#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name	i_deletion_substructures	i_domain	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_header	i_normal_VAF	i_normal_ref_reads	i_normal_var_reads	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_tier	i_title	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_VAF	i_tumor_ref_reads	i_tumor_var_reads	i_type	i_ucsc_cons	i_variant
ABCA3	21	genome.wustl.edu	37	16	2345651	2345651	+	Missense_Mutation	SNP	G	G	A	rs371756212		TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr16:2345651G>A	ENST00000301732.5	-	18	3054	c.2354C>T	c.(2353-2355)aCg>aTg	p.T785M	ABCA3_ENST00000382381.3_Missense_Mutation_p.T727M	NM_001089.2	NP_001080.2	Q99758	ABCA3_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 3	785					response to drug (GO:0042493)|transmembrane transport (GO:0055085)|transport (GO:0006810)	alveolar lamellar body (GO:0097208)|alveolar lamellar body membrane (GO:0097233)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)			breast(7)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(11)|liver(1)|lung(20)|ovary(7)|prostate(5)|skin(6)|upper_aerodigestive_tract(1)	70		Ovarian(90;0.17)			Imatinib(DB00619)	GCTCTCCAGCGTGGCGTTGGG	0.617																																																	0								G	MET/THR	0,4396		0,0,2198	125.0	125.0	125.0		2354	3.6	0.9	16		125	2,8598	2.2+/-6.3	0,2,4298	no	missense	ABCA3	NM_001089.2	81	0,2,6496	AA,AG,GG		0.0233,0.0,0.0154	benign	785/1705	2345651	2,12994	2198	4300	6498	SO:0001583	missense	0			U78735	CCDS10466.1	16p13.3	2012-03-14			ENSG00000167972	ENSG00000167972		"""ATP binding cassette transporters / subfamily A"""	33	protein-coding gene	gene with protein product		601615		ABC3		8706931	Standard	NM_001089		Approved	ABC-C, EST111653, LBM180	uc002cpy.1	Q99758	OTTHUMG00000128845	ENST00000301732.5:c.2354C>T	16.37:g.2345651G>A	ENSP00000301732:p.Thr785Met		B2RU09|Q54A95|Q6P5P9|Q92473	Missense_Mutation	SNP	pfam_ABC_transporter-like,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.T785M	ENST00000301732.5	37	c.2354	CCDS10466.1	16	.	.	.	.	.	.	.	.	.	.	G	9.414	1.081210	0.20309	0.0	2.33E-4	ENSG00000167972	ENST00000301732;ENST00000382381	T	0.63255	-0.03	5.65	3.57	0.40892	.	0.408877	0.27927	N	0.017286	T	0.58278	0.2111	M	0.78223	2.4	0.58432	D	0.999999	B;B;B	0.31026	0.029;0.304;0.064	B;B;B	0.24701	0.018;0.055;0.042	T	0.58250	-0.7669	10	0.28530	T	0.3	.	10.9018	0.47056	0.1783:0.0:0.8217:0.0	.	785;789;785	A7MBM9;Q4LE27;Q99758	.;.;ABCA3_HUMAN	M	785;789	ENSP00000301732:T785M	ENSP00000301732:T785M	T	-	2	0	ABCA3	2285652	0.987000	0.35691	0.855000	0.33649	0.062000	0.15995	2.105000	0.41825	1.598000	0.50083	0.655000	0.94253	ACG	ABCA3	-	NULL	ENSG00000167972		0.617	ABCA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA3	HGNC	protein_coding	OTTHUMT00000250784.2	-	0.00	73	0	G	NM_001089		2345651	-1	tier1	-	no_errors	ENST00000301732	ensembl	human	known	74_37	missense	35.71	27	15	SNP	0.756	A
ACAA2	10449	genome.wustl.edu	37	18	47320775	47320775	+	Nonsense_Mutation	SNP	G	G	T			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr18:47320775G>T	ENST00000285093.10	-	5	927	c.452C>A	c.(451-453)tCa>tAa	p.S151*	ACAA2_ENST00000589432.1_Nonsense_Mutation_p.S96*|ACAA2_ENST00000587994.1_Nonsense_Mutation_p.S148*	NM_006111.2	NP_006102.2	P42765	THIM_HUMAN	acetyl-CoA acyltransferase 2	151					cellular response to hypoxia (GO:0071456)|cholesterol biosynthetic process (GO:0006695)|fatty acid metabolic process (GO:0006631)|negative regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902109)|negative regulation of mitochondrial outer membrane permeabilization involved in apoptotic signaling pathway (GO:1901029)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	acetyl-CoA C-acyltransferase activity (GO:0003988)|poly(A) RNA binding (GO:0044822)			large_intestine(2)|lung(7)|ovary(1)	10						ATCTGTTAATGATACCCATAA	0.328																																																	0													63.0	54.0	57.0					18																	47320775		2203	4300	6503	SO:0001587	stop_gained	0			D16294	CCDS11939.1	18q21	2010-04-30	2010-04-30		ENSG00000167315	ENSG00000167315	2.3.1.16		83	protein-coding gene	gene with protein product	"""mitochondrial 3-oxoacyl-Coenzyme A thiolase"""	604770	"""acetyl-Coenzyme A acyltransferase 2"""			8241273	Standard	NM_006111		Approved	DSAEC	uc002ldw.4	P42765	OTTHUMG00000132667	ENST00000285093.10:c.452C>A	18.37:g.47320775G>T	ENSP00000285093:p.Ser151*		Q9BUT6	Nonsense_Mutation	SNP	pfam_Thiolase_N,pfam_Thiolase_C,superfamily_Thiolase-like,pirsf_Thiolase,tigrfam_Thiolase	p.S151*	ENST00000285093.10	37	c.452	CCDS11939.1	18	.	.	.	.	.	.	.	.	.	.	G	17.74	3.463876	0.63513	.	.	ENSG00000167315	ENST00000285093	.	.	.	5.57	-7.6	0.01303	.	0.570674	0.20238	N	0.096335	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	3.2502	28.8086	0.99999	0.0:0.6539:0.3461:0.0	.	.	.	.	X	151	.	ENSP00000285093:S151X	S	-	2	0	ACAA2	45574773	0.000000	0.05858	0.000000	0.03702	0.021000	0.10359	0.318000	0.19504	-1.196000	0.02676	-1.113000	0.02065	TCA	ACAA2	-	pfam_Thiolase_N,superfamily_Thiolase-like,pirsf_Thiolase,tigrfam_Thiolase	ENSG00000167315		0.328	ACAA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ACAA2	HGNC	protein_coding	OTTHUMT00000255921.2		0.00	61	0	G	NM_006111		47320775	-1			no_errors	ENST00000285093	ensembl	human	known	74_37	nonsense	6.25	45	3	SNP	0.000	T
ACO2	50	genome.wustl.edu	37	22	41865178	41865178	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr22:41865178C>G	ENST00000216254.4	+	1	50	c.28C>G	c.(28-30)Cgg>Ggg	p.R10G	PHF5A_ENST00000491254.1_5'Flank|PHF5A_ENST00000216252.3_5'Flank|ACO2_ENST00000396512.3_Missense_Mutation_p.R10G	NM_001098.2	NP_001089.1	Q99798	ACON_HUMAN	aconitase 2, mitochondrial	10					cell death (GO:0008219)|cellular metabolic process (GO:0044237)|citrate metabolic process (GO:0006101)|generation of precursor metabolites and energy (GO:0006091)|isocitrate metabolic process (GO:0006102)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	3 iron, 4 sulfur cluster binding (GO:0051538)|4 iron, 4 sulfur cluster binding (GO:0051539)|aconitate hydratase activity (GO:0003994)|iron ion binding (GO:0005506)	p.R10G(1)		breast(3)|endometrium(5)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(2)	23						ACTGGTGACTCGGCTGCAGGT	0.642																																																	1	Substitution - Missense(1)	breast(1)											79.0	80.0	80.0					22																	41865178		2203	4300	6503	SO:0001583	missense	0			AH006514	CCDS14017.1	22q13.2	2013-05-21			ENSG00000100412	ENSG00000100412	4.2.1.3		118	protein-coding gene	gene with protein product	"""aconitate hydratase, mitochondrial"""	100850				10591208	Standard	NM_001098		Approved	ACONM	uc003bac.3	Q99798	OTTHUMG00000030544	ENST00000216254.4:c.28C>G	22.37:g.41865178C>G	ENSP00000216254:p.Arg10Gly		O75809|Q5JZ41|Q6FHX0|Q8TAQ6	Missense_Mutation	SNP	pfam_Acoase/IPM_deHydtase_lsu_aba,pfam_AconitaseA/IPMdHydase_ssu_swvl,superfamily_Acoase/IPM_deHydtase_lsu_aba,superfamily_Aconitase/3IPM_dehydase_swvl,prints_Acoase/IPM_deHydtase_lsu_aba,tigrfam_Aconitase_mito-like	p.R10G	ENST00000216254.4	37	c.28	CCDS14017.1	22	.	.	.	.	.	.	.	.	.	.	C	21.0	4.084609	0.76642	.	.	ENSG00000100412	ENST00000544234;ENST00000216254;ENST00000396512	T;T	0.45668	0.9;0.89	5.35	5.35	0.76521	.	0.105835	0.64402	D	0.000004	T	0.49795	0.1578	M	0.77486	2.375	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.49485	-0.8935	10	0.59425	D	0.04	.	19.6142	0.95626	0.0:1.0:0.0:0.0	.	10;10	A2A274;Q99798	.;ACON_HUMAN	G	10	ENSP00000216254:R10G;ENSP00000379769:R10G	ENSP00000216254:R10G	R	+	1	2	ACO2	40195124	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.949000	0.63596	2.941000	0.99782	0.655000	0.94253	CGG	ACO2	-	NULL	ENSG00000100412		0.642	ACO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACO2	HGNC	protein_coding	OTTHUMT00000259151.1	-	0.00	83	0	C	NM_001098		41865178	+1	tier1	-	no_errors	ENST00000216254	ensembl	human	known	74_37	missense	52.86	33	37	SNP	1.000	G
ADAMTS16	170690	genome.wustl.edu	37	5	5303454	5303454	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr5:5303454A>G	ENST00000274181.7	+	19	3001	c.2863A>G	c.(2863-2865)Aca>Gca	p.T955A		NM_139056.2	NP_620687.2	Q8TE57	ATS16_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 16	955	TSP type-1 3. {ECO:0000255|PROSITE- ProRule:PRU00210}.				branching involved in ureteric bud morphogenesis (GO:0001658)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(72)|ovary(4)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	107						CGTGCAGTGCACACGGCGGGT	0.692																																																	0													11.0	15.0	14.0					5																	5303454		2022	4154	6176	SO:0001583	missense	0			AJ315734	CCDS43299.1	5p15	2008-07-18	2005-08-19		ENSG00000145536	ENSG00000145536		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17108	protein-coding gene	gene with protein product		607510	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 16"""			11867212	Standard	NM_139056		Approved	ADAMTS16s	uc003jdl.3	Q8TE57	OTTHUMG00000161663	ENST00000274181.7:c.2863A>G	5.37:g.5303454A>G	ENSP00000274181:p.Thr955Ala		C6G490|Q8IVE2	Missense_Mutation	SNP	pfam_ADAM_spacer1,pfam_Peptidase_M12B_N,pfam_Peptidase_M12B,pfam_Thrombospondin_1_rpt,pfam_PLAC,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Peptidase_M12B_ADAM-TS	p.T955A	ENST00000274181.7	37	c.2863	CCDS43299.1	5	.	.	.	.	.	.	.	.	.	.	A	2.783	-0.253059	0.05829	.	.	ENSG00000145536	ENST00000274181	T	0.50548	0.74	4.97	1.0	0.19881	.	0.408897	0.24226	N	0.040400	T	0.32041	0.0816	L	0.41027	1.25	0.09310	N	0.999995	B;B	0.27951	0.194;0.195	B;B	0.25614	0.036;0.062	T	0.13388	-1.0511	10	0.33141	T	0.24	.	6.2824	0.21015	0.6123:0.3043:0.0834:0.0	.	955;955	Q8TE57;Q8TE57-2	ATS16_HUMAN;.	A	955	ENSP00000274181:T955A	ENSP00000274181:T955A	T	+	1	0	ADAMTS16	5356454	0.001000	0.12720	0.073000	0.20177	0.045000	0.14185	0.180000	0.16860	0.000000	0.14550	0.528000	0.53228	ACA	ADAMTS16	-	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	ENSG00000145536		0.692	ADAMTS16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS16	HGNC	protein_coding	OTTHUMT00000365657.1	-	0.00	40	0	A	NM_139056		5303454	+1	tier1	-	no_errors	ENST00000274181	ensembl	human	known	74_37	missense	50.00	18	18	SNP	0.020	G
AZIN2	113451	genome.wustl.edu	37	1	33560275	33560275	+	Silent	SNP	C	C	G	rs148883141	byFrequency	TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr1:33560275C>G	ENST00000294517.6	+	8	1301	c.714C>G	c.(712-714)ggC>ggG	p.G238G	ADC_ENST00000398167.1_Silent_p.G238G|ADC_ENST00000373443.3_Silent_p.G238G|ADC_ENST00000373441.1_Silent_p.G238G|ADC_ENST00000358680.3_Intron|ADC_ENST00000373440.1_Intron|ADC_ENST00000484656.1_3'UTR	NM_052998.2	NP_443724.1	Q96A70	AZIN2_HUMAN		238					agmatine biosynthetic process (GO:0097055)|cellular nitrogen compound metabolic process (GO:0034641)|negative regulation of protein catabolic process (GO:0042177)|ornithine metabolic process (GO:0006591)|polyamine biosynthetic process (GO:0006596)|polyamine metabolic process (GO:0006595)|positive regulation of catalytic activity (GO:0043085)|positive regulation of polyamine transmembrane transport (GO:1902269)|putrescine transport (GO:0015847)|small molecule metabolic process (GO:0044281)|spermatogenesis (GO:0007283)|trans-Golgi network membrane organization (GO:0098629)	axon (GO:0030424)|cis-Golgi network (GO:0005801)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum-Golgi intermediate compartment membrane (GO:0033116)|granular vesicle (GO:1990005)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perikaryon (GO:0043204)|perinuclear region of cytoplasm (GO:0048471)|trans-Golgi network (GO:0005802)|transport vesicle (GO:0030133)	catalytic activity (GO:0003824)|ornithine decarboxylase activator activity (GO:0042978)|putrescine transmembrane transporter activity (GO:0015489)			NS(1)|endometrium(2)|large_intestine(2)|lung(4)|ovary(2)	11		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)			L-Arginine(DB00125)	TTGGTGGTGGCTTCCCTGGCA	0.582											OREG0013339	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													80.0	82.0	81.0					1																	33560275		2203	4300	6503	SO:0001819	synonymous_variant	0																														ENST00000294517.6:c.714C>G	1.37:g.33560275C>G		841	B2RDU5|D3DPQ9|Q5TIF4|Q5TIF5|Q5TIF6|Q8TF56|Q96L54|Q96L55|Q96L56|Q96L57|Q96MD9	Silent	SNP	pfam_De-COase2_N,pfam_De-COase2_C,superfamily_Ala_racemase/Decarboxylase_C,prints_Orn_de-COase,prints_Orn/DAP/Arg_de-COase	p.G238	ENST00000294517.6	37	c.714	CCDS375.1	1																																																																																			ADC	-	pfam_De-COase2_N	ENSG00000142920		0.582	ADC-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ADC	HGNC	protein_coding	OTTHUMT00000011867.1	-	0.00	79	0	C			33560275	+1	tier1	-	no_errors	ENST00000373441	ensembl	human	known	74_37	silent	31.03	40	18	SNP	0.999	G
ADCY8	114	genome.wustl.edu	37	8	131859748	131859748	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr8:131859748A>C	ENST00000286355.5	-	11	4516	c.2424T>G	c.(2422-2424)gaT>gaG	p.D808E	ADCY8_ENST00000377928.3_Intron	NM_001115.2	NP_001106.1	P40145	ADCY8_HUMAN	adenylate cyclase 8 (brain)	808					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|learning or memory (GO:0007611)|long-term memory (GO:0007616)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)			NS(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|kidney(5)|large_intestine(21)|lung(67)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(5)|urinary_tract(2)	134	Esophageal squamous(12;0.00693)|Ovarian(258;0.00707)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000538)			ACTTGTCAAAATCACACCACA	0.398										HNSCC(32;0.087)																																							0													60.0	59.0	59.0					8																	131859748		2203	4300	6503	SO:0001583	missense	0			Z35309	CCDS6363.1	8q24	2013-02-04			ENSG00000155897	ENSG00000155897	4.6.1.1	"""Adenylate cyclases"""	239	protein-coding gene	gene with protein product		103070		ADCY3		8076676	Standard	NM_001115		Approved	HBAC1, AC8	uc003ytd.4	P40145	OTTHUMG00000164756	ENST00000286355.5:c.2424T>G	8.37:g.131859748A>C	ENSP00000286355:p.Asp808Glu			Missense_Mutation	SNP	pfam_A/G_cyclase,pfam_Adenylate_cyclase-like,superfamily_A/G_cyclase,smart_A/G_cyclase,pfscan_A/G_cyclase	p.D808E	ENST00000286355.5	37	c.2424	CCDS6363.1	8	.	.	.	.	.	.	.	.	.	.	A	15.62	2.888591	0.52014	.	.	ENSG00000155897	ENST00000286355	T	0.42900	0.96	6.06	4.91	0.64330	.	0.210156	0.47093	D	0.000247	T	0.30510	0.0767	L	0.47716	1.5	0.80722	D	1	B	0.30439	0.279	B	0.24155	0.051	T	0.06734	-1.0810	10	0.09590	T	0.72	.	10.9357	0.47243	0.9278:0.0:0.0722:0.0	.	808	P40145	ADCY8_HUMAN	E	808	ENSP00000286355:D808E	ENSP00000286355:D808E	D	-	3	2	ADCY8	131928930	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.368000	0.59505	2.324000	0.78689	0.533000	0.62120	GAT	ADCY8	-	NULL	ENSG00000155897		0.398	ADCY8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADCY8	HGNC	protein_coding	OTTHUMT00000380080.1	-	0.00	63	0	A			131859748	-1	tier1	-	no_errors	ENST00000286355	ensembl	human	known	74_37	missense	24.59	46	15	SNP	1.000	C
AGPS	8540	genome.wustl.edu	37	2	178326678	178326678	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr2:178326678G>T	ENST00000264167.4	+	9	1074	c.928G>T	c.(928-930)Gta>Tta	p.V310L	AGPS_ENST00000409888.1_Intron	NM_003659.3	NP_003650.1	O00116	ADAS_HUMAN	alkylglycerone phosphate synthase	310	FAD-binding PCMH-type. {ECO:0000255|PROSITE-ProRule:PRU00718}.				cellular lipid metabolic process (GO:0044255)|ether lipid biosynthetic process (GO:0008611)|lipid biosynthetic process (GO:0008610)|small molecule metabolic process (GO:0044281)	intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|peroxisomal matrix (GO:0005782)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	alkylglycerone-phosphate synthase activity (GO:0008609)|FAD binding (GO:0071949)|UDP-N-acetylmuramate dehydrogenase activity (GO:0008762)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(8)|lung(12)|ovary(2)|skin(1)	32			OV - Ovarian serous cystadenocarcinoma(117;0.0018)|Epithelial(96;0.00919)|all cancers(119;0.0358)			GTTCAGTACTGTAGGAGGATG	0.358																																																	0													96.0	93.0	94.0					2																	178326678		2203	4300	6503	SO:0001583	missense	0			Y09443	CCDS2275.1	2q	2008-02-05			ENSG00000018510	ENSG00000018510	2.5.1.26		327	protein-coding gene	gene with protein product		603051				9187299, 9553082	Standard	NM_003659		Approved	ADHAPS, ADAS, ALDHPSY, ADPS, ADAP-S	uc002ull.2	O00116	OTTHUMG00000132530	ENST00000264167.4:c.928G>T	2.37:g.178326678G>T	ENSP00000264167:p.Val310Leu		A5D8U9|Q2TU35	Missense_Mutation	SNP	pfam_FAD-linked_oxidase_C,pfam_Oxid_FAD_bind_N,superfamily_FAD-bd_2,superfamily_FAD-linked_Oxase-like_C	p.V310L	ENST00000264167.4	37	c.928	CCDS2275.1	2	.	.	.	.	.	.	.	.	.	.	G	5.784	0.328956	0.10956	.	.	ENSG00000018510	ENST00000264167;ENST00000536686	D	0.97041	-4.22	5.76	1.52	0.23074	FAD-linked oxidase, FAD-binding, subdomain 2 (1);FAD-binding, type 2 (2);FAD linked oxidase, N-terminal (1);	0.301196	0.31601	N	0.007371	T	0.82167	0.4978	N	0.00605	-1.335	0.80722	D	1	B	0.06786	0.001	B	0.01281	0.0	T	0.75391	-0.3334	10	0.02654	T	1	.	3.45	0.07494	0.0769:0.3026:0.2891:0.3315	.	310	O00116	ADAS_HUMAN	L	310;180	ENSP00000264167:V310L	ENSP00000264167:V310L	V	+	1	0	AGPS	178034924	0.999000	0.42202	0.999000	0.59377	0.996000	0.88848	1.841000	0.39240	0.294000	0.22547	0.655000	0.94253	GTA	AGPS	-	pfam_Oxid_FAD_bind_N,superfamily_FAD-bd_2	ENSG00000018510		0.358	AGPS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AGPS	HGNC	protein_coding	OTTHUMT00000255730.2	-	0.00	84	0	G			178326678	+1	tier1	-	no_errors	ENST00000264167	ensembl	human	known	74_37	missense	6.49	72	5	SNP	0.993	T
AJAP1	55966	genome.wustl.edu	37	1	4832493	4832493	+	Silent	SNP	T	T	C			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr1:4832493T>C	ENST00000378191.4	+	4	1452	c.1071T>C	c.(1069-1071)tcT>tcC	p.S357S	AJAP1_ENST00000378190.3_Silent_p.S357S	NM_018836.3	NP_061324.1	Q9UKB5	AJAP1_HUMAN	adherens junctions associated protein 1	357	Targeting signals.				cell adhesion (GO:0007155)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(4)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|urinary_tract(1)	24	all_cancers(77;0.071)|Ovarian(185;0.0721)	all_cancers(23;1.77e-36)|all_epithelial(116;1.26e-21)|all_lung(118;3.51e-08)|Lung NSC(185;3.47e-06)|all_neural(13;8.84e-06)|all_hematologic(16;7.61e-05)|Breast(487;0.000507)|Renal(390;0.0007)|Colorectal(325;0.00117)|Hepatocellular(190;0.0071)|Glioma(11;0.0155)|Myeloproliferative disorder(586;0.0258)|Ovarian(437;0.0409)|Lung SC(97;0.133)|Medulloblastoma(700;0.215)		Epithelial(90;3.89e-35)|OV - Ovarian serous cystadenocarcinoma(86;1.97e-19)|GBM - Glioblastoma multiforme(42;3.71e-19)|Colorectal(212;4.57e-06)|COAD - Colon adenocarcinoma(227;0.00019)|Kidney(185;0.000969)|BRCA - Breast invasive adenocarcinoma(365;0.00122)|STAD - Stomach adenocarcinoma(132;0.00578)|KIRC - Kidney renal clear cell carcinoma(229;0.0126)|READ - Rectum adenocarcinoma(331;0.0689)		TGCAGTGTTCTCACGAGTGCG	0.587																																																	0													74.0	65.0	68.0					1																	4832493		2203	4300	6503	SO:0001819	synonymous_variant	0			AF175409	CCDS54.1	1p36.32	2008-02-05	2008-01-08		ENSG00000196581	ENSG00000196581			30801	protein-coding gene	gene with protein product	"""transmembrane protein SHREW1"""	610972				14595118	Standard	NM_001042478		Approved	SHREW1, SHREW-1, MOT8	uc001aln.3	Q9UKB5	OTTHUMG00000000645	ENST00000378191.4:c.1071T>C	1.37:g.4832493T>C			Q9Y229	Silent	SNP	NULL	p.S357	ENST00000378191.4	37	c.1071	CCDS54.1	1																																																																																			AJAP1	-	NULL	ENSG00000196581		0.587	AJAP1-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	AJAP1	HGNC	protein_coding	OTTHUMT00000001542.3	-	0.00	39	0	T	NM_018836		4832493	+1	tier1	-	no_errors	ENST00000378190	ensembl	human	known	74_37	silent	27.27	32	12	SNP	0.007	C
AKAP1	8165	genome.wustl.edu	37	17	55182920	55182920	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr17:55182920A>G	ENST00000337714.3	+	2	328	c.95A>G	c.(94-96)cAt>cGt	p.H32R	AKAP1_ENST00000314126.3_Missense_Mutation_p.H32R|AKAP1_ENST00000571629.1_Missense_Mutation_p.H32R|AKAP1_ENST00000572557.1_Missense_Mutation_p.H32R|AKAP1_ENST00000539273.1_Missense_Mutation_p.H32R	NM_003488.3	NP_003479.1	Q92667	AKAP1_HUMAN	A kinase (PRKA) anchor protein 1	32					blood coagulation (GO:0007596)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			endometrium(2)|liver(1)|lung(7)|ovary(2)|pancreas(1)|skin(1)	14	Breast(9;5.46e-08)					AAAAAAGGCCATGTCAGCAGC	0.592																																																	0													58.0	54.0	55.0					17																	55182920		2203	4300	6503	SO:0001583	missense	0			X97335	CCDS11594.1	17q22	2013-01-23			ENSG00000121057	ENSG00000121057		"""A-kinase anchor proteins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Tudor domain containing"""	367	protein-coding gene	gene with protein product	"""protein kinase anchoring protein 1"", ""dual specificity A-kinase-anchoring protein 1"", ""protein phosphatase 1, regulatory subunit 43"", ""tudor domain containing 17"""	602449		PRKA1		8769136, 7499250	Standard	NM_003488		Approved	AKAP121, AKAP149, SAKAP84, S-AKAP84, AKAP84, D-AKAP1, PPP1R43, TDRD17	uc002iux.3	Q92667	OTTHUMG00000140369	ENST00000337714.3:c.95A>G	17.37:g.55182920A>G	ENSP00000337736:p.His32Arg		A8K8Q1|D3DTZ0|Q13320|Q9BW14	Missense_Mutation	SNP	pfam_Tudor,pfam_KH_dom_type_1,smart_KH_dom,smart_Tudor,pfscan_Tudor,pfscan_KH_dom_type_1	p.H32R	ENST00000337714.3	37	c.95	CCDS11594.1	17	.	.	.	.	.	.	.	.	.	.	A	9.996	1.232098	0.22626	.	.	ENSG00000121057	ENST00000337714;ENST00000314126;ENST00000427138;ENST00000539273	T;T;T	0.15017	2.46;2.46;2.46	5.34	0.511	0.16989	.	0.990216	0.08242	N	0.975989	T	0.10165	0.0249	L	0.35723	1.085	0.24853	N	0.992394	B	0.06786	0.001	B	0.04013	0.001	T	0.40608	-0.9554	10	0.02654	T	1	-0.377	4.6904	0.12778	0.5654:0.1555:0.2791:0.0	.	32	Q92667	AKAP1_HUMAN	R	32;32;74;32	ENSP00000337736:H32R;ENSP00000314075:H32R;ENSP00000443139:H32R	ENSP00000314075:H32R	H	+	2	0	AKAP1	52537919	0.128000	0.22383	0.007000	0.13788	0.155000	0.21991	0.482000	0.22276	0.036000	0.15547	0.533000	0.62120	CAT	AKAP1	-	NULL	ENSG00000121057		0.592	AKAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AKAP1	HGNC	protein_coding	OTTHUMT00000277069.1	-	0.00	62	0	A			55182920	+1	tier1	-	no_errors	ENST00000337714	ensembl	human	known	74_37	missense	60.00	16	24	SNP	0.405	G
AKAP17A	8227	genome.wustl.edu	37	X	1712780	1712780	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chrX:1712780C>T	ENST00000313871.3	+	2	621	c.425C>T	c.(424-426)cCg>cTg	p.P142L	AKAP17A_ENST00000381261.3_Missense_Mutation_p.P142L	NM_005088.2	NP_005079.2	Q02040	AK17A_HUMAN	A kinase (PRKA) anchor protein 17A	142					B cell activation (GO:0042113)|mRNA processing (GO:0006397)|regulation of RNA splicing (GO:0043484)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|signal transduction (GO:0007165)	nuclear speck (GO:0016607)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein kinase A binding (GO:0051018)			breast(2)|endometrium(5)|kidney(3)|large_intestine(1)|lung(12)|prostate(3)	26						GAGACCCTGCCGGGGGAGCGG	0.667																																																	0													112.0	128.0	122.0					X																	1712780		2203	4296	6499	SO:0001583	missense	0			L03426	CCDS14116.1	Xp22.33 and Yp11.32	2010-09-08	2010-09-08	2010-09-08	ENSG00000197976	ENSG00000197976		"""Pseudoautosomal regions / PAR1"", ""A-kinase anchor proteins"""	18783	protein-coding gene	gene with protein product		312095, 465000	"""chromosome X and Y open reading frame 3"", ""splicing factor, arginine/serine-rich 17A"""	CXYorf3, SFRS17A		9736779, 1438229, 19840947	Standard	NR_027383		Approved	XE7, XE7Y, DXYS155E, MGC39904, 721P, CCDC133	uc004cqa.3	Q02040	OTTHUMG00000021063	ENST00000313871.3:c.425C>T	X.37:g.1712780C>T	ENSP00000324827:p.Pro142Leu		Q02832|Q2TB98|Q5JQ74|Q5JQ76|Q8N6U9	Missense_Mutation	SNP	NULL	p.P142L	ENST00000313871.3	37	c.425	CCDS14116.1	X	.	.	.	.	.	.	.	.	.	.	c	11.18	1.563294	0.27915	.	.	ENSG00000197976	ENST00000313871;ENST00000381261	T;T	0.40225	1.04;1.04	1.86	0.923	0.19413	.	0.000000	0.64402	U	0.000001	T	0.56587	0.1995	.	.	.	0.29408	N	0.861453	D;P	0.89917	1.0;0.819	D;B	0.73380	0.98;0.404	T	0.53954	-0.8365	9	0.52906	T	0.07	-19.2788	8.4952	0.33123	0.0:0.8673:0.0:0.1327	.	142;142	Q02040-3;Q02040	.;AK17A_HUMAN	L	142	ENSP00000324827:P142L;ENSP00000370660:P142L	ENSP00000324827:P142L	P	+	2	0	AKAP17A	1672780	1.000000	0.71417	0.016000	0.15963	0.466000	0.32739	5.659000	0.68010	-0.115000	0.11915	0.100000	0.15512	CCG	AKAP17A	-	NULL	ENSG00000197976		0.667	AKAP17A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	AKAP17A	HGNC	protein_coding	OTTHUMT00000055609.2	-	0.00	123	0	C	NM_005088		1712780	+1	tier1	-	no_errors	ENST00000313871	ensembl	human	known	74_37	missense	71.43	35	90	SNP	1.000	T
ANKRD30B	374860	genome.wustl.edu	37	18	14851980	14851980	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr18:14851980A>G	ENST00000358984.4	+	36	3860	c.3680A>G	c.(3679-3681)gAg>gGg	p.E1227G		NM_001145029.1	NP_001138501.1	Q9BXX2	AN30B_HUMAN	ankyrin repeat domain 30B	1227										breast(3)|endometrium(4)|kidney(3)|lung(8)|ovary(1)|prostate(2)|skin(1)	22						TATAACAATGAGGTGCTCCAT	0.358																																																	0													8.0	8.0	8.0					18																	14851980		690	1575	2265	SO:0001583	missense	0			BC028407	CCDS54182.1	18p11.21	2013-01-10			ENSG00000180777	ENSG00000180777		"""Ankyrin repeat domain containing"""	24165	protein-coding gene	gene with protein product						11280766	Standard	NM_001145029		Approved	NY-BR-1.1	uc010dlo.2	Q9BXX2		ENST00000358984.4:c.3680A>G	18.37:g.14851980A>G	ENSP00000351875:p.Glu1227Gly		B4DGP1|F8WAG3|Q4G175	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.E1227G	ENST00000358984.4	37	c.3680	CCDS54182.1	18	.	.	.	.	.	.	.	.	.	.	A	5.129	0.209327	0.09757	.	.	ENSG00000180777	ENST00000358984;ENST00000320584;ENST00000277669	T	0.17854	2.25	1.39	1.39	0.22231	.	.	.	.	.	T	0.25568	0.0622	L	0.58101	1.795	0.22737	N	0.998797	P;D	0.58620	0.917;0.983	B;P	0.53861	0.292;0.736	T	0.07558	-1.0766	9	0.59425	D	0.04	.	6.8687	0.24108	1.0:0.0:0.0:0.0	.	1312;1227	Q9BXX2;F8WAG3	AN30B_HUMAN;.	G	1227;621;647	ENSP00000351875:E1227G	ENSP00000277669:E647G	E	+	2	0	ANKRD30B	14841980	0.901000	0.30685	0.023000	0.16930	0.077000	0.17291	2.457000	0.45005	0.889000	0.36185	0.145000	0.16022	GAG	ANKRD30B	-	NULL	ENSG00000180777		0.358	ANKRD30B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ANKRD30B	HGNC	protein_coding	OTTHUMT00000443557.1	-	0.00	64	0	A	NM_001145029		14851980	+1	tier1	-	no_errors	ENST00000358984	ensembl	human	known	74_37	missense	27.85	56	22	SNP	0.211	G
ANKRD30BP2	149992	genome.wustl.edu	37	21	14418386	14418386	+	RNA	SNP	A	A	T	rs201367790		TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr21:14418386A>T	ENST00000507941.1	+	0	998				RNU6-614P_ENST00000384369.1_RNA					ankyrin repeat domain 30B pseudogene 2																		CCAGTGAGACATGAGTCTTTT	0.368																																																	0																																												0			AF427490		21q11.2	2010-06-14	2010-06-14	2010-06-14	ENSG00000224309	ENSG00000224309			16620	pseudogene	pseudogene	"""cancer/testis antigen 85"""		"""chromosome 21 open reading frame 99"""	C21orf99		12036297, 17114284	Standard	NR_026916		Approved	CT85, CTSP-1	uc002yja.4		OTTHUMG00000074164		21.37:g.14418386A>T				RNA	SNP	-	NULL	ENST00000507941.1	37	NULL		21																																																																																			ANKRD30BP2	-	-	ENSG00000224309		0.368	ANKRD30BP2-004	KNOWN	basic	processed_transcript	ANKRD30BP2	HGNC	pseudogene	OTTHUMT00000372094.1	-	0.00	17	0	A	NR_026916		14418386	+1	tier1	rs201367790	no_errors	ENST00000507941	ensembl	human	known	74_37	rna	26.32	14	5	SNP	0.003	T
APLNR	187	genome.wustl.edu	37	11	57003544	57003544	+	Frame_Shift_Del	DEL	A	A	-			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr11:57003544delA	ENST00000606794.1	-	1	1131	c.935delT	c.(934-936)ttcfs	p.F312fs		NM_005161.4	NP_005152.1	P35414	APJ_HUMAN	apelin receptor	312					G-protein coupled receptor signaling pathway (GO:0007186)|gastrulation (GO:0007369)|heart development (GO:0007507)|regulation of body fluid levels (GO:0050878)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|receptor activity (GO:0004872)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(14)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	32						GCGGGGGTCGAAAAAGGCATA	0.602																																																	0													100.0	55.0	70.0					11																	57003544		2201	4296	6497	SO:0001589	frameshift_variant	0			U03642	CCDS7950.1	11q12.1	2012-08-08	2008-05-12	2008-05-12	ENSG00000134817	ENSG00000134817			339	protein-coding gene	gene with protein product	"""APJ (apelin) receptor"""	600052	"""angiotensin II receptor-like 1"""	AGTRL1		8294032, 14622440	Standard	NM_005161		Approved	FLJ90771, APJ, APJR	uc001njo.3	P35414	OTTHUMG00000167021	ENST00000606794.1:c.935delT	11.37:g.57003544delA	ENSP00000475344:p.Phe312fs			Frame_Shift_Del	DEL	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_serpentine_rcpt_Srv,pfam_TAS2_rcpt,pfscan_GPCR_Rhodpsn_7TM,prints_APJ_rcpt,prints_GPCR_Rhodpsn,prints_ATII_rcpt	p.F312fs	ENST00000606794.1	37	c.935	CCDS7950.1	11																																																																																			APLNR	-	pfam_7TM_GPCR_serpentine_rcpt_Srv,pfam_TAS2_rcpt,prints_GPCR_Rhodpsn	ENSG00000134817		0.602	APLNR-004	KNOWN	basic|appris_principal|CCDS	protein_coding	APLNR	HGNC	protein_coding	OTTHUMT00000470575.1		0.00	55	0	A	NM_005161		57003544	-1	tier1		no_errors	ENST00000257254	ensembl	human	known	74_37	frame_shift_del	11.76	30	4	DEL	1.000	-
APOB	338	genome.wustl.edu	37	2	21229517	21229517	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr2:21229517C>A	ENST00000233242.1	-	26	10350	c.10223G>T	c.(10222-10224)gGt>gTt	p.G3408V		NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	3408	Heparin-binding.				artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)			NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GTTATGACTACCCTCCACAAA	0.413																																																	0													166.0	165.0	165.0					2																	21229517		2203	4300	6503	SO:0001583	missense	0			M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.10223G>T	2.37:g.21229517C>A	ENSP00000233242:p.Gly3408Val		O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Missense_Mutation	SNP	pfam_Lipid_transpt_N,pfam_Vitellinogen_open_b-sht,pfam_ApoB100_C,pfam_Lipid_transpt_open_b-sht,superfamily_Lipid_transp_b-sht_shell,superfamily_Vitellinogen_superhlx,superfamily_ARM-type_fold,smart_Lipid_transpt_N,pfscan_Lipid_transpt_N	p.G3408V	ENST00000233242.1	37	c.10223	CCDS1703.1	2	.	.	.	.	.	.	.	.	.	.	C	13.48	2.249334	0.39797	.	.	ENSG00000084674	ENST00000233242;ENST00000535079	T	0.39056	1.1	5.74	5.74	0.90152	.	0.000000	0.64402	D	0.000012	T	0.74450	0.3718	M	0.92317	3.295	0.80722	D	1	D	0.76494	0.999	D	0.77557	0.99	T	0.80195	-0.1483	10	0.72032	D	0.01	.	19.9351	0.97137	0.0:1.0:0.0:0.0	.	3408	P04114	APOB_HUMAN	V	3408	ENSP00000233242:G3408V	ENSP00000233242:G3408V	G	-	2	0	APOB	21083022	0.997000	0.39634	0.995000	0.50966	0.136000	0.21042	1.908000	0.39907	2.703000	0.92315	0.655000	0.94253	GGT	APOB	-	NULL	ENSG00000084674		0.413	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APOB	HGNC	protein_coding	OTTHUMT00000207571.1	-	0.00	61	0	C			21229517	-1	tier1	-	no_errors	ENST00000233242	ensembl	human	known	74_37	missense	44.19	24	19	SNP	1.000	A
AQR	9716	genome.wustl.edu	37	15	35212634	35212634	+	Splice_Site	SNP	A	A	C			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr15:35212634A>C	ENST00000156471.5	-	14	1345	c.1120T>G	c.(1120-1122)Tca>Gca	p.S374A		NM_014691.2	NP_055506.1	O60306	AQR_HUMAN	aquarius intron-binding spliceosomal factor	374					mRNA splicing, via spliceosome (GO:0000398)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(10)|lung(18)|ovary(1)|prostate(6)|skin(4)|upper_aerodigestive_tract(2)	57		Lung NSC(122;8.7e-10)|all_lung(180;1.47e-08)		all cancers(64;4.34e-18)|GBM - Glioblastoma multiforme(113;4.59e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0283)		AGTGTGTTTGAACTGCAGAAT	0.313																																																	0													68.0	66.0	67.0					15																	35212634		1851	4086	5937	SO:0001630	splice_region_variant	0			AB011132	CCDS42013.1	15q13	2013-09-12	2013-09-12			ENSG00000021776			29513	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 164"""	610548	"""aquarius homolog (mouse)"""			9626505, 16949364	Standard	NM_014691		Approved	KIAA0560, fSAP164, IBP160	uc001ziv.3	O60306		ENST00000156471.5:c.1119-1T>G	15.37:g.35212634A>C			A0JP17|A5YKK3|Q2YDX9|Q6IRU8|Q6PIC8	Missense_Mutation	SNP	superfamily_P-loop_NTPase	p.S374A	ENST00000156471.5	37	c.1120	CCDS42013.1	15	.	.	.	.	.	.	.	.	.	.	A	5.247	0.231099	0.09969	.	.	ENSG00000021776	ENST00000156471;ENST00000543879	D	0.93366	-3.21	4.92	4.92	0.64577	.	0.188291	0.47852	D	0.000208	T	0.78953	0.4365	N	0.02539	-0.55	0.32341	N	0.559726	B	0.02656	0.0	B	0.01281	0.0	T	0.73802	-0.3868	10	0.09338	T	0.73	-12.7415	7.4654	0.27318	0.839:0.0:0.161:0.0	.	374	O60306	AQR_HUMAN	A	374	ENSP00000156471:S374A	ENSP00000156471:S374A	S	-	1	0	AQR	32999926	1.000000	0.71417	1.000000	0.80357	0.933000	0.57130	5.296000	0.65698	2.079000	0.62486	0.460000	0.39030	TCA	AQR	-	NULL	ENSG00000021776		0.313	AQR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AQR	HGNC	protein_coding	OTTHUMT00000417526.2	-	0.00	47	0	A	NM_014691	Missense_Mutation	35212634	-1	tier1	-	no_errors	ENST00000156471	ensembl	human	known	74_37	missense	22.73	34	10	SNP	1.000	C
ARHGAP28	79822	genome.wustl.edu	37	18	6870651	6870651	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr18:6870651T>C	ENST00000383472.4	+	7	978	c.874T>C	c.(874-876)Tat>Cat	p.Y292H	ARHGAP28_ENST00000419673.2_Missense_Mutation_p.Y133H|ARHGAP28_ENST00000400091.2_Missense_Mutation_p.Y292H|ARHGAP28_ENST00000314319.3_Missense_Mutation_p.Y133H|ARHGAP28_ENST00000418986.1_Missense_Mutation_p.Y133H|ARHGAP28_ENST00000532996.1_Missense_Mutation_p.Y115H|RP11-146G7.2_ENST00000583659.1_RNA|ARHGAP28_ENST00000262227.3_Missense_Mutation_p.Y240H|ARHGAP28_ENST00000531294.1_Missense_Mutation_p.Y128H			Q9P2N2	RHG28_HUMAN	Rho GTPase activating protein 28	292					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell junction (GO:0030054)|cytosol (GO:0005829)|nucleus (GO:0005634)	GTPase activator activity (GO:0005096)			breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(10)|lung(17)|ovary(1)|pancreas(1)|skin(2)|urinary_tract(2)	37		Colorectal(10;0.168)				TGAAGTGTCTTATTCAGAAAT	0.323																																																	0													76.0	86.0	83.0					18																	6870651		2203	4298	6501	SO:0001583	missense	0			BC033668	CCDS32785.1	18p11.23	2011-06-29				ENSG00000088756		"""Rho GTPase activating proteins"""	25509	protein-coding gene	gene with protein product		610592				10718198	Standard	NM_001010000		Approved	KIAA1314, FLJ10312	uc002kne.3	Q9P2N2		ENST00000383472.4:c.874T>C	18.37:g.6870651T>C	ENSP00000372964:p.Tyr292His		A8MQB7|A8MU88|Q6P160|Q8N4T3|Q9NW53	Missense_Mutation	SNP	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	p.Y292H	ENST00000383472.4	37	c.874		18	.	.	.	.	.	.	.	.	.	.	T	23.3	4.396412	0.83011	.	.	ENSG00000088756	ENST00000400091;ENST00000262227;ENST00000419673;ENST00000531294;ENST00000314319;ENST00000418986;ENST00000532996;ENST00000383472	T;T;T;T;T;T	0.15256	2.91;2.87;2.46;2.45;2.46;2.44	5.43	5.43	0.79202	.	0.109437	0.64402	D	0.000006	T	0.38081	0.1027	L	0.60455	1.87	0.38616	D	0.951029	D;D;D;D	0.89917	0.998;0.999;1.0;1.0	D;D;D;D	0.79784	0.93;0.984;0.993;0.987	T	0.15235	-1.0444	10	0.38643	T	0.18	.	15.7693	0.78152	0.0:0.0:0.0:1.0	.	292;124;133;240	Q9P2N2;E9PRP2;F6VKJ9;Q9P2N2-2	RHG28_HUMAN;.;.;.	H	292;240;133;128;133;133;124;115	ENSP00000382963:Y292H;ENSP00000262227:Y240H;ENSP00000392660:Y133H;ENSP00000437262:Y128H;ENSP00000313506:Y133H;ENSP00000406907:Y133H	ENSP00000262227:Y240H	Y	+	1	0	ARHGAP28	6860651	1.000000	0.71417	0.998000	0.56505	0.996000	0.88848	5.407000	0.66363	2.180000	0.69256	0.533000	0.62120	TAT	ARHGAP28	-	NULL	ENSG00000088756		0.323	ARHGAP28-006	NOVEL	basic|appris_principal	protein_coding	ARHGAP28	HGNC	protein_coding	OTTHUMT00000442123.3	-	0.00	60	0	T	XM_371108		6870651	+1	tier1	-	no_errors	ENST00000400091	ensembl	human	known	74_37	missense	29.79	33	14	SNP	1.000	C
ARID1B	57492	genome.wustl.edu	37	6	157521973	157521973	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr6:157521973C>A	ENST00000350026.5	+	17	4207	c.4206C>A	c.(4204-4206)gaC>gaA	p.D1402E	ARID1B_ENST00000275248.4_Missense_Mutation_p.D1397E|ARID1B_ENST00000367148.1_Missense_Mutation_p.D1455E|ARID1B_ENST00000346085.5_Missense_Mutation_p.D1415E	NM_017519.2	NP_059989.2	Q8NFD5	ARI1B_HUMAN	AT rich interactive domain 1B (SWI1-like)	1402					chromatin-mediated maintenance of transcription (GO:0048096)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|transcription coactivator activity (GO:0003713)			NS(2)|breast(5)|central_nervous_system(4)|endometrium(12)|kidney(4)|large_intestine(11)|lung(30)|ovary(3)|pancreas(1)|prostate(4)|skin(2)|urinary_tract(3)	81		Breast(66;0.000162)|Ovarian(120;0.0265)		OV - Ovarian serous cystadenocarcinoma(65;3.19e-17)|BRCA - Breast invasive adenocarcinoma(81;1.01e-05)		CGGGCCCGGACCGCAGGCCCA	0.632																																																	0													40.0	46.0	44.0					6																	157521973		2203	4296	6499	SO:0001583	missense	0			AF521671	CCDS5251.1, CCDS5251.2, CCDS55072.1	6q25.3	2014-09-17			ENSG00000049618	ENSG00000049618		"""-"""	18040	protein-coding gene	gene with protein product		614556					Standard	NM_017519		Approved	KIAA1235, ELD/OSA1, p250R, BAF250b, DAN15, 6A3-5	uc003qqo.3	Q8NFD5	OTTHUMG00000015890	ENST00000350026.5:c.4206C>A	6.37:g.157521973C>A	ENSP00000055163:p.Asp1402Glu		Q5JRD1|Q5VYC4|Q8IZY8|Q8TEV0|Q8TF02|Q99491|Q9ULI5	Missense_Mutation	SNP	pfam_DUF3518,pfam_ARID/BRIGHT_DNA-bd,superfamily_ARID/BRIGHT_DNA-bd,superfamily_ARM-type_fold,smart_ARID/BRIGHT_DNA-bd,pfscan_ARID/BRIGHT_DNA-bd	p.D1455E	ENST00000350026.5	37	c.4365	CCDS5251.2	6	.	.	.	.	.	.	.	.	.	.	C	4.766	0.142446	0.09083	.	.	ENSG00000049618	ENST00000346085;ENST00000350026;ENST00000367148;ENST00000275248;ENST00000414678	T;T;T;T;T	0.01854	4.91;4.91;4.92;4.92;4.6	4.88	2.05	0.26809	.	0.163538	0.53938	N	0.000045	T	0.00271	0.0008	N	0.03000	-0.44	0.38393	D	0.945447	B;B;B	0.16166	0.009;0.016;0.016	B;B;B	0.19148	0.011;0.024;0.016	T	0.39563	-0.9608	10	0.02654	T	1	.	3.2675	0.06870	0.1293:0.4766:0.251:0.1431	.	1402;1415;1397	Q8NFD5;Q8NFD5-2;G3XAA0	ARI1B_HUMAN;.;.	E	1415;1402;1455;1397;924	ENSP00000344546:D1415E;ENSP00000055163:D1402E;ENSP00000356116:D1455E;ENSP00000275248:D1397E;ENSP00000412835:D924E	ENSP00000275248:D1397E	D	+	3	2	ARID1B	157563665	0.003000	0.15002	0.036000	0.18154	0.515000	0.34225	-0.511000	0.06321	0.183000	0.20059	0.655000	0.94253	GAC	ARID1B	-	NULL	ENSG00000049618		0.632	ARID1B-009	KNOWN	basic|appris_candidate|CCDS	protein_coding	ARID1B	HGNC	protein_coding	OTTHUMT00000372723.1	-	0.00	57	0	C	NM_020732		157521973	+1	tier1	-	no_errors	ENST00000367148	ensembl	human	known	74_37	missense	43.04	45	34	SNP	0.880	A
ARID3B	10620	genome.wustl.edu	37	15	74882286	74882286	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr15:74882286A>G	ENST00000346246.5	+	5	1054	c.823A>G	c.(823-825)Acc>Gcc	p.T275A		NM_006465.2	NP_006456.1	Q8IVW6	ARI3B_HUMAN	AT rich interactive domain 3B (BRIGHT-like)	275	ARID. {ECO:0000255|PROSITE- ProRule:PRU00355}.|Interaction with RB1.					nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)			NS(1)|breast(1)|endometrium(1)|large_intestine(2)|lung(7)|prostate(2)	14						GAGGGAGATCACCAAAGGCCT	0.572																																																	0													74.0	62.0	66.0					15																	74882286		2197	4296	6493	SO:0001583	missense	0				CCDS10264.1	15q24	2013-02-07	2006-11-08		ENSG00000179361	ENSG00000179361		"""-"""	14350	protein-coding gene	gene with protein product		612457	"""AT rich interactive domain 3B (BRIGHT- like)"""				Standard	NM_006465		Approved	BDP, DRIL2	uc002ayd.3	Q8IVW6	OTTHUMG00000141321	ENST00000346246.5:c.823A>G	15.37:g.74882286A>G	ENSP00000343126:p.Thr275Ala		O95443|Q59HC9|Q6P9C9	Missense_Mutation	SNP	pfam_ARID/BRIGHT_DNA-bd,superfamily_ARID/BRIGHT_DNA-bd,smart_ARID/BRIGHT_DNA-bd,pfscan_ARID/BRIGHT_DNA-bd	p.T275A	ENST00000346246.5	37	c.823	CCDS10264.1	15	.	.	.	.	.	.	.	.	.	.	A	16.73	3.203559	0.58234	.	.	ENSG00000179361	ENST00000382537;ENST00000346246;ENST00000395077	T	0.58797	0.31	5.35	5.35	0.76521	ARID/BRIGHT DNA-binding domain (5);	0.000000	0.85682	D	0.000000	T	0.57213	0.2038	N	0.16201	0.385	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.83275	0.995;0.996	T	0.52510	-0.8566	10	0.07990	T	0.79	-32.2672	15.3709	0.74564	1.0:0.0:0.0:0.0	.	275;275	Q8IVW6;Q8IVW6-4	ARI3B_HUMAN;.	A	275	ENSP00000343126:T275A	ENSP00000343126:T275A	T	+	1	0	ARID3B	72669339	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.850000	0.92190	2.026000	0.59711	0.482000	0.46254	ACC	ARID3B	-	pfam_ARID/BRIGHT_DNA-bd,superfamily_ARID/BRIGHT_DNA-bd,smart_ARID/BRIGHT_DNA-bd,pfscan_ARID/BRIGHT_DNA-bd	ENSG00000179361		0.572	ARID3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARID3B	HGNC	protein_coding	OTTHUMT00000280688.2	-	0.00	64	0	A	NM_006465		74882286	+1	tier1	-	no_errors	ENST00000346246	ensembl	human	known	74_37	missense	46.15	28	24	SNP	1.000	G
ARIH2	10425	genome.wustl.edu	37	3	48965152	48965152	+	Missense_Mutation	SNP	T	T	A			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr3:48965152T>A	ENST00000356401.4	+	3	500	c.161T>A	c.(160-162)tTt>tAt	p.F54Y	ARIH2_ENST00000490095.1_Intron|ARIH2_ENST00000449376.1_Missense_Mutation_p.F54Y	NM_006321.2	NP_006312.1	O95376	ARI2_HUMAN	ariadne RBR E3 ubiquitin protein ligase 2	54	Asp/Glu-rich (acidic).				developmental cell growth (GO:0048588)|hematopoietic stem cell proliferation (GO:0071425)|multicellular organismal development (GO:0007275)|protein K48-linked ubiquitination (GO:0070936)|protein K63-linked ubiquitination (GO:0070534)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|nucleic acid binding (GO:0003676)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			cervix(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(3)|ovary(1)|skin(1)	13				BRCA - Breast invasive adenocarcinoma(193;9.42e-05)|Kidney(197;0.00258)|KIRC - Kidney renal clear cell carcinoma(197;0.00269)		GCTGATGCCTTTGATCCCGAG	0.527																																																	0													112.0	106.0	108.0					3																	48965152		2203	4300	6503	SO:0001583	missense	0			AF099149	CCDS2780.1	3p21	2013-10-03	2013-10-03		ENSG00000177479	ENSG00000177479			690	protein-coding gene	gene with protein product	"""all-trans retinoic acid inducible RING finger"""	605615	"""ariadne (Drosophila) homolog 2"", ""ariadne homolog 2 (Drosophila)"""			10422847, 24058416	Standard	XM_005264798		Approved	TRIAD1	uc003cvb.3	O95376	OTTHUMG00000133547	ENST00000356401.4:c.161T>A	3.37:g.48965152T>A	ENSP00000348769:p.Phe54Tyr		Q9HBZ6|Q9UEM9	Missense_Mutation	SNP	pfam_Znf_C6HC,smart_Znf_RING,smart_Znf_C6HC,pfscan_Znf_RING	p.F54Y	ENST00000356401.4	37	c.161	CCDS2780.1	3	.	.	.	.	.	.	.	.	.	.	T	14.49	2.551563	0.45487	.	.	ENSG00000177479	ENST00000452882;ENST00000430423;ENST00000356401;ENST00000449376;ENST00000420814;ENST00000449729;ENST00000433170;ENST00000444790	T;T;D;D;T;T;T	0.82167	1.44;1.49;-1.58;-1.58;1.44;0.9;0.67	5.24	5.24	0.73138	.	0.000000	0.85682	D	0.000000	D	0.87026	0.6075	L	0.51422	1.61	0.58432	D	0.999999	P;D;D;D	0.67145	0.924;0.996;0.989;0.957	P;D;D;B	0.72982	0.878;0.979;0.953;0.306	D	0.83441	0.0043	10	0.12766	T	0.61	.	15.5094	0.75769	0.0:0.0:0.0:1.0	.	61;54;54;54	B3KMG5;C9JBC5;F8WCS4;O95376	.;.;.;ARI2_HUMAN	Y	54;54;54;54;54;54;54;53	ENSP00000395560:F54Y;ENSP00000399788:F54Y;ENSP00000348769:F54Y;ENSP00000403222:F54Y;ENSP00000397225:F54Y;ENSP00000404838:F54Y;ENSP00000406063:F54Y	ENSP00000348769:F54Y	F	+	2	0	ARIH2	48940156	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.757000	0.68766	2.131000	0.65755	0.451000	0.29950	TTT	ARIH2	-	NULL	ENSG00000177479		0.527	ARIH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARIH2	HGNC	protein_coding	OTTHUMT00000257525.1	-	0.00	70	0	T	NM_006321		48965152	+1	tier1	-	no_errors	ENST00000356401	ensembl	human	known	74_37	missense	23.81	48	15	SNP	1.000	A
ARL13B	200894	genome.wustl.edu	37	3	93762078	93762078	+	Nonsense_Mutation	SNP	G	G	T			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr3:93762078G>T	ENST00000394222.3	+	7	1293	c.1018G>T	c.(1018-1020)Gaa>Taa	p.E340*	ARL13B_ENST00000539730.1_Nonsense_Mutation_p.E61*|ARL13B_ENST00000303097.7_Nonsense_Mutation_p.E233*|ARL13B_ENST00000471138.1_Nonsense_Mutation_p.E340*|ARL13B_ENST00000535334.1_Nonsense_Mutation_p.E237*	NM_001174150.1	NP_001167621.1	Q3SXY8	AR13B_HUMAN	ADP-ribosylation factor-like 13B	340					cilium assembly (GO:0042384)|dorsal/ventral pattern formation (GO:0009953)|formation of radial glial scaffolds (GO:0021943)|heart looping (GO:0001947)|interneuron migration from the subpallium to the cortex (GO:0021830)|left/right axis specification (GO:0070986)|neural tube patterning (GO:0021532)|nonmotile primary cilium assembly (GO:0035058)|small GTPase mediated signal transduction (GO:0007264)|smoothened signaling pathway (GO:0007224)	ciliary membrane (GO:0060170)|cilium (GO:0005929)|intracellular (GO:0005622)|primary cilium (GO:0072372)	GTP binding (GO:0005525)			endometrium(1)|kidney(1)|large_intestine(3)|lung(3)|urinary_tract(2)	10						GCCATCATTGGAATCAGGTAA	0.279																																																	0													54.0	54.0	54.0					3																	93762078		2201	4300	6501	SO:0001587	stop_gained	0			AL713789	CCDS2924.1, CCDS2925.1, CCDS54615.1	3q11	2014-05-09	2005-11-18	2005-11-18	ENSG00000169379	ENSG00000169379		"""ADP-ribosylation factors-like"", ""ADP-ribosylation factors"""	25419	protein-coding gene	gene with protein product		608922	"""ADP-ribosylation factor-like 2-like 1"""	ARL2L1		15314642, 18674751	Standard	NR_033427		Approved	DKFZp761H079, JBTS8	uc003drf.3	Q3SXY8	OTTHUMG00000159012	ENST00000394222.3:c.1018G>T	3.37:g.93762078G>T	ENSP00000377769:p.Glu340*		D3DN29|G3V1S8|Q504W8|Q8TCL5	Nonsense_Mutation	SNP	pfam_Small_GTPase_ARF/SAR,pfam_Small_GTPase,pfam_SRP_receptor_beta_su,superfamily_P-loop_NTPase,smart_Small_GTPase_ARF,smart_Small_GTPase_SAR1,prints_Small_GTPase_ARF/SAR,tigrfam_Small_GTP-bd_dom	p.E340*	ENST00000394222.3	37	c.1018	CCDS2925.1	3	.	.	.	.	.	.	.	.	.	.	G	34	5.296665	0.95574	.	.	ENSG00000169379	ENST00000535334;ENST00000303097;ENST00000394222;ENST00000471138;ENST00000539730	.	.	.	5.33	5.33	0.75918	.	0.315718	0.30959	N	0.008534	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.36615	T	0.2	-1.7865	17.1398	0.86749	0.0:0.0:1.0:0.0	.	.	.	.	X	237;233;340;340;61	.	ENSP00000306225:E233X	E	+	1	0	ARL13B	95244768	1.000000	0.71417	0.997000	0.53966	0.305000	0.27757	4.121000	0.57904	2.656000	0.90262	0.655000	0.94253	GAA	ARL13B	-	NULL	ENSG00000169379		0.279	ARL13B-005	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	ARL13B	HGNC	protein_coding	OTTHUMT00000352904.1	-	0.00	82	0	G	NM_182896		93762078	+1	tier1	-	no_errors	ENST00000394222	ensembl	human	known	74_37	nonsense	5.63	67	4	SNP	1.000	T
ARL5C	390790	genome.wustl.edu	37	17	37317573	37317573	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr17:37317573C>T	ENST00000269586.7	-	4	286	c.287G>A	c.(286-288)cGg>cAg	p.R96Q	ARL5C_ENST00000444555.1_Missense_Mutation_p.R96Q|ARL5C_ENST00000583123.1_5'Flank	NM_001143968.1	NP_001137440.1	A6NH57	ARL5C_HUMAN	ADP-ribosylation factor-like 5C	96					small GTPase mediated signal transduction (GO:0007264)	intracellular (GO:0005622)	GTP binding (GO:0005525)										CAGCCGATCCCGGTCCGTGCT	0.552																																																	0													40.0	34.0	36.0					17																	37317573		692	1591	2283	SO:0001583	missense	0				CCDS45664.1	17q12	2014-05-09	2005-11-08	2005-11-08	ENSG00000141748	ENSG00000141748		"""ADP-ribosylation factors-like"", ""ADP-ribosylation factors"""	31111	protein-coding gene	gene with protein product			"""ADP-ribosylation factor-like 12"""	ARL12			Standard	NM_001143968		Approved		uc010wea.2	A6NH57		ENST00000269586.7:c.287G>A	17.37:g.37317573C>T	ENSP00000269586:p.Arg96Gln			Missense_Mutation	SNP	pfam_Small_GTPase_ARF/SAR,pfam_Small_GTPase,pfam_SRP_receptor_beta_su,pfam_MIRO-like,superfamily_P-loop_NTPase,smart_Small_GTPase_SAR1,smart_Small_GTPase_ARF,prints_Small_GTPase_ARF/SAR,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.R96Q	ENST00000269586.7	37	c.287	CCDS45664.1	17	.	.	.	.	.	.	.	.	.	.	C	12.49	1.954549	0.34471	.	.	ENSG00000141748	ENST00000444555;ENST00000269586	D;D	0.82711	-1.64;-1.64	4.07	3.1	0.35709	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	T	0.76385	0.3980	M	0.68728	2.09	0.51233	D	0.999916	P	0.48911	0.917	B	0.34652	0.187	T	0.77440	-0.2587	10	0.87932	D	0	-9.0433	9.6983	0.40171	0.0:0.8972:0.0:0.1028	.	96	A6NH57	ARL5C_HUMAN	Q	96	ENSP00000387615:R96Q;ENSP00000269586:R96Q	ENSP00000269586:R96Q	R	-	2	0	ARL5C	34571099	0.999000	0.42202	0.209000	0.23619	0.006000	0.05464	4.059000	0.57470	0.926000	0.37118	-0.137000	0.14449	CGG	ARL5C	-	pfam_Small_GTPase_ARF/SAR,pfam_Small_GTPase,pfam_SRP_receptor_beta_su,pfam_MIRO-like,superfamily_P-loop_NTPase,smart_Small_GTPase_SAR1,smart_Small_GTPase_ARF,prints_Small_GTPase_ARF/SAR,tigrfam_Small_GTP-bd_dom	ENSG00000141748		0.552	ARL5C-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	ARL5C	HGNC	protein_coding	OTTHUMT00000444566.1	-	0.00	52	0	C	NM_001143968		37317573	-1	tier1	-	no_errors	ENST00000269586	ensembl	human	known	74_37	missense	57.69	11	15	SNP	1.000	T
ARRDC2	27106	genome.wustl.edu	37	19	18119312	18119312	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr19:18119312G>A	ENST00000222250.4	+	1	336	c.193G>A	c.(193-195)Gcg>Acg	p.A65T	ARRDC2_ENST00000608009.1_3'UTR|ARRDC2_ENST00000379656.3_Intron	NM_015683.1	NP_056498.1	Q8TBH0	ARRD2_HUMAN	arrestin domain containing 2	65					signal transduction (GO:0007165)	cytoplasmic vesicle (GO:0031410)|plasma membrane (GO:0005886)				endometrium(1)|large_intestine(2)|lung(7)|pancreas(1)|prostate(1)	12						GTCGCGCAGCGCGGGCTCGAG	0.731																																																	0													7.0	9.0	8.0					19																	18119312		2056	4088	6144	SO:0001583	missense	0				CCDS12370.1, CCDS32956.1	19p13.12	2008-02-05				ENSG00000105643			25225	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_015683		Approved	CLONE24945, PP2703	uc002nhv.3	Q8TBH0		ENST00000222250.4:c.193G>A	19.37:g.18119312G>A	ENSP00000222250:p.Ala65Thr		B2RBG9|O95895|Q6ZRV9|Q8WYG6	Missense_Mutation	SNP	pfam_Arrestin-like_N,pfam_Arrestin_C-like,superfamily_Ig_E-set	p.A65T	ENST00000222250.4	37	c.193	CCDS12370.1	19	.	.	.	.	.	.	.	.	.	.	G	18.58	3.654078	0.67472	.	.	ENSG00000105643	ENST00000222250	T	0.14022	2.54	3.67	-4.51	0.03483	Immunoglobulin E-set (1);Arrestin-like, N-terminal (1);	0.315835	0.32852	N	0.005564	T	0.06600	0.0169	L	0.28274	0.84	0.50313	D	0.999861	B	0.13594	0.008	B	0.17979	0.02	T	0.15694	-1.0428	10	0.48119	T	0.1	-7.8288	3.6513	0.08205	0.3337:0.0:0.4001:0.2662	.	65	Q8TBH0	ARRD2_HUMAN	T	65	ENSP00000222250:A65T	ENSP00000222250:A65T	A	+	1	0	ARRDC2	17980312	0.994000	0.37717	0.353000	0.25747	0.998000	0.95712	1.072000	0.30678	-0.938000	0.03714	0.561000	0.74099	GCG	ARRDC2	-	pfam_Arrestin-like_N,superfamily_Ig_E-set	ENSG00000105643		0.731	ARRDC2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ARRDC2	HGNC	protein_coding	OTTHUMT00000466845.1	-	0.00	44	0	G	NM_015683		18119312	+1	tier1	-	no_errors	ENST00000222250	ensembl	human	known	74_37	missense	47.37	20	18	SNP	1.000	A
ASAP2	8853	genome.wustl.edu	37	2	9515045	9515045	+	Missense_Mutation	SNP	C	C	T	rs553146291		TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr2:9515045C>T	ENST00000281419.3	+	17	2058	c.1718C>T	c.(1717-1719)aCg>aTg	p.T573M	ASAP2_ENST00000315273.4_Missense_Mutation_p.T573M	NM_003887.2	NP_003878.1	O43150	ASAP2_HUMAN	ArfGAP with SH3 domain, ankyrin repeat and PH domain 2	573					positive regulation of catalytic activity (GO:0043085)|regulation of ARF GTPase activity (GO:0032312)	Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	ARF GTPase activator activity (GO:0008060)|enzyme activator activity (GO:0008047)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(6)|lung(15)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	36						GTGGATCTTACGGAAAAAATC	0.488													C|||	1	0.000199681	0.0	0.0	5008	,	,		14891	0.0		0.0	False		,,,				2504	0.001																0													87.0	88.0	88.0					2																	9515045		2203	4300	6503	SO:0001583	missense	0			AB007860	CCDS1661.1, CCDS46224.1	2p24	2013-01-10	2008-09-22	2008-09-22	ENSG00000151693	ENSG00000151693		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	2721	protein-coding gene	gene with protein product	"""centaurin, beta 3"""	603817	"""development and differentiation enhancing factor 2"""	DDEF2		10022920, 9455477	Standard	NM_003887		Approved	KIAA0400, PAP, SHAG1, CENTB3	uc002qzh.2	O43150	OTTHUMG00000117485	ENST00000281419.3:c.1718C>T	2.37:g.9515045C>T	ENSP00000281419:p.Thr573Met		D6W4Y8	Missense_Mutation	SNP	pfam_ArfGAP,pfam_Pleckstrin_homology,pfam_Ankyrin_rpt,pfam_SH3_domain,pfam_SH3_2,superfamily_Ankyrin_rpt-contain_dom,superfamily_SH3_domain,smart_Pleckstrin_homology,smart_ArfGAP,smart_Ankyrin_rpt,smart_SH3_domain,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_ArfGAP,prints_ArfGAP	p.T573M	ENST00000281419.3	37	c.1718	CCDS1661.1	2	.	.	.	.	.	.	.	.	.	.	C	10.10	1.258908	0.23051	.	.	ENSG00000151693	ENST00000281419;ENST00000315273	T;T	0.58060	0.42;0.36	5.27	4.39	0.52855	Ankyrin repeat-containing domain (1);	0.089287	0.85682	N	0.000000	T	0.21145	0.0509	N	0.02697	-0.525	0.47547	D	0.999455	P;P	0.41673	0.744;0.759	B;B	0.24541	0.054;0.024	T	0.09975	-1.0650	10	0.17832	T	0.49	.	13.8751	0.63648	0.0:0.9263:0.0:0.0736	.	573;573	O43150-2;O43150	.;ASAP2_HUMAN	M	573	ENSP00000281419:T573M;ENSP00000316404:T573M	ENSP00000281419:T573M	T	+	2	0	ASAP2	9432496	1.000000	0.71417	0.182000	0.23118	0.759000	0.43091	3.961000	0.56759	1.215000	0.43411	-0.140000	0.14226	ACG	ASAP2	-	superfamily_Ankyrin_rpt-contain_dom	ENSG00000151693		0.488	ASAP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ASAP2	HGNC	protein_coding	OTTHUMT00000237522.1		0.00	59	0	C	NM_003887		9515045	+1			no_errors	ENST00000281419	ensembl	human	known	74_37	missense	5.41	35	2	SNP	0.993	T
ATG9B	285973	genome.wustl.edu	37	7	150714208	150714208	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr7:150714208A>C	ENST00000377974.2	-	9	2279	c.2204T>G	c.(2203-2205)gTa>gGa	p.V735G	ATG9B_ENST00000444312.1_Missense_Mutation_p.V221G|ATG9B_ENST00000494791.1_5'UTR|ATG9B_ENST00000605938.1_Missense_Mutation_p.V735G			Q674R7	ATG9B_HUMAN	autophagy related 9B	735					autophagic vacuole assembly (GO:0000045)	autophagic vacuole (GO:0005776)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)				cervix(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(1)|ovary(4)|prostate(1)	14	all_neural(206;0.219)		OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		ATCTTGTTGTACTCGGCCCCA	0.652																																																	0													19.0	26.0	24.0					7																	150714208		1932	4142	6074	SO:0001583	missense	0			AK027791		7q36	2014-02-12	2012-06-06	2005-09-11	ENSG00000181652	ENSG00000181652			21899	protein-coding gene	gene with protein product		612205	"""nitric oxide synthase 3 antisense"", ""ATG9 autophagy related 9 homolog B (S. cerevisiae)"""	NOS3AS		15234981, 15755735	Standard	NM_173681		Approved	FLJ14885, APG9L2, SONE	uc011kvc.2	Q674R7	OTTHUMG00000158634	ENST00000377974.2:c.2204T>G	7.37:g.150714208A>C	ENSP00000475005:p.Val735Gly		A1A5D3|Q6JRW5|Q8N8I8	Missense_Mutation	SNP	pfam_Autophagy-rel_prot_9	p.V735G	ENST00000377974.2	37	c.2204		7	.	.	.	.	.	.	.	.	.	.	A	16.83	3.230674	0.58777	.	.	ENSG00000248602	ENST00000377974;ENST00000444312;ENST00000397266	.	.	.	4.97	4.97	0.65823	.	0.000000	0.85682	D	0.000000	T	0.58878	0.2153	.	.	.	.	.	.	D	0.55605	0.972	P	0.55222	0.771	T	0.65224	-0.6220	7	0.25751	T	0.34	-8.0617	12.6029	0.56506	1.0:0.0:0.0:0.0	.	735	Q674R7	ATG9B_HUMAN	G	735;221;735	.	ENSP00000444232:V735G	V	-	2	0	AC010973.1	150345141	1.000000	0.71417	0.986000	0.45419	0.957000	0.61999	9.226000	0.95229	1.854000	0.53819	0.402000	0.26972	GTA	ATG9B	-	NULL	ENSG00000181652		0.652	ATG9B-201	KNOWN	basic|appris_principal	protein_coding	ATG9B	HGNC	protein_coding		-	0.00	69	0	A	NM_173681		150714208	-1	tier1	-	no_errors	ENST00000377974	ensembl	human	known	74_37	missense	37.50	20	12	SNP	1.000	C
ATMIN	23300	genome.wustl.edu	37	16	81076086	81076086	+	Splice_Site	SNP	G	G	A			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr16:81076086G>A	ENST00000299575.4	+	3	686		c.e3+1		ATMIN_ENST00000564241.1_Splice_Site|ATMIN_ENST00000539819.1_Intron|ATMIN_ENST00000566488.1_Splice_Site	NM_015251.2	NP_056066.2	O43313	ATMIN_HUMAN	ATM interactor						cellular response to DNA damage stimulus (GO:0006974)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	dynein binding (GO:0045502)|metal ion binding (GO:0046872)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(9)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	20						CAGAACACAGGTGAAGGGAAA	0.517																																																	0													66.0	48.0	54.0					16																	81076086		2202	4300	6502	SO:0001630	splice_region_variant	0			BC002701	CCDS32494.1, CCDS73917.1	16q23.2	2013-01-07			ENSG00000166454	ENSG00000166454		"""Zinc fingers, C2H2-type"""	29034	protein-coding gene	gene with protein product	"""ATM/ATR-Substrate Chk2-Interacting Zn++-finger protein"", ""ATM INteracting protein"""	614693				15933716, 17525732, 19001856	Standard	XM_005255866		Approved	ASCIZ, KIAA0431, ZNF822	uc002ffz.1	O43313	OTTHUMG00000176469	ENST00000299575.4:c.662+1G>A	16.37:g.81076086G>A			A8K4H8|Q68DC9	Splice_Site	SNP	-	e3+1	ENST00000299575.4	37	c.662+1	CCDS32494.1	16	.	.	.	.	.	.	.	.	.	.	G	18.68	3.676452	0.67928	.	.	ENSG00000166454	ENST00000299575	.	.	.	5.49	5.49	0.81192	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.3817	0.94540	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ATMIN	79633587	1.000000	0.71417	0.996000	0.52242	0.621000	0.37620	9.553000	0.98118	2.577000	0.86979	0.655000	0.94253	.	ATMIN	-	-	ENSG00000166454		0.517	ATMIN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ATMIN	HGNC	protein_coding	OTTHUMT00000432140.1		0.00	34	0	G	NM_015251	Intron	81076086	+1			no_errors	ENST00000299575	ensembl	human	known	74_37	splice_site	20.69	23	6	SNP	1.000	A
ATP10B	23120	genome.wustl.edu	37	5	160115050	160115050	+	Missense_Mutation	SNP	C	C	T	rs369383733		TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr5:160115050C>T	ENST00000327245.5	-	5	878	c.32G>A	c.(31-33)cGg>cAg	p.R11Q	ATP10B_ENST00000518411.1_5'UTR|CTC-529G1.1_ENST00000524198.1_RNA	NM_025153.2	NP_079429.2	O94823	AT10B_HUMAN	ATPase, class V, type 10B	11					phospholipid translocation (GO:0045332)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|liver(2)|lung(37)|ovary(4)|pancreas(1)|prostate(5)|skin(3)|stomach(1)	75	Renal(175;0.00196)	Medulloblastoma(196;0.0377)|all_neural(177;0.121)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			CCACTGCCACCGATGCCACGA	0.537																																																	0								C	GLN/ARG	0,4254		0,0,2127	59.0	61.0	61.0		32	4.6	1.0	5		61	1,8489		0,1,4244	no	missense	ATP10B	NM_025153.2	43	0,1,6371	TT,TC,CC		0.0118,0.0,0.0078	benign	11/1462	160115050	1,12743	2127	4245	6372	SO:0001583	missense	0			AB018258	CCDS43394.1	5q34	2010-04-20	2007-09-19		ENSG00000118322	ENSG00000118322		"""ATPases / P-type"""	13543	protein-coding gene	gene with protein product			"""ATPase, Class V, type 10B"""			9872452, 11015572	Standard	NM_025153		Approved	ATPVB, KIAA0715, FLJ21477	uc003lym.1	O94823	OTTHUMG00000163551	ENST00000327245.5:c.32G>A	5.37:g.160115050C>T	ENSP00000313600:p.Arg11Gln		Q9H725	Missense_Mutation	SNP	pfam_ATPase_P-typ_transduc_dom_A,pfam_HAD-like_dom,superfamily_HAD-like_dom,superfamily_ATPase_P-typ_cyto_domN,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Plipid-transp,tigrfam_Cation_transp_P_typ_ATPase	p.R11Q	ENST00000327245.5	37	c.32	CCDS43394.1	5	.	.	.	.	.	.	.	.	.	.	C	18.65	3.669898	0.67814	0.0	1.18E-4	ENSG00000118322	ENST00000327245	T	0.52526	0.66	5.5	4.64	0.57946	.	0.000000	0.52532	D	0.000071	T	0.41328	0.1154	M	0.64404	1.975	0.33485	D	0.587954	P;P;B	0.46987	0.888;0.865;0.272	B;B;B	0.34652	0.187;0.129;0.012	T	0.60296	-0.7291	9	.	.	.	.	13.3798	0.60761	0.0:0.9249:0.0:0.0751	.	55;11;11	B4DHG1;O94823-2;O94823	.;.;AT10B_HUMAN	Q	11	ENSP00000313600:R11Q	.	R	-	2	0	ATP10B	160047628	0.440000	0.25618	0.969000	0.41365	0.199000	0.23934	2.747000	0.47475	1.332000	0.45431	-0.251000	0.11542	CGG	ATP10B	-	NULL	ENSG00000118322		0.537	ATP10B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP10B	HGNC	protein_coding	OTTHUMT00000374127.1		0.00	49	0	C	NM_025153		160115050	-1			no_errors	ENST00000327245	ensembl	human	known	74_37	missense	6.52	43	3	SNP	0.971	T
ATP2B2	491	genome.wustl.edu	37	3	10370464	10370464	+	3'UTR	SNP	A	A	C			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr3:10370464A>C	ENST00000352432.4	-	0	3835				ATP2B2_ENST00000383800.4_3'UTR|ATP2B2_ENST00000360273.2_3'UTR|ATP2B2_ENST00000343816.4_3'UTR|ATP2B2_ENST00000397077.1_3'UTR|MIR378B_ENST00000578876.1_RNA|ATP2B2_ENST00000467702.2_5'UTR			Q01814	AT2B2_HUMAN	ATPase, Ca++ transporting, plasma membrane 2						auditory receptor cell stereocilium organization (GO:0060088)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cerebellar granule cell differentiation (GO:0021707)|cerebellar Purkinje cell differentiation (GO:0021702)|cGMP metabolic process (GO:0046068)|cochlea development (GO:0090102)|cytosolic calcium ion homeostasis (GO:0051480)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|ion transmembrane transport (GO:0034220)|lactation (GO:0007595)|locomotion (GO:0040011)|locomotory behavior (GO:0007626)|neuromuscular process controlling balance (GO:0050885)|neuron differentiation (GO:0030182)|organelle organization (GO:0006996)|otolith mineralization (GO:0045299)|positive regulation of calcium ion transport (GO:0051928)|regulation of cell size (GO:0008361)|regulation of synaptic plasticity (GO:0048167)|sensory perception of sound (GO:0007605)|serotonin metabolic process (GO:0042428)|synapse organization (GO:0050808)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cilium (GO:0005929)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calcium-dependent ATPase activity (GO:0030899)|calcium-transporting ATPase activity (GO:0005388)|calmodulin binding (GO:0005516)|metal ion binding (GO:0046872)|PDZ domain binding (GO:0030165)|protein C-terminus binding (GO:0008022)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(7)|large_intestine(19)|lung(29)|ovary(5)|prostate(2)|skin(4)|stomach(2)|urinary_tract(2)	74						AGCGGGGTCCATGAGGGCGGG	0.602																																					Ovarian(125;1619 1709 15675 19819 38835)												0													34.0	33.0	34.0					3																	10370464		2203	4300	6503	SO:0001624	3_prime_UTR_variant	0			X63575	CCDS2601.1, CCDS33701.1	3p25.3	2010-04-20	2001-12-04		ENSG00000157087	ENSG00000157087	3.6.3.8	"""ATPases / P-type"""	815	protein-coding gene	gene with protein product	"""plasma membrane Ca2+ pump 2"", ""plasma membrane calcium-transporting ATPase 2"""	108733				1313367	Standard	NM_001001331		Approved	PMCA2	uc003bvt.3	Q01814	OTTHUMG00000128679	ENST00000352432.4:c.*34T>G	3.37:g.10370464A>C			O00766|Q12994|Q16818	RNA	SNP	-	NULL	ENST00000352432.4	37	NULL	CCDS33701.1	3																																																																																			ATP2B2	-	-	ENSG00000157087		0.602	ATP2B2-001	KNOWN	basic|CCDS	protein_coding	ATP2B2	HGNC	protein_coding	OTTHUMT00000250576.2	-	0.00	45	0	A	NM_001683		10370464	-1	tier1	-	no_errors	ENST00000467702	ensembl	human	known	74_37	rna	26.67	33	12	SNP	0.000	C
ATP6AP1	537	genome.wustl.edu	37	X	153660199	153660199	+	Silent	SNP	A	A	G			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chrX:153660199A>G	ENST00000369762.2	+	3	373	c.312A>G	c.(310-312)gcA>gcG	p.A104A	ATP6AP1_ENST00000484908.1_3'UTR	NM_001183.4	NP_001174.2	Q15904	VAS1_HUMAN	ATPase, H+ transporting, lysosomal accessory protein 1	104					ATP hydrolysis coupled proton transport (GO:0015991)|establishment of organelle localization (GO:0051656)|pH reduction (GO:0045851)|positive regulation of bone resorption (GO:0045780)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of exocytosis (GO:0045921)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of osteoclast development (GO:2001206)|proton transport (GO:0015992)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|proton-transporting two-sector ATPase complex (GO:0016469)|proton-transporting V-type ATPase, V1 domain (GO:0033180)|vacuole (GO:0005773)	ATP binding (GO:0005524)|proton-transporting ATP synthase activity, rotational mechanism (GO:0046933)|proton-transporting ATPase activity, rotational mechanism (GO:0046961)|Rab GTPase binding (GO:0017137)|transporter activity (GO:0005215)			breast(1)|endometrium(2)|large_intestine(2)|lung(4)|ovary(5)	14	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					ATTTCACAGCATATGGCGGTG	0.552											OREG0003605	type=REGULATORY REGION|Gene=ATP6AP1|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																																					0													268.0	230.0	243.0					X																	153660199		2203	4300	6503	SO:0001819	synonymous_variant	0			D16469	CCDS35451.1	Xq28	2010-03-10	2003-08-28	2003-08-29	ENSG00000071553	ENSG00000071553			868	protein-coding gene	gene with protein product		300197	"""ATPase, H+ transporting, lysosomal (vacuolar proton pump), subunit 1"""	ATP6S1, ATP6IP1		8733135, 8281148	Standard	NM_001183		Approved	ORF, XAP-3, VATPS1, 16A, Ac45, XAP3, CF2	uc004flf.1	Q15904	OTTHUMG00000033291	ENST00000369762.2:c.312A>G	X.37:g.153660199A>G		1757	A6ZKI4|Q8NBT4|Q9H0C7	Silent	SNP	pfam_BIG/ATPase_V1_suS1	p.A104	ENST00000369762.2	37	c.312	CCDS35451.1	X																																																																																			ATP6AP1	-	pfam_BIG/ATPase_V1_suS1	ENSG00000071553		0.552	ATP6AP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP6AP1	HGNC	protein_coding	OTTHUMT00000081639.4	-	0.00	33	0	A	NM_001183		153660199	+1	tier1	-	no_errors	ENST00000369762	ensembl	human	known	74_37	silent	57.69	11	15	SNP	0.686	G
ATP8B2	57198	genome.wustl.edu	37	1	154315284	154315284	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr1:154315284G>A	ENST00000368489.3	+	15	1399	c.1399G>A	c.(1399-1401)Gtt>Att	p.V467I		NM_020452.3	NP_065185.1	P98198	AT8B2_HUMAN	ATPase, aminophospholipid transporter, class I, type 8B, member 2	453					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)		IL6R/ATP8B2(2)	breast(2)|endometrium(4)|kidney(3)|large_intestine(7)|lung(25)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	51	all_lung(78;2.62e-30)|Lung NSC(65;3.94e-28)|Hepatocellular(266;0.0877)		LUSC - Lung squamous cell carcinoma(543;0.185)			GCCTGAACCTGTTGACTTCTC	0.547																																																	0													109.0	102.0	104.0					1																	154315284		2203	4300	6503	SO:0001583	missense	0			AB032963	CCDS1066.1, CCDS41405.1	1q21.3	2012-03-09	2012-03-09		ENSG00000143515	ENSG00000143515		"""ATPases / P-type"""	13534	protein-coding gene	gene with protein product		605867	"""ATPase, class I, type 8B, member 2"""			10574461, 11015572	Standard	NM_020452		Approved	ATPID, KIAA1137	uc001fex.3	P98198	OTTHUMG00000035979	ENST00000368489.3:c.1399G>A	1.37:g.154315284G>A	ENSP00000357475:p.Val467Ile		B4E3P4|Q6NT69|Q7Z486|Q96I43|Q96NQ7	Missense_Mutation	SNP	pfam_ATPase_P-typ_transduc_dom_A,superfamily_HAD-like_dom,superfamily_ATPase_P-typ_cyto_domN,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Plipid-transp,tigrfam_Cation_transp_P_typ_ATPase	p.V467I	ENST00000368489.3	37	c.1399	CCDS1066.1	1	.	.	.	.	.	.	.	.	.	.	G	12.06	1.824769	0.32237	.	.	ENSG00000143515	ENST00000368489	T	0.63096	-0.02	5.39	2.17	0.27698	.	0.497920	0.21337	N	0.076194	T	0.38957	0.1060	L	0.46157	1.445	0.80722	D	1	B	0.20052	0.041	B	0.29716	0.106	T	0.25082	-1.0142	10	0.34782	T	0.22	.	11.426	0.50012	0.2184:0.0:0.7816:0.0	.	467	P98198-3	.	I	467	ENSP00000357475:V467I	ENSP00000357475:V467I	V	+	1	0	ATP8B2	152581908	0.814000	0.29104	0.042000	0.18584	0.871000	0.50021	1.025000	0.30090	0.386000	0.24997	0.655000	0.94253	GTT	ATP8B2	-	superfamily_HAD-like_dom,superfamily_ATPase_P-typ_cyto_domN,tigrfam_ATPase_P-typ_Plipid-transp	ENSG00000143515		0.547	ATP8B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP8B2	HGNC	protein_coding	OTTHUMT00000087658.2	-	0.00	62	0	G	NM_020452		154315284	+1	tier1	-	no_errors	ENST00000368489	ensembl	human	known	74_37	missense	7.27	50	4	SNP	0.503	A
B3GNT3	10331	genome.wustl.edu	37	19	17922892	17922892	+	Silent	SNP	G	G	A			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr19:17922892G>A	ENST00000318683.6	+	3	1227	c.1080G>A	c.(1078-1080)caG>caA	p.Q360Q	B3GNT3_ENST00000595387.1_Silent_p.Q360Q	NM_014256.3	NP_055071.2	Q9Y2A9	B3GN3_HUMAN	UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 3	360					carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)	beta-1,3-galactosyl-O-glycosyl-glycoprotein beta-1,3-N-acetylglucosaminyltransferase activity (GO:0047223)|galactosyltransferase activity (GO:0008378)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(7)|prostate(2)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(1)	21						CGCTGAACCAGCCCAACCTCA	0.582																																																	0													44.0	39.0	41.0					19																	17922892		2200	4275	6475	SO:0001819	synonymous_variant	0			AB015630	CCDS12364.1	19p13.1	2013-02-19				ENSG00000179913		"""Beta 3-glycosyltransferases"""	13528	protein-coding gene	gene with protein product	"""putative type II membrane protein"", ""beta-1,3-N-acetylglucosaminyltransferase bGnT-3"", ""transmembrane protein 3"""	605863		TMEM3		10072769, 11042166	Standard	NM_014256		Approved	B3GN-T3, beta3Gn-T3, HP10328, B3GNT-3	uc002nhl.1	Q9Y2A9		ENST00000318683.6:c.1080G>A	19.37:g.17922892G>A			B2RAS4|Q6NWU9|Q6NXU9|Q8WWR6|Q9C0J2	Silent	SNP	pfam_Glyco_trans_31	p.Q360	ENST00000318683.6	37	c.1080	CCDS12364.1	19																																																																																			B3GNT3	-	NULL	ENSG00000179913		0.582	B3GNT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	B3GNT3	HGNC	protein_coding	OTTHUMT00000466877.1	-	0.00	35	0	G	NM_014256		17922892	+1	tier1	-	no_errors	ENST00000318683	ensembl	human	known	74_37	silent	12.90	27	4	SNP	0.022	A
BRCA1	672	genome.wustl.edu	37	17	41203114	41203114	+	Silent	SNP	G	G	T			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr17:41203114G>T	ENST00000357654.3	-	20	5416	c.5298C>A	c.(5296-5298)atC>atA	p.I1766I	BRCA1_ENST00000491747.2_Silent_p.I662I|BRCA1_ENST00000591534.1_Silent_p.I257I|BRCA1_ENST00000351666.3_Silent_p.I583I|BRCA1_ENST00000352993.3_Silent_p.I624I|BRCA1_ENST00000354071.3_Silent_p.I1501I|BRCA1_ENST00000591849.1_Intron|BRCA1_ENST00000586385.1_Silent_p.I76I|BRCA1_ENST00000309486.4_Silent_p.I1470I|BRCA1_ENST00000471181.2_Silent_p.I1787I|BRCA1_ENST00000493795.1_Silent_p.I1719I|BRCA1_ENST00000468300.1_Silent_p.I662I|BRCA1_ENST00000346315.3_Silent_p.I1527I	NM_007294.3	NP_009225.1	P38398	BRCA1_HUMAN	breast cancer 1, early onset	1766	BRCT 2. {ECO:0000255|PROSITE- ProRule:PRU00033}.		I -> S (in BC; unknown pathological significance). {ECO:0000269|PubMed:17924331}.		androgen receptor signaling pathway (GO:0030521)|apoptotic process (GO:0006915)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to indole-3-methanol (GO:0071681)|cellular response to tumor necrosis factor (GO:0071356)|chromosome segregation (GO:0007059)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|fatty acid biosynthetic process (GO:0006633)|G2 DNA damage checkpoint (GO:0031572)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of centriole replication (GO:0046600)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of fatty acid biosynthetic process (GO:0045717)|negative regulation of histone H3-K9 methylation (GO:0051573)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of DNA repair (GO:0045739)|positive regulation of gene expression (GO:0010628)|positive regulation of histone acetylation (GO:0035066)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of histone H3-K9 acetylation (GO:2000617)|positive regulation of histone H4-K16 acetylation (GO:2000620)|positive regulation of histone H4-K20 methylation (GO:0070512)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation vascular endothelial growth factor production (GO:0010575)|postreplication repair (GO:0006301)|protein autoubiquitination (GO:0051865)|protein K6-linked ubiquitination (GO:0085020)|protein ubiquitination (GO:0016567)|regulation of apoptotic process (GO:0042981)|regulation of cell proliferation (GO:0042127)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to estrogen (GO:0043627)|response to ionizing radiation (GO:0010212)	BRCA1-A complex (GO:0070531)|BRCA1-BARD1 complex (GO:0031436)|chromosome (GO:0005694)|cytoplasm (GO:0005737)|gamma-tubulin ring complex (GO:0008274)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ribonucleoprotein complex (GO:0030529)|ubiquitin ligase complex (GO:0000151)	androgen receptor binding (GO:0050681)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligase activity (GO:0016874)|RNA binding (GO:0003723)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)|tubulin binding (GO:0015631)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(30)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(7)|lung(28)|ovary(36)|skin(2)|stomach(4)|urinary_tract(2)	120		Breast(137;0.000717)		BRCA - Breast invasive adenocarcinoma(366;0.126)		CATAGCAACAGATTTCTAGCC	0.453			"""D, Mis, N, F, S"""		ovarian	"""breast, ovarian"""		Homologous recombination	Hereditary Breast-Ovarian Cancer, BRCA1 type	TCGA Ovarian(2;0.000030)																													yes	Rec	yes	Hereditary breast/ovarian cancer	17	17q21	672	familial breast/ovarian cancer gene 1		E	0													69.0	68.0	69.0					17																	41203114		2203	4300	6503	SO:0001819	synonymous_variant	0	Familial Cancer Database		U14680	CCDS11453.1, CCDS11454.1, CCDS11455.1, CCDS11456.1, CCDS11459.1, CCDS11455.2, CCDS11456.2, CCDS11459.2, CCDS11454.2	17q21.31	2014-09-17			ENSG00000012048	ENSG00000012048		"""RING-type (C3HC4) zinc fingers"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1100	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-containing complex, subunit 1"", ""protein phosphatase 1, regulatory subunit 53"""	113705				1676470	Standard	NM_007300		Approved	RNF53, BRCC1, PPP1R53	uc002ict.3	P38398	OTTHUMG00000157426	ENST00000357654.3:c.5298C>A	17.37:g.41203114G>T			O15129|Q1RMC1|Q3LRJ0|Q3LRJ6|Q6IN79|Q7KYU9	Silent	SNP	pirsf_BRCA1,pfam_BRCT_dom,pfam_Znf_C3HC4_RING-type,superfamily_BRCT_dom,smart_Znf_RING,smart_BRCT_dom,prints_BRCA1,pfscan_BRCT_dom,pfscan_Znf_RING	p.I1787	ENST00000357654.3	37	c.5361	CCDS11453.1	17																																																																																			BRCA1	-	pirsf_BRCA1,pfam_BRCT_dom,superfamily_BRCT_dom,smart_BRCT_dom,pfscan_BRCT_dom	ENSG00000012048		0.453	BRCA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRCA1	HGNC	protein_coding	OTTHUMT00000348798.2	-	0.00	44	0	G	NM_007294		41203114	-1	tier1	-	no_errors	ENST00000471181	ensembl	human	known	74_37	silent	73.08	14	38	SNP	1.000	T
BRD7	29117	genome.wustl.edu	37	16	50353169	50353169	+	Nonsense_Mutation	SNP	C	C	A			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr16:50353169C>A	ENST00000394688.3	-	17	2068	c.1909G>T	c.(1909-1911)Gaa>Taa	p.E637*	BRD7_ENST00000394689.2_Nonsense_Mutation_p.E638*			Q9NPI1	BRD7_HUMAN	bromodomain containing 7	637					cell cycle (GO:0007049)|negative regulation of cell proliferation (GO:0008285)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of histone acetylation (GO:0035066)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	histone binding (GO:0042393)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			autonomic_ganglia(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(7)|prostate(2)|urinary_tract(2)	22		all_cancers(37;0.0127)				TTTTTAGGTTCTTCAGTGTCT	0.353																																																	0													64.0	62.0	62.0					16																	50353169		2198	4300	6498	SO:0001587	stop_gained	0			AF213969	CCDS10742.1, CCDS54007.1	16q12.1	2008-11-18	2002-01-14		ENSG00000166164	ENSG00000166164			14310	protein-coding gene	gene with protein product			"""bromodomain-containing 7"""			10526152, 18809673	Standard	NM_013263		Approved	CELTIX1, BP75	uc002ege.2	Q9NPI1	OTTHUMG00000133170	ENST00000394688.3:c.1909G>T	16.37:g.50353169C>A	ENSP00000378180:p.Glu637*		Q4VC09|Q8N2L9|Q96KA4|Q9BV48|Q9UH59	Nonsense_Mutation	SNP	pfam_DUF3512,pfam_Bromodomain,superfamily_Bromodomain,smart_Bromodomain,prints_Bromodomain,pfscan_Bromodomain	p.E638*	ENST00000394688.3	37	c.1912	CCDS10742.1	16	.	.	.	.	.	.	.	.	.	.	C	18.56	3.649853	0.67358	.	.	ENSG00000166164	ENST00000394688;ENST00000394689	.	.	.	5.92	5.92	0.95590	.	0.161287	0.56097	D	0.000038	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.56958	D	0.05	-12.5816	17.0496	0.86515	0.0:1.0:0.0:0.0	.	.	.	.	X	637;638	.	ENSP00000378180:E637X	E	-	1	0	BRD7	48910670	1.000000	0.71417	0.994000	0.49952	0.655000	0.38815	4.124000	0.57924	2.809000	0.96659	0.557000	0.71058	GAA	BRD7	-	NULL	ENSG00000166164		0.353	BRD7-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	BRD7	HGNC	protein_coding	OTTHUMT00000256874.3		0.00	45	0	C	NM_013263		50353169	-1			no_errors	ENST00000394689	ensembl	human	known	74_37	nonsense	5.77	49	3	SNP	1.000	A
BSPRY	54836	genome.wustl.edu	37	9	116116558	116116558	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr9:116116558G>C	ENST00000374183.4	+	2	279	c.240G>C	c.(238-240)caG>caC	p.Q80H	BSPRY_ENST00000462085.1_3'UTR	NM_017688.2	NP_060158.2	Q5W0U4	BSPRY_HUMAN	B-box and SPRY domain containing	80					calcium ion transport (GO:0006816)	cell leading edge (GO:0031252)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)	zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|kidney(1)|lung(4)|urinary_tract(1)	8						TGCAGTTACAGAGTGCTGCCA	0.527																																																	0													118.0	126.0	123.0					9																	116116558		2102	4236	6338	SO:0001583	missense	0			AJ276691	CCDS43868.1	9q33.1	2008-02-05			ENSG00000119411	ENSG00000119411			18232	protein-coding gene	gene with protein product						10978534, 11099500	Standard	NM_017688		Approved	FLJ20150	uc004bhg.4	Q5W0U4	OTTHUMG00000021006	ENST00000374183.4:c.240G>C	9.37:g.116116558G>C	ENSP00000363298:p.Gln80His		B3KS19|Q96DJ2|Q9H4E4|Q9NXN0	Missense_Mutation	SNP	pfam_SPRY_rcpt,pfam_Znf_B-box,superfamily_ConA-like_lec_gl_sf,smart_PRY,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,prints_Butyrophylin	p.Q80H	ENST00000374183.4	37	c.240	CCDS43868.1	9	.	.	.	.	.	.	.	.	.	.	G	15.85	2.954382	0.53293	.	.	ENSG00000119411	ENST00000374183	T	0.62639	0.01	5.16	3.3	0.37823	.	0.000000	0.85682	D	0.000000	T	0.67552	0.2905	L	0.32530	0.975	0.35657	D	0.812208	D;D	0.76494	0.997;0.999	D;D	0.81914	0.995;0.921	T	0.71441	-0.4592	10	0.46703	T	0.11	-16.049	11.8184	0.52224	0.1571:0.0:0.8429:0.0	.	80;80	Q5W0U4-2;Q5W0U4	.;BSPRY_HUMAN	H	80	ENSP00000363298:Q80H	ENSP00000363298:Q80H	Q	+	3	2	BSPRY	115156379	1.000000	0.71417	0.999000	0.59377	0.938000	0.57974	1.873000	0.39558	0.211000	0.20683	-1.094000	0.02160	CAG	BSPRY	-	NULL	ENSG00000119411		0.527	BSPRY-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BSPRY	HGNC	protein_coding	OTTHUMT00000055399.1	-	0.00	57	0	G	NM_017688		116116558	+1	tier1	-	no_errors	ENST00000374183	ensembl	human	known	74_37	missense	31.58	39	18	SNP	1.000	C
C16orf54	283897	genome.wustl.edu	37	16	29755699	29755699	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr16:29755699G>C	ENST00000329410.3	-	2	669	c.574C>G	c.(574-576)Cca>Gca	p.P192A	AC009133.17_ENST00000565600.1_RNA	NM_175900.3	NP_787096.2	Q6UWD8	CP054_HUMAN	chromosome 16 open reading frame 54	192						integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|lung(2)|prostate(1)|urinary_tract(1)	6						GGGCTCCCTGGCCGCTGCCTC	0.692																																																	0													9.0	10.0	10.0					16																	29755699		2131	4235	6366	SO:0001583	missense	0			AK093000	CCDS10652.1	16p11.2	2012-10-10		2005-08-09	ENSG00000185905	ENSG00000185905			26649	protein-coding gene	gene with protein product						12975309	Standard	NM_175900		Approved	FLJ35681	uc002dtp.2	Q6UWD8	OTTHUMG00000132116	ENST00000329410.3:c.574C>G	16.37:g.29755699G>C	ENSP00000327506:p.Pro192Ala		A6NJR6|Q8NAB0	Missense_Mutation	SNP	NULL	p.P192A	ENST00000329410.3	37	c.574	CCDS10652.1	16	.	.	.	.	.	.	.	.	.	.	G	8.335	0.827331	0.16749	.	.	ENSG00000185905	ENST00000329410	.	.	.	5.22	5.22	0.72569	.	0.366130	0.19638	U	0.109507	T	0.41880	0.1178	L	0.29908	0.895	0.09310	N	1	P	0.49961	0.93	P	0.50162	0.633	T	0.30563	-0.9974	9	0.45353	T	0.12	-0.6268	14.2742	0.66170	0.0:0.0:1.0:0.0	.	192	Q6UWD8	CP054_HUMAN	A	192	.	ENSP00000327506:P192A	P	-	1	0	C16orf54	29663200	0.478000	0.25917	0.021000	0.16686	0.089000	0.18198	3.000000	0.49481	2.435000	0.82474	0.313000	0.20887	CCA	C16orf54	-	NULL	ENSG00000185905		0.692	C16orf54-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C16orf54	HGNC	protein_coding	OTTHUMT00000255158.1	-	0.00	39	0	G	NM_175900		29755699	-1	tier1	-	no_errors	ENST00000329410	ensembl	human	known	74_37	missense	41.18	10	7	SNP	0.150	C
C17orf99	100141515	genome.wustl.edu	37	17	76160528	76160528	+	Intron	SNP	G	G	T	rs563739941		TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr17:76160528G>T	ENST00000340363.5	+	4	695				C17orf99_ENST00000451352.3_3'UTR	NM_001163075.1	NP_001156547.1	Q6UX52	CQ099_HUMAN	chromosome 17 open reading frame 99							extracellular region (GO:0005576)											CAGGTCGATGGGAAGTGGGAC	0.637																																																	0																																										SO:0001627	intron_variant	0			AY358510	CCDS54171.1	17q25.3	2012-10-23			ENSG00000187997	ENSG00000187997			34490	protein-coding gene	gene with protein product							Standard	NM_001163075		Approved	GLPG464, UNQ464	uc002jus.4	Q6UX52	OTTHUMG00000153871	ENST00000340363.5:c.640+83G>T	17.37:g.76160528G>T				RNA	SNP	-	NULL	ENST00000340363.5	37	NULL	CCDS54171.1	17	.	.	.	.	.	.	.	.	.	.	G	7.550	0.662477	0.14645	.	.	ENSG00000187997	ENST00000451352	.	.	.	1.72	1.72	0.24424	.	.	.	.	.	T	0.50922	0.1644	.	.	.	0.19300	N	0.999979	D	0.71674	0.998	P	0.59948	0.866	T	0.28299	-1.0048	6	.	.	.	.	6.9989	0.24799	0.0:0.0:1.0:0.0	.	228	E7ESU9	.	C	228	.	.	W	+	3	0	C17orf99	73672123	0.001000	0.12720	0.004000	0.12327	0.093000	0.18481	0.262000	0.18460	1.297000	0.44761	0.306000	0.20318	TGG	C17orf99	-	-	ENSG00000187997		0.637	C17orf99-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C17orf99	HGNC	protein_coding	OTTHUMT00000332775.1	-	0.00	25	0	G	NM_001163075		76160528	+1	tier1	-	no_errors	ENST00000451352	ensembl	human	known	74_37	rna	59.26	11	16	SNP	0.004	T
C1orf158	93190	genome.wustl.edu	37	1	12806383	12806383	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr1:12806383T>G	ENST00000288048.5	+	1	221	c.5T>G	c.(4-6)tTt>tGt	p.F2C	C1orf158_ENST00000474179.1_3'UTR|C1orf158_ENST00000376210.3_Missense_Mutation_p.F2C	NM_152290.2	NP_689503.2	Q8N1D5	CA158_HUMAN	chromosome 1 open reading frame 158	2										central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(1)|ovary(1)|skin(2)|urinary_tract(3)	10	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.0042)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.06e-06)|COAD - Colon adenocarcinoma(227;0.000273)|BRCA - Breast invasive adenocarcinoma(304;0.000311)|Kidney(185;0.00216)|KIRC - Kidney renal clear cell carcinoma(229;0.00575)|STAD - Stomach adenocarcinoma(313;0.00743)|READ - Rectum adenocarcinoma(331;0.0649)		CTTAACATGTTTTTGACTGCA	0.473																																																	0													70.0	70.0	70.0					1																	12806383		2203	4300	6503	SO:0001583	missense	0			BX647383	CCDS147.1	1p36.21	2008-02-05			ENSG00000157330	ENSG00000157330			28567	protein-coding gene	gene with protein product						12477932	Standard	NM_152290		Approved	MGC35194	uc001auh.3	Q8N1D5	OTTHUMG00000001888	ENST00000288048.5:c.5T>G	1.37:g.12806383T>G	ENSP00000288048:p.Phe2Cys		Q5VUY4	Missense_Mutation	SNP	NULL	p.F2C	ENST00000288048.5	37	c.5	CCDS147.1	1	.	.	.	.	.	.	.	.	.	.	T	16.30	3.085649	0.55861	.	.	ENSG00000157330	ENST00000288048;ENST00000376210	T;T	0.53423	0.71;0.62	5.95	4.84	0.62591	.	0.973755	0.08452	N	0.943718	T	0.57770	0.2076	L	0.51422	1.61	0.09310	N	1	D;D	0.67145	0.996;0.993	P;P	0.59288	0.855;0.8	T	0.47058	-0.9146	10	0.62326	D	0.03	-1.9521	7.9877	0.30222	0.0:0.0884:0.0:0.9116	.	2;2	B4DQE0;Q8N1D5	.;CA158_HUMAN	C	2	ENSP00000288048:F2C;ENSP00000365383:F2C	ENSP00000288048:F2C	F	+	2	0	C1orf158	12728970	0.061000	0.20836	0.343000	0.25615	0.049000	0.14656	1.231000	0.32624	2.279000	0.76181	0.533000	0.62120	TTT	C1orf158	-	NULL	ENSG00000157330		0.473	C1orf158-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C1orf158	HGNC	protein_coding	OTTHUMT00000005325.1	-	0.00	61	0	T	NM_152290		12806383	+1	tier1	-	no_errors	ENST00000288048	ensembl	human	known	74_37	missense	23.71	74	23	SNP	0.067	G
C1orf194	127003	genome.wustl.edu	37	1	109649280	109649280	+	Splice_Site	SNP	T	T	C			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr1:109649280T>C	ENST00000369948.3	-	4	391	c.316A>G	c.(316-318)Acc>Gcc	p.T106A	C1orf194_ENST00000369945.3_Splice_Site_p.T67A|C1orf194_ENST00000369949.4_Splice_Site_p.T94A			Q5T5A4	CA194_HUMAN	chromosome 1 open reading frame 194	106										large_intestine(2)|lung(2)|ovary(2)	6						TGGATCTTGGTTCTAGAAGAA	0.443																																																	0													89.0	88.0	88.0					1																	109649280		1568	3582	5150	SO:0001630	splice_region_variant	0				CCDS41364.1	1p13.3	2011-03-31			ENSG00000179902	ENSG00000179902			32331	protein-coding gene	gene with protein product							Standard	NM_001122961		Approved		uc009wew.3	Q5T5A4	OTTHUMG00000011735	ENST00000369948.3:c.315-1A>G	1.37:g.109649280T>C			Q5T5A3	Missense_Mutation	SNP	pfam_DUF3695	p.T106A	ENST00000369948.3	37	c.316		1	.	.	.	.	.	.	.	.	.	.	T	0.140	-1.103127	0.01828	.	.	ENSG00000179902	ENST00000369949;ENST00000369948;ENST00000369945	.	.	.	4.95	1.2	0.21068	.	1.090560	0.07082	N	0.837221	T	0.09247	0.0228	L	0.40543	1.245	0.20403	N	0.999906	B;B	0.16802	0.002;0.019	B;B	0.17098	0.001;0.017	T	0.28004	-1.0057	9	0.07482	T	0.82	-0.8412	2.1247	0.03735	0.1567:0.0895:0.1629:0.5909	.	94;106	Q5T5A4-2;Q5T5A4	.;CA194_HUMAN	A	94;106;67	.	ENSP00000358961:T67A	T	-	1	0	C1orf194	109450803	0.007000	0.16637	0.329000	0.25429	0.076000	0.17211	-0.377000	0.07456	0.234000	0.21139	-1.035000	0.02400	ACC	C1orf194	-	pfam_DUF3695	ENSG00000179902		0.443	C1orf194-001	KNOWN	basic|appris_principal	protein_coding	C1orf194	HGNC	protein_coding	OTTHUMT00000032416.2		0.00	82	0	T	NM_001122961	Missense_Mutation	109649280	-1			no_errors	ENST00000369948	ensembl	human	known	74_37	missense	9.52	38	4	SNP	0.223	C
C4orf50	389197	genome.wustl.edu	37	4	5977670	5977670	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr4:5977670G>T	ENST00000324058.5	-	3	270	c.181C>A	c.(181-183)Cag>Aag	p.Q61K	C4orf50_ENST00000531445.1_Missense_Mutation_p.Q535K			Q6ZRC1	CD050_HUMAN	chromosome 4 open reading frame 50	61										breast(1)|large_intestine(2)|lung(5)|ovary(1)|pancreas(2)|skin(3)|urinary_tract(1)	15						TGCTTTTTCTGAAGTTCTTCA	0.413																																																	0													119.0	112.0	114.0					4																	5977670		2203	4300	6503	SO:0001583	missense	0			BC140710		4p16.1	2009-04-14			ENSG00000181215	ENSG00000181215			33766	protein-coding gene	gene with protein product							Standard	XM_003119922		Approved	FLJ46481		Q6ZRC1	OTTHUMG00000149971	ENST00000324058.5:c.181C>A	4.37:g.5977670G>T	ENSP00000317287:p.Gln61Lys			Missense_Mutation	SNP	NULL	p.Q535K	ENST00000324058.5	37	c.1603		4	.	.	.	.	.	.	.	.	.	.	G	0.013	-1.610055	0.00835	.	.	ENSG00000181215	ENST00000531445;ENST00000324058	T;T	0.22945	1.93;1.93	3.2	2.24	0.28232	.	0.799636	0.10181	N	0.705820	T	0.16981	0.0408	L	0.46157	1.445	0.09310	N	1	B	0.25312	0.123	B	0.18561	0.022	T	0.37150	-0.9718	10	0.02654	T	1	-4.7835	6.9189	0.24376	0.0:0.0:0.7259:0.2741	.	61	Q6ZRC1	CD050_HUMAN	K	535;61	ENSP00000437121:Q535K;ENSP00000317287:Q61K	ENSP00000317287:Q61K	Q	-	1	0	C4orf50	6028571	0.305000	0.24481	0.005000	0.12908	0.024000	0.10985	1.855000	0.39378	1.810000	0.52873	0.455000	0.32223	CAG	C4orf50	-	NULL	ENSG00000181215		0.413	C4orf50-201	KNOWN	basic|appris_candidate	protein_coding	C4orf50	HGNC	protein_coding		-	0.00	83	0	G	NM_207405		5977670	-1	tier1	-	no_errors	ENST00000531445	ensembl	human	known	74_37	missense	5.33	71	4	SNP	0.002	T
C6orf223	221416	genome.wustl.edu	37	6	43970524	43970524	+	Silent	SNP	G	G	A			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr6:43970524G>A	ENST00000336600.5	+	4	410	c.390G>A	c.(388-390)gcG>gcA	p.A130A	C6orf223_ENST00000448947.2_3'UTR|C6orf223_ENST00000439969.2_3'UTR|RP5-1120P11.1_ENST00000422059.1_RNA|C6orf223_ENST00000442114.2_Silent_p.A110A|RP5-1120P11.1_ENST00000607590.1_RNA	NM_001171992.1|NM_153246.4	NP_001165463.1|NP_694978.2	Q8N319	CF223_HUMAN	chromosome 6 open reading frame 223	130	Ala-rich.									central_nervous_system(1)|lung(2)|pancreas(1)|prostate(1)|urinary_tract(1)	6	all_cancers(18;2.28e-07)|all_epithelial(2;1.62e-08)|Lung NSC(15;0.000172)|all_lung(25;0.000533)|Hepatocellular(11;0.00309)|Ovarian(13;0.0437)		all cancers(41;0.00141)|Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)|STAD - Stomach adenocarcinoma(11;0.217)			cggcggcggcggcggcggGAG	0.781																																																	0													3.0	4.0	3.0					6																	43970524		1280	2841	4121	SO:0001819	synonymous_variant	0			BC032706	CCDS34459.1, CCDS55016.1	6p21.1	2012-09-05			ENSG00000181577	ENSG00000181577			28692	protein-coding gene	gene with protein product						12477932	Standard	NM_153246		Approved	MGC45491	uc003own.3	Q8N319	OTTHUMG00000014753	ENST00000336600.5:c.390G>A	6.37:g.43970524G>A			E9PB59|Q8N575	Silent	SNP	NULL	p.A130	ENST00000336600.5	37	c.390	CCDS34459.1	6																																																																																			C6orf223	-	NULL	ENSG00000181577		0.781	C6orf223-003	KNOWN	basic|appris_principal|CCDS	protein_coding	C6orf223	HGNC	protein_coding	OTTHUMT00000040702.3		0.00	34	0	G	NM_153246		43970524	+1			no_errors	ENST00000336600	ensembl	human	known	74_37	silent	10.53	34	4	SNP	0.179	A
C7	730	genome.wustl.edu	37	5	40934522	40934522	+	Silent	SNP	A	A	C			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr5:40934522A>C	ENST00000313164.9	+	4	593	c.234A>C	c.(232-234)ggA>ggC	p.G78G		NM_000587.2	NP_000578.2	P10643	CO7_HUMAN	complement component 7	78	TSP type-1 1. {ECO:0000255|PROSITE- ProRule:PRU00210}.				cellular sodium ion homeostasis (GO:0006883)|complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane attack complex (GO:0005579)							Ovarian(839;0.0112)				CTACAAGAGGATGTCCAACAG	0.463																																																	0													216.0	221.0	219.0					5																	40934522		1965	4168	6133	SO:0001819	synonymous_variant	0			J03507	CCDS47201.1	5p13.1	2014-09-17			ENSG00000112936	ENSG00000112936		"""Complement system"""	1346	protein-coding gene	gene with protein product		217070					Standard	NM_000587		Approved		uc003jmh.3	P10643	OTTHUMG00000150340	ENST00000313164.9:c.234A>C	5.37:g.40934522A>C			Q6P3T5|Q92489	Silent	SNP	pfam_MACPF,pfam_Sushi_SCR_CCP,pfam_LDrepeatLR_classA_rpt,pfam_Thrombospondin_1_rpt,superfamily_Sushi_SCR_CCP,superfamily_Thrombospondin_1_rpt,superfamily_LDrepeatLR_classA_rpt,smart_Thrombospondin_1_rpt,smart_LDrepeatLR_classA_rpt,smart_MACPF,smart_Sushi_SCR_CCP,smart_FacI_MAC,pfscan_LDrepeatLR_classA_rpt,pfscan_Sushi_SCR_CCP,pfscan_Thrombospondin_1_rpt,prints_MAC_perforin	p.G78	ENST00000313164.9	37	c.234	CCDS47201.1	5																																																																																			C7	-	pfam_Thrombospondin_1_rpt,superfamily_LDrepeatLR_classA_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	ENSG00000112936		0.463	C7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C7	HGNC	protein_coding	OTTHUMT00000317680.1	-	0.00	82	0	A			40934522	+1	tier1	-	no_errors	ENST00000313164	ensembl	human	known	74_37	silent	25.61	59	21	SNP	0.942	C
CACNA1G	8913	genome.wustl.edu	37	17	48646258	48646258	+	Silent	SNP	C	C	T			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr17:48646258C>T	ENST00000359106.5	+	2	270	c.270C>T	c.(268-270)gtC>gtT	p.V90V	CACNA1G_ENST00000507336.1_Silent_p.V90V|CACNA1G_ENST00000513689.2_Silent_p.V90V|CACNA1G_ENST00000429973.2_Silent_p.V90V|CACNA1G_ENST00000513964.1_Silent_p.V90V|CACNA1G_ENST00000515411.1_Silent_p.V90V|CACNA1G_ENST00000507609.1_Silent_p.V90V|CACNA1G_ENST00000360761.4_Silent_p.V90V|CACNA1G_ENST00000442258.2_Silent_p.V90V|CACNA1G_ENST00000514181.1_Silent_p.V90V|CACNA1G_ENST00000358244.5_Silent_p.V90V|CACNA1G_ENST00000515165.1_Silent_p.V90V|CACNA1G_ENST00000512389.1_Silent_p.V90V|CACNA1G_ENST00000514717.1_Silent_p.V90V|CACNA1G_ENST00000416767.4_Silent_p.V90V|CACNA1G_ENST00000502264.1_Silent_p.V90V|CACNA1G_ENST00000510366.1_Silent_p.V90V|CACNA1G_ENST00000507896.1_Silent_p.V90V|CACNA1G_ENST00000515765.1_Silent_p.V90V|CACNA1G_ENST00000503485.1_Silent_p.V90V|CACNA1G_ENST00000354983.4_Silent_p.V90V|CACNA1G_ENST00000352832.5_Silent_p.V90V|CACNA1G_ENST00000510115.1_Silent_p.V90V|CACNA1G_ENST00000514079.1_Silent_p.V90V|CACNA1G_ENST00000507510.2_Silent_p.V90V|CACNA1G_ENST00000505165.1_Silent_p.V90V	NM_018896.4	NP_061496.2	O43497	CAC1G_HUMAN	calcium channel, voltage-dependent, T type, alpha 1G subunit	90					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|membrane depolarization during action potential (GO:0086010)|positive regulation of calcium ion-dependent exocytosis (GO:0045956)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of heart rate (GO:0002027)|regulation of membrane potential (GO:0042391)|response to nickel cation (GO:0010045)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	low voltage-gated calcium channel activity (GO:0008332)|scaffold protein binding (GO:0097110)			breast(5)|cervix(1)|endometrium(13)|kidney(5)|lung(23)	47	Breast(11;6.7e-17)		BRCA - Breast invasive adenocarcinoma(22;7.52e-09)		Cinnarizine(DB00568)|Ethosuximide(DB00593)|Flunarizine(DB04841)|Methsuximide(DB05246)|Spironolactone(DB00421)|Trimethadione(DB00347)|Verapamil(DB00661)|Zonisamide(DB00909)	GCATGTTGGTCATCCTTCTCA	0.622																																																	0													92.0	94.0	93.0					17																	48646258		2165	4256	6421	SO:0001819	synonymous_variant	0			AC004590	CCDS45730.1, CCDS45731.1, CCDS45732.1, CCDS45733.1, CCDS45734.1, CCDS45735.1, CCDS45736.1, CCDS45737.1, CCDS54142.1, CCDS54143.1, CCDS54144.1, CCDS54145.1, CCDS54146.1, CCDS58565.1, CCDS58566.1, CCDS58567.1, CCDS58568.1, CCDS58569.1, CCDS58570.1, CCDS58571.1, CCDS58572.1, CCDS58573.1, CCDS58574.1, CCDS58575.1, CCDS58576.1	17q22	2012-03-07	2007-02-16		ENSG00000006283	ENSG00000006283		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1394	protein-coding gene	gene with protein product		604065				9495342, 16382099	Standard	NM_001256334		Approved	Cav3.1, NBR13	uc002irk.2	O43497	OTTHUMG00000162180	ENST00000359106.5:c.270C>T	17.37:g.48646258C>T			D6RA64|E7EPR0|O43498|O94770|Q19QY8|Q19QY9|Q19QZ0|Q19QZ1|Q19QZ2|Q19QZ3|Q19QZ4|Q19QZ5|Q19QZ6|Q19QZ7|Q19QZ8|Q19QZ9|Q19R00|Q19R01|Q19R02|Q19R03|Q19R04|Q19R05|Q19R06|Q19R07|Q19R08|Q19R09|Q19R10|Q19R11|Q19R12|Q19R13|Q19R15|Q19R16|Q19R17|Q19R18|Q2TAC4|Q9NYU4|Q9NYU5|Q9NYU6|Q9NYU7|Q9NYU8|Q9NYU9|Q9NYV0|Q9NYV1|Q9UHN9|Q9UHP0|Q9ULU6|Q9UNG7|Q9Y5T2|Q9Y5T3	Silent	SNP	pfam_Ion_trans_dom,pfam_PKD1_2_channel,prints_VDCC_T_a1su,prints_VDCCAlpha1	p.V90	ENST00000359106.5	37	c.270	CCDS45730.1	17																																																																																			CACNA1G	-	NULL	ENSG00000006283		0.622	CACNA1G-013	KNOWN	basic|CCDS	protein_coding	CACNA1G	HGNC	protein_coding	OTTHUMT00000367895.1	-	0.00	44	0	C	NM_018896		48646258	+1	tier1	-	no_errors	ENST00000359106	ensembl	human	known	74_37	silent	19.64	45	11	SNP	0.994	T
CAMK1G	57172	genome.wustl.edu	37	1	209784837	209784837	+	Silent	SNP	G	G	T			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr1:209784837G>T	ENST00000009105.1	+	10	1100	c.855G>T	c.(853-855)cgG>cgT	p.R285R	CAMK1G_ENST00000361322.2_Silent_p.R285R|CAMK1G_ENST00000494990.1_3'UTR			Q96NX5	KCC1G_HUMAN	calcium/calmodulin-dependent protein kinase IG	285	Autoinhibitory domain. {ECO:0000250}.					calcium- and calmodulin-dependent protein kinase complex (GO:0005954)|Golgi apparatus (GO:0005794)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)			breast(2)|central_nervous_system(1)|large_intestine(8)|lung(8)|stomach(1)	20				OV - Ovarian serous cystadenocarcinoma(81;0.0475)		CCCTCCACCGGGACATCTACC	0.562																																					Ovarian(163;530 1939 9680 28669 48710)												0													102.0	86.0	91.0					1																	209784837		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS1486.1	1q32.2	2012-09-20			ENSG00000008118	ENSG00000008118			14585	protein-coding gene	gene with protein product		614994				12637513	Standard	NM_020439		Approved	VWS1, CLICKIII, dJ272L16.1	uc001hhd.3	Q96NX5	OTTHUMG00000036361	ENST00000009105.1:c.855G>T	1.37:g.209784837G>T			Q86UH5|Q9Y3J7	Silent	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.R285	ENST00000009105.1	37	c.855	CCDS1486.1	1																																																																																			CAMK1G	-	superfamily_Kinase-like_dom	ENSG00000008118		0.562	CAMK1G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CAMK1G	HGNC	protein_coding	OTTHUMT00000088526.1		0.00	86	0	G	NM_020439		209784837	+1			no_errors	ENST00000009105	ensembl	human	known	74_37	silent	6.35	59	4	SNP	1.000	T
CAPN8	388743	genome.wustl.edu	37	1	223803682	223803682	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr1:223803682G>A	ENST00000366872.5	-	10	1297	c.1298C>T	c.(1297-1299)gCc>gTc	p.A433V				A6NHC0	CAN8_HUMAN	calpain 8	434					digestion (GO:0007586)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)			NS(1)|endometrium(2)|prostate(1)	4						CTGGTAGACGGCATAGCCGAT	0.502																																																	0													91.0	77.0	81.0					1																	223803682		692	1591	2283	SO:0001583	missense	0				CCDS73038.1	1q41	2013-01-10	2007-02-21		ENSG00000203697	ENSG00000203697		"""EF-hand domain containing"""	1485	protein-coding gene	gene with protein product			"""calpain 8 (nCL-2)"""			7690035, 8889549	Standard	NM_001143962		Approved	nCL-2	uc009xee.2	A6NHC0	OTTHUMG00000037378	ENST00000366872.5:c.1298C>T	1.37:g.223803682G>A	ENSP00000355837:p.Ala433Val		B2RXL2	Missense_Mutation	SNP	pfam_Peptidase_C2_calpain_cat,pfam_Calpain_domain_III,superfamily_Calpain_domain_III,smart_Peptidase_C2_calpain_cat,smart_Calpain_III,pfscan_EF_hand_dom,pfscan_Peptidase_C2_calpain_cat,prints_Calpain_cysteine_protease	p.A433V	ENST00000366872.5	37	c.1298		1	.	.	.	.	.	.	.	.	.	.	G	15.28	2.785688	0.49997	.	.	ENSG00000203697	ENST00000366872;ENST00000419193	D;D	0.88277	-2.36;-2.36	5.22	4.3	0.51218	Peptidase C2, calpain, large subunit, domain III (2);Peptidase C2, calpain, domain III (1);	0.171581	0.37304	U	0.002151	D	0.86908	0.6046	L	0.54863	1.705	0.51012	D	0.9999	P	0.43578	0.811	B	0.40825	0.341	D	0.86210	0.1624	10	0.44086	T	0.13	.	15.5284	0.75932	0.0:0.1388:0.8612:0.0	.	434	A6NHC0	CAN8_HUMAN	V	433;434	ENSP00000355837:A433V;ENSP00000401665:A434V	ENSP00000355837:A433V	A	-	2	0	CAPN8	221870305	1.000000	0.71417	0.005000	0.12908	0.024000	0.10985	5.578000	0.67450	1.176000	0.42840	0.460000	0.39030	GCC	CAPN8	-	pfam_Calpain_domain_III,superfamily_Calpain_domain_III,smart_Calpain_III	ENSG00000203697		0.502	CAPN8-201	KNOWN	basic|appris_principal	protein_coding	CAPN8	HGNC	protein_coding		-	0.00	74	0	G	NM_001143962		223803682	-1	tier1	-	no_errors	ENST00000366872	ensembl	human	known	74_37	missense	5.62	84	5	SNP	0.829	A
CAPS2	84698	genome.wustl.edu	37	12	75719046	75719046	+	Nonsense_Mutation	SNP	C	C	T			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr12:75719046C>T	ENST00000409445.3	-	3	357	c.161G>A	c.(160-162)tGg>tAg	p.W54*	CAPS2_ENST00000409799.1_Nonsense_Mutation_p.W42*|CAPS2_ENST00000393284.3_5'UTR|CAPS2_ENST00000442339.2_Intron	NM_032606.3	NP_115995.2	Q9BXY5	CAYP2_HUMAN	calcyphosine 2	54							calcium ion binding (GO:0005509)			endometrium(2)|large_intestine(1)|lung(4)|ovary(2)|skin(1)	10						CTGGTTTGTCCATGACTCAGA	0.303																																																	0													147.0	123.0	130.0					12																	75719046		692	1591	2283	SO:0001587	stop_gained	0			AF251056	CCDS9008.2, CCDS66424.1, CCDS73497.1	12q14.1	2013-01-10	2005-05-09		ENSG00000180881	ENSG00000180881		"""EF-hand domain containing"""	16471	protein-coding gene	gene with protein product		607724	"""calcyphosphine 2"""			11846421	Standard	NM_032606		Approved		uc001sxk.4	Q9BXY5	OTTHUMG00000152787	ENST00000409445.3:c.161G>A	12.37:g.75719046C>T	ENSP00000386959:p.Trp54*		Q6PH84|Q8N242|Q8NAY5	Nonsense_Mutation	SNP	smart_EF_hand_dom,pfscan_EF_hand_dom	p.W54*	ENST00000409445.3	37	c.161	CCDS9008.2	12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	34|34	5.310778|5.310778	0.95629|0.95629	.|.	.|.	ENSG00000180881|ENSG00000180881	ENST00000436898|ENST00000409799;ENST00000409445	T|.	0.40476|.	1.03|.	4.75|4.75	3.86|3.86	0.44501|0.44501	.|.	.|0.568522	.|0.14953	.|N	.|0.288810	T|.	0.29749|.	0.0743|.	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.10222|.	-1.0639|.	6|.	0.87932|0.02654	D|T	0|1	.|.	8.83|8.83	0.35078|0.35078	0.0:0.8978:0.0:0.1022|0.0:0.8978:0.0:0.1022	.|.	.|.	.|.	.|.	I|X	1|42;54	ENSP00000411797:M1I|.	ENSP00000411797:M1I|ENSP00000386959:W54X	M|W	-|-	3|2	0|0	CAPS2|CAPS2	74005313|74005313	0.015000|0.015000	0.18098|0.18098	0.749000|0.749000	0.31150|0.31150	0.785000|0.785000	0.44390|0.44390	0.637000|0.637000	0.24659|0.24659	1.358000|1.358000	0.45922|0.45922	0.650000|0.650000	0.86243|0.86243	ATG|TGG	CAPS2	-	NULL	ENSG00000180881		0.303	CAPS2-001	KNOWN	basic|CCDS	protein_coding	CAPS2	HGNC	protein_coding	OTTHUMT00000327880.2	-	0.00	42	0	C			75719046	-1	tier1	-	no_errors	ENST00000409445	ensembl	human	known	74_37	nonsense	20.00	28	7	SNP	0.857	T
CASQ1	844	genome.wustl.edu	37	1	160165779	160165779	+	Silent	SNP	C	C	T	rs371888819		TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr1:160165779C>T	ENST00000368078.3	+	6	940	c.744C>T	c.(742-744)agC>agT	p.S248S	CASQ1_ENST00000467691.1_5'Flank|CASQ1_ENST00000368079.3_Silent_p.S242S			P31415	CASQ1_HUMAN	calsequestrin 1 (fast-twitch, skeletal muscle)	248					endoplasmic reticulum organization (GO:0007029)|ion transmembrane transport (GO:0034220)|protein polymerization (GO:0051258)|regulation of sequestering of calcium ion (GO:0051282)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|response to denervation involved in regulation of muscle adaptation (GO:0014894)|response to heat (GO:0009408)|response to organic substance (GO:0010033)|sarcomere organization (GO:0045214)|skeletal muscle tissue development (GO:0007519)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum lumen (GO:0033018)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna lumen (GO:0014804)	calcium ion binding (GO:0005509)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(9)|ovary(1)|skin(1)	21	all_cancers(52;2.56e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			AGCCCAATAGCGAAGAGGAGA	0.552													C|||	1	0.000199681	0.0	0.0014	5008	,	,		17964	0.0		0.0	False		,,,				2504	0.0																0								C		1,4405	2.1+/-5.4	0,1,2202	86.0	87.0	87.0		744	-3.5	0.9	1		87	0,8600		0,0,4300	no	coding-synonymous	CASQ1	NM_001231.4		0,1,6502	TT,TC,CC		0.0,0.0227,0.0077		248/397	160165779	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	0			S73775	CCDS1198.1, CCDS1198.2	1q21	2011-10-19			ENSG00000143318	ENSG00000143318		"""Protein disulfide isomerases"""	1512	protein-coding gene	gene with protein product	"""calsequestrin 1, fast-twitch, skeletal muscle"", ""calmitine"""	114250		CASQ		8406504, 2321095	Standard	NM_001231		Approved	PDIB1	uc010pja.2	P31415	OTTHUMG00000031607	ENST00000368078.3:c.744C>T	1.37:g.160165779C>T			B1AKZ2|B2R863|Q8TBW7	Silent	SNP	pfam_Calsequestrin,superfamily_Thioredoxin-like_fold,prints_Calsequestrin	p.S248	ENST00000368078.3	37	c.744	CCDS1198.2	1																																																																																			CASQ1	-	pfam_Calsequestrin,superfamily_Thioredoxin-like_fold,prints_Calsequestrin	ENSG00000143318		0.552	CASQ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CASQ1	HGNC	protein_coding	OTTHUMT00000077412.1	-	0.00	48	0	C	NM_001231		160165779	+1	tier1	-	no_errors	ENST00000368078	ensembl	human	known	74_37	silent	10.00	36	4	SNP	0.758	T
CAT	847	genome.wustl.edu	37	11	34490057	34490058	+	Intron	INS	-	-	A	rs534253738|rs371396899		TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr11:34490057_34490058insA	ENST00000241052.4	+	11	1523					NM_001752.3	NP_001743.1	P04040	CATA_HUMAN	catalase						aerobic respiration (GO:0009060)|cellular response to growth factor stimulus (GO:0071363)|cholesterol metabolic process (GO:0008203)|hemoglobin metabolic process (GO:0020027)|hydrogen peroxide catabolic process (GO:0042744)|menopause (GO:0042697)|negative regulation of apoptotic process (GO:0043066)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|nucleobase-containing small molecule metabolic process (GO:0055086)|osteoblast differentiation (GO:0001649)|positive regulation of cell division (GO:0051781)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|protein homotetramerization (GO:0051289)|protein tetramerization (GO:0051262)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide catabolic process (GO:0006195)|response to hyperoxia (GO:0055093)|response to hypoxia (GO:0001666)|response to reactive oxygen species (GO:0000302)|response to vitamin E (GO:0033197)|small molecule metabolic process (GO:0044281)|triglyceride metabolic process (GO:0006641)|ureteric bud development (GO:0001657)|UV protection (GO:0009650)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|lysosome (GO:0005764)|membrane (GO:0016020)|mitochondrial intermembrane space (GO:0005758)|peroxisomal matrix (GO:0005782)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)|plasma membrane (GO:0005886)	aminoacylase activity (GO:0004046)|antioxidant activity (GO:0016209)|catalase activity (GO:0004096)|enzyme binding (GO:0019899)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|NADP binding (GO:0050661)|oxidoreductase activity, acting on peroxide as acceptor (GO:0016684)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)			breast(1)|cervix(2)|endometrium(3)|kidney(2)|large_intestine(6)|lung(5)|ovary(2)|pancreas(1)|stomach(1)|urinary_tract(3)	26		Lung NSC(402;2.76e-08)|Acute lymphoblastic leukemia(5;0.00143)|all_hematologic(20;0.0116)|Melanoma(852;0.027)		BRCA - Breast invasive adenocarcinoma(625;0.000995)	Fomepizole(DB01213)	TAAGAGAACTTAAAAAAAAAAA	0.396																																																	0																																										SO:0001627	intron_variant	0			AY028632	CCDS7891.1	11p13	2012-10-02			ENSG00000121691	ENSG00000121691	1.11.1.6		1516	protein-coding gene	gene with protein product		115500					Standard	NM_001752		Approved		uc001mvm.3	P04040	OTTHUMG00000044353	ENST00000241052.4:c.1434+115->A	11.37:g.34490068_34490068dupA			A8K6C0|B2RCZ9|D3DR07|Q2M1U4|Q4VXX5|Q9BWT9|Q9UC85	RNA	INS	-	NULL	ENST00000241052.4	37	NULL	CCDS7891.1	11																																																																																			CAT	-	-	ENSG00000121691		0.396	CAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CAT	HGNC	protein_coding	OTTHUMT00000103197.2		0.00	17	0	-	NM_001752		34490058	+1	tier1		no_errors	ENST00000525707	ensembl	human	putative	74_37	rna	18.75	13	3	INS	0.001:0.000	A
CATSPER2	117155	genome.wustl.edu	37	15	43939656	43939656	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr15:43939656C>A	ENST00000321596.5	-	3	354	c.155G>T	c.(154-156)cGc>cTc	p.R52L	CATSPER2_ENST00000354127.4_Missense_Mutation_p.R52L|CATSPER2_ENST00000355438.2_Missense_Mutation_p.R52L|CATSPER2_ENST00000464721.1_5'UTR|CATSPER2_ENST00000381761.1_Missense_Mutation_p.R58L|CATSPER2_ENST00000396879.1_Missense_Mutation_p.R52L|STRC_ENST00000541030.1_Intron			Q96P56	CTSR2_HUMAN	cation channel, sperm associated 2	52					calcium ion import (GO:0070509)|cell differentiation (GO:0030154)|membrane depolarization during action potential (GO:0086010)|multicellular organism reproduction (GO:0032504)|multicellular organismal development (GO:0007275)|single fertilization (GO:0007338)|sperm motility (GO:0030317)|sperm-egg recognition (GO:0035036)|spermatogenesis (GO:0007283)	CatSper complex (GO:0036128)|motile cilium (GO:0031514)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|voltage-gated calcium channel activity (GO:0005245)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(3)|lung(8)|ovary(1)|prostate(1)|skin(1)|urinary_tract(2)	22		all_cancers(109;3.26e-15)|all_epithelial(112;1.48e-12)|Lung NSC(122;2.76e-08)|all_lung(180;3.1e-07)|Melanoma(134;0.027)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;3.56e-07)		TTTCTTCTGGCGGGAAGGATC	0.443																																																	0													71.0	83.0	79.0					15																	43939656		2199	4296	6495	SO:0001583	missense	0			AF411817	CCDS10099.1, CCDS32216.1, CCDS73714.1	15q15.3	2011-07-05			ENSG00000166762	ENSG00000166762		"""Voltage-gated ion channels / Cation channels, sperm associated"""	18810	protein-coding gene	gene with protein product		607249				11675491, 16382101	Standard	NM_172095		Approved		uc001zsh.3	Q96P56	OTTHUMG00000059902	ENST00000321596.5:c.155G>T	15.37:g.43939656C>A	ENSP00000321463:p.Arg52Leu		Q8NHT9|Q96P54|Q96P55	Missense_Mutation	SNP	pfam_Ion_trans_dom	p.R52L	ENST00000321596.5	37	c.155	CCDS10099.1	15	.	.	.	.	.	.	.	.	.	.	C	2.189	-0.385639	0.04966	.	.	ENSG00000166762	ENST00000396879;ENST00000299989;ENST00000381761;ENST00000321596;ENST00000354127;ENST00000355438;ENST00000432420;ENST00000409481	T;T;T;T;T;T;T	0.41400	1.0;1.0;1.0;1.0;1.0;1.0;1.0	3.38	-1.0	0.10196	.	1.121610	0.07236	U	0.863389	T	0.25005	0.0607	L	0.28274	0.84	0.09310	N	1	B;B;B	0.12630	0.006;0.001;0.001	B;B;B	0.10450	0.005;0.003;0.001	T	0.26643	-1.0097	10	0.11182	T	0.66	.	6.3317	0.21274	0.0:0.4914:0.0:0.5086	.	52;58;52	Q96P56-4;F8W9H2;Q96P56	.;.;CTSR2_HUMAN	L	52;52;58;52;52;52;52;52	ENSP00000380088:R52L;ENSP00000371180:R58L;ENSP00000321463:R52L;ENSP00000339137:R52L;ENSP00000347613:R52L;ENSP00000407694:R52L;ENSP00000386595:R52L	ENSP00000299989:R52L	R	-	2	0	CATSPER2	41726948	0.000000	0.05858	0.008000	0.14137	0.278000	0.26855	-1.913000	0.01580	-0.058000	0.13177	0.184000	0.17185	CGC	CATSPER2	-	NULL	ENSG00000166762		0.443	CATSPER2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CATSPER2	HGNC	protein_coding	OTTHUMT00000133151.2	-	0.00	38	0	C	NM_054020		43939656	-1	tier1	-	no_errors	ENST00000321596	ensembl	human	known	74_37	missense	12.50	28	4	SNP	0.000	A
