA+_ATPase,smart_Znf_RING,pfscan_Znf_RING	p.C1064Y	ENST00000582970.1	37	c.3191	CCDS58606.1	17	.	.	.	.	.	.	.	.	.	.	G	7.813	0.716067	0.15306	.	.	ENSG00000173821	ENST00000508628;ENST00000411702;ENST00000456466	.	.	.	5.56	-4.21	0.03812	.	.	.	.	.	T	0.12475	0.0303	N	0.10916	0.065	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.31696	-0.9934	8	0.02654	T	1	5.9567	4.6929	0.12790	0.3814:0.0:0.3728:0.2458	.	1064	Q9HCF4	ALO17_HUMAN	Y	1064;1113;1064	.	ENSP00000396478:C1113Y	C	+	2	0	RNF213	75913591	0.002000	0.14202	0.000000	0.03702	0.007000	0.05969	0.315000	0.19451	-1.273000	0.02424	-0.895000	0.02911	TGT	RNF213	-	NULL	ENSG00000173821		0.493	RNF213-020	KNOWN	basic|appris_candidate|CCDS	protein_coding	RNF213	HGNC	protein_coding	OTTHUMT00000443298.1		0.00	48	0	G	NM_020914		78298996	+1			no_errors	ENST00000582970	ensembl	human	known	74_37	missense	5.13	37	2	SNP	0.000	A
ROS1	6098	genome.wustl.edu	37	6	117704507	117704507	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr6:117704507C>A	ENST00000368508.3	-	16	2667	c.2469G>T	c.(2467-2469)caG>caT	p.Q823H	GOPC_ENST00000467125.1_Intron|ROS1_ENST00000368507.3_Missense_Mutation_p.Q818H	NM_002944.2	NP_002935.2	P08922	ROS1_HUMAN	ROS proto-oncogene 1 , receptor tyrosine kinase	823					cell differentiation (GO:0030154)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|columnar/cuboidal epithelial cell development (GO:0002066)|negative regulation of gene expression (GO:0010629)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein phosphorylation (GO:0006468)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of phosphate transport (GO:0010966)|regulation of TOR signaling (GO:0032006)|spermatogenesis (GO:0007283)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)		TPM3_ENST00000368530/ROS1(4)|LRIG3/ROS1(2)|CD74_ENST00000009530/ROS1(32)|SLC34A2/ROS1(14)|EZR/ROS1(4)|GOPC/ROS1(14)|SDC4/ROS1(7)	NS(2)|breast(7)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(28)|lung(56)|ovary(8)|prostate(5)|skin(19)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	162		all_cancers(87;0.00846)|all_epithelial(87;0.0242)		GBM - Glioblastoma multiforme(226;0.0387)|OV - Ovarian serous cystadenocarcinoma(136;0.0954)|all cancers(137;0.137)		AAGGCTGTGTCTGTAGTACAA	0.388			T	"""GOPC, SDC4, SLC34A2, EZR, LRIG3"""	"""glioblastoma, NSCLC"""																																			Dom	yes		6	6q22	6098	v-ros UR2 sarcoma virus oncogene homolog 1 (avian)		"""O, E"""	0													184.0	176.0	179.0					6																	117704507		2203	4300	6503	SO:0001583	missense	0			M13599	CCDS5116.1	6q21-q22	2014-06-26	2014-06-26		ENSG00000047936	ENSG00000047936		"""Fibronectin type III domain containing"""	10261	protein-coding gene	gene with protein product		165020	"""v-ros avian UR2 sarcoma virus oncogene homolog 1"", ""v-ros UR2 sarcoma virus oncogene homolog 1 (avian)"", ""c-ros oncogene 1 , receptor tyrosine kinase"""			1611909	Standard	NM_002944		Approved	MCF3, ROS, c-ros-1	uc003pxp.1	P08922	OTTHUMG00000016188	ENST00000368508.3:c.2469G>T	6.37:g.117704507C>A	ENSP00000357494:p.Gln823His		Q15368|Q5TDB5	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Fibronectin_type3,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_LDLR_classB_rpt,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.Q823H	ENST00000368508.3	37	c.2469	CCDS5116.1	6	.	.	.	.	.	.	.	.	.	.	C	10.76	1.441804	0.25900	.	.	ENSG00000047936	ENST00000368508;ENST00000368507	D;D	0.91124	-2.79;-2.79	4.57	2.78	0.32641	.	0.000000	0.56097	D	0.000035	D	0.83903	0.5355	N	0.24115	0.695	0.80722	D	1	D	0.76494	0.999	D	0.73380	0.98	T	0.79899	-0.1608	10	0.15066	T	0.55	.	8.2743	0.31864	0.0:0.7338:0.0:0.2662	.	823	P08922	ROS1_HUMAN	H	823;818	ENSP00000357494:Q823H;ENSP00000357493:Q818H	ENSP00000357493:Q818H	Q	-	3	2	ROS1	117811200	0.855000	0.29742	0.996000	0.52242	0.993000	0.82548	0.443000	0.21644	0.631000	0.30412	0.655000	0.94253	CAG	ROS1	-	NULL	ENSG00000047936		0.388	ROS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ROS1	HGNC	protein_coding	OTTHUMT00000043464.1	-	0.00	55	0	C			117704507	-1	tier1	-	no_errors	ENST00000368508	ensembl	human	known	74_37	missense	50.00	21	21	SNP	0.979	A
ROS1	6098	genome.wustl.edu	37	6	117708161	117708161	+	Splice_Site	SNP	A	A	G	rs375802861		TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr6:117708161A>G	ENST00000368508.3	-	14	2214	c.2016T>C	c.(2014-2016)gcT>gcC	p.A672A	GOPC_ENST00000467125.1_Intron|ROS1_ENST00000368507.3_Splice_Site_p.A667A	NM_002944.2	NP_002935.2	P08922	ROS1_HUMAN	ROS proto-oncogene 1 , receptor tyrosine kinase	672					cell differentiation (GO:0030154)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|columnar/cuboidal epithelial cell development (GO:0002066)|negative regulation of gene expression (GO:0010629)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein phosphorylation (GO:0006468)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of phosphate transport (GO:0010966)|regulation of TOR signaling (GO:0032006)|spermatogenesis (GO:0007283)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)		TPM3_ENST00000368530/ROS1(4)|LRIG3/ROS1(2)|CD74_ENST00000009530/ROS1(32)|SLC34A2/ROS1(14)|EZR/ROS1(4)|GOPC/ROS1(14)|SDC4/ROS1(7)	NS(2)|breast(7)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(28)|lung(56)|ovary(8)|prostate(5)|skin(19)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	162		all_cancers(87;0.00846)|all_epithelial(87;0.0242)		GBM - Glioblastoma multiforme(226;0.0387)|OV - Ovarian serous cystadenocarcinoma(136;0.0954)|all cancers(137;0.137)		GTGGTTCACTAGCTGTTTAGT	0.333			T	"""GOPC, SDC4, SLC34A2, EZR, LRIG3"""	"""glioblastoma, NSCLC"""								A|||	1	0.000199681	0.0	0.0014	5008	,	,		17443	0.0		0.0	False		,,,				2504	0.0							Dom	yes		6	6q22	6098	v-ros UR2 sarcoma virus oncogene homolog 1 (avian)		"""O, E"""	0								A		0,4406		0,0,2203	76.0	73.0	74.0		2016	1.1	1.0	6		74	1,8599		0,1,4299	no	coding-synonymous-near-splice	ROS1	NM_002944.2		0,1,6502	GG,GA,AA		0.0116,0.0,0.0077		672/2348	117708161	1,13005	2203	4300	6503	SO:0001630	splice_region_variant	0			M13599	CCDS5116.1	6q21-q22	2014-06-26	2014-06-26		ENSG00000047936	ENSG00000047936		"""Fibronectin type III domain containing"""	10261	protein-coding gene	gene with protein product		165020	"""v-ros avian UR2 sarcoma virus oncogene homolog 1"", ""v-ros UR2 sarcoma virus oncogene homolog 1 (avian)"", ""c-ros oncogene 1 , receptor tyrosine kinase"""			1611909	Standard	NM_002944		Approved	MCF3, ROS, c-ros-1	uc003pxp.1	P08922	OTTHUMG00000016188	ENST00000368508.3:c.2015-1T>C	6.37:g.117708161A>G			Q15368|Q5TDB5	Silent	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Fibronectin_type3,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_LDLR_classB_rpt,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.A672	ENST00000368508.3	37	c.2016	CCDS5116.1	6																																																																																			ROS1	-	NULL	ENSG00000047936		0.333	ROS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ROS1	HGNC	protein_coding	OTTHUMT00000043464.1	-	0.00	84	0	A		Silent	117708161	-1	tier1	-	no_errors	ENST00000368508	ensembl	human	known	74_37	silent	5.75	82	5	SNP	0.422	G
RP1L1	94137	genome.wustl.edu	37	8	10466572	10466572	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr8:10466572G>T	ENST00000382483.3	-	4	5259	c.5036C>A	c.(5035-5037)aCc>aAc	p.T1679N		NM_178857.5	NP_849188.4	Q8IWN7	RP1L1_HUMAN	retinitis pigmentosa 1-like 1	1759					cell projection organization (GO:0030030)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|visual perception (GO:0007601)	axoneme (GO:0005930)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|photoreceptor connecting cilium (GO:0032391)|photoreceptor outer segment (GO:0001750)				breast(5)|central_nervous_system(2)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(16)|lung(82)|ovary(8)|prostate(5)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	148				COAD - Colon adenocarcinoma(149;0.0811)		GGGACCTCTGGTTGCCCCCAT	0.622																																																	0													66.0	72.0	70.0					8																	10466572		1999	4192	6191	SO:0001583	missense	0			AY168346	CCDS43708.1	8p23.1	2011-12-06			ENSG00000183638	ENSG00000183638			15946	protein-coding gene	gene with protein product		608581				12634863	Standard	NM_178857		Approved	DCDC4B	uc003wtc.3	Q8IWN7	OTTHUMG00000163806	ENST00000382483.3:c.5036C>A	8.37:g.10466572G>T	ENSP00000371923:p.Thr1679Asn		Q86SQ1|Q8IWN8|Q8IWN9|Q8IWP0|Q8IWP1|Q8IWP2	Missense_Mutation	SNP	pfam_Doublecortin_dom,smart_Doublecortin_dom,pfscan_Doublecortin_dom	p.T1679N	ENST00000382483.3	37	c.5036	CCDS43708.1	8	.	.	.	.	.	.	.	.	.	.	G	10.55	1.381214	0.24944	.	.	ENSG00000183638	ENST00000382483	T	0.04502	3.61	4.66	2.84	0.33178	.	1.667360	0.04203	U	0.330383	T	0.04543	0.0124	N	0.19112	0.55	0.09310	N	1	B	0.26744	0.158	B	0.20767	0.031	T	0.42732	-0.9434	10	0.36615	T	0.2	-0.6735	8.4623	0.32936	0.0906:0.175:0.7344:0.0	.	1679	A6NKC6	.	N	1679	ENSP00000371923:T1679N	ENSP00000371923:T1679N	T	-	2	0	RP1L1	10503982	0.067000	0.21026	0.000000	0.03702	0.067000	0.16453	2.459000	0.45023	0.568000	0.29311	0.462000	0.41574	ACC	RP1L1	-	NULL	ENSG00000183638		0.622	RP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RP1L1	HGNC	protein_coding	OTTHUMT00000375673.1	-	0.00	103	0	G			10466572	-1	tier1	-	no_errors	ENST00000382483	ensembl	human	known	74_37	missense	5.68	83	5	SNP	0.000	T
S1PR5	53637	genome.wustl.edu	37	19	10624599	10624599	+	Silent	SNP	C	C	T			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr19:10624599C>T	ENST00000439028.3	-	2	1214	c.1089G>A	c.(1087-1089)tcG>tcA	p.S363S	S1PR5_ENST00000333430.4_Silent_p.S363S	NM_001166215.1	NP_001159687.1	Q9H228	S1PR5_HUMAN	sphingosine-1-phosphate receptor 5	363					regulation of neuron differentiation (GO:0045664)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sphingosine-1-phosphate receptor activity (GO:0038036)			central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(5)|ovary(1)|pancreas(1)|prostate(1)	12					Fingolimod(DB08868)	ATGAGCGCTCCGAGCCGCTGA	0.736																																																	0													10.0	13.0	12.0					19																	10624599		2130	4178	6308	SO:0001819	synonymous_variant	0			AK074661	CCDS12240.1	19p13.2	2012-08-08	2008-04-30	2008-04-30		ENSG00000180739		"""GPCR / Class A : Lysophospholipid receptors : Sphingosine 1-phosphate"""	14299	protein-coding gene	gene with protein product		605146	"""endothelial differentiation, sphingolipid G-protein-coupled receptor, 8"""	EDG8		10799507	Standard	NM_030760		Approved	Edg-8	uc002mou.2	Q9H228		ENST00000439028.3:c.1089G>A	19.37:g.10624599C>T			Q6NW11	Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_EDG8_S1P_rcpt,prints_S1P_rcpt,prints_GPCR_Rhodpsn	p.S363	ENST00000439028.3	37	c.1089	CCDS12240.1	19																																																																																			S1PR5	-	prints_EDG8_S1P_rcpt	ENSG00000180739		0.736	S1PR5-004	KNOWN	basic|appris_principal|CCDS	protein_coding	S1PR5	HGNC	protein_coding	OTTHUMT00000452015.1	-	0.00	12	0	C	NM_030760		10624599	-1	tier1	-	no_errors	ENST00000333430	ensembl	human	known	74_37	silent	66.67	6	12	SNP	0.053	T
SALL3	27164	genome.wustl.edu	37	18	76753906	76753906	+	Missense_Mutation	SNP	G	G	A	rs557725030	byFrequency	TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr18:76753906G>A	ENST00000537592.2	+	2	1915	c.1915G>A	c.(1915-1917)Gtc>Atc	p.V639I	SALL3_ENST00000575389.2_Missense_Mutation_p.V639I|SALL3_ENST00000536229.3_Missense_Mutation_p.V506I	NM_171999.3	NP_741996.2	Q9BXA9	SALL3_HUMAN	spalt-like transcription factor 3	639					forelimb morphogenesis (GO:0035136)|hindlimb morphogenesis (GO:0035137)|negative regulation of smoothened signaling pathway (GO:0045879)|olfactory bulb interneuron development (GO:0021891)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(8)|lung(40)|ovary(4)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	74		Esophageal squamous(42;0.129)|Melanoma(33;0.16)|Prostate(75;0.167)		OV - Ovarian serous cystadenocarcinoma(15;4.69e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0256)		GCTGCCCGCCGTCTCCGAGCA	0.692													G|||	2	0.000399361	0.0	0.0	5008	,	,		11925	0.0		0.0	False		,,,				2504	0.002																0													12.0	13.0	12.0					18																	76753906		2181	4286	6467	SO:0001583	missense	0			AJ007421	CCDS12013.1	18q23	2013-10-17	2013-10-17		ENSG00000256463	ENSG00000256463		"""Zinc fingers, C2H2-type"""	10527	protein-coding gene	gene with protein product		605079	"""sal (Drosophila)-like 3"", ""sal-like 3 (Drosophila)"""			10610715	Standard	NM_171999		Approved	ZNF796	uc002lmt.3	Q9BXA9	OTTHUMG00000132896	ENST00000537592.2:c.1915G>A	18.37:g.76753906G>A	ENSP00000441823:p.Val639Ile		Q9UGH1	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.V639I	ENST00000537592.2	37	c.1915	CCDS12013.1	18	.	.	.	.	.	.	.	.	.	.	G	1.980	-0.434485	0.04669	.	.	ENSG00000256463	ENST00000537592;ENST00000536229;ENST00000543056	T	0.08634	3.07	5.33	-2.28	0.06826	.	0.948766	0.08681	N	0.909443	T	0.02767	0.0083	N	0.04043	-0.29	0.09310	N	1	B;B	0.10296	0.001;0.003	B;B	0.06405	0.002;0.001	T	0.46400	-0.9194	10	0.20046	T	0.44	-21.9646	1.475	0.02424	0.3742:0.1009:0.3191:0.2058	.	371;639	F5GXY4;Q9BXA9	.;SALL3_HUMAN	I	639;639;371	ENSP00000441823:V639I	ENSP00000299466:V639I	V	+	1	0	SALL3	74854894	0.000000	0.05858	0.000000	0.03702	0.074000	0.17049	-0.064000	0.11636	-0.136000	0.11475	-0.182000	0.12963	GTC	SALL3	-	NULL	ENSG00000256463		0.692	SALL3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	SALL3	HGNC	protein_coding	OTTHUMT00000256397.1	-	0.00	13	0	G	NM_171999		76753906	+1	tier1	-	no_errors	ENST00000537592	ensembl	human	known	74_37	missense	36.36	14	8	SNP	0.000	A
SCAF1	58506	genome.wustl.edu	37	19	50156668	50156668	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr19:50156668C>T	ENST00000360565.3	+	7	3146	c.3022C>T	c.(3022-3024)Ccc>Tcc	p.P1008S		NM_021228.2	NP_067051.2	Q9H7N4	SFR19_HUMAN	SR-related CTD-associated factor 1	1008					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	RNA binding (GO:0003723)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(2)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	20		all_lung(116;1.05e-05)|Lung NSC(112;3.77e-05)|all_neural(266;0.196)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.00113)|GBM - Glioblastoma multiforme(134;0.0204)		CTCCTTCCTGCCCGAGGAGGC	0.667																																																	0													6.0	7.0	7.0					19																	50156668		2082	4165	6247	SO:0001583	missense	0			AK024444	CCDS33074.1	19q13.3-q13.4	2011-01-10			ENSG00000126461	ENSG00000126461			30403	protein-coding gene	gene with protein product						11461075	Standard	NM_021228		Approved	SR-A1, FLJ00034	uc002poq.3	Q9H7N4		ENST00000360565.3:c.3022C>T	19.37:g.50156668C>T	ENSP00000353769:p.Pro1008Ser		Q7Z5V7|Q8WVA1|Q9NR59	Missense_Mutation	SNP	NULL	p.P1008S	ENST00000360565.3	37	c.3022	CCDS33074.1	19	.	.	.	.	.	.	.	.	.	.	C	14.11	2.437645	0.43224	.	.	ENSG00000126461	ENST00000360565	T	0.35789	1.29	5.07	5.07	0.68467	.	0.000000	0.43919	D	0.000505	T	0.43055	0.1230	L	0.27053	0.805	0.36664	D	0.878091	D	0.60575	0.988	P	0.59115	0.852	T	0.40194	-0.9576	9	.	.	.	-14.9424	17.3633	0.87357	0.0:1.0:0.0:0.0	.	1008	Q9H7N4	SFR19_HUMAN	S	1008	ENSP00000353769:P1008S	.	P	+	1	0	SCAF1	54848480	0.773000	0.28580	0.994000	0.49952	0.977000	0.68977	1.179000	0.31993	2.632000	0.89209	0.655000	0.94253	CCC	SCAF1	-	NULL	ENSG00000126461		0.667	SCAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCAF1	HGNC	protein_coding	OTTHUMT00000465764.1	-	0.00	68	0	C	NM_021228		50156668	+1	tier1	-	no_errors	ENST00000360565	ensembl	human	known	74_37	missense	6.15	61	4	SNP	0.959	T
SEMG1	6406	genome.wustl.edu	37	20	43836817	43836817	+	Silent	SNP	A	A	G	rs17850164		TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr20:43836817A>G	ENST00000372781.3	+	2	936	c.879A>G	c.(877-879)acA>acG	p.T293T	SEMG1_ENST00000244069.6_Intron	NM_003007.3	NP_002998.1	P04279	SEMG1_HUMAN	semenogelin I	293	2 X 60 AA tandem repeats, type 1.|Repeat-rich region. {ECO:0000250}.				insemination (GO:0007320)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|secretory granule (GO:0030141)	structural molecule activity (GO:0005198)	p.T293T(2)		cervix(1)|endometrium(2)|kidney(3)|large_intestine(3)|liver(1)|lung(12)|prostate(1)|skin(6)|stomach(2)|urinary_tract(1)	32		Myeloproliferative disorder(115;0.0122)				CTTCAAGTACAGAAGAAAGAC	0.383																																																	2	Substitution - coding silent(2)	lung(1)|kidney(1)											67.0	64.0	65.0					20																	43836817		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS13345.1	20q12-q13.2	2009-08-06			ENSG00000124233	ENSG00000124233			10742	protein-coding gene	gene with protein product	"""semen coagulating protein"", ""cancer/testis antigen 103"""	182140		SEMG		2912989, 15563730	Standard	NM_003007		Approved	CT103		P04279	OTTHUMG00000032565	ENST00000372781.3:c.879A>G	20.37:g.43836817A>G			Q53ZV0|Q53ZV1|Q53ZV2|Q6X4I9|Q6Y809|Q6Y822|Q6Y823|Q86U64|Q96QM3	Silent	SNP	pfam_Semenogelin	p.T293	ENST00000372781.3	37	c.879	CCDS13345.1	20																																																																																			SEMG1	-	pfam_Semenogelin	ENSG00000124233		0.383	SEMG1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SEMG1	HGNC	protein_coding	OTTHUMT00000079416.3		0.00	68	0	A	NM_003007		43836817	+1			no_errors	ENST00000372781	ensembl	human	known	74_37	silent	5.08	56	3	SNP	0.000	G
SEPT8	23176	genome.wustl.edu	37	5	132096579	132096579	+	Missense_Mutation	SNP	G	G	A	rs374687255		TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr5:132096579G>A	ENST00000378719.2	-	9	1438	c.1201C>T	c.(1201-1203)Cgg>Tgg	p.R401W	SEPT8_ENST00000378699.2_Missense_Mutation_p.R341W|SEPT8_ENST00000481030.1_5'Flank|SEPT8_ENST00000378706.1_Missense_Mutation_p.R401W|SEPT8_ENST00000378721.4_Missense_Mutation_p.R399W|SEPT8_ENST00000296873.7_Missense_Mutation_p.R401W|SEPT8_ENST00000378701.1_Missense_Mutation_p.R399W|SEPT8_ENST00000458488.2_Missense_Mutation_p.R401W|SEPT8_ENST00000448933.1_Missense_Mutation_p.R341W	NM_001098811.1	NP_001092281.1	Q92599	SEPT8_HUMAN	septin 8	401					cell cycle (GO:0007049)	septin complex (GO:0031105)	GTP binding (GO:0005525)		SEPT8/AFF4(2)	kidney(2)|lung(5)|ovary(2)|skin(1)|urinary_tract(1)	11		all_cancers(142;0.0751)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			GCAGCCTTCCGGCGATTGAAG	0.622																																																	0								G	TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG	0,4150		0,0,2075	91.0	99.0	97.0		1201,1201,1021,1201	1.6	1.0	5		97	1,8385		0,1,4192	no	missense,missense,missense,missense	SEPT8	NM_001098811.1,NM_001098812.1,NM_001098813.1,NM_015146.1	101,101,101,101	0,1,6267	AA,AG,GG		0.0119,0.0,0.0080	probably-damaging,probably-damaging,probably-damaging,probably-damaging	401/484,401/443,341/370,401/430	132096579	1,12535	2075	4193	6268	SO:0001583	missense	0			AF179995	CCDS43358.1, CCDS43359.1, CCDS43360.1, CCDS47262.1, CCDS75298.1	5q31	2013-01-21			ENSG00000164402	ENSG00000164402		"""Septins"""	16511	protein-coding gene	gene with protein product		608418				9039502, 9149945	Standard	NM_001098812		Approved	KIAA0202, SEP2	uc003kxr.2	Q92599	OTTHUMG00000059735	ENST00000378719.2:c.1201C>T	5.37:g.132096579G>A	ENSP00000367991:p.Arg401Trp		A6NC65|A6NKP6|F6W7K9|Q8IX36|Q8IX37|Q9BVB3	Missense_Mutation	SNP	pfam_Cell_div_GTP-bd,superfamily_P-loop_NTPase,pirsf_Septin	p.R401W	ENST00000378719.2	37	c.1201	CCDS43358.1	5	.	.	.	.	.	.	.	.	.	.	G	22.9	4.349064	0.82132	0.0	1.19E-4	ENSG00000164402	ENST00000378719;ENST00000378721;ENST00000296873;ENST00000448933;ENST00000378706;ENST00000378699;ENST00000378701;ENST00000458488	D;D;D;D;D;D;D;D	0.82803	-1.65;-1.65;-1.65;-1.65;-1.65;-1.65;-1.65;-1.65	5.55	1.62	0.23740	.	0.099302	0.64402	D	0.000004	D	0.89308	0.6678	M	0.76170	2.325	0.47862	D	0.999538	D;D;D;D	0.89917	0.999;1.0;0.998;1.0	D;D;P;D	0.66847	0.924;0.924;0.888;0.947	D	0.90003	0.4116	10	0.87932	D	0	.	14.8247	0.70101	0.0:0.0:0.6909:0.3091	.	399;399;401;401	B7ZVZ1;A6NFQ9;F6W7K9;Q92599	.;.;.;SEPT8_HUMAN	W	401;399;401;341;401;341;399;401	ENSP00000367991:R401W;ENSP00000367993:R399W;ENSP00000296873:R401W;ENSP00000399840:R341W;ENSP00000367978:R401W;ENSP00000367971:R341W;ENSP00000367973:R399W;ENSP00000394766:R401W	ENSP00000296873:R401W	R	-	1	2	SEPT8	132124478	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	1.939000	0.40213	0.384000	0.24942	-0.262000	0.10625	CGG	SEPT8	-	pirsf_Septin	ENSG00000164402		0.622	SEPT8-002	KNOWN	basic|CCDS	protein_coding	SEPT8	HGNC	protein_coding	OTTHUMT00000132827.2	-	0.00	53	0	G	XM_034872		132096579	-1	tier1	-	no_errors	ENST00000378719	ensembl	human	known	74_37	missense	35.85	34	19	SNP	1.000	A
SESN2	83667	genome.wustl.edu	37	1	28598185	28598185	+	Splice_Site	SNP	G	G	T			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr1:28598185G>T	ENST00000253063.3	+	3	478	c.157G>T	c.(157-159)Gtc>Ttc	p.V53F		NM_031459.4	NP_113647.1	P58004	SESN2_HUMAN	sestrin 2	53					autophagy (GO:0006914)|fatty acid beta-oxidation (GO:0006635)|glucose import (GO:0046323)|mitochondrial DNA metabolic process (GO:0032042)|protein kinase B signaling (GO:0043491)|regulation of cAMP-dependent protein kinase activity (GO:2000479)|regulation of gluconeogenesis involved in cellular glucose homeostasis (GO:0090526)|regulation of response to reactive oxygen species (GO:1901031)|response to glucose (GO:0009749)|response to insulin (GO:0032868)|triglyceride homeostasis (GO:0070328)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				cervix(1)|endometrium(3)|large_intestine(5)|lung(7)|ovary(2)|pancreas(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	27		Colorectal(325;3.46e-05)|Lung NSC(340;4.37e-05)|all_lung(284;4.76e-05)|Renal(390;0.00121)|Breast(348;0.00345)|all_neural(195;0.0208)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0261)		OV - Ovarian serous cystadenocarcinoma(117;2.98e-22)|Colorectal(126;3.04e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00279)|STAD - Stomach adenocarcinoma(196;0.00303)|BRCA - Breast invasive adenocarcinoma(304;0.00595)|READ - Rectum adenocarcinoma(331;0.0649)		TGGTTGGCAGGTCCTTCGGGA	0.567																																																	0													49.0	52.0	51.0					1																	28598185		2203	4300	6503	SO:0001630	splice_region_variant	0			AY123223	CCDS321.1	1p35.2	2008-02-05			ENSG00000130766	ENSG00000130766			20746	protein-coding gene	gene with protein product		607767				12607115, 12203114	Standard	NM_031459		Approved	SES2, DKFZp761M0212, HI95, SEST2	uc001bps.3	P58004	OTTHUMG00000003532	ENST00000253063.3:c.157-1G>T	1.37:g.28598185G>T			Q5T7D0|Q96SI5	Missense_Mutation	SNP	pfam_PA26	p.V53F	ENST00000253063.3	37	c.157	CCDS321.1	1	.	.	.	.	.	.	.	.	.	.	G	14.17	2.454861	0.43634	.	.	ENSG00000130766	ENST00000253063	T	0.23348	1.91	5.08	0.82	0.18793	.	0.640916	0.16019	N	0.233423	T	0.17152	0.0412	L	0.36672	1.1	0.35225	D	0.776347	B	0.26708	0.157	B	0.24974	0.057	T	0.19289	-1.0310	9	.	.	.	-16.7711	8.3519	0.32307	0.5513:0.0:0.4487:0.0	.	53	P58004	SESN2_HUMAN	F	53	ENSP00000253063:V53F	.	V	+	1	0	SESN2	28470772	1.000000	0.71417	0.990000	0.47175	0.850000	0.48378	1.565000	0.36386	0.213000	0.20722	0.655000	0.94253	GTC	SESN2	-	pfam_PA26	ENSG00000130766		0.567	SESN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SESN2	HGNC	protein_coding	OTTHUMT00000009840.1	-	0.00	65	0	G		Missense_Mutation	28598185	+1	tier1	-	no_errors	ENST00000253063	ensembl	human	known	74_37	missense	8.00	46	4	SNP	1.000	T
