#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name	i_deletion_substructures	i_domain	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_header	i_normal_VAF	i_normal_ref_reads	i_normal_var_reads	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_tier	i_title	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_VAF	i_tumor_ref_reads	i_tumor_var_reads	i_type	i_ucsc_cons	i_variant
ABCA12	26154	genome.wustl.edu	37	2	215855534	215855534	+	Silent	SNP	G	G	T			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr2:215855534G>T	ENST00000272895.7	-	24	3735	c.3516C>A	c.(3514-3516)acC>acA	p.T1172T	ABCA12_ENST00000389661.4_Silent_p.T854T	NM_173076.2	NP_775099.2	Q86UK0	ABCAC_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 12	1172					cellular homeostasis (GO:0019725)|ceramide transport (GO:0035627)|establishment of skin barrier (GO:0061436)|keratinization (GO:0031424)|lipid homeostasis (GO:0055088)|lipid transport (GO:0006869)|lung alveolus development (GO:0048286)|phospholipid efflux (GO:0033700)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of protein localization to cell surface (GO:2000010)|protein localization to plasma membrane (GO:0072659)|regulated secretory pathway (GO:0045055)|secretion by cell (GO:0032940)|surfactant homeostasis (GO:0043129)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|epidermal lamellar body (GO:0097209)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)	apolipoprotein A-I receptor binding (GO:0034191)|ATP binding (GO:0005524)|lipid transporter activity (GO:0005319)|lipid-transporting ATPase activity (GO:0034040)|receptor binding (GO:0005102)	p.T1172T(1)		NS(3)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(45)|lung(44)|ovary(8)|pancreas(2)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	139		Renal(323;0.127)		Epithelial(149;1.01e-05)|all cancers(144;0.00112)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)		CTGCAATGTTGGTGTTGTTGA	0.393																																					Ovarian(66;664 1488 5121 34295)												1	Substitution - coding silent(1)	lung(1)											108.0	100.0	103.0					2																	215855534		2203	4300	6503	SO:0001819	synonymous_variant	0			AF418105	CCDS33372.1, CCDS33373.1	2q34	2012-03-14			ENSG00000144452	ENSG00000144452		"""ATP binding cassette transporters / subfamily A"""	14637	protein-coding gene	gene with protein product		607800	"""ichthyosis congenita II, lamellar ichthyosis B"""	ICR2B		11435397, 12915478, 8845852, 10094194	Standard	NM_015657		Approved	DKFZP434G232, LI2	uc002vew.3	Q86UK0	OTTHUMG00000154801	ENST00000272895.7:c.3516C>A	2.37:g.215855534G>T			Q53QE2|Q53S55|Q8IZW6|Q96JT3|Q9Y4M5	Silent	SNP	pfam_ABC_transporter-like,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.T1172	ENST00000272895.7	37	c.3516	CCDS33372.1	2																																																																																			ABCA12	-	NULL	ENSG00000144452		0.393	ABCA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA12	HGNC	protein_coding	OTTHUMT00000337111.1	-	0.00	51	0	G	NM_173076		215855534	-1	tier1	-	no_errors	ENST00000272895	ensembl	human	known	74_37	silent	5.63	67	4	SNP	1.000	T
ABCA12	26154	genome.wustl.edu	37	2	215928909	215928909	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr2:215928909C>T	ENST00000272895.7	-	3	416	c.197G>A	c.(196-198)gGa>gAa	p.G66E		NM_173076.2	NP_775099.2	Q86UK0	ABCAC_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 12	66					cellular homeostasis (GO:0019725)|ceramide transport (GO:0035627)|establishment of skin barrier (GO:0061436)|keratinization (GO:0031424)|lipid homeostasis (GO:0055088)|lipid transport (GO:0006869)|lung alveolus development (GO:0048286)|phospholipid efflux (GO:0033700)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of protein localization to cell surface (GO:2000010)|protein localization to plasma membrane (GO:0072659)|regulated secretory pathway (GO:0045055)|secretion by cell (GO:0032940)|surfactant homeostasis (GO:0043129)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|epidermal lamellar body (GO:0097209)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)	apolipoprotein A-I receptor binding (GO:0034191)|ATP binding (GO:0005524)|lipid transporter activity (GO:0005319)|lipid-transporting ATPase activity (GO:0034040)|receptor binding (GO:0005102)			NS(3)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(45)|lung(44)|ovary(8)|pancreas(2)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	139		Renal(323;0.127)		Epithelial(149;1.01e-05)|all cancers(144;0.00112)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)		TGGAAAGAATCCAGTACTAGG	0.418																																					Ovarian(66;664 1488 5121 34295)												0													172.0	162.0	166.0					2																	215928909		2203	4300	6503	SO:0001583	missense	0			AF418105	CCDS33372.1, CCDS33373.1	2q34	2012-03-14			ENSG00000144452	ENSG00000144452		"""ATP binding cassette transporters / subfamily A"""	14637	protein-coding gene	gene with protein product		607800	"""ichthyosis congenita II, lamellar ichthyosis B"""	ICR2B		11435397, 12915478, 8845852, 10094194	Standard	NM_015657		Approved	DKFZP434G232, LI2	uc002vew.3	Q86UK0	OTTHUMG00000154801	ENST00000272895.7:c.197G>A	2.37:g.215928909C>T	ENSP00000272895:p.Gly66Glu		Q53QE2|Q53S55|Q8IZW6|Q96JT3|Q9Y4M5	Missense_Mutation	SNP	pfam_ABC_transporter-like,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.G66E	ENST00000272895.7	37	c.197	CCDS33372.1	2	.	.	.	.	.	.	.	.	.	.	C	23.3	4.401436	0.83120	.	.	ENSG00000144452	ENST00000272895	D	0.99881	-7.47	5.79	5.79	0.91817	.	0.387292	0.24965	N	0.034190	D	0.99885	0.9945	M	0.86028	2.79	0.80722	D	1	D	0.89917	1.0	D	0.74674	0.984	D	0.96501	0.9371	10	0.87932	D	0	.	16.9585	0.86266	0.0:1.0:0.0:0.0	.	66	Q86UK0	ABCAC_HUMAN	E	66	ENSP00000272895:G66E	ENSP00000272895:G66E	G	-	2	0	ABCA12	215637154	1.000000	0.71417	0.997000	0.53966	0.917000	0.54804	4.681000	0.61663	2.736000	0.93811	0.655000	0.94253	GGA	ABCA12	-	NULL	ENSG00000144452		0.418	ABCA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA12	HGNC	protein_coding	OTTHUMT00000337111.1	-	0.00	44	0	C	NM_173076		215928909	-1	tier1	-	no_errors	ENST00000272895	ensembl	human	known	74_37	missense	6.45	58	4	SNP	1.000	T
ABCA7	10347	genome.wustl.edu	37	19	1046340	1046340	+	Silent	SNP	C	C	T	rs369256437	byFrequency	TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr19:1046340C>T	ENST00000263094.6	+	13	1788	c.1557C>T	c.(1555-1557)agC>agT	p.S519S	ABCA7_ENST00000435683.2_Silent_p.S381S|ABCA7_ENST00000533574.1_3'UTR|ABCA7_ENST00000433129.1_Silent_p.S519S	NM_019112.3	NP_061985.2	Q8IZY2	ABCA7_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 7	519					apolipoprotein A-I-mediated signaling pathway (GO:0038027)|ATP catabolic process (GO:0006200)|cholesterol efflux (GO:0033344)|high-density lipoprotein particle assembly (GO:0034380)|memory (GO:0007613)|negative regulation of amyloid precursor protein biosynthetic process (GO:0042985)|negative regulation of ATPase activity (GO:0032780)|negative regulation of beta-amyloid formation (GO:1902430)|peptide cross-linking (GO:0018149)|phagocytosis (GO:0006909)|phospholipid efflux (GO:0033700)|phospholipid scrambling (GO:0017121)|positive regulation of ATPase activity (GO:0032781)|positive regulation of beta-amyloid clearance (GO:1900223)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of engulfment of apoptotic cell (GO:1901076)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phagocytosis (GO:0050766)|positive regulation of phospholipid efflux (GO:1902995)|protein localization to nucleus (GO:0034504)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|ATP-binding cassette (ABC) transporter complex (GO:0043190)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|phagocytic cup (GO:0001891)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	apolipoprotein A-I receptor activity (GO:0034188)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|phospholipid transporter activity (GO:0005548)|transporter activity (GO:0005215)			NS(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(7)|lung(22)|ovary(1)|pancreas(7)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	65		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GCGTGCTCAGCGGCGCCAACC	0.706													C|||	4	0.000798722	0.003	0.0	5008	,	,		12125	0.0		0.0	False		,,,				2504	0.0																0										2,4404	4.2+/-10.8	0,2,2201	134.0	141.0	139.0		1557	-3.5	0.9	19		139	0,8592		0,0,4296	no	coding-synonymous	ABCA7	NM_019112.3		0,2,6497	TT,TC,CC		0.0,0.0454,0.0154		519/2147	1046340	2,12996	2203	4296	6499	SO:0001819	synonymous_variant	0			AF328787	CCDS12055.1	19p13.3	2012-03-14			ENSG00000064687	ENSG00000064687		"""ATP binding cassette transporters / subfamily A"""	37	protein-coding gene	gene with protein product		605414					Standard	NM_019112		Approved	ABCX	uc002lqw.4	Q8IZY2	OTTHUMG00000167547	ENST00000263094.6:c.1557C>T	19.37:g.1046340C>T			Q96S58|Q9BZC4|Q9NR73|Q9UKP8	Silent	SNP	pfam_ABC_transporter-like,superfamily_P-loop_NTPase,superfamily_GroES-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.S519	ENST00000263094.6	37	c.1557	CCDS12055.1	19																																																																																			ABCA7	-	NULL	ENSG00000064687		0.706	ABCA7-001	KNOWN	basic|CCDS	protein_coding	ABCA7	HGNC	protein_coding	OTTHUMT00000394993.1		0.00	91	0	C	NM_019112		1046340	+1			no_errors	ENST00000263094	ensembl	human	known	74_37	silent	5.26	72	4	SNP	0.843	T
ABCG1	9619	genome.wustl.edu	37	21	43717138	43717138	+	3'UTR	SNP	G	G	A			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr21:43717138G>A	ENST00000361802.2	+	0	2818				ABCG1_ENST00000398437.1_3'UTR|ABCG1_ENST00000343687.3_3'UTR|ABCG1_ENST00000347800.2_3'UTR|ABCG1_ENST00000398449.3_3'UTR|ABCG1_ENST00000462050.1_3'UTR|ABCG1_ENST00000398457.2_3'UTR|ABCG1_ENST00000340588.4_3'UTR	NM_004915.3	NP_004906.3	P45844	ABCG1_HUMAN	ATP-binding cassette, sub-family G (WHITE), member 1						amyloid precursor protein catabolic process (GO:0042987)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|detection of hormone stimulus (GO:0009720)|glycoprotein transport (GO:0034436)|high-density lipoprotein particle remodeling (GO:0034375)|intracellular cholesterol transport (GO:0032367)|lipoprotein metabolic process (GO:0042157)|low-density lipoprotein particle remodeling (GO:0034374)|negative regulation of cholesterol storage (GO:0010887)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|phospholipid efflux (GO:0033700)|phospholipid homeostasis (GO:0055091)|positive regulation of cholesterol biosynthetic process (GO:0045542)|positive regulation of cholesterol efflux (GO:0010875)|regulation of cholesterol esterification (GO:0010872)|regulation of transcription, DNA-templated (GO:0006355)|response to high density lipoprotein particle (GO:0055099)|response to lipid (GO:0033993)|response to organic substance (GO:0010033)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)|toxin transport (GO:1901998)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|cholesterol binding (GO:0015485)|cholesterol transporter activity (GO:0017127)|glycoprotein transporter activity (GO:0034437)|phospholipid binding (GO:0005543)|phospholipid transporter activity (GO:0005548)|protein dimerization activity (GO:0046983)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|sterol-transporting ATPase activity (GO:0034041)|toxin transporter activity (GO:0019534)			breast(1)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(8)|lung(6)|ovary(3)|prostate(2)|stomach(1)	29					Adenosine triphosphate(DB00171)	GTTTAACCGAGTCACCCAGCT	0.443																																																	0																																										SO:0001624	3_prime_UTR_variant	0			U34919	CCDS13681.1, CCDS13682.1, CCDS13683.1, CCDS42937.1, CCDS42938.1	21q22.3	2012-03-14			ENSG00000160179	ENSG00000160179		"""ATP binding cassette transporters / subfamily G"""	73	protein-coding gene	gene with protein product	"""ATP-binding cassette transporter 8"""	603076				8659545, 16870176	Standard	NM_016818		Approved	ABC8	uc002zaq.3	P45844	OTTHUMG00000086791	ENST00000361802.2:c.*636G>A	21.37:g.43717138G>A			Q86SU8|Q96L76|Q9BXK6|Q9BXK7|Q9BXK8|Q9BXK9|Q9BXL0|Q9BXL1|Q9BXL2|Q9BXL3|Q9BXL4	RNA	SNP	-	NULL	ENST00000361802.2	37	NULL	CCDS13682.1	21																																																																																			ABCG1	-	-	ENSG00000160179		0.443	ABCG1-006	KNOWN	basic|CCDS	protein_coding	ABCG1	HGNC	protein_coding	OTTHUMT00000195318.2	-	0.00	13	0	G	NM_207174		43717138	+1	tier1	-	no_errors	ENST00000462050	ensembl	human	known	74_37	rna	61.54	5	8	SNP	0.000	A
ACAD8	27034	genome.wustl.edu	37	11	134128431	134128431	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr11:134128431A>G	ENST00000281182.4	+	4	509	c.403A>G	c.(403-405)Agc>Ggc	p.S135G	ACAD8_ENST00000537423.1_Missense_Mutation_p.S58G|ACAD8_ENST00000543332.1_Missense_Mutation_p.S37G|ACAD8_ENST00000374752.4_Intron|ACAD8_ENST00000524547.1_Intron	NM_014384.2	NP_055199.1	Q9UKU7	ACAD8_HUMAN	acyl-CoA dehydrogenase family, member 8	135					branched-chain amino acid catabolic process (GO:0009083)|cellular nitrogen compound metabolic process (GO:0034641)|lipid metabolic process (GO:0006629)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)|valine catabolic process (GO:0006574)	mitochondrial matrix (GO:0005759)	acyl-CoA dehydrogenase activity (GO:0003995)|flavin adenine dinucleotide binding (GO:0050660)			endometrium(4)|large_intestine(3)|lung(5)|ovary(1)|urinary_tract(1)	14	all_hematologic(175;0.127)	all_cancers(12;8e-23)|all_epithelial(12;2.59e-16)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000182)|all_neural(223;0.0189)|Medulloblastoma(222;0.0245)|Esophageal squamous(93;0.0559)		Epithelial(10;1.92e-10)|all cancers(11;2.26e-09)|BRCA - Breast invasive adenocarcinoma(10;8.73e-09)|OV - Ovarian serous cystadenocarcinoma(99;0.00154)|Lung(977;0.21)	Flavin adenine dinucleotide(DB03147)	GATGATTGATAGCTTCGGAAA	0.438																																					GBM(65;238 1125 33403 41853 48889)												0													121.0	89.0	100.0					11																	134128431		2201	4297	6498	SO:0001583	missense	0			AF126245	CCDS8498.1	11q25	2014-09-17	2010-04-30		ENSG00000151498	ENSG00000151498			87	protein-coding gene	gene with protein product		604773	"""acyl-Coenzyme A dehydrogenase family, member 8"""			10524212	Standard	NM_014384		Approved		uc001qhk.3	Q9UKU7	OTTHUMG00000167177	ENST00000281182.4:c.403A>G	11.37:g.134128431A>G	ENSP00000281182:p.Ser135Gly		B7Z5W4|Q6ZWP6|Q9BUS8	Missense_Mutation	SNP	pfam_AcylCo_DH/oxidase_C,pfam_AcylCoA_DH/ox_N,pfam_Acyl-CoA_DH_2_C,pfam_Acyl-CoA_Oxase/DH_cen-dom,superfamily_AcylCoA_DH/oxidase_NM_dom,superfamily_AcylCo_DH/oxidase_C	p.S135G	ENST00000281182.4	37	c.403	CCDS8498.1	11	.	.	.	.	.	.	.	.	.	.	A	15.94	2.980782	0.53827	.	.	ENSG00000151498	ENST00000281182;ENST00000537423;ENST00000543332;ENST00000537915	D;D;D	0.99711	-6.49;-6.49;-5.2	5.44	-2.43	0.06522	Acyl-CoA dehydrogenase/oxidase (1);Acyl-CoA dehydrogenase, N-terminal (1);Acyl-CoA dehydrogenase/oxidase, N-terminal (1);	0.367004	0.32918	N	0.005496	D	0.97898	0.9309	L	0.53617	1.68	0.30362	N	0.783717	B;B;B;B;B	0.31026	0.248;0.169;0.304;0.02;0.074	B;B;B;B;B	0.28784	0.094;0.073;0.064;0.026;0.046	D	0.96679	0.9502	10	0.35671	T	0.21	.	1.9759	0.03415	0.4947:0.2:0.1963:0.109	.	76;58;37;37;135	B7Z767;B7Z5W4;B7Z9L5;B7Z7F1;Q9UKU7	.;.;.;.;ACAD8_HUMAN	G	135;58;37;97	ENSP00000281182:S135G;ENSP00000443763:S58G;ENSP00000438302:S37G	ENSP00000281182:S135G	S	+	1	0	ACAD8	133633641	0.644000	0.27277	0.987000	0.45799	0.994000	0.84299	1.679000	0.37597	-0.199000	0.10317	0.533000	0.62120	AGC	ACAD8	-	pfam_AcylCoA_DH/ox_N,superfamily_AcylCoA_DH/oxidase_NM_dom	ENSG00000151498		0.438	ACAD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACAD8	HGNC	protein_coding	OTTHUMT00000393607.1	-	0.00	50	0	A	NM_014384		134128431	+1	tier1	-	no_errors	ENST00000281182	ensembl	human	known	74_37	missense	8.89	41	4	SNP	0.987	G
ACBD5	91452	genome.wustl.edu	37	10	27507044	27507044	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr10:27507044T>C	ENST00000375888.1	-	7	785	c.721A>G	c.(721-723)Aaa>Gaa	p.K241E	ACBD5_ENST00000375905.4_Missense_Mutation_p.K197E|ACBD5_ENST00000476758.1_5'UTR|ACBD5_ENST00000375901.1_Missense_Mutation_p.K123E|ACBD5_ENST00000396271.3_Missense_Mutation_p.K232E|ACBD5_ENST00000375897.3_Intron			Q5T8D3	ACBD5_HUMAN	acyl-CoA binding domain containing 5	241					peroxisome degradation (GO:0030242)|transport (GO:0006810)	integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)|peroxisome (GO:0005777)	fatty-acyl-CoA binding (GO:0000062)|lipid binding (GO:0008289)			breast(1)|endometrium(1)|large_intestine(3)|lung(7)|prostate(1)	13						AAGCCATCTTTATCATAGCCA	0.368																																																	0													205.0	193.0	197.0					10																	27507044		2203	4300	6503	SO:0001583	missense	0			AF505653	CCDS7154.1, CCDS44368.1, CCDS73079.1	10p12.1	2010-04-30	2010-04-30		ENSG00000107897	ENSG00000107897			23338	protein-coding gene	gene with protein product			"""acyl-Coenzyme A binding domain containing 5"""			12056414	Standard	NR_024150		Approved	DKFZp434A2417, KIAA1996	uc010qdp.2	Q5T8D3	OTTHUMG00000017854	ENST00000375888.1:c.721A>G	10.37:g.27507044T>C	ENSP00000365049:p.Lys241Glu		B3KQ56|D3DRW0|Q5T8D4|Q5T8E1|Q5T8E2|Q86UV1|Q8N6E3|Q9UFB5	Missense_Mutation	SNP	pfam_Acyl-CoA-binding_protein,superfamily_Acyl-CoA-binding_protein,pirsf_M-assoc_diazepam-bd-inh,prints_Acyl-CoA-binding_protein	p.K241E	ENST00000375888.1	37	c.721		10	.	.	.	.	.	.	.	.	.	.	T	12.84	2.059531	0.36373	.	.	ENSG00000107897	ENST00000375889;ENST00000396271;ENST00000375905;ENST00000375901;ENST00000375888;ENST00000426079;ENST00000412279	D;T;T;T;T;T	0.83837	-1.77;2.16;1.41;2.43;2.1;1.81	5.11	3.97	0.46021	.	0.600069	0.18134	N	0.150657	T	0.74321	0.3701	L	0.39397	1.21	0.80722	D	1	B;B;B	0.13594	0.008;0.003;0.003	B;B;B	0.12837	0.008;0.006;0.002	T	0.66654	-0.5869	10	0.40728	T	0.16	-13.9895	7.7469	0.28875	0.0:0.1652:0.0:0.8348	.	232;230;241	Q5T8D3-3;B7Z2R7;Q5T8D3	.;.;ACBD5_HUMAN	E	238;232;197;123;241;250;208	ENSP00000379568:K232E;ENSP00000365070:K197E;ENSP00000365066:K123E;ENSP00000365049:K241E;ENSP00000401591:K250E;ENSP00000393398:K208E	ENSP00000365049:K241E	K	-	1	0	ACBD5	27547050	0.998000	0.40836	0.995000	0.50966	0.997000	0.91878	0.970000	0.29383	0.786000	0.33708	0.477000	0.44152	AAA	ACBD5	-	pirsf_M-assoc_diazepam-bd-inh	ENSG00000107897		0.368	ACBD5-005	KNOWN	basic	protein_coding	ACBD5	HGNC	protein_coding	OTTHUMT00000047314.1	-	0.00	43	0	T	NM_145698		27507044	-1	tier1	-	no_errors	ENST00000375888	ensembl	human	known	74_37	missense	7.41	50	4	SNP	0.999	C
ADAMTSL1	92949	genome.wustl.edu	37	9	18775775	18775775	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr9:18775775G>T	ENST00000380548.4	+	18	2771	c.2432G>T	c.(2431-2433)cGa>cTa	p.R811L		NM_001040272.5	NP_001035362.3	Q8N6G6	ATL1_HUMAN	ADAMTS-like 1	811	TSP type-1 7. {ECO:0000255|PROSITE- ProRule:PRU00210}.					proteinaceous extracellular matrix (GO:0005578)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|liver(2)|lung(17)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	42				GBM - Glioblastoma multiforme(50;1.29e-17)		ACCCAGACTCGAAGCGCCATT	0.512																																																	0													54.0	59.0	58.0					9																	18775775		1960	4158	6118	SO:0001583	missense	0			AF176313	CCDS6485.1, CCDS47954.1	9p21.3	2013-01-11			ENSG00000178031	ENSG00000178031		"""Immunoglobulin superfamily / I-set domain containing"""	14632	protein-coding gene	gene with protein product	"""punctin"""	609198	"""chromosome 9 open reading frame 94"""	C9orf94		9628581, 11805097	Standard	NM_001040272		Approved	ADAMTSR1, FLJ35283	uc003zne.4	Q8N6G6	OTTHUMG00000019604	ENST00000380548.4:c.2432G>T	9.37:g.18775775G>T	ENSP00000369921:p.Arg811Leu		A6PVN1|A8K7E1|Q496M6|Q496M8|Q5T708|Q5VZT8|Q8NAI9|Q96RW4|Q9BXY3	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Thrombospondin_1_rpt,pfam_Immunoglobulin,pfam_PLAC,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,smart_Ig_sub,smart_Ig_sub2,prints_Peptidase_M12B_ADAM-TS,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Ig-like_dom	p.R811L	ENST00000380548.4	37	c.2432	CCDS47954.1	9	.	.	.	.	.	.	.	.	.	.	G	17.17	3.321323	0.60634	.	.	ENSG00000178031	ENST00000380548	T	0.80824	-1.42	5.81	5.81	0.92471	.	0.695701	0.08080	U	1.000000	D	0.90724	0.7089	H	0.99197	4.465	0.80722	D	1	B	0.30193	0.272	B	0.33799	0.17	D	0.88569	0.3128	10	0.87932	D	0	.	13.2939	0.60286	0.0719:0.0:0.9281:0.0	.	811	Q8N6G6	ATL1_HUMAN	L	811	ENSP00000369921:R811L	ENSP00000369921:R811L	R	+	2	0	ADAMTSL1	18765775	1.000000	0.71417	0.939000	0.37840	0.254000	0.26022	4.761000	0.62243	2.736000	0.93811	0.655000	0.94253	CGA	ADAMTSL1	-	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	ENSG00000178031		0.512	ADAMTSL1-012	NOVEL	basic|appris_principal|CCDS	protein_coding	ADAMTSL1	HGNC	protein_coding	OTTHUMT00000401206.1	-	0.00	43	0	G			18775775	+1	tier1	-	no_errors	ENST00000380548	ensembl	human	novel	74_37	missense	6.78	55	4	SNP	0.994	T
ADRA1A	148	genome.wustl.edu	37	8	26614236	26614236	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr8:26614236T>G	ENST00000380581.2	-	2	1379	c.944A>C	c.(943-945)aAg>aCg	p.K315T	ADRA1A_ENST00000380587.1_Intron|ADRA1A_ENST00000380586.1_Intron|ADRA1A_ENST00000380582.3_3'UTR|ADRA1A_ENST00000519229.1_3'UTR			P25100	ADA1D_HUMAN	adrenoceptor alpha 1A	0					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|adrenergic receptor signaling pathway (GO:0071875)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|DNA metabolic process (GO:0006259)|G-protein coupled receptor signaling pathway (GO:0007186)|multicellular organismal development (GO:0007275)|negative regulation of the force of heart contraction involved in baroreceptor response to increased systemic arterial blood pressure (GO:0001986)|norepinephrine-epinephrine vasoconstriction involved in regulation of systemic arterial blood pressure (GO:0001994)|positive regulation of cell proliferation (GO:0008284)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	alpha1-adrenergic receptor activity (GO:0004937)			breast(2)|endometrium(3)|kidney(1)|large_intestine(10)|lung(17)|ovary(1)|prostate(1)|skin(1)	36		all_cancers(63;0.122)|Ovarian(32;2.61e-05)|all_epithelial(46;0.118)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0228)|Epithelial(17;4.92e-10)|Colorectal(74;0.0132)|READ - Rectum adenocarcinoma(644;0.115)	Alfuzosin(DB00346)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Amphetamine(DB00182)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Carvedilol(DB01136)|Chlorpromazine(DB00477)|Clonidine(DB00575)|Dapiprazole(DB00298)|Desipramine(DB01151)|Doxazosin(DB00590)|Doxepin(DB01142)|Dronedarone(DB04855)|Droxidopa(DB06262)|Epinephrine(DB00668)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Fenoldopam(DB00800)|Imipramine(DB00458)|Labetalol(DB00598)|Maprotiline(DB00934)|Mephentermine(DB01365)|Methotrimeprazine(DB01403)|Methoxamine(DB00723)|Mianserin(DB06148)|Midodrine(DB00211)|Mirtazapine(DB00370)|Nicardipine(DB00622)|Norepinephrine(DB00368)|Nortriptyline(DB00540)|Oxymetazoline(DB00935)|Pergolide(DB01186)|Phenoxybenzamine(DB00925)|Phenylephrine(DB00388)|Prazosin(DB00457)|Promazine(DB00420)|Propiomazine(DB00777)|Quetiapine(DB01224)|Sertindole(DB06144)|Silodosin(DB06207)|Tamsulosin(DB00706)|Terazosin(DB01162)|Xylometazoline(DB06694)	CTCCCCTTCCTTGGGCAGTAA	0.507																																																	0													126.0	106.0	113.0					8																	26614236		2203	4300	6503	SO:0001583	missense	0			L31774	CCDS6052.1, CCDS6053.1, CCDS6054.1, CCDS34869.1	8p21.2	2012-08-08	2012-05-09		ENSG00000120907	ENSG00000120907		"""GPCR / Class A : Adrenoceptors : alpha"""	277	protein-coding gene	gene with protein product		104221	"""adrenergic, alpha-1A-, receptor"""	ADRA1C			Standard	NM_033303		Approved	ADRA1L1	uc003xfh.1	P35348	OTTHUMG00000099459	ENST00000380581.2:c.944A>C	8.37:g.26614236T>G	ENSP00000369955:p.Lys315Thr		Q9NPY0	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn,prints_ADRA1A_rcpt,prints_ADR_fam	p.K315T	ENST00000380581.2	37	c.944		8	.	.	.	.	.	.	.	.	.	.	T	9.765	1.171115	0.21621	.	.	ENSG00000120907	ENST00000380581	T	0.59906	0.23	3.0	-6.0	0.02206	.	.	.	.	.	T	0.35740	0.0942	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.26121	-1.0112	8	0.87932	D	0	.	0.2747	0.00236	0.1901:0.2053:0.2366:0.368	.	315	P35348-9	.	T	315	ENSP00000369955:K315T	ENSP00000369955:K315T	K	-	2	0	ADRA1A	26670153	0.000000	0.05858	0.000000	0.03702	0.061000	0.15899	-2.609000	0.00886	-1.997000	0.00969	-0.425000	0.05940	AAG	ADRA1A	-	NULL	ENSG00000120907		0.507	ADRA1A-202	KNOWN	basic	protein_coding	ADRA1A	HGNC	protein_coding		-	0.00	49	0	T	NM_033303		26614236	-1	tier1	-	no_errors	ENST00000380581	ensembl	human	known	74_37	missense	9.26	49	5	SNP	0.000	G
AHCYL1	10768	genome.wustl.edu	37	1	110557445	110557445	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr1:110557445G>T	ENST00000369799.5	+	6	1008	c.641G>T	c.(640-642)cGc>cTc	p.R214L	AHCYL1_ENST00000359172.3_Missense_Mutation_p.R167L|AHCYL1_ENST00000475081.1_3'UTR|AHCYL1_ENST00000393614.4_Missense_Mutation_p.R167L	NM_001242673.1|NM_001242674.1|NM_006621.5	NP_001229602.1|NP_001229603.1|NP_006612.2	O43865	SAHH2_HUMAN	adenosylhomocysteinase-like 1	214					mRNA polyadenylation (GO:0006378)|one-carbon metabolic process (GO:0006730)|positive regulation of sodium ion transport (GO:0010765)|protein export from nucleus (GO:0006611)|regulation of anion transport (GO:0044070)|regulation of ion transmembrane transporter activity (GO:0032412)|regulation of mRNA 3'-end processing (GO:0031440)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)	adenosylhomocysteinase activity (GO:0004013)	p.R214H(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(6)|ovary(1)|prostate(2)	18		all_epithelial(167;3.58e-05)|all_lung(203;0.000116)|Lung NSC(277;0.000233)		Lung(183;0.0259)|Colorectal(144;0.123)|all cancers(265;0.134)|Epithelial(280;0.141)|LUSC - Lung squamous cell carcinoma(189;0.143)		TGTATTGACCGCTGTGTGAAC	0.438																																																	1	Substitution - Missense(1)	large_intestine(1)											213.0	190.0	198.0					1																	110557445		2203	4300	6503	SO:0001583	missense	0			U82761	CCDS818.1, CCDS55620.1	1p13	2014-06-12	2009-06-12		ENSG00000168710	ENSG00000168710			344	protein-coding gene	gene with protein product	"""inositol 1,4,5-trisphosphate receptor-binding protein"", ""protein phosphatase 1, regulatory subunit 78"""	607826	"""S-adenosylhomocysteine hydrolase-like 1"""			11904675, 16754674, 12525476	Standard	NM_006621		Approved	XPVKONA, IRBIT, PPP1R78	uc001dyx.3	O43865	OTTHUMG00000011652	ENST00000369799.5:c.641G>T	1.37:g.110557445G>T	ENSP00000358814:p.Arg214Leu		B4E168|Q2TAJ6|Q502W8|Q5VSM0|Q6P171|Q96PK4|Q9UG84	Missense_Mutation	SNP	pfam_Adenosylhomocysteinase,pfam_Ado_hCys_hydrolase_NAD-bd,pfam_D-isomer_2_OHA_DH_NAD-bd,pfam_IlvN,pirsf_Adenosylhomocysteinase,tigrfam_Adenosylhomocysteinase	p.R214L	ENST00000369799.5	37	c.641	CCDS818.1	1	.	.	.	.	.	.	.	.	.	.	G	19.86	3.905056	0.72868	.	.	ENSG00000168710	ENST00000369799;ENST00000359172;ENST00000393614	T;T;T	0.78481	-1.18;-1.18;-1.18	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	T	0.71668	0.3367	M	0.70787	2.145	0.80722	D	1	P	0.38767	0.646	B	0.31946	0.138	T	0.77064	-0.2726	10	0.87932	D	0	-9.99	20.8794	0.99867	0.0:0.0:1.0:0.0	.	214	O43865	SAHH2_HUMAN	L	214;167;167	ENSP00000358814:R214L;ENSP00000352092:R167L;ENSP00000377238:R167L	ENSP00000352092:R167L	R	+	2	0	AHCYL1	110358968	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.946000	0.87746	2.941000	0.99782	0.655000	0.94253	CGC	AHCYL1	-	pfam_Adenosylhomocysteinase,pirsf_Adenosylhomocysteinase,tigrfam_Adenosylhomocysteinase	ENSG00000168710		0.438	AHCYL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AHCYL1	HGNC	protein_coding	OTTHUMT00000032243.1		0.00	37	0	G			110557445	+1			no_errors	ENST00000369799	ensembl	human	known	74_37	missense	6.85	68	5	SNP	1.000	T
AHI1	54806	genome.wustl.edu	37	6	135784408	135784408	+	Silent	SNP	T	T	C			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr6:135784408T>C	ENST00000367800.4	-	6	1002	c.786A>G	c.(784-786)gaA>gaG	p.E262E	AHI1_ENST00000457866.2_Silent_p.E262E|AHI1_ENST00000327035.6_Silent_p.E262E	NM_001134830.1	NP_001128302.1	Q8N157	AHI1_HUMAN	Abelson helper integration site 1	262	Interaction with HAP1.				cellular protein localization (GO:0034613)|central nervous system development (GO:0007417)|cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|cloaca development (GO:0035844)|heart looping (GO:0001947)|hindbrain development (GO:0030902)|Kupffer's vesicle development (GO:0070121)|left/right axis specification (GO:0070986)|morphogenesis of a polarized epithelium (GO:0001738)|negative regulation of apoptotic process (GO:0043066)|otic vesicle development (GO:0071599)|photoreceptor cell outer segment organization (GO:0035845)|positive regulation of polarized epithelial cell differentiation (GO:0030862)|positive regulation of receptor internalization (GO:0002092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|pronephric duct morphogenesis (GO:0039023)|pronephric nephron tubule morphogenesis (GO:0039008)|protein localization to organelle (GO:0033365)|regulation of behavior (GO:0050795)|retina layer formation (GO:0010842)|specification of axis polarity (GO:0065001)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vesicle targeting (GO:0006903)|vesicle-mediated transport (GO:0016192)	adherens junction (GO:0005912)|cell-cell junction (GO:0005911)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cilium (GO:0005929)|nonmotile primary cilium (GO:0031513)|photoreceptor outer segment (GO:0001750)|primary cilium (GO:0072372)|TCTN-B9D complex (GO:0036038)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(18)|ovary(1)	37	Breast(56;0.239)|Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00904)|OV - Ovarian serous cystadenocarcinoma(155;0.00991)		CTTTCTTTTGTTCACCTTCAA	0.328																																																	0													155.0	143.0	147.0					6																	135784408		1854	4097	5951	SO:0001819	synonymous_variant	0			AJ459824	CCDS47483.1, CCDS47484.1	6q23.2	2013-01-10	2005-11-29		ENSG00000135541	ENSG00000135541		"""WD repeat domain containing"""	21575	protein-coding gene	gene with protein product	"""Jouberin"""	608894	"""Abelson helper integration site"""			15060101, 16240161	Standard	NM_017651		Approved	FLJ20069, ORF1, JBTS3	uc003qgj.3	Q8N157	OTTHUMG00000015631	ENST00000367800.4:c.786A>G	6.37:g.135784408T>C			E1P584|Q4FD35|Q504T3|Q5TCP9|Q6P098|Q6PIT6|Q8NDX0|Q9H0H2	Silent	SNP	pfam_WD40_repeat,pfam_SH3_domain,pfam_SH3_2,superfamily_WD40_repeat_dom,superfamily_SH3_domain,smart_WD40_repeat,smart_SH3_domain,pfscan_SH3_domain,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_SH3_domain	p.E262	ENST00000367800.4	37	c.786	CCDS47483.1	6																																																																																			AHI1	-	NULL	ENSG00000135541		0.328	AHI1-008	KNOWN	basic|appris_principal|CCDS	protein_coding	AHI1	HGNC	protein_coding	OTTHUMT00000391948.1	-	0.00	30	0	T	NM_017651		135784408	-1	tier1	-	no_errors	ENST00000265602	ensembl	human	known	74_37	silent	32.00	17	8	SNP	0.976	C
AICDA	57379	genome.wustl.edu	37	12	8759587	8759587	+	Missense_Mutation	SNP	C	C	A	rs387906328		TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr12:8759587C>A	ENST00000229335.6	-	2	133	c.30G>T	c.(28-30)aaG>aaT	p.K10N	AICDA_ENST00000537228.1_Missense_Mutation_p.K10N	NM_020661.2	NP_065712.1	Q9GZX7	AICDA_HUMAN	activation-induced cytidine deaminase	10	Interaction with SUPT6H.|Nuclear localization signal.				B cell differentiation (GO:0030183)|cellular response to lipopolysaccharide (GO:0071222)|DNA demethylation (GO:0080111)|isotype switching (GO:0045190)|mRNA processing (GO:0006397)|negative regulation of methylation-dependent chromatin silencing (GO:0090310)|somatic diversification of immunoglobulins (GO:0016445)|somatic hypermutation of immunoglobulin genes (GO:0016446)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	cytidine deaminase activity (GO:0004126)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(4)|ovary(2)|pancreas(1)	16	Lung SC(5;0.184)					GGTAAAGAAACTTCCTCCGGT	0.468																																					GBM(62;896 1067 5527 26594 30137)												0													44.0	43.0	44.0					12																	8759587		1904	4108	6012	SO:0001583	missense	0			AB040430	CCDS41747.1	12p13	2014-09-17			ENSG00000111732	ENSG00000111732		"""Apolipoprotein B mRNA editing enzymes"""	13203	protein-coding gene	gene with protein product		605257					Standard	NM_020661		Approved	HIGM2, CDA2, ARP2, AID	uc001qur.2	Q9GZX7	OTTHUMG00000168676	ENST00000229335.6:c.30G>T	12.37:g.8759587C>A	ENSP00000229335:p.Lys10Asn		Q6QJ81|Q8NFC1	Missense_Mutation	SNP	pfam_APOBEC_N,pfam_APOBEC_C,superfamily_Cytidine_deaminase-like	p.K10N	ENST00000229335.6	37	c.30	CCDS41747.1	12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	9.780|9.780	1.175182|1.175182	0.21704|0.21704	.|.	.|.	ENSG00000111732|ENSG00000111732	ENST00000229335;ENST00000537228|ENST00000543081;ENST00000544516;ENST00000545512	T;T|.	0.65364|.	-0.15;-0.15|.	5.36|5.36	3.2|3.2	0.36748|0.36748	APOBEC-like, N-terminal (1);|.	0.326972|.	0.35291|.	N|.	0.003302|.	T|T	0.63558|0.63558	0.2521|0.2521	M|M	0.70595|0.70595	2.14|2.14	0.49798|0.49798	D|D	0.999826|0.999826	B;P;B|.	0.38250|.	0.314;0.624;0.314|.	B;B;B|.	0.32864|.	0.098;0.154;0.098|.	T|T	0.62148|0.62148	-0.6915|-0.6915	10|5	0.87932|.	D|.	0|.	-5.6687|-5.6687	8.1384|8.1384	0.31069|0.31069	0.0:0.6911:0.1372:0.1716|0.0:0.6911:0.1372:0.1716	.|.	10;10;10|.	Q9GZX7;Q6QJ80;Q6QJ81|.	AICDA_HUMAN;.;.|.	N|I	10|9	ENSP00000229335:K10N;ENSP00000445691:K10N|.	ENSP00000229335:K10N|.	K|S	-|-	3|2	2|0	AICDA|AICDA	8650854|8650854	0.986000|0.986000	0.35501|0.35501	0.951000|0.951000	0.38953|0.38953	0.151000|0.151000	0.21798|0.21798	0.237000|0.237000	0.17985|0.17985	1.268000|1.268000	0.44264|0.44264	-0.363000|-0.363000	0.07495|0.07495	AAG|AGT	AICDA	-	pfam_APOBEC_N	ENSG00000111732		0.468	AICDA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AICDA	HGNC	protein_coding	OTTHUMT00000400575.1	-	0.00	41	0	C	NM_020661		8759587	-1	tier1	-	no_errors	ENST00000229335	ensembl	human	known	74_37	missense	10.71	50	6	SNP	0.970	A
ALMS1	7840	genome.wustl.edu	37	2	73676804	73676804	+	Silent	SNP	C	C	T			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr2:73676804C>T	ENST00000264448.6	+	8	3258	c.3147C>T	c.(3145-3147)taC>taT	p.Y1049Y	ALMS1_ENST00000409009.1_Silent_p.Y1007Y|ALMS1_ENST00000377715.1_Silent_p.Y1049Y	NM_015120.4	NP_055935	Q8TCU4	ALMS1_HUMAN	Alstrom syndrome 1	1049	34 X 47 AA approximate tandem repeat.				endosomal transport (GO:0016197)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|regulation of stress fiber assembly (GO:0051492)	centrosome (GO:0005813)|cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)				breast(4)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(31)|lung(68)|ovary(4)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	147						CTAGTTCTTACCCACAGAGGG	0.488																																																	0													136.0	136.0	136.0					2																	73676804		1888	4116	6004	SO:0001819	synonymous_variant	0			AB002326	CCDS42697.1	2p13.1	2014-09-17			ENSG00000116127	ENSG00000116127			428	protein-coding gene	gene with protein product		606844				9063741	Standard	NM_015120		Approved	KIAA0328	uc002sje.1	Q8TCU4	OTTHUMG00000152812	ENST00000264448.6:c.3147C>T	2.37:g.73676804C>T			Q53S05|Q580Q8|Q86VP9|Q9Y4G4	Silent	SNP	NULL	p.Y1049	ENST00000264448.6	37	c.3147	CCDS42697.1	2																																																																																			ALMS1	-	NULL	ENSG00000116127		0.488	ALMS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ALMS1	HGNC	protein_coding	OTTHUMT00000327776.1	-	0.00	37	0	C	NM_015120		73676804	+1	tier1	-	no_errors	ENST00000264448	ensembl	human	known	74_37	silent	8.51	43	4	SNP	0.000	T
ALOX12B	242	genome.wustl.edu	37	17	7984078	7984078	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr17:7984078C>A	ENST00000319144.4	-	5	808	c.548G>T	c.(547-549)gGa>gTa	p.G183V	ALOX12B_ENST00000577351.1_5'Flank|AC129492.6_ENST00000399413.3_3'UTR	NM_001139.2	NP_001130.1	O75342	LX12B_HUMAN	arachidonate 12-lipoxygenase, 12R type	183	Lipoxygenase. {ECO:0000255|PROSITE- ProRule:PRU00726}.				arachidonic acid metabolic process (GO:0019369)|ceramide biosynthetic process (GO:0046513)|establishment of skin barrier (GO:0061436)|hepoxilin biosynthetic process (GO:0051122)|linoleic acid metabolic process (GO:0043651)|lipoxygenase pathway (GO:0019372)|oxidation-reduction process (GO:0055114)|positive regulation of gene expression (GO:0010628)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mucus secretion (GO:0070257)|protein lipidation (GO:0006497)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	cytosol (GO:0005829)	arachidonate 12-lipoxygenase activity (GO:0004052)|iron ion binding (GO:0005506)|linoleate 9S-lipoxygenase activity (GO:1990136)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen (GO:0016702)			endometrium(5)|kidney(1)|large_intestine(3)|lung(5)|prostate(1)|stomach(1)	16						AATTGGGAATCCCGGAATATA	0.602										Multiple Myeloma(8;0.094)	OREG0024153	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													106.0	113.0	110.0					17																	7984078		2203	4300	6503	SO:0001583	missense	0			AF038461	CCDS11129.1	17p13.1	2008-03-18			ENSG00000179477	ENSG00000179477	1.13.11.-	"""Arachidonate lipoxygenases"""	430	protein-coding gene	gene with protein product		603741				9618483	Standard	NM_001139		Approved	12R-LOX	uc002gjy.1	O75342	OTTHUMG00000108180	ENST00000319144.4:c.548G>T	17.37:g.7984078C>A	ENSP00000315167:p.Gly183Val	645		Missense_Mutation	SNP	pfam_LipOase_C,pfam_PLAT/LH2_dom,superfamily_LipOase_C,superfamily_Lipase_LipOase,smart_PLAT/LH2_dom,pfscan_PLAT/LH2_dom,prints_LipOase_C,prints_LipOase_mml	p.G183V	ENST00000319144.4	37	c.548	CCDS11129.1	17	.	.	.	.	.	.	.	.	.	.	C	22.7	4.320429	0.81469	.	.	ENSG00000179477	ENST00000319144	D	0.88975	-2.45	4.34	4.34	0.51931	Lipoxygenase, C-terminal (2);	0.000000	0.85682	D	0.000000	D	0.94483	0.8224	M	0.87900	2.915	0.80722	D	1	D	0.63046	0.992	D	0.69307	0.963	D	0.95207	0.8322	10	0.87932	D	0	-10.2361	14.2763	0.66181	0.0:1.0:0.0:0.0	.	183	O75342	LX12B_HUMAN	V	183	ENSP00000315167:G183V	ENSP00000315167:G183V	G	-	2	0	ALOX12B	7924803	0.994000	0.37717	0.953000	0.39169	0.879000	0.50718	5.320000	0.65841	2.421000	0.82119	0.555000	0.69702	GGA	ALOX12B	-	superfamily_LipOase_C	ENSG00000179477		0.602	ALOX12B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALOX12B	HGNC	protein_coding	OTTHUMT00000226984.3	-	0.00	56	0	C			7984078	-1	tier1	-	no_errors	ENST00000319144	ensembl	human	known	74_37	missense	7.69	48	4	SNP	1.000	A
AMER1	139285	genome.wustl.edu	37	X	63410680	63410680	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chrX:63410680G>T	ENST00000330258.3	-	2	2759	c.2487C>A	c.(2485-2487)caC>caA	p.H829Q	AMER1_ENST00000403336.1_Intron|AMER1_ENST00000374869.3_Intron	NM_152424.3	NP_689637.3	Q5JTC6	AMER1_HUMAN	APC membrane recruitment protein 1	829					adipose tissue development (GO:0060612)|bone development (GO:0060348)|mesenchymal cell differentiation involved in kidney development (GO:0072161)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|regulation of canonical Wnt signaling pathway (GO:0060828)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)	p.0?(67)									CTTCATCATTGTGGAACTCAG	0.502																																																	67	Whole gene deletion(67)	kidney(65)|ovary(1)|large_intestine(1)											41.0	41.0	41.0					X																	63410680		2199	4291	6490	SO:0001583	missense	0			AK097146	CCDS14377.2	Xq11.1	2012-12-03	2012-12-03	2012-12-03	ENSG00000184675	ENSG00000184675		"""-"""	26837	protein-coding gene	gene with protein product	"""Wilms Tumor on the X"", ""adenomatous polyposis coli membrane recruitment 1"""	300647	"""family with sequence similarity 123B"""	FAM123B		21304492, 21498506, 20843316	Standard	NM_152424		Approved	RP11-403E24.2, FLJ39827, WTX	uc004dvo.3	Q5JTC6	OTTHUMG00000021703	ENST00000330258.3:c.2487C>A	X.37:g.63410680G>T	ENSP00000329117:p.His829Gln		A2IB86|Q8N885	Missense_Mutation	SNP	pfam_Uncharacterised_FAM123	p.H829Q	ENST00000330258.3	37	c.2487	CCDS14377.2	X	.	.	.	.	.	.	.	.	.	.	G	10.41	1.341193	0.24339	.	.	ENSG00000184675	ENST00000330258	T	0.41758	0.99	5.0	3.21	0.36854	.	.	.	.	.	T	0.18882	0.0453	N	0.08118	0	0.80722	D	1	B	0.14805	0.011	B	0.08055	0.003	T	0.05194	-1.0900	8	.	.	.	-0.9713	6.1498	0.20306	0.1782:0.1547:0.6671:0.0	.	829	Q5JTC6	F123B_HUMAN	Q	829	ENSP00000329117:H829Q	.	H	-	3	2	FAM123B	63327405	0.987000	0.35691	1.000000	0.80357	0.971000	0.66376	0.114000	0.15520	0.615000	0.30124	0.529000	0.55759	CAC	AMER1	-	NULL	ENSG00000184675		0.502	AMER1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	AMER1	HGNC	protein_coding	OTTHUMT00000316584.1	-	0.00	28	0	G	NM_152424		63410680	-1	tier1	-	no_errors	ENST00000330258	ensembl	human	known	74_37	missense	12.50	21	3	SNP	1.000	T
AMZ2P1	201283	genome.wustl.edu	37	17	62969486	62969486	+	RNA	SNP	A	A	T			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr17:62969486A>T	ENST00000430983.1	-	0	1163					NR_026903.1				archaelysin family metallopeptidase 2 pseudogene 1																		GGAGAATGCAAGGTCCAAAGA	0.473																																																	0																																												0			AK056627		17q24.1	2012-10-16	2010-04-08		ENSG00000214174	ENSG00000214174			26491	pseudogene	pseudogene							Standard	NR_026903		Approved	FLJ32065	uc002jfb.3		OTTHUMG00000132075		17.37:g.62969486A>T				RNA	SNP	-	NULL	ENST00000430983.1	37	NULL		17																																																																																			AMZ2P1	-	-	ENSG00000214174		0.473	AMZ2P1-002	KNOWN	basic	processed_transcript	AMZ2P1	HGNC	pseudogene	OTTHUMT00000255102.1	-	0.00	52	0	A	NM_153032		62969486	-1	tier1	-	no_errors	ENST00000397713	ensembl	human	known	74_37	rna	5.13	73	4	SNP	0.988	T
ANKRD11	29123	genome.wustl.edu	37	16	89354973	89354973	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr16:89354973G>A	ENST00000301030.4	-	7	1167	c.707C>T	c.(706-708)aCg>aTg	p.T236M	ANKRD11_ENST00000378330.2_Missense_Mutation_p.T236M	NM_001256183.1|NM_013275.5	NP_001243112.1|NP_037407.4	Q6UB99	ANR11_HUMAN	ankyrin repeat domain 11	236					bone development (GO:0060348)|face morphogenesis (GO:0060325)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|odontogenesis of dentin-containing tooth (GO:0042475)|skeletal system morphogenesis (GO:0048705)|tissue homeostasis (GO:0001894)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.T236M(1)		breast(4)|central_nervous_system(3)|endometrium(17)|kidney(2)|large_intestine(18)|lung(20)|ovary(6)|pancreas(1)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	83		all_hematologic(23;0.00824)|Colorectal(91;0.0475)		Epithelial(1;5.33e-11)|all cancers(4;2.6e-09)|OV - Ovarian serous cystadenocarcinoma(4;2.29e-07)|BRCA - Breast invasive adenocarcinoma(80;0.0142)		GTGCAAAGGCGTGTCGTCATC	0.617																																																	1	Substitution - Missense(1)	central_nervous_system(1)											199.0	122.0	148.0					16																	89354973		2198	4300	6498	SO:0001583	missense	0			AY373756	CCDS32513.1	16q24.3	2013-01-10				ENSG00000167522		"""Ankyrin repeat domain containing"""	21316	protein-coding gene	gene with protein product		611192				11483580	Standard	NM_001256182		Approved	LZ16, T13	uc002fnc.2	Q6UB99		ENST00000301030.4:c.707C>T	16.37:g.89354973G>A	ENSP00000301030:p.Thr236Met		Q6NTG1|Q6QMF8	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.T236M	ENST00000301030.4	37	c.707	CCDS32513.1	16	.	.	.	.	.	.	.	.	.	.	G	35	5.567951	0.96540	.	.	ENSG00000167522	ENST00000301030;ENST00000378330;ENST00000378332	D;D	0.85556	-2.0;-2.0	5.52	5.52	0.82312	Ankyrin repeat-containing domain (3);	0.000000	0.85682	D	0.000000	D	0.94324	0.8176	M	0.91818	3.245	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.987;0.999;0.997	D	0.95121	0.8246	10	0.87932	D	0	.	19.4262	0.94742	0.0:0.0:1.0:0.0	.	236;250;236	A8K4M9;Q59GC3;Q6UB99	.;.;ANR11_HUMAN	M	236;236;250	ENSP00000301030:T236M;ENSP00000367581:T236M	ENSP00000301030:T236M	T	-	2	0	ANKRD11	87882474	1.000000	0.71417	0.947000	0.38551	0.992000	0.81027	9.630000	0.98420	2.605000	0.88082	0.563000	0.77884	ACG	ANKRD11	-	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000167522		0.617	ANKRD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD11	HGNC	protein_coding	OTTHUMT00000430462.3		0.00	39	0	G	NM_013275		89354973	-1			no_errors	ENST00000301030	ensembl	human	known	74_37	missense	5.71	33	2	SNP	1.000	A
ANKRD30A	91074	genome.wustl.edu	37	10	37418838	37418838	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr10:37418838C>A	ENST00000602533.1	+	2	170	c.71C>A	c.(70-72)gCc>gAc	p.A24D	ANKRD30A_ENST00000361713.1_Missense_Mutation_p.A24D|ANKRD30A_ENST00000374660.1_Missense_Mutation_p.A24D			Q9BXX3	AN30A_HUMAN	ankyrin repeat domain 30A	80					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(8)|endometrium(14)|kidney(21)|large_intestine(13)|lung(70)|ovary(8)|pancreas(1)|prostate(3)|skin(15)|stomach(1)|urinary_tract(3)	158						CTACACTGGGCCTGTGTCAAT	0.443																																																	0													48.0	44.0	45.0					10																	37418838		1915	4139	6054	SO:0001583	missense	0			AF269087	CCDS7193.1	10p11.21	2013-01-10			ENSG00000148513	ENSG00000148513		"""Ankyrin repeat domain containing"""	17234	protein-coding gene	gene with protein product	"""breast cancer antigen NY-BR-1"""	610856				11280766	Standard	NM_052997		Approved	NY-BR-1	uc001iza.1	Q9BXX3	OTTHUMG00000017968	ENST00000602533.1:c.71C>A	10.37:g.37418838C>A	ENSP00000473551:p.Ala24Asp		Q5W025	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.A24D	ENST00000602533.1	37	c.71		10	.	.	.	.	.	.	.	.	.	.	.	15.63	2.889442	0.52014	.	.	ENSG00000148513	ENST00000361713;ENST00000374660	D;D	0.87729	-2.29;-2.29	2.0	2.0	0.26442	Ankyrin repeat-containing domain (4);	.	.	.	.	D	0.95392	0.8504	H	0.99197	4.465	0.37613	D	0.921021	D	0.71674	0.998	D	0.75020	0.985	D	0.94470	0.7684	9	0.87932	D	0	.	7.4605	0.27291	0.0:1.0:0.0:0.0	.	80	Q9BXX3	AN30A_HUMAN	D	24	ENSP00000354432:A24D;ENSP00000363792:A24D	ENSP00000354432:A24D	A	+	2	0	ANKRD30A	37458844	1.000000	0.71417	0.531000	0.27976	0.029000	0.11900	4.798000	0.62510	1.110000	0.41699	0.281000	0.19383	GCC	ANKRD30A	-	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000148513		0.443	ANKRD30A-001	KNOWN	NMD_exception|basic|appris_principal	protein_coding	ANKRD30A	HGNC	protein_coding	OTTHUMT00000047588.2	-	0.00	66	0	C	NM_052997		37418838	+1	tier1	-	no_errors	ENST00000361713	ensembl	human	known	74_37	missense	44.71	47	38	SNP	1.000	A
ANXA9	8416	genome.wustl.edu	37	1	150960781	150960781	+	Silent	SNP	G	G	T	rs372215070		TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr1:150960781G>T	ENST00000368947.4	+	12	1292	c.816G>T	c.(814-816)ccG>ccT	p.P272P		NM_003568.2	NP_003559.2	O76027	ANXA9_HUMAN	annexin A9	272					single organismal cell-cell adhesion (GO:0016337)|synaptic transmission (GO:0007268)	cell surface (GO:0009986)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	acetylcholine receptor activity (GO:0015464)|calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|phosphatidylserine binding (GO:0001786)|phospholipid binding (GO:0005543)|protein homodimerization activity (GO:0042803)			endometrium(1)|large_intestine(1)|lung(4)|skin(2)	8	all_lung(15;1.09e-34)|Lung NSC(24;1.1e-30)|Lung SC(34;0.00202)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)			AGAACACACCGCTGTACTTTG	0.502																																																	0													155.0	143.0	147.0					1																	150960781		2203	4300	6503	SO:0001819	synonymous_variant	0			AJ009985	CCDS975.2	1q21.2	2008-02-05			ENSG00000143412	ENSG00000143412		"""Annexins"""	547	protein-coding gene	gene with protein product		603319		ANX31		9742942, 9931420	Standard	NM_003568		Approved		uc001ewa.2	O76027	OTTHUMG00000035063	ENST00000368947.4:c.816G>T	1.37:g.150960781G>T			Q5SZF1|Q6FI55|Q9BS00|Q9HBJ6	Silent	SNP	pfam_Annexin_repeat,smart_Annexin_repeat,prints_Annexin,prints_AnnexinXXXI	p.P272	ENST00000368947.4	37	c.816	CCDS975.2	1																																																																																			ANXA9	-	NULL	ENSG00000143412		0.502	ANXA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANXA9	HGNC	protein_coding	OTTHUMT00000084895.2		0.00	40	0	G	NM_003568		150960781	+1			no_errors	ENST00000368947	ensembl	human	known	74_37	silent	5.88	32	2	SNP	0.553	T
AOC3	8639	genome.wustl.edu	37	17	41003593	41003593	+	Missense_Mutation	SNP	G	G	A	rs402680	byFrequency	TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr17:41003593G>A	ENST00000308423.2	+	1	393	c.233G>A	c.(232-234)cGg>cAg	p.R78Q	AOC3_ENST00000591562.1_5'Flank	NM_003734.2	NP_003725.1	Q16853	AOC3_HUMAN	amine oxidase, copper containing 3	78			R -> Q (in dbSNP:rs402680).		amine metabolic process (GO:0009308)|cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|cell adhesion (GO:0007155)|inflammatory response (GO:0006954)|response to antibiotic (GO:0046677)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	aliphatic-amine oxidase activity (GO:0052595)|aminoacetone:oxygen oxidoreductase(deaminating) activity (GO:0052594)|calcium ion binding (GO:0005509)|cation channel activity (GO:0005261)|copper ion binding (GO:0005507)|phenethylamine:oxygen oxidoreductase (deaminating) activity (GO:0052596)|primary amine oxidase activity (GO:0008131)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|quinone binding (GO:0048038)|tryptamine:oxygen oxidoreductase (deaminating) activity (GO:0052593)			breast(1)|central_nervous_system(4)|endometrium(4)|kidney(1)|large_intestine(8)|lung(14)|ovary(1)|skin(8)	41		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.156)	Hydralazine(DB01275)|Phenelzine(DB00780)	CTGACCCAGCGGCTGGGGCCA	0.657													G|||	2	0.000399361	0.0015	0.0	5008	,	,		15314	0.0		0.0	False		,,,				2504	0.0				NSCLC(3;192 220 10664 11501 16477)												0								G	GLN/ARG	9,4397	11.4+/-27.6	0,9,2194	76.0	86.0	83.0		233	1.6	0.1	17	dbSNP_80	83	0,8600		0,0,4300	no	missense	AOC3	NM_003734.2	43	0,9,6494	AA,AG,GG		0.0,0.2043,0.0692	benign	78/764	41003593	9,12997	2203	4300	6503	SO:0001583	missense	0			AF067406	CCDS11444.1, CCDS62198.1, CCDS74071.1	17q21	2013-05-08	2013-05-08			ENSG00000131471	1.4.3.21		550	protein-coding gene	gene with protein product	"""vascular adhesion protein 1"""	603735				9653080, 8972912	Standard	NM_003734		Approved	VAP1, HPAO, VAP-1	uc002ibv.4	Q16853		ENST00000308423.2:c.233G>A	17.37:g.41003593G>A	ENSP00000312326:p.Arg78Gln		B2RCI5|K7ESB3|L0L8N9|Q45F94	Missense_Mutation	SNP	pfam_Cu_amine_oxidase_C,pfam_Cu_amine_oxidase_N2,pfam_Cu_amine_oxidase_N3,superfamily_Cu_amine_oxidase_C,superfamily_Cu_amine_oxidase_N-reg,prints_Cu_amine_oxidase	p.R78Q	ENST00000308423.2	37	c.233	CCDS11444.1	17	.	.	.	.	.	.	.	.	.	.	G	0.005	-2.142245	0.00332	0.002043	0.0	ENSG00000131471	ENST00000308423	T	0.31510	1.49	5.05	1.65	0.23941	Copper amine oxidase, N2/N3-terminal (1);Copper amine oxidase, N-terminal (1);Copper amine oxidase, N2-terminal (1);	0.763999	0.12414	N	0.470985	T	0.07683	0.0193	N	0.00608	-1.33	0.09310	N	0.999999	B	0.02656	0.0	B	0.04013	0.001	T	0.36163	-0.9759	10	0.02654	T	1	.	8.7811	0.34792	0.6636:0.0:0.3364:0.0	rs402680;rs7214408	78	Q16853	AOC3_HUMAN	Q	78	ENSP00000312326:R78Q	ENSP00000312326:R78Q	R	+	2	0	AOC3	38257119	0.000000	0.05858	0.081000	0.20488	0.034000	0.12701	0.791000	0.26915	0.103000	0.17682	0.591000	0.81541	CGG	AOC3	-	pfam_Cu_amine_oxidase_N2,superfamily_Cu_amine_oxidase_N-reg	ENSG00000131471		0.657	AOC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AOC3	HGNC	protein_coding	OTTHUMT00000452444.1		0.00	49	0	G	NM_003734		41003593	+1			no_errors	ENST00000308423	ensembl	human	known	74_37	missense	45.71	19	16	SNP	0.045	A
APOH	350	genome.wustl.edu	37	17	64224243	64224243	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr17:64224243C>T	ENST00000205948.6	-	2	173	c.136G>A	c.(136-138)Gag>Aag	p.E46K		NM_000042.2	NP_000033.2	P02749	APOH_HUMAN	apolipoprotein H (beta-2-glycoprotein I)	46	Sushi 1. {ECO:0000255|PROSITE- ProRule:PRU00302}.				blood coagulation, intrinsic pathway (GO:0007597)|negative regulation of angiogenesis (GO:0016525)|negative regulation of blood coagulation (GO:0030195)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibrinolysis (GO:0051918)|negative regulation of myeloid cell apoptotic process (GO:0033033)|negative regulation of smooth muscle cell apoptotic process (GO:0034392)|plasminogen activation (GO:0031639)|positive regulation of blood coagulation (GO:0030194)|positive regulation of lipoprotein lipase activity (GO:0051006)|regulation of fibrinolysis (GO:0051917)|triglyceride metabolic process (GO:0006641)|triglyceride transport (GO:0034197)	cell surface (GO:0009986)|chylomicron (GO:0042627)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|high-density lipoprotein particle (GO:0034364)|very-low-density lipoprotein particle (GO:0034361)	glycoprotein binding (GO:0001948)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|lipid binding (GO:0008289)|lipoprotein lipase activator activity (GO:0060230)|phospholipid binding (GO:0005543)			central_nervous_system(1)|kidney(3)|large_intestine(5)|lung(6)|skin(1)|upper_aerodigestive_tract(1)	17			BRCA - Breast invasive adenocarcinoma(6;9.74e-08)			TACGTAATCTCTTCTCCTGGC	0.483																																					Melanoma(155;624 1882 16869 48804 51309)												0													203.0	188.0	193.0					17																	64224243		2203	4300	6503	SO:0001583	missense	0				CCDS11663.1	17q24.2	2013-01-24				ENSG00000091583		"""Apolipoproteins"""	616	protein-coding gene	gene with protein product	"""beta-2-glycoprotein I"""	138700		B2G1		1582254	Standard	NM_000042		Approved	BG	uc002jfn.4	P02749		ENST00000205948.6:c.136G>A	17.37:g.64224243C>T	ENSP00000205948:p.Glu46Lys		B2R9M3|Q9UCN7	Missense_Mutation	SNP	pfam_Sushi_SCR_CCP,pfam_Sushi_2,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	p.E46K	ENST00000205948.6	37	c.136	CCDS11663.1	17	.	.	.	.	.	.	.	.	.	.	C	8.406	0.843034	0.16963	.	.	ENSG00000091583	ENST00000205948	T	0.62364	0.03	5.67	-3.31	0.04988	Complement control module (2);Sushi/SCR/CCP (3);	0.561897	0.18660	N	0.134748	T	0.48187	0.1486	L	0.28608	0.87	0.25753	N	0.985036	P	0.37466	0.596	B	0.33568	0.166	T	0.33701	-0.9858	10	0.20046	T	0.44	.	23.7708	0.99985	0.0:0.792:0.208:0.0	.	46	P02749	APOH_HUMAN	K	46	ENSP00000205948:E46K	ENSP00000205948:E46K	E	-	1	0	APOH	61654705	0.841000	0.29509	0.836000	0.33094	0.006000	0.05464	-0.010000	0.12743	-0.424000	0.07382	-0.971000	0.02607	GAG	APOH	-	pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	ENSG00000091583		0.483	APOH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APOH	HGNC	protein_coding	OTTHUMT00000446926.1	-	0.00	52	0	C	NM_000042		64224243	-1	tier1	-	no_errors	ENST00000205948	ensembl	human	known	74_37	missense	28.00	36	14	SNP	0.794	T
ARAP1	116985	genome.wustl.edu	37	11	72438099	72438099	+	Silent	SNP	C	C	A			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr11:72438099C>A	ENST00000393609.3	-	3	277	c.75G>T	c.(73-75)ggG>ggT	p.G25G	ARAP1_ENST00000359373.5_Silent_p.G25G|ARAP1_ENST00000455638.2_Silent_p.G25G	NM_001040118.2	NP_001035207.1	Q96P48	ARAP1_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 1	25	SAM. {ECO:0000255|PROSITE- ProRule:PRU00184}.				actin filament reorganization involved in cell cycle (GO:0030037)|negative regulation of stress fiber assembly (GO:0051497)|positive regulation of Cdc42 GTPase activity (GO:0043089)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of receptor recycling (GO:0001921)|regulation of ARF GTPase activity (GO:0032312)|regulation of cell shape (GO:0008360)|regulation of cellular component movement (GO:0051270)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	ARF GTPase activator activity (GO:0008060)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|Rho GTPase activator activity (GO:0005100)|zinc ion binding (GO:0008270)			cervix(2)|endometrium(2)|large_intestine(10)|lung(8)|ovary(1)|skin(3)|urinary_tract(1)	27						GCTCAAAGAGCCCCGTGTACT	0.662																																					Ovarian(102;1198 1520 13195 17913 37529)												0													17.0	22.0	20.0					11																	72438099		2092	4201	6293	SO:0001819	synonymous_variant	0			AF411983	CCDS8217.2, CCDS41687.1, CCDS44671.1	11q13.3	2013-01-11	2008-09-22	2008-09-22	ENSG00000186635	ENSG00000186635		"""ADP-ribosylation factor GTPase activating proteins"", ""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16925	protein-coding gene	gene with protein product		606646	"""centaurin, delta 2"""	CENTD2			Standard	NM_001040118		Approved		uc001osu.3	Q96P48	OTTHUMG00000157102	ENST00000393609.3:c.75G>T	11.37:g.72438099C>A			A3KLL7|B2RTS2|O94879|Q4LDD5|Q59FI7|Q6PHS3|Q8WU51|Q96HP6|Q96L71	Silent	SNP	pfam_RhoGAP_dom,pfam_Pleckstrin_homology,pfam_ArfGAP,pfam_SAM_type1,pfam_Ras-assoc,pfam_SAM_2,superfamily_Rho_GTPase_activation_prot,superfamily_SAM/pointed,smart_SAM,smart_Pleckstrin_homology,smart_ArfGAP,smart_RhoGAP_dom,pfscan_Pleckstrin_homology,pfscan_Ras-assoc,pfscan_SAM,pfscan_ArfGAP,pfscan_RhoGAP_dom,prints_ArfGAP	p.G25	ENST00000393609.3	37	c.75	CCDS41687.1	11																																																																																			ARAP1	-	pfam_SAM_type1,pfam_SAM_2,superfamily_SAM/pointed,smart_SAM,pfscan_SAM	ENSG00000186635		0.662	ARAP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ARAP1	HGNC	protein_coding	OTTHUMT00000347428.1	-	0.00	75	0	C	NM_001040118		72438099	-1	tier1	-	no_errors	ENST00000393609	ensembl	human	known	74_37	silent	13.82	317	51	SNP	0.877	A
ARID1B	57492	genome.wustl.edu	37	6	157528847	157528847	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr6:157528847G>A	ENST00000350026.5	+	19	6534	c.6533G>A	c.(6532-6534)aGc>aAc	p.S2178N	ARID1B_ENST00000275248.4_Missense_Mutation_p.S2173N|ARID1B_ENST00000367148.1_Missense_Mutation_p.S2231N|ARID1B_ENST00000346085.5_Missense_Mutation_p.S2191N	NM_017519.2	NP_059989.2	Q8NFD5	ARI1B_HUMAN	AT rich interactive domain 1B (SWI1-like)	2178					chromatin-mediated maintenance of transcription (GO:0048096)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|transcription coactivator activity (GO:0003713)			NS(2)|breast(5)|central_nervous_system(4)|endometrium(12)|kidney(4)|large_intestine(11)|lung(30)|ovary(3)|pancreas(1)|prostate(4)|skin(2)|urinary_tract(3)	81		Breast(66;0.000162)|Ovarian(120;0.0265)		OV - Ovarian serous cystadenocarcinoma(65;3.19e-17)|BRCA - Breast invasive adenocarcinoma(81;1.01e-05)		GAACCACCTAGCGTAGACATG	0.582																																																	0													93.0	87.0	89.0					6																	157528847		2203	4296	6499	SO:0001583	missense	0			AF521671	CCDS5251.1, CCDS5251.2, CCDS55072.1	6q25.3	2014-09-17			ENSG00000049618	ENSG00000049618		"""-"""	18040	protein-coding gene	gene with protein product		614556					Standard	NM_017519		Approved	KIAA1235, ELD/OSA1, p250R, BAF250b, DAN15, 6A3-5	uc003qqo.3	Q8NFD5	OTTHUMG00000015890	ENST00000350026.5:c.6533G>A	6.37:g.157528847G>A	ENSP00000055163:p.Ser2178Asn		Q5JRD1|Q5VYC4|Q8IZY8|Q8TEV0|Q8TF02|Q99491|Q9ULI5	Missense_Mutation	SNP	pfam_DUF3518,pfam_ARID/BRIGHT_DNA-bd,superfamily_ARID/BRIGHT_DNA-bd,superfamily_ARM-type_fold,smart_ARID/BRIGHT_DNA-bd,pfscan_ARID/BRIGHT_DNA-bd	p.S2231N	ENST00000350026.5	37	c.6692	CCDS5251.2	6	.	.	.	.	.	.	.	.	.	.	G	13.78	2.338093	0.41398	.	.	ENSG00000049618	ENST00000346085;ENST00000350026;ENST00000367148;ENST00000275248;ENST00000414678	T;T;T;T;T	0.44482	0.92;0.92;0.92;0.92;0.92	5.61	5.61	0.85477	Armadillo-like helical (1);	0.000000	0.85682	D	0.000000	T	0.65523	0.2699	M	0.83012	2.62	0.80722	D	1	D;D;D	0.76494	0.999;0.998;0.998	D;D;D	0.83275	0.996;0.994;0.994	T	0.69094	-0.5236	10	0.87932	D	0	.	20.0018	0.97417	0.0:0.0:1.0:0.0	.	2178;2191;2173	Q8NFD5;Q8NFD5-2;G3XAA0	ARI1B_HUMAN;.;.	N	2191;2178;2231;2173;1700	ENSP00000344546:S2191N;ENSP00000055163:S2178N;ENSP00000356116:S2231N;ENSP00000275248:S2173N;ENSP00000412835:S1700N	ENSP00000275248:S2173N	S	+	2	0	ARID1B	157570539	1.000000	0.71417	0.994000	0.49952	0.502000	0.33828	9.803000	0.99136	2.793000	0.96121	0.655000	0.94253	AGC	ARID1B	-	pfam_DUF3518,superfamily_ARM-type_fold	ENSG00000049618		0.582	ARID1B-009	KNOWN	basic|appris_candidate|CCDS	protein_coding	ARID1B	HGNC	protein_coding	OTTHUMT00000372723.1	-	0.00	46	0	G	NM_020732		157528847	+1	tier1	-	no_errors	ENST00000367148	ensembl	human	known	74_37	missense	7.55	49	4	SNP	1.000	A
ARSJ	79642	genome.wustl.edu	37	4	114823556	114823556	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr4:114823556T>G	ENST00000315366.7	-	2	2540	c.1674A>C	c.(1672-1674)gaA>gaC	p.E558D	ARSJ_ENST00000541197.1_Missense_Mutation_p.E558D	NM_024590.3	NP_078866.3	Q5FYB0	ARSJ_HUMAN	arylsulfatase family, member J	558					cellular protein metabolic process (GO:0044267)|glycosphingolipid metabolic process (GO:0006687)|post-translational protein modification (GO:0043687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	arylsulfatase activity (GO:0004065)|metal ion binding (GO:0046872)			endometrium(1)|large_intestine(5)|lung(7)|ovary(2)|prostate(3)|skin(2)|urinary_tract(1)	21		Ovarian(17;0.0035)|Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.00194)		ttttcttggtttcctcttTAT	0.443																																																	0													88.0	74.0	78.0					4																	114823556		1820	4082	5902	SO:0001583	missense	0				CCDS43264.1	4q26	2013-02-14	2006-03-07		ENSG00000180801	ENSG00000180801		"""Arylsulfatase family"""	26286	protein-coding gene	gene with protein product		610010	"""arylsulfatase J"""			12975309, 16174644	Standard	NM_024590		Approved	FLJ23548	uc003ibq.1	Q5FYB0	OTTHUMG00000161067	ENST00000315366.7:c.1674A>C	4.37:g.114823556T>G	ENSP00000320219:p.Glu558Asp		A2RUG0|B7ZM45|Q1HA39|Q5FWE4|Q6UWT9	Missense_Mutation	SNP	pfam_Sulfatase,superfamily_Alkaline_phosphatase_core	p.E558D	ENST00000315366.7	37	c.1674	CCDS43264.1	4	.	.	.	.	.	.	.	.	.	.	T	6.510	0.462339	0.12342	.	.	ENSG00000180801	ENST00000315366;ENST00000541197;ENST00000545965	D;D	0.97161	-4.26;-4.27	5.21	-2.1	0.07210	.	2.052410	0.02877	N	0.132413	D	0.91533	0.7326	N	0.21545	0.675	0.19775	N	0.999956	B;B	0.06786	0.0;0.001	B;B	0.04013	0.001;0.001	D	0.84070	0.0379	10	0.17832	T	0.49	.	2.8803	0.05645	0.1254:0.4105:0.2104:0.2537	.	558;558	Q1HA39;Q5FYB0	.;ARSJ_HUMAN	D	558;558;127	ENSP00000320219:E558D;ENSP00000438836:E558D	ENSP00000320219:E558D	E	-	3	2	ARSJ	115043005	0.000000	0.05858	0.180000	0.23079	0.443000	0.32047	-0.324000	0.07986	0.024000	0.15214	0.533000	0.62120	GAA	ARSJ	-	NULL	ENSG00000180801		0.443	ARSJ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARSJ	HGNC	protein_coding	OTTHUMT00000363650.1	-	0.00	45	0	T	NM_024590		114823556	-1	tier1	-	no_errors	ENST00000315366	ensembl	human	known	74_37	missense	70.83	7	17	SNP	0.003	G
ASPHD2	57168	genome.wustl.edu	37	22	26829738	26829738	+	Missense_Mutation	SNP	G	G	A	rs140657637		TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr22:26829738G>A	ENST00000215906.5	+	2	595	c.157G>A	c.(157-159)Gtg>Atg	p.V53M		NM_020437.4	NP_065170.2	Q6ICH7	ASPH2_HUMAN	aspartate beta-hydroxylase domain containing 2	53					peptidyl-amino acid modification (GO:0018193)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	dioxygenase activity (GO:0051213)|metal ion binding (GO:0046872)			endometrium(3)|large_intestine(3)|lung(4)|ovary(1)|prostate(4)|urinary_tract(1)	16						CATCCAGTCCGTGCGGGACTG	0.652																																																	0								G	MET/VAL	0,4406		0,0,2203	89.0	76.0	80.0		157	4.5	0.9	22	dbSNP_134	80	1,8599	1.2+/-3.3	0,1,4299	no	missense	ASPHD2	NM_020437.4	21	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign	53/370	26829738	1,13005	2203	4300	6503	SO:0001583	missense	0			AK097157	CCDS13834.2	22q12.1	2006-02-02			ENSG00000128203	ENSG00000128203			30437	protein-coding gene	gene with protein product							Standard	NM_020437		Approved	FLJ39838	uc003acg.2	Q6ICH7	OTTHUMG00000150884	ENST00000215906.5:c.157G>A	22.37:g.26829738G>A	ENSP00000215906:p.Val53Met		B2RCH3|Q7L0W3|Q9NSN3	Missense_Mutation	SNP	pfam_Asp_Arg_b-Hydrxlase	p.V53M	ENST00000215906.5	37	c.157	CCDS13834.2	22	.	.	.	.	.	.	.	.	.	.	G	14.22	2.470387	0.43942	0.0	1.16E-4	ENSG00000128203	ENST00000215906	T	0.50277	0.75	4.46	4.46	0.54185	.	0.278592	0.29087	N	0.013184	T	0.30823	0.0777	N	0.19112	0.55	0.43047	D	0.994642	P	0.51933	0.949	B	0.38616	0.277	T	0.28004	-1.0057	10	0.66056	D	0.02	-25.9394	12.0258	0.53368	0.0:0.0:0.8151:0.1849	.	53	Q6ICH7	ASPH2_HUMAN	M	53	ENSP00000215906:V53M	ENSP00000215906:V53M	V	+	1	0	ASPHD2	25159738	0.993000	0.37304	0.934000	0.37439	0.978000	0.69477	2.257000	0.43240	2.311000	0.77944	0.563000	0.77884	GTG	ASPHD2	-	NULL	ENSG00000128203		0.652	ASPHD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASPHD2	HGNC	protein_coding	OTTHUMT00000320422.1	-	0.00	36	0	G	NM_020437		26829738	+1	tier1	rs140657637	no_errors	ENST00000215906	ensembl	human	known	74_37	missense	77.78	4	14	SNP	0.889	A
ASXL3	80816	genome.wustl.edu	37	18	31325070	31325070	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr18:31325070T>C	ENST00000269197.5	+	12	5258	c.5258T>C	c.(5257-5259)tTa>tCa	p.L1753S		NM_030632.1	NP_085135.1	Q9C0F0	ASXL3_HUMAN	additional sex combs like transcriptional regulator 3	1753					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|endometrium(3)|kidney(3)|large_intestine(6)|lung(22)|ovary(2)|pancreas(1)|skin(2)|urinary_tract(1)	43						GTGACGCAGTTACTACAGGGC	0.532																																																	0													62.0	62.0	62.0					18																	31325070		1987	4182	6169	SO:0001583	missense	0			AB051500	CCDS45847.1	18q11	2014-06-17	2014-06-17	2007-02-01		ENSG00000141431			29357	protein-coding gene	gene with protein product		615115	"""KIAA1713"", ""additional sex combs like 3 (Drosophila)"""	KIAA1713		11214970	Standard	NM_030632		Approved		uc010dmg.1	Q9C0F0		ENST00000269197.5:c.5258T>C	18.37:g.31325070T>C	ENSP00000269197:p.Leu1753Ser		Q6ZMX6|Q96MU3|Q9UFC5	Missense_Mutation	SNP	superfamily_Znf_FYVE_PHD	p.L1753S	ENST00000269197.5	37	c.5258	CCDS45847.1	18	.	.	.	.	.	.	.	.	.	.	T	17.50	3.404111	0.62288	.	.	ENSG00000141431	ENST00000269197	T	0.55052	0.54	5.86	5.86	0.93980	.	.	.	.	.	T	0.63189	0.2490	L	0.29908	0.895	0.38067	D	0.93624	D	0.89917	1.0	D	0.85130	0.997	T	0.69544	-0.5117	9	0.87932	D	0	.	16.255	0.82510	0.0:0.0:0.0:1.0	.	1753	Q9C0F0	ASXL3_HUMAN	S	1753	ENSP00000269197:L1753S	ENSP00000269197:L1753S	L	+	2	0	ASXL3	29579068	0.995000	0.38212	0.033000	0.17914	0.947000	0.59692	7.466000	0.80914	2.240000	0.73641	0.533000	0.62120	TTA	ASXL3	-	NULL	ENSG00000141431		0.532	ASXL3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ASXL3	HGNC	protein_coding	OTTHUMT00000441865.2	-	0.00	20	0	T			31325070	+1	tier1	-	no_errors	ENST00000269197	ensembl	human	known	74_37	missense	41.67	7	5	SNP	0.748	C
ATP13A5	344905	genome.wustl.edu	37	3	193081988	193081988	+	Silent	SNP	G	G	A			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr3:193081988G>A	ENST00000342358.4	-	2	262	c.145C>T	c.(145-147)Ctg>Ttg	p.L49L		NM_198505.2	NP_940907.2	Q4VNC0	AT135_HUMAN	ATPase type 13A5	49						integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|metal ion binding (GO:0046872)			NS(1)|autonomic_ganglia(2)|breast(1)|endometrium(6)|kidney(4)|large_intestine(15)|liver(2)|lung(26)|ovary(5)|prostate(1)|skin(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	76	all_cancers(143;1.08e-08)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;5.56e-18)|LUSC - Lung squamous cell carcinoma(58;6.08e-06)|Lung(62;6.49e-06)	GBM - Glioblastoma multiforme(46;0.000307)		TAGAACACCAGCAGAAGGCCC	0.537																																																	0													169.0	167.0	168.0					3																	193081988		2203	4300	6503	SO:0001819	synonymous_variant	0			AK122613	CCDS33914.1	3q29	2010-04-20			ENSG00000187527	ENSG00000187527		"""ATPases / P-type"""	31789	protein-coding gene	gene with protein product							Standard	NM_198505		Approved	FLJ16025	uc011bsq.2	Q4VNC0	OTTHUMG00000156101	ENST00000342358.4:c.145C>T	3.37:g.193081988G>A			Q6UWS4|Q6ZWL0	Silent	SNP	pfam_ATPase_P-typ_transduc_dom_A,pfam_ATPase_P-typ_Cation_typ_V,pfam_ATPase_P-typ_cation-transptr_N,superfamily_HAD-like_dom,superfamily_ATPase_P-typ_cyto_domN,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Cation_typ_V,tigrfam_Cation_transp_P_typ_ATPase	p.L49	ENST00000342358.4	37	c.145	CCDS33914.1	3																																																																																			ATP13A5	-	pfam_ATPase_P-typ_Cation_typ_V,tigrfam_ATPase_P-typ_Cation_typ_V	ENSG00000187527		0.537	ATP13A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP13A5	HGNC	protein_coding	OTTHUMT00000343012.1		0.00	43	0	G	NM_198505		193081988	-1			no_errors	ENST00000342358	ensembl	human	known	74_37	silent	6.06	62	4	SNP	0.209	A
ATP8A1	10396	genome.wustl.edu	37	4	42526846	42526846	+	Nonsense_Mutation	SNP	G	G	A			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr4:42526846G>A	ENST00000381668.5	-	21	1972	c.1741C>T	c.(1741-1743)Cga>Tga	p.R581*	ATP8A1_ENST00000264449.10_Nonsense_Mutation_p.R566*	NM_006095.2	NP_006086.1	Q9Y2Q0	AT8A1_HUMAN	ATPase, aminophospholipid transporter (APLT), class I, type 8A, member 1	581					cation transmembrane transport (GO:0098655)|ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|transmembrane transport (GO:0055085)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(1)|central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(18)|pancreas(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(3)	51					Phosphatidylserine(DB00144)	TCTGCCAGTCGATCATAAATT	0.333																																																	0													91.0	87.0	88.0					4																	42526846		2201	4298	6499	SO:0001587	stop_gained	0			AF067820	CCDS3466.1, CCDS47049.1	4p13	2010-04-20	2007-09-19		ENSG00000124406	ENSG00000124406		"""ATPases / P-type"""	13531	protein-coding gene	gene with protein product		609542	"""ATPase, aminophospholipid transporter (APLT), Class I, type 8A, member 1"""			10198212, 9548971	Standard	NM_006095		Approved	ATPIA	uc003gwr.2	Q9Y2Q0	OTTHUMG00000099403	ENST00000381668.5:c.1741C>T	4.37:g.42526846G>A	ENSP00000371084:p.Arg581*		Q32M35|Q32M36|Q4W5J7|Q4W5P2	Nonsense_Mutation	SNP	pfam_ATPase_P-typ_transduc_dom_A,superfamily_HAD-like_dom,superfamily_ATPase_P-typ_cyto_domN,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Plipid-transp,tigrfam_Cation_transp_P_typ_ATPase	p.R581*	ENST00000381668.5	37	c.1741	CCDS3466.1	4	.	.	.	.	.	.	.	.	.	.	G	39	7.518455	0.98332	.	.	ENSG00000124406	ENST00000381668;ENST00000264449	.	.	.	5.81	4.96	0.65561	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	16.2038	0.82105	0.0:0.0:0.8657:0.1343	.	.	.	.	X	581;566	.	ENSP00000264449:R566X	R	-	1	2	ATP8A1	42221603	1.000000	0.71417	1.000000	0.80357	0.259000	0.26198	6.899000	0.75682	1.434000	0.47414	0.655000	0.94253	CGA	ATP8A1	-	superfamily_HAD-like_dom,superfamily_ATPase_P-typ_cyto_domN,tigrfam_ATPase_P-typ_Plipid-transp	ENSG00000124406		0.333	ATP8A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ATP8A1	HGNC	protein_coding	OTTHUMT00000216861.2	-	0.00	111	0	G	NM_006095		42526846	-1	tier1	-	no_errors	ENST00000381668	ensembl	human	known	74_37	nonsense	26.09	84	30	SNP	1.000	A
ATXN7L2	127002	genome.wustl.edu	37	1	110029160	110029160	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr1:110029160G>C	ENST00000369870.3	+	3	241	c.226G>C	c.(226-228)Gat>Cat	p.D76H		NM_153340.4	NP_699171.3	Q5T6C5	AT7L2_HUMAN	ataxin 7-like 2	76										breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(5)|ovary(2)|prostate(1)|skin(1)	17		all_epithelial(167;0.00197)|all_lung(203;0.00291)|Lung NSC(277;0.00453)		Colorectal(144;0.0129)|Lung(183;0.0426)|Epithelial(280;0.0675)|READ - Rectum adenocarcinoma(129;0.0693)|all cancers(265;0.071)|LUSC - Lung squamous cell carcinoma(189;0.228)		CCCTGCCCATGATGACTTCTA	0.542																																																	0													70.0	57.0	61.0					1																	110029160		2203	4300	6503	SO:0001583	missense	0			BC037582	CCDS30794.1	1p13.2	2008-02-05			ENSG00000162650	ENSG00000162650			28713	protein-coding gene	gene with protein product						12477932	Standard	NM_153340		Approved	MGC46534, FLJ00381	uc001dxr.3	Q5T6C5	OTTHUMG00000011027	ENST00000369870.3:c.226G>C	1.37:g.110029160G>C	ENSP00000358886:p.Asp76His			Missense_Mutation	SNP	pfam_SCA7_dom	p.D76H	ENST00000369870.3	37	c.226	CCDS30794.1	1	.	.	.	.	.	.	.	.	.	.	G	21.5	4.153006	0.78001	.	.	ENSG00000162650	ENST00000369870;ENST00000541125	T	0.32515	1.45	4.72	4.72	0.59763	.	0.000000	0.64402	D	0.000016	T	0.46328	0.1387	L	0.61036	1.89	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.49943	-0.8885	10	0.87932	D	0	-12.1933	16.801	0.85614	0.0:0.0:1.0:0.0	.	76	Q5T6C5	AT7L2_HUMAN	H	76	ENSP00000358886:D76H	ENSP00000358886:D76H	D	+	1	0	ATXN7L2	109830683	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.243000	0.95416	2.346000	0.79739	0.484000	0.47621	GAT	ATXN7L2	-	NULL	ENSG00000162650		0.542	ATXN7L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATXN7L2	HGNC	protein_coding	OTTHUMT00000030331.1		0.00	29	0	G	NM_153340		110029160	+1			no_errors	ENST00000369870	ensembl	human	known	74_37	missense	13.04	20	3	SNP	1.000	C
BICD2	23299	genome.wustl.edu	37	9	95481023	95481023	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr9:95481023C>T	ENST00000375512.3	-	5	1971	c.1904G>A	c.(1903-1905)cGt>cAt	p.R635H	BICD2_ENST00000356884.6_Missense_Mutation_p.R635H	NM_015250.3	NP_056065.1	Q8TD16	BICD2_HUMAN	bicaudal D homolog 2 (Drosophila)	635					cell death (GO:0008219)|microtubule anchoring at microtubule organizing center (GO:0072393)|minus-end-directed organelle transport along microtubule (GO:0072385)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	Rab GTPase binding (GO:0017137)	p.R635H(1)		cervix(3)|endometrium(4)|kidney(1)|large_intestine(6)|lung(5)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	23						GATCTGGTCACGGATGATAGC	0.652																																																	1	Substitution - Missense(1)	endometrium(1)											109.0	105.0	107.0					9																	95481023		2203	4300	6503	SO:0001583	missense	0			AB014599	CCDS6700.1, CCDS35064.1	9q22.32	2008-02-05			ENSG00000185963	ENSG00000185963			17208	protein-coding gene	gene with protein product		609797				9734811	Standard	NM_001003800		Approved	KIAA0699	uc004asp.1	Q8TD16	OTTHUMG00000021036	ENST00000375512.3:c.1904G>A	9.37:g.95481023C>T	ENSP00000364662:p.Arg635His		O75181|Q5TBQ2|Q5TBQ3|Q96LH2|Q9BT84|Q9H561	Missense_Mutation	SNP	pfam_Bicaudal-D_microtubule-assoc	p.R635H	ENST00000375512.3	37	c.1904	CCDS6700.1	9	.	.	.	.	.	.	.	.	.	.	C	22.3	4.272439	0.80580	.	.	ENSG00000185963	ENST00000356884;ENST00000375512	T;T	0.52983	0.64;0.64	5.03	5.03	0.67393	.	0.060107	0.64402	D	0.000004	T	0.70561	0.3238	M	0.80982	2.52	0.58432	D	0.999997	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.74917	-0.3501	10	0.72032	D	0.01	-15.392	16.2317	0.82347	0.0:1.0:0.0:0.0	.	635;635	Q8TD16-2;Q8TD16	.;BICD2_HUMAN	H	635	ENSP00000349351:R635H;ENSP00000364662:R635H	ENSP00000349351:R635H	R	-	2	0	BICD2	94520844	1.000000	0.71417	0.953000	0.39169	0.834000	0.47266	7.714000	0.84703	2.516000	0.84829	0.561000	0.74099	CGT	BICD2	-	pfam_Bicaudal-D_microtubule-assoc	ENSG00000185963		0.652	BICD2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	BICD2	HGNC	protein_coding	OTTHUMT00000055508.1		0.00	49	0	C	NM_015250		95481023	-1			no_errors	ENST00000356884	ensembl	human	known	74_37	missense	6.90	27	2	SNP	0.996	T
BMPER	168667	genome.wustl.edu	37	7	34118668	34118668	+	Silent	SNP	C	C	T			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr7:34118668C>T	ENST00000297161.2	+	13	1652	c.1278C>T	c.(1276-1278)ggC>ggT	p.G426G	BMPER_ENST00000426693.1_Silent_p.G426G	NM_133468.4	NP_597725.1	Q8N8U9	BMPER_HUMAN	BMP binding endothelial regulator	426	VWFD. {ECO:0000255|PROSITE- ProRule:PRU00580}.				blood vessel endothelial cell proliferation involved in sprouting angiogenesis (GO:0002043)|endothelial cell activation (GO:0042118)|inner ear development (GO:0048839)|negative regulation of BMP signaling pathway (GO:0030514)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|regulation of endothelial cell migration (GO:0010594)|regulation of pathway-restricted SMAD protein phosphorylation (GO:0060393)|ureteric bud development (GO:0001657)	extracellular space (GO:0005615)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|lung(24)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	48						TGGTGCTGGGCGAGAGCAGGG	0.682																																																	0													76.0	77.0	77.0					7																	34118668		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS5442.1	7p14.3	2009-02-18			ENSG00000164619	ENSG00000164619			24154	protein-coding gene	gene with protein product	"""crossveinless-2"""	608699				12897139, 14766204	Standard	NM_133468		Approved	Cv2, CRIM3	uc011kap.2	Q8N8U9	OTTHUMG00000128675	ENST00000297161.2:c.1278C>T	7.37:g.34118668C>T			A8K1P8|Q8TF36	Silent	SNP	pfam_VWF_type-D,pfam_VWF_C,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,superfamily_TIL_dom,smart_VWF_C,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,pfscan_VWF_C	p.G426	ENST00000297161.2	37	c.1278	CCDS5442.1	7																																																																																			BMPER	-	pfam_VWF_type-D,smart_VWF_type-D	ENSG00000164619		0.682	BMPER-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BMPER	HGNC	protein_coding	OTTHUMT00000250570.2	-	0.00	47	0	C	NM_133468		34118668	+1	tier1	-	no_errors	ENST00000297161	ensembl	human	known	74_37	silent	53.66	19	22	SNP	0.115	T
BRCA2	675	genome.wustl.edu	37	13	32912267	32912267	+	Missense_Mutation	SNP	A	A	C	rs587782071		TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr13:32912267A>C	ENST00000380152.3	+	11	4008	c.3775A>C	c.(3775-3777)Agt>Cgt	p.S1259R	BRCA2_ENST00000544455.1_Missense_Mutation_p.S1259R			P51587	BRCA2_HUMAN	breast cancer 2, early onset	1259					brain development (GO:0007420)|cell aging (GO:0007569)|centrosome duplication (GO:0051298)|cytokinesis (GO:0000910)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|female gonad development (GO:0008585)|hemopoiesis (GO:0030097)|histone H3 acetylation (GO:0043966)|histone H4 acetylation (GO:0043967)|inner cell mass cell proliferation (GO:0001833)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|male meiosis I (GO:0007141)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|nucleotide-excision repair (GO:0006289)|oocyte maturation (GO:0001556)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cytokinesis (GO:0032465)|replication fork protection (GO:0048478)|response to gamma radiation (GO:0010332)|response to UV-C (GO:0010225)|response to X-ray (GO:0010165)|spermatogenesis (GO:0007283)	BRCA2-MAGE-D1 complex (GO:0033593)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)|secretory granule (GO:0030141)	gamma-tubulin binding (GO:0043015)|H3 histone acetyltransferase activity (GO:0010484)|H4 histone acetyltransferase activity (GO:0010485)|protease binding (GO:0002020)|single-stranded DNA binding (GO:0003697)			NS(3)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(32)|liver(1)|lung(41)|oesophagus(5)|ovary(22)|pancreas(4)|prostate(3)|salivary_gland(1)|skin(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	183		Lung SC(185;0.0262)		all cancers(112;7.13e-07)|Epithelial(112;1.59e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000732)|BRCA - Breast invasive adenocarcinoma(63;0.0291)|GBM - Glioblastoma multiforme(144;0.0704)		ACATCCAATAAGTTTATCTTC	0.294			"""D, Mis, N, F, S"""		"""breast, ovarian, pancreatic"""	"""breast, ovarian, pancreatic, leukemia  (FANCB, FANCD1)"""		Homologous recombination	Pancreatic Cancer, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Prostate Cancer;Hereditary Breast-Ovarian Cancer, BRCA2 type;Fanconi Anemia type D1, bi-allelic BRCA2 mutations;Fanconi Anemia	TCGA Ovarian(8;0.087)																											Esophageal Squamous(138;838 1285 7957 30353 30468 36915 49332)		yes	Rec	yes	Hereditary breast/ovarian cancer	13	13q12	675	familial breast/ovarian cancer gene 2		"""L, E"""	0													36.0	37.0	36.0					13																	32912267		2203	4299	6502	SO:0001583	missense	0	Familial Cancer Database	incl.: Hereditary Pancreatic Adenocarcinoma, Insulin-Dependent Diabetes Mellitus - Exocrine Insufficiency - Familial Pancreatic Cancer, PNCA1;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;HPC; ;FANCD1;Pancytopenia Dysmelia, FA (several complementation groups)	U43746	CCDS9344.1	13q12-q13	2014-09-17	2003-10-14		ENSG00000139618	ENSG00000139618		"""Fanconi anemia, complementation groups"""	1101	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-containing complex, subunit 2"""	600185	"""Fanconi anemia, complementation group D1"""	FANCD1, FACD, FANCD		8091231, 7581463, 15057823	Standard	NM_000059		Approved	FAD, FAD1, BRCC2	uc001uub.1	P51587	OTTHUMG00000017411	ENST00000380152.3:c.3775A>C	13.37:g.32912267A>C	ENSP00000369497:p.Ser1259Arg		O00183|O15008|Q13879|Q5TBJ7	Missense_Mutation	SNP	pfam_DNA_recomb/repair_BRCA2_hlx,pfam_BRCA2_repeat,pfam_BRCA2_OB_3,pfam_BRCA2_OB_1,pfam_Tower,superfamily_DNA_recomb/repair_BRCA2_hlx,superfamily_NA-bd_OB-fold,pirsf_BRCA2,pfscan_BRCA2_repeat	p.S1259R	ENST00000380152.3	37	c.3775	CCDS9344.1	13	.	.	.	.	.	.	.	.	.	.	A	11.91	1.780762	0.31502	.	.	ENSG00000139618	ENST00000380152;ENST00000544455	T;T	0.00808	5.67;5.67	5.28	2.86	0.33363	.	0.815977	0.11409	N	0.566936	T	0.01454	0.0047	L	0.57536	1.79	0.09310	N	1	B	0.17465	0.022	B	0.15052	0.012	T	0.42716	-0.9435	10	0.51188	T	0.08	.	7.6893	0.28559	0.8193:0.0:0.1807:0.0	.	1259	P51587	BRCA2_HUMAN	R	1259	ENSP00000369497:S1259R;ENSP00000439902:S1259R	ENSP00000369497:S1259R	S	+	1	0	BRCA2	31810267	0.001000	0.12720	0.001000	0.08648	0.819000	0.46315	0.828000	0.27435	0.337000	0.23665	0.528000	0.53228	AGT	BRCA2	-	pirsf_BRCA2	ENSG00000139618		0.294	BRCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRCA2	HGNC	protein_coding	OTTHUMT00000046000.2	-	0.00	18	0	A	NM_000059		32912267	+1	tier1	-	no_errors	ENST00000380152	ensembl	human	known	74_37	missense	21.62	29	8	SNP	0.004	C
BRD4	23476	genome.wustl.edu	37	19	15378297	15378297	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr19:15378297C>A	ENST00000263377.2	-	4	710	c.489G>T	c.(487-489)gaG>gaT	p.E163D	BRD4_ENST00000360016.5_Missense_Mutation_p.E163D|BRD4_ENST00000371835.4_Missense_Mutation_p.E163D	NM_058243.2	NP_490597.1	O60885	BRD4_HUMAN	bromodomain containing 4	163					cellular response to DNA damage stimulus (GO:0006974)|chromatin remodeling (GO:0006338)|chromosome segregation (GO:0007059)|histone H3-K14 acetylation (GO:0044154)|histone H4-K12 acetylation (GO:0043983)|inner cell mass cell proliferation (GO:0001833)|negative regulation of DNA damage checkpoint (GO:2000002)|positive regulation of DNA binding (GO:0043388)|positive regulation of G2/M transition of mitotic cell cycle (GO:0010971)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|regulation of inflammatory response (GO:0050727)|regulation of phosphorylation of RNA polymerase II C-terminal domain (GO:1901407)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromosome (GO:0005694)|condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|positive transcription elongation factor complex b (GO:0008024)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(7)|ovary(2)|urinary_tract(1)	21			OV - Ovarian serous cystadenocarcinoma(3;3.02e-24)|Epithelial(3;4.71e-20)|all cancers(3;2.26e-18)			CTGTGGGTAGCTCATTTATTT	0.453			T	C15orf55	lethal midline carcinoma of young people																																			Dom	yes		19	19p13.1	23476	bromodomain containing 4		E	0													223.0	208.0	213.0					19																	15378297		2203	4300	6503	SO:0001583	missense	0			Y12059	CCDS12328.1, CCDS46004.1	19p13.12	2013-09-20	2002-01-14		ENSG00000141867	ENSG00000141867			13575	protein-coding gene	gene with protein product	"""chromosome-associated protein"""	608749	"""bromodomain-containing 4"""			10938129	Standard	NM_058243		Approved	HUNKI, MCAP, CAP, HUNK1	uc002nar.3	O60885	OTTHUMG00000183252	ENST00000263377.2:c.489G>T	19.37:g.15378297C>A	ENSP00000263377:p.Glu163Asp		O60433|Q4G0X8|Q86YS8|Q96PD3	Missense_Mutation	SNP	pfam_Bromodomain,superfamily_Bromodomain,smart_Bromodomain,pfscan_Bromodomain,prints_Bromodomain	p.E163D	ENST00000263377.2	37	c.489	CCDS12328.1	19	.	.	.	.	.	.	.	.	.	.	C	18.39	3.613045	0.66672	.	.	ENSG00000141867	ENST00000263377;ENST00000371835;ENST00000360016	T;T;T	0.20332	2.08;2.08;2.08	5.54	2.24	0.28232	Bromodomain (3);	0.000000	0.64402	D	0.000003	T	0.14960	0.0361	L	0.57536	1.79	0.45541	D	0.998499	P;B;P	0.43857	0.819;0.1;0.638	B;B;B	0.30179	0.112;0.041;0.079	T	0.04607	-1.0939	10	0.41790	T	0.15	-18.1362	7.9463	0.29989	0.0:0.3503:0.0:0.6497	.	163;163;163	Q4G0X8;O60885-2;O60885	.;.;BRD4_HUMAN	D	163	ENSP00000263377:E163D;ENSP00000360901:E163D;ENSP00000353112:E163D	ENSP00000263377:E163D	E	-	3	2	BRD4	15239297	0.999000	0.42202	0.998000	0.56505	0.990000	0.78478	0.485000	0.22324	0.084000	0.17077	-0.238000	0.12139	GAG	BRD4	-	superfamily_Bromodomain,smart_Bromodomain	ENSG00000141867		0.453	BRD4-001	KNOWN	overlapping_uORF|basic|appris_candidate_longest|CCDS	protein_coding	BRD4	HGNC	protein_coding	OTTHUMT00000465800.3	-	0.00	45	0	C	NM_058243		15378297	-1	tier1	-	no_errors	ENST00000263377	ensembl	human	known	74_37	missense	9.09	40	4	SNP	1.000	A
BRINP3	339479	genome.wustl.edu	37	1	190195440	190195440	+	Frame_Shift_Del	DEL	C	C	-			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr1:190195440delC	ENST00000367462.3	-	6	964	c.733delG	c.(733-735)gtafs	p.V245fs	BRINP3_ENST00000463404.1_5'Flank|BRINP3_ENST00000534846.1_Frame_Shift_Del_p.V143fs	NM_199051.1	NP_950252.1	Q76B58	BRNP3_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 3	245	MACPF.				cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)											GGGAGAAGTACTTGAAGCCCT	0.308																																																	0													57.0	56.0	56.0					1																	190195440		2203	4300	6503	SO:0001589	frameshift_variant	0			AB111893	CCDS1373.1	1q31.1	2013-09-18	2013-09-18	2013-09-18	ENSG00000162670	ENSG00000162670			22393	protein-coding gene	gene with protein product			"""family with sequence similarity 5, member C"""	FAM5C		16018821, 15193423	Standard	NM_199051		Approved	DBCCR1L, DBCCR1L1	uc001gse.1	Q76B58	OTTHUMG00000035533	ENST00000367462.3:c.733delG	1.37:g.190195440delC	ENSP00000356432:p.Val245fs		B3KVP1|B7Z260|O95726|Q2M330	Frame_Shift_Del	DEL	pfam_MACPF,smart_MACPF	p.V245fs	ENST00000367462.3	37	c.733	CCDS1373.1	1																																																																																			BRINP3	-	smart_MACPF	ENSG00000162670		0.308	BRINP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRINP3	HGNC	protein_coding	OTTHUMT00000086278.1		0.00	43	0	C	NM_199051		190195440	-1	tier1		no_errors	ENST00000367462	ensembl	human	known	74_37	frame_shift_del	20.69	23	6	DEL	1.000	-
BRIP1	83990	genome.wustl.edu	37	17	59760671	59760671	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr17:59760671G>T	ENST00000259008.2	-	20	4003	c.3736C>A	c.(3736-3738)Cct>Act	p.P1246T		NM_032043.2	NP_114432.2	Q9BX63	FANCJ_HUMAN	BRCA1 interacting protein C-terminal helicase 1	1246					DNA damage checkpoint (GO:0000077)|DNA duplex unwinding (GO:0032508)|double-strand break repair (GO:0006302)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	4 iron, 4 sulfur cluster binding (GO:0051539)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(3)|endometrium(9)|kidney(5)|large_intestine(9)|liver(2)|lung(15)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	55						TTAAAACCAGGAAACATGCCT	0.274			"""F, N, Mis"""			"""AML, leukemia, breast"""		Involved in tolerance or repair of DNA crosslinks																															yes	Rec		"""Fanconi anaemia J, breast cancer susceptiblity"""	17	17q22	83990	BRCA1 interacting protein C-terminal helicase 1		"""L, E"""	0													61.0	65.0	64.0					17																	59760671		2202	4290	6492	SO:0001583	missense	0			AF360549	CCDS11631.1	17q22.2	2014-09-17				ENSG00000136492		"""Fanconi anemia, complementation groups"""	20473	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-associated helicase 1"""	605882				11595410, 11301010	Standard	NM_032043		Approved	OF, BACH1, FANCJ	uc002izk.2	Q9BX63		ENST00000259008.2:c.3736C>A	17.37:g.59760671G>T	ENSP00000259008:p.Pro1246Thr		Q3MJE2|Q8NCI5	Missense_Mutation	SNP	pfam_DEAD_2,pfam_DNA/RNA_helicase_DEAD/DEAH_N,superfamily_P-loop_NTPase,superfamily_TIL_dom,smart_Helicase-like_DEXD_c2,smart_Helicase_ATP-bd,smart_ATP-dep_Helicase_C,pfscan_Helic_SF1/SF2_ATP-bd_DinG/Rad3,tigrfam_DNA_helicase_DNA-repair_Rad3	p.P1246T	ENST00000259008.2	37	c.3736	CCDS11631.1	17	.	.	.	.	.	.	.	.	.	.	G	3.053	-0.195028	0.06259	.	.	ENSG00000136492	ENST00000259008	T	0.77877	-1.13	4.65	2.52	0.30459	.	.	.	.	.	T	0.57198	0.2037	N	0.14661	0.345	0.09310	N	0.999999	B	0.02656	0.0	B	0.04013	0.001	T	0.37526	-0.9702	8	.	.	.	.	6.4666	0.21985	0.0999:0.0:0.7173:0.1828	.	1246	Q9BX63	FANCJ_HUMAN	T	1246	ENSP00000259008:P1246T	.	P	-	1	0	BRIP1	57115453	0.047000	0.20315	0.058000	0.19502	0.059000	0.15707	1.980000	0.40618	2.274000	0.75844	0.467000	0.42956	CCT	BRIP1	-	NULL	ENSG00000136492		0.274	BRIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRIP1	HGNC	protein_coding	OTTHUMT00000445362.1		0.00	43	0	G	NM_032043		59760671	-1			no_errors	ENST00000259008	ensembl	human	known	74_37	missense	6.25	45	3	SNP	0.018	T
BTAF1	9044	genome.wustl.edu	37	10	93740298	93740298	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr10:93740298C>A	ENST00000265990.6	+	15	2046	c.1738C>A	c.(1738-1740)Ctg>Atg	p.L580M	BTAF1_ENST00000471217.1_3'UTR	NM_003972.2	NP_003963.1	O14981	BTAF1_HUMAN	BTAF1 RNA polymerase II, B-TFIID transcription factor-associated, 170kDa	580					negative regulation of chromatin binding (GO:0035562)|negative regulation of transcription, DNA-templated (GO:0045892)	nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|lung(17)|ovary(1)|prostate(1)|skin(2)|urinary_tract(6)	59		Colorectal(252;0.0846)				CCAGGAAATTCTGGACCTTAT	0.348																																																	0													92.0	85.0	87.0					10																	93740298		2203	4300	6503	SO:0001583	missense	0			AJ001017	CCDS7419.1	10q22-q23	2013-05-01	2013-05-01		ENSG00000095564	ENSG00000095564			17307	protein-coding gene	gene with protein product	"""Mot1 homolog (S. cerevisiae)"""	605191	"""BTAF1 RNA polymerase II, B-TFIID transcription factor-associated, 170 kD (Mot1 homolog, S. cerevisiae)"""			9342322, 9488487	Standard	NM_003972		Approved	TAFII170, TAF172, MOT1, TAF-172, TAF(II)170	uc001khr.3	O14981	OTTHUMG00000018752	ENST00000265990.6:c.1738C>A	10.37:g.93740298C>A	ENSP00000265990:p.Leu580Met		B4E0W6|O43578	Missense_Mutation	SNP	pfam_DUF3535,pfam_SNF2_N,pfam_HEAT,pfam_Helicase_C,superfamily_ARM-type_fold,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.L580M	ENST00000265990.6	37	c.1738	CCDS7419.1	10	.	.	.	.	.	.	.	.	.	.	C	15.21	2.767111	0.49574	.	.	ENSG00000095564	ENST00000265990	D	0.91631	-2.88	5.52	3.67	0.42095	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.93135	0.7814	M	0.71296	2.17	0.80722	D	1	D;D	0.58268	0.982;0.982	P;P	0.59357	0.856;0.856	D	0.90216	0.4268	10	0.34782	T	0.22	-3.2582	6.2794	0.20999	0.1481:0.6951:0.0:0.1567	.	580;580	Q2M1V9;O14981	.;BTAF1_HUMAN	M	580	ENSP00000265990:L580M	ENSP00000265990:L580M	L	+	1	2	BTAF1	93730278	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	1.898000	0.39809	0.700000	0.31782	-0.444000	0.05651	CTG	BTAF1	-	superfamily_ARM-type_fold	ENSG00000095564		0.348	BTAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BTAF1	HGNC	protein_coding	OTTHUMT00000049380.4	-	0.00	53	0	C	NM_003972		93740298	+1	tier1	-	no_errors	ENST00000265990	ensembl	human	known	74_37	missense	20.00	60	15	SNP	1.000	A
C11orf16	56673	genome.wustl.edu	37	11	8951033	8951033	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr11:8951033T>C	ENST00000326053.5	-	3	321	c.215A>G	c.(214-216)cAg>cGg	p.Q72R	C11orf16_ENST00000525780.1_Missense_Mutation_p.Q72R|C11orf16_ENST00000528998.1_Intron	NM_020643.2	NP_065694.2	Q9NQ32	CK016_HUMAN	chromosome 11 open reading frame 16	72										central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|stomach(2)|upper_aerodigestive_tract(1)	22				Epithelial(150;4.11e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0234)		GCCAGGCCCCTGCCATGCTGG	0.532																																																	0													67.0	67.0	67.0					11																	8951033		2201	4296	6497	SO:0001583	missense	0			AJ400877	CCDS7794.1	11p15.3	2008-06-25			ENSG00000176029	ENSG00000176029			1169	protein-coding gene	gene with protein product						11528127	Standard	NM_020643		Approved		uc001mhb.4	Q9NQ32	OTTHUMG00000165654	ENST00000326053.5:c.215A>G	11.37:g.8951033T>C	ENSP00000318999:p.Gln72Arg		Q53FB2|Q8N6Y9	Missense_Mutation	SNP	NULL	p.Q72R	ENST00000326053.5	37	c.215	CCDS7794.1	11	.	.	.	.	.	.	.	.	.	.	T	4.804	0.149448	0.09185	.	.	ENSG00000176029	ENST00000525780;ENST00000326053;ENST00000526227	T;T	0.31510	1.5;1.49	4.66	2.27	0.28462	.	0.361457	0.23949	N	0.042974	T	0.25121	0.0610	L	0.47716	1.5	0.09310	N	1	P;P	0.46512	0.739;0.879	B;B	0.43103	0.221;0.408	T	0.08432	-1.0722	10	0.38643	T	0.18	-17.2778	6.2071	0.20608	0.0:0.0853:0.1676:0.7471	.	72;72	Q9NQ32-2;Q9NQ32	.;CK016_HUMAN	R	72	ENSP00000436818:Q72R;ENSP00000318999:Q72R	ENSP00000318999:Q72R	Q	-	2	0	C11orf16	8907609	0.551000	0.26497	0.204000	0.23530	0.043000	0.13939	2.044000	0.41241	0.357000	0.24183	0.533000	0.62120	CAG	C11orf16	-	NULL	ENSG00000176029		0.532	C11orf16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C11orf16	HGNC	protein_coding	OTTHUMT00000385626.1		0.00	52	0	T	NM_020643		8951033	-1			no_errors	ENST00000326053	ensembl	human	known	74_37	missense	5.06	75	4	SNP	0.053	C
C16orf82	162083	genome.wustl.edu	37	16	27078105	27078105	+	lincRNA	SNP	C	C	A			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr16:27078105C>A	ENST00000505035.1	+	0	78				RP11-673P17.2_ENST00000565783.1_RNA			Q7Z2V1	TNT_HUMAN	chromosome 16 open reading frame 82																		TGCCCCACTCCTACCCTCCAG	0.622																																																	0													23.0	25.0	24.0					16																	27078105		2024	4181	6205			0			BC031257		16p12.1	2013-01-24			ENSG00000234186	ENSG00000234186			30755	other	unknown						12477932	Standard	NM_001145545		Approved	TNT	uc010vcm.2	Q7Z2V1	OTTHUMG00000161986		16.37:g.27078105C>A			B9EGC2|Q8NEF0	RNA	SNP	-	NULL	ENST00000505035.1	37	NULL		16																																																																																			C16orf82	-	-	ENSG00000234186		0.622	C16orf82-001	KNOWN	basic	lincRNA	C16orf82	HGNC	lincRNA	OTTHUMT00000366634.1	-	0.00	44	0	C	NM_001145545		27078105	+1	tier1	-	no_errors	ENST00000505035	ensembl	human	known	74_37	rna	53.97	29	34	SNP	0.000	A
C17orf75	64149	genome.wustl.edu	37	17	30665254	30665254	+	Nonsense_Mutation	SNP	A	A	T			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr17:30665254A>T	ENST00000577809.1	-	4	513	c.464T>A	c.(463-465)tTa>tAa	p.L155*	C17orf75_ENST00000225805.4_Nonsense_Mutation_p.L155*|RP11-227G15.3_ENST00000581915.1_RNA	NM_022344.3	NP_071739.2	Q9HAS0	NJMU_HUMAN	chromosome 17 open reading frame 75	155										ovary(1)	1		Breast(31;0.116)|Ovarian(249;0.182)	BRCA - Breast invasive adenocarcinoma(9;0.239)			AGACCCTCCTAAAAAACAGAC	0.388																																																	0													158.0	153.0	155.0					17																	30665254		1840	4099	5939	SO:0001587	stop_gained	0			AB062437	CCDS58537.1	17q11.2	2013-01-21			ENSG00000108666	ENSG00000108666			30173	protein-coding gene	gene with protein product							Standard	NM_022344		Approved	NJMU-R1	uc002hhg.3	Q9HAS0		ENST00000577809.1:c.464T>A	17.37:g.30665254A>T	ENSP00000464275:p.Leu155*		Q7Z2H4	Nonsense_Mutation	SNP	NULL	p.L155*	ENST00000577809.1	37	c.464	CCDS58537.1	17	.	.	.	.	.	.	.	.	.	.	A	36	5.620475	0.96660	.	.	ENSG00000108666	ENST00000225805	.	.	.	5.68	5.68	0.88126	.	0.068483	0.64402	D	0.000019	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-15.7355	15.9265	0.79621	1.0:0.0:0.0:0.0	.	.	.	.	X	155	.	ENSP00000225805:L155X	L	-	2	0	C17orf75	27689367	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.818000	0.91991	2.174000	0.68829	0.459000	0.35465	TTA	C17orf75	-	NULL	ENSG00000108666		0.388	C17orf75-001	KNOWN	non_canonical_U12|basic|appris_candidate_longest|CCDS	protein_coding	C17orf75	HGNC	protein_coding	OTTHUMT00000447204.1	-	0.00	48	0	A	NM_022344		30665254	-1	tier1	-	no_errors	ENST00000225805	ensembl	human	known	74_37	nonsense	6.90	54	4	SNP	1.000	T