CATSPERD	257062	genome.wustl.edu	37	19	5754154	5754154	+	Silent	SNP	G	G	T			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr19:5754154G>T	ENST00000381624.3	+	13	1237	c.1176G>T	c.(1174-1176)ctG>ctT	p.L392L	CATSPERD_ENST00000309164.7_3'UTR|CATSPERD_ENST00000381614.2_Silent_p.L50L	NM_152784.3	NP_689997.3	Q86XM0	CTSRD_HUMAN	catsper channel auxiliary subunit delta	392					multicellular organism reproduction (GO:0032504)|multicellular organismal development (GO:0007275)|single fertilization (GO:0007338)|sperm capacitation (GO:0048240)|sperm motility (GO:0030317)|sperm-egg recognition (GO:0035036)|spermatogenesis (GO:0007283)	CatSper complex (GO:0036128)|plasma membrane (GO:0005886)|sperm principal piece (GO:0097228)											TAGAGTTTCTGACAGGAGAAT	0.463																																																	0													150.0	151.0	151.0					19																	5754154		1888	4123	6011	SO:0001819	synonymous_variant	0			BC043005	CCDS12149.2	19p13.3	2013-10-11	2012-02-22	2012-02-22	ENSG00000174898	ENSG00000174898			28598	protein-coding gene	gene with protein product			"""transmembrane protein 146"""	TMEM146		21224844	Standard	NM_152784		Approved	MGC39581	uc002mda.3	Q86XM0	OTTHUMG00000143036	ENST00000381624.3:c.1176G>T	19.37:g.5754154G>T			Q6ZRP1	Silent	SNP	superfamily_WD40_repeat_dom	p.L392	ENST00000381624.3	37	c.1176	CCDS12149.2	19																																																																																			CATSPERD	-	NULL	ENSG00000174898		0.463	CATSPERD-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	CATSPERD	HGNC	protein_coding	OTTHUMT00000286953.2	-	0.00	67	0	G	NM_152784		5754154	+1	tier1	-	no_errors	ENST00000381624	ensembl	human	known	74_37	silent	6.15	61	4	SNP	0.007	T
CBL	867	genome.wustl.edu	37	11	119169200	119169200	+	Missense_Mutation	SNP	A	A	T			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr11:119169200A>T	ENST00000264033.4	+	15	2760	c.2384A>T	c.(2383-2385)aAt>aTt	p.N795I		NM_005188.3	NP_005179.2	P22681	CBL_HUMAN	Cbl proto-oncogene, E3 ubiquitin protein ligase	795	Asp/Glu-rich (acidic).|Interaction with CD2AP.				cell surface receptor signaling pathway (GO:0007166)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of receptor-mediated endocytosis (GO:0048260)|protein ubiquitination (GO:0016567)|regulation of transcription, DNA-templated (GO:0006355)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|flotillin complex (GO:0016600)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|ephrin receptor binding (GO:0046875)|ligase activity (GO:0016874)|sequence-specific DNA binding transcription factor activity (GO:0003700)|SH3 domain binding (GO:0017124)|signal transducer activity (GO:0004871)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(194)|kidney(3)|large_intestine(9)|lung(30)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	251		Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;4.92e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.000784)		GATATCTCTAATGCCAGCTCC	0.537			"""T, Mis S, O"""	MLL	"""AML, JMML, MDS"""				Noonan syndrome;CBL gene-associated Juvenile Myelomonocytic Leukemia and Developmental Anomalies																															"""Dom, Rec"""	yes		11	11q23.3	867	Cas-Br-M (murine) ecotropic retroviral transforming		L	0													95.0	92.0	93.0					11																	119169200		2199	4295	6494	SO:0001583	missense	0	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CBL-associated JMML	X57110	CCDS8418.1	11q23.3	2014-09-17	2012-02-23		ENSG00000110395	ENSG00000110395		"""RING-type (C3HC4) zinc fingers"""	1541	protein-coding gene	gene with protein product	"""oncogene CBL2"""	165360	"""Cas-Br-M (murine) ecotropic retroviral transforming sequence"""	CBL2		2013228	Standard	NM_005188		Approved	RNF55, c-Cbl	uc001pwe.4	P22681	OTTHUMG00000166170	ENST00000264033.4:c.2384A>T	11.37:g.119169200A>T	ENSP00000264033:p.Asn795Ile		A3KMP8	Missense_Mutation	SNP	pfam_Adaptor_Cbl_N_hlx,pfam_Adaptor_Cbl_SH2-like,pfam_Adaptor_Cbl_EF_hand-like,pfam_Znf_C3HC4_RING-type,pfam_UBA/Ts_N,superfamily_Adaptor_Cbl_N_hlx,superfamily_UBA-like,smart_Znf_RING,smart_UBA/transl_elong_EF1B_N_euk,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Znf_RING	p.N795I	ENST00000264033.4	37	c.2384	CCDS8418.1	11	.	.	.	.	.	.	.	.	.	.	A	12.90	2.075626	0.36662	.	.	ENSG00000110395	ENST00000264033	T	0.78481	-1.18	5.59	5.59	0.84812	.	0.310985	0.36665	N	0.002477	T	0.66896	0.2836	L	0.29908	0.895	0.47065	D	0.999303	B	0.30763	0.294	B	0.21360	0.034	T	0.65998	-0.6032	10	0.41790	T	0.15	-41.6541	15.777	0.78228	1.0:0.0:0.0:0.0	.	795	P22681	CBL_HUMAN	I	795	ENSP00000264033:N795I	ENSP00000264033:N795I	N	+	2	0	CBL	118674410	1.000000	0.71417	0.646000	0.29493	0.963000	0.63663	4.683000	0.61679	2.120000	0.65058	0.528000	0.53228	AAT	CBL	-	NULL	ENSG00000110395		0.537	CBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CBL	HGNC	protein_coding	OTTHUMT00000388219.4	-	0.00	58	0	A	NM_005188		119169200	+1	tier1	-	no_errors	ENST00000264033	ensembl	human	known	74_37	missense	27.71	60	23	SNP	0.982	T
CCDC171	203238	genome.wustl.edu	37	9	15723679	15723679	+	Splice_Site	SNP	G	G	T			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr9:15723679G>T	ENST00000380701.3	+	13	1754	c.1426G>T	c.(1426-1428)Gaa>Taa	p.E476*	CCDC171_ENST00000297641.3_Splice_Site_p.E476*	NM_173550.2	NP_775821.2	Q6TFL3	CC171_HUMAN	coiled-coil domain containing 171	476																	TGATGTTAAGGAAAAGGCATG	0.274																																																	0													42.0	44.0	43.0					9																	15723679		2199	4259	6458	SO:0001630	splice_region_variant	0			AY422473	CCDS6481.1	9p22.2	2012-03-26	2012-03-26	2012-03-26	ENSG00000164989	ENSG00000164989			29828	protein-coding gene	gene with protein product	"""myosin tail domain containing protein"""		"""chromosome 9 open reading frame 93"""	C9orf93		14702039	Standard	NM_173550		Approved	FLJ39267, FLJ46740, Em:AL513423.1, bA778P13.1, bA536D16.1	uc003zmd.3	Q6TFL3	OTTHUMG00000019584	ENST00000380701.3:c.1426-1G>T	9.37:g.15723679G>T			B7ZM22|Q5SU58|Q6P1W1|Q6ZR13|Q8N1Z4|Q8N8L3|Q8TBR2	Nonsense_Mutation	SNP	superfamily_STAT_TF_coiled-coil	p.E476*	ENST00000380701.3	37	c.1426	CCDS6481.1	9	.	.	.	.	.	.	.	.	.	.	G	40	7.970291	0.98588	.	.	ENSG00000164989	ENST00000297641;ENST00000380701	.	.	.	5.77	5.77	0.91146	.	0.214284	0.48286	D	0.000193	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.09338	T	0.73	-9.9634	13.1058	0.59247	0.0:0.0:0.8012:0.1988	.	.	.	.	X	476	.	ENSP00000297641:E476X	E	+	1	0	C9orf93	15713679	0.996000	0.38824	1.000000	0.80357	0.887000	0.51463	2.254000	0.43214	2.885000	0.99019	0.655000	0.94253	GAA	CCDC171	-	NULL	ENSG00000164989		0.274	CCDC171-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC171	HGNC	protein_coding	OTTHUMT00000051768.4	-	0.00	92	0	G	NM_173550	Nonsense_Mutation	15723679	+1	tier1	-	no_errors	ENST00000380701	ensembl	human	known	74_37	nonsense	5.43	87	5	SNP	0.976	T
CCDC30	728621	genome.wustl.edu	37	1	42948562	42948563	+	Intron	INS	-	-	A	rs202122677	byFrequency	TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr1:42948562_42948563insA	ENST00000428554.2	+	4	746				CCDC30_ENST00000475614.2_3'UTR			Q5VVM6	CCD30_HUMAN	coiled-coil domain containing 30							extracellular vesicular exosome (GO:0070062)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(11)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(2)	30						TGGAACATGAGAAAAAAAAAAA	0.366																																																	0																																										SO:0001627	intron_variant	0			AY639646	CCDS30690.1	1p34.2	2009-07-09			ENSG00000186409	ENSG00000186409			26103	protein-coding gene	gene with protein product	"""prefoldin 6-like"""					16710767	Standard	NM_001080850		Approved	FLJ20972, PFD6L, LOC728621	uc009vwk.1	Q5VVM6	OTTHUMG00000007334	ENST00000428554.2:c.-398+75->A	1.37:g.42948573_42948573dupA			Q14F06|Q5VVM5	RNA	INS	-	NULL	ENST00000428554.2	37	NULL	CCDS30690.1	1																																																																																			CCDC30	-	-	ENSG00000186409		0.366	CCDC30-203	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC30	HGNC	protein_coding			0.00	21	0	-	NM_025030		42948563	+1	tier1		no_errors	ENST00000475614	ensembl	human	known	74_37	rna	25.93	20	7	INS	0.001:0.003	A
CCDC83	220047	genome.wustl.edu	37	11	85593712	85593712	+	Silent	SNP	T	T	C			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr11:85593712T>C	ENST00000342404.3	+	4	553	c.337T>C	c.(337-339)Ttg>Ctg	p.L113L	CCDC83_ENST00000280245.4_Silent_p.L113L|CCDC83_ENST00000529676.2_Intron|CCDC83_ENST00000376067.1_Silent_p.L70L			Q8IWF9	CCD83_HUMAN	coiled-coil domain containing 83	113										breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(12)|skin(3)|upper_aerodigestive_tract(2)	29		Acute lymphoblastic leukemia(157;4.88e-06)|all_hematologic(158;0.00572)				GGAAAAAAACTTGAGAGGTGA	0.358																																																	0													62.0	60.0	61.0					11																	85593712		2203	4299	6502	SO:0001819	synonymous_variant	0			AK124113	CCDS8271.1, CCDS66196.1	11q14.1-q14.2	2014-01-21			ENSG00000150676	ENSG00000150676			28535	protein-coding gene	gene with protein product						12477932	Standard	XM_005273842		Approved	MGC34732, FLJ42119, CT148	uc001pbg.1	Q8IWF9	OTTHUMG00000166978	ENST00000342404.3:c.337T>C	11.37:g.85593712T>C			B2RA49|Q6X7T2|Q6ZVT5|Q8N9Y1	Silent	SNP	NULL	p.L113	ENST00000342404.3	37	c.337		11																																																																																			CCDC83	-	NULL	ENSG00000150676		0.358	CCDC83-002	KNOWN	basic|appris_principal	protein_coding	CCDC83	HGNC	protein_coding	OTTHUMT00000392215.1	-	0.00	47	0	T	NM_173556		85593712	+1	tier1	-	no_errors	ENST00000280245	ensembl	human	known	74_37	silent	19.23	42	10	SNP	0.947	C
CCL16	6360	genome.wustl.edu	37	17	34305260	34305260	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr17:34305260A>G	ENST00000293275.3	-	2	191	c.116T>C	c.(115-117)cTg>cCg	p.L39P		NM_004590.2	NP_004581.1	O15467	CCL16_HUMAN	chemokine (C-C motif) ligand 16	39					cell chemotaxis (GO:0060326)|cell communication (GO:0007154)|cell-cell signaling (GO:0007267)|chemotaxis (GO:0006935)|immune response (GO:0006955)|inflammatory response (GO:0006954)|positive chemotaxis (GO:0050918)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	chemoattractant activity (GO:0042056)|chemokine activity (GO:0008009)			endometrium(1)|lung(2)	3		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		ATAATACTTCAGGCAGCAGGT	0.522																																																	0													208.0	197.0	201.0					17																	34305260		2203	4300	6503	SO:0001583	missense	0			AB007454	CCDS11303.1	17q11.2	2014-05-06	2002-08-22	2002-08-23	ENSG00000161573	ENSG00000275152		"""Chemokine ligands"", ""Endogenous ligands"""	10614	protein-coding gene	gene with protein product		601394	"""small inducible cytokine subfamily A (Cys-Cys), member 16"""	SCYA16		8661057	Standard	NM_004590		Approved	NCC-4, SCYL4, LEC, HCC-4, LMC, LCC-1, CKb12, Mtn-1	uc002hkl.3	O15467	OTTHUMG00000188402	ENST00000293275.3:c.116T>C	17.37:g.34305260A>G	ENSP00000293275:p.Leu39Pro		Q4KKU0	Missense_Mutation	SNP	pfam_Chemokine_IL8-like_dom,superfamily_Chemokine_IL8-like_dom,smart_Chemokine_IL8-like_dom	p.L39P	ENST00000293275.3	37	c.116	CCDS11303.1	17	.	.	.	.	.	.	.	.	.	.	A	17.53	3.413867	0.62511	.	.	ENSG00000161573	ENST00000293275	T	0.07908	3.15	5.04	-2.49	0.06403	CC chemokine, conserved site (1);Chemokine interleukin-8-like domain (3);	1.348460	0.05506	N	0.559313	T	0.25568	0.0622	M	0.86651	2.83	0.22656	N	0.99889	D	0.69078	0.997	D	0.72625	0.978	T	0.32079	-0.9920	10	0.87932	D	0	.	0.2918	0.00259	0.2838:0.1522:0.2678:0.2961	.	39	O15467	CCL16_HUMAN	P	39	ENSP00000293275:L39P	ENSP00000293275:L39P	L	-	2	0	CCL16	31329373	0.000000	0.05858	0.006000	0.13384	0.550000	0.35303	-0.926000	0.03988	-0.384000	0.07845	0.460000	0.39030	CTG	CCL16	-	pfam_Chemokine_IL8-like_dom,superfamily_Chemokine_IL8-like_dom,smart_Chemokine_IL8-like_dom	ENSG00000161573		0.522	CCL16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCL16	HGNC	protein_coding	OTTHUMT00000256579.1		0.00	55	0	A	NM_004590		34305260	-1			no_errors	ENST00000293275	ensembl	human	known	74_37	missense	7.69	36	3	SNP	0.004	G
CD248	57124	genome.wustl.edu	37	11	66082572	66082572	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr11:66082572G>A	ENST00000311330.3	-	1	1943	c.1927C>T	c.(1927-1929)Ccc>Tcc	p.P643S	RP11-867G23.13_ENST00000534065.1_RNA	NM_020404.2	NP_065137.1	Q9HCU0	CD248_HUMAN	CD248 molecule, endosialin	643	Pro-rich.				anatomical structure regression (GO:0060033)|cell migration (GO:0016477)|lymph node development (GO:0048535)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell apoptotic process (GO:2000353)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|extracellular matrix binding (GO:0050840)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|liver(1)|lung(11)|ovary(1)|prostate(1)|urinary_tract(2)	26						GGGATTTGGGGGGCTTTGGAA	0.657																																																	0													33.0	38.0	37.0					11																	66082572		2200	4291	6491	SO:0001583	missense	0			AF279142	CCDS8134.1	11q13	2006-04-12	2006-03-28	2005-02-11	ENSG00000174807	ENSG00000174807		"""CD molecules"""	18219	protein-coding gene	gene with protein product	"""endosialin"", ""tumor endothelial marker 1"""	606064	"""CD164 sialomucin-like 1"", ""CD248 antigen, endosialin"""	CD164L1		10947988, 11084048	Standard	NM_020404		Approved	TEM1	uc001ohm.1	Q9HCU0	OTTHUMG00000167073	ENST00000311330.3:c.1927C>T	11.37:g.66082572G>A	ENSP00000308117:p.Pro643Ser		Q2M2V5|Q3SX55|Q96KB6	Missense_Mutation	SNP	pfam_C-type_lectin,pfam_EGF-like_Ca-bd_dom,superfamily_C-type_lectin_fold,smart_C-type_lectin,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,pfscan_C-type_lectin	p.P643S	ENST00000311330.3	37	c.1927	CCDS8134.1	11	.	.	.	.	.	.	.	.	.	.	G	8.749	0.920914	0.17982	.	.	ENSG00000174807	ENST00000311330	D	0.88664	-2.41	3.83	2.92	0.33932	.	0.754197	0.10631	U	0.652115	D	0.82586	0.5069	L	0.38838	1.175	0.09310	N	1	B	0.17038	0.02	B	0.13407	0.009	T	0.70153	-0.4950	10	0.44086	T	0.13	-1.2254	7.2697	0.26250	0.1269:0.0:0.8731:0.0	.	643	Q9HCU0	CD248_HUMAN	S	643	ENSP00000308117:P643S	ENSP00000308117:P643S	P	-	1	0	CD248	65839148	0.139000	0.22563	0.015000	0.15790	0.814000	0.46013	1.344000	0.33941	0.592000	0.29728	0.467000	0.42956	CCC	CD248	-	NULL	ENSG00000174807		0.657	CD248-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CD248	HGNC	protein_coding	OTTHUMT00000392922.2	-	0.00	78	0	G	NM_020404		66082572	-1	tier1	-	no_errors	ENST00000311330	ensembl	human	known	74_37	missense	34.85	43	23	SNP	0.051	A
CD27	939	genome.wustl.edu	37	12	6560765	6560765	+	3'UTR	SNP	C	C	T			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr12:6560765C>T	ENST00000266557.3	+	0	1219				CD27-AS1_ENST00000399492.2_RNA|TAPBPL_ENST00000266556.7_5'Flank|TAPBPL_ENST00000544021.1_5'Flank|CD27_ENST00000541233.1_3'UTR|CD27-AS1_ENST00000545339.1_RNA	NM_001242.4	NP_001233	P26842	CD27_HUMAN	CD27 molecule						cell surface receptor signaling pathway (GO:0007166)|extrinsic apoptotic signaling pathway (GO:0097191)|immunoglobulin mediated immune response (GO:0016064)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of T cell apoptotic process (GO:0070233)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of JNK cascade (GO:0046330)|release of cytoplasmic sequestered NF-kappaB (GO:0008588)|response to ethanol (GO:0045471)	external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|transmembrane signaling receptor activity (GO:0004888)			kidney(1)|large_intestine(5)|lung(1)|urinary_tract(3)	10						AGCAGGAGCCCAGCCAGCTGC	0.567																																																	0																																										SO:0001624	3_prime_UTR_variant	0			M63928	CCDS8545.1	12p13	2014-09-17	2006-10-27	2006-10-27	ENSG00000139193	ENSG00000139193		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	11922	protein-coding gene	gene with protein product		186711	"""tumor necrosis factor receptor superfamily, member 7"""	TNFRSF7		2442250, 8530100	Standard	NM_001242		Approved	S152, Tp55	uc001qod.3	P26842	OTTHUMG00000168316	ENST00000266557.3:c.*207C>T	12.37:g.6560765C>T			B2RDZ0	RNA	SNP	-	NULL	ENST00000266557.3	37	NULL	CCDS8545.1	12																																																																																			CD27	-	-	ENSG00000139193		0.567	CD27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CD27	HGNC	protein_coding	OTTHUMT00000399258.1	-	0.00	19	0	C			6560765	+1	tier1	-	no_errors	ENST00000541233	ensembl	human	known	74_37	rna	80.00	2	8	SNP	0.001	T
CD58	965	genome.wustl.edu	37	1	117078739	117078739	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr1:117078739C>A	ENST00000369489.5	-	3	542	c.476G>T	c.(475-477)tGg>tTg	p.W159L	CD58_ENST00000457047.2_Missense_Mutation_p.W159L|CD58_ENST00000369487.3_Missense_Mutation_p.W159L	NM_001779.2	NP_001770.1	P19256	LFA3_HUMAN	CD58 molecule	159					blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cellular response to interferon-gamma (GO:0071346)|cellular response to tumor necrosis factor (GO:0071356)|heterotypic cell-cell adhesion (GO:0034113)|leukocyte migration (GO:0050900)|positive regulation of interleukin-8 secretion (GO:2000484)|single organismal cell-cell adhesion (GO:0016337)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)	p.W159*(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(2)|lung(3)|urinary_tract(1)	9	Lung SC(450;0.225)	all_cancers(81;0.000363)|all_lung(203;0.000118)|all_epithelial(167;0.000149)|Lung NSC(69;0.000577)		Lung(183;0.0086)|LUSC - Lung squamous cell carcinoma(189;0.0528)|Colorectal(144;0.0775)|all cancers(265;0.109)|Epithelial(280;0.118)|COAD - Colon adenocarcinoma(174;0.121)		AGGACAATCCCATGAGTACAT	0.378																																																	1	Substitution - Nonsense(1)	endometrium(1)											125.0	115.0	119.0					1																	117078739		2203	4300	6503	SO:0001583	missense	0			BC005930	CCDS888.1, CCDS44199.1	1p13	2008-02-05	2006-03-28		ENSG00000116815	ENSG00000116815		"""CD molecules"""	1688	protein-coding gene	gene with protein product		153420	"""CD58 antigen, (lymphocyte function-associated antigen 3)"""	LFA3		9510189	Standard	NM_001144822		Approved		uc001egm.3	P19256	OTTHUMG00000022749	ENST00000369489.5:c.476G>T	1.37:g.117078739C>A	ENSP00000358501:p.Trp159Leu		A8K7G5|Q5U053|Q6IB65|Q96KI9	Missense_Mutation	SNP	NULL	p.W159L	ENST00000369489.5	37	c.476	CCDS888.1	1	.	.	.	.	.	.	.	.	.	.	C	15.32	2.797644	0.50208	.	.	ENSG00000116815	ENST00000369489;ENST00000457047;ENST00000369487	T;T;T	0.70282	0.28;0.3;-0.47	3.36	3.36	0.38483	.	0.258733	0.33959	N	0.004400	T	0.66848	0.2831	L	0.36672	1.1	0.09310	N	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.984;0.999	T	0.58132	-0.7690	10	0.87932	D	0	-4.9982	10.4986	0.44791	0.0:1.0:0.0:0.0	.	159;159;159	P19256-3;B1AMW1;P19256	.;.;LFA3_HUMAN	L	159	ENSP00000358501:W159L;ENSP00000409080:W159L;ENSP00000358499:W159L	ENSP00000358499:W159L	W	-	2	0	CD58	116880262	0.069000	0.21087	0.068000	0.19968	0.018000	0.09664	2.213000	0.42844	2.170000	0.68504	0.655000	0.94253	TGG	CD58	-	NULL	ENSG00000116815		0.378	CD58-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CD58	HGNC	protein_coding	OTTHUMT00000059036.1		0.00	49	0	C	NM_001779		117078739	-1			no_errors	ENST00000369489	ensembl	human	known	74_37	missense	6.25	30	2	SNP	0.077	A
CFHR2	3080	genome.wustl.edu	37	1	196887491	196887491	+	Intron	SNP	A	A	C			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr1:196887491A>C	ENST00000367421.3	+	2	135				CFHR4_ENST00000367416.2_Missense_Mutation_p.Q563H|CFHR4_ENST00000608469.1_Missense_Mutation_p.Q187H|CFHR4_ENST00000251424.4_Missense_Mutation_p.Q317H|CFHR4_ENST00000367418.2_Missense_Mutation_p.Q317H			P36980	FHR2_HUMAN	complement factor H-related 2							extracellular region (GO:0005576)				large_intestine(2)|ovary(1)|skin(3)	6						TATCATTTCAAGCAGTGTGTA	0.373																																																	0													187.0	192.0	190.0					1																	196887491		2202	4300	6502	SO:0001627	intron_variant	0			X64877	CCDS30959.1	1q31.3	2008-02-05	2004-08-09	2006-02-28	ENSG00000080910	ENSG00000080910		"""Complement system"""	4890	protein-coding gene	gene with protein product		600889	"""H factor (complement)-like 3"""	HFL3, CFHL2		1533657, 7672821	Standard	NM_005666		Approved	FHR2	uc001gtq.1	P36980	OTTHUMG00000036518	ENST00000367421.3:c.59-31094A>C	1.37:g.196887491A>C			Q14310|Q5T9T1	Missense_Mutation	SNP	pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	p.Q563H	ENST00000367421.3	37	c.1689		1	.	.	.	.	.	.	.	.	.	.	A	12.67	2.006581	0.35415	.	.	ENSG00000134365	ENST00000367416;ENST00000367418;ENST00000251424;ENST00000538553	D;D;D	0.83335	-1.71;-1.71;-1.71	3.02	-2.01	0.07410	Complement control module (1);	.	.	.	.	T	0.73505	0.3595	N	0.19112	0.55	0.09310	N	1	D;B;P	0.57899	0.981;0.018;0.872	P;B;B	0.54759	0.76;0.002;0.306	T	0.62286	-0.6886	9	0.42905	T	0.14	.	0.5212	0.00612	0.4413:0.2136:0.1367:0.2084	.	563;564;317	C9J7J7;Q5DVJ7;Q92496	.;.;FHR4_HUMAN	H	563;317;317;317	ENSP00000356386:Q563H;ENSP00000356388:Q317H;ENSP00000251424:Q317H	ENSP00000251424:Q317H	Q	+	3	2	CFHR4	195154114	0.000000	0.05858	0.002000	0.10522	0.014000	0.08584	-0.146000	0.10250	-0.750000	0.04740	-0.782000	0.03352	CAA	CFHR4	-	superfamily_Sushi_SCR_CCP	ENSG00000134365		0.373	CFHR2-201	KNOWN	basic|appris_principal	protein_coding	CFHR4	HGNC	protein_coding		-	0.00	55	0	A	NM_005666		196887491	+1	tier1	-	no_errors	ENST00000367416	ensembl	human	known	74_37	missense	32.00	34	16	SNP	0.011	C
CFP	5199	genome.wustl.edu	37	X	47485920	47485920	+	Splice_Site	SNP	T	T	A			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chrX:47485920T>A	ENST00000396992.3	-	7	1061		c.e7-2		CFP_ENST00000480317.1_5'Flank|CFP_ENST00000247153.3_Splice_Site|CFP_ENST00000377005.2_Splice_Site	NM_001145252.1	NP_001138724.1	P27918	PROP_HUMAN	complement factor properdin						complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|defense response to bacterium (GO:0042742)|immune response (GO:0006955)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	extracellular region (GO:0005576)|extracellular space (GO:0005615)				breast(3)|endometrium(4)|kidney(2)|large_intestine(3)|lung(4)|ovary(1)|skin(1)	18						CCCCATCCACTGCAGAGACAG	0.587																																																	0													33.0	27.0	29.0					X																	47485920		2203	4298	6501	SO:0001630	splice_region_variant	0			M83652	CCDS14282.1	Xp11.4	2014-09-17	2006-03-02	2006-03-02	ENSG00000126759	ENSG00000126759		"""Complement system"""	8864	protein-coding gene	gene with protein product		300383	"""properdin P factor, complement"""	PFC		1783405	Standard	NM_001145252		Approved		uc004dih.3	P27918	OTTHUMG00000021451	ENST00000396992.3:c.941-2A>T	X.37:g.47485920T>A			O15134|O15135|O15136|O75826	Splice_Site	SNP	-	e7-2	ENST00000396992.3	37	c.941-2	CCDS14282.1	X	.	.	.	.	.	.	.	.	.	.	T	7.740	0.700983	0.15172	.	.	ENSG00000126759	ENST00000396992;ENST00000247153;ENST00000377005	.	.	.	5.24	4.05	0.47172	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	7.1488	0.25597	0.0:0.1088:0.0:0.8912	.	.	.	.	.	-1	.	.	.	-	.	.	CFP	47370864	1.000000	0.71417	0.997000	0.53966	0.281000	0.26958	3.310000	0.51911	1.859000	0.53934	0.381000	0.24937	.	CFP	-	-	ENSG00000126759		0.587	CFP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CFP	HGNC	protein_coding	OTTHUMT00000056435.2	-	0.00	34	0	T	NM_002621	Intron	47485920	-1	tier1	-	no_errors	ENST00000247153	ensembl	human	known	74_37	splice_site	29.31	41	17	SNP	0.993	A
CHAMP1	283489	genome.wustl.edu	37	13	115090509	115090509	+	Nonsense_Mutation	SNP	C	C	T			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr13:115090509C>T	ENST00000361283.1	+	3	1501	c.1192C>T	c.(1192-1194)Cga>Tga	p.R398*		NM_001164144.1|NM_001164145.1|NM_032436.2	NP_001157616.1|NP_001157617.1|NP_115812.1	Q96JM3	CHAP1_HUMAN	chromosome alignment maintaining phosphoprotein 1	398	Mediates interaction with MAD2L2.|Pro-rich.				attachment of spindle microtubules to kinetochore involved in mitotic sister chromatid segregation (GO:0051315)|protein localization to kinetochore (GO:0034501)|protein localization to microtubule (GO:0035372)|sister chromatid biorientation (GO:0031134)	condensed chromosome (GO:0000793)|condensed chromosome kinetochore (GO:0000777)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|spindle (GO:0005819)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)										ACCAGAACTCCGAAAGACAGC	0.562																																																	0													98.0	102.0	101.0					13																	115090509		2203	4300	6503	SO:0001587	stop_gained	0			AK074894	CCDS9545.1	13q34	2013-01-07	2011-10-07	2011-10-07	ENSG00000198824	ENSG00000198824		"""Zinc fingers, C2H2-type"""	20311	protein-coding gene	gene with protein product	"""chromosome alignment-maintaining phosphoprotein"""		"""chromosome 13 open reading frame 8"", ""zinc finger protein 828"""	C13orf8, ZNF828		21063390	Standard	NM_032436		Approved	CAMP, CHAMP	uc010ahb.3	Q96JM3	OTTHUMG00000017404	ENST00000361283.1:c.1192C>T	13.37:g.115090509C>T	ENSP00000354730:p.Arg398*		B3KU06|Q6P181|Q8NC88|Q9BST0	Nonsense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.R398*	ENST00000361283.1	37	c.1192	CCDS9545.1	13	.	.	.	.	.	.	.	.	.	.	C	38	7.234777	0.98154	.	.	ENSG00000198824	ENST00000361283	.	.	.	5.92	5.07	0.68467	.	0.000000	0.44688	D	0.000436	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-10.4864	12.0896	0.53717	0.312:0.688:0.0:0.0	.	.	.	.	X	398	.	.	R	+	1	2	ZNF828	114108611	0.373000	0.25073	0.996000	0.52242	0.986000	0.74619	0.400000	0.20932	1.478000	0.48253	0.655000	0.94253	CGA	CHAMP1	-	NULL	ENSG00000198824		0.562	CHAMP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHAMP1	HGNC	protein_coding	OTTHUMT00000045977.2	-	0.00	47	0	C	NM_032436		115090509	+1	tier1	-	no_errors	ENST00000361283	ensembl	human	known	74_37	nonsense	46.94	26	23	SNP	0.995	T
CHD5	26038	genome.wustl.edu	37	1	6196804	6196804	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr1:6196804T>C	ENST00000262450.3	-	16	2657	c.2558A>G	c.(2557-2559)aAg>aGg	p.K853R	CHD5_ENST00000378021.1_5'UTR	NM_015557.2	NP_056372.1	O00258	WRB_HUMAN	chromodomain helicase DNA binding protein 5	0					tail-anchored membrane protein insertion into ER membrane (GO:0071816)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)				breast(3)|central_nervous_system(3)|liver(1)|lung(1)|ovary(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	16	Ovarian(185;0.0634)	all_cancers(23;5.36e-32)|all_epithelial(116;2.32e-17)|all_neural(13;3.68e-06)|all_lung(118;3.94e-06)|all_hematologic(16;2.39e-05)|Lung NSC(185;5.33e-05)|Acute lymphoblastic leukemia(12;0.000372)|Glioma(11;0.00127)|Renal(390;0.00188)|Colorectal(325;0.00342)|Breast(487;0.00373)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.15)		Epithelial(90;3.08e-37)|GBM - Glioblastoma multiforme(13;1.36e-31)|OV - Ovarian serous cystadenocarcinoma(86;7.7e-19)|Colorectal(212;9.97e-08)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(185;6.16e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.00109)|BRCA - Breast invasive adenocarcinoma(365;0.0012)|STAD - Stomach adenocarcinoma(132;0.00346)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.193)		CTGGTTGTTCTTGAGGCGGTG	0.667																																																	0													36.0	40.0	39.0					1																	6196804		2203	4300	6503	SO:0001583	missense	0			AF425231	CCDS57.1	1p36.3	2013-01-28			ENSG00000116254	ENSG00000116254		"""Zinc fingers, PHD-type"""	16816	protein-coding gene	gene with protein product		610771				11889561, 12592387	Standard	NM_015557		Approved		uc001amb.2	Q8TDI0	OTTHUMG00000000952	ENST00000262450.3:c.2558A>G	1.37:g.6196804T>C	ENSP00000262450:p.Lys853Arg		A8KAP8|A8MQ44|D3DSH9|O60740	Missense_Mutation	SNP	pfam_CHD_C2,pfam_SNF2_N,pfam_DUF1086,pfam_CHD_N,pfam_DUF1087,pfam_Znf_PHD-finger,pfam_Chromo_domain,pfam_Helicase_C,pfam_Helicase/UvrB_dom,superfamily_P-loop_NTPase,superfamily_Chromodomain-like,superfamily_Znf_FYVE_PHD,superfamily_HMG_box_dom,smart_Znf_PHD,smart_Chromo_domain/shadow,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Znf_PHD-finger,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Chromo_domain/shadow	p.K853R	ENST00000262450.3	37	c.2558	CCDS57.1	1	.	.	.	.	.	.	.	.	.	.	T	22.6	4.308136	0.81247	.	.	ENSG00000116254	ENST00000262450;ENST00000378006;ENST00000536802;ENST00000538279	D	0.95001	-3.58	4.57	4.57	0.56435	DEAD-like helicase (2);SNF2-related (1);	0.000000	0.64402	D	0.000001	D	0.97077	0.9045	M	0.82716	2.605	0.80722	D	1	D	0.69078	0.997	D	0.77004	0.989	D	0.97704	1.0186	10	0.72032	D	0.01	-34.9455	14.2217	0.65830	0.0:0.0:0.0:1.0	.	853	Q8TDI0	CHD5_HUMAN	R	853;369;261;261	ENSP00000262450:K853R	ENSP00000262450:K853R	K	-	2	0	CHD5	6119391	1.000000	0.71417	1.000000	0.80357	0.836000	0.47400	7.944000	0.87722	1.828000	0.53243	0.260000	0.18958	AAG	CHD5	-	pfam_SNF2_N,pfam_Helicase/UvrB_dom,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,pfscan_Helicase_ATP-bd	ENSG00000116254		0.667	CHD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHD5	HGNC	protein_coding	OTTHUMT00000002823.2	-	0.00	78	0	T	NM_015557		6196804	-1	tier1	-	no_errors	ENST00000262450	ensembl	human	known	74_37	missense	19.79	77	19	SNP	1.000	C
CHD8	57680	genome.wustl.edu	37	14	21853819	21853819	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr14:21853819G>C	ENST00000557364.1	-	38	7962	c.7699C>G	c.(7699-7701)Cct>Gct	p.P2567A	CHD8_ENST00000430710.3_Missense_Mutation_p.P2288A|CHD8_ENST00000399982.2_Missense_Mutation_p.P2567A|SUPT16H_ENST00000555943.1_5'Flank|SUPT16H_ENST00000216297.2_5'Flank|RP11-524O1.4_ENST00000565098.1_RNA			Q9HCK8	CHD8_HUMAN	chromodomain helicase DNA binding protein 8	2567	Asp-rich.				ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|canonical Wnt signaling pathway (GO:0060070)|DNA duplex unwinding (GO:0032508)|in utero embryonic development (GO:0001701)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of Wnt signaling pathway (GO:0030178)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	MLL1 complex (GO:0071339)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|beta-catenin binding (GO:0008013)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA-dependent ATPase activity (GO:0008094)|histone binding (GO:0042393)|methylated histone binding (GO:0035064)|p53 binding (GO:0002039)			NS(2)|breast(1)|central_nervous_system(1)|cervix(4)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(8)|lung(33)|ovary(6)|prostate(7)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	85	all_cancers(95;0.00121)		Epithelial(56;2.55e-06)|all cancers(55;1.73e-05)	GBM - Glioblastoma multiforme(265;0.00424)		GGCATCATAGGATCATCAATG	0.478																																																	0													53.0	57.0	56.0					14																	21853819		1638	3110	4748	SO:0001583	missense	0			AB046784	CCDS45081.1, CCDS53885.1	14q11.2	2008-02-05	2004-06-22	2004-06-23		ENSG00000100888			20153	protein-coding gene	gene with protein product		610528	"""helicase with SNF2 domain 1"""	HELSNF1		10997877	Standard	NM_020920		Approved	KIAA1564, DUPLIN	uc001war.2	Q9HCK8		ENST00000557364.1:c.7699C>G	14.37:g.21853819G>C	ENSP00000451601:p.Pro2567Ala		Q4G0D8|Q68DQ0|Q6DKH9|Q6P440|Q6ZNL7|Q8N3Z9|Q8NCY4|Q8TBR9|Q96F26	Missense_Mutation	SNP	pfam_SNF2_N,pfam_Chromo_domain,pfam_BRK_domain,pfam_Helicase_C,pfam_Helicase/UvrB_dom,pfam_DNA/RNA_helicase_DEAD/DEAH_N,superfamily_P-loop_NTPase,superfamily_Chromodomain-like,smart_Chromo_domain/shadow,smart_Helicase_ATP-bd,smart_Helicase_C,smart_BRK_domain,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Chromo_domain/shadow	p.P2567A	ENST00000557364.1	37	c.7699	CCDS53885.1	14	.	.	.	.	.	.	.	.	.	.	G	16.23	3.064051	0.55432	.	.	ENSG00000100888	ENST00000430710;ENST00000399982;ENST00000262707;ENST00000557364	D;D;D	0.92965	-3.08;-3.14;-3.14	5.26	5.26	0.73747	.	0.164825	0.41097	D	0.000944	D	0.91143	0.7211	N	0.08118	0	0.35524	D	0.801714	D	0.67145	0.996	D	0.73708	0.981	D	0.93560	0.6894	10	0.39692	T	0.17	-10.5559	17.6464	0.88149	0.0:0.0:1.0:0.0	.	2288	Q9HCK8-2	.	A	2288;2567;2287;2567	ENSP00000406288:P2288A;ENSP00000382863:P2567A;ENSP00000451601:P2567A	ENSP00000262707:P2287A	P	-	1	0	CHD8	20923659	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.581000	0.67471	2.461000	0.83175	0.655000	0.94253	CCT	CHD8	-	NULL	ENSG00000100888		0.478	CHD8-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CHD8	HGNC	protein_coding	OTTHUMT00000410436.1	-	0.00	52	0	G	NM_020920		21853819	-1	tier1	-	no_errors	ENST00000399982	ensembl	human	known	74_37	missense	40.43	28	19	SNP	1.000	C
CHD9	80205	genome.wustl.edu	37	16	53358631	53358631	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr16:53358631G>T	ENST00000398510.3	+	38	8605	c.8518G>T	c.(8518-8520)Gta>Tta	p.V2840L	CHD9_ENST00000447540.1_Missense_Mutation_p.V2825L|CHD9_ENST00000566029.1_Missense_Mutation_p.V2824L|CHD9_ENST00000564845.1_Missense_Mutation_p.V2824L			Q3L8U1	CHD9_HUMAN	chromodomain helicase DNA binding protein 9	2840					cellular lipid metabolic process (GO:0044255)|chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(5)|kidney(6)|large_intestine(21)|lung(32)|ovary(2)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	78		all_cancers(37;0.0212)				GTCTAAGTCTGTAGAAGTAAA	0.398																																																	0													54.0	49.0	50.0					16																	53358631		1839	4077	5916	SO:0001583	missense	0			AK022240	CCDS45485.1	16q12.2	2006-04-12				ENSG00000177200			25701	protein-coding gene	gene with protein product						9205841	Standard	XM_005256168		Approved	FLJ12178, KIAA0308, BC022889	uc002egy.3	Q3L8U1		ENST00000398510.3:c.8518G>T	16.37:g.53358631G>T	ENSP00000381522:p.Val2840Leu		B2RTU2|B9ZVQ0|O15025|Q1WF12|Q6DTK9|Q9H9V7|Q9UHM2	Missense_Mutation	SNP	pfam_SNF2_N,pfam_BRK_domain,pfam_Chromo_domain,pfam_Helicase_C,pfam_DNA/RNA_helicase_DEAD/DEAH_N,superfamily_P-loop_NTPase,superfamily_Chromodomain-like,smart_Chromo_domain/shadow,smart_Helicase_ATP-bd,smart_Helicase_C,smart_BRK_domain,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Chromo_domain/shadow	p.V2840L	ENST00000398510.3	37	c.8518		16	.	.	.	.	.	.	.	.	.	.	G	6.053	0.378157	0.11466	.	.	ENSG00000177200	ENST00000447540;ENST00000398510;ENST00000450543	D	0.85556	-2.0	5.25	3.28	0.37604	.	0.595355	0.14656	N	0.306288	T	0.72534	0.3472	N	0.24115	0.695	0.19300	N	0.999975	B;B;B;B	0.22683	0.003;0.015;0.073;0.015	B;B;B;B	0.23275	0.003;0.015;0.045;0.015	T	0.58086	-0.7698	10	0.28530	T	0.3	-3.3473	5.8988	0.18955	0.2315:0.145:0.6235:0.0	.	906;2825;2840;2824	C9JR69;Q3L8U1-3;Q3L8U1;Q3L8U1-2	.;.;CHD9_HUMAN;.	L	2825;2824;906	ENSP00000396345:V2825L	ENSP00000381522:V2824L	V	+	1	0	CHD9	51916132	0.371000	0.25056	0.934000	0.37439	0.981000	0.71138	2.318000	0.43779	0.705000	0.31890	0.655000	0.94253	GTA	CHD9	-	NULL	ENSG00000177200		0.398	CHD9-020	KNOWN	basic	protein_coding	CHD9	HGNC	protein_coding	OTTHUMT00000422345.1		0.00	44	0	G	NM_025134		53358631	+1			no_errors	ENST00000398510	ensembl	human	known	74_37	missense	5.56	51	3	SNP	0.392	T
CHRM3	1131	genome.wustl.edu	37	1	240070895	240070895	+	Missense_Mutation	SNP	T	T	A			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr1:240070895T>A	ENST00000255380.4	+	5	923	c.144T>A	c.(142-144)aaT>aaA	p.N48K		NM_000740.2	NP_000731.1	P20309	ACM3_HUMAN	cholinergic receptor, muscarinic 3	48					cell proliferation (GO:0008283)|cellular protein modification process (GO:0006464)|energy reserve metabolic process (GO:0006112)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|G-protein coupled receptor signaling pathway (GO:0007186)|nervous system development (GO:0007399)|positive regulation of smooth muscle contraction (GO:0045987)|regulation of insulin secretion (GO:0050796)|regulation of vascular smooth muscle contraction (GO:0003056)|saliva secretion (GO:0046541)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|smooth muscle contraction (GO:0006939)	asymmetric synapse (GO:0032279)|axon terminus (GO:0043679)|cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|drug binding (GO:0008144)|G-protein coupled acetylcholine receptor activity (GO:0016907)|phosphatidylinositol phospholipase C activity (GO:0004435)|receptor activity (GO:0004872)			breast(3)|endometrium(5)|kidney(2)|large_intestine(4)|lung(19)|ovary(4)|prostate(1)|skin(12)|upper_aerodigestive_tract(1)	51	Ovarian(103;0.127)	all_cancers(173;0.00567)|all_neural(198;0.203)	OV - Ovarian serous cystadenocarcinoma(106;0.00989)		Aclidinium(DB08897)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Anisotropine Methylbromide(DB00517)|Aripiprazole(DB01238)|Atropine(DB00572)|Brompheniramine(DB00835)|Cevimeline(DB00185)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Cinnarizine(DB00568)|Clozapine(DB00363)|Cryptenamine(DB00785)|Cyproheptadine(DB00434)|Darifenacin(DB00496)|Desipramine(DB01151)|Diphemanil Methylsulfate(DB00729)|Diphenidol(DB01231)|Disopyramide(DB00280)|Doxepin(DB01142)|Fesoterodine(DB06702)|Glycopyrrolate(DB00986)|Homatropine Methylbromide(DB00725)|Hyoscyamine(DB00424)|Imipramine(DB00458)|Ipratropium bromide(DB00332)|Isopropamide(DB01625)|Ketamine(DB01221)|Loxapine(DB00408)|Maprotiline(DB00934)|Mepenzolate(DB04843)|Methacholine(DB06709)|Methotrimeprazine(DB01403)|Methylscopolamine bromide(DB00462)|Metixene(DB00340)|Mivacurium(DB01226)|Nicardipine(DB00622)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Oxybutynin(DB01062)|Oxyphencyclimine(DB00383)|Pancuronium(DB01337)|Paroxetine(DB00715)|Pethidine(DB00454)|Pilocarpine(DB01085)|Pipecuronium(DB01338)|Procyclidine(DB00387)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Quetiapine(DB01224)|Scopolamine(DB00747)|Solifenacin(DB01591)|Succinylcholine(DB00202)|Tiotropium(DB01409)|Tolterodine(DB01036)|Tramadol(DB00193)|Trihexyphenidyl(DB00376)|Trimipramine(DB00726)|Tropicamide(DB00809)|Ziprasidone(DB00246)	CAGCTGGCAATTTCTCCTCTC	0.572																																																	0													92.0	88.0	90.0					1																	240070895		2203	4300	6503	SO:0001583	missense	0			U29589	CCDS1616.1	1q43	2012-09-20			ENSG00000133019	ENSG00000133019		"""Cholinergic receptors"", ""GPCR / Class A : Cholinergic receptors, muscarinic"""	1952	protein-coding gene	gene with protein product	"""acetylcholine receptor, muscarinic 3"""	118494					Standard	XM_005273032		Approved		uc001hyp.3	P20309	OTTHUMG00000039649	ENST00000255380.4:c.144T>A	1.37:g.240070895T>A	ENSP00000255380:p.Asn48Lys		Q0VAJ8|Q4QRI3|Q5VXY2|Q9HB60	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_7TM,prints_Musac_Ach_M3_rcpt,prints_Musac_Ach_rcpt,prints_GPCR_Rhodpsn	p.N48K	ENST00000255380.4	37	c.144	CCDS1616.1	1	.	.	.	.	.	.	.	.	.	.	T	12.90	2.077368	0.36662	.	.	ENSG00000133019	ENST00000255380;ENST00000448020	T;T	0.64085	-0.08;-0.08	5.6	0.64	0.17752	.	0.358182	0.23644	N	0.045992	T	0.45438	0.1342	L	0.29908	0.895	0.33882	D	0.63621	B	0.23937	0.094	B	0.16722	0.016	T	0.48854	-0.8998	10	0.49607	T	0.09	-14.3195	9.6828	0.40080	0.0:0.4468:0.0:0.5532	.	48	P20309	ACM3_HUMAN	K	48	ENSP00000255380:N48K;ENSP00000404764:N48K	ENSP00000255380:N48K	N	+	3	2	CHRM3	238137518	0.176000	0.23096	0.947000	0.38551	0.853000	0.48598	0.355000	0.20163	0.133000	0.18654	0.528000	0.53228	AAT	CHRM3	-	NULL	ENSG00000133019		0.572	CHRM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHRM3	HGNC	protein_coding	OTTHUMT00000095644.2	-	0.00	81	0	T	NM_000740		240070895	+1	tier1	-	no_errors	ENST00000255380	ensembl	human	known	74_37	missense	36.17	30	17	SNP	0.981	A
CKAP5	9793	genome.wustl.edu	37	11	46802011	46802011	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr11:46802011G>T	ENST00000529230.1	-	19	2320	c.2274C>A	c.(2272-2274)agC>agA	p.S758R	CKAP5_ENST00000354558.3_Missense_Mutation_p.S758R|CKAP5_ENST00000415402.1_Missense_Mutation_p.S758R|CKAP5_ENST00000312055.5_Missense_Mutation_p.S758R			Q14008	CKAP5_HUMAN	cytoskeleton associated protein 5	758					centrosome organization (GO:0051297)|establishment or maintenance of microtubule cytoskeleton polarity (GO:0030951)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|RNA transport (GO:0050658)|spindle organization (GO:0007051)	centrosome (GO:0005813)|cytosol (GO:0005829)|membrane (GO:0016020)|protein complex (GO:0043234)|spindle pole (GO:0000922)				breast(1)|cervix(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(13)|ovary(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	43						TCTTCACATTGCTAATGAAAG	0.338																																					Ovarian(4;85 273 2202 4844 13323)												0													94.0	87.0	89.0					11																	46802011		2201	4299	6500	SO:0001583	missense	0				CCDS7924.1, CCDS31477.1	11p11.2	2006-09-20			ENSG00000175216	ENSG00000175216			28959	protein-coding gene	gene with protein product		611142				7788527, 8536682	Standard	NM_014756		Approved	ch-TOG, KIAA0097, TOG, TOGp	uc001ndi.2	Q14008	OTTHUMG00000166599	ENST00000529230.1:c.2274C>A	11.37:g.46802011G>T	ENSP00000432768:p.Ser758Arg		Q05D70|Q0VAX7|Q0VAX8|Q14668|Q2TA89|Q6NSH4	Missense_Mutation	SNP	pfam_CLASP_N_dom,pfam_HEAT,superfamily_ARM-type_fold,superfamily_Homing_endonucl,pfscan_HEAT_type_2	p.S758R	ENST00000529230.1	37	c.2274	CCDS31477.1	11	.	.	.	.	.	.	.	.	.	.	G	16.49	3.138806	0.56936	.	.	ENSG00000175216	ENST00000529230;ENST00000415402;ENST00000312055;ENST00000354558	T;T;T;T	0.65549	-0.16;-0.16;-0.16;-0.16	5.57	4.66	0.58398	Armadillo-type fold (1);	0.082952	0.85682	D	0.000000	T	0.51075	0.1653	L	0.29908	0.895	0.40782	D	0.983182	P;P;P	0.41848	0.646;0.763;0.651	B;B;B	0.42422	0.117;0.387;0.216	T	0.49943	-0.8885	10	0.31617	T	0.26	-5.8045	11.0	0.47600	0.1602:0.0:0.8398:0.0	.	758;758;758	Q14008-3;Q14008-2;Q14008	.;.;CKAP5_HUMAN	R	758	ENSP00000432768:S758R;ENSP00000395302:S758R;ENSP00000310227:S758R;ENSP00000346566:S758R	ENSP00000310227:S758R	S	-	3	2	CKAP5	46758587	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.025000	0.57225	1.358000	0.45922	0.655000	0.94253	AGC	CKAP5	-	superfamily_ARM-type_fold	ENSG00000175216		0.338	CKAP5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CKAP5	HGNC	protein_coding	OTTHUMT00000390679.1	-	0.00	59	0	G	NM_014756		46802011	-1	tier1	-	no_errors	ENST00000415402	ensembl	human	known	74_37	missense	7.41	50	4	SNP	1.000	T
CLDN17	26285	genome.wustl.edu	37	21	31538814	31538814	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr21:31538814A>C	ENST00000286808.3	-	1	157	c.122T>G	c.(121-123)aTt>aGt	p.I41S		NM_012131.2	NP_036263.1	P56750	CLD17_HUMAN	claudin 17	41					calcium-independent cell-cell adhesion (GO:0016338)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|tight junction assembly (GO:0070830)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	identical protein binding (GO:0042802)|structural molecule activity (GO:0005198)			NS(1)|breast(1)|endometrium(2)|large_intestine(6)|lung(9)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)	23						CTCAAAGACAATAATGTTGCT	0.527																																																	0													67.0	72.0	70.0					21																	31538814		2203	4300	6503	SO:0001583	missense	0			AJ250712	CCDS13586.1	21q22.1	2008-07-31			ENSG00000156282	ENSG00000156282		"""Claudins"""	2038	protein-coding gene	gene with protein product						12736707	Standard	NM_012131		Approved	MGC126552, MGC126554	uc011acv.2	P56750	OTTHUMG00000081873	ENST00000286808.3:c.122T>G	21.37:g.31538814A>C	ENSP00000286808:p.Ile41Ser		Q3MJB5|Q6UY37	Missense_Mutation	SNP	pfam_PMP22/EMP/MP20/Claudin,prints_Claudin,prints_Claudin14,prints_Claudin8	p.I41S	ENST00000286808.3	37	c.122	CCDS13586.1	21	.	.	.	.	.	.	.	.	.	.	A	23.9	4.470897	0.84533	.	.	ENSG00000156282	ENST00000286808	T	0.62364	0.03	5.22	5.22	0.72569	.	0.183165	0.48767	D	0.000179	T	0.79902	0.4526	M	0.83012	2.62	0.58432	D	0.999992	D	0.61080	0.989	D	0.69654	0.965	T	0.83259	-0.0049	10	0.87932	D	0	.	15.2382	0.73447	1.0:0.0:0.0:0.0	.	41	P56750	CLD17_HUMAN	S	41	ENSP00000286808:I41S	ENSP00000286808:I41S	I	-	2	0	CLDN17	30460685	0.984000	0.35163	0.999000	0.59377	0.998000	0.95712	9.038000	0.93771	2.326000	0.78906	0.533000	0.62120	ATT	CLDN17	-	pfam_PMP22/EMP/MP20/Claudin	ENSG00000156282		0.527	CLDN17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLDN17	HGNC	protein_coding	OTTHUMT00000182261.1	-	0.00	39	0	A	NM_012131		31538814	-1	tier1	-	no_errors	ENST00000286808	ensembl	human	known	74_37	missense	31.71	28	13	SNP	1.000	C
CNKSR2	22866	genome.wustl.edu	37	X	21624945	21624945	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chrX:21624945C>T	ENST00000379510.3	+	19	2129	c.2093C>T	c.(2092-2094)cCa>cTa	p.P698L	CNKSR2_ENST00000279451.4_Missense_Mutation_p.P698L|CNKSR2_ENST00000425654.2_Missense_Mutation_p.P668L|CNKSR2_ENST00000543067.1_Missense_Mutation_p.P649L	NM_014927.3	NP_055742.2	Q8WXI2	CNKR2_HUMAN	connector enhancer of kinase suppressor of Ras 2	698					regulation of signal transduction (GO:0009966)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)				breast(3)|endometrium(8)|kidney(2)|large_intestine(15)|lung(28)|prostate(2)|upper_aerodigestive_tract(3)	61						CCATCAACACCAAAACAAGAT	0.423																																																	0													304.0	197.0	233.0					X																	21624945		2203	4300	6503	SO:0001583	missense	0			AB020709	CCDS14198.1, CCDS55387.1, CCDS55388.1, CCDS55389.1	Xp22.12	2013-01-10			ENSG00000149970	ENSG00000149970		"""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"""	19701	protein-coding gene	gene with protein product		300724					Standard	NM_014927		Approved	KIAA0902, CNK2, KSR2	uc004czx.2	Q8WXI2	OTTHUMG00000021233	ENST00000379510.3:c.2093C>T	X.37:g.21624945C>T	ENSP00000368824:p.Pro698Leu		B4DGR4|B7ZLJ1|B9EG83|E7ESA4|O94976|Q5JPK4|Q5JPN0|Q8WXI1	Missense_Mutation	SNP	pfam_CNKSR2,pfam_CRIC_domain_Chordata,pfam_SAM_type1,pfam_Pleckstrin_homology,pfam_SAM_2,pfam_PDZ,superfamily_SAM/pointed,superfamily_PDZ,smart_SAM,smart_PDZ,smart_Pleckstrin_homology,pfscan_PDZ,pfscan_Pleckstrin_homology,pfscan_SAM	p.P698L	ENST00000379510.3	37	c.2093	CCDS14198.1	X	.	.	.	.	.	.	.	.	.	.	C	15.38	2.817903	0.50633	.	.	ENSG00000149970	ENST00000425654;ENST00000543067;ENST00000279451;ENST00000379510	T;T;T;T	0.18960	2.46;2.18;2.18;2.46	5.97	5.97	0.96955	.	0.210308	0.51477	D	0.000087	T	0.17746	0.0426	L	0.27053	0.805	0.80722	D	1	B;B;B;B	0.21225	0.002;0.001;0.053;0.004	B;B;B;B	0.15870	0.003;0.003;0.014;0.005	T	0.06679	-1.0813	10	0.20046	T	0.44	-11.3976	19.2739	0.94023	0.0:1.0:0.0:0.0	.	668;649;290;698	B7ZLJ1;B4DGR4;B3KPN2;Q8WXI2	.;.;.;CNKR2_HUMAN	L	668;649;698;698	ENSP00000397906:P668L;ENSP00000444633:P649L;ENSP00000279451:P698L;ENSP00000368824:P698L	ENSP00000279451:P698L	P	+	2	0	CNKSR2	21534866	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	7.487000	0.81328	2.504000	0.84457	0.594000	0.82650	CCA	CNKSR2	-	NULL	ENSG00000149970		0.423	CNKSR2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	CNKSR2	HGNC	protein_coding	OTTHUMT00000056019.1	-	0.00	46	0	C	NM_014927		21624945	+1	tier1	-	no_errors	ENST00000379510	ensembl	human	known	74_37	missense	41.18	30	21	SNP	1.000	T
CNOT1	23019	genome.wustl.edu	37	16	58577327	58577327	+	Intron	SNP	A	A	C	rs556592424		TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr16:58577327A>C	ENST00000317147.5	-	31	4767				CNOT1_ENST00000245138.4_Intron|CNOT1_ENST00000569240.1_Intron|CNOT1_ENST00000441024.2_Missense_Mutation_p.F1540V	NM_001265612.1|NM_016284.4	NP_001252541.1|NP_057368.3	A5YKK6	CNOT1_HUMAN	CCR4-NOT transcription complex, subunit 1						gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of cytoplasmic mRNA processing body assembly (GO:0010606)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|regulation of stem cell maintenance (GO:2000036)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|transcription, DNA-templated (GO:0006351)|trophectodermal cell differentiation (GO:0001829)	CCR4-NOT complex (GO:0030014)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|extracellular space (GO:0005615)|membrane (GO:0016020)|nucleus (GO:0005634)|peroxisomal membrane (GO:0005778)	estrogen receptor binding (GO:0030331)|poly(A) RNA binding (GO:0044822)|retinoic acid receptor binding (GO:0042974)			breast(1)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(24)|lung(25)|ovary(4)|prostate(6)|skin(3)|upper_aerodigestive_tract(2)	87				Kidney(780;0.0722)|OV - Ovarian serous cystadenocarcinoma(108;0.173)|Epithelial(162;0.239)		aaaaaaaaaaaacacacagac	0.299													A|||	1	0.000199681	0.0	0.0	5008	,	,		18548	0.0		0.001	False		,,,				2504	0.0																0													20.0	20.0	20.0					16																	58577327		1013	2122	3135	SO:0001627	intron_variant	0			AL833549	CCDS10799.1, CCDS45501.1, CCDS58468.1	16q21	2008-02-05			ENSG00000125107	ENSG00000125107			7877	protein-coding gene	gene with protein product		604917		NOT1		14702039	Standard	NM_016284		Approved	CDC39, NOT1H, KIAA1007, AD-005	uc002env.4	A5YKK6	OTTHUMG00000133487	ENST00000317147.5:c.4434+183T>G	16.37:g.58577327A>C			Q68DX7|Q7Z3K2|Q8IWB8|Q8TB53|Q9BVZ6|Q9UFR8|Q9UI27|Q9Y2L0	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.F1540V	ENST00000317147.5	37	c.4618	CCDS10799.1	16	.	.	.	.	.	.	.	.	.	.	A	4.645	0.119968	0.08881	.	.	ENSG00000125107	ENST00000441024	T	0.44482	0.92	1.6	-3.2	0.05156	.	.	.	.	.	T	0.28499	0.0705	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.12400	-1.0549	8	0.87932	D	0	.	5.872	0.18809	0.2548:0.5872:0.158:0.0	.	1540	A5YKK6-4	.	V	1540	ENSP00000413113:F1540V	ENSP00000413113:F1540V	F	-	1	0	CNOT1	57134828	0.004000	0.15560	0.000000	0.03702	0.000000	0.00434	0.507000	0.22675	-2.105000	0.00842	-1.344000	0.01245	TTT	CNOT1	-	NULL	ENSG00000125107		0.299	CNOT1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CNOT1	HGNC	protein_coding	OTTHUMT00000257385.3		0.00	49	0	A	NM_016284		58577327	-1			no_errors	ENST00000441024	ensembl	human	known	74_37	missense	24.39	31	10	SNP	0.000	C
COL15A1	1306	genome.wustl.edu	37	9	101785706	101785706	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr9:101785706T>C	ENST00000375001.3	+	14	2252	c.1829T>C	c.(1828-1830)cTg>cCg	p.L610P		NM_001855.3	NP_001846.3	P39059	COFA1_HUMAN	collagen, type XV, alpha 1	610	Nonhelical region 2 (NC2).				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell differentiation (GO:0030154)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|signal transduction (GO:0007165)	collagen type XV trimer (GO:0005582)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(20)|liver(1)|lung(42)|ovary(6)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	107		Acute lymphoblastic leukemia(62;0.0562)				TCTGGTGACCTGGTGGGCAGT	0.592																																																	0													57.0	54.0	55.0					9																	101785706		2203	4300	6503	SO:0001583	missense	0			L25286	CCDS35081.1	9q21-q22	2013-01-16			ENSG00000204291	ENSG00000204291		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"""	2192	protein-coding gene	gene with protein product	"""collagen type XV proteoglycan"""	120325				1427836	Standard	NM_001855		Approved		uc004azb.2	P39059	OTTHUMG00000020351	ENST00000375001.3:c.1829T>C	9.37:g.101785706T>C	ENSP00000364140:p.Leu610Pro		Q5T6J4|Q9UDC5|Q9Y4W4	Missense_Mutation	SNP	pfam_Collagenase_NC10/endostatin,pfam_Collagen,superfamily_C-type_lectin_fold,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G	p.L610P	ENST00000375001.3	37	c.1829	CCDS35081.1	9	.	.	.	.	.	.	.	.	.	.	T	5.799	0.331690	0.10956	.	.	ENSG00000204291	ENST00000375001;ENST00000536083	D	0.90788	-2.73	3.63	1.19	0.21007	.	1.700530	0.03776	N	0.260606	D	0.85737	0.5766	L	0.46157	1.445	0.39166	D	0.962491	B	0.09022	0.002	B	0.08055	0.003	T	0.70978	-0.4725	10	0.26408	T	0.33	-0.1245	3.1302	0.06420	0.2064:0.1155:0.0:0.6781	.	610	P39059	COFA1_HUMAN	P	610;580	ENSP00000364140:L610P	ENSP00000364140:L610P	L	+	2	0	COL15A1	100825527	0.048000	0.20356	0.559000	0.28332	0.092000	0.18411	0.194000	0.17135	0.241000	0.21283	-0.695000	0.03696	CTG	COL15A1	-	NULL	ENSG00000204291		0.592	COL15A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL15A1	HGNC	protein_coding	OTTHUMT00000053386.3	-	0.00	31	0	T	NM_001855		101785706	+1	tier1	-	no_errors	ENST00000375001	ensembl	human	known	74_37	missense	6.45	58	4	SNP	0.614	C
COL6A1	1291	genome.wustl.edu	37	21	47421259	47421259	+	Missense_Mutation	SNP	G	G	A	rs564072783		TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr21:47421259G>A	ENST00000361866.3	+	30	2029	c.1915G>A	c.(1915-1917)Gtc>Atc	p.V639I	COL6A1_ENST00000498614.1_3'UTR	NM_001848.2	NP_001839.2	P12109	CO6A1_HUMAN	collagen, type VI, alpha 1	639	C-terminal globular domain.|VWFA 2. {ECO:0000255|PROSITE- ProRule:PRU00219}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|osteoblast differentiation (GO:0001649)|protein heterotrimerization (GO:0070208)	collagen type VI trimer (GO:0005589)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|protein complex (GO:0043234)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)	platelet-derived growth factor binding (GO:0048407)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(18)|ovary(1)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	33	all_hematologic(128;0.24)			Colorectal(79;0.0265)|READ - Rectum adenocarcinoma(84;0.0649)		GGACTTCGTCGTCAAGGTCAT	0.647													G|||	1	0.000199681	0.0008	0.0	5008	,	,		14670	0.0		0.0	False		,,,				2504	0.0																0													119.0	120.0	120.0					21																	47421259		2203	4300	6503	SO:0001583	missense	0			M20776	CCDS13727.1	21q22.3	2014-09-17			ENSG00000142156	ENSG00000142156		"""Collagens"""	2211	protein-coding gene	gene with protein product		120220					Standard	XM_006723964		Approved		uc002zhu.1	P12109	OTTHUMG00000090440	ENST00000361866.3:c.1915G>A	21.37:g.47421259G>A	ENSP00000355180:p.Val639Ile		O00117|O00118|Q14040|Q14041|Q16258|Q7Z645|Q9BSA8	Missense_Mutation	SNP	pfam_VWF_A,pfam_Collagen,smart_VWF_A,pfscan_VWF_A	p.V639I	ENST00000361866.3	37	c.1915	CCDS13727.1	21	.	.	.	.	.	.	.	.	.	.	G	0.757	-0.770651	0.02974	.	.	ENSG00000142156	ENST00000361866	D	0.83419	-1.72	5.2	-3.88	0.04205	von Willebrand factor, type A (3);	0.321647	0.26761	N	0.022622	T	0.55784	0.1942	N	0.03253	-0.375	0.22620	N	0.998922	B	0.06786	0.001	B	0.08055	0.003	T	0.50841	-0.8780	10	0.02654	T	1	-10.5816	14.5625	0.68151	0.8389:0.0:0.1611:0.0	.	639	P12109	CO6A1_HUMAN	I	639	ENSP00000355180:V639I	ENSP00000355180:V639I	V	+	1	0	COL6A1	46245687	0.647000	0.27304	0.584000	0.28653	0.207000	0.24258	0.319000	0.19522	-0.717000	0.04955	-0.513000	0.04457	GTC	COL6A1	-	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	ENSG00000142156		0.647	COL6A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL6A1	HGNC	protein_coding	OTTHUMT00000206877.1	-	0.00	67	0	G	NM_001848		47421259	+1	tier1	-	no_errors	ENST00000361866	ensembl	human	known	74_37	missense	33.93	37	19	SNP	0.951	A
COMMD2	51122	genome.wustl.edu	37	3	149459348	149459348	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr3:149459348T>G	ENST00000473414.1	-	5	614	c.560A>C	c.(559-561)aAg>aCg	p.K187T		NM_016094.3	NP_057178.2	Q86X83	COMD2_HUMAN	COMM domain containing 2	187	COMM. {ECO:0000255|PROSITE- ProRule:PRU00602}.									NS(1)|large_intestine(3)|lung(2)|prostate(1)|skin(1)|urinary_tract(1)	9			LUSC - Lung squamous cell carcinoma(72;0.0378)|Lung(72;0.048)			GTGATTTGTCTTCATCTCTTC	0.383																																																	0													185.0	188.0	187.0					3																	149459348		2203	4300	6503	SO:0001583	missense	0			AY542158	CCDS3145.1	3q25.1	2004-02-20			ENSG00000114744	ENSG00000114744			24993	protein-coding gene	gene with protein product						15799966	Standard	NM_016094		Approved	HSPC042	uc003exj.2	Q86X83	OTTHUMG00000159616	ENST00000473414.1:c.560A>C	3.37:g.149459348T>G	ENSP00000419475:p.Lys187Thr		Q561V4|Q9H3L5|Q9Y5V1	Missense_Mutation	SNP	pfam_HCaRG	p.K187T	ENST00000473414.1	37	c.560	CCDS3145.1	3	.	.	.	.	.	.	.	.	.	.	T	31	5.094598	0.94149	.	.	ENSG00000114744	ENST00000473414	T	0.09817	2.94	5.97	5.97	0.96955	COMM domain (1);	0.043207	0.85682	D	0.000000	T	0.33469	0.0864	M	0.80508	2.5	0.80722	D	1	D	0.59357	0.985	P	0.60345	0.873	T	0.07083	-1.0791	10	0.72032	D	0.01	-31.2399	16.4608	0.84044	0.0:0.0:0.0:1.0	.	187	Q86X83	COMD2_HUMAN	T	187	ENSP00000419475:K187T	ENSP00000419475:K187T	K	-	2	0	COMMD2	150942038	1.000000	0.71417	0.997000	0.53966	0.993000	0.82548	3.742000	0.55097	2.288000	0.76882	0.533000	0.62120	AAG	COMMD2	-	pfam_HCaRG	ENSG00000114744		0.383	COMMD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COMMD2	HGNC	protein_coding	OTTHUMT00000356515.1	-	0.00	60	0	T	NM_016094		149459348	-1	tier1	-	no_errors	ENST00000473414	ensembl	human	known	74_37	missense	21.74	54	15	SNP	1.000	G
CPS1	1373	genome.wustl.edu	37	2	211521321	211521321	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr2:211521321C>T	ENST00000233072.5	+	30	3827	c.3631C>T	c.(3631-3633)Ccc>Tcc	p.P1211S	CPS1_ENST00000430249.2_Missense_Mutation_p.P1217S|CPS1_ENST00000451903.2_Missense_Mutation_p.P760S	NM_001875.4	NP_001866.2	P31327	CPSM_HUMAN	carbamoyl-phosphate synthase 1, mitochondrial	1211	ATP-grasp 2.				anion homeostasis (GO:0055081)|carbamoyl phosphate biosynthetic process (GO:0070409)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to cAMP (GO:0071320)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to glucagon stimulus (GO:0071377)|cellular response to oleic acid (GO:0071400)|citrulline biosynthetic process (GO:0019240)|glutamine catabolic process (GO:0006543)|glycogen catabolic process (GO:0005980)|hepatocyte differentiation (GO:0070365)|homocysteine metabolic process (GO:0050667)|midgut development (GO:0007494)|nitric oxide metabolic process (GO:0046209)|positive regulation of vasodilation (GO:0045909)|response to amine (GO:0014075)|response to amino acid (GO:0043200)|response to dexamethasone (GO:0071548)|response to drug (GO:0042493)|response to food (GO:0032094)|response to growth hormone (GO:0060416)|response to lipopolysaccharide (GO:0032496)|response to starvation (GO:0042594)|response to toxic substance (GO:0009636)|response to zinc ion (GO:0010043)|small molecule metabolic process (GO:0044281)|triglyceride catabolic process (GO:0019433)|urea cycle (GO:0000050)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|carbamoyl-phosphate synthase (ammonia) activity (GO:0004087)|endopeptidase activity (GO:0004175)|glutamate binding (GO:0016595)|modified amino acid binding (GO:0072341)|phospholipid binding (GO:0005543)			breast(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(17)|lung(85)|ovary(8)|pancreas(1)|prostate(6)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	142				Epithelial(149;0.00697)|Lung(261;0.0521)|LUSC - Lung squamous cell carcinoma(261;0.0544)|all cancers(144;0.0843)	Carglumic Acid(DB06775)	TCTGATGCTGCCCACACAAAC	0.413																																																	0													72.0	72.0	72.0					2																	211521321		2203	4300	6503	SO:0001583	missense	0			AF154830	CCDS2393.1, CCDS46505.1, CCDS46506.1	2p	2014-09-17	2010-05-11		ENSG00000021826	ENSG00000021826	6.3.4.16		2323	protein-coding gene	gene with protein product		608307	"""carbamoyl-phosphate synthetase 1, mitochondrial"""				Standard	NM_001122633		Approved		uc002vee.4	P31327	OTTHUMG00000132994	ENST00000233072.5:c.3631C>T	2.37:g.211521321C>T	ENSP00000233072:p.Pro1211Ser		B7Z818|J3KQL0|O43774|Q53TL5|Q59HF8|Q7Z5I5	Missense_Mutation	SNP	pfam_CbamoylP_synth_lsu-like_ATP-bd,pfam_CarbamoylP_synth_ssu_N,pfam_CarbamoylP_synth_lsu_oligo,pfam_GATASE,pfam_CarbamoylP_synth_lsu_N,pfam_MGS-like_dom,pfam_ATP-grasp_carboxylate-amine,pfam_Dala_Dala_lig_C,superfamily_CarbamoylP_synth_lsu_oligo,superfamily_CarbamoylP_synth_ssu_N,superfamily_PreATP-grasp_dom,superfamily_MGS-like_dom,smart_MGS-like_dom,pfscan_ATP-grasp,prints_CbamoylP_synth_lsu_CPSase_dom,tigrfam_CarbamoylP_synth_lsu,tigrfam_CarbamoylP_synth_ssu	p.P1217S	ENST00000233072.5	37	c.3649	CCDS2393.1	2	.	.	.	.	.	.	.	.	.	.	C	29.4	4.998894	0.93227	.	.	ENSG00000021826	ENST00000430249;ENST00000539150;ENST00000233072;ENST00000451903	D;D;D	0.99523	-6.08;-6.08;-6.08	5.87	5.87	0.94306	ATP-grasp fold (1);ATP-grasp fold, subdomain 2 (1);Carbamoyl-phosphate synthetase, large subunit, ATP-binding (1);	0.000000	0.85682	D	0.000000	D	0.99819	0.9920	H	0.99117	4.435	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.96812	0.9597	10	0.87932	D	0	-7.9014	20.206	0.98277	0.0:1.0:0.0:0.0	.	1221;1211	Q59HF8;P31327	.;CPSM_HUMAN	S	1217;1219;1211;760	ENSP00000402608:P1217S;ENSP00000233072:P1211S;ENSP00000406136:P760S	ENSP00000233072:P1211S	P	+	1	0	CPS1	211229566	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.340000	0.79292	2.785000	0.95823	0.655000	0.94253	CCC	CPS1	-	pfam_CbamoylP_synth_lsu-like_ATP-bd,pfam_ATP-grasp_carboxylate-amine,pfam_Dala_Dala_lig_C,pfscan_ATP-grasp,tigrfam_CarbamoylP_synth_lsu	ENSG00000021826		0.413	CPS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPS1	HGNC	protein_coding	OTTHUMT00000256569.5	-	0.00	63	0	C			211521321	+1	tier1	-	no_errors	ENST00000430249	ensembl	human	known	74_37	missense	5.32	89	5	SNP	1.000	T
CPSF7	79869	genome.wustl.edu	37	11	61183740	61183740	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr11:61183740G>T	ENST00000394888.4	-	6	974	c.802C>A	c.(802-804)Ccc>Acc	p.P268T	CPSF7_ENST00000340437.4_Missense_Mutation_p.P311T|CPSF7_ENST00000439958.3_Missense_Mutation_p.P259T|CPSF7_ENST00000448745.1_Missense_Mutation_p.P259T	NM_001136040.2	NP_001129512.1	Q8N684	CPSF7_HUMAN	cleavage and polyadenylation specific factor 7, 59kDa	268	Pro-rich.				gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA splicing, via spliceosome (GO:0000398)|protein tetramerization (GO:0051262)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	membrane (GO:0016020)|mRNA cleavage factor complex (GO:0005849)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.P268S(1)		breast(3)|central_nervous_system(1)|cervix(2)|endometrium(1)|kidney(2)|large_intestine(5)|lung(5)|skin(2)|upper_aerodigestive_tract(1)	22						GGAGGTGGGGGCATGAGATGC	0.612																																																	1	Substitution - Missense(1)	large_intestine(1)											51.0	55.0	53.0					11																	61183740		2202	4299	6501	SO:0001583	missense	0				CCDS8006.2, CCDS44619.1, CCDS44620.1	11q12.2	2013-06-18			ENSG00000149532	ENSG00000149532		"""RNA binding motif (RRM) containing"""	30098	protein-coding gene	gene with protein product	"""pre mRNA cleavage factor I, 59 kDa subunit"", ""cleavage factor Im complex 59 kDa subunit"""					12477932	Standard	NM_024811		Approved	FLJ12529	uc001nrp.3	Q8N684	OTTHUMG00000168198	ENST00000394888.4:c.802C>A	11.37:g.61183740G>T	ENSP00000378352:p.Pro268Thr		B3KU04|C9K0Q4|Q7Z3H9|Q9H025|Q9H9V1	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.P311T	ENST00000394888.4	37	c.931	CCDS44619.1	11	.	.	.	.	.	.	.	.	.	.	G	18.58	3.654777	0.67472	.	.	ENSG00000149532	ENST00000340437;ENST00000394888;ENST00000439958;ENST00000448745;ENST00000544147;ENST00000539952	D;D;D;D	0.87334	-2.24;-2.24;-2.24;-2.24	5.29	5.29	0.74685	.	0.064918	0.64402	D	0.000007	D	0.84334	0.5449	L	0.49126	1.545	0.80722	D	1	B;B;B;B	0.24721	0.067;0.039;0.11;0.065	B;B;B;B	0.29942	0.012;0.021;0.109;0.047	T	0.79911	-0.1603	10	0.24483	T	0.36	-4.5797	15.0193	0.71617	0.0:0.1427:0.8573:0.0	.	259;268;311;259	B4DGF8;Q8N684;Q8N684-3;Q8N684-2	.;CPSF7_HUMAN;.;.	T	311;268;259;259;34;259	ENSP00000345412:P311T;ENSP00000378352:P268T;ENSP00000397203:P259T;ENSP00000407394:P259T	ENSP00000345412:P311T	P	-	1	0	CPSF7	60940316	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	3.109000	0.50345	2.465000	0.83290	0.650000	0.86243	CCC	CPSF7	-	NULL	ENSG00000149532		0.612	CPSF7-006	KNOWN	basic|CCDS	protein_coding	CPSF7	HGNC	protein_coding	OTTHUMT00000347835.2		0.00	50	0	G	NM_024811		61183740	-1			no_errors	ENST00000340437	ensembl	human	known	74_37	missense	6.82	41	3	SNP	1.000	T
CRB2	286204	genome.wustl.edu	37	9	126133620	126133620	+	Missense_Mutation	SNP	C	C	A	rs376689681		TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr9:126133620C>A	ENST00000373631.3	+	8	2200	c.2199C>A	c.(2197-2199)ttC>ttA	p.F733L	CRB2_ENST00000373629.2_Missense_Mutation_p.F401L|CRB2_ENST00000359999.3_Missense_Mutation_p.F733L	NM_173689.5	NP_775960.4	Q5IJ48	CRUM2_HUMAN	crumbs family member 2	733	Laminin G-like 2. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cardiovascular system development (GO:0072358)|maintenance of epithelial cell apical/basal polarity (GO:0045199)|mesoderm formation (GO:0001707)|negative regulation of endopeptidase activity (GO:0010951)|notochord formation (GO:0014028)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|somitogenesis (GO:0001756)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	calcium ion binding (GO:0005509)|enzyme binding (GO:0019899)			NS(2)|breast(1)|cervix(1)|endometrium(2)|lung(11)|ovary(1)|prostate(2)|skin(3)	23						TGCTCAGCTTCGGGCCTGACC	0.692																																																	0													83.0	87.0	85.0					9																	126133620		2203	4299	6502	SO:0001583	missense	0			AK095783	CCDS6852.2	9q33.2	2014-02-06	2014-02-06		ENSG00000148204	ENSG00000148204			18688	protein-coding gene	gene with protein product		609720	"""crumbs homolog 2 (Drosophila)"""			14767562	Standard	XM_005251934		Approved	FLJ38464, FLJ16786	uc004bnx.1	Q5IJ48	OTTHUMG00000020638	ENST00000373631.3:c.2199C>A	9.37:g.126133620C>A	ENSP00000362734:p.Phe733Leu		A2A3N4|Q0QD46|Q5JS41|Q5JS43|Q6ZTA9|Q6ZWI6	Missense_Mutation	SNP	pfam_EG-like_dom,pfam_Laminin_G,pfam_EGF-like_Ca-bd_dom,superfamily_ConA-like_lec_gl_sf,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_Laminin_G,pfscan_EG-like_dom,pfscan_Laminin_G	p.F733L	ENST00000373631.3	37	c.2199	CCDS6852.2	9	.	.	.	.	.	.	.	.	.	.	.	10.32	1.318847	0.23994	.	.	ENSG00000148204	ENST00000359999;ENST00000373631;ENST00000373629	T;T;T	0.78246	-1.16;-1.16;-1.16	4.92	-9.31	0.00646	Concanavalin A-like lectin/glucanase (1);Laminin G domain (1);	0.353251	0.21164	N	0.079114	T	0.50752	0.1634	L	0.28014	0.82	0.20196	N	0.999922	B;B	0.18741	0.006;0.03	B;B	0.21360	0.005;0.034	T	0.50004	-0.8878	10	0.11182	T	0.66	.	6.4793	0.22053	0.1865:0.4081:0.0:0.4053	.	733;733	Q5IJ48;Q5IJ48-2	CRUM2_HUMAN;.	L	733;733;401	ENSP00000353092:F733L;ENSP00000362734:F733L;ENSP00000362732:F401L	ENSP00000353092:F733L	F	+	3	2	CRB2	125173441	0.006000	0.16342	0.208000	0.23602	0.716000	0.41182	-0.613000	0.05610	-1.567000	0.01671	-0.253000	0.11424	TTC	CRB2	-	superfamily_ConA-like_lec_gl_sf,smart_Laminin_G	ENSG00000148204		0.692	CRB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CRB2	HGNC	protein_coding	OTTHUMT00000053990.3	-	0.00	121	0	C	NM_173689		126133620	+1	tier1	-	no_errors	ENST00000373631	ensembl	human	known	74_37	missense	35.77	79	44	SNP	0.002	A
CSMD3	114788	genome.wustl.edu	37	8	113421171	113421171	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr8:113421171G>T	ENST00000297405.5	-	33	5730	c.5486C>A	c.(5485-5487)tCt>tAt	p.S1829Y	CSMD3_ENST00000343508.3_Missense_Mutation_p.S1789Y|CSMD3_ENST00000352409.3_Intron|CSMD3_ENST00000455883.2_Missense_Mutation_p.S1725Y	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	1829	CUB 10. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.S1829F(1)		breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						TGAGAGGGAAGATAACAGAGA	0.408										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																																							1	Substitution - Missense(1)	lung(1)											179.0	171.0	174.0					8																	113421171		2203	4300	6503	SO:0001583	missense	0			AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.5486C>A	8.37:g.113421171G>T	ENSP00000297405:p.Ser1829Tyr		Q96PZ3	Missense_Mutation	SNP	pfam_CUB_dom,pfam_Sushi_SCR_CCP,superfamily_CUB_dom,superfamily_Sushi_SCR_CCP,smart_CUB_dom,smart_Sushi_SCR_CCP,pfscan_CUB_dom,pfscan_Sushi_SCR_CCP	p.S1829Y	ENST00000297405.5	37	c.5486	CCDS6315.1	8	.	.	.	.	.	.	.	.	.	.	g	18.07	3.541408	0.65085	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000455883	T;T;T	0.18657	2.2;2.2;2.2	5.06	5.06	0.68205	CUB (5);	0.081179	0.50627	D	0.000103	T	0.43144	0.1234	L	0.60957	1.885	0.80722	D	1	D;P;D	0.62365	0.991;0.933;0.982	D;P;D	0.67382	0.926;0.866;0.951	T	0.11690	-1.0577	10	0.42905	T	0.14	.	18.6107	0.91284	0.0:0.0:1.0:0.0	.	1725;1829;1789	Q7Z407-3;Q7Z407;Q7Z407-2	.;CSMD3_HUMAN;.	Y	1789;1829;1725	ENSP00000345799:S1789Y;ENSP00000297405:S1829Y;ENSP00000412263:S1725Y	ENSP00000297405:S1829Y	S	-	2	0	CSMD3	113490347	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	6.329000	0.72920	2.630000	0.89119	0.586000	0.80456	TCT	CSMD3	-	pfam_CUB_dom,superfamily_CUB_dom,smart_CUB_dom,pfscan_CUB_dom	ENSG00000164796		0.408	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSMD3	HGNC	protein_coding	OTTHUMT00000347141.1	-	0.00	35	0	G	NM_052900		113421171	-1	tier1	-	no_errors	ENST00000297405	ensembl	human	known	74_37	missense	17.65	28	6	SNP	1.000	T
CSMD3	114788	genome.wustl.edu	37	8	114326842	114326842	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr8:114326842G>A	ENST00000297405.5	-	2	603	c.359C>T	c.(358-360)tCa>tTa	p.S120L	CSMD3_ENST00000343508.3_Missense_Mutation_p.S80L|CSMD3_ENST00000352409.3_Missense_Mutation_p.S120L|CSMD3_ENST00000455883.2_Missense_Mutation_p.S120L	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	120	CUB 1. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						ATCATATAATGATAAGTAGTC	0.343										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																																							0													133.0	127.0	129.0					8																	114326842		2203	4299	6502	SO:0001583	missense	0			AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.359C>T	8.37:g.114326842G>A	ENSP00000297405:p.Ser120Leu		Q96PZ3	Missense_Mutation	SNP	pfam_CUB_dom,pfam_Sushi_SCR_CCP,superfamily_CUB_dom,superfamily_Sushi_SCR_CCP,smart_CUB_dom,smart_Sushi_SCR_CCP,pfscan_CUB_dom,pfscan_Sushi_SCR_CCP	p.S120L	ENST00000297405.5	37	c.359	CCDS6315.1	8	.	.	.	.	.	.	.	.	.	.	G	18.43	3.623109	0.66901	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000455883;ENST00000352409	T;T;T;T	0.18338	2.22;2.22;2.22;2.22	5.72	5.72	0.89469	CUB (5);	0.000000	0.64402	D	0.000012	T	0.36826	0.0981	L	0.44542	1.39	0.39160	D	0.962387	B;D;D;D;B	0.65815	0.426;0.965;0.995;0.985;0.234	B;P;D;D;B	0.72338	0.199;0.647;0.928;0.977;0.272	T	0.06734	-1.0810	10	0.72032	D	0.01	.	18.8756	0.92334	0.0:0.0:1.0:0.0	.	120;120;120;120;80	Q7Z407-3;Q7Z407-4;Q7Z407-5;Q7Z407;Q7Z407-2	.;.;.;CSMD3_HUMAN;.	L	80;120;120;120	ENSP00000345799:S80L;ENSP00000297405:S120L;ENSP00000412263:S120L;ENSP00000343124:S120L	ENSP00000297405:S120L	S	-	2	0	CSMD3	114396018	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.823000	0.75282	2.697000	0.92050	0.557000	0.71058	TCA	CSMD3	-	pfam_CUB_dom,superfamily_CUB_dom,smart_CUB_dom,pfscan_CUB_dom	ENSG00000164796		0.343	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSMD3	HGNC	protein_coding	OTTHUMT00000347141.1	-	0.00	51	0	G	NM_052900		114326842	-1	tier1	-	no_errors	ENST00000297405	ensembl	human	known	74_37	missense	29.55	31	13	SNP	1.000	A
CSN1S1	1446	genome.wustl.edu	37	4	70798299	70798299	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr4:70798299T>C	ENST00000246891.4	+	2	75	c.26T>C	c.(25-27)cTt>cCt	p.L9P	CSN1S1_ENST00000444405.3_Missense_Mutation_p.L9P|CSN1S1_ENST00000507763.1_Missense_Mutation_p.L9P|CSN1S1_ENST00000507772.1_Missense_Mutation_p.L9P|CSN1S1_ENST00000505782.1_Missense_Mutation_p.L9P	NM_001890.1	NP_001881.1	P47710	CASA1_HUMAN	casein alpha s1	9						extracellular region (GO:0005576)|extracellular space (GO:0005615)	transporter activity (GO:0005215)			lung(5)|prostate(1)|upper_aerodigestive_tract(1)	7						CTCACCTGTCTTGTGGCTGTT	0.363																																																	0													55.0	55.0	55.0					4																	70798299		1834	4085	5919	SO:0001583	missense	0			X78416	CCDS47067.1, CCDS54769.1	4q21.1	2014-02-19	2003-01-24	2003-01-31	ENSG00000126545	ENSG00000126545			2445	protein-coding gene	gene with protein product		115450	"""casein, alpha"""	CASA, CSN1		9050925, 7619062	Standard	NM_001890		Approved		uc003hep.1	P47710	OTTHUMG00000160843	ENST00000246891.4:c.26T>C	4.37:g.70798299T>C	ENSP00000246891:p.Leu9Pro		A1A510|A1A511|E9PB60|Q4PNR5	Missense_Mutation	SNP	NULL	p.L9P	ENST00000246891.4	37	c.26	CCDS47067.1	4	.	.	.	.	.	.	.	.	.	.	T	16.58	3.163982	0.57476	.	.	ENSG00000126545	ENST00000246891;ENST00000444405;ENST00000354865;ENST00000507763;ENST00000507772;ENST00000505782	T;T;T;T;T	0.66638	-0.22;-0.17;-0.17;-0.17;-0.15	5.06	5.06	0.68205	.	0.000000	0.39985	N	0.001219	T	0.78811	0.4342	M	0.67397	2.05	0.09310	N	1.0	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.84831	0.0802	9	0.87932	D	0	-15.6299	11.5316	0.50614	0.0:0.0:0.0:1.0	.	9;9;9	E9PDQ1;E9PB60;P47710	.;.;CASA1_HUMAN	P	9	ENSP00000246891:L9P;ENSP00000413157:L9P;ENSP00000422611:L9P;ENSP00000427490:L9P;ENSP00000426684:L9P	ENSP00000246891:L9P	L	+	2	0	CSN1S1	70832888	1.000000	0.71417	0.998000	0.56505	0.691000	0.40173	3.378000	0.52432	2.036000	0.60181	0.533000	0.62120	CTT	CSN1S1	-	NULL	ENSG00000126545		0.363	CSN1S1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CSN1S1	HGNC	protein_coding	OTTHUMT00000362629.1	-	0.00	74	0	T			70798299	+1	tier1	-	no_errors	ENST00000246891	ensembl	human	known	74_37	missense	20.72	88	23	SNP	0.999	C
CSPG4	1464	genome.wustl.edu	37	15	75968270	75968270	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr15:75968270T>C	ENST00000308508.5	-	10	6682	c.6590A>G	c.(6589-6591)gAg>gGg	p.E2197G	AC105020.1_ENST00000435356.1_5'Flank|CTD-2026K11.1_ENST00000569467.1_RNA	NM_001897.4	NP_001888.2	Q6UVK1	CSPG4_HUMAN	chondroitin sulfate proteoglycan 4	2197	Cysteine-containing.|Neurite growth inhibition. {ECO:0000250}.				activation of MAPK activity (GO:0000187)|angiogenesis (GO:0001525)|carbohydrate metabolic process (GO:0005975)|cell proliferation (GO:0008283)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|intracellular signal transduction (GO:0035556)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|small molecule metabolic process (GO:0044281)|tissue remodeling (GO:0048771)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell projection (GO:0042995)|cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)	protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)			breast(1)|cervix(2)|endometrium(5)|kidney(5)|large_intestine(3)|liver(2)|lung(18)|ovary(2)|pancreas(2)|prostate(4)|skin(4)	48						GGGGCCTGGCTCGCCTGTGGG	0.662																																																	0													35.0	39.0	37.0					15																	75968270		2197	4294	6491	SO:0001583	missense	0			X96753, AY359468	CCDS10284.1	15q24.2	2010-04-19	2007-02-16		ENSG00000173546	ENSG00000173546		"""Proteoglycans / Cell surface : Other"""	2466	protein-coding gene	gene with protein product	"""melanoma-associated chondroitin sulfate proteoglycan"""	601172	"""chondroitin sulfate proteoglycan 4 (melanoma-associated)"""			8790396, 16407841	Standard	NM_001897		Approved	MCSPG, MEL-CSPG, MSK16, NG2, MCSP, HMW-MAA	uc002baw.3	Q6UVK1	OTTHUMG00000142836	ENST00000308508.5:c.6590A>G	15.37:g.75968270T>C	ENSP00000312506:p.Glu2197Gly		D3DW77|Q92675	Missense_Mutation	SNP	pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,pfscan_Laminin_G	p.E2197G	ENST00000308508.5	37	c.6590	CCDS10284.1	15	.	.	.	.	.	.	.	.	.	.	T	8.682	0.905306	0.17760	.	.	ENSG00000173546	ENST00000308508;ENST00000537176	T	0.19938	2.11	5.33	0.337	0.15966	.	1.342060	0.04703	N	0.416174	T	0.12944	0.0314	N	0.14661	0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.32214	-0.9915	10	0.23302	T	0.38	.	8.4772	0.33021	0.0:0.4175:0.0:0.5825	.	2197	Q6UVK1	CSPG4_HUMAN	G	2197;229	ENSP00000312506:E2197G	ENSP00000312506:E2197G	E	-	2	0	CSPG4	73755325	0.007000	0.16637	0.069000	0.20011	0.748000	0.42578	0.360000	0.20250	0.055000	0.16094	0.459000	0.35465	GAG	CSPG4	-	NULL	ENSG00000173546		0.662	CSPG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSPG4	HGNC	protein_coding	OTTHUMT00000286472.1	-	0.00	43	0	T	NM_001897		75968270	-1	tier1	-	no_errors	ENST00000308508	ensembl	human	known	74_37	missense	17.86	46	10	SNP	0.044	C
CTR9	9646	genome.wustl.edu	37	11	10790026	10790026	+	Silent	SNP	C	C	T	rs140813178	byFrequency	TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr11:10790026C>T	ENST00000361367.2	+	16	2523	c.2097C>T	c.(2095-2097)agC>agT	p.S699S		NM_014633.3	NP_055448.1	Q6PD62	CTR9_HUMAN	CTR9, Paf1/RNA polymerase II complex component	699					cellular response to lipopolysaccharide (GO:0071222)|endodermal cell fate commitment (GO:0001711)|histone H2B ubiquitination (GO:0033523)|histone H3-K4 trimethylation (GO:0080182)|histone monoubiquitination (GO:0010390)|interleukin-6-mediated signaling pathway (GO:0070102)|JAK-STAT cascade (GO:0007259)|negative regulation of myeloid cell differentiation (GO:0045638)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of histone H3-K79 methylation (GO:2001162)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	Cdc73/Paf1 complex (GO:0016593)|transcriptionally active chromatin (GO:0035327)				breast(4)|central_nervous_system(2)|cervix(1)|endometrium(7)|kidney(3)|large_intestine(7)|lung(12)|ovary(2)|pancreas(1)|stomach(1)	40				all cancers(16;1.64e-07)|Epithelial(150;2.47e-07)|BRCA - Breast invasive adenocarcinoma(625;0.111)		AGTACATCAGCGCCGTTCAGA	0.413																																																	0								C		2,4400	4.2+/-10.8	0,2,2199	108.0	103.0	105.0		2097	-1.7	1.0	11	dbSNP_134	105	8,8580	6.4+/-24.3	0,8,4286	no	coding-synonymous	CTR9	NM_014633.3		0,10,6485	TT,TC,CC		0.0932,0.0454,0.077		699/1174	10790026	10,12980	2201	4294	6495	SO:0001819	synonymous_variant	0			D63875	CCDS7805.1	11p15.3	2013-07-03	2013-07-03	2006-05-22	ENSG00000198730	ENSG00000198730		"""Tetratricopeptide (TTC) repeat domain containing"""	16850	protein-coding gene	gene with protein product		609366	"""SH2 domain binding protein 1 (tetratricopeptide repeat containing)"", ""Ctr9, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae)"""	SH2BP1		8590280, 8636124	Standard	NM_014633		Approved	KIAA0155, TSBP, p150TSP	uc001mja.3	Q6PD62	OTTHUMG00000165789	ENST00000361367.2:c.2097C>T	11.37:g.10790026C>T			D3DQV8|Q15015	Silent	SNP	pfam_TPR_1,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.S699	ENST00000361367.2	37	c.2097	CCDS7805.1	11																																																																																			CTR9	-	smart_TPR_repeat,pfscan_TPR-contain_dom	ENSG00000198730		0.413	CTR9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTR9	HGNC	protein_coding	OTTHUMT00000386215.1		0.00	38	0	C	NM_014633		10790026	+1			no_errors	ENST00000361367	ensembl	human	known	74_37	silent	28.12	23	9	SNP	0.991	T
CXorf30	645090	genome.wustl.edu	37	X	36317100	36317100	+	Silent	SNP	T	T	G			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chrX:36317100T>G	ENST00000378657.4	+	6	681	c.33T>G	c.(31-33)acT>acG	p.T11T		NM_001098843.4	NP_001092313.2	A6PW82	CX030_HUMAN	chromosome X open reading frame 30	11										breast(1)|lung(2)|stomach(1)	4						AGGACAGCACTTGCATTGAAA	0.343																																																	0													134.0	106.0	115.0					X																	36317100		692	1591	2283	SO:0001819	synonymous_variant	0				CCDS55396.1	Xp21.1	2014-08-07			ENSG00000205081	ENSG00000205081			27298	protein-coding gene	gene with protein product							Standard	NM_001098843		Approved		uc011mkc.3	A6PW82	OTTHUMG00000021353	ENST00000378657.4:c.33T>G	X.37:g.36317100T>G				Silent	SNP	NULL	p.T11	ENST00000378657.4	37	c.33	CCDS55396.1	X																																																																																			CXorf30	-	NULL	ENSG00000205081		0.343	CXorf30-201	KNOWN	basic|appris_principal|CCDS	protein_coding	CXorf30	HGNC	protein_coding		-	0.00	46	0	T	NP_001092313		36317100	+1	tier1	-	no_errors	ENST00000378657	ensembl	human	known	74_37	silent	30.23	60	26	SNP	0.000	G
DCBLD1	285761	genome.wustl.edu	37	6	117841079	117841079	+	Frame_Shift_Del	DEL	T	T	-			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr6:117841079delT	ENST00000338728.5	+	3	546	c.426delT	c.(424-426)ggtfs	p.G142fs	GOPC_ENST00000467125.1_Intron|DCBLD1_ENST00000368503.4_Frame_Shift_Del_p.G142fs|DCBLD1_ENST00000296955.8_Frame_Shift_Del_p.G142fs			Q8N8Z6	DCBD1_HUMAN	discoidin, CUB and LCCL domain containing 1	142	CUB. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(15)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	26		all_cancers(87;0.171)		GBM - Glioblastoma multiforme(226;0.0447)|OV - Ovarian serous cystadenocarcinoma(136;0.0921)|all cancers(137;0.125)		CTGGCCGGGGTTTTTTGCTGA	0.443																																																	0													130.0	119.0	123.0					6																	117841079		2203	4300	6503	SO:0001589	frameshift_variant	0			AK055462	CCDS34522.1	6q22.31	2003-06-20			ENSG00000164465	ENSG00000164465			21479	protein-coding gene	gene with protein product							Standard	NM_173674		Approved	MGC46341, dJ94G16.1	uc003pxs.3	Q8N8Z6	OTTHUMG00000015455	ENST00000338728.5:c.426delT	6.37:g.117841079delT	ENSP00000342422:p.Gly142fs		Q5H992|Q8IYK5|Q8N7L9|Q96NH2	Frame_Shift_Del	DEL	pfam_Coagulation_fac_5/8-C_type_dom,pfam_LCCL,pfam_CUB_dom,superfamily_Galactose-bd-like,superfamily_LCCL,superfamily_CUB_dom,smart_CUB_dom,smart_LCCL,smart_Coagulation_fac_5/8-C_type_dom,pfscan_CUB_dom,pfscan_Coagulation_fac_5/8-C_type_dom,pfscan_LCCL	p.L144fs	ENST00000338728.5	37	c.426		6																																																																																			DCBLD1	-	pfam_CUB_dom,superfamily_CUB_dom,smart_CUB_dom,pfscan_CUB_dom	ENSG00000164465		0.443	DCBLD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	DCBLD1	HGNC	protein_coding	OTTHUMT00000041979.2		0.00	58	0	T	NM_173674		117841079	+1	tier1		no_errors	ENST00000338728	ensembl	human	known	74_37	frame_shift_del	37.29	37	22	DEL	0.025	-
DCLRE1A	9937	genome.wustl.edu	37	10	115608957	115608957	+	Frame_Shift_Del	DEL	T	T	-			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr10:115608957delT	ENST00000361384.2	-	2	2824	c.1907delA	c.(1906-1908)aagfs	p.K636fs	DCLRE1A_ENST00000369305.1_Frame_Shift_Del_p.K636fs	NM_014881.3	NP_055696.3	Q6PJP8	DCR1A_HUMAN	DNA cross-link repair 1A	636					mitotic nuclear division (GO:0007067)|nucleotide-excision repair (GO:0006289)	nucleus (GO:0005634)				breast(2)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(10)|lung(8)|prostate(1)|skin(2)|urinary_tract(1)	31				Epithelial(162;0.0157)|all cancers(201;0.0171)		TCTACATCTCTTTTTTTGACG	0.368								Other identified genes with known or suspected DNA repair function																																									0													169.0	172.0	171.0					10																	115608957		2203	4300	6503	SO:0001589	frameshift_variant	0				CCDS7584.1	10q25.1	2010-06-24	2010-06-24		ENSG00000198924	ENSG00000198924			17660	protein-coding gene	gene with protein product	"""PSO2 homolog (S. cerevisiae)"""	609682	"""DNA cross-link repair 1A (PSO2 homolog, S. cerevisiae)"""			9806498, 17804464	Standard	NM_014881		Approved	SNM1, PSO2, KIAA0086, hSNM1	uc031pxf.1	Q6PJP8	OTTHUMG00000019077	ENST00000361384.2:c.1907delA	10.37:g.115608957delT	ENSP00000355185:p.Lys636fs		D3DRC1|Q14701|Q6P5Y3|Q6PKL4	Frame_Shift_Del	DEL	pfam_DRMBL	p.K636fs	ENST00000361384.2	37	c.1907	CCDS7584.1	10																																																																																			DCLRE1A	-	NULL	ENSG00000198924		0.368	DCLRE1A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	DCLRE1A	HGNC	protein_coding	OTTHUMT00000050444.1		0.00	51	0	T	NM_014881		115608957	-1	tier1		no_errors	ENST00000361384	ensembl	human	known	74_37	frame_shift_del	10.71	25	3	DEL	1.000	-
DCTN1	1639	genome.wustl.edu	37	2	74598729	74598729	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr2:74598729G>C	ENST00000361874.3	-	8	897	c.580C>G	c.(580-582)Ccc>Gcc	p.P194A	DCTN1_ENST00000409868.1_Missense_Mutation_p.P177A|DCTN1_ENST00000409567.3_Missense_Mutation_p.P174A|DCTN1_ENST00000394003.3_Missense_Mutation_p.P187A|DCTN1_ENST00000409240.1_Missense_Mutation_p.P157A|DCTN1_ENST00000409438.1_Missense_Mutation_p.P60A|DCTN1_ENST00000407639.2_Missense_Mutation_p.P60A	NM_004082.4	NP_004073.2	Q14203	DCTN1_HUMAN	dynactin 1	194					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|G2/M transition of mitotic cell cycle (GO:0000086)|melanosome transport (GO:0032402)|microtubule-based transport (GO:0010970)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|nervous system development (GO:0007399)	cell leading edge (GO:0031252)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dynactin complex (GO:0005869)|dynein complex (GO:0030286)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule (GO:0005874)|spindle pole (GO:0000922)	motor activity (GO:0003774)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(20)|ovary(4)|prostate(1)|skin(3)	45						GGGATGATGGGTGCTGCCAGC	0.657																																																	0													22.0	24.0	24.0					2																	74598729		2199	4295	6494	SO:0001583	missense	0				CCDS1939.1, CCDS46341.1, CCDS46342.1, CCDS54368.1, CCDS54369.1	2p13	2014-09-17	2010-06-24		ENSG00000204843	ENSG00000204843			2711	protein-coding gene	gene with protein product	"""p150 glued homolog (Drosophila)"""	601143	"""dynactin 1 (p150, Glued (Drosophila) homolog)"""			1828535	Standard	NM_001190836		Approved		uc002skx.3	Q14203	OTTHUMG00000129963	ENST00000361874.3:c.580C>G	2.37:g.74598729G>C	ENSP00000354791:p.Pro194Ala		A8MY36|B4DM45|E9PFS5|E9PGE1|G5E9H4|O95296|Q6IQ37|Q9BRM9|Q9UIU1|Q9UIU2	Missense_Mutation	SNP	pfam_Dynactin,pfam_CAP-Gly_domain,superfamily_CAP-Gly_domain,superfamily_Polyketide_synth_docking,superfamily_P-loop_NTPase,pfscan_CAP-Gly_domain	p.P194A	ENST00000361874.3	37	c.580	CCDS1939.1	2	.	.	.	.	.	.	.	.	.	.	G	32	5.156652	0.94686	.	.	ENSG00000204843	ENST00000361874;ENST00000394003;ENST00000393999;ENST00000407639;ENST00000409438;ENST00000409240;ENST00000409868;ENST00000409567	T;T;T;T;T;T;T	0.78816	-0.86;-0.98;-0.81;-0.81;-1.21;-1.06;-0.99	5.39	5.39	0.77823	.	0.000000	0.42964	D	0.000626	D	0.82291	0.5005	L	0.27053	0.805	0.80722	D	1	D;P;D;P;D;D	0.89917	0.999;0.584;0.999;0.92;1.0;0.999	D;B;D;P;D;D	0.87578	0.967;0.404;0.986;0.644;0.998;0.994	D	0.83910	0.0295	10	0.66056	D	0.02	-7.6315	18.0832	0.89449	0.0:0.0:1.0:0.0	.	174;157;194;187;60;60	E9PGE1;E9PFS5;Q14203;A8MY36;Q14203-2;G5E9H4	.;.;DCTN1_HUMAN;.;.;.	A	194;187;177;60;60;157;177;174	ENSP00000354791:P194A;ENSP00000377571:P187A;ENSP00000384844:P60A;ENSP00000387270:P60A;ENSP00000386406:P157A;ENSP00000387327:P177A;ENSP00000386843:P174A	ENSP00000354791:P194A	P	-	1	0	DCTN1	74452237	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.928000	0.92853	2.795000	0.96236	0.655000	0.94253	CCC	DCTN1	-	NULL	ENSG00000204843		0.657	DCTN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DCTN1	HGNC	protein_coding	OTTHUMT00000252227.3	-	0.00	96	0	G	NM_004082		74598729	-1	tier1	-	no_errors	ENST00000361874	ensembl	human	known	74_37	missense	23.81	64	20	SNP	1.000	C
DDX56	54606	genome.wustl.edu	37	7	44608558	44608558	+	Silent	SNP	G	G	T			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr7:44608558G>T	ENST00000258772.5	-	11	1433	c.1327C>A	c.(1327-1329)Cgg>Agg	p.R443R	DDX56_ENST00000431640.1_Silent_p.R403R|DDX56_ENST00000485367.1_5'UTR	NM_001257189.1|NM_019082.3	NP_001244118.1|NP_061955.1	Q9NY93	DDX56_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 56	443					ATP catabolic process (GO:0006200)|rRNA processing (GO:0006364)	membrane (GO:0016020)|nucleolus (GO:0005730)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|poly(A) RNA binding (GO:0044822)	p.R443R(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(5)|lung(5)|upper_aerodigestive_tract(1)	16						CTTGCCTCCCGAATGGCCTGC	0.537																																																	1	Substitution - coding silent(1)	lung(1)											177.0	149.0	159.0					7																	44608558		2203	4300	6503	SO:0001819	synonymous_variant	0			AJ131712	CCDS5492.1, CCDS59053.1	7p13	2012-02-23	2012-02-23		ENSG00000136271	ENSG00000136271		"""DEAD-boxes"""	18193	protein-coding gene	gene with protein product	"""nucleolar helicase of 61 kDa"""	608023	"""DEAD (Asp-Glu-Ala-Asp) box polypeptide 56"""			10749921	Standard	NM_019082		Approved	NOH61	uc003tlg.4	Q9NY93	OTTHUMG00000129211	ENST00000258772.5:c.1327C>A	7.37:g.44608558G>T			A4D2K9|C9JV95|Q6IAE2|Q9H9I8	Silent	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,pfam_Helicase/UvrB_dom,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_RNA_helicase_DEAD_Q_motif	p.R443	ENST00000258772.5	37	c.1327	CCDS5492.1	7																																																																																			DDX56	-	NULL	ENSG00000136271		0.537	DDX56-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX56	HGNC	protein_coding	OTTHUMT00000251291.1		0.00	49	0	G	NM_019082		44608558	-1			no_errors	ENST00000258772	ensembl	human	known	74_37	silent	5.66	50	3	SNP	0.254	T
DDX56	54606	genome.wustl.edu	37	7	44611155	44611155	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr7:44611155G>C	ENST00000258772.5	-	6	932	c.826C>G	c.(826-828)Ctg>Gtg	p.L276V	DDX56_ENST00000431640.1_Missense_Mutation_p.L276V|DDX56_ENST00000485367.1_5'UTR	NM_001257189.1|NM_019082.3	NP_001244118.1|NP_061955.1	Q9NY93	DDX56_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 56	276	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				ATP catabolic process (GO:0006200)|rRNA processing (GO:0006364)	membrane (GO:0016020)|nucleolus (GO:0005730)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(5)|lung(5)|upper_aerodigestive_tract(1)	16						TCCAAGAACAGGCGTAGCCGG	0.512																																																	0													76.0	71.0	73.0					7																	44611155		2203	4300	6503	SO:0001583	missense	0			AJ131712	CCDS5492.1, CCDS59053.1	7p13	2012-02-23	2012-02-23		ENSG00000136271	ENSG00000136271		"""DEAD-boxes"""	18193	protein-coding gene	gene with protein product	"""nucleolar helicase of 61 kDa"""	608023	"""DEAD (Asp-Glu-Ala-Asp) box polypeptide 56"""			10749921	Standard	NM_019082		Approved	NOH61	uc003tlg.4	Q9NY93	OTTHUMG00000129211	ENST00000258772.5:c.826C>G	7.37:g.44611155G>C	ENSP00000258772:p.Leu276Val		A4D2K9|C9JV95|Q6IAE2|Q9H9I8	Missense_Mutation	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,pfam_Helicase/UvrB_dom,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_RNA_helicase_DEAD_Q_motif	p.L276V	ENST00000258772.5	37	c.826	CCDS5492.1	7	.	.	.	.	.	.	.	.	.	.	.	22.0	4.233233	0.79688	.	.	ENSG00000136271	ENST00000258772;ENST00000431640	T;T	0.77229	-1.08;3.83	5.82	5.82	0.92795	Helicase, C-terminal (3);	0.000000	0.85682	D	0.000000	D	0.90072	0.6899	M	0.88906	2.99	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.996	D	0.90888	0.4759	10	0.59425	D	0.04	-19.1177	17.5789	0.87960	0.0:0.0:1.0:0.0	.	276;276	C9JV95;Q9NY93	.;DDX56_HUMAN	V	276	ENSP00000258772:L276V;ENSP00000393488:L276V	ENSP00000258772:L276V	L	-	1	2	DDX56	44577680	1.000000	0.71417	0.981000	0.43875	0.516000	0.34256	7.169000	0.77578	2.743000	0.94032	0.563000	0.77884	CTG	DDX56	-	pfam_Helicase_C,superfamily_P-loop_NTPase,smart_Helicase_C,pfscan_Helicase_C	ENSG00000136271		0.512	DDX56-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX56	HGNC	protein_coding	OTTHUMT00000251291.1	-	0.00	48	0	G	NM_019082		44611155	-1	tier1	-	no_errors	ENST00000258772	ensembl	human	known	74_37	missense	17.19	52	11	SNP	1.000	C
DECR1	1666	genome.wustl.edu	37	8	91057130	91057130	+	Silent	SNP	C	C	T			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr8:91057130C>T	ENST00000220764.2	+	8	880	c.792C>T	c.(790-792)ggC>ggT	p.G264G	DECR1_ENST00000522161.1_Silent_p.G255G	NM_001359.1	NP_001350.1	Q16698	DECR_HUMAN	2,4-dienoyl CoA reductase 1, mitochondrial	264					cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|protein homotetramerization (GO:0051289)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	2,4-dienoyl-CoA reductase (NADPH) activity (GO:0008670)|NADPH binding (GO:0070402)|oxidoreductase activity, acting on NAD(P)H (GO:0016651)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	15			BRCA - Breast invasive adenocarcinoma(11;0.00953)			AAATGATTGGCAGAATTCCCT	0.428																																																	0													167.0	157.0	160.0					8																	91057130		2203	4300	6503	SO:0001819	synonymous_variant	0			L26050	CCDS6250.1	8q21.3	2011-09-14			ENSG00000104325	ENSG00000104325		"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 1"""	2753	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 18C, member 1"""	222745		DECR		7818482, 19027726	Standard	NM_001359		Approved	SDR18C1	uc003yek.1	Q16698	OTTHUMG00000163829	ENST00000220764.2:c.792C>T	8.37:g.91057130C>T			B7Z6B8|Q2M304|Q93085	Silent	SNP	pfam_DH_sc/Rdtase_SDR,pfam_PKS_KR,prints_Glc/ribitol_DH	p.G264	ENST00000220764.2	37	c.792	CCDS6250.1	8																																																																																			DECR1	-	NULL	ENSG00000104325		0.428	DECR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DECR1	HGNC	protein_coding	OTTHUMT00000375822.1	-	0.00	97	0	C			91057130	+1	tier1	-	no_errors	ENST00000220764	ensembl	human	known	74_37	silent	18.07	68	15	SNP	0.095	T
DEPDC5	9681	genome.wustl.edu	37	22	32215145	32215145	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr22:32215145G>A	ENST00000382112.3	+	21	1874	c.1804G>A	c.(1804-1806)Gct>Act	p.A602T	DEPDC5_ENST00000266091.3_Missense_Mutation_p.A602T|DEPDC5_ENST00000536766.1_Missense_Mutation_p.A574T|DEPDC5_ENST00000535622.1_Missense_Mutation_p.A602T|DEPDC5_ENST00000400249.2_Missense_Mutation_p.A602T|DEPDC5_ENST00000382111.2_Missense_Mutation_p.A602T|DEPDC5_ENST00000400248.2_Missense_Mutation_p.A602T|DEPDC5_ENST00000400246.1_Missense_Mutation_p.A602T|DEPDC5_ENST00000382105.2_Missense_Mutation_p.A602T	NM_001136029.2|NM_001242896.1	NP_001129501.1|NP_001229825.1	O75140	DEPD5_HUMAN	DEP domain containing 5	602					intracellular signal transduction (GO:0035556)	cytosol (GO:0005829)|lysosomal membrane (GO:0005765)|perinuclear region of cytoplasm (GO:0048471)	GTPase activator activity (GO:0005096)			breast(1)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(24)|ovary(5)|pancreas(2)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	63						TAACCCCTTCGCTCCCTCTCG	0.542																																																	0													140.0	141.0	141.0					22																	32215145		2064	4211	6275	SO:0001583	missense	0			AB014545	CCDS43006.1, CCDS43007.1, CCDS46692.1, CCDS56229.1, CCDS74849.1	22q12.3	2013-04-29			ENSG00000100150	ENSG00000100150			18423	protein-coding gene	gene with protein product		614191				23542697, 23542701	Standard	NM_001242896		Approved	KIAA0645, DEP.5	uc011alu.2	O75140	OTTHUMG00000030926	ENST00000382112.3:c.1804G>A	22.37:g.32215145G>A	ENSP00000371546:p.Ala602Thr		A6H8V6|A8MPX9|B4DH93|B9EGN9|Q5K3V5|Q5THY9|Q5THZ0|Q5THZ1|Q5THZ3|Q68DR1|Q6MZX3|Q6PEZ1|Q9UGV8|Q9UH13	Missense_Mutation	SNP	pfam_IML1,pfam_DEP_dom,smart_DEP_dom,pfscan_DEP_dom	p.A602T	ENST00000382112.3	37	c.1804	CCDS46692.1	22	.	.	.	.	.	.	.	.	.	.	G	12.36	1.914750	0.33815	.	.	ENSG00000100150	ENST00000535622;ENST00000536766;ENST00000266091;ENST00000400249;ENST00000382109;ENST00000400246;ENST00000382105;ENST00000382112;ENST00000382111;ENST00000400248	T;T;T;T;T;T;T;T;T	0.30714	1.55;1.52;1.94;1.91;1.94;1.53;1.92;1.94;1.91	5.68	5.68	0.88126	.	0.053756	0.85682	D	0.000000	T	0.18173	0.0436	L	0.27053	0.805	0.80722	D	1	B;P;P;B;B;B	0.44429	0.139;0.725;0.835;0.179;0.032;0.112	B;B;B;B;B;B	0.26770	0.014;0.073;0.073;0.024;0.008;0.01	T	0.08472	-1.0720	10	0.15499	T	0.54	.	18.7742	0.91904	0.0:0.0:1.0:0.0	.	602;574;602;602;602;602	B9EGN9;F5GYZ8;B4DH93;O75140-4;A8MPX9;O75140	.;.;.;.;.;DEPD5_HUMAN	T	602;574;602;602;602;602;602;602;602;602	ENSP00000440210:A602T;ENSP00000441358:A574T;ENSP00000266091:A602T;ENSP00000383108:A602T;ENSP00000383105:A602T;ENSP00000371539:A602T;ENSP00000371546:A602T;ENSP00000371545:A602T;ENSP00000383107:A602T	ENSP00000266091:A602T	A	+	1	0	DEPDC5	30545145	1.000000	0.71417	0.989000	0.46669	0.789000	0.44602	7.623000	0.83113	2.676000	0.91093	0.563000	0.77884	GCT	DEPDC5	-	NULL	ENSG00000100150		0.542	DEPDC5-006	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	DEPDC5	HGNC	protein_coding	OTTHUMT00000129087.1		0.00	31	0	G	NM_014662		32215145	+1			no_errors	ENST00000266091	ensembl	human	known	74_37	missense	5.26	54	3	SNP	1.000	A
EFCAB7	84455	genome.wustl.edu	37	1	64015236	64015237	+	Intron	INS	-	-	A			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr1:64015236_64015237insA	ENST00000371088.4	+	8	1192				DLEU2L_ENST00000371086.2_Frame_Shift_Ins_p.GK48fs|DLEU2L_ENST00000340052.3_Frame_Shift_Ins_p.GK48fs	NM_032437.2	NP_115813.2	A8K855	EFCB7_HUMAN	EF-hand calcium binding domain 7								calcium ion binding (GO:0005509)			breast(1)|endometrium(4)|large_intestine(4)|lung(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	19						TATCAAAAAGGAAAAAAAAATG	0.332																																																	0																																										SO:0001627	intron_variant	0			BC015814	CCDS30737.1	1p31.3	2013-01-10			ENSG00000203965	ENSG00000203965		"""EF-hand domain containing"""	29379	protein-coding gene	gene with protein product						11347906	Standard	NM_032437		Approved	KIAA1799, RP4-534K7.1	uc001dbf.3	A8K855	OTTHUMG00000008983	ENST00000371088.4:c.947-2159->A	1.37:g.64015245_64015245dupA			Q658P0|Q96B95|Q96JM6	Frame_Shift_Ins	INS	NULL	p.N51fs	ENST00000371088.4	37	c.143_144	CCDS30737.1	1																																																																																			DLEU2L	-	NULL	ENSG00000116652		0.332	EFCAB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DLEU2L	HGNC	protein_coding	OTTHUMT00000024910.1		0.00	57	0	-	NM_032437		64015237	+1	tier1		no_errors	ENST00000340052	ensembl	human	known	74_37	frame_shift_ins	32.50	54	26	INS	0.562:0.557	A
DNAH1	25981	genome.wustl.edu	37	3	52416392	52416392	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr3:52416392G>T	ENST00000420323.2	+	50	8123	c.7862G>T	c.(7861-7863)tGg>tTg	p.W2621L		NM_015512.4	NP_056327	Q9P2D7	DYH1_HUMAN	dynein, axonemal, heavy chain 1	2621	AAA 4. {ECO:0000250}.				cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|response to mechanical stimulus (GO:0009612)	axonemal dynein complex (GO:0005858)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			cervix(2)|endometrium(18)|kidney(6)|large_intestine(3)|lung(31)|prostate(1)|urinary_tract(1)	62				BRCA - Breast invasive adenocarcinoma(193;2.02e-05)|OV - Ovarian serous cystadenocarcinoma(275;0.000207)|Kidney(197;0.0022)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		ATGTCCGAGTGGCGAGATGAT	0.567																																																	0													161.0	169.0	167.0					3																	52416392		2145	4257	6402	SO:0001583	missense	0			U61738	CCDS46842.1	3p21-p14	2008-02-05	2006-09-04		ENSG00000114841	ENSG00000114841		"""Axonemal dyneins"""	2940	protein-coding gene	gene with protein product		603332	"""dynein, axonemal, heavy polypeptide 1"""			8812413, 9256245	Standard	NM_015512		Approved	XLHSRF-1, DNAHC1, HDHC7, HL-11, HL11	uc011bef.2	Q9P2D7	OTTHUMG00000158378	ENST00000420323.2:c.7862G>T	3.37:g.52416392G>T	ENSP00000401514:p.Trp2621Leu		B0I1R6|O00436|O15435|O95491|Q6ZU48|Q86YK7|Q8TEJ4|Q92863|Q9H8E6|Q9UFW6|Q9Y4Z7	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase	p.W2621L	ENST00000420323.2	37	c.7862	CCDS46842.1	3	.	.	.	.	.	.	.	.	.	.	G	17.14	3.312815	0.60414	.	.	ENSG00000114841	ENST00000420323	T	0.30714	1.52	4.49	4.49	0.54785	.	0.000000	0.48286	D	0.000188	T	0.50735	0.1633	L	0.53671	1.685	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.44345	-0.9334	10	0.34782	T	0.22	.	17.3812	0.87405	0.0:0.0:1.0:0.0	.	2621	C9JXH6	.	L	2621	ENSP00000401514:W2621L	ENSP00000401514:W2621L	W	+	2	0	DNAH1	52391432	1.000000	0.71417	1.000000	0.80357	0.029000	0.11900	9.657000	0.98554	2.322000	0.78497	0.462000	0.41574	TGG	DNAH1	-	superfamily_P-loop_NTPase	ENSG00000114841		0.567	DNAH1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH1	HGNC	protein_coding	OTTHUMT00000350816.1	-	0.00	33	0	G	NM_015512		52416392	+1	tier1	-	no_errors	ENST00000420323	ensembl	human	known	74_37	missense	21.15	41	11	SNP	1.000	T
DNAH8	1769	genome.wustl.edu	37	6	38705616	38705616	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr6:38705616G>C	ENST00000359357.3	+	5	587	c.333G>C	c.(331-333)aaG>aaC	p.K111N	DNAH8_ENST00000449981.2_Missense_Mutation_p.K328N|DNAH8_ENST00000441566.1_Missense_Mutation_p.K111N			Q96JB1	DYH8_HUMAN	dynein, axonemal, heavy chain 8	111					cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(7)|breast(9)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(16)|large_intestine(44)|liver(4)|lung(101)|ovary(7)|pancreas(2)|prostate(8)|skin(28)|stomach(4)|upper_aerodigestive_tract(6)|urinary_tract(4)	260						GAACAGTGAAGTTAAAGACAA	0.294																																																	0													91.0	94.0	93.0					6																	38705616		2203	4300	6503	SO:0001583	missense	0			Z83806	CCDS75447.1	6p21.2	2012-04-19	2006-09-04		ENSG00000124721	ENSG00000124721		"""Axonemal dyneins"""	2952	protein-coding gene	gene with protein product		603337	"""dynein, axonemal, heavy polypeptide 8"""			9373155	Standard	NM_001206927		Approved	hdhc9	uc021yzh.1	Q96JB1	OTTHUMG00000016253	ENST00000359357.3:c.333G>C	6.37:g.38705616G>C	ENSP00000352312:p.Lys111Asn		O00438|Q5JYI2|Q5T2M3|Q5T2M4|Q5TG00|Q9UEM4	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.K111N	ENST00000359357.3	37	c.333		6	.	.	.	.	.	.	.	.	.	.	G	8.078	0.771663	0.16051	.	.	ENSG00000124721	ENST00000449981;ENST00000327475;ENST00000359357;ENST00000441566	T;T;T	0.25579	1.82;1.81;1.79	5.74	2.14	0.27477	.	0.551162	0.20272	N	0.095639	T	0.05227	0.0139	L	0.28115	0.83	0.32655	N	0.518872	B	0.02656	0.0	B	0.04013	0.001	T	0.36601	-0.9741	10	0.11794	T	0.64	.	9.6756	0.40039	0.2935:0.0:0.7065:0.0	.	111	Q96JB1	DYH8_HUMAN	N	316;316;111;111	ENSP00000333363:K316N;ENSP00000352312:K111N;ENSP00000402294:K111N	ENSP00000333363:K316N	K	+	3	2	DNAH8	38813594	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	0.790000	0.26900	0.579000	0.29504	0.585000	0.79938	AAG	DNAH8	-	NULL	ENSG00000124721		0.294	DNAH8-001	KNOWN	basic|appris_principal	protein_coding	DNAH8	HGNC	protein_coding	OTTHUMT00000043574.1	-	0.00	37	0	G	NM_001206927		38705616	+1	tier1	-	no_errors	ENST00000359357	ensembl	human	known	74_37	missense	17.02	39	8	SNP	0.998	C
DNM3	26052	genome.wustl.edu	37	1	172357927	172357927	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr1:172357927A>G	ENST00000355305.5	+	20	2675	c.2518A>G	c.(2518-2520)Agg>Ggg	p.R840G	DNM3_ENST00000358155.4_Missense_Mutation_p.R834G|DNM3_ENST00000367731.1_Missense_Mutation_p.R830G			Q9UQ16	DYN3_HUMAN	dynamin 3	840					endocytosis (GO:0006897)|filopodium assembly (GO:0046847)|GTP catabolic process (GO:0006184)|synapse assembly (GO:0007416)	dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|perinuclear region of cytoplasm (GO:0048471)|postsynaptic density (GO:0014069)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			NS(1)|breast(3)|endometrium(1)|kidney(1)|large_intestine(9)|lung(16)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	37						TAGGCCTACGAGGGCCCCGCC	0.557																																																	0													17.0	18.0	17.0					1																	172357927		1839	4087	5926	SO:0001583	missense	0			AL136712	CCDS44276.1, CCDS60356.1	1q24.1	2013-01-10			ENSG00000197959	ENSG00000197959		"""Pleckstrin homology (PH) domain containing"""	29125	protein-coding gene	gene with protein product	"""Dyna III"""	611445				10048485	Standard	NM_015569		Approved	KIAA0820	uc001gie.4	Q9UQ16	OTTHUMG00000034913	ENST00000355305.5:c.2518A>G	1.37:g.172357927A>G	ENSP00000347457:p.Arg840Gly		A9Z1Y1|O14982|O95555|Q1MTM8|Q5W129|Q6P2G1|Q9H0P3|Q9H548|Q9NQ68|Q9NQN6	Missense_Mutation	SNP	pfam_Dynamin_central,pfam_Dynamin_GTPase,pfam_GED,pfam_Pleckstrin_homology,superfamily_P-loop_NTPase,smart_Dynamin_GTPase,smart_Pleckstrin_homology,smart_GED,pfscan_Pleckstrin_homology,prints_Dynamin_SF	p.R834G	ENST00000355305.5	37	c.2500		1	.	.	.	.	.	.	.	.	.	.	A	10.31	1.313683	0.23908	.	.	ENSG00000197959	ENST00000359070;ENST00000358155;ENST00000355305;ENST00000367731;ENST00000485254	T;T;T;T	0.22539	1.95;1.95;1.95;1.95	5.52	-6.42	0.01932	.	0.000000	0.85682	D	0.000000	T	0.21509	0.0518	L	0.33485	1.01	0.80722	D	1	D;D;D	0.71674	0.998;0.989;0.989	D;D;D	0.75020	0.981;0.985;0.985	T	0.44174	-0.9345	10	0.48119	T	0.1	.	21.57	0.99956	0.2425:0.7575:0.0:0.0	.	840;830;834	Q9UQ16;Q9UQ16-2;Q9UQ16-3	DYN3_HUMAN;.;.	G	844;834;840;830;203	ENSP00000350876:R834G;ENSP00000347457:R840G;ENSP00000356705:R830G;ENSP00000429165:R203G	ENSP00000347457:R840G	R	+	1	2	DNM3	170624550	0.003000	0.15002	0.019000	0.16419	0.020000	0.10135	0.065000	0.14466	-0.531000	0.06340	-0.331000	0.08364	AGG	DNM3	-	NULL	ENSG00000197959		0.557	DNM3-003	NOVEL	not_organism_supported|basic	protein_coding	DNM3	HGNC	protein_coding	OTTHUMT00000084531.1	-	0.00	74	0	A	NM_015569		172357927	+1	tier1	-	no_errors	ENST00000358155	ensembl	human	known	74_37	missense	5.41	70	4	SNP	0.004	G
DNMT3B	1789	genome.wustl.edu	37	20	31394058	31394058	+	Missense_Mutation	SNP	A	A	T	rs564957434		TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr20:31394058A>T	ENST00000328111.2	+	22	2666	c.2345A>T	c.(2344-2346)aAa>aTa	p.K782I	DNMT3B_ENST00000443239.3_Intron|DNMT3B_ENST00000456297.2_Intron|DNMT3B_ENST00000201963.3_Missense_Mutation_p.K774I|DNMT3B_ENST00000353855.2_Missense_Mutation_p.K762I|DNMT3B_ENST00000344505.4_Intron|DNMT3B_ENST00000348286.2_Intron	NM_006892.3	NP_008823.1	Q9UBC3	DNM3B_HUMAN	DNA (cytosine-5-)-methyltransferase 3 beta	782	SAM-dependent MTase C5-type. {ECO:0000255|PROSITE-ProRule:PRU01016}.				C-5 methylation of cytosine (GO:0090116)|cellular response to amino acid stimulus (GO:0071230)|DNA methylation (GO:0006306)|DNA methylation involved in embryo development (GO:0043045)|DNA methylation on cytosine within a CG sequence (GO:0010424)|methylation-dependent chromatin silencing (GO:0006346)|negative regulation of histone H3-K9 methylation (GO:0051573)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of gene expression (GO:0010628)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of neuron differentiation (GO:0045666)|protein complex localization (GO:0031503)|regulation of gene expression by genetic imprinting (GO:0006349)|response to drug (GO:0042493)|response to ionizing radiation (GO:0010212)|S-adenosylhomocysteine metabolic process (GO:0046498)|S-adenosylmethioninamine metabolic process (GO:0046499)	chromosome, centromeric region (GO:0000775)|cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nuclear heterochromatin (GO:0005720)|nucleus (GO:0005634)	DNA (cytosine-5-)-methyltransferase activity (GO:0003886)|DNA (cytosine-5-)-methyltransferase activity, acting on CpG substrates (GO:0051718)|DNA-methyltransferase activity (GO:0009008)|metal ion binding (GO:0046872)|transcription corepressor activity (GO:0003714)|unmethylated CpG binding (GO:0045322)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(16)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						AACTCGATCAAACAGGGGAAA	0.458																																																	0													116.0	97.0	104.0					20																	31394058		2203	4300	6503	SO:0001583	missense	0				CCDS13204.1, CCDS13205.1, CCDS13206.1, CCDS13207.1, CCDS56183.1, CCDS56184.1	20q11.2	2014-09-17			ENSG00000088305	ENSG00000088305			2979	protein-coding gene	gene with protein product		602900				9662389, 10433969	Standard	NM_006892		Approved		uc002wyc.3	Q9UBC3	OTTHUMG00000032226	ENST00000328111.2:c.2345A>T	20.37:g.31394058A>T	ENSP00000328547:p.Lys782Ile		A2A2E2|B4DSM8|B4DSU1|E1P5M6|E1P5M7|E7EN63|E9PBF2|Q9UBD4|Q9UJQ5|Q9UKA6|Q9UNE5|Q9Y5R9|Q9Y5S0	Missense_Mutation	SNP	pfam_PWWP_dom,pfam_C5_MeTfrase,superfamily_Znf_FYVE_PHD,smart_PWWP_dom,pfscan_PWWP_dom	p.K782I	ENST00000328111.2	37	c.2345	CCDS13205.1	20	.	.	.	.	.	.	.	.	.	.	A	22.1	4.248144	0.80024	.	.	ENSG00000088305	ENST00000328111;ENST00000353855;ENST00000201963	D;D;D	0.96830	-4.14;-4.14;-4.14	5.47	0.635	0.17723	.	0.248603	0.45867	D	0.000324	D	0.95758	0.8620	M	0.77616	2.38	0.80722	D	1	P;P;B	0.43909	0.821;0.558;0.198	P;P;B	0.49192	0.602;0.602;0.132	D	0.93375	0.6738	10	0.66056	D	0.02	-9.6434	6.9576	0.24580	0.539:0.0:0.461:0.0	.	774;762;782	Q9UBC3-6;Q9UBC3-2;Q9UBC3	.;.;DNM3B_HUMAN	I	782;762;774	ENSP00000328547:K782I;ENSP00000313397:K762I;ENSP00000201963:K774I	ENSP00000201963:K774I	K	+	2	0	DNMT3B	30857719	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.387000	0.34430	0.336000	0.23639	-0.248000	0.11899	AAA	DNMT3B	-	NULL	ENSG00000088305		0.458	DNMT3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNMT3B	HGNC	protein_coding	OTTHUMT00000078643.2	-	0.00	66	0	A	NM_006892		31394058	+1	tier1	-	no_errors	ENST00000328111	ensembl	human	known	74_37	missense	37.21	27	16	SNP	1.000	T
DPY19L2P1	554236	genome.wustl.edu	37	7	35131480	35131480	+	RNA	SNP	A	A	T			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr7:35131480A>T	ENST00000436258.1	-	0	1889							Q6NXN4	D19P1_HUMAN	DPY19L2 pseudogene 1							integral component of membrane (GO:0016021)	transferase activity, transferring glycosyl groups (GO:0016757)										ATCTTCGTAAAGTGGATGATT	0.423																																																	0																																												0			BC066987		7p14.2	2014-03-18	2013-09-12		ENSG00000189212	ENSG00000189212			22305	pseudogene	pseudogene			"""dpy-19-like 2 pseudogene 1 (C. elegans)"""				Standard	NR_002833		Approved		uc031swy.1	Q6NXN4	OTTHUMG00000155026		7.37:g.35131480A>T			B4E2E3	RNA	SNP	-	NULL	ENST00000436258.1	37	NULL		7																																																																																			DPY19L2P1	-	-	ENSG00000189212		0.423	DPY19L2P1-002	KNOWN	basic	processed_transcript	DPY19L2P1	HGNC	pseudogene	OTTHUMT00000338113.1		0.00	86	0	A			35131480	-1			no_errors	ENST00000436258	ensembl	human	known	74_37	rna	5.19	73	4	SNP	0.997	T