SETD2	29072	genome.wustl.edu	37	3	47162096	47162096	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr3:47162096G>T	ENST00000409792.3	-	3	4072	c.4030C>A	c.(4030-4032)Cag>Aag	p.Q1344K		NM_014159.6	NP_054878.5	Q9BYW2	SETD2_HUMAN	SET domain containing 2	1344					angiogenesis (GO:0001525)|cell migration involved in vasculogenesis (GO:0035441)|coronary vasculature morphogenesis (GO:0060977)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic placenta morphogenesis (GO:0060669)|forebrain development (GO:0030900)|histone H3-K36 trimethylation (GO:0097198)|mesoderm morphogenesis (GO:0048332)|mismatch repair (GO:0006298)|morphogenesis of a branching structure (GO:0001763)|neural tube closure (GO:0001843)|nucleosome organization (GO:0034728)|pericardium development (GO:0060039)|regulation of mRNA export from nucleus (GO:0010793)|regulation of transcription, DNA-templated (GO:0006355)|stem cell development (GO:0048864)|transcription elongation from RNA polymerase II promoter (GO:0006368)	chromosome (GO:0005694)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)			breast(6)|central_nervous_system(5)|endometrium(4)|kidney(63)|large_intestine(18)|lung(26)|ovary(6)|prostate(2)|skin(3)|soft_tissue(1)|stomach(2)|urinary_tract(5)	141		Acute lymphoblastic leukemia(5;0.0169)		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)		GATCCATCCTGTTGATCCCAA	0.448			"""N, F, S, Mis"""		clear cell renal carcinoma																																			Rec	yes		3	3p21.31	29072	SET domain containing 2		E	0													88.0	89.0	89.0					3																	47162096		2203	4300	6503	SO:0001583	missense	0			AJ238403	CCDS2749.2	3p21.31	2014-09-17			ENSG00000181555	ENSG00000181555		"""Chromatin-modifying enzymes / K-methyltransferases"""	18420	protein-coding gene	gene with protein product		612778				16118227, 11461154	Standard	NM_014159		Approved	HYPB, HIF-1, KIAA1732, FLJ23184, KMT3A	uc003cqs.3	Q9BYW2	OTTHUMG00000133514	ENST00000409792.3:c.4030C>A	3.37:g.47162096G>T	ENSP00000386759:p.Gln1344Lys		O75397|O75405|Q17RW8|Q5BKS9|Q5QGN2|Q69YI5|Q6IN64|Q6ZN53|Q6ZS25|Q8N3R0|Q8TCN0|Q9C0D1|Q9H696|Q9NZW9	Missense_Mutation	SNP	pfam_SRI,pfam_SET_dom,pfam_WW_dom,superfamily_WW_dom,superfamily_Ferritin-like_SF,smart_AWS,smart_SET_dom,smart_Post-SET_dom,smart_WW_dom,pfscan_AWS,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_WW_dom	p.Q1344K	ENST00000409792.3	37	c.4030	CCDS2749.2	3	.	.	.	.	.	.	.	.	.	.	G	5.827	0.336825	0.11013	.	.	ENSG00000181555	ENST00000451092;ENST00000543224;ENST00000409792;ENST00000412450	D;T	0.87491	-2.26;1.61	5.32	5.32	0.75619	.	0.890356	0.09625	N	0.777066	T	0.75781	0.3896	N	0.08118	0	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.04013	0.001;0.001	T	0.57820	-0.7745	9	.	.	.	.	13.2802	0.60210	0.0:0.2835:0.7165:0.0	.	1344;1344	F2Z317;Q9BYW2	.;SETD2_HUMAN	K	1344;1344;1344;1300	ENSP00000386759:Q1344K;ENSP00000416401:Q1300K	.	Q	-	1	0	SETD2	47137100	0.000000	0.05858	0.191000	0.23289	0.533000	0.34776	0.842000	0.27627	2.770000	0.95276	0.563000	0.77884	CAG	SETD2	-	NULL	ENSG00000181555		0.448	SETD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SETD2	HGNC	protein_coding	OTTHUMT00000257479.2	-	0.00	50	0	G	NM_014159		47162096	-1	tier1	-	no_errors	ENST00000409792	ensembl	human	known	74_37	missense	8.00	46	4	SNP	0.070	T
SH3RF2	153769	genome.wustl.edu	37	5	145442018	145442018	+	Silent	SNP	C	C	T			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr5:145442018C>T	ENST00000511217.1	+	9	1996	c.1944C>T	c.(1942-1944)taC>taT	p.Y648Y	SH3RF2_ENST00000359120.4_Silent_p.Y648Y|SH3RF2_ENST00000511705.1_3'UTR			Q8TEC5	SH3R2_HUMAN	SH3 domain containing ring finger 2	648					negative regulation of phosphatase activity (GO:0010923)|protein ubiquitination (GO:0016567)		ligase activity (GO:0016874)|phosphatase binding (GO:0019902)|protein phosphatase 1 binding (GO:0008157)|protein phosphatase inhibitor activity (GO:0004864)|zinc ion binding (GO:0008270)	p.Y648Y(1)		breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|lung(9)|ovary(1)|prostate(1)|skin(2)|stomach(1)	22			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TTCAGAATTACAGCCCTCCTC	0.547																																																	1	Substitution - coding silent(1)	breast(1)											147.0	138.0	141.0					5																	145442018		2203	4300	6503	SO:0001819	synonymous_variant	0			AL833297	CCDS4280.1	5q32	2013-01-09	2011-11-04	2011-11-04	ENSG00000156463	ENSG00000156463		"""RING-type (C3HC4) zinc fingers"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	26299	protein-coding gene	gene with protein product	"""heart protein phosphatase 1-binding protein"", ""POSH-eliminating RING protein"""	613377	"""protein phosphatase 1, regulatory subunit 39"""	PPP1R39		22128169	Standard	NM_152550		Approved	FLJ23654, RNF158, Hepp1, POSHER	uc003lnt.3	Q8TEC5	OTTHUMG00000129685	ENST00000511217.1:c.1944C>T	5.37:g.145442018C>T			A8K961|Q08AM9|Q6GMR9|Q8N5S8|Q96LP8	Silent	SNP	pfam_SH3_2,pfam_SH3_domain,pfam_Znf_C3HC4_RING-type,superfamily_SH3_domain,smart_Znf_RING,smart_SH3_domain,pfscan_SH3_domain,pfscan_Znf_RING,prints_SH3_domain	p.Y648	ENST00000511217.1	37	c.1944	CCDS4280.1	5																																																																																			SH3RF2	-	NULL	ENSG00000156463		0.547	SH3RF2-002	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	SH3RF2	HGNC	protein_coding	OTTHUMT00000372804.1		0.00	52	0	C	NM_152550		145442018	+1			no_errors	ENST00000359120	ensembl	human	known	74_37	silent	5.88	48	3	SNP	1.000	T
SHCBP1	79801	genome.wustl.edu	37	16	46617507	46617507	+	Silent	SNP	A	A	G			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr16:46617507A>G	ENST00000303383.3	-	12	1880	c.1614T>C	c.(1612-1614)aaT>aaC	p.N538N		NM_024745.4	NP_079021	Q8NEM2	SHCBP_HUMAN	SHC SH2-domain binding protein 1	538					fibroblast growth factor receptor signaling pathway (GO:0008543)|regulation of neural precursor cell proliferation (GO:2000177)					breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(7)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	28		all_cancers(37;0.00404)|all_epithelial(9;0.00527)|all_lung(18;0.0413)|Lung NSC(13;0.213)				AACCTTCATTATTATGTATTA	0.318																																																	0													66.0	68.0	67.0					16																	46617507		2202	4294	6496	SO:0001819	synonymous_variant	0			AK055931	CCDS10720.1	16q11	2008-02-05			ENSG00000171241	ENSG00000171241			29547	protein-coding gene	gene with protein product		611027				10086341	Standard	NM_024745		Approved	FLJ22009	uc002eec.4	Q8NEM2	OTTHUMG00000132540	ENST00000303383.3:c.1614T>C	16.37:g.46617507A>G			Q96N60|Q9BVS0|Q9H6P6	Silent	SNP	superfamily_Pectin_lyase_fold/virulence,smart_PbH1	p.N538	ENST00000303383.3	37	c.1614	CCDS10720.1	16																																																																																			SHCBP1	-	superfamily_Pectin_lyase_fold/virulence,smart_PbH1	ENSG00000171241		0.318	SHCBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SHCBP1	HGNC	protein_coding	OTTHUMT00000255740.1	-	0.00	112	0	A	NM_024745		46617507	-1	tier1	-	no_errors	ENST00000303383	ensembl	human	known	74_37	silent	8.57	96	9	SNP	1.000	G
SKI	6497	genome.wustl.edu	37	1	2160969	2160969	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr1:2160969C>G	ENST00000378536.4	+	1	836	c.764C>G	c.(763-765)cCg>cGg	p.P255R		NM_003036.3	NP_003027.1	P12755	SKI_HUMAN	SKI proto-oncogene	255					anterior/posterior axis specification (GO:0009948)|BMP signaling pathway (GO:0030509)|bone morphogenesis (GO:0060349)|camera-type eye development (GO:0043010)|camera-type eye morphogenesis (GO:0048593)|cell motility (GO:0048870)|cell proliferation (GO:0008283)|embryonic limb morphogenesis (GO:0030326)|face morphogenesis (GO:0060325)|gene expression (GO:0010467)|lens morphogenesis in camera-type eye (GO:0002089)|myelination in peripheral nervous system (GO:0022011)|myotube differentiation (GO:0014902)|negative regulation of activin receptor signaling pathway (GO:0032926)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of cell proliferation (GO:0008285)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of Schwann cell proliferation (GO:0010626)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neural tube closure (GO:0001843)|nose morphogenesis (GO:0043585)|olfactory bulb development (GO:0021772)|palate development (GO:0060021)|positive regulation of DNA binding (GO:0043388)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of Wnt signaling pathway (GO:0030177)|protein homotrimerization (GO:0070207)|regulation of apoptotic process (GO:0042981)|retina development in camera-type eye (GO:0060041)|skeletal muscle fiber development (GO:0048741)|SMAD protein signal transduction (GO:0060395)|somatic stem cell maintenance (GO:0035019)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|histone deacetylase inhibitor activity (GO:0046811)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)|repressing transcription factor binding (GO:0070491)|SMAD binding (GO:0046332)|transcription corepressor activity (GO:0003714)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)			central_nervous_system(1)|kidney(2)|lung(5)|prostate(1)|stomach(1)	10	all_cancers(77;0.000139)|all_epithelial(69;4.45e-05)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)			Epithelial(90;2.14e-37)|OV - Ovarian serous cystadenocarcinoma(86;2.72e-29)|GBM - Glioblastoma multiforme(42;2.45e-08)|Colorectal(212;5.33e-05)|COAD - Colon adenocarcinoma(227;0.000228)|Kidney(185;0.00268)|BRCA - Breast invasive adenocarcinoma(365;0.00471)|STAD - Stomach adenocarcinoma(132;0.0147)|KIRC - Kidney renal clear cell carcinoma(229;0.0385)|Lung(427;0.207)		CTCATGTACCCGCCGCACAAG	0.662																																					Ovarian(177;144 1678 13697 20086 27838 40755)												0													27.0	30.0	29.0					1																	2160969		2186	4289	6475	SO:0001583	missense	0			X15218	CCDS39.1	1p36.33	2014-06-25	2014-06-25		ENSG00000157933	ENSG00000157933		"""SKI transcriptional corepressors"""	10896	protein-coding gene	gene with protein product		164780	"""v-ski avian sarcoma viral oncogene homolog"""			2762147	Standard	NM_003036		Approved		uc001aja.4	P12755	OTTHUMG00000001407	ENST00000378536.4:c.764C>G	1.37:g.2160969C>G	ENSP00000367797:p.Pro255Arg		Q5SYT7	Missense_Mutation	SNP	pfam_c-SKI_SMAD4-bd_dom,pfam_Transform_Ski,superfamily_SAND_dom-like,superfamily_DNA-bd_dom_put	p.P255R	ENST00000378536.4	37	c.764	CCDS39.1	1	.	.	.	.	.	.	.	.	.	.	C	24.7	4.563549	0.86335	.	.	ENSG00000157933	ENST00000378536	D	0.96073	-3.9	4.39	4.39	0.52855	SAND domain-like (2);c-SKI Smad4-binding (1);	0.000000	0.85682	D	0.000000	D	0.97235	0.9096	M	0.70595	2.14	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.97758	1.0219	10	0.59425	D	0.04	-21.0597	15.9423	0.79768	0.0:1.0:0.0:0.0	.	255	P12755	SKI_HUMAN	R	255	ENSP00000367797:P255R	ENSP00000367797:P255R	P	+	2	0	SKI	2150829	1.000000	0.71417	0.998000	0.56505	0.985000	0.73830	7.511000	0.81718	1.992000	0.58205	0.393000	0.25936	CCG	SKI	-	pfam_c-SKI_SMAD4-bd_dom,superfamily_SAND_dom-like	ENSG00000157933		0.662	SKI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SKI	HGNC	protein_coding	OTTHUMT00000004070.1		0.00	148	0	C	NM_003036		2160969	+1			no_errors	ENST00000378536	ensembl	human	known	74_37	missense	5.00	76	4	SNP	1.000	G
SLC24A5	283652	genome.wustl.edu	37	15	48426713	48426713	+	Missense_Mutation	SNP	C	C	T	rs538198029		TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr15:48426713C>T	ENST00000341459.3	+	4	540	c.467C>T	c.(466-468)gCc>gTc	p.A156V	SLC24A5_ENST00000449382.2_Missense_Mutation_p.A96V	NM_205850.2	NP_995322.1	Q71RS6	NCKX5_HUMAN	solute carrier family 24 (sodium/potassium/calcium exchanger), member 5	156					ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|negative regulation of melanin biosynthetic process (GO:0048022)|response to stimulus (GO:0050896)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	calcium, potassium:sodium antiporter activity (GO:0008273)|symporter activity (GO:0015293)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(17)|skin(1)|upper_aerodigestive_tract(1)	27		all_lung(180;0.00217)		all cancers(107;3.29e-10)|GBM - Glioblastoma multiforme(94;7.32e-07)		ATCTGTGCTGCCTGTGGTTTG	0.378																																																	0													182.0	156.0	165.0					15																	48426713		2198	4296	6494	SO:0001583	missense	0			AF348468	CCDS10128.1	15q21.1	2014-01-28	2013-07-18		ENSG00000188467	ENSG00000188467		"""Solute carriers"""	20611	protein-coding gene	gene with protein product	"""oculocutaneous albinism 6 (autosomal recessive)"""	609802	"""solute carrier family 24, member 5"""			23364476	Standard	XM_005254308		Approved	JSX, OCA6	uc001zwe.3	Q71RS6	OTTHUMG00000131494	ENST00000341459.3:c.467C>T	15.37:g.48426713C>T	ENSP00000341550:p.Ala156Val		A5X8Z8|A5X8Z9|Q14CT4|Q6DKH3	Missense_Mutation	SNP	pfam_NaCa_Exmemb,tigrfam_K/Na/Ca-exchanger	p.A156V	ENST00000341459.3	37	c.467	CCDS10128.1	15	.	.	.	.	.	.	.	.	.	.	C	13.08	2.129681	0.37630	.	.	ENSG00000188467	ENST00000341459;ENST00000449382	T;T	0.60548	0.18;0.18	4.92	4.92	0.64577	Sodium/calcium exchanger membrane region (1);	0.000000	0.85682	D	0.000000	T	0.55386	0.1917	N	0.11427	0.14	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	T	0.47114	-0.9142	10	0.02654	T	1	.	18.668	0.91499	0.0:1.0:0.0:0.0	.	96;156	A5X8Z9;Q71RS6	.;NCKX5_HUMAN	V	156;96	ENSP00000341550:A156V;ENSP00000389966:A96V	ENSP00000341550:A156V	A	+	2	0	SLC24A5	46214005	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	4.424000	0.59868	2.702000	0.92279	0.655000	0.94253	GCC	SLC24A5	-	pfam_NaCa_Exmemb,tigrfam_K/Na/Ca-exchanger	ENSG00000188467		0.378	SLC24A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC24A5	HGNC	protein_coding	OTTHUMT00000254340.2	-	0.00	49	0	C	NM_205850		48426713	+1	tier1	-	no_errors	ENST00000341459	ensembl	human	known	74_37	missense	54.35	21	25	SNP	1.000	T
SLC52A2	79581	genome.wustl.edu	37	8	145583536	145583536	+	Silent	SNP	G	G	T	rs140003920	byFrequency	TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr8:145583536G>T	ENST00000532887.1	+	3	967	c.384G>T	c.(382-384)tcG>tcT	p.S128S	SLC52A2_ENST00000329994.2_Silent_p.S128S|SLC52A2_ENST00000526891.1_3'UTR|SLC52A2_ENST00000526752.1_Intron|FBXL6_ENST00000455319.2_5'Flank|SLC52A2_ENST00000527078.1_Silent_p.S128S|FBXL6_ENST00000331890.5_5'Flank|SLC52A2_ENST00000530047.1_Silent_p.S128S|SLC52A2_ENST00000402965.1_Silent_p.S128S|FBXL6_ENST00000526524.1_5'Flank|SLC52A2_ENST00000540505.1_Silent_p.S40S			Q9HAB3	S52A2_HUMAN	solute carrier family 52 (riboflavin transporter), member 2	128					riboflavin transport (GO:0032218)	integral component of plasma membrane (GO:0005887)	riboflavin transporter activity (GO:0032217)|virus receptor activity (GO:0001618)									Gamma Hydroxybutyric Acid(DB01440)	GCTGTGCCTCGAATGTCACTT	0.597																																																	0													170.0	162.0	164.0					8																	145583536		2203	4300	6503	SO:0001819	synonymous_variant	0			AY070774	CCDS6423.1	8q24.3	2013-07-17	2013-07-17	2012-02-29		ENSG00000185803		"""Solute carriers"""	30224	protein-coding gene	gene with protein product		607882	"""G protein-coupled receptor 172A"""	GPR172A		12740431	Standard	NM_024531		Approved	FLJ11856, PAR1, GPCR41, D15Ertd747e, RFVT2, hRFT3	uc003zcd.2	Q9HAB3		ENST00000532887.1:c.384G>T	8.37:g.145583536G>T			A8K6B6|D3DWL8|G1UCY1|Q86UT1	Silent	SNP	pfam_Endogenous_retrovirus_rcpt	p.S128	ENST00000532887.1	37	c.384	CCDS6423.1	8																																																																																			SLC52A2	-	NULL	ENSG00000185803		0.597	SLC52A2-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SLC52A2	HGNC	protein_coding	OTTHUMT00000382405.1		0.00	26	0	G	NM_024531		145583536	+1			no_errors	ENST00000329994	ensembl	human	known	74_37	silent	15.38	22	4	SNP	0.993	T
SLIT2	9353	genome.wustl.edu	37	4	20525670	20525670	+	Silent	SNP	C	C	T			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr4:20525670C>T	ENST00000504154.1	+	14	1560	c.1308C>T	c.(1306-1308)tgC>tgT	p.C436C	SLIT2_ENST00000503823.1_Silent_p.C436C|SLIT2_ENST00000503837.1_Silent_p.C440C|SLIT2_ENST00000273739.5_Silent_p.C440C	NM_004787.1	NP_004778.1	O94813	SLIT2_HUMAN	slit homolog 2 (Drosophila)	436	LRRCT 2.				apoptotic process involved in luteolysis (GO:0061364)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|branching morphogenesis of an epithelial tube (GO:0048754)|cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to heparin (GO:0071504)|cellular response to hormone stimulus (GO:0032870)|chemorepulsion involved in postnatal olfactory bulb interneuron migration (GO:0021836)|corticospinal neuron axon guidance through spinal cord (GO:0021972)|dorsal/ventral axon guidance (GO:0033563)|in utero embryonic development (GO:0001701)|induction of negative chemotaxis (GO:0050929)|mammary duct terminal end bud growth (GO:0060763)|metanephros development (GO:0001656)|motor neuron axon guidance (GO:0008045)|negative chemotaxis (GO:0050919)|negative regulation of actin filament polymerization (GO:0030837)|negative regulation of axon extension (GO:0030517)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cellular response to growth factor stimulus (GO:0090288)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of gene expression (GO:0010629)|negative regulation of lamellipodium assembly (GO:0010593)|negative regulation of leukocyte chemotaxis (GO:0002689)|negative regulation of monocyte chemotaxis (GO:0090027)|negative regulation of mononuclear cell migration (GO:0071676)|negative regulation of neutrophil chemotaxis (GO:0090024)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of retinal ganglion cell axon guidance (GO:0090260)|negative regulation of small GTPase mediated signal transduction (GO:0051058)|negative regulation of smooth muscle cell chemotaxis (GO:0071672)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of vascular permeability (GO:0043116)|positive regulation of apoptotic process (GO:0043065)|positive regulation of axonogenesis (GO:0050772)|response to cortisol (GO:0051414)|retinal ganglion cell axon guidance (GO:0031290)|Roundabout signaling pathway (GO:0035385)|single organismal cell-cell adhesion (GO:0016337)|ureteric bud development (GO:0001657)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|chemorepellent activity (GO:0045499)|GTPase inhibitor activity (GO:0005095)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|laminin-1 binding (GO:0043237)|protein homodimerization activity (GO:0042803)|proteoglycan binding (GO:0043394)|Roundabout binding (GO:0048495)			NS(1)|breast(4)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(7)|large_intestine(17)|lung(60)|ovary(3)|pancreas(1)|prostate(2)|skin(10)|upper_aerodigestive_tract(1)	116						TTTGTGACTGCCATCTCAAGT	0.488																																																	0													113.0	116.0	115.0					4																	20525670		2203	4300	6503	SO:0001819	synonymous_variant	0			AF055585	CCDS3426.1, CCDS75110.1, CCDS75111.1	4p15.2	2008-08-01	2001-11-28		ENSG00000145147	ENSG00000145147			11086	protein-coding gene	gene with protein product		603746	"""slit (Drosophila) homolog 2"""	SLIL3		9813312, 18269211	Standard	XM_005248211		Approved	Slit-2	uc003gpr.1	O94813	OTTHUMG00000128551	ENST00000504154.1:c.1308C>T	4.37:g.20525670C>T			B7ZLR5|O95710|Q17RU3|Q9Y5Q7	Silent	SNP	pfam_EG-like_dom,pfam_Laminin_G,pfam_Leu-rich_rpt,pfam_LRR-contain_N,pfam_Cys-rich_flank_reg_C,superfamily_ConA-like_lec_gl_sf,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,smart_Fol_N,smart_Laminin_G,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_EG-like_dom,pfscan_Laminin_G	p.C436	ENST00000504154.1	37	c.1308	CCDS3426.1	4																																																																																			SLIT2	-	smart_Cys-rich_flank_reg_C	ENSG00000145147		0.488	SLIT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLIT2	HGNC	protein_coding	OTTHUMT00000250396.2		0.00	61	0	C			20525670	+1			no_errors	ENST00000504154	ensembl	human	known	74_37	silent	5.00	38	2	SNP	1.000	T
SMC2	10592	genome.wustl.edu	37	9	106864708	106864708	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr9:106864708A>C	ENST00000286398.7	+	9	1162	c.874A>C	c.(874-876)Act>Cct	p.T292P	SMC2_ENST00000374787.3_Missense_Mutation_p.T292P|SMC2_ENST00000303219.8_Missense_Mutation_p.T292P|SMC2_ENST00000374793.3_Missense_Mutation_p.T292P	NM_001042551.1|NM_001265602.1|NM_006444.2	NP_001036016.1|NP_001252531.1|NP_006435.2	O95347	SMC2_HUMAN	structural maintenance of chromosomes 2	292					kinetochore organization (GO:0051383)|meiotic chromosome condensation (GO:0010032)|meiotic chromosome segregation (GO:0045132)|mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)	condensed chromosome (GO:0000793)|condensin complex (GO:0000796)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein heterodimerization activity (GO:0046982)			breast(5)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(14)|ovary(5)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)	48						GTTATAGGAAACTGGAGGTAT	0.338																																																	0													51.0	51.0	51.0					9																	106864708		2203	4300	6503	SO:0001583	missense	0			AF092563	CCDS35086.1	9q31.1	2008-05-14	2006-07-06	2006-07-06	ENSG00000136824	ENSG00000136824		"""Structural maintenance of chromosomes proteins"""	14011	protein-coding gene	gene with protein product		605576	"""SMC2 (structural maintenance of chromosomes 2, yeast)-like 1"", ""SMC2 structural maintenance of chromosomes 2-like 1 (yeast)"""	SMC2L1		9789013	Standard	NM_006444		Approved	hCAP-E, CAP-E	uc011lvl.2	O95347	OTTHUMG00000020401	ENST00000286398.7:c.874A>C	9.37:g.106864708A>C	ENSP00000286398:p.Thr292Pro		Q6IEE0|Q9P1P2	Missense_Mutation	SNP	pfam_RecF/RecN/SMC_N,pfam_SMC_hinge,superfamily_P-loop_NTPase,superfamily_SMC_hinge,smart_SMC_hinge	p.T292P	ENST00000286398.7	37	c.874	CCDS35086.1	9	.	.	.	.	.	.	.	.	.	.	A	11.73	1.724647	0.30593	.	.	ENSG00000136824	ENST00000286398;ENST00000374793;ENST00000303219;ENST00000536893;ENST00000374787	T;T;T;T	0.80304	-1.26;-1.26;-1.36;-1.26	5.58	3.24	0.37175	RecF/RecN/SMC (1);	0.509439	0.22891	N	0.054396	T	0.71160	0.3307	L	0.46157	1.445	0.24403	N	0.994697	B;B;P	0.36282	0.397;0.365;0.546	B;B;B	0.36092	0.217;0.217;0.173	T	0.58595	-0.7609	10	0.30078	T	0.28	-0.4675	7.5342	0.27700	0.6839:0.0:0.3161:0.0	.	292;292;292	A8K984;O95347;Q2KQ72	.;SMC2_HUMAN;.	P	292	ENSP00000286398:T292P;ENSP00000363925:T292P;ENSP00000306152:T292P;ENSP00000363919:T292P	ENSP00000286398:T292P	T	+	1	0	SMC2	105904529	1.000000	0.71417	0.996000	0.52242	0.564000	0.35744	2.308000	0.43690	0.494000	0.27859	0.528000	0.53228	ACT	SMC2	-	pfam_RecF/RecN/SMC_N,superfamily_P-loop_NTPase	ENSG00000136824		0.338	SMC2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	SMC2	HGNC	protein_coding	OTTHUMT00000053470.1	-	0.00	80	0	A			106864708	+1	tier1	-	no_errors	ENST00000286398	ensembl	human	known	74_37	missense	44.14	62	49	SNP	0.999	C
