#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name	i_deletion_substructures	i_domain	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_header	i_normal_VAF	i_normal_ref_reads	i_normal_var_reads	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_tier	i_title	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_VAF	i_tumor_ref_reads	i_tumor_var_reads	i_type	i_ucsc_cons	i_variant
ABCA13	154664	genome.wustl.edu	37	7	48287988	48287988	+	Silent	SNP	T	T	C			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr7:48287988T>C	ENST00000435803.1	+	14	1836	c.1812T>C	c.(1810-1812)tcT>tcC	p.S604S		NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13	604					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270						CTGATCCCTCTCCTGAGAATG	0.463																																																	0													145.0	140.0	141.0					7																	48287988		1957	4146	6103	SO:0001819	synonymous_variant	0			AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869		"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807				12697998	Standard	NM_152701		Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.1812T>C	7.37:g.48287988T>C			K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	Silent	SNP	pfam_ABC_transporter-like,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.S604	ENST00000435803.1	37	c.1812	CCDS47584.1	7																																																																																			ABCA13	-	NULL	ENSG00000179869		0.463	ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA13	HGNC	protein_coding	OTTHUMT00000341964.2	-	0.00	36	0	T	NM_152701		48287988	+1	tier1	-	no_errors	ENST00000435803	ensembl	human	known	74_37	silent	25.71	26	9	SNP	0.000	C
ABCG2	9429	genome.wustl.edu	37	4	89015789	89015789	+	Frame_Shift_Del	DEL	A	A	-			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr4:89015789delA	ENST00000237612.3	-	15	2305	c.1760delT	c.(1759-1761)ttgfs	p.L587fs	ABCG2_ENST00000515655.1_Frame_Shift_Del_p.W584fs	NM_004827.2	NP_004818.2	Q9UNQ0	ABCG2_HUMAN	ATP-binding cassette, sub-family G (WHITE), member 2 (Junior blood group)	587	ABC transmembrane type-2.				cellular iron ion homeostasis (GO:0006879)|drug export (GO:0046618)|drug transmembrane transport (GO:0006855)|embryonic process involved in female pregnancy (GO:0060136)|heme transport (GO:0015886)|response to drug (GO:0042493)|response to folic acid (GO:0051593)|response to glucocorticoid (GO:0051384)|response to iron ion (GO:0010039)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)|urate metabolic process (GO:0046415)	apical plasma membrane (GO:0016324)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|heme transporter activity (GO:0015232)|protein homodimerization activity (GO:0042803)|transporter activity (GO:0005215)|xenobiotic-transporting ATPase activity (GO:0008559)			breast(5)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(13)|lung(10)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	42		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;7.02e-05)	Afatinib(DB08916)|Apixaban(DB06605)|Buprenorphine(DB00921)|Cabazitaxel(DB06772)|Carboplatin(DB00958)|Cisplatin(DB00515)|Cladribine(DB00242)|Clofarabine(DB00631)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Dabrafenib(DB08912)|Dactinomycin(DB00970)|Dasatinib(DB01254)|Daunorubicin(DB00694)|Dexamethasone(DB01234)|Diethylstilbestrol(DB00255)|Docetaxel(DB01248)|Doxorubicin(DB00997)|Dronabinol(DB00470)|Erlotinib(DB00530)|Estradiol(DB00783)|Estrone(DB00655)|Etoposide(DB00773)|Ezetimibe(DB00973)|Fluorouracil(DB00544)|Folic Acid(DB00158)|Gefitinib(DB00317)|Glyburide(DB01016)|Hesperetin(DB01094)|Hydrocortisone(DB00741)|Imatinib(DB00619)|Irinotecan(DB00762)|Ivermectin(DB00602)|Lamivudine(DB00709)|Lansoprazole(DB00448)|Leflunomide(DB01097)|Methotrexate(DB00563)|Mitoxantrone(DB01204)|Mycophenolate mofetil(DB00688)|Nelfinavir(DB00220)|Nilotinib(DB04868)|Nitrofurantoin(DB00698)|Novobiocin(DB01051)|Omeprazole(DB00338)|Oxaliplatin(DB00526)|Paclitaxel(DB01229)|Pantoprazole(DB00213)|Pazopanib(DB06589)|Pitavastatin(DB08860)|Ponatinib(DB08901)|Pravastatin(DB00175)|Prazosin(DB00457)|Rabeprazole(DB01129)|Regorafenib(DB08896)|Rilpivirine(DB08864)|Riluzole(DB00740)|Ritonavir(DB00503)|Rosuvastatin(DB01098)|Saquinavir(DB01232)|Sorafenib(DB00398)|Sulfasalazine(DB00795)|Sumatriptan(DB00669)|Sunitinib(DB01268)|Tamoxifen(DB00675)|Telmisartan(DB00966)|Teniposide(DB00444)|Teriflunomide(DB08880)|Testosterone(DB00624)|Topotecan(DB01030)|Vandetanib(DB05294)|Vemurafenib(DB08881)|Venlafaxine(DB00285)|Verapamil(DB00661)|Vincristine(DB00541)|Vismodegib(DB08828)|Zafirlukast(DB00549)|Zidovudine(DB00495)	GTTTTGTCCCAAAAATTCATT	0.378																																																	0													114.0	101.0	106.0					4																	89015789		2203	4300	6503	SO:0001589	frameshift_variant	0			AF103796	CCDS3628.1, CCDS58910.1	4q22.1	2014-08-27	2014-08-27		ENSG00000118777	ENSG00000118777		"""CD molecules"", ""ATP binding cassette transporters / subfamily G"""	74	protein-coding gene	gene with protein product		603756	"""ATP-binding cassette, sub-family G (WHITE), member 2"""			8894702, 9861027	Standard	NM_001257386		Approved	EST157481, MXR, BCRP, ABCP, CD338	uc003hrg.3	Q9UNQ0	OTTHUMG00000130601	ENST00000237612.3:c.1760delT	4.37:g.89015789delA	ENSP00000237612:p.Leu587fs		A0A1W3|A8K1T5|O95374|Q4W5I3|Q53ZQ1|Q569L4|Q5YLG4|Q86V64|Q8IX16|Q96LD6|Q96TA8|Q9BY73|Q9NUS0	Frame_Shift_Del	DEL	pfam_ABC_2_trans,pfam_ABC_transporter-like,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.L587fs	ENST00000237612.3	37	c.1760	CCDS3628.1	4																																																																																			ABCG2	-	NULL	ENSG00000118777		0.378	ABCG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCG2	HGNC	protein_coding	OTTHUMT00000253051.1		0.00	48	0	A	NM_004827		89015789	-1	tier1		no_errors	ENST00000237612	ensembl	human	known	74_37	frame_shift_del	6.45	29	2	DEL	0.991	-
ABHD6	57406	genome.wustl.edu	37	3	58242358	58242358	+	Silent	SNP	G	G	A			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr3:58242358G>A	ENST00000478253.1	+	3	546	c.45G>A	c.(43-45)acG>acA	p.T15T	ABHD6_ENST00000295962.4_Silent_p.T15T			Q9BV23	ABHD6_HUMAN	abhydrolase domain containing 6	15					long term synaptic depression (GO:0060292)|negative regulation of cell migration (GO:0030336)|regulation of endocannabinoid signaling pathway (GO:2000124)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	acylglycerol lipase activity (GO:0047372)			NS(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(5)|ovary(2)|prostate(1)|skin(1)	16				BRCA - Breast invasive adenocarcinoma(55;0.000225)|KIRC - Kidney renal clear cell carcinoma(284;0.0471)|Kidney(284;0.0589)|OV - Ovarian serous cystadenocarcinoma(275;0.209)		CGGGCGGCACGCTGGCCATCC	0.458																																																	0													172.0	163.0	166.0					3																	58242358		2203	4300	6503	SO:0001819	synonymous_variant	0			AF225418	CCDS2887.1	3p21.2	2006-03-10			ENSG00000163686	ENSG00000163686		"""Abhydrolase domain containing"""	21398	protein-coding gene	gene with protein product							Standard	NM_020676		Approved		uc003djs.4	Q9BV23	OTTHUMG00000159150	ENST00000478253.1:c.45G>A	3.37:g.58242358G>A			B2R7Y9|Q6ZMF7	Silent	SNP	pfam_AB_hydrolase_1,pfam_Ndr,prints_AB_hydrolase_1,prints_Epox_hydrolase-like	p.T15	ENST00000478253.1	37	c.45	CCDS2887.1	3																																																																																			ABHD6	-	NULL	ENSG00000163686		0.458	ABHD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABHD6	HGNC	protein_coding	OTTHUMT00000353511.1	-	0.00	83	0	G	NM_020676		58242358	+1	tier1	-	no_errors	ENST00000295962	ensembl	human	known	74_37	silent	43.24	21	16	SNP	0.004	A
ABT1	29777	genome.wustl.edu	37	6	26598649	26598649	+	Missense_Mutation	SNP	G	G	A	rs151288548		TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr6:26598649G>A	ENST00000274849.1	+	3	626	c.595G>A	c.(595-597)Gat>Aat	p.D199N		NM_013375.3	NP_037507.1	Q9ULW3	ABT1_HUMAN	activator of basal transcription 1	199					regulation of transcription from RNA polymerase II promoter (GO:0006357)|spinal cord motor neuron differentiation (GO:0021522)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|transcription coactivator activity (GO:0003713)			breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)|urinary_tract(1)	11						TCTTGCGGCCGATGGGGACCC	0.617																																																	0								G	ASN/ASP	0,4406		0,0,2203	40.0	41.0	41.0		595	4.5	0.9	6	dbSNP_134	41	1,8599	1.2+/-3.3	0,1,4299	no	missense	ABT1	NM_013375.3	23	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign	199/273	26598649	1,13005	2203	4300	6503	SO:0001583	missense	0			AB027258	CCDS4616.1	6p21.31	2008-07-07			ENSG00000146109	ENSG00000146109			17369	protein-coding gene	gene with protein product						10648625	Standard	NM_013375		Approved		uc003nii.3	Q9ULW3	OTTHUMG00000016319	ENST00000274849.1:c.595G>A	6.37:g.26598649G>A	ENSP00000274849:p.Asp199Asn			Missense_Mutation	SNP	NULL	p.D199N	ENST00000274849.1	37	c.595	CCDS4616.1	6	.	.	.	.	.	.	.	.	.	.	G	14.85	2.657094	0.47467	0.0	1.16E-4	ENSG00000146109	ENST00000274849	.	.	.	5.36	4.48	0.54585	.	0.411985	0.28583	N	0.014826	T	0.16854	0.0405	L	0.45581	1.43	0.27926	N	0.93807	P	0.40250	0.709	B	0.31101	0.124	T	0.03662	-1.1015	9	0.45353	T	0.12	-17.5155	12.7258	0.57170	0.0:0.3174:0.6826:0.0	.	199	Q9ULW3	ABT1_HUMAN	N	199	.	ENSP00000274849:D199N	D	+	1	0	ABT1	26706628	0.104000	0.21937	0.906000	0.35671	0.911000	0.54048	1.714000	0.37961	1.374000	0.46228	0.563000	0.77884	GAT	ABT1	-	NULL	ENSG00000146109		0.617	ABT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABT1	HGNC	protein_coding	OTTHUMT00000043698.1		0.00	41	0	G			26598649	+1			no_errors	ENST00000274849	ensembl	human	known	74_37	missense	7.69	24	2	SNP	0.766	A
ACOT11	26027	genome.wustl.edu	37	1	55059688	55059688	+	Silent	SNP	C	C	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr1:55059688C>T	ENST00000371316.3	+	5	529	c.447C>T	c.(445-447)ttC>ttT	p.F149F	ACOT11_ENST00000481208.1_3'UTR|ACOT11_ENST00000343744.2_Silent_p.F149F	NM_015547.3	NP_056362.1	Q8WXI4	ACO11_HUMAN	acyl-CoA thioesterase 11	149	Acyl coenzyme A hydrolase 1.				fatty acid metabolic process (GO:0006631)|intracellular signal transduction (GO:0035556)|response to cold (GO:0009409)|response to temperature stimulus (GO:0009266)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	acyl-CoA hydrolase activity (GO:0047617)|carboxylic ester hydrolase activity (GO:0052689)|lipid binding (GO:0008289)			NS(1)|central_nervous_system(1)|endometrium(6)|large_intestine(3)|lung(5)|ovary(1)	17						TGGCCACCTTCGTGGCCCGCC	0.632																																					Ovarian(148;1440 1861 22015 32453 51933)												0													65.0	64.0	64.0					1																	55059688		2203	4300	6503	SO:0001819	synonymous_variant	0			AB014607	CCDS592.1, CCDS593.1	1p32.3	2011-09-13	2005-09-08	2005-09-08	ENSG00000162390	ENSG00000162390	3.1.2.-	"""Acyl CoA thioesterases"", ""StAR-related lipid transfer (START) domain containing"""	18156	protein-coding gene	gene with protein product	"""StAR-related lipid transfer (START) domain containing 14"""	606803	"""thioesterase, adipose associated"""	THEA		11696000, 16103133, 16940157	Standard	NM_015547		Approved	STARD14, BFIT, KIAA0707, BFIT1, THEM1	uc001cxl.2	Q8WXI4	OTTHUMG00000009891	ENST00000371316.3:c.447C>T	1.37:g.55059688C>T			B1AQ22|D3DQ50|O75187|Q52LP1|Q53ER9|Q96DI1|Q9H883	Silent	SNP	pfam_START_lipid-bd_dom,pfam_Thioestr_supf,smart_START_lipid-bd_dom,pfscan_START_lipid-bd_dom	p.F149	ENST00000371316.3	37	c.447	CCDS592.1	1																																																																																			ACOT11	-	NULL	ENSG00000162390		0.632	ACOT11-001	KNOWN	basic|CCDS	protein_coding	ACOT11	HGNC	protein_coding	OTTHUMT00000027356.1	-	0.00	22	0	C	NM_015547		55059688	+1	tier1	-	no_errors	ENST00000371316	ensembl	human	known	74_37	silent	38.89	11	7	SNP	0.991	T
ACSL3	2181	genome.wustl.edu	37	2	223773522	223773522	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr2:223773522C>T	ENST00000357430.3	+	4	563	c.32C>T	c.(31-33)aCc>aTc	p.T11I	ACSL3_ENST00000392066.3_Missense_Mutation_p.T11I	NM_004457.3	NP_004448.2	O95573	ACSL3_HUMAN	acyl-CoA synthetase long-chain family member 3	11					brain development (GO:0007420)|fatty acid biosynthetic process (GO:0006633)|long-chain fatty acid import (GO:0044539)|positive regulation of Golgi to plasma membrane protein transport (GO:0042998)|positive regulation of phosphatidylcholine biosynthetic process (GO:2001247)|positive regulation of secretion (GO:0051047)|response to nutrient (GO:0007584)|response to organic cyclic compound (GO:0014070)|very-low-density lipoprotein particle assembly (GO:0034379)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lipid particle (GO:0005811)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|perinuclear region of cytoplasm (GO:0048471)|peroxisome (GO:0005777)	ATP binding (GO:0005524)|long-chain fatty acid-CoA ligase activity (GO:0004467)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			cervix(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(5)|ovary(2)|prostate(1)|skin(2)	22		Renal(207;0.0183)		Epithelial(121;1.28e-10)|all cancers(144;8.06e-08)|Lung(261;0.00834)|LUSC - Lung squamous cell carcinoma(224;0.00864)	Icosapent(DB00159)	AAACCATCTACCATGAAGCTA	0.299			T	ETV1	prostate																																			Dom	yes		2	2q36	2181	acyl-CoA synthetase long-chain family member 3		E	0													62.0	70.0	67.0					2																	223773522		2133	4269	6402	SO:0001583	missense	0			D89053	CCDS2455.1	2q34-q35	2008-02-05	2004-02-19	2004-02-20	ENSG00000123983	ENSG00000123983		"""Acyl-CoA synthetase family"""	3570	protein-coding gene	gene with protein product		602371	"""fatty-acid-Coenzyme A ligase, long-chain 3"""	FACL3			Standard	NM_004457		Approved	ACS3, PRO2194	uc002vnj.3	O95573	OTTHUMG00000133160	ENST00000357430.3:c.32C>T	2.37:g.223773522C>T	ENSP00000350012:p.Thr11Ile		Q60I92|Q8IUM9	Missense_Mutation	SNP	pfam_AMP-dep_Synth/Lig	p.T11I	ENST00000357430.3	37	c.32	CCDS2455.1	2	.	.	.	.	.	.	.	.	.	.	C	13.01	2.109050	0.37242	.	.	ENSG00000123983	ENST00000357430;ENST00000392066;ENST00000535678;ENST00000413316	T;T	0.34275	1.37;1.37	5.22	4.34	0.51931	.	0.486738	0.20458	N	0.091956	T	0.29223	0.0727	L	0.43152	1.355	0.30313	N	0.788356	B	0.16396	0.017	B	0.11329	0.006	T	0.21827	-1.0234	10	0.51188	T	0.08	-4.8998	8.1033	0.30870	0.1674:0.7504:0.0:0.0823	.	11	O95573	ACSL3_HUMAN	I	11	ENSP00000350012:T11I;ENSP00000375918:T11I	ENSP00000350012:T11I	T	+	2	0	ACSL3	223481766	0.807000	0.29009	0.984000	0.44739	0.994000	0.84299	0.547000	0.23299	1.427000	0.47276	0.655000	0.94253	ACC	ACSL3	-	NULL	ENSG00000123983		0.299	ACSL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACSL3	HGNC	protein_coding	OTTHUMT00000256862.2	-	0.00	61	0	C	NM_004457		223773522	+1	tier1	-	no_errors	ENST00000357430	ensembl	human	known	74_37	missense	27.59	21	8	SNP	0.981	T
ACTA2	59	genome.wustl.edu	37	10	90708587	90708587	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr10:90708587G>T	ENST00000458208.1	-	2	575	c.101C>A	c.(100-102)cCa>cAa	p.P34Q	STAMBPL1_ENST00000371927.3_Intron|ACTA2_ENST00000224784.6_Missense_Mutation_p.P34Q|ACTA2_ENST00000480297.1_5'UTR	NM_001141945.1	NP_001135417.1	P62736	ACTA_HUMAN	actin, alpha 2, smooth muscle, aorta	34					glomerular mesangial cell development (GO:0072144)|muscle contraction (GO:0006936)|regulation of blood pressure (GO:0008217)|response to virus (GO:0009615)|vascular smooth muscle contraction (GO:0014829)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)|smooth muscle contractile fiber (GO:0030485)	ATP binding (GO:0005524)|protein kinase binding (GO:0019901)			breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(3)|skin(1)|urinary_tract(2)	17		Colorectal(252;0.0161)		Colorectal(12;0.000123)|COAD - Colon adenocarcinoma(12;0.00018)		CACAATGGATGGGAAAACAGC	0.502																																																	0													126.0	119.0	121.0					10																	90708587		2203	4300	6503	SO:0001583	missense	0			X13839	CCDS7392.1	10q23.31	2014-09-17			ENSG00000107796	ENSG00000107796			130	protein-coding gene	gene with protein product		102620				2398629	Standard	NM_001141945		Approved	ACTSA	uc001kfp.3	P62736	OTTHUMG00000018700	ENST00000458208.1:c.101C>A	10.37:g.90708587G>T	ENSP00000402373:p.Pro34Gln		B2R8A4|P03996|P04108|Q6FI19	Missense_Mutation	SNP	pfam_Actin-related,smart_Actin-related,prints_Actin-related	p.P34Q	ENST00000458208.1	37	c.101	CCDS7392.1	10	.	.	.	.	.	.	.	.	.	.	G	20.2	3.946085	0.73672	.	.	ENSG00000107796	ENST00000224784;ENST00000458208;ENST00000415557;ENST00000458159	D;D;D;D	0.97041	-4.22;-4.22;-4.22;-4.22	5.7	5.7	0.88788	.	0.000000	0.64402	D	0.000001	D	0.98950	0.9643	H	0.94264	3.515	0.80722	D	1	D;D	0.89917	1.0;0.99	D;D	0.97110	1.0;0.992	D	0.99548	1.0965	10	0.87932	D	0	.	18.4001	0.90513	0.0:0.0:1.0:0.0	.	34;34	B7Z6I1;P62736	.;ACTA_HUMAN	Q	34	ENSP00000224784:P34Q;ENSP00000402373:P34Q;ENSP00000396730:P34Q;ENSP00000398239:P34Q	ENSP00000224784:P34Q	P	-	2	0	ACTA2	90698567	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.869000	0.99810	2.688000	0.91661	0.650000	0.86243	CCA	ACTA2	-	pfam_Actin-related,smart_Actin-related,prints_Actin-related	ENSG00000107796		0.502	ACTA2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ACTA2	HGNC	protein_coding	OTTHUMT00000049264.1		0.00	55	0	G	NM_001613		90708587	-1			no_errors	ENST00000224784	ensembl	human	known	74_37	missense	5.88	32	2	SNP	1.000	T
ADAM21P1	145241	genome.wustl.edu	37	14	70713884	70713884	+	RNA	SNP	T	T	G			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr14:70713884T>G	ENST00000530196.1	-	0	634					NR_003951.1				ADAM metallopeptidase domain 21 pseudogene 1																		GAATTGTGTCTCATTACTGTT	0.413																																																	0																																												0					14q24.2	2014-03-25	2010-01-12	2010-01-12	ENSG00000235812	ENSG00000235812			19822	pseudogene	pseudogene			"""a disintegrin and metalloproteinase domain 21 pseudogene"", ""ADAM metallopeptidase domain 21 pseudogene"""	ADAM21P			Standard	NR_003951		Approved		uc010ttg.2		OTTHUMG00000166565		14.37:g.70713884T>G				RNA	SNP	-	NULL	ENST00000530196.1	37	NULL		14																																																																																			ADAM21P1	-	-	ENSG00000235812		0.413	ADAM21P1-002	KNOWN	basic	processed_transcript	ADAM21P1	HGNC	pseudogene	OTTHUMT00000390451.1	-	0.00	44	0	T	NG_002467		70713884	-1	tier1	-	no_errors	ENST00000530196	ensembl	human	known	74_37	rna	29.17	17	7	SNP	0.132	G
ADAMTS7	11173	genome.wustl.edu	37	15	79056071	79056071	+	Silent	SNP	G	G	A			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr15:79056071G>A	ENST00000388820.4	-	22	4920	c.4710C>T	c.(4708-4710)tgC>tgT	p.C1570C		NM_014272.3	NP_055087.2	Q9UKP4	ATS7_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 7	1570	TSP type-1 8. {ECO:0000255|PROSITE- ProRule:PRU00210}.				cellular response to BMP stimulus (GO:0071773)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of chondrocyte differentiation (GO:0032331)|proteolysis involved in cellular protein catabolic process (GO:0051603)	cell surface (GO:0009986)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(2)|lung(23)|ovary(1)|prostate(8)|skin(9)	54						CCCACTGCGTGCAGGGGTGGG	0.701																																																	0													9.0	11.0	11.0					15																	79056071		2056	4092	6148	SO:0001819	synonymous_variant	0			AF140675	CCDS32303.1	15q25.1	2012-05-16	2005-08-19		ENSG00000136378	ENSG00000136378		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	223	protein-coding gene	gene with protein product	"""COMPase"", ""a disintegrin and metalloprotease with thrombospondin motifs-7 preproprotein"""	605009	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 7"""			10464288	Standard	NM_014272		Approved	ADAM-TS7, DKFZp434H204	uc002bej.4	Q9UKP4	OTTHUMG00000172907	ENST00000388820.4:c.4710C>T	15.37:g.79056071G>A			Q14F51|Q6P7J9	Silent	SNP	pfam_ADAM_spacer1,pfam_Peptidase_M12B_N,pfam_Thrombospondin_1_rpt,pfam_Peptidase_M12B,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Peptidase_M12B_ADAM-TS	p.C1570	ENST00000388820.4	37	c.4710	CCDS32303.1	15																																																																																			ADAMTS7	-	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	ENSG00000136378		0.701	ADAMTS7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS7	HGNC	protein_coding	OTTHUMT00000421331.1	-	0.00	136	0	G	NM_014272		79056071	-1	tier1	-	no_errors	ENST00000388820	ensembl	human	known	74_37	silent	6.98	80	6	SNP	0.871	A
ADARB2	105	genome.wustl.edu	37	10	1405730	1405730	+	Frame_Shift_Del	DEL	C	C	-	rs372200566		TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr10:1405730delC	ENST00000381312.1	-	3	895	c.570delG	c.(568-570)gtgfs	p.V190fs	RP11-398B16.2_ENST00000432987.1_RNA	NM_018702.3	NP_061172.1	Q9NS39	RED2_HUMAN	adenosine deaminase, RNA-specific, B2 (non-functional)	190	DRBM 1. {ECO:0000255|PROSITE- ProRule:PRU00266}.				mRNA processing (GO:0006397)	nucleus (GO:0005634)	adenosine deaminase activity (GO:0004000)|double-stranded RNA binding (GO:0003725)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|single-stranded RNA binding (GO:0003727)			breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|lung(17)|prostate(2)|skin(1)|urinary_tract(1)	41		all_epithelial(10;0.059)|Colorectal(49;0.0815)		all cancers(11;0.0224)|GBM - Glioblastoma multiforme(2;0.0414)|Epithelial(11;0.165)		TGGGGAACTGCACGAAGGACC	0.697																																																	0													31.0	28.0	29.0					10																	1405730		2201	4299	6500	SO:0001589	frameshift_variant	0			AF034837	CCDS7058.1	10p15.3	2013-05-20	2013-05-20		ENSG00000185736	ENSG00000185736	3.5.-.-		227	protein-coding gene	gene with protein product	"""RED2 homolog (rat)"""	602065	"""adenosine deaminase, RNA-specific, B2 (RED2 homolog rat)"", ""adenosine deaminase, RNA-specific, B2"""			9272162, 10836796	Standard	NM_018702		Approved	RED2, hRED2, ADAR3	uc009xhq.3	Q9NS39	OTTHUMG00000017543	ENST00000381312.1:c.570delG	10.37:g.1405730delC	ENSP00000370713:p.Val190fs		B2RPJ5|Q5VUT6|Q5VW42	Frame_Shift_Del	DEL	pfam_A_deamin,pfam_dsRNA-bd_dom,smart_dsRNA-bd_dom,smart_A_deamin,pfscan_dsRNA-bd_dom,pfscan_A_deamin	p.Q191fs	ENST00000381312.1	37	c.570	CCDS7058.1	10																																																																																			ADARB2	-	pfscan_dsRNA-bd_dom	ENSG00000185736		0.697	ADARB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADARB2	HGNC	protein_coding	OTTHUMT00000046426.1		0.00	15	0	C	NM_018702		1405730	-1	tier1		no_errors	ENST00000381312	ensembl	human	known	74_37	frame_shift_del	33.33	4	2	DEL	0.918	-
AEBP1	165	genome.wustl.edu	37	7	44151566	44151566	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr7:44151566C>A	ENST00000223357.3	+	16	2259	c.1954C>A	c.(1954-1956)Cgt>Agt	p.R652S	MIR4649_ENST00000582839.1_RNA|AEBP1_ENST00000450684.2_Missense_Mutation_p.R227S	NM_001129.3	NP_001120.3	Q8IUX7	AEBP1_HUMAN	AE binding protein 1	652	Interaction with PTEN. {ECO:0000250}.				cell adhesion (GO:0007155)|muscle organ development (GO:0007517)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	carboxypeptidase activity (GO:0004180)|metallocarboxypeptidase activity (GO:0004181)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(13)|upper_aerodigestive_tract(2)	33						TGGGAACCCACGTGTGCGCAG	0.627																																																	0													78.0	68.0	72.0					7																	44151566		2203	4300	6503	SO:0001583	missense	0			D86479	CCDS5476.1	7p	2008-07-18	2001-11-28		ENSG00000106624	ENSG00000106624			303	protein-coding gene	gene with protein product	"""aortic carboxypeptidase-like protein"", ""adipocyte enhancer binding protein 1"""	602981	"""AE-binding protein 1"""			8920928	Standard	NM_001129		Approved	ACLP	uc003tkb.4	Q8IUX7	OTTHUMG00000023362	ENST00000223357.3:c.1954C>A	7.37:g.44151566C>A	ENSP00000223357:p.Arg652Ser		Q14113|Q59ER7|Q6ZSC7|Q7KZ79	Missense_Mutation	SNP	pfam_Peptidase_M14,pfam_Coagulation_fac_5/8-C_type_dom,superfamily_Galactose-bd-like,superfamily_CarboxyPept-like_regulatory,smart_Coagulation_fac_5/8-C_type_dom,smart_Peptidase_M14,pfscan_Coagulation_fac_5/8-C_type_dom,prints_Peptidase_M14	p.R652S	ENST00000223357.3	37	c.1954	CCDS5476.1	7	.	.	.	.	.	.	.	.	.	.	C	18.81	3.703828	0.68501	.	.	ENSG00000106624	ENST00000223357;ENST00000450684	T;T	0.10960	2.82;2.82	5.42	4.52	0.55395	Peptidase M14, carboxypeptidase A (2);	0.056020	0.64402	D	0.000002	T	0.34454	0.0898	M	0.77313	2.365	0.51233	D	0.999914	D;D	0.89917	0.999;1.0	D;D	0.91635	0.996;0.999	T	0.18713	-1.0328	10	0.87932	D	0	-18.6826	14.7318	0.69388	0.1506:0.8494:0.0:0.0	.	227;652	Q8IUX7-2;Q8IUX7	.;AEBP1_HUMAN	S	652;227	ENSP00000223357:R652S;ENSP00000398878:R227S	ENSP00000223357:R652S	R	+	1	0	AEBP1	44118091	0.976000	0.34144	0.346000	0.25655	0.961000	0.63080	2.550000	0.45811	1.221000	0.43506	0.462000	0.41574	CGT	AEBP1	-	pfam_Peptidase_M14,smart_Peptidase_M14	ENSG00000106624		0.627	AEBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AEBP1	HGNC	protein_coding	OTTHUMT00000250993.2		0.00	40	0	C	NM_001129		44151566	+1			no_errors	ENST00000223357	ensembl	human	known	74_37	missense	9.09	20	2	SNP	0.913	A
AFF1	4299	genome.wustl.edu	37	4	88056848	88056848	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr4:88056848C>G	ENST00000307808.6	+	20	4048	c.3628C>G	c.(3628-3630)Cct>Gct	p.P1210A	AFF1_ENST00000395146.4_Missense_Mutation_p.P1218A|AFF1_ENST00000544085.1_Missense_Mutation_p.P849A	NM_005935.2	NP_005926.1	P51825	AFF1_HUMAN	AF4/FMR2 family, member 1	1210					positive regulation of transcription, DNA-templated (GO:0045893)	transcription elongation factor complex (GO:0008023)	sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|large_intestine(2)	3		Acute lymphoblastic leukemia(40;0.0935)|all_hematologic(202;0.111)|Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000233)		AACCAAAACACCTTAATGGAG	0.458																																																	0													56.0	52.0	53.0					4																	88056848		2203	4300	6503	SO:0001583	missense	0			L22179	CCDS3616.1, CCDS54775.1	4q21.3	2009-08-04	2005-06-27	2005-06-27	ENSG00000172493	ENSG00000172493			7135	protein-coding gene	gene with protein product		159557	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 2"", ""pre-B-cell monocytic leukemia partner 1"""	PBM1, MLLT2		7689231, 1423625, 8353274	Standard	NM_005935		Approved	AF-4, AF4	uc011ccz.2	P51825	OTTHUMG00000130603	ENST00000307808.6:c.3628C>G	4.37:g.88056848C>G	ENSP00000305689:p.Pro1210Ala		B4DTU1|E9PBM3	Missense_Mutation	SNP	pfam_TF_AF4/FMR2	p.P1218A	ENST00000307808.6	37	c.3652	CCDS3616.1	4	.	.	.	.	.	.	.	.	.	.	C	11.81	1.751070	0.31046	.	.	ENSG00000172493	ENST00000395146;ENST00000307808;ENST00000544085	T;T;T	0.75821	-0.27;-0.26;-0.97	5.51	4.67	0.58626	.	0.195497	0.36338	N	0.002655	T	0.71409	0.3336	L	0.56769	1.78	0.41115	D	0.985773	P;P;P	0.48407	0.91;0.91;0.91	B;B;B	0.42462	0.388;0.388;0.388	T	0.75900	-0.3154	10	0.87932	D	0	-0.0579	12.2789	0.54753	0.0:0.921:0.0:0.079	.	1218;1211;1210	E9PBM3;Q14C88;P51825	.;.;AFF1_HUMAN	A	1218;1210;849	ENSP00000378578:P1218A;ENSP00000305689:P1210A;ENSP00000440843:P849A	ENSP00000305689:P1210A	P	+	1	0	AFF1	88275872	1.000000	0.71417	0.948000	0.38648	0.157000	0.22087	5.180000	0.65048	1.462000	0.47948	0.655000	0.94253	CCT	AFF1	-	NULL	ENSG00000172493		0.458	AFF1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	AFF1	HGNC	protein_coding	OTTHUMT00000253053.3		0.00	62	0	C	NM_005935		88056848	+1			no_errors	ENST00000395146	ensembl	human	known	74_37	missense	11.43	30	4	SNP	0.996	G
AGBL1	123624	genome.wustl.edu	37	15	87099468	87099468	+	Silent	SNP	G	G	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr15:87099468G>T	ENST00000441037.2	+	21	2966	c.2871G>T	c.(2869-2871)ctG>ctT	p.L957L	AGBL1_ENST00000421325.2_Silent_p.L957L|AGBL1_ENST00000389298.3_Silent_p.L688L	NM_152336.2	NP_689549.2	Q96MI9	CBPC4_HUMAN	ATP/GTP binding protein-like 1	957					C-terminal protein deglutamylation (GO:0035609)|protein side chain deglutamylation (GO:0035610)	cytoplasm (GO:0005737)	metallocarboxypeptidase activity (GO:0004181)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)			NS(3)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|liver(2)|lung(28)|ovary(2)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	62						CACAGAGGCTGTTGGAGAGGA	0.453																																																	0													69.0	70.0	69.0					15																	87099468		1872	4111	5983	SO:0001819	synonymous_variant	0			AK056872	CCDS58398.1	15q25.3	2014-06-23			ENSG00000166748	ENSG00000166748			26504	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase 4"""	615496				21074048, 24094747	Standard	NM_152336		Approved	FLJ32310, CCP4	uc002blz.1	Q96MI9	OTTHUMG00000149978	ENST00000441037.2:c.2871G>T	15.37:g.87099468G>T			A1A4X5|A6NJH6|C9JHL5	Silent	SNP	pfam_Peptidase_M14,superfamily_ARM-type_fold	p.L957	ENST00000441037.2	37	c.2871	CCDS58398.1	15																																																																																			AGBL1	-	NULL	ENSG00000166748		0.453	AGBL1-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	AGBL1	HGNC	protein_coding	OTTHUMT00000314929.5	-	0.00	34	0	G	NM_152336		87099468	+1	tier1	-	no_errors	ENST00000441037	ensembl	human	known	74_37	silent	22.50	31	9	SNP	0.018	T
AGRN	375790	genome.wustl.edu	37	1	981395	981395	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr1:981395G>A	ENST00000379370.2	+	16	2782	c.2732G>A	c.(2731-2733)cGg>cAg	p.R911Q		NM_198576.3	NP_940978.2	O00468	AGRIN_HUMAN	agrin	911					axon guidance (GO:0007411)|carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|clustering of voltage-gated sodium channels (GO:0045162)|extracellular matrix organization (GO:0030198)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|neuromuscular junction development (GO:0007528)|neurotransmitter receptor metabolic process (GO:0045213)|phototransduction, visible light (GO:0007603)|plasma membrane organization (GO:0007009)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of synaptic growth at neuromuscular junction (GO:0045887)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|receptor clustering (GO:0043113)|retinoid metabolic process (GO:0001523)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synapse organization (GO:0050808)	basal lamina (GO:0005605)|cell junction (GO:0030054)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)|synapse (GO:0045202)	acetylcholine receptor regulator activity (GO:0030548)|calcium ion binding (GO:0005509)|chondroitin sulfate binding (GO:0035374)|dystroglycan binding (GO:0002162)|heparan sulfate proteoglycan binding (GO:0043395)|laminin binding (GO:0043236)|sialic acid binding (GO:0033691)|structural constituent of cytoskeleton (GO:0005200)			breast(1)|central_nervous_system(2)|endometrium(8)|kidney(3)|large_intestine(2)|lung(20)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	42	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		UCEC - Uterine corpus endometrioid carcinoma (11;0.00462)|Epithelial(90;5.98e-38)|OV - Ovarian serous cystadenocarcinoma(86;5.43e-23)|Colorectal(212;5.97e-05)|COAD - Colon adenocarcinoma(227;0.000201)|Kidney(185;0.0024)|BRCA - Breast invasive adenocarcinoma(365;0.00246)|STAD - Stomach adenocarcinoma(132;0.00645)|KIRC - Kidney renal clear cell carcinoma(229;0.0354)|Lung(427;0.201)		TTCGGTGCGCGGTGCGTGGAG	0.657																																																	0													143.0	138.0	140.0					1																	981395		2203	4300	6503	SO:0001583	missense	0			XM_372195	CCDS30551.1	1p36.33	2014-09-17		2007-02-16	ENSG00000188157	ENSG00000188157		"""Proteoglycans / Extracellular Matrix : Other"""	329	protein-coding gene	gene with protein product	"""agrin proteoglycan"""	103320				1851019, 12270958	Standard	NM_198576		Approved	AGRIN	uc001ack.2	O00468	OTTHUMG00000040778	ENST00000379370.2:c.2732G>A	1.37:g.981395G>A	ENSP00000368678:p.Arg911Gln		Q5SVA1|Q5SVA2|Q60FE1|Q7KYS8|Q8N4J5|Q96IC1|Q9BTD4	Missense_Mutation	SNP	pfam_Laminin_G,pfam_Agrin_NtA,pfam_Kazal_dom,pfam_EGF_laminin,pfam_SEA_dom,pfam_EG-like_dom,superfamily_TIMP-like_OB-fold,superfamily_ConA-like_lec_gl_sf,smart_FacI_MAC,smart_Fol_N,smart_Kazal_dom,smart_EG-like_dom,smart_EGF_laminin,smart_SEA_dom,smart_EGF-like_Ca-bd_dom,smart_Laminin_G,pfscan_EG-like_dom,pfscan_EGF_laminin,pfscan_Laminin_G,pfscan_Agrin_NtA,pfscan_SEA_dom	p.R911Q	ENST00000379370.2	37	c.2732	CCDS30551.1	1	.	.	.	.	.	.	.	.	.	.	T	8.264	0.811918	0.16537	.	.	ENSG00000188157	ENST00000379370	T	0.74842	-0.88	5.46	3.59	0.41128	Follistatin-like, N-terminal (1);	0.755303	0.10995	N	0.611185	T	0.56337	0.1978	N	0.11789	0.175	0.09310	N	1	B	0.28880	0.226	B	0.28385	0.089	T	0.44651	-0.9314	10	0.33940	T	0.23	-13.6477	9.1735	0.37098	0.0:0.7744:0.1465:0.0791	.	911	O00468	AGRIN_HUMAN	Q	911	ENSP00000368678:R911Q	ENSP00000368678:R911Q	R	+	2	0	AGRN	971258	0.007000	0.16637	0.181000	0.23098	0.004000	0.04260	2.298000	0.43602	0.657000	0.30906	-0.989000	0.02550	CGG	AGRN	-	smart_FacI_MAC,smart_Fol_N,smart_EG-like_dom	ENSG00000188157		0.657	AGRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AGRN	HGNC	protein_coding	OTTHUMT00000097990.2	-	0.00	59	0	G	NM_198576		981395	+1	tier1	-	no_errors	ENST00000379370	ensembl	human	known	74_37	missense	19.51	33	8	SNP	0.350	A
AHDC1	27245	genome.wustl.edu	37	1	27875353	27875355	+	In_Frame_Del	DEL	AGG	AGG	-			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	AGG	AGG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr1:27875353_27875355delAGG	ENST00000247087.5	-	5	3868_3870	c.3272_3274delCCT	c.(3271-3276)tccttc>ttc	p.S1091del	AHDC1_ENST00000374011.2_In_Frame_Del_p.S1091del			Q5TGY3	AHDC1_HUMAN	AT hook, DNA binding motif, containing 1	1091							DNA binding (GO:0003677)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(8)|lung(20)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	42		all_lung(284;1.06e-05)|Lung NSC(340;1.86e-05)|Colorectal(325;3.46e-05)|Renal(390;0.0007)|Breast(348;0.0021)|Ovarian(437;0.00503)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0434)|OV - Ovarian serous cystadenocarcinoma(117;8.48e-25)|Colorectal(126;9.17e-09)|COAD - Colon adenocarcinoma(152;1.84e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00192)|BRCA - Breast invasive adenocarcinoma(304;0.00259)|STAD - Stomach adenocarcinoma(196;0.00311)|READ - Rectum adenocarcinoma(331;0.0291)		GAGGGCTGGAaggaggaggagga	0.665																																																	0																																										SO:0001651	inframe_deletion	0			AK125431	CCDS30652.1	1p36.13	2008-02-05			ENSG00000126705	ENSG00000126705			25230	protein-coding gene	gene with protein product		615790				8619474, 9110174	Standard	XM_005245848		Approved	DJ159A19.3, RP1-159A19.1	uc009vsy.3	Q5TGY3	OTTHUMG00000003398	ENST00000247087.5:c.3272_3274delCCT	1.37:g.27875362_27875364delAGG	ENSP00000247087:p.Ser1091del		Q5TGY4|Q6PJK1|Q6ZUQ6|Q99769|Q9NUF5	In_Frame_Del	DEL	NULL	p.S1091in_frame_del	ENST00000247087.5	37	c.3274_3272	CCDS30652.1	1																																																																																			AHDC1	-	NULL	ENSG00000126705		0.665	AHDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AHDC1	HGNC	protein_coding	OTTHUMT00000009523.3		0.00	30	0	AGG			27875355	-1	tier1		no_errors	ENST00000247087	ensembl	human	known	74_37	in_frame_del	23.08	10	3	DEL	1.000:1.000:1.000	-
AKAP9	10142	genome.wustl.edu	37	7	91625013	91625013	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr7:91625013C>G	ENST00000359028.2	+	8	1090	c.865C>G	c.(865-867)Ctt>Gtt	p.L289V	AKAP9_ENST00000358100.2_Missense_Mutation_p.L289V|AKAP9_ENST00000356239.3_Missense_Mutation_p.L277V|AKAP9_ENST00000394564.1_Missense_Mutation_p.L277V			Q99996	AKAP9_HUMAN	A kinase (PRKA) anchor protein 9	289	Gln-rich.				G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|Sertoli cell development (GO:0060009)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)|synaptic transmission (GO:0007268)|transport (GO:0006810)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|pericentriolar material (GO:0000242)|voltage-gated potassium channel complex (GO:0008076)	ion channel binding (GO:0044325)|protein complex scaffold (GO:0032947)|receptor binding (GO:0005102)			NS(1)|autonomic_ganglia(2)|breast(14)|central_nervous_system(3)|cervix(1)|endometrium(13)|kidney(12)|large_intestine(35)|lung(49)|ovary(8)|prostate(6)|skin(8)|stomach(1)|urinary_tract(2)	155	all_cancers(62;2.46e-09)|all_epithelial(64;4.42e-08)|Breast(17;0.00206)|all_lung(186;0.185)|all_hematologic(106;0.215)|Lung NSC(181;0.249)		STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			TCAACAGCAGCTTGAAGAACA	0.363			T	BRAF	papillary thyroid																																			Dom	yes		7	7q21-q22	10142	A kinase (PRKA) anchor protein (yotiao) 9		E	0													91.0	82.0	85.0					7																	91625013		2203	4300	6503	SO:0001583	missense	0			AF091711	CCDS5622.1	7q21-q22	2014-09-17	2013-09-25		ENSG00000127914	ENSG00000127914		"""A-kinase anchor proteins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	379	protein-coding gene	gene with protein product	"""A-kinase anchoring protein 450"", ""AKAP9-BRAF fusion protein"", ""AKAP120-like protein"", ""centrosome- and golgi-localized protein kinase N-associated protein"", ""protein kinase A anchoring protein 9"", ""A-kinase anchor protein, 350kDa"", ""protein phosphatase 1, regulatory subunit 45"", ""yotiao"""	604001				9482789, 10390370, 24475373	Standard	NM_147185		Approved	KIAA0803, AKAP350, AKAP450, CG-NAP, YOTIAO, HYPERION, PRKA9, MU-RMS-40.16A, PPP1R45, LQT11	uc003ulg.3	Q99996	OTTHUMG00000131127	ENST00000359028.2:c.865C>G	7.37:g.91625013C>G	ENSP00000351922:p.Leu289Val		A4D1F0|A4D1F2|A4D1F4|O14869|O43355|O94895|Q75N20|Q9UQH3|Q9UQQ4|Q9Y6B8|Q9Y6Y2	Missense_Mutation	SNP	pfam_PACT_domain,superfamily_Prefoldin,superfamily_YbaB	p.L289V	ENST00000359028.2	37	c.865		7	.	.	.	.	.	.	.	.	.	.	C	14.28	2.489179	0.44249	.	.	ENSG00000127914	ENST00000356239;ENST00000359028;ENST00000358100;ENST00000413120;ENST00000394565;ENST00000394564;ENST00000438114	T;T;T;T;T	0.16457	2.34;2.34;2.34;2.34;2.34	5.1	4.22	0.49857	.	0.000000	0.30101	N	0.010412	T	0.30510	0.0767	L	0.47716	1.5	0.39048	D	0.960267	P;D;P;P	0.61080	0.698;0.989;0.946;0.884	P;P;P;P	0.59546	0.561;0.859;0.781;0.636	T	0.10019	-1.0648	10	0.66056	D	0.02	.	13.8279	0.63361	0.0:0.9257:0.0:0.0743	.	277;277;289;277	Q99996-2;Q99996-3;A4D1E4;Q6PJH3	.;.;.;.	V	277;289;289;289;289;277;228	ENSP00000348573:L277V;ENSP00000351922:L289V;ENSP00000350813:L289V;ENSP00000378065:L277V;ENSP00000391704:L228V	ENSP00000348573:L277V	L	+	1	0	AKAP9	91462949	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	1.816000	0.38992	1.287000	0.44583	0.655000	0.94253	CTT	AKAP9	-	NULL	ENSG00000127914		0.363	AKAP9-202	KNOWN	basic	protein_coding	AKAP9	HGNC	protein_coding		-	0.00	31	0	C	NM_005751		91625013	+1	tier1	-	no_errors	ENST00000359028	ensembl	human	known	74_37	missense	48.00	13	12	SNP	1.000	G
AKAP9	10142	genome.wustl.edu	37	7	91641760	91641760	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr7:91641760G>C	ENST00000359028.2	+	10	3597	c.3372G>C	c.(3370-3372)caG>caC	p.Q1124H	AKAP9_ENST00000358100.2_Missense_Mutation_p.Q1124H|AKAP9_ENST00000356239.3_Missense_Mutation_p.Q1112H			Q99996	AKAP9_HUMAN	A kinase (PRKA) anchor protein 9	1124					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|Sertoli cell development (GO:0060009)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)|synaptic transmission (GO:0007268)|transport (GO:0006810)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|pericentriolar material (GO:0000242)|voltage-gated potassium channel complex (GO:0008076)	ion channel binding (GO:0044325)|protein complex scaffold (GO:0032947)|receptor binding (GO:0005102)			NS(1)|autonomic_ganglia(2)|breast(14)|central_nervous_system(3)|cervix(1)|endometrium(13)|kidney(12)|large_intestine(35)|lung(49)|ovary(8)|prostate(6)|skin(8)|stomach(1)|urinary_tract(2)	155	all_cancers(62;2.46e-09)|all_epithelial(64;4.42e-08)|Breast(17;0.00206)|all_lung(186;0.185)|all_hematologic(106;0.215)|Lung NSC(181;0.249)		STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			TAAGGCTACAGATGGAAGCCC	0.308			T	BRAF	papillary thyroid																																			Dom	yes		7	7q21-q22	10142	A kinase (PRKA) anchor protein (yotiao) 9		E	0													61.0	63.0	62.0					7																	91641760		2203	4300	6503	SO:0001583	missense	0			AF091711	CCDS5622.1	7q21-q22	2014-09-17	2013-09-25		ENSG00000127914	ENSG00000127914		"""A-kinase anchor proteins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	379	protein-coding gene	gene with protein product	"""A-kinase anchoring protein 450"", ""AKAP9-BRAF fusion protein"", ""AKAP120-like protein"", ""centrosome- and golgi-localized protein kinase N-associated protein"", ""protein kinase A anchoring protein 9"", ""A-kinase anchor protein, 350kDa"", ""protein phosphatase 1, regulatory subunit 45"", ""yotiao"""	604001				9482789, 10390370, 24475373	Standard	NM_147185		Approved	KIAA0803, AKAP350, AKAP450, CG-NAP, YOTIAO, HYPERION, PRKA9, MU-RMS-40.16A, PPP1R45, LQT11	uc003ulg.3	Q99996	OTTHUMG00000131127	ENST00000359028.2:c.3372G>C	7.37:g.91641760G>C	ENSP00000351922:p.Gln1124His		A4D1F0|A4D1F2|A4D1F4|O14869|O43355|O94895|Q75N20|Q9UQH3|Q9UQQ4|Q9Y6B8|Q9Y6Y2	Missense_Mutation	SNP	pfam_PACT_domain,superfamily_Prefoldin,superfamily_YbaB	p.Q1124H	ENST00000359028.2	37	c.3372		7	.	.	.	.	.	.	.	.	.	.	G	12.58	1.981477	0.34942	.	.	ENSG00000127914	ENST00000356239;ENST00000359028;ENST00000358100;ENST00000413120;ENST00000394565	T;T;T	0.03982	3.75;3.75;3.74	5.39	0.542	0.17174	.	0.000000	0.35124	N	0.003430	T	0.07999	0.0200	L	0.56769	1.78	0.34056	D	0.656775	P;P;P;D	0.56521	0.89;0.933;0.933;0.976	B;P;P;P	0.50049	0.425;0.629;0.629;0.629	T	0.21724	-1.0237	10	0.87932	D	0	.	6.0122	0.19582	0.3915:0.0:0.4946:0.114	.	1124;1112;1112;1124	Q99996;Q99996-2;Q99996-3;A4D1E4	AKAP9_HUMAN;.;.;.	H	1112;1124;1124;1124;1124	ENSP00000348573:Q1112H;ENSP00000351922:Q1124H;ENSP00000350813:Q1124H	ENSP00000348573:Q1112H	Q	+	3	2	AKAP9	91479696	1.000000	0.71417	0.994000	0.49952	0.983000	0.72400	1.228000	0.32588	-0.118000	0.11851	-0.812000	0.03155	CAG	AKAP9	-	NULL	ENSG00000127914		0.308	AKAP9-202	KNOWN	basic	protein_coding	AKAP9	HGNC	protein_coding		-	0.00	36	0	G	NM_005751		91641760	+1	tier1	-	no_errors	ENST00000359028	ensembl	human	known	74_37	missense	18.92	30	7	SNP	0.997	C
AKAP9	10142	genome.wustl.edu	37	7	91708688	91708688	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr7:91708688A>G	ENST00000359028.2	+	32	7502	c.7277A>G	c.(7276-7278)aAt>aGt	p.N2426S	AKAP9_ENST00000358100.2_Missense_Mutation_p.N2426S|AKAP9_ENST00000356239.3_Missense_Mutation_p.N2414S			Q99996	AKAP9_HUMAN	A kinase (PRKA) anchor protein 9	2426	Glu-rich.				G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|Sertoli cell development (GO:0060009)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)|synaptic transmission (GO:0007268)|transport (GO:0006810)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|pericentriolar material (GO:0000242)|voltage-gated potassium channel complex (GO:0008076)	ion channel binding (GO:0044325)|protein complex scaffold (GO:0032947)|receptor binding (GO:0005102)			NS(1)|autonomic_ganglia(2)|breast(14)|central_nervous_system(3)|cervix(1)|endometrium(13)|kidney(12)|large_intestine(35)|lung(49)|ovary(8)|prostate(6)|skin(8)|stomach(1)|urinary_tract(2)	155	all_cancers(62;2.46e-09)|all_epithelial(64;4.42e-08)|Breast(17;0.00206)|all_lung(186;0.185)|all_hematologic(106;0.215)|Lung NSC(181;0.249)		STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			TTCATGAAAAATGTACTTAAA	0.353			T	BRAF	papillary thyroid																																			Dom	yes		7	7q21-q22	10142	A kinase (PRKA) anchor protein (yotiao) 9		E	0													43.0	46.0	45.0					7																	91708688		2201	4299	6500	SO:0001583	missense	0			AF091711	CCDS5622.1	7q21-q22	2014-09-17	2013-09-25		ENSG00000127914	ENSG00000127914		"""A-kinase anchor proteins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	379	protein-coding gene	gene with protein product	"""A-kinase anchoring protein 450"", ""AKAP9-BRAF fusion protein"", ""AKAP120-like protein"", ""centrosome- and golgi-localized protein kinase N-associated protein"", ""protein kinase A anchoring protein 9"", ""A-kinase anchor protein, 350kDa"", ""protein phosphatase 1, regulatory subunit 45"", ""yotiao"""	604001				9482789, 10390370, 24475373	Standard	NM_147185		Approved	KIAA0803, AKAP350, AKAP450, CG-NAP, YOTIAO, HYPERION, PRKA9, MU-RMS-40.16A, PPP1R45, LQT11	uc003ulg.3	Q99996	OTTHUMG00000131127	ENST00000359028.2:c.7277A>G	7.37:g.91708688A>G	ENSP00000351922:p.Asn2426Ser		A4D1F0|A4D1F2|A4D1F4|O14869|O43355|O94895|Q75N20|Q9UQH3|Q9UQQ4|Q9Y6B8|Q9Y6Y2	Missense_Mutation	SNP	pfam_PACT_domain,superfamily_Prefoldin,superfamily_YbaB	p.N2426S	ENST00000359028.2	37	c.7277		7	.	.	.	.	.	.	.	.	.	.	A	9.672	1.146995	0.21288	.	.	ENSG00000127914	ENST00000356239;ENST00000359028;ENST00000358100;ENST00000413120;ENST00000394534	T;T;T;T	0.03745	3.9;3.9;3.88;3.82	5.16	1.17	0.20885	.	0.000000	0.39210	N	0.001434	T	0.06005	0.0156	M	0.70595	2.14	0.25618	N	0.98643	B;P;P;B	0.46859	0.041;0.817;0.885;0.023	B;B;P;B	0.48304	0.018;0.369;0.573;0.018	T	0.23940	-1.0174	10	0.11485	T	0.65	.	5.9471	0.19225	0.6111:0.2455:0.1434:0.0	.	2418;2426;2414;2406	Q99996-6;Q99996;Q99996-2;Q99996-3	.;AKAP9_HUMAN;.;.	S	2414;2426;2426;2418;260	ENSP00000348573:N2414S;ENSP00000351922:N2426S;ENSP00000350813:N2426S;ENSP00000378042:N260S	ENSP00000348573:N2414S	N	+	2	0	AKAP9	91546624	1.000000	0.71417	0.984000	0.44739	0.177000	0.22998	2.040000	0.41203	0.375000	0.24679	0.477000	0.44152	AAT	AKAP9	-	NULL	ENSG00000127914		0.353	AKAP9-202	KNOWN	basic	protein_coding	AKAP9	HGNC	protein_coding		-	0.00	25	0	A	NM_005751		91708688	+1	tier1	-	no_errors	ENST00000359028	ensembl	human	known	74_37	missense	20.00	20	5	SNP	0.998	G
ALDH1A1	216	genome.wustl.edu	37	9	75531955	75531955	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr9:75531955C>T	ENST00000297785.3	-	9	970	c.916G>A	c.(916-918)Gca>Aca	p.A306T	ALDH1A1_ENST00000376939.1_3'UTR	NM_000689.4	NP_000680.2	P00352	AL1A1_HUMAN	aldehyde dehydrogenase 1 family, member A1	306					cellular aldehyde metabolic process (GO:0006081)|ethanol oxidation (GO:0006069)|positive regulation of Ras GTPase activity (GO:0032320)|retinol metabolic process (GO:0042572)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	aldehyde dehydrogenase (NAD) activity (GO:0004029)|androgen binding (GO:0005497)|Ras GTPase activator activity (GO:0005099)|retinal dehydrogenase activity (GO:0001758)			breast(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(5)|ovary(3)|prostate(1)	17					Tretinoin(DB00755)|Vitamin A(DB00162)	ATCCTGGATGCGGCTATACAA	0.428																																																	0													108.0	111.0	110.0					9																	75531955		2203	4300	6503	SO:0001583	missense	0			K03000	CCDS6644.1	9q21.13	2010-08-05			ENSG00000165092	ENSG00000165092	1.2.1.36, 1.2.1.3	"""Aldehyde dehydrogenases"""	402	protein-coding gene	gene with protein product	"""retinaldehyde dehydrogenase 1"""	100640		PUMB1, ALDH1		1709013	Standard	NM_000689		Approved	RALDH1	uc004ajd.3	P00352	OTTHUMG00000020019	ENST00000297785.3:c.916G>A	9.37:g.75531955C>T	ENSP00000297785:p.Ala306Thr		O00768|Q5SYR1	Missense_Mutation	SNP	pfam_Aldehyde_DH_dom,pfam_Acyl-CoA_reduct_LuxC,superfamily_Ald_DH/histidinol_DH	p.A306T	ENST00000297785.3	37	c.916	CCDS6644.1	9	.	.	.	.	.	.	.	.	.	.	C	34	5.399559	0.96030	.	.	ENSG00000165092	ENST00000297785;ENST00000428593	T	0.16196	2.36	5.95	5.95	0.96441	Aldehyde dehydrogenase domain (1);Aldehyde dehydrogenase, C-terminal (1);Aldehyde/histidinol dehydrogenase (1);Aldehyde dehydrogenase, conserved site (1);	0.071606	0.56097	D	0.000026	T	0.26231	0.0640	L	0.28776	0.89	0.80722	D	1	D;D	0.54772	0.968;0.967	P;P	0.52823	0.71;0.698	T	0.00290	-1.1843	10	0.62326	D	0.03	.	20.3775	0.98923	0.0:1.0:0.0:0.0	.	227;306	B4DDF8;P00352	.;AL1A1_HUMAN	T	306;320	ENSP00000297785:A306T	ENSP00000297785:A306T	A	-	1	0	ALDH1A1	74721775	1.000000	0.71417	0.987000	0.45799	0.520000	0.34377	5.561000	0.67339	2.825000	0.97269	0.650000	0.86243	GCA	ALDH1A1	-	pfam_Aldehyde_DH_dom,pfam_Acyl-CoA_reduct_LuxC,superfamily_Ald_DH/histidinol_DH	ENSG00000165092		0.428	ALDH1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALDH1A1	HGNC	protein_coding	OTTHUMT00000052679.1	-	0.00	51	0	C			75531955	-1	tier1	-	no_errors	ENST00000297785	ensembl	human	known	74_37	missense	26.67	22	8	SNP	1.000	T
ALDH1L2	160428	genome.wustl.edu	37	12	105440749	105440749	+	Splice_Site	SNP	T	T	G			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr12:105440749T>G	ENST00000258494.9	-	14	1827		c.e14-2		C12orf45_ENST00000548583.1_Intron	NM_001034173.3	NP_001029345.2	Q3SY69	AL1L2_HUMAN	aldehyde dehydrogenase 1 family, member L2						10-formyltetrahydrofolate catabolic process (GO:0009258)|biosynthetic process (GO:0009058)|one-carbon metabolic process (GO:0006730)	extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	formyltetrahydrofolate dehydrogenase activity (GO:0016155)|hydroxymethyl-, formyl- and related transferase activity (GO:0016742)|methyltransferase activity (GO:0008168)|oxidoreductase activity, acting on the aldehyde or oxo group of donors, NAD or NADP as acceptor (GO:0016620)			breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(13)|prostate(2)|skin(3)|stomach(2)	35						AGTAGAACCCTAAAGAATGAG	0.378																																																	0													140.0	138.0	139.0					12																	105440749		2203	4300	6503	SO:0001630	splice_region_variant	0			AK095827	CCDS31891.1	12q23.3	2014-09-11			ENSG00000136010	ENSG00000136010	1.5.1.6	"""Aldehyde dehydrogenases"""	26777	protein-coding gene	gene with protein product	"""mitochondrial 10-formyltetrahydrofolate dehydrogenase"""	613584				20498374	Standard	NM_001034173		Approved	FLJ38508, mtFDH	uc001tlc.3	Q3SY69	OTTHUMG00000169823	ENST00000258494.9:c.1687-2A>C	12.37:g.105440749T>G			Q3SY68|Q68D62|Q6AI55|Q8N922	Splice_Site	SNP	-	e14-2	ENST00000258494.9	37	c.1687-2	CCDS31891.1	12	.	.	.	.	.	.	.	.	.	.	T	18.60	3.658573	0.67586	.	.	ENSG00000136010	ENST00000258494	.	.	.	5.9	5.9	0.94986	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.315	0.82915	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	ALDH1L2	103964879	1.000000	0.71417	0.971000	0.41717	0.615000	0.37417	7.898000	0.87363	2.250000	0.74265	0.533000	0.62120	.	ALDH1L2	-	-	ENSG00000136010		0.378	ALDH1L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALDH1L2	HGNC	protein_coding	OTTHUMT00000406098.1	-	0.00	92	0	T	XM_090294	Intron	105440749	-1	tier1	-	no_errors	ENST00000258494	ensembl	human	known	74_37	splice_site	44.00	14	11	SNP	1.000	G
ANK2	287	genome.wustl.edu	37	4	114209582	114209582	+	Silent	SNP	A	A	G			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr4:114209582A>G	ENST00000357077.4	+	20	2270	c.2217A>G	c.(2215-2217)ggA>ggG	p.G739G	ANK2_ENST00000394537.3_Silent_p.G739G|ANK2_ENST00000506722.1_Silent_p.G718G|ANK2_ENST00000264366.6_Silent_p.G739G	NM_001148.4	NP_001139.3	Q01484	ANK2_HUMAN	ankyrin 2, neuronal	739					atrial cardiac muscle cell action potential (GO:0086014)|atrial cardiac muscle cell to AV node cell communication (GO:0086066)|atrial septum development (GO:0003283)|axon guidance (GO:0007411)|cardiac muscle contraction (GO:0060048)|cellular calcium ion homeostasis (GO:0006874)|cellular protein localization (GO:0034613)|membrane depolarization during SA node cell action potential (GO:0086046)|paranodal junction assembly (GO:0030913)|positive regulation of calcium ion transmembrane transporter activity (GO:1901021)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cation channel activity (GO:2001259)|positive regulation of gene expression (GO:0010628)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein localization to cell surface (GO:0034394)|protein localization to endoplasmic reticulum (GO:0070972)|protein localization to M-band (GO:0036309)|protein localization to organelle (GO:0033365)|protein localization to plasma membrane (GO:0072659)|protein localization to T-tubule (GO:0036371)|protein stabilization (GO:0050821)|protein targeting to plasma membrane (GO:0072661)|regulation of calcium ion transmembrane transporter activity (GO:1901019)|regulation of calcium ion transport (GO:0051924)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to methylmercury (GO:0051597)|SA node cell action potential (GO:0086015)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|T-tubule organization (GO:0033292)|ventricular cardiac muscle cell action potential (GO:0086005)	A band (GO:0031672)|basolateral plasma membrane (GO:0016323)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intracellular (GO:0005622)|M band (GO:0031430)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(54)|liver(2)|lung(112)|ovary(8)|pancreas(1)|prostate(7)|skin(11)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(10)	248		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		GTCACTATGGAAATGTGAAAA	0.323																																																	0													107.0	105.0	105.0					4																	114209582		2203	4300	6503	SO:0001819	synonymous_variant	0			M37123	CCDS3702.1, CCDS43261.1, CCDS54796.1	4q25-q26	2014-09-17	2003-03-12		ENSG00000145362	ENSG00000145362		"""Ankyrin repeat domain containing"""	493	protein-coding gene	gene with protein product		106410	"""long (electrocardiographic) QT syndrome 4"""	LQT4		7485162, 12571597	Standard	NM_001148		Approved		uc003ibe.4	Q01484	OTTHUMG00000132912	ENST00000357077.4:c.2217A>G	4.37:g.114209582A>G			Q01485|Q08AC7|Q08AC8|Q7Z3L5	Silent	SNP	pfam_Ankyrin_rpt,pfam_ZU5,pfam_Death_domain,superfamily_Ankyrin_rpt-contain_dom,superfamily_DEATH-like_dom,smart_Ankyrin_rpt,smart_ZU5,smart_Death_domain,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Death_domain,pfscan_ZU5,prints_Ankyrin_rpt	p.G739	ENST00000357077.4	37	c.2217	CCDS3702.1	4																																																																																			ANK2	-	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000145362		0.323	ANK2-001	KNOWN	basic|CCDS	protein_coding	ANK2	HGNC	protein_coding	OTTHUMT00000256422.2	-	0.00	49	0	A	NM_001148		114209582	+1	tier1	-	no_errors	ENST00000357077	ensembl	human	known	74_37	silent	51.85	13	14	SNP	1.000	G
ANK2	287	genome.wustl.edu	37	4	114279811	114279811	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr4:114279811C>A	ENST00000357077.4	+	38	10090	c.10037C>A	c.(10036-10038)tCc>tAc	p.S3346Y	ANK2_ENST00000394537.3_Intron|ANK2_ENST00000506722.1_Intron|ANK2_ENST00000509550.1_Intron|ANK2_ENST00000510275.2_Intron|ANK2_ENST00000264366.6_Missense_Mutation_p.S3313Y	NM_001148.4	NP_001139.3	Q01484	ANK2_HUMAN	ankyrin 2, neuronal	3346					atrial cardiac muscle cell action potential (GO:0086014)|atrial cardiac muscle cell to AV node cell communication (GO:0086066)|atrial septum development (GO:0003283)|axon guidance (GO:0007411)|cardiac muscle contraction (GO:0060048)|cellular calcium ion homeostasis (GO:0006874)|cellular protein localization (GO:0034613)|membrane depolarization during SA node cell action potential (GO:0086046)|paranodal junction assembly (GO:0030913)|positive regulation of calcium ion transmembrane transporter activity (GO:1901021)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cation channel activity (GO:2001259)|positive regulation of gene expression (GO:0010628)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein localization to cell surface (GO:0034394)|protein localization to endoplasmic reticulum (GO:0070972)|protein localization to M-band (GO:0036309)|protein localization to organelle (GO:0033365)|protein localization to plasma membrane (GO:0072659)|protein localization to T-tubule (GO:0036371)|protein stabilization (GO:0050821)|protein targeting to plasma membrane (GO:0072661)|regulation of calcium ion transmembrane transporter activity (GO:1901019)|regulation of calcium ion transport (GO:0051924)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to methylmercury (GO:0051597)|SA node cell action potential (GO:0086015)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|T-tubule organization (GO:0033292)|ventricular cardiac muscle cell action potential (GO:0086005)	A band (GO:0031672)|basolateral plasma membrane (GO:0016323)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intracellular (GO:0005622)|M band (GO:0031430)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(54)|liver(2)|lung(112)|ovary(8)|pancreas(1)|prostate(7)|skin(11)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(10)	248		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		AAACCAAAGTCCAAACTCCCT	0.478																																																	0													125.0	126.0	126.0					4																	114279811		2203	4300	6503	SO:0001583	missense	0			M37123	CCDS3702.1, CCDS43261.1, CCDS54796.1	4q25-q26	2014-09-17	2003-03-12		ENSG00000145362	ENSG00000145362		"""Ankyrin repeat domain containing"""	493	protein-coding gene	gene with protein product		106410	"""long (electrocardiographic) QT syndrome 4"""	LQT4		7485162, 12571597	Standard	NM_001148		Approved		uc003ibe.4	Q01484	OTTHUMG00000132912	ENST00000357077.4:c.10037C>A	4.37:g.114279811C>A	ENSP00000349588:p.Ser3346Tyr		Q01485|Q08AC7|Q08AC8|Q7Z3L5	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_ZU5,pfam_Death_domain,superfamily_Ankyrin_rpt-contain_dom,superfamily_DEATH-like_dom,smart_Ankyrin_rpt,smart_ZU5,smart_Death_domain,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Death_domain,pfscan_ZU5,prints_Ankyrin_rpt	p.S3346Y	ENST00000357077.4	37	c.10037	CCDS3702.1	4	.	.	.	.	.	.	.	.	.	.	C	17.64	3.439882	0.63067	.	.	ENSG00000145362	ENST00000357077;ENST00000264366;ENST00000505342	T;T;D	0.97772	-1.01;-0.99;-4.53	5.49	5.49	0.81192	.	0.000000	0.53938	D	0.000056	D	0.98429	0.9477	M	0.62723	1.935	0.80722	D	1	D;P	0.89917	1.0;0.867	D;P	0.87578	0.998;0.564	D	0.99041	1.0824	10	0.51188	T	0.08	.	19.3831	0.94545	0.0:1.0:0.0:0.0	.	3313;3346	Q01484;Q01484-4	ANK2_HUMAN;.	Y	3346;3313;356	ENSP00000349588:S3346Y;ENSP00000264366:S3313Y;ENSP00000422498:S356Y	ENSP00000264366:S3313Y	S	+	2	0	ANK2	114499260	1.000000	0.71417	1.000000	0.80357	0.856000	0.48823	5.735000	0.68587	2.572000	0.86782	0.650000	0.86243	TCC	ANK2	-	NULL	ENSG00000145362		0.478	ANK2-001	KNOWN	basic|CCDS	protein_coding	ANK2	HGNC	protein_coding	OTTHUMT00000256422.2	-	0.00	26	0	C	NM_001148		114279811	+1	tier1	-	no_errors	ENST00000357077	ensembl	human	known	74_37	missense	19.23	21	5	SNP	1.000	A
ANKRD12	23253	genome.wustl.edu	37	18	9257391	9257391	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr18:9257391G>A	ENST00000262126.4	+	9	4366	c.4126G>A	c.(4126-4128)Gct>Act	p.A1376T	ANKRD12_ENST00000383440.2_Missense_Mutation_p.A1353T|RP11-888D10.4_ENST00000609701.1_RNA|ANKRD12_ENST00000400020.3_Missense_Mutation_p.A1353T	NM_015208.4	NP_056023.3	Q6UB98	ANR12_HUMAN	ankyrin repeat domain 12	1376						cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|breast(3)|central_nervous_system(2)|endometrium(8)|kidney(2)|large_intestine(20)|lung(18)|ovary(3)|pancreas(1)|prostate(4)|skin(1)|urinary_tract(2)	65						TCCAACTGGAGCTTCAAACAG	0.413																																																	0													85.0	84.0	84.0					18																	9257391		2203	4300	6503	SO:0001583	missense	0			AY373757	CCDS11843.1, CCDS42411.1	18p11.22	2013-01-10			ENSG00000101745	ENSG00000101745		"""Ankyrin repeat domain containing"""	29135	protein-coding gene	gene with protein product		610616				10048485	Standard	NM_001204056		Approved	KIAA0874, FLJ20053, GAC-1	uc002knv.3	Q6UB98	OTTHUMG00000131595	ENST00000262126.4:c.4126G>A	18.37:g.9257391G>A	ENSP00000262126:p.Ala1376Thr		O94951|Q658K1|Q6QMF7|Q9H231|Q9H784	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.A1376T	ENST00000262126.4	37	c.4126	CCDS11843.1	18	.	.	.	.	.	.	.	.	.	.	G	3.267	-0.149862	0.06585	.	.	ENSG00000101745	ENST00000383440;ENST00000262126	T;T	0.66638	-0.22;-0.22	5.75	0.577	0.17385	.	0.516425	0.20343	N	0.094200	T	0.42426	0.1202	N	0.14661	0.345	0.22240	N	0.999263	B;B	0.22683	0.073;0.044	B;B	0.24394	0.053;0.014	T	0.30679	-0.9970	10	0.66056	D	0.02	-5.6506	2.9866	0.05970	0.1268:0.1261:0.4696:0.2775	.	1353;1376	Q6UB98-2;Q6UB98	.;ANR12_HUMAN	T	1353;1376	ENSP00000372932:A1353T;ENSP00000262126:A1376T	ENSP00000262126:A1376T	A	+	1	0	ANKRD12	9247391	0.004000	0.15560	0.532000	0.27989	0.006000	0.05464	-0.574000	0.05868	0.079000	0.16929	-0.262000	0.10625	GCT	ANKRD12	-	NULL	ENSG00000101745		0.413	ANKRD12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ANKRD12	HGNC	protein_coding	OTTHUMT00000254478.2		0.00	25	0	G	NM_015208		9257391	+1			no_errors	ENST00000262126	ensembl	human	known	74_37	missense	10.53	17	2	SNP	0.574	A
ANKRD30A	91074	genome.wustl.edu	37	10	37490164	37490164	+	Splice_Site	SNP	G	G	A			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr10:37490164G>A	ENST00000602533.1	+	31	2711	c.2612G>A	c.(2611-2613)aGt>aAt	p.S871N	ANKRD30A_ENST00000361713.1_Splice_Site_p.S871N|ANKRD30A_ENST00000374660.1_Splice_Site_p.S990N			Q9BXX3	AN30A_HUMAN	ankyrin repeat domain 30A	927					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(8)|endometrium(14)|kidney(21)|large_intestine(13)|lung(70)|ovary(8)|pancreas(1)|prostate(3)|skin(15)|stomach(1)|urinary_tract(3)	158						TTTTAACAGAGTCTCCGTGAG	0.284																																																	0													71.0	66.0	67.0					10																	37490164		1789	4053	5842	SO:0001630	splice_region_variant	0			AF269087	CCDS7193.1	10p11.21	2013-01-10			ENSG00000148513	ENSG00000148513		"""Ankyrin repeat domain containing"""	17234	protein-coding gene	gene with protein product	"""breast cancer antigen NY-BR-1"""	610856				11280766	Standard	NM_052997		Approved	NY-BR-1	uc001iza.1	Q9BXX3	OTTHUMG00000017968	ENST00000602533.1:c.2611-1G>A	10.37:g.37490164G>A			Q5W025	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.S871N	ENST00000602533.1	37	c.2612		10	.	.	.	.	.	.	.	.	.	.	g	0.062	-1.221548	0.01530	.	.	ENSG00000148513	ENST00000361713;ENST00000374660	T;T	0.06371	3.31;3.31	1.38	-0.688	0.11317	.	.	.	.	.	T	0.03564	0.0102	N	0.22421	0.69	0.09310	N	1	B	0.17667	0.023	B	0.10450	0.005	T	0.48281	-0.9049	9	0.15066	T	0.55	.	4.5107	0.11910	0.4061:0.0:0.5939:0.0	.	927	Q9BXX3	AN30A_HUMAN	N	871;990	ENSP00000354432:S871N;ENSP00000363792:S990N	ENSP00000354432:S871N	S	+	2	0	ANKRD30A	37530170	0.771000	0.28555	0.079000	0.20413	0.013000	0.08279	0.132000	0.15891	-0.250000	0.09555	-0.908000	0.02827	AGT	ANKRD30A	-	NULL	ENSG00000148513		0.284	ANKRD30A-001	KNOWN	NMD_exception|basic|appris_principal	protein_coding	ANKRD30A	HGNC	protein_coding	OTTHUMT00000047588.2		0.00	74	0	G	NM_052997	Missense_Mutation	37490164	+1			no_errors	ENST00000361713	ensembl	human	known	74_37	missense	7.14	52	4	SNP	0.093	A
AP3M1	26985	genome.wustl.edu	37	10	75898113	75898113	+	Missense_Mutation	SNP	T	T	A			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr10:75898113T>A	ENST00000355264.4	-	2	336	c.25A>T	c.(25-27)Aac>Tac	p.N9Y	AP3M1_ENST00000372745.1_Missense_Mutation_p.N9Y|AP3M1_ENST00000487653.1_5'UTR	NM_012095.4	NP_036227.1	Q9Y2T2	AP3M1_HUMAN	adaptor-related protein complex 3, mu 1 subunit	9					anterograde axon cargo transport (GO:0008089)|anterograde synaptic vesicle transport (GO:0048490)|protein targeting to lysosome (GO:0006622)	clathrin adaptor complex (GO:0030131)|cytoplasmic vesicle (GO:0031410)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)	Rab GTPase binding (GO:0017137)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(1)|lung(1)|prostate(1)|skin(1)	13	Prostate(51;0.0112)					CCGGAACAGTTTATGAGAAAT	0.348																																																	0													61.0	63.0	62.0					10																	75898113		2203	4300	6503	SO:0001583	missense	0			AF092092	CCDS7342.1	10q22.1-q22.3	2008-07-07			ENSG00000185009	ENSG00000185009			569	protein-coding gene	gene with protein product		610366				10024875	Standard	NM_207012		Approved		uc001jwh.3	Q9Y2T2	OTTHUMG00000018497	ENST00000355264.4:c.25A>T	10.37:g.75898113T>A	ENSP00000347408:p.Asn9Tyr		Q5JQ12|Q9H5L2	Missense_Mutation	SNP	pfam_Clathrin_mu_C,pfam_AP_mu_sigma_su,superfamily_Clathrin_mu_C,superfamily_Longin-like_dom,pirsf_Clathrin_mu,pfscan_Clathrin_mu_C,prints_Clathrin_mu	p.N9Y	ENST00000355264.4	37	c.25	CCDS7342.1	10	.	.	.	.	.	.	.	.	.	.	T	27.0	4.788020	0.90367	.	.	ENSG00000185009	ENST00000355264;ENST00000372745	T;T	0.78924	-1.22;-1.22	5.82	5.82	0.92795	Longin-like (1);AP complex, mu/sigma subunit (1);	0.000000	0.85682	D	0.000000	D	0.90672	0.7074	M	0.92169	3.28	0.80722	D	1	D;D	0.76494	0.999;0.997	D;D	0.73708	0.91;0.981	D	0.92828	0.6278	10	0.87932	D	0	.	16.19	0.81981	0.0:0.0:0.0:1.0	.	9;9	B4DRN6;Q9Y2T2	.;AP3M1_HUMAN	Y	9	ENSP00000347408:N9Y;ENSP00000361831:N9Y	ENSP00000347408:N9Y	N	-	1	0	AP3M1	75568119	1.000000	0.71417	0.998000	0.56505	0.988000	0.76386	7.698000	0.84413	2.225000	0.72522	0.460000	0.39030	AAC	AP3M1	-	pfam_AP_mu_sigma_su,superfamily_Longin-like_dom,pirsf_Clathrin_mu	ENSG00000185009		0.348	AP3M1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AP3M1	HGNC	protein_coding	OTTHUMT00000048747.1	-	0.00	31	0	T			75898113	-1	tier1	-	no_errors	ENST00000355264	ensembl	human	known	74_37	missense	15.00	17	3	SNP	1.000	A
APOH	350	genome.wustl.edu	37	17	64216829	64216829	+	Silent	SNP	C	C	T	rs372207366		TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr17:64216829C>T	ENST00000205948.6	-	5	484	c.447G>A	c.(445-447)acG>acA	p.T149T		NM_000042.2	NP_000033.2	P02749	APOH_HUMAN	apolipoprotein H (beta-2-glycoprotein I)	149	Sushi 3. {ECO:0000255|PROSITE- ProRule:PRU00302}.				blood coagulation, intrinsic pathway (GO:0007597)|negative regulation of angiogenesis (GO:0016525)|negative regulation of blood coagulation (GO:0030195)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibrinolysis (GO:0051918)|negative regulation of myeloid cell apoptotic process (GO:0033033)|negative regulation of smooth muscle cell apoptotic process (GO:0034392)|plasminogen activation (GO:0031639)|positive regulation of blood coagulation (GO:0030194)|positive regulation of lipoprotein lipase activity (GO:0051006)|regulation of fibrinolysis (GO:0051917)|triglyceride metabolic process (GO:0006641)|triglyceride transport (GO:0034197)	cell surface (GO:0009986)|chylomicron (GO:0042627)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|high-density lipoprotein particle (GO:0034364)|very-low-density lipoprotein particle (GO:0034361)	glycoprotein binding (GO:0001948)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|lipid binding (GO:0008289)|lipoprotein lipase activator activity (GO:0060230)|phospholipid binding (GO:0005543)			central_nervous_system(1)|kidney(3)|large_intestine(5)|lung(6)|skin(1)|upper_aerodigestive_tract(1)	17			BRCA - Breast invasive adenocarcinoma(6;9.74e-08)			GTGTTGCAAACGTAGGTATGG	0.393																																					Melanoma(155;624 1882 16869 48804 51309)												0								T		0,4406		0,0,2203	104.0	102.0	103.0		447	-8.9	0.0	17		103	1,8599	819.2+/-406.8	0,1,4299	no	coding-synonymous	APOH	NM_000042.2		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		149/346	64216829	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS11663.1	17q24.2	2013-01-24				ENSG00000091583		"""Apolipoproteins"""	616	protein-coding gene	gene with protein product	"""beta-2-glycoprotein I"""	138700		B2G1		1582254	Standard	NM_000042		Approved	BG	uc002jfn.4	P02749		ENST00000205948.6:c.447G>A	17.37:g.64216829C>T			B2R9M3|Q9UCN7	Silent	SNP	pfam_Sushi_SCR_CCP,pfam_Sushi_2,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	p.T149	ENST00000205948.6	37	c.447	CCDS11663.1	17																																																																																			APOH	-	pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	ENSG00000091583		0.393	APOH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APOH	HGNC	protein_coding	OTTHUMT00000446926.1	-	0.00	24	0	C	NM_000042		64216829	-1	tier1	-	no_errors	ENST00000205948	ensembl	human	known	74_37	silent	30.77	18	8	SNP	0.001	T
AQP1	358	genome.wustl.edu	37	7	30951715	30951715	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr7:30951715C>T	ENST00000311813.4	+	1	246	c.191C>T	c.(190-192)gCg>gTg	p.A64V	AQP1_ENST00000434909.2_Missense_Mutation_p.A124V|AQP1_ENST00000509504.1_Missense_Mutation_p.A241V	NM_198098.2	NP_932766.1	P29972	AQP1_HUMAN	aquaporin 1 (Colton blood group)	64					ammonium transmembrane transport (GO:0072488)|ammonium transport (GO:0015696)|bicarbonate transport (GO:0015701)|camera-type eye morphogenesis (GO:0048593)|carbon dioxide transmembrane transport (GO:0035378)|carbon dioxide transport (GO:0015670)|cation transmembrane transport (GO:0098655)|cell volume homeostasis (GO:0006884)|cellular homeostasis (GO:0019725)|cellular hyperosmotic response (GO:0071474)|cellular response to cAMP (GO:0071320)|cellular response to copper ion (GO:0071280)|cellular response to dexamethasone stimulus (GO:0071549)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to hypoxia (GO:0071456)|cellular response to inorganic substance (GO:0071241)|cellular response to mechanical stimulus (GO:0071260)|cellular response to mercury ion (GO:0071288)|cellular response to nitric oxide (GO:0071732)|cellular response to retinoic acid (GO:0071300)|cellular response to salt stress (GO:0071472)|cellular response to stress (GO:0033554)|cellular response to UV (GO:0034644)|cerebrospinal fluid secretion (GO:0033326)|cGMP biosynthetic process (GO:0006182)|corticotropin secretion (GO:0051458)|establishment or maintenance of actin cytoskeleton polarity (GO:0030950)|glomerular filtration (GO:0003094)|glycerol transport (GO:0015793)|hyperosmotic salinity response (GO:0042538)|lateral ventricle development (GO:0021670)|lipid digestion (GO:0044241)|maintenance of symbiont-containing vacuole by host (GO:0085018)|metanephric descending thin limb development (GO:0072220)|metanephric glomerulus vasculature development (GO:0072239)|metanephric proximal convoluted tubule segment 2 development (GO:0072232)|metanephric proximal straight tubule development (GO:0072230)|multicellular organismal water homeostasis (GO:0050891)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|nitric oxide transport (GO:0030185)|odontogenesis (GO:0042476)|pancreatic juice secretion (GO:0030157)|positive regulation of angiogenesis (GO:0045766)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of lamellipodium assembly (GO:0010592)|positive regulation of saliva secretion (GO:0046878)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|renal water absorption (GO:0070295)|renal water transport (GO:0003097)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|secretory granule organization (GO:0033363)|sensory perception of pain (GO:0019233)|small molecule metabolic process (GO:0044281)|transepithelial water transport (GO:0035377)|transmembrane transport (GO:0055085)|water transport (GO:0006833)|wound healing (GO:0042060)	apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|axon terminus (GO:0043679)|basal plasma membrane (GO:0009925)|basolateral plasma membrane (GO:0016323)|brush border (GO:0005903)|brush border membrane (GO:0031526)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|symbiont-containing vacuole (GO:0020003)	ammonium transmembrane transporter activity (GO:0008519)|carbon dioxide transmembrane transporter activity (GO:0035379)|glycerol transmembrane transporter activity (GO:0015168)|intracellular cGMP activated cation channel activity (GO:0005223)|nitric oxide transmembrane transporter activity (GO:0030184)|potassium channel activity (GO:0005267)|potassium ion transmembrane transporter activity (GO:0015079)|transmembrane transporter activity (GO:0022857)|water channel activity (GO:0015250)|water transmembrane transporter activity (GO:0005372)			kidney(1)|large_intestine(2)|lung(9)	12		Melanoma(862;0.16)			Acetazolamide(DB00819)	GCCACGCTGGCGCAGAGTGTG	0.642																																																	0													43.0	44.0	44.0					7																	30951715		2203	4300	6503	SO:0001583	missense	0			M77829	CCDS5431.1, CCDS55096.1, CCDS55097.1, CCDS55098.1	7p14	2014-07-19	2014-01-02		ENSG00000240583	ENSG00000240583		"""Ion channels / Aquaporins"", ""Blood group antigens"""	633	protein-coding gene	gene with protein product		107776	"""Colton blood group"", ""aquaporin 1 (channel-forming integral protein, 28kDa)"", ""aquaporin 1 (channel-forming integral protein, 28kDa, CO blood group)"", ""aquaporin 1"""	CO		1722319, 3166547	Standard	NM_198098		Approved	CHIP28		P29972	OTTHUMG00000023944	ENST00000311813.4:c.191C>T	7.37:g.30951715C>T	ENSP00000311165:p.Ala64Val		B5BU39|E7EM69|E9PC21|F5GY19|Q8TBI5|Q8TDC1	Missense_Mutation	SNP	pfam_MIP,superfamily_Aquaporin-like,prints_MIP,prints_Aquaporin_1,tigrfam_MIP	p.A124V	ENST00000311813.4	37	c.371	CCDS5431.1	7	.	.	.	.	.	.	.	.	.	.	C	7.588	0.670137	0.14776	.	.	ENSG00000240583;ENSG00000240583;ENSG00000240583;ENSG00000250424	ENST00000434909;ENST00000311813;ENST00000413400;ENST00000509504	D;D;D	0.82711	-1.64;-1.64;-1.64	4.46	4.46	0.54185	Aquaporin-like (2);	0.000000	0.85682	D	0.000000	T	0.82061	0.4955	N	0.21240	0.645	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.961	T	0.75833	-0.3178	10	0.02654	T	1	-2.1271	15.0132	0.71565	0.0:1.0:0.0:0.0	.	124;64	B4E220;P29972	.;AQP1_HUMAN	V	124;64;64;241	ENSP00000395059:A124V;ENSP00000311165:A64V;ENSP00000421315:A241V	ENSP00000311165:A64V	A	+	2	0	RP5-877J2.1;AQP1	30918240	1.000000	0.71417	1.000000	0.80357	0.080000	0.17528	3.905000	0.56333	2.490000	0.84030	0.561000	0.74099	GCG	AQP1	-	pfam_MIP,superfamily_Aquaporin-like,prints_MIP,tigrfam_MIP	ENSG00000240583		0.642	AQP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AQP1	HGNC	protein_coding	OTTHUMT00000215002.3		0.00	24	0	C	NM_000385		30951715	+1			no_errors	ENST00000434909	ensembl	human	known	74_37	missense	9.09	20	2	SNP	1.000	T
ARC	23237	genome.wustl.edu	37	8	143694914	143694914	+	Missense_Mutation	SNP	G	G	T	rs74348901		TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr8:143694914G>T	ENST00000356613.2	-	1	1919	c.719C>A	c.(718-720)tCc>tAc	p.S240Y	ARC_ENST00000581404.1_5'Flank	NM_015193.4	NP_056008.1	O60936	NOL3_HUMAN	activity-regulated cytoskeleton-associated protein	0					apoptotic process (GO:0006915)|mRNA processing (GO:0006397)|negative regulation of apoptotic process (GO:0043066)|regulation of gene expression (GO:0010468)|response to hypoxia (GO:0001666)|response to injury involved in regulation of muscle adaptation (GO:0014876)|RNA splicing (GO:0008380)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|sarcoplasm (GO:0016528)	identical protein binding (GO:0042802)|RNA binding (GO:0003723)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(4)|lung(3)|upper_aerodigestive_tract(1)	13	all_cancers(97;3.55e-12)|all_epithelial(106;1.03e-08)|Lung NSC(106;0.000353)|all_lung(105;0.00092)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)	Acute lymphoblastic leukemia(644;0.0279)				CTGGATCTGGGACAGCCAGTA	0.597																																																	0													33.0	34.0	34.0					8																	143694914		2199	4299	6498	SO:0001583	missense	0			AF193421	CCDS34950.1	8q24.3	2008-08-01			ENSG00000198576	ENSG00000198576			648	protein-coding gene	gene with protein product		612461				10970730, 17466953	Standard	NM_015193		Approved	KIAA0278, Arg3.1	uc003ywn.2	Q7LC44	OTTHUMG00000134310	ENST00000356613.2:c.719C>A	8.37:g.143694914G>T	ENSP00000349022:p.Ser240Tyr		B4DFL0|O60937	Missense_Mutation	SNP	prints_Activity-reg_cytoskelet-assoc	p.S240Y	ENST00000356613.2	37	c.719	CCDS34950.1	8	.	.	.	.	.	.	.	.	.	.	G	21.5	4.153957	0.78114	.	.	ENSG00000198576	ENST00000356613	.	.	.	4.77	4.77	0.60923	.	0.000000	0.56097	U	0.000036	T	0.64659	0.2618	N	0.24115	0.695	0.49483	D	0.999793	D	0.89917	1.0	D	0.87578	0.998	T	0.68746	-0.5327	9	0.54805	T	0.06	.	16.759	0.85507	0.0:0.0:1.0:0.0	.	240	Q7LC44	ARC_HUMAN	Y	240	.	ENSP00000349022:S240Y	S	-	2	0	ARC	143691916	0.770000	0.28543	0.868000	0.34077	0.983000	0.72400	2.894000	0.48640	2.187000	0.69744	0.462000	0.41574	TCC	ARC	-	NULL	ENSG00000198576		0.597	ARC-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	ARC	HGNC	protein_coding	OTTHUMT00000259274.2	-	0.00	58	0	G			143694914	-1	tier1	-	no_errors	ENST00000356613	ensembl	human	known	74_37	missense	17.95	32	7	SNP	1.000	T
ARFGEF2	10564	genome.wustl.edu	37	20	47605928	47605928	+	Silent	SNP	G	G	A	rs368844677		TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr20:47605928G>A	ENST00000371917.4	+	19	2640	c.2640G>A	c.(2638-2640)ccG>ccA	p.P880P		NM_006420.2	NP_006411.2	Q9Y6D5	BIG2_HUMAN	ADP-ribosylation factor guanine nucleotide-exchange factor 2 (brefeldin A-inhibited)	880					endomembrane system organization (GO:0010256)|endosome organization (GO:0007032)|exocytosis (GO:0006887)|Golgi to plasma membrane transport (GO:0006893)|intracellular signal transduction (GO:0035556)|positive regulation of GTPase activity (GO:0043547)|positive regulation of tumor necrosis factor production (GO:0032760)|protein transport (GO:0015031)|receptor recycling (GO:0001881)|regulation of ARF protein signal transduction (GO:0032012)|vesicle-mediated transport (GO:0016192)	asymmetric synapse (GO:0032279)|axonemal microtubule (GO:0005879)|cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|recycling endosome (GO:0055037)|symmetric synapse (GO:0032280)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|GABA receptor binding (GO:0050811)|guanyl-nucleotide exchange factor activity (GO:0005085)|protein kinase A regulatory subunit binding (GO:0034237)			breast(7)|cervix(2)|endometrium(8)|kidney(4)|large_intestine(11)|lung(19)|ovary(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	63			BRCA - Breast invasive adenocarcinoma(12;0.00148)|Colorectal(8;0.198)			CCAAAGCCCCGTTTACCAGTG	0.517																																					Esophageal Squamous(176;1738 1974 26285 33069 35354)												0													89.0	79.0	82.0					20																	47605928		2203	4300	6503	SO:0001819	synonymous_variant	0			AF084521	CCDS13411.1	20q13.13	2010-08-20			ENSG00000124198	ENSG00000124198		"""A-kinase anchor proteins"""	15853	protein-coding gene	gene with protein product	"""Brefeldin A-inhibited guanine nucleotide-exchange protein 2"""	605371				10212200	Standard	NM_006420		Approved	BIG2	uc002xtx.4	Q9Y6D5	OTTHUMG00000032687	ENST00000371917.4:c.2640G>A	20.37:g.47605928G>A			Q5TFT9|Q9NTS1	Silent	SNP	pfam_Sec7_dom,pfam_DUF1981_Sec7_assoc,superfamily_Sec7_dom,superfamily_ARM-type_fold,smart_Sec7_dom,pfscan_Sec7_dom	p.P880	ENST00000371917.4	37	c.2640	CCDS13411.1	20																																																																																			ARFGEF2	-	superfamily_ARM-type_fold	ENSG00000124198		0.517	ARFGEF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARFGEF2	HGNC	protein_coding	OTTHUMT00000079627.1		0.00	25	0	G	NM_006420		47605928	+1			no_errors	ENST00000371917	ensembl	human	known	74_37	silent	9.52	19	2	SNP	0.002	A
ARHGAP31	57514	genome.wustl.edu	37	3	119133256	119133256	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr3:119133256G>T	ENST00000264245.4	+	12	3012	c.2480G>T	c.(2479-2481)aGc>aTc	p.S827I		NM_020754.2	NP_065805.2	Q2M1Z3	RHG31_HUMAN	Rho GTPase activating protein 31	827					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell junction (GO:0030054)|cytosol (GO:0005829)|lamellipodium (GO:0030027)	GTPase activator activity (GO:0005096)			breast(5)|central_nervous_system(1)|cervix(1)|endometrium(10)|kidney(3)|large_intestine(11)|lung(29)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	67						TCCCAAGACAGCCCTGAGATC	0.512																																					Pancreas(7;176 297 5394 51128 51241)												0													50.0	52.0	52.0					3																	119133256		1930	4128	6058	SO:0001583	missense	0				CCDS43135.1	3q13.33	2011-06-29			ENSG00000031081	ENSG00000031081		"""Rho GTPase activating proteins"""	29216	protein-coding gene	gene with protein product		610911				9786927, 12819203, 16519628	Standard	NM_020754		Approved	CDGAP	uc003ecj.4	Q2M1Z3	OTTHUMG00000159362	ENST00000264245.4:c.2480G>T	3.37:g.119133256G>T	ENSP00000264245:p.Ser827Ile		Q9ULL6	Missense_Mutation	SNP	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	p.S827I	ENST00000264245.4	37	c.2480	CCDS43135.1	3	.	.	.	.	.	.	.	.	.	.	G	16.06	3.016873	0.54576	.	.	ENSG00000031081	ENST00000264245;ENST00000543280	T	0.08370	3.1	4.77	1.99	0.26369	.	0.203595	0.36101	N	0.002800	T	0.06690	0.0171	L	0.32530	0.975	0.22457	N	0.999089	P	0.40476	0.718	B	0.40009	0.316	T	0.23833	-1.0177	10	0.87932	D	0	.	5.7474	0.18128	0.173:0.1599:0.667:0.0	.	827	Q2M1Z3	RHG31_HUMAN	I	827	ENSP00000264245:S827I	ENSP00000264245:S827I	S	+	2	0	ARHGAP31	120615946	0.125000	0.22332	0.374000	0.26016	0.028000	0.11728	0.369000	0.20416	0.225000	0.20959	-0.175000	0.13238	AGC	ARHGAP31	-	NULL	ENSG00000031081		0.512	ARHGAP31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGAP31	HGNC	protein_coding	OTTHUMT00000354942.2	-	0.00	33	0	G			119133256	+1	tier1	-	no_errors	ENST00000264245	ensembl	human	known	74_37	missense	30.43	16	7	SNP	0.528	T
ARHGAP42	143872	genome.wustl.edu	37	11	100641136	100641136	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr11:100641136G>T	ENST00000298815.8	+	2	220	c.217G>T	c.(217-219)Ggt>Tgt	p.G73C	ARHGAP42_ENST00000534060.1_3'UTR|ARHGAP42_ENST00000524892.2_Missense_Mutation_p.G73C	NM_152432.2	NP_689645.2	A6NI28	RHG42_HUMAN	Rho GTPase activating protein 42	73	BAR.				signal transduction (GO:0007165)	intracellular (GO:0005622)	GTPase activator activity (GO:0005096)			endometrium(3)|skin(2)	5						TGAATGTATTGGTGATGCTGA	0.318																																																	0													112.0	103.0	106.0					11																	100641136		692	1591	2283	SO:0001583	missense	0					11q22.1	2012-04-19			ENSG00000165895	ENSG00000165895		"""Rho GTPase activating proteins"""	26545	protein-coding gene	gene with protein product		615936				18954304	Standard	NM_152432		Approved	FLJ32810, GRAF3	uc001pge.2	A6NI28	OTTHUMG00000167530	ENST00000298815.8:c.217G>T	11.37:g.100641136G>T	ENSP00000298815:p.Gly73Cys		Q96M56	Missense_Mutation	SNP	pfam_RhoGAP_dom,pfam_SH3_domain,superfamily_Rho_GTPase_activation_prot,superfamily_SH3_domain,smart_Pleckstrin_homology,smart_RhoGAP_dom,smart_SH3_domain,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_RhoGAP_dom	p.G73C	ENST00000298815.8	37	c.217		11	.	.	.	.	.	.	.	.	.	.	G	25.0	4.592476	0.86953	.	.	ENSG00000165895	ENST00000524892;ENST00000298815	T;T	0.53640	0.61;0.61	5.89	5.89	0.94794	IRSp53/MIM homology domain (IMD) (1);	0.000000	0.52532	U	0.000067	T	0.72590	0.3479	M	0.82823	2.61	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.75578	-0.3269	10	0.87932	D	0	.	17.7505	0.88432	0.0:0.0:1.0:0.0	.	73	A6NI28	RHG42_HUMAN	C	73	ENSP00000431776:G73C;ENSP00000298815:G73C	ENSP00000298815:G73C	G	+	1	0	ARHGAP42	100146346	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	8.867000	0.92314	2.793000	0.96121	0.561000	0.74099	GGT	ARHGAP42	-	NULL	ENSG00000165895		0.318	ARHGAP42-201	KNOWN	basic|appris_principal	protein_coding	ARHGAP42	HGNC	protein_coding		-	0.00	45	0	G	NM_152432		100641136	+1	tier1	-	no_errors	ENST00000298815	ensembl	human	known	74_37	missense	12.50	21	3	SNP	1.000	T
ARRDC2	27106	genome.wustl.edu	37	19	18119552	18119552	+	Missense_Mutation	SNP	C	C	T	rs369910146		TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr19:18119552C>T	ENST00000222250.4	+	2	450	c.307C>T	c.(307-309)Cgc>Tgc	p.R103C	ARRDC2_ENST00000379656.3_Missense_Mutation_p.R98C|ARRDC2_ENST00000608009.1_3'UTR	NM_015683.1	NP_056498.1	Q8TBH0	ARRD2_HUMAN	arrestin domain containing 2	103					signal transduction (GO:0007165)	cytoplasmic vesicle (GO:0031410)|plasma membrane (GO:0005886)		p.R98C(1)		endometrium(1)|large_intestine(2)|lung(7)|pancreas(1)|prostate(1)	12						GCCTCCTGGGCGCCATGAGTT	0.627																																																	1	Substitution - Missense(1)	pancreas(1)											65.0	67.0	67.0					19																	18119552		2203	4300	6503	SO:0001583	missense	0				CCDS12370.1, CCDS32956.1	19p13.12	2008-02-05				ENSG00000105643			25225	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_015683		Approved	CLONE24945, PP2703	uc002nhv.3	Q8TBH0		ENST00000222250.4:c.307C>T	19.37:g.18119552C>T	ENSP00000222250:p.Arg103Cys		B2RBG9|O95895|Q6ZRV9|Q8WYG6	Missense_Mutation	SNP	pfam_Arrestin-like_N,pfam_Arrestin_C-like,superfamily_Ig_E-set	p.R103C	ENST00000222250.4	37	c.307	CCDS12370.1	19	.	.	.	.	.	.	.	.	.	.	C	35	5.526736	0.96431	.	.	ENSG00000105643	ENST00000379656;ENST00000222250	T;T	0.14640	2.49;2.49	4.38	1.85	0.25348	Immunoglobulin E-set (1);Arrestin-like, N-terminal (1);	0.156505	0.53938	D	0.000043	T	0.37679	0.1012	M	0.89715	3.055	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	T	0.19811	-1.0294	10	0.62326	D	0.03	-17.3192	6.4101	0.21686	0.4176:0.4468:0.1356:0.0	.	103;98	Q8TBH0;Q8TBH0-2	ARRD2_HUMAN;.	C	98;103	ENSP00000368977:R98C;ENSP00000222250:R103C	ENSP00000222250:R103C	R	+	1	0	ARRDC2	17980552	1.000000	0.71417	0.457000	0.27056	0.982000	0.71751	5.317000	0.65822	0.962000	0.38057	0.561000	0.74099	CGC	ARRDC2	-	pfam_Arrestin-like_N,superfamily_Ig_E-set	ENSG00000105643		0.627	ARRDC2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ARRDC2	HGNC	protein_coding	OTTHUMT00000466845.1	-	0.00	29	0	C	NM_015683		18119552	+1	tier1	-	no_errors	ENST00000222250	ensembl	human	known	74_37	missense	50.00	8	8	SNP	0.989	T
ARSF	416	genome.wustl.edu	37	X	2990157	2990157	+	Silent	SNP	A	A	C			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chrX:2990157A>C	ENST00000381127.1	+	3	323	c.102A>C	c.(100-102)ctA>ctC	p.L34L	ARSF_ENST00000359361.2_Silent_p.L34L|ARSF_ENST00000537104.1_Silent_p.L34L	NM_001201538.1|NM_001201539.1	NP_001188467.1|NP_001188468.1	P54793	ARSF_HUMAN	arylsulfatase F	34					cellular protein metabolic process (GO:0044267)|glycosphingolipid metabolic process (GO:0006687)|post-translational protein modification (GO:0043687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)	arylsulfatase activity (GO:0004065)|metal ion binding (GO:0046872)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(15)|ovary(2)|prostate(3)|skin(3)|urinary_tract(2)	38		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				ATATTGTCCTAATCATGGTTG	0.502																																																	0													227.0	182.0	197.0					X																	2990157		2203	4300	6503	SO:0001819	synonymous_variant	0			X97868	CCDS14123.1	Xp22.3	2013-02-14			ENSG00000062096	ENSG00000062096		"""Arylsulfatase family"""	721	protein-coding gene	gene with protein product		300003				7720070	Standard	NM_004042		Approved		uc022brz.1	P54793	OTTHUMG00000021081	ENST00000381127.1:c.102A>C	X.37:g.2990157A>C			Q8TCC5	Silent	SNP	pfam_Sulfatase,pfam_Phosphodiest/P_Trfase,superfamily_Alkaline_phosphatase_core	p.L34	ENST00000381127.1	37	c.102	CCDS14123.1	X																																																																																			ARSF	-	pfam_Sulfatase,pfam_Phosphodiest/P_Trfase,superfamily_Alkaline_phosphatase_core	ENSG00000062096		0.502	ARSF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARSF	HGNC	protein_coding	OTTHUMT00000055652.1	-	0.00	27	0	A			2990157	+1	tier1	-	no_errors	ENST00000359361	ensembl	human	known	74_37	silent	54.55	5	6	SNP	1.000	C
ASTN1	460	genome.wustl.edu	37	1	177001973	177001973	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr1:177001973C>T	ENST00000367654.3	-	3	695	c.484G>A	c.(484-486)Gct>Act	p.A162T	ASTN1_ENST00000361833.2_Missense_Mutation_p.A162T|ASTN1_ENST00000367657.3_Missense_Mutation_p.A162T|ASTN1_ENST00000281881.3_5'UTR|ASTN1_ENST00000424564.2_Missense_Mutation_p.A162T	NM_004319.1	NP_004310.1	O14525	ASTN1_HUMAN	astrotactin 1	162					locomotory behavior (GO:0007626)|neuron cell-cell adhesion (GO:0007158)|neuron migration (GO:0001764)	endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)				NS(4)|breast(5)|central_nervous_system(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(23)|liver(1)|lung(81)|ovary(6)|prostate(5)|skin(10)|urinary_tract(3)	153						AGCAGCAGAGCGATCATGCCA	0.582																																																	0													50.0	46.0	47.0					1																	177001973		2203	4299	6502	SO:0001583	missense	0			AB006627	CCDS1319.1, CCDS44280.1, CCDS65732.1	1q25.2	2008-02-05	2006-08-24	2006-08-24	ENSG00000152092	ENSG00000152092			773	protein-coding gene	gene with protein product		600904	"""astrotactin"""	ASTN		9070947	Standard	NM_001286164		Approved		uc001glc.3	O14525	OTTHUMG00000035041	ENST00000367654.3:c.484G>A	1.37:g.177001973C>T	ENSP00000356626:p.Ala162Thr		A5PL12|B4DHI9|E9PFR8|O60799|Q5W0V7|Q5W0V8	Missense_Mutation	SNP	superfamily_Fibronectin_type3,smart_EG-like_dom,smart_MACPF,pfscan_Fibronectin_type3	p.A162T	ENST00000367654.3	37	c.484		1	.	.	.	.	.	.	.	.	.	.	C	33	5.213461	0.95069	.	.	ENSG00000152092	ENST00000367657;ENST00000361833;ENST00000367654;ENST00000424564;ENST00000541808	T;T;T;T	0.18338	2.22;2.64;2.64;2.23	5.42	5.42	0.78866	.	0.000000	0.85682	D	0.000000	T	0.35008	0.0917	L	0.36672	1.1	0.80722	D	1	D;D;D	0.89917	1.0;0.999;0.999	D;D;D	0.83275	0.996;0.994;0.994	T	0.05194	-1.0900	10	0.66056	D	0.02	-9.6878	18.8102	0.92054	0.0:1.0:0.0:0.0	.	162;162;162	O14525;O14525-2;B1AJS1	ASTN1_HUMAN;.;.	T	162	ENSP00000356629:A162T;ENSP00000354536:A162T;ENSP00000356626:A162T;ENSP00000395041:A162T	ENSP00000354536:A162T	A	-	1	0	ASTN1	175268596	1.000000	0.71417	0.991000	0.47740	0.996000	0.88848	7.676000	0.84012	2.509000	0.84616	0.655000	0.94253	GCT	ASTN1	-	NULL	ENSG00000152092		0.582	ASTN1-201	KNOWN	basic	protein_coding	ASTN1	HGNC	protein_coding			0.00	27	0	C	NM_004319		177001973	-1			no_errors	ENST00000367654	ensembl	human	known	74_37	missense	18.75	13	3	SNP	1.000	T
ATM	472	genome.wustl.edu	37	11	108150277	108150277	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr11:108150277T>C	ENST00000452508.2	+	24	3533	c.3344T>C	c.(3343-3345)cTt>cCt	p.L1115P	ATM_ENST00000278616.4_Missense_Mutation_p.L1115P			Q13315	ATM_HUMAN	ATM serine/threonine kinase	1115					brain development (GO:0007420)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|DNA damage induced protein phosphorylation (GO:0006975)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|heart development (GO:0007507)|histone mRNA catabolic process (GO:0071044)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|lipoprotein catabolic process (GO:0042159)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of B cell proliferation (GO:0030889)|neuron apoptotic process (GO:0051402)|oocyte development (GO:0048599)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|positive regulation of neuron apoptotic process (GO:0043525)|pre-B cell allelic exclusion (GO:0002331)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reciprocal meiotic recombination (GO:0007131)|replicative senescence (GO:0090399)|response to hypoxia (GO:0001666)|response to ionizing radiation (GO:0010212)|signal transduction (GO:0007165)|signal transduction involved in mitotic G2 DNA damage checkpoint (GO:0072434)|somitogenesis (GO:0001756)|telomere maintenance (GO:0000723)	cytoplasmic vesicle (GO:0031410)|nucleoplasm (GO:0005654)|spindle (GO:0005819)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|histone serine kinase activity (GO:0035174)|protein complex binding (GO:0032403)|protein dimerization activity (GO:0046983)|protein N-terminus binding (GO:0047485)|protein serine/threonine kinase activity (GO:0004674)			NS(4)|breast(23)|central_nervous_system(11)|endometrium(10)|haematopoietic_and_lymphoid_tissue(227)|kidney(19)|large_intestine(53)|liver(5)|lung(62)|ovary(6)|pancreas(4)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	448		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)	Caffeine(DB00201)	CCTTTGAAGCTTCAGCAAACA	0.358			"""D, Mis, N, F, S"""		T-PLL	"""leukemia, lymphoma, medulloblastoma, glioma"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Ataxia Telangiectasia	TSP Lung(14;0.12)																													yes	Rec	yes	Ataxia-telangiectasia	11	11q22.3	472	ataxia telangiectasia mutated		"""L, O"""	0													96.0	91.0	93.0					11																	108150277		2201	4298	6499	SO:0001583	missense	0	Familial Cancer Database	AT, Louis-Bar syndrome	AB209133	CCDS31669.1	11q22-q23	2014-09-17	2014-06-17		ENSG00000149311	ENSG00000149311			795	protein-coding gene	gene with protein product	"""TEL1, telomere maintenance 1, homolog (S. cerevisiae)"""	607585	"""ataxia telangiectasia mutated (includes complementation groups A, C and D)"", ""ataxia telangiectasia mutated"""	ATA, ATDC, ATC, ATD			Standard	XM_005271561		Approved	TEL1, TELO1	uc001pkb.1	Q13315	OTTHUMG00000166480	ENST00000452508.2:c.3344T>C	11.37:g.108150277T>C	ENSP00000388058:p.Leu1115Pro		B2RNX5|O15429|Q12758|Q16551|Q93007|Q9NP02|Q9UCX7	Missense_Mutation	SNP	pfam_PIK-rel_kinase_FAT,pfam_PI3/4_kinase_cat_dom,pfam_TAN,pfam_FATC,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_PI3/4_kinase_cat_dom,pfscan_PIK_FAT,pfscan_FATC,pfscan_PI3/4_kinase_cat_dom	p.L1115P	ENST00000452508.2	37	c.3344	CCDS31669.1	11	.	.	.	.	.	.	.	.	.	.	T	14.05	2.420556	0.42918	.	.	ENSG00000149311	ENST00000527805;ENST00000278616;ENST00000452508	T;T;T	0.73681	-0.77;-0.77;-0.77	5.73	4.58	0.56647	Armadillo-type fold (1);	0.478642	0.23969	N	0.042798	T	0.73583	0.3605	M	0.61703	1.905	0.43555	D	0.995862	P	0.46220	0.874	P	0.44860	0.462	T	0.71126	-0.4683	10	0.33940	T	0.23	.	12.8244	0.57710	0.0:0.0:0.1366:0.8634	.	1115	Q13315	ATM_HUMAN	P	1115	ENSP00000435747:L1115P;ENSP00000278616:L1115P;ENSP00000388058:L1115P	ENSP00000278616:L1115P	L	+	2	0	ATM	107655487	1.000000	0.71417	1.000000	0.80357	0.767000	0.43475	4.403000	0.59729	0.959000	0.37980	0.477000	0.44152	CTT	ATM	-	superfamily_ARM-type_fold	ENSG00000149311		0.358	ATM-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ATM	HGNC	protein_coding	OTTHUMT00000389938.1		0.00	22	0	T	NM_000051		108150277	+1			no_errors	ENST00000278616	ensembl	human	known	74_37	missense	9.09	20	2	SNP	1.000	C
ATP13A1	57130	genome.wustl.edu	37	19	19757091	19757091	+	Silent	SNP	G	G	C			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr19:19757091G>C	ENST00000357324.6	-	23	3197	c.3171C>G	c.(3169-3171)acC>acG	p.T1057T	GMIP_ENST00000445806.2_5'Flank|GMIP_ENST00000203556.4_5'Flank|ATP13A1_ENST00000291503.5_Silent_p.T939T|GMIP_ENST00000587238.1_5'Flank	NM_020410.2	NP_065143.2	Q9HD20	AT131_HUMAN	ATPase type 13A1	1057						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|metal ion binding (GO:0046872)			central_nervous_system(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|liver(2)|lung(7)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	29						GGAGCATGACGGTGAGGATGG	0.607																																					Esophageal Squamous(142;920 1789 9047 14684 24777)												0													205.0	199.0	201.0					19																	19757091		2203	4300	6503	SO:0001819	synonymous_variant	0			AK056420	CCDS32970.2	19p13.11	2010-04-20	2005-01-12	2005-01-12	ENSG00000105726	ENSG00000105726		"""ATPases / P-type"""	24215	protein-coding gene	gene with protein product	"""cation transporting ATPase"""		"""ATPase type 13A"""	ATP13A		11347906	Standard	NM_020410		Approved	KIAA1825, FLJ31858, CGI-152	uc002nnh.4	Q9HD20	OTTHUMG00000153016	ENST00000357324.6:c.3171C>G	19.37:g.19757091G>C			B3KPJ2|B3KTA7|Q6NT90|Q6ZMG7|Q9H6C6	Silent	SNP	pfam_ATPase_P-typ_transduc_dom_A,pfam_HAD-like_dom,superfamily_HAD-like_dom,superfamily_ATPase_P-typ_cyto_domN,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Cation_typ_V,tigrfam_Cation_transp_P_typ_ATPase	p.T1057	ENST00000357324.6	37	c.3171	CCDS32970.2	19																																																																																			ATP13A1	-	tigrfam_ATPase_P-typ_Cation_typ_V	ENSG00000105726		0.607	ATP13A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP13A1	HGNC	protein_coding	OTTHUMT00000329005.1	-	0.00	58	0	G	NM_020410		19757091	-1	tier1	-	no_errors	ENST00000357324	ensembl	human	known	74_37	silent	21.43	22	6	SNP	0.923	C