DRD1	1812	genome.wustl.edu	37	5	174869480	174869480	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr5:174869480G>A	ENST00000393752.2	-	2	1615	c.623C>T	c.(622-624)gCc>gTc	p.A208V		NM_000794.3	NP_000785.1	P21728	DRD1_HUMAN	dopamine receptor D1	208					activation of adenylate cyclase activity (GO:0007190)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adult walking behavior (GO:0007628)|astrocyte development (GO:0014002)|behavioral fear response (GO:0001662)|behavioral response to cocaine (GO:0048148)|cellular response to catecholamine stimulus (GO:0071870)|cerebral cortex GABAergic interneuron migration (GO:0021853)|conditioned taste aversion (GO:0001661)|dentate gyrus development (GO:0021542)|dopamine metabolic process (GO:0042417)|dopamine transport (GO:0015872)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|glucose import (GO:0046323)|grooming behavior (GO:0007625)|habituation (GO:0046959)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|maternal behavior (GO:0042711)|mating behavior (GO:0007617)|memory (GO:0007613)|neuronal action potential (GO:0019228)|operant conditioning (GO:0035106)|peristalsis (GO:0030432)|phospholipase C-activating dopamine receptor signaling pathway (GO:0060158)|positive regulation of adenylate cyclase activity involved in G-protein coupled receptor signaling pathway (GO:0010579)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cell migration (GO:0030335)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|positive regulation of potassium ion transport (GO:0043268)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|prepulse inhibition (GO:0060134)|protein import into nucleus (GO:0006606)|regulation of dopamine metabolic process (GO:0042053)|regulation of dopamine uptake involved in synaptic transmission (GO:0051584)|response to amphetamine (GO:0001975)|response to drug (GO:0042493)|sensitization (GO:0046960)|striatum development (GO:0021756)|synapse assembly (GO:0007416)|synaptic transmission, dopaminergic (GO:0001963)|temperature homeostasis (GO:0001659)|transmission of nerve impulse (GO:0019226)|vasodilation (GO:0042311)|visual learning (GO:0008542)	endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	dopamine binding (GO:0035240)|dopamine neurotransmitter receptor activity (GO:0004952)|dopamine neurotransmitter receptor activity, coupled via Gs (GO:0001588)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	23	all_cancers(89;0.00895)|Renal(175;0.000159)|Lung NSC(126;0.00625)|all_lung(126;0.0104)	Medulloblastoma(196;0.0208)|all_neural(177;0.0277)|all_hematologic(541;0.214)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)		Acepromazine(DB01614)|Acetophenazine(DB01063)|Amoxapine(DB00543)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Cinnarizine(DB00568)|Clozapine(DB00363)|Dopamine(DB00988)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Fenoldopam(DB00800)|Flupentixol(DB00875)|Fluphenazine(DB00623)|Haloperidol(DB00502)|Iloperidone(DB04946)|Imipramine(DB00458)|L-DOPA(DB01235)|Lisuride(DB00589)|Loxapine(DB00408)|Methotrimeprazine(DB01403)|Methylergometrine(DB00353)|Mianserin(DB06148)|Minaprine(DB00805)|Mirtazapine(DB00370)|Olanzapine(DB00334)|Paliperidone(DB01267)|Pergolide(DB01186)|Perphenazine(DB00850)|Phenylpropanolamine(DB00397)|Pipotiazine(DB01621)|Pramipexole(DB00413)|Promazine(DB00420)|Propericiazine(DB01608)|Propiomazine(DB00777)|Quetiapine(DB01224)|Risperidone(DB00734)|Ropinirole(DB00268)|Rotigotine(DB05271)|Thioproperazine(DB01622)|Thioridazine(DB00679)|Thiothixene(DB01623)|Triflupromazine(DB00508)|Trimipramine(DB00726)|Ziprasidone(DB00246)	AATCATGATGGCCACAGGGAT	0.507																																																	0													161.0	153.0	156.0					5																	174869480		2203	4300	6503	SO:0001583	missense	0			X55760	CCDS4393.1	5q34-q35	2012-08-08			ENSG00000184845	ENSG00000184845		"""GPCR / Class A : Dopamine receptors"""	3020	protein-coding gene	gene with protein product		126449					Standard	NM_000794		Approved		uc003mcz.3	P21728	OTTHUMG00000130557	ENST00000393752.2:c.623C>T	5.37:g.174869480G>A	ENSP00000377353:p.Ala208Val		B2RA44|Q4QRJ0	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_7TM,prints_Dopamine_D1_rcpt,prints_GPCR_Rhodpsn,prints_Dopamine_rcpt,prints_ADR_fam	p.A208V	ENST00000393752.2	37	c.623	CCDS4393.1	5	.	.	.	.	.	.	.	.	.	.	G	11.95	1.792901	0.31685	.	.	ENSG00000184845	ENST00000393752;ENST00000329144	T	0.35421	1.31	5.54	3.77	0.43336	GPCR, rhodopsin-like superfamily (1);	0.047858	0.85682	N	0.000000	T	0.22475	0.0542	N	0.17838	0.53	0.80722	D	1	B	0.31893	0.345	B	0.37346	0.247	T	0.04509	-1.0946	10	0.02654	T	1	.	11.3574	0.49623	0.1461:0.0:0.8539:0.0	.	208	P21728	DRD1_HUMAN	V	208	ENSP00000377353:A208V	ENSP00000327652:A208V	A	-	2	0	DRD1	174802086	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	6.628000	0.74262	0.832000	0.34804	0.650000	0.86243	GCC	DRD1	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000184845		0.507	DRD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DRD1	HGNC	protein_coding	OTTHUMT00000252982.2	-	0.00	63	0	G	NM_000794		174869480	-1	tier1	-	no_errors	ENST00000393752	ensembl	human	known	74_37	missense	34.00	33	17	SNP	1.000	A
DRD2	1813	genome.wustl.edu	37	11	113285184	113285184	+	Splice_Site	SNP	C	C	A			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr11:113285184C>A	ENST00000362072.3	-	6	1068		c.e6-1		DRD2_ENST00000535984.1_Splice_Site|DRD2_ENST00000542968.1_Splice_Site|DRD2_ENST00000346454.3_Intron|DRD2_ENST00000544518.1_Splice_Site|RP11-159N11.3_ENST00000546284.1_RNA|DRD2_ENST00000355319.2_Splice_Site|DRD2_ENST00000538967.1_Splice_Site	NM_000795.3	NP_000786.1	P14416	DRD2_HUMAN	dopamine receptor D2						activation of protein kinase activity (GO:0032147)|adenohypophysis development (GO:0021984)|adenylate cyclase-inhibiting dopamine receptor signaling pathway (GO:0007195)|adult walking behavior (GO:0007628)|arachidonic acid secretion (GO:0050482)|associative learning (GO:0008306)|auditory behavior (GO:0031223)|axonogenesis (GO:0007409)|behavioral response to cocaine (GO:0048148)|behavioral response to ethanol (GO:0048149)|branching morphogenesis of a nerve (GO:0048755)|cellular calcium ion homeostasis (GO:0006874)|cerebral cortex GABAergic interneuron migration (GO:0021853)|circadian regulation of gene expression (GO:0032922)|dopamine metabolic process (GO:0042417)|feeding behavior (GO:0007631)|G-protein coupled receptor internalization (GO:0002031)|grooming behavior (GO:0007625)|intracellular signal transduction (GO:0035556)|locomotory behavior (GO:0007626)|long-term memory (GO:0007616)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of blood pressure (GO:0045776)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of circadian sleep/wake cycle, sleep (GO:0042321)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|negative regulation of dopamine receptor signaling pathway (GO:0060160)|negative regulation of dopamine secretion (GO:0033602)|negative regulation of insulin secretion (GO:0046676)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein secretion (GO:0050709)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|negative regulation of voltage-gated calcium channel activity (GO:1901386)|neurological system process involved in regulation of systemic arterial blood pressure (GO:0001976)|neuron-neuron synaptic transmission (GO:0007270)|orbitofrontal cortex development (GO:0021769)|peristalsis (GO:0030432)|phosphatidylinositol metabolic process (GO:0046488)|phospholipase C-activating dopamine receptor signaling pathway (GO:0060158)|pigmentation (GO:0043473)|positive regulation of cytokinesis (GO:0032467)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|positive regulation of dopamine uptake involved in synaptic transmission (GO:0051586)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of G-protein coupled receptor protein signaling pathway (GO:0045745)|positive regulation of growth hormone secretion (GO:0060124)|positive regulation of long-term synaptic potentiation (GO:1900273)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of receptor internalization (GO:0002092)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of urine volume (GO:0035810)|prepulse inhibition (GO:0060134)|protein localization (GO:0008104)|regulation of cAMP metabolic process (GO:0030814)|regulation of dopamine uptake involved in synaptic transmission (GO:0051584)|regulation of heart rate (GO:0002027)|regulation of locomotion involved in locomotory behavior (GO:0090325)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of phosphoprotein phosphatase activity (GO:0043666)|regulation of potassium ion transport (GO:0043266)|regulation of sodium ion transport (GO:0002028)|regulation of synapse structural plasticity (GO:0051823)|regulation of synaptic transmission, GABAergic (GO:0032228)|release of sequestered calcium ion into cytosol (GO:0051209)|response to amphetamine (GO:0001975)|response to axon injury (GO:0048678)|response to cocaine (GO:0042220)|response to drug (GO:0042493)|response to histamine (GO:0034776)|response to hypoxia (GO:0001666)|response to inactivity (GO:0014854)|response to iron ion (GO:0010039)|response to light stimulus (GO:0009416)|response to morphine (GO:0043278)|response to nicotine (GO:0035094)|response to toxic substance (GO:0009636)|sensory perception of smell (GO:0007608)|striatum development (GO:0021756)|synapse assembly (GO:0007416)|synaptic transmission, dopaminergic (GO:0001963)|temperature homeostasis (GO:0001659)|visual learning (GO:0008542)|Wnt signaling pathway (GO:0016055)	acrosomal vesicle (GO:0001669)|axon (GO:0030424)|axon terminus (GO:0043679)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|endocytic vesicle (GO:0030139)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|sperm flagellum (GO:0036126)|synaptic vesicle membrane (GO:0030672)	dopamine binding (GO:0035240)|dopamine neurotransmitter receptor activity, coupled via Gi/Go (GO:0001591)|drug binding (GO:0008144)|identical protein binding (GO:0042802)|potassium channel regulator activity (GO:0015459)			endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(5)|lung(18)|pancreas(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	39		all_cancers(61;3.91e-16)|all_epithelial(67;2.95e-09)|Melanoma(852;1.46e-05)|all_hematologic(158;0.00014)|Acute lymphoblastic leukemia(157;0.000977)|Breast(348;0.0101)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)|Prostate(24;0.0494)		BRCA - Breast invasive adenocarcinoma(274;5.77e-06)|Epithelial(105;6.66e-05)|all cancers(92;0.000307)|OV - Ovarian serous cystadenocarcinoma(223;0.216)	Acepromazine(DB01614)|Acetophenazine(DB01063)|Alizapride(DB01425)|Amantadine(DB00915)|Amisulpride(DB06288)|Amoxapine(DB00543)|Amphetamine(DB00182)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bromocriptine(DB01200)|Buspirone(DB00490)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Cinnarizine(DB00568)|Clozapine(DB00363)|Desipramine(DB01151)|Domperidone(DB01184)|Dopamine(DB00988)|Doxepin(DB01142)|Droperidol(DB00450)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Flupentixol(DB00875)|Fluphenazine(DB00623)|Fluspirilene(DB04842)|Haloperidol(DB00502)|Iloperidone(DB04946)|Imipramine(DB00458)|Ketamine(DB01221)|L-DOPA(DB01235)|Lisuride(DB00589)|Loxapine(DB00408)|Lurasidone(DB08815)|Maprotiline(DB00934)|Memantine(DB01043)|Mesoridazine(DB00933)|Methotrimeprazine(DB01403)|Metoclopramide(DB01233)|Mianserin(DB06148)|Minaprine(DB00805)|Mirtazapine(DB00370)|Molindone(DB01618)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Paliperidone(DB01267)|Pergolide(DB01186)|Perphenazine(DB00850)|Pimozide(DB01100)|Pipotiazine(DB01621)|Pramipexole(DB00413)|Prochlorperazine(DB00433)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Quetiapine(DB01224)|Remoxipride(DB00409)|Risperidone(DB00734)|Ropinirole(DB00268)|Rotigotine(DB05271)|Sertindole(DB06144)|Sulpiride(DB00391)|Tetrabenazine(DB04844)|Thioproperazine(DB01622)|Thioridazine(DB00679)|Thiothixene(DB01623)|Trifluoperazine(DB00831)|Triflupromazine(DB00508)|Trimipramine(DB00726)|Yohimbine(DB01392)|Ziprasidone(DB00246)	TACAGTTGCCCTGTGGAGTGA	0.547																																																	0													124.0	116.0	118.0					11																	113285184		2201	4296	6497	SO:0001630	splice_region_variant	0			M29066	CCDS8361.1, CCDS8362.1	11q22-q23	2012-08-08						"""GPCR / Class A : Dopamine receptors"""	3023	protein-coding gene	gene with protein product		126450					Standard	NM_000795		Approved		uc001poa.4	P14416		ENST00000362072.3:c.724-1G>T	11.37:g.113285184C>A			Q9NZR3|Q9UPA9	Splice_Site	SNP	-	e5-1	ENST00000362072.3	37	c.724-1	CCDS8361.1	11	.	.	.	.	.	.	.	.	.	.	C	20.6	4.012582	0.75161	.	.	ENSG00000149295	ENST00000355319;ENST00000362072;ENST00000544518;ENST00000542968;ENST00000538967	.	.	.	5.28	5.28	0.74379	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.904	0.92453	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	DRD2	112790394	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	7.407000	0.80029	2.451000	0.82905	0.462000	0.41574	.	DRD2	-	-	ENSG00000149295		0.547	DRD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DRD2	HGNC	protein_coding	OTTHUMT00000395834.1	-	0.00	68	0	C	NM_000795	Intron	113285184	-1	tier1	-	no_errors	ENST00000355319	ensembl	human	known	74_37	splice_site	7.84	47	4	SNP	1.000	A
DST	667	genome.wustl.edu	37	6	56437023	56437023	+	Silent	SNP	T	T	C			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr6:56437023T>C	ENST00000361203.3	-	49	12970	c.12963A>G	c.(12961-12963)gaA>gaG	p.E4321E	DST_ENST00000370788.2_Silent_p.E2235E|DST_ENST00000446842.2_Silent_p.E3997E|DST_ENST00000421834.2_Silent_p.E2235E|DST_ENST00000312431.6_3'UTR|DST_ENST00000370769.4_Silent_p.E4323E|DST_ENST00000370754.5_Silent_p.E4501E|DST_ENST00000244364.6_Silent_p.E1909E			Q03001	DYST_HUMAN	dystonin	4321					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)			NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			TATGCAAAACTTCAAGATGTT	0.333																																																	0													47.0	42.0	43.0					6																	56437023		1823	4069	5892	SO:0001819	synonymous_variant	0			M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000361203.3:c.12963A>G	6.37:g.56437023T>C			B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Silent	SNP	pfam_Spectrin_repeat,pfam_Plectin_repeat,pfam_CH-domain,pfam_GAS2_dom,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_GAS2_dom,superfamily_ABC1_TM_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Plectin_repeat,smart_EF_hand_dom,smart_GAS2_dom,pfscan_CH-domain,pfscan_EF_hand_dom	p.E4501	ENST00000361203.3	37	c.13503		6																																																																																			DST	-	superfamily_ABC1_TM_dom	ENSG00000151914		0.333	DST-004	NOVEL	not_organism_supported|basic|appris_candidate	protein_coding	DST	HGNC	protein_coding	OTTHUMT00000041021.3	-	0.00	128	0	T	NM_001723		56437023	-1	tier1	-	no_errors	ENST00000370754	ensembl	human	known	74_37	silent	29.47	67	28	SNP	1.000	C
DUOX2	50506	genome.wustl.edu	37	15	45392330	45392330	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr15:45392330G>T	ENST00000603300.1	-	24	3304	c.3102C>A	c.(3100-3102)ttC>ttA	p.F1034L	DUOX2_ENST00000389039.6_Missense_Mutation_p.F1034L	NM_014080.4	NP_054799.4	Q9NRD8	DUOX2_HUMAN	dual oxidase 2	1034	Interaction with TXNDC11. {ECO:0000250}.				adenohypophysis morphogenesis (GO:0048855)|bone mineralization (GO:0030282)|cuticle development (GO:0042335)|cytokine-mediated signaling pathway (GO:0019221)|fertilization (GO:0009566)|hormone biosynthetic process (GO:0042446)|hydrogen peroxide catabolic process (GO:0042744)|inner ear development (GO:0048839)|multicellular organism growth (GO:0035264)|oxidation-reduction process (GO:0055114)|response to cAMP (GO:0051591)|response to virus (GO:0009615)|thyroid gland development (GO:0030878)|thyroid hormone generation (GO:0006590)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|heme binding (GO:0020037)|NAD(P)H oxidase activity (GO:0016174)|peroxidase activity (GO:0004601)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(28)|ovary(3)|pancreas(1)|prostate(4)|skin(7)|urinary_tract(1)	63		all_cancers(109;3.79e-11)|all_epithelial(112;2.92e-09)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;1.05e-18)|GBM - Glioblastoma multiforme(94;4.23e-07)|COAD - Colon adenocarcinoma(120;0.0668)|Colorectal(133;0.068)		AGTTCTCCACGAAGCGCTTGT	0.562																																																	0													125.0	104.0	111.0					15																	45392330		2198	4298	6496	SO:0001583	missense	0			AF181972	CCDS10117.1	15q15.3-q21	2013-01-10			ENSG00000140279	ENSG00000140279		"""EF-hand domain containing"""	13273	protein-coding gene	gene with protein product	"""dual oxidase-like domains 2"", ""nicotinamide adenine dinucleotide phosphate oxidase"", ""flavoprotein NADPH oxidase"", ""NADPH thyroid oxidase 2"", ""NADH/NADPH thyroid oxidase p138-tox"", ""NADPH oxidase/peroxidase DUOX2"""	606759				10601291, 10806195	Standard	NM_014080		Approved	P138-TOX, P138(TOX), THOX2, LNOX2	uc010bea.3	Q9NRD8	OTTHUMG00000131355	ENST00000603300.1:c.3102C>A	15.37:g.45392330G>T	ENSP00000475084:p.Phe1034Leu		A8MQ13|D2XI64|Q9NR02|Q9UHF9	Missense_Mutation	SNP	pfam_Haem_peroxidase_animal,pfam_Fe_red_NAD-bd_6,pfam_FAD-bd_8,pfam_Fe3_Rdtase_TM_dom,pfam_EF_hand_dom,superfamily_Haem_peroxidase,superfamily_Riboflavin_synthase-like_b-brl,smart_EF_hand_dom,pfscan_EF_hand_dom,pfscan_Haem_peroxidase_animal,prints_Haem_peroxidase_animal_subgr,prints_Recoverin	p.F1034L	ENST00000603300.1	37	c.3102	CCDS10117.1	15	.	.	.	.	.	.	.	.	.	.	G	17.08	3.297503	0.60086	.	.	ENSG00000140279	ENST00000389039	.	.	.	5.45	-4.27	0.03744	.	0.045751	0.85682	D	0.000000	T	0.54367	0.1854	M	0.65975	2.015	0.58432	D	0.999992	B	0.14805	0.011	B	0.18263	0.021	T	0.40232	-0.9574	9	0.41790	T	0.15	-17.8724	13.1459	0.59461	0.5405:0.0:0.4595:0.0	.	1034	Q9NRD8	DUOX2_HUMAN	L	1034	.	ENSP00000373691:F1034L	F	-	3	2	DUOX2	43179622	0.936000	0.31750	0.956000	0.39512	0.990000	0.78478	0.160000	0.16462	-0.690000	0.05142	-0.251000	0.11542	TTC	DUOX2	-	NULL	ENSG00000140279		0.562	DUOX2-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DUOX2	HGNC	protein_coding			0.00	28	0	G	NM_014080		45392330	-1			no_errors	ENST00000389039	ensembl	human	known	74_37	missense	6.06	31	2	SNP	0.996	T
DUS2	54920	genome.wustl.edu	37	16	68112390	68112390	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr16:68112390G>T	ENST00000565263.1	+	16	1707	c.1213G>T	c.(1213-1215)Gtt>Ttt	p.V405F	DUS2_ENST00000358896.6_Missense_Mutation_p.V405F|DUS2_ENST00000432752.1_Missense_Mutation_p.V370F|RP11-67A1.2_ENST00000548144.1_RNA	NM_017803.3	NP_060273.1	Q9NX74	DUS2L_HUMAN	dihydrouridine synthase 2	405	DRBM.				negative regulation of cell death (GO:0060548)|negative regulation of protein kinase activity (GO:0006469)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|mitochondrion (GO:0005739)	double-stranded RNA binding (GO:0003725)|flavin adenine dinucleotide binding (GO:0050660)|protein kinase inhibitor activity (GO:0004860)|tRNA dihydrouridine synthase activity (GO:0017150)										TATTGTCACCGTTGCTGAACA	0.498																																																	0													193.0	174.0	180.0					16																	68112390		2198	4300	6498	SO:0001583	missense	0				CCDS10859.1, CCDS61970.1	16q22.1	2013-07-23	2013-07-23	2013-07-23	ENSG00000167264	ENSG00000167264			26014	protein-coding gene	gene with protein product	"""SMM1 homolog (S. cerevisiae)"""	609707	"""dihydrouridine synthase 2-like (SMM1, S. cerevisiae)"", ""dihydrouridine synthase 2-like, SMM1 homolog (S. cerevisiae)"", ""dihydrouridine synthase 2-like"""	DUS2L		15994936, 22741570	Standard	NM_017803		Approved	FLJ20399, SMM1	uc002evj.4	Q9NX74	OTTHUMG00000137538	ENST00000565263.1:c.1213G>T	16.37:g.68112390G>T	ENSP00000455229:p.Val405Phe		A8K3G3|Q4H4D9	Missense_Mutation	SNP	pfam_tRNA_hU_synthase,pfam_dsRNA-bd_dom,smart_dsRNA-bd_dom	p.V405F	ENST00000565263.1	37	c.1213	CCDS10859.1	16	.	.	.	.	.	.	.	.	.	.	G	18.18	3.566069	0.65651	.	.	ENSG00000167264	ENST00000358896;ENST00000432752	T;T	0.80653	-1.4;-1.4	5.93	5.93	0.95920	Double-stranded RNA-binding (2);Double-stranded RNA-binding-like (1);	0.061449	0.64402	D	0.000005	D	0.86674	0.5989	M	0.80746	2.51	0.80722	D	1	P;B	0.38800	0.648;0.271	P;B	0.49301	0.606;0.337	T	0.82719	-0.0318	10	0.19147	T	0.46	-17.6471	18.1421	0.89643	0.0:0.0:1.0:0.0	.	370;405	E7EUN9;Q9NX74	.;DUS2L_HUMAN	F	405;370	ENSP00000351769:V405F;ENSP00000409498:V370F	ENSP00000351769:V405F	V	+	1	0	DUS2L	66669891	1.000000	0.71417	1.000000	0.80357	0.936000	0.57629	4.889000	0.63171	2.826000	0.97356	0.655000	0.94253	GTT	DUS2	-	pfam_dsRNA-bd_dom,smart_dsRNA-bd_dom	ENSG00000167264		0.498	DUS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DUS2	HGNC	protein_coding	OTTHUMT00000268869.2	-	0.00	77	0	G	NM_017803		68112390	+1	tier1	-	no_errors	ENST00000358896	ensembl	human	known	74_37	missense	32.35	46	22	SNP	1.000	T
EHMT2	10919	genome.wustl.edu	37	6	31855704	31855704	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr6:31855704G>T	ENST00000375537.4	-	14	1786	c.1780C>A	c.(1780-1782)Ccg>Acg	p.P594T	EHMT2_ENST00000375530.4_Missense_Mutation_p.P560T|EHMT2_ENST00000395728.3_Missense_Mutation_p.P651T|EHMT2_ENST00000480912.1_5'UTR|EHMT2_ENST00000375528.4_Missense_Mutation_p.P617T	NM_006709.3	NP_006700.3	Q96KQ7	EHMT2_HUMAN	euchromatic histone-lysine N-methyltransferase 2	594					DNA methylation (GO:0006306)|DNA methylation on cytosine within a CG sequence (GO:0010424)|fertilization (GO:0009566)|histone methylation (GO:0016571)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|organ growth (GO:0035265)|peptidyl-lysine dimethylation (GO:0018027)|regulation of DNA replication (GO:0006275)|spermatid development (GO:0007286)|synaptonemal complex assembly (GO:0007130)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|histone methyltransferase activity (H3-K27 specific) (GO:0046976)|histone methyltransferase activity (H3-K9 specific) (GO:0046974)|histone-lysine N-methyltransferase activity (GO:0018024)|p53 binding (GO:0002039)|protein-lysine N-methyltransferase activity (GO:0016279)|zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(2)|kidney(2)|large_intestine(3)|lung(6)|ovary(2)|prostate(4)|upper_aerodigestive_tract(1)	21						TCGCAGGGCGGGCGCCGGGGT	0.667																																																	0													23.0	29.0	27.0					6																	31855704		1507	2703	4210	SO:0001583	missense	0			AF134726	CCDS4725.1, CCDS4726.1, CCDS75425.1	6p21.3	2013-01-10	2004-03-22	2005-06-09	ENSG00000204371	ENSG00000204371	2.1.1.43	"""Chromatin-modifying enzymes / K-methyltransferases"", ""Ankyrin repeat domain containing"""	14129	protein-coding gene	gene with protein product		604599	"""chromosome 6 open reading frame 30"", ""HLA-B associated transcript 8"""	C6orf30, BAT8		8457211, 11316813	Standard	XM_005274833		Approved	G9A, Em:AF134726.3, NG36/G9a, KMT1C	uc003nxz.1	Q96KQ7	OTTHUMG00000031180	ENST00000375537.4:c.1780C>A	6.37:g.31855704G>T	ENSP00000364687:p.Pro594Thr		B0UZY2|Q14349|Q5JP83|Q5JQ92|Q5JQA1|Q5JQG3|Q6PK06|Q96MH5|Q96QD0|Q9UQL8|Q9Y331	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_SET_dom,pfam_Pre-SET_dom,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_Pre-SET_Zn-bd_sub,smart_SET_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_SET_dom,pfscan_Pre-SET_dom,prints_Ankyrin_rpt	p.P651T	ENST00000375537.4	37	c.1951	CCDS4725.1	6	.	.	.	.	.	.	.	.	.	.	G	11.91	1.779591	0.31502	.	.	ENSG00000204371	ENST00000395728;ENST00000375528;ENST00000375530;ENST00000375537;ENST00000442298	T;T;T;T	0.70399	-0.48;-0.39;-0.34;-0.47	5.56	3.71	0.42584	.	0.072630	0.56097	N	0.000040	T	0.41050	0.1142	N	0.24115	0.695	0.35031	D	0.758822	B;P;P;B	0.41313	0.302;0.745;0.498;0.069	B;P;B;B	0.47376	0.213;0.545;0.244;0.024	T	0.33394	-0.9870	10	0.21540	T	0.41	.	4.4258	0.11501	0.0834:0.1569:0.5971:0.1626	.	617;560;594;408	A2ABF8;Q96KQ7-2;Q96KQ7;Q59FM7	.;.;EHMT2_HUMAN;.	T	651;617;560;594;408	ENSP00000379078:P651T;ENSP00000364678:P617T;ENSP00000364680:P560T;ENSP00000364687:P594T	ENSP00000364678:P617T	P	-	1	0	EHMT2	31963683	0.189000	0.23263	0.937000	0.37676	0.731000	0.41821	1.004000	0.29822	0.639000	0.30564	0.555000	0.69702	CCG	EHMT2	-	NULL	ENSG00000204371		0.667	EHMT2-001	KNOWN	basic|CCDS	protein_coding	EHMT2	HGNC	protein_coding	OTTHUMT00000076355.5	-	0.00	48	0	G	NM_006709		31855704	-1	tier1	-	no_errors	ENST00000395728	ensembl	human	known	74_37	missense	12.90	27	4	SNP	0.916	T
RP11-24M17.5	0	genome.wustl.edu	37	15	76071775	76071775	+	RNA	SNP	C	C	T			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr15:76071775C>T	ENST00000395215.3	+	0	287																											ACTCAAGCTCCGCAATAATCA	0.493																																																	0																																												0																															15.37:g.76071775C>T				RNA	SNP	-	NULL	ENST00000395215.3	37	NULL		15																																																																																			RP11-24M17.5	-	-	ENSG00000187812		0.493	RP11-24M17.5-001	KNOWN	basic	processed_transcript	ENSG00000187812	Clone_based_vega_gene	pseudogene	OTTHUMT00000420501.1	-	0.00	269	0	C			76071775	+1	tier1	-	no_errors	ENST00000395215	ensembl	human	known	74_37	rna	18.80	285	66	SNP	0.924	T
LOC101927209	101927209	genome.wustl.edu	37	1	142713947	142713947	+	lincRNA	SNP	A	A	C			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr1:142713947A>C	ENST00000610091.1	-	0	1711																											TTACCTCCGAAGTTAAAGAGT	0.308																																																	0																																												0																															1.37:g.142713947A>C				RNA	SNP	-	NULL	ENST00000610091.1	37	NULL		1																																																																																			RP11-417J8.6	-	-	ENSG00000203849		0.308	RP11-417J8.6-001	KNOWN	basic	lincRNA	ENSG00000203849	Clone_based_vega_gene	lincRNA	OTTHUMT00000037265.2	-	0.00	94	0	A			142713947	-1	tier1	-	no_errors	ENST00000369381	ensembl	human	known	74_37	rna	27.38	61	23	SNP	0.009	C
LOC100128554	100128554	genome.wustl.edu	37	12	126932561	126932562	+	lincRNA	DNP	CA	CA	AG			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	C|A	C|A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr12:126932561_126932562CA>AG	ENST00000397346.3	+	0	376_377																											TCCATATCCACAAGAGGCAGAA	0.441																																																	0																																												0																														Exception_encountered	12.37:g.126932561_126932562delinsAG				RNA	SNP	-	NULL	ENST00000397346.3	37	NULL		12																																																																																			RP5-944M2.3	-	-	ENSG00000214043		0.441	RP5-944M2.3-001	KNOWN	basic	lincRNA	ENSG00000214043	Clone_based_vega_gene	lincRNA	OTTHUMT00000399847.1	-	0.00	28|29	0	C|A			126932561|126932562	+1	tier1	-	no_errors	ENST00000397346	ensembl	human	known	74_37	rna	26.92|25.93	19|20	7	SNP	0.004|0.001	A|G
CDH13	1012	genome.wustl.edu	37	16	82875772	82875772	+	Intron	SNP	C	C	T			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr16:82875772C>T	ENST00000566620.1	+	2	335				RN7SL134P_ENST00000579756.1_RNA|CDH13_ENST00000446376.2_Intron|CDH13_ENST00000567445.1_Intron|CDH13_ENST00000268613.10_Intron|AC099506.1_ENST00000408468.1_RNA|CDH13_ENST00000431540.3_Intron|CDH13_ENST00000565636.1_Intron|CDH13_ENST00000428848.3_Intron	NM_001220488.1|NM_001220489.1|NM_001220490.1|NM_001257.4	NP_001207417.1|NP_001207418.1|NP_001207419.1|NP_001248.1	P55290	CAD13_HUMAN	cadherin 13						adherens junction organization (GO:0034332)|calcium-dependent cell-cell adhesion (GO:0016339)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|endothelial cell migration (GO:0043542)|homophilic cell adhesion (GO:0007156)|keratinocyte proliferation (GO:0043616)|lamellipodium assembly (GO:0030032)|localization within membrane (GO:0051668)|low-density lipoprotein particle mediated signaling (GO:0055096)|mitotic cell cycle (GO:0000278)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell proliferation (GO:0008285)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of cell migration (GO:0030335)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|Rac protein signal transduction (GO:0016601)|regulation of cell growth (GO:0001558)|regulation of endocytosis (GO:0030100)|regulation of epidermal growth factor receptor signaling pathway (GO:0042058)|Rho protein signal transduction (GO:0007266)|sprouting angiogenesis (GO:0002040)	anchored component of membrane (GO:0031225)|caveola (GO:0005901)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	adiponectin binding (GO:0055100)|cadherin binding (GO:0045296)|calcium ion binding (GO:0005509)|lipoprotein particle binding (GO:0071813)|low-density lipoprotein particle binding (GO:0030169)			large_intestine(1)	1		all_cancers(2;1.34e-11)|all_epithelial(2;4.3e-09)		COAD - Colon adenocarcinoma(5;0.0268)		tatatatacacacacacacat	0.214																																																	0																																										SO:0001627	intron_variant	0			U59288	CCDS56009.1, CCDS56010.1, CCDS58485.1, CCDS58486.1, CCDS58487.1	16q23.3	2013-08-27	2013-08-27			ENSG00000140945		"""Cadherins / Major cadherins"""	1753	protein-coding gene	gene with protein product	"""T-cadherin"", ""H-cadherin (heart)"""	601364				8673923, 9468307	Standard	NM_001257		Approved	CDHH	uc010vns.2	P55290		ENST00000566620.1:c.46-16195C>T	16.37:g.82875772C>T			A8W476|A8W477|B7Z590|C9JRI6|J3KN62|Q6GTW4|Q8TBX3	RNA	SNP	-	NULL	ENST00000566620.1	37	NULL	CCDS58486.1	16																																																																																			AC099506.1	-	-	ENSG00000221395		0.214	CDH13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000221395	Clone_based_ensembl_gene	protein_coding	OTTHUMT00000432917.1	-	0.00	22	0	C	NM_001257		82875772	+1	tier1	-	no_errors	ENST00000408468	ensembl	human	novel	74_37	rna	18.18	18	4	SNP	0.001	T
AC092329.1	0	genome.wustl.edu	37	19	23369079	23369079	+	RNA	SNP	T	T	C			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr19:23369079T>C	ENST00000408551.1	+	0	46																											cctccaAATCttgtacctgag	0.502																																																	0																																												0																															19.37:g.23369079T>C				RNA	SNP	-	NULL	ENST00000408551.1	37	NULL		19																																																																																			AC092329.1	-	-	ENSG00000221478		0.502	AC092329.1-201	NOVEL	basic	miRNA	ENSG00000221478	Clone_based_ensembl_gene	miRNA		-	0.00	114	0	T			23369079	+1	tier1	-	no_errors	ENST00000408551	ensembl	human	novel	74_37	rna	25.58	64	22	SNP	0.119	C
LSS	4047	genome.wustl.edu	37	21	47608483	47608483	+	3'UTR	SNP	C	C	A			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr21:47608483C>A	ENST00000397728.3	-	0	4812				LSS_ENST00000356396.4_3'UTR|AP001468.58_ENST00000415026.1_RNA	NM_001145436.1|NM_002340.5	NP_001138908.1|NP_002331.3	P48449	ERG7_HUMAN	lanosterol synthase (2,3-oxidosqualene-lanosterol cyclase)						cholesterol biosynthetic process (GO:0006695)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)	endoplasmic reticulum membrane (GO:0005789)|lipid particle (GO:0005811)|membrane (GO:0016020)	lanosterol synthase activity (GO:0000250)			cervix(1)|endometrium(6)|kidney(1)|large_intestine(3)|liver(1)|lung(7)|skin(1)|urinary_tract(1)	21	Breast(49;0.214)					GGTGATGAGTCATCTGGGACA	0.547																																					Pancreas(114;955 2313 34923 50507)												0																																										SO:0001624	3_prime_UTR_variant	0			U22526	CCDS13733.1, CCDS46654.1, CCDS54489.1	21q22.3	1998-05-07			ENSG00000160285	ENSG00000160285	5.4.99.7		6708	protein-coding gene	gene with protein product		600909				7639730, 8655142	Standard	NM_001001438		Approved	OSC	uc002zij.3	P48449	OTTHUMG00000090633	ENST00000397728.3:c.*2535G>T	21.37:g.47608483C>A			B4DJZ9|D3DSN0|E9PEI9|G5E9Q9|Q8IYL6|Q9UEZ1	RNA	SNP	-	NULL	ENST00000397728.3	37	NULL	CCDS13733.1	21																																																																																			AP001468.58	-	-	ENSG00000228404		0.547	LSS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000228404	Clone_based_vega_gene	protein_coding	OTTHUMT00000207274.2	-	0.00	31	0	C			47608483	+1	tier1	-	no_errors	ENST00000415026	ensembl	human	known	74_37	rna	28.57	10	4	SNP	0.001	A
RP3-470B24.5	0	genome.wustl.edu	37	6	168377339	168377339	+	lincRNA	DEL	A	A	-			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr6:168377339delA	ENST00000538528.1	-	0	280																											TCATTCCCCCAGCACTGTGCG	0.667																																																	0																																												0																															6.37:g.168377339delA				RNA	DEL	-	NULL	ENST00000538528.1	37	NULL		6																																																																																			RP3-470B24.5	-	-	ENSG00000235994		0.667	RP3-470B24.5-201	KNOWN	basic	lincRNA	ENSG00000235994	Clone_based_vega_gene	lincRNA			0.00	113	0	A			168377339	-1	tier1		no_errors	ENST00000441716	ensembl	human	known	74_37	rna	20.45	105	27	DEL	0.008	-
PCDHB17	54661	genome.wustl.edu	37	5	140535954	140535954	+	Silent	SNP	T	T	C			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr5:140535954T>C	ENST00000539533.1	+	1	378	c.378T>C	c.(376-378)gaT>gaC	p.D126D						protocadherin beta 17 pseudogene																		AGCTCCAAGATGTAAATGACC	0.423																																																	0																																										SO:0001819	synonymous_variant	0			AF152527		5q31	2010-01-26				ENSG00000255622		"""Cadherins / Protocadherins : Clustered"""	14547	pseudogene	pseudogene						10380929	Standard	NR_001280		Approved	PCDH-psi1	uc003lis.3			ENST00000539533.1:c.378T>C	5.37:g.140535954T>C				Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.D126	ENST00000539533.1	37	c.378		5																																																																																			PCDHB17	-	pfscan_Cadherin	ENSG00000255622		0.423	PCDHB17-201	KNOWN	basic|appris_principal	protein_coding	ENSG00000255622	Uniprot_gn	protein_coding		-	0.00	56	0	T			140535954	+1	tier1	-	no_errors	ENST00000539533	ensembl	human	known	74_37	silent	35.29	44	24	SNP	0.061	C
SHF	90525	genome.wustl.edu	37	15	45490862	45490862	+	Intron	SNP	T	T	C			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr15:45490862T>C	ENST00000290894.8	-	2	798				RP11-519G16.2_ENST00000560034.1_RNA|CTD-2651B20.7_ENST00000568314.1_RNA|SHF_ENST00000318390.6_Intron|CTD-2651B20.6_ENST00000563103.1_RNA	NM_138356.2	NP_612365			Src homology 2 domain containing F											endometrium(2)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)|prostate(2)	12		all_cancers(109;8.13e-11)|all_epithelial(112;6.29e-09)|Lung NSC(122;3.57e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;4.1e-16)|GBM - Glioblastoma multiforme(94;5.98e-06)		tactaaccactatacgatcac	0.542											OREG0023105	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0																																										SO:0001627	intron_variant	0			BC007586	CCDS10120.2, CCDS73721.1	15q21.1	2013-02-14			ENSG00000138606	ENSG00000138606		"""SH2 domain containing"""	25116	protein-coding gene	gene with protein product						11095946	Standard	NM_138356		Approved		uc001zuy.3	Q7M4L6	OTTHUMG00000131353	ENST00000290894.8:c.303+107A>G	15.37:g.45490862T>C		932		RNA	SNP	-	NULL	ENST00000290894.8	37	NULL	CCDS10120.2	15																																																																																			CTD-2651B20.7	-	-	ENSG00000259932		0.542	SHF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ENSG00000259932	Clone_based_vega_gene	protein_coding	OTTHUMT00000254141.2	-	0.00	14	0	T	NM_138356		45490862	-1	tier1	-	no_errors	ENST00000568314	ensembl	human	known	74_37	rna	66.67	3	6	SNP	1.000	C
RP11-23E10.4	0	genome.wustl.edu	37	16	33365566	33365566	+	RNA	SNP	C	C	G	rs574427972		TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr16:33365566C>G	ENST00000568520.1	-	0	103																											TTCACGAGGCCGCTTTCGACT	0.448																																																	0																																												0																															16.37:g.33365566C>G				RNA	SNP	-	NULL	ENST00000568520.1	37	NULL		16																																																																																			RP11-23E10.4	-	-	ENSG00000261405		0.448	RP11-23E10.4-002	KNOWN	basic	processed_transcript	ENSG00000261405	Clone_based_vega_gene	pseudogene	OTTHUMT00000432134.1	-	0.00	158	0	C			33365566	-1	tier1	-	no_errors	ENST00000568520	ensembl	human	known	74_37	rna	7.53	135	11	SNP	0.857	G
LOC102723968	102723968	genome.wustl.edu	37	13	64411550	64411550	+	lincRNA	SNP	A	A	G			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr13:64411550A>G	ENST00000607822.1	-	0	2159				RP11-394A14.4_ENST00000606894.1_lincRNA																							AAGGCAATCAAGTTGTGCAAC	0.498																																																	0																																												0																															13.37:g.64411550A>G				RNA	SNP	-	NULL	ENST00000607822.1	37	NULL		13																																																																																			RP11-394A14.4	-	-	ENSG00000272299		0.498	RP11-394A14.2-002	KNOWN	basic	lincRNA	ENSG00000272299	Clone_based_vega_gene	lincRNA	OTTHUMT00000471084.1	-	0.00	36	0	A			64411550	-1	tier1	-	no_errors	ENST00000606894	ensembl	human	known	74_37	rna	66.67	8	16	SNP	0.886	G
EPB41L1	2036	genome.wustl.edu	37	20	34776333	34776333	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr20:34776333G>T	ENST00000338074.2	+	9	1099	c.938G>T	c.(937-939)cGg>cTg	p.R313L	EPB41L1_ENST00000373946.3_Missense_Mutation_p.R282L|EPB41L1_ENST00000373950.2_Missense_Mutation_p.R216L|EPB41L1_ENST00000373941.1_Missense_Mutation_p.R313L|EPB41L1_ENST00000441639.1_Missense_Mutation_p.R251L|EPB41L1_ENST00000202028.5_Missense_Mutation_p.R251L	NM_001258329.1|NM_012156.2	NP_001245258.1|NP_036288.2	Q9H4G0	E41L1_HUMAN	erythrocyte membrane protein band 4.1-like 1	313	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				cortical actin cytoskeleton organization (GO:0030866)|synaptic transmission (GO:0007268)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extrinsic component of membrane (GO:0019898)|plasma membrane (GO:0005886)	structural molecule activity (GO:0005198)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(10)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	37	Breast(12;0.0239)					TACCGGGACCGGCTGAGAATC	0.552																																																	0													119.0	109.0	112.0					20																	34776333		2203	4300	6503	SO:0001583	missense	0			AB002336	CCDS13271.1, CCDS13272.1, CCDS58771.1	20q11.2-q12	2003-03-17			ENSG00000088367	ENSG00000088367			3378	protein-coding gene	gene with protein product		602879				9570967, 9828140	Standard	NM_012156		Approved	KIAA0338	uc002xfb.3	Q9H4G0	OTTHUMG00000032378	ENST00000338074.2:c.938G>T	20.37:g.34776333G>T	ENSP00000337168:p.Arg313Leu		O15046|Q4VXM6|Q4VXM7|Q4VXM8|Q4VXN4|Q6ZT61|Q8IUU7|Q96CV5|Q96L65	Missense_Mutation	SNP	pfam_Band_4.1_C,pfam_FERM_PH-like_C,pfam_FERM_N,pfam_FERM_central,pfam_SAB_dom,pfam_FERM-adjacent,superfamily_FERM_central,smart_Band_41_domain,pirsf_Band_41_protein,pfscan_FERM_domain,prints_Band_41_fam,prints_Ez/rad/moesin_like	p.R313L	ENST00000338074.2	37	c.938	CCDS13271.1	20	.	.	.	.	.	.	.	.	.	.	G	36	5.610363	0.96637	.	.	ENSG00000088367	ENST00000202028;ENST00000430276;ENST00000373950;ENST00000397315;ENST00000373951;ENST00000441639;ENST00000373946;ENST00000338074;ENST00000373941	D;T;D;D;D;D;D	0.87103	-2.21;-1.23;-2.21;-2.21;-2.21;-2.21;-2.21	5.75	5.75	0.90469	FERM, C-terminal PH-like domain (1);FERM domain (1);Pleckstrin homology-type (1);	.	.	.	.	D	0.91449	0.7301	L	0.42245	1.32	0.80722	D	1	P;D;P;D;D;P	0.89917	0.809;1.0;0.874;1.0;0.997;0.635	P;D;B;D;D;B	0.87578	0.555;0.996;0.327;0.998;0.995;0.215	D	0.91919	0.5546	9	0.87932	D	0	.	18.5116	0.90918	0.0:0.0:1.0:0.0	.	313;313;282;216;216;251	B7Z653;Q9H4G0;Q9H4G0-4;Q9H4G0-3;B3KUB6;Q9H4G0-2	.;E41L1_HUMAN;.;.;.;.	L	251;251;216;313;216;251;282;313;313	ENSP00000202028:R251L;ENSP00000404341:R251L;ENSP00000363061:R216L;ENSP00000399214:R251L;ENSP00000363057:R282L;ENSP00000337168:R313L;ENSP00000363052:R313L	ENSP00000202028:R251L	R	+	2	0	EPB41L1	34239747	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	8.062000	0.89475	2.721000	0.93114	0.561000	0.74099	CGG	EPB41L1	-	pfam_FERM_PH-like_C,pirsf_Band_41_protein,pfscan_FERM_domain	ENSG00000088367		0.552	EPB41L1-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EPB41L1	HGNC	protein_coding	OTTHUMT00000078978.3		0.00	45	0	G	NM_012156		34776333	+1			no_errors	ENST00000338074	ensembl	human	known	74_37	missense	5.26	36	2	SNP	1.000	T
EPHA5	2044	genome.wustl.edu	37	4	66230799	66230799	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr4:66230799T>G	ENST00000273854.3	-	12	2772	c.2172A>C	c.(2170-2172)gaA>gaC	p.E724D	EPHA5_ENST00000432638.2_Missense_Mutation_p.E561D|EPHA5_ENST00000354839.4_Missense_Mutation_p.E702D|EPHA5_ENST00000511294.1_Missense_Mutation_p.E725D	NM_001281765.1|NM_004439.5	NP_001268694.1|NP_004430.4	P54756	EPHA5_HUMAN	EPH receptor A5	724	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon guidance (GO:0007411)|cAMP-mediated signaling (GO:0019933)|ephrin receptor signaling pathway (GO:0048013)|hippocampus development (GO:0021766)|negative regulation of synapse assembly (GO:0051964)|neuron development (GO:0048666)|positive regulation of CREB transcription factor activity (GO:0032793)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|regulation of Rac GTPase activity (GO:0032314)	dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|rough endoplasmic reticulum (GO:0005791)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|GPI-linked ephrin receptor activity (GO:0005004)|transmembrane-ephrin receptor activity (GO:0005005)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(25)|liver(1)|lung(76)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	142						TGATACTTGCTTCACCTAGGA	0.393										TSP Lung(17;0.13)																																							0													235.0	224.0	228.0					4																	66230799		2203	4300	6503	SO:0001583	missense	0			L36644	CCDS3513.1, CCDS3514.1, CCDS75131.1, CCDS75132.1, CCDS75133.1	4q13.1	2013-02-11	2004-10-28		ENSG00000145242	ENSG00000145242		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3389	protein-coding gene	gene with protein product		600004	"""EphA5"""			9267020, 7528718	Standard	NM_004439		Approved	Hek7, TYRO4, CEK7, EHK1	uc003hcy.3	P54756	OTTHUMG00000129273	ENST00000273854.3:c.2172A>C	4.37:g.66230799T>G	ENSP00000273854:p.Glu724Asp		Q7Z3F2	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ephrin_rcpt_lig-bd_dom,pfam_Prot_kinase_dom,pfam_Fibronectin_type3,pfam_SAM_type1,pfam_SAM_2,superfamily_Galactose-bd-like,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_SAM/pointed,superfamily_Growth_fac_rcpt_N_dom,smart_Ephrin_rcpt_lig-bd_dom,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_SAM,pirsf_Tyr_kinase_ephrin_rcpt,pfscan_Fibronectin_type3,pfscan_SAM,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.E724D	ENST00000273854.3	37	c.2172	CCDS3513.1	4	.	.	.	.	.	.	.	.	.	.	T	20.6	4.016595	0.75161	.	.	ENSG00000145242	ENST00000273854;ENST00000432638;ENST00000354839;ENST00000511294	T;T;T;T	0.81163	-1.46;-1.46;-1.46;-1.46	5.76	5.76	0.90799	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000010	D	0.91321	0.7263	H	0.95224	3.64	0.58432	D	0.999994	P;P;P;P	0.48764	0.708;0.915;0.66;0.888	B;P;B;B	0.55545	0.399;0.778;0.278;0.335	D	0.93676	0.6994	10	0.87932	D	0	.	16.0723	0.80943	0.0:0.0:0.0:1.0	.	703;725;702;724	B7ZKW7;B7ZKJ3;P54756-2;P54756	.;.;.;EPHA5_HUMAN	D	724;561;702;725	ENSP00000273854:E724D;ENSP00000389208:E561D;ENSP00000346899:E702D;ENSP00000427638:E725D	ENSP00000273854:E724D	E	-	3	2	EPHA5	65913394	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	2.760000	0.47581	2.199000	0.70637	0.528000	0.53228	GAA	EPHA5	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Tyr_kinase_ephrin_rcpt,pfscan_Prot_kinase_dom	ENSG00000145242		0.393	EPHA5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EPHA5	HGNC	protein_coding	OTTHUMT00000251388.2	-	0.00	108	0	T	NM_004439		66230799	-1	tier1	-	no_errors	ENST00000273854	ensembl	human	known	74_37	missense	23.81	64	20	SNP	1.000	G
EPS15L1	58513	genome.wustl.edu	37	19	16472781	16472781	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr19:16472781C>T	ENST00000248070.6	-	23	2534	c.2395G>A	c.(2395-2397)Gta>Ata	p.V799I	EPS15L1_ENST00000535753.2_Silent_p.L754L|EPS15L1_ENST00000455140.2_Missense_Mutation_p.V799I|EPS15L1_ENST00000594975.1_Silent_p.L756L	NM_021235.2	NP_067058.1	Q9UBC2	EP15R_HUMAN	epidermal growth factor receptor pathway substrate 15-like 1	799	15 X 3 AA repeats of D-P-F.|Pro-rich.				endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)	clathrin coat of coated pit (GO:0030132)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(3)|lung(12)|ovary(4)|skin(2)	30						AGCTGGCTTACAGGTGTACTT	0.507																																																	0													26.0	35.0	32.0					19																	16472781		2202	4300	6502	SO:0001583	missense	0			AF110265	CCDS32944.1, CCDS58653.1, CCDS58654.1, CCDS59363.1	19p13.12	2013-01-10				ENSG00000127527		"""EF-hand domain containing"""	24634	protein-coding gene	gene with protein product							Standard	NM_001258374		Approved	eps15R	uc002ndx.4	Q9UBC2		ENST00000248070.6:c.2395G>A	19.37:g.16472781C>T	ENSP00000248070:p.Val799Ile		A2RRF3|A5PL29|B4DKA3	Missense_Mutation	SNP	superfamily_Prefoldin,smart_EPS15_homology,smart_EF_hand_dom,smart_Ubiquitin-int_motif,pfscan_EF_hand_dom,pfscan_EPS15_homology,pfscan_Ubiquitin-int_motif	p.V799I	ENST00000248070.6	37	c.2395	CCDS32944.1	19	.	.	.	.	.	.	.	.	.	.	C	10.02	1.236418	0.22711	.	.	ENSG00000127527	ENST00000455140;ENST00000248070	T;T	0.53857	0.6;0.6	4.63	3.6	0.41247	.	0.068305	0.64402	N	0.000019	T	0.52386	0.1731	N	0.25286	0.73	0.80722	D	1	D;B	0.64830	0.994;0.2	D;B	0.70716	0.97;0.061	T	0.41538	-0.9503	10	0.10636	T	0.68	.	11.8017	0.52130	0.0:0.9147:0.0:0.0853	.	799;799	Q9UBC2;G3V0H2	EP15R_HUMAN;.	I	799	ENSP00000393313:V799I;ENSP00000248070:V799I	ENSP00000248070:V799I	V	-	1	0	EPS15L1	16333781	1.000000	0.71417	0.984000	0.44739	0.992000	0.81027	4.444000	0.60001	0.968000	0.38212	0.561000	0.74099	GTA	EPS15L1	-	NULL	ENSG00000127527		0.507	EPS15L1-006	KNOWN	basic|CCDS	protein_coding	EPS15L1	HGNC	protein_coding	OTTHUMT00000461040.1	-	0.00	96	0	C	NM_021235		16472781	-1	tier1	-	no_errors	ENST00000455140	ensembl	human	known	74_37	missense	26.26	72	26	SNP	0.998	T
EPSTI1	94240	genome.wustl.edu	37	13	43469163	43469163	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr13:43469163C>T	ENST00000398762.3	-	11	929	c.930G>A	c.(928-930)atG>atA	p.M310I	EPSTI1_ENST00000313640.7_Missense_Mutation_p.M310I|EPSTI1_ENST00000313624.7_Missense_Mutation_p.M299I			Q96J88	ESIP1_HUMAN	epithelial stromal interaction 1 (breast)	310										endometrium(2)|kidney(1)|large_intestine(1)|lung(11)|ovary(1)|skin(1)	17		Lung NSC(96;3.6e-06)|Breast(139;0.00869)|Prostate(109;0.0181)|Lung SC(185;0.0262)|Hepatocellular(98;0.114)		GBM - Glioblastoma multiforme(144;0.000528)|BRCA - Breast invasive adenocarcinoma(63;0.0858)		TACCGCTATTCATATTCCAAC	0.358																																																	0													57.0	57.0	57.0					13																	43469163		2203	4300	6503	SO:0001583	missense	0			AF396928	CCDS9387.1, CCDS31964.1	13q13.3	2011-06-27			ENSG00000133106	ENSG00000133106			16465	protein-coding gene	gene with protein product	"""epithelial stromal interaction protein 1"""	607441				11991720	Standard	NM_033255		Approved	BRESI1, MGC29634	uc001uyw.2	Q96J88	OTTHUMG00000016814	ENST00000398762.3:c.930G>A	13.37:g.43469163C>T	ENSP00000381746:p.Met310Ile		Q8IVC7|Q8NDQ7	Missense_Mutation	SNP	NULL	p.M310I	ENST00000398762.3	37	c.930	CCDS9387.1	13	.	.	.	.	.	.	.	.	.	.	C	17.31	3.357630	0.61293	.	.	ENSG00000133106	ENST00000313640;ENST00000313624;ENST00000398762	T	0.28895	1.59	5.41	4.55	0.56014	.	0.390815	0.26563	N	0.023664	T	0.35128	0.0921	M	0.65975	2.015	0.28222	N	0.926485	P;P	0.38078	0.573;0.617	B;B	0.38378	0.272;0.173	T	0.35301	-0.9794	10	0.62326	D	0.03	-3.8408	13.6672	0.62403	0.0:0.8447:0.1553:0.0	.	299;310	Q96J88-2;Q96J88-3	.;.	I	310;299;310	ENSP00000318982:M310I	ENSP00000318643:M299I	M	-	3	0	EPSTI1	42367163	1.000000	0.71417	0.997000	0.53966	0.975000	0.68041	4.571000	0.60879	1.391000	0.46566	0.561000	0.74099	ATG	EPSTI1	-	NULL	ENSG00000133106		0.358	EPSTI1-010	PUTATIVE	basic|CCDS	protein_coding	EPSTI1	HGNC	protein_coding	OTTHUMT00000400321.1	-	0.00	90	0	C	NM_001002264		43469163	-1	tier1	-	no_errors	ENST00000313640	ensembl	human	known	74_37	missense	57.14	18	24	SNP	1.000	T
ERCC6L	54821	genome.wustl.edu	37	X	71427369	71427369	+	Silent	SNP	C	C	T			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chrX:71427369C>T	ENST00000334463.3	-	2	1383	c.1248G>A	c.(1246-1248)ctG>ctA	p.L416L	ERCC6L_ENST00000373657.1_Silent_p.L293L|PIN4_ENST00000423432.2_Intron	NM_017669.2	NP_060139.2	Q2NKX8	ERC6L_HUMAN	excision repair cross-complementation group 6-like	416					mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	cytosol (GO:0005829)|kinetochore (GO:0000776)|membrane (GO:0016020)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			breast(2)|cervix(1)|endometrium(9)|kidney(4)|large_intestine(9)|lung(9)|ovary(3)|skin(1)	38	Renal(35;0.156)					GTGCAGACAGCAGCCTAGGAT	0.458																																																	0													92.0	85.0	87.0					X																	71427369		2203	4300	6503	SO:0001819	synonymous_variant	0			AK000112	CCDS35329.1	Xq13.1	2014-03-07	2014-03-07		ENSG00000186871	ENSG00000186871			20794	protein-coding gene	gene with protein product	"""PLK1-interacting checkpoint helicase"""	300687	"""excision repair cross-complementing rodent repair deficiency, complementation group 6-like"""			17218258	Standard	NM_017669		Approved	FLJ20105, PICH, RAD26L	uc004eaq.1	Q2NKX8	OTTHUMG00000021810	ENST00000334463.3:c.1248G>A	X.37:g.71427369C>T			Q8NCI1|Q96H93|Q9NXQ8	Silent	SNP	pfam_SNF2_N,pfam_Helicase_C,pfam_Helicase/UvrB_dom,pfam_DNA/RNA_helicase_DEAD/DEAH_N,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_TPR-contain_dom,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.L416	ENST00000334463.3	37	c.1248	CCDS35329.1	X																																																																																			ERCC6L	-	superfamily_P-loop_NTPase	ENSG00000186871		0.458	ERCC6L-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ERCC6L	HGNC	protein_coding	OTTHUMT00000057174.2		0.00	17	0	C	NM_017669		71427369	-1			no_errors	ENST00000334463	ensembl	human	known	74_37	silent	14.81	23	4	SNP	0.993	T
ERCC6L2	375748	genome.wustl.edu	37	9	98717101	98717101	+	Intron	SNP	C	C	G			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr9:98717101C>G	ENST00000288985.7	+	13	2185				ERCC6L2_ENST00000466840.1_Intron|ERCC6L2_ENST00000437817.1_Intron	NM_001010895.2	NP_001010895.1	Q5T890	ER6L2_HUMAN	excision repair cross-complementation group 6-like 2						DNA repair (GO:0006281)	cytoskeleton (GO:0005856)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|DNA binding (GO:0003677)										AGTACCTTACCCCTGGTGGTG	0.502																																																	0																																										SO:0001627	intron_variant	0			BC022957	CCDS35072.1	9q22.32	2014-03-07	2014-03-07	2012-03-30	ENSG00000182150	ENSG00000182150			26922	protein-coding gene	gene with protein product		615667	"""chromosome 9 open reading frame 102"", ""excision repair cross-complementing rodent repair deficiency, complementation group 6-like 2"""	C9orf102			Standard	NM_001010895		Approved	FLJ37706, RAD26L	uc004avt.4	Q5T890	OTTHUMG00000020289	ENST00000288985.7:c.1881-1095C>G	9.37:g.98717101C>G			A4D997|B2RTP8|Q49AM9|Q5T892|Q8N663|Q8N9D0|Q9NPM7	Missense_Mutation	SNP	pfam_SNF2_N,pfam_Helicase_C,superfamily_P-loop_NTPase,smart_Helicase_C,pfscan_Helicase_C	p.P340A	ENST00000288985.7	37	c.1018	CCDS35072.1	9	.	.	.	.	.	.	.	.	.	.	C	11.70	1.717301	0.30413	.	.	ENSG00000182150	ENST00000405401	.	.	.	2.7	1.78	0.24846	.	.	.	.	.	T	0.42562	0.1208	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.36601	-0.9741	5	0.87932	D	0	.	7.6689	0.28447	0.0:0.739:0.261:0.0	.	.	.	.	A	340	.	ENSP00000384241:P340A	P	+	1	0	C9orf102	97756922	0.000000	0.05858	0.001000	0.08648	0.003000	0.03518	-0.005000	0.12855	0.694000	0.31654	0.467000	0.42956	CCC	ERCC6L2	-	pfscan_Helicase_C	ENSG00000182150		0.502	ERCC6L2-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	ERCC6L2	HGNC	protein_coding	OTTHUMT00000053247.2	-	0.00	82	0	C	NM_001010895		98717101	+1	tier1	-	no_errors	ENST00000456993	ensembl	human	known	74_37	missense	32.76	39	19	SNP	0.001	G
EYS	346007	genome.wustl.edu	37	6	65300523	65300523	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr6:65300523A>G	ENST00000370621.3	-	26	5763	c.5237T>C	c.(5236-5238)tTt>tCt	p.F1746S	EYS_ENST00000370616.2_Missense_Mutation_p.F1746S|EYS_ENST00000503581.1_Missense_Mutation_p.F1746S			Q5T1H1	EYS_HUMAN	eyes shut homolog (Drosophila)	1746					detection of light stimulus involved in visual perception (GO:0050908)|skeletal muscle tissue regeneration (GO:0043403)	extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(42)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	69						GTTTAACTCAAAATCCAGAGA	0.353																																																	0													39.0	36.0	37.0					6																	65300523		692	1590	2282	SO:0001583	missense	0				CCDS4967.1, CCDS47445.1, CCDS47446.1	6q12	2014-01-28	2008-10-20	2008-10-20	ENSG00000188107	ENSG00000188107			21555	protein-coding gene	gene with protein product		612424	"""chromosome 6 open reading frame 180"", ""EGF-like-domain, multiple 11"", ""retinitis pigmentosa 25 (autosomal recessive)"", ""EGF-like-domain, multiple 10"", ""chromosome 6 open reading frame 178"", ""chromosome 6 open reading frame 179"""	C6orf180, EGFL11, RP25, EGFL10, C6orf178, C6orf179		18836446, 18976725	Standard	NM_001142800		Approved	dJ1018A4.2, bA166P24.2, SPAM, bA307F22.3, dJ303F19.1, bA74E24.1	uc011dxu.1	Q5T1H1	OTTHUMG00000014971	ENST00000370621.3:c.5237T>C	6.37:g.65300523A>G	ENSP00000359655:p.Phe1746Ser		A2RUR2|A8MVE7|B7TYK8|B7UUQ3|B7ZBE7|B7ZBE8|B7ZBR3|B9ZVD2|Q5SZM4|Q5T3C8|Q5T669|Q5TEL3|Q5TEL4|Q5VVG4|Q6UY05|Q9H557|Q9NQ15	Missense_Mutation	SNP	pfam_Laminin_G,pfam_EG-like_dom,superfamily_ConA-like_lec_gl_sf,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_Laminin_G,pfscan_EG-like_dom,pfscan_Laminin_G	p.F1746S	ENST00000370621.3	37	c.5237		6	.	.	.	.	.	.	.	.	.	.	A	4.167	0.029539	0.08054	.	.	ENSG00000188107	ENST00000503581;ENST00000370621;ENST00000370616	D;D;D	0.84442	-1.85;-1.83;-1.83	5.71	3.29	0.37713	.	.	.	.	.	T	0.56949	0.2020	N	0.08118	0	0.19300	N	0.99998	P;P	0.43169	0.8;0.533	B;B	0.43331	0.416;0.237	T	0.54289	-0.8316	9	0.72032	D	0.01	.	6.4881	0.22099	0.7625:0.1573:0.0803:0.0	.	1746;1746	Q5T1H1-1;Q5T1H1	.;EYS_HUMAN	S	1746	ENSP00000424243:F1746S;ENSP00000359655:F1746S;ENSP00000359650:F1746S	ENSP00000359650:F1746S	F	-	2	0	EYS	65357244	0.001000	0.12720	0.003000	0.11579	0.008000	0.06430	0.887000	0.28254	0.426000	0.26116	0.482000	0.46254	TTT	EYS	-	NULL	ENSG00000188107		0.353	EYS-001	KNOWN	basic	protein_coding	EYS	HGNC	protein_coding	OTTHUMT00000351351.3	-	0.00	72	0	A	XM_294050		65300523	-1	tier1	-	no_errors	ENST00000370616	ensembl	human	known	74_37	missense	33.72	57	29	SNP	0.033	G
FAM189A1	23359	genome.wustl.edu	37	15	29428638	29428638	+	Silent	SNP	G	G	A			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr15:29428638G>A	ENST00000261275.4	-	7	857	c.858C>T	c.(856-858)ccC>ccT	p.P286P		NM_015307.1	NP_056122.1	O60320	F1891_HUMAN	family with sequence similarity 189, member A1	286	Pro-rich.					integral component of membrane (GO:0016021)				central_nervous_system(2)|endometrium(2)|kidney(1)|lung(1)|stomach(1)	7						AGAGCAGGCCGGGGCTATTGA	0.617																																																	0													46.0	42.0	43.0					15																	29428638		692	1591	2283	SO:0001819	synonymous_variant	0				CCDS45198.1	15q12	2014-02-12				ENSG00000104059			29075	protein-coding gene	gene with protein product	"""transmembrane protein 228"""					9628581	Standard	NM_015307		Approved	KIAA0574, TMEM228	uc010azk.1	O60320		ENST00000261275.4:c.858C>T	15.37:g.29428638G>A			A0PK09	Silent	SNP	pfam_CD20-like	p.P286	ENST00000261275.4	37	c.858	CCDS45198.1	15																																																																																			FAM189A1	-	NULL	ENSG00000104059		0.617	FAM189A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM189A1	HGNC	protein_coding	OTTHUMT00000417254.1	-	0.00	99	0	G	NM_015307		29428638	-1	tier1	-	no_errors	ENST00000261275	ensembl	human	known	74_37	silent	29.09	78	32	SNP	0.426	A
FAM205B	389715	genome.wustl.edu	37	9	34834109	34834109	+	RNA	SNP	T	T	C	rs201637043	byFrequency	TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr9:34834109T>C	ENST00000455647.2	-	0	2284							Q63HN1	F205B_HUMAN	family with sequence similarity 205, member B																		GATGTAGGTCTGGGTCACTTG	0.547													T|||	1619	0.323283	0.4244	0.196	5008	,	,		14476	0.3919		0.1819	False		,,,				2504	0.3517																0																																												0					9p13.3	2013-05-22	2011-08-15	2011-08-15	ENSG00000257198	ENSG00000257198			24504	other	unknown			"""chromosome 9 open reading frame 144"""	C9orf144			Standard	NR_024481		Approved	DKFZp434J193, C9orf144A	uc003zvp.4	Q63HN1	OTTHUMG00000019839		9.37:g.34834109T>C			Q6ZRJ7	RNA	SNP	-	NULL	ENST00000455647.2	37	NULL		9																																																																																			FAM205B	-	-	ENSG00000257198		0.547	FAM205B-001	KNOWN	basic	processed_transcript	FAM205B	HGNC	pseudogene	OTTHUMT00000052246.5		0.00	40	0	T	NR_024481		34834109	-1			no_errors	ENST00000455647	ensembl	human	known	74_37	rna	50.00	9	9	SNP	0.000	C
FAM208A	23272	genome.wustl.edu	37	3	56661674	56661674	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr3:56661674T>G	ENST00000493960.2	-	20	3976	c.3966A>C	c.(3964-3966)ttA>ttC	p.L1322F	FAM208A_ENST00000485156.1_5'Flank|FAM208A_ENST00000431842.2_Missense_Mutation_p.L885F|FAM208A_ENST00000355628.5_Missense_Mutation_p.L1261F	NM_001112736.1	NP_001106207.1	Q9UK61	F208A_HUMAN	family with sequence similarity 208, member A	1322							poly(A) RNA binding (GO:0044822)			NS(1)|breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(4)|lung(11)|prostate(3)|skin(1)	32						CAGATACAAATAATTCATTGT	0.378																																																	0													104.0	102.0	103.0					3																	56661674		2203	4300	6503	SO:0001583	missense	0			AF180425	CCDS2877.1, CCDS46853.1	3p14.3	2011-09-14	2011-09-14	2011-09-14	ENSG00000163946	ENSG00000163946			30314	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 63"""	C3orf63		10470851, 11149944	Standard	NM_015224		Approved	se89-1, RAP140, KIAA1105	uc003die.4	Q9UK61	OTTHUMG00000158827	ENST00000493960.2:c.3966A>C	3.37:g.56661674T>G	ENSP00000417509:p.Leu1322Phe		A1L3A4|B5ME28|Q9H2F7|Q9UPP7	Missense_Mutation	SNP	pfam_DUF3715	p.L1261F	ENST00000493960.2	37	c.3783	CCDS46853.1	3	.	.	.	.	.	.	.	.	.	.	T	18.26	3.584114	0.65992	.	.	ENSG00000163946	ENST00000431842;ENST00000493960;ENST00000355628	T;T;T	0.57436	0.4;0.4;0.4	5.56	-2.97	0.05530	.	0.000000	0.47852	D	0.000219	T	0.62527	0.2435	M	0.77313	2.365	0.33281	D	0.562323	D;D;D;D	0.89917	0.999;1.0;1.0;0.999	D;D;D;D	0.97110	0.988;1.0;0.999;0.922	T	0.64846	-0.6311	10	0.72032	D	0.01	-8.8652	3.7871	0.08704	0.1035:0.4172:0.2069:0.2725	.	1322;1261;885;1322	Q9UK61-3;Q9UK61-4;Q9UK61-2;Q9UK61	.;.;.;F208A_HUMAN	F	885;1322;1261	ENSP00000399410:L885F;ENSP00000417509:L1322F;ENSP00000347845:L1261F	ENSP00000347845:L1261F	L	-	3	2	C3orf63	56636714	0.437000	0.25593	0.984000	0.44739	0.988000	0.76386	-0.369000	0.07533	-0.327000	0.08551	-0.326000	0.08463	TTA	FAM208A	-	NULL	ENSG00000163946		0.378	FAM208A-004	PUTATIVE	basic|appris_principal|CCDS	protein_coding	FAM208A	HGNC	protein_coding	OTTHUMT00000352352.2	-	0.00	44	0	T	NM_015224		56661674	-1	tier1	-	no_errors	ENST00000355628	ensembl	human	known	74_37	missense	20.73	65	17	SNP	0.385	G
FAT1	2195	genome.wustl.edu	37	4	187628224	187628224	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr4:187628224C>T	ENST00000441802.2	-	2	2967	c.2758G>A	c.(2758-2760)Gtt>Att	p.V920I		NM_005245.3	NP_005236.2	Q14517	FAT1_HUMAN	FAT atypical cadherin 1	920	Cadherin 7. {ECO:0000255|PROSITE- ProRule:PRU00043}.				actin filament organization (GO:0007015)|anatomical structure morphogenesis (GO:0009653)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(38)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(33)|lung(88)|ovary(13)|pancreas(2)|prostate(16)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	228						TTGTCATTAACATCTTCTAGT	0.473										HNSCC(5;0.00058)																											Colon(197;1040 2055 4143 4984 49344)												0													224.0	219.0	220.0					4																	187628224		1958	4157	6115	SO:0001583	missense	0			X87241	CCDS47177.1	4q35.2	2013-05-31	2013-05-31	2008-10-30	ENSG00000083857	ENSG00000083857		"""Cadherins / Cadherin-related"""	3595	protein-coding gene	gene with protein product	"""cadherin-related family member 8"""	600976	"""FAT tumor suppressor (Drosophila) homolog"", ""FAT tumor suppressor homolog 1 (Drosophila)"""	FAT		8586420	Standard	XM_005262834		Approved	CDHF7, CDHR8	uc003izf.3	Q14517	OTTHUMG00000160320	ENST00000441802.2:c.2758G>A	4.37:g.187628224C>T	ENSP00000406229:p.Val920Ile			Missense_Mutation	SNP	pfam_Cadherin,pfam_Laminin_G,pfam_EG-like_dom,pfam_EGF-like_Ca-bd_dom,superfamily_ConA-like_lec_gl_sf,superfamily_Cadherin-like,smart_Cadherin,smart_EG-like_dom,smart_Laminin_G,smart_EGF-like_Ca-bd_dom,prints_Cadherin,pfscan_EG-like_dom,pfscan_Laminin_G,pfscan_Cadherin	p.V920I	ENST00000441802.2	37	c.2758	CCDS47177.1	4	.	.	.	.	.	.	.	.	.	.	C	21.7	4.189480	0.78789	.	.	ENSG00000083857	ENST00000441802;ENST00000260147	T	0.73789	-0.78	4.67	4.67	0.58626	Cadherin (4);Cadherin conserved site (1);Cadherin-like (1);	0.000000	0.85682	D	0.000000	T	0.81024	0.4737	L	0.39898	1.24	0.80722	D	1	D	0.67145	0.996	D	0.77557	0.99	T	0.78833	-0.2048	10	0.33141	T	0.24	.	18.1062	0.89520	0.0:1.0:0.0:0.0	.	920	Q14517	FAT1_HUMAN	I	920	ENSP00000406229:V920I	ENSP00000260147:V920I	V	-	1	0	FAT1	187865218	1.000000	0.71417	1.000000	0.80357	0.927000	0.56198	3.900000	0.56295	2.579000	0.87056	0.491000	0.48974	GTT	FAT1	-	superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	ENSG00000083857		0.473	FAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAT1	HGNC	protein_coding	OTTHUMT00000360209.3	-	0.00	33	0	C	NM_005245		187628224	-1	tier1	-	no_errors	ENST00000441802	ensembl	human	known	74_37	missense	27.08	35	13	SNP	1.000	T
FBLN2	2199	genome.wustl.edu	37	3	13611943	13611943	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr3:13611943C>T	ENST00000295760.7	+	2	157	c.88C>T	c.(88-90)Cgg>Tgg	p.R30W	FBLN2_ENST00000535798.1_Missense_Mutation_p.R56W|FBLN2_ENST00000404922.3_Missense_Mutation_p.R30W|FBLN2_ENST00000492059.1_Missense_Mutation_p.R30W	NM_001998.2	NP_001989.2	P98095	FBLN2_HUMAN	fibulin 2	30	N.|Subdomain NA (Cys-rich).				extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	calcium ion binding (GO:0005509)|extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)			haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(10)|ovary(3)|prostate(3)|urinary_tract(1)	24			UCEC - Uterine corpus endometrioid carcinoma (1;0.00416)			AGCTGCCCCTCGGCAGGACTG	0.721																																																	0													5.0	7.0	6.0					3																	13611943		1920	4046	5966	SO:0001583	missense	0			X82494	CCDS46761.1, CCDS46762.1	3p25-p24	2010-06-15			ENSG00000163520	ENSG00000163520		"""Fibulins"""	3601	protein-coding gene	gene with protein product		135821				7806230	Standard	NM_001165035		Approved		uc011ava.2	P98095	OTTHUMG00000155437	ENST00000295760.7:c.88C>T	3.37:g.13611943C>T	ENSP00000295760:p.Arg30Trp		B7Z9C5|Q8IUI0|Q8IUI1	Missense_Mutation	SNP	pfam_EGF-like_Ca-bd_dom,pfam_Anaphylatoxin/fibulin,superfamily_Anaphylatoxin_comp_syst,smart_EG-like_dom,smart_Anaphylatoxin/fibulin,smart_EGF-like_Ca-bd_dom,pfscan_Anaphylatoxin/fibulin,pfscan_EG-like_dom	p.R30W	ENST00000295760.7	37	c.88	CCDS46762.1	3	.	.	.	.	.	.	.	.	.	.	C	19.11	3.763046	0.69763	.	.	ENSG00000163520	ENST00000535798;ENST00000404922;ENST00000295760;ENST00000465610;ENST00000492059	T;T;T;T;T	0.03717	3.83;3.83;3.83;3.83;3.83	4.22	-4.58	0.03410	.	0.631733	0.14348	N	0.325282	T	0.01523	0.0049	N	0.08118	0	0.22213	N	0.999284	B;B;B	0.10296	0.001;0.002;0.003	B;B;B	0.04013	0.0;0.001;0.001	T	0.41662	-0.9496	10	0.35671	T	0.21	.	3.5996	0.08019	0.1443:0.3847:0.3601:0.1109	.	30;30;56	P98095;P98095-2;F5H1F3	FBLN2_HUMAN;.;.	W	56;30;30;30;30	ENSP00000445705:R56W;ENSP00000384169:R30W;ENSP00000295760:R30W;ENSP00000420164:R30W;ENSP00000420042:R30W	ENSP00000295760:R30W	R	+	1	2	FBLN2	13586943	0.923000	0.31300	0.010000	0.14722	0.185000	0.23345	1.447000	0.35101	-0.462000	0.06984	0.558000	0.71614	CGG	FBLN2	-	NULL	ENSG00000163520		0.721	FBLN2-002	KNOWN	basic|CCDS	protein_coding	FBLN2	HGNC	protein_coding	OTTHUMT00000340083.3	-	0.00	30	0	C	NM_001004019		13611943	+1	tier1	-	no_errors	ENST00000404922	ensembl	human	known	74_37	missense	28.57	20	8	SNP	0.967	T
FBXW7	55294	genome.wustl.edu	37	4	153244238	153244238	+	Frame_Shift_Del	DEL	C	C	-			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr4:153244238delC	ENST00000281708.4	-	12	3148	c.1919delG	c.(1918-1920)agcfs	p.S641fs	RP11-461L13.3_ENST00000603766.1_lincRNA|FBXW7_ENST00000603841.1_Frame_Shift_Del_p.S641fs|FBXW7_ENST00000603548.1_Frame_Shift_Del_p.S641fs|FBXW7_ENST00000393956.3_Frame_Shift_Del_p.S465fs|FBXW7_ENST00000296555.5_Frame_Shift_Del_p.S523fs|FBXW7_ENST00000263981.5_Frame_Shift_Del_p.S561fs	NM_033632.3	NP_361014.1	Q969H0	FBXW7_HUMAN	F-box and WD repeat domain containing 7, E3 ubiquitin protein ligase	641					cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|lipid homeostasis (GO:0055088)|lung development (GO:0030324)|negative regulation of DNA endoreduplication (GO:0032876)|negative regulation of hepatocyte proliferation (GO:2000346)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of SREBP signaling pathway (GO:2000639)|negative regulation of triglyceride biosynthetic process (GO:0010868)|Notch signaling pathway (GO:0007219)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of oxidative stress-induced neuron intrinsic apoptotic signaling pathway (GO:1903378)|positive regulation of proteasomal protein catabolic process (GO:1901800)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|protein stabilization (GO:0050821)|protein ubiquitination (GO:0016567)|regulation of cell cycle G1/S phase transition (GO:1902806)|regulation of lipid storage (GO:0010883)|regulation of protein localization (GO:0032880)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|sister chromatid cohesion (GO:0007062)|vasculature development (GO:0001944)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Parkin-FBXW7-Cul1 ubiquitin ligase complex (GO:1990452)|protein complex (GO:0043234)|SCF ubiquitin ligase complex (GO:0019005)	cyclin binding (GO:0030332)|identical protein binding (GO:0042802)|protein binding, bridging (GO:0030674)|sequence-specific DNA binding transcription factor activity (GO:0003700)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activator activity (GO:0097027)	p.?(1)		NS(1)|biliary_tract(8)|bone(1)|breast(5)|central_nervous_system(6)|cervix(2)|endometrium(36)|haematopoietic_and_lymphoid_tissue(159)|kidney(6)|large_intestine(155)|lung(31)|ovary(10)|pancreas(3)|prostate(2)|skin(6)|stomach(16)|upper_aerodigestive_tract(9)|urinary_tract(6)	462	all_hematologic(180;0.093)	Acute lymphoblastic leukemia(8;0.000629)|all_hematologic(8;0.067)				ATCATCTGAGCTGGTAATTAC	0.418			"""Mis, N, D, F"""		"""colorectal, endometrial, T-ALL"""																																			Rec	yes		4	4q31.3	55294	"""F-box and WD-40 domain protein 7 (archipelago homolog, Drosophila)"""		"""E, L"""	1	Unknown(1)	haematopoietic_and_lymphoid_tissue(1)											108.0	105.0	106.0					4																	153244238		2203	4300	6503	SO:0001589	frameshift_variant	0			AF411971	CCDS3777.1, CCDS3778.1, CCDS34078.1, CCDS64082.1	4q31.23	2013-01-09	2012-02-23					"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	16712	protein-coding gene	gene with protein product	"""archipelago homolog (Drosophila)"""	606278	"""F-box and WD-40 domain protein 7 (archipelago homolog, Drosophila)"", ""F-box and WD repeat domain containing 7"""			10531037, 11425854	Standard	NM_018315		Approved	AGO, FLJ11071, SEL-10, SEL10, FBW7, FBX30, CDC4, FBXW6	uc003ims.3	Q969H0		ENST00000281708.4:c.1919delG	4.37:g.153244238delC	ENSP00000281708:p.Ser641fs		B7ZLP9|Q68DR0|Q96A16|Q96LE0|Q96RI2|Q9NUX6	Frame_Shift_Del	DEL	pfam_WD40_repeat,pfam_F-box_dom,superfamily_WD40_repeat_dom,superfamily_F-box_dom,smart_F-box_dom,smart_WD40_repeat,pfscan_F-box_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.S640fs	ENST00000281708.4	37	c.1919	CCDS3777.1	4																																																																																			FBXW7	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	ENSG00000109670		0.418	FBXW7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXW7	HGNC	protein_coding	OTTHUMT00000469956.1		0.00	75	0	C			153244238	-1	tier1		no_errors	ENST00000281708	ensembl	human	known	74_37	frame_shift_del	37.21	27	16	DEL	1.000	-
FCHSD1	89848	genome.wustl.edu	37	5	141024481	141024481	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr5:141024481G>A	ENST00000435817.2	-	15	1519	c.1469C>T	c.(1468-1470)aCg>aTg	p.T490M	FCHSD1_ENST00000522126.1_3'UTR|FCHSD1_ENST00000523856.1_5'UTR|FCHSD1_ENST00000522783.1_Missense_Mutation_p.T416M	NM_033449.2	NP_258260.1	Q86WN1	FCSD1_HUMAN	FCH and double SH3 domains 1	490	SH3 1. {ECO:0000255|PROSITE- ProRule:PRU00192}.								FCHSD1/BRAF(2)	central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(8)|lung(5)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	24			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTCACCCTCCGTGATTGTCAG	0.617																																																	0													49.0	57.0	54.0					5																	141024481		2126	4231	6357	SO:0001583	missense	0			AK027281	CCDS47295.1	5q31.3	2008-02-05			ENSG00000197948	ENSG00000197948			25463	protein-coding gene	gene with protein product						11214971, 15067381	Standard	NM_033449		Approved	FLJ00007	uc003llk.3	Q86WN1	OTTHUMG00000163762	ENST00000435817.2:c.1469C>T	5.37:g.141024481G>A	ENSP00000399259:p.Thr490Met		Q6UX75|Q86Y77|Q9NXX8	Missense_Mutation	SNP	pfam_SH3_domain,pfam_SH3_2,pfam_FCH_dom,superfamily_SH3_domain,smart_FCH_dom,smart_SH3_domain,pfscan_FCH_dom,pfscan_SH3_domain	p.T490M	ENST00000435817.2	37	c.1469	CCDS47295.1	5	.	.	.	.	.	.	.	.	.	.	G	12.41	1.929149	0.34096	.	.	ENSG00000197948	ENST00000435817;ENST00000522783;ENST00000518499	T;T;T	0.48836	0.8;0.8;0.8	5.54	1.69	0.24217	Src homology-3 domain (4);	0.218607	0.36815	N	0.002396	T	0.37489	0.1005	L	0.54908	1.71	0.80722	D	1	B;B	0.29805	0.239;0.257	B;B	0.29598	0.023;0.104	T	0.10636	-1.0621	10	0.48119	T	0.1	-9.6222	5.6517	0.17620	0.2829:0.0:0.5797:0.1374	.	170;490	Q86WN1-2;Q86WN1	.;FCSD1_HUMAN	M	490;416;173	ENSP00000399259:T490M;ENSP00000428677:T416M;ENSP00000430448:T173M	ENSP00000399259:T490M	T	-	2	0	FCHSD1	141004665	0.192000	0.23301	0.994000	0.49952	0.979000	0.70002	0.728000	0.26013	0.024000	0.15214	-0.448000	0.05591	ACG	FCHSD1	-	pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain	ENSG00000197948		0.617	FCHSD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FCHSD1	HGNC	protein_coding	OTTHUMT00000375282.2	-	0.00	64	0	G	NM_033449		141024481	-1	tier1	-	no_errors	ENST00000435817	ensembl	human	known	74_37	missense	35.48	40	22	SNP	0.969	A
FES	2242	genome.wustl.edu	37	15	91432539	91432539	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr15:91432539G>C	ENST00000328850.3	+	6	814	c.672G>C	c.(670-672)aaG>aaC	p.K224N	FES_ENST00000444422.2_Missense_Mutation_p.K224N|FES_ENST00000414248.2_Missense_Mutation_p.K166N|FES_ENST00000394302.1_Missense_Mutation_p.K166N|FES_ENST00000394300.3_Missense_Mutation_p.K166N|FES_ENST00000450438.2_Missense_Mutation_p.K166N	NM_002005.3	NP_001996.1	P07332	FES_HUMAN	FES proto-oncogene, tyrosine kinase	224	Important for interaction with membranes containing phosphoinositides.				axon guidance (GO:0007411)|cell proliferation (GO:0008283)|multicellular organismal development (GO:0007275)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of myeloid cell differentiation (GO:0045639)|positive regulation of neuron projection development (GO:0010976)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of cell adhesion (GO:0030155)|regulation of cell differentiation (GO:0045595)|regulation of cell motility (GO:2000145)|regulation of cell proliferation (GO:0042127)|regulation of cell shape (GO:0008360)|regulation of mast cell degranulation (GO:0043304)|regulation of vesicle-mediated transport (GO:0060627)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|microtubule cytoskeleton (GO:0015630)	ATP binding (GO:0005524)|immunoglobulin receptor binding (GO:0034987)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|phosphatidylinositol binding (GO:0035091)|protein tyrosine kinase activity (GO:0004713)			lung(2)|ovary(1)	3	Lung NSC(78;0.0771)|all_lung(78;0.137)		Lung(145;0.229)			GGGGCAGGAAGGAGATCCTGC	0.647																																																	0													58.0	56.0	57.0					15																	91432539		2198	4298	6496	SO:0001583	missense	0			X52192	CCDS10365.1, CCDS45349.1, CCDS45350.1, CCDS45351.1	15q26.1	2014-06-26	2014-06-26		ENSG00000182511	ENSG00000182511	2.7.10.1	"""SH2 domain containing"""	3657	protein-coding gene	gene with protein product	"""Oncogene FES, feline sarcoma virus"", ""c-fes/fps protein"""	190030	"""feline sarcoma (Snyder-Theilen) viral (v-fes)/Fujinami avian sarcoma (PRCII) viral (v-fps) oncogene homolog"", ""feline sarcoma oncogene"""			1870997	Standard	NM_002005		Approved	FPS	uc002bpv.3	P07332	OTTHUMG00000044456	ENST00000328850.3:c.672G>C	15.37:g.91432539G>C	ENSP00000331504:p.Lys224Asn		B2R6E6|B4DUD0|E9PC94|E9PC95|Q2VXS7|Q2VXS8|Q2VXT0|Q6GTU5	Missense_Mutation	SNP	pirsf_Tyr_kinase_non-rcpt_Fes_subgr,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_SH2,pfam_FCH_dom,superfamily_Kinase-like_dom,superfamily_t-SNARE,smart_FCH_dom,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_SH2,pfscan_FCH_dom,pfscan_SH2,pfscan_Prot_kinase_dom	p.K224N	ENST00000328850.3	37	c.672	CCDS10365.1	15	.	.	.	.	.	.	.	.	.	.	G	19.14	3.769097	0.69992	.	.	ENSG00000182511	ENST00000328850;ENST00000414248;ENST00000394302;ENST00000444422;ENST00000394300;ENST00000450438	T;T;T;T;T;T	0.17528	2.27;2.27;2.27;2.27;2.27;2.27	4.71	1.24	0.21308	.	0.000000	0.85682	D	0.000000	T	0.34513	0.0900	M	0.73962	2.25	0.42879	D	0.994165	D;D;D;D;D	0.67145	0.988;0.979;0.99;0.996;0.97	P;P;P;D;P	0.64042	0.844;0.702;0.841;0.921;0.697	T	0.14254	-1.0479	10	0.87932	D	0	-43.8244	9.568	0.39411	0.2713:0.0:0.7287:0.0	.	166;166;166;224;224	P07332-2;E7ENM8;P07332-3;P07332-4;P07332	.;.;.;.;FES_HUMAN	N	224;166;166;224;166;166	ENSP00000331504:K224N;ENSP00000414629:K166N;ENSP00000377839:K166N;ENSP00000400868:K224N;ENSP00000377837:K166N;ENSP00000409915:K166N	ENSP00000331504:K224N	K	+	3	2	FES	89233543	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	2.572000	0.45999	0.423000	0.26033	0.456000	0.33151	AAG	FES	-	pirsf_Tyr_kinase_non-rcpt_Fes_subgr	ENSG00000182511		0.647	FES-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FES	HGNC	protein_coding	OTTHUMT00000313497.1		0.00	52	0	G	NM_002005		91432539	+1			no_errors	ENST00000328850	ensembl	human	known	74_37	missense	5.08	56	3	SNP	1.000	C
FGD6	55785	genome.wustl.edu	37	12	95603631	95603631	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr12:95603631C>T	ENST00000343958.4	-	2	1652	c.1429G>A	c.(1429-1431)Gcc>Acc	p.A477T	FGD6_ENST00000549499.1_Missense_Mutation_p.A477T|FGD6_ENST00000546711.1_Missense_Mutation_p.A477T|FGD6_ENST00000550368.1_5'Flank	NM_018351.3	NP_060821.3	Q6ZV73	FGD6_HUMAN	FYVE, RhoGEF and PH domain containing 6	477					actin cytoskeleton organization (GO:0030036)|cytoskeleton organization (GO:0007010)|filopodium assembly (GO:0046847)|positive regulation of GTPase activity (GO:0043547)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|ruffle (GO:0001726)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|small GTPase binding (GO:0031267)			breast(3)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(14)|liver(1)|lung(12)|ovary(3)|prostate(3)|skin(6)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	56						ATTTGAGGGGCAGAAACTCCC	0.413																																																	0													63.0	67.0	66.0					12																	95603631		2203	4300	6503	SO:0001583	missense	0			AB037783	CCDS31878.1	12q23.1	2013-01-10				ENSG00000180263		"""Zinc fingers, FYVE domain containing"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	21740	protein-coding gene	gene with protein product		613520					Standard	NM_018351		Approved	ZFYVE24, FLJ11183	uc001tdp.4	Q6ZV73	OTTHUMG00000170133	ENST00000343958.4:c.1429G>A	12.37:g.95603631C>T	ENSP00000344446:p.Ala477Thr		Q6ZR53|Q7Z2Z7|Q96D44|Q9NUR8|Q9P2I5	Missense_Mutation	SNP	pfam_DH-domain,pfam_Pleckstrin_homology,pfam_Znf_FYVE,superfamily_DH-domain,smart_DH-domain,smart_Pleckstrin_homology,smart_Znf_FYVE,pfscan_Pleckstrin_homology,pfscan_Znf_FYVE-rel,pfscan_DH-domain	p.A477T	ENST00000343958.4	37	c.1429	CCDS31878.1	12	.	.	.	.	.	.	.	.	.	.	C	11.23	1.576540	0.28092	.	.	ENSG00000180263	ENST00000343958;ENST00000546711;ENST00000549499	T;T;T	0.68025	-0.2;-0.3;-0.22	6.04	1.95	0.26073	.	0.957795	0.08612	N	0.919851	T	0.53077	0.1774	L	0.47716	1.5	0.09310	N	1	P	0.38922	0.651	B	0.25140	0.058	T	0.36114	-0.9761	10	0.45353	T	0.12	2.3421	8.9586	0.35834	0.0:0.6324:0.1458:0.2218	.	477	Q6ZV73	FGD6_HUMAN	T	477	ENSP00000344446:A477T;ENSP00000450342:A477T;ENSP00000449005:A477T	ENSP00000344446:A477T	A	-	1	0	FGD6	94127762	0.001000	0.12720	0.004000	0.12327	0.975000	0.68041	-0.162000	0.10012	0.458000	0.26988	-0.258000	0.10820	GCC	FGD6	-	NULL	ENSG00000180263		0.413	FGD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FGD6	HGNC	protein_coding	OTTHUMT00000407600.1		0.00	94	0	C	NM_018351		95603631	-1			no_errors	ENST00000343958	ensembl	human	known	74_37	missense	5.36	53	3	SNP	0.002	T
FIGN	55137	genome.wustl.edu	37	2	164467428	164467428	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr2:164467428G>T	ENST00000333129.3	-	3	1228	c.914C>A	c.(913-915)cCg>cAg	p.P305Q	FIGN_ENST00000409634.1_Intron|FIGN_ENST00000482917.1_5'Flank	NM_018086.2	NP_060556.2	Q5HY92	FIGN_HUMAN	fidgetin	305					mitotic nuclear division (GO:0007067)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nuclear matrix (GO:0016363)	ATP binding (GO:0005524)			breast(2)|endometrium(3)|kidney(2)|large_intestine(13)|lung(23)|ovary(1)|prostate(2)|skin(1)	47						CAGAGCCGACGGTGCAATAGG	0.517																																																	0													65.0	67.0	66.0					2																	164467428		1985	4158	6143	SO:0001583	missense	0			AK001267	CCDS2221.2	2q24	2010-04-21			ENSG00000182263	ENSG00000182263		"""ATPases / AAA-type"""	13285	protein-coding gene	gene with protein product		605295				11017077	Standard	XM_005246661		Approved		uc002uck.1	Q5HY92	OTTHUMG00000074059	ENST00000333129.3:c.914C>A	2.37:g.164467428G>T	ENSP00000333836:p.Pro305Gln		B3KWM0|Q9H6M5|Q9NVZ9	Missense_Mutation	SNP	pfam_ATPase_AAA_core,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.P305Q	ENST00000333129.3	37	c.914	CCDS2221.2	2	.	.	.	.	.	.	.	.	.	.	G	15.25	2.778093	0.49786	.	.	ENSG00000182263	ENST00000333129	D	0.92545	-3.06	5.94	5.94	0.96194	.	0.000000	0.85682	D	0.000000	D	0.94748	0.8305	L	0.56769	1.78	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.90751	0.4657	10	0.08599	T	0.76	-8.0222	20.3666	0.98879	0.0:0.0:1.0:0.0	.	305	Q5HY92	FIGN_HUMAN	Q	305	ENSP00000333836:P305Q	ENSP00000333836:P305Q	P	-	2	0	FIGN	164175674	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	9.824000	0.99380	2.814000	0.96858	0.563000	0.77884	CCG	FIGN	-	NULL	ENSG00000182263		0.517	FIGN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FIGN	HGNC	protein_coding	OTTHUMT00000157220.2		0.00	39	0	G	NM_018086		164467428	-1			no_errors	ENST00000333129	ensembl	human	known	74_37	missense	7.69	36	3	SNP	1.000	T
FLOT2	2319	genome.wustl.edu	37	17	27209680	27209680	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr17:27209680C>A	ENST00000394908.4	-	5	480	c.376G>T	c.(376-378)Gac>Tac	p.D126Y	FLOT2_ENST00000394906.2_Missense_Mutation_p.D181Y|FLOT2_ENST00000585169.1_Missense_Mutation_p.D126Y|FLOT2_ENST00000577789.1_5'UTR	NM_004475.2	NP_004466.2	Q14254	FLOT2_HUMAN	flotillin 2	126					cell adhesion (GO:0007155)|epidermis development (GO:0008544)|establishment of protein localization to plasma membrane (GO:0090002)|negative regulation of amyloid precursor protein catabolic process (GO:1902992)|negative regulation of gene expression (GO:0010629)|protein stabilization (GO:0050821)	acrosomal membrane (GO:0002080)|caveola (GO:0005901)|endocytic vesicle (GO:0030139)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|flotillin complex (GO:0016600)|focal adhesion (GO:0005925)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				endometrium(3)|lung(6)|prostate(1)|urinary_tract(1)	11	all_cancers(5;2.12e-15)|all_epithelial(6;3.44e-19)|Lung NSC(42;0.01)		Epithelial(11;3.26e-06)|all cancers(11;1.76e-05)|BRCA - Breast invasive adenocarcinoma(11;0.00015)|OV - Ovarian serous cystadenocarcinoma(11;0.0602)			TGGTCCCGGTCCTGATAAATC	0.622																																																	0													74.0	79.0	77.0					17																	27209680		1945	4135	6080	SO:0001583	missense	0			M60922	CCDS11245.2	17q11-q12	2008-07-18			ENSG00000132589	ENSG00000132589			3758	protein-coding gene	gene with protein product	"""Flotillin 2 (epidermal surface antigen 1)"", ""membrane component, chromosome 17, surface marker 1 (35kD protein identified by monoclonal antibody ECS-1)"""	131560		M17S1		1769667	Standard	XM_005257950		Approved	ESA, ESA1, ECS-1, ECS1	uc002hdc.3	Q14254	OTTHUMG00000132674	ENST00000394908.4:c.376G>T	17.37:g.27209680C>A	ENSP00000378368:p.Asp126Tyr			Missense_Mutation	SNP	pfam_Band_7,smart_Band_7	p.D126Y	ENST00000394908.4	37	c.376	CCDS11245.2	17	.	.	.	.	.	.	.	.	.	.	C	26.8	4.776739	0.90195	.	.	ENSG00000132589	ENST00000394906;ENST00000394908	D;D	0.94280	-3.39;-3.39	5.64	5.64	0.86602	.	0.000000	0.85682	D	0.000000	D	0.97945	0.9324	H	0.96111	3.77	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.98953	1.0795	10	0.87932	D	0	-27.7552	18.2754	0.90081	0.0:1.0:0.0:0.0	.	126	Q14254	FLOT2_HUMAN	Y	181;126	ENSP00000378366:D181Y;ENSP00000378368:D126Y	ENSP00000378366:D181Y	D	-	1	0	FLOT2	24233806	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.794000	0.85869	2.675000	0.91044	0.462000	0.41574	GAC	FLOT2	-	pfam_Band_7,smart_Band_7	ENSG00000132589		0.622	FLOT2-003	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	FLOT2	HGNC	protein_coding	OTTHUMT00000255935.3	-	0.00	12	0	C	NM_004475		27209680	-1	tier1	-	no_errors	ENST00000394908	ensembl	human	known	74_37	missense	46.67	8	7	SNP	1.000	A
FMNL1	752	genome.wustl.edu	37	17	43319299	43319299	+	Silent	SNP	C	C	G			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr17:43319299C>G	ENST00000331495.3	+	15	2007	c.1671C>G	c.(1669-1671)gcC>gcG	p.A557A	CTD-2020K17.3_ENST00000587534.1_RNA|FMNL1_ENST00000328118.3_Silent_p.A557A|CTD-2020K17.3_ENST00000393507.2_RNA|FMNL1_ENST00000587489.1_Silent_p.A135A	NM_005892.3	NP_005883	O95466	FMNL_HUMAN	formin-like 1	557	Pro-rich.				actin filament severing (GO:0051014)|cortical actin cytoskeleton organization (GO:0030866)|regulation of cell shape (GO:0008360)|substrate-dependent cell migration (GO:0006929)	cell projection (GO:0042995)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)	actin filament binding (GO:0051015)|GTPase activating protein binding (GO:0032794)|Rac GTPase binding (GO:0048365)			biliary_tract(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(12)|pancreas(1)|skin(1)|urinary_tract(2)	33						cgcaggaagccccgccctctg	0.806																																					GBM(164;1247 1997 8702 11086 51972)												0													1.0	1.0	1.0					17																	43319299		403	1082	1485	SO:0001819	synonymous_variant	0			AJ008112	CCDS11497.1	17q21.31	2008-05-14	2003-12-02	2003-12-03		ENSG00000184922			1212	protein-coding gene	gene with protein product		604656	"""formin-like"""	C17orf1B, FMNL		9799091	Standard	NM_005892		Approved	C17orf1	uc002iin.3	O95466		ENST00000331495.3:c.1671C>G	17.37:g.43319299C>G			D2DGW2|Q6DKG5|Q6IBP3|Q86UH1|Q8N671|Q8TDH1|Q96H10	Silent	SNP	pfam_FH2_Formin,pfam_FH3_dom,pfam_GTPase-bd,superfamily_ARM-type_fold,smart_FH2_Formin	p.A557	ENST00000331495.3	37	c.1671	CCDS11497.1	17																																																																																			FMNL1	-	NULL	ENSG00000184922		0.806	FMNL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FMNL1	HGNC	protein_coding	OTTHUMT00000450198.1		0.00	11	0	C	NM_005892		43319299	+1			no_errors	ENST00000328118	ensembl	human	known	74_37	silent	21.43	11	3	SNP	0.941	G
FN1	2335	genome.wustl.edu	37	2	216236888	216236888	+	Missense_Mutation	SNP	G	G	T	rs199867755		TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr2:216236888G>T	ENST00000359671.1	-	39	6450	c.6185C>A	c.(6184-6186)cCg>cAg	p.P2062Q	FN1_ENST00000323926.6_Missense_Mutation_p.P2153Q|FN1_ENST00000432072.2_Intron|FN1_ENST00000443816.1_Missense_Mutation_p.P1972Q|FN1_ENST00000356005.4_Missense_Mutation_p.P1972Q|FN1_ENST00000421182.1_Missense_Mutation_p.P1947Q|FN1_ENST00000446046.1_Missense_Mutation_p.P2037Q|FN1_ENST00000357867.4_Intron|FN1_ENST00000354785.4_Missense_Mutation_p.P2153Q|FN1_ENST00000346544.3_Intron|FN1_ENST00000345488.5_Intron|FN1_ENST00000336916.4_Missense_Mutation_p.P2062Q|FN1_ENST00000357009.2_Intron			P02751	FINC_HUMAN	fibronectin 1	2062	Connecting strand 3 (CS-3) (V region).				acute-phase response (GO:0006953)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|calcium-independent cell-matrix adhesion (GO:0007161)|cell adhesion (GO:0007155)|cell-substrate junction assembly (GO:0007044)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|integrin activation (GO:0033622)|leukocyte migration (GO:0050900)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of axon extension (GO:0045773)|regulation of cell shape (GO:0008360)|response to wounding (GO:0009611)|substrate adhesion-dependent cell spreading (GO:0034446)	apical plasma membrane (GO:0016324)|basal lamina (GO:0005605)|blood microparticle (GO:0072562)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|platelet alpha granule lumen (GO:0031093)	collagen binding (GO:0005518)|heparin binding (GO:0008201)|integrin binding (GO:0005178)|peptidase activator activity (GO:0016504)|protease binding (GO:0002020)		FN1/ALK(2)	NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(7)|endometrium(9)|kidney(8)|large_intestine(33)|lung(38)|ovary(1)|pancreas(1)|prostate(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	109		Renal(323;0.127)		Epithelial(149;9.59e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)	Ocriplasmin(DB08888)	CGTTGTGGGCGGTGTGGTCCG	0.522																																																	0													130.0	114.0	120.0					2																	216236888		2203	4300	6503	SO:0001583	missense	0				CCDS2399.1, CCDS2400.1, CCDS42813.1, CCDS42814.1, CCDS46510.1, CCDS46512.1	2q34	2014-01-30			ENSG00000115414	ENSG00000115414		"""Fibronectin type III domain containing"", ""Endogenous ligands"""	3778	protein-coding gene	gene with protein product	"""migration-stimulating factor"", ""cold-insoluble globulin"""	135600				2992939, 3003095	Standard	NM_054034		Approved	MSF, CIG, LETS, GFND2, FINC	uc002vfa.3	P02751	OTTHUMG00000133054	ENST00000359671.1:c.6185C>A	2.37:g.216236888G>T	ENSP00000352696:p.Pro2062Gln		B7ZLF0|E9PE77|E9PG29|O95609|O95610|Q14312|Q14325|Q14326|Q17RV7|Q564H7|Q585T2|Q59EH1|Q60FE4|Q68DP8|Q68DP9|Q68DT4|Q6LDP6|Q6MZS0|Q6MZU5|Q6N025|Q6N0A6|Q7Z391|Q86T27|Q8IVI8|Q96KP7|Q96KP8|Q96KP9|Q9H1B8|Q9HAP3|Q9UMK2	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Fibronectin_type1,pfam_FN_type2_col-bd,superfamily_Kringle-like,superfamily_Fibronectin_type3,smart_Fibronectin_type1,smart_FN_type2_col-bd,smart_Fibronectin_type3,pfscan_Fibronectin_type1,pfscan_FN_type2_col-bd,pfscan_Fibronectin_type3	p.P2153Q	ENST00000359671.1	37	c.6458		2	.	.	.	.	.	.	.	.	.	.	G	22.6	4.307279	0.81247	.	.	ENSG00000115414	ENST00000421182;ENST00000323926;ENST00000336916;ENST00000354785;ENST00000265313;ENST00000359671;ENST00000446046;ENST00000443816;ENST00000356005;ENST00000456923;ENST00000438981	T;T;T;T;T;T;T;T;T;T	0.49139	0.81;2.29;2.47;2.44;2.1;2.1;1.65;1.49;0.79;1.45	6.16	6.16	0.99307	.	0.187400	0.37393	N	0.002105	T	0.65852	0.2731	L	0.54323	1.7	0.80722	D	1	D;B;D;D;D;D;D;D;D;D	0.89917	1.0;0.109;0.999;0.998;0.986;0.998;1.0;1.0;0.985;0.996	D;B;D;D;P;D;D;D;P;D	0.91635	0.983;0.073;0.987;0.935;0.8;0.971;0.999;0.999;0.872;0.935	T	0.60469	-0.7257	10	0.42905	T	0.14	.	18.3537	0.90348	0.0:0.0:1.0:0.0	.	1853;2153;1972;2037;2062;2063;1947;1972;2153;2062	Q68CX6;P02751-7;P02751-8;E9PE77;P02751-3;E7ERA1;P02751-9;P02751-14;P02751-15;P02751	.;.;.;.;.;.;.;.;.;FINC_HUMAN	Q	1947;2153;2062;2153;2063;2062;2037;1972;1972;779;156	ENSP00000394423:P1947Q;ENSP00000323534:P2153Q;ENSP00000338200:P2062Q;ENSP00000346839:P2153Q;ENSP00000352696:P2062Q;ENSP00000410422:P2037Q;ENSP00000415018:P1972Q;ENSP00000348285:P1972Q;ENSP00000416139:P779Q;ENSP00000392565:P156Q	ENSP00000265313:P2063Q	P	-	2	0	FN1	215945133	1.000000	0.71417	0.995000	0.50966	0.903000	0.53119	3.681000	0.54648	2.937000	0.99478	0.650000	0.86243	CCG	FN1	-	NULL	ENSG00000115414		0.522	FN1-204	KNOWN	basic	protein_coding	FN1	HGNC	protein_coding			0.00	55	0	G	NM_212476		216236888	-1			no_errors	ENST00000354785	ensembl	human	known	74_37	missense	5.48	69	4	SNP	1.000	T
FOXG1	2290	genome.wustl.edu	37	14	29237869	29237869	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr14:29237869A>G	ENST00000313071.4	+	1	1583	c.1384A>G	c.(1384-1386)Agt>Ggt	p.S462G	FOXG1_ENST00000382535.3_Missense_Mutation_p.S462G	NM_005249.4	NP_005240.3	P55316	FOXG1_HUMAN	forkhead box G1	462					aging (GO:0007568)|axon midline choice point recognition (GO:0016199)|brain development (GO:0007420)|dorsal/ventral pattern formation (GO:0009953)|inner ear morphogenesis (GO:0042472)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron fate determination (GO:0048664)|positive regulation of cell cycle (GO:0045787)|positive regulation of neuroblast proliferation (GO:0002052)|pyramidal neuron migration (GO:0021852)|regulation of mitotic cell cycle (GO:0007346)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(9)|lung(23)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(2)	43			LUAD - Lung adenocarcinoma(48;0.011)|Lung(238;0.0575)	GBM - Glioblastoma multiforme(265;0.00413)		CTCTTTGCCAAGTTTTACGAC	0.557																																																	0													84.0	83.0	83.0					14																	29237869		2203	4300	6503	SO:0001583	missense	0				CCDS9636.1	14q11-q13	2007-10-05	2007-05-16	2007-05-16	ENSG00000176165	ENSG00000176165		"""Forkhead boxes"""	3811	protein-coding gene	gene with protein product		164874	"""forkhead box G1B"", ""forkhead box G1C"", ""forkhead box G1A"""	FKHL2, FOXG1B, FKHL4, FKH2, FKHL1, FOXG1C, FKHL3, FOXG1A		7959731, 17260156	Standard	NM_005249		Approved	HFK2, QIN, BF1, HFK1, HFK3, HBF-3	uc001wqe.4	P55316	OTTHUMG00000140187	ENST00000313071.4:c.1384A>G	14.37:g.29237869A>G	ENSP00000339004:p.Ser462Gly		A6NFY2|P55315|Q14488|Q86XT7	Missense_Mutation	SNP	pfam_TF_fork_head,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head	p.S462G	ENST00000313071.4	37	c.1384	CCDS9636.1	14	.	.	.	.	.	.	.	.	.	.	A	10.91	1.484869	0.26598	.	.	ENSG00000176165	ENST00000382535;ENST00000313071	D;D	0.93659	-3.26;-3.26	4.14	4.14	0.48551	.	0.118050	0.53938	U	0.000046	D	0.85643	0.5744	N	0.14661	0.345	0.36579	D	0.873448	B	0.25667	0.131	B	0.25140	0.058	D	0.85349	0.1100	10	0.66056	D	0.02	.	9.0165	0.36173	0.911:0.0:0.089:0.0	.	462	P55316	FOXG1_HUMAN	G	462	ENSP00000371975:S462G;ENSP00000339004:S462G	ENSP00000339004:S462G	S	+	1	0	FOXG1	28307620	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.591000	0.67536	1.633000	0.50488	0.402000	0.26972	AGT	FOXG1	-	NULL	ENSG00000176165		0.557	FOXG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOXG1	HGNC	protein_coding	OTTHUMT00000276559.3	-	0.00	85	0	A			29237869	+1	tier1	-	no_errors	ENST00000313071	ensembl	human	known	74_37	missense	34.78	60	32	SNP	1.000	G
FYN	2534	genome.wustl.edu	37	6	112015848	112015848	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr6:112015848C>T	ENST00000354650.3	-	11	1708	c.1102G>A	c.(1102-1104)Gtg>Atg	p.V368M	FYN_ENST00000356013.2_Missense_Mutation_p.V313M|FYN_ENST00000368682.3_Missense_Mutation_p.V365M|FYN_ENST00000229471.4_Missense_Mutation_p.V313M|FYN_ENST00000368678.4_Missense_Mutation_p.V365M|FYN_ENST00000229470.5_Missense_Mutation_p.V316M|FYN_ENST00000368667.2_Missense_Mutation_p.V368M|FYN_ENST00000476769.2_5'Flank|FYN_ENST00000538466.1_Missense_Mutation_p.V365M	NM_002037.5	NP_002028.1	P06241	FYN_HUMAN	FYN proto-oncogene, Src family tyrosine kinase	368	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activated T cell proliferation (GO:0050798)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium ion transport (GO:0006816)|cellular response to peptide hormone stimulus (GO:0071375)|dendrite morphogenesis (GO:0048813)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|feeding behavior (GO:0007631)|fibroblast growth factor receptor signaling pathway (GO:0008543)|forebrain development (GO:0030900)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|learning (GO:0007612)|leukocyte migration (GO:0050900)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of gene expression (GO:0010629)|negative regulation of protein catabolic process (GO:0042177)|neuron migration (GO:0001764)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet activation (GO:0030168)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of neuron projection development (GO:0010976)|positive regulation of protein localization to nucleus (GO:1900182)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of cell shape (GO:0008360)|regulation of defense response to virus by virus (GO:0050690)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|viral process (GO:0016032)	cytosol (GO:0005829)|endosome (GO:0005768)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	ATP binding (GO:0005524)|ephrin receptor binding (GO:0046875)|glycoprotein binding (GO:0001948)|growth factor receptor binding (GO:0070851)|metal ion binding (GO:0046872)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(17)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	30		all_cancers(87;1.37e-05)|Acute lymphoblastic leukemia(125;2.15e-07)|all_hematologic(75;5.28e-06)|all_epithelial(87;0.00125)|Colorectal(196;0.0211)		all cancers(137;0.0451)|OV - Ovarian serous cystadenocarcinoma(136;0.0476)|Epithelial(106;0.102)	Dasatinib(DB01254)	GCCATGTCCACAAGATTTGGT	0.388																																																	0													175.0	166.0	169.0					6																	112015848		2203	4300	6503	SO:0001583	missense	0			AK056699	CCDS5094.1, CCDS5095.1, CCDS5096.1	6q21	2014-06-25	2014-06-25		ENSG00000010810	ENSG00000010810		"""SH2 domain containing"""	4037	protein-coding gene	gene with protein product		137025	"""FYN oncogene related to SRC, FGR, YES"""			3526330	Standard	NM_002037		Approved	SYN, SLK, MGC45350	uc003pvh.3	P06241	OTTHUMG00000016305	ENST00000354650.3:c.1102G>A	6.37:g.112015848C>T	ENSP00000346671:p.Val368Met		B5BU57|E1P557|H0UI48|Q16248|Q5R3A6|Q5R3A7|Q8N5D7	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_SH2,pfam_SH3_domain,pfam_SH3_2,superfamily_Kinase-like_dom,superfamily_SH3_domain,smart_SH3_domain,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_SH2,pfscan_SH3_domain,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_SH2,prints_SH3_domain	p.V368M	ENST00000354650.3	37	c.1102	CCDS5094.1	6	.	.	.	.	.	.	.	.	.	.	C	23.7	4.443102	0.83993	.	.	ENSG00000010810	ENST00000368682;ENST00000354650;ENST00000229471;ENST00000368667;ENST00000368678;ENST00000229470;ENST00000356013;ENST00000538466;ENST00000544792	D;D;D;D;D;D;D;D	0.83914	-1.78;-1.78;-1.78;-1.78;-1.78;-1.78;-1.78;-1.78	5.95	5.95	0.96441	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.87573	0.6211	L	0.43757	1.38	0.80722	D	1	D;D;D;D	0.89917	1.0;0.998;1.0;1.0	D;D;D;D	0.83275	0.996;0.968;0.99;0.996	D	0.87744	0.2587	10	0.87932	D	0	.	20.3932	0.98965	0.0:1.0:0.0:0.0	.	316;368;313;365	B3KPS6;P06241;P06241-3;E1P556	.;FYN_HUMAN;.;.	M	365;368;313;368;365;316;313;365;316	ENSP00000357671:V365M;ENSP00000346671:V368M;ENSP00000229471:V313M;ENSP00000357656:V368M;ENSP00000357667:V365M;ENSP00000229470:V316M;ENSP00000348295:V313M;ENSP00000440646:V365M	ENSP00000229470:V316M	V	-	1	0	FYN	112122541	1.000000	0.71417	0.992000	0.48379	0.998000	0.95712	7.818000	0.86416	2.824000	0.97209	0.655000	0.94253	GTG	FYN	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000010810		0.388	FYN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FYN	HGNC	protein_coding	OTTHUMT00000043655.1	-	0.00	61	0	C			112015848	-1	tier1	-	no_errors	ENST00000354650	ensembl	human	known	74_37	missense	27.40	53	20	SNP	1.000	T
GALNT16	57452	genome.wustl.edu	37	14	69818841	69818841	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr14:69818841G>C	ENST00000337827.4	+	15	1960	c.1633G>C	c.(1633-1635)Gct>Cct	p.A545P	GALNT16_ENST00000448469.3_Missense_Mutation_p.A545P	NM_001168368.1|NM_020692.2	NP_001161840.1|NP_065743.2	Q8N428	GLT16_HUMAN	polypeptide N-acetylgalactosaminyltransferase 16	545	Ricin B-type lectin. {ECO:0000255|PROSITE-ProRule:PRU00174}.				protein glycosylation (GO:0006486)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)										CAAGTGTCAGGCTGACGCCCA	0.587																																																	0													43.0	41.0	42.0					14																	69818841		2203	4300	6503	SO:0001583	missense	0			AB032956	CCDS32107.1	14q24.1	2014-03-13	2014-03-13	2013-01-25	ENSG00000100626	ENSG00000100626	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	23233	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 16"""	615132	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 1"", ""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 16"""	GALNTL1		10574461, 22186971	Standard	NM_020692		Approved	KIAA1130, GalNAc-T16	uc010aqu.2	Q8N428	OTTHUMG00000171231	ENST00000337827.4:c.1633G>C	14.37:g.69818841G>C	ENSP00000336729:p.Ala545Pro		Q4KMG3|Q58A55|Q9ULT9	Missense_Mutation	SNP	pfam_Glyco_trans_2,pfam_Ricin_B_lectin,superfamily_Ricin_B_lectin,smart_Ricin_B_lectin,pfscan_Ricin_B_lectin	p.A545P	ENST00000337827.4	37	c.1633	CCDS32107.1	14	.	.	.	.	.	.	.	.	.	.	G	13.03	2.113961	0.37339	.	.	ENSG00000100626	ENST00000337827;ENST00000536652;ENST00000448469	T;T	0.26518	1.73;1.73	5.79	2.97	0.34412	Ricin B-related lectin (1);Ricin B lectin (3);	0.255518	0.46758	N	0.000275	T	0.14013	0.0339	N	0.12422	0.21	0.80722	D	1	B	0.34147	0.438	B	0.41619	0.361	T	0.16217	-1.0410	10	0.21540	T	0.41	.	3.3916	0.07291	0.1499:0.1345:0.5767:0.1389	.	545	Q8N428	GLTL1_HUMAN	P	545;171;545	ENSP00000336729:A545P;ENSP00000402970:A545P	ENSP00000336729:A545P	A	+	1	0	GALNTL1	68888594	0.996000	0.38824	0.989000	0.46669	0.985000	0.73830	1.249000	0.32839	0.369000	0.24510	-0.225000	0.12378	GCT	GALNT16	-	pfam_Ricin_B_lectin,superfamily_Ricin_B_lectin,smart_Ricin_B_lectin,pfscan_Ricin_B_lectin	ENSG00000100626		0.587	GALNT16-002	KNOWN	basic|appris_principal|CCDS	protein_coding	GALNT16	HGNC	protein_coding	OTTHUMT00000412434.1	-	0.00	60	0	G	NM_001168368		69818841	+1	tier1	-	no_errors	ENST00000337827	ensembl	human	known	74_37	missense	44.12	19	15	SNP	0.972	C
GALR1	2587	genome.wustl.edu	37	18	74968128	74968128	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr18:74968128G>T	ENST00000299727.3	+	2	681	c.681G>T	c.(679-681)ttG>ttT	p.L227F	GALR1_ENST00000582943.1_3'UTR	NM_001480.3	NP_001471.2	P47211	GALR1_HUMAN	galanin receptor 1	227					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|digestion (GO:0007586)|negative regulation of adenylate cyclase activity (GO:0007194)|neuropeptide signaling pathway (GO:0007218)|positive regulation of cortisol secretion (GO:0051464)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	galanin receptor activity (GO:0004966)|neuropeptide binding (GO:0042923)|peptide hormone binding (GO:0017046)			breast(2)|endometrium(1)|kidney(1)|large_intestine(3)|lung(13)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	24		Prostate(75;0.0865)|Esophageal squamous(42;0.129)|Melanoma(33;0.211)		OV - Ovarian serous cystadenocarcinoma(15;1.03e-06)|BRCA - Breast invasive adenocarcinoma(31;0.104)		TTAATCACTTGCATAAAAAGT	0.343																																																	0													132.0	130.0	131.0					18																	74968128		2203	4300	6503	SO:0001583	missense	0			U90658	CCDS12012.1	18q23	2012-08-08			ENSG00000166573	ENSG00000166573		"""GPCR / Class A : Galanin receptors"""	4132	protein-coding gene	gene with protein product		600377		GALNR1, GALNR		7524088	Standard	NM_001480		Approved		uc002lms.4	P47211	OTTHUMG00000132875	ENST00000299727.3:c.681G>T	18.37:g.74968128G>T	ENSP00000299727:p.Leu227Phe		Q4VBL7	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srw,pfam_7TM_GPCR_serpentine_rcpt_Srv,pfscan_GPCR_Rhodpsn_7TM,prints_GAL1_rcpt,prints_GPCR_Rhodpsn,prints_Galanin_rcpt,prints_NPY_rcpt	p.L227F	ENST00000299727.3	37	c.681	CCDS12012.1	18	.	.	.	.	.	.	.	.	.	.	G	15.38	2.817111	0.50633	.	.	ENSG00000166573	ENST00000299727	T	0.52057	0.68	4.48	1.63	0.23807	GPCR, rhodopsin-like superfamily (1);	0.322160	0.29515	N	0.011928	T	0.70815	0.3267	H	0.94771	3.58	0.58432	D	0.999999	D	0.67145	0.996	D	0.66351	0.943	T	0.72773	-0.4192	10	0.72032	D	0.01	.	8.0215	0.30412	0.2815:0.0:0.7185:0.0	.	227	P47211	GALR1_HUMAN	F	227	ENSP00000299727:L227F	ENSP00000299727:L227F	L	+	3	2	GALR1	73097116	1.000000	0.71417	0.992000	0.48379	0.842000	0.47809	0.726000	0.25984	0.455000	0.26910	0.467000	0.42956	TTG	GALR1	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srw,pfam_7TM_GPCR_serpentine_rcpt_Srv,pfscan_GPCR_Rhodpsn_7TM,prints_GAL1_rcpt	ENSG00000166573		0.343	GALR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GALR1	HGNC	protein_coding	OTTHUMT00000256362.1		0.00	59	0	G			74968128	+1			no_errors	ENST00000299727	ensembl	human	known	74_37	missense	5.26	54	3	SNP	1.000	T
GARNL3	84253	genome.wustl.edu	37	9	130106619	130106619	+	Splice_Site	SNP	G	G	T			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr9:130106619G>T	ENST00000373387.4	+	15	1708		c.e15+1		GARNL3_ENST00000435213.2_Splice_Site|GARNL3_ENST00000314904.5_Splice_Site	NM_032293.4	NP_115669.3	Q5VVW2	GARL3_HUMAN	GTPase activating Rap/RanGAP domain-like 3						regulation of small GTPase mediated signal transduction (GO:0051056)		GTPase activator activity (GO:0005096)|small GTPase regulator activity (GO:0005083)			NS(1)|central_nervous_system(1)|endometrium(6)|large_intestine(5)|lung(24)|ovary(1)|skin(1)|urinary_tract(2)	41						AATAGGGCAGGTGGGTTTTCT	0.483																																																	0													99.0	114.0	109.0					9																	130106619		2203	4300	6503	SO:0001630	splice_region_variant	0			BC034983	CCDS6869.2, CCDS69663.1	9q34.13	2009-09-14	2004-08-09		ENSG00000136895	ENSG00000136895			25425	protein-coding gene	gene with protein product			"""GTPase activating RANGAP domain-like 3"""			11230166	Standard	NM_032293		Approved	DKFZp761J1523, bA356B19.1	uc011mae.2	Q5VVW2	OTTHUMG00000020700	ENST00000373387.4:c.1356+1G>T	9.37:g.130106619G>T			B4DEP7|B7Z3Q6|Q8IYU1|Q8N951|Q8ND89|Q9BQH6	Splice_Site	SNP	-	e15+1	ENST00000373387.4	37	c.1356+1	CCDS6869.2	9	.	.	.	.	.	.	.	.	.	.	G	23.4	4.410361	0.83340	.	.	ENSG00000136895	ENST00000435213;ENST00000314904;ENST00000373387	.	.	.	5.58	5.58	0.84498	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.1276	0.89591	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	GARNL3	129146440	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.338000	0.96553	2.615000	0.88500	0.563000	0.77884	.	GARNL3	-	-	ENSG00000136895		0.483	GARNL3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	GARNL3	HGNC	protein_coding	OTTHUMT00000054151.3	-	0.00	84	0	G	NM_032293	Intron	130106619	+1	tier1	-	no_errors	ENST00000373387	ensembl	human	known	74_37	splice_site	39.06	39	25	SNP	1.000	T
GMPR	2766	genome.wustl.edu	37	6	16290814	16290814	+	Silent	SNP	C	C	T			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr6:16290814C>T	ENST00000259727.4	+	8	933	c.819C>T	c.(817-819)acC>acT	p.T273T	GMPR_ENST00000544145.1_3'UTR	NM_006877.3	NP_006868.3	P36959	GMPR1_HUMAN	guanosine monophosphate reductase	273					nucleobase-containing small molecule metabolic process (GO:0055086)|nucleotide metabolic process (GO:0009117)|purine nucleobase metabolic process (GO:0006144)|purine-containing compound salvage (GO:0043101)|response to cold (GO:0009409)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|GMP reductase complex (GO:1902560)	GMP reductase activity (GO:0003920)|metal ion binding (GO:0046872)			NS(1)|breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(5)|ovary(1)	20	Breast(50;0.0427)|Ovarian(93;0.103)	all_hematologic(90;0.0895)				GCTCTGACACCGCCATGAACA	0.577																																																	0													149.0	135.0	140.0					6																	16290814		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS4537.1	6p23	2009-07-10			ENSG00000137198	ENSG00000137198	1.7.1.7		4376	protein-coding gene	gene with protein product		139265				2194676	Standard	NM_006877		Approved		uc003nbs.3	P36959	OTTHUMG00000014302	ENST00000259727.4:c.819C>T	6.37:g.16290814C>T			Q96HQ6	Silent	SNP	pfam_IMP_DH_GMPRt,pirsf_GMP_reduct1,tigrfam_GMP_reduct1	p.T273	ENST00000259727.4	37	c.819	CCDS4537.1	6																																																																																			GMPR	-	pfam_IMP_DH_GMPRt,pirsf_GMP_reduct1,tigrfam_GMP_reduct1	ENSG00000137198		0.577	GMPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GMPR	HGNC	protein_coding	OTTHUMT00000039942.2	-	0.00	53	0	C			16290814	+1	tier1	-	no_errors	ENST00000259727	ensembl	human	known	74_37	silent	40.00	17	12	SNP	0.214	T
GOLGB1	2804	genome.wustl.edu	37	3	121413865	121413865	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr3:121413865G>C	ENST00000340645.5	-	13	5615	c.5490C>G	c.(5488-5490)agC>agG	p.S1830R	GOLGB1_ENST00000393667.3_Missense_Mutation_p.S1835R	NM_001256487.1|NM_001256488.1|NM_004487.4	NP_001243416.1|NP_001243417.1|NP_004478.3	Q14789	GOGB1_HUMAN	golgin B1	1830					Golgi organization (GO:0007030)	cis-Golgi network (GO:0005801)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(2)|cervix(2)|endometrium(12)|kidney(3)|large_intestine(26)|liver(2)|lung(36)|ovary(7)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(13)	119				GBM - Glioblastoma multiforme(114;0.0989)		CATCATGTGAGCTGAAATCCT	0.423																																																	0													146.0	152.0	150.0					3																	121413865		2203	4300	6503	SO:0001583	missense	0			X75304	CCDS3004.1, CCDS58847.1, CCDS74989.1	3q13	2010-02-12	2010-02-12	2007-07-27	ENSG00000173230	ENSG00000173230			4429	protein-coding gene	gene with protein product	"""macrogolgin"", ""golgi integral membrane protein 1"""	602500	"""golgi autoantigen, golgin subfamily b, macrogolgin (with transmembrane signal), 1"", ""golgin B1, golgi integral membrane protein"""			7691276, 15004235	Standard	NM_001256486		Approved	GCP, GCP372, giantin, GOLIM1	uc010hrc.4	Q14789	OTTHUMG00000159411	ENST00000340645.5:c.5490C>G	3.37:g.121413865G>C	ENSP00000341848:p.Ser1830Arg		B2ZZ91|D3DN92|E7EP74|Q14398	Missense_Mutation	SNP	superfamily_Prefoldin,superfamily_STAT_TF_coiled-coil,smart_Leu_zip_homeo	p.S1830R	ENST00000340645.5	37	c.5490	CCDS3004.1	3	.	.	.	.	.	.	.	.	.	.	G	0.015	-1.559251	0.00910	.	.	ENSG00000173230	ENST00000340645;ENST00000393667	T;T	0.14640	2.49;2.49	5.41	2.49	0.30216	.	0.092424	0.48286	D	0.000198	T	0.20129	0.0484	M	0.65975	2.015	0.19775	N	0.999957	B;D;D;B	0.53462	0.009;0.96;0.96;0.006	B;P;P;B	0.53649	0.013;0.731;0.731;0.006	T	0.06954	-1.0798	10	0.21014	T	0.42	.	6.0878	0.19976	0.3764:0.0:0.6236:0.0	.	1755;1835;1835;1830	F1T0J2;E7EP74;B2ZZ91;Q14789	.;.;.;GOGB1_HUMAN	R	1830;1835	ENSP00000341848:S1830R;ENSP00000377275:S1835R	ENSP00000341848:S1830R	S	-	3	2	GOLGB1	122896555	0.000000	0.05858	0.159000	0.22649	0.041000	0.13682	-0.166000	0.09954	0.853000	0.35312	-0.137000	0.14449	AGC	GOLGB1	-	NULL	ENSG00000173230		0.423	GOLGB1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	GOLGB1	HGNC	protein_coding	OTTHUMT00000355159.1	-	0.00	55	0	G	NM_004487		121413865	-1	tier1	-	no_errors	ENST00000340645	ensembl	human	known	74_37	missense	24.19	47	15	SNP	0.401	C
GPATCH3	63906	genome.wustl.edu	37	1	27226852	27226852	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr1:27226852G>A	ENST00000361720.5	-	1	105	c.82C>T	c.(82-84)Cat>Tat	p.H28Y		NM_022078.2	NP_071361.2	Q96I76	GPTC3_HUMAN	G patch domain containing 3	28							nucleic acid binding (GO:0003676)			endometrium(2)|large_intestine(1)|lung(11)|skin(1)	15		all_cancers(24;1.29e-21)|all_epithelial(13;2.35e-19)|Colorectal(325;0.000147)|all_lung(284;0.00122)|Lung NSC(340;0.00128)|Breast(348;0.00131)|Renal(390;0.00211)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0707)|all_neural(195;0.0966)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Epithelial(14;3.97e-51)|OV - Ovarian serous cystadenocarcinoma(117;9.55e-30)|Colorectal(126;5.31e-09)|COAD - Colon adenocarcinoma(152;9.31e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000513)|STAD - Stomach adenocarcinoma(196;0.000595)|KIRC - Kidney renal clear cell carcinoma(1967;0.00072)|READ - Rectum adenocarcinoma(331;0.0419)		CTCCGTAAATGGGCCGAGCGC	0.632																																																	0													38.0	38.0	38.0					1																	27226852		2203	4299	6502	SO:0001583	missense	0			BC007767	CCDS290.1	1p35.3-p35.1	2013-01-28		2006-12-13	ENSG00000198746	ENSG00000198746		"""G patch domain containing"""	25720	protein-coding gene	gene with protein product				GPATC3			Standard	NM_022078		Approved	FLJ12455	uc001bne.3	Q96I76	OTTHUMG00000004229	ENST00000361720.5:c.82C>T	1.37:g.27226852G>A	ENSP00000354645:p.His28Tyr		Q5JYH2|Q8NDJ2|Q9H9Z3	Missense_Mutation	SNP	pfam_G_patch_dom,smart_G_patch_dom,pfscan_G_patch_dom	p.H28Y	ENST00000361720.5	37	c.82	CCDS290.1	1	.	.	.	.	.	.	.	.	.	.	G	17.78	3.473089	0.63737	.	.	ENSG00000198746	ENST00000361720;ENST00000536641	T	0.29917	1.55	5.5	5.5	0.81552	.	0.294700	0.38436	N	0.001694	T	0.22475	0.0542	N	0.19112	0.55	0.80722	D	1	B	0.24533	0.105	B	0.22601	0.04	T	0.03739	-1.1008	10	0.72032	D	0.01	-3.6893	13.905	0.63828	0.0:0.1522:0.8478:0.0	.	28	Q96I76	GPTC3_HUMAN	Y	28	ENSP00000354645:H28Y	ENSP00000354645:H28Y	H	-	1	0	GPATCH3	27099439	1.000000	0.71417	0.993000	0.49108	0.986000	0.74619	4.162000	0.58177	2.854000	0.98071	0.655000	0.94253	CAT	GPATCH3	-	NULL	ENSG00000198746		0.632	GPATCH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPATCH3	HGNC	protein_coding	OTTHUMT00000012181.1	-	0.00	73	0	G	NM_022078		27226852	-1	tier1	-	no_errors	ENST00000361720	ensembl	human	known	74_37	missense	15.62	81	15	SNP	1.000	A
GPATCH3	63906	genome.wustl.edu	37	1	27226854	27226856	+	In_Frame_Del	DEL	GCC	GCC	-	rs147405790		TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	GCC	GCC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr1:27226854_27226856delGCC	ENST00000361720.5	-	1	101_103	c.78_80delGGC	c.(76-81)tcggcc>tcc	p.A27del		NM_022078.2	NP_071361.2	Q96I76	GPTC3_HUMAN	G patch domain containing 3	27							nucleic acid binding (GO:0003676)			endometrium(2)|large_intestine(1)|lung(11)|skin(1)	15		all_cancers(24;1.29e-21)|all_epithelial(13;2.35e-19)|Colorectal(325;0.000147)|all_lung(284;0.00122)|Lung NSC(340;0.00128)|Breast(348;0.00131)|Renal(390;0.00211)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0707)|all_neural(195;0.0966)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Epithelial(14;3.97e-51)|OV - Ovarian serous cystadenocarcinoma(117;9.55e-30)|Colorectal(126;5.31e-09)|COAD - Colon adenocarcinoma(152;9.31e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000513)|STAD - Stomach adenocarcinoma(196;0.000595)|KIRC - Kidney renal clear cell carcinoma(1967;0.00072)|READ - Rectum adenocarcinoma(331;0.0419)		CCGTAAATGGGCCGAGCGCAACA	0.626																																																	0																																										SO:0001651	inframe_deletion	0			BC007767	CCDS290.1	1p35.3-p35.1	2013-01-28		2006-12-13	ENSG00000198746	ENSG00000198746		"""G patch domain containing"""	25720	protein-coding gene	gene with protein product				GPATC3			Standard	NM_022078		Approved	FLJ12455	uc001bne.3	Q96I76	OTTHUMG00000004229	ENST00000361720.5:c.78_80delGGC	1.37:g.27226854_27226856delGCC	ENSP00000354645:p.Ala27del		Q5JYH2|Q8NDJ2|Q9H9Z3	In_Frame_Del	DEL	pfam_G_patch_dom,smart_G_patch_dom,pfscan_G_patch_dom	p.A27in_frame_del	ENST00000361720.5	37	c.80_78	CCDS290.1	1																																																																																			GPATCH3	-	NULL	ENSG00000198746		0.626	GPATCH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPATCH3	HGNC	protein_coding	OTTHUMT00000012181.1		0.00	73	0	GCC	NM_022078		27226856	-1	tier1		no_errors	ENST00000361720	ensembl	human	known	74_37	in_frame_del	13.83	81	13	DEL	1.000:1.000:1.000	-