SPAST	6683	genome.wustl.edu	37	2	32312627	32312627	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr2:32312627C>A	ENST00000315285.3	+	2	607	c.482C>A	c.(481-483)gCt>gAt	p.A161D	SPAST_ENST00000345662.1_Missense_Mutation_p.A161D|AL121655.1_ENST00000577299.1_RNA	NM_014946.3	NP_055761.2			spastin											breast(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(8)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.208)					AAAGGAATAGCTGTTATAGTT	0.303																																																	0													135.0	144.0	141.0					2																	32312627		2203	4300	6503	SO:0001583	missense	0			AJ246001	CCDS1778.1, CCDS1779.1	2p24-p21	2014-09-17	2005-03-15	2005-03-17	ENSG00000021574	ENSG00000021574		"""ATPases / AAA-type"""	11233	protein-coding gene	gene with protein product		604277	"""spastic paraplegia 4 (autosomal dominant; spastin)"""	SPG4		10493830, 10610178	Standard	NM_014946		Approved	FSP2, ADPSP, KIAA1083	uc002roc.3	Q9UBP0	OTTHUMG00000128455	ENST00000315285.3:c.482C>A	2.37:g.32312627C>A	ENSP00000320885:p.Ala161Asp			Missense_Mutation	SNP	pfam_ATPase_AAA_core,pfam_MIT,pfam_DNA_helicase_Holl-junc_RuvB_N,superfamily_P-loop_NTPase,smart_MIT,smart_AAA+_ATPase,pirsf_Spastin	p.A161D	ENST00000315285.3	37	c.482	CCDS1778.1	2	.	.	.	.	.	.	.	.	.	.	C	20.6	4.011546	0.75046	.	.	ENSG00000021574	ENST00000345662;ENST00000315285	T;T	0.71103	-0.54;-0.54	5.48	4.6	0.57074	MIT (2);	0.121669	0.53938	D	0.000057	T	0.81673	0.4872	L	0.61218	1.895	0.54753	D	0.999987	D;D	0.76494	0.999;0.998	D;D	0.74348	0.983;0.983	T	0.82694	-0.0330	10	0.51188	T	0.08	-32.3531	15.9538	0.79865	0.0:0.8645:0.1355:0.0	.	161;161	E5KRP6;Q9UBP0	.;SPAST_HUMAN	D	161	ENSP00000340817:A161D;ENSP00000320885:A161D	ENSP00000320885:A161D	A	+	2	0	SPAST	32166131	1.000000	0.71417	0.860000	0.33809	0.957000	0.61999	5.825000	0.69286	1.306000	0.44926	0.650000	0.86243	GCT	SPAST	-	pfam_MIT,smart_MIT,pirsf_Spastin	ENSG00000021574		0.303	SPAST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPAST	HGNC	protein_coding	OTTHUMT00000250253.1	-	0.00	86	0	C	NM_199436		32312627	+1	tier1	-	no_errors	ENST00000315285	ensembl	human	known	74_37	missense	5.19	73	4	SNP	0.998	A
SNRNP200	23020	genome.wustl.edu	37	2	96944361	96944361	+	Silent	SNP	G	G	A	rs142524062		TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr2:96944361G>A	ENST00000323853.5	-	38	5489	c.5412C>T	c.(5410-5412)atC>atT	p.I1804I	SNRNP200_ENST00000349783.5_Intron	NM_014014.4	NP_054733.2	O75643	U520_HUMAN	small nuclear ribonucleoprotein 200kDa (U5)	1804					ATP catabolic process (GO:0006200)|cis assembly of pre-catalytic spliceosome (GO:0000354)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|osteoblast differentiation (GO:0001649)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U5 snRNP (GO:0005682)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|ATP-dependent RNA helicase activity (GO:0004004)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)	p.I1804I(1)		breast(3)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(18)|lung(37)|ovary(7)|prostate(4)|skin(5)|stomach(1)|urinary_tract(1)	90						TCTCGTCCTCGATGCTGATGC	0.582																																																	1	Substitution - coding silent(1)	large_intestine(1)						G		0,4406		0,0,2203	105.0	96.0	99.0		5412	-8.4	0.7	2	dbSNP_134	99	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	SNRNP200	NM_014014.4		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		1804/2137	96944361	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	0			AL831994	CCDS2020.1	2q11.2	2013-05-13	2008-10-29	2008-10-29	ENSG00000144028	ENSG00000144028			30859	protein-coding gene	gene with protein product	"""U5 snRNP specific protein, 200 KD"""	601664	"""activating signal cointegrator 1 complex subunit 3-like 1"", ""retinitis pigmentosa 33 (autosomal dominant)"""	ASCC3L1, RP33		9872452, 8670905, 9774689, 9539711, 16612614, 19878916	Standard	NM_014014		Approved	U5-200KD, HELIC2, KIAA0788, BRR2	uc002svu.3	O75643	OTTHUMG00000130455	ENST00000323853.5:c.5412C>T	2.37:g.96944361G>A			O94884|Q6NZY0|Q6PX59|Q8NBE6|Q96IF2|Q9H7S0	Silent	SNP	pfam_Sec63-dom,pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase/UvrB_dom,pfam_Helicase_C,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,smart_Sec63-dom,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.I1804	ENST00000323853.5	37	c.5412	CCDS2020.1	2																																																																																			SNRNP200	-	NULL	ENSG00000144028		0.582	SNRNP200-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNRNP200	HGNC	protein_coding	OTTHUMT00000252846.2	-	0.00	38	0	G	NM_014014		96944361	-1	tier1	rs142524062	no_errors	ENST00000323853	ensembl	human	known	74_37	silent	27.59	21	8	SNP	0.052	A
SPEN	23013	genome.wustl.edu	37	1	16257159	16257159	+	Missense_Mutation	SNP	G	G	T	rs141407539		TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr1:16257159G>T	ENST00000375759.3	+	11	4628	c.4424G>T	c.(4423-4425)cGa>cTa	p.R1475L		NM_015001.2	NP_055816.2	Q96T58	MINT_HUMAN	spen family transcriptional repressor	1475					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|positive regulation of neurogenesis (GO:0050769)|positive regulation of transcription, DNA-templated (GO:0045893)|viral process (GO:0016032)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)|transcription corepressor activity (GO:0003714)			NS(1)|breast(13)|central_nervous_system(3)|cervix(5)|endometrium(16)|kidney(18)|large_intestine(27)|liver(2)|lung(37)|ovary(7)|prostate(7)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	149		Colorectal(325;0.000258)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(313;0.013)|READ - Rectum adenocarcinoma(331;0.0681)		GCAAATTTTCGAAACAACAAA	0.383																																																	0													59.0	64.0	62.0					1																	16257159		2199	4300	6499	SO:0001583	missense	0				CCDS164.1	1p36	2013-10-17	2013-10-17		ENSG00000065526	ENSG00000065526		"""RNA binding motif (RRM) containing"""	17575	protein-coding gene	gene with protein product		613484	"""SPEN homolog, transcriptional regulator (Drosophila)"", ""spen homolog, transcriptional regulator (Drosophila)"""			10451362, 11331609	Standard	NM_015001		Approved	KIAA0929, MINT, SHARP, RBM15C	uc001axk.1	Q96T58	OTTHUMG00000009376	ENST00000375759.3:c.4424G>T	1.37:g.16257159G>T	ENSP00000364912:p.Arg1475Leu		Q9H9A8|Q9NWH5|Q9UQ01|Q9Y556	Missense_Mutation	SNP	pfam_RRM_dom,pfam_SPOC_C,superfamily_SPOC_like_C_dom,smart_RRM_dom,pfscan_SPOC_met,pfscan_RRM_dom	p.R1475L	ENST00000375759.3	37	c.4424	CCDS164.1	1	.	.	.	.	.	.	.	.	.	.	G	13.89	2.373394	0.42105	.	.	ENSG00000065526	ENST00000375759	T	0.12879	2.64	5.27	5.27	0.74061	.	.	.	.	.	T	0.27731	0.0682	L	0.32530	0.975	0.47374	D	0.999408	D	0.76494	0.999	D	0.65010	0.931	T	0.00878	-1.1530	9	0.66056	D	0.02	-8.5555	19.0911	0.93227	0.0:0.0:1.0:0.0	.	1475	Q96T58	MINT_HUMAN	L	1475	ENSP00000364912:R1475L	ENSP00000364912:R1475L	R	+	2	0	SPEN	16129746	1.000000	0.71417	1.000000	0.80357	0.866000	0.49608	3.357000	0.52277	2.746000	0.94184	0.563000	0.77884	CGA	SPEN	-	NULL	ENSG00000065526		0.383	SPEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPEN	HGNC	protein_coding	OTTHUMT00000025993.1		0.00	98	0	G	NM_015001		16257159	+1			no_errors	ENST00000375759	ensembl	human	known	74_37	missense	5.41	70	4	SNP	1.000	T
STAG1	10274	genome.wustl.edu	37	3	136141419	136141419	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr3:136141419C>A	ENST00000383202.2	-	19	2126	c.1870G>T	c.(1870-1872)Gtg>Ttg	p.V624L	STAG1_ENST00000434713.2_Missense_Mutation_p.V398L|STAG1_ENST00000536929.1_Missense_Mutation_p.V208L|STAG1_ENST00000236698.5_Missense_Mutation_p.V624L	NM_005862.2	NP_005853.2	Q8WVM7	STAG1_HUMAN	stromal antigen 1	624					chromosome segregation (GO:0007059)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	cell junction (GO:0030054)|chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(16)|lung(16)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	58						TGTTTCTCCACAACAAACTTA	0.318																																																	0													96.0	97.0	97.0					3																	136141419		2202	4300	6502	SO:0001583	missense	0			Z75330	CCDS3090.1	3q22.2-q22.3	2011-08-12			ENSG00000118007	ENSG00000118007			11354	protein-coding gene	gene with protein product		604358				9305759	Standard	XM_006713471		Approved	SA-1, SCC3A	uc003era.1	Q8WVM7	OTTHUMG00000159798	ENST00000383202.2:c.1870G>T	3.37:g.136141419C>A	ENSP00000372689:p.Val624Leu		O00539|Q6P275	Missense_Mutation	SNP	pfam_STAG,superfamily_ARM-type_fold	p.V624L	ENST00000383202.2	37	c.1870	CCDS3090.1	3	.	.	.	.	.	.	.	.	.	.	C	22.1	4.243208	0.79912	.	.	ENSG00000118007	ENST00000383202;ENST00000236698;ENST00000434713;ENST00000536929	T;T;T;T	0.19806	2.12;2.12;2.12;2.12	5.65	5.65	0.86999	Armadillo-type fold (1);	0.064937	0.64402	D	0.000008	T	0.26593	0.0650	L	0.60957	1.885	0.80722	D	1	B;P;B	0.36753	0.144;0.568;0.144	B;B;B	0.35770	0.196;0.21;0.196	T	0.01715	-1.1289	10	0.37606	T	0.19	.	19.7806	0.96414	0.0:1.0:0.0:0.0	.	641;624;624	Q4LE48;Q6P275;Q8WVM7	.;.;STAG1_HUMAN	L	624;624;398;208	ENSP00000372689:V624L;ENSP00000236698:V624L;ENSP00000404396:V398L;ENSP00000445787:V208L	ENSP00000236698:V624L	V	-	1	0	STAG1	137624109	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.818000	0.86416	2.668000	0.90789	0.644000	0.83932	GTG	STAG1	-	superfamily_ARM-type_fold	ENSG00000118007		0.318	STAG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STAG1	HGNC	protein_coding	OTTHUMT00000357366.1	-	0.00	44	0	C	NM_005862		136141419	-1	tier1	-	no_errors	ENST00000383202	ensembl	human	known	74_37	missense	56.41	34	44	SNP	1.000	A
STARD9	57519	genome.wustl.edu	37	15	42958001	42958001	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr15:42958001G>T	ENST00000290607.7	+	15	1329	c.1272G>T	c.(1270-1272)ttG>ttT	p.L424F		NM_020759.2	NP_065810.2	Q9P2P6	STAR9_HUMAN	StAR-related lipid transfer (START) domain containing 9	424					ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|spindle assembly (GO:0051225)	centriole (GO:0005814)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|kinesin complex (GO:0005871)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|lipid binding (GO:0008289)|microtubule binding (GO:0008017)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)			haematopoietic_and_lymphoid_tissue(1)|stomach(1)	2						TCAGTTCATTGAGTGATGAAA	0.453																																																	0													211.0	196.0	201.0					15																	42958001		692	1590	2282	SO:0001583	missense	0			AB037721	CCDS53935.1	15q15.2	2013-10-16	2007-08-16		ENSG00000159433	ENSG00000159433		"""StAR-related lipid transfer (START) domain containing"""	19162	protein-coding gene	gene with protein product		614642	"""START domain containing 9"""			10718198	Standard	NM_020759		Approved	KIAA1300	uc010udj.2	Q9P2P6	OTTHUMG00000175799	ENST00000290607.7:c.1272G>T	15.37:g.42958001G>T	ENSP00000290607:p.Leu424Phe		Q68DG2|Q6AI01|Q6ZWK0|Q9UF70	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,pfam_START_lipid-bd_dom,pfam_FHA_dom,superfamily_P-loop_NTPase,superfamily_SMAD_FHA_domain,smart_Kinesin_motor_dom,smart_FHA_dom,pfscan_START_lipid-bd_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.L424F	ENST00000290607.7	37	c.1272	CCDS53935.1	15	.	.	.	.	.	.	.	.	.	.	G	0.629	-0.817947	0.02776	.	.	ENSG00000159433	ENST00000290607	T	0.65549	-0.16	5.8	0.327	0.15913	.	.	.	.	.	T	0.47358	0.1441	N	0.20807	0.61	0.09310	N	1	.	.	.	.	.	.	T	0.40232	-0.9574	7	0.39692	T	0.17	.	9.0089	0.36129	0.153:0.1677:0.6793:0.0	.	.	.	.	F	424	ENSP00000290607:L424F	ENSP00000290607:L424F	L	+	3	2	STARD9	40745293	0.000000	0.05858	0.001000	0.08648	0.448000	0.32197	0.581000	0.23819	0.075000	0.16796	0.591000	0.81541	TTG	STARD9	-	NULL	ENSG00000159433		0.453	STARD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STARD9	HGNC	protein_coding	OTTHUMT00000431094.1	-	0.00	81	0	G			42958001	+1	tier1	-	no_errors	ENST00000290607	ensembl	human	known	74_37	missense	5.71	66	4	SNP	0.000	T
STARD9	57519	genome.wustl.edu	37	15	42984297	42984297	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr15:42984297T>G	ENST00000290607.7	+	23	10578	c.10521T>G	c.(10519-10521)aaT>aaG	p.N3507K		NM_020759.2	NP_065810.2	Q9P2P6	STAR9_HUMAN	StAR-related lipid transfer (START) domain containing 9	3507					ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|spindle assembly (GO:0051225)	centriole (GO:0005814)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|kinesin complex (GO:0005871)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|lipid binding (GO:0008289)|microtubule binding (GO:0008017)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)			haematopoietic_and_lymphoid_tissue(1)|stomach(1)	2						CACTATCAAATGTGGCCCGGT	0.547																																																	0													44.0	43.0	44.0					15																	42984297		692	1590	2282	SO:0001583	missense	0			AB037721	CCDS53935.1	15q15.2	2013-10-16	2007-08-16		ENSG00000159433	ENSG00000159433		"""StAR-related lipid transfer (START) domain containing"""	19162	protein-coding gene	gene with protein product		614642	"""START domain containing 9"""			10718198	Standard	NM_020759		Approved	KIAA1300	uc010udj.2	Q9P2P6	OTTHUMG00000175799	ENST00000290607.7:c.10521T>G	15.37:g.42984297T>G	ENSP00000290607:p.Asn3507Lys		Q68DG2|Q6AI01|Q6ZWK0|Q9UF70	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,pfam_START_lipid-bd_dom,pfam_FHA_dom,superfamily_P-loop_NTPase,superfamily_SMAD_FHA_domain,smart_Kinesin_motor_dom,smart_FHA_dom,pfscan_START_lipid-bd_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.N3507K	ENST00000290607.7	37	c.10521	CCDS53935.1	15	.	.	.	.	.	.	.	.	.	.	T	15.22	2.768279	0.49680	.	.	ENSG00000159433	ENST00000290607	T	0.62364	0.03	5.36	-9.49	0.00587	.	.	.	.	.	T	0.36166	0.0957	L	0.34521	1.04	0.09310	N	1	B	0.12013	0.005	B	0.10450	0.005	T	0.18935	-1.0321	9	0.20046	T	0.44	.	1.2547	0.01989	0.3233:0.3289:0.1374:0.2105	.	3421	Q9P2P6	STAR9_HUMAN	K	3507	ENSP00000290607:N3507K	ENSP00000290607:N3507K	N	+	3	2	STARD9	40771589	0.000000	0.05858	0.000000	0.03702	0.080000	0.17528	-1.698000	0.01908	-1.133000	0.02903	0.379000	0.24179	AAT	STARD9	-	NULL	ENSG00000159433		0.547	STARD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STARD9	HGNC	protein_coding	OTTHUMT00000431094.1	-	0.00	65	0	T			42984297	+1	tier1	-	no_errors	ENST00000290607	ensembl	human	known	74_37	missense	42.37	34	25	SNP	0.000	G
SUCLA2	8803	genome.wustl.edu	37	13	48562564	48562564	+	Intron	SNP	G	G	A			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr13:48562564G>A	ENST00000378654.3	-	4	591				SUCLA2_ENST00000543413.1_Intron|SUCLA2_ENST00000544100.1_Intron|SUCLA2_ENST00000497202.1_Intron|SUCLA2_ENST00000534875.1_Intron	NM_003850.2	NP_003841.1	Q9P2R7	SUCB1_HUMAN	succinate-CoA ligase, ADP-forming, beta subunit						cellular metabolic process (GO:0044237)|small molecule metabolic process (GO:0044281)|succinate metabolic process (GO:0006105)|succinyl-CoA metabolic process (GO:0006104)|succinyl-CoA pathway (GO:0006781)|tricarboxylic acid cycle (GO:0006099)	extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|succinate-CoA ligase (ADP-forming) activity (GO:0004775)			central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(5)|lung(3)|skin(4)	15		all_cancers(8;1.13e-24)|all_epithelial(8;1.78e-13)|all_lung(13;2.85e-06)|Breast(56;0.000141)|Lung NSC(96;0.000226)|all_hematologic(8;0.000885)|Prostate(109;0.00132)|Acute lymphoblastic leukemia(8;0.0167)|Myeloproliferative disorder(33;0.039)|Hepatocellular(98;0.0556)|Lung SC(185;0.102)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(144;2.1e-06)	Succinic acid(DB00139)	CATACAAACAGATTATAATTT	0.244																																																	0																																										SO:0001627	intron_variant	0			AF058953	CCDS9406.1	13q12.2-q13.3	2010-04-16			ENSG00000136143	ENSG00000136143	6.2.1.5		11448	protein-coding gene	gene with protein product		603921				9765291	Standard	NM_003850		Approved		uc001vbs.3	Q9P2R7	OTTHUMG00000016889	ENST00000378654.3:c.534+111C>T	13.37:g.48562564G>A			B2RDE7|O95194|Q5T9Q4|Q5T9Q6|Q9NV21|Q9NVP7	RNA	SNP	-	NULL	ENST00000378654.3	37	NULL	CCDS9406.1	13																																																																																			SUCLA2	-	-	ENSG00000136143		0.244	SUCLA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SUCLA2	HGNC	protein_coding	OTTHUMT00000044852.1	-	0.00	22	0	G			48562564	-1	tier1	-	no_errors	ENST00000470760	ensembl	human	known	74_37	rna	38.10	13	8	SNP	0.000	A
SYNE1	23345	genome.wustl.edu	37	6	152552555	152552555	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr6:152552555G>T	ENST00000367255.5	-	114	21611	c.21010C>A	c.(21010-21012)Caa>Aaa	p.Q7004K	SYNE1_ENST00000448038.1_Missense_Mutation_p.Q6933K|SYNE1_ENST00000341594.5_Missense_Mutation_p.Q6616K|SYNE1_ENST00000356820.4_Missense_Mutation_p.Q1528K|SYNE1_ENST00000423061.1_Missense_Mutation_p.Q6933K|SYNE1_ENST00000265368.4_Missense_Mutation_p.Q7004K	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	7004					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		TGCAGAATTTGCCAACTTTTA	0.443										HNSCC(10;0.0054)																																							0													185.0	167.0	173.0					6																	152552555		2203	4300	6503	SO:0001583	missense	0			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.21010C>A	6.37:g.152552555G>T	ENSP00000356224:p.Gln7004Lys		E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_CH-domain,pfam_KASH,superfamily_CH-domain,superfamily_Calpain_domain_III,superfamily_ABC1_TM_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,pfscan_CH-domain,pfscan_KASH	p.Q7004K	ENST00000367255.5	37	c.21010	CCDS5236.2	6	.	.	.	.	.	.	.	.	.	.	G	29.9	5.044134	0.93685	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594;ENST00000356820	T;T;T;T;T;T	0.34667	1.35;1.35;1.35;1.35;1.35;1.35	5.86	5.86	0.93980	.	0.000000	0.56097	D	0.000024	T	0.57359	0.2048	M	0.76574	2.34	0.80722	D	1	D;D;D	0.76494	0.998;0.998;0.999	D;D;D	0.87578	0.995;0.995;0.998	T	0.55897	-0.8068	10	0.52906	T	0.07	.	20.2625	0.98452	0.0:0.0:1.0:0.0	.	7004;7004;6933	Q8NF91;E7EQI5;Q8NF91-4	SYNE1_HUMAN;.;.	K	7004;6933;7004;6933;6616;1528	ENSP00000356224:Q7004K;ENSP00000396024:Q6933K;ENSP00000265368:Q7004K;ENSP00000390975:Q6933K;ENSP00000341887:Q6616K;ENSP00000349276:Q1528K	ENSP00000265368:Q7004K	Q	-	1	0	SYNE1	152594248	1.000000	0.71417	1.000000	0.80357	0.921000	0.55340	9.865000	0.99609	2.782000	0.95742	0.558000	0.71614	CAA	SYNE1	-	superfamily_Calpain_domain_III,superfamily_ABC1_TM_dom,smart_Spectrin/alpha-actinin	ENSG00000131018		0.443	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYNE1	HGNC	protein_coding	OTTHUMT00000334755.2	-	0.00	65	0	G	NM_182961		152552555	-1	tier1	-	no_errors	ENST00000265368	ensembl	human	known	74_37	missense	5.26	72	4	SNP	1.000	T
SYTL3	94120	genome.wustl.edu	37	6	159146542	159146542	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr6:159146542G>T	ENST00000297239.9	+	10	922	c.728G>T	c.(727-729)aGt>aTt	p.S243I	SYTL3_ENST00000367081.3_Intron|SYTL3_ENST00000360448.3_Missense_Mutation_p.S175I			Q4VX76	SYTL3_HUMAN	synaptotagmin-like 3	243					exocytosis (GO:0006887)|intracellular protein transport (GO:0006886)	membrane (GO:0016020)	calcium-dependent phospholipid binding (GO:0005544)			endometrium(2)|kidney(3)|large_intestine(5)|lung(7)|ovary(1)|pancreas(1)|urinary_tract(1)	20		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;1.54e-17)|BRCA - Breast invasive adenocarcinoma(81;8.24e-06)		CAGAAGGTCAGTGCACCAGAT	0.418																																																	0													131.0	130.0	130.0					6																	159146542		2203	4300	6503	SO:0001583	missense	0			AK055750	CCDS34563.1, CCDS56458.1	6q25.3	2008-07-04			ENSG00000164674	ENSG00000164674			15587	protein-coding gene	gene with protein product						11773082	Standard	NM_001242384		Approved	SLP3, exophilin-6	uc003qrp.3	Q4VX76	OTTHUMG00000015916	ENST00000297239.9:c.728G>T	6.37:g.159146542G>T	ENSP00000297239:p.Ser243Ile		Q496J4|Q496J6|Q5U3B9	Missense_Mutation	SNP	pfam_C2_dom,superfamily_C2_dom,superfamily_Znf_FYVE_PHD,smart_C2_dom,pfscan_C2_dom,pfscan_Znf_FYVE-typ	p.S243I	ENST00000297239.9	37	c.728	CCDS56458.1	6	.	.	.	.	.	.	.	.	.	.	G	14.20	2.463499	0.43736	.	.	ENSG00000164674	ENST00000360448;ENST00000543689;ENST00000297239	T;T	0.20598	2.06;2.07	4.42	4.42	0.53409	.	0.257658	0.38272	N	0.001742	T	0.19127	0.0459	M	0.62723	1.935	0.53688	D	0.999973	P;D	0.56287	0.89;0.975	B;P	0.47299	0.367;0.543	T	0.01084	-1.1457	10	0.66056	D	0.02	.	12.8255	0.57716	0.0:0.0:1.0:0.0	.	243;175	Q4VX76;Q4VX76-2	SYTL3_HUMAN;.	I	175;243;243	ENSP00000353631:S175I;ENSP00000297239:S243I	ENSP00000297239:S243I	S	+	2	0	SYTL3	159066530	0.019000	0.18553	0.001000	0.08648	0.766000	0.43426	1.174000	0.31932	2.750000	0.94351	0.467000	0.42956	AGT	SYTL3	-	NULL	ENSG00000164674		0.418	SYTL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYTL3	HGNC	protein_coding	OTTHUMT00000042876.1	-	0.00	75	0	G			159146542	+1	tier1	-	no_errors	ENST00000297239	ensembl	human	known	74_37	missense	10.81	33	4	SNP	0.001	T
TANK	10010	genome.wustl.edu	37	2	162059994	162059994	+	Intron	SNP	G	G	A			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr2:162059994G>A	ENST00000392749.2	+	3	338				TANK_ENST00000259075.2_Intron|TANK_ENST00000403609.1_Intron|TANK_ENST00000457476.1_Intron|TANK_ENST00000405852.1_Intron|TANK_ENST00000402568.1_Splice_Site|TANK_ENST00000406287.1_Intron	NM_001199135.1	NP_001186064.1	Q92844	TANK_HUMAN	TRAF family member-associated NFKB activator						I-kappaB kinase/NF-kappaB signaling (GO:0007249)|innate immune response (GO:0045087)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	metal ion binding (GO:0046872)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(7)|ovary(1)|prostate(1)	21						TTTTATGTCAGCAGACTGAGA	0.353																																																	0													122.0	118.0	119.0					2																	162059994		2203	4300	6503	SO:0001627	intron_variant	0			U59863	CCDS2215.1, CCDS46436.1	2q24-q31	2008-02-05			ENSG00000136560	ENSG00000136560			11562	protein-coding gene	gene with protein product		603893		TRAF2		8710854, 8855313	Standard	NM_004180		Approved	I-TRAF	uc002ubr.2	Q92844	OTTHUMG00000132037	ENST00000392749.2:c.100-4G>A	2.37:g.162059994G>A			D3DPB5|Q7Z4J6|Q92885	Splice_Site	SNP	-	e3-1	ENST00000392749.2	37	c.274-1	CCDS2215.1	2	.	.	.	.	.	.	.	.	.	.	G	17.60	3.430699	0.62844	.	.	ENSG00000136560	ENST00000432002;ENST00000429217;ENST00000402568	.	.	.	5.06	4.18	0.49190	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.9921	0.47555	0.0871:0.0:0.9129:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	TANK	161768240	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	1.312000	0.33574	1.135000	0.42183	0.467000	0.42956	.	TANK	-	-	ENSG00000136560		0.353	TANK-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TANK	HGNC	protein_coding	OTTHUMT00000324232.1	-	0.00	58	0	G	NM_133484		162059994	+1	tier1	-	no_errors	ENST00000402568	ensembl	human	putative	74_37	splice_site	5.71	66	4	SNP	1.000	A