C19orf44	84167	genome.wustl.edu	37	19	16611880	16611880	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr19:16611880G>A	ENST00000221671.3	+	2	433	c.277G>A	c.(277-279)Gca>Aca	p.A93T	CTD-3222D19.2_ENST00000409035.1_Intron|C19orf44_ENST00000594035.1_Missense_Mutation_p.A93T	NM_032207.2	NP_115583.1	Q9H6X5	CS044_HUMAN	chromosome 19 open reading frame 44	93										endometrium(1)|large_intestine(5)|lung(5)|ovary(1)|skin(1)|stomach(1)|urinary_tract(2)	16						AGCCAATGCCGCACTCATGAA	0.567																																																	0													98.0	109.0	105.0					19																	16611880		2203	4300	6503	SO:0001583	missense	0			AK025395	CCDS12345.1, CCDS74306.1	19p13.11	2011-11-24			ENSG00000105072	ENSG00000105072			26141	protein-coding gene	gene with protein product						12477932	Standard	NM_032207		Approved	FLJ21742	uc002neh.1	Q9H6X5		ENST00000221671.3:c.277G>A	19.37:g.16611880G>A	ENSP00000221671:p.Ala93Thr		Q8N6Y7	Missense_Mutation	SNP	NULL	p.A93T	ENST00000221671.3	37	c.277	CCDS12345.1	19	.	.	.	.	.	.	.	.	.	.	G	23.0	4.368082	0.82463	.	.	ENSG00000105072	ENST00000221671	.	.	.	5.3	5.3	0.74995	.	0.070955	0.53938	D	0.000047	T	0.66307	0.2776	M	0.68952	2.095	0.09310	N	0.999998	D;D	0.89917	1.0;1.0	D;D	0.70716	0.946;0.97	T	0.61058	-0.7139	9	0.62326	D	0.03	-9.4081	15.7129	0.77644	0.0:0.0:1.0:0.0	.	93;93	Q9H6X5;Q9H6X5-2	CS044_HUMAN;.	T	93	.	ENSP00000221671:A93T	A	+	1	0	C19orf44	16472880	0.018000	0.18449	0.005000	0.12908	0.009000	0.06853	2.173000	0.42472	2.482000	0.83794	0.655000	0.94253	GCA	C19orf44	-	NULL	ENSG00000105072		0.567	C19orf44-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	C19orf44	HGNC	protein_coding	OTTHUMT00000461218.1	-	0.00	69	0	G	NM_032207		16611880	+1	tier1	-	no_errors	ENST00000221671	ensembl	human	known	74_37	missense	6.06	62	4	SNP	0.019	A
RSRP1	57035	genome.wustl.edu	37	1	25571794	25571795	+	Splice_Site	INS	-	-	A	rs543739883|rs113744649	byFrequency	TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr1:25571794_25571795insA	ENST00000243189.7	-	3	797		c.e3-2		RP3-465N24.6_ENST00000607698.1_lincRNA|C1orf63_ENST00000431849.2_Splice_Site|C1orf63_ENST00000417642.2_Splice_Site	NM_020317.3	NP_064713.3	Q9BUV0	RSRP1_HUMAN												breast(1)|large_intestine(1)|lung(4)|pancreas(1)	7		Colorectal(325;3.46e-05)|Lung NSC(340;0.000245)|all_lung(284;0.000335)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0101)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0936)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0415)|OV - Ovarian serous cystadenocarcinoma(117;7.9e-27)|Colorectal(126;8.83e-09)|COAD - Colon adenocarcinoma(152;6.43e-07)|STAD - Stomach adenocarcinoma(196;0.000333)|BRCA - Breast invasive adenocarcinoma(304;0.000443)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|GBM - Glioblastoma multiforme(114;0.000932)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)		CCATTCGATCTAAAAAAAAAAG	0.337																																																	0																																										SO:0001630	splice_region_variant	0																														ENST00000243189.7:c.521-2->T	1.37:g.25571804_25571804dupA			A8K917|Q49AA4|Q5TH71|Q9GZP6	Splice_Site	INS	-	e2-2	ENST00000243189.7	37	c.500-3_500-2	CCDS260.1	1																																																																																			C1orf63	-	-	ENSG00000117616		0.337	C1orf63-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	C1orf63	HGNC	protein_coding	OTTHUMT00000101966.2		0.00	30	0	-		Intron	25571795	-1	tier1		no_errors	ENST00000417642	ensembl	human	known	74_37	splice_site_ins	15.15	28	5	INS	0.972:0.056	A
NOL4L	140688	genome.wustl.edu	37	20	31099209	31099209	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr20:31099209G>A	ENST00000201961.2	-	4	577	c.358C>T	c.(358-360)Ccc>Tcc	p.P120S	C20orf112_ENST00000375678.3_Missense_Mutation_p.P79S|C20orf112_ENST00000375677.1_5'UTR			Q96MY1	NOL4L_HUMAN		273						cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(3)|kidney(2)|large_intestine(5)|lung(5)	15						GAGGTGAGGGGCATGTTGTAA	0.552																																																	0																																										SO:0001583	missense	0																														ENST00000201961.2:c.358C>T	20.37:g.31099209G>A	ENSP00000201961:p.Pro120Ser		Q5JYB7|Q6P0Y4|Q9BR34|Q9NQF6	Missense_Mutation	SNP	NULL	p.P120S	ENST00000201961.2	37	c.358		20	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	29.4|29.4	5.001645|5.001645	0.93227|0.93227	.|.	.|.	ENSG00000197183|ENSG00000197183	ENST00000419612|ENST00000375678;ENST00000201961;ENST00000375673	.|.	.|.	.|.	4.84|4.84	4.84|4.84	0.62591|0.62591	.|.	.|.	.|.	.|.	.|.	T|T	0.69842|0.69842	0.3156|0.3156	L|L	0.47716|0.47716	1.5|1.5	0.45946|0.45946	D|D	0.998771|0.998771	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.72503|0.72503	-0.4273|-0.4273	5|6	.|0.72032	.|D	.|0.01	.|.	17.4802|17.4802	0.87671|0.87671	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	V|S	32|79;120;38	.|.	.|ENSP00000201961:P120S	A|P	-|-	2|1	0|0	C20orf112|C20orf112	30562870|30562870	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	9.012000|9.012000	0.93624|0.93624	2.676000|2.676000	0.91093|0.91093	0.561000|0.561000	0.74099|0.74099	GCC|CCC	C20orf112	-	NULL	ENSG00000197183		0.552	C20orf112-002	KNOWN	basic|appris_candidate_longest	protein_coding	C20orf112	HGNC	protein_coding	OTTHUMT00000078629.3	-	0.00	41	0	G			31099209	-1	tier1	-	no_errors	ENST00000201961	ensembl	human	known	74_37	missense	5.15	92	5	SNP	1.000	A
C2orf81	388963	genome.wustl.edu	37	2	74642950	74642950	+	Silent	SNP	G	G	A			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr2:74642950G>A	ENST00000517883.1	-	1	760	c.69C>T	c.(67-69)ccC>ccT	p.P23P	C2orf81_ENST00000290390.5_Silent_p.P121P			A6NN90	CB081_HUMAN	chromosome 2 open reading frame 81	114										endometrium(3)|kidney(1)	4						CACCCCATGTGGGGTCCTCAG	0.657																																																	0													40.0	46.0	44.0					2																	74642950		692	1591	2283	SO:0001819	synonymous_variant	0			AC005041, CH471053		2p13.1	2012-08-07			ENSG00000159239	ENSG00000159239			34350	protein-coding gene	gene with protein product						15815621	Standard	NM_001145054		Approved	LOC388963, hCG40743	uc010yrq.1	A6NN90	OTTHUMG00000164184	ENST00000517883.1:c.69C>T	2.37:g.74642950G>A				Silent	SNP	NULL	p.P121	ENST00000517883.1	37	c.363		2																																																																																			C2orf81	-	NULL	ENSG00000159239		0.657	C2orf81-002	PUTATIVE	basic|appris_candidate	protein_coding	C2orf81	HGNC	protein_coding	OTTHUMT00000377683.1	-	0.00	25	0	G	NM_001145054		74642950	-1	tier1	-	no_errors	ENST00000290390	ensembl	human	known	74_37	silent	35.90	25	14	SNP	0.943	A
C5orf22	55322	genome.wustl.edu	37	5	31535892	31535892	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr5:31535892C>T	ENST00000325366.9	+	3	396	c.269C>T	c.(268-270)gCt>gTt	p.A90V	C5orf22_ENST00000355907.3_5'UTR	NM_018356.2	NP_060826.2	Q49AR2	CE022_HUMAN	chromosome 5 open reading frame 22	90										kidney(3)|large_intestine(2)|lung(10)|ovary(2)|skin(1)	18						GCAGTTTATGCTGGCCATTTT	0.363																																																	0													93.0	86.0	88.0					5																	31535892		2203	4300	6503	SO:0001583	missense	0			AK002055	CCDS3895.1	5p13.3	2012-02-22			ENSG00000082213	ENSG00000082213			25639	protein-coding gene	gene with protein product							Standard	NM_018356		Approved	FLJ11193	uc003jhj.4	Q49AR2	OTTHUMG00000131067	ENST00000325366.9:c.269C>T	5.37:g.31535892C>T	ENSP00000326879:p.Ala90Val		Q8ND28|Q8WU61|Q9NUR1	Missense_Mutation	SNP	superfamily_ICAT	p.A90V	ENST00000325366.9	37	c.269	CCDS3895.1	5	.	.	.	.	.	.	.	.	.	.	C	36	5.598925	0.96614	.	.	ENSG00000082213	ENST00000325366;ENST00000507818	T;T	0.52526	0.66;0.66	6.03	6.03	0.97812	.	0.000000	0.85682	D	0.000000	T	0.75474	0.3854	M	0.87180	2.865	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.77970	-0.2387	10	0.87932	D	0	-23.2775	20.5568	0.99304	0.0:1.0:0.0:0.0	.	90	Q49AR2	CE022_HUMAN	V	90;121	ENSP00000326879:A90V;ENSP00000430860:A121V	ENSP00000326879:A90V	A	+	2	0	C5orf22	31571649	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	7.400000	0.79949	2.861000	0.98227	0.655000	0.94253	GCT	C5orf22	-	NULL	ENSG00000082213		0.363	C5orf22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C5orf22	HGNC	protein_coding	OTTHUMT00000253726.2	-	0.00	44	0	C	NM_018356		31535892	+1	tier1	-	no_errors	ENST00000325366	ensembl	human	known	74_37	missense	8.00	46	4	SNP	1.000	T
CAB39L	81617	genome.wustl.edu	37	13	49951208	49951208	+	Silent	SNP	G	G	A	rs141795356	byFrequency	TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr13:49951208G>A	ENST00000355854.4	-	3	668	c.171C>T	c.(169-171)aaC>aaT	p.N57N	CAB39L_ENST00000410043.1_Silent_p.N57N|CAB39L_ENST00000409308.1_Silent_p.N57N|CAB39L_ENST00000347776.5_Silent_p.N57N	NM_030925.2	NP_112187.2	Q9H9S4	CB39L_HUMAN	calcium binding protein 39-like	57					cell cycle arrest (GO:0007050)|insulin receptor signaling pathway (GO:0008286)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)				breast(1)|endometrium(2)|large_intestine(4)|lung(3)|pancreas(1)|stomach(1)	12		Lung NSC(96;2.11e-05)|Breast(56;0.00017)|Prostate(109;0.00314)|Hepatocellular(98;0.0207)|Myeloproliferative disorder(33;0.163)|Lung SC(185;0.187)|all_neural(104;0.19)	KIRC - Kidney renal clear cell carcinoma(9;0.206)	GBM - Glioblastoma multiforme(99;3.66e-09)|COAD - Colon adenocarcinoma(199;0.226)		GTTCTTTCTCGTTTGTACCAC	0.438																																																	0								G	,	1,4405	2.1+/-5.4	0,1,2202	122.0	118.0	119.0		171,171	1.7	0.9	13	dbSNP_134	119	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous,coding-synonymous	CAB39L	NM_001079670.1,NM_030925.2	,	0,3,6500	AA,AG,GG		0.0233,0.0227,0.0231	,	57/338,57/338	49951208	3,13003	2203	4300	6503	SO:0001819	synonymous_variant	0			AK022639	CCDS9416.2	13q14.11	2008-02-05			ENSG00000102547	ENSG00000102547			20290	protein-coding gene	gene with protein product		612175					Standard	NM_030925		Approved	bA103J18.3, FLJ12577, MO2L	uc001vcw.3	Q9H9S4	OTTHUMG00000016914	ENST00000355854.4:c.171C>T	13.37:g.49951208G>A			Q5TAW6|Q6WG71|Q96FG1|Q9BZ33	Silent	SNP	pfam_Mo25,superfamily_ARM-type_fold	p.N57	ENST00000355854.4	37	c.171	CCDS9416.2	13																																																																																			CAB39L	-	pfam_Mo25,superfamily_ARM-type_fold	ENSG00000102547		0.438	CAB39L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CAB39L	HGNC	protein_coding	OTTHUMT00000044908.3		0.00	43	0	G	NM_030925		49951208	-1			no_errors	ENST00000347776	ensembl	human	known	74_37	silent	5.88	48	3	SNP	0.557	A
CACNA1E	777	genome.wustl.edu	37	1	181680102	181680103	+	Frame_Shift_Del	DEL	AG	AG	-	rs147596634		TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	AG	AG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr1:181680102_181680103delAG	ENST00000367573.2	+	8	1068_1069	c.1068_1069delAG	c.(1066-1071)aaagagfs	p.E357fs	CACNA1E_ENST00000358338.5_Frame_Shift_Del_p.E308fs|CACNA1E_ENST00000357570.5_Frame_Shift_Del_p.E308fs|CACNA1E_ENST00000526775.1_Frame_Shift_Del_p.E357fs|CACNA1E_ENST00000360108.3_Frame_Shift_Del_p.E357fs|CACNA1E_ENST00000367567.4_5'UTR|CACNA1E_ENST00000367570.1_Frame_Shift_Del_p.E357fs	NM_001205293.1	NP_001192222.1	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type, alpha 1E subunit	357					calcium ion import (GO:0070509)|energy reserve metabolic process (GO:0006112)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|voltage-gated calcium channel activity (GO:0005245)			NS(2)|breast(9)|central_nervous_system(3)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(6)|kidney(4)|large_intestine(34)|lung(99)|ovary(6)|pancreas(1)|prostate(9)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	204						AATTTGCCAAAGAGAGAGAGAG	0.51																																																	0									,,	161,3503		41,79,1712					,,	5.3	1.0		dbSNP_134	61	297,7585		52,193,3696	yes	frameshift,frameshift,frameshift	CACNA1E	NM_001205294.1,NM_001205293.1,NM_000721.3	,,	93,272,5408	A1A1,A1R,RR		3.7681,4.3941,3.9667	,,	,,		458,11088				SO:0001589	frameshift_variant	0			AK096563	CCDS53443.1, CCDS55664.1, CCDS55665.1	1q25.3	2013-01-10	2007-02-16		ENSG00000198216	ENSG00000198216		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1392	protein-coding gene	gene with protein product		601013		CACNL1A6		8388125, 16382099	Standard	NM_001205293		Approved	Cav2.3, BII, CACH6	uc009wxt.3	Q15878	OTTHUMG00000037301	ENST00000367573.2:c.1068_1069delAG	1.37:g.181680112_181680113delAG	ENSP00000356545:p.Glu357fs		B1AM12|B1AM13|B1AM14|Q14580|Q14581	Frame_Shift_Del	DEL	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,pfscan_EF_hand_dom,prints_VDCCAlpha1,prints_VDCC_R_a1su	p.R360fs	ENST00000367573.2	37	c.1068_1069	CCDS55664.1	1																																																																																			CACNA1E	-	prints_VDCCAlpha1	ENSG00000198216		0.510	CACNA1E-003	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	CACNA1E	HGNC	protein_coding	OTTHUMT00000090793.2		0.00	35	0	AG	NM_000721		181680103	+1	tier1		no_errors	ENST00000367573	ensembl	human	known	74_37	frame_shift_del	8.33	22	2	DEL	1.000:1.000	-
CACNA1F	778	genome.wustl.edu	37	X	49063212	49063212	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chrX:49063212C>T	ENST00000376265.2	-	45	5430	c.5369G>A	c.(5368-5370)cGt>cAt	p.R1790H	CACNA1F_ENST00000323022.5_Missense_Mutation_p.R1779H|CACNA1F_ENST00000376251.1_Missense_Mutation_p.R1725H	NM_005183.2	NP_005174.2	O60840	CAC1F_HUMAN	calcium channel, voltage-dependent, L type, alpha 1F subunit	1790					axonogenesis (GO:0007409)|calcium ion import (GO:0070509)|cellular calcium ion homeostasis (GO:0006874)|dendrite morphogenesis (GO:0048813)|detection of light stimulus involved in visual perception (GO:0050908)|membrane depolarization during action potential (GO:0086010)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|perikaryon (GO:0043204)|photoreceptor outer segment (GO:0001750)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)	p.R1790H(1)		autonomic_ganglia(1)|breast(8)|central_nervous_system(3)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(24)|ovary(5)|prostate(3)|skin(4)|urinary_tract(1)	85					Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Nimodipine(DB00393)|Spironolactone(DB00421)|Verapamil(DB00661)	GGGCAGCAGACGGCGGCGTGG	0.612																																																	1	Substitution - Missense(1)	large_intestine(1)											45.0	45.0	45.0					X																	49063212		2203	4300	6503	SO:0001583	missense	0			AA019975	CCDS35253.1, CCDS59166.1, CCDS59167.1	Xp11.23	2013-01-23	2007-02-16		ENSG00000102001	ENSG00000102001		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1393	protein-coding gene	gene with protein product		300110	"""Aland island eye disease (Forsius-Eriksson ocular albinism, ocular albinism type 2)"""	CSNB2, AIED		9344658, 9662400, 16382099, 12111638, 17525176	Standard	NM_005183		Approved	Cav1.4, JM8, JMC8, CSNBX2, CORDX3, CSNB2A, OA2	uc010nip.3	O60840	OTTHUMG00000022703	ENST00000376265.2:c.5369G>A	X.37:g.49063212C>T	ENSP00000365441:p.Arg1790His		A6NI29|F5CIQ9|O43901|O95226|Q9UHB1	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,prints_VDCCAlpha1,prints_VDCC_L_a1su	p.R1790H	ENST00000376265.2	37	c.5369	CCDS35253.1	X	.	.	.	.	.	.	.	.	.	.	C	20.8	4.045488	0.75846	.	.	ENSG00000102001	ENST00000376251;ENST00000323022;ENST00000376265	T;T;T	0.61392	0.11;0.11;0.11	5.6	5.6	0.85130	.	0.767914	0.12415	N	0.470940	T	0.74230	0.3689	M	0.69358	2.11	0.51233	D	0.99991	D;D	0.76494	0.999;0.999	D;D	0.80764	0.994;0.987	T	0.66709	-0.5855	10	0.25106	T	0.35	.	15.8861	0.79251	0.0:1.0:0.0:0.0	.	1779;1790	F5CIQ9;O60840	.;CAC1F_HUMAN	H	1725;1779;1790	ENSP00000365427:R1725H;ENSP00000321618:R1779H;ENSP00000365441:R1790H	ENSP00000321618:R1779H	R	-	2	0	CACNA1F	48950156	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	3.949000	0.56668	2.350000	0.79820	0.529000	0.55759	CGT	CACNA1F	-	NULL	ENSG00000102001		0.612	CACNA1F-007	KNOWN	basic|appris_principal|CCDS	protein_coding	CACNA1F	HGNC	protein_coding	OTTHUMT00000358157.1	-	0.00	46	0	C	NM_005183		49063212	-1	tier1	-	no_errors	ENST00000376265	ensembl	human	known	74_37	missense	8.16	45	4	SNP	1.000	T
CADPS	8618	genome.wustl.edu	37	3	62631400	62631400	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr3:62631400G>T	ENST00000383710.4	-	6	1671	c.1322C>A	c.(1321-1323)cCa>cAa	p.P441Q	CADPS_ENST00000357948.3_Missense_Mutation_p.P441Q|CADPS_ENST00000283269.9_Missense_Mutation_p.P441Q|CADPS_ENST00000490353.2_Missense_Mutation_p.P441Q	NM_003716.3	NP_003707.2	Q9ULU8	CAPS1_HUMAN	Ca++-dependent secretion activator	441	C2.				catecholamine secretion (GO:0050432)|exocytosis (GO:0006887)|protein transport (GO:0015031)|synaptic vesicle priming (GO:0016082)|vesicle organization (GO:0016050)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|membrane (GO:0016020)|synapse (GO:0045202)	lipid binding (GO:0008289)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)			breast(3)|central_nervous_system(2)|endometrium(6)|kidney(6)|large_intestine(24)|lung(38)|ovary(4)|prostate(3)|skin(3)|stomach(1)|urinary_tract(2)	92		Lung SC(41;0.0452)		BRCA - Breast invasive adenocarcinoma(55;5.98e-05)|KIRC - Kidney renal clear cell carcinoma(15;0.0246)|Kidney(15;0.0334)		AACTTACGTTGGTTTAGAAGC	0.463																																																	0													198.0	188.0	191.0					3																	62631400		2203	4300	6503	SO:0001583	missense	0			U36448	CCDS2898.1, CCDS2899.1, CCDS46858.1	3p21.1	2013-01-10	2008-08-28		ENSG00000163618	ENSG00000163618		"""Pleckstrin homology (PH) domain containing"""	1426	protein-coding gene	gene with protein product		604667				1516133	Standard	NM_183393		Approved	CAPS, KIAA1121, CAPS1	uc003dll.2	Q9ULU8	OTTHUMG00000158651	ENST00000383710.4:c.1322C>A	3.37:g.62631400G>T	ENSP00000373215:p.Pro441Gln		A6NF60|Q13339|Q6GQQ6|Q8N2Z5|Q8N3M7|Q8NFR0|Q96BC2	Missense_Mutation	SNP	pfam_Ca-dep_secretion_activator,superfamily_C2_dom,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.P441Q	ENST00000383710.4	37	c.1322	CCDS46858.1	3	.	.	.	.	.	.	.	.	.	.	G	28.5	4.925524	0.92319	.	.	ENSG00000163618	ENST00000383709;ENST00000383710;ENST00000357948;ENST00000283269;ENST00000490353	D;D;D;T	0.93133	-3.17;-3.17;-3.17;0.31	5.44	5.44	0.79542	C2 calcium-dependent membrane targeting (1);	0.000000	0.85682	D	0.000000	D	0.96796	0.8954	M	0.78049	2.395	0.80722	D	1	D;D;D	0.76494	0.997;0.999;0.981	D;D;P	0.83275	0.985;0.996;0.77	D	0.96980	0.9714	10	0.87932	D	0	.	19.6287	0.95691	0.0:0.0:1.0:0.0	.	441;441;441	Q9ULU8-2;Q9ULU8-3;Q9ULU8	.;.;CAPS1_HUMAN	Q	441	ENSP00000373215:P441Q;ENSP00000350632:P441Q;ENSP00000283269:P441Q;ENSP00000418736:P441Q	ENSP00000283269:P441Q	P	-	2	0	CADPS	62606440	1.000000	0.71417	0.997000	0.53966	0.918000	0.54935	9.869000	0.99810	2.710000	0.92621	0.655000	0.94253	CCA	CADPS	-	superfamily_C2_dom	ENSG00000163618		0.463	CADPS-013	KNOWN	basic|appris_principal|CCDS	protein_coding	CADPS	HGNC	protein_coding	OTTHUMT00000351951.5	-	0.00	79	0	G	NM_003716, NM_183393, NM_183394		62631400	-1	tier1	-	no_errors	ENST00000383710	ensembl	human	known	74_37	missense	28.57	40	16	SNP	1.000	T
CCDC42	146849	genome.wustl.edu	37	17	8638852	8638852	+	Silent	SNP	C	C	T			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr17:8638852C>T	ENST00000293845.3	-	5	796	c.570G>A	c.(568-570)caG>caA	p.Q190Q	CCDC42_ENST00000539522.2_Intron	NM_144681.2	NP_653282.2	Q96M95	CCD42_HUMAN	coiled-coil domain containing 42	190										kidney(1)|large_intestine(4)|lung(3)|ovary(1)	9						CCTGGCCTTCCTGCGCAGACT	0.582																																																	0													67.0	60.0	62.0					17																	8638852		2203	4300	6503	SO:0001819	synonymous_variant	0			AK057296	CCDS11145.1, CCDS54088.1	17p13.1	2012-05-28			ENSG00000161973	ENSG00000161973			26528	protein-coding gene	gene with protein product							Standard	NM_144681		Approved	FLJ32734, CCDC42A	uc002gln.3	Q96M95		ENST00000293845.3:c.570G>A	17.37:g.8638852C>T			Q8N6Q0	Silent	SNP	NULL	p.Q190	ENST00000293845.3	37	c.570	CCDS11145.1	17																																																																																			CCDC42	-	NULL	ENSG00000161973		0.582	CCDC42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC42	HGNC	protein_coding	OTTHUMT00000442491.1	-	0.00	15	0	C	NM_144681		8638852	-1	tier1	-	no_errors	ENST00000293845	ensembl	human	known	74_37	silent	21.05	15	4	SNP	1.000	T
CCDC74A	90557	genome.wustl.edu	37	2	132287585	132287585	+	Intron	SNP	C	C	G			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr2:132287585C>G	ENST00000295171.6	+	2	433				CCDC74A_ENST00000409856.3_Intron|CCDC74A_ENST00000467992.2_Missense_Mutation_p.A12G	NM_001258304.1|NM_001258305.1|NM_138770.2	NP_001245233.1|NP_001245234.1|NP_620125.1	Q96AQ1	CC74A_HUMAN	coiled-coil domain containing 74A											endometrium(4)|large_intestine(3)|lung(9)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19						CCCTGCCCTGCTAGATCTTTG	0.622																																																	0																																										SO:0001627	intron_variant	0				CCDS2167.1, CCDS58732.1, CCDS74578.1	2q21.1	2008-02-05		2006-02-16	ENSG00000163040	ENSG00000163040			25197	protein-coding gene	gene with protein product						12477932	Standard	NM_138770		Approved	FLJ40345	uc002ttb.4	Q96AQ1	OTTHUMG00000131667	ENST00000295171.6:c.295+321C>G	2.37:g.132287585C>G			Q6P4I5	Missense_Mutation	SNP	NULL	p.A12G	ENST00000295171.6	37	c.35	CCDS2167.1	2	.	.	.	.	.	.	.	.	.	.	.	14.45	2.539117	0.45176	.	.	ENSG00000163040	ENST00000467992	T	0.54279	0.58	1.92	0.894	0.19242	.	.	.	.	.	T	0.48352	0.1495	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.45862	-0.9232	6	0.87932	D	0	.	5.8322	0.18586	0.0:0.6339:0.3661:0.0	.	.	.	.	G	12	ENSP00000444610:A12G	ENSP00000444610:A12G	A	+	2	0	CCDC74A	132004055	0.000000	0.05858	0.001000	0.08648	0.148000	0.21650	-0.456000	0.06754	0.093000	0.17368	0.194000	0.17425	GCT	CCDC74A	-	NULL	ENSG00000163040		0.622	CCDC74A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CCDC74A	HGNC	protein_coding	OTTHUMT00000254570.2	-	0.00	55	0	C	NM_138770		132287585	+1	tier1	-	no_errors	ENST00000467992	ensembl	human	known	74_37	missense	31.03	39	18	SNP	0.004	G
CCHCR1	54535	genome.wustl.edu	37	6	31112472	31112472	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr6:31112472G>A	ENST00000376266.5	-	15	2014	c.1892C>T	c.(1891-1893)gCc>gTc	p.A631V	CCHCR1_ENST00000396268.3_Missense_Mutation_p.A720V|CCHCR1_ENST00000396263.2_Missense_Mutation_p.A578V|CCHCR1_ENST00000451521.2_Missense_Mutation_p.A684V	NM_019052.3	NP_061925.2	Q8TD31	CCHCR_HUMAN	coiled-coil alpha-helical rod protein 1	631					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|protein export from nucleus (GO:0006611)	centriole (GO:0005814)|cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(1)|endometrium(1)|kidney(3)|large_intestine(4)|lung(13)|skin(1)	23						ACCGGCCTTGGCATGCTCCCT	0.542																																																	0													160.0	165.0	164.0					6																	31112472		2203	4300	6503	SO:0001583	missense	0			AF216493	CCDS4695.1, CCDS43445.1, CCDS47397.1	6p21.3	2007-08-01	2005-02-15	2005-02-16	ENSG00000204536	ENSG00000204536			13930	protein-coding gene	gene with protein product		605310	"""chromosome 6 open reading frame 18"""	C6orf18		10888604, 10545595	Standard	NM_019052		Approved	HCR	uc003nsp.4	Q8TD31	OTTHUMG00000031112	ENST00000376266.5:c.1892C>T	6.37:g.31112472G>A	ENSP00000365442:p.Ala631Val		A2ABH6|E9PE84|Q2TB67|Q5SQ82|Q5STE9|Q9NRK8|Q9NWY9|Q9NXJ4|Q9NXK3|Q9Y6W1|Q9Y6W2	Missense_Mutation	SNP	pfam_HCR	p.A720V	ENST00000376266.5	37	c.2159	CCDS4695.1	6	.	.	.	.	.	.	.	.	.	.	G	15.15	2.747496	0.49257	.	.	ENSG00000204536	ENST00000396268;ENST00000376266;ENST00000396263;ENST00000440185;ENST00000451521	T;T;T;T	0.04502	3.61;3.61;3.61;3.61	5.07	2.1	0.27182	.	0.485095	0.19084	N	0.123149	T	0.02494	0.0076	L	0.54323	1.7	0.24024	N	0.996138	P;P;P;P;P	0.43578	0.565;0.623;0.565;0.811;0.767	P;B;B;B;B	0.45276	0.475;0.418;0.393;0.341;0.439	T	0.41484	-0.9506	10	0.42905	T	0.14	-1.4356	6.8274	0.23891	0.0973:0.3685:0.5342:0.0	.	631;631;631;684;720	B4DIA2;A8K081;Q8TD31;E9PE84;Q8TD31-2	.;.;CCHCR_HUMAN;.;.	V	720;631;578;631;684	ENSP00000379566:A720V;ENSP00000365442:A631V;ENSP00000379561:A578V;ENSP00000401039:A684V	ENSP00000365442:A631V	A	-	2	0	CCHCR1	31220451	1.000000	0.71417	0.983000	0.44433	0.703000	0.40648	2.988000	0.49386	0.533000	0.28675	0.448000	0.29417	GCC	CCHCR1	-	pfam_HCR	ENSG00000204536		0.542	CCHCR1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CCHCR1	HGNC	protein_coding	OTTHUMT00000076190.5		0.00	59	0	G	NM_019052		31112472	-1			no_errors	ENST00000396268	ensembl	human	known	74_37	missense	5.48	69	4	SNP	0.770	A
CCHCR1	54535	genome.wustl.edu	37	6	31112959	31112959	+	Silent	SNP	G	G	A			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr6:31112959G>A	ENST00000376266.5	-	13	1715	c.1593C>T	c.(1591-1593)ggC>ggT	p.G531G	CCHCR1_ENST00000396268.3_Silent_p.G620G|CCHCR1_ENST00000396263.2_Silent_p.G478G|CCHCR1_ENST00000451521.2_Silent_p.G584G	NM_019052.3	NP_061925.2	Q8TD31	CCHCR_HUMAN	coiled-coil alpha-helical rod protein 1	531					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|protein export from nucleus (GO:0006611)	centriole (GO:0005814)|cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(1)|endometrium(1)|kidney(3)|large_intestine(4)|lung(13)|skin(1)	23						CCCGAGCCCGGCCCACCTCCT	0.632																																																	0													41.0	40.0	41.0					6																	31112959		1508	2708	4216	SO:0001819	synonymous_variant	0			AF216493	CCDS4695.1, CCDS43445.1, CCDS47397.1	6p21.3	2007-08-01	2005-02-15	2005-02-16	ENSG00000204536	ENSG00000204536			13930	protein-coding gene	gene with protein product		605310	"""chromosome 6 open reading frame 18"""	C6orf18		10888604, 10545595	Standard	NM_019052		Approved	HCR	uc003nsp.4	Q8TD31	OTTHUMG00000031112	ENST00000376266.5:c.1593C>T	6.37:g.31112959G>A			A2ABH6|E9PE84|Q2TB67|Q5SQ82|Q5STE9|Q9NRK8|Q9NWY9|Q9NXJ4|Q9NXK3|Q9Y6W1|Q9Y6W2	Silent	SNP	pfam_HCR	p.G620	ENST00000376266.5	37	c.1860	CCDS4695.1	6																																																																																			CCHCR1	-	pfam_HCR	ENSG00000204536		0.632	CCHCR1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CCHCR1	HGNC	protein_coding	OTTHUMT00000076190.5		0.00	56	0	G	NM_019052		31112959	-1			no_errors	ENST00000396268	ensembl	human	known	74_37	silent	5.71	66	4	SNP	1.000	A
CD80	941	genome.wustl.edu	37	3	119263521	119263521	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr3:119263521G>T	ENST00000264246.3	-	3	656	c.294C>A	c.(292-294)aaC>aaA	p.N98K	CD80_ENST00000383668.3_Missense_Mutation_p.N98K|CD80_ENST00000383669.3_Missense_Mutation_p.N98K|CD80_ENST00000478182.1_Missense_Mutation_p.N98K	NM_005191.3	NP_005182.1	P33681	CD80_HUMAN	CD80 molecule	98	Ig-like V-type.				cell-cell signaling (GO:0007267)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of alpha-beta T cell proliferation (GO:0046641)|positive regulation of granulocyte macrophage colony-stimulating factor biosynthetic process (GO:0045425)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of signal transduction (GO:0009967)|positive regulation of T-helper 1 cell differentiation (GO:0045627)|positive regulation of transcription, DNA-templated (GO:0045893)|T cell activation (GO:0042110)|T cell costimulation (GO:0031295)|viral process (GO:0016032)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	coreceptor activity (GO:0015026)			breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|upper_aerodigestive_tract(2)	12					Abatacept(DB01281)|Belatacept(DB06681)	CAATGGAGAGGTTATTAGTGA	0.473																																					Melanoma(132;135 1764 1806 5833 14593)												0													155.0	147.0	150.0					3																	119263521		2203	4300	6503	SO:0001583	missense	0				CCDS2989.1	3q13.3-q21	2013-01-11	2006-03-31		ENSG00000121594	ENSG00000121594		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"""	1700	protein-coding gene	gene with protein product	"""B-lymphocyte activation antigen B7"""	112203	"""CD80 antigen (CD28 antigen ligand 1, B7-1 antigen)"", ""CD80 molecule """	CD28LG, CD28LG1		1370389	Standard	NM_005191		Approved	B7.1, B7-1	uc003ecq.3	P33681	OTTHUMG00000159419	ENST00000264246.3:c.294C>A	3.37:g.119263521G>T	ENSP00000264246:p.Asn98Lys		Q5DTA9|Q5DTB0	Missense_Mutation	SNP	pfam_CD80_C2-set,pfam_Ig_V-set,pfam_Ig_C1-set,smart_Ig_sub,pfscan_Ig-like_dom	p.N98K	ENST00000264246.3	37	c.294	CCDS2989.1	3	.	.	.	.	.	.	.	.	.	.	G	13.55	2.270864	0.40194	.	.	ENSG00000121594	ENST00000264246;ENST00000478182;ENST00000383669;ENST00000383668	T;T;T;T	0.65178	-0.14;-0.14;-0.14;-0.14	5.05	4.16	0.48862	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.231506	0.30446	N	0.009614	T	0.79975	0.4539	M	0.87456	2.885	0.36258	D	0.854351	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.994;0.994;0.994	D	0.86066	0.1535	10	0.87932	D	0	-20.7216	11.162	0.48520	0.0:0.186:0.814:0.0	.	98;98;98;98	Q5DTA9;Q5DTB0;A0N0P2;P33681	.;.;.;CD80_HUMAN	K	98	ENSP00000264246:N98K;ENSP00000418364:N98K;ENSP00000373165:N98K;ENSP00000373164:N98K	ENSP00000264246:N98K	N	-	3	2	CD80	120746211	1.000000	0.71417	0.639000	0.29394	0.090000	0.18270	1.650000	0.37292	1.307000	0.44944	0.650000	0.86243	AAC	CD80	-	pfam_Ig_V-set,smart_Ig_sub,pfscan_Ig-like_dom	ENSG00000121594		0.473	CD80-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CD80	HGNC	protein_coding	OTTHUMT00000355196.1	-	0.00	38	0	G	NM_005191		119263521	-1	tier1	-	no_errors	ENST00000264246	ensembl	human	known	74_37	missense	10.42	43	5	SNP	0.929	T
CDH26	60437	genome.wustl.edu	37	20	58567452	58567452	+	Missense_Mutation	SNP	C	C	T	rs373374352		TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr20:58567452C>T	ENST00000244047.5	+	10	1614	c.1303C>T	c.(1303-1305)Cca>Tca	p.P435S	CDH26_ENST00000348616.4_Missense_Mutation_p.P435S			Q8IXH8	CAD26_HUMAN	cadherin 26	435	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(11)|lung(14)|ovary(4)|pancreas(2)|prostate(2)|skin(2)|urinary_tract(1)	44	all_lung(29;0.00963)		BRCA - Breast invasive adenocarcinoma(7;5.58e-09)			GGTTCATGACCCAGCAAATTG	0.353																																																	0													82.0	75.0	77.0					20																	58567452		2203	4300	6503	SO:0001583	missense	0			AF169690, AK055202	CCDS13485.1, CCDS13486.1	20q13.33	2010-01-26	2009-11-20		ENSG00000124215	ENSG00000124215		"""Cadherins / Major cadherins"""	15902	protein-coding gene	gene with protein product			"""cadherin-like 26"""				Standard	NM_177980		Approved	VR20	uc002ybe.3	Q8IXH8	OTTHUMG00000032874	ENST00000244047.5:c.1303C>T	20.37:g.58567452C>T	ENSP00000244047:p.Pro435Ser		A2A2M5|B3KNX3|Q6P5Y6|Q8TCH3|Q9BQN4|Q9NRU1	Missense_Mutation	SNP	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.P435S	ENST00000244047.5	37	c.1303		20	.	.	.	.	.	.	.	.	.	.	C	13.97	2.395418	0.42512	.	.	ENSG00000124215	ENST00000244047;ENST00000348616	T;T	0.59772	0.24;0.24	5.15	3.17	0.36434	.	0.142426	0.46442	N	0.000285	T	0.69637	0.3133	M	0.62209	1.925	0.39292	D	0.964759	D	0.76494	0.999	D	0.78314	0.991	T	0.71276	-0.4641	10	0.87932	D	0	.	9.5438	0.39268	0.0:0.7764:0.1435:0.0801	.	435	Q8IXH8-4	.	S	435	ENSP00000244047:P435S;ENSP00000339390:P435S	ENSP00000244047:P435S	P	+	1	0	CDH26	58000847	0.894000	0.30519	0.001000	0.08648	0.211000	0.24417	3.092000	0.50207	0.522000	0.28464	0.650000	0.86243	CCA	CDH26	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000124215		0.353	CDH26-201	KNOWN	basic	protein_coding	CDH26	HGNC	protein_coding		-	0.00	52	0	C	NM_177980		58567452	+1	tier1	-	no_errors	ENST00000244047	ensembl	human	known	74_37	missense	14.19	126	21	SNP	0.774	T
CDK11B	984	genome.wustl.edu	37	1	1586825	1586825	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr1:1586825G>T	ENST00000407249.3	-	2	224	c.225C>A	c.(223-225)gaC>gaA	p.D75E	CDK11B_ENST00000340677.5_Missense_Mutation_p.D75E|CDK11B_ENST00000317673.7_Missense_Mutation_p.D75E|CDK11B_ENST00000341832.6_Missense_Mutation_p.D41E			P21127	CD11B_HUMAN	cyclin-dependent kinase 11B	75					apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|mitotic nuclear division (GO:0007067)|protein phosphorylation (GO:0006468)|regulation of cell growth (GO:0001558)|regulation of mRNA processing (GO:0050684)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			endometrium(2)|large_intestine(3)|lung(4)|skin(1)|stomach(2)	12						CCGCTCACCTGTCTTCCATAG	0.532																																																	0													103.0	98.0	100.0					1																	1586825		1909	4123	6032	SO:0001583	missense	0			AK000081	CCDS72682.1, CCDS72683.1, CCDS72684.1	1p36.33	2013-09-24	2009-12-16	2009-12-16	ENSG00000248333	ENSG00000248333		"""Cyclin-dependent kinases"""	1729	protein-coding gene	gene with protein product		176873	"""cell division cycle 2-like 1 (PITSLRE proteins)"""	CDC2L1		1774066, 14511641, 19884882	Standard	XM_006711061		Approved	CDK11-p110, CDK11-p58, CDK11-p46	uc001agv.1	P21127	OTTHUMG00000078638	ENST00000407249.3:c.225C>A	1.37:g.1586825G>T	ENSP00000464036:p.Asp75Glu		O95265|Q12817|Q12818|Q12819|Q12820|Q12822|Q8N530|Q9NZS5|Q9UBJ0|Q9UBQ1|Q9UBR0|Q9UNY2|Q9UP57|Q9UP58|Q9UP59	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.D75E	ENST00000407249.3	37	c.225		1																																																																																			CDK11B	-	NULL	ENSG00000248333		0.532	CDK11B-204	KNOWN	basic|appris_candidate_longest	protein_coding	CDK11B	HGNC	protein_coding		-	0.00	57	0	G	NM_001787		1586825	-1	tier1	-	no_errors	ENST00000407249	ensembl	human	known	74_37	missense	7.02	53	4	SNP	1.000	T
CELA3A	10136	genome.wustl.edu	37	1	22333434	22333434	+	Silent	SNP	C	C	G			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr1:22333434C>G	ENST00000290122.3	+	5	445	c.426C>G	c.(424-426)gcC>gcG	p.A142A		NM_005747.4	NP_005738.4	P09093	CEL3A_HUMAN	chymotrypsin-like elastase family, member 3A	142	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				cholesterol metabolic process (GO:0008203)|digestion (GO:0007586)|proteolysis (GO:0006508)		serine-type endopeptidase activity (GO:0004252)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(8)|upper_aerodigestive_tract(1)|urinary_tract(1)	18						TCCAGCTCGCCTCACTCCCTC	0.622																																																	0													123.0	108.0	113.0					1																	22333434		2200	4300	6500	SO:0001819	synonymous_variant	0			D00306	CCDS220.1	1p36.12	2009-05-05	2009-05-05	2009-05-05	ENSG00000142789	ENSG00000142789			15944	protein-coding gene	gene with protein product	"""protease E"""		"""elastase 3A, pancreatic (protease E)"", ""elastase 3A, pancreatic"""	ELA3A		2826474, 2460440	Standard	NM_005747		Approved	ELA3		P09093	OTTHUMG00000002755	ENST00000290122.3:c.426C>G	1.37:g.22333434C>G			B1AQ53|Q9BRW4	Silent	SNP	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1,prints_Peptidase_S1A	p.A142	ENST00000290122.3	37	c.426	CCDS220.1	1																																																																																			CELA3A	-	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1	ENSG00000142789		0.622	CELA3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CELA3A	HGNC	protein_coding	OTTHUMT00000007791.1	-	0.00	60	0	C	NM_005747		22333434	+1	tier1	-	no_errors	ENST00000290122	ensembl	human	known	74_37	silent	11.29	55	7	SNP	0.161	G
CELSR1	9620	genome.wustl.edu	37	22	46785357	46785357	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr22:46785357C>T	ENST00000262738.3	-	18	6384	c.6385G>A	c.(6385-6387)Gcc>Acc	p.A2129T		NM_014246.1	NP_055061.1	Q9NYQ6	CELR1_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 1	2129					anterior/posterior pattern specification (GO:0009952)|apical protein localization (GO:0045176)|central nervous system development (GO:0007417)|establishment of body hair planar orientation (GO:0048105)|establishment of planar polarity (GO:0001736)|establishment of planar polarity of embryonic epithelium (GO:0042249)|G-protein coupled receptor signaling pathway (GO:0007186)|hair follicle development (GO:0001942)|homophilic cell adhesion (GO:0007156)|inner ear morphogenesis (GO:0042472)|lateral sprouting involved in lung morphogenesis (GO:0060490)|locomotory behavior (GO:0007626)|neural tube closure (GO:0001843)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|orthogonal dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060488)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|planar dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060489)|protein localization involved in establishment of planar polarity (GO:0090251)|regulation of actin cytoskeleton organization (GO:0032956)|Rho protein signal transduction (GO:0007266)|wound healing (GO:0042060)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)|protein dimerization activity (GO:0046983)|transmembrane signaling receptor activity (GO:0004888)			breast(8)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(13)|lung(27)|ovary(2)|pancreas(2)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(3)	95		Ovarian(80;0.00142)|Breast(42;0.00296)|all_neural(38;0.0416)|Colorectal(5;0.0766)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00643)|BRCA - Breast invasive adenocarcinoma(115;0.171)		AGGGCCCTGGCGCCGTCCACC	0.637																																																	0													38.0	36.0	37.0					22																	46785357		2202	4300	6502	SO:0001583	missense	0			AF231024	CCDS14076.1	22q13.31	2014-08-08	2013-02-18		ENSG00000075275	ENSG00000075275		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	1850	protein-coding gene	gene with protein product	"""flamingo homolog 2 (Drosophila)"""	604523	"""cadherin, EGF LAG seven-pass G-type receptor 1, flamingo (Drosophila) homolog"""			9339365	Standard	XM_006724383		Approved	ME2, HFMI2, FMI2, CDHF9	uc003bhw.1	Q9NYQ6	OTTHUMG00000150423	ENST00000262738.3:c.6385G>A	22.37:g.46785357C>T	ENSP00000262738:p.Ala2129Thr		O95722|Q5TH47|Q9BWQ5|Q9Y506|Q9Y526	Missense_Mutation	SNP	pfam_Cadherin,pfam_DUF3497,pfam_Laminin_G,pfam_GPCR_2_secretin-like,pfam_GPS_dom,pfam_EG-like_dom,pfam_EGF_laminin,superfamily_ConA-like_lec_gl_sf,superfamily_Cadherin-like,smart_Cadherin,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_Laminin_G,smart_EGF_laminin,smart_GPCR_2_extracellular_dom,smart_GPS_dom,pfscan_EG-like_dom,pfscan_EGF_laminin,pfscan_GPS_dom,pfscan_Laminin_G,pfscan_Cadherin,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_Cadherin,prints_GPCR_2_secretin-like	p.A2129T	ENST00000262738.3	37	c.6385	CCDS14076.1	22	.	.	.	.	.	.	.	.	.	.	c	6.501	0.460592	0.12342	.	.	ENSG00000075275	ENST00000262738	T	0.09445	2.98	4.99	2.9	0.33743	Domain of unknown function DUF3497 (1);	0.640402	0.13667	N	0.371164	T	0.04679	0.0127	N	0.08118	0	0.80722	D	1	P;B	0.35628	0.513;0.067	B;B	0.26416	0.069;0.041	T	0.49943	-0.8885	10	0.21014	T	0.42	.	10.3152	0.43732	0.0:0.8356:0.0:0.1644	.	450;2129	B7Z7U7;Q9NYQ6	.;CELR1_HUMAN	T	2129	ENSP00000262738:A2129T	ENSP00000262738:A2129T	A	-	1	0	CELSR1	45164021	0.006000	0.16342	0.002000	0.10522	0.002000	0.02628	2.089000	0.41672	0.512000	0.28257	-0.119000	0.15052	GCC	CELSR1	-	pfam_DUF3497	ENSG00000075275		0.637	CELSR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CELSR1	HGNC	protein_coding	OTTHUMT00000318037.1		0.00	42	0	C	NM_014246		46785357	-1			no_errors	ENST00000262738	ensembl	human	known	74_37	missense	5.56	34	2	SNP	0.224	T
CFHR2	3080	genome.wustl.edu	37	1	196928128	196928128	+	Missense_Mutation	SNP	G	G	T	rs144918980		TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr1:196928128G>T	ENST00000367415.5	+	5	831	c.731G>T	c.(730-732)gGa>gTa	p.G244V	CFHR2_ENST00000476712.2_Missense_Mutation_p.G228V|CFHR2_ENST00000367421.3_Missense_Mutation_p.G244V|CFHR2_ENST00000496448.1_3'UTR	NM_005666.2	NP_005657.1	P36980	FHR2_HUMAN	complement factor H-related 2	244	Sushi 4. {ECO:0000255|PROSITE- ProRule:PRU00302}.					extracellular region (GO:0005576)		p.G244A(1)|p.G244E(1)		large_intestine(2)|ovary(1)|skin(3)	6						TGTAAATCTGGATATCATCCA	0.308																																																	2	Substitution - Missense(2)	lung(1)|skin(1)											55.0	58.0	57.0					1																	196928128		2203	4293	6496	SO:0001583	missense	0			X64877	CCDS30959.1	1q31.3	2008-02-05	2004-08-09	2006-02-28	ENSG00000080910	ENSG00000080910		"""Complement system"""	4890	protein-coding gene	gene with protein product		600889	"""H factor (complement)-like 3"""	HFL3, CFHL2		1533657, 7672821	Standard	NM_005666		Approved	FHR2	uc001gtq.1	P36980	OTTHUMG00000036518	ENST00000367415.5:c.731G>T	1.37:g.196928128G>T	ENSP00000356385:p.Gly244Val		Q14310|Q5T9T1	Missense_Mutation	SNP	pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	p.G244V	ENST00000367415.5	37	c.731	CCDS30959.1	1	.	.	.	.	.	.	.	.	.	.	.	12.26	1.883836	0.33255	.	.	ENSG00000080910	ENST00000367421;ENST00000367415	T;T	0.77358	-1.09;-1.09	3.52	1.63	0.23807	Complement control module (2);Sushi/SCR/CCP (2);	0.757041	0.10816	N	0.630989	D	0.87051	0.6081	M	0.84948	2.725	0.43195	D	0.995038	D;D	0.89917	1.0;0.996	D;D	0.97110	1.0;0.915	T	0.81901	-0.0720	10	0.72032	D	0.01	.	6.4237	0.21758	0.1095:0.1863:0.7042:0.0	.	217;244	P36980-2;P36980	.;FHR2_HUMAN	V	244	ENSP00000356391:G244V;ENSP00000356385:G244V	ENSP00000356385:G244V	G	+	2	0	CFHR2	195194751	0.614000	0.27017	0.214000	0.23707	0.002000	0.02628	1.516000	0.35856	0.202000	0.20498	-1.184000	0.01707	GGA	CFHR2	-	pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP	ENSG00000080910		0.308	CFHR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CFHR2	HGNC	protein_coding	OTTHUMT00000088815.2		0.00	24	0	G	NM_005666		196928128	+1			no_errors	ENST00000367415	ensembl	human	known	74_37	missense	6.67	28	2	SNP	0.844	T
CHD7	55636	genome.wustl.edu	37	8	61761705	61761705	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr8:61761705T>C	ENST00000423902.2	+	25	5875	c.5396T>C	c.(5395-5397)tTc>tCc	p.F1799S	CHD7_ENST00000524602.1_Intron	NM_017780.3	NP_060250.2	Q9P2D1	CHD7_HUMAN	chromodomain helicase DNA binding protein 7	1799					adult heart development (GO:0007512)|adult walking behavior (GO:0007628)|artery morphogenesis (GO:0048844)|blood circulation (GO:0008015)|central nervous system development (GO:0007417)|chromatin modification (GO:0016568)|cognition (GO:0050890)|cranial nerve development (GO:0021545)|embryonic hindlimb morphogenesis (GO:0035116)|epithelium development (GO:0060429)|face development (GO:0060324)|female genitalia development (GO:0030540)|genitalia development (GO:0048806)|heart morphogenesis (GO:0003007)|in utero embryonic development (GO:0001701)|inner ear morphogenesis (GO:0042472)|limb development (GO:0060173)|nose development (GO:0043584)|olfactory behavior (GO:0042048)|olfactory bulb development (GO:0021772)|olfactory nerve development (GO:0021553)|palate development (GO:0060021)|positive regulation of multicellular organism growth (GO:0040018)|regulation of growth hormone secretion (GO:0060123)|regulation of neurogenesis (GO:0050767)|regulation of transcription, DNA-templated (GO:0006355)|retina development in camera-type eye (GO:0060041)|rRNA processing (GO:0006364)|semicircular canal morphogenesis (GO:0048752)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|T cell differentiation (GO:0030217)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)	p.F1799Y(2)		NS(1)|breast(6)|central_nervous_system(8)|cervix(2)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(16)|lung(49)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|urinary_tract(3)	123		all_cancers(86;0.2)|all_lung(136;0.0402)|Lung NSC(129;0.0459)|all_epithelial(80;0.0477)	BRCA - Breast invasive adenocarcinoma(89;0.143)			ATTGGAGTGTTCAAACATGGT	0.393																																																	2	Substitution - Missense(2)	prostate(2)											196.0	189.0	191.0					8																	61761705		1894	4117	6011	SO:0001583	missense	0			AB037837	CCDS47865.1	8q12.2	2014-09-17				ENSG00000171316			20626	protein-coding gene	gene with protein product		608892	"""CHARGE association"""	CRG		15300250, 18834967	Standard	NM_017780		Approved	KIAA1416, FLJ20357, FLJ20361	uc003xue.3	Q9P2D1		ENST00000423902.2:c.5396T>C	8.37:g.61761705T>C	ENSP00000392028:p.Phe1799Ser		D0VBA5|E9PNZ2|Q05DI5|Q2TAN4|Q66K35|Q7Z6C0|Q7Z7Q2|Q9NXA0|Q9NXA3	Missense_Mutation	SNP	pfam_SNF2_N,pfam_BRK_domain,pfam_Chromo_domain,pfam_Helicase_C,superfamily_P-loop_NTPase,superfamily_Chromodomain-like,smart_Chromo_domain/shadow,smart_Helicase_ATP-bd,smart_Helicase_C,smart_BRK_domain,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Chromo_domain/shadow	p.F1799S	ENST00000423902.2	37	c.5396	CCDS47865.1	8	.	.	.	.	.	.	.	.	.	.	T	11.74	1.728352	0.30593	.	.	ENSG00000171316	ENST00000307121;ENST00000423902	D	0.90563	-2.69	5.87	4.68	0.58851	.	0.066103	0.64402	D	0.000011	D	0.88444	0.6438	L	0.49455	1.56	0.58432	D	0.999992	B	0.25390	0.125	B	0.31495	0.131	D	0.87393	0.2364	10	0.87932	D	0	-14.2333	12.7339	0.57212	0.1477:0.0:0.0:0.8522	.	1799	Q9P2D1	CHD7_HUMAN	S	1799	ENSP00000392028:F1799S	ENSP00000307304:F1799S	F	+	2	0	CHD7	61924259	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.105000	0.57797	2.242000	0.73789	0.528000	0.53228	TTC	CHD7	-	NULL	ENSG00000171316		0.393	CHD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHD7	HGNC	protein_coding	OTTHUMT00000383468.2		0.00	42	0	T	XM_098762		61761705	+1			no_errors	ENST00000423902	ensembl	human	known	74_37	missense	5.00	38	2	SNP	1.000	C
CHRM2	1129	genome.wustl.edu	37	7	136700814	136700814	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr7:136700814C>T	ENST00000445907.2	+	3	1730	c.1202C>T	c.(1201-1203)gCc>gTc	p.A401V	hsa-mir-490_ENST00000586239.1_RNA|CHRM2_ENST00000397608.3_Missense_Mutation_p.A401V|hsa-mir-490_ENST00000593789.1_RNA|CHRM2_ENST00000453373.1_Missense_Mutation_p.A401V|hsa-mir-490_ENST00000598184.1_RNA|hsa-mir-490_ENST00000597642.1_RNA|hsa-mir-490_ENST00000425981.2_RNA|hsa-mir-490_ENST00000439694.1_RNA|CHRM2_ENST00000401861.1_Missense_Mutation_p.A401V|CHRM2_ENST00000320658.5_Missense_Mutation_p.A401V|CHRM2_ENST00000402486.3_Missense_Mutation_p.A401V|hsa-mir-490_ENST00000592183.1_RNA	NM_001006627.1|NM_001006629.1	NP_001006628.1|NP_001006630.1	P08172	ACM2_HUMAN	cholinergic receptor, muscarinic 2	401					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|nervous system development (GO:0007399)|phospholipase C-activating G-protein coupled acetylcholine receptor signaling pathway (GO:0007207)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|regulation of heart contraction (GO:0008016)|response to virus (GO:0009615)	cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	G-protein coupled acetylcholine receptor activity (GO:0016907)			central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(13)|liver(1)|lung(29)|ovary(4)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	68					Aclidinium(DB08897)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Anisotropine Methylbromide(DB00517)|Aripiprazole(DB01238)|Atropine(DB00572)|Bethanechol(DB01019)|Brompheniramine(DB00835)|Carbachol(DB00411)|Chlorprothixene(DB01239)|Cinnarizine(DB00568)|Clozapine(DB00363)|Cocaine(DB00907)|Cryptenamine(DB00785)|Cyproheptadine(DB00434)|Darifenacin(DB00496)|Desipramine(DB01151)|Dicyclomine(DB00804)|Dimetindene(DB08801)|Diphenidol(DB01231)|Disopyramide(DB00280)|Doxacurium chloride(DB01135)|Doxepin(DB01142)|Ethopropazine(DB00392)|Fesoterodine(DB06702)|Flavoxate(DB01148)|Gallamine Triethiodide(DB00483)|Glycopyrrolate(DB00986)|Homatropine Methylbromide(DB00725)|Hyoscyamine(DB00424)|Imipramine(DB00458)|Ipratropium bromide(DB00332)|Ketamine(DB01221)|Loxapine(DB00408)|Maprotiline(DB00934)|Methotrimeprazine(DB01403)|Methylscopolamine bromide(DB00462)|Metixene(DB00340)|Metocurine(DB01336)|Mivacurium(DB01226)|Nicardipine(DB00622)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Oxybutynin(DB01062)|Oxyphencyclimine(DB00383)|Pancuronium(DB01337)|Paroxetine(DB00715)|Pethidine(DB00454)|Pilocarpine(DB01085)|Pipecuronium(DB01338)|Procyclidine(DB00387)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Quetiapine(DB01224)|Rocuronium(DB00728)|Scopolamine(DB00747)|Solifenacin(DB01591)|Succinylcholine(DB00202)|Tiotropium(DB01409)|Tolterodine(DB01036)|Triflupromazine(DB00508)|Trihexyphenidyl(DB00376)|Trimipramine(DB00726)|Tropicamide(DB00809)|Ziprasidone(DB00246)	ATCACTTGGGCCCCATACAAT	0.463																																																	0													201.0	170.0	181.0					7																	136700814		2203	4300	6503	SO:0001583	missense	0				CCDS5843.1	7q35-q36	2014-09-17			ENSG00000181072	ENSG00000181072		"""Cholinergic receptors"", ""GPCR / Class A : Cholinergic receptors, muscarinic"""	1951	protein-coding gene	gene with protein product	"""acetylcholine receptor, muscarinic 2"""	118493					Standard	NM_000739		Approved		uc003vtl.1	P08172	OTTHUMG00000155658	ENST00000445907.2:c.1202C>T	7.37:g.136700814C>T	ENSP00000399745:p.Ala401Val		Q4VBK6|Q9P1X9	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Musac_Ach_M2_rcpt,prints_Musac_Ach_rcpt,prints_GPCR_Rhodpsn	p.A401V	ENST00000445907.2	37	c.1202	CCDS5843.1	7	.	.	.	.	.	.	.	.	.	.	C	15.77	2.932219	0.52866	.	.	ENSG00000181072	ENST00000445907;ENST00000453373;ENST00000320658;ENST00000397608;ENST00000402486;ENST00000401861	T;T;T;T;T;T	0.71698	-0.59;-0.59;-0.59;-0.59;-0.59;-0.59	5.91	5.91	0.95273	GPCR, rhodopsin-like superfamily (1);	0.049152	0.85682	D	0.000000	T	0.55449	0.1921	N	0.12961	0.28	0.42059	D	0.991154	B	0.19445	0.036	B	0.25987	0.065	T	0.54296	-0.8315	10	0.05351	T	0.99	-17.4833	20.2985	0.98592	0.0:1.0:0.0:0.0	.	401	P08172	ACM2_HUMAN	V	401	ENSP00000399745:A401V;ENSP00000415386:A401V;ENSP00000319984:A401V;ENSP00000380733:A401V;ENSP00000384937:A401V;ENSP00000384401:A401V	ENSP00000319984:A401V	A	+	2	0	CHRM2	136351354	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.044000	0.71012	2.793000	0.96121	0.655000	0.94253	GCC	CHRM2	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000181072		0.463	CHRM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHRM2	HGNC	protein_coding	OTTHUMT00000341010.1	-	0.00	38	0	C			136700814	+1	tier1	-	no_errors	ENST00000320658	ensembl	human	known	74_37	missense	21.43	22	6	SNP	1.000	T
CIC	23152	genome.wustl.edu	37	19	42796302	42796302	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr19:42796302C>T	ENST00000575354.2	+	12	2991	c.2951C>T	c.(2950-2952)gCc>gTc	p.A984V	CIC_ENST00000160740.3_Missense_Mutation_p.A984V|CIC_ENST00000572681.2_Missense_Mutation_p.A1893V	NM_015125.3	NP_055940.3	Q96RK0	CIC_HUMAN	capicua transcriptional repressor	984	Pro-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			autonomic_ganglia(1)|breast(5)|central_nervous_system(32)|endometrium(10)|kidney(2)|large_intestine(7)|lung(9)|ovary(7)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	82		Prostate(69;0.00682)				CTGAGCCCAGCCACACTCCCT	0.647			"""Mis, F, S"""		oligodendroglioma																																			Rec	yes		19	19q13.2	23152	capicua homolog		O	0													52.0	60.0	57.0					19																	42796302		2203	4297	6500	SO:0001583	missense	0			AB002304	CCDS12601.1	19q13.2	2013-03-15	2013-03-15		ENSG00000079432	ENSG00000079432			14214	protein-coding gene	gene with protein product		612082	"""capicua (Drosophila) homolog"", ""capicua homolog (Drosophila)"""			12393275, 15981098	Standard	NM_015125		Approved	KIAA0306	uc002otf.1	Q96RK0		ENST00000575354.2:c.2951C>T	19.37:g.42796302C>T	ENSP00000458663:p.Ala984Val		Q7LGI1|Q9UEG5|Q9Y6T1	Missense_Mutation	SNP	pfam_HMG_box_dom,superfamily_HMG_box_dom,smart_HMG_box_dom,pfscan_HMG_box_dom	p.A984V	ENST00000575354.2	37	c.2951	CCDS12601.1	19	.	.	.	.	.	.	.	.	.	.	C	17.20	3.327985	0.60743	.	.	ENSG00000079432	ENST00000160740	.	.	.	5.14	5.14	0.70334	.	.	.	.	.	T	0.45316	0.1336	L	0.27053	0.805	0.39962	D	0.974671	B	0.32781	0.384	B	0.26517	0.07	T	0.53358	-0.8450	8	0.87932	D	0	-18.9028	16.1439	0.81551	0.0:1.0:0.0:0.0	.	984	Q96RK0	CIC_HUMAN	V	984	.	ENSP00000160740:A984V	A	+	2	0	CIC	47488142	0.975000	0.34042	0.853000	0.33588	0.976000	0.68499	2.174000	0.42482	2.686000	0.91538	0.561000	0.74099	GCC	CIC	-	NULL	ENSG00000079432		0.647	CIC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CIC	HGNC	protein_coding	OTTHUMT00000438532.2	-	0.00	84	0	C			42796302	+1	tier1	-	no_errors	ENST00000575354	ensembl	human	known	74_37	missense	8.16	45	4	SNP	0.986	T
CNNM2	54805	genome.wustl.edu	37	10	104816695	104816695	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr10:104816695G>A	ENST00000369878.4	+	4	2235	c.2047G>A	c.(2047-2049)Gta>Ata	p.V683I	CNNM2_ENST00000433628.2_Missense_Mutation_p.V683I	NM_017649.4	NP_060119.3	Q9H8M5	CNNM2_HUMAN	cyclin and CBS domain divalent metal cation transport mediator 2	683					magnesium ion homeostasis (GO:0010960)|magnesium ion transport (GO:0015693)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)	adenyl nucleotide binding (GO:0030554)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(7)|ovary(1)|prostate(2)|urinary_tract(1)	19		Colorectal(252;0.103)|all_hematologic(284;0.152)|Breast(234;0.198)		Epithelial(162;7.89e-09)|all cancers(201;1.82e-07)|BRCA - Breast invasive adenocarcinoma(275;0.215)		CAACAAGCCAGTAGACTACTT	0.438																																																	0													129.0	141.0	137.0					10																	104816695		2101	4258	6359	SO:0001583	missense	0			AF216962	CCDS7543.1, CCDS44474.1, CCDS44475.1	10q24.32	2014-08-08	2014-08-07		ENSG00000148842	ENSG00000148842			103	protein-coding gene	gene with protein product		607803	"""cyclin M2"""	ACDP2		21393841, 24699222	Standard	NM_017649		Approved		uc001kwm.3	Q9H8M5	OTTHUMG00000018976	ENST00000369878.4:c.2047G>A	10.37:g.104816695G>A	ENSP00000358894:p.Val683Ile		Q5T569|Q5T570|Q8WU59|Q9H952|Q9NRK5|Q9NXT4	Missense_Mutation	SNP	pfam_DUF21,superfamily_cNMP-bd-like	p.V683I	ENST00000369878.4	37	c.2047	CCDS44474.1	10	.	.	.	.	.	.	.	.	.	.	G	18.13	3.554501	0.65425	.	.	ENSG00000148842	ENST00000457502;ENST00000433628;ENST00000369878;ENST00000345419	T	0.74421	-0.84	5.83	5.83	0.93111	RmlC-like jelly roll fold (1);	0.000000	0.85682	D	0.000000	T	0.71719	0.3373	L	0.60957	1.885	0.58432	D	0.999999	B;B	0.18968	0.032;0.006	B;B	0.23275	0.045;0.014	T	0.67019	-0.5776	10	0.44086	T	0.13	.	14.2917	0.66284	0.0706:0.0:0.9294:0.0	.	683;683	Q9H8M5-2;Q9H8M5	.;CNNM2_HUMAN	I	684;684;683;683	ENSP00000358894:V683I	ENSP00000286899:V683I	V	+	1	0	CNNM2	104806685	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	8.029000	0.88807	2.763000	0.94921	0.561000	0.74099	GTA	CNNM2	-	superfamily_cNMP-bd-like	ENSG00000148842		0.438	CNNM2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CNNM2	HGNC	protein_coding	OTTHUMT00000050113.3	-	0.00	48	0	G	NM_017649		104816695	+1	tier1	-	no_errors	ENST00000369878	ensembl	human	known	74_37	missense	17.31	43	9	SNP	1.000	A
COL14A1	7373	genome.wustl.edu	37	8	121293235	121293235	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr8:121293235G>C	ENST00000297848.3	+	31	4031	c.3761G>C	c.(3760-3762)gGt>gCt	p.G1254A	COL14A1_ENST00000247781.3_Missense_Mutation_p.G1159A|COL14A1_ENST00000309791.4_Missense_Mutation_p.G1254A	NM_021110.1	NP_066933.1			collagen, type XIV, alpha 1											NS(1)|autonomic_ganglia(1)|breast(11)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(9)|large_intestine(31)|lung(42)|ovary(5)|pancreas(1)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	119	Lung NSC(37;6.52e-07)|Ovarian(258;0.00769)|Hepatocellular(40;0.161)		OV - Ovarian serous cystadenocarcinoma(1;6.47e-38)|STAD - Stomach adenocarcinoma(47;0.00503)			ATGGAGCCTGGTACCTTCAAT	0.358																																																	0													92.0	96.0	95.0					8																	121293235		2203	4300	6503	SO:0001583	missense	0				CCDS34938.1	8q23	2013-02-11	2008-02-04		ENSG00000187955	ENSG00000187955		"""Collagens"", ""Fibronectin type III domain containing"""	2191	protein-coding gene	gene with protein product		120324	"""undulin"""	UND		1716629, 9427527	Standard	NM_021110		Approved		uc003yox.4	Q05707	OTTHUMG00000149877	ENST00000297848.3:c.3761G>C	8.37:g.121293235G>C	ENSP00000297848:p.Gly1254Ala			Missense_Mutation	SNP	pfam_VWF_A,pfam_Fibronectin_type3,pfam_Collagen,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_VWF_A,smart_Laminin_G,pfscan_Fibronectin_type3,pfscan_VWF_A	p.G1254A	ENST00000297848.3	37	c.3761	CCDS34938.1	8	.	.	.	.	.	.	.	.	.	.	G	22.1	4.248404	0.80024	.	.	ENSG00000187955	ENST00000309791;ENST00000297848;ENST00000247781	T;T;T	0.03772	3.81;3.81;3.81	5.9	5.9	0.94986	Concanavalin A-like lectin/glucanase (1);Laminin G, thrombospondin-type, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.26085	0.0636	M	0.80183	2.485	0.80722	D	1	D	0.76494	0.999	D	0.85130	0.997	T	0.00113	-1.2042	10	0.54805	T	0.06	.	20.2626	0.98452	0.0:0.0:1.0:0.0	.	1254	Q05707	COEA1_HUMAN	A	1254;1254;1159	ENSP00000311809:G1254A;ENSP00000297848:G1254A;ENSP00000247781:G1159A	ENSP00000247781:G1159A	G	+	2	0	COL14A1	121362416	1.000000	0.71417	0.999000	0.59377	0.521000	0.34408	9.837000	0.99465	2.802000	0.96397	0.650000	0.86243	GGT	COL14A1	-	superfamily_ConA-like_lec_gl_sf,smart_Laminin_G	ENSG00000187955		0.358	COL14A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL14A1	HGNC	protein_coding	OTTHUMT00000313657.2	-	0.00	79	0	G	NM_021110		121293235	+1	tier1	-	no_errors	ENST00000297848	ensembl	human	known	74_37	missense	7.14	76	6	SNP	1.000	C
COL4A3BP	10087	genome.wustl.edu	37	5	74722305	74722306	+	Splice_Site	INS	-	-	A	rs540751366	byFrequency	TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr5:74722305_74722306insA	ENST00000405807.4	-	4	770		c.e4-2		COL4A3BP_ENST00000261415.7_Splice_Site|COL4A3BP_ENST00000380494.5_Splice_Site	NM_005713.2	NP_005704.1	Q9Y5P4	C43BP_HUMAN	collagen, type IV, alpha 3 (Goodpasture antigen) binding protein						cell morphogenesis (GO:0000902)|cell proliferation (GO:0008283)|ceramide metabolic process (GO:0006672)|endoplasmic reticulum organization (GO:0007029)|ER to Golgi ceramide transport (GO:0035621)|heart morphogenesis (GO:0003007)|immune response (GO:0006955)|in utero embryonic development (GO:0001701)|lipid homeostasis (GO:0055088)|mitochondrion morphogenesis (GO:0070584)|muscle contraction (GO:0006936)|protein phosphorylation (GO:0006468)|response to endoplasmic reticulum stress (GO:0034976)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)	cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ceramide binding (GO:0097001)|ceramide transporter activity (GO:0035620)|phosphatidylinositol-4-phosphate binding (GO:0070273)|protein kinase activity (GO:0004672)			breast(1)|kidney(1)|large_intestine(5)|lung(4)|skin(3)|stomach(1)|urinary_tract(1)	16		all_lung(232;0.00101)|Lung NSC(167;0.00278)|Ovarian(174;0.0129)|Prostate(461;0.174)		OV - Ovarian serous cystadenocarcinoma(47;1e-53)		AGATTCAGTCTAAAAAAAAAAG	0.366																																																	0																																										SO:0001630	splice_region_variant	0			AF136450	CCDS4028.1, CCDS4029.1, CCDS47235.1	5q13.3	2013-01-10	2007-06-08	2007-06-08	ENSG00000113163	ENSG00000113163		"""StAR-related lipid transfer (START) domain containing"", ""Pleckstrin homology (PH) domain containing"""	2205	protein-coding gene	gene with protein product	"""ceramide transporter"", ""StAR-related lipid transfer (START) domain containing 11"""	604677				10212244	Standard	NM_001130105		Approved	GPBP, STARD11, CERT	uc003kdt.3	Q9Y5P4	OTTHUMG00000102068	ENST00000405807.4:c.349-2->T	5.37:g.74722315_74722315dupA			A8K7S2|B3KUB7|Q53YV1|Q53YV2|Q96Q85|Q96Q88|Q9H2S7|Q9H2S8	Splice_Site	INS	-	e5-2	ENST00000405807.4	37	c.733-3_733-2	CCDS4028.1	5																																																																																			COL4A3BP	-	-	ENSG00000113163		0.366	COL4A3BP-002	KNOWN	basic|appris_principal|CCDS	protein_coding	COL4A3BP	HGNC	protein_coding	OTTHUMT00000219875.2		0.00	34	0	-	NM_005713	Intron	74722306	-1	tier1		no_errors	ENST00000380494	ensembl	human	known	74_37	splice_site_ins	7.89	35	3	INS	1.000:0.996	A
COL5A3	50509	genome.wustl.edu	37	19	10077032	10077032	+	Silent	SNP	C	C	T			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr19:10077032C>T	ENST00000264828.3	-	64	4825	c.4740G>A	c.(4738-4740)gcG>gcA	p.A1580A		NM_015719.3	NP_056534.2	P25940	CO5A3_HUMAN	collagen, type V, alpha 3	1580	Fibrillar collagen NC1. {ECO:0000255|PROSITE-ProRule:PRU00793}.				axon guidance (GO:0007411)|cell-matrix adhesion (GO:0007160)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skin development (GO:0043588)	collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)			NS(2)|breast(3)|central_nervous_system(2)|endometrium(11)|kidney(23)|large_intestine(12)|liver(2)|lung(35)|ovary(8)|prostate(5)|skin(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	116			Epithelial(33;7.11e-05)			TCTCTCCTCCCGCCGTGAAGT	0.602																																																	0													58.0	48.0	51.0					19																	10077032		2203	4300	6503	SO:0001819	synonymous_variant	0			AF177941	CCDS12222.1	19p13.2	2013-01-16			ENSG00000080573	ENSG00000080573		"""Collagens"""	14864	protein-coding gene	gene with protein product		120216				10722718	Standard	NM_015719		Approved		uc002mmq.1	P25940	OTTHUMG00000150019	ENST00000264828.3:c.4740G>A	19.37:g.10077032C>T			Q9NZQ6	Silent	SNP	pfam_Collagen,pfam_Fib_collagen_C,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,smart_Fib_collagen_C	p.A1580	ENST00000264828.3	37	c.4740	CCDS12222.1	19																																																																																			COL5A3	-	pfam_Fib_collagen_C,smart_Fib_collagen_C	ENSG00000080573		0.602	COL5A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL5A3	HGNC	protein_coding	OTTHUMT00000315788.1	-	0.00	52	0	C	NM_015719		10077032	-1	tier1	-	no_errors	ENST00000264828	ensembl	human	known	74_37	silent	16.98	44	9	SNP	0.032	T
COPB1	1315	genome.wustl.edu	37	11	14501200	14501200	+	Missense_Mutation	SNP	G	G	T	rs377571611		TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr11:14501200G>T	ENST00000249923.3	-	11	1573	c.1273C>A	c.(1273-1275)Cgt>Agt	p.R425S	RNU7-49P_ENST00000516182.1_RNA|COPB1_ENST00000439561.2_Missense_Mutation_p.R425S	NM_016451.4	NP_057535.1	P53618	COPB_HUMAN	coatomer protein complex, subunit beta 1	425					COPI coating of Golgi vesicle (GO:0048205)|intra-Golgi vesicle-mediated transport (GO:0006891)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|viral process (GO:0016032)	COPI vesicle coat (GO:0030126)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi-associated vesicle (GO:0005798)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|plasma membrane (GO:0005886)	structural molecule activity (GO:0005198)	p.R425C(2)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(12)|ovary(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(2)	36						ATGGCTTCACGAACAAACTCC	0.343																																																	2	Substitution - Missense(2)	large_intestine(2)											73.0	74.0	74.0					11																	14501200		2200	4294	6494	SO:0001583	missense	0			BC037280	CCDS7815.1	11p15.2	2011-05-20	2006-06-30	2006-06-30	ENSG00000129083	ENSG00000129083			2231	protein-coding gene	gene with protein product		600959	"""coatomer protein complex, subunit beta"""	COPB		7982906	Standard	NM_016451		Approved		uc001mlg.2	P53618	OTTHUMG00000165824	ENST00000249923.3:c.1273C>A	11.37:g.14501200G>T	ENSP00000249923:p.Arg425Ser		D3DQX0|Q6GTT7|Q9NTK2|Q9UNW7	Missense_Mutation	SNP	pfam_Coatomer_bsu_C,pfam_Clathrin/coatomer_adapt-like_N,superfamily_ARM-type_fold,pirsf_COPB1	p.R425S	ENST00000249923.3	37	c.1273	CCDS7815.1	11	.	.	.	.	.	.	.	.	.	.	G	35	5.467099	0.96257	.	.	ENSG00000129083	ENST00000249923;ENST00000439561;ENST00000534234	T;T;T	0.27557	1.66;1.66;1.66	5.92	5.92	0.95590	Clathrin/coatomer adaptor, adaptin-like, N-terminal (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.69593	0.3128	H	0.94808	3.585	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.77451	-0.2583	10	0.87932	D	0	-0.1037	20.3343	0.98733	0.0:0.0:1.0:0.0	.	425	P53618	COPB_HUMAN	S	425	ENSP00000249923:R425S;ENSP00000397873:R425S;ENSP00000436383:R425S	ENSP00000249923:R425S	R	-	1	0	COPB1	14457776	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.932000	0.87634	2.822000	0.97130	0.650000	0.86243	CGT	COPB1	-	pfam_Clathrin/coatomer_adapt-like_N,superfamily_ARM-type_fold,pirsf_COPB1	ENSG00000129083		0.343	COPB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COPB1	HGNC	protein_coding	OTTHUMT00000386410.1		0.00	32	0	G	NM_016451		14501200	-1			no_errors	ENST00000249923	ensembl	human	known	74_37	missense	5.66	49	3	SNP	1.000	T
CPZ	8532	genome.wustl.edu	37	4	8621087	8621087	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr4:8621087C>G	ENST00000360986.4	+	11	1876	c.1702C>G	c.(1702-1704)Ccc>Gcc	p.P568A	CPZ_ENST00000315782.6_Missense_Mutation_p.P557A|CPZ_ENST00000429646.2_Missense_Mutation_p.P176A|CPZ_ENST00000382480.2_Missense_Mutation_p.P431A	NM_001014447.2	NP_001014447	Q66K79	CBPZ_HUMAN	carboxypeptidase Z	568					proteolysis (GO:0006508)|Wnt signaling pathway (GO:0016055)	extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(23)|ovary(3)|pancreas(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	46						AGTCATCATCCCCGCCCGGAT	0.577																																																	0													50.0	45.0	47.0					4																	8621087		2203	4300	6503	SO:0001583	missense	0			U83411	CCDS3404.1, CCDS33953.1, CCDS43212.1	4p16.1	2012-02-10			ENSG00000109625	ENSG00000109625			2333	protein-coding gene	gene with protein product	"""metallocarboxypeptidase Z"""	603105				9099699	Standard	NM_001014447		Approved		uc003glm.3	Q66K79	OTTHUMG00000090513	ENST00000360986.4:c.1702C>G	4.37:g.8621087C>G	ENSP00000354255:p.Pro568Ala		O00520|Q96MX2	Missense_Mutation	SNP	pfam_Peptidase_M14,pfam_Frizzled_dom,superfamily_Frizzled_dom,superfamily_CarboxyPept-like_regulatory,smart_Frizzled_dom,smart_Peptidase_M14,prints_Peptidase_M14,pfscan_Frizzled_dom	p.P568A	ENST00000360986.4	37	c.1702	CCDS33953.1	4	.	.	.	.	.	.	.	.	.	.	C	19.40	3.819866	0.71028	.	.	ENSG00000109625	ENST00000360986;ENST00000382480;ENST00000315782;ENST00000429646	T;T;T;T	0.39997	1.05;1.05;1.05;1.05	5.21	5.21	0.72293	Peptidase M14, carboxypeptidase A (1);Carboxypeptidase-like, regulatory domain (1);Carboxypeptidase, regulatory domain (1);	0.000000	0.85682	D	0.000000	T	0.63129	0.2485	M	0.68728	2.09	0.58432	D	0.999999	D;D	0.76494	0.999;0.975	D;P	0.76071	0.987;0.514	T	0.62932	-0.6749	10	0.45353	T	0.12	-25.1387	16.9971	0.86370	0.0:1.0:0.0:0.0	.	557;568	Q66K79-2;Q66K79	.;CBPZ_HUMAN	A	568;431;557;176	ENSP00000354255:P568A;ENSP00000371920:P431A;ENSP00000315074:P557A;ENSP00000403981:P176A	ENSP00000315074:P557A	P	+	1	0	CPZ	8671987	1.000000	0.71417	0.995000	0.50966	0.456000	0.32438	7.014000	0.76380	2.435000	0.82474	0.555000	0.69702	CCC	CPZ	-	superfamily_CarboxyPept-like_regulatory,smart_Peptidase_M14	ENSG00000109625		0.577	CPZ-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CPZ	HGNC	protein_coding	OTTHUMT00000207001.4	-	0.00	51	0	C	NM_003652		8621087	+1	tier1	-	no_errors	ENST00000360986	ensembl	human	known	74_37	missense	19.05	34	8	SNP	1.000	G
CRBN	51185	genome.wustl.edu	37	3	3192657	3192657	+	Frame_Shift_Del	DEL	T	T	-			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr3:3192657delT	ENST00000231948.4	-	11	1243	c.1221delA	c.(1219-1221)aaafs	p.K407fs	RP11-97C16.1_ENST00000607052.1_RNA|CRBN_ENST00000432408.2_Frame_Shift_Del_p.K406fs	NM_016302.3	NP_057386.2	Q96SW2	CRBN_HUMAN	cereblon	407	Thalidomide-binding.				negative regulation of ion transmembrane transport (GO:0034766)|negative regulation of protein homooligomerization (GO:0032463)|positive regulation of protein homodimerization activity (GO:0090073)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination (GO:0016567)	Cul4A-RING E3 ubiquitin ligase complex (GO:0031464)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP-dependent peptidase activity (GO:0004176)			endometrium(1)|kidney(1)|large_intestine(4)|lung(1)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	11				Epithelial(13;0.00244)|OV - Ovarian serous cystadenocarcinoma(96;0.00617)|all cancers(10;0.0079)	Lenalidomide(DB00480)|Pomalidomide(DB08910)|Thalidomide(DB01041)	GTGACATGTCTTTTTTGGTGG	0.423																																																	0													123.0	99.0	107.0					3																	3192657		2203	4300	6503	SO:0001589	frameshift_variant	0			BC017419	CCDS2562.1, CCDS54547.1	3p26.3	2014-05-27			ENSG00000113851	ENSG00000113851			30185	protein-coding gene	gene with protein product		609262	"""mental retardation, non-syndromic, autosomal recessive, 2A"""	MRT2A		15557513	Standard	NM_016302		Approved	MRT2	uc003bpq.3	Q96SW2	OTTHUMG00000090261	ENST00000231948.4:c.1221delA	3.37:g.3192657delT	ENSP00000231948:p.Lys407fs		B2R6H4|C9IZA9|C9JAH6|Q6AI62|Q6NVZ0|Q9UHW4	Frame_Shift_Del	DEL	pfam_Pept_S16_N,superfamily_PUA-like_domain,smart_Pept_S16_N	p.D408fs	ENST00000231948.4	37	c.1221	CCDS2562.1	3																																																																																			CRBN	-	NULL	ENSG00000113851		0.423	CRBN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CRBN	HGNC	protein_coding	OTTHUMT00000206579.3		0.00	39	0	T	NM_016302		3192657	-1	tier1		no_errors	ENST00000231948	ensembl	human	known	74_37	frame_shift_del	9.68	28	3	DEL	1.000	-
CRYBG3	131544	genome.wustl.edu	37	3	97617780	97617780	+	Silent	SNP	G	G	A			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr3:97617780G>A	ENST00000182096.4	+	10	1975	c.1911G>A	c.(1909-1911)aaG>aaA	p.K637K		NM_153605.3	NP_705833.3	Q68DQ2	CRBG3_HUMAN	beta-gamma crystallin domain containing 3	2585							carbohydrate binding (GO:0030246)			breast(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(9)|lung(10)|stomach(1)|upper_aerodigestive_tract(2)	32						AAAGTGGGAAGTTTATTGACA	0.323																																																	0													79.0	71.0	74.0					3																	97617780		1803	4070	5873	SO:0001819	synonymous_variant	0					3q11.2	2008-09-30			ENSG00000080200	ENSG00000080200			34427	protein-coding gene	gene with protein product							Standard	NM_153605		Approved	DKFZp667G2110	uc021xbn.2	Q68DQ2	OTTHUMG00000159187	ENST00000182096.4:c.1911G>A	3.37:g.97617780G>A			B4DLE8|F6VHI2|Q4G0V8|Q7Z4R9|Q86VD0|Q8N262|Q8N7F1|Q8NDQ8	Silent	SNP	pfam_Beta/gamma_crystallin,pfam_Ricin_B_lectin,superfamily_G_crystallin-rel,superfamily_Ricin_B_lectin,smart_Beta/gamma_crystallin,smart_Ricin_B_lectin,pfscan_Ricin_B_lectin,pfscan_Beta/gamma_crystallin,prints_Beta/gamma_crystallin	p.K637	ENST00000182096.4	37	c.1911		3																																																																																			CRYBG3	-	pfam_Beta/gamma_crystallin,superfamily_G_crystallin-rel,smart_Beta/gamma_crystallin	ENSG00000080200		0.323	CRYBG3-001	KNOWN	basic|appris_principal	protein_coding	CRYBG3	HGNC	protein_coding	OTTHUMT00000353751.1	-	0.00	40	0	G	NM_153605		97617780	+1	tier1	-	no_errors	ENST00000182096	ensembl	human	known	74_37	silent	56.86	22	29	SNP	0.998	A
CRYGB	1419	genome.wustl.edu	37	2	209007444	209007444	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr2:209007444G>A	ENST00000260988.4	-	3	493	c.446C>T	c.(445-447)cCg>cTg	p.P149L		NM_005210.3	NP_005201.2	P07316	CRGB_HUMAN	crystallin, gamma B	149	Beta/gamma crystallin 'Greek key' 4. {ECO:0000255|PROSITE-ProRule:PRU00028}.				lens fiber cell morphogenesis (GO:0070309)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	structural constituent of eye lens (GO:0005212)			cervix(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(4)|ovary(1)|skin(1)|stomach(1)	14				Epithelial(149;0.0641)|LUSC - Lung squamous cell carcinoma(261;0.0703)|Lung(261;0.132)		GTACTCCCCCGGCCTCAGCAG	0.517																																																	0													87.0	89.0	88.0					2																	209007444		2203	4300	6503	SO:0001583	missense	0				CCDS2380.1	2q34	2013-02-14			ENSG00000182187	ENSG00000182187			2409	protein-coding gene	gene with protein product		123670	"""crystallin, gamma 1-2"""	CRYG2			Standard	NM_005210		Approved		uc002vcp.4	P07316	OTTHUMG00000132941	ENST00000260988.4:c.446C>T	2.37:g.209007444G>A	ENSP00000260988:p.Pro149Leu		Q17RB5|Q53ST2	Missense_Mutation	SNP	pfam_Beta/gamma_crystallin,superfamily_G_crystallin-rel,smart_Beta/gamma_crystallin,prints_Beta/gamma_crystallin,pfscan_Beta/gamma_crystallin	p.P149L	ENST00000260988.4	37	c.446	CCDS2380.1	2	.	.	.	.	.	.	.	.	.	.	G	21.3	4.135962	0.77662	.	.	ENSG00000182187	ENST00000260988	T	0.76968	-1.06	4.73	4.73	0.59995	Beta/gamma crystallin (5);Gamma-crystallin-related (1);	0.050684	0.85682	D	0.000000	D	0.91968	0.7456	H	0.97214	3.96	0.80722	D	1	D	0.76494	0.999	D	0.72075	0.976	D	0.94359	0.7586	10	0.72032	D	0.01	.	15.5827	0.76459	0.0:0.0:1.0:0.0	.	149	P07316	CRGB_HUMAN	L	149	ENSP00000260988:P149L	ENSP00000260988:P149L	P	-	2	0	CRYGB	208715689	1.000000	0.71417	0.957000	0.39632	0.988000	0.76386	6.041000	0.70988	2.614000	0.88457	0.561000	0.74099	CCG	CRYGB	-	pfam_Beta/gamma_crystallin,superfamily_G_crystallin-rel,smart_Beta/gamma_crystallin,prints_Beta/gamma_crystallin,pfscan_Beta/gamma_crystallin	ENSG00000182187		0.517	CRYGB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CRYGB	HGNC	protein_coding	OTTHUMT00000256473.2	-	0.00	55	0	G	NM_005210		209007444	-1	tier1	-	no_errors	ENST00000260988	ensembl	human	known	74_37	missense	34.38	42	22	SNP	0.996	A
CYP4F2	8529	genome.wustl.edu	37	19	15989681	15989681	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr19:15989681C>T	ENST00000221700.6	-	13	1558	c.1463G>A	c.(1462-1464)cGc>cAc	p.R488H		NM_001082.3	NP_001073.3			cytochrome P450, family 4, subfamily F, polypeptide 2											NS(2)|breast(1)|endometrium(6)|kidney(2)|large_intestine(9)|liver(1)|lung(18)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	46						GACGCGGAAGCGCAGCAGCGT	0.677																																																	0													43.0	41.0	42.0					19																	15989681		2203	4300	6503	SO:0001583	missense	0			U02388	CCDS12336.1	19p13.12	2013-11-11	2003-01-14		ENSG00000186115	ENSG00000186115		"""Cytochrome P450s"""	2645	protein-coding gene	gene with protein product		604426	"""cytochrome P450, subfamily IVF, polypeptide 2"""			8424651, 8026587	Standard	NM_001082		Approved		uc002nbs.1	P78329	OTTHUMG00000185995	ENST00000221700.6:c.1463G>A	19.37:g.15989681C>T	ENSP00000221700:p.Arg488His			Missense_Mutation	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450,prints_Cyt_P450_E_grp-II	p.R488H	ENST00000221700.6	37	c.1463	CCDS12336.1	19	.	.	.	.	.	.	.	.	.	.	c	10.42	1.344987	0.24426	.	.	ENSG00000186115	ENST00000221700;ENST00000392846	T	0.70045	-0.45	2.63	0.368	0.16146	.	0.173875	0.35235	U	0.003349	T	0.52240	0.1722	L	0.41906	1.305	0.80722	D	1	B	0.29571	0.249	B	0.34242	0.178	T	0.32877	-0.9890	10	0.40728	T	0.16	.	5.2098	0.15310	0.0:0.5619:0.0:0.4381	.	488	P78329	CP4F2_HUMAN	H	488;339	ENSP00000221700:R488H	ENSP00000221700:R488H	R	-	2	0	CYP4F2	15850681	0.646000	0.27295	0.984000	0.44739	0.412000	0.31113	1.112000	0.31172	0.020000	0.15106	-0.424000	0.05967	CGC	CYP4F2	-	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I	ENSG00000186115		0.677	CYP4F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP4F2	HGNC	protein_coding	OTTHUMT00000460372.3	-	0.00	130	0	C	NM_001082		15989681	-1	tier1	-	no_errors	ENST00000221700	ensembl	human	known	74_37	missense	23.81	80	25	SNP	1.000	T
DAPK2	23604	genome.wustl.edu	37	15	64275784	64275784	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr15:64275784T>C	ENST00000457488.1	-	3	292	c.262A>G	c.(262-264)Acg>Gcg	p.T88A	DAPK2_ENST00000558069.1_Missense_Mutation_p.T88A|DAPK2_ENST00000261891.3_Missense_Mutation_p.T88A|DAPK2_ENST00000558482.1_5'UTR	NM_014326.3	NP_055141.2	Q9UIK4	DAPK2_HUMAN	death-associated protein kinase 2	88	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				anoikis (GO:0043276)|apoptotic process (GO:0006915)|intracellular signal transduction (GO:0035556)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of apoptotic process (GO:0042981)|regulation of autophagy (GO:0010506)|regulation of intrinsic apoptotic signaling pathway (GO:2001242)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)	ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|calmodulin-dependent protein kinase activity (GO:0004683)|identical protein binding (GO:0042802)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(2)|skin(1)|stomach(1)	11				LUAD - Lung adenocarcinoma(2;0.215)		TCGTGCAGCGTGATGACATTG	0.667																																																	0													75.0	72.0	73.0					15																	64275784		2203	4300	6503	SO:0001583	missense	0			AB018001	CCDS10188.1	15q22.1	2008-07-18			ENSG00000035664	ENSG00000035664			2675	protein-coding gene	gene with protein product						10376525	Standard	XM_005254265		Approved	DRP-1, MGC119312	uc002amr.3	Q9UIK4	OTTHUMG00000132947	ENST00000457488.1:c.262A>G	15.37:g.64275784T>C	ENSP00000408277:p.Thr88Ala		E9JGM7|O75892|Q24JS1	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_RIO-like_kinase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.T88A	ENST00000457488.1	37	c.262	CCDS10188.1	15	.	.	.	.	.	.	.	.	.	.	T	14.43	2.533333	0.45073	.	.	ENSG00000035664	ENST00000261891;ENST00000457488	T;T	0.39056	1.1;1.1	5.36	4.24	0.50183	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.161665	0.39615	N	0.001311	T	0.23289	0.0563	N	0.11313	0.125	0.47123	D	0.999328	B;B	0.09022	0.002;0.0	B;B	0.09377	0.004;0.0	T	0.03641	-1.1017	10	0.30854	T	0.27	.	10.4531	0.44535	0.0:0.0765:0.0:0.9235	.	88;88	E9JGM7;Q9UIK4	.;DAPK2_HUMAN	A	88	ENSP00000261891:T88A;ENSP00000408277:T88A	ENSP00000261891:T88A	T	-	1	0	DAPK2	62062837	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	2.876000	0.48498	0.873000	0.35799	0.459000	0.35465	ACG	DAPK2	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_RIO-like_kinase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000035664		0.667	DAPK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DAPK2	HGNC	protein_coding	OTTHUMT00000256479.1	-	0.00	68	0	T	NM_014326		64275784	-1	tier1	-	no_errors	ENST00000261891	ensembl	human	known	74_37	missense	7.02	53	4	SNP	1.000	C
DBX1	120237	genome.wustl.edu	37	11	20181682	20181682	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr11:20181682C>T	ENST00000524983.2	-	1	477	c.189G>A	c.(187-189)atG>atA	p.M63I	DBX1_ENST00000227256.3_Missense_Mutation_p.M63I			A6NMT0	DBX1_HUMAN	developing brain homeobox 1	63					regulation of transcription from RNA polymerase II promoter (GO:0006357)|ventral spinal cord interneuron specification (GO:0021521)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			endometrium(2)|large_intestine(4)|lung(11)|ovary(1)|prostate(1)|skin(2)	21						TGGGCGGCGACATGCTGGCGG	0.746																																																	0													4.0	6.0	5.0					11																	20181682		1903	3689	5592	SO:0001583	missense	0					11p15.1	2011-06-20				ENSG00000109851		"""Homeoboxes / ANTP class : NKL subclass"""	33185	protein-coding gene	gene with protein product						11239429	Standard	NM_001029865		Approved		uc021qey.1	A6NMT0		ENST00000524983.2:c.189G>A	11.37:g.20181682C>T	ENSP00000436881:p.Met63Ile			Missense_Mutation	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom	p.M63I	ENST00000524983.2	37	c.189		11	.	.	.	.	.	.	.	.	.	.	C	10.48	1.362005	0.24684	.	.	ENSG00000109851	ENST00000524983;ENST00000227256	D;T	0.90324	-2.65;0.32	5.51	3.58	0.41010	.	0.470848	0.24488	N	0.038091	T	0.81678	0.4873	N	0.22421	0.69	0.27497	N	0.952108	B	0.13594	0.008	B	0.15870	0.014	T	0.66736	-0.5848	10	0.21540	T	0.41	-5.26	9.1224	0.36795	0.2601:0.6706:0.0:0.0693	.	63	F8W811	.	I	63	ENSP00000436881:M63I;ENSP00000227256:M63I	ENSP00000227256:M63I	M	-	3	0	DBX1	20138258	1.000000	0.71417	0.998000	0.56505	0.967000	0.64934	2.274000	0.43390	0.640000	0.30582	0.491000	0.48974	ATG	DBX1	-	NULL	ENSG00000109851		0.746	DBX1-001	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	DBX1	HGNC	protein_coding	OTTHUMT00000387585.2	-	0.00	19	0	C	NM_001029865		20181682	-1	tier1	-	no_errors	ENST00000227256	ensembl	human	known	74_37	missense	31.25	11	5	SNP	1.000	T
DCP2	167227	genome.wustl.edu	37	5	112346477	112346477	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr5:112346477C>T	ENST00000389063.2	+	10	1270	c.1072C>T	c.(1072-1074)Cgg>Tgg	p.R358W	DCP2_ENST00000543319.1_Missense_Mutation_p.R147W|DCP2_ENST00000515408.1_Missense_Mutation_p.R323W	NM_152624.5	NP_689837	Q8IU60	DCP2_HUMAN	decapping mRNA 2	358					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|histone mRNA catabolic process (GO:0071044)|mRNA catabolic process (GO:0006402)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|nucleus (GO:0005634)|RISC complex (GO:0016442)	exoribonuclease activity, producing 5'-phosphomonoesters (GO:0016896)|m7G(5')pppN diphosphatase activity (GO:0050072)|manganese ion binding (GO:0030145)|RNA binding (GO:0003723)			endometrium(3)|large_intestine(6)|lung(1)	10		all_cancers(142;4.41e-05)|all_epithelial(76;3.65e-07)|Colorectal(10;0.00115)|Prostate(80;0.00133)|Ovarian(225;0.0443)		OV - Ovarian serous cystadenocarcinoma(64;6.98e-08)|Epithelial(69;7.87e-08)|all cancers(49;1.06e-05)|COAD - Colon adenocarcinoma(37;0.0123)|Colorectal(14;0.0171)		ACTTCATCCACGGAAACTTCA	0.313																																																	0													160.0	169.0	166.0					5																	112346477		2201	4300	6501	SO:0001583	missense	0			AY135173	CCDS34210.1, CCDS56377.1	5q22	2013-05-02	2013-05-02		ENSG00000172795	ENSG00000172795	3.6.1.62	"""Nudix motif containing"""	24452	protein-coding gene	gene with protein product	"""nudix (nucleoside diphosphate linked moiety X)-type motif 20"", ""M(7)GpppN-mRNA hydrolase"""	609844	"""DCP2 decapping enzyme homolog (S. cerevisiae)"""			12218187, 12417715	Standard	NM_152624		Approved	NUDT20	uc003kqh.3	Q8IU60	OTTHUMG00000162853	ENST00000389063.2:c.1072C>T	5.37:g.112346477C>T	ENSP00000373715:p.Arg358Trp		C9J778|Q6P2D4|Q7Z5W5|Q8NBG5	Missense_Mutation	SNP	pfam_mRNA_decapping_BoxA,pfam_NUDIX_hydrolase_dom,superfamily_NUDIX_hydrolase_dom-like	p.R358W	ENST00000389063.2	37	c.1072	CCDS34210.1	5	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	20.7|20.7	4.028532|4.028532	0.75390|0.75390	.|.	.|.	ENSG00000172795|ENSG00000172795	ENST00000515408;ENST00000389063;ENST00000543319|ENST00000513585	T;T|.	0.69175|.	-0.38;0.27|.	5.74|5.74	3.78|3.78	0.43462|0.43462	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.44808|0.44808	0.1311|0.1311	L|L	0.32530|0.32530	0.975|0.975	0.58432|0.58432	D|D	0.999999|0.999999	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.91635|.	0.999;0.998|.	T|T	0.27502|0.27502	-1.0072|-1.0072	10|5	0.87932|.	D|.	0|.	.|.	7.772|7.772	0.29015|0.29015	0.3052:0.5729:0.1219:0.0|0.3052:0.5729:0.1219:0.0	.|.	323;358|.	Q8IU60-2;Q8IU60|.	.;DCP2_HUMAN|.	W|M	323;358;147|339	ENSP00000425770:R323W;ENSP00000373715:R358W|.	ENSP00000373715:R358W|.	R|T	+|+	1|2	2|0	DCP2|DCP2	112374376|112374376	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.990000|0.990000	0.78478|0.78478	2.566000|2.566000	0.45948|0.45948	1.413000|1.413000	0.46997|0.46997	0.637000|0.637000	0.83480|0.83480	CGG|ACG	DCP2	-	NULL	ENSG00000172795		0.313	DCP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCP2	HGNC	protein_coding	OTTHUMT00000370765.3	-	0.00	53	0	C	NM_152624		112346477	+1	tier1	-	no_errors	ENST00000389063	ensembl	human	known	74_37	missense	46.30	29	25	SNP	1.000	T
DIDO1	11083	genome.wustl.edu	37	20	61511438	61511438	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr20:61511438G>A	ENST00000266070.4	-	16	6195	c.5870C>T	c.(5869-5871)cCa>cTa	p.P1957L	DIDO1_ENST00000395343.1_Missense_Mutation_p.P1957L	NM_033081.2	NP_149072.2	Q9BTC0	DIDO1_HUMAN	death inducer-obliterator 1	1957	Pro-rich.				apoptotic signaling pathway (GO:0097190)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			NS(6)|breast(5)|central_nervous_system(1)|cervix(3)|endometrium(6)|kidney(1)|large_intestine(17)|lung(39)|ovary(8)|prostate(3)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)	99	Breast(26;5.68e-08)					CCTGGGACCTGGCATAAAGTT	0.582																																					Melanoma(25;381 482 3385 5362 7955 17159 17174 40604 47095)												0													118.0	138.0	131.0					20																	61511438		2203	4299	6502	SO:0001583	missense	0			AB002331	CCDS13508.2, CCDS13509.1, CCDS33506.1	20q13.33	2013-01-28	2005-11-11	2005-11-11	ENSG00000101191	ENSG00000101191		"""Zinc fingers, PHD-type"""	2680	protein-coding gene	gene with protein product		604140	"""chromosome 20 open reading frame 158"", ""death associated transcription factor 1"""	C20orf158, DATF1		10393935	Standard	NM_033081		Approved	DIO1, dJ885L7.8, FLJ11265, KIAA0333, DIO-1, BYE1	uc002ydr.2	Q9BTC0	OTTHUMG00000032945	ENST00000266070.4:c.5870C>T	20.37:g.61511438G>A	ENSP00000266070:p.Pro1957Leu		A8MY65|B9EH82|E1P5I1|O15043|Q3ZTL7|Q3ZTL8|Q4VXS1|Q4VXS2|Q4VXV8|Q4VXV9|Q96D72|Q9BQW0|Q9BW03|Q9H4G6|Q9H4G7|Q9NTU8|Q9NUM8|Q9UFB6	Missense_Mutation	SNP	pfam_TFIIS_cen_dom,pfam_SPOC_C,pfam_Znf_PHD-finger,superfamily_TFIIS_cen_dom,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,smart_TFS2M,pfscan_Znf_PHD-finger	p.P1957L	ENST00000266070.4	37	c.5870	CCDS33506.1	20	.	.	.	.	.	.	.	.	.	.	G	12.89	2.072022	0.36566	.	.	ENSG00000101191	ENST00000266070;ENST00000395343	T;T	0.10005	2.92;2.92	4.85	3.83	0.44106	.	0.172654	0.27705	N	0.018184	T	0.11110	0.0271	L	0.57536	1.79	0.24777	N	0.992837	P	0.38922	0.651	B	0.36030	0.216	T	0.14980	-1.0453	10	0.32370	T	0.25	-12.0382	10.0654	0.42299	0.0:0.1483:0.6984:0.1533	.	1957	Q9BTC0	DIDO1_HUMAN	L	1957	ENSP00000266070:P1957L;ENSP00000378752:P1957L	ENSP00000266070:P1957L	P	-	2	0	DIDO1	60981883	0.984000	0.35163	0.929000	0.37066	0.130000	0.20726	2.352000	0.44080	2.374000	0.81015	0.561000	0.74099	CCA	DIDO1	-	NULL	ENSG00000101191		0.582	DIDO1-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DIDO1	HGNC	protein_coding	OTTHUMT00000080091.2		0.00	28	0	G	NM_080796		61511438	-1			no_errors	ENST00000266070	ensembl	human	known	74_37	missense	9.88	73	8	SNP	0.251	A
DLG2	1740	genome.wustl.edu	37	11	83877955	83877956	+	Intron	INS	-	-	T			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr11:83877955_83877956insT	ENST00000532653.1	-	4	561				DLG2_ENST00000398301.2_Intron|DLG2_ENST00000543673.1_Intron|DLG2_ENST00000524982.1_Intron|DLG2_ENST00000376104.2_Intron|DLG2_ENST00000531015.1_Intron|DLG2_ENST00000398309.2_Intron|DLG2_ENST00000280241.8_Intron|DLG2_ENST00000376106.3_Intron|DLG2_ENST00000330014.6_Intron|DLG2_ENST00000418306.2_Intron|DLG2_ENST00000537455.1_Intron			Q14168	MPP2_HUMAN	discs, large homolog 2 (Drosophila)						nucleotide phosphorylation (GO:0046939)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	guanylate kinase activity (GO:0004385)			breast(1)|central_nervous_system(1)|endometrium(8)|kidney(3)|large_intestine(11)|lung(35)|ovary(3)|pancreas(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	71		all_cancers(6;0.00791)|Acute lymphoblastic leukemia(157;4.44e-05)|all_hematologic(158;0.0036)				GGCCGAATACATTTTTTTTCTT	0.376																																																	0																																										SO:0001627	intron_variant	0			U32376	CCDS41696.1, CCDS44690.1, CCDS44691.1, CCDS44692.1, CCDS55782.1, CCDS73357.1	11q21	2012-04-17	2008-12-15		ENSG00000150672	ENSG00000150672		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	2901	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 58"""	603583	"""discs, large homolog 2, chapsyn-110 (Drosophila)"""			8755482, 9806853	Standard	NM_001142702		Approved	PSD-93, PSD93, chapsyn-110, PPP1R58	uc001pak.2	Q15700	OTTHUMG00000134309	ENST00000532653.1:c.259-3401->A	11.37:g.83877963_83877963dupT			B4DGE9|B4DRJ0|B7Z3G8|E7EV80|E7EV91|E7EX01|Q53ES9|Q5CZB9|Q9BQJ2	RNA	INS	-	NULL	ENST00000532653.1	37	NULL		11																																																																																			DLG2	-	-	ENSG00000150672		0.376	DLG2-009	NOVEL	basic|appris_candidate	protein_coding	DLG2	HGNC	protein_coding	OTTHUMT00000259253.2		0.00	47	0	-	NM_001364		83877956	-1	tier1		no_errors	ENST00000524941	ensembl	human	known	74_37	rna	6.25	30	2	INS	0.000:0.000	T
DNAH12	201625	genome.wustl.edu	37	3	57348623	57348623	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr3:57348623G>A	ENST00000351747.2	-	51	8137	c.7957C>T	c.(7957-7959)Cat>Tat	p.H2653Y	DNAH12_ENST00000344804.4_Intron	NM_178504.4	NP_848599.3	Q6ZR08	DYH12_HUMAN	dynein, axonemal, heavy chain 12	2653	AAA 4. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(3)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(4)|lung(7)|pancreas(1)|prostate(1)|skin(1)	25						ACAAGGGCATGAAAAAAACAA	0.363																																																	0													83.0	66.0	71.0					3																	57348623		692	1591	2283	SO:0001583	missense	0			U53532, AK126276	CCDS33771.1	3p21.1	2009-02-04	2006-09-04		ENSG00000174844	ENSG00000174844		"""Axonemal dyneins"""	2943	protein-coding gene	gene with protein product		603340	"""dynein, axonemal, heavy polypeptide 12"", ""dynein heavy chain domain 2"", ""dynein heavy domain 2"", ""dynein, axonemal, heavy chain 12-like"", ""dynein, axonemal, heavy chain 7-like"""	DNHD2, DNAH12L, DNAH7L		8812413, 8666668	Standard	NM_198564		Approved	DLP12, Dnahc3, HL-19, hdhc3, DHC3, FLJ40427, FLJ44290	uc003dit.2	Q6ZR08	OTTHUMG00000158598	ENST00000351747.2:c.7957C>T	3.37:g.57348623G>A	ENSP00000295937:p.His2653Tyr		A6NGI2|Q6ZTR8|Q8N7R9|Q8WXK2|Q92816	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.H2653Y	ENST00000351747.2	37	c.7957		3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	32|32	5.134103|5.134103	0.94517|0.94517	.|.	.|.	ENSG00000174844|ENSG00000174844	ENST00000351747|ENST00000462199	T|.	0.34072|.	1.38|.	6.17|6.17	6.17|6.17	0.99709|0.99709	Dynein heavy chain (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.90549|0.90549	0.7038|0.7038	H|H	0.97023|0.97023	3.925|3.925	0.80722|0.80722	D|D	1|1	D|.	0.89917|.	1.0|.	D|.	0.97110|.	1.0|.	D|D	0.92383|0.92383	0.5915|0.5915	10|5	0.87932|.	D|.	0|.	.|.	20.8794|20.8794	0.99867|0.99867	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	2653|.	Q6ZR08|.	DYH12_HUMAN|.	Y|L	2653|343	ENSP00000295937:H2653Y|.	ENSP00000295937:H2653Y|.	H|S	-|-	1|2	0|0	DNAH12|DNAH12	57323663|57323663	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	7.594000|7.594000	0.82698|0.82698	2.941000|2.941000	0.99782|0.99782	0.655000|0.655000	0.94253|0.94253	CAT|TCA	DNAH12	-	pfam_Dynein_heavy_dom	ENSG00000174844		0.363	DNAH12-202	KNOWN	basic|appris_principal	protein_coding	DNAH12	HGNC	protein_coding			0.00	39	0	G	NM_178504		57348623	-1			no_errors	ENST00000351747	ensembl	human	known	74_37	missense	6.90	27	2	SNP	1.000	A
DNAH6	1768	genome.wustl.edu	37	2	84940368	84940368	+	Silent	SNP	C	C	G			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr2:84940368C>G	ENST00000237449.6	+	56	9536	c.9528C>G	c.(9526-9528)ccC>ccG	p.P3176P	DNAH6_ENST00000389394.3_Silent_p.P3176P			Q9C0G6	DYH6_HUMAN	dynein, axonemal, heavy chain 6	3176	AAA 5. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(2)|breast(9)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(3)|lung(14)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	57						TGCCAAATCCCCACTATCTGC	0.423																																																	0													122.0	101.0	107.0					2																	84940368		692	1591	2283	SO:0001819	synonymous_variant	0			U61736	CCDS46348.1	2p11.2	2011-05-24	2006-09-04		ENSG00000115423	ENSG00000115423		"""Axonemal dyneins"""	2951	protein-coding gene	gene with protein product		603336	"""dynein, axonemal, heavy polypeptide 6"", ""dynein heavy chain-like 1"""	DNHL1		8812413	Standard	NM_001370		Approved	Dnahc6, HL-2, FLJ37357	uc010fgb.3	Q9C0G6	OTTHUMG00000128957	ENST00000237449.6:c.9528C>G	2.37:g.84940368C>G			A0PJN9|B5MEE0|B7ZL99|O95493|Q53QZ1|Q53TE5|Q8N1W6|Q92861|Q96BL6|Q9H030|Q9H5E1	Silent	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.P3176	ENST00000237449.6	37	c.9528	CCDS46348.1	2																																																																																			DNAH6	-	superfamily_P-loop_NTPase	ENSG00000115423		0.423	DNAH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH6	HGNC	protein_coding	OTTHUMT00000328537.2	-	0.00	79	0	C	NM_001370		84940368	+1	tier1	-	no_errors	ENST00000237449	ensembl	human	known	74_37	silent	5.06	75	4	SNP	0.935	G
DNASE1L3	1776	genome.wustl.edu	37	3	58178417	58178417	+	Silent	SNP	G	G	T			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr3:58178417G>T	ENST00000394549.2	-	8	1231	c.915C>A	c.(913-915)tcC>tcA	p.S305S	DNASE1L3_ENST00000486455.1_Silent_p.S275S|DNASE1L3_ENST00000483681.1_3'UTR|DNASE1L3_ENST00000318316.3_Silent_p.S305S	NM_004944.3	NP_004935.1	Q13609	DNSL3_HUMAN	deoxyribonuclease I-like 3	305					apoptotic DNA fragmentation (GO:0006309)|developmental programmed cell death (GO:0010623)|DNA metabolic process (GO:0006259)	nucleus (GO:0005634)	calcium ion binding (GO:0005509)|deoxyribonuclease activity (GO:0004536)|DNA binding (GO:0003677)|endodeoxyribonuclease activity, producing 5'-phosphomonoesters (GO:0016888)			breast(2)|large_intestine(4)|lung(6)	12				BRCA - Breast invasive adenocarcinoma(55;0.00021)|KIRC - Kidney renal clear cell carcinoma(284;0.0445)|Kidney(284;0.0556)|OV - Ovarian serous cystadenocarcinoma(275;0.202)		CTTGGGTCTAGGAGCGTTTGC	0.403																																					Esophageal Squamous(96;1069 1424 4841 43466 52325)												0													137.0	139.0	139.0					3																	58178417		2203	4300	6503	SO:0001819	synonymous_variant	0			AF047354	CCDS2886.1, CCDS58836.1	3p14.3	2008-05-15			ENSG00000163687	ENSG00000163687			2959	protein-coding gene	gene with protein product	"""DNase gamma"""	602244				9205125, 9714828, 14646506	Standard	NM_004944		Approved	DNAS1L3, LSD	uc003djo.2	Q13609	OTTHUMG00000159153	ENST00000394549.2:c.915C>A	3.37:g.58178417G>T			B2R8B1|B7Z707|O75803	Silent	SNP	pfam_Endo/exonuclease/phosphatase,superfamily_Endo/exonuclease/phosphatase,smart_DNase_I,pirsf_DNase_I,prints_DNase_I	p.S305	ENST00000394549.2	37	c.915	CCDS2886.1	3																																																																																			DNASE1L3	-	NULL	ENSG00000163687		0.403	DNASE1L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNASE1L3	HGNC	protein_coding	OTTHUMT00000353533.1		0.00	39	0	G	NM_004944		58178417	-1			no_errors	ENST00000318316	ensembl	human	known	74_37	silent	10.81	32	4	SNP	0.834	T
DOCK10	55619	genome.wustl.edu	37	2	225657770	225657770	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr2:225657770C>G	ENST00000258390.7	-	47	5299	c.5232G>C	c.(5230-5232)aaG>aaC	p.K1744N	DOCK10_ENST00000409592.3_Missense_Mutation_p.K1738N	NM_014689.2	NP_055504.2	Q96BY6	DOC10_HUMAN	dedicator of cytokinesis 10	1744	DHR-2.				regulation of cell migration (GO:0030334)|small GTPase mediated signal transduction (GO:0007264)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(3)|cervix(1)|endometrium(6)|kidney(10)|large_intestine(16)|lung(40)|ovary(2)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	87		Renal(207;0.0113)|all_lung(227;0.0486)|Lung NSC(271;0.0653)|all_hematologic(139;0.14)		Epithelial(121;2.37e-10)|all cancers(144;2.26e-07)|Lung(261;0.0143)|LUSC - Lung squamous cell carcinoma(224;0.0178)		CTGTGCAAATCTTTTCCACTT	0.438																																																	0													200.0	185.0	190.0					2																	225657770		1864	4095	5959	SO:0001583	missense	0			AB014594	CCDS46528.1, CCDS74661.1	2q36.3	2013-01-10			ENSG00000135905	ENSG00000135905		"""Pleckstrin homology (PH) domain containing"""	23479	protein-coding gene	gene with protein product	"""zizimin3"""	611518				12432077	Standard	NM_014689		Approved	ZIZ3, KIAA0694	uc010fwz.1	Q96BY6	OTTHUMG00000153428	ENST00000258390.7:c.5232G>C	2.37:g.225657770C>G	ENSP00000258390:p.Lys1744Asn		B3FL70|O75178|Q9NW06|Q9NXI8	Missense_Mutation	SNP	pfam_DOCK_C,pfam_DOCK_C/D_N,pfam_Pleckstrin_homology,superfamily_ARM-type_fold,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.K1744N	ENST00000258390.7	37	c.5232	CCDS46528.1	2	.	.	.	.	.	.	.	.	.	.	C	13.79	2.342799	0.41498	.	.	ENSG00000135905	ENST00000409592;ENST00000258390	T;T	0.19394	3.45;2.15	5.6	5.6	0.85130	.	0.204155	0.50627	D	0.000102	T	0.15609	0.0376	N	0.19112	0.55	0.45172	D	0.998181	B;B;B	0.12630	0.006;0.0;0.001	B;B;B	0.09377	0.004;0.001;0.0	T	0.03673	-1.1014	10	0.40728	T	0.16	.	15.1368	0.72572	0.0:0.8591:0.1409:0.0	.	1744;1738;406	Q96BY6;B3FL70;B4DEY4	DOC10_HUMAN;.;.	N	1738;1744	ENSP00000386694:K1738N;ENSP00000258390:K1744N	ENSP00000258390:K1744N	K	-	3	2	DOCK10	225366014	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	2.903000	0.48711	2.634000	0.89283	0.557000	0.71058	AAG	DOCK10	-	superfamily_ARM-type_fold	ENSG00000135905		0.438	DOCK10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK10	HGNC	protein_coding	OTTHUMT00000331246.1		0.00	37	0	C			225657770	-1			no_errors	ENST00000258390	ensembl	human	known	74_37	missense	6.38	44	3	SNP	1.000	G