ATP2A1	487	genome.wustl.edu	37	16	28909674	28909674	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr16:28909674C>T	ENST00000357084.3	+	14	1933	c.1666C>T	c.(1666-1668)Cgg>Tgg	p.R556W	ATP2A1_ENST00000395503.4_Missense_Mutation_p.R556W|ATP2A1_ENST00000536376.1_Missense_Mutation_p.R431W	NM_173201.3	NP_775293.1	O14983	AT2A1_HUMAN	ATPase, Ca++ transporting, cardiac muscle, fast twitch 1	556					apoptotic mitochondrial changes (GO:0008637)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|ion transmembrane transport (GO:0034220)|maintenance of mitochondrion location (GO:0051659)|negative regulation of endoplasmic reticulum calcium ion concentration (GO:0032471)|negative regulation of striated muscle contraction (GO:0045988)|positive regulation of endoplasmic reticulum calcium ion concentration (GO:0032470)|positive regulation of fast-twitch skeletal muscle fiber contraction (GO:0031448)|positive regulation of mitochondrial calcium ion concentration (GO:0051561)|regulation of striated muscle contraction (GO:0006942)|relaxation of skeletal muscle (GO:0090076)|response to endoplasmic reticulum stress (GO:0034976)|transmembrane transport (GO:0055085)	calcium channel complex (GO:0034704)|endoplasmic reticulum membrane (GO:0005789)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|H zone (GO:0031673)|I band (GO:0031674)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|platelet dense tubular network membrane (GO:0031095)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calcium-transporting ATPase activity (GO:0005388)|protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(10)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|urinary_tract(2)	38						GGGCACTGGCCGGGACACCCT	0.637																																																	0													46.0	52.0	50.0					16																	28909674		2197	4300	6497	SO:0001583	missense	0				CCDS10643.1, CCDS42139.1, CCDS66997.1	16p12.1	2012-10-22			ENSG00000196296	ENSG00000196296	3.6.3.8	"""ATPases / P-type"""	811	protein-coding gene	gene with protein product	"""sarcoplasmic/endoplasmic reticulum calcium ATPase 1"", ""calcium pump 1"""	108730		ATP2A			Standard	NM_004320		Approved	SERCA1	uc002dro.1	O14983	OTTHUMG00000131760	ENST00000357084.3:c.1666C>T	16.37:g.28909674C>T	ENSP00000349595:p.Arg556Trp		A8K5J9|B3KY17|O14984	Missense_Mutation	SNP	pfam_ATPase_P-typ_transduc_dom_A,pfam_ATPase_P-typ_cation-transptr_C,pfam_HAD-like_dom,pfam_ATPase_P-typ_cation-transptr_N,superfamily_ATPase_P-typ_cyto_domN,superfamily_HAD-like_dom,smart_ATPase_P-typ_cation-transptr_N,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Ca-transp_IIA,tigrfam_Cation_transp_P_typ_ATPase	p.R556W	ENST00000357084.3	37	c.1666	CCDS10643.1	16	.	.	.	.	.	.	.	.	.	.	C	24.8	4.571104	0.86542	.	.	ENSG00000196296	ENST00000357084;ENST00000395503;ENST00000395498;ENST00000536376	D;D;D	0.83335	-1.71;-1.71;-1.71	5.43	4.47	0.54385	ATPase, cation-transporting, domain N (1);ATPase, P-type, cytoplasmic domain N (1);	0.055698	0.64402	D	0.000001	D	0.90352	0.6981	M	0.91406	3.205	0.52099	D	0.999946	D;P;D	0.63880	0.993;0.936;0.985	P;P;P	0.55749	0.596;0.783;0.676	D	0.91908	0.5537	10	0.87932	D	0	.	12.4065	0.55443	0.3051:0.6949:0.0:0.0	.	431;556;556	B3KY17;O14983;O14983-2	.;AT2A1_HUMAN;.	W	556;556;593;431	ENSP00000349595:R556W;ENSP00000378879:R556W;ENSP00000443101:R431W	ENSP00000349595:R556W	R	+	1	2	ATP2A1	28817175	0.913000	0.31002	1.000000	0.80357	0.996000	0.88848	0.771000	0.26633	1.266000	0.44231	0.655000	0.94253	CGG	ATP2A1	-	superfamily_ATPase_P-typ_cyto_domN,tigrfam_ATPase_P-typ_Ca-transp_IIA	ENSG00000196296		0.637	ATP2A1-001	KNOWN	basic|CCDS	protein_coding	ATP2A1	HGNC	protein_coding	OTTHUMT00000254686.2		0.00	75	0	C	NM_004320		28909674	+1			no_errors	ENST00000357084	ensembl	human	known	74_37	missense	8.70	42	4	SNP	1.000	T
ATP6V0A2	23545	genome.wustl.edu	37	12	124229215	124229215	+	Silent	SNP	C	C	G			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr12:124229215C>G	ENST00000330342.3	+	12	1646	c.1398C>G	c.(1396-1398)ctC>ctG	p.L466L		NM_012463.3	NP_036595.2	Q9Y487	VPP2_HUMAN	ATPase, H+ transporting, lysosomal V0 subunit a2	466					ATP hydrolysis coupled proton transport (GO:0015991)|cellular iron ion homeostasis (GO:0006879)|immune response (GO:0006955)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	acrosomal vesicle (GO:0001669)|cytoplasm (GO:0005737)|endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)|vacuolar proton-transporting V-type ATPase, V0 domain (GO:0000220)	hydrogen ion transmembrane transporter activity (GO:0015078)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|liver(1)|lung(10)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	26	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000224)|Epithelial(86;0.000625)|all cancers(50;0.00775)		ACACTGGCCTCATCTACAACG	0.532																																																	0													143.0	128.0	133.0					12																	124229215		2203	4300	6503	SO:0001819	synonymous_variant	0			AF112972	CCDS9254.1	12q24.31	2010-04-21	2006-01-20		ENSG00000185344	ENSG00000185344		"""ATPases / V-type"""	18481	protein-coding gene	gene with protein product	"""infantile malignant osteopetrosis"""	611716	"""infantile malignant osteopetrosis"", ""ATPase, H+ transporting, lysosomal V0 subunit a isoform 2"", ""ATPase, H+ transporting, lysosomal V0 subunit A2"""			2247090, 18157129	Standard	NM_012463		Approved	TJ6, a2, TJ6s, TJ6M, ATP6a2, J6B7, ATP6N1D, Vph1, Stv1	uc001ufr.3	Q9Y487	OTTHUMG00000168723	ENST00000330342.3:c.1398C>G	12.37:g.124229215C>G			A8K026|Q6NUM0	Silent	SNP	pfam_V-ATPase_116kDa_su	p.L466	ENST00000330342.3	37	c.1398	CCDS9254.1	12																																																																																			ATP6V0A2	-	pfam_V-ATPase_116kDa_su	ENSG00000185344		0.532	ATP6V0A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP6V0A2	HGNC	protein_coding	OTTHUMT00000400765.2		0.00	35	0	C	NM_012463		124229215	+1			no_errors	ENST00000330342	ensembl	human	known	74_37	silent	13.33	13	2	SNP	0.999	G
ATP8B3	148229	genome.wustl.edu	37	19	1802537	1802537	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr19:1802537C>T	ENST00000310127.6	-	11	1250	c.1012G>A	c.(1012-1014)Ggc>Agc	p.G338S	ATP8B3_ENST00000539485.1_Missense_Mutation_p.G338S|ATP8B3_ENST00000525591.1_Missense_Mutation_p.G285S|ATP8B3_ENST00000526092.2_Missense_Mutation_p.G285S	NM_138813.3	NP_620168.1	O60423	AT8B3_HUMAN	ATPase, aminophospholipid transporter, class I, type 8B, member 3	338					binding of sperm to zona pellucida (GO:0007339)	acrosomal vesicle (GO:0001669)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(9)|ovary(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	23		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		ATCCTGCAGCCTCGGAGGAGG	0.567																																																	0													121.0	131.0	128.0					19																	1802537		2122	4239	6361	SO:0001583	missense	0			AA827939	CCDS45901.1, CCDS54196.1	19p13.3	2010-04-28	2010-04-28		ENSG00000130270	ENSG00000130270		"""ATPases / P-type"""	13535	protein-coding gene	gene with protein product	"""aminophospholipid translocase ATP8B3"", ""potential phospholipid-transporting ATPase IK"""	605866	"""ATPase, Class I, type 8B, member 3"", ""ATPase, class I, type 8B, member 3"""			11015572	Standard	NM_138813		Approved	ATPIK	uc002ltw.4	O60423	OTTHUMG00000166189	ENST00000310127.6:c.1012G>A	19.37:g.1802537C>T	ENSP00000311336:p.Gly338Ser		Q7Z485|Q8IVB8|Q8N4Y8|Q96M22	Missense_Mutation	SNP	pfam_ATPase_P-typ_transduc_dom_A,pfam_HAD-like_dom,superfamily_HAD-like_dom,superfamily_ATPase_P-typ_cyto_domN,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Plipid-transp,tigrfam_Cation_transp_P_typ_ATPase	p.G338S	ENST00000310127.6	37	c.1012	CCDS45901.1	19	.	.	.	.	.	.	.	.	.	.	c	26.9	4.783741	0.90282	.	.	ENSG00000130270	ENST00000310127;ENST00000539485;ENST00000525591;ENST00000526092;ENST00000382339	D;D;D;D	0.94280	-3.39;-3.39;-3.39;-3.39	3.72	3.72	0.42706	ATPase, P-type, ATPase-associated domain (1);ATPase,  P-type, cytoplasmic transduction domain A (1);	0.055297	0.64402	N	0.000001	D	0.96904	0.8989	M	0.89163	3.01	0.46901	D	0.999243	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.91635	0.928;0.989;0.999	D	0.97747	1.0212	10	0.87932	D	0	.	14.6992	0.69145	0.0:1.0:0.0:0.0	.	285;338;285	F5H3R9;O60423;Q7Z485	.;AT8B3_HUMAN;.	S	338;338;285;285;285	ENSP00000311336:G338S;ENSP00000443574:G338S;ENSP00000437115:G285S;ENSP00000445204:G285S	ENSP00000311336:G338S	G	-	1	0	ATP8B3	1753537	1.000000	0.71417	0.947000	0.38551	0.834000	0.47266	7.415000	0.80131	1.930000	0.55929	0.450000	0.29827	GGC	ATP8B3	-	pfam_ATPase_P-typ_transduc_dom_A,tigrfam_ATPase_P-typ_Plipid-transp	ENSG00000130270		0.567	ATP8B3-002	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	ATP8B3	HGNC	protein_coding	OTTHUMT00000388279.1	-	0.00	75	0	C	NM_138813		1802537	-1	tier1	-	no_errors	ENST00000539485	ensembl	human	known	74_37	missense	15.79	16	3	SNP	0.998	T
ATR	545	genome.wustl.edu	37	3	142226817	142226817	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr3:142226817T>C	ENST00000350721.4	-	28	5108	c.4987A>G	c.(4987-4989)Aca>Gca	p.T1663A	ATR_ENST00000383101.3_Missense_Mutation_p.T1599A	NM_001184.3	NP_001175.2	Q13535	ATR_HUMAN	ATR serine/threonine kinase	1663	FAT. {ECO:0000255|PROSITE- ProRule:PRU00534}.				cell cycle (GO:0007049)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|cellular response to UV (GO:0034644)|DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|multicellular organismal development (GO:0007275)|negative regulation of DNA replication (GO:0008156)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|protein autophosphorylation (GO:0046777)|regulation of protein binding (GO:0043393)|replicative senescence (GO:0090399)|response to drug (GO:0042493)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)|PML body (GO:0016605)|XY body (GO:0001741)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|MutLalpha complex binding (GO:0032405)|MutSalpha complex binding (GO:0032407)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(10)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(20)|liver(2)|lung(45)|ovary(3)|skin(10)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(4)	122						TTCTTTTCTGTAATAAATGAT	0.358								Other conserved DNA damage response genes																																									0													67.0	68.0	68.0					3																	142226817		2203	4300	6503	SO:0001583	missense	0			U76308	CCDS3124.1	3q23	2014-06-17	2014-06-17		ENSG00000175054	ENSG00000175054			882	protein-coding gene	gene with protein product	"""MEC1, mitosis entry checkpoint 1, homolog (S. cerevisiae)"""	601215	"""ataxia telangiectasia and Rad3 related"""			8978690, 8610130	Standard	NM_001184		Approved	FRP1, SCKL, SCKL1, MEC1	uc003eux.4	Q13535	OTTHUMG00000159234	ENST00000350721.4:c.4987A>G	3.37:g.142226817T>C	ENSP00000343741:p.Thr1663Ala		Q59HB2|Q7KYL3|Q93051|Q9BXK4	Missense_Mutation	SNP	pfam_PI3/4_kinase_cat_dom,pfam_PIK-rel_kinase_FAT,pfam_UME,pfam_FATC,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_UME,smart_PI3/4_kinase_cat_dom,pfscan_PIK_FAT,pfscan_FATC,pfscan_HEAT_type_2,pfscan_PI3/4_kinase_cat_dom	p.T1663A	ENST00000350721.4	37	c.4987	CCDS3124.1	3	.	.	.	.	.	.	.	.	.	.	T	5.306	0.241828	0.10077	.	.	ENSG00000175054	ENST00000350721;ENST00000383101	T;T	0.20738	2.05;2.05	5.42	5.42	0.78866	PIK-related kinase (1);Tetratricopeptide-like helical (1);	0.368951	0.30850	N	0.008741	T	0.14270	0.0345	N	0.20766	0.605	0.30176	N	0.800831	B	0.12630	0.006	B	0.11329	0.006	T	0.09335	-1.0679	10	0.13108	T	0.6	-4.1249	15.4559	0.75314	0.0:0.0:0.0:1.0	.	1663	Q13535	ATR_HUMAN	A	1663;1599	ENSP00000343741:T1663A;ENSP00000372581:T1599A	ENSP00000343741:T1663A	T	-	1	0	ATR	143709507	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.101000	0.41787	2.051000	0.60960	0.482000	0.46254	ACA	ATR	-	pfscan_PIK_FAT	ENSG00000175054		0.358	ATR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATR	HGNC	protein_coding	OTTHUMT00000353995.2	-	0.00	38	0	T	NM_001184		142226817	-1	tier1	-	no_errors	ENST00000350721	ensembl	human	known	74_37	missense	25.00	27	9	SNP	1.000	C
AVL9	23080	genome.wustl.edu	37	7	32584374	32584374	+	Nonsense_Mutation	SNP	C	C	T	rs372188373		TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr7:32584374C>T	ENST00000318709.4	+	3	504	c.283C>T	c.(283-285)Cga>Tga	p.R95*	AVL9_ENST00000409301.1_Nonsense_Mutation_p.R95*|AVL9_ENST00000404479.1_Nonsense_Mutation_p.R95*	NM_015060.1	NP_055875.1	Q8NBF6	AVL9_HUMAN	AVL9 homolog (S. cerevisiase)	95					cell migration (GO:0016477)	integral component of membrane (GO:0016021)|recycling endosome (GO:0055037)				endometrium(3)|kidney(1)|large_intestine(3)|lung(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	18						CTCTTGCTATCGACAAATTGA	0.353																																																	0								C	stop/ARG	0,4406		0,0,2203	98.0	90.0	92.0		283	4.0	1.0	7		92	1,8599	1.2+/-3.3	0,1,4299	no	stop-gained	AVL9	NM_015060.1		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		95/649	32584374	1,13005	2203	4300	6503	SO:0001587	stop_gained	0			D87682	CCDS34613.1	7p14.3	2013-05-01	2008-10-03	2008-10-03	ENSG00000105778	ENSG00000105778			28994	protein-coding gene	gene with protein product		612927	"""KIAA0241"""	KIAA0241		17229886, 22595670	Standard	XM_005249668		Approved		uc003tcv.1	Q8NBF6	OTTHUMG00000152929	ENST00000318709.4:c.283C>T	7.37:g.32584374C>T	ENSP00000315568:p.Arg95*		Q92573	Nonsense_Mutation	SNP	pfam_ABL9/DENND6_dom,pfam_DUF2347	p.R95*	ENST00000318709.4	37	c.283	CCDS34613.1	7	.	.	.	.	.	.	.	.	.	.	C	39	7.423023	0.98275	0.0	1.16E-4	ENSG00000105778	ENST00000318709;ENST00000409301;ENST00000329714;ENST00000404479;ENST00000446718	.	.	.	5.94	3.97	0.46021	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-19.2342	10.3472	0.43913	0.2722:0.6314:0.0964:0.0	.	.	.	.	X	95;95;95;95;26	.	ENSP00000315568:R95X	R	+	1	2	AVL9	32550899	0.995000	0.38212	1.000000	0.80357	0.996000	0.88848	2.261000	0.43276	1.505000	0.48720	0.557000	0.71058	CGA	AVL9	-	pfam_ABL9/DENND6_dom,pfam_DUF2347	ENSG00000105778		0.353	AVL9-003	NOVEL	basic|appris_principal|CCDS	protein_coding	AVL9	HGNC	protein_coding	OTTHUMT00000328643.1	-	0.00	43	0	C	NM_015060		32584374	+1	tier1	-	no_errors	ENST00000404479	ensembl	human	known	74_37	nonsense	21.43	22	6	SNP	1.000	T
AZI2	64343	genome.wustl.edu	37	3	28378343	28378343	+	Nonsense_Mutation	SNP	C	C	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr3:28378343C>T	ENST00000479665.1	-	5	1004	c.473G>A	c.(472-474)tGg>tAg	p.W158*	AZI2_ENST00000457172.1_Nonsense_Mutation_p.W158*|AZI2_ENST00000334100.6_Nonsense_Mutation_p.W158*|AZI2_ENST00000420543.2_Nonsense_Mutation_p.W158*|AZI2_ENST00000295748.3_5'UTR	NM_022461.3	NP_071906.1	Q9H6S1	AZI2_HUMAN	5-azacytidine induced 2	158	Homodimerization. {ECO:0000250}.				dendritic cell differentiation (GO:0097028)|dendritic cell proliferation (GO:0044565)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|interferon-alpha production (GO:0032607)|interferon-gamma production (GO:0032609)|interleukin-6 production (GO:0032635)|mitotic cell cycle (GO:0000278)|T cell activation (GO:0042110)|tumor necrosis factor production (GO:0032640)	cytoplasm (GO:0005737)				cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(5)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	15						TTCCACCTCCCAGTTTGATGA	0.378																																																	0													131.0	119.0	123.0					3																	28378343		2203	4300	6503	SO:0001587	stop_gained	0			AC093142	CCDS2647.1, CCDS46782.1, CCDS46783.1	3p23	2006-03-01			ENSG00000163512	ENSG00000163512			24002	protein-coding gene	gene with protein product		609916				10580148	Standard	NM_001134432		Approved	NAP1, FLJ21939, AZ2	uc003ceb.4	Q9H6S1	OTTHUMG00000130573	ENST00000479665.1:c.473G>A	3.37:g.28378343C>T	ENSP00000419371:p.Trp158*		A8K3M2|C9JB40|H7BXU6|Q86W99|Q9BQF1	Nonsense_Mutation	SNP	NULL	p.W158*	ENST00000479665.1	37	c.473	CCDS2647.1	3	.	.	.	.	.	.	.	.	.	.	C	40	8.076041	0.98640	.	.	ENSG00000163512	ENST00000479665;ENST00000334100;ENST00000420543;ENST00000457172;ENST00000414162	.	.	.	5.92	5.92	0.95590	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-10.243	20.3172	0.98658	0.0:1.0:0.0:0.0	.	.	.	.	X	158	.	ENSP00000335609:W158X	W	-	2	0	AZI2	28353347	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.772000	0.75001	2.801000	0.96364	0.650000	0.86243	TGG	AZI2	-	NULL	ENSG00000163512		0.378	AZI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AZI2	HGNC	protein_coding	OTTHUMT00000252998.2	-	0.00	50	0	C	NM_203326		28378343	-1	tier1	-	no_errors	ENST00000479665	ensembl	human	known	74_37	nonsense	25.00	24	8	SNP	1.000	T
B4GALT1	2683	genome.wustl.edu	37	9	33113814	33113814	+	Frame_Shift_Del	DEL	A	A	-			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr9:33113814delA	ENST00000379731.4	-	5	1208	c.1022delT	c.(1021-1023)atcfs	p.I341fs	B4GALT1_ENST00000535206.1_Intron|B4GALT1_ENST00000541851.1_Frame_Shift_Del_p.I88fs	NM_001497.3	NP_001488.2	P15291	B4GT1_HUMAN	UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 1	341				MI -> PA (in Ref. 6; AAA68220). {ECO:0000305}.	acute inflammatory response (GO:0002526)|angiogenesis involved in wound healing (GO:0060055)|binding of sperm to zona pellucida (GO:0007339)|branching morphogenesis of an epithelial tube (GO:0048754)|carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|development of secondary sexual characteristics (GO:0045136)|epithelial cell development (GO:0002064)|extracellular matrix organization (GO:0030198)|galactose metabolic process (GO:0006012)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|lactose biosynthetic process (GO:0005989)|leukocyte migration (GO:0050900)|mammary gland development (GO:0030879)|multicellular organism reproduction (GO:0032504)|negative regulation of cell proliferation (GO:0008285)|Notch signaling pathway (GO:0007219)|oligosaccharide biosynthetic process (GO:0009312)|penetration of zona pellucida (GO:0007341)|positive regulation of apoptotic process involved in mammary gland involution (GO:0060058)|positive regulation of epithelial cell proliferation involved in wound healing (GO:0060054)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)|regulation of acrosome reaction (GO:0060046)|regulation of cellular component movement (GO:0051270)|single fertilization (GO:0007338)|small molecule metabolic process (GO:0044281)	basolateral plasma membrane (GO:0016323)|brush border membrane (GO:0031526)|desmosome (GO:0030057)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|glycocalyx (GO:0030112)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi trans cisterna (GO:0000138)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	alpha-tubulin binding (GO:0043014)|beta-N-acetylglucosaminylglycopeptide beta-1,4-galactosyltransferase activity (GO:0003831)|beta-tubulin binding (GO:0048487)|galactosyltransferase activity (GO:0008378)|lactose synthase activity (GO:0004461)|manganese ion binding (GO:0030145)|N-acetyllactosamine synthase activity (GO:0003945)|protein homodimerization activity (GO:0042803)|UDP-galactosyltransferase activity (GO:0035250)			endometrium(1)|large_intestine(7)|lung(4)|prostate(1)|skin(1)	14			LUSC - Lung squamous cell carcinoma(29;0.0084)	GBM - Glioblastoma multiforme(74;0.121)	N-Acetyl-D-glucosamine(DB00141)	TGAGTGGCGGATCATGCGACA	0.458																																																	0													120.0	112.0	115.0					9																	33113814		2203	4300	6503	SO:0001589	frameshift_variant	0			X14085	CCDS6535.1	9p13	2013-02-19			ENSG00000086062	ENSG00000086062	2.4.1.22	"""Beta 4-glycosyltransferases"""	924	protein-coding gene	gene with protein product		137060		GGTB2		9597550	Standard	NM_001497		Approved	beta4Gal-T1	uc003zsg.2	P15291	OTTHUMG00000019764	ENST00000379731.4:c.1022delT	9.37:g.33113814delA	ENSP00000369055:p.Ile341fs		B2R710|D3DRL2|Q12909|Q12910|Q12911|Q14456|Q14509|Q14523	Frame_Shift_Del	DEL	pfam_Galactosyl_T_C,prints_Galactosyl_T	p.I341fs	ENST00000379731.4	37	c.1022	CCDS6535.1	9																																																																																			B4GALT1	-	pfam_Galactosyl_T_C	ENSG00000086062		0.458	B4GALT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	B4GALT1	HGNC	protein_coding	OTTHUMT00000052039.1		0.00	50	0	A	NM_001497		33113814	-1	tier1		no_errors	ENST00000379731	ensembl	human	known	74_37	frame_shift_del	14.29	12	2	DEL	1.000	-
BARHL2	343472	genome.wustl.edu	37	1	91182393	91182393	+	Silent	SNP	C	C	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr1:91182393C>T	ENST00000370445.4	-	1	401	c.360G>A	c.(358-360)ccG>ccA	p.P120P		NM_020063.1	NP_064447.1	Q9NY43	BARH2_HUMAN	BarH-like homeobox 2	120	Gln/Pro-rich.				cell fate determination (GO:0001709)|neuron differentiation (GO:0030182)|neuron migration (GO:0001764)|positive regulation of translation (GO:0045727)|regulation of axon extension (GO:0030516)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)			cervix(2)|endometrium(1)|kidney(3)|large_intestine(5)|lung(9)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	24		all_lung(203;0.0263)|Lung SC(238;0.128)		all cancers(265;0.000897)|Epithelial(280;0.00516)|OV - Ovarian serous cystadenocarcinoma(397;0.211)		gcggcggcggcggctgctgtg	0.687																																					GBM(199;3561 4100 22440)												0													3.0	4.0	4.0					1																	91182393		1762	3518	5280	SO:0001819	synonymous_variant	0			AJ251753	CCDS730.1	1p22.2	2011-07-08	2007-07-09		ENSG00000143032	ENSG00000143032		"""Homeoboxes / ANTP class : NKL subclass"""	954	protein-coding gene	gene with protein product		605212	"""BarH (Drosophila)-like 2"""				Standard	NM_020063		Approved		uc001dns.3	Q9NY43	OTTHUMG00000010020	ENST00000370445.4:c.360G>A	1.37:g.91182393C>T			A0AVP2|Q7Z4N7	Silent	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom,prints_Homeobox_metazoa	p.P120	ENST00000370445.4	37	c.360	CCDS730.1	1																																																																																			BARHL2	-	NULL	ENSG00000143032		0.687	BARHL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BARHL2	HGNC	protein_coding	OTTHUMT00000027728.2		0.00	26	0	C			91182393	-1			no_errors	ENST00000370445	ensembl	human	known	74_37	silent	25.00	9	3	SNP	0.906	T
BBS7	55212	genome.wustl.edu	37	4	122766832	122766832	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr4:122766832G>T	ENST00000264499.4	-	11	1240	c.1057C>A	c.(1057-1059)Cag>Aag	p.Q353K	BBS7_ENST00000506636.1_Missense_Mutation_p.Q353K	NM_176824.2	NP_789794.1	Q8IWZ6	BBS7_HUMAN	Bardet-Biedl syndrome 7	353					brain development (GO:0007420)|cilium morphogenesis (GO:0060271)|determination of left/right symmetry (GO:0007368)|digestive tract morphogenesis (GO:0048546)|eye development (GO:0001654)|fat cell differentiation (GO:0045444)|heart looping (GO:0001947)|limb development (GO:0060173)|melanosome transport (GO:0032402)|nonmotile primary cilium assembly (GO:0035058)|palate development (GO:0060021)|pigment granule aggregation in cell center (GO:0051877)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|protein transport (GO:0015031)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|smoothened signaling pathway (GO:0007224)|visual perception (GO:0007601)	axoneme (GO:0005930)|BBSome (GO:0034464)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	RNA polymerase II repressing transcription factor binding (GO:0001103)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(11)|ovary(2)|prostate(1)|skin(2)	30						ACCTTATACTGCAAATGTTCC	0.318									Bardet-Biedl syndrome																																								0													112.0	108.0	109.0					4																	122766832		2203	4297	6500	SO:0001583	missense	0	Familial Cancer Database	BBS, Bardet-Biedl syndrome, type 1-12: BBS1-12,Laurence-Moon-Biedl syndrome	AF521644	CCDS3724.1, CCDS54799.1	4q27	2013-01-08			ENSG00000138686	ENSG00000138686			18758	protein-coding gene	gene with protein product		607590					Standard	NM_176824		Approved	FLJ10715, BBS2L1	uc003ied.3	Q8IWZ6	OTTHUMG00000133076	ENST00000264499.4:c.1057C>A	4.37:g.122766832G>T	ENSP00000264499:p.Gln353Lys		Q4W5P8|Q8N581|Q9NVI4	Missense_Mutation	SNP	superfamily_WD40_repeat_dom,pirsf_Bardet-Biedl_syndrome_7_prot	p.Q353K	ENST00000264499.4	37	c.1057	CCDS3724.1	4	.	.	.	.	.	.	.	.	.	.	G	18.14	3.556568	0.65425	.	.	ENSG00000138686	ENST00000264499;ENST00000506636	T;T	0.75477	-0.94;-0.94	5.69	5.69	0.88448	WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.71082	0.3298	L	0.46670	1.46	0.80722	D	1	B	0.12013	0.005	B	0.15870	0.014	T	0.64198	-0.6464	10	0.35671	T	0.21	-6.2521	19.8113	0.96547	0.0:0.0:1.0:0.0	.	353	Q8IWZ6	BBS7_HUMAN	K	353	ENSP00000264499:Q353K;ENSP00000423626:Q353K	ENSP00000264499:Q353K	Q	-	1	0	BBS7	122986282	1.000000	0.71417	0.987000	0.45799	0.902000	0.53008	8.775000	0.91772	2.690000	0.91761	0.655000	0.94253	CAG	BBS7	-	superfamily_WD40_repeat_dom,pirsf_Bardet-Biedl_syndrome_7_prot	ENSG00000138686		0.318	BBS7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BBS7	HGNC	protein_coding	OTTHUMT00000256716.1		0.00	44	0	G			122766832	-1			no_errors	ENST00000264499	ensembl	human	known	74_37	missense	14.81	23	4	SNP	1.000	T
BBS9	27241	genome.wustl.edu	37	7	33195308	33195308	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr7:33195308G>T	ENST00000242067.6	+	4	843	c.322G>T	c.(322-324)Gtc>Ttc	p.V108F	BBS9_ENST00000350941.3_Missense_Mutation_p.V108F|BBS9_ENST00000354265.4_Missense_Mutation_p.V108F|BBS9_ENST00000425508.2_Missense_Mutation_p.V63F|BBS9_ENST00000396127.2_Missense_Mutation_p.V108F|BBS9_ENST00000355070.2_Missense_Mutation_p.V108F	NM_198428.2	NP_940820.1	Q3SYG4	PTHB1_HUMAN	Bardet-Biedl syndrome 9	108					cilium assembly (GO:0042384)|fat cell differentiation (GO:0045444)|protein transport (GO:0015031)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	BBSome (GO:0034464)|cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)		p.V108F(2)	BBS9/PKD1L1(2)	NS(1)|autonomic_ganglia(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(27)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	50			GBM - Glioblastoma multiforme(11;0.0894)			TGTCTACTCTGTCTCAGGTAA	0.318									Bardet-Biedl syndrome																																								2	Substitution - Missense(2)	lung(2)											71.0	70.0	70.0					7																	33195308		2201	4297	6498	SO:0001583	missense	0	Familial Cancer Database	BBS, Bardet-Biedl syndrome, type 1-12: BBS1-12,Laurence-Moon-Biedl syndrome		CCDS5441.1, CCDS34618.1, CCDS43566.1, CCDS47572.1	7p14	2014-06-17			ENSG00000122507	ENSG00000122507			30000	protein-coding gene	gene with protein product	"""parathyroid hormone responsive B1 gene"""	607968				16380913, 10221542	Standard	XM_005249701		Approved	B1, PTHB1	uc003tdn.1	Q3SYG4	OTTHUMG00000128659	ENST00000242067.6:c.322G>T	7.37:g.33195308G>T	ENSP00000242067:p.Val108Phe		E9PDC9|P78514|Q7KYS6|Q7KYS7|Q8N570|Q99844|Q99854|Q9Y699|Q9Y6A0	Missense_Mutation	SNP	NULL	p.V108F	ENST00000242067.6	37	c.322	CCDS43566.1	7	.	.	.	.	.	.	.	.	.	.	G	22.0	4.226045	0.79576	.	.	ENSG00000122507	ENST00000242067;ENST00000350941;ENST00000396127;ENST00000355070;ENST00000354265;ENST00000396132;ENST00000396125;ENST00000425508	D;D;D;D;D;D	0.85411	-1.98;-1.98;-1.98;-1.98;-1.98;-1.98	4.95	4.95	0.65309	.	0.121927	0.53938	D	0.000043	D	0.91723	0.7383	M	0.72118	2.19	0.50313	D	0.999867	D;D;D;D;D	0.76494	0.999;0.999;0.999;0.999;0.999	D;D;D;D;D	0.80764	0.962;0.989;0.994;0.989;0.989	D	0.91134	0.4940	9	.	.	.	-14.82	18.6673	0.91495	0.0:0.0:1.0:0.0	.	108;108;108;108;108	B3KQ86;Q3SYG4-2;E9PDC9;Q3SYG4-4;Q3SYG4	.;.;.;.;PTHB1_HUMAN	F	108;108;108;108;108;108;108;63	ENSP00000242067:V108F;ENSP00000313122:V108F;ENSP00000379433:V108F;ENSP00000347182:V108F;ENSP00000346214:V108F;ENSP00000405151:V63F	.	V	+	1	0	BBS9	33161833	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.678000	0.46900	2.682000	0.91365	0.557000	0.71058	GTC	BBS9	-	NULL	ENSG00000122507		0.318	BBS9-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BBS9	HGNC	protein_coding	OTTHUMT00000329064.1		0.00	38	0	G			33195308	+1			no_errors	ENST00000242067	ensembl	human	known	74_37	missense	5.13	37	2	SNP	1.000	T
BCAS1	8537	genome.wustl.edu	37	20	52645408	52645408	+	Silent	SNP	T	T	C			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr20:52645408T>C	ENST00000395961.3	-	4	412	c.246A>G	c.(244-246)aaA>aaG	p.K82K	BCAS1_ENST00000371435.2_Silent_p.K82K|BCAS1_ENST00000371440.3_Silent_p.K82K|BCAS1_ENST00000411563.1_5'UTR	NM_003657.2	NP_003648.2	O75363	BCAS1_HUMAN	breast carcinoma amplified sequence 1	82						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)				NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(23)|ovary(2)|skin(2)|stomach(1)|urinary_tract(1)	37	Breast(2;9.53e-15)|Lung NSC(4;5.57e-06)|all_lung(4;1.44e-05)		STAD - Stomach adenocarcinoma(23;0.116)|Colorectal(105;0.198)			GTTTGGCCTCTTTCCCAAGAT	0.522																																																	0													82.0	72.0	75.0					20																	52645408		2203	4300	6503	SO:0001819	synonymous_variant	0			AF041260	CCDS13444.1	20q13.2	2006-11-10			ENSG00000064787	ENSG00000064787			974	protein-coding gene	gene with protein product		602968				9671742	Standard	NM_003657		Approved	NABC1, AIBC1	uc002xws.2	O75363	OTTHUMG00000032772	ENST00000395961.3:c.246A>G	20.37:g.52645408T>C			A0AVG5|Q68CZ3	Silent	SNP	NULL	p.K82	ENST00000395961.3	37	c.246	CCDS13444.1	20																																																																																			BCAS1	-	NULL	ENSG00000064787		0.522	BCAS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCAS1	HGNC	protein_coding	OTTHUMT00000079766.2		0.00	42	0	T	NM_003657		52645408	-1			no_errors	ENST00000371440	ensembl	human	known	74_37	silent	7.69	24	2	SNP	0.696	C
BCR	613	genome.wustl.edu	37	22	23658094	23658094	+	3'UTR	SNP	T	T	C	rs142419707		TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr22:23658094T>C	ENST00000305877.8	+	0	4952				BCR_ENST00000359540.3_3'UTR|BCR_ENST00000436990.2_3'UTR	NM_004327.3	NP_004318.3	P11274	BCR_HUMAN	breakpoint cluster region						actin cytoskeleton organization (GO:0030036)|brain development (GO:0007420)|inner ear morphogenesis (GO:0042472)|negative regulation of cell migration (GO:0030336)|negative regulation of inflammatory response (GO:0050728)|negative regulation of neutrophil degranulation (GO:0043314)|neuromuscular process controlling balance (GO:0050885)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of phagocytosis (GO:0050766)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of cell cycle (GO:0051726)|regulation of small GTPase mediated signal transduction (GO:0051056)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	ATP binding (GO:0005524)|GTPase activator activity (GO:0005096)|kinase activity (GO:0016301)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)|Rac GTPase activator activity (GO:0030675)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)		BCR/JAK2(6)	central_nervous_system(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(9)|ovary(1)|prostate(1)|skin(4)|stomach(1)|urinary_tract(1)	35					Bosutinib(DB06616)|Ponatinib(DB08901)	GGAACGTGACTGGATTCCCTC	0.507			T	"""ABL1,  FGFR1, JAK2 """	"""CML, ALL, AML"""																																			Dom	yes		22	22q11.21	613	breakpoint cluster region		L	0																																										SO:0001624	3_prime_UTR_variant	0				CCDS13806.1, CCDS13807.1	22q11	2013-01-10			ENSG00000186716	ENSG00000186716		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	1014	protein-coding gene	gene with protein product		151410		D22S11, BCR1		1657398, 18070886	Standard	NM_004327		Approved	D22S662, CML, PHL, ALL	uc002zww.3	P11274	OTTHUMG00000150655	ENST00000305877.8:c.*385T>C	22.37:g.23658094T>C			P78501|Q12842|Q4LE80|Q6NZI3	RNA	SNP	-	NULL	ENST00000305877.8	37	NULL	CCDS13806.1	22																																																																																			BCR	-	-	ENSG00000186716		0.507	BCR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCR	HGNC	protein_coding	OTTHUMT00000075819.1	-	0.00	40	0	T	NM_004327		23658094	+1	tier1	rs142419707	no_errors	ENST00000436990	ensembl	human	known	74_37	rna	16.00	21	4	SNP	0.000	C
BDP1	55814	genome.wustl.edu	37	5	70782418	70782418	+	Nonsense_Mutation	SNP	G	G	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr5:70782418G>T	ENST00000358731.4	+	9	1440	c.1177G>T	c.(1177-1179)Gag>Tag	p.E393*	BDP1_ENST00000380675.2_5'UTR	NM_018429.2	NP_060899.2	A6H8Y1	BDP1_HUMAN	B double prime 1, subunit of RNA polymerase III transcription initiation factor IIIB	393	Required for phosphorylation by CSNK2A1.				gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase III promoter (GO:0006383)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			NS(2)|breast(3)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(13)|lung(34)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	72		Lung NSC(167;0.000422)|Prostate(74;0.00815)|Ovarian(174;0.0176)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;5.28e-56)|Epithelial(20;2.31e-50)		CAGTTTAAAGGAGAAGAAATC	0.323																																																	0													63.0	60.0	61.0					5																	70782418		1796	4073	5869	SO:0001587	stop_gained	0			AF298151	CCDS43328.1	5q12-q13	2008-02-05	2001-11-29	2001-11-30	ENSG00000145734	ENSG00000145734			13652	protein-coding gene	gene with protein product		607012	"""TATA box binding protein (TBP)-associated factor, RNA polymerase III, GTF3B subunit 1"""	TFNR, TAF3B1		11214970, 11040218	Standard	NM_018429		Approved	TFIIIB150, TFC5, TFIIIB90, KIAA1689, HSA238520, KIAA1241	uc003kbp.1	A6H8Y1	OTTHUMG00000162506	ENST00000358731.4:c.1177G>T	5.37:g.70782418G>T	ENSP00000351575:p.Glu393*		Q68DS6|Q68DY5|Q6MZL9|Q6PIM7|Q86W98|Q96LR8|Q9C0H4|Q9H197|Q9H1A1|Q9HAW1|Q9HAW2|Q9HCY0|Q9ULH9	Nonsense_Mutation	SNP	superfamily_Homeodomain-like,smart_SANT/Myb	p.E393*	ENST00000358731.4	37	c.1177	CCDS43328.1	5	.	.	.	.	.	.	.	.	.	.	G	40	8.401463	0.98796	.	.	ENSG00000145734	ENST00000358731;ENST00000437938;ENST00000444711	.	.	.	5.54	4.67	0.58626	.	0.284251	0.31279	N	0.007928	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.34782	T	0.22	.	11.3976	0.49851	0.0852:0.0:0.9148:0.0	.	.	.	.	X	393	.	ENSP00000351575:E393X	E	+	1	0	BDP1	70818174	1.000000	0.71417	0.995000	0.50966	0.878000	0.50629	3.857000	0.55972	1.342000	0.45619	0.467000	0.42956	GAG	BDP1	-	NULL	ENSG00000145734		0.323	BDP1-016	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BDP1	HGNC	protein_coding	OTTHUMT00000374681.2		0.00	60	0	G	NM_018429		70782418	+1			no_errors	ENST00000358731	ensembl	human	known	74_37	nonsense	6.06	31	2	SNP	1.000	T
BHLHE22	27319	genome.wustl.edu	37	8	65494189	65494189	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr8:65494189C>G	ENST00000321870.1	+	1	1376	c.842C>G	c.(841-843)tCc>tGc	p.S281C	RP11-21C4.1_ENST00000517909.1_RNA	NM_152414.4	NP_689627.1	Q8NFJ8	BHE22_HUMAN	basic helix-loop-helix family, member e22	281	bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.				anterior commissure morphogenesis (GO:0021960)|cerebral cortex regionalization (GO:0021796)|corpus callosum morphogenesis (GO:0021540)|corticospinal tract morphogenesis (GO:0021957)|negative regulation of transcription, DNA-templated (GO:0045892)|retinal bipolar neuron differentiation (GO:0060040)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			NS(1)|central_nervous_system(1)|lung(1)|prostate(1)|skin(1)	5						CGAAAGCTCTCCAAGATCGCC	0.667																																					Colon(113;104 1586 2865 9855 18065)												0													28.0	26.0	27.0					8																	65494189		2203	4300	6503	SO:0001583	missense	0			U80755	CCDS6179.1	8q12.1	2009-01-12	2009-01-12	2009-01-12		ENSG00000180828		"""Basic helix-loop-helix proteins"""	11963	protein-coding gene	gene with protein product		613483	"""trinucleotide repeat containing 20"", ""basic helix-loop-helix domain containing, class B, 5"""	TNRC20, BHLHB5		9225980, 12213201, 18557763	Standard	NM_152414		Approved	CAGL85, Beta3, bHLHe22	uc003xvi.3	Q8NFJ8		ENST00000321870.1:c.842C>G	8.37:g.65494189C>G	ENSP00000318799:p.Ser281Cys			Missense_Mutation	SNP	pfam_bHLH_dom,superfamily_bHLH_dom,smart_bHLH_dom,pfscan_bHLH_dom	p.S281C	ENST00000321870.1	37	c.842	CCDS6179.1	8	.	.	.	.	.	.	.	.	.	.	C	15.59	2.878281	0.51801	.	.	ENSG00000180828	ENST00000321870	D	0.98937	-5.25	4.13	4.13	0.48395	Helix-loop-helix DNA-binding (5);	0.000000	0.64402	U	0.000003	D	0.99345	0.9770	H	0.95950	3.745	0.58432	D	0.999993	D	0.89917	1.0	D	0.91635	0.999	D	0.98528	1.0626	10	0.87932	D	0	0.3865	12.4678	0.55768	0.168:0.832:0.0:0.0	.	281	Q8NFJ8	BHE22_HUMAN	C	281	ENSP00000318799:S281C	ENSP00000318799:S281C	S	+	2	0	BHLHE22	65656743	1.000000	0.71417	1.000000	0.80357	0.935000	0.57460	4.300000	0.59079	2.096000	0.63516	0.313000	0.20887	TCC	BHLHE22	-	pfam_bHLH_dom,superfamily_bHLH_dom,smart_bHLH_dom,pfscan_bHLH_dom	ENSG00000180828		0.667	BHLHE22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BHLHE22	HGNC	protein_coding	OTTHUMT00000378549.1	-	0.00	18	0	C	NM_152414		65494189	+1	tier1	-	no_errors	ENST00000321870	ensembl	human	known	74_37	missense	36.36	7	4	SNP	1.000	G
BNIP2	663	genome.wustl.edu	37	15	59970119	59970119	+	Missense_Mutation	SNP	T	T	A			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr15:59970119T>A	ENST00000607373.1	-	5	665	c.463A>T	c.(463-465)Agc>Tgc	p.S155C	BNIP2_ENST00000415213.2_Missense_Mutation_p.S217C|BNIP2_ENST00000267859.3_Missense_Mutation_p.S276C	NM_004330.2	NP_004321.2	Q12982	BNIP2_HUMAN	BCL2/adenovirus E1B 19kDa interacting protein 2	155	CRAL-TRIO. {ECO:0000255|PROSITE- ProRule:PRU00056}.				apoptotic process (GO:0006915)|muscle cell differentiation (GO:0042692)|negative regulation of apoptotic process (GO:0043066)|positive regulation of GTPase activity (GO:0043547)|positive regulation of muscle cell differentiation (GO:0051149)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|nuclear envelope (GO:0005635)	calcium ion binding (GO:0005509)|GTPase activator activity (GO:0005096)|identical protein binding (GO:0042802)			NS(1)|large_intestine(2)|lung(5)|ovary(1)	9						CCCCCATGGCTGATAACTTTT	0.363																																					Ovarian(174;1936 1978 6671 8240 38212)												0													131.0	130.0	131.0					15																	59970119		2190	4290	6480	SO:0001583	missense	0			U15173	CCDS10174.2	15q21.3	2008-07-18	2002-08-29		ENSG00000140299	ENSG00000140299			1083	protein-coding gene	gene with protein product		603292	"""BCL2/adenovirus E1B 19kD-interacting protein 2"""			7954800	Standard	NM_004330		Approved	Nip2, BNIP-2	uc010uhc.2	Q12982	OTTHUMG00000132727	ENST00000607373.1:c.463A>T	15.37:g.59970119T>A	ENSP00000475320:p.Ser155Cys		B4DS94	Missense_Mutation	SNP	pfam_Bcl2-/adenovirus-E1B,pfam_CRAL-TRIO_dom,superfamily_CRAL-TRIO_dom,smart_CRAL-TRIO_dom,pfscan_CRAL-TRIO_dom	p.S276C	ENST00000607373.1	37	c.826		15	.	.	.	.	.	.	.	.	.	.	T	23.4	4.414570	0.83449	.	.	ENSG00000140299	ENST00000267859;ENST00000415213;ENST00000439052	D;D;D	0.84516	-1.86;-1.86;-1.86	5.68	5.68	0.88126	Cellular retinaldehyde-binding/triple function, C-terminal (3);	0.000000	0.85682	D	0.000000	D	0.93180	0.7828	M	0.86864	2.845	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.993	D	0.93867	0.7159	9	.	.	.	-18.3949	15.9837	0.80133	0.0:0.0:0.0:1.0	.	155;217	Q12982;Q12982-2	BNIP2_HUMAN;.	C	276;217;33	ENSP00000267859:S276C;ENSP00000412767:S217C;ENSP00000393644:S33C	.	S	-	1	0	BNIP2	57757411	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	4.654000	0.61469	2.186000	0.69663	0.529000	0.55759	AGC	BNIP2	-	pfam_Bcl2-/adenovirus-E1B,superfamily_CRAL-TRIO_dom,smart_CRAL-TRIO_dom,pfscan_CRAL-TRIO_dom	ENSG00000140299		0.363	BNIP2-012	NOVEL	basic|appris_principal	protein_coding	BNIP2	HGNC	protein_coding	OTTHUMT00000470740.1	-	0.00	72	0	T	NM_004330		59970119	-1	tier1	-	no_errors	ENST00000267859	ensembl	human	known	74_37	missense	23.08	20	6	SNP	1.000	A
BPIFA4P	317716	genome.wustl.edu	37	20	31787243	31787243	+	RNA	SNP	C	C	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr20:31787243C>T	ENST00000375465.3	+	0	274					NR_026760.1		Q86YQ2	LATH_HUMAN	BPI fold containing family A, member 4, pseudogene							extracellular region (GO:0005576)	lipid binding (GO:0008289)										TGGACCTCCACTCACCAATGA	0.532																																																	0													131.0	111.0	117.0					20																	31787243		692	1591	2283			0			AY180924		20q11.21	2013-01-24			ENSG00000183566	ENSG00000183566		"""BPI fold containing"""	20469	pseudogene	pseudogene	"""breast cancer and salivary gland expression gene"", ""PLUNC family pseudogene"""	607627				12538848, 21787333	Standard	NR_026760		Approved	BASE	uc002wyq.2	Q86YQ2	OTTHUMG00000032251		20.37:g.31787243C>T				RNA	SNP	-	NULL	ENST00000375465.3	37	NULL		20																																																																																			BPIFA4P	-	-	ENSG00000183566		0.532	BPIFA4P-003	KNOWN	basic	processed_transcript	BPIFA4P	HGNC	pseudogene	OTTHUMT00000469705.1	-	0.00	48	0	C	NR_026760		31787243	+1	tier1	-	no_errors	ENST00000375465	ensembl	human	known	74_37	rna	30.00	28	12	SNP	0.000	T
BRCA1	672	genome.wustl.edu	37	17	41244511	41244511	+	Missense_Mutation	SNP	C	C	G	rs397507208		TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr17:41244511C>G	ENST00000357654.3	-	10	3155	c.3037G>C	c.(3037-3039)Gaa>Caa	p.E1013Q	BRCA1_ENST00000586385.1_Intron|BRCA1_ENST00000309486.4_Missense_Mutation_p.E717Q|BRCA1_ENST00000468300.1_Intron|BRCA1_ENST00000471181.2_Missense_Mutation_p.E1013Q|BRCA1_ENST00000591534.1_Intron|BRCA1_ENST00000352993.3_Intron|BRCA1_ENST00000346315.3_Missense_Mutation_p.E1013Q|BRCA1_ENST00000493795.1_Missense_Mutation_p.E966Q|BRCA1_ENST00000591849.1_Intron|BRCA1_ENST00000351666.3_Intron|BRCA1_ENST00000491747.2_Intron|BRCA1_ENST00000354071.3_Missense_Mutation_p.E1013Q	NM_007294.3	NP_009225.1	P38398	BRCA1_HUMAN	breast cancer 1, early onset	1013					androgen receptor signaling pathway (GO:0030521)|apoptotic process (GO:0006915)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to indole-3-methanol (GO:0071681)|cellular response to tumor necrosis factor (GO:0071356)|chromosome segregation (GO:0007059)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|fatty acid biosynthetic process (GO:0006633)|G2 DNA damage checkpoint (GO:0031572)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of centriole replication (GO:0046600)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of fatty acid biosynthetic process (GO:0045717)|negative regulation of histone H3-K9 methylation (GO:0051573)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of DNA repair (GO:0045739)|positive regulation of gene expression (GO:0010628)|positive regulation of histone acetylation (GO:0035066)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of histone H3-K9 acetylation (GO:2000617)|positive regulation of histone H4-K16 acetylation (GO:2000620)|positive regulation of histone H4-K20 methylation (GO:0070512)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation vascular endothelial growth factor production (GO:0010575)|postreplication repair (GO:0006301)|protein autoubiquitination (GO:0051865)|protein K6-linked ubiquitination (GO:0085020)|protein ubiquitination (GO:0016567)|regulation of apoptotic process (GO:0042981)|regulation of cell proliferation (GO:0042127)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to estrogen (GO:0043627)|response to ionizing radiation (GO:0010212)	BRCA1-A complex (GO:0070531)|BRCA1-BARD1 complex (GO:0031436)|chromosome (GO:0005694)|cytoplasm (GO:0005737)|gamma-tubulin ring complex (GO:0008274)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ribonucleoprotein complex (GO:0030529)|ubiquitin ligase complex (GO:0000151)	androgen receptor binding (GO:0050681)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligase activity (GO:0016874)|RNA binding (GO:0003723)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)|tubulin binding (GO:0015631)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(30)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(7)|lung(28)|ovary(36)|skin(2)|stomach(4)|urinary_tract(2)	120		Breast(137;0.000717)		BRCA - Breast invasive adenocarcinoma(366;0.126)		TTTCCCATTTCTCTTTCAGGT	0.333			"""D, Mis, N, F, S"""		ovarian	"""breast, ovarian"""		Homologous recombination	Hereditary Breast-Ovarian Cancer, BRCA1 type	TCGA Ovarian(2;0.000030)																													yes	Rec	yes	Hereditary breast/ovarian cancer	17	17q21	672	familial breast/ovarian cancer gene 1		E	0													119.0	116.0	117.0					17																	41244511		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database		U14680	CCDS11453.1, CCDS11454.1, CCDS11455.1, CCDS11456.1, CCDS11459.1, CCDS11455.2, CCDS11456.2, CCDS11459.2, CCDS11454.2	17q21.31	2014-09-17			ENSG00000012048	ENSG00000012048		"""RING-type (C3HC4) zinc fingers"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1100	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-containing complex, subunit 1"", ""protein phosphatase 1, regulatory subunit 53"""	113705				1676470	Standard	NM_007300		Approved	RNF53, BRCC1, PPP1R53	uc002ict.3	P38398	OTTHUMG00000157426	ENST00000357654.3:c.3037G>C	17.37:g.41244511C>G	ENSP00000350283:p.Glu1013Gln		O15129|Q1RMC1|Q3LRJ0|Q3LRJ6|Q6IN79|Q7KYU9	Missense_Mutation	SNP	pirsf_BRCA1,pfam_BRCT_dom,pfam_Znf_C3HC4_RING-type,superfamily_BRCT_dom,smart_Znf_RING,smart_BRCT_dom,prints_BRCA1,pfscan_BRCT_dom,pfscan_Znf_RING	p.E1013Q	ENST00000357654.3	37	c.3037	CCDS11453.1	17	.	.	.	.	.	.	.	.	.	.	C	4.056	0.008206	0.07912	.	.	ENSG00000012048	ENST00000357654;ENST00000412061;ENST00000354071;ENST00000346315;ENST00000309486;ENST00000471181;ENST00000493795	T;T;T;T;T;T	0.75477	-0.94;-0.94;-0.94;-0.94;-0.94;-0.94	4.9	-1.71	0.08133	.	0.906070	0.09301	N	0.820905	T	0.56963	0.2021	N	0.14661	0.345	0.09310	N	1	B;B;B;B;B;B	0.16802	0.002;0.009;0.019;0.017;0.01;0.003	B;B;B;B;B;B	0.24394	0.008;0.008;0.053;0.032;0.032;0.003	T	0.50118	-0.8865	10	0.87932	D	0	.	9.0883	0.36594	0.0:0.5611:0.0:0.4389	.	1013;972;1013;1013;1013;1013	E7EMP0;E7ERL4;Q5YLB2;E9PFC7;P38398;P38398-2	.;.;.;.;BRCA1_HUMAN;.	Q	1013;1013;1013;1013;717;1013;966	ENSP00000350283:E1013Q;ENSP00000326002:E1013Q;ENSP00000246907:E1013Q;ENSP00000310938:E717Q;ENSP00000418960:E1013Q;ENSP00000418775:E966Q	ENSP00000310938:E717Q	E	-	1	0	BRCA1	38498037	0.000000	0.05858	0.000000	0.03702	0.021000	0.10359	0.111000	0.15458	-0.441000	0.07201	-0.484000	0.04775	GAA	BRCA1	-	pirsf_BRCA1	ENSG00000012048		0.333	BRCA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRCA1	HGNC	protein_coding	OTTHUMT00000348798.2	-	0.00	51	0	C	NM_007294		41244511	-1	tier1	-	no_errors	ENST00000471181	ensembl	human	known	74_37	missense	15.00	34	6	SNP	0.000	G
BRCA2	675	genome.wustl.edu	37	13	32906424	32906424	+	Missense_Mutation	SNP	C	C	T	rs276174902		TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr13:32906424C>T	ENST00000380152.3	+	10	1042	c.809C>T	c.(808-810)tCa>tTa	p.S270L	BRCA2_ENST00000544455.1_Missense_Mutation_p.S270L			P51587	BRCA2_HUMAN	breast cancer 2, early onset	270					brain development (GO:0007420)|cell aging (GO:0007569)|centrosome duplication (GO:0051298)|cytokinesis (GO:0000910)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|female gonad development (GO:0008585)|hemopoiesis (GO:0030097)|histone H3 acetylation (GO:0043966)|histone H4 acetylation (GO:0043967)|inner cell mass cell proliferation (GO:0001833)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|male meiosis I (GO:0007141)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|nucleotide-excision repair (GO:0006289)|oocyte maturation (GO:0001556)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cytokinesis (GO:0032465)|replication fork protection (GO:0048478)|response to gamma radiation (GO:0010332)|response to UV-C (GO:0010225)|response to X-ray (GO:0010165)|spermatogenesis (GO:0007283)	BRCA2-MAGE-D1 complex (GO:0033593)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)|secretory granule (GO:0030141)	gamma-tubulin binding (GO:0043015)|H3 histone acetyltransferase activity (GO:0010484)|H4 histone acetyltransferase activity (GO:0010485)|protease binding (GO:0002020)|single-stranded DNA binding (GO:0003697)			NS(3)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(32)|liver(1)|lung(41)|oesophagus(5)|ovary(22)|pancreas(4)|prostate(3)|salivary_gland(1)|skin(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	183		Lung SC(185;0.0262)		all cancers(112;7.13e-07)|Epithelial(112;1.59e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000732)|BRCA - Breast invasive adenocarcinoma(63;0.0291)|GBM - Glioblastoma multiforme(144;0.0704)		GGAAAAACATCAGGGAATTCA	0.303			"""D, Mis, N, F, S"""		"""breast, ovarian, pancreatic"""	"""breast, ovarian, pancreatic, leukemia  (FANCB, FANCD1)"""		Homologous recombination	Pancreatic Cancer, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Prostate Cancer;Hereditary Breast-Ovarian Cancer, BRCA2 type;Fanconi Anemia type D1, bi-allelic BRCA2 mutations;Fanconi Anemia	TCGA Ovarian(8;0.087)																											Esophageal Squamous(138;838 1285 7957 30353 30468 36915 49332)		yes	Rec	yes	Hereditary breast/ovarian cancer	13	13q12	675	familial breast/ovarian cancer gene 2		"""L, E"""	0													43.0	44.0	44.0					13																	32906424		2198	4291	6489	SO:0001583	missense	0	Familial Cancer Database	incl.: Hereditary Pancreatic Adenocarcinoma, Insulin-Dependent Diabetes Mellitus - Exocrine Insufficiency - Familial Pancreatic Cancer, PNCA1;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;HPC; ;FANCD1;Pancytopenia Dysmelia, FA (several complementation groups)	U43746	CCDS9344.1	13q12-q13	2014-09-17	2003-10-14		ENSG00000139618	ENSG00000139618		"""Fanconi anemia, complementation groups"""	1101	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-containing complex, subunit 2"""	600185	"""Fanconi anemia, complementation group D1"""	FANCD1, FACD, FANCD		8091231, 7581463, 15057823	Standard	NM_000059		Approved	FAD, FAD1, BRCC2	uc001uub.1	P51587	OTTHUMG00000017411	ENST00000380152.3:c.809C>T	13.37:g.32906424C>T	ENSP00000369497:p.Ser270Leu		O00183|O15008|Q13879|Q5TBJ7	Missense_Mutation	SNP	pfam_DNA_recomb/repair_BRCA2_hlx,pfam_BRCA2_repeat,pfam_BRCA2_OB_3,pfam_BRCA2_OB_1,pfam_Tower,superfamily_DNA_recomb/repair_BRCA2_hlx,superfamily_NA-bd_OB-fold,pirsf_BRCA2,pfscan_BRCA2_repeat	p.S270L	ENST00000380152.3	37	c.809	CCDS9344.1	13	.	.	.	.	.	.	.	.	.	.	C	0.004	-2.279479	0.00254	.	.	ENSG00000139618	ENST00000380152;ENST00000544455;ENST00000530893	T;T	0.00634	6.07;6.07	5.02	0.972	0.19704	.	0.927321	0.08869	N	0.881784	T	0.00241	0.0007	N	0.00446	-1.495	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.0;0.001	T	0.42430	-0.9452	10	0.02654	T	1	.	3.4388	0.07456	0.166:0.1895:0.0:0.6445	.	270;270	P51587;A1YBP1	BRCA2_HUMAN;.	L	270;270;268	ENSP00000369497:S270L;ENSP00000439902:S270L	ENSP00000369497:S270L	S	+	2	0	BRCA2	31804424	0.828000	0.29307	0.000000	0.03702	0.260000	0.26232	2.044000	0.41241	-0.071000	0.12886	-0.294000	0.09567	TCA	BRCA2	-	pirsf_BRCA2	ENSG00000139618		0.303	BRCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRCA2	HGNC	protein_coding	OTTHUMT00000046000.2	-	0.00	41	0	C	NM_000059		32906424	+1	tier1	-	no_errors	ENST00000380152	ensembl	human	known	74_37	missense	11.54	23	3	SNP	0.000	T
BRDT	676	genome.wustl.edu	37	1	92447228	92447230	+	In_Frame_Del	DEL	AGC	AGC	-	rs375773077		TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	AGC	AGC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr1:92447228_92447230delAGC	ENST00000362005.3	+	13	2336_2338	c.1918_1920delAGC	c.(1918-1920)agcdel	p.S648del	BRDT_ENST00000402388.1_In_Frame_Del_p.S648del|BRDT_ENST00000370389.2_In_Frame_Del_p.S575del|BRDT_ENST00000399546.2_In_Frame_Del_p.S648del|BRDT_ENST00000394530.3_In_Frame_Del_p.S602del	NM_001242805.1	NP_001229734	Q58F21	BRDT_HUMAN	bromodomain, testis-specific	648	Ser-rich.				cell differentiation (GO:0030154)|chromatin remodeling (GO:0006338)|histone displacement (GO:0001207)|male meiosis (GO:0007140)|male meiosis I (GO:0007141)|mRNA processing (GO:0006397)|positive regulation of transcription during meiosis (GO:0051039)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	histone binding (GO:0042393)|lysine-acetylated histone binding (GO:0070577)|transcription coactivator activity (GO:0003713)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(24)|ovary(1)|prostate(4)|skin(2)|stomach(2)|urinary_tract(2)	56		all_lung(203;0.00531)|Lung NSC(277;0.0194)		all cancers(265;0.0228)|Epithelial(280;0.133)		ACTGAGTGAGagcagcagcagca	0.419																																																	0																																										SO:0001651	inframe_deletion	0			AF019085	CCDS735.1, CCDS55615.1, CCDS55616.1, CCDS72820.1	1p22.1	2010-12-23			ENSG00000137948	ENSG00000137948			1105	protein-coding gene	gene with protein product	"""cancer/testis antigen 9"""	602144				9367677	Standard	NM_001726		Approved	BRD6, CT9	uc010osz.2	Q58F21	OTTHUMG00000010113	ENST00000362005.3:c.1918_1920delAGC	1.37:g.92447237_92447239delAGC	ENSP00000354568:p.Ser648del		A6NF68|B7Z811|B7Z890|B7ZAX7|D3DT32|O14789|Q05DQ4|Q6P5T1|Q7Z4A6|Q8IWI6	In_Frame_Del	DEL	pfam_Bromodomain,superfamily_Bromodomain,smart_Bromodomain,pfscan_Bromodomain,prints_Bromodomain	p.S643in_frame_del	ENST00000362005.3	37	c.1918_1920	CCDS735.1	1																																																																																			BRDT	-	NULL	ENSG00000137948		0.419	BRDT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRDT	HGNC	protein_coding	OTTHUMT00000027980.2		0.00	29	0	AGC	NM_207189		92447230	+1	tier1		no_errors	ENST00000362005	ensembl	human	known	74_37	in_frame_del	10.53	17	2	DEL	0.989:0.998:1.000	-
BRPF3	27154	genome.wustl.edu	37	6	36196795	36196795	+	Silent	SNP	G	G	A			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr6:36196795G>A	ENST00000357641.6	+	12	3649	c.3396G>A	c.(3394-3396)aaG>aaA	p.K1132K	BRPF3_ENST00000534400.1_Missense_Mutation_p.A1100T|BRPF3_ENST00000339717.7_Silent_p.K862K|BRPF3_ENST00000543502.1_Silent_p.K862K|BRPF3_ENST00000534694.1_Silent_p.K798K|BRPF3_ENST00000443324.2_Silent_p.K798K	NM_015695.2	NP_056510.2	Q9ULD4	BRPF3_HUMAN	bromodomain and PHD finger containing, 3	1132	PWWP. {ECO:0000255|PROSITE- ProRule:PRU00162}.				blood coagulation (GO:0007596)|histone H3 acetylation (GO:0043966)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	cytosol (GO:0005829)|extracellular region (GO:0005576)|MOZ/MORF histone acetyltransferase complex (GO:0070776)	zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(8)|lung(15)|ovary(1)|prostate(1)|skin(4)|urinary_tract(2)	40						CTGGAGAGAAGCTCTTCCTTG	0.632																																																	0													83.0	76.0	79.0					6																	36196795		2203	4300	6503	SO:0001819	synonymous_variant	0			AB033112	CCDS34437.1	6p21.31	2008-02-05			ENSG00000096070	ENSG00000096070			14256	protein-coding gene	gene with protein product						10574462	Standard	NM_015695		Approved	KIAA1286	uc003olv.4	Q9ULD4	OTTHUMG00000014589	ENST00000357641.6:c.3396G>A	6.37:g.36196795G>A			A6ND56|A6NJE2|B7ZLN5|E7EX85|Q17RB6|Q5R3K8	Missense_Mutation	SNP	pfam_Enhancer_polycomb-like_N,pfam_Bromodomain,superfamily_Bromodomain,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,smart_Bromodomain,pfscan_Znf_PHD-finger,pfscan_Bromodomain,prints_Bromodomain	p.A1100T	ENST00000357641.6	37	c.3298	CCDS34437.1	6	.	.	.	.	.	.	.	.	.	.	G	8.260	0.810962	0.16537	.	.	ENSG00000096070	ENST00000534400	T	0.15372	2.43	5.21	4.32	0.51571	.	.	.	.	.	T	0.03827	0.0108	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.12344	-1.0551	6	0.05833	T	0.94	.	11.038	0.47814	0.1481:0.0:0.8519:0.0	.	.	.	.	T	1100	ENSP00000436504:A1100T	ENSP00000436504:A1100T	A	+	1	0	BRPF3	36304773	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	1.255000	0.32909	2.591000	0.87537	0.655000	0.94253	GCT	BRPF3	-	NULL	ENSG00000096070		0.632	BRPF3-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	BRPF3	HGNC	protein_coding	OTTHUMT00000040335.3		0.00	52	0	G	NM_015695		36196795	+1			no_errors	ENST00000534400	ensembl	human	putative	74_37	missense	11.11	24	3	SNP	1.000	A
BSND	7809	genome.wustl.edu	37	1	55464886	55464886	+	Silent	SNP	C	C	T	rs371937424		TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr1:55464886C>T	ENST00000371265.4	+	1	281	c.27C>T	c.(25-27)atC>atT	p.I9I		NM_057176.2	NP_476517.1	Q8WZ55	BSND_HUMAN	barttin CLCNK-type chloride channel accessory beta subunit	9					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	chloride channel activity (GO:0005254)|chloride channel regulator activity (GO:0017081)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(9)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	17						CCTTCCGGATCGGCTTCATTG	0.627																																					Ovarian(191;1657 2078 22894 42033 48899)												0								C		0,4406		0,0,2203	107.0	102.0	104.0		27	0.1	1.0	1		104	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	BSND	NM_057176.2		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		9/321	55464886	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	0			AY034632	CCDS602.1	1p32.3	2014-06-17	2014-06-17		ENSG00000162399	ENSG00000162399			16512	protein-coding gene	gene with protein product		606412	"""deafness, autosomal recessive 73"", ""Bartter syndrome, infantile, with sensorineural deafness (Barttin)"""	DFNB73		11687798, 11734858, 19646679	Standard	NM_057176		Approved	BART	uc001cye.3	Q8WZ55	OTTHUMG00000008112	ENST00000371265.4:c.27C>T	1.37:g.55464886C>T			Q6NT28	Silent	SNP	NULL	p.I9	ENST00000371265.4	37	c.27	CCDS602.1	1																																																																																			BSND	-	NULL	ENSG00000162399		0.627	BSND-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BSND	HGNC	protein_coding	OTTHUMT00000022213.4	-	0.00	35	0	C	NM_057176		55464886	+1	tier1	-	no_errors	ENST00000371265	ensembl	human	known	74_37	silent	22.22	21	6	SNP	0.998	T
C16orf46	123775	genome.wustl.edu	37	16	81097407	81097407	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr16:81097407G>A	ENST00000299578.5	-	3	389	c.154C>T	c.(154-156)Ctt>Ttt	p.L52F	C16orf46_ENST00000378611.4_Missense_Mutation_p.L52F|RP11-303E16.8_ENST00000564536.1_RNA|C16orf46_ENST00000444657.3_Intron	NM_152337.2	NP_689550.2	Q6P387	CP046_HUMAN	chromosome 16 open reading frame 46	52						cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|endometrium(2)|large_intestine(3)|lung(9)|prostate(1)|stomach(1)|urinary_tract(1)	18						TCTTGTTCAAGCGTAATGTCA	0.383																																																	0													188.0	175.0	179.0					16																	81097407		2202	4300	6502	SO:0001583	missense	0			BC064143	CCDS10932.1, CCDS42201.1	16q23.2	2012-10-09			ENSG00000166455	ENSG00000166455			26525	protein-coding gene	gene with protein product							Standard	NM_152337		Approved	FLJ32702	uc002fgc.4	Q6P387	OTTHUMG00000137629	ENST00000299578.5:c.154C>T	16.37:g.81097407G>A	ENSP00000299578:p.Leu52Phe		Q96MA7	Missense_Mutation	SNP	NULL	p.L52F	ENST00000299578.5	37	c.154	CCDS10932.1	16	.	.	.	.	.	.	.	.	.	.	G	6.827	0.521660	0.13005	.	.	ENSG00000166455	ENST00000378611;ENST00000299578	T;T	0.19394	2.15;2.15	5.65	3.71	0.42584	.	0.222293	0.32028	N	0.006694	T	0.14614	0.0353	L	0.34521	1.04	0.09310	N	1	B;B	0.24186	0.099;0.099	B;B	0.25884	0.064;0.064	T	0.18053	-1.0349	10	0.49607	T	0.09	.	5.6884	0.17815	0.1627:0.0:0.6811:0.1563	.	52;52	Q6P387-2;Q6P387	.;CP046_HUMAN	F	52	ENSP00000367874:L52F;ENSP00000299578:L52F	ENSP00000299578:L52F	L	-	1	0	C16orf46	79654908	0.003000	0.15002	0.004000	0.12327	0.066000	0.16364	0.679000	0.25291	0.869000	0.35703	-0.251000	0.11542	CTT	C16orf46	-	NULL	ENSG00000166455		0.383	C16orf46-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	C16orf46	HGNC	protein_coding	OTTHUMT00000269054.2		0.00	70	0	G	NM_152337		81097407	-1			no_errors	ENST00000299578	ensembl	human	known	74_37	missense	6.67	28	2	SNP	0.008	A
LRRC75A	388341	genome.wustl.edu	37	17	16344523	16344524	+	IGR	INS	-	-	A	rs146361133|rs564583685	byFrequency	TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr17:16344523_16344524insA	ENST00000409083.3	-	0	2656				C17orf76-AS1_ENST00000584177.1_RNA|C17orf76-AS1_ENST00000460249.1_RNA|C17orf76-AS1_ENST00000580770.1_RNA|C17orf76-AS1_ENST00000578380.2_RNA|C17orf76-AS1_ENST00000579473.1_RNA|C17orf76-AS1_ENST00000475953.1_RNA|C17orf76-AS1_ENST00000487066.1_RNA|C17orf76-AS1_ENST00000470491.2_RNA|RP11-138I1.3_ENST00000585048.1_lincRNA|C17orf76-AS1_ENST00000580180.1_RNA|C17orf76-AS1_ENST00000491009.1_RNA|C17orf76-AS1_ENST00000477249.2_RNA|C17orf76-AS1_ENST00000492250.1_RNA|C17orf76-AS1_ENST00000481898.1_RNA|C17orf76-AS1_ENST00000583400.2_RNA|C17orf76-AS1_ENST00000475947.2_RNA|C17orf76-AS1_ENST00000582911.1_RNA|C17orf76-AS1_ENST00000581718.1_RNA|C17orf76-AS1_ENST00000472367.1_RNA|C17orf76-AS1_ENST00000478103.2_RNA|C17orf76-AS1_ENST00000384229.1_RNA|C17orf76-AS1_ENST00000584926.1_RNA|C17orf76-AS1_ENST00000483140.1_RNA|C17orf76-AS1_ENST00000581913.1_RNA|C17orf76-AS1_ENST00000481027.1_RNA|C17orf76-AS1_ENST00000584141.1_RNA|C17orf76-AS1_ENST00000365172.1_RNA|C17orf76-AS1_ENST00000484836.1_RNA|C17orf76-AS1_ENST00000480811.1_RNA|C17orf76-AS1_ENST00000391079.1_RNA	NM_207387.3	NP_997270.2														lung(1)	1						AAACTCGCTTCAAAAAAAAAAG	0.406																																																	0																																										SO:0001628	intergenic_variant	0																															17.37:g.16344533_16344533dupA				RNA	INS	-	NULL	ENST00000409083.3	37	NULL	CCDS11178.2	17																																																																																			C17orf76-AS1	-	-	ENSG00000175061		0.406	FAM211A-001	NOVEL	basic|exp_conf|CCDS	protein_coding	C17orf76-AS1	HGNC	protein_coding	OTTHUMT00000130461.2		0.00	49	0	-			16344524	+1	tier1		no_errors	ENST00000460249	ensembl	human	known	74_37	rna	15.62	27	5	INS	0.000:0.000	A
C1QL4	338761	genome.wustl.edu	37	12	49726977	49726977	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr12:49726977A>G	ENST00000334221.3	-	2	1287	c.577T>C	c.(577-579)Tac>Cac	p.Y193H		NM_001008223.1	NP_001008224.1	Q86Z23	C1QL4_HUMAN	complement component 1, q subcomponent-like 4	193	C1q. {ECO:0000255|PROSITE- ProRule:PRU00368}.					collagen trimer (GO:0005581)|extracellular region (GO:0005576)				large_intestine(2)|lung(1)|ovary(1)|skin(1)	5						GCGTAGTCGTAGTTCTGGTCC	0.617																																																	0													143.0	103.0	116.0					12																	49726977		2203	4300	6503	SO:0001583	missense	0				CCDS31793.1	12q13.12	2012-04-12				ENSG00000186897			31416	protein-coding gene	gene with protein product		615229					Standard	NM_001008223		Approved	C1QTNF11, CTRP11	uc001rtz.1	Q86Z23	OTTHUMG00000169515	ENST00000334221.3:c.577T>C	12.37:g.49726977A>G	ENSP00000335285:p.Tyr193His			Missense_Mutation	SNP	pfam_C1q,superfamily_Tumour_necrosis_fac-like_dom,smart_C1q,pfscan_C1q,prints_C1q	p.Y193H	ENST00000334221.3	37	c.577	CCDS31793.1	12	.	.	.	.	.	.	.	.	.	.	A	29.2	4.985885	0.93044	.	.	ENSG00000186897	ENST00000334221	T	0.22336	1.96	5.1	5.1	0.69264	Tumour necrosis factor-like (2);Complement C1q protein (3);	0.000000	0.64402	D	0.000005	T	0.35799	0.0944	L	0.42487	1.325	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.03717	-1.1010	10	0.19590	T	0.45	.	14.007	0.64470	1.0:0.0:0.0:0.0	.	193	Q86Z23	C1QL4_HUMAN	H	193	ENSP00000335285:Y193H	ENSP00000335285:Y193H	Y	-	1	0	C1QL4	48013244	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.033000	0.93741	2.145000	0.66743	0.379000	0.24179	TAC	C1QL4	-	pfam_C1q,superfamily_Tumour_necrosis_fac-like_dom,smart_C1q,pfscan_C1q	ENSG00000186897		0.617	C1QL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C1QL4	HGNC	protein_coding	OTTHUMT00000404561.1	-	0.00	36	0	A	NM_001008223		49726977	-1	tier1	-	no_errors	ENST00000334221	ensembl	human	known	74_37	missense	33.33	22	11	SNP	1.000	G
C1orf162	128346	genome.wustl.edu	37	1	112020764	112020764	+	3'UTR	SNP	G	G	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr1:112020764G>T	ENST00000343534.5	+	0	737				C1orf162_ENST00000464591.1_3'UTR|C1orf162_ENST00000369718.3_3'UTR	NM_174896.2	NP_777556.1	Q8NEQ5	CA162_HUMAN	chromosome 1 open reading frame 162							integral component of membrane (GO:0016021)				NS(1)|kidney(1)|large_intestine(1)|lung(1)|ovary(1)	5		all_cancers(81;0.00116)|all_epithelial(167;0.000761)|all_lung(203;0.00277)|Lung NSC(277;0.0043)		Lung(183;0.0236)|Colorectal(144;0.0286)|all cancers(265;0.0572)|Epithelial(280;0.0862)|COAD - Colon adenocarcinoma(174;0.112)|LUSC - Lung squamous cell carcinoma(189;0.134)		TTCCAATGAGGCTTGAATCCA	0.408																																																	0													57.0	56.0	56.0					1																	112020764		2203	4300	6503	SO:0001624	3_prime_UTR_variant	0			BC017973	CCDS837.1, CCDS72837.1	1p13.2	2008-02-05			ENSG00000143110	ENSG00000143110			28344	protein-coding gene	gene with protein product						12477932	Standard	XM_005270475		Approved	MGC24133	uc001ebe.3	Q8NEQ5	OTTHUMG00000011750	ENST00000343534.5:c.*19G>T	1.37:g.112020764G>T			Q5QNZ1	RNA	SNP	-	NULL	ENST00000343534.5	37	NULL	CCDS837.1	1																																																																																			C1orf162	-	-	ENSG00000143110		0.408	C1orf162-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	C1orf162	HGNC	protein_coding	OTTHUMT00000032471.1	-	0.00	35	0	G	NM_174896		112020764	+1	tier1	-	no_errors	ENST00000464591	ensembl	human	known	74_37	rna	17.39	19	4	SNP	0.010	T
C4orf22	255119	genome.wustl.edu	37	4	81284011	81284011	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr4:81284011C>T	ENST00000358105.3	+	2	264	c.215C>T	c.(214-216)gCa>gTa	p.A72V	C4orf22_ENST00000508675.1_Missense_Mutation_p.A72V|C4orf22_ENST00000512931.1_3'UTR	NM_152770.2	NP_689983.2	Q6V702	CD022_HUMAN	chromosome 4 open reading frame 22	72										NS(1)|large_intestine(3)|lung(5)|prostate(1)|skin(5)	15						ATAGAGATTGCAAGACTGGCT	0.453																																																	0													121.0	127.0	125.0					4																	81284011		2203	4300	6503	SO:0001583	missense	0			BC034296	CCDS3587.1, CCDS56336.1	4q21.21	2008-02-05			ENSG00000197826	ENSG00000197826			28554	protein-coding gene	gene with protein product						12477932	Standard	NM_152770		Approved		uc010ijp.3	Q6V702	OTTHUMG00000130289	ENST00000358105.3:c.215C>T	4.37:g.81284011C>T	ENSP00000350818:p.Ala72Val		E7EQ13|Q6ZQY4|Q8N4G9	Missense_Mutation	SNP	NULL	p.A72V	ENST00000358105.3	37	c.215	CCDS3587.1	4	.	.	.	.	.	.	.	.	.	.	C	17.95	3.513599	0.64522	.	.	ENSG00000197826	ENST00000358105;ENST00000508675	T;T	0.32753	1.44;1.44	5.21	5.21	0.72293	.	0.174652	0.34879	N	0.003603	T	0.44705	0.1306	M	0.75777	2.31	0.33237	D	0.55671	P;P	0.40398	0.716;0.58	P;P	0.45681	0.49;0.454	T	0.58081	-0.7699	10	0.39692	T	0.17	.	17.8844	0.88849	0.0:1.0:0.0:0.0	.	72;72	E7EQ13;Q6V702	.;CD022_HUMAN	V	72	ENSP00000350818:A72V;ENSP00000425786:A72V	ENSP00000350818:A72V	A	+	2	0	C4orf22	81503035	1.000000	0.71417	0.998000	0.56505	0.693000	0.40251	3.662000	0.54510	2.588000	0.87417	0.585000	0.79938	GCA	C4orf22	-	NULL	ENSG00000197826		0.453	C4orf22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C4orf22	HGNC	protein_coding	OTTHUMT00000252629.2		0.00	66	0	C	NM_152770		81284011	+1			no_errors	ENST00000508675	ensembl	human	known	74_37	missense	9.52	19	2	SNP	1.000	T
CFAP69	79846	genome.wustl.edu	37	7	89912265	89912265	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr7:89912265G>C	ENST00000389297.4	+	13	1683	c.1432G>C	c.(1432-1434)Gcc>Ccc	p.A478P	C7orf63_ENST00000497910.1_Missense_Mutation_p.A460P|C7orf63_ENST00000316089.8_Missense_Mutation_p.A478P	NM_001039706.2|NM_001160138.1	NP_001034795.2|NP_001153610.1	A5D8W1	CG063_HUMAN		478										breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(12)|lung(14)|ovary(1)|prostate(3)	37						CAACAAGTTTGCCCAGATGCG	0.393																																																	0													114.0	106.0	108.0					7																	89912265		1900	4107	6007	SO:0001583	missense	0																														ENST00000389297.4:c.1432G>C	7.37:g.89912265G>C	ENSP00000373948:p.Ala478Pro		A3KMP9|B4DYW6|B4DZP7|B9EIM7|Q6V705|Q8IY89|Q9H7C2	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.A478P	ENST00000389297.4	37	c.1432	CCDS43613.2	7	.	.	.	.	.	.	.	.	.	.	G	22.7	4.321287	0.81580	.	.	ENSG00000105792	ENST00000389297;ENST00000316089;ENST00000497910;ENST00000457170;ENST00000449577	T;T;T;T;T	0.36340	1.26;1.26;1.26;1.26;1.26	5.39	5.39	0.77823	Armadillo-type fold (1);	0.108387	0.64402	D	0.000009	T	0.62221	0.2410	M	0.79475	2.455	0.48185	D	0.999602	D;B;B	0.89917	1.0;0.356;0.356	D;B;B	0.87578	0.998;0.231;0.128	T	0.65792	-0.6082	10	0.66056	D	0.02	-6.8081	16.1744	0.81842	0.0:0.1331:0.8669:0.0	.	460;478;478	A5D8W1-5;A5D8W1;A5D8W1-2	.;CG063_HUMAN;.	P	478;478;460;361;61	ENSP00000373948:A478P;ENSP00000321753:A478P;ENSP00000419549:A460P;ENSP00000392365:A361P;ENSP00000391571:A61P	ENSP00000321753:A478P	A	+	1	0	C7orf63	89750201	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.657000	0.54474	2.513000	0.84729	0.591000	0.81541	GCC	C7orf63	-	superfamily_ARM-type_fold	ENSG00000105792		0.393	C7orf63-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	C7orf63	HGNC	protein_coding	OTTHUMT00000139891.4	-	0.00	93	0	G			89912265	+1	tier1	-	no_errors	ENST00000389297	ensembl	human	known	74_37	missense	9.52	57	6	SNP	1.000	C
CA14	23632	genome.wustl.edu	37	1	150235229	150235229	+	Nonsense_Mutation	SNP	T	T	G			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr1:150235229T>G	ENST00000369111.4	+	6	1492	c.522T>G	c.(520-522)taT>taG	p.Y174*	snoU13_ENST00000458929.1_RNA	NM_012113.1	NP_036245.1	Q9ULX7	CAH14_HUMAN	carbonic anhydrase XIV	174					bicarbonate transport (GO:0015701)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbonate dehydratase activity (GO:0004089)|metal ion binding (GO:0046872)			central_nervous_system(1)|cervix(2)|endometrium(1)|kidney(2)|large_intestine(2)|lung(6)|ovary(2)|prostate(2)	18	Lung NSC(24;7.29e-29)|Breast(34;0.00211)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)		Acetazolamide(DB00819)|Zonisamide(DB00909)	ATATAGCTTATGAACACATTC	0.353																																																	0													110.0	115.0	113.0					1																	150235229		2203	4300	6503	SO:0001587	stop_gained	0			AB025904	CCDS947.1	1q21	2008-02-05			ENSG00000118298	ENSG00000118298		"""Carbonic anhydrases"""	1372	protein-coding gene	gene with protein product		604832				10512682	Standard	XM_005245059		Approved		uc001etx.3	Q9ULX7	OTTHUMG00000012549	ENST00000369111.4:c.522T>G	1.37:g.150235229T>G	ENSP00000358107:p.Tyr174*		Q5TB24|Q8NCF4	Nonsense_Mutation	SNP	pfam_Carbonic_anhydrase_a,superfamily_Carbonic_anhydrase_a,pfscan_Carbonic_anhydrase_a	p.Y174*	ENST00000369111.4	37	c.522	CCDS947.1	1	.	.	.	.	.	.	.	.	.	.	T	37	6.301787	0.97458	.	.	ENSG00000118298	ENST00000369111	.	.	.	6.17	1.42	0.22433	.	0.117737	0.64402	D	0.000015	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	8.7726	0.34742	0.0:0.2902:0.0:0.7098	.	.	.	.	X	174	.	ENSP00000358107:Y174X	Y	+	3	2	CA14	148501853	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	0.728000	0.26013	0.204000	0.20548	-1.151000	0.01829	TAT	CA14	-	pfam_Carbonic_anhydrase_a,superfamily_Carbonic_anhydrase_a,pfscan_Carbonic_anhydrase_a	ENSG00000118298		0.353	CA14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CA14	HGNC	protein_coding	OTTHUMT00000035064.2		0.00	31	0	T	NM_012113		150235229	+1			no_errors	ENST00000369111	ensembl	human	known	74_37	nonsense	9.52	19	2	SNP	1.000	G
CACNA1C	775	genome.wustl.edu	37	12	2778165	2778165	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr12:2778165G>T	ENST00000347598.4	+	40	4834	c.4834G>T	c.(4834-4836)Gcc>Tcc	p.A1612S	CACNA1C_ENST00000335762.5_Missense_Mutation_p.A1589S|CACNA1C_ENST00000402845.3_Missense_Mutation_p.A1564S|CACNA1C_ENST00000399637.1_Missense_Mutation_p.A1564S|CACNA1C_ENST00000399595.1_Missense_Mutation_p.A1553S|CACNA1C_ENST00000399603.1_Missense_Mutation_p.A1564S|CACNA1C_ENST00000399655.1_Missense_Mutation_p.A1564S|CACNA1C_ENST00000399641.1_Missense_Mutation_p.A1564S|CACNA1C_ENST00000399638.1_Missense_Mutation_p.A1592S|CACNA1C_ENST00000399629.1_Missense_Mutation_p.A1581S|CACNA1C_ENST00000406454.3_Missense_Mutation_p.A1564S|CACNA1C_ENST00000327702.7_Missense_Mutation_p.A1564S|CACNA1C_ENST00000399591.1_Missense_Mutation_p.A1553S|CACNA1C_ENST00000399601.1_Missense_Mutation_p.A1564S|CACNA1C_ENST00000399606.1_Missense_Mutation_p.A1584S|CACNA1C_ENST00000399621.1_Missense_Mutation_p.A1564S|CACNA1C_ENST00000399617.1_Missense_Mutation_p.A1564S|CACNA1C_ENST00000399644.1_Missense_Mutation_p.A1564S|CACNA1C_ENST00000344100.3_Missense_Mutation_p.A1586S|CACNA1C-AS2_ENST00000545526.1_RNA|CACNA1C_ENST00000399634.1_Missense_Mutation_p.A1564S|CACNA1C_ENST00000399649.1_Missense_Mutation_p.A1551S|CACNA1C_ENST00000399597.1_Missense_Mutation_p.A1564S	NM_001129827.1|NM_199460.2	NP_001123299.1|NP_955630.2	Q13936	CAC1C_HUMAN	calcium channel, voltage-dependent, L type, alpha 1C subunit	1612					adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transport into cytosol (GO:0060402)|calcium ion-dependent exocytosis (GO:0017156)|calcium-mediated signaling using extracellular calcium source (GO:0035585)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|energy reserve metabolic process (GO:0006112)|glucose homeostasis (GO:0042593)|growth hormone secretion (GO:0030252)|insulin secretion (GO:0030073)|membrane depolarization during action potential (GO:0086010)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of blood pressure (GO:0008217)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of insulin secretion (GO:0050796)|regulation of organ growth (GO:0046620)|regulation of vasoconstriction (GO:0019229)|small molecule metabolic process (GO:0044281)|smooth muscle contraction involved in micturition (GO:0060083)|synaptic transmission (GO:0007268)|visual learning (GO:0008542)	caveolar macromolecular signaling complex (GO:0002095)|cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|voltage-gated calcium channel complex (GO:0005891)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|calmodulin binding (GO:0005516)|high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)	p.A1586S(1)|p.A1642S(1)|p.A1612S(1)|p.A1564S(1)|p.A1099S(1)		NS(3)|breast(4)|central_nervous_system(4)|cervix(2)|endometrium(12)|kidney(9)|large_intestine(20)|lung(55)|ovary(10)|pancreas(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(4)	132			OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Drotaverine(DB06751)|Felodipine(DB01023)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	CACCCTGTTTGCCCTGGTCAG	0.562																																																	5	Substitution - Missense(5)	lung(5)											129.0	133.0	132.0					12																	2778165		2187	4298	6485	SO:0001583	missense	0			AF070589	CCDS44787.1, CCDS44788.1, CCDS44789.1, CCDS44790.1, CCDS44791.1, CCDS44792.1, CCDS44793.1, CCDS44794.1, CCDS44795.1, CCDS44796.1, CCDS44797.1, CCDS44798.1, CCDS44799.1, CCDS44800.1, CCDS44801.1, CCDS53733.1, CCDS53734.1, CCDS53735.1, CCDS53736.1	12p13.3	2014-09-17			ENSG00000151067	ENSG00000151067		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1390	protein-coding gene	gene with protein product		114205		CCHL1A1, CACNL1A1		1650913, 16382099	Standard	NM_001129832		Approved	Cav1.2, CACH2, CACN2, TS, LQT8	uc001qjy.3	Q13936	OTTHUMG00000150243	ENST00000347598.4:c.4834G>T	12.37:g.2778165G>T	ENSP00000266376:p.Ala1612Ser		B2RUT3|E9PDJ0|Q13917|Q13918|Q13919|Q13920|Q13921|Q13922|Q13923|Q13924|Q13925|Q13926|Q13927|Q13928|Q13929|Q13930|Q13932|Q13933|Q14743|Q14744|Q15877|Q4VMI7|Q4VMI8|Q4VMI9|Q6PKM7|Q8N6C0|Q99025|Q99241|Q99875	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,prints_VDCC_L_a1csu,prints_VDCCAlpha1,prints_VDCC_L_a1su	p.A1564S	ENST00000347598.4	37	c.4690	CCDS44788.1	12	.	.	.	.	.	.	.	.	.	.	G	27.8	4.862296	0.91511	.	.	ENSG00000151067	ENST00000335762;ENST00000399655;ENST00000399644;ENST00000399638;ENST00000399597;ENST00000399621;ENST00000399637;ENST00000399591;ENST00000399641;ENST00000347598;ENST00000399606;ENST00000399601;ENST00000344100;ENST00000399629;ENST00000327702;ENST00000399649;ENST00000402845;ENST00000399603;ENST00000399634;ENST00000399617;ENST00000406454;ENST00000399595;ENST00000322367	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.98135	-4.42;-4.39;-4.39;-4.38;-4.39;-4.73;-4.6;-4.61;-4.39;-4.32;-4.33;-4.39;-4.73;-4.3;-4.25;-4.73;-4.72;-4.39;-4.42;-4.36;-4.43;-4.74	3.88	3.88	0.44766	.	0.000000	0.85682	D	0.000000	D	0.98804	0.9597	M	0.88640	2.97	0.80722	D	1	D;D;D;D;D;D;D;P;D;D;D;D;P;D;D;D;D;D;D;D;P;D;D;D;D	0.76494	0.974;0.996;0.999;0.995;0.998;0.999;0.999;0.867;0.997;0.978;0.999;0.999;0.939;0.998;0.997;0.997;0.996;0.999;0.999;0.994;0.907;0.999;0.999;0.999;0.999	P;D;D;P;D;D;D;P;D;D;D;D;P;D;D;D;D;D;D;P;B;D;D;D;D	0.87578	0.829;0.985;0.996;0.831;0.994;0.997;0.996;0.54;0.919;0.955;0.997;0.995;0.721;0.998;0.985;0.995;0.987;0.919;0.997;0.858;0.364;0.997;0.997;0.997;0.996	D	0.99568	1.0970	10	0.72032	D	0.01	.	16.4036	0.83650	0.0:0.0:1.0:0.0	.	255;1586;1561;1612;1564;1564;1564;1581;1592;1564;1584;1564;1524;1612;1564;1564;1564;1553;1551;1553;1553;1564;1564;1564;1564	B7Z7Z5;Q13936-14;Q13936-35;Q13936;Q13936-33;Q13936-13;Q13936-22;Q13936-32;Q13936-31;Q13936-21;Q13936-30;Q13936-23;Q13936-28;Q13936-11;E9PDJ1;E9PDJ0;F5GY28;Q13936-25;Q13936-15;Q13936-29;Q13936-19;Q13936-24;Q13936-27;Q13936-20;Q13936-12	.;.;.;CAC1C_HUMAN;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.	S	1589;1564;1564;1592;1564;1564;1564;1553;1564;1612;1584;1564;1586;1581;1564;1551;1564;1564;1564;1564;1564;1553;1394	ENSP00000336982:A1589S;ENSP00000382563:A1564S;ENSP00000382552:A1564S;ENSP00000382547:A1592S;ENSP00000382506:A1564S;ENSP00000382530:A1564S;ENSP00000382546:A1564S;ENSP00000382500:A1553S;ENSP00000382549:A1564S;ENSP00000266376:A1612S;ENSP00000382515:A1584S;ENSP00000382510:A1564S;ENSP00000341092:A1586S;ENSP00000382537:A1581S;ENSP00000329877:A1564S;ENSP00000382557:A1551S;ENSP00000385724:A1564S;ENSP00000382512:A1564S;ENSP00000382542:A1564S;ENSP00000382526:A1564S;ENSP00000385896:A1564S;ENSP00000382504:A1553S	ENSP00000323129:A1394S	A	+	1	0	CACNA1C	2648426	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	9.601000	0.98297	2.152000	0.67230	0.563000	0.77884	GCC	CACNA1C	-	NULL	ENSG00000151067		0.562	CACNA1C-017	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	CACNA1C	HGNC	protein_coding	OTTHUMT00000317035.1		0.00	39	0	G	NM_000719		2778165	+1			no_errors	ENST00000399634	ensembl	human	known	74_37	missense	9.52	19	2	SNP	1.000	T
CALML3	810	genome.wustl.edu	37	10	5567315	5567315	+	Silent	SNP	C	C	A			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr10:5567315C>A	ENST00000315238.1	+	1	392	c.267C>A	c.(265-267)gcC>gcA	p.A89A	CALML3-AS1_ENST00000545372.1_RNA|CALML3-AS1_ENST00000542093.1_RNA|CALML3-AS1_ENST00000543008.1_RNA|RP11-116G8.5_ENST00000442008.2_RNA	NM_005185.2	NP_005176.1	P27482	CALL3_HUMAN	calmodulin-like 3	89	EF-hand 3. {ECO:0000255|PROSITE- ProRule:PRU00448}.					extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			endometrium(3)|lung(2)	5						TCCGCGAGGCCTTCCGCGTGT	0.652																																					Colon(173;2070 2647 27580 52203)												0													117.0	75.0	90.0					10																	5567315		2203	4300	6503	SO:0001819	synonymous_variant	0			X13461	CCDS7069.1	10p15.1	2013-01-10			ENSG00000178363	ENSG00000178363		"""EF-hand domain containing"""	1452	protein-coding gene	gene with protein product		114184				8476923	Standard	NM_005185		Approved	CLP	uc001iie.1	P27482	OTTHUMG00000017597	ENST00000315238.1:c.267C>A	10.37:g.5567315C>A			B2R9V6|Q5SQI4	Silent	SNP	pfam_EF_hand_dom,pfam_EF-hand_Ca_insen,smart_EF_hand_dom,pfscan_EF_hand_dom	p.A89	ENST00000315238.1	37	c.267	CCDS7069.1	10																																																																																			CALML3	-	pfam_EF_hand_dom,pfam_EF-hand_Ca_insen,smart_EF_hand_dom,pfscan_EF_hand_dom	ENSG00000178363		0.652	CALML3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CALML3	HGNC	protein_coding	OTTHUMT00000046555.1	-	0.00	37	0	C	NM_005185		5567315	+1	tier1	-	no_errors	ENST00000315238	ensembl	human	known	74_37	silent	26.67	11	4	SNP	0.997	A
CAPN8	388743	genome.wustl.edu	37	1	223853341	223853341	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr1:223853341G>A	ENST00000366873.2	-	1	84	c.8C>T	c.(7-9)gCc>gTc	p.A3V	CAPN8_ENST00000366872.5_Missense_Mutation_p.A3V			A6NHC0	CAN8_HUMAN	calpain 8	3					digestion (GO:0007586)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)			NS(1)|endometrium(2)|prostate(1)	4						AGCTGCCTGGGCTGCCATGGC	0.582																																																	0													20.0	20.0	20.0					1																	223853341		692	1591	2283	SO:0001583	missense	0				CCDS73038.1	1q41	2013-01-10	2007-02-21		ENSG00000203697	ENSG00000203697		"""EF-hand domain containing"""	1485	protein-coding gene	gene with protein product			"""calpain 8 (nCL-2)"""			7690035, 8889549	Standard	NM_001143962		Approved	nCL-2	uc009xee.2	A6NHC0	OTTHUMG00000037378	ENST00000366873.2:c.8C>T	1.37:g.223853341G>A	ENSP00000355838:p.Ala3Val		B2RXL2	Missense_Mutation	SNP	pfam_Peptidase_C2_calpain_cat,pfam_Calpain_domain_III,superfamily_Calpain_domain_III,smart_Peptidase_C2_calpain_cat,smart_Calpain_III,pfscan_EF_hand_dom,pfscan_Peptidase_C2_calpain_cat,prints_Calpain_cysteine_protease	p.A3V	ENST00000366873.2	37	c.8		1	.	.	.	.	.	.	.	.	.	.	G	15.86	2.956697	0.53293	.	.	ENSG00000203697	ENST00000366872;ENST00000419193;ENST00000366873	D;D;D	0.89485	-2.52;-2.44;-2.43	5.86	3.94	0.45596	.	0.341617	0.24003	U	0.042450	D	0.85336	0.5673	M	0.63428	1.95	0.09310	N	1	P	0.38922	0.651	B	0.38428	0.273	T	0.79077	-0.1951	10	0.87932	D	0	.	5.7322	0.18047	0.0732:0.3049:0.5002:0.1216	.	3	A6NHC0	CAN8_HUMAN	V	3	ENSP00000355837:A3V;ENSP00000401665:A3V;ENSP00000355838:A3V	ENSP00000355837:A3V	A	-	2	0	CAPN8	221919964	0.028000	0.19301	0.789000	0.31954	0.708000	0.40852	1.843000	0.39259	0.769000	0.33313	0.508000	0.49915	GCC	CAPN8	-	NULL	ENSG00000203697		0.582	CAPN8-001	NOVEL	not_organism_supported|basic|exp_conf	protein_coding	CAPN8	HGNC	protein_coding	OTTHUMT00000171394.3		0.00	38	0	G	NM_001143962		223853341	-1			no_errors	ENST00000366872	ensembl	human	known	74_37	missense	10.00	27	3	SNP	0.138	A
CARD11	84433	genome.wustl.edu	37	7	2976751	2976751	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr7:2976751T>G	ENST00000396946.4	-	9	1664	c.1261A>C	c.(1261-1263)Atg>Ctg	p.M421L		NM_032415.4	NP_115791.3	Q9BXL7	CAR11_HUMAN	caspase recruitment domain family, member 11	421					Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|nucleotide phosphorylation (GO:0046939)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cytokine production (GO:0001819)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of T cell proliferation (GO:0042102)|regulation of apoptotic process (GO:0042981)|regulation of B cell differentiation (GO:0045577)|regulation of T cell differentiation (GO:0045580)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|thymic T cell selection (GO:0045061)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|immunological synapse (GO:0001772)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	CARD domain binding (GO:0050700)|guanylate kinase activity (GO:0004385)			NS(1)|breast(3)|central_nervous_system(1)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(62)|kidney(11)|large_intestine(13)|lung(31)|ovary(4)|prostate(5)|skin(7)|upper_aerodigestive_tract(2)	150		Ovarian(82;0.0115)		OV - Ovarian serous cystadenocarcinoma(56;8.44e-14)		CGCCGCACCATCTCGATCCTC	0.592			Mis		DLBCL																																			Dom	yes		7	7p22	84433	"""caspase recruitment domain family, member 11"""		L	0													160.0	129.0	140.0					7																	2976751		2203	4300	6503	SO:0001583	missense	0			AF322641	CCDS5336.2	7p22	2014-09-17			ENSG00000198286	ENSG00000198286			16393	protein-coding gene	gene with protein product	"""card-maguk protein 1"", ""bcl10-interacting maguk protein 3"""	607210				11278692, 11356195	Standard	NM_032415		Approved	CARMA1, BIMP3	uc003smv.3	Q9BXL7	OTTHUMG00000023023	ENST00000396946.4:c.1261A>C	7.37:g.2976751T>G	ENSP00000380150:p.Met421Leu		A4D1Z7|Q2NKN7|Q548H3	Missense_Mutation	SNP	pfam_CARD,superfamily_DEATH-like_dom,superfamily_P-loop_NTPase,superfamily_PDZ,pfscan_CARD	p.M421L	ENST00000396946.4	37	c.1261	CCDS5336.2	7	.	.	.	.	.	.	.	.	.	.	T	4.500	0.092729	0.08632	.	.	ENSG00000198286	ENST00000396946	T	0.29917	1.55	5.22	1.24	0.21308	.	0.182330	0.56097	N	0.000021	T	0.07773	0.0195	N	0.01576	-0.805	0.37417	D	0.913465	B	0.09022	0.002	B	0.04013	0.001	T	0.38178	-0.9673	10	0.02654	T	1	-37.5613	6.065	0.19858	0.0:0.1524:0.4054:0.4422	.	421	Q9BXL7	CAR11_HUMAN	L	421	ENSP00000380150:M421L	ENSP00000380150:M421L	M	-	1	0	CARD11	2943277	1.000000	0.71417	0.998000	0.56505	0.989000	0.77384	1.524000	0.35942	-0.020000	0.14032	0.459000	0.35465	ATG	CARD11	-	NULL	ENSG00000198286		0.592	CARD11-011	KNOWN	basic|appris_principal|CCDS	protein_coding	CARD11	HGNC	protein_coding	OTTHUMT00000059344.4		0.00	42	0	T	NM_032415		2976751	-1			no_errors	ENST00000396946	ensembl	human	known	74_37	missense	15.00	17	3	SNP	0.995	G
CASC5	57082	genome.wustl.edu	37	15	40914281	40914281	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr15:40914281A>G	ENST00000346991.5	+	11	2287	c.1897A>G	c.(1897-1899)Agc>Ggc	p.S633G	CASC5_ENST00000399668.2_Missense_Mutation_p.S607G|CASC5_ENST00000527044.1_3'UTR			Q8NG31	CASC5_HUMAN	cancer susceptibility candidate 5	633	Interaction with BUB1 and BUB1B.				acrosome assembly (GO:0001675)|attachment of spindle microtubules to kinetochore (GO:0008608)|CENP-A containing nucleosome assembly (GO:0034080)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of phosphatase activity (GO:0010923)|nucleosome assembly (GO:0006334)|protein localization to kinetochore (GO:0034501)|spindle assembly checkpoint (GO:0071173)	acrosomal vesicle (GO:0001669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|kinetochore (GO:0000776)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				NS(1)|breast(7)|central_nervous_system(1)|endometrium(6)|kidney(4)|large_intestine(13)|lung(16)|skin(3)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	57		all_cancers(109;2.03e-18)|all_epithelial(112;4.26e-15)|Lung NSC(122;1.12e-10)|all_lung(180;2.59e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;4.99e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0861)|COAD - Colon adenocarcinoma(120;0.211)		TCAGAGCAAAAGCTCTTCAGA	0.408																																																	0													53.0	50.0	51.0					15																	40914281		1875	4111	5986	SO:0001583	missense	0			AF173994	CCDS42023.1, CCDS42024.1	15q14	2013-07-03			ENSG00000137812	ENSG00000137812		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	24054	protein-coding gene	gene with protein product	"""cancer/testis antigen 29"", ""kinetochore null 1 homolog (C. elegans)"", ""blinkin, bub-linking kinetochore protein"", ""protein phosphatase 1, regulatory subunit 55"""	609173				10980622, 10780384, 18045986	Standard	NM_170589		Approved	D40, AF15Q14, CT29, hKNL-1, KNL1, hSpc105, PPP1R55, Spc7	uc010bbt.1	Q8NG31	OTTHUMG00000166532	ENST00000346991.5:c.1897A>G	15.37:g.40914281A>G	ENSP00000335463:p.Ser633Gly		Q8NHE1|Q8WXA6|Q9HCK2|Q9NR92	Missense_Mutation	SNP	NULL	p.S633G	ENST00000346991.5	37	c.1897	CCDS42023.1	15	.	.	.	.	.	.	.	.	.	.	A	12.07	1.826301	0.32329	.	.	ENSG00000137812	ENST00000346991;ENST00000260369;ENST00000399668	T;T	0.19394	2.15;2.15	4.84	4.84	0.62591	.	0.320512	0.27076	N	0.021050	T	0.22666	0.0547	M	0.66939	2.045	0.18873	N	0.999986	P;P;P	0.46784	0.763;0.557;0.884	B;B;B	0.37144	0.242;0.178;0.23	T	0.24083	-1.0170	10	0.36615	T	0.2	.	14.576	0.68246	1.0:0.0:0.0:0.0	.	607;633;607	Q8NG31-2;Q8NG31;Q8NG31-4	.;CASC5_HUMAN;.	G	633;607;607	ENSP00000335463:S633G;ENSP00000382576:S607G	ENSP00000260369:S607G	S	+	1	0	CASC5	38701573	0.925000	0.31364	0.957000	0.39632	0.059000	0.15707	3.060000	0.49955	2.036000	0.60181	0.455000	0.32223	AGC	CASC5	-	NULL	ENSG00000137812		0.408	CASC5-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CASC5	HGNC	protein_coding	OTTHUMT00000390224.2	-	0.00	37	0	A	NM_144508		40914281	+1	tier1	-	no_errors	ENST00000346991	ensembl	human	known	74_37	missense	16.67	15	3	SNP	0.394	G
CASP8	841	genome.wustl.edu	37	2	202131421	202131421	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr2:202131421G>A	ENST00000432109.2	+	3	401	c.212G>A	c.(211-213)aGa>aAa	p.R71K	CASP8_ENST00000264275.5_Missense_Mutation_p.R71K|CASP8_ENST00000392258.3_Missense_Mutation_p.R71K|CASP8_ENST00000264274.9_Missense_Mutation_p.R71K|CASP8_ENST00000392259.2_Missense_Mutation_p.R71K|CASP8_ENST00000392266.3_Missense_Mutation_p.R71K|CASP8_ENST00000323492.7_Missense_Mutation_p.R71K|CASP8_ENST00000358485.4_Missense_Mutation_p.R130K	NM_033355.3	NP_203519.1	Q14790	CASP8_HUMAN	caspase 8, apoptosis-related cysteine peptidase	71	DED 1. {ECO:0000255|PROSITE- ProRule:PRU00065}.				activation of cysteine-type endopeptidase activity (GO:0097202)|activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|B cell activation (GO:0042113)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to mechanical stimulus (GO:0071260)|cellular response to organic cyclic compound (GO:0071407)|execution phase of apoptosis (GO:0097194)|extrinsic apoptotic signaling pathway (GO:0097191)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|heart development (GO:0007507)|hepatocyte apoptotic process (GO:0097284)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway (GO:0097193)|macrophage differentiation (GO:0030225)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|natural killer cell activation (GO:0030101)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of necroptotic process (GO:0060546)|neural tube formation (GO:0001841)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of proteolysis (GO:0045862)|protein heterooligomerization (GO:0051291)|proteolysis (GO:0006508)|proteolysis involved in cellular protein catabolic process (GO:0051603)|regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001239)|regulation of thymocyte apoptotic process (GO:0070243)|response to antibiotic (GO:0046677)|response to cobalt ion (GO:0032025)|response to cold (GO:0009409)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to lipopolysaccharide (GO:0032496)|response to tumor necrosis factor (GO:0034612)|syncytiotrophoblast cell differentiation involved in labyrinthine layer development (GO:0060715)|T cell activation (GO:0042110)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRAIL-activated apoptotic signaling pathway (GO:0036462)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|viral process (GO:0016032)	CD95 death-inducing signaling complex (GO:0031265)|cell body (GO:0044297)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|death-inducing signaling complex (GO:0031264)|membrane raft (GO:0045121)|microtubule organizing center (GO:0005815)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|Noc1p-Noc2p complex (GO:0030690)|nucleus (GO:0005634)|ripoptosome (GO:0097342)	cysteine-type endopeptidase activity (GO:0004197)|cysteine-type endopeptidase activity involved in apoptotic process (GO:0097153)|cysteine-type endopeptidase activity involved in apoptotic signaling pathway (GO:0097199)|cysteine-type peptidase activity (GO:0008234)|death effector domain binding (GO:0035877)|peptidase activity (GO:0008233)|scaffold protein binding (GO:0097110)|ubiquitin protein ligase binding (GO:0031625)			breast(5)|cervix(2)|endometrium(6)|large_intestine(11)|lung(10)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(9)|urinary_tract(3)	52						CGAATTAATAGACTGGATTTG	0.458										HNSCC(4;0.00038)																											Melanoma(82;831 1348 20716 36952 40159)												0													65.0	66.0	66.0					2																	202131421		2203	4300	6503	SO:0001583	missense	0			U60520	CCDS2342.1, CCDS2343.1, CCDS2345.1, CCDS42798.1, CCDS42799.1	2q33-q34	2014-09-17	2005-08-17		ENSG00000064012	ENSG00000064012		"""Caspases"""	1509	protein-coding gene	gene with protein product		601763	"""caspase 8, apoptosis-related cysteine protease"""			8681376, 8681377	Standard	NM_033355		Approved	MCH5, MACH, FLICE, Casp-8	uc002uxt.1	Q14790	OTTHUMG00000132821	ENST00000432109.2:c.212G>A	2.37:g.202131421G>A	ENSP00000412523:p.Arg71Lys		O14676|Q14791|Q14792|Q14793|Q14794|Q14795|Q14796|Q15780|Q15806|Q53TT5|Q8TDI1|Q8TDI2|Q8TDI3|Q8TDI4|Q8TDI5|Q96T22|Q9C0K4|Q9UQ81	Missense_Mutation	SNP	pfam_DED,pfam_Pept_C14_caspase,superfamily_DEATH-like_dom,smart_DED,smart_Pept_C14A_p45_core,pfscan_DED,pfscan_Pept_C14_p10,pfscan_Pept_C14_ICE_p20,prints_Pept_C14A_p45_core	p.R130K	ENST00000432109.2	37	c.389	CCDS2342.1	2	.	.	.	.	.	.	.	.	.	.	G	18.93	3.727044	0.69074	.	.	ENSG00000064012	ENST00000392263;ENST00000264274;ENST00000392259;ENST00000392266;ENST00000432109;ENST00000264275;ENST00000440732;ENST00000392258;ENST00000447616;ENST00000358485;ENST00000392261;ENST00000413726;ENST00000323492;ENST00000429881	D;D;D;D;D;D;D;D;D;D;D;D;D	0.85013	-1.93;-1.93;-1.93;-1.93;-1.93;-1.93;-1.93;-1.93;-1.93;-1.93;-1.93;-1.93;-1.93	5.58	3.79	0.43588	DEATH-like (2);Death effector (3);	0.117372	0.64402	D	0.000015	D	0.92496	0.7617	H	0.94462	3.54	0.09310	N	1	P;D;D;D;D;D;D;D;D	0.76494	0.783;0.994;0.996;0.998;0.999;0.998;0.995;0.993;0.996	B;D;D;D;D;D;P;P;D	0.72075	0.287;0.958;0.93;0.976;0.944;0.973;0.897;0.871;0.93	D	0.85392	0.1126	10	0.07813	T	0.8	.	11.5745	0.50854	0.1282:0.0:0.8718:0.0	.	71;71;71;71;130;71;71;71;71	Q14790-3;E7ETB7;Q14790-7;A8MU92;Q14790-9;Q14790;Q14790-2;Q14790-4;Q14790-5	.;.;.;.;.;CASP8_HUMAN;.;.;.	K	71;71;71;71;71;71;71;71;71;130;71;71;71;71	ENSP00000376091:R71K;ENSP00000264274:R71K;ENSP00000376088:R71K;ENSP00000376094:R71K;ENSP00000412523:R71K;ENSP00000264275:R71K;ENSP00000396869:R71K;ENSP00000376087:R71K;ENSP00000388306:R71K;ENSP00000351273:R130K;ENSP00000397528:R71K;ENSP00000325722:R71K;ENSP00000390641:R71K	ENSP00000264274:R71K	R	+	2	0	CASP8	201839666	0.960000	0.32886	0.003000	0.11579	0.007000	0.05969	5.608000	0.67654	0.718000	0.32166	0.561000	0.74099	AGA	CASP8	-	pfam_DED,superfamily_DEATH-like_dom,smart_DED,pfscan_DED	ENSG00000064012		0.458	CASP8-014	KNOWN	basic|appris_candidate|CCDS	protein_coding	CASP8	HGNC	protein_coding	OTTHUMT00000336853.2		0.00	44	0	G	NM_001228		202131421	+1			no_errors	ENST00000358485	ensembl	human	known	74_37	missense	5.88	31	2	SNP	0.040	A
CCAR2	57805	genome.wustl.edu	37	8	22473234	22473234	+	Nonsense_Mutation	SNP	C	C	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr8:22473234C>T	ENST00000308511.4	+	13	1666	c.1417C>T	c.(1417-1419)Caa>Taa	p.Q473*	CCAR2_ENST00000520861.1_Nonsense_Mutation_p.Q148*|CCAR2_ENST00000389279.3_Nonsense_Mutation_p.Q473*|RP11-582J16.5_ENST00000521025.1_RNA			Q8N163	CCAR2_HUMAN	cell cycle and apoptosis regulator 2	473					cell cycle (GO:0007049)|cellular response to DNA damage stimulus (GO:0006974)|mitochondrial fragmentation involved in apoptotic process (GO:0043653)|mRNA processing (GO:0006397)|negative regulation of catalytic activity (GO:0043086)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902230)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA damage checkpoint (GO:2000003)|regulation of circadian rhythm (GO:0042752)|regulation of DNA-templated transcription, elongation (GO:0032784)|regulation of protein stability (GO:0031647)|response to UV (GO:0009411)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|DBIRD complex (GO:0044609)|mitochondrial matrix (GO:0005759)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|enzyme inhibitor activity (GO:0004857)|poly(A) RNA binding (GO:0044822)|RNA polymerase II core binding (GO:0000993)										TGCCTTGGAGCAAGCAGCAGA	0.582																																																	0													83.0	88.0	87.0					8																	22473234		2203	4300	6503	SO:0001587	stop_gained	0			AL834351	CCDS34863.1	8p22	2013-08-22	2013-08-22	2013-08-22		ENSG00000158941			23360	protein-coding gene	gene with protein product	"""deleted in breast cancer"""	607359	"""KIAA1967"""	KIAA1967		12370419	Standard	NM_021174		Approved	DBC-1, DBC1, NET35	uc003xci.3	Q8N163		ENST00000308511.4:c.1417C>T	8.37:g.22473234C>T	ENSP00000310670:p.Gln473*		A6NL03|B2RB79|D3DSR6|Q6P0Q9|Q8N3G7|Q8N8M1|Q8TF34|Q9H9Q9|Q9HD12|Q9NT55	Nonsense_Mutation	SNP	superfamily_NA-bd_OB-fold	p.Q473*	ENST00000308511.4	37	c.1417	CCDS34863.1	8	.	.	.	.	.	.	.	.	.	.	C	37	6.594801	0.97692	.	.	ENSG00000158941	ENST00000308511;ENST00000389279;ENST00000520861	.	.	.	6.07	6.07	0.98685	.	0.496019	0.19559	N	0.111380	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06099	T	0.92	-7.5618	16.144	0.81551	0.0:1.0:0.0:0.0	.	.	.	.	X	473;473;148	.	ENSP00000310670:Q473X	Q	+	1	0	KIAA1967	22529179	0.834000	0.29399	0.996000	0.52242	0.048000	0.14542	2.741000	0.47426	2.884000	0.98904	0.655000	0.94253	CAA	CCAR2	-	NULL	ENSG00000158941		0.582	CCAR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCAR2	HGNC	protein_coding	OTTHUMT00000375865.1	-	0.00	31	0	C	NM_021174		22473234	+1	tier1	-	no_errors	ENST00000308511	ensembl	human	known	74_37	nonsense	58.82	7	10	SNP	0.999	T