JAZF1	221895	genome.wustl.edu	37	7	27872346	27872346	+	3'UTR	SNP	C	C	A			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr7:27872346C>A	ENST00000283928.5	-	0	970				JAZF1_ENST00000466516.1_5'Flank	NM_175061.3	NP_778231.2	Q86VZ6	JAZF1_HUMAN	JAZF zinc finger 1						negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|transcription corepressor activity (GO:0003714)		JAZF1/SUZ12(133)	endometrium(1)|large_intestine(1)|lung(4)	6						AATGCTTCCCCTGAAAAAAGG	0.348			T	SUZ12	endometrial stromal tumours																																			Dom	yes		7	7p15.2-p15.1	221895	juxtaposed with another zinc finger gene 1		M	0																																										SO:0001624	3_prime_UTR_variant	0			BC047229	CCDS5416.1	7p15.2-p15.1	2010-04-14			ENSG00000153814	ENSG00000153814		"""Zinc fingers, C2H2-type"""	28917	protein-coding gene	gene with protein product		606246				8401585	Standard	XM_006715656		Approved	TIP27, DKFZp761K2222, ZNF802	uc003szn.3	Q86VZ6	OTTHUMG00000128545	ENST00000283928.5:c.*73G>T	7.37:g.27872346C>A			A4D195|Q8N3L7	RNA	SNP	-	NULL	ENST00000283928.5	37	NULL	CCDS5416.1	7																																																																																			TAX1BP1	-	-	ENSG00000106052		0.348	JAZF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAX1BP1	HGNC	protein_coding	OTTHUMT00000250382.2	-	0.00	42	0	C	NM_175061		27872346	+1	tier1	-	no_errors	ENST00000460059	ensembl	human	putative	74_37	rna	10.00	36	4	SNP	1.000	A
TBC1D22A	25771	genome.wustl.edu	37	22	47193449	47193449	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr22:47193449T>C	ENST00000337137.4	+	4	735	c.569T>C	c.(568-570)cTg>cCg	p.L190P	TBC1D22A_ENST00000406733.1_Missense_Mutation_p.L143P|TBC1D22A_ENST00000355704.3_Intron|TBC1D22A_ENST00000380995.1_Missense_Mutation_p.L143P|TBC1D22A_ENST00000407381.3_Intron	NM_001284304.1|NM_001284305.1|NM_014346.2	NP_001271233.1|NP_001271234.1|NP_055161.1	Q8WUA7	TB22A_HUMAN	TBC1 domain family, member 22A	190							protein homodimerization activity (GO:0042803)|Rab GTPase activator activity (GO:0005097)			breast(1)|endometrium(3)|large_intestine(10)|lung(5)|ovary(2)|prostate(1)	22		all_cancers(38;4.44e-05)|all_epithelial(38;0.000507)|Breast(42;0.0488)|all_lung(38;0.0682)|Ovarian(80;0.0731)|all_neural(38;0.0966)|Glioma(61;0.222)|Lung SC(80;0.236)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0347)|BRCA - Breast invasive adenocarcinoma(115;0.231)		AGCTCAGCGCTGAGCGAAAGA	0.642											OREG0026659	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													36.0	32.0	34.0					22																	47193449		2203	4300	6503	SO:0001583	missense	0			AK125705	CCDS14078.1, CCDS63511.1, CCDS63512.1, CCDS74877.1	22q13	2008-01-22	2005-01-05	2005-01-05	ENSG00000054611	ENSG00000054611			1309	protein-coding gene	gene with protein product			"""chromosome 22 open reading frame 4"""	C22orf4			Standard	XM_005261496		Approved		uc003bib.3	Q8WUA7	OTTHUMG00000150332	ENST00000337137.4:c.569T>C	22.37:g.47193449T>C	ENSP00000336724:p.Leu190Pro	945	B0QYI2|B0QYI3|B9A6M3|Q5TE47|Q6ZUH2|Q92680|Q9BVD6|Q9UGG0|Q9UGT2|Q9UGU6|Q9UH25|Q9Y4W5	Missense_Mutation	SNP	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	p.L190P	ENST00000337137.4	37	c.569	CCDS14078.1	22	.	.	.	.	.	.	.	.	.	.	T	15.61	2.884857	0.51908	.	.	ENSG00000054611	ENST00000337137;ENST00000380995;ENST00000406733	T;T;T	0.47177	1.86;0.85;1.87	4.55	3.48	0.39840	.	0.244995	0.39210	N	0.001430	T	0.46288	0.1385	M	0.78916	2.43	0.44168	D	0.996974	B;B	0.09022	0.002;0.002	B;B	0.10450	0.005;0.005	T	0.35724	-0.9777	10	0.24483	T	0.36	.	10.1726	0.42920	0.0:0.0:0.168:0.832	.	190;190	B9A6M3;Q8WUA7	.;TB22A_HUMAN	P	190;143;143	ENSP00000336724:L190P;ENSP00000370383:L143P;ENSP00000385634:L143P	ENSP00000336724:L190P	L	+	2	0	TBC1D22A	45572113	1.000000	0.71417	0.003000	0.11579	0.822000	0.46500	7.019000	0.76412	0.733000	0.32492	0.363000	0.22086	CTG	TBC1D22A	-	NULL	ENSG00000054611		0.642	TBC1D22A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBC1D22A	HGNC	protein_coding	OTTHUMT00000317600.3		0.00	42	0	T	NM_014346		47193449	+1			no_errors	ENST00000337137	ensembl	human	known	74_37	missense	9.38	29	3	SNP	0.322	C
TBL1X	6907	genome.wustl.edu	37	X	9665428	9665428	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chrX:9665428C>T	ENST00000217964.7	+	12	1713	c.1073C>T	c.(1072-1074)gCc>gTc	p.A358V	TBL1X_ENST00000380961.1_Missense_Mutation_p.A307V|TBL1X_ENST00000407597.2_Missense_Mutation_p.A358V|TBL1X_ENST00000536365.1_Missense_Mutation_p.A307V|TBL1X_ENST00000424279.1_Missense_Mutation_p.A307V	NM_005647.3	NP_005638.1	O60907	TBL1X_HUMAN	transducin (beta)-like 1X-linked	358					canonical Wnt signaling pathway (GO:0060070)|cellular lipid metabolic process (GO:0044255)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|proteolysis (GO:0006508)|sensory perception of sound (GO:0007605)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)|transcriptional repressor complex (GO:0017053)	beta-catenin binding (GO:0008013)|histone binding (GO:0042393)|protein C-terminus binding (GO:0008022)|protein domain specific binding (GO:0019904)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|cervix(1)|endometrium(5)|large_intestine(7)|lung(2)|ovary(1)|skin(2)	20		Hepatocellular(5;0.000888)				ATTTGGGATGCCCACACAGGA	0.328																																																	0													179.0	158.0	165.0					X																	9665428		2203	4300	6503	SO:0001583	missense	0			Y12781	CCDS14133.1, CCDS48078.1	Xp22.3	2013-01-10	2002-05-22	2002-05-24	ENSG00000101849	ENSG00000101849		"""WD repeat domain containing"""	11585	protein-coding gene	gene with protein product		300196	"""transducin (beta)-like 1"""	TBL1		10330347	Standard	NM_005647		Approved	EBI	uc004csr.3	O60907	OTTHUMG00000021117	ENST00000217964.7:c.1073C>T	X.37:g.9665428C>T	ENSP00000217964:p.Ala358Val		A8K044|A8K4J7|Q86UY2	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_LisH_dimerisation_subgr,superfamily_WD40_repeat_dom,smart_LisH_dimerisation,smart_WD40_repeat,pfscan_LisH_dimerisation,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.A358V	ENST00000217964.7	37	c.1073	CCDS14133.1	X	.	.	.	.	.	.	.	.	.	.	C	17.21	3.331042	0.60853	.	.	ENSG00000101849	ENST00000407597;ENST00000424279;ENST00000536365;ENST00000380961;ENST00000217964	T;T;T;T;T	0.79845	-1.31;-1.31;-1.31;-1.31;-1.31	4.07	4.07	0.47477	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40 repeat, conserved site (1);WD40-repeat-containing domain (1);	0.000000	0.85682	U	0.000000	T	0.64483	0.2602	N	0.05259	-0.085	0.80722	D	1	P;P	0.51147	0.942;0.772	B;P	0.44897	0.348;0.463	T	0.64622	-0.6364	10	0.11794	T	0.64	.	16.0824	0.81014	0.0:1.0:0.0:0.0	.	321;358	Q59F53;O60907	.;TBL1X_HUMAN	V	358;307;307;307;358	ENSP00000385988:A358V;ENSP00000394097:A307V;ENSP00000445317:A307V;ENSP00000370348:A307V;ENSP00000217964:A358V	ENSP00000217964:A358V	A	+	2	0	TBL1X	9625428	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.922000	0.75811	1.785000	0.52413	0.544000	0.68410	GCC	TBL1X	-	superfamily_WD40_repeat_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000101849		0.328	TBL1X-003	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	TBL1X	HGNC	protein_coding	OTTHUMT00000055709.1	-	0.00	143	0	C	NM_005647		9665428	+1	tier1	-	no_errors	ENST00000217964	ensembl	human	known	74_37	missense	5.63	67	4	SNP	1.000	T
TET2	54790	genome.wustl.edu	37	4	106197248	106197248	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr4:106197248G>A	ENST00000540549.1	+	11	6441	c.5581G>A	c.(5581-5583)Gga>Aga	p.G1861R	TET2_ENST00000545826.1_3'UTR|TET2_ENST00000380013.4_Missense_Mutation_p.G1861R|TET2_ENST00000513237.1_Missense_Mutation_p.G1882R			Q6N021	TET2_HUMAN	tet methylcytosine dioxygenase 2	1861					5-methylcytosine catabolic process (GO:0006211)|cell cycle (GO:0007049)|DNA demethylation (GO:0080111)|histone H3-K4 trimethylation (GO:0080182)|kidney development (GO:0001822)|myeloid cell differentiation (GO:0030099)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-embryonic development (GO:0009791)|protein O-linked glycosylation (GO:0006493)		DNA binding (GO:0003677)|ferrous iron binding (GO:0008198)|methylcytosine dioxygenase activity (GO:0070579)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1272)|kidney(3)|large_intestine(11)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	1314		Myeloproliferative disorder(5;0.0393)		OV - Ovarian serous cystadenocarcinoma(123;7.18e-08)		TGACATTGGGGGAGTGGCCGT	0.542			"""Mis N, F"""		MDS																																			Rec	yes		4	4q24	54790	tet oncogene family member 2		L	0													52.0	50.0	50.0					4																	106197248		692	1591	2283	SO:0001583	missense	0			AB046766	CCDS3666.1, CCDS47120.1	4q24	2014-09-17	2011-09-30	2008-03-12	ENSG00000168769	ENSG00000168769			25941	protein-coding gene	gene with protein product		612839	"""KIAA1546"", ""tet oncogene family member 2"""	KIAA1546		10997877, 12646957	Standard	NM_017628		Approved	FLJ20032	uc003hxk.3	Q6N021	OTTHUMG00000131213	ENST00000540549.1:c.5581G>A	4.37:g.106197248G>A	ENSP00000442788:p.Gly1861Arg		B5MDU0|Q2TB88|Q3LIB8|Q96JX5|Q9HCM6|Q9NXW0	Missense_Mutation	SNP	NULL	p.G1861R	ENST00000540549.1	37	c.5581	CCDS47120.1	4	.	.	.	.	.	.	.	.	.	.	G	28.6	4.931368	0.92389	.	.	ENSG00000168769	ENST00000540549;ENST00000513237;ENST00000380013	T;T;T	0.15834	2.39;2.39;2.39	5.33	5.33	0.75918	Methylcytosine dioxygenase TET, double-stranded beta helix fold domain (1);	.	.	.	.	T	0.48390	0.1497	M	0.82323	2.585	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.54125	-0.8340	9	0.87932	D	0	-12.5329	19.031	0.92957	0.0:0.0:1.0:0.0	.	1882;1861	E7EQS8;Q6N021	.;TET2_HUMAN	R	1861;1882;1861	ENSP00000442788:G1861R;ENSP00000425443:G1882R;ENSP00000369351:G1861R	ENSP00000369351:G1861R	G	+	1	0	TET2	106416697	1.000000	0.71417	0.985000	0.45067	0.994000	0.84299	9.204000	0.95041	2.477000	0.83638	0.591000	0.81541	GGA	TET2	-	NULL	ENSG00000168769		0.542	TET2-202	KNOWN	basic|appris_candidate|CCDS	protein_coding	TET2	HGNC	protein_coding	OTTHUMT00000253952.2	-	0.00	30	0	G	NM_017628		106197248	+1	tier1	-	no_errors	ENST00000380013	ensembl	human	known	74_37	missense	36.36	7	4	SNP	1.000	A
TENM3	55714	genome.wustl.edu	37	4	183714437	183714437	+	Silent	SNP	C	C	A			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr4:183714437C>A	ENST00000511685.1	+	26	6735	c.6612C>A	c.(6610-6612)atC>atA	p.I2204I	TENM3_ENST00000406950.2_Silent_p.I2204I			Q9P273	TEN3_HUMAN	teneurin transmembrane protein 3	2204					camera-type eye morphogenesis (GO:0048593)|homophilic cell adhesion (GO:0007156)|positive regulation of neuron projection development (GO:0010976)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cell projection (GO:0042995)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)										GCACGGAAATCTTTGAATATA	0.493																																																	0													98.0	98.0	98.0					4																	183714437		1909	4114	6023	SO:0001819	synonymous_variant	0			AF195420	CCDS47165.1	4q35	2012-10-02	2012-10-02	2012-10-02	ENSG00000218336	ENSG00000218336			29944	protein-coding gene	gene with protein product		610083	"""odz, odd Oz/ten-m homolog 3 (Drosophila)"""	ODZ3		10331952, 10625539	Standard	NM_001080477		Approved	Ten-M3, KIAA1455	uc003ivd.1	Q9P273	OTTHUMG00000160682	ENST00000511685.1:c.6612C>A	4.37:g.183714437C>A			Q5XUL9|Q96SY2|Q9NV77|Q9NVW1|Q9NZJ2	Silent	SNP	pfam_Ten_N,pfam_EGF_extracell,superfamily_CarboxyPept-like_regulatory,superfamily_Cyt_c-like_dom,smart_EG-like_dom,pfscan_EG-like_dom,tigrfam_YD,tigrfam_Rhs_assc_core	p.I2204	ENST00000511685.1	37	c.6612	CCDS47165.1	4																																																																																			TENM3	-	superfamily_Cyt_c-like_dom	ENSG00000218336		0.493	TENM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TENM3	HGNC	protein_coding	OTTHUMT00000361734.1		0.00	67	0	C			183714437	+1			no_errors	ENST00000406950	ensembl	human	known	74_37	silent	5.00	56	3	SNP	1.000	A
TEX14	56155	genome.wustl.edu	37	17	56676583	56676583	+	Nonsense_Mutation	SNP	G	G	C			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr17:56676583G>C	ENST00000240361.8	-	14	2226	c.2141C>G	c.(2140-2142)tCa>tGa	p.S714*	TEX14_ENST00000389934.3_Nonsense_Mutation_p.S708*|TEX14_ENST00000349033.5_Nonsense_Mutation_p.S708*			Q8IWB6	TEX14_HUMAN	testis expressed 14	714					attachment of spindle microtubules to kinetochore (GO:0008608)|intercellular bridge organization (GO:0043063)|male meiosis (GO:0007140)|mitotic sister chromatid separation (GO:0051306)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of cytokinesis (GO:0032466)|negative regulation of protein binding (GO:0032091)	cell (GO:0005623)|cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|kinetochore (GO:0000776)|midbody (GO:0030496)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)			breast(6)|endometrium(5)|kidney(3)|large_intestine(22)|liver(1)|lung(24)|ovary(4)|pancreas(1)|prostate(1)|skin(5)|stomach(5)|upper_aerodigestive_tract(1)|urinary_tract(3)	81	Medulloblastoma(34;0.127)|all_neural(34;0.237)					TTCTCTGGTTGACTCAGGAAG	0.453																																																	0													203.0	193.0	196.0					17																	56676583		2203	4300	6503	SO:0001587	stop_gained	0			AF285601	CCDS32692.1, CCDS32693.1, CCDS56042.1	17q22	2013-09-20	2007-03-13		ENSG00000121101	ENSG00000121101			11737	protein-coding gene	gene with protein product	"""cancer/testis antigen 113"""	605792	"""testis expressed sequence 14"""			11279525, 12711554	Standard	NM_031272		Approved	CT113	uc010dcz.2	Q8IWB6	OTTHUMG00000179245	ENST00000240361.8:c.2141C>G	17.37:g.56676583G>C	ENSP00000240361:p.Ser714*		A6NH19|Q7RTP3|Q8ND97|Q9BXT9	Nonsense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Prot_kinase_dom	p.S714*	ENST00000240361.8	37	c.2141	CCDS56042.1	17	.	.	.	.	.	.	.	.	.	.	G	24.9	4.577970	0.86645	.	.	ENSG00000121101	ENST00000240361;ENST00000389934;ENST00000349033	.	.	.	5.44	1.87	0.25490	.	1.147340	0.06246	N	0.691218	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.38643	T	0.18	0.1347	2.679	0.05088	0.1809:0.1466:0.522:0.1504	.	.	.	.	X	714;708;708	.	ENSP00000240361:S714X	S	-	2	0	TEX14	54031582	0.008000	0.16893	0.010000	0.14722	0.002000	0.02628	1.439000	0.35013	0.664000	0.31047	-0.175000	0.13238	TCA	TEX14	-	NULL	ENSG00000121101		0.453	TEX14-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TEX14	HGNC	protein_coding	OTTHUMT00000445446.1	-	0.00	39	0	G			56676583	-1	tier1	-	no_errors	ENST00000240361	ensembl	human	known	74_37	nonsense	12.28	50	7	SNP	0.000	C
TMEM190	147744	genome.wustl.edu	37	19	55889435	55889435	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr19:55889435G>A	ENST00000291934.3	+	5	416	c.398G>A	c.(397-399)cGa>cAa	p.R133Q	CTD-2105E13.15_ENST00000595064.1_RNA	NM_139172.1	NP_631911.1	Q8WZ59	TM190_HUMAN	transmembrane protein 190	133					hematopoietic progenitor cell differentiation (GO:0002244)	inner acrosomal membrane (GO:0002079)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)		p.R133P(1)		large_intestine(1)|lung(2)|skin(1)|upper_aerodigestive_tract(1)	5	Breast(117;0.191)		BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.044)		TCCAAGCACCGAGGGACCAAG	0.667																																																	1	Substitution - Missense(1)	lung(1)											37.0	34.0	35.0					19																	55889435		2202	4298	6500	SO:0001583	missense	0			AF442729	CCDS33113.1	19q13.42	2011-09-28				ENSG00000160472			29632	protein-coding gene	gene with protein product						21273369	Standard	NM_139172		Approved	MDAC1	uc002qkt.1	Q8WZ59		ENST00000291934.3:c.398G>A	19.37:g.55889435G>A	ENSP00000291934:p.Arg133Gln		A6NJL5	Missense_Mutation	SNP	superfamily_P_trefoil	p.R133Q	ENST00000291934.3	37	c.398	CCDS33113.1	19	.	.	.	.	.	.	.	.	.	.	G	17.99	3.522603	0.64747	.	.	ENSG00000160472	ENST00000291934	.	.	.	2.8	1.76	0.24704	.	0.247197	0.20806	N	0.085339	T	0.20292	0.0488	L	0.27053	0.805	0.09310	N	0.999998	P	0.36065	0.535	B	0.32149	0.141	T	0.14282	-1.0478	9	0.87932	D	0	-12.3116	5.4794	0.16715	0.1615:0.0:0.8385:0.0	.	133	Q8WZ59	TM190_HUMAN	Q	133	.	ENSP00000291934:R133Q	R	+	2	0	TMEM190	60581247	0.001000	0.12720	0.271000	0.24616	0.089000	0.18198	0.079000	0.14782	0.747000	0.32809	0.313000	0.20887	CGA	TMEM190	-	NULL	ENSG00000160472		0.667	TMEM190-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM190	HGNC	protein_coding	OTTHUMT00000453042.1	-	0.00	129	0	G	NM_139172		55889435	+1	tier1	-	no_errors	ENST00000291934	ensembl	human	known	74_37	missense	43.75	63	49	SNP	0.258	A
TMEM2	23670	genome.wustl.edu	37	9	74319524	74319524	+	Missense_Mutation	SNP	C	C	T	rs138339130		TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr9:74319524C>T	ENST00000377044.4	-	18	3720	c.3181G>A	c.(3181-3183)Gtc>Atc	p.V1061I	TMEM2_ENST00000396272.3_Missense_Mutation_p.V54I|TMEM2_ENST00000377066.5_Missense_Mutation_p.V998I	NM_001135820.1|NM_013390.2	NP_001129292.1|NP_037522.1	Q9UHN6	TMEM2_HUMAN	transmembrane protein 2	1061					multicellular organismal development (GO:0007275)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)		p.V1061I(1)		central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(15)|liver(1)|lung(19)|ovary(2)|prostate(5)|skin(1)|stomach(1)|urinary_tract(2)	56		all_epithelial(88;4.56e-14)|Myeloproliferative disorder(762;0.0255)		GBM - Glioblastoma multiforme(74;7.45e-21)|OV - Ovarian serous cystadenocarcinoma(323;1.02e-16)		TTGAAGTTGACGAGGTATAGA	0.428																																																	1	Substitution - Missense(1)	lung(1)						C	ILE/VAL,ILE/VAL	1,4405	2.1+/-5.4	0,1,2202	105.0	98.0	100.0		2992,3181	2.2	1.0	9	dbSNP_134	100	0,8600		0,0,4300	no	missense,missense	TMEM2	NM_001135820.1,NM_013390.2	29,29	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	benign,benign	998/1321,1061/1384	74319524	1,13005	2203	4300	6503	SO:0001583	missense	0				CCDS6638.1, CCDS47979.1	9q21.13	2011-07-19			ENSG00000135048	ENSG00000135048			11869	protein-coding gene	gene with protein product		605835					Standard	NM_013390		Approved		uc011lsa.1	Q9UHN6	OTTHUMG00000020000	ENST00000377044.4:c.3181G>A	9.37:g.74319524C>T	ENSP00000366243:p.Val1061Ile		A6H8W9|B2RTQ6|Q5T838|Q5T839|Q5T840|Q5T841|Q8NBP6|Q9P2D5	Missense_Mutation	SNP	pfam_G8_domain,superfamily_Pectin_lyase_fold/virulence	p.V1061I	ENST00000377044.4	37	c.3181	CCDS6638.1	9	.	.	.	.	.	.	.	.	.	.	C	4.382	0.070415	0.08436	2.27E-4	0.0	ENSG00000135048	ENST00000377044;ENST00000377066;ENST00000396272;ENST00000377055;ENST00000377043	T;T;T;T;T	0.35236	1.32;1.32;1.32;1.32;1.32	5.58	2.18	0.27775	.	0.138874	0.64402	N	0.000007	T	0.07098	0.0180	N	0.00256	-1.76	0.29511	N	0.854227	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.38693	-0.9649	10	0.02654	T	1	.	7.6415	0.28296	0.0:0.2361:0.0:0.7639	.	1061;998	Q9UHN6;Q9UHN6-2	TMEM2_HUMAN;.	I	1061;998;54;90;162	ENSP00000366243:V1061I;ENSP00000366266:V998I;ENSP00000379569:V54I;ENSP00000366254:V90I;ENSP00000366242:V162I	ENSP00000366242:V162I	V	-	1	0	TMEM2	73509344	1.000000	0.71417	0.992000	0.48379	0.890000	0.51754	1.189000	0.32114	0.153000	0.19213	0.561000	0.74099	GTC	TMEM2	-	NULL	ENSG00000135048		0.428	TMEM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM2	HGNC	protein_coding	OTTHUMT00000052618.2		0.00	60	0	C	NM_013390		74319524	-1			no_errors	ENST00000377044	ensembl	human	known	74_37	missense	5.56	51	3	SNP	1.000	T
TMEM202	338949	genome.wustl.edu	37	15	72700132	72700132	+	Silent	SNP	G	G	A	rs140026568		TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr15:72700132G>A	ENST00000341689.3	+	5	774	c.720G>A	c.(718-720)ccG>ccA	p.P240P	TMEM202_ENST00000567679.1_3'UTR	NM_001080462.1	NP_001073931.1	A6NGA9	TM202_HUMAN	transmembrane protein 202	240						integral component of membrane (GO:0016021)				NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|large_intestine(4)|lung(6)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	18						GGGTTGGTCCGGTGACTACAG	0.468													A|||	1	0.000199681	0.0008	0.0	5008	,	,		18184	0.0		0.0	False		,,,				2504	0.0																0								A		5,4393	825.1+/-416.5	0,5,2194	87.0	82.0	83.0		720	-1.3	0.6	15	dbSNP_134	83	2,8592	818.9+/-406.8	0,2,4295	no	coding-synonymous	TMEM202	NM_001080462.1		0,7,6489	AA,AG,GG		0.0233,0.1137,0.0539		240/274	72700132	7,12985	2199	4297	6496	SO:0001819	synonymous_variant	0				CCDS32287.1	15q24.1	2007-12-18				ENSG00000187806			33733	protein-coding gene	gene with protein product							Standard	NM_001080462		Approved	FLJ27523	uc002auq.3	A6NGA9		ENST00000341689.3:c.720G>A	15.37:g.72700132G>A				Silent	SNP	NULL	p.P240	ENST00000341689.3	37	c.720	CCDS32287.1	15																																																																																			TMEM202	-	NULL	ENSG00000187806		0.468	TMEM202-003	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	TMEM202	HGNC	protein_coding	OTTHUMT00000435756.1	-	0.00	114	0	G	NM_001080462		72700132	+1	tier1	rs140026568	no_errors	ENST00000341689	ensembl	human	known	74_37	silent	44.70	73	59	SNP	0.301	A
TNFRSF12A	51330	genome.wustl.edu	37	16	3070514	3070514	+	Intron	SNP	G	G	T			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr16:3070514G>T	ENST00000326577.4	+	1	180				TNFRSF12A_ENST00000573001.1_Intron|CLDN6_ENST00000572154.1_5'Flank|CLDN6_ENST00000396925.1_5'Flank|CLDN6_ENST00000328796.4_5'Flank|TNFRSF12A_ENST00000575124.1_Missense_Mutation_p.G39V|TNFRSF12A_ENST00000341627.5_Intron	NM_016639.2	NP_057723.1	Q9NP84	TNR12_HUMAN	tumor necrosis factor receptor superfamily, member 12A						angiogenesis (GO:0001525)|extrinsic apoptotic signaling pathway (GO:0097191)|positive regulation of apoptotic process (GO:0043065)|positive regulation of axon extension (GO:0045773)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|regulation of angiogenesis (GO:0045765)|regulation of wound healing (GO:0061041)|substrate-dependent cell migration, cell attachment to substrate (GO:0006931)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|ruffle (GO:0001726)				lung(1)|skin(1)	2						TCCGGGGTCGGGGAACCCCGG	0.726																																																	0													4.0	5.0	5.0					16																	3070514		1757	3682	5439	SO:0001627	intron_variant	0			AB035480	CCDS10489.1	16p13.3	2008-02-05			ENSG00000006327	ENSG00000006327		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	18152	protein-coding gene	gene with protein product		605914				10751351, 10551889	Standard	NM_016639		Approved	FN14, TweakR, CD266	uc002csv.4	Q9NP84	OTTHUMG00000129001	ENST00000326577.4:c.94+22G>T	16.37:g.3070514G>T			D3DUA6|Q9HCS0	Missense_Mutation	SNP	NULL	p.G39V	ENST00000326577.4	37	c.116	CCDS10489.1	16																																																																																			TNFRSF12A	-	NULL	ENSG00000006327		0.726	TNFRSF12A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNFRSF12A	HGNC	protein_coding	OTTHUMT00000250990.1	-	0.00	111	0	G			3070514	+1	tier1	-	no_errors	ENST00000575124	ensembl	human	putative	74_37	missense	7.55	49	4	SNP	0.000	T