DOCK3	1795	genome.wustl.edu	37	3	51349978	51349978	+	Silent	SNP	C	C	T			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr3:51349978C>T	ENST00000266037.9	+	30	3188	c.3165C>T	c.(3163-3165)acC>acT	p.T1055T		NM_004947.4	NP_004938.1	Q8IZD9	DOCK3_HUMAN	dedicator of cytokinesis 3	1055					small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(2)|cervix(1)|endometrium(10)|kidney(4)|lung(22)|prostate(5)|urinary_tract(1)	45				BRCA - Breast invasive adenocarcinoma(193;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00449)|Kidney(197;0.00518)		AAATTATCACCTCAGCCAAAA	0.383																																																	0													78.0	69.0	72.0					3																	51349978		1827	4081	5908	SO:0001819	synonymous_variant	0			AB002297	CCDS46835.1	3p21	2008-02-01			ENSG00000088538	ENSG00000088538			2989	protein-coding gene	gene with protein product		603123	"""dedicator of cyto-kinesis 3"""			9205841	Standard	NM_004947		Approved	KIAA0299, MOCA, PBP	uc011bds.2	Q8IZD9	OTTHUMG00000156892	ENST00000266037.9:c.3165C>T	3.37:g.51349978C>T			O15017	Silent	SNP	pfam_DOCK_C,pfam_SH3_2,superfamily_SH3_domain,superfamily_ARM-type_fold,smart_SH3_domain,pfscan_SH3_domain	p.T1055	ENST00000266037.9	37	c.3165	CCDS46835.1	3																																																																																			DOCK3	-	superfamily_ARM-type_fold	ENSG00000088538		0.383	DOCK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK3	HGNC	protein_coding	OTTHUMT00000346478.5	-	0.00	54	0	C	NM_004947		51349978	+1	tier1	-	no_errors	ENST00000266037	ensembl	human	known	74_37	silent	18.60	35	8	SNP	0.812	T
DTNA	1837	genome.wustl.edu	37	18	32395957	32395957	+	Nonsense_Mutation	SNP	C	C	T			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr18:32395957C>T	ENST00000399113.3	+	6	688	c.688C>T	c.(688-690)Cga>Tga	p.R230*	DTNA_ENST00000597674.1_5'Flank|DTNA_ENST00000269191.6_Nonsense_Mutation_p.R230*|DTNA_ENST00000269190.7_Nonsense_Mutation_p.R230*|DTNA_ENST00000399097.3_5'UTR|DTNA_ENST00000315456.6_Nonsense_Mutation_p.R230*|DTNA_ENST00000598142.1_Nonsense_Mutation_p.R230*|DTNA_ENST00000595022.1_Nonsense_Mutation_p.R230*|DTNA_ENST00000596745.1_Intron|DTNA_ENST00000597599.1_Nonsense_Mutation_p.R230*|DTNA_ENST00000591182.1_5'Flank|DTNA_ENST00000269192.7_5'Flank|DTNA_ENST00000399121.5_Nonsense_Mutation_p.R230*|DTNA_ENST00000598334.1_Nonsense_Mutation_p.R230*|DTNA_ENST00000444659.1_Nonsense_Mutation_p.R230*|DTNA_ENST00000556414.3_5'Flank|DTNA_ENST00000554864.3_Nonsense_Mutation_p.R230*|DTNA_ENST00000599844.1_5'Flank|DTNA_ENST00000601125.1_5'Flank|DTNA_ENST00000598774.1_Nonsense_Mutation_p.R230*|DTNA_ENST00000283365.9_Nonsense_Mutation_p.R230*|DTNA_ENST00000348997.5_Nonsense_Mutation_p.R230*			Q9Y4J8	DTNA_HUMAN	dystrobrevin, alpha	230	Interaction with MAGEE1. {ECO:0000250}.				neuromuscular synaptic transmission (GO:0007274)|signal transduction (GO:0007165)|striated muscle contraction (GO:0006941)|synaptic transmission (GO:0007268)	axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|synapse (GO:0045202)	calcium ion binding (GO:0005509)|zinc ion binding (GO:0008270)			endometrium(1)|haematopoietic_and_lymphoid_tissue(4)|kidney(1)|large_intestine(2)|lung(19)|prostate(1)|upper_aerodigestive_tract(1)	29						TCTTCTGCATCGACTAGCAAA	0.408																																																	0													146.0	140.0	142.0					18																	32395957		2203	4300	6503	SO:0001587	stop_gained	0			U84540	CCDS11908.1, CCDS11909.1, CCDS42426.1, CCDS45848.1, CCDS56060.1, CCDS56061.1, CCDS56062.1, CCDS56063.1, CCDS59309.1, CCDS59310.1, CCDS59311.1, CCDS59312.1, CCDS59313.1, CCDS59314.1	18q12	2014-09-17			ENSG00000134769	ENSG00000134769			3057	protein-coding gene	gene with protein product	"""dystrophin-related protein 3"""	601239				8081380, 15834686	Standard	NM_001390		Approved	D18S892E, DTN, DTN-1, DTN-2, DTN-3, DRP3	uc010dmn.1	Q9Y4J8	OTTHUMG00000132309	ENST00000399113.3:c.688C>T	18.37:g.32395957C>T	ENSP00000382064:p.Arg230*		A8K541|A8MSZ0|A8MUY4|B4DGS6|B4DIR0|B4DIU8|M0QYX6|M0R397|O15332|O15333|O75697|Q13197|Q13198|Q13199|Q13498|Q13499|Q13500|Q59GK7|Q9BS59	Nonsense_Mutation	SNP	pfam_EF-hand_dom_typ1,pfam_EF-hand_dom_typ2,pfam_Znf_ZZ,smart_Znf_ZZ,pirsf_Distrobrevin,pfscan_Znf_ZZ	p.R230*	ENST00000399113.3	37	c.688	CCDS59311.1	18	.	.	.	.	.	.	.	.	.	.	C	36	5.812242	0.96975	.	.	ENSG00000134769	ENST00000399119;ENST00000283365;ENST00000315456;ENST00000556176;ENST00000399114;ENST00000269190;ENST00000348997;ENST00000399121;ENST00000444659;ENST00000269191;ENST00000399113	.	.	.	6.04	5.17	0.71159	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-9.2892	14.4127	0.67124	0.2685:0.7315:0.0:0.0	.	.	.	.	X	230	.	ENSP00000269190:R230X	R	+	1	2	DTNA	30649955	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	4.871000	0.63042	1.550000	0.49438	0.563000	0.77884	CGA	DTNA	-	pfam_EF-hand_dom_typ2,pirsf_Distrobrevin	ENSG00000134769		0.408	DTNA-005	PUTATIVE	basic|appris_candidate_longest|CCDS	protein_coding	DTNA	HGNC	protein_coding	OTTHUMT00000255422.2	-	0.00	75	0	C	NM_001390		32395957	+1	tier1	-	no_errors	ENST00000269190	ensembl	human	known	74_37	nonsense	31.58	39	18	SNP	1.000	T
DUSP12	11266	genome.wustl.edu	37	1	161719720	161719720	+	Silent	SNP	G	G	T			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr1:161719720G>T	ENST00000367943.4	+	1	161	c.129G>T	c.(127-129)gcG>gcT	p.A43A		NM_007240.1	NP_009171.1	Q9UNI6	DUS12_HUMAN	dual specificity phosphatase 12	43					cellular protein modification process (GO:0006464)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of glucokinase activity (GO:0033133)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|kidney(1)|lung(1)	5	all_hematologic(112;0.0359)		BRCA - Breast invasive adenocarcinoma(70;0.00634)			CGGCCGTCGCGGAGCCAGATC	0.662																																																	0													26.0	29.0	28.0					1																	161719720		2203	4299	6502	SO:0001819	synonymous_variant	0			AF119226	CCDS1234.1	1q21-q22	2011-06-09			ENSG00000081721	ENSG00000081721		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Atypical dual specificity phosphatases"""	3067	protein-coding gene	gene with protein product	"""serine/threonine specific protein phosphatase"", ""YVH1 protein-tyrosine phosphatase (S. cerevisiae) ortholog"""	604835				10446167	Standard	XM_005244862		Approved	YVH1, DUSP1	uc001gbo.3	Q9UNI6	OTTHUMG00000034540	ENST00000367943.4:c.129G>T	1.37:g.161719720G>T			Q5VXA8	Silent	SNP	pfam_Dual-sp_phosphatase_cat-dom,smart_Dual-sp_phosphatase_subgr_cat,pirsf_DUSP12,pfscan_Znf_C2H2,pfscan_Tyr/Dual-sp_Pase,pfscan_Dual-sp_phosphatase_subgr_cat	p.A43	ENST00000367943.4	37	c.129	CCDS1234.1	1																																																																																			DUSP12	-	pfam_Dual-sp_phosphatase_cat-dom,smart_Dual-sp_phosphatase_subgr_cat,pirsf_DUSP12,pfscan_Dual-sp_phosphatase_subgr_cat	ENSG00000081721		0.662	DUSP12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DUSP12	HGNC	protein_coding	OTTHUMT00000083588.1		0.00	63	0	G	NM_007240		161719720	+1			no_errors	ENST00000367943	ensembl	human	known	74_37	silent	5.06	75	4	SNP	0.127	T
DUSP12	11266	genome.wustl.edu	37	1	161721524	161721524	+	Silent	SNP	C	C	A			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr1:161721524C>A	ENST00000367943.4	+	2	443	c.411C>A	c.(409-411)ccC>ccA	p.P137P		NM_007240.1	NP_009171.1	Q9UNI6	DUS12_HUMAN	dual specificity phosphatase 12	137	Tyrosine-protein phosphatase.				cellular protein modification process (GO:0006464)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of glucokinase activity (GO:0033133)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|kidney(1)|lung(1)	5	all_hematologic(112;0.0359)		BRCA - Breast invasive adenocarcinoma(70;0.00634)			ACCAACTTCCCTTTGAAAAAG	0.343																																																	0													115.0	118.0	117.0					1																	161721524		2203	4300	6503	SO:0001819	synonymous_variant	0			AF119226	CCDS1234.1	1q21-q22	2011-06-09			ENSG00000081721	ENSG00000081721		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Atypical dual specificity phosphatases"""	3067	protein-coding gene	gene with protein product	"""serine/threonine specific protein phosphatase"", ""YVH1 protein-tyrosine phosphatase (S. cerevisiae) ortholog"""	604835				10446167	Standard	XM_005244862		Approved	YVH1, DUSP1	uc001gbo.3	Q9UNI6	OTTHUMG00000034540	ENST00000367943.4:c.411C>A	1.37:g.161721524C>A			Q5VXA8	Silent	SNP	pfam_Dual-sp_phosphatase_cat-dom,smart_Dual-sp_phosphatase_subgr_cat,pirsf_DUSP12,pfscan_Znf_C2H2,pfscan_Tyr/Dual-sp_Pase,pfscan_Dual-sp_phosphatase_subgr_cat	p.P137	ENST00000367943.4	37	c.411	CCDS1234.1	1																																																																																			DUSP12	-	pfam_Dual-sp_phosphatase_cat-dom,smart_Dual-sp_phosphatase_subgr_cat,pirsf_DUSP12,pfscan_Tyr/Dual-sp_Pase,pfscan_Dual-sp_phosphatase_subgr_cat	ENSG00000081721		0.343	DUSP12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DUSP12	HGNC	protein_coding	OTTHUMT00000083588.1		0.00	45	0	C	NM_007240		161721524	+1			no_errors	ENST00000367943	ensembl	human	known	74_37	silent	5.26	36	2	SNP	0.982	A
DYNC1LI1	51143	genome.wustl.edu	37	3	32578524	32578524	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr3:32578524T>C	ENST00000273130.4	-	6	914	c.811A>G	c.(811-813)Atc>Gtc	p.I271V	DYNC1LI1_ENST00000432458.2_Missense_Mutation_p.I155V	NM_016141.3	NP_057225.2	Q9Y6G9	DC1L1_HUMAN	dynein, cytoplasmic 1, light intermediate chain 1	271					microtubule-based movement (GO:0007018)|mitotic nuclear division (GO:0007067)|positive regulation of mitotic cell cycle spindle assembly checkpoint (GO:0090267)|transport (GO:0006810)|viral process (GO:0016032)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic dynein complex (GO:0005868)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|spindle pole (GO:0000922)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)|poly(A) RNA binding (GO:0044822)			kidney(2)|large_intestine(1)|lung(3)|ovary(1)	7						AACTTCCGGATATGTGACTGA	0.259																																																	0													80.0	76.0	78.0					3																	32578524		2202	4288	6490	SO:0001583	missense	0			AF078849	CCDS2654.1	3p23	2013-01-18	2005-11-25	2005-11-25	ENSG00000144635	ENSG00000144635		"""Cytoplasmic dyneins"""	18745	protein-coding gene	gene with protein product		615890	"""dynein, cytoplasmic, light intermediate polypeptide 1"""	DNCLI1		16260502	Standard	NM_016141		Approved		uc003cfb.4	Q9Y6G9	OTTHUMG00000130750	ENST00000273130.4:c.811A>G	3.37:g.32578524T>C	ENSP00000273130:p.Ile271Val		A2RRG7|Q53HC8|Q53HK7	Missense_Mutation	SNP	pfam_Dynein_light_int_chain,superfamily_P-loop_NTPase	p.I271V	ENST00000273130.4	37	c.811	CCDS2654.1	3	.	.	.	.	.	.	.	.	.	.	T	15.13	2.742445	0.49151	.	.	ENSG00000144635	ENST00000273130;ENST00000432458	T;T	0.21543	2.0;2.0	5.66	5.66	0.87406	.	0.096864	0.64402	D	0.000001	T	0.24122	0.0584	L	0.48642	1.525	0.54753	D	0.999989	B;B	0.30326	0.276;0.053	B;B	0.34873	0.191;0.123	T	0.02450	-1.1157	10	0.33940	T	0.23	-10.1977	15.8884	0.79273	0.0:0.0:0.0:1.0	.	155;271	E9PHI6;Q9Y6G9	.;DC1L1_HUMAN	V	271;155	ENSP00000273130:I271V;ENSP00000407279:I155V	ENSP00000273130:I271V	I	-	1	0	DYNC1LI1	32553528	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	4.259000	0.58828	2.147000	0.66899	0.383000	0.25322	ATC	DYNC1LI1	-	pfam_Dynein_light_int_chain,superfamily_P-loop_NTPase	ENSG00000144635		0.259	DYNC1LI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DYNC1LI1	HGNC	protein_coding	OTTHUMT00000253250.1	-	0.00	71	0	T	NM_016141		32578524	-1	tier1	-	no_errors	ENST00000273130	ensembl	human	known	74_37	missense	59.32	24	35	SNP	1.000	C
EFCAB12	90288	genome.wustl.edu	37	3	129127513	129127513	+	Silent	SNP	C	C	T			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr3:129127513C>T	ENST00000505956.1	-	6	1386	c.1224G>A	c.(1222-1224)ccG>ccA	p.P408P	EFCAB12_ENST00000326085.3_Silent_p.P408P	NM_207307.1	NP_997190.1	Q6NXP0	EFC12_HUMAN	EF-hand calcium binding domain 12	408							calcium ion binding (GO:0005509)	p.P408P(1)									CCTCTGTCAGCGGGAGGCCAT	0.587																																																	1	Substitution - coding silent(1)	kidney(1)											34.0	33.0	33.0					3																	129127513		1994	4169	6163	SO:0001819	synonymous_variant	0			AK096099	CCDS54638.1	3q21.3	2013-01-10	2012-07-20	2012-07-20	ENSG00000172771	ENSG00000172771		"""EF-hand domain containing"""	28061	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 25"""	C3orf25			Standard	NM_207307		Approved		uc003emg.3	Q6NXP0	OTTHUMG00000159464	ENST00000505956.1:c.1224G>A	3.37:g.129127513C>T			Q69YX4	Silent	SNP	pfscan_EF_hand_dom	p.P408	ENST00000505956.1	37	c.1224	CCDS54638.1	3																																																																																			EFCAB12	-	NULL	ENSG00000172771		0.587	EFCAB12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EFCAB12	HGNC	protein_coding	OTTHUMT00000355530.1		0.00	43	0	C	NM_207307		129127513	-1			no_errors	ENST00000326085	ensembl	human	known	74_37	silent	5.45	52	3	SNP	0.985	T
ECT2	1894	genome.wustl.edu	37	3	172520673	172520673	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr3:172520673G>T	ENST00000392692.3	+	20	2185	c.2009G>T	c.(2008-2010)cGa>cTa	p.R670L	ECT2_ENST00000417960.1_Missense_Mutation_p.R638L|ECT2_ENST00000427830.1_Missense_Mutation_p.R639L|ECT2_ENST00000540509.1_Missense_Mutation_p.R670L|ECT2_ENST00000232458.5_Missense_Mutation_p.R639L|ECT2_ENST00000441497.2_Missense_Mutation_p.R639L	NM_001258315.1	NP_001245244.1	Q9H8V3	ECT2_HUMAN	epithelial cell transforming 2	670					activation of protein kinase activity (GO:0032147)|activation of Rac GTPase activity (GO:0032863)|activation of Rho GTPase activity (GO:0032862)|apoptotic signaling pathway (GO:0097190)|cell morphogenesis (GO:0000902)|cellular response to calcium ion (GO:0071277)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to ionizing radiation (GO:0071479)|cytokinesis (GO:0000910)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of Cdc42 GTPase activity (GO:0043089)|positive regulation of cytokinesis (GO:0032467)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of Rho GTPase activity (GO:0032321)|protein homooligomerization (GO:0051260)|protein transport (GO:0015031)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of protein kinase activity (GO:0045859)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|tight junction assembly (GO:0070830)	cell-cell junction (GO:0005911)|centralspindlin complex (GO:0097149)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|midbody (GO:0030496)|mitotic spindle (GO:0072686)|nucleus (GO:0005634)|tight junction (GO:0005923)	GTPase activator activity (GO:0005096)|protein homodimerization activity (GO:0042803)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|signal transducer activity (GO:0004871)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(5)|large_intestine(5)|lung(11)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	37	Ovarian(172;0.00197)|Breast(254;0.158)		Lung(28;1.33e-14)|LUSC - Lung squamous cell carcinoma(14;1.48e-14)			TCTTCTCACCGAAGCTTAGTA	0.363																																																	0													74.0	73.0	73.0					3																	172520673		2203	4300	6503	SO:0001583	missense	0			AA206473	CCDS3220.1, CCDS58860.1	3q26.1-q26.2	2014-03-11	2014-03-11		ENSG00000114346	ENSG00000114346		"""Rho guanine nucleotide exchange factors"""	3155	protein-coding gene	gene with protein product		600586	"""epithelial cell transforming sequence 2 oncogene"""			8464478, 10579713	Standard	NM_018098		Approved	ARHGEF31	uc003fil.2	Q9H8V3	OTTHUMG00000156762	ENST00000392692.3:c.2009G>T	3.37:g.172520673G>T	ENSP00000376457:p.Arg670Leu		Q0MT80|Q2M269|Q6U836|Q9NSV8|Q9NVW9	Missense_Mutation	SNP	pfam_DH-domain,pfam_BRCT_dom,superfamily_DH-domain,superfamily_BRCT_dom,smart_BRCT_dom,smart_DH-domain,pfscan_BRCT_dom,pfscan_DH-domain	p.R639L	ENST00000392692.3	37	c.1916	CCDS58860.1	3	.	.	.	.	.	.	.	.	.	.	G	34	5.334626	0.95758	.	.	ENSG00000114346	ENST00000232458;ENST00000392692;ENST00000427830;ENST00000417960;ENST00000441497;ENST00000540509	T;T;T;T;T;T	0.37915	1.17;1.17;1.17;1.17;1.17;1.17	5.93	5.93	0.95920	Pleckstrin homology-type (1);Pleckstrin homology domain (1);	0.000000	0.85682	D	0.000000	T	0.66723	0.2818	M	0.84082	2.675	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;0.998;1.0;1.0;1.0	T	0.69239	-0.5197	10	0.87932	D	0	-10.7748	20.3368	0.98748	0.0:0.0:1.0:0.0	.	670;115;670;639;638	Q9H8V3;Q96SJ9;Q9H8V3-3;G5E9L8;Q9H8V3-2	ECT2_HUMAN;.;.;.;.	L	639;670;639;638;639;670	ENSP00000232458:R639L;ENSP00000376457:R670L;ENSP00000401910:R639L;ENSP00000415876:R638L;ENSP00000412259:R639L;ENSP00000443160:R670L	ENSP00000232458:R639L	R	+	2	0	ECT2	174003367	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.143000	0.94623	2.805000	0.96524	0.655000	0.94253	CGA	ECT2	-	NULL	ENSG00000114346		0.363	ECT2-003	NOVEL	basic|CCDS	protein_coding	ECT2	HGNC	protein_coding	OTTHUMT00000345994.2		0.00	48	0	G	NM_018098		172520673	+1			no_errors	ENST00000427830	ensembl	human	known	74_37	missense	5.17	55	3	SNP	1.000	T
EFS	10278	genome.wustl.edu	37	14	23829784	23829784	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr14:23829784G>T	ENST00000216733.3	-	2	884	c.277C>A	c.(277-279)Cac>Aac	p.H93N	EFS_ENST00000351354.3_Intron|EFS_ENST00000429593.2_Intron	NM_005864.2	NP_005855.1	O43281	EFS_HUMAN	embryonal Fyn-associated substrate	93	Pro-rich.				cell adhesion (GO:0007155)|intracellular signal transduction (GO:0035556)	cytoplasm (GO:0005737)	protein domain specific binding (GO:0019904)			endometrium(2)|kidney(1)|large_intestine(1)|liver(1)|lung(5)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(2)	16	all_cancers(95;7.12e-06)			GBM - Glioblastoma multiforme(265;0.00649)		TCATTGCTGTGATCTGGGGCT	0.652																																																	0													62.0	62.0	62.0					14																	23829784		2202	4298	6500	SO:0001583	missense	0			AB001466	CCDS9595.1, CCDS9596.1, CCDS61404.1	14q11.2-q12	2011-04-13			ENSG00000100842	ENSG00000100842		"""Cas scaffolding proteins"""	16898	protein-coding gene	gene with protein product	"""Cas scaffolding protein family member 3"""	609906				9349509	Standard	NM_005864		Approved	EFS2, EFS1, HEFS, SIN, CASS3	uc001wjo.4	O43281	OTTHUMG00000028741	ENST00000216733.3:c.277C>A	14.37:g.23829784G>T	ENSP00000216733:p.His93Asn		B2RAJ7|B4DJ56|E9PGU2|O43282	Missense_Mutation	SNP	pfam_CAS_DUF3513,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain,prints_SH3_domain	p.H93N	ENST00000216733.3	37	c.277	CCDS9595.1	14	.	.	.	.	.	.	.	.	.	.	G	10.03	1.238348	0.22711	.	.	ENSG00000100842	ENST00000216733	T	0.40756	1.02	4.99	4.99	0.66335	Src homology-3 domain (1);	0.997194	0.08128	N	0.993678	T	0.30262	0.0759	N	0.22421	0.69	0.20074	N	0.999932	B	0.11235	0.004	B	0.06405	0.002	T	0.08576	-1.0715	10	0.16896	T	0.51	-2.0319	11.1041	0.48193	0.0:0.0:0.8156:0.1844	.	93	O43281	EFS_HUMAN	N	93	ENSP00000216733:H93N	ENSP00000216733:H93N	H	-	1	0	EFS	22899624	0.001000	0.12720	0.846000	0.33378	0.981000	0.71138	1.124000	0.31320	2.769000	0.95229	0.563000	0.77884	CAC	EFS	-	superfamily_SH3_domain	ENSG00000100842		0.652	EFS-003	KNOWN	basic|appris_principal|CCDS	protein_coding	EFS	HGNC	protein_coding	OTTHUMT00000071770.2		0.00	98	0	G			23829784	-1			no_errors	ENST00000216733	ensembl	human	known	74_37	missense	5.19	73	4	SNP	0.016	T
EIF4H	7458	genome.wustl.edu	37	7	73604164	73604164	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr7:73604164C>T	ENST00000265753.8	+	4	464	c.325C>T	c.(325-327)Cgg>Tgg	p.R109W	MIR590_ENST00000385008.1_RNA|EIF4H_ENST00000353999.6_Missense_Mutation_p.R109W|EIF4H_ENST00000495187.1_3'UTR	NM_022170.1	NP_071496.1	Q15056	IF4H_HUMAN	eukaryotic translation initiation factor 4H	109	RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.				cellular protein metabolic process (GO:0044267)|developmental growth (GO:0048589)|gene expression (GO:0010467)|regulation of translational initiation (GO:0006446)|sexual reproduction (GO:0019953)|translation (GO:0006412)|translational initiation (GO:0006413)|viral process (GO:0016032)	cytosol (GO:0005829)|eukaryotic translation initiation factor 4F complex (GO:0016281)|membrane (GO:0016020)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)			endometrium(1)|lung(2)|prostate(1)	4						GTTGGGCGATCGGTCACTTCG	0.423																																																	0													128.0	118.0	121.0					7																	73604164		2203	4300	6503	SO:0001583	missense	0				CCDS5564.1, CCDS5565.1	7q11.23	2013-02-12	2006-11-27	2006-11-27	ENSG00000106682	ENSG00000106682		"""RNA binding motif (RRM) containing"""	12741	protein-coding gene	gene with protein product		603431	"""Williams-Beuren syndrome chromosome region 1"""	WBSCR1		9516461, 15078951	Standard	NM_022170		Approved	WSCR1, KIAA0038	uc003uad.1	Q15056	OTTHUMG00000023025	ENST00000265753.8:c.325C>T	7.37:g.73604164C>T	ENSP00000265753:p.Arg109Trp		A8K3R1|D3DXF6|D3DXF8	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.R109W	ENST00000265753.8	37	c.325	CCDS5564.1	7	.	.	.	.	.	.	.	.	.	.	C	22.3	4.277581	0.80580	.	.	ENSG00000106682	ENST00000265753;ENST00000353999	T;T	0.79845	-1.31;-1.31	5.62	5.62	0.85841	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.85682	D	0.000000	D	0.93074	0.7795	H	0.95574	3.69	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.85130	0.983;0.973;0.997;0.981	D	0.94717	0.7897	10	0.87932	D	0	-3.9447	18.2076	0.89859	0.0:1.0:0.0:0.0	.	109;109;109;109	B4DMV6;Q75MU2;Q15056-2;Q15056	.;.;.;IF4H_HUMAN	W	109	ENSP00000265753:R109W;ENSP00000265754:R109W	ENSP00000265753:R109W	R	+	1	2	EIF4H	73242100	0.996000	0.38824	1.000000	0.80357	0.998000	0.95712	2.958000	0.49145	2.647000	0.89833	0.655000	0.94253	CGG	EIF4H	-	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	ENSG00000106682		0.423	EIF4H-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EIF4H	HGNC	protein_coding	OTTHUMT00000252375.2		0.00	52	0	C	NM_022170		73604164	+1			no_errors	ENST00000265753	ensembl	human	known	74_37	missense	6.76	69	5	SNP	1.000	T
RP11-764K9.1	0	genome.wustl.edu	37	9	68400475	68400475	+	lincRNA	SNP	T	T	G	rs75317582	byFrequency	TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr9:68400475T>G	ENST00000417843.2	-	0	1344																											CAGGCCACAGTGTGGACtgtt	0.488																																																	0																																												0																															9.37:g.68400475T>G				RNA	SNP	-	NULL	ENST00000417843.2	37	NULL		9																																																																																			RP11-764K9.1	-	-	ENSG00000225411		0.488	RP11-764K9.1-001	KNOWN	basic	lincRNA	ENSG00000225411	Clone_based_vega_gene	lincRNA	OTTHUMT00000129817.2	-	0.00	28	0	T			68400475	-1	tier1	rs75317582	no_errors	ENST00000417843	ensembl	human	known	74_37	rna	14.81	23	4	SNP	0.010	G
RP11-403I13.8	0	genome.wustl.edu	37	1	149287967	149287967	+	lincRNA	SNP	G	G	A			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr1:149287967G>A	ENST00000433084.1	+	0	517				RNU1-143P_ENST00000516296.1_RNA|RP11-403I13.7_ENST00000424684.1_lincRNA																							cattttaggcgatggcaacgc	0.532																																																	0																																												0																															1.37:g.149287967G>A				RNA	SNP	-	NULL	ENST00000433084.1	37	NULL		1																																																																																			RP11-403I13.8	-	-	ENSG00000235999		0.532	RP11-403I13.8-001	KNOWN	basic	lincRNA	ENSG00000235999	Clone_based_vega_gene	lincRNA	OTTHUMT00000099633.1	-	0.00	191	0	G			149287967	+1	tier1	-	no_errors	ENST00000433084	ensembl	human	known	74_37	rna	5.69	231	14	SNP	0.001	A
CTC-471C19.1	0	genome.wustl.edu	37	5	6020309	6020309	+	lincRNA	SNP	G	G	T			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr5:6020309G>T	ENST00000564741.1	-	0	2087																											CTGTGTGAATGATTTTCCAGT	0.438																																																	0																																												0																															5.37:g.6020309G>T				RNA	SNP	-	NULL	ENST00000564741.1	37	NULL		5																																																																																			CTC-471C19.1	-	-	ENSG00000261037		0.438	CTC-471C19.1-001	KNOWN	basic	lincRNA	ENSG00000261037	Clone_based_vega_gene	lincRNA	OTTHUMT00000423121.1	-	0.00	24	0	G			6020309	-1	tier1	-	no_errors	ENST00000564741	ensembl	human	known	74_37	rna	27.27	16	6	SNP	0.000	T
ITGAL	3683	genome.wustl.edu	37	16	30500480	30500480	+	Intron	SNP	C	C	T			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr16:30500480C>T	ENST00000356798.6	+	10	1260				ITGAL_ENST00000433423.2_Intron|ITGAL_ENST00000358164.5_Intron|ITGAL_ENST00000568012.1_Intron|RP11-297C4.2_ENST00000569459.1_RNA	NM_002209.2	NP_002200.2	P20701	ITAL_HUMAN	integrin, alpha L (antigen CD11A (p180), lymphocyte function-associated antigen 1; alpha polypeptide)						activated T cell proliferation (GO:0050798)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|cellular component movement (GO:0006928)|extracellular matrix organization (GO:0030198)|heterophilic cell-cell adhesion (GO:0007157)|inflammatory response (GO:0006954)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of T cell proliferation (GO:0042102)|receptor clustering (GO:0043113)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)|T cell activation via T cell receptor contact with antigen bound to MHC molecule on antigen presenting cell (GO:0002291)	cell surface (GO:0009986)|cell-cell junction (GO:0005911)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|integrin alphaL-beta2 complex (GO:0034687)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cell adhesion molecule binding (GO:0050839)|ICAM-3 receptor activity (GO:0030369)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(10)|kidney(4)|large_intestine(12)|lung(32)|ovary(3)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	76					Antithymocyte globulin(DB00098)|Efalizumab(DB00095)|Lovastatin(DB00227)	CAGCAGGGTGCGTGCTGGGCT	0.617																																					NSCLC(110;1462 1641 3311 33990 49495)												0													60.0	55.0	56.0					16																	30500480		2197	4300	6497	SO:0001627	intron_variant	0				CCDS32433.1, CCDS45461.1	16p13.1-p11	2010-03-23				ENSG00000005844		"""CD molecules"", ""Integrins"""	6148	protein-coding gene	gene with protein product		153370		CD11A		3284962	Standard	NM_002209		Approved	LFA-1	uc002dyi.4	P20701		ENST00000356798.6:c.1080+4C>T	16.37:g.30500480C>T			O43746|Q45H73|Q96HB1|Q9UBC8	RNA	SNP	-	NULL	ENST00000356798.6	37	NULL	CCDS32433.1	16																																																																																			RP11-297C4.2	-	-	ENSG00000261346		0.617	ITGAL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000261346	Clone_based_vega_gene	protein_coding	OTTHUMT00000434508.2	-	0.00	49	0	C			30500480	-1	tier1	-	no_errors	ENST00000569459	ensembl	human	known	74_37	rna	9.76	37	4	SNP	0.000	T
EPHA10	284656	genome.wustl.edu	37	1	38185090	38185090	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr1:38185090G>T	ENST00000373048.4	-	15	2751	c.2752C>A	c.(2752-2754)Ccc>Acc	p.P918T	EPHA10_ENST00000330210.7_Missense_Mutation_p.P413T|EPHA10_ENST00000446149.2_5'UTR|EPHA10_ENST00000427468.2_Missense_Mutation_p.P918T|EPHA10_ENST00000540011.1_Intron	NM_001099439.1	NP_001092909.1	Q5JZY3	EPHAA_HUMAN	EPH receptor A10	918					ephrin receptor signaling pathway (GO:0048013)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|transmembrane-ephrin receptor activity (GO:0005005)			NS(2)|breast(4)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(4)|lung(13)|prostate(3)|skin(8)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	50	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				ACGTACCTGGGACAGGTAGTC	0.632																																																	0													26.0	32.0	30.0					1																	38185090		2046	4178	6224	SO:0001583	missense	0			AK090974	CCDS425.1, CCDS41305.1	1p34.3	2013-02-11			ENSG00000183317	ENSG00000183317		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	19987	protein-coding gene	gene with protein product		611123				12477932	Standard	NM_001099439		Approved	FLJ16103, FLJ33655	uc009vvi.3	Q5JZY3	OTTHUMG00000004325	ENST00000373048.4:c.2752C>A	1.37:g.38185090G>T	ENSP00000362139:p.Pro918Thr		A4FU89|J3KPB5|Q6NW42	Missense_Mutation	SNP	pirsf_Tyr_kinase_ephrin_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ephrin_rcpt_lig-bd_dom,pfam_Prot_kinase_dom,pfam_Fibronectin_type3,pfam_SAM_type1,pfam_SAM_2,superfamily_Galactose-bd-like,superfamily_Kinase-like_dom,superfamily_SAM/pointed,superfamily_Fibronectin_type3,superfamily_Growth_fac_rcpt_N_dom,smart_Ephrin_rcpt_lig-bd_dom,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_SAM,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_SAM,pfscan_Prot_kinase_dom	p.P918T	ENST00000373048.4	37	c.2752	CCDS41305.1	1	.	.	.	.	.	.	.	.	.	.	G	10.88	1.476643	0.26511	.	.	ENSG00000183317	ENST00000330210;ENST00000427468;ENST00000373048	T;T;T	0.62364	0.03;0.03;0.03	5.04	3.1	0.35709	Protein kinase-like domain (1);	1.057850	0.07544	N	0.914294	T	0.50171	0.1600	N	0.19112	0.55	0.80722	D	1	B	0.15141	0.012	B	0.18871	0.023	T	0.11542	-1.0583	10	0.35671	T	0.21	.	12.748	0.57291	0.0:0.3351:0.6649:0.0	.	918	Q5JZY3	EPHAA_HUMAN	T	413;918;918	ENSP00000330379:P413T;ENSP00000397746:P918T;ENSP00000362139:P918T	ENSP00000330379:P413T	P	-	1	0	EPHA10	37957677	0.309000	0.24518	1.000000	0.80357	0.496000	0.33645	0.325000	0.19628	0.606000	0.29965	0.491000	0.48974	CCC	EPHA10	-	pirsf_Tyr_kinase_ephrin_rcpt,superfamily_Kinase-like_dom	ENSG00000183317		0.632	EPHA10-003	KNOWN	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	EPHA10	HGNC	protein_coding	OTTHUMT00000012497.2		0.00	20	0	G	NM_173641		38185090	-1			no_errors	ENST00000427468	ensembl	human	known	74_37	missense	11.43	31	4	SNP	1.000	T
ERVW-1	30816	genome.wustl.edu	37	7	92099506	92099506	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr7:92099506C>A	ENST00000493463.2	-	1	1113	c.190G>T	c.(190-192)Gcc>Tcc	p.A64S	AC007566.10_ENST00000427458.1_RNA|ERVW-1_ENST00000604270.1_Intron|ERVW-1_ENST00000603053.1_Missense_Mutation_p.A64S	NM_014590.3	NP_055405.3	Q9UQF0	SYCY1_HUMAN	endogenous retrovirus group W, member 1	64					anatomical structure morphogenesis (GO:0009653)|syncytium formation (GO:0006949)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|viral envelope (GO:0019031)				endometrium(1)|large_intestine(1)|lung(15)	17						tgggtgtgggcagtgaaggtg	0.473																																																	0													84.0	90.0	88.0					7																	92099506		2203	4300	6503	SO:0001583	missense	0			AF208161	CCDS5626.1	7q21.2	2011-06-16	2011-05-05	2011-05-05	ENSG00000242950	ENSG00000242950			13525	other	endogenous retrovirus	"""envelope protein"", ""HERV-W Env glycoprotein"", ""enverin"", ""syncytin-1"", ""HERV-tryptophan envelope protein"", ""HERV-W{7q21.1} provirus ancestral Env polyprotein"", ""HERV-7q envelope protein"", ""envelope glycoprotein"", ""syncytin"""	604659	"""endogenous retroviral family W, env(C7), member 1"""	ERVWE1		9835022, 9882319, 21542922	Standard	NM_001130925		Approved	HERV-W, HERV-W-ENV, HERVW, HERV-7q	uc022ahe.1	Q9UQF0	OTTHUMG00000131249	ENST00000493463.2:c.190G>T	7.37:g.92099506C>A	ENSP00000419945:p.Ala64Ser		B2RPD4|O95244|O95245|Q8NHY7|Q9NRZ2|Q9NZG3	Missense_Mutation	SNP	pfam_TLV/ENV_coat_polyprotein	p.A64S	ENST00000493463.2	37	c.190	CCDS5626.1	7	.	.	.	.	.	.	.	.	.	.	C	9.583	1.124022	0.20959	.	.	ENSG00000242950	ENST00000493463	T	0.19669	2.13	0.0465	0.0465	0.14256	.	.	.	.	.	T	0.08447	0.0210	N	0.08118	0	0.09310	N	1	.	.	.	.	.	.	T	0.39860	-0.9593	6	0.16896	T	0.51	.	.	.	.	.	.	.	.	S	64	ENSP00000419945:A64S	ENSP00000419945:A64S	A	-	1	0	ERVW-1	91937442	0.638000	0.27225	0.393000	0.26258	0.397000	0.30659	0.145000	0.16157	0.132000	0.18615	0.134000	0.15878	GCC	ERVW-1	-	NULL	ENSG00000242950		0.473	ERVW-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ERVW-1	HGNC	protein_coding	OTTHUMT00000254009.2		0.00	19	0	C	NM_014590		92099506	-1			no_errors	ENST00000493463	ensembl	human	known	74_37	missense	5.45	190	11	SNP	0.421	A
EXTL3	2137	genome.wustl.edu	37	8	28608307	28608307	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr8:28608307C>T	ENST00000220562.4	+	7	3586	c.2684C>T	c.(2683-2685)aCg>aTg	p.T895M	EXTL3_ENST00000519886.1_Intron|EXTL3_ENST00000523149.1_Missense_Mutation_p.T511M	NM_001440.2	NP_001431.1	O43909	EXTL3_HUMAN	exostosin-like glycosyltransferase 3	895					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|positive regulation of cell growth (GO:0030307)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|intrinsic component of endoplasmic reticulum membrane (GO:0031227)	glucuronyl-galactosyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase activity (GO:0001888)|metal ion binding (GO:0046872)			biliary_tract(1)|endometrium(3)|kidney(2)|large_intestine(15)|lung(8)|ovary(1)|prostate(2)|skin(2)|soft_tissue(1)|urinary_tract(1)	36		Ovarian(32;0.069)		KIRC - Kidney renal clear cell carcinoma(542;0.107)|Kidney(114;0.129)|Colorectal(74;0.228)		CTCCTGTACACGCAGTTCAGG	0.562																																																	0													209.0	158.0	175.0					8																	28608307		2203	4300	6503	SO:0001583	missense	0			U76188	CCDS6070.1	8p22-p12	2013-03-01	2013-03-01		ENSG00000012232	ENSG00000012232	2.4.1.223	"""Exostosin glycosyltransferase family"""	3518	protein-coding gene	gene with protein product	"""REG receptor"", ""glucuronyl-galactosyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase"""	605744	"""exostoses (multiple)-like 3"""			9479495, 9450183, 11257457	Standard	NM_001440		Approved	botv, REGR	uc003xgz.2	O43909	OTTHUMG00000102146	ENST00000220562.4:c.2684C>T	8.37:g.28608307C>T	ENSP00000220562:p.Thr895Met		D3DST8|O00225|Q53XT3	Missense_Mutation	SNP	pfam_HexNAc_Trfase_a,pfam_Exostosin	p.T895M	ENST00000220562.4	37	c.2684	CCDS6070.1	8	.	.	.	.	.	.	.	.	.	.	C	31	5.066784	0.93898	.	.	ENSG00000012232	ENST00000523149;ENST00000220562	D;D	0.86432	-2.12;-2.12	5.61	5.61	0.85477	EXTL2, alpha-1,4-N-acetylhexosaminyltransferase (1);	0.000000	0.85682	D	0.000000	D	0.94248	0.8153	M	0.83852	2.665	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.94543	0.7747	10	0.87932	D	0	-23.1011	19.6401	0.95754	0.0:1.0:0.0:0.0	.	895	O43909	EXTL3_HUMAN	M	511;895	ENSP00000428691:T511M;ENSP00000220562:T895M	ENSP00000220562:T895M	T	+	2	0	EXTL3	28664226	1.000000	0.71417	0.953000	0.39169	0.964000	0.63967	7.574000	0.82434	2.643000	0.89663	0.555000	0.69702	ACG	EXTL3	-	pfam_HexNAc_Trfase_a	ENSG00000012232		0.562	EXTL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EXTL3	HGNC	protein_coding	OTTHUMT00000219987.3		0.00	32	0	C	NM_001440		28608307	+1			no_errors	ENST00000220562	ensembl	human	known	74_37	missense	7.69	24	2	SNP	1.000	T
FAM154B	283726	genome.wustl.edu	37	15	82575497	82575498	+	3'UTR	INS	-	-	T	rs142677476|rs72410475	byFrequency	TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr15:82575497_82575498insT	ENST00000339465.5	+	0	1360_1361				FAM154B_ENST00000427381.2_3'UTR|FAM154B_ENST00000565501.1_3'UTR	NM_001008226.1	NP_001008227.1	Q658L1	F154B_HUMAN	family with sequence similarity 154, member B											autonomic_ganglia(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(9)|skin(2)	19						atgatataataaatcatttttt	0.203																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AL833762	CCDS32310.1	15q25.2	2008-02-21				ENSG00000188659			33727	protein-coding gene	gene with protein product							Standard	XM_005254317		Approved	DKFZp666G057	uc002bgv.3	Q658L1		ENST00000339465.5:c.*95->T	15.37:g.82575497_82575498insT			B4E2M2	RNA	INS	-	NULL	ENST00000339465.5	37	NULL	CCDS32310.1	15																																																																																			FAM154B	-	-	ENSG00000188659		0.203	FAM154B-001	KNOWN	basic|CCDS	protein_coding	FAM154B	HGNC	protein_coding	OTTHUMT00000419644.1		0.00	23	0	-	NM_001008226		82575498	+1	tier1		no_errors	ENST00000565501	ensembl	human	known	74_37	rna	12.50	14	2	INS	0.000:0.000	T
ERICH6	131831	genome.wustl.edu	37	3	150396288	150396288	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr3:150396288T>C	ENST00000295910.6	-	10	1217	c.1165A>G	c.(1165-1167)Aaa>Gaa	p.K389E	FAM194A_ENST00000491361.1_Missense_Mutation_p.K243E	NM_152394.3	NP_689607.2														NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(10)|lung(14)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	38						ATTATCTGTTTTTCTGGAATA	0.289																																																	0													67.0	64.0	65.0					3																	150396288		2201	4290	6491	SO:0001583	missense	0																														ENST00000295910.6:c.1165A>G	3.37:g.150396288T>C	ENSP00000295910:p.Lys389Glu			Missense_Mutation	SNP	NULL	p.K389E	ENST00000295910.6	37	c.1165	CCDS3151.2	3	.	.	.	.	.	.	.	.	.	.	T	1.134	-0.651637	0.03506	.	.	ENSG00000163645	ENST00000295910;ENST00000491361;ENST00000313811	T;T	0.14144	2.75;2.53	3.85	1.29	0.21616	.	0.905682	0.09278	N	0.824229	T	0.12433	0.0302	L	0.56769	1.78	0.09310	N	1	P	0.36535	0.557	B	0.39258	0.295	T	0.26326	-1.0106	10	0.06757	T	0.87	-3.1228	4.9757	0.14138	0.0:0.1027:0.1847:0.7126	.	389	Q7L0X2	F194A_HUMAN	E	389;243;347	ENSP00000295910:K389E;ENSP00000419366:K243E	ENSP00000295910:K389E	K	-	1	0	FAM194A	151878978	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	0.047000	0.14056	0.149000	0.19098	-0.472000	0.04984	AAA	FAM194A	-	NULL	ENSG00000163645		0.289	FAM194A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM194A	HGNC	protein_coding	OTTHUMT00000257666.1	-	0.00	28	0	T			150396288	-1	tier1	-	no_errors	ENST00000295910	ensembl	human	known	74_37	missense	12.73	48	7	SNP	0.000	C
FAM205A	259308	genome.wustl.edu	37	9	34723557	34723557	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr9:34723557T>C	ENST00000378788.3	-	4	3719	c.3680A>G	c.(3679-3681)aAa>aGa	p.K1227R		NM_001141917.1	NP_001135389.1	Q6ZU69	F205A_HUMAN	family with sequence similarity 205, member A	1227						integral component of membrane (GO:0016021)|nucleus (GO:0005634)		p.K1227R(2)		breast(1)|endometrium(2)|kidney(1)	4						CCCTTTGCCTTTTGTCTTGGG	0.473																																																	2	Substitution - Missense(2)	endometrium(2)											32.0	24.0	26.0					9																	34723557		692	1591	2283	SO:0001583	missense	0				CCDS55305.1	9p13.3	2014-05-16			ENSG00000205108	ENSG00000205108			41911	protein-coding gene	gene with protein product							Standard	NM_001141917		Approved	C9orf144B	uc011lor.2	Q6ZU69	OTTHUMG00000000448	ENST00000378788.3:c.3680A>G	9.37:g.34723557T>C	ENSP00000417711:p.Lys1227Arg		A8MVW7	Missense_Mutation	SNP	NULL	p.K1227R	ENST00000378788.3	37	c.3680	CCDS55305.1	9	.	.	.	.	.	.	.	.	.	.	T	15.16	2.751969	0.49362	.	.	ENSG00000205108	ENST00000378788	T	0.34275	1.37	3.77	3.77	0.43336	.	.	.	.	.	T	0.51618	0.1685	L	0.57536	1.79	0.09310	N	1	D	0.89917	1.0	D	0.67725	0.953	T	0.33111	-0.9881	9	0.66056	D	0.02	.	9.0558	0.36405	0.0:0.0:0.0:1.0	.	1227	Q6ZU69	F205A_HUMAN	R	1227	ENSP00000417711:K1227R	ENSP00000417711:K1227R	K	-	2	0	RP11-195F19.10	34713557	0.589000	0.26807	0.044000	0.18714	0.030000	0.12068	2.201000	0.42734	1.692000	0.51112	0.528000	0.53228	AAA	FAM205A	-	NULL	ENSG00000205108		0.473	FAM205A-001	NOVEL	basic|appris_principal|CCDS	protein_coding	FAM205A	HGNC	protein_coding	OTTHUMT00000001150.2		0.00	44	0	T	NM_001141917		34723557	-1			no_errors	ENST00000378788	ensembl	human	novel	74_37	missense	6.52	43	3	SNP	0.024	C
FAM219B	57184	genome.wustl.edu	37	15	75198407	75198407	+	Intron	SNP	A	A	G			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr15:75198407A>G	ENST00000357635.5	-	2	623				FAM219B_ENST00000563119.1_Intron|FAM219B_ENST00000565772.1_Intron|FAM219B_ENST00000563706.1_5'UTR|FAM219B_ENST00000457294.2_Intron	NM_020447.3	NP_065180.1	Q5XKK7	F219B_HUMAN	family with sequence similarity 219, member B																		CACTCACAGAACTCCCTTATT	0.468																																																	0																																										SO:0001627	intron_variant	0			AK000005	CCDS32295.1	15q23	2012-03-06	2012-03-06	2012-03-06	ENSG00000178761	ENSG00000178761			24695	protein-coding gene	gene with protein product			"""chromosome 15 open reading frame 17"""	C15orf17		11214971	Standard	NM_020447		Approved	FLJ00005	uc002azh.4	Q5XKK7	OTTHUMG00000172715	ENST00000357635.5:c.302+211T>C	15.37:g.75198407A>G			A8K4Q5|B4DK57|Q9NXY0	RNA	SNP	-	NULL	ENST00000357635.5	37	NULL	CCDS32295.1	15																																																																																			FAM219B	-	-	ENSG00000178761		0.468	FAM219B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM219B	HGNC	protein_coding	OTTHUMT00000420165.1	-	0.00	11	0	A	NM_020447		75198407	-1	tier1	-	no_errors	ENST00000563706	ensembl	human	known	74_37	rna	66.67	2	4	SNP	0.001	G
FARP2	9855	genome.wustl.edu	37	2	242343285	242343285	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr2:242343285C>T	ENST00000264042.3	+	3	396	c.226C>T	c.(226-228)Cgt>Tgt	p.R76C	FARP2_ENST00000373287.4_Missense_Mutation_p.R76C|FARP2_ENST00000545004.1_Missense_Mutation_p.R76C	NM_014808.2	NP_055623.1	O94887	FARP2_HUMAN	FERM, RhoGEF and pleckstrin domain protein 2	76	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				actin cytoskeleton reorganization (GO:0031532)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|neuron remodeling (GO:0016322)|osteoclast differentiation (GO:0030316)|podosome assembly (GO:0071800)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|Rac protein signal transduction (GO:0016601)|regulation of integrin activation (GO:0033623)|regulation of Rac GTPase activity (GO:0032314)|semaphorin-plexin signaling pathway (GO:0071526)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extrinsic component of membrane (GO:0019898)	Rac guanyl-nucleotide exchange factor activity (GO:0030676)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(8)|lung(18)|ovary(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	43		all_cancers(19;4.88e-34)|all_epithelial(40;4.81e-14)|Breast(86;0.000141)|Renal(207;0.0143)|all_lung(227;0.0344)|Lung NSC(271;0.0886)|Ovarian(221;0.0905)|Esophageal squamous(248;0.131)|all_hematologic(139;0.182)|Melanoma(123;0.238)		Epithelial(32;1.81e-33)|all cancers(36;1.61e-30)|OV - Ovarian serous cystadenocarcinoma(60;6.83e-15)|Kidney(56;1.19e-08)|KIRC - Kidney renal clear cell carcinoma(57;8.98e-08)|BRCA - Breast invasive adenocarcinoma(100;1.49e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00125)|Colorectal(34;0.0199)|COAD - Colon adenocarcinoma(134;0.121)		AGTGTGGAAGCGTTTAAACCT	0.458																																																	0													134.0	122.0	126.0					2																	242343285		2203	4300	6503	SO:0001583	missense	0			AB018336	CCDS33424.1, CCDS63197.1	2q37.3	2013-01-10			ENSG00000006607	ENSG00000006607		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	16460	protein-coding gene	gene with protein product						9872452, 12351724	Standard	NM_001282984		Approved	KIAA0793, FIR, PLEKHC3, FRG	uc002wbi.2	O94887	OTTHUMG00000151574	ENST00000264042.3:c.226C>T	2.37:g.242343285C>T	ENSP00000264042:p.Arg76Cys		B7Z6J8|F5GZ84|Q53QM5|Q8WU27|Q9UFE7	Missense_Mutation	SNP	pfam_DH-domain,pfam_Pleckstrin_homology,pfam_FERM_PH-like_C,pfam_FERM_N,pfam_FERM_central,pfam_FERM-adjacent,superfamily_DH-domain,superfamily_FERM_central,smart_Band_41_domain,smart_DH-domain,smart_Pleckstrin_homology,pfscan_FERM_domain,pfscan_Pleckstrin_homology,pfscan_DH-domain,prints_Band_41_fam,prints_Ez/rad/moesin_like	p.R76C	ENST00000264042.3	37	c.226	CCDS33424.1	2	.	.	.	.	.	.	.	.	.	.	C	10.99	1.507607	0.27036	.	.	ENSG00000006607	ENST00000264042;ENST00000545004;ENST00000373287;ENST00000418082;ENST00000445489	T;T;T;T;T	0.78924	-1.22;-1.22;-1.22;-1.22;-1.22	4.62	4.62	0.57501	FERM, N-terminal (1);Band 4.1 domain (1);FERM domain (1);	0.487197	0.21559	N	0.072603	D	0.84257	0.5432	L	0.56280	1.765	0.18873	N	0.999985	D;D;D	0.76494	0.999;0.999;0.999	P;P;D	0.65874	0.9;0.866;0.939	T	0.77205	-0.2673	10	0.87932	D	0	.	14.7732	0.69696	0.0:1.0:0.0:0.0	.	76;76;76	O94887-2;F5GZ84;O94887	.;.;FARP2_HUMAN	C	76	ENSP00000264042:R76C;ENSP00000443876:R76C;ENSP00000362384:R76C;ENSP00000393376:R76C;ENSP00000388167:R76C	ENSP00000264042:R76C	R	+	1	0	FARP2	241991958	0.309000	0.24518	0.023000	0.16930	0.101000	0.19017	5.559000	0.67326	2.279000	0.76181	0.557000	0.71058	CGT	FARP2	-	pfam_FERM_N,smart_Band_41_domain,pfscan_FERM_domain,prints_Ez/rad/moesin_like	ENSG00000006607		0.458	FARP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FARP2	HGNC	protein_coding	OTTHUMT00000323153.1		0.00	39	0	C			242343285	+1			no_errors	ENST00000264042	ensembl	human	known	74_37	missense	5.56	51	3	SNP	0.060	T
FBN2	2201	genome.wustl.edu	37	5	127674677	127674677	+	Silent	SNP	G	G	A			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr5:127674677G>A	ENST00000508053.1	-	32	4394	c.3420C>T	c.(3418-3420)tgC>tgT	p.C1140C	FBN2_ENST00000508989.1_Silent_p.C1107C|FBN2_ENST00000507835.1_5'UTR|FBN2_ENST00000262464.4_Silent_p.C1140C			P35556	FBN2_HUMAN	fibrillin 2	1140	EGF-like 16; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				anatomical structure morphogenesis (GO:0009653)|bone trabecula formation (GO:0060346)|embryonic limb morphogenesis (GO:0030326)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|sequestering of TGFbeta in extracellular matrix (GO:0035583)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(37)|liver(1)|lung(89)|ovary(9)|pancreas(2)|prostate(6)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	197		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		CGAAGCACTCGCACTCAAAGC	0.488																																																	0													103.0	84.0	91.0					5																	127674677		2203	4300	6503	SO:0001819	synonymous_variant	0			U03272	CCDS34222.1	5q23-q31	2008-08-01	2008-08-01			ENSG00000138829			3604	protein-coding gene	gene with protein product	"""fibrillin 5"""	612570	"""congenital contractural arachnodactyly"""	CCA		1852206, 8120105	Standard	NM_001999		Approved	DA9	uc003kuu.3	P35556		ENST00000508053.1:c.3420C>T	5.37:g.127674677G>A			B4DU01|Q59ES6	Silent	SNP	pirsf_FBN,pfam_EGF-like_Ca-bd_dom,pfam_EG-like_dom,pfam_TB_dom,superfamily_TB_dom,superfamily_Cadherin-like,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,pfscan_EG-like_dom	p.C1140	ENST00000508053.1	37	c.3420	CCDS34222.1	5																																																																																			FBN2	-	pirsf_FBN,pfam_EGF-like_Ca-bd_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom	ENSG00000138829		0.488	FBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBN2	HGNC	protein_coding	OTTHUMT00000371618.2	-	0.00	21	0	G	NM_001999		127674677	-1	tier1	-	no_errors	ENST00000262464	ensembl	human	known	74_37	silent	19.51	33	8	SNP	0.867	A
FBXO7	25793	genome.wustl.edu	37	22	32889257	32889257	+	Missense_Mutation	SNP	G	G	C	rs375751043		TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr22:32889257G>C	ENST00000266087.7	+	7	1460	c.1133G>C	c.(1132-1134)cGt>cCt	p.R378P	FBXO7_ENST00000382058.3_Missense_Mutation_p.R299P|FBXO7_ENST00000397426.1_Missense_Mutation_p.R264P	NM_012179.3	NP_036311.3	Q9Y3I1	FBX7_HUMAN	F-box protein 7	378			R -> G (in PARK15; no effect on interaction with PARK2; dbSNP:rs71799110). {ECO:0000269|PubMed:18513678}.		cell death (GO:0008219)|mitochondrion degradation (GO:0000422)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of lymphocyte differentiation (GO:0045620)|protein targeting to mitochondrion (GO:0006626)|protein ubiquitination (GO:0016567)|regulation of protein stability (GO:0031647)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein complex (GO:0043234)|ubiquitin ligase complex (GO:0000151)	ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						TTATATCTGCGTGATTTTCGA	0.413																																																	0													140.0	125.0	130.0					22																	32889257		2203	4300	6503	SO:0001583	missense	0			AF129537	CCDS13907.1, CCDS58806.1	22q12.3	2013-09-19	2004-06-15		ENSG00000100225	ENSG00000100225		"""F-boxes /  ""other"""", ""Parkinson disease"""	13586	protein-coding gene	gene with protein product		605648	"""F-box only protein 7"""			10531035, 10531037, 19038853	Standard	NM_001257990		Approved	FBX7, Fbx, PARK15	uc003amq.3	Q9Y3I1	OTTHUMG00000030674	ENST00000266087.7:c.1133G>C	22.37:g.32889257G>C	ENSP00000266087:p.Arg378Pro		B4DNB3|B4DWX5|Q5TGC4|Q5TI86|Q96HM6|Q9UF21|Q9UKT2	Missense_Mutation	SNP	pfam_FP_dom,pfam_F-box_dom,superfamily_F-box_dom,smart_F-box_dom,pfscan_F-box_dom	p.R378P	ENST00000266087.7	37	c.1133	CCDS13907.1	22	.	.	.	.	.	.	.	.	.	.	G	25.2	4.614534	0.87359	.	.	ENSG00000100225	ENST00000266087;ENST00000382058;ENST00000397426	T;T;T	0.50548	0.74;0.74;0.74	6.08	6.08	0.98989	F-box domain, Skp2-like (1);	0.000000	0.85682	D	0.000000	T	0.73241	0.3562	M	0.81497	2.545	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;1.0	T	0.74112	-0.3770	10	0.72032	D	0.01	-20.4576	20.6634	0.99662	0.0:0.0:1.0:0.0	.	378;299;378	A8K7F7;Q9Y3I1-2;Q9Y3I1	.;.;FBX7_HUMAN	P	378;299;264	ENSP00000266087:R378P;ENSP00000371490:R299P;ENSP00000380571:R264P	ENSP00000266087:R378P	R	+	2	0	FBXO7	31219257	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	7.521000	0.81832	2.894000	0.99253	0.655000	0.94253	CGT	FBXO7	-	superfamily_F-box_dom	ENSG00000100225		0.413	FBXO7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXO7	HGNC	protein_coding	OTTHUMT00000129001.1	-	0.00	56	0	G			32889257	+1	tier1	-	no_errors	ENST00000266087	ensembl	human	known	74_37	missense	47.27	29	26	SNP	1.000	C
FCRLA	84824	genome.wustl.edu	37	1	161680413	161680414	+	3'UTR	INS	-	-	A	rs573172596|rs112039702|rs77972815	byFrequency	TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr1:161680413_161680414insA	ENST00000470841.1	+	0	335_336				FCRLA_ENST00000236938.6_Intron|FCRLA_ENST00000309691.6_Intron|FCRLA_ENST00000367957.2_Intron|FCRLA_ENST00000546024.1_Intron|FCRLA_ENST00000367953.3_Intron|FCRLA_ENST00000367949.2_Intron|FCRLA_ENST00000367950.1_Intron|FCRLA_ENST00000294796.4_Intron|FCRLA_ENST00000540521.1_Intron|FCRLA_ENST00000367959.2_Intron|FCRLA_ENST00000350710.3_Intron|FCRLA_ENST00000540926.1_Intron|FCRLA_ENST00000349527.4_Intron			Q7L513	FCRLA_HUMAN	Fc receptor-like A						cell differentiation (GO:0030154)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)				breast(1)|kidney(12)|large_intestine(4)|lung(13)|prostate(1)|skin(2)|stomach(1)	34	all_cancers(52;2.55e-15)|all_hematologic(112;0.0359)		BRCA - Breast invasive adenocarcinoma(70;0.00301)			GGGTCTTTCCGAAAAAAAAAAA	0.455																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AF531423	CCDS30926.1, CCDS53415.1, CCDS53416.1, CCDS53417.1, CCDS53418.1, CCDS53419.1, CCDS53420.1	1q23.3	2014-01-28	2006-09-26	2006-09-26	ENSG00000132185	ENSG00000132185		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18504	protein-coding gene	gene with protein product		606891	"""Fc receptor-like and mucin-like 1"""	FCRLM1		11754007	Standard	NM_001184866		Approved	MGC4595, FCRLc2, FCRLb, FCRLc1, FCRLd, FCRLe, FCRL, FCRLa, FREB, FCRLX	uc001gbe.3	Q7L513	OTTHUMG00000034537	ENST00000470841.1:c.*333->A	1.37:g.161680424_161680424dupA			A0N0M1|A6NC03|A6NL20|F5H720|F8W743|G3V1J2|Q5VXA1|Q5VXA2|Q5VXA3|Q5VXA4|Q5VXB0|Q5VXB1|Q8NEW4|Q8WXH3|Q96PC6|Q96PJ0|Q96PJ1|Q96PJ2|Q96PJ4|Q9BR57	RNA	INS	-	NULL	ENST00000470841.1	37	NULL		1																																																																																			FCRLA	-	-	ENSG00000132185		0.455	FCRLA-009	KNOWN	basic	processed_transcript	FCRLA	HGNC	protein_coding	OTTHUMT00000083582.1		0.00	29	0	-	NM_032738		161680414	+1	tier1		no_errors	ENST00000470841	ensembl	human	known	74_37	rna	16.13	26	5	INS	0.003:0.001	A
FGGY	55277	genome.wustl.edu	37	1	60073514	60073514	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr1:60073514C>A	ENST00000303721.7	+	9	1117	c.943C>A	c.(943-945)Cct>Act	p.P315T	FGGY_ENST00000371210.1_Missense_Mutation_p.P16T|FGGY_ENST00000474476.1_3'UTR|FGGY_ENST00000371212.1_Missense_Mutation_p.P227T|FGGY_ENST00000371218.4_Missense_Mutation_p.P315T	NM_018291.3	NP_060761.3	Q96C11	FGGY_HUMAN	FGGY carbohydrate kinase domain containing	315					carbohydrate metabolic process (GO:0005975)|cell death (GO:0008219)|neuron cellular homeostasis (GO:0070050)		kinase activity (GO:0016301)|phosphotransferase activity, alcohol group as acceptor (GO:0016773)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(13)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	22	all_cancers(7;7.36e-05)					CGTCTGGGGGCCTTATTTCTC	0.463																																																	0													130.0	132.0	131.0					1																	60073514		2203	4300	6503	SO:0001583	missense	0				CCDS611.2, CCDS44155.1, CCDS58003.1, CCDS60155.1	1p32.1	2008-10-23			ENSG00000172456	ENSG00000172456			25610	protein-coding gene	gene with protein product		611370				17671248	Standard	NM_018291		Approved	FLJ10986	uc009wac.3	Q96C11	OTTHUMG00000008424	ENST00000303721.7:c.943C>A	1.37:g.60073514C>A	ENSP00000305922:p.Pro315Thr		B1AK92|B1AK93|B1AK94|B2RDR8|D3DQ56|Q9HA63|Q9NV20	Missense_Mutation	SNP	pfam_Carb_kinase_FGGY_C,pfam_Carb_kinase_FGGY_N,tigrfam_Carb_kinase_FGGY-rel	p.P315T	ENST00000303721.7	37	c.943	CCDS611.2	1	.	.	.	.	.	.	.	.	.	.	C	26.2	4.715873	0.89112	.	.	ENSG00000172456	ENST00000371218;ENST00000303721;ENST00000371212;ENST00000371210	D;D;D;D	0.85013	-1.93;-1.93;-1.93;-1.93	5.65	5.65	0.86999	Carbohydrate kinase, FGGY, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.93249	0.7849	M	0.85710	2.77	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;0.999;0.999;0.999	D	0.92947	0.6377	9	.	.	.	-15.6317	18.6545	0.91445	0.0:1.0:0.0:0.0	.	315;227;315;315	Q96C11-3;B1AK94;F2Z2V1;Q96C11	.;.;.;FGGY_HUMAN	T	315;315;227;16	ENSP00000360262:P315T;ENSP00000305922:P315T;ENSP00000360256:P227T;ENSP00000360254:P16T	.	P	+	1	0	FGGY	59846102	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.409000	0.73289	2.941000	0.99782	0.655000	0.94253	CCT	FGGY	-	pfam_Carb_kinase_FGGY_C,tigrfam_Carb_kinase_FGGY-rel	ENSG00000172456		0.463	FGGY-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FGGY	HGNC	protein_coding	OTTHUMT00000023210.2	-	0.00	74	0	C	NM_001113411		60073514	+1	tier1	-	no_errors	ENST00000303721	ensembl	human	known	74_37	missense	43.04	45	34	SNP	1.000	A
FIGN	55137	genome.wustl.edu	37	2	164467538	164467538	+	Silent	SNP	C	C	T	rs202236615		TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr2:164467538C>T	ENST00000333129.3	-	3	1118	c.804G>A	c.(802-804)ccG>ccA	p.P268P	FIGN_ENST00000409634.1_Intron|FIGN_ENST00000482917.1_5'Flank	NM_018086.2	NP_060556.2	Q5HY92	FIGN_HUMAN	fidgetin	268	Pro-rich.				mitotic nuclear division (GO:0007067)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nuclear matrix (GO:0016363)	ATP binding (GO:0005524)			breast(2)|endometrium(3)|kidney(2)|large_intestine(13)|lung(23)|ovary(1)|prostate(2)|skin(1)	47						AAGGCGGAGGCGGTGCCCCCC	0.602																																																	0								C		1,4027		0,1,2013	35.0	39.0	38.0		804	-2.5	0.9	2		38	1,8319		0,1,4159	no	coding-synonymous	FIGN	NM_018086.2		0,2,6172	TT,TC,CC		0.012,0.0248,0.0162		268/760	164467538	2,12346	2014	4160	6174	SO:0001819	synonymous_variant	0			AK001267	CCDS2221.2	2q24	2010-04-21			ENSG00000182263	ENSG00000182263		"""ATPases / AAA-type"""	13285	protein-coding gene	gene with protein product		605295				11017077	Standard	XM_005246661		Approved		uc002uck.1	Q5HY92	OTTHUMG00000074059	ENST00000333129.3:c.804G>A	2.37:g.164467538C>T			B3KWM0|Q9H6M5|Q9NVZ9	Silent	SNP	pfam_ATPase_AAA_core,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.P268	ENST00000333129.3	37	c.804	CCDS2221.2	2																																																																																			FIGN	-	NULL	ENSG00000182263		0.602	FIGN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FIGN	HGNC	protein_coding	OTTHUMT00000157220.2	-	0.00	20	0	C	NM_018086		164467538	-1	tier1	rs202236615	no_errors	ENST00000333129	ensembl	human	known	74_37	silent	40.54	22	15	SNP	0.948	T
ZNF473	25888	genome.wustl.edu	37	19	50554114	50554114	+	IGR	SNP	T	T	G			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr19:50554114T>G	ENST00000595661.1	+	0	4828				CTD-2126E3.1_ENST00000527209.1_RNA|CTD-2126E3.3_ENST00000599410.1_RNA|ZNF473_ENST00000601364.1_Intron|CTD-2126E3.3_ENST00000599914.1_RNA			Q8WTR7	ZN473_HUMAN	zinc finger protein 473						gene expression (GO:0010467)|histone mRNA 3'-end processing (GO:0006398)|histone mRNA metabolic process (GO:0008334)|mRNA 3'-end processing (GO:0031124)|regulation of transcription, DNA-templated (GO:0006355)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	Cajal body (GO:0015030)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(9)|liver(2)|lung(12)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	37		all_neural(266;0.0459)|Ovarian(192;0.0728)		GBM - Glioblastoma multiforme(134;0.00111)|OV - Ovarian serous cystadenocarcinoma(262;0.0058)		TCAGACTCCCTGATGAACTAC	0.672																																																	0																																										SO:0001628	intergenic_variant	0			AB032967	CCDS33077.1	19q13.33	2013-01-08						"""Zinc fingers, C2H2-type"", ""-"""	23239	protein-coding gene	gene with protein product						11782445	Standard	NM_015428		Approved	KIAA1141, DKFZP434N043, HZFP100	uc002prn.3	Q8WTR7			19.37:g.50554114T>G			A8K8T7|Q9ULS9|Q9Y4Q7	RNA	SNP	-	NULL	ENST00000595661.1	37	NULL	CCDS33077.1	19																																																																																			CTD-2126E3.1	-	-	ENSG00000204666		0.672	ZNF473-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	FLJ26850	Clone_based_vega_gene	protein_coding	OTTHUMT00000464833.1	-	0.00	80	0	T	XM_046390		50554114	+1	tier1	-	no_errors	ENST00000527209	ensembl	human	known	74_37	rna	6.06	62	4	SNP	0.192	G
FOXG1	2290	genome.wustl.edu	37	14	29237633	29237633	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr14:29237633C>T	ENST00000313071.4	+	1	1347	c.1148C>T	c.(1147-1149)gCg>gTg	p.A383V	FOXG1_ENST00000382535.3_Missense_Mutation_p.A383V	NM_005249.4	NP_005240.3	P55316	FOXG1_HUMAN	forkhead box G1	383	Interaction with KDM5B.				aging (GO:0007568)|axon midline choice point recognition (GO:0016199)|brain development (GO:0007420)|dorsal/ventral pattern formation (GO:0009953)|inner ear morphogenesis (GO:0042472)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron fate determination (GO:0048664)|positive regulation of cell cycle (GO:0045787)|positive regulation of neuroblast proliferation (GO:0002052)|pyramidal neuron migration (GO:0021852)|regulation of mitotic cell cycle (GO:0007346)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(9)|lung(23)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(2)	43			LUAD - Lung adenocarcinoma(48;0.011)|Lung(238;0.0575)	GBM - Glioblastoma multiforme(265;0.00413)		ACGGCCGCCGCGCTAGCCGCC	0.692																																																	0													40.0	35.0	36.0					14																	29237633		2202	4297	6499	SO:0001583	missense	0				CCDS9636.1	14q11-q13	2007-10-05	2007-05-16	2007-05-16	ENSG00000176165	ENSG00000176165		"""Forkhead boxes"""	3811	protein-coding gene	gene with protein product		164874	"""forkhead box G1B"", ""forkhead box G1C"", ""forkhead box G1A"""	FKHL2, FOXG1B, FKHL4, FKH2, FKHL1, FOXG1C, FKHL3, FOXG1A		7959731, 17260156	Standard	NM_005249		Approved	HFK2, QIN, BF1, HFK1, HFK3, HBF-3	uc001wqe.4	P55316	OTTHUMG00000140187	ENST00000313071.4:c.1148C>T	14.37:g.29237633C>T	ENSP00000339004:p.Ala383Val		A6NFY2|P55315|Q14488|Q86XT7	Missense_Mutation	SNP	pfam_TF_fork_head,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head	p.A383V	ENST00000313071.4	37	c.1148	CCDS9636.1	14	.	.	.	.	.	.	.	.	.	.	C	14.55	2.567748	0.45798	.	.	ENSG00000176165	ENST00000382535;ENST00000313071	D;D	0.93488	-3.23;-3.23	4.21	4.21	0.49690	.	0.063200	0.64402	U	0.000007	D	0.85296	0.5664	N	0.19112	0.55	0.58432	D	0.999998	P	0.42375	0.778	B	0.26864	0.074	D	0.87401	0.2369	10	0.49607	T	0.09	.	16.9273	0.86180	0.0:1.0:0.0:0.0	.	383	P55316	FOXG1_HUMAN	V	383	ENSP00000371975:A383V;ENSP00000339004:A383V	ENSP00000339004:A383V	A	+	2	0	FOXG1	28307384	1.000000	0.71417	1.000000	0.80357	0.929000	0.56500	4.828000	0.62730	2.042000	0.60477	0.491000	0.48974	GCG	FOXG1	-	NULL	ENSG00000176165		0.692	FOXG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOXG1	HGNC	protein_coding	OTTHUMT00000276559.3	-	0.00	33	0	C			29237633	+1	tier1	-	no_errors	ENST00000313071	ensembl	human	known	74_37	missense	19.05	17	4	SNP	1.000	T
FREM3	166752	genome.wustl.edu	37	4	144620576	144620576	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr4:144620576G>A	ENST00000329798.5	-	1	1252	c.1253C>T	c.(1252-1254)cCc>cTc	p.P418L	RP13-578N3.3_ENST00000499587.2_RNA	NM_001168235.1	NP_001161707.1	P0C091	FREM3_HUMAN	FRAS1 related extracellular matrix 3	418					cell adhesion (GO:0007155)|cell communication (GO:0007154)	basement membrane (GO:0005604)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)			NS(1)|breast(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|lung(2)|prostate(1)	8						GAAGGCAAAGGGGTCTGAGGC	0.567																																																	0													40.0	34.0	36.0					4																	144620576		692	1591	2283	SO:0001583	missense	0			BX091796	CCDS54808.1	4q31.21	2011-06-09			ENSG00000183090	ENSG00000183090			25172	protein-coding gene	gene with protein product		608946				15345741	Standard	NM_001168235		Approved		uc021xsj.1	P0C091	OTTHUMG00000161577	ENST00000329798.5:c.1253C>T	4.37:g.144620576G>A	ENSP00000332886:p.Pro418Leu			Missense_Mutation	SNP	pfam_Calx_beta,superfamily_Cadherin-like,smart_Calx_beta	p.P418L	ENST00000329798.5	37	c.1253	CCDS54808.1	4	.	.	.	.	.	.	.	.	.	.	G	14.40	2.523568	0.44866	.	.	ENSG00000183090	ENST00000329798	T	0.30182	1.54	4.03	3.19	0.36642	.	0.452102	0.21251	N	0.077650	T	0.44477	0.1295	M	0.81682	2.555	0.36060	D	0.841415	.	.	.	.	.	.	T	0.53165	-0.8477	8	0.51188	T	0.08	-10.6989	6.0202	0.19625	0.1011:0.0:0.7116:0.1874	.	.	.	.	L	418	ENSP00000332886:P418L	ENSP00000332886:P418L	P	-	2	0	FREM3	144840026	1.000000	0.71417	0.474000	0.27266	0.723000	0.41478	5.553000	0.67287	0.906000	0.36621	0.563000	0.77884	CCC	FREM3	-	NULL	ENSG00000183090		0.567	FREM3-001	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	FREM3	HGNC	protein_coding	OTTHUMT00000365391.1	-	0.00	79	0	G	XM_094074		144620576	-1	tier1	-	no_errors	ENST00000329798	ensembl	human	putative	74_37	missense	19.35	75	18	SNP	0.499	A
FRG1B	284802	genome.wustl.edu	37	20	29631566	29631566	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr20:29631566A>C	ENST00000278882.3	+	7	742	c.362A>C	c.(361-363)aAg>aCg	p.K121T	FRG1B_ENST00000358464.4_Missense_Mutation_p.K121T			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B	121										endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						AAAGAAACCAAGAAAAAAGAT	0.333																																																	0																																										SO:0001583	missense	0					20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.362A>C	20.37:g.29631566A>C	ENSP00000278882:p.Lys121Thr		C4AME5	Missense_Mutation	SNP	pfam_FRG1,superfamily_Actin_cross-linking	p.K121T	ENST00000278882.3	37	c.362		20	.	.	.	.	.	.	.	.	.	.	N	2.591	-0.295272	0.05532	.	.	ENSG00000149531	ENST00000278882;ENST00000358464	.	.	.	2.03	0.899	0.19271	.	0.149876	0.64402	N	0.000018	T	0.35682	0.0940	.	.	.	0.32238	N	0.573042	P	0.48998	0.918	P	0.47299	0.543	T	0.42916	-0.9423	8	0.33141	T	0.24	.	6.5494	0.22425	0.7531:0.2469:0.0:0.0	.	121	Q9BZ01	FRG1B_HUMAN	T	121	.	ENSP00000278882:K121T	K	+	2	0	FRG1B	28245227	1.000000	0.71417	1.000000	0.80357	0.499000	0.33736	2.600000	0.46240	0.237000	0.21200	-0.474000	0.04947	AAG	FRG1B	-	pfam_FRG1	ENSG00000149531		0.333	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	FRG1B	HGNC	protein_coding	OTTHUMT00000078494.2		0.00	39	0	A	NR_003579		29631566	+1			no_errors	ENST00000278882	ensembl	human	known	74_37	missense	6.45	58	4	SNP	0.994	C
FRYL	285527	genome.wustl.edu	37	4	48591842	48591842	+	Silent	SNP	T	T	C			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr4:48591842T>C	ENST00000503238.1	-	15	1559	c.1560A>G	c.(1558-1560)agA>agG	p.R520R	FRYL_ENST00000264319.7_5'UTR|FRYL_ENST00000537810.1_Silent_p.R520R|FRYL_ENST00000506685.1_Silent_p.R226R|FRYL_ENST00000507711.1_Silent_p.R520R|FRYL_ENST00000358350.4_Silent_p.R520R			O94915	FRYL_HUMAN	FRY-like	520					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)					breast(2)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(21)|lung(38)|ovary(1)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	91						TGTCCAAATGTCTGAGGATGC	0.358																																																	0													188.0	174.0	178.0					4																	48591842		1874	4111	5985	SO:0001819	synonymous_variant	0			AL833170	CCDS43227.1	4p12	2011-08-03	2006-11-17	2005-11-24	ENSG00000075539	ENSG00000075539			29127	protein-coding gene	gene with protein product			"""KIAA0826"", ""furry homolog-like (Drosophila)"""	KIAA0826		10048485	Standard	NM_015030		Approved	DKFZp686E205	uc003gyh.1	O94915	OTTHUMG00000160608	ENST00000503238.1:c.1560A>G	4.37:g.48591842T>C			O95640|Q8WTZ5|Q9NT40	Silent	SNP	superfamily_ARM-type_fold	p.R520	ENST00000503238.1	37	c.1560	CCDS43227.1	4																																																																																			FRYL	-	superfamily_ARM-type_fold	ENSG00000075539		0.358	FRYL-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FRYL	HGNC	protein_coding	OTTHUMT00000369265.2	-	0.00	60	0	T			48591842	-1	tier1	-	no_errors	ENST00000358350	ensembl	human	known	74_37	silent	32.61	31	15	SNP	0.929	C
DDX42	11325	genome.wustl.edu	37	17	61899383	61899383	+	IGR	SNP	G	G	T			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr17:61899383G>T	ENST00000578681.1	+	0	4337				FTSJ3_ENST00000427159.2_Missense_Mutation_p.A479E	NM_007372.2	NP_031398.2	Q86XP3	DDX42_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 42						protein localization (GO:0008104)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(12)|kidney(3)|large_intestine(6)|lung(12)|ovary(2)|prostate(2)|skin(3)	46						CCTGACTCCTGCCAGCTCCTC	0.532																																																	0													137.0	111.0	120.0					17																	61899383		2203	4300	6503	SO:0001628	intergenic_variant	0			BC015505	CCDS32704.1	17q23	2014-02-14	2013-05-13			ENSG00000198231		"""DEAD-boxes"""	18676	protein-coding gene	gene with protein product	"""splicing factor 3b, subunit 8"""	613369	"""DEAD (Asp-Glu-Ala-Asp) box polypeptide 42"""			10727850, 16397294	Standard	NM_007372		Approved	RNAHP, RHELP, SF3b125, SF3B8	uc002jbv.3	Q86XP3			17.37:g.61899383G>T			A6NML1|A8KA43|O75619|Q68G51|Q96BK1|Q96HR7|Q9Y3V8	Missense_Mutation	SNP	pfam_rRNA_MeTfrase_Spb1_C,pfam_rRNA_MeTrfase_FtsJ_dom,pfam_rRNA_MeTfrase_Spb1_DUF3381	p.A479E	ENST00000578681.1	37	c.1436	CCDS32704.1	17	.	.	.	.	.	.	.	.	.	.	G	6.835	0.523243	0.13066	.	.	ENSG00000108592	ENST00000427159	T	0.28666	1.6	5.21	5.21	0.72293	.	0.242522	0.33515	N	0.004836	T	0.16769	0.0403	N	0.22421	0.69	0.34224	D	0.675745	B	0.22276	0.067	B	0.15052	0.012	T	0.10965	-1.0607	10	0.02654	T	1	-15.9625	11.222	0.48860	0.0:0.0:0.8174:0.1826	.	479	Q8IY81	RRMJ3_HUMAN	E	479	ENSP00000396673:A479E	ENSP00000396673:A479E	A	-	2	0	FTSJ3	59253115	1.000000	0.71417	1.000000	0.80357	0.919000	0.55068	2.868000	0.48436	2.716000	0.92895	0.650000	0.86243	GCA	FTSJ3	-	NULL	ENSG00000108592		0.532	DDX42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FTSJ3	HGNC	protein_coding	OTTHUMT00000444368.1	-	0.00	31	0	G	NM_007372		61899383	-1	tier1	-	no_errors	ENST00000427159	ensembl	human	known	74_37	missense	6.78	55	4	SNP	1.000	T
FYCO1	79443	genome.wustl.edu	37	3	46016794	46016794	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr3:46016794G>T	ENST00000296137.2	-	5	537	c.332C>A	c.(331-333)tCc>tAc	p.S111Y	FYCO1_ENST00000535325.1_Missense_Mutation_p.S111Y	NM_024513.3	NP_078789.2	Q9BQS8	FYCO1_HUMAN	FYVE and coiled-coil domain containing 1	111	RUN. {ECO:0000255|PROSITE- ProRule:PRU00178}.				plus-end-directed vesicle transport along microtubule (GO:0072383)	autophagic vacuole (GO:0005776)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)	metal ion binding (GO:0046872)			NS(4)|breast(3)|central_nervous_system(1)|endometrium(11)|kidney(2)|large_intestine(9)|lung(17)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	54				BRCA - Breast invasive adenocarcinoma(193;0.00147)|KIRC - Kidney renal clear cell carcinoma(197;0.0272)|Kidney(197;0.0323)		GTGCACCAAGGAGTAGCGAAT	0.488																																																	0													164.0	130.0	142.0					3																	46016794		2203	4300	6503	SO:0001583	missense	0			AJ292348	CCDS2734.1	3p21.3	2008-02-05			ENSG00000163820	ENSG00000163820		"""Zinc fingers, FYVE domain containing"""	14673	protein-coding gene	gene with protein product		607182				11896456	Standard	NM_024513		Approved	FLJ13335, ZFYVE7	uc003cpb.5	Q9BQS8	OTTHUMG00000133447	ENST00000296137.2:c.332C>A	3.37:g.46016794G>T	ENSP00000296137:p.Ser111Tyr		B7ZKT7|Q3MJE6|Q86T41|Q86TB1|Q8TEF9|Q96IV5|Q9H8P9	Missense_Mutation	SNP	pfam_Znf_FYVE,pfam_Run,superfamily_GOLD,superfamily_Znf_FYVE_PHD,superfamily_Prefoldin,superfamily_tRNA-bd_arm,smart_Znf_FYVE,pfscan_GOLD,pfscan_Run,pfscan_Znf_FYVE-rel	p.S111Y	ENST00000296137.2	37	c.332	CCDS2734.1	3	.	.	.	.	.	.	.	.	.	.	G	24.2	4.510229	0.85282	.	.	ENSG00000163820	ENST00000296137;ENST00000535325	T;T	0.30448	1.53;1.53	5.69	5.69	0.88448	RUN (2);	0.000000	0.85682	D	0.000000	T	0.46386	0.1390	L	0.29908	0.895	0.58432	D	0.999992	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	T	0.43426	-0.9392	10	0.87932	D	0	-19.6544	17.9818	0.89144	0.0:0.0:1.0:0.0	.	111;111	B7ZKT7;Q9BQS8	.;FYCO1_HUMAN	Y	111	ENSP00000296137:S111Y;ENSP00000441178:S111Y	ENSP00000296137:S111Y	S	-	2	0	FYCO1	45991798	1.000000	0.71417	0.977000	0.42913	0.983000	0.72400	9.352000	0.97076	2.684000	0.91462	0.557000	0.71058	TCC	FYCO1	-	pfam_Run,pfscan_Run	ENSG00000163820		0.488	FYCO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FYCO1	HGNC	protein_coding	OTTHUMT00000257320.2		0.00	56	0	G	NM_024513		46016794	-1			no_errors	ENST00000535325	ensembl	human	known	74_37	missense	5.66	50	3	SNP	0.999	T
GABRA6	2559	genome.wustl.edu	37	5	161128522	161128522	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr5:161128522C>T	ENST00000274545.5	+	9	1538	c.1105C>T	c.(1105-1107)Cat>Tat	p.H369Y	GABRA6_ENST00000523217.1_Missense_Mutation_p.H359Y			Q16445	GBRA6_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha 6	369					gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	benzodiazepine receptor activity (GO:0008503)|chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)	p.H369Y(1)		breast(1)|central_nervous_system(2)|endometrium(6)|large_intestine(9)|liver(2)|lung(22)|ovary(7)|skin(6)|urinary_tract(2)	57	Renal(175;0.00259)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		Acamprosate(DB00659)|Alprazolam(DB00404)|Amobarbital(DB01351)|Amoxapine(DB00543)|Aprobarbital(DB01352)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Flumazenil(DB01205)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Thiopental(DB00599)|Topiramate(DB00273)|Triazolam(DB00897)	CTCCAAATATCATCTGAAGAA	0.378										TCGA Ovarian(5;0.080)																																							1	Substitution - Missense(1)	skin(1)											104.0	109.0	107.0					5																	161128522		2203	4300	6503	SO:0001583	missense	0				CCDS4356.1	5q34	2012-06-22			ENSG00000145863	ENSG00000145863		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4080	protein-coding gene	gene with protein product	"""GABA(A) receptor, alpha 6"""	137143				8020978	Standard	NM_000811		Approved		uc003lyu.2	Q16445	OTTHUMG00000130351	ENST00000274545.5:c.1105C>T	5.37:g.161128522C>T	ENSP00000274545:p.His369Tyr		A8K096|Q4VAV2	Missense_Mutation	SNP	pfam_Neur_chan_lig-bd,pfam_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,prints_GABAAa_rcpt,prints_GABAA_rcpt,prints_GABBAa6_rcpt,prints_Neur_channel,prints_GABBAg_rcpt,tigrfam_Neur_channel	p.H369Y	ENST00000274545.5	37	c.1105	CCDS4356.1	5	.	.	.	.	.	.	.	.	.	.	C	5.469	0.271617	0.10349	.	.	ENSG00000145863	ENST00000274545;ENST00000523217	D;D	0.83914	-1.78;-1.78	5.16	-0.862	0.10673	Neurotransmitter-gated ion-channel transmembrane domain (1);	0.571169	0.17860	N	0.159575	T	0.59128	0.2171	N	0.04959	-0.14	0.24253	N	0.99532	B	0.02656	0.0	B	0.12837	0.008	T	0.46938	-0.9155	10	0.30854	T	0.27	.	4.9722	0.14121	0.4759:0.2697:0.0:0.2544	.	369	Q16445	GBRA6_HUMAN	Y	369;359	ENSP00000274545:H369Y;ENSP00000430527:H359Y	ENSP00000274545:H369Y	H	+	1	0	GABRA6	161061100	0.710000	0.27896	0.635000	0.29338	0.943000	0.58893	1.108000	0.31123	0.013000	0.14918	0.655000	0.94253	CAT	GABRA6	-	superfamily_Neurotrans-gated_channel_TM,prints_GABBAa6_rcpt	ENSG00000145863		0.378	GABRA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GABRA6	HGNC	protein_coding	OTTHUMT00000252707.2		0.00	33	0	C			161128522	+1			no_errors	ENST00000274545	ensembl	human	known	74_37	missense	7.14	26	2	SNP	0.229	T
GBP7	388646	genome.wustl.edu	37	1	89618084	89618084	+	Silent	SNP	C	C	T			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr1:89618084C>T	ENST00000294671.2	-	5	630	c.492G>A	c.(490-492)gaG>gaA	p.E164E		NM_207398.2	NP_997281.2	Q8N8V2	GBP7_HUMAN	guanylate binding protein 7	164	GB1/RHD3-type G.|GTPase domain (Globular). {ECO:0000250}.					membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(9)|lung(5)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	27		Lung NSC(277;0.0908)		all cancers(265;0.00835)|Epithelial(280;0.0322)		CGCTGGAGTCCTCAACTTCAT	0.483																																																	0													149.0	139.0	142.0					1																	89618084		2203	4300	6503	SO:0001819	synonymous_variant	0			AK096141	CCDS720.1	1p22.2	2008-02-05			ENSG00000213512	ENSG00000213512			29606	protein-coding gene	gene with protein product		612468					Standard	NM_207398		Approved	FLJ38822, GBP4L	uc001dna.2	Q8N8V2	OTTHUMG00000010659	ENST00000294671.2:c.492G>A	1.37:g.89618084C>T				Silent	SNP	pfam_Guanylate-bd_N,pfam_Guanylate-bd_C,superfamily_Guanylate-bd_C,superfamily_P-loop_NTPase	p.E164	ENST00000294671.2	37	c.492	CCDS720.1	1																																																																																			GBP7	-	pfam_Guanylate-bd_N,superfamily_P-loop_NTPase	ENSG00000213512		0.483	GBP7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GBP7	HGNC	protein_coding	OTTHUMT00000029401.1	-	0.00	74	0	C	NM_207398		89618084	-1	tier1	-	no_errors	ENST00000294671	ensembl	human	known	74_37	silent	28.57	40	16	SNP	0.044	T
GNA13	10672	genome.wustl.edu	37	17	63049657	63049657	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr17:63049657A>G	ENST00000439174.2	-	2	718	c.473T>C	c.(472-474)aTa>aCa	p.I158T	GNA13_ENST00000541118.1_Missense_Mutation_p.I63T|RP11-583F2.5_ENST00000581796.1_RNA	NM_006572.4	NP_006563.2	Q14344	GNA13_HUMAN	guanine nucleotide binding protein (G protein), alpha 13	158					activation of phospholipase D activity (GO:0031584)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|blood coagulation (GO:0007596)|cell differentiation (GO:0030154)|cellular component movement (GO:0006928)|in utero embryonic development (GO:0001701)|patterning of blood vessels (GO:0001569)|platelet activation (GO:0030168)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of cell migration (GO:0030334)|regulation of cell shape (GO:0008360)|Rho protein signal transduction (GO:0007266)|signal transduction (GO:0007165)	brush border membrane (GO:0031526)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|heterotrimeric G-protein complex (GO:0005834)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	D5 dopamine receptor binding (GO:0031752)|G-protein beta/gamma-subunit complex binding (GO:0031683)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)|type 1 angiotensin receptor binding (GO:0031702)	p.I158K(1)		breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(14)|kidney(2)|large_intestine(4)|lung(6)|urinary_tract(1)	34						GGCATTCTGTATGCCGCTGTC	0.428																																																	1	Substitution - Missense(1)	haematopoietic_and_lymphoid_tissue(1)											99.0	102.0	101.0					17																	63049657		2203	4300	6503	SO:0001583	missense	0			L22075	CCDS11661.1, CCDS62302.1	17q24.1	2014-09-04			ENSG00000120063	ENSG00000120063			4381	protein-coding gene	gene with protein product		604406				7791744	Standard	NM_006572		Approved	G13, MGC46138	uc002jfc.3	Q14344	OTTHUMG00000179316	ENST00000439174.2:c.473T>C	17.37:g.63049657A>G	ENSP00000400717:p.Ile158Thr		B2R977|B7Z7R0|F5H1G8|Q8TD70	Missense_Mutation	SNP	pfam_Gprotein_alpha_su,pfam_Small_GTPase_ARF/SAR,superfamily_P-loop_NTPase,superfamily_GproteinA_insert,smart_Gprotein_alpha_su,prints_Gprotein_alpha_su,prints_Gprotein_alpha_12	p.I158T	ENST00000439174.2	37	c.473	CCDS11661.1	17	.	.	.	.	.	.	.	.	.	.	A	24.4	4.527374	0.85706	.	.	ENSG00000120063	ENST00000439174;ENST00000541118;ENST00000239138	D;D	0.90732	-2.72;-2.72	5.42	5.42	0.78866	G protein alpha subunit, helical insertion (2);	0.000000	0.85682	D	0.000000	D	0.95297	0.8474	M	0.81179	2.53	0.80722	D	1	D	0.71674	0.998	D	0.85130	0.997	D	0.95878	0.8896	10	0.87932	D	0	.	15.4962	0.75653	1.0:0.0:0.0:0.0	.	158	Q14344	GNA13_HUMAN	T	158;63;133	ENSP00000400717:I158T;ENSP00000439647:I63T	ENSP00000239138:I133T	I	-	2	0	GNA13	60480119	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	8.962000	0.93254	2.058000	0.61347	0.533000	0.62120	ATA	GNA13	-	pfam_Gprotein_alpha_su,superfamily_P-loop_NTPase,superfamily_GproteinA_insert,smart_Gprotein_alpha_su	ENSG00000120063		0.428	GNA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GNA13	HGNC	protein_coding	OTTHUMT00000445720.1		0.00	39	0	A	NM_006572		63049657	-1			no_errors	ENST00000439174	ensembl	human	known	74_37	missense	7.69	36	3	SNP	1.000	G
GOLGA2P5	55592	genome.wustl.edu	37	12	100561418	100561418	+	RNA	SNP	C	C	A			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr12:100561418C>A	ENST00000397112.4	-	0	599					NR_036632.1		Q9HBQ8	GGA2B_HUMAN								Golgi apparatus (GO:0005794)				large_intestine(1)|lung(3)	4						GCCTTGAAAACTGGATGGTGA	0.527																																																	0																																												0																															12.37:g.100561418C>A			Q9NSV2	Splice_Site	SNP	-	NULL	ENST00000397112.4	37	c.NULL		12																																																																																			GOLGA2B	-	-	ENSG00000238105		0.527	GOLGA2B-004	KNOWN	basic	processed_transcript	GOLGA2P5	Clone_based_vega_gene	pseudogene	OTTHUMT00000396439.2	-	0.00	79	0	C			100561418	-1	tier1	-	no_errors	ENST00000421840	ensembl	human	known	74_37	splice_site	5.71	66	4	SNP	0.827	A
GOLGB1	2804	genome.wustl.edu	37	3	121410616	121410616	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr3:121410616G>A	ENST00000340645.5	-	14	7705	c.7580C>T	c.(7579-7581)gCc>gTc	p.A2527V	GOLGB1_ENST00000393667.3_Missense_Mutation_p.A2532V	NM_001256487.1|NM_001256488.1|NM_004487.4	NP_001243416.1|NP_001243417.1|NP_004478.3	Q14789	GOGB1_HUMAN	golgin B1	2527					Golgi organization (GO:0007030)	cis-Golgi network (GO:0005801)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(2)|cervix(2)|endometrium(12)|kidney(3)|large_intestine(26)|liver(2)|lung(36)|ovary(7)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(13)	119				GBM - Glioblastoma multiforme(114;0.0989)		ATCTAGCTTGGCATTCTCAGA	0.398																																																	0													159.0	165.0	163.0					3																	121410616		2203	4300	6503	SO:0001583	missense	0			X75304	CCDS3004.1, CCDS58847.1, CCDS74989.1	3q13	2010-02-12	2010-02-12	2007-07-27	ENSG00000173230	ENSG00000173230			4429	protein-coding gene	gene with protein product	"""macrogolgin"", ""golgi integral membrane protein 1"""	602500	"""golgi autoantigen, golgin subfamily b, macrogolgin (with transmembrane signal), 1"", ""golgin B1, golgi integral membrane protein"""			7691276, 15004235	Standard	NM_001256486		Approved	GCP, GCP372, giantin, GOLIM1	uc010hrc.4	Q14789	OTTHUMG00000159411	ENST00000340645.5:c.7580C>T	3.37:g.121410616G>A	ENSP00000341848:p.Ala2527Val		B2ZZ91|D3DN92|E7EP74|Q14398	Missense_Mutation	SNP	superfamily_Prefoldin,superfamily_STAT_TF_coiled-coil,smart_Leu_zip_homeo	p.A2527V	ENST00000340645.5	37	c.7580	CCDS3004.1	3	.	.	.	.	.	.	.	.	.	.	G	16.63	3.176818	0.57692	.	.	ENSG00000173230	ENST00000340645;ENST00000393667	T;T	0.61040	0.14;0.14	5.55	5.55	0.83447	.	0.000000	0.64402	D	0.000008	T	0.76328	0.3972	M	0.78801	2.425	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.997;0.999;1.0	T	0.74867	-0.3518	10	0.35671	T	0.21	.	17.0019	0.86383	0.0:0.0:1.0:0.0	.	2532;2532;2527	E7EP74;B2ZZ91;Q14789	.;.;GOGB1_HUMAN	V	2527;2532	ENSP00000341848:A2527V;ENSP00000377275:A2532V	ENSP00000341848:A2527V	A	-	2	0	GOLGB1	122893306	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.756000	0.98918	2.601000	0.87937	0.563000	0.77884	GCC	GOLGB1	-	NULL	ENSG00000173230		0.398	GOLGB1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	GOLGB1	HGNC	protein_coding	OTTHUMT00000355159.1		0.00	23	0	G	NM_004487		121410616	-1			no_errors	ENST00000340645	ensembl	human	known	74_37	missense	11.43	31	4	SNP	1.000	A
GPN1	11321	genome.wustl.edu	37	2	27855528	27855528	+	Missense_Mutation	SNP	A	A	T			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr2:27855528A>T	ENST00000610189.1	+	5	348	c.341A>T	c.(340-342)aAc>aTc	p.N114I	GPN1_ENST00000515877.1_Missense_Mutation_p.N35I|RP11-158I13.2_ENST00000505973.1_RNA|GPN1_ENST00000458167.2_Missense_Mutation_p.N19I|GPN1_ENST00000407583.3_Missense_Mutation_p.N102I|GPN1_ENST00000424214.1_Missense_Mutation_p.N35I|GPN1_ENST00000264718.3_Missense_Mutation_p.N128I|ZNF512_ENST00000556601.1_3'UTR|GPN1_ENST00000503738.1_Missense_Mutation_p.N19I|GPN1_ENST00000461249.1_3'UTR	NM_007266.3	NP_009197.2			GPN-loop GTPase 1											endometrium(1)|large_intestine(1)|lung(12)	14						AAGGCCCAGAACATGTCCAAG	0.408																																																	0													209.0	204.0	206.0					2																	27855528		2203	4300	6503	SO:0001583	missense	0			AB044661	CCDS1760.2, CCDS46248.1, CCDS46249.1, CCDS46250.1	2p23.3	2011-11-04	2008-04-30	2008-04-30	ENSG00000198522	ENSG00000198522		"""GPN-loop GTPases"""	17030	protein-coding gene	gene with protein product	"""RNA polymerase II associated protein 4"""	611479	"""XPA binding protein 1"", ""XPA binding protein 1, GTPase"""	XAB1		11058119, 11124703	Standard	NM_007266		Approved	NTPBP, MBDIN, ATPBD1A, RPAP4	uc010ymc.2	Q9HCN4	OTTHUMG00000097784	ENST00000610189.1:c.341A>T	2.37:g.27855528A>T	ENSP00000476446:p.Asn114Ile			Missense_Mutation	SNP	pfam_Uncharacterised_ATP-bd,pfam_EF_GTP-bd_dom,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.N128I	ENST00000610189.1	37	c.383		2	.	.	.	.	.	.	.	.	.	.	A	15.63	2.891002	0.52014	.	.	ENSG00000198522	ENST00000515877;ENST00000503738;ENST00000458167;ENST00000424214;ENST00000407583;ENST00000264718	T;T;T;T;T;T	0.23552	1.9;1.9;1.9;1.9;1.9;1.9	5.31	5.31	0.75309	ATPase, AAA+ type, core (1);	0.153219	0.64402	D	0.000014	T	0.29158	0.0725	L	0.42245	1.32	0.40458	D	0.980213	B;P;B;P	0.41673	0.287;0.622;0.257;0.759	B;B;B;P	0.46275	0.296;0.311;0.216;0.51	T	0.03750	-1.1007	10	0.35671	T	0.21	10.3779	12.6267	0.56634	1.0:0.0:0.0:0.0	.	114;128;19;102	Q9HCN4;B4DQM4;B4DXU4;B5MBZ5	GPN1_HUMAN;.;.;.	I	35;19;19;35;102;128	ENSP00000424678:N35I;ENSP00000427269:N19I;ENSP00000412170:N19I;ENSP00000398115:N35I;ENSP00000384255:N102I;ENSP00000264718:N128I	ENSP00000264718:N128I	N	+	2	0	GPN1	27709032	1.000000	0.71417	1.000000	0.80357	0.876000	0.50452	2.683000	0.46943	2.000000	0.58554	0.402000	0.26972	AAC	GPN1	-	pfam_Uncharacterised_ATP-bd,pfam_EF_GTP-bd_dom,superfamily_P-loop_NTPase,smart_AAA+_ATPase	ENSG00000198522		0.408	GPN1-010	KNOWN	basic|appris_principal	protein_coding	GPN1	HGNC	protein_coding	OTTHUMT00000473126.1	-	0.00	69	0	A	NM_007266		27855528	+1	tier1	-	no_errors	ENST00000264718	ensembl	human	known	74_37	missense	6.90	54	4	SNP	1.000	T
GRM2	2912	genome.wustl.edu	37	3	51749765	51749765	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr3:51749765G>A	ENST00000395052.3	+	4	2210	c.1976G>A	c.(1975-1977)cGc>cAc	p.R659H	GRM2_ENST00000475478.1_3'UTR|GRM2_ENST00000442933.2_Intron	NM_000839.3	NP_000830.2	Q14416	GRM2_HUMAN	glutamate receptor, metabotropic 2	659					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|glutamate secretion (GO:0014047)|negative regulation of adenylate cyclase activity (GO:0007194)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission (GO:0007268)	axon (GO:0030424)|cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	calcium channel regulator activity (GO:0005246)|G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group II metabotropic glutamate receptor activity (GO:0001641)	p.R659H(1)		breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|liver(1)|lung(11)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	33				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.000539)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)		CGCATTGCACGCATCTTCGGT	0.622																																																	1	Substitution - Missense(1)	lung(1)											75.0	66.0	69.0					3																	51749765		2203	4300	6503	SO:0001583	missense	0			L35318	CCDS2834.1	3p21.2	2013-09-20			ENSG00000164082	ENSG00000164082		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4594	protein-coding gene	gene with protein product		604099				7620613	Standard	NM_000839		Approved	GPRC1B, mGlu2, MGLUR2	uc010hlv.3	Q14416	OTTHUMG00000156902	ENST00000395052.3:c.1976G>A	3.37:g.51749765G>A	ENSP00000378492:p.Arg659His		B0M0K7|Q14CU5|Q52MC6|Q9H3N6	Missense_Mutation	SNP	pfam_ANF_lig-bd_rcpt,pfam_GPCR_3_C,pfam_GPCR_3_9-Cys_dom,superfamily_Peripla_BP_I,pfscan_GPCR_3_C,prints_GPCR_3,prints_GPCR_3_mtglu_rcpt_2,prints_GPCR_3_mtglu_rcpt,prints_GPCR_3_mtglu_rcpt_3,prints_GPCR_3_GABA_rcpt_B	p.R659H	ENST00000395052.3	37	c.1976	CCDS2834.1	3	.	.	.	.	.	.	.	.	.	.	G	28.6	4.930307	0.92389	.	.	ENSG00000164082	ENST00000395052	D	0.89746	-2.56	5.16	5.16	0.70880	GPCR, family 3, C-terminal (2);	0.000000	0.85682	D	0.000000	D	0.95510	0.8541	M	0.88512	2.96	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.95988	0.8983	10	0.72032	D	0.01	.	19.0285	0.92944	0.0:0.0:1.0:0.0	.	659	Q14416	GRM2_HUMAN	H	659	ENSP00000378492:R659H	ENSP00000378492:R659H	R	+	2	0	GRM2	51724805	1.000000	0.71417	0.992000	0.48379	0.946000	0.59487	9.855000	0.99526	2.576000	0.86940	0.561000	0.74099	CGC	GRM2	-	pfam_GPCR_3_C,pfscan_GPCR_3_C,prints_GPCR_3	ENSG00000164082		0.622	GRM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRM2	HGNC	protein_coding	OTTHUMT00000346542.1		0.00	25	0	G			51749765	+1			no_errors	ENST00000395052	ensembl	human	known	74_37	missense	7.41	25	2	SNP	1.000	A
GTPBP1	9567	genome.wustl.edu	37	22	39112748	39112748	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr22:39112748C>T	ENST00000216044.5	+	4	810	c.577C>T	c.(577-579)Cgc>Tgc	p.R193C		NM_004286.4	NP_004277.2	O00178	GTPB1_HUMAN	GTP binding protein 1	193	tr-type G. {ECO:0000255|PROSITE- ProRule:PRU01059}.				GTP catabolic process (GO:0006184)|immune response (GO:0006955)|positive regulation of mRNA catabolic process (GO:0061014)|signal transduction (GO:0007165)	cytoplasmic exosome (RNase complex) (GO:0000177)|cytosol (GO:0005829)|membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)	p.R193C(1)		endometrium(2)|large_intestine(3)|lung(9)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)	18	Melanoma(58;0.04)					AGGCTTTGCCCGCCAGAAACT	0.552																																																	1	Substitution - Missense(1)	large_intestine(1)											57.0	56.0	56.0					22																	39112748		2203	4300	6503	SO:0001583	missense	0			U87964	CCDS13977.2	22q13.1	2008-07-01			ENSG00000100226	ENSG00000100226			4669	protein-coding gene	gene with protein product		602245				9070279	Standard	XM_005261857		Approved	GP-1, HSPC018	uc003awg.3	O00178	OTTHUMG00000151002	ENST00000216044.5:c.577C>T	22.37:g.39112748C>T	ENSP00000216044:p.Arg193Cys		Q6IC67	Missense_Mutation	SNP	pfam_EF_GTP-bd_dom,pfam_Transl_elong_EFTu/EF1A_C,pfam_Transl_elong_EFTu/EF1A_2,superfamily_P-loop_NTPase,superfamily_Transl_elong_EF1A/Init_IF2_C,superfamily_Transl_B-barrel	p.R193C	ENST00000216044.5	37	c.577	CCDS13977.2	22	.	.	.	.	.	.	.	.	.	.	C	22.3	4.277245	0.80580	.	.	ENSG00000100226	ENST00000216044;ENST00000484657	T;T	0.71341	-0.56;-0.56	5.25	4.22	0.49857	Protein synthesis factor, GTP-binding (1);	0.053428	0.85682	D	0.000000	D	0.88381	0.6421	H	0.97214	3.96	0.80722	D	1	D	0.71674	0.998	D	0.72338	0.977	D	0.90553	0.4510	10	0.87932	D	0	.	10.8796	0.46931	0.1471:0.7113:0.1416:0.0	.	193	O00178	GTPB1_HUMAN	C	193;112	ENSP00000216044:R193C;ENSP00000442881:R112C	ENSP00000216044:R193C	R	+	1	0	GTPBP1	37442694	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	4.743000	0.62110	1.186000	0.42985	0.551000	0.68910	CGC	GTPBP1	-	pfam_EF_GTP-bd_dom,superfamily_P-loop_NTPase	ENSG00000100226		0.552	GTPBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GTPBP1	HGNC	protein_coding	OTTHUMT00000075532.1	-	0.00	30	0	C	NM_004286		39112748	+1	tier1	-	no_errors	ENST00000216044	ensembl	human	known	74_37	missense	37.50	15	9	SNP	1.000	T
HECTD4	283450	genome.wustl.edu	37	12	112757112	112757112	+	5'UTR	SNP	C	C	T			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr12:112757112C>T	ENST00000430131.2	-	0	575				HECTD4_ENST00000550722.1_Silent_p.E60E|HECTD4_ENST00000377560.5_Silent_p.E60E			Q9Y4D8	HECD4_HUMAN	HECT domain containing E3 ubiquitin protein ligase 4						glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)										CAGAAGTCTCCTCTAGCCAAG	0.498																																																	0																																										SO:0001623	5_prime_UTR_variant	0			AK091473		12q24.13	2013-07-17	2012-08-14	2012-08-14	ENSG00000173064	ENSG00000173064			26611	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 51"""	C12orf51		21270382	Standard	NM_001109662		Approved	FLJ34154, KIAA0614	uc021reb.1	Q9Y4D8	OTTHUMG00000150719	ENST00000430131.2:c.-571G>A	12.37:g.112757112C>T			L8B0P6|Q3MJD5|Q6P0A0|Q7L530|Q8NB70|Q8WU73|Q96NT9|Q9NZS4|Q9UFT6	Silent	SNP	pfam_HECT,superfamily_HECT,superfamily_ConA-like_lec_gl_sf,smart_HECT,pfscan_HECT	p.E60	ENST00000430131.2	37	c.180		12																																																																																			HECTD4	-	NULL	ENSG00000173064		0.498	HECTD4-202	KNOWN	basic	protein_coding	HECTD4	HGNC	protein_coding		-	0.00	67	0	C	NM_173813		112757112	-1	tier1	-	no_errors	ENST00000377560	ensembl	human	known	74_37	silent	12.77	41	6	SNP	1.000	T
HLA-C	3107	genome.wustl.edu	37	6	31239424	31239424	+	Missense_Mutation	SNP	G	G	C	rs41549514		TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr6:31239424G>C	ENST00000376228.5	-	2	309	c.295C>G	c.(295-297)Cga>Gga	p.R99G	HLA-C_ENST00000383329.3_Missense_Mutation_p.R99G	NM_002117.5	NP_002108.4	Q95604	1C17_HUMAN	major histocompatibility complex, class I, C	99	Alpha-1.				antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|regulation of immune response (GO:0050776)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cell surface (GO:0009986)|early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	peptide antigen binding (GO:0042605)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(2)|lung(4)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	17						AGGCTCACTCGGTCAGCCTGT	0.701																																																	0													44.0	45.0	44.0					6																	31239424		1511	2709	4220	SO:0001583	missense	0			M11886	CCDS34393.1	6p21.3	2014-01-30			ENSG00000204525	ENSG00000204525		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4933	protein-coding gene	gene with protein product		142840	"""psoriasis susceptibility 1"""	HLA-JY3, D6S204, PSORS1		3863816, 16642438	Standard	NM_001243042		Approved		uc003nsy.3	P04222	OTTHUMG00000031154	ENST00000376228.5:c.295C>G	6.37:g.31239424G>C	ENSP00000365402:p.Arg99Gly		O02864|O02958|Q29643|Q9MY30	Missense_Mutation	SNP	pfam_MHC_I_a_a1/a2,pfam_Ig_C1-set,pfam_MHC_I_a_C,superfamily_MHC_I/II-like_Ag-recog,smart_Ig_C1-set,pfscan_Ig-like_dom,prints_MHC_I_a	p.R99G	ENST00000376228.5	37	c.295	CCDS34393.1	6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	N|N	11.94|11.94	1.789359|1.789359	0.31685|0.31685	.|.	.|.	ENSG00000204525|ENSG00000204525	ENST00000415537|ENST00000376228;ENST00000383329;ENST00000396254;ENST00000539307	.|T;T	.|0.00014	.|9.2;9.2	2.81|2.81	2.81|2.81	0.32909|0.32909	.|MHC class I, alpha chain, alpha1/alpha2 (2);MHC classes I/II-like antigen recognition protein (1);MHC class I-like antigen recognition (1);	.|1.158660	.|0.07190	.|U	.|0.855459	T|T	0.00300|0.00300	0.0009|0.0009	H|H	0.98178|0.98178	4.165|4.165	0.09310|0.09310	N|N	1|1	.|D;D;D;D	.|0.89917	.|1.0;1.0;1.0;0.993	.|D;D;D;D	.|0.91635	.|0.999;0.999;0.999;0.953	T|T	0.47898|0.47898	-0.9081|-0.9081	5|10	.|0.87932	.|D	.|0	.|.	9.2778|9.2778	0.37709|0.37709	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	rs41549514|rs41549514	.|99;99;99;99	.|A2AEA4;A6H578;A2AEA2;P10321	.|.;.;.;1C07_HUMAN	R|G	98|99;99;99;136	.|ENSP00000365402:R99G;ENSP00000372819:R99G	.|ENSP00000365402:R99G	P|R	-|-	2|1	0|2	HLA-C|HLA-C	31347403|31347403	0.000000|0.000000	0.05858|0.05858	0.005000|0.005000	0.12908|0.12908	0.010000|0.010000	0.07245|0.07245	-0.183000|-0.183000	0.09712|0.09712	1.886000|1.886000	0.54624|0.54624	0.305000|0.305000	0.20034|0.20034	CCG|CGA	HLA-C	-	pfam_MHC_I_a_a1/a2,superfamily_MHC_I/II-like_Ag-recog,prints_MHC_I_a	ENSG00000204525		0.701	HLA-C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HLA-C	HGNC	protein_coding	OTTHUMT00000076281.3	-	0.00	125	0	G	NM_002117		31239424	-1	tier1	rs41549514	no_errors	ENST00000383329	ensembl	human	known	74_37	missense	15.04	113	20	SNP	0.005	C
HLA-DPB1	3115	genome.wustl.edu	37	6	33048643	33048643	+	Missense_Mutation	SNP	C	C	T	rs41554314		TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr6:33048643C>T	ENST00000418931.2	+	2	411	c.295C>T	c.(295-297)Cgg>Tgg	p.R99W	HLA-DPA1_ENST00000419277.1_5'Flank|HLA-DPB1_ENST00000535465.1_Missense_Mutation_p.R99W|HLA-DPB1_ENST00000471184.1_3'UTR	NM_002121.5	NP_002112.3	P04440	DPB1_HUMAN	major histocompatibility complex, class II, DP beta 1	99	Beta-1.		R -> W (in allele DPB1*94:01; dbSNP:rs41554314).		antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of T cell activation (GO:0050870)|positive regulation of T cell proliferation (GO:0042102)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)	cell surface (GO:0009986)|clathrin-coated endocytic vesicle membrane (GO:0030669)|endocytic vesicle membrane (GO:0030666)|endosome (GO:0005768)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|MHC class II protein complex (GO:0042613)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)|transport vesicle membrane (GO:0030658)	peptide antigen binding (GO:0042605)			cervix(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(3)|ovary(1)|skin(1)	11						GGAGGAGAAGCGGGCAGTGCC	0.682																																																	0													39.0	41.0	40.0					6																	33048643		1510	2708	4218	SO:0001583	missense	0				CCDS4765.1	6p21.3	2013-01-11			ENSG00000223865	ENSG00000223865		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4940	protein-coding gene	gene with protein product		142858		HLA-DP1B			Standard	NM_002121		Approved		uc003ocu.2	P04440	OTTHUMG00000031076	ENST00000418931.2:c.295C>T	6.37:g.33048643C>T	ENSP00000408146:p.Arg99Trp		A0PFJ7|A5I886|A8YPB3|B5U8B4|B7VF80|B7VF87|B8ZX68|B8ZYT0|B9W5S8|B9W6F7|B9W6F9|C0MPP5|C0MPQ2|C0MPQ3|C0MPQ5|C0MPQ6|C0MPQ7|C4R9J5|C5IZL1|O00259|O19698|O19700|O19702|O19749|O46884|O77952|O98215|O98216|O98217|O98218|O98219|O98222|O98223|P01916|P04232|P13763|P79493|P79608|Q0P0L4|Q0ZFN3|Q14279|Q27S71|Q29682|Q29684|Q29698|Q29714|Q29775|Q29776|Q29778|Q29779|Q29781|Q29827|Q29828|Q29879|Q29880|Q29898|Q29977|Q2MGW3|Q30015|Q30031|Q30032|Q30033|Q30034|Q30050|Q30051|Q30052|Q30053|Q30054|Q30055|Q30174|Q4GY31|Q4JHD8|Q5ENE0|Q5ENE1|Q5ENW3|Q5EP46|Q5EP47|Q5EP49|Q5EP51|Q5EP52|Q5EP53|Q5EP56|Q5I4H8|Q5I4H9|Q5ISH4|Q5ISH5|Q5SQ73|Q5STP2|Q5YLA6|Q6IVX1|Q6LBX2|Q6LBX3|Q6LBX4|Q6LBX5|Q6LBX6|Q6LBX7|Q6PWX6|Q6TAS4|Q714U1|Q714U2|Q7YQ10|Q860Z7|Q8HWL7|Q8HWT5|Q8SNC4|Q95HC1|Q95IT7|Q95IT8|Q9BD13|Q9GIM2|Q9GIM4|Q9GIX6|Q9GJ41|Q9MY67|Q9TNT7|Q9TQE2|Q9XS11|Q9XS12	Missense_Mutation	SNP	pfam_MHC_II_b_N,pfam_Ig_C1-set,superfamily_MHC_I/II-like_Ag-recog,smart_MHC_II_b_N,smart_Ig_C1-set,pfscan_Ig-like_dom	p.R99W	ENST00000418931.2	37	c.295	CCDS4765.1	6	.	.	.	.	.	.	.	.	.	.	C	16.78	3.216628	0.58452	.	.	ENSG00000223865	ENST00000418931;ENST00000535465;ENST00000411942;ENST00000428835	T;T;T	0.00367	7.77;7.77;7.77	3.93	3.04	0.35103	MHC class II, alpha/beta chain, N-terminal (1);MHC class II, beta chain, N-terminal (3);MHC classes I/II-like antigen recognition protein (1);	0.251711	0.28544	U	0.014970	T	0.00608	0.0020	M	0.93939	3.475	0.09310	N	1	D;D	0.89917	1.0;1.0	D;D	0.80764	0.977;0.994	T	0.27331	-1.0077	10	0.87932	D	0	.	10.9704	0.47436	0.1876:0.8124:0.0:0.0	rs41554314	109;99	Q59GY1;P04440	.;DPB1_HUMAN	W	99;99;99;76	ENSP00000408146:R99W;ENSP00000439674:R99W;ENSP00000412654:R76W	ENSP00000389210:R99W	R	+	1	2	HLA-DPB1	33156621	0.024000	0.19004	0.003000	0.11579	0.003000	0.03518	0.298000	0.19120	0.975000	0.38392	0.579000	0.79373	CGG	HLA-DPB1	-	pfam_MHC_II_b_N,superfamily_MHC_I/II-like_Ag-recog,smart_MHC_II_b_N	ENSG00000223865		0.682	HLA-DPB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HLA-DPB1	HGNC	protein_coding	OTTHUMT00000076106.2	-	0.00	121	0	C	NM_002121		33048643	+1	tier1	rs41554314	no_errors	ENST00000418931	ensembl	human	known	74_37	missense	5.62	150	9	SNP	0.010	T