GPC6	10082	genome.wustl.edu	37	13	94680021	94680021	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr13:94680021G>T	ENST00000377047.4	+	4	1365	c.750G>T	c.(748-750)aaG>aaT	p.K250N	RNA5SP35_ENST00000391257.1_RNA	NM_005708.3	NP_005699.1	Q9Y625	GPC6_HUMAN	glypican 6	250					carbohydrate metabolic process (GO:0005975)|cell migration (GO:0016477)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	anchored component of membrane (GO:0031225)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)				NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(13)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	38	all_neural(89;0.0684)|Medulloblastoma(90;0.163)	all_cancers(2;5.48e-07)|all_epithelial(2;5.69e-08)|all_lung(2;2.19e-05)|Lung NSC(4;6.09e-05)|Breast(118;0.0395)|Renal(2;0.0568)|Hepatocellular(115;0.217)				CCCTCATGAAGATGCTGTACT	0.483																																																	0													155.0	143.0	147.0					13																	94680021		2203	4300	6503	SO:0001583	missense	0			AF111178	CCDS9469.1	13q32	2008-02-05			ENSG00000183098	ENSG00000183098		"""Proteoglycans / Cell Surface : Glypicans"""	4454	protein-coding gene	gene with protein product	"""glypican proteoglycan 6"""	604404				10329016	Standard	NM_005708		Approved		uc001vlt.3	Q9Y625	OTTHUMG00000017205	ENST00000377047.4:c.750G>T	13.37:g.94680021G>T	ENSP00000366246:p.Lys250Asn		A8K279|Q96SG5|Q96SG8|Q9H1P4	Missense_Mutation	SNP	pfam_Glypican	p.K250N	ENST00000377047.4	37	c.750	CCDS9469.1	13	.	.	.	.	.	.	.	.	.	.	G	35	5.499060	0.96355	.	.	ENSG00000183098	ENST00000377047	T	0.61742	0.08	5.92	5.92	0.95590	.	0.000000	0.85682	D	0.000000	T	0.79718	0.4494	M	0.87328	2.875	0.58432	D	0.999999	P;P	0.51147	0.74;0.942	P;P	0.62298	0.588;0.9	T	0.81284	-0.1002	10	0.66056	D	0.02	.	20.3206	0.98668	0.0:0.0:1.0:0.0	.	250;250	B4E2M1;Q9Y625	.;GPC6_HUMAN	N	250	ENSP00000366246:K250N	ENSP00000366246:K250N	K	+	3	2	GPC6	93478022	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.969000	0.87988	2.809000	0.96659	0.655000	0.94253	AAG	GPC6	-	pfam_Glypican	ENSG00000183098		0.483	GPC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPC6	HGNC	protein_coding	OTTHUMT00000045460.4	-	0.00	74	0	G	NM_005708		94680021	+1	tier1	-	no_errors	ENST00000377047	ensembl	human	known	74_37	missense	24.05	58	19	SNP	1.000	T
GPC6	10082	genome.wustl.edu	37	13	94680086	94680086	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr13:94680086A>G	ENST00000377047.4	+	4	1430	c.815A>G	c.(814-816)aAc>aGc	p.N272S	RNA5SP35_ENST00000391257.1_RNA	NM_005708.3	NP_005699.1	Q9Y625	GPC6_HUMAN	glypican 6	272					carbohydrate metabolic process (GO:0005975)|cell migration (GO:0016477)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	anchored component of membrane (GO:0031225)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)				NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(13)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	38	all_neural(89;0.0684)|Medulloblastoma(90;0.163)	all_cancers(2;5.48e-07)|all_epithelial(2;5.69e-08)|all_lung(2;2.19e-05)|Lung NSC(4;6.09e-05)|Breast(118;0.0395)|Renal(2;0.0568)|Hepatocellular(115;0.217)				TACTGTCTCAACGTCATGAAG	0.527																																																	0													162.0	147.0	152.0					13																	94680086		2203	4300	6503	SO:0001583	missense	0			AF111178	CCDS9469.1	13q32	2008-02-05			ENSG00000183098	ENSG00000183098		"""Proteoglycans / Cell Surface : Glypicans"""	4454	protein-coding gene	gene with protein product	"""glypican proteoglycan 6"""	604404				10329016	Standard	NM_005708		Approved		uc001vlt.3	Q9Y625	OTTHUMG00000017205	ENST00000377047.4:c.815A>G	13.37:g.94680086A>G	ENSP00000366246:p.Asn272Ser		A8K279|Q96SG5|Q96SG8|Q9H1P4	Missense_Mutation	SNP	pfam_Glypican	p.N272S	ENST00000377047.4	37	c.815	CCDS9469.1	13	.	.	.	.	.	.	.	.	.	.	A	23.3	4.401313	0.83120	.	.	ENSG00000183098	ENST00000377047	T	0.57595	0.39	5.92	5.92	0.95590	Glypican, conserved site (1);	0.000000	0.85682	D	0.000000	T	0.80053	0.4553	M	0.93594	3.435	0.53005	D	0.999966	D;D	0.89917	0.994;1.0	D;D	0.91635	0.967;0.999	D	0.84998	0.0898	10	0.62326	D	0.03	.	16.3631	0.83280	1.0:0.0:0.0:0.0	.	272;272	B4E2M1;Q9Y625	.;GPC6_HUMAN	S	272	ENSP00000366246:N272S	ENSP00000366246:N272S	N	+	2	0	GPC6	93478087	1.000000	0.71417	0.989000	0.46669	0.680000	0.39746	9.303000	0.96183	2.266000	0.75297	0.533000	0.62120	AAC	GPC6	-	pfam_Glypican	ENSG00000183098		0.527	GPC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPC6	HGNC	protein_coding	OTTHUMT00000045460.4	-	0.00	74	0	A	NM_005708		94680086	+1	tier1	-	no_errors	ENST00000377047	ensembl	human	known	74_37	missense	26.92	57	21	SNP	1.000	G
GPC6	10082	genome.wustl.edu	37	13	94680141	94680141	+	Silent	SNP	G	G	A			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr13:94680141G>A	ENST00000377047.4	+	4	1485	c.870G>A	c.(868-870)ctG>ctA	p.L290L	RNA5SP35_ENST00000391257.1_RNA	NM_005708.3	NP_005699.1	Q9Y625	GPC6_HUMAN	glypican 6	290					carbohydrate metabolic process (GO:0005975)|cell migration (GO:0016477)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	anchored component of membrane (GO:0031225)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)				NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(13)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	38	all_neural(89;0.0684)|Medulloblastoma(90;0.163)	all_cancers(2;5.48e-07)|all_epithelial(2;5.69e-08)|all_lung(2;2.19e-05)|Lung NSC(4;6.09e-05)|Breast(118;0.0395)|Renal(2;0.0568)|Hepatocellular(115;0.217)				AGTGGAATCTGTTTATAGGTA	0.493																																																	0													101.0	94.0	96.0					13																	94680141		2203	4300	6503	SO:0001819	synonymous_variant	0			AF111178	CCDS9469.1	13q32	2008-02-05			ENSG00000183098	ENSG00000183098		"""Proteoglycans / Cell Surface : Glypicans"""	4454	protein-coding gene	gene with protein product	"""glypican proteoglycan 6"""	604404				10329016	Standard	NM_005708		Approved		uc001vlt.3	Q9Y625	OTTHUMG00000017205	ENST00000377047.4:c.870G>A	13.37:g.94680141G>A			A8K279|Q96SG5|Q96SG8|Q9H1P4	Silent	SNP	pfam_Glypican	p.L290	ENST00000377047.4	37	c.870	CCDS9469.1	13																																																																																			GPC6	-	pfam_Glypican	ENSG00000183098		0.493	GPC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPC6	HGNC	protein_coding	OTTHUMT00000045460.4	-	0.00	63	0	G	NM_005708		94680141	+1	tier1	-	no_errors	ENST00000377047	ensembl	human	known	74_37	silent	28.07	41	16	SNP	0.984	A
GPR56	9289	genome.wustl.edu	37	16	57690476	57690476	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr16:57690476G>C	ENST00000388812.4	+	9	1554	c.1114G>C	c.(1114-1116)Gaa>Caa	p.E372Q	GPR56_ENST00000562631.1_Missense_Mutation_p.E372Q|GPR56_ENST00000379694.4_Missense_Mutation_p.E202Q|GPR56_ENST00000456916.1_Missense_Mutation_p.E372Q|GPR56_ENST00000568908.1_Missense_Mutation_p.E372Q|GPR56_ENST00000538815.1_Missense_Mutation_p.E372Q|GPR56_ENST00000567835.1_Missense_Mutation_p.E372Q|GPR56_ENST00000562558.1_Missense_Mutation_p.E372Q|GPR56_ENST00000568909.1_Missense_Mutation_p.E372Q|GPR56_ENST00000540164.2_Missense_Mutation_p.E372Q|GPR56_ENST00000544297.1_Missense_Mutation_p.E197Q|GPR56_ENST00000379696.3_Missense_Mutation_p.E372Q|GPR56_ENST00000388813.5_Missense_Mutation_p.E372Q			Q9Y653	GPR56_HUMAN	G protein-coupled receptor 56	372	GPS. {ECO:0000255|PROSITE- ProRule:PRU00098}.				angiogenesis (GO:0001525)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|cerebral cortex radial glia guided migration (GO:0021801)|G-protein coupled receptor signaling pathway (GO:0007186)|layer formation in cerebral cortex (GO:0021819)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron migration (GO:2001223)|neuropeptide signaling pathway (GO:0007218)|positive regulation of cell adhesion (GO:0045785)|positive regulation of Rho protein signal transduction (GO:0035025)|protein kinase C signaling (GO:0070528)|Rho protein signal transduction (GO:0007266)|vascular endothelial growth factor production (GO:0010573)	extracellular vesicular exosome (GO:0070062)|glial limiting end-foot (GO:0097451)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	collagen binding (GO:0005518)|extracellular matrix binding (GO:0050840)|G-protein coupled receptor activity (GO:0004930)			kidney(1)|large_intestine(3)|lung(9)|prostate(1)|skin(1)	15						CGTCAGGAGAGAAACCCAAAC	0.617																																																	0													180.0	148.0	159.0					16																	57690476		2198	4300	6498	SO:0001583	missense	0			AJ011001	CCDS32460.1, CCDS32461.1, CCDS73893.1	16q13	2014-08-08				ENSG00000205336		"""-"", ""GPCR / Class B : Orphans"""	4512	protein-coding gene	gene with protein product		604110				10049584, 10100861	Standard	XM_005256237		Approved	TM7LN4, TM7XN1	uc002emb.2	Q9Y653		ENST00000388812.4:c.1114G>C	16.37:g.57690476G>C	ENSP00000373464:p.Glu372Gln		A6NIT7|A6NJV9|B0M0K4|B4DR54|O95966|Q6ZMP1|Q8NGB3|Q96HB4	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_GPS_dom,smart_GPS_dom,prints_GPCR_2_orphan_rcpt_GPR56,prints_GPCR_2_secretin-like,pfscan_GPS_dom,pfscan_GPCR_2-like	p.E372Q	ENST00000388812.4	37	c.1114	CCDS32460.1	16	.	.	.	.	.	.	.	.	.	.	G	12.55	1.970517	0.34754	.	.	ENSG00000205336	ENST00000388813;ENST00000388812;ENST00000538815;ENST00000456916;ENST00000540164;ENST00000544297;ENST00000379694;ENST00000379696	T;T;T;T;T;T;T;T	0.69435	-0.4;-0.4;-0.4;-0.4;-0.4;-0.4;-0.4;-0.4	5.57	4.61	0.57282	GPS domain (3);	0.569102	0.17844	N	0.160107	T	0.65923	0.2738	L	0.27975	0.815	0.09310	N	1	P;D;B;D;P	0.62365	0.937;0.991;0.356;0.991;0.939	P;P;B;P;P	0.56960	0.572;0.81;0.098;0.81;0.625	T	0.57871	-0.7736	10	0.17832	T	0.49	.	15.1737	0.72894	0.0:0.1419:0.8581:0.0	.	197;377;372;372;202	F5H144;B4DR54;Q9Y653-2;Q9Y653;E7ENB2	.;.;.;GPR56_HUMAN;.	Q	372;372;372;372;372;197;202;372	ENSP00000373465:E372Q;ENSP00000373464:E372Q;ENSP00000444415:E372Q;ENSP00000398034:E372Q;ENSP00000444911:E372Q;ENSP00000438006:E197Q;ENSP00000369016:E202Q;ENSP00000369018:E372Q	ENSP00000369016:E202Q	E	+	1	0	GPR56	56247977	0.194000	0.23325	0.053000	0.19242	0.212000	0.24457	1.418000	0.34782	1.337000	0.45525	-0.300000	0.09419	GAA	GPR56	-	pfam_GPS_dom,smart_GPS_dom,pfscan_GPS_dom	ENSG00000205336		0.617	GPR56-203	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GPR56	HGNC	protein_coding	OTTHUMT00000433436.3	-	0.00	36	0	G			57690476	+1	tier1	-	no_errors	ENST00000379696	ensembl	human	known	74_37	missense	23.68	29	9	SNP	0.097	C
GPR98	84059	genome.wustl.edu	37	5	90106393	90106393	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr5:90106393G>A	ENST00000405460.2	+	74	15412	c.15316G>A	c.(15316-15318)Gat>Aat	p.D5106N	GPR98_ENST00000425867.2_Missense_Mutation_p.D767N	NM_032119.3	NP_115495.3	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98	5106					detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|G-protein coupled receptor signaling pathway (GO:0007186)|inner ear receptor stereocilium organization (GO:0060122)|maintenance of organ identity (GO:0048496)|nervous system development (GO:0007399)|neurological system process (GO:0050877)|neuropeptide signaling pathway (GO:0007218)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|stereocilia ankle link complex (GO:0002142)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(4)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(18)|large_intestine(46)|liver(2)|lung(80)|ovary(12)|pancreas(5)|prostate(1)|skin(50)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(6)	269		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		ACAAAAGTTTGATGTTAATTG	0.343																																																	0													116.0	116.0	116.0					5																	90106393		1835	4085	5920	SO:0001583	missense	0			AB014586	CCDS47246.1	5q13	2014-08-08	2006-05-26	2006-05-26	ENSG00000164199	ENSG00000164199		"""-"", ""GPCR / Class B : Orphans"""	17416	protein-coding gene	gene with protein product		602851	"""monogenic, audiogenic seizure susceptibility 1 homolog (mouse)"""	USH2C, MASS1		10976914, 14740321	Standard	NM_032119		Approved	DKFZp761P0710, KIAA0686, FEB4, VLGR1b	uc003kju.3	Q8WXG9	OTTHUMG00000162668	ENST00000405460.2:c.15316G>A	5.37:g.90106393G>A	ENSP00000384582:p.Asp5106Asn		O75171|Q8TF58|Q9H0X5|Q9UL61	Missense_Mutation	SNP	pfam_Calx_beta,pfam_EPTP,pfam_GPCR_2_secretin-like,pfam_GPS_dom,superfamily_ConA-like_lec_gl_sf,superfamily_Gal_Oxase/kelch_b-propeller,smart_Calx_beta,pfscan_EAR,pfscan_GPS_dom,pfscan_GPCR_2-like	p.D5106N	ENST00000405460.2	37	c.15316	CCDS47246.1	5	.	.	.	.	.	.	.	.	.	.	G	4.772	0.143619	0.09134	.	.	ENSG00000164199	ENST00000405460;ENST00000296619;ENST00000425867	T;T	0.35605	1.3;1.3	5.37	3.45	0.39498	.	0.658584	0.17407	N	0.175330	T	0.28466	0.0704	L	0.50333	1.59	0.09310	N	1	B;B;B	0.34015	0.309;0.002;0.435	B;B;B	0.30572	0.055;0.002;0.117	T	0.12319	-1.0552	9	.	.	.	.	7.4986	0.27505	0.1742:0.1348:0.691:0.0	.	767;5106;767	E7EML1;Q8WXG9;Q8WXG9-2	.;GPR98_HUMAN;.	N	5106;5106;767	ENSP00000384582:D5106N;ENSP00000392618:D767N	.	D	+	1	0	GPR98	90142149	0.948000	0.32251	0.006000	0.13384	0.212000	0.24457	2.151000	0.42263	0.640000	0.30582	0.563000	0.77884	GAT	GPR98	-	NULL	ENSG00000164199		0.343	GPR98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR98	HGNC	protein_coding	OTTHUMT00000369993.2	-	0.00	33	0	G	NM_032119		90106393	+1	tier1	-	no_errors	ENST00000405460	ensembl	human	known	74_37	missense	27.03	27	10	SNP	0.012	A
GRK4	2868	genome.wustl.edu	37	4	3030927	3030927	+	Splice_Site	SNP	G	G	T			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr4:3030927G>T	ENST00000398052.4	+	12	1403		c.e12-1		GRK4_ENST00000398051.4_Splice_Site|GRK4_ENST00000504933.1_Splice_Site|GRK4_ENST00000509545.1_Splice_Site|GRK4_ENST00000345167.6_Splice_Site	NM_182982.2	NP_892027.2	P32298	GRK4_HUMAN	G protein-coupled receptor kinase 4						G-protein coupled receptor internalization (GO:0002031)|receptor internalization (GO:0031623)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|signal transduction (GO:0007165)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytosol (GO:0005829)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)	ATP binding (GO:0005524)|G-protein coupled receptor kinase activity (GO:0004703)|rhodopsin kinase activity (GO:0050254)			lung(1)|upper_aerodigestive_tract(1)	2				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		TTGTTATGTAGCACCTGAAGT	0.338																																																	0													71.0	71.0	71.0					4																	3030927		2203	4300	6503	SO:0001630	splice_region_variant	0				CCDS33946.1, CCDS33947.1, CCDS47002.1, CCDS68656.1	4p16.3	2008-02-05	2004-02-04	2004-02-06	ENSG00000125388	ENSG00000125388			4543	protein-coding gene	gene with protein product		137026	"""G protein-coupled receptor kinase 2-like (Drosophila)"""	GPRK2L		1338872	Standard	NM_182982		Approved	GPRK4	uc003ggn.1	P32298	OTTHUMG00000159914	ENST00000398052.4:c.1061-1G>T	4.37:g.3030927G>T			O00641|O00642|Q13293|Q13294|Q13295|Q14453|Q14725|Q15313|Q15314|Q15315|Q15316|Q17RH6|Q53EQ8	Splice_Site	SNP	-	e12-1	ENST00000398052.4	37	c.1061-1	CCDS33946.1	4	.	.	.	.	.	.	.	.	.	.	G	11.45	1.643110	0.29246	.	.	ENSG00000125388	ENST00000398051;ENST00000398052;ENST00000345167;ENST00000504933	.	.	.	5.02	5.02	0.67125	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.6978	0.88286	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	GRK4	3000725	1.000000	0.71417	0.996000	0.52242	0.118000	0.20060	9.606000	0.98325	2.475000	0.83589	0.643000	0.83706	.	GRK4	-	-	ENSG00000125388		0.338	GRK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRK4	HGNC	protein_coding	OTTHUMT00000358176.2	-	0.00	73	0	G	NM_005307	Intron	3030927	+1	tier1	-	no_errors	ENST00000398052	ensembl	human	known	74_37	splice_site	5.56	68	4	SNP	1.000	T
HACE1	57531	genome.wustl.edu	37	6	105239382	105239382	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr6:105239382G>T	ENST00000262903.4	-	11	1347	c.1071C>A	c.(1069-1071)ttC>ttA	p.F357L	HACE1_ENST00000369125.2_Missense_Mutation_p.F357L	NM_020771.3	NP_065822.2	Q8IYU2	HACE1_HUMAN	HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1	357					cell cycle (GO:0007049)|Golgi organization (GO:0007030)|membrane fusion (GO:0061025)|protein K48-linked ubiquitination (GO:0070936)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|Rac protein signal transduction (GO:0016601)|regulation of cell migration (GO:0030334)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	endoplasmic reticulum (GO:0005783)|Golgi membrane (GO:0000139)|nucleus (GO:0005634)	ligase activity (GO:0016874)|Rab GTPase binding (GO:0017137)|Rac GTPase binding (GO:0048365)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(11)|lung(17)|ovary(5)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	44		all_cancers(87;6.89e-05)|Acute lymphoblastic leukemia(125;1.9e-08)|all_hematologic(75;9.25e-07)|all_epithelial(87;0.0216)|Colorectal(196;0.202)		BRCA - Breast invasive adenocarcinoma(108;0.122)|Epithelial(106;0.204)		TTCTCACCTTGAACACCTGGC	0.393																																																	0													165.0	156.0	159.0					6																	105239382		2203	4300	6503	SO:0001583	missense	0			BC034982	CCDS5050.1	6q21	2013-01-10	2012-02-23		ENSG00000085382	ENSG00000085382		"""Ankyrin repeat domain containing"""	21033	protein-coding gene	gene with protein product		610876				10718198	Standard	NM_020771		Approved	KIAA1320	uc003pqu.1	Q8IYU2	OTTHUMG00000015287	ENST00000262903.4:c.1071C>A	6.37:g.105239382G>T	ENSP00000262903:p.Phe357Leu		A8K6U5|B3KY89|B4DFM6|B4DTQ4|B7Z9X6|E9PGP0|Q5VU99|Q5VUA0|Q8ND12|Q9P2M6	Missense_Mutation	SNP	pfam_HECT,pfam_Ankyrin_rpt,superfamily_HECT,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_HECT,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_HECT,prints_Ankyrin_rpt	p.F357L	ENST00000262903.4	37	c.1071	CCDS5050.1	6	.	.	.	.	.	.	.	.	.	.	G	18.07	3.542485	0.65198	.	.	ENSG00000085382	ENST00000262903;ENST00000369125	T;T	0.38887	1.13;1.11	5.84	4.97	0.65823	.	0.045094	0.85682	N	0.000000	T	0.16557	0.0398	L	0.29908	0.895	0.80722	D	1	B;B	0.06786	0.0;0.001	B;B	0.04013	0.0;0.001	T	0.07693	-1.0759	10	0.14656	T	0.56	.	16.9769	0.86315	0.0:0.1276:0.8723:0.0	.	357;357	E9PGP0;Q8IYU2	.;HACE1_HUMAN	L	357	ENSP00000262903:F357L;ENSP00000358121:F357L	ENSP00000262903:F357L	F	-	3	2	HACE1	105346075	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.532000	0.53553	1.445000	0.47624	0.650000	0.86243	TTC	HACE1	-	NULL	ENSG00000085382		0.393	HACE1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	HACE1	HGNC	protein_coding	OTTHUMT00000041643.2	-	0.00	68	0	G	XM_045095		105239382	-1	tier1	-	no_errors	ENST00000262903	ensembl	human	known	74_37	missense	5.71	66	4	SNP	1.000	T
GRM1	2911	genome.wustl.edu	37	6	146720652	146720652	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr6:146720652C>T	ENST00000282753.1	+	7	2712	c.2477C>T	c.(2476-2478)gCt>gTt	p.A826V	GRM1_ENST00000392299.2_Missense_Mutation_p.A826V|GRM1_ENST00000507907.1_Missense_Mutation_p.A826V|GRM1_ENST00000361719.2_Missense_Mutation_p.A826V|GRM1_ENST00000355289.4_Missense_Mutation_p.A826V|GRM1_ENST00000492807.2_Missense_Mutation_p.A826V			Q13255	GRM1_HUMAN	glutamate receptor, metabotropic 1	826					activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|cell death (GO:0008219)|cellular response to electrical stimulus (GO:0071257)|dimeric G-protein coupled receptor signaling pathway (GO:0038042)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|G-protein coupled receptor signaling pathway (GO:0007186)|locomotory behavior (GO:0007626)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of sensory perception of pain (GO:0051930)|regulation of synaptic transmission, glutamatergic (GO:0051966)|sensory perception of pain (GO:0019233)|synaptic transmission (GO:0007268)	dendrite (GO:0030425)|G-protein coupled receptor dimeric complex (GO:0038037)|G-protein coupled receptor homodimeric complex (GO:0038038)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)			NS(2)|breast(5)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(54)|ovary(7)|pancreas(2)|prostate(5)|skin(7)|upper_aerodigestive_tract(4)|urinary_tract(1)	126		Ovarian(120;0.0387)		OV - Ovarian serous cystadenocarcinoma(155;5.35e-08)|GBM - Glioblastoma multiforme(68;0.00762)		GTAACAGTGGCTCTGGGGTGC	0.483																																																	0													148.0	118.0	128.0					6																	146720652		2203	4300	6503	SO:0001583	missense	0			U31215	CCDS5209.1, CCDS47497.1, CCDS64548.1	6q24	2014-06-12			ENSG00000152822	ENSG00000152822		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4593	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 85"""	604473				9076744, 9376535	Standard	NM_001278064		Approved	GPRC1A, mGlu1, MGLUR1, PPP1R85	uc010khw.2	Q13255	OTTHUMG00000015752	ENST00000282753.1:c.2477C>T	6.37:g.146720652C>T	ENSP00000282753:p.Ala826Val		B9EG79|F8W805|Q13256|Q14757|Q14758|Q5VTF7|Q5VTF8|Q9NU10|Q9UGS9|Q9UGT0	Missense_Mutation	SNP	pfam_ANF_lig-bd_rcpt,pfam_GPCR_3_C,pfam_Metabotropic_Glu_rcpt_Homer-bd,pfam_GPCR_3_9-Cys_dom,superfamily_Peripla_BP_I,pfscan_GPCR_3_C,prints_GPCR_3_mtglu_rcpt_1,prints_GPCR_3,prints_GPCR_3_mtglu_rcpt,prints_GPCR_3_mtglu_rcpt_5	p.A826V	ENST00000282753.1	37	c.2477	CCDS5209.1	6	.	.	.	.	.	.	.	.	.	.	C	18.64	3.667117	0.67814	.	.	ENSG00000152822	ENST00000361719;ENST00000392299;ENST00000492807;ENST00000282753;ENST00000355289;ENST00000507907	D;D;D;D;D;D	0.86769	-2.17;-2.17;-2.17;-2.17;-2.17;-2.17	5.68	5.68	0.88126	GPCR, family 3, C-terminal (2);	0.000000	0.85682	D	0.000000	D	0.86456	0.5937	N	0.17723	0.515	0.80722	D	1	D;D;D	0.89917	0.983;1.0;0.994	D;D;P	0.91635	0.915;0.999;0.885	D	0.84628	0.0688	10	0.27082	T	0.32	.	19.7753	0.96389	0.0:1.0:0.0:0.0	.	826;826;826	F8W805;Q13255;Q13255-2	.;GRM1_HUMAN;.	V	826	ENSP00000354896:A826V;ENSP00000376119:A826V;ENSP00000424095:A826V;ENSP00000282753:A826V;ENSP00000347437:A826V;ENSP00000425599:A826V	ENSP00000282753:A826V	A	+	2	0	GRM1	146762345	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.089000	0.71384	2.686000	0.91538	0.585000	0.79938	GCT	GRM1	-	pfam_GPCR_3_C,pfscan_GPCR_3_C,prints_GPCR_3_mtglu_rcpt	ENSG00000152822		0.483	GRM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRM1	HGNC	protein_coding	OTTHUMT00000042574.1	-	0.00	63	0	C	NM_000838		146720652	+1	tier1	-	no_errors	ENST00000282753	ensembl	human	known	74_37	missense	37.14	44	26	SNP	1.000	T
HAPLN4	404037	genome.wustl.edu	37	19	19369550	19369550	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr19:19369550G>A	ENST00000291481.7	-	4	662	c.599C>T	c.(598-600)gCg>gTg	p.A200V	AC138430.4_ENST00000586064.2_RNA	NM_023002.2	NP_075378.1	Q86UW8	HPLN4_HUMAN	hyaluronan and proteoglycan link protein 4	200	Link 1. {ECO:0000255|PROSITE- ProRule:PRU00323, ECO:0000305}.				cell adhesion (GO:0007155)	proteinaceous extracellular matrix (GO:0005578)	hyaluronic acid binding (GO:0005540)			NS(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(7)|pancreas(1)|prostate(1)	16			Epithelial(12;0.00575)		Hyaluronan(DB08818)	GCGCCAGGCCGCGTGCAGCTG	0.716																																																	0													11.0	11.0	11.0					19																	19369550		2188	4273	6461	SO:0001583	missense	0			AB107883	CCDS12398.1	19p13.1	2013-01-11						"""Immunoglobulin superfamily / V-set domain containing"""	31357	protein-coding gene	gene with protein product	"""brain link protein 2"""					12663660	Standard	NM_023002		Approved	BRAL2, KIAA1926	uc002nmb.3	Q86UW8		ENST00000291481.7:c.599C>T	19.37:g.19369550G>A	ENSP00000291481:p.Ala200Val		A5PKW5|Q96PW2	Missense_Mutation	SNP	pfam_Link,pfam_Ig_V-set,superfamily_C-type_lectin_fold,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Link,pfscan_Link,pfscan_Ig-like_dom,prints_Link	p.A200V	ENST00000291481.7	37	c.599	CCDS12398.1	19	.	.	.	.	.	.	.	.	.	.	G	19.93	3.918679	0.73098	.	.	ENSG00000187664	ENST00000291481	T	0.12774	2.65	3.97	3.97	0.46021	C-type lectin fold (1);Link (4);C-type lectin-like (1);	0.230090	0.35124	N	0.003434	T	0.20740	0.0499	M	0.78801	2.425	0.29950	N	0.820341	P	0.49783	0.928	P	0.45998	0.5	T	0.12344	-1.0551	10	0.45353	T	0.12	-16.2039	9.0847	0.36574	0.0:0.0:0.6599:0.3401	.	200	Q86UW8	HPLN4_HUMAN	V	200	ENSP00000291481:A200V	ENSP00000291481:A200V	A	-	2	0	HAPLN4	19230550	1.000000	0.71417	1.000000	0.80357	0.594000	0.36715	2.579000	0.46059	2.055000	0.61198	0.313000	0.20887	GCG	HAPLN4	-	pfam_Link,superfamily_C-type_lectin_fold,smart_Link,pfscan_Link	ENSG00000187664		0.716	HAPLN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HAPLN4	HGNC	protein_coding	OTTHUMT00000460117.2	-	0.00	70	0	G	NM_023002		19369550	-1	tier1	-	no_errors	ENST00000291481	ensembl	human	known	74_37	missense	30.77	45	20	SNP	1.000	A
HECW2	57520	genome.wustl.edu	37	2	197184343	197184343	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr2:197184343T>G	ENST00000260983.3	-	9	1453	c.1271A>C	c.(1270-1272)gAa>gCa	p.E424A	HECW2_ENST00000409111.1_Missense_Mutation_p.E68A	NM_020760.1	NP_065811.1	Q9P2P5	HECW2_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2	424					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			biliary_tract(1)|breast(3)|central_nervous_system(4)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(24)|lung(45)|ovary(5)|pancreas(2)|prostate(2)|skin(10)|upper_aerodigestive_tract(2)|urinary_tract(2)	113						GCCATTGTGTTCGATAGCATC	0.512																																																	0													69.0	71.0	70.0					2																	197184343		2203	4300	6503	SO:0001583	missense	0			AL390186	CCDS33354.1	2q32.3	2004-12-13			ENSG00000138411	ENSG00000138411			29853	protein-coding gene	gene with protein product						10718198, 12890487	Standard	NM_020760		Approved	KIAA1301, NEDL2	uc002utm.1	Q9P2P5	OTTHUMG00000154435	ENST00000260983.3:c.1271A>C	2.37:g.197184343T>G	ENSP00000260983:p.Glu424Ala		B8ZZB4|Q17RT5|Q68DF8|Q9NPS9	Missense_Mutation	SNP	pfam_HECT,pfam_WW_dom,pfam_C2_dom,superfamily_HECT,superfamily_WW_dom,superfamily_C2_dom,smart_C2_dom,smart_WW_dom,smart_HECT,pfscan_HECT,pfscan_C2_dom,pfscan_WW_dom	p.E424A	ENST00000260983.3	37	c.1271	CCDS33354.1	2	.	.	.	.	.	.	.	.	.	.	T	10.59	1.391546	0.25118	.	.	ENSG00000138411	ENST00000409111;ENST00000260983	T;T	0.44881	0.91;1.0	5.64	4.48	0.54585	.	1.022860	0.07729	N	0.945017	T	0.36413	0.0966	L	0.32530	0.975	0.50171	D	0.999858	B	0.17038	0.02	B	0.19946	0.027	T	0.05468	-1.0883	10	0.51188	T	0.08	.	10.2014	0.43087	0.0:0.0744:0.0:0.9256	.	424	Q9P2P5	HECW2_HUMAN	A	68;424	ENSP00000386775:E68A;ENSP00000260983:E424A	ENSP00000260983:E424A	E	-	2	0	HECW2	196892588	1.000000	0.71417	0.547000	0.28179	0.022000	0.10575	5.326000	0.65875	1.146000	0.42352	0.528000	0.53228	GAA	HECW2	-	NULL	ENSG00000138411		0.512	HECW2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HECW2	HGNC	protein_coding	OTTHUMT00000335199.3		0.00	19	0	T	NM_020760		197184343	-1			no_errors	ENST00000260983	ensembl	human	known	74_37	missense	15.79	16	3	SNP	1.000	G
HERC2P3	283755	genome.wustl.edu	37	15	20588510	20588510	+	RNA	SNP	T	T	C			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr15:20588510T>C	ENST00000428453.1	-	0	4240							Q9BVR0	HRC23_HUMAN	hect domain and RLD 2 pseudogene 3								metal ion binding (GO:0046872)|ubiquitin-protein transferase activity (GO:0004842)			central_nervous_system(1)|endometrium(11)|kidney(2)|large_intestine(1)|lung(14)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	35						AGGGAAAACCTGAGCAACAGC	0.493																																																	0																																												0			AF041081		15q11.2	2010-08-02			ENSG00000180229	ENSG00000180229			4871	pseudogene	pseudogene						9730612	Standard	NR_036432		Approved	D15F37S4, LOC283755	uc001ytg.3	Q9BVR0	OTTHUMG00000157175		15.37:g.20588510T>C				RNA	SNP	-	NULL	ENST00000428453.1	37	NULL		15																																																																																			HERC2P3	-	-	ENSG00000180229		0.493	HERC2P3-014	KNOWN	basic	processed_transcript	HERC2P3	HGNC	pseudogene	OTTHUMT00000347772.2	-	0.00	69	0	T	NG_008269		20588510	-1	tier1	-	no_errors	ENST00000428453	ensembl	human	known	74_37	rna	21.31	48	13	SNP	0.006	C
HIAT1	64645	genome.wustl.edu	37	1	100547618	100547618	+	Silent	SNP	G	G	C	rs189326739		TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr1:100547618G>C	ENST00000370152.3	+	12	1462	c.1326G>C	c.(1324-1326)ctG>ctC	p.L442L	RP4-714D9.2_ENST00000432294.1_RNA|SASS6_ENST00000462159.1_5'Flank	NM_033055.2	NP_149044.2	Q96MC6	HIAT1_HUMAN	hippocampus abundant transcript 1	442					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(8)|skin(1)	16		all_epithelial(167;2.96e-06)|all_lung(203;0.00125)|Lung NSC(277;0.00131)		Epithelial(280;0.0832)|all cancers(265;0.136)|COAD - Colon adenocarcinoma(174;0.148)|Lung(183;0.195)		TGCTGGCTCTGCTTGTTGCCT	0.433																																																	0													111.0	104.0	106.0					1																	100547618		2203	4300	6503	SO:0001819	synonymous_variant	0			AK096669	CCDS763.1	1p21.3	2008-02-05			ENSG00000156875	ENSG00000156875			23363	protein-coding gene	gene with protein product						9299464	Standard	NM_033055		Approved	DKFZP564L0864	uc001dst.3	Q96MC6	OTTHUMG00000010755	ENST00000370152.3:c.1326G>C	1.37:g.100547618G>C			Q6P2N7|Q8N8K2|Q8NBV3|Q96NY0|Q9NT25	Silent	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,prints_Tet-R_TetA/multi-R_MdtG	p.L442	ENST00000370152.3	37	c.1326	CCDS763.1	1																																																																																			HIAT1	-	superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	ENSG00000156875		0.433	HIAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIAT1	HGNC	protein_coding	OTTHUMT00000029657.1	-	0.00	29	0	G	NM_033055		100547618	+1	tier1	-	no_errors	ENST00000370152	ensembl	human	known	74_37	silent	9.52	38	4	SNP	1.000	C
HLX	3142	genome.wustl.edu	37	1	221057991	221057991	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr1:221057991C>G	ENST00000366903.6	+	4	2913	c.1412C>G	c.(1411-1413)gCc>gGc	p.A471G	HLX_ENST00000549319.1_Missense_Mutation_p.A257G	NM_021958.3	NP_068777.1	Q14774	HLX_HUMAN	H2.0-like homeobox	471					cell differentiation (GO:0030154)|embryonic digestive tract morphogenesis (GO:0048557)|enteric nervous system development (GO:0048484)|liver development (GO:0001889)|multicellular organismal development (GO:0007275)|negative regulation of T-helper 2 cell differentiation (GO:0045629)|positive regulation of cell proliferation (GO:0008284)|positive regulation of organ growth (GO:0046622)|positive regulation of T-helper 1 cell differentiation (GO:0045627)|regulation of transcription, DNA-templated (GO:0006355)|skeletal muscle tissue development (GO:0007519)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			breast(1)|central_nervous_system(1)|endometrium(5)|large_intestine(9)|lung(11)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	32				GBM - Glioblastoma multiforme(131;0.00914)		CAGCCCACAGCCAGCAGCGCT	0.677																																																	0													10.0	14.0	13.0					1																	221057991		2185	4279	6464	SO:0001583	missense	0			BC033808	CCDS1527.1	1q41	2011-06-20	2007-07-26	2007-07-26	ENSG00000136630	ENSG00000136630		"""Homeoboxes / ANTP class : NKL subclass"""	4978	protein-coding gene	gene with protein product		142995	"""H2.0 (Drosophila)-like homeo box 1"", ""H2.0-like homeobox 1 (Drosophila)"", ""H2.0-like homeobox 1"""	HLX1		1676597, 7806220	Standard	NM_021958		Approved	HB24	uc001hmv.4	Q14774	OTTHUMG00000037352	ENST00000366903.6:c.1412C>G	1.37:g.221057991C>G	ENSP00000355870:p.Ala471Gly		B2R8A8|Q15988|Q59HE7|Q9NZ75	Missense_Mutation	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom,prints_HTH_motif,prints_Homeobox_metazoa	p.A471G	ENST00000366903.6	37	c.1412	CCDS1527.1	1	.	.	.	.	.	.	.	.	.	.	C	11.68	1.710471	0.30322	.	.	ENSG00000136630	ENST00000366903;ENST00000549319	D;D	0.91740	-2.62;-2.9	4.78	-5.64	0.02466	.	1.509640	0.04402	N	0.364414	T	0.79690	0.4489	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.66881	-0.5811	10	0.59425	D	0.04	-1.88	3.1778	0.06575	0.1375:0.4581:0.1401:0.2643	.	471	Q14774	HLX_HUMAN	G	471;257	ENSP00000355870:A471G;ENSP00000449882:A257G	ENSP00000355870:A471G	A	+	2	0	HLX	219124614	0.000000	0.05858	0.002000	0.10522	0.058000	0.15608	-0.386000	0.07370	-0.630000	0.05567	-0.258000	0.10820	GCC	HLX	-	NULL	ENSG00000136630		0.677	HLX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HLX	HGNC	protein_coding	OTTHUMT00000090902.3	-	0.00	47	0	C	NM_021958		221057991	+1	tier1	-	no_errors	ENST00000366903	ensembl	human	known	74_37	missense	28.57	20	8	SNP	0.000	G
HOXB2	3212	genome.wustl.edu	37	17	46621976	46621976	+	Nonsense_Mutation	SNP	C	C	A			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr17:46621976C>A	ENST00000330070.4	-	1	1465	c.298G>T	c.(298-300)Gag>Tag	p.E100*	HOXB-AS1_ENST00000435312.1_RNA|HOXB-AS1_ENST00000502764.2_RNA|HOXB-AS1_ENST00000508688.1_RNA|HOXB-AS1_ENST00000504972.3_RNA|HOXB2_ENST00000504772.3_5'Flank	NM_002145.3	NP_002136.1	P14652	HXB2_HUMAN	homeobox B2	100					anterior/posterior pattern specification (GO:0009952)|blood circulation (GO:0008015)|dorsal/ventral pattern formation (GO:0009953)|embryonic skeletal system morphogenesis (GO:0048704)|facial nerve structural organization (GO:0021612)|morphogenesis of an epithelial sheet (GO:0002011)|multicellular organismal development (GO:0007275)|neural nucleus development (GO:0048857)|rhombomere 3 development (GO:0021569)|rhombomere 4 development (GO:0021570)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(5)|prostate(1)|skin(1)	11						GATTTCTTCTCTTTCATCCAA	0.692																																																	0													19.0	27.0	24.0					17																	46621976		2194	4294	6488	SO:0001587	stop_gained	0				CCDS11527.1	17q21.32	2012-02-22	2005-12-22		ENSG00000173917	ENSG00000173917		"""Homeoboxes / ANTP class : HOXL subclass"""	5113	protein-coding gene	gene with protein product		142967	"""homeo box B2"""	HOX2, HOX2H		1973146, 1358459	Standard	XM_005257276		Approved		uc002inm.3	P14652	OTTHUMG00000159930	ENST00000330070.4:c.298G>T	17.37:g.46621976C>A	ENSP00000331741:p.Glu100*		P10913|P17485	Nonsense_Mutation	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom,prints_Homeobox_metazoa	p.E100*	ENST00000330070.4	37	c.298	CCDS11527.1	17	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	48|48	14.276967|14.276967	0.99788|0.99788	.|.	.|.	ENSG00000173917|ENSG00000173917	ENST00000330070|ENST00000326226	.|.	.|.	.|.	5.05|5.05	5.05|5.05	0.67936|0.67936	.|.	0.128620|.	0.51477|.	D|.	0.000081|.	.|T	.|0.76793	.|0.4037	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.80221	.|-0.1472	.|4	0.54805|0.72032	T|D	0.06|0.01	.|.	17.3735|17.3735	0.87385|0.87385	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|.	.|.	.|.	X|I	100|14	.|.	ENSP00000331741:E100X|ENSP00000316334:R14I	E|R	-|-	1|2	0|0	HOXB2|HOXB2	43976975|43976975	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	7.114000|7.114000	0.77103|0.77103	2.629000|2.629000	0.89072|0.89072	0.650000|0.650000	0.86243|0.86243	GAG|AGA	HOXB2	-	NULL	ENSG00000173917		0.692	HOXB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HOXB2	HGNC	protein_coding	OTTHUMT00000358384.2	-	0.00	171	0	C			46621976	-1	tier1	-	no_errors	ENST00000330070	ensembl	human	known	74_37	nonsense	26.01	128	45	SNP	1.000	A
HRNR	388697	genome.wustl.edu	37	1	152187200	152187200	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr1:152187200C>T	ENST00000368801.2	-	3	6980	c.6905G>A	c.(6904-6906)cGc>cAc	p.R2302H	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_001009931.1	NP_001009931.1	Q86YZ3	HORN_HUMAN	hornerin	2302					establishment of skin barrier (GO:0061436)|hematopoietic progenitor cell differentiation (GO:0002244)|keratinization (GO:0031424)	cornified envelope (GO:0001533)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(19)|liver(1)|lung(84)|ovary(5)|prostate(6)|skin(12)|stomach(9)|upper_aerodigestive_tract(5)|urinary_tract(6)	192	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			ATGTCGGCCGCGACTAGGAGA	0.612																																																	0													8.0	14.0	12.0					1																	152187200		1562	3800	5362	SO:0001583	missense	0			AB104446	CCDS30859.1	1q21.3	2013-01-10			ENSG00000197915	ENSG00000197915		"""EF-hand domain containing"""	20846	protein-coding gene	gene with protein product	"""filaggrin family member 3"""						Standard	NM_001009931		Approved	S100a18, S100A16, FLG3	uc001ezt.2	Q86YZ3	OTTHUMG00000012243	ENST00000368801.2:c.6905G>A	1.37:g.152187200C>T	ENSP00000357791:p.Arg2302His		Q5DT20|Q5U1F4	Missense_Mutation	SNP	pfam_S100_Ca-bd_sub,pfscan_EF_hand_dom	p.R2302H	ENST00000368801.2	37	c.6905	CCDS30859.1	1	.	.	.	.	.	.	.	.	.	.	-	6.536	0.467234	0.12402	.	.	ENSG00000197915	ENST00000368801	T	0.19394	2.15	3.07	-4.2	0.03823	.	.	.	.	.	T	0.02342	0.0072	N	0.17474	0.49	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.43621	-0.9380	9	0.24483	T	0.36	.	1.6962	0.02863	0.1323:0.2941:0.134:0.4396	.	2302	Q86YZ3	HORN_HUMAN	H	2302	ENSP00000357791:R2302H	ENSP00000357791:R2302H	R	-	2	0	HRNR	150453824	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-5.060000	0.00155	-0.961000	0.03609	-2.109000	0.00356	CGC	HRNR	-	NULL	ENSG00000197915		0.612	HRNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HRNR	HGNC	protein_coding	OTTHUMT00000034016.1	-	0.00	22	0	C	XM_373868		152187200	-1	tier1	-	no_errors	ENST00000368801	ensembl	human	known	74_37	missense	22.22	14	4	SNP	0.000	T
HRNR	388697	genome.wustl.edu	37	1	152192643	152192643	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr1:152192643A>C	ENST00000368801.2	-	3	1537	c.1462T>G	c.(1462-1464)Tcc>Gcc	p.S488A	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_001009931.1	NP_001009931.1	Q86YZ3	HORN_HUMAN	hornerin	488					establishment of skin barrier (GO:0061436)|hematopoietic progenitor cell differentiation (GO:0002244)|keratinization (GO:0031424)	cornified envelope (GO:0001533)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(19)|liver(1)|lung(84)|ovary(5)|prostate(6)|skin(12)|stomach(9)|upper_aerodigestive_tract(5)|urinary_tract(6)	192	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TGGCCGGAGGAGTGACCTGAG	0.532																																																	0													298.0	279.0	285.0					1																	152192643		2203	4300	6503	SO:0001583	missense	0			AB104446	CCDS30859.1	1q21.3	2013-01-10			ENSG00000197915	ENSG00000197915		"""EF-hand domain containing"""	20846	protein-coding gene	gene with protein product	"""filaggrin family member 3"""						Standard	NM_001009931		Approved	S100a18, S100A16, FLG3	uc001ezt.2	Q86YZ3	OTTHUMG00000012243	ENST00000368801.2:c.1462T>G	1.37:g.152192643A>C	ENSP00000357791:p.Ser488Ala		Q5DT20|Q5U1F4	Missense_Mutation	SNP	pfam_S100_Ca-bd_sub,pfscan_EF_hand_dom	p.S488A	ENST00000368801.2	37	c.1462	CCDS30859.1	1	.	.	.	.	.	.	.	.	.	.	A	6.994	0.553624	0.13374	.	.	ENSG00000197915	ENST00000368801	T	0.01455	4.87	3.52	-0.534	0.11883	.	.	.	.	.	T	0.00356	0.0011	N	0.12182	0.205	0.09310	N	1	P	0.51057	0.941	B	0.42916	0.402	T	0.26608	-1.0098	9	0.13470	T	0.59	.	2.6512	0.05000	0.4647:0.0:0.1237:0.4116	.	488	Q86YZ3	HORN_HUMAN	A	488	ENSP00000357791:S488A	ENSP00000357791:S488A	S	-	1	0	HRNR	150459267	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	0.665000	0.25083	-0.325000	0.08577	0.409000	0.27619	TCC	HRNR	-	NULL	ENSG00000197915		0.532	HRNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HRNR	HGNC	protein_coding	OTTHUMT00000034016.1	-	0.00	132	0	A	XM_373868		152192643	-1	tier1	-	no_errors	ENST00000368801	ensembl	human	known	74_37	missense	25.26	71	24	SNP	0.000	C
HSH2D	84941	genome.wustl.edu	37	19	16268588	16268588	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr19:16268588G>T	ENST00000253680.6	+	9	1573	c.1042G>T	c.(1042-1044)Gcc>Tcc	p.A348S	HSH2D_ENST00000593154.2_3'UTR|HSH2D_ENST00000588246.1_3'UTR|HSH2D_ENST00000397372.4_Missense_Mutation_p.A258S			Q96JZ2	HSH2D_HUMAN	hematopoietic SH2 domain containing	348					negative regulation of B cell apoptotic process (GO:0002903)|negative regulation of mitochondrial depolarization (GO:0051902)|positive regulation of signal transduction (GO:0009967)|T cell activation (GO:0042110)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleus (GO:0005634)				central_nervous_system(1)|kidney(1)|large_intestine(2)	4						GCCACCCTTTGCCCCTGGGTA	0.612																																																	0													24.0	28.0	27.0					19																	16268588		1952	4152	6104	SO:0001583	missense	0			AK027792	CCDS74304.1	19p13.12	2013-02-14				ENSG00000196684		"""SH2 domain containing"""	24920	protein-coding gene	gene with protein product		608349				11700021	Standard	NM_032855		Approved	ALX, HSH2, FLJ14886	uc002ndp.4	Q96JZ2		ENST00000253680.6:c.1042G>T	19.37:g.16268588G>T	ENSP00000253680:p.Ala348Ser		B5ME72|Q6ZNG7	Missense_Mutation	SNP	pfam_SH2,smart_SH2,pfscan_SH2,prints_SH2	p.A348S	ENST00000253680.6	37	c.1042		19	.	.	.	.	.	.	.	.	.	.	G	16.04	3.010263	0.54361	.	.	ENSG00000196684	ENST00000397372;ENST00000253680	T	0.61510	0.1	4.16	4.16	0.48862	.	0.000000	0.53938	D	0.000059	T	0.73583	0.3605	.	.	.	0.34795	D	0.736161	D	0.76494	0.999	D	0.75484	0.986	T	0.82598	-0.0378	9	0.87932	D	0	.	12.6744	0.56884	0.0:0.0:1.0:0.0	.	348	Q96JZ2	HSH2D_HUMAN	S	258;348	ENSP00000253680:A348S	ENSP00000253680:A348S	A	+	1	0	HSH2D	16129588	0.998000	0.40836	0.953000	0.39169	0.149000	0.21700	4.561000	0.60809	2.263000	0.75096	0.462000	0.41574	GCC	HSH2D	-	NULL	ENSG00000196684		0.612	HSH2D-201	KNOWN	basic|appris_principal	protein_coding	HSH2D	HGNC	protein_coding			0.00	56	0	G	NM_032855		16268588	+1			no_errors	ENST00000253680	ensembl	human	known	74_37	missense	5.45	52	3	SNP	0.992	T
IGSF22	283284	genome.wustl.edu	37	11	18735564	18735564	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr11:18735564C>A	ENST00000513874.1	-	14	2069	c.1930G>T	c.(1930-1932)Gat>Tat	p.D644Y	RP11-1081L13.4_ENST00000527285.1_RNA	NM_173588.3	NP_775859	Q8N9C0	IGS22_HUMAN	immunoglobulin superfamily, member 22	644	Ig-like 4.									NS(2)|autonomic_ganglia(1)|breast(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(20)|ovary(4)|prostate(4)|skin(3)	56						TCCATGCCATCCTTGTACCAT	0.607																																																	0													122.0	126.0	125.0					11																	18735564		2180	4266	6446	SO:0001583	missense	0			AK095113	CCDS41625.1, CCDS41625.2	11p15.1	2014-06-06			ENSG00000179057	ENSG00000179057		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	26750	protein-coding gene	gene with protein product							Standard	NM_173588		Approved	FLJ37794	uc009yht.2	Q8N9C0	OTTHUMG00000160502	ENST00000513874.1:c.1930G>T	11.37:g.18735564C>A	ENSP00000421191:p.Asp644Tyr		A6NNA0|D6RGV7	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.D644Y	ENST00000513874.1	37	c.1930	CCDS41625.2	11	.	.	.	.	.	.	.	.	.	.	C	18.53	3.643040	0.67244	.	.	ENSG00000179057	ENST00000513874	T	0.52057	0.68	4.11	2.13	0.27403	.	0.000000	0.37857	U	0.001914	T	0.76709	0.4025	H	0.98048	4.135	0.23762	N	0.996914	D	0.89917	1.0	D	0.91635	0.999	T	0.68903	-0.5286	10	0.87932	D	0	.	9.0426	0.36327	0.1657:0.6745:0.1598:0.0	.	644	D6RGV7	.	Y	644	ENSP00000421191:D644Y	ENSP00000322422:D644Y	D	-	1	0	IGSF22	18692140	0.994000	0.37717	0.712000	0.30502	0.982000	0.71751	5.070000	0.64376	0.342000	0.23796	0.551000	0.68910	GAT	IGSF22	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000179057		0.607	IGSF22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IGSF22	HGNC	protein_coding	OTTHUMT00000360850.2	-	0.00	78	0	C	NM_173588		18735564	-1	tier1	-	no_errors	ENST00000513874	ensembl	human	known	74_37	missense	24.53	40	13	SNP	0.991	A
IL1RAPL1	11141	genome.wustl.edu	37	X	29973907	29973907	+	Silent	SNP	G	G	A			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chrX:29973907G>A	ENST00000378993.1	+	11	2734	c.2061G>A	c.(2059-2061)agG>agA	p.R687R	IL1RAPL1_ENST00000302196.4_Silent_p.R687R	NM_014271.3	NP_055086.1	Q9NZN1	IRPL1_HUMAN	interleukin 1 receptor accessory protein-like 1	687					calcium ion transmembrane transport (GO:0070588)|heterophilic cell-cell adhesion (GO:0007157)|negative regulation of exocytosis (GO:0045920)|neuron differentiation (GO:0030182)|positive regulation of dendrite morphogenesis (GO:0050775)|presynaptic membrane assembly (GO:0097105)|regulation of neuron projection development (GO:0010975)|signal transduction (GO:0007165)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	receptor binding (GO:0005102)|voltage-gated calcium channel activity (GO:0005245)			biliary_tract(1)|breast(1)|endometrium(5)|large_intestine(9)|lung(38)|ovary(3)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	62						TGTTGCCAAGGGAGACCAGTA	0.537																																																	0													37.0	34.0	35.0					X																	29973907		2202	4300	6502	SO:0001819	synonymous_variant	0			AJ243874	CCDS14218.1	Xp22.1-p21.3	2013-01-29	2004-02-13		ENSG00000169306	ENSG00000169306		"""Interleukins and interleukin receptors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5996	protein-coding gene	gene with protein product		300206	"""mental retardation, X-linked 34"", ""mental retardation, X-linked 21"", ""mental retardation, X-linked 10"""	IL1RAPL, MRX34, MRX21, MRX10		10471494, 10757639	Standard	NM_014271		Approved	OPHN4, TIGIRR-2, IL1R8	uc004dby.2	Q9NZN1	OTTHUMG00000021317	ENST00000378993.1:c.2061G>A	X.37:g.29973907G>A			A0AVG4|Q9UJ53	Silent	SNP	pfam_TIR_dom,pfam_Ig_I-set,pfam_Immunoglobulin,superfamily_TIR_dom,smart_Ig_sub,smart_Ig_sub2,smart_TIR_dom,pfscan_TIR_dom,pfscan_Ig-like_dom	p.R687	ENST00000378993.1	37	c.2061	CCDS14218.1	X																																																																																			IL1RAPL1	-	NULL	ENSG00000169306		0.537	IL1RAPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL1RAPL1	HGNC	protein_coding	OTTHUMT00000056155.1	-	0.00	21	0	G	NM_014271		29973907	+1	tier1	-	no_errors	ENST00000302196	ensembl	human	known	74_37	silent	29.63	19	8	SNP	1.000	A
IRS1	3667	genome.wustl.edu	37	2	227661413	227661413	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr2:227661413C>T	ENST00000305123.5	-	1	3062	c.2042G>A	c.(2041-2043)aGc>aAc	p.S681N	IRS1_ENST00000498335.1_5'Flank	NM_005544.2	NP_005535.1	P35568	IRS1_HUMAN	insulin receptor substrate 1	681	Poly-Ser.				cellular response to insulin stimulus (GO:0032869)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose homeostasis (GO:0042593)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|lipid catabolic process (GO:0016042)|mammary gland development (GO:0030879)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of insulin secretion (GO:0046676)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of fatty acid beta-oxidation (GO:0032000)|positive regulation of glucose import (GO:0046326)|positive regulation of glucose import in response to insulin stimulus (GO:2001275)|positive regulation of glucose metabolic process (GO:0010907)|positive regulation of glycogen biosynthetic process (GO:0045725)|positive regulation of insulin receptor signaling pathway (GO:0046628)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|protein kinase B signaling (GO:0043491)|protein localization to nucleus (GO:0034504)|regulation of gene expression (GO:0010468)|response to insulin (GO:0032868)|response to peptide hormone (GO:0043434)|signal transduction (GO:0007165)	caveola (GO:0005901)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|insulin receptor complex (GO:0005899)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	insulin receptor binding (GO:0005158)|insulin-like growth factor receptor binding (GO:0005159)|phosphatidylinositol 3-kinase binding (GO:0043548)|protein kinase C binding (GO:0005080)|SH2 domain binding (GO:0042169)|signal transducer activity (GO:0004871)|transmembrane receptor protein tyrosine kinase adaptor activity (GO:0005068)			autonomic_ganglia(1)|breast(2)|central_nervous_system(4)|endometrium(5)|kidney(4)|large_intestine(10)|lung(33)|ovary(6)|pancreas(1)|prostate(1)|urinary_tract(2)	69		Renal(207;0.023)|all_lung(227;0.0994)|all_hematologic(139;0.118)|Esophageal squamous(248;0.23)		Epithelial(121;3.03e-11)|all cancers(144;2.42e-08)|Lung(261;0.00712)|LUSC - Lung squamous cell carcinoma(224;0.0137)		gctgctgctgctgctgGGGCC	0.617											OREG0015248	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													48.0	51.0	50.0					2																	227661413		2203	4300	6503	SO:0001583	missense	0				CCDS2463.1	2q36	2013-01-10			ENSG00000169047	ENSG00000169047		"""Pleckstrin homology (PH) domain containing"""	6125	protein-coding gene	gene with protein product		147545				1648180	Standard	NM_005544		Approved	HIRS-1	uc002voh.4	P35568	OTTHUMG00000133179	ENST00000305123.5:c.2042G>A	2.37:g.227661413C>T	ENSP00000304895:p.Ser681Asn	2321		Missense_Mutation	SNP	pfam_Insln_rcpt_S1,pfam_Pleckstrin_homology,smart_Pleckstrin_homology,smart_Insln_rcpt_S1,prints_Insln_rcpt_S1,pfscan_Pleckstrin_homology,pfscan_Insln_rcpt_S1	p.S681N	ENST00000305123.5	37	c.2042	CCDS2463.1	2	.	.	.	.	.	.	.	.	.	.	C	11.77	1.736578	0.30774	.	.	ENSG00000169047	ENST00000305123	T	0.57436	0.4	3.06	3.06	0.35304	.	0.516694	0.16300	N	0.220514	T	0.27900	0.0687	N	0.08118	0	0.21802	N	0.999534	B	0.23058	0.079	B	0.15870	0.014	T	0.09596	-1.0667	10	0.17369	T	0.5	-4.4784	10.0298	0.42094	0.0:1.0:0.0:0.0	.	681	P35568	IRS1_HUMAN	N	681	ENSP00000304895:S681N	ENSP00000304895:S681N	S	-	2	0	IRS1	227369657	0.687000	0.27671	0.702000	0.30337	0.992000	0.81027	0.000000	0.12993	2.097000	0.63578	0.549000	0.68633	AGC	IRS1	-	NULL	ENSG00000169047		0.617	IRS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IRS1	HGNC	protein_coding	OTTHUMT00000256886.3	-	0.00	64	0	C	NM_005544		227661413	-1	tier1	-	no_errors	ENST00000305123	ensembl	human	known	74_37	missense	27.66	34	13	SNP	0.749	T
ISX	91464	genome.wustl.edu	37	22	35463110	35463110	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr22:35463110C>G	ENST00000308700.6	+	1	982	c.30C>G	c.(28-30)tgC>tgG	p.C10W	RP1-272J12.1_ENST00000448318.4_RNA|ISX_ENST00000404699.2_Missense_Mutation_p.C10W	NM_001008494.1	NP_001008494.1	Q2M1V0	ISX_HUMAN	intestine-specific homeobox	10					regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of vitamin A metabolic process (GO:1901738)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(12)|ovary(3)|prostate(1)|skin(4)	26						CTGCTCTCTGCAGGGGTATGG	0.602																																																	0													40.0	41.0	41.0					22																	35463110		2203	4300	6503	SO:0001583	missense	0			AK025181	CCDS33640.1	22q12.3	2011-06-20			ENSG00000175329	ENSG00000175329		"""Homeoboxes / PRD class"""	28084	protein-coding gene	gene with protein product		612019					Standard	NM_001008494		Approved	RAXLX	uc003anj.3	Q2M1V0	OTTHUMG00000150962	ENST00000308700.6:c.30C>G	22.37:g.35463110C>G	ENSP00000311492:p.Cys10Trp		Q68DJ5	Missense_Mutation	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom	p.C10W	ENST00000308700.6	37	c.30	CCDS33640.1	22	.	.	.	.	.	.	.	.	.	.	C	8.339	0.828193	0.16749	.	.	ENSG00000175329	ENST00000308700;ENST00000404699	D;D	0.89415	-2.51;-2.51	4.75	-1.45	0.08828	.	1.359010	0.04927	N	0.456047	T	0.78591	0.4307	N	0.14661	0.345	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.63778	-0.6560	10	0.44086	T	0.13	.	6.3759	0.21507	0.0:0.386:0.4406:0.1734	.	10	Q2M1V0	ISX_HUMAN	W	10	ENSP00000311492:C10W;ENSP00000386037:C10W	ENSP00000311492:C10W	C	+	3	2	ISX	33793110	0.001000	0.12720	0.000000	0.03702	0.006000	0.05464	-0.408000	0.07169	-0.285000	0.09089	0.655000	0.94253	TGC	ISX	-	NULL	ENSG00000175329		0.602	ISX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ISX	HGNC	protein_coding	OTTHUMT00000320662.1	-	0.00	61	0	C	NM_001008494		35463110	+1	tier1	-	no_errors	ENST00000308700	ensembl	human	known	74_37	missense	65.79	13	25	SNP	0.000	G
ITGA4	3676	genome.wustl.edu	37	2	182350629	182350629	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr2:182350629G>A	ENST00000397033.2	+	10	1493	c.1063G>A	c.(1063-1065)Gaa>Aaa	p.E355K		NM_000885.4	NP_000876.3	P13612	ITA4_HUMAN	integrin, alpha 4 (antigen CD49D, alpha 4 subunit of VLA-4 receptor)	355					B cell differentiation (GO:0030183)|blood coagulation (GO:0007596)|blood vessel remodeling (GO:0001974)|cell-matrix adhesion (GO:0007160)|cell-matrix adhesion involved in ameboidal cell migration (GO:0003366)|chorio-allantoic fusion (GO:0060710)|endodermal cell differentiation (GO:0035987)|extracellular matrix organization (GO:0030198)|face development (GO:0060324)|heart development (GO:0007507)|heterophilic cell-cell adhesion (GO:0007157)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte tethering or rolling (GO:0050901)|negative regulation of protein homodimerization activity (GO:0090074)|receptor clustering (GO:0043113)|regulation of immune response (GO:0050776)|substrate adhesion-dependent cell spreading (GO:0034446)|T cell migration (GO:0072678)	cell surface (GO:0009986)|cell-cell junction (GO:0005911)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integrin alpha4-beta7 complex (GO:0034669)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cell adhesion molecule binding (GO:0050839)|metal ion binding (GO:0046872)			breast(3)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(27)|ovary(3)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	58			OV - Ovarian serous cystadenocarcinoma(117;0.0593)		Natalizumab(DB00108)|Tinzaparin(DB06822)	GAATGCAATGGAAACAAACCT	0.368																																																	0													147.0	139.0	142.0					2																	182350629		1862	4110	5972	SO:0001583	missense	0				CCDS42788.1	2q31-q32	2010-03-23			ENSG00000115232	ENSG00000115232		"""CD molecules"", ""Integrins"""	6140	protein-coding gene	gene with protein product		192975		CD49D		1537388	Standard	NM_000885		Approved	CD49d	uc002unu.3	P13612	OTTHUMG00000154212	ENST00000397033.2:c.1063G>A	2.37:g.182350629G>A	ENSP00000380227:p.Glu355Lys		D3DPG4|Q7Z4L6	Missense_Mutation	SNP	pfam_Integrin_alpha-2,pfam_FG-GAP,smart_Int_alpha_beta-p,prints_Integrin_alpha	p.E355K	ENST00000397033.2	37	c.1063	CCDS42788.1	2	.	.	.	.	.	.	.	.	.	.	G	13.45	2.241405	0.39598	.	.	ENSG00000115232	ENST00000425522;ENST00000397033;ENST00000233573	T;T	0.11063	2.81;2.81	5.87	5.87	0.94306	.	0.201419	0.51477	D	0.000096	T	0.07052	0.0179	L	0.34521	1.04	0.40975	D	0.984732	B;P	0.35328	0.099;0.495	B;B	0.25291	0.058;0.059	T	0.37686	-0.9695	10	0.14656	T	0.56	.	10.808	0.46529	0.0699:0.131:0.7991:0.0	.	355;355	E7EP60;P13612	.;ITA4_HUMAN	K	355	ENSP00000380227:E355K;ENSP00000233573:E355K	ENSP00000233573:E355K	E	+	1	0	ITGA4	182058874	1.000000	0.71417	1.000000	0.80357	0.931000	0.56810	3.135000	0.50546	2.768000	0.95171	0.585000	0.79938	GAA	ITGA4	-	smart_Int_alpha_beta-p	ENSG00000115232		0.368	ITGA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGA4	HGNC	protein_coding	OTTHUMT00000334427.1	-	0.00	74	0	G			182350629	+1	tier1	-	no_errors	ENST00000397033	ensembl	human	known	74_37	missense	24.66	55	18	SNP	1.000	A
ITIH5	80760	genome.wustl.edu	37	10	7618751	7618751	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr10:7618751C>T	ENST00000256861.6	-	10	1721	c.1643G>A	c.(1642-1644)cGg>cAg	p.R548Q	ITIH5_ENST00000397145.2_Missense_Mutation_p.R548Q|ITIH5_ENST00000397146.2_Missense_Mutation_p.R548Q|ITIH5_ENST00000446830.2_Missense_Mutation_p.R330Q|ITIH5_ENST00000434980.1_5'UTR|ITIH5_ENST00000298441.6_Missense_Mutation_p.R334Q	NM_030569.6	NP_085046.5	Q86UX2	ITIH5_HUMAN	inter-alpha-trypsin inhibitor heavy chain family, member 5	548					hyaluronan metabolic process (GO:0030212)	extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(5)|kidney(6)|large_intestine(21)|lung(25)|ovary(4)|pancreas(1)|skin(2)|stomach(1)|urinary_tract(3)	75						CTTCTGAGGCCGCACAGGCAC	0.592																																																	0													66.0	64.0	65.0					10																	7618751		2203	4300	6503	SO:0001583	missense	0					10p14	2011-10-26	2011-10-26		ENSG00000123243	ENSG00000123243			21449	protein-coding gene	gene with protein product		609783	"""inter-alpha (globulin) inhibitor H5"""			14744536	Standard	NM_001001851		Approved	MGC10848	uc021pmv.1	Q86UX2	OTTHUMG00000017635	ENST00000256861.6:c.1643G>A	10.37:g.7618751C>T	ENSP00000256861:p.Arg548Gln		Q5T664|Q5T665|Q5T666|Q6AI60|Q6UXB7|Q8TF48|Q8WYV2|Q96K70	Missense_Mutation	SNP	pfam_ITI_HC_C,pfam_VIT,pfam_VWF_A,smart_VIT,smart_VWF_A,pfscan_VWF_A	p.R548Q	ENST00000256861.6	37	c.1643		10	.	.	.	.	.	.	.	.	.	.	C	2.932	-0.220880	0.06061	.	.	ENSG00000123243	ENST00000256861;ENST00000397146;ENST00000298441;ENST00000446830;ENST00000397145	T;T;T;T;T	0.11063	2.81;2.81;2.81;2.81;2.81	5.41	-4.29	0.03721	.	0.880038	0.10177	N	0.706378	T	0.05686	0.0149	.	.	.	0.09310	N	1	B;B;B	0.15930	0.006;0.015;0.007	B;B;B	0.06405	0.001;0.001;0.002	T	0.42699	-0.9436	9	0.24483	T	0.36	-14.6668	8.6715	0.34154	0.0:0.4423:0.1098:0.4479	.	548;548;334	G5E9D8;Q86UX2;Q86UX2-3	.;ITIH5_HUMAN;.	Q	548;548;334;330;548	ENSP00000256861:R548Q;ENSP00000380333:R548Q;ENSP00000298441:R334Q;ENSP00000387969:R330Q;ENSP00000380332:R548Q	ENSP00000256861:R548Q	R	-	2	0	ITIH5	7658757	0.000000	0.05858	0.060000	0.19600	0.024000	0.10985	-0.244000	0.08903	-0.263000	0.09378	0.462000	0.41574	CGG	ITIH5	-	NULL	ENSG00000123243		0.592	ITIH5-001	KNOWN	basic|appris_principal	protein_coding	ITIH5	HGNC	protein_coding	OTTHUMT00000046688.1	-	0.00	38	0	C	NM_030569		7618751	-1	tier1	-	no_errors	ENST00000256861	ensembl	human	known	74_37	missense	17.91	55	12	SNP	0.001	T
JPH3	57338	genome.wustl.edu	37	16	87637893	87637893	+	Intron	DEL	C	C	-	rs543846456|rs377520154|rs71156237		TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr16:87637893delC	ENST00000284262.2	+	1	624				RP11-482M8.3_ENST00000602388.1_RNA	NM_020655.2	NP_065706.2	Q8WXH2	JPH3_HUMAN	junctophilin 3						calcium ion transport into cytosol (GO:0060402)|exploration behavior (GO:0035640)|learning (GO:0007612)|locomotion (GO:0040011)|memory (GO:0007613)|neuromuscular process controlling balance (GO:0050885)|regulation of neuronal synaptic plasticity (GO:0048168)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)	calcium-release channel activity (GO:0015278)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	30				BRCA - Breast invasive adenocarcinoma(80;0.0287)		CAGGGAgctgcctgctgctgc	0.607																																																	0																																										SO:0001627	intron_variant	0			AB042636	CCDS10962.1	16q24.3	2008-02-05	2002-11-13		ENSG00000154118	ENSG00000154118			14203	protein-coding gene	gene with protein product		605268	"""trinucleotide repeat containing 22"""	TNRC22		10949023, 10891348	Standard	NM_020655		Approved	JP-3, CAGL237, HDL2, JP3	uc002fkd.4	Q8WXH2	OTTHUMG00000137656	ENST00000284262.2:c.382+759C>-	16.37:g.87637893delC			D3DUN2|Q8N471|Q9HDC3|Q9HDC4	RNA	DEL	-	NULL	ENST00000284262.2	37	NULL	CCDS10962.1	16																																																																																			JPH3	-	-	ENSG00000154118		0.607	JPH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	JPH3	HGNC	protein_coding	OTTHUMT00000269108.2		0.00	67	0	C			87637893	+1	tier1		no_errors	ENST00000301008	ensembl	human	known	74_37	rna	9.72	65	7	DEL	0.000	-
KANK1	23189	genome.wustl.edu	37	9	730236	730236	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr9:730236G>A	ENST00000382303.1	+	8	3536	c.2884G>A	c.(2884-2886)Gct>Act	p.A962T	KANK1_ENST00000489369.1_3'UTR|KANK1_ENST00000382293.3_Missense_Mutation_p.A804T|KANK1_ENST00000382297.2_Missense_Mutation_p.A962T	NM_001256876.1	NP_001243805.1	Q14678	KANK1_HUMAN	KN motif and ankyrin repeat domains 1	962					negative regulation of actin filament polymerization (GO:0030837)|negative regulation of cell migration (GO:0030336)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of lamellipodium morphogenesis (GO:2000393)|negative regulation of neuron projection development (GO:0010977)|negative regulation of Rho protein signal transduction (GO:0035024)|negative regulation of ruffle assembly (GO:1900028)|negative regulation of substrate adhesion-dependent cell spreading (GO:1900025)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of Wnt signaling pathway (GO:0030177)|positive regulation of wound healing (GO:0090303)|regulation of establishment of cell polarity (GO:2000114)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|ruffle membrane (GO:0032587)	beta-catenin binding (GO:0008013)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(3)|large_intestine(9)|lung(8)|ovary(3)|pancreas(1)|prostate(3)|stomach(4)|upper_aerodigestive_tract(1)	43		Lung NSC(10;9.84e-12)|all_lung(10;1.02e-11)|Breast(48;0.128)		Epithelial(6;0.000153)|OV - Ovarian serous cystadenocarcinoma(1;0.000358)|Lung(218;0.0222)		CCAGATCGCCGCTGGCCTCTA	0.502																																																	0													57.0	52.0	54.0					9																	730236		2203	4300	6503	SO:0001583	missense	0			AL833161	CCDS6441.1, CCDS34976.1	9p24.3	2013-01-10	2008-01-29	2008-01-29	ENSG00000107104	ENSG00000107104		"""KN motif and ankyrin repeat domain containing"", ""Ankyrin repeat domain containing"""	19309	protein-coding gene	gene with protein product		607704	"""ankyrin repeat domain 15"""	ANKRD15		12133830, 17996375, 19554261	Standard	NM_015158		Approved	KIAA0172, KANK	uc003zgn.2	Q14678	OTTHUMG00000019434	ENST00000382303.1:c.2884G>A	9.37:g.730236G>A	ENSP00000371740:p.Ala962Thr		A2A2W8|D3DRH3|Q5W0W0|Q8IY65|Q8WX74	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_KN_motif,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.A962T	ENST00000382303.1	37	c.2884	CCDS34976.1	9	.	.	.	.	.	.	.	.	.	.	G	8.063	0.768484	0.15983	.	.	ENSG00000107104	ENST00000382303;ENST00000354485;ENST00000382297;ENST00000382293	T;T;T	0.16196	2.36;2.36;2.36	5.91	-1.48	0.08745	.	0.481200	0.19440	N	0.114216	T	0.05456	0.0144	N	0.12182	0.205	0.32760	N	0.505207	B;B	0.15473	0.013;0.001	B;B	0.06405	0.002;0.001	T	0.33803	-0.9854	10	0.10636	T	0.68	-1.8866	0.9588	0.01391	0.2597:0.1059:0.2192:0.4152	.	962;962	Q5W0W1;Q14678	.;KANK1_HUMAN	T	962;962;962;804	ENSP00000371740:A962T;ENSP00000371734:A962T;ENSP00000371730:A804T	ENSP00000346479:A962T	A	+	1	0	KANK1	720236	0.004000	0.15560	0.007000	0.13788	0.866000	0.49608	0.072000	0.14617	-0.220000	0.09988	-0.123000	0.14984	GCT	KANK1	-	smart_Ankyrin_rpt	ENSG00000107104		0.502	KANK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KANK1	HGNC	protein_coding	OTTHUMT00000051484.2		0.00	65	0	G	NM_015158		730236	+1			no_errors	ENST00000382297	ensembl	human	known	74_37	missense	5.63	67	4	SNP	0.017	A
KCNH1	3756	genome.wustl.edu	37	1	211093344	211093344	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr1:211093344T>C	ENST00000271751.4	-	7	1127	c.1100A>G	c.(1099-1101)aAg>aGg	p.K367R	KCNH1_ENST00000367007.4_Missense_Mutation_p.K340R			O95259	KCNH1_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 1	367					myoblast fusion (GO:0007520)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	nucleus (GO:0005634)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|phosphorelay sensor kinase activity (GO:0000155)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(13)|lung(35)|ovary(4)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	68				OV - Ovarian serous cystadenocarcinoma(81;0.0109)|all cancers(67;0.141)|Epithelial(68;0.185)		GTGGTCCAGCTTACGGGCCAC	0.567																																																	0													98.0	100.0	100.0					1																	211093344		2203	4300	6503	SO:0001583	missense	0			AJ001366	CCDS1496.1, CCDS31015.1	1q32.2	2012-07-05			ENSG00000143473	ENSG00000143473		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6250	protein-coding gene	gene with protein product		603305				9738473, 16382104	Standard	NM_172362		Approved	Kv10.1, eag, h-eag, eag1	uc001hib.2	O95259	OTTHUMG00000036309	ENST00000271751.4:c.1100A>G	1.37:g.211093344T>C	ENSP00000271751:p.Lys367Arg		B1AQ26|O76035|Q14CL3	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_cNMP-bd_dom,pfam_2pore_dom_K_chnl_dom,pfam_PAS_fold,superfamily_cNMP-bd-like,superfamily_PAS,smart_PAC,smart_cNMP-bd_dom,prints_K_chnl_volt-dep_EAG,prints_K_chnl_volt-dep_EAG/ELK/ERG,prints_K_chnl_volt-dep_ERG,pfscan_cNMP-bd_dom,pfscan_PAS,pfscan_PAS-assoc_C,tigrfam_PAS	p.K367R	ENST00000271751.4	37	c.1100	CCDS1496.1	1	.	.	.	.	.	.	.	.	.	.	T	22.7	4.326544	0.81690	.	.	ENSG00000143473	ENST00000271751;ENST00000367007	D;D	0.98474	-4.95;-4.95	5.48	5.48	0.80851	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.97393	0.9147	L	0.45470	1.425	0.80722	D	1	B;B	0.33120	0.398;0.398	B;B	0.43867	0.434;0.434	D	0.97544	1.0088	10	0.56958	D	0.05	.	14.76	0.69600	0.0:0.0:0.0:1.0	.	340;367	Q14CL3;O95259	.;KCNH1_HUMAN	R	367;340	ENSP00000271751:K367R;ENSP00000355974:K340R	ENSP00000271751:K367R	K	-	2	0	KCNH1	209159967	1.000000	0.71417	0.992000	0.48379	0.998000	0.95712	7.751000	0.85126	2.087000	0.62958	0.533000	0.62120	AAG	KCNH1	-	pfam_Ion_trans_dom	ENSG00000143473		0.567	KCNH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNH1	HGNC	protein_coding	OTTHUMT00000088332.1	-	0.00	40	0	T	NM_002238		211093344	-1	tier1	-	no_errors	ENST00000271751	ensembl	human	known	74_37	missense	52.94	16	18	SNP	1.000	C
KCNJ15	3772	genome.wustl.edu	37	21	39671472	39671472	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr21:39671472C>T	ENST00000328656.4	+	4	592	c.289C>T	c.(289-291)Ccc>Tcc	p.P97S	KCNJ15_ENST00000398934.1_Missense_Mutation_p.P97S|KCNJ15_ENST00000398930.1_Missense_Mutation_p.P97S|KCNJ15_ENST00000398932.1_Missense_Mutation_p.P97S|KCNJ15_ENST00000398938.2_Missense_Mutation_p.P97S	NM_001276437.1|NM_001276438.1|NM_001276439.1|NM_002243.3	NP_001263366.1|NP_001263367.1|NP_001263368.1|NP_002234.2	Q99712	KCJ15_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 15	97					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	inward rectifier potassium channel activity (GO:0005242)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|kidney(2)|large_intestine(4)|lung(6)|ovary(2)|prostate(2)|skin(3)|urinary_tract(1)	24					Yohimbine(DB01392)	GGACTTAGAACCCGGTGAGCC	0.483																																																	0													122.0	120.0	121.0					21																	39671472		2203	4300	6503	SO:0001583	missense	0			Y10745	CCDS13656.1	21q22.2	2011-07-05			ENSG00000157551	ENSG00000157551		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6261	protein-coding gene	gene with protein product		602106				9299242, 8995301, 16382105	Standard	NM_170736		Approved	Kir4.2, Kir1.3, IRKK	uc002ywx.4	Q99712	OTTHUMG00000090609	ENST00000328656.4:c.289C>T	21.37:g.39671472C>T	ENSP00000331698:p.Pro97Ser		D3DSH5|O00564|Q96L28|Q99446	Missense_Mutation	SNP	pfam_K_chnl_inward-rec_Kir,superfamily_Ig_E-set,pirsf_K_chnl_inward-rec_Kir,prints_K_chnl_inward-rec_Kir1.3,prints_K_chnl_inward-rec_Kir,prints_K_chnl_inward-rec_Kir1.1	p.P97S	ENST00000328656.4	37	c.289	CCDS13656.1	21	.	.	.	.	.	.	.	.	.	.	C	0.031	-1.335731	0.01287	.	.	ENSG00000157551	ENST00000328656;ENST00000398928;ENST00000398938;ENST00000398932;ENST00000438657;ENST00000398930;ENST00000398934;ENST00000398927;ENST00000419868	D;D;D;D;D;D;D;D;D	0.93366	-3.21;-3.21;-3.21;-3.21;-3.21;-3.21;-3.21;-3.21;-3.21	5.13	2.26	0.28386	Potassium channel, inwardly rectifying, Kir, conserved region 2 (1);	0.780249	0.10635	U	0.651663	D	0.86243	0.5886	L	0.34521	1.04	0.09310	N	1	B	0.20261	0.043	B	0.21360	0.034	T	0.71879	-0.4459	9	.	.	.	.	1.901	0.03267	0.2885:0.4272:0.1264:0.1579	.	97	Q99712	IRK15_HUMAN	S	97	ENSP00000331698:P97S;ENSP00000381902:P97S;ENSP00000381911:P97S;ENSP00000381905:P97S;ENSP00000414487:P97S;ENSP00000381904:P97S;ENSP00000381907:P97S;ENSP00000381901:P97S;ENSP00000400849:P97S	.	P	+	1	0	KCNJ15	38593342	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.207000	0.17395	0.254000	0.21573	-0.140000	0.14226	CCC	KCNJ15	-	pfam_K_chnl_inward-rec_Kir,pirsf_K_chnl_inward-rec_Kir	ENSG00000157551		0.483	KCNJ15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNJ15	HGNC	protein_coding	OTTHUMT00000207181.2	-	0.00	91	0	C	NM_002243		39671472	+1	tier1	-	no_errors	ENST00000328656	ensembl	human	known	74_37	missense	29.73	52	22	SNP	0.001	T
KCNK2	3776	genome.wustl.edu	37	1	215259759	215259759	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr1:215259759A>C	ENST00000444842.2	+	2	245	c.95A>C	c.(94-96)aAa>aCa	p.K32T	KCNK2_ENST00000391895.2_Missense_Mutation_p.K28T|KCNK2_ENST00000391894.2_Missense_Mutation_p.K17T	NM_001017425.2|NM_014217.3	NP_001017425.2|NP_055032.1	O95069	KCNK2_HUMAN	potassium channel, subfamily K, member 2	32					G-protein coupled receptor signaling pathway (GO:0007186)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	endoplasmic reticulum (GO:0005783)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	outward rectifier potassium channel activity (GO:0015271)|potassium channel inhibitor activity (GO:0019870)|potassium ion leak channel activity (GO:0022841)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(15)|upper_aerodigestive_tract(1)	30				OV - Ovarian serous cystadenocarcinoma(81;0.0399)|all cancers(67;0.0556)|GBM - Glioblastoma multiforme(131;0.068)	Dofetilide(DB00204)|Dronedarone(DB04855)	CAGAACTCCAAACCGAGGCTC	0.507																																																	0													71.0	70.0	70.0					1																	215259759		2203	4300	6503	SO:0001583	missense	0			AF004711	CCDS31024.1, CCDS41466.1, CCDS41467.1	1q41	2012-03-07			ENSG00000082482	ENSG00000082482		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6277	protein-coding gene	gene with protein product		603219				9721223, 16382106	Standard	NM_001017424		Approved	K2p2.1, TREK-1	uc001hkr.4	O95069	OTTHUMG00000037017	ENST00000444842.2:c.95A>C	1.37:g.215259759A>C	ENSP00000394033:p.Lys32Thr		A1Z1V3|A8K618|B2RCS4|B7ZL56|D3DTA5|Q5DP47|Q5DP48|Q9NRT2|Q9UNE3	Missense_Mutation	SNP	pfam_2pore_dom_K_chnl_dom,prints_2pore_dom_K_chnl_TREK,prints_2pore_dom_K_chnl,prints_2pore_dom_K_chnl_TRAAK,prints_2pore_dom_K_chnl_TASK	p.K32T	ENST00000444842.2	37	c.95	CCDS41467.1	1	.	.	.	.	.	.	.	.	.	.	A	21.5	4.158464	0.78114	.	.	ENSG00000082482	ENST00000366948;ENST00000391895;ENST00000391894;ENST00000444842	T;T;T	0.22539	1.97;2.0;1.95	5.77	5.77	0.91146	.	0.642294	0.17154	N	0.184936	T	0.35451	0.0932	L	0.50919	1.6	0.52501	D	0.999952	P;P;B	0.46952	0.887;0.82;0.045	P;P;B	0.57009	0.811;0.652;0.09	T	0.02059	-1.1221	10	0.16896	T	0.51	.	16.0954	0.81117	1.0:0.0:0.0:0.0	.	17;32;28	O95069-2;O95069;O95069-3	.;KCNK2_HUMAN;.	T	28;28;17;32	ENSP00000375765:K28T;ENSP00000375764:K17T;ENSP00000394033:K32T	ENSP00000355915:K28T	K	+	2	0	KCNK2	213326382	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.088000	0.76901	2.203000	0.70933	0.455000	0.32223	AAA	KCNK2	-	NULL	ENSG00000082482		0.507	KCNK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNK2	HGNC	protein_coding	OTTHUMT00000089856.2	-	0.00	83	0	A	NM_014217		215259759	+1	tier1	-	no_errors	ENST00000444842	ensembl	human	known	74_37	missense	21.28	37	10	SNP	1.000	C
KCNQ1DN	55539	genome.wustl.edu	37	11	2892044	2892044	+	RNA	SNP	C	C	G			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr11:2892044C>G	ENST00000441418.2	+	0	782					NR_024627.1		Q9H478	KCQ1D_HUMAN	KCNQ1 downstream neighbor (non-protein coding)																		AAAGGCTTCCCAAGAGGCAAG	0.602																																																	0													97.0	96.0	96.0					11																	2892044		692	1591	2283			0			AB039920		11p15.5	2012-10-16	2011-08-30		ENSG00000237941	ENSG00000237941		"""Long non-coding RNAs"""	13335	non-coding RNA	RNA, long non-coding		610980	"""KCNQ1 downstream neighbor"""			11056398, 11063728, 22067257	Standard	NR_024627		Approved	BWRT, HSA404617	uc021pwt.1	Q9H478	OTTHUMG00000009942		11.37:g.2892044C>G				RNA	SNP	-	NULL	ENST00000441418.2	37	NULL		11																																																																																			KCNQ1DN	-	-	ENSG00000237941		0.602	KCNQ1DN-001	KNOWN	basic	antisense	KCNQ1DN	HGNC	antisense	OTTHUMT00000027530.3	-	0.00	67	0	C	NR_024627		2892044	+1	tier1	-	no_errors	ENST00000441418	ensembl	human	known	74_37	rna	32.00	34	16	SNP	0.001	G
KCP	375616	genome.wustl.edu	37	7	128534279	128534279	+	RNA	SNP	G	G	A			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr7:128534279G>A	ENST00000476647.2	-	0	942							Q6ZWJ8	KCP_HUMAN	kielin/chordin-like protein							extracellular region (GO:0005576)				central_nervous_system(1)|endometrium(3)	4						GCAGGTGCCTGGGAGGGGCCG	0.637																																																	0													24.0	32.0	30.0					7																	128534279		692	1590	2282			0			AK122706		7q32.3	2009-11-06	2009-02-18	2009-02-18	ENSG00000135253	ENSG00000135253			17585	protein-coding gene	gene with protein product	"""kielin"""	609344	"""cysteine rich BMP regulator 2 (chordin-like)"""	CRIM2		15793581	Standard	NM_001135914		Approved	FLJ33365, NET67	uc011kor.2	Q6ZWJ8	OTTHUMG00000158363		7.37:g.128534279G>A			Q8NBE0	RNA	SNP	-	NULL	ENST00000476647.2	37	NULL		7																																																																																			KCP	-	-	ENSG00000135253		0.637	KCP-006	KNOWN	basic	processed_transcript	KCP	HGNC	processed_transcript	OTTHUMT00000403051.1	-	0.00	155	0	G	NM_199349		128534279	-1	tier1	-	no_errors	ENST00000297801	ensembl	human	known	74_37	rna	46.08	55	47	SNP	0.997	A
KDM4A	9682	genome.wustl.edu	37	1	44132051	44132051	+	Intron	SNP	G	G	T			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr1:44132051G>T	ENST00000372396.3	+	7	807				KDM4A_ENST00000463151.1_Intron	NM_014663.2	NP_055478.2	O75164	KDM4A_HUMAN	lysine (K)-specific demethylase 4A						cardiac muscle hypertrophy in response to stress (GO:0014898)|histone demethylation (GO:0016577)|histone H3-K36 demethylation (GO:0070544)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	histone demethylase activity (H3-K36 specific) (GO:0051864)|methylated histone binding (GO:0035064)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(13)|prostate(1)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(1)	37						agaagcacaggtgtgaagtga	0.463																																																	0																																										SO:0001627	intron_variant	0			AB014577	CCDS491.1	1p34.1	2013-01-23	2009-04-06	2009-04-06	ENSG00000066135	ENSG00000066135		"""Chromatin-modifying enzymes / K-demethylases"", ""Tudor domain containing"""	22978	protein-coding gene	gene with protein product	"""jumonji C domain-containing histone demethylase 3A"", ""tudor domain containing 14A"""	609764	"""jumonji domain containing 2"", ""jumonji domain containing 2A"""	JMJD2, JMJD2A		9734811, 15138608	Standard	XM_005271354		Approved	KIAA0677, JHDM3A, TDRD14A	uc001cjx.3	O75164	OTTHUMG00000007560	ENST00000372396.3:c.674-72G>T	1.37:g.44132051G>T			Q5VVB1	RNA	SNP	-	NULL	ENST00000372396.3	37	NULL	CCDS491.1	1																																																																																			KDM4A	-	-	ENSG00000066135		0.463	KDM4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KDM4A	HGNC	protein_coding	OTTHUMT00000019960.1	-	0.00	42	0	G	NM_014663		44132051	+1	tier1	-	no_errors	ENST00000472265	ensembl	human	known	74_37	rna	37.50	25	15	SNP	0.001	T
KDM4D	55693	genome.wustl.edu	37	11	94731549	94731549	+	Missense_Mutation	SNP	G	G	A	rs371293647		TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr11:94731549G>A	ENST00000335080.5	+	3	1845	c.1013G>A	c.(1012-1014)cGt>cAt	p.R338H	KDM4D_ENST00000536741.1_Missense_Mutation_p.R338H	NM_018039.2	NP_060509.2	Q6B0I6	KDM4D_HUMAN	lysine (K)-specific demethylase 4D	338					chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	blood microparticle (GO:0072562)|nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|metal ion binding (GO:0046872)			endometrium(4)|kidney(2)|large_intestine(2)|liver(2)|lung(16)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	30						CTGTGGAAACGTGGGCAAGAC	0.587																																																	0								G	HIS/ARG	1,4401	2.1+/-5.4	0,1,2200	76.0	72.0	73.0		1013	1.6	0.0	11		73	0,8596		0,0,4298	no	missense	KDM4D	NM_018039.2	29	0,1,6498	AA,AG,GG		0.0,0.0227,0.0077	benign	338/524	94731549	1,12997	2201	4298	6499	SO:0001583	missense	0			AK001113	CCDS8302.1	11q21	2012-03-28	2009-04-06	2009-04-06	ENSG00000186280	ENSG00000186280		"""Chromatin-modifying enzymes / K-demethylases"""	25498	protein-coding gene	gene with protein product		609766	"""jumonji domain containing 2D"""	JMJD2D		15138608	Standard	NM_018039		Approved	FLJ10251	uc001pfe.3	Q6B0I6	OTTHUMG00000167838	ENST00000335080.5:c.1013G>A	11.37:g.94731549G>A	ENSP00000334181:p.Arg338His		B3KPC4|Q0VF39|Q9NT41|Q9NW76	Missense_Mutation	SNP	pfam_JmjC_dom,pfam_TF_JmjN,smart_TF_JmjN,smart_JmjC_dom,pfscan_TF_JmjN,pfscan_JmjC_dom	p.R338H	ENST00000335080.5	37	c.1013	CCDS8302.1	11	.	.	.	.	.	.	.	.	.	.	G	13.12	2.142305	0.37825	2.27E-4	0.0	ENSG00000186280	ENST00000335080	T	0.29397	1.57	3.73	1.59	0.23543	.	0.287946	0.29551	U	0.011836	T	0.16257	0.0391	N	0.21282	0.65	0.09310	N	1	B	0.12013	0.005	B	0.04013	0.001	T	0.13980	-1.0489	10	0.33141	T	0.24	-2.8192	5.0968	0.14737	0.1351:0.4007:0.4642:0.0	.	338	Q6B0I6	KDM4D_HUMAN	H	338	ENSP00000334181:R338H	ENSP00000334181:R338H	R	+	2	0	KDM4D	94371197	0.000000	0.05858	0.023000	0.16930	0.690000	0.40134	-0.029000	0.12329	0.432000	0.26286	0.462000	0.41574	CGT	KDM4D	-	NULL	ENSG00000186280		0.587	KDM4D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KDM4D	HGNC	protein_coding	OTTHUMT00000396558.2	-	0.00	43	0	G	NM_018039		94731549	+1	tier1	-	no_errors	ENST00000335080	ensembl	human	known	74_37	missense	40.74	32	22	SNP	0.001	A
KDM6A	7403	genome.wustl.edu	37	X	44922979	44922979	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chrX:44922979G>A	ENST00000377967.4	+	16	1881	c.1840G>A	c.(1840-1842)Gca>Aca	p.A614T	KDM6A_ENST00000382899.4_Missense_Mutation_p.A621T|KDM6A_ENST00000536777.1_Missense_Mutation_p.A569T|KDM6A_ENST00000543216.1_Missense_Mutation_p.A535T	NM_021140.2	NP_066963.2	O15550	KDM6A_HUMAN	lysine (K)-specific demethylase 6A	614	Interaction with SUPT6H. {ECO:0000250}.				canonical Wnt signaling pathway (GO:0060070)|heart morphogenesis (GO:0003007)|histone H3-K4 methylation (GO:0051568)|in utero embryonic development (GO:0001701)|mesodermal cell differentiation (GO:0048333)|multicellular organism growth (GO:0035264)|neural tube closure (GO:0001843)|notochord morphogenesis (GO:0048570)|regulation of gene expression (GO:0010468)|respiratory system process (GO:0003016)|somite rostral/caudal axis specification (GO:0032525)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|histone demethylase activity (H3-K27 specific) (GO:0071558)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)	p.0?(6)|p.0(2)		NS(1)|breast(7)|central_nervous_system(27)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(24)|kidney(24)|large_intestine(9)|liver(1)|lung(21)|oesophagus(11)|pancreas(2)|prostate(5)|skin(1)|soft_tissue(1)|urinary_tract(29)	170						GCAGCGAAACGCACTCACTCT	0.468			"""D, N, F, S"""		"""renal, oesophageal SCC, MM"""																																Colon(129;1273 1667 15230 27352 52914)			Rec	yes		X	Xp11.2	7403	"""lysine (K)-specific demethylase 6A, UTX"""		"""E, L"""	8	Whole gene deletion(6)|No detectable mRNA/protein(2)	haematopoietic_and_lymphoid_tissue(2)|oesophagus(2)|breast(2)|pancreas(2)											70.0	54.0	60.0					X																	44922979		2203	4300	6503	SO:0001583	missense	0			AF000992	CCDS14265.1	Xp11.2	2014-09-17	2009-04-17	2009-04-17	ENSG00000147050	ENSG00000147050		"""Chromatin-modifying enzymes / K-demethylases"", ""Tetratricopeptide (TTC) repeat domain containing"""	12637	protein-coding gene	gene with protein product		300128	"""ubiquitously transcribed tetratricopeptide repeat, X chromosome"""	UTX		9499428, 9381176	Standard	XM_005272655		Approved		uc004dge.4	O15550	OTTHUMG00000021402	ENST00000377967.4:c.1840G>A	X.37:g.44922979G>A	ENSP00000367203:p.Ala614Thr		Q52LL9|Q5JVQ7	Missense_Mutation	SNP	pfam_JmjC_dom,pfam_TPR_1,smart_TPR_repeat,smart_JmjC_dom,pfscan_JmjC_dom,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.A621T	ENST00000377967.4	37	c.1861	CCDS14265.1	X	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.66|13.66	2.304844|2.304844	0.40795|0.40795	.|.	.|.	ENSG00000147050|ENSG00000147050	ENST00000334516;ENST00000377967;ENST00000536777;ENST00000382899;ENST00000543216|ENST00000414389;ENST00000433797	T;T;T;T|.	0.18960|.	2.19;2.21;2.21;2.18|.	5.28|5.28	5.28|5.28	0.74379|0.74379	.|.	0.056013|.	0.64402|.	D|.	0.000001|.	T|T	0.51736|0.51736	0.1692|0.1692	N|N	0.16478|0.16478	0.41|0.41	0.80722|0.80722	D|D	1|1	D;D;B;B;D;B|.	0.89917|.	0.999;1.0;0.011;0.0;0.999;0.007|.	D;D;B;B;D;B|.	0.79108|.	0.978;0.992;0.012;0.002;0.985;0.005|.	T|T	0.48031|0.48031	-0.9070|-0.9070	10|5	0.14252|.	T|.	0.57|.	-4.8156|-4.8156	18.2207|18.2207	0.89901|0.89901	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	253;621;569;666;580;614|.	B4E0L8;F8W8R6;F5H6S1;B7ZKN5;B4E253;O15550|.	.;.;.;.;.;KDM6A_HUMAN|.	T|H	311;614;569;621;535|211;256	ENSP00000367203:A614T;ENSP00000437405:A569T;ENSP00000372355:A621T;ENSP00000443078:A535T|.	ENSP00000334340:A311T|.	A|R	+|+	1|2	0|0	KDM6A|KDM6A	44807923|44807923	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	4.292000|4.292000	0.59031|0.59031	2.327000|2.327000	0.79052|0.79052	0.513000|0.513000	0.50165|0.50165	GCA|CGC	KDM6A	-	NULL	ENSG00000147050		0.468	KDM6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KDM6A	HGNC	protein_coding	OTTHUMT00000056324.1	-	0.00	30	0	G	NM_021140		44922979	+1	tier1	-	no_errors	ENST00000382899	ensembl	human	known	74_37	missense	9.30	39	4	SNP	1.000	A
KIAA1456	57604	genome.wustl.edu	37	8	12878968	12878968	+	Silent	SNP	T	T	C			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr8:12878968T>C	ENST00000524591.2	+	5	1269	c.780T>C	c.(778-780)acT>acC	p.T260T	KIAA1456_ENST00000447063.2_Intron	NM_001099677.1|NM_020844.2	NP_001093147.1|NP_065895.2	Q9P272	K1456_HUMAN	KIAA1456	260							methyltransferase activity (GO:0008168)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)	7						ATGAATCGACTCTGAGGAAGC	0.408																																																	0													84.0	79.0	81.0					8																	12878968		1857	4098	5955	SO:0001819	synonymous_variant	0			BC035082	CCDS47808.1	8p22	2013-10-04	2011-02-23	2011-02-23	ENSG00000250305	ENSG00000250305			26725	protein-coding gene	gene with protein product		615666	"""chromosome 8 open reading frame 79"""	C8orf79		23381944	Standard	NM_020844		Approved	FLJ36980	uc010lsq.3	Q8N9K7	OTTHUMG00000165477	ENST00000524591.2:c.780T>C	8.37:g.12878968T>C			Q96AW6	Silent	SNP	pfam_Methyltransf_11,pfam_Methyltransf_12,pfam_UbiE/COQ5_MeTrFase,pfam_Methyltransferase-rel	p.T260	ENST00000524591.2	37	c.780	CCDS47808.1	8																																																																																			KIAA1456	-	NULL	ENSG00000250305		0.408	KIAA1456-008	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1456	HGNC	protein_coding	OTTHUMT00000383262.2	-	0.00	28	0	T	NM_001099677		12878968	+1	tier1	-	no_errors	ENST00000524591	ensembl	human	known	74_37	silent	33.33	16	8	SNP	0.049	C
KIF13B	23303	genome.wustl.edu	37	8	28929564	28929564	+	Silent	SNP	G	G	A			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr8:28929564G>A	ENST00000524189.1	-	39	4829	c.4791C>T	c.(4789-4791)acC>acT	p.T1597T	KIF13B_ENST00000404075.3_Silent_p.T116T	NM_015254.3	NP_056069.2	Q9NQT8	KI13B_HUMAN	kinesin family member 13B	1597					metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|protein targeting (GO:0006605)|regulation of axonogenesis (GO:0050770)|signal transduction (GO:0007165)|T cell activation (GO:0042110)	axon (GO:0030424)|cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	14-3-3 protein binding (GO:0071889)|ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)|protein kinase binding (GO:0019901)			endometrium(6)|kidney(1)|lung(20)|urinary_tract(1)	28		Ovarian(32;0.000536)		KIRC - Kidney renal clear cell carcinoma(542;0.152)|Kidney(114;0.181)		CCTCAGGGGCGGTGGGCATGG	0.781																																																	0													1.0	2.0	1.0					8																	28929564		991	2402	3393	SO:0001819	synonymous_variant	0			AB014539	CCDS55217.1	8p21	2008-07-30				ENSG00000197892		"""Kinesins"""	14405	protein-coding gene	gene with protein product		607350				9734811, 10859302, 16864656	Standard	NM_015254		Approved	GAKIN, KIAA0639	uc003xhh.4	Q9NQT8		ENST00000524189.1:c.4791C>T	8.37:g.28929564G>A			B4DGY5|B5MC45|F8VPJ2|O75134|Q9BYJ6	Silent	SNP	pfam_Kinesin_motor_dom,pfam_Kinesin-like,pfam_CAP-Gly_domain,pfam_KIF1B,pfam_FHA_dom,superfamily_P-loop_NTPase,superfamily_CAP-Gly_domain,superfamily_SMAD_FHA_domain,smart_Kinesin_motor_dom,pfscan_CAP-Gly_domain,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.T1597	ENST00000524189.1	37	c.4791	CCDS55217.1	8																																																																																			KIF13B	-	NULL	ENSG00000197892		0.781	KIF13B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF13B	HGNC	protein_coding	OTTHUMT00000376878.1		0.00	10	0	G			28929564	-1			no_errors	ENST00000524189	ensembl	human	known	74_37	silent	66.67	1	2	SNP	0.173	A
KIF18A	81930	genome.wustl.edu	37	11	28057867	28057867	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr11:28057867C>T	ENST00000263181.6	-	14	2583	c.2293G>A	c.(2293-2295)Gac>Aac	p.D765N		NM_031217.3	NP_112494.3	Q8NI77	KI18A_HUMAN	kinesin family member 18A	765					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule depolymerization (GO:0007019)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic metaphase plate congression (GO:0007080)|protein transport (GO:0015031)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|kinetochore microtubule (GO:0005828)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)|ruffle (GO:0001726)	actin binding (GO:0003779)|ATP binding (GO:0005524)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|plus-end-directed microtubule motor activity (GO:0008574)|tubulin-dependent ATPase activity (GO:0070463)|ubiquitin binding (GO:0043130)			breast(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(10)|ovary(3)|prostate(1)|skin(1)|urinary_tract(2)	36						GAGTCCAAGTCCTCCTGTCCA	0.353																																																	0													140.0	135.0	137.0					11																	28057867		2202	4298	6500	SO:0001583	missense	0			AL136819	CCDS7867.1	11p14.1	2014-06-12			ENSG00000121621	ENSG00000121621		"""Kinesins"""	29441	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 99"""	611271				11230166	Standard	NM_031217		Approved	DKFZP434G2226, PPP1R99	uc001msc.2	Q8NI77	OTTHUMG00000166195	ENST00000263181.6:c.2293G>A	11.37:g.28057867C>T	ENSP00000263181:p.Asp765Asn		Q4VPE3|Q86VS5|Q9H0F3	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.D765N	ENST00000263181.6	37	c.2293	CCDS7867.1	11	.	.	.	.	.	.	.	.	.	.	C	0.522	-0.861804	0.02610	.	.	ENSG00000121621	ENST00000263181	T	0.71817	-0.6	5.07	0.0808	0.14422	.	1.140340	0.06286	N	0.698302	T	0.50188	0.1601	N	0.17082	0.46	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.26052	-1.0114	10	0.16896	T	0.51	.	5.9277	0.19122	0.0:0.4031:0.135:0.4619	.	765	Q8NI77	KI18A_HUMAN	N	765	ENSP00000263181:D765N	ENSP00000263181:D765N	D	-	1	0	KIF18A	28014443	0.002000	0.14202	0.074000	0.20217	0.042000	0.13812	-0.130000	0.10498	0.057000	0.16193	0.643000	0.83706	GAC	KIF18A	-	NULL	ENSG00000121621		0.353	KIF18A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF18A	HGNC	protein_coding	OTTHUMT00000388328.3	-	0.00	64	0	C	NM_031217		28057867	-1	tier1	-	no_errors	ENST00000263181	ensembl	human	known	74_37	missense	44.44	25	20	SNP	0.001	T
KIF27	55582	genome.wustl.edu	37	9	86468750	86468750	+	Splice_Site	SNP	C	C	T			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr9:86468750C>T	ENST00000297814.2	-	15	3294	c.3151G>A	c.(3151-3153)Gaa>Aaa	p.E1051K	RP11-575L7.4_ENST00000591217.1_RNA|RP11-575L7.4_ENST00000590368.1_RNA|RP11-575L7.4_ENST00000586206.1_RNA|RP11-575L7.4_ENST00000608866.1_RNA|RP11-575L7.4_ENST00000589817.1_RNA|RP11-575L7.4_ENST00000590813.1_RNA|KIF27_ENST00000334204.2_Splice_Site_p.E954K|KIF27_ENST00000413982.1_Splice_Site_p.E985K	NM_017576.1	NP_060046.1	Q86VH2	KIF27_HUMAN	kinesin family member 27	1051					ATP catabolic process (GO:0006200)|cilium assembly (GO:0042384)|epithelial cilium movement (GO:0003351)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|smoothened signaling pathway (GO:0007224)|ventricular system development (GO:0021591)	cilium (GO:0005929)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(7)|lung(17)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	43						ACATGTTCTTCCTAGATATAA	0.338																																																	0													41.0	42.0	42.0					9																	86468750		2203	4296	6499	SO:0001630	splice_region_variant	0			AY237536	CCDS6665.1, CCDS65071.1, CCDS65072.1	9q21.32	2008-03-03			ENSG00000165115	ENSG00000165115		"""Kinesins"""	18632	protein-coding gene	gene with protein product		611253					Standard	NM_017576		Approved	DKFZp434D0917	uc004ana.4	Q86VH2	OTTHUMG00000020109	ENST00000297814.2:c.3151-1G>A	9.37:g.86468750C>T			B2RTR8|Q5T6W0|Q86VH0|Q86VH1|Q9UF54	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.E1051K	ENST00000297814.2	37	c.3151	CCDS6665.1	9	.	.	.	.	.	.	.	.	.	.	C	22.1	4.238513	0.79800	.	.	ENSG00000165115	ENST00000297814;ENST00000413982;ENST00000334204	T;T;T	0.79247	-1.01;-1.25;-1.01	4.22	4.22	0.49857	.	0.000000	0.64402	D	0.000018	D	0.87067	0.6085	M	0.70275	2.135	0.31899	N	0.616263	D;D;D	0.89917	0.995;1.0;0.997	P;D;D	0.91635	0.894;0.999;0.985	D	0.88720	0.3229	10	0.62326	D	0.03	.	16.7962	0.85602	0.0:1.0:0.0:0.0	.	954;985;1051	Q86VH2-3;Q86VH2-2;Q86VH2	.;.;KIF27_HUMAN	K	1051;985;954	ENSP00000297814:E1051K;ENSP00000401688:E985K;ENSP00000333928:E954K	ENSP00000297814:E1051K	E	-	1	0	KIF27	85658570	1.000000	0.71417	0.995000	0.50966	0.981000	0.71138	5.247000	0.65416	2.180000	0.69256	0.491000	0.48974	GAA	KIF27	-	NULL	ENSG00000165115		0.338	KIF27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF27	HGNC	protein_coding	OTTHUMT00000052861.1	-	0.00	51	0	C	NM_017576	Missense_Mutation	86468750	-1	tier1	-	no_errors	ENST00000297814	ensembl	human	known	74_37	missense	23.29	56	17	SNP	1.000	T
KIFC2	90990	genome.wustl.edu	37	8	145692681	145692681	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr8:145692681G>T	ENST00000301332.2	+	4	803	c.426G>T	c.(424-426)caG>caT	p.Q142H	CYHR1_ENST00000438911.2_5'Flank|CYHR1_ENST00000424149.2_5'Flank|CTD-2517M22.16_ENST00000525461.1_RNA|CYHR1_ENST00000306145.5_5'Flank|CYHR1_ENST00000403000.2_5'Flank|KIFC2_ENST00000301331.5_5'Flank	NM_145754.2	NP_665697.1	Q96AC6	KIFC2_HUMAN	kinesin family member C2	142					ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			central_nervous_system(1)|endometrium(1)|kidney(1)|lung(7)|ovary(3)|prostate(3)|skin(2)|urinary_tract(1)	19	all_cancers(97;4.61e-11)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.08e-41)|Epithelial(56;8.67e-41)|all cancers(56;1.1e-35)|BRCA - Breast invasive adenocarcinoma(115;0.035)|Colorectal(110;0.055)			CCCTGCTCCAGGGGACTCAGC	0.617											OREG0019057	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													42.0	51.0	48.0					8																	145692681		2202	4299	6501	SO:0001583	missense	0			AY007121	CCDS6427.1	8q24.3	2007-02-13			ENSG00000167702	ENSG00000167702		"""Kinesins"""	29530	protein-coding gene	gene with protein product						9115737	Standard	NM_145754		Approved		uc003zcz.3	Q96AC6	OTTHUMG00000165133	ENST00000301332.2:c.426G>T	8.37:g.145692681G>T	ENSP00000301332:p.Gln142His	1696	E9PHB2|Q96NN6	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,superfamily_Prefoldin,smart_Kinesin_motor_dom,prints_Kinesin_motor_dom,pfscan_Kinesin_motor_dom	p.Q142H	ENST00000301332.2	37	c.426	CCDS6427.1	8	.	.	.	.	.	.	.	.	.	.	G	17.80	3.478261	0.63849	.	.	ENSG00000167702	ENST00000301332	T	0.49432	0.78	4.94	3.14	0.36123	.	0.000000	0.32401	N	0.006148	T	0.52403	0.1732	L	0.29908	0.895	0.58432	D	0.999993	D	0.69078	0.997	D	0.77557	0.99	T	0.51116	-0.8746	10	0.62326	D	0.03	-13.4124	9.0561	0.36405	0.1826:0.0:0.8174:0.0	.	142	Q96AC6	KIFC2_HUMAN	H	142	ENSP00000301332:Q142H	ENSP00000301332:Q142H	Q	+	3	2	KIFC2	145663489	0.302000	0.24454	0.432000	0.26747	0.865000	0.49528	0.746000	0.26275	0.601000	0.29879	0.563000	0.77884	CAG	KIFC2	-	NULL	ENSG00000167702		0.617	KIFC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIFC2	HGNC	protein_coding	OTTHUMT00000382052.2	-	0.00	100	0	G	NM_145754		145692681	+1	tier1	-	no_errors	ENST00000301332	ensembl	human	known	74_37	missense	28.17	51	20	SNP	0.356	T
LAX1	54900	genome.wustl.edu	37	1	203740067	203740067	+	Splice_Site	SNP	T	T	C			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr1:203740067T>C	ENST00000442561.2	+	2	589		c.e2+2		LAX1_ENST00000367217.5_Splice_Site|LAX1_ENST00000367215.1_Splice_Site	NM_017773.3	NP_060243.2	Q8IWV1	LAX1_HUMAN	lymphocyte transmembrane adaptor 1						antigen receptor-mediated signaling pathway (GO:0050851)|B cell activation (GO:0042113)|immune response (GO:0006955)|immunoglobulin secretion (GO:0048305)|inactivation of MAPK activity (GO:0000188)|intracellular signal transduction (GO:0035556)|negative regulation of T cell activation (GO:0050868)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|SH2 domain binding (GO:0042169)			central_nervous_system(2)|endometrium(3)|large_intestine(2)|lung(13)|prostate(1)|stomach(1)|urinary_tract(2)	24	all_cancers(21;0.0915)		BRCA - Breast invasive adenocarcinoma(75;0.109)			GGAAGAAGCGTGAGTCCCTTG	0.468																																																	0													111.0	104.0	106.0					1																	203740067		2203	4300	6503	SO:0001630	splice_region_variant	0			AK000347	CCDS1441.2, CCDS44297.1	1q32.1	2008-02-05			ENSG00000122188	ENSG00000122188			26005	protein-coding gene	gene with protein product	"""LAT-like membrane associated protein"", ""linker for activation of x cells"""					12359715	Standard	NM_017773		Approved	LAX, FLJ20340	uc001haa.3	Q8IWV1	OTTHUMG00000035908	ENST00000442561.2:c.199+2T>C	1.37:g.203740067T>C			B7Z744|J3KP69|Q6NSZ6|Q9NXB4	Splice_Site	SNP	-	e2+2	ENST00000442561.2	37	c.199+2	CCDS1441.2	1	.	.	.	.	.	.	.	.	.	.	T	11.30	1.597023	0.28445	.	.	ENSG00000122188	ENST00000442561;ENST00000367217	.	.	.	5.28	5.28	0.74379	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.6043	0.51022	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	LAX1	202006690	1.000000	0.71417	1.000000	0.80357	0.159000	0.22180	3.628000	0.54259	2.003000	0.58678	0.459000	0.35465	.	LAX1	-	-	ENSG00000122188		0.468	LAX1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LAX1	HGNC	protein_coding	OTTHUMT00000087468.3	-	0.00	84	0	T	NM_017773	Intron	203740067	+1	tier1	-	no_errors	ENST00000442561	ensembl	human	known	74_37	splice_site	6.25	60	4	SNP	1.000	C
LDHAL6A	160287	genome.wustl.edu	37	11	18478264	18478264	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr11:18478264G>T	ENST00000280706.2	+	1	834	c.37G>T	c.(37-39)Gcg>Tcg	p.A13S	LDHAL6A_ENST00000396213.3_Missense_Mutation_p.A13S	NM_144972.4	NP_659409.2	Q6ZMR3	LDH6A_HUMAN	lactate dehydrogenase A-like 6A	13					cellular carbohydrate metabolic process (GO:0044262)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	L-lactate dehydrogenase activity (GO:0004459)			large_intestine(3)|lung(9)|urinary_tract(1)	13						TAAGAATTTCGCGGAAGAGGA	0.413																																																	0													121.0	116.0	118.0					11																	18478264		2199	4293	6492	SO:0001583	missense	0			AK131523	CCDS7841.1	11p15.1	2011-01-27			ENSG00000166800	ENSG00000166800			28335	protein-coding gene	gene with protein product						12477932	Standard	NM_001144071		Approved	MGC23940, LDH6A	uc001mop.1	Q6ZMR3	OTTHUMG00000167724	ENST00000280706.2:c.37G>T	11.37:g.18478264G>T	ENSP00000280706:p.Ala13Ser		D3DQY5	Missense_Mutation	SNP	pfam_Lactate/malate_DH_N,pfam_Lactate/malate_DH_C,superfamily_Lactate_DH/Glyco_Ohase_4_C,pirsf_L-lactate/malate_DH,prints_L-lactate/malate_DH,tigrfam_L-lactate_DH	p.A13S	ENST00000280706.2	37	c.37	CCDS7841.1	11	.	.	.	.	.	.	.	.	.	.	G	6.505	0.461347	0.12342	.	.	ENSG00000166800	ENST00000396213;ENST00000280706	D;D	0.90261	-2.64;-2.64	4.2	-6.11	0.02131	NAD(P)-binding domain (1);	1.072780	0.07382	U	0.887681	T	0.75295	0.3830	N	0.12471	0.22	0.09310	N	1	B	0.06786	0.001	B	0.08055	0.003	T	0.61257	-0.7099	10	0.21540	T	0.41	.	4.2367	0.10628	0.1971:0.2411:0.4549:0.1069	.	13	Q6ZMR3	LDH6A_HUMAN	S	13	ENSP00000379516:A13S;ENSP00000280706:A13S	ENSP00000280706:A13S	A	+	1	0	LDHAL6A	18434840	0.000000	0.05858	0.001000	0.08648	0.010000	0.07245	-1.084000	0.03393	-0.552000	0.06167	-1.004000	0.02495	GCG	LDHAL6A	-	NULL	ENSG00000166800		0.413	LDHAL6A-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	LDHAL6A	HGNC	protein_coding	OTTHUMT00000395904.1	-	0.00	40	0	G	NM_144972		18478264	+1	tier1	-	no_errors	ENST00000280706	ensembl	human	known	74_37	missense	6.25	60	4	SNP	0.000	T
LRCH3	84859	genome.wustl.edu	37	3	197559084	197559084	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr3:197559084C>T	ENST00000425562.2	+	8	998	c.998C>T	c.(997-999)tCa>tTa	p.S333L	LRCH3_ENST00000414675.2_Missense_Mutation_p.S333L|LRCH3_ENST00000536618.1_5'UTR|AC055764.1_ENST00000454526.1_RNA|LRCH3_ENST00000438796.2_Missense_Mutation_p.S333L|LRCH3_ENST00000441090.2_Missense_Mutation_p.S207L|LRCH3_ENST00000334859.4_Missense_Mutation_p.S333L			Q96II8	LRCH3_HUMAN	leucine-rich repeats and calponin homology (CH) domain containing 3	333						cytoplasm (GO:0005737)|extracellular region (GO:0005576)		p.S333*(1)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(13)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29	all_cancers(143;1.15e-09)|Ovarian(172;0.0418)|Breast(254;0.0976)		Epithelial(36;4.82e-24)|all cancers(36;3.61e-22)|OV - Ovarian serous cystadenocarcinoma(49;7.08e-19)|LUSC - Lung squamous cell carcinoma(58;6.94e-07)|Lung(62;9.92e-07)	GBM - Glioblastoma multiforme(93;0.119)		GATGAATTTTCAGATCTGCCT	0.423																																																	1	Substitution - Nonsense(1)	large_intestine(1)											77.0	74.0	75.0					3																	197559084		2203	4300	6503	SO:0001583	missense	0			AL137527	CCDS3330.1	3q29	2006-04-12			ENSG00000186001	ENSG00000186001			28637	protein-coding gene	gene with protein product						12477932	Standard	NM_032773		Approved	MGC4126	uc003fyj.1	Q96II8	OTTHUMG00000155378	ENST00000425562.2:c.998C>T	3.37:g.197559084C>T	ENSP00000393579:p.Ser333Leu		B4E0T7|Q96FP9|Q9NT52	Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_CH-domain,superfamily_CH-domain,smart_Leu-rich_rpt_typical-subtyp,smart_CH-domain,pfscan_CH-domain	p.S333L	ENST00000425562.2	37	c.998		3	.	.	.	.	.	.	.	.	.	.	C	29.8	5.033516	0.93575	.	.	ENSG00000186001	ENST00000438796;ENST00000441090;ENST00000414675;ENST00000334859;ENST00000425562	T;T;T;T;T	0.37915	1.85;1.17;1.85;2.01;1.86	5.51	5.51	0.81932	.	0.073222	0.56097	D	0.000022	T	0.51500	0.1678	L	0.31065	0.9	0.80722	D	1	D;D;D;D	0.89917	1.0;0.997;1.0;0.984	D;P;D;D	0.91635	0.982;0.882;0.999;0.933	T	0.54186	-0.8331	10	0.87932	D	0	-14.58	19.4531	0.94876	0.0:1.0:0.0:0.0	.	207;333;333;333	E9PD99;B4E0T7;Q96II8-2;Q96II8-3	.;.;.;.	L	333;207;333;333;333	ENSP00000399751:S333L;ENSP00000394609:S207L;ENSP00000394965:S333L;ENSP00000334375:S333L;ENSP00000393579:S333L	ENSP00000334375:S333L	S	+	2	0	LRCH3	199043481	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.680000	0.74518	2.601000	0.87937	0.585000	0.79938	TCA	LRCH3	-	NULL	ENSG00000186001		0.423	LRCH3-006	KNOWN	basic	protein_coding	LRCH3	HGNC	protein_coding	OTTHUMT00000339965.1		0.00	78	0	C	NM_032773		197559084	+1			no_errors	ENST00000438796	ensembl	human	known	74_37	missense	5.56	34	2	SNP	1.000	T
LRP3	4037	genome.wustl.edu	37	19	33696342	33696342	+	Silent	SNP	G	G	A			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr19:33696342G>A	ENST00000253193.7	+	5	868	c.666G>A	c.(664-666)gcG>gcA	p.A222A	CTD-2540B15.13_ENST00000609744.1_RNA	NM_002333.3	NP_002324.2	O75074	LRP3_HUMAN	low density lipoprotein receptor-related protein 3	222	LDL-receptor class A 2. {ECO:0000255|PROSITE-ProRule:PRU00124}.				receptor-mediated endocytosis (GO:0006898)	coated pit (GO:0005905)|integral component of membrane (GO:0016021)				breast(1)|kidney(1)|large_intestine(1)|lung(9)|ovary(1)|pancreas(2)	15	Esophageal squamous(110;0.137)					GCAGCGGGGCGCGCTCCACGC	0.741																																																	0													8.0	10.0	9.0					19																	33696342		2148	4211	6359	SO:0001819	synonymous_variant	0			AB009462	CCDS12430.1	19q13.11	2013-05-30			ENSG00000130881	ENSG00000130881		"""Low density lipoprotein receptors"""	6695	protein-coding gene	gene with protein product		603159				9693042, 7959795	Standard	NM_002333		Approved	LRP-3, hLRp105	uc010edh.3	O75074	OTTHUMG00000180343	ENST00000253193.7:c.666G>A	19.37:g.33696342G>A			B3KQD6|B4DKF2	Silent	SNP	pfam_LDrepeatLR_classA_rpt,pfam_CUB_dom,superfamily_CUB_dom,superfamily_LDrepeatLR_classA_rpt,smart_CUB_dom,smart_LDrepeatLR_classA_rpt,pfscan_CUB_dom,pfscan_LDrepeatLR_classA_rpt,prints_LDrepeatLR_classA_rpt	p.A222	ENST00000253193.7	37	c.666	CCDS12430.1	19																																																																																			LRP3	-	pfam_LDrepeatLR_classA_rpt,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,pfscan_LDrepeatLR_classA_rpt	ENSG00000130881		0.741	LRP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP3	HGNC	protein_coding	OTTHUMT00000450842.4	-	0.00	16	0	G			33696342	+1	tier1	-	no_errors	ENST00000253193	ensembl	human	known	74_37	silent	38.89	11	7	SNP	0.384	A
LRRK2	120892	genome.wustl.edu	37	12	40753152	40753152	+	Nonsense_Mutation	SNP	A	A	T			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr12:40753152A>T	ENST00000298910.7	+	47	6992	c.6934A>T	c.(6934-6936)Aga>Tga	p.R2312*		NM_198578.3	NP_940980	Q5S007	LRRK2_HUMAN	leucine-rich repeat kinase 2	2312					activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|autophagy (GO:0006914)|cellular protein localization (GO:0034613)|cellular response to dopamine (GO:1903351)|cellular response to manganese ion (GO:0071287)|cellular response to oxidative stress (GO:0034599)|determination of adult lifespan (GO:0008340)|endocytosis (GO:0006897)|exploration behavior (GO:0035640)|GTP catabolic process (GO:0006184)|intracellular distribution of mitochondria (GO:0048312)|intracellular signal transduction (GO:0035556)|locomotory exploration behavior (GO:0035641)|MAPK cascade (GO:0000165)|negative regulation of GTPase activity (GO:0034260)|negative regulation of hydrogen peroxide-induced cell death (GO:1903206)|negative regulation of late endosome to lysosome transport (GO:1902823)|negative regulation of peroxidase activity (GO:2000469)|negative regulation of protein binding (GO:0032091)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein processing (GO:0010955)|negative regulation of protein processing involved in protein targeting to mitochondrion (GO:1903217)|negative regulation of protein targeting to mitochondrion (GO:1903215)|negative regulation of thioredoxin peroxidase activity by peptidyl-threonine phosphorylation (GO:1903125)|neuromuscular junction development (GO:0007528)|neuron death (GO:0070997)|neuron projection morphogenesis (GO:0048812)|olfactory bulb development (GO:0021772)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of autophagy (GO:0010508)|positive regulation of dopamine receptor signaling pathway (GO:0060161)|positive regulation of GTPase activity (GO:0043547)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of programmed cell death (GO:0043068)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein autoubiquitination (GO:1902499)|positive regulation of protein binding (GO:0032092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reactive oxygen species metabolic process (GO:0072593)|regulation of branching morphogenesis of a nerve (GO:2000172)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of dopamine receptor signaling pathway (GO:0060159)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of kidney size (GO:0035564)|regulation of locomotion (GO:0040012)|regulation of membrane potential (GO:0042391)|regulation of mitochondrial depolarization (GO:0051900)|regulation of neuroblast proliferation (GO:1902692)|regulation of neuron death (GO:1901214)|regulation of neuron maturation (GO:0014041)|regulation of protein kinase A signaling (GO:0010738)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of synaptic vesicle exocytosis (GO:2000300)|regulation of synaptic vesicle transport (GO:1902803)|response to oxidative stress (GO:0006979)|small GTPase mediated signal transduction (GO:0007264)|tangential migration from the subventricular zone to the olfactory bulb (GO:0022028)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic side of mitochondrial outer membrane (GO:0032473)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendrite (GO:0030425)|dendrite cytoplasm (GO:0032839)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|lysosome (GO:0005764)|membrane raft (GO:0045121)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)|terminal bouton (GO:0043195)|trans-Golgi network (GO:0005802)	actin binding (GO:0003779)|ATP binding (GO:0005524)|clathrin binding (GO:0030276)|glycoprotein binding (GO:0001948)|GTP binding (GO:0005525)|GTP-dependent protein kinase activity (GO:0034211)|GTPase activator activity (GO:0005096)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|kinase activity (GO:0016301)|MAP kinase kinase activity (GO:0004708)|peroxidase inhibitor activity (GO:0036479)|protein homodimerization activity (GO:0042803)|protein kinase A binding (GO:0051018)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|Rho GTPase binding (GO:0017048)|SNARE binding (GO:0000149)|syntaxin-1 binding (GO:0017075)|tubulin binding (GO:0015631)			NS(3)|biliary_tract(1)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(23)|large_intestine(31)|lung(55)|ovary(15)|pancreas(2)|prostate(4)|skin(4)|stomach(9)|upper_aerodigestive_tract(7)|urinary_tract(2)	181	all_cancers(12;0.00108)|Breast(8;0.218)	Lung NSC(34;0.0942)|all_lung(34;0.11)				TTCAACGGAAAGAAATGTAAT	0.373																																																	0													106.0	102.0	103.0					12																	40753152		2203	4300	6503	SO:0001587	stop_gained	0			AK026776	CCDS31774.1	12q12	2011-07-21			ENSG00000188906	ENSG00000188906		"""Parkinson disease"""	18618	protein-coding gene	gene with protein product		609007	"""Parkinson disease (autosomal dominant) 8"""	PARK8		15541308	Standard	NM_198578		Approved	ROCO2, DKFZp434H2111, FLJ45829, RIPK7	uc001rmg.4	Q5S007	OTTHUMG00000059742	ENST00000298910.7:c.6934A>T	12.37:g.40753152A>T	ENSP00000298910:p.Arg2312*		A6NJU2|Q6ZS50|Q8NCX9	Nonsense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_MIRO-like,pfam_Small_GTPase,pfam_Leu-rich_rpt,pfam_Small_GTPase_ARF/SAR,superfamily_Kinase-like_dom,superfamily_P-loop_NTPase,superfamily_ARM-type_fold,superfamily_WD40_repeat_dom,smart_Leu-rich_rpt_typical-subtyp,smart_Small_GTPase_Rab_type,smart_Tyr_kinase_cat_dom,smart_Ser/Thr_dual-sp_kinase_dom,prints_Small_GTPase,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,tigrfam_Small_GTP-bd_dom	p.R2312*	ENST00000298910.7	37	c.6934	CCDS31774.1	12	.	.	.	.	.	.	.	.	.	.	A	47	12.987907	0.99711	.	.	ENSG00000188906	ENST00000298910	.	.	.	5.92	5.92	0.95590	.	0.385498	0.33477	N	0.004861	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	16.371	0.83361	1.0:0.0:0.0:0.0	.	.	.	.	X	2312	.	ENSP00000298910:R2312X	R	+	1	2	LRRK2	39039419	1.000000	0.71417	0.036000	0.18154	0.315000	0.28087	7.389000	0.79806	2.267000	0.75376	0.477000	0.44152	AGA	LRRK2	-	superfamily_WD40_repeat_dom	ENSG00000188906		0.373	LRRK2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRK2	HGNC	protein_coding	OTTHUMT00000277179.1	-	0.00	55	0	A	XM_058513		40753152	+1	tier1	-	no_errors	ENST00000298910	ensembl	human	known	74_37	nonsense	20.34	47	12	SNP	0.999	T
MADD	8567	genome.wustl.edu	37	11	47307015	47307015	+	Silent	SNP	C	C	T			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr11:47307015C>T	ENST00000311027.5	+	14	2590	c.2425C>T	c.(2425-2427)Ctg>Ttg	p.L809L	MADD_ENST00000342922.4_Silent_p.L809L|MADD_ENST00000402192.2_Silent_p.L809L|MADD_ENST00000402799.1_Silent_p.L766L|MADD_ENST00000349238.3_Silent_p.L809L|MADD_ENST00000407859.3_Silent_p.L766L|MADD_ENST00000406482.1_Silent_p.L766L|MADD_ENST00000395336.3_Silent_p.L809L|MADD_ENST00000395344.3_Silent_p.L766L	NM_003682.3	NP_003673.3			MAP-kinase activating death domain											breast(7)|central_nervous_system(2)|endometrium(9)|kidney(3)|large_intestine(19)|lung(26)|ovary(6)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	84				Lung(87;0.182)		TCAAAAGCTGCTGCGGCCCAA	0.552																																																	0													140.0	131.0	134.0					11																	47307015		2201	4298	6499	SO:0001819	synonymous_variant	0			AB002356	CCDS7930.1, CCDS7931.1, CCDS7932.1, CCDS41642.1, CCDS44586.1, CCDS44587.1, CCDS44588.1, CCDS44589.1, CCDS44590.1	11p11.2	2012-10-04			ENSG00000110514	ENSG00000110514		"""DENN/MADD domain containing"""	6766	protein-coding gene	gene with protein product		603584				9115275, 9796103	Standard	NM_130476		Approved	DENN, KIAA0358, RAB3GEP	uc001ner.1	Q8WXG6	OTTHUMG00000150350	ENST00000311027.5:c.2425C>T	11.37:g.47307015C>T				Silent	SNP	pfam_DENN_dom,pfam_uDENN_dom,pfam_dDENN_dom,smart_uDENN_dom,smart_DENN_dom,smart_dDENN_dom,pfscan_DENN_dom,pfscan_uDENN_dom,pfscan_dDENN_dom	p.L809	ENST00000311027.5	37	c.2425	CCDS7930.1	11																																																																																			MADD	-	NULL	ENSG00000110514		0.552	MADD-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MADD	HGNC	protein_coding	OTTHUMT00000317746.1		0.00	40	0	C			47307015	+1			no_errors	ENST00000311027	ensembl	human	known	74_37	silent	5.41	35	2	SNP	1.000	T
MAGEA10	4109	genome.wustl.edu	37	X	151303878	151303878	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chrX:151303878T>C	ENST00000370323.4	-	4	531	c.215A>G	c.(214-216)gAg>gGg	p.E72G	RP11-1007I13.4_ENST00000509345.2_RNA|MAGEA10_ENST00000244096.3_Missense_Mutation_p.E72G	NM_001251828.1|NM_021048.4	NP_001238757.1|NP_066386	P43363	MAGAA_HUMAN	melanoma antigen family A, 10	72						nucleus (GO:0005634)				endometrium(2)|kidney(2)|large_intestine(4)|lung(11)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	23	Acute lymphoblastic leukemia(192;6.56e-05)					AGAAACCTCCTCTGGGGTGCT	0.527																																																	0													106.0	109.0	108.0					X																	151303878		2203	4300	6503	SO:0001583	missense	0				CCDS14705.1	Xq28	2009-03-13			ENSG00000124260	ENSG00000124260			6797	protein-coding gene	gene with protein product	"""MAGE-10 antigen"", ""melanoma-associated antigen 10"", ""cancer/testis antigen family 1, member 10"""	300343		MAGE10		8575766	Standard	NM_001011543		Approved	MGC10599, CT1.10	uc004ffl.3	P43363	OTTHUMG00000024180	ENST00000370323.4:c.215A>G	X.37:g.151303878T>C	ENSP00000359347:p.Glu72Gly			Missense_Mutation	SNP	pfam_MAGE,pfam_Melanoma_ass_antigen_N,pfscan_MAGE	p.E72G	ENST00000370323.4	37	c.215	CCDS14705.1	X	.	.	.	.	.	.	.	.	.	.	T	4.632	0.117546	0.08881	.	.	ENSG00000124260	ENST00000370323;ENST00000244096;ENST00000444834;ENST00000427322	T;T;T;T	0.04970	3.52;3.52;3.52;3.52	2.08	0.76	0.18442	Melanoma associated antigen, MAGE, N-terminal (1);	.	.	.	.	T	0.07548	0.0190	L	0.46614	1.455	0.09310	N	1	B	0.21309	0.054	B	0.35278	0.199	T	0.43829	-0.9367	9	0.38643	T	0.18	.	3.8341	0.08886	0.0:0.2058:0.0:0.7942	.	72	P43363	MAGAA_HUMAN	G	72	ENSP00000359347:E72G;ENSP00000244096:E72G;ENSP00000406161:E72G;ENSP00000391977:E72G	ENSP00000244096:E72G	E	-	2	0	MAGEA10	151054534	0.009000	0.17119	0.009000	0.14445	0.057000	0.15508	0.937000	0.28951	0.129000	0.18514	0.238000	0.17879	GAG	MAGEA10	-	pfam_Melanoma_ass_antigen_N	ENSG00000124260		0.527	MAGEA10-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	MAGEA10	HGNC	protein_coding	OTTHUMT00000060916.3	-	0.00	21	0	T	NM_021048		151303878	-1	tier1	-	no_errors	ENST00000244096	ensembl	human	known	74_37	missense	58.33	10	14	SNP	0.008	C