TNPO2	30000	genome.wustl.edu	37	19	12822221	12822221	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr19:12822221G>A	ENST00000592287.1	-	11	1114	c.1006C>T	c.(1006-1008)Cgc>Tgc	p.R336C	TNPO2_ENST00000441499.1_Missense_Mutation_p.R336C|TNPO2_ENST00000356861.5_Missense_Mutation_p.R336C|TNPO2_ENST00000450764.2_Missense_Mutation_p.R336C|TNPO2_ENST00000589956.1_5'UTR|TNPO2_ENST00000425528.1_Missense_Mutation_p.R336C|TNPO2_ENST00000588216.1_Missense_Mutation_p.R336C	NM_001136196.1	NP_001129668.1	O14787	TNPO2_HUMAN	transportin 2	336					intracellular protein transport (GO:0006886)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	nuclear localization sequence binding (GO:0008139)	p.R336C(1)		autonomic_ganglia(1)|breast(2)|endometrium(5)|kidney(2)|large_intestine(2)|lung(12)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	28						TTGTGGAAGCGTGGCTTGATG	0.617																																																	1	Substitution - Missense(1)	large_intestine(1)											158.0	168.0	165.0					19																	12822221		2200	4291	6491	SO:0001583	missense	0			AF019039	CCDS45991.1, CCDS45992.1	19p13.13	2009-01-12	2009-01-12			ENSG00000105576		"""Importins"""	19998	protein-coding gene	gene with protein product	"""importin 3"", ""karyopherin beta 2b"""	603002				9298975, 12384575	Standard	NM_013433		Approved	IPO3, KPNB2B, FLJ12155, TRN2	uc002muo.3	O14787		ENST00000592287.1:c.1006C>T	19.37:g.12822221G>A	ENSP00000468434:p.Arg336Cys		O14655|Q6IN77	Missense_Mutation	SNP	pfam_HEAT,pfam_Importin-beta_N,superfamily_ARM-type_fold,smart_Importin-beta_N	p.R336C	ENST00000592287.1	37	c.1006	CCDS45991.1	19	.	.	.	.	.	.	.	.	.	.	G	26.2	4.719223	0.89205	.	.	ENSG00000105576	ENST00000536114;ENST00000425528;ENST00000441499;ENST00000450764;ENST00000356861;ENST00000420511;ENST00000546320	T;T;T;T	0.67698	-0.28;-0.28;-0.28;-0.28	5.44	4.37	0.52481	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.85248	0.5653	M	0.93150	3.385	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.72075	0.976;0.951	D	0.88924	0.3368	10	0.87932	D	0	-3.8122	14.4799	0.67573	0.0:0.0:0.8524:0.1476	.	500;336	Q4LE60;O14787	.;TNPO2_HUMAN	C	500;336;336;336;336;336;336	ENSP00000407182:R336C;ENSP00000389648:R336C;ENSP00000397379:R336C;ENSP00000349321:R336C	ENSP00000349321:R336C	R	-	1	0	TNPO2	12683221	1.000000	0.71417	0.991000	0.47740	0.920000	0.55202	7.621000	0.83083	2.556000	0.86216	0.561000	0.74099	CGC	TNPO2	-	superfamily_ARM-type_fold	ENSG00000105576		0.617	TNPO2-002	KNOWN	basic|CCDS	protein_coding	TNPO2	HGNC	protein_coding	OTTHUMT00000450785.1		0.00	62	0	G	NM_013433		12822221	-1			no_errors	ENST00000425528	ensembl	human	known	74_37	missense	5.00	57	3	SNP	0.995	A
TNRC6C	57690	genome.wustl.edu	37	17	76082657	76082657	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr17:76082657A>G	ENST00000588061.1	+	14	4278	c.3551A>G	c.(3550-3552)cAg>cGg	p.Q1184R	TNRC6C_ENST00000541771.1_Missense_Mutation_p.Q1184R|TNRC6C_ENST00000544502.1_Missense_Mutation_p.Q1181R|TNRC6C_ENST00000588847.1_Missense_Mutation_p.Q1181R|TNRC6C_ENST00000301624.4_Missense_Mutation_p.Q1184R|TNRC6C_ENST00000335749.4_Missense_Mutation_p.Q1181R			Q9HCJ0	TNR6C_HUMAN	trinucleotide repeat containing 6C	1184					embryonic hemopoiesis (GO:0035162)|endoderm formation (GO:0001706)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|regulation of gene silencing by miRNA (GO:0060964)	cytosol (GO:0005829)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(9)|lung(16)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	40			BRCA - Breast invasive adenocarcinoma(99;0.00269)|Lung(188;0.0973)			ATGAGACAACAGGAGCAGCAA	0.413																																																	0													82.0	83.0	82.0					17																	76082657		2012	4192	6204	SO:0001583	missense	0			AL834429	CCDS45798.1, CCDS45799.1	17q25.3	2012-10-04			ENSG00000078687	ENSG00000078687		"""Trinucleotide (CAG) repeat containing"""	29318	protein-coding gene	gene with protein product		610741					Standard	NM_018996		Approved	KIAA1582, FLJ20015	uc002juf.2	Q9HCJ0	OTTHUMG00000132642	ENST00000588061.1:c.3551A>G	17.37:g.76082657A>G	ENSP00000468647:p.Gln1184Arg		G3XAB8|Q86UE5|Q8N3D8|Q96MU9	Missense_Mutation	SNP	pfam_Argonaute_hook_dom,pfam_UBA/Ts_N,superfamily_UBA-like,smart_UBA/transl_elong_EF1B_N_euk,pfscan_UBA/transl_elong_EF1B_N_euk	p.Q1181R	ENST00000588061.1	37	c.3542	CCDS45798.1	17	.	.	.	.	.	.	.	.	.	.	A	29.4	5.001513	0.93227	.	.	ENSG00000078687	ENST00000455761;ENST00000395801;ENST00000335749;ENST00000301624;ENST00000541771;ENST00000544502	T;T;T;T	0.19394	2.15;2.16;2.16;2.15	5.4	5.4	0.78164	.	0.172411	0.53938	D	0.000058	T	0.43656	0.1257	M	0.72118	2.19	0.80722	D	1	D;D	0.67145	0.991;0.996	P;D	0.66084	0.805;0.941	T	0.21211	-1.0252	10	0.33141	T	0.24	-8.0742	15.583	0.76459	1.0:0.0:0.0:0.0	.	1181;1184	G3XAB8;Q9HCJ0	.;TNR6C_HUMAN	R	1184;1181;1181;1184;1184;1181	ENSP00000336783:Q1181R;ENSP00000301624:Q1184R;ENSP00000440310:Q1184R;ENSP00000442421:Q1181R	ENSP00000301624:Q1184R	Q	+	2	0	TNRC6C	73594252	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.551000	0.90678	2.270000	0.75569	0.533000	0.62120	CAG	TNRC6C	-	NULL	ENSG00000078687		0.413	TNRC6C-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	TNRC6C	HGNC	protein_coding	OTTHUMT00000395947.1		0.00	74	0	A	NM_018996		76082657	+1			no_errors	ENST00000335749	ensembl	human	known	74_37	missense	5.71	66	4	SNP	1.000	G
TOMM7	54543	genome.wustl.edu	37	7	22852721	22852721	+	3'UTR	SNP	C	C	G			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr7:22852721C>G	ENST00000358435.4	-	0	307				TOMM7_ENST00000405021.3_3'UTR|TOMM7_ENST00000463284.1_5'UTR|TOMM7_ENST00000372879.4_Missense_Mutation_p.G125R	NM_019059.2	NP_061932.1	Q9P0U1	TOM7_HUMAN	translocase of outer mitochondrial membrane 7 homolog (yeast)						cellular protein metabolic process (GO:0044267)|protein import into mitochondrial matrix (GO:0030150)|protein targeting to mitochondrion (GO:0006626)	integral component of membrane (GO:0016021)|mitochondrial outer membrane translocase complex (GO:0005742)|mitochondrion (GO:0005739)	protein transmembrane transporter activity (GO:0008320)			skin(1)	1						ATCTCTTATCCGAGCCAGAGC	0.443																																																	0													56.0	45.0	48.0					7																	22852721		692	1591	2283	SO:0001624	3_prime_UTR_variant	0			AF150733	CCDS5376.1	7p15.3	2003-07-21			ENSG00000196683	ENSG00000196683			21648	protein-coding gene	gene with protein product		607980				10647823, 12198123	Standard	NM_019059		Approved		uc003svk.4	Q9P0U1	OTTHUMG00000094805	ENST00000358435.4:c.*68G>C	7.37:g.22852721C>G			O95939	Missense_Mutation	SNP	pfam_Tom7	p.G125R	ENST00000358435.4	37	c.373	CCDS5376.1	7	.	.	.	.	.	.	.	.	.	.	C	11.97	1.797485	0.31777	.	.	ENSG00000196683	ENST00000372879	.	.	.	5.51	3.64	0.41730	.	.	.	.	.	T	0.44993	0.1320	.	.	.	0.20074	N	0.999935	.	.	.	.	.	.	T	0.36672	-0.9738	5	0.87932	D	0	-13.4251	9.1123	0.36734	0.1671:0.672:0.1609:0.0	.	.	.	.	R	125	.	ENSP00000361970:G125R	G	-	1	0	TOMM7	22819246	0.004000	0.15560	0.608000	0.28969	0.004000	0.04260	0.283000	0.18846	0.757000	0.33036	-0.282000	0.10007	GGA	TOMM7	-	NULL	ENSG00000196683		0.443	TOMM7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TOMM7	HGNC	protein_coding	OTTHUMT00000211623.1	-	0.00	58	0	C	NM_019059		22852721	-1	tier1	-	no_errors	ENST00000372879	ensembl	human	putative	74_37	missense	39.53	26	17	SNP	0.751	G
TP53	7157	genome.wustl.edu	37	17	7578407	7578407	+	Missense_Mutation	SNP	G	G	C	rs138729528		TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr17:7578407G>C	ENST00000269305.4	-	5	712	c.523C>G	c.(523-525)Cgc>Ggc	p.R175G	TP53_ENST00000445888.2_Missense_Mutation_p.R175G|TP53_ENST00000574684.1_5'UTR|TP53_ENST00000413465.2_Missense_Mutation_p.R175G|TP53_ENST00000455263.2_Missense_Mutation_p.R175G|TP53_ENST00000420246.2_Missense_Mutation_p.R175G|TP53_ENST00000359597.4_Missense_Mutation_p.R175G	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	175	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		R -> C (in sporadic cancers; somatic mutation).|R -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> H (in LFS; germline mutation and in sporadic cancers; somatic mutation; does not induce SNAI1 degradation; reduces interaction with ZNF385A; dbSNP:rs28934578). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:1868473, ECO:0000269|PubMed:7887414, ECO:0000269|PubMed:8825920}.|R -> L (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in a sporadic cancer; somatic mutation).|R -> S (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R175G(20)|p.R175C(19)|p.0?(8)|p.R175S(5)|p.R43G(3)|p.R174fs*24(3)|p.R82G(3)|p.R175_E180delRCPHHE(3)|p.R43C(2)|p.V173fs*59(2)|p.R174fs*1(2)|p.R82C(2)|p.V157_C176del20(1)|p.V173fs*69(1)|p.E171fs*61(1)|p.V173fs*23(1)|p.R174_H178>S(1)|p.V172_E180delVVRRCPHHE(1)|p.R174_H179delRRCPHH(1)|p.E171fs*1(1)|p.R175_H178>X(1)|p.R175fs*5(1)|p.R175fs*6(1)|p.R42fs*24(1)|p.R174_C176delRRC(1)|p.H168fs*69(1)|p.R175fs*72(1)|p.R174fs*70(1)|p.E171_H179delEVVRRCPHH(1)|p.R81fs*24(1)|p.S149fs*72(1)|p.R174_E180>K(1)|p.R174fs*3(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TGGGGGCAGCGCCTCACAACC	0.657		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	93	Substitution - Missense(54)|Deletion - Frameshift(19)|Deletion - In frame(8)|Whole gene deletion(8)|Complex - deletion inframe(3)|Insertion - Frameshift(1)	large_intestine(25)|lung(19)|breast(11)|upper_aerodigestive_tract(8)|oesophagus(7)|central_nervous_system(4)|haematopoietic_and_lymphoid_tissue(4)|liver(4)|bone(4)|stomach(2)|salivary_gland(2)|urinary_tract(2)|cervix(1)	GRCh37	CM011013	TP53	M	rs138729528						50.0	50.0	50.0					17																	7578407		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.523C>G	17.37:g.7578407G>C	ENSP00000269305:p.Arg175Gly		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.R175G	ENST00000269305.4	37	c.523	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	G	18.19	3.570086	0.65765	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99891	-7.56;-7.56;-7.56;-7.56;-7.56;-7.56;-7.56;-7.56	5.41	2.14	0.27477	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.101149	0.64402	D	0.000008	D	0.99862	0.9935	M	0.92784	3.345	0.58432	D	0.999991	D;D;D;D;D;D;D	0.89917	1.0;0.998;1.0;1.0;0.999;0.997;1.0	D;D;D;D;D;D;D	0.97110	1.0;0.987;1.0;0.999;0.992;0.975;1.0	D	0.98196	1.0465	10	0.87932	D	0	-11.8679	4.599	0.12343	0.171:0.0:0.5642:0.2648	.	136;175;175;82;175;175;175	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	G	175;175;175;175;175;175;164;82;43;82;43	ENSP00000410739:R175G;ENSP00000352610:R175G;ENSP00000269305:R175G;ENSP00000398846:R175G;ENSP00000391127:R175G;ENSP00000391478:R175G;ENSP00000425104:R43G;ENSP00000423862:R82G	ENSP00000269305:R175G	R	-	1	0	TP53	7519132	1.000000	0.71417	0.786000	0.31890	0.745000	0.42441	4.630000	0.61297	0.778000	0.33520	-0.140000	0.14226	CGC	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor	ENSG00000141510		0.657	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	-	0.00	45	0	G	NM_000546		7578407	-1	tier1	rs138729528	no_errors	ENST00000269305	ensembl	human	known	74_37	missense	35.90	25	14	SNP	0.997	C
TP53	7157	genome.wustl.edu	37	17	7579359	7579359	+	Missense_Mutation	SNP	G	G	A	rs587781371|rs587780066		TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr17:7579359G>A	ENST00000269305.4	-	4	517	c.328C>T	c.(328-330)Cgt>Tgt	p.R110C	TP53_ENST00000445888.2_Missense_Mutation_p.R110C|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000413465.2_Missense_Mutation_p.R110C|TP53_ENST00000455263.2_Missense_Mutation_p.R110C|TP53_ENST00000420246.2_Missense_Mutation_p.R110C|TP53_ENST00000359597.4_Missense_Mutation_p.R110C	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	110	Interaction with HIPK1. {ECO:0000250}.|Interaction with WWOX.|Required for interaction with ZNF385A.		R -> C (in sporadic cancers; somatic mutation).|R -> G (in a sporadic cancer; somatic mutation).|R -> H (in sporadic cancers; somatic mutation).|R -> L (in a familial cancer not matching LFS; germline mutation and in sporadic cancers; somatic mutation; does not induce SNAI1 degradation).|R -> P (in sporadic cancers; somatic mutation; dbSNP:rs11540654). {ECO:0000269|PubMed:17224074}.|R -> S (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R110fs*13(9)|p.0?(8)|p.R110C(7)|p.G59fs*23(3)|p.F109_R110delFR(2)|p.V73fs*9(1)|p.F109_R110insXX(1)|p.G105_T125del21(1)|p.R110fs*18(1)|p.Y107fs*44(1)|p.R110fs*39(1)|p.Y103_G112>C(1)|p.R110S(1)|p.P13fs*18(1)|p.S33fs*23(1)|p.Y107fs*38(1)|p.Y103_L111>L(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	AAGCCCAGACGGAAACCGTAG	0.607		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	41	Deletion - Frameshift(17)|Whole gene deletion(8)|Substitution - Missense(8)|Deletion - In frame(3)|Insertion - Frameshift(2)|Complex - deletion inframe(2)|Insertion - In frame(1)	breast(11)|upper_aerodigestive_tract(4)|bone(4)|large_intestine(3)|lung(3)|NS(3)|prostate(3)|central_nervous_system(2)|liver(2)|skin(2)|stomach(1)|haematopoietic_and_lymphoid_tissue(1)|salivary_gland(1)|oesophagus(1)											62.0	59.0	60.0					17																	7579359		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.328C>T	17.37:g.7579359G>A	ENSP00000269305:p.Arg110Cys		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.R110C	ENST00000269305.4	37	c.328	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	G	11.15	1.554385	0.27739	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000508793;ENST00000503591	D;D;D;D;D;D;D;D	0.99773	-6.72;-6.72;-6.72;-6.72;-6.72;-6.72;-6.72;-6.72	4.75	0.0479	0.14282	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.808524	0.11806	N	0.527643	D	0.99330	0.9765	L	0.52759	1.655	0.24591	N	0.993824	D;B;B;D;B;B;D	0.89917	1.0;0.205;0.032;0.996;0.05;0.021;0.999	D;B;B;P;B;B;P	0.64877	0.93;0.086;0.024;0.766;0.061;0.041;0.861	D	0.98545	1.0634	10	0.87932	D	0	-0.2466	3.1911	0.06618	0.0868:0.1448:0.3246:0.4438	.	71;110;110;110;110;110;110	B4E095;E7EMR6;P04637-2;P04637-3;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	C	110	ENSP00000410739:R110C;ENSP00000352610:R110C;ENSP00000269305:R110C;ENSP00000398846:R110C;ENSP00000391127:R110C;ENSP00000391478:R110C;ENSP00000424104:R110C;ENSP00000426252:R110C	ENSP00000269305:R110C	R	-	1	0	TP53	7520084	0.045000	0.20229	0.111000	0.21465	0.951000	0.60555	0.025000	0.13577	-0.013000	0.14199	0.655000	0.94253	CGT	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd	ENSG00000141510		0.607	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	-	0.00	153	0	G	NM_000546		7579359	-1	tier1	-	no_errors	ENST00000269305	ensembl	human	known	74_37	missense	53.14	82	93	SNP	0.028	A
TOP2A	7153	genome.wustl.edu	37	17	38546381	38546381	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr17:38546381T>C	ENST00000423485.1	-	34	4461	c.4303A>G	c.(4303-4305)Agg>Ggg	p.R1435G	Y_RNA_ENST00000410949.1_RNA	NM_001067.3	NP_001058.2	P11388	TOP2A_HUMAN	topoisomerase (DNA) II alpha 170kDa	1435					apoptotic chromosome condensation (GO:0030263)|ATP catabolic process (GO:0006200)|cellular response to DNA damage stimulus (GO:0006974)|chromosome segregation (GO:0007059)|DNA ligation (GO:0006266)|DNA topological change (GO:0006265)|DNA unwinding involved in DNA replication (GO:0006268)|embryonic cleavage (GO:0040016)|hematopoietic progenitor cell differentiation (GO:0002244)|mitotic cell cycle (GO:0000278)|mitotic DNA integrity checkpoint (GO:0044774)|mitotic recombination (GO:0006312)|positive regulation of apoptotic process (GO:0043065)|positive regulation of single stranded viral RNA replication via double stranded DNA intermediate (GO:0045870)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of viral genome replication (GO:0045070)|resolution of meiotic recombination intermediates (GO:0000712)|sister chromatid segregation (GO:0000819)	condensed chromosome (GO:0000793)|cytoplasm (GO:0005737)|DNA topoisomerase complex (ATP-hydrolyzing) (GO:0009330)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA binding, bending (GO:0008301)|DNA topoisomerase type II (ATP-hydrolyzing) activity (GO:0003918)|DNA-dependent ATPase activity (GO:0008094)|drug binding (GO:0008144)|enzyme binding (GO:0019899)|histone deacetylase binding (GO:0042826)|magnesium ion binding (GO:0000287)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase C binding (GO:0005080)|ubiquitin binding (GO:0043130)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(9)|ovary(5)|pancreas(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)	39		Breast(137;0.00328)	STAD - Stomach adenocarcinoma(5;0.00183)		Amsacrine(DB00276)|Ciprofloxacin(DB00537)|Dactinomycin(DB00970)|Daunorubicin(DB00694)|Dexrazoxane(DB00380)|Doxorubicin(DB00997)|Enoxacin(DB00467)|Epirubicin(DB00445)|Etoposide(DB00773)|Fleroxacin(DB04576)|Idarubicin(DB01177)|Levofloxacin(DB01137)|Lomefloxacin(DB00978)|Lucanthone(DB04967)|Mitoxantrone(DB01204)|Moxifloxacin(DB00218)|Norfloxacin(DB01059)|Ofloxacin(DB01165)|Pefloxacin(DB00487)|Podofilox(DB01179)|Sparfloxacin(DB01208)|Teniposide(DB00444)|Trovafloxacin(DB00685)|Valrubicin(DB00385)	GGGGCAGCCCTTTTTTTGGCA	0.478																																																	0													60.0	54.0	56.0					17																	38546381		1865	4106	5971	SO:0001583	missense	0				CCDS45672.1	17q21-q22	2008-08-06	2002-08-29		ENSG00000131747	ENSG00000131747	5.99.1.2		11989	protein-coding gene	gene with protein product		126430	"""topoisomerase (DNA) II alpha (170kD)"""	TOP2			Standard	NM_001067		Approved		uc002huq.3	P11388	OTTHUMG00000155008	ENST00000423485.1:c.4303A>G	17.37:g.38546381T>C	ENSP00000411532:p.Arg1435Gly		B2RTS1|Q71UN1|Q71UQ5|Q9HB24|Q9HB25|Q9HB26|Q9UP44|Q9UQP9	Missense_Mutation	SNP	pfam_Topo_IIA_A/C,pfam_Topo_IIA_bsu_dom2,pfam_DTHCT,pfam_HATPase_ATP-bd,superfamily_Topo_IIA_like_dom,superfamily_HATPase_ATP-bd,superfamily_Ribosomal_S5_D2-typ_fold,smart_Topo_IIA,smart_Topo_IIA_A/C,prints_TopoII_euk,prints_Topo_IIA,prints_Transcrpt_fac_NFYB/HAP3	p.R1435G	ENST00000423485.1	37	c.4303	CCDS45672.1	17	.	.	.	.	.	.	.	.	.	.	T	8.262	0.811371	0.16537	.	.	ENSG00000131747	ENST00000423485;ENST00000269577;ENST00000348049;ENST00000357601	T	0.52754	0.65	5.35	1.81	0.25067	DTHCT (1);	0.179132	0.64402	D	0.000017	T	0.31670	0.0804	L	0.36672	1.1	0.27155	N	0.961306	B	0.22604	0.072	B	0.26202	0.067	T	0.14727	-1.0462	10	0.23302	T	0.38	.	5.2131	0.15329	0.0:0.1596:0.152:0.6884	.	1435	P11388	TOP2A_HUMAN	G	1435;1515;1458;1472	ENSP00000411532:R1435G	ENSP00000269577:R1515G	R	-	1	2	TOP2A	35799907	1.000000	0.71417	0.998000	0.56505	0.042000	0.13812	1.320000	0.33666	0.384000	0.24942	0.482000	0.46254	AGG	TOP2A	-	pfam_DTHCT	ENSG00000131747		0.478	TOP2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TOP2A	HGNC	protein_coding	OTTHUMT00000338035.1	-	0.00	104	0	T			38546381	-1	tier1	-	no_errors	ENST00000423485	ensembl	human	known	74_37	missense	5.26	88	5	SNP	0.997	C
TRIM67	440730	genome.wustl.edu	37	1	231344888	231344888	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr1:231344888G>A	ENST00000366653.5	+	8	2015	c.2015G>A	c.(2014-2016)aGg>aAg	p.R672K	TRIM67_ENST00000449018.3_Missense_Mutation_p.R610K|TRIM67_ENST00000444294.3_Missense_Mutation_p.R670K|TRIM67_ENST00000366652.2_Missense_Mutation_p.R672K			Q6ZTA4	TRI67_HUMAN	tripartite motif containing 67	672	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of neuron projection development (GO:0010976)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	zinc ion binding (GO:0008270)	p.R672M(2)		breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(10)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	29	Breast(184;0.0871)	all_cancers(173;0.189)|Prostate(94;0.167)				GGGGTGGCCAGGGCCAGCGTG	0.627																																																	2	Substitution - Missense(2)	lung(2)											84.0	93.0	90.0					1																	231344888		2194	4297	6491	SO:0001583	missense	0			AK126782	CCDS44333.1, CCDS73048.1	1q42.2	2014-02-17	2011-01-25		ENSG00000119283	ENSG00000119283		"""Tripartite motif containing / Tripartite motif containing"", ""Fibronectin type III domain containing"", ""RING-type (C3HC4) zinc fingers"""	31859	protein-coding gene	gene with protein product		610584	"""tripartite motif-containing 67"""				Standard	NM_001004342		Approved	TNL	uc009xfn.1	Q6ZTA4	OTTHUMG00000037958	ENST00000366653.5:c.2015G>A	1.37:g.231344888G>A	ENSP00000355613:p.Arg672Lys		Q5TER7|Q5TER8|Q7Z4K7	Missense_Mutation	SNP	pfam_SPRY_rcpt,pfam_Znf_B-box,pfam_Fibronectin_type3,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_Znf_RING,smart_Znf_B-box,smart_Bbox_C,smart_Fibronectin_type3,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Fibronectin_type3,pfscan_Znf_B-box	p.R672K	ENST00000366653.5	37	c.2015	CCDS44333.1	1	.	.	.	.	.	.	.	.	.	.	G	36	5.654860	0.96724	.	.	ENSG00000119283	ENST00000444294;ENST00000366652;ENST00000449018;ENST00000366653	T;T;T;T	0.69926	-0.44;-0.44;-0.44;-0.44	5.73	5.73	0.89815	Concanavalin A-like lectin/glucanase (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	0.000000	0.85682	D	0.000000	T	0.70937	0.3281	M	0.71581	2.175	0.80722	D	1	P	0.38250	0.624	B	0.40329	0.326	T	0.68530	-0.5384	10	0.33141	T	0.24	.	20.2699	0.98469	0.0:0.0:1.0:0.0	.	672	Q6ZTA4	TRI67_HUMAN	K	670;672;610;672	ENSP00000412124:R670K;ENSP00000355612:R672K;ENSP00000400163:R610K;ENSP00000355613:R672K	ENSP00000355612:R672K	R	+	2	0	TRIM67	229411511	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.760000	0.98935	2.854000	0.98071	0.655000	0.94253	AGG	TRIM67	-	pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl_sf,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY	ENSG00000119283		0.627	TRIM67-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	TRIM67	HGNC	protein_coding	OTTHUMT00000092649.3		0.00	35	0	G	NM_001004342		231344888	+1			no_errors	ENST00000366652	ensembl	human	known	74_37	missense	5.26	54	3	SNP	1.000	A