HNRNPKP3	399881	genome.wustl.edu	37	11	43283301	43283301	+	RNA	SNP	T	T	C			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr11:43283301T>C	ENST00000511537.1	-	0	1634					NR_033868.1				heterogeneous nuclear ribonucleoprotein K pseudogene 3																		TGTGGCCTATTGTTACTCTTC	0.378																																																	0																																												0					11p12	2011-07-05				ENSG00000251557			42376	pseudogene	pseudogene							Standard	NR_033868		Approved		uc001mxe.2				11.37:g.43283301T>C				RNA	SNP	-	NULL	ENST00000511537.1	37	NULL		11																																																																																			HNRNPKP3	-	-	ENSG00000251557		0.378	HNRNPKP3-003	KNOWN	basic	processed_transcript	HNRNPKP3	HGNC	pseudogene	OTTHUMT00000390385.1		0.00	16	0	T	NR_033868		43283301	-1			no_errors	ENST00000511537	ensembl	human	known	74_37	rna	26.67	11	4	SNP	0.000	C
HOXB6	3216	genome.wustl.edu	37	17	46673330	46673331	+	3'UTR	INS	-	-	G			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr17:46673330_46673331insG	ENST00000484302.2	-	0	1741_1742				HOXB-AS3_ENST00000487849.3_RNA|HOXB-AS3_ENST00000429755.4_RNA|HOXB-AS3_ENST00000466037.2_RNA|HOXB6_ENST00000490419.1_5'Flank|HOXB-AS3_ENST00000474324.1_RNA|HOXB-AS3_ENST00000460041.1_RNA|HOXB6_ENST00000225648.3_3'UTR|HOXB-AS3_ENST00000481995.1_RNA|HOXB-AS3_ENST00000477144.1_RNA|HOXB-AS3_ENST00000474040.1_RNA|HOXB-AS3_ENST00000476204.1_RNA|HOXB5_ENST00000239151.5_5'Flank|HOXB-AS3_ENST00000465846.2_RNA|HOXB-AS3_ENST00000467155.2_RNA|HOXB-AS3_ENST00000492897.3_RNA|HOXB-AS3_ENST00000480872.1_RNA|HOXB3_ENST00000552000.2_Intron			P17509	HXB6_HUMAN	homeobox B6						anterior/posterior pattern specification (GO:0009952)|embryonic skeletal system morphogenesis (GO:0048704)|erythrocyte homeostasis (GO:0034101)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|kidney(1)|large_intestine(1)|lung(4)	7						GGCTTTGGGGAGGGGGTGGGAG	0.5																																																	0																																										SO:0001624	3_prime_UTR_variant	0				CCDS11531.1	17q21.32	2011-06-20	2005-12-22		ENSG00000108511	ENSG00000108511		"""Homeoboxes / ANTP class : HOXL subclass"""	5117	protein-coding gene	gene with protein product		142961	"""homeo box B6"""	HOX2, HOX2B		1973146, 1358459	Standard	XM_005257284		Approved		uc002ins.1	P17509	OTTHUMG00000159912	ENST00000484302.2:c.*445->C	17.37:g.46673335_46673335dupG			A8K835|D3DTV5|P09068|Q9HB11|Q9UGH2	RNA	INS	-	NULL	ENST00000484302.2	37	NULL	CCDS11531.1	17																																																																																			HOXB-AS3	-	-	ENSG00000233101		0.500	HOXB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HOXB-AS3	HGNC	protein_coding	OTTHUMT00000358146.2		0.00	69	0	-			46673331	+1	tier1		no_errors	ENST00000460041	ensembl	human	known	74_37	rna	16.98	44	9	INS	0.998:0.997	G
HTR7	3363	genome.wustl.edu	37	10	92509183	92509183	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr10:92509183G>T	ENST00000336152.3	-	2	734	c.708C>A	c.(706-708)gaC>gaA	p.D236E	HTR7_ENST00000371719.2_Missense_Mutation_p.D236E|HTR7_ENST00000277874.6_Missense_Mutation_p.D236E|HTR7_ENST00000371721.3_Missense_Mutation_p.D236E	NM_019859.3	NP_062873.1	P34969	5HT7R_HUMAN	5-hydroxytryptamine (serotonin) receptor 7, adenylate cyclase-coupled	236					blood circulation (GO:0008015)|circadian rhythm (GO:0007623)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|serotonin receptor signaling pathway (GO:0007210)|smooth muscle contraction (GO:0006939)|synaptic transmission (GO:0007268)|vasoconstriction (GO:0042310)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	serotonin receptor activity (GO:0004993)			NS(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(11)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30					Amisulpride(DB06288)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Clozapine(DB00363)|Dopamine(DB00988)|Eletriptan(DB00216)|Epinastine(DB00751)|Ergoloid mesylate(DB01049)|Iloperidone(DB04946)|Imipramine(DB00458)|Loxapine(DB00408)|Lurasidone(DB08815)|Maprotiline(DB00934)|Methysergide(DB00247)|Mianserin(DB06148)|Mirtazapine(DB00370)|Olanzapine(DB00334)|Quetiapine(DB01224)|Ziprasidone(DB00246)	TATAGCCAAAGTCCTGGCTGA	0.473																																																	0													93.0	98.0	96.0					10																	92509183		2203	4300	6503	SO:0001583	missense	0			BC047526	CCDS7408.1, CCDS7409.1, CCDS7410.1	10q21-q24	2012-08-08	2012-02-03		ENSG00000148680	ENSG00000148680		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5302	protein-coding gene	gene with protein product		182137	"""5-hydroxytryptamine (serotonin) receptor 7 (adenylate cyclase-coupled)"""			8226867	Standard	NM_000872		Approved	5-HT7	uc001kha.3	P34969	OTTHUMG00000018732	ENST00000336152.3:c.708C>A	10.37:g.92509183G>T	ENSP00000337949:p.Asp236Glu		B5BUP6|P78336|P78372|P78516|Q5VX01|Q5VX02|Q5VX03	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_5HT_7_rcpt,prints_GPCR_Rhodpsn,prints_Melcrt_ACTH_rcpt	p.D236E	ENST00000336152.3	37	c.708	CCDS7408.1	10	.	.	.	.	.	.	.	.	.	.	G	19.25	3.791058	0.70452	.	.	ENSG00000148680	ENST00000336152;ENST00000277874;ENST00000371719;ENST00000371721	T;T;T;T	0.38887	1.11;1.11;1.11;1.11	5.28	-4.83	0.03161	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.42040	0.1185	N	0.21545	0.675	0.42283	D	0.992101	D;P	0.63880	0.993;0.923	D;P	0.66084	0.941;0.79	T	0.39742	-0.9599	10	0.25106	T	0.35	.	16.9893	0.86349	0.3105:0.0:0.6895:0.0	.	236;236	P34969;P34969-2	5HT7R_HUMAN;.	E	236	ENSP00000337949:D236E;ENSP00000277874:D236E;ENSP00000360784:D236E;ENSP00000360786:D236E	ENSP00000277874:D236E	D	-	3	2	HTR7	92499163	0.973000	0.33851	0.651000	0.29564	0.994000	0.84299	0.130000	0.15850	-0.716000	0.04962	0.650000	0.86243	GAC	HTR7	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM	ENSG00000148680		0.473	HTR7-001	KNOWN	basic|CCDS	protein_coding	HTR7	HGNC	protein_coding	OTTHUMT00000049343.1	-	0.00	37	0	G	NM_000872		92509183	-1	tier1	-	no_errors	ENST00000336152	ensembl	human	known	74_37	missense	8.33	55	5	SNP	0.993	T
HTRA1	5654	genome.wustl.edu	37	10	124249032	124249032	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr10:124249032A>G	ENST00000368984.3	+	3	795	c.667A>G	c.(667-669)Acc>Gcc	p.T223A		NM_002775.4	NP_002766.1	Q92743	HTRA1_HUMAN	HtrA serine peptidase 1	223	Serine protease.				negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|proteolysis (GO:0006508)|regulation of cell growth (GO:0001558)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			endometrium(1)|kidney(1)|large_intestine(8)|lung(7)	17		all_neural(114;0.0765)|Lung NSC(174;0.133)|all_lung(145;0.163)|Breast(234;0.238)				CCACGTGGTGACCAACAAGCA	0.488																																																	0													166.0	145.0	152.0					10																	124249032		2203	4300	6503	SO:0001583	missense	0			AF097709	CCDS7630.1	10q26.3	2014-01-28	2005-08-18	2005-08-18	ENSG00000166033	ENSG00000166033		"""Serine peptidases / Serine peptidases"""	9476	protein-coding gene	gene with protein product		602194	"""protease, serine, 11 (IGF binding)"""	PRSS11		8977104	Standard	NM_002775		Approved	HtrA, IGFBP5-protease, ARMD7	uc001lgj.2	Q92743	OTTHUMG00000019186	ENST00000368984.3:c.667A>G	10.37:g.124249032A>G	ENSP00000357980:p.Thr223Ala		D3DRE4|Q9UNS5	Missense_Mutation	SNP	pfam_Peptidase_S1,pfam_PDZ,pfam_Kazal_dom,pfam_IGFBP-like,superfamily_Trypsin-like_Pept_dom,superfamily_PDZ,smart_IGFBP-like,smart_Kazal_dom,smart_PDZ,pfscan_PDZ,prints_Peptidase_S1C	p.T223A	ENST00000368984.3	37	c.667	CCDS7630.1	10	.	.	.	.	.	.	.	.	.	.	A	11.12	1.545231	0.27652	.	.	ENSG00000166033	ENST00000368984;ENST00000435263	D	0.87103	-2.21	5.13	5.13	0.70059	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (1);	0.054951	0.64402	D	0.000001	T	0.59321	0.2185	N	0.00298	-1.69	0.49915	D	0.999831	B	0.06786	0.001	B	0.08055	0.003	T	0.65928	-0.6049	10	0.05833	T	0.94	-0.8765	14.9758	0.71269	1.0:0.0:0.0:0.0	.	223	Q92743	HTRA1_HUMAN	A	223;190	ENSP00000357980:T223A	ENSP00000357980:T223A	T	+	1	0	HTRA1	124239022	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.341000	0.79300	1.935000	0.56089	0.528000	0.53228	ACC	HTRA1	-	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,prints_Peptidase_S1C	ENSG00000166033		0.488	HTRA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HTRA1	HGNC	protein_coding	OTTHUMT00000128327.1	-	0.00	53	0	A	NM_002775		124249032	+1	tier1	-	no_errors	ENST00000368984	ensembl	human	known	74_37	missense	15.25	50	9	SNP	1.000	G
IGSF10	285313	genome.wustl.edu	37	3	151164323	151164323	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr3:151164323G>A	ENST00000282466.3	-	4	3445	c.3446C>T	c.(3445-3447)tCc>tTc	p.S1149F		NM_001178145.1|NM_001178146.1|NM_178822.4	NP_001171616.1|NP_001171617.1|NP_849144.2	Q6WRI0	IGS10_HUMAN	immunoglobulin superfamily, member 10	1149					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)	extracellular region (GO:0005576)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(24)|liver(4)|lung(43)|ovary(8)|prostate(4)|skin(9)|stomach(1)|urinary_tract(3)	116			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			CATGGGTATGGATGTTGGAGC	0.408																																																	0													276.0	261.0	266.0					3																	151164323		2203	4300	6503	SO:0001583	missense	0			AY273815	CCDS3160.1	3q25.1	2013-01-11			ENSG00000152580	ENSG00000152580		"""Immunoglobulin superfamily / I-set domain containing"""	26384	protein-coding gene	gene with protein product						12477932	Standard	NM_178822		Approved	FLJ25972, CMF608	uc011bod.2	Q6WRI0	OTTHUMG00000159856	ENST00000282466.3:c.3446C>T	3.37:g.151164323G>A	ENSP00000282466:p.Ser1149Phe		Q86YJ9|Q8N772|Q8NA84	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,pfscan_Ig-like_dom	p.S1149F	ENST00000282466.3	37	c.3446	CCDS3160.1	3	.	.	.	.	.	.	.	.	.	.	G	13.03	2.114881	0.37339	.	.	ENSG00000152580	ENST00000282466	T	0.70045	-0.45	5.13	5.13	0.70059	.	0.155285	0.30244	N	0.010070	T	0.68035	0.2957	L	0.29908	0.895	0.09310	N	1	D	0.61697	0.99	P	0.58577	0.841	T	0.61357	-0.7079	10	0.39692	T	0.17	.	13.9763	0.64275	0.0:0.0:0.8475:0.1525	.	1149	Q6WRI0	IGS10_HUMAN	F	1149	ENSP00000282466:S1149F	ENSP00000282466:S1149F	S	-	2	0	IGSF10	152647013	0.001000	0.12720	0.025000	0.17156	0.015000	0.08874	0.920000	0.28705	2.383000	0.81215	0.591000	0.81541	TCC	IGSF10	-	NULL	ENSG00000152580		0.408	IGSF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IGSF10	HGNC	protein_coding	OTTHUMT00000357782.1	-	0.00	73	0	G	NM_178822		151164323	-1	tier1	-	no_errors	ENST00000282466	ensembl	human	known	74_37	missense	30.69	70	31	SNP	0.011	A
INADL	10207	genome.wustl.edu	37	1	62579862	62579862	+	Silent	SNP	T	T	C			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr1:62579862T>C	ENST00000371158.2	+	35	4713	c.4599T>C	c.(4597-4599)ccT>ccC	p.P1533P	INADL_ENST00000545929.1_Silent_p.P178P|INADL_ENST00000316485.6_Silent_p.P1563P|INADL_ENST00000543708.1_Silent_p.P347P	NM_176877.2	NP_795352	Q8NI35	INADL_HUMAN	InaD-like (Drosophila)	1533	PDZ 9. {ECO:0000255|PROSITE- ProRule:PRU00143}.				cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|intracellular signal transduction (GO:0035556)|tight junction assembly (GO:0070830)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|tight junction (GO:0005923)				breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(8)|liver(1)|lung(51)|ovary(3)|pancreas(1)|prostate(7)|skin(5)|stomach(1)|upper_aerodigestive_tract(3)	103						AGATTTTCCCTGTGGATCTGC	0.567																																																	0													78.0	79.0	79.0					1																	62579862		2203	4300	6503	SO:0001819	synonymous_variant	0			AB044807	CCDS617.2	1p31	2008-02-05			ENSG00000132849	ENSG00000132849			28881	protein-coding gene	gene with protein product		603199				9280290, 11374908	Standard	NM_176877		Approved	Cipp, PATJ	uc001dab.3	Q8NI35	OTTHUMG00000008560	ENST00000371158.2:c.4599T>C	1.37:g.62579862T>C			O15249|O43742|O60833|Q5VUA5|Q5VUA6|Q5VUA7|Q5VUA8|Q5VUA9|Q5VUB0|Q8WU78|Q9H3N9	Silent	SNP	pfam_PDZ,pfam_L27_2,superfamily_PDZ,smart_L27,smart_PDZ,pfscan_L27,pfscan_PDZ	p.P1533	ENST00000371158.2	37	c.4599	CCDS617.2	1																																																																																			INADL	-	superfamily_PDZ,pfscan_PDZ	ENSG00000132849		0.567	INADL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INADL	HGNC	protein_coding	OTTHUMT00000023639.2		0.00	70	0	T	NM_170605		62579862	+1			no_errors	ENST00000371158	ensembl	human	known	74_37	silent	6.15	60	4	SNP	0.003	C
IL12RB2	3595	genome.wustl.edu	37	1	67792431	67792431	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr1:67792431G>T	ENST00000262345.1	+	4	1018	c.378G>T	c.(376-378)caG>caT	p.Q126H	IL12RB2_ENST00000544434.1_Missense_Mutation_p.Q126H|IL12RB2_ENST00000371000.1_Missense_Mutation_p.Q126H|IL12RB2_ENST00000541374.1_Missense_Mutation_p.Q126H	NM_001559.2	NP_001550.1	Q99665	I12R2_HUMAN	interleukin 12 receptor, beta 2	126	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell surface receptor signaling pathway (GO:0007166)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma production (GO:0032609)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell proliferation (GO:0008284)|positive regulation of interferon-gamma production (GO:0032729)|response to lipopolysaccharide (GO:0032496)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)	cytokine receptor activity (GO:0004896)			breast(3)|central_nervous_system(1)|endometrium(3)|large_intestine(8)|lung(21)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	45						CTCCAGAACAGCCTCAAAATT	0.413																																																	0													87.0	85.0	86.0					1																	67792431		2203	4300	6503	SO:0001583	missense	0			U64198	CCDS638.1, CCDS58006.1, CCDS58007.1, CCDS72805.1	1p31.3-p31.2	2014-07-15			ENSG00000081985	ENSG00000081985		"""Interleukins and interleukin receptors"", ""Fibronectin type III domain containing"""	5972	protein-coding gene	gene with protein product		601642				9284929, 8943050	Standard	NM_001559		Approved		uc001ddu.3	Q99665	OTTHUMG00000009094	ENST00000262345.1:c.378G>T	1.37:g.67792431G>T	ENSP00000262345:p.Gln126His		B1AN98|B7ZKL9|F5H7L6|Q2M3V3	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_IgC2-like_lig-bd,pfam_IL-6_rcpt_alpha-bd,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	p.Q126H	ENST00000262345.1	37	c.378	CCDS638.1	1	.	.	.	.	.	.	.	.	.	.	G	14.13	2.443781	0.43429	.	.	ENSG00000081985	ENST00000262345;ENST00000371000;ENST00000541374;ENST00000544434	T;T;T;T	0.21932	1.98;1.98;1.98;1.98	5.89	3.01	0.34805	Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.557981	0.21489	N	0.073716	T	0.25232	0.0613	M	0.73962	2.25	0.32670	N	0.516901	D;D;D;D	0.71674	0.966;0.998;0.989;0.989	P;D;P;P	0.64595	0.706;0.927;0.846;0.87	T	0.08066	-1.0740	10	0.48119	T	0.1	-0.8813	7.539	0.27727	0.2684:0.0:0.7316:0.0	.	126;126;126;126	B4DGA4;F5H7L6;Q99665-2;Q99665	.;.;.;I12R2_HUMAN	H	126	ENSP00000262345:Q126H;ENSP00000360039:Q126H;ENSP00000445276:Q126H;ENSP00000442443:Q126H	ENSP00000262345:Q126H	Q	+	3	2	IL12RB2	67565019	1.000000	0.71417	0.996000	0.52242	0.411000	0.31082	0.944000	0.29043	0.392000	0.25172	0.563000	0.77884	CAG	IL12RB2	-	superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000081985		0.413	IL12RB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL12RB2	HGNC	protein_coding	OTTHUMT00000025202.2	-	0.00	38	0	G	NM_001559		67792431	+1	tier1	-	no_errors	ENST00000262345	ensembl	human	known	74_37	missense	5.88	64	4	SNP	1.000	T
INSR	3643	genome.wustl.edu	37	19	7166284	7166284	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr19:7166284C>T	ENST00000302850.5	-	8	1884	c.1742G>A	c.(1741-1743)cGg>cAg	p.R581Q	INSR_ENST00000341500.5_Missense_Mutation_p.R581Q	NM_000208.2	NP_000199.2	P06213	INSR_HUMAN	insulin receptor	581					activation of MAPK activity (GO:0000187)|activation of protein kinase activity (GO:0032147)|activation of protein kinase B activity (GO:0032148)|carbohydrate metabolic process (GO:0005975)|cellular response to growth factor stimulus (GO:0071363)|cellular response to insulin stimulus (GO:0032869)|epidermis development (GO:0008544)|exocrine pancreas development (GO:0031017)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose homeostasis (GO:0042593)|heart morphogenesis (GO:0003007)|insulin receptor signaling pathway (GO:0008286)|male sex determination (GO:0030238)|peptidyl-tyrosine autophosphorylation (GO:0038083)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of developmental growth (GO:0048639)|positive regulation of DNA replication (GO:0045740)|positive regulation of glucose import (GO:0046326)|positive regulation of glycogen biosynthetic process (GO:0045725)|positive regulation of glycolytic process (GO:0045821)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mitosis (GO:0045840)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of respiratory burst (GO:0060267)|protein autophosphorylation (GO:0046777)|protein heterotetramerization (GO:0051290)|regulation of embryonic development (GO:0045995)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction by phosphorylation (GO:0023014)|transformation of host cell by virus (GO:0019087)	caveola (GO:0005901)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|insulin receptor complex (GO:0005899)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|insulin binding (GO:0043559)|insulin receptor substrate binding (GO:0043560)|insulin-activated receptor activity (GO:0005009)|insulin-like growth factor I binding (GO:0031994)|insulin-like growth factor II binding (GO:0031995)|insulin-like growth factor receptor binding (GO:0005159)|phosphatidylinositol 3-kinase binding (GO:0043548)|protein tyrosine kinase activity (GO:0004713)|PTB domain binding (GO:0051425)|receptor signaling protein tyrosine kinase activity (GO:0004716)			breast(1)|central_nervous_system(4)|endometrium(6)|kidney(2)|large_intestine(13)|lung(25)|ovary(4)|prostate(4)|skin(3)|stomach(2)|urinary_tract(2)	66					"""""""Insulin(DB00071)|""""Insulin(DB08914)|Insulin Aspart(DB01306)|Insulin Detemir(DB01307)|Insulin Glargine(DB00047)|Insulin Glulisine(DB01309)|Insulin Lispro(DB00046)|Insulin Regular(DB00030)|Mecasermin(DB01277)"""	CTTGAGACCCCGCATCAGCCA	0.557																																																	0													96.0	87.0	90.0					19																	7166284		2203	4300	6503	SO:0001583	missense	0			M10051	CCDS12176.1, CCDS42487.1	19p13.3-p13.2	2013-02-11				ENSG00000171105		"""CD molecules"", ""Fibronectin type III domain containing"""	6091	protein-coding gene	gene with protein product		147670				2983222	Standard	NM_000208		Approved	CD220	uc002mgd.1	P06213		ENST00000302850.5:c.1742G>A	19.37:g.7166284C>T	ENSP00000303830:p.Arg581Gln		Q17RW0|Q59H98|Q9UCB7|Q9UCB8|Q9UCB9	Missense_Mutation	SNP	pirsf_Tyr_kinase_insulin-like_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_EGF_rcpt_L,pfam_Prot_kinase_dom,pfam_Furin-like_Cys-rich_dom,pfam_Fibronectin_type3,superfamily_Kinase-like_dom,superfamily_Growth_fac_rcpt_N_dom,superfamily_Fibronectin_type3,smart_Furin_repeat,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom	p.R581Q	ENST00000302850.5	37	c.1742	CCDS12176.1	19	.	.	.	.	.	.	.	.	.	.	C	7.858	0.725529	0.15439	.	.	ENSG00000171105	ENST00000302850;ENST00000341500;ENST00000538006	T;T	0.69435	-0.4;-0.4	5.08	5.08	0.68730	Fibronectin, type III (1);	0.000000	0.40302	U	0.001129	T	0.56046	0.1959	L	0.39898	1.24	0.36714	D	0.880805	B;B;B	0.14438	0.003;0.01;0.006	B;B;B	0.12156	0.002;0.007;0.001	T	0.56372	-0.7990	10	0.09843	T	0.71	.	15.9818	0.80116	0.0:1.0:0.0:0.0	.	572;581;581	Q86WY9;P06213-2;P06213	.;.;INSR_HUMAN	Q	581;581;44	ENSP00000303830:R581Q;ENSP00000342838:R581Q	ENSP00000303830:R581Q	R	-	2	0	INSR	7117284	0.923000	0.31300	0.975000	0.42487	0.265000	0.26407	2.609000	0.46317	2.349000	0.79799	0.655000	0.94253	CGG	INSR	-	pirsf_Tyr_kinase_insulin-like_rcpt,superfamily_Fibronectin_type3,smart_Fibronectin_type3	ENSG00000171105		0.557	INSR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	INSR	HGNC	protein_coding	OTTHUMT00000458544.1	-	0.00	42	0	C			7166284	-1	tier1	-	no_errors	ENST00000302850	ensembl	human	known	74_37	missense	18.52	22	5	SNP	0.861	T
INTS8	55656	genome.wustl.edu	37	8	95850846	95850846	+	Splice_Site	SNP	G	G	T			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr8:95850846G>T	ENST00000523731.1	+	8	1150	c.1017G>T	c.(1015-1017)caG>caT	p.Q339H	INTS8_ENST00000447247.1_Splice_Site_p.Q339H	NM_017864.2	NP_060334.2	Q75QN2	INT8_HUMAN	integrator complex subunit 8	339					snRNA processing (GO:0016180)	integrator complex (GO:0032039)				breast(3)|endometrium(3)|kidney(1)|large_intestine(9)|liver(1)|lung(9)|prostate(1)|upper_aerodigestive_tract(1)	28	Breast(36;1.05e-06)					GCAACTATCAGGTAAGGTGTA	0.423																																																	0													128.0	118.0	121.0					8																	95850846		2203	4300	6503	SO:0001630	splice_region_variant	0			AK091278	CCDS34925.1	8q22.1	2007-05-03	2006-03-15	2006-03-15	ENSG00000164941	ENSG00000164941			26048	protein-coding gene	gene with protein product		611351	"""chromosome 8 open reading frame 52"""	C8orf52		16239144	Standard	NM_017864		Approved	FLJ20530, INT8, MGC131633	uc003yhb.4	Q75QN2	OTTHUMG00000164695	ENST00000523731.1:c.1017+1G>T	8.37:g.95850846G>T			B2RN92|Q5RKZ3|Q6P1R5|Q7Z314|Q9NVS6|Q9NWY7	Missense_Mutation	SNP	NULL	p.Q339H	ENST00000523731.1	37	c.1017	CCDS34925.1	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	22.2|22.2	4.255129|4.255129	0.80135|0.80135	.|.	.|.	ENSG00000164941|ENSG00000164941	ENST00000523731;ENST00000447247|ENST00000520526	.|.	.|.	.|.	5.42|5.42	5.42|5.42	0.78866|0.78866	.|.	0.157039|.	0.64402|.	D|.	0.000015|.	T|T	0.71542|0.71542	0.3352|0.3352	L|L	0.54323|0.54323	1.7|1.7	0.80722|0.80722	D|D	1|1	D;P|.	0.54207|.	0.965;0.729|.	P;P|.	0.53313|.	0.723;0.653|.	T|T	0.68303|0.68303	-0.5444|-0.5444	9|5	0.54805|.	T|.	0.06|.	-1.8886|-1.8886	19.2018|19.2018	0.93714|0.93714	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	339;339|.	Q75QN2;Q75QN2-2|.	INT8_HUMAN;.|.	H|M	339|161	.|.	ENSP00000343274:Q339H|.	Q|R	+|+	3|2	2|0	INTS8|INTS8	95920022|95920022	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.945000|0.945000	0.59286|0.59286	8.014000|8.014000	0.88676|0.88676	2.522000|2.522000	0.85027|0.85027	0.491000|0.491000	0.48974|0.48974	CAG|AGG	INTS8	-	NULL	ENSG00000164941		0.423	INTS8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INTS8	HGNC	protein_coding	OTTHUMT00000379794.1		0.00	29	0	G	NM_017864	Missense_Mutation	95850846	+1			no_errors	ENST00000523731	ensembl	human	known	74_37	missense	9.09	30	3	SNP	1.000	T
ITGAV	3685	genome.wustl.edu	37	2	187529245	187529245	+	Silent	SNP	G	G	T			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr2:187529245G>T	ENST00000261023.3	+	20	2224	c.1950G>T	c.(1948-1950)ggG>ggT	p.G650G	ITGAV_ENST00000433736.2_Silent_p.G604G|ITGAV_ENST00000374907.3_Silent_p.G614G|AC017101.10_ENST00000453665.1_RNA	NM_002210.3	NP_002201	P06756	ITAV_HUMAN	integrin, alpha V	650					angiogenesis (GO:0001525)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apolipoprotein A-I-mediated signaling pathway (GO:0038027)|apoptotic cell clearance (GO:0043277)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|cell adhesion (GO:0007155)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cell-substrate adhesion (GO:0031589)|endodermal cell differentiation (GO:0035987)|entry of symbiont into host cell by promotion of host phagocytosis (GO:0052066)|ERK1 and ERK2 cascade (GO:0070371)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|negative chemotaxis (GO:0050919)|negative regulation of entry of bacterium into host cell (GO:2000536)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of lipid storage (GO:0010888)|negative regulation of lipid transport (GO:0032369)|negative regulation of lipoprotein metabolic process (GO:0050748)|negative regulation of low-density lipoprotein particle receptor biosynthetic process (GO:0045715)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of osteoblast proliferation (GO:0033690)|regulation of apoptotic cell clearance (GO:2000425)|regulation of phagocytosis (GO:0050764)|substrate adhesion-dependent cell spreading (GO:0034446)|viral entry into host cell (GO:0046718)	alphav-beta3 integrin-IGF-1-IGF1R complex (GO:0035867)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|integrin alphav-beta3 complex (GO:0034683)|integrin alphav-beta5 complex (GO:0034684)|integrin alphav-beta8 complex (GO:0034686)|integrin complex (GO:0008305)|lamellipodium membrane (GO:0031258)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	extracellular matrix binding (GO:0050840)|extracellular matrix protein binding (GO:1990430)|fibronectin binding (GO:0001968)|metal ion binding (GO:0046872)|protease binding (GO:0002020)|transforming growth factor beta binding (GO:0050431)|virus receptor activity (GO:0001618)|voltage-gated calcium channel activity (GO:0005245)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(19)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	47			OV - Ovarian serous cystadenocarcinoma(117;0.0185)|Epithelial(96;0.072)|all cancers(119;0.189)	STAD - Stomach adenocarcinoma(3;0.106)|COAD - Colon adenocarcinoma(31;0.108)	Antithymocyte globulin(DB00098)	TCTATATTGGGGATGACAACC	0.403																																					Melanoma(58;108 1995 6081)												0													145.0	139.0	141.0					2																	187529245		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS2292.1, CCDS46470.1, CCDS46471.1	2q31-q32	2012-04-20	2012-04-20		ENSG00000138448	ENSG00000138448		"""CD molecules"", ""Integrins"""	6150	protein-coding gene	gene with protein product		193210	"""antigen identified by monoclonal antibody L230"", ""vitronectin receptor"", ""integrin, alpha V (vitronectin receptor, alpha polypeptide, antigen CD51)"""	VNRA, MSK8, VTNR		2454952	Standard	NM_001144999		Approved	CD51	uc002upq.4	P06756	OTTHUMG00000132635	ENST00000261023.3:c.1950G>T	2.37:g.187529245G>T			A0AV67|B0LPF4|B7Z883|B7ZLX0|D3DPG8|E7EWZ6|Q53SK4|Q59EB7|Q6LD15	Silent	SNP	pfam_Integrin_alpha-2,pfam_FG-GAP,pfam_Integrin_alpha_C_CS,smart_Int_alpha_beta-p,prints_Integrin_alpha	p.G650	ENST00000261023.3	37	c.1950	CCDS2292.1	2																																																																																			ITGAV	-	pfam_Integrin_alpha-2	ENSG00000138448		0.403	ITGAV-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGAV	HGNC	protein_coding	OTTHUMT00000255882.2	-	0.00	49	0	G	NM_002210		187529245	+1	tier1	-	no_errors	ENST00000261023	ensembl	human	known	74_37	silent	6.78	54	4	SNP	0.997	T
ITGAX	3687	genome.wustl.edu	37	16	31390952	31390952	+	Silent	SNP	C	C	A			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr16:31390952C>A	ENST00000268296.4	+	24	2974	c.2853C>A	c.(2851-2853)gcC>gcA	p.A951A	ITGAX_ENST00000562522.1_Silent_p.A951A	NM_000887.3	NP_000878.2	P20702	ITAX_HUMAN	integrin, alpha X (complement component 3 receptor 4 subunit)	951					blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|organ morphogenesis (GO:0009887)	cell surface (GO:0009986)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|receptor activity (GO:0004872)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(42)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	77						GCCATGTGGCCATGCACAGAT	0.572																																																	0													40.0	31.0	34.0					16																	31390952		2193	4293	6486	SO:0001819	synonymous_variant	0			BC038237	CCDS10711.1, CCDS67014.1	16p11.2	2010-03-23	2006-02-10		ENSG00000140678	ENSG00000140678		"""CD molecules"", ""Complement system"", ""Integrins"""	6152	protein-coding gene	gene with protein product		151510	"""integrin, alpha X (antigen CD11C (p150), alpha polypeptide)"""	CD11C		3284962, 2303426	Standard	NM_001286375		Approved	CD11c	uc002ebu.1	P20702	OTTHUMG00000132465	ENST00000268296.4:c.2853C>A	16.37:g.31390952C>A			Q8IVA6	Silent	SNP	pfam_Integrin_alpha-2,pfam_VWF_A,pfam_FG-GAP,pfam_Integrin_alpha_C_CS,smart_Int_alpha_beta-p,smart_VWF_A,pfscan_VWF_A,prints_Integrin_alpha	p.A951	ENST00000268296.4	37	c.2853	CCDS10711.1	16																																																																																			ITGAX	-	pfam_Integrin_alpha-2	ENSG00000140678		0.572	ITGAX-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ITGAX	HGNC	protein_coding	OTTHUMT00000255628.2	-	0.00	47	0	C	NM_000887		31390952	+1	tier1	-	no_errors	ENST00000268296	ensembl	human	known	74_37	silent	21.21	52	14	SNP	0.000	A
IZUMO4	113177	genome.wustl.edu	37	19	2098979	2098979	+	Missense_Mutation	SNP	C	C	T	rs535248980		TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr19:2098979C>T	ENST00000395301.3	+	9	623	c.559C>T	c.(559-561)Cgc>Tgc	p.R187C	IZUMO4_ENST00000395307.2_Intron|IZUMO4_ENST00000588003.1_3'UTR|MOB3A_ENST00000357066.3_5'Flank	NM_001039846.1	NP_001034935.1	Q1ZYL8	IZUM4_HUMAN	IZUMO family member 4	187						extracellular region (GO:0005576)|nucleus (GO:0005634)				central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(1)|skin(1)|urinary_tract(1)	6						GAACAGACCACGCTCCTCTGC	0.617													C|||	1	0.000199681	0.0008	0.0	5008	,	,		15169	0.0		0.0	False		,,,				2504	0.0																0													92.0	102.0	99.0					19																	2098979		2144	4233	6377	SO:0001583	missense	0			BC014609	CCDS35499.1, CCDS42458.1	19p13.3	2014-02-17	2010-07-29	2010-07-29	ENSG00000099840	ENSG00000099840		"""-"""	26950	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 36"""	C19orf36		12975309, 19658160, 22957301	Standard	XM_005259480		Approved		uc002luw.1	Q1ZYL8	OTTHUMG00000141290	ENST00000395301.3:c.559C>T	19.37:g.2098979C>T	ENSP00000378712:p.Arg187Cys		A7RA93|A7RA94|Q6UXA2|Q96FT6|Q96L02	Missense_Mutation	SNP	NULL	p.R187C	ENST00000395301.3	37	c.559	CCDS42458.1	19	.	.	.	.	.	.	.	.	.	.	C	9.536	1.112139	0.20795	.	.	ENSG00000099840	ENST00000395301	T	0.25749	1.78	3.78	-7.55	0.01327	.	.	.	.	.	T	0.08935	0.0221	N	0.08118	0	0.09310	N	0.999999	B	0.02656	0.0	B	0.01281	0.0	T	0.28902	-1.0029	9	0.59425	D	0.04	.	1.1674	0.01818	0.1338:0.2372:0.3132:0.3158	.	187	Q1ZYL8	IZUM4_HUMAN	C	187	ENSP00000378712:R187C	ENSP00000378712:R187C	R	+	1	0	IZUMO4	2049979	0.000000	0.05858	0.000000	0.03702	0.013000	0.08279	-2.990000	0.00658	-2.226000	0.00723	-0.481000	0.04817	CGC	IZUMO4	-	NULL	ENSG00000099840		0.617	IZUMO4-004	KNOWN	basic|CCDS	protein_coding	IZUMO4	HGNC	protein_coding	OTTHUMT00000280536.3	-	0.00	39	0	C	NM_052878		2098979	+1	tier1	-	no_errors	ENST00000395301	ensembl	human	known	74_37	missense	8.00	46	4	SNP	0.000	T
JAKMIP3	282973	genome.wustl.edu	37	10	133930889	133930889	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr10:133930889G>T	ENST00000298622.4	+	2	582	c.444G>T	c.(442-444)gaG>gaT	p.E148D		NM_001105521.2	NP_001098991.1	Q5VZ66	JKIP3_HUMAN	Janus kinase and microtubule interacting protein 3	148						Golgi apparatus (GO:0005794)				breast(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(10)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)	31		all_cancers(35;5.63e-09)|all_epithelial(44;9.25e-07)|Lung NSC(174;0.0108)|all_lung(145;0.0173)|Colorectal(31;0.0721)|all_neural(114;0.0726)|Breast(234;0.0949)|Glioma(114;0.172)|Melanoma(40;0.175)		OV - Ovarian serous cystadenocarcinoma(35;0.000104)|Epithelial(32;0.000142)|all cancers(32;0.000185)|BRCA - Breast invasive adenocarcinoma(275;0.224)		AGGGGTTCGAGGTGGAGAAGG	0.622																																																	0													92.0	108.0	103.0					10																	133930889		2160	4256	6416	SO:0001583	missense	0			AL832756	CCDS44494.1	10q26.3	2009-04-23	2009-04-23	2008-01-28	ENSG00000188385	ENSG00000188385			23523	protein-coding gene	gene with protein product	"""neuroendocrine long coiled-coil 2"""	611198	"""chromosome 10 open reading frame 39"", ""chromosome 10 open reading frame 14"""	C10orf39, C10orf14		15277531, 17572408	Standard	NM_001105521		Approved	FLJ37857, NECC2, KIAA4091, bA140A10.5	uc001lkx.4	Q5VZ66	OTTHUMG00000150167	ENST00000298622.4:c.444G>T	10.37:g.133930889G>T	ENSP00000298622:p.Glu148Asp		A6PW00|Q69YM6|Q6ZT29	Missense_Mutation	SNP	NULL	p.E148D	ENST00000298622.4	37	c.444	CCDS44494.1	10	.	.	.	.	.	.	.	.	.	.	G	2.121	-0.401461	0.04865	.	.	ENSG00000188385	ENST00000298622	T	0.26067	1.76	4.53	3.63	0.41609	.	0.055126	0.64402	D	0.000001	T	0.09905	0.0243	N	0.03608	-0.345	0.24055	N	0.996036	B	0.19583	0.037	B	0.16722	0.016	T	0.19418	-1.0306	10	0.31617	T	0.26	-34.3933	5.911	0.19029	0.1693:0.1591:0.6715:0.0	.	148	Q5VZ66	JKIP3_HUMAN	D	148	ENSP00000298622:E148D	ENSP00000298622:E148D	E	+	3	2	JAKMIP3	133780879	0.001000	0.12720	1.000000	0.80357	0.993000	0.82548	-0.154000	0.10130	1.132000	0.42129	0.491000	0.48974	GAG	JAKMIP3	-	NULL	ENSG00000188385		0.622	JAKMIP3-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	JAKMIP3	HGNC	protein_coding	OTTHUMT00000051049.3	-	0.00	35	0	G	NM_194303		133930889	+1	tier1	-	no_errors	ENST00000298622	ensembl	human	known	74_37	missense	14.71	58	10	SNP	0.984	T
KAT6A	7994	genome.wustl.edu	37	8	41838370	41838370	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr8:41838370G>A	ENST00000396930.3	-	6	1444	c.901C>T	c.(901-903)Cca>Tca	p.P301S	KAT6A_ENST00000406337.1_Missense_Mutation_p.P301S|KAT6A_ENST00000485568.1_Missense_Mutation_p.P301S|KAT6A_ENST00000265713.2_Missense_Mutation_p.P301S	NM_001099412.1	NP_001092882.1	Q92794	KAT6A_HUMAN	K(lysine) acetyltransferase 6A	301	Interaction with PML.				aorta morphogenesis (GO:0035909)|cellular senescence (GO:0090398)|chromatin organization (GO:0006325)|DNA packaging (GO:0006323)|embryonic hemopoiesis (GO:0035162)|face morphogenesis (GO:0060325)|heart morphogenesis (GO:0003007)|histone acetylation (GO:0016573)|histone H3 acetylation (GO:0043966)|myeloid cell differentiation (GO:0030099)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome assembly (GO:0006334)|positive regulation of transcription, DNA-templated (GO:0045893)|protein acetylation (GO:0006473)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	Golgi apparatus (GO:0005794)|MOZ/MORF histone acetyltransferase complex (GO:0070776)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|PML body (GO:0016605)	acetyltransferase activity (GO:0016407)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)										TCACCTTTTGGCATACGGGTG	0.353																																																	0													146.0	153.0	150.0					8																	41838370		2203	4300	6503	SO:0001583	missense	0			U47742	CCDS6124.1	8p11	2013-01-28	2011-07-21	2011-07-21	ENSG00000083168	ENSG00000083168		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Zinc fingers, C2HC-type containing"", ""Zinc fingers, PHD-type"""	13013	protein-coding gene	gene with protein product	"""Monocytic leukemia zinc finger protein"""	601408	"""runt-related transcription factor binding protein 2"", ""MYST histone acetyltransferase (monocytic leukemia) 3"""	ZNF220, RUNXBP2, MYST3		8849440, 8782817	Standard	NM_001099412		Approved	MOZ, ZC2HC6A	uc003xon.4	Q92794	OTTHUMG00000150453	ENST00000396930.3:c.901C>T	8.37:g.41838370G>A	ENSP00000380136:p.Pro301Ser		Q76L81	Missense_Mutation	SNP	pfam_MOZ_SAS,pfam_Znf_PHD-finger,superfamily_Acyl_CoA_acyltransferase,superfamily_Znf_FYVE_PHD,smart_Histone_H1/H5_H15,smart_Znf_PHD,pfscan_Znf_PHD-finger	p.P301S	ENST00000396930.3	37	c.901	CCDS6124.1	8	.	.	.	.	.	.	.	.	.	.	G	16.28	3.079928	0.55753	.	.	ENSG00000083168	ENST00000265713;ENST00000406337;ENST00000396930;ENST00000485568	D;D;D;D	0.90004	-2.6;-2.6;-2.6;-2.52	5.25	5.25	0.73442	.	0.000000	0.64402	D	0.000002	D	0.95014	0.8386	M	0.82716	2.605	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.95311	0.8412	10	0.72032	D	0.01	-16.8541	19.205	0.93726	0.0:0.0:1.0:0.0	.	301;301	A5PLL3;Q92794	.;KAT6A_HUMAN	S	301	ENSP00000265713:P301S;ENSP00000385888:P301S;ENSP00000380136:P301S;ENSP00000430606:P301S	ENSP00000265713:P301S	P	-	1	0	KAT6A	41957527	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	9.420000	0.97426	2.596000	0.87737	0.563000	0.77884	CCA	KAT6A	-	pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,pfscan_Znf_PHD-finger	ENSG00000083168		0.353	KAT6A-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KAT6A	HGNC	protein_coding	OTTHUMT00000318163.1	-	0.00	56	0	G	NM_006766		41838370	-1	tier1	-	no_errors	ENST00000265713	ensembl	human	known	74_37	missense	10.00	36	4	SNP	1.000	A
KCNC3	3748	genome.wustl.edu	37	19	50826458	50826458	+	Silent	SNP	C	C	T			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr19:50826458C>T	ENST00000477616.1	-	2	2046	c.1752G>A	c.(1750-1752)ccG>ccA	p.P584P	KCNC3_ENST00000391818.2_Intron|KCNC3_ENST00000376959.2_Silent_p.P584P|KCNC3_ENST00000474951.1_Intron	NM_004977.2	NP_004968.2	Q14003	KCNC3_HUMAN	potassium voltage-gated channel, Shaw-related subfamily, member 3	584	Poly-Pro.				cell death (GO:0008219)|potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|regulation of neurotransmitter secretion (GO:0046928)|synaptic transmission (GO:0007268)	axolemma (GO:0030673)|axon terminus (GO:0043679)|dendrite membrane (GO:0032590)|neuromuscular junction (GO:0031594)|neuronal cell body membrane (GO:0032809)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|voltage-gated potassium channel activity (GO:0005249)			endometrium(2)|large_intestine(4)|lung(5)|pancreas(1)|skin(1)	13		all_neural(266;0.057)|Ovarian(192;0.208)		OV - Ovarian serous cystadenocarcinoma(262;0.00283)|GBM - Glioblastoma multiforme(134;0.0181)	Dalfampridine(DB06637)	GCGGGTGGGGCGGGGGTGGCG	0.721																																					Melanoma(91;1496 2324 50908)												0													1.0	2.0	2.0					19																	50826458		1080	2445	3525	SO:0001819	synonymous_variant	0			AB208930	CCDS12793.1	19q13.33	2014-09-17			ENSG00000131398	ENSG00000131398		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6235	protein-coding gene	gene with protein product		176264	"""spinocerebellar ataxia 13"""	SCA13		1740329, 8111118, 16382104	Standard	NM_004977		Approved	Kv3.3	uc002pru.1	Q14003	OTTHUMG00000044580	ENST00000477616.1:c.1752G>A	19.37:g.50826458C>T				Silent	SNP	pfam_Ion_trans_dom,pfam_T1-type_BTB,pfam_2pore_dom_K_chnl_dom,pfam_K_chnl_volt-dep_Kv3_ID,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl,prints_K_chnl_volt-dep_Kv3.3,prints_K_chnl_volt-dep_Kv3,prints_K_chnl_volt-dep_Kv	p.P584	ENST00000477616.1	37	c.1752	CCDS12793.1	19																																																																																			KCNC3	-	prints_K_chnl_volt-dep_Kv3.3	ENSG00000131398		0.721	KCNC3-005	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNC3	HGNC	protein_coding	OTTHUMT00000314288.2	-	0.00	22	0	C	NM_004977		50826458	-1	tier1	-	no_errors	ENST00000477616	ensembl	human	known	74_37	silent	31.82	15	7	SNP	0.003	T
KCTD1	284252	genome.wustl.edu	37	18	24056534	24056534	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr18:24056534C>G	ENST00000408011.3	-	3	813	c.254G>C	c.(253-255)aGa>aCa	p.R85T	KCTD1_ENST00000579973.1_Missense_Mutation_p.R85T|KCTD1_ENST00000580059.1_Missense_Mutation_p.R85T|KCTD1_ENST00000417602.1_Missense_Mutation_p.R693T|KCTD1_ENST00000317932.7_Missense_Mutation_p.R85T	NM_001136205.2	NP_001129677.1	Q719H9	KCTD1_HUMAN	potassium channel tetramerization domain containing 1	85	BTB.				negative regulation of transcription, DNA-templated (GO:0045892)|protein homooligomerization (GO:0051260)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)			endometrium(2)|large_intestine(3)|lung(3)|ovary(1)|prostate(3)	12	all_cancers(21;0.00191)|Lung NSC(5;0.000698)|all_lung(6;0.0019)|Ovarian(20;0.0848)		Epithelial(2;7.8e-06)|OV - Ovarian serous cystadenocarcinoma(3;9.02e-06)|all cancers(3;3.37e-05)			CAAGATATATCTGAACATCTG	0.368																																																	0													93.0	81.0	85.0					18																	24056534		2203	4300	6503	SO:0001583	missense	0			AF542549	CCDS11888.1	18q11.2	2013-09-20	2013-06-20		ENSG00000134504	ENSG00000134504			18249	protein-coding gene	gene with protein product		613420	"""potassium channel tetramerisation domain containing 1"""	C18orf5			Standard	NM_001142730		Approved		uc010xbj.3	Q719H9	OTTHUMG00000131947	ENST00000408011.3:c.254G>C	18.37:g.24056534C>G	ENSP00000384367:p.Arg85Thr		A8K1F5	Missense_Mutation	SNP	pfam_DUF3504,pfam_T1-type_BTB,superfamily_BTB/POZ_fold,smart_BTB/POZ-like	p.R693T	ENST00000408011.3	37	c.2078	CCDS11888.1	18	.	.	.	.	.	.	.	.	.	.	C	28.6	4.934882	0.92458	.	.	ENSG00000134504	ENST00000317932;ENST00000417602;ENST00000408011	T;T;T	0.49139	0.79;0.79;0.79	5.78	5.78	0.91487	BTB/POZ-like (1);BTB/POZ fold (2);Potassium channel, voltage dependent, Kv, tetramerisation (1);	0.000000	0.85682	D	0.000000	T	0.72104	0.3419	M	0.80183	2.485	0.80722	D	1	D	0.63046	0.992	D	0.70016	0.967	T	0.73827	-0.3860	10	0.62326	D	0.03	.	20.0026	0.97425	0.0:1.0:0.0:0.0	.	85	Q719H9	KCTD1_HUMAN	T	85;693;85	ENSP00000314831:R85T;ENSP00000408405:R693T;ENSP00000384367:R85T	ENSP00000314831:R85T	R	-	2	0	KCTD1	22310532	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.405000	0.80007	2.722000	0.93159	0.650000	0.86243	AGA	KCTD1	-	pfam_T1-type_BTB,superfamily_BTB/POZ_fold,smart_BTB/POZ-like	ENSG00000134504		0.368	KCTD1-003	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	KCTD1	HGNC	protein_coding	OTTHUMT00000446265.1		0.00	50	0	C	XM_209091		24056534	-1			no_errors	ENST00000417602	ensembl	human	known	74_37	missense	5.41	35	2	SNP	1.000	G
KDM4C	23081	genome.wustl.edu	37	9	7011779	7011779	+	Missense_Mutation	SNP	C	C	G	rs144567752		TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr9:7011779C>G	ENST00000381309.3	+	13	2433	c.1868C>G	c.(1867-1869)aCg>aGg	p.T623R	KDM4C_ENST00000428870.2_Missense_Mutation_p.T310R|KDM4C_ENST00000442236.2_Missense_Mutation_p.T368R|KDM4C_ENST00000543771.1_Missense_Mutation_p.T623R|KDM4C_ENST00000381306.3_Missense_Mutation_p.T623R|KDM4C_ENST00000535193.1_Missense_Mutation_p.T645R|KDM4C_ENST00000536108.1_Missense_Mutation_p.T442R	NM_015061.3	NP_055876.2	Q9H3R0	KDM4C_HUMAN	lysine (K)-specific demethylase 4C	623					histone H3-K9 demethylation (GO:0033169)|positive regulation of cell proliferation (GO:0008284)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)	androgen receptor binding (GO:0050681)|dioxygenase activity (GO:0051213)|enzyme binding (GO:0019899)|histone demethylase activity (H3-K9 specific) (GO:0032454)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(8)|lung(14)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	43						CTTTGGCAGACGAAGTCCCCT	0.517																																																	0													102.0	95.0	97.0					9																	7011779		2203	4300	6503	SO:0001583	missense	0			AB018323	CCDS6471.1, CCDS55285.1, CCDS55286.1, CCDS55287.1	9p24-p23	2013-01-23	2009-04-06	2009-04-06	ENSG00000107077	ENSG00000107077		"""Chromatin-modifying enzymes / K-demethylases"", ""Tudor domain containing"""	17071	protein-coding gene	gene with protein product	"""tudor domain containing 14C"""	605469	"""jumonji domain containing 2C"""	JMJD2C		9872452, 15138608	Standard	NM_015061		Approved	GASC1, KIAA0780, TDRD14C	uc003zkh.3	Q9H3R0	OTTHUMG00000019536	ENST00000381309.3:c.1868C>G	9.37:g.7011779C>G	ENSP00000370710:p.Thr623Arg		B4E1Y4|B7ZL46|F5H347|F5H7P0|O94877|Q2M3M0|Q5JUC9|Q5VYJ2|Q5VYJ3	Missense_Mutation	SNP	pfam_JmjC_dom,pfam_TF_JmjN,superfamily_Znf_FYVE_PHD,superfamily_Chorismate_mutase_type_II,smart_TF_JmjN,smart_JmjC_dom,smart_Znf_PHD,smart_Tudor,pfscan_TF_JmjN,pfscan_JmjC_dom	p.T623R	ENST00000381309.3	37	c.1868	CCDS6471.1	9	.	.	.	.	.	.	.	.	.	.	C	18.78	3.697864	0.68386	.	.	ENSG00000107077	ENST00000535193;ENST00000543771;ENST00000381309;ENST00000381306;ENST00000442236;ENST00000536108;ENST00000428870	T;T;T;T;T;T;T	0.53423	0.62;0.62;0.62;0.62;0.62;0.62;0.62	5.76	4.83	0.62350	.	0.219510	0.45606	D	0.000348	T	0.59865	0.2225	L	0.60455	1.87	0.50813	D	0.999894	D;D;D;P;P	0.69078	0.984;0.997;0.988;0.759;0.91	P;P;P;B;P	0.61070	0.691;0.883;0.789;0.245;0.624	T	0.61964	-0.6954	10	0.72032	D	0.01	-26.9629	12.4732	0.55799	0.1318:0.7413:0.1269:0.0	.	368;623;645;623;623	E7EV17;F5H347;F5H7P0;Q9H3R0;Q9H3R0-2	.;.;.;KDM4C_HUMAN;.	R	645;623;623;623;368;442;310	ENSP00000442382:T645R;ENSP00000445427:T623R;ENSP00000370710:T623R;ENSP00000370707:T623R;ENSP00000409353:T368R;ENSP00000440656:T442R;ENSP00000405739:T310R	ENSP00000370707:T623R	T	+	2	0	KDM4C	7001779	0.904000	0.30761	0.965000	0.40720	0.869000	0.49853	1.841000	0.39240	2.713000	0.92767	0.655000	0.94253	ACG	KDM4C	-	NULL	ENSG00000107077		0.517	KDM4C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KDM4C	HGNC	protein_coding	OTTHUMT00000051692.1		0.00	59	0	C	NM_015061		7011779	+1			no_errors	ENST00000381309	ensembl	human	known	74_37	missense	6.06	31	2	SNP	0.879	G
CEMIP	57214	genome.wustl.edu	37	15	81201538	81201538	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr15:81201538G>A	ENST00000394685.3	+	14	2107	c.1688G>A	c.(1687-1689)gGt>gAt	p.G563D	KIAA1199_ENST00000220244.3_Missense_Mutation_p.G563D|RP11-351M8.2_ENST00000560873.1_RNA|KIAA1199_ENST00000356249.5_Missense_Mutation_p.G563D|RP11-351M8.1_ENST00000560560.1_Intron			Q8WUJ3	CEMIP_HUMAN		563	Necessary for its endoplasmic reticulum (ER) retention and interaction with HSPA5.			HFHLAGD -> TRPPTRP (in Ref. 6; CAB94391). {ECO:0000305}.	hyaluronan catabolic process (GO:0030214)|positive regulation of cell migration (GO:0030335)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of protein kinase C activity (GO:1900020)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|sensory perception of sound (GO:0007605)	clathrin-coated vesicle membrane (GO:0030665)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	clathrin heavy chain binding (GO:0032050)|ER retention sequence binding (GO:0046923)|hyaluronic acid binding (GO:0005540)|hyalurononglucosaminidase activity (GO:0004415)			breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(10)|lung(14)|ovary(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	49						CACCTGGCCGGTGATGTAGAC	0.542																																																	0													164.0	118.0	133.0					15																	81201538		2203	4300	6503	SO:0001583	missense	0																														ENST00000394685.3:c.1688G>A	15.37:g.81201538G>A	ENSP00000378177:p.Gly563Asp		Q6L9J5|Q9H1K5|Q9NPN9|Q9ULM1	Missense_Mutation	SNP	pfam_G8_domain,superfamily_Pectin_lyase_fold/virulence	p.G563D	ENST00000394685.3	37	c.1688	CCDS10315.1	15	.	.	.	.	.	.	.	.	.	.	G	16.57	3.161538	0.57368	.	.	ENSG00000103888	ENST00000220244;ENST00000394685;ENST00000356249;ENST00000394683	D;D;D	0.94092	-3.35;-3.35;-3.35	4.57	4.57	0.56435	Pectin lyase fold/virulence factor (1);	0.000000	0.85682	D	0.000000	D	0.97235	0.9096	M	0.90198	3.095	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.97782	1.0233	10	0.56958	D	0.05	-21.276	17.5272	0.87804	0.0:0.0:1.0:0.0	.	563	Q8WUJ3	K1199_HUMAN	D	563	ENSP00000220244:G563D;ENSP00000378177:G563D;ENSP00000348583:G563D	ENSP00000220244:G563D	G	+	2	0	KIAA1199	78988593	1.000000	0.71417	0.065000	0.19835	0.040000	0.13550	7.275000	0.78548	2.368000	0.80403	0.467000	0.42956	GGT	KIAA1199	-	superfamily_Pectin_lyase_fold/virulence	ENSG00000103888		0.542	KIAA1199-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1199	HGNC	protein_coding	OTTHUMT00000291389.1	-	0.00	54	0	G			81201538	+1	tier1	-	no_errors	ENST00000220244	ensembl	human	known	74_37	missense	13.70	63	10	SNP	0.998	A
KIAA2018	205717	genome.wustl.edu	37	3	113378493	113378493	+	Nonsense_Mutation	SNP	G	G	T			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr3:113378493G>T	ENST00000478658.1	-	5	2053	c.2036C>A	c.(2035-2037)tCa>tAa	p.S679*	KIAA2018_ENST00000491165.1_Intron|KIAA2018_ENST00000316407.4_Nonsense_Mutation_p.S679*			Q68DE3	K2018_HUMAN	KIAA2018	679						membrane (GO:0016020)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity (GO:0004571)			NS(1)|breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|liver(1)|lung(30)|ovary(8)|skin(5)|upper_aerodigestive_tract(4)|urinary_tract(2)	80						AGTTCCTGATGAAGACATCAC	0.413																																																	0													109.0	104.0	106.0					3																	113378493		1866	4107	5973	SO:0001587	stop_gained	0			AB095938	CCDS43133.1	3q13.2	2014-01-02			ENSG00000176542	ENSG00000176542			30494	protein-coding gene	gene with protein product							Standard	XM_005247208		Approved		uc003eam.3	Q68DE3	OTTHUMG00000159322	ENST00000478658.1:c.2036C>A	3.37:g.113378493G>T	ENSP00000420721:p.Ser679*		Q7Z3L9|Q8IVF3|Q9H8T4	Nonsense_Mutation	SNP	pfam_bHLH_dom,superfamily_bHLH_dom,smart_bHLH_dom,pfscan_bHLH_dom	p.S679*	ENST00000478658.1	37	c.2036	CCDS43133.1	3	.	.	.	.	.	.	.	.	.	.	G	37	5.996819	0.97184	.	.	ENSG00000176542	ENST00000316407;ENST00000478658	.	.	.	5.27	5.27	0.74061	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-12.37	15.2767	0.73748	0.0:0.1405:0.8595:0.0	.	.	.	.	X	679	.	ENSP00000320794:S679X	S	-	2	0	KIAA2018	114861183	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.124000	0.77185	2.449000	0.82847	0.650000	0.86243	TCA	KIAA2018	-	NULL	ENSG00000176542		0.413	KIAA2018-003	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	KIAA2018	HGNC	protein_coding	OTTHUMT00000354591.1		0.00	43	0	G	NM_001009899		113378493	-1			no_errors	ENST00000316407	ensembl	human	known	74_37	nonsense	5.66	50	3	SNP	1.000	T
KLF11	8462	genome.wustl.edu	37	2	10192515	10192515	+	Missense_Mutation	SNP	C	C	T	rs532353853		TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr2:10192515C>T	ENST00000305883.1	+	4	1582	c.1420C>T	c.(1420-1422)Cgg>Tgg	p.R474W	KLF11_ENST00000540845.1_Missense_Mutation_p.R457W|KLF11_ENST00000535335.1_Missense_Mutation_p.R457W|RP11-254F7.3_ENST00000607181.1_RNA	NM_003597.4	NP_003588.1	O14901	KLF11_HUMAN	Kruppel-like factor 11	474					apoptotic process (GO:0006915)|cellular response to peptide (GO:1901653)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of apoptotic process (GO:0043065)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			endometrium(2)|kidney(1)|large_intestine(2)|lung(5)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	16	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.133)|OV - Ovarian serous cystadenocarcinoma(76;0.228)		GAAGCATGCCCGGCGCCACAT	0.612													C|||	1	0.000199681	0.0	0.0	5008	,	,		17683	0.001		0.0	False		,,,				2504	0.0				Melanoma(56;431 1507 23687 50789)												0													76.0	72.0	73.0					2																	10192515		2203	4300	6503	SO:0001583	missense	0			AF028008	CCDS1668.1, CCDS54333.1	2p25	2013-01-08	2004-11-29	2004-12-01	ENSG00000172059	ENSG00000172059		"""Kruppel-like transcription factors"", ""Zinc fingers, C2H2-type"""	11811	protein-coding gene	gene with protein product		603301	"""TGFB inducible early growth response 2"""	TIEG2		9748269, 11087666	Standard	NM_001177716		Approved	Tieg3, MODY7	uc002raf.1	O14901	OTTHUMG00000119004	ENST00000305883.1:c.1420C>T	2.37:g.10192515C>T	ENSP00000307023:p.Arg474Trp		B4DZE7|Q9EPF4	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.R474W	ENST00000305883.1	37	c.1420	CCDS1668.1	2	.	.	.	.	.	.	.	.	.	.	C	35	5.522937	0.96431	.	.	ENSG00000172059	ENST00000305883;ENST00000540845;ENST00000535335	T;T;T	0.72051	-0.62;-0.62;-0.62	6.08	6.08	0.98989	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	D	0.86477	0.5942	M	0.82716	2.605	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	D	0.86801	0.1992	10	0.87932	D	0	.	20.6721	0.99693	0.0:1.0:0.0:0.0	.	474	O14901	KLF11_HUMAN	W	474;457;457	ENSP00000307023:R474W;ENSP00000444690:R457W;ENSP00000442722:R457W	ENSP00000307023:R474W	R	+	1	2	KLF11	10109966	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	7.792000	0.85828	2.894000	0.99253	0.591000	0.81541	CGG	KLF11	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000172059		0.612	KLF11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KLF11	HGNC	protein_coding	OTTHUMT00000239202.3		0.00	17	0	C	NM_003597		10192515	+1			no_errors	ENST00000305883	ensembl	human	known	74_37	missense	8.70	21	2	SNP	1.000	T
KMT2E	55904	genome.wustl.edu	37	7	104746087	104746087	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr7:104746087G>A	ENST00000311117.3	+	18	2943	c.2398G>A	c.(2398-2400)Gaa>Aaa	p.E800K	KMT2E_ENST00000257745.4_Missense_Mutation_p.E800K|CTB-152G17.6_ENST00000607968.1_RNA|KMT2E_ENST00000334877.4_Missense_Mutation_p.E800K|KMT2E_ENST00000334914.7_5'UTR	NM_182931.2	NP_891847.1	Q8IZD2	KMT2E_HUMAN	lysine (K)-specific methyltransferase 2E	800					cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|DNA methylation (GO:0006306)|erythrocyte differentiation (GO:0030218)|histone H3-K4 methylation (GO:0051568)|neutrophil activation (GO:0042119)|neutrophil mediated immunity (GO:0002446)|positive regulation of granulocyte differentiation (GO:0030854)|positive regulation of transcription, DNA-templated (GO:0045893)|retinoic acid receptor signaling pathway (GO:0048384)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|MLL5-L complex (GO:0070688)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)										ATTCCTTTCAGAAAAAAGGAG	0.363																																																	0													86.0	86.0	86.0					7																	104746087		2202	4300	6502	SO:0001583	missense	0			AF067804	CCDS34723.1	7q22.1	2013-05-09	2013-05-09	2013-05-09	ENSG00000005483	ENSG00000005483		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	18541	protein-coding gene	gene with protein product		608444	"""myeloid/lymphoid or mixed-lineage leukemia 5 (trithorax homolog, Drosophila)"""	MLL5		9218106, 7672722	Standard	XM_005250493		Approved	HDCMC04P		Q8IZD2	OTTHUMG00000157403	ENST00000311117.3:c.2398G>A	7.37:g.104746087G>A	ENSP00000312379:p.Glu800Lys		B6ZDE4|B6ZDM3|M4K8J3|Q6P5Y2|Q6PKG4|Q6T316|Q86TI3|Q86W12|Q86WG0|Q86WL2|Q8IV78|Q8IWR5|Q8NFF8|Q9NWE7	Missense_Mutation	SNP	pfam_SET_dom,pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,smart_SET_dom,pfscan_SET_dom,pfscan_Znf_PHD-finger	p.E800K	ENST00000311117.3	37	c.2398	CCDS34723.1	7	.	.	.	.	.	.	.	.	.	.	G	21.3	4.133530	0.77662	.	.	ENSG00000005483	ENST00000311117;ENST00000393656;ENST00000334877;ENST00000351043;ENST00000257745	D;D;D	0.93133	-3.17;-2.74;-3.17	6.04	6.04	0.98038	.	0.156527	0.56097	D	0.000025	D	0.91012	0.7173	L	0.48642	1.525	0.80722	D	1	P	0.43094	0.799	B	0.35931	0.214	D	0.91294	0.5061	10	0.62326	D	0.03	.	20.5948	0.99439	0.0:0.0:1.0:0.0	.	800	Q8IZD2	MLL5_HUMAN	K	800;800;800;720;800	ENSP00000312379:E800K;ENSP00000335599:E800K;ENSP00000257745:E800K	ENSP00000257745:E800K	E	+	1	0	MLL5	104533323	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.626000	0.90969	2.873000	0.98535	0.563000	0.77884	GAA	KMT2E	-	NULL	ENSG00000005483		0.363	KMT2E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KMT2E	HGNC	protein_coding	OTTHUMT00000348697.1		0.00	42	0	G			104746087	+1			no_errors	ENST00000257745	ensembl	human	known	74_37	missense	5.41	34	2	SNP	1.000	A
KRT27	342574	genome.wustl.edu	37	17	38933254	38933254	+	Silent	SNP	G	G	A			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr17:38933254G>A	ENST00000301656.3	-	8	1417	c.1377C>T	c.(1375-1377)tcC>tcT	p.S459S	KRT27_ENST00000540723.1_5'UTR	NM_181537.3	NP_853515.2			keratin 27											NS(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(6)|ovary(1)|prostate(3)|skin(1)|stomach(1)	21		Breast(137;0.000812)				CTGGAGTTCAGGAAGACACCC	0.423																																																	0													107.0	109.0	108.0					17																	38933254		2203	4300	6503	SO:0001819	synonymous_variant	0			AJ564206	CCDS11375.1	17q21.2	2013-01-16	2006-07-17	2006-07-17	ENSG00000171446	ENSG00000171446		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	30841	protein-coding gene	gene with protein product			"""keratin 25C"""	KRT25C		16831889	Standard	NM_181537		Approved		uc002hvg.3	Q7Z3Y8	OTTHUMG00000133371	ENST00000301656.3:c.1377C>T	17.37:g.38933254G>A				Silent	SNP	pfam_IF,superfamily_Prefoldin,prints_Keratin_I	p.S459	ENST00000301656.3	37	c.1377	CCDS11375.1	17																																																																																			KRT27	-	NULL	ENSG00000171446		0.423	KRT27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT27	HGNC	protein_coding	OTTHUMT00000257216.1	-	0.00	63	0	G	NM_181537		38933254	-1	tier1	-	no_errors	ENST00000301656	ensembl	human	known	74_37	silent	64.29	15	27	SNP	0.773	A
KRTAP1-5	83895	genome.wustl.edu	37	17	39183284	39183284	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr17:39183284T>C	ENST00000361883.5	-	1	170	c.124A>G	c.(124-126)Act>Gct	p.T42A		NM_031957.1	NP_114163.1	Q9BYS1	KRA15_HUMAN	keratin associated protein 1-5	42	15 X 5 AA repeats of C-C-[QEPVRC]- [TPIVLE]-[SRHVP].					keratin filament (GO:0045095)				central_nervous_system(1)|endometrium(2)|kidney(1)|lung(9)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(2)	17		Breast(137;0.00043)	STAD - Stomach adenocarcinoma(17;0.000371)			CAGAAGCTAGTCTGGCAGCTG	0.612																																																	0													46.0	52.0	50.0					17																	39183284		1994	4195	6189	SO:0001583	missense	0			AJ406928	CCDS42321.1	17q21.2	2013-06-25			ENSG00000221852	ENSG00000221852		"""Keratin associated proteins"""	16777	protein-coding gene	gene with protein product		608822				11279113	Standard	NM_031957		Approved	KAP1.5	uc002hvu.3	Q9BYS1	OTTHUMG00000133587	ENST00000361883.5:c.124A>G	17.37:g.39183284T>C	ENSP00000355302:p.Thr42Ala		A6NJW6|A6NLZ6|B6ZDR1|Q52LP6	Missense_Mutation	SNP	pfam_Keratin-assoc	p.T42A	ENST00000361883.5	37	c.124	CCDS42321.1	17	.	.	.	.	.	.	.	.	.	.	T	1.518	-0.547775	0.04024	.	.	ENSG00000221852	ENST00000361883;ENST00000543389	T	0.31510	1.49	1.67	-1.06	0.10002	.	.	.	.	.	T	0.28234	0.0697	M	0.79475	2.455	0.09310	N	1	B	0.10296	0.003	B	0.04013	0.001	T	0.32771	-0.9894	9	0.32370	T	0.25	.	3.2953	0.06964	0.0:0.1651:0.2378:0.5971	.	42	Q9BYS1	KRA15_HUMAN	A	42	ENSP00000355302:T42A	ENSP00000355302:T42A	T	-	1	0	KRTAP1-5	36436810	0.002000	0.14202	0.000000	0.03702	0.135000	0.20990	-0.402000	0.07223	-0.325000	0.08577	0.260000	0.18958	ACT	KRTAP1-5	-	pfam_Keratin-assoc	ENSG00000221852		0.612	KRTAP1-5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP1-5	HGNC	protein_coding	OTTHUMT00000257691.1	-	0.00	156	0	T			39183284	-1	tier1	-	no_errors	ENST00000361883	ensembl	human	known	74_37	missense	15.28	122	22	SNP	0.000	C
L3MBTL3	84456	genome.wustl.edu	37	6	130415492	130415492	+	Silent	SNP	G	G	T	rs143084734	byFrequency	TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr6:130415492G>T	ENST00000529410.1	+	20	2195	c.1716G>T	c.(1714-1716)gcG>gcT	p.A572A	L3MBTL3_ENST00000533560.1_Silent_p.A547A|L3MBTL3_ENST00000368139.2_Silent_p.A547A|L3MBTL3_ENST00000526019.1_Silent_p.A547A|L3MBTL3_ENST00000368136.2_Silent_p.A572A|L3MBTL3_ENST00000361794.2_Silent_p.A572A			Q96JM7	LMBL3_HUMAN	l(3)mbt-like 3 (Drosophila)	572					chromatin modification (GO:0016568)|erythrocyte maturation (GO:0043249)|granulocyte differentiation (GO:0030851)|macrophage differentiation (GO:0030225)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				cervix(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(22)|ovary(5)|skin(4)|stomach(1)|urinary_tract(1)	43				GBM - Glioblastoma multiforme(226;0.0266)|OV - Ovarian serous cystadenocarcinoma(155;0.154)		TCAAGAGAGCGAGACATCTGG	0.418																																																	0													77.0	72.0	74.0					6																	130415492		2203	4300	6503	SO:0001819	synonymous_variant	0			AB058701	CCDS34537.1, CCDS34538.1	6q23	2013-01-10			ENSG00000198945	ENSG00000198945		"""Sterile alpha motif (SAM) domain containing"""	23035	protein-coding gene	gene with protein product							Standard	NM_032438		Approved	KIAA1798	uc003qbt.3	Q96JM7	OTTHUMG00000015554	ENST00000529410.1:c.1716G>T	6.37:g.130415492G>T			Q4VXE1|Q5VUM9|Q6P9B5	Silent	SNP	pfam_Mbt,pfam_SAM_type1,pfam_SAM_2,superfamily_SAM/pointed,smart_Mbt,smart_SAM,pfscan_Mbt,pfscan_SAM	p.A572	ENST00000529410.1	37	c.1716	CCDS34537.1	6																																																																																			L3MBTL3	-	NULL	ENSG00000198945		0.418	L3MBTL3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	L3MBTL3	HGNC	protein_coding	OTTHUMT00000042195.2		0.00	50	0	G	XM_027074		130415492	+1			no_errors	ENST00000361794	ensembl	human	known	74_37	silent	6.78	55	4	SNP	0.015	T
LCT	3938	genome.wustl.edu	37	2	136547232	136547232	+	Frame_Shift_Del	DEL	G	G	-			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr2:136547232delG	ENST00000264162.2	-	16	5482	c.5472delC	c.(5470-5472)cccfs	p.P1824fs		NM_002299.2	NP_002290.2	P09848	LPH_HUMAN	lactase	1824	4 X approximate repeats.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	glycosylceramidase activity (GO:0017042)|lactase activity (GO:0000016)			breast(6)|central_nervous_system(3)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(26)|lung(57)|ovary(7)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(4)	124				BRCA - Breast invasive adenocarcinoma(221;0.169)	Vitamin C(DB00126)	CTGATGCTTTGGGGATCCTTG	0.532																																																	0													120.0	115.0	117.0					2																	136547232		2203	4300	6503	SO:0001589	frameshift_variant	0			X07994	CCDS2178.1	2q21	2014-09-17			ENSG00000115850	ENSG00000115850	3.2.1.108, 3.2.1.62		6530	protein-coding gene	gene with protein product		603202					Standard	NM_002299		Approved		uc002tuu.1	P09848	OTTHUMG00000131738	ENST00000264162.2:c.5472delC	2.37:g.136547232delG	ENSP00000264162:p.Pro1824fs		Q4ZG58	Frame_Shift_Del	DEL	pfam_Glyco_hydro_1,superfamily_Glycoside_hydrolase_SF,prints_Glyco_hydro_1	p.A1826fs	ENST00000264162.2	37	c.5472	CCDS2178.1	2																																																																																			LCT	-	pfam_Glyco_hydro_1,superfamily_Glycoside_hydrolase_SF	ENSG00000115850		0.532	LCT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LCT	HGNC	protein_coding	OTTHUMT00000254657.1		0.00	46	0	G	NM_002299		136547232	-1	tier1		no_errors	ENST00000264162	ensembl	human	known	74_37	frame_shift_del	6.25	30	2	DEL	1.000	-
LIMA1	51474	genome.wustl.edu	37	12	50615967	50615967	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr12:50615967G>A	ENST00000341247.4	-	4	616	c.467C>T	c.(466-468)aCa>aTa	p.T156I	LIMA1_ENST00000552783.1_5'UTR|LIMA1_ENST00000394943.3_Missense_Mutation_p.T156I|LIMA1_ENST00000552909.1_5'UTR|LIMA1_ENST00000552823.1_5'UTR|LIMA1_ENST00000552008.1_5'Flank|RP3-405J10.4_ENST00000551284.1_RNA	NM_001113546.1|NM_016357.4	NP_001107018.1|NP_057441.1	Q9UHB6	LIMA1_HUMAN	LIM domain and actin binding 1	156					actin filament bundle assembly (GO:0051017)|negative regulation of actin filament depolymerization (GO:0030835)|ruffle organization (GO:0031529)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|stress fiber (GO:0001725)	actin filament binding (GO:0051015)|actin monomer binding (GO:0003785)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(17)|ovary(1)|prostate(2)|skin(2)	44						TTTACTTTCTGTTGAGTGGTC	0.433																																																	0													155.0	139.0	144.0					12																	50615967		2203	4300	6503	SO:0001583	missense	0			AF198454	CCDS8802.1, CCDS44877.1, CCDS55826.1, CCDS58230.1	12q13.12	2006-04-12				ENSG00000050405			24636	protein-coding gene	gene with protein product	"""epithelial protein lost in neoplasm beta"""	608364				10806352, 10618726, 12566430	Standard	NM_016357		Approved	EPLIN	uc001rwk.4	Q9UHB6		ENST00000341247.4:c.467C>T	12.37:g.50615967G>A	ENSP00000340184:p.Thr156Ile		B2RB09|Q2TAN7|Q59FE8|Q9BVF2|Q9H8J1|Q9HBN5|Q9NX96|Q9NXC3|Q9NXU6|Q9P0H8|Q9UHB5	Missense_Mutation	SNP	pfam_Znf_LIM,smart_Znf_LIM,pfscan_Znf_LIM	p.T156I	ENST00000341247.4	37	c.467	CCDS8802.1	12	.	.	.	.	.	.	.	.	.	.	G	10.83	1.462341	0.26248	.	.	ENSG00000050405	ENST00000394943;ENST00000341247;ENST00000420992	D;T	0.84516	-1.86;-1.13	5.93	1.58	0.23477	.	0.804031	0.11818	N	0.526550	T	0.77644	0.4161	L	0.47716	1.5	0.19775	N	0.999955	B;B	0.06786	0.001;0.001	B;B	0.04013	0.001;0.001	T	0.64664	-0.6354	10	0.38643	T	0.18	.	6.1292	0.20195	0.1575:0.0:0.5629:0.2796	.	165;156	Q59FE8;Q9UHB6	.;LIMA1_HUMAN	I	156;156;75	ENSP00000378400:T156I;ENSP00000340184:T156I	ENSP00000340184:T156I	T	-	2	0	LIMA1	48902234	0.000000	0.05858	0.031000	0.17742	0.977000	0.68977	-0.096000	0.11059	0.829000	0.34733	0.655000	0.94253	ACA	LIMA1	-	NULL	ENSG00000050405		0.433	LIMA1-003	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	LIMA1	HGNC	protein_coding	OTTHUMT00000406235.2	-	0.00	61	0	G	NM_016357		50615967	-1	tier1	-	no_errors	ENST00000394943	ensembl	human	known	74_37	missense	5.41	70	4	SNP	0.004	A
LINGO2	158038	genome.wustl.edu	37	9	27950045	27950045	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr9:27950045T>C	ENST00000379992.2	-	6	1074	c.625A>G	c.(625-627)Aag>Gag	p.K209E	LINGO2_ENST00000308675.3_Missense_Mutation_p.K209E	NM_152570.2	NP_689783.1	Q7L985	LIGO2_HUMAN	leucine rich repeat and Ig domain containing 2	209						integral component of membrane (GO:0016021)				autonomic_ganglia(1)|breast(2)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|liver(1)|lung(13)|ovary(2)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)	44	Melanoma(11;0.242)	all_neural(11;2.78e-09)		UCEC - Uterine corpus endometrioid carcinoma (5;0.0818)|GBM - Glioblastoma multiforme(2;1.31e-34)|all cancers(2;2.37e-25)|Lung(2;7.48e-08)|LUSC - Lung squamous cell carcinoma(38;5.09e-07)|KIRC - Kidney renal clear cell carcinoma(2;0.0465)|Kidney(2;0.0604)		TTGAGATGCTTCAGATGCAGG	0.468																																																	0													79.0	81.0	81.0					9																	27950045		2203	4300	6503	SO:0001583	missense	0			AL353746	CCDS6524.1	9p21.2	2013-01-11	2007-02-01	2007-02-01	ENSG00000174482	ENSG00000174482		"""Immunoglobulin superfamily / I-set domain containing"""	21207	protein-coding gene	gene with protein product		609793	"""leucine rich repeat neuronal 6C"""	LRRN6C		14686891	Standard	NM_152570		Approved	LERN3	uc003zqu.2	Q7L985	OTTHUMG00000019721	ENST00000379992.2:c.625A>G	9.37:g.27950045T>C	ENSP00000369328:p.Lys209Glu		A8K4K7|B2RPM5|Q6ZMD0	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Leu-rich_rpt,pfam_Ig_V-set,pfam_LRR-contain_N,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.K209E	ENST00000379992.2	37	c.625	CCDS6524.1	9	.	.	.	.	.	.	.	.	.	.	T	12.39	1.922795	0.33908	.	.	ENSG00000174482	ENST00000379992;ENST00000308675	T;T	0.79033	-1.23;-1.23	6.17	5.0	0.66597	.	0.167538	0.50627	D	0.000115	T	0.56615	0.1997	N	0.05177	-0.1	0.49130	D	0.999756	B	0.12013	0.005	B	0.17098	0.017	T	0.53878	-0.8376	9	.	.	.	.	12.4297	0.55567	0.0:0.0:0.2625:0.7375	.	209	Q7L985	LIGO2_HUMAN	E	209	ENSP00000369328:K209E;ENSP00000310126:K209E	.	K	-	1	0	LINGO2	27940045	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.382000	0.44345	2.371000	0.80710	0.533000	0.62120	AAG	LINGO2	-	smart_Leu-rich_rpt_typical-subtyp	ENSG00000174482		0.468	LINGO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LINGO2	HGNC	protein_coding	OTTHUMT00000051978.2	-	0.00	29	0	T	NM_152570		27950045	-1	tier1	-	no_errors	ENST00000308675	ensembl	human	known	74_37	missense	35.29	11	6	SNP	1.000	C
UGT1A6	54578	genome.wustl.edu	37	2	234663738	234663739	+	Intron	DNP	AC	AC	TG	rs549594693|rs566230339	byFrequency	TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	A|C	A|C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr2:234663738_234663739AC>TG	ENST00000305139.6	+	2	1000				UGT1A9_ENST00000354728.4_Intron|UGT1A1_ENST00000609637.1_Intron|UGT1A6_ENST00000373424.1_Intron|UGT1A10_ENST00000373445.1_Intron|UGT1A6_ENST00000406651.1_Intron|UGT1A3_ENST00000482026.1_Intron|UGT1A5_ENST00000373414.3_Intron|UGT1A1_ENST00000609767.1_Intron|UGT1A7_ENST00000373426.3_Intron|UGT1A1_ENST00000608381.1_Intron|AC114812.5_ENST00000450901.1_RNA|UGT1A1_ENST00000373450.4_Intron|UGT1A4_ENST00000373409.3_Intron|UGT1A10_ENST00000344644.5_Intron|UGT1A6_ENST00000480628.1_3'UTR	NM_001072.3	NP_001063.2	P19224	UD16_HUMAN	UDP glucuronosyltransferase 1 family, polypeptide A6						cellular glucuronidation (GO:0052695)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	enzyme binding (GO:0019899)|glucuronosyltransferase activity (GO:0015020)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(10)|skin(1)|upper_aerodigestive_tract(1)	22		Breast(86;0.000765)|all_lung(227;0.00267)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0328)|Lung NSC(271;0.0457)|Lung SC(224;0.128)		Epithelial(121;5.86e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000384)|Lung(119;0.00306)|LUSC - Lung squamous cell carcinoma(224;0.00702)	Acetaminophen(DB00316)|Deferiprone(DB08826)|Mycophenolate mofetil(DB00688)|Mycophenolic acid(DB01024)|Propofol(DB00818)|Valproic Acid(DB00313)	TCGCGTTTCTACGCGTCCGACA	0.619																																																	0																																										SO:0001627	intron_variant	0			M84130	CCDS2507.1, CCDS2508.1	2q37	2010-03-05	2005-07-20		ENSG00000167165	ENSG00000167165		"""UDP glucuronosyltransferases"""	12538	other	complex locus constituent		606431	"""UDP glycosyltransferase 1 family, polypeptide A6"""			9295054, 1339448	Standard	NM_001072		Approved	HLUGP, GNT1, UGT1F		P19224	OTTHUMG00000059122	Exception_encountered	2.37:g.234663738_234663739delinsTG			A6NKK6|B8K289|Q96TE7	RNA	SNP	-	NULL	ENST00000305139.6	37	NULL	CCDS2507.1	2																																																																																			AC114812.5	-	-	ENSG00000178836		0.619	UGT1A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC100286922	Clone_based_vega_gene	protein_coding	OTTHUMT00000130988.1	-	0.00	77|75	0	A|C	NM_205862		234663738|234663739	-1	tier1	-	no_errors	ENST00000389816	ensembl	human	known	74_37	rna	17.86	46	10	SNP	0.995|0.994	T|G
EVPLL	645027	genome.wustl.edu	37	17	18284334	18284334	+	Intron	SNP	T	T	A			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr17:18284334T>A	ENST00000399134.4	+	2	421				RP1-37N7.1_ENST00000579352.1_RNA	NM_001145127.1	NP_001138599.1	A8MZ36	EVPLL_HUMAN	envoplakin-like											NS(1)|endometrium(1)|large_intestine(1)|lung(2)	5						CGGCAGCAGTTGGCAGGGTGT	0.632																																																	0													56.0	64.0	62.0					17																	18284334		692	1591	2283	SO:0001627	intron_variant	0				CCDS45626.1	17p11.2	2009-08-25			ENSG00000214860	ENSG00000214860			35236	protein-coding gene	gene with protein product							Standard	NM_001145127		Approved		uc002gte.3	A8MZ36	OTTHUMG00000059095	ENST00000399134.4:c.63+20T>A	17.37:g.18284334T>A			B4DPD4	RNA	SNP	-	NULL	ENST00000399134.4	37	NULL	CCDS45626.1	17																																																																																			RP1-37N7.1	-	-	ENSG00000264177		0.632	EVPLL-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	LOC101928729	Clone_based_vega_gene	protein_coding	OTTHUMT00000130836.2	-	0.00	73	0	T	NM_001145127		18284334	-1	tier1	-	no_errors	ENST00000579352	ensembl	human	known	74_37	rna	5.26	90	5	SNP	0.017	A
LOC645752	645752	genome.wustl.edu	37	15	78211653	78211653	+	lincRNA	SNP	C	C	T	rs577974396	byFrequency	TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr15:78211653C>T	ENST00000565869.1	+	0	111				RP11-114H24.2_ENST00000567226.1_RNA|RN7SL214P_ENST00000487317.2_RNA																							GGGATAGGGGCTCAGCTGAGA	0.522																																																	0																																												0																															15.37:g.78211653C>T				RNA	SNP	-	NULL	ENST00000565869.1	37	NULL		15																																																																																			RP11-114H24.2	-	-	ENSG00000260776		0.522	RP11-114H24.7-001	KNOWN	basic	lincRNA	LOC645752	Clone_based_vega_gene	lincRNA	OTTHUMT00000421587.1	-	0.00	174	0	C			78211653	-1	tier1	-	no_errors	ENST00000567226	ensembl	human	known	74_37	rna	58.14	71	100	SNP	0.006	T
LPHN3	23284	genome.wustl.edu	37	4	62813888	62813888	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr4:62813888G>T	ENST00000514591.1	+	16	2824	c.2495G>T	c.(2494-2496)tGg>tTg	p.W832L	LPHN3_ENST00000507164.1_Missense_Mutation_p.W900L|LPHN3_ENST00000507625.1_Missense_Mutation_p.W900L|LPHN3_ENST00000506746.1_Missense_Mutation_p.W900L|LPHN3_ENST00000504896.1_Missense_Mutation_p.W832L|LPHN3_ENST00000514996.1_Missense_Mutation_p.W832L|LPHN3_ENST00000511324.1_Missense_Mutation_p.W900L|LPHN3_ENST00000514157.1_Missense_Mutation_p.W832L|LPHN3_ENST00000506720.1_Missense_Mutation_p.W900L|LPHN3_ENST00000508693.1_Missense_Mutation_p.W900L|LPHN3_ENST00000506700.1_Missense_Mutation_p.W832L|LPHN3_ENST00000509896.1_Missense_Mutation_p.W900L|LPHN3_ENST00000512091.2_Missense_Mutation_p.W832L|LPHN3_ENST00000508946.1_Missense_Mutation_p.W832L|LPHN3_ENST00000545650.1_Missense_Mutation_p.W832L			Q9HAR2	LPHN3_HUMAN	latrophilin 3	819	GPS. {ECO:0000255|PROSITE- ProRule:PRU00098}.				G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|G-protein coupled receptor activity (GO:0004930)	p.W832L(3)		breast(5)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(21)|lung(73)|ovary(1)|pancreas(1)|prostate(6)|upper_aerodigestive_tract(1)	125						ACAGGTTATTGGTCAACACAA	0.403																																																	3	Substitution - Missense(3)	prostate(3)											97.0	87.0	90.0					4																	62813888		1894	4116	6010	SO:0001583	missense	0			AB018311	CCDS54768.1	4q13.1	2014-08-08				ENSG00000150471		"""-"", ""GPCR / Class B : Orphans"""	20974	protein-coding gene	gene with protein product						10994649	Standard	NM_015236		Approved	KIAA0768, LEC3	uc010ihh.3	Q9HAR2		ENST00000514591.1:c.2495G>T	4.37:g.62813888G>T	ENSP00000422533:p.Trp832Leu		E9PE04|O94867|Q9NWK5	Missense_Mutation	SNP	pfam_GPCR_2_latrophilin_rcpt_C,pfam_Olfac-like,pfam_DUF3497,pfam_GPCR_2_secretin-like,pfam_Lectin_gal-bd_dom,pfam_GPS_dom,pfam_GPCR_2_extracellular_dom,smart_Olfac-like,smart_GPCR_2_extracellular_dom,smart_GPS_dom,pfscan_GPS_dom,pfscan_Lectin_gal-bd_dom,pfscan_Olfac-like,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_GPCR_2_latrophilin,prints_GPCR_2_secretin-like	p.W900L	ENST00000514591.1	37	c.2699	CCDS54768.1	4	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	31|31	5.097063|5.097063	0.94197|0.94197	.|.	.|.	ENSG00000150471|ENSG00000150471	ENST00000502815|ENST00000512091;ENST00000514591;ENST00000509896;ENST00000511324;ENST00000506700;ENST00000545650;ENST00000295349;ENST00000280009;ENST00000507164;ENST00000508693;ENST00000507625;ENST00000514157;ENST00000504896;ENST00000508946;ENST00000506720;ENST00000506746;ENST00000514996	.|D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	.|0.92595	.|-3.07;-3.07;-3.07;-3.07;-3.07;-3.07;-3.07;-3.07;-3.07;-3.07;-3.07;-3.07;-3.07;-3.07;-3.07	5.98|5.98	5.98|5.98	0.97165|0.97165	.|GPS domain (3);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.98036|0.98036	0.9353|0.9353	H|H	0.98314|0.98314	4.2|4.2	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.76494	.|0.999;0.999;0.998	.|D;D;D	.|0.83275	.|0.996;0.996;0.994	D|D	0.98633|0.98633	1.0672|1.0672	5|10	.|0.87932	.|D	.|0	.|.	20.5212|20.5212	0.99222|0.99222	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|832;819;832	.|E9PE04;Q9HAR2;Q9HAR2-2	.|.;LPHN3_HUMAN;.	F|L	289|832;832;900;900;832;832;819;832;900;900;900;832;832;832;900;900;832	.|ENSP00000423388:W832L;ENSP00000422533:W832L;ENSP00000423787:W900L;ENSP00000425033:W900L;ENSP00000424120:W832L;ENSP00000439831:W832L;ENSP00000421476:W900L;ENSP00000424030:W900L;ENSP00000421372:W900L;ENSP00000425201:W832L;ENSP00000423434:W832L;ENSP00000421627:W832L;ENSP00000420931:W900L;ENSP00000425884:W900L;ENSP00000424258:W832L	.|ENSP00000280009:W832L	L|W	+|+	3|2	2|0	LPHN3|LPHN3	62496483|62496483	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.978000|0.978000	0.69477|0.69477	9.865000|9.865000	0.99609|0.99609	2.861000|2.861000	0.98227|0.98227	0.650000|0.650000	0.86243|0.86243	TTG|TGG	LPHN3	-	pfam_GPS_dom,smart_GPS_dom,pfscan_GPS_dom	ENSG00000150471		0.403	LPHN3-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	LPHN3	HGNC	protein_coding	OTTHUMT00000361765.1	-	0.00	21	0	G			62813888	+1	tier1	-	no_errors	ENST00000507625	ensembl	human	known	74_37	missense	14.29	24	4	SNP	1.000	T
LRRK2	120892	genome.wustl.edu	37	12	40634305	40634305	+	Nonsense_Mutation	SNP	G	G	T			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr12:40634305G>T	ENST00000298910.7	+	6	650	c.592G>T	c.(592-594)Gaa>Taa	p.E198*	LRRK2_ENST00000343742.2_Nonsense_Mutation_p.E198*	NM_198578.3	NP_940980	Q5S007	LRRK2_HUMAN	leucine-rich repeat kinase 2	198					activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|autophagy (GO:0006914)|cellular protein localization (GO:0034613)|cellular response to dopamine (GO:1903351)|cellular response to manganese ion (GO:0071287)|cellular response to oxidative stress (GO:0034599)|determination of adult lifespan (GO:0008340)|endocytosis (GO:0006897)|exploration behavior (GO:0035640)|GTP catabolic process (GO:0006184)|intracellular distribution of mitochondria (GO:0048312)|intracellular signal transduction (GO:0035556)|locomotory exploration behavior (GO:0035641)|MAPK cascade (GO:0000165)|negative regulation of GTPase activity (GO:0034260)|negative regulation of hydrogen peroxide-induced cell death (GO:1903206)|negative regulation of late endosome to lysosome transport (GO:1902823)|negative regulation of peroxidase activity (GO:2000469)|negative regulation of protein binding (GO:0032091)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein processing (GO:0010955)|negative regulation of protein processing involved in protein targeting to mitochondrion (GO:1903217)|negative regulation of protein targeting to mitochondrion (GO:1903215)|negative regulation of thioredoxin peroxidase activity by peptidyl-threonine phosphorylation (GO:1903125)|neuromuscular junction development (GO:0007528)|neuron death (GO:0070997)|neuron projection morphogenesis (GO:0048812)|olfactory bulb development (GO:0021772)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of autophagy (GO:0010508)|positive regulation of dopamine receptor signaling pathway (GO:0060161)|positive regulation of GTPase activity (GO:0043547)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of programmed cell death (GO:0043068)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein autoubiquitination (GO:1902499)|positive regulation of protein binding (GO:0032092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reactive oxygen species metabolic process (GO:0072593)|regulation of branching morphogenesis of a nerve (GO:2000172)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of dopamine receptor signaling pathway (GO:0060159)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of kidney size (GO:0035564)|regulation of locomotion (GO:0040012)|regulation of membrane potential (GO:0042391)|regulation of mitochondrial depolarization (GO:0051900)|regulation of neuroblast proliferation (GO:1902692)|regulation of neuron death (GO:1901214)|regulation of neuron maturation (GO:0014041)|regulation of protein kinase A signaling (GO:0010738)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of synaptic vesicle exocytosis (GO:2000300)|regulation of synaptic vesicle transport (GO:1902803)|response to oxidative stress (GO:0006979)|small GTPase mediated signal transduction (GO:0007264)|tangential migration from the subventricular zone to the olfactory bulb (GO:0022028)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic side of mitochondrial outer membrane (GO:0032473)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendrite (GO:0030425)|dendrite cytoplasm (GO:0032839)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|lysosome (GO:0005764)|membrane raft (GO:0045121)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)|terminal bouton (GO:0043195)|trans-Golgi network (GO:0005802)	actin binding (GO:0003779)|ATP binding (GO:0005524)|clathrin binding (GO:0030276)|glycoprotein binding (GO:0001948)|GTP binding (GO:0005525)|GTP-dependent protein kinase activity (GO:0034211)|GTPase activator activity (GO:0005096)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|kinase activity (GO:0016301)|MAP kinase kinase activity (GO:0004708)|peroxidase inhibitor activity (GO:0036479)|protein homodimerization activity (GO:0042803)|protein kinase A binding (GO:0051018)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|Rho GTPase binding (GO:0017048)|SNARE binding (GO:0000149)|syntaxin-1 binding (GO:0017075)|tubulin binding (GO:0015631)			NS(3)|biliary_tract(1)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(23)|large_intestine(31)|lung(55)|ovary(15)|pancreas(2)|prostate(4)|skin(4)|stomach(9)|upper_aerodigestive_tract(7)|urinary_tract(2)	181	all_cancers(12;0.00108)|Breast(8;0.218)	Lung NSC(34;0.0942)|all_lung(34;0.11)				GCAACTGACTGAATTTGTTGA	0.274																																																	0													86.0	86.0	86.0					12																	40634305		2203	4297	6500	SO:0001587	stop_gained	0			AK026776	CCDS31774.1	12q12	2011-07-21			ENSG00000188906	ENSG00000188906		"""Parkinson disease"""	18618	protein-coding gene	gene with protein product		609007	"""Parkinson disease (autosomal dominant) 8"""	PARK8		15541308	Standard	NM_198578		Approved	ROCO2, DKFZp434H2111, FLJ45829, RIPK7	uc001rmg.4	Q5S007	OTTHUMG00000059742	ENST00000298910.7:c.592G>T	12.37:g.40634305G>T	ENSP00000298910:p.Glu198*		A6NJU2|Q6ZS50|Q8NCX9	Nonsense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_MIRO-like,pfam_Small_GTPase,pfam_Leu-rich_rpt,pfam_Small_GTPase_ARF/SAR,superfamily_Kinase-like_dom,superfamily_P-loop_NTPase,superfamily_ARM-type_fold,superfamily_WD40_repeat_dom,smart_Leu-rich_rpt_typical-subtyp,smart_Small_GTPase_Rab_type,smart_Tyr_kinase_cat_dom,smart_Ser/Thr_dual-sp_kinase_dom,prints_Small_GTPase,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,tigrfam_Small_GTP-bd_dom	p.E198*	ENST00000298910.7	37	c.592	CCDS31774.1	12	.	.	.	.	.	.	.	.	.	.	G	38	6.833266	0.97873	.	.	ENSG00000188906	ENST00000343742;ENST00000298910	.	.	.	5.54	5.54	0.83059	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.54805	T	0.06	.	18.2426	0.89973	0.0:0.0:1.0:0.0	.	.	.	.	X	198	.	ENSP00000298910:E198X	E	+	1	0	LRRK2	38920572	1.000000	0.71417	0.997000	0.53966	0.976000	0.68499	6.989000	0.76219	2.613000	0.88420	0.650000	0.86243	GAA	LRRK2	-	superfamily_ARM-type_fold	ENSG00000188906		0.274	LRRK2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRK2	HGNC	protein_coding	OTTHUMT00000277179.1	-	0.00	34	0	G	XM_058513		40634305	+1	tier1	-	no_errors	ENST00000298910	ensembl	human	known	74_37	nonsense	23.33	23	7	SNP	1.000	T
LTK	4058	genome.wustl.edu	37	15	41805206	41805206	+	Silent	SNP	G	G	T			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr15:41805206G>T	ENST00000263800.6	-	2	252	c.156C>A	c.(154-156)atC>atA	p.I52I	LTK_ENST00000355166.5_Silent_p.I52I|LTK_ENST00000453182.2_Silent_p.I52I|LTK_ENST00000561619.1_Intron	NM_002344.5	NP_002335.2	P29376	LTK_HUMAN	leukocyte receptor tyrosine kinase	52					cell proliferation (GO:0008283)|cellular response to retinoic acid (GO:0071300)|negative regulation of apoptotic process (GO:0043066)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol 3-kinase signaling (GO:0014065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of neuron projection development (GO:0010976)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			NS(1)|breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(16)|skin(3)|urinary_tract(1)	26		all_cancers(109;1.89e-19)|all_epithelial(112;2.28e-16)|Lung NSC(122;5.34e-11)|all_lung(180;1.33e-09)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.172)		OV - Ovarian serous cystadenocarcinoma(18;2.1e-17)|GBM - Glioblastoma multiforme(113;1.34e-06)|Colorectal(105;0.0148)|BRCA - Breast invasive adenocarcinoma(123;0.113)		CTGGCTCCAAGATACTAGGCG	0.662										TSP Lung(18;0.14)																																							0													30.0	36.0	34.0					15																	41805206		2202	4297	6499	SO:0001819	synonymous_variant	0			D16105	CCDS10077.1, CCDS10078.1, CCDS45237.1	15q15.1-q21.1	2009-07-10	2008-01-23		ENSG00000062524	ENSG00000062524	2.7.10.1		6721	protein-coding gene	gene with protein product		151520	"""leukocyte tyrosine kinase"""			2320375	Standard	NM_206961		Approved	TYK1	uc001zoa.3	P29376	OTTHUMG00000130339	ENST00000263800.6:c.156C>A	15.37:g.41805206G>T			A6NNJ8|B4DL89|E9PFX4	Silent	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.I52	ENST00000263800.6	37	c.156	CCDS10077.1	15																																																																																			LTK	-	NULL	ENSG00000062524		0.662	LTK-001	KNOWN	basic|CCDS	protein_coding	LTK	HGNC	protein_coding	OTTHUMT00000252690.2		0.00	75	0	G			41805206	-1			no_errors	ENST00000263800	ensembl	human	known	74_37	silent	5.80	65	4	SNP	0.000	T
LYST	1130	genome.wustl.edu	37	1	235896893	235896893	+	Frame_Shift_Del	DEL	T	T	-			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr1:235896893delT	ENST00000389794.3	-	34	8885	c.8711delA	c.(8710-8712)aagfs	p.K2904fs	LYST_ENST00000473037.1_5'UTR|LYST_ENST00000389793.2_Frame_Shift_Del_p.K2904fs			Q99698	LYST_HUMAN	lysosomal trafficking regulator	2904					blood coagulation (GO:0007596)|defense response to bacterium (GO:0042742)|defense response to protozoan (GO:0042832)|defense response to virus (GO:0051607)|endosome to lysosome transport via multivesicular body sorting pathway (GO:0032510)|leukocyte chemotaxis (GO:0030595)|lysosome organization (GO:0007040)|mast cell secretory granule organization (GO:0033364)|melanosome organization (GO:0032438)|microtubule-based process (GO:0007017)|natural killer cell mediated cytotoxicity (GO:0042267)|neutrophil mediated immunity (GO:0002446)|phospholipid homeostasis (GO:0055091)|phospholipid metabolic process (GO:0006644)|pigmentation (GO:0043473)|positive regulation of natural killer cell activation (GO:0032816)|response to drug (GO:0042493)|secretion of lysosomal enzymes (GO:0033299)|T cell mediated immunity (GO:0002456)	cytosol (GO:0005829)|microtubule cytoskeleton (GO:0015630)				NS(1)|breast(13)|central_nervous_system(3)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(27)|lung(66)|ovary(7)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	162	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00246)|Prostate(94;0.0771)|Acute lymphoblastic leukemia(190;0.228)	OV - Ovarian serous cystadenocarcinoma(106;0.000674)			CTGGATCACCTTTTTTCTCTC	0.418																																																	0													100.0	87.0	91.0					1																	235896893		2203	4300	6503	SO:0001589	frameshift_variant	0			U70064	CCDS31062.1	1q42.1-q42.2	2014-09-17	2004-12-09	2004-12-10	ENSG00000143669	ENSG00000143669		"""WD repeat domain containing"""	1968	protein-coding gene	gene with protein product		606897	"""Chediak-Higashi syndrome 1"""	CHS1		8717042, 8896560	Standard	NM_000081		Approved	CHS	uc001hxj.3	Q99698	OTTHUMG00000040527	ENST00000389794.3:c.8711delA	1.37:g.235896893delT	ENSP00000374444:p.Lys2904fs		O43274|Q5T2U9|Q96TD7|Q96TD8|Q99709|Q9H133	Frame_Shift_Del	DEL	pfam_BEACH_dom,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_BEACH_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.K2904fs	ENST00000389794.3	37	c.8711	CCDS31062.1	1																																																																																			LYST	-	superfamily_ARM-type_fold	ENSG00000143669		0.418	LYST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LYST	HGNC	protein_coding	OTTHUMT00000097533.5		0.00	34	0	T			235896893	-1	tier1		no_errors	ENST00000389793	ensembl	human	known	74_37	frame_shift_del	5.41	35	2	DEL	1.000	-
MAP2K4	6416	genome.wustl.edu	37	17	12044509	12044509	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr17:12044509G>T	ENST00000353533.5	+	11	1195	c.1132G>T	c.(1132-1134)Gca>Tca	p.A378S	MAP2K4_ENST00000415385.3_Missense_Mutation_p.A389S	NM_003010.2	NP_003001.1	P45985	MP2K4_HUMAN	mitogen-activated protein kinase kinase 4	378	DVD domain.				apoptotic process (GO:0006915)|cellular response to mechanical stimulus (GO:0071260)|cellular response to sorbitol (GO:0072709)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|JNK cascade (GO:0007254)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|positive regulation of DNA replication (GO:0045740)|positive regulation of neuron apoptotic process (GO:0043525)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|dendrite cytoplasm (GO:0032839)|nucleus (GO:0005634)|perikaryon (GO:0043204)	ATP binding (GO:0005524)|JUN kinase kinase activity (GO:0008545)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)	p.0?(10)|p.?(2)|p.A378T(1)		NS(1)|biliary_tract(2)|breast(22)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(26)|lung(15)|ovary(8)|pancreas(11)|skin(3)|stomach(2)|testis(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	100		all_cancers(5;0.0413)|Breast(5;0.000625)|all_epithelial(5;0.00978)|all_lung(20;0.0449)|Lung NSC(33;0.163)		Epithelial(2;4.12e-09)|all cancers(2;6.86e-07)|BRCA - Breast invasive adenocarcinoma(2;8.74e-07)|Colorectal(4;5.32e-05)|COAD - Colon adenocarcinoma(4;0.0039)|READ - Rectum adenocarcinoma(10;0.0681)		CGTTGAGGTCGCATGCTATGT	0.398			"""D, Mis, N"""		"""pancreatic, breast, colorectal"""																																			Rec	yes		17	17p11.2	6416	mitogen-activated protein kinase kinase 4		E	13	Whole gene deletion(10)|Unknown(2)|Substitution - Missense(1)	breast(4)|ovary(4)|pancreas(2)|biliary_tract(1)|endometrium(1)|lung(1)											148.0	129.0	135.0					17																	12044509		2203	4300	6503	SO:0001583	missense	0			L36870	CCDS11162.1, CCDS62095.1	17p12	2012-03-23			ENSG00000065559	ENSG00000065559	2.7.12.2	"""Mitogen-activated protein kinase cascade / Kinase kinases"""	6844	protein-coding gene	gene with protein product		601335		SERK1		7716521	Standard	NM_003010		Approved	MEK4, JNKK1, PRKMK4, MKK4	uc002gnj.3	P45985		ENST00000353533.5:c.1132G>T	17.37:g.12044509G>T	ENSP00000262445:p.Ala378Ser		B2R7N7|B3KYB2|D3DTS5|Q5U0B8|Q6FHX4|Q6P9H2|Q6PIE6	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.A389S	ENST00000353533.5	37	c.1165	CCDS11162.1	17	.	.	.	.	.	.	.	.	.	.	G	19.22	3.785524	0.70337	.	.	ENSG00000065559	ENST00000353533;ENST00000415385;ENST00000538465;ENST00000536413	T;T	0.20200	2.09;2.09	5.53	5.53	0.82687	Protein kinase-like domain (1);	0.000000	0.85682	D	0.000000	T	0.33731	0.0873	L	0.43701	1.375	0.80722	D	1	B;B;B	0.32302	0.029;0.299;0.363	B;P;B	0.47346	0.02;0.544;0.342	T	0.02691	-1.1123	10	0.40728	T	0.16	.	18.3995	0.90511	0.0:0.0:1.0:0.0	.	250;389;378	B7ZA62;P45985-2;P45985	.;.;MP2K4_HUMAN	S	378;389;355;250	ENSP00000262445:A378S;ENSP00000410402:A389S	ENSP00000262445:A378S	A	+	1	0	MAP2K4	11985234	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.652000	0.98499	2.879000	0.98667	0.650000	0.86243	GCA	MAP2K4	-	superfamily_Kinase-like_dom	ENSG00000065559		0.398	MAP2K4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MAP2K4	HGNC	protein_coding	OTTHUMT00000441226.1		0.00	25	0	G			12044509	+1			no_errors	ENST00000415385	ensembl	human	known	74_37	missense	7.50	37	3	SNP	1.000	T
MAPK8IP1	9479	genome.wustl.edu	37	11	45925666	45925666	+	Silent	SNP	T	T	C			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr11:45925666T>C	ENST00000241014.2	+	7	1790	c.1620T>C	c.(1618-1620)ccT>ccC	p.P540P	MAPK8IP1_ENST00000395629.2_Silent_p.P530P|RP11-618K13.2_ENST00000533218.1_RNA	NM_005456.3	NP_005447.1	Q9UQF2	JIP1_HUMAN	mitogen-activated protein kinase 8 interacting protein 1	540	Interaction with VRK2.|SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				JUN phosphorylation (GO:0007258)|negative regulation of apoptotic process (GO:0043066)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|negative regulation of JNK cascade (GO:0046329)|negative regulation of JUN kinase activity (GO:0043508)|positive regulation of signal transduction (GO:0009967)|regulation of JNK cascade (GO:0046328)|regulation of transcription, DNA-templated (GO:0006355)|vesicle-mediated transport (GO:0016192)	axonal growth cone (GO:0044295)|cell body (GO:0044297)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic growth cone (GO:0044294)|dentate gyrus mossy fiber (GO:0044302)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|synapse (GO:0045202)	kinesin binding (GO:0019894)|MAP-kinase scaffold activity (GO:0005078)|protein kinase inhibitor activity (GO:0004860)			breast(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(7)|ovary(2)|prostate(1)|skin(2)	24				GBM - Glioblastoma multiforme(35;0.231)		GTGTCTTTCCTGCCTATTACG	0.602																																																	0													89.0	71.0	77.0					11																	45925666		2203	4299	6502	SO:0001819	synonymous_variant	0				CCDS7916.1	11p11.2	2009-07-24			ENSG00000121653	ENSG00000121653			6882	protein-coding gene	gene with protein product		604641		PRKM8IP		9235893, 9442013	Standard	NM_005456		Approved	IB1, JIP-1, JIP1	uc001nbr.3	Q9UQF2	OTTHUMG00000134324	ENST00000241014.2:c.1620T>C	11.37:g.45925666T>C			D3DQP4|O43407	Silent	SNP	pfam_PTB/PI_dom,pfam_SH3_domain,superfamily_SH3_domain,smart_SH3_domain,smart_PTB/PI_dom,pfscan_PTB/PI_dom,pfscan_SH3_domain	p.P540	ENST00000241014.2	37	c.1620	CCDS7916.1	11																																																																																			MAPK8IP1	-	pfam_SH3_domain,superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain	ENSG00000121653		0.602	MAPK8IP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAPK8IP1	HGNC	protein_coding	OTTHUMT00000259405.1	-	0.00	33	0	T	NM_005456		45925666	+1	tier1	-	no_errors	ENST00000241014	ensembl	human	known	74_37	silent	17.65	14	3	SNP	0.554	C
MAPK8IP3	23162	genome.wustl.edu	37	16	1818620	1818620	+	Silent	SNP	C	C	T			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr16:1818620C>T	ENST00000250894.4	+	31	4039	c.3882C>T	c.(3880-3882)ttC>ttT	p.F1294F	MAPK8IP3_ENST00000356010.5_Silent_p.F1288F	NM_015133.3	NP_055948.2	Q9UPT6	JIP3_HUMAN	mitogen-activated protein kinase 8 interacting protein 3	1294					activation of JUN kinase activity (GO:0007257)|axon guidance (GO:0007411)|forebrain development (GO:0030900)|in utero embryonic development (GO:0001701)|lung alveolus development (GO:0048286)|lung morphogenesis (GO:0060425)|positive regulation of neuron differentiation (GO:0045666)|post-embryonic development (GO:0009791)|protein localization (GO:0008104)|regulation of gene expression (GO:0010468)|regulation of JNK cascade (GO:0046328)|respiratory gaseous exchange (GO:0007585)|vesicle-mediated transport (GO:0016192)	axolemma (GO:0030673)|dendrite (GO:0030425)|Golgi membrane (GO:0000139)|smooth endoplasmic reticulum (GO:0005790)	kinesin binding (GO:0019894)|MAP-kinase scaffold activity (GO:0005078)			NS(1)|breast(3)|central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(20)|ovary(1)|prostate(2)|skin(2)|urinary_tract(3)	42						ACATCGACTTCCGCATTGGTG	0.711																																																	0													24.0	39.0	34.0					16																	1818620		2048	4181	6229	SO:0001819	synonymous_variant	0			AB028989	CCDS10442.2, CCDS45379.1	16p13.3	2009-11-23			ENSG00000138834	ENSG00000138834			6884	protein-coding gene	gene with protein product	"""homolog of Drosophila Sunday driver 2"""	605431				10523642, 10629060	Standard	XM_005255187		Approved	KIAA1066, JSAP1, JIP3, syd	uc002cmk.3	Q9UPT6	OTTHUMG00000128637	ENST00000250894.4:c.3882C>T	16.37:g.1818620C>T			A2A2B3|A7E2B3|Q96RY4|Q9H4I4|Q9H7P1|Q9NUG0	Silent	SNP	pfam_JNK/Rab-associated_protein-1_N,superfamily_WD40_repeat_dom	p.F1294	ENST00000250894.4	37	c.3882	CCDS10442.2	16																																																																																			MAPK8IP3	-	NULL	ENSG00000138834		0.711	MAPK8IP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAPK8IP3	HGNC	protein_coding	OTTHUMT00000250508.2	-	0.00	36	0	C	NM_001040439		1818620	+1	tier1	-	no_errors	ENST00000250894	ensembl	human	known	74_37	silent	21.57	40	11	SNP	1.000	T