MAN1B1	11253	genome.wustl.edu	37	9	140000305	140000305	+	Intron	SNP	T	T	C			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr9:140000305T>C	ENST00000371589.4	+	9	1327				MAN1B1_ENST00000474902.1_Intron|MAN1B1_ENST00000540391.1_3'UTR	NM_016219.4	NP_057303.2	Q9UKM7	MA1B1_HUMAN	mannosidase, alpha, class 1B, member 1						cellular protein metabolic process (GO:0044267)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|oligosaccharide metabolic process (GO:0009311)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum quality control compartment (GO:0044322)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|vesicle (GO:0031982)	calcium ion binding (GO:0005509)|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity (GO:0004571)			autonomic_ganglia(1)|central_nervous_system(2)|kidney(1)|large_intestine(2)|liver(2)|lung(4)|ovary(2)	14	all_cancers(76;0.0926)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.0878)	OV - Ovarian serous cystadenocarcinoma(145;3.08e-05)|Epithelial(140;0.000513)		GAGTAAGGGATGAGAGCCATC	0.602																																																	0																																										SO:0001627	intron_variant	0			AF145732	CCDS7029.1	9q34.3	2014-05-27			ENSG00000177239	ENSG00000177239			6823	protein-coding gene	gene with protein product	"""endoplasmic reticulum alpha-mannosidase 1"", ""alpha 1,2-mannosidase"", ""endoplasmic reticulum mannosyl-oligosaccharide 1,2-alpha-mannosidase 1"", ""ER alpha 1,2-mannosidase"", ""Man9GlcNAc2-specific processing alpha-mannosidase"""	604346				10409699, 10521544	Standard	NM_016219		Approved	MANA-ER, MRT15	uc004cld.3	Q9UKM7	OTTHUMG00000020978	ENST00000371589.4:c.1255-272T>C	9.37:g.140000305T>C			Q5VSG3|Q9BRS9|Q9Y5K7	RNA	SNP	-	NULL	ENST00000371589.4	37	NULL	CCDS7029.1	9																																																																																			MAN1B1	-	-	ENSG00000177239		0.602	MAN1B1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	MAN1B1	HGNC	protein_coding	OTTHUMT00000055294.2	-	0.00	30	0	T	NM_016219		140000305	+1	tier1	-	no_errors	ENST00000540391	ensembl	human	known	74_37	rna	17.65	28	6	SNP	0.001	C
MAPK11	5600	genome.wustl.edu	37	22	50705432	50705432	+	Missense_Mutation	SNP	C	C	T	rs200417198		TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr22:50705432C>T	ENST00000330651.6	-	7	641	c.541G>A	c.(541-543)Ggc>Agc	p.G181S	MAPK11_ENST00000495277.1_5'Flank|MAPK11_ENST00000449719.2_Missense_Mutation_p.G73S	NM_002751.5	NP_002742.3	Q15759	MK11_HUMAN	mitogen-activated protein kinase 11	181	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|gene expression (GO:0010467)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|mRNA metabolic process (GO:0016071)|muscle cell differentiation (GO:0042692)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of muscle cell differentiation (GO:0051149)|Ras protein signal transduction (GO:0007265)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|response to stress (GO:0006950)|RNA metabolic process (GO:0016070)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription, DNA-templated (GO:0006351)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|MAP kinase activity (GO:0004707)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(1)|lung(4)	6		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)	Regorafenib(DB08896)	GCCACATAGCCGGTCATCTCC	0.652																																					GBM(9;634 739 50668)												0													72.0	63.0	66.0					22																	50705432		2200	4298	6498	SO:0001583	missense	0			Y14440	CCDS14090.1	22q13.33	2011-06-09			ENSG00000185386	ENSG00000185386	2.7.11.1	"""Mitogen-activated protein kinase cascade / Kinases"""	6873	protein-coding gene	gene with protein product		602898		PRKM11		9218798	Standard	NM_002751		Approved	p38-2, p38Beta, SAPK2	uc003bkr.3	Q15759	OTTHUMG00000150226	ENST00000330651.6:c.541G>A	22.37:g.50705432C>T	ENSP00000333685:p.Gly181Ser		A8K730|B0LPG1|B7Z630|E7ETQ1|L7RT27|O00284|O15472|Q2XNF2	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_LipoPS_kinase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,prints_MAPK_p38,prints_MAPK_JNK	p.G181S	ENST00000330651.6	37	c.541	CCDS14090.1	22	.	.	.	.	.	.	.	.	.	.	c	22.1	4.247799	0.80024	.	.	ENSG00000185386	ENST00000330651;ENST00000449719	T;T	0.63417	-0.04;-0.04	4.96	4.96	0.65561	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.059629	0.64402	U	0.000003	T	0.66208	0.2766	N	0.13098	0.295	0.80722	D	1	D;P	0.89917	1.0;0.896	D;P	0.80764	0.994;0.512	T	0.73294	-0.4028	10	0.87932	D	0	-22.5789	17.0156	0.86418	0.0:1.0:0.0:0.0	.	73;181	B7Z630;Q15759	.;MK11_HUMAN	S	181;73	ENSP00000333685:G181S;ENSP00000406921:G73S	ENSP00000333685:G181S	G	-	1	0	MAPK11	49047559	0.998000	0.40836	0.881000	0.34555	0.059000	0.15707	4.654000	0.61469	2.332000	0.79248	0.537000	0.68136	GGC	MAPK11	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000185386		0.652	MAPK11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAPK11	HGNC	protein_coding	OTTHUMT00000316900.1	-	0.00	43	0	C			50705432	-1	tier1	rs200417198	no_errors	ENST00000330651	ensembl	human	known	74_37	missense	42.86	20	15	SNP	1.000	T
MAPKAP1	79109	genome.wustl.edu	37	9	128347859	128347859	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr9:128347859T>C	ENST00000373498.1	-	4	714	c.646A>G	c.(646-648)Agc>Ggc	p.S216G	MAPKAP1_ENST00000373497.5_Missense_Mutation_p.S24G|MAPKAP1_ENST00000373511.2_Missense_Mutation_p.S216G|MAPKAP1_ENST00000350766.3_Missense_Mutation_p.S216G|MAPKAP1_ENST00000394060.3_Missense_Mutation_p.S216G|MAPKAP1_ENST00000394063.1_Missense_Mutation_p.S24G|MAPKAP1_ENST00000373503.3_Missense_Mutation_p.S24G|MAPKAP1_ENST00000265960.3_Missense_Mutation_p.S216G			Q9BPZ7	SIN1_HUMAN	mitogen-activated protein kinase associated protein 1	216	Interaction with NBN.				epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|negative regulation of Ras protein signal transduction (GO:0046580)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|substantia nigra development (GO:0021762)|T cell costimulation (GO:0031295)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	phosphatidic acid binding (GO:0070300)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein kinase binding (GO:0019901)|Ras GTPase binding (GO:0017016)			endometrium(2)|kidney(1)|large_intestine(2)|lung(15)|ovary(3)	23						CGTCCTTCGCTTGTATACTGC	0.547																																																	0													134.0	109.0	118.0					9																	128347859		2203	4300	6503	SO:0001583	missense	0			M37191	CCDS6864.1, CCDS35139.1, CCDS35140.1, CCDS35141.1, CCDS48020.1	9q34.11	2008-02-05			ENSG00000119487	ENSG00000119487			18752	protein-coding gene	gene with protein product	"""stress-activated protein kinase-interacting 1"""	610558				15363842	Standard	NM_001006620		Approved	MGC2745, SIN1, MIP1	uc004bpv.3	Q9BPZ7	OTTHUMG00000020683	ENST00000373498.1:c.646A>G	9.37:g.128347859T>C	ENSP00000362597:p.Ser216Gly		A8K1Z5|B1AMA4|B7Z309|Q00426|Q5JSV5|Q5JSV6|Q5JSV9|Q658R0|Q699U1|Q699U2|Q699U3|Q699U4|Q6GVJ0|Q6GVJ1|Q6GVJ2	Missense_Mutation	SNP	pfam_SIN1	p.S216G	ENST00000373498.1	37	c.646	CCDS35140.1	9	.	.	.	.	.	.	.	.	.	.	T	13.81	2.349291	0.41599	.	.	ENSG00000119487	ENST00000373511;ENST00000350766;ENST00000373503;ENST00000373498;ENST00000265960;ENST00000394063;ENST00000373505;ENST00000373497;ENST00000420643;ENST00000394060;ENST00000427078;ENST00000468896	.	.	.	5.86	4.73	0.59995	.	0.075155	0.85682	D	0.000000	T	0.45716	0.1356	L	0.56769	1.78	0.26090	N	0.98096	B;B;B;B;B;B	0.32467	0.258;0.372;0.241;0.143;0.185;0.259	B;B;B;B;B;B	0.37267	0.093;0.08;0.116;0.133;0.108;0.245	T	0.35351	-0.9792	9	0.27785	T	0.31	-9.1436	11.2102	0.48793	0.0:0.0715:0.0:0.9285	.	24;216;216;216;216;216	B7Z5E5;Q9BPZ7-6;Q9BPZ7-5;Q9BPZ7-3;Q9BPZ7-2;Q9BPZ7	.;.;.;.;.;SIN1_HUMAN	G	216;216;24;216;216;24;218;24;24;216;24;117	.	ENSP00000265960:S216G	S	-	1	0	MAPKAP1	127387680	0.996000	0.38824	0.385000	0.26158	0.977000	0.68977	4.098000	0.57748	1.040000	0.40099	0.533000	0.62120	AGC	MAPKAP1	-	pfam_SIN1	ENSG00000119487		0.547	MAPKAP1-009	KNOWN	basic|CCDS	protein_coding	MAPKAP1	HGNC	protein_coding	OTTHUMT00000054092.1	-	0.00	76	0	T			128347859	-1	tier1	-	no_errors	ENST00000265960	ensembl	human	known	74_37	missense	20.97	49	13	SNP	0.795	C
MAST2	23139	genome.wustl.edu	37	1	46499769	46499769	+	Silent	SNP	C	C	A			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr1:46499769C>A	ENST00000361297.2	+	28	3982	c.3699C>A	c.(3697-3699)cgC>cgA	p.R1233R	MAST2_ENST00000372009.2_Silent_p.R1140R	NM_015112.2	NP_055927.2			microtubule associated serine/threonine kinase 2											breast(1)|lung(3)|ovary(5)|stomach(2)	11	Acute lymphoblastic leukemia(166;0.155)|Lung SC(450;0.184)					CCCTGTTCCGCAAGATCACCA	0.607																																																	0													110.0	119.0	116.0					1																	46499769		2093	4228	6321	SO:0001819	synonymous_variant	0			AB047005	CCDS41326.1	1p34.1	2008-02-05			ENSG00000086015	ENSG00000086015			19035	protein-coding gene	gene with protein product		612257					Standard	NM_015112		Approved	MAST205, KIAA0807	uc001cov.3	Q6P0Q8	OTTHUMG00000008007	ENST00000361297.2:c.3699C>A	1.37:g.46499769C>A				Silent	SNP	pfam_MA_Ser/Thr_Kinase_dom,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_PDZ,superfamily_Kinase-like_dom,superfamily_MAST_pre-PK_dom,superfamily_PDZ,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_PDZ,pfscan_PDZ,pfscan_Prot_kinase_dom	p.R1233	ENST00000361297.2	37	c.3699	CCDS41326.1	1																																																																																			MAST2	-	NULL	ENSG00000086015		0.607	MAST2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAST2	HGNC	protein_coding	OTTHUMT00000021977.1	-	0.00	52	0	C	NM_015112		46499769	+1	tier1	-	no_errors	ENST00000361297	ensembl	human	known	74_37	silent	7.84	46	4	SNP	1.000	A
MARK1	4139	genome.wustl.edu	37	1	220752752	220752752	+	Silent	SNP	C	C	T			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr1:220752752C>T	ENST00000366917.4	+	2	374	c.108C>T	c.(106-108)agC>agT	p.S36S	MARK1_ENST00000402574.1_5'UTR|MARK1_ENST00000485104.1_3'UTR|MARK1_ENST00000366918.4_Silent_p.S36S					MAP/microtubule affinity-regulating kinase 1											central_nervous_system(2)|endometrium(9)|kidney(6)|large_intestine(12)|lung(22)|ovary(4)|pancreas(1)|skin(3)|stomach(3)|urinary_tract(1)	63				GBM - Glioblastoma multiforme(131;0.0407)		AGTCGAGTAGCAGACAGAACA	0.383																																																	0													99.0	87.0	91.0					1																	220752752		2203	4300	6503	SO:0001819	synonymous_variant	0			AF154845	CCDS31029.2, CCDS65789.1, CCDS73033.1, CCDS73034.1	1q41	2013-06-27			ENSG00000116141	ENSG00000116141			6896	protein-coding gene	gene with protein product		606511				9108484	Standard	NM_018650		Approved	MARK, PAR-1C	uc001hmn.4	Q9P0L2	OTTHUMG00000037351	ENST00000366917.4:c.108C>T	1.37:g.220752752C>T				Silent	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_KA1_dom,superfamily_Kinase-like_dom,superfamily_KA1/Ssp2_C,superfamily_UBA-like,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_UBA/transl_elong_EF1B_N_euk,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Prot_kinase_dom	p.S36	ENST00000366917.4	37	c.108	CCDS31029.2	1																																																																																			MARK1	-	NULL	ENSG00000116141		0.383	MARK1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	MARK1	HGNC	protein_coding	OTTHUMT00000090899.1	-	0.00	74	0	C			220752752	+1	tier1	-	no_errors	ENST00000366917	ensembl	human	known	74_37	silent	6.15	61	4	SNP	1.000	T
MBD3L3	653657	genome.wustl.edu	37	19	7056628	7056628	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr19:7056628A>G	ENST00000333843.4	-	2	366	c.332T>C	c.(331-333)tTg>tCg	p.L111S		NM_001164425.1	NP_001157897.1	A6NE82	MB3L3_HUMAN	methyl-CpG binding domain protein 3-like 3	111					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)					central_nervous_system(1)|lung(5)|stomach(1)	7						GACGCTCTCCAAATGCAGTGG	0.637																																																	0													9.0	16.0	15.0					19																	7056628		101	609	710	SO:0001583	missense	0				CCDS45944.1	19p13.2	2014-04-01			ENSG00000182315	ENSG00000182315			37205	protein-coding gene	gene with protein product							Standard	NM_001164425		Approved		uc021uns.1	A6NE82	OTTHUMG00000181976	ENST00000333843.4:c.332T>C	19.37:g.7056628A>G	ENSP00000333183:p.Leu111Ser			Missense_Mutation	SNP	NULL	p.L111S	ENST00000333843.4	37	c.332	CCDS45944.1	19	.	.	.	.	.	.	.	.	.	.	.	4.093	0.015293	0.07959	.	.	ENSG00000182315	ENST00000333843	.	.	.	0.742	-0.751	0.11076	.	0.751798	0.10240	N	0.698514	T	0.37376	0.1001	L	0.52573	1.65	0.09310	N	0.999994	.	.	.	.	.	.	T	0.39121	-0.9629	7	0.56958	D	0.05	4.0352	3.3929	0.07295	0.5643:0.4357:0.0:0.0	.	.	.	.	S	111	.	ENSP00000333183:L111S	L	-	2	0	MBD3L3	7007628	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.127000	0.15790	-0.305000	0.08831	0.322000	0.21391	TTG	MBD3L3	-	NULL	ENSG00000182315		0.637	MBD3L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MBD3L3	HGNC	protein_coding	OTTHUMT00000458500.1	-	0.00	184	0	A	NM_001164425		7056628	-1	tier1	-	no_errors	ENST00000333843	ensembl	human	known	74_37	missense	13.36	201	31	SNP	0.000	G
MC3R	4159	genome.wustl.edu	37	20	54824726	54824726	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr20:54824726G>A	ENST00000243911.2	+	1	939	c.827G>A	c.(826-828)tGc>tAc	p.C276Y		NM_019888.3	NP_063941.3	P41968	MC3R_HUMAN	melanocortin 3 receptor	276					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|homoiothermy (GO:0042309)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cAMP biosynthetic process (GO:0030819)|regulation of blood pressure (GO:0008217)|regulation of heart rate (GO:0002027)|sodium ion homeostasis (GO:0055078)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	melanocortin receptor activity (GO:0004977)|melanocyte-stimulating hormone receptor activity (GO:0004980)|neuropeptide binding (GO:0042923)|peptide hormone binding (GO:0017046)			breast(2)|endometrium(1)|kidney(3)|large_intestine(3)|lung(13)|ovary(3)|skin(1)	26			Colorectal(105;0.202)			TACTGCATCTGCTACACTGCC	0.567																																																	0													220.0	187.0	198.0					20																	54824726		2203	4300	6503	SO:0001583	missense	0				CCDS13449.2	20q13.2-q13.3	2012-08-10			ENSG00000124089	ENSG00000124089		"""GPCR / Class A : Melanocortin receptors"""	6931	protein-coding gene	gene with protein product		155540				8463333	Standard	NM_019888		Approved	MC3	uc002xxb.2	P41968	OTTHUMG00000032785	ENST00000243911.2:c.827G>A	20.37:g.54824726G>A	ENSP00000243911:p.Cys276Tyr		Q4KN27|Q9H517	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Melcrt_ACTH_rcpt,prints_Mcort_3_rcpt,prints_GPCR_Rhodpsn,prints_Melancort_rcpt	p.C276Y	ENST00000243911.2	37	c.827	CCDS13449.2	20	.	.	.	.	.	.	.	.	.	.	G	21.0	4.077766	0.76528	.	.	ENSG00000124089	ENST00000243911	T	0.71698	-0.59	5.09	5.09	0.68999	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	D	0.86871	0.6037	M	0.90814	3.15	0.80722	D	1	D	0.71674	0.998	D	0.68483	0.958	D	0.89868	0.4021	10	0.87932	D	0	.	18.1096	0.89530	0.0:0.0:1.0:0.0	.	313	P41968	MC3R_HUMAN	Y	276	ENSP00000243911:C276Y	ENSP00000243911:C276Y	C	+	2	0	MC3R	54258133	1.000000	0.71417	1.000000	0.80357	0.925000	0.55904	7.636000	0.83301	2.362000	0.80069	0.555000	0.69702	TGC	MC3R	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Melcrt_ACTH_rcpt	ENSG00000124089		0.567	MC3R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MC3R	HGNC	protein_coding	OTTHUMT00000079786.2		0.00	67	0	G			54824726	+1			no_errors	ENST00000243911	ensembl	human	known	74_37	missense	5.19	72	4	SNP	1.000	A
MCTP2	55784	genome.wustl.edu	37	15	94841617	94841617	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr15:94841617G>T	ENST00000357742.4	+	1	123	c.123G>T	c.(121-123)agG>agT	p.R41S	MCTP2_ENST00000451018.3_Missense_Mutation_p.R41S|MCTP2_ENST00000543482.1_Missense_Mutation_p.R41S|MCTP2_ENST00000331706.4_5'UTR	NM_018349.3	NP_060819.3	Q6DN12	MCTP2_HUMAN	multiple C2 domains, transmembrane 2	41					calcium-mediated signaling (GO:0019722)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(4)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(12)|liver(1)|lung(12)|ovary(1)|pancreas(1)|skin(9)|stomach(2)	49	Lung NSC(78;0.0821)|all_lung(78;0.148)		BRCA - Breast invasive adenocarcinoma(143;0.0323)|OV - Ovarian serous cystadenocarcinoma(32;0.0593)			TACGGGCAAGGCATCACTTGG	0.567																																																	0													71.0	73.0	72.0					15																	94841617		2197	4298	6495	SO:0001583	missense	0			AK002037	CCDS32338.1, CCDS53975.1, CCDS53976.1	15q26.2	2006-02-08				ENSG00000140563			25636	protein-coding gene	gene with protein product						15528213	Standard	NM_018349		Approved	FLJ11175, FLJ33303	uc002btj.3	Q6DN12		ENST00000357742.4:c.123G>T	15.37:g.94841617G>T	ENSP00000350377:p.Arg41Ser		A2RRC2|C6G483|C6G484|Q49AB0|Q8TAX2|Q9NUS2|Q9NUW7	Missense_Mutation	SNP	pfam_C2_dom,pfam_PRibTrfase_C,superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom	p.R41S	ENST00000357742.4	37	c.123	CCDS32338.1	15	.	.	.	.	.	.	.	.	.	.	G	6.012	0.370584	0.11352	.	.	ENSG00000140563	ENST00000543482;ENST00000556363;ENST00000451018;ENST00000357742	T;T;T	0.70399	-0.48;-0.24;-0.08	5.17	1.63	0.23807	.	1.464360	0.04135	N	0.318535	T	0.57844	0.2081	N	0.12182	0.205	0.09310	N	0.999997	B;B;B;B;B	0.09022	0.001;0.0;0.0;0.001;0.002	B;B;B;B;B	0.08055	0.001;0.002;0.001;0.001;0.003	T	0.45673	-0.9245	10	0.33141	T	0.24	.	14.7391	0.69440	0.0:0.0:0.6047:0.3952	.	41;41;41;41;41	F5H415;Q6DN12-2;Q6DN12;B7Z6H2;G3V2J2	.;.;MCTP2_HUMAN;.;.	S	41	ENSP00000438521:R41S;ENSP00000395109:R41S;ENSP00000350377:R41S	ENSP00000350377:R41S	R	+	3	2	MCTP2	92642621	0.017000	0.18338	0.001000	0.08648	0.154000	0.21943	1.011000	0.29911	0.493000	0.27837	0.655000	0.94253	AGG	MCTP2	-	NULL	ENSG00000140563		0.567	MCTP2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	MCTP2	HGNC	protein_coding	OTTHUMT00000415060.3	-	0.00	51	0	G	NM_018349		94841617	+1	tier1	-	no_errors	ENST00000357742	ensembl	human	known	74_37	missense	8.16	45	4	SNP	0.000	T
MEA1	4201	genome.wustl.edu	37	6	42980662	42980662	+	Splice_Site	SNP	A	A	T			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr6:42980662A>T	ENST00000244711.3	-	3	561		c.e3+1		KLHDC3_ENST00000326974.4_5'Flank|KLHDC3_ENST00000244670.8_5'Flank	NM_014623.2	NP_055438.1	Q16626	MEA1_HUMAN	male-enhanced antigen 1						cell differentiation (GO:0030154)|male gonad development (GO:0008584)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)				central_nervous_system(1)|large_intestine(3)|lung(1)|skin(1)	6			Colorectal(64;0.00237)|all cancers(41;0.00411)|COAD - Colon adenocarcinoma(64;0.00473)|OV - Ovarian serous cystadenocarcinoma(102;0.0664)|KIRC - Kidney renal clear cell carcinoma(15;0.133)|Kidney(15;0.188)			ATGATCTTTTACCTGGGTCCA	0.433																																																	0													158.0	148.0	151.0					6																	42980662		2203	4300	6503	SO:0001630	splice_region_variant	0				CCDS4879.1	6p21.3-p21.1	2008-08-15	2005-06-02	2005-06-02	ENSG00000124733	ENSG00000124733			6986	protein-coding gene	gene with protein product		143170	"""male-enhanced antigen"""	MEA		2813404, 12444059	Standard	NM_014623		Approved		uc003otk.3	Q16626	OTTHUMG00000014717	ENST00000244711.3:c.406+1T>A	6.37:g.42980662A>T			Q5TC36|Q9BV01	Splice_Site	SNP	-	e3+2	ENST00000244711.3	37	c.406+2	CCDS4879.1	6	.	.	.	.	.	.	.	.	.	.	A	25.4	4.635119	0.87760	.	.	ENSG00000124733	ENST00000244711	.	.	.	5.97	5.97	0.96955	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.1117	0.81270	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	MEA1	43088640	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	8.281000	0.89905	2.287000	0.76781	0.482000	0.46254	.	MEA1	-	-	ENSG00000124733		0.433	MEA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MEA1	HGNC	protein_coding	OTTHUMT00000040574.2	-	0.00	57	0	A		Intron	42980662	-1	tier1	-	no_errors	ENST00000244711	ensembl	human	known	74_37	splice_site	10.91	49	6	SNP	1.000	T
METTL21A	151194	genome.wustl.edu	37	2	208489022	208489022	+	Silent	SNP	A	A	G			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr2:208489022A>G	ENST00000411432.1	-	2	294	c.78T>C	c.(76-78)ttT>ttC	p.F26F	METTL21A_ENST00000432416.1_Silent_p.F26F|METTL21A_ENST00000458426.1_Silent_p.F26F|METTL21A_ENST00000426075.1_Silent_p.F26F|METTL21A_ENST00000272839.3_Silent_p.F26F|METTL21A_ENST00000448823.2_Silent_p.F26F|METTL21A_ENST00000406927.2_Silent_p.F26F|METTL21A_ENST00000448007.2_Silent_p.F26F|METTL21A_ENST00000442521.1_Silent_p.F26F|METTL21A_ENST00000425132.1_Silent_p.F26F	NM_001127395.1	NP_001120867.1	Q8WXB1	MT21A_HUMAN	methyltransferase like 21A	26					peptidyl-lysine methylation (GO:0018022)|protein methylation (GO:0006479)	cytoplasm (GO:0005737)	ATPase binding (GO:0051117)|Hsp70 protein binding (GO:0030544)|protein-lysine N-methyltransferase activity (GO:0016279)			endometrium(2)|large_intestine(3)|lung(3)|ovary(1)|stomach(1)	10						TGTGGTTTGCAAAGGAAAAAG	0.577																																																	0													70.0	68.0	68.0					2																	208489022		2203	4300	6503	SO:0001819	synonymous_variant	0			AK093812, AF455817	CCDS2376.1	2q33.3	2013-09-30	2011-03-03	2011-03-03	ENSG00000144401	ENSG00000144401			30476	protein-coding gene	gene with protein product	"""Hepatocellular carcinoma-associated antigen 557b"", ""heat shock protein 70kDa lysine (K) methyltransferase"""	615257	"""family with sequence similarity 119, member A"""	FAM119A		23921388	Standard	NM_145280		Approved	LOC151194, HCA557b, HSPA-KMT	uc010fuk.1	Q8WXB1	OTTHUMG00000132934	ENST00000411432.1:c.78T>C	2.37:g.208489022A>G			Q53RV0|Q8N1Z9|Q96GH6	Silent	SNP	pfam_Nicotinamide_N-MeTfrase-like,pfam_Ribosomal-L11_MeTrfase_PrmA,pfam_Small_mtfrase_dom	p.F26	ENST00000411432.1	37	c.78	CCDS2376.1	2																																																																																			METTL21A	-	NULL	ENSG00000144401		0.577	METTL21A-201	KNOWN	basic|appris_principal|CCDS	protein_coding	METTL21A	HGNC	protein_coding	OTTHUMT00000337044.1	-	0.00	107	0	A	NM_145280		208489022	-1	tier1	-	no_errors	ENST00000406927	ensembl	human	known	74_37	silent	33.96	70	36	SNP	0.974	G
MLN	4295	genome.wustl.edu	37	6	33766970	33766970	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr6:33766970T>G	ENST00000430124.2	-	3	211	c.146A>C	c.(145-147)aAa>aCa	p.K49T	MLN_ENST00000507738.1_Missense_Mutation_p.K49T|MLN_ENST00000266003.5_Missense_Mutation_p.K49T	NM_001040109.1|NM_001184698.1|NM_002418.2	NP_001035198.1|NP_001171627.1|NP_002409.1	P12872	MOTI_HUMAN	motilin	49					cell-cell signaling (GO:0007267)|G-protein coupled receptor signaling pathway (GO:0007186)	extracellular region (GO:0005576)	receptor binding (GO:0005102)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(1)|skin(1)	6						ACTCAGGGATTTCTTTTGCCC	0.527																																																	0													163.0	136.0	145.0					6																	33766970		2203	4300	6503	SO:0001583	missense	0				CCDS4786.1, CCDS47412.1, CCDS54993.1	6p21.31	2014-01-30			ENSG00000096395	ENSG00000096395		"""Endogenous ligands"""	7141	protein-coding gene	gene with protein product	"""prepromotilin"""	158270					Standard	NM_001184698		Approved		uc003off.1	P12872	OTTHUMG00000014536	ENST00000430124.2:c.146A>C	6.37:g.33766970T>G	ENSP00000388825:p.Lys49Thr		B7ZLR7|E9PDN2|J3KN51|Q2M1L2|Q5T975|Q6NSY7	Missense_Mutation	SNP	pfam_Motilin_assoc,pfam_Motilin_ghrelin	p.K49T	ENST00000430124.2	37	c.146	CCDS4786.1	6	.	.	.	.	.	.	.	.	.	.	T	19.56	3.849654	0.71603	.	.	ENSG00000096395	ENST00000430124;ENST00000266003;ENST00000507738	T;T;T	0.60424	0.19;0.19;0.19	4.77	4.77	0.60923	Motilin/ghrelin (1);	0.000000	0.64402	D	0.000018	T	0.67859	0.2938	M	0.78049	2.395	0.32087	N	0.592316	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	T	0.72388	-0.4309	10	0.87932	D	0	-27.1084	12.5462	0.56201	0.0:0.0:0.0:1.0	.	49;49;49	E9PDN2;B7ZLR7;P12872	.;.;MOTI_HUMAN	T	49	ENSP00000388825:K49T;ENSP00000266003:K49T;ENSP00000425467:K49T	ENSP00000266003:K49T	K	-	2	0	MLN	33874948	1.000000	0.71417	0.312000	0.25196	0.949000	0.60115	2.630000	0.46494	1.786000	0.52430	0.533000	0.62120	AAA	MLN	-	pfam_Motilin_ghrelin	ENSG00000096395		0.527	MLN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MLN	HGNC	protein_coding	OTTHUMT00000040211.4	-	0.00	44	0	T			33766970	-1	tier1	-	no_errors	ENST00000430124	ensembl	human	known	74_37	missense	21.28	37	10	SNP	1.000	G
MLLT4	4301	genome.wustl.edu	37	6	168276141	168276141	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr6:168276141G>T	ENST00000447894.2	+	5	705	c.705G>T	c.(703-705)caG>caT	p.Q235H	MLLT4_ENST00000366806.2_Missense_Mutation_p.Q235H|MLLT4_ENST00000392112.1_Missense_Mutation_p.Q234H|MLLT4_ENST00000400822.3_Missense_Mutation_p.Q234H|MLLT4_ENST00000344191.4_Missense_Mutation_p.Q235H|MLLT4_ENST00000351017.4_Missense_Mutation_p.Q235H|MLLT4_ENST00000392108.3_Missense_Mutation_p.Q235H			P55196	AFAD_HUMAN	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 4	235					adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cell-cell signaling (GO:0007267)|signal transduction (GO:0007165)	apical part of cell (GO:0045177)|cell junction (GO:0030054)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein C-terminus binding (GO:0008022)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(13)|large_intestine(10)|lung(19)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	65		Breast(66;1.07e-05)|Ovarian(120;0.024)		Epithelial(4;2.38e-32)|OV - Ovarian serous cystadenocarcinoma(33;9.99e-23)|BRCA - Breast invasive adenocarcinoma(4;1.2e-11)|GBM - Glioblastoma multiforme(31;0.00117)		AGAGAATGCAGGAATTTCGGA	0.418			T	MLL	AL																																			Dom	yes		6	6q27	4301	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 4 (AF6)"""		L	0													196.0	208.0	204.0					6																	168276141		2203	4296	6499	SO:0001583	missense	0			AB011399	CCDS47517.1, CCDS75553.1	6q27	2008-02-05	2001-11-28		ENSG00000130396	ENSG00000130396			7137	protein-coding gene	gene with protein product		159559	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 4"""			8242616	Standard	NM_001040000		Approved	AF-6, AF6	uc021zij.1	P55196	OTTHUMG00000016031	ENST00000447894.2:c.705G>T	6.37:g.168276141G>T	ENSP00000404595:p.Gln235His		O75087|O75088|O75089|Q59FP0|Q5TIG6|Q5TIG7|Q9NSN7|Q9NU92	Missense_Mutation	SNP	pfam_Ras-assoc,pfam_Dil_domain,pfam_PDZ,pfam_FHA_dom,superfamily_PDZ,superfamily_SMAD_FHA_domain,smart_Ras-assoc,smart_FHA_dom,smart_PDZ,pfscan_Dilute,pfscan_PDZ,pfscan_Ras-assoc	p.Q235H	ENST00000447894.2	37	c.705		6	.	.	.	.	.	.	.	.	.	.	G	17.14	3.312419	0.60414	.	.	ENSG00000130396	ENST00000400825;ENST00000344191;ENST00000351017;ENST00000392108;ENST00000366806;ENST00000392112;ENST00000341575;ENST00000400824;ENST00000400822;ENST00000447894	T;T;T;T;T;T;T	0.05786	3.57;3.48;3.58;3.58;3.39;3.48;3.48	4.48	-0.263	0.12954	.	0.074745	0.56097	N	0.000035	T	0.11580	0.0282	M	0.74647	2.275	0.49299	D	0.999775	D;D;D	0.76494	0.999;0.997;0.999	D;D;D	0.83275	0.996;0.982;0.983	T	0.02326	-1.1176	10	0.87932	D	0	-0.7089	9.6376	0.39819	0.5346:0.0:0.4654:0.0	.	234;235;234	P55196-5;P55196-6;P55196-2	.;.;.	H	235;235;235;235;235;234;235;236;234;235	ENSP00000341118:Q235H;ENSP00000252692:Q235H;ENSP00000375956:Q235H;ENSP00000355771:Q235H;ENSP00000375960:Q234H;ENSP00000383623:Q234H;ENSP00000404595:Q235H	ENSP00000345834:Q235H	Q	+	3	2	MLLT4	168018990	1.000000	0.71417	0.993000	0.49108	0.987000	0.75469	0.797000	0.26999	-0.000000	0.14550	0.460000	0.39030	CAG	MLLT4	-	NULL	ENSG00000130396		0.418	MLLT4-013	PUTATIVE	basic|appris_candidate_longest	protein_coding	MLLT4	HGNC	protein_coding	OTTHUMT00000372077.1	-	0.00	80	0	G	NM_005936		168276141	+1	tier1	-	no_errors	ENST00000366806	ensembl	human	known	74_37	missense	47.00	52	47	SNP	1.000	T
MLXIPL	51085	genome.wustl.edu	37	7	73012035	73012035	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr7:73012035G>C	ENST00000313375.3	-	9	1127	c.1080C>G	c.(1078-1080)aaC>aaG	p.N360K	MLXIPL_ENST00000429400.2_Missense_Mutation_p.N360K|MLXIPL_ENST00000414749.2_Missense_Mutation_p.N360K|MLXIPL_ENST00000395189.1_Missense_Mutation_p.N267K|MLXIPL_ENST00000434326.1_Missense_Mutation_p.N267K|MLXIPL_ENST00000354613.1_Missense_Mutation_p.N360K	NM_032951.2|NM_032953.2	NP_116569.1|NP_116571.1	Q9NP71	MLXPL_HUMAN	MLX interacting protein-like	360					anatomical structure morphogenesis (GO:0009653)|energy reserve metabolic process (GO:0006112)|fatty acid homeostasis (GO:0055089)|glucose homeostasis (GO:0042593)|glucose mediated signaling pathway (GO:0010255)|intracellular signal transduction (GO:0035556)|negative regulation of cell cycle arrest (GO:0071157)|negative regulation of oxidative phosphorylation (GO:0090324)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cellular metabolic process (GO:0031325)|positive regulation of fatty acid biosynthetic process (GO:0045723)|positive regulation of glycolytic process (GO:0045821)|positive regulation of lipid biosynthetic process (GO:0046889)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of energy homeostasis (GO:2000505)|regulation of fatty acid biosynthetic process (GO:0042304)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)|triglyceride homeostasis (GO:0070328)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	carbohydrate response element binding (GO:0035538)|DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			cervix(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	13		Lung NSC(55;0.0659)|all_lung(88;0.152)				CAGGGCAGCTGTTCCGAGCCT	0.667																																																	0													20.0	25.0	23.0					7																	73012035		1589	3253	4842	SO:0001583	missense	0			AK055029	CCDS5553.1, CCDS5554.1, CCDS47605.1, CCDS47606.1	7q11.23	2013-05-21	2005-10-31	2005-10-31	ENSG00000009950	ENSG00000009950			12744	protein-coding gene	gene with protein product	"""carbohydrate response element binding protein"""	605678	"""Williams Beuren syndrome chromosome region 14"""	WBSCR14		9860302	Standard	XM_005250399		Approved	WS-bHLH, MIO, CHREBP, MONDOB, bHLHd14	uc003tyn.1	Q9NP71	OTTHUMG00000129995	ENST00000313375.3:c.1080C>G	7.37:g.73012035G>C	ENSP00000320886:p.Asn360Lys		C5HU02|C5HU03|C5HU04|Q96E48|Q9BY03|Q9BY04|Q9BY05|Q9BY06|Q9Y2P3	Missense_Mutation	SNP	pfam_bHLH_dom,superfamily_bHLH_dom,smart_bHLH_dom,pfscan_bHLH_dom	p.N360K	ENST00000313375.3	37	c.1080	CCDS5553.1	7	.	.	.	.	.	.	.	.	.	.	G	4.105	0.017644	0.07959	.	.	ENSG00000009950	ENST00000414749;ENST00000429400;ENST00000313375;ENST00000354613;ENST00000395189;ENST00000434326;ENST00000453275	T;T;T;T;T;T	0.21734	2.59;2.59;2.59;2.59;1.99;1.99	4.31	3.42	0.39159	.	1.460240	0.03942	N	0.287057	T	0.14874	0.0359	N	0.22421	0.69	0.09310	N	0.999991	B;B;B;B;B;B	0.30482	0.281;0.034;0.02;0.034;0.034;0.034	B;B;B;B;B;B	0.19946	0.027;0.025;0.011;0.025;0.025;0.025	T	0.27054	-1.0085	10	0.15066	T	0.55	-6.012	9.9473	0.41616	0.1037:0.0:0.8963:0.0	.	267;267;360;360;360;360	C5HU01;Q9NP71-6;Q9NP71;Q9NP71-2;Q9NP71-3;Q9NP71-4	.;.;MLXPL_HUMAN;.;.;.	K	360;360;360;360;267;267;193	ENSP00000412330:N360K;ENSP00000406296:N360K;ENSP00000320886:N360K;ENSP00000346629:N360K;ENSP00000378616:N267K;ENSP00000392636:N267K	ENSP00000320886:N360K	N	-	3	2	MLXIPL	72649971	1.000000	0.71417	0.995000	0.50966	0.914000	0.54420	3.400000	0.52594	0.800000	0.34041	0.423000	0.28283	AAC	MLXIPL	-	NULL	ENSG00000009950		0.667	MLXIPL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MLXIPL	HGNC	protein_coding	OTTHUMT00000252262.1	-	0.00	36	0	G	NM_032951		73012035	-1	tier1	-	no_errors	ENST00000313375	ensembl	human	known	74_37	missense	68.42	6	13	SNP	0.975	C
MMP16	4325	genome.wustl.edu	37	8	89339413	89339413	+	Missense_Mutation	SNP	G	G	C	rs199761222		TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr8:89339413G>C	ENST00000286614.6	-	1	304	c.23C>G	c.(22-24)aCt>aGt	p.T8S	RP11-586K2.1_ENST00000520849.1_RNA|RP11-586K2.1_ENST00000523254.1_RNA|RP11-586K2.1_ENST00000521433.1_RNA|MMP16_ENST00000544227.1_5'UTR	NM_005941.4	NP_005932.2	P51512	MMP16_HUMAN	matrix metallopeptidase 16 (membrane-inserted)	8					chondrocyte proliferation (GO:0035988)|collagen catabolic process (GO:0030574)|craniofacial suture morphogenesis (GO:0097094)|embryonic cranial skeleton morphogenesis (GO:0048701)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of catalytic activity (GO:0043085)	Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|enzyme activator activity (GO:0008047)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(5)|liver(1)|lung(51)|ovary(3)|prostate(4)|skin(1)|upper_aerodigestive_tract(5)|urinary_tract(3)	81					Marimastat(DB00786)	CCGTCTTCCAGTGCTGAATGT	0.493																																																	0													175.0	154.0	161.0					8																	89339413		2203	4300	6503	SO:0001583	missense	0			D85511	CCDS6246.1	8q21	2009-01-09	2005-08-08		ENSG00000156103	ENSG00000156103			7162	protein-coding gene	gene with protein product		602262	"""matrix metalloproteinase 16 (membrane-inserted)"", ""chromosome 8 open reading frame 57"""	C8orf57		7559440	Standard	NM_005941		Approved	MT3-MMP, DKFZp761D112	uc003yeb.4	P51512	OTTHUMG00000163769	ENST00000286614.6:c.23C>G	8.37:g.89339413G>C	ENSP00000286614:p.Thr8Ser		B2RAN7|Q14824|Q52H48	Missense_Mutation	SNP	pirsf_Pept_M10A_Metazoans,pfam_Hemopexin-like_repeat,pfam_Pept_M10_metallopeptidase,pfam_Pept_M10A_metallopeptidase_C,pfam_Peptidoglycan-bd-like,superfamily_Hemopexin-like_dom,superfamily_Peptidoglycan-bd-like,smart_Peptidase_Metallo,smart_Hemopexin-like_repeat,prints_Pept_M10A	p.T8S	ENST00000286614.6	37	c.23	CCDS6246.1	8	.	.	.	.	.	.	.	.	.	.	G	13.84	2.358520	0.41801	.	.	ENSG00000156103	ENST00000286614;ENST00000522726	T;T	0.49432	2.48;0.78	5.44	4.56	0.56223	.	0.259999	0.36740	N	0.002429	T	0.26629	0.0651	N	0.08118	0	0.26033	N	0.981716	B;B	0.02656	0.0;0.0	B;B	0.10450	0.005;0.0	T	0.12863	-1.0531	10	0.17832	T	0.49	.	12.424	0.55536	0.0781:0.0:0.9219:0.0	.	8;8	P51512-2;P51512	.;MMP16_HUMAN	S	8;25	ENSP00000286614:T8S;ENSP00000429147:T25S	ENSP00000286614:T8S	T	-	2	0	MMP16	89408529	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.740000	0.62087	1.273000	0.44346	0.563000	0.77884	ACT	MMP16	-	pirsf_Pept_M10A_Metazoans	ENSG00000156103		0.493	MMP16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MMP16	HGNC	protein_coding	OTTHUMT00000375304.2	-	0.00	71	0	G	NM_005941		89339413	-1	tier1	-	no_errors	ENST00000286614	ensembl	human	known	74_37	missense	27.59	42	16	SNP	1.000	C
MMS22L	253714	genome.wustl.edu	37	6	97679434	97679434	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr6:97679434C>G	ENST00000275053.4	-	13	1662	c.1397G>C	c.(1396-1398)tGt>tCt	p.C466S	MMS22L_ENST00000369251.2_Missense_Mutation_p.C426S	NM_198468.2	NP_940870.2	Q6ZRQ5	MMS22_HUMAN	MMS22-like, DNA repair protein	466					double-strand break repair via homologous recombination (GO:0000724)|replication fork processing (GO:0031297)	nuclear replication fork (GO:0043596)		p.C466F(1)		breast(1)|endometrium(9)|kidney(2)|large_intestine(12)|lung(20)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	50						TTTATCGCAACAGCAAGTCTT	0.343																																																	1	Substitution - Missense(1)	lung(1)											95.0	92.0	93.0					6																	97679434		2203	4300	6503	SO:0001583	missense	0				CCDS5039.1	6q16.3	2010-11-11	2010-11-11	2010-11-11	ENSG00000146263	ENSG00000146263			21475	protein-coding gene	gene with protein product		615614	"""chromosome 6 open reading frame 167"""	C6orf167		21055983, 21055984	Standard	NM_198468		Approved	dJ39B17.2	uc003ppb.3	Q6ZRQ5	OTTHUMG00000015248	ENST00000275053.4:c.1397G>C	6.37:g.97679434C>G	ENSP00000275053:p.Cys466Ser		D6R9Y8|D6RBQ4|E1P529|Q5THT2|Q68CQ6|Q68D32	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.C466S	ENST00000275053.4	37	c.1397	CCDS5039.1	6	.	.	.	.	.	.	.	.	.	.	C	7.452	0.642921	0.14451	.	.	ENSG00000146263	ENST00000275053;ENST00000369251	T;T	0.34859	1.34;1.34	4.78	2.91	0.33838	.	0.120753	0.56097	D	0.000026	T	0.22166	0.0534	M	0.74258	2.255	0.54753	D	0.999986	P;P	0.39216	0.664;0.554	B;B	0.37989	0.262;0.188	T	0.04103	-1.0977	10	0.72032	D	0.01	-2.3041	8.0515	0.30581	0.1564:0.7612:0.0:0.0824	.	426;466	E2QRD4;Q6ZRQ5	.;MMS22_HUMAN	S	466;426	ENSP00000275053:C466S;ENSP00000358254:C426S	ENSP00000275053:C466S	C	-	2	0	MMS22L	97786155	0.998000	0.40836	0.998000	0.56505	0.153000	0.21895	2.252000	0.43196	0.375000	0.24679	0.655000	0.94253	TGT	MMS22L	-	NULL	ENSG00000146263		0.343	MMS22L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MMS22L	HGNC	protein_coding	OTTHUMT00000041573.3	-	0.00	84	0	C	NM_198468		97679434	-1	tier1	-	no_errors	ENST00000275053	ensembl	human	known	74_37	missense	24.29	53	17	SNP	1.000	G
MROH2B	133558	genome.wustl.edu	37	5	41052670	41052670	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr5:41052670A>G	ENST00000399564.4	-	12	1577	c.1127T>C	c.(1126-1128)cTc>cCc	p.L376P	MROH2B_ENST00000506092.2_Intron	NM_173489.4	NP_775760.3	Q7Z745	MRO2B_HUMAN	maestro heat-like repeat family member 2B	376																	TTGGATGAGGAGAAGAACAGA	0.358																																																	0													71.0	64.0	66.0					5																	41052670		1848	4093	5941	SO:0001583	missense	0				CCDS47202.1	5p13.1	2012-12-19	2012-12-19	2012-12-19	ENSG00000171495	ENSG00000171495		"""maestro heat-like repeat containing"""	26857	protein-coding gene	gene with protein product			"""HEAT repeat family member 7B2"""	HEATR7B2		12477932	Standard	NM_173489		Approved	DKFZp781F0822, FLJ40243	uc003jmj.4	Q7Z745	OTTHUMG00000162151	ENST00000399564.4:c.1127T>C	5.37:g.41052670A>G	ENSP00000382476:p.Leu376Pro		Q68DM1|Q7Z4U4|Q8N7X3	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.L376P	ENST00000399564.4	37	c.1127	CCDS47202.1	5	.	.	.	.	.	.	.	.	.	.	A	16.25	3.070526	0.55539	.	.	ENSG00000171495	ENST00000296803;ENST00000399564	T	0.68903	-0.36	5.79	5.79	0.91817	Armadillo-type fold (1);	0.000000	0.47455	D	0.000233	T	0.77798	0.4184	L	0.56769	1.78	0.58432	D	0.999999	D	0.89917	1.0	D	0.91635	0.999	T	0.77900	-0.2415	10	0.46703	T	0.11	.	12.5167	0.56036	1.0:0.0:0.0:0.0	.	376	Q7Z745	HTRB2_HUMAN	P	80;376	ENSP00000382476:L376P	ENSP00000296803:L80P	L	-	2	0	HEATR7B2	41088427	0.980000	0.34600	0.997000	0.53966	0.714000	0.41099	2.688000	0.46984	2.208000	0.71279	0.533000	0.62120	CTC	MROH2B	-	superfamily_ARM-type_fold	ENSG00000171495		0.358	MROH2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MROH2B	HGNC	protein_coding	OTTHUMT00000367558.2	-	0.00	60	0	A	NM_173489		41052670	-1	tier1	-	no_errors	ENST00000399564	ensembl	human	known	74_37	missense	26.19	31	11	SNP	1.000	G
MRPL49	740	genome.wustl.edu	37	11	64889706	64889706	+	5'Flank	SNP	C	C	G			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr11:64889706C>G	ENST00000279242.2	+	0	0				FAU_ENST00000529259.1_5'Flank|FAU_ENST00000525297.1_5'Flank|MRPL49_ENST00000534078.1_5'Flank|FAU_ENST00000531743.1_5'Flank|MRPL49_ENST00000526171.1_5'Flank|FAU_ENST00000434372.2_5'Flank|FAU_ENST00000529639.1_5'UTR|FAU_ENST00000279259.3_5'Flank|MRPL49_ENST00000531705.1_5'Flank|MRPL49_ENST00000524482.1_3'UTR|FAU_ENST00000527548.1_5'Flank	NM_004927.3	NP_004918.1	Q13405	RM49_HUMAN	mitochondrial ribosomal protein L49						translation (GO:0006412)	mitochondrial ribosome (GO:0005761)	structural constituent of ribosome (GO:0003735)			endometrium(1)|ovary(1)	2						CAAGGCAGTCCTAGCTCCGCC	0.677																																																	0																																										SO:0001631	upstream_gene_variant	0				CCDS8096.1	11q13.1	2012-11-14	2001-10-16	2001-10-19	ENSG00000149792	ENSG00000149792		"""Mitochondrial ribosomal proteins / large subunits"""	1176	protein-coding gene	gene with protein product	"""neighbor of FAU"", ""next to FAU"""	606866	"""chromosome 11 open reading frame 4"""	C11orf4		8786148	Standard	NM_004927		Approved	NOF, NOF1, L49mt	uc001oda.2	Q13405	OTTHUMG00000165608		11.37:g.64889706C>G	Exception_encountered		B2R4G6	RNA	SNP	-	NULL	ENST00000279242.2	37	NULL	CCDS8096.1	11																																																																																			MRPL49	-	-	ENSG00000149792		0.677	MRPL49-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRPL49	HGNC	protein_coding	OTTHUMT00000385293.1	-	0.00	39	0	C	NM_004927		64889706	+1	tier1	-	no_errors	ENST00000524482	ensembl	human	known	74_37	rna	31.43	24	11	SNP	0.001	G
MSRA	4482	genome.wustl.edu	37	8	10159088	10159088	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr8:10159088G>A	ENST00000317173.4	+	4	625	c.376G>A	c.(376-378)Gaa>Aaa	p.E126K	MSRA_ENST00000382490.5_Missense_Mutation_p.E83K|MSRA_ENST00000518255.1_Missense_Mutation_p.E126K|MSRA_ENST00000528246.1_Missense_Mutation_p.E60K|MSRA_ENST00000441698.2_Missense_Mutation_p.E86K	NM_012331.3	NP_036463.1	Q9UJ68	MSRA_HUMAN	methionine sulfoxide reductase A	126					cellular protein modification process (GO:0006464)|methionine metabolic process (GO:0006555)|protein repair (GO:0030091)|response to oxidative stress (GO:0006979)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	peptide-methionine (S)-S-oxide reductase activity (GO:0008113)			central_nervous_system(1)|endometrium(2)|kidney(1)|lung(4)	8		Myeloproliferative disorder(644;0.178)			L-Methionine(DB00134)	GTACCAGCCAGAACACATGAG	0.423																																					NSCLC(88;1378 1469 30580 49103 52286)												0													124.0	125.0	124.0					8																	10159088		2203	4300	6503	SO:0001583	missense	0			BC054033	CCDS5975.1, CCDS47798.1, CCDS47799.1, CCDS56522.1	8p23.1	2009-07-10			ENSG00000175806	ENSG00000175806	1.8.4.11		7377	protein-coding gene	gene with protein product		601250				10452521	Standard	NM_012331		Approved		uc003wsx.3	Q9UJ68	OTTHUMG00000090517	ENST00000317173.4:c.376G>A	8.37:g.10159088G>A	ENSP00000313921:p.Glu126Lys		E9PAS8|Q52TC4|Q549N4|Q66MI7	Missense_Mutation	SNP	pfam_Met_Sox_Rdtase_MsrA,superfamily_Met_Sox_Rdtase_MsrA,tigrfam_Met_Sox_Rdtase_MsrA	p.E126K	ENST00000317173.4	37	c.376	CCDS5975.1	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	10.21|10.21	1.286251|1.286251	0.23478|0.23478	.|.	.|.	ENSG00000175806|ENSG00000175806	ENST00000317173;ENST00000441698;ENST00000518255;ENST00000522907;ENST00000528246;ENST00000382490|ENST00000521686	.|.	.|.	.|.	5.71|5.71	5.71|5.71	0.89125|0.89125	.|.	0.355468|.	0.34879|.	N|.	0.003620|.	T|T	0.30634|0.30634	0.0771|0.0771	N|N	0.03983|0.03983	-0.305|-0.305	0.33701|0.33701	D|D	0.614556|0.614556	B;B;B;B|.	0.23990|.	0.005;0.095;0.002;0.006|.	B;B;B;B|.	0.22753|.	0.002;0.041;0.002;0.012|.	T|T	0.41556|0.41556	-0.9502|-0.9502	8|5	.|.	.|.	.|.	-15.7183|-15.7183	15.952|15.952	0.79846|0.79846	0.0:0.1347:0.8653:0.0|0.0:0.1347:0.8653:0.0	.|.	83;86;83;126|.	B7Z694;Q9UJ68-4;Q9UJ68-3;Q9UJ68|.	.;.;.;MSRA_HUMAN|.	K|K	126;86;126;60;60;83|15	.|.	.|.	E|R	+|+	1|2	0|0	MSRA|MSRA	10196498|10196498	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.999000|0.999000	0.98932|0.98932	6.163000|6.163000	0.71880|0.71880	2.687000|2.687000	0.91594|0.91594	0.655000|0.655000	0.94253|0.94253	GAA|AGA	MSRA	-	pfam_Met_Sox_Rdtase_MsrA,superfamily_Met_Sox_Rdtase_MsrA,tigrfam_Met_Sox_Rdtase_MsrA	ENSG00000175806		0.423	MSRA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MSRA	HGNC	protein_coding	OTTHUMT00000207005.1	-	0.00	70	0	G	NM_012331		10159088	+1	tier1	-	no_errors	ENST00000317173	ensembl	human	known	74_37	missense	26.67	44	16	SNP	1.000	A
MT-CO1	4512	genome.wustl.edu	37	M	4267	4267	+	5'Flank	SNP	A	A	G			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chrM:4267A>G	ENST00000361624.2	+	0	0				MT-ND2_ENST00000361453.3_5'Flank|MT-TC_ENST00000387405.1_RNA|MT-TL1_ENST00000386347.1_RNA|MT-TM_ENST00000387377.1_RNA|MT-TA_ENST00000387392.1_RNA|MT-RNR1_ENST00000389680.2_RNA|MT-TI_ENST00000387365.1_RNA|MT-TQ_ENST00000387372.1_RNA|MT-RNR2_ENST00000387347.2_RNA|MT-TW_ENST00000387382.1_RNA|MT-TV_ENST00000387342.1_RNA|MT-TN_ENST00000387400.1_RNA|MT-TY_ENST00000387409.1_RNA			P00395	COX1_HUMAN	mitochondrially encoded cytochrome c oxidase I						aerobic respiration (GO:0009060)|cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|oxidative phosphorylation (GO:0006119)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex IV (GO:0005751)|respiratory chain complex IV (GO:0045277)	cytochrome-c oxidase activity (GO:0004129)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(4)|endometrium(25)|kidney(19)|lung(3)|prostate(3)	54						AAACCTAAGAAATATGTCTGA	0.383																																																	0																																										SO:0001631	upstream_gene_variant	0					mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198804	ENSG00000198804		"""Mitochondrial respiratory chain complex / Complex IV"""	7419	protein-coding gene	gene with protein product		516030	"""cytochrome c oxidase I"""	MTCO1		7219534	Standard			Approved	COX1, COI		P00395			M.37:g.4267A>G	Exception_encountered		Q34770	RNA	SNP	-	NULL	ENST00000361624.2	37	NULL		MT																																																																																			MT-TI	-	-	ENSG00000210100		0.383	MT-CO1-201	KNOWN	basic|appris_principal	protein_coding	MT-TI	HGNC	protein_coding			0.00	9	0	A	YP_003024028		4267	+1			no_errors	ENST00000387365	ensembl	human	known	74_37	rna	30.00	7	3	SNP	NULL	G
MT-ND6	4541	genome.wustl.edu	37	M	16015	16015	+	5'Flank	SNP	T	T	C			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chrM:16015T>C	ENST00000361681.2	-	0	0				MT-TE_ENST00000387459.1_RNA|MT-TT_ENST00000387460.2_RNA|MT-TP_ENST00000387461.2_RNA			P03923	NU6M_HUMAN	mitochondrially encoded NADH dehydrogenase 6						cellular metabolic process (GO:0044237)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|respiratory chain (GO:0070469)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(1)|endometrium(10)|kidney(17)|urinary_tract(1)	29						CTAATTTAAACTATTCTCTGT	0.408																																																	0																																										SO:0001631	upstream_gene_variant	0					mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198695	ENSG00000198695	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7462	protein-coding gene	gene with protein product	"""complex I ND6 subunit"", ""NADH-ubiquinone oxidoreductase chain 6"""	516006	"""NADH dehydrogenase 6"""	MTND6			Standard			Approved	NAD6, ND6		P03923			M.37:g.16015T>C	Exception_encountered		Q34774|Q8HG30	RNA	SNP	-	NULL	ENST00000361681.2	37	NULL		MT																																																																																			MT-TP	-	-	ENSG00000210196		0.408	MT-ND6-201	KNOWN	basic|appris_principal	protein_coding	MT-TP	HGNC	protein_coding		-	0.00	13	0	T	YP_003024037		16015	-1	tier1	-	no_errors	ENST00000387461	ensembl	human	known	74_37	rna	100.00	0	10	SNP	NULL	C
MTG1	92170	genome.wustl.edu	37	10	135207758	135207758	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr10:135207758G>A	ENST00000317502.6	+	1	84	c.34G>A	c.(34-36)Gcc>Acc	p.A12T	RP11-108K14.8_ENST00000468317.2_Intron|MTG1_ENST00000477902.2_Intron	NM_138384.2	NP_612393.2	Q9BT17	MTG1_HUMAN	mitochondrial ribosome-associated GTPase 1	12					GTP catabolic process (GO:0006184)|regulation of mitochondrial translation (GO:0070129)|regulation of respiratory system process (GO:0044065)|ribosome biogenesis (GO:0042254)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial ribosome (GO:0005761)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			endometrium(1)|large_intestine(5)|lung(5)|ovary(2)|skin(1)|urinary_tract(1)	15		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;1.21e-06)|all cancers(32;1.69e-06)|Epithelial(32;1.94e-06)		GTGCAGCGCCGCCCAGGCCGC	0.746																																																	0													4.0	6.0	5.0					10																	135207758		1759	3378	5137	SO:0001583	missense	0				CCDS31320.1	10q26.3	2013-05-24	2013-05-24	2006-01-09	ENSG00000148824	ENSG00000148824			32159	protein-coding gene	gene with protein product			"""GTP-binding protein 7"", ""GTP-binding protein 7 (putative)"", ""mitochondrial GTPase 1 homolog (S. cerevisiae)"""	GTPBP7		12808030, 23396448	Standard	NM_138384		Approved		uc001lnd.3	Q9BT17	OTTHUMG00000166564	ENST00000317502.6:c.34G>A	10.37:g.135207758G>A	ENSP00000323047:p.Ala12Thr		Q5VWX8|Q6PIY9|Q8IYJ4|Q8NC48|Q9BVU8	Missense_Mutation	SNP	pfam_GTP_binding_domain,superfamily_P-loop_NTPase,pirsf_GTPase_MTG1,tigrfam_GTP-bd_ribosome_bgen_YlqF	p.A12T	ENST00000317502.6	37	c.34	CCDS31320.1	10	.	.	.	.	.	.	.	.	.	.	g	15.74	2.922596	0.52653	.	.	ENSG00000148824	ENST00000317502;ENST00000432508	T;T	0.49432	1.45;0.78	5.01	4.08	0.47627	.	2.417310	0.01583	N	0.021175	T	0.35422	0.0931	N	0.14661	0.345	0.36809	D	0.885792	B	0.17465	0.022	B	0.12837	0.008	T	0.06643	-1.0815	10	0.18710	T	0.47	-1.8056	10.5784	0.45240	0.0:0.0:0.8071:0.1929	.	12	Q9BT17	MTG1_HUMAN	T	12	ENSP00000323047:A12T;ENSP00000393480:A12T	ENSP00000323047:A12T	A	+	1	0	AL360181.1	135057748	0.070000	0.21116	0.009000	0.14445	0.042000	0.13812	1.571000	0.36450	1.057000	0.40506	0.563000	0.77884	GCC	MTG1	-	NULL	ENSG00000148824		0.746	MTG1-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	MTG1	HGNC	protein_coding	OTTHUMT00000051166.1	-	0.00	17	0	G	NM_138384		135207758	+1	tier1	-	no_errors	ENST00000317502	ensembl	human	known	74_37	missense	21.05	15	4	SNP	0.045	A
MTUS2	23281	genome.wustl.edu	37	13	29855933	29855933	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr13:29855933G>A	ENST00000431530.3	+	4	2825	c.2767G>A	c.(2767-2769)Gca>Aca	p.A923T		NM_001033602.2	NP_001028774.2	Q5JR59	MTUS2_HUMAN	microtubule associated tumor suppressor candidate 2	913	Localization to the growing distal tip of microtubules.|Mediates interaction with MAPRE1.					cytoplasm (GO:0005737)|microtubule (GO:0005874)	microtubule binding (GO:0008017)|protein homodimerization activity (GO:0042803)			NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(3)|prostate(1)|skin(1)	20						GGCCCCTCCAGCATCCTCCAG	0.577																																																	0													42.0	44.0	43.0					13																	29855933		1874	4111	5985	SO:0001583	missense	0			AB018317	CCDS41874.1, CCDS45022.1	13q12.3	2013-01-17	2009-10-20	2009-10-20	ENSG00000132938	ENSG00000132938			20595	protein-coding gene	gene with protein product	"""+TIP of 150 kDa"", ""cardiac zipper protein"""		"""KIAA0774"""	KIAA0774		19543227	Standard	NM_001033602		Approved	TIP150, CAZIP, ICIS	uc001usl.4	Q5JR59	OTTHUMG00000016657	ENST00000431530.3:c.2767G>A	13.37:g.29855933G>A	ENSP00000392057:p.Ala923Thr		A7E292|B4DF81|O94872|Q08E97|Q5JQR3|Q8N5E2	Missense_Mutation	SNP	NULL	p.A923T	ENST00000431530.3	37	c.2767	CCDS45022.1	13	.	.	.	.	.	.	.	.	.	.	G	8.328	0.825825	0.16749	.	.	ENSG00000132938	ENST00000431530	T	0.14266	2.52	4.87	0.836	0.18891	.	0.759646	0.11752	N	0.532919	T	0.07098	0.0180	N	0.22421	0.69	0.09310	N	0.999999	B	0.27351	0.176	B	0.24541	0.054	T	0.39563	-0.9608	9	.	.	.	.	2.8301	0.05497	0.1702:0.1352:0.5464:0.1483	.	913	Q5JR59	MTUS2_HUMAN	T	923	ENSP00000392057:A923T	.	A	+	1	0	MTUS2	28753933	0.009000	0.17119	0.000000	0.03702	0.003000	0.03518	1.234000	0.32660	0.011000	0.14865	0.655000	0.94253	GCA	MTUS2	-	NULL	ENSG00000132938		0.577	MTUS2-002	KNOWN	basic|CCDS	protein_coding	MTUS2	HGNC	protein_coding	OTTHUMT00000044336.3	-	0.00	94	0	G	XM_166270		29855933	+1	tier1	-	no_errors	ENST00000431530	ensembl	human	known	74_37	missense	7.02	53	4	SNP	0.001	A
MUC5B	727897	genome.wustl.edu	37	11	1247507	1247507	+	Splice_Site	SNP	G	G	A			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr11:1247507G>A	ENST00000529681.1	+	3	257		c.e3+1		MUC5B_ENST00000447027.1_Splice_Site	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming						cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		AGCCTGAGCCGTAAGCAGATG	0.672																																																	0													13.0	17.0	16.0					11																	1247507		1888	4013	5901	SO:0001630	splice_region_variant	0			U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.199+1G>A	11.37:g.1247507G>A			O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Splice_Site	SNP	-	e3+1	ENST00000529681.1	37	c.199+1	CCDS44515.2	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	11.73|11.73	1.725410|1.725410	0.30593|0.30593	.|.	.|.	ENSG00000117983|ENSG00000117983	ENST00000529681;ENST00000447027;ENST00000349637|ENST00000406844	.|.	.|.	.|.	3.24|3.24	3.24|3.24	0.37175|0.37175	.|.	.|.	.|.	.|.	.|.	.|T	.|0.35098	.|0.0920	.|.	.|.	.|.	0.47621|0.47621	D|D	0.999478|0.999478	.|D	.|0.62365	.|0.991	.|B	.|0.43155	.|0.41	.|T	.|0.06320	.|-1.0833	.|7	.|0.20519	.|T	.|0.43	.|.	10.1164|10.1164	0.42593|0.42593	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|693	.|A7Y9J9	.|.	.|H	-1|70	.|.	.|ENSP00000384815:R70H	.|R	+|+	.|2	.|0	MUC5B|MUC5B	1204083|1204083	0.421000|0.421000	0.25465|0.25465	0.618000|0.618000	0.29105|0.29105	0.052000|0.052000	0.14988|0.14988	0.926000|0.926000	0.28804|0.28804	1.813000|1.813000	0.52934|0.52934	0.561000|0.561000	0.74099|0.74099	.|CGT	MUC5B	-	-	ENSG00000117983		0.672	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	MUC5B	HGNC	protein_coding	OTTHUMT00000390041.2	-	0.00	206	0	G	XM_001126093	Intron	1247507	+1	tier1	-	no_errors	ENST00000447027	ensembl	human	known	74_37	splice_site	28.33	208	83	SNP	0.453	A
MXI1	4601	genome.wustl.edu	37	10	112045704	112045705	+	3'UTR	INS	-	-	A	rs569487570		TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr10:112045704_112045705insA	ENST00000239007.7	+	0	1864_1865				MXI1_ENST00000361248.4_3'UTR|MXI1_ENST00000332674.5_3'UTR|MXI1_ENST00000485566.1_3'UTR	NM_005962.4	NP_005953.4	P50539	MXI1_HUMAN	MAX interactor 1, dimerization protein						cytoplasmic sequestering of transcription factor (GO:0042994)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(3)|lung(1)	10		Breast(234;0.052)|Lung NSC(174;0.223)		Epithelial(162;1.33e-05)|all cancers(201;0.000277)|BRCA - Breast invasive adenocarcinoma(275;0.127)		AGCTTATCCATAAAAAAAAATA	0.322																																																	0																																										SO:0001624	3_prime_UTR_variant	0			BC016678	CCDS7563.1, CCDS7564.2, CCDS31284.1	10q24-q25	2012-11-15	2012-11-15		ENSG00000119950	ENSG00000119950		"""MAX dimerization proteins"", ""Basic helix-loop-helix proteins"""	7534	protein-coding gene	gene with protein product		600020	"""MAX interacting protein 1"", ""MAX interactor 1"""			7959753	Standard	NM_130439		Approved	MXD2, MAD2, MXI, bHLHc11	uc001kyy.3	P50539	OTTHUMG00000019033	ENST00000239007.7:c.*960->A	10.37:g.112045713_112045713dupA			B1ANN7|D3DR25|D3DRA9|Q15887|Q6FHW2|Q96E53	RNA	INS	-	NULL	ENST00000239007.7	37	NULL	CCDS7564.2	10																																																																																			MXI1	-	-	ENSG00000119950		0.322	MXI1-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	MXI1	HGNC	protein_coding	OTTHUMT00000050316.1		0.00	54	0	-	NM_130439		112045705	+1	tier1		no_errors	ENST00000485566	ensembl	human	known	74_37	rna	17.24	24	5	INS	0.991:0.827	A
MYH2	4620	genome.wustl.edu	37	17	10441064	10441064	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr17:10441064T>C	ENST00000245503.5	-	15	1889	c.1505A>G	c.(1504-1506)gAg>gGg	p.E502G	RP11-799N11.1_ENST00000399342.2_RNA|CTC-297N7.11_ENST00000587182.2_RNA|MYH2_ENST00000532183.2_Missense_Mutation_p.E502G|RP11-799N11.1_ENST00000581304.1_RNA|MYH2_ENST00000397183.2_Missense_Mutation_p.E502G	NM_017534.5	NP_060004.3	Q9UKX2	MYH2_HUMAN	myosin, heavy chain 2, skeletal muscle, adult	502	Myosin motor.				Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|membrane organization (GO:0061024)|metabolic process (GO:0008152)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|plasma membrane repair (GO:0001778)|response to activity (GO:0014823)	A band (GO:0031672)|actomyosin contractile ring (GO:0005826)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)|protein complex (GO:0043234)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|lung(99)|ovary(6)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(4)	176						CTTGTACTCCTCCTGCTCCAG	0.488																																																	0													184.0	154.0	165.0					17																	10441064		2203	4300	6503	SO:0001583	missense	0				CCDS11156.1	17p13.1	2014-02-04	2006-09-29		ENSG00000125414	ENSG00000125414		"""Myosins / Myosin superfamily : Class II"""	7572	protein-coding gene	gene with protein product		160740	"""myosin, heavy polypeptide 2, skeletal muscle, adult"", ""inclusion body myopathy 3, autosomal dominant"""	IBM3		7545970, 11889243	Standard	NM_001100112		Approved	MYH2A, MYHSA2, MyHC-IIa, MYHas8, MyHC-2A	uc010coi.3	Q9UKX2	OTTHUMG00000130363	ENST00000245503.5:c.1505A>G	17.37:g.10441064T>C	ENSP00000245503:p.Glu502Gly		A0AVL4|Q14322|Q16229|Q567P6|Q86T56	Missense_Mutation	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_P-loop_NTPase,superfamily_Prefoldin,superfamily_Ribosomal_L29,superfamily_t-SNARE,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.E502G	ENST00000245503.5	37	c.1505	CCDS11156.1	17	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	28.7|28.7	4.942035|4.942035	0.92526|0.92526	.|.	.|.	ENSG00000125414|ENSG00000214970	ENST00000532183;ENST00000245503;ENST00000397183|ENST00000399342	T;T;T|.	0.76316|.	-1.01;-1.01;-1.01|.	5.51|5.51	5.51|5.51	0.81932|0.81932	Myosin head, motor domain (2);|.	0.000000|.	0.39687|.	U|.	0.001290|.	D|D	0.89487|0.89487	0.6729|0.6729	H|H	0.99104|0.99104	4.43|4.43	0.58432|0.58432	D|D	0.999999|0.999999	D;D|.	0.76494|.	0.999;0.974|.	D;D|.	0.81914|.	0.995;0.947|.	D|D	0.93690|0.93690	0.7006|0.7006	10|6	0.87932|0.87932	D|D	0|0	.|.	14.8155|14.8155	0.70031|0.70031	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	502;502|.	Q567P6;Q9UKX2|.	.;MYH2_HUMAN|.	G|P	502|46	ENSP00000433944:E502G;ENSP00000245503:E502G;ENSP00000380367:E502G|.	ENSP00000245503:E502G|ENSP00000382280:S46P	E|S	-|+	2|1	0|0	MYH2|AC005323.1	10381789|10381789	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	8.004000|8.004000	0.88535|0.88535	2.105000|2.105000	0.64084|0.64084	0.533000|0.533000	0.62120|0.62120	GAG|TCC	MYH2	-	pfam_Myosin_head_motor_dom,superfamily_P-loop_NTPase,smart_Myosin_head_motor_dom	ENSG00000125414		0.488	MYH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH2	HGNC	protein_coding	OTTHUMT00000252726.3	-	0.00	199	0	T	NM_017534		10441064	-1	tier1	-	no_errors	ENST00000245503	ensembl	human	known	74_37	missense	53.33	49	56	SNP	1.000	C
MYO1D	4642	genome.wustl.edu	37	17	31102928	31102929	+	Frame_Shift_Ins	INS	-	-	A			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr17:31102928_31102929insA	ENST00000318217.5	-	4	821_822	c.517_518insT	c.(517-519)aagfs	p.K173fs	MYO1D_ENST00000579584.1_Frame_Shift_Ins_p.K173fs|MYO1D_ENST00000394649.4_Frame_Shift_Ins_p.K85fs|MYO1D_ENST00000583621.1_Frame_Shift_Ins_p.K173fs	NM_015194.1	NP_056009.1	O94832	MYO1D_HUMAN	myosin ID	173	Myosin motor.				early endosome to recycling endosome transport (GO:0061502)|negative regulation of phosphatase activity (GO:0010923)	axolemma (GO:0030673)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|smooth endoplasmic reticulum (GO:0005790)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			breast(1)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(8)|lung(14)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	39			BRCA - Breast invasive adenocarcinoma(9;0.0362)			AGGGTCACCCTTGAAGTCAAAG	0.356																																																	0																																										SO:0001589	frameshift_variant	0			AB018270	CCDS32615.1	17q11-q12	2014-06-12				ENSG00000176658		"""Myosins / Myosin superfamily : Class I"""	7598	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 108"""	606539				8884266	Standard	NM_015194		Approved	KIAA0727, myr4, PPP1R108	uc002hho.1	O94832		ENST00000318217.5:c.517_518insT	17.37:g.31102928_31102929insA	ENSP00000324527:p.Lys173fs		A6H8V3|Q8NHP9	Frame_Shift_Ins	INS	pfam_Myosin_head_motor_dom,pfam_Myosin_tail_2,pfam_IQ_motif_EF-hand-BS,superfamily_P-loop_NTPase,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.K173fs	ENST00000318217.5	37	c.518_517	CCDS32615.1	17																																																																																			MYO1D	-	pfam_Myosin_head_motor_dom,superfamily_P-loop_NTPase,smart_Myosin_head_motor_dom	ENSG00000176658		0.356	MYO1D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO1D	HGNC	protein_coding	OTTHUMT00000447457.1		0.00	67	0	-			31102929	-1	tier1		no_errors	ENST00000318217	ensembl	human	known	74_37	frame_shift_ins	22.22	28	8	INS	1.000:1.000	A
NAT2	10	genome.wustl.edu	37	8	18258116	18258116	+	Silent	SNP	T	T	C			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr8:18258116T>C	ENST00000286479.3	+	2	710	c.603T>C	c.(601-603)gaT>gaC	p.D201D	NAT2_ENST00000520116.1_Silent_p.D71D	NM_000015.2	NP_000006.2	P11245	ARY2_HUMAN	N-acetyltransferase 2 (arylamine N-acetyltransferase)	201					small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	arylamine N-acetyltransferase activity (GO:0004060)			kidney(1)|large_intestine(1)|lung(6)|ovary(1)|prostate(1)|skin(2)	12				Colorectal(111;0.0531)|COAD - Colon adenocarcinoma(73;0.21)	Acetaminophen(DB00316)|Clonazepam(DB01068)|Dapsone(DB00250)|Ezogabine(DB04953)|Isoniazid(DB00951)|Sulfamethoxazole(DB01015)	CAATTGAAGATTTTGAGTCTA	0.353									Naso-/Oropharyngeal/Laryngeal Cancer, Familial Clustering of																																								0													92.0	97.0	96.0					8																	18258116		2202	4300	6502	SO:0001819	synonymous_variant	0	Familial Cancer Database	incl.: Familial Head and Neck Cancer	D90042	CCDS6008.1	8p22	2012-01-18			ENSG00000156006	ENSG00000156006	2.3.1.5		7646	protein-coding gene	gene with protein product		612182		AAC2		7773298	Standard	NM_000015		Approved		uc003wyw.1	P11245	OTTHUMG00000130826	ENST00000286479.3:c.603T>C	8.37:g.18258116T>C			O43637|O60654|O60655|Q13146|Q16697|Q2MLE4|Q2MLF5|Q2MLG8|Q2MLJ6|Q2MLK4|Q2MLK6|Q2MLN7|Q6LET4|Q86XS0|Q86XS1|Q96KY8|Q96T64|Q96T65|Q9H220	Silent	SNP	pfam_Arylamine_N-AcTrfase,prints_Arylamine_N-AcTrfase	p.D201	ENST00000286479.3	37	c.603	CCDS6008.1	8																																																																																			NAT2	-	pfam_Arylamine_N-AcTrfase,prints_Arylamine_N-AcTrfase	ENSG00000156006		0.353	NAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NAT2	HGNC	protein_coding	OTTHUMT00000253380.1	-	0.00	56	0	T	NM_000015		18258116	+1	tier1	-	no_errors	ENST00000286479	ensembl	human	known	74_37	silent	30.61	34	15	SNP	0.980	C
NDST4	64579	genome.wustl.edu	37	4	115997920	115997920	+	Silent	SNP	G	G	T			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr4:115997920G>T	ENST00000264363.2	-	2	951	c.273C>A	c.(271-273)ctC>ctA	p.L91L		NM_022569.1	NP_072091.1	Q9H3R1	NDST4_HUMAN	N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 4	91	Heparan sulfate N-deacetylase 4.				heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparin biosynthetic process (GO:0030210)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine N-sulfotransferase activity (GO:0015016)|deacetylase activity (GO:0019213)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(5)|lung(43)|ovary(1)|prostate(7)|skin(11)|upper_aerodigestive_tract(1)|urinary_tract(1)	81		Ovarian(17;0.156)		OV - Ovarian serous cystadenocarcinoma(123;0.000562)		TATCTTGACCGAGTTGAGAGT	0.438																																																	0													137.0	150.0	145.0					4																	115997920		2203	4300	6503	SO:0001819	synonymous_variant	0			AB036429	CCDS3706.1	4q26	2008-02-05			ENSG00000138653	ENSG00000138653		"""Sulfotransferases, membrane-bound"""	20779	protein-coding gene	gene with protein product		615039				11087757	Standard	NM_022569		Approved		uc003ibu.3	Q9H3R1	OTTHUMG00000132916	ENST00000264363.2:c.273C>A	4.37:g.115997920G>T			Q2KHM8	Silent	SNP	pfam_Heparan_SO4_deacetylase,pfam_Sulfotransferase_dom,superfamily_P-loop_NTPase	p.L91	ENST00000264363.2	37	c.273	CCDS3706.1	4																																																																																			NDST4	-	pfam_Heparan_SO4_deacetylase	ENSG00000138653		0.438	NDST4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NDST4	HGNC	protein_coding	OTTHUMT00000256427.1		0.00	57	0	G	NM_022569		115997920	-1			no_errors	ENST00000264363	ensembl	human	known	74_37	silent	5.66	50	3	SNP	0.028	T
NEB	4703	genome.wustl.edu	37	2	152471079	152471079	+	Missense_Mutation	SNP	C	C	T	rs374486286		TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr2:152471079C>T	ENST00000172853.10	-	73	10730	c.10583G>A	c.(10582-10584)cGc>cAc	p.R3528H	NEB_ENST00000603639.1_Missense_Mutation_p.R3771H|NEB_ENST00000397345.3_Missense_Mutation_p.R3771H|NEB_ENST00000604864.1_Missense_Mutation_p.R3771H|NEB_ENST00000427231.2_Missense_Mutation_p.R3771H|NEB_ENST00000409198.1_Missense_Mutation_p.R3528H			P20929	NEBU_HUMAN	nebulin	3528					muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|regulation of actin filament length (GO:0030832)|somatic muscle development (GO:0007525)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)			NS(5)|autonomic_ganglia(3)|breast(9)|central_nervous_system(5)|cervix(3)|endometrium(35)|kidney(16)|large_intestine(77)|liver(1)|lung(99)|ovary(9)|pancreas(3)|prostate(13)|skin(7)|stomach(8)|upper_aerodigestive_tract(6)|urinary_tract(2)	301				BRCA - Breast invasive adenocarcinoma(221;0.219)		AAGCTGTTTGCGGTAGCCTTC	0.418																																																	0													105.0	99.0	101.0					2																	152471079		1884	4118	6002	SO:0001583	missense	0			X83957	CCDS46424.1, CCDS54407.1, CCDS54408.1, CCDS74588.1	2q22	2014-09-17			ENSG00000183091	ENSG00000183091			7720	protein-coding gene	gene with protein product	"""nemaline myopathy type 2"""	161650		NEM2		10051637, 9359044	Standard	NM_001164507		Approved	NEB177D	uc010fnx.3	P20929	OTTHUMG00000153784	ENST00000172853.10:c.10583G>A	2.37:g.152471079C>T	ENSP00000172853:p.Arg3528His		F8WCL5|F8WCP0|Q15346|Q53QQ2|Q53TG8	Missense_Mutation	SNP	pfam_Nebulin_35r-motif,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,superfamily_Adhesion_dom,superfamily_6-PGluconate_DH_C-like,smart_Nebulin_35r-motif,smart_SH3_domain,pfscan_Nebulin_35r-motif,pfscan_SH3_domain,prints_Nebulin	p.R3771H	ENST00000172853.10	37	c.11312		2	.	.	.	.	.	.	.	.	.	.	C	35	5.541940	0.96474	.	.	ENSG00000183091	ENST00000409198;ENST00000397345;ENST00000427231;ENST00000172853	T;T;T;T	0.47177	0.85;0.85;0.85;0.85	5.77	5.77	0.91146	.	0.118820	0.64402	D	0.000019	T	0.73674	0.3617	M	0.87097	2.86	0.80722	D	1	D	0.67145	0.996	D	0.67900	0.954	T	0.74771	-0.3552	10	0.49607	T	0.09	.	20.3472	0.98799	0.0:1.0:0.0:0.0	.	3528	P20929	NEBU_HUMAN	H	3528;3771;3771;3528	ENSP00000386259:R3528H;ENSP00000380505:R3771H;ENSP00000416578:R3771H;ENSP00000172853:R3528H	ENSP00000172853:R3528H	R	-	2	0	NEB	152179325	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.005000	0.70716	2.890000	0.99128	0.650000	0.86243	CGC	NEB	-	pfam_Nebulin_35r-motif,smart_Nebulin_35r-motif,pfscan_Nebulin_35r-motif	ENSG00000183091		0.418	NEB-201	KNOWN	basic	protein_coding	NEB	HGNC	protein_coding		-	0.00	79	0	C	NM_004543		152471079	-1	tier1	-	no_errors	ENST00000397345	ensembl	human	known	74_37	missense	6.45	58	4	SNP	1.000	T
NHSL1	57224	genome.wustl.edu	37	6	138794462	138794462	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr6:138794462T>C	ENST00000427025.2	-	3	1092	c.464A>G	c.(463-465)gAt>gGt	p.D155G	NHSL1_ENST00000343505.5_Missense_Mutation_p.D107G|NHSL1_ENST00000479393.2_5'UTR	NM_020464.1	NP_065197.1	Q5SYE7	NHSL1_HUMAN	NHS-like 1	155										breast(2)|endometrium(4)|kidney(1)	7						TGTTTCTTCATCTTCATCTTG	0.478																																																	0													76.0	63.0	67.0					6																	138794462		692	1591	2283	SO:0001583	missense	0			AB037778	CCDS47487.1, CCDS55063.1	6q23.3	2009-02-18	2004-10-07	2004-10-07	ENSG00000135540	ENSG00000135540			21021	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 63"""	C6orf63			Standard	NM_001144060		Approved	bA43P8.1, KIAA1357	uc011edp.2	Q5SYE7	OTTHUMG00000016321	ENST00000427025.2:c.464A>G	6.37:g.138794462T>C	ENSP00000394546:p.Asp155Gly		Q3ZCS5|Q5SYE8|Q9P2J0	Missense_Mutation	SNP	NULL	p.D155G	ENST00000427025.2	37	c.464	CCDS55063.1	6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	11.74|11.74	1.728743|1.728743	0.30593|0.30593	.|.	.|.	ENSG00000135540|ENSG00000135540	ENST00000427025;ENST00000343505;ENST00000342260;ENST00000533765|ENST00000491526	T;T|.	0.37752|.	1.18;1.63|.	4.89|4.89	4.89|4.89	0.63831|0.63831	.|.	0.284116|.	0.38837|.	N|.	0.001545|.	T|T	0.35335|0.35335	0.0928|0.0928	L|L	0.34521|0.34521	1.04|1.04	0.36082|0.36082	D|D	0.842821|0.842821	P;B;P|.	0.45474|.	0.703;0.004;0.859|.	B;B;B|.	0.43889|.	0.342;0.006;0.435|.	T|T	0.26538|0.26538	-1.0100|-1.0100	10|5	0.25751|.	T|.	0.34|.	-17.4743|-17.4743	12.3209|12.3209	0.54983|0.54983	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	107;107;155|.	E2QRJ1;Q5SYE7-2;Q5SYE7|.	.;.;NHSL1_HUMAN|.	G|V	155;107;93;108|120	ENSP00000394546:D155G;ENSP00000344672:D107G|.	ENSP00000344582:D93G|.	D|M	-|-	2|1	0|0	NHSL1|NHSL1	138836155|138836155	1.000000|1.000000	0.71417|0.71417	0.991000|0.991000	0.47740|0.47740	0.506000|0.506000	0.33950|0.33950	2.642000|2.642000	0.46596|0.46596	1.962000|1.962000	0.57031|0.57031	0.459000|0.459000	0.35465|0.35465	GAT|ATG	NHSL1	-	NULL	ENSG00000135540		0.478	NHSL1-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	NHSL1	HGNC	protein_coding	OTTHUMT00000043700.2	-	0.00	89	0	T	XM_050421		138794462	-1	tier1	-	no_errors	ENST00000427025	ensembl	human	known	74_37	missense	17.78	74	16	SNP	1.000	C
NIPBL	25836	genome.wustl.edu	37	5	36995692	36995693	+	Intron	INS	-	-	T	rs148066104	byFrequency	TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr5:36995692_36995693insT	ENST00000282516.8	+	11	3620				NIPBL_ENST00000448238.2_Intron|NIPBL_ENST00000504430.1_Intron	NM_015384.4|NM_133433.3	NP_056199.2|NP_597677.2	Q6KC79	NIPBL_HUMAN	Nipped-B homolog (Drosophila)						brain development (GO:0007420)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to X-ray (GO:0071481)|cognition (GO:0050890)|developmental growth (GO:0048589)|ear morphogenesis (GO:0042471)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic forelimb morphogenesis (GO:0035115)|embryonic viscerocranium morphogenesis (GO:0048703)|external genitalia morphogenesis (GO:0035261)|eye morphogenesis (GO:0048592)|face morphogenesis (GO:0060325)|fat cell differentiation (GO:0045444)|forelimb morphogenesis (GO:0035136)|gall bladder development (GO:0061010)|heart morphogenesis (GO:0003007)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|metanephros development (GO:0001656)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid cohesion (GO:0007064)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract morphogenesis (GO:0003151)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of ossification (GO:0045778)|regulation of developmental growth (GO:0048638)|regulation of embryonic development (GO:0045995)|regulation of hair cycle (GO:0042634)|sensory perception of sound (GO:0007605)|stem cell maintenance (GO:0019827)|uterus morphogenesis (GO:0061038)	extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMC loading complex (GO:0032116)	chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|histone deacetylase binding (GO:0042826)|protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)			autonomic_ganglia(1)|breast(4)|endometrium(9)|kidney(22)|large_intestine(21)|liver(1)|lung(47)|ovary(7)|pancreas(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(4)	128	all_lung(31;0.000447)|Hepatocellular(1;0.108)		Epithelial(62;0.072)|COAD - Colon adenocarcinoma(61;0.14)|all cancers(62;0.191)|Colorectal(62;0.202)			TCAGATTTACATTTTTTTTTTA	0.262													|||unknown(HR)	86	0.0171725	0.0552	0.0029	5008	,	,		16347	0.005		0.002	False		,,,				2504	0.0041																0																																										SO:0001627	intron_variant	0			AB019494	CCDS3920.1, CCDS47198.1	5p13.2	2009-08-28			ENSG00000164190	ENSG00000164190			28862	protein-coding gene	gene with protein product	"""sister chromatid cohesion 2 homolog (yeast)"""	608667				15146186, 15146185	Standard	NM_133433		Approved	IDN3, DKFZp434L1319, FLJ11203, FLJ12597, FLJ13354, FLJ13648, Scc2	uc003jkl.4	Q6KC79	OTTHUMG00000090795	ENST00000282516.8:c.3122-31->T	5.37:g.36995702_36995702dupT			Q6KCD6|Q6N080|Q6ZT92|Q7Z2E6|Q8N4M5|Q9Y6Y3|Q9Y6Y4	RNA	INS	-	NULL	ENST00000282516.8	37	NULL	CCDS3920.1	5																																																																																			NIPBL	-	-	ENSG00000164190		0.262	NIPBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NIPBL	HGNC	protein_coding	OTTHUMT00000207582.1		0.00	39	0	-	NM_015384		36995693	+1	tier1		no_errors	ENST00000503274	ensembl	human	known	74_37	rna	17.24	24	5	INS	0.869:0.879	T
NLGN1	22871	genome.wustl.edu	37	3	173996750	173996750	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr3:173996750T>G	ENST00000457714.1	+	6	1388	c.959T>G	c.(958-960)gTt>gGt	p.V320G	NLGN1_ENST00000361589.4_Missense_Mutation_p.V320G|NLGN1_ENST00000401917.3_Missense_Mutation_p.V360G|NLGN1_ENST00000466350.1_3'UTR|NLGN1_ENST00000545397.1_Missense_Mutation_p.V320G	NM_014932.2	NP_055747.1	Q8N2Q7	NLGN1_HUMAN	neuroligin 1	337					alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor clustering (GO:0097113)|calcium-dependent cell-cell adhesion (GO:0016339)|cytoskeletal matrix organization at active zone (GO:0048789)|establishment of protein localization (GO:0045184)|heterophilic cell-cell adhesion (GO:0007157)|N-methyl-D-aspartate receptor clustering (GO:0097114)|nervous system development (GO:0007399)|neurexin clustering (GO:0097115)|neuron cell-cell adhesion (GO:0007158)|neuronal signal transduction (GO:0023041)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of intracellular signal transduction (GO:1902533)|positive regulation of ruffle assembly (GO:1900029)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of synaptic vesicle endocytosis (GO:1900244)|positive regulation of synaptic vesicle exocytosis (GO:2000302)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|protein heterotetramerization (GO:0051290)|protein homooligomerization (GO:0051260)|protein localization to synapse (GO:0035418)|protein targeting (GO:0006605)|receptor localization to synapse (GO:0097120)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of neuron differentiation (GO:0045664)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|synapse assembly (GO:0007416)|synaptic vesicle clustering (GO:0097091)|synaptic vesicle targeting (GO:0016080)|terminal button organization (GO:0072553)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|filopodium tip (GO:0032433)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal postsynaptic density (GO:0097481)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|neurexin family protein binding (GO:0042043)|PDZ domain binding (GO:0030165)|protein dimerization activity (GO:0046983)|receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(9)|liver(2)|lung(54)|ovary(1)|pancreas(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	83	Ovarian(172;0.0025)		LUSC - Lung squamous cell carcinoma(14;5.36e-13)|Lung(28;9.49e-13)			GCCACAAAAGTTGGTTGCAAT	0.423																																																	0													132.0	125.0	127.0					3																	173996750		2203	4300	6503	SO:0001583	missense	0			AB028993	CCDS3222.1	3q26.32	2008-07-18			ENSG00000169760	ENSG00000169760			14291	protein-coding gene	gene with protein product		600568				10767552, 10819331	Standard	NM_014932		Approved	KIAA1070	uc003fio.1	Q8N2Q7	OTTHUMG00000157005	ENST00000457714.1:c.959T>G	3.37:g.173996750T>G	ENSP00000392500:p.Val320Gly		Q9UPT2	Missense_Mutation	SNP	pfam_CarbesteraseB,pfam_AB_hydrolase_3,prints_Neuroligin	p.V360G	ENST00000457714.1	37	c.1079	CCDS3222.1	3	.	.	.	.	.	.	.	.	.	.	T	19.50	3.839364	0.71488	.	.	ENSG00000169760	ENST00000457714;ENST00000361589;ENST00000415045;ENST00000545397;ENST00000401917	T;T;T;T;T	0.70631	-0.5;-0.5;-0.5;-0.5;-0.5	5.59	5.59	0.84812	.	0.000000	0.85682	D	0.000000	D	0.86049	0.5840	M	0.86502	2.82	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.81914	0.995;0.988	D	0.88576	0.3133	10	0.87932	D	0	.	16.065	0.80865	0.0:0.0:0.0:1.0	.	360;320	D2X2H5;Q8N2Q7-2	.;.	G	320;320;360;320;360	ENSP00000392500:V320G;ENSP00000354541:V320G;ENSP00000410374:V360G;ENSP00000441108:V320G;ENSP00000385750:V360G	ENSP00000354541:V320G	V	+	2	0	NLGN1	175479444	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.997000	0.88414	2.257000	0.74773	0.460000	0.39030	GTT	NLGN1	-	pfam_CarbesteraseB	ENSG00000169760		0.423	NLGN1-001	KNOWN	basic|CCDS	protein_coding	NLGN1	HGNC	protein_coding	OTTHUMT00000347054.3	-	0.00	41	0	T	NM_014932		173996750	+1	tier1	-	no_errors	ENST00000401917	ensembl	human	known	74_37	missense	31.58	26	12	SNP	1.000	G
NOXO1	124056	genome.wustl.edu	37	16	2029801	2029801	+	Silent	SNP	T	T	C			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr16:2029801T>C	ENST00000397280.4	-	6	708	c.705A>G	c.(703-705)ctA>ctG	p.L235L	NOXO1_ENST00000354249.4_Silent_p.L229L|NOXO1_ENST00000356120.4_Silent_p.L230L|AC005606.1_ENST00000598236.1_5'Flank|TBL3_ENST00000568546.1_3'UTR|NOXO1_ENST00000566005.1_Silent_p.L234L			Q8NFA2	NOXO1_HUMAN	NADPH oxidase organizer 1	235					extracellular matrix disassembly (GO:0022617)|regulation of hydrogen peroxide metabolic process (GO:0010310)|regulation of respiratory burst (GO:0060263)|superoxide metabolic process (GO:0006801)	NADPH oxidase complex (GO:0043020)	enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|phosphatidylinositol binding (GO:0035091)|phospholipid binding (GO:0005543)|superoxide-generating NADPH oxidase activator activity (GO:0016176)			lung(2)	2					Ecabet(DB05265)	CGCTGCTCCCTAGGGACGGGC	0.716																																					Pancreas(104;2811 2841 4129)|Esophageal Squamous(25;910 1225 43728)												0																																										SO:0001819	synonymous_variant	0			AF532985	CCDS10454.1, CCDS10455.1, CCDS42101.1, CCDS58406.1	16p13.3	2008-02-05			ENSG00000196408	ENSG00000196408			19404	protein-coding gene	gene with protein product		611256					Standard	NM_144603		Approved	P41NOXA, P41NOXB, P41NOXC, SH3PXD5, SNX28	uc002cnx.4	Q8NFA2	OTTHUMG00000128707	ENST00000397280.4:c.705A>G	16.37:g.2029801T>C			Q86YM1|Q8NFA3|Q96B73	Silent	SNP	pfam_SH3_domain,pfam_Phox,superfamily_Phox,superfamily_SH3_domain,smart_SH3_domain,pfscan_Phox,pfscan_SH3_domain	p.L235	ENST00000397280.4	37	c.705	CCDS42101.1	16																																																																																			NOXO1	-	NULL	ENSG00000196408		0.716	NOXO1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NOXO1	HGNC	protein_coding	OTTHUMT00000250612.1	-	0.00	62	0	T			2029801	-1	tier1	-	no_errors	ENST00000397280	ensembl	human	known	74_37	silent	35.00	26	14	SNP	0.000	C
SMG1P4	100507526	genome.wustl.edu	37	16	21890769	21890769	+	RNA	SNP	T	T	A			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr16:21890769T>A	ENST00000540706.1	-	0	2543																											AAGAGTGGAATAAGACAGTCC	0.418																																																	0																																												0																															16.37:g.21890769T>A				RNA	SNP	-	NULL	ENST00000540706.1	37	NULL		16																																																																																			NPIPB4	-	-	ENSG00000185864		0.418	RP11-645C24.2-003	KNOWN	basic	processed_transcript	NPIPB4	HGNC	pseudogene	OTTHUMT00000402428.1	-	0.00	196	0	T			21890769	-1	tier1	-	no_errors	ENST00000538859	ensembl	human	known	74_37	rna	11.94	118	16	SNP	1.000	A
NUP153	9972	genome.wustl.edu	37	6	17626152	17626152	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr6:17626152G>T	ENST00000262077.2	-	19	3787	c.3788C>A	c.(3787-3789)aCa>aAa	p.T1263K	NUP153_ENST00000537253.1_Missense_Mutation_p.T1294K	NM_005124.2	NP_005115.2	P49790	NU153_HUMAN	nucleoporin 153kDa	1263					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|negative regulation of RNA export from nucleus (GO:0046832)|nuclear pore complex assembly (GO:0051292)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral entry into host cell (GO:0046718)|viral penetration into host nucleus (GO:0075732)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|nucleocytoplasmic transporter activity (GO:0005487)|protein anchor (GO:0043495)|structural constituent of nuclear pore (GO:0017056)|transporter activity (GO:0005215)|zinc ion binding (GO:0008270)			NS(2)|breast(6)|endometrium(4)|kidney(3)|large_intestine(7)|lung(23)|ovary(3)|skin(3)|urinary_tract(2)	53	Breast(50;0.0259)|Ovarian(93;0.0584)	all_hematologic(90;0.125)	all cancers(50;0.0981)|Epithelial(50;0.112)			TGTGCTGGATGTGGTTGCTAG	0.493																																																	0													111.0	96.0	101.0					6																	17626152		2203	4300	6503	SO:0001583	missense	0			Z25535	CCDS4541.1, CCDS64359.1, CCDS75407.1	6p22.3	2008-07-29	2002-08-29		ENSG00000124789	ENSG00000124789			8062	protein-coding gene	gene with protein product		603948	"""nucleoporin 153kD"""			8110839	Standard	NM_001278209		Approved	HNUP153	uc003ncd.2	P49790	OTTHUMG00000014312	ENST00000262077.2:c.3788C>A	6.37:g.17626152G>T	ENSP00000262077:p.Thr1263Lys		B4DIK2|E7EPX5|F6QR24|Q4LE47|Q5T9I7|Q7Z743	Missense_Mutation	SNP	pfam_Nucleoporin_Nup153,pfam_Znf_RanBP2,pfam_Retro-transposon_transp_CS,smart_Znf_RanBP2,pfscan_Znf_RanBP2	p.T1294K	ENST00000262077.2	37	c.3881	CCDS4541.1	6	.	.	.	.	.	.	.	.	.	.	G	26.1	4.705510	0.89018	.	.	ENSG00000124789	ENST00000262077;ENST00000430136;ENST00000537253	T;T	0.09255	3.01;3.0	5.87	5.87	0.94306	.	0.000000	0.48286	D	0.000193	T	0.19248	0.0462	L	0.57536	1.79	0.44611	D	0.997584	D;P;P	0.58268	0.982;0.704;0.651	P;B;B	0.58331	0.837;0.277;0.216	T	0.00195	-1.1932	10	0.38643	T	0.18	-2.2027	20.2181	0.98305	0.0:0.0:1.0:0.0	.	1294;1243;1263	F6QR24;Q4LE47;P49790	.;.;NU153_HUMAN	K	1263;1243;1294	ENSP00000262077:T1263K;ENSP00000444029:T1294K	ENSP00000262077:T1263K	T	-	2	0	NUP153	17734131	1.000000	0.71417	0.999000	0.59377	0.990000	0.78478	6.652000	0.74377	2.785000	0.95823	0.655000	0.94253	ACA	NUP153	-	NULL	ENSG00000124789		0.493	NUP153-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUP153	HGNC	protein_coding	OTTHUMT00000039953.1	-	0.00	54	0	G			17626152	-1	tier1	-	no_errors	ENST00000537253	ensembl	human	known	74_37	missense	9.09	40	4	SNP	0.999	T
OPN5	221391	genome.wustl.edu	37	6	47775912	47775912	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr6:47775912G>C	ENST00000371211.2	+	5	807	c.779G>C	c.(778-780)gGa>gCa	p.G260A	OPN5_ENST00000393699.2_Missense_Mutation_p.G260A|OPN5_ENST00000489301.2_Missense_Mutation_p.G260A|OPN5_ENST00000244799.4_3'UTR	NM_181744.3	NP_859528.1	Q6U736	OPN5_HUMAN	opsin 5	260					phototransduction (GO:0007602)|protein-chromophore linkage (GO:0018298)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)	G-protein coupled receptor activity (GO:0004930)|photoreceptor activity (GO:0009881)			endometrium(1)|large_intestine(3)|lung(14)|ovary(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(2)	29						ATTTGTGCTGGATTCCTGATT	0.468																																					Melanoma(28;740 973 10870 42660 45347)												0													383.0	339.0	354.0					6																	47775912		2203	4300	6503	SO:0001583	missense	0			AY288419	CCDS4923.1	6p12.3	2012-08-08	2004-01-23		ENSG00000124818	ENSG00000124818		"""GPCR / Class A : Opsin receptors"""	19992	protein-coding gene	gene with protein product	"""neuropsin"""	609042	"""transmembrane protein 13"""	TMEM13		14623103, 14623098	Standard	NR_033806		Approved	neuropsin, dJ402H5.1	uc003ozc.3	Q6U736	OTTHUMG00000014803	ENST00000371211.2:c.779G>C	6.37:g.47775912G>C	ENSP00000360255:p.Gly260Ala		A0AV33|Q5T5B9|Q5T886|Q7Z603|Q86SL5	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn,prints_Peropsin	p.G260A	ENST00000371211.2	37	c.779	CCDS4923.1	6	.	.	.	.	.	.	.	.	.	.	G	27.7	4.850808	0.91277	.	.	ENSG00000124818	ENST00000489301;ENST00000371211;ENST00000393699	T;T;T	0.69561	-0.41;-0.41;-0.41	5.54	5.54	0.83059	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.58935	0.2157	L	0.28014	0.82	0.80722	D	1	D	0.69078	0.997	D	0.68943	0.961	T	0.55147	-0.8186	10	0.02654	T	1	.	19.8585	0.96775	0.0:0.0:1.0:0.0	.	260	Q6U736	OPN5_HUMAN	A	260	ENSP00000426991:G260A;ENSP00000360255:G260A;ENSP00000377302:G260A	ENSP00000360255:G260A	G	+	2	0	OPN5	47883871	1.000000	0.71417	1.000000	0.80357	0.935000	0.57460	7.487000	0.81328	2.760000	0.94817	0.655000	0.94253	GGA	OPN5	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000124818		0.468	OPN5-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	OPN5	HGNC	protein_coding	OTTHUMT00000359451.1	-	0.00	69	0	G	NM_181744		47775912	+1	tier1	-	no_errors	ENST00000371211	ensembl	human	known	74_37	missense	24.53	40	13	SNP	1.000	C
OR11L1	391189	genome.wustl.edu	37	1	248004771	248004771	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr1:248004771C>A	ENST00000355784.2	-	1	483	c.428G>T	c.(427-429)aGg>aTg	p.R143M		NM_001001959.1	NP_001001959.1	Q8NGX0	O11L1_HUMAN	olfactory receptor, family 11, subfamily L, member 1	143						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(4)|kidney(5)|large_intestine(5)|lung(35)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	57	all_cancers(71;8.78e-05)|all_epithelial(71;9.15e-06)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.0786)|Lung NSC(105;0.0858)		OV - Ovarian serous cystadenocarcinoma(106;0.0319)			CACCACCAACCTGGCACAGAG	0.572																																																	0													59.0	57.0	58.0					1																	248004771		2203	4300	6503	SO:0001583	missense	0			AB065646	CCDS31098.1	1q44	2013-09-24			ENSG00000197591	ENSG00000197591		"""GPCR / Class A : Olfactory receptors"""	14998	protein-coding gene	gene with protein product							Standard	NM_001001959		Approved		uc001idn.1	Q8NGX0	OTTHUMG00000040193	ENST00000355784.2:c.428G>T	1.37:g.248004771C>A	ENSP00000348033:p.Arg143Met			Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,prints_Olfact_rcpt,prints_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	p.R143M	ENST00000355784.2	37	c.428	CCDS31098.1	1	.	.	.	.	.	.	.	.	.	.	C	1.245	-0.620196	0.03636	.	.	ENSG00000197591	ENST00000355784	T	0.00039	8.85	4.42	-3.2	0.05156	GPCR, rhodopsin-like superfamily (1);	0.789981	0.10293	N	0.692129	T	0.00109	0.0003	L	0.35854	1.095	0.09310	N	1	B	0.23249	0.082	B	0.33121	0.158	T	0.12426	-1.0548	10	0.34782	T	0.22	.	1.0176	0.01511	0.2056:0.1582:0.3454:0.2908	.	143	Q8NGX0	O11L1_HUMAN	M	143	ENSP00000348033:R143M	ENSP00000348033:R143M	R	-	2	0	OR11L1	246071394	0.000000	0.05858	0.000000	0.03702	0.026000	0.11368	-0.769000	0.04710	-0.684000	0.05183	-1.279000	0.01387	AGG	OR11L1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000197591		0.572	OR11L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR11L1	HGNC	protein_coding	OTTHUMT00000096850.1	-	0.00	33	0	C	NM_001001959		248004771	-1	tier1	-	no_errors	ENST00000355784	ensembl	human	known	74_37	missense	25.00	27	9	SNP	0.000	A
OR2A2	442361	genome.wustl.edu	37	7	143807174	143807174	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr7:143807174T>G	ENST00000408979.2	+	1	568	c.499T>G	c.(499-501)Ttc>Gtc	p.F167V		NM_001005480.2	NP_001005480.2	Q6IF42	OR2A2_HUMAN	olfactory receptor, family 2, subfamily A, member 2	167						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|kidney(1)|large_intestine(2)|lung(13)|prostate(1)|skin(4)	22	Melanoma(164;0.0783)					AAGGTTGCCCTTCTGTGGGCC	0.527																																																	0													106.0	103.0	104.0					7																	143807174		1977	4168	6145	SO:0001583	missense	0				CCDS43671.1	7q35	2013-09-20		2004-03-10	ENSG00000221989	ENSG00000221989		"""GPCR / Class A : Olfactory receptors"""	8230	protein-coding gene	gene with protein product				OR2A2P, OR2A17P			Standard	NM_001005480		Approved	OST008	uc011ktz.2	Q6IF42	OTTHUMG00000158001	ENST00000408979.2:c.499T>G	7.37:g.143807174T>G	ENSP00000386209:p.Phe167Val		B2RN85|Q8NGT6	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.F167V	ENST00000408979.2	37	c.499	CCDS43671.1	7	.	.	.	.	.	.	.	.	.	.	T	15.92	2.976675	0.53720	.	.	ENSG00000221989	ENST00000408979	T	0.00145	8.67	3.47	3.47	0.39725	GPCR, rhodopsin-like superfamily (1);	0.000000	0.35096	U	0.003446	T	0.00524	0.0017	M	0.91768	3.24	0.32112	N	0.589222	D	0.69078	0.997	D	0.69479	0.964	T	0.14643	-1.0465	10	0.66056	D	0.02	-33.4342	10.1929	0.43037	0.0:0.0:0.0:1.0	.	167	Q6IF42	OR2A2_HUMAN	V	167	ENSP00000386209:F167V	ENSP00000386209:F167V	F	+	1	0	OR2A2	143438107	0.829000	0.29322	0.997000	0.53966	0.740000	0.42216	1.771000	0.38542	1.576000	0.49790	0.418000	0.28097	TTC	OR2A2	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000221989		0.527	OR2A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2A2	HGNC	protein_coding	OTTHUMT00000349978.1	-	0.00	88	0	T			143807174	+1	tier1	-	no_errors	ENST00000408979	ensembl	human	known	74_37	missense	46.67	24	21	SNP	0.981	G
OR52J3	119679	genome.wustl.edu	37	11	5068584	5068584	+	Missense_Mutation	SNP	G	G	A	rs558682985	byFrequency	TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr11:5068584G>A	ENST00000380370.1	+	1	829	c.829G>A	c.(829-831)Gtt>Att	p.V277I		NM_001001916.2	NP_001001916.2	Q8NH60	O52J3_HUMAN	olfactory receptor, family 52, subfamily J, member 3	277						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(1)|kidney(6)|large_intestine(6)|lung(19)|ovary(1)|skin(2)	36		Medulloblastoma(188;0.00131)|all_neural(188;0.0189)|Breast(177;0.0204)		Epithelial(150;9.29e-10)|BRCA - Breast invasive adenocarcinoma(625;0.135)|LUSC - Lung squamous cell carcinoma(625;0.19)		TCACATTCTTGTTGCCAATCT	0.413																																																	0													171.0	154.0	160.0					11																	5068584		2201	4298	6499	SO:0001583	missense	0			AB065530	CCDS31370.1	11p15.4	2012-08-09			ENSG00000205495	ENSG00000205495		"""GPCR / Class A : Olfactory receptors"""	14799	protein-coding gene	gene with protein product							Standard	NM_001001916		Approved		uc010qyv.2	Q8NH60	OTTHUMG00000066600	ENST00000380370.1:c.829G>A	11.37:g.5068584G>A	ENSP00000369728:p.Val277Ile		Q6IFE4	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.V277I	ENST00000380370.1	37	c.829	CCDS31370.1	11	.	.	.	.	.	.	.	.	.	.	G	3.617	-0.078430	0.07184	.	.	ENSG00000205495	ENST00000380370	T	0.36878	1.23	4.19	-3.94	0.04130	GPCR, rhodopsin-like superfamily (1);	0.368313	0.19427	N	0.114560	T	0.22742	0.0549	L	0.33189	0.99	0.09310	N	0.999999	B	0.19073	0.033	B	0.26864	0.074	T	0.15636	-1.0430	10	0.42905	T	0.14	.	8.1721	0.31260	0.6305:0.1888:0.1808:0.0	.	277	Q8NH60	O52J3_HUMAN	I	277	ENSP00000369728:V277I	ENSP00000369728:V277I	V	+	1	0	OR52J3	5025160	0.000000	0.05858	0.960000	0.40013	0.082000	0.17680	-1.641000	0.02007	-0.766000	0.04639	-0.793000	0.03317	GTT	OR52J3	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000205495		0.413	OR52J3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR52J3	HGNC	protein_coding	OTTHUMT00000142807.1	-	0.00	38	0	G	NM_001001916		5068584	+1	tier1	-	no_errors	ENST00000380370	ensembl	human	known	74_37	missense	35.42	31	17	SNP	0.005	A
OVCH2	341277	genome.wustl.edu	37	11	7718085	7718085	+	RNA	SNP	A	A	C			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr11:7718085A>C	ENST00000533663.1	-	0	0				OVCH2_ENST00000454689.1_RNA|OVCH2_ENST00000534193.2_RNA			Q7RTZ1	OVCH2_HUMAN	ovochymase 2 (gene/pseudogene)							extracellular region (GO:0005576)	metal ion binding (GO:0046872)|serine-type endopeptidase activity (GO:0004252)			cervix(1)|kidney(2)|large_intestine(3)|lung(7)|upper_aerodigestive_tract(2)	15				Epithelial(150;7.9e-08)|BRCA - Breast invasive adenocarcinoma(625;0.197)		GGTGGGAAAAACTGAGCAACA	0.453																																																	0													115.0	112.0	113.0					11																	7718085		1987	4162	6149			0			BN000120	CCDS73251.1	11p15.4	2012-10-02	2010-06-08		ENSG00000183378	ENSG00000183378			29970	protein-coding gene	gene with protein product			"""ovochymase 2"""			12838346	Standard	XM_006718221		Approved	OVTN	uc031pyw.1	Q7RTZ1	OTTHUMG00000165418		11.37:g.7718085A>C				Missense_Mutation	SNP	pfam_Peptidase_S1,pfam_CUB_dom,superfamily_Trypsin-like_Pept_dom,superfamily_CUB_dom,smart_Peptidase_S1,smart_CUB_dom,pfscan_CUB_dom,pfscan_Peptidase_S1,prints_Peptidase_S1A	p.S356R	ENST00000533663.1	37	c.1068		11	.	.	.	.	.	.	.	.	.	.	A	0.609	-0.825661	0.02734	.	.	ENSG00000183378	ENST00000454689	T	0.18016	2.24	5.45	-0.76	0.11041	CUB (5);	1.004800	0.08013	N	0.990669	T	0.10594	0.0259	L	0.31526	0.94	0.09310	N	1	B	0.32010	0.351	B	0.32022	0.139	T	0.34925	-0.9809	10	0.07813	T	0.8	0.3856	8.6326	0.33928	0.553:0.0:0.447:0.0	.	356	Q7RTZ1	OVCH2_HUMAN	R	356	ENSP00000407158:S356R	ENSP00000407158:S356R	S	-	3	2	OVCH2	7674661	0.086000	0.21541	0.002000	0.10522	0.065000	0.16274	0.448000	0.21726	-0.151000	0.11176	-0.256000	0.11100	AGT	OVCH2	-	pfam_CUB_dom,superfamily_CUB_dom,smart_CUB_dom,pfscan_CUB_dom	ENSG00000183378		0.453	OVCH2-002	KNOWN	basic	processed_transcript	OVCH2	HGNC	polymorphic_pseudogene	OTTHUMT00000383928.1	-	0.00	48	0	A	NM_198185		7718085	-1	tier1	-	no_errors	ENST00000454689	ensembl	human	known	74_37	missense	26.67	22	8	SNP	0.019	C
OSBP	5007	genome.wustl.edu	37	11	59349001	59349001	+	Missense_Mutation	SNP	T	T	G	rs372017413		TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr11:59349001T>G	ENST00000263847.1	-	10	2184	c.1705A>C	c.(1705-1707)Act>Cct	p.T569P		NM_002556.2	NP_002547.1	P22059	OSBP1_HUMAN	oxysterol binding protein	569					lipid transport (GO:0006869)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	oxysterol binding (GO:0008142)			NS(2)|breast(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	26		all_epithelial(135;0.000236)		BRCA - Breast invasive adenocarcinoma(625;0.00607)|LUSC - Lung squamous cell carcinoma(625;0.207)		TGGTGCCCAGTTGCATGGAAA	0.413																																																	0													153.0	128.0	137.0					11																	59349001		2201	4295	6496	SO:0001583	missense	0			AF185696	CCDS7974.1	11q12-q13	2013-01-10			ENSG00000110048	ENSG00000110048		"""Oxysterol binding proteins"", ""Pleckstrin homology (PH) domain containing"""	8503	protein-coding gene	gene with protein product		167040					Standard	NM_002556		Approved	OSBP1	uc001noc.1	P22059	OTTHUMG00000167422	ENST00000263847.1:c.1705A>C	11.37:g.59349001T>G	ENSP00000263847:p.Thr569Pro		Q6P524	Missense_Mutation	SNP	pfam_Oxysterol-bd,pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.T569P	ENST00000263847.1	37	c.1705	CCDS7974.1	11	.	.	.	.	.	.	.	.	.	.	T	15.38	2.815128	0.50527	.	.	ENSG00000110048	ENST00000263847;ENST00000378235	T	0.30714	1.52	5.45	5.45	0.79879	.	0.187386	0.56097	D	0.000028	T	0.39118	0.1066	L	0.58510	1.815	0.46701	D	0.999168	P	0.45212	0.853	P	0.50617	0.646	T	0.14364	-1.0475	10	0.35671	T	0.21	-17.3032	9.8524	0.41066	0.1529:0.0:0.0:0.8471	.	569	P22059	OSBP1_HUMAN	P	569;169	ENSP00000263847:T569P	ENSP00000263847:T569P	T	-	1	0	OSBP	59105577	0.967000	0.33354	1.000000	0.80357	0.997000	0.91878	2.084000	0.41625	2.082000	0.62665	0.533000	0.62120	ACT	OSBP	-	pfam_Oxysterol-bd	ENSG00000110048		0.413	OSBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OSBP	HGNC	protein_coding	OTTHUMT00000394555.1	-	0.00	40	0	T			59349001	-1	tier1	-	no_errors	ENST00000263847	ensembl	human	known	74_37	missense	32.61	31	15	SNP	1.000	G
OR8G5	219865	genome.wustl.edu	37	11	124135444	124135444	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr11:124135444A>C	ENST00000524943.2	+	1	722	c.722A>C	c.(721-723)aAc>aCc	p.N241T	OR8G1_ENST00000341493.2_RNA	NM_001005198.1	NP_001005198.1	Q8NG78	OR8G5_HUMAN	olfactory receptor, family 8, subfamily G, member 5	241						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)						Breast(109;0.0157)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0523)		AGTGGAATTAACATCCTTGTC	0.423																																					Ovarian(169;523 1969 8640 31295 51256)												0													137.0	138.0	137.0					11																	124135444		2101	4248	6349	SO:0001583	missense	0			BK004516	CCDS66256.1	11q24.1	2014-04-17		2004-03-10	ENSG00000255298	ENSG00000255298		"""GPCR / Class A : Olfactory receptors"""	19622	protein-coding gene	gene with protein product				OR8G5P, OR8G6			Standard	NM_001005198		Approved			Q8NG78	OTTHUMG00000186059	ENST00000524943.2:c.722A>C	11.37:g.124135444A>C	ENSP00000477014:p.Asn241Thr		B2RND3|Q6IEU6	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.N241T	ENST00000524943.2	37	c.722		11																																																																																			OR8G5	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000255298		0.423	OR8G5-001	KNOWN	basic|appris_principal	protein_coding	OR8G5	HGNC	protein_coding	OTTHUMT00000387283.2	-	0.00	130	0	A	NM_001005198		124135444	+1	tier1	-	no_errors	ENST00000524943	ensembl	human	known	74_37	missense	28.03	95	37	SNP	0.000	C
PAK6	56924	genome.wustl.edu	37	15	40558404	40558404	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr15:40558404C>T	ENST00000542403.2	+	3	677	c.566C>T	c.(565-567)tCg>tTg	p.S189L	RP11-133K1.2_ENST00000558658.1_3'UTR|PAK6_ENST00000453867.1_Missense_Mutation_p.S189L|PAK6_ENST00000560346.1_Missense_Mutation_p.S189L|PAK6_ENST00000559901.1_3'UTR|PAK6_ENST00000441369.1_Missense_Mutation_p.S189L|PAK6_ENST00000260404.4_Missense_Mutation_p.S189L|PAK6_ENST00000455577.2_Missense_Mutation_p.S189L	NM_001276717.1	NP_001263646.1	Q9NQU5	PAK6_HUMAN	p21 protein (Cdc42/Rac)-activated kinase 6	189	Linker.				apoptotic process (GO:0006915)|cytoskeleton organization (GO:0007010)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|cervix(1)|endometrium(3)|large_intestine(2)|liver(1)|lung(11)|ovary(2)|prostate(1)|skin(2)	24		all_cancers(109;1.13e-18)|all_epithelial(112;1.62e-15)|Lung NSC(122;5.67e-11)|all_lung(180;1.41e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0823)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;1.51e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0544)		CAGGGTGCCTCGCAGCGCTGT	0.672																																																	0													16.0	19.0	18.0					15																	40558404		2199	4292	6491	SO:0001583	missense	0			AF276893	CCDS10054.1, CCDS61590.1	15q14	2008-06-17	2008-06-17		ENSG00000137843	ENSG00000137843			16061	protein-coding gene	gene with protein product		608110	"""p21(CDKN1A)-activated kinase 6"""			11278661	Standard	NM_020168		Approved	PAK5	uc001zlb.3	Q9NQU5	OTTHUMG00000129921	ENST00000542403.2:c.566C>T	15.37:g.40558404C>T	ENSP00000439597:p.Ser189Leu		A8K2G2|B3KYB0|G5E9R2	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_CRIB_dom,superfamily_Kinase-like_dom,smart_CRIB_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_CRIB_dom,pfscan_Prot_kinase_dom	p.S189L	ENST00000542403.2	37	c.566	CCDS10054.1	15	.	.	.	.	.	.	.	.	.	.	C	5.250	0.231590	0.09969	.	.	ENSG00000137843	ENST00000441369;ENST00000453867;ENST00000455577;ENST00000260404;ENST00000542403	T;T;T;T;T	0.73575	-0.75;-0.75;-0.76;-0.75;-0.75	5.26	4.32	0.51571	.	1.320840	0.04772	N	0.428264	T	0.60792	0.2296	N	0.14661	0.345	0.09310	N	1	B;B	0.13145	0.004;0.007	B;B	0.10450	0.002;0.005	T	0.50841	-0.8780	10	0.54805	T	0.06	.	6.4223	0.21750	0.227:0.6758:0.0:0.0972	.	189;189	Q9NQU5;G5E9R2	PAK6_HUMAN;.	L	189	ENSP00000406873:S189L;ENSP00000401153:S189L;ENSP00000409465:S189L;ENSP00000260404:S189L;ENSP00000439597:S189L	ENSP00000260404:S189L	S	+	2	0	PAK6	38345696	0.002000	0.14202	0.065000	0.19835	0.009000	0.06853	1.597000	0.36729	1.174000	0.42811	0.561000	0.74099	TCG	PAK6	-	NULL	ENSG00000137843		0.672	PAK6-004	NOVEL	alternative_3_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	PAK6	HGNC	protein_coding	OTTHUMT00000418355.1	-	0.00	68	0	C			40558404	+1	tier1	-	no_errors	ENST00000260404	ensembl	human	known	74_37	missense	29.63	57	24	SNP	0.006	T
PAK7	57144	genome.wustl.edu	37	20	9561175	9561175	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr20:9561175A>C	ENST00000378429.3	-	5	1153	c.607T>G	c.(607-609)Ttg>Gtg	p.L203V	RP5-986I17.2_ENST00000428769.1_RNA|PAK7_ENST00000378423.1_Missense_Mutation_p.L203V|PAK7_ENST00000353224.5_Missense_Mutation_p.L203V	NM_020341.3	NP_065074.1	Q9P286	PAK7_HUMAN	p21 protein (Cdc42/Rac)-activated kinase 7	203	Linker.				apoptotic process (GO:0006915)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cytoskeleton organization (GO:0007010)|learning (GO:0007612)|locomotory behavior (GO:0007626)|memory (GO:0007613)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|signal transduction (GO:0007165)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|central_nervous_system(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(44)|ovary(2)|skin(13)|stomach(1)|upper_aerodigestive_tract(3)	81			COAD - Colon adenocarcinoma(9;0.194)			AGTGAGTCCAAATGTGAGTGA	0.463																																																	0													98.0	95.0	96.0					20																	9561175		2203	4300	6503	SO:0001583	missense	0			AB033090	CCDS13107.1	20p12	2008-06-17	2008-06-17		ENSG00000101349	ENSG00000101349			15916	protein-coding gene	gene with protein product		608038	"""p21(CDKN1A)-activated kinase 7"""			11756552, 10574462	Standard	NM_020341		Approved	KIAA1264, PAK5	uc002wnk.2	Q9P286	OTTHUMG00000031857	ENST00000378429.3:c.607T>G	20.37:g.9561175A>C	ENSP00000367686:p.Leu203Val		A8K5T6|D3DW14|Q5W115|Q9BX09|Q9ULF6	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_CRIB_dom,superfamily_Kinase-like_dom,smart_CRIB_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_CRIB_dom,pfscan_Prot_kinase_dom	p.L203V	ENST00000378429.3	37	c.607	CCDS13107.1	20	.	.	.	.	.	.	.	.	.	.	A	3.520	-0.097870	0.07010	.	.	ENSG00000101349	ENST00000378429;ENST00000353224;ENST00000378423;ENST00000439520	T;T;T	0.31510	1.49;1.49;1.49	5.55	-1.19	0.09585	.	0.271361	0.36665	N	0.002466	T	0.12902	0.0313	N	0.21448	0.665	0.38205	D	0.940295	B;B	0.06786	0.001;0.0	B;B	0.06405	0.002;0.001	T	0.12811	-1.0533	9	.	.	.	.	1.0728	0.01625	0.2466:0.2298:0.3284:0.1952	.	203;203	B0AZM9;Q9P286	.;PAK7_HUMAN	V	203;203;203;151	ENSP00000367686:L203V;ENSP00000322957:L203V;ENSP00000367679:L203V	.	L	-	1	2	PAK7	9509175	0.351000	0.24887	0.271000	0.24616	0.192000	0.23643	0.013000	0.13310	-0.124000	0.11724	-0.404000	0.06349	TTG	PAK7	-	NULL	ENSG00000101349		0.463	PAK7-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PAK7	HGNC	protein_coding	OTTHUMT00000077962.1	-	0.00	48	0	A			9561175	-1	tier1	-	no_errors	ENST00000353224	ensembl	human	known	74_37	missense	36.96	28	17	SNP	0.972	C
PAMR1	25891	genome.wustl.edu	37	11	35489582	35489582	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr11:35489582A>C	ENST00000378880.2	-	6	1232	c.787T>G	c.(787-789)Ttg>Gtg	p.L263V	PAMR1_ENST00000278360.3_Missense_Mutation_p.L263V|PAMR1_ENST00000534803.1_5'UTR|PAMR1_ENST00000532848.1_Missense_Mutation_p.L223V|PAMR1_ENST00000378878.3_Missense_Mutation_p.L152V	NM_001001991.1	NP_001001991.1	Q6UXH9	PAMR1_HUMAN	peptidase domain containing associated with muscle regeneration 1	263	EGF-like. {ECO:0000255|PROSITE- ProRule:PRU00076}.					extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(8)|ovary(3)|upper_aerodigestive_tract(1)	26						TAGCCTGCCAAGCAGGCACAC	0.502																																																	0													80.0	48.0	59.0					11																	35489582		2199	4286	6485	SO:0001583	missense	0				CCDS7898.1, CCDS31460.1, CCDS60759.1, CCDS60760.1	11p13	2009-09-30			ENSG00000149090	ENSG00000149090			24554	protein-coding gene	gene with protein product	"""regeneration-associated muscle protease"""					15111323	Standard	NM_001282675		Approved	RAMP, DKFZP586H2123	uc001mwf.3	Q6UXH9	OTTHUMG00000166328	ENST00000378880.2:c.787T>G	11.37:g.35489582A>C	ENSP00000368158:p.Leu263Val		A8MQ58|B7ZA73|Q5EBL7|Q5JPI4|Q6N062|Q71RE9|Q96JW2|Q9Y432	Missense_Mutation	SNP	pfam_Peptidase_S1,pfam_CUB_dom,pfam_Sushi_SCR_CCP,pfam_EG-like_dom,superfamily_Trypsin-like_Pept_dom,superfamily_CUB_dom,superfamily_Sushi_SCR_CCP,smart_EG-like_dom,smart_CUB_dom,smart_EGF-like_Ca-bd_dom,smart_Sushi_SCR_CCP,smart_Peptidase_S1,prints_Peptidase_S1A,pfscan_CUB_dom,pfscan_EG-like_dom,pfscan_Sushi_SCR_CCP,pfscan_Peptidase_S1	p.L263V	ENST00000378880.2	37	c.787	CCDS31460.1	11	.	.	.	.	.	.	.	.	.	.	A	20.1	3.932094	0.73442	.	.	ENSG00000149090	ENST00000278360;ENST00000378880;ENST00000378878;ENST00000532848;ENST00000527605;ENST00000529303	D;D;D;D;D;D	0.99527	-6.09;-6.09;-3.01;-6.09;-6.09;-3.01	5.9	1.63	0.23807	EGF (1);Epidermal growth factor-like (1);EGF-like region, conserved site (2);Epidermal growth factor-like, type 3 (1);	0.000000	0.85682	D	0.000000	D	0.98667	0.9553	N	0.21545	0.675	0.58432	D	0.999996	D;D;D	0.76494	0.998;0.999;0.998	D;D;D	0.83275	0.992;0.994;0.996	D	0.97639	1.0147	10	0.87932	D	0	.	9.9387	0.41567	0.2917:0.0:0.7083:0.0	.	152;263;263	A8MQ58;Q6UXH9;Q6UXH9-2	.;PAMR1_HUMAN;.	V	263;263;152;223;223;152	ENSP00000278360:L263V;ENSP00000368158:L263V;ENSP00000368156:L152V;ENSP00000433868:L223V;ENSP00000432591:L223V;ENSP00000433024:L152V	ENSP00000278360:L263V	L	-	1	2	PAMR1	35446158	1.000000	0.71417	0.997000	0.53966	0.842000	0.47809	2.314000	0.43743	0.041000	0.15688	-0.366000	0.07423	TTG	PAMR1	-	pfam_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom	ENSG00000149090		0.502	PAMR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAMR1	HGNC	protein_coding	OTTHUMT00000389177.1	-	0.00	21	0	A	NM_015430		35489582	-1	tier1	-	no_errors	ENST00000278360	ensembl	human	known	74_37	missense	20.00	20	5	SNP	1.000	C
PANK4	55229	genome.wustl.edu	37	1	2444348	2444348	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr1:2444348C>G	ENST00000378466.3	-	13	1718	c.1706G>C	c.(1705-1707)tGg>tCg	p.W569S	PANK4_ENST00000435556.3_Missense_Mutation_p.W530S	NM_018216.1	NP_060686.1	Q9NVE7	PANK4_HUMAN	pantothenate kinase 4	569					coenzyme A biosynthetic process (GO:0015937)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|pantothenate kinase activity (GO:0004594)			breast(2)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(4)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(4)	23	all_cancers(77;0.000158)|all_epithelial(69;8.01e-05)|all_lung(157;0.0212)|Lung NSC(156;0.0376)|Ovarian(185;0.0634)	all_epithelial(116;3.18e-20)|all_lung(118;1.67e-08)|Lung NSC(185;2.69e-06)|Breast(487;0.00147)|Renal(390;0.00183)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.0847)|Medulloblastoma(700;0.123)		Epithelial(90;1.54e-37)|OV - Ovarian serous cystadenocarcinoma(86;6.95e-23)|GBM - Glioblastoma multiforme(42;2.81e-08)|Colorectal(212;4.25e-05)|COAD - Colon adenocarcinoma(227;0.000196)|Kidney(185;0.000342)|BRCA - Breast invasive adenocarcinoma(365;0.00445)|KIRC - Kidney renal clear cell carcinoma(229;0.00549)|STAD - Stomach adenocarcinoma(132;0.00644)|Lung(427;0.201)		TTTGGCCCCCCAGTCGAAGAC	0.697																																																	0													74.0	85.0	81.0					1																	2444348		2203	4299	6502	SO:0001583	missense	0			AK001644	CCDS42.1	1p36.32	2008-02-05			ENSG00000157881	ENSG00000157881			19366	protein-coding gene	gene with protein product		606162				11479594	Standard	XR_241034		Approved	FLJ10782	uc001ajm.1	Q9NVE7	OTTHUMG00000000791	ENST00000378466.3:c.1706G>C	1.37:g.2444348C>G	ENSP00000367727:p.Trp569Ser		B9DI84|Q53EU3|Q5TA84|Q7RTX3|Q9H3X5	Missense_Mutation	SNP	pfam_Type_II_PanK,pfam_DUF89,superfamily_DUF89,pirsf_PanK_long,tigrfam_Type_II_PanK	p.W569S	ENST00000378466.3	37	c.1706	CCDS42.1	1	.	.	.	.	.	.	.	.	.	.	C	24.9	4.585405	0.86748	.	.	ENSG00000157881	ENST00000378466;ENST00000435556	T;T	0.06528	3.29;3.29	5.33	5.33	0.75918	Domain of unknown function DUF89 (2);	0.000000	0.85682	D	0.000000	T	0.32436	0.0829	M	0.88105	2.93	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.81914	0.995;0.995	T	0.23084	-1.0198	10	0.87932	D	0	-20.1247	17.9869	0.89158	0.0:1.0:0.0:0.0	.	530;569	E9PHT6;Q9NVE7	.;PANK4_HUMAN	S	569;530	ENSP00000367727:W569S;ENSP00000421433:W530S	ENSP00000367727:W569S	W	-	2	0	PANK4	2434208	1.000000	0.71417	1.000000	0.80357	0.869000	0.49853	7.321000	0.79088	2.485000	0.83878	0.561000	0.74099	TGG	PANK4	-	pfam_DUF89,superfamily_DUF89,pirsf_PanK_long	ENSG00000157881		0.697	PANK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PANK4	HGNC	protein_coding	OTTHUMT00000002082.1	-	0.00	161	0	C			2444348	-1	tier1	-	no_errors	ENST00000378466	ensembl	human	known	74_37	missense	17.91	165	36	SNP	1.000	G
PCDH1	5097	genome.wustl.edu	37	5	141242988	141242988	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr5:141242988G>C	ENST00000394536.3	-	3	3047	c.2908C>G	c.(2908-2910)Cgc>Ggc	p.R970G	PCDH1_ENST00000536585.1_Missense_Mutation_p.R948G|PCDH1_ENST00000503492.1_Intron|PCDH1_ENST00000511044.1_5'UTR|PCDH1_ENST00000456271.1_Missense_Mutation_p.R958G|PCDH1_ENST00000287008.3_Missense_Mutation_p.R970G	NM_001278613.1|NM_001278615.1	NP_001265542.1|NP_001265544.1	Q08174	PCDH1_HUMAN	protocadherin 1	970					cell-cell signaling (GO:0007267)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	cell-cell junction (GO:0005911)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(4)|lung(20)|ovary(5)|skin(3)|upper_aerodigestive_tract(1)	51		Lung NSC(810;0.027)|all_lung(500;0.0321)|all_hematologic(541;0.0433)|Prostate(461;0.0453)|Breast(839;0.128)|Lung SC(612;0.238)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	GBM - Glioblastoma multiforme(465;1.06e-05)		GAGTTAGAGCGATAGTGGCGG	0.617																																					Ovarian(132;1609 1739 4190 14731 45037)												0													52.0	47.0	48.0					5																	141242988		2203	4299	6502	SO:0001583	missense	0			AK075233	CCDS4267.1, CCDS43375.1	5q31.3	2010-01-26	2007-02-12		ENSG00000156453	ENSG00000156453		"""Cadherins / Protocadherins : Non-clustered"""	8655	protein-coding gene	gene with protein product		603626	"""protocadherin 1 (cadherin-like 1)"""			8508762	Standard	NM_032420		Approved	pc42	uc003llp.3	Q08174	OTTHUMG00000129661	ENST00000394536.3:c.2908C>G	5.37:g.141242988G>C	ENSP00000378043:p.Arg970Gly		Q8IUP2	Missense_Mutation	SNP	pfam_Cadherin,pfam_Protocadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.R970G	ENST00000394536.3	37	c.2908	CCDS43375.1	5	.	.	.	.	.	.	.	.	.	.	g	16.15	3.040284	0.55003	.	.	ENSG00000156453	ENST00000287008;ENST00000394536;ENST00000456271;ENST00000357517;ENST00000536585	T;T;T;T;T	0.35048	1.33;1.33;1.33;1.33;1.33	4.59	4.59	0.56863	Protocadherin (1);	0.000000	0.49916	D	0.000122	T	0.57007	0.2024	M	0.67953	2.075	0.80722	D	1	D;D	0.65815	0.995;0.994	D;D	0.69142	0.962;0.937	T	0.61422	-0.7066	10	0.87932	D	0	.	14.9325	0.70926	0.0:0.0:1.0:0.0	.	970;970	Q08174;Q08174-2	PCDH1_HUMAN;.	G	970;970;958;981;948	ENSP00000287008:R970G;ENSP00000378043:R970G;ENSP00000403497:R958G;ENSP00000350122:R981G;ENSP00000438825:R948G	ENSP00000287008:R970G	R	-	1	0	PCDH1	141223172	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	3.592000	0.53993	2.386000	0.81285	0.457000	0.33378	CGC	PCDH1	-	pfam_Protocadherin	ENSG00000156453		0.617	PCDH1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PCDH1	HGNC	protein_coding	OTTHUMT00000251862.1	-	0.00	59	0	G	NM_032420		141242988	-1	tier1	-	no_errors	ENST00000287008	ensembl	human	known	74_37	missense	34.69	32	17	SNP	1.000	C