CCDC157	550631	genome.wustl.edu	37	22	30768244	30768244	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr22:30768244C>G	ENST00000405659.1	+	7	2013	c.1304C>G	c.(1303-1305)gCc>gGc	p.A435G	CCDC157_ENST00000338306.3_Missense_Mutation_p.A435G|RP1-130H16.16_ENST00000332468.4_RNA			Q569K6	CC157_HUMAN	coiled-coil domain containing 157	435										central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(5)|skin(3)|upper_aerodigestive_tract(1)	15						AAGGAGAAGGCCCGTGTCGAC	0.662																																																	0													16.0	17.0	17.0					22																	30768244		2199	4297	6496	SO:0001583	missense	0			BC018040	CCDS33632.2	22q12.2	2009-03-05			ENSG00000187860	ENSG00000187860			33854	protein-coding gene	gene with protein product							Standard	NM_001017437		Approved		uc011aku.2	Q569K6	OTTHUMG00000151007	ENST00000405659.1:c.1304C>G	22.37:g.30768244C>G	ENSP00000385357:p.Ala435Gly		Q0VD76|Q9BYA4	Missense_Mutation	SNP	superfamily_Prefoldin,superfamily_t-SNARE	p.A435G	ENST00000405659.1	37	c.1304	CCDS33632.2	22	.	.	.	.	.	.	.	.	.	.	C	15.54	2.862947	0.51482	.	.	ENSG00000187860	ENST00000405659;ENST00000338306	T;T	0.39406	1.08;1.08	4.91	3.88	0.44766	.	0.000000	0.85682	D	0.000000	T	0.50222	0.1603	L	0.51422	1.61	0.80722	D	1	D	0.59767	0.986	P	0.58130	0.833	T	0.51012	-0.8759	10	0.59425	D	0.04	-24.0783	10.2535	0.43383	0.0:0.8399:0.0:0.1601	.	435	Q569K6	CC157_HUMAN	G	435	ENSP00000385357:A435G;ENSP00000343087:A435G	ENSP00000343087:A435G	A	+	2	0	CCDC157	29098244	1.000000	0.71417	1.000000	0.80357	0.729000	0.41735	1.661000	0.37408	1.284000	0.44531	0.563000	0.77884	GCC	CCDC157	-	NULL	ENSG00000187860		0.662	CCDC157-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CCDC157	HGNC	protein_coding	OTTHUMT00000320936.1	-	0.00	56	0	C	NM_001017437		30768244	+1	tier1	-	no_errors	ENST00000338306	ensembl	human	known	74_37	missense	18.18	26	6	SNP	1.000	G
TMEM205	374882	genome.wustl.edu	37	19	11459651	11459651	+	5'Flank	SNP	C	C	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr19:11459651C>T	ENST00000354882.5	-	0	0				TMEM205_ENST00000593256.2_5'Flank|CCDC159_ENST00000458408.1_Intron|TMEM205_ENST00000587948.1_5'Flank|TMEM205_ENST00000447337.1_5'Flank|TMEM205_ENST00000588560.1_5'Flank|TMEM205_ENST00000586590.1_5'Flank|TMEM205_ENST00000586218.1_5'Flank|RAB3D_ENST00000589655.1_5'Flank|TMEM205_ENST00000586956.1_5'Flank|TMEM205_ENST00000589555.1_5'Flank|CCDC159_ENST00000588790.1_Intron			Q6UW68	TM205_HUMAN	transmembrane protein 205							extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				endometrium(1)|lung(1)	2						GGCTCTTCCTCGGACAAGGCT	0.627																																																	0													19.0	20.0	19.0					19																	11459651		1928	4157	6085	SO:0001631	upstream_gene_variant	0			AK127147	CCDS32909.1	19p13.2	2008-01-09				ENSG00000105518			29631	protein-coding gene	gene with protein product		613771				12975309	Standard	NM_198536		Approved	UNQ501, MBC3205	uc002mrb.2	Q6UW68			19.37:g.11459651C>T	Exception_encountered			Missense_Mutation	SNP	NULL	p.R11W	ENST00000354882.5	37	c.31	CCDS32909.1	19	.	.	.	.	.	.	.	.	.	.	C	8.171	0.791785	0.16258	.	.	ENSG00000183401	ENST00000427879	.	.	.	3.9	1.78	0.24846	.	.	.	.	.	T	0.29556	0.0737	.	.	.	0.21220	N	0.999753	B	0.20261	0.043	B	0.15052	0.012	T	0.25398	-1.0133	7	0.66056	D	0.02	.	6.2013	0.20577	0.0:0.7712:0.0:0.2288	.	49	P0C7I6	CC159_HUMAN	L	49	.	ENSP00000390400:S49L	S	+	2	0	CCDC159	11320651	0.839000	0.29477	0.254000	0.24359	0.034000	0.12701	0.507000	0.22675	0.618000	0.30179	-0.244000	0.11960	TCG	CCDC159	-	NULL	ENSG00000183401		0.627	TMEM205-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	CCDC159	HGNC	protein_coding	OTTHUMT00000458743.1	-	0.00	47	0	C	NM_198536		11459651	+1	tier1	-	no_errors	ENST00000590636	ensembl	human	known	74_37	missense	13.04	20	3	SNP	0.332	T
CCDC30	728621	genome.wustl.edu	37	1	43004883	43004883	+	Missense_Mutation	SNP	A	A	G	rs369098834		TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr1:43004883A>G	ENST00000340612.4	+	2	157	c.157A>G	c.(157-159)Aat>Gat	p.N53D	CCDC30_ENST00000342022.4_Missense_Mutation_p.N53D|CCDC30_ENST00000428554.2_Missense_Mutation_p.N53D|CCDC30_ENST00000507855.1_Intron			Q5VVM6	CCD30_HUMAN	coiled-coil domain containing 30	53						extracellular vesicular exosome (GO:0070062)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(11)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(2)	30						ATGCCTTTATAATGAAGTTCA	0.313																																																	0													77.0	82.0	81.0					1																	43004883		2203	4300	6503	SO:0001583	missense	0			AY639646	CCDS30690.1	1p34.2	2009-07-09			ENSG00000186409	ENSG00000186409			26103	protein-coding gene	gene with protein product	"""prefoldin 6-like"""					16710767	Standard	NM_001080850		Approved	FLJ20972, PFD6L, LOC728621	uc009vwk.1	Q5VVM6	OTTHUMG00000007334	ENST00000340612.4:c.157A>G	1.37:g.43004883A>G	ENSP00000340378:p.Asn53Asp		Q14F06|Q5VVM5	Missense_Mutation	SNP	NULL	p.N53D	ENST00000340612.4	37	c.157	CCDS30690.1	1	.	.	.	.	.	.	.	.	.	.	A	8.789	0.930137	0.18131	.	.	ENSG00000186409	ENST00000428554;ENST00000340612;ENST00000342022	T;T;T	0.49720	0.77;0.77;0.77	5.33	1.57	0.23409	.	0.823352	0.11098	N	0.600023	T	0.30166	0.0756	L	0.40543	1.245	0.80722	D	1	B	0.11235	0.004	B	0.09377	0.004	T	0.23797	-1.0178	10	0.05436	T	0.98	.	5.1402	0.14955	0.5463:0.3528:0.1009:0.0	.	53	Q5VVM6	CCD30_HUMAN	D	53	ENSP00000397035:N53D;ENSP00000340378:N53D;ENSP00000339280:N53D	ENSP00000340378:N53D	N	+	1	0	CCDC30	42777470	1.000000	0.71417	0.996000	0.52242	0.580000	0.36256	1.614000	0.36911	0.011000	0.14865	0.402000	0.26972	AAT	CCDC30	-	NULL	ENSG00000186409		0.313	CCDC30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC30	HGNC	protein_coding	OTTHUMT00000019524.3	-	0.00	89	0	A	NM_025030		43004883	+1	tier1	-	no_errors	ENST00000340612	ensembl	human	known	74_37	missense	7.55	49	4	SNP	0.999	G
CCDC38	120935	genome.wustl.edu	37	12	96266178	96266178	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr12:96266178C>T	ENST00000344280.3	-	14	1896	c.1339G>A	c.(1339-1341)Gat>Aat	p.D447N	SNRPF_ENST00000552085.1_Intron|SNRPF_ENST00000553192.1_Intron	NM_182496.2	NP_872302.2	Q502W7	CCD38_HUMAN	coiled-coil domain containing 38	447										breast(1)|endometrium(2)|large_intestine(3)|lung(9)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18						TCCTCAGCATCTCCAATGCAG	0.398																																																	0													148.0	146.0	147.0					12																	96266178		2203	4300	6503	SO:0001583	missense	0			AK097408	CCDS9056.1	12q23.1	2005-11-02				ENSG00000165972			26843	protein-coding gene	gene with protein product							Standard	NM_182496		Approved	FLJ40089	uc001tek.2	Q502W7	OTTHUMG00000170352	ENST00000344280.3:c.1339G>A	12.37:g.96266178C>T	ENSP00000345470:p.Asp447Asn		Q8N835	Missense_Mutation	SNP	NULL	p.D447N	ENST00000344280.3	37	c.1339	CCDS9056.1	12	.	.	.	.	.	.	.	.	.	.	C	16.86	3.239256	0.58995	.	.	ENSG00000165972	ENST00000344280	T	0.34859	1.34	5.53	5.53	0.82687	.	0.110878	0.64402	D	0.000009	T	0.51075	0.1653	L	0.47716	1.5	0.80722	D	1	D	0.76494	0.999	D	0.64144	0.922	T	0.22452	-1.0216	10	0.22109	T	0.4	-25.6389	18.5973	0.91234	0.0:1.0:0.0:0.0	.	447	Q502W7	CCD38_HUMAN	N	447	ENSP00000345470:D447N	ENSP00000345470:D447N	D	-	1	0	CCDC38	94790309	1.000000	0.71417	0.997000	0.53966	0.313000	0.28021	4.386000	0.59620	2.765000	0.95021	0.555000	0.69702	GAT	CCDC38	-	NULL	ENSG00000165972		0.398	CCDC38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC38	HGNC	protein_coding	OTTHUMT00000408634.1	-	0.00	65	0	C	NM_182496		96266178	-1	tier1	-	no_errors	ENST00000344280	ensembl	human	known	74_37	missense	15.38	33	6	SNP	0.999	T
CCDC88A	55704	genome.wustl.edu	37	2	55616015	55616015	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr2:55616015T>G	ENST00000436346.1	-	3	1013	c.172A>C	c.(172-174)Aaa>Caa	p.K58Q	CCDC88A_ENST00000263630.8_Missense_Mutation_p.K58Q|CCDC88A_ENST00000336838.6_Missense_Mutation_p.K58Q|CCDC88A_ENST00000413716.2_Missense_Mutation_p.K58Q	NM_001135597.1|NM_001254943.1	NP_001129069.1|NP_001241872.1	Q3V6T2	GRDN_HUMAN	coiled-coil domain containing 88A	58					activation of protein kinase B activity (GO:0032148)|cell migration (GO:0016477)|DNA replication (GO:0006260)|lamellipodium assembly (GO:0030032)|membrane organization (GO:0061024)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell proliferation (GO:0042127)|regulation of DNA replication (GO:0006275)|regulation of neuron projection development (GO:0010975)|regulation of protein phosphorylation (GO:0001932)|TOR signaling (GO:0031929)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|membrane (GO:0016020)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|microtubule binding (GO:0008017)|phosphatidylinositol binding (GO:0035091)|protein homodimerization activity (GO:0042803)|protein kinase B binding (GO:0043422)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(22)|lung(23)|ovary(3)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|urinary_tract(1)	69						CTCTCCAATTTAGGATTACTG	0.224																																																	0													59.0	63.0	62.0					2																	55616015		2202	4280	6482	SO:0001583	missense	0			AB033038, AF112218	CCDS33203.1, CCDS46288.1, CCDS58710.1	2p16.3	2013-03-13	2007-05-31	2007-05-31	ENSG00000115355	ENSG00000115355			25523	protein-coding gene	gene with protein product	"""Galpha-interacting vesicle-associated protein"", ""Akt-phosphorylation enhancer"", ""girdin"", ""girders of actin filaments"""	609736	"""KIAA1212"""	KIAA1212		15749703, 15753085	Standard	NM_001135597		Approved	FLJ10392, APE, GIV, HkRP1, GRDN	uc002ryv.2	Q3V6T2	OTTHUMG00000151915	ENST00000436346.1:c.172A>C	2.37:g.55616015T>G	ENSP00000410608:p.Lys58Gln		A1IGE7|B7ZM78|C9JG83|Q53SF1|Q581G3|Q5HYD0|Q7Z339|Q7Z3C5	Missense_Mutation	SNP	pfam_Hook-related_fam,superfamily_Prefoldin,superfamily_t-SNARE	p.K58Q	ENST00000436346.1	37	c.172		2	.	.	.	.	.	.	.	.	.	.	T	25.3	4.620066	0.87460	.	.	ENSG00000115355	ENST00000336838;ENST00000263630;ENST00000436346;ENST00000413716	T;T;T;T	0.41400	1.0;1.0;1.0;1.0	5.97	5.97	0.96955	.	0.000000	0.50627	U	0.000111	T	0.59542	0.2201	L	0.54323	1.7	0.80722	D	1	D;D;D	0.63880	0.971;0.993;0.993	P;P;D	0.66602	0.811;0.886;0.945	T	0.60697	-0.7212	10	0.62326	D	0.03	-28.1862	16.1075	0.81236	0.0:0.0:0.0:1.0	.	58;58;58	B7ZM78;Q3V6T2-2;Q3V6T2-3	.;.;.	Q	58	ENSP00000338728:K58Q;ENSP00000263630:K58Q;ENSP00000410608:K58Q;ENSP00000404431:K58Q	ENSP00000263630:K58Q	K	-	1	0	CCDC88A	55469519	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	5.867000	0.69597	2.285000	0.76669	0.528000	0.53228	AAA	CCDC88A	-	pfam_Hook-related_fam	ENSG00000115355		0.224	CCDC88A-203	KNOWN	basic	protein_coding	CCDC88A	HGNC	protein_coding			0.00	68	0	T	NM_017571		55616015	-1			no_errors	ENST00000436346	ensembl	human	known	74_37	missense	12.82	34	5	SNP	1.000	G
CCDC88C	440193	genome.wustl.edu	37	14	91787488	91787490	+	In_Frame_Del	DEL	CTT	CTT	-			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	CTT	CTT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr14:91787488_91787490delCTT	ENST00000389857.6	-	13	1587_1589	c.1501_1503delAAG	c.(1501-1503)aagdel	p.K501del		NM_001080414.3	NP_001073883.2	Q9P219	DAPLE_HUMAN	coiled-coil domain containing 88C	501					protein destabilization (GO:0031648)|protein homooligomerization (GO:0051260)|regulation of protein phosphorylation (GO:0001932)|Wnt signaling pathway (GO:0016055)		PDZ domain binding (GO:0030165)|protein self-association (GO:0043621)			central_nervous_system(3)|endometrium(2)|kidney(3)|large_intestine(2)|lung(6)|ovary(6)|pancreas(1)|urinary_tract(1)	24		all_cancers(154;0.0468)				GGTGGTTCTCCTTCTCCAGCTCC	0.631																																																	0																																										SO:0001651	inframe_deletion	0				CCDS45151.1	14q32.12	2014-07-30	2007-05-31	2007-05-31		ENSG00000015133			19967	protein-coding gene	gene with protein product	"""Dvl-associating protein with a high frequency of leucine residues"", ""spinocerebellar ataxia 40"""	611204	"""KIAA1509"""	KIAA1509		17185515, 25062847	Standard	NM_001080414		Approved	DAPLE, HkRP2, SCA40	uc010aty.3	Q9P219		ENST00000389857.6:c.1501_1503delAAG	14.37:g.91787488_91787490delCTT	ENSP00000374507:p.Lys501del		Q69YK1|Q7L1M2|Q86SX7|Q8IYG8	In_Frame_Del	DEL	pfam_Hook-related_fam,superfamily_Prefoldin,superfamily_Fum_Rdtase/Succ_DH_flav-like_C	p.K501in_frame_del	ENST00000389857.6	37	c.1503_1501	CCDS45151.1	14																																																																																			CCDC88C	-	pfam_Hook-related_fam	ENSG00000015133		0.631	CCDC88C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC88C	HGNC	protein_coding	OTTHUMT00000411650.1		0.00	33	0	CTT	XM_029353		91787490	-1	tier1		no_errors	ENST00000389857	ensembl	human	known	74_37	in_frame_del	16.67	10	2	DEL	1.000:1.000:1.000	-
CD244	51744	genome.wustl.edu	37	1	160811200	160811200	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr1:160811200C>T	ENST00000368033.3	-	3	552	c.470G>A	c.(469-471)tGc>tAc	p.C157Y	CD244_ENST00000368032.2_Missense_Mutation_p.C152Y|CD244_ENST00000322302.7_Intron|CD244_ENST00000368034.4_Missense_Mutation_p.C152Y|CD244_ENST00000481677.1_5'Flank			Q9BZW8	CD244_HUMAN	CD244 molecule, natural killer cell receptor 2B4	157	Ig-like 2.				blood coagulation (GO:0007596)|leukocyte migration (GO:0050900)|signal transduction (GO:0007165)	external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			central_nervous_system(1)|large_intestine(3)|lung(12)|ovary(1)|urinary_tract(1)	18	all_cancers(52;2.72e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00737)			GGAGACCAAGCAAGACAGAGC	0.542																																																	0													153.0	136.0	142.0					1																	160811200		2203	4300	6503	SO:0001583	missense	0			AF105261	CCDS1210.1, CCDS53398.1, CCDS53399.1	1q23.1	2013-01-11	2006-03-29		ENSG00000122223	ENSG00000122223		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18171	protein-coding gene	gene with protein product		605554	"""natural killer cell receptor 2B4"", ""CD244 natural killer cell receptor 2B4"""			3772297, 10458320	Standard	NM_016382		Approved	2B4, NAIL, NKR2B4, Nmrk, SLAMF4	uc009wtq.3	Q9BZW8	OTTHUMG00000028606	ENST00000368033.3:c.470G>A	1.37:g.160811200C>T	ENSP00000357012:p.Cys157Tyr		Q5VYI2|Q5VYI6|Q5VYI7|Q96T47|Q9NQD2|Q9NQD3|Q9Y288	Missense_Mutation	SNP	pfam_NK_rcpt_2B4_Ig_dom,pfscan_Ig-like_dom	p.C157Y	ENST00000368033.3	37	c.470	CCDS53399.1	1	.	.	.	.	.	.	.	.	.	.	C	19.47	3.833820	0.71258	.	.	ENSG00000122223	ENST00000368034;ENST00000368033;ENST00000368032	D;D;D	0.94537	-3.45;-3.45;-3.45	4.73	4.73	0.59995	Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.96904	0.8989	M	0.84511	2.7	0.43095	D	0.994771	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.97512	1.0067	10	0.87932	D	0	-15.6026	13.5848	0.61924	0.0:1.0:0.0:0.0	.	157;152	Q9BZW8;Q9BZW8-2	CD244_HUMAN;.	Y	152;157;152	ENSP00000357013:C152Y;ENSP00000357012:C157Y;ENSP00000357011:C152Y	ENSP00000357011:C152Y	C	-	2	0	CD244	159077824	1.000000	0.71417	0.287000	0.24848	0.370000	0.29829	3.464000	0.53057	2.353000	0.79882	0.655000	0.94253	TGC	CD244	-	pfscan_Ig-like_dom	ENSG00000122223		0.542	CD244-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CD244	HGNC	protein_coding	OTTHUMT00000071469.1	-	0.00	41	0	C	NM_016382		160811200	-1	tier1	-	no_errors	ENST00000368033	ensembl	human	known	74_37	missense	15.38	22	4	SNP	0.980	T
CDH7	1005	genome.wustl.edu	37	18	63530073	63530073	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr18:63530073A>G	ENST00000397968.2	+	11	2210	c.1784A>G	c.(1783-1785)aAt>aGt	p.N595S	CDH7_ENST00000536984.2_Missense_Mutation_p.N595S|RP11-389J22.1_ENST00000581987.1_RNA|CDH7_ENST00000323011.3_Missense_Mutation_p.N595S	NM_004361.2	NP_004352.2	Q9ULB5	CADH7_HUMAN	cadherin 7, type 2	595	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.			AQTCNAEAYV -> TQTAMQRLC (in Ref. 1; CAC13127). {ECO:0000305}.	adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(43)|ovary(3)|pancreas(1)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(2)	80		Esophageal squamous(42;0.129)				CAGACCTGCAATGCAGAGGCC	0.542																																																	0													116.0	96.0	103.0					18																	63530073		2203	4300	6503	SO:0001583	missense	0			AB035301	CCDS11993.1	18q22.1	2010-01-26			ENSG00000081138	ENSG00000081138		"""Cadherins / Major cadherins"""	1766	protein-coding gene	gene with protein product		605806				9615235	Standard	NM_033646		Approved		uc002ljz.3	Q9ULB5	OTTHUMG00000132800	ENST00000397968.2:c.1784A>G	18.37:g.63530073A>G	ENSP00000381058:p.Asn595Ser		Q9H157	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.N595S	ENST00000397968.2	37	c.1784	CCDS11993.1	18	.	.	.	.	.	.	.	.	.	.	A	9.525	1.109243	0.20714	.	.	ENSG00000081138	ENST00000323011;ENST00000536984;ENST00000397966;ENST00000397968	T;T;T	0.54071	0.59;0.61;0.59	5.37	5.37	0.77165	Cadherin (1);	0.162254	0.53938	D	0.000046	T	0.40347	0.1113	L	0.35793	1.09	0.36668	D	0.87831	B;B	0.10296	0.003;0.0	B;B	0.13407	0.009;0.001	T	0.41520	-0.9504	10	0.23302	T	0.38	.	9.8238	0.40899	0.923:0.0:0.077:0.0	.	595;595	F5H5X9;Q9ULB5	.;CADH7_HUMAN	S	595	ENSP00000319166:N595S;ENSP00000443030:N595S;ENSP00000381058:N595S	ENSP00000319166:N595S	N	+	2	0	CDH7	61681053	0.994000	0.37717	0.977000	0.42913	0.581000	0.36288	3.008000	0.49544	2.044000	0.60594	0.482000	0.46254	AAT	CDH7	-	pfscan_Cadherin	ENSG00000081138		0.542	CDH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH7	HGNC	protein_coding	OTTHUMT00000256217.2	-	0.00	22	0	A	NM_033646		63530073	+1	tier1	-	no_errors	ENST00000323011	ensembl	human	known	74_37	missense	40.00	6	4	SNP	0.984	G
CDK13	8621	genome.wustl.edu	37	7	40127865	40127865	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr7:40127865A>C	ENST00000181839.4	+	12	3775	c.3170A>C	c.(3169-3171)aAc>aCc	p.N1057T	CDK13_ENST00000340829.5_Missense_Mutation_p.N1057T	NM_003718.4|NM_031267.3	NP_003709.3|NP_112557.2	Q14004	CDK13_HUMAN	cyclin-dependent kinase 13	1057					alternative mRNA splicing, via spliceosome (GO:0000380)|hemopoiesis (GO:0030097)|multicellular organismal development (GO:0007275)|phosphorylation of RNA polymerase II C-terminal domain (GO:0070816)|positive regulation of cell proliferation (GO:0008284)|regulation of mitosis (GO:0007088)|viral process (GO:0016032)	cyclin K-CDK13 complex (GO:0002945)|extracellular space (GO:0005615)|nuclear cyclin-dependent protein kinase holoenzyme complex (GO:0019908)|nuclear speck (GO:0016607)	ATP binding (GO:0005524)|cyclin binding (GO:0030332)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|RNA polymerase II carboxy-terminal domain kinase activity (GO:0008353)			cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(19)|ovary(1)|pancreas(2)|prostate(2)|skin(5)|stomach(2)|urinary_tract(1)	49						AGCAGAACCAACACACCCCAG	0.502																																																	0													88.0	78.0	82.0					7																	40127865		2203	4300	6503	SO:0001583	missense	0			M80629	CCDS5461.1, CCDS5462.1	7p14.1	2011-11-08	2009-12-16	2009-12-16	ENSG00000065883	ENSG00000065883		"""Cyclin-dependent kinases"""	1733	protein-coding gene	gene with protein product	"""cholinesterase-related cell division controller"""	603309	"""cell division cycle 2-like 5 (cholinesterase-related cell division controller)"""	CDC2L5		1731328, 19884882	Standard	NM_003718		Approved	CHED, CDC2L, KIAA1791	uc003thh.4	Q14004	OTTHUMG00000023726	ENST00000181839.4:c.3170A>C	7.37:g.40127865A>C	ENSP00000181839:p.Asn1057Thr		Q53G78|Q6DKQ9|Q75MH4|Q75MH5|Q96JN4|Q9H4A0|Q9H4A1|Q9UDR4	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.N1057T	ENST00000181839.4	37	c.3170	CCDS5461.1	7	.	.	.	.	.	.	.	.	.	.	A	15.45	2.837025	0.50951	.	.	ENSG00000065883	ENST00000181839;ENST00000340829	T;T	0.52295	0.67;0.67	5.25	-5.49	0.02584	.	.	.	.	.	T	0.33265	0.0857	L	0.39898	1.24	0.34400	D	0.695148	B;B	0.30686	0.29;0.035	B;B	0.26094	0.066;0.029	T	0.18587	-1.0332	8	.	.	.	-2.9946	14.6198	0.68576	0.5983:0.0:0.4017:0.0	.	1057;1057	Q14004-2;Q14004	.;CDK13_HUMAN	T	1057	ENSP00000181839:N1057T;ENSP00000340557:N1057T	.	N	+	2	0	CDK13	40094390	0.980000	0.34600	0.491000	0.27477	0.968000	0.65278	0.424000	0.21330	-1.027000	0.03325	0.528000	0.53228	AAC	CDK13	-	NULL	ENSG00000065883		0.502	CDK13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CDK13	HGNC	protein_coding	OTTHUMT00000250726.2		0.00	51	0	A	NM_003718		40127865	+1			no_errors	ENST00000181839	ensembl	human	known	74_37	missense	12.50	21	3	SNP	0.990	C
CDKN2A	1029	genome.wustl.edu	37	9	21971111	21971111	+	Missense_Mutation	SNP	G	G	A	rs121913385		TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr9:21971111G>A	ENST00000304494.5	-	2	517	c.247C>T	c.(247-249)Cac>Tac	p.H83Y	CDKN2A_ENST00000498124.1_Missense_Mutation_p.H83Y|RP11-145E5.5_ENST00000404796.2_Intron|CDKN2A_ENST00000579122.1_Missense_Mutation_p.H83Y|CDKN2A_ENST00000446177.1_Missense_Mutation_p.H83Y|CDKN2A_ENST00000578845.2_Missense_Mutation_p.H32Y|CDKN2A_ENST00000498628.2_Missense_Mutation_p.H32Y|CDKN2A_ENST00000497750.1_Missense_Mutation_p.H32Y|CDKN2A_ENST00000579755.1_Missense_Mutation_p.A97V|CDKN2A_ENST00000361570.3_Missense_Mutation_p.A138V|CDKN2A_ENST00000479692.2_Missense_Mutation_p.H32Y|CDKN2A_ENST00000494262.1_Missense_Mutation_p.H32Y|CDKN2A_ENST00000530628.2_Missense_Mutation_p.A97V	NM_000077.4	NP_000068.1	P42771	CD2A1_HUMAN	cyclin-dependent kinase inhibitor 2A	83			H -> N (in a lung tumor).|H -> Q (in dbSNP:rs34968276).|H -> Y (in a pancreas and a head and neck tumor).		cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of phosphorylation (GO:0042326)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cellular senescence (GO:2000774)|positive regulation of macrophage apoptotic process (GO:2000111)|positive regulation of smooth muscle cell apoptotic process (GO:0034393)|Ras protein signal transduction (GO:0007265)|replicative senescence (GO:0090399)|senescence-associated heterochromatin focus assembly (GO:0035986)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|senescence-associated heterochromatin focus (GO:0035985)	cyclin-dependent protein serine/threonine kinase inhibitor activity (GO:0004861)|NF-kappaB binding (GO:0051059)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)	p.0?(1315)|p.?(44)|p.H83Y(30)|p.A138V(2)|p.H83fs*2(2)|p.H83N(1)|p.V82fs*62(1)|p.0(1)|p.V82_G89>G(1)|p.E61_L94del(1)|p.R137fs*48(1)|p.A68fs*3(1)|p.P81_A85del(1)|p.R80fs*34(1)|p.V82_E88del(1)		NS(28)|adrenal_gland(6)|autonomic_ganglia(11)|biliary_tract(74)|bone(84)|breast(46)|central_nervous_system(522)|cervix(23)|endometrium(14)|eye(4)|genital_tract(15)|haematopoietic_and_lymphoid_tissue(698)|kidney(39)|large_intestine(11)|liver(92)|lung(365)|meninges(18)|oesophagus(239)|ovary(98)|pancreas(263)|pleura(94)|prostate(13)|salivary_gland(10)|skin(541)|small_intestine(1)|soft_tissue(93)|stomach(48)|thymus(4)|thyroid(24)|upper_aerodigestive_tract(436)|urinary_tract(283)|vulva(2)	4199		all_cancers(5;0)|Acute lymphoblastic leukemia(3;0)|all_hematologic(3;0)|all_epithelial(2;2.37e-290)|Lung NSC(2;1.26e-139)|all_lung(2;4.48e-131)|Glioma(2;3.26e-60)|all_neural(2;2.1e-52)|Renal(3;1.07e-46)|Esophageal squamous(3;3.83e-46)|Melanoma(2;2.74e-34)|Breast(3;1.14e-11)|Ovarian(3;0.000128)|Hepatocellular(5;0.00162)|Colorectal(97;0.172)		all cancers(2;0)|GBM - Glioblastoma multiforme(3;0)|Lung(2;4.07e-74)|Epithelial(2;1.08e-61)|LUSC - Lung squamous cell carcinoma(2;3.82e-48)|LUAD - Lung adenocarcinoma(2;4.56e-26)|OV - Ovarian serous cystadenocarcinoma(39;7.64e-10)|BRCA - Breast invasive adenocarcinoma(2;5.01e-09)|STAD - Stomach adenocarcinoma(4;4.63e-07)|Kidney(2;5.79e-07)|KIRC - Kidney renal clear cell carcinoma(2;7.27e-07)|COAD - Colon adenocarcinoma(8;5.15e-05)		GCAGCGTCGTGCACGGGTCGG	0.741	H83Y(CALU3_LUNG)|H83Y(HS944T_SKIN)|H83Y(JHH2_LIVER)|H83Y(OPM2_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|H83Y(SEM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)	17								HNSCC(2;<9.43e_08)|TSP Lung(5;3.83e-07)																																							1403	Whole gene deletion(1316)|Unknown(44)|Substitution - Missense(33)|Deletion - Frameshift(6)|Deletion - In frame(3)|Complex - deletion inframe(1)	haematopoietic_and_lymphoid_tissue(284)|skin(175)|central_nervous_system(171)|lung(154)|urinary_tract(93)|bone(74)|oesophagus(59)|soft_tissue(58)|upper_aerodigestive_tract(56)|pleura(51)|ovary(36)|pancreas(34)|breast(33)|kidney(32)|thyroid(13)|NS(12)|biliary_tract(12)|stomach(12)|autonomic_ganglia(9)|liver(7)|meninges(7)|large_intestine(6)|salivary_gland(5)|thymus(4)|vulva(2)|endometrium(2)|prostate(2)	GRCh37	CM053801|CM056557	CDKN2A	M	rs121913385						12.0	15.0	14.0					9																	21971111		2176	4259	6435	SO:0001583	missense	0			L27211	CCDS6510.1, CCDS6511.1, CCDS6511.2, CCDS56565.1	9p21	2014-09-17	2012-03-08		ENSG00000147889	ENSG00000147889			1787	protein-coding gene	gene with protein product		600160	"""cyclin-dependent kinase inhibitor 2A (melanoma, p16, inhibits CDK4)"""	CDKN2, MLM		8152487, 7606716	Standard	NM_058195		Approved	CDK4I, p16, INK4a, MTS1, CMM2, ARF, p19, p14, INK4, p16INK4a, p19Arf	uc003zpk.3	P42771	OTTHUMG00000019686	ENST00000304494.5:c.247C>T	9.37:g.21971111G>A	ENSP00000307101:p.His83Tyr		A5X2G7|D3DRK1|O95440|Q15191|Q5VVJ5|Q96B52|Q9NP05	Missense_Mutation	SNP	pfam_Cyclin_kinase-Inhib_2A	p.A138V	ENST00000304494.5	37	c.413	CCDS6510.1	9	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	26.7|26.7	4.762523|4.762523	0.89932|0.89932	.|.	.|.	ENSG00000147889|ENSG00000147889	ENST00000361570;ENST00000530628|ENST00000304494;ENST00000446177	T;T|T;T	0.80393|0.71222	-1.37;-1.31|-0.55;-0.55	5.93|5.93	5.93|5.93	0.95920|0.95920	.|Ankyrin repeat-containing domain (4);	0.000000|.	0.37261|.	N|.	0.002164|.	T|T	0.77579|0.77579	0.4151|0.4151	L|L	0.27053|0.27053	0.805|0.805	0.46521|0.46521	D|D	0.999085|0.999085	P|D	0.47191|0.76494	0.891|0.999	B|D	0.44044|0.75484	0.439|0.986	T|T	0.79024|0.79024	-0.1972|-0.1972	10|9	0.62326|0.66056	D|D	0.03|0.02	-15.192|-15.192	19.1026|19.1026	0.93279|0.93279	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	138|83	Q8N726|P42771	CD2A2_HUMAN|CD2A1_HUMAN	V|Y	138;97|83	ENSP00000355153:A138V;ENSP00000432664:A97V|ENSP00000307101:H83Y;ENSP00000394932:H83Y	ENSP00000355153:A138V|ENSP00000307101:H83Y	A|H	-|-	2|1	0|0	CDKN2A|CDKN2A	21961111|21961111	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.915000|0.915000	0.54546|0.54546	8.665000|8.665000	0.91144|0.91144	2.803000|2.803000	0.96430|0.96430	0.650000|0.650000	0.86243|0.86243	GCA|CAC	CDKN2A	-	NULL	ENSG00000147889		0.741	CDKN2A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CDKN2A	HGNC	protein_coding	OTTHUMT00000051915.1		0.00	27	0	G	NM_000077		21971111	-1			no_errors	ENST00000361570	ensembl	human	known	74_37	missense	40.00	3	2	SNP	1.000	A
CDKN2AIP	55602	genome.wustl.edu	37	4	184367434	184367434	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr4:184367434G>C	ENST00000504169.1	+	3	804	c.597G>C	c.(595-597)caG>caC	p.Q199H	CDKN2AIP_ENST00000506835.1_3'UTR|CDKN2AIP_ENST00000302350.4_3'UTR	NM_017632.2	NP_060102.1	Q9NXV6	CARF_HUMAN	CDKN2A interacting protein	199	Ser-rich.				negative regulation of cell growth (GO:0030308)|positive regulation of signal transduction (GO:0009967)|regulation of protein stability (GO:0031647)	cytoplasm (GO:0005737)|granular component (GO:0001652)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	p53 binding (GO:0002039)|RNA binding (GO:0003723)			endometrium(1)|kidney(2)|large_intestine(2)|lung(1)	6		all_lung(41;6.9e-12)|Lung NSC(41;1.28e-11)|Colorectal(36;0.00435)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|all_hematologic(60;0.0749)		all cancers(43;1.15e-26)|Epithelial(43;2.98e-22)|OV - Ovarian serous cystadenocarcinoma(60;7.64e-10)|GBM - Glioblastoma multiforme(59;4.22e-06)|Colorectal(24;5.87e-06)|STAD - Stomach adenocarcinoma(60;2.09e-05)|COAD - Colon adenocarcinoma(29;5.15e-05)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.155)		TCTCCAGTCAGAATAGCTCTA	0.507																																																	0													92.0	91.0	91.0					4																	184367434		2203	4300	6503	SO:0001583	missense	0			AK000043	CCDS34110.1	4q35.1	2008-02-05			ENSG00000168564	ENSG00000168564			24325	protein-coding gene	gene with protein product	"""collaborates/cooperates with ARF (alternate reading frame) protein"""	615914				12154087, 16803988	Standard	NM_017632		Approved	FLJ20036, CARF	uc003ivp.1	Q9NXV6	OTTHUMG00000160626	ENST00000504169.1:c.597G>C	4.37:g.184367434G>C	ENSP00000427108:p.Gln199His		Q8TBM5|Q9NYH0	Missense_Mutation	SNP	pfam_DUF3469,pfscan_dsRNA-bd_dom	p.Q199H	ENST00000504169.1	37	c.597	CCDS34110.1	4	.	.	.	.	.	.	.	.	.	.	G	7.764	0.706054	0.15172	.	.	ENSG00000168564	ENST00000504169	.	.	.	5.44	4.6	0.57074	.	0.370774	0.23405	N	0.048536	T	0.44603	0.1301	L	0.27053	0.805	0.80722	D	1	P	0.42039	0.769	P	0.44477	0.451	T	0.41106	-0.9527	9	0.45353	T	0.12	-1.4171	12.0932	0.53739	0.0827:0.0:0.9173:0.0	.	199	Q9NXV6	CARF_HUMAN	H	199	.	ENSP00000427108:Q199H	Q	+	3	2	CDKN2AIP	184604428	0.366000	0.25014	0.396000	0.26296	0.606000	0.37113	1.183000	0.32041	1.521000	0.48983	0.655000	0.94253	CAG	CDKN2AIP	-	NULL	ENSG00000168564		0.507	CDKN2AIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDKN2AIP	HGNC	protein_coding	OTTHUMT00000361488.1	-	0.00	49	0	G	NM_017632		184367434	+1	tier1	-	no_errors	ENST00000504169	ensembl	human	known	74_37	missense	27.59	21	8	SNP	0.958	C
CENPT	80152	genome.wustl.edu	37	16	67866141	67866141	+	Silent	SNP	G	G	A			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr16:67866141G>A	ENST00000562787.1	-	6	827	c.279C>T	c.(277-279)atC>atT	p.I93I	CENPT_ENST00000445712.2_Intron|CENPT_ENST00000562947.1_5'UTR|CENPT_ENST00000440851.2_Silent_p.I93I|CENPT_ENST00000564817.1_Silent_p.I93I|CENPT_ENST00000219172.3_Silent_p.I93I	NM_025082.3	NP_079358.3	Q96BT3	CENPT_HUMAN	centromere protein T	93	Flexible stalk domain. {ECO:0000250}.				chromosome organization (GO:0051276)|chromosome segregation (GO:0007059)|kinetochore assembly (GO:0051382)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	chromosome, centromeric region (GO:0000775)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|breast(2)|lung(6)|urinary_tract(1)	10		Acute lymphoblastic leukemia(13;0.000299)|all_hematologic(13;0.0184)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.00429)|Epithelial(162;0.019)|all cancers(182;0.124)		CAGTTAGTAGGATGTTCTTCA	0.537																																																	0													62.0	66.0	65.0					16																	67866141		2074	4202	6276	SO:0001819	synonymous_variant	0			AK056097	CCDS42182.1	16q22.1	2013-11-05	2006-06-15	2006-06-15		ENSG00000102901			25787	protein-coding gene	gene with protein product		611510	"""chromosome 16 open reading frame 56"""	C16orf56		16622420, 16622419	Standard	NM_025082		Approved	FLJ13111, CENP-T	uc002eun.4	Q96BT3		ENST00000562787.1:c.279C>T	16.37:g.67866141G>A			Q96I29|Q96IC6|Q96NK9|Q9H901	Silent	SNP	superfamily_Histone-fold	p.I93	ENST00000562787.1	37	c.279	CCDS42182.1	16																																																																																			CENPT	-	NULL	ENSG00000102901		0.537	CENPT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CENPT	HGNC	protein_coding	OTTHUMT00000422020.1		0.00	34	0	G	NM_025082		67866141	-1			no_errors	ENST00000219172	ensembl	human	known	74_37	silent	10.34	26	3	SNP	0.989	A
CEP290	80184	genome.wustl.edu	37	12	88519038	88519038	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr12:88519038G>C	ENST00000552810.1	-	13	1517	c.1174C>G	c.(1174-1176)Ctc>Gtc	p.L392V	CEP290_ENST00000397838.3_5'UTR|CEP290_ENST00000309041.7_Missense_Mutation_p.L392V	NM_025114.3	NP_079390.3	O15078	CE290_HUMAN	centrosomal protein 290kDa	392					cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|establishment or maintenance of cell polarity (GO:0007163)|eye photoreceptor cell development (GO:0042462)|G2/M transition of mitotic cell cycle (GO:0000086)|hindbrain development (GO:0030902)|mitotic cell cycle (GO:0000278)|otic vesicle formation (GO:0030916)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of transcription, DNA-templated (GO:0045893)|pronephros development (GO:0048793)|protein transport (GO:0015031)|regulation of cAMP metabolic process (GO:0030814)|regulation of establishment of protein localization (GO:0070201)|retina development in camera-type eye (GO:0060041)	centriolar satellite (GO:0034451)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|photoreceptor connecting cilium (GO:0032391)|protein complex (GO:0043234)|TCTN-B9D complex (GO:0036038)				breast(4)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(20)|liver(1)|lung(18)|ovary(5)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	73						TTTCTTTGGAGCTCATTTTTC	0.239																																																	0													54.0	46.0	49.0					12																	88519038		1506	3345	4851	SO:0001583	missense	0			AB002371	CCDS55858.1	12q21.33	2014-09-17				ENSG00000198707			29021	protein-coding gene	gene with protein product	"""Joubert syndrome 5"", ""nephrocystin-6"", ""cancer/testis antigen 87"", ""POC3 centriolar protein homolog (Chlamydomonas)"", ""Meckel syndrome, type 4"""	610142				15474516, 16682973, 16632484	Standard	NM_025114		Approved	KIAA0373, FLJ13615, 3H11Ag, rd16, NPHP6, JBTS5, SLSN6, LCA10, MKS4, BBS14, CT87, POC3	uc001tar.3	O15078		ENST00000552810.1:c.1174C>G	12.37:g.88519038G>C	ENSP00000448012:p.Leu392Val		Q1PSK5|Q66GS8|Q9H2G6|Q9H6Q7|Q9H8I0	Missense_Mutation	SNP	NULL	p.L392V	ENST00000552810.1	37	c.1174	CCDS55858.1	12	.	.	.	.	.	.	.	.	.	.	G	16.41	3.115547	0.56505	.	.	ENSG00000198707	ENST00000552810;ENST00000309041;ENST00000536998;ENST00000545139	T;T	0.66280	-0.19;-0.2	5.43	5.43	0.79202	.	0.196194	0.35739	N	0.003011	T	0.69895	0.3162	L	0.50333	1.59	0.80722	D	1	D;D	0.63880	0.993;0.981	P;P	0.58520	0.84;0.651	T	0.64368	-0.6424	10	0.20519	T	0.43	.	17.4083	0.87479	0.0:0.0:1.0:0.0	.	392;392	Q05BJ6;O15078	.;CE290_HUMAN	V	392;392;392;294	ENSP00000448012:L392V;ENSP00000308021:L392V	ENSP00000308021:L392V	L	-	1	0	CEP290	87043169	1.000000	0.71417	0.998000	0.56505	0.944000	0.59088	3.894000	0.56250	2.531000	0.85337	0.650000	0.86243	CTC	CEP290	-	NULL	ENSG00000198707		0.239	CEP290-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CEP290	HGNC	protein_coding	OTTHUMT00000406344.1	-	0.00	80	0	G	NM_025114		88519038	-1	tier1	-	no_errors	ENST00000309041	ensembl	human	known	74_37	missense	19.05	51	12	SNP	0.992	C
CERK	64781	genome.wustl.edu	37	22	47108185	47108185	+	Silent	SNP	T	T	G			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr22:47108185T>G	ENST00000216264.8	-	4	497	c.385A>C	c.(385-387)Aga>Cga	p.R129R	CERK_ENST00000541677.1_5'UTR	NM_022766.5	NP_073603.2	Q8TCT0	CERK1_HUMAN	ceramide kinase	129	DAGKc. {ECO:0000255|PROSITE- ProRule:PRU00783}.				ceramide metabolic process (GO:0006672)|glycosphingolipid metabolic process (GO:0006687)|lipid phosphorylation (GO:0046834)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ceramide kinase activity (GO:0001729)|diacylglycerol kinase activity (GO:0004143)|magnesium ion binding (GO:0000287)|NAD+ kinase activity (GO:0003951)			cervix(1)|endometrium(1)|large_intestine(2)|lung(11)|ovary(1)|prostate(2)|skin(2)	20		Breast(42;0.00571)|Ovarian(80;0.00965)|all_neural(38;0.0416)|Lung SC(80;0.164)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0182)|BRCA - Breast invasive adenocarcinoma(115;0.171)		TGCTTTGGTCTGGACGCTGTA	0.393																																																	0													168.0	128.0	142.0					22																	47108185		2203	4300	6503	SO:0001819	synonymous_variant	0			AB079066	CCDS14077.1	22q13.31	2008-06-10			ENSG00000100422	ENSG00000100422			19256	protein-coding gene	gene with protein product		610307				11956206, 11258795	Standard	NM_022766		Approved	hCERK, FLJ23239, dA59H18.3, DKFZp434E0211, FLJ21430, KIAA1646, LK4, dA59H18.2	uc003bia.3	Q8TCT0	OTTHUMG00000150395	ENST00000216264.8:c.385A>C	22.37:g.47108185T>G			A0JNT4|A8K611|Q6NX59|Q9BYB3|Q9UGE5	Silent	SNP	pfam_Diacylglycerol_kinase_cat_dom,superfamily_ATP-NAD_kinase_PpnK-typ,smart_Diacylglycerol_kinase_cat_dom	p.R129	ENST00000216264.8	37	c.385	CCDS14077.1	22																																																																																			CERK	-	NULL	ENSG00000100422		0.393	CERK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CERK	HGNC	protein_coding	OTTHUMT00000317924.2	-	0.00	75	0	T	NM_022766		47108185	-1	tier1	-	no_errors	ENST00000216264	ensembl	human	known	74_37	silent	23.64	42	13	SNP	0.263	G
CFLAR	8837	genome.wustl.edu	37	2	201997801	201997801	+	Missense_Mutation	SNP	T	T	A			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr2:201997801T>A	ENST00000309955.3	+	3	846	c.331T>A	c.(331-333)Tca>Aca	p.S111T	CFLAR_ENST00000341222.6_Missense_Mutation_p.S111T|CFLAR_ENST00000355558.4_Missense_Mutation_p.S111T|CFLAR_ENST00000443227.1_Missense_Mutation_p.S15T|CFLAR_ENST00000340870.5_Missense_Mutation_p.S111T|CFLAR_ENST00000342795.5_Missense_Mutation_p.S111T|CFLAR_ENST00000341582.6_Missense_Mutation_p.S111T|CFLAR_ENST00000423241.2_Missense_Mutation_p.S111T|CFLAR_ENST00000479953.2_Missense_Mutation_p.S15T|CFLAR_ENST00000440180.1_Missense_Mutation_p.S111T|CFLAR_ENST00000494258.1_Missense_Mutation_p.S15T|CFLAR_ENST00000395148.2_Missense_Mutation_p.S111T|CFLAR_ENST00000457277.1_Missense_Mutation_p.S111T	NM_001202515.1|NM_003879.5	NP_001189444.1|NP_003870.4	O15519	CFLAR_HUMAN	CASP8 and FADD-like apoptosis regulator	111	DED 2. {ECO:0000255|PROSITE- ProRule:PRU00065}.|Interaction with FADD.|Interaction with caspase-8 propeptide.|Interaction with caspase-8.|Not proteolytically processed and involved in apoptosis inhibition.				apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of myoblast fusion (GO:1901740)|positive regulation of catalytic activity (GO:0043085)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001239)|regulation of necroptotic process (GO:0060544)|regulation of satellite cell proliferation (GO:0014842)|skeletal muscle atrophy (GO:0014732)|skeletal muscle tissue development (GO:0007519)|skeletal muscle tissue regeneration (GO:0043403)|skeletal myofibril assembly (GO:0014866)|viral process (GO:0016032)	CD95 death-inducing signaling complex (GO:0031265)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|death-inducing signaling complex (GO:0031264)|ripoptosome (GO:0097342)	cysteine-type peptidase activity (GO:0008234)|death effector domain binding (GO:0035877)|enzyme activator activity (GO:0008047)|protease binding (GO:0002020)			breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(6)|stomach(1)	13						TGATGTGTCCTCATTAATTTT	0.428																																					Pancreas(16;548 657 22190 32864 42338)												0													164.0	145.0	151.0					2																	201997801		2203	4300	6503	SO:0001583	missense	0			AF005774	CCDS2337.1, CCDS46487.1, CCDS56157.1, CCDS56158.1, CCDS59436.1	2q33-q34	2014-01-30			ENSG00000003402	ENSG00000003402		"""Endogenous ligands"""	1876	protein-coding gene	gene with protein product		603599		CASP8AP1		9208847, 9217161	Standard	NM_003879		Approved	CASH, Casper, CLARP, FLAME, FLIP, I-FLICE, MRIT, c-FLIP	uc002uxb.4	O15519	OTTHUMG00000132819	ENST00000309955.3:c.331T>A	2.37:g.201997801T>A	ENSP00000312455:p.Ser111Thr		B4DJE0|B7Z9F9|O14673|O14674|O14675|O15137|O15138|O15356|O15510|O43618|O43619|O43620|O60458|O60459|Q53TS6|Q54AF1|Q96TE4|Q9UEW1	Missense_Mutation	SNP	pfam_DED,pfam_Pept_C14_caspase,superfamily_DEATH-like_dom,smart_DED,smart_Pept_C14A_p45_core,pfscan_DED,pfscan_Pept_C14_ICE_p20	p.S111T	ENST00000309955.3	37	c.331	CCDS2337.1	2	.	.	.	.	.	.	.	.	.	.	T	16.46	3.129966	0.56721	.	.	ENSG00000003402	ENST00000309955;ENST00000443227;ENST00000341222;ENST00000355558;ENST00000340870;ENST00000343375;ENST00000341582;ENST00000342795;ENST00000395148;ENST00000441224;ENST00000423241;ENST00000417748;ENST00000440180;ENST00000457277	D;D;D;D;D;D;D;D;D;D	0.83335	-1.71;-1.71;-1.71;-1.71;-1.71;-1.71;-1.71;-1.71;-1.71;-1.71	6.17	2.34	0.29019	DEATH-like (2);Death effector (3);	0.556556	0.19645	N	0.109351	D	0.90017	0.6883	M	0.80028	2.48	0.38674	D	0.952375	D;P;D;D;D;P;B;P	0.76494	0.999;0.891;0.997;0.996;0.995;0.928;0.363;0.885	D;P;D;D;D;P;P;P	0.79108	0.992;0.771;0.972;0.932;0.97;0.591;0.452;0.771	D	0.89293	0.3620	10	0.52906	T	0.07	-1.4504	12.2648	0.54672	0.0:0.0:0.4076:0.5924	.	15;111;111;111;111;111;111;111	O15519-3;C9JK38;O15519-11;O15519-8;O15519;O15519-12;O15519-2;E9PAP3	.;.;.;.;CFLAR_HUMAN;.;.;.	T	111;15;111;111;111;15;111;111;111;111;111;111;111;111	ENSP00000312455:S111T;ENSP00000413270:S15T;ENSP00000339335:S111T;ENSP00000347757:S111T;ENSP00000339326:S111T;ENSP00000345807:S111T;ENSP00000342809:S111T;ENSP00000399420:S111T;ENSP00000406775:S111T;ENSP00000411535:S111T	ENSP00000312455:S111T	S	+	1	0	CFLAR	201706046	0.953000	0.32496	0.441000	0.26858	0.284000	0.27059	1.794000	0.38774	0.157000	0.19338	-0.313000	0.08912	TCA	CFLAR	-	pfam_DED,superfamily_DEATH-like_dom,smart_DED,pfscan_DED	ENSG00000003402		0.428	CFLAR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CFLAR	HGNC	protein_coding	OTTHUMT00000256276.3	-	0.00	72	0	T	NM_003879		201997801	+1	tier1	-	no_errors	ENST00000309955	ensembl	human	known	74_37	missense	7.14	52	4	SNP	0.360	A
CHD8	57680	genome.wustl.edu	37	14	21867861	21867861	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr14:21867861C>G	ENST00000557364.1	-	26	5084	c.4821G>C	c.(4819-4821)gaG>gaC	p.E1607D	CHD8_ENST00000430710.3_Missense_Mutation_p.E1328D|CHD8_ENST00000399982.2_Missense_Mutation_p.E1607D|CHD8_ENST00000555962.1_5'UTR|SNORD8_ENST00000363915.1_RNA			Q9HCK8	CHD8_HUMAN	chromodomain helicase DNA binding protein 8	1607					ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|canonical Wnt signaling pathway (GO:0060070)|DNA duplex unwinding (GO:0032508)|in utero embryonic development (GO:0001701)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of Wnt signaling pathway (GO:0030178)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	MLL1 complex (GO:0071339)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|beta-catenin binding (GO:0008013)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA-dependent ATPase activity (GO:0008094)|histone binding (GO:0042393)|methylated histone binding (GO:0035064)|p53 binding (GO:0002039)			NS(2)|breast(1)|central_nervous_system(1)|cervix(4)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(8)|lung(33)|ovary(6)|prostate(7)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	85	all_cancers(95;0.00121)		Epithelial(56;2.55e-06)|all cancers(55;1.73e-05)	GBM - Glioblastoma multiforme(265;0.00424)		ATATGTCAATCTCACTAAAGG	0.423																																																	0													86.0	83.0	84.0					14																	21867861		1982	4176	6158	SO:0001583	missense	0			AB046784	CCDS45081.1, CCDS53885.1	14q11.2	2008-02-05	2004-06-22	2004-06-23		ENSG00000100888			20153	protein-coding gene	gene with protein product		610528	"""helicase with SNF2 domain 1"""	HELSNF1		10997877	Standard	NM_020920		Approved	KIAA1564, DUPLIN	uc001war.2	Q9HCK8		ENST00000557364.1:c.4821G>C	14.37:g.21867861C>G	ENSP00000451601:p.Glu1607Asp		Q4G0D8|Q68DQ0|Q6DKH9|Q6P440|Q6ZNL7|Q8N3Z9|Q8NCY4|Q8TBR9|Q96F26	Missense_Mutation	SNP	pfam_SNF2_N,pfam_Chromo_domain,pfam_BRK_domain,pfam_Helicase_C,pfam_Helicase/UvrB_dom,pfam_DNA/RNA_helicase_DEAD/DEAH_N,superfamily_P-loop_NTPase,superfamily_Chromodomain-like,smart_Chromo_domain/shadow,smart_Helicase_ATP-bd,smart_Helicase_C,smart_BRK_domain,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Chromo_domain/shadow	p.E1607D	ENST00000557364.1	37	c.4821	CCDS53885.1	14	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	4.709|4.709	0.131801|0.131801	0.08981|0.08981	.|.	.|.	ENSG00000100888|ENSG00000100888	ENST00000555935|ENST00000430710;ENST00000399982;ENST00000262707;ENST00000557364	.|D;D;D	.|0.88354	.|-2.37;-2.37;-2.37	5.44|5.44	4.54|4.54	0.55810|0.55810	.|.	.|0.119705	.|0.56097	.|D	.|0.000034	T|T	0.74129|0.74129	0.3676|0.3676	N|N	0.11284|0.11284	0.12|0.12	0.38463|0.38463	D|D	0.947273|0.947273	.|B	.|0.06786	.|0.001	.|B	.|0.13407	.|0.009	T|T	0.67425|0.67425	-0.5674|-0.5674	5|10	.|0.12766	.|T	.|0.61	-14.2143|-14.2143	7.6239|7.6239	0.28202|0.28202	0.0:0.7765:0.0:0.2235|0.0:0.7765:0.0:0.2235	.|.	.|1328	.|Q9HCK8-2	.|.	H|D	841|1328;1607;1327;1607	.|ENSP00000406288:E1328D;ENSP00000382863:E1607D;ENSP00000451601:E1607D	.|ENSP00000262707:E1327D	D|E	-|-	1|3	0|2	CHD8|CHD8	20937701|20937701	0.475000|0.475000	0.25894|0.25894	1.000000|1.000000	0.80357|0.80357	0.989000|0.989000	0.77384|0.77384	-0.211000|-0.211000	0.09332|0.09332	2.828000|2.828000	0.97474|0.97474	0.655000|0.655000	0.94253|0.94253	GAT|GAG	CHD8	-	NULL	ENSG00000100888		0.423	CHD8-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CHD8	HGNC	protein_coding	OTTHUMT00000410436.1	-	0.00	36	0	C	NM_020920		21867861	-1	tier1	-	no_errors	ENST00000399982	ensembl	human	known	74_37	missense	23.81	16	5	SNP	1.000	G
CHST1	8534	genome.wustl.edu	37	11	45671517	45671517	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr11:45671517G>T	ENST00000308064.2	-	4	1627	c.957C>A	c.(955-957)ttC>ttA	p.F319L	RP11-495O11.1_ENST00000525563.1_RNA|CHST1_ENST00000533673.1_5'Flank	NM_003654.5	NP_003645.1	O43916	CHST1_HUMAN	carbohydrate (keratan sulfate Gal-6) sulfotransferase 1	319					carbohydrate metabolic process (GO:0005975)|galactose metabolic process (GO:0006012)|glycosaminoglycan metabolic process (GO:0030203)|inflammatory response (GO:0006954)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|polysaccharide metabolic process (GO:0005976)|small molecule metabolic process (GO:0044281)|sulfur compound metabolic process (GO:0006790)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	keratan sulfotransferase activity (GO:0045130)|sulfotransferase activity (GO:0008146)			breast(1)|endometrium(3)|large_intestine(10)|lung(17)|pancreas(1)|prostate(2)|skin(7)|upper_aerodigestive_tract(1)	42				GBM - Glioblastoma multiforme(35;3e-06)|BRCA - Breast invasive adenocarcinoma(625;0.0781)		GGATGCCCAGGAACCCGTAGA	0.632																																																	0													67.0	66.0	66.0					11																	45671517		2203	4299	6502	SO:0001583	missense	0			U65637	CCDS7913.1	11p11.2	2010-04-29			ENSG00000175264	ENSG00000175264		"""Sulfotransferases, membrane-bound"""	1969	protein-coding gene	gene with protein product		603797				9405439, 9639683	Standard	NM_003654		Approved	C6ST, KSGal6ST	uc001mys.2	O43916		ENST00000308064.2:c.957C>A	11.37:g.45671517G>T	ENSP00000309270:p.Phe319Leu		D3DQP2	Missense_Mutation	SNP	pfam_Sulfotransferase_dom,superfamily_P-loop_NTPase,pirsf_Carbohydrate_sulfotransferase	p.F319L	ENST00000308064.2	37	c.957	CCDS7913.1	11	.	.	.	.	.	.	.	.	.	.	G	18.47	3.630681	0.67015	.	.	ENSG00000175264	ENST00000308064	D	0.94723	-3.5	4.81	4.81	0.61882	Sulfotransferase domain (1);	0.110721	0.64402	D	0.000009	D	0.96595	0.8889	M	0.92367	3.3	0.53005	D	0.999963	P	0.52692	0.955	P	0.52424	0.698	D	0.96927	0.9678	10	0.66056	D	0.02	-17.7324	11.4006	0.49868	0.0833:0.0:0.9167:0.0	.	319	O43916	CHST1_HUMAN	L	319	ENSP00000309270:F319L	ENSP00000309270:F319L	F	-	3	2	CHST1	45628093	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	5.601000	0.67606	2.200000	0.70718	0.462000	0.41574	TTC	CHST1	-	pfam_Sulfotransferase_dom,superfamily_P-loop_NTPase,pirsf_Carbohydrate_sulfotransferase	ENSG00000175264		0.632	CHST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHST1	HGNC	protein_coding	OTTHUMT00000390127.1	-	0.00	52	0	G	NM_003654		45671517	-1	tier1	-	no_errors	ENST00000308064	ensembl	human	known	74_37	missense	17.86	23	5	SNP	1.000	T
CLCA2	9635	genome.wustl.edu	37	1	86905910	86905910	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr1:86905910A>G	ENST00000370565.4	+	8	1445	c.1283A>G	c.(1282-1284)aAt>aGt	p.N428S		NM_006536.5	NP_006527.1	Q9UQC9	CLCA2_HUMAN	chloride channel accessory 2	428	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)|transport (GO:0006810)	cell junction (GO:0030054)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	chloride channel activity (GO:0005254)|ligand-gated ion channel activity (GO:0015276)			NS(2)|breast(1)|endometrium(1)|kidney(3)|large_intestine(9)|lung(18)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|stomach(1)	42		Lung NSC(277;0.238)		all cancers(265;0.0233)|Epithelial(280;0.0452)		CTTCTTGGCAATTGCTTACCC	0.443																																					Melanoma(157;1000 1898 5363 5664 48018)|Ovarian(88;135 1366 2838 28875 34642)												0													156.0	147.0	150.0					1																	86905910		2203	4300	6503	SO:0001583	missense	0				CCDS708.1	1p22.3	2012-02-26	2009-01-29		ENSG00000137975	ENSG00000137975			2016	protein-coding gene	gene with protein product		604003	"""chloride channel, calcium activated, family member 2"", ""chloride channel regulator 2"""				Standard	NM_006536		Approved	CLCRG2	uc001dlr.4	Q9UQC9	OTTHUMG00000010256	ENST00000370565.4:c.1283A>G	1.37:g.86905910A>G	ENSP00000359596:p.Asn428Ser		A8K2T3|Q9Y6N2	Missense_Mutation	SNP	pfam_Cl_channel_Ca,pfam_DUF1973,pfam_VWF_A,smart_VWF_A,pfscan_VWF_A,tigrfam_CaCC_prot	p.N428S	ENST00000370565.4	37	c.1283	CCDS708.1	1	.	.	.	.	.	.	.	.	.	.	A	1.055	-0.674670	0.03378	.	.	ENSG00000137975	ENST00000370565	T	0.13420	2.59	5.77	1.9	0.25705	von Willebrand factor, type A (3);	0.509346	0.21938	N	0.066937	T	0.00906	0.0030	N	0.01874	-0.695	0.09310	N	1	B	0.11235	0.004	B	0.11329	0.006	T	0.47911	-0.9080	10	0.02654	T	1	-7.8873	5.4123	0.16354	0.4181:0.3276:0.2543:0.0	.	428	Q9UQC9	CLCA2_HUMAN	S	428	ENSP00000359596:N428S	ENSP00000359596:N428S	N	+	2	0	CLCA2	86678498	0.000000	0.05858	0.009000	0.14445	0.231000	0.25187	0.409000	0.21082	1.003000	0.39130	0.533000	0.62120	AAT	CLCA2	-	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A,tigrfam_CaCC_prot	ENSG00000137975		0.443	CLCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLCA2	HGNC	protein_coding	OTTHUMT00000028284.1	-	0.00	40	0	A	NM_006536		86905910	+1	tier1	-	no_errors	ENST00000370565	ensembl	human	known	74_37	missense	17.86	23	5	SNP	0.001	G
CLEC1B	51266	genome.wustl.edu	37	12	10151696	10151696	+	Nonsense_Mutation	SNP	G	G	A			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr12:10151696G>A	ENST00000298527.6	-	1	183	c.4C>T	c.(4-6)Cag>Tag	p.Q2*	CLEC1B_ENST00000348658.4_Nonsense_Mutation_p.Q2*|CLEC1B_ENST00000428126.2_Nonsense_Mutation_p.Q2*	NM_016509.3	NP_057593.3	Q9P126	CLC1B_HUMAN	C-type lectin domain family 1, member B	2					cell surface receptor signaling pathway (GO:0007166)|defense response (GO:0006952)|platelet formation (GO:0030220)	integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(1)|central_nervous_system(1)|large_intestine(2)|lung(12)|stomach(1)|urinary_tract(1)	19						TCTTCATCCTGCATGGCTTCC	0.373																																																	0													210.0	201.0	204.0					12																	10151696		1900	4123	6023	SO:0001587	stop_gained	0			AF124841	CCDS41751.1, CCDS41752.1	12p13.31	2006-04-12				ENSG00000165682		"""C-type lectin domain containing"""	24356	protein-coding gene	gene with protein product		606783				10671229, 11745369	Standard	NM_016509		Approved	CLEC2	uc001qwu.3	Q9P126		ENST00000298527.6:c.4C>T	12.37:g.10151696G>A	ENSP00000298527:p.Gln2*		Q6UWX7|Q8NHR6	Nonsense_Mutation	SNP	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin	p.Q2*	ENST00000298527.6	37	c.4	CCDS41752.1	12	.	.	.	.	.	.	.	.	.	.	G	38	7.196674	0.98129	.	.	ENSG00000165682	ENST00000428126;ENST00000298527;ENST00000348658	.	.	.	5.67	5.67	0.87782	.	0.131822	0.34828	N	0.003659	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.21540	T	0.41	.	15.2731	0.73720	0.0:0.0:1.0:0.0	.	.	.	.	X	2	.	ENSP00000298527:Q2X	Q	-	1	0	CLEC1B	10042963	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	2.797000	0.47877	2.677000	0.91161	0.655000	0.94253	CAG	CLEC1B	-	NULL	ENSG00000165682		0.373	CLEC1B-005	KNOWN	basic|appris_principal|CCDS	protein_coding	CLEC1B	HGNC	protein_coding	OTTHUMT00000399922.1		0.00	38	0	G	NM_016509		10151696	-1			no_errors	ENST00000298527	ensembl	human	known	74_37	nonsense	9.52	19	2	SNP	1.000	A
CLEC9A	283420	genome.wustl.edu	37	12	10194069	10194069	+	5'UTR	SNP	C	C	G			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr12:10194069C>G	ENST00000355819.1	+	0	301				CLEC9A_ENST00000544751.1_3'UTR	NM_207345.2	NP_997228.1	Q6UXN8	CLC9A_HUMAN	C-type lectin domain family 9, member A						positive regulation of cytokine secretion (GO:0050715)|receptor-mediated endocytosis (GO:0006898)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			breast(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(8)|ovary(1)|prostate(2)|urinary_tract(1)	22						CTCCAGGTGACTATAAACGCA	0.418																																																	0																																										SO:0001623	5_prime_UTR_variant	0				CCDS8611.1	12p13.31	2010-04-27				ENSG00000197992		"""C-type lectin domain containing"""	26705	protein-coding gene	gene with protein product		612252					Standard	NM_207345		Approved	UNQ9341, HEEE9341	uc001qxa.3	Q6UXN8		ENST00000355819.1:c.-313C>G	12.37:g.10194069C>G			B0ZBM2	RNA	SNP	-	NULL	ENST00000355819.1	37	NULL	CCDS8611.1	12																																																																																			CLEC9A	-	-	ENSG00000197992		0.418	CLEC9A-001	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	CLEC9A	HGNC	protein_coding	OTTHUMT00000399564.1	-	0.00	39	0	C	NM_207345		10194069	+1	tier1	-	no_errors	ENST00000544751	ensembl	human	known	74_37	rna	23.08	20	6	SNP	0.571	G
CLVS1	157807	genome.wustl.edu	37	8	62212688	62212688	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr8:62212688G>A	ENST00000519846.1	+	3	774	c.302G>A	c.(301-303)cGc>cAc	p.R101H	CLVS1_ENST00000518592.1_Intron|RP11-787D18.1_ENST00000521801.1_RNA|RP11-787D18.1_ENST00000518064.1_RNA|CLVS1_ENST00000325897.4_Missense_Mutation_p.R101H			Q8IUQ0	CLVS1_HUMAN	clavesin 1	101					lysosome organization (GO:0007040)	clathrin-coated vesicle (GO:0030136)|endosome (GO:0005768)|membrane (GO:0016020)|trans-Golgi network (GO:0005802)	phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|transporter activity (GO:0005215)			endometrium(3)|kidney(4)|large_intestine(4)|lung(21)|ovary(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	41						TTCCAGTACCGCCAGCTAAAC	0.502																																																	0													65.0	63.0	64.0					8																	62212688		2203	4300	6503	SO:0001583	missense	0			AY094971	CCDS6176.1	8q12.1	2009-10-14	2009-10-14	2009-10-14		ENSG00000177182			23139	protein-coding gene	gene with protein product		611292	"""retinaldehyde binding protein 1-like 1"""	RLBP1L1		16802092, 19651769	Standard	NM_173519		Approved	MGC34646, CRALBPL, C6orf212L	uc003xuh.3	Q8IUQ0		ENST00000519846.1:c.302G>A	8.37:g.62212688G>A	ENSP00000428402:p.Arg101His		B2R7M5|C8UZT3|Q8NB32	Missense_Mutation	SNP	pfam_CRAL-TRIO_dom,pfam_CRAL/TRIO_N_dom,superfamily_CRAL-TRIO_dom,superfamily_CRAL/TRIO_N_dom,smart_CRAL-TRIO_dom,pfscan_CRAL-TRIO_dom,prints_CRAL-bd_toc_tran	p.R101H	ENST00000519846.1	37	c.302	CCDS6176.1	8	.	.	.	.	.	.	.	.	.	.	G	32	5.176948	0.94846	.	.	ENSG00000177182	ENST00000519846;ENST00000325897	D;D	0.89270	-2.49;-2.49	5.79	5.79	0.91817	Phosphatidylinositol transfer protein-like, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.93989	0.8075	M	0.84156	2.68	0.80722	D	1	D;D	0.57571	0.98;0.975	P;P	0.56960	0.573;0.81	D	0.93561	0.6895	9	.	.	.	-14.0481	20.0313	0.97540	0.0:0.0:1.0:0.0	.	101;101	Q8IUQ0;Q8IUQ0-2	CLVS1_HUMAN;.	H	101	ENSP00000428402:R101H;ENSP00000325506:R101H	.	R	+	2	0	CLVS1	62375242	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.869000	0.99810	2.746000	0.94184	0.655000	0.94253	CGC	CLVS1	-	superfamily_CRAL/TRIO_N_dom	ENSG00000177182		0.502	CLVS1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	CLVS1	HGNC	protein_coding	OTTHUMT00000378323.1	-	0.00	38	0	G	NM_173519		62212688	+1	tier1	-	no_errors	ENST00000325897	ensembl	human	known	74_37	missense	13.79	25	4	SNP	1.000	A
CMPK2	129607	genome.wustl.edu	37	2	7005185	7005185	+	Frame_Shift_Del	DEL	C	C	-			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr2:7005185delC	ENST00000256722.5	-	1	642	c.643delG	c.(643-645)gacfs	p.D215fs	CMPK2_ENST00000478738.1_Intron|CMPK2_ENST00000458098.1_Frame_Shift_Del_p.D215fs|CMPK2_ENST00000404168.1_Frame_Shift_Del_p.D215fs	NM_207315.3	NP_997198.2	Q5EBM0	CMPK2_HUMAN	cytidine monophosphate (UMP-CMP) kinase 2, mitochondrial	215					cellular response to lipopolysaccharide (GO:0071222)|dTDP biosynthetic process (GO:0006233)|dUDP biosynthetic process (GO:0006227)|nucleoside diphosphate phosphorylation (GO:0006165)|nucleoside triphosphate biosynthetic process (GO:0009142)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cytidylate kinase activity (GO:0004127)|nucleoside diphosphate kinase activity (GO:0004550)|thymidylate kinase activity (GO:0004798)|UMP kinase activity (GO:0033862)			large_intestine(1)|lung(13)|prostate(1)|upper_aerodigestive_tract(1)	16	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)					GCTTCCCGGTCCGGGAAGACC	0.677																																																	0													4.0	5.0	5.0					2																	7005185		1739	3870	5609	SO:0001589	frameshift_variant	0				CCDS42648.1, CCDS58695.1, CCDS58696.1	2p25.2	2008-01-25			ENSG00000134326	ENSG00000134326	2.7.4.14		27015	protein-coding gene	gene with protein product	"""cytidylate kinase 2"""	611787				17999954	Standard	NM_207315		Approved	TYKi, UMP-CMPK2	uc002qyo.4	Q5EBM0	OTTHUMG00000151629	ENST00000256722.5:c.643delG	2.37:g.7005185delC	ENSP00000256722:p.Asp215fs		A2RUB0|A5D8T2|B7ZM18|Q6ZRU2|Q96AL8	Frame_Shift_Del	DEL	superfamily_P-loop_NTPase,pirsf_UMP-CMP_kinase_mit	p.D215fs	ENST00000256722.5	37	c.643	CCDS42648.1	2																																																																																			CMPK2	-	pirsf_UMP-CMP_kinase_mit	ENSG00000134326		0.677	CMPK2-002	NOVEL	basic|appris_principal|CCDS	protein_coding	CMPK2	HGNC	protein_coding	OTTHUMT00000323339.2		0.00	26	0	C	NM_207315		7005185	-1	tier1		no_errors	ENST00000458098	ensembl	human	known	74_37	frame_shift_del	20.00	8	2	DEL	0.000	-
CMYA5	202333	genome.wustl.edu	37	5	79084824	79084824	+	Silent	SNP	G	G	A			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr5:79084824G>A	ENST00000446378.2	+	10	11617	c.11586G>A	c.(11584-11586)ctG>ctA	p.L3862L	CTC-431G16.2_ENST00000421252.2_RNA	NM_153610.3	NP_705838.3	Q8N3K9	CMYA5_HUMAN	cardiomyopathy associated 5	3862	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				negative regulation of calcineurin-NFAT signaling cascade (GO:0070885)|negative regulation of protein phosphatase type 2B activity (GO:0032513)|regulation of skeletal muscle adaptation (GO:0014733)	costamere (GO:0043034)				NS(2)|breast(4)|central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(37)|lung(34)|ovary(6)|pancreas(2)|prostate(5)|skin(5)|stomach(11)|upper_aerodigestive_tract(3)|urinary_tract(1)	128		Lung NSC(167;0.00296)|all_lung(232;0.00327)|Ovarian(174;0.0262)		OV - Ovarian serous cystadenocarcinoma(54;9.85e-46)|Epithelial(54;3.38e-40)|all cancers(79;3.43e-35)		GACTCCAGCTGAAAGTTAACC	0.373																																																	0													142.0	137.0	138.0					5																	79084824		1862	4105	5967	SO:0001819	synonymous_variant	0			AW755254, AL831986	CCDS47238.1	5q14.1	2013-02-11			ENSG00000164309	ENSG00000164309		"""Tripartite motif containing / Tripartite motif containing"", ""A-kinase anchor proteins"", ""Fibronectin type III domain containing"""	14305	protein-coding gene	gene with protein product	"""genethonin-3"", ""tripartite motif-containing 76"""	612193	"""chromosome 5 open reading frame 10"""	C5orf10		14688250	Standard	NM_153610		Approved	myospryn, SPRYD2, DKFZp451G223, TRIM76	uc003kgc.3	Q8N3K9	OTTHUMG00000162548	ENST00000446378.2:c.11586G>A	5.37:g.79084824G>A			A0PJB7|Q05CT4|Q2NKX1|Q2T9G9|Q69YQ8|Q69YQ9|Q6P517|Q6P5U3|Q7Z4I1|Q86T34|Q86T49|Q8N3S4|Q8N3S7|Q8NAG8|Q9UK88	Silent	SNP	pfam_Fibronectin_type3,pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_B30.2/SPRY,pfscan_Fibronectin_type3	p.L3862	ENST00000446378.2	37	c.11586	CCDS47238.1	5																																																																																			CMYA5	-	superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000164309		0.373	CMYA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CMYA5	HGNC	protein_coding	OTTHUMT00000369497.1	-	0.00	46	0	G	NM_153610		79084824	+1	tier1	-	no_errors	ENST00000446378	ensembl	human	known	74_37	silent	42.86	4	3	SNP	1.000	A
CNTN2	6900	genome.wustl.edu	37	1	205035662	205035662	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr1:205035662C>T	ENST00000331830.4	+	15	2194	c.1910C>T	c.(1909-1911)cCc>cTc	p.P637L		NM_005076.3	NP_005067.1	Q02246	CNTN2_HUMAN	contactin 2 (axonal)	637	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|cell adhesion (GO:0007155)|cellular protein localization (GO:0034613)|central nervous system myelination (GO:0022010)|cerebral cortex GABAergic interneuron migration (GO:0021853)|clustering of voltage-gated potassium channels (GO:0045163)|establishment of protein localization to juxtaparanode region of axon (GO:0071206)|learning (GO:0007612)|microtubule cytoskeleton organization (GO:0000226)|negative regulation of neuron differentiation (GO:0045665)|positive regulation of adenosine receptor signaling pathway (GO:0060168)|positive regulation of protein processing (GO:0010954)|presynaptic membrane organization (GO:0097090)|receptor internalization (GO:0031623)|regulation of astrocyte differentiation (GO:0048710)|regulation of axon diameter (GO:0031133)|regulation of neuronal synaptic plasticity (GO:0048168)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|juxtaparanode region of axon (GO:0044224)|myelin sheath (GO:0043209)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|synapse (GO:0045202)|voltage-gated potassium channel complex (GO:0008076)	carbohydrate binding (GO:0030246)|identical protein binding (GO:0042802)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(11)|lung(23)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	54	all_cancers(21;0.144)|Breast(84;0.0437)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)			AACCACAGCCCCATCGCTAAG	0.617																																					Melanoma(183;2548 2817 37099 41192)												0													91.0	66.0	74.0					1																	205035662		2203	4300	6503	SO:0001583	missense	0			X67734	CCDS1449.1	1q32.1	2013-02-11			ENSG00000184144	ENSG00000184144		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2172	protein-coding gene	gene with protein product		190197		TAX, AXT		8307567, 8586965	Standard	NM_005076		Approved	TAG-1, TAX1	uc001hbr.3	Q02246	OTTHUMG00000037105	ENST00000331830.4:c.1910C>T	1.37:g.205035662C>T	ENSP00000330633:p.Pro637Leu		P78432|Q5T054	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.P637L	ENST00000331830.4	37	c.1910	CCDS1449.1	1	.	.	.	.	.	.	.	.	.	.	C	35	5.577799	0.96565	.	.	ENSG00000184144	ENST00000331830	T	0.60171	0.21	6.08	6.08	0.98989	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.52532	D	0.000061	D	0.85461	0.5702	H	0.96576	3.845	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	D	0.89146	0.3520	10	0.87932	D	0	.	20.2672	0.98462	0.0:1.0:0.0:0.0	.	637;528	Q02246;Q68DA2	CNTN2_HUMAN;.	L	637	ENSP00000330633:P637L	ENSP00000330633:P637L	P	+	2	0	CNTN2	203302285	1.000000	0.71417	1.000000	0.80357	0.883000	0.51084	7.663000	0.83820	2.894000	0.99253	0.591000	0.81541	CCC	CNTN2	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000184144		0.617	CNTN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTN2	HGNC	protein_coding	OTTHUMT00000090080.3	-	0.00	40	0	C	NM_005076		205035662	+1	tier1	-	no_errors	ENST00000331830	ensembl	human	known	74_37	missense	54.17	11	13	SNP	1.000	T
COL10A1	1300	genome.wustl.edu	37	6	116442377	116442377	+	Frame_Shift_Del	DEL	G	G	-			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr6:116442377delG	ENST00000327673.4	-	2	1309	c.902delC	c.(901-903)ccafs	p.P301fs	NT5DC1_ENST00000319550.4_Intron|AL121963.1_ENST00000430695.1_Frame_Shift_Del_p.G11fs|COL10A1_ENST00000243222.4_Frame_Shift_Del_p.P301fs			Q03692	COAA1_HUMAN	collagen, type X, alpha 1	301	Triple-helical region.				cartilage development (GO:0051216)|collagen catabolic process (GO:0030574)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	cell cortex (GO:0005938)|collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(2)|lung(6)|skin(3)|upper_aerodigestive_tract(1)	13		all_cancers(87;0.0176)|all_epithelial(87;0.0263)|Colorectal(196;0.234)		all cancers(137;0.0157)|OV - Ovarian serous cystadenocarcinoma(136;0.0325)|GBM - Glioblastoma multiforme(226;0.0446)|Epithelial(106;0.0711)		TGGCAAGCCTGGTTTCCCAAA	0.642																																																	0													28.0	32.0	31.0					6																	116442377		2191	4289	6480	SO:0001589	frameshift_variant	0				CCDS5105.1	6q21-q22	2013-01-16	2008-07-29		ENSG00000123500	ENSG00000123500		"""Collagens"""	2185	protein-coding gene	gene with protein product	"""Schmid metaphyseal chondrodysplasia"""	120110				2037056	Standard	XM_006715332		Approved		uc003pwm.3	Q03692	OTTHUMG00000015426	ENST00000327673.4:c.902delC	6.37:g.116442377delG	ENSP00000327368:p.Pro301fs		A1L4P2	Frame_Shift_Del	DEL	pfam_Collagen,pfam_C1q,superfamily_Tumour_necrosis_fac-like_dom,smart_C1q,pfscan_C1q,prints_C1q	p.P301fs	ENST00000327673.4	37	c.902	CCDS5105.1	6																																																																																			COL10A1	-	NULL	ENSG00000123500		0.642	COL10A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL10A1	HGNC	protein_coding	OTTHUMT00000041926.1		0.00	24	0	G			116442377	-1	tier1		no_errors	ENST00000243222	ensembl	human	known	74_37	frame_shift_del	33.33	4	2	DEL	1.000	-
COL11A1	1301	genome.wustl.edu	37	1	103544425	103544425	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr1:103544425C>T	ENST00000370096.3	-	3	589	c.277G>A	c.(277-279)Gga>Aga	p.G93R	COL11A1_ENST00000358392.2_Missense_Mutation_p.G93R|COL11A1_ENST00000512756.1_Missense_Mutation_p.G93R|COL11A1_ENST00000353414.4_Missense_Mutation_p.G93R	NM_001854.3	NP_001845.3	P12107	COBA1_HUMAN	collagen, type XI, alpha 1	93	Laminin G-like.				cartilage condensation (GO:0001502)|chondrocyte development (GO:0002063)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|embryonic skeletal system morphogenesis (GO:0048704)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|proteoglycan metabolic process (GO:0006029)|sensory perception of sound (GO:0007605)|tendon development (GO:0035989)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visual perception (GO:0007601)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)			NS(3)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(17)|kidney(8)|large_intestine(28)|lung(157)|ovary(6)|pancreas(2)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(1)	258		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		GGGAAAGTTCCACCTGAGAAG	0.318																																																	0													22.0	24.0	24.0					1																	103544425		2182	4291	6473	SO:0001583	missense	0			J04177	CCDS778.1, CCDS780.1, CCDS780.2, CCDS53348.1	1p21	2013-01-16			ENSG00000060718	ENSG00000060718		"""Collagens"""	2186	protein-coding gene	gene with protein product	"""collagen XI, alpha-1 polypeptide"""	120280		COLL6		3182841	Standard	NM_080630		Approved	STL2, CO11A1	uc001dul.3	P12107	OTTHUMG00000010872	ENST00000370096.3:c.277G>A	1.37:g.103544425C>T	ENSP00000359114:p.Gly93Arg		B1ASK7|D3DT73|E9PCU0|Q14034|Q149N0|Q9UIT4|Q9UIT5|Q9UIT6	Missense_Mutation	SNP	pfam_Collagen,pfam_Fib_collagen_C,pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,superfamily_Fibrinogen_a/b/g_C_dom,smart_Laminin_G,smart_Fib_collagen_C	p.G93R	ENST00000370096.3	37	c.277	CCDS778.1	1	.	.	.	.	.	.	.	.	.	.	C	20.5	4.004678	0.74932	.	.	ENSG00000060718	ENST00000370096;ENST00000358392;ENST00000353414;ENST00000512756;ENST00000427239;ENST00000447608	T;T;T;T;T;T	0.02472	4.28;4.28;4.28;4.28;4.28;4.28	5.73	5.73	0.89815	Concanavalin A-like lectin/glucanase (1);Laminin G, thrombospondin-type, N-terminal (1);	0.117593	0.64402	D	0.000019	T	0.12518	0.0304	M	0.91249	3.19	0.80722	D	1	D;D;D;D	0.57257	0.964;0.979;0.979;0.964	P;P;P;P	0.56042	0.621;0.79;0.79;0.621	T	0.01795	-1.1272	10	0.87932	D	0	.	19.8984	0.96975	0.0:1.0:0.0:0.0	.	93;93;93;93	E9PCU0;P12107-3;P12107-2;P12107	.;.;.;COBA1_HUMAN	R	93;93;93;93;93;20	ENSP00000359114:G93R;ENSP00000351163:G93R;ENSP00000302551:G93R;ENSP00000426533:G93R;ENSP00000408640:G93R;ENSP00000410177:G20R	ENSP00000302551:G93R	G	-	1	0	COL11A1	103317013	1.000000	0.71417	1.000000	0.80357	0.896000	0.52359	4.920000	0.63390	2.713000	0.92767	0.655000	0.94253	GGA	COL11A1	-	superfamily_ConA-like_lec_gl_sf,smart_Laminin_G	ENSG00000060718		0.318	COL11A1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	COL11A1	HGNC	protein_coding	OTTHUMT00000029997.1	-	0.00	62	0	C	NM_080630		103544425	-1	tier1	-	no_errors	ENST00000358392	ensembl	human	known	74_37	missense	10.64	42	5	SNP	1.000	T
COL27A1	85301	genome.wustl.edu	37	9	117064372	117064372	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr9:117064372G>A	ENST00000356083.3	+	56	5247	c.4856G>A	c.(4855-4857)gGg>gAg	p.G1619E		NM_032888.2	NP_116277.2	Q8IZC6	CORA1_HUMAN	collagen, type XXVII, alpha 1	1619	Collagen-like 16.|Pro-rich.				extracellular matrix organization (GO:0030198)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|fibrillar collagen trimer (GO:0005583)	extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)			central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(17)|lung(30)|ovary(4)|prostate(6)|skin(3)|soft_tissue(1)|stomach(1)|urinary_tract(3)	80						GGTCCTCCAGGGGGTCCTATC	0.557																																																	0													112.0	112.0	112.0					9																	117064372		2203	4300	6503	SO:0001583	missense	0			AB058773	CCDS6802.1	9q33.1	2013-01-16			ENSG00000196739	ENSG00000196739		"""Collagens"""	22986	protein-coding gene	gene with protein product		608461				12766169	Standard	NM_032888		Approved	KIAA1870, MGC11337, FLJ11895	uc011lxl.2	Q8IZC6	OTTHUMG00000020537	ENST00000356083.3:c.4856G>A	9.37:g.117064372G>A	ENSP00000348385:p.Gly1619Glu		Q66K43|Q96JF7	Missense_Mutation	SNP	pfam_Collagen,pfam_Fib_collagen_C,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,smart_Fib_collagen_C	p.G1619E	ENST00000356083.3	37	c.4856	CCDS6802.1	9	.	.	.	.	.	.	.	.	.	.	G	15.16	2.751089	0.49257	.	.	ENSG00000196739	ENST00000356083	D	0.99619	-6.28	4.97	4.97	0.65823	.	.	.	.	.	D	0.99768	0.9905	H	0.98314	4.2	0.26139	N	0.980309	D	0.58970	0.984	P	0.62184	0.899	D	0.98563	1.0642	9	0.66056	D	0.02	.	14.0889	0.64977	0.0:0.0:1.0:0.0	.	1619	Q8IZC6	CORA1_HUMAN	E	1619	ENSP00000348385:G1619E	ENSP00000348385:G1619E	G	+	2	0	COL27A1	116104193	1.000000	0.71417	0.939000	0.37840	0.979000	0.70002	4.691000	0.61738	2.468000	0.83385	0.462000	0.41574	GGG	COL27A1	-	pfam_Collagen	ENSG00000196739		0.557	COL27A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL27A1	HGNC	protein_coding	OTTHUMT00000053763.1	-	0.00	65	0	G	NM_032888		117064372	+1	tier1	-	no_errors	ENST00000356083	ensembl	human	known	74_37	missense	14.71	29	5	SNP	0.982	A
COLEC12	81035	genome.wustl.edu	37	18	334900	334900	+	Missense_Mutation	SNP	A	A	T	rs531789462		TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr18:334900A>T	ENST00000400256.3	-	6	1865	c.1658T>A	c.(1657-1659)gTt>gAt	p.V553D		NM_130386.2	NP_569057	Q5KU26	COL12_HUMAN	collectin sub-family member 12	553	Collagen-like 3.				carbohydrate mediated signaling (GO:0009756)|defense response (GO:0006952)|innate immune response (GO:0045087)|pattern recognition receptor signaling pathway (GO:0002221)|phagocytosis, recognition (GO:0006910)|protein homooligomerization (GO:0051260)|receptor-mediated endocytosis (GO:0006898)	collagen trimer (GO:0005581)|endocytic vesicle membrane (GO:0030666)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	galactose binding (GO:0005534)|low-density lipoprotein particle binding (GO:0030169)|metal ion binding (GO:0046872)|scavenger receptor activity (GO:0005044)|signaling pattern recognition receptor activity (GO:0008329)	p.V553A(1)		cervix(2)|endometrium(3)|kidney(2)|large_intestine(10)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	46		all_cancers(4;0.0442)|Myeloproliferative disorder(11;0.0426)				AGGCTCCCCAACGGTGCCCTG	0.736																																																	1	Substitution - Missense(1)	lung(1)											9.0	12.0	11.0					18																	334900		2169	4234	6403	SO:0001583	missense	0			AB038518	CCDS32782.1	18p11.32	2013-09-19			ENSG00000158270	ENSG00000158270		"""Collectins"""	16016	protein-coding gene	gene with protein product		607621				11162630	Standard	NM_130386		Approved	SRCL, CL-P1, SCARA4	uc002kkm.3	Q5KU26	OTTHUMG00000178145	ENST00000400256.3:c.1658T>A	18.37:g.334900A>T	ENSP00000383115:p.Val553Asp		Q6P9F2|Q8TCR2|Q8WZA4|Q9BY85|Q9BYH7	Missense_Mutation	SNP	pfam_C-type_lectin,pfam_Collagen,superfamily_C-type_lectin_fold,smart_C-type_lectin,prints_AntifreezeII,pfscan_C-type_lectin	p.V553D	ENST00000400256.3	37	c.1658	CCDS32782.1	18	.	.	.	.	.	.	.	.	.	.	A	6.059	0.379234	0.11466	.	.	ENSG00000158270	ENST00000400256	D	0.93307	-3.2	5.53	5.53	0.82687	.	0.386506	0.30338	N	0.009849	D	0.83348	0.5235	N	0.05534	-0.03	0.52099	D	0.999947	B	0.33413	0.411	B	0.37015	0.239	T	0.79082	-0.1949	10	0.14656	T	0.56	-17.4248	6.1608	0.20364	0.7813:0.0:0.0751:0.1436	.	553	Q5KU26	COL12_HUMAN	D	553	ENSP00000383115:V553D	ENSP00000383115:V553D	V	-	2	0	COLEC12	324900	0.008000	0.16893	0.899000	0.35326	0.015000	0.08874	1.900000	0.39828	2.094000	0.63399	0.459000	0.35465	GTT	COLEC12	-	pfam_Collagen	ENSG00000158270		0.736	COLEC12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COLEC12	HGNC	protein_coding	OTTHUMT00000440746.1		0.00	60	0	A			334900	-1			no_errors	ENST00000400256	ensembl	human	known	74_37	missense	6.82	41	3	SNP	0.692	T
CORO6	84940	genome.wustl.edu	37	17	27948355	27948355	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr17:27948355G>A	ENST00000445145.2	-	1	86	c.85C>T	c.(85-87)Cgt>Tgt	p.R29C	CORO6_ENST00000577909.1_Intron|CORO6_ENST00000345068.5_Missense_Mutation_p.R29C|CORO6_ENST00000584969.1_Missense_Mutation_p.R29C|CORO6_ENST00000388767.3_Missense_Mutation_p.R29C|CORO6_ENST00000580212.1_Missense_Mutation_p.R29C|RP11-68I3.10_ENST00000582367.1_RNA|RP11-68I3.2_ENST00000581474.1_RNA			Q6QEF8	CORO6_HUMAN	coronin 6	29					actin cytoskeleton organization (GO:0030036)	actin cytoskeleton (GO:0015629)	actin filament binding (GO:0051015)			breast(1)|cervix(1)|endometrium(1)|large_intestine(4)|lung(4)|prostate(1)|urinary_tract(2)	14						TTGGACACACGGATGTCCTCG	0.587																																																	0													73.0	77.0	76.0					17																	27948355		2192	4296	6488	SO:0001583	missense	0			AF193039	CCDS11252.2	17q11.2	2013-01-10			ENSG00000167549	ENSG00000167549		"""Coronins"", ""WD repeat domain containing"""	21356	protein-coding gene	gene with protein product							Standard	NM_032854		Approved	FLJ14871	uc002hel.2	Q6QEF8	OTTHUMG00000132732	ENST00000445145.2:c.85C>T	17.37:g.27948355G>A	ENSP00000393624:p.Arg29Cys		B3KU26|Q71MF3|Q8WYH7|Q96K02	Missense_Mutation	SNP	pfam_DUF1900,pfam_DUF1899,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.R29C	ENST00000445145.2	37	c.85		17	.	.	.	.	.	.	.	.	.	.	G	15.66	2.899777	0.52227	.	.	ENSG00000167549	ENST00000345068;ENST00000388767;ENST00000445145	T;T	0.62498	0.1;0.02	5.44	5.44	0.79542	.	0.000000	0.85682	D	0.000000	D	0.85186	0.5639	M	0.93638	3.44	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.88596	0.3146	10	0.87932	D	0	-11.1491	19.2367	0.93864	0.0:0.0:1.0:0.0	.	29	Q6QEF8-5	.	C	100;29;29	ENSP00000373419:R29C;ENSP00000393624:R29C	ENSP00000344562:R100C	R	-	1	0	CORO6	24972481	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.452000	0.66638	2.717000	0.92951	0.655000	0.94253	CGT	CORO6	-	pfam_DUF1899	ENSG00000167549		0.587	CORO6-202	KNOWN	basic|appris_candidate_longest	protein_coding	CORO6	HGNC	protein_coding	OTTHUMT00000447831.1		0.00	26	0	G	NM_032854		27948355	-1			no_errors	ENST00000345068	ensembl	human	known	74_37	missense	11.76	15	2	SNP	1.000	A
CPS1	1373	genome.wustl.edu	37	2	211471635	211471635	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr2:211471635G>A	ENST00000233072.5	+	18	2358	c.2162G>A	c.(2161-2163)cGa>cAa	p.R721Q	CPS1_ENST00000430249.2_Missense_Mutation_p.R727Q|CPS1_ENST00000451903.2_Missense_Mutation_p.R270Q	NM_001875.4	NP_001866.2	P31327	CPSM_HUMAN	carbamoyl-phosphate synthase 1, mitochondrial	721	ATP-grasp 1.		R -> Q (in CPS1D). {ECO:0000269|PubMed:21120950}.	RLSRS -> KMSPN (in Ref. 1; BAA14328). {ECO:0000305}.	anion homeostasis (GO:0055081)|carbamoyl phosphate biosynthetic process (GO:0070409)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to cAMP (GO:0071320)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to glucagon stimulus (GO:0071377)|cellular response to oleic acid (GO:0071400)|citrulline biosynthetic process (GO:0019240)|glutamine catabolic process (GO:0006543)|glycogen catabolic process (GO:0005980)|hepatocyte differentiation (GO:0070365)|homocysteine metabolic process (GO:0050667)|midgut development (GO:0007494)|nitric oxide metabolic process (GO:0046209)|positive regulation of vasodilation (GO:0045909)|response to amine (GO:0014075)|response to amino acid (GO:0043200)|response to dexamethasone (GO:0071548)|response to drug (GO:0042493)|response to food (GO:0032094)|response to growth hormone (GO:0060416)|response to lipopolysaccharide (GO:0032496)|response to starvation (GO:0042594)|response to toxic substance (GO:0009636)|response to zinc ion (GO:0010043)|small molecule metabolic process (GO:0044281)|triglyceride catabolic process (GO:0019433)|urea cycle (GO:0000050)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|carbamoyl-phosphate synthase (ammonia) activity (GO:0004087)|endopeptidase activity (GO:0004175)|glutamate binding (GO:0016595)|modified amino acid binding (GO:0072341)|phospholipid binding (GO:0005543)			breast(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(17)|lung(85)|ovary(8)|pancreas(1)|prostate(6)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	142				Epithelial(149;0.00697)|Lung(261;0.0521)|LUSC - Lung squamous cell carcinoma(261;0.0544)|all cancers(144;0.0843)	Carglumic Acid(DB06775)	AGACTGTCCCGAAGCTCTGCT	0.443																																																	0													83.0	74.0	77.0					2																	211471635		2203	4300	6503	SO:0001583	missense	0			AF154830	CCDS2393.1, CCDS46505.1, CCDS46506.1	2p	2014-09-17	2010-05-11		ENSG00000021826	ENSG00000021826	6.3.4.16		2323	protein-coding gene	gene with protein product		608307	"""carbamoyl-phosphate synthetase 1, mitochondrial"""				Standard	NM_001122633		Approved		uc002vee.4	P31327	OTTHUMG00000132994	ENST00000233072.5:c.2162G>A	2.37:g.211471635G>A	ENSP00000233072:p.Arg721Gln		B7Z818|J3KQL0|O43774|Q53TL5|Q59HF8|Q7Z5I5	Missense_Mutation	SNP	pfam_CbamoylP_synth_lsu-like_ATP-bd,pfam_CarbamoylP_synth_ssu_N,pfam_CarbamoylP_synth_lsu_oligo,pfam_GATASE,pfam_CarbamoylP_synth_lsu_N,pfam_MGS-like_dom,pfam_ATP-grasp_carboxylate-amine,pfam_Dala_Dala_lig_C,superfamily_CarbamoylP_synth_lsu_oligo,superfamily_CarbamoylP_synth_ssu_N,superfamily_PreATP-grasp_dom,superfamily_MGS-like_dom,smart_MGS-like_dom,pfscan_ATP-grasp,prints_CbamoylP_synth_lsu_CPSase_dom,tigrfam_CarbamoylP_synth_lsu,tigrfam_CarbamoylP_synth_ssu	p.R727Q	ENST00000233072.5	37	c.2180	CCDS2393.1	2	.	.	.	.	.	.	.	.	.	.	G	35	5.540602	0.96474	.	.	ENSG00000021826	ENST00000430249;ENST00000539150;ENST00000233072;ENST00000451903	D;D;D	0.98717	-5.09;-5.09;-5.09	5.73	5.73	0.89815	ATP-grasp fold (1);ATP-grasp fold, subdomain 2 (1);Carbamoyl-phosphate synthetase, large subunit, ATP-binding (1);Carbamoyl-phosphate synthase, large subunit, CPS-domain (1);	0.000000	0.85682	D	0.000000	D	0.99664	0.9875	H	0.99859	4.855	0.54753	D	0.999984	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.97157	0.9835	10	0.87932	D	0	-28.6625	19.9597	0.97242	0.0:0.0:1.0:0.0	.	731;721	Q59HF8;P31327	.;CPSM_HUMAN	Q	727;729;721;270	ENSP00000402608:R727Q;ENSP00000233072:R721Q;ENSP00000406136:R270Q	ENSP00000233072:R721Q	R	+	2	0	CPS1	211179880	1.000000	0.71417	0.996000	0.52242	0.983000	0.72400	9.472000	0.97709	2.723000	0.93209	0.586000	0.80456	CGA	CPS1	-	pfam_CbamoylP_synth_lsu-like_ATP-bd,pfscan_ATP-grasp,prints_CbamoylP_synth_lsu_CPSase_dom,tigrfam_CarbamoylP_synth_lsu	ENSG00000021826		0.443	CPS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPS1	HGNC	protein_coding	OTTHUMT00000256569.5	-	0.00	30	0	G			211471635	+1	tier1	-	no_errors	ENST00000430249	ensembl	human	known	74_37	missense	35.00	13	7	SNP	1.000	A
CRP	1401	genome.wustl.edu	37	1	159683718	159683718	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr1:159683718T>C	ENST00000255030.5	-	2	375	c.272A>G	c.(271-273)tAc>tGc	p.Y91C	CRP_ENST00000437342.1_De_novo_Start_OutOfFrame|CRP_ENST00000368111.1_Intron|CRP_ENST00000368112.1_Intron|CRP_ENST00000368110.1_Intron|CRP_ENST00000343919.2_Intron|CRP_ENST00000473196.1_5'Flank	NM_000567.2	NP_000558.2	P02741	CRP_HUMAN	C-reactive protein, pentraxin-related	91	Pentaxin.			Missing (in Ref. 13; AA sequence). {ECO:0000305}.	acute-phase response (GO:0006953)|aging (GO:0007568)|cellular response to calcium ion (GO:0071277)|complement activation, classical pathway (GO:0006958)|defense response to Gram-positive bacterium (GO:0050830)|inflammatory response (GO:0006954)|negative regulation of lipid storage (GO:0010888)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|opsonization (GO:0008228)|positive regulation of dendrite development (GO:1900006)|protein polymerization (GO:0051258)|regulation of interleukin-8 secretion (GO:2000482)|response to ethanol (GO:0045471)|response to hypoxia (GO:0001666)|response to lead ion (GO:0010288)|wound healing (GO:0042060)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|growth cone (GO:0030426)	calcium ion binding (GO:0005509)|cholesterol binding (GO:0015485)|choline binding (GO:0033265)|complement component C1q binding (GO:0001849)|low-density lipoprotein particle binding (GO:0030169)			breast(1)|endometrium(3)|kidney(1)|lung(15)|ovary(1)|skin(1)	22	all_hematologic(112;0.0429)				inhaled insulin(DB05278)	TGTAAAACTGTATCCTATATC	0.453																																																	0													109.0	107.0	108.0					1																	159683718		2203	4300	6503	SO:0001583	missense	0			M11725	CCDS30911.1	1q23.2	2013-05-13			ENSG00000132693	ENSG00000132693			2367	protein-coding gene	gene with protein product	"""pentraxin 1"""	123260				3840479, 6857266	Standard	NM_000567		Approved	PTX1	uc001ftw.3	P02741	OTTHUMG00000035344	ENST00000255030.5:c.272A>G	1.37:g.159683718T>C	ENSP00000255030:p.Tyr91Cys		A8K078|D3DVD9|D3DVE0|Q08AK3|Q8WW75	Missense_Mutation	SNP	pfam_Pentaxin,superfamily_ConA-like_lec_gl_sf,smart_Pentaxin,prints_Pentaxin	p.Y91C	ENST00000255030.5	37	c.272	CCDS30911.1	1	.	.	.	.	.	.	.	.	.	.	T	14.33	2.502577	0.44455	.	.	ENSG00000132693	ENST00000255030	T	0.09163	3.01	4.97	-8.04	0.01110	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);	0.458214	0.22588	N	0.058122	T	0.10723	0.0262	M	0.76170	2.325	0.20307	N	0.999917	D	0.89917	1.0	D	0.97110	1.0	T	0.01791	-1.1273	10	0.59425	D	0.04	-10.7565	5.4035	0.16308	0.5196:0.1451:0.0:0.3353	.	91	P02741	CRP_HUMAN	C	91	ENSP00000255030:Y91C	ENSP00000255030:Y91C	Y	-	2	0	CRP	157950342	0.143000	0.22626	0.000000	0.03702	0.003000	0.03518	0.326000	0.19646	-0.822000	0.04306	0.528000	0.53228	TAC	CRP	-	pfam_Pentaxin,superfamily_ConA-like_lec_gl_sf,smart_Pentaxin	ENSG00000132693		0.453	CRP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CRP	HGNC	protein_coding	OTTHUMT00000085553.1	-	0.00	43	0	T	NM_000567		159683718	-1	tier1	-	no_errors	ENST00000255030	ensembl	human	known	74_37	missense	13.79	25	4	SNP	0.000	C
CRTAM	56253	genome.wustl.edu	37	11	122733129	122733129	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr11:122733129C>A	ENST00000533709.1	+	1	119	c.13C>A	c.(13-15)Ctg>Atg	p.L5M	CRTAM_ENST00000227348.4_Intron					cytotoxic and regulatory T cell molecule											breast(1)|endometrium(2)|large_intestine(5)|lung(7)|ovary(2)|pancreas(1)|prostate(1)	19		Breast(109;0.00249)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;5.28e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0308)		GTGGGTAAAACTGCTCTCTAT	0.423																																																	0													43.0	42.0	42.0					11																	122733129		2202	4299	6501	SO:0001583	missense	0			AF001622	CCDS8437.1	11q24.1	2013-01-11			ENSG00000109943	ENSG00000109943		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"""	24313	protein-coding gene	gene with protein product	"""class I MHC restricted T cell associated molecule"""	612597				10811014, 16300832	Standard	NM_019604		Approved	CD355	uc001pyj.3	O95727	OTTHUMG00000166026	ENST00000533709.1:c.13C>A	11.37:g.122733129C>A	ENSP00000433728:p.Leu5Met			Missense_Mutation	SNP	NULL	p.L5M	ENST00000533709.1	37	c.13		11	.	.	.	.	.	.	.	.	.	.	C	18.58	3.654493	0.67472	.	.	ENSG00000109943	ENST00000533709	T	0.35605	1.3	4.2	-6.41	0.01938	.	.	.	.	.	T	0.52901	0.1763	.	.	.	0.09310	N	1	D	0.76494	0.999	D	0.73380	0.98	T	0.58059	-0.7703	8	0.87932	D	0	.	12.8165	0.57669	0.0:0.1768:0.0:0.8232	.	5	O95727-2	.	M	5	ENSP00000433728:L5M	ENSP00000433728:L5M	L	+	1	2	CRTAM	122238339	0.002000	0.14202	0.001000	0.08648	0.820000	0.46376	-0.368000	0.07543	-1.397000	0.02068	-0.793000	0.03317	CTG	CRTAM	-	NULL	ENSG00000109943		0.423	CRTAM-002	KNOWN	basic	protein_coding	CRTAM	HGNC	protein_coding	OTTHUMT00000387508.1	-	0.00	28	0	C	NM_019604		122733129	+1	tier1	-	no_errors	ENST00000533709	ensembl	human	known	74_37	missense	25.00	18	6	SNP	0.001	A
CSF2RB	1439	genome.wustl.edu	37	22	37334439	37334439	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr22:37334439G>C	ENST00000403662.3	+	14	2811	c.2589G>C	c.(2587-2589)caG>caC	p.Q863H	CSF2RB_ENST00000406230.1_Missense_Mutation_p.Q869H|CSF2RB_ENST00000536485.1_Missense_Mutation_p.Q810H|CSF2RB_ENST00000262825.5_Missense_Mutation_p.Q869H			P32927	IL3RB_HUMAN	colony stimulating factor 2 receptor, beta, low-affinity (granulocyte-macrophage)	863					cellular response to interleukin-3 (GO:0036016)|interleukin-3-mediated signaling pathway (GO:0038156)|interleukin-5-mediated signaling pathway (GO:0038043)|respiratory gaseous exchange (GO:0007585)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)	granulocyte macrophage colony-stimulating factor receptor complex (GO:0030526)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cytokine receptor activity (GO:0004896)|receptor activity (GO:0004872)			breast(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(18)|ovary(3)|pancreas(1)|skin(5)|upper_aerodigestive_tract(2)	42					Sargramostim(DB00020)	CCCCAGGCCAGGCTGTGCCCC	0.607																																																	0													76.0	90.0	85.0					22																	37334439		2203	4300	6503	SO:0001583	missense	0			M59941	CCDS13936.1	22q12.3	2014-09-09			ENSG00000100368	ENSG00000100368		"""CD molecules"", ""Fibronectin type III domain containing"""	2436	protein-coding gene	gene with protein product		138981		IL3RB		1833064, 1424804	Standard	NM_000395		Approved	IL5RB, CD131	uc003aqa.4	P32927	OTTHUMG00000150546	ENST00000403662.3:c.2589G>C	22.37:g.37334439G>C	ENSP00000384053:p.Gln863His		Q5JZI1|Q6ICE0	Missense_Mutation	SNP	pirsf_IL3_rcpt_beta,pfam_Fibronectin_type3,pfam_IL-6_rcpt_alpha-bd,pfam_Interferon_alpha/beta_rcpt_bsu,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	p.Q869H	ENST00000403662.3	37	c.2607	CCDS13936.1	22	.	.	.	.	.	.	.	.	.	.	G	17.07	3.294312	0.60086	.	.	ENSG00000100368	ENST00000403662;ENST00000539104;ENST00000262825;ENST00000406230;ENST00000536485	D;D;D;D	0.94000	-2.81;-3.32;-3.32;-3.33	5.38	-2.4	0.06583	.	1.079400	0.07307	N	0.875087	D	0.94528	0.8238	L	0.54323	1.7	0.09310	N	1	D;D	0.89917	1.0;0.999	D;P	0.69479	0.964;0.87	D	0.87206	0.2244	10	0.66056	D	0.02	-7.7044	9.4474	0.38706	0.5504:0.0:0.4496:0.0	.	869;863	P32927-2;P32927	.;IL3RB_HUMAN	H	863;863;869;869;810	ENSP00000384053:Q863H;ENSP00000262825:Q869H;ENSP00000385271:Q869H;ENSP00000440003:Q810H	ENSP00000262825:Q869H	Q	+	3	2	CSF2RB	35664385	0.000000	0.05858	0.002000	0.10522	0.354000	0.29330	-0.091000	0.11146	-0.309000	0.08779	0.650000	0.86243	CAG	CSF2RB	-	pirsf_IL3_rcpt_beta	ENSG00000100368		0.607	CSF2RB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSF2RB	HGNC	protein_coding	OTTHUMT00000318854.1		0.00	94	0	G	NM_000395		37334439	+1			no_errors	ENST00000262825	ensembl	human	known	74_37	missense	5.88	48	3	SNP	0.000	C
CSPG4	1464	genome.wustl.edu	37	15	75968663	75968663	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr15:75968663G>T	ENST00000308508.5	-	10	6289	c.6197C>A	c.(6196-6198)aCc>aAc	p.T2066N	AC105020.1_ENST00000435356.1_5'Flank|CTD-2026K11.1_ENST00000569467.1_RNA	NM_001897.4	NP_001888.2	Q6UVK1	CSPG4_HUMAN	chondroitin sulfate proteoglycan 4	2066	Cysteine-containing.|Neurite growth inhibition. {ECO:0000250}.				activation of MAPK activity (GO:0000187)|angiogenesis (GO:0001525)|carbohydrate metabolic process (GO:0005975)|cell proliferation (GO:0008283)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|intracellular signal transduction (GO:0035556)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|small molecule metabolic process (GO:0044281)|tissue remodeling (GO:0048771)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell projection (GO:0042995)|cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)	protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)			breast(1)|cervix(2)|endometrium(5)|kidney(5)|large_intestine(3)|liver(2)|lung(18)|ovary(2)|pancreas(2)|prostate(4)|skin(4)	48						ATCTAGGACGGTGGGGTCCAG	0.692																																																	0													26.0	22.0	23.0					15																	75968663		2195	4293	6488	SO:0001583	missense	0			X96753, AY359468	CCDS10284.1	15q24.2	2010-04-19	2007-02-16		ENSG00000173546	ENSG00000173546		"""Proteoglycans / Cell surface : Other"""	2466	protein-coding gene	gene with protein product	"""melanoma-associated chondroitin sulfate proteoglycan"""	601172	"""chondroitin sulfate proteoglycan 4 (melanoma-associated)"""			8790396, 16407841	Standard	NM_001897		Approved	MCSPG, MEL-CSPG, MSK16, NG2, MCSP, HMW-MAA	uc002baw.3	Q6UVK1	OTTHUMG00000142836	ENST00000308508.5:c.6197C>A	15.37:g.75968663G>T	ENSP00000312506:p.Thr2066Asn		D3DW77|Q92675	Missense_Mutation	SNP	pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,pfscan_Laminin_G	p.T2066N	ENST00000308508.5	37	c.6197	CCDS10284.1	15	.	.	.	.	.	.	.	.	.	.	G	0.630	-0.817430	0.02776	.	.	ENSG00000173546	ENST00000308508;ENST00000537176	T	0.17528	2.27	4.62	-1.57	0.08506	.	0.986339	0.08249	N	0.974934	T	0.11239	0.0274	L	0.31664	0.95	0.09310	N	1	B	0.11235	0.004	B	0.06405	0.002	T	0.37337	-0.9710	10	0.30854	T	0.27	.	7.1277	0.25482	0.0869:0.5915:0.2095:0.112	.	2066	Q6UVK1	CSPG4_HUMAN	N	2066;98	ENSP00000312506:T2066N	ENSP00000312506:T2066N	T	-	2	0	CSPG4	73755718	0.034000	0.19679	0.000000	0.03702	0.061000	0.15899	2.145000	0.42207	-0.096000	0.12329	0.561000	0.74099	ACC	CSPG4	-	NULL	ENSG00000173546		0.692	CSPG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSPG4	HGNC	protein_coding	OTTHUMT00000286472.1		0.00	38	0	G	NM_001897		75968663	-1			no_errors	ENST00000308508	ensembl	human	known	74_37	missense	11.11	16	2	SNP	0.000	T
CSTF3	1479	genome.wustl.edu	37	11	33129939	33129939	+	Missense_Mutation	SNP	A	A	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr11:33129939A>T	ENST00000323959.4	-	4	390	c.251T>A	c.(250-252)gTt>gAt	p.V84D	CSTF3_ENST00000524827.1_Missense_Mutation_p.V116D	NM_001326.2	NP_001317.1	Q12996	CSTF3_HUMAN	cleavage stimulation factor, 3' pre-RNA, subunit 3, 77kDa	84					gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA cleavage (GO:0006379)|mRNA polyadenylation (GO:0006378)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(2)|endometrium(4)|kidney(1)|large_intestine(5)|lung(4)|prostate(1)|skin(1)|stomach(1)	19						CACCTTTTCAACCTTGTCATA	0.239																																																	0													17.0	18.0	18.0					11																	33129939		2118	4179	6297	SO:0001583	missense	0			U15782	CCDS7883.1, CCDS44563.1, CCDS44564.1	11p13	2007-01-05	2002-08-29		ENSG00000176102	ENSG00000176102			2485	protein-coding gene	gene with protein product		600367	"""cleavage stimulation factor, 3' pre-RNA, subunit 3, 77kD"""			7984242	Standard	XM_006718154		Approved	CstF-77	uc001muh.3	Q12996	OTTHUMG00000166268	ENST00000323959.4:c.251T>A	11.37:g.33129939A>T	ENSP00000315791:p.Val84Asp		A8K471|D3DR04|E9PB40|Q32P22|Q96FQ8|Q96QD6|Q96QK4	Missense_Mutation	SNP	pfam_Suf,smart_HAT	p.V84D	ENST00000323959.4	37	c.251	CCDS7883.1	11	.	.	.	.	.	.	.	.	.	.	A	19.63	3.864231	0.71949	.	.	ENSG00000176102	ENST00000323959;ENST00000537832;ENST00000524827	T;T	0.37915	1.17;1.17	5.4	4.26	0.50523	Tetratricopeptide-like helical (1);	0.056387	0.64402	N	0.000001	T	0.61800	0.2376	M	0.89601	3.045	0.80722	D	1	D	0.59767	0.986	P	0.60541	0.876	T	0.68667	-0.5348	10	0.87932	D	0	.	11.6744	0.51422	0.8671:0.0:0.0:0.1329	.	84	Q12996	CSTF3_HUMAN	D	84;17;116	ENSP00000315791:V84D;ENSP00000431355:V116D	ENSP00000315791:V84D	V	-	2	0	CSTF3	33086515	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.012000	0.76366	0.856000	0.35383	-0.336000	0.08194	GTT	CSTF3	-	smart_HAT	ENSG00000176102		0.239	CSTF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSTF3	HGNC	protein_coding	OTTHUMT00000388801.1	-	0.00	90	0	A	NM_001326		33129939	-1	tier1	-	no_errors	ENST00000323959	ensembl	human	known	74_37	missense	27.27	40	15	SNP	1.000	T
CYFIP1	23191	genome.wustl.edu	37	15	22998467	22998467	+	Silent	SNP	G	G	A			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr15:22998467G>A	ENST00000313077.7	+	28	3284	c.3159G>A	c.(3157-3159)aaG>aaA	p.K1053K	CYFIP1_ENST00000435939.2_Silent_p.K622K|CYFIP1_ENST00000560848.1_Silent_p.K1053K	NM_014608.2	NP_055423.1			cytoplasmic FMR1 interacting protein 1											endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|liver(1)|lung(14)|ovary(4)|pancreas(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	40		all_cancers(20;2.26e-25)|all_epithelial(15;2.1e-22)|Lung NSC(15;3.36e-17)|all_lung(15;1.04e-16)|Breast(32;0.000776)|Colorectal(260;0.0488)		all cancers(64;2.22e-06)|Epithelial(43;1.49e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00101)		TAGAATCAAAGTACGCCCCGC	0.468																																																	0													64.0	58.0	60.0					15																	22998467		2203	4300	6503	SO:0001819	synonymous_variant	0			D38549	CCDS73695.1, CCDS73696.1	15q11	2008-07-18			ENSG00000068793	ENSG00000273749			13759	protein-coding gene	gene with protein product	"""selective hybridizing clone"", ""cytoplasmic FMRP interacting protein 1"""	606322				11438699	Standard	XM_005272543		Approved	KIAA0068, P140SRA-1, SHYC	uc001yus.3	Q7L576	OTTHUMG00000129100	ENST00000313077.7:c.3159G>A	15.37:g.22998467G>A				Silent	SNP	pfam_Cytoplasmic_FMR1-int,pirsf_Cytoplasmic_FMR1-int_sub,prints_Cytoplasmic_FMR1-int	p.K1053	ENST00000313077.7	37	c.3159	CCDS10009.1	15																																																																																			CYFIP1	-	pfam_Cytoplasmic_FMR1-int,pirsf_Cytoplasmic_FMR1-int_sub	ENSG00000068793		0.468	CYFIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYFIP1	HGNC	protein_coding	OTTHUMT00000251136.2		0.00	43	0	G	NM_014608		22998467	+1			no_errors	ENST00000313077	ensembl	human	known	74_37	silent	10.00	27	3	SNP	1.000	A