TRMT6	51605	genome.wustl.edu	37	20	5922605	5922605	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr20:5922605G>T	ENST00000203001.2	-	8	1234	c.1104C>A	c.(1102-1104)aaC>aaA	p.N368K	TRMT6_ENST00000473131.1_5'UTR|TRMT6_ENST00000453074.2_Missense_Mutation_p.N198K	NM_015939.3	NP_057023.2	Q9UJA5	TRM6_HUMAN	tRNA methyltransferase 6 homolog (S. cerevisiae)	368					regulation of translational initiation (GO:0006446)|tRNA processing (GO:0008033)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|translation initiation factor activity (GO:0003743)	p.N368N(1)		breast(2)|endometrium(4)|kidney(1)|large_intestine(2)|lung(5)|pancreas(1)	15						ACCCATCTGCGTTTCTTTCAC	0.453																																																	1	Substitution - coding silent(1)	large_intestine(1)											235.0	226.0	229.0					20																	5922605		2203	4300	6503	SO:0001583	missense	0			AK000613	CCDS13093.1, CCDS63225.1	20p12.3	2009-01-12			ENSG00000089195	ENSG00000089195			20900	protein-coding gene	gene with protein product						16043508	Standard	NM_001281467		Approved	GCD10, MGC5029, Gcd10p, CGI-09	uc002wmh.1	Q9UJA5	OTTHUMG00000031816	ENST00000203001.2:c.1104C>A	20.37:g.5922605G>T	ENSP00000203001:p.Asn368Lys		B4DUV6|Q76P92|Q9BQV5|Q9ULR7|Q9Y2Z8	Missense_Mutation	SNP	pfam_EIF3_gamma,pirsf_tRNA_m1A_mtfrase	p.N368K	ENST00000203001.2	37	c.1104	CCDS13093.1	20	.	.	.	.	.	.	.	.	.	.	G	17.14	3.312671	0.60414	.	.	ENSG00000089195	ENST00000203001;ENST00000453074	T;T	0.21932	2.0;1.98	6.17	-10.3	0.00346	.	0.000000	0.85682	D	0.000000	T	0.23611	0.0571	L	0.28649	0.875	0.51012	D	0.999902	D	0.89917	1.0	D	0.77557	0.99	T	0.71909	-0.4450	10	0.07813	T	0.8	-26.5267	20.2849	0.98532	0.825:0.0:0.175:0.0	.	368	Q9UJA5	TRM6_HUMAN	K	368;198	ENSP00000203001:N368K;ENSP00000392070:N198K	ENSP00000203001:N368K	N	-	3	2	TRMT6	5870605	0.595000	0.26857	0.533000	0.28001	0.606000	0.37113	-0.090000	0.11163	-1.836000	0.01190	-1.623000	0.00790	AAC	TRMT6	-	pirsf_tRNA_m1A_mtfrase	ENSG00000089195		0.453	TRMT6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRMT6	HGNC	protein_coding	OTTHUMT00000077889.2	-	0.00	32	0	G			5922605	-1	tier1	-	no_errors	ENST00000203001	ensembl	human	known	74_37	missense	8.33	44	4	SNP	0.417	T
TRMU	55687	genome.wustl.edu	37	22	46748166	46748166	+	Silent	SNP	G	G	A			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr22:46748166G>A	ENST00000290846.4	+	7	1051	c.711G>A	c.(709-711)ctG>ctA	p.L237L	TRMU_ENST00000424260.2_3'UTR|TRMU_ENST00000381019.3_Silent_p.L237L	NM_018006.4	NP_060476.2	O75648	MTU1_HUMAN	tRNA 5-methylaminomethyl-2-thiouridylate methyltransferase	237					tRNA processing (GO:0008033)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|sulfurtransferase activity (GO:0016783)|tRNA binding (GO:0000049)			NS(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(2)|ovary(1)	10		Ovarian(80;0.00965)|Breast(42;0.0194)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00449)|LUAD - Lung adenocarcinoma(64;0.248)		TCCAGTATCTGCAGCCTCGAC	0.493																																																	0													215.0	214.0	214.0					22																	46748166		2203	4300	6503	SO:0001819	synonymous_variant	0			AY062123	CCDS14075.1, CCDS63510.1	22q13	2005-08-11	2005-08-11	2005-08-11	ENSG00000100416	ENSG00000100416	2.1.1.61		25481	protein-coding gene	gene with protein product		610230	"""tRNA (5-methylaminomethyl-2-thiouridylate)-methyltransferase """	TRMT		14746906	Standard	XM_005261678		Approved	FLJ10140, MTO2	uc003bhp.3	O75648	OTTHUMG00000150424	ENST00000290846.4:c.711G>A	22.37:g.46748166G>A			A8K3U7|Q05C99|Q5W9C8|Q66K31|Q6ICC3|Q9NWC1	Silent	SNP	pfam_tRNA-specific_2-thiouridylase,pfam_ThiI_C_dom,pfam_NAD/GMP_synthase,tigrfam_tRNA-specific_2-thiouridylase	p.L237	ENST00000290846.4	37	c.711	CCDS14075.1	22																																																																																			TRMU	-	pfam_tRNA-specific_2-thiouridylase,tigrfam_tRNA-specific_2-thiouridylase	ENSG00000100416		0.493	TRMU-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRMU	HGNC	protein_coding	OTTHUMT00000318042.2		0.00	46	0	G	NM_018006		46748166	+1			no_errors	ENST00000290846	ensembl	human	known	74_37	silent	8.51	43	4	SNP	0.999	A
TTN	7273	genome.wustl.edu	37	2	179664274	179664274	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr2:179664274G>C	ENST00000591111.1	-	6	1078	c.854C>G	c.(853-855)cCc>cGc	p.P285R	TTN_ENST00000342992.6_Missense_Mutation_p.P285R|TTN_ENST00000589042.1_Missense_Mutation_p.P285R|TTN_ENST00000342175.6_Missense_Mutation_p.P285R|TTN_ENST00000359218.5_Missense_Mutation_p.P285R|TTN_ENST00000360870.5_Missense_Mutation_p.P285R|TTN_ENST00000460472.2_Missense_Mutation_p.P285R			Q8WZ42	TITIN_HUMAN	titin	0	ZIS1.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GTGTCTTATGGGCGATGGGGA	0.562																																																	0													86.0	84.0	85.0					2																	179664274		2203	4300	6503	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.854C>G	2.37:g.179664274G>C	ENSP00000465570:p.Pro285Arg		A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.P285R	ENST00000591111.1	37	c.854		2	.	.	.	.	.	.	.	.	.	.	G	18.07	3.542763	0.65198	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127;ENST00000360870	D;D;D;D;D	0.84223	-1.58;-1.55;-1.56;-1.58;-1.82	5.86	5.86	0.93980	.	.	.	.	.	D	0.91626	0.7354	L	0.56769	1.78	0.48288	D	0.999627	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	0.998;0.998;0.998;0.998;1.0	D	0.91610	0.5302	9	0.87932	D	0	.	20.1828	0.98210	0.0:0.0:1.0:0.0	.	285;285;285;285;285	D3DPF9;E7EQE6;E7ET18;Q8WZ42;Q8WZ42-6	.;.;.;TITIN_HUMAN;.	R	285	ENSP00000343764:P285R;ENSP00000434586:P285R;ENSP00000340554:P285R;ENSP00000352154:P285R;ENSP00000354117:P285R	ENSP00000340554:P285R	P	-	2	0	TTN	179372519	1.000000	0.71417	0.528000	0.27938	0.549000	0.35272	9.600000	0.98282	2.767000	0.95098	0.561000	0.74099	CCC	TTN	-	NULL	ENSG00000155657		0.562	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	-	0.00	42	0	G	NM_133378		179664274	-1	tier1	-	no_errors	ENST00000342992	ensembl	human	known	74_37	missense	7.14	52	4	SNP	1.000	C
MORC2	22880	genome.wustl.edu	37	22	31367278	31367279	+	5'Flank	INS	-	-	A			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr22:31367278_31367279insA	ENST00000397641.3	-	0	0				TUG1_ENST00000569384.1_RNA|TUG1_ENST00000540687.1_RNA|TUG1_ENST00000566220.1_RNA|TUG1_ENST00000569149.1_RNA|TUG1_ENST00000602971.1_RNA|TUG1_ENST00000563812.1_RNA|TUG1_ENST00000521091.2_RNA|TUG1_ENST00000602393.1_RNA|TUG1_ENST00000519077.3_RNA			Q9Y6X9	MORC2_HUMAN	MORC family CW-type zinc finger 2							cytoplasm (GO:0005737)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			breast(2)|kidney(2)|large_intestine(5)|lung(4)|ovary(2)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)	21						ATGACTTGGAGAAAAAAAAGTG	0.356																																																	0																																										SO:0001631	upstream_gene_variant	0			AB020659	CCDS33636.1	22q12.2	2005-06-15	2005-06-15	2005-06-15	ENSG00000133422	ENSG00000133422			23573	protein-coding gene	gene with protein product			"""zinc finger, CW-type with coiled-coil domain 1"", ""zinc finger, CW type with coiled-coil domain 1"""	ZCWCC1		14607086	Standard	XM_005261391		Approved	ZCW3, KIAA0852, AC004542.C22.1	uc003aje.1	Q9Y6X9	OTTHUMG00000151193		22.37:g.31367286_31367286dupA	Exception_encountered		B2RNB1|Q9UF28|Q9Y6V2	RNA	INS	-	NULL	ENST00000397641.3	37	NULL		22																																																																																			TUG1	-	-	ENSG00000253352		0.356	MORC2-001	KNOWN	basic|appris_principal	protein_coding	TUG1	HGNC	protein_coding	OTTHUMT00000321710.2		0.00	13	0	0	NM_014941		31367279	+1			no_errors	ENST00000519077	ensembl	human	known	74_37	rna	33.33	4	2	INS	0.906:0.666	A
UBE3D	90025	genome.wustl.edu	37	6	83732246	83732246	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr6:83732246G>T	ENST00000369747.3	-	7	894	c.772C>A	c.(772-774)Ctg>Atg	p.L258M		NM_198920.1	NP_944602.1	Q7Z6J8	UBE3D_HUMAN	ubiquitin protein ligase E3D	258					protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)										AGCTGCACCAGACACTGGGCG	0.388																																																	0													65.0	64.0	64.0					6																	83732246		2203	4300	6503	SO:0001583	missense	0			AL137544	CCDS34491.1	6q15	2012-02-24	2012-02-24	2012-02-24	ENSG00000118420	ENSG00000118420			21381	protein-coding gene	gene with protein product	"""UBCH10 binding protein with a hect-like domain"""	612495	"""chromosome 6 open reading frame 157"", ""ubiquitin-conjugating enzyme E2C binding protein"""	C6orf157, UBE2CBP		15749827	Standard	NM_198920		Approved	DKFZp434A1520, H10BH, YJR141W	uc003pjp.2	Q7Z6J8	OTTHUMG00000015108	ENST00000369747.3:c.772C>A	6.37:g.83732246G>T	ENSP00000358762:p.Leu258Met		B4DP63|Q5T4W2|Q6IPR4|Q75UG0|Q9NT42	Missense_Mutation	SNP	pfam_UBQ-conj_enz_E2-bd_prot	p.L258M	ENST00000369747.3	37	c.772	CCDS34491.1	6	.	.	.	.	.	.	.	.	.	.	G	12.73	2.026451	0.35701	.	.	ENSG00000118420	ENST00000369747	T	0.48522	0.81	5.72	2.96	0.34315	.	0.134536	0.51477	D	0.000089	T	0.48223	0.1488	M	0.71581	2.175	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.73380	0.979;0.98	T	0.47086	-0.9144	10	0.37606	T	0.19	-9.8047	6.1285	0.20192	0.0718:0.1344:0.654:0.1398	.	237;258	C9JRS1;Q7Z6J8	.;UB2CB_HUMAN	M	258	ENSP00000358762:L258M	ENSP00000358762:L258M	L	-	1	2	UBE2CBP	83788965	1.000000	0.71417	0.936000	0.37596	0.163000	0.22366	2.265000	0.43311	0.339000	0.23719	-1.119000	0.02030	CTG	UBE3D	-	pfam_UBQ-conj_enz_E2-bd_prot	ENSG00000118420		0.388	UBE3D-003	KNOWN	basic|appris_principal|CCDS	protein_coding	UBE3D	HGNC	protein_coding	OTTHUMT00000041347.7	-	0.00	75	0	G	NM_198920		83732246	-1	tier1	-	no_errors	ENST00000369747	ensembl	human	known	74_37	missense	5.19	73	4	SNP	0.996	T
UBIAD1	29914	genome.wustl.edu	37	1	11345718	11345718	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr1:11345718G>T	ENST00000376810.5	+	2	873	c.547G>T	c.(547-549)Gtg>Ttg	p.V183L	UBIAD1_ENST00000376804.2_Intron	NM_013319.2	NP_037451.1	Q9Y5Z9	UBIA1_HUMAN	UbiA prenyltransferase domain containing 1	183					menaquinone biosynthetic process (GO:0009234)|ubiquinone biosynthetic process (GO:0006744)|vitamin K biosynthetic process (GO:0042371)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|integral component of Golgi membrane (GO:0030173)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	antioxidant activity (GO:0016209)|prenyltransferase activity (GO:0004659)	p.V183M(1)		endometrium(1)|kidney(2)|large_intestine(2)|lung(4)|prostate(3)	12	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.000818)|all_lung(284;0.00105)|Colorectal(325;0.0062)|Breast(348;0.012)|Hepatocellular(190;0.0305)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;1.52e-06)|COAD - Colon adenocarcinoma(227;0.000254)|BRCA - Breast invasive adenocarcinoma(304;0.000299)|Kidney(185;0.000754)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.00727)|READ - Rectum adenocarcinoma(331;0.0487)		ATTCAAGTACGTGGCTCTGGG	0.552																																																	1	Substitution - Missense(1)	prostate(1)											101.0	85.0	90.0					1																	11345718		2203	4300	6503	SO:0001583	missense	0				CCDS129.1	1p36.22	2012-05-02			ENSG00000120942	ENSG00000120942			30791	protein-coding gene	gene with protein product	"""transitional epithelia response protein"""	611632	"""Schnyder crystalline corneal dystrophy"""	SCCD		20953171, 12497587, 11314041, 17668063, 17962451, 8894705	Standard	NM_013319		Approved	TERE1	uc001asg.3	Q9Y5Z9	OTTHUMG00000002075	ENST00000376810.5:c.547G>T	1.37:g.11345718G>T	ENSP00000366006:p.Val183Leu		B3KQG3|Q53GX3|Q5THD4	Missense_Mutation	SNP	pfam_UbiA_prenyltransferase	p.V183L	ENST00000376810.5	37	c.547	CCDS129.1	1	.	.	.	.	.	.	.	.	.	.	G	13.64	2.298214	0.40694	.	.	ENSG00000120942	ENST00000376810	D	0.92446	-3.04	5.44	4.52	0.55395	.	0.120448	0.56097	N	0.000034	D	0.83700	0.5311	N	0.17674	0.51	0.80722	D	1	B	0.06786	0.001	B	0.13407	0.009	T	0.76389	-0.2977	10	0.06891	T	0.86	0.0579	13.7157	0.62695	0.0:0.1649:0.8351:0.0	.	183	Q9Y5Z9	UBIA1_HUMAN	L	183	ENSP00000366006:V183L	ENSP00000366006:V183L	V	+	1	0	UBIAD1	11268305	1.000000	0.71417	0.989000	0.46669	0.959000	0.62525	7.550000	0.82173	1.260000	0.44134	0.491000	0.48974	GTG	UBIAD1	-	pfam_UbiA_prenyltransferase	ENSG00000120942		0.552	UBIAD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBIAD1	HGNC	protein_coding	OTTHUMT00000005773.1		0.00	67	0	G	NM_013319		11345718	+1			no_errors	ENST00000376810	ensembl	human	known	74_37	missense	5.26	36	2	SNP	0.998	T
USP7	7874	genome.wustl.edu	37	16	8998324	8998324	+	Silent	SNP	G	G	T			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr16:8998324G>T	ENST00000344836.4	-	15	1870	c.1672C>A	c.(1672-1674)Cgg>Agg	p.R558R	USP7_ENST00000381886.4_Silent_p.R542R|USP7_ENST00000535863.1_Silent_p.R459R	NM_003470.2	NP_003461.2	Q93009	UBP7_HUMAN	ubiquitin specific peptidase 7 (herpes virus-associated)	558					maintenance of DNA methylation (GO:0010216)|multicellular organismal development (GO:0007275)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|protein deubiquitination (GO:0016579)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|transcription-coupled nucleotide-excision repair (GO:0006283)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|p53 binding (GO:0002039)|protein C-terminus binding (GO:0008022)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(13)|lung(20)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	48						GCTTCCTGCCGCTCCTTCCGC	0.557																																																	0													106.0	90.0	96.0					16																	8998324		2197	4300	6497	SO:0001819	synonymous_variant	0			Z72499	CCDS32385.1, CCDS66941.1	16p13.3	2008-04-11	2005-08-08			ENSG00000187555		"""Ubiquitin-specific peptidases"""	12630	protein-coding gene	gene with protein product		602519	"""ubiquitin specific protease 7 (herpes virus-associated)"""	HAUSP		12838346, 9925944	Standard	NM_003470		Approved		uc002czl.2	Q93009		ENST00000344836.4:c.1672C>A	16.37:g.8998324G>T			A6NMY8|B7Z815|H0Y3G8	Missense_Mutation	SNP	pfam_Peptidase_C19/C67,pfam_MATH,superfamily_TRAF-like,smart_MATH,pfscan_MATH,pfscan_Peptidase_C19/C67	p.A486E	ENST00000344836.4	37	c.1457	CCDS32385.1	16	.	.	.	.	.	.	.	.	.	.	G	14.26	2.481312	0.44147	.	.	ENSG00000187555	ENST00000542333	T	0.07021	3.23	5.09	2.94	0.34122	.	.	.	.	.	T	0.05135	0.0137	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.16748	-1.0392	6	0.02654	T	1	.	12.7525	0.57316	0.0:0.0:0.5853:0.4147	.	.	.	.	E	486	ENSP00000439272:A486E	ENSP00000439272:A486E	A	-	2	0	USP7	8905825	1.000000	0.71417	1.000000	0.80357	0.732000	0.41865	2.108000	0.41854	1.096000	0.41439	0.455000	0.32223	GCG	USP7	-	NULL	ENSG00000187555		0.557	USP7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP7	HGNC	protein_coding	OTTHUMT00000434268.2	-	0.00	54	0	G			8998324	-1	tier1	-	no_errors	ENST00000542333	ensembl	human	known	74_37	missense	9.30	38	4	SNP	1.000	T
VANGL2	57216	genome.wustl.edu	37	1	160390311	160390311	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr1:160390311G>A	ENST00000368061.2	+	5	1385	c.911G>A	c.(910-912)gGc>gAc	p.G304D	VANGL2_ENST00000483408.1_Intron	NM_020335.2	NP_065068.1	Q9ULK5	VANG2_HUMAN	VANGL planar cell polarity protein 2	304					anterior/posterior pattern specification (GO:0009952)|apical protein localization (GO:0045176)|cell migration involved in kidney development (GO:0035787)|cochlea morphogenesis (GO:0090103)|convergent extension involved in axis elongation (GO:0060028)|convergent extension involved in neural plate elongation (GO:0022007)|digestive tract morphogenesis (GO:0048546)|establishment of body hair planar orientation (GO:0048105)|establishment of planar polarity (GO:0001736)|establishment of planar polarity involved in neural tube closure (GO:0090177)|establishment or maintenance of epithelial cell apical/basal polarity (GO:0045197)|glomerulus development (GO:0032835)|hair follicle development (GO:0001942)|heart looping (GO:0001947)|inner ear receptor stereocilium organization (GO:0060122)|kidney morphogenesis (GO:0060993)|lateral sprouting involved in lung morphogenesis (GO:0060490)|membranous septum morphogenesis (GO:0003149)|muscular septum morphogenesis (GO:0003150)|neural tube closure (GO:0001843)|nonmotile primary cilium assembly (GO:0035058)|orthogonal dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060488)|planar cell polarity pathway involved in axis elongation (GO:0003402)|planar cell polarity pathway involved in heart morphogenesis (GO:0061346)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|planar dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060489)|positive regulation of JUN kinase activity (GO:0043507)|post-anal tail morphogenesis (GO:0036342)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of Wnt signaling pathway (GO:0030111)|Rho protein signal transduction (GO:0007266)|somatic stem cell division (GO:0048103)|somatic stem cell maintenance (GO:0035019)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cell pole (GO:0060187)|cell-cell junction (GO:0005911)|ER to Golgi transport vesicle (GO:0030134)|integral component of membrane (GO:0016021)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)|stress fiber (GO:0001725)				biliary_tract(1)|breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(7)|lung(12)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|stomach(2)|urinary_tract(1)	37	all_cancers(52;1.08e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			AAAGTGTCTGGCTTCAAGGTG	0.567																																																	0													153.0	120.0	131.0					1																	160390311		2203	4300	6503	SO:0001583	missense	0			AB033041	CCDS30915.1	1q22-q23	2013-03-05	2013-03-05		ENSG00000162738	ENSG00000162738			15511	protein-coding gene	gene with protein product	"""vang, van gogh-like 2"", ""loop-tail-associated protein"", ""strabismus"""	600533	"""vang (van gogh, Drosophila)-like 2, vang, van gogh-like 2 (Drosophila)"", ""vang-like 2 (van gogh, Drosophila)"""			11431695	Standard	NM_020335		Approved	KIAA1215, LTAP, LPP1, STBM, STB1, STBM1, MGC119403, MGC119404	uc001fwc.2	Q9ULK5	OTTHUMG00000033122	ENST00000368061.2:c.911G>A	1.37:g.160390311G>A	ENSP00000357040:p.Gly304Asp		D3DVE9|Q5T212	Missense_Mutation	SNP	pfam_Strabismus,pirsf_Strabismus	p.G304D	ENST00000368061.2	37	c.911	CCDS30915.1	1	.	.	.	.	.	.	.	.	.	.	G	27.3	4.820116	0.90873	.	.	ENSG00000162738	ENST00000368061	T	0.81247	-1.47	4.91	4.91	0.64330	.	0.122413	0.53938	D	0.000050	D	0.86151	0.5864	M	0.82517	2.595	0.80722	D	1	D	0.56746	0.977	P	0.56434	0.798	D	0.87496	0.2430	10	0.56958	D	0.05	-25.4854	16.8162	0.85734	0.0:0.0:1.0:0.0	.	304	Q9ULK5	VANG2_HUMAN	D	304	ENSP00000357040:G304D	ENSP00000357040:G304D	G	+	2	0	VANGL2	158656935	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.399000	0.79935	2.549000	0.85964	0.561000	0.74099	GGC	VANGL2	-	pfam_Strabismus,pirsf_Strabismus	ENSG00000162738		0.567	VANGL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VANGL2	HGNC	protein_coding	OTTHUMT00000080677.1	-	0.00	99	0	G	NM_020335		160390311	+1	tier1	-	no_errors	ENST00000368061	ensembl	human	known	74_37	missense	61.27	55	87	SNP	1.000	A
VCL	7414	genome.wustl.edu	37	10	75860775	75860775	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr10:75860775G>A	ENST00000211998.4	+	14	2036	c.1942G>A	c.(1942-1944)Gct>Act	p.A648T	VCL_ENST00000372755.3_Missense_Mutation_p.A648T|VCL_ENST00000417648.2_Intron|VCL_ENST00000478896.2_Intron	NM_014000.2	NP_054706.1	P18206	VINC_HUMAN	vinculin	648	N-terminal globular head.				adherens junction assembly (GO:0034333)|apical junction assembly (GO:0043297)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|cellular component movement (GO:0006928)|epithelial cell-cell adhesion (GO:0090136)|lamellipodium assembly (GO:0030032)|morphogenesis of an epithelium (GO:0002009)|muscle contraction (GO:0006936)|negative regulation of cell migration (GO:0030336)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|protein localization to cell surface (GO:0034394)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cell-substrate junction (GO:0030055)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|vesicle (GO:0031982)	actin binding (GO:0003779)|alpha-catenin binding (GO:0045294)|beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|dystroglycan binding (GO:0002162)|structural molecule activity (GO:0005198)		VCL/ALK(4)	breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(8)|ovary(2)|upper_aerodigestive_tract(1)	20	Prostate(51;0.0112)					CGAGAAGGCGGCTGCGGTTGG	0.473																																																	0													56.0	54.0	54.0					10																	75860775		2203	4300	6503	SO:0001583	missense	0			M33308	CCDS7340.1, CCDS7341.1	10q22.1-q23	2014-09-17			ENSG00000035403	ENSG00000035403			12665	protein-coding gene	gene with protein product	"""metavinculin"""	193065				1339348	Standard	NM_014000		Approved		uc001jwd.3	P18206	OTTHUMG00000018498	ENST00000211998.4:c.1942G>A	10.37:g.75860775G>A	ENSP00000211998:p.Ala648Thr		Q16450|Q5SWX2|Q7Z3B8|Q8IXU7	Missense_Mutation	SNP	pfam_Vinculin/catenin,superfamily_Vinculin/catenin,prints_Vinculin	p.A648T	ENST00000211998.4	37	c.1942	CCDS7341.1	10	.	.	.	.	.	.	.	.	.	.	G	35	5.564045	0.96527	.	.	ENSG00000035403	ENST00000372755;ENST00000211998;ENST00000415462;ENST00000537043;ENST00000436396	T;T;T	0.51071	0.72;0.72;0.72	5.05	5.05	0.67936	.	0.000000	0.85682	D	0.000000	T	0.69993	0.3173	M	0.74647	2.275	0.80722	D	1	D;D;D	0.71674	0.998;0.998;0.997	D;D;D	0.78314	0.984;0.991;0.989	T	0.73767	-0.3879	10	0.72032	D	0.01	.	18.7576	0.91838	0.0:0.0:1.0:0.0	.	575;648;648	F5H7T3;P18206-2;P18206	.;.;VINC_HUMAN	T	648;648;555;575;320	ENSP00000361841:A648T;ENSP00000211998:A648T;ENSP00000415489:A320T	ENSP00000211998:A648T	A	+	1	0	VCL	75530781	1.000000	0.71417	0.995000	0.50966	0.995000	0.86356	9.154000	0.94694	2.496000	0.84212	0.655000	0.94253	GCT	VCL	-	pfam_Vinculin/catenin,superfamily_Vinculin/catenin	ENSG00000035403		0.473	VCL-201	KNOWN	basic|appris_principal|CCDS	protein_coding	VCL	HGNC	protein_coding		-	0.00	65	0	G	NM_003373, NM_014000		75860775	+1	tier1	-	no_errors	ENST00000211998	ensembl	human	known	74_37	missense	5.33	71	4	SNP	1.000	A