PCDH11X	27328	genome.wustl.edu	37	X	91134272	91134272	+	Splice_Site	SNP	G	G	A	rs138111592	byFrequency	TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chrX:91134272G>A	ENST00000373094.1	+	2	3878	c.3033G>A	c.(3031-3033)ccG>ccA	p.P1011P	PCDH11X_ENST00000395337.2_Splice_Site_p.P1011P|PCDH11X_ENST00000373097.1_Splice_Site_p.P1011P|PCDH11X_ENST00000361724.1_Silent_p.P1011P|PCDH11X_ENST00000504220.2_Splice_Site_p.P1011P|PCDH11X_ENST00000373088.1_Splice_Site_p.P1011P|PCDH11X_ENST00000298274.8_Splice_Site_p.P1011P|PCDH11X_ENST00000361655.2_Splice_Site_p.P1011P|PCDH11X_ENST00000406881.1_Splice_Site_p.P1011P	NM_032968.3	NP_116750.1	Q9BZA7	PC11X_HUMAN	protocadherin 11 X-linked	1011					homophilic cell adhesion (GO:0007156)|negative regulation of phosphatase activity (GO:0010923)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(30)|liver(4)|lung(92)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	159						ACACCAGACCGGTAGGTATCC	0.403													G|||	3	0.000794702	0.0023	0.0	3775	,	,		14242	0.0		0.0	False		,,,				2504	0.0				NSCLC(38;925 1092 2571 38200 45895)												0								G	,,,,,,,	8,3827		0,5,3,1627,568	107.0	92.0	97.0		3033,3033,3033,3033,3033,3033,3033,3033	4.3	1.0	X	dbSNP_134	97	0,6728		0,0,0,2428,1872	no	coding-synonymous-near-splice,coding-synonymous-near-splice,coding-synonymous-near-splice,coding-synonymous-near-splice,coding-synonymous,coding-synonymous-near-splice,coding-synonymous-near-splice,coding-synonymous-near-splice	PCDH11X	NM_001168360.1,NM_001168361.1,NM_001168362.1,NM_001168363.1,NM_014522.1,NM_032967.2,NM_032968.3,NM_032969.3	,,,,,,,	0,5,3,4055,2440	AA,AG,A,GG,G		0.0,0.2086,0.0757	,,,,,,,	1011/1340,1011/1066,1011/1311,1011/1330,1011/1022,1011/1026,1011/1348,1011/1338	91134272	8,10555	2203	4300	6503	SO:0001630	splice_region_variant	0			AB026187	CCDS14461.1, CCDS14462.1, CCDS55458.1, CCDS55459.1, CCDS55460.1, CCDS55461.1	Xq21.3	2014-06-13	2002-05-22	2002-05-24	ENSG00000102290	ENSG00000102290		"""Cadherins / Protocadherins : Non-clustered"""	8656	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 119"""	300246	"""protocadherin 11"""	PCDH11		10644456	Standard	NM_001168360		Approved	PCDH-X, PCDHX, PPP1R119	uc004efm.2	Q9BZA7	OTTHUMG00000021965	ENST00000373094.1:c.3033+1G>A	X.37:g.91134272G>A			A6NIQ4|Q2TJH0|Q2TJH1|Q2TJH3|Q5JVZ0|Q70LR8|Q70LS7|Q70LS8|Q70LS9|Q70LT7|Q70LT8|Q70LT9|Q70LU0|Q70LU1|Q96RV4|Q96RW0|Q9BZA6|Q9H4E0|Q9P2M0|Q9P2X5	Silent	SNP	pfam_Cadherin,pfam_Protocadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.P1011	ENST00000373094.1	37	c.3033	CCDS14461.1	X																																																																																			PCDH11X	-	NULL	ENSG00000102290		0.403	PCDH11X-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PCDH11X	HGNC	protein_coding	OTTHUMT00000057436.1	-	0.00	55	0	G	NM_032969	Silent	91134272	+1	tier1	rs138111592	no_errors	ENST00000373094	ensembl	human	known	74_37	silent	57.78	19	26	SNP	1.000	A
PCDHAC1	56135	genome.wustl.edu	37	5	140307982	140307982	+	Nonsense_Mutation	SNP	C	C	A			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr5:140307982C>A	ENST00000253807.2	+	1	1505	c.1505C>A	c.(1504-1506)tCa>tAa	p.S502*	PCDHA1_ENST00000504120.2_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA13_ENST00000289272.2_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA10_ENST00000307360.5_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA11_ENST00000398640.2_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA13_ENST00000409494.1_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHAC1_ENST00000409700.3_Nonsense_Mutation_p.S502*|PCDHA2_ENST00000526136.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA12_ENST00000398631.2_Intron	NM_018898.3	NP_061721.2	Q9H158	PCDC1_HUMAN	protocadherin alpha subfamily C, 1	502	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|breast(3)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(13)|liver(2)|lung(13)|ovary(3)|prostate(2)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(4)	65			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCAGTGGAATCATCCAGTGGG	0.542																																																	0													70.0	76.0	74.0					5																	140307982		2203	4300	6503	SO:0001587	stop_gained	0			AF152473	CCDS4241.1	5q31	2010-11-26			ENSG00000248383	ENSG00000248383		"""Cadherins / Protocadherins : Clustered"""	8676	other	complex locus constituent	"""PCDH-ALPHA-C1"""	606320				10380929	Standard	NM_018898		Approved			Q9H158	OTTHUMG00000129603	ENST00000253807.2:c.1505C>A	5.37:g.140307982C>A	ENSP00000253807:p.Ser502*		Q9Y5F5|Q9Y5I5	Nonsense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.S502*	ENST00000253807.2	37	c.1505	CCDS4241.1	5	.	.	.	.	.	.	.	.	.	.	C	25.0	4.594072	0.86953	.	.	ENSG00000248383	ENST00000409700;ENST00000253807	.	.	.	5.49	4.59	0.56863	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	10.2717	0.43487	0.0:0.7831:0.1376:0.0793	.	.	.	.	X	502	.	ENSP00000253807:S502X	S	+	2	0	PCDHAC1	140288166	0.011000	0.17503	0.847000	0.33407	0.992000	0.81027	2.539000	0.45718	2.566000	0.86566	0.563000	0.77884	TCA	PCDHAC1	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000248383		0.542	PCDHAC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PCDHAC1	HGNC	protein_coding	OTTHUMT00000251798.1	-	0.00	46	0	C	NM_018898		140307982	+1	tier1	-	no_errors	ENST00000253807	ensembl	human	known	74_37	nonsense	25.49	38	13	SNP	0.082	A
PCDHB3	56132	genome.wustl.edu	37	5	140480810	140480810	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr5:140480810G>A	ENST00000231130.2	+	1	577	c.577G>A	c.(577-579)Gaa>Aaa	p.E193K	AC005754.7_ENST00000607216.1_RNA	NM_018937.2	NP_061760.1	Q9Y5E6	PCDB3_HUMAN	protocadherin beta 3	193	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(19)|lung(24)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	72			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GAAGTACCCGGAACTAGTACT	0.577																																																	0													75.0	73.0	74.0					5																	140480810		2203	4300	6503	SO:0001583	missense	0			AF152496	CCDS4245.1	5q31	2010-01-26			ENSG00000113205	ENSG00000113205		"""Cadherins / Protocadherins : Clustered"""	8688	other	protocadherin		606329				10380929	Standard	NM_018937		Approved	PCDH-BETA3	uc003lio.3	Q9Y5E6	OTTHUMG00000129622	ENST00000231130.2:c.577G>A	5.37:g.140480810G>A	ENSP00000231130:p.Glu193Lys		B2R8P2	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.E193K	ENST00000231130.2	37	c.577	CCDS4245.1	5	.	.	.	.	.	.	.	.	.	.	G	18.68	3.676620	0.67928	.	.	ENSG00000113205	ENST00000231130	T	0.21932	1.98	5.08	4.2	0.49525	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.48314	0.1493	M	0.79805	2.47	0.40116	D	0.976542	D	0.67145	0.996	D	0.70016	0.967	T	0.58521	-0.7622	9	0.87932	D	0	.	15.4478	0.75243	0.0:0.1397:0.8603:0.0	.	193	Q9Y5E6	PCDB3_HUMAN	K	193	ENSP00000231130:E193K	ENSP00000231130:E193K	E	+	1	0	PCDHB3	140460994	1.000000	0.71417	0.330000	0.25442	0.401000	0.30781	6.645000	0.74343	1.240000	0.43803	0.655000	0.94253	GAA	PCDHB3	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000113205		0.577	PCDHB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB3	HGNC	protein_coding	OTTHUMT00000251817.2	-	0.00	43	0	G	NM_018937		140480810	+1	tier1	-	no_errors	ENST00000231130	ensembl	human	known	74_37	missense	28.57	25	10	SNP	0.984	A
PCDHGA11	56105	genome.wustl.edu	37	5	140802465	140802465	+	Silent	SNP	C	C	T			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr5:140802465C>T	ENST00000398587.2	+	1	1704	c.1671C>T	c.(1669-1671)aaC>aaT	p.N557N	PCDHGB3_ENST00000576222.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA10_ENST00000398610.2_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGB7_ENST00000398594.2_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGA11_ENST00000518882.1_Silent_p.N557N|PCDHGA3_ENST00000253812.6_Intron|PCDHGB4_ENST00000519479.1_Intron	NM_018914.2|NM_032092.1	NP_061737.1|NP_114481.1	Q9Y5H2	PCDGB_HUMAN	protocadherin gamma subfamily A, 11	557	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|endometrium(8)|kidney(3)|large_intestine(9)|lung(22)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)	49			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGGACCAGAACGACAATGCGC	0.632																																																	0													158.0	178.0	171.0					5																	140802465		2203	4300	6503	SO:0001819	synonymous_variant	0			AF152505	CCDS47294.1, CCDS54930.1, CCDS75345.1	5q31	2010-01-26			ENSG00000253873	ENSG00000253873		"""Cadherins / Protocadherins : Clustered"""	8698	other	protocadherin		606298				10380929	Standard	NM_018914		Approved	PCDH-GAMMA-A11		Q9Y5H2	OTTHUMG00000164055	ENST00000398587.2:c.1671C>T	5.37:g.140802465C>T			B7ZVY8|Q9Y5D8|Q9Y5D9	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.N557	ENST00000398587.2	37	c.1671	CCDS47294.1	5																																																																																			PCDHGA11	-	superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	ENSG00000253873		0.632	PCDHGA11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGA11	HGNC	protein_coding	OTTHUMT00000376974.1	-	0.00	113	0	C	NM_018914		140802465	+1	tier1	-	no_errors	ENST00000398587	ensembl	human	known	74_37	silent	22.68	75	22	SNP	0.950	T
PCLO	27445	genome.wustl.edu	37	7	82467549	82467549	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr7:82467549A>C	ENST00000333891.9	-	15	14544	c.14207T>G	c.(14206-14208)cTt>cGt	p.L4736R	PCLO_ENST00000423517.2_Missense_Mutation_p.L4736R|PCLO_ENST00000426442.2_5'UTR	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein											breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						CCCTGGAAGAAGGTACACTTT	0.333																																																	0													68.0	66.0	67.0					7																	82467549		1833	4076	5909	SO:0001583	missense	0			AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.14207T>G	7.37:g.82467549A>C	ENSP00000334319:p.Leu4736Arg			Missense_Mutation	SNP	pfam_Znf_piccolo,pfam_C2_dom,pfam_PDZ,superfamily_C2_dom,superfamily_PDZ,superfamily_Znf_FYVE_PHD,smart_PDZ,smart_C2_dom,pfscan_C2_dom,pfscan_PDZ	p.L4736R	ENST00000333891.9	37	c.14207	CCDS47630.1	7	.	.	.	.	.	.	.	.	.	.	A	14.81	2.646705	0.47258	.	.	ENSG00000186472	ENST00000333891;ENST00000423517;ENST00000380195	T;T	0.74209	-0.82;-0.82	5.58	5.58	0.84498	.	.	.	.	.	D	0.87553	0.6206	M	0.85041	2.73	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;0.999;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;0.999	D	0.89622	0.3849	9	0.87932	D	0	.	15.7636	0.78106	1.0:0.0:0.0:0.0	.	4736;4736;166;233	Q9Y6V0-5;Q9Y6V0-6;Q9Y6V0-3;Q32P40	.;.;.;.	R	4736;4736;232	ENSP00000334319:L4736R;ENSP00000388393:L4736R	ENSP00000334319:L4736R	L	-	2	0	PCLO	82305485	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	8.596000	0.90844	2.105000	0.64084	0.533000	0.62120	CTT	PCLO	-	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom	ENSG00000186472		0.333	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	PCLO	HGNC	protein_coding	OTTHUMT00000337368.5	-	0.00	69	0	A	NM_014510		82467549	-1	tier1	-	no_errors	ENST00000333891	ensembl	human	known	74_37	missense	55.88	15	19	SNP	1.000	C
PCLO	27445	genome.wustl.edu	37	7	82581865	82581865	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr7:82581865C>T	ENST00000333891.9	-	5	8741	c.8404G>A	c.(8404-8406)Gct>Act	p.A2802T	PCLO_ENST00000437081.1_5'Flank|PCLO_ENST00000423517.2_Missense_Mutation_p.A2802T	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein											breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						CTTGCACTAGCTGTGCATGTG	0.463																																																	0													201.0	177.0	185.0					7																	82581865		2038	4185	6223	SO:0001583	missense	0			AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.8404G>A	7.37:g.82581865C>T	ENSP00000334319:p.Ala2802Thr			Missense_Mutation	SNP	pfam_Znf_piccolo,pfam_C2_dom,pfam_PDZ,superfamily_C2_dom,superfamily_PDZ,superfamily_Znf_FYVE_PHD,smart_PDZ,smart_C2_dom,pfscan_C2_dom,pfscan_PDZ	p.A2802T	ENST00000333891.9	37	c.8404	CCDS47630.1	7	.	.	.	.	.	.	.	.	.	.	C	9.820	1.185494	0.21870	.	.	ENSG00000186472	ENST00000431819;ENST00000333891;ENST00000423517	T;T	0.17370	2.28;2.28	5.69	1.66	0.24008	.	.	.	.	.	T	0.10637	0.0260	N	0.21097	0.63	0.80722	D	1	B;B	0.20671	0.047;0.047	B;B	0.20184	0.028;0.019	T	0.11155	-1.0599	9	0.87932	D	0	.	6.0001	0.19515	0.0:0.4739:0.3139:0.2122	.	2802;2802	Q9Y6V0-5;Q9Y6V0-6	.;.	T	2733;2802;2802	ENSP00000334319:A2802T;ENSP00000388393:A2802T	ENSP00000334319:A2802T	A	-	1	0	PCLO	82419801	0.716000	0.27956	0.275000	0.24674	0.786000	0.44442	0.861000	0.27885	0.242000	0.21303	0.655000	0.94253	GCT	PCLO	-	NULL	ENSG00000186472		0.463	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	PCLO	HGNC	protein_coding	OTTHUMT00000337368.5	-	0.00	54	0	C	NM_014510		82581865	-1	tier1	-	no_errors	ENST00000333891	ensembl	human	known	74_37	missense	24.44	34	11	SNP	0.996	T
PDCD11	22984	genome.wustl.edu	37	10	105181166	105181166	+	Missense_Mutation	SNP	C	C	T	rs145404572	byFrequency	TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr10:105181166C>T	ENST00000369797.3	+	17	2433	c.2339C>T	c.(2338-2340)gCg>gTg	p.A780V		NM_014976.1	NP_055791.1	Q14690	RRP5_HUMAN	programmed cell death 11	780	S1 motif 8. {ECO:0000255|PROSITE- ProRule:PRU00180}.		A -> S (in dbSNP:rs11591914).		mRNA processing (GO:0006397)|rRNA processing (GO:0006364)	cytosol (GO:0005829)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|transcription factor binding (GO:0008134)	p.A780V(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(10)|lung(29)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	64		Colorectal(252;0.0747)|Breast(234;0.128)		Epithelial(162;7.21e-09)|all cancers(201;1.17e-08)|BRCA - Breast invasive adenocarcinoma(275;0.208)		CAGACAGTAGCGGCAAAGGTG	0.537													C|||	2	0.000399361	0.0008	0.0	5008	,	,		16448	0.001		0.0	False		,,,				2504	0.0																1	Substitution - Missense(1)	large_intestine(1)											67.0	57.0	60.0					10																	105181166		2203	4300	6503	SO:0001583	missense	0			D80007	CCDS31276.1	10q24.32	2010-07-06			ENSG00000148843	ENSG00000148843			13408	protein-coding gene	gene with protein product		612333				10229231	Standard	XM_005269647		Approved	KIAA0185, ALG-4, RRP5	uc001kwy.1	Q14690	OTTHUMG00000018988	ENST00000369797.3:c.2339C>T	10.37:g.105181166C>T	ENSP00000358812:p.Ala780Val		Q2TA92|Q5W093|Q6P2J3|Q86VQ8|Q9H4P1	Missense_Mutation	SNP	pfam_Rbsml_prot_S1_RNA-bd_dom,pfam_Suf,superfamily_NA-bd_OB-fold,smart_RNA-binding_domain_S1,smart_HAT,pfscan_TPR-contain_dom,pfscan_Rbsml_prot_S1_RNA-bd_dom,prints_Ribosomal_S1	p.A780V	ENST00000369797.3	37	c.2339	CCDS31276.1	10	2	9.157509157509158E-4	1	0.0020325203252032522	0	0.0	1	0.0017482517482517483	0	0.0	C	0.013	-1.639427	0.00799	.	.	ENSG00000148843	ENST00000369797;ENST00000543503	T	0.42900	0.96	5.74	2.05	0.26809	Nucleic acid-binding, OB-fold-like (1);Nucleic acid-binding, OB-fold (1);RNA-binding domain, S1 (1);Ribosomal protein S1, RNA-binding domain (2);	0.496053	0.24443	N	0.038497	T	0.11623	0.0283	N	0.00303	-1.675	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.29366	-1.0014	10	0.16420	T	0.52	-11.4892	12.0084	0.53272	0.0:0.1304:0.0:0.8696	.	780	Q14690	RRP5_HUMAN	V	780	ENSP00000358812:A780V	ENSP00000358812:A780V	A	+	2	0	PDCD11	105171156	1.000000	0.71417	0.040000	0.18447	0.041000	0.13682	3.097000	0.50251	0.521000	0.28445	-1.421000	0.01109	GCG	PDCD11	-	pfam_Rbsml_prot_S1_RNA-bd_dom,superfamily_NA-bd_OB-fold,smart_RNA-binding_domain_S1,pfscan_Rbsml_prot_S1_RNA-bd_dom	ENSG00000148843		0.537	PDCD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDCD11	HGNC	protein_coding	OTTHUMT00000050151.1		0.00	56	0	C			105181166	+1			no_errors	ENST00000369797	ensembl	human	known	74_37	missense	5.00	38	2	SNP	0.049	T
PDE10A	10846	genome.wustl.edu	37	6	165829695	165829695	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr6:165829695G>A	ENST00000366882.1	-	13	1197	c.1043C>T	c.(1042-1044)gCa>gTa	p.A348V	PDE10A_ENST00000354448.4_Missense_Mutation_p.A348V|PDE10A_ENST00000539869.2_Missense_Mutation_p.A358V			Q9Y233	PDE10_HUMAN	phosphodiesterase 10A	348	GAF 2.				blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cGMP catabolic process (GO:0046069)|regulation of cAMP-mediated signaling (GO:0043949)|regulation of protein kinase A signaling (GO:0010738)|signal transduction (GO:0007165)	cytosol (GO:0005829)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|cGMP-stimulated cyclic-nucleotide phosphodiesterase activity (GO:0004118)|metal ion binding (GO:0046872)			breast(4)|endometrium(5)|kidney(1)|large_intestine(13)|liver(1)|lung(39)|ovary(3)|skin(4)|upper_aerodigestive_tract(1)	71		Breast(66;0.000425)|Prostate(117;0.104)|Ovarian(120;0.221)		OV - Ovarian serous cystadenocarcinoma(33;1.5e-17)|BRCA - Breast invasive adenocarcinoma(81;1.8e-06)|GBM - Glioblastoma multiforme(31;1.92e-05)	Caffeine(DB00201)|Dipyridamole(DB00975)|Papaverine(DB01113)|Tofisopam(DB08811)|Triflusal(DB08814)	GCGTGGGTCTGCATAGGCATC	0.453																																					Esophageal Squamous(22;308 615 5753 12038 40624)												0													266.0	235.0	245.0					6																	165829695		2203	4300	6503	SO:0001583	missense	0			AB020593	CCDS47513.1	6q26	2008-03-18			ENSG00000112541	ENSG00000112541	3.1.4.17	"""Phosphodiesterases"""	8772	protein-coding gene	gene with protein product		610652				10373451	Standard	NM_001130690		Approved		uc003quo.3	Q9Y233	OTTHUMG00000015986	ENST00000366882.1:c.1043C>T	6.37:g.165829695G>A	ENSP00000355847:p.Ala348Val		Q6FHX1|Q9HCP9|Q9NTV4|Q9ULW9|Q9Y5T1	Missense_Mutation	SNP	pfam_PDEase_catalytic_dom,pfam_GAF,smart_GAF,smart_HD/PDEase_dom,prints_PDEase	p.A358V	ENST00000366882.1	37	c.1073		6	.	.	.	.	.	.	.	.	.	.	G	21.8	4.198985	0.79015	.	.	ENSG00000112541	ENST00000366882;ENST00000539869;ENST00000343842;ENST00000354448;ENST00000392126	T;T	0.69040	-0.37;-0.37	5.2	5.2	0.72013	GAF (2);	0.000000	0.85682	D	0.000000	T	0.75708	0.3886	L	0.60455	1.87	0.80722	D	1	D;D	0.69078	0.997;0.964	D;P	0.80764	0.994;0.661	T	0.76225	-0.3037	10	0.51188	T	0.08	.	18.7528	0.91821	0.0:0.0:1.0:0.0	.	358;348	Q9ULW9;Q9Y233	.;PDE10_HUMAN	V	348;376;358;348;347	ENSP00000355847:A348V;ENSP00000346435:A348V	ENSP00000341187:A358V	A	-	2	0	PDE10A	165749685	1.000000	0.71417	0.436000	0.26797	0.731000	0.41821	9.507000	0.97996	2.430000	0.82344	0.561000	0.74099	GCA	PDE10A	-	pfam_GAF,smart_GAF	ENSG00000112541		0.453	PDE10A-001	PUTATIVE	basic	protein_coding	PDE10A	HGNC	protein_coding	OTTHUMT00000043031.1	-	0.00	56	0	G			165829695	-1	tier1	-	no_errors	ENST00000539869	ensembl	human	known	74_37	missense	5.06	75	4	SNP	1.000	A
PDE1A	5136	genome.wustl.edu	37	2	183051250	183051250	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr2:183051250T>C	ENST00000410103.1	-	13	1404	c.1321A>G	c.(1321-1323)Att>Gtt	p.I441V	PDE1A_ENST00000331935.6_Missense_Mutation_p.I441V|PDE1A_ENST00000536095.1_Missense_Mutation_p.I337V|PDE1A_ENST00000409365.1_Missense_Mutation_p.I425V|PDE1A_ENST00000351439.5_Missense_Mutation_p.I425V|PDE1A_ENST00000435564.1_Missense_Mutation_p.I441V|PDE1A_ENST00000346717.4_Missense_Mutation_p.I407V|PDE1A_ENST00000358139.2_Missense_Mutation_p.I441V|PDE1A_ENST00000456212.1_Missense_Mutation_p.I441V	NM_001003683.2	NP_001003683.1	P54750	PDE1A_HUMAN	phosphodiesterase 1A, calmodulin-dependent	441	Catalytic. {ECO:0000250}.				activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cGMP catabolic process (GO:0046069)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of smooth muscle cell apoptotic process (GO:0034391)|regulation of smooth muscle cell proliferation (GO:0048660)|signal transduction (GO:0007165)	cytosol (GO:0005829)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|calcium- and calmodulin-regulated 3',5'-cyclic-GMP phosphodiesterase activity (GO:0048101)|calmodulin-dependent cyclic-nucleotide phosphodiesterase activity (GO:0004117)|cGMP binding (GO:0030553)|metal ion binding (GO:0046872)			endometrium(5)|large_intestine(3)|lung(12)|ovary(1)|pancreas(1)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(2)	35			OV - Ovarian serous cystadenocarcinoma(117;0.061)		Bepridil(DB01244)|Caffeine(DB00201)|Felodipine(DB01023)|Nicardipine(DB00622)	ATAAGAGGAATAACAATTTTC	0.353																																																	0													69.0	71.0	71.0					2																	183051250		2203	4300	6503	SO:0001583	missense	0				CCDS2285.1, CCDS33344.1, CCDS58741.1, CCDS74612.1	2q32.1	2008-03-18			ENSG00000115252	ENSG00000115252	3.1.4.17	"""Phosphodiesterases"""	8774	protein-coding gene	gene with protein product		171890				8557689, 11342109	Standard	NM_005019		Approved		uc010zfq.2	P54750	OTTHUMG00000132596	ENST00000410103.1:c.1321A>G	2.37:g.183051250T>C	ENSP00000387037:p.Ile441Val		D3DPG5|Q86VZ0|Q9C0K8|Q9C0K9|Q9C0L0|Q9C0L1|Q9C0L2|Q9C0L3|Q9C0L4|Q9UFX3	Missense_Mutation	SNP	pfam_PDEase_catalytic_dom,pfam_PDEase_N,superfamily_GRIP,smart_HD/PDEase_dom,prints_PDEase	p.I441V	ENST00000410103.1	37	c.1321	CCDS33344.1	2	.	.	.	.	.	.	.	.	.	.	T	10.46	1.355499	0.24598	.	.	ENSG00000115252	ENST00000435564;ENST00000346717;ENST00000536095;ENST00000409365;ENST00000331935;ENST00000351439;ENST00000410103;ENST00000358139;ENST00000456212	D;D;D;D;D;D;D;D;D	0.81499	-1.5;-1.5;-1.5;-1.5;-1.5;-1.5;-1.5;-1.5;-1.5	5.29	2.71	0.32032	5&apos (2);-cyclic nucleotide phosphodiesterase, catalytic domain (2);3&apos (2);	0.537282	0.22518	N	0.059006	T	0.65386	0.2686	L	0.34521	1.04	0.23361	N	0.99784	B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0	B;B;B;B;B	0.12837	0.005;0.002;0.008;0.001;0.005	T	0.49560	-0.8927	10	0.30078	T	0.28	.	3.5552	0.07862	0.1595:0.2084:0.0:0.6321	.	337;407;441;425;441	B7Z3A7;P54750-3;P54750;P54750-2;P54750-4	.;.;PDE1A_HUMAN;.;.	V	441;407;337;425;441;425;441;441;441	ENSP00000410309:I441V;ENSP00000329112:I407V;ENSP00000439938:I337V;ENSP00000386767:I425V;ENSP00000331574:I441V;ENSP00000309269:I425V;ENSP00000387037:I441V;ENSP00000350858:I441V;ENSP00000408874:I441V	ENSP00000331574:I441V	I	-	1	0	PDE1A	182759495	0.182000	0.23173	0.999000	0.59377	0.994000	0.84299	0.532000	0.23067	0.829000	0.34733	0.533000	0.62120	ATT	PDE1A	-	pfam_PDEase_catalytic_dom	ENSG00000115252		0.353	PDE1A-003	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	PDE1A	HGNC	protein_coding	OTTHUMT00000334356.1	-	0.00	41	0	T			183051250	-1	tier1	-	no_errors	ENST00000456212	ensembl	human	known	74_37	missense	32.26	21	10	SNP	0.991	C
PGM5	5239	genome.wustl.edu	37	9	71015611	71015611	+	Intron	SNP	A	A	T			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr9:71015611A>T	ENST00000396396.1	+	6	1272				RP11-88I18.2_ENST00000609241.1_RNA|RP11-88I18.2_ENST00000592778.1_RNA|PGM5_ENST00000604870.2_Intron|PGM5_ENST00000396392.1_Intron|RP11-88I18.2_ENST00000590767.1_RNA|RP11-88I18.2_ENST00000446984.2_RNA	NM_021965.3	NP_068800.2	Q15124	PGM5_HUMAN	phosphoglucomutase 5						carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)	cell-cell adherens junction (GO:0005913)|costamere (GO:0043034)|cytoplasmic side of plasma membrane (GO:0009898)|dystrophin-associated glycoprotein complex (GO:0016010)|focal adhesion (GO:0005925)|intercalated disc (GO:0014704)|sarcolemma (GO:0042383)|spot adherens junction (GO:0005914)|stress fiber (GO:0001725)|Z disc (GO:0030018)	intramolecular transferase activity, phosphotransferases (GO:0016868)|magnesium ion binding (GO:0000287)|structural molecule activity (GO:0005198)			endometrium(5)|kidney(1)|large_intestine(5)|liver(2)|lung(15)|ovary(1)|pancreas(1)|prostate(3)|skin(1)	34						TTTGGATATAATAAAACTATG	0.333																																																	0																																										SO:0001627	intron_variant	0			L40933	CCDS6622.2	9q13	2008-02-05			ENSG00000154330	ENSG00000154330			8908	protein-coding gene	gene with protein product	"""phosphoglucomutase-related protein"""	600981				8586438, 8631316	Standard	NM_021965		Approved	PGMRP	uc004agr.3	Q15124	OTTHUMG00000019966	ENST00000396396.1:c.1043+8222A>T	9.37:g.71015611A>T			B1AM46|B4DLQ6|Q5VYV3|Q8N527|Q9UDH4	RNA	SNP	-	NULL	ENST00000396396.1	37	NULL	CCDS6622.2	9																																																																																			PGM5	-	-	ENSG00000154330		0.333	PGM5-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	PGM5	HGNC	protein_coding	OTTHUMT00000052548.2	-	0.00	68	0	A	NM_021965		71015611	+1	tier1	-	no_errors	ENST00000587852	ensembl	human	known	74_37	rna	42.17	48	35	SNP	0.003	T
PIK3R3	8503	genome.wustl.edu	37	1	46598535	46598535	+	5'UTR	SNP	A	A	G			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr1:46598535A>G	ENST00000420542.1	-	0	173				PIK3R3_ENST00000540385.1_Intron|RP4-533D7.5_ENST00000452785.2_RNA|PIK3R3_ENST00000354242.4_5'UTR|PIK3R3_ENST00000372006.1_5'Flank|PIK3R3_ENST00000340332.6_5'UTR|PIK3R3_ENST00000262741.5_5'Flank|PIK3R3_ENST00000423209.1_5'Flank	NM_001114172.1	NP_001107644.1	Q92569	P55G_HUMAN	phosphoinositide-3-kinase, regulatory subunit 3 (gamma)						insulin receptor signaling pathway (GO:0008286)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|phosphatidylinositol 3-kinase complex (GO:0005942)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|phosphatidylinositol 3-kinase regulator activity (GO:0035014)			endometrium(1)|large_intestine(5)|lung(6)|prostate(2)	14	Acute lymphoblastic leukemia(166;0.155)				Isoprenaline(DB01064)	ACCGCTCTCTAGGCTTCGGCT	0.612																																																	0																																										SO:0001623	5_prime_UTR_variant	0			BC021622	CCDS529.1	1p34.1	2013-02-14	2008-02-04		ENSG00000117461	ENSG00000117461		"""SH2 domain containing"""	8981	protein-coding gene	gene with protein product		606076				9524259	Standard	NM_003629		Approved	p55	uc001cpb.4	Q92569	OTTHUMG00000008096	ENST00000420542.1:c.-84T>C	1.37:g.46598535A>G			B2R9C1|D3DQ12|O60482|Q5T4P1|Q5T4P2	RNA	SNP	-	NULL	ENST00000420542.1	37	NULL	CCDS529.1	1																																																																																			PIK3R3	-	-	ENSG00000117461		0.612	PIK3R3-203	KNOWN	basic|appris_principal|CCDS	protein_coding	PIK3R3	HGNC	protein_coding	OTTHUMT00000022166.1	-	0.00	37	0	A	NM_003629		46598535	-1	tier1	-	no_errors	ENST00000493202	ensembl	human	known	74_37	rna	29.79	33	14	SNP	0.000	G
PITPNM2	57605	genome.wustl.edu	37	12	123498552	123498552	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr12:123498552C>T	ENST00000542749.1	-	2	179	c.116G>A	c.(115-117)gGc>gAc	p.G39D	PITPNM2_ENST00000280562.5_Missense_Mutation_p.G39D|PITPNM2_ENST00000392428.1_Missense_Mutation_p.G39D|PITPNM2_ENST00000451868.2_5'UTR|PITPNM2_ENST00000320201.4_Missense_Mutation_p.G39D|RN7SL133P_ENST00000585256.1_RNA|PITPNM2_ENST00000546049.1_Missense_Mutation_p.G39D			Q9BZ72	PITM2_HUMAN	phosphatidylinositol transfer protein, membrane-associated 2	39					metabolic process (GO:0008152)|transport (GO:0006810)	integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)	calcium ion binding (GO:0005509)|lipid binding (GO:0008289)			NS(2)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(10)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	39	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;2.55e-05)|Epithelial(86;8.43e-05)|BRCA - Breast invasive adenocarcinoma(302;0.123)		GATCTCCACGCCGCTGCCTTC	0.592																																																	0													116.0	98.0	104.0					12																	123498552		2203	4300	6503	SO:0001583	missense	0			AF334585	CCDS9242.1, CCDS73543.1	12q24.31	2008-02-05				ENSG00000090975			21044	protein-coding gene	gene with protein product		608920				10022914	Standard	XM_005253582		Approved	RDGBA2, RDGB2, NIR3	uc001uej.1	Q9BZ72		ENST00000542749.1:c.116G>A	12.37:g.123498552C>T	ENSP00000437611:p.Gly39Asp		Q9P271	Missense_Mutation	SNP	pfam_PI_transfer,pfam_DDHD,pfam_LNS2,superfamily_HAD-like_dom,smart_LNS2,pfscan_DDHD,prints_PI_transfer	p.G39D	ENST00000542749.1	37	c.116	CCDS9242.1	12	.	.	.	.	.	.	.	.	.	.	C	29.7	5.024885	0.93518	.	.	ENSG00000090975	ENST00000280562;ENST00000320201;ENST00000392428;ENST00000542749;ENST00000542210	T;T;T;T;T	0.62498	0.02;0.02;0.02;0.02;0.02	4.42	4.42	0.53409	START-like domain (1);	0.000000	0.85682	D	0.000000	D	0.86619	0.5976	H	0.97340	3.985	0.43047	D	0.994649	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.92228	0.5790	10	0.87932	D	0	-33.2154	17.4015	0.87461	0.0:1.0:0.0:0.0	.	39;39;39	A5D8U3;Q9BZ72-2;Q9BZ72	.;.;PITM2_HUMAN	D	39	ENSP00000280562:G39D;ENSP00000322218:G39D;ENSP00000376223:G39D;ENSP00000437611:G39D;ENSP00000437869:G39D	ENSP00000280562:G39D	G	-	2	0	PITPNM2	122064505	1.000000	0.71417	0.998000	0.56505	0.988000	0.76386	7.627000	0.83176	2.168000	0.68352	0.655000	0.94253	GGC	PITPNM2	-	pfam_PI_transfer	ENSG00000090975		0.592	PITPNM2-005	KNOWN	basic|appris_principal|CCDS	protein_coding	PITPNM2	HGNC	protein_coding	OTTHUMT00000401342.1	-	0.00	35	0	C	NM_020845		123498552	-1	tier1	-	no_errors	ENST00000320201	ensembl	human	known	74_37	missense	51.85	13	14	SNP	1.000	T
PITPNM3	83394	genome.wustl.edu	37	17	6374666	6374666	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr17:6374666A>C	ENST00000262483.8	-	12	1526	c.1439T>G	c.(1438-1440)cTa>cGa	p.L480R	PITPNM3_ENST00000576664.1_Intron|PITPNM3_ENST00000421306.3_Missense_Mutation_p.L444R	NM_031220.3	NP_112497.2	Q9BZ71	PITM3_HUMAN	PITPNM family member 3	480	DDHD. {ECO:0000255|PROSITE- ProRule:PRU00378}.				phosphatidylinositol metabolic process (GO:0046488)|phospholipid transport (GO:0015914)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)	calcium ion binding (GO:0005509)|lipid binding (GO:0008289)|phosphatidylinositol transporter activity (GO:0008526)|receptor tyrosine kinase binding (GO:0030971)			autonomic_ganglia(1)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(9)|lung(10)|ovary(3)|prostate(3)|skin(2)	36				Colorectal(2;0.000372)|READ - Rectum adenocarcinoma(2;0.0276)|LUAD - Lung adenocarcinoma(2;0.0836)|COAD - Colon adenocarcinoma(228;0.185)		GTGGGTGTGTAGGGCATCAGC	0.672																																																	0													18.0	20.0	20.0					17																	6374666		2200	4299	6499	SO:0001583	missense	0			AF334586	CCDS11076.1, CCDS54080.1	17p13	2013-07-18	2013-07-18	2013-07-18	ENSG00000091622	ENSG00000091622		"""GPCR / Class A : Chemokine receptors : Atypical"""	21043	protein-coding gene	gene with protein product	"""atypical chemokine receptor 6"""	608921	"""cone rod dystrophy 5"""	CORD5		10022914	Standard	NM_031220		Approved	NIR1, RDGBA3, ACKR6	uc002gdd.4	Q9BZ71	OTTHUMG00000102039	ENST00000262483.8:c.1439T>G	17.37:g.6374666A>C	ENSP00000262483:p.Leu480Arg		A1A5D0|F8WEW5|Q59GH9|Q9NPQ4	Missense_Mutation	SNP	pfam_DDHD,pfam_LNS2,superfamily_HAD-like_dom,smart_LNS2,pfscan_DDHD	p.L480R	ENST00000262483.8	37	c.1439	CCDS11076.1	17	.	.	.	.	.	.	.	.	.	.	A	17.32	3.359494	0.61403	.	.	ENSG00000091622	ENST00000262483;ENST00000421306	T;T	0.50548	0.75;0.74	4.78	4.78	0.61160	DDHD (2);	0.419471	0.21064	N	0.080778	T	0.55970	0.1954	L	0.39898	1.24	0.38031	D	0.93516	D;D	0.62365	0.991;0.989	P;P	0.61592	0.891;0.832	T	0.62895	-0.6757	10	0.87932	D	0	.	12.553	0.56238	1.0:0.0:0.0:0.0	.	444;480	F8WEW5;Q9BZ71	.;PITM3_HUMAN	R	480;444	ENSP00000262483:L480R;ENSP00000407882:L444R	ENSP00000262483:L480R	L	-	2	0	PITPNM3	6315390	1.000000	0.71417	1.000000	0.80357	0.508000	0.34012	7.450000	0.80656	1.920000	0.55613	0.459000	0.35465	CTA	PITPNM3	-	pfam_DDHD,pfscan_DDHD	ENSG00000091622		0.672	PITPNM3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PITPNM3	HGNC	protein_coding	OTTHUMT00000219824.2	-	0.00	62	0	A	NM_031220		6374666	-1	tier1	-	no_errors	ENST00000262483	ensembl	human	known	74_37	missense	25.86	43	15	SNP	1.000	C
PKD1	5310	genome.wustl.edu	37	16	2164867	2164867	+	Silent	SNP	G	G	A	rs545699501		TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr16:2164867G>A	ENST00000262304.4	-	11	2365	c.2157C>T	c.(2155-2157)caC>caT	p.H719H	RP11-304L19.4_ENST00000568795.1_RNA|PKD1_ENST00000423118.1_Silent_p.H719H	NM_001009944.2	NP_001009944	P98161	PKD1_HUMAN	polycystic kidney disease 1 (autosomal dominant)	719					anatomical structure morphogenesis (GO:0009653)|branching morphogenesis of an epithelial tube (GO:0048754)|calcium ion transmembrane transport (GO:0070588)|calcium-independent cell-matrix adhesion (GO:0007161)|cartilage condensation (GO:0001502)|cartilage development (GO:0051216)|cation transmembrane transport (GO:0098655)|cell cycle arrest (GO:0007050)|cell-matrix adhesion (GO:0007160)|cytoplasmic sequestering of transcription factor (GO:0042994)|detection of mechanical stimulus (GO:0050982)|digestive tract development (GO:0048565)|embryonic placenta development (GO:0001892)|genitalia development (GO:0048806)|heart development (GO:0007507)|homophilic cell adhesion (GO:0007156)|in utero embryonic development (GO:0001701)|JAK-STAT cascade (GO:0007259)|kidney development (GO:0001822)|liver development (GO:0001889)|lung epithelium development (GO:0060428)|mesonephric duct development (GO:0072177)|mesonephric tubule development (GO:0072164)|metanephric ascending thin limb development (GO:0072218)|metanephric collecting duct development (GO:0072205)|metanephric distal tubule morphogenesis (GO:0072287)|metanephric proximal tubule development (GO:0072237)|neural tube development (GO:0021915)|neuropeptide signaling pathway (GO:0007218)|nitrogen compound metabolic process (GO:0006807)|peptidyl-serine phosphorylation (GO:0018105)|placenta blood vessel development (GO:0060674)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of protein binding (GO:0032092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein export from nucleus (GO:0006611)|regulation of mitotic spindle organization (GO:0060236)|regulation of proteasomal protein catabolic process (GO:0061136)|response to fluid shear stress (GO:0034405)|skin development (GO:0043588)|spinal cord development (GO:0021510)	basolateral plasma membrane (GO:0016323)|cilium (GO:0005929)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|motile primary cilium (GO:0031512)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|polycystin complex (GO:0002133)	calcium channel activity (GO:0005262)|carbohydrate binding (GO:0030246)|cation channel activity (GO:0005261)|ion channel binding (GO:0044325)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|kidney(6)|lung(34)|prostate(4)|skin(10)|upper_aerodigestive_tract(3)|urinary_tract(3)	72						GGCCAGCGTCGTGCTGCAAGC	0.706													a|||	1	0.000199681	0.0	0.0	5008	,	,		17371	0.001		0.0	False		,,,				2504	0.0																0													1.0	1.0	1.0					16																	2164867		515	850	1365	SO:0001819	synonymous_variant	0			L33243	CCDS32369.1, CCDS45385.1	16p13.3	2014-01-28			ENSG00000008710	ENSG00000008710		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	9008	protein-coding gene	gene with protein product	"""polycystin 1"", ""transient receptor potential cation channel, subfamily P, member 1"""	601313					Standard	NM_001009944		Approved	PBP, Pc-1, TRPP1	uc002cos.1	P98161	OTTHUMG00000155795	ENST00000262304.4:c.2157C>T	16.37:g.2164867G>A			Q15140|Q15141	Silent	SNP	pfam_PKD_dom,pfam_PKD1_2_channel,pfam_PKD/REJ-like,pfam_PLAT/LH2_dom,pfam_C-type_lectin,pfam_WSC_carb-bd,pfam_GPS_dom,superfamily_C-type_lectin_fold,superfamily_Lipase_LipOase,superfamily_PKD_dom,superfamily_Fe_hydrogenase,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_WSC_carb-bd_subgr,smart_PKD/Chitinase_dom,smart_C-type_lectin,smart_GPS_dom,smart_PLAT/LH2_dom,prints_PKD_1,pfscan_GPS_dom,pfscan_C-type_lectin,pfscan_PKD_dom,pfscan_PLAT/LH2_dom,pfscan_REJ-like,pfscan_WSC_carb-bd,tigrfam_Polycystin_cat	p.H719	ENST00000262304.4	37	c.2157	CCDS32369.1	16																																																																																			PKD1	-	tigrfam_Polycystin_cat	ENSG00000008710		0.706	PKD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PKD1	HGNC	protein_coding	OTTHUMT00000341688.1	-	0.00	123	0	G			2164867	-1	tier1	-	no_errors	ENST00000262304	ensembl	human	known	74_37	silent	26.19	93	33	SNP	0.956	A
PLBD2	196463	genome.wustl.edu	37	12	113821938	113821938	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr12:113821938A>C	ENST00000280800.3	+	7	1017	c.986A>C	c.(985-987)aAg>aCg	p.K329T	PLBD2_ENST00000545182.2_Missense_Mutation_p.K329T	NM_173542.3	NP_775813.2	Q8NHP8	PLBL2_HUMAN	phospholipase B domain containing 2	329					lipid catabolic process (GO:0016042)	extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	hydrolase activity (GO:0016787)			breast(1)|endometrium(1)|large_intestine(3)|lung(7)|prostate(1)	13						ATTGGCAACAAGAACCCAGCC	0.617																																																	0													69.0	61.0	64.0					12																	113821938		2203	4300	6503	SO:0001583	missense	0			BC030618	CCDS9168.1, CCDS53834.1	12q24.13	2013-10-11				ENSG00000151176			27283	protein-coding gene	gene with protein product	"""PLB homolog 2 (Dictyostelium)"", ""mannose-6-phosphate protein associated protein p76"""					17105447, 15193148, 19019078	Standard	NM_001159727		Approved	p76	uc001tve.2	Q8NHP8	OTTHUMG00000169567	ENST00000280800.3:c.986A>C	12.37:g.113821938A>C	ENSP00000280800:p.Lys329Thr		F5H5E2	Missense_Mutation	SNP	pfam_PLipase_B-like	p.K329T	ENST00000280800.3	37	c.986	CCDS9168.1	12	.	.	.	.	.	.	.	.	.	.	A	9.616	1.132596	0.21041	.	.	ENSG00000151176	ENST00000545182;ENST00000280800	T;T	0.17370	2.28;2.28	4.84	-2.57	0.06248	.	0.722612	0.13003	N	0.421508	T	0.14141	0.0342	L	0.39633	1.23	0.23401	N	0.997756	B;B	0.15930	0.015;0.004	B;B	0.28991	0.02;0.097	T	0.40327	-0.9569	10	0.18710	T	0.47	-12.2249	12.9608	0.58458	0.3966:0.0:0.6034:0.0	.	329;329	F5H5E2;Q8NHP8	.;PLBL2_HUMAN	T	329	ENSP00000443463:K329T;ENSP00000280800:K329T	ENSP00000280800:K329T	K	+	2	0	PLBD2	112306321	0.992000	0.36948	0.993000	0.49108	0.957000	0.61999	0.336000	0.19823	-0.259000	0.09432	0.254000	0.18369	AAG	PLBD2	-	pfam_PLipase_B-like	ENSG00000151176		0.617	PLBD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLBD2	HGNC	protein_coding	OTTHUMT00000404835.1	-	0.00	71	0	A	NM_173542		113821938	+1	tier1	-	no_errors	ENST00000280800	ensembl	human	known	74_37	missense	47.92	25	23	SNP	0.927	C
PLCH1	23007	genome.wustl.edu	37	3	155200283	155200283	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr3:155200283A>C	ENST00000340059.7	-	23	3555	c.3556T>G	c.(3556-3558)Tta>Gta	p.L1186V	PLCH1_ENST00000494598.1_Intron|PLCH1_ENST00000414191.1_Missense_Mutation_p.L1148V|PLCH1_ENST00000447496.2_3'UTR|PLCH1_ENST00000334686.6_Missense_Mutation_p.L1148V|PLCH1_ENST00000460012.1_Missense_Mutation_p.L1148V	NM_001130960.1	NP_001124432.1	Q4KWH8	PLCH1_HUMAN	phospholipase C, eta 1	1186					inositol phosphate metabolic process (GO:0043647)|lipid catabolic process (GO:0016042)|phosphatidylinositol-mediated signaling (GO:0048015)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|calcium-dependent phospholipase C activity (GO:0050429)|phosphatidylinositol phospholipase C activity (GO:0004435)|signal transducer activity (GO:0004871)			NS(3)|breast(3)|endometrium(9)|kidney(4)|large_intestine(20)|lung(45)|ovary(2)|prostate(5)|skin(8)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(4)	107			Lung(72;0.11)|LUSC - Lung squamous cell carcinoma(72;0.114)			TCATTTGTTAAAGTGACATTG	0.433																																																	0													69.0	69.0	69.0					3																	155200283		2203	4300	6503	SO:0001583	missense	0			AB028992	CCDS33881.1, CCDS46939.1, CCDS46940.1	3q25	2013-01-10	2006-03-16	2006-03-16	ENSG00000114805	ENSG00000114805	3.1.4.11	"""EF-hand domain containing"""	29185	protein-coding gene	gene with protein product		612835	"""phospholipase C-like 3"""	PLCL3		15702972	Standard	NM_014996		Approved	KIAA1069, MGC117152, DKFZp434C1372, PLCeta1	uc021xge.1	Q4KWH8	OTTHUMG00000158477	ENST00000340059.7:c.3556T>G	3.37:g.155200283A>C	ENSP00000345988:p.Leu1186Val		Q29RV9|Q4KWH9|Q68CN0|Q86XK4|Q9H9U2|Q9UPT3	Missense_Mutation	SNP	pfam_PLipase_C_PInositol-sp_X_dom,pfam_PLipase_C_Pinositol-sp_Y,pfam_PLipase_C_EF-hand-like,pfam_C2_dom,superfamily_PLC-like_Pdiesterase_TIM-brl,superfamily_C2_dom,smart_Pleckstrin_homology,smart_EF_hand_dom,smart_PLipase_C_PInositol-sp_X_dom,smart_PLipase_C_Pinositol-sp_Y,smart_C2_dom,pfscan_EF_hand_dom,pfscan_C2_dom,pfscan_Pleckstrin_homology,pfscan_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_Pinositol-sp_Y,prints_Pinositol_PLipase_C	p.L1186V	ENST00000340059.7	37	c.3556	CCDS46939.1	3	.	.	.	.	.	.	.	.	.	.	A	17.00	3.276671	0.59758	.	.	ENSG00000114805	ENST00000460012;ENST00000340059;ENST00000334686;ENST00000414191	T;T;T;T	0.49432	0.78;0.78;0.78;0.78	5.57	1.75	0.24633	.	1.049620	0.07416	N	0.893172	T	0.53674	0.1811	L	0.34521	1.04	0.32722	N	0.51022	D;D	0.71674	0.998;0.997	D;P	0.68353	0.957;0.907	T	0.53215	-0.8470	10	0.62326	D	0.03	.	5.6199	0.17451	0.684:0.0:0.1997:0.1162	.	1148;1186	Q4KWH8-2;Q4KWH8	.;PLCH1_HUMAN	V	1148;1186;1148;1148	ENSP00000417502:L1148V;ENSP00000345988:L1186V;ENSP00000335469:L1148V;ENSP00000412977:L1148V	ENSP00000335469:L1148V	L	-	1	2	PLCH1	156682977	0.875000	0.30112	0.011000	0.14972	0.996000	0.88848	1.444000	0.35068	0.058000	0.16222	0.482000	0.46254	TTA	PLCH1	-	NULL	ENSG00000114805		0.433	PLCH1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PLCH1	HGNC	protein_coding	OTTHUMT00000351125.1	-	0.00	41	0	A	NM_014996		155200283	-1	tier1	-	no_errors	ENST00000340059	ensembl	human	known	74_37	missense	35.71	27	15	SNP	0.643	C
PLCZ1	89869	genome.wustl.edu	37	12	18872517	18872517	+	Missense_Mutation	SNP	A	A	T			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr12:18872517A>T	ENST00000266505.7	-	5	680	c.417T>A	c.(415-417)gaT>gaA	p.D139E	PLCZ1_ENST00000447925.2_Missense_Mutation_p.D137E|PLCZ1_ENST00000539875.1_Intron|RP11-361I14.2_ENST00000536931.1_RNA|PLCZ1_ENST00000435379.1_Intron|PLCZ1_ENST00000541695.1_Missense_Mutation_p.D2E					phospholipase C, zeta 1											NS(1)|breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(13)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)	31	Acute lymphoblastic leukemia(4;0.000455)|all_hematologic(4;0.0241)					ATTCACGTGAATCCATGTATC	0.264																																																	0													51.0	50.0	50.0					12																	18872517		2201	4284	6485	SO:0001583	missense	0			AY035866	CCDS8680.1	12p13.31	2013-01-10			ENSG00000139151	ENSG00000139151	3.1.4.11	"""EF-hand domain containing"""	19218	protein-coding gene	gene with protein product		608075				12117804	Standard	NM_033123		Approved	NYD-SP27, PLCzeta	uc021qvx.2	Q86YW0	OTTHUMG00000168937	ENST00000266505.7:c.417T>A	12.37:g.18872517A>T	ENSP00000266505:p.Asp139Glu			Missense_Mutation	SNP	pfam_PLipase_C_PInositol-sp_X_dom,pfam_PLipase_C_Pinositol-sp_Y,pfam_PLipase_C_EF-hand-like,pfam_C2_dom,superfamily_PLC-like_Pdiesterase_TIM-brl,superfamily_C2_dom,smart_PLipase_C_PInositol-sp_X_dom,smart_PLipase_C_Pinositol-sp_Y,smart_C2_dom,pfscan_EF_hand_dom,pfscan_C2_dom,pfscan_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_Pinositol-sp_Y,prints_Pinositol_PLipase_C	p.D139E	ENST00000266505.7	37	c.417	CCDS8680.1	12	.	.	.	.	.	.	.	.	.	.	A	4.858	0.159471	0.09236	.	.	ENSG00000139151	ENST00000266505;ENST00000447925;ENST00000541695;ENST00000541966	T;T;T;T	0.26810	2.33;2.33;1.71;2.33	5.28	2.92	0.33932	Phospholipase C, phosphoinositol-specific, EF-hand-like (1);EF-hand-like domain (1);	0.996520	0.08142	N	0.991423	T	0.16727	0.0402	N	0.24115	0.695	0.09310	N	1	B	0.13145	0.007	B	0.11329	0.006	T	0.25813	-1.0121	10	0.46703	T	0.11	.	4.1681	0.10317	0.5478:0.1773:0.2748:0.0	.	139	Q86YW0	PLCZ1_HUMAN	E	139;137;2;35	ENSP00000266505:D139E;ENSP00000402358:D137E;ENSP00000443349:D2E;ENSP00000444383:D35E	ENSP00000266505:D139E	D	-	3	2	PLCZ1	18763784	0.088000	0.21588	0.187000	0.23214	0.149000	0.21700	0.452000	0.21795	0.846000	0.35142	0.482000	0.46254	GAT	PLCZ1	-	pfam_PLipase_C_EF-hand-like	ENSG00000139151		0.264	PLCZ1-001	KNOWN	NAGNAG_splice_site|non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	PLCZ1	HGNC	protein_coding	OTTHUMT00000401667.3	-	0.00	30	0	A	NM_033123		18872517	-1	tier1	-	no_errors	ENST00000266505	ensembl	human	known	74_37	missense	31.58	13	6	SNP	0.029	T
PLEC	5339	genome.wustl.edu	37	8	145001217	145001217	+	Silent	SNP	C	C	T	rs374669316		TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr8:145001217C>T	ENST00000322810.4	-	29	4453	c.4284G>A	c.(4282-4284)gcG>gcA	p.A1428A	PLEC_ENST00000398774.2_Silent_p.A1259A|PLEC_ENST00000436759.2_Silent_p.A1318A|PLEC_ENST00000527096.1_Silent_p.A1314A|PLEC_ENST00000345136.3_Silent_p.A1291A|PLEC_ENST00000354589.3_Silent_p.A1291A|PLEC_ENST00000357649.2_Silent_p.A1295A|PLEC_ENST00000354958.2_Silent_p.A1269A|PLEC_ENST00000356346.3_Silent_p.A1277A	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	1428	Globular 1.				apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						GCTCAAGCTGCGCCTTGTACG	0.637																																																	0								C	,,,,,,,	1,4183		0,1,2091	58.0	63.0	62.0		3954,3831,3807,4284,3777,3873,3885,3873	-9.9	0.3	8		62	0,8434		0,0,4217	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	PLEC	NM_000445.3,NM_201378.2,NM_201379.1,NM_201380.2,NM_201381.1,NM_201382.2,NM_201383.1,NM_201384.1	,,,,,,,	0,1,6308	TT,TC,CC		0.0,0.0239,0.0079	,,,,,,,	1318/4575,1277/4534,1269/4526,1428/4685,1259/4516,1291/4548,1295/4552,1291/4548	145001217	1,12617	2092	4217	6309	SO:0001819	synonymous_variant	0			U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.4284G>A	8.37:g.145001217C>T			Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Silent	SNP	pfam_Plectin_repeat,pfam_CH-domain,pfam_S10_plectin_N,superfamily_CH-domain,superfamily_Chorismate_mutase_type_II,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Plectin_repeat,pfscan_CH-domain	p.A1428	ENST00000322810.4	37	c.4284	CCDS43772.1	8																																																																																			PLEC	-	smart_Spectrin/alpha-actinin	ENSG00000178209		0.637	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEC	HGNC	protein_coding	OTTHUMT00000383281.1	-	0.00	52	0	C	NM_000445		145001217	-1	tier1	-	no_errors	ENST00000322810	ensembl	human	known	74_37	silent	9.76	37	4	SNP	0.005	T
POLI	11201	genome.wustl.edu	37	18	51820113	51820113	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr18:51820113G>T	ENST00000579534.1	+	10	1642	c.1499G>T	c.(1498-1500)aGg>aTg	p.R500M	POLI_ENST00000217800.5_Missense_Mutation_p.R374M|POLI_ENST00000406285.3_Missense_Mutation_p.R421M|POLI_ENST00000579434.1_Missense_Mutation_p.R397M|POLI_ENST00000582366.1_3'UTR	NM_007195.2	NP_009126.2	Q9UNA4	POLI_HUMAN	polymerase (DNA directed) iota	500					DNA repair (GO:0006281)|DNA-dependent DNA replication (GO:0006261)	intracellular (GO:0005622)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	damaged DNA binding (GO:0003684)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)			breast(1)|endometrium(4)|kidney(2)|large_intestine(10)|lung(5)|ovary(3)|urinary_tract(1)	26				Colorectal(16;0.0234)|READ - Rectum adenocarcinoma(59;0.197)		ACAAGAACTAGGGAGTCTCCA	0.368								DNA polymerases (catalytic subunits)																																									0													22.0	23.0	23.0					18																	51820113		2202	4298	6500	SO:0001583	missense	0				CCDS11954.2	18q21.1	2012-05-18			ENSG00000101751	ENSG00000101751		"""DNA polymerases"""	9182	protein-coding gene	gene with protein product		605252		RAD3OB, RAD30B		17609217	Standard	NM_007195		Approved		uc002lfj.4	Q9UNA4	OTTHUMG00000132704	ENST00000579534.1:c.1499G>T	18.37:g.51820113G>T	ENSP00000462664:p.Arg500Met		Q8N590|Q9H0S1|Q9NYH6	Missense_Mutation	SNP	pfam_DNA_repair_prot_UmuC-like,pfam_DNA_pol_Y-fam_little_finger,superfamily_DNA_pol_Y-fam_little_finger,pfscan_DNA_repair_prot_UmuC-like_N	p.R500M	ENST00000579534.1	37	c.1499	CCDS11954.2	18	.	.	.	.	.	.	.	.	.	.	G	1.324	-0.598794	0.03744	.	.	ENSG00000101751	ENST00000406285;ENST00000217800	T	0.44482	0.92	5.17	3.34	0.38264	.	0.833891	0.11005	N	0.610119	T	0.24122	0.0584	N	0.22421	0.69	0.22896	N	0.998597	P;P	0.46457	0.85;0.878	B;B	0.37198	0.188;0.243	T	0.09707	-1.0662	10	0.46703	T	0.11	-2.2582	4.2398	0.10642	0.0864:0.1569:0.5948:0.162	.	420;500	B7Z780;Q9UNA4	.;POLI_HUMAN	M	421;500	ENSP00000385196:R421M	ENSP00000217800:R500M	R	+	2	0	POLI	50074111	0.001000	0.12720	0.336000	0.25522	0.136000	0.21042	0.213000	0.17521	0.651000	0.30788	-0.140000	0.14226	AGG	POLI	-	NULL	ENSG00000101751		0.368	POLI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POLI	HGNC	protein_coding	OTTHUMT00000256002.3		0.00	39	0	G	NM_007195		51820113	+1			no_errors	ENST00000579534	ensembl	human	known	74_37	missense	9.52	19	2	SNP	0.565	T
POT1	25913	genome.wustl.edu	37	7	124503636	124503636	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr7:124503636G>A	ENST00000357628.3	-	8	912	c.314C>T	c.(313-315)aCg>aTg	p.T105M	POT1_ENST00000393329.1_De_novo_Start_InFrame	NM_015450.2	NP_056265.2	Q9NUX5	POTE1_HUMAN	protection of telomeres 1	105					DNA duplex unwinding (GO:0032508)|negative regulation of telomerase activity (GO:0051974)|negative regulation of telomere maintenance via telomerase (GO:0032211)|positive regulation of DNA strand elongation (GO:0060383)|positive regulation of helicase activity (GO:0051096)|positive regulation of telomerase activity (GO:0051973)|positive regulation of telomere maintenance via telomerase (GO:0032212)|telomere capping (GO:0016233)|telomere formation via telomerase (GO:0032203)|telomere maintenance (GO:0000723)|telomere maintenance via telomerase (GO:0007004)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|nuclear telomere cap complex (GO:0000783)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DEAD/H-box RNA helicase binding (GO:0017151)|single-stranded telomeric DNA binding (GO:0043047)|telomerase inhibitor activity (GO:0010521)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(4)|liver(1)|lung(23)|ovary(1)|prostate(1)|skin(3)|stomach(1)|urinary_tract(1)	47						TCCCTCAAACGTCAAAGATGC	0.398																																					Esophageal Squamous(149;1032 1141 16047 36610 40540 42429 44687 51642)												0													116.0	112.0	113.0					7																	124503636		2203	4299	6502	SO:0001583	missense	0			AK022580	CCDS5793.1	7q31.33	2013-01-21	2013-01-21		ENSG00000128513	ENSG00000128513			17284	protein-coding gene	gene with protein product		606478	"""protection of telomeres 1 homolog (S. pombe)"""			11349150, 12391173	Standard	NR_003102		Approved	hPot1, DKFZp586D211	uc003vlm.3	Q9NUX5	OTTHUMG00000157194	ENST00000357628.3:c.314C>T	7.37:g.124503636G>A	ENSP00000350249:p.Thr105Met		O95018|Q5MJ36|Q9H662|Q9NW19|Q9UG95	Missense_Mutation	SNP	pfam_Telomer_end-bd_POT1/Cdc13,superfamily_NA-bd_OB-fold,smart_Telomer_end-bd_POT1/Cdc13	p.T105M	ENST00000357628.3	37	c.314	CCDS5793.1	7	.	.	.	.	.	.	.	.	.	.	G	19.90	3.912248	0.72983	.	.	ENSG00000128513	ENST00000357628;ENST00000451720;ENST00000440969;ENST00000393326;ENST00000265391	T	0.47869	0.83	5.44	5.44	0.79542	Nucleic acid-binding, OB-fold-like (1);Telomere end binding protein (2);Nucleic acid-binding, OB-fold (1);	0.161807	0.53938	D	0.000044	T	0.60753	0.2293	L	0.50333	1.59	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.58775	-0.7577	10	0.42905	T	0.14	.	11.6996	0.51562	0.0804:0.0:0.9196:0.0	.	105	Q9NUX5	POTE1_HUMAN	M	105;105;105;105;104	ENSP00000350249:T105M	ENSP00000265391:T104M	T	-	2	0	POT1	124290872	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	4.798000	0.62510	2.543000	0.85770	0.650000	0.86243	ACG	POT1	-	pfam_Telomer_end-bd_POT1/Cdc13,superfamily_NA-bd_OB-fold,smart_Telomer_end-bd_POT1/Cdc13	ENSG00000128513		0.398	POT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POT1	HGNC	protein_coding	OTTHUMT00000347861.1		0.00	25	0	G			124503636	-1			no_errors	ENST00000357628	ensembl	human	known	74_37	missense	6.67	28	2	SNP	1.000	A
POU5F1B	5462	genome.wustl.edu	37	8	128428446	128428446	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr8:128428446C>T	ENST00000465342.2	+	2	1492	c.335C>T	c.(334-336)cCg>cTg	p.P112L	CASC8_ENST00000502082.1_RNA|CASC8_ENST00000523825.1_RNA|POU5F1B_ENST00000391675.1_Missense_Mutation_p.P112L|CASC8_ENST00000501396.1_RNA			Q06416	P5F1B_HUMAN	POU class 5 homeobox 1B	112					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			lung(1)|prostate(1)|urinary_tract(1)	3						GGGGCCTCCCCGGAACCCTGC	0.612																																																	0													7.0	7.0	7.0					8																	128428446		691	1585	2276	SO:0001583	missense	0			AF268615	CCDS55274.1	8q24.21	2011-06-20	2009-04-15	2009-04-15	ENSG00000212993	ENSG00000212993		"""Homeoboxes / POU class"""	9223	protein-coding gene	gene with protein product		615739	"""POU domain class 5, transcription factor 1 pseudogene 1"", ""POU class 5 homeobox 1 pseudogene 1"""	OTF3P1, POU5F1P1		1408763	Standard	NM_001159542		Approved	OTF3C	uc003ysf.3	Q06416	OTTHUMG00000157807	ENST00000465342.2:c.335C>T	8.37:g.128428446C>T	ENSP00000419298:p.Pro112Leu		D5K9S4|D5K9S9|D5K9T0|D5K9T1|D5K9T3|D5K9U3|D5K9U6|D5K9V4|D5K9V6|D5K9W0|D5K9W2|D5K9W7|D5K9X2|D5K9X3|D5K9X5|D5K9X8|D5K9X9|E9LRB1|E9LRB2|E9LRH5|E9LRH6|E9LRH7|E9LRK4|E9LRK5|E9LRK7|E9LRK8|E9LRM7|E9LRM9|E9LRN2|E9LRN4|E9LRN5|E9LRP8|E9LRQ0|E9LRQ2|E9LRQ3|E9LRQ4|E9LRQ5|E9LRS3|Q2VIK6|Q9BZV7|Q9BZV9	Missense_Mutation	SNP	pfam_POU_specific,pfam_Homeobox_dom,superfamily_Lambda_DNA-bd_dom,superfamily_Homeodomain-like,smart_POU_specific,smart_Homeobox_dom,pfscan_Homeobox_dom,pfscan_POU_specific,prints_POU	p.P112L	ENST00000465342.2	37	c.335	CCDS55274.1	8	.	.	.	.	.	.	.	.	.	.	C	8.716	0.913210	0.17907	.	.	ENSG00000212993	ENST00000465342;ENST00000391675	T;T	0.23147	1.92;1.92	1.43	0.362	0.16113	.	0.000000	0.40385	N	0.001114	T	0.16041	0.0386	L	0.38531	1.155	0.09310	N	1	B	0.25105	0.118	B	0.21546	0.035	T	0.14615	-1.0466	10	0.37606	T	0.19	.	6.4495	0.21896	0.2899:0.7101:0.0:0.0	.	112	Q06416	P5F1B_HUMAN	L	112	ENSP00000419298:P112L;ENSP00000375557:P112L	ENSP00000375557:P112L	P	+	2	0	POU5F1B	128497628	0.096000	0.21769	0.001000	0.08648	0.112000	0.19704	1.902000	0.39848	0.116000	0.18110	0.121000	0.15741	CCG	POU5F1B	-	NULL	ENSG00000212993		0.612	POU5F1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POU5F1B	HGNC	protein_coding	OTTHUMT00000349649.2	-	0.00	113	0	C	NM_001159542		128428446	+1	tier1	-	no_errors	ENST00000391675	ensembl	human	known	74_37	missense	37.61	73	44	SNP	0.094	T
PPFIA2	8499	genome.wustl.edu	37	12	81741361	81741361	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr12:81741361G>A	ENST00000549396.1	-	18	2343	c.2183C>T	c.(2182-2184)aCc>aTc	p.T728I	PPFIA2_ENST00000550359.2_Missense_Mutation_p.T575I|PPFIA2_ENST00000541017.1_Intron|PPFIA2_ENST00000550584.2_Missense_Mutation_p.T728I|PPFIA2_ENST00000552948.1_Missense_Mutation_p.T728I|PPFIA2_ENST00000541570.2_Missense_Mutation_p.T295I|PPFIA2_ENST00000549325.1_Missense_Mutation_p.T710I|PPFIA2_ENST00000443686.3_Missense_Mutation_p.T629I|PPFIA2_ENST00000407050.4_Missense_Mutation_p.T654I|PPFIA2_ENST00000545296.2_Intron|PPFIA2_ENST00000548586.1_Missense_Mutation_p.T728I|PPFIA2_ENST00000333447.7_Missense_Mutation_p.T710I	NM_001220476.1|NM_001282536.1|NM_003625.3	NP_001207405.1|NP_001269465.1|NP_003616.2	O75334	LIPA2_HUMAN	protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 2	728					cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|presynaptic active zone (GO:0048786)				NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(15)|lung(37)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(5)	85						GCTTCGAGGGGTGAGCTTTGG	0.532																																																	0													148.0	152.0	151.0					12																	81741361		1999	4158	6157	SO:0001583	missense	0			AF034799	CCDS55850.1, CCDS55851.1, CCDS55852.1, CCDS55853.1, CCDS55854.1, CCDS55855.1, CCDS55856.1, CCDS55857.1, CCDS59236.1, CCDS73503.1	12q21.31	2013-01-10						"""Sterile alpha motif (SAM) domain containing"""	9246	protein-coding gene	gene with protein product	"""Liprin-alpha2"""	603143				9624153	Standard	NM_003625		Approved		uc031qis.1	O75334		ENST00000549396.1:c.2183C>T	12.37:g.81741361G>A	ENSP00000450337:p.Thr728Ile		B3KVT5|B3KXA0|B7Z2A6|B7Z3U9|B7Z663|B7ZKZ5|E7ERB8|E7ETG6|F8VP68|Q2M3G8	Missense_Mutation	SNP	pfam_SAM_type1,pfam_SAM_2,superfamily_SAM/pointed,smart_SAM,pfscan_SAM	p.T728I	ENST00000549396.1	37	c.2183	CCDS55857.1	12	.	.	.	.	.	.	.	.	.	.	G	16.52	3.147132	0.57151	.	.	ENSG00000139220	ENST00000549396;ENST00000549325;ENST00000541570;ENST00000407050;ENST00000541501;ENST00000333447;ENST00000548586;ENST00000443686;ENST00000552948	T;T;T;T;T;T;T;T	0.42513	0.97;0.97;0.97;0.97;0.97;0.97;0.97;0.97	5.51	5.51	0.81932	.	0.119358	0.56097	D	0.000022	T	0.37210	0.0995	L	0.35487	1.065	0.80722	D	1	P	0.42039	0.769	B	0.41299	0.353	T	0.04885	-1.0920	10	0.18710	T	0.47	-14.8185	19.7929	0.96466	0.0:0.0:1.0:0.0	.	728	O75334	LIPA2_HUMAN	I	728;710;295;654;739;710;728;629;728	ENSP00000450337:T728I;ENSP00000450298:T710I;ENSP00000438337:T295I;ENSP00000385093:T654I;ENSP00000327416:T710I;ENSP00000449338:T728I;ENSP00000388373:T629I;ENSP00000447868:T728I	ENSP00000327416:T710I	T	-	2	0	PPFIA2	80265492	1.000000	0.71417	0.999000	0.59377	0.988000	0.76386	4.483000	0.60264	2.741000	0.93983	0.650000	0.86243	ACC	PPFIA2	-	NULL	ENSG00000139220		0.532	PPFIA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PPFIA2	HGNC	protein_coding	OTTHUMT00000408030.1	-	0.00	74	0	G			81741361	-1	tier1	-	no_errors	ENST00000549396	ensembl	human	known	74_37	missense	10.42	43	5	SNP	1.000	A
PPP1R12B	4660	genome.wustl.edu	37	1	202407189	202407190	+	Intron	INS	-	-	T			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr1:202407189_202407190insT	ENST00000608999.1	+	10	1611				RP11-175B9.2_ENST00000602961.1_RNA|PPP1R12B_ENST00000336894.4_Intron|PPP1R12B_ENST00000480184.1_Frame_Shift_Ins_p.V499fs|PPP1R12B_ENST00000356764.2_3'UTR	NM_001197131.1|NM_002481.3	NP_001184060.1|NP_002472.2	O60237	MYPT2_HUMAN	protein phosphatase 1, regulatory subunit 12B						G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|positive regulation of catalytic activity (GO:0043085)|regulation of muscle contraction (GO:0006937)|signal transduction (GO:0007165)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	enzyme activator activity (GO:0008047)			central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(7)|lung(17)|ovary(4)|skin(3)|urinary_tract(1)	41			BRCA - Breast invasive adenocarcinoma(75;0.166)			TTCCAAGGCAGTTTTTTTTTTC	0.391																																																	0																																										SO:0001627	intron_variant	0			AB003062	CCDS1426.1, CCDS44294.1, CCDS44295.1, CCDS53458.1, CCDS53459.1, CCDS73005.1	1q32.1	2013-01-10	2011-10-04	2001-08-10	ENSG00000077157	ENSG00000077157		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ankyrin repeat domain containing"""	7619	protein-coding gene	gene with protein product	"""myosin phosphatase regulatory subunit"", ""myosin phosphatase, target subunit 2"""	603768	"""protein phosphatase 1, regulatory (inhibitor) subunit 12B"""	MYPT2		9570949	Standard	NM_002481		Approved	MGC87886, MGC131980, PP1bp55	uc001gya.2	O60237	OTTHUMG00000041393	ENST00000608999.1:c.1458+37->T	1.37:g.202407199_202407199dupT			A8MYF5|B7ZMN6|Q2TAI8|Q5T506|Q5VUK2|Q8N179|Q9HCB7|Q9HCB8	Frame_Shift_Ins	INS	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.F503fs	ENST00000608999.1	37	c.1495_1496	CCDS1426.1	1																																																																																			PPP1R12B	-	NULL	ENSG00000077157		0.391	PPP1R12B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PPP1R12B	HGNC	protein_coding	OTTHUMT00000099166.3		0.00	31	0	-	NM_032105		202407190	+1	tier1		no_errors	ENST00000480184	ensembl	human	novel	74_37	frame_shift_ins	14.29	30	5	INS	0.085:0.041	T
PPP1R14C	81706	genome.wustl.edu	37	6	150569908	150569908	+	Silent	SNP	G	G	A			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr6:150569908G>A	ENST00000361131.4	+	4	567	c.450G>A	c.(448-450)cgG>cgA	p.R150R		NM_030949.2	NP_112211.1	Q8TAE6	PP14C_HUMAN	protein phosphatase 1, regulatory (inhibitor) subunit 14C	150					regulation of phosphorylation (GO:0042325)	cytoplasm (GO:0005737)|membrane (GO:0016020)	protein serine/threonine phosphatase inhibitor activity (GO:0004865)			endometrium(1)|large_intestine(1)|prostate(1)	3		Ovarian(120;0.0284)	BRCA - Breast invasive adenocarcinoma(37;0.215)	OV - Ovarian serous cystadenocarcinoma(155;9.14e-12)		TGCTTTCTCGGATAAGAGGCA	0.393																																					Melanoma(165;1879 1941 2052 16588 48349)												0													62.0	63.0	63.0					6																	150569908		2203	4300	6503	SO:0001819	synonymous_variant	0			AF308297	CCDS5226.1	6q24.3-q25.3	2012-04-17			ENSG00000198729	ENSG00000198729		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14952	protein-coding gene	gene with protein product	"""kinase C-enhanced PP1 inhibitor"""	613242				11948623	Standard	NM_030949		Approved	CPI17-like, NY-BR-81, KEPI	uc003qnt.3	Q8TAE6	OTTHUMG00000015818	ENST00000361131.4:c.450G>A	6.37:g.150569908G>A			Q5VY83|Q96BB1|Q9H277	Silent	SNP	pfam_PP1_inhibitor,superfamily_PP1_inhibitor	p.R150	ENST00000361131.4	37	c.450	CCDS5226.1	6																																																																																			PPP1R14C	-	pfam_PP1_inhibitor,superfamily_PP1_inhibitor	ENSG00000198729		0.393	PPP1R14C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1R14C	HGNC	protein_coding	OTTHUMT00000042685.1	-	0.00	98	0	G	NM_030949		150569908	+1	tier1	-	no_errors	ENST00000361131	ensembl	human	known	74_37	silent	43.82	50	39	SNP	1.000	A
PPP2R5C	5527	genome.wustl.edu	37	14	102378766	102378766	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr14:102378766G>A	ENST00000334743.5	+	12	1330	c.1282G>A	c.(1282-1284)Gaa>Aaa	p.E428K	PPP2R5C_ENST00000445439.3_Missense_Mutation_p.E428K|PPP2R5C_ENST00000350249.3_Missense_Mutation_p.E428K|PPP2R5C_ENST00000328724.5_Missense_Mutation_p.E483K|PPP2R5C_ENST00000422945.2_Missense_Mutation_p.E459K	NM_002719.3	NP_002710.2	Q13362	2A5G_HUMAN	protein phosphatase 2, regulatory subunit B', gamma	428					DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|negative regulation of cell proliferation (GO:0008285)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|regulation of catalytic activity (GO:0050790)|signal transduction (GO:0007165)	chromosome, centromeric region (GO:0000775)|nucleus (GO:0005634)|protein phosphatase type 2A complex (GO:0000159)	protein phosphatase type 2A regulator activity (GO:0008601)			breast(2)|endometrium(2)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	20						AGAACGGGAAGAAGCATGGGT	0.373																																																	0													82.0	84.0	83.0					14																	102378766		2203	4300	6503	SO:0001583	missense	0			L42375	CCDS9964.1, CCDS9965.1, CCDS45163.1, CCDS53911.1, CCDS53912.1	14q32.31	2010-06-18	2010-04-14		ENSG00000078304	ENSG00000078304		"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"""	9311	protein-coding gene	gene with protein product		601645	"""protein phosphatase 2, regulatory subunit B (B56), gamma isoform"", ""protein phosphatase 2, regulatory subunit B', gamma isoform"""			7592815	Standard	NM_002719		Approved	B56G, PR61G	uc001ykk.3	Q13362		ENST00000334743.5:c.1282G>A	14.37:g.102378766G>A	ENSP00000333905:p.Glu428Lys		B4DYJ8|B5BUA5|F5GWP3|Q14391|Q15060|Q15174|Q6ZN33	Missense_Mutation	SNP	pfam_PP2A_B56,superfamily_ARM-type_fold,pirsf_PP2A_B56	p.E459K	ENST00000334743.5	37	c.1375	CCDS9964.1	14	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	36|36	5.598510|5.598510	0.96614|0.96614	.|.	.|.	ENSG00000078304|ENSG00000078304	ENST00000422945;ENST00000328724;ENST00000557268;ENST00000350249;ENST00000445439;ENST00000334743|ENST00000557716	T;T;T;T;T|.	0.48201|.	0.84;0.82;0.84;0.86;0.84|.	5.58|5.58	5.58|5.58	0.84498|0.84498	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.82549|0.82549	0.5061|0.5061	M|M	0.83312|0.83312	2.635|2.635	0.80722|0.80722	D|D	1|1	B;B;B;B;B|.	0.27594|.	0.151;0.073;0.182;0.002;0.02|.	B;B;B;B;B|.	0.30495|.	0.07;0.02;0.116;0.005;0.034|.	T|T	0.83247|0.83247	-0.0055|-0.0055	10|5	0.49607|.	T|.	0.09|.	-20.9826|-20.9826	19.5825|19.5825	0.95473|0.95473	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	459;428;428;428;483|.	F5GWP3;Q13362-3;Q13362;Q13362-2;Q6ZN33|.	.;.;2A5G_HUMAN;.;.|.	K|K	459;483;457;428;428;428|147	ENSP00000412324:E459K;ENSP00000329009:E483K;ENSP00000450931:E457K;ENSP00000262239:E428K;ENSP00000333905:E428K|.	ENSP00000329009:E483K|.	E|R	+|+	1|2	0|0	PPP2R5C|PPP2R5C	101448519|101448519	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.993000|0.993000	0.82548|0.82548	9.684000|9.684000	0.98659|0.98659	2.624000|2.624000	0.88883|0.88883	0.655000|0.655000	0.94253|0.94253	GAA|AGA	PPP2R5C	-	pfam_PP2A_B56,pirsf_PP2A_B56	ENSG00000078304		0.373	PPP2R5C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP2R5C	HGNC	protein_coding	OTTHUMT00000414373.2	-	0.00	50	0	G	NM_002719		102378766	+1	tier1	-	no_errors	ENST00000422945	ensembl	human	known	74_37	missense	42.42	19	14	SNP	1.000	A
PRG4	10216	genome.wustl.edu	37	1	186277487	186277487	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr1:186277487A>G	ENST00000445192.2	+	7	2681	c.2636A>G	c.(2635-2637)gAg>gGg	p.E879G	PRG4_ENST00000367483.4_Missense_Mutation_p.E838G|PRG4_ENST00000367485.4_Missense_Mutation_p.E786G|PRG4_ENST00000367484.3_Missense_Mutation_p.E408G|PRG4_ENST00000367486.3_Missense_Mutation_p.E836G	NM_005807.3	NP_005798.2	Q92954	PRG4_HUMAN	proteoglycan 4	879					cell proliferation (GO:0008283)|hematopoietic stem cell proliferation (GO:0071425)|immune response (GO:0006955)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|regulation of cell proliferation (GO:0042127)	extracellular space (GO:0005615)	polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(33)|prostate(7)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(1)	102						TCAACTCCTGAGCTTTCTGCA	0.488																																																	0													148.0	152.0	150.0					1																	186277487		2203	4300	6503	SO:0001583	missense	0			U70136	CCDS1369.1, CCDS44287.1, CCDS44288.1	1q25-q31	2008-07-18	2004-11-15		ENSG00000116690	ENSG00000116690			9364	protein-coding gene	gene with protein product	"""lubricin"", ""megakaryocyte stimulating factor"", ""articular superficial zone protein"", ""Jacobs camptodactyly-arthropathy-pericarditis syndrome"", ""camptodactyly, arthropathy, coxa vara, pericarditis syndrome"", ""bG174L6.2 (MSF: megakaryocyte stimulating factor )"""	604283	"""proteoglycan 4, (megakaryocyte stimulating factor, articular superficial zone protein, camptodactyly, arthropathy, coxa vara, pericarditis syndrome)"""	CACP		10545950, 9920774	Standard	NM_005807		Approved	JCAP, SZP, MSF, HAPO, bG174L6.2, FLJ32635	uc001gru.4	Q92954	OTTHUMG00000035574	ENST00000445192.2:c.2636A>G	1.37:g.186277487A>G	ENSP00000399679:p.Glu879Gly		Q6DNC4|Q6DNC5|Q6ZMZ5|Q9BX49	Missense_Mutation	SNP	pfam_Somatomedin_B_dom,pfam_Hemopexin-like_repeat,superfamily_Hemopexin-like_dom,smart_Somatomedin_B_dom,smart_Hemopexin-like_repeat,prints_Somatomedin_B_chordata,pfscan_Somatomedin_B_dom	p.E879G	ENST00000445192.2	37	c.2636	CCDS1369.1	1	.	.	.	.	.	.	.	.	.	.	A	9.068	0.996195	0.19043	.	.	ENSG00000116690	ENST00000367486;ENST00000367484;ENST00000367482;ENST00000367483;ENST00000367485;ENST00000445192	T;T;T;T;T	0.05717	3.41;3.47;3.51;3.4;3.53	2.76	1.4	0.22301	.	1.401760	0.05748	U	0.602533	T	0.03390	0.0098	N	0.08118	0	0.09310	N	1	P;P;B;P	0.36535	0.557;0.557;0.421;0.557	B;B;B;B	0.32864	0.154;0.154;0.055;0.154	T	0.40421	-0.9564	10	0.24483	T	0.36	-2.1005	7.2537	0.26164	0.7746:0.2254:0.0:0.0	.	745;786;879;838	Q92954-4;Q92954-3;Q92954;Q92954-2	.;.;PRG4_HUMAN;.	G	836;408;745;838;786;879	ENSP00000356456:E836G;ENSP00000356454:E408G;ENSP00000356453:E838G;ENSP00000356455:E786G;ENSP00000399679:E879G	ENSP00000356452:E745G	E	+	2	0	PRG4	184544110	0.000000	0.05858	0.039000	0.18376	0.395000	0.30598	1.075000	0.30716	1.055000	0.40461	0.338000	0.21704	GAG	PRG4	-	NULL	ENSG00000116690		0.488	PRG4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PRG4	HGNC	protein_coding	OTTHUMT00000086346.1	-	0.00	76	0	A	NM_005807		186277487	+1	tier1	-	no_errors	ENST00000445192	ensembl	human	known	74_37	missense	37.33	47	28	SNP	0.003	G
PRR5L	79899	genome.wustl.edu	37	11	36440811	36440811	+	Silent	SNP	G	G	A			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr11:36440811G>A	ENST00000378867.3	+	5	607	c.252G>A	c.(250-252)ctG>ctA	p.L84L	PRR5L_ENST00000389693.3_3'UTR|PRR5L_ENST00000311599.5_Silent_p.L58L|PRR5L_ENST00000530639.1_Silent_p.L84L|PRR5L_ENST00000527487.1_Silent_p.L84L	NM_024841.4	NP_079117.3	Q6MZQ0	PRR5L_HUMAN	proline rich 5 like	84					negative regulation of protein phosphorylation (GO:0001933)|negative regulation of signal transduction (GO:0009968)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein phosphorylation (GO:0001934)|regulation of fibroblast migration (GO:0010762)|TORC2 signaling (GO:0038203)	mitochondrion (GO:0005739)|TORC2 complex (GO:0031932)	ubiquitin protein ligase binding (GO:0031625)			breast(1)|cervix(1)|endometrium(4)|large_intestine(5)|lung(7)|ovary(1)	19						CCAGGCGGCTGTTGAAGAGTG	0.512																																																	0													203.0	177.0	186.0					11																	36440811		2202	4298	6500	SO:0001819	synonymous_variant	0				CCDS31463.1, CCDS53617.1	11p13-p12	2009-07-09				ENSG00000135362			25878	protein-coding gene	gene with protein product	"""protein observed with Rictor-2"""	611728				17461779	Standard	NM_024841		Approved	FLJ14213, PROTOR-2	uc001mwp.3	Q6MZQ0		ENST00000378867.3:c.252G>A	11.37:g.36440811G>A			A4QN22|E9PKY1|Q96H46|Q9H7V4	Silent	SNP	pfam_HbrB	p.L84	ENST00000378867.3	37	c.252	CCDS31463.1	11																																																																																			PRR5L	-	pfam_HbrB	ENSG00000135362		0.512	PRR5L-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PRR5L	HGNC	protein_coding	OTTHUMT00000389209.1	-	0.00	91	0	G	NM_024841		36440811	+1	tier1	-	no_errors	ENST00000378867	ensembl	human	known	74_37	silent	6.06	62	4	SNP	1.000	A
PRSS8	5652	genome.wustl.edu	37	16	31143758	31143758	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr16:31143758C>T	ENST00000317508.6	-	5	960	c.697G>A	c.(697-699)Gcc>Acc	p.A233T	PRSS8_ENST00000568261.1_Missense_Mutation_p.A179T|RP11-388M20.2_ENST00000563605.1_RNA	NM_002773.3	NP_002764.1	Q16651	PRSS8_HUMAN	protease, serine, 8	233	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				positive regulation of sodium ion transport (GO:0010765)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(2)|skin(1)|upper_aerodigestive_tract(1)	8						ACCTGGCAGGCGTCCTTGCCC	0.612																																																	0													89.0	95.0	93.0					16																	31143758		2101	4219	6320	SO:0001583	missense	0			U33446	CCDS45469.1	16p11.2	2010-05-07	2007-02-21			ENSG00000052344		"""Serine peptidases / Serine peptidases"""	9491	protein-coding gene	gene with protein product	"""prostasin"""	600823				8838796, 7768952	Standard	NM_002773		Approved		uc002ebc.4	Q16651		ENST00000317508.6:c.697G>A	16.37:g.31143758C>T	ENSP00000319730:p.Ala233Thr		B4DWP2|Q9UCA3	Missense_Mutation	SNP	pfam_Peptidase_S1,pfam_Peptidase_S1A_nudel,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1,prints_Peptidase_S1A	p.A233T	ENST00000317508.6	37	c.697	CCDS45469.1	16	.	.	.	.	.	.	.	.	.	.	C	27.3	4.816958	0.90790	.	.	ENSG00000052344	ENST00000317508	D	0.92965	-3.14	5.44	4.48	0.54585	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.000000	0.56097	D	0.000021	D	0.91529	0.7325	N	0.16016	0.355	0.49915	D	0.999835	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	D	0.91301	0.5067	10	0.37606	T	0.19	.	14.4427	0.67327	0.1488:0.8512:0.0:0.0	.	179;233	B4DWP2;Q16651	.;PRSS8_HUMAN	T	233	ENSP00000319730:A233T	ENSP00000319730:A233T	A	-	1	0	PRSS8	31051259	0.978000	0.34361	0.998000	0.56505	0.959000	0.62525	1.541000	0.36126	1.270000	0.44297	0.561000	0.74099	GCC	PRSS8	-	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1,prints_Peptidase_S1A	ENSG00000052344		0.612	PRSS8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRSS8	HGNC	protein_coding	OTTHUMT00000433536.1	-	0.00	49	0	C	NM_002773		31143758	-1	tier1	-	no_errors	ENST00000317508	ensembl	human	known	74_37	missense	9.30	39	4	SNP	1.000	T
PTGER4	5734	genome.wustl.edu	37	5	40681181	40681182	+	Missense_Mutation	DNP	TC	TC	GA			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	T|C	T|C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr5:40681181_40681182TC>GA	ENST00000302472.3	+	2	1110_1111	c.86_87TC>GA	c.(85-87)aTC>aGA	p.I29R	PTGER4_ENST00000514343.1_3'UTR	NM_000958.2	NP_000949.1	P35408	PE2R4_HUMAN	prostaglandin E receptor 4 (subtype EP4)	29					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|bone development (GO:0060348)|cellular response to mechanical stimulus (GO:0071260)|ERK1 and ERK2 cascade (GO:0070371)|immune response (GO:0006955)|JNK cascade (GO:0007254)|negative regulation of cytokine secretion (GO:0050710)|negative regulation of eosinophil extravasation (GO:2000420)|negative regulation of inflammatory response (GO:0050728)|negative regulation of integrin activation (GO:0033624)|positive regulation of cytokine secretion (GO:0050715)|positive regulation of inflammatory response (GO:0050729)|regulation of ossification (GO:0030278)|regulation of stress fiber assembly (GO:0051492)|response to lipopolysaccharide (GO:0032496)|response to mechanical stimulus (GO:0009612)|T-helper cell differentiation (GO:0042093)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	prostaglandin E receptor activity (GO:0004957)			breast(1)|endometrium(3)|liver(1)|lung(13)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	23					Dinoprostone(DB00917)|Misoprostol(DB00929)	GTGATGTTCATCTTCGGGGTGG	0.629											OREG0016588	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0																																										SO:0001583	missense	0			L28175	CCDS3930.1	5p13.1	2012-08-08			ENSG00000171522	ENSG00000171522		"""GPCR / Class A : Prostanoid receptors"""	9596	protein-coding gene	gene with protein product		601586				7759114, 8661119	Standard	NM_000958		Approved	EP4	uc003jlz.3	P35408	OTTHUMG00000094769	Exception_encountered	5.37:g.40681181_40681182delinsGA	ENSP00000302846:p.Ile29Arg	895	Q3MJ87	Missense_Mutation|Silent	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_7TM,prints_Prost_EP4_rcpt,prints_Prostanoid_rcpt,prints_GPCR_Rhodpsn,prints_Prostglndn_DP_rcpt	p.I29S|p.I29	ENST00000302472.3	37	c.86|c.87	CCDS3930.1	5																																																																																			PTGER4	-	pfam_7TM_GPCR_serpentine_rcpt_Srx,prints_GPCR_Rhodpsn,prints_Prostglndn_DP_rcpt	ENSG00000171522		0.629	PTGER4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTGER4	HGNC	protein_coding	OTTHUMT00000211578.2	-	0.00	58|57	0	T|C	NM_000958		40681181|40681182	+1	tier1	-	no_errors	ENST00000302472	ensembl	human	known	74_37	missense|silent	34.00	33	17	SNP	1.000	G|A
PTPRVP	148713	genome.wustl.edu	37	1	202158378	202158378	+	RNA	SNP	A	A	T			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr1:202158378A>T	ENST00000482597.1	+	0	3896					NR_002930.2				protein tyrosine phosphatase, receptor type, V, pseudogene																		ATCTACCTCTACAATTGTCTG	0.577																																																	0																																												0			AJ629456		1q32.1	2013-09-26	2010-03-16	2010-03-16	ENSG00000243323	ENSG00000243323		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"""	13421	pseudogene	pseudogene				PTPRV		15358244	Standard	NR_002930		Approved	OST-PTP, ESP	uc009xaa.2		OTTHUMG00000040524		1.37:g.202158378A>T				RNA	SNP	-	NULL	ENST00000482597.1	37	NULL		1																																																																																			PTPRVP	-	-	ENSG00000243323		0.577	PTPRVP-003	KNOWN	basic	processed_transcript	PTPRVP	HGNC	pseudogene	OTTHUMT00000334021.1	-	0.00	71	0	A	XM_086287		202158378	+1	tier1	-	no_errors	ENST00000482597	ensembl	human	known	74_37	rna	6.90	54	4	SNP	0.958	T
RALGDS	5900	genome.wustl.edu	37	9	135975619	135975619	+	Intron	SNP	C	C	T			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr9:135975619C>T	ENST00000372050.3	-	17	2591				RALGDS_ENST00000393157.3_Intron|RALGDS_ENST00000469972.1_5'UTR|RALGDS_ENST00000542690.1_Intron|RALGDS_ENST00000372062.3_Intron|RALGDS_ENST00000372047.3_Intron|RALGDS_ENST00000393160.3_Intron	NM_006266.2	NP_006257.1	Q12967	GNDS_HUMAN	ral guanine nucleotide dissociation stimulator						neurotrophin TRK receptor signaling pathway (GO:0048011)|Ras protein signal transduction (GO:0007265)|regulation of catalytic activity (GO:0050790)|regulation of small GTPase mediated signal transduction (GO:0051056)	cytosol (GO:0005829)	guanyl-nucleotide exchange factor activity (GO:0005085)|small GTPase regulator activity (GO:0005083)			endometrium(1)|large_intestine(4)|lung(2)|ovary(1)|upper_aerodigestive_tract(2)	10				OV - Ovarian serous cystadenocarcinoma(145;3.66e-06)|Epithelial(140;2.77e-05)		TGTGGACCTGCCCCCTCTGCC	0.597			T	CIITA	"""PMBL, Hodgkin Lymphona, """																																Melanoma(189;762 2088 15384 21931 52515)			Dom	yes		9	9q34.3	5900	ral guanine nucleotide dissociation stimulator		L	0													135.0	134.0	134.0					9																	135975619		2203	4300	6503	SO:0001627	intron_variant	0			AB037729	CCDS6959.1, CCDS43897.1, CCDS65172.1, CCDS65173.1, CCDS65174.1	9q34.3	2009-04-08			ENSG00000160271	ENSG00000160271			9842	protein-coding gene	gene with protein product		601619				7972015	Standard	NM_006266		Approved	RGF, RalGEF, RGDS	uc004ccr.3	Q12967	OTTHUMG00000020858	ENST00000372050.3:c.2569+35G>A	9.37:g.135975619C>T			B7Z753|E7ER93|E7ERZ0|Q5T7V4|Q6KH11|Q6PCE1|Q6ZSD5|Q9HAX7|Q9HAY1|Q9HCT1|Q9P2N8	RNA	SNP	-	NULL	ENST00000372050.3	37	NULL	CCDS6959.1	9																																																																																			RALGDS	-	-	ENSG00000160271		0.597	RALGDS-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RALGDS	HGNC	protein_coding	OTTHUMT00000054837.1	-	0.00	66	0	C	NM_006266		135975619	-1	tier1	-	no_errors	ENST00000469972	ensembl	human	known	74_37	rna	50.00	20	20	SNP	0.000	T
RAP2A	5911	genome.wustl.edu	37	13	98116495	98116495	+	Missense_Mutation	SNP	A	A	T			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr13:98116495A>T	ENST00000245304.4	+	2	600	c.351A>T	c.(349-351)aaA>aaT	p.K117N		NM_021033.6	NP_066361.1	P10114	RAP2A_HUMAN	RAP2A, member of RAS oncogene family	117					actin cytoskeleton reorganization (GO:0031532)|cellular protein localization (GO:0034613)|establishment of protein localization (GO:0045184)|negative regulation of cell migration (GO:0030336)|positive regulation of protein autophosphorylation (GO:0031954)|Rap protein signal transduction (GO:0032486)|regulation of dendrite morphogenesis (GO:0048814)|regulation of JNK cascade (GO:0046328)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|recycling endosome (GO:0055037)|recycling endosome membrane (GO:0055038)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(2)	5	all_neural(89;0.0982)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)		BRCA - Breast invasive adenocarcinoma(86;0.166)			TTGGGAACAAAGTGGACCTGG	0.448																																																	0													103.0	104.0	103.0					13																	98116495		2203	4300	6503	SO:0001583	missense	0			AF205602	CCDS9485.1	13q34	2014-05-09			ENSG00000125249	ENSG00000125249			9861	protein-coding gene	gene with protein product		179540		RAP2			Standard	NM_021033		Approved	K-REV	uc001vnd.3	P10114	OTTHUMG00000017240	ENST00000245304.4:c.351A>T	13.37:g.98116495A>T	ENSP00000245304:p.Lys117Asn		B2RCJ1|Q5JSC1|Q5JSC2	Missense_Mutation	SNP	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_EF_GTP-bd_dom,superfamily_P-loop_NTPase,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.K117N	ENST00000245304.4	37	c.351	CCDS9485.1	13	.	.	.	.	.	.	.	.	.	.	A	18.50	3.638304	0.67130	.	.	ENSG00000125249	ENST00000245304	D	0.94650	-3.48	5.67	4.5	0.54988	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.98317	0.9442	H	0.98701	4.305	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.98047	1.0385	10	0.87932	D	0	.	11.2199	0.48848	0.9289:0.0:0.0711:0.0	.	117	P10114	RAP2A_HUMAN	N	117	ENSP00000245304:K117N	ENSP00000245304:K117N	K	+	3	2	RAP2A	96914496	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.750000	0.47500	1.010000	0.39314	0.451000	0.29950	AAA	RAP2A	-	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_EF_GTP-bd_dom,superfamily_P-loop_NTPase,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	ENSG00000125249		0.448	RAP2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAP2A	HGNC	protein_coding	OTTHUMT00000045528.4	-	0.00	23	0	A			98116495	+1	tier1	-	no_errors	ENST00000245304	ensembl	human	known	74_37	missense	28.57	15	6	SNP	1.000	T
RASGRF2	5924	genome.wustl.edu	37	5	80366374	80366374	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr5:80366374G>C	ENST00000265080.4	+	4	674	c.607G>C	c.(607-609)Gat>Cat	p.D203H	RASGRF2_ENST00000502677.1_3'UTR	NM_006909.2	NP_008840.1	O14827	RGRF2_HUMAN	Ras protein-specific guanine nucleotide-releasing factor 2	203					apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|plasma membrane (GO:0005886)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			biliary_tract(1)|breast(5)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(28)|ovary(5)|prostate(3)|skin(4)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	75		Lung NSC(167;0.00498)|all_lung(232;0.00531)|Ovarian(174;0.0357)		OV - Ovarian serous cystadenocarcinoma(54;4.22e-42)|Epithelial(54;4.04e-35)|all cancers(79;2.52e-29)		AGAAGACGAAGATCCAGACAT	0.433																																																	0													142.0	143.0	143.0					5																	80366374		2203	4300	6503	SO:0001583	missense	0			AF023130	CCDS4052.1	5q13	2013-01-10			ENSG00000113319	ENSG00000113319		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	9876	protein-coding gene	gene with protein product		606614					Standard	NM_006909		Approved	GRF2, Ras-GRF2	uc003kha.2	O14827	OTTHUMG00000119015	ENST00000265080.4:c.607G>C	5.37:g.80366374G>C	ENSP00000265080:p.Asp203His		B9EG89|Q9UK56	Missense_Mutation	SNP	pfam_RasGRF_CDC25,pfam_Ras-like_Gua-exchang_fac_N,pfam_DH-domain,pfam_Pleckstrin_homology,superfamily_Ras_GEF_dom,superfamily_DH-domain,smart_Pleckstrin_homology,smart_DH-domain,smart_Ras-like_Gua-exchang_fac_N,smart_RasGRF_CDC25,pfscan_IQ_motif_EF-hand-BS,pfscan_Pleckstrin_homology,pfscan_DH-domain,pfscan_RasGRF_CDC25,pfscan_Ras-like_Gua-exchang_fac_N	p.D203H	ENST00000265080.4	37	c.607	CCDS4052.1	5	.	.	.	.	.	.	.	.	.	.	G	28.5	4.923178	0.92319	.	.	ENSG00000113319	ENST00000265080	T	0.76578	-1.03	5.69	5.69	0.88448	.	0.044848	0.85682	D	0.000000	D	0.85470	0.5704	L	0.48642	1.525	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.72075	0.976;0.946	D	0.84857	0.0817	10	0.54805	T	0.06	.	20.181	0.98201	0.0:0.0:1.0:0.0	.	203;203	D6RAS9;O14827	.;RGRF2_HUMAN	H	203	ENSP00000265080:D203H	ENSP00000265080:D203H	D	+	1	0	RASGRF2	80402130	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.966000	0.87956	2.840000	0.97914	0.655000	0.94253	GAT	RASGRF2	-	NULL	ENSG00000113319		0.433	RASGRF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RASGRF2	HGNC	protein_coding	OTTHUMT00000239215.2	-	0.00	61	0	G	NM_006909		80366374	+1	tier1	-	no_errors	ENST00000265080	ensembl	human	known	74_37	missense	16.67	30	6	SNP	1.000	C
RBM28	55131	genome.wustl.edu	37	7	127958055	127958055	+	Silent	SNP	G	G	T			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr7:127958055G>T	ENST00000223073.2	-	15	1782	c.1668C>A	c.(1666-1668)gcC>gcA	p.A556A	RBM28_ENST00000415472.2_Silent_p.A415A|RBM28_ENST00000481788.1_Intron	NM_018077.2	NP_060547.2	Q9NW13	RBM28_HUMAN	RNA binding motif protein 28	556	RRM 4. {ECO:0000255|PROSITE- ProRule:PRU00176}.				mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleolus (GO:0005730)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|kidney(7)|large_intestine(3)|lung(8)|ovary(2)	21						TGAGGCGGAGGGCTTTCAGGG	0.542																																																	0													103.0	91.0	95.0					7																	127958055		2203	4300	6503	SO:0001819	synonymous_variant	0			AK001239	CCDS5801.1, CCDS55159.1	7q32.2	2013-02-12			ENSG00000106344	ENSG00000106344		"""RNA binding motif (RRM) containing"""	21863	protein-coding gene	gene with protein product		612074					Standard	NM_018077		Approved	FLJ10377	uc003vmp.2	Q9NW13	OTTHUMG00000157711	ENST00000223073.2:c.1668C>A	7.37:g.127958055G>T			A4D100|B4DU52|E9PDD9|Q53H65|Q96CV3	Silent	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.A556	ENST00000223073.2	37	c.1668	CCDS5801.1	7																																																																																			RBM28	-	smart_RRM_dom,pfscan_RRM_dom	ENSG00000106344		0.542	RBM28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBM28	HGNC	protein_coding	OTTHUMT00000349442.2	-	0.00	50	0	G	NM_018077		127958055	-1	tier1	-	no_errors	ENST00000223073	ensembl	human	known	74_37	silent	10.81	33	4	SNP	1.000	T
RFC1	5981	genome.wustl.edu	37	4	39329211	39329211	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr4:39329211A>G	ENST00000381897.1	-	5	630	c.497T>C	c.(496-498)cTt>cCt	p.L166P	RFC1_ENST00000418436.1_5'UTR|RFC1_ENST00000349703.2_Missense_Mutation_p.L166P	NM_001204747.1|NM_002913.4	NP_001191676.1|NP_002904.3	P35251	RFC1_HUMAN	replication factor C (activator 1) 1, 145kDa	166					DNA repair (GO:0006281)|DNA strand elongation involved in DNA replication (GO:0006271)|DNA-dependent DNA replication (GO:0006261)|mitotic cell cycle (GO:0000278)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|positive regulation of catalytic activity (GO:0043085)|positive regulation of transcription, DNA-templated (GO:0045893)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|telomere maintenance via telomerase (GO:0007004)|transcription, DNA-templated (GO:0006351)|transcription-coupled nucleotide-excision repair (GO:0006283)	cell junction (GO:0030054)|DNA replication factor C complex (GO:0005663)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA clamp loader activity (GO:0003689)|double-stranded DNA binding (GO:0003690)|enzyme activator activity (GO:0008047)|sequence-specific DNA binding (GO:0043565)			haematopoietic_and_lymphoid_tissue(2)|large_intestine(9)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	16						AAAATAATCAAGTACTGATGT	0.343																																					Colon(109;59 1555 12203 17579 39824)|Esophageal Squamous(18;360 542 16186 28570 51157)												0													150.0	137.0	141.0					4																	39329211		2203	4298	6501	SO:0001583	missense	0			L23320	CCDS3450.1, CCDS56329.1	4p14-p13	2010-04-21	2002-08-29		ENSG00000035928	ENSG00000035928		"""ATPases / AAA-type"""	9969	protein-coding gene	gene with protein product		102579	"""replication factor C (activator 1) 1 (145kD)"""			8114700	Standard	NM_002913		Approved	A1, PO-GA, RFC140, MHCBFB	uc003gty.2	P35251	OTTHUMG00000099363	ENST00000381897.1:c.497T>C	4.37:g.39329211A>G	ENSP00000371321:p.Leu166Pro		A8K6E7|Q5XKF5|Q6PKU0|Q86V41|Q86V46	Missense_Mutation	SNP	pfam_DNA_replication_fac_RFC1_C,pfam_BRCT_dom,pfam_ATPase_AAA_core,superfamily_DNA_pol3_clamp-load_cplx_C,superfamily_P-loop_NTPase,superfamily_BRCT_dom,smart_BRCT_dom,smart_AAA+_ATPase,pirsf_DNA_replication_fac_C_lsu,pfscan_BRCT_dom	p.L166P	ENST00000381897.1	37	c.497	CCDS56329.1	4	.	.	.	.	.	.	.	.	.	.	A	21.6	4.167936	0.78339	.	.	ENSG00000035928	ENST00000381897;ENST00000349703	T;T	0.32988	1.43;1.43	5.64	5.64	0.86602	.	0.367232	0.27645	N	0.018444	T	0.52789	0.1756	M	0.71581	2.175	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.70016	0.927;0.967	T	0.48055	-0.9068	10	0.30078	T	0.28	-4.1803	14.7395	0.69442	1.0:0.0:0.0:0.0	.	166;166	P35251;P35251-2	RFC1_HUMAN;.	P	166	ENSP00000371321:L166P;ENSP00000261424:L166P	ENSP00000261424:L166P	L	-	2	0	RFC1	39005606	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	5.042000	0.64202	2.278000	0.76064	0.523000	0.50628	CTT	RFC1	-	superfamily_P-loop_NTPase,pirsf_DNA_replication_fac_C_lsu	ENSG00000035928		0.343	RFC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RFC1	HGNC	protein_coding	OTTHUMT00000216808.1	-	0.00	98	0	A	NM_002913		39329211	-1	tier1	-	no_errors	ENST00000381897	ensembl	human	known	74_37	missense	25.68	55	19	SNP	1.000	G
RHAG	6005	genome.wustl.edu	37	6	49573531	49573531	+	Nonsense_Mutation	SNP	T	T	A			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr6:49573531T>A	ENST00000371175.4	-	10	1251	c.1225A>T	c.(1225-1227)Aga>Tga	p.R409*	RHAG_ENST00000229810.7_3'UTR	NM_000324.2	NP_000315.2	Q02094	RHAG_HUMAN	Rh-associated glycoprotein	409					ammonium transmembrane transport (GO:0072488)|ammonium transport (GO:0015696)|bicarbonate transport (GO:0015701)|carbon dioxide transport (GO:0015670)|cellular ion homeostasis (GO:0006873)|erythrocyte development (GO:0048821)|multicellular organismal iron ion homeostasis (GO:0060586)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ammonium transmembrane transporter activity (GO:0008519)|ankyrin binding (GO:0030506)			NS(1)|breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(24)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	39	Lung NSC(77;0.0255)					TCAAGTTATCTCGTCTTAGGG	0.383																																					Ovarian(176;476 2003 7720 43408 44749)												0													132.0	123.0	126.0					6																	49573531		2203	4300	6503	SO:0001587	stop_gained	0				CCDS4927.1	6p12.3	2014-07-19	2006-02-23		ENSG00000112077	ENSG00000112077		"""CD molecules"", ""Blood group antigens"", ""Solute carriers"""	10006	protein-coding gene	gene with protein product		180297	"""Rhesus blood group-associated glycoprotein"""			9479501	Standard	NM_000324		Approved	RH50A, CD241, SLC42A1	uc003ozk.4	Q02094	OTTHUMG00000016377	ENST00000371175.4:c.1225A>T	6.37:g.49573531T>A	ENSP00000360217:p.Arg409*		B2R8T8|O43514|O43515|Q7L8L3|Q9H454	Nonsense_Mutation	SNP	pfam_NH4_transpt_AmtB-like_dom,superfamily_NH4_transpt_AmtB-like_dom,prints_RhesusRHD	p.R409*	ENST00000371175.4	37	c.1225	CCDS4927.1	6	.	.	.	.	.	.	.	.	.	.	T	17.06	3.291941	0.59976	.	.	ENSG00000112077	ENST00000371175;ENST00000418071	.	.	.	5.44	4.12	0.48240	.	0.387141	0.30320	N	0.009897	.	.	.	.	.	.	0.20563	N	0.99989	.	.	.	.	.	.	.	.	.	.	0.39692	T	0.17	-0.2016	5.6009	0.17353	0.0:0.1488:0.0:0.8512	.	.	.	.	X	409	.	ENSP00000360217:R409X	R	-	1	2	RHAG	49681490	0.002000	0.14202	0.005000	0.12908	0.002000	0.02628	1.245000	0.32790	2.183000	0.69458	0.533000	0.62120	AGA	RHAG	-	NULL	ENSG00000112077		0.383	RHAG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RHAG	HGNC	protein_coding	OTTHUMT00000043806.1	-	0.00	53	0	T			49573531	-1	tier1	-	no_errors	ENST00000371175	ensembl	human	known	74_37	nonsense	6.90	54	4	SNP	0.004	A
RMDN2	151393	genome.wustl.edu	37	2	38201326	38201326	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr2:38201326G>T	ENST00000406384.1	+	3	790	c.596G>T	c.(595-597)aGt>aTt	p.S199I	RMDN2_ENST00000417700.2_Missense_Mutation_p.S54I|RMDN2_ENST00000354545.2_Missense_Mutation_p.S199I|RMDN2_ENST00000407257.1_Missense_Mutation_p.S377I|RMDN2-AS1_ENST00000414365.2_RNA|RMDN2_ENST00000234195.3_Missense_Mutation_p.S377I	NM_001170792.1	NP_001164263.1	Q96LZ7	RMD2_HUMAN	regulator of microtubule dynamics 2	199						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|microtubule (GO:0005874)|mitochondrion (GO:0005739)											AAGTCGGAGAGTTTTGAACTA	0.368																																																	0													108.0	107.0	108.0					2																	38201326		2203	4299	6502	SO:0001583	missense	0			AK057516	CCDS1792.1, CCDS54351.1, CCDS54352.1	2p22.2	2013-01-11	2013-01-11	2013-01-11	ENSG00000115841	ENSG00000115841			26567	protein-coding gene	gene with protein product		611872	"""family with sequence similarity 82, member A1"""	FAM82A, FAM82A1		12477932	Standard	XM_005264161		Approved	FLJ32954, RMD2	uc002rqn.2	Q96LZ7	OTTHUMG00000128487	ENST00000406384.1:c.596G>T	2.37:g.38201326G>T	ENSP00000386004:p.Ser199Ile		A9UMZ7|A9UN00|Q4ZG33|Q6UXN4|Q8N657|Q8N9A2|Q8NCV6|Q8NHM0	Missense_Mutation	SNP	NULL	p.S377I	ENST00000406384.1	37	c.1130	CCDS54351.1	2	.	.	.	.	.	.	.	.	.	.	G	14.29	2.491760	0.44249	.	.	ENSG00000115841	ENST00000354545;ENST00000406384;ENST00000407257;ENST00000417700;ENST00000234195;ENST00000442857	T;T;T;T;T;T	0.44482	0.93;0.93;0.92;0.92;0.92;0.92	5.44	4.57	0.56435	.	0.227283	0.43747	D	0.000536	T	0.26195	0.0639	L	0.28344	0.845	0.42862	D	0.99411	B;B;P;B	0.43287	0.335;0.433;0.802;0.158	B;B;B;B	0.36719	0.135;0.104;0.231;0.139	T	0.04693	-1.0933	9	.	.	.	.	9.7605	0.40530	0.092:0.0:0.908:0.0	.	377;54;199;54	Q96LZ7-2;Q96LZ7-4;Q96LZ7;Q96LZ7-3	.;.;RMD2_HUMAN;.	I	199;199;377;54;377;54	ENSP00000346549:S199I;ENSP00000386004:S199I;ENSP00000385049:S377I;ENSP00000392977:S54I;ENSP00000234195:S377I;ENSP00000416367:S54I	.	S	+	2	0	FAM82A1	38054830	1.000000	0.71417	1.000000	0.80357	0.938000	0.57974	3.360000	0.52299	1.537000	0.49254	0.650000	0.86243	AGT	RMDN2	-	NULL	ENSG00000115841		0.368	RMDN2-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	RMDN2	HGNC	protein_coding	OTTHUMT00000325577.1	-	0.00	45	0	G	NM_144713		38201326	+1	tier1	-	no_errors	ENST00000234195	ensembl	human	known	74_37	missense	8.70	42	4	SNP	1.000	T
ACTR5	79913	genome.wustl.edu	37	20	37390255	37390256	+	Intron	INS	-	-	TC	rs147078384	byFrequency	TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr20:37390255_37390256insTC	ENST00000243903.4	+	6	1213				RN7SKP173_ENST00000362821.1_RNA	NM_024855.3	NP_079131.3	Q9H9F9	ARP5_HUMAN	ARP5 actin-related protein 5 homolog (yeast)						DNA recombination (GO:0006310)|double-strand break repair (GO:0006302)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|UV-damage excision repair (GO:0070914)	cytoplasm (GO:0005737)|Ino80 complex (GO:0031011)|nucleus (GO:0005634)				kidney(2)|large_intestine(2)|liver(1)|lung(5)|skin(2)	12		Myeloproliferative disorder(115;0.00878)				ctaagctggtgtctttctgtcc	0.51														2053	0.409944	0.3971	0.4251	5008	,	,		16260	0.4107		0.4245	False		,,,				2504	0.4008																0																																										SO:0001627	intron_variant	0			AK022847	CCDS13308.1	20q12	2011-07-06	2001-11-28		ENSG00000101442	ENSG00000101442		"""INO80 complex subunits"""	14671	protein-coding gene	gene with protein product	"""INO80 complex subunit M"""		"""ARP5 (actin-related protein 5, yeast) homolog"""			16230350	Standard	NM_024855		Approved	FLJ12785, Arp5, INO80M	uc002xjd.2	Q9H9F9	OTTHUMG00000032456	ENST00000243903.4:c.1177-3789->TC	20.37:g.37390256_37390257dupTC			Q86WF7|Q8IUY5|Q8N724|Q9BRN0|Q9BVB7	RNA	INS	-	NULL	ENST00000243903.4	37	NULL	CCDS13308.1	20																																																																																			RN7SKP173	-	-	ENSG00000199691		0.510	ACTR5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RN7SKP173	HGNC	protein_coding	OTTHUMT00000079205.2		0.00	9	0	-	NM_024855		37390256	+1	tier1		no_errors	ENST00000362821	ensembl	human	known	74_37	rna	50.00	5	5	INS	0.580:0.606	TC
RNF6	6049	genome.wustl.edu	37	13	26789577	26789577	+	Silent	SNP	G	G	T			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr13:26789577G>T	ENST00000381588.4	-	5	1194	c.442C>A	c.(442-444)Cgg>Agg	p.R148R	RNF6_ENST00000346166.3_Silent_p.R148R|RNF6_ENST00000468480.1_Intron|RNF6_ENST00000381570.3_Silent_p.R148R|RNF6_ENST00000399762.2_Intron	NM_005977.3	NP_005968.1	Q9Y252	RNF6_HUMAN	ring finger protein (C3H2C3 type) 6	148					negative regulation of axon extension (GO:0030517)|positive regulation of transcription, DNA-templated (GO:0045893)|protein K27-linked ubiquitination (GO:0044314)|protein K48-linked ubiquitination (GO:0070936)|protein K6-linked ubiquitination (GO:0085020)|regulation of androgen receptor signaling pathway (GO:0060765)|regulation of transcription, DNA-templated (GO:0006355)|ubiquitin-dependent protein catabolic process (GO:0006511)	axon (GO:0030424)|cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|PML body (GO:0016605)	androgen receptor binding (GO:0050681)|DNA binding (GO:0003677)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.R148W(1)		breast(2)|endometrium(2)|kidney(1)|large_intestine(9)|lung(3)|ovary(2)|prostate(2)|skin(2)	23	Colorectal(5;0.000442)	Lung SC(185;0.0156)|Breast(139;0.147)		all cancers(112;0.00893)|Epithelial(112;0.0481)|OV - Ovarian serous cystadenocarcinoma(117;0.148)|GBM - Glioblastoma multiforme(144;0.23)|Lung(94;0.245)		AAACTAAACCGAAACTCTCCA	0.408																																																	1	Substitution - Missense(1)	large_intestine(1)											126.0	113.0	117.0					13																	26789577		2203	4300	6503	SO:0001819	synonymous_variant	0			AJ010346	CCDS9316.1	13q12.2	2013-01-09			ENSG00000127870	ENSG00000127870		"""RING-type (C3HC4) zinc fingers"""	10069	protein-coding gene	gene with protein product	"""RING-H2 protein RNF-6"""	604242				10331950	Standard	NM_005977		Approved	DKFZp686P0776	uc001uqq.3	Q9Y252	OTTHUMG00000016614	ENST00000381588.4:c.442C>A	13.37:g.26789577G>T			B4DDP0|Q5W0H0|Q9BZP5|Q9UF41	Silent	SNP	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	p.R148	ENST00000381588.4	37	c.442	CCDS9316.1	13																																																																																			RNF6	-	NULL	ENSG00000127870		0.408	RNF6-006	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF6	HGNC	protein_coding	OTTHUMT00000044246.2		0.00	77	0	G	NM_005977		26789577	-1			no_errors	ENST00000346166	ensembl	human	known	74_37	silent	5.26	36	2	SNP	0.999	T
ROBO2	6092	genome.wustl.edu	37	3	77629225	77629225	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr3:77629225G>A	ENST00000461745.1	+	16	3356	c.2456G>A	c.(2455-2457)aGt>aAt	p.S819N	ROBO2_ENST00000487694.3_Missense_Mutation_p.S835N|ROBO2_ENST00000332191.8_Missense_Mutation_p.S819N	NM_002942.4	NP_002933.1	Q9HCK4	ROBO2_HUMAN	roundabout, axon guidance receptor, homolog 2 (Drosophila)	819	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				apoptotic process involved in luteolysis (GO:0061364)|axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|brain development (GO:0007420)|cellular response to hormone stimulus (GO:0032870)|central nervous system development (GO:0007417)|homophilic cell adhesion (GO:0007156)|metanephros development (GO:0001656)|negative regulation of negative chemotaxis (GO:0050925)|negative regulation of synapse assembly (GO:0051964)|olfactory bulb interneuron development (GO:0021891)|positive regulation of axonogenesis (GO:0050772)|retinal ganglion cell axon guidance (GO:0031290)|ureteric bud development (GO:0001657)	axolemma (GO:0030673)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	axon guidance receptor activity (GO:0008046)|identical protein binding (GO:0042802)	p.S819N(1)		NS(1)|biliary_tract(5)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(23)|liver(1)|lung(52)|ovary(2)|pancreas(2)|prostate(5)|skin(8)|upper_aerodigestive_tract(1)	117				Epithelial(33;0.00199)|LUSC - Lung squamous cell carcinoma(21;0.008)|BRCA - Breast invasive adenocarcinoma(55;0.00884)|Lung(72;0.0183)|KIRC - Kidney renal clear cell carcinoma(39;0.0832)|Kidney(39;0.103)		GCTAGTACCAGTGCAGGGGTT	0.448																																																	1	Substitution - Missense(1)	lung(1)											104.0	106.0	105.0					3																	77629225		1922	4130	6052	SO:0001583	missense	0			AF040991	CCDS43109.1, CCDS54609.1	3p12.3	2013-02-11	2001-11-28		ENSG00000185008	ENSG00000185008		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	10250	protein-coding gene	gene with protein product		602431	"""roundabout (axon guidance receptor, Drosophila) homolog 2"""			9458045	Standard	NM_002942		Approved	KIAA1568	uc003dpy.4	Q9HCK4	OTTHUMG00000158935	ENST00000461745.1:c.2456G>A	3.37:g.77629225G>A	ENSP00000417164:p.Ser819Asn		O43608|Q19AB4|Q19AB5	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.S819N	ENST00000461745.1	37	c.2456	CCDS43109.1	3	.	.	.	.	.	.	.	.	.	.	G	18.38	3.611217	0.66558	.	.	ENSG00000185008	ENST00000487694;ENST00000403211;ENST00000343019;ENST00000461745;ENST00000332191;ENST00000398467	T;T;T	0.56776	0.44;0.44;0.44	5.53	3.74	0.42951	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.138561	0.32459	N	0.006063	T	0.50205	0.1602	L	0.58510	1.815	0.36803	D	0.885460	B;B;B	0.27951	0.195;0.095;0.116	B;B;B	0.35278	0.152;0.094;0.199	T	0.56992	-0.7887	9	0.27785	T	0.31	.	11.2105	0.48795	0.1485:0.0:0.8515:0.0	.	835;819;819	Q19AB5;F8W703;Q9HCK4	.;.;ROBO2_HUMAN	N	835;835;839;819;819;540	ENSP00000417335:S835N;ENSP00000417164:S819N;ENSP00000327536:S819N	ENSP00000327536:S819N	S	+	2	0	ROBO2	77711915	1.000000	0.71417	1.000000	0.80357	0.887000	0.51463	4.076000	0.57591	0.701000	0.31803	0.563000	0.77884	AGT	ROBO2	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000185008		0.448	ROBO2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	ROBO2	HGNC	protein_coding	OTTHUMT00000352600.2		0.00	31	0	G	XM_031246		77629225	+1			no_errors	ENST00000461745	ensembl	human	known	74_37	missense	5.13	37	2	SNP	1.000	A
RP2	6102	genome.wustl.edu	37	X	46713468	46713468	+	Silent	SNP	T	T	A			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chrX:46713468T>A	ENST00000218340.3	+	2	821	c.660T>A	c.(658-660)atT>atA	p.I220I		NM_006915.2	NP_008846.2	O75695	XRP2_HUMAN	retinitis pigmentosa 2 (X-linked recessive)	220					cell morphogenesis (GO:0000902)|CTP biosynthetic process (GO:0006241)|cytoskeleton organization (GO:0007010)|GTP biosynthetic process (GO:0006183)|positive regulation of GTPase activity (GO:0043547)|post-Golgi vesicle-mediated transport (GO:0006892)|protein folding (GO:0006457)|protein transport (GO:0015031)|UTP biosynthetic process (GO:0006228)|visual perception (GO:0007601)	centriole (GO:0005814)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|periciliary membrane compartment (GO:1990075)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|GTPase activator activity (GO:0005096)|nucleoside diphosphate kinase activity (GO:0004550)|unfolded protein binding (GO:0051082)			NS(1)|large_intestine(4)|lung(5)|stomach(1)	11						ATAGAAGCATTGTTCCAATAT	0.438																																																	0													71.0	55.0	60.0					X																	46713468		2203	4300	6503	SO:0001819	synonymous_variant	0			AJ007590	CCDS14270.1	Xp11.3	2013-01-08			ENSG00000102218	ENSG00000102218			10274	protein-coding gene	gene with protein product		300757				6325945, 9697692, 19852809	Standard	NM_006915		Approved	TBCCD2, NME10, NM23-H10	uc004dgw.4	O75695	OTTHUMG00000021430	ENST00000218340.3:c.660T>A	X.37:g.46713468T>A			Q86XJ7|Q9NU67	Silent	SNP	pfam_Tubulin-bd_cofactor_C_dom,superfamily_Nucleoside_diP_kinase,superfamily_Adenylate_cyclase-assoc_CAP_C,smart_CARP_motif,pirsf_Protein_XRP2	p.I220	ENST00000218340.3	37	c.660	CCDS14270.1	X																																																																																			RP2	-	pirsf_Protein_XRP2	ENSG00000102218		0.438	RP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RP2	HGNC	protein_coding	OTTHUMT00000056375.1	-	0.00	21	0	T	NM_006915		46713468	+1	tier1	-	no_errors	ENST00000218340	ensembl	human	known	74_37	silent	29.03	22	9	SNP	0.419	A
RPL32P3	132241	genome.wustl.edu	37	3	129111880	129111880	+	RNA	SNP	A	A	T			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr3:129111880A>T	ENST00000514355.1	-	0	933									ribosomal protein L32 pseudogene 3											lung(1)	1						GATGGGAAGGAAGCACTGGGG	0.567																																																	0																																												0			AK096589, AL117606		3q21.3	2014-03-20			ENSG00000251474	ENSG00000251474			27024	pseudogene	pseudogene						12477932	Standard	NR_003111		Approved		uc003ema.4		OTTHUMG00000159465		3.37:g.129111880A>T				RNA	SNP	-	NULL	ENST00000514355.1	37	NULL		3																																																																																			RPL32P3	-	-	ENSG00000251474		0.567	RPL32P3-003	KNOWN	basic	processed_transcript	RPL32P3	HGNC	pseudogene	OTTHUMT00000355880.1	-	0.00	12	0	A			129111880	-1	tier1	-	no_errors	ENST00000514355	ensembl	human	known	74_37	rna	41.67	14	10	SNP	0.030	T
RUFY3	22902	genome.wustl.edu	37	4	71650542	71650543	+	Nonsense_Mutation	DNP	GC	GC	CT			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	G|C	G|C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr4:71650542_71650543GC>CT	ENST00000226328.4	+	10	1580_1581	c.1017_1018GC>CT	c.(1015-1020)ggGCaa>ggCTaa	p.Q340*	RUFY3_ENST00000381006.3_Nonsense_Mutation_p.Q340*|RUFY3_ENST00000502653.1_Nonsense_Mutation_p.Q287*|RUFY3_ENST00000417478.2_Nonsense_Mutation_p.Q400*|RUFY3_ENST00000536664.1_Nonsense_Mutation_p.Q324*	NM_014961.3	NP_055776.1	Q7L099	RUFY3_HUMAN	RUN and FYVE domain containing 3	340					negative regulation of axonogenesis (GO:0050771)	filopodium (GO:0030175)|growth cone (GO:0030426)		p.G339G(2)		endometrium(1)|kidney(3)|large_intestine(4)|lung(6)|prostate(1)|stomach(1)	16		all_hematologic(202;0.248)	Lung(101;0.235)			CTGCAGAAGGGCAAGCACTAAG	0.322																																																	2	Substitution - coding silent(2)	lung(2)																																								SO:0001587	stop_gained	0			AF112221	CCDS3547.1, CCDS34001.1, CCDS47068.1, CCDS75138.1	4q13.3	2009-05-29			ENSG00000018189	ENSG00000018189		"""Zinc fingers, FYVE domain containing"""	30285	protein-coding gene	gene with protein product	"""single axon-related 1"""	611194				17439943	Standard	NM_001130709		Approved	RIPx, KIAA0871, Singar1	uc003hfr.3	Q7L099	OTTHUMG00000129910	Exception_encountered	4.37:g.71650542_71650543delinsCT	ENSP00000226328:p.Gln340*		B3KM25|B4DYW7|D9N163|O94948|Q9UI00	Silent|Nonsense_Mutation	SNP	pfam_Run,superfamily_Prefoldin,smart_Run,pfscan_Run	p.G399|p.Q400*	ENST00000226328.4	37	c.1197|c.1198	CCDS3547.1	4																																																																																			RUFY3	-	NULL	ENSG00000018189		0.322	RUFY3-001	KNOWN	basic|CCDS	protein_coding	RUFY3	HGNC	protein_coding	OTTHUMT00000252161.2	-	0.00	35|34	0	G|C	NM_014961		71650542|71650543	+1	tier1	-	no_errors	ENST00000417478	ensembl	human	known	74_37	silent|nonsense	32.26	21	10	SNP	0.971|1.000	C|T
RXFP2	122042	genome.wustl.edu	37	13	32376333	32376333	+	Missense_Mutation	SNP	T	T	A			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr13:32376333T>A	ENST00000298386.2	+	18	2127	c.2056T>A	c.(2056-2058)Ttg>Atg	p.L686M	RXFP2_ENST00000380314.1_Missense_Mutation_p.L662M	NM_130806.3	NP_570718.1	Q8WXD0	RXFP2_HUMAN	relaxin/insulin-like family peptide receptor 2	686					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|male gonad development (GO:0008584)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|oocyte maturation (GO:0001556)|positive regulation of cAMP biosynthetic process (GO:0030819)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	peptide hormone binding (GO:0017046)|protein-hormone receptor activity (GO:0016500)			cervix(1)|endometrium(2)|large_intestine(15)|lung(13)|prostate(1)|stomach(1)	33		Lung SC(185;0.0262)		all cancers(112;0.000559)|Epithelial(112;0.0017)|OV - Ovarian serous cystadenocarcinoma(117;0.0145)|BRCA - Breast invasive adenocarcinoma(63;0.0535)		TAACAGTGCTTTGAATCCAAT	0.333																																																	0													89.0	88.0	88.0					13																	32376333		2203	4300	6503	SO:0001583	missense	0			AF403384	CCDS9342.1, CCDS53862.1	13q12.3	2012-08-08	2006-05-09	2006-05-09	ENSG00000133105	ENSG00000133105		"""GPCR / Class A : Relaxin family peptide receptors"""	17318	protein-coding gene	gene with protein product		606655	"""leucine-rich repeat-containing G protein-coupled receptor 8"""	LGR8		12217959, 12970298, 15956688, 16507880	Standard	NM_130806		Approved	GREAT, GPR106, INSL3R, RXFPR2	uc001utt.3	Q8WXD0	OTTHUMG00000016690	ENST00000298386.2:c.2056T>A	13.37:g.32376333T>A	ENSP00000298386:p.Leu686Met		B1ALE9|Q3KU23	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_Leu-rich_rpt,pfam_LDrepeatLR_classA_rpt,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_Leu-rich_rpt_typical-subtyp,pfscan_LDrepeatLR_classA_rpt,pfscan_GPCR_Rhodpsn_7TM,prints_Relaxin_rcpt,prints_GPCR_Rhodpsn,prints_Gphrmn_rcpt_fam	p.L686M	ENST00000298386.2	37	c.2056	CCDS9342.1	13	.	.	.	.	.	.	.	.	.	.	T	19.47	3.834352	0.71373	.	.	ENSG00000133105	ENST00000380314;ENST00000298386	T;T	0.49432	0.78;0.78	5.68	4.55	0.56014	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	D	0.000001	T	0.66356	0.2781	M	0.80508	2.5	0.44254	D	0.997103	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	T	0.68588	-0.5369	10	0.52906	T	0.07	.	8.8955	0.35460	0.0:0.1186:0.0:0.8814	.	662;686	Q3KU23;Q8WXD0	.;RXFP2_HUMAN	M	662;686	ENSP00000369670:L662M;ENSP00000298386:L686M	ENSP00000298386:L686M	L	+	1	2	RXFP2	31274333	0.991000	0.36638	1.000000	0.80357	0.986000	0.74619	0.496000	0.22499	2.175000	0.68902	0.533000	0.62120	TTG	RXFP2	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000133105		0.333	RXFP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RXFP2	HGNC	protein_coding	OTTHUMT00000044399.1	-	0.00	71	0	T	NM_130806		32376333	+1	tier1	-	no_errors	ENST00000298386	ensembl	human	known	74_37	missense	9.76	37	4	SNP	1.000	A
S100A2	6273	genome.wustl.edu	37	1	153535934	153535934	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr1:153535934T>C	ENST00000368707.4	-	3	269	c.220A>G	c.(220-222)Agc>Ggc	p.S74G	S100A2_ENST00000368709.1_Intron|S100A2_ENST00000368710.1_Intron|S100A2_ENST00000487430.2_Intron|S100A2_ENST00000368708.3_Intron|S100A2_ENST00000497140.1_Intron			P29034	S10A2_HUMAN	S100 calcium binding protein A2	0	EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.				endothelial cell migration (GO:0043542)		calcium ion binding (GO:0005509)|identical protein binding (GO:0042802)			endometrium(1)|large_intestine(2)|lung(1)|ovary(1)	5	all_lung(78;5.98e-32)|Lung NSC(65;2.27e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.171)		Olopatadine(DB00768)	ccttctgggctctggtttctc	0.443																																																	0																																										SO:0001583	missense	0			BC002829	CCDS1044.1	1q21	2013-01-10	2001-11-28		ENSG00000196754	ENSG00000196754		"""S100 calcium binding proteins"", ""EF-hand domain containing"""	10492	protein-coding gene	gene with protein product		176993	"""S100 calcium-binding protein A2"""	S100L		8341667	Standard	NM_005978		Approved	CAN19	uc001fcb.3	P29034	OTTHUMG00000035031	ENST00000368707.4:c.220A>G	1.37:g.153535934T>C	ENSP00000357696:p.Ser74Gly		O00266|Q3KRB9|Q5RHS8|Q9BU83	Missense_Mutation	SNP	pfam_S100_Ca-bd_sub	p.S74G	ENST00000368707.4	37	c.220		1	.	.	.	.	.	.	.	.	.	.	T	13.43	2.234958	0.39498	.	.	ENSG00000196754	ENST00000368707	.	.	.	2.93	2.93	0.34026	.	.	.	.	.	T	0.25568	0.0622	.	.	.	0.28505	N	0.913849	.	.	.	.	.	.	T	0.11108	-1.0601	5	0.52906	T	0.07	.	7.6753	0.28481	0.0:0.0:0.0:1.0	.	.	.	.	G	74	.	ENSP00000357696:S74G	S	-	1	0	S100A2	151802558	0.150000	0.22732	0.853000	0.33588	0.238000	0.25445	0.698000	0.25571	1.578000	0.49821	0.383000	0.25322	AGC	S100A2	-	NULL	ENSG00000196754		0.443	S100A2-004	PUTATIVE	basic	protein_coding	S100A2	HGNC	protein_coding	OTTHUMT00000084792.2	-	0.00	66	0	T	NM_005978		153535934	-1	tier1	-	no_errors	ENST00000368707	ensembl	human	putative	74_37	missense	28.57	35	14	SNP	0.980	C