CYFIP1	23191	genome.wustl.edu	37	15	22999460	22999460	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr15:22999460G>A	ENST00000313077.7	+	29	3457	c.3332G>A	c.(3331-3333)gGg>gAg	p.G1111E	CYFIP1_ENST00000435939.2_Missense_Mutation_p.G680E|CYFIP1_ENST00000560848.1_Missense_Mutation_p.G1111E	NM_014608.2	NP_055423.1			cytoplasmic FMR1 interacting protein 1											endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|liver(1)|lung(14)|ovary(4)|pancreas(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	40		all_cancers(20;2.26e-25)|all_epithelial(15;2.1e-22)|Lung NSC(15;3.36e-17)|all_lung(15;1.04e-16)|Breast(32;0.000776)|Colorectal(260;0.0488)		all cancers(64;2.22e-06)|Epithelial(43;1.49e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00101)		ATCTGGCGCGGGCCTCTGCCC	0.592																																																	0													65.0	63.0	64.0					15																	22999460		2203	4300	6503	SO:0001583	missense	0			D38549	CCDS73695.1, CCDS73696.1	15q11	2008-07-18			ENSG00000068793	ENSG00000273749			13759	protein-coding gene	gene with protein product	"""selective hybridizing clone"", ""cytoplasmic FMRP interacting protein 1"""	606322				11438699	Standard	XM_005272543		Approved	KIAA0068, P140SRA-1, SHYC	uc001yus.3	Q7L576	OTTHUMG00000129100	ENST00000313077.7:c.3332G>A	15.37:g.22999460G>A	ENSP00000324549:p.Gly1111Glu			Missense_Mutation	SNP	pfam_Cytoplasmic_FMR1-int,pirsf_Cytoplasmic_FMR1-int_sub,prints_Cytoplasmic_FMR1-int	p.G1111E	ENST00000313077.7	37	c.3332	CCDS10009.1	15	.	.	.	.	.	.	.	.	.	.	G	35	5.498800	0.96355	.	.	ENSG00000068793	ENST00000313077;ENST00000412127;ENST00000435939	T;T	0.30182	1.54;1.54	5.55	5.55	0.83447	.	0.000000	0.64402	D	0.000002	T	0.56587	0.1995	M	0.66506	2.035	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.76071	0.987;0.986	T	0.56438	-0.7979	10	0.59425	D	0.04	-39.8728	19.4921	0.95054	0.0:0.0:1.0:0.0	.	680;1111	Q7L576-2;Q7L576	.;CYFP1_HUMAN	E	1111;1113;680	ENSP00000324549:G1111E;ENSP00000405956:G680E	ENSP00000324549:G1111E	G	+	2	0	CYFIP1	20550901	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.807000	0.99171	2.624000	0.88883	0.561000	0.74099	GGG	CYFIP1	-	pfam_Cytoplasmic_FMR1-int,pirsf_Cytoplasmic_FMR1-int_sub	ENSG00000068793		0.592	CYFIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYFIP1	HGNC	protein_coding	OTTHUMT00000251136.2	-	0.00	31	0	G	NM_014608		22999460	+1	tier1	-	no_errors	ENST00000313077	ensembl	human	known	74_37	missense	31.58	13	6	SNP	1.000	A
CYP11B1	1584	genome.wustl.edu	37	8	143961103	143961103	+	Missense_Mutation	SNP	G	G	A	rs369213890		TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr8:143961103G>A	ENST00000292427.4	-	1	159	c.127C>T	c.(127-129)Cgg>Tgg	p.R43W	CYP11B1_ENST00000377675.3_Missense_Mutation_p.R43W|CYP11B1_ENST00000517471.1_Missense_Mutation_p.R43W	NM_000497.3	NP_000488.3	P15538	C11B1_HUMAN	cytochrome P450, family 11, subfamily B, polypeptide 1	43			R -> Q (in dbSNP:rs4534). {ECO:0000269|PubMed:10391209, ECO:0000269|PubMed:10391210, ECO:0000269|PubMed:2401360}.		aldosterone biosynthetic process (GO:0032342)|C21-steroid hormone biosynthetic process (GO:0006700)|cellular response to hormone stimulus (GO:0032870)|cellular response to potassium ion (GO:0035865)|cortisol biosynthetic process (GO:0034651)|glucocorticoid biosynthetic process (GO:0006704)|glucose homeostasis (GO:0042593)|immune response (GO:0006955)|mineralocorticoid biosynthetic process (GO:0006705)|regulation of blood pressure (GO:0008217)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|steroid 11-beta-monooxygenase activity (GO:0004507)			central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(10)|lung(36)|ovary(4)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	67	all_cancers(97;4.74e-11)|all_epithelial(106;2.06e-08)|Lung NSC(106;0.000228)|all_lung(105;0.000633)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)				Cimetidine(DB00501)|Clotrimazole(DB00257)|Etomidate(DB00292)|Fluconazole(DB00196)|Hydrocortisone(DB00741)|Ketoconazole(DB01026)|Metoclopramide(DB01233)|Metyrapone(DB01011)|Miconazole(DB01110)|Mitotane(DB00648)|Phenytoin(DB00252)|Spironolactone(DB00421)	CCTGGACGCCGGGGCATGGCT	0.642									Familial Hyperaldosteronism type I																																								0								G	TRP/ARG,TRP/ARG	1,4405	2.1+/-5.4	0,1,2202	66.0	63.0	64.0		127,127	0.9	0.0	8		64	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	CYP11B1	NM_000497.3,NM_001026213.1	101,101	0,2,6501	AA,AG,GG		0.0116,0.0227,0.0154	possibly-damaging,possibly-damaging	43/504,43/438	143961103	2,13004	2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Dexamethasone Sensitive Aldosteronism, FH-I	D16153	CCDS6392.1, CCDS34953.1	8q21-q22	2013-06-19	2003-01-14		ENSG00000160882	ENSG00000160882	1.14.15.4	"""Cytochrome P450s"""	2591	protein-coding gene	gene with protein product	"""steroid 11-beta-monooxygenase"""	610613	"""cytochrome P450, subfamily XIB (steroid 11-beta-hydroxylase), polypeptide 1"""	CYP11B		1303253	Standard	XM_005250807		Approved	P450C11, FHI, CPN1	uc003yxi.3	P15538	OTTHUMG00000164637	ENST00000292427.4:c.127C>T	8.37:g.143961103G>A	ENSP00000292427:p.Arg43Trp		Q14095|Q4VAQ8|Q4VAQ9|Q9UML2	Missense_Mutation	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_mitochondrial,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450_B,prints_Cyt_P450	p.R43W	ENST00000292427.4	37	c.127	CCDS6392.1	8	.	.	.	.	.	.	.	.	.	.	G	10.31	1.314991	0.23908	2.27E-4	1.16E-4	ENSG00000160882	ENST00000292427;ENST00000517471;ENST00000377675	T;T;T	0.75704	-0.42;-0.42;-0.96	2.96	0.916	0.19373	.	1.282380	0.06023	N	0.651646	T	0.72463	0.3463	L	0.36672	1.1	0.09310	N	1	P;P;D	0.60160	0.862;0.931;0.987	B;P;P	0.52909	0.339;0.606;0.713	T	0.59316	-0.7477	10	0.87932	D	0	.	5.5656	0.17168	0.0:0.2211:0.5521:0.2268	.	43;43;43	Q4VAR0;Q4VAQ9;P15538	.;.;C11B1_HUMAN	W	43	ENSP00000292427:R43W;ENSP00000428043:R43W;ENSP00000366903:R43W	ENSP00000292427:R43W	R	-	1	2	CYP11B1	143958105	0.017000	0.18338	0.009000	0.14445	0.096000	0.18686	0.370000	0.20433	0.043000	0.15746	0.305000	0.20034	CGG	CYP11B1	-	pfam_Cyt_P450,prints_Cyt_P450_mitochondrial	ENSG00000160882		0.642	CYP11B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP11B1	HGNC	protein_coding	OTTHUMT00000379475.2		0.00	31	0	G			143961103	-1			no_errors	ENST00000292427	ensembl	human	known	74_37	missense	17.65	14	3	SNP	0.228	A
CYP4F22	126410	genome.wustl.edu	37	19	15640544	15640544	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr19:15640544C>A	ENST00000269703.3	+	4	446	c.247C>A	c.(247-249)Caa>Aaa	p.Q83K	CYP4F22_ENST00000601005.2_Missense_Mutation_p.Q83K	NM_173483.3	NP_775754.2	Q6NT55	CP4FN_HUMAN	cytochrome P450, family 4, subfamily F, polypeptide 22	83						endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen (GO:0016705)			endometrium(6)|large_intestine(9)|lung(16)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|soft_tissue(1)	37						GGCGGGCCTTCAAGATGAGAA	0.552																																																	0													126.0	98.0	107.0					19																	15640544		2203	4300	6503	SO:0001583	missense	0				CCDS12331.1	19p13.12	2013-11-11			ENSG00000171954	ENSG00000171954		"""Cytochrome P450s"""	26820	protein-coding gene	gene with protein product		611495				16436457	Standard	NM_173483		Approved	FLJ39501	uc002nbh.4	Q6NT55	OTTHUMG00000182451	ENST00000269703.3:c.247C>A	19.37:g.15640544C>A	ENSP00000269703:p.Gln83Lys		Q8N8H4	Missense_Mutation	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450,prints_Cyt_P450_E_grp-II	p.Q83K	ENST00000269703.3	37	c.247	CCDS12331.1	19	.	.	.	.	.	.	.	.	.	.	C	0.279	-0.987793	0.02162	.	.	ENSG00000171954	ENST00000269703	D	0.87491	-2.26	5.37	1.75	0.24633	.	0.567797	0.18151	N	0.150087	T	0.67702	0.2921	N	0.05574	-0.02	0.09310	N	1	B	0.02656	0.0	B	0.09377	0.004	T	0.52563	-0.8559	10	0.05959	T	0.93	.	8.1378	0.31064	0.4533:0.3996:0.1471:0.0	.	83	Q6NT55	CP4FN_HUMAN	K	83	ENSP00000269703:Q83K	ENSP00000269703:Q83K	Q	+	1	0	CYP4F22	15501544	0.004000	0.15560	0.010000	0.14722	0.317000	0.28152	0.865000	0.27940	0.592000	0.29728	0.462000	0.41574	CAA	CYP4F22	-	pfam_Cyt_P450,superfamily_Cyt_P450	ENSG00000171954		0.552	CYP4F22-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP4F22	HGNC	protein_coding	OTTHUMT00000461338.2	-	0.00	73	0	C	NM_173483		15640544	+1	tier1	-	no_errors	ENST00000269703	ensembl	human	known	74_37	missense	26.92	37	14	SNP	0.043	A
CYP2G1P	22952	genome.wustl.edu	37	19	41398059	41398059	+	Splice_Site	SNP	T	T	A			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr19:41398059T>A	ENST00000601627.1	+	2	281		c.e2+2		CYP2G1P_ENST00000252909.4_RNA																							AAGGTCATGGTAGGTAGCAAC	0.443																																																	0																																										SO:0001630	splice_region_variant	0																														ENST00000601627.1:c.197+2T>A	19.37:g.41398059T>A				Splice_Site	SNP	-	NULL	ENST00000601627.1	37	c.NULL		19																																																																																			CYP2G1P	-	-	ENSG00000130612		0.443	CTC-490E21.12-001	KNOWN	mRNA_start_NF|cds_start_NF|basic|appris_principal|readthrough_transcript	nonsense_mediated_decay	CYP2G1P	HGNC	protein_coding	OTTHUMT00000463921.1		0.00	9	0	T		Intron	41398059	+1			no_errors	ENST00000252909	ensembl	human	known	74_37	splice_site	22.22	7	2	SNP	0.984	A
DAB2IP	153090	genome.wustl.edu	37	9	124536636	124536637	+	Frame_Shift_Ins	INS	-	-	C			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr9:124536636_124536637insC	ENST00000408936.3	+	13	3247_3248	c.3065_3066insC	c.(3064-3069)gaccccfs	p.DP1022fs	DAB2IP_ENST00000309989.1_Frame_Shift_Ins_p.DP898fs|DAB2IP_ENST00000259371.2_Frame_Shift_Ins_p.DP994fs			Q5VWQ8	DAB2P_HUMAN	DAB2 interacting protein	1022					activation of JUN kinase activity (GO:0007257)|activation of MAPKKK activity (GO:0000185)|angiogenesis (GO:0001525)|cell cycle (GO:0007049)|cell motility involved in cerebral cortex radial glia guided migration (GO:0021814)|cellular protein catabolic process (GO:0044257)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to interleukin-1 (GO:0071347)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to tumor necrosis factor (GO:0071356)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|endothelial cell apoptotic process (GO:0072577)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|I-kappaB phosphorylation (GO:0007252)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|layer formation in cerebral cortex (GO:0021819)|negative regulation of angiogenesis (GO:0016525)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catenin import into nucleus (GO:0035414)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin catabolic process (GO:2000599)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of G0 to G1 transition (GO:0070317)|negative regulation of GTPase activity (GO:0034260)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of phosphatidylinositol 3-kinase activity (GO:0043553)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|negative regulation of Ras GTPase activity (GO:0034261)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of toll-like receptor 4 signaling pathway (GO:0034144)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030948)|negative regulation of vascular endothelial growth factor signaling pathway (GO:1900747)|neuron projection morphogenesis (GO:0048812)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of dendrite development (GO:1900006)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of neuron migration (GO:2001224)|positive regulation of neuron projection development (GO:0010976)|positive regulation of proteasomal protein catabolic process (GO:1901800)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of synapse maturation (GO:0090129)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of ARF GTPase activity (GO:0032312)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of p38MAPK cascade (GO:1900744)|regulation of protein complex assembly (GO:0043254)|response to unfolded protein (GO:0006986)|transformed cell apoptotic process (GO:0006927)|tube formation (GO:0035148)|vascular endothelial growth factor receptor-2 signaling pathway (GO:0036324)	axon (GO:0030424)|cerebellar mossy fiber (GO:0044300)|climbing fiber (GO:0044301)|cytoplasm (GO:0005737)|endocytic vesicle (GO:0030139)|extracellular vesicular exosome (GO:0070062)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|neuronal cell body (GO:0043025)|neuronal cell body membrane (GO:0032809)|parallel fiber (GO:1990032)|plasma membrane (GO:0005886)	14-3-3 protein binding (GO:0071889)|death receptor binding (GO:0005123)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|mitogen-activated protein kinase kinase binding (GO:0031434)|mitogen-activated protein kinase kinase kinase binding (GO:0031435)|phosphatidylinositol 3-kinase binding (GO:0043548)|phosphatidylinositol 3-kinase regulatory subunit binding (GO:0036312)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4-phosphate binding (GO:0070273)|protein complex binding (GO:0032403)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|protein phosphatase 2A binding (GO:0051721)|Ras GTPase activator activity (GO:0005099)|SH3 domain binding (GO:0017124)|signaling adaptor activity (GO:0035591)|vascular endothelial growth factor receptor 2 binding (GO:0043184)			breast(3)|central_nervous_system(2)|cervix(1)|endometrium(3)|large_intestine(8)|lung(6)|ovary(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	27						CTGGGCCCAGACCCCCCCCACA	0.634																																																	0									,	22,4242		0,22,2110					,	5.3	1.0			38	17,8235		0,17,4109	no	frameshift,frameshift	DAB2IP	NM_138709.1,NM_032552.2	,	0,39,6219	A1A1,A1R,RR		0.206,0.5159,0.3116	,	,		39,12477				SO:0001589	frameshift_variant	0			AF367051	CCDS6832.1, CCDS6833.2	9q33.1-q33.3	2008-07-21			ENSG00000136848	ENSG00000136848			17294	protein-coding gene	gene with protein product	"""nGAP-like protein"", ""DOC-2/DAB2 interactive protein"", ""ASK-interacting protein"", ""ASK1-interacting protein 1"""	609205				11944990, 11812785	Standard	XM_005251721		Approved	AF9Q34, DIP1/2, KIAA1743, AIP1	uc004bln.3	Q5VWQ8	OTTHUMG00000020595	ENST00000408936.3:c.3073dupC	9.37:g.124536644_124536644dupC	ENSP00000386183:p.Asp1022fs		A6H8V2|A6NHI9|B0QZB1|G3XA90|Q8TDL2|Q96SE1|Q9C0C0	Frame_Shift_Ins	INS	pfam_DUF3498,pfam_RasGAP,pfam_C2_dom,superfamily_Rho_GTPase_activation_prot,superfamily_C2_dom,smart_Pleckstrin_homology,smart_C2_dom,smart_RasGAP,pfscan_Pleckstrin_homology,pfscan_RasGAP	p.H1025fs	ENST00000408936.3	37	c.3065_3066		9																																																																																			DAB2IP	-	pfam_DUF3498	ENSG00000136848		0.634	DAB2IP-009	KNOWN	basic|appris_candidate_longest	protein_coding	DAB2IP	HGNC	protein_coding	OTTHUMT00000317857.1		0.00	35	0	-	NM_032552		124536637	+1	tier1		no_errors	ENST00000408936	ensembl	human	known	74_37	frame_shift_ins	11.11	24	3	INS	1.000:0.988	C
DAGLA	747	genome.wustl.edu	37	11	61503792	61503792	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr11:61503792G>T	ENST00000257215.5	+	13	1457	c.1341G>T	c.(1339-1341)atG>atT	p.M447I		NM_006133.2	NP_006124.1	Q9Y4D2	DGLA_HUMAN	diacylglycerol lipase, alpha	447					arachidonic acid metabolic process (GO:0019369)|blood coagulation (GO:0007596)|cell death (GO:0008219)|diacylglycerol catabolic process (GO:0046340)|endocannabinoid signaling pathway (GO:0071926)|neuroblast proliferation (GO:0007405)|neurotransmitter biosynthetic process (GO:0042136)|platelet activation (GO:0030168)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|liver(2)|lung(17)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(4)	43				READ - Rectum adenocarcinoma(4;0.219)		AGCAGGAGATGGTCCTGTCCC	0.582																																																	0													119.0	104.0	109.0					11																	61503792		2202	4299	6501	SO:0001583	missense	0			AB014559	CCDS31578.1	11q12.3	2008-03-18	2007-02-28	2007-02-28		ENSG00000134780	3.1.1.-		1165	protein-coding gene	gene with protein product	"""neural stem cell-derived dendrite regulator"""	614015	"""chromosome 11 open reading frame 11"""	C11orf11		9734811	Standard	NM_006133		Approved	KIAA0659, NSDDR, DAGLALPHA	uc001nsa.3	Q9Y4D2		ENST00000257215.5:c.1341G>T	11.37:g.61503792G>T	ENSP00000257215:p.Met447Ile		A7E233|Q6WQJ0	Missense_Mutation	SNP	pfam_Lipase_3	p.M447I	ENST00000257215.5	37	c.1341	CCDS31578.1	11	.	.	.	.	.	.	.	.	.	.	G	19.17	3.776033	0.70107	.	.	ENSG00000134780	ENST00000257215	T	0.22945	1.93	3.71	3.71	0.42584	.	0.000000	0.85682	D	0.000000	T	0.28928	0.0718	N	0.08118	0	0.80722	D	1	P	0.49559	0.925	D	0.65140	0.932	T	0.30297	-0.9983	10	0.37606	T	0.19	-39.3142	16.0317	0.80582	0.0:0.0:1.0:0.0	.	447	Q9Y4D2	DGLA_HUMAN	I	447	ENSP00000257215:M447I	ENSP00000257215:M447I	M	+	3	0	DAGLA	61260368	1.000000	0.71417	1.000000	0.80357	0.867000	0.49689	8.886000	0.92447	2.076000	0.62316	0.462000	0.41574	ATG	DAGLA	-	pfam_Lipase_3	ENSG00000134780		0.582	DAGLA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DAGLA	HGNC	protein_coding	OTTHUMT00000398516.1		0.00	44	0	G	NM_006133		61503792	+1			no_errors	ENST00000257215	ensembl	human	known	74_37	missense	9.52	19	2	SNP	1.000	T
DBH	1621	genome.wustl.edu	37	9	136521726	136521726	+	Missense_Mutation	SNP	G	G	A	rs148439785	byFrequency	TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr9:136521726G>A	ENST00000393056.2	+	10	1528	c.1516G>A	c.(1516-1518)Gct>Act	p.A506T	DBH-AS1_ENST00000425189.1_RNA	NM_000787.3	NP_000778.3	P09172	DOPO_HUMAN	dopamine beta-hydroxylase (dopamine beta-monooxygenase)	506					behavioral response to ethanol (GO:0048149)|blood vessel remodeling (GO:0001974)|catecholamine biosynthetic process (GO:0042423)|cellular nitrogen compound metabolic process (GO:0034641)|cytokine production (GO:0001816)|dopamine catabolic process (GO:0042420)|fear response (GO:0042596)|glucose homeostasis (GO:0042593)|homoiothermy (GO:0042309)|leukocyte mediated immunity (GO:0002443)|leukocyte migration (GO:0050900)|locomotory behavior (GO:0007626)|maternal behavior (GO:0042711)|memory (GO:0007613)|norepinephrine biosynthetic process (GO:0042421)|positive regulation of vasoconstriction (GO:0045907)|regulation of cell proliferation (GO:0042127)|regulation of extrinsic apoptotic signaling pathway (GO:2001236)|response to amphetamine (GO:0001975)|response to pain (GO:0048265)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|visual learning (GO:0008542)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|secretory granule lumen (GO:0034774)	catalytic activity (GO:0003824)|copper ion binding (GO:0005507)|dopamine beta-monooxygenase activity (GO:0004500)|L-ascorbic acid binding (GO:0031418)			central_nervous_system(3)|endometrium(7)|kidney(2)|large_intestine(9)|liver(1)|lung(6)|ovary(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	36				OV - Ovarian serous cystadenocarcinoma(145;2.33e-07)|Epithelial(140;1.5e-06)|all cancers(34;1.66e-05)	Disulfiram(DB00822)|Dopamine(DB00988)|Propylthiouracil(DB00550)|Vitamin C(DB00126)	CTGCAAGAGCGCTGTGGACGC	0.612													G|||	4	0.000798722	0.0	0.0058	5008	,	,		17808	0.0		0.0	False		,,,				2504	0.0																0								G	THR/ALA	0,4406		0,0,2203	52.0	50.0	51.0		1516	-1.0	0.0	9	dbSNP_134	51	6,8594	5.0+/-18.6	0,6,4294	yes	missense	DBH	NM_000787.3	58	0,6,6497	AA,AG,GG		0.0698,0.0,0.0461	benign	506/618	136521726	6,13000	2203	4300	6503	SO:0001583	missense	0			X13256	CCDS6977.2	9q34	2013-06-03			ENSG00000123454	ENSG00000123454	1.14.17.1		2689	protein-coding gene	gene with protein product		609312					Standard	NM_000787		Approved	DBM	uc004cel.3	P09172	OTTHUMG00000020878	ENST00000393056.2:c.1516G>A	9.37:g.136521726G>A	ENSP00000376776:p.Ala506Thr		Q5T381|Q96AG2	Missense_Mutation	SNP	pfam_Cu2_ascorb_mOase_N,pfam_DOMON_domain,superfamily_PHM/PNGase_F_dom,smart_DOMON_domain,pfscan_DOMON_domain,prints_Dopamine_b_mOase	p.A506T	ENST00000393056.2	37	c.1516	CCDS6977.2	9	2	9.157509157509158E-4	0	0.0	2	0.0055248618784530384	0	0.0	0	0.0	G	9.520	1.108011	0.20714	0.0	6.98E-4	ENSG00000123454	ENST00000393056	T	0.77489	-1.1	4.63	-0.972	0.10300	PHM/PNGase F domain (1);Copper type II, ascorbate-dependent monooxygenase-like, C-terminal (1);	0.559070	0.20148	N	0.098235	T	0.48768	0.1518	L	0.35288	1.05	0.09310	N	1	B	0.22480	0.07	B	0.21708	0.036	T	0.27536	-1.0071	10	0.23891	T	0.37	-28.8823	0.8409	0.01149	0.2781:0.1168:0.3656:0.2395	.	506	P09172	DOPO_HUMAN	T	506	ENSP00000376776:A506T	ENSP00000376776:A506T	A	+	1	0	DBH	135511547	0.002000	0.14202	0.013000	0.15412	0.469000	0.32828	0.620000	0.24403	-0.177000	0.10690	0.491000	0.48974	GCT	DBH	-	superfamily_PHM/PNGase_F_dom	ENSG00000123454		0.612	DBH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DBH	HGNC	protein_coding	OTTHUMT00000054929.2		0.00	35	0	G	NM_000787		136521726	+1			no_errors	ENST00000393056	ensembl	human	known	74_37	missense	6.98	40	3	SNP	0.006	A
DCBLD2	131566	genome.wustl.edu	37	3	98520488	98520488	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr3:98520488T>C	ENST00000326840.6	-	14	2038	c.1676A>G	c.(1675-1677)aAa>aGa	p.K559R	DCBLD2_ENST00000326857.9_Missense_Mutation_p.K559R	NM_080927.3	NP_563615.3	Q96PD2	DCBD2_HUMAN	discoidin, CUB and LCCL domain containing 2	559					cell adhesion (GO:0007155)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of cell growth (GO:0030308)|wound healing (GO:0042060)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)				breast(1)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(3)|lung(7)|ovary(2)|prostate(1)|stomach(2)	25						TTCAGTTTTTTTCTTTCTGGA	0.463																																																	0													48.0	50.0	50.0					3																	98520488		1848	4086	5934	SO:0001583	missense	0				CCDS46878.1	3q12.2	2006-04-12			ENSG00000057019	ENSG00000057019			24627	protein-coding gene	gene with protein product		608698				11447234	Standard	NM_080927		Approved	CLCP1, ESDN	uc003dtd.3	Q96PD2	OTTHUMG00000151985	ENST00000326840.6:c.1676A>G	3.37:g.98520488T>C	ENSP00000321573:p.Lys559Arg		B7WNL1|D3DN41|Q8N6M4|Q8TDX2	Missense_Mutation	SNP	pfam_Coagulation_fac_5/8-C_type_dom,pfam_CUB_dom,pfam_LCCL,superfamily_Galactose-bd-like,superfamily_CUB_dom,superfamily_LCCL,smart_CUB_dom,smart_LCCL,smart_Coagulation_fac_5/8-C_type_dom,pfscan_CUB_dom,pfscan_Coagulation_fac_5/8-C_type_dom,pfscan_LCCL	p.K559R	ENST00000326840.6	37	c.1676	CCDS46878.1	3	.	.	.	.	.	.	.	.	.	.	T	16.42	3.119015	0.56505	.	.	ENSG00000057019	ENST00000326840;ENST00000326857	D;D	0.92348	-3.02;-2.92	5.41	5.41	0.78517	.	0.000000	0.85682	D	0.000000	D	0.94660	0.8278	M	0.61703	1.905	0.80722	D	1	B;D	0.69078	0.244;0.997	B;D	0.75020	0.091;0.985	D	0.93911	0.7197	10	0.38643	T	0.18	-25.7778	13.6816	0.62489	0.0:0.0:0.0:1.0	.	559;559	Q96PD2-2;Q96PD2	.;DCBD2_HUMAN	R	559	ENSP00000321573:K559R;ENSP00000321646:K559R	ENSP00000321573:K559R	K	-	2	0	DCBLD2	100003178	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.276000	0.65580	2.178000	0.69098	0.533000	0.62120	AAA	DCBLD2	-	NULL	ENSG00000057019		0.463	DCBLD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCBLD2	HGNC	protein_coding	OTTHUMT00000324675.2	-	0.00	50	0	T	NM_080927		98520488	-1	tier1	-	no_errors	ENST00000326857	ensembl	human	known	74_37	missense	13.79	25	4	SNP	1.000	C
DCLK1	9201	genome.wustl.edu	37	13	36410265	36410265	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr13:36410265T>G	ENST00000360631.3	-	8	1345	c.1134A>C	c.(1132-1134)gaA>gaC	p.E378D	DCLK1_ENST00000379893.1_Missense_Mutation_p.E71D|DCLK1_ENST00000255448.4_Missense_Mutation_p.E378D			O15075	DCLK1_HUMAN	doublecortin-like kinase 1	378					axon extension (GO:0048675)|central nervous system development (GO:0007417)|central nervous system projection neuron axonogenesis (GO:0021952)|dendrite morphogenesis (GO:0048813)|endosomal transport (GO:0016197)|forebrain development (GO:0030900)|nervous system development (GO:0007399)|neuron migration (GO:0001764)|protein phosphorylation (GO:0006468)|response to virus (GO:0009615)	integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein activity (GO:0005057)			breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(18)|lung(17)|ovary(2)|prostate(3)|skin(4)|stomach(6)|urinary_tract(1)	64		Breast(139;0.0147)|Lung SC(185;0.0685)|Prostate(109;0.122)	KIRC - Kidney renal clear cell carcinoma(5;0.119)|Kidney(79;0.169)	all cancers(112;1.72e-06)|Epithelial(112;4.24e-05)|BRCA - Breast invasive adenocarcinoma(63;0.00159)|OV - Ovarian serous cystadenocarcinoma(117;0.0158)|GBM - Glioblastoma multiforme(144;0.0638)		TCTGGAAGCCTTCCTCCGACA	0.358																																																	0													209.0	198.0	202.0					13																	36410265		2203	4300	6503	SO:0001583	missense	0			AB002367	CCDS9354.1, CCDS55895.1, CCDS73561.1	13q13.3	2008-02-05	2007-04-02	2007-04-02	ENSG00000133083	ENSG00000133083			2700	protein-coding gene	gene with protein product		604742	"""doublecortin and CaM kinase-like 1"""	DCAMKL1		9747029, 10036192	Standard	NM_004734		Approved	KIAA0369, DCLK, DCDC3A	uc001uvf.3	O15075	OTTHUMG00000016729	ENST00000360631.3:c.1134A>C	13.37:g.36410265T>G	ENSP00000353846:p.Glu378Asp		B7Z3E9|Q5VZY8|Q5VZZ0|Q5VZZ1	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Doublecortin_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Doublecortin_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Doublecortin_dom,pfscan_Prot_kinase_dom	p.E378D	ENST00000360631.3	37	c.1134		13	.	.	.	.	.	.	.	.	.	.	T	11.18	1.562159	0.27915	.	.	ENSG00000133083	ENST00000399319;ENST00000255448;ENST00000360631;ENST00000379893;ENST00000539451	T;T;T	0.68331	-0.3;-0.29;-0.32	6.04	4.87	0.63330	.	1.637160	0.03125	N	0.164404	T	0.58977	0.2160	L	0.27053	0.805	0.80722	D	1	B;B;B	0.13145	0.002;0.007;0.002	B;B;B	0.12837	0.005;0.008;0.007	T	0.08186	-1.0734	10	0.30078	T	0.28	.	10.9611	0.47385	0.0:0.0765:0.0:0.9235	.	71;378;71	O15075-4;O15075-2;O15075-3	.;.;.	D	70;378;378;71;378	ENSP00000255448:E378D;ENSP00000353846:E378D;ENSP00000369223:E71D	ENSP00000255448:E378D	E	-	3	2	DCLK1	35308265	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.947000	0.40293	1.098000	0.41479	0.460000	0.39030	GAA	DCLK1	-	superfamily_Kinase-like_dom	ENSG00000133083		0.358	DCLK1-010	KNOWN	basic	protein_coding	DCLK1	HGNC	protein_coding	OTTHUMT00000044487.1	-	0.00	52	0	T	NM_004734		36410265	-1	tier1	-	no_errors	ENST00000360631	ensembl	human	known	74_37	missense	45.45	12	10	SNP	1.000	G
DCLRE1C	64421	genome.wustl.edu	37	10	14951146	14951146	+	Missense_Mutation	SNP	G	G	A	rs80148779		TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr10:14951146G>A	ENST00000378278.2	-	14	1377	c.1340C>T	c.(1339-1341)aCa>aTa	p.T447I	DCLRE1C_ENST00000396817.2_Missense_Mutation_p.T327I|DCLRE1C_ENST00000378254.1_Missense_Mutation_p.T327I|DCLRE1C_ENST00000357717.2_Missense_Mutation_p.T332I|DCLRE1C_ENST00000378289.4_Intron|DCLRE1C_ENST00000492201.1_5'UTR|DCLRE1C_ENST00000378242.1_Missense_Mutation_p.T100I|DCLRE1C_ENST00000378258.1_Missense_Mutation_p.T327I|DCLRE1C_ENST00000378249.1_Missense_Mutation_p.T332I|DCLRE1C_ENST00000453695.2_Missense_Mutation_p.T327I|DCLRE1C_ENST00000378255.1_Missense_Mutation_p.T327I|DCLRE1C_ENST00000378246.2_Missense_Mutation_p.T332I			Q96SD1	DCR1C_HUMAN	DNA cross-link repair 1C	447					B cell differentiation (GO:0030183)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA recombination (GO:0006310)|double-strand break repair (GO:0006302)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|response to ionizing radiation (GO:0010212)|telomere maintenance (GO:0000723)	nucleus (GO:0005634)	5'-3' exonuclease activity (GO:0008409)|single-stranded DNA endodeoxyribonuclease activity (GO:0000014)			breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)	17						TACAAAGTTTGTGAAACGAGA	0.448								Non-homologous end-joining																																									0													105.0	99.0	101.0					10																	14951146		2203	4300	6503	SO:0001583	missense	0			BC022254	CCDS7105.1, CCDS31149.1, CCDS31150.1	10p13	2014-09-17	2010-06-24		ENSG00000152457	ENSG00000152457			17642	protein-coding gene	gene with protein product	"""PSO2 homolog (S. cerevisiae)"""	605988	"""severe combined immunodeficiency, type a (Athabascan)"", ""DNA cross-link repair 1C (PSO2 homolog, S. cerevisiae)"""	SCIDA		11336668, 9443881	Standard	XM_005252558		Approved	ARTEMIS, FLJ11360, SNM1C, A-SCID	uc001inn.3	Q96SD1	OTTHUMG00000017716	ENST00000378278.2:c.1340C>T	10.37:g.14951146G>A	ENSP00000367527:p.Thr447Ile		D3DRT6|Q1HCL2|Q5JSR4|Q5JSR5|Q5JSR7|Q5JSR8|Q5JSR9|Q5JSS0|Q5JSS7|Q6PK14|Q8N101|Q8N132|Q8TBW9|Q9BVW9|Q9HAM4	Missense_Mutation	SNP	pfam_DRMBL	p.T447I	ENST00000378278.2	37	c.1340	CCDS31149.1	10	.	.	.	.	.	.	.	.	.	.	G	3.600	-0.081723	0.07141	.	.	ENSG00000152457	ENST00000453695;ENST00000378246;ENST00000357717;ENST00000378249;ENST00000396817;ENST00000378255;ENST00000378254;ENST00000378278;ENST00000378258;ENST00000378242	T;T;T;T;T;T;T;T;T;T	0.23754	1.89;1.89;1.89;1.89;1.89;1.89;1.89;1.89;1.89;1.89	5.76	3.75	0.43078	.	1.236610	0.05046	N	0.477207	T	0.19565	0.0470	L	0.29908	0.895	0.09310	N	1	B;B	0.16396	0.017;0.001	B;B	0.13407	0.009;0.001	T	0.23261	-1.0193	10	0.22109	T	0.4	.	6.2377	0.20772	0.1026:0.0:0.5491:0.3484	.	332;447	Q96SD1-3;Q96SD1	.;DCR1C_HUMAN	I	327;332;332;332;327;327;327;447;327;100	ENSP00000400529:T327I;ENSP00000367492:T332I;ENSP00000350349:T332I;ENSP00000367496:T332I;ENSP00000380030:T327I;ENSP00000367503:T327I;ENSP00000367502:T327I;ENSP00000367527:T447I;ENSP00000367506:T327I;ENSP00000367488:T100I	ENSP00000350349:T332I	T	-	2	0	DCLRE1C	14991152	0.005000	0.15991	0.052000	0.19188	0.284000	0.27059	1.651000	0.37302	1.355000	0.45865	0.655000	0.94253	ACA	DCLRE1C	-	NULL	ENSG00000152457		0.448	DCLRE1C-009	KNOWN	basic|appris_principal|CCDS	protein_coding	DCLRE1C	HGNC	protein_coding	OTTHUMT00000046934.1	-	0.00	40	0	G	NM_022487		14951146	-1	tier1	-	no_errors	ENST00000378278	ensembl	human	known	74_37	missense	15.00	17	3	SNP	0.011	A
DERA	51071	genome.wustl.edu	37	12	16111249	16111249	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr12:16111249C>G	ENST00000428559.2	+	3	469	c.257C>G	c.(256-258)gCt>gGt	p.A86G	DERA_ENST00000526530.1_5'UTR|DERA_ENST00000532964.1_Missense_Mutation_p.A86G	NM_015954.2	NP_057038.2	Q9Y315	DEOC_HUMAN	deoxyribose-phosphate aldolase (putative)	86					deoxyribonucleoside catabolic process (GO:0046121)|deoxyribonucleotide catabolic process (GO:0009264)|deoxyribose phosphate catabolic process (GO:0046386)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	deoxyribose-phosphate aldolase activity (GO:0004139)			endometrium(1)|large_intestine(2)|lung(3)|skin(1)	7		Hepatocellular(102;0.121)				CTCTTAAAAGCTTTAAATATG	0.338																																																	0													65.0	64.0	64.0					12																	16111249		1862	4095	5957	SO:0001583	missense	0			AF132960	CCDS44838.1, CCDS73451.1	12p12.3	2010-06-24	2010-06-24		ENSG00000023697	ENSG00000023697	4.1.2.4		24269	protein-coding gene	gene with protein product			"""2-deoxyribose-5-phosphate aldolase homolog (C. elegans)"""			12546782	Standard	XM_006719083		Approved	CGI-26, DEOC	uc001rde.3	Q9Y315	OTTHUMG00000165537	ENST00000428559.2:c.257C>G	12.37:g.16111249C>G	ENSP00000416583:p.Ala86Gly		Q53HN9|Q6PHW2	Missense_Mutation	SNP	pfam_DeoC/FbaB/lacD_aldolase,pirsf_DeoC,tigrfam_DeoC	p.A86G	ENST00000428559.2	37	c.257	CCDS44838.1	12	.	.	.	.	.	.	.	.	.	.	C	13.01	2.110694	0.37242	.	.	ENSG00000023697	ENST00000428559;ENST00000531803;ENST00000532964	.	.	.	5.06	5.06	0.68205	Aldolase-type TIM barrel (1);	0.427868	0.27159	N	0.020649	T	0.49423	0.1556	L	0.54323	1.7	0.80722	D	1	P	0.39352	0.669	B	0.31946	0.138	T	0.53989	-0.8360	9	0.44086	T	0.13	-9.4026	13.586	0.61931	0.1551:0.8449:0.0:0.0	.	86	Q9Y315	DEOC_HUMAN	G	86;107;86	.	ENSP00000416583:A86G	A	+	2	0	DERA	16002516	1.000000	0.71417	0.998000	0.56505	0.998000	0.95712	1.282000	0.33226	2.622000	0.88805	0.650000	0.86243	GCT	DERA	-	pfam_DeoC/FbaB/lacD_aldolase,pirsf_DeoC,tigrfam_DeoC	ENSG00000023697		0.338	DERA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DERA	HGNC	protein_coding	OTTHUMT00000384731.1	-	0.00	60	0	C	NM_015954		16111249	+1	tier1	-	no_errors	ENST00000428559	ensembl	human	known	74_37	missense	28.57	35	14	SNP	0.918	G
DHRS4	10901	genome.wustl.edu	37	14	24422949	24422949	+	5'UTR	SNP	C	C	G			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr14:24422949C>G	ENST00000313250.5	+	0	155				DHRS4-AS1_ENST00000556379.1_RNA|DHRS4_ENST00000543741.2_5'Flank|DHRS4_ENST00000397073.2_5'Flank|DHRS4_ENST00000558581.1_5'Flank|DHRS4_ENST00000382761.3_5'Flank|DHRS4_ENST00000558263.1_5'UTR|DHRS4_ENST00000421831.1_5'Flank|DHRS4_ENST00000559632.1_5'Flank|DHRS4_ENST00000397075.3_5'Flank|DHRS4_ENST00000308178.8_5'Flank|DHRS4_ENST00000397074.3_5'Flank	NM_021004.2	NP_066284.2	Q9BTZ2	DHRS4_HUMAN	dehydrogenase/reductase (SDR family) member 4						alcohol metabolic process (GO:0006066)|cellular ketone metabolic process (GO:0042180)|oxidation-reduction process (GO:0055114)|protein tetramerization (GO:0051262)|steroid metabolic process (GO:0008202)	extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	3-keto sterol reductase activity (GO:0000253)|alcohol dehydrogenase [NAD(P)+] activity (GO:0018455)|carbonyl reductase (NADPH) activity (GO:0004090)|oxidoreductase activity, acting on NAD(P)H, quinone or similar compound as acceptor (GO:0016655)|receptor binding (GO:0005102)			central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(1)|lung(4)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	14				GBM - Glioblastoma multiforme(265;0.00962)	Vitamin A(DB00162)	TCGCCCTACTCTGTCACCGCC	0.682																																																	0													31.0	36.0	34.0					14																	24422949		2203	4300	6503	SO:0001623	5_prime_UTR_variant	0			AF044127	CCDS9605.1, CCDS61408.1, CCDS61409.1, CCDS61410.1, CCDS61411.1, CCDS61412.1	14q11.2	2013-06-14			ENSG00000157326	ENSG00000157326	1.1.1.184	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 1"""	16985	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 25C, member 2"""	611596				10333503, 19027726	Standard	NM_021004		Approved	SCAD-SRL, SDR-SRL, humNRDR, FLJ11008, SDR25C2	uc001wla.3	Q9BTZ2	OTTHUMG00000028777	ENST00000313250.5:c.-49C>G	14.37:g.24422949C>G			B2RB10|B7WNS9|D3YTB8|E2QRL8|O95162|Q20CR0|Q2LC19|Q2LE81|Q58IU4|Q6E0Y1|Q6UWU3|Q71UQ6|Q8TD03|Q9H3N5|Q9NV08	RNA	SNP	-	NULL	ENST00000313250.5	37	NULL	CCDS9605.1	14																																																																																			DHRS4-AS1	-	-	ENSG00000215256		0.682	DHRS4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	DHRS4-AS1	HGNC	protein_coding	OTTHUMT00000071857.3	-	0.00	51	0	C			24422949	-1	tier1	-	no_errors	ENST00000553454	ensembl	human	putative	74_37	rna	8.33	44	4	SNP	0.000	G
DICER1	23405	genome.wustl.edu	37	14	95569780	95569780	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr14:95569780A>C	ENST00000526495.1	-	23	4244	c.3953T>G	c.(3952-3954)cTt>cGt	p.L1318R	DICER1_ENST00000556045.1_Missense_Mutation_p.L216R|DICER1_ENST00000393063.1_Missense_Mutation_p.L1318R|DICER1_ENST00000541352.1_Missense_Mutation_p.L1318R|DICER1_ENST00000343455.3_Missense_Mutation_p.L1318R|DICER1_ENST00000527414.1_Missense_Mutation_p.L1318R			Q9UPY3	DICER_HUMAN	dicer 1, ribonuclease type III	1318	RNase III 1. {ECO:0000255|PROSITE- ProRule:PRU00177}.				angiogenesis (GO:0001525)|branching morphogenesis of an epithelial tube (GO:0048754)|cardiac muscle cell development (GO:0055013)|cerebral cortex development (GO:0021987)|defense response to virus (GO:0051607)|embryonic hindlimb morphogenesis (GO:0035116)|gene expression (GO:0010467)|hair follicle cell proliferation (GO:0071335)|hair follicle morphogenesis (GO:0031069)|inner ear receptor cell development (GO:0060119)|intestinal epithelial cell development (GO:0060576)|lung development (GO:0030324)|mRNA stabilization (GO:0048255)|multicellular organism growth (GO:0035264)|negative regulation of Schwann cell proliferation (GO:0010626)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nerve development (GO:0021675)|neuron projection morphogenesis (GO:0048812)|olfactory bulb interneuron differentiation (GO:0021889)|peripheral nervous system myelin formation (GO:0032290)|positive regulation of gene expression (GO:0010628)|positive regulation of miRNA metabolic process (GO:2000630)|positive regulation of myelination (GO:0031643)|positive regulation of Schwann cell differentiation (GO:0014040)|post-embryonic development (GO:0009791)|pre-miRNA processing (GO:0031054)|production of miRNAs involved in gene silencing by miRNA (GO:0035196)|production of siRNA involved in RNA interference (GO:0030422)|regulation of cell cycle (GO:0051726)|regulation of enamel mineralization (GO:0070173)|regulation of neuron differentiation (GO:0045664)|regulation of oligodendrocyte differentiation (GO:0048713)|regulation of viral genome replication (GO:0045069)|reproductive structure development (GO:0048608)|RNA phosphodiester bond hydrolysis (GO:0090501)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|spinal cord motor neuron differentiation (GO:0021522)|spindle assembly (GO:0051225)|spleen development (GO:0048536)|stem cell maintenance (GO:0019827)|targeting of mRNA for destruction involved in RNA interference (GO:0030423)|zygote asymmetric cell division (GO:0010070)	axon (GO:0030424)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|growth cone (GO:0030426)|RISC complex (GO:0016442)	ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|miRNA binding (GO:0035198)|ribonuclease III activity (GO:0004525)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(1)|central_nervous_system(1)|endometrium(13)|kidney(3)|large_intestine(10)|lung(33)|ovary(1)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(3)	75		all_cancers(154;0.0621)|all_epithelial(191;0.223)		Epithelial(152;0.211)|COAD - Colon adenocarcinoma(157;0.215)		GGAGTCGCCAAGCATTTCAAG	0.458			"""Mis F, N"""		"""sex cord-stromal tumour, TGCT, embryonal rhadomyosarcoma"""	pleuropulmonary blastoma			Familial Multinodular Goiter ;DICER 1 syndrome																														yes	Rec	yes	Familial Pleuropulmonary Blastoma	14	14q32.13	23405	"""dicer 1, ribonuclease type III """		"""E, M, O"""	0													59.0	63.0	62.0					14																	95569780		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Adolescent Multinodular Goiter, incl. Multinodular Euthyroid Goiter & Non-Medullary Thyroid Cancer;incl. Pleuropulmonary Blastoma, Familial ; Cystic Nephroma, Familial	AB028449	CCDS9931.1, CCDS55941.1	14q32.13	2014-09-17	2008-02-20		ENSG00000100697	ENSG00000100697			17098	protein-coding gene	gene with protein product	"""dicer 1, double-stranded RNA-specific endoribonuclease"""	606241	"""Dicer1, Dcr-1 homolog (Drosophila)"", ""multinodular goitre 1"""	MNG1		10051563, 10786632, 21205968	Standard	NM_177438		Approved	Dicer, KIAA0928, K12H4.8-LIKE, HERNA	uc001ydw.2	Q9UPY3	OTTHUMG00000166134	ENST00000526495.1:c.3953T>G	14.37:g.95569780A>C	ENSP00000437256:p.Leu1318Arg		A7E2D3|B3KRG4|E0AD28|O95943|Q9UQ02	Missense_Mutation	SNP	pfam_RNase_III_dom,pfam_PAZ_dom,pfam_Dicer_dimerisation_dom,pfam_Helicase_C,pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase/UvrB_dom,superfamily_RNase_III_dom,superfamily_P-loop_NTPase,superfamily_PAZ_dom,smart_Helicase_ATP-bd,smart_Helicase_C,smart_PAZ_dom,smart_RNase_III_dom,smart_dsRNA-bd_dom,pfscan_PAZ_dom,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_dsRNA-bd_dom,pfscan_RNase_III_dom	p.L1318R	ENST00000526495.1	37	c.3953	CCDS9931.1	14	.	.	.	.	.	.	.	.	.	.	A	23.0	4.362739	0.82353	.	.	ENSG00000100697	ENST00000343455;ENST00000526495;ENST00000393063;ENST00000527414;ENST00000556045;ENST00000541352	D;D;D;D;D;D	0.85484	-1.99;-1.99;-1.99;-1.99;-1.99;-1.99	5.33	5.33	0.75918	Ribonuclease III (5);	0.000000	0.85682	D	0.000000	D	0.94703	0.8291	H	0.96175	3.78	0.80722	D	1	D;P;P	0.76494	0.999;0.956;0.952	D;D;P	0.75020	0.985;0.932;0.905	D	0.96317	0.9233	10	0.87932	D	0	-17.0038	15.2834	0.73806	1.0:0.0:0.0:0.0	.	216;1318;1318	B3KRG4;E0AD28;Q9UPY3	.;.;DICER_HUMAN	R	1318;1318;1318;1318;216;1318	ENSP00000343745:L1318R;ENSP00000437256:L1318R;ENSP00000376783:L1318R;ENSP00000435681:L1318R;ENSP00000451041:L216R;ENSP00000444719:L1318R	ENSP00000343745:L1318R	L	-	2	0	DICER1	94639533	1.000000	0.71417	0.988000	0.46212	0.993000	0.82548	9.300000	0.96151	2.018000	0.59344	0.402000	0.26972	CTT	DICER1	-	pfam_RNase_III_dom,superfamily_RNase_III_dom,smart_RNase_III_dom,pfscan_RNase_III_dom	ENSG00000100697		0.458	DICER1-004	KNOWN	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	DICER1	HGNC	protein_coding	OTTHUMT00000387997.1		0.00	38	0	A			95569780	-1			no_errors	ENST00000343455	ensembl	human	known	74_37	missense	11.54	23	3	SNP	1.000	C
DIXDC1	85458	genome.wustl.edu	37	11	111853111	111853111	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr11:111853111G>A	ENST00000440460.2	+	8	1112	c.815G>A	c.(814-816)gGa>gAa	p.G272E	DIXDC1_ENST00000315253.5_Missense_Mutation_p.G61E|DIXDC1_ENST00000389821.4_3'UTR	NM_001037954.2	NP_001033043.1	Q155Q3	DIXC1_HUMAN	DIX domain containing 1	273	Actin-binding.				camera-type eye development (GO:0043010)|cell cycle (GO:0007049)|cerebellar cortex development (GO:0021695)|cerebral cortex radially oriented cell migration (GO:0021799)|forebrain development (GO:0030900)|forebrain ventricular zone progenitor cell division (GO:0021869)|negative regulation of neuron differentiation (GO:0045665)|positive regulation of axonogenesis (GO:0050772)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of JNK cascade (GO:0046330)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of JNK cascade (GO:0046328)|regulation of microtubule cytoskeleton organization (GO:0070507)|Wnt signaling pathway (GO:0016055)	axon terminus (GO:0043679)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cytosol (GO:0005829)|neuronal cell body (GO:0043025)|protein complex (GO:0043234)	gamma-tubulin binding (GO:0043015)|mitogen-activated protein kinase kinase kinase binding (GO:0031435)			cervix(2)|endometrium(4)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)	17		all_cancers(61;7.58e-15)|all_epithelial(67;5.42e-09)|Melanoma(852;1.91e-06)|all_hematologic(158;0.000405)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0112)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		Epithelial(105;2.99e-07)|BRCA - Breast invasive adenocarcinoma(274;6.72e-07)|all cancers(92;6.25e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.0548)		AGGGAGCCTGGAACCTATCTG	0.418											OREG0021331	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													46.0	48.0	48.0					11																	111853111		1832	4085	5917	SO:0001583	missense	0			AB051522	CCDS60957.1, CCDS73381.1, CCDS73382.1	11q23.1	2014-03-20			ENSG00000150764	ENSG00000150764			23695	protein-coding gene	gene with protein product		610493				12792787	Standard	NM_001037954		Approved	KIAA1735, Dixin	uc001pmm.3	Q155Q3	OTTHUMG00000166912	ENST00000440460.2:c.815G>A	11.37:g.111853111G>A	ENSP00000394352:p.Gly272Glu	1438	A1A5D8|E9PRV4|Q6P2J8|Q6PIK4|Q86SR7|Q8IVY4|Q96N69|Q9C0C8	Missense_Mutation	SNP	pfam_DIX,pfam_CH-domain,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,smart_DIX,pfscan_CH-domain,pfscan_DIX	p.G272E	ENST00000440460.2	37	c.815		11	.	.	.	.	.	.	.	.	.	.	G	11.99	1.802277	0.31869	.	.	ENSG00000150764	ENST00000440460;ENST00000315253	T;T	0.70164	-0.46;0.92	6.17	4.26	0.50523	.	0.366721	0.29707	N	0.011420	T	0.48447	0.1500	N	0.19112	0.55	0.09310	N	0.999999	B;P	0.35656	0.236;0.514	B;B	0.32533	0.147;0.142	T	0.35076	-0.9803	10	0.36615	T	0.2	-0.986	10.9357	0.47243	0.0:0.2652:0.5973:0.1375	.	61;273	E7EQ17;Q155Q3	.;DIXC1_HUMAN	E	272;61	ENSP00000394352:G272E;ENSP00000314068:G61E	ENSP00000314068:G61E	G	+	2	0	DIXDC1	111358321	0.943000	0.32029	0.010000	0.14722	0.984000	0.73092	2.414000	0.44627	0.885000	0.36088	0.655000	0.94253	GGA	DIXDC1	-	NULL	ENSG00000150764		0.418	DIXDC1-202	KNOWN	basic|appris_principal	protein_coding	DIXDC1	HGNC	protein_coding		-	0.00	71	0	G	NM_001037954		111853111	+1	tier1	-	no_errors	ENST00000440460	ensembl	human	known	74_37	missense	14.89	40	7	SNP	0.021	A
DNAH10	196385	genome.wustl.edu	37	12	124337784	124337784	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr12:124337784A>C	ENST00000409039.3	+	35	5994	c.5969A>C	c.(5968-5970)aAg>aCg	p.K1990T		NM_207437.3	NP_997320.2	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	1990	AAA 1. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		GTTCTGTATAAGCTGGCCCGG	0.428																																																	0													45.0	45.0	45.0					12																	124337784		1904	4105	6009	SO:0001583	missense	0			AJ132089	CCDS9255.2	12q24	2008-02-05	2006-09-04		ENSG00000197653	ENSG00000197653		"""Axonemal dyneins"""	2941	protein-coding gene	gene with protein product		605884	"""dynein, axonemal, heavy polypeptide 10"""				Standard	NM_207437		Approved	FLJ43808	uc001uft.4	Q8IVF4	OTTHUMG00000154477	ENST00000409039.3:c.5969A>C	12.37:g.124337784A>C	ENSP00000386770:p.Lys1990Thr		C9JMF5|O95495|Q6ZUC9|Q6ZUP6|Q8N761	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,pfam_Dynein_heavy_dom-1,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,superfamily_PyrdxlP-dep_Trfase,smart_AAA+_ATPase	p.K1990T	ENST00000409039.3	37	c.5969	CCDS9255.2	12	.	.	.	.	.	.	.	.	.	.	A	19.36	3.812948	0.70912	.	.	ENSG00000197653	ENST00000409039	T	0.40225	1.04	5.7	5.7	0.88788	.	0.064020	0.64402	U	0.000011	T	0.48484	0.1502	L	0.42245	1.32	0.51012	D	0.9999	P	0.51240	0.943	P	0.53722	0.733	T	0.31138	-0.9954	10	0.23891	T	0.37	.	15.9745	0.80049	1.0:0.0:0.0:0.0	.	1990	Q8IVF4	DYH10_HUMAN	T	1990	ENSP00000386770:K1990T	ENSP00000386770:K1990T	K	+	2	0	DNAH10	122903737	1.000000	0.71417	0.971000	0.41717	0.889000	0.51656	7.516000	0.81772	2.168000	0.68352	0.533000	0.62120	AAG	DNAH10	-	superfamily_P-loop_NTPase	ENSG00000197653		0.428	DNAH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH10	HGNC	protein_coding	OTTHUMT00000335420.3		0.00	64	0	A			124337784	+1			no_errors	ENST00000409039	ensembl	human	known	74_37	missense	7.50	37	3	SNP	1.000	C
DNAH10	196385	genome.wustl.edu	37	12	124413856	124413856	+	Missense_Mutation	SNP	A	A	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr12:124413856A>T	ENST00000409039.3	+	70	12012	c.11987A>T	c.(11986-11988)aAc>aTc	p.N3996I	DNAH10OS_ENST00000514254.2_3'UTR|CCDC92_ENST00000544798.1_Intron	NM_207437.3	NP_997320.2	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	3996	AAA 6. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		CTGAAACTCAACATGAGGGCA	0.537																																																	0													35.0	35.0	35.0					12																	124413856		2042	4190	6232	SO:0001583	missense	0			AJ132089	CCDS9255.2	12q24	2008-02-05	2006-09-04		ENSG00000197653	ENSG00000197653		"""Axonemal dyneins"""	2941	protein-coding gene	gene with protein product		605884	"""dynein, axonemal, heavy polypeptide 10"""				Standard	NM_207437		Approved	FLJ43808	uc001uft.4	Q8IVF4	OTTHUMG00000154477	ENST00000409039.3:c.11987A>T	12.37:g.124413856A>T	ENSP00000386770:p.Asn3996Ile		C9JMF5|O95495|Q6ZUC9|Q6ZUP6|Q8N761	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,pfam_Dynein_heavy_dom-1,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,superfamily_PyrdxlP-dep_Trfase,smart_AAA+_ATPase	p.N3996I	ENST00000409039.3	37	c.11987	CCDS9255.2	12	.	.	.	.	.	.	.	.	.	.	A	27.4	4.826390	0.90955	.	.	ENSG00000197653	ENST00000409039	T	0.15718	2.4	5.16	5.16	0.70880	Dynein heavy chain (1);	0.000000	0.85682	D	0.000000	T	0.61937	0.2387	H	0.99286	4.5	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.79771	-0.1663	10	0.87932	D	0	.	15.2906	0.73862	1.0:0.0:0.0:0.0	.	3996	Q8IVF4	DYH10_HUMAN	I	3996	ENSP00000386770:N3996I	ENSP00000386770:N3996I	N	+	2	0	DNAH10	122979809	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	9.287000	0.95975	2.079000	0.62486	0.482000	0.46254	AAC	DNAH10	-	pfam_Dynein_heavy_dom	ENSG00000197653		0.537	DNAH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH10	HGNC	protein_coding	OTTHUMT00000335420.3	-	0.00	29	0	A			124413856	+1	tier1	-	no_errors	ENST00000409039	ensembl	human	known	74_37	missense	45.45	6	5	SNP	1.000	T
DNAH2	146754	genome.wustl.edu	37	17	7690293	7690293	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr17:7690293T>C	ENST00000572933.1	+	42	8005	c.6545T>C	c.(6544-6546)aTg>aCg	p.M2182T	DNAH2_ENST00000389173.2_Missense_Mutation_p.M2182T			Q9P225	DYH2_HUMAN	dynein, axonemal, heavy chain 2	2182	AAA 2. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(3)|breast(11)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(53)|liver(2)|lung(49)|ovary(7)|prostate(7)|skin(15)|upper_aerodigestive_tract(1)|urinary_tract(1)	189		all_cancers(10;4.66e-07)|Prostate(122;0.081)				AACTCCGTCATGGACGATAAC	0.587																																																	0													94.0	63.0	73.0					17																	7690293		2203	4300	6503	SO:0001583	missense	0			U83570, AK128517	CCDS32551.1	17p13.1	2007-10-05	2006-09-04			ENSG00000183914		"""Axonemal dyneins"""	2948	protein-coding gene	gene with protein product		603333	"""dynein, axonemal, heavy polypeptide 2"", ""dynein heavy chain domain 3"""	DNHD3		9256245	Standard	XM_005256470		Approved	KIAA1503, FLJ46675	uc002giu.1	Q9P225		ENST00000572933.1:c.6545T>C	17.37:g.7690293T>C	ENSP00000458355:p.Met2182Thr		A8K992|B5MDX5|O15434|Q6PIH3|Q6ZR42	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,pfam_Dynein_heavy_dom-1,pfam_ATPase_dyneun-rel_AAA,pfam_ATPase_AAA_core,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.M2182T	ENST00000572933.1	37	c.6545	CCDS32551.1	17	.	.	.	.	.	.	.	.	.	.	T	24.1	4.499311	0.85069	.	.	ENSG00000183914	ENST00000360606;ENST00000389173	D	0.87334	-2.24	5.16	5.16	0.70880	ATPase, dynein-related, AAA domain (1);	0.000000	0.85682	D	0.000000	D	0.95357	0.8493	H	0.96111	3.77	0.80722	D	1	D	0.71674	0.998	D	0.72625	0.978	D	0.96642	0.9475	10	0.87932	D	0	.	14.1147	0.65146	0.0:0.0:0.0:1.0	.	2182	Q9P225	DYH2_HUMAN	T	2182	ENSP00000373825:M2182T	ENSP00000353818:M2182T	M	+	2	0	DNAH2	7631018	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	7.725000	0.84808	2.159000	0.67721	0.528000	0.53228	ATG	DNAH2	-	pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase	ENSG00000183914		0.587	DNAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH2	HGNC	protein_coding	OTTHUMT00000440241.1	-	0.00	29	0	T	NM_020877		7690293	+1	tier1	-	no_errors	ENST00000389173	ensembl	human	known	74_37	missense	36.84	12	7	SNP	1.000	C
DNAH3	55567	genome.wustl.edu	37	16	20952734	20952734	+	Silent	SNP	G	G	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr16:20952734G>T	ENST00000261383.3	-	59	11642	c.11643C>A	c.(11641-11643)atC>atA	p.I3881I	DNAH3_ENST00000415178.1_3'UTR	NM_017539.1	NP_060009.1	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	3881					cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			NS(3)|autonomic_ganglia(1)|breast(12)|central_nervous_system(3)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(42)|liver(2)|lung(57)|ovary(14)|pancreas(1)|prostate(7)|skin(11)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(6)	202				GBM - Glioblastoma multiforme(48;0.207)		TGTTGAATCTGATGAGCTCCT	0.498																																																	0													347.0	336.0	340.0					16																	20952734		2201	4300	6501	SO:0001819	synonymous_variant	0			U83574	CCDS10594.1	16p12.2	2008-08-01	2006-09-04		ENSG00000158486	ENSG00000158486		"""Axonemal dyneins"""	2949	protein-coding gene	gene with protein product		603334	"""dynein, axonemal, heavy polypeptide 3"""			9256245, 9373155	Standard	NM_017539		Approved	Dnahc3b, DLP3, Hsadhc3, DKFZp434N074	uc010vbe.2	Q8TD57	OTTHUMG00000090677	ENST00000261383.3:c.11643C>A	16.37:g.20952734G>T			O00437|O15437|O43326|Q3C0H2|Q8WUP9|Q9UEM3|Q9UEM5|Q9UG35	Silent	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,superfamily_Prefoldin,smart_AAA+_ATPase	p.I3881	ENST00000261383.3	37	c.11643	CCDS10594.1	16																																																																																			DNAH3	-	pfam_Dynein_heavy_dom	ENSG00000158486		0.498	DNAH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH3	HGNC	protein_coding	OTTHUMT00000207361.1	-	0.00	40	0	G	NM_017539		20952734	-1	tier1	-	no_errors	ENST00000261383	ensembl	human	known	74_37	silent	10.53	34	4	SNP	1.000	T
DNAH3	55567	genome.wustl.edu	37	16	21145766	21145766	+	Missense_Mutation	SNP	A	A	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr16:21145766A>T	ENST00000261383.3	-	7	895	c.896T>A	c.(895-897)aTc>aAc	p.I299N	DNAH3_ENST00000415178.1_Missense_Mutation_p.I299N	NM_017539.1	NP_060009.1	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	299	Stem. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			NS(3)|autonomic_ganglia(1)|breast(12)|central_nervous_system(3)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(42)|liver(2)|lung(57)|ovary(14)|pancreas(1)|prostate(7)|skin(11)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(6)	202				GBM - Glioblastoma multiforme(48;0.207)		GTCCATGAGGATGTAATCAAC	0.458																																																	0													64.0	61.0	62.0					16																	21145766		2201	4300	6501	SO:0001583	missense	0			U83574	CCDS10594.1	16p12.2	2008-08-01	2006-09-04		ENSG00000158486	ENSG00000158486		"""Axonemal dyneins"""	2949	protein-coding gene	gene with protein product		603334	"""dynein, axonemal, heavy polypeptide 3"""			9256245, 9373155	Standard	NM_017539		Approved	Dnahc3b, DLP3, Hsadhc3, DKFZp434N074	uc010vbe.2	Q8TD57	OTTHUMG00000090677	ENST00000261383.3:c.896T>A	16.37:g.21145766A>T	ENSP00000261383:p.Ile299Asn		O00437|O15437|O43326|Q3C0H2|Q8WUP9|Q9UEM3|Q9UEM5|Q9UG35	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,superfamily_Prefoldin,smart_AAA+_ATPase	p.I299N	ENST00000261383.3	37	c.896	CCDS10594.1	16	.	.	.	.	.	.	.	.	.	.	A	21.4	4.147050	0.77888	.	.	ENSG00000158486	ENST00000261383;ENST00000415178;ENST00000396036	T;T	0.28895	1.59;1.69	5.85	5.85	0.93711	.	0.140764	0.47852	D	0.000205	T	0.54498	0.1862	M	0.65975	2.015	0.58432	D	0.999998	D;D	0.89917	0.991;1.0	P;D	0.83275	0.861;0.996	T	0.55573	-0.8120	10	0.56958	D	0.05	.	15.2181	0.73285	1.0:0.0:0.0:0.0	.	299;270	Q8TD57;Q8TD57-2	DYH3_HUMAN;.	N	299;299;270	ENSP00000261383:I299N;ENSP00000394245:I299N	ENSP00000261383:I299N	I	-	2	0	DNAH3	21053267	1.000000	0.71417	1.000000	0.80357	0.781000	0.44180	6.967000	0.76079	2.238000	0.73509	0.533000	0.62120	ATC	DNAH3	-	NULL	ENSG00000158486		0.458	DNAH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH3	HGNC	protein_coding	OTTHUMT00000207361.1		0.00	25	0	A	NM_017539		21145766	-1			no_errors	ENST00000261383	ensembl	human	known	74_37	missense	15.79	16	3	SNP	1.000	T
DNAH8	1769	genome.wustl.edu	37	6	38917247	38917247	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr6:38917247G>T	ENST00000359357.3	+	79	11752	c.11498G>T	c.(11497-11499)gGg>gTg	p.G3833V	RP1-207H1.3_ENST00000416948.1_RNA|DNAH8_ENST00000441566.1_Missense_Mutation_p.G3797V|DNAH8_ENST00000449981.2_Missense_Mutation_p.G4050V			Q96JB1	DYH8_HUMAN	dynein, axonemal, heavy chain 8	3833					cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(7)|breast(9)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(16)|large_intestine(44)|liver(4)|lung(101)|ovary(7)|pancreas(2)|prostate(8)|skin(28)|stomach(4)|upper_aerodigestive_tract(6)|urinary_tract(4)	260						AATGAGAAGGGGTGGAAAAGC	0.373																																																	0													150.0	173.0	165.0					6																	38917247		2203	4300	6503	SO:0001583	missense	0			Z83806	CCDS75447.1	6p21.2	2012-04-19	2006-09-04		ENSG00000124721	ENSG00000124721		"""Axonemal dyneins"""	2952	protein-coding gene	gene with protein product		603337	"""dynein, axonemal, heavy polypeptide 8"""			9373155	Standard	NM_001206927		Approved	hdhc9	uc021yzh.1	Q96JB1	OTTHUMG00000016253	ENST00000359357.3:c.11498G>T	6.37:g.38917247G>T	ENSP00000352312:p.Gly3833Val		O00438|Q5JYI2|Q5T2M3|Q5T2M4|Q5TG00|Q9UEM4	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.G3833V	ENST00000359357.3	37	c.11498		6	.	.	.	.	.	.	.	.	.	.	G	13.07	2.127468	0.37533	.	.	ENSG00000124721	ENST00000449981;ENST00000327475;ENST00000359357;ENST00000441566	T;T;T	0.08282	3.11;3.11;3.11	5.5	5.5	0.81552	Dynein heavy chain (1);	0.269412	0.36444	N	0.002588	T	0.03695	0.0105	L	0.33710	1.025	0.58432	D	0.999993	B;B	0.32467	0.321;0.372	B;B	0.36030	0.138;0.216	T	0.45687	-0.9244	10	0.31617	T	0.26	.	11.4039	0.49885	0.0:0.1351:0.7249:0.14	.	3797;3833	Q96JB1-2;Q96JB1	.;DYH8_HUMAN	V	4038;4038;3833;3797	ENSP00000333363:G4038V;ENSP00000352312:G3833V;ENSP00000402294:G3797V	ENSP00000333363:G4038V	G	+	2	0	DNAH8	39025225	0.163000	0.22920	1.000000	0.80357	0.997000	0.91878	0.590000	0.23954	2.602000	0.87976	0.591000	0.81541	GGG	DNAH8	-	pfam_Dynein_heavy_dom	ENSG00000124721		0.373	DNAH8-001	KNOWN	basic|appris_principal	protein_coding	DNAH8	HGNC	protein_coding	OTTHUMT00000043574.1	-	0.00	54	0	G	NM_001206927		38917247	+1	tier1	-	no_errors	ENST00000359357	ensembl	human	known	74_37	missense	19.57	36	9	SNP	0.958	T
DNAJC17	55192	genome.wustl.edu	37	15	41068808	41068808	+	Missense_Mutation	SNP	G	G	C	rs148595451		TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr15:41068808G>C	ENST00000220496.4	-	5	343	c.313C>G	c.(313-315)Cgg>Ggg	p.R105G		NM_018163.2	NP_060633.1	Q9NVM6	DJC17_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 17	105					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)		nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			endometrium(1)|kidney(1)|large_intestine(2)|pancreas(1)|skin(1)	6		all_cancers(109;4.16e-14)|all_epithelial(112;9.68e-12)|Lung NSC(122;3.19e-09)|all_lung(180;6.45e-08)|Melanoma(134;0.091)|Colorectal(260;0.175)|Ovarian(310;0.243)		GBM - Glioblastoma multiforme(113;2.91e-05)|COAD - Colon adenocarcinoma(120;0.153)|BRCA - Breast invasive adenocarcinoma(123;0.166)		TGGGCCTGCCGCTCCCGGGCC	0.632																																																	0													85.0	84.0	84.0					15																	41068808		2203	4300	6503	SO:0001583	missense	0			AK001496	CCDS10065.1	15q15.1	2014-02-12			ENSG00000104129	ENSG00000104129		"""Heat shock proteins / DNAJ (HSP40)"", ""RNA binding motif (RRM) containing"""	25556	protein-coding gene	gene with protein product						12477932	Standard	NM_018163		Approved	FLJ10634	uc001zms.2	Q9NVM6	OTTHUMG00000130065	ENST00000220496.4:c.313C>G	15.37:g.41068808G>C	ENSP00000220496:p.Arg105Gly			Missense_Mutation	SNP	pfam_DnaJ_domain,pfam_RRM_dom,superfamily_DnaJ_domain,smart_DnaJ_domain,pfscan_DnaJ_domain,prints_DnaJ_domain	p.R105G	ENST00000220496.4	37	c.313	CCDS10065.1	15	.	.	.	.	.	.	.	.	.	.	G	13.91	2.377703	0.42105	.	.	ENSG00000104129	ENST00000220496	T	0.23552	1.9	4.99	2.88	0.33553	.	0.183263	0.47852	D	0.000217	T	0.33118	0.0852	M	0.86740	2.835	0.58432	D	0.999996	P	0.34780	0.468	B	0.34038	0.174	T	0.35871	-0.9771	10	0.66056	D	0.02	.	10.2317	0.43258	0.0805:0.0:0.7267:0.1928	.	105	Q9NVM6	DJC17_HUMAN	G	105	ENSP00000220496:R105G	ENSP00000220496:R105G	R	-	1	2	DNAJC17	38856100	1.000000	0.71417	0.994000	0.49952	0.935000	0.57460	3.578000	0.53892	1.117000	0.41842	0.561000	0.74099	CGG	DNAJC17	-	NULL	ENSG00000104129		0.632	DNAJC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAJC17	HGNC	protein_coding	OTTHUMT00000252356.2	-	0.00	27	0	G	NM_018163		41068808	-1	tier1	-	no_errors	ENST00000220496	ensembl	human	known	74_37	missense	22.22	14	4	SNP	0.988	C
DOCK2	1794	genome.wustl.edu	37	5	169267766	169267766	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr5:169267766C>A	ENST00000256935.8	+	27	2789	c.2709C>A	c.(2707-2709)ttC>ttA	p.F903L	DOCK2_ENST00000523351.1_3'UTR|DOCK2_ENST00000520908.1_Missense_Mutation_p.F395L|DOCK2_ENST00000540750.1_5'UTR	NM_004946.2	NP_004937.1	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2	903					actin cytoskeleton organization (GO:0030036)|alpha-beta T cell proliferation (GO:0046633)|chemotaxis (GO:0006935)|establishment of T cell polarity (GO:0001768)|immunological synapse formation (GO:0001771)|macropinocytosis (GO:0044351)|membrane raft polarization (GO:0001766)|myeloid dendritic cell activation involved in immune response (GO:0002277)|negative thymic T cell selection (GO:0045060)|positive regulation of phagocytosis (GO:0050766)|positive thymic T cell selection (GO:0045059)|regulation of defense response to virus by virus (GO:0050690)|small GTPase mediated signal transduction (GO:0007264)|viral process (GO:0016032)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|T cell receptor binding (GO:0042608)			NS(2)|breast(5)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(42)|liver(2)|lung(63)|ovary(5)|pancreas(3)|prostate(7)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)	160	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			TACAGGCCTTCACCTACCACC	0.493																																																	0													142.0	113.0	123.0					5																	169267766		2203	4300	6503	SO:0001583	missense	0			BC016996	CCDS4371.1	5q35.1	2008-02-05			ENSG00000134516	ENSG00000134516			2988	protein-coding gene	gene with protein product		603122	"""dedicator of cyto-kinesis 2"""				Standard	NM_004946		Approved	KIAA0209	uc003maf.3	Q92608	OTTHUMG00000130437	ENST00000256935.8:c.2709C>A	5.37:g.169267766C>A	ENSP00000256935:p.Phe903Leu		Q2M3I0|Q96AK7	Missense_Mutation	SNP	pfam_DOCK_C,pfam_SH3_2,superfamily_SH3_domain,superfamily_Cyt_c-like_dom,superfamily_ARM-type_fold,superfamily_Ferritin-like_SF,smart_SH3_domain,pfscan_SH3_domain	p.F903L	ENST00000256935.8	37	c.2709	CCDS4371.1	5	.	.	.	.	.	.	.	.	.	.	C	12.71	2.019735	0.35606	.	.	ENSG00000134516	ENST00000256935;ENST00000343291;ENST00000520908;ENST00000519628	T;T;T	0.18657	3.83;3.83;2.2	5.37	3.4	0.38934	.	0.402848	0.28766	N	0.014204	T	0.07052	0.0179	N	0.03608	-0.345	0.80722	D	1	B;B	0.19817	0.039;0.001	B;B	0.14023	0.01;0.002	T	0.19943	-1.0290	10	0.11182	T	0.66	.	5.5161	0.16908	0.2927:0.6032:0.0:0.104	.	395;903	E7ERW7;Q92608	.;DOCK2_HUMAN	L	903;284;395;107	ENSP00000256935:F903L;ENSP00000429283:F395L;ENSP00000428841:F107L	ENSP00000256935:F903L	F	+	3	2	DOCK2	169200344	0.994000	0.37717	1.000000	0.80357	0.949000	0.60115	0.122000	0.15687	1.258000	0.44101	0.650000	0.86243	TTC	DOCK2	-	superfamily_ARM-type_fold	ENSG00000134516		0.493	DOCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK2	HGNC	protein_coding	OTTHUMT00000252828.2	-	0.00	54	0	C	NM_004946		169267766	+1	tier1	-	no_errors	ENST00000256935	ensembl	human	known	74_37	missense	16.22	31	6	SNP	1.000	A
DOCK2	1794	genome.wustl.edu	37	5	169506006	169506006	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr5:169506006G>C	ENST00000256935.8	+	49	5102	c.5022G>C	c.(5020-5022)aaG>aaC	p.K1674N	DOCK2_ENST00000523351.1_3'UTR|DOCK2_ENST00000520908.1_Missense_Mutation_p.K1166N|DOCK2_ENST00000540750.1_Missense_Mutation_p.K735N	NM_004946.2	NP_004937.1	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2	1674					actin cytoskeleton organization (GO:0030036)|alpha-beta T cell proliferation (GO:0046633)|chemotaxis (GO:0006935)|establishment of T cell polarity (GO:0001768)|immunological synapse formation (GO:0001771)|macropinocytosis (GO:0044351)|membrane raft polarization (GO:0001766)|myeloid dendritic cell activation involved in immune response (GO:0002277)|negative thymic T cell selection (GO:0045060)|positive regulation of phagocytosis (GO:0050766)|positive thymic T cell selection (GO:0045059)|regulation of defense response to virus by virus (GO:0050690)|small GTPase mediated signal transduction (GO:0007264)|viral process (GO:0016032)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|T cell receptor binding (GO:0042608)			NS(2)|breast(5)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(42)|liver(2)|lung(63)|ovary(5)|pancreas(3)|prostate(7)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)	160	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			CATCACCCAAGACGCCGAGAG	0.562																																																	0													103.0	111.0	108.0					5																	169506006		2203	4300	6503	SO:0001583	missense	0			BC016996	CCDS4371.1	5q35.1	2008-02-05			ENSG00000134516	ENSG00000134516			2988	protein-coding gene	gene with protein product		603122	"""dedicator of cyto-kinesis 2"""				Standard	NM_004946		Approved	KIAA0209	uc003maf.3	Q92608	OTTHUMG00000130437	ENST00000256935.8:c.5022G>C	5.37:g.169506006G>C	ENSP00000256935:p.Lys1674Asn		Q2M3I0|Q96AK7	Missense_Mutation	SNP	pfam_DOCK_C,pfam_SH3_2,superfamily_SH3_domain,superfamily_Cyt_c-like_dom,superfamily_ARM-type_fold,superfamily_Ferritin-like_SF,smart_SH3_domain,pfscan_SH3_domain	p.K1674N	ENST00000256935.8	37	c.5022	CCDS4371.1	5	.	.	.	.	.	.	.	.	.	.	G	12.37	1.917482	0.33815	.	.	ENSG00000134516	ENST00000256935;ENST00000520908;ENST00000540750	T;T;T	0.09723	3.6;3.24;2.95	4.92	3.13	0.36017	.	0.976609	0.08474	N	0.940579	T	0.09730	0.0239	L	0.27053	0.805	0.09310	N	1	B;B;B	0.25772	0.026;0.134;0.026	B;B;B	0.31946	0.021;0.138;0.014	T	0.45160	-0.9280	10	0.26408	T	0.33	.	8.8425	0.35151	0.2501:0.0:0.7499:0.0	.	1166;230;1674	E7ERW7;B3KY14;Q92608	.;.;DOCK2_HUMAN	N	1674;1166;735	ENSP00000256935:K1674N;ENSP00000429283:K1166N;ENSP00000438827:K735N	ENSP00000256935:K1674N	K	+	3	2	DOCK2	169438584	0.344000	0.24827	0.008000	0.14137	0.125000	0.20455	1.286000	0.33273	0.605000	0.29947	0.650000	0.86243	AAG	DOCK2	-	NULL	ENSG00000134516		0.562	DOCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK2	HGNC	protein_coding	OTTHUMT00000252828.2	-	0.00	46	0	G	NM_004946		169506006	+1	tier1	-	no_errors	ENST00000256935	ensembl	human	known	74_37	missense	17.86	23	5	SNP	0.201	C
DOCK6	57572	genome.wustl.edu	37	19	11333578	11333578	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr19:11333578C>T	ENST00000294618.7	-	26	3084	c.3073G>A	c.(3073-3075)Gcc>Acc	p.A1025T	DOCK6_ENST00000319867.7_Missense_Mutation_p.A364T	NM_020812.3	NP_065863.2	Q96HP0	DOCK6_HUMAN	dedicator of cytokinesis 6	1025					blood coagulation (GO:0007596)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(1)|central_nervous_system(1)|endometrium(11)|large_intestine(8)|liver(2)|lung(9)|ovary(4)|prostate(1)|skin(1)|urinary_tract(1)	39						AGCCGCGTGGCCACCTGCAGG	0.622																																																	0													26.0	34.0	31.0					19																	11333578		2169	4252	6421	SO:0001583	missense	0				CCDS45975.1	19p13.2	2011-08-04			ENSG00000130158	ENSG00000130158			19189	protein-coding gene	gene with protein product		614194				12432077	Standard	NM_020812		Approved	KIAA1395, ZIR1	uc002mqs.5	Q96HP0		ENST00000294618.7:c.3073G>A	19.37:g.11333578C>T	ENSP00000294618:p.Ala1025Thr		A6H8X5|Q7Z7P4|Q9P2F2	Missense_Mutation	SNP	pfam_DOCK_C,pfam_DOCK_C/D_N	p.A1025T	ENST00000294618.7	37	c.3073	CCDS45975.1	19	.	.	.	.	.	.	.	.	.	.	C	11.14	1.551416	0.27739	.	.	ENSG00000130158	ENST00000294618;ENST00000319867	T;T	0.23147	1.92;1.92	4.81	2.39	0.29439	.	0.354959	0.25464	N	0.030487	T	0.09069	0.0224	N	0.05280	-0.08	0.37953	D	0.932727	B;B	0.09022	0.001;0.002	B;B	0.11329	0.003;0.006	T	0.22626	-1.0211	10	0.17832	T	0.49	-24.1274	3.2307	0.06747	0.4256:0.409:0.0:0.1654	.	364;1025	C9IZV6;Q96HP0	.;DOCK6_HUMAN	T	1025;364	ENSP00000294618:A1025T;ENSP00000321556:A364T	ENSP00000294618:A1025T	A	-	1	0	DOCK6	11194578	0.676000	0.27567	1.000000	0.80357	0.730000	0.41778	-0.069000	0.11542	2.229000	0.72834	0.491000	0.48974	GCC	DOCK6	-	NULL	ENSG00000130158		0.622	DOCK6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK6	HGNC	protein_coding	OTTHUMT00000453155.1	-	0.00	24	0	C	NM_020812		11333578	-1	tier1	-	no_errors	ENST00000294618	ensembl	human	known	74_37	missense	14.81	23	4	SNP	0.999	T
DOPEY1	23033	genome.wustl.edu	37	6	83855342	83855342	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr6:83855342G>T	ENST00000349129.2	+	25	5901	c.5641G>T	c.(5641-5643)Gtt>Ttt	p.V1881F	DOPEY1_ENST00000237163.5_Missense_Mutation_p.V1862F|DOPEY1_ENST00000484282.1_3'UTR|DOPEY1_ENST00000369739.3_Missense_Mutation_p.V1872F	NM_015018.3	NP_055833.2	Q5JWR5	DOP1_HUMAN	dopey family member 1	1881					protein transport (GO:0015031)					breast(4)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(16)|ovary(5)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	67		all_cancers(76;2.29e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000865)|all_epithelial(107;0.00203)		BRCA - Breast invasive adenocarcinoma(397;0.053)		TGTAAAAGAAGTTTTAAAGCA	0.388																																																	0													76.0	69.0	72.0					6																	83855342		2203	4300	6503	SO:0001583	missense	0			AK027030	CCDS4996.1, CCDS64467.1	6q15	2013-03-05	2006-02-02	2006-02-02	ENSG00000083097	ENSG00000083097			21194	protein-coding gene	gene with protein product			"""KIAA1117"""	KIAA1117		16301316, 16303751, 10931277	Standard	NM_015018		Approved	dJ202D23.2	uc011dyy.2	Q5JWR5	OTTHUMG00000016365	ENST00000349129.2:c.5641G>T	6.37:g.83855342G>T	ENSP00000195654:p.Val1881Phe		Q86XV1|Q9H5J5|Q9NSL4|Q9UPN5|Q9Y414	Missense_Mutation	SNP	pfam_Dopey_N,superfamily_ARM-type_fold	p.V1881F	ENST00000349129.2	37	c.5641	CCDS4996.1	6	.	.	.	.	.	.	.	.	.	.	G	28.9	4.963818	0.92791	.	.	ENSG00000083097	ENST00000349129;ENST00000237163;ENST00000369739	T;T	0.46063	1.25;0.88	6.05	6.05	0.98169	.	0.000000	0.85682	D	0.000000	T	0.56587	0.1995	M	0.67700	2.07	0.80722	D	1	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.83275	0.996;0.996;0.996	T	0.37709	-0.9694	10	0.21540	T	0.41	.	20.5989	0.99451	0.0:0.0:1.0:0.0	.	1772;1872;1881	E1P545;B2RWN9;Q5JWR5	.;.;DOP1_HUMAN	F	1881;1862;1862	ENSP00000195654:V1881F;ENSP00000237163:V1862F	ENSP00000237163:V1862F	V	+	1	0	DOPEY1	83912061	1.000000	0.71417	1.000000	0.80357	0.885000	0.51271	9.444000	0.97578	2.871000	0.98454	0.637000	0.83480	GTT	DOPEY1	-	superfamily_ARM-type_fold	ENSG00000083097		0.388	DOPEY1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	DOPEY1	HGNC	protein_coding	OTTHUMT00000043785.2		0.00	52	0	G	NM_015018		83855342	+1			no_errors	ENST00000349129	ensembl	human	known	74_37	missense	9.52	19	2	SNP	1.000	T
DPP4	1803	genome.wustl.edu	37	2	162868348	162868348	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr2:162868348C>G	ENST00000360534.3	-	20	2347	c.1787G>C	c.(1786-1788)aGa>aCa	p.R596T	DPP4_ENST00000491591.1_5'UTR	NM_001935.3	NP_001926.2	P27487	DPP4_HUMAN	dipeptidyl-peptidase 4	596					cell adhesion (GO:0007155)|endothelial cell migration (GO:0043542)|negative regulation of extracellular matrix disassembly (GO:0010716)|positive regulation of cell proliferation (GO:0008284)|regulation of cell-cell adhesion mediated by integrin (GO:0033632)|response to hypoxia (GO:0001666)|T cell activation (GO:0042110)|T cell costimulation (GO:0031295)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|endocytic vesicle (GO:0030139)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intercellular canaliculus (GO:0046581)|invadopodium membrane (GO:0071438)|lamellipodium (GO:0030027)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|plasma membrane (GO:0005886)	dipeptidyl-peptidase activity (GO:0008239)|identical protein binding (GO:0042802)|protease binding (GO:0002020)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(1)|lung(21)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	48					Alogliptin(DB06203)|Atorvastatin(DB01076)|Linagliptin(DB08882)|Liraglutide(DB06655)|Saxagliptin(DB06335)|Sitagliptin(DB01261)|Vildagliptin(DB04876)	TCCCAGTCTTCTGTTGATTGC	0.408																																																	0													158.0	140.0	146.0					2																	162868348		2203	4300	6503	SO:0001583	missense	0			M74777	CCDS2216.1	2q24.2	2013-09-19	2008-08-01		ENSG00000197635	ENSG00000197635	3.4.14.5	"""CD molecules"""	3009	protein-coding gene	gene with protein product		102720	"""dipeptidylpeptidase IV (CD26, adenosine deaminase complexing protein 2)"", ""adenosine deaminase complexing protein 2"""	CD26, ADCP2		8101391	Standard	NM_001935		Approved	DPPIV	uc002ubz.3	P27487	OTTHUMG00000132056	ENST00000360534.3:c.1787G>C	2.37:g.162868348C>G	ENSP00000353731:p.Arg596Thr		Q53TN1	Missense_Mutation	SNP	pfam_Peptidase_S9B,pfam_Peptidase_S9	p.R596T	ENST00000360534.3	37	c.1787	CCDS2216.1	2	.	.	.	.	.	.	.	.	.	.	C	20.5	4.006130	0.74932	.	.	ENSG00000197635	ENST00000360534	T	0.32023	1.47	5.94	3.15	0.36227	Peptidase S9, prolyl oligopeptidase, catalytic domain (1);	0.380488	0.31542	N	0.007469	T	0.56717	0.2004	M	0.92412	3.305	0.42822	D	0.993996	D	0.56287	0.975	P	0.58970	0.849	T	0.62393	-0.6864	10	0.87932	D	0	-9.0464	9.4876	0.38940	0.0:0.7284:0.0:0.2716	.	596	P27487	DPP4_HUMAN	T	596	ENSP00000353731:R596T	ENSP00000353731:R596T	R	-	2	0	DPP4	162576594	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	0.907000	0.28531	0.386000	0.24997	0.591000	0.81541	AGA	DPP4	-	pfam_Peptidase_S9	ENSG00000197635		0.408	DPP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DPP4	HGNC	protein_coding	OTTHUMT00000255079.2		0.00	98	0	C			162868348	-1			no_errors	ENST00000360534	ensembl	human	known	74_37	missense	8.33	33	3	SNP	1.000	G
DPP4	1803	genome.wustl.edu	37	2	162873287	162873287	+	Missense_Mutation	SNP	T	T	A			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr2:162873287T>A	ENST00000360534.3	-	18	2118	c.1558A>T	c.(1558-1560)Aat>Tat	p.N520Y	DPP4_ENST00000491591.1_5'UTR	NM_001935.3	NP_001926.2	P27487	DPP4_HUMAN	dipeptidyl-peptidase 4	520					cell adhesion (GO:0007155)|endothelial cell migration (GO:0043542)|negative regulation of extracellular matrix disassembly (GO:0010716)|positive regulation of cell proliferation (GO:0008284)|regulation of cell-cell adhesion mediated by integrin (GO:0033632)|response to hypoxia (GO:0001666)|T cell activation (GO:0042110)|T cell costimulation (GO:0031295)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|endocytic vesicle (GO:0030139)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intercellular canaliculus (GO:0046581)|invadopodium membrane (GO:0071438)|lamellipodium (GO:0030027)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|plasma membrane (GO:0005886)	dipeptidyl-peptidase activity (GO:0008239)|identical protein binding (GO:0042802)|protease binding (GO:0002020)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(1)|lung(21)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	48					Alogliptin(DB06203)|Atorvastatin(DB01076)|Linagliptin(DB08882)|Liraglutide(DB06655)|Saxagliptin(DB06335)|Sitagliptin(DB01261)|Vildagliptin(DB04876)	CTTGTTTCATTCAAAATAATG	0.338																																																	0													76.0	80.0	78.0					2																	162873287		2203	4300	6503	SO:0001583	missense	0			M74777	CCDS2216.1	2q24.2	2013-09-19	2008-08-01		ENSG00000197635	ENSG00000197635	3.4.14.5	"""CD molecules"""	3009	protein-coding gene	gene with protein product		102720	"""dipeptidylpeptidase IV (CD26, adenosine deaminase complexing protein 2)"", ""adenosine deaminase complexing protein 2"""	CD26, ADCP2		8101391	Standard	NM_001935		Approved	DPPIV	uc002ubz.3	P27487	OTTHUMG00000132056	ENST00000360534.3:c.1558A>T	2.37:g.162873287T>A	ENSP00000353731:p.Asn520Tyr		Q53TN1	Missense_Mutation	SNP	pfam_Peptidase_S9B,pfam_Peptidase_S9	p.N520Y	ENST00000360534.3	37	c.1558	CCDS2216.1	2	.	.	.	.	.	.	.	.	.	.	T	11.56	1.675166	0.29783	.	.	ENSG00000197635	ENST00000360534	T	0.24723	1.84	5.71	3.34	0.38264	.	0.479626	0.24024	N	0.042248	T	0.21590	0.0520	L	0.52573	1.65	0.29688	N	0.841163	B	0.06786	0.001	B	0.04013	0.001	T	0.14337	-1.0476	10	0.56958	D	0.05	-10.5017	6.5492	0.22423	0.0:0.1275:0.4683:0.4042	.	520	P27487	DPP4_HUMAN	Y	520	ENSP00000353731:N520Y	ENSP00000353731:N520Y	N	-	1	0	DPP4	162581533	0.152000	0.22762	0.554000	0.28268	0.972000	0.66771	-0.025000	0.12413	0.525000	0.28522	0.528000	0.53228	AAT	DPP4	-	NULL	ENSG00000197635		0.338	DPP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DPP4	HGNC	protein_coding	OTTHUMT00000255079.2		0.00	60	0	T			162873287	-1			no_errors	ENST00000360534	ensembl	human	known	74_37	missense	7.14	39	3	SNP	0.728	A
DSC2	1824	genome.wustl.edu	37	18	28662987	28662987	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr18:28662987T>G	ENST00000280904.6	-	8	1425	c.982A>C	c.(982-984)Atg>Ctg	p.M328L	DSC2_ENST00000251081.6_Missense_Mutation_p.M328L	NM_024422.3	NP_077740.1	Q02487	DSC2_HUMAN	desmocollin 2	328	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				bundle of His cell to Purkinje myocyte communication (GO:0086069)|cardiac muscle cell-cardiac muscle cell adhesion (GO:0086042)|cell adhesion (GO:0007155)|cellular response to starvation (GO:0009267)|homophilic cell adhesion (GO:0007156)|regulation of heart rate by cardiac conduction (GO:0086091)|ventricular cardiac muscle cell action potential (GO:0086005)	cell-cell adherens junction (GO:0005913)|cytoplasmic vesicle (GO:0031410)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(2)|kidney(1)|large_intestine(2)|lung(12)|ovary(2)|prostate(1)|skin(1)	21			OV - Ovarian serous cystadenocarcinoma(10;0.0241)			TGACCATCCATGTCTTGTACT	0.313																																																	0													104.0	99.0	101.0					18																	28662987		2203	4300	6503	SO:0001583	missense	0			X56807	CCDS11892.1, CCDS11893.1	18q12.1	2014-09-17			ENSG00000134755	ENSG00000134755		"""Cadherins / Major cadherins"""	3036	protein-coding gene	gene with protein product		125645		DSC3		7774948	Standard	NM_024422		Approved	CDHF2	uc002kwl.4	Q02487	OTTHUMG00000131981	ENST00000280904.6:c.982A>C	18.37:g.28662987T>G	ENSP00000280904:p.Met328Leu			Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,pfam_Cadherin_pro_dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin,prints_Cadherin/Desmocollin,prints_Desmosomal_cadherin	p.M328L	ENST00000280904.6	37	c.982	CCDS11892.1	18	.	.	.	.	.	.	.	.	.	.	T	18.54	3.645672	0.67358	.	.	ENSG00000134755	ENST00000251081;ENST00000280904;ENST00000438199;ENST00000399347	T;T	0.50001	0.76;0.76	5.41	5.41	0.78517	Cadherin (5);Cadherin-like (1);	0.000000	0.39020	N	0.001482	T	0.58892	0.2154	M	0.62154	1.92	0.54753	D	0.999983	P;P	0.51537	0.946;0.933	P;P	0.53689	0.732;0.612	T	0.63721	-0.6573	10	0.87932	D	0	.	14.4409	0.67318	0.0:0.0:0.0:1.0	.	328;328	Q02487;Q02487-2	DSC2_HUMAN;.	L	328;328;94;341	ENSP00000251081:M328L;ENSP00000280904:M328L	ENSP00000251081:M328L	M	-	1	0	DSC2	26916985	1.000000	0.71417	1.000000	0.80357	0.858000	0.48976	3.519000	0.53458	2.058000	0.61347	0.533000	0.62120	ATG	DSC2	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	ENSG00000134755		0.313	DSC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DSC2	HGNC	protein_coding	OTTHUMT00000254943.1	-	0.00	49	0	T	NM_004949		28662987	-1	tier1	-	no_errors	ENST00000280904	ensembl	human	known	74_37	missense	16.67	40	8	SNP	1.000	G
DSCAM	1826	genome.wustl.edu	37	21	41684007	41684007	+	Splice_Site	DEL	C	C	-			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr21:41684007delC	ENST00000400454.1	-	9	2540		c.e9+1			NM_001271534.1|NM_001389.3	NP_001258463.1|NP_001380.2	O60469	DSCAM_HUMAN	Down syndrome cell adhesion molecule						cell adhesion (GO:0007155)|dendrite morphogenesis (GO:0048813)|dendrite self-avoidance (GO:0070593)|locomotory behavior (GO:0007626)|negative regulation of cell adhesion (GO:0007162)|nervous system development (GO:0007399)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of phosphorylation (GO:0042327)|post-embryonic retina morphogenesis in camera-type eye (GO:0060060)	axon (GO:0030424)|extracellular region (GO:0005576)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)				NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(22)|lung(47)|ovary(7)|pancreas(2)|prostate(3)|skin(14)|upper_aerodigestive_tract(6)|urinary_tract(4)	142		all_cancers(19;0.186)|Prostate(19;1.15e-05)|all_epithelial(19;0.0103)				CCTTTGCTCACCTCTGACAAT	0.453																																					Melanoma(134;970 1778 1785 21664 32388)												0													103.0	99.0	100.0					21																	41684007		1973	4173	6146	SO:0001630	splice_region_variant	0			AF023449	CCDS42929.1	21q22.2-q22.3	2013-02-11			ENSG00000171587	ENSG00000171587		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	3039	protein-coding gene	gene with protein product		602523				9426258	Standard	NM_001271534		Approved	CHD2-42, CHD2-52	uc002yyq.1	O60469	OTTHUMG00000086732	ENST00000400454.1:c.2062+1G>-	21.37:g.41684007delC			O60468	Splice_Site	DEL	-	e9+1	ENST00000400454.1	37	c.2062+1	CCDS42929.1	21																																																																																			DSCAM	-	-	ENSG00000171587		0.453	DSCAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DSCAM	HGNC	protein_coding	OTTHUMT00000195029.1		0.00	46	0	C	NM_001389	Intron	41684007	-1	tier1		no_errors	ENST00000400454	ensembl	human	known	74_37	splice_site_del	15.38	11	2	DEL	1.000	-
DSCAML1	57453	genome.wustl.edu	37	11	117391983	117391983	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr11:117391983C>T	ENST00000321322.6	-	6	1256	c.1255G>A	c.(1255-1257)Gag>Aag	p.E419K	DSCAML1_ENST00000527706.1_Missense_Mutation_p.E149K	NM_020693.2	NP_065744.2	Q8TD84	DSCL1_HUMAN	Down syndrome cell adhesion molecule like 1	359	Ig-like C2-type 5.				axonogenesis (GO:0007409)|brain development (GO:0007420)|cell fate determination (GO:0001709)|central nervous system development (GO:0007417)|dendrite self-avoidance (GO:0070593)|dorsal/ventral pattern formation (GO:0009953)|embryonic skeletal system morphogenesis (GO:0048704)|homophilic cell adhesion (GO:0007156)|negative regulation of cell adhesion (GO:0007162)	cell surface (GO:0009986)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)			breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(24)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	110	all_hematologic(175;0.0487)	Breast(348;0.0424)|Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)		BRCA - Breast invasive adenocarcinoma(274;9.12e-06)|Epithelial(105;0.00172)		GAGATGGCCTCGTCAGGCAGC	0.647																																																	0													115.0	96.0	102.0					11																	117391983		2201	4296	6497	SO:0001583	missense	0				CCDS8384.1	11q22.2-q22.3	2013-02-11			ENSG00000177103	ENSG00000177103		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	14656	protein-coding gene	gene with protein product		611782				11453658	Standard	NM_020693		Approved	KIAA1132	uc001prh.1	Q8TD84	OTTHUMG00000167071	ENST00000321322.6:c.1255G>A	11.37:g.117391983C>T	ENSP00000315465:p.Glu419Lys		Q76MU9|Q8IZY3|Q8IZY4|Q8WXU7|Q9ULT7	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.E419K	ENST00000321322.6	37	c.1255	CCDS8384.1	11	.	.	.	.	.	.	.	.	.	.	C	13.06	2.123615	0.37436	.	.	ENSG00000177103	ENST00000527706;ENST00000321322;ENST00000446508	T;T	0.30448	1.53;1.53	4.67	4.67	0.58626	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.23451	0.0567	L	0.31207	0.915	0.48040	D	0.999578	B;B	0.15141	0.012;0.009	B;B	0.12156	0.004;0.007	T	0.06250	-1.0837	9	0.10377	T	0.69	.	17.7518	0.88436	0.0:1.0:0.0:0.0	.	149;359	G3V1B5;Q8TD84	.;DSCL1_HUMAN	K	149;419;126	ENSP00000434335:E149K;ENSP00000315465:E419K	ENSP00000315465:E419K	E	-	1	0	DSCAML1	116897193	1.000000	0.71417	0.962000	0.40283	0.956000	0.61745	3.976000	0.56867	2.417000	0.82017	0.609000	0.83330	GAG	DSCAML1	-	pfam_Ig_I-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000177103		0.647	DSCAML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DSCAML1	HGNC	protein_coding	OTTHUMT00000392907.2	-	0.00	46	0	C	NM_020693		117391983	-1	tier1	-	no_errors	ENST00000321322	ensembl	human	known	74_37	missense	12.12	29	4	SNP	0.997	T
DSCR8	84677	genome.wustl.edu	37	21	39494412	39494412	+	De_novo_Start_OutOfFrame	SNP	C	C	A			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr21:39494412C>A	ENST00000357704.4	+	0	136				DSCR8_ENST00000400477.3_De_novo_Start_OutOfFrame|DSCR8_ENST00000465532.1_3'UTR|DSCR4_ENST00000328264.3_5'Flank|DSCR4_ENST00000398948.1_5'Flank			Q96T75	DSCR8_HUMAN	Down syndrome critical region gene 8																		TTAGCTTCATCTTGCTGAGCA	0.403																																																	0																																												0			AF321193		21q22.2	2013-01-16	2002-11-26		ENSG00000198054	ENSG00000198054			16707	other	unknown	"""cancer/testis antigen family 25, member 1a"", ""cancer/testis antigen family 25, member 1b"", ""malignant melanoma-associated 1"""	613396	"""chromosome 21 open reading frame 65"""	C21orf65		9503011, 12036297, 11920614	Standard	NR_026838		Approved	MTAG2, CT25.1a, CT25.1b, MMA-1a, MMA-1b	uc010gnq.4	Q96T75	OTTHUMG00000090610	ENST00000357704.4:c.-14C>A	21.37:g.39494412C>A			Q8N3X0|Q8NDY5|Q96B46	RNA	SNP	-	NULL	ENST00000357704.4	37	NULL		21																																																																																			DSCR8	-	-	ENSG00000198054		0.403	DSCR8-006	KNOWN	basic|appris_candidate_longest	protein_coding	DSCR8	HGNC	protein_coding	OTTHUMT00000207197.1	-	0.00	49	0	C	NR_026838		39494412	+1	tier1	-	no_errors	ENST00000465532	ensembl	human	known	74_37	rna	29.17	17	7	SNP	0.001	A
DST	667	genome.wustl.edu	37	6	56358968	56358968	+	Missense_Mutation	SNP	G	G	A	rs565745746		TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr6:56358968G>A	ENST00000361203.3	-	78	19281	c.19274C>T	c.(19273-19275)gCt>gTt	p.A6425V	DST_ENST00000421834.2_Missense_Mutation_p.A4448V|DST_ENST00000370754.5_Missense_Mutation_p.A6714V|DST_ENST00000370788.2_Missense_Mutation_p.A4339V|DST_ENST00000244364.6_Missense_Mutation_p.A4122V|DST_ENST00000370769.4_Missense_Mutation_p.A6536V|DST_ENST00000312431.6_3'UTR|DST_ENST00000446842.2_Missense_Mutation_p.A6210V|DST_ENST00000340834.4_5'UTR			Q03001	DYST_HUMAN	dystonin	6425					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)			NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			TTCAAAGGCAGCACAGACTTC	0.378																																																	0													123.0	111.0	115.0					6																	56358968		1835	4090	5925	SO:0001583	missense	0			M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000361203.3:c.19274C>T	6.37:g.56358968G>A	ENSP00000354508:p.Ala6425Val		B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_Plectin_repeat,pfam_CH-domain,pfam_GAS2_dom,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_GAS2_dom,superfamily_ABC1_TM_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Plectin_repeat,smart_EF_hand_dom,smart_GAS2_dom,pfscan_CH-domain,pfscan_EF_hand_dom	p.A6714V	ENST00000361203.3	37	c.20141		6	.	.	.	.	.	.	.	.	.	.	G	16.62	3.174511	0.57692	.	.	ENSG00000151914	ENST00000244364;ENST00000370754;ENST00000370769;ENST00000421834;ENST00000446842;ENST00000370788;ENST00000361203	T;T;T;T;T;T;T	0.55588	0.51;0.51;0.51;0.51;0.51;0.51;0.51	5.56	4.66	0.58398	.	0.251825	0.27572	N	0.018779	T	0.54464	0.1860	L	0.53249	1.67	0.27099	N	0.962679	D;P;P;B;B	0.53462	0.96;0.763;0.599;0.085;0.317	P;P;B;B;B	0.59357	0.856;0.507;0.206;0.133;0.138	T	0.49184	-0.8966	9	0.30078	T	0.28	.	15.7935	0.78388	0.0:0.0:0.8633:0.1367	.	4448;6536;6714;6534;4122	Q5TBT1;E7ERU2;E9PEB9;Q03001;Q03001-8	.;.;.;DYST_HUMAN;.	V	4122;6714;6536;4448;6210;4339;6425	ENSP00000244364:A4122V;ENSP00000359790:A6714V;ENSP00000359805:A6536V;ENSP00000400883:A4448V;ENSP00000393645:A6210V;ENSP00000359824:A4339V;ENSP00000354508:A6425V	ENSP00000244364:A4122V	A	-	2	0	DST	56466927	1.000000	0.71417	1.000000	0.80357	0.845000	0.48019	4.661000	0.61518	2.615000	0.88500	0.563000	0.77884	GCT	DST	-	pfam_Spectrin_repeat,superfamily_ABC1_TM_dom,smart_Spectrin/alpha-actinin	ENSG00000151914		0.378	DST-004	NOVEL	not_organism_supported|basic|appris_candidate	protein_coding	DST	HGNC	protein_coding	OTTHUMT00000041021.3	-	0.00	41	0	G	NM_001723		56358968	-1	tier1	-	no_errors	ENST00000370754	ensembl	human	known	74_37	missense	13.64	19	3	SNP	1.000	A
DYNC1I1	1780	genome.wustl.edu	37	7	95616416	95616416	+	Silent	SNP	T	T	C			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr7:95616416T>C	ENST00000324972.6	+	9	1036	c.843T>C	c.(841-843)gaT>gaC	p.D281D	DYNC1I1_ENST00000537881.1_Silent_p.D244D|DYNC1I1_ENST00000457059.1_Silent_p.D264D|DYNC1I1_ENST00000359388.4_Silent_p.D244D|DYNC1I1_ENST00000437599.1_Silent_p.D261D|DYNC1I1_ENST00000447467.2_Silent_p.D264D	NM_004411.4	NP_004402.1	O14576	DC1I1_HUMAN	dynein, cytoplasmic 1, intermediate chain 1	281					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|metabolic process (GO:0008152)|vesicle transport along microtubule (GO:0047496)	cytoplasmic dynein complex (GO:0005868)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|kinetochore (GO:0000776)|microtubule (GO:0005874)|perinuclear region of cytoplasm (GO:0048471)|spindle pole (GO:0000922)|vesicle (GO:0031982)	microtubule binding (GO:0008017)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)|spectrin binding (GO:0030507)			NS(2)|autonomic_ganglia(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(27)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	54	all_cancers(62;9.39e-10)|all_epithelial(64;2.28e-09)|Lung NSC(181;0.165)|all_lung(186;0.191)		STAD - Stomach adenocarcinoma(171;0.0957)			AGTTCTATGATGAACATTGGT	0.463																																																	0													288.0	279.0	282.0					7																	95616416		2203	4300	6503	SO:0001819	synonymous_variant	0			AF063228	CCDS5644.1, CCDS47645.1, CCDS47646.1, CCDS64718.1	7q21.3-q22.1	2013-01-18	2005-11-24	2005-11-24	ENSG00000158560	ENSG00000158560		"""Cytoplasmic dyneins"", ""WD repeat domain containing"""	2963	protein-coding gene	gene with protein product		603772	"""dynein, cytoplasmic, intermediate polypeptide 1"""	DNCI1		10049579, 16260502	Standard	NM_004411		Approved	DNCIC1	uc003uoc.4	O14576	OTTHUMG00000153983	ENST00000324972.6:c.843T>C	7.37:g.95616416T>C			B4DME3|F5H050|G5E9K1|Q8TBF7|Q9Y2X1	Silent	SNP	pfam_Dynein_IC_1/2,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom	p.D281	ENST00000324972.6	37	c.843	CCDS5644.1	7																																																																																			DYNC1I1	-	superfamily_WD40_repeat_dom	ENSG00000158560		0.463	DYNC1I1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DYNC1I1	HGNC	protein_coding	OTTHUMT00000333432.1	-	0.00	60	0	T	NM_004411		95616416	+1	tier1	-	no_errors	ENST00000324972	ensembl	human	known	74_37	silent	19.35	25	6	SNP	1.000	C
EED	8726	genome.wustl.edu	37	11	85961397	85961397	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr11:85961397C>G	ENST00000263360.6	+	2	860	c.174C>G	c.(172-174)aaC>aaG	p.N58K	EED_ENST00000327320.4_Missense_Mutation_p.N58K|EED_ENST00000528180.1_Missense_Mutation_p.N58K|EED_ENST00000351625.6_Missense_Mutation_p.N58K	NM_003797.3	NP_003788.2	O75530	EED_HUMAN	embryonic ectoderm development	58					negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of histone H3-K27 methylation (GO:0061087)|regulation of gene expression by genetic imprinting (GO:0006349)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|ESC/E(Z) complex (GO:0035098)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|pronucleus (GO:0045120)|sex chromatin (GO:0001739)	chromatin binding (GO:0003682)|histone methyltransferase activity (GO:0042054)|identical protein binding (GO:0042802)			haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(2)|lung(7)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|stomach(1)	21		Acute lymphoblastic leukemia(157;7.24e-07)|all_hematologic(158;0.00092)				CACCTACAAACACGCCAAATG	0.388																																																	0													112.0	99.0	103.0					11																	85961397		2203	4299	6502	SO:0001583	missense	0			AF078933	CCDS8273.1, CCDS8274.1	11q14.2-q22.3	2013-01-10			ENSG00000074266	ENSG00000074266		"""WD repeat domain containing"""	3188	protein-coding gene	gene with protein product	"""WD protein associating with integrin cytoplasmic tails 1"""	605984				9765275, 9806832	Standard	NM_003797		Approved	WAIT-1, HEED	uc001pbp.3	O75530	OTTHUMG00000167209	ENST00000263360.6:c.174C>G	11.37:g.85961397C>G	ENSP00000263360:p.Asn58Lys		A8K7V5|O00149|Q6NTH2|Q7LDA5|Q7LDG8|Q86VV2|Q9UNY7	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.N58K	ENST00000263360.6	37	c.174	CCDS8273.1	11	.	.	.	.	.	.	.	.	.	.	C	12.20	1.867892	0.32977	.	.	ENSG00000074266	ENST00000263360;ENST00000528180;ENST00000351625;ENST00000327320;ENST00000537092	T;T;T;T	0.79749	-0.8;-1.3;-0.73;-0.73	4.84	1.29	0.21616	.	0.049498	0.85682	D	0.000000	T	0.66489	0.2794	L	0.38175	1.15	0.80722	D	1	P;B;B;B	0.34587	0.458;0.084;0.102;0.329	B;B;B;B	0.31869	0.137;0.051;0.054;0.095	T	0.55742	-0.8093	9	.	.	.	-12.7	8.2093	0.31473	0.0:0.4061:0.0:0.5939	.	58;58;58;58	O75530-3;E9PJK2;O75530-2;O75530	.;.;.;EED_HUMAN	K	58	ENSP00000263360:N58K;ENSP00000431778:N58K;ENSP00000338186:N58K;ENSP00000315587:N58K	.	N	+	3	2	EED	85639045	1.000000	0.71417	0.975000	0.42487	0.997000	0.91878	1.962000	0.40442	0.226000	0.20979	0.585000	0.79938	AAC	EED	-	NULL	ENSG00000074266		0.388	EED-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EED	HGNC	protein_coding	OTTHUMT00000393733.1	-	0.00	62	0	C	NM_003797		85961397	+1	tier1	-	no_errors	ENST00000263360	ensembl	human	known	74_37	missense	26.47	25	9	SNP	1.000	G
EFCAB10	100130771	genome.wustl.edu	37	7	105210019	105210019	+	Splice_Site	SNP	C	C	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr7:105210019C>T	ENST00000480514.1	-	2	143		c.e2-1		EFCAB10_ENST00000485614.1_Splice_Site|EFCAB10_ENST00000460135.1_Intron|EFCAB10_ENST00000486180.1_Splice_Site|RP11-251G23.5_ENST00000609827.1_RNA|EFCAB10_ENST00000490493.1_Splice_Site			A6NFE3	EFC10_HUMAN	EF-hand calcium binding domain 10								calcium ion binding (GO:0005509)										TTTGGTTTTTCTGCAAAAGAA	0.323																																																	0																																										SO:0001630	splice_region_variant	0			BC105284		7q22.2	2013-01-29			ENSG00000185055	ENSG00000185055		"""EF-hand domain containing"""	34531	protein-coding gene	gene with protein product							Standard	NR_027068		Approved		uc003vdc.4	A6NFE3	OTTHUMG00000157397	ENST00000480514.1:c.107-1G>A	7.37:g.105210019C>T				Splice_Site	SNP	-	e2-1	ENST00000480514.1	37	c.107-1		7	.	.	.	.	.	.	.	.	.	.	C	22.4	4.287919	0.80803	.	.	ENSG00000185055	ENST00000480514;ENST00000485614;ENST00000486180	.	.	.	5.81	5.81	0.92471	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.6899	0.95996	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	EFCAB10	104997255	1.000000	0.71417	1.000000	0.80357	0.934000	0.57294	5.295000	0.65692	2.747000	0.94245	0.650000	0.86243	.	EFCAB10	-	-	ENSG00000185055		0.323	EFCAB10-001	KNOWN	basic|appris_candidate	protein_coding	EFCAB10	HGNC	protein_coding	OTTHUMT00000348673.1	-	0.00	47	0	C		Intron	105210019	-1	tier1	-	no_errors	ENST00000480514	ensembl	human	known	74_37	splice_site	34.38	21	11	SNP	1.000	T