VCP	7415	genome.wustl.edu	37	9	35059646	35059647	+	Frame_Shift_Ins	INS	-	-	T			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr9:35059646_35059647insT	ENST00000358901.6	-	14	2742_2743	c.1847_1848insA	c.(1846-1848)aatfs	p.N616fs		NM_007126.3	NP_009057.1	P55072	TERA_HUMAN	valosin containing protein	616					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|aggresome assembly (GO:0070842)|cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER to Golgi vesicle-mediated transport (GO:0006888)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|establishment of protein localization (GO:0045184)|positive regulation of Lys63-specific deubiquitinase activity (GO:1903007)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of protein K63-linked deubiquitination (GO:1903006)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein homooligomerization (GO:0051260)|protein N-linked glycosylation via asparagine (GO:0018279)|protein ubiquitination (GO:0016567)|regulation of apoptotic process (GO:0042981)|retrograde protein transport, ER to cytosol (GO:0030970)|translesion synthesis (GO:0019985)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|Hrd1p ubiquitin ligase complex (GO:0000836)|intracellular membrane-bounded organelle (GO:0043231)|lipid particle (GO:0005811)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|proteasome complex (GO:0000502)|site of double-strand break (GO:0035861)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|deubiquitinase activator activity (GO:0035800)|lipid binding (GO:0008289)|poly(A) RNA binding (GO:0044822)|polyubiquitin binding (GO:0031593)|protein domain specific binding (GO:0019904)|protein phosphatase binding (GO:0019903)|ubiquitin-specific protease binding (GO:1990381)	p.N616fs*63(1)		breast(3)|endometrium(2)|kidney(1)|large_intestine(4)|lung(10)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	24			LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)			TGATGAACACATTTTTTTTTGT	0.515																																																	1	Deletion - Frameshift(1)	large_intestine(1)																																								SO:0001589	frameshift_variant	0			AC004472	CCDS6573.1	9p13.3	2014-09-17	2011-01-25		ENSG00000165280	ENSG00000165280		"""ATPases / AAA-type"""	12666	protein-coding gene	gene with protein product		601023	"""valosin-containing protein"""			8595912, 7553851	Standard	NM_007126		Approved	IBMPFD, p97	uc003zvy.2	P55072	OTTHUMG00000019855	ENST00000358901.6:c.1848dupA	9.37:g.35059655_35059655dupT	ENSP00000351777:p.Asn616fs		B2R5T8|Q0V924|Q2TAI5|Q969G7|Q9UCD5	Frame_Shift_Ins	INS	pfam_ATPase_AAA_core,pfam_CDC4_N-term_subdom,pfam_DNA_helicase_Holl-junc_RuvB_N,pfam_Cdc48_dom2,pfam_ATPase_dyneun-rel_AAA,pfam_ATPase_AAA-2,pfam_Vps4_C,superfamily_P-loop_NTPase,superfamily_Asp_de-COase-like_dom,smart_AAA+_ATPase,tigrfam_AAA_ATPase_CDC48	p.N616fs	ENST00000358901.6	37	c.1848_1847	CCDS6573.1	9																																																																																			VCP	-	pfam_ATPase_AAA_core,superfamily_P-loop_NTPase,smart_AAA+_ATPase,tigrfam_AAA_ATPase_CDC48	ENSG00000165280		0.515	VCP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VCP	HGNC	protein_coding	OTTHUMT00000052290.1		0.00	44	0	-	NM_007126		35059647	-1	tier1		no_errors	ENST00000358901	ensembl	human	known	74_37	frame_shift_ins	12.73	48	7	INS	1.000:1.000	T
VPS36	51028	genome.wustl.edu	37	13	52999941	52999942	+	Intron	INS	-	-	A	rs373315037|rs371686906		TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr13:52999941_52999942insA	ENST00000378060.4	-	9	802					NM_001282168.1|NM_001282169.1|NM_016075.2	NP_001269097.1|NP_001269098.1|NP_057159.2	Q86VN1	VPS36_HUMAN	vacuolar protein sorting 36 homolog (S. cerevisiae)						endosomal transport (GO:0016197)|membrane organization (GO:0061024)|protein transport (GO:0015031)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)|nucleus (GO:0005634)	phosphatidylinositol-3-phosphate binding (GO:0032266)			breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(7)|skin(1)|upper_aerodigestive_tract(2)	17		Breast(56;0.000207)|Lung NSC(96;0.00212)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;3.14e-08)		ATACCTGAAAGAAAAAAAAAAC	0.233																																																	0																																										SO:0001627	intron_variant	0			AF151903	CCDS9434.1, CCDS73577.1	13q14.13	2008-02-05	2007-01-12	2005-08-02	ENSG00000136100	ENSG00000136100			20312	protein-coding gene	gene with protein product		610903	"""chromosome 13 open reading frame 9"", ""vacuolar protein sorting 36 homolog (yeast)"""	C13orf9		11278625, 15755741	Standard	NM_016075		Approved	CGI-145, Eap45	uc001vgs.3	Q86VN1	OTTHUMG00000016964	ENST00000378060.4:c.774+124->T	13.37:g.52999951_52999951dupA			A8K125|Q3ZCV7|Q5H9S1|Q5VXB6|Q9H8Z5|Q9Y3E3	RNA	INS	-	NULL	ENST00000378060.4	37	NULL	CCDS9434.1	13																																																																																			VPS36	-	-	ENSG00000136100		0.233	VPS36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VPS36	HGNC	protein_coding	OTTHUMT00000045059.3		0.00	35	0	-			52999942	-1	tier1		no_errors	ENST00000492650	ensembl	human	known	74_37	rna	10.53	34	4	INS	0.003:0.001	A
VPS37C	55048	genome.wustl.edu	37	11	60899316	60899316	+	Silent	SNP	C	C	T	rs560010024		TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr11:60899316C>T	ENST00000301765.5	-	5	1276	c.1044G>A	c.(1042-1044)ccG>ccA	p.P348P		NM_017966.4	NP_060436.4	A5D8V6	VP37C_HUMAN	vacuolar protein sorting 37 homolog C (S. cerevisiae)	348	Pro-rich.				endosomal transport (GO:0016197)|intracellular transport of virus (GO:0075733)|membrane organization (GO:0061024)|protein transport (GO:0015031)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral protein processing (GO:0019082)|virion assembly (GO:0019068)	endosome membrane (GO:0010008)|ESCRT I complex (GO:0000813)|extracellular vesicular exosome (GO:0070062)				breast(1)|kidney(1)|large_intestine(3)|lung(1)|skin(1)	7						AGGCAGGCCCCGGCGGTGGTG	0.697																																																	0													4.0	4.0	4.0					11																	60899316		1922	3928	5850	SO:0001819	synonymous_variant	0			AK097326	CCDS31573.1	11q12.2	2008-02-05	2006-04-04			ENSG00000167987			26097	protein-coding gene	gene with protein product		610038	"""vacuolar protein sorting 37C (yeast)"""			15509564	Standard	XM_005274077		Approved	FLJ20847	uc001nqv.1	A5D8V6		ENST00000301765.5:c.1044G>A	11.37:g.60899316C>T			Q8N3K4	Silent	SNP	pfam_Mod_r	p.P348	ENST00000301765.5	37	c.1044	CCDS31573.1	11																																																																																			VPS37C	-	NULL	ENSG00000167987		0.697	VPS37C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VPS37C	HGNC	protein_coding	OTTHUMT00000396467.1	-	0.00	78	0	C	NM_017966		60899316	-1	tier1	-	no_errors	ENST00000301765	ensembl	human	known	74_37	silent	5.06	75	4	SNP	0.572	T
VPS53	55275	genome.wustl.edu	37	17	465823	465823	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr17:465823C>A	ENST00000571805.1	-	14	1612	c.1476G>T	c.(1474-1476)gaG>gaT	p.E492D	VPS53_ENST00000576149.1_5'UTR|VPS53_ENST00000437048.2_Missense_Mutation_p.E492D|VPS53_ENST00000446250.2_Missense_Mutation_p.E294D|VPS53_ENST00000574029.1_Intron|VPS53_ENST00000291074.5_Missense_Mutation_p.E463D|VPS53_ENST00000401468.3_Missense_Mutation_p.E215D			Q5VIR6	VPS53_HUMAN	vacuolar protein sorting 53 homolog (S. cerevisiae)	492					protein transport (GO:0015031)	endosome (GO:0005768)|GARP complex (GO:0000938)|membrane (GO:0016020)				breast(1)|endometrium(4)|large_intestine(5)|lung(8)|prostate(1)	19				UCEC - Uterine corpus endometrioid carcinoma (25;0.0265)		CGATCATGGGCTCCCCAGTAC	0.547																																																	0													85.0	78.0	80.0					17																	465823		2203	4300	6503	SO:0001583	missense	0				CCDS10995.1, CCDS45558.1	17p13.3	2007-07-13	2006-12-19			ENSG00000141252			25608	protein-coding gene	gene with protein product		615850	"""vacuolar protein sorting 53 (yeast)"""			15878329	Standard	NM_018289		Approved	FLJ10979, HCCS1	uc010cjo.2	Q5VIR6		ENST00000571805.1:c.1476G>T	17.37:g.465823C>A	ENSP00000459312:p.Glu492Asp		A8K2S8|B3FH42|Q8WYW3|Q9BRR2|Q9BY02|Q9NV25	Missense_Mutation	SNP	pfam_Vps53_N,pfam_Vacuolar_sorting-assoc_54	p.E492D	ENST00000571805.1	37	c.1476		17	.	.	.	.	.	.	.	.	.	.	C	15.26	2.781204	0.49891	.	.	ENSG00000141252	ENST00000437048;ENST00000446250;ENST00000291074;ENST00000401468;ENST00000389040	T;T;T;T;T	0.32272	1.46;1.46;1.46;1.46;1.46	6.07	4.1	0.47936	.	0.000000	0.85682	D	0.000000	T	0.38878	0.1057	L	0.50333	1.59	0.80722	D	1	P;P;P;B;B	0.51240	0.943;0.726;0.591;0.146;0.074	P;B;B;B;B	0.53988	0.739;0.108;0.219;0.065;0.039	T	0.07214	-1.0784	10	0.36615	T	0.2	-29.4875	10.8151	0.46571	0.0:0.7919:0.0:0.2081	.	215;492;294;492;463	E7EVT8;Q5VIR6-4;G3V0H8;Q5VIR6;Q5VIR6-2	.;.;.;VPS53_HUMAN;.	D	492;294;463;215;444	ENSP00000401435:E492D;ENSP00000394386:E294D;ENSP00000291074:E463D;ENSP00000384294:E215D;ENSP00000373692:E444D	ENSP00000291074:E463D	E	-	3	2	VPS53	412573	1.000000	0.71417	1.000000	0.80357	0.888000	0.51559	0.959000	0.29240	0.906000	0.36621	0.655000	0.94253	GAG	VPS53	-	NULL	ENSG00000141252		0.547	VPS53-006	KNOWN	basic	protein_coding	VPS53	HGNC	protein_coding	OTTHUMT00000436940.2		0.00	68	0	C	NM_018289		465823	-1			no_errors	ENST00000437048	ensembl	human	known	74_37	missense	5.75	82	5	SNP	1.000	A
VPS9D1	9605	genome.wustl.edu	37	16	89776294	89776294	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr16:89776294G>T	ENST00000389386.3	-	11	1403	c.1279C>A	c.(1279-1281)Ctt>Att	p.L427I	VPS9D1-AS1_ENST00000562866.1_RNA|VPS9D1_ENST00000561976.1_Missense_Mutation_p.L357I|VPS9D1_ENST00000565452.1_5'Flank	NM_004913.2	NP_004904.2	Q9Y2B5	VP9D1_HUMAN	VPS9 domain containing 1	427					ATP synthesis coupled proton transport (GO:0015986)		GTPase activator activity (GO:0005096)|transporter activity (GO:0005215)										AAGGCCAGAAGGGTCAGCGAG	0.627																																																	0													83.0	100.0	94.0					16																	89776294		2115	4245	6360	SO:0001583	missense	0			AB018551	CCDS42220.1	16q24.3	2012-10-09	2012-10-09	2012-10-09	ENSG00000075399	ENSG00000075399			13526	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 7"""	C16orf7		10231027	Standard	NM_004913		Approved	ATP-BL	uc002fom.1	Q9Y2B5	OTTHUMG00000173219	ENST00000389386.3:c.1279C>A	16.37:g.89776294G>T	ENSP00000374037:p.Leu427Ile			Missense_Mutation	SNP	pfam_VPS9,smart_VPS9_subgr,pfscan_VPS9	p.L427I	ENST00000389386.3	37	c.1279	CCDS42220.1	16	.	.	.	.	.	.	.	.	.	.	G	17.92	3.505719	0.64410	.	.	ENSG00000075399	ENST00000389386	.	.	.	5.54	5.54	0.83059	.	0.000000	0.64402	D	0.000001	T	0.77631	0.4159	M	0.69823	2.125	0.51767	D	0.99993	D	0.76494	0.999	D	0.78314	0.991	T	0.73228	-0.4049	9	0.23891	T	0.37	-21.3946	18.0438	0.89326	0.0:0.0:1.0:0.0	.	427	Q9Y2B5	CP007_HUMAN	I	427	.	ENSP00000374037:L427I	L	-	1	0	C16orf7	88303795	0.998000	0.40836	0.759000	0.31340	0.949000	0.60115	2.772000	0.47678	2.606000	0.88127	0.655000	0.94253	CTT	VPS9D1	-	NULL	ENSG00000075399		0.627	VPS9D1-002	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	VPS9D1	HGNC	protein_coding	OTTHUMT00000422508.1	-	0.00	109	0	G	NM_004913		89776294	-1	tier1	-	no_errors	ENST00000389386	ensembl	human	known	74_37	missense	5.13	73	4	SNP	0.999	T
WASL	8976	genome.wustl.edu	37	7	123388731	123388731	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr7:123388731G>C	ENST00000223023.4	-	1	390	c.58C>G	c.(58-60)Ctg>Gtg	p.L20V	RP11-390E23.6_ENST00000607957.1_RNA	NM_003941.2	NP_003932.3	O00401	WASL_HUMAN	Wiskott-Aldrich syndrome-like	20					actin polymerization or depolymerization (GO:0008154)|axon guidance (GO:0007411)|cellular component movement (GO:0006928)|cellular protein complex localization (GO:0034629)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|membrane budding (GO:0006900)|mitotic nuclear division (GO:0007067)|nitric oxide metabolic process (GO:0046209)|positive regulation of clathrin-mediated endocytosis (GO:2000370)|positive regulation of filopodium assembly (GO:0051491)|protein complex assembly (GO:0006461)|regulation of nitric-oxide synthase activity (GO:0050999)|regulation of protein localization (GO:0032880)|regulation of transcription, DNA-templated (GO:0006355)|response to bacterium (GO:0009617)|small molecule metabolic process (GO:0044281)|spindle localization (GO:0051653)|transcription, DNA-templated (GO:0006351)|vesicle organization (GO:0016050)|vesicle transport along actin filament (GO:0030050)	actin cap (GO:0030478)|actin cytoskeleton (GO:0015629)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|extracellular vesicular exosome (GO:0070062)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	small GTPase regulator activity (GO:0005083)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(8)|lung(9)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						GTGAGCAACAGGGACCCCACG	0.662																																																	0													43.0	40.0	41.0					7																	123388731		2203	4300	6503	SO:0001583	missense	0			D88460	CCDS34743.1	7q31.3	2008-02-01			ENSG00000106299	ENSG00000106299			12735	protein-coding gene	gene with protein product		605056				9422512, 9322739	Standard	NM_003941		Approved	N-WASP, NWASP	uc003vkz.3	O00401	OTTHUMG00000157346	ENST00000223023.4:c.58C>G	7.37:g.123388731G>C	ENSP00000223023:p.Leu20Val		A1JUI9|Q7Z746	Missense_Mutation	SNP	pfam_WH1/EVH1,pfam_CRIB_dom,pfam_WH2_dom,superfamily_WASP_C,smart_WH1/EVH1,smart_CRIB_dom,smart_WH2_dom,pfscan_CRIB_dom,pfscan_WH1/EVH1,pfscan_WH2_dom	p.L20V	ENST00000223023.4	37	c.58	CCDS34743.1	7	.	.	.	.	.	.	.	.	.	.	G	17.18	3.323257	0.60634	.	.	ENSG00000106299	ENST00000223023;ENST00000536685	D	0.99691	-6.42	4.78	0.841	0.18918	Pleckstrin homology-type (1);	0.292557	0.28659	N	0.014580	D	0.96691	0.8920	N	0.08118	0	0.40261	D	0.978175	B	0.19583	0.037	B	0.12837	0.008	D	0.92217	0.5781	10	0.21014	T	0.42	-6.7874	4.2764	0.10811	0.341:0.0:0.5127:0.1463	.	20	O00401	WASL_HUMAN	V	20	ENSP00000223023:L20V	ENSP00000223023:L20V	L	-	1	2	WASL	123175967	0.986000	0.35501	0.996000	0.52242	0.936000	0.57629	0.494000	0.22467	-0.148000	0.11234	-0.459000	0.05422	CTG	WASL	-	NULL	ENSG00000106299		0.662	WASL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WASL	HGNC	protein_coding	OTTHUMT00000348522.1	-	0.00	244	0	G	NM_003941		123388731	-1	tier1	-	no_errors	ENST00000223023	ensembl	human	known	74_37	missense	10.19	194	22	SNP	0.992	C
ZBTB17	7709	genome.wustl.edu	37	1	16274893	16274893	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr1:16274893A>G	ENST00000375743.4	-	3	330	c.98T>C	c.(97-99)gTt>gCt	p.V33A	ZBTB17_ENST00000537142.1_Intron|ZBTB17_ENST00000448462.2_Missense_Mutation_p.V33A|ZBTB17_ENST00000479282.1_5'UTR|ZBTB17_ENST00000375733.2_Missense_Mutation_p.V33A	NM_003443.2	NP_003434.2	Q13105	ZBT17_HUMAN	zinc finger and BTB domain containing 17	33	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|ectoderm development (GO:0007398)|endoplasmic reticulum unfolded protein response (GO:0030968)|gastrulation with mouth forming second (GO:0001702)|negative regulation of cell cycle (GO:0045786)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(4)|large_intestine(1)|lung(4)|ovary(2)|prostate(2)	15		Colorectal(325;0.000257)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|Colorectal(212;4.12e-07)|COAD - Colon adenocarcinoma(227;2.43e-05)|BRCA - Breast invasive adenocarcinoma(304;9.97e-05)|Kidney(64;0.000182)|KIRC - Kidney renal clear cell carcinoma(64;0.00269)|STAD - Stomach adenocarcinoma(313;0.012)|READ - Rectum adenocarcinoma(331;0.0649)		CTTAAAGTGAACACCGTCCAC	0.562																																																	0													88.0	80.0	82.0					1																	16274893		2203	4300	6503	SO:0001583	missense	0			U20647	CCDS165.1, CCDS55576.1, CCDS72712.1	1p36.13	2013-01-08	2004-07-16	2004-07-16	ENSG00000116809	ENSG00000116809		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	12936	protein-coding gene	gene with protein product		604084	"""zinc finger protein 151 (pHZ-67)"", ""zinc finger protein 60"""	ZNF151, ZNF60			Standard	NM_003443		Approved	MIZ1, pHZ-67	uc001axl.4	Q13105	OTTHUMG00000009377	ENST00000375743.4:c.98T>C	1.37:g.16274893A>G	ENSP00000364895:p.Val33Ala		A0AV07|B4DXB4|B7ZLQ9|F5H411|Q15932|Q5JYB2|Q9NUC9	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.V33A	ENST00000375743.4	37	c.98	CCDS165.1	1	.	.	.	.	.	.	.	.	.	.	A	18.60	3.659090	0.67586	.	.	ENSG00000116809	ENST00000375743;ENST00000375733;ENST00000444654;ENST00000448462	T;T;T	0.66460	-0.21;-0.21;-0.21	5.3	5.3	0.74995	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	0.151201	0.44285	D	0.000465	T	0.71945	0.3400	L	0.37466	1.105	0.25928	N	0.983025	D;D;P;D;D;P	0.69078	0.975;0.997;0.901;0.997;0.997;0.587	P;D;B;D;D;B	0.73708	0.866;0.981;0.38;0.981;0.945;0.361	T	0.65429	-0.6170	10	0.87932	D	0	.	10.0476	0.42197	0.8499:0.0:0.0:0.1501	.	33;33;33;33;33;33	B4DGV6;E7EPQ4;Q13105-2;B4DSM7;B2RCP2;Q13105	.;.;.;.;.;ZBT17_HUMAN	A	33	ENSP00000364895:V33A;ENSP00000364885:V33A;ENSP00000391002:V33A	ENSP00000364885:V33A	V	-	2	0	ZBTB17	16147480	0.999000	0.42202	0.363000	0.25875	0.962000	0.63368	5.245000	0.65405	2.140000	0.66376	0.459000	0.35465	GTT	ZBTB17	-	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,pfscan_BTB/POZ-like	ENSG00000116809		0.562	ZBTB17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBTB17	HGNC	protein_coding	OTTHUMT00000025998.1	-	0.00	55	0	A	NM_003443		16274893	-1	tier1	-	no_errors	ENST00000375733	ensembl	human	known	74_37	missense	12.90	27	4	SNP	0.776	G
ZEB1	6935	genome.wustl.edu	37	10	31799649	31799649	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr10:31799649G>T	ENST00000320985.10	+	5	640	c.530G>T	c.(529-531)aGa>aTa	p.R177I	ZEB1_ENST00000560721.2_Missense_Mutation_p.R157I|ZEB1_ENST00000361642.5_Missense_Mutation_p.R178I|ZEB1_ENST00000446923.2_Missense_Mutation_p.R161I|ZEB1_ENST00000542815.3_Missense_Mutation_p.R110I|ZEB1_ENST00000559858.1_3'UTR			P37275	ZEB1_HUMAN	zinc finger E-box binding homeobox 1	177					cartilage development (GO:0051216)|cell proliferation (GO:0008283)|cellular response to amino acid stimulus (GO:0071230)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cochlea morphogenesis (GO:0090103)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic skeletal system morphogenesis (GO:0048704)|forebrain development (GO:0030900)|immune response (GO:0006955)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial cell differentiation (GO:0030857)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|pattern specification process (GO:0007389)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of mesenchymal cell proliferation (GO:0010464)|regulation of smooth muscle cell differentiation (GO:0051150)|regulation of T cell differentiation in thymus (GO:0033081)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|response to activity (GO:0014823)|response to nutrient levels (GO:0031667)|semicircular canal morphogenesis (GO:0048752)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|E-box binding (GO:0070888)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			NS(2)|breast(4)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(14)|lung(38)|ovary(3)|skin(6)|upper_aerodigestive_tract(4)	77		Prostate(175;0.0156)				TATTGTGATAGAGGCTATAAA	0.323																																					Ovarian(40;423 959 14296 36701 49589)												0													74.0	72.0	72.0					10																	31799649		2203	4300	6503	SO:0001583	missense	0			AK091478	CCDS7169.1, CCDS44370.1, CCDS53505.1, CCDS53506.1, CCDS53507.1	10p11.22	2014-02-14	2007-02-15	2007-02-15	ENSG00000148516	ENSG00000148516		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	11642	protein-coding gene	gene with protein product		189909	"""transcription factor 8 (represses interleukin 2 expression)"", ""posterior polymorphous corneal dystrophy 3"""	TCF8, PPCD3		1427828, 1840704, 15384081, 16252232	Standard	NM_001128128		Approved	BZP, ZEB, AREB6, NIL-2-A, Zfhep, Zfhx1a, FECD6	uc001ivu.4	P37275	OTTHUMG00000017907	ENST00000320985.10:c.530G>T	10.37:g.31799649G>T	ENSP00000319248:p.Arg177Ile		B4DJV0|B4DUW9|E9PCM7|F5H4I8|Q12924|Q13800|Q2KJ05|Q5T968|Q5VZ84|Q8NB68	Missense_Mutation	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Znf_C2H2-like,smart_Homeobox_dom,pfscan_Znf_C2H2	p.R178I	ENST00000320985.10	37	c.533	CCDS7169.1	10	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	33|33	5.271754|5.271754	0.95429|0.95429	.|.	.|.	ENSG00000148516|ENSG00000148516	ENST00000543514|ENST00000537225;ENST00000361642;ENST00000546250;ENST00000542815;ENST00000320985;ENST00000437844;ENST00000541037;ENST00000424869;ENST00000446923	.|T;T;T;T;T	.|0.28666	.|1.6;1.6;1.6;1.6;1.6	5.83|5.83	5.83|5.83	0.93111|0.93111	.|Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.|0.081866	.|0.52532	.|D	.|0.000075	.|T	.|0.57681	.|0.2070	M|M	0.68952|0.68952	2.095|2.095	0.80722|0.80722	D|D	1|1	.|D;D;D;D;D;D;D;D	.|0.89917	.|1.0;1.0;0.999;0.999;0.999;1.0;0.999;0.999	.|D;D;D;D;D;D;D;D	.|0.97110	.|1.0;0.998;0.996;0.996;0.996;0.999;0.996;0.996	.|T	.|0.57470	.|-0.7806	.|10	.|0.87932	.|D	.|0	.|-20.1634	20.1174|20.1174	0.97942|0.97942	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|110;177;161;177;177;157;178;177	.|F5H4I8;F5H1R1;E9PCM7;B2RBI8;A0JLS9;Q5VZ84;Q2KJ05;P37275	.|.;.;.;.;.;.;.;ZEB1_HUMAN	.|I	-1|177;178;177;110;177;157;36;178;161	.|ENSP00000354487:R178I;ENSP00000444891:R110I;ENSP00000319248:R177I;ENSP00000415961:R178I;ENSP00000391612:R161I	.|ENSP00000319248:R177I	.|R	+|+	.|2	.|0	ZEB1|ZEB1	31839655|31839655	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	9.388000|9.388000	0.97237|0.97237	2.771000|2.771000	0.95319|0.95319	0.591000|0.591000	0.81541|0.81541	.|AGA	ZEB1	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000148516		0.323	ZEB1-018	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZEB1	HGNC	protein_coding	OTTHUMT00000419083.2	-	0.00	52	0	G	NM_030751		31799649	+1	tier1	-	no_errors	ENST00000361642	ensembl	human	known	74_37	missense	10.26	35	4	SNP	1.000	T
ZMAT1	84460	genome.wustl.edu	37	X	101153104	101153104	+	Silent	SNP	A	A	G			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chrX:101153104A>G	ENST00000372782.3	-	4	365	c.318T>C	c.(316-318)gtT>gtC	p.V106V	ZMAT1_ENST00000540921.1_Silent_p.V106V|ZMAT1_ENST00000458570.1_5'UTR	NM_001011657.3	NP_001011657	Q5H9K5	ZMAT1_HUMAN	zinc finger, matrin-type 1	106						nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			endometrium(3)|kidney(2)|large_intestine(6)|lung(6)|ovary(1)|prostate(1)|skin(1)|urinary_tract(2)	22						GAAAATTCTCAACATGCATCT	0.338																																																	0													142.0	107.0	119.0					X																	101153104		2203	4299	6502	SO:0001819	synonymous_variant	0			Z69304	CCDS35348.1	Xq21	2012-10-05	2010-09-15		ENSG00000166432	ENSG00000166432		"""Zinc fingers, matrin-type"""	29377	protein-coding gene	gene with protein product							Standard	NM_001011657		Approved	KIAA1789	uc011mrl.2	Q5H9K5	OTTHUMG00000022044	ENST00000372782.3:c.318T>C	X.37:g.101153104A>G			Q8NDS3|Q96JN6	Silent	SNP	superfamily_Asn/Gln_tRNA_amidoTrfrase-rel,smart_Znf_U1,smart_Znf_C2H2-like	p.V106	ENST00000372782.3	37	c.318	CCDS35348.1	X																																																																																			ZMAT1	-	NULL	ENSG00000166432		0.338	ZMAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZMAT1	HGNC	protein_coding	OTTHUMT00000057598.1	-	0.00	133	0	A			101153104	-1	tier1	-	no_errors	ENST00000372782	ensembl	human	known	74_37	silent	5.41	70	4	SNP	0.001	G