SALL2	6297	genome.wustl.edu	37	14	21990864	21990864	+	Silent	SNP	G	G	T			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr14:21990864G>T	ENST00000327430.3	-	2	3292	c.2998C>A	c.(2998-3000)Cga>Aga	p.R1000R	SALL2_ENST00000450879.2_Intron|SALL2_ENST00000317492.5_Intron|AE000658.22_ENST00000535893.1_RNA|SALL2_ENST00000538754.1_Intron	NM_005407.1	NP_005398.1	Q9Y467	SALL2_HUMAN	spalt-like transcription factor 2	1000					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(12)|lung(12)|ovary(2)|skin(6)|urinary_tract(2)	43	all_cancers(95;0.000662)			GBM - Glioblastoma multiforme(265;0.0151)		TCATCTTTTCGGGGAAAGGGG	0.542																																																	0													69.0	74.0	72.0					14																	21990864		2203	4300	6503	SO:0001819	synonymous_variant	0			AB002358	CCDS32045.1	14q11.1-q12.1	2013-10-17	2013-10-17		ENSG00000165821	ENSG00000165821		"""Zinc fingers, C2H2-type"""	10526	protein-coding gene	gene with protein product		602219	"""sal (Drosophila)-like 2"", ""sal-like 2 (Drosophila)"""			8975705	Standard	XM_005267983		Approved	KIAA0360, Hsal2, ZNF795	uc001wbe.3	Q9Y467	OTTHUMG00000168826	ENST00000327430.3:c.2998C>A	14.37:g.21990864G>T			B2RMX6|B9EGK8|Q8N656|Q9Y4G1	Silent	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.R1000	ENST00000327430.3	37	c.2998	CCDS32045.1	14																																																																																			SALL2	-	NULL	ENSG00000165821		0.542	SALL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SALL2	HGNC	protein_coding	OTTHUMT00000401242.1		0.00	47	0	G	NM_005407		21990864	-1			no_errors	ENST00000327430	ensembl	human	known	74_37	silent	5.36	53	3	SNP	0.545	T
SCCPDH	51097	genome.wustl.edu	37	1	246921571	246921571	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr1:246921571G>T	ENST00000366510.3	+	6	984	c.608G>T	c.(607-609)gGt>gTt	p.G203V		NM_016002.2	NP_057086.2	Q8NBX0	SCPDL_HUMAN	saccharopine dehydrogenase (putative)	203						lipid particle (GO:0005811)|membrane (GO:0016020)|midbody (GO:0030496)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	oxidoreductase activity (GO:0016491)			cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|lung(9)|ovary(1)	17	all_cancers(71;6.8e-05)|all_epithelial(71;7.93e-06)|Ovarian(71;0.0173)|Breast(184;0.0318)|all_lung(81;0.0545)|Lung NSC(105;0.0618)	all_cancers(173;0.0343)	OV - Ovarian serous cystadenocarcinoma(106;0.00323)	GBM - Glioblastoma multiforme(49;0.0896)		GCAATTTATGGTTTTGGAGAT	0.328																																																	0													89.0	95.0	93.0					1																	246921571		2203	4299	6502	SO:0001583	missense	0				CCDS31084.1	1q44	2009-11-06			ENSG00000143653	ENSG00000143653			24275	protein-coding gene	gene with protein product						10810093	Standard	NM_016002		Approved	CGI-49, NET11	uc001ibr.3	Q8NBX0	OTTHUMG00000040221	ENST00000366510.3:c.608G>T	1.37:g.246921571G>T	ENSP00000355467:p.Gly203Val		Q8TAR0|Q9Y363	Missense_Mutation	SNP	pfam_Saccharopine_DH/HSpermid_syn	p.G203V	ENST00000366510.3	37	c.608	CCDS31084.1	1	.	.	.	.	.	.	.	.	.	.	G	26.7	4.767460	0.90020	.	.	ENSG00000143653	ENST00000366510;ENST00000366509	T	0.39787	1.06	6.06	6.06	0.98353	.	0.043787	0.85682	D	0.000000	T	0.72614	0.3482	M	0.91249	3.19	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.70622	-0.4821	10	0.24483	T	0.36	.	20.2501	0.98402	0.0:0.0:1.0:0.0	.	203	Q8NBX0	SCPDL_HUMAN	V	203;34	ENSP00000355467:G203V	ENSP00000355466:G34V	G	+	2	0	SCCPDH	244988194	1.000000	0.71417	1.000000	0.80357	0.933000	0.57130	8.770000	0.91746	2.880000	0.98712	0.650000	0.86243	GGT	SCCPDH	-	pfam_Saccharopine_DH/HSpermid_syn	ENSG00000143653		0.328	SCCPDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCCPDH	HGNC	protein_coding	OTTHUMT00000096902.2	-	0.00	72	0	G	NM_016002		246921571	+1	tier1	-	no_errors	ENST00000366510	ensembl	human	known	74_37	missense	6.56	57	4	SNP	1.000	T
SCG2	7857	genome.wustl.edu	37	2	224462806	224462806	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr2:224462806A>C	ENST00000305409.2	-	2	1427	c.1195T>G	c.(1195-1197)Tta>Gta	p.L399V		NM_003469.4	NP_003460.2	O00255	MEN1_HUMAN	secretogranin II	0					brain development (GO:0007420)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|chromatin remodeling (GO:0006338)|DNA repair (GO:0006281)|embryonic skeletal system morphogenesis (GO:0048704)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|histone lysine methylation (GO:0034968)|leukocyte homeostasis (GO:0001776)|MAPK cascade (GO:0000165)|maternal process involved in female pregnancy (GO:0060135)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of JNK cascade (GO:0046329)|negative regulation of organ growth (GO:0046621)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of telomerase activity (GO:0051974)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|osteoblast development (GO:0002076)|osteoblast fate commitment (GO:0002051)|palate development (GO:0060021)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell division (GO:0051781)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of histone methylation (GO:0031062)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein binding (GO:0032092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of activin receptor signaling pathway (GO:0032925)|response to gamma radiation (GO:0010332)|response to UV (GO:0009411)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	chromatin (GO:0000785)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|histone methyltransferase complex (GO:0035097)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|four-way junction DNA binding (GO:0000400)|protein binding, bridging (GO:0030674)|protein N-terminus binding (GO:0047485)|R-SMAD binding (GO:0070412)|sequence-specific DNA binding (GO:0043565)|transcription regulatory region DNA binding (GO:0044212)|Y-form DNA binding (GO:0000403)			NS(1)|breast(1)|endometrium(1)|kidney(6)|large_intestine(10)|liver(1)|lung(16)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(4)	44		Renal(207;0.0112)|Lung NSC(271;0.0185)|all_lung(227;0.0271)		Epithelial(121;8.16e-11)|all cancers(144;4.66e-08)|Lung(261;0.00714)|LUSC - Lung squamous cell carcinoma(224;0.008)		GGATGGTCTAAGTCAGCCTCT	0.532																																																	0													82.0	75.0	78.0					2																	224462806		2203	4300	6503	SO:0001583	missense	0			M25756	CCDS2457.1	2q35-q36	2010-04-27	2010-04-27		ENSG00000171951	ENSG00000171951			10575	protein-coding gene	gene with protein product	"""secretoneurin"", ""chromogranin C"""	118930				8617499, 16101435	Standard	NM_003469		Approved	CHGC, SgII, SN	uc002vnm.3	P13521	OTTHUMG00000133166	ENST00000305409.2:c.1195T>G	2.37:g.224462806A>C	ENSP00000304133:p.Leu399Val		A5HBC6|A5HBC7|A5HBC8|A5HBC9|A5HBD0|A5HBD1|A5HBD2|O00632|Q9BUF0|Q9BUK2	Missense_Mutation	SNP	pfam_Granin	p.L399V	ENST00000305409.2	37	c.1195	CCDS2457.1	2	.	.	.	.	.	.	.	.	.	.	A	1.277	-0.611421	0.03690	.	.	ENSG00000171951	ENST00000305409;ENST00000450330	T	0.01745	4.66	5.73	-6.4	0.01944	.	0.959682	0.08619	N	0.918695	T	0.00875	0.0029	N	0.25647	0.755	0.09310	N	0.999998	B	0.06786	0.001	B	0.09377	0.004	T	0.50684	-0.8799	10	0.02654	T	1	.	0.3568	0.00358	0.2495:0.2705:0.2243:0.2557	.	399	P13521	SCG2_HUMAN	V	399;259	ENSP00000304133:L399V	ENSP00000304133:L399V	L	-	1	2	SCG2	224171050	0.395000	0.25254	0.244000	0.24202	0.987000	0.75469	-0.407000	0.07178	-0.484000	0.06763	0.454000	0.30748	TTA	SCG2	-	pfam_Granin	ENSG00000171951		0.532	SCG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCG2	HGNC	protein_coding	OTTHUMT00000256870.2	-	0.00	52	0	A	NM_003469		224462806	-1	tier1	-	no_errors	ENST00000305409	ensembl	human	known	74_37	missense	20.51	30	8	SNP	0.001	C
SEC16A	9919	genome.wustl.edu	37	9	139350129	139350129	+	Silent	SNP	C	C	T			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr9:139350129C>T	ENST00000371706.3	-	18	5280	c.5247G>A	c.(5245-5247)ggG>ggA	p.G1749G	SEC16A_ENST00000313050.7_Silent_p.G1927G|SEC16A_ENST00000431893.2_Silent_p.G1749G|SEC16A_ENST00000290037.6_Silent_p.G1749G			O15027	SC16A_HUMAN	SEC16 homolog A (S. cerevisiae)	1749					COPII vesicle coating (GO:0048208)|endoplasmic reticulum organization (GO:0007029)|protein transport (GO:0015031)|substantia nigra development (GO:0021762)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)				breast(1)|central_nervous_system(3)|endometrium(7)|kidney(5)|large_intestine(15)|lung(14)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51		Myeloproliferative disorder(178;0.0511)		Epithelial(140;2.9e-06)|OV - Ovarian serous cystadenocarcinoma(145;5.88e-06)		GGTTGGCGATCCCCAGGGCTC	0.687																																																	0													18.0	25.0	23.0					9																	139350129		2113	4213	6326	SO:0001819	synonymous_variant	0			AK074565	CCDS55351.1, CCDS75936.1	9q34.3	2007-06-20	2007-06-20	2007-06-20	ENSG00000148396	ENSG00000148396			29006	protein-coding gene	gene with protein product		612854	"""KIAA0310"""	KIAA0310		9205841	Standard	NM_014866		Approved	p250	uc004chx.3	O15027	OTTHUMG00000020932	ENST00000371706.3:c.5247G>A	9.37:g.139350129C>T			A1YCA4|Q4G0D7|Q5SXP0|Q5SXP1|Q8N347|Q96HP1	Silent	SNP	NULL	p.G1927	ENST00000371706.3	37	c.5781		9																																																																																			SEC16A	-	NULL	ENSG00000148396		0.687	SEC16A-001	KNOWN	basic	protein_coding	SEC16A	HGNC	protein_coding	OTTHUMT00000055077.1	-	0.00	106	0	C	XM_088459		139350129	-1	tier1	-	no_errors	ENST00000313050	ensembl	human	known	74_37	silent	36.13	76	43	SNP	0.000	T
SEC16A	9919	genome.wustl.edu	37	9	139354317	139354317	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr9:139354317C>T	ENST00000371706.3	-	13	4582	c.4549G>A	c.(4549-4551)Gac>Aac	p.D1517N	SEC16A_ENST00000313050.7_Missense_Mutation_p.D1695N|SEC16A_ENST00000431893.2_Missense_Mutation_p.D1517N|SEC16A_ENST00000290037.6_Missense_Mutation_p.D1517N			O15027	SC16A_HUMAN	SEC16 homolog A (S. cerevisiae)	1517					COPII vesicle coating (GO:0048208)|endoplasmic reticulum organization (GO:0007029)|protein transport (GO:0015031)|substantia nigra development (GO:0021762)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)				breast(1)|central_nervous_system(3)|endometrium(7)|kidney(5)|large_intestine(15)|lung(14)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51		Myeloproliferative disorder(178;0.0511)		Epithelial(140;2.9e-06)|OV - Ovarian serous cystadenocarcinoma(145;5.88e-06)		CATTTCTCGTCTCCACAGCAC	0.557																																																	0													55.0	57.0	57.0					9																	139354317		2081	4212	6293	SO:0001583	missense	0			AK074565	CCDS55351.1, CCDS75936.1	9q34.3	2007-06-20	2007-06-20	2007-06-20	ENSG00000148396	ENSG00000148396			29006	protein-coding gene	gene with protein product		612854	"""KIAA0310"""	KIAA0310		9205841	Standard	NM_014866		Approved	p250	uc004chx.3	O15027	OTTHUMG00000020932	ENST00000371706.3:c.4549G>A	9.37:g.139354317C>T	ENSP00000360771:p.Asp1517Asn		A1YCA4|Q4G0D7|Q5SXP0|Q5SXP1|Q8N347|Q96HP1	Missense_Mutation	SNP	NULL	p.D1695N	ENST00000371706.3	37	c.5083		9	.	.	.	.	.	.	.	.	.	.	C	22.5	4.303901	0.81136	.	.	ENSG00000148396	ENST00000313050;ENST00000277537;ENST00000453963;ENST00000371706;ENST00000290037;ENST00000431893;ENST00000404925	T;T;T;T;T;T	0.50001	1.69;0.76;1.3;1.69;1.69;1.69	5.66	5.66	0.87406	.	0.048843	0.85682	D	0.000000	T	0.67869	0.2939	L	0.61387	1.9	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.80764	0.994;0.992;0.987;0.993	T	0.69068	-0.5243	10	0.72032	D	0.01	-35.6721	18.7199	0.91689	0.0:1.0:0.0:0.0	.	1695;1517;1517;1085	F1T0I1;O15027-5;O15027-4;A4QN19	.;.;.;.	N	1695;89;417;1517;1517;1517;1085	ENSP00000325827:D1695N;ENSP00000277537:D89N;ENSP00000403525:D417N;ENSP00000360771:D1517N;ENSP00000290037:D1517N;ENSP00000387583:D1517N	ENSP00000277537:D89N	D	-	1	0	SEC16A	138474138	1.000000	0.71417	0.705000	0.30386	0.251000	0.25915	7.702000	0.84576	2.668000	0.90789	0.561000	0.74099	GAC	SEC16A	-	NULL	ENSG00000148396		0.557	SEC16A-001	KNOWN	basic	protein_coding	SEC16A	HGNC	protein_coding	OTTHUMT00000055077.1	-	0.00	31	0	C	XM_088459		139354317	-1	tier1	-	no_errors	ENST00000313050	ensembl	human	known	74_37	missense	27.03	27	10	SNP	1.000	T
SEC61A1	29927	genome.wustl.edu	37	3	127788799	127788799	+	3'UTR	SNP	C	C	G			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr3:127788799C>G	ENST00000243253.3	+	0	1909				SEC61A1_ENST00000483956.1_3'UTR|RUVBL1_ENST00000464873.1_Intron|SEC61A1_ENST00000424880.2_3'UTR	NM_013336.3	NP_037468.1	P61619	S61A1_HUMAN	Sec61 alpha 1 subunit (S. cerevisiae)						antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cell growth (GO:0016049)|endoplasmic reticulum organization (GO:0007029)|posttranslational protein targeting to membrane (GO:0006620)|protein targeting to ER (GO:0045047)|response to interferon-gamma (GO:0034341)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)	integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)|rough endoplasmic reticulum (GO:0005791)	ribosome binding (GO:0043022)			central_nervous_system(1)|kidney(1)|large_intestine(5)|liver(1)|lung(8)|ovary(1)|prostate(4)	21						TTAACCTTTGCACCTTCTCAG	0.453																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AF077032	CCDS3046.1	3q21.3	2008-02-05			ENSG00000058262	ENSG00000058262			18276	protein-coding gene	gene with protein product		609213					Standard	NM_013336		Approved		uc003ekb.3	P61619	OTTHUMG00000159624	ENST00000243253.3:c.*294C>G	3.37:g.127788799C>G			P38378|P57726|Q5JPF8|Q8N0Z4|Q8N3U3|Q8NC71|Q9BU16|Q9Y2R3	RNA	SNP	-	NULL	ENST00000243253.3	37	NULL	CCDS3046.1	3																																																																																			SEC61A1	-	-	ENSG00000058262		0.453	SEC61A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEC61A1	HGNC	protein_coding	OTTHUMT00000356541.2	-	0.00	42	0	C	NM_013336		127788799	+1	tier1	-	no_errors	ENST00000483956	ensembl	human	known	74_37	rna	12.12	29	4	SNP	0.095	G
SEL1L2	80343	genome.wustl.edu	37	20	13894224	13894224	+	Intron	SNP	T	T	G			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr20:13894224T>G	ENST00000284951.5	-	5	624				SEL1L2_ENST00000378072.5_Intron|SEL1L2_ENST00000486903.1_Intron			Q5TEA6	SE1L2_HUMAN	sel-1 suppressor of lin-12-like 2 (C. elegans)							integral component of membrane (GO:0016021)				cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(14)|lung(25)|ovary(2)|skin(3)|urinary_tract(1)	51						GTGAATACATTTTATATAAAA	0.358																																																	0																																										SO:0001627	intron_variant	0			AL137678	CCDS59443.1	20p12.1	2011-03-31	2006-11-24	2006-11-24	ENSG00000101251	ENSG00000101251			15897	protein-coding gene	gene with protein product		614289	"""chromosome 20 open reading frame 50"""	C20orf50			Standard	NM_001271539		Approved	DKFZp434C1826	uc010zrl.3	Q5TEA6	OTTHUMG00000031910	ENST00000284951.5:c.549+203A>C	20.37:g.13894224T>G			B4DXX5	RNA	SNP	-	NULL	ENST00000284951.5	37	NULL		20																																																																																			SEL1L2	-	-	ENSG00000101251		0.358	SEL1L2-002	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	SEL1L2	HGNC	protein_coding	OTTHUMT00000078067.3	-	0.00	11	0	T	NM_025229		13894224	-1	tier1	-	no_errors	ENST00000476952	ensembl	human	known	74_37	rna	22.22	14	4	SNP	0.000	G
SEMA4C	54910	genome.wustl.edu	37	2	97531628	97531628	+	Silent	SNP	A	A	G			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr2:97531628A>G	ENST00000305476.5	-	4	429	c.297T>C	c.(295-297)tgT>tgC	p.C99C		NM_017789.4	NP_060259.4	Q9C0C4	SEM4C_HUMAN	sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4C	99	Dominant negative effect on myogenic differentiation. {ECO:0000250}.|Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				cell migration in hindbrain (GO:0021535)|cerebellum development (GO:0021549)|muscle cell differentiation (GO:0042692)|neural tube closure (GO:0001843)|positive regulation of stress-activated MAPK cascade (GO:0032874)|semaphorin-plexin signaling pathway (GO:0071526)	cell junction (GO:0030054)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|synaptic vesicle membrane (GO:0030672)	receptor activity (GO:0004872)			NS(1)|kidney(1)|lung(8)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	17						CTTTCTGGATACACTCAGTCT	0.597																																																	0													120.0	129.0	126.0					2																	97531628		2203	4300	6503	SO:0001819	synonymous_variant	0			AB051526	CCDS2029.1	2q11.2	2013-01-11			ENSG00000168758	ENSG00000168758		"""Semaphorins"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10731	protein-coding gene	gene with protein product	"""M-Sema F"""	604462		SEMAI		7656991	Standard	NM_017789		Approved	Semacl1, Semaf	uc002sxh.4	Q9C0C4	OTTHUMG00000130535	ENST00000305476.5:c.297T>C	2.37:g.97531628A>G			Q32MJ3|Q7Z5X0	Silent	SNP	pfam_Semap_dom,pfam_Plexin_repeat,superfamily_Semap_dom,superfamily_Plexin-like_fold,smart_Semap_dom,smart_Plexin-like_fold,smart_Ig_sub,pfscan_Semap_dom,pfscan_Ig-like_dom	p.C99	ENST00000305476.5	37	c.297	CCDS2029.1	2																																																																																			SEMA4C	-	pfam_Semap_dom,superfamily_Semap_dom,smart_Semap_dom,pfscan_Semap_dom	ENSG00000168758		0.597	SEMA4C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEMA4C	HGNC	protein_coding	OTTHUMT00000252957.1	-	0.00	25	0	A	NM_017789		97531628	-1	tier1	-	no_errors	ENST00000305476	ensembl	human	known	74_37	silent	34.88	28	15	SNP	0.292	G
SERTAD4	56256	genome.wustl.edu	37	1	210415432	210415432	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr1:210415432G>A	ENST00000367012.3	+	4	1051	c.821G>A	c.(820-822)gGt>gAt	p.G274D	SERTAD4_ENST00000490620.1_3'UTR	NM_019605.3	NP_062551.1	Q9NUC0	SRTD4_HUMAN	SERTA domain containing 4	274						nucleus (GO:0005634)				endometrium(2)|kidney(1)|large_intestine(2)|lung(5)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(1)	14				OV - Ovarian serous cystadenocarcinoma(81;0.0237)|all cancers(67;0.127)		AGATCACTTGGTGTTCAGGAA	0.453																																																	0													69.0	63.0	65.0					1																	210415432		2203	4300	6503	SO:0001583	missense	0			BC012083	CCDS1494.1	1q32.1-q41	2008-02-05			ENSG00000082497	ENSG00000082497			25236	protein-coding gene	gene with protein product						12477932	Standard	NM_019605		Approved	DJ667H12.2	uc001hhy.3	Q9NUC0	OTTHUMG00000036391	ENST00000367012.3:c.821G>A	1.37:g.210415432G>A	ENSP00000355979:p.Gly274Asp		B2RD32	Missense_Mutation	SNP	pfam_SERTA,pfscan_SERTA	p.G274D	ENST00000367012.3	37	c.821	CCDS1494.1	1	.	.	.	.	.	.	.	.	.	.	G	11.44	1.638836	0.29157	.	.	ENSG00000082497	ENST00000367012	.	.	.	5.24	3.27	0.37495	.	0.166850	0.40640	N	0.001059	T	0.34308	0.0893	L	0.29908	0.895	0.32122	N	0.587863	P	0.44627	0.839	B	0.43623	0.425	T	0.47761	-0.9092	9	0.87932	D	0	-15.5003	11.7415	0.51796	0.0:0.2491:0.6219:0.1291	.	274	Q9NUC0	SRTD4_HUMAN	D	274	.	ENSP00000355979:G274D	G	+	2	0	SERTAD4	208482055	1.000000	0.71417	0.990000	0.47175	0.982000	0.71751	2.135000	0.42112	0.630000	0.30394	0.655000	0.94253	GGT	SERTAD4	-	NULL	ENSG00000082497		0.453	SERTAD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SERTAD4	HGNC	protein_coding	OTTHUMT00000088577.1	-	0.00	37	0	G	NM_019605		210415432	+1	tier1	-	no_errors	ENST00000367012	ensembl	human	known	74_37	missense	24.14	22	7	SNP	0.853	A
SET	6418	genome.wustl.edu	37	9	131455942	131455942	+	Missense_Mutation	SNP	C	C	T	rs150832256	byFrequency	TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr9:131455942C>T	ENST00000372692.4	+	6	798	c.557C>T	c.(556-558)aCg>aTg	p.T186M	SET_ENST00000322030.8_Missense_Mutation_p.T173M|SET_ENST00000409104.3_Missense_Mutation_p.T164M|SET_ENST00000372688.4_Missense_Mutation_p.T162M|SET_ENST00000477806.1_3'UTR	NM_001122821.1	NP_001116293.1	Q01105	SET_HUMAN	SET nuclear proto-oncogene	186	Earmuff domain.				DNA replication (GO:0006260)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of catalytic activity (GO:0043086)|negative regulation of histone acetylation (GO:0035067)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleocytoplasmic transport (GO:0006913)|nucleosome assembly (GO:0006334)|nucleosome disassembly (GO:0006337)|regulation of catalytic activity (GO:0050790)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|protein complex (GO:0043234)	DNA binding (GO:0003677)|histone binding (GO:0042393)|protein phosphatase inhibitor activity (GO:0004864)|protein phosphatase type 2A regulator activity (GO:0008601)			endometrium(2)|kidney(1)|lung(2)	5		Myeloproliferative disorder(178;0.204)		GBM - Glioblastoma multiforme(294;3.1e-09)		TCGAGTCAAACGCAGAATAAA	0.418			T	NUP214	AML																																			Dom	yes		9	9q34	6418	SET translocation		L	0								C	MET/THR,MET/THR	0,4406		0,0,2203	40.0	36.0	38.0		557,518	5.2	1.0	9	dbSNP_134	38	6,8594	5.0+/-18.6	0,6,4294	yes	missense,missense	SET	NM_001122821.1,NM_003011.3	81,81	0,6,6497	TT,TC,CC		0.0698,0.0,0.0461	benign,benign	186/291,173/278	131455942	6,13000	2203	4300	6503	SO:0001583	missense	0			M93651	CCDS6907.1, CCDS48037.1, CCDS59149.1, CCDS59150.1	9q34	2014-06-25	2014-06-25		ENSG00000119335	ENSG00000119335			10760	protein-coding gene	gene with protein product	"""protein phosphatase type 2A inhibitor"", ""Template-Activating Factor-I, chromatin remodelling factor"""	600960	"""SET translocation (myeloid leukemia-associated)"""			1630450, 8626647	Standard	NM_003011		Approved	PHAPII, 2PP2A, IPP2A2	uc022bol.1	Q01105	OTTHUMG00000020755	ENST00000372692.4:c.557C>T	9.37:g.131455942C>T	ENSP00000361777:p.Thr186Met		A5A5H4|A6NGV1|B4DUE2|Q15541|Q5VXV1|Q5VXV2|Q6FHZ5	Missense_Mutation	SNP	pfam_NAP_family	p.T186M	ENST00000372692.4	37	c.557	CCDS48037.1	9	.	.	.	.	.	.	.	.	.	.	C	16.64	3.180713	0.57800	0.0	6.98E-4	ENSG00000119335	ENST00000372692;ENST00000409104;ENST00000322030;ENST00000372688;ENST00000372686	T;T;T;T;T	0.26373	1.74;1.74;1.74;1.74;1.74	5.2	5.2	0.72013	.	0.000000	0.85682	D	0.000000	T	0.19208	0.0461	N	0.25426	0.745	0.80722	D	1	P;B;B	0.34629	0.46;0.383;0.386	B;B;B	0.26094	0.066;0.062;0.064	T	0.03384	-1.1042	10	0.45353	T	0.12	.	17.7102	0.88319	0.0:1.0:0.0:0.0	.	162;173;186	A6NGV1;Q01105-2;Q01105	.;.;SET_HUMAN	M	186;164;173;162;161	ENSP00000361777:T186M;ENSP00000387321:T164M;ENSP00000318012:T173M;ENSP00000361773:T162M;ENSP00000361771:T161M	ENSP00000318012:T173M	T	+	2	0	SET	130495763	1.000000	0.71417	0.974000	0.42286	0.982000	0.71751	6.995000	0.76257	2.427000	0.82271	0.555000	0.69702	ACG	SET	-	pfam_NAP_family	ENSG00000119335		0.418	SET-001	KNOWN	basic|CCDS	protein_coding	SET	HGNC	protein_coding	OTTHUMT00000054476.2	-	0.00	29	0	C	NM_001122821		131455942	+1	tier1	rs150832256	no_errors	ENST00000372692	ensembl	human	known	74_37	missense	43.75	9	7	SNP	1.000	T
SGOL2	151246	genome.wustl.edu	37	2	201436414	201436414	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr2:201436414G>A	ENST00000357799.4	+	7	1443	c.1345G>A	c.(1345-1347)Ggt>Agt	p.G449S		NM_001160033.1|NM_001160046.1|NM_152524.5	NP_001153505.1|NP_001153518.1|NP_689737.4	Q562F6	SGOL2_HUMAN	shugoshin-like 2 (S. pombe)	449					meiotic sister chromatid cohesion, centromeric (GO:0051754)|mitotic cell cycle (GO:0000278)	chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|kinetochore (GO:0000776)|mitotic cohesin complex (GO:0030892)|nucleus (GO:0005634)				NS(2)|breast(2)|cervix(3)|endometrium(1)|kidney(2)|large_intestine(7)|lung(20)|ovary(2)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	46						AGAAGATCCCGGTTTTATTTT	0.403																																																	0													107.0	107.0	107.0					2																	201436414		1838	4076	5914	SO:0001583	missense	0			AY094614	CCDS42796.1	2q33.2	2008-02-05			ENSG00000163535	ENSG00000163535			30812	protein-coding gene	gene with protein product		612425					Standard	NM_001160046		Approved	TRIPIN, FLJ25211	uc002uvw.2	Q562F6	OTTHUMG00000154535	ENST00000357799.4:c.1345G>A	2.37:g.201436414G>A	ENSP00000350447:p.Gly449Ser		Q53RR9|Q53T20|Q86XY4|Q8IWK2|Q8IZK1|Q8N1Q5|Q96LQ3	Missense_Mutation	SNP	NULL	p.G449S	ENST00000357799.4	37	c.1345	CCDS42796.1	2	.	.	.	.	.	.	.	.	.	.	G	3.766	-0.048521	0.07407	.	.	ENSG00000163535	ENST00000357799	T	0.43294	0.95	5.15	-3.8	0.04307	.	1.610810	0.03091	N	0.159831	T	0.19805	0.0476	N	0.08118	0	0.09310	N	1	B;B;B	0.18166	0.026;0.026;0.026	B;B;B	0.06405	0.002;0.002;0.002	T	0.08785	-1.0705	10	0.27082	T	0.32	0.106	4.1916	0.10424	0.6324:0.109:0.1501:0.1085	.	449;449;449	B7Z7S9;Q562F6-2;Q562F6	.;.;SGOL2_HUMAN	S	449	ENSP00000350447:G449S	ENSP00000350447:G449S	G	+	1	0	SGOL2	201144659	0.000000	0.05858	0.000000	0.03702	0.104000	0.19210	-0.807000	0.04520	-0.590000	0.05866	0.585000	0.79938	GGT	SGOL2	-	NULL	ENSG00000163535		0.403	SGOL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SGOL2	HGNC	protein_coding	OTTHUMT00000335834.1		0.00	27	0	G	NM_152524		201436414	+1			no_errors	ENST00000357799	ensembl	human	known	74_37	missense	6.06	31	2	SNP	0.000	A
SH3KBP1	30011	genome.wustl.edu	37	X	19713154	19713154	+	Intron	SNP	G	G	A			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chrX:19713154G>A	ENST00000397821.3	-	5	811				SH3KBP1_ENST00000379698.4_Intron|SH3KBP1_ENST00000379697.3_Missense_Mutation_p.P179L	NM_031892.2	NP_114098.1	Q96B97	SH3K1_HUMAN	SH3-domain kinase binding protein 1						apoptotic process (GO:0006915)|cell migration (GO:0016477)|cell-cell signaling (GO:0007267)|cytoskeleton organization (GO:0007010)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|regulation of cell shape (GO:0008360)	cell-cell junction (GO:0005911)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|synapse (GO:0045202)				breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(8)|skin(4)	29						AGAAGCTGGAGGGAGACCTTC	0.547																																																	0													15.0	14.0	14.0					X																	19713154		876	1989	2865	SO:0001627	intron_variant	0			AF230904	CCDS14193.1, CCDS35213.1, CCDS55383.1	Xp22.1-p21.3	2008-02-05			ENSG00000147010	ENSG00000147010			13867	protein-coding gene	gene with protein product		300374				8889549, 7566098	Standard	NM_031892		Approved	CIN85	uc004czm.3	Q96B97	OTTHUMG00000021227	ENST00000397821.3:c.520+575C>T	X.37:g.19713154G>A			B7Z1D5|Q5JPT4|Q5JPT5|Q8IWX6|Q8IX98|Q96RN4|Q9NYR0	Missense_Mutation	SNP	pfam_SH3_2,pfam_SH3_domain,superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain,prints_p67phox,prints_SH3_domain,prints_Spectrin_alpha_SH3	p.P179L	ENST00000397821.3	37	c.536	CCDS14193.1	X	.	.	.	.	.	.	.	.	.	.	G	11.29	1.594604	0.28445	.	.	ENSG00000147010	ENST00000379702;ENST00000379726;ENST00000379697	T;T	0.39787	1.32;1.06	5.24	4.37	0.52481	.	.	.	.	.	T	0.31136	0.0787	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.05533	-1.0879	6	0.11794	T	0.64	.	7.9558	0.30042	0.1132:0.0:0.8868:0.0	.	.	.	.	L	120;115;179	ENSP00000369049:P115L;ENSP00000369019:P179L	ENSP00000369019:P179L	P	-	2	0	SH3KBP1	19623075	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.500000	0.45381	1.174000	0.42811	0.600000	0.82982	CCT	SH3KBP1	-	superfamily_SH3_domain	ENSG00000147010		0.547	SH3KBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SH3KBP1	HGNC	protein_coding	OTTHUMT00000055992.1	-	0.00	18	0	G	NM_031892		19713154	-1	tier1	-	no_errors	ENST00000379697	ensembl	human	known	74_37	missense	53.57	13	15	SNP	1.000	A
SHANK3	85358	genome.wustl.edu	37	22	51135697	51135698	+	Frame_Shift_Ins	INS	-	-	G			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr22:51135697_51135698insG	ENST00000262795.3	+	11	1331_1332	c.1331_1332insG	c.(1330-1335)gtggggfs	p.VG444fs	SHANK3_ENST00000445220.2_Intron|SHANK3_ENST00000414786.2_Intron	NM_033517.1	NP_277052.1	Q9BYB0	SHAN3_HUMAN	SH3 and multiple ankyrin repeat domains 3	435					adult behavior (GO:0030534)|alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor clustering (GO:0097113)|brain morphogenesis (GO:0048854)|dendritic spine morphogenesis (GO:0060997)|guanylate kinase-associated protein clustering (GO:0097117)|learning (GO:0007612)|MAPK cascade (GO:0000165)|memory (GO:0007613)|N-methyl-D-aspartate receptor clustering (GO:0097114)|negative regulation of actin filament bundle assembly (GO:0032232)|negative regulation of cell volume (GO:0045794)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of glutamate receptor signaling pathway (GO:1900451)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of synapse structural plasticity (GO:0051835)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic density assembly (GO:0097107)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of long term synaptic depression (GO:1900452)|regulation of long-term synaptic potentiation (GO:1900271)|social behavior (GO:0035176)|striatal medium spiny neuron differentiation (GO:0021773)|synapse assembly (GO:0007416)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|ciliary membrane (GO:0060170)|cytoplasm (GO:0005737)|neuron projection (GO:0043005)|neuron spine (GO:0044309)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	GKAP/Homer scaffold activity (GO:0030160)|identical protein binding (GO:0042802)|ionotropic glutamate receptor binding (GO:0035255)|protein C-terminus binding (GO:0008022)|scaffold protein binding (GO:0097110)|SH3 domain binding (GO:0017124)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|kidney(1)|lung(5)	8		all_cancers(38;3.75e-11)|all_epithelial(38;1.82e-09)|Breast(42;0.000448)|all_lung(38;0.000665)|Lung NSC(38;0.0104)|Ovarian(80;0.104)|Lung SC(80;0.162)|Hepatocellular(38;0.178)		BRCA - Breast invasive adenocarcinoma(115;0.22)		CCTGGAGGGGTGGGGGGGGCGC	0.752																																																	0																																										SO:0001589	frameshift_variant	0			AB051437		22q13.3	2013-11-14			ENSG00000251322	ENSG00000251322		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	14294	protein-coding gene	gene with protein product	"""proline rich synapse associated protein 2"", ""shank postsynaptic density protein"""	606230				11258795, 11431708, 10806096, 17173049	Standard	NM_033517		Approved	SPANK-2, prosap2, KIAA1650, PSAP2	uc031ryd.1	Q9BYB0	OTTHUMG00000150169	ENST00000262795.3:c.1339dupG	22.37:g.51135705_51135705dupG	ENSP00000442518:p.Val444fs		D7UT47|Q8TET3	Frame_Shift_Ins	INS	pfam_SAM_type1,pfam_Ankyrin_rpt,pfam_SAM_2,pfam_SH3_2,pfam_PDZ,superfamily_Ankyrin_rpt-contain_dom,superfamily_PDZ,superfamily_SAM/pointed,superfamily_SH3_domain,smart_Ankyrin_rpt,smart_SH3_domain,smart_PDZ,smart_SAM,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_PDZ,pfscan_SAM,pfscan_SH3_domain	p.A447fs	ENST00000262795.3	37	c.1331_1332		22																																																																																			SHANK3	-	NULL	ENSG00000251322		0.752	SHANK3-201	KNOWN	basic|appris_candidate_longest	protein_coding	SHANK3	HGNC	protein_coding			0.00	15	0	0	NM_001080420		51135698	+1			no_errors	ENST00000262795	ensembl	human	known	74_37	frame_shift_ins	33.33	4	2	INS	0.000:0.002	G
SHISA6	388336	genome.wustl.edu	37	17	11461312	11461312	+	Silent	SNP	G	G	A	rs367709694	byFrequency	TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr17:11461312G>A	ENST00000409168.3	+	4	1194	c.1194G>A	c.(1192-1194)acG>acA	p.T398T	SHISA6_ENST00000441885.3_Silent_p.T449T|SHISA6_ENST00000432116.3_Silent_p.T430T	NM_001173461.1	NP_001166932.1	Q6ZSJ9	SHSA6_HUMAN	shisa family member 6	398						alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)				breast(1)|endometrium(4)	5						TGCTCTCCACGGAGCGCCTGC	0.667													G|||	4	0.000798722	0.0015	0.0	5008	,	,		15711	0.0		0.0	False		,,,				2504	0.002																0								G	,,	1,1383		0,1,691	31.0	38.0	36.0		1194,1290,1347	-8.8	0.8	17		36	0,3182		0,0,1591	no	coding-synonymous,coding-synonymous,coding-synonymous	SHISA6	NM_001173461.1,NM_001173462.1,NM_207386.3	,,	0,1,2282	AA,AG,GG		0.0,0.0723,0.0219	,,	398/501,430/533,449/552	11461312	1,4565	692	1591	2283	SO:0001819	synonymous_variant	0			AK127379, AK128003	CCDS45615.1, CCDS54089.1, CCDS54090.1	17p13.1-p12	2013-07-31	2013-07-31		ENSG00000188803	ENSG00000188803		"""Shisa homologs"""	34491	protein-coding gene	gene with protein product			"""shisa homolog 6 (Xenopus laevis)"""				Standard	NM_207386		Approved	FLJ45455	uc002gnc.2	Q6ZSJ9	OTTHUMG00000154121	ENST00000409168.3:c.1194G>A	17.37:g.11461312G>A			B3KXV5|Q4PL63	Silent	SNP	NULL	p.T449	ENST00000409168.3	37	c.1347	CCDS54090.1	17																																																																																			SHISA6	-	NULL	ENSG00000188803		0.667	SHISA6-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	SHISA6	HGNC	protein_coding	OTTHUMT00000333970.2		0.00	33	0	G	NM_207386		11461312	+1			no_errors	ENST00000441885	ensembl	human	known	74_37	silent	10.00	18	2	SNP	0.131	A
SIK2	23235	genome.wustl.edu	37	11	111593398	111593398	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr11:111593398C>G	ENST00000304987.3	+	14	2238	c.2065C>G	c.(2065-2067)Ctt>Gtt	p.L689V		NM_015191.1	NP_056006.1	Q9H0K1	SIK2_HUMAN	salt-inducible kinase 2	689					insulin receptor signaling pathway (GO:0008286)|intracellular signal transduction (GO:0035556)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of insulin receptor signaling pathway (GO:0046626)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(2)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(7)|prostate(3)|skin(1)|upper_aerodigestive_tract(3)	30						GAAGCCCAGCCTTCTGTCAAA	0.512																																																	0													131.0	130.0	130.0					11																	111593398		2201	4297	6498	SO:0001583	missense	0			AB018324	CCDS8347.1	11q23.1	2008-12-23	2008-12-23	2008-12-23	ENSG00000170145	ENSG00000170145			21680	protein-coding gene	gene with protein product		608973	"""SNF1-like kinase 2"""	SNF1LK2		15067358	Standard	NM_015191		Approved	KIAA0781, QIK, DKFZp434K1115, LOH11CR1I	uc001plt.3	Q9H0K1	OTTHUMG00000150644	ENST00000304987.3:c.2065C>G	11.37:g.111593398C>G	ENSP00000305976:p.Leu689Val		A8K5B8|B0YJ94|O94878|Q17RV0|Q6AZE2|Q76N03|Q8NCV7|Q96CZ8	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Ser/Thr_kinase_SIK1/2,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.L689V	ENST00000304987.3	37	c.2065	CCDS8347.1	11	.	.	.	.	.	.	.	.	.	.	C	13.02	2.111054	0.37242	.	.	ENSG00000170145	ENST00000304987	T	0.74842	-0.88	5.91	5.91	0.95273	.	0.128446	0.52532	D	0.000064	T	0.68842	0.3045	M	0.61703	1.905	0.45318	D	0.998317	B	0.25719	0.132	B	0.17098	0.017	T	0.62656	-0.6808	10	0.17832	T	0.49	.	13.1723	0.59606	0.0:0.9267:0.0:0.0733	.	689	Q9H0K1	SIK2_HUMAN	V	689	ENSP00000305976:L689V	ENSP00000305976:L689V	L	+	1	0	SIK2	111098608	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.381000	0.44336	2.808000	0.96608	0.655000	0.94253	CTT	SIK2	-	pirsf_Ser/Thr_kinase_SIK1/2	ENSG00000170145		0.512	SIK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIK2	HGNC	protein_coding	OTTHUMT00000319352.3	-	0.00	27	0	C	NM_015191		111593398	+1	tier1	-	no_errors	ENST00000304987	ensembl	human	known	74_37	missense	43.48	13	10	SNP	1.000	G
SLC30A10	55532	genome.wustl.edu	37	1	220089150	220089150	+	Silent	SNP	G	G	T			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr1:220089150G>T	ENST00000366926.3	-	4	1260	c.1099C>A	c.(1099-1101)Cga>Aga	p.R367R	SLC30A10_ENST00000484079.1_5'UTR|SLC30A10_ENST00000536446.1_Silent_p.R122R	NM_018713.2	NP_061183.2	Q6XR72	ZNT10_HUMAN	solute carrier family 30, member 10	367					zinc ion transport (GO:0006829)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cation transmembrane transporter activity (GO:0008324)			NS(1)|endometrium(1)|large_intestine(1)|lung(9)|skin(1)	13				GBM - Glioblastoma multiforme(131;0.051)|all cancers(67;0.209)		AAGATTTCTCGAATTTTTGTG	0.458																																					Colon(76;360 1614 43677 51136)												0													120.0	116.0	118.0					1																	220089150		2203	4300	6503	SO:0001819	synonymous_variant	0			AY212919	CCDS31026.1	1q41	2013-05-22			ENSG00000196660	ENSG00000196660		"""Solute carriers"""	25355	protein-coding gene	gene with protein product	"""zinc transporter 8"""	611146				15154973	Standard	NR_046437		Approved	DKFZp547M236, ZnT-10, ZRC1, ZNT8	uc001hlw.3	Q6XR72	OTTHUMG00000037434	ENST00000366926.3:c.1099C>A	1.37:g.220089150G>T			Q49AL9|Q9NPW0	Silent	SNP	pfam_Cation_efflux,tigrfam_Cation_efflux	p.R367	ENST00000366926.3	37	c.1099	CCDS31026.1	1																																																																																			SLC30A10	-	pfam_Cation_efflux,tigrfam_Cation_efflux	ENSG00000196660		0.458	SLC30A10-004	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC30A10	HGNC	protein_coding	OTTHUMT00000357709.1	-	0.00	76	0	G	NM_018713		220089150	-1	tier1	-	no_errors	ENST00000366926	ensembl	human	known	74_37	silent	5.71	66	4	SNP	1.000	T
SLC30A10	55532	genome.wustl.edu	37	1	220091715	220091715	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr1:220091715G>T	ENST00000366926.3	-	3	1001	c.840C>A	c.(838-840)gaC>gaA	p.D280E	SLC30A10_ENST00000484079.1_5'UTR|SLC30A10_ENST00000536446.1_Missense_Mutation_p.D35E	NM_018713.2	NP_061183.2	Q6XR72	ZNT10_HUMAN	solute carrier family 30, member 10	280					zinc ion transport (GO:0006829)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cation transmembrane transporter activity (GO:0008324)			NS(1)|endometrium(1)|large_intestine(1)|lung(9)|skin(1)	13				GBM - Glioblastoma multiforme(131;0.051)|all cancers(67;0.209)		TCAGGCTGGGGTCAATGTAAC	0.527																																					Colon(76;360 1614 43677 51136)												0													169.0	151.0	157.0					1																	220091715		2203	4300	6503	SO:0001583	missense	0			AY212919	CCDS31026.1	1q41	2013-05-22			ENSG00000196660	ENSG00000196660		"""Solute carriers"""	25355	protein-coding gene	gene with protein product	"""zinc transporter 8"""	611146				15154973	Standard	NR_046437		Approved	DKFZp547M236, ZnT-10, ZRC1, ZNT8	uc001hlw.3	Q6XR72	OTTHUMG00000037434	ENST00000366926.3:c.840C>A	1.37:g.220091715G>T	ENSP00000355893:p.Asp280Glu		Q49AL9|Q9NPW0	Missense_Mutation	SNP	pfam_Cation_efflux,tigrfam_Cation_efflux	p.D280E	ENST00000366926.3	37	c.840	CCDS31026.1	1	.	.	.	.	.	.	.	.	.	.	G	21.1	4.100231	0.76983	.	.	ENSG00000196660	ENST00000366926;ENST00000536446	D;D	0.85013	-1.93;-1.93	6.01	4.13	0.48395	.	0.107297	0.64402	D	0.000005	D	0.93684	0.7982	H	0.95470	3.675	0.80722	D	1	D	0.89917	1.0	D	0.77557	0.99	D	0.93430	0.6784	9	.	.	.	-52.5717	9.3985	0.38417	0.2668:0.0:0.7332:0.0	.	280	Q6XR72	ZNT10_HUMAN	E	280;35	ENSP00000355893:D280E;ENSP00000439489:D35E	.	D	-	3	2	SLC30A10	218158338	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	2.062000	0.41413	0.867000	0.35654	0.585000	0.79938	GAC	SLC30A10	-	pfam_Cation_efflux,tigrfam_Cation_efflux	ENSG00000196660		0.527	SLC30A10-004	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC30A10	HGNC	protein_coding	OTTHUMT00000357709.1	-	0.00	58	0	G	NM_018713		220091715	-1	tier1	-	no_errors	ENST00000366926	ensembl	human	known	74_37	missense	6.25	75	5	SNP	1.000	T
SLC35G3	146861	genome.wustl.edu	37	17	33521184	33521184	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr17:33521184C>T	ENST00000297307.5	-	1	228	c.143G>A	c.(142-144)gGc>gAc	p.G48D	RP11-799D4.2_ENST00000590144.1_RNA	NM_152462.2	NP_689675.1	Q8N808	S35G3_HUMAN	solute carrier family 35, member G3	48						integral component of membrane (GO:0016021)											AGCAGGCAGGCCCCCACCCAG	0.682																																																	0													47.0	53.0	51.0					17																	33521184		2203	4297	6500	SO:0001583	missense	0			AK097473	CCDS11293.1	17q21.1	2013-05-22	2011-08-03	2011-08-03	ENSG00000164729	ENSG00000164729		"""Solute carriers"""	26848	protein-coding gene	gene with protein product			"""transmembrane protein 21A"", ""acyl-malonyl condensing enzyme 1"""	TMEM21A, AMAC1			Standard	NM_152462		Approved	FLJ40154	uc002hjd.2	Q8N808	OTTHUMG00000132929	ENST00000297307.5:c.143G>A	17.37:g.33521184C>T	ENSP00000297307:p.Gly48Asp		B9EGE9	Missense_Mutation	SNP	pfam_DMT	p.G48D	ENST00000297307.5	37	c.143	CCDS11293.1	17	.	.	.	.	.	.	.	.	.	.	C	12.30	1.896592	0.33442	.	.	ENSG00000164729	ENST00000297307	T	0.33438	1.41	.	.	.	.	0.000000	0.45867	D	0.000333	T	0.33177	0.0854	L	0.27053	0.805	0.34310	D	0.68534	D	0.89917	1.0	D	0.91635	0.999	T	0.43686	-0.9376	9	0.66056	D	0.02	-7.1546	3.5985	0.08016	2.0E-4:0.5013:0.4982:2.0E-4	.	48	Q8N808	S35G3_HUMAN	D	48	ENSP00000297307:G48D	ENSP00000297307:G48D	G	-	2	0	SLC35G3	30545297	0.257000	0.24022	0.379000	0.26080	0.382000	0.30200	0.823000	0.27366	0.064000	0.16427	0.064000	0.15345	GGC	SLC35G3	-	NULL	ENSG00000164729		0.682	SLC35G3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC35G3	HGNC	protein_coding	OTTHUMT00000256445.2		0.00	114	0	C	NM_152462		33521184	-1			no_errors	ENST00000297307	ensembl	human	known	74_37	missense	6.25	60	4	SNP	0.997	T
SLC7A7	9056	genome.wustl.edu	37	14	23243154	23243154	+	Silent	SNP	G	G	T	rs386833808		TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr14:23243154G>T	ENST00000397532.3	-	9	1942	c.1417C>A	c.(1417-1419)Cga>Aga	p.R473R	SLC7A7_ENST00000554061.1_5'UTR|SLC7A7_ENST00000397528.4_Silent_p.R473R|SLC7A7_ENST00000397529.2_Silent_p.R473R|SLC7A7_ENST00000554517.1_Silent_p.R207R|SLC7A7_ENST00000555702.1_Silent_p.R473R|SLC7A7_ENST00000285850.7_Silent_p.R473R			Q9UM01	YLAT1_HUMAN	solute carrier family 7 (amino acid transporter light chain, y+L system), member 7	473					amino acid transport (GO:0006865)|blood coagulation (GO:0007596)|cellular amino acid metabolic process (GO:0006520)|ion transport (GO:0006811)|leukocyte migration (GO:0050900)|protein complex assembly (GO:0006461)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	amino acid transmembrane transporter activity (GO:0015171)			breast(2)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|skin(2)	20	all_cancers(95;8.44e-05)			GBM - Glioblastoma multiforme(265;0.00741)		ACGATCCTTCGGAGGTAAAGC	0.493																																																	0			GRCh37	CM000427	SLC7A7	M							85.0	76.0	79.0					14																	23243154		2203	4300	6503	SO:0001819	synonymous_variant	0			AF092032	CCDS9574.1	14q11.2	2014-09-17	2011-07-12		ENSG00000155465	ENSG00000155465		"""Solute carriers"""	11065	protein-coding gene	gene with protein product		603593		LPI		9829974	Standard	NM_001126106		Approved	y+LAT-1	uc001wgs.4	Q9UM01	OTTHUMG00000028692	ENST00000397532.3:c.1417C>A	14.37:g.23243154G>T			B2RAU0|D3DS26|O95984|Q53XC1|Q86U07|Q9P2V5	Silent	SNP	pfam_AA-permease/SLC12A_dom,pirsf_AA/rel_permease1	p.R473	ENST00000397532.3	37	c.1417	CCDS9574.1	14																																																																																			SLC7A7	-	pirsf_AA/rel_permease1	ENSG00000155465		0.493	SLC7A7-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SLC7A7	HGNC	protein_coding	OTTHUMT00000071636.3	-	0.00	43	0	G			23243154	-1	tier1	-	no_errors	ENST00000285850	ensembl	human	known	74_37	silent	10.00	27	3	SNP	1.000	T
SLC9A3R1	9368	genome.wustl.edu	37	17	72764629	72764629	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr17:72764629C>G	ENST00000262613.5	+	6	1106	c.911C>G	c.(910-912)cCa>cGa	p.P304R	SLC9A3R1_ENST00000413388.2_Missense_Mutation_p.P148R	NM_004252.4	NP_004243.1	O14745	NHRF1_HUMAN	solute carrier family 9, subfamily A (NHE3, cation proton antiporter 3), member 3 regulator 1	304					actin cytoskeleton organization (GO:0030036)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|bile acid secretion (GO:0032782)|cellular phosphate ion homeostasis (GO:0030643)|cellular protein localization (GO:0034613)|glutathione transport (GO:0034635)|microvillus assembly (GO:0030033)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of platelet-derived growth factor receptor signaling pathway (GO:0010642)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of sodium ion transport (GO:0010766)|negative regulation of sodium:proton antiporter activity (GO:0032416)|phospholipase C-activating dopamine receptor signaling pathway (GO:0060158)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|protein complex assembly (GO:0006461)|regulation of excretion (GO:0044062)|regulation of protein kinase activity (GO:0045859)|regulation of sodium:proton antiporter activity (GO:0032415)|renal absorption (GO:0070293)|renal phosphate ion absorption (GO:0097291)|renal sodium ion transport (GO:0003096)|Wnt signaling pathway (GO:0016055)	actin cytoskeleton (GO:0015629)|apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|cell periphery (GO:0071944)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|membrane raft (GO:0045121)|microvillus (GO:0005902)|microvillus membrane (GO:0031528)|plasma membrane (GO:0005886)|sperm midpiece (GO:0097225)|vesicle (GO:0031982)	beta-2 adrenergic receptor binding (GO:0031698)|beta-catenin binding (GO:0008013)|chloride channel regulator activity (GO:0017081)|growth factor receptor binding (GO:0070851)|PDZ domain binding (GO:0030165)|phosphatase binding (GO:0019902)|protein self-association (GO:0043621)|receptor binding (GO:0005102)			large_intestine(4)	4						GACAGCCCCCCAAAACAGGAC	0.582																																																	0													183.0	191.0	188.0					17																	72764629		2203	4300	6503	SO:0001583	missense	0			AF015926	CCDS11705.1	17q25.1	2014-09-04	2012-03-22		ENSG00000109062	ENSG00000109062			11075	protein-coding gene	gene with protein product		604990	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 3 regulatory factor 1"", ""solute carrier family 9 (sodium/hydrogen exchanger), isoform 3 regulator 1"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 3 regulator 1"""			9314537, 9430655	Standard	NM_004252		Approved	NHERF, EBP50	uc002jlo.4	O14745	OTTHUMG00000178863	ENST00000262613.5:c.911C>G	17.37:g.72764629C>G	ENSP00000262613:p.Pro304Arg		B3KY21|O43552|Q86WQ5	Missense_Mutation	SNP	pfam_PDZ,pfam_EBP50_C-term,superfamily_PDZ,smart_PDZ,pirsf_NaH_exchngr_reg_CF_NHE-RF,pfscan_PDZ	p.P304R	ENST00000262613.5	37	c.911	CCDS11705.1	17	.	.	.	.	.	.	.	.	.	.	C	4.289	0.052845	0.08291	.	.	ENSG00000109062	ENST00000262613	T	0.28895	1.59	4.95	1.43	0.22495	.	1.375620	0.04370	N	0.358899	T	0.20170	0.0485	N	0.19112	0.55	0.23381	N	0.997799	B	0.02656	0.0	B	0.01281	0.0	T	0.24440	-1.0160	10	0.16420	T	0.52	-14.8033	7.6841	0.28530	0.7695:0.1456:0.0849:0.0	.	304	O14745	NHRF1_HUMAN	R	304	ENSP00000262613:P304R	ENSP00000262613:P304R	P	+	2	0	SLC9A3R1	70276224	1.000000	0.71417	0.993000	0.49108	0.375000	0.29983	0.449000	0.21744	-0.029000	0.13827	-1.521000	0.00933	CCA	SLC9A3R1	-	pirsf_NaH_exchngr_reg_CF_NHE-RF	ENSG00000109062		0.582	SLC9A3R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC9A3R1	HGNC	protein_coding	OTTHUMT00000443671.1	-	0.00	73	0	C			72764629	+1	tier1	-	no_errors	ENST00000262613	ensembl	human	known	74_37	missense	64.79	25	46	SNP	0.998	G
SLU7	10569	genome.wustl.edu	37	5	159834513	159834513	+	Silent	SNP	T	T	C			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr5:159834513T>C	ENST00000297151.4	-	11	1482	c.1095A>G	c.(1093-1095)aaA>aaG	p.K365K		NM_006425.4	NP_006416.3	O95391	SLU7_HUMAN	SLU7 splicing factor homolog (S. cerevisiae)	365					alternative mRNA splicing, via spliceosome (GO:0000380)|cellular response to heat (GO:0034605)|intracellular protein transport (GO:0006886)|mRNA 3'-splice site recognition (GO:0000389)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|small nuclear ribonucleoprotein complex (GO:0030532)|spliceosomal complex (GO:0005681)	pre-mRNA 3'-splice site binding (GO:0030628)|second spliceosomal transesterification activity (GO:0000386)|zinc ion binding (GO:0008270)			endometrium(4)|kidney(5)|large_intestine(4)|lung(6)|ovary(1)	20	Renal(175;0.00196)	Medulloblastoma(196;0.0354)|all_neural(177;0.116)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			TCTGCTGTTCTTTGAAATCTT	0.368																																																	0													158.0	148.0	151.0					5																	159834513		2203	4300	6503	SO:0001819	synonymous_variant	0			AF101074	CCDS4352.1	5q33.3	2010-04-13			ENSG00000164609	ENSG00000164609			16939	protein-coding gene	gene with protein product	zinc knuckle motif containing	605974				10197984, 15728250	Standard	NM_006425		Approved	9G8	uc003lyg.3	O95391	OTTHUMG00000130324	ENST00000297151.4:c.1095A>G	5.37:g.159834513T>C			D3DQK2|Q3LUJ0|Q3LUJ1|Q6RXQ5|Q96FM9	Silent	SNP	pfam_Slu7,superfamily_Znf_CCHC	p.K365	ENST00000297151.4	37	c.1095	CCDS4352.1	5																																																																																			SLU7	-	pfam_Slu7	ENSG00000164609		0.368	SLU7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLU7	HGNC	protein_coding	OTTHUMT00000252673.1	-	0.00	50	0	T	NM_006425		159834513	-1	tier1	-	no_errors	ENST00000297151	ensembl	human	known	74_37	silent	35.42	31	17	SNP	0.999	C
SMARCD1	6602	genome.wustl.edu	37	12	50488347	50488347	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr12:50488347G>C	ENST00000394963.4	+	10	1659	c.1261G>C	c.(1261-1263)Gac>Cac	p.D421H	SMARCD1_ENST00000548573.1_Missense_Mutation_p.D219H|SMARCD1_ENST00000381513.4_Missense_Mutation_p.D421H	NM_003076.4	NP_003067.3			SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 1											NS(1)|breast(2)|endometrium(2)|large_intestine(6)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)	18						TGCTACTCTAGACAACAAGGT	0.463																																																	0													134.0	132.0	132.0					12																	50488347		2203	4300	6503	SO:0001583	missense	0			U66617	CCDS8797.2, CCDS8798.2	12q13-q14	2008-08-05			ENSG00000066117	ENSG00000066117			11106	protein-coding gene	gene with protein product		601735				8804307, 9693044, 12917342	Standard	NM_003076		Approved	BAF60A, Rsc6p, CRACD1	uc001rvx.4	Q96GM5	OTTHUMG00000150194	ENST00000394963.4:c.1261G>C	12.37:g.50488347G>C	ENSP00000378414:p.Asp421His			Missense_Mutation	SNP	pfam_SWIB_MDM2_domain,superfamily_SWIB_MDM2_domain,smart_SWIB_domain	p.D421H	ENST00000394963.4	37	c.1261	CCDS8797.2	12	.	.	.	.	.	.	.	.	.	.	G	28.7	4.946279	0.92593	.	.	ENSG00000066117	ENST00000394963;ENST00000381513;ENST00000542914;ENST00000548573	T;T	0.63744	-0.06;0.02	5.61	5.61	0.85477	.	0.000000	0.85682	D	0.000000	D	0.85762	0.5772	H	0.94620	3.56	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.80764	0.991;0.994;0.988	D	0.88934	0.3375	10	0.87932	D	0	-16.0504	20.0173	0.97481	0.0:0.0:1.0:0.0	.	219;421;421	F8VRQ4;Q96GM5-2;Q96GM5	.;.;SMRD1_HUMAN	H	421;421;197;219	ENSP00000378414:D421H;ENSP00000370924:D421H	ENSP00000370924:D421H	D	+	1	0	SMARCD1	48774614	1.000000	0.71417	1.000000	0.80357	0.929000	0.56500	9.804000	0.99143	2.814000	0.96858	0.591000	0.81541	GAC	SMARCD1	-	NULL	ENSG00000066117		0.463	SMARCD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMARCD1	HGNC	protein_coding	OTTHUMT00000316759.2	-	0.00	60	0	G	NM_003076		50488347	+1	tier1	-	no_errors	ENST00000394963	ensembl	human	known	74_37	missense	39.02	25	16	SNP	1.000	C
SMNDC1	10285	genome.wustl.edu	37	10	112057441	112057441	+	Silent	SNP	G	G	C	rs150361329	byFrequency	TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr10:112057441G>C	ENST00000369603.5	-	4	512	c.309C>G	c.(307-309)acC>acG	p.T103T	SMNDC1_ENST00000369592.1_Silent_p.T103T|SMNDC1_ENST00000471297.1_5'UTR	NM_005871.3	NP_005862.1	O75940	SPF30_HUMAN	survival motor neuron domain containing 1	103	Tudor. {ECO:0000255|PROSITE- ProRule:PRU00211}.				apoptotic process (GO:0006915)|mRNA processing (GO:0006397)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	poly(A) RNA binding (GO:0044822)			haematopoietic_and_lymphoid_tissue(1)|lung(2)|skin(1)	4		Breast(234;0.174)		Epithelial(162;6.86e-05)|all cancers(201;0.00149)|BRCA - Breast invasive adenocarcinoma(275;0.119)		TGATTGCAGCGGTGCCATTTT	0.463																																																	0													179.0	154.0	162.0					10																	112057441		2203	4300	6503	SO:0001819	synonymous_variant	0			AF083385	CCDS7565.1	10q23	2013-01-23			ENSG00000119953	ENSG00000119953		"""Tudor domain containing"""	16900	protein-coding gene	gene with protein product	"""splicing factor 30, survival of motor neuron-related"", ""tudor domain containing 16C"""	603519				9731529, 9817934	Standard	NM_005871		Approved	SPF30, SMNR, TDRD16C	uc001kzc.4	O75940	OTTHUMG00000019036	ENST00000369603.5:c.309C>G	10.37:g.112057441G>C			B2RA27|D3DRB1|Q5T3K6	Silent	SNP	pfam_Survival_motor_neuron,smart_Tudor,pfscan_Tudor	p.T103	ENST00000369603.5	37	c.309	CCDS7565.1	10																																																																																			SMNDC1	-	pfam_Survival_motor_neuron,smart_Tudor,pfscan_Tudor	ENSG00000119953		0.463	SMNDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMNDC1	HGNC	protein_coding	OTTHUMT00000050325.2	-	0.00	71	0	G	NM_005871		112057441	-1	tier1	-	no_errors	ENST00000369603	ensembl	human	known	74_37	silent	40.62	37	26	SNP	0.956	C
SNX6	58533	genome.wustl.edu	37	14	35074923	35074923	+	Splice_Site	SNP	T	T	C			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr14:35074923T>C	ENST00000362031.4	-	5	337	c.307A>G	c.(307-309)Att>Gtt	p.I103V	SNX6_ENST00000396526.3_5'UTR|SNX6_ENST00000355110.5_5'UTR|SNX6_ENST00000396534.3_5'UTR	NM_152233.2	NP_689419.2	Q9UNH7	SNX6_HUMAN	sorting nexin 6	91	PX. {ECO:0000255|PROSITE- ProRule:PRU00147}.|Phosphatidylinositol bisphosphate binding. {ECO:0000250}.				intracellular protein transport (GO:0006886)|negative regulation of epidermal growth factor-activated receptor activity (GO:0007175)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|retrograde transport, endosome to Golgi (GO:0042147)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|early endosome membrane (GO:0031901)|intracellular (GO:0005622)|nucleus (GO:0005634)	phosphatidylinositol binding (GO:0035091)|protein homodimerization activity (GO:0042803)			endometrium(4)|lung(1)|ovary(1)	6	Breast(36;0.0473)|Hepatocellular(127;0.158)		LUAD - Lung adenocarcinoma(48;0.00169)|Lung(238;0.00199)|Epithelial(34;0.187)	GBM - Glioblastoma multiforme(112;0.0245)		GCTGGTGGAATCTGTAACAGG	0.413																																																	0													92.0	86.0	88.0					14																	35074923		2203	4300	6503	SO:0001630	splice_region_variant	0			AF121856	CCDS9648.1, CCDS41942.1	14q13	2010-08-05			ENSG00000129515	ENSG00000129515		"""Sorting nexins"""	14970	protein-coding gene	gene with protein product		606098				11279102	Standard	XM_006720224		Approved		uc001wsf.1	Q9UNH7	OTTHUMG00000140213	ENST00000362031.4:c.307-1A>G	14.37:g.35074923T>C			C0H5W9|Q9Y449	Missense_Mutation	SNP	pfam_Phox,pfam_Vps5_C,pfam_BAR_dom,superfamily_Phox,pirsf_Snx5_Snx6,pfscan_Phox	p.I103V	ENST00000362031.4	37	c.307	CCDS41942.1	14	.	.	.	.	.	.	.	.	.	.	T	15.58	2.876133	0.51801	.	.	ENSG00000129515	ENST00000362031;ENST00000557265;ENST00000555648	T;T;T	0.42513	0.97;0.97;0.97	5.07	5.07	0.68467	Phox homologous domain (4);	0.000000	0.85682	D	0.000000	T	0.54224	0.1845	L	0.47078	1.49	0.80722	D	1	B	0.31153	0.31	P	0.51742	0.678	T	0.49322	-0.8952	10	0.22706	T	0.39	-7.8477	15.533	0.75980	0.0:0.0:0.0:1.0	.	91	Q9UNH7	SNX6_HUMAN	V	103;66;121	ENSP00000355217:I103V;ENSP00000452577:I66V;ENSP00000452520:I121V	ENSP00000355217:I103V	I	-	1	0	SNX6	34144674	1.000000	0.71417	1.000000	0.80357	0.784000	0.44337	7.930000	0.87610	2.212000	0.71576	0.460000	0.39030	ATT	SNX6	-	pfam_Phox,superfamily_Phox,pirsf_Snx5_Snx6,pfscan_Phox	ENSG00000129515		0.413	SNX6-002	KNOWN	downstream_ATG|basic|appris_principal|CCDS	protein_coding	SNX6	HGNC	protein_coding	OTTHUMT00000276642.3	-	0.00	83	0	T		Missense_Mutation	35074923	-1	tier1	-	no_errors	ENST00000362031	ensembl	human	known	74_37	missense	29.49	55	23	SNP	1.000	C
SMOC1	64093	genome.wustl.edu	37	14	70477509	70477509	+	Silent	SNP	C	C	T			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr14:70477509C>T	ENST00000381280.4	+	8	956	c.703C>T	c.(703-705)Ctg>Ttg	p.L235L	SMOC1_ENST00000361956.3_Silent_p.L235L	NM_001034852.2|NM_022137.5	NP_001030024.1|NP_071420.1	Q9H4F8	SMOC1_HUMAN	SPARC related modular calcium binding 1	235	Thyroglobulin type-1 2. {ECO:0000255|PROSITE-ProRule:PRU00500}.				cell differentiation (GO:0030154)|extracellular matrix organization (GO:0030198)|eye development (GO:0001654)|limb development (GO:0060173)|positive regulation of cell-substrate adhesion (GO:0010811)|regulation of osteoblast differentiation (GO:0045667)|signal transduction (GO:0007165)	basement membrane (GO:0005604)	calcium ion binding (GO:0005509)|extracellular matrix binding (GO:0050840)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(10)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	21				all cancers(60;0.00417)|BRCA - Breast invasive adenocarcinoma(234;0.0119)|OV - Ovarian serous cystadenocarcinoma(108;0.028)		GCAGAGTGCCCTGGAAGAGGC	0.532																																																	0													111.0	118.0	116.0					14																	70477509		2203	4300	6503	SO:0001819	synonymous_variant	0			AJ249900	CCDS9798.1, CCDS32110.1	14q24.1	2010-08-05			ENSG00000198732	ENSG00000198732			20318	protein-coding gene	gene with protein product		608488				12130637	Standard	NM_001034852		Approved		uc001xlt.2	Q9H4F8		ENST00000381280.4:c.703C>T	14.37:g.70477509C>T			A8K1S3|B2R7P5|Q96F78	Silent	SNP	pfam_Thyroglobulin_1,pfam_SPARC/Testican_Ca-bd-dom,pfam_Kazal_dom,superfamily_Thyroglobulin_1,smart_Kazal_dom,smart_Thyroglobulin_1,pfscan_Thyroglobulin_1	p.L235	ENST00000381280.4	37	c.703	CCDS9798.1	14																																																																																			SMOC1	-	pfam_Thyroglobulin_1,superfamily_Thyroglobulin_1,pfscan_Thyroglobulin_1	ENSG00000198732		0.532	SMOC1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	SMOC1	HGNC	protein_coding	OTTHUMT00000412467.1	-	0.00	56	0	C			70477509	+1	tier1	-	no_errors	ENST00000361956	ensembl	human	known	74_37	silent	53.85	18	21	SNP	1.000	T
SPAG17	200162	genome.wustl.edu	37	1	118583397	118583397	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr1:118583397G>A	ENST00000336338.5	-	22	3187	c.3122C>T	c.(3121-3123)tCt>tTt	p.S1041F		NM_206996.2	NP_996879.1	Q6Q759	SPG17_HUMAN	sperm associated antigen 17	1041						cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)|sperm flagellum (GO:0036126)				NS(1)|biliary_tract(1)|breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(30)|liver(2)|lung(56)|ovary(3)|prostate(5)|skin(5)|upper_aerodigestive_tract(6)|urinary_tract(1)	123	Esophageal squamous(2;0.0106)	all_cancers(81;0.0204)|all_lung(203;9.46e-05)|Lung NSC(69;0.000675)|all_epithelial(167;0.01)		Lung(183;0.0858)		CCCCCCATCAGAAGGATACAG	0.348																																																	0													131.0	112.0	119.0					1																	118583397		2203	4300	6503	SO:0001583	missense	0				CCDS899.1	1p12	2014-01-21			ENSG00000155761	ENSG00000155761			26620	protein-coding gene	gene with protein product							Standard	NM_206996		Approved	FLJ34497, PF6, RP4-776P7.2, CT143	uc001ehk.2	Q6Q759	OTTHUMG00000012198	ENST00000336338.5:c.3122C>T	1.37:g.118583397G>A	ENSP00000337804:p.Ser1041Phe		Q8NAZ1|Q9NT21	Missense_Mutation	SNP	NULL	p.S1041F	ENST00000336338.5	37	c.3122	CCDS899.1	1	.	.	.	.	.	.	.	.	.	.	G	18.94	3.728916	0.69074	.	.	ENSG00000155761	ENST00000336338	T	0.30182	1.54	5.7	5.7	0.88788	.	0.356930	0.26738	N	0.022745	T	0.43166	0.1235	L	0.51422	1.61	0.34375	D	0.692487	D	0.76494	0.999	D	0.73380	0.98	T	0.40156	-0.9578	10	0.72032	D	0.01	.	18.0154	0.89238	0.0:0.0:1.0:0.0	.	1041	Q6Q759	SPG17_HUMAN	F	1041	ENSP00000337804:S1041F	ENSP00000337804:S1041F	S	-	2	0	SPAG17	118384920	1.000000	0.71417	1.000000	0.80357	0.648000	0.38561	6.160000	0.71862	2.691000	0.91804	0.557000	0.71058	TCT	SPAG17	-	NULL	ENSG00000155761		0.348	SPAG17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPAG17	HGNC	protein_coding	OTTHUMT00000033723.1	-	0.00	96	0	G	NM_206996		118583397	-1	tier1	-	no_errors	ENST00000336338	ensembl	human	known	74_37	missense	28.09	64	25	SNP	0.998	A
SPATA5L1	79029	genome.wustl.edu	37	15	45713469	45713469	+	3'UTR	SNP	G	G	A			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr15:45713469G>A	ENST00000305560.6	+	0	2422				SPATA5L1_ENST00000533841.1_3'UTR	NM_024063.2	NP_076968.2	Q9BVQ7	SPA5L_HUMAN	spermatogenesis associated 5-like 1							cytoplasm (GO:0005737)	ATP binding (GO:0005524)			kidney(2)|large_intestine(3)|lung(1)|ovary(3)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	14		Lung NSC(122;8.3e-05)|all_lung(180;0.000547)|Melanoma(134;0.0417)		all cancers(107;7.31e-17)|GBM - Glioblastoma multiforme(94;6.28e-07)		CCTGTCGTTTGCAACTTCACA	0.299																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AK023232	CCDS10123.1	15q15.1	2010-04-21			ENSG00000171763	ENSG00000171763		"""ATPases / AAA-type"""	28762	protein-coding gene	gene with protein product						12477932	Standard	NM_024063		Approved	MGC5347, FLJ12286	uc001zve.3	Q9BVQ7	OTTHUMG00000131425	ENST00000305560.6:c.*61G>A	15.37:g.45713469G>A			C9JHR5|Q9H8W7|Q9HA41	RNA	SNP	-	NULL	ENST00000305560.6	37	NULL	CCDS10123.1	15																																																																																			SPATA5L1	-	-	ENSG00000171763		0.299	SPATA5L1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	SPATA5L1	HGNC	protein_coding	OTTHUMT00000254218.1	-	0.00	28	0	G	NM_024063		45713469	+1	tier1	-	no_errors	ENST00000533841	ensembl	human	putative	74_37	rna	46.88	17	15	SNP	0.029	A
SPP2	6694	genome.wustl.edu	37	2	234959516	234959516	+	Splice_Site	SNP	G	G	T			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr2:234959516G>T	ENST00000168148.3	+	1	173		c.e1+1		SPP2_ENST00000492481.1_Splice_Site|SPP2_ENST00000373368.1_Splice_Site	NM_006944.2	NP_008875.1	Q13103	SPP24_HUMAN	secreted phosphoprotein 2, 24kDa						bone remodeling (GO:0046849)|negative regulation of endopeptidase activity (GO:0010951)|protein complex assembly (GO:0006461)|skeletal system development (GO:0001501)	extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)	endopeptidase inhibitor activity (GO:0004866)			breast(1)|kidney(1)|large_intestine(2)|lung(6)|prostate(1)|skin(1)	12		Breast(86;0.0109)|Renal(207;0.019)|all_lung(227;0.13)|all_hematologic(139;0.182)		Epithelial(121;5.73e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000166)|Lung(119;0.00539)|LUSC - Lung squamous cell carcinoma(224;0.00846)		TCTTGCTCAGGTAAGGTATTC	0.478																																																	0													251.0	227.0	235.0					2																	234959516		2203	4300	6503	SO:0001630	splice_region_variant	0				CCDS2511.1	2q37.1	2012-08-14	2002-08-29		ENSG00000072080	ENSG00000072080			11256	protein-coding gene	gene with protein product		602637	"""secreted phosphoprotein 2, 24kD"""			9533032	Standard	XM_005246102		Approved	SPP24	uc002vvk.1	Q13103	OTTHUMG00000059208	ENST00000168148.3:c.85+1G>T	2.37:g.234959516G>T			A4QMV3|Q3B892|Q546M5	Splice_Site	SNP	-	e1+1	ENST00000168148.3	37	c.85+1	CCDS2511.1	2	.	.	.	.	.	.	.	.	.	.	G	16.33	3.093071	0.56075	.	.	ENSG00000072080	ENST00000373368;ENST00000168148	.	.	.	5.38	5.38	0.77491	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.6509	0.68797	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	SPP2	234624255	1.000000	0.71417	1.000000	0.80357	0.857000	0.48899	4.652000	0.61454	2.528000	0.85240	0.650000	0.86243	.	SPP2	-	-	ENSG00000072080		0.478	SPP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPP2	HGNC	protein_coding	OTTHUMT00000131313.3		0.00	71	0	G	NM_006944	Intron	234959516	+1			no_errors	ENST00000168148	ensembl	human	known	74_37	splice_site	6.00	47	3	SNP	1.000	T
SPTAN1	6709	genome.wustl.edu	37	9	131353868	131353868	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr9:131353868G>A	ENST00000372731.4	+	22	3229	c.3119G>A	c.(3118-3120)gGc>gAc	p.G1040D	SPTAN1_ENST00000372739.3_Missense_Mutation_p.G1040D|SPTAN1_ENST00000358161.5_Missense_Mutation_p.G1040D	NM_001195532.1|NM_003127.3	NP_001182461.1|NP_003118.2	Q13813	SPTN1_HUMAN	spectrin, alpha, non-erythrocytic 1	1040					actin filament capping (GO:0051693)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)	cuticular plate (GO:0032437)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|intracellular membrane-bounded organelle (GO:0043231)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|spectrin (GO:0008091)|vesicle (GO:0031982)|Z disc (GO:0030018)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(2)|breast(8)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(21)|liver(1)|lung(25)|ovary(5)|pancreas(1)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	87						GAGGAGCAAGGCAGCATAGCA	0.582																																					NSCLC(120;833 1744 2558 35612 37579)												0													75.0	77.0	76.0					9																	131353868		2203	4300	6503	SO:0001583	missense	0			M19725	CCDS6905.1, CCDS48036.1, CCDS75914.1	9q34.11	2013-01-10	2012-06-15		ENSG00000197694	ENSG00000197694		"""EF-hand domain containing"""	11273	protein-coding gene	gene with protein product	"""alpha-fodrin"""	182810				3336352	Standard	NM_003127		Approved		uc004bvm.4	Q13813	OTTHUMG00000020754	ENST00000372731.4:c.3119G>A	9.37:g.131353868G>A	ENSP00000361816:p.Gly1040Asp		Q13186|Q15324|Q16606|Q59EF1|Q5VXV5|Q5VXV6|Q7Z6M5|Q9P0V0	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_EF-hand_Ca_insen,pfam_SH3_domain,pfam_EF_hand_dom,pfam_SH3_2,superfamily_SH3_domain,smart_Spectrin/alpha-actinin,smart_SH3_domain,smart_EF_hand_dom,pfscan_EF_hand_dom,pfscan_SH3_domain,prints_Spectrin_alpha_SH3,prints_SH3_domain	p.G1040D	ENST00000372731.4	37	c.3119	CCDS6905.1	9	.	.	.	.	.	.	.	.	.	.	G	32	5.176652	0.94846	.	.	ENSG00000197694	ENST00000358161;ENST00000372731;ENST00000372739;ENST00000372719	T;T;T	0.50277	0.76;0.77;0.75	5.82	5.82	0.92795	.	0.000000	0.85682	D	0.000000	T	0.60753	0.2293	L	0.39898	1.24	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.83275	0.992;0.992;0.996;0.996;0.992	T	0.50294	-0.8845	10	0.20046	T	0.44	.	19.0792	0.93175	0.0:0.0:1.0:0.0	.	1040;1040;1040;1040;1040	A6NG51;B4DTV8;Q13813-3;Q13813-2;Q13813	.;.;.;.;SPTA2_HUMAN	D	1040	ENSP00000350882:G1040D;ENSP00000361816:G1040D;ENSP00000361824:G1040D	ENSP00000350882:G1040D	G	+	2	0	SPTAN1	130393689	1.000000	0.71417	1.000000	0.80357	0.932000	0.56968	9.238000	0.95380	2.755000	0.94549	0.591000	0.81541	GGC	SPTAN1	-	smart_Spectrin/alpha-actinin	ENSG00000197694		0.582	SPTAN1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	SPTAN1	HGNC	protein_coding	OTTHUMT00000054472.1	-	0.00	56	0	G	NM_003127		131353868	+1	tier1	-	no_errors	ENST00000358161	ensembl	human	known	74_37	missense	8.89	40	4	SNP	1.000	A
SSPO	23145	genome.wustl.edu	37	7	149511585	149511585	+	RNA	SNP	G	G	A	rs562328149		TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr7:149511585G>A	ENST00000378016.2	+	0	10245							A2VEC9	SSPO_HUMAN	SCO-spondin						cell adhesion (GO:0007155)	extracellular space (GO:0005615)	peptidase inhibitor activity (GO:0030414)					Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			GCCCGTGGTCGGAGTGGACAA	0.706													G|||	1	0.000199681	0.0	0.0	5008	,	,		15390	0.0		0.0	False		,,,				2504	0.001																0													14.0	17.0	16.0					7																	149511585		2042	4173	6215			0			AK093431		7q36.1	2013-08-07	2013-08-06		ENSG00000197558	ENSG00000197558			21998	protein-coding gene	gene with protein product	"""subcommissural organ spondin"", ""SCO protein, thrombospondin domain containing"""		"""SCO-spondin homolog (Bos taurus)"""			8743952, 11008217	Standard	NM_198455		Approved	SCO-spondin, KIAA0543, FLJ36112	uc010lpk.3	A2VEC9	OTTHUMG00000157884		7.37:g.149511585G>A			Q76B61	RNA	SNP	-	NULL	ENST00000378016.2	37	NULL		7																																																																																			SSPO	-	-	ENSG00000197558		0.706	SSPO-202	KNOWN	basic	processed_transcript	SSPO	HGNC	processed_transcript		-	0.00	30	0	G			149511585	+1	tier1	-	no_errors	ENST00000378016	ensembl	human	known	74_37	rna	66.67	4	8	SNP	0.290	A
ST13	6767	genome.wustl.edu	37	22	41223099	41223099	+	Splice_Site	SNP	C	C	G			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr22:41223099C>G	ENST00000216218.3	-	11	1463		c.e11+1			NM_003932.3	NP_003923.2	P50502	F10A1_HUMAN	suppression of tumorigenicity 13 (colon carcinoma) (Hsp70 interacting protein)						chaperone cofactor-dependent protein refolding (GO:0070389)|negative regulation of protein refolding (GO:0061084)|protein folding (GO:0006457)|protein homooligomerization (GO:0051260)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)	dATP binding (GO:0032564)|protein binding, bridging (GO:0030674)			cervix(1)|large_intestine(1)|lung(3)|skin(1)	6						CCAAGTCTTACCTGCATGGCT	0.423																																																	0													86.0	88.0	87.0					22																	41223099		2203	4300	6503	SO:0001630	splice_region_variant	0				CCDS14006.1	22q13.2	2013-01-10	2001-11-29		ENSG00000100380	ENSG00000100380		"""Tetratricopeptide (TTC) repeat domain containing"""	11343	protein-coding gene	gene with protein product	"""progesterone receptor-associated p48 protein"""	606796	"""suppression of tumorigenicity 13 (colon carcinoma) (Hsp70-interacting protein)"""			9925927, 8721986	Standard	NM_003932		Approved	SNC6, HSPABP1, HIP, P48, FAM10A1	uc003aze.3	P50502	OTTHUMG00000151201	ENST00000216218.3:c.981+1G>C	22.37:g.41223099C>G			O14999|Q2TU77	Splice_Site	SNP	-	e11+1	ENST00000216218.3	37	c.981+1	CCDS14006.1	22	.	.	.	.	.	.	.	.	.	.	C	22.8	4.335802	0.81801	.	.	ENSG00000100380	ENST00000216218	.	.	.	5.46	5.46	0.80206	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.2991	0.94136	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ST13	39553045	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	5.740000	0.68629	2.573000	0.86826	0.555000	0.69702	.	ST13	-	-	ENSG00000100380		0.423	ST13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ST13	HGNC	protein_coding	OTTHUMT00000321759.1	-	0.00	120	0	C	NM_003932	Intron	41223099	-1	tier1	-	no_errors	ENST00000216218	ensembl	human	known	74_37	splice_site	61.40	22	35	SNP	1.000	G
STIM2	57620	genome.wustl.edu	37	4	27010561	27010561	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr4:27010561C>G	ENST00000467011.1	+	10	1851	c.1426C>G	c.(1426-1428)Cca>Gca	p.P476A	STIM2_ENST00000412829.2_Missense_Mutation_p.P563A|STIM2_ENST00000382009.3_Missense_Mutation_p.P571A|STIM2_ENST00000237364.5_Missense_Mutation_p.P563A|STIM2_ENST00000465503.1_Missense_Mutation_p.P484A|STIM2_ENST00000467087.1_Missense_Mutation_p.P476A	NM_001169117.1	NP_001162588	Q9P246	STIM2_HUMAN	stromal interaction molecule 2	476					activation of store-operated calcium channel activity (GO:0032237)|calcium ion transmembrane transport (GO:0070588)|cellular calcium ion homeostasis (GO:0006874)|positive regulation of calcium ion transport (GO:0051928)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|store-operated calcium channel activity (GO:0015279)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(7)|prostate(1)|skin(2)|urinary_tract(1)	25		Breast(46;0.0503)				TCCACCCTATCCAATTGCTGG	0.473																																																	0													80.0	78.0	78.0					4																	27010561		2203	4300	6503	SO:0001583	missense	0			AB040915	CCDS3440.1, CCDS3440.2, CCDS54751.1, CCDS54752.1	4p15.2	2013-01-10			ENSG00000109689	ENSG00000109689		"""Sterile alpha motif (SAM) domain containing"""	19205	protein-coding gene	gene with protein product		610841				11463338	Standard	NM_020860		Approved		uc003gsh.4	Q9P246	OTTHUMG00000097805	ENST00000467011.1:c.1426C>G	4.37:g.27010561C>G	ENSP00000419383:p.Pro476Ala		A6H8L7|B7ZVY0|Q96BF1|Q9BQH2|Q9H8R1	Missense_Mutation	SNP	pfam_SAM_2,pfam_SAM_type1,superfamily_SAM/pointed,pfscan_SAM	p.P571A	ENST00000467011.1	37	c.1711	CCDS54752.1	4	.	.	.	.	.	.	.	.	.	.	C	14.86	2.662916	0.47572	.	.	ENSG00000109689	ENST00000467087;ENST00000382009;ENST00000237364;ENST00000467011;ENST00000412829;ENST00000465503;ENST00000473519;ENST00000477474	T;T;T;T;T;T;T;T	0.76839	-1.02;-1.03;-1.03;-1.02;-1.04;-1.01;-1.05;-1.05	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	T	0.79028	0.4377	L	0.43152	1.355	0.58432	D	0.999999	P;P;P;D	0.54601	0.944;0.894;0.944;0.967	B;B;B;P	0.50405	0.437;0.437;0.437;0.64	T	0.72453	-0.4289	10	0.18710	T	0.47	.	20.8794	0.99867	0.0:1.0:0.0:0.0	.	476;563;571;563	Q9P246;A6H8L7;E9PGD0;F5GXJ4	STIM2_HUMAN;.;.;.	A	476;571;563;476;563;484;184;78	ENSP00000419073:P476A;ENSP00000371439:P571A;ENSP00000237364:P563A;ENSP00000419383:P476A;ENSP00000404812:P563A;ENSP00000417569:P484A;ENSP00000420113:P184A;ENSP00000419536:P78A	ENSP00000237364:P563A	P	+	1	0	STIM2	26619659	0.993000	0.37304	0.994000	0.49952	0.987000	0.75469	3.019000	0.49635	2.941000	0.99782	0.655000	0.94253	CCA	STIM2	-	NULL	ENSG00000109689		0.473	STIM2-003	NOVEL	basic|exp_conf|CCDS	protein_coding	STIM2	HGNC	protein_coding	OTTHUMT00000356861.1	-	0.00	71	0	C	NM_020860		27010561	+1	tier1	-	no_errors	ENST00000382009	ensembl	human	known	74_37	missense	39.34	37	24	SNP	1.000	G
STX3	6809	genome.wustl.edu	37	11	59523091	59523091	+	Silent	SNP	C	C	T			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr11:59523091C>T	ENST00000337979.4	+	1	560	c.13C>T	c.(13-15)Ctg>Ttg	p.L5L	STX3_ENST00000529177.1_Silent_p.L5L|STX3_ENST00000300150.7_Intron|STX3_ENST00000437946.2_5'UTR|STX3_ENST00000535361.1_Silent_p.L5L|AP000640.10_ENST00000525337.1_RNA	NM_001178040.1|NM_004177.4	NP_001171511.1|NP_004168.1	Q13277	STX3_HUMAN	syntaxin 3	5				Missing (in Ref. 2). {ECO:0000305}.	exocytosis (GO:0006887)|intracellular protein transport (GO:0006886)|long-term synaptic potentiation (GO:0060291)|membrane fusion (GO:0061025)|neuron projection development (GO:0031175)|neurotransmitter transport (GO:0006836)	apical plasma membrane (GO:0016324)|azurophil granule (GO:0042582)|cell-cell junction (GO:0005911)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|SNARE complex (GO:0031201)|specific granule (GO:0042581)|vacuole (GO:0005773)	arachidonic acid binding (GO:0050544)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(3)|ovary(2)|skin(1)	13						GAAGGACCGTCTGGAGCAGCT	0.687																																																	0													24.0	29.0	27.0					11																	59523091		2198	4291	6489	SO:0001819	synonymous_variant	0			AJ002076	CCDS7975.1, CCDS53637.1	11q12.1	2008-02-05	2006-04-25	2006-04-25	ENSG00000166900	ENSG00000166900			11438	protein-coding gene	gene with protein product		600876	"""syntaxin 3A"""	STX3A		16598260, 16339081	Standard	NM_004177		Approved		uc001nog.3	Q13277	OTTHUMG00000167353	ENST00000337979.4:c.13C>T	11.37:g.59523091C>T			B4DME0|O43750|O43751|Q15360	Silent	SNP	pfam_Syntaxin_N,pfam_T_SNARE_dom,superfamily_t-SNARE,smart_Syntaxin_N,smart_T_SNARE_dom,pfscan_T_SNARE_dom	p.L5	ENST00000337979.4	37	c.13	CCDS7975.1	11																																																																																			STX3	-	NULL	ENSG00000166900		0.687	STX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STX3	HGNC	protein_coding	OTTHUMT00000394264.1	-	0.00	38	0	C	NM_004177		59523091	+1	tier1	-	no_errors	ENST00000337979	ensembl	human	known	74_37	silent	29.41	24	10	SNP	0.999	T
SULF1	23213	genome.wustl.edu	37	8	70570792	70570792	+	3'UTR	SNP	C	C	T			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr8:70570792C>T	ENST00000260128.4	+	0	3355				SULF1_ENST00000419716.3_3'UTR|SULF1_ENST00000458141.2_3'UTR|SULF1_ENST00000402687.4_3'UTR|SULF1_ENST00000521946.1_3'UTR	NM_015170.2	NP_055985.2	Q8IWU6	SULF1_HUMAN	sulfatase 1						apoptotic process (GO:0006915)|bone development (GO:0060348)|cartilage development (GO:0051216)|chondrocyte development (GO:0002063)|embryonic skeletal system development (GO:0048706)|esophagus smooth muscle contraction (GO:0014846)|glial cell-derived neurotrophic factor receptor signaling pathway (GO:0035860)|glomerular basement membrane development (GO:0032836)|glomerular filtration (GO:0003094)|heparan sulfate proteoglycan metabolic process (GO:0030201)|innervation (GO:0060384)|kidney development (GO:0001822)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell migration (GO:0030336)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of prostatic bud formation (GO:0060686)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of Wnt signaling pathway (GO:0030177)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	arylsulfatase activity (GO:0004065)|calcium ion binding (GO:0005509)|N-acetylglucosamine-6-sulfatase activity (GO:0008449)			breast(2)|central_nervous_system(3)|endometrium(5)|kidney(3)|large_intestine(10)|lung(15)|ovary(3)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	Breast(64;0.0654)		Epithelial(68;0.0124)|OV - Ovarian serous cystadenocarcinoma(28;0.0265)|all cancers(69;0.0534)			TCACTGCAGACATCAACTGGC	0.443																																																	0													119.0	95.0	103.0					8																	70570792		2203	4300	6503	SO:0001624	3_prime_UTR_variant	0			AB029000	CCDS6204.1	8q13.2	2014-09-11			ENSG00000137573	ENSG00000137573			20391	protein-coding gene	gene with protein product		610012				12368295	Standard	NM_015170		Approved	KIAA1077, SULF-1	uc003xyd.2	Q8IWU6	OTTHUMG00000164466	ENST00000260128.4:c.*22C>T	8.37:g.70570792C>T			Q86YV8|Q8NCA2|Q9UPS5	RNA	SNP	-	NULL	ENST00000260128.4	37	NULL	CCDS6204.1	8																																																																																			SULF1	-	-	ENSG00000137573		0.443	SULF1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	SULF1	HGNC	protein_coding	OTTHUMT00000378885.2	-	0.00	43	0	C	NM_015170		70570792	+1	tier1	-	no_errors	ENST00000521946	ensembl	human	known	74_37	rna	30.56	25	11	SNP	0.977	T
SYNE2	23224	genome.wustl.edu	37	14	64430706	64430706	+	Missense_Mutation	SNP	T	T	A			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr14:64430706T>A	ENST00000344113.4	+	10	1190	c.978T>A	c.(976-978)ttT>ttA	p.F326L	SYNE2_ENST00000358025.3_Missense_Mutation_p.F326L|SYNE2_ENST00000357395.3_5'UTR|SYNE2_ENST00000554584.1_Missense_Mutation_p.F326L	NM_015180.4	NP_055995.4	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	326					centrosome localization (GO:0051642)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment or maintenance of cell polarity (GO:0007163)|fibroblast migration (GO:0010761)|nuclear envelope organization (GO:0006998)|nuclear migration (GO:0007097)|nuclear migration along microfilament (GO:0031022)|positive regulation of cell migration (GO:0030335)|protein localization to nucleus (GO:0034504)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intermediate filament cytoskeleton (GO:0045111)|lamellipodium membrane (GO:0031258)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)|SUN-KASH complex (GO:0034993)|Z disc (GO:0030018)	actin binding (GO:0003779)			NS(5)|breast(17)|central_nervous_system(3)|cervix(8)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(21)|large_intestine(34)|lung(75)|ovary(10)|pancreas(2)|prostate(8)|skin(8)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(4)	224				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		ATACCTACTTTAAAAAGTATA	0.323																																																	0													62.0	59.0	60.0					14																	64430706		1800	4063	5863	SO:0001583	missense	0			AB023228	CCDS9761.2, CCDS41963.1, CCDS45124.1, CCDS45125.1	14q22.1-q22.3	2014-09-17			ENSG00000054654	ENSG00000054654			17084	protein-coding gene	gene with protein product	"""nuclear envelope spectrin repeat-2"", ""nucleus and actin connecting element"""	608442				10231032, 10878022	Standard	NM_182910		Approved	SYNE-2, DKFZP434H2235, Nesprin-2, NUANCE, NUA, KIAA1011, Nesp2	uc001xgl.3	Q8WXH0	OTTHUMG00000140349	ENST00000344113.4:c.978T>A	14.37:g.64430706T>A	ENSP00000341781:p.Phe326Leu		Q540G1|Q8N1S3|Q8NF49|Q8TER7|Q8WWW3|Q8WWW4|Q8WWW5|Q8WXH1|Q9NU50|Q9UFQ4|Q9Y2L4|Q9Y4R1	Missense_Mutation	SNP	pfam_CH-domain,pfam_KASH,pfam_Spectrin_repeat,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,smart_Spectrin/alpha-actinin,pfscan_CH-domain,pfscan_KASH	p.F326L	ENST00000344113.4	37	c.978	CCDS41963.1	14	.	.	.	.	.	.	.	.	.	.	T	2.975	-0.211511	0.06140	.	.	ENSG00000054654	ENST00000358025;ENST00000344113;ENST00000554584;ENST00000261678	T;T;T	0.55234	0.9;0.9;0.53	5.04	1.27	0.21489	.	0.965693	0.08497	N	0.937046	T	0.34135	0.0887	L	0.29908	0.895	0.09310	N	0.999997	B;B	0.21606	0.035;0.058	B;B	0.22601	0.018;0.04	T	0.25950	-1.0117	10	0.16420	T	0.52	.	2.6861	0.05108	0.192:0.2752:0.0:0.5327	.	326;326	Q8WXH0;Q8WXH0-2	SYNE2_HUMAN;.	L	326	ENSP00000350719:F326L;ENSP00000341781:F326L;ENSP00000452570:F326L	ENSP00000261678:F326L	F	+	3	2	SYNE2	63500459	0.051000	0.20477	0.016000	0.15963	0.011000	0.07611	0.344000	0.19962	0.235000	0.21160	-0.451000	0.05528	TTT	SYNE2	-	NULL	ENSG00000054654		0.323	SYNE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYNE2	HGNC	protein_coding	OTTHUMT00000276994.2	-	0.00	68	0	T	NM_182914		64430706	+1	tier1	-	no_errors	ENST00000358025	ensembl	human	known	74_37	missense	5.80	65	4	SNP	0.025	A
SYNE2	23224	genome.wustl.edu	37	14	64519522	64519522	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr14:64519522G>T	ENST00000344113.4	+	48	9103	c.8891G>T	c.(8890-8892)cGc>cTc	p.R2964L	SYNE2_ENST00000358025.3_Missense_Mutation_p.R2964L|SYNE2_ENST00000357395.3_5'UTR|SYNE2_ENST00000554584.1_Missense_Mutation_p.R2997L	NM_015180.4	NP_055995.4	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	2964					centrosome localization (GO:0051642)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment or maintenance of cell polarity (GO:0007163)|fibroblast migration (GO:0010761)|nuclear envelope organization (GO:0006998)|nuclear migration (GO:0007097)|nuclear migration along microfilament (GO:0031022)|positive regulation of cell migration (GO:0030335)|protein localization to nucleus (GO:0034504)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intermediate filament cytoskeleton (GO:0045111)|lamellipodium membrane (GO:0031258)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)|SUN-KASH complex (GO:0034993)|Z disc (GO:0030018)	actin binding (GO:0003779)	p.R2964H(1)		NS(5)|breast(17)|central_nervous_system(3)|cervix(8)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(21)|large_intestine(34)|lung(75)|ovary(10)|pancreas(2)|prostate(8)|skin(8)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(4)	224				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		AGTATACAGCGCAATGAACTA	0.358																																																	1	Substitution - Missense(1)	lung(1)											47.0	45.0	45.0					14																	64519522		1872	4103	5975	SO:0001583	missense	0			AB023228	CCDS9761.2, CCDS41963.1, CCDS45124.1, CCDS45125.1	14q22.1-q22.3	2014-09-17			ENSG00000054654	ENSG00000054654			17084	protein-coding gene	gene with protein product	"""nuclear envelope spectrin repeat-2"", ""nucleus and actin connecting element"""	608442				10231032, 10878022	Standard	NM_182910		Approved	SYNE-2, DKFZP434H2235, Nesprin-2, NUANCE, NUA, KIAA1011, Nesp2	uc001xgl.3	Q8WXH0	OTTHUMG00000140349	ENST00000344113.4:c.8891G>T	14.37:g.64519522G>T	ENSP00000341781:p.Arg2964Leu		Q540G1|Q8N1S3|Q8NF49|Q8TER7|Q8WWW3|Q8WWW4|Q8WWW5|Q8WXH1|Q9NU50|Q9UFQ4|Q9Y2L4|Q9Y4R1	Missense_Mutation	SNP	pfam_CH-domain,pfam_KASH,pfam_Spectrin_repeat,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,smart_Spectrin/alpha-actinin,pfscan_CH-domain,pfscan_KASH	p.R2964L	ENST00000344113.4	37	c.8891	CCDS41963.1	14	.	.	.	.	.	.	.	.	.	.	G	0.778	-0.763287	0.02996	.	.	ENSG00000054654	ENST00000358025;ENST00000344113;ENST00000554584;ENST00000261678	T;T;T	0.56444	0.83;0.83;0.46	5.24	1.55	0.23275	.	0.639490	0.14541	N	0.313288	T	0.22589	0.0545	N	0.03608	-0.345	0.09310	N	1	B;B	0.09022	0.001;0.002	B;B	0.12156	0.003;0.007	T	0.17349	-1.0372	10	0.18710	T	0.47	.	3.8425	0.08920	0.5663:0.0:0.2791:0.1546	.	2964;2964	Q8WXH0;Q8WXH0-2	SYNE2_HUMAN;.	L	2964;2964;2997;2997	ENSP00000350719:R2964L;ENSP00000341781:R2964L;ENSP00000452570:R2997L	ENSP00000261678:R2997L	R	+	2	0	SYNE2	63589275	0.000000	0.05858	0.217000	0.23759	0.223000	0.24884	0.041000	0.13927	0.301000	0.22738	-0.752000	0.03492	CGC	SYNE2	-	NULL	ENSG00000054654		0.358	SYNE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYNE2	HGNC	protein_coding	OTTHUMT00000276994.2		0.00	24	0	G	NM_182914		64519522	+1			no_errors	ENST00000358025	ensembl	human	known	74_37	missense	7.41	25	2	SNP	0.002	T
SYT2	127833	genome.wustl.edu	37	1	202574728	202574728	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr1:202574728A>G	ENST00000367267.1	-	2	365	c.173T>C	c.(172-174)aTt>aCt	p.I58T	SYT2_ENST00000367268.4_Missense_Mutation_p.I58T|RP11-569A11.1_ENST00000428573.1_RNA	NM_001136504.1	NP_001129976.1	Q8N9I0	SYT2_HUMAN	synaptotagmin II	58					neurotransmitter secretion (GO:0007269)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|endocytic vesicle membrane (GO:0030666)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|transporter activity (GO:0005215)			NS(1)|breast(4)|endometrium(3)|kidney(1)|large_intestine(5)|liver(1)|lung(9)|ovary(2)|skin(2)|urinary_tract(1)	29			BRCA - Breast invasive adenocarcinoma(75;0.169)		Botulinum Toxin Type B(DB00042)	CTCACAGGGAATCTTGTTTAT	0.552																																																	0													69.0	62.0	65.0					1																	202574728		2203	4300	6503	SO:0001583	missense	0			AK090672	CCDS1427.1	1q32.1	2013-01-21			ENSG00000143858	ENSG00000143858		"""Synaptotagmins"""	11510	protein-coding gene	gene with protein product		600104				7749232	Standard	NM_177402		Approved		uc010pqb.2	Q8N9I0	OTTHUMG00000041388	ENST00000367267.1:c.173T>C	1.37:g.202574728A>G	ENSP00000356236:p.Ile58Thr		Q496K5|Q8NBE5	Missense_Mutation	SNP	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom,prints_Synaptotagmin,prints_C2_dom	p.I58T	ENST00000367267.1	37	c.173	CCDS1427.1	1	.	.	.	.	.	.	.	.	.	.	A	15.89	2.965835	0.53507	.	.	ENSG00000143858	ENST00000367268;ENST00000367267	T;T	0.41065	1.01;1.01	5.43	5.43	0.79202	.	0.000000	0.85682	D	0.000000	T	0.46425	0.1392	M	0.77313	2.365	0.58432	D	0.999992	B	0.17667	0.023	B	0.17722	0.019	T	0.40813	-0.9543	10	0.27082	T	0.32	.	15.4591	0.75339	1.0:0.0:0.0:0.0	.	58	Q8N9I0	SYT2_HUMAN	T	58	ENSP00000356237:I58T;ENSP00000356236:I58T	ENSP00000356236:I58T	I	-	2	0	SYT2	200841351	1.000000	0.71417	1.000000	0.80357	0.783000	0.44284	8.594000	0.90836	2.072000	0.62099	0.386000	0.25728	ATT	SYT2	-	NULL	ENSG00000143858		0.552	SYT2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SYT2	HGNC	protein_coding	OTTHUMT00000099157.1	-	0.00	121	0	A	NM_177402		202574728	-1	tier1	-	no_errors	ENST00000367267	ensembl	human	known	74_37	missense	30.12	58	25	SNP	1.000	G
TAAR2	9287	genome.wustl.edu	37	6	132938983	132938983	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr6:132938983C>A	ENST00000367931.1	-	2	361	c.362G>T	c.(361-363)aGt>aTt	p.S121I	TAAR2_ENST00000275191.2_Missense_Mutation_p.S76I|TAAR2_ENST00000537809.1_Missense_Mutation_p.S76I			Q9P1P5	TAAR2_HUMAN	trace amine associated receptor 2	121					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|trace-amine receptor activity (GO:0001594)			breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(15)|ovary(1)|skin(1)	23	Breast(56;0.135)			OV - Ovarian serous cystadenocarcinoma(155;0.00608)|GBM - Glioblastoma multiforme(226;0.0151)		CAGGTCAAAACTATAATAAAT	0.368																																																	0													78.0	75.0	76.0					6																	132938983		2203	4300	6503	SO:0001583	missense	0			AF112460	CCDS34541.1, CCDS5157.1	6q24	2012-08-08	2005-02-23	2005-02-24	ENSG00000146378	ENSG00000146378		"""GPCR / Class A : Trace amine associated receptors"""	4514	protein-coding gene	gene with protein product		604849	"""G protein-coupled receptor 58"""	GPR58		10684976, 15718104	Standard	NM_014626		Approved		uc003qdl.1	Q9P1P5	OTTHUMG00000015585	ENST00000367931.1:c.362G>T	6.37:g.132938983C>A	ENSP00000356908:p.Ser121Ile		Q5QD02|Q6NWS1|Q6NWS2|Q6NWS3	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn,prints_TAAR_fam	p.S121I	ENST00000367931.1	37	c.362	CCDS34541.1	6	.	.	.	.	.	.	.	.	.	.	C	18.86	3.713803	0.68730	.	.	ENSG00000146378	ENST00000275191;ENST00000367931;ENST00000537809	T;T;T	0.19394	2.15;2.15;2.15	6.0	6.0	0.97389	GPCR, rhodopsin-like superfamily (1);	0.049047	0.85682	D	0.000000	T	0.37210	0.0995	L	0.49699	1.58	0.46701	D	0.999161	D	0.89917	1.0	D	0.91635	0.999	T	0.04140	-1.0974	10	0.66056	D	0.02	-38.712	20.4946	0.99205	0.0:1.0:0.0:0.0	.	121	Q9P1P5	TAAR2_HUMAN	I	76;121;76	ENSP00000275191:S76I;ENSP00000356908:S121I;ENSP00000441263:S76I	ENSP00000275191:S76I	S	-	2	0	TAAR2	132980676	0.968000	0.33430	1.000000	0.80357	0.797000	0.45037	2.636000	0.46545	2.846000	0.97976	0.650000	0.86243	AGT	TAAR2	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM	ENSG00000146378		0.368	TAAR2-002	KNOWN	basic|CCDS	protein_coding	TAAR2	HGNC	protein_coding	OTTHUMT00000390735.1		0.00	30	0	C	NM_014626		132938983	-1			no_errors	ENST00000367931	ensembl	human	known	74_37	missense	25.58	32	11	SNP	1.000	A
TAAR2	9287	genome.wustl.edu	37	6	132938985	132938985	+	Silent	SNP	A	A	G			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr6:132938985A>G	ENST00000367931.1	-	2	359	c.360T>C	c.(358-360)taT>taC	p.Y120Y	TAAR2_ENST00000275191.2_Silent_p.Y75Y|TAAR2_ENST00000537809.1_Silent_p.Y75Y			Q9P1P5	TAAR2_HUMAN	trace amine associated receptor 2	120					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|trace-amine receptor activity (GO:0001594)			breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(15)|ovary(1)|skin(1)	23	Breast(56;0.135)			OV - Ovarian serous cystadenocarcinoma(155;0.00608)|GBM - Glioblastoma multiforme(226;0.0151)		GGTCAAAACTATAATAAATCT	0.373																																																	0													79.0	76.0	77.0					6																	132938985		2203	4300	6503	SO:0001819	synonymous_variant	0			AF112460	CCDS34541.1, CCDS5157.1	6q24	2012-08-08	2005-02-23	2005-02-24	ENSG00000146378	ENSG00000146378		"""GPCR / Class A : Trace amine associated receptors"""	4514	protein-coding gene	gene with protein product		604849	"""G protein-coupled receptor 58"""	GPR58		10684976, 15718104	Standard	NM_014626		Approved		uc003qdl.1	Q9P1P5	OTTHUMG00000015585	ENST00000367931.1:c.360T>C	6.37:g.132938985A>G			Q5QD02|Q6NWS1|Q6NWS2|Q6NWS3	Silent	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn,prints_TAAR_fam	p.Y120	ENST00000367931.1	37	c.360	CCDS34541.1	6																																																																																			TAAR2	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM	ENSG00000146378		0.373	TAAR2-002	KNOWN	basic|CCDS	protein_coding	TAAR2	HGNC	protein_coding	OTTHUMT00000390735.1		0.00	34	0	A	NM_014626		132938985	-1			no_errors	ENST00000367931	ensembl	human	known	74_37	silent	25.58	32	11	SNP	0.848	G
TAF10	6881	genome.wustl.edu	37	11	6632975	6632975	+	Frame_Shift_Del	DEL	C	C	-			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr11:6632975delC	ENST00000299424.4	-	2	784	c.307delG	c.(307-309)gccfs	p.A103fs	TAF10_ENST00000531760.1_5'UTR|RP11-732A19.2_ENST00000527398.1_RNA	NM_006284.3	NP_006275.1	Q12962	TAF10_HUMAN	TAF10 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 30kDa	103					chromatin organization (GO:0006325)|DNA-templated transcription, initiation (GO:0006352)|gene expression (GO:0010467)|histone deubiquitination (GO:0016578)|histone H3 acetylation (GO:0043966)|protein homooligomerization (GO:0051260)|regulation of transcription, DNA-templated (GO:0006355)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PCAF complex (GO:0000125)|perinuclear region of cytoplasm (GO:0048471)|STAGA complex (GO:0030914)|transcription factor TFIID complex (GO:0005669)|transcription factor TFTC complex (GO:0033276)	enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|RNA polymerase binding (GO:0070063)|transcription coactivator activity (GO:0003713)						Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.0481)		Epithelial(150;2.9e-09)|BRCA - Breast invasive adenocarcinoma(625;0.129)		TCTCCGTTGGCCGCGCTCGGC	0.632																																																	0													35.0	41.0	39.0					11																	6632975		2201	4296	6497	SO:0001589	frameshift_variant	0			U13991, U25816	CCDS7769.1	11p15.5-p15.2	2006-11-14	2002-08-29	2001-12-07	ENSG00000166337	ENSG00000166337			11543	protein-coding gene	gene with protein product		600475	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, H, 30kD"""	TAF2H, TAF2A		7923369	Standard	NM_006284		Approved	TAFII30	uc001mej.2	Q12962	OTTHUMG00000133402	ENST00000299424.4:c.307delG	11.37:g.6632975delC	ENSP00000299424:p.Ala103fs		O00703|Q13175|Q6FH13	Frame_Shift_Del	DEL	pfam_TFIID_30kDa,pirsf_TFIID_30kDa,prints_TFIID_30kDa	p.A103fs	ENST00000299424.4	37	c.307	CCDS7769.1	11																																																																																			TAF10	-	pirsf_TFIID_30kDa	ENSG00000166337		0.632	TAF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAF10	HGNC	protein_coding	OTTHUMT00000257259.2		0.00	18	0	C	NM_006284		6632975	-1	tier1		no_errors	ENST00000299424	ensembl	human	known	74_37	frame_shift_del	33.33	14	7	DEL	1.000	-
TBC1D9	23158	genome.wustl.edu	37	4	141600856	141600856	+	Missense_Mutation	SNP	A	A	T			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr4:141600856A>T	ENST00000442267.2	-	4	576	c.502T>A	c.(502-504)Tat>Aat	p.Y168N		NM_015130.2	NP_055945.2	Q6ZT07	TBCD9_HUMAN	TBC1 domain family, member 9 (with GRAM domain)	168	GRAM 1.						calcium ion binding (GO:0005509)|Rab GTPase activator activity (GO:0005097)			endometrium(3)|kidney(2)|large_intestine(3)|lung(18)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	31	all_hematologic(180;0.162)	Medulloblastoma(177;0.00498)				CCCTTCCAATAGCTGCAAGAG	0.433																																																	0													80.0	79.0	79.0					4																	141600856		1854	4088	5942	SO:0001583	missense	0			AB020689	CCDS47136.1	4q31.1	2013-01-10	2006-07-12		ENSG00000109436	ENSG00000109436		"""EF-hand domain containing"""	21710	protein-coding gene	gene with protein product			"""TBC1 domain family, member 9"""			12970790	Standard	NM_015130		Approved	KIAA0882, MDR1	uc010ioj.3	Q6ZT07	OTTHUMG00000161405	ENST00000442267.2:c.502T>A	4.37:g.141600856A>T	ENSP00000411197:p.Tyr168Asn		A6H8U8|D3DNZ1|O94958	Missense_Mutation	SNP	pfam_Rab-GTPase-TBC_dom,pfam_GRAM,superfamily_Rab-GTPase-TBC_dom,smart_GRAM,smart_Rab-GTPase-TBC_dom,pfscan_EF_hand_dom,pfscan_Rab-GTPase-TBC_dom	p.Y168N	ENST00000442267.2	37	c.502	CCDS47136.1	4	.	.	.	.	.	.	.	.	.	.	A	24.7	4.564376	0.86335	.	.	ENSG00000109436	ENST00000442267	D	0.87256	-2.23	5.41	5.41	0.78517	GRAM (2);	0.000000	0.85682	D	0.000000	D	0.94046	0.8092	M	0.87758	2.905	0.80722	D	1	D	0.71674	0.998	D	0.79784	0.993	D	0.94873	0.8032	10	0.66056	D	0.02	.	15.4549	0.75305	1.0:0.0:0.0:0.0	.	168	Q6ZT07	TBCD9_HUMAN	N	168	ENSP00000411197:Y168N	ENSP00000411197:Y168N	Y	-	1	0	TBC1D9	141820306	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.210000	0.95106	2.061000	0.61500	0.533000	0.62120	TAT	TBC1D9	-	pfam_GRAM,smart_GRAM	ENSG00000109436		0.433	TBC1D9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBC1D9	HGNC	protein_coding	OTTHUMT00000364806.1	-	0.00	67	0	A	NM_015130		141600856	-1	tier1	-	no_errors	ENST00000442267	ensembl	human	known	74_37	missense	41.18	20	14	SNP	1.000	T
TCAIM	285343	genome.wustl.edu	37	3	44408948	44408948	+	Splice_Site	SNP	G	G	C			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr3:44408948G>C	ENST00000342649.4	+	5	747	c.320G>C	c.(319-321)gGa>gCa	p.G107A	TCAIM_ENST00000417237.1_Splice_Site_p.G107A	NM_001282913.1|NM_173826.3	NP_001269842.1|NP_776187.2	Q8N3R3	TCAIM_HUMAN	T cell activation inhibitor, mitochondrial	107						mitochondrion (GO:0005739)											TATTCTCTAGGATTTCGAGCA	0.303																																																	0													62.0	65.0	64.0					3																	44408948		2203	4300	6503	SO:0001630	splice_region_variant	0				CCDS2712.1, CCDS43076.1	3p21.33-p21.32	2012-08-22	2012-08-22	2012-08-22	ENSG00000179152	ENSG00000179152			25241	protein-coding gene	gene with protein product	"""tolerance associated gene-1"""		"""chromosome 3 open reading frame 23"""	C3orf23		12477932	Standard	NM_001029840		Approved	DKFZp313N0621, TOAG-1	uc003cnd.4	Q8N3R3	OTTHUMG00000133049	ENST00000342649.4:c.320-1G>C	3.37:g.44408948G>C			A8K9P1|Q0P5T9|Q495R1|Q495R3|Q4G0M4|Q6GMU8	Missense_Mutation	SNP	NULL	p.G107A	ENST00000342649.4	37	c.320	CCDS2712.1	3	.	.	.	.	.	.	.	.	.	.	G	28.1	4.888958	0.91814	.	.	ENSG00000179152	ENST00000417237;ENST00000342649	T;T	0.44881	0.91;0.91	5.69	5.69	0.88448	.	0.000000	0.85682	D	0.000000	T	0.66107	0.2756	M	0.72118	2.19	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.63980	-0.6514	9	.	.	.	.	19.8052	0.96529	0.0:0.0:1.0:0.0	.	107	Q8N3R3	CC023_HUMAN	A	107	ENSP00000402581:G107A;ENSP00000341539:G107A	.	G	+	2	0	C3orf23	44383952	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.414000	0.97362	2.692000	0.91855	0.650000	0.86243	GGA	TCAIM	-	NULL	ENSG00000179152		0.303	TCAIM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TCAIM	HGNC	protein_coding	OTTHUMT00000256655.2	-	0.00	69	0	G	NM_173826	Missense_Mutation	44408948	+1	tier1	-	no_errors	ENST00000342649	ensembl	human	known	74_37	missense	29.35	65	27	SNP	1.000	C
TET2	54790	genome.wustl.edu	37	4	106155823	106155823	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr4:106155823G>C	ENST00000540549.1	+	3	1584	c.724G>C	c.(724-726)Gtg>Ctg	p.V242L	TET2_ENST00000380013.4_Missense_Mutation_p.V242L|TET2_ENST00000305737.2_Missense_Mutation_p.V242L|TET2_ENST00000513237.1_Missense_Mutation_p.V263L|TET2_ENST00000413648.2_Missense_Mutation_p.V242L|TET2_ENST00000394764.1_Missense_Mutation_p.V242L|TET2_ENST00000545826.1_Missense_Mutation_p.V242L			Q6N021	TET2_HUMAN	tet methylcytosine dioxygenase 2	242					5-methylcytosine catabolic process (GO:0006211)|cell cycle (GO:0007049)|DNA demethylation (GO:0080111)|histone H3-K4 trimethylation (GO:0080182)|kidney development (GO:0001822)|myeloid cell differentiation (GO:0030099)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-embryonic development (GO:0009791)|protein O-linked glycosylation (GO:0006493)		DNA binding (GO:0003677)|ferrous iron binding (GO:0008198)|methylcytosine dioxygenase activity (GO:0070579)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1272)|kidney(3)|large_intestine(11)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	1314		Myeloproliferative disorder(5;0.0393)		OV - Ovarian serous cystadenocarcinoma(123;7.18e-08)		TTCCATTGCGGTGCAGAAAAC	0.443			"""Mis N, F"""		MDS																																			Rec	yes		4	4q24	54790	tet oncogene family member 2		L	0													87.0	82.0	84.0					4																	106155823		2203	4300	6503	SO:0001583	missense	0			AB046766	CCDS3666.1, CCDS47120.1	4q24	2014-09-17	2011-09-30	2008-03-12	ENSG00000168769	ENSG00000168769			25941	protein-coding gene	gene with protein product		612839	"""KIAA1546"", ""tet oncogene family member 2"""	KIAA1546		10997877, 12646957	Standard	NM_017628		Approved	FLJ20032	uc003hxk.3	Q6N021	OTTHUMG00000131213	ENST00000540549.1:c.724G>C	4.37:g.106155823G>C	ENSP00000442788:p.Val242Leu		B5MDU0|Q2TB88|Q3LIB8|Q96JX5|Q9HCM6|Q9NXW0	Missense_Mutation	SNP	NULL	p.V242L	ENST00000540549.1	37	c.724	CCDS47120.1	4	.	.	.	.	.	.	.	.	.	.	G	11.65	1.701989	0.30232	.	.	ENSG00000168769	ENST00000305737;ENST00000540549;ENST00000545826;ENST00000513237;ENST00000380013;ENST00000394764;ENST00000413648;ENST00000535110	T;T;T;T;T;T;T	0.03920	3.76;4.41;3.76;4.41;4.41;3.76;3.77	4.95	3.96	0.45880	.	2.164530	0.02866	U	0.130902	T	0.05456	0.0144	L	0.32530	0.975	0.27365	N	0.955849	B;B;P	0.39022	0.278;0.278;0.655	B;B;B	0.34242	0.051;0.051;0.178	T	0.22871	-1.0204	10	0.66056	D	0.02	.	6.5677	0.22521	0.2013:0.0:0.7987:0.0	.	263;242;242	E7EQS8;Q6N021;Q6N021-2	.;TET2_HUMAN;.	L	242;242;242;263;242;242;242;242	ENSP00000306705:V242L;ENSP00000442788:V242L;ENSP00000442867:V242L;ENSP00000425443:V263L;ENSP00000369351:V242L;ENSP00000378245:V242L;ENSP00000391448:V242L	ENSP00000265149:V242L	V	+	1	0	TET2	106375272	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.318000	0.43779	2.301000	0.77427	0.655000	0.94253	GTG	TET2	-	NULL	ENSG00000168769		0.443	TET2-202	KNOWN	basic|appris_candidate|CCDS	protein_coding	TET2	HGNC	protein_coding	OTTHUMT00000253952.2		0.00	44	0	G	NM_017628		106155823	+1			no_errors	ENST00000380013	ensembl	human	known	74_37	missense	6.06	31	2	SNP	1.000	C
TG	7038	genome.wustl.edu	37	8	133935598	133935598	+	Missense_Mutation	SNP	A	A	T			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr8:133935598A>T	ENST00000220616.4	+	22	4584	c.4544A>T	c.(4543-4545)cAg>cTg	p.Q1515L	TG_ENST00000377869.1_Intron|TG_ENST00000542445.1_5'UTR	NM_003235.4	NP_003226.4	P01266	THYG_HUMAN	thyroglobulin	1515	Thyroglobulin type-1 11. {ECO:0000255|PROSITE-ProRule:PRU00500}.				hormone biosynthetic process (GO:0042446)|iodide transport (GO:0015705)|regulation of myelination (GO:0031641)|signal transduction (GO:0007165)|thyroid gland development (GO:0030878)|thyroid hormone generation (GO:0006590)	extracellular region (GO:0005576)|extracellular space (GO:0005615)				NS(1)|breast(11)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(34)|liver(2)|lung(59)|ovary(9)|pancreas(2)|prostate(6)|skin(7)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(8)	168	Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0559)|Breast(495;0.0735)	BRCA - Breast invasive adenocarcinoma(115;0.000701)	KIRC - Kidney renal clear cell carcinoma(542;0.0546)		ACTGACTGTCAGAGGAACGAA	0.557																																																	0													88.0	80.0	83.0					8																	133935598		2203	4300	6503	SO:0001583	missense	0			AU141420	CCDS34944.1	8q24	2012-10-02			ENSG00000042832	ENSG00000042832			11764	protein-coding gene	gene with protein product		188450					Standard	NM_003235		Approved	TGN, AITD3	uc003ytw.3	P01266	OTTHUMG00000164649	ENST00000220616.4:c.4544A>T	8.37:g.133935598A>T	ENSP00000220616:p.Gln1515Leu		O15274|O43899|Q15593|Q15948|Q9NYR1|Q9NYR2|Q9UMZ0|Q9UNY3	Missense_Mutation	SNP	pfam_Thyroglobulin_1,pfam_CarbesteraseB,pfam_Tyr-kin_ephrin_A/B_rcpt-like,superfamily_Thyroglobulin_1,smart_Thyroglobulin_1,pirsf_Thyroglobulin,pfscan_Thyroglobulin_1	p.Q1515L	ENST00000220616.4	37	c.4544	CCDS34944.1	8	.	.	.	.	.	.	.	.	.	.	A	18.80	3.700138	0.68501	.	.	ENSG00000042832	ENST00000543313;ENST00000220616	D	0.96992	-4.2	4.63	4.63	0.57726	Thyroglobulin type-1 (2);	0.119370	0.37437	N	0.002096	D	0.96959	0.9007	M	0.76002	2.32	0.80722	D	1	D	0.64830	0.994	P	0.57911	0.829	D	0.97012	0.9737	10	0.87932	D	0	.	10.4227	0.44359	1.0:0.0:0.0:0.0	.	1515	P01266	THYG_HUMAN	L	321;1515	ENSP00000220616:Q1515L	ENSP00000220616:Q1515L	Q	+	2	0	TG	134004780	1.000000	0.71417	0.991000	0.47740	0.949000	0.60115	5.260000	0.65490	1.733000	0.51620	0.454000	0.30748	CAG	TG	-	superfamily_Thyroglobulin_1,pirsf_Thyroglobulin,pfscan_Thyroglobulin_1	ENSG00000042832		0.557	TG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TG	HGNC	protein_coding	OTTHUMT00000379606.1	-	0.00	108	0	A	NM_003235		133935598	+1	tier1	-	no_errors	ENST00000220616	ensembl	human	known	74_37	missense	27.85	57	22	SNP	1.000	T
THBS2	7058	genome.wustl.edu	37	6	169648555	169648555	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr6:169648555C>T	ENST00000366787.3	-	4	815	c.566G>A	c.(565-567)cGg>cAg	p.R189Q		NM_003247.2	NP_003238.2	P35442	TSP2_HUMAN	thrombospondin 2	189	Heparin-binding. {ECO:0000255}.|Laminin G-like.				cell adhesion (GO:0007155)|negative regulation of angiogenesis (GO:0016525)|positive regulation of synapse assembly (GO:0051965)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|platelet alpha granule (GO:0031091)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)	p.R189P(1)		NS(3)|biliary_tract(1)|endometrium(8)|kidney(3)|large_intestine(23)|liver(1)|lung(56)|ovary(6)|prostate(1)|skin(3)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	111		Breast(66;1.78e-05)|Ovarian(120;0.0728)|Esophageal squamous(34;0.247)		OV - Ovarian serous cystadenocarcinoma(33;1.85e-21)|BRCA - Breast invasive adenocarcinoma(81;1.43e-06)|GBM - Glioblastoma multiforme(31;0.000379)		CACGTACATCCGGCTCTTTTC	0.612																																					Esophageal Squamous(91;219 1934 18562 44706)												1	Substitution - Missense(1)	ovary(1)											101.0	104.0	103.0					6																	169648555		2203	4300	6503	SO:0001583	missense	0				CCDS34574.1	6q27	2008-07-28			ENSG00000186340	ENSG00000186340			11786	protein-coding gene	gene with protein product		188061				18455130	Standard	NM_003247		Approved	TSP2	uc003qwt.3	P35442	OTTHUMG00000045408	ENST00000366787.3:c.566G>A	6.37:g.169648555C>T	ENSP00000355751:p.Arg189Gln		A6H8N1|A7E232|Q5RI52	Missense_Mutation	SNP	pfam_Thrombospondin_C,pfam_Thrombospondin_1_rpt,pfam_VWF_C,pfam_Thrombospondin_3-like_rpt,pfam_EGF-like_Ca-bd_dom,pfam_EG-like_dom,superfamily_ConA-like_lec_gl_sf,superfamily_Thrombospondin_1_rpt,smart_Laminin_G,smart_VWF_C,smart_Thrombospondin_1_rpt,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_Thrombospondin_1_rpt,pfscan_VWF_C	p.R189Q	ENST00000366787.3	37	c.566	CCDS34574.1	6	.	.	.	.	.	.	.	.	.	.	C	13.39	2.223377	0.39300	.	.	ENSG00000186340	ENST00000366787	T	0.02216	4.39	4.5	3.6	0.41247	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G, thrombospondin-type, N-terminal (1);	0.159155	0.28268	U	0.015970	T	0.00906	0.0030	L	0.41573	1.285	0.26483	N	0.975079	B	0.25772	0.134	B	0.17433	0.018	T	0.45963	-0.9225	10	0.45353	T	0.12	-39.3345	9.9005	0.41344	0.0:0.8357:0.0:0.1643	.	189	P35442	TSP2_HUMAN	Q	189	ENSP00000355751:R189Q	ENSP00000355751:R189Q	R	-	2	0	THBS2	169390480	1.000000	0.71417	1.000000	0.80357	0.347000	0.29111	2.330000	0.43885	2.204000	0.70986	0.563000	0.77884	CGG	THBS2	-	superfamily_ConA-like_lec_gl_sf,smart_Laminin_G	ENSG00000186340		0.612	THBS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THBS2	HGNC	protein_coding	OTTHUMT00000105439.1		0.00	22	0	C	NM_003247		169648555	-1			no_errors	ENST00000366787	ensembl	human	known	74_37	missense	7.14	26	2	SNP	1.000	T
THSD7A	221981	genome.wustl.edu	37	7	11676143	11676143	+	Silent	SNP	G	G	A			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr7:11676143G>A	ENST00000423059.4	-	2	887	c.636C>T	c.(634-636)agC>agT	p.S212S	THSD7A_ENST00000480061.1_5'Flank	NM_015204.2	NP_056019.1	Q9UPZ6	THS7A_HUMAN	thrombospondin, type I, domain containing 7A	212	TSP type-1 2. {ECO:0000255|PROSITE- ProRule:PRU00210}.				angiogenesis (GO:0001525)|cell differentiation (GO:0030154)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|autonomic_ganglia(1)|breast(5)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(7)|lung(68)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(11)	113				UCEC - Uterine corpus endometrioid carcinoma (126;0.163)		GCTGGAGCCCGCTGCCGCAGG	0.607										HNSCC(18;0.044)																																							0													35.0	35.0	35.0					7																	11676143		1989	4170	6159	SO:0001819	synonymous_variant	0				CCDS47543.1	7p21.3	2006-10-16			ENSG00000005108	ENSG00000005108			22207	protein-coding gene	gene with protein product		612249					Standard	NM_015204		Approved	KIAA0960	uc021zzn.1	Q9UPZ6	OTTHUMG00000152346	ENST00000423059.4:c.636C>T	7.37:g.11676143G>A				Silent	SNP	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	p.S212	ENST00000423059.4	37	c.636	CCDS47543.1	7																																																																																			THSD7A	-	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	ENSG00000005108		0.607	THSD7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THSD7A	HGNC	protein_coding	OTTHUMT00000325944.4		0.00	20	0	G	XM_928187.2		11676143	-1			no_errors	ENST00000423059	ensembl	human	known	74_37	silent	10.53	17	2	SNP	0.891	A
THSD7B	80731	genome.wustl.edu	37	2	137872721	137872721	+	Silent	SNP	A	A	G			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr2:137872721A>G	ENST00000409968.1	+	5	1405	c.1227A>G	c.(1225-1227)aaA>aaG	p.K409K	THSD7B_ENST00000543459.1_Silent_p.K268K|THSD7B_ENST00000272643.3_Silent_p.K409K|THSD7B_ENST00000413152.2_Silent_p.K378K			Q9C0I4	THS7B_HUMAN	thrombospondin, type I, domain containing 7B	409	TSP type-1 5. {ECO:0000255|PROSITE- ProRule:PRU00210}.					integral component of membrane (GO:0016021)				NS(3)|breast(3)|central_nervous_system(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(14)|lung(57)|ovary(4)|pancreas(3)|prostate(11)|skin(4)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	134				BRCA - Breast invasive adenocarcinoma(221;0.19)		CTGAATGGAAAGAATGCCAAG	0.473																																																	0													65.0	66.0	66.0					2																	137872721		1906	4132	6038	SO:0001819	synonymous_variant	0					2q22.1	2006-11-24			ENSG00000144229	ENSG00000144229			29348	protein-coding gene	gene with protein product						11214970	Standard	NM_001080427		Approved	KIAA1679	uc002tva.1	Q9C0I4	OTTHUMG00000153590	ENST00000409968.1:c.1227A>G	2.37:g.137872721A>G				Silent	SNP	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	p.K409	ENST00000409968.1	37	c.1227		2																																																																																			THSD7B	-	superfamily_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	ENSG00000144229		0.473	THSD7B-001	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	THSD7B	HGNC	protein_coding	OTTHUMT00000331769.2	-	0.00	82	0	A	XM_046570.9		137872721	+1	tier1	-	no_errors	ENST00000272643	ensembl	human	known	74_37	silent	59.09	18	26	SNP	1.000	G
TMEM107	84314	genome.wustl.edu	37	17	8079571	8079571	+	Missense_Mutation	SNP	A	A	T			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr17:8079571A>T	ENST00000437139.2	-	1	121	c.34T>A	c.(34-36)Ttc>Atc	p.F12I	RP11-599B13.7_ENST00000581248.1_lincRNA|TMEM107_ENST00000449985.2_Missense_Mutation_p.F12I|TMEM107_ENST00000533070.1_Missense_Mutation_p.F12I|SNORD118_ENST00000363593.1_RNA|TMEM107_ENST00000316425.5_Missense_Mutation_p.F12I|TMEM107_ENST00000431792.2_Missense_Mutation_p.F12I|TMEM107_ENST00000532998.1_Missense_Mutation_p.F12I	NM_183065.2	NP_898888.1	Q6UX40	TM107_HUMAN	transmembrane protein 107	12					cilium assembly (GO:0042384)|embryonic digit morphogenesis (GO:0042733)|neural tube patterning (GO:0021532)	integral component of membrane (GO:0016021)				large_intestine(1)|lung(4)|ovary(1)	6						AGCGTCAGGAAGCGAGAGGGC	0.622																																																	0													63.0	52.0	55.0					17																	8079571		2203	4300	6503	SO:0001583	missense	0			AF311338	CCDS11132.1, CCDS45607.1	17p13.1	2005-12-19				ENSG00000179029			28128	protein-coding gene	gene with protein product						12477932	Standard	NM_032354		Approved	MGC10744	uc002gkh.4	Q6UX40		ENST00000437139.2:c.34T>A	17.37:g.8079571A>T	ENSP00000402732:p.Phe12Ile		A0PJV7|Q6NSE3|Q6ZRX9|Q96T82	Missense_Mutation	SNP	NULL	p.F12I	ENST00000437139.2	37	c.34	CCDS45607.1	17	.	.	.	.	.	.	.	.	.	.	A	21.7	4.181642	0.78677	.	.	ENSG00000179029	ENST00000449985;ENST00000532998;ENST00000437139;ENST00000533070;ENST00000316425;ENST00000431792;ENST00000415860	.	.	.	5.6	4.51	0.55191	.	0.000000	0.85682	D	0.000000	T	0.77631	0.4159	M	0.80183	2.485	0.45634	D	0.998565	D;D;D;P	0.67145	0.996;0.996;0.989;0.932	D;D;D;P	0.77557	0.99;0.99;0.985;0.647	T	0.79169	-0.1914	9	0.87932	D	0	-35.8501	9.9502	0.41634	0.8291:0.1709:0.0:0.0	.	12;12;12;12	B3KNL7;Q6UX40-3;Q6UX40-4;Q6UX40	.;.;.;TM107_HUMAN	I	12	.	ENSP00000314116:F12I	F	-	1	0	TMEM107	8020296	1.000000	0.71417	0.994000	0.49952	0.217000	0.24651	7.858000	0.86971	1.040000	0.40099	-0.340000	0.08031	TTC	TMEM107	-	NULL	ENSG00000179029		0.622	TMEM107-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM107	HGNC	protein_coding	OTTHUMT00000388844.1		0.00	34	0	A	NM_032354		8079571	-1			no_errors	ENST00000316425	ensembl	human	known	74_37	missense	6.67	28	2	SNP	1.000	T
TMEM202	338949	genome.wustl.edu	37	15	72691089	72691089	+	Silent	SNP	C	C	G			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr15:72691089C>G	ENST00000341689.3	+	2	231	c.177C>G	c.(175-177)ctC>ctG	p.L59L	TMEM202_ENST00000567679.1_Intron	NM_001080462.1	NP_001073931.1	A6NGA9	TM202_HUMAN	transmembrane protein 202	59						integral component of membrane (GO:0016021)				NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|large_intestine(4)|lung(6)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	18						TCCGAACGCTCTGTGGCAGCC	0.522																																																	0													155.0	110.0	125.0					15																	72691089		2199	4297	6496	SO:0001819	synonymous_variant	0				CCDS32287.1	15q24.1	2007-12-18				ENSG00000187806			33733	protein-coding gene	gene with protein product							Standard	NM_001080462		Approved	FLJ27523	uc002auq.3	A6NGA9		ENST00000341689.3:c.177C>G	15.37:g.72691089C>G				Silent	SNP	NULL	p.L59	ENST00000341689.3	37	c.177	CCDS32287.1	15																																																																																			TMEM202	-	NULL	ENSG00000187806		0.522	TMEM202-003	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	TMEM202	HGNC	protein_coding	OTTHUMT00000435756.1	-	0.00	34	0	C	NM_001080462		72691089	+1	tier1	-	no_errors	ENST00000341689	ensembl	human	known	74_37	silent	70.00	9	21	SNP	1.000	G