EFCAB5	374786	genome.wustl.edu	37	17	28418937	28418937	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr17:28418937G>T	ENST00000394835.3	+	21	4178	c.3986G>T	c.(3985-3987)cGa>cTa	p.R1329L	EFCAB5_ENST00000394832.2_Intron|RP11-1148O4.2_ENST00000582938.1_RNA|EFCAB5_ENST00000320856.5_Missense_Mutation_p.R1205L	NM_198529.3	NP_940931	A4FU69	EFCB5_HUMAN	EF-hand calcium binding domain 5	1329							calcium ion binding (GO:0005509)			breast(7)|endometrium(2)|kidney(4)|large_intestine(11)|lung(14)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	43						CTCTTCTTCCGAATCATGCTG	0.423																																																	0													114.0	107.0	109.0					17																	28418937		1904	4136	6040	SO:0001583	missense	0			AL833911	CCDS11254.2, CCDS54103.1	17q11.2	2013-01-10			ENSG00000176927	ENSG00000176927		"""EF-hand domain containing"""	24801	protein-coding gene	gene with protein product							Standard	NM_198529		Approved	FLJ46247	uc002het.3	A4FU69	OTTHUMG00000132753	ENST00000394835.3:c.3986G>T	17.37:g.28418937G>T	ENSP00000378312:p.Arg1329Leu		B2RPN0|B4DS75|B4DZR5|F5GYL2|Q0VD68|Q6ZRM6|Q8NDG9	Missense_Mutation	SNP	pfscan_EF_hand_dom	p.R1329L	ENST00000394835.3	37	c.3986	CCDS11254.2	17	.	.	.	.	.	.	.	.	.	.	G	25.0	4.591231	0.86851	.	.	ENSG00000176927	ENST00000394835;ENST00000320856;ENST00000419434	T;T;T	0.30714	1.52;1.64;1.62	5.72	4.75	0.60458	.	0.000000	0.64402	D	0.000005	T	0.54143	0.1840	M	0.72894	2.215	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.99;0.999	T	0.56685	-0.7938	10	0.87932	D	0	-7.2405	14.2419	0.65963	0.0727:0.0:0.9272:0.0	.	1205;1329	E7EVS9;A4FU69	.;EFCB5_HUMAN	L	1329;1205;1011	ENSP00000378312:R1329L;ENSP00000322003:R1205L;ENSP00000417009:R1011L	ENSP00000322003:R1205L	R	+	2	0	EFCAB5	25443063	1.000000	0.71417	0.997000	0.53966	0.991000	0.79684	3.809000	0.55606	2.709000	0.92574	0.655000	0.94253	CGA	EFCAB5	-	NULL	ENSG00000176927		0.423	EFCAB5-003	KNOWN	basic|appris_principal|CCDS	protein_coding	EFCAB5	HGNC	protein_coding	OTTHUMT00000256120.4		0.00	47	0	G	NM_198529		28418937	+1			no_errors	ENST00000394835	ensembl	human	known	74_37	missense	5.26	36	2	SNP	0.997	T
EHBP1L1	254102	genome.wustl.edu	37	11	65346828	65346828	+	Missense_Mutation	SNP	C	C	T	rs367950334		TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr11:65346828C>T	ENST00000309295.4	+	3	444	c.179C>T	c.(178-180)cCg>cTg	p.P60L		NM_001099409.1	NP_001092879.1	Q8N3D4	EH1L1_HUMAN	EH domain binding protein 1-like 1	60						membrane (GO:0016020)				central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(3)|lung(6)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	23						AGCTGGCAGCCGGGCATCCAG	0.582													C|||	1	0.000199681	0.0	0.0	5008	,	,		15098	0.001		0.0	False		,,,				2504	0.0																0								C	LEU/PRO	1,4069		0,1,2034	26.0	30.0	29.0		179	5.2	1.0	11		29	0,8334		0,0,4167	no	missense	EHBP1L1	NM_001099409.1	98	0,1,6201	TT,TC,CC		0.0,0.0246,0.0081	probably-damaging	60/1524	65346828	1,12403	2035	4167	6202	SO:0001583	missense	0			AL834433	CCDS44649.1	11q13.1	2008-02-05			ENSG00000173442	ENSG00000173442			30682	protein-coding gene	gene with protein product							Standard	NM_001099409		Approved	DKFZp762C186, TANGERIN	uc001oeo.4	Q8N3D4	OTTHUMG00000166520	ENST00000309295.4:c.179C>T	11.37:g.65346828C>T	ENSP00000312671:p.Pro60Leu		Q8TB89|Q9H7M7	Missense_Mutation	SNP	pfam_DUF3585,pfam_CH-domain,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,pfscan_CH-domain	p.P60L	ENST00000309295.4	37	c.179	CCDS44649.1	11	.	.	.	.	.	.	.	.	.	.	C	34	5.403237	0.96051	2.46E-4	0.0	ENSG00000173442	ENST00000309295;ENST00000533237	T;T	0.41758	0.99;0.99	5.18	5.18	0.71444	.	0.000000	0.64402	D	0.000005	T	0.67692	0.2920	M	0.85197	2.74	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.73335	-0.4015	10	0.87932	D	0	.	14.1742	0.65529	0.0:1.0:0.0:0.0	.	60	Q8N3D4	EH1L1_HUMAN	L	60	ENSP00000312671:P60L;ENSP00000431996:P60L	ENSP00000312671:P60L	P	+	2	0	EHBP1L1	65103404	1.000000	0.71417	0.993000	0.49108	0.993000	0.82548	6.717000	0.74707	2.435000	0.82474	0.491000	0.48974	CCG	EHBP1L1	-	NULL	ENSG00000173442		0.582	EHBP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EHBP1L1	HGNC	protein_coding	OTTHUMT00000390145.1		0.00	23	0	C	XM_170658		65346828	+1			no_errors	ENST00000309295	ensembl	human	known	74_37	missense	17.65	14	3	SNP	0.999	T
EHHADH	1962	genome.wustl.edu	37	3	184922287	184922287	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr3:184922287C>A	ENST00000231887.3	-	6	902	c.827G>T	c.(826-828)aGg>aTg	p.R276M	EHHADH_ENST00000456310.1_Missense_Mutation_p.R180M	NM_001166415.1|NM_001966.3	NP_001159887.1|NP_001957.2	Q08426	ECHP_HUMAN	enoyl-CoA, hydratase/3-hydroxyacyl CoA dehydrogenase	276	Enoyl-CoA hydratase / isomerase.				fatty acid beta-oxidation (GO:0006635)|internal protein amino acid acetylation (GO:0006475)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|peroxisome (GO:0005777)	3-hydroxyacyl-CoA dehydrogenase activity (GO:0003857)|coenzyme binding (GO:0050662)|dodecenoyl-CoA delta-isomerase activity (GO:0004165)|enoyl-CoA hydratase activity (GO:0004300)|enzyme binding (GO:0019899)|receptor binding (GO:0005102)			breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(9)|ovary(3)|prostate(2)|skin(3)	24	all_cancers(143;4.04e-11)|Ovarian(172;0.0339)|Breast(254;0.247)		Epithelial(37;1.98e-32)|OV - Ovarian serous cystadenocarcinoma(80;5.55e-21)			ATTTGCTTTCCTTTCAGCGAA	0.493																																																	0													129.0	127.0	128.0					3																	184922287		2203	4300	6503	SO:0001583	missense	0			L07077	CCDS33901.1, CCDS54694.1	3q26.3-q28	2012-07-13	2010-04-30		ENSG00000113790	ENSG00000113790	4.2.1.17, 1.1.1.35, 5.3.3.8		3247	protein-coding gene	gene with protein product		607037	"""enoyl-Coenzyme A, hydratase/3-hydroxyacyl Coenzyme A dehydrogenase"""	ECHD		8188243	Standard	NM_001966		Approved		uc003fpf.3	Q08426	OTTHUMG00000156698	ENST00000231887.3:c.827G>T	3.37:g.184922287C>A	ENSP00000231887:p.Arg276Met		A8K6Y3|B4DWG3|D3DNU0|Q58EZ5	Missense_Mutation	SNP	pfam_Crotonase_core_superfam,pfam_3-OHacyl-CoA_DH_NAD-bd,pfam_3HC_DH_C,superfamily_6-PGluconate_DH_C-like	p.R276M	ENST00000231887.3	37	c.827	CCDS33901.1	3	.	.	.	.	.	.	.	.	.	.	C	16.09	3.023880	0.54683	.	.	ENSG00000113790	ENST00000537544;ENST00000231887;ENST00000456310	T;T	0.72942	-0.7;-0.7	5.53	0.294	0.15747	.	0.211576	0.46442	D	0.000284	D	0.83408	0.5248	M	0.91354	3.2	0.80722	D	1	D	0.71674	0.998	D	0.65773	0.938	T	0.83295	-0.0031	10	0.87932	D	0	-8.068	9.7337	0.40376	0.0:0.6222:0.0:0.3778	.	276	Q08426	ECHP_HUMAN	M	276;276;180	ENSP00000231887:R276M;ENSP00000387746:R180M	ENSP00000231887:R276M	R	-	2	0	EHHADH	186404981	0.496000	0.26059	0.154000	0.22540	0.500000	0.33767	0.998000	0.29744	0.000000	0.14550	0.650000	0.86243	AGG	EHHADH	-	NULL	ENSG00000113790		0.493	EHHADH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EHHADH	HGNC	protein_coding	OTTHUMT00000345326.1		0.00	34	0	C			184922287	-1			no_errors	ENST00000231887	ensembl	human	known	74_37	missense	12.50	21	3	SNP	0.716	A
EIF3L	51386	genome.wustl.edu	37	22	38251609	38251609	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr22:38251609C>T	ENST00000412331.2	+	4	913	c.331C>T	c.(331-333)Cct>Tct	p.P111S	EIF3L_ENST00000476955.1_Intron|EIF3L_ENST00000381683.6_Missense_Mutation_p.P111S|EIF3L_ENST00000406934.1_Intron	NM_016091.3	NP_057175.1			eukaryotic translation initiation factor 3, subunit L											kidney(2)|large_intestine(3)|lung(4)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	15						CAAGAATACACCTTGGCCCGA	0.428																																																	0													68.0	65.0	66.0					22																	38251609		2203	4300	6503	SO:0001583	missense	0			AF083243	CCDS13960.1, CCDS56230.1	22q	2012-12-20	2009-01-07	2009-01-07	ENSG00000100129	ENSG00000100129			18138	protein-coding gene	gene with protein product			"""eukaryotic translation initiation factor 3, subunit 6 interacting protein"", ""eukaryotic translation initiation factor 3, subunit E interacting protein"""	EIF3S6IP, EIF3EIP		11042152, 11590142	Standard	NM_016091		Approved	HSPC021, HSPC025, EIF3S11	uc003auf.3	Q9Y262	OTTHUMG00000150671	ENST00000412331.2:c.331C>T	22.37:g.38251609C>T	ENSP00000416892:p.Pro111Ser			Missense_Mutation	SNP	pfam_eIF3l	p.P111S	ENST00000412331.2	37	c.331	CCDS13960.1	22	.	.	.	.	.	.	.	.	.	.	C	15.34	2.804821	0.50315	.	.	ENSG00000100129	ENST00000412331;ENST00000425539;ENST00000414316;ENST00000381683;ENST00000262832;ENST00000451427	T;T	0.44083	0.97;0.93	5.07	5.07	0.68467	.	0.000000	0.85682	D	0.000000	T	0.34687	0.0906	L	0.41632	1.29	0.80722	D	1	B;B;B	0.29481	0.245;0.033;0.004	B;B;B	0.20955	0.032;0.026;0.01	T	0.10989	-1.0606	10	0.18710	T	0.47	-12.389	18.8147	0.92072	0.0:1.0:0.0:0.0	.	111;111;154	B4DYB2;Q9Y262;B0QY89	.;EIF3L_HUMAN;.	S	111;154;128;111;111;87	ENSP00000416892:P111S;ENSP00000371099:P111S	ENSP00000262832:P111S	P	+	1	0	EIF3L	36581555	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.104000	0.77024	2.502000	0.84385	0.561000	0.74099	CCT	EIF3L	-	NULL	ENSG00000100129		0.428	EIF3L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EIF3L	HGNC	protein_coding	OTTHUMT00000319551.2	-	0.00	27	0	C	NM_016091		38251609	+1	tier1	-	no_errors	ENST00000412331	ensembl	human	known	74_37	missense	20.00	12	3	SNP	1.000	T
EIF4G3	8672	genome.wustl.edu	37	1	21307562	21307562	+	Frame_Shift_Del	DEL	C	C	-	rs559259798		TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr1:21307562delC	ENST00000264211.8	-	3	383	c.189delG	c.(187-189)gggfs	p.G63fs	EIF4G3_ENST00000356916.3_Frame_Shift_Del_p.G74fs|EIF4G3_ENST00000400422.1_Frame_Shift_Del_p.G63fs|EIF4G3_ENST00000602326.1_Frame_Shift_Del_p.G70fs|EIF4G3_ENST00000374937.3_Frame_Shift_Del_p.G70fs|EIF4G3_ENST00000374935.3_Frame_Shift_Del_p.G63fs|EIF4G3_ENST00000374927.4_Frame_Shift_Del_p.G63fs	NM_003760.4	NP_003751.2	O43432	IF4G3_HUMAN	eukaryotic translation initiation factor 4 gamma, 3	63					cytokine-mediated signaling pathway (GO:0019221)|positive regulation of meiosis I (GO:0060903)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of translation (GO:0045727)|regulation of translational initiation (GO:0006446)|spermatogenesis (GO:0007283)|viral process (GO:0016032)	cytosol (GO:0005829)|eukaryotic translation initiation factor 4F complex (GO:0016281)	poly(A) RNA binding (GO:0044822)|RNA cap binding (GO:0000339)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)			endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(18)|lung(20)|ovary(1)|prostate(4)|skin(3)|stomach(1)|urinary_tract(3)	70		all_lung(284;2.61e-06)|Lung NSC(340;2.81e-06)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00149)|Ovarian(437;0.00338)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.023)|COAD - Colon adenocarcinoma(152;5.42e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000327)|GBM - Glioblastoma multiforme(114;0.000696)|Kidney(64;0.0018)|STAD - Stomach adenocarcinoma(196;0.00644)|KIRC - Kidney renal clear cell carcinoma(64;0.0185)|READ - Rectum adenocarcinoma(331;0.124)|Lung(427;0.191)		AGTACTGAGGCCCCTGGGGCA	0.532																																																	0													100.0	88.0	92.0					1																	21307562		2203	4300	6503	SO:0001589	frameshift_variant	0			AF012072	CCDS214.1, CCDS55580.1, CCDS59192.1, CCDS72723.1	1p36.12	2008-02-05			ENSG00000075151	ENSG00000075151			3298	protein-coding gene	gene with protein product		603929				9418880	Standard	NM_001198801		Approved	eIF4GII	uc001bef.3	O43432	OTTHUMG00000002624	ENST00000264211.8:c.189delG	1.37:g.21307562delC	ENSP00000264211:p.Gly63fs		B9EGQ7|Q15597|Q504Z1|Q5SWC3|Q8NEN1	Frame_Shift_Del	DEL	pfam_MIF4G-like_typ-3,pfam_Initiation_fac_eIF4g_MI,pfam_W2_domain,superfamily_ARM-type_fold,smart_MIF4G-like_typ-3,smart_Initiation_fac_eIF4g_MI,smart_W2_domain	p.P71fs	ENST00000264211.8	37	c.210	CCDS214.1	1																																																																																			EIF4G3	-	NULL	ENSG00000075151		0.532	EIF4G3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	EIF4G3	HGNC	protein_coding	OTTHUMT00000007467.3		0.00	42	0	C	NM_003760		21307562	-1	tier1		no_errors	ENST00000374937	ensembl	human	known	74_37	frame_shift_del	6.90	27	2	DEL	0.649	-
EIF5B	9669	genome.wustl.edu	37	2	99984963	99984963	+	Missense_Mutation	SNP	A	A	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr2:99984963A>T	ENST00000289371.6	+	7	1498	c.1296A>T	c.(1294-1296)gaA>gaT	p.E432D		NM_015904.3	NP_056988.3	O60841	IF2P_HUMAN	eukaryotic translation initiation factor 5B	432					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|regulation of translational initiation (GO:0006446)|translation (GO:0006412)|translational initiation (GO:0006413)	cytosol (GO:0005829)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)|translation initiation factor activity (GO:0003743)			breast(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(13)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	31						CAGGTGTTGAAGTGCCATCAA	0.358																																					Colon(162;2388 2567 2705 3444)												0													88.0	79.0	82.0					2																	99984963		1826	4086	5912	SO:0001583	missense	0			AF078035	CCDS42721.1	2q11.2	2012-09-20			ENSG00000158417	ENSG00000158417			30793	protein-coding gene	gene with protein product	"""translation initiation factor IF2"""	606086				10200264, 10432305	Standard	XM_005264075		Approved	IF2, KIAA0741, DKFZp434I036, FLJ10524	uc002tab.3	O60841	OTTHUMG00000153242	ENST00000289371.6:c.1296A>T	2.37:g.99984963A>T	ENSP00000289371:p.Glu432Asp		O95805|Q53RV7|Q53SI8|Q9UF81|Q9UMN7	Missense_Mutation	SNP	pfam_EF_GTP-bd_dom,pfam_TIF_IF2_dom3,pfam_Transl_elong_EFTu/EF1A_2,superfamily_P-loop_NTPase,superfamily_Transl_B-barrel,superfamily_TIF_IF2_dom3,prints_EF_GTP-bd_dom,tigrfam_Small_GTP-bd_dom	p.E432D	ENST00000289371.6	37	c.1296	CCDS42721.1	2	.	.	.	.	.	.	.	.	.	.	A	13.05	2.122493	0.37436	.	.	ENSG00000158417	ENST00000289371	T	0.46063	0.88	5.41	5.41	0.78517	.	.	.	.	.	T	0.57740	0.2074	M	0.69185	2.1	0.58432	D	0.999998	D	0.64830	0.994	D	0.70716	0.97	T	0.59380	-0.7465	8	.	.	.	-32.6439	8.2645	0.31806	0.8507:0.0:0.1493:0.0	.	432	O60841	IF2P_HUMAN	D	432	ENSP00000289371:E432D	.	E	+	3	2	EIF5B	99351395	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.083000	0.50136	2.171000	0.68590	0.533000	0.62120	GAA	EIF5B	-	NULL	ENSG00000158417		0.358	EIF5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EIF5B	HGNC	protein_coding	OTTHUMT00000330364.2		0.00	32	0	A	NM_015904		99984963	+1			no_errors	ENST00000289371	ensembl	human	known	74_37	missense	11.76	15	2	SNP	1.000	T
ENPP4	22875	genome.wustl.edu	37	6	46107441	46107441	+	Silent	SNP	C	C	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr6:46107441C>T	ENST00000321037.4	+	2	351	c.121C>T	c.(121-123)Ctg>Ttg	p.L41L		NM_014936.4	NP_055751.1	Q9Y6X5	ENPP4_HUMAN	ectonucleotide pyrophosphatase/phosphodiesterase 4 (putative)	41					blood coagulation (GO:0007596)|positive regulation of blood coagulation (GO:0030194)|purine ribonucleoside catabolic process (GO:0046130)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	bis(5'-adenosyl)-triphosphatase activity (GO:0047710)|metal ion binding (GO:0046872)	p.L41L(1)		central_nervous_system(1)|large_intestine(2)|lung(7)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	18						AGCTGATTATCTGAAGAACTA	0.338																																																	1	Substitution - coding silent(1)	lung(1)											71.0	74.0	73.0					6																	46107441		2201	4297	6498	SO:0001819	synonymous_variant	0			AB020686	CCDS34468.1	6p12.3	2010-06-24	2010-06-24		ENSG00000001561	ENSG00000001561			3359	protein-coding gene	gene with protein product						11027689	Standard	NM_014936		Approved	NPP4, KIAA0879	uc003oxy.3	Q9Y6X5	OTTHUMG00000014779	ENST00000321037.4:c.121C>T	6.37:g.46107441C>T			A8K5G1|Q7L2N1	Silent	SNP	pfam_Phosphodiest/P_Trfase,pfam_Sulfatase,superfamily_Alkaline_phosphatase_core	p.L41	ENST00000321037.4	37	c.121	CCDS34468.1	6																																																																																			ENPP4	-	pfam_Phosphodiest/P_Trfase,superfamily_Alkaline_phosphatase_core	ENSG00000001561		0.338	ENPP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENPP4	HGNC	protein_coding	OTTHUMT00000040777.2		0.00	46	0	C			46107441	+1			no_errors	ENST00000321037	ensembl	human	known	74_37	silent	11.11	16	2	SNP	1.000	T
ENPP6	133121	genome.wustl.edu	37	4	185012359	185012359	+	Missense_Mutation	SNP	C	C	T	rs146403093		TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr4:185012359C>T	ENST00000296741.2	-	8	1435	c.1294G>A	c.(1294-1296)Gca>Aca	p.A432T		NM_153343.3	NP_699174.1	Q6UWR7	ENPP6_HUMAN	ectonucleotide pyrophosphatase/phosphodiesterase 6	432					choline metabolic process (GO:0019695)|lipid catabolic process (GO:0016042)|lipid metabolic process (GO:0006629)	anchored component of membrane (GO:0031225)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	glycerophosphocholine cholinephosphodiesterase activity (GO:0047390)|glycerophosphodiester phosphodiesterase activity (GO:0008889)|phosphoric diester hydrolase activity (GO:0008081)			breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(5)|skin(2)	15		all_lung(41;7.99e-12)|Lung NSC(41;1.46e-11)|Colorectal(36;0.00435)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|all_hematologic(60;0.0749)		all cancers(43;4.98e-27)|Epithelial(43;3.15e-24)|OV - Ovarian serous cystadenocarcinoma(60;4.09e-12)|Colorectal(24;3.78e-05)|STAD - Stomach adenocarcinoma(60;4.5e-05)|COAD - Colon adenocarcinoma(29;0.000154)|GBM - Glioblastoma multiforme(59;0.000167)|BRCA - Breast invasive adenocarcinoma(30;0.000378)|LUSC - Lung squamous cell carcinoma(40;0.0151)		AGAATCAGTGCCAGGGCACAG	0.552																																																	0								C	THR/ALA	5,4401	9.9+/-24.2	0,5,2198	68.0	72.0	71.0		1294	3.2	0.8	4	dbSNP_134	71	0,8600		0,0,4300	no	missense	ENPP6	NM_153343.3	58	0,5,6498	TT,TC,CC		0.0,0.1135,0.0384	possibly-damaging	432/441	185012359	5,13001	2203	4300	6503	SO:0001583	missense	0			AK057370	CCDS3834.1	4q35.1	2008-02-05			ENSG00000164303	ENSG00000164303			23409	protein-coding gene	gene with protein product							Standard	NM_153343		Approved	MGC33971	uc003iwc.3	Q6UWR7	OTTHUMG00000160617	ENST00000296741.2:c.1294G>A	4.37:g.185012359C>T	ENSP00000296741:p.Ala432Thr		Q4W5Q1|Q96M57	Missense_Mutation	SNP	pfam_Phosphodiest/P_Trfase,superfamily_Alkaline_phosphatase_core	p.A432T	ENST00000296741.2	37	c.1294	CCDS3834.1	4	.	.	.	.	.	.	.	.	.	.	C	14.65	2.598520	0.46318	0.001135	0.0	ENSG00000164303	ENST00000296741	T	0.75477	-0.94	5.98	3.2	0.36748	.	3.750420	0.01065	N	0.004711	T	0.64768	0.2628	L	0.28274	0.84	0.21499	N	0.999668	B	0.14012	0.009	B	0.09377	0.004	T	0.47560	-0.9108	10	0.25751	T	0.34	-13.8217	8.5822	0.33634	0.0:0.6318:0.236:0.1321	.	432	Q6UWR7	ENPP6_HUMAN	T	432	ENSP00000296741:A432T	ENSP00000296741:A432T	A	-	1	0	ENPP6	185249353	0.889000	0.30405	0.828000	0.32881	0.005000	0.04900	0.617000	0.24359	0.842000	0.35045	-0.229000	0.12294	GCA	ENPP6	-	NULL	ENSG00000164303		0.552	ENPP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENPP6	HGNC	protein_coding	OTTHUMT00000361428.1		0.00	33	0	C	NM_153343		185012359	-1			no_errors	ENST00000296741	ensembl	human	known	74_37	missense	13.33	13	2	SNP	0.462	T
LOC285766	285766	genome.wustl.edu	37	6	203769	203769	+	lincRNA	SNP	A	A	G			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr6:203769A>G	ENST00000580119.1	-	0	598				RP3-416J7.5_ENST00000381078.1_lincRNA																							cccagtcagtattgtctgcag	0.498																																																	0																																												0																															6.37:g.203769A>G				RNA	SNP	-	NULL	ENST00000580119.1	37	NULL		6	.	.	.	.	.	.	.	.	.	.	A	2.808	-0.247651	0.05867	.	.	ENSG00000205653	ENST00000381078	.	.	.	1.88	-2.18	0.07037	.	.	.	.	.	T	0.26484	0.0647	.	.	.	0.21064	N	0.999794	.	.	.	.	.	.	T	0.29088	-1.0023	4	0.87932	D	0	.	5.8766	0.18832	0.4536:0.0:0.5464:0.0	.	.	.	.	V	113	.	ENSP00000370468:I113V	I	+	1	0	AL035696.1	148769	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.040000	0.13905	-0.579000	0.05952	-0.456000	0.05471	ATT	RP3-416J7.5	-	-	ENSG00000205653		0.498	RP3-416J7.4-001	KNOWN	basic	lincRNA	ENSG00000205653	Clone_based_vega_gene	lincRNA	OTTHUMT00000445711.1	-	0.00	40	0	A			203769	+1	tier1	-	no_errors	ENST00000381078	ensembl	human	known	74_37	rna	15.79	16	3	SNP	0.000	G
AP001024.1	0	genome.wustl.edu	37	11	107650471	107650471	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr11:107650471C>T	ENST00000398067.1	+	2	229	c.229C>T	c.(229-231)Ccg>Tcg	p.P77S																								ccgcgcctggccGGGACCCCA	0.502																																																	0																																										SO:0001583	missense	0																														ENST00000398067.1:c.229C>T	11.37:g.107650471C>T	ENSP00000381142:p.Pro77Ser			Missense_Mutation	SNP	NULL	p.P77S	ENST00000398067.1	37	c.229		11	.	.	.	.	.	.	.	.	.	.	C	3.831	-0.035834	0.07497	.	.	ENSG00000214305	ENST00000398067	T	0.05855	3.38	0.235	-0.47	0.12131	.	.	.	.	.	T	0.05547	0.0146	.	.	.	.	.	.	.	.	.	.	.	.	T	0.38607	-0.9653	4	0.59425	D	0.04	.	.	.	.	.	.	.	.	S	77	ENSP00000381142:P77S	ENSP00000381142:P77S	P	+	1	0	AP001024.1	107155681	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.906000	0.01590	-2.235000	0.00714	-2.281000	0.00270	CCG	AP001024.1	-	NULL	ENSG00000214305		0.502	AP001024.1-201	NOVEL	basic|appris_principal	protein_coding	ENSG00000214305	Clone_based_ensembl_gene	protein_coding		-	0.00	22	0	C			107650471	+1	tier1	-	no_errors	ENST00000398067	ensembl	human	novel	74_37	missense	21.43	11	3	SNP	0.000	T
RP11-483E23.2	0	genome.wustl.edu	37	15	28599774	28599774	+	RNA	SNP	C	C	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr15:28599774C>T	ENST00000568624.1	-	0	537																											TCTAACTCTCCTGCAAACTTC	0.567																																																	0																																												0																															15.37:g.28599774C>T				RNA	SNP	-	NULL	ENST00000568624.1	37	NULL		15	.	.	.	.	.	.	.	.	.	.	.	4.026	0.002348	0.07819	.	.	ENSG00000237850	ENST00000454724;ENST00000424531	.	.	.	.	.	.	.	.	.	.	.	T	0.36276	0.0961	.	.	.	.	.	.	P	0.45715	0.865	P	0.46585	0.521	T	0.44128	-0.9348	4	0.28530	T	0.3	.	.	.	.	.	157	B4DY83	.	R	163;161	.	ENSP00000393266:G161R	G	-	1	0	AC091304.2	26273369	0.850000	0.29656	0.116000	0.21606	0.118000	0.20060	0.313000	0.19415	0.159000	0.19401	0.162000	0.16502	GGA	RP11-483E23.2	-	-	ENSG00000237850		0.567	RP11-483E23.2-002	KNOWN	basic	processed_transcript	ENSG00000237850	Clone_based_vega_gene	pseudogene	OTTHUMT00000431212.1	-	0.00	58	0	C			28599774	-1	tier1	-	no_errors	ENST00000568624	ensembl	human	known	74_37	rna	13.64	19	3	SNP	0.916	T
SEC16B	89866	genome.wustl.edu	37	1	177898865	177898865	+	3'UTR	SNP	G	G	A			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr1:177898865G>A	ENST00000308284.6	-	0	3400				RP4-798P15.3_ENST00000354921.3_RNA|SEC16B_ENST00000495165.1_5'UTR	NM_033127.2	NP_149118.2	Q96JE7	SC16B_HUMAN	SEC16 homolog B (S. cerevisiae)						COPII vesicle coating (GO:0048208)|endoplasmic reticulum organization (GO:0007029)|peroxisome fission (GO:0016559)|peroxisome organization (GO:0007031)|positive regulation of gene expression (GO:0010628)|positive regulation of protein exit from endoplasmic reticulum (GO:0070863)|protein localization to endoplasmic reticulum (GO:0070972)|protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|Golgi membrane (GO:0000139)|intracellular membrane-bounded organelle (GO:0043231)				central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(7)|lung(14)|ovary(3)|skin(1)|stomach(1)	35						CTAAGTGCCCGGTGGAGGCAT	0.473																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AK090411	CCDS44281.1	1q25.2	2012-10-08	2007-06-20	2007-06-20	ENSG00000120341	ENSG00000120341			30301	protein-coding gene	gene with protein product	"""regucalcin gene promotor region related protein"""	612855	"""leucine zipper transcription regulator 2"""	LZTR2		11572484, 11605020	Standard	NM_033127		Approved	RGPR, PGPR-p117	uc001gli.1	Q96JE7	OTTHUMG00000167206	ENST00000308284.6:c.*128C>T	1.37:g.177898865G>A			A3EYF1|Q5HYF6|Q8N7D6|Q96GX6	RNA	SNP	-	NULL	ENST00000308284.6	37	NULL	CCDS44281.1	1																																																																																			RP4-798P15.3	-	-	ENSG00000254154		0.473	SEC16B-004	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000254154	Clone_based_vega_gene	protein_coding	OTTHUMT00000084773.16	-	0.00	60	0	G	NM_033127		177898865	-1	tier1	-	no_errors	ENST00000354921	ensembl	human	known	74_37	rna	15.62	27	5	SNP	0.000	A
BRMS1L	84312	genome.wustl.edu	37	14	36295691	36295691	+	5'UTR	SNP	C	C	A			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr14:36295691C>A	ENST00000216807.7	+	0	168				BRMS1L_ENST00000543183.1_5'UTR|RP11-317N8.5_ENST00000555918.1_RNA	NM_032352.3	NP_115728.2	Q5PSV4	BRM1L_HUMAN	breast cancer metastasis-suppressor 1-like						regulation of growth (GO:0040008)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				breast(1)|cervix(1)|endometrium(2)|kidney(1)|lung(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	9	Breast(36;0.137)|Hepatocellular(127;0.158)		Lung(8;1.7e-07)|LUAD - Lung adenocarcinoma(9;3e-07)|Epithelial(34;0.00467)|all cancers(34;0.0157)|BRCA - Breast invasive adenocarcinoma(188;0.158)	GBM - Glioblastoma multiforme(112;0.0333)		GGGCTGGGCGCCGGTAGTGGA	0.672																																																	0													16.0	14.0	14.0					14																	36295691		2139	4216	6355	SO:0001623	5_prime_UTR_variant	0			AK096496	CCDS32066.1	14q13.1	2005-09-22	2003-12-02	2003-12-03		ENSG00000100916			20512	protein-coding gene	gene with protein product			"""breast cancer metastasis-suppressor 1"""	BRMS1			Standard	XM_005268128		Approved	MGC11296, FLJ39177	uc001wtl.3	Q5PSV4		ENST00000216807.7:c.-32C>A	14.37:g.36295691C>A			A6NFW5|A6NH45|B2RD65|Q9BRI4	RNA	SNP	-	NULL	ENST00000216807.7	37	NULL	CCDS32066.1	14																																																																																			RP11-317N8.5	-	-	ENSG00000258938		0.672	BRMS1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000258938	Clone_based_vega_gene	protein_coding	OTTHUMT00000409601.2	-	0.00	78	0	C	NM_032352		36295691	-1	tier1	-	no_errors	ENST00000555918	ensembl	human	known	74_37	rna	31.71	28	13	SNP	0.995	A
AC015849.16	0	genome.wustl.edu	37	17	34236062	34236062	+	lincRNA	SNP	G	G	A			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr17:34236062G>A	ENST00000587132.1	-	0	1965																											CTTGATCTTGGCTTGGTGTTG	0.512																																																	0																																												0																															17.37:g.34236062G>A				RNA	SNP	-	NULL	ENST00000587132.1	37	NULL		17																																																																																			AC015849.16	-	-	ENSG00000266999		0.512	AC015849.16-001	KNOWN	basic	lincRNA	ENSG00000266999	Clone_based_vega_gene	lincRNA	OTTHUMT00000449325.1	-	0.00	28	0	G			34236062	-1	tier1	-	no_errors	ENST00000587132	ensembl	human	known	74_37	rna	15.79	16	3	SNP	0.000	A
SEPP1	6414	genome.wustl.edu	37	5	42806831	42806831	+	Intron	SNP	G	G	C			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr5:42806831G>C	ENST00000514985.1	-	3	673				SEPP1_ENST00000509276.1_Intron|SEPP1_ENST00000506577.1_Intron|SEPP1_ENST00000507920.1_Intron|SEPP1_ENST00000511224.1_Intron|CTD-2325A15.5_ENST00000606056.1_RNA	NM_005410.2	NP_005401.3	P49908	SEPP1_HUMAN	selenoprotein P, plasma, 1						brain development (GO:0007420)|growth (GO:0040007)|locomotory behavior (GO:0007626)|post-embryonic development (GO:0009791)|response to oxidative stress (GO:0006979)|selenium compound metabolic process (GO:0001887)|sexual reproduction (GO:0019953)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	selenium binding (GO:0008430)			kidney(10)|large_intestine(1)|lung(4)	15						caaaaataaggagtgattttt	0.328																																																	0																																										SO:0001627	intron_variant	0			BC040075	CCDS43311.1	5q31	2012-03-01				ENSG00000250722			10751	protein-coding gene	gene with protein product		601484				8421687	Standard	NM_001085486		Approved	SeP	uc011cpu.2	P49908		ENST00000514985.1:c.416+166C>G	5.37:g.42806831G>C			Q6PD59|Q6PI43|Q6PI87|Q6PJF9	RNA	SNP	-	NULL	ENST00000514985.1	37	NULL	CCDS43311.1	5																																																																																			CTD-2325A15.5	-	-	ENSG00000272234		0.328	SEPP1-001	KNOWN	basic|appris_principal|CCDS|seleno	protein_coding	ENSG00000272234	Clone_based_vega_gene	protein_coding	OTTHUMT00000367483.1	-	0.00	11	0	G	NM_005410		42806831	+1	tier1	-	no_errors	ENST00000606056	ensembl	human	known	74_37	rna	50.00	4	4	SNP	0.001	C
RGL4	266747	genome.wustl.edu	37	22	24034484	24034484	+	Intron	SNP	G	G	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr22:24034484G>T	ENST00000290691.5	+	2	1349				GUSBP11_ENST00000455485.1_RNA|KB-1572G7.2_ENST00000421064.1_RNA|AP000347.2_ENST00000417194.1_RNA|RGL4_ENST00000401461.1_Intron	NM_153615.1	NP_705843.1	Q8IZJ4	RGDSR_HUMAN	ral guanine nucleotide dissociation stimulator-like 4						small GTPase mediated signal transduction (GO:0007264)	cytoplasmic vesicle (GO:0031410)	guanyl-nucleotide exchange factor activity (GO:0005085)			endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|skin(3)	15						TGTGGGAGAAGGCCAGGCCTC	0.592																																																	0													170.0	166.0	167.0					22																	24034484		2203	4300	6503	SO:0001627	intron_variant	0				CCDS13811.1	22q11.23	2008-02-22			ENSG00000159496	ENSG00000159496			31911	protein-coding gene	gene with protein product	"""RalGDS related oncogene"""	612214				9178890, 10851075	Standard	NM_153615		Approved	Rgr	uc002zxn.3	Q8IZJ4	OTTHUMG00000150711	ENST00000290691.5:c.180-38G>T	22.37:g.24034484G>T			Q495L8	RNA	SNP	-	NULL	ENST00000290691.5	37	NULL	CCDS13811.1	22																																																																																			AP000347.2	-	-	ENSG00000272578		0.592	RGL4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ENSG00000272578	Clone_based_vega_gene	protein_coding	OTTHUMT00000319711.1	-	0.00	42	0	G	NM_153615		24034484	-1	tier1	-	no_errors	ENST00000417194	ensembl	human	known	74_37	rna	9.09	40	4	SNP	0.003	T
EPDR1	54749	genome.wustl.edu	37	7	37960276	37960276	+	5'UTR	SNP	A	A	G			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr7:37960276A>G	ENST00000199448.4	+	0	114				EPDR1_ENST00000425345.1_5'Flank|EPDR1_ENST00000476620.1_Intron|EPDR1_ENST00000559325.1_Missense_Mutation_p.Q32R|EPDR1_ENST00000423717.1_5'UTR	NM_017549.4	NP_060019.2	Q9UM22	EPDR1_HUMAN	ependymin related 1						cell-matrix adhesion (GO:0007160)	extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	calcium ion binding (GO:0005509)			breast(1)|endometrium(1)|large_intestine(2)|lung(9)|ovary(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	22						CAGTGGCAGCAGGCAGTGGCA	0.642																																																	0													20.0	24.0	23.0					7																	37960276		2203	4299	6502	SO:0001623	5_prime_UTR_variant	0			BC018299	CCDS5454.1, CCDS5454.2, CCDS59051.1, CCDS59052.1	7p14.1	2013-07-31	2013-07-31		ENSG00000086289	ENSG00000086289			17572	protein-coding gene	gene with protein product			"""ependymin related protein 1 (zebrafish)"""			11749721, 11248421	Standard	NM_001242946		Approved	MERP-1, MERP1, UCC1, EPDR	uc003tfp.4	Q9UM22	OTTHUMG00000102187	ENST00000199448.4:c.-266A>G	7.37:g.37960276A>G			A8K4C0|C9JYS3|Q06BL0|Q99M77	Missense_Mutation	SNP	pfam_Ependymin,smart_Ependymin,prints_Ependymin	p.Q32R	ENST00000199448.4	37	c.95	CCDS5454.2	7	.	.	.	.	.	.	.	.	.	.	A	8.338	0.828048	0.16749	.	.	ENSG00000086289	ENST00000199448;ENST00000423717	.	.	.	0.14	0.14	0.14804	.	.	.	.	.	T	0.18800	0.0451	N	0.08118	0	0.18873	N	0.999985	.	.	.	.	.	.	T	0.23762	-1.0179	5	0.56958	D	0.05	.	.	.	.	.	32	A4D1W8	.	R	32;6	.	ENSP00000199448:Q32R	Q	+	2	0	EPDR1	37926801	0.087000	0.21565	0.076000	0.20297	0.142000	0.21351	0.222000	0.17699	0.157000	0.19338	0.155000	0.16302	CAG	EPDR1	-	NULL	ENSG00000086289		0.642	EPDR1-001	KNOWN	upstream_uORF|basic|appris_principal|CCDS	protein_coding	EPDR1	HGNC	protein_coding	OTTHUMT00000220037.3	-	0.00	76	0	A	NM_017549		37960276	+1	tier1	-	no_errors	ENST00000559325	ensembl	human	known	74_37	missense	11.29	55	7	SNP	0.086	G
EPHB1	2047	genome.wustl.edu	37	3	134977896	134977896	+	Silent	SNP	G	G	A			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr3:134977896G>A	ENST00000398015.3	+	16	3259	c.2889G>A	c.(2887-2889)aaG>aaA	p.K963K	EPHB1_ENST00000493838.1_Silent_p.K524K	NM_004441.4	NP_004432.1	P54762	EPHB1_HUMAN	EPH receptor B1	963	SAM. {ECO:0000255|PROSITE- ProRule:PRU00184}.				angiogenesis (GO:0001525)|axon guidance (GO:0007411)|camera-type eye morphogenesis (GO:0048593)|cell chemotaxis (GO:0060326)|cell-substrate adhesion (GO:0031589)|central nervous system projection neuron axonogenesis (GO:0021952)|dendritic spine development (GO:0060996)|dendritic spine morphogenesis (GO:0060997)|detection of temperature stimulus involved in sensory perception of pain (GO:0050965)|ephrin receptor signaling pathway (GO:0048013)|establishment of cell polarity (GO:0030010)|neural precursor cell proliferation (GO:0061351)|neurogenesis (GO:0022008)|optic nerve morphogenesis (GO:0021631)|positive regulation of synapse assembly (GO:0051965)|protein autophosphorylation (GO:0046777)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of JNK cascade (GO:0046328)|retinal ganglion cell axon guidance (GO:0031290)	axon (GO:0030424)|early endosome membrane (GO:0031901)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)	ATP binding (GO:0005524)|axon guidance receptor activity (GO:0008046)|transmembrane-ephrin receptor activity (GO:0005005)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(13)|lung(63)|ovary(8)|pancreas(2)|prostate(8)|skin(7)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(2)	130						GCCATCAGAAGAAGATCCTGA	0.468																																																	0													67.0	62.0	64.0					3																	134977896		1950	4161	6111	SO:0001819	synonymous_variant	0			L40636	CCDS46921.1	3q21-q23	2013-02-11	2004-10-28			ENSG00000154928		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3392	protein-coding gene	gene with protein product		600600	"""EphB1"""	EPHT2		8666391	Standard	NM_004441		Approved	Hek6	uc003eqt.3	P54762		ENST00000398015.3:c.2889G>A	3.37:g.134977896G>A			A8K593|B3KTB2|B5A969|O43569|O95142|O95143|Q0VG87	Silent	SNP	pirsf_Tyr_kinase_ephrin_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ephrin_rcpt_lig-bd_dom,pfam_Prot_kinase_dom,pfam_Fibronectin_type3,pfam_SAM_type1,pfam_SAM_2,superfamily_Galactose-bd-like,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_SAM/pointed,superfamily_Growth_fac_rcpt_N_dom,smart_Ephrin_rcpt_lig-bd_dom,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_SAM,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_SAM,pfscan_Prot_kinase_dom	p.K963	ENST00000398015.3	37	c.2889	CCDS46921.1	3																																																																																			EPHB1	-	pirsf_Tyr_kinase_ephrin_rcpt,pfam_SAM_type1,pfam_SAM_2,superfamily_SAM/pointed,smart_SAM,pfscan_SAM	ENSG00000154928		0.468	EPHB1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	EPHB1	HGNC	protein_coding	OTTHUMT00000357671.1	-	0.00	43	0	G	NM_004441		134977896	+1	tier1	-	no_errors	ENST00000398015	ensembl	human	known	74_37	silent	20.00	16	4	SNP	1.000	A
FAM13B	51306	genome.wustl.edu	37	5	137295438	137295438	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr5:137295438C>G	ENST00000033079.3	-	13	1759	c.1308G>C	c.(1306-1308)aaG>aaC	p.K436N	FAM13B_ENST00000425075.2_Missense_Mutation_p.K318N|FAM13B_ENST00000420893.2_Missense_Mutation_p.K436N	NM_016603.2	NP_057687.2	Q9NYF5	FA13B_HUMAN	family with sequence similarity 13, member B	436					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)			endometrium(4)|kidney(2)|lung(5)	11						AATCACATATCTTGCTACTAG	0.393																																																	0													83.0	72.0	76.0					5																	137295438		2203	4300	6503	SO:0001583	missense	0			AF251038	CCDS4195.1, CCDS47269.1, CCDS47270.1	5q31	2011-09-07	2009-01-20	2009-01-20	ENSG00000031003	ENSG00000031003		"""Rho GTPase activating proteins"""	1335	protein-coding gene	gene with protein product		609371	"""chromosome 5 open reading frame 5"", ""family with sequence similarity 13, member B1"""	C5orf5, FAM13B1		11087669, 11161817	Standard	NM_016603		Approved	N61, KHCHP, ARHGAP49	uc003lbz.2	Q9NYF5	OTTHUMG00000129202	ENST00000033079.3:c.1308G>C	5.37:g.137295438C>G	ENSP00000033079:p.Lys436Asn		D3DQB5|G3V0H9|Q3ZCR0|Q6PGQ2|Q9P0I7	Missense_Mutation	SNP	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	p.K436N	ENST00000033079.3	37	c.1308	CCDS4195.1	5	.	.	.	.	.	.	.	.	.	.	C	13.46	2.244527	0.39697	.	.	ENSG00000031003	ENST00000033079;ENST00000425075;ENST00000420893	D;T;D	0.95342	-3.68;1.84;-3.68	5.57	3.77	0.43336	.	0.527835	0.21797	N	0.068974	D	0.91875	0.7428	M	0.68593	2.085	0.28925	N	0.891882	B;B;B	0.31383	0.321;0.13;0.004	B;B;B	0.32980	0.156;0.05;0.002	D	0.86564	0.1843	10	0.48119	T	0.1	0.0032	5.7668	0.18231	0.145:0.6499:0.0:0.2051	.	318;436;436	G3V0H9;Q9NYF5-2;Q9NYF5	.;.;FA13B_HUMAN	N	436;318;436	ENSP00000033079:K436N;ENSP00000394669:K318N;ENSP00000388521:K436N	ENSP00000033079:K436N	K	-	3	2	FAM13B	137323337	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	0.613000	0.24299	0.686000	0.31488	0.655000	0.94253	AAG	FAM13B	-	NULL	ENSG00000031003		0.393	FAM13B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM13B	HGNC	protein_coding	OTTHUMT00000251279.1	-	0.00	40	0	C			137295438	-1	tier1	-	no_errors	ENST00000033079	ensembl	human	known	74_37	missense	26.67	11	4	SNP	1.000	G
FAM178A	55719	genome.wustl.edu	37	10	102676648	102676648	+	Missense_Mutation	SNP	G	G	A	rs564996877		TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr10:102676648G>A	ENST00000238961.4	+	3	1048	c.506G>A	c.(505-507)cGa>cAa	p.R169Q	FAM178A_ENST00000370269.3_Missense_Mutation_p.R169Q|FAM178A_ENST00000370271.3_Missense_Mutation_p.R169Q	NM_018121.3	NP_060591.3	Q8IX21	F178A_HUMAN	family with sequence similarity 178, member A	169						chromatin (GO:0000785)|extracellular space (GO:0005615)|nucleus (GO:0005634)											AAAAAACATCGATCCCCAGAG	0.383													G|||	1	0.000199681	0.0	0.0	5008	,	,		20539	0.001		0.0	False		,,,				2504	0.0																0													58.0	58.0	58.0					10																	102676648		2203	4300	6503	SO:0001583	missense	0			AF460991	CCDS7500.1, CCDS44470.1, CCDS65918.1	10q24.31	2008-07-18	2008-07-18	2008-07-18	ENSG00000119906	ENSG00000119906			17814	protein-coding gene	gene with protein product		610348	"""chromosome 10 open reading frame 6"""	C10orf6		12459258	Standard	NM_018121		Approved	FLJ10512, FLJ25012	uc001krs.3	Q8IX21	OTTHUMG00000018919	ENST00000238961.4:c.506G>A	10.37:g.102676648G>A	ENSP00000238961:p.Arg169Gln		A8K950|B1AL17|Q5W0L8|Q6GMU6|Q9NPE8	Missense_Mutation	SNP	NULL	p.R169Q	ENST00000238961.4	37	c.506	CCDS7500.1	10	.	.	.	.	.	.	.	.	.	.	G	6.473	0.455527	0.12283	.	.	ENSG00000119906	ENST00000370271;ENST00000238961;ENST00000370269	T;T;T	0.51817	0.69;1.35;1.34	5.84	-3.49	0.04724	.	1.057950	0.07426	N	0.894930	T	0.22513	0.0543	N	0.08118	0	0.09310	N	1	B;B;B	0.20261	0.002;0.005;0.043	B;B;B	0.14578	0.003;0.003;0.011	T	0.23368	-1.0190	10	0.17832	T	0.49	0.0445	7.9306	0.29899	0.5862:0.1197:0.2941:0.0	.	169;169;169	Q8IX21;B1AL17;B1AL16	F178A_HUMAN;.;.	Q	169	ENSP00000359294:R169Q;ENSP00000238961:R169Q;ENSP00000359292:R169Q	ENSP00000238961:R169Q	R	+	2	0	FAM178A	102666638	0.000000	0.05858	0.308000	0.25141	0.188000	0.23474	-0.212000	0.09319	-0.425000	0.07371	-0.140000	0.14226	CGA	FAM178A	-	NULL	ENSG00000119906		0.383	FAM178A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FAM178A	HGNC	protein_coding	OTTHUMT00000049897.3	-	0.00	27	0	G			102676648	+1	tier1	-	no_errors	ENST00000370269	ensembl	human	known	74_37	missense	21.43	11	3	SNP	0.028	A
FAM182B	728882	genome.wustl.edu	37	20	25840388	25840388	+	Intron	SNP	C	C	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr20:25840388C>T	ENST00000376403.1	-	1	142				FAM182B_ENST00000376404.2_Intron|FAM182B_ENST00000478164.1_Intron			Q5T319	F182B_HUMAN	family with sequence similarity 182, member B											lung(1)	1						caaccaacaccgtccgggcag	0.637																																																	0																																										SO:0001627	intron_variant	0					20p11.1	2010-07-14			ENSG00000175170	ENSG00000175170			34503	pseudogene	pseudogene							Standard	NR_027061		Approved			Q5T319	OTTHUMG00000032136	ENST00000376403.1:c.236+3307G>A	20.37:g.25840388C>T			Q4G0Q1	RNA	SNP	-	NULL	ENST00000376403.1	37	NULL		20																																																																																			FAM182B	-	-	ENSG00000175170		0.637	FAM182B-003	PUTATIVE	basic|appris_candidate_longest|exp_conf	protein_coding	FAM182B	HGNC	protein_coding	OTTHUMT00000078463.2	-	0.00	20	0	C	NR_026714		25840388	-1	tier1	-	no_errors	ENST00000584356	ensembl	human	known	74_37	rna	22.22	13	4	SNP	0.019	T
FAM208B	54906	genome.wustl.edu	37	10	5804539	5804539	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr10:5804539C>G	ENST00000328090.5	+	20	7844	c.7219C>G	c.(7219-7221)Ctt>Gtt	p.L2407V	GDI2_ENST00000479928.1_5'Flank	NM_017782.4	NP_060252	Q5VWN6	F208B_HUMAN	family with sequence similarity 208, member B	2407																	TAGTGGAATCCTTGTTACAGA	0.279																																																	0													61.0	60.0	60.0					10																	5804539		1787	4049	5836	SO:0001583	missense	0			BX649177	CCDS41485.1	10p15.1	2011-09-14	2011-09-14	2011-09-14	ENSG00000108021	ENSG00000108021			23484	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 18"""	C10orf18		12477932	Standard	NM_017782		Approved	FLJ20360, bA318E3.2, KIAA2006	uc001iij.3	Q5VWN6	OTTHUMG00000017605	ENST00000328090.5:c.7219C>G	10.37:g.5804539C>G	ENSP00000328426:p.Leu2407Val		Q2YD91|Q5VWN5|Q6ZRQ8|Q8IVG4|Q9BUZ7|Q9H5J9|Q9H7A4|Q9H996|Q9NXA1	Missense_Mutation	SNP	pfam_DUF3715,pfam_DUF3699	p.L2407V	ENST00000328090.5	37	c.7219	CCDS41485.1	10	.	.	.	.	.	.	.	.	.	.	C	14.86	2.661411	0.47572	.	.	ENSG00000108021	ENST00000328090;ENST00000442808	T	0.06218	3.33	6.01	6.01	0.97437	.	0.104481	0.43260	D	0.000597	T	0.15132	0.0365	L	0.32530	0.975	0.37679	D	0.923402	D	0.89917	1.0	D	0.87578	0.998	T	0.04635	-1.0937	10	0.33940	T	0.23	.	13.2724	0.60167	0.0:0.9244:0.0:0.0756	.	2407	Q5VWN6	F208B_HUMAN	V	2407;1602	ENSP00000328426:L2407V	ENSP00000328426:L2407V	L	+	1	0	C10orf18	5844545	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	2.733000	0.47360	2.861000	0.98227	0.650000	0.86243	CTT	FAM208B	-	NULL	ENSG00000108021		0.279	FAM208B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM208B	HGNC	protein_coding	OTTHUMT00000046571.2	-	0.00	80	0	C	NM_017782		5804539	+1	tier1	-	no_errors	ENST00000328090	ensembl	human	known	74_37	missense	9.80	46	5	SNP	1.000	G
FAM228A	653140	genome.wustl.edu	37	2	24402031	24402031	+	Intron	DEL	G	G	-			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr2:24402031delG	ENST00000295150.3	+	3	248				RP11-507M3.1_ENST00000584973.1_Intron	NM_001040710.1	NP_001035800.1	Q86W67	F228A_HUMAN	family with sequence similarity 228, member A																		AAGAAGAAAAGAGATGTTACA	0.289																																																	0																																										SO:0001627	intron_variant	0				CCDS42659.1	2p23.3	2012-07-04	2012-07-04	2012-07-04	ENSG00000186453	ENSG00000186453			34418	protein-coding gene	gene with protein product			"""chromosome 2 open reading frame 84"""	C2orf84			Standard	NM_001040710		Approved	FLJ30851	uc002rfc.3	Q86W67	OTTHUMG00000151903	ENST00000295150.3:c.162+1292G>-	2.37:g.24402031delG				Frame_Shift_Del	DEL	NULL	p.E72fs	ENST00000295150.3	37	c.214	CCDS42659.1	2																																																																																			FAM228A	-	NULL	ENSG00000186453		0.289	FAM228A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM228A	HGNC	protein_coding	OTTHUMT00000324342.1		0.00	104	0	G	NM_001040710		24402031	+1	tier1		no_errors	ENST00000456591	ensembl	human	known	74_37	frame_shift_del	12.50	42	6	DEL	1.000	-
FAM230C	26080	genome.wustl.edu	37	22	21663812	21663812	+	lincRNA	SNP	A	A	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr22:21663812A>T	ENST00000436681.1	-	0	358																											CCTCATGGGGAGCTAGAAAAA	0.547																																																	0																																												0																															22.37:g.21663812A>T				RNA	SNP	-	NULL	ENST00000436681.1	37	NULL		22																																																																																			KB-1183D5.13	-	-	ENSG00000206142		0.547	KB-1183D5.13-003	KNOWN	basic	lincRNA	FAM230C	Clone_based_vega_gene	lincRNA	OTTHUMT00000320109.1	-	0.00	95	0	A			21663812	-1	tier1	-	no_errors	ENST00000436681	ensembl	human	known	74_37	rna	13.85	56	9	SNP	0.005	T
FAM57B	83723	genome.wustl.edu	37	16	30036934	30036934	+	Intron	SNP	C	C	T	rs544047026		TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr16:30036934C>T	ENST00000380495.4	-	4	1272				FAM57B_ENST00000279389.4_Intron|FAM57B_ENST00000564806.1_Missense_Mutation_p.R168H	NM_031478.4	NP_113666.2	Q71RH2	FA57B_HUMAN	family with sequence similarity 57, member B						ceramide biosynthetic process (GO:0046513)|negative regulation of fat cell differentiation (GO:0045599)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	sphingosine N-acyltransferase activity (GO:0050291)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(4)|lung(5)|upper_aerodigestive_tract(1)	14						TCAAAATGCACGGGGTGAGGG	0.642													C|||	1	0.000199681	0.0	0.0	5008	,	,		19073	0.001		0.0	False		,,,				2504	0.0																0																																										SO:0001627	intron_variant	0			AF370365	CCDS10667.2	16p11.2	2013-02-19			ENSG00000149926	ENSG00000149926			25295	protein-coding gene	gene with protein product		615175				11230166, 23275342	Standard	NM_031478		Approved	DKFZP434I2117	uc002dvt.3	Q71RH2	OTTHUMG00000132105	ENST00000380495.4:c.540+112G>A	16.37:g.30036934C>T			Q9H0J1	Missense_Mutation	SNP	pfam_TLC-dom,pfscan_TLC-dom	p.R168H	ENST00000380495.4	37	c.503	CCDS10667.2	16																																																																																			FAM57B	-	pfscan_TLC-dom	ENSG00000149926		0.642	FAM57B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM57B	HGNC	protein_coding	OTTHUMT00000255142.2	-	0.00	41	0	C	NM_031478		30036934	-1	tier1	-	no_errors	ENST00000564806	ensembl	human	novel	74_37	missense	54.55	10	12	SNP	0.000	T
FARP1	10160	genome.wustl.edu	37	13	99092956	99092956	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr13:99092956G>A	ENST00000319562.6	+	24	2927	c.2662G>A	c.(2662-2664)Gag>Aag	p.E888K	FARP1_ENST00000595437.1_Missense_Mutation_p.E919K|FARP1_ENST00000376586.2_Missense_Mutation_p.E919K	NM_005766.2	NP_005757.1	Q9Y4F1	FARP1_HUMAN	FERM, RhoGEF (ARHGEF) and pleckstrin domain protein 1 (chondrocyte-derived)	888					dendrite morphogenesis (GO:0048813)|negative regulation of phosphatase activity (GO:0010923)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|synapse assembly (GO:0007416)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite (GO:0030425)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|synapse (GO:0045202)	Rac guanyl-nucleotide exchange factor activity (GO:0030676)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(3)|endometrium(6)|kidney(6)|large_intestine(13)|lung(16)|ovary(1)|skin(3)|urinary_tract(1)	49	all_neural(89;0.0982)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)		BRCA - Breast invasive adenocarcinoma(86;0.233)			GGCTGACCAGGAGTCAGAGGA	0.627																																																	0													45.0	45.0	45.0					13																	99092956		2203	4300	6503	SO:0001583	missense	0			AB008430	CCDS9487.1, CCDS32000.1, CCDS66572.1	13q32.2	2013-01-10			ENSG00000152767	ENSG00000152767		"""Rho guanine nucleotide exchange factors"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Pleckstrin homology (PH) domain containing"""	3591	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 75"""	602654				9425278	Standard	NM_005766		Approved	CDEP, PLEKHC2, MGC87400, PPP1R75	uc001vnj.3	Q9Y4F1	OTTHUMG00000017248	ENST00000319562.6:c.2662G>A	13.37:g.99092956G>A	ENSP00000322926:p.Glu888Lys		Q5JVI9|Q6IQ29	Missense_Mutation	SNP	pfam_DH-domain,pfam_Pleckstrin_homology,pfam_FERM_PH-like_C,pfam_FERM_N,pfam_FERM-adjacent,pfam_FERM_central,superfamily_DH-domain,superfamily_FERM_central,smart_Band_41_domain,smart_DH-domain,smart_Pleckstrin_homology,pfscan_FERM_domain,pfscan_Pleckstrin_homology,pfscan_DH-domain,prints_Band_41_fam,prints_Ez/rad/moesin_like	p.E919K	ENST00000319562.6	37	c.2755	CCDS9487.1	13	.	.	.	.	.	.	.	.	.	.	G	26.4	4.731256	0.89390	.	.	ENSG00000152767	ENST00000376586;ENST00000319562	T;T	0.12255	2.7;2.7	5.53	4.69	0.59074	.	0.000000	0.85682	D	0.000000	T	0.36771	0.0979	M	0.75777	2.31	0.80722	D	1	D;D	0.71674	0.965;0.998	P;D	0.75484	0.629;0.986	T	0.12400	-1.0549	10	0.44086	T	0.13	.	14.4339	0.67268	0.0705:0.0:0.9295:0.0	.	888;919	Q9Y4F1;C9JME2	FARP1_HUMAN;.	K	919;888	ENSP00000365771:E919K;ENSP00000322926:E888K	ENSP00000322926:E888K	E	+	1	0	FARP1	97890957	1.000000	0.71417	1.000000	0.80357	0.780000	0.44128	9.470000	0.97683	1.350000	0.45770	0.655000	0.94253	GAG	FARP1	-	NULL	ENSG00000152767		0.627	FARP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FARP1	HGNC	protein_coding	OTTHUMT00000045541.3	-	0.00	30	0	G	NM_005766		99092956	+1	tier1	-	no_errors	ENST00000376586	ensembl	human	known	74_37	missense	26.09	17	6	SNP	1.000	A
FBXL13	222235	genome.wustl.edu	37	7	102667940	102667940	+	Missense_Mutation	SNP	G	G	A	rs115245242	byFrequency	TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr7:102667940G>A	ENST00000313221.4	-	5	709	c.283C>T	c.(283-285)Cgg>Tgg	p.R95W	FBXL13_ENST00000393772.2_Missense_Mutation_p.R95W|FBXL13_ENST00000379305.3_Missense_Mutation_p.R95W|RP11-645N11.3_ENST00000447336.1_RNA|FBXL13_ENST00000379306.3_Missense_Mutation_p.R95W|FBXL13_ENST00000379308.3_Missense_Mutation_p.R95W|FBXL13_ENST00000455112.2_Missense_Mutation_p.R95W|FBXL13_ENST00000456695.1_Missense_Mutation_p.R95W|FBXL13_ENST00000471074.1_5'UTR|FBXL13_ENST00000436908.1_Missense_Mutation_p.R95W	NM_145032.3	NP_659469.3	Q8NEE6	FXL13_HUMAN	F-box and leucine-rich repeat protein 13	95										NS(1)|breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(9)|skin(3)|stomach(1)	27						GCTGTATTCCGCCATTTTGTT	0.299													G|||	3	0.000599042	0.0023	0.0	5008	,	,		16853	0.0		0.0	False		,,,				2504	0.0																0													138.0	125.0	129.0					7																	102667940		2203	4299	6502	SO:0001583	missense	0			BC031285	CCDS5726.1, CCDS47678.1, CCDS75649.1	7q22.1	2014-07-18			ENSG00000161040	ENSG00000161040		"""F-boxes / Leucine-rich repeats"""	21658	protein-coding gene	gene with protein product		609080					Standard	NM_145032		Approved	MGC21636, Fbl13	uc003vaq.2	Q8NEE6	OTTHUMG00000157224	ENST00000313221.4:c.283C>T	7.37:g.102667940G>A	ENSP00000321927:p.Arg95Trp		C9J565|C9J566|Q6UVW7|Q6UVW8|Q75MN5|Q86UJ5|Q8N7Y4|Q8TCL2|Q8WUF9|Q8WUG0	Missense_Mutation	SNP	smart_Leu-rich_rpt_Cys-con_subtyp,pfscan_F-box_dom	p.R95W	ENST00000313221.4	37	c.283	CCDS5726.1	7	.	.	.	.	.	.	.	.	.	.	G	14.79	2.640795	0.47153	.	.	ENSG00000161040	ENST00000393772;ENST00000379308;ENST00000379306;ENST00000349747;ENST00000379305;ENST00000436908;ENST00000313221;ENST00000456695;ENST00000455112;ENST00000440067	T;T;T;T;T;T;T;T;T	0.48201	0.82;0.82;0.82;0.82;0.82;0.82;0.82;0.82;0.82	4.05	-0.792	0.10925	.	1.235670	0.05902	N	0.630168	T	0.62660	0.2446	M	0.63428	1.95	0.19300	N	0.999978	D;D;D	0.76494	0.999;0.999;0.998	P;P;P	0.62298	0.897;0.9;0.732	T	0.57780	-0.7752	10	0.72032	D	0.01	.	11.523	0.50562	0.0:0.0:0.229:0.771	.	95;95;95	Q8NEE6-3;Q8NEE6-2;Q8NEE6	.;.;FXL13_HUMAN	W	95;95;95;22;95;95;95;95;95;185	ENSP00000377367:R95W;ENSP00000368610:R95W;ENSP00000368608:R95W;ENSP00000368607:R95W;ENSP00000388608:R95W;ENSP00000321927:R95W;ENSP00000409716:R95W;ENSP00000391550:R95W;ENSP00000390126:R185W	ENSP00000321927:R95W	R	-	1	2	FBXL13	102455176	0.279000	0.24239	0.058000	0.19502	0.040000	0.13550	0.163000	0.16520	-0.130000	0.11599	0.655000	0.94253	CGG	FBXL13	-	NULL	ENSG00000161040		0.299	FBXL13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FBXL13	HGNC	protein_coding	OTTHUMT00000348001.1		0.00	64	0	G	NM_145032		102667940	-1			no_errors	ENST00000313221	ensembl	human	known	74_37	missense	6.98	40	3	SNP	0.063	A
FBXL5	26234	genome.wustl.edu	37	4	15638248	15638248	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr4:15638248A>G	ENST00000341285.3	-	5	759	c.635T>C	c.(634-636)gTa>gCa	p.V212A	FBXL5_ENST00000412094.2_Missense_Mutation_p.V195A|FBXL5_ENST00000382358.4_Missense_Mutation_p.V86A	NM_001193534.1|NM_001193535.1|NM_012161.3	NP_001180463.1|NP_001180464.1|NP_036293.1	Q9UKA1	FBXL5_HUMAN	F-box and leucine-rich repeat protein 5	212	F-box. {ECO:0000255|PROSITE- ProRule:PRU00080}.				iron ion homeostasis (GO:0055072)|protein ubiquitination (GO:0016567)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)	perinuclear region of cytoplasm (GO:0048471)|SCF ubiquitin ligase complex (GO:0019005)|ubiquitin ligase complex (GO:0000151)	iron ion binding (GO:0005506)|ubiquitin-protein transferase activity (GO:0004842)			endometrium(2)|large_intestine(3)|lung(5)|ovary(1)|pancreas(1)|prostate(1)	13						TGACAGCATTACCTCAGGAGG	0.403																																																	0													121.0	103.0	109.0					4																	15638248		2203	4300	6503	SO:0001583	missense	0			AF174591	CCDS3415.1, CCDS54745.1	4p15.33	2011-06-09			ENSG00000118564	ENSG00000118564		"""F-boxes / Leucine-rich repeats"""	13602	protein-coding gene	gene with protein product		605655				10531035	Standard	NM_012161		Approved	FBL4, FBL5, FLR1	uc003goc.2	Q9UKA1	OTTHUMG00000097097	ENST00000341285.3:c.635T>C	4.37:g.15638248A>G	ENSP00000344866:p.Val212Ala		A8MSK4|B4DIB5|Q4W5A8|Q8NHP3|Q9NXN2|Q9P0I0|Q9P0X5|Q9UJT7|Q9UKC8	Missense_Mutation	SNP	pfam_F-box_dom,pfam_Leu-rich_rpt,superfamily_F-box_dom,smart_F-box_dom,smart_Leu-rich_rpt_Cys-con_subtyp,pfscan_F-box_dom	p.V212A	ENST00000341285.3	37	c.635	CCDS3415.1	4	.	.	.	.	.	.	.	.	.	.	A	26.0	4.697671	0.88830	.	.	ENSG00000118564	ENST00000341285;ENST00000412094;ENST00000382358;ENST00000512066	T;T;T;T	0.58652	0.67;0.67;0.67;0.32	5.28	5.28	0.74379	F-box domain, cyclin-like (2);F-box domain, Skp2-like (1);	0.110731	0.64402	D	0.000006	T	0.71031	0.3292	L	0.52266	1.64	0.58432	D	0.999992	D;D	0.69078	0.996;0.997	D;D	0.79108	0.987;0.992	T	0.74210	-0.3739	10	0.87932	D	0	-16.2431	15.498	0.75673	1.0:0.0:0.0:0.0	.	195;212	Q9UKA1-2;Q9UKA1	.;FBXL5_HUMAN	A	212;195;86;172	ENSP00000344866:V212A;ENSP00000408679:V195A;ENSP00000371795:V86A;ENSP00000426993:V172A	ENSP00000344866:V212A	V	-	2	0	FBXL5	15247346	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.098000	0.89540	2.121000	0.65114	0.482000	0.46254	GTA	FBXL5	-	pfam_F-box_dom,superfamily_F-box_dom,smart_F-box_dom,pfscan_F-box_dom	ENSG00000118564		0.403	FBXL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXL5	HGNC	protein_coding	OTTHUMT00000214235.2	-	0.00	40	0	A			15638248	-1	tier1	-	no_errors	ENST00000341285	ensembl	human	known	74_37	missense	31.58	13	6	SNP	1.000	G
FBXO3	26273	genome.wustl.edu	37	11	33777435	33777435	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr11:33777435C>T	ENST00000265651.3	-	5	578	c.560G>A	c.(559-561)aGa>aAa	p.R187K	FBXO3_ENST00000534136.1_Missense_Mutation_p.R187K|FBXO3_ENST00000533103.1_5'Flank|FBXO3_ENST00000531080.1_5'Flank|FBXO3_ENST00000448981.2_Missense_Mutation_p.R187K|FBXO3_ENST00000526785.1_Missense_Mutation_p.R74K|FBXO3_ENST00000532057.1_5'Flank|FBXO3_ENST00000530401.1_Missense_Mutation_p.R182K	NM_012175.3	NP_036307.2	Q9UK99	FBX3_HUMAN	F-box protein 3	187					proteolysis (GO:0006508)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(2)|pancreas(1)|stomach(1)	13		Lung NSC(402;0.0804)		BRCA - Breast invasive adenocarcinoma(625;0.00315)|Lung(977;0.00488)|LUSC - Lung squamous cell carcinoma(625;0.008)		CAGTCCCTGTCTCTGCTGGAA	0.448																																																	0													101.0	95.0	97.0					11																	33777435		2202	4298	6500	SO:0001583	missense	0			AK001943	CCDS7887.1, CCDS44566.1	11p13	2006-07-07	2004-06-15		ENSG00000110429	ENSG00000110429		"""F-boxes /  ""other"""""	13582	protein-coding gene	gene with protein product		609089	"""F-box only protein 3"""			10531037	Standard	NM_033406		Approved	FBX3, FBA	uc001muz.3	Q9UK99	OTTHUMG00000166244	ENST00000265651.3:c.560G>A	11.37:g.33777435C>T	ENSP00000265651:p.Arg187Lys		B3KY16|D3DR05|Q86X90|Q9H0V2|Q9NUX2	Missense_Mutation	SNP	pfam_ApaG_domain,pfam_F-box_dom,superfamily_ApaG_domain,superfamily_F-box_dom,smart_F-box_dom,smart_SMI1/KNR4_like_dom,pfscan_ApaG_domain,pfscan_F-box_dom	p.R187K	ENST00000265651.3	37	c.560	CCDS7887.1	11	.	.	.	.	.	.	.	.	.	.	C	33	5.232348	0.95207	.	.	ENSG00000110429	ENST00000526785;ENST00000265651;ENST00000530401;ENST00000534136;ENST00000448981	T;T;T;T;T	0.40225	1.04;1.04;1.04;1.04;1.04	5.77	5.77	0.91146	Cell wall assembly/cell proliferation coordinating protein, KNR4-like (1);	0.000000	0.85682	D	0.000000	T	0.42899	0.1223	M	0.62723	1.935	0.58432	D	0.999999	B;B;B	0.33637	0.42;0.42;0.296	B;B;B	0.29176	0.099;0.099;0.046	T	0.26326	-1.0106	10	0.25106	T	0.35	-13.8699	19.9758	0.97304	0.0:1.0:0.0:0.0	.	182;187;187	Q9UK99-3;Q9UK99-2;Q9UK99	.;.;FBX3_HUMAN	K	74;187;182;187;187	ENSP00000435680:R74K;ENSP00000265651:R187K;ENSP00000433781:R182K;ENSP00000431745:R187K;ENSP00000408836:R187K	ENSP00000265651:R187K	R	-	2	0	FBXO3	33734011	1.000000	0.71417	1.000000	0.80357	0.932000	0.56968	7.442000	0.80503	2.723000	0.93209	0.650000	0.86243	AGA	FBXO3	-	smart_SMI1/KNR4_like_dom	ENSG00000110429		0.448	FBXO3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXO3	HGNC	protein_coding	OTTHUMT00000388665.1	-	0.00	20	0	C	NM_012175		33777435	-1	tier1	-	no_errors	ENST00000265651	ensembl	human	known	74_37	missense	18.92	30	7	SNP	1.000	T
FBXO4	26272	genome.wustl.edu	37	5	41927260	41927260	+	Frame_Shift_Del	DEL	C	C	-			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr5:41927260delC	ENST00000281623.3	+	2	391	c.335delC	c.(334-336)tctfs	p.S112fs	FBXO4_ENST00000296812.2_Frame_Shift_Del_p.S112fs|FBXO4_ENST00000509134.1_Frame_Shift_Del_p.S112fs	NM_012176.2	NP_036308.1	Q9UKT5	FBX4_HUMAN	F-box protein 4	112					positive regulation of protein ubiquitination (GO:0031398)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|telomere maintenance (GO:0000723)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|SCF ubiquitin ligase complex (GO:0019005)|ubiquitin ligase complex (GO:0000151)	protein homodimerization activity (GO:0042803)|ubiquitin-protein transferase activity (GO:0004842)			breast(2)|endometrium(1)|kidney(2)|large_intestine(6)|liver(1)|lung(11)|prostate(1)|stomach(1)|urinary_tract(2)	27		Lung NSC(810;4.15e-05)|Breast(839;0.00093)|Ovarian(839;0.00965)|Myeloproliferative disorder(839;0.0255)|all_neural(839;0.0604)				TCTTGGTCTTCTGTTGACTGG	0.383																																																	0													166.0	165.0	165.0					5																	41927260		2203	4300	6503	SO:0001589	frameshift_variant	0			AF129534	CCDS3938.1, CCDS3939.1, CCDS75238.1	5p12	2008-02-05	2004-06-15		ENSG00000151876	ENSG00000151876		"""F-boxes /  ""other"""""	13583	protein-coding gene	gene with protein product		609090	"""F-box only protein 4"""			10531035, 10531037	Standard	NM_033484		Approved	FBX4	uc003jmq.3	Q9UKT5	OTTHUMG00000094799	ENST00000281623.3:c.335delC	5.37:g.41927260delC	ENSP00000281623:p.Ser112fs		Q68CU8|Q86VT8|Q9UK98	Frame_Shift_Del	DEL	pfam_F-box_dom,superfamily_F-box_dom,smart_F-box_dom,pfscan_F-box_dom	p.S112fs	ENST00000281623.3	37	c.335	CCDS3938.1	5																																																																																			FBXO4	-	superfamily_F-box_dom	ENSG00000151876		0.383	FBXO4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXO4	HGNC	protein_coding	OTTHUMT00000211614.1		0.00	44	0	C			41927260	+1	tier1		no_errors	ENST00000281623	ensembl	human	known	74_37	frame_shift_del	35.71	18	10	DEL	1.000	-
FCHSD2	9873	genome.wustl.edu	37	11	72613670	72613670	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr11:72613670T>C	ENST00000409418.4	-	10	1225	c.842A>G	c.(841-843)tAc>tGc	p.Y281C	FCHSD2_ENST00000311172.7_Missense_Mutation_p.Y225C|FCHSD2_ENST00000409853.1_Missense_Mutation_p.Y225C|FCHSD2_ENST00000458644.2_Missense_Mutation_p.Y121C|FCHSD2_ENST00000409314.1_Missense_Mutation_p.Y281C	NM_014824.2	NP_055639.2	O94868	FCSD2_HUMAN	FCH and double SH3 domains 2	281										endometrium(2)|large_intestine(11)|lung(5)|ovary(2)|prostate(1)|skin(1)	22			BRCA - Breast invasive adenocarcinoma(5;3.3e-05)			CTGAAGATTGTAGTCCCGGAC	0.348																																																	0													53.0	50.0	51.0					11																	72613670		2199	4285	6484	SO:0001583	missense	0			AB018312	CCDS8218.2	11q13.3	2008-02-05	2004-04-14	2004-04-16	ENSG00000137478	ENSG00000137478			29114	protein-coding gene	gene with protein product			"""SH3 multiple domains 3"""	SH3MD3		9872452, 15067381	Standard	NM_014824		Approved	KIAA0769	uc009ytl.3	O94868	OTTHUMG00000153082	ENST00000409418.4:c.842A>G	11.37:g.72613670T>C	ENSP00000386722:p.Tyr281Cys		B4DNI3|Q7L8J9|Q8WVM2|Q96FV7|Q9UF77	Missense_Mutation	SNP	pfam_SH3_domain,pfam_FCH_dom,pfam_SH3_2,superfamily_SH3_domain,smart_FCH_dom,smart_SH3_domain,pfscan_FCH_dom,pfscan_SH3_domain,prints_SH3_domain	p.Y281C	ENST00000409418.4	37	c.842	CCDS8218.2	11	.	.	.	.	.	.	.	.	.	.	T	18.47	3.631727	0.67015	.	.	ENSG00000137478	ENST00000311172;ENST00000409314;ENST00000409418;ENST00000458644;ENST00000409853	T;T;T;T;T	0.13901	2.55;2.55;2.55;2.55;2.55	5.84	5.84	0.93424	.	0.119691	0.64402	D	0.000015	T	0.23649	0.0572	L	0.49126	1.545	0.50313	D	0.999868	D;D;D	0.65815	0.995;0.985;0.992	P;P;P	0.53185	0.72;0.527;0.719	T	0.00453	-1.1730	10	0.41790	T	0.15	-25.1551	14.1714	0.65512	0.0:0.0:0.0:1.0	.	121;281;225	E7ENZ2;O94868;O94868-3	.;FCSD2_HUMAN;.	C	225;281;281;121;225	ENSP00000308978:Y225C;ENSP00000386987:Y281C;ENSP00000386722:Y281C;ENSP00000402972:Y121C;ENSP00000386314:Y225C	ENSP00000308978:Y225C	Y	-	2	0	FCHSD2	72291318	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.984000	0.56923	2.234000	0.73211	0.528000	0.53228	TAC	FCHSD2	-	NULL	ENSG00000137478		0.348	FCHSD2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	FCHSD2	HGNC	protein_coding	OTTHUMT00000329429.2	-	0.00	20	0	T	NM_014824		72613670	-1	tier1	-	no_errors	ENST00000409418	ensembl	human	known	74_37	missense	21.05	15	4	SNP	1.000	C
FCRL5	83416	genome.wustl.edu	37	1	157514250	157514250	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr1:157514250A>G	ENST00000361835.3	-	5	803	c.646T>C	c.(646-648)Tct>Cct	p.S216P	FCRL5_ENST00000368189.3_Missense_Mutation_p.S216P|FCRL5_ENST00000368190.3_Missense_Mutation_p.S216P|FCRL5_ENST00000368191.3_Missense_Mutation_p.S131P|FCRL5_ENST00000356953.4_Missense_Mutation_p.S216P	NM_001195388.1|NM_031281.2	NP_001182317.1|NP_112571.2	Q96RD9	FCRL5_HUMAN	Fc receptor-like 5	216	Ig-like C2-type 2.				negative regulation of B cell receptor signaling pathway (GO:0050859)|negative regulation of release of sequestered calcium ion into cytosol (GO:0051280)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)				breast(5)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(45)|ovary(5)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	85	all_hematologic(112;0.0378)|Hepatocellular(266;0.178)	Prostate(1639;0.231)				CTCTCTAGAGAGAGCTGGGTC	0.557																																																	0													96.0	99.0	98.0					1																	157514250		2203	4300	6503	SO:0001583	missense	0			AF369794	CCDS1165.1	1q21	2013-01-11			ENSG00000143297	ENSG00000143297		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18508	protein-coding gene	gene with protein product		605877				11027651, 11290337	Standard	NM_031281		Approved	FCRH5, IRTA2, BXMAS1, CD307e	uc009wsm.3	Q96RD9	OTTHUMG00000017481	ENST00000361835.3:c.646T>C	1.37:g.157514250A>G	ENSP00000354691:p.Ser216Pro		A0N0M2|B7WNT9|B7WP94|Q495Q2|Q495Q4|Q5VYK9|Q6UY46	Missense_Mutation	SNP	smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.S216P	ENST00000361835.3	37	c.646	CCDS1165.1	1	.	.	.	.	.	.	.	.	.	.	A	6.762	0.509477	0.12883	.	.	ENSG00000143297	ENST00000361835;ENST00000356953;ENST00000368190;ENST00000368191;ENST00000368189	T;T;T;T;T	0.10860	2.83;2.83;2.83;2.83;2.83	4.17	-4.98	0.03019	Immunoglobulin-like (1);Immunoglobulin-like fold (1);	2.840650	0.01633	N	0.023651	T	0.02418	0.0074	L	0.33245	0.995	0.20975	N	0.999816	B;B;B;B;B	0.16802	0.008;0.008;0.019;0.006;0.019	B;B;B;B;B	0.24701	0.011;0.009;0.035;0.01;0.055	T	0.40308	-0.9570	10	0.26408	T	0.33	.	7.1631	0.25675	0.5244:0.1178:0.3578:0.0	.	131;216;216;216;216	F5GXJ2;Q96RD9-3;A6NJE8;Q96RD9-4;Q96RD9	.;.;.;.;FCRL5_HUMAN	P	216;216;216;131;216	ENSP00000354691:S216P;ENSP00000349434:S216P;ENSP00000357173:S216P;ENSP00000357174:S131P;ENSP00000357172:S216P	ENSP00000349434:S216P	S	-	1	0	FCRL5	155780874	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-4.062000	0.00303	-0.986000	0.03498	-0.456000	0.05471	TCT	FCRL5	-	smart_Ig_sub,pfscan_Ig-like_dom	ENSG00000143297		0.557	FCRL5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FCRL5	HGNC	protein_coding	OTTHUMT00000046263.1	-	0.00	33	0	A	NM_031281		157514250	-1	tier1	-	no_errors	ENST00000356953	ensembl	human	known	74_37	missense	17.14	29	6	SNP	0.004	G
FDFT1	2222	genome.wustl.edu	37	8	11689141	11689141	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr8:11689141C>T	ENST00000220584.4	+	7	1216	c.994C>T	c.(994-996)Cca>Tca	p.P332S	FDFT1_ENST00000525900.1_Missense_Mutation_p.P325S|FDFT1_ENST00000446331.2_3'UTR|FDFT1_ENST00000443614.2_Missense_Mutation_p.P289S|FDFT1_ENST00000538689.1_Missense_Mutation_p.P221S|FDFT1_ENST00000528643.1_Missense_Mutation_p.P247S|FDFT1_ENST00000530664.1_Missense_Mutation_p.P268S|FDFT1_ENST00000528812.1_Missense_Mutation_p.P268S|FDFT1_ENST00000525777.1_Missense_Mutation_p.P247S	NM_004462.3	NP_004453.3	P37268	FDFT_HUMAN	farnesyl-diphosphate farnesyltransferase 1	332					cellular lipid metabolic process (GO:0044255)|cholesterol biosynthetic process (GO:0006695)|isoprenoid biosynthetic process (GO:0008299)|small molecule metabolic process (GO:0044281)|steroid biosynthetic process (GO:0006694)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	farnesyl-diphosphate farnesyltransferase activity (GO:0004310)|oxidoreductase activity (GO:0016491)|squalene synthase activity (GO:0051996)			breast(1)|endometrium(1)|large_intestine(3)|lung(2)|prostate(1)|stomach(2)|upper_aerodigestive_tract(2)	12	all_epithelial(15;0.234)		STAD - Stomach adenocarcinoma(15;0.00225)	COAD - Colon adenocarcinoma(149;0.18)		CACCAATATGCCAGCTGTCAA	0.408																																																	0													205.0	196.0	199.0					8																	11689141		2203	4300	6503	SO:0001583	missense	0			X69141	CCDS5985.1, CCDS75696.1, CCDS75697.1	8p23.1-p22	2005-03-07			ENSG00000079459	ENSG00000079459	2.5.1.21		3629	protein-coding gene	gene with protein product	"""squalene synthase"""	184420					Standard	NM_001287742		Approved		uc003wui.3	P37268	OTTHUMG00000090801	ENST00000220584.4:c.994C>T	8.37:g.11689141C>T	ENSP00000220584:p.Pro332Ser		B3KQ95|B4DJE5|B4DT56|B7Z1J3|Q96GT0	Missense_Mutation	SNP	pfam_Squ/phyt_synthse,superfamily_Terpenoid_synth,tigrfam_Squal_synth	p.P332S	ENST00000220584.4	37	c.994	CCDS5985.1	8	.	.	.	.	.	.	.	.	.	.	C	7.080	0.570098	0.13560	.	.	ENSG00000079459	ENST00000538689;ENST00000220584;ENST00000443614;ENST00000525900;ENST00000528812;ENST00000530664;ENST00000528643;ENST00000525777	T;T;T;T;T;T;T;T	0.70869	-0.52;-0.52;-0.52;-0.52;-0.52;-0.52;-0.52;-0.52	6.07	5.2	0.72013	Terpenoid synthase (2);	0.494319	0.23433	N	0.048236	T	0.45135	0.1327	N	0.08118	0	0.29750	N	0.836416	B;B;B;B;B	0.22146	0.014;0.006;0.065;0.008;0.008	B;B;B;B;B	0.12156	0.002;0.002;0.007;0.002;0.002	T	0.35773	-0.9775	10	0.07990	T	0.79	-8.0672	9.8724	0.41182	0.0:0.7886:0.1392:0.0722	.	165;289;389;325;332	B4DWP0;B4DJE5;B4DND3;E9PNM1;P37268	.;.;.;.;FDFT_HUMAN	S	221;332;289;325;268;268;247;247	ENSP00000444248:P221S;ENSP00000220584:P332S;ENSP00000390367:P289S;ENSP00000434714:P325S;ENSP00000431749:P268S;ENSP00000432331:P268S;ENSP00000431649:P247S;ENSP00000436069:P247S	ENSP00000220584:P332S	P	+	1	0	FDFT1	11726550	0.983000	0.35010	1.000000	0.80357	0.953000	0.61014	0.746000	0.26275	1.582000	0.49881	0.655000	0.94253	CCA	FDFT1	-	superfamily_Terpenoid_synth,tigrfam_Squal_synth	ENSG00000079459		0.408	FDFT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FDFT1	HGNC	protein_coding	OTTHUMT00000207588.2		0.00	43	0	C			11689141	+1			no_errors	ENST00000220584	ensembl	human	known	74_37	missense	6.06	31	2	SNP	0.999	T
FGF14	2259	genome.wustl.edu	37	13	102379085	102379085	+	Missense_Mutation	SNP	A	A	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr13:102379085A>T	ENST00000376143.4	-	4	483	c.484T>A	c.(484-486)Tac>Aac	p.Y162N	FGF14_ENST00000376131.4_Missense_Mutation_p.Y167N	NM_004115.3	NP_004106.1	Q92915	FGF14_HUMAN	fibroblast growth factor 14	162					adult locomotory behavior (GO:0008344)|cell death (GO:0008219)|cell-cell signaling (GO:0007267)|JNK cascade (GO:0007254)|nervous system development (GO:0007399)|neuromuscular process (GO:0050905)|positive regulation of sodium ion transport (GO:0010765)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	extracellular region (GO:0005576)|nucleus (GO:0005634)	growth factor activity (GO:0008083)|heparin binding (GO:0008201)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(14)|ovary(2)|prostate(2)	29	all_neural(89;0.0239)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					TGTTGTCTGTACAACATGGAT	0.368																																																	0													102.0	95.0	97.0					13																	102379085		2203	4300	6503	SO:0001583	missense	0				CCDS9500.1, CCDS9501.1	13q34	2008-02-05			ENSG00000102466	ENSG00000102466			3671	protein-coding gene	gene with protein product		601515				8790420, 17236779	Standard	NM_175929		Approved	FHF4, SCA27	uc001vpf.2	Q92915	OTTHUMG00000017303	ENST00000376143.4:c.484T>A	13.37:g.102379085A>T	ENSP00000365313:p.Tyr162Asn		Q86YN7|Q96QX6	Missense_Mutation	SNP	pfam_Fibroblast_GF_fam,superfamily_Cytokine_IL1-like,smart_Fibroblast_GF_fam,prints_Fibroblast_GF_fam,prints_IL-1_fam/FGF_fam	p.Y167N	ENST00000376143.4	37	c.499	CCDS9501.1	13	.	.	.	.	.	.	.	.	.	.	A	23.7	4.441687	0.83993	.	.	ENSG00000102466	ENST00000376131;ENST00000376143	T;T	0.69926	-0.44;-0.44	5.65	5.65	0.86999	.	0.300687	0.38111	N	0.001809	D	0.82683	0.5090	M	0.80982	2.52	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.85310	0.1078	10	0.87932	D	0	.	15.8767	0.79170	1.0:0.0:0.0:0.0	.	167;162	Q92915-2;Q92915	.;FGF14_HUMAN	N	167;162	ENSP00000365301:Y167N;ENSP00000365313:Y162N	ENSP00000365301:Y167N	Y	-	1	0	FGF14	101177086	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	8.962000	0.93254	2.162000	0.67917	0.482000	0.46254	TAC	FGF14	-	pfam_Fibroblast_GF_fam,superfamily_Cytokine_IL1-like,smart_Fibroblast_GF_fam,prints_IL-1_fam/FGF_fam	ENSG00000102466		0.368	FGF14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FGF14	HGNC	protein_coding	OTTHUMT00000045679.2	-	0.00	45	0	A			102379085	-1	tier1	-	no_errors	ENST00000376131	ensembl	human	known	74_37	missense	8.82	31	3	SNP	1.000	T
FHAD1	114827	genome.wustl.edu	37	1	15639618	15639618	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr1:15639618G>C	ENST00000375998.4	+	7	1105	c.1105G>C	c.(1105-1107)Gag>Cag	p.E369Q	FHAD1_ENST00000358897.4_Missense_Mutation_p.E369Q|FHAD1_ENST00000375995.3_Missense_Mutation_p.E75Q|FHAD1_ENST00000375999.3_Missense_Mutation_p.E369Q|FHAD1_ENST00000401090.2_Missense_Mutation_p.E75Q|FHAD1_ENST00000417793.1_Missense_Mutation_p.E369Q			B1AJZ9	FHAD1_HUMAN	forkhead-associated (FHA) phosphopeptide binding domain 1	369										skin(1)|stomach(1)	2						ACTAAAGGAAGAGGTCAGTCA	0.458																																																	0													147.0	120.0	129.0					1																	15639618		692	1591	2283	SO:0001583	missense	0			AK093300		1p36.21	2012-04-19			ENSG00000142621	ENSG00000142621			29408	protein-coding gene	gene with protein product						11572484	Standard	NM_052929		Approved	KIAA1937	uc001awb.2	B1AJZ9	OTTHUMG00000002088	ENST00000375998.4:c.1105G>C	1.37:g.15639618G>C	ENSP00000365166:p.Glu369Gln		Q0P6F5|Q8N8D3|Q8N9T6|Q8NA05	Missense_Mutation	SNP	pfam_FHA_dom,superfamily_SMAD_FHA_domain,smart_FHA_dom,pfscan_FHA_dom	p.E369Q	ENST00000375998.4	37	c.1105		1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	4.333|4.333	0.061238|0.061238	0.08339|0.08339	.|.	.|.	ENSG00000142621|ENSG00000142621	ENST00000358897;ENST00000417793;ENST00000375999;ENST00000375998;ENST00000375995;ENST00000401090|ENST00000375997	T;T;T;T;T;D|.	0.84298|.	-0.3;-0.28;-0.34;-0.3;0.76;-1.83|.	4.87|4.87	2.93|2.93	0.34026|0.34026	.|.	0.231558|.	0.27600|.	N|.	0.018650|.	T|T	0.64549|0.64549	0.2608|0.2608	M|M	0.72894|0.72894	2.215|2.215	0.80722|0.80722	D|D	1|1	B;B|.	0.25563|.	0.044;0.129|.	B;B|.	0.26202|.	0.038;0.067|.	T|T	0.59521|0.59521	-0.7439|-0.7439	10|5	0.39692|.	T|.	0.17|.	-37.622|-37.622	9.5952|9.5952	0.39569|0.39569	0.0864:0.1431:0.7705:0.0|0.0864:0.1431:0.7705:0.0	.|.	369;96|.	B1AJZ9;B1AJZ8|.	FHAD1_HUMAN;.|.	Q|T	369;369;369;369;75;75|83	ENSP00000351770:E369Q;ENSP00000407615:E369Q;ENSP00000365167:E369Q;ENSP00000365166:E369Q;ENSP00000365163:E75Q;ENSP00000383868:E75Q|.	ENSP00000351770:E369Q|.	E|R	+|+	1|2	0|0	FHAD1|FHAD1	15512205|15512205	1.000000|1.000000	0.71417|0.71417	0.092000|0.092000	0.20876|0.20876	0.003000|0.003000	0.03518|0.03518	1.592000|1.592000	0.36676|0.36676	0.193000|0.193000	0.20303|0.20303	-1.151000|-1.151000	0.01829|0.01829	GAG|AGA	FHAD1	-	NULL	ENSG00000142621		0.458	FHAD1-026	PUTATIVE	basic|appris_candidate_longest	protein_coding	FHAD1	HGNC	protein_coding	OTTHUMT00000393400.2		0.00	17	0	G	NM_052929		15639618	+1			no_errors	ENST00000375999	ensembl	human	known	74_37	missense	18.75	13	3	SNP	0.829	C
FLJ37453	729614	genome.wustl.edu	37	1	16162412	16162413	+	RNA	INS	-	-	GC	rs35098215|rs368250925|rs554075159|rs71574140	byFrequency	TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr1:16162412_16162413insGC	ENST00000317122.1	-	0	1028_1029				RP11-169K16.9_ENST00000535249.1_RNA	NR_024279.1																						GTGGTGCGTGAGCGCGCGCGCG	0.644																																																	0																																												0																															1.37:g.16162421_16162422dupGC				RNA	INS	-	NULL	ENST00000317122.1	37	NULL		1																																																																																			RP11-169K16.9	-	-	ENSG00000179743		0.644	RP11-169K16.9-001	KNOWN	basic	antisense	FLJ37453	Clone_based_vega_gene	antisense	OTTHUMT00000025992.1		0.00	8	0	-			16162413	-1	tier1		no_errors	ENST00000317122	ensembl	human	known	74_37	rna	72.73	3	8	INS	0.091:0.173	GC
FLNC	2318	genome.wustl.edu	37	7	128470943	128470943	+	Silent	SNP	C	C	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr7:128470943C>T	ENST00000325888.8	+	1	513	c.252C>T	c.(250-252)cgC>cgT	p.R84R	FLNC_ENST00000346177.6_Silent_p.R84R	NM_001458.4	NP_001449.3	Q14315	FLNC_HUMAN	filamin C, gamma	84	Actin-binding.|CH 1. {ECO:0000255|PROSITE- ProRule:PRU00044}.				cell junction assembly (GO:0034329)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|cytoskeletal protein binding (GO:0008092)			biliary_tract(1)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(19)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(59)|ovary(2)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)	128						GCATGTACCGCAAGTTCCATC	0.642																																																	0													59.0	61.0	60.0					7																	128470943		2203	4300	6503	SO:0001819	synonymous_variant	0			AB208865	CCDS43644.1, CCDS47705.1	7q32-q35	2014-09-17	2009-07-23		ENSG00000128591	ENSG00000128591			3756	protein-coding gene	gene with protein product	"""actin binding protein 280"""	102565	"""filamin C, gamma (actin binding protein 280)"""	FLN2		7689010, 8088838	Standard	NM_001458		Approved	ABP-280, ABPL	uc003vnz.4	Q14315	OTTHUMG00000023627	ENST00000325888.8:c.252C>T	7.37:g.128470943C>T			B2ZZ88|O95303|Q07985|Q9NS12|Q9NYE5|Q9UMR8|Q9Y503	Silent	SNP	pfam_Filamin/ABP280_repeat-like,pfam_CH-domain,superfamily_CH-domain,superfamily_Ig_E-set,smart_CH-domain,smart_Filamin,pfscan_CH-domain,pfscan_Filamin/ABP280_repeat-like	p.R84	ENST00000325888.8	37	c.252	CCDS43644.1	7																																																																																			FLNC	-	pfam_CH-domain,superfamily_CH-domain,smart_CH-domain,pfscan_CH-domain	ENSG00000128591		0.642	FLNC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FLNC	HGNC	protein_coding	OTTHUMT00000059948.3	-	0.00	36	0	C			128470943	+1	tier1	-	no_errors	ENST00000325888	ensembl	human	known	74_37	silent	50.00	9	9	SNP	1.000	T
FLNC	2318	genome.wustl.edu	37	7	128490861	128490861	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr7:128490861G>C	ENST00000325888.8	+	33	5664	c.5403G>C	c.(5401-5403)gaG>gaC	p.E1801D	FLNC_ENST00000346177.6_Missense_Mutation_p.E1768D|RP11-309L24.2_ENST00000469965.1_RNA	NM_001458.4	NP_001449.3	Q14315	FLNC_HUMAN	filamin C, gamma	1801					cell junction assembly (GO:0034329)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|cytoskeletal protein binding (GO:0008092)			biliary_tract(1)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(19)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(59)|ovary(2)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)	128						CTGCAGGAGAGGTGCGGATGC	0.632																																																	0													69.0	74.0	72.0					7																	128490861		2149	4229	6378	SO:0001583	missense	0			AB208865	CCDS43644.1, CCDS47705.1	7q32-q35	2014-09-17	2009-07-23		ENSG00000128591	ENSG00000128591			3756	protein-coding gene	gene with protein product	"""actin binding protein 280"""	102565	"""filamin C, gamma (actin binding protein 280)"""	FLN2		7689010, 8088838	Standard	NM_001458		Approved	ABP-280, ABPL	uc003vnz.4	Q14315	OTTHUMG00000023627	ENST00000325888.8:c.5403G>C	7.37:g.128490861G>C	ENSP00000327145:p.Glu1801Asp		B2ZZ88|O95303|Q07985|Q9NS12|Q9NYE5|Q9UMR8|Q9Y503	Missense_Mutation	SNP	pfam_Filamin/ABP280_repeat-like,pfam_CH-domain,superfamily_CH-domain,superfamily_Ig_E-set,smart_CH-domain,smart_Filamin,pfscan_CH-domain,pfscan_Filamin/ABP280_repeat-like	p.E1801D	ENST00000325888.8	37	c.5403	CCDS43644.1	7	.	.	.	.	.	.	.	.	.	.	G	14.58	2.577128	0.45902	.	.	ENSG00000128591	ENST00000325888;ENST00000346177	D;D	0.84944	-1.92;-1.92	5.34	3.5	0.40072	Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.88153	0.6360	L	0.52759	1.655	0.41471	D	0.988101	P;B	0.48764	0.915;0.002	D;B	0.72075	0.976;0.037	D	0.86936	0.2076	10	0.52906	T	0.07	.	7.8525	0.29464	0.3149:0.0:0.6851:0.0	.	1768;1801	Q14315-2;Q14315	.;FLNC_HUMAN	D	1801;1768	ENSP00000327145:E1801D;ENSP00000344002:E1768D	ENSP00000327145:E1801D	E	+	3	2	FLNC	128278097	0.999000	0.42202	1.000000	0.80357	0.983000	0.72400	0.533000	0.23082	1.203000	0.43233	0.655000	0.94253	GAG	FLNC	-	pfam_Filamin/ABP280_repeat-like,superfamily_Ig_E-set,smart_Filamin,pfscan_Filamin/ABP280_repeat-like	ENSG00000128591		0.632	FLNC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FLNC	HGNC	protein_coding	OTTHUMT00000059948.3	-	0.00	18	0	G			128490861	+1	tier1	-	no_errors	ENST00000325888	ensembl	human	known	74_37	missense	26.32	14	5	SNP	1.000	C
FLNC	2318	genome.wustl.edu	37	7	128498574	128498574	+	Silent	SNP	T	T	C	rs374175186		TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr7:128498574T>C	ENST00000325888.8	+	48	8436	c.8175T>C	c.(8173-8175)ccT>ccC	p.P2725P	FLNC_ENST00000346177.6_Silent_p.P2692P|RP11-309L24.2_ENST00000469965.1_RNA	NM_001458.4	NP_001449.3	Q14315	FLNC_HUMAN	filamin C, gamma	2725	Self-association site, tail. {ECO:0000250}.				cell junction assembly (GO:0034329)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|cytoskeletal protein binding (GO:0008092)			biliary_tract(1)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(19)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(59)|ovary(2)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)	128						TCAAGGTCCCTTGAATCCCAA	0.532																																																	0													71.0	84.0	80.0					7																	128498574		2037	4179	6216	SO:0001819	synonymous_variant	0			AB208865	CCDS43644.1, CCDS47705.1	7q32-q35	2014-09-17	2009-07-23		ENSG00000128591	ENSG00000128591			3756	protein-coding gene	gene with protein product	"""actin binding protein 280"""	102565	"""filamin C, gamma (actin binding protein 280)"""	FLN2		7689010, 8088838	Standard	NM_001458		Approved	ABP-280, ABPL	uc003vnz.4	Q14315	OTTHUMG00000023627	ENST00000325888.8:c.8175T>C	7.37:g.128498574T>C			B2ZZ88|O95303|Q07985|Q9NS12|Q9NYE5|Q9UMR8|Q9Y503	Silent	SNP	pfam_Filamin/ABP280_repeat-like,pfam_CH-domain,superfamily_CH-domain,superfamily_Ig_E-set,smart_CH-domain,smart_Filamin,pfscan_CH-domain,pfscan_Filamin/ABP280_repeat-like	p.P2725	ENST00000325888.8	37	c.8175	CCDS43644.1	7																																																																																			FLNC	-	smart_Filamin	ENSG00000128591		0.532	FLNC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FLNC	HGNC	protein_coding	OTTHUMT00000059948.3		0.00	44	0	T			128498574	+1			no_errors	ENST00000325888	ensembl	human	known	74_37	silent	8.00	23	2	SNP	0.976	C
FOXB2	442425	genome.wustl.edu	37	9	79634684	79634684	+	Silent	SNP	C	C	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr9:79634684C>T	ENST00000376708.1	+	1	114	c.114C>T	c.(112-114)gaC>gaT	p.D38D		NM_001013735.1	NP_001013757.1	Q5VYV0	FOXB2_HUMAN	forkhead box B2	38					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|lung(8)|ovary(1)	10						CGCTGAGCGACATCTACAAGT	0.577																																																	0													75.0	65.0	68.0					9																	79634684		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS35045.1	9q21.2	2008-02-05			ENSG00000204612	ENSG00000204612		"""Forkhead boxes"""	23315	protein-coding gene	gene with protein product							Standard	NM_001013735		Approved	bA159H20.4	uc004ako.1	Q5VYV0	OTTHUMG00000020051	ENST00000376708.1:c.114C>T	9.37:g.79634684C>T				Silent	SNP	pfam_TF_fork_head,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head,prints_Antifreeze_1	p.D38	ENST00000376708.1	37	c.114	CCDS35045.1	9																																																																																			FOXB2	-	pfam_TF_fork_head,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head	ENSG00000204612		0.577	FOXB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOXB2	HGNC	protein_coding	OTTHUMT00000052745.1	-	0.00	45	0	C	NM_001013735		79634684	+1	tier1	-	no_errors	ENST00000376708	ensembl	human	known	74_37	silent	25.00	21	7	SNP	1.000	T
FOXO3	2309	genome.wustl.edu	37	6	108984758	108984758	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr6:108984758G>C	ENST00000343882.6	+	3	1026	c.722G>C	c.(721-723)gGg>gCg	p.G241A	FOXO3_ENST00000406360.1_Missense_Mutation_p.G241A|FOXO3_ENST00000540898.1_Missense_Mutation_p.G21A	NM_201559.2	NP_963853.1	O43524	FOXO3_HUMAN	forkhead box O3	241				PDGGKSGKA -> LMGEERKT (in Ref. 6; CAA04860). {ECO:0000305}.	antral ovarian follicle growth (GO:0001547)|cellular response to oxidative stress (GO:0034599)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|epidermal growth factor receptor signaling pathway (GO:0007173)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose homeostasis (GO:0042593)|initiation of primordial ovarian follicle growth (GO:0001544)|innate immune response (GO:0045087)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neurotrophin TRK receptor signaling pathway (GO:0048011)|oocyte maturation (GO:0001556)|ovulation from ovarian follicle (GO:0001542)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of translation (GO:0006417)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|protein kinase binding (GO:0019901)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(5)|endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(2)|prostate(4)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	26		all_cancers(87;1.78e-07)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;3.88e-05)|Colorectal(196;0.0294)|all_lung(197;0.0487)|Lung SC(18;0.152)		Epithelial(106;0.000759)|all cancers(137;0.00121)|BRCA - Breast invasive adenocarcinoma(108;0.00163)|OV - Ovarian serous cystadenocarcinoma(136;0.00718)		CCTGATGGGGGGAAGAGCGGA	0.582																																																	0													25.0	27.0	26.0					6																	108984758		2190	4252	6442	SO:0001583	missense	0			AF032886	CCDS5068.1	6q21	2008-09-08	2007-05-02	2007-05-02	ENSG00000118689	ENSG00000118689		"""Forkhead boxes"""	3821	protein-coding gene	gene with protein product		602681		FKHRL1, FOXO3A		9479491	Standard	NM_001455		Approved	AF6q21, FOXO2	uc003psm.2	O43524	OTTHUMG00000015327	ENST00000343882.6:c.722G>C	6.37:g.108984758G>C	ENSP00000339527:p.Gly241Ala		B4DVZ6|E1P5E6|O15171|Q5T2I7|Q9BZ04	Missense_Mutation	SNP	pfam_TF_fork_head,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head	p.G241A	ENST00000343882.6	37	c.722	CCDS5068.1	6	.	.	.	.	.	.	.	.	.	.	G	11.02	1.516068	0.27123	.	.	ENSG00000118689	ENST00000343882;ENST00000406360;ENST00000540258;ENST00000540898	D;D	0.95205	-3.64;-3.64	5.74	4.86	0.63082	Winged helix-turn-helix transcription repressor DNA-binding (1);Transcription factor, fork head (3);	0.000000	0.85682	D	0.000000	D	0.95903	0.8666	M	0.63208	1.945	0.80722	D	1	D	0.71674	0.998	D	0.76575	0.988	D	0.96502	0.9372	10	0.72032	D	0.01	-12.2582	16.1297	0.81418	0.0:0.0:0.8652:0.1348	.	241	O43524	FOXO3_HUMAN	A	241;241;21;21	ENSP00000339527:G241A;ENSP00000385824:G241A	ENSP00000339527:G241A	G	+	2	0	FOXO3	109091451	1.000000	0.71417	0.953000	0.39169	0.165000	0.22458	9.433000	0.97501	1.409000	0.46915	-0.314000	0.08810	GGG	FOXO3	-	pfam_TF_fork_head,smart_TF_fork_head,pfscan_TF_fork_head	ENSG00000118689		0.582	FOXO3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOXO3	HGNC	protein_coding	OTTHUMT00000041722.2		0.00	45	0	G			108984758	+1			no_errors	ENST00000343882	ensembl	human	known	74_37	missense	17.86	23	5	SNP	1.000	C
FOXP1	27086	genome.wustl.edu	37	3	71179678	71179678	+	Intron	SNP	C	C	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr3:71179678C>T	ENST00000318789.4	-	7	706				FOXP1_ENST00000498215.1_Intron|FOXP1_ENST00000491238.1_Missense_Mutation_p.A53T|FOXP1_ENST00000468577.1_Intron|FOXP1_ENST00000475937.1_Intron|FOXP1_ENST00000484350.1_Intron|FOXP1_ENST00000493089.1_Intron	NM_001244810.1|NM_001244813.1|NM_032682.5	NP_001231739.1|NP_001231742.1|NP_116071.2	Q9H334	FOXP1_HUMAN	forkhead box P1						negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|lung(8)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	31		Lung NSC(201;4.62e-05)|Prostate(10;0.0181)|Hepatocellular(537;0.186)|Myeloproliferative disorder(1037;0.209)		BRCA - Breast invasive adenocarcinoma(55;1.17e-05)|Epithelial(33;1.39e-05)|LUSC - Lung squamous cell carcinoma(21;2.35e-05)|Lung(16;4.26e-05)		GCGAAGGGAGCCCGTACTGTC	0.443			T	PAX5	ALL																																			Dom	yes		3	3p14.1	27086	forkhead box P1		L	0													85.0	81.0	82.0					3																	71179678		876	1991	2867	SO:0001627	intron_variant	0			AF146696	CCDS2914.1, CCDS33785.1, CCDS58837.1, CCDS58838.1, CCDS58839.1, CCDS74963.1, CCDS74964.1	3p14.1	2008-07-18			ENSG00000114861	ENSG00000114861		"""Forkhead boxes"""	3823	protein-coding gene	gene with protein product	"""fork head-related protein like B"", ""glutamine-rich factor 1"", ""PAX5/FOXP1 fusion protein"""	605515				8265594, 11751404	Standard	NM_032682		Approved	QRF1, 12CC4, HSPC215, hFKH1B	uc003doj.3	Q9H334	OTTHUMG00000158803	ENST00000318789.4:c.181-17890G>A	3.37:g.71179678C>T			A3QVP8|B3KV70|G5E9V8|Q8NAN6|Q9BSG9|Q9H332|Q9H333|Q9P0R1	Missense_Mutation	SNP	pfam_TF_fork_head,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head	p.A53T	ENST00000318789.4	37	c.157	CCDS2914.1	3	.	.	.	.	.	.	.	.	.	.	C	14.72	2.619939	0.46736	.	.	ENSG00000114861	ENST00000497355;ENST00000491238	D;T	0.90133	-2.62;1.33	5.83	4.73	0.59995	.	.	.	.	.	D	0.92414	0.7592	.	.	.	0.80722	D	1	.	.	.	.	.	.	D	0.91460	0.5188	6	0.51188	T	0.08	.	10.6364	0.45567	0.0:0.8871:0.0:0.1129	.	.	.	.	T	23;53	ENSP00000418225:A23T;ENSP00000420736:A53T	ENSP00000420736:A53T	A	-	1	0	FOXP1	71262368	1.000000	0.71417	0.448000	0.26945	0.981000	0.71138	2.518000	0.45537	1.110000	0.41699	0.655000	0.94253	GCT	FOXP1	-	NULL	ENSG00000114861		0.443	FOXP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FOXP1	HGNC	protein_coding	OTTHUMT00000352250.1		0.00	52	0	C	NM_032682		71179678	-1			no_errors	ENST00000491238	ensembl	human	putative	74_37	missense	10.34	26	3	SNP	0.994	T
FRA10AC1	118924	genome.wustl.edu	37	10	95451832	95451832	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr10:95451832C>G	ENST00000359204.4	-	7	596	c.399G>C	c.(397-399)aaG>aaC	p.K133N	FRA10AC1_ENST00000371430.2_Missense_Mutation_p.K133N|FRA10AC1_ENST00000394100.2_Missense_Mutation_p.K133N|FRA10AC1_ENST00000536233.1_Missense_Mutation_p.K133N	NM_145246.4	NP_660289.2	Q70Z53	F10C1_HUMAN	fragile site, folic acid type, rare, fra(10)(q23.3) or fra(10)(q24.2) candidate 1	133	Lys-rich.					nucleus (GO:0005634)		p.K133N(2)		NS(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(4)|urinary_tract(1)	14						CATAGTATTTCTTAGCAAGTC	0.299																																																	2	Substitution - Missense(2)	large_intestine(2)											39.0	43.0	42.0					10																	95451832		2188	4274	6462	SO:0001583	missense	0			AK090955	CCDS7430.1	10q23.33	2014-01-28	2010-05-25	2010-05-25	ENSG00000148690	ENSG00000148690			1162	protein-coding gene	gene with protein product		608866	"""chromosome 10 open reading frame 4"""	C10orf4		15203205	Standard	NM_145246		Approved		uc001kiz.2	Q70Z53	OTTHUMG00000018776	ENST00000359204.4:c.399G>C	10.37:g.95451832C>G	ENSP00000360488:p.Lys133Asn		C9JCR4|C9JCR5|C9JMY4|Q70Z49|Q70Z50|Q70Z51|Q70Z52|Q8N293|Q8WVH5|Q96JQ8	Missense_Mutation	SNP	pfam_Folate-sensitive_fs_Fra10Ac1	p.K133N	ENST00000359204.4	37	c.399	CCDS7430.1	10	.	.	.	.	.	.	.	.	.	.	C	18.12	3.553939	0.65425	.	.	ENSG00000148690	ENST00000359204;ENST00000536233;ENST00000371426;ENST00000371430;ENST00000394100	T;T;T;T	0.28666	1.61;1.64;1.6;1.61	5.49	3.65	0.41850	.	0.088857	0.85682	D	0.000000	T	0.55417	0.1919	M	0.89968	3.075	0.53688	D	0.999977	D;D	0.54207	0.962;0.965	P;P	0.57620	0.558;0.824	T	0.62900	-0.6756	10	0.72032	D	0.01	-25.3316	11.5829	0.50902	0.0:0.8561:0.0:0.1439	.	133;133	Q70Z53-2;Q70Z53	.;F10C1_HUMAN	N	133	ENSP00000360488:K133N;ENSP00000438405:K133N;ENSP00000360484:K133N;ENSP00000377660:K133N	ENSP00000360488:K133N	K	-	3	2	FRA10AC1	95441822	1.000000	0.71417	1.000000	0.80357	0.938000	0.57974	2.386000	0.44380	0.684000	0.31448	0.585000	0.79938	AAG	FRA10AC1	-	pfam_Folate-sensitive_fs_Fra10Ac1	ENSG00000148690		0.299	FRA10AC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FRA10AC1	HGNC	protein_coding	OTTHUMT00000049439.1		0.00	40	0	C	NM_145246		95451832	-1			no_errors	ENST00000359204	ensembl	human	known	74_37	missense	8.70	21	2	SNP	1.000	G
FRAS1	80144	genome.wustl.edu	37	4	79340102	79340102	+	Splice_Site	SNP	G	G	A			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr4:79340102G>A	ENST00000325942.6	+	33	4865		c.e33-1		FRAS1_ENST00000264895.6_Splice_Site	NM_001166133.1	NP_001159605.1	Q86XX4	FRAS1_HUMAN	Fraser extracellular matrix complex subunit 1						cell communication (GO:0007154)|embryonic limb morphogenesis (GO:0030326)|metanephros morphogenesis (GO:0003338)|morphogenesis of an epithelium (GO:0002009)|palate development (GO:0060021)|protein transport (GO:0015031)|skin development (GO:0043588)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sublamina densa (GO:0061618)	metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(5)|lung(54)|prostate(7)|skin(2)|urinary_tract(4)	103						ACTTTGTTTAGGCTAGAGAAG	0.393																																																	0													134.0	126.0	128.0					4																	79340102		1846	4088	5934	SO:0001630	splice_region_variant	0			AB040933	CCDS54772.1	4q21.21	2014-06-25	2014-06-25		ENSG00000138759	ENSG00000138759			19185	protein-coding gene	gene with protein product		607830	"""Fraser syndrome 1"""			12766769, 3118036	Standard	NM_025074		Approved	FLJ22031, FLJ14927, KIAA1500	uc003hlb.2	Q86XX4	OTTHUMG00000160856	ENST00000325942.6:c.4426-1G>A	4.37:g.79340102G>A			A2RRR8|Q86UZ4|Q8N3U9|Q8NAU7|Q96JW7|Q9H6N9|Q9P228	Splice_Site	SNP	-	e33-1	ENST00000325942.6	37	c.4426-1	CCDS54772.1	4	.	.	.	.	.	.	.	.	.	.	G	9.052	0.992279	0.18966	.	.	ENSG00000138759	ENST00000325942;ENST00000264895	.	.	.	5.22	5.22	0.72569	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.9499	0.86242	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	FRAS1	79559126	1.000000	0.71417	0.997000	0.53966	0.022000	0.10575	7.053000	0.76641	2.595000	0.87683	0.655000	0.94253	.	FRAS1	-	-	ENSG00000138759		0.393	FRAS1-001	NOVEL	basic|CCDS	protein_coding	FRAS1	HGNC	protein_coding	OTTHUMT00000362706.2	-	0.00	55	0	G		Intron	79340102	+1	tier1	-	no_errors	ENST00000264895	ensembl	human	known	74_37	splice_site	12.90	27	4	SNP	1.000	A
FRY	10129	genome.wustl.edu	37	13	32798406	32798406	+	Silent	SNP	G	G	C			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr13:32798406G>C	ENST00000380250.3	+	37	5296	c.4800G>C	c.(4798-4800)ctG>ctC	p.L1600L		NM_023037.2	NP_075463.2	Q5TBA9	FRY_HUMAN	furry homolog (Drosophila)	1600						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				NS(3)|breast(4)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(31)|lung(50)|ovary(5)|pancreas(1)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	132		Lung SC(185;0.0271)		all cancers(112;4.81e-05)|Epithelial(112;0.000656)|OV - Ovarian serous cystadenocarcinoma(117;0.0123)|BRCA - Breast invasive adenocarcinoma(63;0.0295)|GBM - Glioblastoma multiforme(144;0.104)		GCTGGTTGCTGACTATTACAG	0.522																																																	0													70.0	71.0	71.0					13																	32798406		1875	4104	5979	SO:0001819	synonymous_variant	0			AL049784	CCDS41875.1	13q13.1	2008-02-05	2005-11-24	2005-11-24	ENSG00000073910	ENSG00000073910			20367	protein-coding gene	gene with protein product		614818	"""chromosome 13 open reading frame 14"""	C13orf14		14702039, 8812419	Standard	NM_023037		Approved	bA37E23.1, 13CDNA73, CG003	uc001utx.3	Q5TBA9	OTTHUMG00000016696	ENST00000380250.3:c.4800G>C	13.37:g.32798406G>C			Q9Y3N6	Silent	SNP	superfamily_ARM-type_fold	p.L1600	ENST00000380250.3	37	c.4800	CCDS41875.1	13																																																																																			FRY	-	NULL	ENSG00000073910		0.522	FRY-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FRY	HGNC	protein_coding	OTTHUMT00000044405.1		0.00	39	0	G	NM_023037		32798406	+1			no_errors	ENST00000380250	ensembl	human	known	74_37	silent	11.76	15	2	SNP	0.998	C
FRZB	2487	genome.wustl.edu	37	2	183699658	183699658	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr2:183699658C>T	ENST00000295113.4	-	6	1505	c.896G>A	c.(895-897)aGt>aAt	p.S299N		NM_001463.3	NP_001454.2	Q92765	SFRP3_HUMAN	frizzled-related protein	299					brain development (GO:0007420)|cochlea morphogenesis (GO:0090103)|convergent extension involved in organogenesis (GO:0060029)|epithelium development (GO:0060429)|gonad development (GO:0008406)|mammary gland involution (GO:0060056)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cartilage development (GO:0061037)|negative regulation of cell development (GO:0010721)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of hepatocyte differentiation (GO:0070367)|negative regulation of Wnt signaling pathway (GO:0030178)|neural crest cell differentiation (GO:0014033)|positive regulation of apoptotic process (GO:0043065)|positive regulation of fat cell differentiation (GO:0045600)|skeletal system development (GO:0001501)|somite development (GO:0061053)|vasculature development (GO:0001944)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|membrane (GO:0016020)	PDZ domain binding (GO:0030165)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(12)|ovary(2)|prostate(1)|skin(1)	21			OV - Ovarian serous cystadenocarcinoma(117;0.109)|Epithelial(96;0.231)			ATCACTTTTACTGAGTCCAAG	0.418																																																	0													106.0	100.0	102.0					2																	183699658		2203	4300	6503	SO:0001583	missense	0			U24163	CCDS2286.1	2q32.1	2013-09-19			ENSG00000162998	ENSG00000162998		"""Secreted frizzled-related proteins"""	3959	protein-coding gene	gene with protein product		605083				8824257, 9118218	Standard	NM_001463		Approved	FRZB-PEN, FRZB1, SRFP3, FRP-3, SFRP3, FRE, FRITZ, FRZB-1, FZRB, hFIZ	uc002upa.2	Q92765	OTTHUMG00000132597	ENST00000295113.4:c.896G>A	2.37:g.183699658C>T	ENSP00000295113:p.Ser299Asn		O00181|Q99686	Missense_Mutation	SNP	pfam_Frizzled_dom,pfam_Netrin_module_non-TIMP,superfamily_Frizzled_dom,superfamily_TIMP-like_OB-fold,smart_Frizzled_dom,smart_Netrin_module_non-TIMP,pfscan_Frizzled_dom,pfscan_Netrin_domain	p.S299N	ENST00000295113.4	37	c.896	CCDS2286.1	2	.	.	.	.	.	.	.	.	.	.	C	8.044	0.764490	0.15914	.	.	ENSG00000162998	ENST00000295113	T	0.73047	-0.71	5.7	3.74	0.42951	.	0.420987	0.27787	N	0.017851	T	0.49047	0.1534	N	0.14661	0.345	0.28671	N	0.90563	B	0.02656	0.0	B	0.01281	0.0	T	0.35943	-0.9768	10	0.31617	T	0.26	.	6.9101	0.24331	0.0:0.6791:0.1455:0.1753	.	299	Q92765	SFRP3_HUMAN	N	299	ENSP00000295113:S299N	ENSP00000295113:S299N	S	-	2	0	FRZB	183407903	0.993000	0.37304	1.000000	0.80357	0.963000	0.63663	0.759000	0.26461	0.602000	0.29896	0.650000	0.86243	AGT	FRZB	-	NULL	ENSG00000162998		0.418	FRZB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FRZB	HGNC	protein_coding	OTTHUMT00000255808.1	-	0.00	35	0	C	NM_001463		183699658	-1	tier1	-	no_errors	ENST00000295113	ensembl	human	known	74_37	missense	27.27	8	3	SNP	1.000	T