MARVELD2	153562	genome.wustl.edu	37	5	68715895	68715895	+	Nonsense_Mutation	SNP	C	C	A			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr5:68715895C>A	ENST00000325631.5	+	2	757	c.683C>A	c.(682-684)tCa>tAa	p.S228*	MARVELD2_ENST00000413223.2_Nonsense_Mutation_p.S228*	NM_001038603.2|NM_001244734.1	NP_001033692.2|NP_001231663.1	Q8N4S9	MALD2_HUMAN	MARVEL domain containing 2	228	MARVEL. {ECO:0000255|PROSITE- ProRule:PRU00581}.				cell-cell junction organization (GO:0045216)|establishment of endothelial barrier (GO:0061028)|sensory perception of sound (GO:0007605)|tight junction assembly (GO:0070830)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|paranodal junction (GO:0033010)|Schmidt-Lanterman incisure (GO:0043220)|tight junction (GO:0005923)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|liver(1)|lung(4)|skin(1)|urinary_tract(1)	15		Lung NSC(167;0.000937)|Prostate(74;0.0187)|Ovarian(174;0.16)		OV - Ovarian serous cystadenocarcinoma(47;7.31e-57)|Epithelial(20;1.05e-52)|all cancers(19;2.63e-48)|Lung(70;0.0183)		TTTGGATATTCACAACCGTAT	0.507																																																	0													197.0	180.0	186.0					5																	68715895		2203	4300	6503	SO:0001587	stop_gained	0			AK055094	CCDS34175.1, CCDS58956.1	5q13.1	2007-05-01	2004-07-12	2004-07-14	ENSG00000152939	ENSG00000152939			26401	protein-coding gene	gene with protein product	"""tricellulin"""	610572	"""MARVEL (membrane-associating) domain containing 2"", ""deafness, autosomal recessive 49"""	MRVLDC2, DFNB49		17186462	Standard	NM_001038603		Approved	FLJ30532, TRIC	uc003jwq.3	Q8N4S9	OTTHUMG00000162512	ENST00000325631.5:c.683C>A	5.37:g.68715895C>A	ENSP00000323264:p.Ser228*		A1BQX0|A1BQX1|A8KA97|Q96NM9	Nonsense_Mutation	SNP	pfam_Occludin_RNApol2_elong_fac_ELL,pfam_Marvel	p.S228*	ENST00000325631.5	37	c.683	CCDS34175.1	5	.	.	.	.	.	.	.	.	.	.	C	38	7.063027	0.98036	.	.	ENSG00000152939	ENST00000325631;ENST00000282886;ENST00000454295;ENST00000512803;ENST00000436532;ENST00000413223	.	.	.	5.12	3.3	0.37823	.	0.338832	0.31847	N	0.006972	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-12.4038	11.1153	0.48256	0.1443:0.7167:0.139:0.0	.	.	.	.	X	228	.	ENSP00000282886:S228X	S	+	2	0	MARVELD2	68751651	0.961000	0.32948	0.000000	0.03702	0.942000	0.58702	3.913000	0.56394	0.519000	0.28406	0.561000	0.74099	TCA	MARVELD2	-	pfam_Marvel	ENSG00000152939		0.507	MARVELD2-006	KNOWN	basic|appris_principal|CCDS	protein_coding	MARVELD2	HGNC	protein_coding	OTTHUMT00000369583.1	-	0.00	62	0	C	NM_144724		68715895	+1	tier1	-	no_errors	ENST00000325631	ensembl	human	known	74_37	nonsense	33.33	36	18	SNP	0.350	A
MCM6	4175	genome.wustl.edu	37	2	136614333	136614333	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr2:136614333C>T	ENST00000264156.2	-	11	1651	c.1591G>A	c.(1591-1593)Gat>Aat	p.D531N	MCM6_ENST00000492091.1_Intron	NM_005915.5	NP_005906.2	Q14566	MCM6_HUMAN	minichromosome maintenance complex component 6	531	MCM.				DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA strand elongation involved in DNA replication (GO:0006271)|DNA unwinding involved in DNA replication (GO:0006268)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)	MCM complex (GO:0042555)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA helicase activity (GO:0003678)|identical protein binding (GO:0042802)|single-stranded DNA binding (GO:0003697)	p.D531N(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|liver(1)|lung(15)|prostate(2)|skin(1)	29				BRCA - Breast invasive adenocarcinoma(221;0.166)		AAGAAGAGATCGAATCGGGAC	0.408																																					Ovarian(196;141 2104 8848 24991 25939)												1	Substitution - Missense(1)	large_intestine(1)											134.0	130.0	132.0					2																	136614333		2203	4300	6503	SO:0001583	missense	0				CCDS2179.1	2q14-q21	2008-02-05	2007-04-04		ENSG00000076003	ENSG00000076003			6949	protein-coding gene	gene with protein product	"""MIS5 homolog (S.pombe)"""	601806	"""minichromosome maintenance deficient (mis5, S. pombe) 6"", ""MCM6 minichromosome maintenance deficient 6 (MIS5 homolog, S. pombe) (S. cerevisiae)"", ""minichromosome maintenance deficient 6 homolog (S. cerevisiae)"""				Standard	NM_005915		Approved	Mis5	uc002tuw.4	Q14566	OTTHUMG00000131739	ENST00000264156.2:c.1591G>A	2.37:g.136614333C>T	ENSP00000264156:p.Asp531Asn		B2R6H2|Q13504|Q99859	Missense_Mutation	SNP	pfam_MCM_DNA-dep_ATPase,pfam_Mg_chelatse_chII,superfamily_NA-bd_OB-fold,superfamily_P-loop_NTPase,smart_MCM_DNA-dep_ATPase,pfscan_MCM_DNA-dep_ATPase,prints_MCM6,prints_MCM_DNA-dep_ATPase	p.D531N	ENST00000264156.2	37	c.1591	CCDS2179.1	2	.	.	.	.	.	.	.	.	.	.	C	35	5.452722	0.96223	.	.	ENSG00000076003	ENST00000264156	T	0.18174	2.23	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	T	0.66567	0.2802	H	0.99697	4.71	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.82808	-0.0274	10	0.87932	D	0	-24.4756	19.9601	0.97247	0.0:1.0:0.0:0.0	.	531	Q14566	MCM6_HUMAN	N	531	ENSP00000264156:D531N	ENSP00000264156:D531N	D	-	1	0	MCM6	136330803	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.683000	0.84093	2.720000	0.93068	0.655000	0.94253	GAT	MCM6	-	pfam_MCM_DNA-dep_ATPase,pfam_Mg_chelatse_chII,superfamily_P-loop_NTPase,smart_MCM_DNA-dep_ATPase,pfscan_MCM_DNA-dep_ATPase,prints_MCM_DNA-dep_ATPase	ENSG00000076003		0.408	MCM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MCM6	HGNC	protein_coding	OTTHUMT00000254658.1		0.00	62	0	C	NM_005915		136614333	-1			no_errors	ENST00000264156	ensembl	human	known	74_37	missense	5.66	50	3	SNP	1.000	T
MGA	23269	genome.wustl.edu	37	15	42042214	42042214	+	Nonsense_Mutation	SNP	G	G	T			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr15:42042214G>T	ENST00000570161.1	+	16	6409	c.6409G>T	c.(6409-6411)Gaa>Taa	p.E2137*	MGA_ENST00000545763.1_Nonsense_Mutation_p.E1928*|MGA_ENST00000219905.7_Nonsense_Mutation_p.E2137*|MGA_ENST00000566586.1_Nonsense_Mutation_p.E1928*|MGA_ENST00000389936.4_Nonsense_Mutation_p.E2098*			O43451	MGA_HUMAN	MGA, MAX dimerization protein	0					carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)			NS(1)|breast(4)|central_nervous_system(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(33)|ovary(8)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95		all_cancers(109;0.00356)|all_epithelial(112;0.0413)|all_lung(180;0.18)|Ovarian(310;0.238)		OV - Ovarian serous cystadenocarcinoma(18;1.41e-18)|GBM - Glioblastoma multiforme(113;2.15e-06)|COAD - Colon adenocarcinoma(120;0.031)|Lung(196;0.0721)|BRCA - Breast invasive adenocarcinoma(123;0.0964)|Colorectal(105;0.0998)|LUSC - Lung squamous cell carcinoma(244;0.235)	Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	CTTTAAGGAAGAAAGTAAATT	0.403																																																	0													47.0	46.0	46.0					15																	42042214		1876	4122	5998	SO:0001587	stop_gained	0			AB011090	CCDS55959.1, CCDS55960.1	15q15	2012-11-15	2012-11-15		ENSG00000174197	ENSG00000174197		"""MAX dimerization proteins"", ""T-boxes"""	14010	protein-coding gene	gene with protein product			"""MAX gene associated"""				Standard	NM_001080541		Approved	KIAA0518, MAD5, MXD5, FLJ12634	uc010ucy.2	Q8IWI9		ENST00000570161.1:c.6409G>T	15.37:g.42042214G>T	ENSP00000457035:p.Glu2137*		Q0VAX6|Q75ME7|Q86UM5	Nonsense_Mutation	SNP	pfam_TF_T-box,pfam_bHLH_dom,superfamily_p53-like_TF_DNA-bd,superfamily_bHLH_dom,smart_TF_T-box,smart_bHLH_dom,pfscan_bHLH_dom,pfscan_TF_T-box,prints_TF_T-box	p.E2137*	ENST00000570161.1	37	c.6409	CCDS55959.1	15	.	.	.	.	.	.	.	.	.	.	G	24.7	4.556578	0.86231	.	.	ENSG00000174197	ENST00000219905;ENST00000389936;ENST00000545763	.	.	.	4.11	4.11	0.48088	.	1.264840	0.05558	N	0.568619	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.42905	T	0.14	.	5.9956	0.19491	0.1055:0.2142:0.6802:0.0	.	.	.	.	X	2137;2098;1928	.	ENSP00000219905:E2137X	E	+	1	0	MGA	39829506	0.996000	0.38824	0.984000	0.44739	0.786000	0.44442	2.400000	0.44504	2.149000	0.67028	0.467000	0.42956	GAA	MGA	-	NULL	ENSG00000174197		0.403	MGA-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MGA	HGNC	protein_coding	OTTHUMT00000420229.1		0.00	30	0	G	NM_001164273.1		42042214	+1			no_errors	ENST00000219905	ensembl	human	known	74_37	nonsense	8.00	23	2	SNP	0.872	T
MMP16	4325	genome.wustl.edu	37	8	89339430	89339430	+	Silent	SNP	G	G	A			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr8:89339430G>A	ENST00000286614.6	-	1	287	c.6C>T	c.(4-6)atC>atT	p.I2I	MMP16_ENST00000544227.1_5'UTR|RP11-586K2.1_ENST00000523254.1_RNA|RP11-586K2.1_ENST00000520849.1_RNA|RP11-586K2.1_ENST00000521433.1_RNA	NM_005941.4	NP_005932.2	P51512	MMP16_HUMAN	matrix metallopeptidase 16 (membrane-inserted)	2					chondrocyte proliferation (GO:0035988)|collagen catabolic process (GO:0030574)|craniofacial suture morphogenesis (GO:0097094)|embryonic cranial skeleton morphogenesis (GO:0048701)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of catalytic activity (GO:0043085)	Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|enzyme activator activity (GO:0008047)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.I2I(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(5)|liver(1)|lung(51)|ovary(3)|prostate(4)|skin(1)|upper_aerodigestive_tract(5)|urinary_tract(3)	81					Marimastat(DB00786)	ATGTGAGTAAGATCATAGTGA	0.473																																																	1	Substitution - coding silent(1)	lung(1)											167.0	149.0	155.0					8																	89339430		2203	4300	6503	SO:0001819	synonymous_variant	0			D85511	CCDS6246.1	8q21	2009-01-09	2005-08-08		ENSG00000156103	ENSG00000156103			7162	protein-coding gene	gene with protein product		602262	"""matrix metalloproteinase 16 (membrane-inserted)"", ""chromosome 8 open reading frame 57"""	C8orf57		7559440	Standard	NM_005941		Approved	MT3-MMP, DKFZp761D112	uc003yeb.4	P51512	OTTHUMG00000163769	ENST00000286614.6:c.6C>T	8.37:g.89339430G>A			B2RAN7|Q14824|Q52H48	Silent	SNP	pirsf_Pept_M10A_Metazoans,pfam_Hemopexin-like_repeat,pfam_Pept_M10_metallopeptidase,pfam_Pept_M10A_metallopeptidase_C,pfam_Peptidoglycan-bd-like,superfamily_Hemopexin-like_dom,superfamily_Peptidoglycan-bd-like,smart_Peptidase_Metallo,smart_Hemopexin-like_repeat,prints_Pept_M10A	p.I2	ENST00000286614.6	37	c.6	CCDS6246.1	8																																																																																			MMP16	-	NULL	ENSG00000156103		0.473	MMP16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MMP16	HGNC	protein_coding	OTTHUMT00000375304.2	-	0.00	62	0	G	NM_005941		89339430	-1	tier1	-	no_errors	ENST00000286614	ensembl	human	known	74_37	silent	11.36	39	5	SNP	1.000	A
MRGPRX2	117194	genome.wustl.edu	37	11	19077360	19077360	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr11:19077360A>G	ENST00000329773.2	-	2	677	c.590T>C	c.(589-591)gTt>gCt	p.V197A		NM_054030.2	NP_473371.1	Q96LB1	MRGX2_HUMAN	MAS-related GPR, member X2	197					positive regulation of cytokinesis (GO:0032467)|sensory perception of pain (GO:0019233)|sleep (GO:0030431)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|neuropeptide binding (GO:0042923)			NS(1)|large_intestine(2)|liver(1)|lung(5)|ovary(1)|prostate(1)|skin(1)|stomach(2)|urinary_tract(1)	15						CCCACAGAGAACCATGAATAA	0.517																																					GBM(198;1966 2199 4849 37227 49954)												0													46.0	48.0	47.0					11																	19077360		2199	4293	6492	SO:0001583	missense	0				CCDS7847.1	11p15.1	2013-10-10			ENSG00000183695	ENSG00000183695		"""GPCR / Class A : Orphans"""	17983	protein-coding gene	gene with protein product		607228				11551509	Standard	NM_054030		Approved	MRGX2	uc001mph.3	Q96LB1	OTTHUMG00000166098	ENST00000329773.2:c.590T>C	11.37:g.19077360A>G	ENSP00000333800:p.Val197Ala		B5B0C7|Q4QXW4|Q4QXW7|Q4QXX0|Q4QXX2|Q4QXX3|Q4QXX4|Q4QXX6|Q4QXX7	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	p.V197A	ENST00000329773.2	37	c.590	CCDS7847.1	11	.	.	.	.	.	.	.	.	.	.	.	16.95	3.264055	0.59431	.	.	ENSG00000183695	ENST00000329773	T	0.74106	-0.81	4.99	4.99	0.66335	GPCR, rhodopsin-like superfamily (1);	1.202360	0.06022	N	0.651402	D	0.84288	0.5439	M	0.85462	2.755	0.09310	N	1	P	0.44344	0.833	P	0.49085	0.6	T	0.72431	-0.4296	10	0.62326	D	0.03	.	12.9765	0.58540	1.0:0.0:0.0:0.0	.	197	Q96LB1	MRGX2_HUMAN	A	197	ENSP00000333800:V197A	ENSP00000333800:V197A	V	-	2	0	MRGPRX2	19033936	0.001000	0.12720	0.348000	0.25681	0.220000	0.24768	1.208000	0.32345	2.241000	0.73720	0.533000	0.62120	GTT	MRGPRX2	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000183695		0.517	MRGPRX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRGPRX2	HGNC	protein_coding	OTTHUMT00000387819.1	-	0.00	20	0	A	NM_054030		19077360	-1	tier1	-	no_errors	ENST00000329773	ensembl	human	known	74_37	missense	31.25	22	10	SNP	0.063	G
MRPS25	64432	genome.wustl.edu	37	3	15091444	15091444	+	3'UTR	SNP	T	T	A			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr3:15091444T>A	ENST00000253686.2	-	0	3166				MRPS25_ENST00000449354.2_Splice_Site|MRPS25_ENST00000496484.1_5'UTR	NM_022497.3	NP_071942.1	P82663	RT25_HUMAN	mitochondrial ribosomal protein S25							mitochondrion (GO:0005739)|ribosome (GO:0005840)				large_intestine(1)|lung(1)	2						AGGTAGTGCCTCAAAGAGAAG	0.443																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AB061208	CCDS2622.1	3p25	2012-09-13			ENSG00000131368	ENSG00000131368		"""Mitochondrial ribosomal proteins / small subunits"""	14511	protein-coding gene	gene with protein product	"""mitochondrial 28S ribosomal protein S25"""	611987				11279123	Standard	NM_022497		Approved	MRP-S25, FLJ00023, DKFZp313H0817, RPMS25	uc003bzl.3	P82663	OTTHUMG00000129836	ENST00000253686.2:c.*2504A>T	3.37:g.15091444T>A			B4DFJ5|B4DQG6|Q9H7P5	Splice_Site	SNP	-	e4-2	ENST00000253686.2	37	c.333-2	CCDS2622.1	3	.	.	.	.	.	.	.	.	.	.	T	4.205	0.036787	0.08148	.	.	ENSG00000131368	ENST00000449354	.	.	.	1.54	0.339	0.15979	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	3.0621	0.06203	0.0:0.4554:0.0:0.5446	.	.	.	.	.	-1	.	.	.	-	.	.	MRPS25	15066448	0.002000	0.14202	0.001000	0.08648	0.213000	0.24496	0.404000	0.20999	0.088000	0.17205	0.172000	0.16884	.	MRPS25	-	-	ENSG00000131368		0.443	MRPS25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRPS25	HGNC	protein_coding	OTTHUMT00000252076.2	-	0.00	30	0	T	NM_022497		15091444	-1	tier1	-	no_errors	ENST00000420267	ensembl	human	known	74_37	splice_site	12.90	27	4	SNP	0.001	A
MT-ND5	4540	genome.wustl.edu	37	M	12991	12991	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chrM:12991G>A	ENST00000361567.2	+	1	655	c.655G>A	c.(655-657)Gca>Aca	p.A219T	MT-TH_ENST00000387441.1_RNA|MT-TG_ENST00000387429.1_RNA|MT-TE_ENST00000387459.1_RNA|MT-TT_ENST00000387460.2_RNA|MT-TR_ENST00000387439.1_RNA|MT-CYB_ENST00000361789.2_5'Flank|MT-TS2_ENST00000387449.1_RNA|MT-TL2_ENST00000387456.1_RNA|MT-TP_ENST00000387461.2_RNA			P03915	NU5M_HUMAN	mitochondrially encoded NADH dehydrogenase 5	219					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(4)|endometrium(29)|kidney(33)|pancreas(1)|prostate(7)	74						GCCTCCTCCTAGCAGCAGCAG	0.532																																																	0																																										SO:0001583	missense	0					mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198786	ENSG00000198786	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7461	protein-coding gene	gene with protein product	"""complex I ND5 subunit"", ""NADH-ubiquinone oxidoreductase chain 5"""	516005	"""NADH dehydrogenase 5"""	MTND5			Standard			Approved	ND5, NAD5		P03915		ENST00000361567.2:c.655G>A	M.37:g.12991G>A	ENSP00000354813:p.Ala219Thr		Q34773|Q8WCY3	Missense_Mutation	SNP	pfam_NADH_UbQ/plastoQ_OxRdtase,pfam_NADH_DH_su5_C,pfam_NADH_UbQ_OxRdtase_chain5/L_N,tigrfam_NADHpl_OxRdtase_5	p.A219T	ENST00000361567.2	37	c.655		MT																																																																																			MT-ND5	-	pfam_NADH_UbQ/plastoQ_OxRdtase,tigrfam_NADHpl_OxRdtase_5	ENSG00000198786		0.532	MT-ND5-201	KNOWN	basic|appris_principal	protein_coding	MT-ND5	HGNC	protein_coding		-	0.00	15	0	G	YP_003024036		12991	+1	tier1	-	no_errors	ENST00000361567	ensembl	human	known	74_37	missense	66.67	2	4	SNP	NULL	A
MTHFR	4524	genome.wustl.edu	37	1	11852371	11852371	+	Nonsense_Mutation	SNP	G	G	C			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr1:11852371G>C	ENST00000376592.1	-	9	1724	c.1596C>G	c.(1594-1596)taC>taG	p.Y532*	MTHFR_ENST00000376585.1_Nonsense_Mutation_p.Y573*|MTHFR_ENST00000376583.3_Nonsense_Mutation_p.Y573*|MTHFR_ENST00000376590.3_Nonsense_Mutation_p.Y532*			P42898	MTHR_HUMAN	methylenetetrahydrofolate reductase (NAD(P)H)	532					blood circulation (GO:0008015)|cellular amino acid metabolic process (GO:0006520)|folic acid metabolic process (GO:0046655)|homocysteine metabolic process (GO:0050667)|methionine biosynthetic process (GO:0009086)|response to drug (GO:0042493)|response to folic acid (GO:0051593)|response to hypoxia (GO:0001666)|response to interleukin-1 (GO:0070555)|response to vitamin B2 (GO:0033274)|S-adenosylmethionine metabolic process (GO:0046500)|small molecule metabolic process (GO:0044281)|tetrahydrofolate interconversion (GO:0035999)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|neuron projection (GO:0043005)	flavin adenine dinucleotide binding (GO:0050660)|methylenetetrahydrofolate reductase (NAD(P)H) activity (GO:0004489)|modified amino acid binding (GO:0072341)|NADP binding (GO:0050661)			NS(4)|breast(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(6)|prostate(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	33	Ovarian(185;0.249)	Lung NSC(185;8.69e-05)|all_lung(284;9.87e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00826)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.66e-06)|COAD - Colon adenocarcinoma(227;0.000261)|BRCA - Breast invasive adenocarcinoma(304;0.000304)|Kidney(185;0.000777)|KIRC - Kidney renal clear cell carcinoma(229;0.00261)|STAD - Stomach adenocarcinoma(313;0.0073)|READ - Rectum adenocarcinoma(331;0.0649)	Benazepril(DB00542)|Cyanocobalamin(DB00115)|Fluorouracil(DB00544)|Folic Acid(DB00158)|L-Methionine(DB00134)|Menadione(DB00170)|Methotrexate(DB00563)|Riboflavin(DB00140)|Tetrahydrofolic acid(DB00116)	CCCGGAGCTCGTACTTCTTCA	0.557																																																	0													117.0	120.0	119.0					1																	11852371		2203	4300	6503	SO:0001587	stop_gained	0			BC053509	CCDS137.1	1p36.3	2014-09-17	2010-05-04		ENSG00000177000	ENSG00000177000	1.5.1.20		7436	protein-coding gene	gene with protein product		607093	"""5,10-methylenetetrahydrofolate reductase (NADPH)"""			7920641	Standard	NM_005957		Approved		uc001atc.2	P42898	OTTHUMG00000002277	ENST00000376592.1:c.1596C>G	1.37:g.11852371G>C	ENSP00000365777:p.Tyr532*		B2R7A6|Q5SNW6|Q5SNW9|Q7Z6M6|Q8IU73|Q9UQR2	Nonsense_Mutation	SNP	pfam_Mehydrof_redctse,tigrfam_Fadh2_euk	p.Y573*	ENST00000376592.1	37	c.1719	CCDS137.1	1	.	.	.	.	.	.	.	.	.	.	G	46	12.273840	0.99652	.	.	ENSG00000177000	ENST00000376592;ENST00000376583;ENST00000376590;ENST00000376585	.	.	.	5.18	-7.85	0.01192	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	18.1553	0.89689	0.7245:0.0:0.2755:0.0	.	.	.	.	X	532;573;532;573	.	ENSP00000365767:Y573X	Y	-	3	2	MTHFR	11774958	0.000000	0.05858	0.205000	0.23548	0.975000	0.68041	-2.467000	0.00993	-1.894000	0.01105	-0.339000	0.08088	TAC	MTHFR	-	NULL	ENSG00000177000		0.557	MTHFR-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MTHFR	HGNC	protein_coding	OTTHUMT00000006538.1	-	0.00	58	0	G	NM_005957		11852371	-1	tier1	-	no_errors	ENST00000376583	ensembl	human	known	74_37	nonsense	25.86	43	15	SNP	0.078	C
MUC16	94025	genome.wustl.edu	37	19	9063073	9063073	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr19:9063073T>G	ENST00000397910.4	-	3	24576	c.24373A>C	c.(24373-24375)Aag>Cag	p.K8125Q		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	8127	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						CTGCTGGTCTTTCTCAGTCCA	0.527																																																	0													127.0	124.0	125.0					19																	9063073		2000	4171	6171	SO:0001583	missense	0			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.24373A>C	19.37:g.9063073T>G	ENSP00000381008:p.Lys8125Gln		Q6ZQW5|Q96RK2	Missense_Mutation	SNP	pfam_SEA_dom,smart_SEA_dom,pfscan_SEA_dom	p.K8125Q	ENST00000397910.4	37	c.24373	CCDS54212.1	19	.	.	.	.	.	.	.	.	.	.	t	6.706	0.498855	0.12762	.	.	ENSG00000181143	ENST00000397910	T	0.02709	4.19	3.09	-6.17	0.02091	.	.	.	.	.	T	0.01387	0.0045	N	0.08118	0	.	.	.	B	0.34147	0.438	B	0.31946	0.138	T	0.46261	-0.9204	8	0.87932	D	0	.	4.8854	0.13701	0.0:0.2588:0.2872:0.4541	.	8125	B5ME49	.	Q	8125	ENSP00000381008:K8125Q	ENSP00000381008:K8125Q	K	-	1	0	MUC16	8924073	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.905000	0.04075	-1.355000	0.02186	0.416000	0.27883	AAG	MUC16	-	NULL	ENSG00000181143		0.527	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	HGNC	protein_coding	OTTHUMT00000402806.1	-	0.00	81	0	T	NM_024690		9063073	-1	tier1	-	no_errors	ENST00000397910	ensembl	human	known	74_37	missense	23.08	50	15	SNP	0.000	G
MUC19	283463	genome.wustl.edu	37	12	40811954	40811954	+	5'UTR	SNP	T	T	C			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr12:40811954T>C	ENST00000454784.4	+	0	332				RP11-115F18.1_ENST00000552757.1_RNA			Q7Z5P9	MUC19_HUMAN	mucin 19, oligomeric						cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				lung(2)	2						CGTCTGAATATAGTACGTCTG	0.318																																																	0																																										SO:0001623	5_prime_UTR_variant	0			AY236870		12q12	2012-04-20	2006-03-14		ENSG00000205592	ENSG00000205592		"""Mucins"""	14362	protein-coding gene	gene with protein product		612170				12882755	Standard	NM_173600		Approved	FLJ35746	uc021qxa.1	Q7Z5P9	OTTHUMG00000060732	ENST00000454784.4:c.-402T>C	12.37:g.40811954T>C			Q8NA85	Silent	SNP	pfam_VWF_type-D	p.Y93	ENST00000454784.4	37	c.279		12																																																																																			MUC19	-	NULL	ENSG00000205592		0.318	MUC19-001	NOVEL	non_canonical_conserved|non_canonical_genome_sequence_error|basic|appris_principal	protein_coding	MUC19	HGNC	protein_coding	OTTHUMT00000384257.6	-	0.00	21	0	T	XM_003403524		40811954	+1	tier1	-	no_errors	ENST00000425730	ensembl	human	putative	74_37	silent	30.77	18	8	SNP	0.000	C
MURC	347273	genome.wustl.edu	37	9	103348507	103348507	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr9:103348507G>A	ENST00000307584.5	+	2	934	c.869G>A	c.(868-870)aGg>aAg	p.R290K		NM_001018116.1	NP_001018126.1	Q5BKX8	MURC_HUMAN	muscle-related coiled-coil protein	290					cell differentiation (GO:0030154)|muscle organ development (GO:0007517)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	Z disc (GO:0030018)				endometrium(1)|kidney(1)|large_intestine(6)|lung(7)|ovary(1)	16		Acute lymphoblastic leukemia(62;0.0461)				GAATGTGCCAGGGAGATGGGT	0.527																																																	0													112.0	115.0	114.0					9																	103348507		2203	4300	6503	SO:0001583	missense	0			BC090888	CCDS35083.1	9q31.1	2014-09-17			ENSG00000170681	ENSG00000170681			33742	protein-coding gene	gene with protein product	"""muscle-restricted coiled-coil protein"""					18508909, 18332105	Standard	NM_001018116		Approved	cavin-4, CAVIN4	uc004bba.3	Q5BKX8	OTTHUMG00000020368	ENST00000307584.5:c.869G>A	9.37:g.103348507G>A	ENSP00000418668:p.Arg290Lys		B1PRL3|B4DT88	Missense_Mutation	SNP	NULL	p.R290K	ENST00000307584.5	37	c.869	CCDS35083.1	9	.	.	.	.	.	.	.	.	.	.	G	11.26	1.587007	0.28268	.	.	ENSG00000170681	ENST00000307584	T	0.62941	-0.01	5.29	1.53	0.23141	.	0.849786	0.10811	N	0.631621	T	0.37320	0.0999	N	0.14661	0.345	0.23506	N	0.997537	B	0.19200	0.034	B	0.19391	0.025	T	0.20706	-1.0267	10	0.18710	T	0.47	-2.3688	2.5598	0.04769	0.3785:0.0:0.4117:0.2097	.	290	Q5BKX8	MURC_HUMAN	K	290	ENSP00000418668:R290K	ENSP00000418668:R290K	R	+	2	0	MURC	102388328	1.000000	0.71417	0.431000	0.26735	0.257000	0.26127	3.837000	0.55820	0.530000	0.28619	0.561000	0.74099	AGG	MURC	-	NULL	ENSG00000170681		0.527	MURC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MURC	HGNC	protein_coding	OTTHUMT00000053419.2	-	0.00	44	0	G	NM_001018116		103348507	+1	tier1	-	no_errors	ENST00000307584	ensembl	human	known	74_37	missense	15.19	67	12	SNP	0.699	A
MXRA5	25878	genome.wustl.edu	37	X	3238108	3238108	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chrX:3238108A>G	ENST00000217939.6	-	5	5772	c.5618T>C	c.(5617-5619)tTc>tCc	p.F1873S		NM_015419.3	NP_056234.2	Q9NR99	MXRA5_HUMAN	matrix-remodelling associated 5	1873	Ig-like C2-type 3.					extracellular vesicular exosome (GO:0070062)				NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(3)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(32)|lung(81)|ovary(6)|prostate(3)|skin(9)|stomach(3)|urinary_tract(2)	157		all_lung(23;0.00031)|Lung NSC(23;0.000946)				CTCACAGGGGAACACAGTGTC	0.463																																																	0													86.0	71.0	76.0					X																	3238108		2203	4300	6503	SO:0001583	missense	0			AF245505	CCDS14124.1	Xp22.33	2013-01-29			ENSG00000101825	ENSG00000101825		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	7539	protein-coding gene	gene with protein product	"""adlican"""					12101425	Standard	NM_015419		Approved	DKFZp564I1922	uc004crg.4	Q9NR99	OTTHUMG00000021083	ENST00000217939.6:c.5618T>C	X.37:g.3238108A>G	ENSP00000217939:p.Phe1873Ser		Q6P1M7|Q9Y3Y8	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.F1873S	ENST00000217939.6	37	c.5618	CCDS14124.1	X	.	.	.	.	.	.	.	.	.	.	A	16.28	3.079286	0.55753	.	.	ENSG00000101825	ENST00000381114;ENST00000217939	T	0.74737	-0.87	3.51	3.51	0.40186	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.721162	0.11336	U	0.574549	D	0.85911	0.5807	M	0.92691	3.335	0.25185	N	0.99018	D	0.53151	0.958	P	0.54174	0.744	T	0.76846	-0.2808	10	0.87932	D	0	.	11.8172	0.52218	1.0:0.0:0.0:0.0	.	1873	Q9NR99	MXRA5_HUMAN	S	1873	ENSP00000217939:F1873S	ENSP00000217939:F1873S	F	-	2	0	MXRA5	3248108	0.995000	0.38212	0.015000	0.15790	0.677000	0.39632	7.903000	0.87398	1.133000	0.42147	0.372000	0.22366	TTC	MXRA5	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000101825		0.463	MXRA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MXRA5	HGNC	protein_coding	OTTHUMT00000055655.2	-	0.00	44	0	A	NM_015419		3238108	-1	tier1	-	no_errors	ENST00000217939	ensembl	human	known	74_37	missense	42.86	28	21	SNP	0.746	G
MXRA5	25878	genome.wustl.edu	37	X	3240440	3240440	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chrX:3240440G>A	ENST00000217939.6	-	5	3440	c.3286C>T	c.(3286-3288)Cct>Tct	p.P1096S		NM_015419.3	NP_056234.2	Q9NR99	MXRA5_HUMAN	matrix-remodelling associated 5	1096						extracellular vesicular exosome (GO:0070062)				NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(3)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(32)|lung(81)|ovary(6)|prostate(3)|skin(9)|stomach(3)|urinary_tract(2)	157		all_lung(23;0.00031)|Lung NSC(23;0.000946)				GTGGAGTCAGGCAAAGTGATG	0.498																																																	0													131.0	104.0	113.0					X																	3240440		2203	4300	6503	SO:0001583	missense	0			AF245505	CCDS14124.1	Xp22.33	2013-01-29			ENSG00000101825	ENSG00000101825		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	7539	protein-coding gene	gene with protein product	"""adlican"""					12101425	Standard	NM_015419		Approved	DKFZp564I1922	uc004crg.4	Q9NR99	OTTHUMG00000021083	ENST00000217939.6:c.3286C>T	X.37:g.3240440G>A	ENSP00000217939:p.Pro1096Ser		Q6P1M7|Q9Y3Y8	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.P1096S	ENST00000217939.6	37	c.3286	CCDS14124.1	X	.	.	.	.	.	.	.	.	.	.	g	0.011	-1.726600	0.00694	.	.	ENSG00000101825	ENST00000381114;ENST00000217939	T	0.60548	0.18	2.62	-0.181	0.13291	.	2.087410	0.03023	U	0.151026	T	0.32255	0.0823	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.13019	-1.0525	10	0.12103	T	0.63	.	3.3082	0.07007	0.2016:0.0:0.374:0.4244	.	1096	Q9NR99	MXRA5_HUMAN	S	1096	ENSP00000217939:P1096S	ENSP00000217939:P1096S	P	-	1	0	MXRA5	3250440	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.085000	0.11250	0.099000	0.17552	0.519000	0.50382	CCT	MXRA5	-	NULL	ENSG00000101825		0.498	MXRA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MXRA5	HGNC	protein_coding	OTTHUMT00000055655.2		0.00	39	0	G	NM_015419		3240440	-1			no_errors	ENST00000217939	ensembl	human	known	74_37	missense	5.63	67	4	SNP	0.000	A
MYH10	4628	genome.wustl.edu	37	17	8381682	8381682	+	Nonsense_Mutation	SNP	G	G	A			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr17:8381682G>A	ENST00000269243.4	-	39	5725	c.5587C>T	c.(5587-5589)Cga>Tga	p.R1863*	MYH10_ENST00000379980.4_Nonsense_Mutation_p.R1879*|MYH10_ENST00000360416.3_Nonsense_Mutation_p.R1894*|MYH10_ENST00000396239.1_Nonsense_Mutation_p.R1884*|NDEL1_ENST00000299734.7_Intron	NM_005964.3	NP_005955.3	P35580	MYH10_HUMAN	myosin, heavy chain 10, non-muscle	1863					actin filament-based movement (GO:0030048)|actomyosin structure organization (GO:0031032)|adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|cardiac myofibril assembly (GO:0055003)|cell adhesion (GO:0007155)|cell proliferation (GO:0008283)|cerebellar Purkinje cell layer development (GO:0021680)|exocytosis (GO:0006887)|fourth ventricle development (GO:0021592)|in utero embryonic development (GO:0001701)|lateral ventricle development (GO:0021670)|mitotic cytokinesis (GO:0000281)|neuromuscular process controlling balance (GO:0050885)|neuron migration (GO:0001764)|nuclear migration (GO:0007097)|plasma membrane repair (GO:0001778)|regulation of cell shape (GO:0008360)|retina development in camera-type eye (GO:0060041)|substrate-dependent cell migration, cell extension (GO:0006930)|third ventricle development (GO:0021678)|ventricular cardiac muscle cell development (GO:0055015)	actomyosin (GO:0042641)|axon (GO:0030424)|cell cortex (GO:0005938)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|midbody (GO:0030496)|myosin complex (GO:0016459)|myosin II complex (GO:0016460)|myosin II filament (GO:0097513)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|spindle (GO:0005819)|stress fiber (GO:0001725)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			breast(5)|endometrium(9)|kidney(2)|large_intestine(16)|lung(9)|ovary(3)|prostate(3)|skin(4)|stomach(1)	52						TCCGCGTGTCGACGCTCATCC	0.542																																																	0													156.0	126.0	136.0					17																	8381682		2203	4300	6503	SO:0001587	stop_gained	0			M69181	CCDS11144.1, CCDS58515.1, CCDS73984.1	17p13	2011-09-27	2006-09-29		ENSG00000133026	ENSG00000133026		"""Myosins / Myosin superfamily : Class II"""	7568	protein-coding gene	gene with protein product		160776	"""myosin, heavy polypeptide 10, non-muscle"""			1860190	Standard	NM_001256012		Approved	NMMHCB	uc002glm.4	P35580	OTTHUMG00000108195	ENST00000269243.4:c.5587C>T	17.37:g.8381682G>A	ENSP00000269243:p.Arg1863*		B2RWP9|D3DTS1|F8VTL3|Q12989|Q149N3|Q149N4|Q16087|Q4LE45|Q6PK16|Q9BWG0	Nonsense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_Myosin_tail,pfam_Myosin_N,pfam_IQ_motif_EF-hand-BS,superfamily_P-loop_NTPase,superfamily_Prefoldin,superfamily_HR1_rho-bd,superfamily_UBA-like,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.R1884*	ENST00000269243.4	37	c.5650	CCDS11144.1	17	.	.	.	.	.	.	.	.	.	.	G	42	9.650481	0.99229	.	.	ENSG00000133026	ENST00000269243;ENST00000360416;ENST00000396239;ENST00000379980	.	.	.	4.78	4.78	0.61160	.	0.062748	0.64402	D	0.000005	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.30078	T	0.28	.	13.357	0.60633	0.0:0.0:0.8425:0.1575	.	.	.	.	X	1863;1894;1884;1879	.	ENSP00000269243:R1863X	R	-	1	2	MYH10	8322407	1.000000	0.71417	0.439000	0.26833	0.086000	0.17979	5.302000	0.65733	2.657000	0.90304	0.655000	0.94253	CGA	MYH10	-	pfam_Myosin_tail,superfamily_HR1_rho-bd	ENSG00000133026		0.542	MYH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH10	HGNC	protein_coding	OTTHUMT00000227001.2		0.00	44	0	G			8381682	-1			no_errors	ENST00000396239	ensembl	human	known	74_37	nonsense	5.56	34	2	SNP	0.998	A
MYH13	8735	genome.wustl.edu	37	17	10265724	10265724	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr17:10265724C>A	ENST00000418404.3	-	3	464	c.301G>T	c.(301-303)Gct>Tct	p.A101S	MYH13_ENST00000252172.4_Missense_Mutation_p.A101S			Q9UKX3	MYH13_HUMAN	myosin, heavy chain 13, skeletal muscle	101	Myosin motor.				cellular response to starvation (GO:0009267)|metabolic process (GO:0008152)|muscle contraction (GO:0006936)	extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			breast(3)|cervix(2)|endometrium(11)|kidney(7)|large_intestine(21)|lung(48)|ovary(7)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(2)	108						TACAGAACAGCAGGTTCATGC	0.463																																																	0													290.0	265.0	273.0					17																	10265724		2203	4300	6503	SO:0001583	missense	0			AF075248	CCDS45613.1	17p13	2011-09-27	2006-09-29			ENSG00000006788		"""Myosins / Myosin superfamily : Class II"""	7571	protein-coding gene	gene with protein product	"""extraocular muscle myosin heavy chain"", ""extraocular myosin heavy chain"""	603487	"""myosin, heavy polypeptide 13, skeletal muscle"""			9806854	Standard	NM_003802		Approved	MyHC-eo	uc002gmk.1	Q9UKX3		ENST00000418404.3:c.301G>T	17.37:g.10265724C>A	ENSP00000404570:p.Ala101Ser		O95252|Q9P0U8	Missense_Mutation	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_P-loop_NTPase,superfamily_Prefoldin,smart_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.A101S	ENST00000418404.3	37	c.301	CCDS45613.1	17	.	.	.	.	.	.	.	.	.	.	C	0.113	-1.136371	0.01742	.	.	ENSG00000006788	ENST00000252172	D	0.86769	-2.17	4.4	4.4	0.53042	Myosin head, motor domain (2);	.	.	.	.	T	0.68128	0.2967	N	0.02973	-0.45	0.34234	D	0.676901	B	0.02656	0.0	B	0.17433	0.018	T	0.64474	-0.6399	9	0.02654	T	1	.	12.6056	0.56521	0.1658:0.8342:0.0:0.0	.	101	Q9UKX3	MYH13_HUMAN	S	101	ENSP00000252172:A101S	ENSP00000252172:A101S	A	-	1	0	MYH13	10206449	0.156000	0.22821	0.722000	0.30670	0.149000	0.21700	0.645000	0.24782	2.445000	0.82738	0.467000	0.42956	GCT	MYH13	-	pfam_Myosin_head_motor_dom,superfamily_P-loop_NTPase,smart_Myosin_head_motor_dom	ENSG00000006788		0.463	MYH13-003	KNOWN	alternative_3_UTR|alternative_5_UTR|NMD_exception|not_organism_supported|basic|appris_principal|CCDS	protein_coding	MYH13	HGNC	protein_coding	OTTHUMT00000442255.1	-	0.00	110	0	C	NM_003802		10265724	-1	tier1	-	no_errors	ENST00000252172	ensembl	human	known	74_37	missense	14.53	99	17	SNP	0.842	A
MXRA7	439921	genome.wustl.edu	37	17	74684639	74684639	+	Intron	SNP	C	C	A			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr17:74684639C>A	ENST00000355797.3	-	2	351				MXRA7_ENST00000449428.2_Intron|MXRA7_ENST00000585519.1_Intron|MXRA7_ENST00000589082.1_Intron|MXRA7_ENST00000592148.1_Missense_Mutation_p.D31Y|MXRA7_ENST00000375036.2_Intron|MXRA7_ENST00000588114.1_Intron	NM_001008528.1	NP_001008528.1	P84157	MXRA7_HUMAN	matrix-remodelling associated 7							integral component of membrane (GO:0016021)				kidney(1)|large_intestine(2)|lung(2)|skin(1)	6						GGGTGTCTGTCTGGGACCAGG	0.577																																																	0																																										SO:0001627	intron_variant	0			BC053983	CCDS32745.1, CCDS32746.1, CCDS45786.1	17q25.1	2007-08-01				ENSG00000182534			7541	protein-coding gene	gene with protein product							Standard	XM_005257382		Approved	FLJ46603, TMAP1, PS1TP1	uc002jsk.1	P84157		ENST00000355797.3:c.343-381G>T	17.37:g.74684639C>A			Q0P5W3	Missense_Mutation	SNP	NULL	p.D31Y	ENST00000355797.3	37	c.91	CCDS32745.1	17																																																																																			MXRA7	-	NULL	ENSG00000182534		0.577	MXRA7-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MXRA7	HGNC	protein_coding	OTTHUMT00000450983.1	-	0.00	37	0	C	NM_001008529		74684639	-1	tier1	-	no_errors	ENST00000592148	ensembl	human	putative	74_37	missense	9.76	37	4	SNP	0.001	A
MYLK3	91807	genome.wustl.edu	37	16	46771735	46771735	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr16:46771735G>A	ENST00000394809.4	-	3	1004	c.889C>T	c.(889-891)Ccc>Tcc	p.P297S	MYLK3_ENST00000536476.1_Intron	NM_182493.2	NP_872299.2	Q32MK0	MYLK3_HUMAN	myosin light chain kinase 3	297					cardiac myofibril assembly (GO:0055003)|cellular response to interleukin-1 (GO:0071347)|positive regulation of sarcomere organization (GO:0060298)|protein phosphorylation (GO:0006468)|regulation of vascular permeability involved in acute inflammatory response (GO:0002528)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)|myosin light chain kinase activity (GO:0004687)			central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(7)|lung(11)|ovary(3)|prostate(3)|skin(5)|stomach(3)	37		all_cancers(37;0.00023)|all_epithelial(9;0.000543)|all_lung(18;0.00585)|Lung NSC(13;0.0496)|Breast(268;0.116)				TCCTCTAAGGGCTCAGGGTCA	0.667																																																	0													72.0	71.0	72.0					16																	46771735		2203	4300	6503	SO:0001583	missense	0			AJ247087	CCDS10723.2	16q11.2	2008-10-23			ENSG00000140795	ENSG00000140795			29826	protein-coding gene	gene with protein product	"""MLC kinase"""	612147				17885681	Standard	NM_182493		Approved	caMLCK, MLCK	uc002eei.4	Q32MK0	OTTHUMG00000132543	ENST00000394809.4:c.889C>T	16.37:g.46771735G>A	ENSP00000378288:p.Pro297Ser		B5BUL9|B7Z5U8|Q32MK1|Q96DV1	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.P297S	ENST00000394809.4	37	c.889	CCDS10723.2	16	.	.	.	.	.	.	.	.	.	.	G	7.782	0.709820	0.15239	.	.	ENSG00000140795	ENST00000394809	T	0.66995	-0.24	4.75	-3.89	0.04193	.	0.890012	0.09176	N	0.838139	T	0.40094	0.1103	L	0.29908	0.895	0.09310	N	1	B	0.15141	0.012	B	0.09377	0.004	T	0.31558	-0.9939	10	0.08381	T	0.77	.	0.3905	0.00409	0.3495:0.1264:0.223:0.301	.	297	Q32MK0	MYLK3_HUMAN	S	297	ENSP00000378288:P297S	ENSP00000378288:P297S	P	-	1	0	MYLK3	45329236	0.080000	0.21391	0.000000	0.03702	0.006000	0.05464	0.406000	0.21032	-0.527000	0.06374	0.655000	0.94253	CCC	MYLK3	-	NULL	ENSG00000140795		0.667	MYLK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYLK3	HGNC	protein_coding	OTTHUMT00000255743.2	-	0.00	39	0	G	NM_182493		46771735	-1	tier1	-	no_errors	ENST00000394809	ensembl	human	known	74_37	missense	9.62	47	5	SNP	0.000	A
MYO3A	53904	genome.wustl.edu	37	10	26462823	26462823	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr10:26462823A>C	ENST00000265944.5	+	30	3796	c.3630A>C	c.(3628-3630)gaA>gaC	p.E1210D	MYO3A_ENST00000543632.1_Intron	NM_017433.4	NP_059129.3	Q8NEV4	MYO3A_HUMAN	myosin IIIA	1210					ATP catabolic process (GO:0006200)|inner ear development (GO:0048839)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of filopodium assembly (GO:0051491)|protein autophosphorylation (GO:0046777)|response to stimulus (GO:0050896)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|filamentous actin (GO:0031941)|filopodium (GO:0030175)|filopodium tip (GO:0032433)|myosin complex (GO:0016459)|photoreceptor inner segment (GO:0001917)|stereocilium bundle tip (GO:0032426)	actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|plus-end directed microfilament motor activity (GO:0060002)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(9)|central_nervous_system(3)|endometrium(9)|kidney(10)|large_intestine(28)|liver(1)|lung(46)|ovary(11)|pancreas(1)|prostate(6)|skin(11)|stomach(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	146						TAGGGCCAGAAGTAAGCCCCA	0.413																																																	0													97.0	98.0	97.0					10																	26462823		2203	4300	6503	SO:0001583	missense	0			AF229172	CCDS7148.1	10p11.1	2011-09-27	2004-05-19		ENSG00000095777	ENSG00000095777		"""Myosins / Myosin superfamily : Class III"""	7601	protein-coding gene	gene with protein product		606808	"""deafness, autosomal recessive 30"""	DFNB30		10936054	Standard	NM_017433		Approved		uc001isn.2	Q8NEV4	OTTHUMG00000017837	ENST00000265944.5:c.3630A>C	10.37:g.26462823A>C	ENSP00000265944:p.Glu1210Asp		Q4G0X2|Q5VZ28|Q8WX17|Q9NYS8	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_IQ_motif_EF-hand-BS,superfamily_P-loop_NTPase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,pfscan_Prot_kinase_dom,prints_Myosin_head_motor_dom	p.E1210D	ENST00000265944.5	37	c.3630	CCDS7148.1	10	.	.	.	.	.	.	.	.	.	.	A	12.93	2.086212	0.36855	.	.	ENSG00000095777	ENST00000265944	T	0.79749	-1.3	5.07	2.63	0.31362	.	2.311560	0.01184	N	0.007160	T	0.73156	0.3551	L	0.29908	0.895	0.40321	D	0.978823	B	0.12630	0.006	B	0.08055	0.003	T	0.58329	-0.7655	10	0.72032	D	0.01	.	6.2622	0.20907	0.5756:0.159:0.0:0.2654	.	1210	Q8NEV4	MYO3A_HUMAN	D	1210	ENSP00000265944:E1210D	ENSP00000265944:E1210D	E	+	3	2	MYO3A	26502829	0.305000	0.24481	0.042000	0.18584	0.272000	0.26649	0.773000	0.26661	0.317000	0.23160	0.533000	0.62120	GAA	MYO3A	-	superfamily_P-loop_NTPase	ENSG00000095777		0.413	MYO3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO3A	HGNC	protein_coding	OTTHUMT00000047259.1	-	0.00	19	0	A	NM_017433		26462823	+1	tier1	-	no_errors	ENST00000265944	ensembl	human	known	74_37	missense	22.73	17	5	SNP	0.592	C
NAT10	55226	genome.wustl.edu	37	11	34144020	34144020	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr11:34144020G>T	ENST00000257829.3	+	9	1001	c.795G>T	c.(793-795)ttG>ttT	p.L265F	NAT10_ENST00000527971.1_Intron|NAT10_ENST00000531159.2_Missense_Mutation_p.L193F	NM_024662.2	NP_078938	Q9H0A0	NAT10_HUMAN	N-acetyltransferase 10 (GCN5-related)	265						membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|N-acetyltransferase activity (GO:0008080)|poly(A) RNA binding (GO:0044822)			endometrium(4)|large_intestine(8)|lung(8)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	23		Acute lymphoblastic leukemia(5;0.0119)|all_hematologic(20;0.0231)				AAGCTGTCTTGAAATTTATCG	0.483																																																	0													86.0	88.0	88.0					11																	34144020		2202	4298	6500	SO:0001583	missense	0			AF489535	CCDS7889.1, CCDS44568.1	11p13	2011-11-16	2008-09-24		ENSG00000135372	ENSG00000135372	2.3.1.-		29830	protein-coding gene	gene with protein product		609221	"""N-acetyltransferase 10"""			14592445, 21177859	Standard	NM_024662		Approved	hALP, FLJ10774, FLJ12179, NET43, KIAA1709	uc001mvk.3	Q9H0A0	OTTHUMG00000166249	ENST00000257829.3:c.795G>T	11.37:g.34144020G>T	ENSP00000257829:p.Leu265Phe		B4DFD5|E7ESU4|E9PMN9|Q86WK5|Q9C0F4|Q9HA61|Q9NVF2	Missense_Mutation	SNP	pfam_Helicase_dom,pfam_DUF1726,superfamily_Acyl_CoA_acyltransferase,superfamily_P-loop_NTPase,pfscan_GNAT_dom	p.L265F	ENST00000257829.3	37	c.795	CCDS7889.1	11	.	.	.	.	.	.	.	.	.	.	G	16.52	3.147611	0.57151	.	.	ENSG00000135372	ENST00000257829;ENST00000531159	T;T	0.37915	1.19;1.17	5.78	3.85	0.44370	.	0.000000	0.85682	D	0.000000	T	0.45377	0.1339	M	0.90369	3.11	0.80722	D	1	P	0.46020	0.871	B	0.43783	0.431	T	0.50242	-0.8851	10	0.41790	T	0.15	-14.3503	6.9716	0.24652	0.188:0.1393:0.6726:0.0	.	265	Q9H0A0	NAT10_HUMAN	F	265;193	ENSP00000257829:L265F;ENSP00000433011:L193F	ENSP00000257829:L265F	L	+	3	2	NAT10	34100596	1.000000	0.71417	1.000000	0.80357	0.935000	0.57460	2.577000	0.46042	1.454000	0.47793	0.561000	0.74099	TTG	NAT10	-	superfamily_P-loop_NTPase	ENSG00000135372		0.483	NAT10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NAT10	HGNC	protein_coding	OTTHUMT00000388693.1		0.00	45	0	G	NM_024662		34144020	+1			no_errors	ENST00000257829	ensembl	human	known	74_37	missense	5.71	66	4	SNP	1.000	T
NBEA	26960	genome.wustl.edu	37	13	35644148	35644148	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr13:35644148A>C	ENST00000400445.3	+	9	1877	c.1343A>C	c.(1342-1344)aAt>aCt	p.N448T	NBEA_ENST00000540320.1_Missense_Mutation_p.N448T|NBEA_ENST00000379939.2_Missense_Mutation_p.N448T|NBEA_ENST00000310336.4_Missense_Mutation_p.N448T	NM_015678.4	NP_056493.3	Q8NFP9	NBEA_HUMAN	neurobeachin	448					protein localization (GO:0008104)	cytosol (GO:0005829)|endomembrane system (GO:0012505)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)				NS(1)|breast(1)|endometrium(14)|kidney(4)|large_intestine(29)|lung(40)|ovary(9)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	108		Breast(139;0.0141)|Lung SC(185;0.0548)|Prostate(109;0.207)		all cancers(112;1.93e-08)|Epithelial(112;1.62e-07)|BRCA - Breast invasive adenocarcinoma(63;0.00033)|OV - Ovarian serous cystadenocarcinoma(117;0.00109)|KIRC - Kidney renal clear cell carcinoma(186;0.00575)|Kidney(163;0.00656)|GBM - Glioblastoma multiforme(144;0.191)|Lung(94;0.199)		TTTACATATAATGCTAAGGCC	0.403																																																	0													56.0	50.0	52.0					13																	35644148		1898	4123	6021	SO:0001583	missense	0			AF467288	CCDS45026.1, CCDS55894.1	13q13	2014-09-17			ENSG00000172915	ENSG00000172915		"""A-kinase anchor proteins"", ""WD repeat domain containing"""	7648	protein-coding gene	gene with protein product		604889				10501977	Standard	NM_015678		Approved	KIAA1544, BCL8B, FLJ10197	uc021ric.1	Q8NFP9	OTTHUMG00000016724	ENST00000400445.3:c.1343A>C	13.37:g.35644148A>C	ENSP00000383295:p.Asn448Thr		B7Z2H9|Q5T320|Q9HCM8|Q9NSU1|Q9NW98|Q9Y6J1	Missense_Mutation	SNP	pfam_BEACH_dom,pfam_DUF1088,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_ConA-like_lec_gl_sf,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_BEACH_dom,pfscan_WD40_repeat_dom	p.N448T	ENST00000400445.3	37	c.1343	CCDS45026.1	13	.	.	.	.	.	.	.	.	.	.	A	25.0	4.593177	0.86953	.	.	ENSG00000172915	ENST00000540320;ENST00000400445;ENST00000379939;ENST00000310336	T;T;T;T	0.66280	-0.2;-0.2;-0.2;-0.2	5.53	5.53	0.82687	.	0.000000	0.85682	D	0.000000	T	0.80215	0.4582	M	0.82823	2.61	0.80722	D	1	D	0.63880	0.993	D	0.74674	0.984	T	0.81767	-0.0782	10	0.46703	T	0.11	.	15.6509	0.77091	1.0:0.0:0.0:0.0	.	448	Q5T321	.	T	448	ENSP00000440951:N448T;ENSP00000383295:N448T;ENSP00000369271:N448T;ENSP00000308534:N448T	ENSP00000308534:N448T	N	+	2	0	NBEA	34542148	1.000000	0.71417	0.900000	0.35374	0.938000	0.57974	9.296000	0.96104	2.100000	0.63781	0.254000	0.18369	AAT	NBEA	-	NULL	ENSG00000172915		0.403	NBEA-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NBEA	HGNC	protein_coding		-	0.00	169	0	A	NM_015678		35644148	+1	tier1	-	no_errors	ENST00000310336	ensembl	human	known	74_37	missense	19.74	187	46	SNP	1.000	C
NCAM2	4685	genome.wustl.edu	37	21	22710769	22710769	+	Missense_Mutation	SNP	T	T	A			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr21:22710769T>A	ENST00000400546.1	+	8	1208	c.959T>A	c.(958-960)cTc>cAc	p.L320H	NCAM2_ENST00000284894.7_Missense_Mutation_p.L178H|NCAM2_ENST00000535285.1_Missense_Mutation_p.L345H	NM_004540.3	NP_004531.2	O15394	NCAM2_HUMAN	neural cell adhesion molecule 2	320	Ig-like C2-type 4.				axonal fasciculation (GO:0007413)|neuron cell-cell adhesion (GO:0007158)|sensory perception of smell (GO:0007608)	axon (GO:0030424)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(4)|cervix(2)|endometrium(8)|kidney(6)|large_intestine(22)|liver(4)|lung(49)|ovary(4)|prostate(4)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	108		Lung NSC(9;0.195)		all cancers(11;0.00102)|OV - Ovarian serous cystadenocarcinoma(11;0.00121)|Epithelial(23;0.00147)|Colorectal(24;0.174)		CAAGTCACACTCGTATGTGAT	0.408																																																	0													68.0	66.0	66.0					21																	22710769		1894	4103	5997	SO:0001583	missense	0				CCDS42910.1	21q21	2013-02-11			ENSG00000154654	ENSG00000154654		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7657	protein-coding gene	gene with protein product		602040				9226371	Standard	NM_004540		Approved	NCAM21, MGC51008	uc002yld.2	O15394	OTTHUMG00000078121	ENST00000400546.1:c.959T>A	21.37:g.22710769T>A	ENSP00000383392:p.Leu320His		A8MQ06|B7Z841|Q7Z7F2	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom,prints_Neural_cell_adh	p.L320H	ENST00000400546.1	37	c.959	CCDS42910.1	21	.	.	.	.	.	.	.	.	.	.	T	20.9	4.058697	0.76074	.	.	ENSG00000154654	ENST00000400546;ENST00000284894;ENST00000535285	T;T;T	0.75477	0.4;0.4;-0.94	5.8	5.8	0.92144	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.051674	0.85682	D	0.000000	D	0.89553	0.6748	M	0.93678	3.445	0.58432	D	0.999997	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.991;0.991	D	0.92105	0.5691	10	0.87932	D	0	-13.818	14.9656	0.71188	0.0:0.0:0.0:1.0	.	345;178;320	B7Z841;B7Z5K2;O15394	.;.;NCAM2_HUMAN	H	320;178;345	ENSP00000383392:L320H;ENSP00000284894:L178H;ENSP00000441887:L345H	ENSP00000284894:L178H	L	+	2	0	NCAM2	21632640	0.945000	0.32115	0.922000	0.36590	0.571000	0.35966	4.144000	0.58057	2.209000	0.71365	0.482000	0.46254	CTC	NCAM2	-	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,pfscan_Ig-like_dom	ENSG00000154654		0.408	NCAM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCAM2	HGNC	protein_coding	OTTHUMT00000170915.1	-	0.00	39	0	T	NM_004540		22710769	+1	tier1	-	no_errors	ENST00000400546	ensembl	human	known	74_37	missense	37.50	15	9	SNP	0.988	A
NDUFB8	4714	genome.wustl.edu	37	10	102289559	102289559	+	Missense_Mutation	SNP	G	G	T	rs139653725		TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr10:102289559G>T	ENST00000299166.4	-	1	62	c.50C>A	c.(49-51)gCa>gAa	p.A17E	NDUFB8_ENST00000531258.1_Missense_Mutation_p.A17E|NDUFB8_ENST00000370320.4_Missense_Mutation_p.A17E|SEC31B_ENST00000535773.1_5'UTR|NDUFB8_ENST00000370322.1_Intron|NDUFB8_ENST00000557395.1_Missense_Mutation_p.A17E	NM_005004.2	NP_004995.1	O95169	NDUB8_HUMAN	NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 8, 19kDa	17					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			endometrium(2)|lung(2)	4		Colorectal(252;0.234)		Epithelial(162;5.68e-10)|all cancers(201;4.05e-08)		GTTCCGGGATGCCCTTTGCAG	0.627																																																	0													36.0	38.0	37.0					10																	102289559		2203	4300	6503	SO:0001583	missense	0			AF044958	CCDS7497.1, CCDS65916.1, CCDS65917.1	10q24.31	2011-07-04	2002-08-29		ENSG00000166136	ENSG00000166136		"""Mitochondrial respiratory chain complex / Complex I"""	7703	protein-coding gene	gene with protein product	"""complex I ASHI subunit"""	602140	"""NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 8 (19kD, ASHI)"""			9763676	Standard	NM_001284368		Approved	ASHI, CI-ASHI	uc001kri.1	O95169	OTTHUMG00000019346	ENST00000299166.4:c.50C>A	10.37:g.102289559G>T	ENSP00000299166:p.Ala17Glu		A8K0L4|Q5W143|Q5W144|Q5W145|Q9UG53|Q9UJR4|Q9UQF3	Missense_Mutation	SNP	pfam_NDUFB8,pirsf_NADH_UbQ_OxRdtase_b-cplx_su8	p.A17E	ENST00000299166.4	37	c.50	CCDS7497.1	10	.	.	.	.	.	.	.	.	.	.	G	12.16	1.855854	0.32791	.	.	ENSG00000166136	ENST00000531258;ENST00000299166;ENST00000370320	.	.	.	5.04	4.14	0.48551	.	0.482464	0.22019	N	0.065757	T	0.44705	0.1306	L	0.47190	1.495	0.80722	D	1	B	0.14805	0.011	B	0.14023	0.01	T	0.26155	-1.0111	9	0.06757	T	0.87	-3.0164	10.4096	0.44285	0.091:0.0:0.909:0.0	.	17	O95169	NDUB8_HUMAN	E	17	.	ENSP00000299166:A17E	A	-	2	0	NDUFB8	102279549	0.018000	0.18449	0.777000	0.31699	0.140000	0.21249	1.202000	0.32271	1.356000	0.45884	0.462000	0.41574	GCA	NDUFB8	-	pfam_NDUFB8,pirsf_NADH_UbQ_OxRdtase_b-cplx_su8	ENSG00000166136		0.627	NDUFB8-005	KNOWN	basic|appris_principal|CCDS	protein_coding	NDUFB8	HGNC	protein_coding	OTTHUMT00000051225.1	-	0.00	46	0	G	NM_005004		102289559	-1	tier1	-	no_errors	ENST00000299166	ensembl	human	known	74_37	missense	6.02	78	5	SNP	0.646	T
NEGR1	257194	genome.wustl.edu	37	1	71873192	71873192	+	Nonsense_Mutation	SNP	G	G	T			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr1:71873192G>T	ENST00000357731.5	-	7	1241	c.1002C>A	c.(1000-1002)taC>taA	p.Y334*	ZRANB2-AS2_ENST00000590186.1_RNA|ZRANB2-AS2_ENST00000587066.1_RNA|ZRANB2-AS2_ENST00000586006.1_RNA|ZRANB2-AS2_ENST00000587306.1_RNA|ZRANB2-AS2_ENST00000430605.1_RNA|ZRANB2-AS2_ENST00000585499.1_RNA|NEGR1_ENST00000306821.3_Nonsense_Mutation_p.Y206*|ZRANB2-AS2_ENST00000585415.1_RNA|NEGR1_ENST00000434200.1_Nonsense_Mutation_p.Y288*|ZRANB2-AS2_ENST00000608579.1_RNA	NM_173808.2	NP_776169.2	Q7Z3B1	NEGR1_HUMAN	neuronal growth regulator 1	334					feeding behavior (GO:0007631)|locomotory behavior (GO:0007626)|positive regulation of neuron projection development (GO:0010976)|single organismal cell-cell adhesion (GO:0016337)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)				endometrium(1)|kidney(4)|large_intestine(7)|lung(16)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	32		all_cancers(4;1.26e-06)|Renal(4;1.32e-08)|all_epithelial(4;5.39e-07)|Hepatocellular(141;0.117)		KIRC - Kidney renal clear cell carcinoma(4;0.00529)|Kidney(4;0.00609)|all cancers(265;0.022)|GBM - Glioblastoma multiforme(62;0.0382)|Epithelial(280;0.242)		TCAACACAAGGTACCAGCAGG	0.393																																																	0													90.0	89.0	89.0					1																	71873192		2203	4299	6502	SO:0001587	stop_gained	0			AK092307	CCDS661.1	1p31.1	2013-01-11			ENSG00000172260	ENSG00000172260		"""Immunoglobulin superfamily / I-set domain containing"""	17302	protein-coding gene	gene with protein product	"""a kindred of IgLON"", ""neurotractin"", ""IgLON family member 4"""	613173				10075727	Standard	NM_173808		Approved	KILON, MGC46680, Ntra, IGLON4	uc001dfw.3	Q7Z3B1	OTTHUMG00000009698	ENST00000357731.5:c.1002C>A	1.37:g.71873192G>T	ENSP00000350364:p.Tyr334*		Q5VT21|Q6UY06|Q8N440|Q8NAQ3	Nonsense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.Y334*	ENST00000357731.5	37	c.1002	CCDS661.1	1	.	.	.	.	.	.	.	.	.	.	G	34	5.316649	0.95682	.	.	ENSG00000172260	ENST00000357731;ENST00000306821;ENST00000434200	.	.	.	5.85	4.93	0.64822	.	0.474781	0.22602	N	0.057955	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-0.5122	15.3678	0.74538	0.0678:0.0:0.9322:0.0	.	.	.	.	X	334;206;288	.	ENSP00000305938:Y206X	Y	-	3	2	NEGR1	71645780	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.032000	0.76498	2.773000	0.95371	0.655000	0.94253	TAC	NEGR1	-	NULL	ENSG00000172260		0.393	NEGR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NEGR1	HGNC	protein_coding	OTTHUMT00000026722.4	-	0.00	56	0	G	NM_173808		71873192	-1	tier1	-	no_errors	ENST00000357731	ensembl	human	known	74_37	nonsense	20.78	61	16	SNP	1.000	T
NDUFS2	4720	genome.wustl.edu	37	1	161172165	161172165	+	5'UTR	SNP	G	G	T			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr1:161172165G>T	ENST00000367993.3	+	0	438				NDUFS2_ENST00000392179.4_5'UTR|NDUFS2_ENST00000476409.2_5'UTR	NM_004550.4	NP_004541.1	O75306	NDUS2_HUMAN	NADH dehydrogenase (ubiquinone) Fe-S protein 2, 49kDa (NADH-coenzyme Q reductase)						cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	4 iron, 4 sulfur cluster binding (GO:0051539)|electron carrier activity (GO:0009055)|metal ion binding (GO:0046872)|NAD binding (GO:0051287)|NADH dehydrogenase (ubiquinone) activity (GO:0008137)|quinone binding (GO:0048038)			breast(2)|endometrium(1)|kidney(2)|large_intestine(3)|lung(8)|prostate(1)|skin(1)	18	all_cancers(52;1.16e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00376)		Doxorubicin(DB00997)	GCAGTCTGCAGCCGGAGTAAG	0.657																																																	0													17.0	18.0	17.0					1																	161172165		2203	4299	6502	SO:0001623	5_prime_UTR_variant	0			BC008868	CCDS1224.1, CCDS53404.1	1q23.3	2011-07-04	2002-08-29		ENSG00000158864	ENSG00000158864	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7708	protein-coding gene	gene with protein product	"""complex I 49kDa subunit"", ""NADH dehydrogenase [ubiquinone] iron-sulfur protein 2, mitochondrial"""	602985	"""NADH dehydrogenase (ubiquinone) Fe-S protein 2 (49kD) (NADH-coenzyme Q reductase)"""			1832859, 9585441	Standard	NM_004550		Approved	CI-49	uc001fyw.3	O75306	OTTHUMG00000034344	ENST00000367993.3:c.-11G>T	1.37:g.161172165G>T			D3DVG7|J3KPM7|Q5VTW0|Q969P3|Q9UEV3	RNA	SNP	-	NULL	ENST00000367993.3	37	NULL	CCDS1224.1	1																																																																																			NDUFS2	-	-	ENSG00000158864		0.657	NDUFS2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NDUFS2	HGNC	protein_coding	OTTHUMT00000083015.1	-	0.00	80	0	G	NM_004550		161172165	+1	tier1	-	no_errors	ENST00000467295	ensembl	human	known	74_37	rna	6.06	62	4	SNP	0.005	T
NELL2	4753	genome.wustl.edu	37	12	45000977	45000977	+	Silent	SNP	G	G	C			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr12:45000977G>C	ENST00000429094.2	-	15	2142	c.1638C>G	c.(1636-1638)ggC>ggG	p.G546G	NELL2_ENST00000333837.4_Silent_p.G569G|NELL2_ENST00000549027.1_Silent_p.G545G|NELL2_ENST00000395487.2_Silent_p.G545G|NELL2_ENST00000437801.2_Silent_p.G596G|NELL2_ENST00000551601.1_Silent_p.G545G|NELL2_ENST00000452445.2_Silent_p.G546G	NM_001145108.1	NP_001138580.1	Q99435	NELL2_HUMAN	NEL-like 2 (chicken)	546	EGF-like 4. {ECO:0000255|PROSITE- ProRule:PRU00076}.					extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(16)|lung(30)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	65	Lung SC(27;0.192)	Lung NSC(34;0.144)		GBM - Glioblastoma multiforme(48;0.092)		GTCCAGTGAAGCCTTGTGGGC	0.388																																																	0													83.0	80.0	81.0					12																	45000977		2203	4299	6502	SO:0001819	synonymous_variant	0			D83018	CCDS8746.1, CCDS44863.1, CCDS44864.1, CCDS53781.1	12q12	2012-01-30	2001-11-28		ENSG00000184613	ENSG00000184613			7751	protein-coding gene	gene with protein product		602320	"""nel (chicken)-like 2"""			19249368	Standard	NM_006159		Approved	NRP2	uc010skz.1	Q99435	OTTHUMG00000169464	ENST00000429094.2:c.1638C>G	12.37:g.45000977G>C			B7Z2U7|B7Z5Q4|B7Z9J5|B7Z9U3|Q96JS2	Silent	SNP	pfam_EGF-like_Ca-bd_dom,pfam_VWF_C,pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,smart_VWC_out,smart_VWF_C,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_VWF_C	p.G596	ENST00000429094.2	37	c.1788	CCDS8746.1	12																																																																																			NELL2	-	smart_EG-like_dom,pfscan_EG-like_dom	ENSG00000184613		0.388	NELL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	NELL2	HGNC	protein_coding	OTTHUMT00000404180.1		0.00	38	0	G	NM_006159		45000977	-1			no_errors	ENST00000437801	ensembl	human	known	74_37	silent	5.77	49	3	SNP	1.000	C
NEU4	129807	genome.wustl.edu	37	2	242758151	242758151	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr2:242758151T>C	ENST00000391969.2	+	5	1943	c.1232T>C	c.(1231-1233)gTg>gCg	p.V411A	NEU4_ENST00000407683.1_Missense_Mutation_p.V411A|NEU4_ENST00000404257.1_Missense_Mutation_p.V423A|NEU4_ENST00000325935.6_Missense_Mutation_p.V424A|NEU4_ENST00000405370.1_Missense_Mutation_p.V411A	NM_001167602.1	NP_001161074.1	Q8WWR8	NEUR4_HUMAN	sialidase 4	411					ganglioside catabolic process (GO:0006689)|glycoprotein catabolic process (GO:0006516)|glycosphingolipid metabolic process (GO:0006687)|oligosaccharide catabolic process (GO:0009313)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	lysosomal lumen (GO:0043202)|lysosome (GO:0005764)|mitochondrion (GO:0005739)|organelle inner membrane (GO:0019866)	exo-alpha-(2->3)-sialidase activity (GO:0052794)|exo-alpha-(2->6)-sialidase activity (GO:0052795)|exo-alpha-(2->8)-sialidase activity (GO:0052796)|exo-alpha-sialidase activity (GO:0004308)			breast(1)|lung(10)|prostate(2)|skin(2)	15		all_cancers(19;1.09e-40)|all_epithelial(40;2.03e-18)|Breast(86;1.53e-05)|all_lung(227;0.00338)|Renal(207;0.00502)|Ovarian(221;0.00716)|Lung NSC(271;0.012)|Esophageal squamous(248;0.129)|Melanoma(123;0.144)|all_hematologic(139;0.158)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;3.84e-33)|all cancers(36;8.08e-31)|OV - Ovarian serous cystadenocarcinoma(60;7.41e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.63e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00154)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0825)		GAGCCCTGGGTGATCTACGAG	0.697																																																	0													10.0	12.0	12.0					2																	242758151		2184	4269	6453	SO:0001583	missense	0			BC012899	CCDS2553.1, CCDS54441.1, CCDS54442.1	2q37.3	2008-02-05			ENSG00000204099	ENSG00000204099			21328	protein-coding gene	gene with protein product		608527					Standard	NM_001167600		Approved		uc010fzr.3	Q8WWR8	OTTHUMG00000133412	ENST00000391969.2:c.1232T>C	2.37:g.242758151T>C	ENSP00000375830:p.Val411Ala		A8K056|J3KNJ5|Q96D64	Missense_Mutation	SNP	superfamily_Sialidases	p.V424A	ENST00000391969.2	37	c.1271	CCDS54442.1	2	.	.	.	.	.	.	.	.	.	.	T	20.1	3.931522	0.73442	.	.	ENSG00000204099	ENST00000407683;ENST00000405370;ENST00000472793;ENST00000404257;ENST00000391969;ENST00000325935	D;D;D;D;D	0.85088	-1.94;-1.94;-1.94;-1.94;-1.94	4.24	3.04	0.35103	Neuraminidase (2);	0.205916	0.41938	D	0.000785	D	0.87767	0.6260	M	0.75085	2.285	0.30117	N	0.806006	P;D;D	0.55385	0.952;0.971;0.962	P;P;P	0.53224	0.53;0.721;0.687	D	0.84752	0.0757	10	0.87932	D	0	-13.8371	9.7176	0.40284	0.0:0.0851:0.0:0.9149	.	423;423;411	A8K211;Q8WWR8-2;Q8WWR8	.;.;NEUR4_HUMAN	A	411;411;421;423;411;424	ENSP00000385402:V411A;ENSP00000384804:V411A;ENSP00000385149:V423A;ENSP00000375830:V411A;ENSP00000320318:V424A	ENSP00000320318:V424A	V	+	2	0	NEU4	242406824	1.000000	0.71417	0.931000	0.37212	0.976000	0.68499	4.384000	0.59607	0.471000	0.27319	0.330000	0.21533	GTG	NEU4	-	superfamily_Sialidases	ENSG00000204099		0.697	NEU4-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	NEU4	HGNC	protein_coding	OTTHUMT00000257270.2	-	0.00	136	0	T	NM_080741		242758151	+1	tier1	-	no_errors	ENST00000325935	ensembl	human	known	74_37	missense	18.85	99	23	SNP	1.000	C
NID1	4811	genome.wustl.edu	37	1	236192981	236192981	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr1:236192981C>T	ENST00000264187.6	-	7	1689	c.1607G>A	c.(1606-1608)cGg>cAg	p.R536Q	NID1_ENST00000366595.3_Missense_Mutation_p.R536Q	NM_002508.2	NP_002499.2	P14543	NID1_HUMAN	nidogen 1	536	Nidogen G2 beta-barrel. {ECO:0000255|PROSITE-ProRule:PRU00348}.				basement membrane organization (GO:0071711)|cell-matrix adhesion (GO:0007160)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glomerular basement membrane development (GO:0032836)|positive regulation of cell-substrate adhesion (GO:0010811)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|cell periphery (GO:0071944)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|laminin binding (GO:0043236)|proteoglycan binding (GO:0043394)			breast(4)|endometrium(9)|kidney(1)|large_intestine(23)|lung(20)|pancreas(1)|prostate(4)|skin(3)|urinary_tract(1)	66	Ovarian(103;0.0544)|Breast(184;0.23)	all_cancers(173;0.00491)|Prostate(94;0.184)|Acute lymphoblastic leukemia(190;0.229)	OV - Ovarian serous cystadenocarcinoma(106;0.00162)		Urokinase(DB00013)	GCCGCTGAACCGCTGCTTAAT	0.602																																																	0													55.0	45.0	48.0					1																	236192981		2203	4300	6503	SO:0001583	missense	0			BC045606	CCDS1608.1	1q43	2011-05-08	2005-06-02	2005-06-02	ENSG00000116962	ENSG00000116962			7821	protein-coding gene	gene with protein product		131390	"""nidogen (enactin)"""	NID		2471408, 7557988	Standard	NM_002508		Approved	entactin	uc001hxo.3	P14543	OTTHUMG00000040071	ENST00000264187.6:c.1607G>A	1.37:g.236192981C>T	ENSP00000264187:p.Arg536Gln		Q14942|Q59FL2|Q5TAF2|Q5TAF3|Q86XD7	Missense_Mutation	SNP	pfam_G2_nidogen/fibulin_G2F,pfam_LDLR_classB_rpt,pfam_Nidogen_extracell_dom,pfam_Thyroglobulin_1,pfam_EGF-like_Ca-bd_dom,superfamily_GFP,superfamily_Thyroglobulin_1,smart_Nidogen_extracell_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,smart_G2_nidogen/fibulin_G2F,smart_Thyroglobulin_1,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDLR_classB_rpt,pfscan_G2_nidogen/fibulin_G2F,pfscan_Thyroglobulin_1	p.R536Q	ENST00000264187.6	37	c.1607	CCDS1608.1	1	.	.	.	.	.	.	.	.	.	.	C	13.06	2.123487	0.37436	.	.	ENSG00000116962	ENST00000264187;ENST00000366595	T;T	0.27890	1.64;1.64	5.29	0.374	0.16183	G2 nidogen/fibulin G2F (3);Green fluorescent protein-like (1);	0.482216	0.25810	N	0.028151	T	0.09555	0.0235	N	0.01668	-0.77	0.22354	N	0.99917	B;B	0.02656	0.0;0.0	B;B	0.06405	0.001;0.002	T	0.32587	-0.9901	10	0.21540	T	0.41	.	8.7011	0.34327	0.0:0.3227:0.0:0.6773	.	536;536	P14543-2;P14543	.;NID1_HUMAN	Q	536	ENSP00000264187:R536Q;ENSP00000355554:R536Q	ENSP00000264187:R536Q	R	-	2	0	NID1	234259604	0.991000	0.36638	0.998000	0.56505	0.995000	0.86356	1.544000	0.36158	-0.089000	0.12484	0.563000	0.77884	CGG	NID1	-	pfam_G2_nidogen/fibulin_G2F,superfamily_GFP,smart_G2_nidogen/fibulin_G2F,pfscan_G2_nidogen/fibulin_G2F	ENSG00000116962		0.602	NID1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NID1	HGNC	protein_coding	OTTHUMT00000096647.2	-	0.00	39	0	C	NM_002508		236192981	-1	tier1	-	no_errors	ENST00000264187	ensembl	human	known	74_37	missense	41.67	21	15	SNP	1.000	T
NIPBL	25836	genome.wustl.edu	37	5	36985224	36985224	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr5:36985224A>G	ENST00000282516.8	+	10	2441	c.1942A>G	c.(1942-1944)Aca>Gca	p.T648A	NIPBL_ENST00000504430.1_3'UTR|NIPBL_ENST00000448238.2_Missense_Mutation_p.T648A	NM_015384.4|NM_133433.3	NP_056199.2|NP_597677.2	Q6KC79	NIPBL_HUMAN	Nipped-B homolog (Drosophila)	648				T -> I (in Ref. 2; CAD98051/CAD98052). {ECO:0000305}.	brain development (GO:0007420)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to X-ray (GO:0071481)|cognition (GO:0050890)|developmental growth (GO:0048589)|ear morphogenesis (GO:0042471)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic forelimb morphogenesis (GO:0035115)|embryonic viscerocranium morphogenesis (GO:0048703)|external genitalia morphogenesis (GO:0035261)|eye morphogenesis (GO:0048592)|face morphogenesis (GO:0060325)|fat cell differentiation (GO:0045444)|forelimb morphogenesis (GO:0035136)|gall bladder development (GO:0061010)|heart morphogenesis (GO:0003007)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|metanephros development (GO:0001656)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid cohesion (GO:0007064)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract morphogenesis (GO:0003151)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of ossification (GO:0045778)|regulation of developmental growth (GO:0048638)|regulation of embryonic development (GO:0045995)|regulation of hair cycle (GO:0042634)|sensory perception of sound (GO:0007605)|stem cell maintenance (GO:0019827)|uterus morphogenesis (GO:0061038)	extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMC loading complex (GO:0032116)	chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|histone deacetylase binding (GO:0042826)|protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)			autonomic_ganglia(1)|breast(4)|endometrium(9)|kidney(22)|large_intestine(21)|liver(1)|lung(47)|ovary(7)|pancreas(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(4)	128	all_lung(31;0.000447)|Hepatocellular(1;0.108)		Epithelial(62;0.072)|COAD - Colon adenocarcinoma(61;0.14)|all cancers(62;0.191)|Colorectal(62;0.202)			TGAGACCCAAACAGAAGAACT	0.353																																																	0													87.0	90.0	89.0					5																	36985224		2203	4300	6503	SO:0001583	missense	0			AB019494	CCDS3920.1, CCDS47198.1	5p13.2	2009-08-28			ENSG00000164190	ENSG00000164190			28862	protein-coding gene	gene with protein product	"""sister chromatid cohesion 2 homolog (yeast)"""	608667				15146186, 15146185	Standard	NM_133433		Approved	IDN3, DKFZp434L1319, FLJ11203, FLJ12597, FLJ13354, FLJ13648, Scc2	uc003jkl.4	Q6KC79	OTTHUMG00000090795	ENST00000282516.8:c.1942A>G	5.37:g.36985224A>G	ENSP00000282516:p.Thr648Ala		Q6KCD6|Q6N080|Q6ZT92|Q7Z2E6|Q8N4M5|Q9Y6Y3|Q9Y6Y4	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.T648A	ENST00000282516.8	37	c.1942	CCDS3920.1	5	.	.	.	.	.	.	.	.	.	.	A	6.733	0.504063	0.12822	.	.	ENSG00000164190	ENST00000282516;ENST00000448238	D;D	0.92647	-3.08;-3.08	5.65	5.65	0.86999	.	0.227465	0.35708	N	0.003021	D	0.89677	0.6784	N	0.08118	0	0.39643	D	0.97035	P;D	0.56035	0.956;0.974	P;D	0.67725	0.899;0.953	D	0.86675	0.1913	10	0.08599	T	0.76	.	15.877	0.79173	1.0:0.0:0.0:0.0	.	648;648	Q6KC79;Q6KC79-2	NIPBL_HUMAN;.	A	648	ENSP00000282516:T648A;ENSP00000406266:T648A	ENSP00000282516:T648A	T	+	1	0	NIPBL	37020981	0.817000	0.29147	0.972000	0.41901	0.659000	0.38960	0.148000	0.16224	2.288000	0.76882	0.528000	0.53228	ACA	NIPBL	-	NULL	ENSG00000164190		0.353	NIPBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NIPBL	HGNC	protein_coding	OTTHUMT00000207582.1		0.00	28	0	A	NM_015384		36985224	+1			no_errors	ENST00000282516	ensembl	human	known	74_37	missense	5.88	32	2	SNP	0.992	G
NPAS4	266743	genome.wustl.edu	37	11	66191636	66191636	+	Silent	SNP	T	T	G			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr11:66191636T>G	ENST00000311034.2	+	7	1451	c.1275T>G	c.(1273-1275)ccT>ccG	p.P425P		NM_178864.3	NP_849195.2	Q8IUM7	NPAS4_HUMAN	neuronal PAS domain protein 4	425					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|signal transducer activity (GO:0004871)			breast(4)|endometrium(2)|kidney(3)|large_intestine(11)|liver(2)|lung(20)|ovary(1)|prostate(3)|skin(3)	49						GCACTCCACCTTACACGCCCC	0.552																																																	0													182.0	178.0	179.0					11																	66191636		2200	4295	6495	SO:0001819	synonymous_variant	0			AB049469	CCDS8138.1	11q13.2	2013-05-21			ENSG00000174576	ENSG00000174576		"""Basic helix-loop-helix proteins"""	18983	protein-coding gene	gene with protein product		608554				14701734	Standard	NM_178864		Approved	PASD10, NXF, Le-PAS, bHLHe79	uc001ohx.1	Q8IUM7	OTTHUMG00000167045	ENST00000311034.2:c.1275T>G	11.37:g.66191636T>G			B7ZL81|Q8N8S5|Q8N9Q9	Silent	SNP	pfam_PAS_fold_3,superfamily_PAS,smart_PAS,pfscan_PAS	p.P425	ENST00000311034.2	37	c.1275	CCDS8138.1	11																																																																																			NPAS4	-	NULL	ENSG00000174576		0.552	NPAS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPAS4	HGNC	protein_coding	OTTHUMT00000392634.1		0.00	22	0	T	NM_178864		66191636	+1			no_errors	ENST00000311034	ensembl	human	known	74_37	silent	13.33	52	8	SNP	0.853	G
NPHS1	4868	genome.wustl.edu	37	19	36339237	36339237	+	Silent	SNP	G	G	A	rs374218631		TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr19:36339237G>A	ENST00000378910.5	-	10	1232	c.1233C>T	c.(1231-1233)aaC>aaT	p.N411N	NPHS1_ENST00000353632.6_Silent_p.N411N	NM_004646.3	NP_004637.1	O60500	NPHN_HUMAN	nephrosis 1, congenital, Finnish type (nephrin)	411	Ig-like C2-type 4.				cell adhesion (GO:0007155)|excretion (GO:0007588)|glomerular basement membrane development (GO:0032836)|glomerular visceral epithelial cell development (GO:0072015)|JNK cascade (GO:0007254)|myoblast fusion (GO:0007520)|positive regulation of actin filament polymerization (GO:0030838)|regulation of excretion (GO:0044062)|skeletal muscle tissue development (GO:0007519)	cell projection (GO:0042995)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|slit diaphragm (GO:0036057)	myosin binding (GO:0017022)			NS(2)|breast(1)|cervix(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(16)|liver(1)|lung(26)|ovary(5)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	74	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			GGGTCAGACCGTTGTCCTCCC	0.587													G|||	1	0.000199681	0.0008	0.0	5008	,	,		16953	0.0		0.0	False		,,,				2504	0.0																0								G		1,4405	2.1+/-5.4	0,1,2202	103.0	92.0	96.0		1233	-7.2	0.4	19		96	0,8600		0,0,4300	no	coding-synonymous	NPHS1	NM_004646.3		0,1,6502	AA,AG,GG		0.0,0.0227,0.0077		411/1242	36339237	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS32996.1	19q12-q13.1	2014-09-17				ENSG00000161270		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7908	protein-coding gene	gene with protein product		602716				9915943, 9660941	Standard	NM_004646		Approved	CNF, NPHN	uc002oby.3	O60500		ENST00000378910.5:c.1233C>T	19.37:g.36339237G>A			A6NDH2|C3RX61	Silent	SNP	pfam_CD80_C2-set,pfam_Ig_I-set,pfam_Ig_V-set,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.N411	ENST00000378910.5	37	c.1233	CCDS32996.1	19																																																																																			NPHS1	-	pfam_CD80_C2-set,smart_Ig_sub,pfscan_Ig-like_dom	ENSG00000161270		0.587	NPHS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPHS1	HGNC	protein_coding	OTTHUMT00000452553.1	-	0.00	53	0	G			36339237	-1	tier1	-	no_errors	ENST00000378910	ensembl	human	known	74_37	silent	35.14	23	13	SNP	0.677	A
NRXN1	9378	genome.wustl.edu	37	2	50147953	50147953	+	3'UTR	SNP	G	G	A			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr2:50147953G>A	ENST00000406316.2	-	0	7039				NRXN1_ENST00000404971.1_3'UTR|NRXN1_ENST00000342183.5_3'UTR|NRXN1_ENST00000401710.1_3'UTR	NM_004801.4	NP_004792.1	Q9ULB1	NRX1A_HUMAN	neurexin 1						adult behavior (GO:0030534)|axon guidance (GO:0007411)|calcium-dependent cell-cell adhesion (GO:0016339)|cerebellar granule cell differentiation (GO:0021707)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|gamma-aminobutyric acid receptor clustering (GO:0097112)|gephyrin clustering (GO:0097116)|guanylate kinase-associated protein clustering (GO:0097117)|heterophilic cell-cell adhesion (GO:0007157)|learning (GO:0007612)|N-methyl-D-aspartate receptor clustering (GO:0097114)|negative regulation of filopodium assembly (GO:0051490)|neuroligin clustering (GO:0097118)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|neuron maturation (GO:0042551)|neurotransmitter secretion (GO:0007269)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|receptor localization to synapse (GO:0097120)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic vesicle clustering (GO:0097091)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	axonal growth cone (GO:0044295)|cell junction (GO:0030054)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	acetylcholine receptor binding (GO:0033130)|calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)|receptor activity (GO:0004872)			breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(33)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	58		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			ATGTATATATGTGACTTTCTA	0.328																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AB011150	CCDS1845.1, CCDS46282.1, CCDS54360.1	2p16.3	2008-05-15			ENSG00000179915	ENSG00000179915			8008	protein-coding gene	gene with protein product		600565					Standard	NM_001135659		Approved	KIAA0578, Hs.22998	uc021vhj.1	P58400	OTTHUMG00000129263	ENST00000406316.2:c.*1129C>T	2.37:g.50147953G>A			A7KRL9|O60323|Q53TJ9|Q53TQ1|Q9C079|Q9C080|Q9C081|Q9H3M2|Q9UDM6	RNA	SNP	-	NULL	ENST00000406316.2	37	NULL	CCDS54360.1	2																																																																																			NRXN1	-	-	ENSG00000179915		0.328	NRXN1-001	KNOWN	basic|CCDS	protein_coding	NRXN1	HGNC	protein_coding	OTTHUMT00000325291.2	-	0.00	32	0	G			50147953	-1	tier1	-	no_errors	ENST00000484192	ensembl	human	known	74_37	rna	31.58	13	6	SNP	1.000	A
NUMA1	4926	genome.wustl.edu	37	11	71717113	71717113	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr11:71717113G>A	ENST00000393695.3	-	22	5991	c.5660C>T	c.(5659-5661)tCc>tTc	p.S1887F	NUMA1_ENST00000358965.6_Missense_Mutation_p.S1873F|NUMA1_ENST00000351960.6_Missense_Mutation_p.S751F	NM_006185.2	NP_006176.2			nuclear mitotic apparatus protein 1											central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(12)|lung(20)|ovary(5)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	65						CCCGGCCTGGGAACGACGAGC	0.597			T	RARA	APL																																			Dom	yes		11	11q13	4926	nuclear mitotic apparatus protein 1		L	0													63.0	74.0	71.0					11																	71717113		2200	4293	6493	SO:0001583	missense	0			Z11584	CCDS31633.1, CCDS66156.1	11q13	2008-02-05				ENSG00000137497			8059	protein-coding gene	gene with protein product		164009				8406455	Standard	NM_006185		Approved		uc001orl.1	Q14980		ENST00000393695.3:c.5660C>T	11.37:g.71717113G>A	ENSP00000377298:p.Ser1887Phe			Missense_Mutation	SNP	superfamily_Prefoldin	p.S1887F	ENST00000393695.3	37	c.5660	CCDS31633.1	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	21.2|21.2	4.119692|4.119692	0.77323|0.77323	.|.	.|.	ENSG00000137497|ENSG00000137497	ENST00000541584|ENST00000351960;ENST00000358965;ENST00000393695;ENST00000359652;ENST00000536544	.|T;T;T	.|0.21191	.|2.02;2.48;2.48	5.11|5.11	5.11|5.11	0.69529|0.69529	.|.	.|0.000000	.|0.56097	.|D	.|0.000027	T|T	0.34077|0.34077	0.0885|0.0885	N|N	0.24115|0.24115	0.695|0.695	0.46149|0.46149	D|D	0.998897|0.998897	.|D;D;D;D	.|0.71674	.|0.998;0.998;0.998;0.998	.|D;D;D;D	.|0.80764	.|0.994;0.971;0.994;0.967	T|T	0.14062|0.14062	-1.0486|-1.0486	5|10	.|0.72032	.|D	.|0.01	.|.	17.4732|17.4732	0.87652|0.87652	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|1893;1873;1887;751	.|Q4LE64;Q14980-2;Q14980;Q9BTE9	.|.;.;NUMA1_HUMAN;.	S|F	736|751;1873;1887;1436;860	.|ENSP00000260051:S751F;ENSP00000351851:S1873F;ENSP00000377298:S1887F	.|ENSP00000260051:S751F	P|S	-|-	1|2	0|0	NUMA1|NUMA1	71394761|71394761	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.675000|0.675000	0.39556|0.39556	5.748000|5.748000	0.68697|0.68697	2.652000|2.652000	0.90054|0.90054	0.655000|0.655000	0.94253|0.94253	CCC|TCC	NUMA1	-	NULL	ENSG00000137497		0.597	NUMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUMA1	HGNC	protein_coding	OTTHUMT00000395769.1	-	0.00	27	0	G			71717113	-1	tier1	-	no_errors	ENST00000393695	ensembl	human	known	74_37	missense	8.24	78	7	SNP	1.000	A
NUP210L	91181	genome.wustl.edu	37	1	154042813	154042813	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr1:154042813G>T	ENST00000368559.3	-	17	2561	c.2490C>A	c.(2488-2490)ttC>ttA	p.F830L	NUP210L_ENST00000271854.3_Missense_Mutation_p.F830L	NM_207308.2	NP_997191.2	Q5VU65	P210L_HUMAN	nucleoporin 210kDa-like	830					Sertoli cell development (GO:0060009)|spermatid development (GO:0007286)	integral component of membrane (GO:0016021)		p.F830F(1)		NS(1)|breast(6)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(12)|lung(34)|ovary(4)|pancreas(1)|prostate(2)|skin(6)|urinary_tract(2)	80	all_lung(78;9.35e-31)|Lung NSC(65;1.33e-28)|Hepatocellular(266;0.0877)|Melanoma(130;0.128)		LUSC - Lung squamous cell carcinoma(543;0.151)|Colorectal(543;0.198)			TATAATCTTCGAAATGGGCTA	0.378																																																	1	Substitution - coding silent(1)	lung(1)											150.0	137.0	141.0					1																	154042813		1903	4107	6010	SO:0001583	missense	0			AK125924	CCDS41399.1, CCDS53370.1	1q21.3	2008-02-05			ENSG00000143552	ENSG00000143552			29915	protein-coding gene	gene with protein product							Standard	NM_207308		Approved		uc001fdw.3	Q5VU65	OTTHUMG00000035852	ENST00000368559.3:c.2490C>A	1.37:g.154042813G>T	ENSP00000357547:p.Phe830Leu		E7EP56|Q5T4L7|Q6ZRN1|Q6ZRT4|Q6ZU81|Q8NDI6|Q9UF31	Missense_Mutation	SNP	pfam_Big_2,superfamily_Invasin/intimin_cell_adhesion,smart_Big_2	p.F830L	ENST00000368559.3	37	c.2490	CCDS41399.1	1	.	.	.	.	.	.	.	.	.	.	G	9.720	1.159319	0.21454	.	.	ENSG00000143552	ENST00000368559;ENST00000271854	T;T	0.40225	1.04;1.04	5.12	-2.93	0.05598	.	0.109297	0.40818	N	0.001017	T	0.12987	0.0315	L	0.53249	1.67	0.18873	N	0.999981	B;B	0.18863	0.031;0.031	B;B	0.17433	0.018;0.01	T	0.34428	-0.9829	10	0.26408	T	0.33	-25.5913	7.55	0.27790	0.3208:0.1574:0.5219:0.0	.	830;830	E7EP56;Q5VU65	.;P210L_HUMAN	L	830	ENSP00000357547:F830L;ENSP00000271854:F830L	ENSP00000271854:F830L	F	-	3	2	NUP210L	152309437	0.015000	0.18098	0.617000	0.29091	0.959000	0.62525	-0.833000	0.04396	-0.551000	0.06175	-0.451000	0.05528	TTC	NUP210L	-	NULL	ENSG00000143552		0.378	NUP210L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUP210L	HGNC	protein_coding	OTTHUMT00000087270.3	-	0.00	48	0	G	NM_207308		154042813	-1	tier1	-	no_errors	ENST00000368559	ensembl	human	known	74_37	missense	34.78	45	24	SNP	0.210	T
NUPL1	9818	genome.wustl.edu	37	13	25911128	25911128	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr13:25911128G>A	ENST00000381736.3	+	14	1740	c.1490G>A	c.(1489-1491)gGc>gAc	p.G497D	NUPL1_ENST00000466694.1_3'UTR|NUPL1_ENST00000381718.3_Missense_Mutation_p.G485D	NM_001008564.1|NM_014089.3	NP_001008564.1|NP_054808.1	Q9BVL2	NUPL1_HUMAN	nucleoporin like 1	497	14 X 2 AA repeats of F-G.				carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)	nucleocytoplasmic transporter activity (GO:0005487)			breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(7)|stomach(1)|urinary_tract(1)	16		Lung SC(185;0.0225)|Breast(139;0.0351)		all cancers(112;0.0092)|Epithelial(112;0.0477)|OV - Ovarian serous cystadenocarcinoma(117;0.165)|GBM - Glioblastoma multiforme(144;0.244)		TCAGGTATTGGCACTGGCTTG	0.363																																					Pancreas(166;1040 2004 4560 4728 37041)|GBM(109;1045 1520 7614 9308 19618)												0													77.0	75.0	76.0					13																	25911128		2203	4300	6503	SO:0001583	missense	0			AB007870	CCDS9314.1, CCDS31949.1	13q12.12	2011-04-12			ENSG00000139496	ENSG00000139496			20261	protein-coding gene	gene with protein product		607615				9455477	Standard	NM_014089		Approved	KIAA0410	uc001uqi.3	Q9BVL2	OTTHUMG00000016608	ENST00000381736.3:c.1490G>A	13.37:g.25911128G>A	ENSP00000371155:p.Gly497Asp		A6NI12|B4DZJ1|O43160|Q5JRG2|Q5JRG5	Missense_Mutation	SNP	NULL	p.G497D	ENST00000381736.3	37	c.1490	CCDS9314.1	13	.	.	.	.	.	.	.	.	.	.	G	21.4	4.140320	0.77775	.	.	ENSG00000139496	ENST00000381736;ENST00000313619;ENST00000381718	T;T	0.36520	1.26;1.25	5.54	5.54	0.83059	.	0.000000	0.85682	D	0.000000	T	0.49626	0.1568	L	0.60455	1.87	0.80722	D	1	D;D	0.58620	0.983;0.983	P;P	0.56865	0.808;0.808	T	0.48375	-0.9041	10	0.59425	D	0.04	-7.3109	12.7788	0.57464	0.0747:0.0:0.9253:0.0	.	485;497	A6NI12;Q9BVL2	.;NUPL1_HUMAN	D	497;474;485	ENSP00000371155:G497D;ENSP00000371137:G485D	ENSP00000318459:G474D	G	+	2	0	NUPL1	24809128	1.000000	0.71417	1.000000	0.80357	0.871000	0.50021	7.130000	0.77235	2.617000	0.88574	0.585000	0.79938	GGC	NUPL1	-	NULL	ENSG00000139496		0.363	NUPL1-001	KNOWN	basic|CCDS	protein_coding	NUPL1	HGNC	protein_coding	OTTHUMT00000044228.2		0.00	44	0	G			25911128	+1			no_errors	ENST00000381736	ensembl	human	known	74_37	missense	6.45	58	4	SNP	1.000	A
NXF2B	728343	genome.wustl.edu	37	X	101623934	101623934	+	Silent	SNP	A	A	G			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chrX:101623934A>G	ENST00000372750.1	-	11	1342	c.543T>C	c.(541-543)agT>agC	p.S181S	NXF2B_ENST00000412230.2_Silent_p.S181S|NXF2B_ENST00000457521.2_Silent_p.S181S|NXF2B_ENST00000372749.1_Silent_p.S181S|NXF2B_ENST00000372752.1_Silent_p.S93S			Q9GZY0	NXF2_HUMAN	nuclear RNA export factor 2B	181	RRM.				mRNA export from nucleus (GO:0006406)|multicellular organismal development (GO:0007275)|RNA transport (GO:0050658)	cytoplasm (GO:0005737)|nuclear RNA export factor complex (GO:0042272)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			breast(1)|kidney(1)|lung(4)|ovary(1)	7						AAATCTTATAACTGACATCCT	0.532																																																	0													6.0	5.0	5.0					X																	101623934		1864	3734	5598	SO:0001819	synonymous_variant	0				CCDS43979.1	Xq22.1	2013-05-14			ENSG00000185945	ENSG00000269437			23984	protein-coding gene	gene with protein product						16382448	Standard	NM_001099686		Approved	bA353J17.1		Q9GZY0	OTTHUMG00000154920	ENST00000372750.1:c.543T>C	X.37:g.101623934A>G			Q9BXU4|Q9NSS1|Q9NX66	Silent	SNP	pfam_Tap_RNA-bd,pfam_TAP_C_dom,pfam_NTF2,superfamily_UBA-like,smart_TAP_C_dom,pfscan_Nuclear_transport_factor_2_euk	p.S181	ENST00000372750.1	37	c.543	CCDS43979.1	X																																																																																			NXF2B	-	pfam_Tap_RNA-bd	ENSG00000185945		0.532	NXF2B-007	KNOWN	basic|appris_principal|CCDS	protein_coding	NXF2B	HGNC	protein_coding	OTTHUMT00000058979.1	-	0.00	12	0	A			101623934	-1	tier1	-	no_errors	ENST00000372749	ensembl	human	known	74_37	silent	37.50	5	3	SNP	0.000	G
OR4A5	81318	genome.wustl.edu	37	11	51411684	51411684	+	Missense_Mutation	SNP	T	T	A			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr11:51411684T>A	ENST00000319760.6	-	1	764	c.712A>T	c.(712-714)Agc>Tgc	p.S238C		NM_001005272.3	NP_001005272.3	Q8NH83	OR4A5_HUMAN	olfactory receptor, family 4, subfamily A, member 5	238						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(8)|lung(28)|ovary(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	49		all_lung(304;0.236)				CTGCCGGAGCTGCAGGTAGAC	0.403																																																	0													63.0	63.0	63.0					11																	51411684		2201	4295	6496	SO:0001583	missense	0			AB065506	CCDS73289.1	11p11.12	2012-08-09			ENSG00000221840	ENSG00000221840		"""GPCR / Class A : Olfactory receptors"""	15162	protein-coding gene	gene with protein product							Standard	NM_001005272		Approved		uc001nhi.2	Q8NH83	OTTHUMG00000166764	ENST00000319760.6:c.712A>T	11.37:g.51411684T>A	ENSP00000367664:p.Ser238Cys		Q6IF84	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.S238C	ENST00000319760.6	37	c.712	CCDS31497.1	11	.	.	.	.	.	.	.	.	.	.	.	8.368	0.834614	0.16820	.	.	ENSG00000221840	ENST00000319760	T	0.38722	1.12	1.93	0.762	0.18454	GPCR, rhodopsin-like superfamily (1);	0.790281	0.10892	N	0.622623	T	0.61286	0.2335	M	0.86268	2.805	0.26196	N	0.979513	D	0.67145	0.996	D	0.70016	0.967	T	0.47341	-0.9125	10	0.52906	T	0.07	.	5.1685	0.15098	0.0:0.172:0.0:0.828	.	238	Q8NH83	OR4A5_HUMAN	C	238	ENSP00000367664:S238C	ENSP00000367664:S238C	S	-	1	0	OR4A5	51268260	0.000000	0.05858	0.311000	0.25182	0.042000	0.13812	-1.940000	0.01543	0.207000	0.20607	0.136000	0.15936	AGC	OR4A5	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt	ENSG00000221840		0.403	OR4A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4A5	HGNC	protein_coding	OTTHUMT00000391399.1		0.00	51	0	T	NM_001005272		51411684	-1			no_errors	ENST00000319760	ensembl	human	known	74_37	missense	7.69	24	2	SNP	0.992	A
LOC101927079	101927079	genome.wustl.edu	37	15	22345668	22345668	+	RNA	SNP	A	A	T	rs76270326		TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr15:22345668A>T	ENST00000558896.1	+	0	583				OR4H6P_ENST00000603819.1_RNA																							TTAAAAAAACAGTTCCTAAAA	0.323																																																	0																																												0																															15.37:g.22345668A>T				RNA	SNP	-	NULL	ENST00000558896.1	37	NULL		15																																																																																			OR4H6P	-	-	ENSG00000261277		0.323	RP11-69H14.6-001	KNOWN	basic	sense_overlapping	OR4H6P	HGNC	sense_overlapping	OTTHUMT00000417625.1	-	0.00	11	0	A			22345668	+1	tier1	rs76270326	no_errors	ENST00000603819	ensembl	human	known	74_37	rna	71.43	2	5	SNP	0.000	T
OR5B3	441608	genome.wustl.edu	37	11	58170641	58170641	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr11:58170641G>T	ENST00000309403.2	-	1	241	c.242C>A	c.(241-243)gCt>gAt	p.A81D		NM_001005469.1	NP_001005469.1	Q8NH48	OR5B3_HUMAN	olfactory receptor, family 5, subfamily B, member 3	81						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(17)|ovary(1)|prostate(1)|skin(2)|stomach(6)|upper_aerodigestive_tract(1)	34	Esophageal squamous(5;0.0027)	Breast(21;0.0778)				AAGGAATCCAGCCATGACGAT	0.428																																																	0													104.0	99.0	101.0					11																	58170641		2201	4295	6496	SO:0001583	missense	0			AB065545	CCDS31549.1	11q12.1	2012-08-09			ENSG00000172769	ENSG00000172769		"""GPCR / Class A : Olfactory receptors"""	8324	protein-coding gene	gene with protein product				OR5B13			Standard	NM_001005469		Approved	OST129	uc010rkf.2	Q8NH48	OTTHUMG00000167516	ENST00000309403.2:c.242C>A	11.37:g.58170641G>T	ENSP00000308270:p.Ala81Asp		Q6IEV6	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.A81D	ENST00000309403.2	37	c.242	CCDS31549.1	11	.	.	.	.	.	.	.	.	.	.	g	2.501	-0.315201	0.05422	.	.	ENSG00000172769	ENST00000309403	T	0.00382	7.61	4.19	1.01	0.19927	GPCR, rhodopsin-like superfamily (1);	0.612481	0.14602	N	0.309594	T	0.00300	0.0009	L	0.55017	1.72	0.09310	N	1	B	0.18013	0.025	B	0.20767	0.031	T	0.38286	-0.9668	10	0.59425	D	0.04	-11.6554	7.7616	0.28955	0.0:0.2943:0.4038:0.3019	.	81	Q8NH48	OR5B3_HUMAN	D	81	ENSP00000308270:A81D	ENSP00000308270:A81D	A	-	2	0	OR5B3	57927217	0.000000	0.05858	0.001000	0.08648	0.049000	0.14656	-0.537000	0.06128	0.112000	0.17975	-0.291000	0.09656	GCT	OR5B3	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM	ENSG00000172769		0.428	OR5B3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5B3	HGNC	protein_coding	OTTHUMT00000394886.1		0.00	63	0	G	NM_001005469		58170641	-1			no_errors	ENST00000309403	ensembl	human	known	74_37	missense	5.41	35	2	SNP	0.000	T
OR8B2	26595	genome.wustl.edu	37	11	124252550	124252550	+	Silent	SNP	G	G	T			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr11:124252550G>T	ENST00000375013.2	-	1	708	c.690C>A	c.(688-690)tcC>tcA	p.S230S		NM_001005468.1	NP_001005468.1	Q96RD0	OR8B2_HUMAN	olfactory receptor, family 8, subfamily B, member 2	230						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(13)|ovary(1)	23		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0277)		TTCCTTGAGTGGATTTGATAT	0.378																																																	0													73.0	80.0	78.0					11																	124252550		2201	4296	6497	SO:0001819	synonymous_variant	0			AB065826	CCDS31708.1	11q24.1	2012-08-09			ENSG00000204293	ENSG00000204293		"""GPCR / Class A : Olfactory receptors"""	8471	protein-coding gene	gene with protein product							Standard	XM_005271500		Approved		uc010sai.2	Q96RD0	OTTHUMG00000165982	ENST00000375013.2:c.690C>A	11.37:g.124252550G>T			Q8NGH2	Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.S230	ENST00000375013.2	37	c.690	CCDS31708.1	11																																																																																			OR8B2	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000204293		0.378	OR8B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR8B2	HGNC	protein_coding	OTTHUMT00000387290.1	-	0.00	31	0	G	NM_001005468		124252550	-1	tier1	-	no_errors	ENST00000375013	ensembl	human	known	74_37	silent	17.86	23	5	SNP	0.000	T
PADI1	29943	genome.wustl.edu	37	1	17556668	17556668	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr1:17556668C>G	ENST00000375471.4	+	9	1110	c.1018C>G	c.(1018-1020)Cct>Gct	p.P340A		NM_013358.2	NP_037490.2	Q9ULC6	PADI1_HUMAN	peptidyl arginine deiminase, type I	340					protein citrullination (GO:0018101)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|protein-arginine deiminase activity (GO:0004668)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(14)|ovary(1)|prostate(4)|skin(1)|stomach(1)|urinary_tract(1)	28		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.00054)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00522)|BRCA - Breast invasive adenocarcinoma(304;1.3e-05)|COAD - Colon adenocarcinoma(227;1.31e-05)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(196;0.0069)|READ - Rectum adenocarcinoma(331;0.0681)|Lung(427;0.197)	L-Citrulline(DB00155)	GACCATCTGCCCTCAAGTTGA	0.532																																					Esophageal Squamous(80;414 1257 4580 27746 50832)												0													89.0	87.0	88.0					1																	17556668		2203	4300	6503	SO:0001583	missense	0			AB033768	CCDS178.1	1p36.13	2008-07-18			ENSG00000142623	ENSG00000142623	3.5.3.15	"""Peptidyl arginine deiminases"""	18367	protein-coding gene	gene with protein product	"""peptidylarginine deiminase type I"", ""protein-arginine deiminase type-1"", ""hPAD-colony 10"""	607934				12416996	Standard	NM_013358		Approved	HPAD10, PDI1, PDI, PAD1	uc001bah.1	Q9ULC6	OTTHUMG00000002294	ENST00000375471.4:c.1018C>G	1.37:g.17556668C>G	ENSP00000364620:p.Pro340Ala		A1L4K6|Q70SX6	Missense_Mutation	SNP	pfam_PAD_C,pfam_Prot_Arg_deaminase_cen_dom,pfam_PAD_N,superfamily_Prot_Arg_deaminase_cen_dom,superfamily_Cupredoxin,pirsf_Protein-arginine_deiminase_sub	p.P340A	ENST00000375471.4	37	c.1018	CCDS178.1	1	.	.	.	.	.	.	.	.	.	.	C	6.551	0.469848	0.12461	.	.	ENSG00000142623	ENST00000375471	T	0.25085	1.82	4.99	4.99	0.66335	Protein-arginine deiminase, C-terminal (1);	0.379952	0.27134	N	0.020762	T	0.33789	0.0875	L	0.58101	1.795	0.80722	D	1	P	0.49358	0.923	P	0.54544	0.755	T	0.04427	-1.0952	10	0.17369	T	0.5	-11.3955	8.1127	0.30924	0.0:0.8266:0.0:0.1734	.	340	Q9ULC6	PADI1_HUMAN	A	340	ENSP00000364620:P340A	ENSP00000364620:P340A	P	+	1	0	PADI1	17429255	0.005000	0.15991	0.992000	0.48379	0.223000	0.24884	0.084000	0.14891	2.483000	0.83821	0.467000	0.42956	CCT	PADI1	-	pfam_PAD_C,pirsf_Protein-arginine_deiminase_sub	ENSG00000142623		0.532	PADI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PADI1	HGNC	protein_coding	OTTHUMT00000006621.1	-	0.00	44	0	C	NM_013358		17556668	+1	tier1	-	no_errors	ENST00000375471	ensembl	human	known	74_37	missense	21.31	48	13	SNP	0.893	G
PADI6	353238	genome.wustl.edu	37	1	17720864	17720864	+	RNA	SNP	G	G	T			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr1:17720864G>T	ENST00000434762.2	+	0	1302							Q6TGC4	PADI6_HUMAN	peptidyl arginine deiminase, type VI						cytoplasm organization (GO:0007028)|cytoskeleton organization (GO:0007010)|protein citrullination (GO:0018101)|regulation of translation by machinery localization (GO:0043143)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|protein-arginine deiminase activity (GO:0004668)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(9)|lung(9)|ovary(2)	29		Colorectal(325;3.46e-05)|Breast(348;0.000162)|all_lung(284;0.000337)|Lung NSC(340;0.000419)|Renal(390;0.000518)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00488)|BRCA - Breast invasive adenocarcinoma(304;7.59e-06)|COAD - Colon adenocarcinoma(227;1.18e-05)|Kidney(64;0.000186)|KIRC - Kidney renal clear cell carcinoma(64;0.00272)|STAD - Stomach adenocarcinoma(196;0.0134)|READ - Rectum adenocarcinoma(331;0.0655)|Lung(427;0.189)	L-Citrulline(DB00155)	ATTCCATTGGGAACCTGATGG	0.572																																																	0													41.0	42.0	42.0					1																	17720864		1915	4134	6049			0			AY422079	CCDS72715.1	1p36.13	2014-07-10			ENSG00000256049	ENSG00000276747	3.5.3.15	"""Peptidyl arginine deiminases"""	20449	protein-coding gene	gene with protein product		610363				15087120	Standard	NM_207421		Approved		uc001bak.1	Q6TGC4	OTTHUMG00000002372		1.37:g.17720864G>T			Q330K5|Q70SX3	RNA	SNP	-	NULL	ENST00000434762.2	37	NULL		1																																																																																			PADI6	-	-	ENSG00000256049		0.572	PADI6-001	KNOWN	basic	processed_transcript	PADI6	HGNC	processed_transcript	OTTHUMT00000006804.4	-	0.00	48	0	G	NM_207421		17720864	+1	tier1	-	no_errors	ENST00000358481	ensembl	human	known	74_37	rna	8.51	43	4	SNP	0.999	T
PAPD7	11044	genome.wustl.edu	37	5	6746462	6746462	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr5:6746462G>T	ENST00000230859.6	+	7	760	c.631G>T	c.(631-633)Gcc>Tcc	p.A211S		NM_001171805.1|NM_001171806.1|NM_006999.4	NP_001165276.1|NP_001165277.1|NP_008930.1	Q5XG87	PAPD7_HUMAN	PAP associated domain containing 7	441					double-strand break repair (GO:0006302)|mitotic chromosome condensation (GO:0007076)|response to drug (GO:0042493)|sister chromatid cohesion (GO:0007062)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|polynucleotide adenylyltransferase activity (GO:0004652)|SMC family protein binding (GO:0043221)			cervix(1)|endometrium(2)|large_intestine(8)|lung(10)|ovary(2)|pancreas(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	27						TGCCTATATCGCCAAAGAGGA	0.463																																					NSCLC(7;212 333 5667 23379 46547)												0													100.0	106.0	104.0					5																	6746462		2203	4300	6503	SO:0001583	missense	0			AF089896	CCDS3871.1	5p15	2010-11-18	2010-01-19	2010-01-19	ENSG00000112941	ENSG00000112941			16705	protein-coding gene	gene with protein product	"""topoisomerase-related function protein 4-1"", ""polymerase (DNA-directed) sigma"", ""DNA polymerase kappa"", ""TUTase5"""	605198	"""polymerase (DNA directed) sigma"""	POLS		10066793, 10926539	Standard	NM_006999		Approved	POLK, TRF4, LAK-1, TRF4-1	uc003jdx.1	Q5XG87	OTTHUMG00000090457	ENST00000230859.6:c.631G>T	5.37:g.6746462G>T	ENSP00000230859:p.Ala211Ser		A8K1E2|M1JCE6|O43289|Q17RZ1|Q9Y6C1	Missense_Mutation	SNP	pfam_PAP_assoc,pfam_Nucleotidyltransferase	p.A211S	ENST00000230859.6	37	c.631	CCDS3871.1	5	.	.	.	.	.	.	.	.	.	.	G	13.59	2.283397	0.40394	.	.	ENSG00000112941	ENST00000230859	T	0.73681	-0.77	5.47	3.66	0.41972	PAP/25A-associated (1);	0.216136	0.48286	N	0.000194	T	0.40015	0.1100	N	0.01009	-1.055	0.53005	D	0.999961	B;B	0.29671	0.254;0.102	B;B	0.28011	0.085;0.085	T	0.40590	-0.9555	10	0.06891	T	0.86	-4.4728	10.6579	0.45686	0.0687:0.0:0.7986:0.1328	.	211;211	B7ZLL4;Q5XG87	.;PAPD7_HUMAN	S	211	ENSP00000230859:A211S	ENSP00000230859:A211S	A	+	1	0	PAPD7	6799462	1.000000	0.71417	0.997000	0.53966	0.975000	0.68041	4.028000	0.57246	0.766000	0.33244	0.561000	0.74099	GCC	PAPD7	-	pfam_PAP_assoc	ENSG00000112941		0.463	PAPD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAPD7	HGNC	protein_coding	OTTHUMT00000206904.1		0.00	56	0	G	NM_006999		6746462	+1			no_errors	ENST00000230859	ensembl	human	known	74_37	missense	6.78	55	4	SNP	1.000	T