SCTR	6344	genome.wustl.edu	37	2	120194856	120194856	+	IGR	SNP	C	C	A			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr2:120194856C>A	ENST00000019103.5	-	0	1865				TMEM37_ENST00000409826.1_Missense_Mutation_p.S150Y|TMEM37_ENST00000465296.1_3'UTR|TMEM37_ENST00000306406.4_Missense_Mutation_p.S138Y	NM_002980.2	NP_002971.2	P47872	SCTR_HUMAN	secretin receptor						digestion (GO:0007586)|excretion (GO:0007588)|G-protein coupled receptor signaling pathway (GO:0007186)	cytoplasmic microtubule (GO:0005881)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	secretin receptor activity (GO:0015055)	p.S138F(1)		central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)|prostate(1)|skin(3)	19					Secretin(DB00021)	TTCGTCCTCTCCTCCGGCGGG	0.557																																																	1	Substitution - Missense(1)	breast(1)											177.0	178.0	178.0					2																	120194856		2203	4300	6503	SO:0001628	intergenic_variant	0				CCDS2127.1	2q14.1	2012-08-10			ENSG00000080293	ENSG00000080293		"""GPCR / Class B : Glucagon receptors"""	10608	protein-coding gene	gene with protein product		182098				1646711	Standard	NM_002980		Approved		uc002tma.3	P47872	OTTHUMG00000131407		2.37:g.120194856C>A			Q12961|Q13213|Q53T00	Missense_Mutation	SNP	NULL	p.S138Y	ENST00000019103.5	37	c.413	CCDS2127.1	2	.	.	.	.	.	.	.	.	.	.	C	12.62	1.994098	0.35226	.	.	ENSG00000171227	ENST00000409826;ENST00000306406	.	.	.	4.97	4.09	0.47781	.	0.153934	0.44688	D	0.000430	T	0.58878	0.2153	M	0.72118	2.19	0.30332	N	0.786587	P	0.52842	0.956	P	0.54100	0.742	T	0.64478	-0.6398	9	0.72032	D	0.01	-26.6068	12.285	0.54788	0.0:0.9187:0.0:0.0813	.	138	Q8WXS4	CCGL_HUMAN	Y	150;138	.	ENSP00000303148:S138Y	S	+	2	0	TMEM37	119911326	1.000000	0.71417	0.177000	0.23020	0.008000	0.06430	5.970000	0.70431	1.323000	0.45263	0.655000	0.94253	TCC	TMEM37	-	NULL	ENSG00000171227		0.557	SCTR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM37	HGNC	protein_coding	OTTHUMT00000254198.2		0.00	95	0	C			120194856	+1			no_errors	ENST00000306406	ensembl	human	known	74_37	missense	5.17	55	3	SNP	0.664	A
TMEM8C	389827	genome.wustl.edu	37	9	136385396	136385396	+	Silent	SNP	G	G	A			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr9:136385396G>A	ENST00000339996.3	-	2	251	c.150C>T	c.(148-150)tgC>tgT	p.C50C	TMEM8C_ENST00000413714.1_5'UTR	NM_001080483.2	NP_001073952.1	A6NI61	TMM8C_HUMAN	transmembrane protein 8C	50					muscle organ development (GO:0007517)|myoblast fusion (GO:0007520)|plasma membrane fusion (GO:0045026)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|autonomic_ganglia(1)|large_intestine(2)|lung(4)	8						CGGGTCCATTGCAGGCATGGT	0.602																																																	0													100.0	81.0	87.0					9																	136385396		2203	4300	6503	SO:0001819	synonymous_variant	0			BX324209	CCDS35170.1	9q34.2	2009-06-19		2009-06-19	ENSG00000187616	ENSG00000187616			33778	protein-coding gene	gene with protein product	"""transmembrane protein 226"""	615345					Standard	NM_001080483		Approved	TMEM226	uc011mdk.2	A6NI61	OTTHUMG00000131685	ENST00000339996.3:c.150C>T	9.37:g.136385396G>A				Silent	SNP	pfam_DUF3522	p.C50	ENST00000339996.3	37	c.150	CCDS35170.1	9																																																																																			TMEM8C	-	pfam_DUF3522	ENSG00000187616		0.602	TMEM8C-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM8C	HGNC	protein_coding	OTTHUMT00000356200.2	-	0.00	33	0	G	NM_001080483		136385396	-1	tier1	-	no_errors	ENST00000339996	ensembl	human	known	74_37	silent	14.29	18	3	SNP	0.763	A
TMIE	259236	genome.wustl.edu	37	3	46751074	46751076	+	In_Frame_Del	DEL	AAG	AAG	-	rs552239745|rs397817178|rs10578999|rs372639803|rs544504092|rs538183178|rs71619660|rs75020261	byFrequency	TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	AAG	AAG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr3:46751074_46751076delAAG	ENST00000326431.3	+	4	522_524	c.367_369delAAG	c.(367-369)aagdel	p.K131del		NM_147196.2	NP_671729.2	Q8NEW7	TMIE_HUMAN	transmembrane inner ear	131	Lys-rich.			Missing (in Ref. 1; AAL89820 and 4; AAI26259/AAI26261). {ECO:0000305}.	inner ear morphogenesis (GO:0042472)|sensory perception of sound (GO:0007605)	integral component of membrane (GO:0016021)				endometrium(1)|lung(1)|skin(1)	3				BRCA - Breast invasive adenocarcinoma(193;0.000688)|KIRC - Kidney renal clear cell carcinoma(197;0.0177)|Kidney(197;0.0208)		CACAGAGGATaagaagaagaaga	0.502																																																	0																																										SO:0001651	inframe_deletion	0			AY081842	CCDS43081.1	3p21	2010-01-06	2004-05-19		ENSG00000181585	ENSG00000181585			30800	protein-coding gene	gene with protein product		607237	"""deafness, autosomal recessive 6"""	DFNB6		12140191, 12145746	Standard	NM_147196		Approved		uc010hjk.1	Q8NEW7	OTTHUMG00000149909	ENST00000326431.3:c.367_369delAAG	3.37:g.46751083_46751085delAAG	ENSP00000324775:p.Lys131del		A0AV93|A8K0R0	In_Frame_Del	DEL	NULL	p.K126in_frame_del	ENST00000326431.3	37	c.367_369	CCDS43081.1	3																																																																																			TMIE	-	NULL	ENSG00000181585		0.502	TMIE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMIE	HGNC	protein_coding	OTTHUMT00000313853.1		0.00	46	0	AAG	NM_147196		46751076	+1	tier1		no_errors	ENST00000326431	ensembl	human	known	74_37	in_frame_del	10.71	25	3	DEL	0.074:0.151:0.294	-
TMPRSS3	64699	genome.wustl.edu	37	21	43809063	43809063	+	Silent	SNP	T	T	C			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr21:43809063T>C	ENST00000291532.3	-	4	1252	c.297A>G	c.(295-297)aaA>aaG	p.K99K	TMPRSS3_ENST00000380399.1_Silent_p.K183K|TMPRSS3_ENST00000474596.1_5'UTR|TMPRSS3_ENST00000433957.2_Silent_p.K99K|TMPRSS3_ENST00000398397.3_Silent_p.K99K|TMPRSS3_ENST00000398405.1_Silent_p.K97K	NM_032404.2	NP_115780.1	P57727	TMPS3_HUMAN	transmembrane protease, serine 3	99	LDL-receptor class A. {ECO:0000255|PROSITE-ProRule:PRU00124}.				cellular sodium ion homeostasis (GO:0006883)|proteolysis (GO:0006508)|sensory perception of sound (GO:0007605)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)	scavenger receptor activity (GO:0005044)|serine-type endopeptidase activity (GO:0004252)|sodium channel regulator activity (GO:0017080)			breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(2)|ovary(4)|skin(1)	13						CCTCCCCGTCTTTGCAATCCG	0.527																																																	0													99.0	84.0	89.0					21																	43809063		2203	4300	6503	SO:0001819	synonymous_variant	0			AF201380	CCDS13686.1, CCDS42939.1, CCDS58790.1	21q22.3	2010-04-13			ENSG00000160183	ENSG00000160183		"""Serine peptidases / Transmembrane"""	11877	protein-coding gene	gene with protein product		605511		DFNB10, DFNB8		11462234, 11907649	Standard	NM_032405		Approved		uc002zbc.3	P57727	OTTHUMG00000086796	ENST00000291532.3:c.297A>G	21.37:g.43809063T>C			D3DSJ6|Q5USC7|Q6ZMC3	Silent	SNP	pfam_Peptidase_S1,pfam_SRCR,pfam_Peptidase_S1A_nudel,pfam_LDrepeatLR_classA_rpt,superfamily_Trypsin-like_Pept_dom,superfamily_Srcr_rcpt-rel,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_Srcr_rcpt-rel,smart_Peptidase_S1,pfscan_LDrepeatLR_classA_rpt,pfscan_SRCR,pfscan_Peptidase_S1,prints_Peptidase_S1A	p.K183	ENST00000291532.3	37	c.549	CCDS13686.1	21																																																																																			TMPRSS3	-	pfam_LDrepeatLR_classA_rpt,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,pfscan_LDrepeatLR_classA_rpt	ENSG00000160183		0.527	TMPRSS3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TMPRSS3	HGNC	protein_coding	OTTHUMT00000195347.1	-	0.00	40	0	T			43809063	-1	tier1	-	no_errors	ENST00000380399	ensembl	human	known	74_37	silent	11.90	74	10	SNP	0.186	C
TNC	3371	genome.wustl.edu	37	9	117786271	117786271	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr9:117786271C>A	ENST00000350763.4	-	27	6887	c.6476G>T	c.(6475-6477)gGg>gTg	p.G2159V	TNC_ENST00000341037.4_Missense_Mutation_p.G1977V|TNC_ENST00000346706.3_Missense_Mutation_p.G1613V|TNC_ENST00000345230.3_Missense_Mutation_p.G1522V|TNC_ENST00000542877.1_Missense_Mutation_p.G1796V|TNC_ENST00000423613.2_Missense_Mutation_p.G1886V|TNC_ENST00000340094.3_Missense_Mutation_p.G1795V|TNC_ENST00000537320.1_Missense_Mutation_p.G1522V|TNC_ENST00000535648.1_Missense_Mutation_p.G1704V	NM_002160.3	NP_002151.2	P24821	TENA_HUMAN	tenascin C	2159	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				bud outgrowth involved in lung branching (GO:0060447)|cell adhesion (GO:0007155)|cellular response to prostaglandin D stimulus (GO:0071799)|cellular response to retinoic acid (GO:0071300)|cellular response to vitamin D (GO:0071305)|extracellular matrix organization (GO:0030198)|mesenchymal-epithelial cell signaling involved in prostate gland development (GO:0060739)|negative regulation of cell adhesion (GO:0007162)|neuromuscular junction development (GO:0007528)|odontogenesis of dentin-containing tooth (GO:0042475)|osteoblast differentiation (GO:0001649)|peripheral nervous system axon regeneration (GO:0014012)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|prostate gland epithelium morphogenesis (GO:0060740)|response to ethanol (GO:0045471)|response to fibroblast growth factor (GO:0071774)|response to mechanical stimulus (GO:0009612)|response to wounding (GO:0009611)|wound healing (GO:0042060)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|interstitial matrix (GO:0005614)|membrane (GO:0016020)	syndecan binding (GO:0045545)			NS(3)|breast(5)|central_nervous_system(4)|endometrium(8)|kidney(6)|large_intestine(32)|liver(1)|lung(39)|ovary(1)|pancreas(2)|prostate(5)|skin(5)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	120						GTTATTGTCCCCATATCTCCC	0.527																																																	0													187.0	155.0	166.0					9																	117786271		2203	4300	6503	SO:0001583	missense	0				CCDS6811.1	9q33.1	2014-01-28	2008-07-31	2002-06-07	ENSG00000041982	ENSG00000041982		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	5318	protein-coding gene	gene with protein product	"""hexabrachion (tenascin)"""	187380	"""hexabrachion (tenascin C, cytotactin)"", ""deafness, autosomal dominant 56"""	HXB, DFNA56		1704365, 1707164, 23936043	Standard	NM_002160		Approved	TN, MGC167029	uc004bjj.4	P24821	OTTHUMG00000021010	ENST00000350763.4:c.6476G>T	9.37:g.117786271C>A	ENSP00000265131:p.Gly2159Val		C9IYT7|C9J575|C9J6D9|C9J848|Q14583|Q15567|Q5T7S3	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Fibrinogen_a/b/g_C_dom,pfam_EGF_extracell,superfamily_Fibrinogen_a/b/g_C_dom,superfamily_Fibronectin_type3,smart_EG-like_dom,smart_Fibronectin_type3,smart_Fibrinogen_a/b/g_C_dom,pfscan_EG-like_dom,pfscan_Fibronectin_type3	p.G2159V	ENST00000350763.4	37	c.6476	CCDS6811.1	9	.	.	.	.	.	.	.	.	.	.	C	26.9	4.782153	0.90282	.	.	ENSG00000041982	ENST00000340094;ENST00000535648;ENST00000346706;ENST00000345230;ENST00000350763;ENST00000341037;ENST00000423613;ENST00000537320;ENST00000542877	T;T;T;T;T;T;T;T;T	0.80123	-1.34;-1.34;-1.34;-1.34;-1.34;-1.34;-1.34;-1.34;-1.34	5.55	5.55	0.83447	Fibrinogen, alpha/beta/gamma chain, C-terminal globular (4);Fibrinogen, alpha/beta/gamma chain, C-terminal globular, subdomain 2 (1);	0.000000	0.85682	D	0.000000	D	0.90950	0.7155	M	0.84219	2.685	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.91543	0.5251	10	0.87932	D	0	.	19.848	0.96722	0.0:1.0:0.0:0.0	.	1886;2159	E9PC84;P24821	.;TENA_HUMAN	V	1795;1704;1613;1522;2159;1977;1886;1522;1796	ENSP00000344400:G1795V;ENSP00000438152:G1704V;ENSP00000344555:G1613V;ENSP00000345861:G1522V;ENSP00000265131:G2159V;ENSP00000339553:G1977V;ENSP00000411406:G1886V;ENSP00000443478:G1522V;ENSP00000442242:G1796V	ENSP00000344400:G1795V	G	-	2	0	TNC	116826092	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	5.953000	0.70290	2.764000	0.94973	0.563000	0.77884	GGG	TNC	-	pfam_Fibrinogen_a/b/g_C_dom,superfamily_Fibrinogen_a/b/g_C_dom,smart_Fibrinogen_a/b/g_C_dom	ENSG00000041982		0.527	TNC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNC	HGNC	protein_coding	OTTHUMT00000055418.2	-	0.00	64	0	C	NM_002160		117786271	-1	tier1	-	no_errors	ENST00000350763	ensembl	human	known	74_37	missense	34.78	30	16	SNP	1.000	A
TNFAIP3	7128	genome.wustl.edu	37	6	138192616	138192616	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr6:138192616C>G	ENST00000237289.4	+	2	318	c.252C>G	c.(250-252)aaC>aaG	p.N84K		NM_001270507.1|NM_001270508.1|NM_006290.3	NP_001257436.1|NP_001257437.1|NP_006281.1	P21580	TNAP3_HUMAN	tumor necrosis factor, alpha-induced protein 3	84	TRAF-binding.				apoptotic process (GO:0006915)|B-1 B cell homeostasis (GO:0001922)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to lipopolysaccharide (GO:0071222)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|negative regulation of B cell activation (GO:0050869)|negative regulation of bone resorption (GO:0045779)|negative regulation of CD40 signaling pathway (GO:2000349)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of inflammatory response (GO:0050728)|negative regulation of innate immune response (GO:0045824)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of osteoclast proliferation (GO:0090291)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of smooth muscle cell proliferation (GO:0048662)|negative regulation of toll-like receptor 2 signaling pathway (GO:0034136)|negative regulation of toll-like receptor 3 signaling pathway (GO:0034140)|negative regulation of toll-like receptor 4 signaling pathway (GO:0034144)|negative regulation of tumor necrosis factor production (GO:0032720)|negative regulation of type I interferon production (GO:0032480)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of protein catabolic process (GO:0045732)|protein deubiquitination (GO:0016579)|protein K11-linked deubiquitination (GO:0035871)|protein K48-linked deubiquitination (GO:0071108)|protein K48-linked ubiquitination (GO:0070936)|protein K63-linked deubiquitination (GO:0070536)|protein oligomerization (GO:0051259)|regulation of defense response to virus by host (GO:0050691)|regulation of germinal center formation (GO:0002634)|regulation of vascular wound healing (GO:0061043)|response to molecule of bacterial origin (GO:0002237)|tolerance induction to lipopolysaccharide (GO:0072573)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|protease binding (GO:0002020)|protein self-association (GO:0043621)|ubiquitin binding (GO:0043130)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-protein transferase activity (GO:0004842)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)	p.0?(25)		breast(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(196)|kidney(1)|large_intestine(4)|lung(13)|ovary(4)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	225	Breast(32;0.135)|Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.000849)|OV - Ovarian serous cystadenocarcinoma(155;0.00468)		AGAAACTCAACTGGTGTCGAG	0.507			"""D, N, F"""		"""marginal zone B-cell lymphomas, Hodgkin's lymphoma, primary mediastinal B cell lymphoma"""																																GBM(130;153 1739 22295 28918 47987)			Rec	yes		6	6q23	7128	"""tumor necrosis factor, alpha-induced protein 3"""		L	25	Whole gene deletion(25)	haematopoietic_and_lymphoid_tissue(25)											158.0	148.0	152.0					6																	138192616		2203	4300	6503	SO:0001583	missense	0			M59465	CCDS5187.1	6q23-q25	2013-01-21			ENSG00000118503	ENSG00000118503		"""OTU domain containing"""	11896	protein-coding gene	gene with protein product		191163				2118515	Standard	NM_006290		Approved	A20, OTUD7C	uc031spw.1	P21580	OTTHUMG00000015664	ENST00000237289.4:c.252C>G	6.37:g.138192616C>G	ENSP00000237289:p.Asn84Lys		B2R767|E1P588|Q2HIX9|Q5VXQ7|Q9NSR6	Missense_Mutation	SNP	pfam_Znf_A20,pfam_OTU,smart_Znf_A20,pfscan_OTU,pfscan_Znf_A20	p.N84K	ENST00000237289.4	37	c.252	CCDS5187.1	6	.	.	.	.	.	.	.	.	.	.	C	20.9	4.060643	0.76074	.	.	ENSG00000118503	ENST00000420009;ENST00000237289;ENST00000433680;ENST00000535574;ENST00000535332;ENST00000539356;ENST00000544646;ENST00000536070	T;T	0.57273	0.41;0.51	6.08	3.25	0.37280	.	0.000000	0.85682	D	0.000000	T	0.47820	0.1466	L	0.36672	1.1	0.53688	D	0.999979	D	0.89917	1.0	D	0.91635	0.999	T	0.52983	-0.8502	10	0.87932	D	0	-3.3656	8.7108	0.34382	0.0:0.694:0.0:0.306	.	84	P21580	TNAP3_HUMAN	K	84	ENSP00000401562:N84K;ENSP00000237289:N84K	ENSP00000237289:N84K	N	+	3	2	TNFAIP3	138234309	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	1.820000	0.39032	0.394000	0.25230	-0.345000	0.07892	AAC	TNFAIP3	-	NULL	ENSG00000118503		0.507	TNFAIP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNFAIP3	HGNC	protein_coding	OTTHUMT00000042414.1	-	0.00	43	0	C			138192616	+1	tier1	-	no_errors	ENST00000237289	ensembl	human	known	74_37	missense	36.36	21	12	SNP	1.000	G
TNFRSF19	55504	genome.wustl.edu	37	13	24190184	24190184	+	Splice_Site	SNP	G	G	C			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr13:24190184G>C	ENST00000382258.4	+	4	563	c.359G>C	c.(358-360)gGa>gCa	p.G120A	TNFRSF19_ENST00000248484.4_Splice_Site_p.G120A|TNFRSF19_ENST00000403372.2_5'UTR|TNFRSF19_ENST00000382263.3_Splice_Site_p.G120A	NM_018647.3	NP_061117.2	Q9NS68	TNR19_HUMAN	tumor necrosis factor receptor superfamily, member 19	120					apoptotic process (GO:0006915)|hair follicle development (GO:0001942)|JNK cascade (GO:0007254)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	integral component of membrane (GO:0016021)	tumor necrosis factor-activated receptor activity (GO:0005031)			breast(1)|endometrium(4)|kidney(1)|large_intestine(4)|liver(2)|lung(5)|prostate(1)|skin(2)|stomach(1)|urinary_tract(1)	22		all_cancers(29;3.4e-22)|all_epithelial(30;8.75e-19)|all_lung(29;5.09e-18)|Lung SC(185;0.0225)|Breast(139;0.128)		all cancers(112;0.00193)|Epithelial(112;0.0137)|OV - Ovarian serous cystadenocarcinoma(117;0.0465)|GBM - Glioblastoma multiforme(144;0.184)|Lung(94;0.19)		TGCTTGCCAGGGTGAGTTGGC	0.448																																																	0													60.0	61.0	61.0					13																	24190184		2203	4300	6503	SO:0001630	splice_region_variant	0			AB040434	CCDS9301.1, CCDS9302.1, CCDS55893.1	13q12.11-q12.3	2008-07-18			ENSG00000127863	ENSG00000127863		"""Tumor necrosis factor receptor superfamily"""	11915	protein-coding gene	gene with protein product	"""toxicity and JNK inducer"""	606122				10764796, 10809768	Standard	NM_018647		Approved	TAJ-alpha, TROY, TAJ, TRADE	uc001uov.2	Q9NS68	OTTHUMG00000016568	ENST00000382258.4:c.359+1G>C	13.37:g.24190184G>C			A8KA09|A8KA26|B1AM40|B1AM41|B4E2I6|Q9BXZ9|Q9BY00|Q9NZV2	Missense_Mutation	SNP	smart_TNFR/NGFR_Cys_rich_reg,pfscan_TNFR/NGFR_Cys_rich_reg,prints_TNFR_19	p.G120A	ENST00000382258.4	37	c.359	CCDS9302.1	13	.	.	.	.	.	.	.	.	.	.	G	25.5	4.644676	0.87859	.	.	ENSG00000127863	ENST00000248484;ENST00000382258;ENST00000382263	T;T;T	0.62364	1.4;0.03;1.4	5.47	5.47	0.80525	.	0.000000	0.85682	D	0.000000	D	0.84316	0.5445	M	0.91140	3.18	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.87596	0.2494	10	0.87932	D	0	-17.9934	19.3317	0.94293	0.0:0.0:1.0:0.0	.	120;120	Q9NS68;Q9NS68-2	TNR19_HUMAN;.	A	120	ENSP00000248484:G120A;ENSP00000371693:G120A;ENSP00000371698:G120A	ENSP00000248484:G120A	G	+	2	0	TNFRSF19	23088184	1.000000	0.71417	0.999000	0.59377	0.950000	0.60333	9.476000	0.97823	2.582000	0.87167	0.561000	0.74099	GGA	TNFRSF19	-	NULL	ENSG00000127863		0.448	TNFRSF19-001	KNOWN	basic|CCDS	protein_coding	TNFRSF19	HGNC	protein_coding	OTTHUMT00000044156.2	-	0.00	52	0	G	NM_018647	Missense_Mutation	24190184	+1	tier1	-	no_errors	ENST00000382258	ensembl	human	known	74_37	missense	60.87	9	14	SNP	1.000	C
TP53	7157	genome.wustl.edu	37	17	7578412	7578412	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr17:7578412A>C	ENST00000269305.4	-	5	707	c.518T>G	c.(517-519)gTg>gGg	p.V173G	TP53_ENST00000574684.1_5'UTR|TP53_ENST00000413465.2_Missense_Mutation_p.V173G|TP53_ENST00000445888.2_Missense_Mutation_p.V173G|TP53_ENST00000455263.2_Missense_Mutation_p.V173G|TP53_ENST00000420246.2_Missense_Mutation_p.V173G|TP53_ENST00000359597.4_Missense_Mutation_p.V173G	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	173	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		V -> A (in sporadic cancers; somatic mutation).|V -> E (in sporadic cancers; somatic mutation).|V -> G (in sporadic cancers; somatic mutation).|V -> L (in sporadic cancers; somatic mutation).|V -> M (in LFS; germline mutation and in sporadic cancers; somatic mutation).|V -> W (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.V173A(12)|p.0?(8)|p.V173G(6)|p.V173fs*7(3)|p.V173fs*59(2)|p.V157_C176del20(1)|p.V173E(1)|p.V41fs*7(1)|p.H168fs*69(1)|p.E171fs*1(1)|p.V172_R174delVVR(1)|p.P151_V173del23(1)|p.V173fs*69(1)|p.E171_H179delEVVRRCPHH(1)|p.E171fs*61(1)|p.V173fs*23(1)|p.V173W(1)|p.S149fs*72(1)|p.V80fs*7(1)|p.V172_E180delVVRRCPHHE(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GCAGCGCCTCACAACCTCCGT	0.662		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	46	Substitution - Missense(20)|Deletion - Frameshift(13)|Whole gene deletion(8)|Deletion - In frame(5)	large_intestine(9)|central_nervous_system(7)|bone(5)|haematopoietic_and_lymphoid_tissue(4)|lung(4)|stomach(3)|biliary_tract(3)|oesophagus(3)|upper_aerodigestive_tract(2)|liver(2)|endometrium(1)|ovary(1)|prostate(1)|breast(1)											51.0	51.0	51.0					17																	7578412		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.518T>G	17.37:g.7578412A>C	ENSP00000269305:p.Val173Gly		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.V173G	ENST00000269305.4	37	c.518	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	A	17.13	3.311672	0.60414	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99861	-7.26;-7.26;-7.26;-7.26;-7.26;-7.26;-7.26;-7.26	5.59	2.07	0.26955	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99819	0.9920	M	0.92459	3.31	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	1.0;0.999;1.0;1.0;0.999;1.0;1.0	D	0.98609	1.0662	10	0.87932	D	0	-25.5548	3.5237	0.07752	0.6522:0.1396:0.0747:0.1336	.	134;173;173;80;173;173;173	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	G	173;173;173;173;173;173;162;80;41;80;41	ENSP00000410739:V173G;ENSP00000352610:V173G;ENSP00000269305:V173G;ENSP00000398846:V173G;ENSP00000391127:V173G;ENSP00000391478:V173G;ENSP00000425104:V41G;ENSP00000423862:V80G	ENSP00000269305:V173G	V	-	2	0	TP53	7519137	1.000000	0.71417	0.149000	0.22428	0.475000	0.33008	9.287000	0.95975	0.122000	0.18314	-0.256000	0.11100	GTG	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor	ENSG00000141510		0.662	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	-	0.00	42	0	A	NM_000546		7578412	-1	tier1	-	no_errors	ENST00000269305	ensembl	human	known	74_37	missense	75.00	8	24	SNP	0.995	C
TPRX2P	503627	genome.wustl.edu	37	19	48364761	48364761	+	Missense_Mutation	SNP	G	G	A	rs543314120		TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr19:48364761G>A	ENST00000535362.1	+	3	973	c.973G>A	c.(973-975)Gat>Aat	p.D325N	CTD-3098H1.2_ENST00000555406.2_lincRNA					tetra-peptide repeat homeobox 2 pseudogene																		GTCATTACTGGATTTATAGGG	0.527																																																	0																																										SO:0001583	missense	0					19q13.32	2011-06-20				ENSG00000259009		"""Homeoboxes / PRD class"""	32175	pseudogene	pseudogene							Standard	NG_004835		Approved	TPRX2P1				ENST00000535362.1:c.973G>A	19.37:g.48364761G>A	ENSP00000440389:p.Asp325Asn			Missense_Mutation	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom	p.D325N	ENST00000535362.1	37	c.973		19	.	.	.	.	.	.	.	.	.	.	G	12.78	2.040353	0.35989	.	.	ENSG00000105392	ENST00000535362	D	0.92495	-3.05	1.72	-2.42	0.06542	.	.	.	.	.	D	0.89121	0.6625	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.81665	-0.0830	6	0.87932	D	0	.	5.6614	0.17670	0.6436:0.0:0.3564:0.0	.	.	.	.	N	325	ENSP00000440389:D325N	ENSP00000440389:D325N	D	+	1	0	CRX	53056573	0.000000	0.05858	0.000000	0.03702	0.018000	0.09664	-0.741000	0.04855	-0.649000	0.05430	0.563000	0.77884	GAT	TPRX2P	-	NULL	ENSG00000259009		0.527	TPRX2P-001	KNOWN	basic|appris_principal	protein_coding	TPRX2P	HGNC	protein_coding	OTTHUMT00000470149.1	-	0.00	45	0	G	NG_004835		48364761	+1	tier1	-	no_errors	ENST00000535362	ensembl	human	known	74_37	missense	28.21	28	11	SNP	0.000	A
TRHDE	29953	genome.wustl.edu	37	12	72771817	72771817	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr12:72771817G>A	ENST00000261180.4	+	3	1192	c.1096G>A	c.(1096-1098)Ggg>Agg	p.G366R		NM_013381.2	NP_037513.1	Q9UKU6	TRHDE_HUMAN	thyrotropin-releasing hormone degrading enzyme	366					cell-cell signaling (GO:0007267)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(8)|kidney(3)|large_intestine(13)|lung(38)|ovary(2)|skin(4)|soft_tissue(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	79						AAGAGGATCCGGGGACTATGC	0.328																																																	0													63.0	65.0	65.0					12																	72771817		2203	4298	6501	SO:0001583	missense	0			AF126372	CCDS9004.1	12q15-q21	2012-07-25		2005-08-09		ENSG00000072657	3.4.19.6		30748	protein-coding gene	gene with protein product	"""pyroglutamyl-peptidase II"", ""pyroglutamyl aminopeptidase II"", ""TRH-specific aminopeptidase"""	606950				10491199, 12975309	Standard	NM_013381		Approved	PGPEP2, TRH-DE, PAP-II	uc001sxa.3	Q9UKU6		ENST00000261180.4:c.1096G>A	12.37:g.72771817G>A	ENSP00000261180:p.Gly366Arg		A5PL19|Q6UWJ4	Missense_Mutation	SNP	pfam_Peptidase_M1_N,prints_Peptidase_M1_N	p.G366R	ENST00000261180.4	37	c.1096	CCDS9004.1	12	.	.	.	.	.	.	.	.	.	.	G	23.4	4.411170	0.83340	.	.	ENSG00000072657	ENST00000261180	T	0.05025	3.51	5.57	5.57	0.84162	Peptidase M1, membrane alanine aminopeptidase, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.25644	0.0624	M	0.67569	2.06	0.80722	D	1	D	0.89917	1.0	D	0.72982	0.979	T	0.00141	-1.1998	10	0.72032	D	0.01	.	19.5437	0.95283	0.0:0.0:1.0:0.0	.	366	Q9UKU6	TRHDE_HUMAN	R	366	ENSP00000261180:G366R	ENSP00000261180:G366R	G	+	1	0	TRHDE	71058084	1.000000	0.71417	0.999000	0.59377	0.998000	0.95712	9.235000	0.95353	2.645000	0.89757	0.585000	0.79938	GGG	TRHDE	-	pfam_Peptidase_M1_N	ENSG00000072657		0.328	TRHDE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRHDE	HGNC	protein_coding	OTTHUMT00000405380.1	-	0.00	95	0	G	NM_013381		72771817	+1	tier1	-	no_errors	ENST00000261180	ensembl	human	known	74_37	missense	18.58	92	21	SNP	1.000	A
TRIM36	55521	genome.wustl.edu	37	5	114469750	114469750	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr5:114469750G>T	ENST00000282369.3	-	8	1462	c.1341C>A	c.(1339-1341)agC>agA	p.S447R	TRIM36_ENST00000514154.1_Missense_Mutation_p.S292R|TRIM36_ENST00000513154.1_Missense_Mutation_p.S435R	NM_018700.3	NP_061170.2	Q9NQ86	TRI36_HUMAN	tripartite motif containing 36	447	Fibronectin type-III. {ECO:0000255|PROSITE-ProRule:PRU00316}.				acrosome reaction (GO:0007340)|regulation of cell cycle (GO:0051726)	acrosomal vesicle (GO:0001669)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(3)|endometrium(1)|kidney(2)|large_intestine(4)|lung(15)|ovary(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	37		all_cancers(142;0.00133)|all_epithelial(76;2.41e-05)|Prostate(80;0.00955)|Ovarian(225;0.0443)|Breast(839;0.195)		OV - Ovarian serous cystadenocarcinoma(64;3.62e-08)|Epithelial(69;7.69e-08)|all cancers(49;9.33e-06)		CAAGAACATAGCTATCAGCTT	0.358																																																	0													124.0	115.0	118.0					5																	114469750		2202	4300	6502	SO:0001583	missense	0			AJ272269	CCDS4115.1, CCDS34211.1, CCDS34212.1, CCDS75287.1	5q22	2013-02-11	2011-01-25		ENSG00000152503	ENSG00000152503		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"", ""Fibronectin type III domain containing"""	16280	protein-coding gene	gene with protein product	"""zinc-binding protein Rbcc728"", ""tripartite motif protein 36"", ""RING finger protein 98"""	609317	"""tripartite motif-containing 36"""			11331580	Standard	XM_005272031		Approved	RBCC728, RNF98, HAPRIN	uc003kqs.3	Q9NQ86	OTTHUMG00000128892	ENST00000282369.3:c.1341C>A	5.37:g.114469750G>T	ENSP00000282369:p.Ser447Arg		A1L3Z1|A6NDD0|B7Z3V4|B7ZAV7|E9PFI8|Q0P5Z9	Missense_Mutation	SNP	pfam_Znf_B-box,pfam_Fibronectin_type3,pfam_SPRY_rcpt,pfam_Znf_C3HC4_RING-type,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_Znf_RING,smart_Znf_B-box,pfscan_B30.2/SPRY,pfscan_Fibronectin_type3,pfscan_Znf_B-box,pfscan_Znf_RING,prints_Butyrophylin	p.S447R	ENST00000282369.3	37	c.1341	CCDS4115.1	5	.	.	.	.	.	.	.	.	.	.	G	11.43	1.637599	0.29157	.	.	ENSG00000152503	ENST00000282369;ENST00000513154;ENST00000514154	T;T;T	0.57273	0.41;0.41;0.41	5.63	3.6	0.41247	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.472746	0.24681	N	0.036478	T	0.38268	0.1034	L	0.34521	1.04	0.80722	D	1	B;B	0.14012	0.007;0.009	B;B	0.17979	0.01;0.02	T	0.20571	-1.0271	10	0.35671	T	0.21	.	7.8849	0.29644	0.1851:0.2019:0.613:0.0	.	435;447	E9PFI8;Q9NQ86	.;TRI36_HUMAN	R	447;435;292	ENSP00000282369:S447R;ENSP00000423934:S435R;ENSP00000424259:S292R	ENSP00000282369:S447R	S	-	3	2	TRIM36	114497649	0.996000	0.38824	1.000000	0.80357	0.966000	0.64601	0.533000	0.23082	1.385000	0.46445	0.655000	0.94253	AGC	TRIM36	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000152503		0.358	TRIM36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM36	HGNC	protein_coding	OTTHUMT00000250854.2	-	0.00	36	0	G	NM_018700		114469750	-1	tier1	-	no_errors	ENST00000282369	ensembl	human	known	74_37	missense	14.29	18	3	SNP	0.999	T
TSEN34	79042	genome.wustl.edu	37	19	54695405	54695405	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr19:54695405G>C	ENST00000396383.1	+	2	501	c.190G>C	c.(190-192)Ggc>Cgc	p.G64R	MBOAT7_ENST00000474910.1_5'Flank|TSEN34_ENST00000396388.2_Missense_Mutation_p.G64R|TSEN34_ENST00000429671.2_Missense_Mutation_p.G64R|MBOAT7_ENST00000338624.6_5'Flank|CTD-3093M3.1_ENST00000594382.1_lincRNA|TSEN34_ENST00000302937.4_Missense_Mutation_p.G64R|MBOAT7_ENST00000245615.1_5'Flank|MBOAT7_ENST00000391754.1_5'Flank|MBOAT7_ENST00000431666.2_5'Flank			Q9BSV6	SEN34_HUMAN	TSEN34 tRNA splicing endonuclease subunit	64					mRNA processing (GO:0006397)|tRNA-type intron splice site recognition and cleavage (GO:0000379)	tRNA-intron endonuclease complex (GO:0000214)	lyase activity (GO:0016829)|nucleic acid binding (GO:0003676)|tRNA-intron endonuclease activity (GO:0000213)			endometrium(1)|large_intestine(1)|lung(6)|prostate(1)|upper_aerodigestive_tract(1)	10	all_cancers(19;0.00723)|all_epithelial(19;0.00389)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)					GGCCGAGATCGGCGCCGTGAC	0.741																																					Esophageal Squamous(37;841 964 4869 42824)												0													12.0	13.0	13.0					19																	54695405		1757	3873	5630	SO:0001583	missense	0			AF211970	CCDS42609.1, CCDS74446.1	19q13.4	2013-08-06	2013-08-06	2005-03-12	ENSG00000170892	ENSG00000170892		"""tRNA splicing endonuclease subunits"""	15506	protein-coding gene	gene with protein product		608754	"""leukocyte receptor cluster (LRC) member 5"", ""tRNA splicing endonuclease 34 homolog (SEN34, S. cerevisiae)"", ""tRNA splicing endonuclease 34 homolog (S. cerevisiae)"""	LENG5		10941842, 15109492	Standard	NM_024075		Approved	SEN34, SEN34L	uc002qdw.3	Q9BSV6	OTTHUMG00000066515	ENST00000396383.1:c.190G>C	19.37:g.54695405G>C	ENSP00000379667:p.Gly64Arg		A6NNB1|B0V3J1|Q9BVT1|Q9H6H5	Missense_Mutation	SNP	pfam_tRNA_intron_Endonuc_cat-like,superfamily_tRNA_intron_Endonuc_cat-like,pirsf_tRNA_splic_SEN34,tigrfam_tRNA_splic	p.G64R	ENST00000396383.1	37	c.190	CCDS42609.1	19	.	.	.	.	.	.	.	.	.	.	G	17.19	3.325711	0.60743	.	.	ENSG00000170892	ENST00000455798;ENST00000456872;ENST00000302937;ENST00000429671;ENST00000396383;ENST00000396388	T;T;T;T;T;T	0.70631	-0.5;-0.48;-0.42;-0.46;-0.42;-0.42	4.06	4.06	0.47325	.	0.201078	0.32608	N	0.005879	T	0.78553	0.4301	M	0.80982	2.52	0.42193	D	0.991735	D;D	0.58620	0.983;0.983	P;P	0.50896	0.579;0.653	D	0.83734	0.0200	10	0.66056	D	0.02	.	15.3594	0.74460	0.0:0.0:1.0:0.0	.	64;64	E7EQB3;Q9BSV6	.;SEN34_HUMAN	R	64;67;64;64;64;64	ENSP00000400743:G64R;ENSP00000408689:G67R;ENSP00000305524:G64R;ENSP00000397402:G64R;ENSP00000379667:G64R;ENSP00000379671:G64R	ENSP00000305524:G64R	G	+	1	0	TSEN34	59387217	1.000000	0.71417	0.962000	0.40283	0.419000	0.31324	5.897000	0.69831	1.985000	0.57927	0.462000	0.41574	GGC	TSEN34	-	pirsf_tRNA_splic_SEN34	ENSG00000170892		0.741	TSEN34-003	KNOWN	basic|appris_principal|CCDS	protein_coding	TSEN34	HGNC	protein_coding	OTTHUMT00000142200.1	-	0.00	19	0	G	NM_024075		54695405	+1	tier1	-	no_errors	ENST00000429671	ensembl	human	known	74_37	missense	52.17	11	12	SNP	0.996	C
TTC39B	158219	genome.wustl.edu	37	9	15175077	15175077	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr9:15175077G>A	ENST00000512701.2	-	19	1934	c.1898C>T	c.(1897-1899)gCa>gTa	p.A633V	TTC39B_ENST00000380850.4_Missense_Mutation_p.A620V|TTC39B_ENST00000355694.2_Missense_Mutation_p.A567V|TTC39B_ENST00000507993.1_Missense_Mutation_p.A468V|TTC39B_ENST00000297615.5_Missense_Mutation_p.A564V|TTC39B_ENST00000507285.1_Missense_Mutation_p.A468V			Q5VTQ0	TT39B_HUMAN	tetratricopeptide repeat domain 39B	633										NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(7)|ovary(2)|prostate(1)	21						ATACAAAGATGCCAATTCAAA	0.393																																																	0													113.0	107.0	109.0					9																	15175077		2203	4300	6503	SO:0001583	missense	0			AK091187	CCDS6477.1, CCDS6477.2, CCDS55294.1, CCDS55295.1, CCDS55296.1	9p22.2	2013-01-11	2008-06-23	2008-06-23	ENSG00000155158	ENSG00000155158		"""Tetratricopeptide (TTC) repeat domain containing"""	23704	protein-coding gene	gene with protein product		613574	"""chromosome 9 open reading frame 52"""	C9orf52			Standard	NM_001168339		Approved	FLJ33868	uc003zlr.2	Q5VTQ0	OTTHUMG00000019581	ENST00000512701.2:c.1898C>T	9.37:g.15175077G>A	ENSP00000422496:p.Ala633Val		A5PLN1|B4DQ10|B4DQX4|B4DW93|Q8IVR7|Q8IXZ6|Q8N267	Missense_Mutation	SNP	pfam_OMP_IML2_mit/TPR_39,smart_TPR_repeat	p.A633V	ENST00000512701.2	37	c.1898	CCDS6477.2	9	.	.	.	.	.	.	.	.	.	.	G	21.6	4.167715	0.78339	.	.	ENSG00000155158	ENST00000380850;ENST00000297615;ENST00000355694;ENST00000512701;ENST00000507285;ENST00000507993	T;T;T;T;T;T	0.79845	-1.31;-0.35;-0.35;0.44;-0.35;-0.35	5.72	4.81	0.61882	Tetratricopeptide-like helical (1);	0.115878	0.56097	D	0.000021	D	0.86481	0.5943	L	0.57536	1.79	0.80722	D	1	D;P;D;D;P	0.67145	0.996;0.945;0.988;0.988;0.891	D;P;D;D;P	0.71656	0.931;0.722;0.974;0.974;0.671	D	0.87185	0.2230	10	0.87932	D	0	-15.3302	12.8454	0.57827	0.0:0.3769:0.6231:0.0	.	564;620;565;567;150	F5H705;E9PAQ9;A5PLN1;Q5VTQ0;Q8IXZ6	.;.;.;TT39B_HUMAN;.	V	620;564;567;633;468;468	ENSP00000370231:A620V;ENSP00000297615:A564V;ENSP00000347920:A567V;ENSP00000422496:A633V;ENSP00000426539:A468V;ENSP00000423392:A468V	ENSP00000297615:A564V	A	-	2	0	TTC39B	15165077	1.000000	0.71417	0.988000	0.46212	0.751000	0.42716	3.939000	0.56591	2.691000	0.91804	0.655000	0.94253	GCA	TTC39B	-	smart_TPR_repeat	ENSG00000155158		0.393	TTC39B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TTC39B	HGNC	protein_coding	OTTHUMT00000051758.3	-	0.00	41	0	G	NM_152574		15175077	-1	tier1	-	no_errors	ENST00000512701	ensembl	human	known	74_37	missense	61.36	17	27	SNP	0.998	A
TTLL5	23093	genome.wustl.edu	37	14	76173979	76173979	+	Silent	SNP	C	C	T	rs543743763		TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr14:76173979C>T	ENST00000298832.9	+	9	874	c.669C>T	c.(667-669)gaC>gaT	p.D223D	TTLL5_ENST00000555422.1_3'UTR|TTLL5_ENST00000557636.1_Silent_p.D223D|TTLL5_ENST00000286650.5_Silent_p.D223D	NM_015072.4	NP_055887.3	Q6EMB2	TTLL5_HUMAN	tubulin tyrosine ligase-like family, member 5	223	TTL. {ECO:0000255|PROSITE- ProRule:PRU00568}.				fertilization (GO:0009566)|protein polyglutamylation (GO:0018095)|sperm axoneme assembly (GO:0007288)|sperm motility (GO:0030317)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cilium (GO:0005929)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)			NS(2)|breast(2)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(1)|large_intestine(3)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|urinary_tract(2)	50				BRCA - Breast invasive adenocarcinoma(234;0.029)		TCAAGTTTGACGTGCGCCTCT	0.368													C|||	1	0.000199681	0.0008	0.0	5008	,	,		14639	0.0		0.0	False		,,,				2504	0.0																0													81.0	79.0	79.0					14																	76173979		2203	4300	6503	SO:0001819	synonymous_variant	0			AF107885	CCDS32124.1	14q24.3	2014-09-09	2005-07-29	2005-07-29	ENSG00000119685	ENSG00000119685		"""Tubulin tyrosine ligase-like family"""	19963	protein-coding gene	gene with protein product		612268	"""KIAA0998"""	KIAA0998		15890843	Standard	NM_015072		Approved		uc001xrx.3	Q6EMB2	OTTHUMG00000171611	ENST00000298832.9:c.669C>T	14.37:g.76173979C>T			B9EGH8|B9EGH9|Q9BUB0|Q9H0G4|Q9H7W2|Q9P1V5|Q9UPZ4	Silent	SNP	pfam_TTL/TTLL_fam	p.D223	ENST00000298832.9	37	c.669	CCDS32124.1	14																																																																																			TTLL5	-	pfam_TTL/TTLL_fam	ENSG00000119685		0.368	TTLL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTLL5	HGNC	protein_coding	OTTHUMT00000414453.1	-	0.00	40	0	C	NM_015072		76173979	+1	tier1	-	no_errors	ENST00000298832	ensembl	human	known	74_37	silent	58.82	7	10	SNP	0.907	T
TTN	7273	genome.wustl.edu	37	2	179458716	179458716	+	Silent	SNP	C	C	T			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr2:179458716C>T	ENST00000591111.1	-	247	53705	c.53481G>A	c.(53479-53481)agG>agA	p.R17827R	TTN-AS1_ENST00000589234.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000589907.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000589042.1_Silent_p.R19468R|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000359218.5_Silent_p.R10528R|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN_ENST00000460472.2_Silent_p.R10403R|TTN-AS1_ENST00000590743.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN_ENST00000342175.6_Silent_p.R10595R|TTN_ENST00000342992.6_Silent_p.R16900R			Q8WZ42	TITIN_HUMAN	titin	17827	Ig-like 104.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AGAAACCTTTCCTAGAGCCTG	0.388																																																	0													176.0	172.0	173.0					2																	179458716		1963	4150	6113	SO:0001819	synonymous_variant	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.53481G>A	2.37:g.179458716C>T			A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.R16900	ENST00000591111.1	37	c.50700		2																																																																																			TTN	-	pfam_Ig_I-set,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,pfscan_Ig-like_dom	ENSG00000155657		0.388	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	-	0.00	53	0	C	NM_133378		179458716	-1	tier1	-	no_errors	ENST00000342992	ensembl	human	known	74_37	silent	36.84	36	21	SNP	1.000	T
TTN	7273	genome.wustl.edu	37	2	179545834	179545834	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr2:179545834T>G	ENST00000591111.1	-	136	32585	c.32361A>C	c.(32359-32361)aaA>aaC	p.K10787N	TTN-AS1_ENST00000589487.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.K11104N|TTN_ENST00000359218.5_Intron|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000431752.1_RNA|TTN-AS1_ENST00000589830.1_RNA|TTN_ENST00000460472.2_Intron|TTN_ENST00000342175.6_Intron|TTN_ENST00000342992.6_Missense_Mutation_p.K9860N			Q8WZ42	TITIN_HUMAN	titin	0	Glu-rich.|Pro-rich.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TCACCTGCTCTTTTTCACGTT	0.323																																																	0													90.0	88.0	89.0					2																	179545834		1811	4072	5883	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.32361A>C	2.37:g.179545834T>G	ENSP00000465570:p.Lys10787Asn		A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.K9860N	ENST00000591111.1	37	c.29580		2	.	.	.	.	.	.	.	.	.	.	T	14.32	2.499658	0.44455	.	.	ENSG00000155657	ENST00000342992	T	0.75050	-0.9	5.92	4.78	0.61160	Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);	.	.	.	.	T	0.73976	0.3656	L	0.29908	0.895	0.80722	D	1	D	0.58268	0.982	P	0.59825	0.864	T	0.75328	-0.3356	9	0.87932	D	0	.	8.5154	0.33242	0.0:0.149:0.0:0.851	.	10787	Q8WZ42	TITIN_HUMAN	N	9860	ENSP00000343764:K9860N	ENSP00000343764:K9860N	K	-	3	2	TTN	179254079	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	0.896000	0.28377	1.091000	0.41335	0.528000	0.53228	AAA	TTN	-	pfam_PPAK_motif,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom	ENSG00000155657		0.323	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	-	0.00	73	0	T	NM_133378		179545834	-1	tier1	-	no_errors	ENST00000342992	ensembl	human	known	74_37	missense	24.62	49	16	SNP	1.000	G
TUBA3C	7278	genome.wustl.edu	37	13	19751406	19751406	+	Silent	SNP	C	C	T	rs397839852		TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr13:19751406C>T	ENST00000400113.3	-	4	821	c.717G>A	c.(715-717)acG>acA	p.T239T		NM_006001.2	NP_005992.1	Q13748	TBA3C_HUMAN	tubulin, alpha 3c	239					'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|microtubule-based process (GO:0007017)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|biliary_tract(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(33)|ovary(4)|prostate(7)|skin(7)|urinary_tract(1)	72		all_cancers(29;1.31e-20)|all_epithelial(30;1.59e-20)|all_lung(29;6.91e-20)|Lung NSC(5;9.25e-17)|Hepatocellular(1;0.0207)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;6.78e-06)|Epithelial(112;3.79e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00172)|Lung(94;0.0186)|LUSC - Lung squamous cell carcinoma(192;0.108)		GCAGGGAGGCCGTGATGGAGG	0.582													C|||	1	0.000199681	0.0	0.0	5008	,	,		19674	0.0		0.0	False		,,,				2504	0.001																0													164.0	141.0	148.0					13																	19751406		2203	4300	6503	SO:0001819	synonymous_variant	0			AF005392	CCDS9284.1	13q12.11	2007-06-20	2007-02-12	2007-02-12	ENSG00000198033	ENSG00000198033		"""Tubulins"""	12408	protein-coding gene	gene with protein product		602528	"""tubulin, alpha 2"""	TUBA2		9465305	Standard	NM_006001		Approved	bA408E5.3	uc009zzj.3	Q13748	OTTHUMG00000016481	ENST00000400113.3:c.717G>A	13.37:g.19751406C>T			A6NJQ0|Q5W099|Q6PEY3|Q96F18	Silent	SNP	pfam_Tubulin_FtsZ_GTPase,pfam_Tubulin/FtsZ_2-layer-sand-dom,superfamily_Tubulin_FtsZ_GTPase,superfamily_Tub_FtsZ_C,smart_Tubulin_FtsZ_GTPase,smart_Tubulin/FtsZ_2-layer-sand-dom,prints_Alpha_tubulin,prints_Tubulin,prints_Epsilon_tubulin,prints_Delta_tubulin,prints_Beta_tubulin	p.T239	ENST00000400113.3	37	c.717	CCDS9284.1	13																																																																																			TUBA3C	-	superfamily_Tubulin_FtsZ_GTPase,smart_Tubulin_FtsZ_GTPase	ENSG00000198033		0.582	TUBA3C-002	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	TUBA3C	HGNC	protein_coding	OTTHUMT00000044007.2	-	0.00	148	0	C	NM_006001		19751406	-1	tier1	-	no_errors	ENST00000400113	ensembl	human	known	74_37	silent	29.30	111	46	SNP	0.989	T
TWIST2	117581	genome.wustl.edu	37	2	239757202	239757202	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr2:239757202T>G	ENST00000448943.2	+	1	530	c.346T>G	c.(346-348)Ttc>Gtc	p.F116V		NM_057179.2	NP_476527.1	Q8WVJ9	TWST2_HUMAN	twist family bHLH transcription factor 2	116	bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)										GTACATAGACTTCCTCTACCA	0.612																																																	0													110.0	94.0	99.0					2																	239757202		692	1591	2283	SO:0001583	missense	0			BC017907	CCDS46558.1	2q37.3	2013-10-17	2013-10-17		ENSG00000233608	ENSG00000233608		"""Basic helix-loop-helix proteins"""	20670	protein-coding gene	gene with protein product		607556	"""twist homolog 2 (Drosophila)"", ""twist basic helix-loop-helix transcription factor 2"""			7589808, 9061034	Standard	NM_057179		Approved	DERMO1, Dermo-1, bHLHa39	uc021vyw.2	Q8WVJ9	OTTHUMG00000152836	ENST00000448943.2:c.346T>G	2.37:g.239757202T>G	ENSP00000405176:p.Phe116Val		Q3SYL6	Missense_Mutation	SNP	pfam_bHLH_dom,superfamily_bHLH_dom,smart_bHLH_dom,pfscan_bHLH_dom	p.F116V	ENST00000448943.2	37	c.346	CCDS46558.1	2	.	.	.	.	.	.	.	.	.	.	T	14.58	2.578120	0.45902	.	.	ENSG00000233608	ENST00000448943	D	0.97888	-4.59	4.99	3.84	0.44239	Helix-loop-helix DNA-binding (5);	.	.	.	.	D	0.97932	0.9320	L	0.58302	1.8	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.97739	1.0207	9	0.87932	D	0	.	10.5143	0.44881	0.0:0.0765:0.0:0.9235	.	116	Q8WVJ9	TWST2_HUMAN	V	116	ENSP00000405176:F116V	ENSP00000405176:F116V	F	+	1	0	TWIST2	.	1.000000	0.71417	1.000000	0.80357	0.075000	0.17131	7.656000	0.83736	0.745000	0.32763	-0.385000	0.06624	TTC	TWIST2	-	pfam_bHLH_dom,superfamily_bHLH_dom,smart_bHLH_dom,pfscan_bHLH_dom	ENSG00000233608		0.612	TWIST2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TWIST2	HGNC	protein_coding	OTTHUMT00000393081.1		0.00	28	0	T			239757202	+1			no_errors	ENST00000448943	ensembl	human	known	74_37	missense	17.39	19	4	SNP	1.000	G
UBQLNL	143630	genome.wustl.edu	37	11	5537601	5537601	+	Missense_Mutation	SNP	T	T	A			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr11:5537601T>A	ENST00000380184.1	-	1	334	c.71A>T	c.(70-72)aAa>aTa	p.K24I	HBG2_ENST00000380259.2_Intron	NM_145053.4	NP_659490.4	Q8IYU4	UBQLN_HUMAN	ubiquilin-like	24										endometrium(1)|kidney(3)|large_intestine(9)|lung(13)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	33		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;1.92e-09)|BRCA - Breast invasive adenocarcinoma(625;0.136)		AGAGATATTTTTGTCTGCCAG	0.507																																																	0													98.0	95.0	96.0					11																	5537601		2201	4297	6498	SO:0001583	missense	0			AK127987	CCDS31385.1	11p15.4	2014-02-12			ENSG00000175518	ENSG00000175518		"""Ubiquilin family"""	28294	protein-coding gene	gene with protein product							Standard	NM_145053		Approved	MGC20470, MGC26958	uc001maz.4	Q8IYU4	OTTHUMG00000066903	ENST00000380184.1:c.71A>T	11.37:g.5537601T>A	ENSP00000369531:p.Lys24Ile		Q6ZRU1|Q96EK3|Q96MB0	Missense_Mutation	SNP	pfam_Ubiquitin_dom,smart_Ubiquitin_dom,pfscan_Ubiquitin_supergroup	p.K24I	ENST00000380184.1	37	c.71	CCDS31385.1	11	.	.	.	.	.	.	.	.	.	.	T	14.03	2.414414	0.42817	.	.	ENSG00000175518	ENST00000380184;ENST00000538889	T	0.42900	0.96	4.94	0.88	0.19161	.	1.035410	0.07661	N	0.933607	T	0.41534	0.1163	L	0.53249	1.67	0.09310	N	1	P	0.44578	0.838	P	0.44990	0.466	T	0.28235	-1.0050	10	0.42905	T	0.14	.	6.6943	0.23191	0.0:0.3336:0.0:0.6664	.	24	Q8IYU4	UBQLN_HUMAN	I	24	ENSP00000369531:K24I	ENSP00000369531:K24I	K	-	2	0	UBQLNL	5494177	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	0.425000	0.21346	-0.025000	0.13918	-0.263000	0.10527	AAA	UBQLNL	-	NULL	ENSG00000175518		0.507	UBQLNL-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	UBQLNL	HGNC	protein_coding	OTTHUMT00000143386.1	-	0.00	47	0	T	NM_145053		5537601	-1	tier1	-	no_errors	ENST00000380184	ensembl	human	putative	74_37	missense	28.21	28	11	SNP	0.000	A
UCA1	652995	genome.wustl.edu	37	19	15940098	15940098	+	RNA	SNP	A	A	C			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr19:15940098A>C	ENST00000397381.4	+	0	328				AC004510.3_ENST00000589310.1_lincRNA	NR_015379.3				urothelial cancer associated 1 (non-protein coding)																		tccacctgcgacctcgggtcc	0.562																																																	0																																												0			BC005351		19p13.12	2013-07-02			ENSG00000214049	ENSG00000214049		"""Long non-coding RNAs"", ""-"""	37126	non-coding RNA	RNA, long non-coding	"""long intergenic non-protein coding RNA 178"", ""cancer up-regulated drug resistant"""					18501714, 17416635, 23801869	Standard	NR_015379		Approved	LINC00178, CUDR, UCAT1	uc002nbr.4		OTTHUMG00000182287		19.37:g.15940098A>C				RNA	SNP	-	NULL	ENST00000397381.4	37	NULL		19																																																																																			UCA1	-	-	ENSG00000214049		0.562	UCA1-001	KNOWN	basic	lincRNA	UCA1	HGNC	processed_transcript	OTTHUMT00000362098.19	-	0.00	53	0	A	NR_015379		15940098	+1	tier1	-	no_errors	ENST00000397381	ensembl	human	known	74_37	rna	51.85	26	28	SNP	0.022	C
USH2A	7399	genome.wustl.edu	37	1	216462679	216462679	+	Nonsense_Mutation	SNP	G	G	T			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr1:216462679G>T	ENST00000307340.3	-	11	2300	c.1914C>A	c.(1912-1914)tgC>tgA	p.C638*	USH2A_ENST00000366943.2_Nonsense_Mutation_p.C638*|USH2A_ENST00000366942.3_Nonsense_Mutation_p.C638*	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	638	Laminin EGF-like 2. {ECO:0000255|PROSITE- ProRule:PRU00460}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		CACAGGGTTTGCAAACATCTA	0.423										HNSCC(13;0.011)																																							0													173.0	151.0	158.0					1																	216462679		2203	4300	6503	SO:0001587	stop_gained	0			AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.1914C>A	1.37:g.216462679G>T	ENSP00000305941:p.Cys638*		Q5VVM9|Q6S362|Q9NS27	Nonsense_Mutation	SNP	pfam_Fibronectin_type3,pfam_EGF_laminin,pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_LamG-like,smart_Laminin_N,smart_EGF_laminin,smart_Fibronectin_type3,smart_Laminin_G,pfscan_EGF_laminin,pfscan_Fibronectin_type3,pfscan_Laminin_G,pfscan_Laminin_N	p.C638*	ENST00000307340.3	37	c.1914	CCDS31025.1	1	.	.	.	.	.	.	.	.	.	.	G	42	9.698261	0.99241	.	.	ENSG00000042781	ENST00000307340;ENST00000366943;ENST00000366942	.	.	.	5.43	4.52	0.55395	.	0.000000	0.47852	D	0.000211	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	14.3494	0.66691	0.0714:0.0:0.9286:0.0	.	.	.	.	X	638	.	ENSP00000305941:C638X	C	-	3	2	USH2A	214529302	1.000000	0.71417	0.937000	0.37676	0.821000	0.46438	1.891000	0.39738	1.437000	0.47472	0.557000	0.71058	TGC	USH2A	-	smart_EGF_laminin	ENSG00000042781		0.423	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	USH2A	HGNC	protein_coding	OTTHUMT00000128138.1	-	0.00	65	0	G	NM_007123		216462679	-1	tier1	-	no_errors	ENST00000366943	ensembl	human	known	74_37	nonsense	5.48	69	4	SNP	1.000	T
USP17L2	377630	genome.wustl.edu	37	8	11994772	11994772	+	Missense_Mutation	SNP	C	C	T	rs199889083	byFrequency	TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr8:11994772C>T	ENST00000333796.3	-	1	1814	c.1498G>A	c.(1498-1500)Gtg>Atg	p.V500M	FAM66D_ENST00000434078.2_RNA	NM_001256869.1|NM_001256871.1|NM_001256872.1|NM_001256873.1|NM_001256874.1|NM_201402.2	NP_001243798.1|NP_001243800.1|NP_001243801.1|NP_001243802.1|NP_001243803.1|NP_958804.2	Q6R6M4	U17L2_HUMAN	ubiquitin specific peptidase 17-like family member 2	500	Mediates interaction with SUDS3.			V -> M (in Ref. 1; AAR91701). {ECO:0000305}.	apoptotic process (GO:0006915)|CAAX-box protein processing (GO:0071586)|cell cycle checkpoint (GO:0000075)|mitotic cell cycle checkpoint (GO:0007093)|negative regulation of histone deacetylation (GO:0031064)|negative regulation of protein processing (GO:0010955)|negative regulation of protein targeting to membrane (GO:0090315)|negative regulation of Ras GTPase activity (GO:0034261)|positive regulation of MDA-5 signaling pathway (GO:1900245)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of RIG-I signaling pathway (GO:1900246)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)|regulation of apoptotic process (GO:0042981)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|regulation of defense response to virus by host (GO:0050691)|regulation of ruffle assembly (GO:1900027)|ubiquitin-dependent protein catabolic process (GO:0006511)	endoplasmic reticulum membrane (GO:0005789)|nucleus (GO:0005634)	ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			central_nervous_system(1)|kidney(1)|large_intestine(11)|liver(1)|lung(8)|ovary(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	29						CCAGTGTTCACGGACTCCTGA	0.512													T|||	7	0.00139776	0.0038	0.0	5008	,	,		20725	0.001		0.001	False		,,,				2504	0.0																0								T	MET/VAL	18,2818		4,10,1404	69.0	77.0	75.0		1498	-0.8	0.0	8	dbSNP_134	75	7,5999		0,7,2996	no	missense	USP17L2	NM_201402.2	21	4,17,4400	TT,TC,CC		0.1166,0.6347,0.2827	benign	500/531	11994772	25,8817	1418	3003	4421	SO:0001583	missense	0			BC156290	CCDS43713.1	8p23.1	2012-10-09	2012-10-09		ENSG00000223443	ENSG00000223443			34434	protein-coding gene	gene with protein product	"""deubiquitinating enzyme 3"""	610186	"""ubiquitin specific peptidase 17-like 2"""				Standard	NM_201402		Approved	DUB3	uc003wvc.1	Q6R6M4	OTTHUMG00000165295	ENST00000333796.3:c.1498G>A	8.37:g.11994772C>T	ENSP00000333329:p.Val500Met			Missense_Mutation	SNP	pfam_Peptidase_C19/C67,pfam_HABP4_PAIRBP1-bd,pfscan_Peptidase_C19/C67	p.V500M	ENST00000333796.3	37	c.1498	CCDS43713.1	8	.	.	.	.	.	.	.	.	.	.	T	0.001	-3.113402	0.00032	0.006347	0.001166	ENSG00000223443	ENST00000333796	T	0.12774	2.65	0.418	-0.836	0.10770	.	4.360810	0.00725	N	0.000903	T	0.05593	0.0147	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.23547	-1.0185	8	0.29301	T	0.29	.	.	.	.	.	500	Q6R6M4	U17L2_HUMAN	M	500	ENSP00000333329:V500M	ENSP00000333329:V500M	V	-	1	0	USP17L2	12032181	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.278000	0.02809	-1.803000	0.01242	-1.931000	0.00510	GTG	USP17L2	-	NULL	ENSG00000223443		0.512	USP17L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP17L2	HGNC	protein_coding	OTTHUMT00000383303.2	-	0.00	122	0	C	NM_201402		11994772	-1	tier1	rs199889083	no_errors	ENST00000333796	ensembl	human	known	74_37	missense	65.62	33	63	SNP	0.000	T
USP31	57478	genome.wustl.edu	37	16	23080011	23080011	+	Missense_Mutation	SNP	T	T	A			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr16:23080011T>A	ENST00000219689.7	-	16	3414	c.3415A>T	c.(3415-3417)Agg>Tgg	p.R1139W	USP31_ENST00000567975.1_Missense_Mutation_p.R432W	NM_020718.3	NP_065769.3	Q86UV5	UBP48_HUMAN	ubiquitin specific peptidase 31	0					ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ubiquitin-specific protease activity (GO:0004843)			breast(4)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(17)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(2)	57				GBM - Glioblastoma multiforme(48;0.0187)		AAAGGGCTCCTTGTGGCAGGG	0.592																																																	0													63.0	68.0	66.0					16																	23080011		2197	4300	6497	SO:0001583	missense	0			AB033029	CCDS10607.1	16p12.3	2008-02-05	2005-08-08		ENSG00000103404	ENSG00000103404		"""Ubiquitin-specific peptidases"""	20060	protein-coding gene	gene with protein product			"""ubiquitin specific protease 31"""			12838346	Standard	NM_020718		Approved	KIAA1203	uc002dll.3	Q70CQ4	OTTHUMG00000094793	ENST00000219689.7:c.3415A>T	16.37:g.23080011T>A	ENSP00000219689:p.Arg1139Trp		B7ZKS7|Q2M3I4|Q5SZI4|Q5T3T5|Q6NX53|Q8N3F6|Q96F64|Q96IQ3|Q9H5N3|Q9H5T7|Q9NUJ6|Q9NXR0	Missense_Mutation	SNP	pfam_Peptidase_C19/C67,pfscan_Peptidase_C19/C67	p.R1139W	ENST00000219689.7	37	c.3415	CCDS10607.1	16	.	.	.	.	.	.	.	.	.	.	T	17.74	3.463797	0.63513	.	.	ENSG00000103404	ENST00000219689	T	0.10960	2.82	5.8	3.44	0.39384	.	2.079960	0.02497	N	0.090052	T	0.26666	0.0652	L	0.29908	0.895	0.40212	D	0.977632	D;D	0.89917	0.997;1.0	P;D	0.79784	0.907;0.993	T	0.00228	-1.1899	10	0.87932	D	0	-23.2872	11.9353	0.52870	0.0:0.0:0.2759:0.7241	.	1139;432	Q70CQ4;B3KS48	UBP31_HUMAN;.	W	1139	ENSP00000219689:R1139W	ENSP00000219689:R1139W	R	-	1	2	USP31	22987512	0.457000	0.25752	0.488000	0.27440	0.769000	0.43574	0.567000	0.23608	0.401000	0.25424	0.533000	0.62120	AGG	USP31	-	NULL	ENSG00000103404		0.592	USP31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP31	HGNC	protein_coding	OTTHUMT00000211607.1		0.00	57	0	T	NM_020718		23080011	-1			no_errors	ENST00000219689	ensembl	human	known	74_37	missense	6.82	41	3	SNP	0.970	A
USP5	8078	genome.wustl.edu	37	12	6968681	6968681	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr12:6968681C>T	ENST00000229268.8	+	9	1158	c.1106C>T	c.(1105-1107)cCt>cTt	p.P369L	USP5_ENST00000389231.5_Missense_Mutation_p.P369L	NM_001098536.1	NP_001092006.1	P45974	UBP5_HUMAN	ubiquitin specific peptidase 5 (isopeptidase T)	369	USP.				positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|protein K48-linked deubiquitination (GO:0071108)|ubiquitin-dependent protein catabolic process (GO:0006511)	lysosome (GO:0005764)	cysteine-type endopeptidase activity (GO:0004197)|omega peptidase activity (GO:0008242)|ubiquitin thiolesterase activity (GO:0004221)|zinc ion binding (GO:0008270)			breast(6)|endometrium(4)|kidney(2)|large_intestine(6)|lung(14)|skin(2)|urinary_tract(2)	36						CCGACGGACCCTACCCAGGAT	0.552																																																	0													93.0	85.0	88.0					12																	6968681		2203	4300	6503	SO:0001583	missense	0			U35116	CCDS31733.1, CCDS41743.1	12p13	2007-03-02	2005-08-08		ENSG00000111667	ENSG00000111667		"""Ubiquitin-specific peptidases"""	12628	protein-coding gene	gene with protein product		601447	"""ubiquitin specific protease 5 (isopeptidase T)"""			12838346, 8723724	Standard	NM_003481		Approved	IsoT	uc001qri.4	P45974	OTTHUMG00000169233	ENST00000229268.8:c.1106C>T	12.37:g.6968681C>T	ENSP00000229268:p.Pro369Leu		D3DUS7|D3DUS8|Q96J22	Missense_Mutation	SNP	pfam_Peptidase_C19/C67,pfam_UBA/Ts_N,pfam_Znf_UBP,superfamily_UBA-like,smart_Znf_UBP,smart_UBA/transl_elong_EF1B_N_euk,pirsf_Ubiquitinyl_hydrolase,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Znf_UBP,pfscan_Peptidase_C19/C67	p.P369L	ENST00000229268.8	37	c.1106	CCDS41743.1	12	.	.	.	.	.	.	.	.	.	.	C	34	5.298536	0.95574	.	.	ENSG00000111667	ENST00000229268;ENST00000389231	T;T	0.29397	1.57;1.57	5.38	5.38	0.77491	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.000000	0.85682	D	0.000000	T	0.64505	0.2604	M	0.89095	3.005	0.80722	D	1	D;D	0.89917	1.0;0.998	D;D	0.97110	1.0;0.99	T	0.70342	-0.4898	10	0.72032	D	0.01	-3.8274	19.3333	0.94303	0.0:1.0:0.0:0.0	.	369;369	P45974;P45974-2	UBP5_HUMAN;.	L	369	ENSP00000229268:P369L;ENSP00000373883:P369L	ENSP00000229268:P369L	P	+	2	0	USP5	6838942	1.000000	0.71417	0.991000	0.47740	0.989000	0.77384	7.609000	0.82925	2.793000	0.96121	0.655000	0.94253	CCT	USP5	-	pfam_Peptidase_C19/C67,pirsf_Ubiquitinyl_hydrolase,pfscan_Peptidase_C19/C67	ENSG00000111667		0.552	USP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP5	HGNC	protein_coding	OTTHUMT00000402982.1	-	0.00	61	0	C			6968681	+1	tier1	-	no_errors	ENST00000229268	ensembl	human	known	74_37	missense	7.84	47	4	SNP	1.000	T
USP53	54532	genome.wustl.edu	37	4	120192515	120192515	+	Silent	SNP	A	A	G			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr4:120192515A>G	ENST00000274030.6	+	16	2679	c.1500A>G	c.(1498-1500)aaA>aaG	p.K500K	USP53_ENST00000450251.1_Silent_p.K500K	NM_019050.2	NP_061923.2			ubiquitin specific peptidase 53											breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|lung(5)|ovary(1)|pancreas(1)|skin(2)|stomach(1)	27						ATGGTTTTAAACAACATGGGA	0.348																																																	0													68.0	65.0	66.0					4																	120192515		1845	4098	5943	SO:0001819	synonymous_variant	0			BC017382	CCDS43265.1	4q26	2010-05-12	2005-08-08		ENSG00000145390	ENSG00000145390		"""Ubiquitin-specific peptidases"""	29255	protein-coding gene	gene with protein product			"""ubiquitin specific protease 53"""			10718198, 14715245	Standard	NM_019050		Approved	KIAA1350	uc003ics.4	Q70EK8	OTTHUMG00000161331	ENST00000274030.6:c.1500A>G	4.37:g.120192515A>G				Silent	SNP	pfam_Peptidase_C19/C67,pfscan_Peptidase_C19/C67	p.K500	ENST00000274030.6	37	c.1500	CCDS43265.1	4																																																																																			USP53	-	NULL	ENSG00000145390		0.348	USP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP53	HGNC	protein_coding	OTTHUMT00000364564.2	-	0.00	35	0	A	XM_052597		120192515	+1	tier1	-	no_errors	ENST00000274030	ensembl	human	known	74_37	silent	21.62	29	8	SNP	0.009	G
USP9Y	8287	genome.wustl.edu	37	Y	14951885	14951885	+	Silent	SNP	A	A	C			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chrY:14951885A>C	ENST00000338981.3	+	36	6378	c.5433A>C	c.(5431-5433)gcA>gcC	p.A1811A	USP9Y_ENST00000426564.2_3'UTR	NM_004654.3	NP_004645.2	O00507	USP9Y_HUMAN	ubiquitin specific peptidase 9, Y-linked	1811	USP.				BMP signaling pathway (GO:0030509)|protein deubiquitination (GO:0016579)|spermatogenesis (GO:0007283)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)	co-SMAD binding (GO:0070410)|cysteine-type peptidase activity (GO:0008234)|ubiquitin-specific protease activity (GO:0004843)			kidney(1)|large_intestine(8)|lung(5)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	17						GAGAATGTGCAATTAAATTCA	0.393																																																	0													55.0	51.0	52.0					Y																	14951885		599	1934	2533	SO:0001819	synonymous_variant	0			Y13618	CCDS14781.1	Yq11.2	2010-04-09	2009-03-17		ENSG00000114374	ENSG00000114374		"""Ubiquitin-specific peptidases"""	12633	protein-coding gene	gene with protein product	"""fat facets-like homolog (Drosophila)"""	400005	"""ubiquitin specific peptidase 9, Y-linked (fat facets-like, Drosophila)"""			8922996, 9384609, 19246359	Standard	NM_004654		Approved	DFFRY	uc004fst.1	O00507	OTTHUMG00000036469	ENST00000338981.3:c.5433A>C	Y.37:g.14951885A>C			O14601	Silent	SNP	pfam_Peptidase_C19/C67,superfamily_ARM-type_fold,superfamily_Glycoside_hydrolase_SF,pfscan_Peptidase_C19/C67	p.A1811	ENST00000338981.3	37	c.5433	CCDS14781.1	Y																																																																																			USP9Y	-	pfam_Peptidase_C19/C67,pfscan_Peptidase_C19/C67	ENSG00000114374		0.393	USP9Y-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP9Y	HGNC	protein_coding	OTTHUMT00000088703.2	-	0.00	75	0	A	NM_004654		14951885	+1	tier1	-	no_errors	ENST00000338981	ensembl	human	known	74_37	silent	8.16	45	4	SNP	1.000	C
UTP20	27340	genome.wustl.edu	37	12	101777368	101777368	+	Silent	SNP	G	G	C			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr12:101777368G>C	ENST00000261637.4	+	60	8151	c.7977G>C	c.(7975-7977)ggG>ggC	p.G2659G		NM_014503.2	NP_055318.2	O75691	UTP20_HUMAN	UTP20, small subunit (SSU) processome component, homolog (yeast)	2659					endonucleolytic cleavage in 5'-ETS of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000480)|endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000447)|endonucleolytic cleavage to generate mature 5'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000472)|negative regulation of cell proliferation (GO:0008285)|rRNA processing (GO:0006364)	90S preribosome (GO:0030686)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|preribosome, small subunit precursor (GO:0030688)|small-subunit processome (GO:0032040)	poly(A) RNA binding (GO:0044822)			NS(3)|biliary_tract(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(26)|lung(30)|ovary(2)|prostate(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	88						TGGATCTTGGGATAGACAAGG	0.433																																																	0													146.0	126.0	133.0					12																	101777368		2203	4300	6503	SO:0001819	synonymous_variant	0			AJ006778	CCDS9081.1	12q23	2006-02-11				ENSG00000120800			17897	protein-coding gene	gene with protein product	"""down regulated in metastasis"""	612822				9673349, 15590835, 12837249	Standard	NM_014503		Approved	DRIM	uc001tia.1	O75691	OTTHUMG00000170270	ENST00000261637.4:c.7977G>C	12.37:g.101777368G>C			Q9H3H4	Silent	SNP	pfam_DRIM,superfamily_ARM-type_fold	p.G2659	ENST00000261637.4	37	c.7977	CCDS9081.1	12																																																																																			UTP20	-	NULL	ENSG00000120800		0.433	UTP20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UTP20	HGNC	protein_coding	OTTHUMT00000408242.1	-	0.00	54	0	G	NM_014503		101777368	+1	tier1	-	no_errors	ENST00000261637	ensembl	human	known	74_37	silent	61.90	16	26	SNP	0.000	C
UTY	7404	genome.wustl.edu	37	Y	15582100	15582100	+	Missense_Mutation	SNP	A	A	T			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chrY:15582100A>T	ENST00000331397.4	-	3	1233	c.226T>A	c.(226-228)Tgc>Agc	p.C76S	UTY_ENST00000537580.1_Missense_Mutation_p.C76S|UTY_ENST00000382896.4_Missense_Mutation_p.C76S|UTY_ENST00000329134.5_Missense_Mutation_p.C76S|UTY_ENST00000545955.1_Missense_Mutation_p.C76S|UTY_ENST00000382893.1_Missense_Mutation_p.C76S|UTY_ENST00000362096.4_Missense_Mutation_p.C76S|UTY_ENST00000474365.1_5'UTR|UTY_ENST00000538878.1_Missense_Mutation_p.C76S|UTY_ENST00000540140.1_Missense_Mutation_p.C76S	NM_001258267.1|NM_007125.4	NP_001245196.1|NP_009056.3	O14607	UTY_HUMAN	ubiquitously transcribed tetratricopeptide repeat containing, Y-linked	76					regulation of gene expression (GO:0010468)	nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|histone demethylase activity (H3-K27 specific) (GO:0071558)|metal ion binding (GO:0046872)			kidney(1)|lung(6)	7						GATTCGTAGCAGCGAACAGCC	0.353																																					Colon(103;1740 2135 40732 45171)												0													45.0	47.0	47.0					Y																	15582100		585	1916	2501	SO:0001583	missense	0			AF000994	CCDS14783.1, CCDS14784.1, CCDS14785.1, CCDS59184.1, CCDS76073.1, CCDS76074.1, CCDS76075.1, CCDS76076.1, CCDS76077.1, CCDS76078.1, CCDS76079.1	Yq11.221	2013-11-04	2012-11-15		ENSG00000183878	ENSG00000183878		"""Tetratricopeptide (TTC) repeat domain containing"""	12638	protein-coding gene	gene with protein product		400009	"""ubiquitously transcribed tetratricopeptide repeat gene, Y chromosome"", ""ubiquitously transcribed tetratricopeptide repeat gene, Y-linked"""			8944031, 9499428	Standard	NM_182659		Approved	KDM6AL	uc022ckf.2	O14607	OTTHUMG00000036319	ENST00000331397.4:c.226T>A	Y.37:g.15582100A>T	ENSP00000328939:p.Cys76Ser		A8K9Z3|E1U199|E1U1A0|F5H4V7|F8W8R7|O14608	Missense_Mutation	SNP	pfam_JmjC_dom,pfam_TPR_1,smart_TPR_repeat,smart_JmjC_dom,pfscan_JmjC_dom,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.C76S	ENST00000331397.4	37	c.226	CCDS14783.1	Y																																																																																			UTY	-	NULL	ENSG00000183878		0.353	UTY-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	UTY	HGNC	protein_coding	OTTHUMT00000088394.1	-	0.00	36	0	A	NM_182660		15582100	-1	tier1	-	no_errors	ENST00000382896	ensembl	human	known	74_37	missense	94.74	1	18	SNP	1.000	T
VASN	114990	genome.wustl.edu	37	16	4432883	4432883	+	Missense_Mutation	SNP	G	G	A	rs370311116		TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr16:4432883G>A	ENST00000304735.3	+	2	2160	c.2005G>A	c.(2005-2007)Gca>Aca	p.A669T	CORO7_ENST00000537233.2_Intron|CORO7_ENST00000423908.2_Intron|CORO7_ENST00000539968.1_Intron|CORO7_ENST00000574025.1_Intron|CORO7-PAM16_ENST00000572467.1_Intron|CORO7_ENST00000251166.4_Intron	NM_138440.2	NP_612449.2	Q6EMK4	VASN_HUMAN	vasorin	669					cellular response to hypoxia (GO:0071456)|cellular response to redox state (GO:0071461)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)	cell surface (GO:0009986)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	transforming growth factor beta binding (GO:0050431)			breast(1)|lung(3)|prostate(1)|skin(1)	6						ACCCCTCCACGCAAAGCCCTA	0.652																																																	0								G	,,,,THR/ALA	1,4363		0,1,2181	13.0	15.0	14.0		,,,,2005	-9.8	0.0	16		14	0,8584		0,0,4292	no	intron,intron,intron,intron,missense	CORO7,VASN,CORO7-PAM16	NM_001201472.1,NM_001201473.1,NM_001201479.1,NM_024535.4,NM_138440.2	,,,,58	0,1,6473	AA,AG,GG		0.0,0.0229,0.0077	,,,,benign	,,,,669/674	4432883	1,12947	2182	4292	6474	SO:0001583	missense	0			AY358299	CCDS10514.1	16p13.3	2008-02-05	2006-03-30	2006-03-30	ENSG00000168140	ENSG00000168140			18517	protein-coding gene	gene with protein product		608843	"""slit-like 2 (Drosophila)"""	SLITL2		15247411	Standard	NM_138440		Approved		uc002cwj.1	Q6EMK4	OTTHUMG00000129469	ENST00000304735.3:c.2005G>A	16.37:g.4432883G>A	ENSP00000306864:p.Ala669Thr		Q6UXL4|Q6UXL5|Q96CX1	Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_LRR-contain_N,superfamily_Fibronectin_type3,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_Fibronectin_type3	p.A669T	ENST00000304735.3	37	c.2005	CCDS10514.1	16	.	.	.	.	.	.	.	.	.	.	G	2.869	-0.234440	0.05983	2.29E-4	0.0	ENSG00000168140	ENST00000304735	T	0.55588	0.51	4.92	-9.84	0.00479	.	1.371070	0.04738	N	0.422379	T	0.26159	0.0638	N	0.24115	0.695	0.09310	N	1	B	0.09022	0.002	B	0.04013	0.001	T	0.10086	-1.0645	10	0.18276	T	0.48	0.1682	1.3827	0.02233	0.2782:0.0855:0.2614:0.3749	.	669	Q6EMK4	VASN_HUMAN	T	669	ENSP00000306864:A669T	ENSP00000306864:A669T	A	+	1	0	VASN	4372884	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-1.822000	0.01711	-1.827000	0.01204	-0.314000	0.08810	GCA	VASN	-	NULL	ENSG00000168140		0.652	VASN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VASN	HGNC	protein_coding	OTTHUMT00000251632.1	-	0.00	76	0	G	NM_138440		4432883	+1	tier1	-	no_errors	ENST00000304735	ensembl	human	known	74_37	missense	6.90	54	4	SNP	0.000	A
VPS18	57617	genome.wustl.edu	37	15	41195198	41195198	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr15:41195198C>A	ENST00000220509.5	+	5	2920	c.2581C>A	c.(2581-2583)Ctc>Atc	p.L861I		NM_020857.2	NP_065908.1	Q9P253	VPS18_HUMAN	vacuolar protein sorting 18 homolog (S. cerevisiae)	861					endosome organization (GO:0007032)|intracellular protein transport (GO:0006886)|lysosome organization (GO:0007040)|vesicle-mediated transport (GO:0016192)|viral entry into host cell (GO:0046718)	actin filament (GO:0005884)|early endosome (GO:0005769)|HOPS complex (GO:0030897)|lysosomal membrane (GO:0005765)	metal ion binding (GO:0046872)			autonomic_ganglia(1)|endometrium(5)|kidney(4)|large_intestine(4)|lung(6)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	28		all_cancers(109;1.35e-17)|all_epithelial(112;3.78e-15)|Lung NSC(122;9.68e-11)|all_lung(180;2.25e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;1.07e-05)|COAD - Colon adenocarcinoma(120;0.15)|BRCA - Breast invasive adenocarcinoma(123;0.164)		CTTCCCCCTGCTCAACCGCCC	0.647																																																	0													127.0	117.0	120.0					15																	41195198		2203	4300	6503	SO:0001583	missense	0			AF308802	CCDS10069.1	15q14-q15	2006-12-19	2006-12-19		ENSG00000104142	ENSG00000104142			15972	protein-coding gene	gene with protein product		608551	"""vacuolar protein sorting protein 18"""			11250079, 16203730	Standard	NM_020857		Approved	KIAA1475, PEP3	uc001zne.3	Q9P253	OTTHUMG00000130135	ENST00000220509.5:c.2581C>A	15.37:g.41195198C>A	ENSP00000220509:p.Leu861Ile		Q8TCG0|Q96DI3|Q9H268	Missense_Mutation	SNP	pfam_Pep3_Vps18,pfam_Clathrin_H-chain/VPS_repeat,superfamily_ARM-type_fold	p.L861I	ENST00000220509.5	37	c.2581	CCDS10069.1	15	.	.	.	.	.	.	.	.	.	.	C	25.2	4.608851	0.87258	.	.	ENSG00000104142	ENST00000220509	T	0.67523	-0.27	5.23	4.32	0.51571	.	0.058227	0.64402	D	0.000001	T	0.78304	0.4262	M	0.73430	2.235	0.80722	D	1	D	0.62365	0.991	P	0.61201	0.885	T	0.79701	-0.1693	10	0.46703	T	0.11	-33.7057	13.8376	0.63419	0.0:0.9269:0.0:0.0731	.	861	Q9P253	VPS18_HUMAN	I	861	ENSP00000220509:L861I	ENSP00000220509:L861I	L	+	1	0	VPS18	38982490	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.930000	0.70104	1.448000	0.47680	0.561000	0.74099	CTC	VPS18	-	NULL	ENSG00000104142		0.647	VPS18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VPS18	HGNC	protein_coding	OTTHUMT00000252443.2	-	0.00	81	0	C			41195198	+1	tier1	-	no_errors	ENST00000220509	ensembl	human	known	74_37	missense	5.97	63	4	SNP	1.000	A
VPS51	738	genome.wustl.edu	37	11	64876183	64876183	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr11:64876183C>G	ENST00000279281.3	+	5	1332	c.1240C>G	c.(1240-1242)Ctc>Gtc	p.L414V	AP003068.9_ENST00000528887.1_RNA|VPS51_ENST00000527646.1_3'UTR	NM_013265.2	NP_037397.2	Q9UID3	VPS51_HUMAN	vacuolar protein sorting 51 homolog (S. cerevisiae)	414					autophagy (GO:0006914)|lipid transport (GO:0006869)|protein transport (GO:0015031)|retrograde transport, endosome to Golgi (GO:0042147)	GARP complex (GO:0000938)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)											CCTGCAGGGTCTCCGGGCGGC	0.751																																																	0													7.0	8.0	8.0					11																	64876183		1943	3961	5904	SO:0001583	missense	0			AF024631	CCDS8093.1	11q13.1	2012-07-19	2012-07-19	2012-07-19	ENSG00000149823	ENSG00000149823			1172	protein-coding gene	gene with protein product	"""fat-free homolog (zebrafish)"""	615738	"""chromosome 11 open reading frame 3"", ""chromosome 11 open reading frame 2"""	C11orf3, C11orf2		9286704, 20685960	Standard	NM_013265		Approved	ANG2, ANG3, FFR	uc001ocr.2	Q9UID3	OTTHUMG00000165600	ENST00000279281.3:c.1240C>G	11.37:g.64876183C>G	ENSP00000279281:p.Leu414Val		Q6PJV5|Q7L8A6|Q8WZ35|Q96DF4|Q96GR3	Missense_Mutation	SNP	pfam_COG8,pfam_Vacuolar_sorting-assoc_54,pfam_COG_su2_N,pfam_RZZ-complex_Zw10,superfamily_Cullin_repeat-like_dom	p.L414V	ENST00000279281.3	37	c.1240	CCDS8093.1	11	.	.	.	.	.	.	.	.	.	.	C	17.12	3.307301	0.60305	.	.	ENSG00000149823	ENST00000279281	.	.	.	5.19	4.22	0.49857	.	0.000000	0.64402	D	0.000001	T	0.77205	0.4096	M	0.80422	2.495	0.58432	D	0.999998	D	0.71674	0.998	D	0.67548	0.952	T	0.79122	-0.1933	8	.	.	.	-4.386	12.906	0.58152	0.0:0.8353:0.1646:0.0	.	414	Q9UID3	FFR_HUMAN	V	414	.	.	L	+	1	0	C11orf2	64632759	0.999000	0.42202	0.995000	0.50966	0.883000	0.51084	3.546000	0.53656	2.420000	0.82092	0.549000	0.68633	CTC	VPS51	-	NULL	ENSG00000149823		0.751	VPS51-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VPS51	HGNC	protein_coding	OTTHUMT00000385217.1	-	0.00	15	0	C	NM_013265		64876183	+1	tier1	-	no_errors	ENST00000279281	ensembl	human	known	74_37	missense	26.09	17	6	SNP	1.000	G
VSTM2A	222008	genome.wustl.edu	37	7	54617774	54617774	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr7:54617774G>A	ENST00000407838.3	+	4	951	c.545G>A	c.(544-546)aGc>aAc	p.S182N	VSTM2A_ENST00000402026.2_Missense_Mutation_p.S181N|VSTM2A_ENST00000404951.1_Missense_Mutation_p.S182N|VSTM2A_ENST00000302287.3_Missense_Mutation_p.S182N|VSTM2A_ENST00000402613.3_Missense_Mutation_p.S182N|VSTM2A_ENST00000498834.1_3'UTR	NM_182546.2	NP_872352.2	Q8TAG5	VTM2A_HUMAN	V-set and transmembrane domain containing 2A	182						extracellular region (GO:0005576)				endometrium(1)|large_intestine(2)|lung(12)|prostate(1)	16			STAD - Stomach adenocarcinoma(5;0.0525)			GCCATCCCCAGCAGCATCCAT	0.572																																																	0													69.0	56.0	60.0					7																	54617774		2202	4300	6502	SO:0001583	missense	0			BC028404	CCDS5512.2, CCDS75604.1	7p11.2	2013-01-11	2007-08-10	2007-08-10	ENSG00000170419	ENSG00000170419		"""Immunoglobulin superfamily / V-set domain containing"""	28499	protein-coding gene	gene with protein product			"""V-set and transmembrane domain containing 2"""	VSTM2		12477932	Standard	XM_006715663		Approved	MGC33530	uc010kzf.3	Q8TAG5	OTTHUMG00000129271	ENST00000407838.3:c.545G>A	7.37:g.54617774G>A	ENSP00000384967:p.Ser182Asn		A4D2E9|B5MC94	Missense_Mutation	SNP	pfam_Ig_V-set,pfam_Ig_I-set,smart_Ig_sub,pfscan_Ig-like_dom	p.S181N	ENST00000407838.3	37	c.542	CCDS5512.2	7	.	.	.	.	.	.	.	.	.	.	G	9.874	1.199695	0.22121	.	.	ENSG00000170419	ENST00000302287;ENST00000407838;ENST00000404951;ENST00000402026;ENST00000402613	T;T;T;T;T	0.47528	0.85;0.86;0.84;0.85;0.88	5.06	3.24	0.37175	.	0.282442	0.45361	N	0.000367	T	0.40322	0.1112	M	0.64997	1.995	0.26831	N	0.968577	B;B;B	0.29188	0.012;0.037;0.236	B;B;B	0.22386	0.012;0.039;0.039	T	0.24870	-1.0148	10	0.31617	T	0.26	-10.5966	9.4332	0.38624	0.1765:0.0:0.8235:0.0	.	182;182;182	Q8TAG5;Q8TAG5-2;B5MCX6	VTM2A_HUMAN;.;.	N	182;182;182;181;182	ENSP00000303108:S182N;ENSP00000384967:S182N;ENSP00000384701:S182N;ENSP00000385933:S181N;ENSP00000384103:S182N	ENSP00000303108:S182N	S	+	2	0	VSTM2A	54585268	1.000000	0.71417	0.897000	0.35233	0.126000	0.20510	3.917000	0.56424	0.631000	0.30412	0.655000	0.94253	AGC	VSTM2A	-	NULL	ENSG00000170419		0.572	VSTM2A-003	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	VSTM2A	HGNC	protein_coding	OTTHUMT00000318694.1	-	0.00	64	0	G	NM_182546		54617774	+1	tier1	-	no_errors	ENST00000402026	ensembl	human	known	74_37	missense	9.09	40	4	SNP	1.000	A
VTA1	51534	genome.wustl.edu	37	6	142539707	142539707	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr6:142539707A>G	ENST00000367630.4	+	8	909	c.851A>G	c.(850-852)cAg>cGg	p.Q284R	VTA1_ENST00000367621.1_Missense_Mutation_p.Q226R|VTA1_ENST00000452973.2_Missense_Mutation_p.Q199R	NM_016485.3	NP_057569.2	Q9NP79	VTA1_HUMAN	vesicle (multivesicular body) trafficking 1	284	Interaction with VPS4B. {ECO:0000250}.				endosomal transport (GO:0016197)|membrane organization (GO:0061024)|protein transport (GO:0015031)|viral life cycle (GO:0019058)|viral process (GO:0016032)	cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)				endometrium(2)|large_intestine(1)|lung(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	12	Breast(32;0.155)			OV - Ovarian serous cystadenocarcinoma(155;1.34e-05)|GBM - Glioblastoma multiforme(68;0.00182)		AGTGCTTTGCAGTATGAAGAT	0.428																																																	0													74.0	74.0	74.0					6																	142539707		2203	4299	6502	SO:0001583	missense	0			AF060225	CCDS5197.1, CCDS69214.1, CCDS75531.1	6q24.1	2013-08-05	2013-08-05	2007-04-03	ENSG00000009844	ENSG00000009844			20954	protein-coding gene	gene with protein product		610902	"""chromosome 6 open reading frame 55"", ""Vps20-associated 1 homolog (S. cerevisiae)"""	C6orf55		11489251, 15644320	Standard	NM_001286372		Approved	HSPC228, My012	uc003qiw.3	Q9NP79	OTTHUMG00000015707	ENST00000367630.4:c.851A>G	6.37:g.142539707A>G	ENSP00000356602:p.Gln284Arg		B4DW55|E1P594|E7ETQ7|Q5TGM1|Q6IAE8|Q9H0R2|Q9H3K9|Q9P0Q0	Missense_Mutation	SNP	NULL	p.Q284R	ENST00000367630.4	37	c.851	CCDS5197.1	6	.	.	.	.	.	.	.	.	.	.	A	26.4	4.733782	0.89482	.	.	ENSG00000009844	ENST00000367630;ENST00000367621;ENST00000452973	T;T;T	0.50277	0.75;0.75;0.75	5.93	5.93	0.95920	.	0.000000	0.85682	D	0.000000	T	0.59959	0.2232	M	0.72479	2.2	0.80722	D	1	D;D	0.89917	1.0;0.998	D;D	0.77557	0.99;0.971	T	0.58589	-0.7610	10	0.33940	T	0.23	-9.715	16.3871	0.83514	1.0:0.0:0.0:0.0	.	199;284	E7ETQ7;Q9NP79	.;VTA1_HUMAN	R	284;226;199	ENSP00000356602:Q284R;ENSP00000356593:Q226R;ENSP00000395767:Q199R	ENSP00000356593:Q226R	Q	+	2	0	VTA1	142581400	1.000000	0.71417	1.000000	0.80357	0.918000	0.54935	8.850000	0.92190	2.265000	0.75225	0.533000	0.62120	CAG	VTA1	-	NULL	ENSG00000009844		0.428	VTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VTA1	HGNC	protein_coding	OTTHUMT00000042483.2	-	0.00	58	0	A	NM_016485		142539707	+1	tier1	-	no_errors	ENST00000367630	ensembl	human	known	74_37	missense	5.00	76	4	SNP	1.000	G
WASH3P	374666	genome.wustl.edu	37	15	102513202	102513202	+	RNA	DEL	C	C	-			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr15:102513202delC	ENST00000557932.1	+	0	383							C4AMC7	WASH3_HUMAN	WAS protein family homolog 3 pseudogene						Arp2/3 complex-mediated actin nucleation (GO:0034314)|endosomal transport (GO:0016197)|retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|filopodium (GO:0030175)|lamellipodium (GO:0030027)|membrane (GO:0016020)|recycling endosome (GO:0055037)|WASH complex (GO:0071203)	alpha-tubulin binding (GO:0043014)	p.H121fs*24(1)		central_nervous_system(1)|endometrium(6)|kidney(11)|prostate(5)|stomach(1)|urinary_tract(1)	25						GACGCCCCCGCCACAGGATCC	0.652																																																	1	Deletion - Frameshift(1)	central_nervous_system(1)																																										0					15q26.3	2014-03-20	2008-01-16	2008-01-16	ENSG00000185596	ENSG00000185596		"""WAS protein homologs"""	24362	pseudogene	pseudogene			"""family with sequence similarity 39, member D pseudogene"""	FAM39DP		11701968, 18159949	Standard	NR_003659		Approved	FLJ25222	uc002cdi.3	C4AMC7	OTTHUMG00000172275		15.37:g.102513202delC				RNA	DEL	-	NULL	ENST00000557932.1	37	NULL		15																																																																																			WASH3P	-	-	ENSG00000185596		0.652	WASH3P-001	KNOWN	basic	processed_transcript	WASH3P	HGNC	pseudogene	OTTHUMT00000417608.1		0.00	9	0	C	NM_199163		102513202	+1			no_errors	ENST00000354296	ensembl	human	known	74_37	rna	16.67	10	2	DEL	0.994	0
WDHD1	11169	genome.wustl.edu	37	14	55434081	55434081	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr14:55434081G>A	ENST00000360586.3	-	17	2160	c.2095C>T	c.(2095-2097)Cca>Tca	p.P699S	WDHD1_ENST00000420358.2_Missense_Mutation_p.P576S|WDHD1_ENST00000421192.1_Missense_Mutation_p.P576S|WDHD1_ENST00000359167.4_Missense_Mutation_p.P217S	NM_007086.3	NP_009017.1	O75717	WDHD1_HUMAN	WD repeat and HMG-box DNA binding protein 1	699					heterochromatin maintenance (GO:0070829)|regulation of chromosome organization (GO:0033044)|RNA processing (GO:0006396)	chromosome, centromeric region (GO:0000775)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|RNA binding (GO:0003723)			breast(3)|endometrium(4)|kidney(3)|large_intestine(9)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(4)|urinary_tract(2)	42						GGAAGGGTTGGGGGAAACCGA	0.373																																																	0													84.0	85.0	85.0					14																	55434081		2203	4300	6503	SO:0001583	missense	0			AJ006266	CCDS9721.1, CCDS41955.1	14q22.2	2013-01-09			ENSG00000198554	ENSG00000198554		"""WD repeat domain containing"""	23170	protein-coding gene	gene with protein product	"""CTF4, chromosome transmission fidelity factor 4 homolog (S. cerevisiae)"""	608126				9175701, 20028748	Standard	NM_007086		Approved	AND-1, CTF4, CHTF4	uc001xbm.2	O75717	OTTHUMG00000140304	ENST00000360586.3:c.2095C>T	14.37:g.55434081G>A	ENSP00000353793:p.Pro699Ser		C9JW18|F6W0U7	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_DUF3639,pfam_TIF_beta_prop-like,superfamily_WD40_repeat_dom,superfamily_HMG_box_dom,smart_WD40_repeat,smart_HMG_box_dom,pfscan_HMG_box_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.P699S	ENST00000360586.3	37	c.2095	CCDS9721.1	14	.	.	.	.	.	.	.	.	.	.	G	18.81	3.702452	0.68501	.	.	ENSG00000198554	ENST00000360586;ENST00000359167;ENST00000421192	T;T;T	0.69435	-0.03;0.57;-0.4	5.33	5.33	0.75918	.	0.000000	0.85682	D	0.000000	T	0.70168	0.3193	L	0.50919	1.6	0.80722	D	1	D;B	0.53462	0.96;0.302	P;B	0.51415	0.669;0.173	T	0.71417	-0.4599	10	0.48119	T	0.1	.	15.409	0.74902	0.0:0.1392:0.8608:0.0	.	217;699	F8W7P7;O75717	.;WDHD1_HUMAN	S	699;217;576	ENSP00000353793:P699S;ENSP00000352085:P217S;ENSP00000391049:P576S	ENSP00000352085:P217S	P	-	1	0	WDHD1	54503831	1.000000	0.71417	0.999000	0.59377	0.924000	0.55760	7.318000	0.79029	2.483000	0.83821	0.650000	0.86243	CCA	WDHD1	-	NULL	ENSG00000198554		0.373	WDHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDHD1	HGNC	protein_coding	OTTHUMT00000276897.2	-	0.00	58	0	G	NM_007086		55434081	-1	tier1	-	no_errors	ENST00000360586	ensembl	human	known	74_37	missense	38.18	34	21	SNP	1.000	A
WDR54	84058	genome.wustl.edu	37	2	74649396	74649396	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr2:74649396G>A	ENST00000348227.4	+	2	204	c.116G>A	c.(115-117)gGa>gAa	p.G39E	WDR54_ENST00000409791.1_Intron|WDR54_ENST00000461531.1_Intron	NM_032118.2	NP_115494.1	Q9H977	WDR54_HUMAN	WD repeat domain 54	39										breast(1)|large_intestine(1)|lung(6)|upper_aerodigestive_tract(1)	9						GTGGTTCATGGACCAAGCGCC	0.647																																																	0													58.0	53.0	55.0					2																	74649396		2203	4300	6503	SO:0001583	missense	0			AK023015	CCDS1940.1	2p13.1	2013-01-09			ENSG00000005448	ENSG00000005448		"""WD repeat domain containing"""	25770	protein-coding gene	gene with protein product						12477932	Standard	NM_032118		Approved	FLJ12953	uc002slb.3	Q9H977	OTTHUMG00000129951	ENST00000348227.4:c.116G>A	2.37:g.74649396G>A	ENSP00000006526:p.Gly39Glu		D6W5I3|Q53H85|Q86V45	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.G39E	ENST00000348227.4	37	c.116	CCDS1940.1	2	.	.	.	.	.	.	.	.	.	.	G	19.87	3.907744	0.72868	.	.	ENSG00000005448	ENST00000426787;ENST00000348227	.	.	.	5.47	5.47	0.80525	.	0.061006	0.64402	D	0.000003	T	0.40815	0.1132	L	0.36672	1.1	0.42605	D	0.993292	P	0.48764	0.915	B	0.40165	0.321	T	0.31081	-0.9956	9	0.08837	T	0.75	-12.4029	16.2503	0.82481	0.0:0.0:1.0:0.0	.	39	Q9H977	WDR54_HUMAN	E	39	.	ENSP00000006526:G39E	G	+	2	0	WDR54	74502904	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	5.377000	0.66184	2.576000	0.86940	0.511000	0.50034	GGA	WDR54	-	NULL	ENSG00000005448		0.647	WDR54-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR54	HGNC	protein_coding	OTTHUMT00000252213.1	-	0.00	31	0	G	NM_032118		74649396	+1	tier1	-	no_errors	ENST00000348227	ensembl	human	known	74_37	missense	37.50	20	12	SNP	1.000	A
WWP1	11059	genome.wustl.edu	37	8	87460711	87460711	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr8:87460711G>T	ENST00000517970.1	+	20	2549	c.2242G>T	c.(2242-2244)Gtg>Ttg	p.V748L	WWP1_ENST00000265428.4_Missense_Mutation_p.V748L|WWP1_ENST00000349423.2_Missense_Mutation_p.V530L|WWP1_ENST00000341922.2_Missense_Mutation_p.V618L	NM_007013.3	NP_008944.1	Q9H0M0	WWP1_HUMAN	WW domain containing E3 ubiquitin protein ligase 1	748	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				central nervous system development (GO:0007417)|ion transmembrane transport (GO:0034220)|negative regulation of transcription, DNA-templated (GO:0045892)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|signal transduction (GO:0007165)|transmembrane transport (GO:0055085)|viral entry into host cell (GO:0046718)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ubiquitin ligase complex (GO:0000151)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			endometrium(3)|kidney(2)|large_intestine(9)|liver(4)|lung(10)|prostate(2)|urinary_tract(1)	31						CAATATTCTGGTGACTGAGGA	0.368																																																	0													98.0	91.0	94.0					8																	87460711		2203	4300	6503	SO:0001583	missense	0			AY043361	CCDS6242.1	8q21.3	2013-07-22			ENSG00000123124	ENSG00000123124			17004	protein-coding gene	gene with protein product		602307				9169421, 9647693	Standard	NM_007013		Approved	AIP5, DKFZP434D2111	uc003ydt.3	Q9H0M0	OTTHUMG00000163690	ENST00000517970.1:c.2242G>T	8.37:g.87460711G>T	ENSP00000427793:p.Val748Leu		O00307|Q5YLC1|Q96BP4	Missense_Mutation	SNP	pfam_HECT,pfam_WW_dom,pfam_C2_dom,superfamily_HECT,superfamily_C2_dom,superfamily_WW_dom,smart_C2_dom,smart_WW_dom,smart_HECT,pfscan_HECT,pfscan_C2_dom,pfscan_WW_dom	p.V748L	ENST00000517970.1	37	c.2242	CCDS6242.1	8	.	.	.	.	.	.	.	.	.	.	G	29.8	5.034045	0.93575	.	.	ENSG00000123124	ENST00000517970;ENST00000265428;ENST00000341922;ENST00000349423	T;T;T;T	0.73789	-0.78;-0.78;-0.78;-0.78	5.37	5.37	0.77165	HECT (4);	0.000000	0.85682	D	0.000000	D	0.88138	0.6356	M	0.84683	2.71	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.89206	0.3561	10	0.59425	D	0.04	.	19.106	0.93294	0.0:0.0:1.0:0.0	.	748	Q9H0M0	WWP1_HUMAN	L	748;748;618;530	ENSP00000427793:V748L;ENSP00000265428:V748L;ENSP00000340564:V618L;ENSP00000342665:V530L	ENSP00000265428:V748L	V	+	1	0	WWP1	87529827	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.700000	0.98707	2.522000	0.85027	0.563000	0.77884	GTG	WWP1	-	pfam_HECT,superfamily_HECT,smart_HECT,pfscan_HECT	ENSG00000123124		0.368	WWP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WWP1	HGNC	protein_coding	OTTHUMT00000374755.1		0.00	34	0	G	NM_007013		87460711	+1			no_errors	ENST00000265428	ensembl	human	known	74_37	missense	5.88	32	2	SNP	1.000	T
XKR8	55113	genome.wustl.edu	37	1	28293308	28293308	+	Missense_Mutation	SNP	G	G	T	rs202057519		TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr1:28293308G>T	ENST00000373884.5	+	3	1393	c.785G>T	c.(784-786)cGg>cTg	p.R262L		NM_018053.2	NP_060523.2	Q9H6D3	XKR8_HUMAN	XK, Kell blood group complex subunit-related family, member 8	262					engulfment of apoptotic cell (GO:0043652)|phosphatidylserine exposure on apoptotic cell surface (GO:0070782)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(1)|large_intestine(2)|lung(1)	4		Colorectal(325;0.000147)|Renal(390;0.00357)|Lung NSC(340;0.00588)|all_lung(284;0.00645)|Breast(348;0.0174)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0545)|all_neural(195;0.0557)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0416)|OV - Ovarian serous cystadenocarcinoma(117;4.72e-24)|Colorectal(126;1.52e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00269)|STAD - Stomach adenocarcinoma(196;0.00303)|BRCA - Breast invasive adenocarcinoma(304;0.00572)|READ - Rectum adenocarcinoma(331;0.0526)		TGGCTGTACCGGGTGACGGTG	0.642																																																	0													25.0	26.0	26.0					1																	28293308		2203	4300	6503	SO:0001583	missense	0			AK091615	CCDS315.1	1p35.3	2008-02-05	2006-01-12		ENSG00000158156	ENSG00000158156			25508	protein-coding gene	gene with protein product			"""X Kell blood group precursor-related family, member 8"""			12477932	Standard	NM_018053		Approved	FLJ10307	uc001bph.1	Q9H6D3	OTTHUMG00000003912	ENST00000373884.5:c.785G>T	1.37:g.28293308G>T	ENSP00000362991:p.Arg262Leu			Missense_Mutation	SNP	pfam_Transport_prot_XK	p.R262L	ENST00000373884.5	37	c.785	CCDS315.1	1	.	.	.	.	.	.	.	.	.	.	g	22.9	4.354752	0.82243	.	.	ENSG00000158156	ENST00000373884	T	0.65549	-0.16	5.47	4.56	0.56223	.	0.066911	0.64402	D	0.000008	T	0.78861	0.4350	M	0.87180	2.865	0.48762	D	0.999704	D	0.89917	1.0	D	0.91635	0.999	T	0.78889	-0.2026	10	0.10111	T	0.7	.	14.4933	0.67667	0.0707:0.0:0.9293:0.0	.	262	Q9H6D3	XKR8_HUMAN	L	262	ENSP00000362991:R262L	ENSP00000362991:R262L	R	+	2	0	XKR8	28165895	1.000000	0.71417	0.994000	0.49952	0.791000	0.44710	6.314000	0.72848	1.324000	0.45282	-0.119000	0.15052	CGG	XKR8	-	pfam_Transport_prot_XK	ENSG00000158156		0.642	XKR8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XKR8	HGNC	protein_coding	OTTHUMT00000011175.1	-	0.00	95	0	G	NM_018053		28293308	+1	tier1	-	no_errors	ENST00000373884	ensembl	human	known	74_37	missense	5.32	89	5	SNP	1.000	T
ZBTB21	49854	genome.wustl.edu	37	21	43411988	43411988	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr21:43411988G>T	ENST00000310826.5	-	3	2400	c.2217C>A	c.(2215-2217)agC>agA	p.S739R	ZBTB21_ENST00000398511.3_Missense_Mutation_p.S739R|ZBTB21_ENST00000398505.3_Missense_Mutation_p.S538R|ZBTB21_ENST00000465968.1_5'UTR|ZBTB21_ENST00000398499.1_Missense_Mutation_p.S739R	NM_001098402.1	NP_001091872.1	Q9ULJ3	ZBT21_HUMAN	zinc finger and BTB domain containing 21	739					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|methyl-CpG binding (GO:0008327)										GCCGCTCGTGGCTTCCTTGCT	0.537																																																	0													142.0	164.0	157.0					21																	43411988		2203	4300	6503	SO:0001583	missense	0			AB033053	CCDS13678.1, CCDS42934.1	21q22.3	2013-01-09	2013-01-09	2013-01-09	ENSG00000173276	ENSG00000173276		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	13083	protein-coding gene	gene with protein product			"""zinc finger protein 295"""	ZNF295			Standard	NM_020727		Approved	KIAA1227	uc002yzy.4	Q9ULJ3	OTTHUMG00000086789	ENST00000310826.5:c.2217C>A	21.37:g.43411988G>T	ENSP00000308759:p.Ser739Arg		Q5R2W1|Q5R2W2|Q6P4R0	Missense_Mutation	SNP	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.S739R	ENST00000310826.5	37	c.2217	CCDS13678.1	21	.	.	.	.	.	.	.	.	.	.	G	12.14	1.849525	0.32699	.	.	ENSG00000173276	ENST00000398505;ENST00000310826;ENST00000398499;ENST00000398511	T;T;T;T	0.06768	3.44;3.26;3.26;3.26	5.6	3.76	0.43208	Zinc finger, C2H2-like (1);	0.423865	0.24256	N	0.040137	T	0.04227	0.0117	N	0.08118	0	0.39213	D	0.963363	B;B	0.25772	0.127;0.134	B;B	0.26969	0.071;0.075	T	0.46830	-0.9163	10	0.21014	T	0.42	-8.9108	8.7761	0.34762	0.1577:0.1225:0.7198:0.0	.	538;739	Q9ULJ3-2;Q9ULJ3	.;ZN295_HUMAN	R	538;739;739;739	ENSP00000381517:S538R;ENSP00000308759:S739R;ENSP00000381512:S739R;ENSP00000381523:S739R	ENSP00000308759:S739R	S	-	3	2	ZNF295	42285057	1.000000	0.71417	0.879000	0.34478	0.990000	0.78478	2.642000	0.46596	1.360000	0.45960	0.551000	0.68910	AGC	ZBTB21	-	smart_Znf_C2H2-like	ENSG00000173276		0.537	ZBTB21-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZBTB21	HGNC	protein_coding	OTTHUMT00000195308.1	-	0.00	49	0	G	NM_020727		43411988	-1	tier1	-	no_errors	ENST00000310826	ensembl	human	known	74_37	missense	7.41	50	4	SNP	0.994	T
ZMYM4	9202	genome.wustl.edu	37	1	35846959	35846960	+	Frame_Shift_Ins	INS	-	-	A			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr1:35846959_35846960insA	ENST00000314607.6	+	8	1361_1362	c.1281_1282insA	c.(1282-1284)aaafs	p.K428fs	ZMYM4_ENST00000373297.2_Frame_Shift_Ins_p.K428fs	NM_005095.2	NP_005086.2	Q5VZL5	ZMYM4_HUMAN	zinc finger, MYM-type 4	428					cytoskeleton organization (GO:0007010)|multicellular organismal development (GO:0007275)|regulation of cell morphogenesis (GO:0022604)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(13)|lung(16)|ovary(2)|prostate(3)|skin(2)	54		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				CATATGAACTGAAAAAAAAACC	0.342																																																	0																																										SO:0001589	frameshift_variant	0			AB007885	CCDS389.1	1p34-p32	2013-01-08	2005-12-19	2005-12-19	ENSG00000146463	ENSG00000146463		"""Zinc fingers, MYM type"""	13055	protein-coding gene	gene with protein product		613568	"""zinc finger protein 262"""	ZNF262		10449923	Standard	NM_005095		Approved	KIAA0425, ZNF198L3, MYM	uc001byt.3	Q5VZL5	OTTHUMG00000004241	ENST00000314607.6:c.1290dupA	1.37:g.35846968_35846968dupA	ENSP00000322915:p.Lys428fs		A0JP19|A0JP20|O43308|Q5T5E1|Q5T5E2|Q7L3Q4	Frame_Shift_Ins	INS	pfam_DUF3504,pfam_Znf_MYM,smart_TRASH_dom	p.P430fs	ENST00000314607.6	37	c.1281_1282	CCDS389.1	1																																																																																			ZMYM4	-	NULL	ENSG00000146463		0.342	ZMYM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZMYM4	HGNC	protein_coding	OTTHUMT00000012207.3		0.00	43	0	-	NM_005095		35846960	+1	tier1		no_errors	ENST00000314607	ensembl	human	known	74_37	frame_shift_ins	12.12	29	4	INS	0.987:1.000	A
ZNF292	23036	genome.wustl.edu	37	6	87967225	87967225	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr6:87967225A>G	ENST00000369577.3	+	8	3921	c.3878A>G	c.(3877-3879)aAt>aGt	p.N1293S	ZNF292_ENST00000339907.4_Missense_Mutation_p.N1288S	NM_015021.1	NP_055836.1	O60281	ZN292_HUMAN	zinc finger protein 292	1293						nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(27)|lung(21)|ovary(4)|prostate(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	89		all_cancers(76;3.82e-09)|Prostate(29;1.34e-10)|Acute lymphoblastic leukemia(125;2.17e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;5.31e-05)		BRCA - Breast invasive adenocarcinoma(108;0.0199)		CTGGAAAATAATACAAATCAT	0.383																																																	0													46.0	42.0	43.0					6																	87967225		1851	4087	5938	SO:0001583	missense	0			AB011102	CCDS47457.1	6q15	2008-10-23			ENSG00000188994	ENSG00000188994		"""Zinc fingers, C2H2-type"""	18410	protein-coding gene	gene with protein product						9628581	Standard	NM_015021		Approved	KIAA0530, ZFP292, bA393I2.3, Zn-15, Zn-16	uc003plm.4	O60281	OTTHUMG00000015164	ENST00000369577.3:c.3878A>G	6.37:g.87967225A>G	ENSP00000358590:p.Asn1293Ser		Q5W0B2|Q7Z3L7|Q9H8G3|Q9H8J4	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.N1293S	ENST00000369577.3	37	c.3878	CCDS47457.1	6	.	.	.	.	.	.	.	.	.	.	A	6.355	0.433579	0.12045	.	.	ENSG00000188994	ENST00000369577;ENST00000339907	T;T	0.05382	3.45;3.46	5.5	-3.82	0.04281	.	0.361191	0.33792	N	0.004555	T	0.00815	0.0027	N	0.12182	0.205	0.25457	N	0.987952	B	0.02656	0.0	B	0.06405	0.002	T	0.43782	-0.9370	10	0.15499	T	0.54	.	9.0492	0.36365	0.3782:0.1271:0.4947:0.0	.	1293	O60281	ZN292_HUMAN	S	1293;1288	ENSP00000358590:N1293S;ENSP00000342847:N1288S	ENSP00000342847:N1288S	N	+	2	0	ZNF292	88023944	0.203000	0.23435	0.966000	0.40874	0.993000	0.82548	0.010000	0.13242	-0.736000	0.04831	0.528000	0.53228	AAT	ZNF292	-	NULL	ENSG00000188994		0.383	ZNF292-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF292	HGNC	protein_coding	OTTHUMT00000376192.2	-	0.00	57	0	A	NM_015021		87967225	+1	tier1	-	no_errors	ENST00000369577	ensembl	human	known	74_37	missense	46.43	15	13	SNP	0.972	G
ZNF536	9745	genome.wustl.edu	37	19	30936105	30936105	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr19:30936105C>T	ENST00000355537.3	+	2	1783	c.1636C>T	c.(1636-1638)Cgc>Tgc	p.R546C		NM_014717.1	NP_055532.1	O15090	ZN536_HUMAN	zinc finger protein 536	546					negative regulation of neuron differentiation (GO:0045665)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|retinoic acid-responsive element binding (GO:0044323)	p.R546G(2)		NS(3)|breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|lung(119)|ovary(7)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	182	Esophageal squamous(110;0.0834)					TCCGCTGCAGCGCAACCACGA	0.562																																																	2	Substitution - Missense(2)	lung(2)											75.0	81.0	79.0					19																	30936105		2203	4300	6503	SO:0001583	missense	0				CCDS32984.1	19q13.11	2013-01-08				ENSG00000198597		"""Zinc fingers, C2H2-type"""	29025	protein-coding gene	gene with protein product						9205841	Standard	XM_005259445		Approved	KIAA0390	uc002nsu.1	O15090		ENST00000355537.3:c.1636C>T	19.37:g.30936105C>T	ENSP00000347730:p.Arg546Cys		A2RU18	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.R546C	ENST00000355537.3	37	c.1636	CCDS32984.1	19	.	.	.	.	.	.	.	.	.	.	C	9.722	1.159984	0.21454	.	.	ENSG00000198597	ENST00000355537	T	0.47177	0.85	5.53	4.48	0.54585	.	0.296137	0.38837	N	0.001546	T	0.37183	0.0994	L	0.36672	1.1	0.51482	D	0.999928	B;B	0.30851	0.297;0.297	B;B	0.17098	0.017;0.017	T	0.16958	-1.0385	10	0.42905	T	0.14	-34.643	15.5642	0.76277	0.1391:0.8609:0.0:0.0	.	546;546	A7E228;O15090	.;ZN536_HUMAN	C	546	ENSP00000347730:R546C	ENSP00000347730:R546C	R	+	1	0	ZNF536	35627945	1.000000	0.71417	0.987000	0.45799	0.201000	0.24016	6.061000	0.71148	1.278000	0.44430	0.655000	0.94253	CGC	ZNF536	-	NULL	ENSG00000198597		0.562	ZNF536-004	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF536	HGNC	protein_coding	OTTHUMT00000459667.2		0.00	44	0	C	NM_014717		30936105	+1			no_errors	ENST00000355537	ensembl	human	known	74_37	missense	6.67	28	2	SNP	1.000	T
ZNF660	285349	genome.wustl.edu	37	3	44636561	44636561	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr3:44636561C>A	ENST00000322734.2	+	3	1209	c.876C>A	c.(874-876)caC>caA	p.H292Q	RP11-944L7.4_ENST00000457331.1_RNA	NM_173658.2	NP_775929.2	Q6AZW8	ZN660_HUMAN	zinc finger protein 660	292					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.H292H(1)		large_intestine(2)|lung(4)	6				KIRC - Kidney renal clear cell carcinoma(197;0.0468)|Kidney(197;0.0585)		TTATTCTACACTTGAGAACCC	0.403																																																	1	Substitution - coding silent(1)	large_intestine(1)											54.0	55.0	55.0					3																	44636561		2203	4300	6503	SO:0001583	missense	0			AK094189	CCDS2716.1	3p21.32	2013-01-08			ENSG00000144792	ENSG00000144792		"""Zinc fingers, C2H2-type"""	26720	protein-coding gene	gene with protein product							Standard	NM_173658		Approved	FLJ36870	uc003cnl.1	Q6AZW8	OTTHUMG00000133097	ENST00000322734.2:c.876C>A	3.37:g.44636561C>A	ENSP00000324605:p.His292Gln		Q7Z331|Q8N9M8	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.H292Q	ENST00000322734.2	37	c.876	CCDS2716.1	3	.	.	.	.	.	.	.	.	.	.	C	15.70	2.910880	0.52439	.	.	ENSG00000144792	ENST00000322734	D	0.86865	-2.18	4.21	2.94	0.34122	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.92532	0.7628	M	0.94021	3.485	0.80722	D	1	D	0.59357	0.985	P	0.57057	0.812	D	0.91538	0.5247	8	.	.	.	.	7.1007	0.25336	0.0:0.1958:0.0:0.8042	.	292	Q6AZW8	ZN660_HUMAN	Q	292	ENSP00000324605:H292Q	.	H	+	3	2	ZNF660	44611565	0.001000	0.12720	1.000000	0.80357	0.992000	0.81027	-0.132000	0.10467	0.750000	0.32877	-0.300000	0.09419	CAC	ZNF660	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000144792		0.403	ZNF660-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF660	HGNC	protein_coding	OTTHUMT00000256756.4		0.00	39	0	C	NM_173658		44636561	+1			no_errors	ENST00000322734	ensembl	human	known	74_37	missense	6.98	40	3	SNP	0.999	A
ZNF670	93474	genome.wustl.edu	37	1	247200821	247200821	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr1:247200821C>G	ENST00000366503.2	-	4	1258	c.1100G>C	c.(1099-1101)tGt>tCt	p.C367S		NM_001204220.1|NM_033213.4	NP_001191149.1|NP_149990.1	Q9BS34	ZN670_HUMAN	zinc finger protein 670	367					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(3)|ovary(1)|skin(1)|urinary_tract(1)	17	all_cancers(71;4.01e-05)|all_epithelial(71;6.72e-06)|Ovarian(71;0.0173)|Breast(184;0.0318)|all_lung(81;0.0458)|Lung NSC(105;0.0518)	all_cancers(173;0.0266)	OV - Ovarian serous cystadenocarcinoma(106;0.00427)			ACATTTCTTACATTCATAGGG	0.398																																																	0													89.0	86.0	87.0					1																	247200821		2203	4300	6503	SO:0001583	missense	0				CCDS31087.1	1q44	2013-01-08			ENSG00000135747	ENSG00000135747		"""Zinc fingers, C2H2-type"", ""-"""	28167	protein-coding gene	gene with protein product						12477932	Standard	NM_033213		Approved	MGC12466	uc001icd.2	Q9BS34	OTTHUMG00000040868	ENST00000366503.2:c.1100G>C	1.37:g.247200821C>G	ENSP00000355459:p.Cys367Ser			Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.C367S	ENST00000366503.2	37	c.1100	CCDS31087.1	1	.	.	.	.	.	.	.	.	.	.	C	17.94	3.512134	0.64522	.	.	ENSG00000135747	ENST00000366503	D	0.85171	-1.95	0.641	0.641	0.17759	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.93864	0.8037	H	0.97659	4.05	0.25359	N	0.988797	D	0.89917	1.0	D	0.85130	0.997	D	0.83753	0.0210	9	0.72032	D	0.01	.	7.0739	0.25193	0.0:0.9999:0.0:1.0E-4	.	367	Q9BS34	ZN670_HUMAN	S	367	ENSP00000355459:C367S	ENSP00000355459:C367S	C	-	2	0	ZNF670	245267444	0.995000	0.38212	0.776000	0.31678	0.723000	0.41478	5.211000	0.65219	0.604000	0.29930	0.467000	0.42956	TGT	ZNF670	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000135747		0.398	ZNF670-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF670	HGNC	protein_coding	OTTHUMT00000098183.3	-	0.00	100	0	C	NM_033213		247200821	-1	tier1	-	no_errors	ENST00000366503	ensembl	human	known	74_37	missense	28.95	54	22	SNP	0.696	G
ZNF720	124411	genome.wustl.edu	37	16	31766026	31766026	+	Intron	SNP	G	G	C			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr16:31766026G>C	ENST00000316491.9	+	4	560				ZNF720_ENST00000539915.1_Intron|ZNF720_ENST00000531864.2_Intron|ZNF720_ENST00000534369.1_Intron|ZNF720_ENST00000399681.3_Missense_Mutation_p.K138N|ZNF720_ENST00000398696.3_3'UTR	NM_001130913.1	NP_001124385.1	Q7Z2F6	ZN720_HUMAN	zinc finger protein 720						regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	nucleic acid binding (GO:0003676)			endometrium(1)|kidney(1)|lung(1)|stomach(1)	4						TTGGAGAAAAGTCACACAGAT	0.313																																																	0																																										SO:0001627	intron_variant	0			AK128671	CCDS45473.1	16p11.2	2013-01-08				ENSG00000197302		"""Zinc fingers, C2H2-type"", ""-"""	26987	protein-coding gene	gene with protein product							Standard	NM_001130913		Approved		uc002ecq.3	Q7Z2F6		ENST00000316491.9:c.361+805G>C	16.37:g.31766026G>C			Q6ZQX1	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.K138N	ENST00000316491.9	37	c.414	CCDS45473.1	16	.	.	.	.	.	.	.	.	.	.	g	10.03	1.239793	0.22711	.	.	ENSG00000197302	ENST00000399681	T	0.35048	1.33	0.965	-1.93	0.07594	.	.	.	.	.	T	0.47060	0.1425	.	.	.	0.18873	N	0.999987	D;D	0.69078	0.964;0.997	P;D	0.68353	0.743;0.957	T	0.35226	-0.9797	8	0.52906	T	0.07	.	3.9369	0.09310	0.2135:0.3637:0.4227:0.0	.	138;138	F5GYB6;B7Z5S2	.;.	N	138	ENSP00000440701:K138N	ENSP00000440701:K138N	K	+	3	2	ZNF720	31673527	0.000000	0.05858	0.001000	0.08648	0.051000	0.14879	-0.151000	0.10175	-0.623000	0.05618	-0.311000	0.09066	AAG	ZNF720	-	pfscan_Znf_C2H2	ENSG00000197302		0.313	ZNF720-001	KNOWN	basic|CCDS	protein_coding	ZNF720	HGNC	protein_coding	OTTHUMT00000394883.3	-	0.00	89	0	G	NM_001004300		31766026	+1	tier1	-	no_errors	ENST00000399681	ensembl	human	known	74_37	missense	24.73	69	23	SNP	0.383	C
ZNF738	148203	genome.wustl.edu	37	19	21558723	21558723	+	Missense_Mutation	SNP	T	T	A			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr19:21558723T>A	ENST00000311015.3	+	4	487	c.276T>A	c.(274-276)gaT>gaA	p.D92E	ZNF738_ENST00000380870.4_Missense_Mutation_p.D92E|ZNF738_ENST00000597810.1_Missense_Mutation_p.D92E			Q8NE65	ZN738_HUMAN	zinc finger protein 738	92	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				protein polyubiquitination (GO:0000209)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|ubiquitin-protein transferase activity (GO:0004842)			kidney(1)|lung(1)	2						AAGGAAAAGATCCCTGGAATA	0.373																																																	0																																										SO:0001583	missense	0			BC034499		19p12	2013-01-16			ENSG00000172687	ENSG00000172687			32469	other	unknown							Standard	NR_027130		Approved		uc002nps.4	Q8NE65	OTTHUMG00000141298	ENST00000311015.3:c.276T>A	19.37:g.21558723T>A	ENSP00000311957:p.Asp92Glu		A8K4N7	Missense_Mutation	SNP	pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box	p.D92E	ENST00000311015.3	37	c.276		19	.	.	.	.	.	.	.	.	.	.	N	1.926	-0.447190	0.04572	.	.	ENSG00000172687	ENST00000311015;ENST00000380870	T;T	0.00635	6.08;6.06	0.185	0.185	0.15096	Krueppel-associated box (2);	.	.	.	.	T	0.00328	0.0010	.	.	.	0.20764	N	0.99985	B	0.10296	0.003	B	0.13407	0.009	T	0.41627	-0.9498	7	0.02654	T	1	.	.	.	.	.	92	Q8NE65	ZN738_HUMAN	E	92	ENSP00000311957:D92E;ENSP00000370252:D92E	ENSP00000311957:D92E	D	+	3	2	ZNF738	21350563	0.000000	0.05858	0.801000	0.32222	0.805000	0.45488	-2.034000	0.01424	0.251000	0.21505	0.248000	0.18094	GAT	ZNF738	-	smart_Krueppel-associated_box,pfscan_Krueppel-associated_box	ENSG00000172687		0.373	ZNF738-001	NOVEL	basic|appris_candidate_longest|exp_conf	protein_coding	ZNF738	HGNC	protein_coding	OTTHUMT00000280564.1	-	0.00	88	0	T	NR_027130		21558723	+1	tier1	-	no_errors	ENST00000597810	ensembl	human	putative	74_37	missense	28.74	62	25	SNP	0.863	A
ZNF837	116412	genome.wustl.edu	37	19	58880489	58880489	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr19:58880489C>G	ENST00000427624.2	-	3	533	c.211G>C	c.(211-213)Ggg>Cgg	p.G71R	CTD-2619J13.3_ENST00000599889.1_RNA|ZNF837_ENST00000597582.1_Missense_Mutation_p.G71R			Q96EG3	ZN837_HUMAN	zinc finger protein 837	71					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|skin(1)	2						GGGCTCACCCCGAGGCTGCAG	0.746																																																	0													1.0	2.0	2.0					19																	58880489		472	1155	1627	SO:0001583	missense	0			BC012365	CCDS46216.1	19q13.43	2013-01-08			ENSG00000152475	ENSG00000152475		"""Zinc fingers, C2H2-type"""	25164	protein-coding gene	gene with protein product						12477932	Standard	NM_138466		Approved		uc002qsl.4	Q96EG3		ENST00000427624.2:c.211G>C	19.37:g.58880489C>G	ENSP00000405699:p.Gly71Arg			Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.G71R	ENST00000427624.2	37	c.211	CCDS46216.1	19	.	.	.	.	.	.	.	.	.	.	C	0.008	-1.933431	0.00488	.	.	ENSG00000152475	ENST00000427624	T	0.15834	2.39	1.29	-2.58	0.06228	.	.	.	.	.	T	0.06872	0.0175	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.35773	-0.9775	9	0.25106	T	0.35	.	5.5808	0.17248	0.1675:0.6302:0.0:0.2023	.	71	Q96EG3	ZN837_HUMAN	R	71	ENSP00000405699:G71R	ENSP00000405699:G71R	G	-	1	0	ZNF837	63572301	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.977000	0.03782	-1.552000	0.01704	-1.377000	0.01181	GGG	ZNF837	-	NULL	ENSG00000152475		0.746	ZNF837-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZNF837	HGNC	protein_coding	OTTHUMT00000466962.1	-	0.00	18	0	C	NM_138466		58880489	-1	tier1	-	no_errors	ENST00000427624	ensembl	human	known	74_37	missense	33.33	11	6	SNP	0.000	G
ZNF853	54753	genome.wustl.edu	37	7	6662398	6662398	+	Silent	SNP	G	G	A			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr7:6662398G>A	ENST00000457543.3	+	3	2334	c.1776G>A	c.(1774-1776)tcG>tcA	p.S592S		NM_017560.1	NP_060030.1	P0CG23	ZN853_HUMAN	zinc finger protein 853	592							metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			endometrium(1)|kidney(1)	2						GCACGCACTCGGGCGAGCGGC	0.721																																																	0													9.0	14.0	12.0					7																	6662398		685	1576	2261	SO:0001819	synonymous_variant	0			AL133055	CCDS59048.1	7p22.1	2013-01-08				ENSG00000236609		"""Zinc fingers, C2H2-type"""	21767	protein-coding gene	gene with protein product							Standard	NM_017560		Approved	DKFZp434J1015	uc011jwz.2	P0CG23		ENST00000457543.3:c.1776G>A	7.37:g.6662398G>A				Silent	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S592	ENST00000457543.3	37	c.1776	CCDS59048.1	7																																																																																			ZNF853	-	pfscan_Znf_C2H2	ENSG00000236609		0.721	ZNF853-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	ZNF853	HGNC	protein_coding	OTTHUMT00000324169.2	-	0.00	46	0	G	NM_017560		6662398	+1	tier1	-	no_errors	ENST00000457543	ensembl	human	known	74_37	silent	27.42	45	17	SNP	0.995	A
ZSCAN20	7579	genome.wustl.edu	37	1	33959192	33959192	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A8NI-01A-11D-A37C-09	TCGA-L5-A8NI-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	189b15ae-53a6-40c5-b334-157f0b896a3b	9125397b-fddd-47bb-b4c0-6c9007d878ce	g.chr1:33959192T>G	ENST00000361328.3	+	7	2003	c.1850T>G	c.(1849-1851)tTg>tGg	p.L617W		NM_145238.3	NP_660281	P17040	ZSC20_HUMAN	zinc finger and SCAN domain containing 20	617					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(11)|ovary(2)|pancreas(1)|stomach(1)	31		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.211)				CCTTCAACCTTGTGTCCTAAA	0.517																																																	0													122.0	123.0	123.0					1																	33959192		2012	4176	6188	SO:0001583	missense	0			X52360	CCDS41300.1	1p34.3	2013-01-08	2007-02-20	2007-02-20	ENSG00000121903	ENSG00000121903		"""-"", ""Zinc fingers, C2H2-type"""	13093	protein-coding gene	gene with protein product		611315	"""zinc finger protein 31 (KOX 29)"", ""zinc finger protein 31"""	ZNF360, ZNF31		2288909	Standard	NM_145238		Approved	KOX29	uc001bxj.4	P17040	OTTHUMG00000004173	ENST00000361328.3:c.1850T>G	1.37:g.33959192T>G	ENSP00000355053:p.Leu617Trp		A8K2D0|B1ALI4|B1ALI5|B1ALI6|Q6ZN23|Q96FA9|Q96H84	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Tscrpt_reg_SCAN,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,smart_SANT/Myb,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Tscrpt_reg_SCAN	p.L617W	ENST00000361328.3	37	c.1850	CCDS41300.1	1	.	.	.	.	.	.	.	.	.	.	T	3.218	-0.160150	0.06502	.	.	ENSG00000121903	ENST00000326544;ENST00000361328;ENST00000401072	.	.	.	3.9	-0.731	0.11151	.	0.835651	0.10529	N	0.664015	T	0.26702	0.0653	L	0.50333	1.59	0.09310	N	1	P;P	0.50156	0.932;0.824	B;B	0.40165	0.321;0.219	T	0.18777	-1.0326	9	0.66056	D	0.02	2.9667	3.5939	0.07998	0.0:0.3995:0.1942:0.4063	.	616;617	P17040-3;P17040	.;ZSC20_HUMAN	W	617;551;551	.	ENSP00000324450:L617W	L	+	2	0	ZSCAN20	33731779	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	-0.211000	0.09332	-0.113000	0.11958	-0.408000	0.06270	TTG	ZSCAN20	-	NULL	ENSG00000121903		0.517	ZSCAN20-004	KNOWN	basic|appris_principal|CCDS	protein_coding	ZSCAN20	HGNC	protein_coding	OTTHUMT00000277003.2	-	0.00	21	0	T	NM_145238		33959192	+1	tier1	-	no_errors	ENST00000361328	ensembl	human	known	74_37	missense	22.22	14	4	SNP	0.000	G