FST	10468	genome.wustl.edu	37	5	52779494	52779494	+	Silent	SNP	A	A	G			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr5:52779494A>G	ENST00000256759.3	+	3	821	c.438A>G	c.(436-438)ctA>ctG	p.L146L	FST_ENST00000396947.3_Silent_p.L146L	NM_013409.2	NP_037541.1	P19883	FST_HUMAN	follistatin	146	Kazal-like 1. {ECO:0000255|PROSITE- ProRule:PRU00798}.				BMP signaling pathway (GO:0030509)|female gonad development (GO:0008585)|gamete generation (GO:0007276)|hair follicle morphogenesis (GO:0031069)|hematopoietic progenitor cell differentiation (GO:0002244)|keratinocyte proliferation (GO:0043616)|negative regulation of activin receptor signaling pathway (GO:0032926)|negative regulation of cell differentiation (GO:0045596)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|odontogenesis of dentin-containing tooth (GO:0042475)|pattern specification process (GO:0007389)|positive regulation of hair follicle development (GO:0051798)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|nucleus (GO:0005634)	activin binding (GO:0048185)|signal transducer activity (GO:0004871)			breast(1)|endometrium(1)|large_intestine(4)|lung(7)|prostate(1)|urinary_tract(1)	15		Ovarian(174;1.78e-06)|Lung NSC(810;3.55e-06)|Breast(144;4.08e-05)				GTGCACTCCTAAAGGCAAGAT	0.542																																																	0													70.0	65.0	67.0					5																	52779494		2203	4300	6503	SO:0001819	synonymous_variant	0			M19481	CCDS3959.1, CCDS43315.1	5q11.2	2008-02-05			ENSG00000134363	ENSG00000134363			3971	protein-coding gene	gene with protein product		136470				10411917, 3380788	Standard	NM_006350		Approved	FS	uc003jpd.3	P19883	OTTHUMG00000131183	ENST00000256759.3:c.438A>G	5.37:g.52779494A>G			B5BU94|Q9BTH0	Silent	SNP	pfam_Kazal_dom,pfam_Follistatin/Osteonectin_EGF,superfamily_TB_dom,smart_Fol_N,smart_Kazal_dom	p.L146	ENST00000256759.3	37	c.438	CCDS3959.1	5																																																																																			FST	-	pfam_Kazal_dom,smart_Kazal_dom	ENSG00000134363		0.542	FST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FST	HGNC	protein_coding	OTTHUMT00000253906.1		0.00	35	0	A	NM_013409		52779494	+1			no_errors	ENST00000256759	ensembl	human	known	74_37	silent	10.53	17	2	SNP	1.000	G
FSTL1	11167	genome.wustl.edu	37	3	120123704	120123704	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr3:120123704G>C	ENST00000295633.3	-	7	933	c.577C>G	c.(577-579)Ctt>Gtt	p.L193V	FSTL1_ENST00000424703.2_Missense_Mutation_p.L158V	NM_007085.4	NP_009016.1	Q12841	FSTL1_HUMAN	follistatin-like 1	193	EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.				BMP signaling pathway (GO:0030509)|response to starvation (GO:0042594)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(6)|liver(1)|lung(9)|skin(1)	20				GBM - Glioblastoma multiforme(114;0.189)		TCTCACCTAAGCAACTTGTTG	0.468																																																	0													256.0	241.0	246.0					3																	120123704		2203	4300	6503	SO:0001583	missense	0			U06863	CCDS2998.1	3q13.33	2013-01-10			ENSG00000163430	ENSG00000163430		"""EF-hand domain containing"""	3972	protein-coding gene	gene with protein product		605547				7957230, 9786430	Standard	NM_007085		Approved	FRP, FSL1	uc003eds.3	Q12841	OTTHUMG00000159440	ENST00000295633.3:c.577C>G	3.37:g.120123704G>C	ENSP00000295633:p.Leu193Val		A8K523|B4DTT5|D3DN90|Q549Z0	Missense_Mutation	SNP	pfam_Kazal_dom,pfam_Follistatin/Osteonectin_EGF,smart_Fol_N,smart_Kazal_dom,pfscan_EF_hand_dom	p.L193V	ENST00000295633.3	37	c.577	CCDS2998.1	3	.	.	.	.	.	.	.	.	.	.	G	19.20	3.781078	0.70222	.	.	ENSG00000163430	ENST00000295633;ENST00000539471;ENST00000424703	T;T	0.32023	2.32;1.47	6.06	6.06	0.98353	EF-hand-like domain (1);	0.247438	0.42682	D	0.000670	T	0.33847	0.0877	L	0.55481	1.735	0.80722	D	1	B;B	0.34329	0.449;0.314	B;B	0.34385	0.181;0.119	T	0.03684	-1.1013	10	0.42905	T	0.14	.	17.7768	0.88511	0.0:0.0:1.0:0.0	.	158;193	B4DTT5;Q12841	.;FSTL1_HUMAN	V	193;136;158	ENSP00000295633:L193V;ENSP00000394355:L158V	ENSP00000295633:L193V	L	-	1	0	FSTL1	121606394	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	8.715000	0.91416	2.882000	0.98803	0.655000	0.94253	CTT	FSTL1	-	pfscan_EF_hand_dom	ENSG00000163430		0.468	FSTL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FSTL1	HGNC	protein_coding	OTTHUMT00000355399.1	-	0.00	68	0	G	NM_007085		120123704	-1	tier1	-	no_errors	ENST00000295633	ensembl	human	known	74_37	missense	19.51	33	8	SNP	1.000	C
FXR2	9513	genome.wustl.edu	37	17	7496858	7496858	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr17:7496858C>G	ENST00000250113.7	-	12	1527	c.1193G>C	c.(1192-1194)gGg>gCg	p.G398A	FXR2_ENST00000573057.1_5'Flank	NM_004860.3	NP_004851.2	P51116	FXR2_HUMAN	fragile X mental retardation, autosomal homolog 2	398						cytoplasm (GO:0005737)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			NS(1)|breast(2)|endometrium(6)|kidney(1)|large_intestine(7)|lung(8)|prostate(1)	26				READ - Rectum adenocarcinoma(115;0.17)		GCTGCCCCGCCCACTCCCAGG	0.602																																																	0													18.0	22.0	21.0					17																	7496858		2090	4213	6303	SO:0001583	missense	0			U31501	CCDS45604.1	17p13.3	2014-09-17				ENSG00000129245			4024	protein-coding gene	gene with protein product		605339		FMR1L2		7489725, 9259278	Standard	NM_004860		Approved		uc002gia.2	P51116		ENST00000250113.7:c.1193G>C	17.37:g.7496858C>G	ENSP00000250113:p.Gly398Ala		B2R9M2|D3DTQ1|Q86V09|Q8WUM2	Missense_Mutation	SNP	pfam_Frag_X_MRP_fam,pfam_KH_dom_type_1,pfam_Agenet-like_dom,smart_KH_dom,pfscan_KH_dom_type_1	p.G398A	ENST00000250113.7	37	c.1193	CCDS45604.1	17	.	.	.	.	.	.	.	.	.	.	C	10.45	1.352344	0.24512	.	.	ENSG00000129245	ENST00000250113	T	0.29397	1.57	5.28	5.28	0.74379	.	0.079527	0.51477	D	0.000095	T	0.21062	0.0507	N	0.08118	0	0.51012	D	0.999908	B	0.34372	0.451	B	0.38921	0.285	T	0.09885	-1.0654	10	0.33141	T	0.24	0.0486	16.4423	0.83905	0.0:1.0:0.0:0.0	.	398	P51116	FXR2_HUMAN	A	398	ENSP00000250113:G398A	ENSP00000250113:G398A	G	-	2	0	FXR2	7437583	0.980000	0.34600	1.000000	0.80357	0.277000	0.26821	3.048000	0.49862	2.747000	0.94245	0.462000	0.41574	GGG	FXR2	-	pfam_Frag_X_MRP_fam	ENSG00000129245		0.602	FXR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FXR2	HGNC	protein_coding	OTTHUMT00000441084.1		0.00	42	0	C			7496858	-1			no_errors	ENST00000250113	ensembl	human	known	74_37	missense	9.52	19	2	SNP	1.000	G
GAD1	2571	genome.wustl.edu	37	2	171705836	171705836	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr2:171705836G>A	ENST00000358196.3	+	12	1710	c.1160G>A	c.(1159-1161)cGc>cAc	p.R387H		NM_000817.2	NP_000808.2	Q99259	DCE1_HUMAN	glutamate decarboxylase 1 (brain, 67kDa)	387					gamma-aminobutyric acid biosynthetic process (GO:0009449)|glutamate catabolic process (GO:0006538)|glutamate decarboxylation to succinate (GO:0006540)|neurotransmitter biosynthetic process (GO:0042136)|neurotransmitter secretion (GO:0007269)|protein-pyridoxal-5-phosphate linkage (GO:0018352)|response to drug (GO:0042493)|synaptic transmission (GO:0007268)	clathrin-sculpted gamma-aminobutyric acid transport vesicle membrane (GO:0061202)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|vesicle membrane (GO:0012506)	glutamate binding (GO:0016595)|glutamate decarboxylase activity (GO:0004351)|pyridoxal phosphate binding (GO:0030170)	p.R387H(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(11)|lung(15)|ovary(1)|urinary_tract(2)	35						AGGAAGCACCGCCATAAACTC	0.542																																																	1	Substitution - Missense(1)	large_intestine(1)											80.0	70.0	73.0					2																	171705836		2203	4300	6503	SO:0001583	missense	0				CCDS2239.1, CCDS2240.1	2q31	2008-02-05	2002-08-29		ENSG00000128683	ENSG00000128683	4.1.1.15		4092	protein-coding gene	gene with protein product		605363	"""glutamate decarboxylase 1 (brain, 67kD)"""	GAD		1549570	Standard	XM_005246443		Approved		uc002ugi.3	Q99259	OTTHUMG00000044175	ENST00000358196.3:c.1160G>A	2.37:g.171705836G>A	ENSP00000350928:p.Arg387His		Q49AK1|Q53TQ7|Q9BU91|Q9UHH4	Missense_Mutation	SNP	pfam_PyrdxlP-dep_de-COase,pfam_Aminotrans_V/Cys_dSase,pfam_ArAA_b-elim_lyase/Thr_aldolase,superfamily_PyrdxlP-dep_Trfase	p.R387H	ENST00000358196.3	37	c.1160	CCDS2239.1	2	.	.	.	.	.	.	.	.	.	.	G	28.4	4.917002	0.92249	.	.	ENSG00000128683	ENST00000358196	T	0.49720	0.77	5.76	5.76	0.90799	Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.049890	0.85682	D	0.000000	T	0.69061	0.3069	M	0.88775	2.98	0.80722	D	1	D	0.56035	0.974	P	0.52598	0.703	T	0.75739	-0.3212	10	0.87932	D	0	-12.8832	19.9857	0.97347	0.0:0.0:1.0:0.0	.	387	Q99259	DCE1_HUMAN	H	387	ENSP00000350928:R387H	ENSP00000350928:R387H	R	+	2	0	GAD1	171414082	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.074000	0.64401	2.706000	0.92434	0.655000	0.94253	CGC	GAD1	-	pfam_PyrdxlP-dep_de-COase,superfamily_PyrdxlP-dep_Trfase	ENSG00000128683		0.542	GAD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GAD1	HGNC	protein_coding	OTTHUMT00000102664.2	-	0.00	40	0	G			171705836	+1	tier1	-	no_errors	ENST00000358196	ensembl	human	known	74_37	missense	22.22	20	6	SNP	1.000	A
GAPDHS	26330	genome.wustl.edu	37	19	36027767	36027767	+	Silent	SNP	A	A	G			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr19:36027767A>G	ENST00000222286.4	+	2	236	c.120A>G	c.(118-120)ccA>ccG	p.P40P		NM_014364.4	NP_055179.1	O14556	G3PT_HUMAN	glyceraldehyde-3-phosphate dehydrogenase, spermatogenic	40	Testis-specific N-terminal extension.				carbohydrate metabolic process (GO:0005975)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|positive regulation of glycolytic process (GO:0045821)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatid development (GO:0007286)	cytosol (GO:0005829)|nucleus (GO:0005634)|sperm fibrous sheath (GO:0035686)|sperm principal piece (GO:0097228)	glyceraldehyde-3-phosphate dehydrogenase (NAD+) (phosphorylating) activity (GO:0004365)|NAD binding (GO:0051287)|NADP binding (GO:0050661)			endometrium(1)|kidney(1)|large_intestine(1)|lung(8)	11	all_lung(56;1.05e-07)|Lung NSC(56;1.63e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)			AGCCCCAGCCACAACCAGAGC	0.602																																																	0													232.0	204.0	214.0					19																	36027767		2203	4300	6503	SO:0001819	synonymous_variant	0			AJ005371	CCDS12465.1	19q13.1	2008-02-05		2005-05-06		ENSG00000105679			24864	protein-coding gene	gene with protein product		609169		GAPDS		10714828	Standard	NM_014364		Approved	GAPDH-2, GAPD2	uc002oaf.1	O14556		ENST00000222286.4:c.120A>G	19.37:g.36027767A>G			B2RC82|O60823|Q6JTT9|Q9HCU6	Silent	SNP	pirsf_GlycerAld/Erythrose_P_DH,pfam_GlycerAld_3-P_DH_cat,pfam_GlycerAld_3-P_DH_NAD(P)-bd,smart_GlycerAld_3-P_DH_NAD(P)-bd,prints_GlycerAld/Erythrose_P_DH,tigrfam_Glyceraldehyde-3-P_DH_1	p.P40	ENST00000222286.4	37	c.120	CCDS12465.1	19																																																																																			GAPDHS	-	NULL	ENSG00000105679		0.602	GAPDHS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GAPDHS	HGNC	protein_coding	OTTHUMT00000460423.1	-	0.00	63	0	A	NM_014364		36027767	+1	tier1	-	no_errors	ENST00000222286	ensembl	human	known	74_37	silent	12.00	44	6	SNP	0.000	G
GAS2L2	246176	genome.wustl.edu	37	17	34072683	34072683	+	Silent	SNP	G	G	A			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr17:34072683G>A	ENST00000254466.6	-	6	1860	c.1833C>T	c.(1831-1833)aaC>aaT	p.N611N	GAS2L2_ENST00000587565.1_Silent_p.N595N	NM_139285.3	NP_644814.1	Q8NHY3	GA2L2_HUMAN	growth arrest-specific 2 like 2	611					cell cycle arrest (GO:0007050)|microtubule bundle formation (GO:0001578)|negative regulation of microtubule depolymerization (GO:0007026)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	actin filament binding (GO:0051015)|cytoskeletal adaptor activity (GO:0008093)|microtubule binding (GO:0008017)			central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(14)|ovary(2)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	35		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		GCAGCTTCATGTTGCCCAAAA	0.607																																																	0													110.0	109.0	109.0					17																	34072683		2203	4300	6503	SO:0001819	synonymous_variant	0			AF508784	CCDS11298.1	17q21	2014-05-06			ENSG00000132139	ENSG00000270765			24846	protein-coding gene	gene with protein product		611398				12584248	Standard	NM_139285		Approved	GAR17	uc002hjv.2	Q8NHY3	OTTHUMG00000188386	ENST00000254466.6:c.1833C>T	17.37:g.34072683G>A			Q8NHY4	Silent	SNP	pfam_GAS2_dom,pfam_CH-domain,superfamily_CH-domain,superfamily_GAS2_dom,smart_CH-domain,smart_GAS2_dom,pfscan_CH-domain	p.N611	ENST00000254466.6	37	c.1833	CCDS11298.1	17																																																																																			GAS2L2	-	NULL	ENSG00000132139		0.607	GAS2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GAS2L2	HGNC	protein_coding	OTTHUMT00000256497.1	-	0.00	34	0	G	NM_139285		34072683	-1	tier1	-	no_errors	ENST00000254466	ensembl	human	known	74_37	silent	20.00	20	5	SNP	0.958	A
GATSL3	652968	genome.wustl.edu	37	22	30681878	30681878	+	Silent	SNP	C	C	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr22:30681878C>T	ENST00000407689.3	-	8	993	c.864G>A	c.(862-864)ctG>ctA	p.L288L	GATSL3_ENST00000404953.3_Silent_p.L250L|RP1-130H16.18_ENST00000447976.1_3'UTR|GATSL3_ENST00000459785.1_Intron	NM_001037666.2	NP_001032755.1	Q8WTX7	GATL3_HUMAN	GATS protein-like 3	288										breast(1)|endometrium(1)|lung(1)	3						CAGCGGCAGCCAGGGGACCTG	0.617																																																	0													29.0	37.0	34.0					22																	30681878		2157	4264	6421	SO:0001819	synonymous_variant	0				CCDS43001.1	22q12	2010-06-23			ENSG00000239282	ENSG00000239282			34423	protein-coding gene	gene with protein product							Standard	NM_001037666		Approved			Q8WTX7	OTTHUMG00000150929	ENST00000407689.3:c.864G>A	22.37:g.30681878C>T			O76052|Q96ND9|Q9UIE8	Silent	SNP	NULL	p.L288	ENST00000407689.3	37	c.864	CCDS43001.1	22																																																																																			GATSL3	-	NULL	ENSG00000239282		0.617	GATSL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GATSL3	HGNC	protein_coding	OTTHUMT00000320581.2		0.00	58	0	C	NM_001037666		30681878	-1			no_errors	ENST00000407689	ensembl	human	known	74_37	silent	6.25	30	2	SNP	1.000	T
GBA	2629	genome.wustl.edu	37	1	155208054	155208054	+	Missense_Mutation	SNP	A	A	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr1:155208054A>T	ENST00000327247.5	-	7	864	c.632T>A	c.(631-633)gTt>gAt	p.V211D	GBA_ENST00000428024.3_Missense_Mutation_p.V124D|GBA_ENST00000427500.3_Missense_Mutation_p.V162D|GBA_ENST00000493842.1_5'UTR|GBA_ENST00000368373.3_Missense_Mutation_p.V211D|GBA_ENST00000536770.1_Missense_Mutation_p.V98D|AL713999.1_ENST00000401290.1_RNA	NM_001005741.2|NM_001005742.2	NP_001005741.1|NP_001005742.1	P04062	GLCM_HUMAN	glucosidase, beta, acid	211					carbohydrate metabolic process (GO:0005975)|cell death (GO:0008219)|cellular response to tumor necrosis factor (GO:0071356)|ceramide biosynthetic process (GO:0046513)|glucosylceramide catabolic process (GO:0006680)|glycosphingolipid metabolic process (GO:0006687)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of MAP kinase activity (GO:0043407)|positive regulation of protein dephosphorylation (GO:0035307)|regulation of water loss via skin (GO:0033561)|response to estrogen (GO:0043627)|response to glucocorticoid (GO:0051384)|response to pH (GO:0009268)|response to testosterone (GO:0033574)|response to thyroid hormone (GO:0097066)|skin morphogenesis (GO:0043589)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)|sphingosine biosynthetic process (GO:0046512)|termination of signal transduction (GO:0023021)	extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)|lysosomal membrane (GO:0005765)	glucosylceramidase activity (GO:0004348)|receptor binding (GO:0005102)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(3)|lung(9)|ovary(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	26	all_lung(78;2.32e-23)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		Epithelial(20;3.72e-10)|all cancers(21;1.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)		Velaglucerase alfa(DB06720)	AAGGAGTGAAACGGGACGCTG	0.562									Gaucher disease type I																																								0													46.0	40.0	42.0					1																	155208054		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	glucocerebrosidase insufficiency	M19285	CCDS1102.1, CCDS53373.1, CCDS53374.1	1q22	2010-01-19	2010-01-19		ENSG00000177628	ENSG00000177628	3.2.1.21		4177	protein-coding gene	gene with protein product		606463	"""glucosylceramidase"", ""glucosidase, beta; acid (includes glucosylceramidase)"""	GLUC		3359914	Standard	NM_001005742		Approved	GBA1	uc001fjl.3	P04062	OTTHUMG00000035841	ENST00000327247.5:c.632T>A	1.37:g.155208054A>T	ENSP00000314508:p.Val211Asp		A8K796|B7Z5G2|B7Z6S1|J3KQG4|J3KQK9|Q16545|Q4VX22|Q6I9R6|Q9UMJ8	Missense_Mutation	SNP	pfam_Glyco_hydro_30,superfamily_Glycoside_hydrolase_SF,prints_Glyco_hydro_30	p.V211D	ENST00000327247.5	37	c.632	CCDS1102.1	1	.	.	.	.	.	.	.	.	.	.	.	12.07	1.826501	0.32329	.	.	ENSG00000177628	ENST00000427500;ENST00000428024;ENST00000368373;ENST00000327247;ENST00000536770;ENST00000536555;ENST00000402928	D;D;D;D;D	0.99287	-5.69;-5.69;-5.69;-5.69;-5.69	3.66	2.54	0.30619	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.720633	0.12683	N	0.447843	D	0.97365	0.9138	L	0.46157	1.445	0.18873	N	0.999984	B;D;P	0.53619	0.425;0.961;0.883	P;P;P	0.51615	0.466;0.668;0.675	D	0.94729	0.7908	10	0.87932	D	0	.	5.1017	0.14762	0.8625:0.0:0.1375:0.0	.	162;98;211	B7Z5G2;F5H241;P04062	.;.;GLCM_HUMAN	D	162;124;211;211;98;168;196	ENSP00000402577:V162D;ENSP00000397986:V124D;ENSP00000357357:V211D;ENSP00000314508:V211D;ENSP00000445560:V98D	ENSP00000314508:V211D	V	-	2	0	GBA	153474678	0.897000	0.30589	0.073000	0.20177	0.077000	0.17291	6.455000	0.73497	1.663000	0.50791	0.248000	0.18094	GTT	GBA	-	pfam_Glyco_hydro_30,superfamily_Glycoside_hydrolase_SF	ENSG00000177628		0.562	GBA-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	GBA	HGNC	protein_coding	OTTHUMT00000087204.1	-	0.00	80	0	A	NM_000157		155208054	-1	tier1	-	no_errors	ENST00000327247	ensembl	human	known	74_37	missense	8.16	45	4	SNP	0.083	T
GC	2638	genome.wustl.edu	37	4	72607566	72607566	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr4:72607566C>A	ENST00000513476.1	-	12	1444	c.1417G>T	c.(1417-1419)Ggg>Tgg	p.G473W	GC_ENST00000273951.8_3'UTR|GC_ENST00000503472.1_5'UTR|GC_ENST00000504199.1_3'UTR			P02774	VTDB_HUMAN	group-specific component (vitamin D binding protein)	0	Albumin 3. {ECO:0000255|PROSITE- ProRule:PRU00769}.				small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)|vitamin transport (GO:0051180)	blood microparticle (GO:0072562)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)	actin binding (GO:0003779)|calcidiol binding (GO:1902118)|vitamin D binding (GO:0005499)|vitamin transporter activity (GO:0051183)			endometrium(5)|kidney(1)|large_intestine(4)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(4)	45		all_hematologic(202;0.107)	Lung(101;0.148)		Alfacalcidol(DB01436)|Cholecalciferol(DB00169)	AGATCATTCCCCTGGGTGGCT	0.388																																																	0																																										SO:0001583	missense	0			L10641	CCDS3550.1, CCDS56332.1	4q12-q13	2008-08-29			ENSG00000145321	ENSG00000145321			4187	protein-coding gene	gene with protein product		139200				558959	Standard	NM_000583		Approved	DBP, VDBP, hDBP	uc010iif.3	P02774	OTTHUMG00000129915	ENST00000513476.1:c.1417G>T	4.37:g.72607566C>A	ENSP00000426683:p.Gly473Trp		B4DPP2|D6RAK8|Q16309|Q16310|Q53F31|Q6GTG1	Missense_Mutation	SNP	pfam_Serum_albumin_N,pfam_VitD-bind_III,superfamily_Serum_albumin-like,smart_Serum_albumin_N,prints_VitD-bd,prints_ALB/AFP/VDB	p.G473W	ENST00000513476.1	37	c.1417		4	.	.	.	.	.	.	.	.	.	.	C	2.716	-0.267685	0.05754	.	.	ENSG00000145321	ENST00000513476	T	0.59906	0.23	4.04	-0.11	0.13580	.	.	.	.	.	T	0.56001	0.1956	.	.	.	0.09310	N	1	D	0.54047	0.964	P	0.49853	0.624	T	0.49570	-0.8926	8	0.87932	D	0	.	6.5718	0.22543	0.0:0.4555:0.0:0.5445	.	473	D6RF35	.	W	473	ENSP00000426683:G473W	ENSP00000426683:G473W	G	-	1	0	GC	72826430	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.165000	0.09968	-0.055000	0.13244	-0.355000	0.07637	GGG	GC	-	superfamily_Serum_albumin-like	ENSG00000145321		0.388	GC-004	PUTATIVE	basic	protein_coding	GC	HGNC	protein_coding	OTTHUMT00000362264.1		0.00	46	0	C			72607566	-1			no_errors	ENST00000513476	ensembl	human	putative	74_37	missense	10.53	17	2	SNP	0.000	A
GFM1	85476	genome.wustl.edu	37	3	158409146	158409146	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr3:158409146G>C	ENST00000486715.1	+	18	2503	c.2146G>C	c.(2146-2148)Gag>Cag	p.E716Q	GFM1_ENST00000264263.5_Missense_Mutation_p.E735Q|RP11-379F4.7_ENST00000607624.1_lincRNA	NM_024996.5	NP_079272.4			G elongation factor, mitochondrial 1											breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(5)|lung(9)|ovary(3)|urinary_tract(2)	22			Lung(72;0.00309)|LUSC - Lung squamous cell carcinoma(72;0.0043)			ATACACAATGGAGTATAGCAG	0.348																																																	0													96.0	96.0	96.0					3																	158409146		2203	4300	6503	SO:0001583	missense	0			AF309777	CCDS33885.1	3q25	2008-02-05			ENSG00000168827	ENSG00000168827			13780	protein-coding gene	gene with protein product		606639	"""G translation elongation factor, mitochondrial"""			11374907, 11735030	Standard	NM_024996		Approved	EFGM, GFM, EGF1	uc003fce.3	Q96RP9	OTTHUMG00000158804	ENST00000486715.1:c.2146G>C	3.37:g.158409146G>C	ENSP00000419038:p.Glu716Gln			Missense_Mutation	SNP	pfam_EF_GTP-bd_dom,pfam_Transl_elong_EFG/EF2_IV,pfam_EFG_V,pfam_Transl_elong_EFTu/EF1A_2,superfamily_P-loop_NTPase,superfamily_Ribosomal_S5_D2-typ_fold,superfamily_Transl_B-barrel,superfamily_EFG_III-V,smart_Transl_elong_EFG/EF2_IV,smart_EFG_V,prints_EF_GTP-bd_dom,tigrfam_Transl_elong_EFG/EF2,tigrfam_Small_GTP-bd_dom	p.E716Q	ENST00000486715.1	37	c.2146	CCDS33885.1	3	.	.	.	.	.	.	.	.	.	.	G	26.2	4.713842	0.89112	.	.	ENSG00000168827	ENST00000486715;ENST00000264263	T;T	0.65916	-0.18;-0.18	5.66	5.66	0.87406	Elongation factor G/III/V (1);Translation elongation factor EFG/EF2, C-terminal (3);	0.000000	0.85682	D	0.000000	T	0.77452	0.4132	L	0.61036	1.89	0.80722	D	1	D;D	0.67145	0.995;0.996	D;D	0.69479	0.959;0.964	T	0.75892	-0.3157	10	0.45353	T	0.12	-14.2736	19.7559	0.96291	0.0:0.0:1.0:0.0	.	735;716	Q96RP9-2;Q96RP9	.;EFGM_HUMAN	Q	716;735	ENSP00000419038:E716Q;ENSP00000264263:E735Q	ENSP00000264263:E735Q	E	+	1	0	GFM1	159891840	1.000000	0.71417	1.000000	0.80357	0.873000	0.50193	9.035000	0.93752	2.656000	0.90262	0.655000	0.94253	GAG	GFM1	-	pfam_EFG_V,superfamily_EFG_III-V,smart_EFG_V,tigrfam_Transl_elong_EFG/EF2	ENSG00000168827		0.348	GFM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GFM1	HGNC	protein_coding	OTTHUMT00000352271.1	-	0.00	23	0	G	NM_024996		158409146	+1	tier1	-	no_errors	ENST00000486715	ensembl	human	known	74_37	missense	29.41	12	5	SNP	1.000	C
GFPT1	2673	genome.wustl.edu	37	2	69565629	69565629	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr2:69565629G>C	ENST00000357308.4	-	14	1450	c.1272C>G	c.(1270-1272)gaC>gaG	p.D424E	GFPT1_ENST00000361060.5_Missense_Mutation_p.D406E	NM_001244710.1	NP_001231639.1	Q06210	GFPT1_HUMAN	glutamine--fructose-6-phosphate transaminase 1	424	Isomerase.|SIS 1. {ECO:0000255|PROSITE- ProRule:PRU00797}.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|carbohydrate biosynthetic process (GO:0016051)|cellular protein metabolic process (GO:0044267)|cellular response to insulin stimulus (GO:0032869)|circadian regulation of gene expression (GO:0032922)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|endoplasmic reticulum unfolded protein response (GO:0030968)|energy reserve metabolic process (GO:0006112)|fructose 6-phosphate metabolic process (GO:0006002)|glucosamine biosynthetic process (GO:0006042)|glutamine metabolic process (GO:0006541)|negative regulation of glycogen biosynthetic process (GO:0045719)|post-translational protein modification (GO:0043687)|protein homotetramerization (GO:0051289)|protein N-linked glycosylation via asparagine (GO:0018279)|response to sucrose (GO:0009744)|UDP-N-acetylglucosamine biosynthetic process (GO:0006048)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	amino acid binding (GO:0016597)|carbohydrate binding (GO:0030246)|glutamine-fructose-6-phosphate transaminase (isomerizing) activity (GO:0004360)			endometrium(1)|large_intestine(3)|lung(5)|skin(3)	12						GTGTGTTTCTGTCCAGGAAGT	0.398																																																	0													118.0	110.0	113.0					2																	69565629		2203	4300	6503	SO:0001583	missense	0				CCDS33216.1, CCDS58713.1	2p13	2014-09-17	2010-05-11		ENSG00000198380	ENSG00000198380	2.6.1.16		4241	protein-coding gene	gene with protein product		138292	"""glutamine-fructose-6-phosphate transaminase 1"""	GFPT		1460020	Standard	NM_002056		Approved	GFAT, GFA, GFAT1	uc002sfi.2	Q06210	OTTHUMG00000152666	ENST00000357308.4:c.1272C>G	2.37:g.69565629G>C	ENSP00000349860:p.Asp424Glu		Q53QE6|Q9BXF8	Missense_Mutation	SNP	pfam_SIS,pfam_GATase_dom,tigrfam_GlmS_trans	p.D424E	ENST00000357308.4	37	c.1272	CCDS58713.1	2	.	.	.	.	.	.	.	.	.	.	G	19.44	3.828830	0.71258	.	.	ENSG00000198380	ENST00000357308;ENST00000361060	T;T	0.63580	-0.05;-0.05	5.05	0.123	0.14709	.	0.000000	0.85682	D	0.000000	T	0.70064	0.3181	L	0.53729	1.69	0.80722	D	1	D	0.69078	0.997	D	0.79784	0.993	T	0.68104	-0.5497	10	0.72032	D	0.01	-19.3885	9.9211	0.41464	0.4404:0.0:0.5596:0.0	.	406	Q06210-2	.	E	424;406	ENSP00000349860:D424E;ENSP00000354347:D406E	ENSP00000349860:D424E	D	-	3	2	GFPT1	69419133	1.000000	0.71417	0.997000	0.53966	0.994000	0.84299	1.331000	0.33793	-0.114000	0.11936	-0.312000	0.09012	GAC	GFPT1	-	pfam_SIS,tigrfam_GlmS_trans	ENSG00000198380		0.398	GFPT1-201	KNOWN	basic|CCDS	protein_coding	GFPT1	HGNC	protein_coding		-	0.00	51	0	G			69565629	-1	tier1	-	no_errors	ENST00000357308	ensembl	human	known	74_37	missense	13.95	37	6	SNP	1.000	C
GGA1	26088	genome.wustl.edu	37	22	38014499	38014499	+	Silent	SNP	C	C	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr22:38014499C>T	ENST00000343632.4	+	4	635	c.249C>T	c.(247-249)gaC>gaT	p.D83D	GGA1_ENST00000405147.3_Silent_p.D83D|GGA1_ENST00000337437.4_Intron|GGA1_ENST00000406772.1_Silent_p.D10D|GGA1_ENST00000381756.5_Silent_p.D100D|GGA1_ENST00000325180.8_Silent_p.D83D	NM_001172687.1|NM_013365.4	NP_001166158.1|NP_037497.1	Q9UJY5	GGA1_HUMAN	golgi-associated, gamma adaptin ear containing, ARF binding protein 1	83	VHS. {ECO:0000255|PROSITE- ProRule:PRU00218}.				intracellular protein transport (GO:0006886)|positive regulation of protein catabolic process (GO:0045732)|vesicle-mediated transport (GO:0016192)	clathrin adaptor complex (GO:0030131)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(2)|endometrium(2)|kidney(1)|large_intestine(2)|lung(1)|ovary(1)|urinary_tract(1)	10	Melanoma(58;0.0574)					GGTTCCACGACGAAGTGGGCA	0.627																																																	0													132.0	92.0	106.0					22																	38014499		2203	4300	6503	SO:0001819	synonymous_variant	0			AF190862	CCDS13951.1, CCDS33643.1, CCDS54526.1	22q13.31	2010-02-12	2010-02-12		ENSG00000100083	ENSG00000100083			17842	protein-coding gene	gene with protein product		606004				10747088, 10747089, 16407204	Standard	NM_013365		Approved		uc003atc.3	Q9UJY5	OTTHUMG00000030985	ENST00000343632.4:c.249C>T	22.37:g.38014499C>T			A8K3D3|B0QYR7|Q5TG07|Q86YA9|Q8NCS6|Q9BW94|Q9UG00|Q9UGW0|Q9UGW1	Silent	SNP	pfam_VHS,pfam_GAT,pfam_Clathrin_a/b/g-adaptin_app_Ig,superfamily_Coatomer/clathrin_app_Ig-like,superfamily_ENTH_VHS,smart_VHS_subgr,smart_Clathrin_a/b/g-adaptin_app_Ig,pfscan_Clathrin_g-adaptin_app,pfscan_GAT,pfscan_VHS	p.D83	ENST00000343632.4	37	c.249	CCDS13951.1	22																																																																																			GGA1	-	pfam_VHS,superfamily_ENTH_VHS,smart_VHS_subgr,pfscan_VHS	ENSG00000100083		0.627	GGA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GGA1	HGNC	protein_coding	OTTHUMT00000075873.3	-	0.00	22	0	C	NM_013365		38014499	+1	tier1	-	no_errors	ENST00000343632	ensembl	human	known	74_37	silent	13.79	25	4	SNP	0.216	T
GJE1	100126572	genome.wustl.edu	37	6	142456038	142456038	+	Silent	SNP	A	A	G			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr6:142456038A>G	ENST00000450456.2	+	3	666	c.597A>G	c.(595-597)ttA>ttG	p.L199L				Q8NFK1	CXG3_HUMAN	gap junction protein, epsilon 1, 23kDa	0					cell communication (GO:0007154)|myelination (GO:0042552)|sensory perception of sound (GO:0007605)	connexon complex (GO:0005922)|integral component of membrane (GO:0016021)|myelin sheath (GO:0043209)											TTAGAAGATTATACTTTCCAT	0.249																																																	0																																										SO:0001819	synonymous_variant	0					6q24.1	2013-01-16			ENSG00000203733	ENSG00000203733		"""Ion channels / Gap junction proteins (connexins)"""	33251	other	unknown						18849090	Standard	NG_033968		Approved	CX23		A6NN92	OTTHUMG00000015706	ENST00000450456.2:c.597A>G	6.37:g.142456038A>G			A4D296|Q86XI9	Silent	SNP	pfam_Connexin_CCC,pfam_Connexin_N	p.L199	ENST00000450456.2	37	c.597		6																																																																																			GJE1	-	NULL	ENSG00000203733		0.249	GJE1-001	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	GJE1	HGNC	protein_coding	OTTHUMT00000042482.2	-	0.00	57	0	A			142456038	+1	tier1	-	no_errors	ENST00000450456	ensembl	human	known	74_37	silent	24.24	25	8	SNP	1.000	G
GNAS	2778	genome.wustl.edu	37	20	57428467	57428467	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr20:57428467G>A	ENST00000371100.4	+	1	699	c.147G>A	c.(145-147)atG>atA	p.M49I	GNAS_ENST00000371099.2_Missense_Mutation_p.M49I|GNAS-AS1_ENST00000424094.2_RNA|GNAS_ENST00000371098.2_Intron|GNAS_ENST00000306120.3_5'Flank|GNAS_ENST00000371075.3_Intron|GNAS-AS1_ENST00000598163.1_RNA|GNAS_ENST00000464624.2_3'UTR|GNAS_ENST00000313949.7_Intron|GNAS_ENST00000371102.4_Missense_Mutation_p.M49I	NM_001077490.1|NM_080425.2	NP_001070958.1|NP_536350.2	P63092	GNAS2_HUMAN	GNAS complex locus	0					activation of adenylate cyclase activity (GO:0007190)|adenylate cyclase-activating adrenergic receptor signaling pathway (GO:0071880)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|blood coagulation (GO:0007596)|bone development (GO:0060348)|cAMP biosynthetic process (GO:0006171)|cellular response to catecholamine stimulus (GO:0071870)|cellular response to glucagon stimulus (GO:0071377)|cellular response to prostaglandin E stimulus (GO:0071380)|cognition (GO:0050890)|developmental growth (GO:0048589)|energy reserve metabolic process (GO:0006112)|hair follicle placode formation (GO:0060789)|intracellular transport (GO:0046907)|platelet aggregation (GO:0070527)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of Ras GTPase activity (GO:0032320)|regulation of insulin secretion (GO:0050796)|sensory perception of smell (GO:0007608)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|intrinsic component of membrane (GO:0031224)|membrane (GO:0016020)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)	adenylate cyclase activity (GO:0004016)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)			adrenal_gland(12)|autonomic_ganglia(1)|biliary_tract(5)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(37)|liver(9)|lung(9)|ovary(16)|pancreas(56)|parathyroid(5)|pituitary(228)|prostate(2)|small_intestine(1)|stomach(1)|testis(2)|thyroid(35)|upper_aerodigestive_tract(3)|urinary_tract(1)	441	all_lung(29;0.0104)		BRCA - Breast invasive adenocarcinoma(13;2.19e-08)|Colorectal(105;0.109)			CCGAAGAGATGGAGACCGAAC	0.647			Mis		pituitary adenoma		"""McCune-Albright syndrome; pseudohypoparathyroidism, type IA"""			TSP Lung(22;0.16)																											Colon(117;935 1597 6045 8307 46442)			Dom	yes		20	20q13.2	2778	"""guanine nucleotide binding protein (G protein), alpha stimulating activity polypeptide 1"""	yes	E	0													15.0	18.0	17.0					20																	57428467		1876	4104	5980	SO:0001583	missense	0			M21142	CCDS13471.1, CCDS13472.1, CCDS42892.1, CCDS46622.1, CCDS46623.1, CCDS46624.1	20q13.2-q13.3	2010-03-01	2001-12-19	2001-12-20	ENSG00000087460	ENSG00000087460			4392	protein-coding gene	gene with protein product	"""secretogranin VI"""	139320	"""guanine nucleotide binding protein (G protein), alpha stimulating activity polypeptide 1"""	GNAS1			Standard	NM_000516		Approved	NESP55, NESP, GNASXL, GPSA, SCG6	uc002xzw.3	O95467	OTTHUMG00000033069	ENST00000371100.4:c.147G>A	20.37:g.57428467G>A	ENSP00000360141:p.Met49Ile		A6NI00|E1P5G5|P04895|Q12927|Q14433|Q32P26|Q5JWD2|Q5JWD4|Q5JWD5|Q6NR75|Q6NXS0|Q8TBC0|Q96H70	Missense_Mutation	SNP	pfam_Gprotein_alpha_su,pfam_Small_GTPase_ARF/SAR,superfamily_P-loop_NTPase,superfamily_GproteinA_insert,smart_Gprotein_alpha_su,prints_Gprotein_alpha_S,prints_Gprotein_alpha_su	p.M49I	ENST00000371100.4	37	c.147	CCDS46622.1	20	.	.	.	.	.	.	.	.	.	.	G	15.49	2.848689	0.51164	.	.	ENSG00000087460	ENST00000371099;ENST00000371100;ENST00000371102	D;D	0.91068	-2.78;-2.76	3.9	3.9	0.45041	.	.	.	.	.	D	0.86598	0.5971	L	0.57536	1.79	0.80722	D	1	B	0.30914	0.3	B	0.23275	0.045	D	0.85005	0.0902	9	0.39692	T	0.17	.	11.6662	0.51374	0.0:0.0:1.0:0.0	.	49	Q5JWF2	GNAS1_HUMAN	I	49	ENSP00000360141:M49I;ENSP00000360143:M49I	ENSP00000360140:M49I	M	+	3	0	GNAS	56861862	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.382000	0.59594	2.469000	0.83416	0.563000	0.77884	ATG	GNAS	-	NULL	ENSG00000087460		0.647	GNAS-001	PUTATIVE	basic|CCDS	protein_coding	GNAS	HGNC	protein_coding	OTTHUMT00000080417.3		0.00	27	0	G	NM_000516		57428467	+1			no_errors	ENST00000371100	ensembl	human	putative	74_37	missense	13.64	19	3	SNP	1.000	A
GMEB2	26205	genome.wustl.edu	37	20	62250681	62250681	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr20:62250681C>G	ENST00000266068.1	-	1	548	c.70G>C	c.(70-72)Gac>Cac	p.D24H	GMEB2_ENST00000370077.1_Missense_Mutation_p.D24H			Q9UKD1	GMEB2_HUMAN	glucocorticoid modulatory element binding protein 2	24				DGSGVEGVKTVLVTTNLAPHG -> CPAGCALRDPDSILSS LHFTR (in Ref. 6). {ECO:0000305}.	regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|transcription coactivator activity (GO:0003713)			breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(7)|ovary(1)|prostate(1)	18	all_cancers(38;2.51e-11)|all_epithelial(29;8.27e-13)		Epithelial(9;4.79e-09)|all cancers(9;2.76e-08)|BRCA - Breast invasive adenocarcinoma(10;5.15e-06)|OV - Ovarian serous cystadenocarcinoma(5;0.0114)			CCACTGCCGTCCACTGCAGTG	0.652																																																	0													160.0	92.0	115.0					20																	62250681		2203	4300	6503	SO:0001583	missense	0			AF173867	CCDS13528.1	20q13.33	2008-07-02			ENSG00000101216	ENSG00000101216			4371	protein-coding gene	gene with protein product		607451				10523663, 11743720	Standard	NM_012384		Approved	P79PIF, KIAA1269, PIF79	uc002yfq.1	Q9UKD1	OTTHUMG00000032988	ENST00000266068.1:c.70G>C	20.37:g.62250681C>G	ENSP00000266068:p.Asp24His		E1P5J3|Q5TDS0|Q9H431|Q9H4X7|Q9H4X8|Q9UF78|Q9ULF1	Missense_Mutation	SNP	pfam_SAND_dom,superfamily_SAND_dom-like,superfamily_Sig_transdc_His_kin_Hpt_dom,smart_SAND_dom,pfscan_SAND_dom	p.D24H	ENST00000266068.1	37	c.70	CCDS13528.1	20	.	.	.	.	.	.	.	.	.	.	C	14.30	2.493316	0.44352	.	.	ENSG00000101216	ENST00000370077;ENST00000266068	T;T	0.59772	0.24;0.24	4.69	4.69	0.59074	.	0.139522	0.43579	D	0.000551	T	0.58278	0.2111	N	0.14661	0.345	0.40740	D	0.982828	D	0.61080	0.989	P	0.59012	0.85	T	0.67894	-0.5552	10	0.87932	D	0	-1.0642	17.5536	0.87884	0.0:1.0:0.0:0.0	.	24	Q9UKD1	GMEB2_HUMAN	H	24	ENSP00000359094:D24H;ENSP00000266068:D24H	ENSP00000266068:D24H	D	-	1	0	GMEB2	61721125	0.998000	0.40836	0.044000	0.18714	0.108000	0.19459	5.313000	0.65798	2.291000	0.77112	0.313000	0.20887	GAC	GMEB2	-	NULL	ENSG00000101216		0.652	GMEB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GMEB2	HGNC	protein_coding	OTTHUMT00000080166.1	-	0.00	33	0	C	NM_012384		62250681	-1	tier1	-	no_errors	ENST00000266068	ensembl	human	known	74_37	missense	29.17	17	7	SNP	0.757	G
GNAT2	2780	genome.wustl.edu	37	1	110152713	110152713	+	Silent	SNP	G	G	A	rs371604259		TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr1:110152713G>A	ENST00000351050.3	-	3	438	c.252C>T	c.(250-252)atC>atT	p.I84I		NM_005272.3	NP_005263.1	P19087	GNAT2_HUMAN	guanine nucleotide binding protein (G protein), alpha transducing activity polypeptide 2	84					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|detection of light stimulus involved in visual perception (GO:0050908)|G-protein coupled receptor signaling pathway (GO:0007186)|phototransduction (GO:0007602)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|response to light intensity (GO:0009642)|retinal cone cell development (GO:0046549)|visual perception (GO:0007601)	heterotrimeric G-protein complex (GO:0005834)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|photoreceptor outer segment membrane (GO:0042622)|plasma membrane (GO:0005886)	G-protein beta/gamma-subunit complex binding (GO:0031683)|G-protein coupled photoreceptor activity (GO:0008020)|G-protein coupled receptor binding (GO:0001664)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(2)|prostate(1)|upper_aerodigestive_tract(1)	14		all_epithelial(167;2.5e-05)|all_lung(203;0.000135)|Lung NSC(277;0.000269)|Breast(1374;0.244)		Lung(183;0.0422)|Colorectal(144;0.108)|Epithelial(280;0.125)|all cancers(265;0.129)|LUSC - Lung squamous cell carcinoma(189;0.227)		TGGCCCGGATGATAGCCAGGA	0.493																																																	0													253.0	219.0	231.0					1																	110152713		2203	4300	6503	SO:0001819	synonymous_variant	0			BC000233	CCDS803.1	1p13	2013-01-08			ENSG00000134183	ENSG00000134183			4394	protein-coding gene	gene with protein product		139340				8406495	Standard	NM_005272		Approved	ACHM4	uc001dya.3	P19087	OTTHUMG00000011639	ENST00000351050.3:c.252C>T	1.37:g.110152713G>A				Silent	SNP	pfam_Gprotein_alpha_su,pfam_Small_GTPase_ARF/SAR,superfamily_P-loop_NTPase,superfamily_GproteinA_insert,smart_Gprotein_alpha_su,prints_Gprotein_alpha_su,prints_Gprotein_alpha_I	p.I84	ENST00000351050.3	37	c.252	CCDS803.1	1																																																																																			GNAT2	-	pfam_Gprotein_alpha_su,superfamily_P-loop_NTPase,superfamily_GproteinA_insert,smart_Gprotein_alpha_su,prints_Gprotein_alpha_I	ENSG00000134183		0.493	GNAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GNAT2	HGNC	protein_coding	OTTHUMT00000032181.1	-	0.00	36	0	G	NM_005272		110152713	-1	tier1	-	no_errors	ENST00000351050	ensembl	human	known	74_37	silent	28.57	10	4	SNP	1.000	A
GPR98	84059	genome.wustl.edu	37	5	89989976	89989976	+	Nonsense_Mutation	SNP	C	C	A			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr5:89989976C>A	ENST00000405460.2	+	33	7499	c.7403C>A	c.(7402-7404)tCa>tAa	p.S2468*		NM_032119.3	NP_115495.3	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98	2468	Calx-beta 17. {ECO:0000305|PubMed:11606593}.				detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|G-protein coupled receptor signaling pathway (GO:0007186)|inner ear receptor stereocilium organization (GO:0060122)|maintenance of organ identity (GO:0048496)|nervous system development (GO:0007399)|neurological system process (GO:0050877)|neuropeptide signaling pathway (GO:0007218)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|stereocilia ankle link complex (GO:0002142)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(4)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(18)|large_intestine(46)|liver(2)|lung(80)|ovary(12)|pancreas(5)|prostate(1)|skin(50)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(6)	269		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		TGGATGACATCATGGATCAGC	0.488																																																	0													67.0	66.0	66.0					5																	89989976		1929	4129	6058	SO:0001587	stop_gained	0			AB014586	CCDS47246.1	5q13	2014-08-08	2006-05-26	2006-05-26	ENSG00000164199	ENSG00000164199		"""-"", ""GPCR / Class B : Orphans"""	17416	protein-coding gene	gene with protein product		602851	"""monogenic, audiogenic seizure susceptibility 1 homolog (mouse)"""	USH2C, MASS1		10976914, 14740321	Standard	NM_032119		Approved	DKFZp761P0710, KIAA0686, FEB4, VLGR1b	uc003kju.3	Q8WXG9	OTTHUMG00000162668	ENST00000405460.2:c.7403C>A	5.37:g.89989976C>A	ENSP00000384582:p.Ser2468*		O75171|Q8TF58|Q9H0X5|Q9UL61	Nonsense_Mutation	SNP	pfam_Calx_beta,pfam_EPTP,pfam_GPCR_2_secretin-like,pfam_GPS_dom,superfamily_ConA-like_lec_gl_sf,superfamily_Gal_Oxase/kelch_b-propeller,smart_Calx_beta,pfscan_EAR,pfscan_GPS_dom,pfscan_GPCR_2-like	p.S2468*	ENST00000405460.2	37	c.7403	CCDS47246.1	5	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	50|50	16.587485|16.587485	0.99867|0.99867	.|.	.|.	ENSG00000164199|ENSG00000164199	ENST00000509621|ENST00000405460;ENST00000296619	.|.	.|.	.|.	5.92|5.92	5.05|5.05	0.67936|0.67936	.|.	.|0.250493	.|0.41938	.|D	.|0.000785	T|.	0.43411|.	0.1246|.	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.33929|.	-0.9849|.	4|.	.|0.02654	.|T	.|1	.|.	15.3899|15.3899	0.74735|0.74735	0.0:0.933:0.0:0.067|0.0:0.933:0.0:0.067	.|.	.|.	.|.	.|.	N|X	34|2468	.|.	.|ENSP00000296619:S2468X	H|S	+|+	1|2	0|0	GPR98|GPR98	90025732|90025732	0.983000|0.983000	0.35010|0.35010	0.955000|0.955000	0.39395|0.39395	0.952000|0.952000	0.60782|0.60782	3.884000|3.884000	0.56175|0.56175	1.501000|1.501000	0.48654|0.48654	0.655000|0.655000	0.94253|0.94253	CAT|TCA	GPR98	-	NULL	ENSG00000164199		0.488	GPR98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR98	HGNC	protein_coding	OTTHUMT00000369993.2	-	0.00	66	0	C	NM_032119		89989976	+1	tier1	-	no_errors	ENST00000405460	ensembl	human	known	74_37	nonsense	29.17	17	7	SNP	0.711	A
GRB7	2886	genome.wustl.edu	37	17	37898911	37898911	+	Missense_Mutation	SNP	T	T	A			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr17:37898911T>A	ENST00000309156.4	+	3	505	c.248T>A	c.(247-249)aTt>aAt	p.I83N	GRB7_ENST00000578702.1_3'UTR|GRB7_ENST00000394209.2_Missense_Mutation_p.I83N|GRB7_ENST00000445327.2_Missense_Mutation_p.I106N|GRB7_ENST00000309185.3_Missense_Mutation_p.I83N|GRB7_ENST00000394211.3_Missense_Mutation_p.I83N|GRB7_ENST00000394204.1_Missense_Mutation_p.I83N	NM_005310.3	NP_005301.2	Q14451	GRB7_HUMAN	growth factor receptor-bound protein 7	83					blood coagulation (GO:0007596)|epidermal growth factor receptor signaling pathway (GO:0007173)|leukocyte migration (GO:0050900)|negative regulation of translation (GO:0017148)|positive regulation of cell migration (GO:0030335)|positive regulation of signal transduction (GO:0009967)|stress granule assembly (GO:0034063)	cell projection (GO:0042995)|cytoplasmic stress granule (GO:0010494)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)|phosphatidylinositol binding (GO:0035091)|protein kinase binding (GO:0019901)|RNA binding (GO:0003723)|SH3/SH2 adaptor activity (GO:0005070)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	18	all_cancers(6;1.06e-93)|all_epithelial(6;2.33e-113)|Breast(7;9.37e-100)|Lung NSC(9;9.76e-10)|all_lung(9;5.34e-09)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)		UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|Epithelial(3;6.86e-60)|all cancers(3;1.65e-53)|BRCA - Breast invasive adenocarcinoma(8;2.03e-43)|STAD - Stomach adenocarcinoma(3;1.43e-12)|Colorectal(5;6.23e-08)|COAD - Colon adenocarcinoma(5;8.58e-06)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|LUSC - Lung squamous cell carcinoma(15;0.171)			CAGAGCCCAATTCTCGGGGGC	0.652																																																	0													52.0	61.0	58.0					17																	37898911		2203	4300	6503	SO:0001583	missense	0			D43772	CCDS11345.1, CCDS56028.1	17q12	2013-02-14			ENSG00000141738	ENSG00000141738		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	4567	protein-coding gene	gene with protein product		601522					Standard	NM_005310		Approved		uc021twu.1	Q14451	OTTHUMG00000133253	ENST00000309156.4:c.248T>A	17.37:g.37898911T>A	ENSP00000310771:p.Ile83Asn		B2RAV1|B3KNL0|B3KWP9|B7WP75|J3KQM4|Q53YD3|Q92568|Q96DF9|Q9Y220	Missense_Mutation	SNP	pfam_BPS-dom,pfam_SH2,pfam_Ras-assoc,pfam_Pleckstrin_homology,smart_Ras-assoc,smart_Pleckstrin_homology,smart_SH2,pfscan_Pleckstrin_homology,pfscan_Ras-assoc,pfscan_SH2,prints_SH2	p.I106N	ENST00000309156.4	37	c.317	CCDS11345.1	17	.	.	.	.	.	.	.	.	.	.	T	9.479	1.097612	0.20552	.	.	ENSG00000141738	ENST00000309185;ENST00000309156;ENST00000394211;ENST00000394209;ENST00000445327;ENST00000394204	T;T;T;T;T;T	0.50001	0.76;0.76;0.76;0.76;0.76;0.76	5.3	5.3	0.74995	.	0.111433	0.64402	D	0.000009	T	0.62490	0.2432	L	0.50333	1.59	0.47949	D	0.999554	D;D	0.89917	1.0;0.964	D;P	0.87578	0.998;0.714	T	0.62632	-0.6813	10	0.46703	T	0.11	-12.4921	14.2145	0.65783	0.0:0.0:0.0:1.0	.	83;83	Q14451-2;Q14451	.;GRB7_HUMAN	N	83;83;83;83;106;83	ENSP00000311752:I83N;ENSP00000310771:I83N;ENSP00000377761:I83N;ENSP00000377759:I83N;ENSP00000403459:I106N;ENSP00000377754:I83N	ENSP00000310771:I83N	I	+	2	0	GRB7	35152437	1.000000	0.71417	0.998000	0.56505	0.050000	0.14768	4.711000	0.61881	2.019000	0.59389	0.459000	0.35465	ATT	GRB7	-	NULL	ENSG00000141738		0.652	GRB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRB7	HGNC	protein_coding	OTTHUMT00000257024.2	-	0.00	32	0	T	NM_005310		37898911	+1	tier1	-	no_errors	ENST00000445327	ensembl	human	known	74_37	missense	20.00	24	6	SNP	1.000	A
GRB7	2886	genome.wustl.edu	37	17	37898928	37898928	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr17:37898928A>C	ENST00000309156.4	+	3	522	c.265A>C	c.(265-267)Agt>Cgt	p.S89R	GRB7_ENST00000578702.1_3'UTR|GRB7_ENST00000394209.2_Missense_Mutation_p.S89R|GRB7_ENST00000445327.2_Missense_Mutation_p.S112R|GRB7_ENST00000309185.3_Missense_Mutation_p.S89R|GRB7_ENST00000394211.3_Missense_Mutation_p.S89R|GRB7_ENST00000394204.1_Missense_Mutation_p.S89R	NM_005310.3	NP_005301.2	Q14451	GRB7_HUMAN	growth factor receptor-bound protein 7	89					blood coagulation (GO:0007596)|epidermal growth factor receptor signaling pathway (GO:0007173)|leukocyte migration (GO:0050900)|negative regulation of translation (GO:0017148)|positive regulation of cell migration (GO:0030335)|positive regulation of signal transduction (GO:0009967)|stress granule assembly (GO:0034063)	cell projection (GO:0042995)|cytoplasmic stress granule (GO:0010494)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)|phosphatidylinositol binding (GO:0035091)|protein kinase binding (GO:0019901)|RNA binding (GO:0003723)|SH3/SH2 adaptor activity (GO:0005070)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	18	all_cancers(6;1.06e-93)|all_epithelial(6;2.33e-113)|Breast(7;9.37e-100)|Lung NSC(9;9.76e-10)|all_lung(9;5.34e-09)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)		UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|Epithelial(3;6.86e-60)|all cancers(3;1.65e-53)|BRCA - Breast invasive adenocarcinoma(8;2.03e-43)|STAD - Stomach adenocarcinoma(3;1.43e-12)|Colorectal(5;6.23e-08)|COAD - Colon adenocarcinoma(5;8.58e-06)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|LUSC - Lung squamous cell carcinoma(15;0.171)			GGGCCCCTCCAGTGCAAGGGG	0.652																																																	0													44.0	51.0	49.0					17																	37898928		2201	4293	6494	SO:0001583	missense	0			D43772	CCDS11345.1, CCDS56028.1	17q12	2013-02-14			ENSG00000141738	ENSG00000141738		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	4567	protein-coding gene	gene with protein product		601522					Standard	NM_005310		Approved		uc021twu.1	Q14451	OTTHUMG00000133253	ENST00000309156.4:c.265A>C	17.37:g.37898928A>C	ENSP00000310771:p.Ser89Arg		B2RAV1|B3KNL0|B3KWP9|B7WP75|J3KQM4|Q53YD3|Q92568|Q96DF9|Q9Y220	Missense_Mutation	SNP	pfam_BPS-dom,pfam_SH2,pfam_Ras-assoc,pfam_Pleckstrin_homology,smart_Ras-assoc,smart_Pleckstrin_homology,smart_SH2,pfscan_Pleckstrin_homology,pfscan_Ras-assoc,pfscan_SH2,prints_SH2	p.S112R	ENST00000309156.4	37	c.334	CCDS11345.1	17	.	.	.	.	.	.	.	.	.	.	A	3.393	-0.123830	0.06795	.	.	ENSG00000141738	ENST00000309185;ENST00000309156;ENST00000394211;ENST00000394209;ENST00000445327;ENST00000394204	T;T;T;T;T;T	0.47177	0.85;0.85;0.85;0.85;0.85;0.85	5.3	-1.28	0.09318	.	0.830510	0.10803	N	0.632451	T	0.36744	0.0978	L	0.40543	1.245	0.09310	N	1	P;B	0.42203	0.773;0.06	B;B	0.42422	0.387;0.022	T	0.29243	-1.0018	10	0.15952	T	0.53	-0.6534	10.0572	0.42252	0.4899:0.0:0.5101:0.0	.	89;89	Q14451-2;Q14451	.;GRB7_HUMAN	R	89;89;89;89;112;89	ENSP00000311752:S89R;ENSP00000310771:S89R;ENSP00000377761:S89R;ENSP00000377759:S89R;ENSP00000403459:S112R;ENSP00000377754:S89R	ENSP00000310771:S89R	S	+	1	0	GRB7	35152454	0.000000	0.05858	0.000000	0.03702	0.027000	0.11550	-0.462000	0.06704	-0.271000	0.09272	0.459000	0.35465	AGT	GRB7	-	NULL	ENSG00000141738		0.652	GRB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRB7	HGNC	protein_coding	OTTHUMT00000257024.2	-	0.00	30	0	A	NM_005310		37898928	+1	tier1	-	no_errors	ENST00000445327	ensembl	human	known	74_37	missense	17.24	24	5	SNP	0.000	C
GRID1	2894	genome.wustl.edu	37	10	87482894	87482894	+	Silent	SNP	G	G	A			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr10:87482894G>A	ENST00000327946.7	-	12	1948	c.1863C>T	c.(1861-1863)ggC>ggT	p.G621G	GRID1_ENST00000536331.1_Silent_p.G192G	NM_017551.2	NP_060021.1	Q9ULK0	GRID1_HUMAN	glutamate receptor, ionotropic, delta 1	621					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|social behavior (GO:0035176)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|ionotropic glutamate receptor complex (GO:0008328)|postsynaptic membrane (GO:0045211)	extracellular-glutamate-gated ion channel activity (GO:0005234)|ionotropic glutamate receptor activity (GO:0004970)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(24)|lung(46)|ovary(5)|prostate(4)|skin(5)|stomach(4)|upper_aerodigestive_tract(5)	106						CGGAAGATTCGCCACCTGCGG	0.602										Multiple Myeloma(13;0.14)																																							0													97.0	72.0	80.0					10																	87482894		2203	4300	6503	SO:0001819	synonymous_variant	0			AB033046	CCDS31236.1	10q22	2012-08-29			ENSG00000182771	ENSG00000182771		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4575	protein-coding gene	gene with protein product		610659					Standard	NM_017551		Approved	GluD1, KIAA1220	uc001kdl.1	Q9ULK0	OTTHUMG00000018650	ENST00000327946.7:c.1863C>T	10.37:g.87482894G>A			B3KXD5|B7Z7L0|Q8IXT3	Silent	SNP	pfam_ANF_lig-bd_rcpt,pfam_Iontro_glu_rcpt,pfam_SBP_bac_3,pfam_Glu_rcpt_Glu/Gly-bd,superfamily_Peripla_BP_I,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.G621	ENST00000327946.7	37	c.1863	CCDS31236.1	10																																																																																			GRID1	-	pfam_Iontro_glu_rcpt,pfam_SBP_bac_3,smart_Iontro_glu_rcpt	ENSG00000182771		0.602	GRID1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	GRID1	HGNC	protein_coding	OTTHUMT00000049148.3		0.00	19	0	G	XM_043613		87482894	-1			no_errors	ENST00000327946	ensembl	human	known	74_37	silent	50.00	2	2	SNP	0.000	A
GRIK4	2900	genome.wustl.edu	37	11	120837934	120837934	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr11:120837934C>A	ENST00000527524.2	+	19	2584	c.2297C>A	c.(2296-2298)gCc>gAc	p.A766D	GRIK4_ENST00000438375.2_Missense_Mutation_p.A766D	NM_001282470.1	NP_001269399.1	Q16099	GRIK4_HUMAN	glutamate receptor, ionotropic, kainate 4	766					glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|response to corticosteroid (GO:0031960)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|nucleus (GO:0005634)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	extracellular-glutamate-gated ion channel activity (GO:0005234)|kainate selective glutamate receptor activity (GO:0015277)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(20)|liver(1)|lung(29)|ovary(2)|pancreas(1)|prostate(4)|skin(2)|urinary_tract(1)	69		Breast(109;0.000868)|Medulloblastoma(222;0.0453)|all_neural(223;0.116)|all_hematologic(192;0.21)		BRCA - Breast invasive adenocarcinoma(274;1.24e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.116)		TTTGATCTGGCCATTCTCCAG	0.572																																																	0													85.0	76.0	79.0					11																	120837934		2203	4299	6502	SO:0001583	missense	0			S67803	CCDS8433.1	11q23.3	2012-08-29			ENSG00000149403	ENSG00000149403		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4582	protein-coding gene	gene with protein product		600282		GRIK			Standard	NM_001282470		Approved	GluK4, KA1	uc009zax.1	Q16099	OTTHUMG00000048255	ENST00000527524.2:c.2297C>A	11.37:g.120837934C>A	ENSP00000435648:p.Ala766Asp		A8K9L1	Missense_Mutation	SNP	pfam_ANF_lig-bd_rcpt,pfam_Iontro_glu_rcpt,pfam_Glu_rcpt_Glu/Gly-bd,pfam_SBP_bac_3,superfamily_Peripla_BP_I,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.A766D	ENST00000527524.2	37	c.2297	CCDS8433.1	11	.	.	.	.	.	.	.	.	.	.	C	35	5.441273	0.96187	.	.	ENSG00000149403	ENST00000527524;ENST00000438375	T;T	0.16196	2.36;2.36	5.41	5.41	0.78517	Ionotropic glutamate receptor (2);	0.000000	0.85682	D	0.000000	T	0.56232	0.1971	H	0.94582	3.555	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.69720	-0.5069	10	0.87932	D	0	.	18.7905	0.91973	0.0:1.0:0.0:0.0	.	766	Q16099	GRIK4_HUMAN	D	766	ENSP00000435648:A766D;ENSP00000404063:A766D	ENSP00000404063:A766D	A	+	2	0	GRIK4	120343144	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.757000	0.85209	2.537000	0.85549	0.563000	0.77884	GCC	GRIK4	-	pfam_Iontro_glu_rcpt,pfam_SBP_bac_3,smart_Iontro_glu_rcpt	ENSG00000149403		0.572	GRIK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIK4	HGNC	protein_coding	OTTHUMT00000109760.4	-	0.00	49	0	C	NM_014619		120837934	+1	tier1	-	no_errors	ENST00000527524	ensembl	human	known	74_37	missense	23.40	36	11	SNP	1.000	A
GRIN2A	2903	genome.wustl.edu	37	16	9858292	9858292	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr16:9858292C>T	ENST00000396573.2	-	14	3418	c.3109G>A	c.(3109-3111)Gca>Aca	p.A1037T	GRIN2A_ENST00000535259.1_Missense_Mutation_p.A880T|GRIN2A_ENST00000396575.2_Missense_Mutation_p.A1037T|GRIN2A_ENST00000330684.3_Missense_Mutation_p.A1037T|GRIN2A_ENST00000404927.2_Missense_Mutation_p.A1037T|GRIN2A_ENST00000562109.1_Missense_Mutation_p.A1037T	NM_000833.3	NP_000824.1	Q12879	NMDE1_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2A	1037					directional locomotion (GO:0033058)|dopamine metabolic process (GO:0042417)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|learning or memory (GO:0007611)|memory (GO:0007613)|negative regulation of protein catabolic process (GO:0042177)|neurogenesis (GO:0022008)|positive regulation of apoptotic process (GO:0043065)|protein localization (GO:0008104)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of sensory perception of pain (GO:0051930)|regulation of synaptic plasticity (GO:0048167)|response to amphetamine (GO:0001975)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to wounding (GO:0009611)|sensory perception of pain (GO:0019233)|serotonin metabolic process (GO:0042428)|sleep (GO:0030431)|startle response (GO:0001964)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)|visual learning (GO:0008542)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|synaptic vesicle (GO:0008021)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|zinc ion binding (GO:0008270)			NS(7)|breast(5)|cervix(1)|endometrium(11)|kidney(6)|large_intestine(36)|lung(71)|ovary(4)|prostate(9)|skin(45)|upper_aerodigestive_tract(2)|urinary_tract(1)	198					Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Felbamate(DB00949)|Gabapentin(DB00996)|Glycine(DB00145)|Halothane(DB01159)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	TCTGCTGTTGCCTCATCCCTC	0.522																																																	0													134.0	141.0	139.0					16																	9858292		2197	4300	6497	SO:0001583	missense	0				CCDS10539.1, CCDS45407.1	16p13.2	2012-08-29			ENSG00000183454	ENSG00000183454		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4585	protein-coding gene	gene with protein product		138253		NMDAR2A		9480759	Standard	XM_005255267		Approved	GluN2A	uc002czo.4	Q12879	OTTHUMG00000129721	ENST00000396573.2:c.3109G>A	16.37:g.9858292C>T	ENSP00000379818:p.Ala1037Thr		O00669|Q17RZ6	Missense_Mutation	SNP	pfam_NMDAR2_C,pfam_Iontro_glu_rcpt,pfam_SBP_bac_3,pfam_Glu_rcpt_Glu/Gly-bd,pfam_ANF_lig-bd_rcpt,superfamily_Peripla_BP_I,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.A1037T	ENST00000396573.2	37	c.3109	CCDS10539.1	16	.	.	.	.	.	.	.	.	.	.	C	2.843	-0.239970	0.05944	.	.	ENSG00000183454	ENST00000396573;ENST00000404927;ENST00000535259;ENST00000330684;ENST00000396575	T;T;T;T;T	0.11385	2.79;2.78;2.78;2.79;2.79	5.33	4.37	0.52481	Glutamate [NMDA] receptor, epsilon subunit, C-terminal (1);	0.889974	0.10160	N	0.708463	T	0.08626	0.0214	N	0.19112	0.55	0.21256	N	0.999746	B;B;B	0.27166	0.052;0.17;0.049	B;B;B	0.27380	0.047;0.079;0.045	T	0.38001	-0.9681	9	.	.	.	.	12.1969	0.54303	0.0:0.9167:0.0:0.0833	.	880;1037;1037	F5GZ52;Q17RZ6;Q12879	.;.;NMDE1_HUMAN	T	1037;1037;880;1037;1037	ENSP00000379818:A1037T;ENSP00000385872:A1037T;ENSP00000441572:A880T;ENSP00000332549:A1037T;ENSP00000379820:A1037T	.	A	-	1	0	GRIN2A	9765793	0.003000	0.15002	0.093000	0.20910	0.323000	0.28346	0.690000	0.25451	1.216000	0.43427	0.655000	0.94253	GCA	GRIN2A	-	pfam_NMDAR2_C	ENSG00000183454		0.522	GRIN2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIN2A	HGNC	protein_coding	OTTHUMT00000251930.3		0.00	30	0	C			9858292	-1			no_errors	ENST00000330684	ensembl	human	known	74_37	missense	7.14	26	2	SNP	0.948	T
GRIP2	80852	genome.wustl.edu	37	3	14559283	14559283	+	RNA	SNP	G	G	C	rs575150002		TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr3:14559283G>C	ENST00000273083.3	-	0	1217							Q9C0E4	GRIP2_HUMAN	glutamate receptor interacting protein 2						synaptic transmission (GO:0007268)	cytosol (GO:0005829)|plasma membrane (GO:0005886)				endometrium(5)|large_intestine(4)|lung(8)|ovary(1)|pancreas(1)|prostate(5)|skin(1)	25						ACATTACATCGGCTTTGGTCC	0.642																																																	0													20.0	25.0	23.0					3																	14559283		2027	4169	6196			0			AB051506		3p24-p23	2012-02-08			ENSG00000144596	ENSG00000144596			23841	protein-coding gene	gene with protein product							Standard	NM_001080423		Approved	KIAA1719	uc021wtn.1	Q9C0E4	OTTHUMG00000155544		3.37:g.14559283G>C			Q8TEH9|Q9H7H3	RNA	SNP	-	NULL	ENST00000273083.3	37	NULL		3																																																																																			GRIP2	-	-	ENSG00000144596		0.642	GRIP2-001	KNOWN	basic	processed_transcript	GRIP2	HGNC	processed_transcript	OTTHUMT00000340582.2	-	0.00	91	0	G	NM_001080423		14559283	-1	tier1	-	no_errors	ENST00000273083	ensembl	human	known	74_37	rna	28.33	43	17	SNP	1.000	C
GSDMC	56169	genome.wustl.edu	37	8	130789698	130789698	+	Missense_Mutation	SNP	G	G	A	rs140640562	byFrequency	TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr8:130789698G>A	ENST00000276708.4	-	2	1017	c.136C>T	c.(136-138)Cgt>Tgt	p.R46C		NM_031415.2	NP_113603.1	Q9BYG8	GSDMC_HUMAN	gasdermin C	46						cytoplasm (GO:0005737)|microtubule organizing center (GO:0005815)|mitochondrion (GO:0005739)				autonomic_ganglia(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(5)|ovary(2)|pancreas(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)	26						AATGATGAACGAGAATCCTTC	0.418																																																	0								G	CYS/ARG	0,4406		0,0,2203	149.0	136.0	140.0		136	0.3	0.0	8	dbSNP_134	140	4,8596	3.7+/-12.6	0,4,4296	yes	missense	GSDMC	NM_031415.2	180	0,4,6499	AA,AG,GG		0.0465,0.0,0.0308	benign	46/509	130789698	4,13002	2203	4300	6503	SO:0001583	missense	0			AB042405	CCDS6360.1	8q24.21	2014-05-14	2008-07-31	2008-07-31	ENSG00000147697	ENSG00000147697			7151	protein-coding gene	gene with protein product		608384	"""melanoma-derived leucine zipper, extra-nuclear factor"""	MLZE		17350798	Standard	NM_031415		Approved		uc003ysr.3	Q9BYG8	OTTHUMG00000164851	ENST00000276708.4:c.136C>T	8.37:g.130789698G>A	ENSP00000276708:p.Arg46Cys		Q5XKF3|Q6P494	Missense_Mutation	SNP	pfam_Gasdermin	p.R46C	ENST00000276708.4	37	c.136	CCDS6360.1	8	.	.	.	.	.	.	.	.	.	.	G	6.926	0.540506	0.13250	0.0	4.65E-4	ENSG00000147697	ENST00000276708	T	0.24151	1.87	4.01	0.339	0.15979	.	6.925660	0.00166	N	0.000003	T	0.14013	0.0339	N	0.12182	0.205	0.09310	N	1	B	0.27264	0.173	B	0.20955	0.032	T	0.14420	-1.0473	10	0.38643	T	0.18	.	3.0667	0.06217	0.3781:0.2224:0.3996:0.0	.	46	Q9BYG8	GSDMC_HUMAN	C	46	ENSP00000276708:R46C	ENSP00000276708:R46C	R	-	1	0	GSDMC	130858880	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.788000	0.04614	0.073000	0.16731	-1.434000	0.01081	CGT	GSDMC	-	pfam_Gasdermin	ENSG00000147697		0.418	GSDMC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GSDMC	HGNC	protein_coding	OTTHUMT00000380586.1	-	0.00	45	0	G			130789698	-1	tier1	rs140640562	no_errors	ENST00000276708	ensembl	human	known	74_37	missense	12.00	22	3	SNP	0.000	A
GTF2I	2969	genome.wustl.edu	37	7	74120764	74120764	+	Splice_Site	SNP	G	G	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr7:74120764G>T	ENST00000324896.4	+	8	1074	c.685G>T	c.(685-687)Ggc>Tgc	p.G229C	AC083884.8_ENST00000434256.1_RNA|GTF2I_ENST00000416070.1_Splice_Site_p.G229C|GTF2I_ENST00000443166.1_Splice_Site_p.G229C|AC083884.8_ENST00000450426.2_RNA|GTF2I_ENST00000353920.4_Splice_Site_p.G229C|AC083884.8_ENST00000594967.1_RNA|GTF2I_ENST00000346152.4_Splice_Site_p.G229C	NM_032999.2	NP_127492.1	P78347	GTF2I_HUMAN	general transcription factor IIi	229					negative regulation of angiogenesis (GO:0016525)|signal transduction (GO:0007165)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(7)|kidney(1)|large_intestine(1)|lung(5)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	19						AGAAGATTCTGGTATGTACTA	0.398																																																	0													116.0	107.0	110.0					7																	74120764		2203	4300	6503	SO:0001630	splice_region_variant	0			U77948	CCDS5573.1, CCDS5574.1, CCDS5575.1, CCDS47614.1, CCDS64680.1	7q11.23	2011-05-25	2009-07-23			ENSG00000263001		"""General transcription factors"""	4659	protein-coding gene	gene with protein product		601679	"""general transcription factor II, i"""	WBSCR6		9334314, 9012831	Standard	NM_032999		Approved	TFII-I, BAP-135, SPIN, BTKAP1, DIWS, IB291	uc003uau.3	P78347		ENST00000324896.4:c.685+1G>T	7.37:g.74120764G>T			O14743|O15359|O43546|O43588|O43589|Q75M85|Q75M86|Q75M87|Q75M88|Q86U51|Q9BSZ4	Missense_Mutation	SNP	pfam_GTF2I,superfamily_GTF2I,pirsf_TF_II-I,pfscan_GTF2I	p.G229C	ENST00000324896.4	37	c.685	CCDS5573.1	7	.	.	.	.	.	.	.	.	.	.	G	21.2	4.110734	0.77210	.	.	ENSG00000077809	ENST00000324896;ENST00000539339;ENST00000353920;ENST00000346152;ENST00000416070;ENST00000443166	T;T;T;T;T	0.48201	1.36;1.37;1.38;1.4;0.82	5.41	5.41	0.78517	.	0.085953	0.49916	D	0.000137	T	0.65026	0.2652	L	0.50333	1.59	0.80722	D	1	D;D;D;D;D;D	0.89917	0.999;0.999;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.87578	0.915;0.946;0.996;0.961;0.998;0.993	T	0.67011	-0.5778	10	0.87932	D	0	-11.0065	17.7574	0.88453	0.0:0.0:1.0:0.0	.	229;229;229;229;229;229	Q499G6;P78347-2;P78347-3;P78347-4;P78347;Q86U51	.;.;.;.;GTF2I_HUMAN;.	C	229;224;229;229;229;229	ENSP00000322542:G229C;ENSP00000322671:G229C;ENSP00000322599:G229C;ENSP00000387651:G229C;ENSP00000404240:G229C	ENSP00000322542:G229C	G	+	1	0	GTF2I	73758700	1.000000	0.71417	1.000000	0.80357	0.902000	0.53008	6.388000	0.73195	2.537000	0.85549	0.561000	0.74099	GGC	GTF2I	-	pirsf_TF_II-I	ENSG00000077809		0.398	GTF2I-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GTF2I	HGNC	protein_coding	OTTHUMT00000252708.1	-	0.00	82	0	G	NM_032999	Missense_Mutation	74120764	+1	tier1	-	no_errors	ENST00000324896	ensembl	human	known	74_37	missense	5.88	64	4	SNP	1.000	T
HEATR5B	54497	genome.wustl.edu	37	2	37306470	37306470	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr2:37306470T>G	ENST00000233099.5	-	3	226	c.131A>C	c.(130-132)gAt>gCt	p.D44A	HEATR5B_ENST00000354531.2_Missense_Mutation_p.D44A	NM_019024.1	NP_061897.1	Q9P2D3	HTR5B_HUMAN	HEAT repeat containing 5B	44						extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)				breast(3)|cervix(3)|endometrium(3)|kidney(3)|large_intestine(11)|lung(31)|ovary(5)|pancreas(1)|prostate(1)|skin(10)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	77		all_hematologic(82;0.21)				TTCCTTTACATCGGTCTGTTA	0.269																																																	0													73.0	70.0	71.0					2																	37306470		2201	4297	6498	SO:0001583	missense	0			AB037835	CCDS33181.1	2p22.2	2007-01-02			ENSG00000008869	ENSG00000008869			29273	protein-coding gene	gene with protein product						10718198	Standard	XM_005264379		Approved	KIAA1414, DKFZp686P15184	uc002rpp.1	Q9P2D3	OTTHUMG00000152158	ENST00000233099.5:c.131A>C	2.37:g.37306470T>G	ENSP00000233099:p.Asp44Ala		B5MDU8|Q7Z3B2|Q9NVL7	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.D44A	ENST00000233099.5	37	c.131	CCDS33181.1	2	.	.	.	.	.	.	.	.	.	.	T	22.1	4.237885	0.79800	.	.	ENSG00000008869	ENST00000233099;ENST00000354531;ENST00000424416	T;T	0.08102	3.13;3.13	5.75	5.75	0.90469	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.26629	0.0651	M	0.67397	2.05	0.80722	D	1	D	0.63046	0.992	D	0.65987	0.94	T	0.00373	-1.1781	10	0.51188	T	0.08	-25.2482	16.0542	0.80782	0.0:0.0:0.0:1.0	.	44	Q9P2D3	HTR5B_HUMAN	A	44	ENSP00000233099:D44A;ENSP00000346531:D44A	ENSP00000233099:D44A	D	-	2	0	HEATR5B	37159974	1.000000	0.71417	1.000000	0.80357	0.865000	0.49528	7.892000	0.87324	2.188000	0.69820	0.460000	0.39030	GAT	HEATR5B	-	superfamily_ARM-type_fold	ENSG00000008869		0.269	HEATR5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HEATR5B	HGNC	protein_coding	OTTHUMT00000325492.1	-	0.00	43	0	T	NM_019024		37306470	-1	tier1	-	no_errors	ENST00000233099	ensembl	human	known	74_37	missense	15.38	22	4	SNP	1.000	G
HEBP2	23593	genome.wustl.edu	37	6	138727227	138727227	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr6:138727227C>T	ENST00000607197.1	+	3	635	c.358C>T	c.(358-360)Ccc>Tcc	p.P120S	HEBP2_ENST00000448741.1_Intron|HEBP2_ENST00000367697.3_Intron	NM_014320.2	NP_055135.1	Q9Y5Z4	HEBP2_HUMAN	heme binding protein 2	120					negative regulation of mitochondrial membrane potential (GO:0010917)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of necrotic cell death (GO:0010940)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)				endometrium(1)|large_intestine(1)|lung(3)	5	Breast(32;0.0933)			GBM - Glioblastoma multiforme(68;0.000732)|OV - Ovarian serous cystadenocarcinoma(155;0.00171)		ATTTGATCCACCCAGGCCTTT	0.443																																																	0													191.0	186.0	188.0					6																	138727227		2203	4300	6503	SO:0001583	missense	0			AF117616	CCDS5191.1	6q24	2008-08-29	2002-09-23	2002-09-27	ENSG00000051620	ENSG00000051620			15716	protein-coding gene	gene with protein product		605825	"""chromosome 6 open reading frame 34"""	C6orf34		10640688, 17098234	Standard	NM_014320		Approved	SOUL	uc003qhw.1	Q9Y5Z4	OTTHUMG00000015671	ENST00000607197.1:c.358C>T	6.37:g.138727227C>T	ENSP00000475750:p.Pro120Ser		Q96P57	Missense_Mutation	SNP	pfam_SOUL_haem-bd,superfamily_Reg_factor_effector_dom	p.P120S	ENST00000607197.1	37	c.358	CCDS5191.1	6	.	.	.	.	.	.	.	.	.	.	C	20.6	4.010531	0.75046	.	.	ENSG00000051620	ENST00000058691	T	0.67865	-0.29	5.33	5.33	0.75918	Regulatory factor, effector, bacterial (1);	0.000000	0.85682	D	0.000000	D	0.83769	0.5326	M	0.92738	3.34	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.87590	0.2490	9	.	.	.	.	15.9103	0.79467	0.0:1.0:0.0:0.0	.	120	Q9Y5Z4	HEBP2_HUMAN	S	120	ENSP00000058691:P120S	.	P	+	1	0	HEBP2	138768920	0.999000	0.42202	0.997000	0.53966	0.764000	0.43329	5.392000	0.66272	2.498000	0.84270	0.491000	0.48974	CCC	HEBP2	-	pfam_SOUL_haem-bd,superfamily_Reg_factor_effector_dom	ENSG00000051620		0.443	HEBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HEBP2	HGNC	protein_coding	OTTHUMT00000042426.2		0.00	62	0	C			138727227	+1			no_errors	ENST00000607197	ensembl	human	known	74_37	missense	6.25	30	2	SNP	0.999	T
HECTD1	25831	genome.wustl.edu	37	14	31614117	31614117	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr14:31614117C>G	ENST00000399332.1	-	16	3015	c.2527G>C	c.(2527-2529)Gac>Cac	p.D843H	RNU6-541P_ENST00000384709.1_RNA|HECTD1_ENST00000553700.1_Missense_Mutation_p.D843H	NM_015382.2	NP_056197.2	Q9ULT8	HECD1_HUMAN	HECT domain containing E3 ubiquitin protein ligase 1	843					neural tube closure (GO:0001843)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|metal ion binding (GO:0046872)|ubiquitin-protein transferase activity (GO:0004842)			breast(10)|endometrium(7)|kidney(5)|large_intestine(12)|lung(23)|ovary(4)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	70	Hepatocellular(127;0.0877)|Breast(36;0.176)		LUAD - Lung adenocarcinoma(48;0.00292)|Lung(238;0.0164)|BRCA - Breast invasive adenocarcinoma(188;0.111)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.00617)		TTAAAATGGTCATCGTATAAA	0.338																																																	0													71.0	67.0	69.0					14																	31614117		1865	4104	5969	SO:0001583	missense	0			AB032957	CCDS41939.1	14q12	2013-01-10	2012-02-23		ENSG00000092148	ENSG00000092148		"""Ankyrin repeat domain containing"""	20157	protein-coding gene	gene with protein product			"""HECT domain containing 1"""			10574461	Standard	XM_005267502		Approved	KIAA1131	uc001wrc.1	Q9ULT8	OTTHUMG00000170670	ENST00000399332.1:c.2527G>C	14.37:g.31614117C>G	ENSP00000382269:p.Asp843His		D3DS86|Q6P445|Q86VJ1|Q96F34|Q9UFZ7	Missense_Mutation	SNP	pfam_HECT,pfam_Sad1_UNC_C,pfam_Mib_Herc2,pfam_Ankyrin_rpt,superfamily_HECT,superfamily_Ankyrin_rpt-contain_dom,superfamily_ARM-type_fold,superfamily_Galactose-bd-like,smart_Ankyrin_rpt,smart_HECT,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_HECT	p.D843H	ENST00000399332.1	37	c.2527	CCDS41939.1	14	.	.	.	.	.	.	.	.	.	.	C	22.1	4.244069	0.79912	.	.	ENSG00000092148	ENST00000553700;ENST00000261312;ENST00000399332;ENST00000553957;ENST00000556224	T;T;T;T	0.72505	0.98;0.98;1.46;-0.66	5.54	5.54	0.83059	Armadillo-type fold (1);	0.000000	0.85682	U	0.000000	T	0.67468	0.2896	N	0.19112	0.55	0.80722	D	1	D;P	0.61697	0.99;0.917	P;P	0.49922	0.626;0.502	T	0.70714	-0.4796	10	0.51188	T	0.08	-9.4878	19.4923	0.95056	0.0:1.0:0.0:0.0	.	843;843	D3DS86;Q9ULT8	.;HECD1_HUMAN	H	843;843;843;317;843	ENSP00000450697:D843H;ENSP00000382269:D843H;ENSP00000451860:D317H;ENSP00000452015:D843H	ENSP00000261312:D843H	D	-	1	0	HECTD1	30683868	1.000000	0.71417	0.998000	0.56505	0.995000	0.86356	6.072000	0.71238	2.607000	0.88179	0.650000	0.86243	GAC	HECTD1	-	superfamily_ARM-type_fold	ENSG00000092148		0.338	HECTD1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	HECTD1	HGNC	protein_coding	OTTHUMT00000409942.1		0.00	46	0	C			31614117	-1			no_errors	ENST00000399332	ensembl	human	known	74_37	missense	7.14	26	2	SNP	1.000	G
HELLS	3070	genome.wustl.edu	37	10	96352185	96352185	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr10:96352185G>A	ENST00000348459.5	+	17	1990	c.1885G>A	c.(1885-1887)Gac>Aac	p.D629N	HELLS_ENST00000239026.6_3'UTR|HELLS_ENST00000394036.1_3'UTR|RP11-119K6.6_ENST00000432120.1_RNA|HELLS_ENST00000394045.1_Missense_Mutation_p.D531N|HELLS_ENST00000371332.4_Missense_Mutation_p.D675N	NM_018063.3	NP_060533.2			helicase, lymphoid-specific											endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(7)|lung(4)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	22		Colorectal(252;0.0429)		all cancers(201;2.13e-05)		AAGCATGTTGGACATTTTGAT	0.328																																																	0													86.0	84.0	84.0					10																	96352185		2203	4300	6503	SO:0001583	missense	0			AF155827	CCDS7434.1, CCDS73162.1, CCDS73163.1, CCDS73164.1, CCDS73165.1	10q24.2	2008-08-01			ENSG00000119969	ENSG00000119969			4861	protein-coding gene	gene with protein product	"""SWI/SNF2-related, matrix-associated, actin-dependent regulator of chromatin, subfamily A, member 6"", ""proliferation-associated SNF2-like protein"""	603946				9878251, 10910076	Standard	NM_018063		Approved	PASG, SMARCA6, LSH, Nbla10143	uc001kjt.3	Q9NRZ9	OTTHUMG00000018793	ENST00000348459.5:c.1885G>A	10.37:g.96352185G>A	ENSP00000239027:p.Asp629Asn			Missense_Mutation	SNP	pfam_SNF2_N,pfam_Helicase_C,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.D675N	ENST00000348459.5	37	c.2023	CCDS7434.1	10	.	.	.	.	.	.	.	.	.	.	G	29.3	4.993253	0.93167	.	.	ENSG00000119969	ENST00000348459;ENST00000394045;ENST00000371332;ENST00000371327	T;T;T;T	0.78126	-1.15;-1.15;-1.15;-1.15	5.83	5.83	0.93111	Helicase, C-terminal (2);	0.000000	0.85682	D	0.000000	D	0.84138	0.5406	L	0.36672	1.1	0.80722	D	1	D;D;D;P;D	0.89917	0.992;0.995;0.966;0.687;1.0	P;D;P;B;D	0.75484	0.898;0.925;0.872;0.189;0.986	D	0.85142	0.0981	10	0.87932	D	0	-17.1327	19.1118	0.93319	0.0:0.0:1.0:0.0	.	613;629;499;531;629	Q9NRZ9-2;Q6I7N8;Q9NRZ9-6;Q9NRZ9-5;Q9NRZ9	.;.;.;.;HELLS_HUMAN	N	629;531;675;66	ENSP00000239027:D629N;ENSP00000377609:D531N;ENSP00000360383:D675N;ENSP00000360378:D66N	ENSP00000239027:D629N	D	+	1	0	HELLS	96342175	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.588000	0.98232	2.746000	0.94184	0.563000	0.77884	GAC	HELLS	-	superfamily_P-loop_NTPase,smart_Helicase_C,pfscan_Helicase_C	ENSG00000119969		0.328	HELLS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HELLS	HGNC	protein_coding	OTTHUMT00000049475.1	-	0.00	37	0	G	NM_018063		96352185	+1	tier1	-	no_errors	ENST00000371332	ensembl	human	known	74_37	missense	31.25	11	5	SNP	1.000	A
HFE2	148738	genome.wustl.edu	37	1	145416492	145416493	+	Frame_Shift_Del	DEL	CT	CT	-			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	CT	CT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr1:145416492_145416493delCT	ENST00000336751.5	+	4	1075_1076	c.837_838delCT	c.(835-840)gcctacfs	p.Y280fs	HFE2_ENST00000475797.1_Frame_Shift_Del_p.Y54fs|HFE2_ENST00000497365.1_Frame_Shift_Del_p.Y54fs|HFE2_ENST00000357836.5_Frame_Shift_Del_p.Y167fs	NM_213653.3	NP_998818.1	Q6ZVN8	RGMC_HUMAN	hemochromatosis type 2 (juvenile)	280					axon guidance (GO:0007411)|BMP signaling pathway (GO:0030509)|iron ion homeostasis (GO:0055072)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)	coreceptor activity (GO:0015026)			central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(7)|ovary(1)|pancreas(1)	14	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					TCCAAGCTGCCTACATTGGCAC	0.515																																																	0																																										SO:0001589	frameshift_variant	0			AY372521	CCDS72877.1, CCDS72878.1, CCDS72879.1	1q21.2	2014-06-26			ENSG00000168509	ENSG00000168509			4887	protein-coding gene	gene with protein product	"""repulsive guidance molecule c"""	608374				10205270, 14647275	Standard	NM_213653		Approved	JH, HFE2A, RGMC, HJV, hemojuvelin, haemojuvelin	uc001eni.2	Q6ZVN8	OTTHUMG00000013748	ENST00000336751.5:c.837_838delCT	1.37:g.145416492_145416493delCT	ENSP00000337014:p.Tyr280fs		B1ALI7|Q2PQ63|Q6IMF6|Q8NAH2|Q8WVJ5	Frame_Shift_Del	DEL	pfam_RGM_N,pfam_RGM_C	p.Y280fs	ENST00000336751.5	37	c.837_838	CCDS910.1	1																																																																																			HFE2	-	pfam_RGM_C	ENSG00000168509		0.515	HFE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HFE2	HGNC	protein_coding	OTTHUMT00000038527.1		0.00	53	0	CT	NM_145277		145416493	+1	tier1		no_errors	ENST00000336751	ensembl	human	known	74_37	frame_shift_del	17.14	29	6	DEL	0.996:1.000	-
HHLA3	11147	genome.wustl.edu	37	1	70820576	70820576	+	5'UTR	SNP	C	C	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr1:70820576C>T	ENST00000359875.5	+	0	82				ANKRD13C_ENST00000370944.4_5'Flank|ANKRD13C_ENST00000262346.6_5'Flank|HHLA3_ENST00000370940.5_5'UTR|HHLA3_ENST00000432224.1_5'Flank|HHLA3_ENST00000486110.1_3'UTR|HHLA3_ENST00000361764.4_5'UTR|HHLA3_ENST00000531950.1_5'UTR	NM_001036645.1	NP_001031722.1	Q9XRX5	HHLA3_HUMAN	HERV-H LTR-associating 3											large_intestine(3)|lung(1)	4						GACCCCGAACCCGCACTCCCG	0.602																																																	0																																										SO:0001623	5_prime_UTR_variant	0			AF126164	CCDS649.1, CCDS30752.1, CCDS30753.1	1p31.1	2008-02-05			ENSG00000197568	ENSG00000197568			4906	protein-coding gene	gene with protein product		604372				10444326	Standard	NR_027404		Approved		uc001dfa.3	Q9XRX5	OTTHUMG00000009346	ENST00000359875.5:c.-59C>T	1.37:g.70820576C>T			D3DQ74|Q5VZP2|Q96FH5|Q9XRX4	RNA	SNP	-	NULL	ENST00000359875.5	37	NULL	CCDS30753.1	1																																																																																			HHLA3	-	-	ENSG00000197568		0.602	HHLA3-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	HHLA3	HGNC	protein_coding	OTTHUMT00000025911.2	-	0.00	46	0	C	NM_007071		70820576	+1	tier1	-	no_errors	ENST00000486110	ensembl	human	putative	74_37	rna	31.25	11	5	SNP	0.000	T
HIVEP1	3096	genome.wustl.edu	37	6	12125918	12125918	+	Missense_Mutation	SNP	G	G	C	rs546867775	byFrequency	TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr6:12125918G>C	ENST00000379388.2	+	4	6222	c.5890G>C	c.(5890-5892)Gcc>Ccc	p.A1964P	HIVEP1_ENST00000541134.1_5'Flank	NM_002114.2	NP_002105.2	P15822	ZEP1_HUMAN	human immunodeficiency virus type I enhancer binding protein 1	1964					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(11)|liver(1)|lung(31)|ovary(4)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	90	Breast(50;0.0639)|Ovarian(93;0.0816)	all_hematologic(90;0.117)				GAAAACTTCAGCCTATACTGA	0.438																																																	0													102.0	97.0	99.0					6																	12125918		1872	4110	5982	SO:0001583	missense	0			J05011	CCDS43426.1	6p24-p22.3	2012-10-05	2001-11-28		ENSG00000095951	ENSG00000095951		"""Zinc fingers, C2H2-type"""	4920	protein-coding gene	gene with protein product		194540	"""human immunodeficiency virus type I enhancer-binding protein 1"", ""zinc finger protein 40"""	ZNF40		2037300	Standard	XR_241895		Approved	CIRIP, MBP-1, CRYBP1, PRDII-BF1, ZAS1, Schnurri-1, ZNF40A	uc003nac.3	P15822	OTTHUMG00000014265	ENST00000379388.2:c.5890G>C	6.37:g.12125918G>C	ENSP00000368698:p.Ala1964Pro		B2RTU3|Q14122|Q5MPB1|Q5VW60	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.A1964P	ENST00000379388.2	37	c.5890	CCDS43426.1	6	.	.	.	.	.	.	.	.	.	.	G	33	5.278029	0.95459	.	.	ENSG00000095951	ENST00000379388	T	0.11169	2.8	6.07	6.07	0.98685	.	0.000000	0.36134	N	0.002771	T	0.31071	0.0785	M	0.80616	2.505	0.80722	D	1	D	0.76494	0.999	D	0.81914	0.995	T	0.01090	-1.1455	9	.	.	.	-28.172	20.6439	0.99570	0.0:0.0:1.0:0.0	.	1964	P15822	ZEP1_HUMAN	P	1964	ENSP00000368698:A1964P	.	A	+	1	0	HIVEP1	12233904	1.000000	0.71417	0.907000	0.35723	0.990000	0.78478	9.869000	0.99810	2.884000	0.98904	0.655000	0.94253	GCC	HIVEP1	-	NULL	ENSG00000095951		0.438	HIVEP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIVEP1	HGNC	protein_coding	OTTHUMT00000039870.2		0.00	50	0	G	NM_002114		12125918	+1			no_errors	ENST00000379388	ensembl	human	known	74_37	missense	10.71	25	3	SNP	1.000	C
HLA-F	3134	genome.wustl.edu	37	6	29706476	29706476	+	IGR	SNP	C	C	T	rs571033310		TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr6:29706476C>T	ENST00000440587.2	+	0	1622				HLA-F-AS1_ENST00000458236.1_RNA			P30511	HLAF_HUMAN	major histocompatibility complex, class I, F						antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|regulation of immune response (GO:0050776)|type I interferon signaling pathway (GO:0060337)	early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|membrane (GO:0016020)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	peptide antigen binding (GO:0042605)|TAP1 binding (GO:0046978)|TAP2 binding (GO:0046979)			cervix(1)|endometrium(1)|large_intestine(1)|lung(3)|prostate(1)|upper_aerodigestive_tract(1)	8						GCCAGCtgccccagggccacc	0.488													C|||	1	0.000199681	0.0	0.0	5008	,	,		16847	0.001		0.0	False		,,,				2504	0.0																0																																										SO:0001628	intergenic_variant	0			AY253269	CCDS43437.1, CCDS43438.1, CCDS43439.1	6p21.3	2013-01-11			ENSG00000204642	ENSG00000204642		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4963	protein-coding gene	gene with protein product		143110				1688605	Standard	NM_018950		Approved		uc003nno.4	P30511	OTTHUMG00000031156		6.37:g.29706476C>T			Q5JQI8|Q5JQJ1|Q5SPT5|Q860R0|Q8MGQ1|Q8WLP5|Q95HC0|Q9TP68	RNA	SNP	-	NULL	ENST00000440587.2	37	NULL		6																																																																																			HLA-F-AS1	-	-	ENSG00000214922		0.488	HLA-F-204	KNOWN	basic	protein_coding	HLA-F-AS1	HGNC	protein_coding			0.00	15	0	C	NM_018950		29706476	-1			no_errors	ENST00000399247	ensembl	human	known	74_37	rna	11.11	16	2	SNP	0.003	T
HMCN1	83872	genome.wustl.edu	37	1	186039872	186039872	+	Missense_Mutation	SNP	T	T	A			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr1:186039872T>A	ENST00000271588.4	+	52	8351	c.8122T>A	c.(8122-8124)Tgg>Agg	p.W2708R	HMCN1_ENST00000367492.2_Missense_Mutation_p.W2708R	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	2708	Ig-like C2-type 25.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						CTCCCTCAGCTGGTACAAGGA	0.398																																																	0													119.0	112.0	114.0					1																	186039872		2203	4300	6503	SO:0001583	missense	0			AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.8122T>A	1.37:g.186039872T>A	ENSP00000271588:p.Trp2708Arg		A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_G2_nidogen/fibulin_G2F,pfam_EGF-like_Ca-bd_dom,pfam_Thrombospondin_1_rpt,superfamily_GFP,superfamily_Thrombospondin_1_rpt,superfamily_Growth_fac_rcpt_N_dom,superfamily_Cadherin-like,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Thrombospondin_1_rpt,smart_G2_nidogen/fibulin_G2F,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_G2_nidogen/fibulin_G2F,pfscan_Thrombospondin_1_rpt,pfscan_Ig-like_dom	p.W2708R	ENST00000271588.4	37	c.8122	CCDS30956.1	1	.	.	.	.	.	.	.	.	.	.	T	24.2	4.508916	0.85282	.	.	ENSG00000143341	ENST00000271588;ENST00000367492	D;D	0.96300	-3.97;-3.97	5.71	5.71	0.89125	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.99093	0.9688	H	0.99391	4.545	0.80722	D	1	D	0.76494	0.999	D	0.85130	0.997	D	0.98903	1.0777	10	0.87932	D	0	.	15.9869	0.80160	0.0:0.0:0.0:1.0	.	2708	Q96RW7	HMCN1_HUMAN	R	2708	ENSP00000271588:W2708R;ENSP00000356462:W2708R	ENSP00000271588:W2708R	W	+	1	0	HMCN1	184306495	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.839000	0.86812	2.171000	0.68590	0.533000	0.62120	TGG	HMCN1	-	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,pfscan_Ig-like_dom	ENSG00000143341		0.398	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HMCN1	HGNC	protein_coding	OTTHUMT00000131848.1	-	0.00	39	0	T	NM_031935		186039872	+1	tier1	-	no_errors	ENST00000271588	ensembl	human	known	74_37	missense	21.43	11	3	SNP	1.000	A
HMGN5	79366	genome.wustl.edu	37	X	80370665	80370665	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chrX:80370665T>C	ENST00000358130.2	-	7	660	c.332A>G	c.(331-333)aAg>aGg	p.K111R	HMGN5_ENST00000491275.1_5'UTR	NM_030763.2	NP_110390.1	P82970	HMGN5_HUMAN	high mobility group nucleosome binding domain 5	111					chromatin modification (GO:0016568)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	chromatin (GO:0000785)|intracellular membrane-bounded organelle (GO:0043231)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(3)	10						ttctcctcccttttctGTGGC	0.363																																																	0													55.0	38.0	44.0					X																	80370665		2196	4291	6487	SO:0001583	missense	0			AF250329	CCDS14448.1	Xq13.3	2011-07-01	2011-04-05	2009-09-15	ENSG00000198157	ENSG00000198157		"""High-mobility group / Canonical"""	8013	protein-coding gene	gene with protein product		300385	"""nucleosomal binding protein 1"", ""high-mobility group nucleosome binding domain 5"""	NSBP1		11161810, 19748358	Standard	NM_030763		Approved		uc004eee.1	P82970	OTTHUMG00000021911	ENST00000358130.2:c.332A>G	X.37:g.80370665T>C	ENSP00000350848:p.Lys111Arg		Q5JSL1	Missense_Mutation	SNP	pfam_HMGN_fam,smart_HMGN_fam,prints_HMGN_fam	p.K111R	ENST00000358130.2	37	c.332	CCDS14448.1	X	.	.	.	.	.	.	.	.	.	.	T	7.933	0.741166	0.15642	.	.	ENSG00000198157	ENST00000358130;ENST00000447319;ENST00000373250;ENST00000430960	.	.	.	3.79	2.57	0.30868	.	0.822769	0.09841	U	0.748863	T	0.17874	0.0429	N	0.08118	0	0.09310	N	1	B	0.26400	0.148	B	0.15052	0.012	T	0.17868	-1.0355	9	0.72032	D	0.01	.	5.5559	0.17115	0.2479:0.0:0.0:0.7521	.	111	P82970	HMGN5_HUMAN	R	111;91;101;111	.	ENSP00000350848:K111R	K	-	2	0	HMGN5	80257321	0.016000	0.18221	0.027000	0.17364	0.210000	0.24377	0.472000	0.22116	0.596000	0.29794	0.441000	0.28932	AAG	HMGN5	-	NULL	ENSG00000198157		0.363	HMGN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HMGN5	HGNC	protein_coding	OTTHUMT00000057354.1		0.00	19	0	T	NM_030763		80370665	-1			no_errors	ENST00000358130	ensembl	human	known	74_37	missense	5.13	37	2	SNP	0.025	C
HNRNPK	3190	genome.wustl.edu	37	9	86593149	86593149	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr9:86593149C>T	ENST00000376264.2	-	3	277	c.19G>A	c.(19-21)Gaa>Aaa	p.E7K	RP11-575L7.8_ENST00000448389.1_RNA|HNRNPK_ENST00000376281.4_Missense_Mutation_p.E7K|HNRNPK_ENST00000360384.5_Missense_Mutation_p.E7K|HNRNPK_ENST00000376263.3_Missense_Mutation_p.E7K|HNRNPK_ENST00000351839.3_Missense_Mutation_p.E7K|RMI1_ENST00000325875.3_5'Flank	NM_002140.3|NM_031262.2	NP_002131.2|NP_112552.1	P61978	HNRPK_HUMAN	heterogeneous nuclear ribonucleoprotein K	7	Necessary for interaction with DDX1.				gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|positive regulation of low-density lipoprotein particle receptor biosynthetic process (GO:0045716)|positive regulation of receptor-mediated endocytosis (GO:0048260)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of lipid transport by positive regulation of transcription from RNA polymerase II promoter (GO:0072369)|regulation of low-density lipoprotein particle clearance (GO:0010988)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|signal transduction (GO:0007165)|viral process (GO:0016032)	catalytic step 2 spliceosome (GO:0071013)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|single-stranded DNA binding (GO:0003697)			endometrium(3)|kidney(2)|large_intestine(4)|lung(8)|skin(1)|stomach(1)	19						AAGGTTTCTTCTGGCTGTTCA	0.333																																																	0													84.0	85.0	85.0					9																	86593149		2203	4300	6503	SO:0001583	missense	0				CCDS6667.1, CCDS6668.1	9q21.32-q21.33	2011-10-24		2008-04-18	ENSG00000165119	ENSG00000165119			5044	protein-coding gene	gene with protein product	"""transformation upregulated nuclear protein"""	600712		HNRPK		8107114	Standard	NM_031263		Approved	CSBP, TUNP	uc004anf.4	P61978	OTTHUMG00000020107	ENST00000376264.2:c.19G>A	9.37:g.86593149C>T	ENSP00000365440:p.Glu7Lys		Q07244|Q15671|Q59F98|Q5T6W4|Q60577|Q922Y7|Q96J62	Missense_Mutation	SNP	pfam_KH_dom_type_1,pfam_ROK_N,smart_KH_dom,pfscan_KH_dom_type_1	p.E7K	ENST00000376264.2	37	c.19	CCDS6667.1	9	.	.	.	.	.	.	.	.	.	.	C	33	5.258206	0.95368	.	.	ENSG00000165119	ENST00000376281;ENST00000376264;ENST00000376263;ENST00000376268;ENST00000351839;ENST00000435158;ENST00000360384;ENST00000376258;ENST00000457156	T;T;T;T;T	0.50001	0.76;0.77;0.76;0.77;0.77	5.03	5.03	0.67393	ROK, N-terminal (1);	0.335623	0.32935	N	0.005464	T	0.58264	0.2110	L	0.29908	0.895	0.44462	D	0.997392	D;P;D;D;P;D;D;P	0.76494	0.998;0.822;0.999;0.999;0.913;0.998;0.977;0.929	D;B;D;D;P;D;P;P	0.83275	0.965;0.325;0.996;0.996;0.716;0.991;0.814;0.814	T	0.55431	-0.8142	10	0.33141	T	0.24	-3.9099	18.7128	0.91664	0.0:1.0:0.0:0.0	.	7;7;7;7;7;7;7;7	B4DUQ1;Q5T6W5;Q5EC54;B4DFF1;P61978-2;P61978-3;P61978;Q6IBN1	.;.;.;.;.;.;HNRPK_HUMAN;.	K	7	ENSP00000365458:E7K;ENSP00000365440:E7K;ENSP00000365439:E7K;ENSP00000317788:E7K;ENSP00000353552:E7K	ENSP00000317788:E7K	E	-	1	0	HNRNPK	85782969	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.110000	0.71535	2.480000	0.83734	0.655000	0.94253	GAA	HNRNPK	-	pfam_ROK_N	ENSG00000165119		0.333	HNRNPK-202	KNOWN	basic|appris_candidate|CCDS	protein_coding	HNRNPK	HGNC	protein_coding	OTTHUMT00000052846.2	-	0.00	114	0	C			86593149	-1	tier1	-	no_errors	ENST00000376263	ensembl	human	known	74_37	missense	23.81	32	10	SNP	1.000	T
HPS3	84343	genome.wustl.edu	37	3	148857972	148857972	+	Silent	SNP	G	G	A	rs563502898		TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr3:148857972G>A	ENST00000296051.2	+	2	539	c.399G>A	c.(397-399)tcG>tcA	p.S133S	HPS3_ENST00000460120.1_Intron	NM_032383.3	NP_115759.2	Q969F9	HPS3_HUMAN	Hermansky-Pudlak syndrome 3	133					organelle organization (GO:0006996)|pigmentation (GO:0043473)	BLOC-2 complex (GO:0031084)				breast(2)|endometrium(2)|kidney(1)|large_intestine(7)|lung(12)|ovary(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)	34			LUSC - Lung squamous cell carcinoma(72;0.0473)|Lung(72;0.0607)			TGCCGCTTTCGGAGGCCCCCT	0.438									Hermansky-Pudlak syndrome				G|||	1	0.000199681	0.0008	0.0	5008	,	,		18548	0.0		0.0	False		,,,				2504	0.0																0													133.0	132.0	132.0					3																	148857972		2203	4300	6503	SO:0001819	synonymous_variant	0	Familial Cancer Database	HPS, HPS1-8	AY033141	CCDS3140.1	3q24	2014-06-18			ENSG00000163755	ENSG00000163755			15597	protein-coding gene	gene with protein product		606118				11455388	Standard	NM_032383		Approved	SUTAL	uc003ewu.1	Q969F9	OTTHUMG00000159548	ENST00000296051.2:c.399G>A	3.37:g.148857972G>A			A8K6G6|Q8WTV6|Q96AP1|Q96MR3|Q9H608	Silent	SNP	pirsf_HPS3	p.S133	ENST00000296051.2	37	c.399	CCDS3140.1	3																																																																																			HPS3	-	pirsf_HPS3	ENSG00000163755		0.438	HPS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HPS3	HGNC	protein_coding	OTTHUMT00000356151.1		0.00	27	0	G	NM_032383		148857972	+1			no_errors	ENST00000296051	ensembl	human	known	74_37	silent	10.00	27	3	SNP	0.000	A
HSPG2	3339	genome.wustl.edu	37	1	22222429	22222429	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr1:22222429C>G	ENST00000374695.3	-	3	309	c.230G>C	c.(229-231)gGg>gCg	p.G77A		NM_005529.5	NP_005520.4	P98160	PGBM_HUMAN	heparan sulfate proteoglycan 2	77					angiogenesis (GO:0001525)|brain development (GO:0007420)|carbohydrate metabolic process (GO:0005975)|cardiac muscle tissue development (GO:0048738)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|chondrocyte differentiation (GO:0002062)|chondroitin sulfate metabolic process (GO:0030204)|embryonic skeletal system morphogenesis (GO:0048704)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|lipoprotein metabolic process (GO:0042157)|phototransduction, visible light (GO:0007603)|protein localization (GO:0008104)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	basal lamina (GO:0005605)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)			breast(6)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(15)|liver(1)|lung(44)|ovary(10)|pancreas(1)|prostate(10)|skin(9)|upper_aerodigestive_tract(3)|urinary_tract(3)	127		Colorectal(325;3.46e-05)|all_lung(284;7.93e-05)|Lung NSC(340;8.71e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0498)|OV - Ovarian serous cystadenocarcinoma(117;1.14e-26)|Colorectal(126;4.18e-07)|COAD - Colon adenocarcinoma(152;1.82e-05)|GBM - Glioblastoma multiforme(114;3.13e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000756)|STAD - Stomach adenocarcinoma(196;0.00656)|KIRC - Kidney renal clear cell carcinoma(1967;0.00942)|READ - Rectum adenocarcinoma(331;0.0721)|Lung(427;0.223)	Palifermin(DB00039)	CTGGAAGTCCCCGCTGCCCAG	0.572																																																	0													52.0	54.0	54.0					1																	22222429		2203	4300	6503	SO:0001583	missense	0			M85289	CCDS30625.1	1p36.1-p35	2013-01-29	2007-02-16	2007-02-16	ENSG00000142798	ENSG00000142798		"""Proteoglycans / Extracellular Matrix : Other"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5273	protein-coding gene	gene with protein product	"""perlecan proteoglycan"""	142461	"""Schwartz-Jampel syndrome 1 (chondrodystrophic myotonia)"""	SJS1		1685141, 11941538	Standard	XM_005245863		Approved	perlecan, PRCAN	uc001bfj.3	P98160	OTTHUMG00000002674	ENST00000374695.3:c.230G>C	1.37:g.22222429C>G	ENSP00000363827:p.Gly77Ala		Q16287|Q5SZI3|Q9H3V5	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Laminin_G,pfam_Laminin_B_type_IV,pfam_EGF_laminin,pfam_LDrepeatLR_classA_rpt,pfam_EG-like_dom,superfamily_ConA-like_lec_gl_sf,superfamily_LDrepeatLR_classA_rpt,smart_SEA_dom,smart_LDrepeatLR_classA_rpt,smart_EG-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Laminin_B_subgr,smart_EGF_laminin,smart_EGF-like_Ca-bd_dom,smart_Laminin_G,pfscan_EG-like_dom,pfscan_Laminin_B_type_IV,pfscan_EGF_laminin,pfscan_Laminin_G,pfscan_LDrepeatLR_classA_rpt,pfscan_SEA_dom,pfscan_Ig-like_dom,prints_LDrepeatLR_classA_rpt	p.G77A	ENST00000374695.3	37	c.230	CCDS30625.1	1	.	.	.	.	.	.	.	.	.	.	C	22.0	4.224680	0.79576	.	.	ENSG00000142798	ENST00000374695;ENST00000412328;ENST00000439717	T;T;T	0.76709	-1.04;-0.18;0.7	4.72	4.72	0.59763	.	0.000000	0.40302	N	0.001137	T	0.79747	0.4499	L	0.27053	0.805	0.32560	N	0.531218	D;B	0.89917	1.0;0.016	D;B	0.91635	0.999;0.008	T	0.80792	-0.1224	10	0.33940	T	0.23	.	13.0666	0.59036	0.0:1.0:0.0:0.0	.	56;77	Q5SZI5;P98160	.;PGBM_HUMAN	A	77;56;43	ENSP00000363827:G77A;ENSP00000405412:G56A;ENSP00000395884:G43A	ENSP00000363827:G77A	G	-	2	0	HSPG2	22095016	0.710000	0.27896	0.998000	0.56505	0.966000	0.64601	2.156000	0.42310	2.452000	0.82932	0.643000	0.83706	GGG	HSPG2	-	NULL	ENSG00000142798		0.572	HSPG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSPG2	HGNC	protein_coding	OTTHUMT00000007598.1	-	0.00	55	0	C	NM_005529		22222429	-1	tier1	-	no_errors	ENST00000374695	ensembl	human	known	74_37	missense	12.50	35	5	SNP	1.000	G