PARP1	142	genome.wustl.edu	37	1	226549886	226549886	+	Intron	DEL	T	T	-	rs368063214		TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr1:226549886delT	ENST00000366794.5	-	22	2992				PARP1_ENST00000490921.1_Intron	NM_001618.3	NP_001609.2	P09874	PARP1_HUMAN	poly (ADP-ribose) polymerase 1						base-excision repair (GO:0006284)|cellular response to insulin stimulus (GO:0032869)|DNA damage response, detection of DNA damage (GO:0042769)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|gene expression (GO:0010467)|macrophage differentiation (GO:0030225)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription regulatory region DNA binding (GO:2000679)|protein ADP-ribosylation (GO:0006471)|protein autoprocessing (GO:0016540)|protein poly-ADP-ribosylation (GO:0070212)|regulation of growth rate (GO:0040009)|signal transduction involved in regulation of gene expression (GO:0023019)|telomere maintenance (GO:0000723)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|NAD binding (GO:0051287)|NAD+ ADP-ribosyltransferase activity (GO:0003950)|poly(A) RNA binding (GO:0044822)|protein N-terminus binding (GO:0047485)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			breast(2)|endometrium(4)|kidney(4)|large_intestine(8)|lung(15)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)	44	Breast(184;0.133)			GBM - Glioblastoma multiforme(131;0.0531)		GTGGTCtttcttttttttttt	0.468								Poly(ADP-ribose) polymerase (PARP) enzymes that bind to DNA																																									0																																										SO:0001627	intron_variant	0			BC037545	CCDS1554.1	1q41-q42	2010-02-16	2008-07-28	2004-08-26	ENSG00000143799	ENSG00000143799	2.4.2.30	"""Poly (ADP-ribose) polymerases"""	270	protein-coding gene	gene with protein product		173870	"""ADP-ribosyltransferase (NAD+; poly (ADP-ribose) polymerase)"", ""poly (ADP-ribose) polymerase family, member 1"""	PPOL, ADPRT		10964595	Standard	NM_001618		Approved	PARP	uc001hqd.4	P09874	OTTHUMG00000037556	ENST00000366794.5:c.2849-102A>-	1.37:g.226549886delT			B1ANJ4|Q8IUZ9	RNA	DEL	-	NULL	ENST00000366794.5	37	NULL	CCDS1554.1	1																																																																																			PARP1	-	-	ENSG00000143799		0.468	PARP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PARP1	HGNC	protein_coding	OTTHUMT00000091519.1		0.00	28	0	T	NM_001618		226549886	-1	tier1		no_errors	ENST00000491816	ensembl	human	known	74_37	rna	11.11	24	3	DEL	0.004	-
PCDHGB6	56100	genome.wustl.edu	37	5	140788747	140788747	+	Silent	SNP	T	T	A			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr5:140788747T>A	ENST00000520790.1	+	1	978	c.978T>A	c.(976-978)ggT>ggA	p.G326G	PCDHGA1_ENST00000517417.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA5_ENST00000518069.1_Intron	NM_018926.2|NM_032100.1	NP_061749.1|NP_115271.1	Q9Y5F9	PCDGI_HUMAN	protocadherin gamma subfamily B, 6	326	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(2)|endometrium(9)|kidney(1)|large_intestine(10)|lung(16)|ovary(1)|prostate(3)|stomach(2)|upper_aerodigestive_tract(2)	48			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ACGGAGGTGGTCTCTCTACCC	0.388																																																	0													102.0	105.0	104.0					5																	140788747		1913	4119	6032	SO:0001819	synonymous_variant	0			AF152522	CCDS54929.1, CCDS75342.1	5q31	2010-01-26				ENSG00000253305		"""Cadherins / Protocadherins : Clustered"""	8713	other	protocadherin		606303				10380929	Standard	NM_018926		Approved	PCDH-GAMMA-B6		Q9Y5F9		ENST00000520790.1:c.978T>A	5.37:g.140788747T>A			Q9Y5C5	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.G326	ENST00000520790.1	37	c.978	CCDS54929.1	5																																																																																			PCDHGB6	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	ENSG00000253305		0.388	PCDHGB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGB6	HGNC	protein_coding	OTTHUMT00000374746.1	-	0.00	35	0	T	NM_018926		140788747	+1	tier1	-	no_errors	ENST00000520790	ensembl	human	known	74_37	silent	30.77	36	16	SNP	0.000	A
PCNT	5116	genome.wustl.edu	37	21	47819581	47819581	+	Silent	SNP	T	T	C			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr21:47819581T>C	ENST00000359568.5	+	25	4769	c.4662T>C	c.(4660-4662)gaT>gaC	p.D1554D	PCNT_ENST00000480896.1_3'UTR	NM_006031.5	NP_006022.3	O95613	PCNT_HUMAN	pericentrin	1554					brain morphogenesis (GO:0048854)|cerebellar cortex morphogenesis (GO:0021696)|cilium assembly (GO:0042384)|G2/M transition of mitotic cell cycle (GO:0000086)|in utero embryonic development (GO:0001701)|limb morphogenesis (GO:0035108)|microtubule cytoskeleton organization (GO:0000226)|mitotic cell cycle (GO:0000278)|multicellular organism growth (GO:0035264)|negative regulation of apoptotic process (GO:0043066)|neural precursor cell proliferation (GO:0061351)|neuron migration (GO:0001764)|olfactory bulb development (GO:0021772)|positive regulation of intracellular protein transport (GO:0090316)|spindle organization (GO:0007051)	centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intercellular bridge (GO:0045171)|membrane (GO:0016020)|microtubule (GO:0005874)|motile cilium (GO:0031514)|pericentriolar material (GO:0000242)				NS(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(15)|liver(2)|lung(41)|ovary(5)|pancreas(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	104	Breast(49;0.112)					AGTCGGCAGATAGACAAGTGT	0.373																																																	0													102.0	108.0	106.0					21																	47819581		2203	4300	6503	SO:0001819	synonymous_variant	0			AB007862	CCDS33592.1	21q22.3	2014-02-20	2008-01-30	2005-11-03	ENSG00000160299	ENSG00000160299			16068	protein-coding gene	gene with protein product	"""kendrin"", ""Seckel syndrome 4"""	605925	"""pericentrin 2 (kendrin)"""	PCNT2		8812505, 9455477	Standard	NM_006031		Approved	KEN, KIAA0402, PCN, PCNTB, SCKL4	uc002zji.4	O95613	OTTHUMG00000090665	ENST00000359568.5:c.4662T>C	21.37:g.47819581T>C			O43152|Q7Z7C9	Silent	SNP	pfam_PACT_domain	p.D1554	ENST00000359568.5	37	c.4662	CCDS33592.1	21																																																																																			PCNT	-	NULL	ENSG00000160299		0.373	PCNT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCNT	HGNC	protein_coding	OTTHUMT00000207336.1	-	0.00	51	0	T	NM_006031		47819581	+1	tier1	-	no_errors	ENST00000359568	ensembl	human	known	74_37	silent	87.10	4	27	SNP	0.682	C
PDE10A	10846	genome.wustl.edu	37	6	165801869	165801869	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr6:165801869T>G	ENST00000366882.1	-	18	1854	c.1700A>C	c.(1699-1701)aAg>aCg	p.K567T	PDE10A_ENST00000539869.2_Missense_Mutation_p.K577T|PDE10A_ENST00000354448.4_Missense_Mutation_p.K567T			Q9Y233	PDE10_HUMAN	phosphodiesterase 10A	567					blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cGMP catabolic process (GO:0046069)|regulation of cAMP-mediated signaling (GO:0043949)|regulation of protein kinase A signaling (GO:0010738)|signal transduction (GO:0007165)	cytosol (GO:0005829)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|cGMP-stimulated cyclic-nucleotide phosphodiesterase activity (GO:0004118)|metal ion binding (GO:0046872)			breast(4)|endometrium(5)|kidney(1)|large_intestine(13)|liver(1)|lung(39)|ovary(3)|skin(4)|upper_aerodigestive_tract(1)	71		Breast(66;0.000425)|Prostate(117;0.104)|Ovarian(120;0.221)		OV - Ovarian serous cystadenocarcinoma(33;1.5e-17)|BRCA - Breast invasive adenocarcinoma(81;1.8e-06)|GBM - Glioblastoma multiforme(31;1.92e-05)	Caffeine(DB00201)|Dipyridamole(DB00975)|Papaverine(DB01113)|Tofisopam(DB08811)|Triflusal(DB08814)	GTGGTCGAACTTCTGCAGGTA	0.532																																					Esophageal Squamous(22;308 615 5753 12038 40624)												0													142.0	118.0	126.0					6																	165801869		2203	4300	6503	SO:0001583	missense	0			AB020593	CCDS47513.1	6q26	2008-03-18			ENSG00000112541	ENSG00000112541	3.1.4.17	"""Phosphodiesterases"""	8772	protein-coding gene	gene with protein product		610652				10373451	Standard	NM_001130690		Approved		uc003quo.3	Q9Y233	OTTHUMG00000015986	ENST00000366882.1:c.1700A>C	6.37:g.165801869T>G	ENSP00000355847:p.Lys567Thr		Q6FHX1|Q9HCP9|Q9NTV4|Q9ULW9|Q9Y5T1	Missense_Mutation	SNP	pfam_PDEase_catalytic_dom,pfam_GAF,smart_GAF,smart_HD/PDEase_dom,prints_PDEase	p.K577T	ENST00000366882.1	37	c.1730		6	.	.	.	.	.	.	.	.	.	.	T	16.96	3.266769	0.59540	.	.	ENSG00000112541	ENST00000366882;ENST00000539869;ENST00000343842;ENST00000354448;ENST00000392126	T;T	0.79033	-1.23;-1.23	5.89	5.89	0.94794	Metal-dependent phosphohydrolase, HD domain (1);5&apos (2);-cyclic nucleotide phosphodiesterase, catalytic domain (2);3&apos (2);	0.000000	0.85682	D	0.000000	D	0.84370	0.5457	M	0.65975	2.015	0.80722	D	1	D;P	0.71674	0.998;0.535	D;B	0.79784	0.993;0.414	D	0.85820	0.1385	10	0.59425	D	0.04	.	16.3109	0.82869	0.0:0.0:0.0:1.0	.	577;567	Q9ULW9;Q9Y233	.;PDE10_HUMAN	T	567;595;577;567;566	ENSP00000355847:K567T;ENSP00000346435:K567T	ENSP00000341187:K577T	K	-	2	0	PDE10A	165721859	1.000000	0.71417	1.000000	0.80357	0.817000	0.46193	7.409000	0.80053	2.257000	0.74773	0.460000	0.39030	AAG	PDE10A	-	pfam_PDEase_catalytic_dom,smart_HD/PDEase_dom,prints_PDEase	ENSG00000112541		0.532	PDE10A-001	PUTATIVE	basic	protein_coding	PDE10A	HGNC	protein_coding	OTTHUMT00000043031.1	-	0.00	47	0	T			165801869	-1	tier1	-	no_errors	ENST00000539869	ensembl	human	known	74_37	missense	48.28	15	14	SNP	1.000	G
PDE6A	5145	genome.wustl.edu	37	5	149323979	149323979	+	Silent	SNP	G	G	A			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr5:149323979G>A	ENST00000255266.5	-	1	377	c.258C>T	c.(256-258)tgC>tgT	p.C86C		NM_000440.2	NP_000431.2	P16499	PDE6A_HUMAN	phosphodiesterase 6A, cGMP-specific, rod, alpha	86	GAF 1.				cytosolic calcium ion homeostasis (GO:0051480)|GMP metabolic process (GO:0046037)|phototransduction, visible light (GO:0007603)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|retina development in camera-type eye (GO:0060041)|rhodopsin mediated signaling pathway (GO:0016056)|visual perception (GO:0007601)	photoreceptor disc membrane (GO:0097381)|plasma membrane (GO:0005886)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|metal ion binding (GO:0046872)			breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(13)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|stomach(3)|upper_aerodigestive_tract(2)	44			KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)		Caffeine(DB00201)	GCAGGAGGAAGCACAGCTTCT	0.517																																																	0													79.0	79.0	79.0					5																	149323979		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS4299.1	5q31.2-q34	2013-02-14			ENSG00000132915	ENSG00000132915	3.1.4.17	"""Phosphodiesterases"""	8785	protein-coding gene	gene with protein product		180071		PDEA		2155175	Standard	NM_000440		Approved	RP43	uc003lrg.4	P16499	OTTHUMG00000130047	ENST00000255266.5:c.258C>T	5.37:g.149323979G>A			Q0P638	Silent	SNP	pfam_PDEase_catalytic_dom,pfam_GAF,smart_GAF,smart_HD/PDEase_dom,prints_PDEase	p.C86	ENST00000255266.5	37	c.258	CCDS4299.1	5																																																																																			PDE6A	-	pfam_GAF,smart_GAF	ENSG00000132915		0.517	PDE6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDE6A	HGNC	protein_coding	OTTHUMT00000252326.2	-	0.00	24	0	G			149323979	-1	tier1	-	no_errors	ENST00000255266	ensembl	human	known	74_37	silent	16.67	15	3	SNP	1.000	A
PDZRN4	29951	genome.wustl.edu	37	12	41957441	41957441	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr12:41957441C>T	ENST00000402685.2	+	8	1465	c.1457C>T	c.(1456-1458)cCa>cTa	p.P486L	PDZRN4_ENST00000298919.7_Missense_Mutation_p.P226L|PDZRN4_ENST00000539469.2_Missense_Mutation_p.P228L	NM_001164595.1	NP_001158067.1	Q6ZMN7	PZRN4_HUMAN	PDZ domain containing ring finger 4	486	PDZ 2. {ECO:0000255|PROSITE- ProRule:PRU00143}.						ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(23)|lung(29)|ovary(3)|pancreas(1)|prostate(2)|skin(4)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	77	all_cancers(12;0.000673)	Lung NSC(34;0.0205)|all_lung(34;0.0264)				GTTGCAAGGCCAGAGATTCAG	0.388																																																	0													111.0	104.0	106.0					12																	41957441		2203	4300	6503	SO:0001583	missense	0			AK094690	CCDS8739.1, CCDS53777.1	12q12	2008-08-14	2008-08-14			ENSG00000165966		"""RING-type (C3HC4) zinc fingers"""	30552	protein-coding gene	gene with protein product	"""similar to semaF cytoplasmic domain associated protein 3"""	609730				11230166, 15010864	Standard	NM_013377		Approved	DKFZp434B0417, LNX4, FLJ33777, IMAGE5767589	uc010skn.2	Q6ZMN7		ENST00000402685.2:c.1457C>T	12.37:g.41957441C>T	ENSP00000384197:p.Pro486Leu		Q52LY3|Q52LY4|Q6N052|Q8IUU1|Q9NTP7	Missense_Mutation	SNP	pfam_PDZ,superfamily_PDZ,superfamily_TRAF-like,smart_Znf_RING,smart_PDZ,pfscan_PDZ,pfscan_Znf_RING	p.P486L	ENST00000402685.2	37	c.1457	CCDS53777.1	12	.	.	.	.	.	.	.	.	.	.	C	27.2	4.807051	0.90623	.	.	ENSG00000165966	ENST00000402685;ENST00000539469;ENST00000298919	T;T;T	0.44083	0.93;0.93;0.93	5.19	5.19	0.71726	PDZ/DHR/GLGF (2);	0.000000	0.64402	D	0.000001	T	0.58793	0.2147	L	0.41236	1.265	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.998;1.0;0.999	T	0.60424	-0.7266	10	0.87932	D	0	-21.5435	19.6008	0.95560	0.0:1.0:0.0:0.0	.	486;226;228	Q6ZMN7;Q6ZMN7-4;Q6ZMN7-2	PZRN4_HUMAN;.;.	L	486;228;226	ENSP00000384197:P486L;ENSP00000439990:P228L;ENSP00000298919:P226L	ENSP00000298919:P226L	P	+	2	0	PDZRN4	40243708	1.000000	0.71417	0.991000	0.47740	0.998000	0.95712	7.772000	0.85439	2.791000	0.96007	0.655000	0.94253	CCA	PDZRN4	-	superfamily_PDZ,smart_PDZ	ENSG00000165966		0.388	PDZRN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDZRN4	HGNC	protein_coding	OTTHUMT00000403701.1		0.00	25	0	C	NM_013377		41957441	+1			no_errors	ENST00000402685	ensembl	human	known	74_37	missense	5.71	33	2	SNP	1.000	T
PER1	5187	genome.wustl.edu	37	17	8050700	8050700	+	Splice_Site	SNP	C	C	A			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr17:8050700C>A	ENST00000317276.4	-	13	1735		c.e13-1		PER1_ENST00000354903.5_Splice_Site|PER1_ENST00000581082.1_Splice_Site|PER1_ENST00000578089.1_5'Flank	NM_002616.2	NP_002607.2	O15534	PER1_HUMAN	period circadian clock 1						circadian regulation of gene expression (GO:0032922)|circadian regulation of translation (GO:0097167)|circadian rhythm (GO:0007623)|entrainment of circadian clock (GO:0009649)|entrainment of circadian clock by photoperiod (GO:0043153)|histone H3 acetylation (GO:0043966)|histone H3 deacetylation (GO:0070932)|histone H4 acetylation (GO:0043967)|negative regulation of glucocorticoid receptor signaling pathway (GO:2000323)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of JNK cascade (GO:0046329)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|posttranscriptional regulation of gene expression (GO:0010608)|regulation of circadian rhythm (GO:0042752)|regulation of cytokine production involved in inflammatory response (GO:1900015)|regulation of hair cycle (GO:0042634)|regulation of p38MAPK cascade (GO:1900744)|regulation of sodium ion transport (GO:0002028)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|E-box binding (GO:0070888)|kinase binding (GO:0019900)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|signal transducer activity (GO:0004871)|transcription factor binding transcription factor activity (GO:0000989)|ubiquitin protein ligase binding (GO:0031625)			breast(4)|central_nervous_system(1)|endometrium(2)|kidney(7)|large_intestine(3)|lung(15)|ovary(4)|pancreas(1)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	47						TGTGGACGGGCTGCAGCAGGG	0.662			T	ETV6	"""AML, CMML"""			Other conserved DNA damage response genes																																Dom	yes		17	17p13.1-17p12	5187	period homolog 1 (Drosophila)		L	0													20.0	21.0	21.0					17																	8050700		2198	4293	6491	SO:0001630	splice_region_variant	0			AB002107	CCDS11131.1	17p13.1	2012-12-13	2012-12-13			ENSG00000179094			8845	protein-coding gene	gene with protein product		602260	"""period (Drosophila) homolog 1"", ""period homolog 1 (Drosophila)"""	PER		9323128	Standard	NM_002616		Approved	RIGUI	uc002gkd.3	O15534		ENST00000317276.4:c.1498-1G>T	17.37:g.8050700C>A			B2RPA8|B4DI49|D3DTR3	Splice_Site	SNP	-	e12-1	ENST00000317276.4	37	c.1498-1	CCDS11131.1	17	.	.	.	.	.	.	.	.	.	.	C	8.005	0.756146	0.15846	.	.	ENSG00000179094	ENST00000317276;ENST00000354903	.	.	.	4.39	4.39	0.52855	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.8302	0.70142	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	PER1	7991425	1.000000	0.71417	0.946000	0.38457	0.114000	0.19823	6.033000	0.70925	2.446000	0.82766	0.551000	0.68910	.	PER1	-	-	ENSG00000179094		0.662	PER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PER1	HGNC	protein_coding	OTTHUMT00000441481.2		0.00	52	0	C		Intron	8050700	-1			no_errors	ENST00000317276	ensembl	human	known	74_37	splice_site	6.90	54	4	SNP	0.998	A
PEX11B	8799	genome.wustl.edu	37	1	145522905	145522905	+	Nonsense_Mutation	SNP	C	C	T			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr1:145522905C>T	ENST00000369306.3	+	4	915	c.766C>T	c.(766-768)Cga>Tga	p.R256*	PEX11B_ENST00000537888.1_Nonsense_Mutation_p.R242*|ITGA10_ENST00000538811.1_5'Flank|ITGA10_ENST00000539363.1_5'Flank|ITGA10_ENST00000369304.3_5'Flank	NM_003846.2	NP_003837.1	O96011	PX11B_HUMAN	peroxisomal biogenesis factor 11 beta	256	Interaction with PEX19 and peroxisome targeting.				peroxisome fission (GO:0016559)|peroxisome organization (GO:0007031)|protein homooligomerization (GO:0051260)|regulation of peroxisome size (GO:0044375)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)|integral component of peroxisomal membrane (GO:0005779)|membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)|protein complex (GO:0043234)	protein homodimerization activity (GO:0042803)			breast(1)|endometrium(1)|large_intestine(2)|lung(2)|skin(1)	7	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					TCCCTGGCTACGACTCAAGCC	0.547																																																	0													85.0	76.0	79.0					1																	145522905		2203	4300	6503	SO:0001587	stop_gained	0			AF093670	CCDS72870.1, CCDS72871.1	1q21	2008-08-26	2008-08-26		ENSG00000131779	ENSG00000131779			8853	protein-coding gene	gene with protein product		603867	"""peroxisomal biogenesis factor 11B"""			9792670	Standard	NM_003846		Approved		uc001eny.2	O96011	OTTHUMG00000013756	ENST00000369306.3:c.766C>T	1.37:g.145522905C>T	ENSP00000358312:p.Arg256*		B3KN85|B4DXH9|Q96ET2	Nonsense_Mutation	SNP	pfam_PEX11	p.R256*	ENST00000369306.3	37	c.766	CCDS917.1	1	.	.	.	.	.	.	.	.	.	.	C	37	5.980015	0.97168	.	.	ENSG00000131779	ENST00000369306;ENST00000537888;ENST00000428634	.	.	.	5.44	4.52	0.55395	.	0.065095	0.64402	D	0.000010	.	.	.	.	.	.	0.42411	D	0.992604	.	.	.	.	.	.	.	.	.	.	0.22706	T	0.39	-7.3181	11.2048	0.48762	0.3336:0.6664:0.0:0.0	.	.	.	.	X	256;242;78	.	ENSP00000358312:R256X	R	+	1	2	PEX11B	144234262	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	3.367000	0.52350	1.516000	0.48900	0.655000	0.94253	CGA	PEX11B	-	NULL	ENSG00000131779		0.547	PEX11B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PEX11B	HGNC	protein_coding	OTTHUMT00000038549.1		0.00	11	0	C	NM_003846		145522905	+1			no_errors	ENST00000369306	ensembl	human	known	74_37	nonsense	11.54	23	3	SNP	1.000	T
PF4V1	5197	genome.wustl.edu	37	4	74719825	74719825	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr4:74719825C>T	ENST00000226524.3	+	3	475	c.301C>T	c.(301-303)Cat>Tat	p.H101Y		NM_002620.2	NP_002611.1	P10720	PF4V_HUMAN	platelet factor 4 variant 1	101	Heparin-binding.				cell chemotaxis (GO:0060326)|immune response (GO:0006955)	extracellular space (GO:0005615)	heparin binding (GO:0008201)			endometrium(1)|liver(2)	3	Breast(15;0.00102)		all cancers(17;0.00176)|Lung(101;0.128)|LUSC - Lung squamous cell carcinoma(112;0.187)			CATTAAGGAACATTTGGAGAG	0.398																																																	0													80.0	82.0	82.0					4																	74719825		2203	4300	6503	SO:0001583	missense	0			M26167	CCDS3561.1	4q12-q21	2008-08-15			ENSG00000109272	ENSG00000109272			8862	protein-coding gene	gene with protein product		173461				2725510	Standard	NM_002620		Approved	SCYB4V1, CXCL4V1, CXCL4L1	uc003hhg.1	P10720	OTTHUMG00000130177	ENST00000226524.3:c.301C>T	4.37:g.74719825C>T	ENSP00000226524:p.His101Tyr		A1L4S0	Missense_Mutation	SNP	pfam_Chemokine_IL8-like_dom,superfamily_Chemokine_IL8-like_dom,smart_Chemokine_IL8-like_dom,prints_Chemokine_CXC	p.H101Y	ENST00000226524.3	37	c.301	CCDS3561.1	4	.	.	.	.	.	.	.	.	.	.	C	8.803	0.933465	0.18206	.	.	ENSG00000109272	ENST00000226524	.	.	.	3.9	1.06	0.20224	Chemokine interleukin-8-like domain (2);	0.728841	0.12956	N	0.425459	T	0.07908	0.0198	N	0.03608	-0.345	0.09310	N	1	P	0.39250	0.665	B	0.28638	0.092	T	0.18366	-1.0339	9	0.48119	T	0.1	.	4.5453	0.12078	0.3886:0.5036:0.0:0.1079	.	101	P10720	PF4V_HUMAN	Y	101	.	ENSP00000226524:H101Y	H	+	1	0	PF4V1	74938689	0.001000	0.12720	0.013000	0.15412	0.006000	0.05464	-0.591000	0.05753	0.175000	0.19841	0.655000	0.94253	CAT	PF4V1	-	superfamily_Chemokine_IL8-like_dom,smart_Chemokine_IL8-like_dom	ENSG00000109272		0.398	PF4V1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PF4V1	HGNC	protein_coding	OTTHUMT00000252495.1	-	0.00	12	0	C			74719825	+1	tier1	-	no_errors	ENST00000226524	ensembl	human	known	74_37	missense	25.64	29	10	SNP	0.021	T
PHLDB1	23187	genome.wustl.edu	37	11	118502746	118502746	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr11:118502746G>T	ENST00000361417.2	+	9	2628	c.2217G>T	c.(2215-2217)caG>caT	p.Q739H	PHLDB1_ENST00000356063.5_Missense_Mutation_p.Q739H|PHLDB1_ENST00000534672.1_3'UTR	NM_015157.3	NP_055972.1	Q86UU1	PHLB1_HUMAN	pleckstrin homology-like domain, family B, member 1	739										breast(3)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(10)|liver(3)|lung(14)|ovary(2)|pancreas(1)|prostate(3)|skin(1)	46	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0523)|all_hematologic(192;0.0735)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;3.4e-05)		AGCTAGAGCAGCAGCTGCAGG	0.632																																																	0													52.0	54.0	53.0					11																	118502746		2200	4295	6495	SO:0001583	missense	0				CCDS8401.1, CCDS44750.1	11q23.3	2013-01-10			ENSG00000019144	ENSG00000019144		"""Pleckstrin homology (PH) domain containing"""	23697	protein-coding gene	gene with protein product		612834				14532993	Standard	NM_015157		Approved	FLJ00141, LL5a, KIAA0638	uc001pts.3	Q86UU1	OTTHUMG00000166341	ENST00000361417.2:c.2217G>T	11.37:g.118502746G>T	ENSP00000354498:p.Gln739His		B0YJ63|B0YJ64|O75133|Q4KMF8|Q8TEQ2	Missense_Mutation	SNP	pfam_Pleckstrin_homology,superfamily_SMAD_FHA_domain,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.Q739H	ENST00000361417.2	37	c.2217	CCDS8401.1	11	.	.	.	.	.	.	.	.	.	.	G	11.76	1.735522	0.30774	.	.	ENSG00000019144	ENST00000361417;ENST00000361465;ENST00000358191;ENST00000356063	T;T	0.30981	1.51;1.51	4.94	3.96	0.45880	.	0.187198	0.49305	D	0.000153	T	0.20292	0.0488	N	0.24115	0.695	0.80722	D	1	B;B;B;B	0.13145	0.006;0.002;0.007;0.001	B;B;B;B	0.13407	0.004;0.009;0.004;0.002	T	0.04481	-1.0948	10	0.31617	T	0.26	-30.6424	11.8379	0.52336	0.0:0.1393:0.7345:0.1263	.	483;739;739;739	Q5W9G0;Q86UU1-3;Q86UU1-2;Q86UU1	.;.;.;PHLB1_HUMAN	H	739;498;61;739	ENSP00000354498:Q739H;ENSP00000348359:Q739H	ENSP00000348359:Q739H	Q	+	3	2	PHLDB1	118007956	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.338000	0.59316	2.298000	0.77334	0.561000	0.74099	CAG	PHLDB1	-	NULL	ENSG00000019144		0.632	PHLDB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHLDB1	HGNC	protein_coding	OTTHUMT00000389279.1		0.00	34	0	G	NM_015157		118502746	+1			no_errors	ENST00000361417	ensembl	human	known	74_37	missense	7.32	38	3	SNP	1.000	T
PIK3C2B	5287	genome.wustl.edu	37	1	204425008	204425008	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr1:204425008C>T	ENST00000367187.3	-	12	2475	c.1919G>A	c.(1918-1920)cGc>cAc	p.R640H	PIK3C2B_ENST00000496872.1_5'UTR|PIK3C2B_ENST00000424712.2_Missense_Mutation_p.R640H	NM_002646.3	NP_002637.3	O00750	P3C2B_HUMAN	phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 beta	640	C2 PI3K-type. {ECO:0000255|PROSITE- ProRule:PRU00041, ECO:0000255|PROSITE- ProRule:PRU00880}.				phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|protein kinase B signaling (GO:0043491)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|lipid kinase activity (GO:0001727)|phosphatidylinositol binding (GO:0035091)			breast(3)|central_nervous_system(1)|cervix(2)|endometrium(4)|large_intestine(11)|lung(24)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	52	all_cancers(21;0.00347)|all_neural(3;0.0218)|Glioma(3;0.0382)|all_epithelial(62;0.171)|Breast(84;0.179)|Prostate(682;0.227)		GBM - Glioblastoma multiforme(2;2.69e-45)|all cancers(3;1.66e-30)|KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.143)|Epithelial(59;0.193)			GATGGGGATGCGGTGGGTGGC	0.612																																																	0													56.0	55.0	55.0					1																	204425008		2203	4300	6503	SO:0001583	missense	0			Y11312	CCDS1446.1	1q32	2012-07-13	2012-07-13		ENSG00000133056	ENSG00000133056	2.7.1.154		8972	protein-coding gene	gene with protein product		602838	"""phosphoinositide-3-kinase, class 2, beta polypeptide"""			9144573, 9830063	Standard	NM_002646		Approved	C2-PI3K, PI3K-C2beta	uc001haw.3	O00750	OTTHUMG00000036101	ENST00000367187.3:c.1919G>A	1.37:g.204425008C>T	ENSP00000356155:p.Arg640His		O95666|Q5SW99	Missense_Mutation	SNP	pfam_PI3/4_kinase_cat_dom,pfam_PInositide-3_kin_accessory_dom,pfam_PI3K_C2_dom,pfam_PI3K_Ras-bd_dom,pfam_Phox,pfam_C2_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_dom,superfamily_Phox,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,smart_Phox,smart_C2_dom,pfscan_C2_dom,pfscan_Phox,pfscan_PI3/4_kinase_cat_dom	p.R640H	ENST00000367187.3	37	c.1919	CCDS1446.1	1	.	.	.	.	.	.	.	.	.	.	C	25.8	4.677824	0.88445	.	.	ENSG00000133056	ENST00000367187;ENST00000424712	T;T	0.71222	-0.55;-0.55	5.18	5.18	0.71444	C2 calcium/lipid-binding domain, CaLB (1);Phosphoinositide 3-kinase, C2 (1);	0.000000	0.85682	D	0.000000	T	0.72495	0.3467	L	0.36672	1.1	0.40721	D	0.982664	D;P	0.60575	0.988;0.48	P;B	0.54706	0.759;0.049	T	0.72972	-0.4129	10	0.38643	T	0.18	.	16.4479	0.83947	0.0:1.0:0.0:0.0	.	640;640	F5GWN5;O00750	.;P3C2B_HUMAN	H	640	ENSP00000356155:R640H;ENSP00000400561:R640H	ENSP00000356155:R640H	R	-	2	0	PIK3C2B	202691631	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	7.086000	0.76885	2.404000	0.81709	0.561000	0.74099	CGC	PIK3C2B	-	superfamily_C2_dom,smart_PI3K_C2_dom	ENSG00000133056		0.612	PIK3C2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIK3C2B	HGNC	protein_coding	OTTHUMT00000087965.1	-	0.00	31	0	C	NM_002646		204425008	-1	tier1	-	no_errors	ENST00000367187	ensembl	human	known	74_37	missense	10.81	33	4	SNP	1.000	T
PKD1	5310	genome.wustl.edu	37	16	2144123	2144123	+	Nonsense_Mutation	SNP	G	G	A			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr16:2144123G>A	ENST00000262304.4	-	35	10796	c.10588C>T	c.(10588-10590)Cag>Tag	p.Q3530*	PKD1_ENST00000423118.1_Nonsense_Mutation_p.Q3529*|RP11-304L19.1_ENST00000570072.1_RNA|RP11-304L19.3_ENST00000565937.1_RNA	NM_001009944.2	NP_001009944	P98161	PKD1_HUMAN	polycystic kidney disease 1 (autosomal dominant)	3530					anatomical structure morphogenesis (GO:0009653)|branching morphogenesis of an epithelial tube (GO:0048754)|calcium ion transmembrane transport (GO:0070588)|calcium-independent cell-matrix adhesion (GO:0007161)|cartilage condensation (GO:0001502)|cartilage development (GO:0051216)|cation transmembrane transport (GO:0098655)|cell cycle arrest (GO:0007050)|cell-matrix adhesion (GO:0007160)|cytoplasmic sequestering of transcription factor (GO:0042994)|detection of mechanical stimulus (GO:0050982)|digestive tract development (GO:0048565)|embryonic placenta development (GO:0001892)|genitalia development (GO:0048806)|heart development (GO:0007507)|homophilic cell adhesion (GO:0007156)|in utero embryonic development (GO:0001701)|JAK-STAT cascade (GO:0007259)|kidney development (GO:0001822)|liver development (GO:0001889)|lung epithelium development (GO:0060428)|mesonephric duct development (GO:0072177)|mesonephric tubule development (GO:0072164)|metanephric ascending thin limb development (GO:0072218)|metanephric collecting duct development (GO:0072205)|metanephric distal tubule morphogenesis (GO:0072287)|metanephric proximal tubule development (GO:0072237)|neural tube development (GO:0021915)|neuropeptide signaling pathway (GO:0007218)|nitrogen compound metabolic process (GO:0006807)|peptidyl-serine phosphorylation (GO:0018105)|placenta blood vessel development (GO:0060674)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of protein binding (GO:0032092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein export from nucleus (GO:0006611)|regulation of mitotic spindle organization (GO:0060236)|regulation of proteasomal protein catabolic process (GO:0061136)|response to fluid shear stress (GO:0034405)|skin development (GO:0043588)|spinal cord development (GO:0021510)	basolateral plasma membrane (GO:0016323)|cilium (GO:0005929)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|motile primary cilium (GO:0031512)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|polycystin complex (GO:0002133)	calcium channel activity (GO:0005262)|carbohydrate binding (GO:0030246)|cation channel activity (GO:0005261)|ion channel binding (GO:0044325)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|kidney(6)|lung(34)|prostate(4)|skin(10)|upper_aerodigestive_tract(3)|urinary_tract(3)	72						GCCTGGGGCTGTTCCCAGTTC	0.672																																																	0			GRCh37	CM090561	PKD1	M							17.0	17.0	17.0					16																	2144123		2186	4286	6472	SO:0001587	stop_gained	0			L33243	CCDS32369.1, CCDS45385.1	16p13.3	2014-01-28			ENSG00000008710	ENSG00000008710		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	9008	protein-coding gene	gene with protein product	"""polycystin 1"", ""transient receptor potential cation channel, subfamily P, member 1"""	601313					Standard	NM_001009944		Approved	PBP, Pc-1, TRPP1	uc002cos.1	P98161	OTTHUMG00000155795	ENST00000262304.4:c.10588C>T	16.37:g.2144123G>A	ENSP00000262304:p.Gln3530*		Q15140|Q15141	Nonsense_Mutation	SNP	pfam_PKD_dom,pfam_PKD1_2_channel,pfam_PKD/REJ-like,pfam_PLAT/LH2_dom,pfam_C-type_lectin,pfam_WSC_carb-bd,pfam_GPS_dom,superfamily_C-type_lectin_fold,superfamily_Lipase_LipOase,superfamily_PKD_dom,superfamily_Fe_hydrogenase,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_WSC_carb-bd_subgr,smart_PKD/Chitinase_dom,smart_C-type_lectin,smart_GPS_dom,smart_PLAT/LH2_dom,prints_PKD_1,pfscan_GPS_dom,pfscan_C-type_lectin,pfscan_PKD_dom,pfscan_PLAT/LH2_dom,pfscan_REJ-like,pfscan_WSC_carb-bd,tigrfam_Polycystin_cat	p.Q3530*	ENST00000262304.4	37	c.10588	CCDS32369.1	16	.	.	.	.	.	.	.	.	.	.	G	52	19.082151	0.99914	.	.	ENSG00000008710	ENST00000262304;ENST00000423118;ENST00000306101	.	.	.	3.87	2.9	0.33743	.	0.893904	0.09591	N	0.781482	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05833	T	0.94	.	2.5013	0.04634	0.1501:0.1746:0.5155:0.1598	.	.	.	.	X	3530;3529;2864	.	ENSP00000262304:Q3530X	Q	-	1	0	PKD1	2084124	0.007000	0.16637	0.113000	0.21522	0.373000	0.29922	1.319000	0.33655	0.843000	0.35070	0.505000	0.49811	CAG	PKD1	-	NULL	ENSG00000008710		0.672	PKD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PKD1	HGNC	protein_coding	OTTHUMT00000341688.1	-	0.00	11	0	G			2144123	-1	tier1	-	no_errors	ENST00000262304	ensembl	human	known	74_37	nonsense	36.84	12	7	SNP	0.000	A
PKD1	5310	genome.wustl.edu	37	16	2148015	2148015	+	Intron	SNP	G	G	A	rs4018144		TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr16:2148015G>A	ENST00000262304.4	-	31	10259				PKD1_ENST00000423118.1_Intron|RP11-304L19.1_ENST00000570072.1_RNA|RP11-304L19.3_ENST00000565937.1_RNA	NM_001009944.2	NP_001009944	P98161	PKD1_HUMAN	polycystic kidney disease 1 (autosomal dominant)						anatomical structure morphogenesis (GO:0009653)|branching morphogenesis of an epithelial tube (GO:0048754)|calcium ion transmembrane transport (GO:0070588)|calcium-independent cell-matrix adhesion (GO:0007161)|cartilage condensation (GO:0001502)|cartilage development (GO:0051216)|cation transmembrane transport (GO:0098655)|cell cycle arrest (GO:0007050)|cell-matrix adhesion (GO:0007160)|cytoplasmic sequestering of transcription factor (GO:0042994)|detection of mechanical stimulus (GO:0050982)|digestive tract development (GO:0048565)|embryonic placenta development (GO:0001892)|genitalia development (GO:0048806)|heart development (GO:0007507)|homophilic cell adhesion (GO:0007156)|in utero embryonic development (GO:0001701)|JAK-STAT cascade (GO:0007259)|kidney development (GO:0001822)|liver development (GO:0001889)|lung epithelium development (GO:0060428)|mesonephric duct development (GO:0072177)|mesonephric tubule development (GO:0072164)|metanephric ascending thin limb development (GO:0072218)|metanephric collecting duct development (GO:0072205)|metanephric distal tubule morphogenesis (GO:0072287)|metanephric proximal tubule development (GO:0072237)|neural tube development (GO:0021915)|neuropeptide signaling pathway (GO:0007218)|nitrogen compound metabolic process (GO:0006807)|peptidyl-serine phosphorylation (GO:0018105)|placenta blood vessel development (GO:0060674)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of protein binding (GO:0032092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein export from nucleus (GO:0006611)|regulation of mitotic spindle organization (GO:0060236)|regulation of proteasomal protein catabolic process (GO:0061136)|response to fluid shear stress (GO:0034405)|skin development (GO:0043588)|spinal cord development (GO:0021510)	basolateral plasma membrane (GO:0016323)|cilium (GO:0005929)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|motile primary cilium (GO:0031512)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|polycystin complex (GO:0002133)	calcium channel activity (GO:0005262)|carbohydrate binding (GO:0030246)|cation channel activity (GO:0005261)|ion channel binding (GO:0044325)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|kidney(6)|lung(34)|prostate(4)|skin(10)|upper_aerodigestive_tract(3)|urinary_tract(3)	72						GTCAGCGGGCGGCAGCTCAGA	0.637																																																	0													5.0	6.0	5.0					16																	2148015		1939	3857	5796	SO:0001627	intron_variant	0			L33243	CCDS32369.1, CCDS45385.1	16p13.3	2014-01-28			ENSG00000008710	ENSG00000008710		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	9008	protein-coding gene	gene with protein product	"""polycystin 1"", ""transient receptor potential cation channel, subfamily P, member 1"""	601313					Standard	NM_001009944		Approved	PBP, Pc-1, TRPP1	uc002cos.1	P98161	OTTHUMG00000155795	ENST00000262304.4:c.10051-30C>T	16.37:g.2148015G>A			Q15140|Q15141	RNA	SNP	-	NULL	ENST00000262304.4	37	NULL	CCDS32369.1	16																																																																																			PKD1	-	-	ENSG00000008710		0.637	PKD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PKD1	HGNC	protein_coding	OTTHUMT00000341688.1	-	0.00	155	0	G			2148015	-1	tier1	rs4018144	no_errors	ENST00000566784	ensembl	human	putative	74_37	rna	26.11	133	47	SNP	0.000	A
PKHD1	5314	genome.wustl.edu	37	6	51503711	51503711	+	Nonsense_Mutation	SNP	G	G	T			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr6:51503711G>T	ENST00000371117.3	-	64	11717	c.11442C>A	c.(11440-11442)taC>taA	p.Y3814*		NM_138694.3	NP_619639.3	P08F94	PKHD1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)	3814					cellular calcium ion homeostasis (GO:0006874)|cilium assembly (GO:0042384)|homeostatic process (GO:0042592)|kidney development (GO:0001822)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular component movement (GO:0051271)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein kinase B signaling (GO:0051898)|positive regulation of cell proliferation (GO:0008284)|regulation of centrosome duplication (GO:0010824)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of TOR signaling (GO:0032006)|single organismal cell-cell adhesion (GO:0016337)	anchored component of external side of plasma membrane (GO:0031362)|apical plasma membrane (GO:0016324)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|primary cilium (GO:0072372)	receptor activity (GO:0004872)			NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(5)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(59)|lung(139)|ovary(16)|prostate(8)|skin(20)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(7)|urinary_tract(5)	304	Lung NSC(77;0.0605)					CTGCCAAGTTGTAGAAGCTAA	0.363																																																	0													155.0	155.0	155.0					6																	51503711		2203	4300	6503	SO:0001587	stop_gained	0			AF480064	CCDS4935.1, CCDS4936.1	6p21.2-p12	2012-11-26	2003-04-16		ENSG00000170927	ENSG00000170927			9016	protein-coding gene	gene with protein product	"""tigmin"", ""polyductin"", ""fibrocystin"""	606702	"""TIG multiple domains 1"""	TIGM1		9503014	Standard	NM_138694		Approved	ARPKD, FCYT	uc003pah.1	P08F94	OTTHUMG00000014841	ENST00000371117.3:c.11442C>A	6.37:g.51503711G>T	ENSP00000360158:p.Tyr3814*		Q5VUA2|Q5VUA3|Q5VWV1|Q86Z26|Q8TCZ9	Nonsense_Mutation	SNP	pfam_IPT,pfam_G8_domain,superfamily_Ig_E-set,superfamily_Pectin_lyase_fold/virulence,smart_IPT,smart_PbH1	p.Y3814*	ENST00000371117.3	37	c.11442	CCDS4935.1	6	.	.	.	.	.	.	.	.	.	.	G	53	20.685980	0.99933	.	.	ENSG00000170927	ENST00000371117	.	.	.	5.7	2.92	0.33932	.	0.161083	0.43919	D	0.000515	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.41790	T	0.15	.	8.2619	0.31790	0.2442:0.0:0.7558:0.0	.	.	.	.	X	3814	.	ENSP00000360158:Y3814X	Y	-	3	2	PKHD1	51611670	1.000000	0.71417	0.987000	0.45799	0.612000	0.37316	0.693000	0.25497	0.319000	0.23209	0.585000	0.79938	TAC	PKHD1	-	NULL	ENSG00000170927		0.363	PKHD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PKHD1	HGNC	protein_coding	OTTHUMT00000040893.1	-	0.00	57	0	G	NM_138694		51503711	-1	tier1	-	no_errors	ENST00000371117	ensembl	human	known	74_37	nonsense	5.97	63	4	SNP	1.000	T
PLA2G4E	123745	genome.wustl.edu	37	15	42292154	42292154	+	Silent	SNP	G	G	T			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr15:42292154G>T	ENST00000399518.3	-	9	1383	c.897C>A	c.(895-897)ctC>ctA	p.L299L	PLA2G4E_ENST00000413860.2_Silent_p.L270L|CTD-2382E5.1_ENST00000499478.2_RNA	NM_001206670.1	NP_001193599.1	Q3MJ16	PA24E_HUMAN	phospholipase A2, group IVE	292					glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid catabolic process (GO:0009395)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|lysosome (GO:0005764)|membrane (GO:0016020)	metal ion binding (GO:0046872)|phospholipase A2 activity (GO:0004623)			NS(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(2)|ovary(1)|prostate(1)|stomach(1)	16		all_cancers(109;8.09e-13)|all_epithelial(112;2.03e-11)|Lung NSC(122;2.17e-07)|all_lung(180;8.79e-07)|Melanoma(134;0.0273)		OV - Ovarian serous cystadenocarcinoma(18;7.61e-18)|GBM - Glioblastoma multiforme(94;3.07e-06)		AAAGGCAGTCGAGGGGCTGGC	0.647																																																	0													22.0	25.0	24.0					15																	42292154		1935	4144	6079	SO:0001819	synonymous_variant	0				CCDS55962.1	15q15.1	2008-09-19			ENSG00000188089	ENSG00000188089	3.1.1.4		24791	protein-coding gene	gene with protein product						15866882	Standard	NM_001206670		Approved	FLJ45651	uc021sjp.1	Q3MJ16	OTTHUMG00000130371	ENST00000399518.3:c.897C>A	15.37:g.42292154G>T			Q6ZSC0	Silent	SNP	pfam_LysoPLipase_cat_dom,pfam_C2_dom,superfamily_Acyl_Trfase/lysoPLipase,superfamily_C2_dom,smart_C2_dom,smart_LysoPLipase_cat_dom,pfscan_C2_dom,pfscan_LysoPLipase_cat_dom	p.L270	ENST00000399518.3	37	c.810	CCDS55962.1	15																																																																																			PLA2G4E	-	NULL	ENSG00000188089		0.647	PLA2G4E-001	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	PLA2G4E	HGNC	protein_coding	OTTHUMT00000252738.2		0.00	28	0	G	NM_198442		42292154	-1			no_errors	ENST00000413860	ensembl	human	known	74_37	silent	9.09	20	2	SNP	0.086	T
PLCB4	5332	genome.wustl.edu	37	20	9449234	9449234	+	Nonsense_Mutation	SNP	C	C	T			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr20:9449234C>T	ENST00000378493.1	+	32	3244	c.3229C>T	c.(3229-3231)Cga>Tga	p.R1077*	PLCB4_ENST00000378473.3_Nonsense_Mutation_p.R1089*|PLCB4_ENST00000378501.2_Nonsense_Mutation_p.R1077*|PLCB4_ENST00000492632.1_3'UTR|PLCB4_ENST00000278655.4_Nonsense_Mutation_p.R1077*|PLCB4_ENST00000334005.3_Nonsense_Mutation_p.R1077*|PLCB4_ENST00000414679.2_Nonsense_Mutation_p.R1089*			Q15147	PLCB4_HUMAN	phospholipase C, beta 4	1077					inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|dendrite (GO:0030425)|nucleus (GO:0005634)|postsynaptic density (GO:0014069)|smooth endoplasmic reticulum (GO:0005790)	calcium ion binding (GO:0005509)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|signal transducer activity (GO:0004871)			NS(2)|breast(4)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(11)|liver(4)|lung(34)|ovary(3)|pancreas(1)|prostate(1)|skin(19)|upper_aerodigestive_tract(1)	87						CAAGGAAATGCGAGCACACCA	0.413																																																	0													143.0	142.0	142.0					20																	9449234		2203	4300	6503	SO:0001587	stop_gained	0				CCDS13104.1, CCDS13105.1, CCDS54447.1	20p12	2008-03-18			ENSG00000101333	ENSG00000101333	3.1.4.11		9059	protein-coding gene	gene with protein product		600810				8530101	Standard	NM_000933		Approved		uc021wam.1	Q15147	OTTHUMG00000031853	ENST00000378493.1:c.3229C>T	20.37:g.9449234C>T	ENSP00000367754:p.Arg1077*		B7ZLK6|E2QRH8|Q17R56|Q5JYS8|Q5JYS9|Q5JYT0|Q5JYT3|Q5JYT4|Q9BQW5|Q9BQW6|Q9BQW8|Q9UJQ2	Nonsense_Mutation	SNP	pirsf_PLC-beta,pfam_PLipase_C_PInositol-sp_X_dom,pfam_PLipase_C_Pinositol-sp_Y,pfam_PLipase_C_EF-hand-like,pfam_PLC-beta_CS,pfam_C2_dom,superfamily_PLC-like_Pdiesterase_TIM-brl,superfamily_C2_dom,smart_PLipase_C_PInositol-sp_X_dom,smart_PLipase_C_Pinositol-sp_Y,smart_C2_dom,prints_Pinositol_PLipase_C,pfscan_C2_dom,pfscan_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_Pinositol-sp_Y	p.R1077*	ENST00000378493.1	37	c.3229	CCDS13105.1	20	.	.	.	.	.	.	.	.	.	.	C	43	9.995805	0.99313	.	.	ENSG00000101333	ENST00000334005;ENST00000378473;ENST00000278655;ENST00000378493;ENST00000378501;ENST00000414679	.	.	.	5.75	-1.96	0.07525	.	0.067617	0.64402	D	0.000019	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07030	T	0.85	.	19.4281	0.94754	0.7649:0.235:0.0:0.0	.	.	.	.	X	1077;1089;1077;1077;1077;925	.	ENSP00000278655:R1077X	R	+	1	2	PLCB4	9397234	1.000000	0.71417	0.975000	0.42487	0.991000	0.79684	0.859000	0.27858	-0.683000	0.05190	-0.181000	0.13052	CGA	PLCB4	-	pirsf_PLC-beta	ENSG00000101333		0.413	PLCB4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PLCB4	HGNC	protein_coding	OTTHUMT00000077948.2		0.00	47	0	C			9449234	+1			no_errors	ENST00000334005	ensembl	human	known	74_37	nonsense	5.13	37	2	SNP	1.000	T
PLCH2	9651	genome.wustl.edu	37	1	2420795	2420795	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr1:2420795T>C	ENST00000419816.2	+	9	1659	c.1385T>C	c.(1384-1386)cTc>cCc	p.L462P	RP3-395M20.2_ENST00000424657.1_RNA|PLCH2_ENST00000449969.1_Missense_Mutation_p.L435P|PLCH2_ENST00000378488.3_Missense_Mutation_p.L462P|PLCH2_ENST00000378486.3_Missense_Mutation_p.L462P|PLCH2_ENST00000288766.5_Intron			O75038	PLCH2_HUMAN	phospholipase C, eta 2	462	PI-PLC X-box. {ECO:0000255|PROSITE- ProRule:PRU00270}.				inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|phosphatidylinositol metabolic process (GO:0046488)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|phosphatidylinositol phospholipase C activity (GO:0004435)|signal transducer activity (GO:0004871)			central_nervous_system(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(8)|ovary(1)|prostate(3)|skin(1)	20	all_cancers(77;0.000161)|all_epithelial(69;5.98e-05)|all_lung(157;0.016)|Lung NSC(156;0.0376)|Ovarian(185;0.0634)	all_epithelial(116;7.32e-16)|all_lung(118;1.15e-06)|Lung NSC(185;6.26e-05)|Renal(390;0.00571)|Breast(487;0.00832)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Medulloblastoma(700;0.151)|Lung SC(97;0.217)		Epithelial(90;1.44e-37)|OV - Ovarian serous cystadenocarcinoma(86;6.78e-23)|GBM - Glioblastoma multiforme(42;2.8e-08)|Colorectal(212;4.19e-05)|COAD - Colon adenocarcinoma(227;0.000195)|Kidney(185;0.00034)|BRCA - Breast invasive adenocarcinoma(365;0.00443)|KIRC - Kidney renal clear cell carcinoma(229;0.00548)|STAD - Stomach adenocarcinoma(132;0.00644)|Lung(427;0.2)		CCACAGATGCTCAAGGGCAAG	0.582																																																	0													100.0	102.0	102.0					1																	2420795		2129	4230	6359	SO:0001583	missense	0			AB007919	CCDS59959.1	1p36.32	2013-01-10	2006-03-16	2006-03-16	ENSG00000149527	ENSG00000149527	3.1.4.11	"""EF-hand domain containing"""	29037	protein-coding gene	gene with protein product		612836	"""phospholipase C-like 4"""	PLCL4		15899900	Standard	XM_006711054		Approved	KIAA0450, PLCeta2, RP3-395M20.1, PLC-eta2	uc001aji.1	O75038	OTTHUMG00000000719	ENST00000419816.2:c.1385T>C	1.37:g.2420795T>C	ENSP00000389803:p.Leu462Pro		A2VCM3|B9DI80|Q3LUA8|Q86XJ2|Q86XU1|Q86YU7|Q8TEH5|Q8WUS6	Missense_Mutation	SNP	pfam_PLipase_C_PInositol-sp_X_dom,pfam_PLipase_C_Pinositol-sp_Y,pfam_PLipase_C_EF-hand-like,pfam_C2_dom,superfamily_PLC-like_Pdiesterase_TIM-brl,superfamily_C2_dom,smart_Pleckstrin_homology,smart_EF_hand_dom,smart_PLipase_C_PInositol-sp_X_dom,smart_PLipase_C_Pinositol-sp_Y,smart_C2_dom,pfscan_EF_hand_dom,pfscan_C2_dom,pfscan_Pleckstrin_homology,pfscan_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_Pinositol-sp_Y,prints_Pinositol_PLipase_C	p.L462P	ENST00000419816.2	37	c.1385		1	.	.	.	.	.	.	.	.	.	.	T	17.59	3.427060	0.62733	.	.	ENSG00000149527	ENST00000449969;ENST00000378486;ENST00000378488;ENST00000343889;ENST00000278878	T;T;T	0.73363	-0.74;-0.74;-0.74	5.1	5.1	0.69264	PLC-like phosphodiesterase, TIM beta/alpha-barrel domain (2);Phospholipase C, phosphatidylinositol-specific , X domain (3);	0.077846	0.49305	D	0.000150	D	0.91650	0.7361	H	0.98866	4.355	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.94675	0.7860	10	0.87932	D	0	.	14.0841	0.64944	0.0:0.0:0.0:1.0	.	309;250;435;462	B9DI81;B9DI82;O75038-2;O75038	.;.;.;PLCH2_HUMAN	P	435;462;462;309;250	ENSP00000397289:L435P;ENSP00000367747:L462P;ENSP00000367749:L462P	ENSP00000278878:L250P	L	+	2	0	PLCH2	2410655	1.000000	0.71417	0.965000	0.40720	0.114000	0.19823	7.773000	0.85462	1.922000	0.55676	0.459000	0.35465	CTC	PLCH2	-	pfam_PLipase_C_PInositol-sp_X_dom,superfamily_PLC-like_Pdiesterase_TIM-brl,smart_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_PInositol-sp_X_dom,prints_Pinositol_PLipase_C	ENSG00000149527		0.582	PLCH2-009	KNOWN	non_canonical_conserved|basic|appris_principal	protein_coding	PLCH2	HGNC	protein_coding	OTTHUMT00000467514.1	-	0.00	25	0	T	NM_014638		2420795	+1	tier1	-	no_errors	ENST00000378486	ensembl	human	known	74_37	missense	21.88	25	7	SNP	0.999	C
PLK1	5347	genome.wustl.edu	37	16	23691416	23691416	+	Missense_Mutation	SNP	G	G	T	rs35984094	byFrequency	TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr16:23691416G>T	ENST00000300093.4	+	2	531	c.420G>T	c.(418-420)gaG>gaT	p.E140D	PLK1_ENST00000564202.1_3'UTR	NM_005030.3	NP_005021.2	P53350	PLK1_HUMAN	polo-like kinase 1	140	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of mitotic anaphase-promoting complex activity (GO:0007092)|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell proliferation (GO:0008283)|centrosome organization (GO:0051297)|cytokinesis (GO:0000910)|establishment of protein localization (GO:0045184)|G2 DNA damage checkpoint (GO:0031572)|G2/M transition of mitotic cell cycle (GO:0000086)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|microtubule bundle formation (GO:0001578)|mitotic cell cycle (GO:0000278)|mitotic cytokinesis (GO:0000281)|mitotic nuclear division (GO:0007067)|mitotic nuclear envelope disassembly (GO:0007077)|mitotic sister chromatid segregation (GO:0000070)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|peptidyl-serine phosphorylation (GO:0018105)|polar body extrusion after meiotic divisions (GO:0040038)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of proteolysis (GO:0045862)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|protein destabilization (GO:0031648)|protein localization to chromatin (GO:0071168)|protein phosphorylation (GO:0006468)|protein ubiquitination (GO:0016567)|regulation of cell cycle (GO:0051726)|regulation of mitotic cell cycle (GO:0007346)|regulation of mitotic metaphase/anaphase transition (GO:0030071)|regulation of protein binding (GO:0043393)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|response to antibiotic (GO:0046677)	centrosome (GO:0005813)|condensed nuclear chromosome outer kinetochore (GO:0000942)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|microtubule cytoskeleton (GO:0015630)|midbody (GO:0030496)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)|spindle midzone (GO:0051233)|spindle pole (GO:0000922)	anaphase-promoting complex binding (GO:0010997)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|microtubule binding (GO:0008017)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(7)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23				GBM - Glioblastoma multiforme(48;0.0156)		CTCTCCTGGAGCTGCACAAGA	0.587																																					Colon(12;240 564 27038 33155)												0													74.0	58.0	63.0					16																	23691416		2197	4300	6497	SO:0001583	missense	0				CCDS10616.1	16p	2013-01-17	2010-06-24	2004-01-28	ENSG00000166851	ENSG00000166851			9077	protein-coding gene	gene with protein product		602098	"""polo-like kinase (Drosophila)"""	PLK		8127874	Standard	NM_005030		Approved		uc002dlz.1	P53350	OTTHUMG00000096984	ENST00000300093.4:c.420G>T	16.37:g.23691416G>T	ENSP00000300093:p.Glu140Asp		Q15153|Q99746	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_POLO_box_duplicated_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_POLO_box_duplicated_dom,pfscan_Prot_kinase_dom	p.E140D	ENST00000300093.4	37	c.420	CCDS10616.1	16	.	.	.	.	.	.	.	.	.	.	G	23.4	4.415687	0.83449	.	.	ENSG00000166851	ENST00000300093;ENST00000425844;ENST00000330792	T	0.21191	2.02	5.51	2.51	0.30379	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.20740	0.0499	N	0.04148	-0.265	0.80722	D	1	D	0.59357	0.985	D	0.72075	0.976	T	0.10847	-1.0612	10	0.66056	D	0.02	-28.5165	8.9234	0.35625	0.2433:0.0:0.7567:0.0	.	140	P53350	PLK1_HUMAN	D	140;43;140	ENSP00000300093:E140D	ENSP00000300093:E140D	E	+	3	2	PLK1	23598917	1.000000	0.71417	0.999000	0.59377	0.993000	0.82548	3.598000	0.54038	0.302000	0.22762	0.555000	0.69702	GAG	PLK1	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000166851		0.587	PLK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLK1	HGNC	protein_coding	OTTHUMT00000214057.2	-	0.00	52	0	G	NM_005030		23691416	+1	tier1	-	no_errors	ENST00000300093	ensembl	human	known	74_37	missense	6.56	57	4	SNP	1.000	T
PLXDC1	57125	genome.wustl.edu	37	17	37234192	37234192	+	Missense_Mutation	SNP	A	A	T			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr17:37234192A>T	ENST00000315392.4	-	11	1371	c.1160T>A	c.(1159-1161)cTc>cAc	p.L387H	CTD-2206N4.4_ENST00000583447.1_RNA|PLXDC1_ENST00000539608.1_3'UTR|PLXDC1_ENST00000493200.1_5'UTR|PLXDC1_ENST00000444911.2_Missense_Mutation_p.L347H	NM_020405.4	NP_065138.2	Q8IUK5	PLDX1_HUMAN	plexin domain containing 1	387					angiogenesis (GO:0001525)|spinal cord development (GO:0021510)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|tight junction (GO:0005923)	receptor activity (GO:0004872)			kidney(2)|large_intestine(6)|liver(1)|lung(10)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	23						GTCGATGAAGAGGGAGGAGGA	0.607																																																	0													159.0	115.0	130.0					17																	37234192		2203	4300	6503	SO:0001583	missense	0			AF279144	CCDS11333.1	17q21.1	2006-04-12			ENSG00000161381	ENSG00000161381			20945	protein-coding gene	gene with protein product	"""tumor endothelial marker 7 precursor"""	606826				10947988, 11559528	Standard	NM_020405		Approved	TEM3, TEM7	uc002hrg.2	Q8IUK5	OTTHUMG00000133183	ENST00000315392.4:c.1160T>A	17.37:g.37234192A>T	ENSP00000323927:p.Leu387His		B2R7I8|Q5QCZ7|Q5QCZ8|Q5QCZ9|Q9HCT9	Missense_Mutation	SNP	pfam_Plexin_repeat,superfamily_Plexin-like_fold	p.L387H	ENST00000315392.4	37	c.1160	CCDS11333.1	17	.	.	.	.	.	.	.	.	.	.	A	6.061	0.379568	0.11466	.	.	ENSG00000161381	ENST00000315392;ENST00000394318;ENST00000444911	T;T	0.29655	1.56;1.56	5.38	5.38	0.77491	.	0.655472	0.15232	N	0.273346	T	0.31327	0.0793	N	0.24115	0.695	0.80722	D	1	P;D	0.56521	0.94;0.976	P;P	0.54460	0.674;0.753	T	0.01484	-1.1343	10	0.14656	T	0.56	-19.6895	12.8825	0.58024	1.0:0.0:0.0:0.0	.	347;387	B4E173;Q8IUK5	.;PXDC1_HUMAN	H	387;314;347	ENSP00000323927:L387H;ENSP00000409687:L347H	ENSP00000323927:L387H	L	-	2	0	PLXDC1	34487718	0.996000	0.38824	0.433000	0.26760	0.026000	0.11368	3.468000	0.53086	2.269000	0.75478	0.533000	0.62120	CTC	PLXDC1	-	NULL	ENSG00000161381		0.607	PLXDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLXDC1	HGNC	protein_coding	OTTHUMT00000256892.2	-	0.00	24	0	A	NM_020405		37234192	-1	tier1	-	no_errors	ENST00000315392	ensembl	human	known	74_37	missense	26.32	28	10	SNP	0.672	T
POLQ	10721	genome.wustl.edu	37	3	121178982	121178982	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr3:121178982G>A	ENST00000264233.5	-	25	7195	c.7067C>T	c.(7066-7068)gCt>gTt	p.A2356V		NM_199420.3	NP_955452.3	O75417	DPOLQ_HUMAN	polymerase (DNA directed), theta	2356					ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)	nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|damaged DNA binding (GO:0003684)|DNA-directed DNA polymerase activity (GO:0003887)|single-stranded DNA-dependent ATPase activity (GO:0043142)			NS(2)|breast(7)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|lung(55)|ovary(5)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	120				GBM - Glioblastoma multiforme(114;0.0915)		GAAAACATCAGCTCCAGTGTT	0.468								DNA polymerases (catalytic subunits)																													Pancreas(152;907 1925 26081 31236 36904)												0													149.0	132.0	137.0					3																	121178982		2203	4300	6503	SO:0001583	missense	0			AF052573	CCDS33833.1	3q13.3	2012-05-18			ENSG00000051341	ENSG00000051341	2.7.7.7	"""DNA polymerases"""	9186	protein-coding gene	gene with protein product		604419				10395804	Standard	NM_199420		Approved	POLH	uc003eee.4	O75417	OTTHUMG00000159396	ENST00000264233.5:c.7067C>T	3.37:g.121178982G>A	ENSP00000264233:p.Ala2356Val		O95160|Q6VMB5	Missense_Mutation	SNP	pfam_DNA-dir_DNA_pol_A_palm_dom,pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,superfamily_P-loop_NTPase,superfamily_RNaseH-like_dom,smart_Helicase_ATP-bd,smart_Helicase_C,smart_DNA-dir_DNA_pol_A_palm_dom,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,prints_DNA_polymerase_A	p.A2356V	ENST00000264233.5	37	c.7067	CCDS33833.1	3	.	.	.	.	.	.	.	.	.	.	G	19.47	3.833067	0.71258	.	.	ENSG00000051341	ENST00000543272;ENST00000264233;ENST00000393672	D	0.96992	-4.2	5.6	3.76	0.43208	DNA-directed DNA polymerase, family A, palm domain (2);	0.122829	0.56097	N	0.000034	D	0.92681	0.7674	L	0.31752	0.955	0.33521	D	0.592384	B;P	0.42692	0.203;0.787	B;B	0.42343	0.105;0.384	D	0.93091	0.6500	10	0.54805	T	0.06	.	10.45	0.44516	0.0696:0.0:0.788:0.1423	.	2356;1528	O75417;O75417-2	DPOLQ_HUMAN;.	V	1979;2356;2492	ENSP00000264233:A2356V	ENSP00000264233:A2356V	A	-	2	0	POLQ	122661672	0.914000	0.31030	0.981000	0.43875	0.962000	0.63368	4.105000	0.57797	0.664000	0.31047	0.591000	0.81541	GCT	POLQ	-	pfam_DNA-dir_DNA_pol_A_palm_dom,smart_DNA-dir_DNA_pol_A_palm_dom	ENSG00000051341		0.468	POLQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POLQ	HGNC	protein_coding	OTTHUMT00000355097.1	-	0.00	34	0	G	NM_199420		121178982	-1	tier1	-	no_errors	ENST00000264233	ensembl	human	known	74_37	missense	43.33	17	13	SNP	0.993	A
PPP1R16A	84988	genome.wustl.edu	37	8	145724303	145724303	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr8:145724303G>A	ENST00000292539.4	+	4	1252	c.335G>A	c.(334-336)tGc>tAc	p.C112Y	CTD-2517M22.14_ENST00000532766.1_RNA|CTD-2517M14.5_ENST00000569326.1_RNA|PPP1R16A_ENST00000435887.1_Missense_Mutation_p.C112Y			Q96I34	PP16A_HUMAN	protein phosphatase 1, regulatory subunit 16A	112						plasma membrane (GO:0005886)		p.C112Y(1)		NS(1)|endometrium(1)|kidney(2)|lung(3)|prostate(1)	8	all_cancers(97;5.56e-11)|all_epithelial(106;3.54e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.48e-41)|Epithelial(56;1.85e-40)|all cancers(56;3.59e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0483)|Colorectal(110;0.055)			TTGCAGTGCTGCATTGATGAT	0.652																																																	1	Substitution - Missense(1)	kidney(1)											65.0	54.0	58.0					8																	145724303		2203	4300	6503	SO:0001583	missense	0				CCDS6429.1	8q24.3	2013-01-10	2011-10-04		ENSG00000160972	ENSG00000160972		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ankyrin repeat domain containing"""	14941	protein-coding gene	gene with protein product		609172	"""protein phosphatase 1, regulatory (inhibitor) subunit 16A"""			11948623	Standard	NM_032902		Approved	MGC14333, MYPT3	uc003zdf.3	Q96I34	OTTHUMG00000165173	ENST00000292539.4:c.335G>A	8.37:g.145724303G>A	ENSP00000292539:p.Cys112Tyr		D3DWM5	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,superfamily_Adenylate_cyclase-assoc_CAP_N,smart_Ankyrin_rpt,pirsf_Pase-1_reg_su_16AB_euk,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.C112Y	ENST00000292539.4	37	c.335	CCDS6429.1	8	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	G|G|G	20.8|20.8|20.8	4.055449|4.055449|4.055449	0.75960|0.75960|0.75960	.|.|.	.|.|.	ENSG00000255182|ENSG00000160972|ENSG00000255182	ENST00000532766|ENST00000292539;ENST00000435887|ENST00000527086	.|T;T|.	.|0.64803|.	.|-0.12;-0.12|.	4.76|4.76|4.76	4.76|4.76|4.76	0.60689|0.60689|0.60689	.|Ankyrin repeat-containing domain (4);|.	.|0.000000|.	.|0.85682|.	.|D|.	.|0.000000|.	D|D|.	0.83547|0.83547|.	0.5278|0.5278|.	M|M|M	0.90814|0.90814|0.90814	3.15|3.15|3.15	0.80722|0.80722|0.80722	D|D|D	1|1|1	.|D|.	.|0.89917|.	.|1.0|.	.|D|.	.|0.87578|.	.|0.998|.	D|D|.	0.87601|0.87601|.	0.2497|0.2497|.	6|10|.	0.87932|0.87932|0.87932	D|D|D	0|0|0	.|.|.	15.2564|15.2564|15.2564	0.73588|0.73588|0.73588	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.|.	.|112|.	.|Q96I34|.	.|PP16A_HUMAN|.	V|Y|X	31|112|46	.|ENSP00000292539:C112Y;ENSP00000391126:C112Y|.	ENSP00000435686:A31V|ENSP00000292539:C112Y|ENSP00000437304:Q46X	A|C|Q	-|+|-	2|2|1	0|0|0	CTD-2517M22.14|PPP1R16A|CTD-2517M22.14	145695111|145695111|145695111	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.555000|0.555000|0.555000	0.35460|0.35460|0.35460	5.314000|5.314000|5.314000	0.65804|0.65804|0.65804	2.198000|2.198000|2.198000	0.70561|0.70561|0.70561	0.462000|0.462000|0.462000	0.41574|0.41574|0.41574	GCA|TGC|CAG	PPP1R16A	-	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pirsf_Pase-1_reg_su_16AB_euk,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000160972		0.652	PPP1R16A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1R16A	HGNC	protein_coding	OTTHUMT00000382459.1		0.00	35	0	G	NM_032902		145724303	+1			no_errors	ENST00000292539	ensembl	human	known	74_37	missense	5.41	35	2	SNP	1.000	A
PRKAR1B	5575	genome.wustl.edu	37	7	720328	720328	+	Silent	SNP	T	T	C			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr7:720328T>C	ENST00000406797.1	-	3	387	c.213A>G	c.(211-213)tcA>tcG	p.S71S	PRKAR1B_ENST00000544935.1_Silent_p.S71S|PRKAR1B_ENST00000360274.4_Silent_p.S71S|PRKAR1B_ENST00000537384.1_Silent_p.S71S|PRKAR1B_ENST00000403562.1_Silent_p.S71S	NM_001164761.1	NP_001158233.1	P31321	KAP1_HUMAN	protein kinase, cAMP-dependent, regulatory, type I, beta	71	Dimerization and phosphorylation.				activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|blood coagulation (GO:0007596)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|learning or memory (GO:0007611)|negative regulation of cAMP-dependent protein kinase activity (GO:2000480)|neurotrophin TRK receptor signaling pathway (GO:0048011)|protein phosphorylation (GO:0006468)|regulation of insulin secretion (GO:0050796)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cAMP-dependent protein kinase complex (GO:0005952)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	cAMP binding (GO:0030552)|cAMP-dependent protein kinase inhibitor activity (GO:0004862)|cAMP-dependent protein kinase regulator activity (GO:0008603)|protein kinase A catalytic subunit binding (GO:0034236)			endometrium(4)|large_intestine(1)|liver(1)|lung(10)|prostate(1)	17		Ovarian(82;0.0779)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0181)|Epithelial(4;5.75e-19)|OV - Ovarian serous cystadenocarcinoma(56;2.01e-18)|all cancers(6;3.96e-16)|BRCA - Breast invasive adenocarcinoma(126;0.152)		ACTGTGAGTTTGACTTTTGCC	0.612																																																	0													86.0	82.0	84.0					7																	720328		2203	4300	6503	SO:0001819	synonymous_variant	0			M65066	CCDS34579.1	7p22.3	2013-09-19			ENSG00000188191	ENSG00000188191	2.7.11.1		9390	protein-coding gene	gene with protein product		176911				1358799, 3479018	Standard	NM_002735		Approved		uc003siw.2	P31321	OTTHUMG00000151411	ENST00000406797.1:c.213A>G	7.37:g.720328T>C			Q8N422	Silent	SNP	pfam_cNMP-bd_dom,pfam_cAMP_dep_PK_reg_su_I/II_a/b,superfamily_cNMP-bd-like,superfamily_cAMP_dep_PK_reg_su_I/II_a/b,smart_cAMP_dep_PK_reg_su_I/II_a/b,smart_cNMP-bd_dom,pirsf_cAMP_dep_PK_reg_su,pfscan_cNMP-bd_dom,prints_cAMP/cGMP_kin	p.S71	ENST00000406797.1	37	c.213	CCDS34579.1	7																																																																																			PRKAR1B	-	pirsf_cAMP_dep_PK_reg_su	ENSG00000188191		0.612	PRKAR1B-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PRKAR1B	HGNC	protein_coding	OTTHUMT00000322525.1		0.00	40	0	T			720328	-1			no_errors	ENST00000360274	ensembl	human	known	74_37	silent	7.41	25	2	SNP	0.415	C
PPP1R3A	5506	genome.wustl.edu	37	7	113520081	113520081	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr7:113520081A>C	ENST00000284601.3	-	4	1134	c.1066T>G	c.(1066-1068)Tta>Gta	p.L356V		NM_002711.3	NP_002702.2	Q16821	PPR3A_HUMAN	protein phosphatase 1, regulatory subunit 3A	356					glycogen metabolic process (GO:0005977)	integral component of membrane (GO:0016021)				NS(2)|breast(8)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|liver(1)|lung(43)|ovary(10)|pancreas(7)|prostate(3)|skin(15)|stomach(1)|upper_aerodigestive_tract(2)	121						TTCTTCTCTAACCCCTCTGCT	0.378																																																	0													181.0	180.0	180.0					7																	113520081		2203	4300	6503	SO:0001583	missense	0			AF024578	CCDS5759.1	7q31.1	2012-04-17	2011-10-04	2001-07-02	ENSG00000154415	ENSG00000154415	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9291	protein-coding gene	gene with protein product	"""glycogen-associated regulatory subunit of protein phosphatase-1"", ""protein phosphatase 1 regulatory subunit GM"""	600917	"""protein phosphatase 1, regulatory (inhibitor) subunit 3A (glycogen and sarcoplasmic reticulum binding subunit, skeletal muscle)"", ""protein phosphatase 1, regulatory (inhibitor) subunit 3A"""	PPP1R3		7926294	Standard	NM_002711		Approved	GM	uc010ljy.1	Q16821	OTTHUMG00000156944	ENST00000284601.3:c.1066T>G	7.37:g.113520081A>C	ENSP00000284601:p.Leu356Val		A0AVQ2|A4D0T6|O43476|Q75LN8|Q7KYM8|Q86UI6	Missense_Mutation	SNP	pfam_CBM_21,pfscan_CBM_21	p.L356V	ENST00000284601.3	37	c.1066	CCDS5759.1	7	.	.	.	.	.	.	.	.	.	.	A	11.76	1.735951	0.30774	.	.	ENSG00000154415	ENST00000284601;ENST00000449795	T;T	0.39997	2.21;1.05	5.51	3.14	0.36123	.	0.856438	0.09927	N	0.737685	T	0.46889	0.1416	M	0.65975	2.015	0.09310	N	0.999995	P	0.52463	0.953	P	0.47603	0.551	T	0.27400	-1.0075	10	0.44086	T	0.13	-2.2676	8.0133	0.30365	0.7733:0.0:0.2267:0.0	.	356	Q16821	PPR3A_HUMAN	V	356;35	ENSP00000284601:L356V;ENSP00000401278:L35V	ENSP00000284601:L356V	L	-	1	2	PPP1R3A	113307317	0.117000	0.22190	0.488000	0.27440	0.210000	0.24377	0.420000	0.21263	0.478000	0.27488	-0.280000	0.10049	TTA	PPP1R3A	-	NULL	ENSG00000154415		0.378	PPP1R3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1R3A	HGNC	protein_coding	OTTHUMT00000346724.1	-	0.00	74	0	A	NM_002711		113520081	-1	tier1	-	no_errors	ENST00000284601	ensembl	human	known	74_37	missense	44.74	20	17	SNP	0.346	C
PRKCZ	5590	genome.wustl.edu	37	1	2087464	2087464	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr1:2087464G>T	ENST00000400921.2	+	7	1041	c.358G>T	c.(358-360)Gtg>Ttg	p.V120L	PRKCZ_ENST00000479263.1_3'UTR|PRKCZ_ENST00000400920.1_Missense_Mutation_p.V120L	NM_001033581.1	NP_001028753.1	Q05513	KPCZ_HUMAN	protein kinase C, zeta	303	Interaction with SQSTM1. {ECO:0000250}.				actin cytoskeleton reorganization (GO:0031532)|activation of phospholipase D activity (GO:0031584)|activation of protein kinase B activity (GO:0032148)|blood coagulation (GO:0007596)|cell migration (GO:0016477)|establishment of cell polarity (GO:0030010)|inflammatory response (GO:0006954)|insulin receptor signaling pathway (GO:0008286)|long-term memory (GO:0007616)|long-term synaptic potentiation (GO:0060291)|membrane hyperpolarization (GO:0060081)|microtubule cytoskeleton organization (GO:0000226)|negative regulation of apoptotic process (GO:0043066)|negative regulation of hydrolase activity (GO:0051346)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of peptidyl-tyrosine phosphorylation (GO:0050732)|negative regulation of protein complex assembly (GO:0031333)|neuron projection extension (GO:1990138)|peptidyl-serine phosphorylation (GO:0018105)|platelet activation (GO:0030168)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of glucose import (GO:0046326)|positive regulation of insulin receptor signaling pathway (GO:0046628)|positive regulation of interleukin-10 secretion (GO:2001181)|positive regulation of interleukin-13 secretion (GO:2000667)|positive regulation of interleukin-4 production (GO:0032753)|positive regulation of interleukin-5 secretion (GO:2000664)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of T-helper 2 cell cytokine production (GO:2000553)|positive regulation of T-helper 2 cell differentiation (GO:0045630)|protein heterooligomerization (GO:0051291)|protein kinase C signaling (GO:0070528)|protein localization to plasma membrane (GO:0072659)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)|transforming growth factor beta receptor signaling pathway (GO:0007179)|vesicle transport along microtubule (GO:0047496)	apical cortex (GO:0045179)|apical plasma membrane (GO:0016324)|axon hillock (GO:0043203)|cell junction (GO:0030054)|cell leading edge (GO:0031252)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|membrane raft (GO:0045121)|microtubule organizing center (GO:0005815)|myelin sheath abaxonal region (GO:0035748)|nuclear envelope (GO:0005635)|nuclear matrix (GO:0016363)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|tight junction (GO:0005923)	ATP binding (GO:0005524)|insulin receptor substrate binding (GO:0043560)|potassium channel regulator activity (GO:0015459)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(4)|endometrium(1)|large_intestine(5)|lung(5)|stomach(1)	18	all_cancers(77;0.000177)|all_epithelial(69;6.41e-05)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;1.14e-19)|all_lung(118;1.22e-08)|Lung NSC(185;1.24e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Medulloblastoma(700;0.123)|Lung SC(97;0.128)		Epithelial(90;2.96e-37)|OV - Ovarian serous cystadenocarcinoma(86;3.3e-23)|GBM - Glioblastoma multiforme(42;2.85e-08)|Colorectal(212;6.15e-05)|COAD - Colon adenocarcinoma(227;0.000241)|Kidney(185;0.00294)|BRCA - Breast invasive adenocarcinoma(365;0.00493)|STAD - Stomach adenocarcinoma(132;0.00669)|KIRC - Kidney renal clear cell carcinoma(229;0.0411)|Lung(427;0.213)	Tamoxifen(DB00675)	AGAGAAGCACGTGTTTGAGCA	0.507																																																	0													184.0	168.0	174.0					1																	2087464		2203	4300	6503	SO:0001583	missense	0			BC014270	CCDS37.1, CCDS41229.1, CCDS55563.1	1p36.33-p36.2	2009-07-10			ENSG00000067606	ENSG00000067606	2.7.11.1		9412	protein-coding gene	gene with protein product		176982					Standard	NM_001242874		Approved	PKC2	uc001aiq.3	Q05513	OTTHUMG00000001238	ENST00000400921.2:c.358G>T	1.37:g.2087464G>T	ENSP00000383712:p.Val120Leu		A8K4N0|A8MU64|B7Z2J7|E9PCW2|Q15207|Q5SYT5|Q969S4	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_OPR_PB1,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_Pkinase_C,superfamily_Kinase-like_dom,smart_OPR_PB1,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pirsf_PKC_zeta,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_dom,prints_DAG/PE-bd	p.V303L	ENST00000400921.2	37	c.907	CCDS41229.1	1	.	.	.	.	.	.	.	.	.	.	g	27.4	4.825079	0.90955	.	.	ENSG00000067606	ENST00000378567;ENST00000400921;ENST00000461106;ENST00000400920;ENST00000486681	T;T;T;T;T	0.65178	-0.14;-0.14;-0.14;-0.14;-0.14	4.35	4.35	0.52113	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.68284	0.2984	L	0.28274	0.84	0.80722	D	1	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.70935	0.971;0.971;0.971	T	0.73372	-0.4003	10	0.87932	D	0	.	16.4442	0.83910	0.0:0.0:1.0:0.0	.	199;127;303	E9PCW2;B3KUN5;Q05513	.;.;KPCZ_HUMAN	L	303;120;199;120;116	ENSP00000367830:V303L;ENSP00000383712:V120L;ENSP00000426412:V199L;ENSP00000383711:V120L;ENSP00000424763:V116L	ENSP00000367830:V303L	V	+	1	0	PRKCZ	2077324	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	8.964000	0.93389	2.424000	0.82194	0.437000	0.28790	GTG	PRKCZ	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_PKC_zeta,pfscan_Prot_kinase_dom	ENSG00000067606		0.507	PRKCZ-009	KNOWN	basic|CCDS	protein_coding	PRKCZ	HGNC	protein_coding	OTTHUMT00000098533.3		0.00	54	0	G	NM_002744		2087464	+1			no_errors	ENST00000378567	ensembl	human	known	74_37	missense	5.66	50	3	SNP	1.000	T
PRKD1	5587	genome.wustl.edu	37	14	30068314	30068314	+	Silent	SNP	C	C	T			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr14:30068314C>T	ENST00000331968.5	-	15	2314	c.2085G>A	c.(2083-2085)cgG>cgA	p.R695R	PRKD1_ENST00000415220.2_Silent_p.R703R	NM_002742.2	NP_002733.2	Q15139	KPCD1_HUMAN	protein kinase D1	695	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|cellular response to oxidative stress (GO:0034599)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|Golgi organization (GO:0007030)|Golgi vesicle transport (GO:0048193)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|intracellular signal transduction (GO:0035556)|negative regulation of cell death (GO:0060548)|negative regulation of endocytosis (GO:0045806)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of endothelial cell chemotaxis (GO:2001028)|positive regulation of endothelial cell chemotaxis by VEGF-activated vascular endothelial growth factor receptor signaling pathway (GO:0038033)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of histone deacetylase activity (GO:1901727)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of neuron projection development (GO:0010976)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein autophosphorylation (GO:0046777)|regulation of integrin-mediated signaling pathway (GO:2001044)|regulation of keratinocyte proliferation (GO:0010837)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cell cortex (GO:0005938)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(21)|lung(32)|ovary(2)|prostate(1)|skin(4)|urinary_tract(2)	78	Hepatocellular(127;0.0604)		LUAD - Lung adenocarcinoma(48;0.00527)|Lung(238;0.0252)	GBM - Glioblastoma multiforme(265;0.00888)		AATGAAGGTGCCGCAAAGCCA	0.368																																																	0													99.0	98.0	98.0					14																	30068314		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS9637.1	14q11	2013-01-10	2004-10-28	2004-10-30	ENSG00000184304	ENSG00000184304	2.7.11.1	"""Pleckstrin homology (PH) domain containing"""	9407	protein-coding gene	gene with protein product		605435	"""protein kinase C, mu"""	PRKCM		8119958, 10965134	Standard	NM_002742		Approved	PKCM, PKD, PKC-mu	uc001wqh.3	Q15139	OTTHUMG00000140203	ENST00000331968.5:c.2085G>A	14.37:g.30068314C>T			A6NL64|B2RAF6	Silent	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_Pleckstrin_homology,superfamily_Kinase-like_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Pleckstrin_homology,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Pleckstrin_homology,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_dom,prints_DAG/PE-bd	p.R695	ENST00000331968.5	37	c.2085	CCDS9637.1	14																																																																																			PRKD1	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000184304		0.368	PRKD1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PRKD1	HGNC	protein_coding	OTTHUMT00000276611.2		0.00	40	0	C	NM_002742		30068314	-1			no_errors	ENST00000331968	ensembl	human	known	74_37	silent	6.45	29	2	SNP	0.218	T
PRKG1	5592	genome.wustl.edu	37	10	53841384	53841384	+	Intron	DEL	A	A	-			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr10:53841384delA	ENST00000401604.2	+	7	1084				PRKG1_ENST00000373980.4_Intron|PRKG1_ENST00000373975.2_Frame_Shift_Del_p.Q4fs|PRKG1_ENST00000373985.1_Intron			Q13976	KGP1_HUMAN	protein kinase, cGMP-dependent, type I						actin cytoskeleton organization (GO:0030036)|blood coagulation (GO:0007596)|cGMP-mediated signaling (GO:0019934)|dendrite development (GO:0016358)|forebrain development (GO:0030900)|negative regulation of platelet aggregation (GO:0090331)|neuron migration (GO:0001764)|protein phosphorylation (GO:0006468)|regulation of GTPase activity (GO:0043087)|relaxation of vascular smooth muscle (GO:0060087)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium channel regulator activity (GO:0005246)|cGMP binding (GO:0030553)|cGMP-dependent protein kinase activity (GO:0004692)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(23)|ovary(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	53		all_cancers(4;2.13e-08)|all_epithelial(4;2.44e-08)|all_lung(4;0.000173)		all cancers(4;1.18e-05)|GBM - Glioblastoma multiforme(4;0.000359)|Epithelial(53;0.00532)|Lung(62;0.0606)		atggagaagcaaaacatgttt	0.353																																																	0																																										SO:0001627	intron_variant	0				CCDS7244.1	10q11.2	2009-07-10			ENSG00000185532	ENSG00000185532	2.7.11.1		9414	protein-coding gene	gene with protein product		176894		PRKGR1B, PRKG1B		2792381, 1544322	Standard	NM_001098512		Approved	PGK, PKG	uc001jjo.3	Q13976	OTTHUMG00000018248	ENST00000401604.2:c.890+18993A>-	10.37:g.53841384delA			A5YM56|B3KSF3|E2PU10|P14619|Q5JP05|Q5JSJ6|Q6P5T7	Frame_Shift_Del	DEL	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_cNMP-bd-like,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pfscan_cNMP-bd_dom,pfscan_Prot_kinase_dom,prints_cGMP_dep_kinase,prints_Ser-Thr/Tyr_kinase_cat_dom	p.N5fs	ENST00000401604.2	37	c.11	CCDS44399.1	10																																																																																			PRKG1	-	pfscan_cNMP-bd_dom	ENSG00000185532		0.353	PRKG1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKG1	HGNC	protein_coding			0.00	23	0	A			53841384	+1	tier1		no_errors	ENST00000373975	ensembl	human	putative	74_37	frame_shift_del	6.06	31	2	DEL	0.020	-
PRKG2	5593	genome.wustl.edu	37	4	82126024	82126024	+	Nonsense_Mutation	SNP	T	T	A			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr4:82126024T>A	ENST00000395578.1	-	2	294	c.178A>T	c.(178-180)Aag>Tag	p.K60*	PRKG2_ENST00000264399.1_Nonsense_Mutation_p.K60*|PRKG2_ENST00000418486.2_Nonsense_Mutation_p.K60*			Q13237	KGP2_HUMAN	protein kinase, cGMP-dependent, type II	60					blood coagulation (GO:0007596)|circadian regulation of gene expression (GO:0032922)|nitric oxide metabolic process (GO:0046209)|protein phosphorylation (GO:0006468)|regulation of nitric-oxide synthase activity (GO:0050999)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cGMP binding (GO:0030553)|cGMP-dependent protein kinase activity (GO:0004692)|protein kinase activity (GO:0004672)			NS(1)|breast(4)|central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(7)|lung(14)|ovary(1)|skin(2)	37						ACAGTCTGCTTCGACAGCTGC	0.562																																																	0													111.0	109.0	110.0					4																	82126024		2203	4300	6503	SO:0001587	stop_gained	0			X94612	CCDS3589.1, CCDS75150.1	4q13.1-q21.1	2009-07-10			ENSG00000138669	ENSG00000138669	2.7.11.1		9416	protein-coding gene	gene with protein product		601591				7498513	Standard	XM_005263126		Approved	cGKII, PRKGR2	uc003hmh.2	Q13237	OTTHUMG00000130296	ENST00000395578.1:c.178A>T	4.37:g.82126024T>A	ENSP00000378945:p.Lys60*		B4DMX3|E7EPE6|O00125|O60916	Nonsense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_cNMP-bd_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pirsf_cGMP-dependent_protein_kinase,pfscan_cNMP-bd_dom,pfscan_Prot_kinase_dom,prints_cGMP_dep_kinase,prints_cAMP/cGMP_kin	p.K60*	ENST00000395578.1	37	c.178	CCDS3589.1	4	.	.	.	.	.	.	.	.	.	.	T	38	7.263865	0.98171	.	.	ENSG00000138669	ENST00000395578;ENST00000264399;ENST00000418486	.	.	.	5.34	5.34	0.76211	.	0.374882	0.30979	N	0.008485	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.05833	T	0.94	-14.9826	10.5978	0.45349	0.0:0.0766:0.0:0.9234	.	.	.	.	X	60	.	ENSP00000264399:K60X	K	-	1	0	PRKG2	82345048	0.991000	0.36638	0.791000	0.31998	0.934000	0.57294	2.211000	0.42825	2.244000	0.73946	0.477000	0.44152	AAG	PRKG2	-	pirsf_cGMP-dependent_protein_kinase	ENSG00000138669		0.562	PRKG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKG2	HGNC	protein_coding	OTTHUMT00000252639.1	-	0.00	30	0	T	NM_006259		82126024	-1	tier1	-	no_errors	ENST00000264399	ensembl	human	known	74_37	nonsense	66.67	5	10	SNP	0.871	A
PRLHR	2834	genome.wustl.edu	37	10	120354100	120354100	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr10:120354100C>A	ENST00000369169.1	-	1	656	c.657G>T	c.(655-657)gaG>gaT	p.E219D	PRLHR_ENST00000239032.2_Missense_Mutation_p.E219D			P49683	PRLHR_HUMAN	prolactin releasing hormone receptor	219					feeding behavior (GO:0007631)|female pregnancy (GO:0007565)|G-protein coupled receptor signaling pathway (GO:0007186)|hormone metabolic process (GO:0042445)|neuropeptide signaling pathway (GO:0007218)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|neuropeptide receptor activity (GO:0008188)|neuropeptide Y receptor activity (GO:0004983)			large_intestine(2)|lung(8)|ovary(1)|skin(1)	12		Colorectal(252;0.0429)|Lung NSC(174;0.142)|all_lung(145;0.175)		all cancers(201;0.0166)		GGCGCTGGCGCTCCTGGGAGC	0.677																																																	0													10.0	9.0	9.0					10																	120354100		2161	4231	6392	SO:0001583	missense	0			AB048946	CCDS7606.1	10q25.3-q26	2014-02-21	2005-11-24	2005-11-24	ENSG00000119973	ENSG00000119973		"""GPCR / Class A : RF amide peptide receptors"""	4464	protein-coding gene	gene with protein product		600895	"""G protein-coupled receptor 10"""	GPR10		8666380, 15885496	Standard	NM_004248		Approved	PrRPR	uc001ldp.1	P49683	OTTHUMG00000019136	ENST00000369169.1:c.657G>T	10.37:g.120354100C>A	ENSP00000358167:p.Glu219Asp		O75194|Q502U8|Q5VXR9	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Prolrel_pep_rcpt,prints_GPCR_Rhodpsn,prints_NPY_rcpt	p.E219D	ENST00000369169.1	37	c.657	CCDS7606.1	10	.	.	.	.	.	.	.	.	.	.	C	12.09	1.835098	0.32421	.	.	ENSG00000119973	ENST00000239032;ENST00000369169	T;T	0.36699	1.24;1.24	4.8	0.763	0.18459	GPCR, rhodopsin-like superfamily (1);	0.118966	0.53938	D	0.000042	T	0.39064	0.1064	L	0.40543	1.245	0.37801	D	0.927702	D	0.71674	0.998	D	0.71656	0.974	T	0.38329	-0.9666	10	0.19147	T	0.46	.	4.9268	0.13898	0.1438:0.5065:0.0:0.3497	.	219	P49683	PRLHR_HUMAN	D	219	ENSP00000239032:E219D;ENSP00000358167:E219D	ENSP00000239032:E219D	E	-	3	2	PRLHR	120344090	0.630000	0.27155	0.999000	0.59377	0.494000	0.33585	0.151000	0.16283	0.245000	0.21373	-0.181000	0.13052	GAG	PRLHR	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Prolrel_pep_rcpt	ENSG00000119973		0.677	PRLHR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRLHR	HGNC	protein_coding	OTTHUMT00000050610.1	-	0.00	28	0	C	NM_004248		120354100	-1	tier1	-	no_errors	ENST00000239032	ensembl	human	known	74_37	missense	69.77	13	30	SNP	0.995	A
PRPS1	5631	genome.wustl.edu	37	X	106885630	106885630	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chrX:106885630C>T	ENST00000372435.4	+	4	562	c.440C>T	c.(439-441)gCa>gTa	p.A147V	PRPS1_ENST00000543248.1_Missense_Mutation_p.A147V|PRPS1_ENST00000372428.4_Missense_Mutation_p.A80V|PRPS1_ENST00000372418.1_Missense_Mutation_p.A47V	NM_002764.3	NP_002755.1	P60891	PRPS1_HUMAN	phosphoribosyl pyrophosphate synthetase 1	147					5-phosphoribose 1-diphosphate biosynthetic process (GO:0006015)|carbohydrate metabolic process (GO:0005975)|cell death (GO:0008219)|hypoxanthine biosynthetic process (GO:0046101)|nervous system development (GO:0007399)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide biosynthetic process (GO:0006164)|pyrimidine nucleotide biosynthetic process (GO:0006221)|ribonucleoside monophosphate biosynthetic process (GO:0009156)|small molecule metabolic process (GO:0044281)|urate biosynthetic process (GO:0034418)	cytosol (GO:0005829)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|magnesium ion binding (GO:0000287)|protein homodimerization activity (GO:0042803)|ribose phosphate diphosphokinase activity (GO:0004749)			breast(3)|endometrium(2)|kidney(3)|large_intestine(3)|lung(11)|upper_aerodigestive_tract(1)	23						AATTTGTATGCAGAGCCGGCT	0.433																																																	0													117.0	103.0	107.0					X																	106885630		2203	4300	6503	SO:0001583	missense	0			X15331	CCDS14529.1, CCDS76007.1	Xq22.3	2014-09-17			ENSG00000147224	ENSG00000147224	2.7.6.1		9462	protein-coding gene	gene with protein product	"""PRS I"", ""ribose-phosphate diphosphokinase 1"""	311850	"""deafness, X-linked 2, perceptive, congenital"""	DFN2		1962753, 20021999	Standard	NM_002764		Approved	CMTX5, DFNX1	uc004ene.4	P60891	OTTHUMG00000022167	ENST00000372435.4:c.440C>T	X.37:g.106885630C>T	ENSP00000361512:p.Ala147Val		B1ALA8|B2R6T7|B4DNL6|D3DUX6|P09329	Missense_Mutation	SNP	pfam_PRibTrfase_dom,tigrfam_Rib-P_diPkinase	p.A147V	ENST00000372435.4	37	c.440	CCDS14529.1	X	.	.	.	.	.	.	.	.	.	.	C	18.25	3.583538	0.65992	.	.	ENSG00000147224	ENST00000372435;ENST00000372428;ENST00000543248;ENST00000372418	D;D;D;D	0.91996	-2.95;-2.95;-2.95;-2.89	4.51	4.51	0.55191	.	0.052323	0.85682	N	0.000000	D	0.92854	0.7727	M	0.91140	3.18	0.80722	D	1	P;P	0.34562	0.457;0.457	B;B	0.27380	0.079;0.079	D	0.94042	0.7310	10	0.87932	D	0	.	16.0202	0.80478	0.0:1.0:0.0:0.0	.	147;147	Q53FW2;P60891	.;PRPS1_HUMAN	V	147;80;147;47	ENSP00000361512:A147V;ENSP00000361505:A80V;ENSP00000443185:A147V;ENSP00000361495:A47V	ENSP00000361495:A47V	A	+	2	0	PRPS1	106772286	1.000000	0.71417	0.997000	0.53966	0.988000	0.76386	7.395000	0.79876	2.174000	0.68829	0.544000	0.68410	GCA	PRPS1	-	tigrfam_Rib-P_diPkinase	ENSG00000147224		0.433	PRPS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRPS1	HGNC	protein_coding	OTTHUMT00000057840.1	-	0.00	34	0	C			106885630	+1	tier1	-	no_errors	ENST00000372435	ensembl	human	known	74_37	missense	7.27	51	4	SNP	1.000	T
PSME1	5720	genome.wustl.edu	37	14	24607555	24607555	+	Splice_Site	SNP	T	T	C			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr14:24607555T>C	ENST00000206451.6	+	9	634	c.529T>C	c.(529-531)Tat>Cat	p.Y177H	RP11-468E2.5_ENST00000558478.1_lincRNA|PSME1_ENST00000561435.1_Splice_Site_p.Y177H|PSME1_ENST00000559123.1_Splice_Site_p.Y18H|PSME1_ENST00000382708.3_Splice_Site_p.Y177H|EMC9_ENST00000558200.1_5'Flank	NM_001281528.1|NM_006263.2	NP_001268457.1|NP_006254.1	Q06323	PSME1_HUMAN	proteasome (prosome, macropain) activator subunit 1 (PA28 alpha)	177					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|proteasome activator complex (GO:0008537)|proteasome complex (GO:0000502)	endopeptidase activator activity (GO:0061133)			endometrium(1)|kidney(1)|large_intestine(1)|lung(1)|ovary(2)|prostate(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	11				GBM - Glioblastoma multiforme(265;0.00831)		CTTCCACAGGTATTTCTCTGA	0.512																																																	0													286.0	295.0	292.0					14																	24607555		2203	4300	6503	SO:0001630	splice_region_variant	0				CCDS9612.1, CCDS41930.1, CCDS61415.1	14q11.2	2008-08-29			ENSG00000092010	ENSG00000092010		"""Proteasome (prosome, macropain) subunits"""	9568	protein-coding gene	gene with protein product		600654				8269930	Standard	NM_006263		Approved	IFI5111, PA28alpha	uc001wmh.3	Q06323	OTTHUMG00000028795	ENST00000206451.6:c.528-1T>C	14.37:g.24607555T>C			A6NJG9|H0YNE3|Q6IBM2|Q9UEF4	Missense_Mutation	SNP	pfam_Proteasome_activ_pa28_C,pfam_Proteasome_activ_pa28_N,superfamily_Proteasome_activ_pa28	p.Y177H	ENST00000206451.6	37	c.529	CCDS9612.1	14	.	.	.	.	.	.	.	.	.	.	t	21.2	4.105865	0.77096	.	.	ENSG00000092010	ENST00000206451;ENST00000382708	T;T	0.64438	-0.1;-0.1	5.3	5.3	0.74995	Proteasome activator pa28, REG beta subunit (2);	0.000000	0.85682	D	0.000000	T	0.80449	0.4625	M	0.85299	2.745	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.83699	0.0181	10	0.87932	D	0	-7.4956	13.2337	0.59957	0.0:0.0:0.0:1.0	.	177;177	A6NJG9;Q06323	.;PSME1_HUMAN	H	177	ENSP00000206451:Y177H;ENSP00000372155:Y177H	ENSP00000206451:Y177H	Y	+	1	0	PSME1	23677395	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.766000	0.62279	2.225000	0.72522	0.460000	0.39030	TAT	PSME1	-	pfam_Proteasome_activ_pa28_C,superfamily_Proteasome_activ_pa28	ENSG00000092010		0.512	PSME1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSME1	HGNC	protein_coding	OTTHUMT00000071910.2	-	0.00	45	0	T	NM_006263	Missense_Mutation	24607555	+1	tier1	-	no_errors	ENST00000382708	ensembl	human	known	74_37	missense	50.00	13	13	SNP	1.000	C
PTPN21	11099	genome.wustl.edu	37	14	88945583	88945583	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr14:88945583C>T	ENST00000556564.1	-	13	2476	c.2192G>A	c.(2191-2193)cGt>cAt	p.R731H	PTPN21_ENST00000328736.3_Missense_Mutation_p.R731H	NM_007039.3	NP_008970.2	Q16825	PTN21_HUMAN	protein tyrosine phosphatase, non-receptor type 21	731					peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	protein tyrosine phosphatase activity (GO:0004725)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(13)|liver(1)|lung(7)|ovary(4)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	45						CTCGCGCGCACGTGCAGGAGG	0.716																																																	0													22.0	23.0	23.0					14																	88945583		2199	4293	6492	SO:0001583	missense	0			X79510	CCDS9884.1	14q31	2011-06-09				ENSG00000070778		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9651	protein-coding gene	gene with protein product		603271				7519780	Standard	NM_007039		Approved	PTPD1, PTPRL10	uc001xwv.4	Q16825		ENST00000556564.1:c.2192G>A	14.37:g.88945583C>T	ENSP00000452414:p.Arg731His			Missense_Mutation	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_FERM_central,pfam_FERM_N,pfam_FERM_PH-like_C,superfamily_FERM_central,smart_Band_41_domain,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pirsf_Tyr_Pase_non-rcpt_typ-14/21,pfscan_FERM_domain,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt,prints_Band_41_fam	p.R731H	ENST00000556564.1	37	c.2192	CCDS9884.1	14	.	.	.	.	.	.	.	.	.	.	C	7.495	0.651406	0.14516	.	.	ENSG00000070778	ENST00000328736;ENST00000556564	T;T	0.72725	-0.68;-0.68	3.91	0.34	0.15985	.	0.570987	0.17321	N	0.178507	T	0.50103	0.1596	L	0.36672	1.1	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.15093	-1.0449	10	0.20046	T	0.44	.	2.441	0.04494	0.2241:0.2559:0.4037:0.1164	.	731	Q16825	PTN21_HUMAN	H	731	ENSP00000330276:R731H;ENSP00000452414:R731H	ENSP00000330276:R731H	R	-	2	0	PTPN21	88015336	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.715000	0.04997	0.615000	0.30124	0.467000	0.42956	CGT	PTPN21	-	pirsf_Tyr_Pase_non-rcpt_typ-14/21	ENSG00000070778		0.716	PTPN21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPN21	HGNC	protein_coding	OTTHUMT00000410303.1	-	0.00	52	0	C			88945583	-1	tier1	-	no_errors	ENST00000328736	ensembl	human	known	74_37	missense	59.46	15	22	SNP	0.000	T
PTPN23	25930	genome.wustl.edu	37	3	47453615	47453615	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr3:47453615C>T	ENST00000265562.4	+	22	4182	c.4105C>T	c.(4105-4107)Cgc>Tgc	p.R1369C	PTPN23_ENST00000431726.1_Missense_Mutation_p.R1243C	NM_015466.2	NP_056281.1	Q9H3S7	PTN23_HUMAN	protein tyrosine phosphatase, non-receptor type 23	1369	Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.				cilium morphogenesis (GO:0060271)|negative regulation of epithelial cell migration (GO:0010633)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of adherens junction organization (GO:1903393)|positive regulation of early endosome to late endosome transport (GO:2000643)|positive regulation of homophilic cell adhesion (GO:1903387)|protein transport (GO:0015031)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)	ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)	p.R1369S(1)		breast(3)|central_nervous_system(1)|large_intestine(5)|lung(7)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	23				BRCA - Breast invasive adenocarcinoma(193;0.000271)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		CAACTTGCTGCGCTTCATCCA	0.637																																																	1	Substitution - Missense(1)	lung(1)											48.0	46.0	47.0					3																	47453615		2202	4300	6502	SO:0001583	missense	0			AB025194	CCDS2754.1	3p21.3	2011-06-09			ENSG00000076201	ENSG00000076201		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	14406	protein-coding gene	gene with protein product		606584				11095967	Standard	NM_015466		Approved	DKFZP564F0923, KIAA1471, HD-PTP	uc003crf.1	Q9H3S7	OTTHUMG00000133520	ENST00000265562.4:c.4105C>T	3.37:g.47453615C>T	ENSP00000265562:p.Arg1369Cys		A8K0D7|Q7KZF8|Q8N6Z5|Q9BSR5|Q9P257|Q9UG03|Q9UMZ4	Missense_Mutation	SNP	pfam_BRO1_dom,pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_BRO1_dom,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt	p.R1369C	ENST00000265562.4	37	c.4105	CCDS2754.1	3	.	.	.	.	.	.	.	.	.	.	c	15.19	2.761225	0.49468	.	.	ENSG00000076201	ENST00000265562	T	0.14893	2.47	4.43	2.63	0.31362	Protein-tyrosine phosphatase, receptor/non-receptor type (3);Protein-tyrosine/Dual-specificity phosphatase (1);	0.433127	0.21187	N	0.078717	T	0.18130	0.0435	M	0.71581	2.175	0.37828	D	0.928607	B	0.13594	0.008	B	0.12837	0.008	T	0.06215	-1.0839	10	0.72032	D	0.01	-2.7526	5.4511	0.16565	0.1579:0.6679:0.0:0.1742	.	1369	Q9H3S7	PTN23_HUMAN	C	1369	ENSP00000265562:R1369C	ENSP00000265562:R1369C	R	+	1	0	PTPN23	47428619	0.999000	0.42202	0.994000	0.49952	0.683000	0.39861	2.693000	0.47027	0.428000	0.26173	-0.213000	0.12676	CGC	PTPN23	-	pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt	ENSG00000076201		0.637	PTPN23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPN23	HGNC	protein_coding	OTTHUMT00000257492.2		0.00	26	0	C	NM_015466		47453615	+1			no_errors	ENST00000265562	ensembl	human	known	74_37	missense	13.33	13	2	SNP	1.000	T
RAB35	11021	genome.wustl.edu	37	12	120541663	120541663	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr12:120541663G>A	ENST00000229340.5	-	3	382	c.194C>T	c.(193-195)gCg>gTg	p.A65V	RAB35_ENST00000534951.1_Missense_Mutation_p.A65V	NM_001167606.1|NM_006861.6	NP_001161078.1|NP_006852.1	Q15286	RAB35_HUMAN	RAB35, member RAS oncogene family	65					antigen processing and presentation (GO:0019882)|cellular response to nerve growth factor stimulus (GO:1990090)|cytokinesis (GO:0000910)|endosomal transport (GO:0016197)|GTP catabolic process (GO:0006184)|neuron projection development (GO:0031175)|plasma membrane to endosome transport (GO:0048227)|protein localization (GO:0008104)|protein localization to endosome (GO:0036010)|protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)	cell projection membrane (GO:0031253)|clathrin-coated endocytic vesicle (GO:0045334)|coated pit (GO:0005905)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|intercellular bridge (GO:0045171)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)			endometrium(1)|ovary(1)	2	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.248)		CTCCTGCCCCGCTGTGTCCCA	0.617																																																	0													118.0	139.0	132.0					12																	120541663		2203	4300	6503	SO:0001583	missense	0			X79781	CCDS41846.1, CCDS53836.1	12q24	2008-07-28			ENSG00000111737	ENSG00000111737		"""RAB, member RAS oncogene"""	9774	protein-coding gene	gene with protein product		604199					Standard	NM_001167606		Approved	H-ray	uc009zww.2	Q15286	OTTHUMG00000169159	ENST00000229340.5:c.194C>T	12.37:g.120541663G>A	ENSP00000229340:p.Ala65Val		B2R6E0|B4E390	Missense_Mutation	SNP	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_EF_GTP-bd_dom,pfam_Gtr1_RagA,superfamily_P-loop_NTPase,smart_Small_GTPase_ARF,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.A65V	ENST00000229340.5	37	c.194	CCDS41846.1	12	.	.	.	.	.	.	.	.	.	.	G	33	5.243353	0.95272	.	.	ENSG00000111737	ENST00000229340;ENST00000427416;ENST00000534951;ENST00000538903	D;D;D	0.88818	-2.43;-2.43;-2.43	5.93	5.04	0.67666	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.96408	0.8828	H	0.96604	3.85	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.97704	1.0186	10	0.87932	D	0	.	15.1511	0.72700	0.0674:0.0:0.9326:0.0	.	65;65	B4E390;Q15286	.;RAB35_HUMAN	V	65	ENSP00000229340:A65V;ENSP00000441883:A65V;ENSP00000443994:A65V	ENSP00000229340:A65V	A	-	2	0	RAB35	119026046	1.000000	0.71417	0.095000	0.20976	0.950000	0.60333	9.865000	0.99609	1.534000	0.49203	-0.141000	0.14075	GCG	RAB35	-	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_EF_GTP-bd_dom,pfam_Gtr1_RagA,superfamily_P-loop_NTPase,smart_Small_GTPase_ARF,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	ENSG00000111737		0.617	RAB35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAB35	HGNC	protein_coding	OTTHUMT00000402599.2	-	0.00	41	0	G			120541663	-1	tier1	-	no_errors	ENST00000229340	ensembl	human	known	74_37	missense	8.51	43	4	SNP	0.999	A