ZMYM6	9204	genome.wustl.edu	37	1	35457931	35457931	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr1:35457931T>C	ENST00000357182.4	-	15	2277	c.2050A>G	c.(2050-2052)Agg>Ggg	p.R684G	ZMYM6_ENST00000487874.1_Missense_Mutation_p.R684G|ZMYM6_ENST00000493328.1_5'UTR|ZMYM6_ENST00000373340.2_Missense_Mutation_p.R684G	NM_007167.3	NP_009098.3	O95789	ZMYM6_HUMAN	zinc finger, MYM-type 6	684					cytoskeleton organization (GO:0007010)|multicellular organismal development (GO:0007275)|regulation of cell morphogenesis (GO:0022604)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(10)|ovary(4)|pancreas(1)|prostate(1)|skin(1)	44		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.13)				TTTAAAAGCCTGGAAGGCTGG	0.393																																																	0													202.0	187.0	192.0					1																	35457931		2203	4300	6503	SO:0001583	missense	0			AF055470	CCDS387.2	1p34.2	2014-05-12	2005-09-12	2005-09-12	ENSG00000163867	ENSG00000163867		"""Zinc fingers, MYM type"", ""Zinc fingers, BED-type"""	13050	protein-coding gene	gene with protein product	"""zinc finger, BED-type containing 7"""	613567	"""zinc finger protein 258"", ""zinc finger, MYM-type containing 6"""	ZNF258		10486218, 23533661	Standard	NM_007167		Approved	ZNF198L4, MYM, Buster2, ZBED7	uc001byh.3	O95789	OTTHUMG00000004163	ENST00000357182.4:c.2050A>G	1.37:g.35457931T>C	ENSP00000349708:p.Arg684Gly		B4DRJ6|Q32Q23|Q4G108|Q5SVZ9|Q5SW00|Q69YL4|Q96IY0|Q9NWF1|Q9P2J4	Missense_Mutation	SNP	pfam_Znf_MYM,superfamily_RNaseH-like_dom,smart_TRASH_dom	p.R684G	ENST00000357182.4	37	c.2050	CCDS387.2	1	.	.	.	.	.	.	.	.	.	.	T	11.38	1.623084	0.28889	.	.	ENSG00000163867	ENST00000373340;ENST00000357182	T;T	0.27256	1.68;2.76	4.47	3.26	0.37387	.	0.464708	0.21687	N	0.070637	T	0.28632	0.0709	L	0.43923	1.385	0.09310	N	0.999996	B;B;B	0.31485	0.18;0.325;0.294	B;B;B	0.42245	0.083;0.131;0.381	T	0.23154	-1.0196	10	0.56958	D	0.05	0.2996	10.6994	0.45918	0.0:0.0:0.2911:0.7089	.	587;684;684	B4DWC0;O95789;O95789-1	.;ZMYM6_HUMAN;.	G	684	ENSP00000362437:R684G;ENSP00000349708:R684G	ENSP00000349708:R684G	R	-	1	2	ZMYM6	35230518	0.019000	0.18553	0.077000	0.20336	0.861000	0.49209	0.952000	0.29149	2.009000	0.58944	0.477000	0.44152	AGG	ZMYM6	-	NULL	ENSG00000163867		0.393	ZMYM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZMYM6	HGNC	protein_coding	OTTHUMT00000011999.1	-	0.00	98	0	T	NM_007167		35457931	-1	tier1	-	no_errors	ENST00000357182	ensembl	human	known	74_37	missense	5.48	69	4	SNP	0.193	C
ZNF280D	54816	genome.wustl.edu	37	15	56959058	56959058	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr15:56959058C>T	ENST00000267807.7	-	15	1888	c.1672G>A	c.(1672-1674)Gca>Aca	p.A558T	ZNF280D_ENST00000559000.1_Missense_Mutation_p.A545T|ZNF280D_ENST00000396245.1_Missense_Mutation_p.A262T|ZNF280D_ENST00000559237.1_Missense_Mutation_p.A545T	NM_017661.2	NP_060131.2	Q6N043	Z280D_HUMAN	zinc finger protein 280D	558					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(5)|kidney(4)|large_intestine(7)|lung(12)|ovary(1)|skin(1)	30				all cancers(107;0.0399)|GBM - Glioblastoma multiforme(80;0.0787)		TTAGATTTTGCAGGATTTTTA	0.363																																																	0													115.0	120.0	119.0					15																	56959058		2191	4292	6483	SO:0001583	missense	0			AB046804	CCDS32245.1, CCDS42041.1, CCDS58364.1	15q21.2	2008-05-02	2007-09-20	2007-09-20					25953	protein-coding gene	gene with protein product			"""suppressor of hairy wing homolog 4 (Drosophila)"""	SUHW4		10997877	Standard	XM_005254481		Approved	FLJ20086, ZNF634	uc002adu.3	Q6N043		ENST00000267807.7:c.1672G>A	15.37:g.56959058C>T	ENSP00000267807:p.Ala558Thr		A1L495|B2RMT6|Q6MZM6|Q6N085|Q6P2R6|Q7Z6J5|Q9H0U5|Q9HCI8|Q9NXS0	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.A558T	ENST00000267807.7	37	c.1672	CCDS32245.1	15	.	.	.	.	.	.	.	.	.	.	C	0.004	-2.356286	0.00217	.	.	ENSG00000137871	ENST00000267807;ENST00000455329;ENST00000396245	T;T	0.02916	4.11;4.52	5.1	0.104	0.14531	.	9.061880	0.01209	N	0.007794	T	0.01254	0.0041	N	0.01874	-0.695	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.41070	-0.9529	10	0.02654	T	1	0.0358	4.7348	0.12982	0.0:0.2404:0.2879:0.4717	.	621;558	B4DHL1;Q6N043	.;Z280D_HUMAN	T	558;545;262	ENSP00000267807:A558T;ENSP00000379545:A262T	ENSP00000267807:A558T	A	-	1	0	ZNF280D	54746350	0.958000	0.32768	0.005000	0.12908	0.188000	0.23474	0.018000	0.13422	-0.164000	0.10927	-1.322000	0.01289	GCA	ZNF280D	-	NULL	ENSG00000137871		0.363	ZNF280D-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF280D	HGNC	protein_coding	OTTHUMT00000418891.2	-	0.00	68	0	C	XM_370867		56959058	-1	tier1	-	no_errors	ENST00000267807	ensembl	human	known	74_37	missense	6.25	60	4	SNP	0.000	T
ZNF335	63925	genome.wustl.edu	37	20	44590785	44590785	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr20:44590785T>C	ENST00000322927.2	-	10	1670	c.1570A>G	c.(1570-1572)Aag>Gag	p.K524E	ZNF335_ENST00000426788.1_Missense_Mutation_p.K369E	NM_022095.3	NP_071378.1	Q9H4Z2	ZN335_HUMAN	zinc finger protein 335	524					brain development (GO:0007420)|brain morphogenesis (GO:0048854)|cerebral cortex neuron differentiation (GO:0021895)|histone H3-K4 trimethylation (GO:0080182)|in utero embryonic development (GO:0001701)|neuron projection morphogenesis (GO:0048812)|positive regulation of lymphocyte proliferation (GO:0050671)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of neurogenesis (GO:0050769)|regulation of gene expression, epigenetic (GO:0040029)|regulation of histone H3-K4 methylation (GO:0051569)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(13)|lung(17)|ovary(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	51		Myeloproliferative disorder(115;0.0122)				TCGTCACACTTGTAGGGCTTG	0.637																																																	0													195.0	147.0	163.0					20																	44590785		2203	4300	6503	SO:0001583	missense	0			AK026157	CCDS13389.1	20q13.12	2011-09-12			ENSG00000198026	ENSG00000198026		"""Zinc fingers, C2H2-type"""	15807	protein-coding gene	gene with protein product	"""NRC-interacting factor 1"""	610827				12215545, 19131338	Standard	NM_022095		Approved	bA465L10.2, NIF-1	uc002xqw.3	Q9H4Z2	OTTHUMG00000032637	ENST00000322927.2:c.1570A>G	20.37:g.44590785T>C	ENSP00000325326:p.Lys524Glu		B4DLG7|Q548D0|Q9H684	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.K524E	ENST00000322927.2	37	c.1570	CCDS13389.1	20	.	.	.	.	.	.	.	.	.	.	T	27.6	4.846847	0.91277	.	.	ENSG00000198026	ENST00000322927;ENST00000243961;ENST00000426788	T;T	0.16196	2.36;2.36	4.87	4.87	0.63330	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.30572	0.0769	L	0.43757	1.38	0.80722	D	1	D;D	0.76494	0.998;0.999	D;D	0.81914	0.994;0.995	T	0.02728	-1.1118	10	0.17369	T	0.5	-34.8234	13.7947	0.63164	0.0:0.0:0.0:1.0	.	369;524	Q9H4Z2-2;Q9H4Z2	.;ZN335_HUMAN	E	524;301;369	ENSP00000325326:K524E;ENSP00000397098:K369E	ENSP00000243961:K301E	K	-	1	0	ZNF335	44024192	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.412000	0.80091	2.043000	0.60533	0.402000	0.26972	AAG	ZNF335	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000198026		0.637	ZNF335-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF335	HGNC	protein_coding	OTTHUMT00000079553.1	-	0.00	56	0	T	NM_022095		44590785	-1	tier1	-	no_errors	ENST00000322927	ensembl	human	known	74_37	missense	10.26	35	4	SNP	1.000	C
ZNF527	84503	genome.wustl.edu	37	19	37861967	37861967	+	5'Flank	SNP	G	G	T			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr19:37861967G>T	ENST00000436120.2	+	0	0				ZNF527_ENST00000587349.1_5'Flank|ZNF527_ENST00000589615.1_3'UTR|ZNF527_ENST00000483919.1_5'Flank	NM_032453.1	NP_115829.1	Q8NB42	ZN527_HUMAN	zinc finger protein 527						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(14)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	33			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			CTCGTGGTTCGCGGGGTCCAT	0.662																																																	0																																										SO:0001631	upstream_gene_variant	0			AB058732, AK091585	CCDS42559.1	19q13.1	2013-01-08			ENSG00000189164	ENSG00000189164		"""Zinc fingers, C2H2-type"", ""-"""	29385	protein-coding gene	gene with protein product						11347906	Standard	NM_032453		Approved	KIAA1829	uc010efk.1	Q8NB42	OTTHUMG00000048173		19.37:g.37861967G>T	Exception_encountered		B4DVL5	RNA	SNP	-	NULL	ENST00000436120.2	37	NULL	CCDS42559.1	19																																																																																			ZNF527	-	-	ENSG00000189164		0.662	ZNF527-004	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF527	HGNC	protein_coding	OTTHUMT00000458434.1	-	0.00	61	0	G	NM_032453		37861967	+1	tier1	-	no_errors	ENST00000589615	ensembl	human	known	74_37	rna	7.41	50	4	SNP	0.394	T
ZNF45	7596	genome.wustl.edu	37	19	44418047	44418047	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr19:44418047C>T	ENST00000269973.5	-	10	2631	c.1541G>A	c.(1540-1542)aGc>aAc	p.S514N	RP11-15A1.2_ENST00000586247.1_RNA|ZNF45_ENST00000589703.1_Missense_Mutation_p.S514N	NM_003425.3	NP_003416.1	Q02386	ZNF45_HUMAN	zinc finger protein 45	514					gene expression (GO:0010467)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(4)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	17						CACCTGAAGGCTGGAGAACTG	0.488																																																	0													70.0	63.0	66.0					19																	44418047		2203	4300	6503	SO:0001583	missense	0			M67509	CCDS12632.1	19q13.2	2013-01-08	2005-01-11			ENSG00000124459		"""Zinc fingers, C2H2-type"", ""-"""	13111	protein-coding gene	gene with protein product		194554	"""zinc finger protein 45 (a Kruppel-associated box (KRAB) domain polypeptide)"", ""zinc finger protein 13"""	ZNF13		9067431	Standard	NM_003425		Approved		uc002oxw.2	Q02386		ENST00000269973.5:c.1541G>A	19.37:g.44418047C>T	ENSP00000269973:p.Ser514Asn		P17016|P78472|Q9P1U9	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.S514N	ENST00000269973.5	37	c.1541	CCDS12632.1	19	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	1.168|1.168	-0.641823|-0.641823	0.03531|0.03531	.|.	.|.	ENSG00000124459|ENSG00000124459	ENST00000328762|ENST00000269973	.|T	.|0.15718	.|2.4	3.61|3.61	2.54|2.54	0.30619|0.30619	.|Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.|0.000000	.|0.42548	.|D	.|0.000692	T|T	0.07683|0.07683	0.0193|0.0193	N|N	0.13140|0.13140	0.3|0.3	0.09310|0.09310	N|N	1|1	.|B	.|0.22604	.|0.072	.|B	.|0.23018	.|0.043	T|T	0.37502|0.37502	-0.9703|-0.9703	6|10	0.18710|0.12103	T|T	0.47|0.63	-16.2863|-16.2863	5.8651|5.8651	0.18771|0.18771	0.1925:0.7031:0.0:0.1045|0.1925:0.7031:0.0:0.1045	.|.	.|514	.|Q02386	.|ZNF45_HUMAN	T|N	514|514	.|ENSP00000269973:S514N	ENSP00000367176:A514T|ENSP00000269973:S514N	A|S	-|-	1|2	0|0	ZNF45|ZNF45	49109887|49109887	0.000000|0.000000	0.05858|0.05858	0.929000|0.929000	0.37066|0.37066	0.676000|0.676000	0.39594|0.39594	-0.803000|-0.803000	0.04540|0.04540	0.830000|0.830000	0.34757|0.34757	0.455000|0.455000	0.32223|0.32223	GCC|AGC	ZNF45	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000124459		0.488	ZNF45-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZNF45	HGNC	protein_coding	OTTHUMT00000459919.1	-	0.00	87	0	C	NM_003425		44418047	-1	tier1	-	no_errors	ENST00000269973	ensembl	human	known	74_37	missense	5.13	74	4	SNP	0.002	T
ZNF699	374879	genome.wustl.edu	37	19	9407537	9407537	+	Silent	SNP	T	T	A			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr19:9407537T>A	ENST00000591998.1	-	6	771	c.543A>T	c.(541-543)ccA>ccT	p.P181P	CTC-325H20.4_ENST00000591336.1_RNA|ZNF699_ENST00000308650.3_Silent_p.P181P			Q32M78	ZN699_HUMAN	zinc finger protein 699	181					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(7)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						AATCAAGATTTGGAACTTGGC	0.348																																																	0													76.0	68.0	71.0					19																	9407537		1889	4124	6013	SO:0001819	synonymous_variant	0			BC109268	CCDS42495.1	19p13.2	2013-01-08				ENSG00000196110		"""Zinc fingers, C2H2-type"", ""-"""	24750	protein-coding gene	gene with protein product	hangover homolog (Drosophila)	609571				16940975	Standard	NM_198535		Approved	FLJ38144, hang	uc002mlc.1	Q32M78		ENST00000591998.1:c.543A>T	19.37:g.9407537T>A			Q8N9A1	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.P181	ENST00000591998.1	37	c.543	CCDS42495.1	19																																																																																			ZNF699	-	NULL	ENSG00000196110		0.348	ZNF699-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF699	HGNC	protein_coding	OTTHUMT00000449010.1		0.00	58	0	T	NM_198535		9407537	-1			no_errors	ENST00000308650	ensembl	human	known	74_37	silent	5.71	66	4	SNP	0.018	A
ZNF626	199777	genome.wustl.edu	37	19	20807456	20807456	+	Silent	SNP	G	G	A			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr19:20807456G>A	ENST00000601440.1	-	4	1373	c.1227C>T	c.(1225-1227)tcC>tcT	p.S409S	CTC-513N18.7_ENST00000595094.1_lincRNA	NM_001076675.2	NP_001070143.1	Q68DY1	ZN626_HUMAN	zinc finger protein 626	409					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(1)|lung(3)|skin(1)	6						TAAGGTTAGAGGAGTACTTAA	0.403																																																	0													58.0	61.0	60.0					19																	20807456		2152	4276	6428	SO:0001819	synonymous_variant	0			BC007116	CCDS32976.1, CCDS42535.1	19p13.11	2013-01-08				ENSG00000188171		"""Zinc fingers, C2H2-type"", ""-"""	30461	protein-coding gene	gene with protein product						12477932	Standard	NM_145297		Approved		uc002npb.1	Q68DY1		ENST00000601440.1:c.1227C>T	19.37:g.20807456G>A			Q8N8T4|Q96QM1	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.S409	ENST00000601440.1	37	c.1227	CCDS42535.1	19																																																																																			ZNF626	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000188171		0.403	ZNF626-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF626	HGNC	protein_coding	OTTHUMT00000447845.2	-	0.00	60	0	G	NM_145297		20807456	-1	tier1	-	no_errors	ENST00000601440	ensembl	human	known	74_37	silent	5.19	73	4	SNP	0.000	A
ZNF582	147948	genome.wustl.edu	37	19	56895939	56895939	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr19:56895939A>G	ENST00000301310.4	-	5	1005	c.847T>C	c.(847-849)Tat>Cat	p.Y283H	ZNF582_ENST00000586929.1_Missense_Mutation_p.Y283H|AC006116.12_ENST00000589671.1_RNA	NM_144690.1	NP_653291.1	Q96NG8	ZN582_HUMAN	zinc finger protein 582	283					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.Y283H(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(7)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	26		Colorectal(82;0.000256)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0547)		TTACACTGATAGGGTTTCTCG	0.418																																					Ovarian(183;1887 2032 4349 30507 51343)												1	Substitution - Missense(1)	large_intestine(1)											71.0	60.0	64.0					19																	56895939		2203	4300	6503	SO:0001583	missense	0			AK055489	CCDS33121.1	19q13.43	2013-07-15			ENSG00000018869	ENSG00000018869		"""Zinc fingers, C2H2-type"", ""-"""	26421	protein-coding gene	gene with protein product		615600				12477932	Standard	NM_144690		Approved	FLJ30927	uc002qmz.1	Q96NG8	OTTHUMG00000181939	ENST00000301310.4:c.847T>C	19.37:g.56895939A>G	ENSP00000301310:p.Tyr283His		B4DQZ9|B7Z9R3|Q6PJT6	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.Y283H	ENST00000301310.4	37	c.847	CCDS33121.1	19	.	.	.	.	.	.	.	.	.	.	A	17.12	3.309056	0.60414	.	.	ENSG00000018869	ENST00000301310	T	0.21734	1.99	4.88	3.79	0.43588	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.32416	N	0.006131	T	0.30823	0.0777	L	0.27053	0.805	0.09310	N	1	D;D	0.89917	0.997;1.0	D;D	0.91635	0.98;0.999	T	0.02966	-1.1088	10	0.87932	D	0	.	11.357	0.49621	0.8491:0.1509:0.0:0.0	.	283;314	Q96NG8;B4DQZ9	ZN582_HUMAN;.	H	283	ENSP00000301310:Y283H	ENSP00000301310:Y283H	Y	-	1	0	ZNF582	61587751	0.123000	0.22298	0.004000	0.12327	0.037000	0.13140	4.031000	0.57267	2.164000	0.68074	0.533000	0.62120	TAT	ZNF582	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000018869		0.418	ZNF582-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF582	HGNC	protein_coding	OTTHUMT00000458387.2	-	0.00	88	0	A	NM_144690		56895939	-1	tier1	-	no_errors	ENST00000301310	ensembl	human	known	74_37	missense	5.80	65	4	SNP	0.029	G
ZNF717	100131827	genome.wustl.edu	37	3	75790939	75790940	+	5'UTR	INS	-	-	T			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr3:75790939_75790940insT	ENST00000491507.1	-	0	271_272				ZNF717_ENST00000477374.1_Intron|ZNF717_ENST00000478296.1_Intron|ZNF717_ENST00000400845.3_5'UTR|ZNF717_ENST00000422325.1_Intron			Q9BY31	ZN717_HUMAN	zinc finger protein 717						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			autonomic_ganglia(6)|endometrium(3)|lung(2)|ovary(1)|stomach(7)	19						TCCTGTACAGGGTCCTCTAAGC	0.52																																																	0																																										SO:0001623	5_prime_UTR_variant	0			AF226994		3p12.3	2013-01-08			ENSG00000227124	ENSG00000227124		"""Zinc fingers, C2H2-type"", ""-"""	29448	protein-coding gene	gene with protein product			"""zinc finger protein 838"""	ZNF838			Standard	NM_001128223		Approved	X17	uc011bgi.2	Q9BY31	OTTHUMG00000158965	ENST00000491507.1:c.-2070->A	3.37:g.75790939_75790940insT				RNA	INS	-	NULL	ENST00000491507.1	37	NULL		3																																																																																			ZNF717	-	-	ENSG00000227124		0.520	ZNF717-004	KNOWN	basic	processed_transcript	ZNF717	HGNC	protein_coding	OTTHUMT00000352766.1		0.00	20	0	-	NM_001128223		75790940	-1	tier1		no_errors	ENST00000491507	ensembl	human	known	74_37	rna	75.00	1	3	INS	0.781:0.693	T
ZNF784	147808	genome.wustl.edu	37	19	56133668	56133668	+	Missense_Mutation	SNP	A	A	T			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr19:56133668A>T	ENST00000325351.4	-	2	460	c.421T>A	c.(421-423)Ttg>Atg	p.L141M	ZNF784_ENST00000591479.1_3'UTR	NM_203374.1	NP_976308.1	Q8NCA9	ZN784_HUMAN	zinc finger protein 784	141					hematopoietic progenitor cell differentiation (GO:0002244)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			upper_aerodigestive_tract(1)	1			BRCA - Breast invasive adenocarcinoma(297;0.18)	GBM - Glioblastoma multiforme(193;0.105)		AGGGGCGCCAAGGCCTTGAAG	0.756																																																	0													2.0	3.0	3.0					19																	56133668		1573	3329	4902	SO:0001583	missense	0			AK074859	CCDS12930.1	19q13.42	2013-01-08			ENSG00000179922	ENSG00000179922		"""Zinc fingers, C2H2-type"""	33111	protein-coding gene	gene with protein product							Standard	NM_203374		Approved	MGC75238	uc002qll.1	Q8NCA9	OTTHUMG00000180860	ENST00000325351.4:c.421T>A	19.37:g.56133668A>T	ENSP00000320096:p.Leu141Met			Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Znf_C2H2_jaz,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.L141M	ENST00000325351.4	37	c.421	CCDS12930.1	19	.	.	.	.	.	.	.	.	.	.	A	13.36	2.214737	0.39102	.	.	ENSG00000179922	ENST00000325351	T	0.09073	3.02	3.0	0.788	0.18601	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.29424	N	0.012182	T	0.10852	0.0265	N	0.24115	0.695	0.80722	D	1	D	0.76494	0.999	D	0.68621	0.959	T	0.27226	-1.0080	10	0.49607	T	0.09	-13.2797	3.5871	0.07975	0.5361:0.2114:0.2525:0.0	.	141	Q8NCA9	ZN784_HUMAN	M	141	ENSP00000320096:L141M	ENSP00000320096:L141M	L	-	1	2	ZNF784	60825480	0.000000	0.05858	0.991000	0.47740	0.643000	0.38383	-1.836000	0.01690	0.199000	0.20427	0.379000	0.24179	TTG	ZNF784	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000179922		0.756	ZNF784-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF784	HGNC	protein_coding	OTTHUMT00000453355.2	-	0.00	16	0	A	NM_203374		56133668	-1	tier1	-	no_errors	ENST00000325351	ensembl	human	known	74_37	missense	36.36	7	4	SNP	0.984	T
ZNF805	390980	genome.wustl.edu	37	19	57765566	57765566	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr19:57765566G>T	ENST00000414468.2	+	4	1379	c.1379G>T	c.(1378-1380)tGt>tTt	p.C460F	ZNF805_ENST00000535550.1_Missense_Mutation_p.C327F|ZNF805_ENST00000354309.4_Missense_Mutation_p.C327F	NM_001023563.3	NP_001018857.2	Q5CZA5	ZN805_HUMAN	zinc finger protein 805	460					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(3)|kidney(3)|lung(1)|stomach(1)	9						TGCAAAGAGTGTGGGAAAGCC	0.493																																																	0													59.0	58.0	58.0					19																	57765566		692	1591	2283	SO:0001583	missense	0			AF024708	CCDS46207.1, CCDS46208.1	19q13.43	2013-01-08			ENSG00000204524	ENSG00000204524		"""Zinc fingers, C2H2-type"", ""-"""	23272	protein-coding gene	gene with protein product							Standard	NM_001023563		Approved		uc010ygt.2	Q5CZA5		ENST00000414468.2:c.1379G>T	19.37:g.57765566G>T	ENSP00000412999:p.Cys460Phe		B4DNM5	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.C460F	ENST00000414468.2	37	c.1379	CCDS46207.1	19	.	.	.	.	.	.	.	.	.	.	G	19.71	3.878402	0.72294	.	.	ENSG00000204524	ENST00000535550;ENST00000414468;ENST00000354309	D;D;D	0.85861	-2.04;-2.04;-2.04	4.21	4.21	0.49690	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.53938	D	0.000055	D	0.95755	0.8619	H	0.99299	4.505	0.45883	D	0.99873	D	0.89917	1.0	D	0.97110	1.0	D	0.97690	1.0178	10	0.87932	D	0	.	15.828	0.78730	0.0:0.0:1.0:0.0	.	460	Q5CZA5	ZN805_HUMAN	F	327;460;327	ENSP00000440067:C327F;ENSP00000412999:C460F;ENSP00000365414:C327F	ENSP00000365414:C327F	C	+	2	0	ZNF805	62457378	1.000000	0.71417	0.951000	0.38953	0.963000	0.63663	5.775000	0.68915	2.322000	0.78497	0.563000	0.77884	TGT	ZNF805	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000204524		0.493	ZNF805-002	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	ZNF805	HGNC	protein_coding	OTTHUMT00000465722.1		0.00	103	0	G	NM_001023563		57765566	+1			no_errors	ENST00000414468	ensembl	human	known	74_37	missense	5.21	91	5	SNP	1.000	T
ZSWIM6	57688	genome.wustl.edu	37	5	60839571	60839571	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A88Z-01A-11D-A36J-09	TCGA-L5-A88Z-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	780573c9-1514-4b9c-b31f-c0c0df3b7b45	247edf65-6355-4962-9ea6-79b9a0d04711	g.chr5:60839571G>A	ENST00000252744.5	+	14	3075	c.3075G>A	c.(3073-3075)atG>atA	p.M1025I		NM_020928.1	NP_065979.1	Q9HCJ5	ZSWM6_HUMAN	zinc finger, SWIM-type containing 6	1025					neuron projection morphogenesis (GO:0048812)|regulation of neuron migration (GO:2001222)		zinc ion binding (GO:0008270)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)	8						CGACTGGCATGAGCTATACAC	0.537																																																	0													44.0	40.0	41.0					5																	60839571		692	1591	2283	SO:0001583	missense	0			BC039438	CCDS47215.1	5q12.1	2011-03-17			ENSG00000130449	ENSG00000130449		"""Zinc fingers, SWIM-type"""	29316	protein-coding gene	gene with protein product		615951				10997877, 16427614	Standard	NM_020928		Approved	KIAA1577	uc003jsr.3	Q9HCJ5	OTTHUMG00000162388	ENST00000252744.5:c.3075G>A	5.37:g.60839571G>A	ENSP00000252744:p.Met1025Ile			Missense_Mutation	SNP	pfscan_Znf_SWIM,prints_Antifreeze_1	p.M1025I	ENST00000252744.5	37	c.3075	CCDS47215.1	5	.	.	.	.	.	.	.	.	.	.	g	13.11	2.138773	0.37728	.	.	ENSG00000130449	ENST00000252744	T	0.44482	0.92	5.18	5.18	0.71444	.	0.000000	0.85682	D	0.000000	T	0.42877	0.1222	L	0.47078	1.49	0.48975	D	0.999734	B	0.32302	0.363	B	0.37888	0.26	T	0.17531	-1.0366	10	0.21014	T	0.42	-12.9594	18.885	0.92372	0.0:0.0:1.0:0.0	.	1025	Q9HCJ5	ZSWM6_HUMAN	I	1025	ENSP00000252744:M1025I	ENSP00000252744:M1025I	M	+	3	0	ZSWIM6	60875328	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	7.671000	0.83941	2.696000	0.92011	0.556000	0.70494	ATG	ZSWIM6	-	NULL	ENSG00000130449		0.537	ZSWIM6-001	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	ZSWIM6	HGNC	protein_coding	OTTHUMT00000368710.1	-	0.00	34	0	G	NM_020928		60839571	+1	tier1	-	no_errors	ENST00000252744	ensembl	human	novel	74_37	missense	11.76	30	4	SNP	1.000	A