IFIT5	24138	genome.wustl.edu	37	10	91177056	91177056	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr10:91177056G>A	ENST00000371795.4	+	2	313	c.100G>A	c.(100-102)Gta>Ata	p.V34I	LIPA_ENST00000371837.1_5'Flank|IFIT5_ENST00000416601.1_Missense_Mutation_p.V34I	NM_012420.2	NP_036552.1	Q13325	IFIT5_HUMAN	interferon-induced protein with tetratricopeptide repeats 5	34					defense response to virus (GO:0051607)|innate immune response (GO:0045087)	actin cytoskeleton (GO:0015629)|apical part of cell (GO:0045177)|ruffle membrane (GO:0032587)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|single-stranded RNA binding (GO:0003727)|tRNA binding (GO:0000049)			endometrium(1)|large_intestine(4)|lung(4)	9						TCTGTTTGAGGTAGAAGATAC	0.368																																																	0													86.0	89.0	88.0					10																	91177056		2203	4300	6503	SO:0001583	missense	0			U34605	CCDS7403.1	10q23.31	2013-01-10			ENSG00000152778	ENSG00000152778		"""Tetratricopeptide (TTC) repeat domain containing"""	13328	protein-coding gene	gene with protein product	"""retinoic acid- and interferon-inducible protein (58kD)"""					9398535	Standard	NM_012420		Approved	RI58	uc010qnh.2	Q13325	OTTHUMG00000018713	ENST00000371795.4:c.100G>A	10.37:g.91177056G>A	ENSP00000360860:p.Val34Ile		B2R5X9|B4DDV1|Q5T7I9|Q6IAX3	Missense_Mutation	SNP	pfam_TPR_2,pfam_TPR_1,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.V34I	ENST00000371795.4	37	c.100	CCDS7403.1	10	.	.	.	.	.	.	.	.	.	.	G	12.79	2.042246	0.35989	.	.	ENSG00000152778	ENST00000371795;ENST00000416601	T;T	0.41400	1.0;1.0	6.03	1.74	0.24563	.	0.359282	0.29707	N	0.011411	T	0.16599	0.0399	N	0.08118	0	0.09310	N	0.99999	P;P	0.35844	0.524;0.524	B;B	0.31946	0.138;0.138	T	0.07028	-1.0794	10	0.45353	T	0.12	-12.1513	3.1861	0.06601	0.0835:0.2907:0.3774:0.2484	.	34;34	Q13325;B4DDV1	IFIT5_HUMAN;.	I	34	ENSP00000360860:V34I;ENSP00000414042:V34I	ENSP00000360860:V34I	V	+	1	0	IFIT5	91167036	0.013000	0.17824	0.998000	0.56505	0.872000	0.50106	0.170000	0.16663	1.495000	0.48549	0.655000	0.94253	GTA	IFIT5	-	NULL	ENSG00000152778		0.368	IFIT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IFIT5	HGNC	protein_coding	OTTHUMT00000049303.1		0.00	37	0	G	NM_012420		91177056	+1			no_errors	ENST00000371795	ensembl	human	known	74_37	missense	11.76	15	2	SNP	0.373	A
IDE	3416	genome.wustl.edu	37	10	94223528	94223528	+	Silent	SNP	G	G	A			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr10:94223528G>A	ENST00000265986.6	-	21	2777	c.2721C>T	c.(2719-2721)taC>taT	p.Y907Y	IDE_ENST00000371581.5_Silent_p.Y352Y|IDE_ENST00000496903.1_5'UTR	NM_004969.3	NP_004960.2	P14735	IDE_HUMAN	insulin-degrading enzyme	907					beta-amyloid metabolic process (GO:0050435)|bradykinin catabolic process (GO:0010815)|determination of adult lifespan (GO:0008340)|hormone catabolic process (GO:0042447)|insulin catabolic process (GO:1901143)|insulin metabolic process (GO:1901142)|insulin receptor signaling pathway (GO:0008286)|negative regulation of proteolysis (GO:0045861)|positive regulation of protein oligomerization (GO:0032461)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|protein homotetramerization (GO:0051289)|proteolysis (GO:0006508)|proteolysis involved in cellular protein catabolic process (GO:0051603)|ubiquitin homeostasis (GO:0010992)|viral process (GO:0016032)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic proteasome complex (GO:0031597)|extracellular space (GO:0005615)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|beta-amyloid binding (GO:0001540)|beta-endorphin binding (GO:0031626)|glycoprotein binding (GO:0001948)|insulin binding (GO:0043559)|metalloendopeptidase activity (GO:0004222)|peptide binding (GO:0042277)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|ubiquitin binding (GO:0043130)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(10)|liver(1)|lung(10)|ovary(2)|urinary_tract(2)	33					"""""""Insulin(DB00071)|Bacitracin(DB00626)|Insulin Regular(DB00030)"""	TTTCTCCCCAGTATTTAGCAC	0.398																																																	0													175.0	169.0	171.0					10																	94223528		2203	4300	6503	SO:0001819	synonymous_variant	0			M21188	CCDS7421.1, CCDS53554.1	10q23-q25	2007-03-27			ENSG00000119912	ENSG00000119912			5381	protein-coding gene	gene with protein product	"""insulysin"""	146680				2293021	Standard	NM_004969		Approved		uc001kia.3	P14735	OTTHUMG00000018759	ENST00000265986.6:c.2721C>T	10.37:g.94223528G>A			B2R721|B7ZAU2|D3DR35|Q5T5N2	Silent	SNP	pfam_Pept_M16_N,pfam_Peptidase_M16_C,superfamily_Metalloenz_LuxS/M16	p.Y907	ENST00000265986.6	37	c.2721	CCDS7421.1	10																																																																																			IDE	-	superfamily_Metalloenz_LuxS/M16	ENSG00000119912		0.398	IDE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IDE	HGNC	protein_coding	OTTHUMT00000049393.1		0.00	55	0	G	NM_004969		94223528	-1			no_errors	ENST00000265986	ensembl	human	known	74_37	silent	9.09	20	2	SNP	0.993	A
IFT20	90410	genome.wustl.edu	37	17	26656251	26656251	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr17:26656251G>C	ENST00000585313.1	-	5	402	c.265C>G	c.(265-267)Caa>Gaa	p.Q89E	IFT20_ENST00000578985.1_Missense_Mutation_p.Q115E|IFT20_ENST00000578122.1_Missense_Mutation_p.Q115E|IFT20_ENST00000395418.3_Missense_Mutation_p.Q89E|IFT20_ENST00000357896.3_Nonsense_Mutation_p.S128*|IFT20_ENST00000579419.1_Missense_Mutation_p.Q89E|IFT20_ENST00000585089.1_Missense_Mutation_p.Q115E	NM_001267775.1	NP_001254704.1	Q8IY31	IFT20_HUMAN	intraflagellar transport 20	89	IFT57-binding. {ECO:0000250}.				cardiac muscle cell differentiation (GO:0055007)|centrosome localization (GO:0051642)|cilium assembly (GO:0042384)|intraciliary transport (GO:0042073)|kidney development (GO:0001822)|neural precursor cell proliferation (GO:0061351)|opsin transport (GO:0036372)|photoreceptor cell outer segment organization (GO:0035845)|protein localization to cilium (GO:0061512)|protein localization to Golgi apparatus (GO:0034067)|regulation of autophagic vacuole assembly (GO:2000785)|regulation of canonical Wnt signaling pathway (GO:0060828)|regulation of cilium assembly (GO:1902017)|smoothened signaling pathway (GO:0007224)|visual learning (GO:0008542)	centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|ciliary base (GO:0097546)|cilium (GO:0005929)|dendrite terminus (GO:0044292)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intraciliary transport particle B (GO:0030992)|motile cilium (GO:0031514)|photoreceptor connecting cilium (GO:0032391)|photoreceptor outer segment (GO:0001750)				lung(2)	2	all_lung(13;0.000294)|Lung NSC(42;0.000964)			UCEC - Uterine corpus endometrioid carcinoma (53;0.153)		TGCTGCTGTTGAGCTTCTCTC	0.428																																																	0													246.0	208.0	221.0					17																	26656251		2203	4300	6503	SO:0001583	missense	0			AF070643	CCDS32593.1, CCDS58533.1, CCDS58534.1, CCDS58535.1, CCDS74017.1	17q11.2	2014-07-03	2014-07-03			ENSG00000109083		"""Intraflagellar transport homologs"""	30989	protein-coding gene	gene with protein product		614394	"""intraflagellar transport 20 homolog (Chlamydomonas)"""				Standard	NM_001267774		Approved		uc002hau.2	Q8IY31		ENST00000585313.1:c.265C>G	17.37:g.26656251G>C	ENSP00000463138:p.Gln89Glu		J3QL09|Q5GLZ2|Q9BUG5	Nonsense_Mutation	SNP	NULL	p.S128*	ENST00000585313.1	37	c.383	CCDS58534.1	17	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	35|35	5.565720|5.565720	0.96540|0.96540	.|.	.|.	ENSG00000109083|ENSG00000109083	ENST00000395418|ENST00000357896	.|.	.|.	.|.	5.73|5.73	5.73|5.73	0.89815|0.89815	.|.	0.046975|.	0.85682|.	D|.	0.000000|.	T|.	0.57198|.	0.2037|.	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	P;P|.	0.50443|.	0.935;0.663|.	P;B|.	0.45639|.	0.488;0.159|.	T|.	0.44097|.	-0.9350|.	8|.	0.11794|0.10111	T|T	0.64|0.7	-24.3538|-24.3538	19.2479|19.2479	0.93909|0.93909	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	89;115|.	Q8IY31;Q8IY31-2|.	IFT20_HUMAN;.|.	E|X	89|128	.|.	ENSP00000378809:Q89E|ENSP00000350570:S128X	Q|S	-|-	1|2	0|0	IFT20|IFT20	23680378|23680378	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.965000|0.965000	0.64279|0.64279	6.952000|6.952000	0.75989|0.75989	2.861000|2.861000	0.98227|0.98227	0.655000|0.655000	0.94253|0.94253	CAA|TCA	IFT20	-	NULL	ENSG00000109083		0.428	IFT20-008	NOVEL	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	IFT20	HGNC	protein_coding	OTTHUMT00000446153.2	-	0.00	48	0	G	NM_174887		26656251	-1	tier1	-	no_errors	ENST00000357896	ensembl	human	known	74_37	nonsense	23.08	20	6	SNP	1.000	C
IGDCC4	57722	genome.wustl.edu	37	15	65676433	65676433	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr15:65676433G>A	ENST00000352385.2	-	20	3876	c.3667C>T	c.(3667-3669)Cct>Tct	p.P1223S	IGDCC4_ENST00000558048.1_5'UTR	NM_020962.1	NP_066013.1	Q8TDY8	IGDC4_HUMAN	immunoglobulin superfamily, DCC subclass, member 4	1223						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(24)|ovary(1)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)	44						CTATCTCCAGGGGTCTCCTCT	0.657																																																	0													24.0	29.0	28.0					15																	65676433		2201	4298	6499	SO:0001583	missense	0				CCDS10206.1	15q22.31	2013-02-11			ENSG00000103742	ENSG00000103742		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	13770	protein-coding gene	gene with protein product	"""likely ortholog of mouse neighbor of Punc E11"""						Standard	NM_020962		Approved	NOPE, LOC57722	uc002aou.1	Q8TDY8	OTTHUMG00000133136	ENST00000352385.2:c.3667C>T	15.37:g.65676433G>A	ENSP00000319623:p.Pro1223Ser		Q9HCE4	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.P1223S	ENST00000352385.2	37	c.3667	CCDS10206.1	15	.	.	.	.	.	.	.	.	.	.	G	8.605	0.887808	0.17540	.	.	ENSG00000103742	ENST00000352385;ENST00000356152	T	0.58060	0.36	5.2	1.07	0.20283	.	0.340719	0.21657	N	0.071091	T	0.34077	0.0885	L	0.29908	0.895	0.24154	N	0.99569	B	0.06786	0.001	B	0.04013	0.001	T	0.20706	-1.0267	10	0.56958	D	0.05	-0.0693	4.5137	0.11924	0.1683:0.0:0.5261:0.3055	.	1223	Q8TDY8	IGDC4_HUMAN	S	1223;952	ENSP00000319623:P1223S	ENSP00000319623:P1223S	P	-	1	0	IGDCC4	63463486	1.000000	0.71417	0.963000	0.40424	0.004000	0.04260	0.901000	0.28445	0.229000	0.21039	-0.122000	0.15005	CCT	IGDCC4	-	NULL	ENSG00000103742		0.657	IGDCC4-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	IGDCC4	HGNC	protein_coding	OTTHUMT00000256825.2	-	0.00	121	0	G	NM_020962		65676433	-1	tier1	-	no_errors	ENST00000352385	ensembl	human	novel	74_37	missense	9.68	56	6	SNP	0.810	A
IRAK2	3656	genome.wustl.edu	37	3	10261453	10261453	+	Silent	SNP	C	C	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr3:10261453C>T	ENST00000256458.4	+	8	1083	c.993C>T	c.(991-993)atC>atT	p.I331I	RNU6-814P_ENST00000410416.1_RNA	NM_001570.3	NP_001561.3	O43187	IRAK2_HUMAN	interleukin-1 receptor-associated kinase 2	331	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interleukin-1-mediated signaling pathway (GO:0070498)|JNK cascade (GO:0007254)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein phosphorylation (GO:0006468)|regulation of cytokine-mediated signaling pathway (GO:0001959)|response to interleukin-1 (GO:0070555)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|endosome membrane (GO:0010008)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)			breast(4)|large_intestine(8)|lung(11)|prostate(1)|stomach(1)	25						GTCTGGAGATCATCCACAGCA	0.632																																																	0													75.0	61.0	66.0					3																	10261453		2203	4300	6503	SO:0001819	synonymous_variant	0			AF026273	CCDS33697.1	3p25.2	2008-08-18			ENSG00000134070	ENSG00000134070			6113	protein-coding gene	gene with protein product		603304				9374458	Standard	XR_245126		Approved		uc003bve.1	O43187	OTTHUMG00000155358	ENST00000256458.4:c.993C>T	3.37:g.10261453C>T			B4DQZ6|Q08AG6|Q5K546	Silent	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Death_domain,superfamily_Kinase-like_dom,superfamily_DEATH-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.I331	ENST00000256458.4	37	c.993	CCDS33697.1	3																																																																																			IRAK2	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000134070		0.632	IRAK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IRAK2	HGNC	protein_coding	OTTHUMT00000339623.1	-	0.00	40	0	C			10261453	+1	tier1	-	no_errors	ENST00000256458	ensembl	human	known	74_37	silent	17.39	38	8	SNP	0.977	T
IL1RAP	3556	genome.wustl.edu	37	3	190373709	190373709	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr3:190373709G>C	ENST00000317757.3	+	12	1583	c.1377G>C	c.(1375-1377)caG>caC	p.Q459H	IL1RAP_ENST00000443369.2_Missense_Mutation_p.Q459H	NM_001167931.1	NP_001161403.1	Q9NPH3	IL1AP_HUMAN	interleukin 1 receptor accessory protein	459	TIR. {ECO:0000255|PROSITE- ProRule:PRU00204}.				immune response (GO:0006955)|inflammatory response (GO:0006954)|interleukin-2 biosynthetic process (GO:0042094)|protein complex assembly (GO:0006461)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	interleukin-1 receptor activity (GO:0004908)|signal transducer activity (GO:0004871)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(8)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	20	all_cancers(143;3.61e-10)|Ovarian(172;0.0733)|Breast(254;0.21)		Lung(62;1.95e-06)|LUSC - Lung squamous cell carcinoma(58;2.05e-06)	GBM - Glioblastoma multiforme(93;0.00851)		ATTTCATTCAGAGAAGCAGAA	0.388																																																	0													121.0	99.0	106.0					3																	190373709		692	1591	2283	SO:0001583	missense	0			AB006537	CCDS3298.1, CCDS46982.1, CCDS54696.1	3q28	2013-01-11			ENSG00000196083	ENSG00000196083		"""Interleukins and interleukin receptors"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5995	protein-coding gene	gene with protein product		602626				9479509, 9065432	Standard	NM_002182		Approved	IL-1RAcP, IL1R3, C3orf13	uc003fsq.3	Q9NPH3	OTTHUMG00000156211	ENST00000317757.3:c.1377G>C	3.37:g.190373709G>C	ENSP00000314807:p.Gln459His		B1NLD0|D3DNW0|O14915|Q86WJ7	Missense_Mutation	SNP	pfam_TIR_dom,superfamily_TIR_dom,smart_Ig_sub,smart_TIR_dom,pfscan_TIR_dom,pfscan_Ig-like_dom,prints_IL-1_rcpt_I/II-typ	p.Q459H	ENST00000317757.3	37	c.1377	CCDS54696.1	3	.	.	.	.	.	.	.	.	.	.	G	15.54	2.863114	0.51482	.	.	ENSG00000196083	ENST00000443369;ENST00000317757	T;T	0.08370	3.1;3.1	5.76	2.9	0.33743	.	.	.	.	.	T	0.23806	0.0576	.	.	.	0.80722	D	1	D	0.71674	0.998	D	0.67725	0.953	T	0.00230	-1.1897	8	0.52906	T	0.07	.	9.8105	0.40820	0.2285:0.0:0.7715:0.0	.	459	Q9NPH3-5	.	H	459	ENSP00000408893:Q459H;ENSP00000314807:Q459H	ENSP00000314807:Q459H	Q	+	3	2	IL1RAP	191856403	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	2.252000	0.43196	0.301000	0.22738	0.655000	0.94253	CAG	IL1RAP	-	pfam_TIR_dom,superfamily_TIR_dom,smart_TIR_dom,pfscan_TIR_dom	ENSG00000196083		0.388	IL1RAP-006	PUTATIVE	basic|appris_candidate_longest|CCDS	protein_coding	IL1RAP	HGNC	protein_coding	OTTHUMT00000343502.1	-	0.00	66	0	G			190373709	+1	tier1	-	no_errors	ENST00000443369	ensembl	human	known	74_37	missense	19.23	21	5	SNP	1.000	C
ITIH5	80760	genome.wustl.edu	37	10	7601805	7601806	+	Frame_Shift_Ins	INS	-	-	T	rs529327910		TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr10:7601805_7601806insT	ENST00000397146.2	-	12	2143_2144	c.2038_2039insA	c.(2038-2040)agafs	p.R680fs	ITIH5_ENST00000256861.6_3'UTR			Q86UX2	ITIH5_HUMAN	inter-alpha-trypsin inhibitor heavy chain family, member 5	132					hyaluronan metabolic process (GO:0030212)	extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(5)|kidney(6)|large_intestine(21)|lung(25)|ovary(4)|pancreas(1)|skin(2)|stomach(1)|urinary_tract(3)	75						tctcccatgtcttttttttgtt	0.505																																																	0																																										SO:0001589	frameshift_variant	0					10p14	2011-10-26	2011-10-26		ENSG00000123243	ENSG00000123243			21449	protein-coding gene	gene with protein product		609783	"""inter-alpha (globulin) inhibitor H5"""			14744536	Standard	NM_001001851		Approved	MGC10848	uc021pmv.1	Q86UX2	OTTHUMG00000017635	ENST00000397146.2:c.2039dupA	10.37:g.7601813_7601813dupT	ENSP00000380333:p.Arg680fs		Q5T664|Q5T665|Q5T666|Q6AI60|Q6UXB7|Q8TF48|Q8WYV2|Q96K70	Frame_Shift_Ins	INS	pfam_VIT,pfam_VWF_A,smart_VIT,smart_VWF_A,pfscan_VWF_A	p.R680fs	ENST00000397146.2	37	c.2039_2038		10																																																																																			ITIH5	-	NULL	ENSG00000123243		0.505	ITIH5-202	KNOWN	basic	protein_coding	ITIH5	HGNC	protein_coding			0.00	29	0	0	NM_030569		7601806	-1			no_errors	ENST00000397146	ensembl	human	known	74_37	frame_shift_ins	50.00	3	3	INS	0.020:0.020	T
KCNJ13	3769	genome.wustl.edu	37	2	233633414	233633414	+	Missense_Mutation	SNP	T	T	A			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr2:233633414T>A	ENST00000233826.3	-	3	709	c.570A>T	c.(568-570)caA>caT	p.Q190H	GIGYF2_ENST00000373563.4_Intron|GIGYF2_ENST00000409480.1_Intron|GIGYF2_ENST00000373566.3_Intron|KCNJ13_ENST00000410029.1_Missense_Mutation_p.Q190H|GIGYF2_ENST00000409547.1_Intron|GIGYF2_ENST00000409451.3_Intron|AC064852.4_ENST00000427571.1_RNA|KCNJ13_ENST00000409779.1_3'UTR|GIGYF2_ENST00000452341.2_Intron|GIGYF2_ENST00000409196.3_Intron	NM_002242.4	NP_002233.2	O60928	KCJ13_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 13	190					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)	integral component of membrane (GO:0016021)	inward rectifier potassium channel activity (GO:0005242)			endometrium(3)|large_intestine(2)|lung(2)|stomach(1)|urinary_tract(1)	9		Breast(86;0.00279)|all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0306)|Lung NSC(271;0.0908)		Epithelial(121;5.9e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000311)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00942)|GBM - Glioblastoma multiforme(43;0.0617)		TGTTGGCCACTTGGAAGATAA	0.478																																																	0													141.0	141.0	141.0					2																	233633414		2203	4300	6503	SO:0001583	missense	0			AJ006128	CCDS2498.1, CCDS54437.1	2q37	2014-01-28			ENSG00000115474	ENSG00000115474		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6259	protein-coding gene	gene with protein product		603208				9878260, 9620703, 16382105	Standard	NM_002242		Approved	Kir7.1, Kir1.4, LCA16	uc002vtp.3	O60928	OTTHUMG00000153292	ENST00000233826.3:c.570A>T	2.37:g.233633414T>A	ENSP00000233826:p.Gln190His		A0PGH1|O76023|Q53SA1|Q8N3Y4	Missense_Mutation	SNP	pfam_K_chnl_inward-rec_Kir,superfamily_Ig_E-set,pirsf_K_chnl_inward-rec_Kir,prints_KCNJ13,prints_K_chnl_inward-rec_Kir	p.Q190H	ENST00000233826.3	37	c.570	CCDS2498.1	2	.	.	.	.	.	.	.	.	.	.	T	18.53	3.644100	0.67244	.	.	ENSG00000115474	ENST00000233826;ENST00000410029;ENST00000438786	D;D;D	0.91792	-2.91;-2.91;-2.91	6.07	6.07	0.98685	Immunoglobulin E-set (1);Potassium channel, inwardly rectifying, Kir, conserved region 2 (1);Potassium channel, inwardly rectifying, Kir, cytoplasmic (1);	0.108127	0.64402	D	0.000002	D	0.93132	0.7813	L	0.56769	1.78	0.52501	D	0.999956	D	0.55385	0.971	P	0.55161	0.77	D	0.93419	0.6775	10	0.87932	D	0	.	11.1894	0.48677	0.0:0.0761:0.0:0.9239	.	190	O60928	IRK13_HUMAN	H	190;190;110	ENSP00000233826:Q190H;ENSP00000386251:Q190H;ENSP00000407284:Q110H	ENSP00000233826:Q190H	Q	-	3	2	KCNJ13	233341658	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.174000	0.50847	2.326000	0.78906	0.533000	0.62120	CAA	KCNJ13	-	pfam_K_chnl_inward-rec_Kir,superfamily_Ig_E-set,pirsf_K_chnl_inward-rec_Kir	ENSG00000115474		0.478	KCNJ13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNJ13	HGNC	protein_coding	OTTHUMT00000257036.1	-	0.00	27	0	T	NM_002242		233633414	-1	tier1	-	no_errors	ENST00000233826	ensembl	human	known	74_37	missense	25.93	20	7	SNP	1.000	A
KCNK13	56659	genome.wustl.edu	37	14	90651010	90651010	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr14:90651010G>T	ENST00000282146.4	+	2	1331	c.890G>T	c.(889-891)gGg>gTg	p.G297V		NM_022054.2	NP_071337.2	Q9HB14	KCNKD_HUMAN	potassium channel, subfamily K, member 13	297					synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium channel activity (GO:0005267)|voltage-gated ion channel activity (GO:0005244)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(12)|prostate(1)|skin(4)	25		all_cancers(154;0.186)				ATGGACAGCGGGTGCTGCCCG	0.532																																																	0													73.0	79.0	77.0					14																	90651010		2203	4300	6503	SO:0001583	missense	0			AF287303	CCDS9889.1	14q32.11	2012-03-07				ENSG00000152315		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6275	protein-coding gene	gene with protein product		607367				11060316, 16382106	Standard	NM_022054		Approved	K2p13.1, THIK-1, THIK1	uc001xye.1	Q9HB14		ENST00000282146.4:c.890G>T	14.37:g.90651010G>T	ENSP00000282146:p.Gly297Val		B5TJL8|Q96E79	Missense_Mutation	SNP	pfam_2pore_dom_K_chnl_dom,prints_2pore_dom_K_chnl_THIK,prints_2pore_dom_K_chnl,prints_2pore_dom_K_chnl_TASK	p.G297V	ENST00000282146.4	37	c.890	CCDS9889.1	14	.	.	.	.	.	.	.	.	.	.	G	0.088	-1.172518	0.01646	.	.	ENSG00000152315	ENST00000282146	T	0.11930	2.73	5.3	1.63	0.23807	.	1.327990	0.05258	N	0.515280	T	0.15262	0.0368	L	0.50333	1.59	0.19575	N	0.999964	B	0.14438	0.01	B	0.20184	0.028	T	0.36040	-0.9764	10	0.31617	T	0.26	.	8.2203	0.31537	0.2992:0.1137:0.5871:0.0	.	297	Q9HB14	KCNKD_HUMAN	V	297	ENSP00000282146:G297V	ENSP00000282146:G297V	G	+	2	0	KCNK13	89720763	0.851000	0.29673	0.013000	0.15412	0.038000	0.13279	1.403000	0.34612	0.499000	0.27970	0.655000	0.94253	GGG	KCNK13	-	NULL	ENSG00000152315		0.532	KCNK13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNK13	HGNC	protein_coding	OTTHUMT00000411251.1		0.00	31	0	G	NM_022054		90651010	+1			no_errors	ENST00000282146	ensembl	human	known	74_37	missense	10.00	18	2	SNP	0.012	T
KDELR2	11014	genome.wustl.edu	37	7	6522212	6522212	+	Intron	SNP	A	A	C			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr7:6522212A>C	ENST00000258739.4	-	1	276				KDELR2_ENST00000463747.1_Intron|FLJ20306_ENST00000601673.1_5'Flank|KDELR2_ENST00000490996.1_Intron|DAGLB_ENST00000436575.1_Intron	NM_006854.3	NP_006845.1	P33947	ERD22_HUMAN	KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 2						intracellular protein transport (GO:0006886)|protein retention in ER lumen (GO:0006621)|vesicle-mediated transport (GO:0016192)	cis-Golgi network (GO:0005801)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	KDEL sequence binding (GO:0005046)			central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(5)|ovary(1)	10		Ovarian(82;0.0776)		UCEC - Uterine corpus endometrioid carcinoma (126;0.101)		ccaaggagacaggcgaggcct	0.418																																																	0																																										SO:0001627	intron_variant	0			X63745	CCDS5351.1, CCDS43550.1	7p	2008-05-02			ENSG00000136240	ENSG00000136240			6305	protein-coding gene	gene with protein product		609024				1316805, 1325562	Standard	NM_006854		Approved	ELP-1, ERD2.2	uc003sqe.4	P33947	OTTHUMG00000023103	ENST00000258739.4:c.91+1385T>G	7.37:g.6522212A>C			A4D2P4|Q6IPC5|Q96E30	Missense_Mutation	SNP	NULL	p.C34G	ENST00000258739.4	37	c.100	CCDS5351.1	7																																																																																			KDELR2	-	NULL	ENSG00000136240		0.418	KDELR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KDELR2	HGNC	protein_coding	OTTHUMT00000059424.2	-	0.00	48	0	A			6522212	-1	tier1	-	no_errors	ENST00000382267	ensembl	human	known	74_37	missense	26.32	28	10	SNP	0.144	C
KDM4D	55693	genome.wustl.edu	37	11	94730972	94730972	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr11:94730972G>C	ENST00000335080.5	+	3	1268	c.436G>C	c.(436-438)Gat>Cat	p.D146H	KDM4D_ENST00000536741.1_Missense_Mutation_p.D146H	NM_018039.2	NP_060509.2	Q6B0I6	KDM4D_HUMAN	lysine (K)-specific demethylase 4D	146	JmjC. {ECO:0000255|PROSITE- ProRule:PRU00538}.				chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	blood microparticle (GO:0072562)|nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|metal ion binding (GO:0046872)			endometrium(4)|kidney(2)|large_intestine(2)|liver(2)|lung(16)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	30						CTCCTTGTTTGATGAAAACAC	0.443																																																	0													92.0	90.0	91.0					11																	94730972		2201	4298	6499	SO:0001583	missense	0			AK001113	CCDS8302.1	11q21	2012-03-28	2009-04-06	2009-04-06	ENSG00000186280	ENSG00000186280		"""Chromatin-modifying enzymes / K-demethylases"""	25498	protein-coding gene	gene with protein product		609766	"""jumonji domain containing 2D"""	JMJD2D		15138608	Standard	NM_018039		Approved	FLJ10251	uc001pfe.3	Q6B0I6	OTTHUMG00000167838	ENST00000335080.5:c.436G>C	11.37:g.94730972G>C	ENSP00000334181:p.Asp146His		B3KPC4|Q0VF39|Q9NT41|Q9NW76	Missense_Mutation	SNP	pfam_JmjC_dom,pfam_TF_JmjN,smart_TF_JmjN,smart_JmjC_dom,pfscan_TF_JmjN,pfscan_JmjC_dom	p.D146H	ENST00000335080.5	37	c.436	CCDS8302.1	11	.	.	.	.	.	.	.	.	.	.	G	23.3	4.402261	0.83230	.	.	ENSG00000186280	ENST00000335080	T	0.29655	1.56	3.91	3.91	0.45181	Transcription factor jumonji/aspartyl beta-hydroxylase (2);	0.000000	0.64402	U	0.000002	T	0.60573	0.2279	M	0.93197	3.39	0.43156	D	0.994938	D	0.89917	1.0	D	0.70016	0.967	T	0.68712	-0.5336	10	0.87932	D	0	-26.4954	9.1856	0.37168	0.0:0.0:0.7836:0.2164	.	146	Q6B0I6	KDM4D_HUMAN	H	146	ENSP00000334181:D146H	ENSP00000334181:D146H	D	+	1	0	KDM4D	94370620	0.975000	0.34042	0.084000	0.20598	0.957000	0.61999	2.216000	0.42871	2.478000	0.83669	0.563000	0.77884	GAT	KDM4D	-	smart_JmjC_dom,pfscan_JmjC_dom	ENSG00000186280		0.443	KDM4D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KDM4D	HGNC	protein_coding	OTTHUMT00000396558.2		0.00	37	0	G	NM_018039		94730972	+1			no_errors	ENST00000335080	ensembl	human	known	74_37	missense	7.14	26	2	SNP	0.932	C
KIAA0319	9856	genome.wustl.edu	37	6	24564486	24564486	+	Missense_Mutation	SNP	A	A	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr6:24564486A>T	ENST00000378214.3	-	15	2899	c.2375T>A	c.(2374-2376)gTc>gAc	p.V792D	KIAA0319_ENST00000430948.2_Missense_Mutation_p.V747D|KIAA0319_ENST00000535378.1_Missense_Mutation_p.V783D|KIAA0319_ENST00000537886.1_Missense_Mutation_p.V792D|KIAA0319_ENST00000543707.1_Missense_Mutation_p.V792D	NM_001168375.1|NM_014809.3	NP_001161847.1|NP_055624.2	Q5VV43	K0319_HUMAN	KIAA0319	792	PKD 5. {ECO:0000255|PROSITE- ProRule:PRU00151}.				negative regulation of dendrite development (GO:2000171)|neuron migration (GO:0001764)	early endosome (GO:0005769)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(3)|endometrium(6)|kidney(3)|large_intestine(11)|lung(19)|ovary(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)	53						ACTGTCGGTGACTCGCAAGTG	0.592																																																	0													103.0	83.0	90.0					6																	24564486		2203	4300	6503	SO:0001583	missense	0			AB002317	CCDS34348.1, CCDS54969.1, CCDS54970.1, CCDS54971.1, CCDS75409.1	6p22.3	2013-12-13			ENSG00000137261	ENSG00000137261			21580	protein-coding gene	gene with protein product	"""neuronal migration"""	609269				9205841, 15514892	Standard	NM_014809		Approved	NMIG	uc003neh.1	Q5VV43	OTTHUMG00000014358	ENST00000378214.3:c.2375T>A	6.37:g.24564486A>T	ENSP00000367459:p.Val792Asp		A7MD37|B2RTU7|B4DHA7|B4DK75|B7ZML3|F5H123|Q9UJC8|Q9Y4G7	Missense_Mutation	SNP	pfam_PKD/REJ-like,superfamily_PKD_dom,smart_MANSC_N,smart_Fibronectin_type3,smart_PKD/Chitinase_dom,pfscan_MANSC,pfscan_PKD_dom	p.V792D	ENST00000378214.3	37	c.2375	CCDS34348.1	6	.	.	.	.	.	.	.	.	.	.	A	18.38	3.612036	0.66672	.	.	ENSG00000137261	ENST00000537886;ENST00000535378;ENST00000430948;ENST00000378214;ENST00000543707	T;T;T;T;T	0.24723	1.84;1.84;1.84;1.84;1.84	4.32	4.32	0.51571	PKD/Chitinase domain (1);Fibronectin, type III (1);PKD domain (2);	0.000000	0.64402	D	0.000005	T	0.59636	0.2208	H	0.97983	4.12	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.91635	0.972;0.998;0.999	T	0.76282	-0.3016	10	0.87932	D	0	-16.6387	13.6516	0.62314	1.0:0.0:0.0:0.0	.	792;783;792	F5H123;Q5VV43-2;Q5VV43	.;.;K0319_HUMAN	D	792;783;747;792;792	ENSP00000439700:V792D;ENSP00000442403:V783D;ENSP00000401086:V747D;ENSP00000367459:V792D;ENSP00000437656:V792D	ENSP00000367459:V792D	V	-	2	0	KIAA0319	24672465	1.000000	0.71417	0.027000	0.17364	0.540000	0.34992	8.087000	0.89521	1.796000	0.52611	0.533000	0.62120	GTC	KIAA0319	-	pfam_PKD/REJ-like,superfamily_PKD_dom,smart_Fibronectin_type3,smart_PKD/Chitinase_dom	ENSG00000137261		0.592	KIAA0319-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0319	HGNC	protein_coding	OTTHUMT00000040009.1		0.00	26	0	A	NM_014809		24564486	-1			no_errors	ENST00000378214	ensembl	human	known	74_37	missense	10.34	26	3	SNP	1.000	T
KIAA0368	23392	genome.wustl.edu	37	9	114132855	114132855	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr9:114132855G>C	ENST00000338205.5	-	44	5053	c.4834C>G	c.(4834-4836)Caa>Gaa	p.Q1612E	KIAA0368_ENST00000465499.1_5'UTR|KIAA0368_ENST00000259335.4_Missense_Mutation_p.Q1790E|KIAA0368_ENST00000374378.3_Missense_Mutation_p.Q76E			Q5VYK3	ECM29_HUMAN	KIAA0368	1618					ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)	centrosome (GO:0005813)|cytoplasmic membrane-bounded vesicle (GO:0016023)|early endosome (GO:0005769)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle (GO:0030134)|late endosome (GO:0005770)|membrane (GO:0016020)|multivesicular body (GO:0005771)|nucleus (GO:0005634)|proteasome complex (GO:0000502)				NS(2)|breast(3)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(23)|prostate(3)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	65						AGAACAGCTTGAAGAATTTCA	0.418																																																	0													63.0	60.0	61.0					9																	114132855		1894	4106	6000	SO:0001583	missense	0			AK025689	CCDS48006.1	9q32	2012-11-29	2006-11-23	2006-11-23	ENSG00000136813	ENSG00000136813			29020	protein-coding gene	gene with protein product	"""ECM29 homolog (S. cerevisiae)"""					9205841, 15496406, 20682791	Standard	NM_001080398		Approved	FLJ22036, ECM29	uc004bfe.1	Q5VYK3	OTTHUMG00000020489	ENST00000338205.5:c.4834C>G	9.37:g.114132855G>C	ENSP00000339889:p.Gln1612Glu		O15074|Q8WU82	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.Q1790E	ENST00000338205.5	37	c.5368		9	.	.	.	.	.	.	.	.	.	.	G	5.988	0.366255	0.11352	.	.	ENSG00000136813	ENST00000338205;ENST00000259335;ENST00000374383;ENST00000543827;ENST00000374378	T;T	0.65732	-0.17;-0.17	5.79	5.79	0.91817	.	0.122398	0.56097	D	0.000033	T	0.45696	0.1355	N	0.17082	0.46	0.48975	D	0.999737	B	0.02656	0.0	B	0.04013	0.001	T	0.46748	-0.9169	10	0.02654	T	1	.	20.031	0.97536	0.0:0.0:1.0:0.0	.	1087	B3KXF2	.	E	1612;1790;76;1087;76	ENSP00000259335:Q1790E;ENSP00000363499:Q76E	ENSP00000259335:Q1790E	Q	-	1	0	KIAA0368	113172676	1.000000	0.71417	0.999000	0.59377	0.993000	0.82548	6.751000	0.74893	2.735000	0.93741	0.655000	0.94253	CAA	KIAA0368	-	superfamily_ARM-type_fold	ENSG00000136813		0.418	KIAA0368-001	NOVEL	basic|appris_candidate	protein_coding	KIAA0368	HGNC	protein_coding	OTTHUMT00000053637.2	-	0.00	73	0	G	NM_014686		114132855	-1	tier1	-	no_errors	ENST00000259335	ensembl	human	known	74_37	missense	13.64	38	6	SNP	1.000	C
KIAA0586	9786	genome.wustl.edu	37	14	58896142	58896142	+	Silent	SNP	G	G	A			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr14:58896142G>A	ENST00000556134.1	+	3	490	c.216G>A	c.(214-216)gtG>gtA	p.V72V	KIAA0586_ENST00000261244.5_Silent_p.V87V|TIMM9_ENST00000395159.2_5'Flank|TIMM9_ENST00000555593.1_5'Flank|TIMM9_ENST00000216463.4_5'Flank|TIMM9_ENST00000556007.2_5'Flank|KIAA0586_ENST00000354386.6_Silent_p.V99V|KIAA0586_ENST00000423743.3_Silent_p.V2V|TIMM9_ENST00000555404.1_5'Flank|RP11-517O13.1_ENST00000556734.1_RNA	NM_001244190.1|NM_001244193.1	NP_001231119.1|NP_001231122.1	Q9BVV6	TALD3_HUMAN	KIAA0586	72					cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|regulation of establishment of protein localization (GO:0070201)|smoothened signaling pathway (GO:0007224)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)				endometrium(4)|kidney(6)|large_intestine(8)|lung(12)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						ATCCCATGGTGTCAGAAAGTG	0.303																																																	0													122.0	118.0	120.0					14																	58896142		1807	4063	5870	SO:0001819	synonymous_variant	0			AB011158	CCDS45115.1, CCDS58320.1, CCDS58321.1, CCDS58322.1, CCDS73639.1	14q23.1	2012-12-06			ENSG00000100578	ENSG00000100578			19960	protein-coding gene	gene with protein product		610178				16702409	Standard	NM_014749		Approved	Talpid3	uc010trr.2	Q9BVV6	OTTHUMG00000171141	ENST00000556134.1:c.216G>A	14.37:g.58896142G>A			B4DZB6|E7EWM8|J3KQH9|O60328|Q6NYC6|Q6UV20	Silent	SNP	NULL	p.V72	ENST00000556134.1	37	c.216	CCDS58321.1	14																																																																																			KIAA0586	-	NULL	ENSG00000100578		0.303	KIAA0586-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	KIAA0586	HGNC	protein_coding	OTTHUMT00000411887.1		0.00	50	0	G	NM_014749		58896142	+1			no_errors	ENST00000556134	ensembl	human	known	74_37	silent	9.38	29	3	SNP	0.041	A
KIAA1024L	100127206	genome.wustl.edu	37	5	129096098	129096098	+	Silent	SNP	C	C	A			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr5:129096098C>A	ENST00000564719.1	+	2	305	c.193C>A	c.(193-195)Cga>Aga	p.R65R	KIAA1024L_ENST00000334562.1_5'Flank|CTC-575N7.1_ENST00000503616.1_RNA|CTC-575N7.1_ENST00000515569.1_RNA	NM_001257308.1	NP_001244237.1	P59773	K102L_HUMAN	KIAA1024-like	65						integral component of membrane (GO:0016021)											TGCTGCTCAACGAATTAGGGG	0.458																																																	0																																										SO:0001819	synonymous_variant	0				CCDS58966.1	5q23.3	2013-01-16			ENSG00000186367	ENSG00000186367			33914	protein-coding gene	gene with protein product							Standard	NM_001257308		Approved		uc031skx.1	P59773	OTTHUMG00000163041	ENST00000564719.1:c.193C>A	5.37:g.129096098C>A			H3BM78	Silent	SNP	pfam_UPF0258	p.R65	ENST00000564719.1	37	c.193	CCDS58966.1	5																																																																																			KIAA1024L	-	pfam_UPF0258	ENSG00000186367		0.458	KIAA1024L-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	KIAA1024L	HGNC	protein_coding	OTTHUMT00000371450.2		0.00	24	0	C	NM_001257308		129096098	+1			no_errors	ENST00000564719	ensembl	human	known	74_37	silent	15.00	17	3	SNP	0.000	A
KIAA1211L	343990	genome.wustl.edu	37	2	99454593	99454593	+	Silent	SNP	C	C	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr2:99454593C>T	ENST00000397899.2	-	3	559	c.228G>A	c.(226-228)gaG>gaA	p.E76E	RNU7-46P_ENST00000459066.1_RNA|KIAA1211L_ENST00000462314.1_5'UTR	NM_207362.2	NP_997245.2	Q6NV74	K121L_HUMAN	KIAA1211-like	76																	CCAGCTCATCCTCGGAGTCGT	0.507																																																	0													97.0	93.0	94.0					2																	99454593		2021	4180	6201	SO:0001819	synonymous_variant	0			BC068277	CCDS42720.1	2q11.2	2012-08-03	2012-08-03	2012-08-03	ENSG00000196872	ENSG00000196872			33454	protein-coding gene	gene with protein product			"""chromosome 2 open reading frame 55"""	C2orf55			Standard	NM_207362		Approved	MGC42367	uc002szf.1	Q6NV74	OTTHUMG00000153171	ENST00000397899.2:c.228G>A	2.37:g.99454593C>T				Silent	SNP	NULL	p.E76	ENST00000397899.2	37	c.228	CCDS42720.1	2																																																																																			KIAA1211L	-	NULL	ENSG00000196872		0.507	KIAA1211L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1211L	HGNC	protein_coding	OTTHUMT00000329933.1	-	0.00	38	0	C	NM_207362		99454593	-1	tier1	-	no_errors	ENST00000397899	ensembl	human	known	74_37	silent	13.89	31	5	SNP	1.000	T
KIAA1324L	222223	genome.wustl.edu	37	7	86556147	86556147	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr7:86556147T>C	ENST00000450689.2	-	9	1360	c.1175A>G	c.(1174-1176)aAg>aGg	p.K392R	KIAA1324L_ENST00000444627.1_Missense_Mutation_p.K392R|KIAA1324L_ENST00000416314.1_Missense_Mutation_p.K225R|KIAA1324L_ENST00000297222.6_Missense_Mutation_p.K152R	NM_001142749.2	NP_001136221.1	A8MWY0	K132L_HUMAN	KIAA1324-like	392						integral component of membrane (GO:0016021)				breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(14)|ovary(6)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	44	Esophageal squamous(14;0.0058)					ACAATCCTTCTTCTCTCCAGA	0.438																																																	0													126.0	126.0	126.0					7																	86556147		2203	4300	6503	SO:0001583	missense	0			AK055902	CCDS34677.1, CCDS47632.1, CCDS34677.2	7q21.12	2008-09-18			ENSG00000164659	ENSG00000164659			21945	protein-coding gene	gene with protein product	"""EIG121-like"""	614048					Standard	NM_001142749		Approved	FLJ31340, EIG121L	uc011kha.2	A8MWY0	OTTHUMG00000153995	ENST00000450689.2:c.1175A>G	7.37:g.86556147T>C	ENSP00000413445:p.Lys392Arg		A4D1C9|B4DJV3|Q17RI6|Q96DP2	Missense_Mutation	SNP	superfamily_Man6P_isomerase_rcpt-bd_dom,superfamily_Growth_fac_rcpt_N_dom	p.K392R	ENST00000450689.2	37	c.1175	CCDS47632.1	7	.	.	.	.	.	.	.	.	.	.	T	12.03	1.816461	0.32145	.	.	ENSG00000164659	ENST00000450689;ENST00000297222;ENST00000444627;ENST00000416314	T;T;T;T	0.30182	1.54;1.54;1.54;1.56	5.53	5.53	0.82687	Growth factor, receptor (1);	0.163737	0.51477	D	0.000086	T	0.18257	0.0438	N	0.20685	0.6	0.41127	D	0.985851	B;B;B	0.19073	0.033;0.001;0.001	B;B;B	0.19148	0.024;0.003;0.003	T	0.12451	-1.0547	10	0.17369	T	0.5	.	9.2502	0.37551	0.0:0.089:0.0:0.911	.	392;152;225	A8MWY0;A8MWY0-2;B4DJV3	K132L_HUMAN;.;.	R	392;152;392;225	ENSP00000413445:K392R;ENSP00000297222:K152R;ENSP00000397377:K392R;ENSP00000402390:K225R	ENSP00000297222:K152R	K	-	2	0	KIAA1324L	86394083	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.247000	0.43151	2.098000	0.63641	0.460000	0.39030	AAG	KIAA1324L	-	superfamily_Growth_fac_rcpt_N_dom	ENSG00000164659		0.438	KIAA1324L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIAA1324L	HGNC	protein_coding	OTTHUMT00000333372.3	-	0.00	70	0	T	NM_152748		86556147	-1	tier1	-	no_errors	ENST00000450689	ensembl	human	known	74_37	missense	15.00	51	9	SNP	1.000	C
CIPC	85457	genome.wustl.edu	37	14	77572081	77572081	+	Silent	SNP	C	C	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr14:77572081C>T	ENST00000361786.2	+	2	347	c.30C>T	c.(28-30)agC>agT	p.S10S	RP11-463C8.4_ENST00000557752.1_Silent_p.S10S|KIAA1737_ENST00000555611.1_Silent_p.S10S|KIAA1737_ENST00000555437.1_Silent_p.S10S	NM_033426.2	NP_219494.2	Q9C0C6	CIPC_HUMAN		10					negative regulation of circadian rhythm (GO:0042754)|negative regulation of transcription, DNA-templated (GO:0045892)|rhythmic process (GO:0048511)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				endometrium(2)|lung(4)|prostate(3)	9			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0284)		CCAGAGAGAGCCCCAGAAGAC	0.478																																																	0													111.0	113.0	112.0					14																	77572081		2203	4300	6503	SO:0001819	synonymous_variant	0																														ENST00000361786.2:c.30C>T	14.37:g.77572081C>T			B2RCI1|Q8N389|Q8NDZ1	Silent	SNP	NULL	p.S10	ENST00000361786.2	37	c.30	CCDS9855.1	14																																																																																			KIAA1737	-	NULL	ENSG00000198894		0.478	KIAA1737-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1737	HGNC	protein_coding	OTTHUMT00000414278.1	-	0.00	27	0	C			77572081	+1	tier1	-	no_errors	ENST00000361786	ensembl	human	known	74_37	silent	16.00	21	4	SNP	1.000	T
KIAA2026	158358	genome.wustl.edu	37	9	5968554	5968554	+	Missense_Mutation	SNP	G	G	C	rs112865182		TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr9:5968554G>C	ENST00000399933.3	-	3	1676	c.1677C>G	c.(1675-1677)atC>atG	p.I559M	KIAA2026_ENST00000381461.2_Missense_Mutation_p.I559M	NM_001017969.2	NP_001017969.2	Q5HYC2	K2026_HUMAN	KIAA2026	559										breast(6)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(11)|lung(15)|ovary(2)|prostate(2)|skin(1)	46		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.00155)|Lung(218;0.124)		TTTCAACAGAGATGTCATGAT	0.358																																																	0													108.0	100.0	102.0					9																	5968554		1847	4100	5947	SO:0001583	missense	0			AB095946		9p24.1	2014-01-10			ENSG00000183354	ENSG00000183354			23378	protein-coding gene	gene with protein product							Standard	NM_001017969		Approved	FLJ20375	uc003zjq.4	Q5HYC2	OTTHUMG00000019507	ENST00000399933.3:c.1677C>G	9.37:g.5968554G>C	ENSP00000382815:p.Ile559Met		A8MTP2|B9EGW7|Q4VXA2|Q8IVE5	Missense_Mutation	SNP	superfamily_Bromodomain	p.I559M	ENST00000399933.3	37	c.1677		9	.	.	.	.	.	.	.	.	.	.	G	12.16	1.853237	0.32699	.	.	ENSG00000183354	ENST00000399933;ENST00000381461;ENST00000513355	D;D;D	0.91894	-2.93;-2.93;-2.93	5.86	2.97	0.34412	.	0.278687	0.23779	U	0.044649	D	0.87752	0.6256	N	0.24115	0.695	0.22975	N	0.99849	P	0.46220	0.874	P	0.48141	0.568	T	0.80174	-0.1492	10	0.62326	D	0.03	.	8.9984	0.36066	0.2902:0.0:0.7098:0.0	.	559	Q5HYC2	K2026_HUMAN	M	559;559;492	ENSP00000382815:I559M;ENSP00000370870:I559M;ENSP00000444993:I492M	ENSP00000370870:I559M	I	-	3	3	KIAA2026	5958554	0.996000	0.38824	0.999000	0.59377	0.986000	0.74619	0.695000	0.25527	0.359000	0.24239	0.591000	0.81541	ATC	KIAA2026	-	NULL	ENSG00000183354		0.358	KIAA2026-002	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	KIAA2026	HGNC	protein_coding	OTTHUMT00000051652.2		0.00	31	0	G	NM_001017969		5968554	-1			no_errors	ENST00000399933	ensembl	human	novel	74_37	missense	18.18	9	2	SNP	0.986	C
KIAA2026	158358	genome.wustl.edu	37	9	5968562	5968562	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr9:5968562G>A	ENST00000399933.3	-	3	1668	c.1669C>T	c.(1669-1671)Cat>Tat	p.H557Y	KIAA2026_ENST00000381461.2_Missense_Mutation_p.H557Y	NM_001017969.2	NP_001017969.2	Q5HYC2	K2026_HUMAN	KIAA2026	557										breast(6)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(11)|lung(15)|ovary(2)|prostate(2)|skin(1)	46		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.00155)|Lung(218;0.124)		GAGATGTCATGATTATCCAAG	0.353																																																	0													109.0	102.0	104.0					9																	5968562		1856	4100	5956	SO:0001583	missense	0			AB095946		9p24.1	2014-01-10			ENSG00000183354	ENSG00000183354			23378	protein-coding gene	gene with protein product							Standard	NM_001017969		Approved	FLJ20375	uc003zjq.4	Q5HYC2	OTTHUMG00000019507	ENST00000399933.3:c.1669C>T	9.37:g.5968562G>A	ENSP00000382815:p.His557Tyr		A8MTP2|B9EGW7|Q4VXA2|Q8IVE5	Missense_Mutation	SNP	superfamily_Bromodomain	p.H557Y	ENST00000399933.3	37	c.1669		9	.	.	.	.	.	.	.	.	.	.	G	9.004	0.980877	0.18812	.	.	ENSG00000183354	ENST00000399933;ENST00000381461;ENST00000513355	D;D;D	0.90900	-2.75;-2.75;-2.75	5.86	5.86	0.93980	.	0.730148	0.11588	U	0.549043	T	0.81351	0.4804	N	0.19112	0.55	0.26408	N	0.976318	B	0.33583	0.418	B	0.30943	0.122	T	0.69461	-0.5139	10	0.19590	T	0.45	.	7.6807	0.28511	0.1912:0.0:0.8088:0.0	.	557	Q5HYC2	K2026_HUMAN	Y	557;557;490	ENSP00000382815:H557Y;ENSP00000370870:H557Y;ENSP00000444993:H490Y	ENSP00000370870:H557Y	H	-	1	0	KIAA2026	5958562	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	3.197000	0.51028	2.781000	0.95711	0.591000	0.81541	CAT	KIAA2026	-	NULL	ENSG00000183354		0.353	KIAA2026-002	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	KIAA2026	HGNC	protein_coding	OTTHUMT00000051652.2		0.00	29	0	G	NM_001017969		5968562	-1			no_errors	ENST00000399933	ensembl	human	novel	74_37	missense	20.00	8	2	SNP	1.000	A
KIF19	124602	genome.wustl.edu	37	17	72339240	72339240	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr17:72339240C>A	ENST00000389916.4	+	5	535	c.397C>A	c.(397-399)Cgt>Agt	p.R133S		NM_153209.3	NP_694941.2	Q2TAC6	KIF19_HUMAN	kinesin family member 19	133	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|axonemal microtubule depolymerization (GO:0060404)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|plus-end specific microtubule depolymerization (GO:0070462)	cilium (GO:0005929)|cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|plus-end-directed microtubule motor activity (GO:0008574)	p.R133C(1)		autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(6)|large_intestine(3)|lung(16)|ovary(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	41						CGACCTCTTCCGTGCCATCGA	0.592																																																	1	Substitution - Missense(1)	breast(1)											99.0	76.0	84.0					17																	72339240		2203	4300	6503	SO:0001583	missense	0			AK094619	CCDS32718.2	17q25	2007-02-13			ENSG00000196169	ENSG00000196169		"""Kinesins"""	26735	protein-coding gene	gene with protein product						11416179	Standard	NM_153209		Approved	FLJ37300, KIF19A	uc031rei.1	Q2TAC6	OTTHUMG00000150694	ENST00000389916.4:c.397C>A	17.37:g.72339240C>A	ENSP00000374566:p.Arg133Ser		A6NLG2|B7ZKR1|Q52M87|Q8N1X8|Q8TAB6	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,prints_Kinesin_motor_dom,pfscan_Kinesin_motor_dom	p.R133S	ENST00000389916.4	37	c.397	CCDS32718.2	17	.	.	.	.	.	.	.	.	.	.	C	6.468	0.454572	0.12283	.	.	ENSG00000196169	ENST00000551294;ENST00000389916	T;T	0.74421	-0.62;-0.84	5.48	2.25	0.28309	Kinesin, motor domain (4);	.	.	.	.	T	0.47967	0.1474	N	0.03324	-0.35	0.31417	N	0.674746	B;B;B;B	0.16802	0.019;0.004;0.003;0.0	B;B;B;B	0.23852	0.049;0.021;0.017;0.008	T	0.46978	-0.9152	9	0.25751	T	0.34	.	5.7653	0.18224	0.2671:0.5834:0.0:0.1495	.	133;133;133;133	Q2TAC6;F8VW50;Q2TAC6-3;Q2TAC6-2	KIF19_HUMAN;.;.;.	S	133	ENSP00000449134:R133S;ENSP00000374566:R133S	ENSP00000374566:R133S	R	+	1	0	KIF19	69850835	0.603000	0.26924	0.626000	0.29213	0.281000	0.26958	1.133000	0.31430	0.645000	0.30675	0.556000	0.70494	CGT	KIF19	-	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom	ENSG00000196169		0.592	KIF19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF19	HGNC	protein_coding	OTTHUMT00000319644.2		0.00	45	0	C	NM_153209		72339240	+1			no_errors	ENST00000389916	ensembl	human	known	74_37	missense	7.41	25	2	SNP	0.723	A
KIF4B	285643	genome.wustl.edu	37	5	154395889	154395889	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr5:154395889G>A	ENST00000435029.4	+	1	2630	c.2470G>A	c.(2470-2472)Gag>Aag	p.E824K		NM_001099293.1	NP_001092763.1	Q2VIQ3	KIF4B_HUMAN	kinesin family member 4B	824	Interaction with PRC1. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|plus-end-directed microtubule motor activity (GO:0008574)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(6)|large_intestine(13)|lung(27)|ovary(2)|upper_aerodigestive_tract(1)	58	Renal(175;0.00488)	Medulloblastoma(196;0.0523)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			TGAAAGCCTAGAGACTGAAAT	0.443																																																	0													56.0	58.0	57.0					5																	154395889		2203	4300	6503	SO:0001583	missense	0			AF241316	CCDS47324.1	5q33.2	2010-06-22			ENSG00000226650	ENSG00000226650		"""Kinesins"""	6322	protein-coding gene	gene with protein product		609184					Standard	NM_001099293		Approved		uc010jih.1	Q2VIQ3	OTTHUMG00000164143	ENST00000435029.4:c.2470G>A	5.37:g.154395889G>A	ENSP00000387875:p.Glu824Lys			Missense_Mutation	SNP	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.E824K	ENST00000435029.4	37	c.2470	CCDS47324.1	5	.	.	.	.	.	.	.	.	.	.	g	15.79	2.936758	0.52972	.	.	ENSG00000226650	ENST00000435029	T	0.70869	-0.52	1.48	1.48	0.22813	.	.	.	.	.	T	0.69378	0.3104	M	0.72576	2.205	0.58432	D	0.999991	P	0.45986	0.87	P	0.47251	0.542	T	0.65813	-0.6077	9	0.23891	T	0.37	.	8.8832	0.35387	0.0:0.0:1.0:0.0	.	824	Q2VIQ3	KIF4B_HUMAN	K	824	ENSP00000387875:E824K	ENSP00000387875:E824K	E	+	1	0	KIF4B	154376082	1.000000	0.71417	0.997000	0.53966	0.933000	0.57130	1.370000	0.34238	1.138000	0.42230	0.563000	0.77884	GAG	KIF4B	-	NULL	ENSG00000226650		0.443	KIF4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF4B	HGNC	protein_coding	OTTHUMT00000377478.1	-	0.00	47	0	G			154395889	+1	tier1	-	no_errors	ENST00000435029	ensembl	human	known	74_37	missense	13.04	20	3	SNP	1.000	A
KIRREL3	84623	genome.wustl.edu	37	11	126343242	126343242	+	Nonsense_Mutation	SNP	G	G	A			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr11:126343242G>A	ENST00000525144.2	-	5	802	c.553C>T	c.(553-555)Cga>Tga	p.R185*	KIRREL3_ENST00000529097.2_Nonsense_Mutation_p.R185*|KIRREL3_ENST00000525704.2_Nonsense_Mutation_p.R185*	NM_032531.3	NP_115920.1	Q8IZU9	KIRR3_HUMAN	kin of IRRE like 3 (Drosophila)	185	Ig-like C2-type 2.				hemopoiesis (GO:0030097)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.R144*(1)		central_nervous_system(1)|endometrium(5)|large_intestine(11)|lung(8)|ovary(3)|prostate(1)	29	all_hematologic(175;0.145)	Lung NSC(97;0.0484)|all_lung(97;0.0522)|Medulloblastoma(222;0.0523)|Breast(109;0.0949)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;6.03e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.12)		TCTCCCTTTCGCAACCAGATG	0.652																																																	1	Substitution - Nonsense(1)	large_intestine(1)											43.0	47.0	45.0					11																	126343242		2018	4168	6186	SO:0001587	stop_gained	0			AB058770	CCDS53723.1, CCDS55796.1, CCDS73413.1	11q24	2013-01-29			ENSG00000149571	ENSG00000149571		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	23204	protein-coding gene	gene with protein product		607761				12424224, 11347906	Standard	NM_032531		Approved	NEPH2, KIAA1867, KIRRE	uc001qea.3	Q8IZU9	OTTHUMG00000165831	ENST00000525144.2:c.553C>T	11.37:g.126343242G>A	ENSP00000435466:p.Arg185*		Q3MIJ7|Q6UWJ9|Q6UWL5|Q96JG0	Nonsense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_CD80_C2-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.R185*	ENST00000525144.2	37	c.553	CCDS53723.1	11	.	.	.	.	.	.	.	.	.	.	g	25.8	4.673453	0.88445	.	.	ENSG00000149571	ENST00000525144;ENST00000529097;ENST00000525704	.	.	.	4.86	-2.07	0.07276	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	10.6823	0.45821	0.0724:0.0:0.3862:0.5414	.	.	.	.	X	185	.	ENSP00000435466:R185X	R	-	1	2	KIRREL3	125848452	1.000000	0.71417	0.967000	0.41034	0.998000	0.95712	1.040000	0.30278	-0.174000	0.10743	0.632000	0.83419	CGA	KIRREL3	-	pfam_CD80_C2-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000149571		0.652	KIRREL3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIRREL3	HGNC	protein_coding	OTTHUMT00000386479.2	-	0.00	128	0	G	NM_032531		126343242	-1	tier1	-	no_errors	ENST00000525144	ensembl	human	known	74_37	nonsense	13.75	69	11	SNP	0.930	A
KLHL12	59349	genome.wustl.edu	37	1	202887395	202887395	+	Silent	SNP	A	A	G			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr1:202887395A>G	ENST00000367261.3	-	4	689	c.471T>C	c.(469-471)ttT>ttC	p.F157F	KLHL12_ENST00000435533.3_Silent_p.F195F	NM_021633.2	NP_067646.1	Q53G59	KLH12_HUMAN	kelch-like family member 12	157	BACK.				COPII vesicle coating (GO:0048208)|ER to Golgi vesicle-mediated transport (GO:0006888)|protein monoubiquitination (GO:0006513)|Wnt signaling pathway (GO:0016055)	Cul3-RING ubiquitin ligase complex (GO:0031463)|ER to Golgi transport vesicle (GO:0030134)|Golgi membrane (GO:0000139)				NS(3)|breast(2)|endometrium(1)|large_intestine(1)|lung(6)|stomach(1)	14			BRCA - Breast invasive adenocarcinoma(75;0.166)			GCTTCTGGCTAAAAACCTCAG	0.433																																																	0													160.0	150.0	153.0					1																	202887395		2203	4300	6503	SO:0001819	synonymous_variant	0			AF190900	CCDS1429.1	1q32.1	2013-01-30	2013-01-30		ENSG00000117153	ENSG00000117153		"""Kelch-like"", ""BTB/POZ domain containing"""	19360	protein-coding gene	gene with protein product		614522	"""kelch-like 12 (Drosophila)"""			12477932	Standard	NM_021633		Approved	C3IP1	uc001gyo.1	Q53G59	OTTHUMG00000041385	ENST00000367261.3:c.471T>C	1.37:g.202887395A>G			A6NEN8|B7Z7B8|Q9HBX5	Silent	SNP	pfam_Kelch_1,pfam_BACK,pfam_BTB_POZ,pfam_Kelch_2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.F195	ENST00000367261.3	37	c.585	CCDS1429.1	1																																																																																			KLHL12	-	pfam_BACK,smart_BACK,pirsf_Kelch-like_gigaxonin	ENSG00000117153		0.433	KLHL12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHL12	HGNC	protein_coding	OTTHUMT00000099151.1	-	0.00	23	0	A	NM_021633		202887395	-1	tier1	-	no_errors	ENST00000435533	ensembl	human	known	74_37	silent	27.78	13	5	SNP	1.000	G
KLK11	11012	genome.wustl.edu	37	19	51530735	51530735	+	Silent	SNP	C	C	T	rs201833226		TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr19:51530735C>T	ENST00000594768.1	-	1	224	c.39G>A	c.(37-39)tcG>tcA	p.S13S	KLK11_ENST00000594458.1_5'Flank|KLK11_ENST00000319720.7_Intron|KLK11_ENST00000391804.3_Intron|CTC-518B2.9_ENST00000594910.1_RNA|KLK11_ENST00000453757.3_5'Flank|KLK11_ENST00000600362.1_5'Flank	NM_144947.1	NP_659196.1	Q9UBX7	KLK11_HUMAN	kallikrein-related peptidase 11	13						extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)	p.S13S(1)		breast(1)|endometrium(2)|large_intestine(1)|lung(2)|skin(1)	7		all_neural(266;0.026)		OV - Ovarian serous cystadenocarcinoma(262;0.00327)|GBM - Glioblastoma multiforme(134;0.00878)		GACCTCTGCCCGATGACTTCC	0.612																																																	1	Substitution - coding silent(1)	lung(1)						C	,,	1,4405	2.1+/-5.4	0,1,2202	90.0	92.0	91.0		,,39	-3.4	0.0	19		91	0,8600		0,0,4300	no	intron,intron,coding-synonymous	KLK11	NM_001167605.1,NM_006853.2,NM_144947.1	,,	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	,,	,,13/283	51530735	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	0			AB012917	CCDS12818.1, CCDS12819.1, CCDS54297.1	19q13.33	2011-09-07	2006-10-27			ENSG00000167757		"""Kallikreins"", ""Serine peptidases / Serine peptidases"""	6359	protein-coding gene	gene with protein product		604434	"""kallikrein 11"""	PRSS20		9765601, 10662548, 16800724, 16800723	Standard	NM_006853		Approved	TLSP	uc002pvb.2	Q9UBX7		ENST00000594768.1:c.39G>A	19.37:g.51530735C>T			O75837|Q0WXX5|Q8IXD7|Q9NS65	Silent	SNP	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,prints_Peptidase_S1A,pfscan_Peptidase_S1	p.S13	ENST00000594768.1	37	c.39	CCDS12818.1	19																																																																																			KLK11	-	NULL	ENSG00000167757		0.612	KLK11-002	KNOWN	basic|CCDS	protein_coding	KLK11	HGNC	protein_coding	OTTHUMT00000464314.2	-	0.00	84	0	C	NM_006853		51530735	-1	tier1	rs201833226	no_errors	ENST00000594768	ensembl	human	known	74_37	silent	32.39	48	23	SNP	0.000	T
KLRK1	22914	genome.wustl.edu	37	12	10525766	10525766	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr12:10525766T>C	ENST00000240618.6	-	8	738	c.598A>G	c.(598-600)Ata>Gta	p.I200V	RP11-277P12.20_ENST00000500682.1_RNA|KLRK1_ENST00000540818.1_Missense_Mutation_p.I200V|KLRC4-KLRK1_ENST00000539300.1_3'UTR	NM_001199805.1|NM_007360.3	NP_001186734.1|NP_031386.2	P26718	NKG2D_HUMAN	killer cell lectin-like receptor subfamily K, member 1	200	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				cell differentiation (GO:0030154)|innate immune response (GO:0045087)|natural killer cell activation (GO:0030101)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(3)|skin(1)	9						CAGTTTTCTATATAGCCTTTA	0.373																																																	0													186.0	164.0	171.0					12																	10525766		2203	4300	6503	SO:0001583	missense	0			AJ001687	CCDS8623.1	12p13.2-p12.3	2010-02-17	2003-02-19		ENSG00000213809	ENSG00000213809		"""Killer cell lectin-like receptors"", ""CD molecules"""	18788	protein-coding gene	gene with protein product		611817	"""DNA segment on chromosome 12 (unique) 2489 expressed sequence"""	D12S2489E		9683661, 2007850	Standard	NM_007360		Approved	NKG2D, KLR, NKG2-D, CD314	uc009zhj.3	P26718	OTTHUMG00000168574	ENST00000240618.6:c.598A>G	12.37:g.10525766T>C	ENSP00000240618:p.Ile200Val		A8K7K5|A8K7P4|Q9NR41	Missense_Mutation	SNP	pfam_C-type_lectin,pfam_Herpes_UL45-like,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin,prints_AntifreezeII	p.I200V	ENST00000240618.6	37	c.598	CCDS8623.1	12	.	.	.	.	.	.	.	.	.	.	T	0.018	-1.467228	0.01053	.	.	ENSG00000213809	ENST00000240618;ENST00000540818	T;T	0.18174	2.23;2.23	5.59	3.12	0.35913	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	0.213937	0.33180	N	0.005182	T	0.09335	0.0230	N	0.17764	0.52	0.09310	N	1	B	0.14805	0.011	B	0.14578	0.011	T	0.19877	-1.0292	10	0.44086	T	0.13	.	4.3389	0.11099	0.1743:0.0922:0.0:0.7335	.	200	P26718	NKG2D_HUMAN	V	200	ENSP00000240618:I200V;ENSP00000446003:I200V	ENSP00000240618:I200V	I	-	1	0	KLRK1	10417033	0.189000	0.23263	0.708000	0.30435	0.030000	0.12068	1.009000	0.29886	0.969000	0.38237	0.528000	0.53228	ATA	KLRK1	-	pfam_C-type_lectin,pfam_Herpes_UL45-like,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin	ENSG00000213809		0.373	KLRK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLRK1	HGNC	protein_coding	OTTHUMT00000400269.1	-	0.00	34	0	T	NM_007360		10525766	-1	tier1	-	no_errors	ENST00000240618	ensembl	human	known	74_37	missense	33.33	10	5	SNP	0.257	C
KPNA3	3839	genome.wustl.edu	37	13	50280504	50280504	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr13:50280504G>A	ENST00000261667.3	-	13	1451	c.1037C>T	c.(1036-1038)gCa>gTa	p.A346V		NM_002267.3	NP_002258.2	O00505	IMA4_HUMAN	karyopherin alpha 3 (importin alpha 4)	346	NLS binding site (minor). {ECO:0000250}.				cytokine-mediated signaling pathway (GO:0019221)|NLS-bearing protein import into nucleus (GO:0006607)|protein complex assembly (GO:0006461)|viral entry into host cell (GO:0046718)|viral penetration into host nucleus (GO:0075732)	cytosol (GO:0005829)|nuclear pore (GO:0005643)|nucleoplasm (GO:0005654)	nuclear localization sequence binding (GO:0008139)|protein transporter activity (GO:0008565)			cervix(1)|endometrium(3)|large_intestine(4)|liver(1)|lung(5)|ovary(1)|skin(1)|stomach(1)|urinary_tract(4)	21		Lung NSC(96;2.46e-05)|Breast(56;9.7e-05)|Prostate(109;0.00174)|Hepatocellular(98;0.0207)|Myeloproliferative disorder(33;0.163)|Lung SC(185;0.187)|all_neural(104;0.19)		GBM - Glioblastoma multiforme(99;1.42e-09)		GAACCACACTGCTTCCTATAA	0.323																																																	0													88.0	77.0	81.0					13																	50280504		2203	4300	6503	SO:0001583	missense	0			D89618	CCDS9421.1	13q14.3	2013-02-14			ENSG00000102753	ENSG00000102753		"""Importins"", ""Armadillo repeat containing"""	6396	protein-coding gene	gene with protein product		601892				9154134, 9435235	Standard	NM_002267		Approved	SRP1gamma, SRP4, hSRP1, IPOA4	uc001vdj.2	O00505	OTTHUMG00000016922	ENST00000261667.3:c.1037C>T	13.37:g.50280504G>A	ENSP00000261667:p.Ala346Val		O00191|O43195|Q5JVM9|Q96AA7	Missense_Mutation	SNP	pfam_Armadillo,pfam_Importin-a_IBB,pfam_HEAT,superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo,pfscan_Importin-a_IBB	p.A346V	ENST00000261667.3	37	c.1037	CCDS9421.1	13	.	.	.	.	.	.	.	.	.	.	G	35	5.450564	0.96205	.	.	ENSG00000102753	ENST00000261667	D	0.83506	-1.73	5.91	5.91	0.95273	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.92499	0.7618	M	0.84773	2.715	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	D	0.92725	0.6195	10	0.87932	D	0	-15.2119	20.3011	0.98612	0.0:0.0:1.0:0.0	.	346	O00505	IMA3_HUMAN	V	346	ENSP00000261667:A346V	ENSP00000261667:A346V	A	-	2	0	KPNA3	49178505	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.869000	0.99810	2.804000	0.96469	0.650000	0.86243	GCA	KPNA3	-	pfam_Armadillo,superfamily_ARM-type_fold,smart_Armadillo	ENSG00000102753		0.323	KPNA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KPNA3	HGNC	protein_coding	OTTHUMT00000044939.2		0.00	51	0	G	NM_002267		50280504	-1			no_errors	ENST00000261667	ensembl	human	known	74_37	missense	8.82	31	3	SNP	1.000	A
KPRP	448834	genome.wustl.edu	37	1	152733635	152733635	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr1:152733635A>G	ENST00000606109.1	+	1	1599	c.1571A>G	c.(1570-1572)gAc>gGc	p.D524G	KPRP_ENST00000368773.1_Missense_Mutation_p.D524G			Q5T749	KPRP_HUMAN	keratinocyte proline-rich protein	524						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)				NS(1)|breast(1)|endometrium(9)|kidney(1)|large_intestine(10)|lung(21)|ovary(6)|pancreas(1)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	60	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			CACCGCCTAGACACCGAAGCT	0.607																																																	0													72.0	68.0	70.0					1																	152733635		2203	4300	6503	SO:0001583	missense	0			AY960854	CCDS30862.1	1q21.3	2008-02-05	2007-02-02	2006-12-07	ENSG00000203786	ENSG00000203786			31823	protein-coding gene	gene with protein product		613260	"""chromosome 1 open reading frame 45"""	C1orf45		16297201	Standard	NM_001025231		Approved		uc001fal.1	Q5T749	OTTHUMG00000012402	ENST00000606109.1:c.1571A>G	1.37:g.152733635A>G	ENSP00000475216:p.Asp524Gly			Missense_Mutation	SNP	NULL	p.D524G	ENST00000606109.1	37	c.1571	CCDS30862.1	1	.	.	.	.	.	.	.	.	.	.	A	16.85	3.237471	0.58886	.	.	ENSG00000203786	ENST00000368773	T	0.25250	1.81	4.61	4.61	0.57282	.	0.000000	0.48767	D	0.000179	T	0.33411	0.0862	L	0.54323	1.7	0.39453	D	0.967437	D	0.89917	1.0	D	0.91635	0.999	T	0.11991	-1.0565	10	0.62326	D	0.03	-15.6362	10.5778	0.45238	1.0:0.0:0.0:0.0	.	524	Q5T749	KPRP_HUMAN	G	524	ENSP00000357762:D524G	ENSP00000357762:D524G	D	+	2	0	KPRP	151000259	0.997000	0.39634	0.746000	0.31095	0.301000	0.27625	2.365000	0.44196	2.066000	0.61787	0.379000	0.24179	GAC	KPRP	-	NULL	ENSG00000203786		0.607	KPRP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KPRP	HGNC	protein_coding	OTTHUMT00000034522.2	-	0.00	26	0	A	NM_001025231		152733635	+1	tier1	-	no_errors	ENST00000368773	ensembl	human	known	74_37	missense	23.53	26	8	SNP	0.978	G
KRT3	3850	genome.wustl.edu	37	12	53188100	53188100	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr12:53188100G>C	ENST00000417996.2	-	2	735	c.661C>G	c.(661-663)Caa>Gaa	p.Q221E	KRT3_ENST00000309505.3_Missense_Mutation_p.Q221E	NM_057088.2	NP_476429.2	P12035	K2C3_HUMAN	keratin 3	221	Coil 1A.|Rod.				epithelial cell differentiation (GO:0030855)|intermediate filament cytoskeleton organization (GO:0045104)	extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			NS(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(8)|prostate(2)|skin(1)	23						TTGTTCTGTTGCTCCAGGAAC	0.522																																																	0													97.0	108.0	104.0					12																	53188100		2199	4300	6499	SO:0001583	missense	0				CCDS44895.1	12q13.13	2013-01-16			ENSG00000186442	ENSG00000186442		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6440	protein-coding gene	gene with protein product	"""keratin, type II cytoskeletal 3"", ""cytokeratin 3"""	148043				7510223, 16831889	Standard	NM_057088		Approved	CK3, K3	uc001say.3	P12035	OTTHUMG00000169799	ENST00000417996.2:c.661C>G	12.37:g.53188100G>C	ENSP00000413479:p.Gln221Glu		A6NIS2|Q701L8	Missense_Mutation	SNP	pfam_IF,superfamily_Prefoldin,prints_Keratin_II,prints_Keratin_I	p.Q221E	ENST00000417996.2	37	c.661	CCDS44895.1	12	.	.	.	.	.	.	.	.	.	.	G	21.4	4.144033	0.77888	.	.	ENSG00000186442	ENST00000417996;ENST00000309505	T;T	0.74842	-0.88;-0.88	4.84	3.94	0.45596	Filament (1);	0.000000	0.44483	D	0.000456	D	0.87954	0.6308	M	0.88450	2.955	0.43564	D	0.99588	D	0.89917	1.0	D	0.85130	0.997	D	0.90797	0.4691	10	0.87932	D	0	.	15.7968	0.78416	0.0:0.1361:0.8639:0.0	.	221	P12035	K2C3_HUMAN	E	221	ENSP00000413479:Q221E;ENSP00000312206:Q221E	ENSP00000312206:Q221E	Q	-	1	0	KRT3	51474367	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.580000	0.74040	1.385000	0.46445	0.655000	0.94253	CAA	KRT3	-	pfam_IF	ENSG00000186442		0.522	KRT3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	KRT3	HGNC	protein_coding	OTTHUMT00000405930.1	-	0.00	39	0	G	NM_057088		53188100	-1	tier1	-	no_errors	ENST00000309505	ensembl	human	known	74_37	missense	40.00	18	12	SNP	1.000	C
KSR1	8844	genome.wustl.edu	37	17	25909803	25909803	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr17:25909803G>A	ENST00000319524.6	+	4	652	c.652G>A	c.(652-654)Gca>Aca	p.A218T	KSR1_ENST00000268763.6_Missense_Mutation_p.A81T|KSR1_ENST00000398988.3_Missense_Mutation_p.A81T|KSR1_ENST00000509603.2_Missense_Mutation_p.A218T			Q8IVT5	KSR1_HUMAN	kinase suppressor of ras 1	218					Ras protein signal transduction (GO:0007265)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.A218S(2)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|large_intestine(5)|lung(12)|prostate(2)|urinary_tract(1)	28	Lung NSC(42;0.00836)		BRCA - Breast invasive adenocarcinoma(3;0.00122)	UCEC - Uterine corpus endometrioid carcinoma (53;0.168)		GCTGGGCAGAGCAGGCAACAG	0.682																																					Esophageal Squamous(88;1120 1336 6324 10502 16832)												2	Substitution - Missense(2)	large_intestine(2)											28.0	34.0	32.0					17																	25909803		2080	4201	6281	SO:0001583	missense	0			U43586	CCDS58532.1	17q11.2	2012-05-23	2005-12-14	2005-12-14	ENSG00000141068	ENSG00000141068			6465	protein-coding gene	gene with protein product		601132	"""kinase suppressor of ras"""	KSR		8521512	Standard	XM_006722151		Approved	RSU2	uc031qzj.1	Q8IVT5	OTTHUMG00000132051	ENST00000319524.6:c.652G>A	17.37:g.25909803G>A	ENSP00000323178:p.Ala218Thr		F8WEA9|H7BYU0|Q13476	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.A218T	ENST00000319524.6	37	c.652		17	.	.	.	.	.	.	.	.	.	.	G	2.069	-0.413534	0.04799	.	.	ENSG00000141068	ENST00000319524;ENST00000509603;ENST00000268763;ENST00000398982	T;T;T	0.00476	7.15;7.15;7.15	4.97	-5.53	0.02552	.	1.344380	0.04393	N	0.362746	T	0.00271	0.0008	L	0.28274	0.84	0.21325	N	0.99972	B	0.19817	0.039	B	0.14023	0.01	T	0.43940	-0.9360	10	0.08179	T	0.78	.	9.0662	0.36465	0.1535:0.4933:0.3532:0.0	.	216	Q8IVT5	KSR1_HUMAN	T	218;218;81;81	ENSP00000323178:A218T;ENSP00000438795:A218T;ENSP00000268763:A81T	ENSP00000268763:A81T	A	+	1	0	KSR1	22933930	0.004000	0.15560	0.176000	0.23000	0.036000	0.12997	-0.666000	0.05280	-0.869000	0.04052	0.455000	0.32223	GCA	KSR1	-	NULL	ENSG00000141068		0.682	KSR1-202	KNOWN	basic|appris_candidate_longest	protein_coding	KSR1	HGNC	protein_coding		-	0.00	87	0	G	NM_014238		25909803	+1	tier1	-	no_errors	ENST00000319524	ensembl	human	known	74_37	missense	15.62	27	5	SNP	0.688	A
L3MBTL1	26013	genome.wustl.edu	37	20	42163487	42163487	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr20:42163487G>T	ENST00000427442.2	+	16	1823	c.1664G>T	c.(1663-1665)aGt>aTt	p.S555I	L3MBTL1_ENST00000418998.1_Missense_Mutation_p.S555I|L3MBTL1_ENST00000444063.1_Missense_Mutation_p.S487I|L3MBTL1_ENST00000373135.3_Missense_Mutation_p.S487I|L3MBTL1_ENST00000373134.1_Missense_Mutation_p.S487I			Q9Y468	LMBL1_HUMAN	l(3)mbt-like 1 (Drosophila)	487					chromatin modification (GO:0016568)|hemopoiesis (GO:0030097)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of cell cycle (GO:0051726)|regulation of megakaryocyte differentiation (GO:0045652)|regulation of mitosis (GO:0007088)|transcription, DNA-templated (GO:0006351)	chromatin (GO:0000785)|condensed chromosome (GO:0000793)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|histone binding (GO:0042393)|identical protein binding (GO:0042802)|methylated histone binding (GO:0035064)|nucleosomal histone binding (GO:0031493)|nucleosome binding (GO:0031491)|SAM domain binding (GO:0032093)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|large_intestine(3)|ovary(1)|skin(2)	7						GATGGCTGGAGTCATGGCTAT	0.592																																																	0													76.0	66.0	69.0					20																	42163487		2203	4300	6503	SO:0001583	missense	0			U89358	CCDS13319.1, CCDS46602.1, CCDS46602.2	20q13.12	2013-01-10	2010-09-03	2010-09-03	ENSG00000185513	ENSG00000185513		"""Zinc fingers, C2HC-type containing"", ""Sterile alpha motif (SAM) domain containing"""	15905	protein-coding gene	gene with protein product	"""lethal (3) malignant brain tumor l(3)"""	608802	"""l(3)mbt (Drosophila)-like"", ""l(3)mbt-like (Drosophila)"""	L3MBTL		10445843, 17540172	Standard	NM_032107		Approved	ZC2HC3, dJ138B7.3, DKFZp586P1522, KIAA0681	uc010zwh.2	Q9Y468	OTTHUMG00000032503	ENST00000427442.2:c.1664G>T	20.37:g.42163487G>T	ENSP00000402107:p.Ser555Ile		B4DRC9|E1P5W7|Q5H8Y8|Q5H8Y9|Q8IUV7|Q9H1E6|Q9H1G5|Q9UG06|Q9UJB9|Q9Y4C9	Missense_Mutation	SNP	pfam_Mbt,pfam_Znf_C2HC,superfamily_SAM/pointed,smart_Mbt,pfscan_Mbt	p.S555I	ENST00000427442.2	37	c.1664	CCDS46602.2	20	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.15|19.15	3.771463|3.771463	0.69992|0.69992	.|.	.|.	ENSG00000185513|ENSG00000185513	ENST00000427442;ENST00000418998;ENST00000373135;ENST00000444063;ENST00000373134;ENST00000422861;ENST00000373133|ENST00000445228	T;T;T;T;T;T|.	0.49432|.	0.78;0.78;0.78;0.78;0.78;0.78|.	5.32|5.32	3.38|3.38	0.38709|0.38709	.|.	0.041025|.	0.85682|.	D|.	0.000000|.	T|T	0.73806|0.73806	0.3634|0.3634	M|M	0.83953|0.83953	2.67|2.67	0.45979|0.45979	D|D	0.998792|0.998792	D;D;D;D|.	0.76494|.	0.999;0.998;0.999;0.998|.	D;D;D;D|.	0.72982|.	0.96;0.945;0.979;0.973|.	T|T	0.74225|0.74225	-0.3734|-0.3734	10|5	0.52906|.	T|.	0.07|.	.|.	10.6909|10.6909	0.45870|0.45870	0.1564:0.0:0.8436:0.0|0.1564:0.0:0.8436:0.0	.|.	555;139;487;487|.	Q9Y468-5;Q9Y468-3;Q9Y468-2;Q9Y468-1|.	.;.;.;.|.	I|F	555;555;487;487;487;273;139|178	ENSP00000402107:S555I;ENSP00000398516:S555I;ENSP00000362227:S487I;ENSP00000403316:S487I;ENSP00000362226:S487I;ENSP00000410139:S273I|.	ENSP00000362225:S139I|.	S|V	+|+	2|1	0|0	L3MBTL1|L3MBTL1	41596901|41596901	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.991000|0.991000	0.79684|0.79684	3.564000|3.564000	0.53791|0.53791	0.815000|0.815000	0.34398|0.34398	0.655000|0.655000	0.94253|0.94253	AGT|GTC	L3MBTL1	-	pfam_Mbt,smart_Mbt,pfscan_Mbt	ENSG00000185513		0.592	L3MBTL1-007	KNOWN	upstream_ATG|basic|appris_candidate_longest|CCDS	protein_coding	L3MBTL1	HGNC	protein_coding	OTTHUMT00000079300.3	-	0.00	38	0	G	NM_032107		42163487	+1	tier1	-	no_errors	ENST00000418998	ensembl	human	known	74_37	missense	17.24	24	5	SNP	1.000	T
LAMA2	3908	genome.wustl.edu	37	6	129807652	129807652	+	Silent	SNP	C	C	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr6:129807652C>T	ENST00000421865.2	+	56	7832	c.7783C>T	c.(7783-7785)Ctg>Ttg	p.L2595L		NM_000426.3|NM_001079823.1	NP_000417|NP_001073291.1	P24043	LAMA2_HUMAN	laminin, alpha 2	2595	Laminin G-like 3. {ECO:0000255|PROSITE- ProRule:PRU00122}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|myelination in peripheral nervous system (GO:0022011)|positive regulation of synaptic transmission, cholinergic (GO:0032224)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basement membrane (GO:0005604)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|sarcolemma (GO:0042383)	structural molecule activity (GO:0005198)			NS(2)|biliary_tract(2)|breast(10)|central_nervous_system(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(35)|lung(84)|ovary(10)|prostate(4)|skin(9)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(2)	194				OV - Ovarian serous cystadenocarcinoma(136;0.178)|all cancers(137;0.245)		CAGGGGCCGTCTGGAAGTGCA	0.443																																																	0													87.0	77.0	80.0					6																	129807652		2203	4300	6503	SO:0001819	synonymous_variant	0			Z26653	CCDS5138.1	6q22-q23	2014-09-17	2008-08-01		ENSG00000196569	ENSG00000196569		"""Laminins"""	6482	protein-coding gene	gene with protein product	"""merosin"", ""congenital muscular dystrophy"""	156225		LAMM		2185464, 8294519	Standard	NM_000426		Approved		uc003qbn.3	P24043	OTTHUMG00000015545	ENST00000421865.2:c.7783C>T	6.37:g.129807652C>T			Q14736|Q5VUM2|Q93022	Silent	SNP	pfam_Laminin_G,pfam_EGF_laminin,pfam_Laminin_N,pfam_Laminin_I,pfam_Laminin_B_type_IV,pfam_Laminin_II,superfamily_ConA-like_lec_gl_sf,superfamily_Galactose-bd-like,superfamily_t-SNARE,smart_Laminin_N,smart_EGF_laminin,smart_EG-like_dom,smart_Laminin_B_subgr,smart_Laminin_G,pfscan_Laminin_B_type_IV,pfscan_EGF_laminin,pfscan_Laminin_G,pfscan_Laminin_N	p.L2595	ENST00000421865.2	37	c.7783	CCDS5138.1	6																																																																																			LAMA2	-	pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,pfscan_Laminin_G	ENSG00000196569		0.443	LAMA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMA2	HGNC	protein_coding	OTTHUMT00000042180.1	-	0.00	40	0	C			129807652	+1	tier1	-	no_errors	ENST00000421865	ensembl	human	known	74_37	silent	22.22	14	4	SNP	0.983	T
LAMTOR4	389541	genome.wustl.edu	37	7	99746558	99746558	+	5'UTR	SNP	C	C	G			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr7:99746558C>G	ENST00000341942.5	+	0	29				LAMTOR4_ENST00000441173.1_5'Flank	NM_001008395.2	NP_001008396.1	Q0VGL1	LTOR4_HUMAN	late endosomal/lysosomal adaptor, MAPK and MTOR activator 4						cellular response to amino acid stimulus (GO:0071230)|positive regulation of GTPase activity (GO:0043547)|positive regulation of TOR signaling (GO:0032008)|protein localization to lysosome (GO:0061462)|regulation of cell size (GO:0008361)	intracellular membrane-bounded organelle (GO:0043231)|lysosome (GO:0005764)|Ragulator complex (GO:0071986)											CGGAAGCTACCTATCTGGTAG	0.647																																																	0													74.0	74.0	74.0					7																	99746558		2203	4300	6503	SO:0001623	5_prime_UTR_variant	0				CCDS34702.1	7q22	2012-09-24	2012-09-24	2012-09-24	ENSG00000188186	ENSG00000188186			33772	protein-coding gene	gene with protein product			"""chromosome 7 open reading frame 59"""	C7orf59		22980980	Standard	NM_001008395		Approved		uc003utq.2	Q0VGL1	OTTHUMG00000154854	ENST00000341942.5:c.-38C>G	7.37:g.99746558C>G				RNA	SNP	-	NULL	ENST00000341942.5	37	NULL	CCDS34702.1	7																																																																																			LAMTOR4	-	-	ENSG00000188186		0.647	LAMTOR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMTOR4	HGNC	protein_coding	OTTHUMT00000337373.2	-	0.00	92	0	C	NM_001008395		99746558	+1	tier1	-	no_errors	ENST00000460732	ensembl	human	known	74_37	rna	7.69	60	5	SNP	0.060	G
LARP4B	23185	genome.wustl.edu	37	10	860788	860788	+	Missense_Mutation	SNP	T	T	A			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr10:860788T>A	ENST00000316157.3	-	16	1863	c.1823A>T	c.(1822-1824)gAt>gTt	p.D608V	LARP4B_ENST00000469487.1_5'UTR	NM_015155.1	NP_055970.1	Q92615	LAR4B_HUMAN	La ribonucleoprotein domain family, member 4B	608					positive regulation of translation (GO:0045727)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleolus (GO:0005730)|polysomal ribosome (GO:0042788)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(13)|lung(13)|ovary(2)|skin(2)|urinary_tract(2)	38						CACCTTGGGATCACTGTAAAA	0.527																																																	0													88.0	64.0	72.0					10																	860788		2203	4300	6503	SO:0001583	missense	0			D86971	CCDS31131.1	10p15.3	2011-08-24	2009-06-09	2009-06-09	ENSG00000107929	ENSG00000107929		"""La ribonucleoprotein domain containing"""	28987	protein-coding gene	gene with protein product			"""KIAA0217"", ""La ribonucleoprotein domain family, member 5"""	KIAA0217, LARP5		9039502, 20573744	Standard	NM_015155		Approved		uc031ptb.1	Q92615	OTTHUMG00000017534	ENST00000316157.3:c.1823A>T	10.37:g.860788T>A	ENSP00000326128:p.Asp608Val		A7MD20|Q5T3R3|Q5T3R4|Q5T3R5|Q68CY4	Missense_Mutation	SNP	pfam_Lupus_La_RNA-bd,smart_Lupus_La_RNA-bd,pfscan_Lupus_La_RNA-bd	p.D608V	ENST00000316157.3	37	c.1823	CCDS31131.1	10	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	T|T|T	15.17|15.17|15.17	2.753347|2.753347|2.753347	0.49362|0.49362|0.49362	.|.|.	.|.|.	ENSG00000107929|ENSG00000107929|ENSG00000107929	ENST00000316157|ENST00000440895|ENST00000448368	T|.|.	0.33438|.|.	1.41|.|.	6.07|6.07|6.07	6.07|6.07|6.07	0.98685|0.98685|0.98685	.|.|.	0.310783|.|.	0.37577|.|.	N|.|.	0.002038|.|.	T|T|.	0.51295|0.51295|.	0.1666|0.1666|.	L|L|L	0.27053|0.27053|0.27053	0.805|0.805|0.805	0.80722|0.80722|0.80722	D|D|D	1|1|1	P|.|.	0.48834|.|.	0.916|.|.	P|.|.	0.45660|.|.	0.489|.|.	T|T|.	0.49214|0.49214|.	-0.8963|-0.8963|.	10|5|.	0.30854|.|.	T|.|.	0.27|.|.	-15.9523|-15.9523|-15.9523	11.8089|11.8089|11.8089	0.52171|0.52171|0.52171	0.0:0.0:0.146:0.854|0.0:0.0:0.146:0.854|0.0:0.0:0.146:0.854	.|.|.	608|.|.	Q92615|.|.	LAR4B_HUMAN|.|.	V|F|C	608|84|173	ENSP00000326128:D608V|.|.	ENSP00000326128:D608V|.|.	D|I|X	-|-|-	2|1|3	0|0|0	LARP4B|LARP4B|LARP4B	850788|850788|850788	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	0.976000|0.976000|0.976000	0.42696|0.42696|0.42696	0.056000|0.056000|0.056000	0.15407|0.15407|0.15407	4.013000|4.013000|4.013000	0.57138|0.57138|0.57138	2.326000|2.326000|2.326000	0.78906|0.78906|0.78906	0.533000|0.533000|0.533000	0.62120|0.62120|0.62120	GAT|ATC|TGA	LARP4B	-	NULL	ENSG00000107929		0.527	LARP4B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	LARP4B	HGNC	protein_coding	OTTHUMT00000046395.2		0.00	28	0	T	NM_015155		860788	-1			no_errors	ENST00000316157	ensembl	human	known	74_37	missense	10.53	17	2	SNP	0.982	A
LATS2	26524	genome.wustl.edu	37	13	21562178	21562178	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr13:21562178G>A	ENST00000382592.4	-	4	2146	c.1741C>T	c.(1741-1743)Cgc>Tgc	p.R581C	LATS2_ENST00000542899.1_Missense_Mutation_p.R581C|LATS2_ENST00000472754.1_5'Flank	NM_014572.2	NP_055387.2			large tumor suppressor kinase 2									p.R581C(2)		breast(4)|central_nervous_system(3)|endometrium(2)|kidney(2)|large_intestine(7)|lung(19)|ovary(3)|pancreas(1)|prostate(2)|urinary_tract(2)	45		all_cancers(29;4.74e-22)|all_epithelial(30;1.45e-18)|all_lung(29;4.69e-16)|Lung SC(185;0.0262)|Hepatocellular(188;0.244)		all cancers(112;0.000781)|Epithelial(112;0.00144)|OV - Ovarian serous cystadenocarcinoma(117;0.0183)|Lung(94;0.0375)|LUSC - Lung squamous cell carcinoma(192;0.104)		CTGTTTTTGCGGACGGGAACG	0.547																																																	2	Substitution - Missense(2)	endometrium(2)											240.0	243.0	242.0					13																	21562178		2203	4300	6503	SO:0001583	missense	0			AB028019	CCDS9294.1	13q11-q12	2013-04-25	2013-04-25		ENSG00000150457	ENSG00000150457			6515	protein-coding gene	gene with protein product		604861	"""LATS (large tumor suppressor, Drosophila) homolog 2"", ""LATS, large tumor suppressor, homolog 2 (Drosophila)"""			10673337	Standard	NM_014572		Approved		uc001unr.4	Q9NRM7	OTTHUMG00000016531	ENST00000382592.4:c.1741C>T	13.37:g.21562178G>A	ENSP00000372035:p.Arg581Cys			Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Pkinase_C,superfamily_Kinase-like_dom,superfamily_UBA-like,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Prot_kinase_dom	p.R581C	ENST00000382592.4	37	c.1741	CCDS9294.1	13	.	.	.	.	.	.	.	.	.	.	G	17.40	3.379098	0.61735	.	.	ENSG00000150457	ENST00000382592;ENST00000542899	T;T	0.53640	0.61;0.61	5.12	5.12	0.69794	.	0.178002	0.39341	N	0.001386	T	0.63873	0.2548	L	0.52905	1.665	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.65582	-0.6133	10	0.87932	D	0	.	14.5371	0.67969	0.0:0.0:0.8532:0.1468	.	581	Q9NRM7	LATS2_HUMAN	C	581	ENSP00000372035:R581C;ENSP00000441817:R581C	ENSP00000372035:R581C	R	-	1	0	LATS2	20460178	1.000000	0.71417	0.153000	0.22517	0.747000	0.42532	3.166000	0.50785	2.691000	0.91804	0.549000	0.68633	CGC	LATS2	-	NULL	ENSG00000150457		0.547	LATS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LATS2	HGNC	protein_coding	OTTHUMT00000044102.1	-	0.00	110	0	G			21562178	-1	tier1	-	no_errors	ENST00000382592	ensembl	human	known	74_37	missense	30.00	42	18	SNP	0.922	A
LINGO4	339398	genome.wustl.edu	37	1	151775030	151775030	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr1:151775030G>T	ENST00000368820.3	-	2	1088	c.151C>A	c.(151-153)Ctg>Atg	p.L51M		NM_001004432.2	NP_001004432.1	Q6UY18	LIGO4_HUMAN	leucine rich repeat and Ig domain containing 4	51	LRRNT.					integral component of membrane (GO:0016021)				breast(2)|cervix(1)|endometrium(4)|large_intestine(5)|lung(4)|ovary(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	21	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.14)		LUSC - Lung squamous cell carcinoma(543;0.181)			ACAGCCTCCAGTTGCCTGTGG	0.652																																																	0													33.0	23.0	27.0					1																	151775030		2202	4296	6498	SO:0001583	missense	0				CCDS30855.1	1q21.3	2013-01-11	2007-02-01	2007-02-01	ENSG00000213171	ENSG00000213171		"""Immunoglobulin superfamily / I-set domain containing"""	31814	protein-coding gene	gene with protein product		609794	"""leucine rich repeat neuronal 6D"""	LRRN6D			Standard	NM_001004432		Approved		uc001ezf.1	Q6UY18	OTTHUMG00000013059	ENST00000368820.3:c.151C>A	1.37:g.151775030G>T	ENSP00000357810:p.Leu51Met			Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_Ig_I-set,pfam_Ig_V-set,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.L51M	ENST00000368820.3	37	c.151	CCDS30855.1	1	.	.	.	.	.	.	.	.	.	.	G	17.12	3.308458	0.60305	.	.	ENSG00000213171	ENST00000368820	D	0.82167	-1.58	5.41	5.41	0.78517	Leucine-rich repeat-containing N-terminal (1);	0.000000	0.37857	N	0.001909	D	0.88603	0.6481	M	0.82630	2.6	0.58432	D	0.999997	D	0.61080	0.989	P	0.57911	0.829	D	0.88958	0.3391	10	0.56958	D	0.05	.	16.7425	0.85463	0.0:0.0:1.0:0.0	.	51	Q6UY18	LIGO4_HUMAN	M	51	ENSP00000357810:L51M	ENSP00000357810:L51M	L	-	1	2	LINGO4	150041654	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	4.527000	0.60573	2.822000	0.97130	0.557000	0.71058	CTG	LINGO4	-	smart_LRR-contain_N	ENSG00000213171		0.652	LINGO4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LINGO4	HGNC	protein_coding	OTTHUMT00000036639.1	-	0.00	36	0	G	XM_291387		151775030	-1	tier1	-	no_errors	ENST00000368820	ensembl	human	known	74_37	missense	16.67	19	4	SNP	1.000	T
LIPT2	387787	genome.wustl.edu	37	11	74203330	74203330	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr11:74203330G>C	ENST00000310109.4	-	2	575	c.546C>G	c.(544-546)atC>atG	p.I182M	AP001372.2_ENST00000526036.1_lincRNA	NM_001144869.1	NP_001138341.1	A6NK58	LIPT2_HUMAN	lipoyl(octanoyl) transferase 2 (putative)	182	BPL/LPL catalytic. {ECO:0000255|PROSITE- ProRule:PRU01067}.				cellular protein modification process (GO:0006464)|lipoate biosynthetic process (GO:0009107)	mitochondrion (GO:0005739)	ligase activity (GO:0016874)|lipoyl(octanoyl) transferase activity (GO:0033819)|octanoyltransferase activity (GO:0016415)			endometrium(1)|prostate(1)|stomach(1)	3						CACAGGGCACGATGTGCTCAA	0.577																																																	0													89.0	74.0	78.0					11																	74203330		692	1591	2283	SO:0001583	missense	0				CCDS44679.1	11q13.4	2009-09-09			ENSG00000175536	ENSG00000175536			37216	protein-coding gene	gene with protein product							Standard	NM_001144869		Approved		uc010rrk.2	A6NK58	OTTHUMG00000165646	ENST00000310109.4:c.546C>G	11.37:g.74203330G>C	ENSP00000309463:p.Ile182Met			Missense_Mutation	SNP	pfam_BPL_LipA_LipB,tigrfam_Octanoyltransferase	p.I182M	ENST00000310109.4	37	c.546	CCDS44679.1	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.42|12.42	1.932927|1.932927	0.34096|0.34096	.|.	.|.	ENSG00000175536|ENSG00000175536	ENST00000310109|ENST00000527115	D|.	0.96104|.	-3.91|.	5.25|5.25	-5.84|-5.84	0.02318|0.02318	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.74253|0.74253	0.3692|0.3692	M|M	0.85710|0.85710	2.77|2.77	0.36608|0.36608	D|D	0.875066|0.875066	D|.	0.89917|.	1.0|.	D|.	0.87578|.	0.998|.	T|T	0.80493|0.80493	-0.1358|-0.1358	10|5	0.87932|.	D|.	0|.	-19.7467|-19.7467	16.0636|16.0636	0.80856|0.80856	0.3243:0.0:0.6757:0.0|0.3243:0.0:0.6757:0.0	.|.	182|.	A6NK58|.	LIPT2_HUMAN|.	M|G	182|66	ENSP00000309463:I182M|.	ENSP00000309463:I182M|.	I|R	-|-	3|1	3|0	LIPT2|LIPT2	73880978|73880978	0.961000|0.961000	0.32948|0.32948	0.958000|0.958000	0.39756|0.39756	0.143000|0.143000	0.21401|0.21401	0.169000|0.169000	0.16641|0.16641	-0.952000|-0.952000	0.03649|0.03649	-1.267000|-1.267000	0.01435|0.01435	ATC|CGT	LIPT2	-	tigrfam_Octanoyltransferase	ENSG00000175536		0.577	LIPT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LIPT2	HGNC	protein_coding	OTTHUMT00000385544.1	-	0.00	59	0	G	NM_001144869		74203330	-1	tier1	-	no_errors	ENST00000310109	ensembl	human	known	74_37	missense	9.80	46	5	SNP	0.408	C
CADM3	57863	genome.wustl.edu	37	1	159166979	159166980	+	Intron	INS	-	-	TA			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr1:159166979_159166980insTA	ENST00000368125.4	+	7	1109				CTA-134P22.2_ENST00000415675.2_RNA|CADM3_ENST00000497636.1_Intron|CADM3_ENST00000368124.4_Intron	NM_001127173.1	NP_001120645.1	Q8N126	CADM3_HUMAN	cell adhesion molecule 3						adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|heterophilic cell-cell adhesion (GO:0007157)|homophilic cell adhesion (GO:0007156)|protein localization (GO:0008104)	cell-cell junction (GO:0005911)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|endometrium(5)|kidney(4)|large_intestine(12)|lung(20)|ovary(2)|pancreas(1)|prostate(2)|skin(3)	55	all_hematologic(112;0.0429)					ACCAGCCCACCACTGGGGTCCC	0.475																																																	0																																										SO:0001627	intron_variant	0			AY046418	CCDS1182.1, CCDS44251.1	1q21.2-q22	2013-01-29	2007-02-07	2007-02-07	ENSG00000162706	ENSG00000162706		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17601	protein-coding gene	gene with protein product	"""nectin-like 1"""	609743	"""immunoglobulin superfamily, member 4B"""	IGSF4B		11536053	Standard	NM_021189		Approved	BIgR, FLJ10698, TSLL1, NECL1, SynCAM3, Necl-1	uc001ftk.2	Q8N126	OTTHUMG00000037177	ENST00000368125.4:c.952+129->TA	1.37:g.159166979_159166980insTA			Q8IZQ9|Q9NVJ5|Q9UJP1	RNA	INS	-	NULL	ENST00000368125.4	37	NULL	CCDS44251.1	1																																																																																			CTA-134P22.2	-	-	ENSG00000225670		0.475	CADM3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	LOC100131825	Clone_based_vega_gene	protein_coding	OTTHUMT00000090330.1		0.00	15	0	-	NM_021189		159166980	-1	tier1		no_errors	ENST00000415675	ensembl	human	known	74_37	rna	28.57	5	2	INS	0.000:0.000	TA
LOC100240735	100240735	genome.wustl.edu	37	9	44870044	44870044	+	Silent	SNP	T	T	A			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr9:44870044T>A	ENST00000377548.2	+	3	422	c.180T>A	c.(178-180)ccT>ccA	p.P60P	RP11-160N1.10_ENST00000448436.2_Silent_p.P60P																							TCCAGCGACCTCCGACCCTCC	0.537																																																	0																																										SO:0001819	synonymous_variant	0																														ENST00000377548.2:c.180T>A	9.37:g.44870044T>A				Silent	SNP	NULL	p.P60	ENST00000377548.2	37	c.180		9																																																																																			RP11-160N1.10	-	NULL	ENSG00000204814		0.537	RP11-160N1.10-002	NOVEL	alternative_5_UTR|basic|appris_principal	protein_coding	LOC101928102	Clone_based_vega_gene	protein_coding	OTTHUMT00000192591.2	-	0.00	331	0	T			44870044	+1	tier1	-	no_errors	ENST00000448436	ensembl	human	putative	74_37	silent	9.65	206	22	SNP	0.026	A
LOC100288069	100288069	genome.wustl.edu	37	1	700532	700532	+	lincRNA	SNP	T	T	A			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr1:700532T>A	ENST00000428504.1	-	0	1021				RP11-206L10.5_ENST00000417659.1_lincRNA	NR_033908.1																						aaaaaaaaaaTTCCTTTGGGA	0.453																																																	0																																												0																															1.37:g.700532T>A				RNA	SNP	-	NULL	ENST00000428504.1	37	NULL		1																																																																																			RP11-206L10.2	-	-	ENSG00000228327		0.453	RP11-206L10.2-001	KNOWN	basic	lincRNA	LOC101929540	Clone_based_vega_gene	lincRNA	OTTHUMT00000006889.1		0.00	8	0	T			700532	-1			no_errors	ENST00000428504	ensembl	human	known	74_37	rna	33.33	6	3	SNP	0.239	A
LOC389332	389332	genome.wustl.edu	37	5	135528018	135528018	+	lincRNA	SNP	C	C	G			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr5:135528018C>G	ENST00000607574.1	-	0	804					NR_024418.1																						CGAGCGCCACCGAGAGCAGCA	0.711																																																	0																																												0																															5.37:g.135528018C>G				RNA	SNP	-	NULL	ENST00000607574.1	37	NULL		5																																																																																			AC009014.3	-	-	ENSG00000271824		0.711	AC009014.3-001	KNOWN	basic	lincRNA	LOC389332	Clone_based_vega_gene	lincRNA	OTTHUMT00000470729.1	-	0.00	64	0	C			135528018	-1	tier1	-	no_errors	ENST00000607574	ensembl	human	known	74_37	rna	37.21	27	16	SNP	0.996	G
LOXHD1	125336	genome.wustl.edu	37	18	44221958	44221958	+	Missense_Mutation	SNP	C	C	T	rs376467400		TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr18:44221958C>T	ENST00000441551.2	-	3	286	c.287G>A	c.(286-288)cGg>cAg	p.R96Q	LOXHD1_ENST00000536736.1_Missense_Mutation_p.R96Q			Q8IVV2	LOXH1_HUMAN	lipoxygenase homology domains 1	799	PLAT 1. {ECO:0000255|PROSITE- ProRule:PRU00152}.				calcium ion transmembrane transport (GO:0070588)|detection of mechanical stimulus (GO:0050982)|sensory perception of sound (GO:0007605)	membrane (GO:0016020)|stereocilium (GO:0032420)	calcium channel activity (GO:0005262)			NS(3)|autonomic_ganglia(1)|breast(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|lung(2)|pancreas(1)|prostate(4)|skin(4)|stomach(1)	36						GGTTCTCACCCGGAACACATC	0.522																																																	0								C	GLN/ARG	0,1384		0,0,692	114.0	90.0	97.0		287	5.6	1.0	18		97	2,3180		0,2,1589	no	missense	LOXHD1	NM_144612.6	43	0,2,2281	TT,TC,CC		0.0629,0.0,0.0438	probably-damaging	96/2212	44221958	2,4564	692	1591	2283	SO:0001583	missense	0			AK057232	CCDS45861.1, CCDS45862.1, CCDS54184.1	18q21.1	2009-09-11			ENSG00000167210	ENSG00000167210			26521	protein-coding gene	gene with protein product		613072	"""deafness, autosomal recessive 77"""	DFNB77		19732867	Standard	NM_144612		Approved	FLJ32670, LH2D1	uc010xcw.1	Q8IVV2	OTTHUMG00000132644	ENST00000441551.2:c.287G>A	18.37:g.44221958C>T	ENSP00000387621:p.Arg96Gln		B7WNN3|B7WNT1|B7WPI9|Q6ZRY7|Q86WW9|Q96DL7	Missense_Mutation	SNP	pfam_PLAT/LH2_dom,superfamily_Lipase_LipOase,smart_PLAT/LH2_dom,pfscan_PLAT/LH2_dom	p.R96Q	ENST00000441551.2	37	c.287		18	.	.	.	.	.	.	.	.	.	.	C	17.52	3.409506	0.62399	0.0	6.29E-4	ENSG00000167210	ENST00000536736	T	0.64085	-0.08	5.59	5.59	0.84812	.	.	.	.	.	T	0.65606	0.2707	N	0.12887	0.27	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.65166	-0.6234	9	0.26408	T	0.33	.	19.6038	0.95573	0.0:1.0:0.0:0.0	.	96	F5GZB4	.	Q	96	ENSP00000444586:R96Q	ENSP00000444586:R96Q	R	-	2	0	LOXHD1	42475956	1.000000	0.71417	1.000000	0.80357	0.795000	0.44927	7.456000	0.80751	2.620000	0.88729	0.561000	0.74099	CGG	LOXHD1	-	pfam_PLAT/LH2_dom,superfamily_Lipase_LipOase,smart_PLAT/LH2_dom,pfscan_PLAT/LH2_dom	ENSG00000167210		0.522	LOXHD1-013	NOVEL	not_organism_supported|basic	protein_coding	LOXHD1	HGNC	protein_coding	OTTHUMT00000446054.1	-	0.00	37	0	C	NM_144612		44221958	-1	tier1	-	no_errors	ENST00000536736	ensembl	human	known	74_37	missense	42.11	11	8	SNP	1.000	T
LPHN3	23284	genome.wustl.edu	37	4	62599069	62599069	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr4:62599069A>G	ENST00000514591.1	+	7	1321	c.992A>G	c.(991-993)gAc>gGc	p.D331G	LPHN3_ENST00000514996.1_Missense_Mutation_p.D331G|LPHN3_ENST00000504896.1_Missense_Mutation_p.D331G|LPHN3_ENST00000512091.2_Missense_Mutation_p.D331G|LPHN3_ENST00000506720.1_Missense_Mutation_p.D399G|LPHN3_ENST00000545650.1_Missense_Mutation_p.D331G|LPHN3_ENST00000507625.1_Missense_Mutation_p.D399G|LPHN3_ENST00000506746.1_Missense_Mutation_p.D399G|LPHN3_ENST00000514157.1_Missense_Mutation_p.D331G|LPHN3_ENST00000509896.1_Missense_Mutation_p.D399G|LPHN3_ENST00000508946.1_Missense_Mutation_p.D331G|LPHN3_ENST00000506700.1_Missense_Mutation_p.D331G|LPHN3_ENST00000507164.1_Missense_Mutation_p.D399G|LPHN3_ENST00000508693.1_Missense_Mutation_p.D399G|LPHN3_ENST00000511324.1_Missense_Mutation_p.D399G			Q9HAR2	LPHN3_HUMAN	latrophilin 3	331	Olfactomedin-like. {ECO:0000255|PROSITE- ProRule:PRU00446}.				G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|G-protein coupled receptor activity (GO:0004930)	p.D331V(3)		breast(5)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(21)|lung(73)|ovary(1)|pancreas(1)|prostate(6)|upper_aerodigestive_tract(1)	125						GAGGATGATGACAATGAGGCT	0.378																																																	3	Substitution - Missense(3)	lung(3)											121.0	107.0	112.0					4																	62599069		1942	4145	6087	SO:0001583	missense	0			AB018311	CCDS54768.1	4q13.1	2014-08-08				ENSG00000150471		"""-"", ""GPCR / Class B : Orphans"""	20974	protein-coding gene	gene with protein product						10994649	Standard	NM_015236		Approved	KIAA0768, LEC3	uc010ihh.3	Q9HAR2		ENST00000514591.1:c.992A>G	4.37:g.62599069A>G	ENSP00000422533:p.Asp331Gly		E9PE04|O94867|Q9NWK5	Missense_Mutation	SNP	pfam_GPCR_2_latrophilin_rcpt_C,pfam_Olfac-like,pfam_DUF3497,pfam_GPCR_2_secretin-like,pfam_Lectin_gal-bd_dom,pfam_GPS_dom,pfam_GPCR_2_extracellular_dom,smart_Olfac-like,smart_GPCR_2_extracellular_dom,smart_GPS_dom,pfscan_GPS_dom,pfscan_Lectin_gal-bd_dom,pfscan_Olfac-like,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_GPCR_2_latrophilin,prints_GPCR_2_secretin-like	p.D399G	ENST00000514591.1	37	c.1196	CCDS54768.1	4	.	.	.	.	.	.	.	.	.	.	A	16.34	3.096505	0.56075	.	.	ENSG00000150471	ENST00000512091;ENST00000514591;ENST00000509896;ENST00000511324;ENST00000506700;ENST00000534975;ENST00000545650;ENST00000295349;ENST00000280009;ENST00000507164;ENST00000508693;ENST00000507625;ENST00000514157;ENST00000504896;ENST00000508946;ENST00000506720;ENST00000506746;ENST00000514996	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.94000	-3.33;-3.33;-3.33;-3.33;-3.33;-3.33;-3.33;-3.33;-3.33;-3.33;-3.33;-3.33;-3.33;-3.33;-3.33	5.31	5.31	0.75309	.	0.000000	0.85682	D	0.000000	D	0.94971	0.8373	L	0.42245	1.32	0.54753	D	0.999988	D;D;D	0.76494	0.999;0.999;0.996	D;D;D	0.85130	0.997;0.997;0.987	D	0.95552	0.8621	10	0.87932	D	0	.	14.4261	0.67218	1.0:0.0:0.0:0.0	.	331;399;331	E9PE04;E7EN28;Q9HAR2-2	.;.;.	G	331;331;399;399;331;331;331;331;331;399;399;399;331;331;331;399;399;331	ENSP00000423388:D331G;ENSP00000422533:D331G;ENSP00000423787:D399G;ENSP00000425033:D399G;ENSP00000424120:D331G;ENSP00000439831:D331G;ENSP00000421476:D399G;ENSP00000424030:D399G;ENSP00000421372:D399G;ENSP00000425201:D331G;ENSP00000423434:D331G;ENSP00000421627:D331G;ENSP00000420931:D399G;ENSP00000425884:D399G;ENSP00000424258:D331G	ENSP00000280009:D331G	D	+	2	0	LPHN3	62281664	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.962000	0.93254	1.999000	0.58509	0.455000	0.32223	GAC	LPHN3	-	pfam_Olfac-like,smart_Olfac-like,pfscan_Olfac-like	ENSG00000150471		0.378	LPHN3-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	LPHN3	HGNC	protein_coding	OTTHUMT00000361765.1		0.00	28	0	A			62599069	+1			no_errors	ENST00000507625	ensembl	human	known	74_37	missense	10.00	18	2	SNP	1.000	G
LRP12	29967	genome.wustl.edu	37	8	105502495	105502495	+	3'UTR	SNP	G	G	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr8:105502495G>T	ENST00000276654.5	-	0	3094				LRP12_ENST00000424843.2_3'UTR|LRP12_ENST00000518375.1_5'UTR	NM_013437.4	NP_038465.1	Q9Y561	LRP12_HUMAN	low density lipoprotein receptor-related protein 12						endocytosis (GO:0006897)|receptor-mediated endocytosis (GO:0006898)|regulation of growth (GO:0040008)|signal transduction (GO:0007165)	coated pit (GO:0005905)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	low-density lipoprotein receptor activity (GO:0005041)			NS(1)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(18)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	48			OV - Ovarian serous cystadenocarcinoma(57;1.21e-06)|STAD - Stomach adenocarcinoma(118;0.229)			AGTATATTAAGTTACAAGATG	0.264																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AF166350	CCDS6303.1, CCDS47907.1	8q22.2	2013-02-27	2010-01-26		ENSG00000147650	ENSG00000147650		"""Low density lipoprotein receptors"""	31708	protein-coding gene	gene with protein product						12809483, 14676824	Standard	NM_013437		Approved	ST7, FLJ12929	uc003yma.3	Q9Y561	OTTHUMG00000164892	ENST00000276654.5:c.*406C>A	8.37:g.105502495G>T			A8K137|B4DRQ2	RNA	SNP	-	NULL	ENST00000276654.5	37	NULL	CCDS6303.1	8																																																																																			LRP12	-	-	ENSG00000147650		0.264	LRP12-001	NOVEL	basic|appris_principal|CCDS	protein_coding	LRP12	HGNC	protein_coding	OTTHUMT00000380821.1	-	0.00	43	0	G	NM_013437		105502495	-1	tier1	-	no_errors	ENST00000518375	ensembl	human	putative	74_37	rna	16.13	26	5	SNP	1.000	T