RASAL3	64926	genome.wustl.edu	37	19	15571892	15571892	+	Silent	SNP	G	G	T			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr19:15571892G>T	ENST00000343625.7	-	5	670	c.585C>A	c.(583-585)ccC>ccA	p.P195P	RASAL3_ENST00000608577.1_5'Flank	NM_022904.1	NP_075055.1	Q86YV0	RASL3_HUMAN	RAS protein activator like 3	195					negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of Ras GTPase activity (GO:0032320)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|membrane (GO:0016020)	Ras GTPase activator activity (GO:0005099)			breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(10)|skin(1)	18						GGACCTGGTTGGGACCAGCAG	0.577																																																	0													57.0	57.0	57.0					19																	15571892		1926	4124	6050	SO:0001819	synonymous_variant	0				CCDS46006.1	19p13.12	2008-12-18			ENSG00000105122	ENSG00000105122			26129	protein-coding gene	gene with protein product						12477932	Standard	NM_022904		Approved	FLJ21438	uc002nbe.2	Q86YV0		ENST00000343625.7:c.585C>A	19.37:g.15571892G>T			Q8N2T9|Q9H735	Silent	SNP	pfam_RasGAP,superfamily_Rho_GTPase_activation_prot,superfamily_C2_dom,smart_RasGAP,pfscan_RasGAP	p.P195	ENST00000343625.7	37	c.585	CCDS46006.1	19																																																																																			RASAL3	-	NULL	ENSG00000105122		0.577	RASAL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RASAL3	HGNC	protein_coding	OTTHUMT00000461331.3		0.00	66	0	G	NM_022904		15571892	-1			no_errors	ENST00000343625	ensembl	human	known	74_37	silent	8.16	45	4	SNP	0.986	T
RBMXL2	27288	genome.wustl.edu	37	11	7111369	7111369	+	Nonsense_Mutation	SNP	C	C	T			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr11:7111369C>T	ENST00000306904.5	+	1	1205	c.1018C>T	c.(1018-1020)Cga>Tga	p.R340*		NM_014469.4	NP_055284.3	O75526	RMXL2_HUMAN	RNA binding motif protein, X-linked-like 2	340	Arg/Gly/Pro-rich.					nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			NS(1)|breast(1)|endometrium(2)|large_intestine(2)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	15				Epithelial(150;5.14e-08)|BRCA - Breast invasive adenocarcinoma(625;0.189)		CTCGAGGGGCCGACACCGGGT	0.662																																																	0													21.0	22.0	22.0					11																	7111369		2200	4296	6496	SO:0001587	stop_gained	0			AF069682	CCDS7777.1	11p15	2013-07-16				ENSG00000170748		"""RNA binding motif (RRM) containing"""	17886	protein-coding gene	gene with protein product	"""heterogeneous nuclear ribonucleoprotein G T"""	605444				10958650	Standard	NM_014469		Approved	HNRNPG-T, HNRPGT	uc001mfc.2	O75526		ENST00000306904.5:c.1018C>T	11.37:g.7111369C>T	ENSP00000304139:p.Arg340*		Q6PEZ2|Q9NQU0	Nonsense_Mutation	SNP	pfam_RRM_dom,pfam_RBM1CTR,smart_RRM_dom_euk,smart_RRM_dom,pfscan_RRM_dom	p.R340*	ENST00000306904.5	37	c.1018	CCDS7777.1	11	.	.	.	.	.	.	.	.	.	.	C	37	6.426066	0.97559	.	.	ENSG00000170748	ENST00000306904	.	.	.	3.73	3.73	0.42828	.	0.000000	0.85682	U	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.8214	0.63322	0.0:1.0:0.0:0.0	.	.	.	.	X	340	.	ENSP00000304139:R340X	R	+	1	2	RBMXL2	7067945	1.000000	0.71417	0.999000	0.59377	0.847000	0.48162	6.945000	0.75947	2.365000	0.80145	0.563000	0.77884	CGA	RBMXL2	-	NULL	ENSG00000170748		0.662	RBMXL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBMXL2	HGNC	protein_coding	OTTHUMT00000384552.1	-	0.00	35	0	C	NM_014469		7111369	+1	tier1	-	no_errors	ENST00000306904	ensembl	human	known	74_37	nonsense	44.68	26	21	SNP	1.000	T
REV1	51455	genome.wustl.edu	37	2	100021024	100021024	+	Silent	SNP	G	G	A			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr2:100021024G>A	ENST00000258428.3	-	18	3156	c.2928C>T	c.(2926-2928)ggC>ggT	p.G976G	RP11-527J8.1_ENST00000608144.1_RNA|REV1_ENST00000393445.3_Silent_p.G975G|REV1_ENST00000465835.1_5'UTR	NM_001037872.1|NM_016316.2	NP_001032961.1|NP_057400.1	Q9UBZ9	REV1_HUMAN	REV1, polymerase (DNA directed)	976					DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA-dependent DNA replication (GO:0006261)|error-prone translesion synthesis (GO:0042276)|response to UV (GO:0009411)	nucleoplasm (GO:0005654)	damaged DNA binding (GO:0003684)|deoxycytidyl transferase activity (GO:0017125)|DNA-directed DNA polymerase activity (GO:0003887)|magnesium ion binding (GO:0000287)	p.G976G(1)		NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(14)|lung(12)|ovary(2)|prostate(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						CTGTATTACAGCCATTTACTG	0.448								Direct reversal of damage																																									1	Substitution - coding silent(1)	large_intestine(1)											200.0	186.0	191.0					2																	100021024		2203	4300	6503	SO:0001819	synonymous_variant	0			AF206019	CCDS2045.1, CCDS42722.1	2q11.1-q11.2	2012-05-18	2012-05-18	2006-11-07	ENSG00000135945	ENSG00000135945		"""DNA polymerases"""	14060	protein-coding gene	gene with protein product		606134	"""REV1 (yeast homolog)- like"", ""REV1-like (yeast)"", ""REV1 homolog (S. cerevisiae)"""	REV1L		10536157	Standard	XM_005263968		Approved		uc002tad.3	Q9UBZ9	OTTHUMG00000130636	ENST00000258428.3:c.2928C>T	2.37:g.100021024G>A			O95941|Q53SI7|Q9C0J4|Q9NUP2	Silent	SNP	pfam_DNA_repair_prot_UmuC-like,pfam_DNA_pol_Y-fam_little_finger,pfam_BRCT_dom,superfamily_BRCT_dom,superfamily_DNA_pol_Y-fam_little_finger,smart_BRCT_dom,pirsf_REV1,pfscan_BRCT_dom,pfscan_DNA_repair_prot_UmuC-like_N	p.G976	ENST00000258428.3	37	c.2928	CCDS2045.1	2																																																																																			REV1	-	pirsf_REV1	ENSG00000135945		0.448	REV1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	REV1	HGNC	protein_coding	OTTHUMT00000253123.2		0.00	75	0	G	NM_016316		100021024	-1			no_errors	ENST00000258428	ensembl	human	known	74_37	silent	5.36	53	3	SNP	0.988	A
RHOU	58480	genome.wustl.edu	37	1	228879482	228879482	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr1:228879482G>A	ENST00000366691.3	+	3	1438	c.772G>A	c.(772-774)Gta>Ata	p.V258I		NM_021205.5	NP_067028.1			ras homolog family member U									p.V258L(1)		breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(8)|stomach(1)	13	Breast(184;0.162)	Prostate(94;0.183)				CTGCTGTTTCGTATGATGCTG	0.408																																																	1	Substitution - Missense(1)	lung(1)											48.0	52.0	51.0					1																	228879482		2203	4298	6501	SO:0001583	missense	0				CCDS1575.1	1q42.11-q42.3	2012-02-27	2012-02-27	2004-03-24	ENSG00000116574	ENSG00000116574			17794	protein-coding gene	gene with protein product	"""Ryu GTPase"", ""Wnt-1 responsive Cdc42 homolog"", ""2310026M05Rik"", ""GTP-binding protein like 1"", ""CDC42-like GTPase"", ""GTP-binding protein SB128"", ""ras-like gene family member U"""	606366	"""ras homolog gene family, member U"""	ARHU		11459829	Standard	NM_021205		Approved	WRCH-1, DJ646B12.2, FLJ10616, WRCH1, CDC42L1, hG28K, fJ646B12.2	uc001htf.3	Q7L0Q8	OTTHUMG00000037919	ENST00000366691.3:c.772G>A	1.37:g.228879482G>A	ENSP00000355652:p.Val258Ile			Missense_Mutation	SNP	pfam_Small_GTPase,pfam_MIRO-like,superfamily_P-loop_NTPase,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.V258I	ENST00000366691.3	37	c.772	CCDS1575.1	1	.	.	.	.	.	.	.	.	.	.	G	12.67	2.008770	0.35415	.	.	ENSG00000116574	ENST00000366691	T	0.67345	-0.26	4.95	3.03	0.35002	.	0.393509	0.25906	N	0.027531	T	0.40570	0.1122	N	0.24115	0.695	0.21256	N	0.999748	P	0.37525	0.598	B	0.21151	0.033	T	0.42085	-0.9472	10	0.87932	D	0	.	3.5953	0.08003	0.0912:0.1677:0.5679:0.1732	.	258	Q7L0Q8	RHOU_HUMAN	I	258	ENSP00000355652:V258I	ENSP00000355652:V258I	V	+	1	0	RHOU	226946105	1.000000	0.71417	0.619000	0.29118	0.981000	0.71138	3.588000	0.53964	0.646000	0.30693	-0.140000	0.14226	GTA	RHOU	-	NULL	ENSG00000116574		0.408	RHOU-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RHOU	HGNC	protein_coding	OTTHUMT00000092555.1		0.00	16	0	G	NM_021205		228879482	+1			no_errors	ENST00000366691	ensembl	human	known	74_37	missense	5.71	33	2	SNP	0.811	A
RIC3	79608	genome.wustl.edu	37	11	8159966	8159967	+	Intron	INS	-	-	A	rs79339332|rs78612783		TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr11:8159966_8159967insA	ENST00000309737.6	-	3	351				RIC3_ENST00000343202.4_Intron|RIC3_ENST00000425599.2_Intron|RIC3_ENST00000335425.7_Intron|RIC3_ENST00000530060.1_5'UTR|RIC3_ENST00000539720.1_Intron			Q7Z5B4	RIC3_HUMAN	RIC3 acetylcholine receptor chaperone						cellular protein complex assembly (GO:0043623)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|protein folding (GO:0006457)|synaptic transmission, cholinergic (GO:0007271)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|large_intestine(2)|lung(9)|ovary(2)|pancreas(1)	17				Epithelial(150;2.89e-07)|BRCA - Breast invasive adenocarcinoma(625;0.204)		TCATATCAAACAAAAAAAAAAG	0.381																																																	0																																										SO:0001627	intron_variant	0				CCDS7788.1, CCDS44533.1, CCDS55741.1, CCDS55742.1	11p15.4	2013-08-05	2013-08-05		ENSG00000166405	ENSG00000166405			30338	protein-coding gene	gene with protein product		610509	"""resistance to inhibitors of cholinesterase 3 homolog (C. elegans)"""			12821669	Standard	NM_024557		Approved	FLJ11608, PRO1385, AYST720	uc001mgd.2	Q7Z5B4	OTTHUMG00000165694	ENST00000309737.6:c.352-72->T	11.37:g.8159976_8159976dupA			B0B1U0|B2RD25|D3DQU5|Q6UX78|Q7Z5B3|Q86T94|Q8TBJ9|Q9HAH8	RNA	INS	-	NULL	ENST00000309737.6	37	NULL	CCDS55742.1	11																																																																																			RIC3	-	-	ENSG00000166405		0.381	RIC3-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RIC3	HGNC	protein_coding	OTTHUMT00000385900.1		0.00	40	0	-	NM_024557		8159967	-1	tier1		no_errors	ENST00000524799	ensembl	human	known	74_37	rna	7.50	37	3	INS	0.000:0.000	A
RNF2	6045	genome.wustl.edu	37	1	185069041	185069041	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr1:185069041G>A	ENST00000367510.3	+	6	1144	c.856G>A	c.(856-858)Gcc>Acc	p.A286T	RNF2_ENST00000367509.4_Missense_Mutation_p.A214T	NM_007212.3	NP_009143.1	Q99496	RING2_HUMAN	ring finger protein 2	286					anterior/posterior axis specification (GO:0009948)|gastrulation with mouth forming second (GO:0001702)|histone H2A monoubiquitination (GO:0035518)|histone H2A-K119 monoubiquitination (GO:0036353)|mitotic cell cycle (GO:0000278)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	euchromatin (GO:0000791)|MLL1 complex (GO:0071339)|nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)|sex chromatin (GO:0001739)|ubiquitin ligase complex (GO:0000151)	chromatin binding (GO:0003682)|ligase activity (GO:0016874)|RING-like zinc finger domain binding (GO:0071535)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(3)|endometrium(2)|large_intestine(4)|lung(3)|skin(2)	14		Breast(1374;0.000496)		Colorectal(1306;6.9e-08)|KIRC - Kidney renal clear cell carcinoma(1967;8.12e-06)		CCTTGATACAGCCAGTGAGAA	0.418																																																	0													99.0	99.0	99.0					1																	185069041		2203	4300	6503	SO:0001583	missense	0			BC012583, Y10571	CCDS1365.1	1q25.3	2013-01-09			ENSG00000121481	ENSG00000121481		"""RING-type (C3HC4) zinc fingers"""	10061	protein-coding gene	gene with protein product		608985				11513855	Standard	XM_005245413		Approved	BAP-1, BAP1, DING, HIPI3, RING1B, RING2	uc001grc.1	Q99496	OTTHUMG00000035391	ENST00000367510.3:c.856G>A	1.37:g.185069041G>A	ENSP00000356480:p.Ala286Thr		B2RBS7|B3KRH1|Q5TEN1|Q5TEN2	Missense_Mutation	SNP	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	p.A286T	ENST00000367510.3	37	c.856	CCDS1365.1	1	.	.	.	.	.	.	.	.	.	.	G	18.97	3.735741	0.69189	.	.	ENSG00000121481	ENST00000367510;ENST00000367509	D	0.84800	-1.9	5.83	5.83	0.93111	.	0.000000	0.85682	D	0.000000	T	0.77718	0.4172	L	0.36672	1.1	0.80722	D	1	P;B	0.45011	0.848;0.026	B;B	0.34779	0.189;0.027	T	0.75736	-0.3213	10	0.15066	T	0.55	-6.2435	20.1822	0.98208	0.0:0.0:1.0:0.0	.	214;286	B3KRH1;Q99496	.;RING2_HUMAN	T	286;214	ENSP00000356480:A286T	ENSP00000356479:A214T	A	+	1	0	RNF2	183335664	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.262000	0.95591	2.771000	0.95319	0.650000	0.86243	GCC	RNF2	-	NULL	ENSG00000121481		0.418	RNF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF2	HGNC	protein_coding	OTTHUMT00000085793.1		0.00	57	0	G	NM_007212		185069041	+1			no_errors	ENST00000367510	ensembl	human	known	74_37	missense	6.52	43	3	SNP	1.000	A
RPS10	6204	genome.wustl.edu	37	6	34393814	34393814	+	5'UTR	SNP	C	C	T			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr6:34393814C>T	ENST00000326199.8	-	0	88				RPS10_ENST00000344700.3_5'Flank|RPS10-NUDT3_ENST00000605528.1_5'UTR|RPS10_ENST00000494077.1_5'Flank	NM_001014.4|NM_001203245.2|NM_001204091.1	NP_001005.1|NP_001190174.1|NP_001191020.1	P46783	RS10_HUMAN	ribosomal protein S10						cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic small ribosomal subunit (GO:0022627)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleolus (GO:0005730)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|lung(4)	9						CTCACCTCTGCGGCTGCAGGG	0.701																																					Colon(121;749 1624 4895 8687 22360)												0																																										SO:0001623	5_prime_UTR_variant	0			U14972	CCDS4792.1	6p21.31	2011-04-05			ENSG00000124614	ENSG00000124614		"""S ribosomal proteins"""	10383	protein-coding gene	gene with protein product		603632				7772601, 9582194	Standard	NM_001014		Approved	MGC88819, S10		P46783	OTTHUMG00000014546	ENST00000326199.8:c.-6G>A	6.37:g.34393814C>T			B2R4E3|Q5TZC0	RNA	SNP	-	NULL	ENST00000326199.8	37	NULL	CCDS4792.1	6																																																																																			RPS10	-	-	ENSG00000124614		0.701	RPS10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPS10	HGNC	protein_coding	OTTHUMT00000040230.1	-	0.00	28	0	C			34393814	-1	tier1	-	no_errors	ENST00000480942	ensembl	human	known	74_37	rna	13.79	25	4	SNP	0.000	T
RPS6KL1	83694	genome.wustl.edu	37	14	75388105	75388105	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr14:75388105C>A	ENST00000555647.1	-	3	427	c.140G>T	c.(139-141)cGt>cTt	p.R47L	RPS6KL1_ENST00000354625.2_Missense_Mutation_p.R47L|RPS6KL1_ENST00000554900.1_Intron|RPS6KL1_ENST00000358328.4_Missense_Mutation_p.R47L|RPS6KL1_ENST00000557413.1_Missense_Mutation_p.R47L			Q9Y6S9	RPKL1_HUMAN	ribosomal protein S6 kinase-like 1	47						ribosome (GO:0005840)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|liver(1)|lung(4)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	17				BRCA - Breast invasive adenocarcinoma(234;0.00658)		CAGATAGTCACGTTTTGTCAT	0.592																																																	0													143.0	127.0	132.0					14																	75388105		2203	4300	6503	SO:0001583	missense	0			BC004540	CCDS9834.1, CCDS9834.2	14q24.2	2011-04-05				ENSG00000198208			20222	protein-coding gene	gene with protein product							Standard	NM_031464		Approved	MGC11287	uc010tux.2	Q9Y6S9		ENST00000555647.1:c.140G>T	14.37:g.75388105C>A	ENSP00000452027:p.Arg47Leu		A6NGM9|Q69YT9|Q6ZMQ6|Q96NR9|Q9BSU9	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_MIT,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_MIT,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.R47L	ENST00000555647.1	37	c.140	CCDS9834.2	14	.	.	.	.	.	.	.	.	.	.	C	14.07	2.424498	0.43020	.	.	ENSG00000198208	ENST00000555647;ENST00000354625;ENST00000557413;ENST00000358328	T;T;T;T	0.29655	2.03;1.56;2.03;2.03	4.16	2.31	0.28768	MIT (1);	0.128968	0.51477	D	0.000091	T	0.19765	0.0475	N	0.24115	0.695	0.42549	D	0.9931	B;P;P	0.35192	0.075;0.489;0.462	B;B;B	0.38500	0.045;0.149;0.275	T	0.04976	-1.0914	10	0.19147	T	0.46	-0.3774	9.3187	0.37950	0.0:0.8163:0.0:0.1837	.	47;47;47	Q9Y6S9;Q9Y6S9-4;Q9Y6S9-2	RPKL1_HUMAN;.;.	L	47	ENSP00000452027:R47L;ENSP00000346644:R47L;ENSP00000450567:R47L;ENSP00000351086:R47L	ENSP00000346644:R47L	R	-	2	0	RPS6KL1	74457858	0.851000	0.29673	0.648000	0.29521	0.569000	0.35902	1.939000	0.40213	0.357000	0.24183	0.561000	0.74099	CGT	RPS6KL1	-	smart_MIT	ENSG00000198208		0.592	RPS6KL1-002	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	RPS6KL1	HGNC	protein_coding	OTTHUMT00000413732.1	-	0.00	32	0	C			75388105	-1	tier1	-	no_errors	ENST00000358328	ensembl	human	known	74_37	missense	23.53	26	8	SNP	0.987	A
RSPH4A	345895	genome.wustl.edu	37	6	116938141	116938141	+	Nonsense_Mutation	SNP	G	G	T			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr6:116938141G>T	ENST00000229554.5	+	1	492	c.355G>T	c.(355-357)Gaa>Taa	p.E119*	RSPH4A_ENST00000368581.4_Nonsense_Mutation_p.E119*|RSPH4A_ENST00000368580.4_Nonsense_Mutation_p.E119*	NM_001010892.2	NP_001010892.1	Q5TD94	RSH4A_HUMAN	radial spoke head 4 homolog A (Chlamydomonas)	119					axoneme assembly (GO:0035082)|cilium movement (GO:0003341)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)|motile cilium (GO:0031514)|nucleolus (GO:0005730)|nucleus (GO:0005634)|radial spoke (GO:0001534)				breast(1)|endometrium(2)|kidney(1)|large_intestine(11)|lung(8)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	27						TGTGATTCCTGAAGCTGGGAC	0.537									Kartagener syndrome																																								0													75.0	77.0	76.0					6																	116938141		2203	4300	6503	SO:0001587	stop_gained	0	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome		CCDS34521.1, CCDS55051.1	6q22.1	2012-05-03	2009-02-17	2009-02-17	ENSG00000111834	ENSG00000111834			21558	protein-coding gene	gene with protein product		612647	"""radial spokehead-like 3"""	RSHL3		19200523	Standard	NM_001010892		Approved	dJ412I7.1, FLJ37974, RSPH6B, CILD11	uc003pxe.2	Q5TD94	OTTHUMG00000015444	ENST00000229554.5:c.355G>T	6.37:g.116938141G>T	ENSP00000229554:p.Glu119*		B4DSI1|Q3KP24|Q5TD95	Nonsense_Mutation	SNP	pfam_Radial_spoke	p.E119*	ENST00000229554.5	37	c.355	CCDS34521.1	6	.	.	.	.	.	.	.	.	.	.	G	25.3	4.627691	0.87560	.	.	ENSG00000111834	ENST00000368581;ENST00000229554;ENST00000368580	.	.	.	5.53	1.85	0.25348	.	0.932998	0.09014	N	0.861076	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.17369	T	0.5	-0.0026	7.3894	0.26901	0.3407:0.0:0.6593:0.0	.	.	.	.	X	119	.	ENSP00000229554:E119X	E	+	1	0	RSPH4A	117044834	0.037000	0.19845	0.000000	0.03702	0.016000	0.09150	1.586000	0.36611	0.164000	0.19529	0.655000	0.94253	GAA	RSPH4A	-	NULL	ENSG00000111834		0.537	RSPH4A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	RSPH4A	HGNC	protein_coding	OTTHUMT00000041960.1		0.00	29	0	G	NM_001010892		116938141	+1			no_errors	ENST00000229554	ensembl	human	known	74_37	nonsense	7.89	35	3	SNP	0.000	T
SAGE1	55511	genome.wustl.edu	37	X	134987423	134987423	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chrX:134987423C>G	ENST00000370709.3	+	4	326	c.326C>G	c.(325-327)gCt>gGt	p.A109G	SAGE1_ENST00000537770.1_Missense_Mutation_p.A109G|SAGE1_ENST00000324447.3_Missense_Mutation_p.A109G|SAGE1_ENST00000535938.1_Missense_Mutation_p.A109G			Q9NXZ1	SAGE1_HUMAN	sarcoma antigen 1	109						nucleus (GO:0005634)				breast(5)|endometrium(5)|large_intestine(10)|lung(23)|ovary(3)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	55	Acute lymphoblastic leukemia(192;0.000127)					GCTACCATCGCTCACAATATC	0.463																																																	0													158.0	107.0	124.0					X																	134987423		2203	4300	6503	SO:0001583	missense	0			AJ278111	CCDS14652.1	Xq26	2009-03-25			ENSG00000181433	ENSG00000181433			30369	protein-coding gene	gene with protein product	"""cancer/testis antigen 14"""	300359				10919659	Standard	NM_018666		Approved	SAGE, CT14	uc004ezh.3	Q9NXZ1	OTTHUMG00000022496	ENST00000370709.3:c.326C>G	X.37:g.134987423C>G	ENSP00000359743:p.Ala109Gly		Q5JNW0	Missense_Mutation	SNP	NULL	p.A109G	ENST00000370709.3	37	c.326	CCDS14652.1	X	.	.	.	.	.	.	.	.	.	.	C	5.242	0.230096	0.09969	.	.	ENSG00000181433	ENST00000324447;ENST00000535938;ENST00000537770;ENST00000370709	T;T;T;T	0.35605	1.3;1.3;1.49;1.3	1.32	-1.54	0.08584	.	0.159392	0.39834	U	0.001246	T	0.18045	0.0433	N	0.14661	0.345	0.09310	N	1	B;B	0.31705	0.336;0.0	B;B	0.35278	0.199;0.002	T	0.12604	-1.0541	10	0.72032	D	0.01	.	4.3785	0.11283	0.0:0.4439:0.0:0.5561	.	109;109	F5H2Z8;Q9NXZ1	.;SAGE1_HUMAN	G	109	ENSP00000323191:A109G;ENSP00000445959:A109G;ENSP00000438276:A109G;ENSP00000359743:A109G	ENSP00000323191:A109G	A	+	2	0	SAGE1	134815089	0.003000	0.15002	0.004000	0.12327	0.006000	0.05464	-0.166000	0.09954	-0.604000	0.05760	0.284000	0.19432	GCT	SAGE1	-	NULL	ENSG00000181433		0.463	SAGE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SAGE1	HGNC	protein_coding	OTTHUMT00000058448.1	-	0.00	21	0	C	NM_018666		134987423	+1	tier1	-	no_errors	ENST00000324447	ensembl	human	known	74_37	missense	61.54	10	16	SNP	0.004	G
SCARB1	949	genome.wustl.edu	37	12	125294827	125294827	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr12:125294827G>T	ENST00000415380.2	-	6	860	c.735C>A	c.(733-735)ttC>ttA	p.F245L	SCARB1_ENST00000535005.1_5'UTR|SCARB1_ENST00000540495.1_Missense_Mutation_p.F208L|SCARB1_ENST00000339570.5_Missense_Mutation_p.F245L|SCARB1_ENST00000261693.6_Missense_Mutation_p.F245L|SCARB1_ENST00000544327.1_Missense_Mutation_p.F191L|SCARB1_ENST00000541205.1_Missense_Mutation_p.F204L|SCARB1_ENST00000376788.1_Missense_Mutation_p.F145L|SCARB1_ENST00000546215.1_Missense_Mutation_p.F245L			Q8WTV0	SCRB1_HUMAN	scavenger receptor class B, member 1	245					adhesion of symbiont to host (GO:0044406)|androgen biosynthetic process (GO:0006702)|blood vessel endothelial cell migration (GO:0043534)|cell adhesion (GO:0007155)|cholesterol catabolic process (GO:0006707)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol import (GO:0070508)|detection of lipopolysaccharide (GO:0032497)|endothelial cell proliferation (GO:0001935)|high-density lipoprotein particle clearance (GO:0034384)|high-density lipoprotein particle remodeling (GO:0034375)|lipopolysaccharide transport (GO:0015920)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|lipoprotein metabolic process (GO:0042157)|low-density lipoprotein particle clearance (GO:0034383)|phospholipid transport (GO:0015914)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of triglyceride biosynthetic process (GO:0010867)|receptor-mediated endocytosis (GO:0006898)|recognition of apoptotic cell (GO:0043654)|regulation of phagocytosis (GO:0050764)|regulation of phosphatidylcholine catabolic process (GO:0010899)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)|triglyceride homeostasis (GO:0070328)|viral process (GO:0016032)|wound healing (GO:0042060)	caveola (GO:0005901)|cell surface (GO:0009986)|endocytic vesicle membrane (GO:0030666)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|microvillus membrane (GO:0031528)|plasma membrane (GO:0005886)	1-phosphatidylinositol binding (GO:0005545)|apolipoprotein A-I binding (GO:0034186)|apolipoprotein binding (GO:0034185)|high-density lipoprotein particle binding (GO:0008035)|high-density lipoprotein particle receptor activity (GO:0070506)|lipopolysaccharide binding (GO:0001530)|lipopolysaccharide receptor activity (GO:0001875)|low-density lipoprotein particle binding (GO:0030169)|phosphatidylserine binding (GO:0001786)|transporter activity (GO:0005215)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(7)|prostate(1)	17	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000116)|Epithelial(86;0.000415)|all cancers(50;0.00395)	Phosphatidylserine(DB00144)	CGGAATGCCAGAAGTCAACCT	0.567																																																	0													75.0	66.0	69.0					12																	125294827		2203	4300	6503	SO:0001583	missense	0			Z22555	CCDS9259.1, CCDS45008.1	12q24.32	2008-08-05	2002-09-06	2002-09-06	ENSG00000073060	ENSG00000073060			1664	protein-coding gene	gene with protein product		601040	"""CD36 antigen (collagen type I receptor, thrombospondin receptor)-like 1"""	CD36L1		7689561	Standard	NM_001082959		Approved	SRB1, CLA-1, CLA1, SR-BI	uc001ugm.4	Q8WTV0	OTTHUMG00000168544	ENST00000415380.2:c.735C>A	12.37:g.125294827G>T	ENSP00000414979:p.Phe245Leu		F8W8N0|Q14016|Q52LZ5|Q6KFX4	Missense_Mutation	SNP	pfam_CD36,prints_CD36,prints_CD36_antigen	p.F245L	ENST00000415380.2	37	c.735		12	.	.	.	.	.	.	.	.	.	.	G	14.69	2.609828	0.46527	.	.	ENSG00000073060	ENST00000339570;ENST00000415380;ENST00000261693;ENST00000376788;ENST00000546215;ENST00000541205;ENST00000544327;ENST00000540495	T;T;T;T;T;T;T;T	0.71103	-0.54;-0.54;-0.54;-0.54;-0.54;-0.54;-0.54;-0.54	5.29	2.45	0.29901	.	0.520190	0.22687	N	0.056878	T	0.71500	0.3347	M	0.79343	2.45	0.37254	D	0.906699	P;B;P;P;B;P	0.41673	0.566;0.238;0.759;0.759;0.2;0.576	B;B;B;B;B;B	0.43990	0.438;0.257;0.438;0.438;0.167;0.234	T	0.72883	-0.4157	10	0.66056	D	0.02	-19.0902	8.2147	0.31505	0.3121:0.0:0.6879:0.0	.	204;245;245;245;245;245	B3KW46;B7ZKQ9;B4E3I1;Q8WTV0;F8W8N0;Q8WTV0-2	.;.;.;SCRB1_HUMAN;.;.	L	245;245;245;145;245;204;191;208	ENSP00000343795:F245L;ENSP00000414979:F245L;ENSP00000261693:F245L;ENSP00000365984:F145L;ENSP00000442862:F245L;ENSP00000446107:F204L;ENSP00000444851:F191L;ENSP00000443286:F208L	ENSP00000261693:F245L	F	-	3	2	SCARB1	123860780	1.000000	0.71417	0.292000	0.24919	0.651000	0.38670	2.503000	0.45407	0.223000	0.20920	0.462000	0.41574	TTC	SCARB1	-	pfam_CD36	ENSG00000073060		0.567	SCARB1-006	KNOWN	basic	protein_coding	SCARB1	HGNC	protein_coding	OTTHUMT00000400165.1	-	0.00	54	0	G	NM_005505		125294827	-1	tier1	-	no_errors	ENST00000415380	ensembl	human	known	74_37	missense	6.35	59	4	SNP	0.949	T
SCARB2	950	genome.wustl.edu	37	4	77091064	77091064	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr4:77091064G>A	ENST00000264896.2	-	8	1418	c.1069C>T	c.(1069-1071)Cac>Tac	p.H357Y	SCARB2_ENST00000452464.2_Missense_Mutation_p.H214Y	NM_005506.3	NP_005497.1	Q14108	SCRB2_HUMAN	scavenger receptor class B, member 2	357					cell adhesion (GO:0007155)|protein targeting to lysosome (GO:0006622)	extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|lysosomal lumen (GO:0043202)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)	enzyme binding (GO:0019899)|receptor activity (GO:0004872)			breast(1)|endometrium(4)|kidney(4)|large_intestine(7)|lung(3)|prostate(2)|skin(1)	22			Lung(101;0.196)			TGATTTGGGTGCATGCCTTCT	0.398																																																	0													162.0	151.0	155.0					4																	77091064		2203	4300	6503	SO:0001583	missense	0			D12676	CCDS3577.1, CCDS56335.1	4q21.1	2014-07-11	2002-09-06	2002-09-06	ENSG00000138760	ENSG00000138760			1665	protein-coding gene	gene with protein product		602257	"""CD36 antigen (collagen type I receptor, thrombospondin receptor)-like 2 (lysosomal integral membrane protein II)"""	CD36L2		1374238	Standard	NM_005506		Approved	HLGP85, LIMPII, SR-BII, LIMP-2	uc003hju.2	Q14108	OTTHUMG00000130099	ENST00000264896.2:c.1069C>T	4.37:g.77091064G>A	ENSP00000264896:p.His357Tyr		B4DKD8|E7EM68|Q53Y63	Missense_Mutation	SNP	pfam_CD36,superfamily_NA-bd_OB-fold,prints_LimpII,prints_CD36,prints_CD36_antigen	p.H357Y	ENST00000264896.2	37	c.1069	CCDS3577.1	4	.	.	.	.	.	.	.	.	.	.	G	17.38	3.376100	0.61735	.	.	ENSG00000138760	ENST00000264896;ENST00000452464	T;T	0.72167	-0.63;-0.63	4.87	3.97	0.46021	.	0.482474	0.24922	N	0.034538	T	0.78773	0.4336	M	0.68728	2.09	0.35714	D	0.816654	D;P	0.61697	0.99;0.909	P;P	0.60236	0.871;0.808	D	0.84100	0.0395	10	0.56958	D	0.05	.	12.2449	0.54563	0.0:0.0:0.7262:0.2738	.	214;357	E7EM68;Q14108	.;SCRB2_HUMAN	Y	357;214	ENSP00000264896:H357Y;ENSP00000399154:H214Y	ENSP00000264896:H357Y	H	-	1	0	SCARB2	77310088	0.997000	0.39634	0.925000	0.36789	0.923000	0.55619	2.117000	0.41939	2.406000	0.81754	0.460000	0.39030	CAC	SCARB2	-	pfam_CD36,superfamily_NA-bd_OB-fold,prints_CD36_antigen	ENSG00000138760		0.398	SCARB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCARB2	HGNC	protein_coding	OTTHUMT00000252403.1	-	0.00	35	0	G	NM_005506		77091064	-1	tier1	-	no_errors	ENST00000264896	ensembl	human	known	74_37	missense	14.29	24	4	SNP	0.936	A
SCN1A	6323	genome.wustl.edu	37	2	166848274	166848274	+	Silent	SNP	C	C	T			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr2:166848274C>T	ENST00000303395.4	-	26	5510	c.5511G>A	c.(5509-5511)ccG>ccA	p.P1837P	AC010127.3_ENST00000597623.1_RNA|SCN1A_ENST00000409050.1_Silent_p.P1809P|SCN1A_ENST00000423058.2_Silent_p.P1837P|SCN1A_ENST00000375405.3_Silent_p.P1826P|AC010127.3_ENST00000595647.1_RNA			P35498	SCN1A_HUMAN	sodium channel, voltage-gated, type I, alpha subunit	1837					adult walking behavior (GO:0007628)|membrane depolarization during action potential (GO:0086010)|neuromuscular process controlling posture (GO:0050884)|neuronal action potential (GO:0019228)|neuronal action potential propagation (GO:0019227)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon initial segment (GO:0043194)|intercalated disc (GO:0014704)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)|Z disc (GO:0030018)	voltage-gated sodium channel activity (GO:0005248)			NS(4)|breast(5)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(33)|lung(87)|ovary(7)|pancreas(1)|prostate(9)|skin(23)|upper_aerodigestive_tract(2)|urinary_tract(1)	200					Dronedarone(DB04855)|Nitrazepam(DB01595)|Permethrin(DB04930)|Phenacemide(DB01121)|Phenazopyridine(DB01438)|Phenytoin(DB00252)|Topiramate(DB00273)|Valproic Acid(DB00313)|Zonisamide(DB00909)	GATTGAGAGGCGGTTCAAGCG	0.443																																																	0													96.0	99.0	98.0					2																	166848274		2203	4300	6503	SO:0001819	synonymous_variant	0			AB093548	CCDS33316.1, CCDS54413.1, CCDS54414.1	2q24.3	2014-09-17	2007-01-23		ENSG00000144285	ENSG00000144285		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10585	protein-coding gene	gene with protein product		182389	"""febrile convulsions 3"""	SCN1, FEB3		8062593, 16382098, 11823106	Standard	NM_006920		Approved	Nav1.1, GEFSP2, HBSCI, NAC1, SMEI	uc021vsb.1	P35498	OTTHUMG00000044173	ENST00000303395.4:c.5511G>A	2.37:g.166848274C>T			E9PG49|Q16172|Q585T7|Q8IUJ6|Q96LA3|Q9C008	Silent	SNP	pfam_Ion_trans_dom,pfam_DUF3451,pfam_Na_trans_assoc,pfam_PKD1_2_channel,prints_Na_channel_a1su,prints_Na_channel_asu,prints_PKD_2	p.P1837	ENST00000303395.4	37	c.5511	CCDS54413.1	2																																																																																			SCN1A	-	NULL	ENSG00000144285		0.443	SCN1A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	SCN1A	HGNC	protein_coding	OTTHUMT00000102661.1	-	0.00	51	0	C	NM_006920		166848274	-1	tier1	-	no_errors	ENST00000303395	ensembl	human	known	74_37	silent	57.14	21	28	SNP	0.075	T
SEMA3G	56920	genome.wustl.edu	37	3	52474808	52474808	+	Silent	SNP	C	C	T			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr3:52474808C>T	ENST00000231721.2	-	9	959	c.960G>A	c.(958-960)ggG>ggA	p.G320G		NM_020163.1	NP_064548.1	Q9NS98	SEM3G_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3G	320	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				multicellular organismal development (GO:0007275)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	receptor activity (GO:0004872)			kidney(1)|large_intestine(5)|lung(8)|ovary(2)|prostate(1)|skin(1)	18				BRCA - Breast invasive adenocarcinoma(193;1.69e-05)|Kidney(197;0.00173)|KIRC - Kidney renal clear cell carcinoma(197;0.00196)|OV - Ovarian serous cystadenocarcinoma(275;0.0333)		CGAGGCTCTTCCCGGCCTTGG	0.622																																																	0													63.0	59.0	60.0					3																	52474808		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS2856.1	3p21.1	2013-01-11			ENSG00000010319	ENSG00000010319		"""Semaphorins"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	30400	protein-coding gene	gene with protein product						11214971	Standard	XM_005265327		Approved	FLJ00014, sem2	uc003dea.1	Q9NS98	OTTHUMG00000158570	ENST00000231721.2:c.960G>A	3.37:g.52474808C>T			Q7L9D9|Q9H7Q3	Silent	SNP	pfam_Semap_dom,pfam_Plexin_repeat,superfamily_Semap_dom,superfamily_Plexin-like_fold,smart_Semap_dom,smart_Plexin-like_fold,pfscan_Semap_dom,pfscan_Ig-like_dom	p.G320	ENST00000231721.2	37	c.960	CCDS2856.1	3																																																																																			SEMA3G	-	pfam_Semap_dom,superfamily_Semap_dom,smart_Semap_dom,pfscan_Semap_dom	ENSG00000010319		0.622	SEMA3G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEMA3G	HGNC	protein_coding	OTTHUMT00000351354.1	-	0.00	33	0	C	NM_020163		52474808	-1	tier1	-	no_errors	ENST00000231721	ensembl	human	known	74_37	silent	31.43	24	11	SNP	0.989	T
SENP2	59343	genome.wustl.edu	37	3	185300577	185300577	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr3:185300577G>A	ENST00000545472.1	+	1	71	c.43G>A	c.(43-45)Gaa>Aaa	p.E15K	SENP2_ENST00000465201.1_3'UTR			Q9HC62	SENP2_HUMAN	SUMO1/sentrin/SMT3 specific peptidase 2	0					cellular protein metabolic process (GO:0044267)|dorsal/ventral axis specification (GO:0009950)|heart development (GO:0007507)|labyrinthine layer development (GO:0060711)|mRNA transport (GO:0051028)|negative regulation of chromatin binding (GO:0035562)|negative regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043518)|negative regulation of protein binding (GO:0032091)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-translational protein modification (GO:0043687)|protein desumoylation (GO:0016926)|protein sumoylation (GO:0016925)|protein transport (GO:0015031)|regulation of DNA endoreduplication (GO:0032875)|regulation of G1/S transition of mitotic cell cycle (GO:2000045)|regulation of Wnt signaling pathway (GO:0030111)|spongiotrophoblast layer development (GO:0060712)|trophoblast giant cell differentiation (GO:0060707)|Wnt signaling pathway (GO:0016055)	cytoplasmic vesicle (GO:0031410)|nuclear pore (GO:0005643)|nucleoplasm (GO:0005654)|PML body (GO:0016605)	SUMO-specific protease activity (GO:0016929)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(5)|skin(3)	12	all_cancers(143;1.28e-10)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(80;1.31e-21)			ACAGGACAGCGAAGGCACCAA	0.547																																																	0																																										SO:0001583	missense	0			AF151697	CCDS33902.1	3q28	2005-08-17	2005-08-17		ENSG00000163904	ENSG00000163904			23116	protein-coding gene	gene with protein product		608261	"""SUMO1/sentrin/SMT3 specific protease 2"""			11896061, 11489887	Standard	XM_005247690		Approved	SMT3IP2, KIAA1331, DKFZp762A2316, AXAM2	uc003fpn.3	Q9HC62	OTTHUMG00000156658	ENST00000545472.1:c.43G>A	3.37:g.185300577G>A	ENSP00000439653:p.Glu15Lys		B4DQ42|Q8IW97|Q96SR2|Q9P2L5	Missense_Mutation	SNP	pfam_Peptidase_C48,pfscan_Peptidase_C48	p.E15K	ENST00000545472.1	37	c.43		3	.	.	.	.	.	.	.	.	.	.	G	12.40	1.927050	0.34002	.	.	ENSG00000163904	ENST00000430355;ENST00000545472	T	0.24908	1.83	2.81	-1.28	0.09318	.	.	.	.	.	T	0.14917	0.0360	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.27606	-1.0069	8	0.59425	D	0.04	.	2.7322	0.05230	0.3876:0.0:0.4048:0.2076	.	15	B4DQ42	.	K	79;15	ENSP00000439653:E15K	ENSP00000399156:E79K	E	+	1	0	SENP2	186783271	0.000000	0.05858	0.000000	0.03702	0.724000	0.41520	0.071000	0.14594	-0.328000	0.08539	0.561000	0.74099	GAA	SENP2	-	NULL	ENSG00000163904		0.547	SENP2-202	KNOWN	basic	protein_coding	SENP2	HGNC	protein_coding		-	0.00	71	0	G	NM_021627		185300577	+1	tier1	-	no_errors	ENST00000545472	ensembl	human	known	74_37	missense	17.05	73	15	SNP	0.000	A
SERBP1	26135	genome.wustl.edu	37	1	67880930	67880930	+	Silent	SNP	G	G	A			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr1:67880930G>A	ENST00000370995.2	-	7	1174	c.1089C>T	c.(1087-1089)ggC>ggT	p.G363G	SERBP1_ENST00000370994.4_Silent_p.G342G|SERBP1_ENST00000370990.5_Silent_p.G357G|SERBP1_ENST00000361219.6_Silent_p.G348G|RNU6-387P_ENST00000411331.1_RNA			Q8NC51	PAIRB_HUMAN	SERPINE1 mRNA binding protein 1	363					regulation of apoptotic process (GO:0042981)|regulation of mRNA stability (GO:0043488)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	mRNA 3'-UTR binding (GO:0003730)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(2)|large_intestine(3)|lung(4)|skin(1)|upper_aerodigestive_tract(2)	13						GTCCTGGGCGGCCAAGGTCTC	0.532																																																	0													52.0	57.0	55.0					1																	67880930		2203	4300	6503	SO:0001819	synonymous_variant	0			AF151813	CCDS639.1, CCDS30746.1, CCDS30747.1, CCDS30748.1	1p31	2009-12-17			ENSG00000142864	ENSG00000142864			17860	protein-coding gene	gene with protein product		607378				11001948, 10810093, 18440126, 17698176	Standard	NM_001018067		Approved	PAI-RBP1, DKFZP564M2423, CGI-55, HABP4L, PAIRBP1, CHD3IP	uc001ddv.3	Q8NC51	OTTHUMG00000009372	ENST00000370995.2:c.1089C>T	1.37:g.67880930G>A			Q5VU19|Q5VU20|Q5VU22|Q8WUH0|Q96SE2|Q9BTY3|Q9BUM4|Q9Y367|Q9Y4S3	Silent	SNP	pfam_HABP4_PAIRBP1-bd	p.G363	ENST00000370995.2	37	c.1089	CCDS30746.1	1																																																																																			SERBP1	-	NULL	ENSG00000142864		0.532	SERBP1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SERBP1	HGNC	protein_coding	OTTHUMT00000025984.2	-	0.00	40	0	G	NM_001018067		67880930	-1	tier1	-	no_errors	ENST00000370995	ensembl	human	known	74_37	silent	7.58	61	5	SNP	1.000	A
SLC10A5	347051	genome.wustl.edu	37	8	82606431	82606431	+	Silent	SNP	C	C	T			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr8:82606431C>T	ENST00000518568.1	-	1	1978	c.777G>A	c.(775-777)agG>agA	p.R259R		NM_001010893.2	NP_001010893.1	Q5PT55	NTCP5_HUMAN	solute carrier family 10, member 5	259						integral component of membrane (GO:0016021)	bile acid:sodium symporter activity (GO:0008508)			autonomic_ganglia(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(5)	15						ACCCTAATATCCTACTGTATA	0.368																																																	0													71.0	75.0	73.0					8																	82606431		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS34915.1	8q21.13	2013-07-18	2013-07-18		ENSG00000253598	ENSG00000253598		"""Solute carriers"""	22981	protein-coding gene	gene with protein product							Standard	NM_001010893		Approved		uc011lfs.2	Q5PT55	OTTHUMG00000164683	ENST00000518568.1:c.777G>A	8.37:g.82606431C>T			B2RN26	Silent	SNP	pfam_BilAc/Na_symport	p.R259	ENST00000518568.1	37	c.777	CCDS34915.1	8																																																																																			SLC10A5	-	pfam_BilAc/Na_symport	ENSG00000253598		0.368	SLC10A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC10A5	HGNC	protein_coding	OTTHUMT00000379736.1	-	0.00	35	0	C	XM_294493		82606431	-1	tier1	-	no_errors	ENST00000518568	ensembl	human	known	74_37	silent	32.14	19	9	SNP	0.002	T
SLC28A1	9154	genome.wustl.edu	37	15	85431044	85431044	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr15:85431044C>T	ENST00000286749.3	+	2	143	c.53C>T	c.(52-54)gCc>gTc	p.A18V	SLC28A1_ENST00000537703.1_5'UTR|SLC28A1_ENST00000538177.1_Missense_Mutation_p.A18V|SLC28A1_ENST00000537216.1_Missense_Mutation_p.A18V|SLC28A1_ENST00000394573.1_Missense_Mutation_p.A18V|SLC28A1_ENST00000338602.2_Missense_Mutation_p.A18V|SLC28A1_ENST00000537624.1_Missense_Mutation_p.A18V			O00337	S28A1_HUMAN	solute carrier family 28 (concentrative nucleoside transporter), member 1	18					nucleobase-containing compound metabolic process (GO:0006139)|nucleoside transmembrane transport (GO:1901642)|nucleoside transport (GO:0015858)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	nucleoside binding (GO:0001882)|nucleoside transmembrane transporter activity (GO:0005337)|nucleoside:sodium symporter activity (GO:0005415)			breast(2)|endometrium(4)|kidney(2)|large_intestine(4)|lung(17)|ovary(1)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)	41			BRCA - Breast invasive adenocarcinoma(143;0.0587)		Gemcitabine(DB00441)|Stavudine(DB00649)|Zidovudine(DB00495)	ACACCTGTGGCCAAGGGTCTG	0.572																																																	0													174.0	153.0	160.0					15																	85431044		2203	4299	6502	SO:0001583	missense	0			U62967	CCDS10334.1, CCDS10335.1, CCDS73777.1	15q25.3	2013-07-17	2013-07-17		ENSG00000156222	ENSG00000156222		"""Solute carriers"""	11001	protein-coding gene	gene with protein product		606207	"""solute carrier family 28 (sodium-coupled nucleoside transporter), member 1"""			9124315	Standard	NM_004213		Approved	CNT1	uc002blg.3	O00337	OTTHUMG00000148668	ENST00000286749.3:c.53C>T	15.37:g.85431044C>T	ENSP00000286749:p.Ala18Val		A0AV42|A8K7I2|O00335|O00336|Q5U5S6|Q5U648|Q9UEZ9	Missense_Mutation	SNP	pfam_Nucleos_tra2_C,pfam_Nuclsd_transpt2,pfam_Nucleoside_recog_Gate,tigrfam_C_nuclsd_transpt_met_bac	p.A18V	ENST00000286749.3	37	c.53	CCDS10334.1	15	.	.	.	.	.	.	.	.	.	.	C	13.09	2.132330	0.37630	.	.	ENSG00000156222	ENST00000338602;ENST00000537216;ENST00000538177;ENST00000537624;ENST00000286749;ENST00000394573	T;T;T;T;T;T	0.13901	2.55;4.47;4.2;4.65;4.66;4.66	4.21	3.21	0.36854	.	0.425559	0.19195	N	0.120325	T	0.21022	0.0506	M	0.63428	1.95	0.09310	N	1	B;P;P;B;D	0.61697	0.259;0.518;0.788;0.44;0.99	B;B;B;B;P	0.51453	0.118;0.234;0.256;0.118;0.67	T	0.03784	-1.1004	10	0.54805	T	0.06	.	8.7097	0.34376	0.2264:0.7736:0.0:0.0	.	18;18;18;18;18	B7Z533;F5H560;B7Z3L6;O00337;O00337-2	.;.;.;S28A1_HUMAN;.	V	18	ENSP00000341629:A18V;ENSP00000440546:A18V;ENSP00000443752:A18V;ENSP00000444700:A18V;ENSP00000286749:A18V;ENSP00000378074:A18V	ENSP00000286749:A18V	A	+	2	0	SLC28A1	83232048	0.003000	0.15002	0.009000	0.14445	0.010000	0.07245	0.924000	0.28777	2.325000	0.78763	0.563000	0.77884	GCC	SLC28A1	-	NULL	ENSG00000156222		0.572	SLC28A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC28A1	HGNC	protein_coding	OTTHUMT00000308998.2		0.00	82	0	C			85431044	+1			no_errors	ENST00000286749	ensembl	human	known	74_37	missense	6.78	55	4	SNP	0.002	T
SLC45A1	50651	genome.wustl.edu	37	1	8395635	8395635	+	Missense_Mutation	SNP	G	G	A	rs367968730		TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr1:8395635G>A	ENST00000471889.1	+	6	1967	c.1582G>A	c.(1582-1584)Gtc>Atc	p.V528I	SLC45A1_ENST00000481265.1_3'UTR|SLC45A1_ENST00000377479.2_Missense_Mutation_p.V562I|SLC45A1_ENST00000289877.8_Missense_Mutation_p.V528I			Q9Y2W3	S45A1_HUMAN	solute carrier family 45, member 1	528					carbohydrate transport (GO:0008643)	integral component of membrane (GO:0016021)	symporter activity (GO:0015293)			central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|liver(1)|lung(12)|ovary(2)|pancreas(2)|prostate(4)|skin(2)|urinary_tract(2)	33	Ovarian(185;0.0661)|all_lung(157;0.127)	all_epithelial(116;1.22e-15)|all_lung(118;0.000147)|Lung NSC(185;0.000251)|Renal(390;0.000469)|Colorectal(325;0.00578)|Breast(348;0.00686)|Hepatocellular(190;0.0228)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.11)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;3.95e-66)|GBM - Glioblastoma multiforme(8;5.93e-33)|Colorectal(212;2.86e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|Kidney(185;5.33e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000513)|KIRC - Kidney renal clear cell carcinoma(229;0.000979)|STAD - Stomach adenocarcinoma(132;0.00199)|READ - Rectum adenocarcinoma(331;0.0649)		CACCCTCTGCGTCAACCACTT	0.692													G|||	1	0.000199681	0.0	0.0	5008	,	,		17459	0.001		0.0	False		,,,				2504	0.0																0								G	ILE/VAL	0,4406		0,0,2203	63.0	60.0	61.0		1582	2.4	1.0	1		61	1,8599	1.2+/-3.3	0,1,4299	no	missense	SLC45A1	NM_001080397.1	29	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign	528/749	8395635	1,13005	2203	4300	6503	SO:0001583	missense	0			AF118274	CCDS30577.1	1p36.23	2014-01-28	2005-10-04	2005-10-04	ENSG00000162426	ENSG00000162426		"""Solute carriers"""	17939	protein-coding gene	gene with protein product	"""H+/sugar symporter"""	605763	"""deleted in neuroblastoma 5"""	DNB5		10729226	Standard	XM_005263467		Approved		uc001apb.3	Q9Y2W3	OTTHUMG00000000503	ENST00000471889.1:c.1582G>A	1.37:g.8395635G>A	ENSP00000418096:p.Val528Ile		Q5VY46|Q5VY49	Missense_Mutation	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt	p.V562I	ENST00000471889.1	37	c.1684	CCDS30577.1	1	.	.	.	.	.	.	.	.	.	.	G	8.312	0.822315	0.16678	0.0	1.16E-4	ENSG00000162426	ENST00000471889;ENST00000377479;ENST00000289877	D;D;D	0.90261	-2.64;-2.64;-2.64	4.78	2.44	0.29823	Major facilitator superfamily domain, general substrate transporter (1);	0.157326	0.56097	N	0.000031	T	0.75466	0.3853	N	0.10664	0.02	0.30459	N	0.774498	B	0.09022	0.002	B	0.04013	0.001	T	0.65240	-0.6216	10	0.25106	T	0.35	-45.5034	4.55	0.12107	0.4485:0.0:0.5515:0.0	.	528	Q9Y2W3	S45A1_HUMAN	I	528;562;528	ENSP00000418096:V528I;ENSP00000366699:V562I;ENSP00000289877:V528I	ENSP00000289877:V528I	V	+	1	0	SLC45A1	8318222	1.000000	0.71417	0.998000	0.56505	0.908000	0.53690	3.980000	0.56895	1.124000	0.41980	0.555000	0.69702	GTC	SLC45A1	-	superfamily_MFS_dom_general_subst_transpt	ENSG00000162426		0.692	SLC45A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC45A1	HGNC	protein_coding	OTTHUMT00000001245.5	-	0.00	49	0	G			8395635	+1	tier1	-	no_errors	ENST00000377479	ensembl	human	known	74_37	missense	27.71	60	23	SNP	1.000	A
SLC46A2	57864	genome.wustl.edu	37	9	115652722	115652722	+	Silent	SNP	G	G	T			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr9:115652722G>T	ENST00000374228.4	-	1	471	c.240C>A	c.(238-240)atC>atA	p.I80I		NM_033051.3	NP_149040.3	Q9BY10	TSCOT_HUMAN	solute carrier family 46, member 2	80					negative regulation of T cell apoptotic process (GO:0070233)|regulation of T cell differentiation (GO:0045580)|T cell homeostasis (GO:0043029)|thymus development (GO:0048538)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	symporter activity (GO:0015293)			central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(11)|pancreas(1)|skin(1)	18						CAAGGTTGTAGATAATGTAGA	0.612																																																	0													109.0	111.0	110.0					9																	115652722		2203	4300	6503	SO:0001819	synonymous_variant	0			AF242557	CCDS6786.1	9q32	2013-05-22	2007-03-29	2007-03-29	ENSG00000119457	ENSG00000119457		"""Solute carriers"""	16055	protein-coding gene	gene with protein product		608956	"""thymic stromal co-transporter"""	TSCOT		10978518, 12826694	Standard	NM_033051		Approved	Ly110	uc004bgk.3	Q9BY10	OTTHUMG00000020513	ENST00000374228.4:c.240C>A	9.37:g.115652722G>T			B1ALK1|Q86VT0|Q96NE2	Silent	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,prints_Tet-R_TetA/multi-R_MdtG	p.I80	ENST00000374228.4	37	c.240	CCDS6786.1	9																																																																																			SLC46A2	-	NULL	ENSG00000119457		0.612	SLC46A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC46A2	HGNC	protein_coding	OTTHUMT00000053702.1	-	0.00	45	0	G	NM_033051		115652722	-1	tier1	-	no_errors	ENST00000374228	ensembl	human	known	74_37	silent	13.64	38	6	SNP	1.000	T
SLC6A12	6539	genome.wustl.edu	37	12	305292	305292	+	Nonsense_Mutation	SNP	C	C	A			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr12:305292C>A	ENST00000428720.1	-	12	2067	c.1324G>T	c.(1324-1326)Gag>Tag	p.E442*	SLC6A12_ENST00000397296.2_Nonsense_Mutation_p.E442*|SLC6A12_ENST00000536824.1_Nonsense_Mutation_p.E442*|SLC6A12_ENST00000359674.4_Nonsense_Mutation_p.E442*|SLC6A12_ENST00000424061.2_Nonsense_Mutation_p.E442*|RP11-283I3.1_ENST00000544067.1_RNA|SLC6A12_ENST00000538272.1_5'Flank	NM_001122848.2	NP_001116320.1	P48065	S6A12_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 12	442					amino acid transport (GO:0006865)|cellular hyperosmotic response (GO:0071474)|cellular water homeostasis (GO:0009992)|ion transport (GO:0006811)|neurotransmitter secretion (GO:0007269)|response to organic substance (GO:0010033)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	gamma-aminobutyric acid:sodium symporter activity (GO:0005332)|neurotransmitter:sodium symporter activity (GO:0005328)			central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(6)|lung(8)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	26	all_cancers(10;0.0172)|all_epithelial(11;0.0283)|all_lung(10;0.0392)|Lung NSC(10;0.0567)|Ovarian(42;0.142)		OV - Ovarian serous cystadenocarcinoma(31;0.00227)			CAGCTCACCTCGGTGACCAGG	0.647																																																	0													15.0	17.0	16.0					12																	305292		2159	4220	6379	SO:0001587	stop_gained	0			L42300	CCDS8501.1	12p13	2013-07-19	2013-07-19		ENSG00000111181	ENSG00000111181		"""Solute carriers"""	11045	protein-coding gene	gene with protein product	"""betaine/GABA transporter-1"""	603080	"""solute carrier family 6 (neurotransmitter transporter, betaine/GABA), member 12"""			7589472	Standard	NM_003044		Approved	BGT-1	uc009zdh.2	P48065	OTTHUMG00000090309	ENST00000428720.1:c.1324G>T	12.37:g.305292C>A	ENSP00000388184:p.Glu442*		A0AV52|B2R992|D3DUN8	Nonsense_Mutation	SNP	pfam_Na/ntran_symport,pfscan_Na/ntran_symport,prints_Na/ntran_symport,prints_Na/ntran_symport_betaine	p.E442*	ENST00000428720.1	37	c.1324	CCDS8501.1	12	.	.	.	.	.	.	.	.	.	.	C	37	6.324418	0.97476	.	.	ENSG00000111181	ENST00000359674;ENST00000397296;ENST00000428720;ENST00000424061;ENST00000536824	.	.	.	5.45	4.56	0.56223	.	0.060356	0.64402	D	0.000003	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.54805	T	0.06	.	14.3667	0.66810	0.0:0.9283:0.0:0.0717	.	.	.	.	X	442	.	ENSP00000352702:E442X	E	-	1	0	SLC6A12	175553	0.978000	0.34361	0.890000	0.34922	0.435000	0.31806	2.513000	0.45494	1.308000	0.44962	0.563000	0.77884	GAG	SLC6A12	-	pfam_Na/ntran_symport,pfscan_Na/ntran_symport	ENSG00000111181		0.647	SLC6A12-202	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC6A12	HGNC	protein_coding	OTTHUMT00000206671.2		0.00	40	0	C	NM_003044		305292	-1			no_errors	ENST00000359674	ensembl	human	known	74_37	nonsense	5.00	38	2	SNP	0.846	A
SLC9A3R1	9368	genome.wustl.edu	37	17	72764670	72764670	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr17:72764670G>T	ENST00000262613.5	+	6	1147	c.952G>T	c.(952-954)Gac>Tac	p.D318Y	SLC9A3R1_ENST00000413388.2_Missense_Mutation_p.D162Y	NM_004252.4	NP_004243.1	O14745	NHRF1_HUMAN	solute carrier family 9, subfamily A (NHE3, cation proton antiporter 3), member 3 regulator 1	318					actin cytoskeleton organization (GO:0030036)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|bile acid secretion (GO:0032782)|cellular phosphate ion homeostasis (GO:0030643)|cellular protein localization (GO:0034613)|glutathione transport (GO:0034635)|microvillus assembly (GO:0030033)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of platelet-derived growth factor receptor signaling pathway (GO:0010642)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of sodium ion transport (GO:0010766)|negative regulation of sodium:proton antiporter activity (GO:0032416)|phospholipase C-activating dopamine receptor signaling pathway (GO:0060158)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|protein complex assembly (GO:0006461)|regulation of excretion (GO:0044062)|regulation of protein kinase activity (GO:0045859)|regulation of sodium:proton antiporter activity (GO:0032415)|renal absorption (GO:0070293)|renal phosphate ion absorption (GO:0097291)|renal sodium ion transport (GO:0003096)|Wnt signaling pathway (GO:0016055)	actin cytoskeleton (GO:0015629)|apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|cell periphery (GO:0071944)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|membrane raft (GO:0045121)|microvillus (GO:0005902)|microvillus membrane (GO:0031528)|plasma membrane (GO:0005886)|sperm midpiece (GO:0097225)|vesicle (GO:0031982)	beta-2 adrenergic receptor binding (GO:0031698)|beta-catenin binding (GO:0008013)|chloride channel regulator activity (GO:0017081)|growth factor receptor binding (GO:0070851)|PDZ domain binding (GO:0030165)|phosphatase binding (GO:0019902)|protein self-association (GO:0043621)|receptor binding (GO:0005102)			large_intestine(4)	4						CTCCTCCTCCGACCCCATCCT	0.587																																																	0													159.0	165.0	163.0					17																	72764670		2203	4300	6503	SO:0001583	missense	0			AF015926	CCDS11705.1	17q25.1	2014-09-04	2012-03-22		ENSG00000109062	ENSG00000109062			11075	protein-coding gene	gene with protein product		604990	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 3 regulatory factor 1"", ""solute carrier family 9 (sodium/hydrogen exchanger), isoform 3 regulator 1"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 3 regulator 1"""			9314537, 9430655	Standard	NM_004252		Approved	NHERF, EBP50	uc002jlo.4	O14745	OTTHUMG00000178863	ENST00000262613.5:c.952G>T	17.37:g.72764670G>T	ENSP00000262613:p.Asp318Tyr		B3KY21|O43552|Q86WQ5	Missense_Mutation	SNP	pfam_PDZ,pfam_EBP50_C-term,superfamily_PDZ,smart_PDZ,pirsf_NaH_exchngr_reg_CF_NHE-RF,pfscan_PDZ	p.D318Y	ENST00000262613.5	37	c.952	CCDS11705.1	17	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	10.90|10.90	1.481639|1.481639	0.26598|0.26598	.|.	.|.	ENSG00000109062|ENSG00000109062	ENST00000262613|ENST00000413388	T|.	0.37411|.	1.2|.	4.89|4.89	4.89|4.89	0.63831|0.63831	EBP50, C-terminal (1);|.	0.181905|.	0.45126|.	D|.	0.000388|.	T|T	0.54464|0.54464	0.1860|0.1860	L|L	0.34521|0.34521	1.04|1.04	0.38541|0.38541	D|D	0.949227|0.949227	D|.	0.71674|.	0.998|.	D|.	0.74674|.	0.984|.	T|T	0.57888|0.57888	-0.7733|-0.7733	10|6	0.87932|0.42905	D|T	0|0.14	-29.3099|-29.3099	10.8165|10.8165	0.46580|0.46580	0.0902:0.0:0.9098:0.0|0.0902:0.0:0.9098:0.0	.|.	318|.	O14745|.	NHRF1_HUMAN|.	Y|L	318|205	ENSP00000262613:D318Y|.	ENSP00000262613:D318Y|ENSP00000398782:R205L	D|R	+|+	1|2	0|0	SLC9A3R1|SLC9A3R1	70276265|70276265	1.000000|1.000000	0.71417|0.71417	0.994000|0.994000	0.49952|0.49952	0.983000|0.983000	0.72400|0.72400	7.093000|7.093000	0.76937|0.76937	2.270000|2.270000	0.75569|0.75569	0.591000|0.591000	0.81541|0.81541	GAC|CGA	SLC9A3R1	-	pfam_EBP50_C-term,pirsf_NaH_exchngr_reg_CF_NHE-RF	ENSG00000109062		0.587	SLC9A3R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC9A3R1	HGNC	protein_coding	OTTHUMT00000443671.1		0.00	57	0	G			72764670	+1			no_errors	ENST00000262613	ensembl	human	known	74_37	missense	6.06	62	4	SNP	0.991	T
SLIT2	9353	genome.wustl.edu	37	4	20569178	20569178	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr4:20569178G>A	ENST00000504154.1	+	28	3140	c.2888G>A	c.(2887-2889)aGt>aAt	p.S963N	SLIT2_ENST00000273739.5_Missense_Mutation_p.S967N|SLIT2_ENST00000503823.1_Missense_Mutation_p.S955N|SLIT2_ENST00000503837.1_Missense_Mutation_p.S959N	NM_004787.1	NP_004778.1	O94813	SLIT2_HUMAN	slit homolog 2 (Drosophila)	963	EGF-like 2. {ECO:0000255|PROSITE- ProRule:PRU00076}.				apoptotic process involved in luteolysis (GO:0061364)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|branching morphogenesis of an epithelial tube (GO:0048754)|cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to heparin (GO:0071504)|cellular response to hormone stimulus (GO:0032870)|chemorepulsion involved in postnatal olfactory bulb interneuron migration (GO:0021836)|corticospinal neuron axon guidance through spinal cord (GO:0021972)|dorsal/ventral axon guidance (GO:0033563)|in utero embryonic development (GO:0001701)|induction of negative chemotaxis (GO:0050929)|mammary duct terminal end bud growth (GO:0060763)|metanephros development (GO:0001656)|motor neuron axon guidance (GO:0008045)|negative chemotaxis (GO:0050919)|negative regulation of actin filament polymerization (GO:0030837)|negative regulation of axon extension (GO:0030517)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cellular response to growth factor stimulus (GO:0090288)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of gene expression (GO:0010629)|negative regulation of lamellipodium assembly (GO:0010593)|negative regulation of leukocyte chemotaxis (GO:0002689)|negative regulation of monocyte chemotaxis (GO:0090027)|negative regulation of mononuclear cell migration (GO:0071676)|negative regulation of neutrophil chemotaxis (GO:0090024)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of retinal ganglion cell axon guidance (GO:0090260)|negative regulation of small GTPase mediated signal transduction (GO:0051058)|negative regulation of smooth muscle cell chemotaxis (GO:0071672)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of vascular permeability (GO:0043116)|positive regulation of apoptotic process (GO:0043065)|positive regulation of axonogenesis (GO:0050772)|response to cortisol (GO:0051414)|retinal ganglion cell axon guidance (GO:0031290)|Roundabout signaling pathway (GO:0035385)|single organismal cell-cell adhesion (GO:0016337)|ureteric bud development (GO:0001657)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|chemorepellent activity (GO:0045499)|GTPase inhibitor activity (GO:0005095)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|laminin-1 binding (GO:0043237)|protein homodimerization activity (GO:0042803)|proteoglycan binding (GO:0043394)|Roundabout binding (GO:0048495)			NS(1)|breast(4)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(7)|large_intestine(17)|lung(60)|ovary(3)|pancreas(1)|prostate(2)|skin(10)|upper_aerodigestive_tract(1)	116						GCCTGCATCAGTAACCCATGT	0.453																																																	0													144.0	132.0	136.0					4																	20569178		2203	4300	6503	SO:0001583	missense	0			AF055585	CCDS3426.1, CCDS75110.1, CCDS75111.1	4p15.2	2008-08-01	2001-11-28		ENSG00000145147	ENSG00000145147			11086	protein-coding gene	gene with protein product		603746	"""slit (Drosophila) homolog 2"""	SLIL3		9813312, 18269211	Standard	XM_005248211		Approved	Slit-2	uc003gpr.1	O94813	OTTHUMG00000128551	ENST00000504154.1:c.2888G>A	4.37:g.20569178G>A	ENSP00000422591:p.Ser963Asn		B7ZLR5|O95710|Q17RU3|Q9Y5Q7	Missense_Mutation	SNP	pfam_EG-like_dom,pfam_Laminin_G,pfam_Leu-rich_rpt,pfam_LRR-contain_N,pfam_Cys-rich_flank_reg_C,superfamily_ConA-like_lec_gl_sf,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,smart_Fol_N,smart_Laminin_G,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_EG-like_dom,pfscan_Laminin_G	p.S963N	ENST00000504154.1	37	c.2888	CCDS3426.1	4	.	.	.	.	.	.	.	.	.	.	G	19.82	3.898131	0.72639	.	.	ENSG00000145147	ENST00000503823;ENST00000504154;ENST00000273739;ENST00000382173;ENST00000503837;ENST00000511508	D;D;D;D;D	0.98419	-2.68;-2.68;-2.68;-2.68;-4.92	5.98	5.98	0.97165	EGF (1);Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	0.118187	0.85682	D	0.000000	D	0.97632	0.9224	M	0.66297	2.02	0.80722	D	1	B;B	0.15930	0.015;0.01	B;B	0.28638	0.055;0.092	D	0.94703	0.7885	10	0.45353	T	0.12	.	20.5176	0.99214	0.0:0.0:1.0:0.0	.	955;963	O94813-3;O94813	.;SLIT2_HUMAN	N	955;963;967;959;959;175	ENSP00000427548:S955N;ENSP00000422591:S963N;ENSP00000273739:S967N;ENSP00000422261:S959N;ENSP00000421975:S175N	ENSP00000273739:S967N	S	+	2	0	SLIT2	20178276	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	6.751000	0.74893	2.852000	0.98041	0.644000	0.83932	AGT	SLIT2	-	pfam_EG-like_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,pfscan_EG-like_dom	ENSG00000145147		0.453	SLIT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLIT2	HGNC	protein_coding	OTTHUMT00000250396.2	-	0.00	43	0	G			20569178	+1	tier1	-	no_errors	ENST00000504154	ensembl	human	known	74_37	missense	8.51	43	4	SNP	1.000	A
SLITRK1	114798	genome.wustl.edu	37	13	84455568	84455568	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr13:84455568T>G	ENST00000377084.2	-	1	960	c.75A>C	c.(73-75)aaA>aaC	p.K25N		NM_001281503.1|NM_052910.1	NP_001268432.1|NP_443142.1	Q96PX8	SLIK1_HUMAN	SLIT and NTRK-like family, member 1	25	LRRNT 1.				adult behavior (GO:0030534)|axonogenesis (GO:0007409)|homeostatic process (GO:0042592)|multicellular organism growth (GO:0035264)	integral component of membrane (GO:0016021)				NS(2)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|liver(1)|lung(36)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	80	Medulloblastoma(90;0.18)	Breast(118;0.212)		GBM - Glioblastoma multiforme(99;0.07)		AGATCTTCTCTTTGCAAACGT	0.483																																																	0													92.0	91.0	92.0					13																	84455568		2203	4300	6503	SO:0001583	missense	0			AB067497	CCDS9464.1	13q31.1	2004-01-08	2004-01-08		ENSG00000178235	ENSG00000178235			20297	protein-coding gene	gene with protein product		609678	"""leucine rich repeat containing 12"""	LRRC12		14557068, 12975309	Standard	NM_001281503		Approved	KIAA1910	uc001vlk.3	Q96PX8	OTTHUMG00000017149	ENST00000377084.2:c.75A>C	13.37:g.84455568T>G	ENSP00000366288:p.Lys25Asn		Q5U5I6|Q96SF9	Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C	p.K25N	ENST00000377084.2	37	c.75	CCDS9464.1	13	.	.	.	.	.	.	.	.	.	.	T	11.64	1.697590	0.30142	.	.	ENSG00000178235	ENST00000377084	T	0.58940	0.3	4.59	4.59	0.56863	.	0.000000	0.85682	D	0.000000	T	0.48732	0.1516	L	0.41824	1.3	0.50039	D	0.999849	P	0.47409	0.895	B	0.41236	0.351	T	0.52049	-0.8627	10	0.44086	T	0.13	-11.1236	13.2304	0.59941	0.0:0.0:0.0:1.0	.	25	Q96PX8	SLIK1_HUMAN	N	25	ENSP00000366288:K25N	ENSP00000366288:K25N	K	-	3	2	SLITRK1	83353569	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.418000	0.52721	2.050000	0.60909	0.459000	0.35465	AAA	SLITRK1	-	NULL	ENSG00000178235		0.483	SLITRK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLITRK1	HGNC	protein_coding	OTTHUMT00000045396.1	-	0.00	23	0	T	NM_052910		84455568	-1	tier1	-	no_errors	ENST00000377084	ensembl	human	known	74_37	missense	20.00	24	6	SNP	1.000	G
SMAD5	4090	genome.wustl.edu	37	5	135469656	135469656	+	Intron	SNP	A	A	C			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr5:135469656A>C	ENST00000514641.2	+	1	118				SMAD5_ENST00000545620.1_Intron|SMAD5_ENST00000545279.1_Intron|SMAD5-AS1_ENST00000297163.3_RNA			Q99717	SMAD5_HUMAN	SMAD family member 5						BMP signaling pathway (GO:0030509)|bone development (GO:0060348)|cardiac muscle contraction (GO:0060048)|cartilage development (GO:0051216)|cellular response to BMP stimulus (GO:0071773)|cellular response to organic cyclic compound (GO:0071407)|embryonic pattern specification (GO:0009880)|erythrocyte differentiation (GO:0030218)|germ cell development (GO:0007281)|intracellular signal transduction (GO:0035556)|Mullerian duct regression (GO:0001880)|osteoblast fate commitment (GO:0002051)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter involved in cellular response to chemical stimulus (GO:1901522)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ureteric bud development (GO:0001657)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)|transcription factor complex (GO:0005667)	metal ion binding (GO:0046872)|receptor signaling protein activity (GO:0005057)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transforming growth factor beta receptor, pathway-specific cytoplasmic mediator activity (GO:0030618)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|large_intestine(4)|lung(3)	8			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			TAGGTGAGGAATGGCTGAACA	0.552																																																	0																																										SO:0001627	intron_variant	0			U59913	CCDS75308.1	5q31	2008-02-05	2006-11-06	2004-05-26		ENSG00000113658		"""SMADs"""	6771	protein-coding gene	gene with protein product		603110	"""MAD, mothers against decapentaplegic homolog 5 (Drosophila)"", ""SMAD, mothers against DPP homolog 5 (Drosophila)"""	MADH5		8673135	Standard	NM_005903		Approved	Dwfc, JV5-1	uc003lbl.1	Q99717		ENST00000514641.2:c.118+1005A>C	5.37:g.135469656A>C			O14688|Q15798|Q9UQA1	RNA	SNP	-	NULL	ENST00000514641.2	37	NULL		5																																																																																			SMAD5-AS1	-	-	ENSG00000164621		0.552	SMAD5-001	KNOWN	basic	processed_transcript	SMAD5-AS1	HGNC	protein_coding	OTTHUMT00000372096.2	-	0.00	61	0	A	NM_005903		135469656	-1	tier1	-	no_errors	ENST00000297163	ensembl	human	known	74_37	rna	18.60	70	16	SNP	1.000	C
SNRNP200	23020	genome.wustl.edu	37	2	96943977	96943977	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr2:96943977G>T	ENST00000323853.5	-	39	5685	c.5608C>A	c.(5608-5610)Cag>Aag	p.Q1870K	SNRNP200_ENST00000349783.5_Intron	NM_014014.4	NP_054733.2	O75643	U520_HUMAN	small nuclear ribonucleoprotein 200kDa (U5)	1870	SEC63 2.				ATP catabolic process (GO:0006200)|cis assembly of pre-catalytic spliceosome (GO:0000354)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|osteoblast differentiation (GO:0001649)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U5 snRNP (GO:0005682)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|ATP-dependent RNA helicase activity (GO:0004004)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)			breast(3)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(18)|lung(37)|ovary(7)|prostate(4)|skin(5)|stomach(1)|urinary_tract(1)	90						GTCCTCACCTGCCTCAGGAGA	0.552																																																	0													175.0	146.0	156.0					2																	96943977		2203	4300	6503	SO:0001583	missense	0			AL831994	CCDS2020.1	2q11.2	2013-05-13	2008-10-29	2008-10-29	ENSG00000144028	ENSG00000144028			30859	protein-coding gene	gene with protein product	"""U5 snRNP specific protein, 200 KD"""	601664	"""activating signal cointegrator 1 complex subunit 3-like 1"", ""retinitis pigmentosa 33 (autosomal dominant)"""	ASCC3L1, RP33		9872452, 8670905, 9774689, 9539711, 16612614, 19878916	Standard	NM_014014		Approved	U5-200KD, HELIC2, KIAA0788, BRR2	uc002svu.3	O75643	OTTHUMG00000130455	ENST00000323853.5:c.5608C>A	2.37:g.96943977G>T	ENSP00000317123:p.Gln1870Lys		O94884|Q6NZY0|Q6PX59|Q8NBE6|Q96IF2|Q9H7S0	Missense_Mutation	SNP	pfam_Sec63-dom,pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase/UvrB_dom,pfam_Helicase_C,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,smart_Sec63-dom,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.Q1870K	ENST00000323853.5	37	c.5608	CCDS2020.1	2	.	.	.	.	.	.	.	.	.	.	G	14.12	2.439375	0.43326	.	.	ENSG00000144028	ENST00000323853;ENST00000536601;ENST00000543553	T	0.56444	0.46	5.24	5.24	0.73138	Sec63 domain (3);	0.000000	0.85682	D	0.000000	T	0.41880	0.1178	L	0.31294	0.92	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.15378	-1.0439	10	0.22706	T	0.39	-20.3744	16.7058	0.85371	0.0:0.0:1.0:0.0	.	1870	O75643	U520_HUMAN	K	1870;329;453	ENSP00000317123:Q1870K	ENSP00000317123:Q1870K	Q	-	1	0	SNRNP200	96307704	1.000000	0.71417	1.000000	0.80357	0.925000	0.55904	9.244000	0.95423	2.884000	0.98904	0.655000	0.94253	CAG	SNRNP200	-	pfam_Sec63-dom,smart_Sec63-dom	ENSG00000144028		0.552	SNRNP200-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNRNP200	HGNC	protein_coding	OTTHUMT00000252846.2		0.00	35	0	G	NM_014014		96943977	-1			no_errors	ENST00000323853	ensembl	human	known	74_37	missense	10.34	26	3	SNP	1.000	T
SNRPD2	6633	genome.wustl.edu	37	19	46191713	46191713	+	Silent	SNP	G	G	A			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr19:46191713G>A	ENST00000342669.3	-	2	558	c.114C>T	c.(112-114)aaC>aaT	p.N38N	SNRPD2_ENST00000590212.1_Silent_p.N38N|SNRPD2_ENST00000585392.1_5'UTR|SNRPD2_ENST00000391932.3_Silent_p.N28N|SNRPD2_ENST00000588599.1_Silent_p.N28N|SNRPD2_ENST00000587367.1_Silent_p.N28N|SNRPD2_ENST00000588301.1_Silent_p.N38N	NM_004597.5	NP_004588.1	P62316	SMD2_HUMAN	small nuclear ribonucleoprotein D2 polypeptide 16.5kDa	38				N -> S (in Ref. 5; BU531743). {ECO:0000305}.	gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|ncRNA metabolic process (GO:0034660)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|spliceosomal complex assembly (GO:0000245)|spliceosomal snRNP assembly (GO:0000387)	catalytic step 2 spliceosome (GO:0071013)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|methylosome (GO:0034709)|nucleoplasm (GO:0005654)|pICln-Sm protein complex (GO:0034715)|small nuclear ribonucleoprotein complex (GO:0030532)|SMN-Sm protein complex (GO:0034719)|spliceosomal complex (GO:0005681)|U1 snRNP (GO:0005685)|U12-type spliceosomal complex (GO:0005689)|U4 snRNP (GO:0005687)	poly(A) RNA binding (GO:0044822)			breast(1)|large_intestine(1)|lung(2)	4		Ovarian(192;0.051)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00546)|GBM - Glioblastoma multiforme(486;0.0807)|Epithelial(262;0.194)		CTTGGGTATTGTTCTTGACTG	0.547																																																	0													201.0	162.0	175.0					19																	46191713		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS33053.1, CCDS54281.1	19q13.2-q13.3	2011-10-11	2002-08-29		ENSG00000125743	ENSG00000125743			11159	protein-coding gene	gene with protein product	"""snRNP core protein D2"""	601061	"""small nuclear ribonucleoprotein D2 polypeptide (16.5kD)"""	SNRPD1		7527560, 1701240	Standard	NM_004597		Approved	Sm-D2	uc002pcw.3	P62316		ENST00000342669.3:c.114C>T	19.37:g.46191713G>A			A8K797|J3KPM5|P43330	Silent	SNP	pfam_Ribonucl_LSM,superfamily_LSM_dom,smart_Ribonucl_LSM_euk/arc	p.N38	ENST00000342669.3	37	c.114	CCDS33053.1	19																																																																																			SNRPD2	-	pfam_Ribonucl_LSM,superfamily_LSM_dom,smart_Ribonucl_LSM_euk/arc	ENSG00000125743		0.547	SNRPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNRPD2	HGNC	protein_coding	OTTHUMT00000459648.1	-	0.00	78	0	G	NM_004597		46191713	-1	tier1	-	no_errors	ENST00000342669	ensembl	human	known	74_37	silent	5.80	65	4	SNP	1.000	A
SNUPN	10073	genome.wustl.edu	37	15	75890977	75890977	+	Missense_Mutation	SNP	C	C	T	rs138384328		TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr15:75890977C>T	ENST00000564644.1	-	10	1383	c.805G>A	c.(805-807)Gga>Aga	p.G269R	SNUPN_ENST00000371091.5_Missense_Mutation_p.G311R|SNUPN_ENST00000308588.5_Missense_Mutation_p.G269R|SNUPN_ENST00000564675.1_Missense_Mutation_p.G269R|CTD-2323K18.1_ENST00000568707.1_RNA|SNUPN_ENST00000567134.1_Missense_Mutation_p.G269R			O95149	SPN1_HUMAN	snurportin 1	269	Necessary for binding to the m3G-cap structure.				gene expression (GO:0010467)|ncRNA metabolic process (GO:0034660)|protein import into nucleus (GO:0006606)|RNA metabolic process (GO:0016070)|snRNA import into nucleus (GO:0061015)|spliceosomal snRNP assembly (GO:0000387)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nuclear pore (GO:0005643)	protein transporter activity (GO:0008565)|RNA cap binding (GO:0000339)			endometrium(2)|large_intestine(3)|lung(2)|pancreas(1)	8						GGAGTGCTTCCGGGGCTGTAG	0.552													C|||	1	0.000199681	0.0	0.0	5008	,	,		17969	0.0		0.0	False		,,,				2504	0.001																0								C	ARG/GLY,ARG/GLY,ARG/GLY	1,4393	2.1+/-5.4	0,1,2196	106.0	119.0	115.0		805,805,805	5.9	1.0	15	dbSNP_134	115	2,8582	2.2+/-6.3	0,2,4290	yes	missense,missense,missense	SNUPN	NM_001042581.1,NM_001042588.1,NM_005701.3	125,125,125	0,3,6486	TT,TC,CC		0.0233,0.0228,0.0231	probably-damaging,probably-damaging,probably-damaging	269/361,269/361,269/361	75890977	3,12975	2197	4292	6489	SO:0001583	missense	0			AF039029	CCDS10281.1	15q24.2	2008-02-05	2006-07-14	2006-07-14	ENSG00000169371	ENSG00000169371			14245	protein-coding gene	gene with protein product		607902	"""RNA, U transporter 1"""	RNUT1		9670026	Standard	NM_005701		Approved	SNURPORTIN-1, Snurportin1	uc002bas.3	O95149	OTTHUMG00000142833	ENST00000564644.1:c.805G>A	15.37:g.75890977C>T	ENSP00000454852:p.Gly269Arg		A6NE34|A8K0B0|D3DW76	Missense_Mutation	SNP	pfam_Snurportin-1_N,pirsf_Snurportin-1,pfscan_Importin-a_IBB	p.G311R	ENST00000564644.1	37	c.931	CCDS10281.1	15	.	.	.	.	.	.	.	.	.	.	C	34	5.309504	0.95629	2.28E-4	2.33E-4	ENSG00000169371	ENST00000308588;ENST00000371091	T;T	0.65364	-0.15;-0.15	5.9	5.9	0.94986	.	0.000000	0.85682	D	0.000000	T	0.81004	0.4733	M	0.78285	2.405	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.82018	-0.0665	10	0.87932	D	0	-20.7093	19.3122	0.94192	0.0:1.0:0.0:0.0	.	311;269	C9K0X5;O95149	.;SPN1_HUMAN	R	269;311	ENSP00000309831:G269R;ENSP00000360132:G311R	ENSP00000309831:G269R	G	-	1	0	SNUPN	73678032	1.000000	0.71417	0.985000	0.45067	0.988000	0.76386	7.296000	0.78790	2.811000	0.96726	0.555000	0.69702	GGA	SNUPN	-	pirsf_Snurportin-1	ENSG00000169371		0.552	SNUPN-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SNUPN	HGNC	protein_coding	OTTHUMT00000420332.1	-	0.00	51	0	C	NM_005701		75890977	-1	tier1	rs138384328	no_errors	ENST00000371091	ensembl	human	known	74_37	missense	47.62	22	20	SNP	1.000	T
SORCS3	22986	genome.wustl.edu	37	10	106907435	106907435	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr10:106907435C>G	ENST00000369701.3	+	9	1590	c.1363C>G	c.(1363-1365)Cag>Gag	p.Q455E		NM_014978.1	NP_055793.1	Q9UPU3	SORC3_HUMAN	sortilin-related VPS10 domain containing receptor 3	455					learning (GO:0007612)|memory (GO:0007613)|neuropeptide signaling pathway (GO:0007218)|regulation of long term synaptic depression (GO:1900452)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|neuronal postsynaptic density (GO:0097481)	neuropeptide receptor activity (GO:0008188)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(19)|lung(63)|ovary(6)|pancreas(1)|prostate(6)|skin(8)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	131		Colorectal(252;0.134)|Breast(234;0.142)|Lung NSC(174;0.191)		Epithelial(162;1.58e-07)|all cancers(201;1.02e-05)|BRCA - Breast invasive adenocarcinoma(275;0.0628)		AGAATGGAACCAGAACGACAC	0.483																																					NSCLC(116;1497 1690 7108 13108 14106)												0													252.0	201.0	218.0					10																	106907435		2203	4300	6503	SO:0001583	missense	0			AB028982	CCDS7558.1	10q23-q25	2006-04-12			ENSG00000156395	ENSG00000156395			16699	protein-coding gene	gene with protein product		606285				11499680	Standard	NM_014978		Approved	KIAA1059, SORCS	uc001kyi.1	Q9UPU3	OTTHUMG00000019011	ENST00000369701.3:c.1363C>G	10.37:g.106907435C>G	ENSP00000358715:p.Gln455Glu		Q5VXF9|Q9NQJ2	Missense_Mutation	SNP	pfam_PKD_dom,superfamily_PKD_dom,smart_VPS10,pfscan_PKD_dom	p.Q455E	ENST00000369701.3	37	c.1363	CCDS7558.1	10	.	.	.	.	.	.	.	.	.	.	C	24.2	4.507753	0.85282	.	.	ENSG00000156395	ENST00000369701	T	0.36340	1.26	5.27	5.27	0.74061	VPS10 (1);	0.000000	0.85682	D	0.000000	T	0.46927	0.1418	M	0.62088	1.915	0.80722	D	1	P	0.40250	0.709	P	0.44897	0.463	T	0.46317	-0.9200	10	0.54805	T	0.06	.	19.2555	0.93944	0.0:1.0:0.0:0.0	.	455	Q9UPU3	SORC3_HUMAN	E	455	ENSP00000358715:Q455E	ENSP00000358715:Q455E	Q	+	1	0	SORCS3	106897425	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.776000	0.85560	2.639000	0.89480	0.650000	0.86243	CAG	SORCS3	-	smart_VPS10	ENSG00000156395		0.483	SORCS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SORCS3	HGNC	protein_coding	OTTHUMT00000050221.1	-	0.00	61	0	C	NM_014978		106907435	+1	tier1	-	no_errors	ENST00000369701	ensembl	human	known	74_37	missense	16.46	66	13	SNP	1.000	G
SPIDR	23514	genome.wustl.edu	37	8	48353023	48353023	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr8:48353023G>T	ENST00000297423.4	+	8	1400	c.1016G>T	c.(1015-1017)gGc>gTc	p.G339V	SPIDR_ENST00000518074.1_Missense_Mutation_p.G279V|SPIDR_ENST00000521214.1_3'UTR|SPIDR_ENST00000541342.1_Missense_Mutation_p.G269V	NM_001080394.2|NM_001282916.1	NP_001073863.1|NP_001269845.1	Q14159	SPIDR_HUMAN	scaffolding protein involved in DNA repair	339	Necessary for interaction with RAD51.				cellular response to camptothecin (GO:0072757)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to hydroxyurea (GO:0072711)|cellular response to ionizing radiation (GO:0071479)|double-strand break repair via homologous recombination (GO:0000724)|positive regulation of double-strand break repair (GO:2000781)|positive regulation of protein complex assembly (GO:0031334)|regulation of double-strand break repair via homologous recombination (GO:0010569)|regulation of establishment of protein localization to chromosome (GO:0070202)	nuclear chromosome (GO:0000228)											CCTGGAGCTGGCCTGAAAGTT	0.582																																																	0													50.0	53.0	52.0					8																	48353023		1948	4142	6090	SO:0001583	missense	0			AK055680	CCDS43737.1, CCDS64890.1, CCDS64891.1	8q11.21	2013-07-02	2013-07-02	2013-07-02	ENSG00000164808	ENSG00000164808			28971	protein-coding gene	gene with protein product		615384	"""KIAA0146"""	KIAA0146		8590280, 23509288	Standard	XM_005251189		Approved		uc003xqd.3	Q14159	OTTHUMG00000164176	ENST00000297423.4:c.1016G>T	8.37:g.48353023G>T	ENSP00000297423:p.Gly339Val		B4DFV2|B4E0Y6|Q96BI5	Missense_Mutation	SNP	NULL	p.G339V	ENST00000297423.4	37	c.1016	CCDS43737.1	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	0.021|0.021	-1.428406|-1.428406	0.01117|0.01117	.|.	.|.	ENSG00000164808|ENSG00000164808	ENST00000519401|ENST00000297423;ENST00000518074;ENST00000541342;ENST00000524006	.|.	.|.	.|.	4.12|4.12	-4.72|-4.72	0.03269|0.03269	.|.	.|2.317920	.|0.01523	.|N	.|0.018457	T|T	0.27663|0.27663	0.0680|0.0680	L|L	0.34521|0.34521	1.04|1.04	0.09310|0.09310	N|N	0.999999|0.999999	.|B;B;B;B	.|0.26876	.|0.162;0.119;0.063;0.119	.|B;B;B;B	.|0.23574	.|0.038;0.047;0.022;0.047	T|T	0.07693|0.07693	-1.0759|-1.0759	5|9	.|0.17369	.|T	.|0.5	.|.	5.8456|5.8456	0.18663|0.18663	0.5458:0.0:0.3213:0.1329|0.5458:0.0:0.3213:0.1329	.|.	.|279;269;339;339	.|B4E0Y6;B4DFV2;B4DEV5;Q14159	.|.;.;.;K0146_HUMAN	S|V	21|339;279;269;28	.|.	.|ENSP00000297423:G339V	A|G	+|+	1|2	0|0	KIAA0146|KIAA0146	48515576|48515576	0.000000|0.000000	0.05858|0.05858	0.001000|0.001000	0.08648|0.08648	0.026000|0.026000	0.11368|0.11368	-0.432000|-0.432000	0.06956|0.06956	-0.996000|-0.996000	0.03455|0.03455	-0.345000|-0.345000	0.07892|0.07892	GCC|GGC	SPIDR	-	NULL	ENSG00000164808		0.582	SPIDR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SPIDR	HGNC	protein_coding	OTTHUMT00000377611.1		0.00	48	0	G	NM_001080394		48353023	+1			no_errors	ENST00000297423	ensembl	human	known	74_37	missense	5.88	32	2	SNP	0.000	T
SSPO	23145	genome.wustl.edu	37	7	149484958	149484959	+	RNA	INS	-	-	G	rs112418142	byFrequency	TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr7:149484958_149484959insG	ENST00000378016.2	+	0	3713_3714							A2VEC9	SSPO_HUMAN	SCO-spondin						cell adhesion (GO:0007155)	extracellular space (GO:0005615)	peptidase inhibitor activity (GO:0030414)					Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			AGCTGCGACTCGGGGGGTGACT	0.644																																																	0																																												0			AK093431		7q36.1	2013-08-07	2013-08-06		ENSG00000197558	ENSG00000197558			21998	protein-coding gene	gene with protein product	"""subcommissural organ spondin"", ""SCO protein, thrombospondin domain containing"""		"""SCO-spondin homolog (Bos taurus)"""			8743952, 11008217	Standard	NM_198455		Approved	SCO-spondin, KIAA0543, FLJ36112	uc010lpk.3	A2VEC9	OTTHUMG00000157884		7.37:g.149484964_149484964dupG			Q76B61	RNA	INS	-	NULL	ENST00000378016.2	37	NULL		7																																																																																			SSPO	-	-	ENSG00000197558		0.644	SSPO-202	KNOWN	basic	processed_transcript	SSPO	HGNC	processed_transcript			0.00	80	0	-			149484959	+1	tier1		no_errors	ENST00000262089	ensembl	human	known	74_37	rna	41.03	23	16	INS	1.000:0.010	G
STEAP3	55240	genome.wustl.edu	37	2	120003167	120003167	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr2:120003167G>A	ENST00000354888.5	+	3	599	c.95G>A	c.(94-96)gGc>gAc	p.G32D	STEAP3_ENST00000393110.2_Missense_Mutation_p.G42D|STEAP3_ENST00000450943.2_Missense_Mutation_p.G32D|STEAP3_ENST00000425223.2_Missense_Mutation_p.G32D|STEAP3_ENST00000393106.2_Missense_Mutation_p.G32D|STEAP3_ENST00000393108.2_Missense_Mutation_p.G32D|STEAP3_ENST00000393107.2_Missense_Mutation_p.G32D|STEAP3-AS1_ENST00000454260.1_RNA|STEAP3_ENST00000409811.1_Missense_Mutation_p.G32D	NM_182915.2	NP_878919.2	Q658P3	STEA3_HUMAN	STEAP family member 3, metalloreductase	32				G -> S (in Ref. 3; AAL78206/AAM08128 and 6; AAM45136). {ECO:0000305}.	apoptotic process (GO:0006915)|cell cycle (GO:0007049)|cellular iron ion homeostasis (GO:0006879)|copper ion import (GO:0015677)|exosomal secretion (GO:1990182)|ferric iron import into cell (GO:0097461)|positive regulation of apoptotic process (GO:0043065)|positive regulation of intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:1902167)|protein secretion (GO:0009306)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|multivesicular body (GO:0005771)|plasma membrane (GO:0005886)	cupric reductase activity (GO:0008823)|ferric-chelate reductase (NADPH) activity (GO:0052851)|ferric-chelate reductase activity (GO:0000293)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(2)|endometrium(6)|kidney(1)|large_intestine(2)|lung(4)|skin(1)	17						CCCAAAGTGGGCATCCTGGGT	0.622																																																	0													36.0	38.0	38.0					2																	120003167		2203	4300	6503	SO:0001583	missense	0			AY029585	CCDS2125.1, CCDS42738.1	2q14.2	2011-09-30	2011-09-30		ENSG00000115107	ENSG00000115107			24592	protein-coding gene	gene with protein product		609671				12606722	Standard	NM_182915		Approved	TSAP6, dudlin-2, STMP3	uc002tlr.3	Q658P3	OTTHUMG00000131402	ENST00000354888.5:c.95G>A	2.37:g.120003167G>A	ENSP00000346961:p.Gly32Asp		A8K6E3|Q4VBR2|Q4ZG36|Q53SQ8|Q7Z389|Q86SF6|Q8NEW6|Q8TDP3|Q8TF03|Q9NVB5	Missense_Mutation	SNP	pfam_Fe3_Rdtase_TM_dom	p.G42D	ENST00000354888.5	37	c.125	CCDS2125.1	2	.	.	.	.	.	.	.	.	.	.	G	23.3	4.394507	0.83011	.	.	ENSG00000115107	ENST00000393108;ENST00000354888;ENST00000450943;ENST00000393110;ENST00000393106;ENST00000409811;ENST00000393107;ENST00000425223	T;T;T;T;T;T;T;T	0.56611	0.45;0.45;0.45;0.45;0.45;0.45;0.45;0.45	4.96	4.96	0.65561	NAD(P)-binding domain (1);	0.127367	0.52532	D	0.000062	T	0.81123	0.4757	H	0.95679	3.705	0.54753	D	0.999981	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;0.999	D	0.86981	0.2104	9	.	.	.	-35.5872	17.3712	0.87379	0.0:0.0:1.0:0.0	.	32;42;32	B8ZZX6;Q658P3-2;Q658P3	.;.;STEA3_HUMAN	D	32;32;32;42;32;32;32;32	ENSP00000376820:G32D;ENSP00000346961:G32D;ENSP00000396873:G32D;ENSP00000376822:G42D;ENSP00000376818:G32D;ENSP00000386510:G32D;ENSP00000376819:G32D;ENSP00000396214:G32D	.	G	+	2	0	STEAP3	119719637	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	6.026000	0.70873	2.576000	0.86940	0.655000	0.94253	GGC	STEAP3	-	NULL	ENSG00000115107		0.622	STEAP3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	STEAP3	HGNC	protein_coding	OTTHUMT00000254193.1	-	0.00	52	0	G	NM_018234		120003167	+1	tier1	-	no_errors	ENST00000393110	ensembl	human	known	74_37	missense	5.88	64	4	SNP	1.000	A
STK10	6793	genome.wustl.edu	37	5	171509489	171509489	+	Missense_Mutation	SNP	G	G	T	rs144136778	byFrequency	TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr5:171509489G>T	ENST00000176763.5	-	12	2173	c.1830C>A	c.(1828-1830)gaC>gaA	p.D610E	AC113342.1_ENST00000579783.1_RNA	NM_005990.3	NP_005981.3	O94804	STK10_HUMAN	serine/threonine kinase 10	610					cell cycle (GO:0007049)|lymphocyte aggregation (GO:0071593)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of lymphocyte migration (GO:2000401)|signal transduction by phosphorylation (GO:0023014)	extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|polo kinase kinase activity (GO:0042801)|protein homodimerization activity (GO:0042803)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(15)|ovary(6)|pancreas(1)|prostate(1)|testis(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	47	Renal(175;0.000159)|Lung NSC(126;0.0056)|all_lung(126;0.0094)	Medulloblastoma(196;0.00868)|all_neural(177;0.026)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			CTAATTCCGTGTCAAAGAACT	0.537																																																	0													75.0	73.0	74.0					5																	171509489		2203	4300	6503	SO:0001583	missense	0			AB015718	CCDS34290.1	5q35.1	2008-07-18			ENSG00000072786	ENSG00000072786			11388	protein-coding gene	gene with protein product		603919				10199912	Standard	NM_005990		Approved	LOK, PRO2729	uc003mbo.1	O94804	OTTHUMG00000163265	ENST00000176763.5:c.1830C>A	5.37:g.171509489G>T	ENSP00000176763:p.Asp610Glu		A6ND35|B2R8F5|B3KMY1|Q6NSK0|Q9UIW4	Missense_Mutation	SNP	pfam_PKK,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.D610E	ENST00000176763.5	37	c.1830	CCDS34290.1	5	.	.	.	.	.	.	.	.	.	.	G	9.987	1.229629	0.22542	.	.	ENSG00000072786	ENST00000176763;ENST00000545839	T	0.26067	1.76	5.11	3.31	0.37934	.	0.000000	0.85682	D	0.000000	T	0.37892	0.1020	L	0.46885	1.475	0.49582	D	0.999801	D	0.89917	1.0	D	0.79784	0.993	T	0.06356	-1.0831	10	0.23891	T	0.37	.	9.8155	0.40849	0.1729:0.0:0.8271:0.0	.	610	O94804	STK10_HUMAN	E	610	ENSP00000176763:D610E	ENSP00000176763:D610E	D	-	3	2	STK10	171442094	0.695000	0.27747	0.737000	0.30932	0.008000	0.06430	0.964000	0.29306	1.164000	0.42652	-0.136000	0.14681	GAC	STK10	-	pfam_PKK	ENSG00000072786		0.537	STK10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STK10	HGNC	protein_coding	OTTHUMT00000372374.2		0.00	24	0	G	NM_005990		171509489	-1			no_errors	ENST00000176763	ensembl	human	known	74_37	missense	10.26	34	4	SNP	0.891	T
STT3B	201595	genome.wustl.edu	37	3	31663635	31663635	+	Silent	SNP	G	G	T			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr3:31663635G>T	ENST00000295770.2	+	10	1583	c.1374G>T	c.(1372-1374)gtG>gtT	p.V458V		NM_178862.1	NP_849193.1	Q8TCJ2	STT3B_HUMAN	STT3B, subunit of the oligosaccharyltransferase complex (catalytic)	458					co-translational protein modification (GO:0043686)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|glycoprotein catabolic process (GO:0006516)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|response to unfolded protein (GO:0006986)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|oligosaccharyltransferase complex (GO:0008250)	dolichyl-diphosphooligosaccharide-protein glycotransferase activity (GO:0004579)			autonomic_ganglia(1)|biliary_tract(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(3)|prostate(1)|upper_aerodigestive_tract(1)	19						GAGTGATGGTGCGACTGATGT	0.418																																																	0													280.0	246.0	257.0					3																	31663635		2203	4300	6503	SO:0001819	synonymous_variant	0			AK027789	CCDS2650.1	3p24.1	2013-03-06	2013-03-06		ENSG00000163527	ENSG00000163527	2.4.99.18		30611	protein-coding gene	gene with protein product	"""source of immunodominant MHC associated peptides"", ""dolichyl-diphosphooligosaccharide protein glycotransferase"""	608605	"""STT3, subunit of the oligosaccharyltransferase complex, homolog B (S. cerevisiae)"""			12887896, 12439619	Standard	XM_006713017		Approved	SIMP, FLJ90106, STT3-B	uc011axe.2	Q8TCJ2	OTTHUMG00000130673	ENST00000295770.2:c.1374G>T	3.37:g.31663635G>T			Q96JZ4|Q96KY7	Silent	SNP	pfam_Oligo_trans_STT3	p.V458	ENST00000295770.2	37	c.1374	CCDS2650.1	3																																																																																			STT3B	-	pfam_Oligo_trans_STT3	ENSG00000163527		0.418	STT3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STT3B	HGNC	protein_coding	OTTHUMT00000253166.2	-	0.00	31	0	G	NM_178862		31663635	+1	tier1	-	no_errors	ENST00000295770	ensembl	human	known	74_37	silent	10.26	35	4	SNP	0.995	T
SYNGAP1	8831	genome.wustl.edu	37	6	33411523	33411523	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr6:33411523C>T	ENST00000418600.2	+	15	3295	c.3194C>T	c.(3193-3195)cCg>cTg	p.P1065L	SYNGAP1_ENST00000496374.1_3'UTR|SYNGAP1_ENST00000293748.5_Missense_Mutation_p.P1065L|SYNGAP1_ENST00000428982.2_Missense_Mutation_p.P1006L	NM_006772.2	NP_006763.2	Q96PV0	SYGP1_HUMAN	synaptic Ras GTPase activating protein 1	1065					dendrite development (GO:0016358)|negative regulation of axonogenesis (GO:0050771)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of Ras protein signal transduction (GO:0046580)|pattern specification process (GO:0007389)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|receptor clustering (GO:0043113)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of MAPK cascade (GO:0043408)|regulation of synapse structure and activity (GO:0050803)|regulation of synaptic plasticity (GO:0048167)|visual learning (GO:0008542)	cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)	Rab GTPase activator activity (GO:0005097)|Ras GTPase activator activity (GO:0005099)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(15)|ovary(7)|pancreas(1)|stomach(1)|urinary_tract(1)	43						GGGGGCCAGCCGCCTCCATTG	0.677																																																	0													15.0	20.0	18.0					6																	33411523		2189	4278	6467	SO:0001583	missense	0			AB067525	CCDS34434.2	6p21.3	2010-06-25	2010-06-25		ENSG00000197283	ENSG00000197283			11497	protein-coding gene	gene with protein product		603384	"""synaptic Ras GTPase activating protein 1 homolog (rat)"""			9581761, 18323856	Standard	NM_006772		Approved	SYNGAP, RASA5, KIAA1938	uc011dri.2	Q96PV0	OTTHUMG00000031096	ENST00000418600.2:c.3194C>T	6.37:g.33411523C>T	ENSP00000403636:p.Pro1065Leu		A2AB17|A2BEL6|A2BEL7|A8MQC4|Q8TCS2|Q9UGE2	Missense_Mutation	SNP	pfam_DUF3498,pfam_RasGAP,pfam_C2_dom,superfamily_Rho_GTPase_activation_prot,superfamily_C2_dom,smart_Pleckstrin_homology,smart_C2_dom,smart_RasGAP,pfscan_Pleckstrin_homology,pfscan_RasGAP	p.P1065L	ENST00000418600.2	37	c.3194	CCDS34434.2	6	.	.	.	.	.	.	.	.	.	.	C	11.23	1.577140	0.28092	.	.	ENSG00000197283	ENST00000293748;ENST00000418600;ENST00000449372;ENST00000428982	T;T;T	0.21361	2.01;2.01;2.01	4.09	2.09	0.27110	.	1.804940	0.03324	N	0.192379	T	0.14830	0.0358	L	0.49126	1.545	0.49798	D	0.999829	P;D;P	0.61080	0.95;0.989;0.938	B;P;B	0.48030	0.419;0.564;0.295	T	0.35943	-0.9768	10	0.87932	D	0	.	6.4382	0.21835	0.1917:0.6998:0.0:0.1085	.	1065;1065;1065	Q96PV0;Q96PV0-2;Q96PV0-4	SYGP1_HUMAN;.;.	L	1065;1065;1051;1006	ENSP00000293748:P1065L;ENSP00000403636:P1065L;ENSP00000412475:P1006L	ENSP00000293748:P1065L	P	+	2	0	SYNGAP1	33519501	0.246000	0.23909	0.788000	0.31933	0.848000	0.48234	1.089000	0.30890	0.947000	0.37659	0.484000	0.47621	CCG	SYNGAP1	-	pfam_DUF3498	ENSG00000197283		0.677	SYNGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYNGAP1	HGNC	protein_coding	OTTHUMT00000076151.4	-	0.00	28	0	C	XM_166407		33411523	+1	tier1	-	no_errors	ENST00000418600	ensembl	human	known	74_37	missense	37.04	17	10	SNP	0.926	T
TARDBP	23435	genome.wustl.edu	37	1	11080620	11080620	+	Silent	SNP	C	C	T			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr1:11080620C>T	ENST00000240185.3	+	5	792	c.678C>T	c.(676-678)ttC>ttT	p.F226F	TARDBP_ENST00000315091.3_Silent_p.F226F|TARDBP_ENST00000439080.2_Silent_p.F110F	NM_007375.3	NP_031401.1	Q13148	TADBP_HUMAN	TAR DNA binding protein	226	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				3'-UTR-mediated mRNA stabilization (GO:0070935)|cell death (GO:0008219)|mRNA processing (GO:0006397)|negative regulation by host of viral transcription (GO:0043922)|RNA splicing (GO:0008380)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|identical protein binding (GO:0042802)|mRNA 3'-UTR binding (GO:0003730)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(3)|ovary(2)	11	Ovarian(185;0.249)	Lung NSC(185;1.04e-05)|all_lung(284;1.31e-05)|Renal(390;0.000147)|Colorectal(325;0.00205)|Breast(348;0.00262)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)	STAD - Stomach adenocarcinoma(5;0.0578)	UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.37e-07)|COAD - Colon adenocarcinoma(227;7.38e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000299)|Kidney(185;0.000754)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|READ - Rectum adenocarcinoma(331;0.0487)		CCAAGCCATTCAGGGCCTTTG	0.517																																																	0													124.0	122.0	122.0					1																	11080620		2203	4300	6503	SO:0001819	synonymous_variant	0			U23731	CCDS122.1	1p36.22	2014-09-17			ENSG00000120948	ENSG00000120948		"""RNA binding motif (RRM) containing"""	11571	protein-coding gene	gene with protein product		605078				7745706	Standard	NM_007375		Approved	TDP-43, ALS10	uc001art.3	Q13148	OTTHUMG00000002120	ENST00000240185.3:c.678C>T	1.37:g.11080620C>T			A4GUK4|A4GUK5|A4GUK6|B2R629|B4DJ45|E2PU12|Q53H27|Q6FI92|Q96DJ0	Silent	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.F226	ENST00000240185.3	37	c.678	CCDS122.1	1																																																																																			TARDBP	-	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	ENSG00000120948		0.517	TARDBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TARDBP	HGNC	protein_coding	OTTHUMT00000006063.1	-	0.00	74	0	C	NM_007375		11080620	+1	tier1	-	no_errors	ENST00000240185	ensembl	human	known	74_37	silent	15.38	66	12	SNP	1.000	T
TBX5	6910	genome.wustl.edu	37	12	114793480	114793480	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr12:114793480G>T	ENST00000310346.4	-	9	2080	c.1414C>A	c.(1414-1416)Cct>Act	p.P472T	TBX5_ENST00000349716.5_Missense_Mutation_p.P422T|TBX5_ENST00000405440.2_Missense_Mutation_p.P472T	NM_000192.3	NP_000183.2	Q99593	TBX5_HUMAN	T-box 5	472					apoptotic nuclear changes (GO:0030262)|atrial septum morphogenesis (GO:0060413)|atrioventricular valve morphogenesis (GO:0003181)|bundle of His development (GO:0003166)|cardiac left ventricle formation (GO:0003218)|cardiac muscle cell differentiation (GO:0055007)|cell migration involved in coronary vasculogenesis (GO:0060980)|cell-cell signaling (GO:0007267)|embryonic forelimb morphogenesis (GO:0035115)|embryonic limb morphogenesis (GO:0030326)|endocardial cushion development (GO:0003197)|forelimb morphogenesis (GO:0035136)|gene expression (GO:0010467)|heart development (GO:0007507)|lung development (GO:0030324)|morphogenesis of an epithelium (GO:0002009)|negative regulation of cardiac muscle cell proliferation (GO:0060044)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|pattern specification process (GO:0007389)|pericardium development (GO:0060039)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cardioblast differentiation (GO:0051891)|positive regulation of secondary heart field cardioblast proliferation (GO:0072513)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of execution phase of apoptosis (GO:1900117)|transcription initiation from RNA polymerase II promoter (GO:0006367)|ventricular cardiac muscle tissue development (GO:0003229)|ventricular septum development (GO:0003281)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|lung(29)|ovary(6)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	56	Medulloblastoma(191;0.163)|all_neural(191;0.178)			BRCA - Breast invasive adenocarcinoma(302;0.0893)		CCAGTCTGAGGCCCACACTGC	0.627																																					NSCLC(152;1358 1980 4050 23898 40356)												0													35.0	36.0	36.0					12																	114793480		2203	4300	6503	SO:0001583	missense	0			U89353	CCDS9173.1, CCDS9174.1	12q24.1	2014-09-17			ENSG00000089225	ENSG00000089225		"""T-boxes"""	11604	protein-coding gene	gene with protein product		601620		HOS		8988165, 8054982	Standard	NM_000192		Approved		uc001tvo.4	Q99593	OTTHUMG00000166191	ENST00000310346.4:c.1414C>A	12.37:g.114793480G>T	ENSP00000309913:p.Pro472Thr		A6ND77|O15301|Q96TB0|Q9Y4I2	Missense_Mutation	SNP	pfam_TF_T-box,superfamily_p53-like_TF_DNA-bd,smart_TF_T-box,pfscan_TF_T-box,prints_TF_T-box	p.P472T	ENST00000310346.4	37	c.1414	CCDS9173.1	12	.	.	.	.	.	.	.	.	.	.	G	24.2	4.500018	0.85176	.	.	ENSG00000089225	ENST00000349716;ENST00000310346;ENST00000448888;ENST00000405440	T;T;T	0.59224	0.28;0.28;0.28	5.42	5.42	0.78866	.	0.568268	0.19070	N	0.123530	T	0.51534	0.1680	L	0.34521	1.04	0.80722	D	1	P	0.43024	0.798	B	0.39465	0.3	T	0.57728	-0.7761	10	0.62326	D	0.03	.	19.2304	0.93836	0.0:0.0:1.0:0.0	.	472	Q99593	TBX5_HUMAN	T	422;472;369;472	ENSP00000337723:P422T;ENSP00000309913:P472T;ENSP00000384152:P472T	ENSP00000309913:P472T	P	-	1	0	TBX5	113277863	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.476000	0.97823	2.540000	0.85666	0.655000	0.94253	CCT	TBX5	-	NULL	ENSG00000089225		0.627	TBX5-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	TBX5	HGNC	protein_coding	OTTHUMT00000388297.1	-	0.00	50	0	G	NM_080717		114793480	-1	tier1	-	no_errors	ENST00000310346	ensembl	human	known	74_37	missense	9.09	38	4	SNP	1.000	T
TEX13A	56157	genome.wustl.edu	37	X	104463918	104463918	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chrX:104463918G>A	ENST00000413579.1	-	5	1069	c.958C>T	c.(958-960)Cca>Tca	p.P320S	TEX13A_ENST00000372578.3_Silent_p.L320L|TEX13A_ENST00000372575.1_Silent_p.L320L|IL1RAPL2_ENST00000372582.1_Intron|IL1RAPL2_ENST00000344799.4_Intron			Q9BXU3	TX13A_HUMAN	testis expressed 13A	320							zinc ion binding (GO:0008270)			large_intestine(5)|ovary(2)|upper_aerodigestive_tract(1)	8						GTTGCTTGTGGAGGGGATATA	0.537																																																	0													104.0	101.0	102.0					X																	104463918		2179	4280	6459	SO:0001583	missense	0			AF285597	CCDS76005.1	Xq28	2012-04-20	2007-03-13		ENSG00000133149	ENSG00000268629			11735	protein-coding gene	gene with protein product		300312	"""testis expressed sequence 13A"""			11279525	Standard	NM_031274		Approved		uc004ema.3	Q9BXU3	OTTHUMG00000022133	ENST00000413579.1:c.958C>T	X.37:g.104463918G>A	ENSP00000399753:p.Pro320Ser		B1B1G8|Q32NB6	Missense_Mutation	SNP	pfam_Znf_RanBP2,pfscan_Znf_RanBP2	p.P320S	ENST00000413579.1	37	c.958		X	.	.	.	.	.	.	.	.	.	.	G	10.61	1.399521	0.25291	.	.	ENSG00000133149	ENST00000413579	.	.	.	3.08	2.17	0.27698	.	.	.	.	.	T	0.26810	0.0656	L	0.28115	0.83	0.09310	N	1	D	0.54964	0.969	P	0.47075	0.536	T	0.08066	-1.0740	8	0.21014	T	0.42	.	7.1693	0.25708	0.0:0.2734:0.7266:0.0	.	320	Q9BXU3	TX13A_HUMAN	S	320	.	ENSP00000399753:P320S	P	-	1	0	TEX13A	104350574	0.038000	0.19896	0.009000	0.14445	0.023000	0.10783	0.681000	0.25320	0.664000	0.31047	0.436000	0.28706	CCA	TEX13A	-	NULL	ENSG00000133149		0.537	TEX13A-201	KNOWN	basic|appris_principal	protein_coding	TEX13A	HGNC	protein_coding		-	0.00	24	0	G	NM_031274		104463918	-1	tier1	-	no_errors	ENST00000413579	ensembl	human	known	74_37	missense	79.17	5	19	SNP	0.008	A
TFAM	7019	genome.wustl.edu	37	10	60154864	60154864	+	3'UTR	SNP	G	G	T			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr10:60154864G>T	ENST00000487519.1	+	0	1297				TFAM_ENST00000373895.3_3'UTR|TFAM_ENST00000373899.3_3'UTR	NM_001270782.1|NM_003201.2	NP_001257711.1|NP_003192.1	Q00059	TFAM_HUMAN	transcription factor A, mitochondrial						DNA-dependent DNA replication (GO:0006261)|gene expression (GO:0010467)|mitochondrial respiratory chain complex assembly (GO:0033108)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase I promoter (GO:0006356)|transcription from mitochondrial promoter (GO:0006390)|transcription initiation from mitochondrial promoter (GO:0006391)	mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding, bending (GO:0008301)|mitochondrial light strand promoter sense binding (GO:0070363)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)			kidney(1)|large_intestine(1)|lung(4)|prostate(1)	7						GTTCACAATGGATAGGCACAG	0.348																																																	0													55.0	45.0	48.0					10																	60154864		2203	4300	6503	SO:0001624	3_prime_UTR_variant	0			BC018628	CCDS7253.1, CCDS59217.1	10q21	2010-09-24			ENSG00000108064	ENSG00000108064			11741	protein-coding gene	gene with protein product		600438		TCF6, TCF6L2		7789991	Standard	NM_003201		Approved		uc001jkf.4	Q00059	OTTHUMG00000018270	ENST00000487519.1:c.*30G>T	10.37:g.60154864G>T			A8MRB2|A9QXC6|B5BU05|Q5U0C6	RNA	SNP	-	NULL	ENST00000487519.1	37	NULL	CCDS7253.1	10																																																																																			TFAM	-	-	ENSG00000108064		0.348	TFAM-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TFAM	HGNC	protein_coding	OTTHUMT00000048146.1	-	0.00	33	0	G	NM_003201		60154864	+1	tier1	-	no_errors	ENST00000373899	ensembl	human	known	74_37	rna	10.00	36	4	SNP	0.772	T
TM2D3	80213	genome.wustl.edu	37	15	102182790	102182791	+	Frame_Shift_Ins	INS	-	-	C			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr15:102182790_102182791insC	ENST00000333202.3	-	6	640_641	c.635_636insG	c.(634-636)ggcfs	p.G212fs	TM2D3_ENST00000428002.2_Intron|TM2D3_ENST00000561373.1_Frame_Shift_Ins_p.G147fs|TM2D3_ENST00000559107.1_Intron|TM2D3_ENST00000347970.3_Frame_Shift_Ins_p.G186fs	NM_078474.2	NP_510883.2	Q9BRN9	TM2D3_HUMAN	TM2 domain containing 3	212						integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(2)|lung(6)|ovary(1)	10	Lung NSC(78;0.000991)|all_lung(78;0.00128)|Melanoma(26;0.00505)		OV - Ovarian serous cystadenocarcinoma(32;0.000268)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			GCTTGCCGAGGCCTTCCCGCCA	0.574																																																	0																																										SO:0001589	frameshift_variant	0			AK094955	CCDS10392.1, CCDS10393.1	15q26.3	2014-02-12			ENSG00000184277	ENSG00000184277			24128	protein-coding gene	gene with protein product		610014				11278849	Standard	XM_005254980		Approved	BLP2, FLJ22604	uc002bxi.3	Q9BRN9	OTTHUMG00000149872	ENST00000333202.3:c.636dupG	15.37:g.102182792_102182792dupC	ENSP00000330433:p.Gly212fs		B2RDK9|Q9H046|Q9H651	Frame_Shift_Ins	INS	pfam_TM2	p.L213fs	ENST00000333202.3	37	c.636_635	CCDS10393.1	15																																																																																			TM2D3	-	pfam_TM2	ENSG00000184277		0.574	TM2D3-002	KNOWN	basic|CCDS	protein_coding	TM2D3	HGNC	protein_coding	OTTHUMT00000313623.1		0.00	10	0	-	NM_078474		102182791	-1	tier1		no_errors	ENST00000333202	ensembl	human	known	74_37	frame_shift_ins	33.33	4	2	INS	0.994:1.000	C
TM4SF18	116441	genome.wustl.edu	37	3	149051106	149051106	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr3:149051106T>C	ENST00000296059.2	-	2	329	c.64A>G	c.(64-66)Ata>Gta	p.I22V	TM4SF18_ENST00000470080.1_Missense_Mutation_p.I22V|RP11-206M11.7_ENST00000489011.1_RNA	NM_138786.3	NP_620141.1	Q96CE8	T4S18_HUMAN	transmembrane 4 L six family member 18	22						integral component of membrane (GO:0016021)				lung(1)|ovary(1)|prostate(1)	3			LUSC - Lung squamous cell carcinoma(72;0.0378)|Lung(72;0.048)			TTCACGATTATACTCCAAAGT	0.438																																																	0													76.0	73.0	74.0					3																	149051106		2203	4300	6503	SO:0001583	missense	0			BC014339	CCDS3142.1	3q25.1	2005-08-09			ENSG00000163762	ENSG00000163762			25181	protein-coding gene	gene with protein product						10975581	Standard	NM_001184723		Approved	L6D	uc021xfl.1	Q96CE8	OTTHUMG00000159582	ENST00000296059.2:c.64A>G	3.37:g.149051106T>C	ENSP00000296059:p.Ile22Val		B2R8K0|D3DNH5	Missense_Mutation	SNP	pfam_L6_membrane	p.I22V	ENST00000296059.2	37	c.64	CCDS3142.1	3	.	.	.	.	.	.	.	.	.	.	T	17.18	3.324008	0.60634	.	.	ENSG00000163762	ENST00000296059;ENST00000470080;ENST00000474754	T;T;T	0.30448	1.53;1.53;1.53	4.8	4.8	0.61643	.	0.058889	0.64402	D	0.000003	T	0.38134	0.1029	L	0.56199	1.76	0.31989	N	0.604854	B	0.28880	0.226	B	0.40659	0.336	T	0.50294	-0.8845	10	0.38643	T	0.18	-5.5124	14.0068	0.64468	0.0:0.0:0.0:1.0	.	22	Q96CE8	T4S18_HUMAN	V	22	ENSP00000296059:I22V;ENSP00000419278:I22V;ENSP00000418372:I22V	ENSP00000296059:I22V	I	-	1	0	TM4SF18	150533796	1.000000	0.71417	0.928000	0.36995	0.867000	0.49689	5.141000	0.64814	1.777000	0.52277	0.528000	0.53228	ATA	TM4SF18	-	pfam_L6_membrane	ENSG00000163762		0.438	TM4SF18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TM4SF18	HGNC	protein_coding	OTTHUMT00000356326.1		0.00	20	0	T	NM_138786		149051106	-1			no_errors	ENST00000296059	ensembl	human	known	74_37	missense	5.88	48	3	SNP	0.996	C
TNNT2	7139	genome.wustl.edu	37	1	201331138	201331138	+	Frame_Shift_Del	DEL	T	T	-			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr1:201331138delT	ENST00000509001.1	-	13	878	c.592delA	c.(592-594)agtfs	p.S198fs	TNNT2_ENST00000458432.2_Frame_Shift_Del_p.S207fs|TNNT2_ENST00000367318.5_Frame_Shift_Del_p.S198fs|TNNT2_ENST00000360372.4_Frame_Shift_Del_p.S193fs|TNNT2_ENST00000367315.2_Frame_Shift_Del_p.S195fs|TNNT2_ENST00000367320.2_Frame_Shift_Del_p.S165fs|TNNT2_ENST00000236918.7_Frame_Shift_Del_p.S203fs|TNNT2_ENST00000460780.1_5'UTR|TNNT2_ENST00000367322.1_Frame_Shift_Del_p.S195fs|TNNT2_ENST00000421663.2_Frame_Shift_Del_p.S201fs|TNNT2_ENST00000367317.4_Frame_Shift_Del_p.S198fs	NM_001276347.1	NP_001263276.1	P45379	TNNT2_HUMAN	troponin T type 2 (cardiac)	208					ATP catabolic process (GO:0006200)|atrial cardiac muscle tissue morphogenesis (GO:0055009)|muscle filament sliding (GO:0030049)|negative regulation of ATPase activity (GO:0032780)|positive regulation of ATPase activity (GO:0032781)|regulation of heart contraction (GO:0008016)|regulation of muscle contraction (GO:0006937)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cytosol (GO:0005829)|sarcomere (GO:0030017)|striated muscle thin filament (GO:0005865)|troponin complex (GO:0005861)	actin binding (GO:0003779)|structural constituent of cytoskeleton (GO:0005200)|tropomyosin binding (GO:0005523)|troponin C binding (GO:0030172)|troponin I binding (GO:0031013)			breast(2)|cervix(1)|endometrium(3)|large_intestine(4)|liver(1)|lung(9)	20						CTCTTCCCACTTTTCCGCTCT	0.572											OREG0014076	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													97.0	97.0	97.0					1																	201331138		2203	4300	6503	SO:0001589	frameshift_variant	0			X74819	CCDS30968.1, CCDS30969.1, CCDS60390.1, CCDS73002.1, CCDS73003.1	1q32	2014-09-17	2005-09-12		ENSG00000118194	ENSG00000118194			11949	protein-coding gene	gene with protein product		191045	"""troponin T2, cardiac"", ""cardiomyopathy, hypertrophic 2"", ""cardiomyopathy, dilated 1D (autosomal dominant)"""	CMH2, CMD1D		8088824, 8205619, 9482583	Standard	NM_001001430		Approved	CMPD2	uc001gwf.4	P45379	OTTHUMG00000035733	ENST00000509001.1:c.592delA	1.37:g.201331138delT	ENSP00000422031:p.Ser198fs	2121	A2TDB9|A8K3K6|O60214|Q99596|Q99597|Q9BUF6|Q9UM96	Frame_Shift_Del	DEL	pfam_Troponin	p.S207fs	ENST00000509001.1	37	c.619	CCDS30969.1	1																																																																																			TNNT2	-	pfam_Troponin	ENSG00000118194		0.572	TNNT2-008	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	TNNT2	HGNC	protein_coding	OTTHUMT00000360358.1		0.00	46	0	T	NM_000364		201331138	-1	tier1		no_errors	ENST00000458432	ensembl	human	known	74_37	frame_shift_del	6.25	30	2	DEL	0.414	-
TNRC6C	57690	genome.wustl.edu	37	17	76099514	76099514	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr17:76099514G>T	ENST00000588061.1	+	21	5319	c.4592G>T	c.(4591-4593)cGg>cTg	p.R1531L	TNRC6C_ENST00000588847.1_Missense_Mutation_p.R1567L|TNRC6C_ENST00000301624.4_Missense_Mutation_p.R1531L|TNRC6C_ENST00000541771.1_Missense_Mutation_p.R1531L|TNRC6C_ENST00000335749.4_Missense_Mutation_p.R1567L|TNRC6C_ENST00000544502.1_Missense_Mutation_p.R1567L			Q9HCJ0	TNR6C_HUMAN	trinucleotide repeat containing 6C	1531	Silencing domain; interaction with CNOT1 and PAN3.|Sufficient for translational repression when tethered to a target mRNA.				embryonic hemopoiesis (GO:0035162)|endoderm formation (GO:0001706)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|regulation of gene silencing by miRNA (GO:0060964)	cytosol (GO:0005829)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(9)|lung(16)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	40			BRCA - Breast invasive adenocarcinoma(99;0.00269)|Lung(188;0.0973)			TCTACACTGCGGACATTGTGT	0.463																																																	0													92.0	89.0	90.0					17																	76099514		1972	4162	6134	SO:0001583	missense	0			AL834429	CCDS45798.1, CCDS45799.1	17q25.3	2012-10-04			ENSG00000078687	ENSG00000078687		"""Trinucleotide (CAG) repeat containing"""	29318	protein-coding gene	gene with protein product		610741					Standard	NM_018996		Approved	KIAA1582, FLJ20015	uc002juf.2	Q9HCJ0	OTTHUMG00000132642	ENST00000588061.1:c.4592G>T	17.37:g.76099514G>T	ENSP00000468647:p.Arg1531Leu		G3XAB8|Q86UE5|Q8N3D8|Q96MU9	Missense_Mutation	SNP	pfam_Argonaute_hook_dom,pfam_UBA/Ts_N,superfamily_UBA-like,smart_UBA/transl_elong_EF1B_N_euk,pfscan_UBA/transl_elong_EF1B_N_euk	p.R1567L	ENST00000588061.1	37	c.4700	CCDS45798.1	17	.	.	.	.	.	.	.	.	.	.	G	23.2	4.386224	0.82902	.	.	ENSG00000078687	ENST00000455761;ENST00000395801;ENST00000335749;ENST00000301624;ENST00000541771;ENST00000544502	T;T;T;T	0.46819	0.86;0.86;0.86;0.86	4.34	4.34	0.51931	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (1);	0.000000	0.85682	D	0.000000	T	0.68961	0.3058	M	0.76574	2.34	0.80722	D	1	D;D	0.89917	0.997;1.0	D;D	0.91635	0.986;0.999	T	0.74456	-0.3659	10	0.66056	D	0.02	-16.9324	16.864	0.86025	0.0:0.0:1.0:0.0	.	1567;1531	G3XAB8;Q9HCJ0	.;TNR6C_HUMAN	L	1531;1567;1567;1531;1531;1567	ENSP00000336783:R1567L;ENSP00000301624:R1531L;ENSP00000440310:R1531L;ENSP00000442421:R1567L	ENSP00000301624:R1531L	R	+	2	0	TNRC6C	73611109	1.000000	0.71417	0.997000	0.53966	0.990000	0.78478	8.000000	0.88501	1.949000	0.56562	0.561000	0.74099	CGG	TNRC6C	-	NULL	ENSG00000078687		0.463	TNRC6C-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	TNRC6C	HGNC	protein_coding	OTTHUMT00000395947.1	-	0.00	65	0	G	NM_018996		76099514	+1	tier1	-	no_errors	ENST00000335749	ensembl	human	known	74_37	missense	5.71	66	4	SNP	1.000	T
TPTE2	93492	genome.wustl.edu	37	13	20048088	20048089	+	Frame_Shift_Ins	INS	-	-	A			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr13:20048088_20048089insA	ENST00000400230.2	-	6	401_402	c.357_358insT	c.(355-360)tttctcfs	p.L120fs	TPTE2_ENST00000457266.2_Intron|TPTE2_ENST00000255310.6_Frame_Shift_Ins_p.L83fs|TPTE2_ENST00000382975.4_Frame_Shift_Ins_p.L120fs|TPTE2_ENST00000382978.1_Frame_Shift_Ins_p.L120fs|TPTE2_ENST00000390680.2_Frame_Shift_Ins_p.L83fs|TPTE2_ENST00000400103.2_Intron|TPTE2_ENST00000382977.4_Frame_Shift_Ins_p.L120fs			Q6XPS3	TPTE2_HUMAN	transmembrane phosphoinositide 3-phosphatase and tensin homolog 2	120					phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	ion channel activity (GO:0005216)|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity (GO:0016314)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			NS(2)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(8)|lung(21)|pancreas(1)|prostate(8)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	65		all_cancers(29;1.23e-20)|all_lung(29;1.97e-20)|all_epithelial(30;5.86e-20)|Lung NSC(5;3.36e-17)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;1.73e-05)|Epithelial(112;7.42e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000785)|Lung(94;0.0176)|LUSC - Lung squamous cell carcinoma(192;0.089)		ACATCCATGAGAAAAAATAAGC	0.347																																																	0																																										SO:0001589	frameshift_variant	0			AJ421032	CCDS9285.1, CCDS45013.1, CCDS45014.1	13q12.11	2012-12-10			ENSG00000132958	ENSG00000132958		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	17299	protein-coding gene	gene with protein product		606791				11716755, 12717346, 15057823	Standard	NM_130785		Approved	TPIP	uc001umd.3	Q6XPS3	OTTHUMG00000016493	ENST00000400230.2:c.358dupT	13.37:g.20048094_20048094dupA	ENSP00000383089:p.Leu120fs		A1A4X0|A1A4X1|A8MX64|B1AQ16|B4DWZ2|Q5VUH2|Q8WWL4|Q8WWL5	Frame_Shift_Ins	INS	pfam_Tensin_phosphatase_C2-dom,pfam_Ion_trans_dom,pfam_Dual-sp_phosphatase_cat-dom,superfamily_C2_dom,pfscan_Tyr/Dual-sp_Pase,pfscan_Phosphatase_tensin-typ,pfscan_Tensin_phosphatase_C2-dom	p.L119fs	ENST00000400230.2	37	c.358_357	CCDS45014.1	13																																																																																			TPTE2	-	pfam_Ion_trans_dom	ENSG00000132958		0.347	TPTE2-205	KNOWN	basic|appris_principal|CCDS	protein_coding	TPTE2	HGNC	protein_coding			0.00	158	0	-	NM_199254		20048089	-1	tier1		no_errors	ENST00000382977	ensembl	human	known	74_37	frame_shift_ins	13.36	201	31	INS	0.050:0.090	A
TPTEP1	387590	genome.wustl.edu	37	22	17082854	17082854	+	lincRNA	SNP	G	G	T			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr22:17082854G>T	ENST00000426585.1	+	0	0									transmembrane phosphatase with tensin homology pseudogene 1																		GCGAGAGTCTGAGCCGGGGAG	0.721																																																	0																																												0					22q11.1	2013-10-15			ENSG00000100181	ENSG00000100181			43648	pseudogene	pseudogene						14659893	Standard	NR_001591		Approved	psiTPTE22	uc002zlr.3		OTTHUMG00000141300		22.37:g.17082854G>T				RNA	SNP	-	NULL	ENST00000426585.1	37	NULL		22																																																																																			TPTEP1	-	-	ENSG00000100181		0.721	TPTEP1-002	KNOWN	basic	lincRNA	TPTEP1	HGNC	lincRNA	OTTHUMT00000280575.1	-	0.00	27	0	G	NR_001591		17082854	+1	tier1	-	no_errors	ENST00000400593	ensembl	human	known	74_37	rna	22.22	14	4	SNP	0.796	T
TRIM55	84675	genome.wustl.edu	37	8	67062681	67062681	+	Missense_Mutation	SNP	G	G	T	rs145295575		TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr8:67062681G>T	ENST00000315962.4	+	7	1338	c.965G>T	c.(964-966)cGt>cTt	p.R322L	TRIM55_ENST00000350034.4_Intron|TRIM55_ENST00000353317.5_Missense_Mutation_p.R322L|TRIM55_ENST00000276573.7_Missense_Mutation_p.R322L	NM_184085.1	NP_908973.1	Q9BYV6	TRI55_HUMAN	tripartite motif containing 55	322	COS. {ECO:0000255|PROSITE- ProRule:PRU00586}.				signal transduction (GO:0007165)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)	identical protein binding (GO:0042802)|signal transducer activity (GO:0004871)|zinc ion binding (GO:0008270)	p.R322H(1)		breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(13)|ovary(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(2)	39		Lung NSC(129;0.138)|all_lung(136;0.221)	Epithelial(68;0.0136)|all cancers(69;0.0582)|BRCA - Breast invasive adenocarcinoma(89;0.0628)|OV - Ovarian serous cystadenocarcinoma(28;0.0904)			AAGATAATACGTGAAATTGAC	0.428																																																	1	Substitution - Missense(1)	skin(1)											97.0	93.0	94.0					8																	67062681		2203	4300	6503	SO:0001583	missense	0			AJ291712	CCDS6184.1, CCDS6185.1, CCDS6186.1, CCDS6187.1	8q13.1	2013-01-09	2011-01-25	2004-11-17	ENSG00000147573	ENSG00000147573		"""RING-type (C3HC4) zinc fingers"", ""Tripartite motif containing / Tripartite motif containing"""	14215	protein-coding gene	gene with protein product		606469	"""ring finger protein 29"", ""tripartite motif-containing 55"""	RNF29		11243782	Standard	NM_033058		Approved	MURF-2	uc003xvv.3	Q9BYV6	OTTHUMG00000164473	ENST00000315962.4:c.965G>T	8.37:g.67062681G>T	ENSP00000323913:p.Arg322Leu		B3KRC0|B3KRJ3|Q53XX3|Q8IUD9|Q8IUE4|Q96DV2|Q96DV3|Q9BYV5	Missense_Mutation	SNP	pfam_Znf_B-box,pfam_Znf_C3HC4_RING-type,smart_Znf_RING,smart_Znf_B-box,pfscan_Znf_B-box,pfscan_Znf_RING	p.R322L	ENST00000315962.4	37	c.965	CCDS6184.1	8	.	.	.	.	.	.	.	.	.	.	G	18.32	3.597515	0.66332	.	.	ENSG00000147573	ENST00000315962;ENST00000353317;ENST00000276573	T;T;T	0.31769	1.48;1.55;1.49	5.84	5.84	0.93424	COS domain (1);	0.106278	0.64402	D	0.000003	T	0.35537	0.0935	L	0.52266	1.64	0.80722	D	1	B;B;B	0.31640	0.178;0.225;0.333	B;B;B	0.33846	0.109;0.083;0.171	T	0.07009	-1.0795	10	0.48119	T	0.1	.	20.1535	0.98095	0.0:0.0:1.0:0.0	.	322;322;322	Q9BYV6-2;Q9BYV6;Q9BYV6-3	.;TRI55_HUMAN;.	L	322	ENSP00000323913:R322L;ENSP00000297348:R322L;ENSP00000276573:R322L	ENSP00000276573:R322L	R	+	2	0	TRIM55	67225235	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.785000	0.85724	2.764000	0.94973	0.650000	0.86243	CGT	TRIM55	-	NULL	ENSG00000147573		0.428	TRIM55-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM55	HGNC	protein_coding	OTTHUMT00000378921.1		0.00	63	0	G	NM_184085		67062681	+1			no_errors	ENST00000315962	ensembl	human	known	74_37	missense	5.56	34	2	SNP	1.000	T
TRPC4	7223	genome.wustl.edu	37	13	38320271	38320271	+	Nonsense_Mutation	SNP	C	C	A			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr13:38320271C>A	ENST00000379705.3	-	3	1557	c.700G>T	c.(700-702)Gaa>Taa	p.E234*	TRPC4_ENST00000338947.5_Intron|TRPC4_ENST00000379673.2_Nonsense_Mutation_p.E234*|TRPC4_ENST00000355779.2_Nonsense_Mutation_p.E234*|TRPC4_ENST00000426868.2_Nonsense_Mutation_p.E234*|TRPC4_ENST00000379679.1_Intron|TRPC4_ENST00000379681.3_Nonsense_Mutation_p.E234*|TRPC4_ENST00000447043.1_Nonsense_Mutation_p.E234*|TRPC4_ENST00000358477.2_Nonsense_Mutation_p.E234*			Q9UBN4	TRPC4_HUMAN	transient receptor potential cation channel, subfamily C, member 4	234					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|gamma-aminobutyric acid secretion (GO:0014051)|ion transmembrane transport (GO:0034220)|oligodendrocyte differentiation (GO:0048709)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|calcium channel complex (GO:0034704)|caveola (GO:0005901)|cell surface (GO:0009986)|cortical cytoskeleton (GO:0030863)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|inositol 1,4,5 trisphosphate binding (GO:0070679)|store-operated calcium channel activity (GO:0015279)			NS(2)|breast(4)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(26)|lung(30)|ovary(4)|prostate(1)|skin(4)|urinary_tract(2)	83				all cancers(112;1.92e-08)|Epithelial(112;5.04e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000677)|GBM - Glioblastoma multiforme(144;0.00623)|BRCA - Breast invasive adenocarcinoma(63;0.0126)		AATTCATTTTCCACCTTGCTC	0.468																																																	0													134.0	121.0	125.0					13																	38320271		2203	4300	6503	SO:0001587	stop_gained	0			U40983	CCDS9365.1, CCDS45035.1, CCDS45036.1, CCDS45038.1, CCDS45039.1	13q13.3	2013-01-10			ENSG00000133107	ENSG00000133107		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	12336	protein-coding gene	gene with protein product		603651				8646775, 16382100	Standard	NM_016179		Approved	HTRP4, TRP4	uc010abx.3	Q9UBN4	OTTHUMG00000016752	ENST00000379705.3:c.700G>T	13.37:g.38320271C>A	ENSP00000369027:p.Glu234*		B1ALE0|B1ALE1|B1ALE2|Q15721|Q3SWS6|Q96P03|Q96P04|Q96P05|Q9UIB0|Q9UIB1|Q9UIB2	Nonsense_Mutation	SNP	pfam_Ion_trans_dom,pfam_TRP_dom,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,prints_TRPC4_channel,prints_TRPC_channel,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,tigrfam_TRP_channel	p.E234*	ENST00000379705.3	37	c.700	CCDS9365.1	13	.	.	.	.	.	.	.	.	.	.	C	40	8.521024	0.98848	.	.	ENSG00000133107	ENST00000379705;ENST00000379681;ENST00000426868;ENST00000355779;ENST00000358477;ENST00000379673;ENST00000447043	.	.	.	6.07	6.07	0.98685	.	0.043108	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-27.7518	20.6593	0.99626	0.0:1.0:0.0:0.0	.	.	.	.	X	234	.	ENSP00000348025:E234X	E	-	1	0	TRPC4	37218271	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	7.818000	0.86416	2.885000	0.99019	0.655000	0.94253	GAA	TRPC4	-	pfam_TRP_dom,tigrfam_TRP_channel	ENSG00000133107		0.468	TRPC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRPC4	HGNC	protein_coding	OTTHUMT00000044574.2	-	0.00	52	0	C	NM_003306		38320271	-1	tier1	-	no_errors	ENST00000379681	ensembl	human	known	74_37	nonsense	12.07	51	7	SNP	1.000	A
TSHZ3	57616	genome.wustl.edu	37	19	31769567	31769567	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr19:31769567A>G	ENST00000240587.4	-	2	1459	c.1132T>C	c.(1132-1134)Ttt>Ctt	p.F378L		NM_020856.2	NP_065907.2	Q63HK5	TSH3_HUMAN	teashirt zinc finger homeobox 3	378					in utero embryonic development (GO:0001701)|kidney morphogenesis (GO:0060993)|kidney smooth muscle cell differentiation (GO:0072195)|lung development (GO:0030324)|metanephros development (GO:0001656)|musculoskeletal movement (GO:0050881)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of smooth muscle cell differentiation (GO:0051152)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|sensory perception of touch (GO:0050975)|transcription, DNA-templated (GO:0006351)|ureter smooth muscle cell differentiation (GO:0072193)|ureteric bud development (GO:0001657)|ureteric peristalsis (GO:0072105)	growth cone (GO:0030426)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(15)|kidney(9)|large_intestine(20)|lung(60)|ovary(4)|pancreas(2)|prostate(4)|skin(5)	123	Esophageal squamous(110;0.226)					CGGGCCTCAAAGTGCCATGCA	0.552																																																	0													203.0	196.0	198.0					19																	31769567		2203	4300	6503	SO:0001583	missense	0			AL136805	CCDS12421.2	19q13.11	2013-11-20	2007-07-16	2006-03-14	ENSG00000121297	ENSG00000121297		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	30700	protein-coding gene	gene with protein product	"""teashirt 3"""	614119	"""zinc finger protein 537"", ""teashirt family zinc finger 3"""	ZNF537			Standard	NM_020856		Approved	KIAA1474, TSH3	uc002nsy.4	Q63HK5	OTTHUMG00000150184	ENST00000240587.4:c.1132T>C	19.37:g.31769567A>G	ENSP00000240587:p.Phe378Leu		Q9H0G6|Q9P254	Missense_Mutation	SNP	superfamily_Homeodomain-like,smart_Znf_C2H2-like,smart_Homeobox_dom,pfscan_Homeobox_dom,pfscan_Znf_C2H2	p.F378L	ENST00000240587.4	37	c.1132	CCDS12421.2	19	.	.	.	.	.	.	.	.	.	.	A	20.3	3.961172	0.74016	.	.	ENSG00000121297	ENST00000240587	T	0.19532	2.14	5.46	5.46	0.80206	.	0.000000	0.85682	D	0.000000	T	0.33206	0.0855	N	0.24115	0.695	0.80722	D	1	D	0.57257	0.979	D	0.74023	0.982	T	0.13255	-1.0516	10	0.62326	D	0.03	-24.468	15.5394	0.76031	1.0:0.0:0.0:0.0	.	378	Q63HK5	TSH3_HUMAN	L	378	ENSP00000240587:F378L	ENSP00000240587:F378L	F	-	1	0	TSHZ3	36461407	1.000000	0.71417	0.996000	0.52242	0.815000	0.46073	8.930000	0.92872	2.061000	0.61500	0.533000	0.62120	TTT	TSHZ3	-	NULL	ENSG00000121297		0.552	TSHZ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSHZ3	HGNC	protein_coding	OTTHUMT00000316743.2	-	0.00	46	0	A	NM_020856		31769567	-1	tier1	-	no_errors	ENST00000240587	ensembl	human	known	74_37	missense	33.33	18	9	SNP	1.000	G
TTC30B	150737	genome.wustl.edu	37	2	178417117	178417117	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr2:178417117G>T	ENST00000408939.3	-	1	625	c.375C>A	c.(373-375)agC>agA	p.S125R		NM_152517.2	NP_689730.2	Q8N4P2	TT30B_HUMAN	tetratricopeptide repeat domain 30B	125					cilium assembly (GO:0042384)|intraciliary transport (GO:0042073)	cilium (GO:0005929)|intraciliary transport particle B (GO:0030992)		p.S125R(1)		cervix(1)|endometrium(1)|kidney(4)|large_intestine(7)|lung(6)|prostate(1)|skin(2)|urinary_tract(1)	23			OV - Ovarian serous cystadenocarcinoma(117;0.00151)|Epithelial(96;0.00931)|all cancers(119;0.0362)			GATCGCCCTCGCTGTACTTGA	0.632																																																	1	Substitution - Missense(1)	lung(1)											108.0	121.0	117.0					2																	178417117		2202	4299	6501	SO:0001583	missense	0			AK055552	CCDS42784.1	2q31.2	2014-02-21			ENSG00000196659	ENSG00000196659		"""Tetratricopeptide (TTC) repeat domain containing"", ""Intraflagellar transport homologs"""	26425	protein-coding gene	gene with protein product						12477932	Standard	NM_152517		Approved	FLJ30990, fleer, IFT70	uc002uln.3	Q8N4P2	OTTHUMG00000154166	ENST00000408939.3:c.375C>A	2.37:g.178417117G>T	ENSP00000386181:p.Ser125Arg		Q63HQ1|Q96NE6	Missense_Mutation	SNP	smart_TPR_repeat,pfscan_TPR-contain_dom	p.S125R	ENST00000408939.3	37	c.375	CCDS42784.1	2	.	.	.	.	.	.	.	.	.	.	G	3.934	-0.015544	0.07681	.	.	ENSG00000196659	ENST00000500357;ENST00000408939	T	0.77358	-1.09	4.3	-4.53	0.03462	.	0.179890	0.64402	D	0.000016	T	0.49592	0.1566	N	0.08118	0	0.29488	N	0.855876	B	0.10296	0.003	B	0.09377	0.004	T	0.35301	-0.9794	10	0.21014	T	0.42	.	9.2828	0.37737	0.5333:0.1049:0.3617:0.0	.	125	Q8N4P2	TT30B_HUMAN	R	78;125	ENSP00000386181:S125R	ENSP00000386181:S125R	S	-	3	2	TTC30B	178125363	0.012000	0.17670	0.920000	0.36463	0.917000	0.54804	-1.784000	0.01769	-0.993000	0.03467	-0.940000	0.02684	AGC	TTC30B	-	NULL	ENSG00000196659		0.632	TTC30B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTC30B	HGNC	protein_coding	OTTHUMT00000334193.2	-	0.00	43	0	G	NM_152517		178417117	-1	tier1	-	no_errors	ENST00000408939	ensembl	human	known	74_37	missense	9.43	48	5	SNP	0.397	T
TTN	7273	genome.wustl.edu	37	2	179398419	179398419	+	Missense_Mutation	SNP	G	G	T	rs528711725		TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr2:179398419G>T	ENST00000591111.1	-	308	98224	c.98000C>A	c.(97999-98001)aCa>aAa	p.T32667K	TTN-AS1_ENST00000592182.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000431259.2_RNA|TTN-AS1_ENST00000604571.1_RNA|TTN-AS1_ENST00000589434.1_RNA|TTN-AS1_ENST00000585487.1_RNA|TTN-AS1_ENST00000591466.1_RNA|TTN-AS1_ENST00000450692.2_RNA|TTN-AS1_ENST00000587568.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.T25435K|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.T31740K|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000590040.1_RNA|TTN-AS1_ENST00000588244.1_RNA|TTN-AS1_ENST00000442329.2_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000588804.1_RNA|TTN-AS1_ENST00000591867.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.T34308K|TTN-AS1_ENST00000585358.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.T25368K|TTN-AS1_ENST00000586452.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.T25243K|TTN-AS1_ENST00000592836.1_RNA|TTN-AS1_ENST00000588257.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000589842.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000585625.1_RNA|TTN-AS1_ENST00000587944.1_RNA|TTN-AS1_ENST00000589355.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000588716.1_RNA|TTN-AS1_ENST00000589391.1_RNA			Q8WZ42	TITIN_HUMAN	titin	32667	Ig-like 144.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TGACTCAAATGTGTACTTCTT	0.403																																																	0													158.0	143.0	148.0					2																	179398419		1941	4152	6093	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.98000C>A	2.37:g.179398419G>T	ENSP00000465570:p.Thr32667Lys		A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.T31740K	ENST00000591111.1	37	c.95219		2	.	.	.	.	.	.	.	.	.	.	G	15.14	2.745750	0.49151	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.64438	-0.1;-0.1;-0.1;-0.1	5.6	0.703	0.18116	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.44095	0.1277	N	0.05351	-0.065	0.38404	D	0.945737	B;B;B;B	0.21905	0.062;0.062;0.062;0.062	B;B;B;B	0.33196	0.159;0.159;0.159;0.159	T	0.40961	-0.9535	9	0.87932	D	0	.	10.7085	0.45969	0.3174:0.0:0.6826:0.0	.	25243;25368;25435;32667	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	K	31740;25243;25435;25368;25240	ENSP00000343764:T31740K;ENSP00000434586:T25243K;ENSP00000340554:T25435K;ENSP00000352154:T25368K	ENSP00000340554:T25435K	T	-	2	0	TTN	179106665	1.000000	0.71417	0.879000	0.34478	0.277000	0.26821	3.557000	0.53741	0.067000	0.16545	-1.430000	0.01095	ACA	TTN	-	pfam_Ig_I-set,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000155657		0.403	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	-	0.00	49	0	G	NM_133378		179398419	-1	tier1	-	no_errors	ENST00000342992	ensembl	human	known	74_37	missense	6.15	61	4	SNP	0.920	T
TXNDC11	51061	genome.wustl.edu	37	16	11827869	11827873	+	Frame_Shift_Del	DEL	AAAAG	AAAAG	-			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	AAAAG	AAAAG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr16:11827869_11827873delAAAAG	ENST00000356957.3	-	3	641_645	c.534_538delCTTTT	c.(532-540)ttcttttatfs	p.FFY178fs	TXNDC11_ENST00000283033.5_Frame_Shift_Del_p.FFY178fs			Q6PKC3	TXD11_HUMAN	thioredoxin domain containing 11	178	Thioredoxin 1. {ECO:0000255|PROSITE- ProRule:PRU00691}.				cell redox homeostasis (GO:0045454)|protein folding (GO:0006457)|response to endoplasmic reticulum stress (GO:0034976)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	protein disulfide isomerase activity (GO:0003756)			endometrium(3)|large_intestine(5)|lung(7)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	21						ACAGGAAAATAAAAGAAGTGTTTCT	0.341																																																	0																																										SO:0001589	frameshift_variant	0			BC013727	CCDS32387.1	16p13.13	2008-09-29				ENSG00000153066			28030	protein-coding gene	gene with protein product	"""EF-hand binding protein 1"""					8619474, 9110174	Standard	XM_005255346		Approved	EFP1	uc002dbg.1	Q6PKC3		ENST00000356957.3:c.534_538delCTTTT	16.37:g.11827869_11827873delAAAAG	ENSP00000349439:p.Phe178fs		O95887|Q6PJA6|Q8N2Q4|Q96K45|Q96K53	Frame_Shift_Del	DEL	pfam_Thioredoxin_domain,superfamily_Thioredoxin-like_fold	p.F178fs	ENST00000356957.3	37	c.538_534		16																																																																																			TXNDC11	-	pfam_Thioredoxin_domain,superfamily_Thioredoxin-like_fold	ENSG00000153066		0.341	TXNDC11-002	KNOWN	basic|appris_candidate_longest	protein_coding	TXNDC11	HGNC	protein_coding	OTTHUMT00000437057.1		0.00	53	0	AAAAG	NM_015914		11827873	-1			no_errors	ENST00000356957	ensembl	human	known	74_37	frame_shift_del	8.96	61	6	DEL	1.000:1.000:1.000:1.000:1.000	0
UBA1	7317	genome.wustl.edu	37	X	47065781	47065781	+	Nonsense_Mutation	SNP	G	G	T			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chrX:47065781G>T	ENST00000335972.6	+	16	2059	c.1876G>T	c.(1876-1878)Gag>Tag	p.E626*	UBA1_ENST00000377269.3_5'Flank|UBA1_ENST00000490869.1_3'UTR|INE1_ENST00000456273.1_RNA|UBA1_ENST00000377351.4_Nonsense_Mutation_p.E626*	NM_003334.3	NP_003325.2	P22314	UBA1_HUMAN	ubiquitin-like modifier activating enzyme 1	626					cell death (GO:0008219)|cellular response to DNA damage stimulus (GO:0006974)|modification-dependent protein catabolic process (GO:0019941)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|ubiquitin activating enzyme activity (GO:0004839)|ubiquitin-protein transferase activity (GO:0004842)			breast(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(7)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	31						GGACCCACCTGAGAAGTCCAT	0.567																																																	0													95.0	68.0	77.0					X																	47065781		2203	4300	6503	SO:0001587	stop_gained	0			AF258566	CCDS14275.1	Xp11.23	2014-08-13	2007-11-30	2007-11-30	ENSG00000130985	ENSG00000130985	6.3.2.19	"""Ubiquitin-like modifier activating enzymes"""	12469	protein-coding gene	gene with protein product	"""UBA1, ubiquitin-activating enzyme E1 homolog (yeast)"", ""POC20 centriolar protein homolog (Chlamydomonas)"""	314370	"""ubiquitin-activating enzyme E1 (A1S9T and BN75 temperature sensitivity complementing)"", ""ubiquitin-activating enzyme E1"""	A1S9T, GXP1, UBE1		1845793	Standard	NM_153280		Approved	UBE1X, POC20, CFAP124	uc004dhj.4	P22314	OTTHUMG00000021436	ENST00000335972.6:c.1876G>T	X.37:g.47065781G>T	ENSP00000338413:p.Glu626*		Q5JRR8|Q96E13	Nonsense_Mutation	SNP	pfam_ThiF_NAD_FAD-bd,pfam_Ub-activating_enz_e1_C,pfam_UBact_repeat,pfam_Ubiquitin-activating_enzyme,superfamily_Molybdenum_cofac_synth_MoeB,prints_UBQ/SUMO-activ_enz_E1-like,tigrfam_UBQ-activ_enz_E1	p.E626*	ENST00000335972.6	37	c.1876	CCDS14275.1	X	.	.	.	.	.	.	.	.	.	.	G	41	8.561869	0.98863	.	.	ENSG00000130985	ENST00000377351;ENST00000335972	.	.	.	4.92	4.92	0.64577	.	0.155201	0.56097	D	0.000031	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-26.8312	14.3678	0.66817	0.0:0.0:1.0:0.0	.	.	.	.	X	626	.	ENSP00000338413:E626X	E	+	1	0	UBA1	46950725	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.597000	0.82733	2.173000	0.68751	0.597000	0.82753	GAG	UBA1	-	pfam_Ubiquitin-activating_enzyme,superfamily_Molybdenum_cofac_synth_MoeB,tigrfam_UBQ-activ_enz_E1	ENSG00000130985		0.567	UBA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBA1	HGNC	protein_coding	OTTHUMT00000056389.1		0.00	15	0	G	NM_003334		47065781	+1			no_errors	ENST00000335972	ensembl	human	known	74_37	nonsense	18.75	13	3	SNP	1.000	T
UBE3B	89910	genome.wustl.edu	37	12	109972420	109972420	+	Missense_Mutation	SNP	G	G	A	rs376853832		TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr12:109972420G>A	ENST00000342494.3	+	28	3635	c.3040G>A	c.(3040-3042)Gtc>Atc	p.V1014I	UBE3B_ENST00000434735.2_Missense_Mutation_p.V1014I	NM_130466.3	NP_569733.2	Q7Z3V4	UBE3B_HUMAN	ubiquitin protein ligase E3B	1014	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(3)|endometrium(6)|kidney(4)|large_intestine(7)|lung(20)|ovary(2)|urinary_tract(2)	45						TCTGGGCAGCGTCCTCCGGGG	0.642																																																	0								G	ILE/VAL,ILE/VAL	0,4406		0,0,2203	44.0	45.0	45.0		3040,3040	5.3	1.0	12		45	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	UBE3B	NM_130466.2,NM_183415.1	29,29	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging	1014/1069,1014/1069	109972420	1,13005	2203	4300	6503	SO:0001583	missense	0			BC032301	CCDS9129.1, CCDS58277.1	12q24.12	2004-03-02			ENSG00000151148	ENSG00000151148			13478	protein-coding gene	gene with protein product		608047					Standard	NM_130466		Approved		uc001toq.4	Q7Z3V4	OTTHUMG00000169254	ENST00000342494.3:c.3040G>A	12.37:g.109972420G>A	ENSP00000340596:p.Val1014Ile		A5D8Z3|Q05BX9|Q659F7|Q7Z7Q1|Q9BXZ4	Missense_Mutation	SNP	pfam_HECT,pfam_IQ_motif_EF-hand-BS,superfamily_HECT,superfamily_P-loop_NTPase,smart_IQ_motif_EF-hand-BS,smart_HECT,pfscan_HECT,pfscan_IQ_motif_EF-hand-BS	p.V1014I	ENST00000342494.3	37	c.3040	CCDS9129.1	12	.	.	.	.	.	.	.	.	.	.	G	35	5.530174	0.96446	0.0	1.16E-4	ENSG00000151148	ENST00000434735;ENST00000342494	T;T	0.39229	1.09;1.09	5.3	5.3	0.74995	HECT (4);	0.000000	0.85682	D	0.000000	T	0.66963	0.2843	M	0.79805	2.47	0.80722	D	1	D	0.67145	0.996	D	0.68483	0.958	T	0.71414	-0.4600	10	0.66056	D	0.02	-34.1852	17.9631	0.89092	0.0:0.0:1.0:0.0	.	1014	Q7Z3V4	UBE3B_HUMAN	I	1014	ENSP00000391529:V1014I;ENSP00000340596:V1014I	ENSP00000340596:V1014I	V	+	1	0	UBE3B	108456803	1.000000	0.71417	0.994000	0.49952	0.983000	0.72400	9.385000	0.97223	2.474000	0.83562	0.563000	0.77884	GTC	UBE3B	-	pfam_HECT,superfamily_HECT,smart_HECT,pfscan_HECT	ENSG00000151148		0.642	UBE3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBE3B	HGNC	protein_coding	OTTHUMT00000403119.1	-	0.00	25	0	G	NM_183415		109972420	+1	tier1	-	no_errors	ENST00000342494	ensembl	human	known	74_37	missense	31.82	30	14	SNP	1.000	A
UBQLN3	50613	genome.wustl.edu	37	11	5530262	5530262	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr11:5530262A>G	ENST00000311659.4	-	2	674	c.527T>C	c.(526-528)tTc>tCc	p.F176S	HBG2_ENST00000380259.2_Intron	NM_017481.2	NP_059509.1	Q9H347	UBQL3_HUMAN	ubiquilin 3	176										NS(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(16)|ovary(4)|prostate(1)|skin(2)	39		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;1.74e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		ACCCGGGATGAAGGGGTCATC	0.572																																					Ovarian(72;684 1260 12332 41642 52180)												0													70.0	69.0	69.0					11																	5530262		2201	4297	6498	SO:0001583	missense	0			AF230481	CCDS7758.1	11p15	2013-02-12			ENSG00000175520	ENSG00000175520		"""Ubiquilin family"""	12510	protein-coding gene	gene with protein product		605473				10831842	Standard	NM_017481		Approved	TUP-1	uc001may.1	Q9H347	OTTHUMG00000066886	ENST00000311659.4:c.527T>C	11.37:g.5530262A>G	ENSP00000347997:p.Phe176Ser		Q9NRE0	Missense_Mutation	SNP	pfam_Ubiquitin_dom,pfam_Rad60/SUMO_like,pfam_UBA/Ts_N,superfamily_UBA-like,superfamily_ARM-type_fold,smart_Ubiquitin_dom,smart_STI1_HS-bd,smart_UBA/transl_elong_EF1B_N_euk,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Ubiquitin_supergroup	p.F176S	ENST00000311659.4	37	c.527	CCDS7758.1	11	.	.	.	.	.	.	.	.	.	.	A	21.4	4.142653	0.77888	.	.	ENSG00000175520	ENST00000311659;ENST00000445998	T;T	0.52295	1.24;0.67	5.55	5.55	0.83447	.	0.000000	0.49305	D	0.000145	T	0.44973	0.1319	L	0.54323	1.7	0.41624	D	0.988982	B	0.29716	0.255	B	0.29663	0.105	T	0.43814	-0.9368	10	0.48119	T	0.1	-15.5123	13.9369	0.64029	1.0:0.0:0.0:0.0	.	176	Q9H347	UBQL3_HUMAN	S	176	ENSP00000347997:F176S;ENSP00000412561:F176S	ENSP00000347997:F176S	F	-	2	0	UBQLN3	5486838	1.000000	0.71417	0.995000	0.50966	0.985000	0.73830	9.190000	0.94934	2.238000	0.73509	0.477000	0.44152	TTC	UBQLN3	-	NULL	ENSG00000175520		0.572	UBQLN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBQLN3	HGNC	protein_coding	OTTHUMT00000143348.1	-	0.00	33	0	A	NM_017481		5530262	-1	tier1	-	no_errors	ENST00000311659	ensembl	human	known	74_37	missense	21.43	44	12	SNP	1.000	G
UGT2B28	54490	genome.wustl.edu	37	4	70156482	70156482	+	Silent	SNP	G	G	C			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr4:70156482G>C	ENST00000335568.5	+	5	1265	c.1263G>C	c.(1261-1263)tcG>tcC	p.S421S	UGT2B28_ENST00000511240.1_Intron	NM_053039.1	NP_444267.1	Q9BY64	UDB28_HUMAN	UDP glucuronosyltransferase 2 family, polypeptide B28	421					metabolic process (GO:0008152)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	glucuronosyltransferase activity (GO:0015020)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(16)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	31						ACACAATGTCGAGTACAGACC	0.423																																																	0													118.0	126.0	123.0					4																	70156482		2044	4235	6279	SO:0001819	synonymous_variant	0			AF177272	CCDS3528.1, CCDS56330.1	4q13.3	2011-02-09	2005-07-20		ENSG00000135226	ENSG00000135226		"""UDP glucuronosyltransferases"""	13479	protein-coding gene	gene with protein product		606497	"""UDP glycosyltransferase 2 family, polypeptide B28"""			11300766	Standard	NM_053039		Approved		uc003hej.3	Q9BY64	OTTHUMG00000129401	ENST00000335568.5:c.1263G>C	4.37:g.70156482G>C			B5BUM0|Q9BY62|Q9BY63	Silent	SNP	pfam_UDP_glucos_trans,pfam_Glyco_trans_28_C	p.S421	ENST00000335568.5	37	c.1263	CCDS3528.1	4																																																																																			UGT2B28	-	pfam_UDP_glucos_trans,pfam_Glyco_trans_28_C	ENSG00000135226		0.423	UGT2B28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UGT2B28	HGNC	protein_coding	OTTHUMT00000251557.2	-	0.00	164	0	G	NM_053039		70156482	+1	tier1	-	no_errors	ENST00000335568	ensembl	human	known	74_37	silent	25.81	92	32	SNP	0.001	C
UCP1	7350	genome.wustl.edu	37	4	141481057	141481057	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr4:141481057G>A	ENST00000262999.3	-	6	992	c.917C>T	c.(916-918)gCc>gTc	p.A306V		NM_021833.4	NP_068605.1	P25874	UCP1_HUMAN	uncoupling protein 1 (mitochondrial, proton carrier)	306					brown fat cell differentiation (GO:0050873)|cellular metabolic process (GO:0044237)|mitochondrial transport (GO:0006839)|proton transport (GO:0015992)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	oxidative phosphorylation uncoupler activity (GO:0017077)			NS(1)|breast(1)|kidney(1)|large_intestine(4)|lung(6)|ovary(1)|skin(1)|stomach(1)	16	all_hematologic(180;0.162)					TGATTATGTGGCACAGTCCAT	0.383																																																	0													177.0	146.0	156.0					4																	141481057		2203	4300	6503	SO:0001583	missense	0			X51955	CCDS3753.1	4q28-q31	2013-05-22			ENSG00000109424	ENSG00000109424		"""Solute carriers"""	12517	protein-coding gene	gene with protein product		113730		UCP		2380264	Standard	NM_021833		Approved	SLC25A7	uc011chj.2	P25874	OTTHUMG00000133415	ENST00000262999.3:c.917C>T	4.37:g.141481057G>A	ENSP00000262999:p.Ala306Val		Q13218|Q4KMZ3|Q68G66	Missense_Mutation	SNP	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier,prints_Mit_uncoupling	p.A306V	ENST00000262999.3	37	c.917	CCDS3753.1	4	.	.	.	.	.	.	.	.	.	.	G	15.51	2.855832	0.51376	.	.	ENSG00000109424	ENST00000262999	T	0.76968	-1.06	5.23	4.39	0.52855	.	0.370115	0.24298	N	0.039741	T	0.68449	0.3002	L	0.36672	1.1	0.29912	N	0.823452	B;B	0.21381	0.055;0.055	B;B	0.12837	0.008;0.008	T	0.67313	-0.5702	10	0.72032	D	0.01	.	11.8036	0.52141	0.0857:0.0:0.9143:0.0	.	305;306	Q4KMT7;P25874	.;UCP1_HUMAN	V	306	ENSP00000262999:A306V	ENSP00000262999:A306V	A	-	2	0	UCP1	141700507	1.000000	0.71417	0.995000	0.50966	0.958000	0.62258	3.734000	0.55037	1.214000	0.43395	0.591000	0.81541	GCC	UCP1	-	NULL	ENSG00000109424		0.383	UCP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UCP1	HGNC	protein_coding	OTTHUMT00000257273.1	-	0.00	49	0	G			141481057	-1	tier1	-	no_errors	ENST00000262999	ensembl	human	known	74_37	missense	6.25	59	4	SNP	0.867	A
UPK1A	11045	genome.wustl.edu	37	19	36168744	36168744	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr19:36168744G>A	ENST00000222275.2	+	6	679	c.679G>A	c.(679-681)Gac>Aac	p.D227N	UPK1A_ENST00000379013.2_Silent_p.S259S	NM_007000.2	NP_008931.1	O00322	UPK1A_HUMAN	uroplakin 1A	227					epithelial cell differentiation (GO:0030855)|protein oligomerization (GO:0051259)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	monosaccharide binding (GO:0048029)|protein homodimerization activity (GO:0042803)			breast(1)|large_intestine(4)|lung(2)|stomach(2)	9	all_lung(56;2.22e-07)|Lung NSC(56;3.47e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			CCACGCCATCGACAGCTACAC	0.637																																																	0													76.0	64.0	68.0					19																	36168744		2203	4300	6503	SO:0001583	missense	0			AF085807	CCDS12470.1, CCDS62640.1	19q13.1	2013-02-14			ENSG00000105668	ENSG00000105668		"""Tetraspanins"""	12577	protein-coding gene	gene with protein product		611557				9846985, 10404304	Standard	NM_007000		Approved	TSPAN21	uc002oaw.3	O00322	OTTHUMG00000048115	ENST00000222275.2:c.679G>A	19.37:g.36168744G>A	ENSP00000222275:p.Asp227Asn		Q3KNU5|Q3KNU6	Missense_Mutation	SNP	pfam_Tetraspanin/Peripherin,superfamily_Tetraspanin_EC2,prints_Tetraspanin	p.D227N	ENST00000222275.2	37	c.679	CCDS12470.1	19	.	.	.	.	.	.	.	.	.	.	G	6.451	0.451436	0.12223	.	.	ENSG00000105668	ENST00000222275	T	0.78816	-1.21	5.43	3.08	0.35506	Tetraspanin, EC2 domain (1);	.	.	.	.	T	0.51160	0.1658	N	0.02916	-0.46	0.30268	N	0.792564	B	0.10296	0.003	B	0.06405	0.002	T	0.44817	-0.9303	9	0.17832	T	0.49	-1.1535	8.0726	0.30697	0.204:0.0:0.796:0.0	.	227	O00322	UPK1A_HUMAN	N	227	ENSP00000222275:D227N	ENSP00000222275:D227N	D	+	1	0	UPK1A	40860584	0.593000	0.26840	0.997000	0.53966	0.981000	0.71138	0.567000	0.23608	0.542000	0.28846	0.462000	0.41574	GAC	UPK1A	-	pfam_Tetraspanin/Peripherin,superfamily_Tetraspanin_EC2	ENSG00000105668		0.637	UPK1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UPK1A	HGNC	protein_coding	OTTHUMT00000109486.3	-	0.00	81	0	G			36168744	+1	tier1	-	no_errors	ENST00000222275	ensembl	human	known	74_37	missense	5.80	65	4	SNP	0.988	A
USP26	83844	genome.wustl.edu	37	X	132160963	132160963	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chrX:132160963C>A	ENST00000511190.1	-	6	1755	c.1286G>T	c.(1285-1287)gGg>gTg	p.G429V	USP26_ENST00000406273.1_Missense_Mutation_p.G429V|USP26_ENST00000370832.1_Missense_Mutation_p.G429V	NM_031907.1	NP_114113.1	Q9BXU7	UBP26_HUMAN	ubiquitin specific peptidase 26	429	USP.				protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)	nucleus (GO:0005634)	cysteine-type peptidase activity (GO:0008234)|ubiquitinyl hydrolase activity (GO:0036459)			breast(3)|central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(11)|liver(2)|lung(18)|ovary(1)|prostate(2)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(3)	60	Acute lymphoblastic leukemia(192;0.000127)					GCAAGAAAACCCACTGGTGTC	0.373																																					NSCLC(104;342 1621 36940 47097 52632)												0													84.0	79.0	80.0					X																	132160963		2203	4300	6503	SO:0001583	missense	0			AF285593	CCDS14635.1	Xq26.2	2012-07-13	2005-08-08		ENSG00000134588	ENSG00000134588	3.4.19.12	"""Ubiquitin-specific peptidases"""	13485	protein-coding gene	gene with protein product		300309	"""ubiquitin specific protease 26"""			12838346	Standard	NM_031907		Approved		uc011mvf.2	Q9BXU7	OTTHUMG00000022429	ENST00000511190.1:c.1286G>T	X.37:g.132160963C>A	ENSP00000423390:p.Gly429Val		B9WRT6|Q5H9H4	Missense_Mutation	SNP	pfam_Peptidase_C19/C67,pfscan_Peptidase_C19/C67	p.G429V	ENST00000511190.1	37	c.1286	CCDS14635.1	X	.	.	.	.	.	.	.	.	.	.	c	0.005	-2.181718	0.00308	.	.	ENSG00000134588	ENST00000370832;ENST00000511190;ENST00000406273	T;T;T	0.30182	1.54;1.54;1.54	3.62	-6.51	0.01878	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	2.343600	0.02256	N	0.067145	T	0.08935	0.0221	N	0.02539	-0.55	0.09310	N	1	B	0.11235	0.004	B	0.12156	0.007	T	0.18903	-1.0322	10	0.07644	T	0.81	2.7813	2.1252	0.03737	0.3098:0.3904:0.1773:0.1225	.	429	Q9BXU7	UBP26_HUMAN	V	429	ENSP00000359869:G429V;ENSP00000423390:G429V;ENSP00000384360:G429V	ENSP00000359869:G429V	G	-	2	0	USP26	131988629	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.083000	0.11286	-1.566000	0.01673	-1.235000	0.01560	GGG	USP26	-	pfam_Peptidase_C19/C67,pfscan_Peptidase_C19/C67	ENSG00000134588		0.373	USP26-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	USP26	HGNC	protein_coding	OTTHUMT00000359441.1	-	0.00	39	0	C	NM_031907		132160963	-1	tier1	-	no_errors	ENST00000370832	ensembl	human	known	74_37	missense	78.12	7	25	SNP	0.000	A
UTP20	27340	genome.wustl.edu	37	12	101764854	101764854	+	Silent	SNP	C	C	T			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr12:101764854C>T	ENST00000261637.4	+	51	6880	c.6706C>T	c.(6706-6708)Ctg>Ttg	p.L2236L		NM_014503.2	NP_055318.2	O75691	UTP20_HUMAN	UTP20, small subunit (SSU) processome component, homolog (yeast)	2236					endonucleolytic cleavage in 5'-ETS of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000480)|endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000447)|endonucleolytic cleavage to generate mature 5'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000472)|negative regulation of cell proliferation (GO:0008285)|rRNA processing (GO:0006364)	90S preribosome (GO:0030686)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|preribosome, small subunit precursor (GO:0030688)|small-subunit processome (GO:0032040)	poly(A) RNA binding (GO:0044822)	p.L2236L(1)		NS(3)|biliary_tract(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(26)|lung(30)|ovary(2)|prostate(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	88						ATCAAGAAAGCTGTTGGTCCC	0.448																																																	1	Substitution - coding silent(1)	prostate(1)											143.0	139.0	140.0					12																	101764854		2203	4300	6503	SO:0001819	synonymous_variant	0			AJ006778	CCDS9081.1	12q23	2006-02-11				ENSG00000120800			17897	protein-coding gene	gene with protein product	"""down regulated in metastasis"""	612822				9673349, 15590835, 12837249	Standard	NM_014503		Approved	DRIM	uc001tia.1	O75691	OTTHUMG00000170270	ENST00000261637.4:c.6706C>T	12.37:g.101764854C>T			Q9H3H4	Silent	SNP	pfam_DRIM,superfamily_ARM-type_fold	p.L2236	ENST00000261637.4	37	c.6706	CCDS9081.1	12																																																																																			UTP20	-	superfamily_ARM-type_fold	ENSG00000120800		0.448	UTP20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UTP20	HGNC	protein_coding	OTTHUMT00000408242.1		0.00	32	0	C	NM_014503		101764854	+1			no_errors	ENST00000261637	ensembl	human	known	74_37	silent	6.06	31	2	SNP	0.816	T
VAPB	9217	genome.wustl.edu	37	20	57016116	57016116	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr20:57016116C>T	ENST00000475243.1	+	5	888	c.550C>T	c.(550-552)Cgg>Tgg	p.R184W	VAPB_ENST00000395802.3_Intron|VAPB_ENST00000265619.2_3'UTR	NM_004738.4	NP_004729.1	O95292	VAPB_HUMAN	VAMP (vesicle-associated membrane protein)-associated protein B and C	184					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cell death (GO:0008219)|cellular calcium ion homeostasis (GO:0006874)|endoplasmic reticulum unfolded protein response (GO:0030968)|modulation by virus of host morphology or physiology (GO:0019048)|positive regulation of viral genome replication (GO:0045070)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	beta-tubulin binding (GO:0048487)|enzyme binding (GO:0019899)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|structural molecule activity (GO:0005198)			kidney(2)|lung(3)|prostate(1)	6	Lung NSC(12;0.000615)|all_lung(29;0.00186)		BRCA - Breast invasive adenocarcinoma(13;6.2e-12)|Epithelial(14;3.7e-08)|all cancers(14;3.88e-07)			TCAGAGGCTACGGGAGGAGAA	0.428																																																	0													90.0	84.0	86.0					20																	57016116		2203	4300	6503	SO:0001583	missense	0			AF086628	CCDS33498.1, CCDS56198.1	20q13	2014-09-17			ENSG00000124164	ENSG00000124164			12649	protein-coding gene	gene with protein product		605704				9920726	Standard	NM_004738		Approved	VAP-B, VAP-C, ALS8	uc002xza.3	O95292	OTTHUMG00000032840	ENST00000475243.1:c.550C>T	20.37:g.57016116C>T	ENSP00000417175:p.Arg184Trp		A2A2F2|O95293|Q9P0H0	Missense_Mutation	SNP	pfam_MSP_dom,superfamily_PapD-like,pirsf_Vesicle-associated_membrane,pfscan_MSP_dom	p.R184W	ENST00000475243.1	37	c.550	CCDS33498.1	20	.	.	.	.	.	.	.	.	.	.	C	16.17	3.047793	0.55110	.	.	ENSG00000124164	ENST00000475243	T	0.30981	1.51	5.38	4.44	0.53790	.	0.126361	0.56097	D	0.000036	T	0.37571	0.1008	M	0.85197	2.74	0.80722	D	1	B;B	0.26876	0.162;0.022	B;B	0.21917	0.037;0.01	T	0.35425	-0.9789	10	0.66056	D	0.02	-3.827	10.4645	0.44600	0.0:0.8513:0.0:0.1487	.	61;184	B4DNS4;O95292	.;VAPB_HUMAN	W	184	ENSP00000417175:R184W	ENSP00000417175:R184W	R	+	1	2	VAPB	56449522	1.000000	0.71417	0.767000	0.31495	0.999000	0.98932	2.908000	0.48750	1.275000	0.44379	0.650000	0.86243	CGG	VAPB	-	pirsf_Vesicle-associated_membrane	ENSG00000124164		0.428	VAPB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VAPB	HGNC	protein_coding	OTTHUMT00000079875.2		0.00	41	0	C			57016116	+1			no_errors	ENST00000475243	ensembl	human	known	74_37	missense	5.13	37	2	SNP	0.998	T
VPS9D1	9605	genome.wustl.edu	37	16	89778882	89778882	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr16:89778882C>T	ENST00000389386.3	-	6	716	c.592G>A	c.(592-594)Gcc>Acc	p.A198T	VPS9D1_ENST00000565452.1_5'Flank|VPS9D1_ENST00000561976.1_Missense_Mutation_p.A128T|VPS9D1-AS1_ENST00000562866.1_RNA	NM_004913.2	NP_004904.2	Q9Y2B5	VP9D1_HUMAN	VPS9 domain containing 1	198					ATP synthesis coupled proton transport (GO:0015986)		GTPase activator activity (GO:0005096)|transporter activity (GO:0005215)										TCCTCCCGGGCTTTGGCAATC	0.657																																																	0													60.0	66.0	64.0					16																	89778882		1915	4120	6035	SO:0001583	missense	0			AB018551	CCDS42220.1	16q24.3	2012-10-09	2012-10-09	2012-10-09	ENSG00000075399	ENSG00000075399			13526	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 7"""	C16orf7		10231027	Standard	NM_004913		Approved	ATP-BL	uc002fom.1	Q9Y2B5	OTTHUMG00000173219	ENST00000389386.3:c.592G>A	16.37:g.89778882C>T	ENSP00000374037:p.Ala198Thr			Missense_Mutation	SNP	pfam_VPS9,smart_VPS9_subgr,pfscan_VPS9	p.A198T	ENST00000389386.3	37	c.592	CCDS42220.1	16	.	.	.	.	.	.	.	.	.	.	c	34	5.383023	0.95967	.	.	ENSG00000075399	ENST00000389386;ENST00000261625	T	0.13089	2.62	4.94	4.94	0.65067	.	0.000000	0.85682	D	0.000000	T	0.33411	0.0862	M	0.71581	2.175	0.53005	D	0.999966	D	0.67145	0.996	D	0.63381	0.914	T	0.05886	-1.0858	10	0.72032	D	0.01	-20.8406	13.7291	0.62776	0.0:1.0:0.0:0.0	.	198	Q9Y2B5	CP007_HUMAN	T	198;229	ENSP00000374037:A198T	ENSP00000261625:A229T	A	-	1	0	C16orf7	88306383	1.000000	0.71417	0.976000	0.42696	0.986000	0.74619	4.865000	0.62998	2.298000	0.77334	0.479000	0.44913	GCC	VPS9D1	-	NULL	ENSG00000075399		0.657	VPS9D1-002	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	VPS9D1	HGNC	protein_coding	OTTHUMT00000422508.1	-	0.00	78	0	C	NM_004913		89778882	-1	tier1	-	no_errors	ENST00000389386	ensembl	human	known	74_37	missense	46.90	60	53	SNP	1.000	T
VWA5B1	127731	genome.wustl.edu	37	1	20669680	20669680	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr1:20669680C>T	ENST00000375079.2	+	16	2616	c.2420C>T	c.(2419-2421)cCg>cTg	p.P807L	VWA5B1_ENST00000289815.8_Missense_Mutation_p.P807L|VWA5B1_ENST00000375083.4_Missense_Mutation_p.P807L|VWA5B1_ENST00000525343.1_3'UTR	NM_001039500.2	NP_001034589.2	Q5TIE3	VW5B1_HUMAN	von Willebrand factor A domain containing 5B1	807						extracellular region (GO:0005576)				central_nervous_system(1)|endometrium(3)|kidney(1)|prostate(1)|skin(1)	7						ACCCCGGCCCCGGTGCTGGGC	0.716																																																	0													7.0	12.0	10.0					1																	20669680		676	1572	2248	SO:0001583	missense	0			AK125833, AK057346		1p36.12	2014-02-12			ENSG00000158816	ENSG00000158816			26538	protein-coding gene	gene with protein product							Standard	NM_001039500		Approved	FLJ32784	uc009vps.2	Q5TIE3	OTTHUMG00000002835	ENST00000375079.2:c.2420C>T	1.37:g.20669680C>T	ENSP00000364220:p.Pro807Leu		A4IF35|A4IF36|Q3ZCM4|Q6ZUB4|Q96M71	Missense_Mutation	SNP	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	p.P807L	ENST00000375079.2	37	c.2420		1	.	.	.	.	.	.	.	.	.	.	c	11.51	1.661684	0.29515	.	.	ENSG00000158816	ENST00000375089;ENST00000289815;ENST00000375083;ENST00000375079	T;T;T	0.12984	2.63;2.63;2.63	3.89	0.776	0.18532	.	1.938780	0.02840	N	0.127803	T	0.09949	0.0244	N	0.08118	0	0.09310	N	0.999999	B;P;D	0.59767	0.008;0.802;0.986	B;B;P	0.45971	0.001;0.177;0.499	T	0.18304	-1.0341	10	0.56958	D	0.05	-9.7514	6.1109	0.20100	0.0:0.6616:0.1521:0.1862	.	807;807;807	Q5TIE3;Q5TIE3-5;Q5TIE3-2	VW5B1_HUMAN;.;.	L	807	ENSP00000289815:P807L;ENSP00000364224:P807L;ENSP00000364220:P807L	ENSP00000289815:P807L	P	+	2	0	VWA5B1	20542267	0.000000	0.05858	0.014000	0.15608	0.164000	0.22412	0.033000	0.13754	0.139000	0.18822	0.165000	0.16767	CCG	VWA5B1	-	NULL	ENSG00000158816		0.716	VWA5B1-001	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	VWA5B1	HGNC	protein_coding	OTTHUMT00000007945.4	-	0.00	24	0	C	XM_001722222		20669680	+1	tier1	-	no_errors	ENST00000289815	ensembl	human	known	74_37	missense	38.89	11	7	SNP	0.001	T
WASL	8976	genome.wustl.edu	37	7	123332839	123332841	+	In_Frame_Del	DEL	AGG	AGG	-			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	AGG	AGG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr7:123332839_123332841delAGG	ENST00000223023.4	-	9	1239_1241	c.907_909delCCT	c.(907-909)cctdel	p.P303del		NM_003941.2	NP_003932.3	O00401	WASL_HUMAN	Wiskott-Aldrich syndrome-like	303	Pro-rich.				actin polymerization or depolymerization (GO:0008154)|axon guidance (GO:0007411)|cellular component movement (GO:0006928)|cellular protein complex localization (GO:0034629)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|membrane budding (GO:0006900)|mitotic nuclear division (GO:0007067)|nitric oxide metabolic process (GO:0046209)|positive regulation of clathrin-mediated endocytosis (GO:2000370)|positive regulation of filopodium assembly (GO:0051491)|protein complex assembly (GO:0006461)|regulation of nitric-oxide synthase activity (GO:0050999)|regulation of protein localization (GO:0032880)|regulation of transcription, DNA-templated (GO:0006355)|response to bacterium (GO:0009617)|small molecule metabolic process (GO:0044281)|spindle localization (GO:0051653)|transcription, DNA-templated (GO:0006351)|vesicle organization (GO:0016050)|vesicle transport along actin filament (GO:0030050)	actin cap (GO:0030478)|actin cytoskeleton (GO:0015629)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|extracellular vesicular exosome (GO:0070062)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	small GTPase regulator activity (GO:0005083)	p.P303A(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(8)|lung(9)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						TTCCCCTagcaggaggaggagga	0.616																																																	1	Substitution - Missense(1)	kidney(1)																																								SO:0001651	inframe_deletion	0			D88460	CCDS34743.1	7q31.3	2008-02-01			ENSG00000106299	ENSG00000106299			12735	protein-coding gene	gene with protein product		605056				9422512, 9322739	Standard	NM_003941		Approved	N-WASP, NWASP	uc003vkz.3	O00401	OTTHUMG00000157346	ENST00000223023.4:c.907_909delCCT	7.37:g.123332848_123332850delAGG	ENSP00000223023:p.Pro303del		A1JUI9|Q7Z746	In_Frame_Del	DEL	pfam_WH1/EVH1,pfam_CRIB_dom,pfam_WH2_dom,superfamily_WASP_C,smart_WH1/EVH1,smart_CRIB_dom,smart_WH2_dom,pfscan_CRIB_dom,pfscan_WH1/EVH1,pfscan_WH2_dom	p.P303in_frame_del	ENST00000223023.4	37	c.909_907	CCDS34743.1	7																																																																																			WASL	-	superfamily_WASP_C	ENSG00000106299		0.616	WASL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WASL	HGNC	protein_coding	OTTHUMT00000348522.1		0.00	33	0	AGG	NM_003941		123332841	-1	tier1		no_errors	ENST00000223023	ensembl	human	known	74_37	in_frame_del	26.67	11	4	DEL	0.996:1.000:1.000	-
WDFY1	57590	genome.wustl.edu	37	2	224759012	224759012	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr2:224759012A>G	ENST00000233055.4	-	8	872	c.770T>C	c.(769-771)cTc>cCc	p.L257P		NM_020830.3	NP_065881.1	Q8IWB7	WDFY1_HUMAN	WD repeat and FYVE domain containing 1	257						cytosol (GO:0005829)|early endosome (GO:0005769)|nucleus (GO:0005634)	1-phosphatidylinositol binding (GO:0005545)|zinc ion binding (GO:0008270)			NS(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(6)|prostate(2)	18		all_lung(227;0.00682)|Lung NSC(271;0.00859)|Renal(207;0.0112)|all_hematologic(139;0.189)		Epithelial(121;5.34e-10)|all cancers(144;1.67e-07)|Lung(261;0.00807)|LUSC - Lung squamous cell carcinoma(224;0.00843)		ACAGGAGACGAGCTGCCTGGT	0.542																																																	0													173.0	127.0	143.0					2																	224759012		2203	4300	6503	SO:0001583	missense	0			AB037856	CCDS33387.1	2q36.2	2013-01-09	2003-03-13		ENSG00000085449	ENSG00000085449		"""Zinc fingers, FYVE domain containing"", ""WD repeat domain containing"""	20451	protein-coding gene	gene with protein product			"""WD40 and FYVE domain containing 1"""			11739631	Standard	NM_020830		Approved	KIAA1435, FENS-1, WDF1, ZFYVE17	uc002vnq.3	Q8IWB7	OTTHUMG00000153370	ENST00000233055.4:c.770T>C	2.37:g.224759012A>G	ENSP00000233055:p.Leu257Pro		Q53S17|Q9H9D5|Q9P2B3	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_Znf_FYVE,superfamily_WD40_repeat_dom,superfamily_Znf_FYVE_PHD,smart_WD40_repeat,smart_Znf_FYVE,pfscan_Znf_FYVE-rel,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.L257P	ENST00000233055.4	37	c.770	CCDS33387.1	2	.	.	.	.	.	.	.	.	.	.	A	24.3	4.514283	0.85389	.	.	ENSG00000085449	ENST00000233055;ENST00000429915	T;T	0.55052	0.86;0.54	5.73	5.73	0.89815	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40 repeat, conserved site (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	D	0.83046	0.5169	H	0.97918	4.105	0.80722	D	1	D	0.76494	0.999	D	0.91635	0.999	D	0.89556	0.3803	10	0.87932	D	0	-20.9839	16.026	0.80545	1.0:0.0:0.0:0.0	.	257	Q8IWB7	WDFY1_HUMAN	P	257;214	ENSP00000233055:L257P;ENSP00000395416:L214P	ENSP00000233055:L257P	L	-	2	0	WDFY1	224467256	1.000000	0.71417	0.984000	0.44739	0.972000	0.66771	8.582000	0.90791	2.191000	0.70037	0.533000	0.62120	CTC	WDFY1	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000085449		0.542	WDFY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDFY1	HGNC	protein_coding	OTTHUMT00000330908.1		0.00	52	0	A	NM_020830		224759012	-1			no_errors	ENST00000233055	ensembl	human	known	74_37	missense	9.52	38	4	SNP	0.999	G
WDR48	57599	genome.wustl.edu	37	3	39116253	39116253	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr3:39116253T>C	ENST00000302313.5	+	8	737	c.709T>C	c.(709-711)Tgg>Cgg	p.W237R	WDR48_ENST00000396258.3_Missense_Mutation_p.W155R|WDR48_ENST00000544962.1_Missense_Mutation_p.W29R|WDR48_ENST00000418020.1_5'UTR	NM_020839.2	NP_065890.1	Q8TAF3	WDR48_HUMAN	WD repeat domain 48	237					double-strand break repair via homologous recombination (GO:0000724)|embryonic organ development (GO:0048568)|homeostasis of number of cells (GO:0048872)|multicellular organism growth (GO:0035264)|positive regulation of epithelial cell proliferation (GO:0050679)|protein deubiquitination (GO:0016579)|regulation of protein monoubiquitination (GO:1902525)|seminiferous tubule development (GO:0072520)|single fertilization (GO:0007338)|skeletal system morphogenesis (GO:0048705)|skin development (GO:0043588)|spermatogenesis (GO:0007283)|viral process (GO:0016032)	intracellular membrane-bounded organelle (GO:0043231)|lysosome (GO:0005764)|nucleus (GO:0005634)				breast(2)|kidney(1)|large_intestine(2)|lung(4)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	15				KIRC - Kidney renal clear cell carcinoma(284;0.0588)|Kidney(284;0.0738)		AATTCGCCTTTGGTCCCTTGG	0.478																																																	0													140.0	117.0	125.0					3																	39116253		2203	4300	6503	SO:0001583	missense	0			AF468833	CCDS33738.1	3p21.33	2014-06-16			ENSG00000114742	ENSG00000114742		"""WD repeat domain containing"""	30914	protein-coding gene	gene with protein product		612167				10819331, 12196293, 24482476	Standard	NM_020839		Approved	KIAA1449, P80, SPG60	uc003cit.3	Q8TAF3	OTTHUMG00000155972	ENST00000302313.5:c.709T>C	3.37:g.39116253T>C	ENSP00000307491:p.Trp237Arg		B4DM86|B4DQI2|B4DY84|Q63HJ2|Q658Y1|Q8N3Z1|Q9NSK8|Q9P279	Missense_Mutation	SNP	pfam_DUF3337,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.W237R	ENST00000302313.5	37	c.709	CCDS33738.1	3	.	.	.	.	.	.	.	.	.	.	T	28.8	4.954481	0.92726	.	.	ENSG00000114742	ENST00000302313;ENST00000544962;ENST00000396258	D;T;D	0.83506	-1.73;1.18;-1.73	5.86	5.86	0.93980	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	D	0.94105	0.8110	H	0.96111	3.77	0.80722	D	1	D;D;D;D	0.89917	0.994;1.0;1.0;1.0	D;D;D;D	0.97110	0.986;1.0;1.0;1.0	D	0.95790	0.8824	10	0.87932	D	0	-10.5386	16.2644	0.82568	0.0:0.0:0.0:1.0	.	29;155;228;237	Q8TAF3-5;Q8TAF3-4;Q8TAF3-3;Q8TAF3	.;.;.;WDR48_HUMAN	R	237;29;155	ENSP00000307491:W237R;ENSP00000445187:W29R;ENSP00000379557:W155R	ENSP00000307491:W237R	W	+	1	0	WDR48	39091257	1.000000	0.71417	0.978000	0.43139	0.993000	0.82548	8.040000	0.89188	2.244000	0.73946	0.528000	0.53228	TGG	WDR48	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	ENSG00000114742		0.478	WDR48-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR48	HGNC	protein_coding	OTTHUMT00000342529.1	-	0.00	68	0	T	NM_020839		39116253	+1	tier1	-	no_errors	ENST00000302313	ensembl	human	known	74_37	missense	6.90	54	4	SNP	1.000	C
WDR72	256764	genome.wustl.edu	37	15	53908282	53908282	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr15:53908282G>T	ENST00000396328.1	-	15	2360	c.2121C>A	c.(2119-2121)ttC>ttA	p.F707L	WDR72_ENST00000559418.1_Missense_Mutation_p.F717L|WDR72_ENST00000360509.5_Missense_Mutation_p.F707L|WDR72_ENST00000557913.1_Missense_Mutation_p.F704L	NM_001277176.1|NM_182758.2	NP_001264105.1|NP_877435.3	Q3MJ13	WDR72_HUMAN	WD repeat domain 72	707										NS(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(18)|lung(29)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	71				all cancers(107;0.0511)		CACCACCATAGAATGAACTGG	0.443																																																	0													94.0	84.0	88.0					15																	53908282		2194	4293	6487	SO:0001583	missense	0			BX537884	CCDS10151.1, CCDS73730.1	15q21.3	2013-01-09			ENSG00000166415	ENSG00000166415		"""WD repeat domain containing"""	26790	protein-coding gene	gene with protein product		613214					Standard	NM_182758		Approved	FLJ38736	uc002acj.2	Q3MJ13	OTTHUMG00000131939	ENST00000396328.1:c.2121C>A	15.37:g.53908282G>T	ENSP00000379619:p.Phe707Leu		Q7Z3I3|Q8N8X2	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.F707L	ENST00000396328.1	37	c.2121	CCDS10151.1	15	.	.	.	.	.	.	.	.	.	.	G	0.645	-0.811686	0.02798	.	.	ENSG00000166415	ENST00000396328;ENST00000360509	T;T	0.33216	1.42;1.42	5.37	2.23	0.28157	.	0.214179	0.41712	D	0.000834	T	0.12092	0.0294	N	0.16656	0.425	0.09310	N	1	B	0.09022	0.002	B	0.09377	0.004	T	0.31943	-0.9925	10	0.02654	T	1	.	3.7169	0.08441	0.2253:0.1218:0.5409:0.112	.	707	Q3MJ13	WDR72_HUMAN	L	707	ENSP00000379619:F707L;ENSP00000353699:F707L	ENSP00000353699:F707L	F	-	3	2	WDR72	51695574	1.000000	0.71417	0.841000	0.33234	0.596000	0.36781	1.648000	0.37271	0.655000	0.30866	0.313000	0.20887	TTC	WDR72	-	NULL	ENSG00000166415		0.443	WDR72-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	WDR72	HGNC	protein_coding	OTTHUMT00000254893.2		0.00	55	0	G	NM_182758		53908282	-1			no_errors	ENST00000360509	ensembl	human	known	74_37	missense	9.38	29	3	SNP	0.023	T
XIRP2	129446	genome.wustl.edu	37	2	168103321	168103321	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr2:168103321G>T	ENST00000409195.1	+	9	5508	c.5419G>T	c.(5419-5421)Gac>Tac	p.D1807Y	XIRP2_ENST00000409273.1_Missense_Mutation_p.D1585Y|XIRP2_ENST00000409728.1_Intron|XIRP2_ENST00000409043.1_Intron|XIRP2_ENST00000295237.9_Missense_Mutation_p.D1807Y|XIRP2_ENST00000420519.1_Intron|XIRP2_ENST00000409605.1_Intron|XIRP2_ENST00000409756.2_Intron	NM_152381.5	NP_689594.4	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2	1632					actin cytoskeleton organization (GO:0030036)|cardiac muscle tissue morphogenesis (GO:0055008)|cell-cell junction organization (GO:0045216)|ventricular septum development (GO:0003281)	cell junction (GO:0030054)|Z disc (GO:0030018)				NS(3)|biliary_tract(2)|breast(5)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(51)|lung(160)|ovary(7)|pancreas(3)|prostate(11)|skin(14)|stomach(5)|upper_aerodigestive_tract(8)|urinary_tract(7)	315						TAGTGAAACTGACATCATCCC	0.393																																																	0													171.0	159.0	163.0					2																	168103321		1932	4143	6075	SO:0001583	missense	0			AK056582	CCDS42768.1, CCDS42769.1, CCDS56143.1, CCDS56144.1, CCDS56145.1	2q31.1	2013-10-25	2007-06-27	2007-06-27	ENSG00000163092	ENSG00000163092			14303	protein-coding gene	gene with protein product	"""myomaxin"""	609778	"""cardiomyopathy associated 3"""	CMYA3		17046827, 12203715, 15454575	Standard	NM_001079810		Approved		uc002udx.3	A4UGR9	OTTHUMG00000154027	ENST00000409195.1:c.5419G>T	2.37:g.168103321G>T	ENSP00000386840:p.Asp1807Tyr		A0PJ94|B2BBS0|B2BBS1|B2BBS4|B3KVH0|J3KNB1|Q53R52|Q5MJ67|Q702N7|Q86T36|Q86T38|Q86T46|Q86T51|Q86T53|Q86T55|Q86T79|Q86TB6|Q8N1M9|Q8N3R5|Q8TBV6	Missense_Mutation	SNP	pfam_Actin-binding_Xin_repeat	p.D1807Y	ENST00000409195.1	37	c.5419	CCDS42769.1	2	.	.	.	.	.	.	.	.	.	.	G	17.69	3.450934	0.63290	.	.	ENSG00000163092	ENST00000409195;ENST00000295237;ENST00000409273	T;T;T	0.05139	3.5;3.5;3.49	5.59	5.59	0.84812	.	0.046814	0.85682	D	0.000000	T	0.28366	0.0701	M	0.77103	2.36	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.97110	0.962;0.983;1.0	T	0.00684	-1.1611	10	0.87932	D	0	-17.4855	18.3707	0.90406	0.0:0.0:1.0:0.0	.	1632;1632;1585	A4UGR9;A4UGR9-3;A4UGR9-2	XIRP2_HUMAN;.;.	Y	1807;1807;1585	ENSP00000386840:D1807Y;ENSP00000295237:D1807Y;ENSP00000387255:D1585Y	ENSP00000295237:D1807Y	D	+	1	0	XIRP2	167811567	1.000000	0.71417	1.000000	0.80357	0.766000	0.43426	6.176000	0.71955	2.642000	0.89623	0.650000	0.86243	GAC	XIRP2	-	NULL	ENSG00000163092		0.393	XIRP2-001	KNOWN	basic|CCDS	protein_coding	XIRP2	HGNC	protein_coding	OTTHUMT00000333547.1	-	0.00	24	0	G	NM_152381		168103321	+1	tier1	-	no_errors	ENST00000295237	ensembl	human	known	74_37	missense	15.38	22	4	SNP	1.000	T
XKR7	343702	genome.wustl.edu	37	20	30584967	30584967	+	Nonsense_Mutation	SNP	G	G	T			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr20:30584967G>T	ENST00000562532.2	+	3	1621	c.1447G>T	c.(1447-1449)Gag>Tag	p.E483*		NM_001011718.1	NP_001011718.1	Q5GH72	XKR7_HUMAN	XK, Kell blood group complex subunit-related family, member 7	483						integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|liver(1)|lung(19)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	34			Colorectal(19;0.00306)|COAD - Colon adenocarcinoma(19;0.0347)			TACAGGTGCTGAGCGGGATGG	0.687																																																	0													29.0	31.0	30.0					20																	30584967		2203	4299	6502	SO:0001587	stop_gained	0			AY534245	CCDS33459.1	20q11.21	2014-07-16	2006-01-12		ENSG00000260903	ENSG00000260903			23062	protein-coding gene	gene with protein product			"""X Kell blood group precursor-related family, member 7"", ""chromosome 20 open reading frame 159"""	C20orf159			Standard	NM_001011718		Approved	dJ310O13.4	uc002wxe.3	Q5GH72	OTTHUMG00000032198	ENST00000562532.2:c.1447G>T	20.37:g.30584967G>T	ENSP00000477059:p.Glu483*		Q9NUG5	Nonsense_Mutation	SNP	pfam_Transport_prot_XK	p.E483*	ENST00000562532.2	37	c.1447	CCDS33459.1	20	.	.	.	.	.	.	.	.	.	.	G	37	6.202741	0.97371	.	.	ENSG00000101321	ENST00000217299	.	.	.	4.85	4.85	0.62838	.	0.782790	0.12288	N	0.482266	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.40728	T	0.16	-7.2848	15.2794	0.73770	0.0:0.0:1.0:0.0	.	.	.	.	X	483	.	ENSP00000217299:E483X	E	+	1	0	XKR7	30048628	1.000000	0.71417	0.950000	0.38849	0.836000	0.47400	6.421000	0.73353	2.518000	0.84900	0.561000	0.74099	GAG	XKR7	-	NULL	ENSG00000260903		0.687	XKR7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XKR7	HGNC	protein_coding	OTTHUMT00000078597.3		0.00	34	0	G	NM_001011718		30584967	+1			no_errors	ENST00000562532	ensembl	human	known	74_37	nonsense	6.12	46	3	SNP	1.000	T
XRRA1	143570	genome.wustl.edu	37	11	74651896	74651896	+	Frame_Shift_Del	DEL	C	C	-	rs558916942		TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr11:74651896delC	ENST00000340360.6	-	3	359	c.28delG	c.(28-30)gatfs	p.D11fs	XRRA1_ENST00000321448.8_Intron|XRRA1_ENST00000527087.1_Frame_Shift_Del_p.D11fs|XRRA1_ENST00000533598.1_Intron	NM_182969.2	NP_892014.1			X-ray radiation resistance associated 1											breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(8)|prostate(3)	20						TTCCCATCATCCAGCTTGTAG	0.517																																																	0													57.0	57.0	57.0					11																	74651896		2145	4273	6418	SO:0001589	frameshift_variant	0			AK074152	CCDS44680.1, CCDS58159.1, CCDS58160.1	11q13.4	2010-03-19			ENSG00000166435	ENSG00000166435			18868	protein-coding gene	gene with protein product		609788				12908878, 17295261	Standard	NM_182969		Approved	FLJ00225	uc009yub.3	Q6P2D8		ENST00000340360.6:c.28delG	11.37:g.74651896delC	ENSP00000339918:p.Asp11fs			Frame_Shift_Del	DEL	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.D10fs	ENST00000340360.6	37	c.28	CCDS44680.1	11																																																																																			XRRA1	-	NULL	ENSG00000166435		0.517	XRRA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XRRA1	HGNC	protein_coding	OTTHUMT00000384715.1		0.00	49	0	C	NM_182969		74651896	-1	tier1		no_errors	ENST00000340360	ensembl	human	known	74_37	frame_shift_del	11.76	15	2	DEL	1.000	-
ZFC3H1	196441	genome.wustl.edu	37	12	72057007	72057007	+	Missense_Mutation	SNP	A	A	T			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr12:72057007A>T	ENST00000378743.3	-	1	742	c.384T>A	c.(382-384)agT>agA	p.S128R	ZFC3H1_ENST00000549407.1_5'UTR|THAP2_ENST00000547843.1_5'Flank|THAP2_ENST00000308086.2_5'UTR|ZFC3H1_ENST00000552037.1_Missense_Mutation_p.S128R|ZFC3H1_ENST00000548100.1_Missense_Mutation_p.S128R	NM_144982.4	NP_659419.3	O60293	ZC3H1_HUMAN	zinc finger, C3H1-type containing	128	Ser-rich.				RNA processing (GO:0006396)	extracellular space (GO:0005615)|intracellular (GO:0005622)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(12)|lung(31)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	69						ACGGCCGGGGACTGCTTTCGG	0.657																																																	0													64.0	71.0	69.0					12																	72057007		1956	4129	6085	SO:0001583	missense	0			AB011118	CCDS41813.1	12q21.1	2013-01-25	2008-10-01	2008-10-01		ENSG00000133858		"""Zinc finger, C3H1-type containing"""	28328	protein-coding gene	gene with protein product			"""proline/serine-rich coiled-coil 2"", ""coiled-coil domain containing 131"""	PSRC2, CCDC131		9628581	Standard	NM_144982		Approved	MGC23401, KIAA0546	uc001swo.2	O60293	OTTHUMG00000169545	ENST00000378743.3:c.384T>A	12.37:g.72057007A>T	ENSP00000368017:p.Ser128Arg		Q6GMU1|Q6P2S9|Q6ZV36|Q96BE7	Missense_Mutation	SNP	pfam_Putative_zinc-finger_domain,smart_HAT,pfscan_TPR-contain_dom	p.S128R	ENST00000378743.3	37	c.384	CCDS41813.1	12	.	.	.	.	.	.	.	.	.	.	A	12.09	1.833301	0.32421	.	.	ENSG00000133858	ENST00000378743;ENST00000548100;ENST00000552037	T	0.36520	1.25	4.47	2.37	0.29283	.	0.335860	0.26753	N	0.022669	T	0.19565	0.0470	N	0.14661	0.345	0.80722	D	1	B;B;B	0.14805	0.011;0.005;0.0	B;B;B	0.18263	0.021;0.003;0.0	T	0.04678	-1.0934	10	0.56958	D	0.05	.	6.2299	0.20728	0.1879:0.1512:0.6608:0.0	.	128;128;128	G3V1X1;O60293-4;O60293	.;.;ZC3H1_HUMAN	R	128	ENSP00000368017:S128R	ENSP00000368017:S128R	S	-	3	2	ZFC3H1	70343274	1.000000	0.71417	0.999000	0.59377	0.327000	0.28475	1.583000	0.36579	0.556000	0.29098	-0.345000	0.07892	AGT	ZFC3H1	-	NULL	ENSG00000133858		0.657	ZFC3H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFC3H1	HGNC	protein_coding	OTTHUMT00000404751.1	-	0.00	62	0	A	NM_144982		72057007	-1	tier1	-	no_errors	ENST00000378743	ensembl	human	known	74_37	missense	25.98	94	33	SNP	1.000	T
ZNF175	7728	genome.wustl.edu	37	19	52090051	52090051	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr19:52090051T>C	ENST00000262259.2	+	5	825	c.467T>C	c.(466-468)aTg>aCg	p.M156T	ZNF175_ENST00000436511.2_Intron	NM_007147.2	NP_009078.1	Q9Y473	ZN175_HUMAN	zinc finger protein 175	156					defense response to virus (GO:0051607)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(6)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	24		all_neural(266;0.0299)		GBM - Glioblastoma multiforme(134;0.000426)|OV - Ovarian serous cystadenocarcinoma(262;0.0257)		ATTCAACCCATGAGTCACAGT	0.433																																																	0													90.0	85.0	87.0					19																	52090051		2203	4300	6503	SO:0001583	missense	0			D50419	CCDS12837.1	19q13.4	2013-01-08			ENSG00000105497	ENSG00000105497		"""Zinc fingers, C2H2-type"", ""-"""	12964	protein-coding gene	gene with protein product		601139				8838321	Standard	NM_007147		Approved	OTK18	uc002pxb.3	Q9Y473	OTTHUMG00000167771	ENST00000262259.2:c.467T>C	19.37:g.52090051T>C	ENSP00000262259:p.Met156Thr		A8K9H2	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.M156T	ENST00000262259.2	37	c.467	CCDS12837.1	19	.	.	.	.	.	.	.	.	.	.	T	0.076	-1.192808	0.01607	.	.	ENSG00000105497	ENST00000262259	T	0.06294	3.32	2.2	-3.2	0.05156	.	.	.	.	.	T	0.02494	0.0076	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.46803	-0.9165	9	0.17832	T	0.49	.	4.1164	0.10083	0.1762:0.4658:0.0:0.358	.	156	Q9Y473	ZN175_HUMAN	T	156	ENSP00000262259:M156T	ENSP00000262259:M156T	M	+	2	0	ZNF175	56781863	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.095000	0.11077	-0.938000	0.03714	-2.033000	0.00422	ATG	ZNF175	-	NULL	ENSG00000105497		0.433	ZNF175-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF175	HGNC	protein_coding	OTTHUMT00000396205.1	-	0.00	39	0	T	NM_007147		52090051	+1	tier1	-	no_errors	ENST00000262259	ensembl	human	known	74_37	missense	33.33	28	14	SNP	0.000	C
ZNF215	7762	genome.wustl.edu	37	11	6977317	6977317	+	Frame_Shift_Del	DEL	A	A	-			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr11:6977317delA	ENST00000278319.5	+	7	1697	c.1109delA	c.(1108-1110)caafs	p.Q370fs	ZNF215_ENST00000527171.1_3'UTR|ZNF215_ENST00000414517.2_Frame_Shift_Del_p.Q370fs|ZNF215_ENST00000529903.1_Intron	NM_013250.2	NP_037382.2	Q9UL58	ZN215_HUMAN	zinc finger protein 215	370					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(12)|ovary(1)|prostate(2)|skin(4)	32				Epithelial(150;6.33e-08)|BRCA - Breast invasive adenocarcinoma(625;0.134)		ATTCGACACCAAAAAAGTCAT	0.343																																																	0													61.0	60.0	60.0					11																	6977317		2201	4296	6497	SO:0001589	frameshift_variant	0			AF056618	CCDS7775.1	11p15.4	2013-01-09			ENSG00000149054	ENSG00000149054		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	13007	protein-coding gene	gene with protein product		605016					Standard	XM_005253130		Approved	ZKSCAN11, ZSCAN43	uc001mey.3	Q9UL58	OTTHUMG00000165507	ENST00000278319.5:c.1109delA	11.37:g.6977317delA	ENSP00000278319:p.Gln370fs		Q96C84	Frame_Shift_Del	DEL	pfam_Tscrpt_reg_SCAN,pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Retrov_capsid_C,superfamily_Krueppel-associated_box,smart_Tscrpt_reg_SCAN,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box,pfscan_Tscrpt_reg_SCAN	p.S372fs	ENST00000278319.5	37	c.1109	CCDS7775.1	11																																																																																			ZNF215	-	NULL	ENSG00000149054		0.343	ZNF215-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF215	HGNC	protein_coding	OTTHUMT00000384550.1		0.00	32	0	A			6977317	+1	tier1		no_errors	ENST00000278319	ensembl	human	known	74_37	frame_shift_del	11.11	24	3	DEL	0.000	-
ZNF442	79973	genome.wustl.edu	37	19	12461334	12461334	+	Silent	SNP	C	C	A			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr19:12461334C>A	ENST00000242804.4	-	6	1647	c.1065G>T	c.(1063-1065)ggG>ggT	p.G355G	ZNF442_ENST00000438182.1_Silent_p.G286G|CTD-3105H18.13_ENST00000563695.2_lincRNA	NM_030824.2	NP_110451.1	Q9H7R0	ZN442_HUMAN	zinc finger protein 442	355					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(8)|lung(8)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	31						CAAAGCCTTTCCCACATATCT	0.428																																																	0													216.0	208.0	211.0					19																	12461334		2203	4298	6501	SO:0001819	synonymous_variant	0			AK024418	CCDS12271.1	19p13.13	2013-01-08			ENSG00000198342	ENSG00000198342		"""Zinc fingers, C2H2-type"", ""-"""	20877	protein-coding gene	gene with protein product							Standard	NM_030824		Approved	FLJ14356	uc002mtr.1	Q9H7R0	OTTHUMG00000156411	ENST00000242804.4:c.1065G>T	19.37:g.12461334C>A			B4DJ48	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.G355	ENST00000242804.4	37	c.1065	CCDS12271.1	19																																																																																			ZNF442	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000198342		0.428	ZNF442-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF442	HGNC	protein_coding	OTTHUMT00000344109.1	-	0.00	104	0	C	NM_030824		12461334	-1	tier1	-	no_errors	ENST00000242804	ensembl	human	known	74_37	silent	6.02	78	5	SNP	0.995	A
ZNF729	100287226	genome.wustl.edu	37	19	22499671	22499671	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr19:22499671A>C	ENST00000601693.1	+	4	3570	c.3452A>C	c.(3451-3453)aAg>aCg	p.K1151T	ZNF729_ENST00000357491.6_Missense_Mutation_p.K1123T			A6NN14	ZN729_HUMAN	zinc finger protein 729	1151					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(5)|central_nervous_system(1)|lung(32)|ovary(3)	41						ACTAAACATAAGATAATTCAT	0.378																																																	0																																										SO:0001583	missense	0				CCDS59368.1	19p12	2014-02-14			ENSG00000196350	ENSG00000196350		"""Zinc fingers, C2H2-type"", ""-"""	32464	protein-coding gene	gene with protein product							Standard	NM_001242680		Approved		uc021urs.1	A6NN14	OTTHUMG00000182938	ENST00000601693.1:c.3452A>C	19.37:g.22499671A>C	ENSP00000469582:p.Lys1151Thr		M0QY45	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.K1151T	ENST00000601693.1	37	c.3452	CCDS59368.1	19	.	.	.	.	.	.	.	.	.	.	.	6.444	0.450007	0.12223	.	.	ENSG00000196350	ENST00000357491	T	0.17854	2.25	0.96	0.96	0.19631	.	.	.	.	.	T	0.17662	0.0424	L	0.41573	1.285	.	.	.	.	.	.	.	.	.	T	0.23797	-1.0178	6	0.62326	D	0.03	.	6.8812	0.24174	1.0:0.0:0.0:0.0	.	.	.	.	T	1123	ENSP00000350085:K1123T	ENSP00000350085:K1123T	K	+	2	0	ZNF729	22291511	0.000000	0.05858	0.027000	0.17364	0.025000	0.11179	0.666000	0.25097	0.346000	0.23899	0.335000	0.21663	AAG	ZNF729	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000196350		0.378	ZNF729-001	NOVEL	basic|appris_principal|CCDS	protein_coding	ZNF729	HGNC	protein_coding	OTTHUMT00000464396.1	-	0.00	39	0	A	XM_496301		22499671	+1	tier1	-	no_errors	ENST00000601693	ensembl	human	novel	74_37	missense	24.24	25	8	SNP	0.009	C
ZNF577	84765	genome.wustl.edu	37	19	52364182	52364182	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr19:52364182G>T	ENST00000412216.1	-	6	1681	c.333C>A	c.(331-333)agC>agA	p.S111R	ZNF577_ENST00000485702.1_5'UTR			Q9BSK1	ZN577_HUMAN	zinc finger protein 577	0					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|kidney(1)|large_intestine(5)|lung(9)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	21		all_neural(266;0.0602)		GBM - Glioblastoma multiforme(134;0.00161)|OV - Ovarian serous cystadenocarcinoma(262;0.019)		ATTCTTCTTAGCTTTCCTGCA	0.328																																																	0																																										SO:0001583	missense	0			AL832871	CCDS12842.2, CCDS46160.1	19q13.41	2013-09-20			ENSG00000161551	ENSG00000161551		"""Zinc fingers, C2H2-type"", ""-"""	28673	protein-coding gene	gene with protein product						12477932	Standard	NM_032679		Approved	MGC4400	uc010yde.2	Q9BSK1	OTTHUMG00000157045	ENST00000412216.1:c.333C>A	19.37:g.52364182G>T	ENSP00000394828:p.Ser111Arg		A8K0B4|A8K6Z7|C9JFB9	Missense_Mutation	SNP	pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box	p.S111R	ENST00000412216.1	37	c.333		19	.	.	.	.	.	.	.	.	.	.	.	8.310	0.821873	0.16678	.	.	ENSG00000161551	ENST00000412216	T	0.00816	5.66	1.71	1.71	0.24356	.	.	.	.	.	T	0.01695	0.0054	.	.	.	0.20873	N	0.999831	.	.	.	.	.	.	T	0.48779	-0.9005	6	0.72032	D	0.01	.	9.3961	0.38404	0.0:0.0:1.0:0.0	.	.	.	.	R	111	ENSP00000394828:S111R	ENSP00000394828:S111R	S	-	3	2	ZNF577	57055994	.	.	0.009000	0.14445	0.034000	0.12701	.	.	1.267000	0.44247	0.205000	0.17691	AGC	ZNF577	-	NULL	ENSG00000161551		0.328	ZNF577-005	PUTATIVE	basic	protein_coding	ZNF577	HGNC	protein_coding	OTTHUMT00000347247.1	-	0.00	39	0	G	NM_032679		52364182	-1	tier1	-	no_errors	ENST00000412216	ensembl	human	putative	74_37	missense	10.53	34	4	SNP	0.106	T
ZNF525	170958	genome.wustl.edu	37	19	53885241	53885241	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr19:53885241G>T	ENST00000355326.3	+	1	563	c.563G>T	c.(562-564)gGa>gTa	p.G188V	ZNF525_ENST00000593918.1_Intron|ZNF525_ENST00000474037.1_Missense_Mutation_p.G470V|ZNF525_ENST00000467003.1_Missense_Mutation_p.G434V|ZNF525_ENST00000475179.1_Intron			Q8N782	ZN525_HUMAN	zinc finger protein 525	188					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|kidney(3)|lung(3)	9						TGCAAGTGTGGAGAATGTGAC	0.378																																																	0																																										SO:0001583	missense	0			AB075859		19q13.42	2013-01-16			ENSG00000203326	ENSG00000203326		"""Zinc fingers, C2H2-type"", ""-"""	29423	protein-coding gene	gene with protein product						11853319	Standard	NR_003699		Approved	KIAA1979	uc010eqn.3	Q8N782	OTTHUMG00000158277	ENST00000355326.3:c.563G>T	19.37:g.53885241G>T	ENSP00000408929:p.Gly188Val		Q8TF23	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.G188V	ENST00000355326.3	37	c.563		19	.	.	.	.	.	.	.	.	.	.	A	4.124	0.021182	0.08006	.	.	ENSG00000203326	ENST00000474037;ENST00000467003;ENST00000355326	T;T;T	0.17854	2.25;2.25;2.25	1.49	0.347	0.16022	Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.11410	0.0278	.	.	.	0.09310	N	1	B	0.19583	0.037	B	0.10450	0.005	T	0.29488	-1.0010	8	0.66056	D	0.02	.	3.9145	0.09217	0.3176:0.3589:0.3235:0.0	.	188	Q8N782	ZN525_HUMAN	V	470;434;188	ENSP00000417696:G470V;ENSP00000419136:G434V;ENSP00000408929:G188V	ENSP00000408929:G188V	G	+	2	0	ZNF525	58577053	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.228000	0.02948	-0.833000	0.04245	-1.298000	0.01336	GGA	ZNF525	-	NULL	ENSG00000203326		0.378	ZNF525-201	KNOWN	basic	protein_coding	ZNF525	HGNC	protein_coding		-	0.00	50	0	G	NR_003699		53885241	+1	tier1	-	no_errors	ENST00000355326	ensembl	human	known	74_37	missense	24.49	37	12	SNP	0.000	T
ZNF732	654254	genome.wustl.edu	37	4	265860	265860	+	Silent	SNP	G	G	T			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr4:265860G>T	ENST00000419098.1	-	4	796	c.786C>A	c.(784-786)tcC>tcA	p.S262S		NM_001137608.1	NP_001131080.1	B4DXR9	ZN732_HUMAN	zinc finger protein 732	262					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|lung(2)	3						TAAGGGTTGAGGACCTATTAA	0.373																																																	0													57.0	50.0	52.0					4																	265860		692	1591	2283	SO:0001819	synonymous_variant	0			AK302099	CCDS46990.1	4p16.3	2014-02-12	2009-07-22		ENSG00000186777	ENSG00000186777		"""Zinc fingers, C2H2-type"", ""-"""	37138	protein-coding gene	gene with protein product							Standard	NM_001137608		Approved	FLJ59067	uc011buu.1	B4DXR9	OTTHUMG00000159883	ENST00000419098.1:c.786C>A	4.37:g.265860G>T				Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.S262	ENST00000419098.1	37	c.786	CCDS46990.1	4																																																																																			ZNF732	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000186777		0.373	ZNF732-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	ZNF732	HGNC	protein_coding	OTTHUMT00000357937.2	-	0.00	46	0	G	NM_001137608		265860	-1	tier1	-	no_errors	ENST00000419098	ensembl	human	known	74_37	silent	51.11	22	23	SNP	0.001	T
ZNF829	374899	genome.wustl.edu	37	19	37382913	37382913	+	Silent	SNP	T	T	C			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr19:37382913T>C	ENST00000391711.3	-	6	1144	c.780A>G	c.(778-780)agA>agG	p.R260R	ZNF345_ENST00000526123.1_Intron|ZNF829_ENST00000520965.1_Silent_p.R341R|ZNF345_ENST00000432005.2_Intron	NM_001037232.3	NP_001032309.2	Q3KNS6	ZN829_HUMAN	zinc finger protein 829	260					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|kidney(1)|large_intestine(11)|lung(8)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	29	Esophageal squamous(110;0.183)		COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			CAGTGTGAATTCTCTGATGAT	0.363																																																	0													45.0	48.0	47.0					19																	37382913		2201	4297	6498	SO:0001819	synonymous_variant	0			BC107131	CCDS42557.1, CCDS59380.1	19q13.12	2013-01-08			ENSG00000185869	ENSG00000185869		"""Zinc fingers, C2H2-type"", ""-"""	34032	protein-coding gene	gene with protein product							Standard	NM_001037232		Approved	DKFZp779O175	uc021utr.1	Q3KNS6	OTTHUMG00000048161	ENST00000391711.3:c.780A>G	19.37:g.37382913T>C			Q3KNS7|Q6ZNN0|Q7Z657	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R341	ENST00000391711.3	37	c.1023	CCDS42557.1	19																																																																																			ZNF829	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000185869		0.363	ZNF829-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF829	HGNC	protein_coding	OTTHUMT00000109575.3	-	0.00	55	0	T	NM_001037232		37382913	-1	tier1	-	no_errors	ENST00000520965	ensembl	human	known	74_37	silent	8.47	54	5	SNP	1.000	C
ZNF829	374899	genome.wustl.edu	37	19	37382962	37382962	+	Missense_Mutation	SNP	T	T	A			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr19:37382962T>A	ENST00000391711.3	-	6	1095	c.731A>T	c.(730-732)gAa>gTa	p.E244V	ZNF345_ENST00000526123.1_Intron|ZNF829_ENST00000520965.1_Missense_Mutation_p.E325V|ZNF345_ENST00000432005.2_Intron	NM_001037232.3	NP_001032309.2	Q3KNS6	ZN829_HUMAN	zinc finger protein 829	244					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|kidney(1)|large_intestine(11)|lung(8)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	29	Esophageal squamous(110;0.183)		COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			TTTTCCACATTCCTTACATTC	0.373																																																	0													52.0	55.0	54.0					19																	37382962		2200	4298	6498	SO:0001583	missense	0			BC107131	CCDS42557.1, CCDS59380.1	19q13.12	2013-01-08			ENSG00000185869	ENSG00000185869		"""Zinc fingers, C2H2-type"", ""-"""	34032	protein-coding gene	gene with protein product							Standard	NM_001037232		Approved	DKFZp779O175	uc021utr.1	Q3KNS6	OTTHUMG00000048161	ENST00000391711.3:c.731A>T	19.37:g.37382962T>A	ENSP00000429266:p.Glu244Val		Q3KNS7|Q6ZNN0|Q7Z657	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E325V	ENST00000391711.3	37	c.974	CCDS42557.1	19	.	.	.	.	.	.	.	.	.	.	T	14.78	2.636816	0.47049	.	.	ENSG00000185869	ENST00000520965;ENST00000391711	T	0.04706	3.57	3.41	3.41	0.39046	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.04407	0.0121	N	0.17564	0.495	0.09310	N	0.999999	P	0.39940	0.696	B	0.39771	0.309	T	0.41034	-0.9531	9	0.59425	D	0.04	.	11.7579	0.51886	0.0:0.0:0.0:1.0	.	244	Q3KNS6	ZN829_HUMAN	V	244	ENSP00000429266:E244V	ENSP00000429266:E244V	E	-	2	0	ZNF829	42074802	0.000000	0.05858	1.000000	0.80357	0.954000	0.61252	0.631000	0.24568	1.783000	0.52377	0.528000	0.53228	GAA	ZNF829	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000185869		0.373	ZNF829-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF829	HGNC	protein_coding	OTTHUMT00000109575.3	-	0.00	63	0	T	NM_001037232		37382962	-1	tier1	-	no_errors	ENST00000520965	ensembl	human	known	74_37	missense	8.33	43	4	SNP	0.356	A
ZNF99	7652	genome.wustl.edu	37	19	22941667	22941667	+	Silent	SNP	T	T	C	rs199672066		TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr19:22941667T>C	ENST00000596209.1	-	4	1134	c.1044A>G	c.(1042-1044)aaA>aaG	p.K348K	ZNF99_ENST00000397104.3_Silent_p.K257K	NM_001080409.2	NP_001073878.2	A8MXY4	ZNF99_HUMAN	zinc finger protein 99	348					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(20)|lung(55)|ovary(2)|prostate(10)|skin(5)|stomach(9)|upper_aerodigestive_tract(2)|urinary_tract(3)	124		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.102)				GGCTAAAAGCTTTGCCACATT	0.373																																																	0													53.0	56.0	55.0					19																	22941667		1993	4204	6197	SO:0001819	synonymous_variant	0			BC021822	CCDS59369.1	19p12	2013-01-08	2006-01-17		ENSG00000213973	ENSG00000213973		"""Zinc fingers, C2H2-type"", ""-"""	13175	protein-coding gene	gene with protein product		603981	"""zinc finger protein 99 (F8281)"", ""chromosome 19 open reading frame 9"""	C19orf9			Standard	NM_001080409		Approved	MGC24986	uc021urt.1	A8MXY4		ENST00000596209.1:c.1044A>G	19.37:g.22941667T>C			M0R335	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.K257	ENST00000596209.1	37	c.771	CCDS59369.1	19																																																																																			ZNF99	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000213973		0.373	ZNF99-001	NOVEL	not_best_in_genome_evidence|basic|CCDS	protein_coding	ZNF99	HGNC	protein_coding	OTTHUMT00000464591.1	-	0.00	85	0	T	XM_065124		22941667	-1	tier1	rs199672066	no_errors	ENST00000397104	ensembl	human	known	74_37	silent	13.24	59	9	SNP	0.014	C
ZNF829	374899	genome.wustl.edu	37	19	37382964	37382964	+	Silent	SNP	C	C	T			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr19:37382964C>T	ENST00000391711.3	-	6	1093	c.729G>A	c.(727-729)aaG>aaA	p.K243K	ZNF345_ENST00000526123.1_Intron|ZNF829_ENST00000520965.1_Silent_p.K324K|ZNF345_ENST00000432005.2_Intron	NM_001037232.3	NP_001032309.2	Q3KNS6	ZN829_HUMAN	zinc finger protein 829	243					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|kidney(1)|large_intestine(11)|lung(8)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	29	Esophageal squamous(110;0.183)		COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			TTCCACATTCCTTACATTCAT	0.373																																																	0													53.0	56.0	55.0					19																	37382964		2200	4298	6498	SO:0001819	synonymous_variant	0			BC107131	CCDS42557.1, CCDS59380.1	19q13.12	2013-01-08			ENSG00000185869	ENSG00000185869		"""Zinc fingers, C2H2-type"", ""-"""	34032	protein-coding gene	gene with protein product							Standard	NM_001037232		Approved	DKFZp779O175	uc021utr.1	Q3KNS6	OTTHUMG00000048161	ENST00000391711.3:c.729G>A	19.37:g.37382964C>T			Q3KNS7|Q6ZNN0|Q7Z657	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.K324	ENST00000391711.3	37	c.972	CCDS42557.1	19																																																																																			ZNF829	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000185869		0.373	ZNF829-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF829	HGNC	protein_coding	OTTHUMT00000109575.3	-	0.00	62	0	C	NM_001037232		37382964	-1	tier1	-	no_errors	ENST00000520965	ensembl	human	known	74_37	silent	8.33	44	4	SNP	0.066	T
ZSWIM7	125150	genome.wustl.edu	37	17	15890599	15890599	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NF-01A-11D-A37C-09	TCGA-L5-A8NF-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	344221f6-4b8a-46e4-885b-b2e2205529f2	6c3798fb-7b20-4c5c-9d02-492c8d972ec2	g.chr17:15890599C>T	ENST00000399277.1	-	3	279	c.182G>A	c.(181-183)aGt>aAt	p.S61N	ZSWIM7_ENST00000472495.1_Missense_Mutation_p.S61N|ZSWIM7_ENST00000486655.1_Missense_Mutation_p.S46N|ZSWIM7_ENST00000399280.2_5'UTR	NM_001042697.1|NM_001042698.1	NP_001036162.1|NP_001036163.1	Q19AV6	ZSWM7_HUMAN	zinc finger, SWIM-type containing 7	61					double-strand break repair via homologous recombination (GO:0000724)|protein stabilization (GO:0050821)	nucleus (GO:0005634)|Shu complex (GO:0097196)	zinc ion binding (GO:0008270)			upper_aerodigestive_tract(1)	1				UCEC - Uterine corpus endometrioid carcinoma (92;0.0827)		ACGCCTTCCACTGGGTGATGA	0.468																																																	0													83.0	82.0	82.0					17																	15890599		1887	4122	6009	SO:0001583	missense	0			AK093384	CCDS42266.1	17p11.2	2014-02-12			ENSG00000214941	ENSG00000214941		"""Zinc fingers, SWIM-type"""	26993	protein-coding gene	gene with protein product	"""SWIM domain containing Srs2 interacting protein 1"""	614535				16710300	Standard	NM_001042698		Approved	SWS1	uc002gpf.3	Q19AV6	OTTHUMG00000059308	ENST00000399277.1:c.182G>A	17.37:g.15890599C>T	ENSP00000382218:p.Ser61Asn			Missense_Mutation	SNP	pfam_Znf_SWIM,pfscan_Znf_SWIM	p.S61N	ENST00000399277.1	37	c.182	CCDS42266.1	17	.	.	.	.	.	.	.	.	.	.	C	14.75	2.627357	0.46944	.	.	ENSG00000214941	ENST00000399277;ENST00000472495	.	.	.	5.93	5.93	0.95920	.	0.000000	0.85682	U	0.000000	T	0.76292	0.3967	M	0.74647	2.275	0.43000	D	0.994518	D	0.71674	0.998	P	0.59487	0.858	T	0.75909	-0.3151	9	0.44086	T	0.13	-9.0864	17.0732	0.86580	0.0:1.0:0.0:0.0	.	61	Q19AV6	ZSWM7_HUMAN	N	61	.	ENSP00000382218:S61N	S	-	2	0	ZSWIM7	15831324	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.294000	0.65687	2.826000	0.97356	0.655000	0.94253	AGT	ZSWIM7	-	NULL	ENSG00000214941		0.468	ZSWIM7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZSWIM7	HGNC	protein_coding	OTTHUMT00000131736.1	-	0.00	49	0	C	NM_001042697		15890599	-1	tier1	-	no_errors	ENST00000399277	ensembl	human	known	74_37	missense	7.27	51	4	SNP	1.000	T