LRP4	4038	genome.wustl.edu	37	11	46884284	46884284	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr11:46884284T>G	ENST00000378623.1	-	37	5500	c.5258A>C	c.(5257-5259)aAg>aCg	p.K1753T	LRP4-AS1_ENST00000502049.2_RNA|LRP4-AS1_ENST00000531719.1_RNA	NM_002334.3	NP_002325.2	O75096	LRP4_HUMAN	low density lipoprotein receptor-related protein 4	1753					dendrite morphogenesis (GO:0048813)|dorsal/ventral pattern formation (GO:0009953)|embryonic digit morphogenesis (GO:0042733)|endocytosis (GO:0006897)|extracellular matrix organization (GO:0030198)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|limb development (GO:0060173)|negative regulation of axonogenesis (GO:0050771)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of ossification (GO:0030279)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of presynaptic membrane organization (GO:1901631)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|protein heterotetramerization (GO:0051290)|proximal/distal pattern formation (GO:0009954)|regulation of protein phosphorylation (GO:0001932)|skeletal muscle acetylcholine-gated channel clustering (GO:0071340)|synapse organization (GO:0050808)|synaptic growth at neuromuscular junction (GO:0051124)|Wnt signaling pathway (GO:0016055)	cell surface (GO:0009986)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|postsynaptic density (GO:0014069)|synaptic membrane (GO:0097060)	calcium ion binding (GO:0005509)|receptor tyrosine kinase binding (GO:0030971)|scaffold protein binding (GO:0097110)			breast(7)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(13)|lung(24)|ovary(3)|pancreas(2)|prostate(5)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)	70				Lung(87;0.159)		ATCAGTGAACTTGGATTTTTT	0.473																																																	0													229.0	221.0	224.0					11																	46884284		2201	4299	6500	SO:0001583	missense	0			AB011540	CCDS31478.1	11p11.2	2013-05-29			ENSG00000134569	ENSG00000134569		"""Low density lipoprotein receptors"""	6696	protein-coding gene	gene with protein product		604270				9693030	Standard	NM_002334		Approved	MEGF7, CLSS, LRP-4, SOST2	uc001ndn.4	O75096	OTTHUMG00000166700	ENST00000378623.1:c.5258A>C	11.37:g.46884284T>G	ENSP00000367888:p.Lys1753Thr		B2RN39|Q4AC85|Q5KTZ5	Missense_Mutation	SNP	pfam_LDLR_classB_rpt,pfam_LDrepeatLR_classA_rpt,pfam_EGF-like_Ca-bd_dom,superfamily_Growth_fac_rcpt_N_dom,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_LDLR_classB_rpt,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt,prints_LDrepeatLR_classA_rpt	p.K1753T	ENST00000378623.1	37	c.5258	CCDS31478.1	11	.	.	.	.	.	.	.	.	.	.	T	24.8	4.567572	0.86439	.	.	ENSG00000134569	ENST00000378623	D	0.91295	-2.82	5.64	5.64	0.86602	.	0.056531	0.64402	D	0.000001	D	0.83022	0.5164	N	0.24115	0.695	0.80722	D	1	P	0.37781	0.608	B	0.27608	0.081	D	0.85196	0.1012	10	0.72032	D	0.01	.	15.8697	0.79101	0.0:0.0:0.0:1.0	.	1753	O75096	LRP4_HUMAN	T	1753	ENSP00000367888:K1753T	ENSP00000367888:K1753T	K	-	2	0	LRP4	46840860	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.671000	0.83941	2.152000	0.67230	0.533000	0.62120	AAG	LRP4	-	NULL	ENSG00000134569		0.473	LRP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP4	HGNC	protein_coding	OTTHUMT00000391133.1		0.00	95	0	T	NM_002334		46884284	-1			no_errors	ENST00000378623	ensembl	human	known	74_37	missense	7.14	39	3	SNP	1.000	G
LRRC3	81543	genome.wustl.edu	37	21	45877116	45877116	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr21:45877116A>G	ENST00000291592.4	+	2	906	c.589A>G	c.(589-591)Agc>Ggc	p.S197G	LRRC3-AS1_ENST00000426578.1_RNA|LRRC3DN_ENST00000596691.1_5'Flank	NM_030891.3	NP_112153.1	Q9BY71	LRRC3_HUMAN	leucine rich repeat containing 3	197						integral component of membrane (GO:0016021)				endometrium(2)|kidney(1)|lung(1)|urinary_tract(1)	5		Breast(209;0.00908)		COAD - Colon adenocarcinoma(84;0.148)|Lung(125;0.195)		CAGCCTCTGCAGCGTCCCCCA	0.622																																																	0													72.0	68.0	70.0					21																	45877116		2203	4300	6503	SO:0001583	missense	0			AB058646	CCDS13711.1	21q22.3	2011-12-07	2002-06-20		ENSG00000160233	ENSG00000160233			14965	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 102"""	C21orf102		12036297	Standard	NM_030891		Approved		uc002zfa.3	Q9BY71	OTTHUMG00000040847	ENST00000291592.4:c.589A>G	21.37:g.45877116A>G	ENSP00000291592:p.Ser197Gly		Q0VDJ2	Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_LRR-contain_N,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp	p.S197G	ENST00000291592.4	37	c.589	CCDS13711.1	21	.	.	.	.	.	.	.	.	.	.	A	0.118	-1.129242	0.01756	.	.	ENSG00000160233	ENST00000291592	T	0.59502	0.26	4.87	1.08	0.20341	.	0.110219	0.64402	N	0.000016	T	0.32436	0.0829	N	0.14661	0.345	0.33406	D	0.578047	B	0.09022	0.002	B	0.09377	0.004	T	0.33240	-0.9876	10	0.09843	T	0.71	-22.1667	9.265	0.37636	0.708:0.0:0.292:0.0	.	197	Q9BY71	LRRC3_HUMAN	G	197	ENSP00000291592:S197G	ENSP00000291592:S197G	S	+	1	0	LRRC3	44701544	1.000000	0.71417	0.812000	0.32479	0.224000	0.24922	3.653000	0.54446	0.007000	0.14760	0.402000	0.26972	AGC	LRRC3	-	NULL	ENSG00000160233		0.622	LRRC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC3	HGNC	protein_coding	OTTHUMT00000098095.3	-	0.00	29	0	A			45877116	+1	tier1	-	no_errors	ENST00000291592	ensembl	human	known	74_37	missense	18.75	13	3	SNP	0.985	G
LRRC32	2615	genome.wustl.edu	37	11	76372422	76372422	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr11:76372422T>C	ENST00000407242.2	-	3	457	c.215A>G	c.(214-216)tAc>tGc	p.Y72C	LRRC32_ENST00000464145.1_Intron|LRRC32_ENST00000260061.5_Missense_Mutation_p.Y72C|AP001189.4_ENST00000447519.1_RNA|LRRC32_ENST00000404995.1_Missense_Mutation_p.Y72C	NM_005512.2	NP_005503.1	Q14392	LRC32_HUMAN	leucine rich repeat containing 32	72					negative regulation of activated T cell proliferation (GO:0046007)|negative regulation of cytokine secretion (GO:0050710)|positive regulation of gene expression (GO:0010628)	integral component of plasma membrane (GO:0005887)				endometrium(1)|large_intestine(3)|lung(26)|upper_aerodigestive_tract(1)	31						AAGTGCTGTGTAGAAGCCCAG	0.627																																																	0													79.0	71.0	74.0					11																	76372422		2200	4292	6492	SO:0001583	missense	0			Z24680	CCDS8245.1	11q13.5-q14	2008-02-05	2005-02-25	2005-02-25	ENSG00000137507	ENSG00000137507			4161	protein-coding gene	gene with protein product		137207	"""glycoprotein A repetitions predominant"""	D11S833E, GARP		8180135, 1543912	Standard	NM_005512		Approved		uc001oxq.4	Q14392	OTTHUMG00000133687	ENST00000407242.2:c.215A>G	11.37:g.76372422T>C	ENSP00000384126:p.Tyr72Cys		Q86V06	Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_LRR-contain_N,smart_LRR-contain_N,smart_Leu-rich_rpt_RNase_inh_sub-typ,smart_Leu-rich_rpt_typical-subtyp	p.Y72C	ENST00000407242.2	37	c.215	CCDS8245.1	11	.	.	.	.	.	.	.	.	.	.	T	15.43	2.830646	0.50845	.	.	ENSG00000137507	ENST00000260061;ENST00000407242;ENST00000404995;ENST00000421973	T;T;T;T	0.55588	0.51;0.51;0.51;0.51	4.98	4.98	0.66077	.	0.188982	0.47455	D	0.000227	T	0.58380	0.2118	N	0.19112	0.55	0.50171	D	0.999854	D;D	0.89917	1.0;1.0	D;D	0.81914	0.992;0.995	T	0.63879	-0.6537	10	0.62326	D	0.03	.	14.8415	0.70230	0.0:0.0:0.0:1.0	.	72;72	C9JYU3;Q14392	.;LRC32_HUMAN	C	72	ENSP00000260061:Y72C;ENSP00000384126:Y72C;ENSP00000385766:Y72C;ENSP00000413331:Y72C	ENSP00000260061:Y72C	Y	-	2	0	LRRC32	76050070	1.000000	0.71417	0.972000	0.41901	0.919000	0.55068	3.590000	0.53979	2.098000	0.63641	0.459000	0.35465	TAC	LRRC32	-	smart_Leu-rich_rpt_RNase_inh_sub-typ,smart_Leu-rich_rpt_typical-subtyp	ENSG00000137507		0.627	LRRC32-201	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC32	HGNC	protein_coding	OTTHUMT00000257926.2	-	0.00	65	0	T	NM_005512		76372422	-1	tier1	-	no_errors	ENST00000260061	ensembl	human	known	74_37	missense	7.55	49	4	SNP	0.988	C
LRRC37A3	374819	genome.wustl.edu	37	17	62855703	62855703	+	Missense_Mutation	SNP	T	T	A	rs199620763		TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr17:62855703T>A	ENST00000584306.1	-	11	5091	c.4561A>T	c.(4561-4563)Aca>Tca	p.T1521S	LRRC37A3_ENST00000319651.5_Missense_Mutation_p.T1521S|LRRC37A3_ENST00000334962.5_Missense_Mutation_p.T498S|LRRC37A3_ENST00000400877.3_Missense_Mutation_p.T559S|LRRC37A3_ENST00000339474.5_Missense_Mutation_p.T639S	NM_199340.2	NP_955372.2	O60309	L37A3_HUMAN	leucine rich repeat containing 37, member A3	1521						integral component of membrane (GO:0016021)				NS(1)|breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(6)|liver(1)|lung(10)|pancreas(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	40						AGGTGGCCTGTCCTGGAGACG	0.502																																																	0													143.0	145.0	144.0					17																	62855703		2203	4296	6499	SO:0001583	missense	0			AB011135	CCDS32708.1	17q24.1	2008-10-22			ENSG00000176809	ENSG00000176809			32427	protein-coding gene	gene with protein product							Standard	NM_199340		Approved	FLJ34306, KIAA0563	uc031rbi.1	O60309	OTTHUMG00000132307	ENST00000584306.1:c.4561A>T	17.37:g.62855703T>A	ENSP00000464535:p.Thr1521Ser		Q49A01|Q49A80|Q8NB33	Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.T1521S	ENST00000584306.1	37	c.4561	CCDS32708.1	17	.	.	.	.	.	.	.	.	.	.	.	12.34	1.908743	0.33721	.	.	ENSG00000176809	ENST00000339474;ENST00000400877;ENST00000334962;ENST00000319651	T;T;T	0.54675	0.56;0.56;0.56	2.39	1.3	0.21679	.	.	.	.	.	T	0.65217	0.2670	M	0.73962	2.25	0.20764	N	0.999858	D;P	0.76494	0.999;0.956	D;D	0.72982	0.979;0.931	T	0.51268	-0.8727	9	0.87932	D	0	.	3.6503	0.08201	0.0:0.1998:0.0:0.8002	.	639;1521	B4DG20;O60309	.;L37A3_HUMAN	S	602;559;498;1521	ENSP00000383674:T559S;ENSP00000335617:T498S;ENSP00000325713:T1521S	ENSP00000325713:T1521S	T	-	1	0	LRRC37A3	60286165	0.977000	0.34250	0.995000	0.50966	0.172000	0.22775	1.265000	0.33027	1.098000	0.41479	0.155000	0.16302	ACA	LRRC37A3	-	NULL	ENSG00000176809		0.502	LRRC37A3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC37A3	HGNC	protein_coding	OTTHUMT00000445377.1	-	0.00	158	0	T	NM_199340		62855703	-1	tier1	-	no_errors	ENST00000319651	ensembl	human	known	74_37	missense	7.45	87	7	SNP	0.994	A
LRRC41	10489	genome.wustl.edu	37	1	46746102	46746102	+	Silent	SNP	G	G	C			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr1:46746102G>C	ENST00000343304.6	-	6	2172	c.1887C>G	c.(1885-1887)ccC>ccG	p.P629P	LRRC41_ENST00000472710.1_5'UTR	NM_006369.4	NP_006360.3	Q15345	LRC41_HUMAN	leucine rich repeat containing 41	629					protein ubiquitination (GO:0016567)	membrane (GO:0016020)				breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(7)|ovary(3)|pancreas(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	28	Acute lymphoblastic leukemia(166;0.155)					CAAAATCCTGGGGAGAGGCAA	0.572																																																	0													92.0	99.0	97.0					1																	46746102		2203	4300	6503	SO:0001819	synonymous_variant	0			AK024051	CCDS533.1	1p34.1	2008-02-05			ENSG00000132128	ENSG00000132128			16917	protein-coding gene	gene with protein product						11384984	Standard	XM_005270376		Approved	MUF1	uc001cpn.3	Q15345	OTTHUMG00000007810	ENST00000343304.6:c.1887C>G	1.37:g.46746102G>C			A8K5G8|Q3MJ96|Q5TDF5|Q71RA8|Q9BSM0	Silent	SNP	smart_Leu-rich_rpt_RNase_inh_sub-typ	p.P629	ENST00000343304.6	37	c.1887	CCDS533.1	1																																																																																			LRRC41	-	NULL	ENSG00000132128		0.572	LRRC41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC41	HGNC	protein_coding	OTTHUMT00000021438.1	-	0.00	32	0	G	NM_006369		46746102	-1	tier1	-	no_errors	ENST00000343304	ensembl	human	known	74_37	silent	25.93	20	7	SNP	0.995	C
LRRC43	254050	genome.wustl.edu	37	12	122685870	122685870	+	Frame_Shift_Del	DEL	A	A	-			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr12:122685870delA	ENST00000339777.4	+	11	1865	c.1837delA	c.(1837-1839)aaafs	p.K614fs	LRRC43_ENST00000425921.1_Frame_Shift_Del_p.K429fs|LRRC43_ENST00000537733.1_3'UTR|B3GNT4_ENST00000546192.1_5'Flank|B3GNT4_ENST00000324189.4_5'Flank	NM_152759.4	NP_689972.3	Q8N309	LRC43_HUMAN	leucine rich repeat containing 43	614										NS(1)|endometrium(1)|large_intestine(4)|lung(10)|skin(1)|upper_aerodigestive_tract(2)	19	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000312)|Epithelial(86;0.000539)|BRCA - Breast invasive adenocarcinoma(302;0.225)		GAAAGTTGCCAAAAAAGGTGA	0.542																																																	0													138.0	145.0	143.0					12																	122685870		1907	4124	6031	SO:0001589	frameshift_variant	0			AK124107	CCDS45001.1	12q24.31	2014-09-11			ENSG00000158113	ENSG00000158113			28562	protein-coding gene	gene with protein product						12477932	Standard	NM_152759		Approved	MGC35140	uc009zxm.3	Q8N309	OTTHUMG00000168915	ENST00000339777.4:c.1837delA	12.37:g.122685870delA	ENSP00000344233:p.Lys614fs		Q6ZVT9	Frame_Shift_Del	DEL	NULL	p.E615fs	ENST00000339777.4	37	c.1837	CCDS45001.1	12																																																																																			LRRC43	-	NULL	ENSG00000158113		0.542	LRRC43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC43	HGNC	protein_coding	OTTHUMT00000401589.1		0.00	33	0	A	NM_152759		122685870	+1	tier1		no_errors	ENST00000339777	ensembl	human	known	74_37	frame_shift_del	14.29	18	3	DEL	0.722	-
LRRC66	339977	genome.wustl.edu	37	4	52861992	52861992	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr4:52861992G>T	ENST00000343457.3	-	4	1202	c.1196C>A	c.(1195-1197)cCt>cAt	p.P399H		NM_001024611.1	NP_001019782.1	Q68CR7	LRC66_HUMAN	leucine rich repeat containing 66	399						integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(9)|kidney(1)|large_intestine(8)|lung(34)|ovary(1)|pancreas(1)|prostate(2)|skin(1)	58						GTCAACATAAGGCCTTGTGAA	0.547																																																	0													64.0	66.0	65.0					4																	52861992		1961	4156	6117	SO:0001583	missense	0			BC040414	CCDS43229.1	4q12	2008-08-08			ENSG00000188993	ENSG00000188993			34299	protein-coding gene	gene with protein product							Standard	XM_005265739		Approved		uc003gzi.3	Q68CR7	OTTHUMG00000160623	ENST00000343457.3:c.1196C>A	4.37:g.52861992G>T	ENSP00000341944:p.Pro399His			Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.P399H	ENST00000343457.3	37	c.1196	CCDS43229.1	4	.	.	.	.	.	.	.	.	.	.	G	14.27	2.485542	0.44147	.	.	ENSG00000188993	ENST00000343457	T	0.51574	0.7	4.67	4.67	0.58626	.	0.000000	0.42964	D	0.000633	T	0.65533	0.2700	M	0.63843	1.955	0.38241	D	0.941324	D	0.89917	1.0	D	0.97110	1.0	T	0.72037	-0.4411	10	0.87932	D	0	-18.3676	14.6507	0.68794	0.0:0.0:1.0:0.0	.	399	Q68CR7	LRC66_HUMAN	H	399	ENSP00000341944:P399H	ENSP00000341944:P399H	P	-	2	0	LRRC66	52556749	1.000000	0.71417	0.819000	0.32651	0.039000	0.13416	6.117000	0.71577	2.306000	0.77630	0.467000	0.42956	CCT	LRRC66	-	NULL	ENSG00000188993		0.547	LRRC66-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC66	HGNC	protein_coding	OTTHUMT00000361473.1	-	0.00	40	0	G	NM_001024611		52861992	-1	tier1	-	no_errors	ENST00000343457	ensembl	human	known	74_37	missense	12.00	22	3	SNP	0.991	T
LRRK1	79705	genome.wustl.edu	37	15	101561287	101561287	+	Missense_Mutation	SNP	A	A	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr15:101561287A>T	ENST00000388948.3	+	13	1998	c.1639A>T	c.(1639-1641)Agt>Tgt	p.S547C	LRRK1_ENST00000284395.5_Missense_Mutation_p.S544C	NM_024652.3	NP_078928.3			leucine-rich repeat kinase 1											breast(2)|central_nervous_system(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|lung(25)|ovary(4)|prostate(1)|skin(1)	72	Melanoma(26;0.00505)|Lung NSC(78;0.00793)|all_lung(78;0.0094)		OV - Ovarian serous cystadenocarcinoma(32;0.000932)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			GGCCTTCCTAAGTGAGTCTTT	0.498																																																	0													108.0	104.0	105.0					15																	101561287		1933	4130	6063	SO:0001583	missense	0			AB058693	CCDS42086.1	15q26.3	2007-01-29			ENSG00000154237	ENSG00000154237			18608	protein-coding gene	gene with protein product		610986				11347906, 14654223	Standard	XM_005254979		Approved	FLJ23119, KIAA1790, Roco1, RIPK6	uc002bwr.3	Q38SD2	OTTHUMG00000165514	ENST00000388948.3:c.1639A>T	15.37:g.101561287A>T	ENSP00000373600:p.Ser547Cys			Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Leu-rich_rpt,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_Small_GTPase,superfamily_Kinase-like_dom,superfamily_P-loop_NTPase,superfamily_Ankyrin_rpt-contain_dom,superfamily_WD40_repeat_dom,smart_Ankyrin_rpt,smart_Leu-rich_rpt_typical-subtyp,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Ankyrin_rpt-contain_dom,pfscan_Prot_kinase_dom	p.S547C	ENST00000388948.3	37	c.1639	CCDS42086.1	15	.	.	.	.	.	.	.	.	.	.	A	18.13	3.555258	0.65425	.	.	ENSG00000154237	ENST00000388948;ENST00000284395	T;T	0.23552	1.9;1.9	5.5	4.38	0.52667	.	0.122446	0.56097	D	0.000033	T	0.20740	0.0499	N	0.16098	0.37	0.35987	D	0.836456	D	0.59357	0.985	P	0.49999	0.628	T	0.17018	-1.0383	10	0.37606	T	0.19	.	10.4583	0.44563	0.9239:0.0:0.0761:0.0	.	547	Q38SD2	LRRK1_HUMAN	C	547;544	ENSP00000373600:S547C;ENSP00000284395:S544C	ENSP00000284395:S544C	S	+	1	0	LRRK1	99378810	0.999000	0.42202	0.422000	0.26621	0.889000	0.51656	4.190000	0.58365	0.921000	0.36994	0.454000	0.30748	AGT	LRRK1	-	NULL	ENSG00000154237		0.498	LRRK1-003	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	LRRK1	HGNC	protein_coding	OTTHUMT00000384567.2	-	0.00	31	0	A	NM_024652		101561287	+1	tier1	-	no_errors	ENST00000388948	ensembl	human	known	74_37	missense	14.81	23	4	SNP	0.829	T
MALAT1	378938	genome.wustl.edu	37	11	65266920	65266920	+	lincRNA	SNP	T	T	A			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr11:65266920T>A	ENST00000534336.1	+	0	1688				AP000769.7_ENST00000602344.1_lincRNA	NR_002819.2		Q9UHZ2	MALAT_HUMAN	metastasis associated lung adenocarcinoma transcript 1 (non-protein coding)																		TAAAGTTTAGTTTAAAAGTTG	0.338																																																	0													9.0	10.0	9.0					11																	65266920		868	1971	2839			0			AF001540		11q13.1	2013-12-11	2007-11-20		ENSG00000251562	ENSG00000251562		"""Long non-coding RNAs"", ""-"""	29665	non-coding RNA	RNA, long non-coding	"""metastasis associated in lung adenocarcinoma transcript 1"", ""non-protein coding RNA 47"", ""hepcarcin"", ""nuclear enriched abundant transcript 2"", ""nuclear paraspeckle assembly transcript 2 (non-protein coding)"", ""long intergenic non-protein coding RNA 47"""	607924				12970751, 22560368	Standard	NR_002819		Approved	PRO1073, MALAT-1, NCRNA00047, HCN, NEAT2, LINC00047, mascRNA	uc010roh.3	Q9UHZ2	OTTHUMG00000166322		11.37:g.65266920T>A				RNA	SNP	-	NULL	ENST00000534336.1	37	NULL		11																																																																																			MALAT1	-	-	ENSG00000251562		0.338	MALAT1-001	KNOWN	basic	lincRNA	MALAT1	HGNC	lincRNA	OTTHUMT00000389143.1	-	0.00	96	0	T	NR_002819		65266920	+1	tier1	-	no_errors	ENST00000534336	ensembl	human	known	74_37	rna	30.36	39	17	SNP	0.008	A
MALAT1	378938	genome.wustl.edu	37	11	65270548	65270548	+	lincRNA	SNP	G	G	C			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr11:65270548G>C	ENST00000534336.1	+	0	5316					NR_002819.2		Q9UHZ2	MALAT_HUMAN	metastasis associated lung adenocarcinoma transcript 1 (non-protein coding)																		CAAGTGGATTGAGGAGGCTGT	0.403																																																	0													24.0	22.0	23.0					11																	65270548		874	1988	2862			0			AF001540		11q13.1	2013-12-11	2007-11-20		ENSG00000251562	ENSG00000251562		"""Long non-coding RNAs"", ""-"""	29665	non-coding RNA	RNA, long non-coding	"""metastasis associated in lung adenocarcinoma transcript 1"", ""non-protein coding RNA 47"", ""hepcarcin"", ""nuclear enriched abundant transcript 2"", ""nuclear paraspeckle assembly transcript 2 (non-protein coding)"", ""long intergenic non-protein coding RNA 47"""	607924				12970751, 22560368	Standard	NR_002819		Approved	PRO1073, MALAT-1, NCRNA00047, HCN, NEAT2, LINC00047, mascRNA	uc010roh.3	Q9UHZ2	OTTHUMG00000166322		11.37:g.65270548G>C				RNA	SNP	-	NULL	ENST00000534336.1	37	NULL		11																																																																																			MALAT1	-	-	ENSG00000251562		0.403	MALAT1-001	KNOWN	basic	lincRNA	MALAT1	HGNC	lincRNA	OTTHUMT00000389143.1	-	0.00	60	0	G	NR_002819		65270548	+1	tier1	-	no_errors	ENST00000508832	ensembl	human	known	74_37	rna	19.35	25	6	SNP	0.862	C
MALAT1	378938	genome.wustl.edu	37	11	65271577	65271577	+	lincRNA	SNP	G	G	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr11:65271577G>T	ENST00000534336.1	+	0	6345					NR_002819.2		Q9UHZ2	MALAT_HUMAN	metastasis associated lung adenocarcinoma transcript 1 (non-protein coding)																		GGGTGCCTGTGGGGTTTTAAA	0.393																																																	0													26.0	27.0	27.0					11																	65271577		874	1988	2862			0			AF001540		11q13.1	2013-12-11	2007-11-20		ENSG00000251562	ENSG00000251562		"""Long non-coding RNAs"", ""-"""	29665	non-coding RNA	RNA, long non-coding	"""metastasis associated in lung adenocarcinoma transcript 1"", ""non-protein coding RNA 47"", ""hepcarcin"", ""nuclear enriched abundant transcript 2"", ""nuclear paraspeckle assembly transcript 2 (non-protein coding)"", ""long intergenic non-protein coding RNA 47"""	607924				12970751, 22560368	Standard	NR_002819		Approved	PRO1073, MALAT-1, NCRNA00047, HCN, NEAT2, LINC00047, mascRNA	uc010roh.3	Q9UHZ2	OTTHUMG00000166322		11.37:g.65271577G>T				RNA	SNP	-	NULL	ENST00000534336.1	37	NULL		11																																																																																			MALAT1	-	-	ENSG00000251562		0.393	MALAT1-001	KNOWN	basic	lincRNA	MALAT1	HGNC	lincRNA	OTTHUMT00000389143.1		0.00	41	0	G	NR_002819		65271577	+1			no_errors	ENST00000534336	ensembl	human	known	74_37	rna	10.00	27	3	SNP	0.160	T
MAMDC4	158056	genome.wustl.edu	37	9	139751128	139751128	+	3'UTR	SNP	G	G	T	rs200584832	byFrequency	TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr9:139751128G>T	ENST00000485732.1	+	0	2280				MAMDC4_ENST00000445819.1_Intron|MAMDC4_ENST00000317446.2_Intron					MAM domain containing 4											breast(4)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(1)|lung(4)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(2)	19	all_cancers(76;0.0763)|all_epithelial(76;0.198)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;1.52e-05)|Epithelial(140;0.000171)		GGGGAGGGGAGAAGGTGTGTG	0.637																																																	0													40.0	35.0	37.0					9																	139751128		2194	4295	6489	SO:0001624	3_prime_UTR_variant	0			AL834531	CCDS7010.1	9q34.3	2013-10-21			ENSG00000177943	ENSG00000177943			24083	protein-coding gene	gene with protein product	"""apical early endosomal glycoprotein precursor"", ""endotubin"""					7829488	Standard	NM_206920		Approved	AEGP, DKFZp434M1411	uc004cjs.3	Q6UXC1	OTTHUMG00000020951	ENST00000485732.1:c.*2277G>T	9.37:g.139751128G>T				RNA	SNP	-	NULL	ENST00000485732.1	37	NULL		9																																																																																			MAMDC4	-	-	ENSG00000177943		0.637	MAMDC4-001	KNOWN	basic	processed_transcript	MAMDC4	HGNC	protein_coding	OTTHUMT00000055156.1	-	0.00	54	0	G	NM_206920		139751128	+1	tier1	-	no_errors	ENST00000485732	ensembl	human	known	74_37	rna	9.76	37	4	SNP	0.000	T
MAMLD1	10046	genome.wustl.edu	37	X	149639632	149639632	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chrX:149639632T>C	ENST00000370401.2	+	4	2097	c.1787T>C	c.(1786-1788)cTg>cCg	p.L596P	MAMLD1_ENST00000426613.2_Missense_Mutation_p.L571P|MAMLD1_ENST00000432680.2_Missense_Mutation_p.L571P|MAMLD1_ENST00000455522.2_Missense_Mutation_p.L77P|MAMLD1_ENST00000262858.5_Missense_Mutation_p.L596P			Q13495	MAMD1_HUMAN	mastermind-like domain containing 1	596	Poly-Gln.				male gonad development (GO:0008584)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				breast(1)|endometrium(4)|kidney(3)|large_intestine(12)|lung(14)|ovary(1)|prostate(2)	37	Acute lymphoblastic leukemia(192;6.56e-05)					ACCTTgcagctgcagcagcag	0.612																																																	0													67.0	60.0	62.0					X																	149639632		2203	4300	6503	SO:0001583	missense	0			U46023	CCDS14693.2, CCDS55525.1, CCDS55526.1	Xq28	2008-02-05	2008-01-03	2008-01-03	ENSG00000013619	ENSG00000013619			2568	protein-coding gene	gene with protein product		300120	"""chromosome X open reading frame 6"""	CXorf6		9169146, 17086185, 18162467	Standard	NM_001177465		Approved	CG1, F18	uc011mxu.2	Q13495	OTTHUMG00000024157	ENST00000370401.2:c.1787T>C	X.37:g.149639632T>C	ENSP00000359428:p.Leu596Pro		B2RCQ4|B4DG93|B9EGA5	Missense_Mutation	SNP	NULL	p.L571P	ENST00000370401.2	37	c.1712	CCDS14693.2	X	.	.	.	.	.	.	.	.	.	.	T	10.35	1.324548	0.24080	.	.	ENSG00000013619	ENST00000445612;ENST00000370401;ENST00000432680;ENST00000262858;ENST00000426613;ENST00000455522	T;T;T;T;T	0.68479	-0.33;-0.33;-0.33;-0.33;-0.33	3.98	-5.4	0.02656	.	1.571050	0.03858	N	0.273440	T	0.54581	0.1867	L	0.51422	1.61	0.52501	D	0.999956	B;B;B;B	0.11235	0.001;0.002;0.004;0.004	B;B;B;B	0.13407	0.006;0.006;0.009;0.006	T	0.24905	-1.0147	10	0.23891	T	0.37	-0.4166	5.7174	0.17968	0.5456:0.2684:0.0:0.186	.	468;571;571;596	F6WVG1;Q13495-4;Q13495-3;Q13495	.;.;.;MAMD1_HUMAN	P	468;596;571;596;571;77	ENSP00000359428:L596P;ENSP00000414517:L571P;ENSP00000262858:L596P;ENSP00000397438:L571P;ENSP00000389106:L77P	ENSP00000262858:L596P	L	+	2	0	MAMLD1	149390290	0.129000	0.22400	0.010000	0.14722	0.386000	0.30323	-0.423000	0.07034	-0.945000	0.03681	-1.230000	0.01575	CTG	MAMLD1	-	NULL	ENSG00000013619		0.612	MAMLD1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MAMLD1	HGNC	protein_coding	OTTHUMT00000060844.2		0.00	22	0	T	NM_005491		149639632	+1			no_errors	ENST00000432680	ensembl	human	known	74_37	missense	12.12	29	4	SNP	0.980	C
MAN2B1	4125	genome.wustl.edu	37	19	12760814	12760814	+	Missense_Mutation	SNP	T	T	A	rs201318291		TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr19:12760814T>A	ENST00000456935.2	-	18	2220	c.2180A>T	c.(2179-2181)aAg>aTg	p.K727M	CTD-2192J16.22_ENST00000597692.1_5'Flank|MAN2B1_ENST00000221363.4_Missense_Mutation_p.K726M	NM_000528.3|NM_001173498.1	NP_000519.2|NP_001166969.1	O00754	MA2B1_HUMAN	mannosidase, alpha, class 2B, member 1	727					cellular protein modification process (GO:0006464)|mannose metabolic process (GO:0006013)|protein deglycosylation (GO:0006517)	extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	alpha-mannosidase activity (GO:0004559)|carbohydrate binding (GO:0030246)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(10)|ovary(4)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	33						GATGACCTCCTTCCCCCAGGT	0.592																																																	0													207.0	186.0	193.0					19																	12760814		2203	4300	6503	SO:0001583	missense	0				CCDS32919.1, CCDS54224.1	19p13.2	2013-09-20			ENSG00000104774	ENSG00000104774	3.2.1.24		6826	protein-coding gene	gene with protein product		609458		MANB			Standard	NM_000528		Approved	LAMAN	uc002mub.2	O00754	OTTHUMG00000156397	ENST00000456935.2:c.2180A>T	19.37:g.12760814T>A	ENSP00000395473:p.Lys727Met		G5E928|O15330|Q16680|Q93094|Q9BW13	Missense_Mutation	SNP	pfam_Glyco_hydro_38_C,pfam_Glyco_hydro_38_N,pfam_Glyco_hydro_38_cen_dom,superfamily_Gal_mutarotase_SF_dom,superfamily_Glyco_hydro/deAcase_b/a-brl,smart_Glyco_hydro_38_cen_dom	p.K727M	ENST00000456935.2	37	c.2180	CCDS32919.1	19	.	.	.	.	.	.	.	.	.	.	T	20.7	4.038182	0.75617	.	.	ENSG00000104774	ENST00000456935;ENST00000536796;ENST00000221363	D;D	0.82433	-1.61;-1.61	5.13	5.13	0.70059	Glycosyl hydrolases 38, C-terminal (1);Glycoside hydrolase-type carbohydrate-binding (1);	0.134780	0.34291	N	0.004087	D	0.91768	0.7396	M	0.89095	3.005	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.92827	0.6277	10	0.62326	D	0.03	-41.2834	12.9397	0.58335	0.0:0.0:0.0:1.0	.	726;727	G5E928;O00754	.;MA2B1_HUMAN	M	727;666;726	ENSP00000395473:K727M;ENSP00000221363:K726M	ENSP00000221363:K726M	K	-	2	0	MAN2B1	12621814	1.000000	0.71417	1.000000	0.80357	0.716000	0.41182	7.319000	0.79040	2.166000	0.68216	0.454000	0.30748	AAG	MAN2B1	-	pfam_Glyco_hydro_38_C,superfamily_Gal_mutarotase_SF_dom	ENSG00000104774		0.592	MAN2B1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MAN2B1	HGNC	protein_coding	OTTHUMT00000344062.1		0.00	50	0	T			12760814	-1			no_errors	ENST00000456935	ensembl	human	known	74_37	missense	12.90	27	4	SNP	1.000	A
MAP3K10	4294	genome.wustl.edu	37	19	40698370	40698370	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr19:40698370G>T	ENST00000253055.3	+	1	720	c.432G>T	c.(430-432)caG>caT	p.Q144H	MAP3K10_ENST00000593906.1_Intron	NM_002446.3	NP_002437.2	Q02779	M3K10_HUMAN	mitogen-activated protein kinase kinase kinase 10	144	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of JNKK activity (GO:0007256)|activation of JUN kinase activity (GO:0007257)|apoptotic process (GO:0006915)|JNK cascade (GO:0007254)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of apoptotic process (GO:0043065)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|protein autophosphorylation (GO:0046777)|signal transduction (GO:0007165)|smoothened signaling pathway (GO:0007224)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|bHLH transcription factor binding (GO:0043425)|JUN kinase kinase kinase activity (GO:0004706)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|transcription corepressor activity (GO:0003714)			NS(1)|breast(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(5)|ovary(2)|pancreas(1)|prostate(1)|skin(2)	24						AGGTGTGCCAGGAAGCCCGGC	0.657																																																	0													33.0	40.0	38.0					19																	40698370		2203	4300	6503	SO:0001583	missense	0			X90846	CCDS12549.1	19q13.2	2014-08-12			ENSG00000130758		2.7.11.1	"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6849	protein-coding gene	gene with protein product	"""MKN28 kinase"", ""mixed lineage kinase 2"", ""MKN28 derived nonreceptor_type serine/threonine kinase"""	600137		MLK2		8536694, 7731697	Standard	NM_002446		Approved	MST, MEKK10	uc002ona.3	Q02779	OTTHUMG00000182591	ENST00000253055.3:c.432G>T	19.37:g.40698370G>T	ENSP00000253055:p.Gln144His		Q12761|Q14871	Missense_Mutation	SNP	pirsf_MAPKKK9/10/11,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_SH3_2,pfam_SH3_domain,superfamily_Kinase-like_dom,superfamily_SH3_domain,smart_SH3_domain,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_SH3_domain,pfscan_SH3_domain,pfscan_Prot_kinase_dom	p.Q144H	ENST00000253055.3	37	c.432	CCDS12549.1	19	.	.	.	.	.	.	.	.	.	.	G	20.2	3.942190	0.73672	.	.	ENSG00000130758	ENST00000253055	D	0.83075	-1.68	4.62	3.58	0.41010	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.136846	0.50627	D	0.000104	D	0.84665	0.5522	L	0.33137	0.985	0.58432	D	0.999995	P	0.45957	0.869	D	0.64877	0.93	D	0.85144	0.0982	10	0.87932	D	0	.	10.4784	0.44678	0.0952:0.0:0.9048:0.0	.	144	Q02779	M3K10_HUMAN	H	144	ENSP00000253055:Q144H	ENSP00000253055:Q144H	Q	+	3	2	MAP3K10	45390210	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	1.316000	0.33620	1.174000	0.42811	0.655000	0.94253	CAG	MAP3K10	-	pirsf_MAPKKK9/10/11,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000130758		0.657	MAP3K10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAP3K10	HGNC	protein_coding	OTTHUMT00000462552.1	-	0.00	98	0	G	NM_002446		40698370	+1	tier1	-	no_errors	ENST00000253055	ensembl	human	known	74_37	missense	5.56	68	4	SNP	1.000	T
MAPRE3	22924	genome.wustl.edu	37	2	27246243	27246243	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr2:27246243T>G	ENST00000233121.2	+	3	363	c.165T>G	c.(163-165)tgT>tgG	p.C55W	MAPRE3_ENST00000405074.3_Missense_Mutation_p.C55W|MAPRE3_ENST00000402218.1_Missense_Mutation_p.C55W			Q9UPY8	MARE3_HUMAN	microtubule-associated protein, RP/EB family, member 3	55	CH. {ECO:0000255|PROSITE- ProRule:PRU00044}.				mitotic nuclear division (GO:0007067)|positive regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045737)|positive regulation of microtubule plus-end binding (GO:1903033)|positive regulation of transcription, DNA-templated (GO:0045893)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|midbody (GO:0030496)|perinuclear region of cytoplasm (GO:0048471)	microtubule binding (GO:0008017)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(3)|upper_aerodigestive_tract(1)	13	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TCCCCGGCTGTGTGCACTTGA	0.537																																																	0													122.0	104.0	110.0					2																	27246243		2203	4300	6503	SO:0001583	missense	0			Y11174	CCDS1731.1	2p23.3-p23.1	2008-06-04			ENSG00000084764	ENSG00000084764			6892	protein-coding gene	gene with protein product		605788				9233623	Standard	NM_012326		Approved	RP3, EB3	uc002rhw.3	Q9UPY8	OTTHUMG00000097067	ENST00000233121.2:c.165T>G	2.37:g.27246243T>G	ENSP00000233121:p.Cys55Trp		B7WPK5|O00265|Q6FHB0|Q6FI15|Q9BZP7|Q9BZP8	Missense_Mutation	SNP	pfam_EB1_C,pfam_CH-domain,superfamily_CH-domain,superfamily_EB1_C,pfscan_CH-domain	p.C55W	ENST00000233121.2	37	c.165	CCDS1731.1	2	.	.	.	.	.	.	.	.	.	.	T	11.82	1.753967	0.31046	.	.	ENSG00000084764	ENST00000233121;ENST00000405074;ENST00000458529;ENST00000402218	T;T;T;T	0.42131	0.98;0.98;0.98;0.98	5.95	-6.74	0.01743	Calponin homology domain (4);	0.047836	0.85682	D	0.000000	T	0.62196	0.2408	M	0.88640	2.97	0.45883	D	0.99873	D;D;D	0.89917	0.998;1.0;1.0	D;D;D	0.81914	0.989;0.992;0.995	T	0.72054	-0.4406	10	0.87932	D	0	-7.7162	13.8339	0.63398	0.1017:0.6467:0.0:0.2517	.	55;55;55	B7Z867;Q9UPY8-2;Q9UPY8	.;.;MARE3_HUMAN	W	55	ENSP00000233121:C55W;ENSP00000383915:C55W;ENSP00000391705:C55W;ENSP00000385715:C55W	ENSP00000233121:C55W	C	+	3	2	MAPRE3	27099747	0.002000	0.14202	0.009000	0.14445	0.006000	0.05464	-1.297000	0.02759	-1.475000	0.01876	-0.904000	0.02843	TGT	MAPRE3	-	pfam_CH-domain,superfamily_CH-domain,pfscan_CH-domain	ENSG00000084764		0.537	MAPRE3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAPRE3	HGNC	protein_coding	OTTHUMT00000214183.1		0.00	28	0	T	NM_012326		27246243	+1			no_errors	ENST00000233121	ensembl	human	known	74_37	missense	11.11	16	2	SNP	0.189	G
MARCH2	51257	genome.wustl.edu	37	19	8503352	8503352	+	Silent	SNP	G	G	T	rs200360606		TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr19:8503352G>T	ENST00000602117.1	+	5	1118	c.663G>T	c.(661-663)gcG>gcT	p.A221A	MARCH2_ENST00000393944.1_Silent_p.A221A|MARCH2_ENST00000601283.1_Intron|MARCH2_ENST00000381035.4_Silent_p.A151A|MARCH2_ENST00000215555.2_Silent_p.A221A			Q9P0N8	MARH2_HUMAN	membrane-associated ring finger (C3HC4) 2, E3 ubiquitin protein ligase	221					endocytosis (GO:0006897)|protein ubiquitination (GO:0016567)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(1)|lung(3)|ovary(3)|skin(1)|urinary_tract(1)	10						TCCGGGAGGCGGACAGCCCCG	0.617																																																	0													45.0	47.0	46.0					19																	8503352		2203	4300	6503	SO:0001819	synonymous_variant	0			AF151074	CCDS12202.1, CCDS32894.1	19p13.2	2013-01-09	2012-02-23			ENSG00000099785		"""MARCH membrane-associated ring fingers"", ""RING-type (C3HC4) zinc fingers"""	28038	protein-coding gene	gene with protein product		613332	"""membrane-associated ring finger (C3HC4) 2"""			11042152, 14722266	Standard	NM_016496		Approved	HSPC240, MARCH-II, RNF172	uc002mjw.3	Q9P0N8		ENST00000602117.1:c.663G>T	19.37:g.8503352G>T			A6NP10|Q5H785|Q8N5A3|Q96B78	Silent	SNP	pfam_Znf_C3HC4_RING-type,smart_Znf_RING-CH,pfscan_Znf_RING	p.A221	ENST00000602117.1	37	c.663	CCDS12202.1	19																																																																																			MARCH2	-	NULL	ENSG00000099785		0.617	MARCH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MARCH2	HGNC	protein_coding	OTTHUMT00000460361.2	-	0.00	62	0	G	NM_016496		8503352	+1	tier1	-	no_errors	ENST00000215555	ensembl	human	known	74_37	silent	13.79	25	4	SNP	0.000	T
MAST1	22983	genome.wustl.edu	37	19	12981985	12981985	+	Splice_Site	SNP	A	A	G			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr19:12981985A>G	ENST00000251472.4	+	24	3301	c.3262A>G	c.(3262-3264)Agc>Ggc	p.S1088G	AC020934.1_ENST00000578125.1_RNA	NM_014975.2	NP_055790.1			microtubule associated serine/threonine kinase 1											NS(1)|cervix(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(9)|lung(20)|ovary(5)|prostate(5)|skin(3)	56						GGGCCAGGAGAGGTGGGCACA	0.587																																																	0													41.0	42.0	42.0					19																	12981985		2203	4300	6503	SO:0001630	splice_region_variant	0			AB023190	CCDS32921.1	19p13.2	2008-02-05				ENSG00000105613			19034	protein-coding gene	gene with protein product		612256					Standard	NM_014975		Approved	SAST, KIAA0973	uc002mvm.3	Q9Y2H9		ENST00000251472.4:c.3263+1A>G	19.37:g.12981985A>G				Missense_Mutation	SNP	pfam_MA_Ser/Thr_Kinase_dom,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_PDZ,superfamily_Kinase-like_dom,superfamily_MAST_pre-PK_dom,superfamily_PDZ,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_PDZ,pfscan_PDZ,pfscan_Prot_kinase_dom	p.S1088G	ENST00000251472.4	37	c.3262	CCDS32921.1	19	.	.	.	.	.	.	.	.	.	.	A	16.65	3.182383	0.57800	.	.	ENSG00000105613	ENST00000251472	T	0.67865	-0.29	4.85	4.85	0.62838	.	0.000000	0.85682	D	0.000000	T	0.64438	0.2598	M	0.72118	2.19	0.47276	D	0.999374	B	0.30634	0.288	B	0.27170	0.077	T	0.67090	-0.5758	10	0.56958	D	0.05	-26.9965	12.3753	0.55277	1.0:0.0:0.0:0.0	.	1088	Q9Y2H9	MAST1_HUMAN	G	1088	ENSP00000251472:S1088G	ENSP00000251472:S1088G	S	+	1	0	MAST1	12842985	1.000000	0.71417	1.000000	0.80357	0.749000	0.42624	5.333000	0.65917	1.807000	0.52817	0.379000	0.24179	AGC	MAST1	-	NULL	ENSG00000105613		0.587	MAST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAST1	HGNC	protein_coding	OTTHUMT00000451733.2		0.00	66	0	A	NM_014975	Missense_Mutation	12981985	+1			no_errors	ENST00000251472	ensembl	human	known	74_37	missense	8.82	31	3	SNP	1.000	G
MAT2A	4144	genome.wustl.edu	37	2	85770071	85770071	+	Silent	SNP	C	C	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr2:85770071C>T	ENST00000306434.3	+	8	1122	c.999C>T	c.(997-999)ttC>ttT	p.F333F	MAT2A_ENST00000409017.1_Silent_p.F270F	NM_005911.5	NP_005902.1	P31153	METK2_HUMAN	methionine adenosyltransferase II, alpha	333					cellular nitrogen compound metabolic process (GO:0034641)|methylation (GO:0032259)|one-carbon metabolic process (GO:0006730)|S-adenosylmethionine biosynthetic process (GO:0006556)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|methionine adenosyltransferase complex (GO:0048269)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|methionine adenosyltransferase activity (GO:0004478)			breast(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	9					L-Methionine(DB00134)|S-Adenosylmethionine(DB00118)	TCTCCATTTTCCATTATGGTA	0.388																																																	0													177.0	181.0	179.0					2																	85770071		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS1977.1	2p11.2	2008-06-03			ENSG00000168906	ENSG00000168906			6904	protein-coding gene	gene with protein product		601468				1426236, 9703951	Standard	NM_005911		Approved	SAMS2, MATA2, MATII	uc002spr.3	P31153	OTTHUMG00000130174	ENST00000306434.3:c.999C>T	2.37:g.85770071C>T			A8K511|B4DN45|D6W5L1|Q53SP5	Silent	SNP	pfam_S-AdoMet_synt_C,pfam_S-AdoMet_synt_central,pfam_S-AdoMet_synt_N,superfamily_S-AdoMet_synthetase_sfam,pirsf_S-AdoMet_synthetase,tigrfam_S-AdoMet_synthetase	p.F333	ENST00000306434.3	37	c.999	CCDS1977.1	2																																																																																			MAT2A	-	pfam_S-AdoMet_synt_C,superfamily_S-AdoMet_synthetase_sfam,pirsf_S-AdoMet_synthetase,tigrfam_S-AdoMet_synthetase	ENSG00000168906		0.388	MAT2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAT2A	HGNC	protein_coding	OTTHUMT00000252491.2	-	0.00	33	0	C	NM_005911		85770071	+1	tier1	-	no_errors	ENST00000306434	ensembl	human	known	74_37	silent	31.58	13	6	SNP	1.000	T
MATN1	4146	genome.wustl.edu	37	1	31188993	31188993	+	Missense_Mutation	SNP	G	G	A	rs141354318		TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr1:31188993G>A	ENST00000373765.4	-	5	1005	c.970C>T	c.(970-972)Cgc>Tgc	p.R324C	MATN1-AS1_ENST00000414763.1_RNA|MATN1_ENST00000477320.1_5'UTR|MATN1-AS1_ENST00000414532.2_RNA|MATN1-AS1_ENST00000454613.1_RNA	NM_002379.3	NP_002370.1	P21941	MATN1_HUMAN	matrilin 1, cartilage matrix protein	324	VWFA 2. {ECO:0000255|PROSITE- ProRule:PRU00219}.				extracellular matrix organization (GO:0030198)|growth plate cartilage chondrocyte morphogenesis (GO:0003429)|protein complex assembly (GO:0006461)|regulation of bone mineralization (GO:0030500)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|prostate(1)|upper_aerodigestive_tract(1)	12		Colorectal(325;0.00792)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)|Ovarian(437;0.0563)|Breast(348;0.0848)|Medulloblastoma(700;0.123)		Colorectal(126;1.29e-05)|COAD - Colon adenocarcinoma(152;0.000726)|STAD - Stomach adenocarcinoma(196;0.0183)|READ - Rectum adenocarcinoma(331;0.0649)		AACTCCTGGCGCACAGAGCTT	0.572																																																	0								G	CYS/ARG	0,4406		0,0,2203	82.0	88.0	86.0		970	5.3	0.9	1	dbSNP_134	86	1,8599	1.2+/-3.3	0,1,4299	no	missense	MATN1	NM_002379.3	180	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	324/497	31188993	1,13005	2203	4300	6503	SO:0001583	missense	0			M55675	CCDS336.1	1p35	2008-02-05			ENSG00000162510	ENSG00000162510			6907	protein-coding gene	gene with protein product		115437		CRTM, CMP		2246248, 9083061	Standard	NM_002379		Approved		uc001brz.3	P21941	OTTHUMG00000003705	ENST00000373765.4:c.970C>T	1.37:g.31188993G>A	ENSP00000362870:p.Arg324Cys		B2R7E3|Q5TBB9	Missense_Mutation	SNP	pfam_VWF_A,pfam_Matrilin_coiled-coil_trimer,pfam_EGF-like_Ca-bd_dom,smart_VWF_A,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,pfscan_VWF_A	p.R324C	ENST00000373765.4	37	c.970	CCDS336.1	1	.	.	.	.	.	.	.	.	.	.	G	14.20	2.465211	0.43839	0.0	1.16E-4	ENSG00000162510	ENST00000373765	D	0.84442	-1.85	5.34	5.34	0.76211	von Willebrand factor, type A (3);	.	.	.	.	D	0.94401	0.8199	H	0.96547	3.84	0.54753	D	0.999981	D;D	0.89917	1.0;1.0	D;D	0.70716	0.97;0.959	D	0.95650	0.8706	9	0.87932	D	0	-25.4758	13.6234	0.62150	0.0:0.0:0.7155:0.2845	.	308;324	A3KMG0;P21941	.;MATN1_HUMAN	C	324	ENSP00000362870:R324C	ENSP00000362870:R324C	R	-	1	0	MATN1	30961580	1.000000	0.71417	0.865000	0.33974	0.150000	0.21749	3.418000	0.52721	2.499000	0.84300	0.650000	0.86243	CGC	MATN1	-	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	ENSG00000162510		0.572	MATN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MATN1	HGNC	protein_coding	OTTHUMT00000010458.1		0.00	30	0	G	NM_002379		31188993	-1			no_errors	ENST00000373765	ensembl	human	known	74_37	missense	15.79	16	3	SNP	0.999	A
MBD6	114785	genome.wustl.edu	37	12	57921732	57921732	+	Frame_Shift_Del	DEL	G	G	-			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr12:57921732delG	ENST00000355673.3	+	9	2694	c.2338delG	c.(2338-2340)gggfs	p.G782fs	MBD6_ENST00000431731.2_Frame_Shift_Del_p.G782fs	NM_052897.3	NP_443129.3	Q96DN6	MBD6_HUMAN	methyl-CpG binding domain protein 6	782	Pro-rich.					chromocenter (GO:0010369)|nucleus (GO:0005634)	chromatin binding (GO:0003682)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(8)|lung(8)|ovary(1)|urinary_tract(1)	31						GCTCCTCCCTGGGGGGGGAGC	0.627																																																	0										71,34,4157		0,0,71,1,32,2027	35.0	40.0	38.0			2.6	1.0	12		40	92,54,8084		1,0,90,3,48,3973	no	codingComplex	MBD6	NM_052897.3		1,0,161,4,80,6000	A1A1,A1A2,A1R,A2A2,A2R,RR		1.774,2.4636,2.0093			57921732	163,88,12241	2201	4297	6498	SO:0001589	frameshift_variant	0			AB067474	CCDS8944.1	12q13.2	2008-02-05				ENSG00000166987			20445	protein-coding gene	gene with protein product						12529184	Standard	NM_052897		Approved	KIAA1887	uc001soj.1	Q96DN6		ENST00000355673.3:c.2338delG	12.37:g.57921732delG	ENSP00000347896:p.Gly782fs		Q8N3M0|Q8NA81|Q96Q00	Frame_Shift_Del	DEL	superfamily_DNA-bd_dom,smart_Methyl_CpG_DNA-bd,pfscan_Methyl_CpG_DNA-bd	p.G782fs	ENST00000355673.3	37	c.2338	CCDS8944.1	12																																																																																			MBD6	-	NULL	ENSG00000166987		0.627	MBD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MBD6	HGNC	protein_coding	OTTHUMT00000407250.1		0.00	60	0	G			57921732	+1	tier1		no_errors	ENST00000355673	ensembl	human	known	74_37	frame_shift_del	11.54	23	3	DEL	1.000	-
MCF2	4168	genome.wustl.edu	37	X	138678710	138678710	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chrX:138678710T>C	ENST00000370576.4	-	19	2484	c.2275A>G	c.(2275-2277)Aaa>Gaa	p.K759E	MCF2_ENST00000520602.1_Missense_Mutation_p.K819E|MCF2_ENST00000338585.6_Missense_Mutation_p.K775E|MCF2_ENST00000370578.4_Missense_Mutation_p.K904E|MCF2_ENST00000519895.1_Missense_Mutation_p.K835E|AL033403.1_ENST00000401295.2_RNA|MCF2_ENST00000536274.1_Missense_Mutation_p.K720E|MCF2_ENST00000370573.4_Missense_Mutation_p.K759E|MCF2_ENST00000414978.1_Missense_Mutation_p.K819E	NM_001171879.1|NM_005369.4	NP_001165350.1|NP_005360.3	P10911	MCF2_HUMAN	MCF.2 cell line derived transforming sequence	759	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				apoptotic signaling pathway (GO:0097190)|dendrite development (GO:0016358)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(2)|cervix(2)|endometrium(4)|kidney(2)|large_intestine(15)|lung(34)|pancreas(1)|pleura(1)|prostate(1)	62	Acute lymphoblastic leukemia(192;0.000127)					TGTCTTACTTTCCAACAGTGT	0.358																																																	0													56.0	45.0	49.0					X																	138678710		2203	4299	6502	SO:0001583	missense	0				CCDS14667.1, CCDS48175.1, CCDS55514.1, CCDS55515.1, CCDS55516.1, CCDS55517.1	Xq26.3-q27.1	2012-07-24			ENSG00000101977	ENSG00000101977		"""Rho guanine nucleotide exchange factors"""	6940	protein-coding gene	gene with protein product	"""Oncogene MCF2 (oncogene DBL)"""	311030				2577874, 1611909	Standard	NM_001099855		Approved	DBL, ARHGEF21	uc011mwo.1	P10911	OTTHUMG00000022537	ENST00000370576.4:c.2275A>G	X.37:g.138678710T>C	ENSP00000359608:p.Lys759Glu		B7Z3Y5|B7Z869|B7ZAV1|E9PH77|F5H091|P14919|Q5JYJ2|Q5JYJ3|Q5JYJ4|Q8IUF3|Q8IUF4|Q9UJB3	Missense_Mutation	SNP	pfam_DH-domain,superfamily_DH-domain,superfamily_CRAL-TRIO_dom,smart_CRAL-TRIO_dom,smart_Spectrin/alpha-actinin,smart_DH-domain,smart_Pleckstrin_homology,pfscan_CRAL-TRIO_dom,pfscan_Pleckstrin_homology,pfscan_DH-domain	p.K904E	ENST00000370576.4	37	c.2710	CCDS14667.1	X	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	22.1|22.1	4.248193|4.248193	0.80024|0.80024	.|.	.|.	ENSG00000101977|ENSG00000101977	ENST00000437564|ENST00000520602;ENST00000370576;ENST00000536274;ENST00000370578;ENST00000414978;ENST00000446225;ENST00000519895;ENST00000370573;ENST00000338585	.|T;T;T;T;T;T;T;T;T	.|0.13901	.|2.55;2.55;2.55;2.55;2.55;2.55;2.55;2.55;2.55	5.67|5.67	4.51|4.51	0.55191|0.55191	.|Pleckstrin homology-type (1);Pleckstrin homology domain (2);	.|0.128514	.|0.64402	.|D	.|0.000001	T|T	0.37046|0.37046	0.0989|0.0989	M|M	0.91249|0.91249	3.19|3.19	0.58432|0.58432	D|D	0.999994|0.999994	.|P;P;P;P;P;P;P;P	.|0.48764	.|0.862;0.773;0.915;0.862;0.915;0.862;0.913;0.862	.|B;B;P;P;P;P;P;P	.|0.55577	.|0.434;0.342;0.637;0.489;0.687;0.52;0.779;0.489	T|T	0.27872|0.27872	-1.0061|-1.0061	5|10	.|0.59425	.|D	.|0.04	.|.	9.7593|9.7593	0.40522|0.40522	0.0:0.0811:0.0:0.9188|0.0:0.0811:0.0:0.9188	.|.	.|835;904;720;759;759;904;775;759	.|E9PH77;B7Z3Z2;F5H091;B2R9S6;P10911-2;Q5JYJ7;P10911-4;P10911	.|.;.;.;.;.;.;.;MCF2_HUMAN	G|E	262|819;759;720;904;819;362;835;759;775	.|ENSP00000427745:K819E;ENSP00000359608:K759E;ENSP00000438155:K720E;ENSP00000359610:K904E;ENSP00000397055:K819E;ENSP00000405848:K362E;ENSP00000430276:K835E;ENSP00000359605:K759E;ENSP00000342204:K775E	.|ENSP00000342204:K775E	E|K	-|-	2|1	0|0	MCF2|MCF2	138506376|138506376	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.966000|0.966000	0.64601|0.64601	6.250000|6.250000	0.72435|0.72435	0.784000|0.784000	0.33661|0.33661	0.486000|0.486000	0.48141|0.48141	GAA|AAA	MCF2	-	smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	ENSG00000101977		0.358	MCF2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	MCF2	HGNC	protein_coding	OTTHUMT00000058560.1	-	0.00	45	0	T	NM_005369		138678710	-1	tier1	-	no_errors	ENST00000370578	ensembl	human	known	74_37	missense	40.62	19	13	SNP	1.000	C
MCF2L	23263	genome.wustl.edu	37	13	113701016	113701016	+	Intron	SNP	C	C	G			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr13:113701016C>G	ENST00000375608.3	+	5	517				MCF2L_ENST00000397021.1_3'UTR|MCF2L_ENST00000375604.2_Intron|MCF2L_ENST00000375601.3_Intron|MCF2L_ENST00000480321.1_3'UTR|MCF2L_ENST00000397030.1_Intron|MCF2L_ENST00000375597.4_Intron|MCF2L_ENST00000421756.1_Intron|MCF2L_ENST00000423482.2_Intron|MCF2L_ENST00000535094.2_Intron|MCF2L_ENST00000442652.2_Intron|MCF2L_ENST00000434480.2_Intron			O15068	MCF2L_HUMAN	MCF.2 cell line derived transforming sequence-like						apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|extracellular space (GO:0005615)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)	1-phosphatidylinositol binding (GO:0005545)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			kidney(1)|large_intestine(5)|ovary(1)|stomach(1)	8	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_cancers(25;0.118)|all_lung(25;0.0368)|all_epithelial(44;0.0396)|Lung NSC(25;0.129)|Breast(118;0.188)				GATGAGGCATCTCCTTGCACC	0.592																																																	0																																										SO:0001627	intron_variant	0			AB002360	CCDS9527.2, CCDS45070.1, CCDS9527.3, CCDS45070.2	13q34	2013-01-10			ENSG00000126217	ENSG00000126217		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	14576	protein-coding gene	gene with protein product		609499				9205841	Standard	NM_001112732		Approved	KIAA0362, DBS, OST, ARHGEF14	uc010tjr.2	O15068	OTTHUMG00000017377	ENST00000375608.3:c.459+1341C>G	13.37:g.113701016C>G			A2A2X1|A2A2X2|A2A3G6|A2A3G8|B4DHD6|B4DIL6|E9PDN8|Q5JU56|Q5VXT1|Q6ZWD4|Q765G8|Q765G9|Q8N679	RNA	SNP	-	NULL	ENST00000375608.3	37	NULL		13																																																																																			MCF2L	-	-	ENSG00000126217		0.592	MCF2L-001	KNOWN	basic	protein_coding	MCF2L	HGNC	protein_coding	OTTHUMT00000045849.4	-	0.00	21	0	C			113701016	+1	tier1	-	no_errors	ENST00000480321	ensembl	human	known	74_37	rna	15.00	17	3	SNP	0.000	G
MDH1	4190	genome.wustl.edu	37	2	63832427	63832427	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr2:63832427G>A	ENST00000233114.8	+	7	1124	c.689G>A	c.(688-690)cGt>cAt	p.R230H	MDH1_ENST00000394423.1_Missense_Mutation_p.R230H|MDH1_ENST00000544381.1_Missense_Mutation_p.R141H|MDH1_ENST00000409908.1_Missense_Mutation_p.R65H|MDH1_ENST00000409476.1_Missense_Mutation_p.R106H|MDH1_ENST00000539945.1_Missense_Mutation_p.R248H	NM_005917.3	NP_005908.1	P40925	MDHC_HUMAN	malate dehydrogenase 1, NAD (soluble)	230					carbohydrate metabolic process (GO:0005975)|cellular carbohydrate metabolic process (GO:0044262)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|malate metabolic process (GO:0006108)|NADH metabolic process (GO:0006734)|oxaloacetate metabolic process (GO:0006107)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	diiodophenylpyruvate reductase activity (GO:0047860)|L-malate dehydrogenase activity (GO:0030060)|malic enzyme activity (GO:0004470)|NAD binding (GO:0051287)			endometrium(2)|kidney(4)|large_intestine(1)|liver(2)|lung(4)	13						GTGCAGCAGCGTGGCGCTGCT	0.512																																																	0													48.0	45.0	46.0					2																	63832427		2203	4300	6503	SO:0001583	missense	0				CCDS1874.1, CCDS56121.1, CCDS56122.1	2p23	2012-10-02			ENSG00000014641	ENSG00000014641	1.1.1.37		6970	protein-coding gene	gene with protein product		154200					Standard	NM_005917		Approved		uc010ypv.2	P40925	OTTHUMG00000129512	ENST00000233114.8:c.689G>A	2.37:g.63832427G>A	ENSP00000233114:p.Arg230His		B2R5V5|B4DUN2|B7Z3I7|F5H098|Q6I9V0	Missense_Mutation	SNP	pfam_Lactate/malate_DH_C,pfam_Lactate/malate_DH_N,superfamily_Lactate_DH/Glyco_Ohase_4_C,pirsf_L-lactate/malate_DH,tigrfam_Malate_DH_NAD-dep_euk,tigrfam_Malate_DH_type2	p.R248H	ENST00000233114.8	37	c.743	CCDS1874.1	2	.	.	.	.	.	.	.	.	.	.	G	32	5.177844	0.94846	.	.	ENSG00000014641	ENST00000233114;ENST00000409908;ENST00000409476;ENST00000539945;ENST00000544381;ENST00000394423	T;T;T;T;T;T	0.07444	3.19;3.19;3.19;3.19;3.19;3.19	5.47	5.47	0.80525	Lactate/malate dehydrogenase, C-terminal (1);Lactate dehydrogenase/glycoside hydrolase, family 4, C-terminal (2);	0.000000	0.85682	D	0.000000	T	0.41465	0.1160	M	0.92970	3.365	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.52533	-0.8563	10	0.87932	D	0	-40.8532	19.6948	0.96021	0.0:0.0:1.0:0.0	.	248;230	F5H098;P40925	.;MDHC_HUMAN	H	230;65;106;248;141;230	ENSP00000233114:R230H;ENSP00000386743:R65H;ENSP00000386719:R106H;ENSP00000438144:R248H;ENSP00000446395:R141H;ENSP00000377945:R230H	ENSP00000233114:R230H	R	+	2	0	MDH1	63685931	1.000000	0.71417	1.000000	0.80357	0.751000	0.42716	9.420000	0.97426	2.723000	0.93209	0.655000	0.94253	CGT	MDH1	-	pfam_Lactate/malate_DH_C,superfamily_Lactate_DH/Glyco_Ohase_4_C,pirsf_L-lactate/malate_DH,tigrfam_Malate_DH_NAD-dep_euk,tigrfam_Malate_DH_type2	ENSG00000014641		0.512	MDH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MDH1	HGNC	protein_coding	OTTHUMT00000251687.1		0.00	12	0	G			63832427	+1			no_errors	ENST00000539945	ensembl	human	known	74_37	missense	28.57	5	2	SNP	1.000	A
MED12L	116931	genome.wustl.edu	37	3	150873950	150873950	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr3:150873950T>C	ENST00000474524.1	+	5	597	c.559T>C	c.(559-561)Tgg>Cgg	p.W187R	MED12L_ENST00000273432.4_Missense_Mutation_p.W187R|MED12L_ENST00000309237.4_Missense_Mutation_p.W187R|MED12L_ENST00000422248.2_Missense_Mutation_p.W187R	NM_053002.4	NP_443728.3	Q86YW9	MD12L_HUMAN	mediator complex subunit 12-like	187						mediator complex (GO:0016592)	RNA polymerase II transcription cofactor activity (GO:0001104)			NS(1)|breast(3)|central_nervous_system(3)|cervix(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(27)|lung(50)|ovary(6)|prostate(3)|skin(4)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	128			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			AAATGCAGAGTGGACACAGAT	0.438																																																	0													65.0	65.0	65.0					3																	150873950		2203	4300	6503	SO:0001583	missense	0			AB046855, AF388364	CCDS33876.1	3q25.1	2007-07-30	2007-07-30		ENSG00000144893	ENSG00000144893			16050	protein-coding gene	gene with protein product		611318	"""mediator of RNA polymerase II transcription, subunit 12 homolog (S. cerevisiae)-like"""			11524702	Standard	XM_006713487		Approved	KIAA1635, TNRC11L, TRALPUSH, TRALP	uc003eyp.3	Q86YW9	OTTHUMG00000159844	ENST00000474524.1:c.559T>C	3.37:g.150873950T>C	ENSP00000417235:p.Trp187Arg		Q96PC7|Q96PC8|Q9H9M5|Q9HCD7|Q9UI69	Missense_Mutation	SNP	pfam_Mediator_Med12_LCEWAV,pfam_Mediator_Med12,pfam_Mediator_Med12_catenin-bd	p.W187R	ENST00000474524.1	37	c.559	CCDS33876.1	3	.	.	.	.	.	.	.	.	.	.	T	20.1	3.935687	0.73442	.	.	ENSG00000144893	ENST00000422248;ENST00000309237;ENST00000474524;ENST00000273432	T;T;T;T	0.66099	0.13;0.1;-0.14;-0.19	4.54	4.54	0.55810	.	0.000000	0.64402	D	0.000001	T	0.77246	0.4102	M	0.72894	2.215	0.39018	D	0.959684	D;D;D;D	0.76494	0.999;0.99;0.999;0.998	D;D;D;D	0.85130	0.996;0.969;0.997;0.994	T	0.81831	-0.0752	10	0.87932	D	0	-7.6072	13.8419	0.63444	0.0:0.0:0.0:1.0	.	187;187;187;187	F8WAE6;Q86YW9;Q86YW9-2;Q86YW9-3	.;MD12L_HUMAN;.;.	R	187	ENSP00000403308:W187R;ENSP00000310760:W187R;ENSP00000417235:W187R;ENSP00000273432:W187R	ENSP00000273432:W187R	W	+	1	0	MED12L	152356640	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	7.575000	0.82447	1.811000	0.52892	0.455000	0.32223	TGG	MED12L	-	NULL	ENSG00000144893		0.438	MED12L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MED12L	HGNC	protein_coding	OTTHUMT00000357707.2		0.00	33	0	T	NM_053002		150873950	+1			no_errors	ENST00000474524	ensembl	human	known	74_37	missense	23.08	10	3	SNP	1.000	C
MED15	51586	genome.wustl.edu	37	22	20909317	20909317	+	Silent	SNP	C	C	T	rs145581029	byFrequency	TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr22:20909317C>T	ENST00000263205.7	+	5	402	c.333C>T	c.(331-333)ggC>ggT	p.G111G	MED15_ENST00000382974.2_Intron|MED15_ENST00000406969.1_Silent_p.G85G|MED15_ENST00000292733.7_Silent_p.G111G|MED15_ENST00000541476.1_Silent_p.G85G|MED15_ENST00000542773.1_Intron|MED15_ENST00000425759.2_Intron	NM_001003891.1	NP_001003891.1	Q96RN5	MED15_HUMAN	mediator complex subunit 15	111					gene expression (GO:0010467)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	RNA polymerase II transcription cofactor activity (GO:0001104)			central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(2)|lung(8)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	25	all_cancers(11;2.07e-24)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0221)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.00102)|Lung(15;0.0173)|Epithelial(17;0.209)			AGTCTCTGGGCGGGATGGGTA	0.652													C|||	2	0.000399361	0.0015	0.0	5008	,	,		16518	0.0		0.0	False		,,,				2504	0.0																0								C	,	9,4397	14.3+/-33.2	0,9,2194	39.0	40.0	40.0		333,333	-3.7	0.8	22	dbSNP_134	40	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	MED15	NM_001003891.1,NM_015889.3	,	0,10,6493	TT,TC,CC		0.0116,0.2043,0.0769	,	111/789,111/749	20909317	10,12996	2203	4300	6503	SO:0001819	synonymous_variant	0			AF056191	CCDS13781.1, CCDS33602.1, CCDS74824.1	22q11.2	2007-07-30	2007-07-30	2007-07-30	ENSG00000099917	ENSG00000099917			14248	protein-coding gene	gene with protein product		607372	"""trinucleotide repeat containing 7"", ""PC2 (positive cofactor 2, multiprotein complex) glutamine/Q-rich-associated protein"""	TNRC7, PCQAP		11024300, 11414760, 15175163	Standard	XM_005261632		Approved	TIG-1, CAG7A, Arc105	uc002zsp.3	Q96RN5	OTTHUMG00000150810	ENST00000263205.7:c.333C>T	22.37:g.20909317C>T			D3DX31|D3DX32|O15413|Q6IC31|Q8NF16|Q96CT0|Q96IH7|Q9P1T3	Silent	SNP	pfam_Mediator_Med15_met	p.G111	ENST00000263205.7	37	c.333	CCDS33602.1	22																																																																																			MED15	-	pfam_Mediator_Med15_met	ENSG00000099917		0.652	MED15-004	KNOWN	basic|CCDS	protein_coding	MED15	HGNC	protein_coding	OTTHUMT00000320177.2	-	0.00	82	0	C	NM_015889		20909317	+1	tier1	rs145581029	no_errors	ENST00000263205	ensembl	human	known	74_37	silent	48.15	27	26	SNP	0.860	T
MEOX1	4222	genome.wustl.edu	37	17	41738715	41738715	+	Nonsense_Mutation	SNP	G	G	C			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr17:41738715G>C	ENST00000318579.4	-	1	607	c.188C>G	c.(187-189)tCa>tGa	p.S63*	MEOX1_ENST00000329168.3_Nonsense_Mutation_p.S63*|MEOX1_ENST00000549132.1_Missense_Mutation_p.Q34E|MEOX1_ENST00000393661.2_5'UTR	NM_001040002.1|NM_004527.3	NP_001035091.1|NP_004518.1	P50221	MEOX1_HUMAN	mesenchyme homeobox 1	63					multicellular organismal development (GO:0007275)|somite specification (GO:0001757)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(4)	8		Breast(137;0.00908)		BRCA - Breast invasive adenocarcinoma(366;0.0753)		GCAGGAGGCTGAGAAGTCAGG	0.642																																																	0													51.0	55.0	53.0					17																	41738715		2203	4300	6503	SO:0001587	stop_gained	0				CCDS11466.1, CCDS11467.1, CCDS42343.1	17q21.31	2014-07-15	2005-12-22					"""Homeoboxes / ANTP class : HOXL subclass"""	7013	protein-coding gene	gene with protein product		600147	"""mesenchyme homeo box 1"""			7987315	Standard	NM_013999		Approved	MOX1	uc002idz.3	P50221	OTTHUMG00000170513	ENST00000318579.4:c.188C>G	17.37:g.41738715G>C	ENSP00000321684:p.Ser63*		A8K524|A8MWF9|Q15069	Nonsense_Mutation	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom,prints_Homeobox_metazoa	p.S63*	ENST00000318579.4	37	c.188	CCDS11466.1	17	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	40|40	8.350870|8.350870	0.98772|0.98772	.|.	.|.	ENSG00000005102|ENSG00000005102	ENST00000549132|ENST00000318579;ENST00000329168	.|.	.|.	.|.	4.68|4.68	4.68|4.68	0.58851|0.58851	.|.	.|0.063755	.|0.64402	.|D	.|0.000004	T|.	0.74291|.	0.3697|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.80233|.	-0.1467|.	4|.	0.87932|0.59425	D|D	0|0.04	-31.3287|-31.3287	15.9611|15.9611	0.79930|0.79930	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	E|X	34|63	.|.	ENSP00000449049:Q34E|ENSP00000321684:S63X	Q|S	-|-	1|2	0|0	MEOX1|MEOX1	39094241|39094241	1.000000|1.000000	0.71417|0.71417	0.972000|0.972000	0.41901|0.41901	0.948000|0.948000	0.59901|0.59901	8.541000|8.541000	0.90644|0.90644	2.430000|2.430000	0.82344|0.82344	0.563000|0.563000	0.77884|0.77884	CAG|TCA	MEOX1	-	NULL	ENSG00000005102		0.642	MEOX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MEOX1	HGNC	protein_coding	OTTHUMT00000409452.1	-	0.00	77	0	G			41738715	-1	tier1	-	no_errors	ENST00000318579	ensembl	human	known	74_37	nonsense	11.29	55	7	SNP	1.000	C
MET	4233	genome.wustl.edu	37	7	116435832	116435832	+	Missense_Mutation	SNP	T	T	A			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr7:116435832T>A	ENST00000318493.6	+	20	4163	c.3976T>A	c.(3976-3978)Tgc>Agc	p.C1326S	MET_ENST00000539704.1_Missense_Mutation_p.C178S|MET_ENST00000397752.3_Missense_Mutation_p.C1308S			Q9NWH9	SLTM_HUMAN	MET proto-oncogene, receptor tyrosine kinase	0					apoptotic process (GO:0006915)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(10)|breast(4)|central_nervous_system(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(5)|kidney(25)|large_intestine(8)|liver(3)|lung(70)|ovary(10)|pleura(2)|prostate(4)|skin(5)|stomach(6)|testis(1)|thyroid(4)|upper_aerodigestive_tract(64)|urinary_tract(3)	233	all_cancers(3;1.25e-07)|all_epithelial(6;4.07e-08)|Lung NSC(10;0.00108)|all_lung(10;0.00125)	Ovarian(593;0.133)	GBM - Glioblastoma multiforme(2;2.31e-07)|all cancers(2;0.000419)|STAD - Stomach adenocarcinoma(10;0.000512)			ACCCGAATACTGCCCAGACCC	0.438			Mis		"""papillary renal, head-neck squamous cell """	papillary renal			Hereditary Papillary Renal Carcinoma (type 1)		OREG0003446	type=REGULATORY REGION|Gene=MET|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																												Dom	yes	Familial Papillary Renal Cancer	7	7q31	4233	met proto-oncogene (hepatocyte growth factor receptor)		E	0													147.0	143.0	145.0					7																	116435832		1875	4100	5975	SO:0001583	missense	0	Familial Cancer Database	HPRC, Hereditary Papillary Renal Cell Cancer	M35073	CCDS43636.1, CCDS47689.1	7q31	2014-09-17	2014-06-26		ENSG00000105976	ENSG00000105976	2.7.10.1		7029	protein-coding gene	gene with protein product	"""hepatocyte growth factor receptor"""	164860	"""met proto-oncogene"""			1846706, 1611909	Standard	NM_001127500		Approved	HGFR, RCCP2	uc010lkh.3	P08581	OTTHUMG00000023299	ENST00000318493.6:c.3976T>A	7.37:g.116435832T>A	ENSP00000317272:p.Cys1326Ser	1473	A8K5V8|B2RTX3|Q2VPK7|Q52MB3|Q658J7|Q6ZNF2|Q86TK6|Q9H7C3|Q9H8U9	Missense_Mutation	SNP	pirsf_Tyr_kinase_HGF/MSP_rcpt,pfam_Semap_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_IPT,pfam_Plexin_repeat,superfamily_Semap_dom,superfamily_Kinase-like_dom,superfamily_Ig_E-set,superfamily_Plexin-like_fold,smart_Semap_dom,smart_Plexin-like_fold,smart_IPT,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Semap_dom,pfscan_Prot_kinase_dom	p.C1326S	ENST00000318493.6	37	c.3976	CCDS47689.1	7	.	.	.	.	.	.	.	.	.	.	T	27.1	4.802613	0.90623	.	.	ENSG00000105976	ENST00000397752;ENST00000318493;ENST00000539704	D;D;D	0.83992	-1.79;-1.79;-1.79	5.72	5.72	0.89469	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.91948	0.7450	M	0.85945	2.785	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.93104	0.6511	10	0.87932	D	0	.	16.2988	0.82793	0.0:0.0:0.0:1.0	.	1326;1308	P08581-2;P08581	.;MET_HUMAN	S	1308;1326;178	ENSP00000380860:C1308S;ENSP00000317272:C1326S;ENSP00000445020:C178S	ENSP00000317272:C1326S	C	+	1	0	MET	116223068	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	7.997000	0.88414	2.311000	0.77944	0.533000	0.62120	TGC	MET	-	pirsf_Tyr_kinase_HGF/MSP_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000105976		0.438	MET-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MET	HGNC	protein_coding	OTTHUMT00000059620.3	-	0.00	52	0	T			116435832	+1	tier1	-	no_errors	ENST00000318493	ensembl	human	known	74_37	missense	22.50	31	9	SNP	1.000	A
METTL21EP	121952	genome.wustl.edu	37	13	103544807	103544807	+	lincRNA	SNP	C	C	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr13:103544807C>T	ENST00000607072.1	+	0	1954				METTL21EP_ENST00000605100.1_RNA																							TGAGTACTCTCATGTACTCAT	0.363																																																	0																																												0																															13.37:g.103544807C>T				RNA	SNP	-	NULL	ENST00000607072.1	37	NULL		13																																																																																			METTL21EP	-	-	ENSG00000250878		0.363	RP11-255P5.2-001	KNOWN	basic	lincRNA	METTL21EP	HGNC	lincRNA	OTTHUMT00000471205.1		0.00	16	0	C			103544807	+1			no_errors	ENST00000605100	ensembl	human	known	74_37	rna	27.27	8	3	SNP	0.000	T
MFSD11	79157	genome.wustl.edu	37	17	74750243	74750243	+	Intron	SNP	G	G	A			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr17:74750243G>A	ENST00000588460.1	+	8	2724				MFSD11_ENST00000336509.4_Intron|RNU6-97P_ENST00000363387.1_RNA|MFSD11_ENST00000590514.1_Intron|MFSD11_ENST00000355954.3_Intron|MFSD11_ENST00000586622.1_Intron|MFSD11_ENST00000593181.1_Intron	NM_001242534.1	NP_001229463.1	O43934	MFS11_HUMAN	major facilitator superfamily domain containing 11							integral component of membrane (GO:0016021)				endometrium(1)|kidney(2)|large_intestine(3)|lung(7)|ovary(2)|prostate(1)|skin(1)	17						CCTATTCCCTGGTAACTTTGG	0.408																																																	0													51.0	45.0	47.0					17																	74750243		692	1591	2283	SO:0001627	intron_variant	0			BC002753	CCDS11750.1, CCDS56045.1	17q25.1	2012-03-09			ENSG00000092931	ENSG00000092931			25458	protein-coding gene	gene with protein product						9358160	Standard	NM_001242532		Approved	FLJ22196, FLJ20226	uc002jte.3	O43934		ENST00000588460.1:c.682+74G>A	17.37:g.74750243G>A			O43442|Q9NXI5	RNA	SNP	-	NULL	ENST00000588460.1	37	NULL	CCDS11750.1	17																																																																																			MFSD11	-	-	ENSG00000092931		0.408	MFSD11-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	MFSD11	HGNC	protein_coding	OTTHUMT00000451516.1	-	0.00	78	0	G	NM_024311		74750243	+1	tier1	-	no_errors	ENST00000585958	ensembl	human	known	74_37	rna	6.67	56	4	SNP	0.123	A
MGA	23269	genome.wustl.edu	37	15	42003273	42003273	+	Missense_Mutation	SNP	A	A	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr15:42003273A>T	ENST00000570161.1	+	7	2810	c.2810A>T	c.(2809-2811)aAg>aTg	p.K937M	MGA_ENST00000389936.4_Missense_Mutation_p.K937M|MGA_ENST00000545763.1_Missense_Mutation_p.K937M|MGA_ENST00000219905.7_Missense_Mutation_p.K937M|MGA_ENST00000566586.1_Missense_Mutation_p.K937M			O43451	MGA_HUMAN	MGA, MAX dimerization protein	0					carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)			NS(1)|breast(4)|central_nervous_system(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(33)|ovary(8)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95		all_cancers(109;0.00356)|all_epithelial(112;0.0413)|all_lung(180;0.18)|Ovarian(310;0.238)		OV - Ovarian serous cystadenocarcinoma(18;1.41e-18)|GBM - Glioblastoma multiforme(113;2.15e-06)|COAD - Colon adenocarcinoma(120;0.031)|Lung(196;0.0721)|BRCA - Breast invasive adenocarcinoma(123;0.0964)|Colorectal(105;0.0998)|LUSC - Lung squamous cell carcinoma(244;0.235)	Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	CTAGGAGATAAGGTTACCAAG	0.368																																																	0													141.0	140.0	140.0					15																	42003273		1895	4128	6023	SO:0001583	missense	0			AB011090	CCDS55959.1, CCDS55960.1	15q15	2012-11-15	2012-11-15		ENSG00000174197	ENSG00000174197		"""MAX dimerization proteins"", ""T-boxes"""	14010	protein-coding gene	gene with protein product			"""MAX gene associated"""				Standard	NM_001080541		Approved	KIAA0518, MAD5, MXD5, FLJ12634	uc010ucy.2	Q8IWI9		ENST00000570161.1:c.2810A>T	15.37:g.42003273A>T	ENSP00000457035:p.Lys937Met		Q0VAX6|Q75ME7|Q86UM5	Missense_Mutation	SNP	pfam_TF_T-box,pfam_bHLH_dom,superfamily_p53-like_TF_DNA-bd,superfamily_bHLH_dom,smart_TF_T-box,smart_bHLH_dom,pfscan_bHLH_dom,pfscan_TF_T-box,prints_TF_T-box	p.K937M	ENST00000570161.1	37	c.2810	CCDS55959.1	15	.	.	.	.	.	.	.	.	.	.	A	18.24	3.580018	0.65992	.	.	ENSG00000174197	ENST00000219905;ENST00000389936;ENST00000545763	T;T;T	0.18657	2.2;2.2;2.2	5.84	4.7	0.59300	.	0.446931	0.23602	N	0.046429	T	0.22742	0.0549	L	0.27053	0.805	0.34948	D	0.751007	D;D	0.63046	0.963;0.992	P;P	0.53102	0.718;0.671	T	0.30822	-0.9965	10	0.87932	D	0	.	8.4658	0.32956	0.8458:0.0:0.1542:0.0	.	937;937	F5H7K2;E7ENI0	.;.	M	937	ENSP00000219905:K937M;ENSP00000374586:K937M;ENSP00000442467:K937M	ENSP00000219905:K937M	K	+	2	0	MGA	39790565	0.816000	0.29132	0.951000	0.38953	0.965000	0.64279	1.407000	0.34657	1.031000	0.39867	0.533000	0.62120	AAG	MGA	-	NULL	ENSG00000174197		0.368	MGA-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MGA	HGNC	protein_coding	OTTHUMT00000420229.1	-	0.00	52	0	A	NM_001164273.1		42003273	+1	tier1	-	no_errors	ENST00000219905	ensembl	human	known	74_37	missense	25.71	26	9	SNP	0.966	T
MICAL2	9645	genome.wustl.edu	37	11	12278449	12278449	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr11:12278449G>A	ENST00000256194.4	+	24	3361	c.3073G>A	c.(3073-3075)Gag>Aag	p.E1025K	MICAL2_ENST00000342902.5_Missense_Mutation_p.E1004K|MICAL2_ENST00000527546.1_Missense_Mutation_p.E835K|MICAL2_ENST00000379612.3_Missense_Mutation_p.E799K|MICAL2_ENST00000537344.1_Missense_Mutation_p.E835K	NM_001282663.1|NM_014632.2	NP_001269592.1|NP_055447.1	O94851	MICA2_HUMAN	microtubule associated monooxygenase, calponin and LIM domain containing 2	1025	LIM zinc-binding. {ECO:0000255|PROSITE- ProRule:PRU00125}.				actin filament depolymerization (GO:0030042)|cytoskeleton organization (GO:0007010)|heart development (GO:0007507)|heart looping (GO:0001947)|oxidation-reduction process (GO:0055114)|positive regulation of transcription via serum response element binding (GO:0010735)|sulfur oxidation (GO:0019417)	nucleus (GO:0005634)	actin binding (GO:0003779)|FAD binding (GO:0071949)|NADPH:sulfur oxidoreductase activity (GO:0043914)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen (GO:0016709)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(6)|lung(12)|ovary(2)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	47				Epithelial(150;0.00552)		CTTCCACCGGGAGTGTTTCCG	0.597																																																	0													117.0	94.0	102.0					11																	12278449		2201	4294	6495	SO:0001583	missense	0			AB018293	CCDS7809.1, CCDS60726.1, CCDS60727.1, CCDS60728.1	11p15.3	2014-08-12	2013-03-26		ENSG00000133816	ENSG00000133816			24693	protein-coding gene	gene with protein product		608881				12110185	Standard	XM_005253249		Approved	KIAA0750	uc001mjz.3	O94851	OTTHUMG00000165744	ENST00000256194.4:c.3073G>A	11.37:g.12278449G>A	ENSP00000256194:p.Glu1025Lys		B4DGZ0|B7Z849|D3DQW5|G3XAC8|Q5KTR3|Q5KTR4|Q7Z3A8	Missense_Mutation	SNP	pfam_CH-domain,pfam_CAMSAP_CH,pfam_Znf_LIM,pfam_mOase_FAD-bd,pfam_FAD_bind_dom,superfamily_CH-domain,smart_CH-domain,smart_Znf_LIM,pfscan_CH-domain,pfscan_Znf_LIM,prints_Rng_hydrolase-like	p.E1025K	ENST00000256194.4	37	c.3073	CCDS7809.1	11	.	.	.	.	.	.	.	.	.	.	G	22.1	4.247638	0.80024	.	.	ENSG00000133816	ENST00000537344;ENST00000544073;ENST00000256194;ENST00000527546;ENST00000342902;ENST00000379612	D;D;D;D;D	0.88354	-2.37;-2.37;-2.37;-2.37;-2.37	5.17	5.17	0.71159	Zinc finger, LIM-type (5);	0.000000	0.85682	D	0.000000	D	0.92176	0.7519	L	0.43923	1.385	0.33554	D	0.59649	P;D;D;P;D;D	0.71674	0.793;0.998;0.961;0.772;0.98;0.991	P;D;P;P;P;D	0.80764	0.56;0.994;0.764;0.542;0.858;0.926	D	0.93575	0.6907	10	0.40728	T	0.16	.	18.2925	0.90135	0.0:0.0:1.0:0.0	.	368;1004;835;778;799;1025	B4DYS3;G3XAC8;B7Z849;Q5KTR3;Q5KTR4;O94851	.;.;.;.;.;MICA2_HUMAN	K	835;368;1025;835;1004;799	ENSP00000441689:E835K;ENSP00000256194:E1025K;ENSP00000433965:E835K;ENSP00000344894:E1004K;ENSP00000368932:E799K	ENSP00000256194:E1025K	E	+	1	0	MICAL2	12235025	1.000000	0.71417	0.979000	0.43373	0.996000	0.88848	7.873000	0.87193	2.407000	0.81776	0.655000	0.94253	GAG	MICAL2	-	pfam_Znf_LIM,smart_Znf_LIM,pfscan_Znf_LIM	ENSG00000133816		0.597	MICAL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MICAL2	HGNC	protein_coding	OTTHUMT00000385993.1		0.00	31	0	G	NM_014632		12278449	+1			no_errors	ENST00000256194	ensembl	human	known	74_37	missense	18.18	9	2	SNP	0.999	A
MICALCL	84953	genome.wustl.edu	37	11	12315652	12315652	+	Missense_Mutation	SNP	A	A	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr11:12315652A>T	ENST00000256186.2	+	3	965	c.674A>T	c.(673-675)aAa>aTa	p.K225I		NM_032867.2	NP_116256.2	Q6ZW33	MICLK_HUMAN	MICAL C-terminal like	225					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)	mitogen-activated protein kinase binding (GO:0051019)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(5)|lung(5)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)	30				Epithelial(150;0.00177)		CGTGTGCTAAAACCAGTCCGC	0.587																																																	0													44.0	48.0	47.0					11																	12315652		1921	4111	6032	SO:0001583	missense	0			BK000463	CCDS41620.1	11p15.3	2005-11-01			ENSG00000133808	ENSG00000133808			25933	protein-coding gene	gene with protein product		612355				12110185	Standard	NM_032867		Approved	FLJ14966	uc001mkg.1	Q6ZW33	OTTHUMG00000165777	ENST00000256186.2:c.674A>T	11.37:g.12315652A>T	ENSP00000256186:p.Lys225Ile		Q7RTP7|Q96JU6	Missense_Mutation	SNP	pfam_DUF3585,smart_ProQ/FinO	p.K225I	ENST00000256186.2	37	c.674	CCDS41620.1	11	.	.	.	.	.	.	.	.	.	.	A	16.53	3.150125	0.57151	.	.	ENSG00000133808	ENST00000256186	T	0.29397	1.57	5.14	1.29	0.21616	.	0.138367	0.32719	N	0.005729	T	0.43411	0.1246	M	0.64997	1.995	0.09310	N	1	D	0.76494	0.999	D	0.67231	0.95	T	0.16660	-1.0395	10	0.48119	T	0.1	.	6.2242	0.20698	0.6129:0.0:0.3871:0.0	.	225	Q6ZW33	MICLK_HUMAN	I	225	ENSP00000256186:K225I	ENSP00000256186:K225I	K	+	2	0	MICALCL	12272228	0.436000	0.25586	0.099000	0.21106	0.076000	0.17211	1.637000	0.37155	0.210000	0.20664	0.455000	0.32223	AAA	MICALCL	-	NULL	ENSG00000133808		0.587	MICALCL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MICALCL	HGNC	protein_coding	OTTHUMT00000386164.1	-	0.00	32	0	A	NM_032867		12315652	+1	tier1	-	no_errors	ENST00000256186	ensembl	human	known	74_37	missense	36.84	12	7	SNP	0.014	T
MLLT3	4300	genome.wustl.edu	37	9	20414280	20414280	+	Silent	SNP	G	G	A			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr9:20414280G>A	ENST00000380338.4	-	5	850	c.564C>T	c.(562-564)agC>agT	p.S188S	MLLT3_ENST00000475957.1_5'UTR|MLLT3_ENST00000429426.2_Silent_p.S185S|MLLT3_ENST00000355930.6_5'UTR	NM_004529.2	NP_004520.2	P42568	AF9_HUMAN	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3	188	Poly-Ser.				anterior/posterior pattern specification (GO:0009952)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000096)|regulation of transcription, DNA-templated (GO:0006355)|segment specification (GO:0007379)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)		p.S188S(1)		central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(6)|lung(24)|ovary(1)|prostate(4)|skin(1)|urinary_tract(7)	66				GBM - Glioblastoma multiforme(3;4.35e-105)|Lung(42;3.48e-06)|LUSC - Lung squamous cell carcinoma(42;7.92e-05)		TGGTActactgctgctgctgc	0.502			T	MLL	ALL																																			Dom	yes		9	9p22	4300	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3 (AF9)"""		L	1	Substitution - coding silent(1)	large_intestine(1)											77.0	84.0	82.0					9																	20414280		2203	4300	6503	SO:0001819	synonymous_variant	0			L13744	CCDS6494.1	9p22	2008-02-05	2001-11-28		ENSG00000171843	ENSG00000171843			7136	protein-coding gene	gene with protein product		159558	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 3"""			8506309, 8414510	Standard	NM_001286691		Approved	AF-9, AF9, YEATS3	uc003zoe.2	P42568	OTTHUMG00000019650	ENST00000380338.4:c.564C>T	9.37:g.20414280G>A			B1AMQ2|B2R7B3|B7Z755|D3DRJ8|Q8IVB0	Silent	SNP	pfam_YEATS,pfscan_YEATS	p.S188	ENST00000380338.4	37	c.564	CCDS6494.1	9																																																																																			MLLT3	-	NULL	ENSG00000171843		0.502	MLLT3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MLLT3	HGNC	protein_coding	OTTHUMT00000051872.1		0.00	36	0	G	NM_004529		20414280	-1			no_errors	ENST00000380338	ensembl	human	known	74_37	silent	14.29	12	2	SNP	1.000	A
MLXIP	22877	genome.wustl.edu	37	12	122623385	122623385	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr12:122623385C>T	ENST00000319080.7	+	15	2540	c.2408C>T	c.(2407-2409)gCc>gTc	p.A803V	MLXIP_ENST00000538698.1_Missense_Mutation_p.A410V					MLX interacting protein											NS(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(7)|ovary(3)	20	all_neural(191;0.0837)|Medulloblastoma(191;0.163)	Lung NSC(355;0.0659)		OV - Ovarian serous cystadenocarcinoma(86;0.000599)|Epithelial(86;0.00102)|BRCA - Breast invasive adenocarcinoma(302;0.233)		CTGCTCCCTGCCACGGGAGTC	0.557																																					Esophageal Squamous(105;787 1493 16200 18566 52466)												0													27.0	30.0	29.0					12																	122623385		1940	4147	6087	SO:0001583	missense	0			AB020674	CCDS73540.1	12q21.31	2013-05-21				ENSG00000175727		"""Basic helix-loop-helix proteins"""	17055	protein-coding gene	gene with protein product		608090				10048485, 11073985	Standard	XM_006719290		Approved	MONDOA, KIAA0867, MIR, bHLHe36	uc001ubq.3	Q9HAP2		ENST00000319080.7:c.2408C>T	12.37:g.122623385C>T	ENSP00000312834:p.Ala803Val			Missense_Mutation	SNP	pfam_bHLH_dom,superfamily_bHLH_dom,smart_bHLH_dom,pfscan_bHLH_dom	p.A803V	ENST00000319080.7	37	c.2408		12	.	.	.	.	.	.	.	.	.	.	C	29.6	5.019268	0.93462	.	.	ENSG00000175727	ENST00000319080;ENST00000538698;ENST00000366272	T;T;T	0.57107	2.18;1.48;0.42	5.45	5.45	0.79879	.	0.052613	0.85682	D	0.000000	T	0.45677	0.1354	.	.	.	0.80722	D	1	B	0.29188	0.236	B	0.26416	0.069	T	0.46005	-0.9222	9	0.59425	D	0.04	-31.9927	13.5605	0.61786	0.0:0.9257:0.0:0.0742	.	803	Q9HAP2	MLXIP_HUMAN	V	803;410;274	ENSP00000312834:A803V;ENSP00000440769:A410V;ENSP00000445891:A274V	ENSP00000312834:A803V	A	+	2	0	MLXIP	121189338	0.997000	0.39634	1.000000	0.80357	0.996000	0.88848	3.124000	0.50461	2.549000	0.85964	0.655000	0.94253	GCC	MLXIP	-	NULL	ENSG00000175727		0.557	MLXIP-001	KNOWN	basic|appris_principal	protein_coding	MLXIP	HGNC	protein_coding	OTTHUMT00000401718.2	-	0.00	30	0	C	NM_014938		122623385	+1	tier1	-	no_errors	ENST00000319080	ensembl	human	known	74_37	missense	14.29	18	3	SNP	1.000	T
MPPE1	65258	genome.wustl.edu	37	18	11885058	11885058	+	Intron	SNP	T	T	C			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr18:11885058T>C	ENST00000588072.1	-	11	2230				MPPE1_ENST00000317235.7_Intron|MPPE1_ENST00000309976.9_Intron|MPPE1_ENST00000592755.1_5'UTR|GNAL_ENST00000334049.6_3'UTR|MPPE1_ENST00000344987.7_Intron|MPPE1_ENST00000399978.2_Intron	NM_023075.5	NP_075563.3	Q53F39	MPPE1_HUMAN	metallophosphoesterase 1						ER to Golgi vesicle-mediated transport (GO:0006888)|GPI anchor biosynthetic process (GO:0006506)	cis-Golgi network (GO:0005801)|endoplasmic reticulum exit site (GO:0070971)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	GPI anchor binding (GO:0034235)|manganese ion binding (GO:0030145)|phosphoric diester hydrolase activity (GO:0008081)			endometrium(1)|large_intestine(1)|lung(1)|ovary(1)|skin(1)	5						AATACATGTGTCCAGGTCGTC	0.443																																																	0																																										SO:0001627	intron_variant	0			BC002877	CCDS11853.1, CCDS56054.1	18p11.21	2004-04-30			ENSG00000154889	ENSG00000154889			15988	protein-coding gene	gene with protein product		611900				11978971	Standard	NM_001242904		Approved		uc002kqf.3	Q53F39	OTTHUMG00000131661	ENST00000588072.1:c.1009-432A>G	18.37:g.11885058T>C			B0YJ39|B0YJ40|B0YJ41|B5ME53|B7WNJ3|D3DUI5|D3DUI7|Q6GMP1|Q8TAD6|Q8TE26|Q8WZ32|Q9BU58|Q9H958|Q9HAI4	RNA	SNP	-	NULL	ENST00000588072.1	37	NULL	CCDS11853.1	18																																																																																			MPPE1	-	-	ENSG00000154889		0.443	MPPE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MPPE1	HGNC	protein_coding	OTTHUMT00000254562.2	-	0.00	55	0	T	NM_023075		11885058	-1	tier1	-	no_errors	ENST00000592755	ensembl	human	putative	74_37	rna	24.19	47	15	SNP	0.000	C
MROH8	140699	genome.wustl.edu	37	20	35788510	35788510	+	Missense_Mutation	SNP	C	C	T	rs373753414		TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr20:35788510C>T	ENST00000400441.3	-	6	717	c.718G>A	c.(718-720)Gct>Act	p.A240T	MROH8_ENST00000441008.2_Missense_Mutation_p.A226T|MROH8_ENST00000217333.8_Missense_Mutation_p.A155T			Q9H579	MROH8_HUMAN	maestro heat-like repeat family member 8	160																	CTGAGATCAGCGATGGTGACA	0.517																																																	0													36.0	40.0	39.0					20																	35788510		1987	4157	6144	SO:0001583	missense	0			AL136172		20q11.22	2012-12-19	2012-12-19	2012-12-19	ENSG00000101353	ENSG00000101353		"""maestro heat-like repeat containing"""	16125	protein-coding gene	gene with protein product	"""hypothetical protein LOC140699"""		"""chromosome 20 open reading frame 131"", ""chromosome 20 open reading frame 132"""	C20orf131, C20orf132		11780052, 15635413	Standard	NM_152503		Approved	dJ621N11.4, dJ621N11.3	uc010zvu.2	Q9H579	OTTHUMG00000032407	ENST00000400441.3:c.718G>A	20.37:g.35788510C>T	ENSP00000383291:p.Ala240Thr		Q5JYQ6	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.A240T	ENST00000400441.3	37	c.718		20	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	0.020|0.020	-1.439044|-1.439044	0.01098|0.01098	.|.	.|.	ENSG00000101353|ENSG00000101353	ENST00000441008;ENST00000400441;ENST00000217333;ENST00000434295;ENST00000422138|ENST00000421643	T;T;T|.	0.05447|.	3.44;3.44;3.44|.	5.51|5.51	-9.02|-9.02	0.00741|0.00741	.|.	0.738161|.	0.12946|.	N|.	0.426180|.	T|T	0.07683|0.07683	0.0193|0.0193	N|N	0.01874|0.01874	-0.695|-0.695	0.09310|0.09310	N|N	1|1	B;B;B|.	0.19073|.	0.019;0.018;0.033|.	B;B;B|.	0.12837|.	0.003;0.003;0.008|.	T|T	0.28299|0.28299	-1.0048|-1.0048	10|5	0.08837|.	T|.	0.75|.	-13.4513|-13.4513	5.2232|5.2232	0.15379|0.15379	0.1271:0.1301:0.1005:0.6422|0.1271:0.1301:0.1005:0.6422	.|.	240;160;250|.	E7ETR9;Q9H579;Q6PF12|.	.;CT132_HUMAN;.|.	T|H	226;240;155;10;10|276	ENSP00000392144:A226T;ENSP00000383291:A240T;ENSP00000217333:A155T|.	ENSP00000217333:A155T|.	A|R	-|-	1|2	0|0	C20orf132|C20orf132	35221924|35221924	0.000000|0.000000	0.05858|0.05858	0.001000|0.001000	0.08648|0.08648	0.050000|0.050000	0.14768|0.14768	-2.061000|-2.061000	0.01391|0.01391	-1.454000|-1.454000	0.01926|0.01926	-1.724000|-1.724000	0.00704|0.00704	GCT|CGC	MROH8	-	superfamily_ARM-type_fold	ENSG00000101353		0.517	MROH8-202	KNOWN	basic|appris_principal	protein_coding	MROH8	HGNC	protein_coding		-	0.00	52	0	C	NM_152503		35788510	-1	tier1	-	no_errors	ENST00000400441	ensembl	human	known	74_37	missense	12.90	27	4	SNP	0.001	T
MRPL15	29088	genome.wustl.edu	37	8	55049207	55049207	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr8:55049207G>A	ENST00000260102.4	+	2	319	c.245G>A	c.(244-246)gGg>gAg	p.G82E		NM_014175.3	NP_054894.1	Q9P015	RM15_HUMAN	mitochondrial ribosomal protein L15	82					translation (GO:0006412)	large ribosomal subunit (GO:0015934)|mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(1)|prostate(1)|skin(3)	10		Lung NSC(129;0.109)|all_epithelial(80;0.134)|all_lung(136;0.181)	OV - Ovarian serous cystadenocarcinoma(7;4.3e-07)|Epithelial(17;5.79e-05)|all cancers(17;0.000458)			CCAAAATACGGGTTTAACGAA	0.443																																																	0													74.0	80.0	78.0					8																	55049207		2203	4300	6503	SO:0001583	missense	0			AB051619	CCDS6158.1	8q11.2-q13	2012-09-13			ENSG00000137547	ENSG00000137547		"""Mitochondrial ribosomal proteins / large subunits"""	14054	protein-coding gene	gene with protein product		611828				11543634	Standard	NM_014175		Approved	RPML7, MRP-L7, HSPC145, L15mt, MRP-L15	uc003xsa.2	Q9P015	OTTHUMG00000164315	ENST00000260102.4:c.245G>A	8.37:g.55049207G>A	ENSP00000260102:p.Gly82Glu		Q96Q54|Q9H0Y1	Missense_Mutation	SNP	pfam_Ribosomal_L18e/L15P,superfamily_Ribosomal_L18e/L15P	p.G82E	ENST00000260102.4	37	c.245	CCDS6158.1	8	.	.	.	.	.	.	.	.	.	.	G	21.3	4.127753	0.77549	.	.	ENSG00000137547	ENST00000260102;ENST00000519831	.	.	.	5.43	5.43	0.79202	Ribosomal protein L18e/L15P (2);	0.000000	0.85682	D	0.000000	D	0.83543	0.5277	H	0.95884	3.735	0.80722	D	1	P	0.34815	0.47	B	0.39465	0.3	D	0.86531	0.1822	9	0.54805	T	0.06	-22.7696	19.2615	0.93970	0.0:0.0:1.0:0.0	.	82	Q9P015	RM15_HUMAN	E	82	.	ENSP00000260102:G82E	G	+	2	0	MRPL15	55211760	1.000000	0.71417	0.998000	0.56505	0.978000	0.69477	9.855000	0.99526	2.523000	0.85059	0.655000	0.94253	GGG	MRPL15	-	pfam_Ribosomal_L18e/L15P,superfamily_Ribosomal_L18e/L15P	ENSG00000137547		0.443	MRPL15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRPL15	HGNC	protein_coding	OTTHUMT00000378254.1	-	0.00	61	0	G	NM_014175		55049207	+1	tier1	-	no_errors	ENST00000260102	ensembl	human	known	74_37	missense	40.00	21	14	SNP	1.000	A
MS4A15	219995	genome.wustl.edu	37	11	60538930	60538930	+	Intron	SNP	G	G	C			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr11:60538930G>C	ENST00000405633.3	+	4	484				MS4A15_ENST00000337911.4_Intron|MS4A15_ENST00000528170.1_Intron	NM_001098835.1	NP_001092305.1	Q8N5U1	M4A15_HUMAN	membrane-spanning 4-domains, subfamily A, member 15							integral component of membrane (GO:0016021)				breast(1)|large_intestine(2)|lung(3)	6						CAGCACTTCAGGGGACCTGCA	0.582																																																	0																																										SO:0001627	intron_variant	0			AY584608	CCDS7991.1, CCDS44617.1, CCDS60802.1	11q12.2	2008-03-25							28573	protein-coding gene	gene with protein product							Standard	NM_001098835		Approved		uc009ynf.1	Q8N5U1		ENST00000405633.3:c.405+110G>C	11.37:g.60538930G>C			A9UJY6|A9UJY7|F2Z2J5	Missense_Mutation	SNP	NULL	p.G131R	ENST00000405633.3	37	c.391	CCDS44617.1	11																																																																																			MS4A15	-	NULL	ENSG00000166961		0.582	MS4A15-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MS4A15	HGNC	protein_coding	OTTHUMT00000395618.1	-	0.00	40	0	G			60538930	+1	tier1	-	no_errors	ENST00000429322	ensembl	human	known	74_37	missense	20.00	16	4	SNP	0.002	C
MSRB3	253827	genome.wustl.edu	37	12	65702437	65702437	+	Intron	SNP	T	T	C			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr12:65702437T>C	ENST00000355192.3	+	2	223				MSRB3_ENST00000535664.1_Splice_Site|MSRB3_ENST00000308259.5_Splice_Site|MSRB3_ENST00000538725.1_Splice_Site|MSRB3_ENST00000540804.1_Intron	NM_198080.3	NP_932346.1	Q8IXL7	MSRB3_HUMAN	methionine sulfoxide reductase B3						protein repair (GO:0030091)|response to oxidative stress (GO:0006979)	endoplasmic reticulum (GO:0005783)|mitochondrion (GO:0005739)	peptide-methionine (R)-S-oxide reductase activity (GO:0033743)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(4)|lung(3)|prostate(1)|skin(1)	13			LUAD - Lung adenocarcinoma(6;0.0234)|LUSC - Lung squamous cell carcinoma(43;0.0975)	GBM - Glioblastoma multiforme(28;0.131)		TTCCCTCAGGTTGCTGCTTGT	0.473																																																	0													123.0	106.0	112.0					12																	65702437		2203	4300	6503	SO:0001627	intron_variant	0			BX640871	CCDS8973.1, CCDS31853.1	12q14.3	2011-11-29			ENSG00000174099	ENSG00000174099			27375	protein-coding gene	gene with protein product		613719	"""deafness, autosomal recessive 74"""	DFNB74		21185009	Standard	NM_198080		Approved	FLJ36866, DKFZp686C1178	uc021qzy.1	Q8IXL7	OTTHUMG00000168866	ENST00000355192.3:c.98-18169T>C	12.37:g.65702437T>C			B4DR19|B7ZAQ0|Q6UXS2	Splice_Site	SNP	-	e1+2	ENST00000355192.3	37	c.76+2	CCDS8973.1	12	.	.	.	.	.	.	.	.	.	.	T	16.43	3.120487	0.56613	.	.	ENSG00000174099	ENST00000308259;ENST00000535664;ENST00000538045;ENST00000535239	.	.	.	6.01	6.01	0.97437	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.5285	0.84344	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	MSRB3	63988704	1.000000	0.71417	1.000000	0.80357	0.779000	0.44077	6.440000	0.73435	2.307000	0.77673	0.528000	0.53228	.	MSRB3	-	-	ENSG00000174099		0.473	MSRB3-001	KNOWN	basic|CCDS	protein_coding	MSRB3	HGNC	protein_coding	OTTHUMT00000401421.1		0.00	30	0	T	NM_198080		65702437	+1			no_errors	ENST00000308259	ensembl	human	known	74_37	splice_site	8.33	22	2	SNP	1.000	C
MT-CO1	4512	genome.wustl.edu	37	M	3156	3156	+	5'Flank	SNP	A	A	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chrM:3156A>T	ENST00000361624.2	+	0	0				MT-ND1_ENST00000361390.2_5'Flank|MT-TI_ENST00000387365.1_RNA|MT-RNR2_ENST00000387347.2_RNA|MT-TW_ENST00000387382.1_RNA|MT-TF_ENST00000387314.1_RNA|MT-TV_ENST00000387342.1_RNA|MT-ND2_ENST00000361453.3_5'Flank|MT-TN_ENST00000387400.1_RNA|MT-RNR1_ENST00000389680.2_RNA|MT-TY_ENST00000387409.1_RNA|MT-TQ_ENST00000387372.1_RNA|MT-TA_ENST00000387392.1_RNA|MT-TL1_ENST00000386347.1_RNA|MT-TM_ENST00000387377.1_RNA|MT-TC_ENST00000387405.1_RNA			P00395	COX1_HUMAN	mitochondrially encoded cytochrome c oxidase I						aerobic respiration (GO:0009060)|cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|oxidative phosphorylation (GO:0006119)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex IV (GO:0005751)|respiratory chain complex IV (GO:0045277)	cytochrome-c oxidase activity (GO:0004129)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(4)|endometrium(25)|kidney(19)|lung(3)|prostate(3)	54						AGGCCTACTTCACAAAGCGCC	0.463																																																	0																																										SO:0001631	upstream_gene_variant	0					mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198804	ENSG00000198804		"""Mitochondrial respiratory chain complex / Complex IV"""	7419	protein-coding gene	gene with protein product		516030	"""cytochrome c oxidase I"""	MTCO1		7219534	Standard			Approved	COX1, COI		P00395			M.37:g.3156A>T	Exception_encountered		Q34770	RNA	SNP	-	NULL	ENST00000361624.2	37	NULL		MT																																																																																			MT-RNR2	-	-	ENSG00000210082		0.463	MT-CO1-201	KNOWN	basic|appris_principal	protein_coding	MT-RNR2	HGNC	protein_coding		-	0.00	58	0	A	YP_003024028		3156	+1	tier1	-	no_errors	ENST00000387347	ensembl	human	known	74_37	rna	11.76	14	2	SNP	NULL	T
MT-ND5	4540	genome.wustl.edu	37	M	10046	10046	+	5'Flank	SNP	T	T	C			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chrM:10046T>C	ENST00000361567.2	+	0	0				MT-TG_ENST00000387429.1_RNA|MT-TS1_ENST00000387416.2_RNA|MT-ND4L_ENST00000361335.1_5'Flank|MT-TH_ENST00000387441.1_RNA|MT-TR_ENST00000387439.1_RNA|MT-ND4_ENST00000361381.2_5'Flank|MT-TS2_ENST00000387449.1_RNA|MT-TL2_ENST00000387456.1_RNA|MT-TD_ENST00000387419.1_RNA|MT-TK_ENST00000387421.1_RNA|MT-ND3_ENST00000361227.2_5'Flank			P03915	NU5M_HUMAN	mitochondrially encoded NADH dehydrogenase 5						cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(4)|endometrium(29)|kidney(33)|pancreas(1)|prostate(7)	74						TTTGACAACATTCAAAAAAGA	0.323																																																	0																																										SO:0001631	upstream_gene_variant	0					mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198786	ENSG00000198786	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7461	protein-coding gene	gene with protein product	"""complex I ND5 subunit"", ""NADH-ubiquinone oxidoreductase chain 5"""	516005	"""NADH dehydrogenase 5"""	MTND5			Standard			Approved	ND5, NAD5		P03915			M.37:g.10046T>C	Exception_encountered		Q34773|Q8WCY3	RNA	SNP	-	NULL	ENST00000361567.2	37	NULL		MT																																																																																			MT-TG	-	-	ENSG00000210164		0.323	MT-ND5-201	KNOWN	basic|appris_principal	protein_coding	MT-TG	HGNC	protein_coding		-	0.00	22	0	T	YP_003024036		10046	+1	tier1	-	no_errors	ENST00000387429	ensembl	human	known	74_37	rna	28.57	5	2	SNP	NULL	C
MTHFD2L	441024	genome.wustl.edu	37	4	75041020	75041020	+	Silent	SNP	A	A	G			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr4:75041020A>G	ENST00000395759.2	+	3	378	c.351A>G	c.(349-351)ctA>ctG	p.L117L	MTHFD2L_ENST00000325278.6_Silent_p.L59L|MTHFD2L_ENST00000433372.1_5'UTR|MTHFD2L_ENST00000331145.6_Silent_p.L59L	NM_001144978.1	NP_001138450.1	Q9H903	MTD2L_HUMAN	methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2-like	117					folic acid-containing compound biosynthetic process (GO:0009396)|histidine biosynthetic process (GO:0000105)|methionine biosynthetic process (GO:0009086)|one-carbon metabolic process (GO:0006730)|purine nucleotide biosynthetic process (GO:0006164)|tetrahydrofolate interconversion (GO:0035999)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	methenyltetrahydrofolate cyclohydrolase activity (GO:0004477)|methylenetetrahydrofolate dehydrogenase (NAD+) activity (GO:0004487)|methylenetetrahydrofolate dehydrogenase (NADP+) activity (GO:0004488)			central_nervous_system(1)|endometrium(1)|lung(4)|ovary(2)	8			all cancers(17;0.0101)|Lung(101;0.196)			AGCTCATTCTAAAACCTAAGG	0.388																																																	0													142.0	138.0	139.0					4																	75041020		2203	4299	6502	SO:0001819	synonymous_variant	0			BC065771	CCDS47075.1	4q13.3	2011-08-03			ENSG00000163738	ENSG00000163738			31865	protein-coding gene	gene with protein product		614047				21163947	Standard	NM_001144978		Approved	MGC72244	uc011cbk.2	Q9H903	OTTHUMG00000157135	ENST00000395759.2:c.351A>G	4.37:g.75041020A>G			Q6P079|Q8N560	Silent	SNP	pfam_THF_DH/CycHdrlase_NAD-bd_dom,pfam_THF_DH/CycHdrlase_cat_dom,prints_THF_DH/CycHdrlase	p.L117	ENST00000395759.2	37	c.351	CCDS47075.1	4																																																																																			MTHFD2L	-	pfam_THF_DH/CycHdrlase_cat_dom	ENSG00000163738		0.388	MTHFD2L-202	KNOWN	basic|appris_principal|CCDS	protein_coding	MTHFD2L	HGNC	protein_coding		-	0.00	63	0	A	NM_001004346		75041020	+1	tier1	-	no_errors	ENST00000395759	ensembl	human	known	74_37	silent	17.24	24	5	SNP	0.998	G
MTSS1L	92154	genome.wustl.edu	37	16	70714902	70714902	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr16:70714902G>C	ENST00000338779.6	-	2	370	c.96C>G	c.(94-96)ttC>ttG	p.F32L		NM_138383.2	NP_612392.1	Q765P7	MTSSL_HUMAN	metastasis suppressor 1-like	32	IMD. {ECO:0000255|PROSITE- ProRule:PRU00668}.				filopodium assembly (GO:0046847)|signal transduction (GO:0007165)					breast(1)|central_nervous_system(2)|endometrium(1)|liver(1)|lung(1)|skin(1)	7						CCTTGGAGTTGAAGTCCTCCC	0.662																																																	0													68.0	74.0	72.0					16																	70714902		2196	4296	6492	SO:0001583	missense	0				CCDS32476.1	16q22.1	2008-12-16				ENSG00000132613			25094	protein-coding gene	gene with protein product	"""actin-bundling protein with BAIAP2 homology"""					12477932	Standard	XM_006721335		Approved	ABBA-1, LOC92154	uc002ezj.3	Q765P7		ENST00000338779.6:c.96C>G	16.37:g.70714902G>C	ENSP00000341171:p.Phe32Leu		A6NJI7|Q9BUA8	Missense_Mutation	SNP	pfam_IRSp53/MIM_homology_IMD	p.F32L	ENST00000338779.6	37	c.96	CCDS32476.1	16	.	.	.	.	.	.	.	.	.	.	g	24.1	4.490588	0.84962	.	.	ENSG00000132613	ENST00000254951;ENST00000338779	T	0.31510	1.49	4.79	3.83	0.44106	IRSp53/MIM homology domain (IMD) (3);	0.000000	0.85682	D	0.000000	T	0.42154	0.1190	M	0.64080	1.96	0.43959	D	0.996637	D	0.89917	1.0	D	0.77004	0.989	T	0.48768	-0.9006	10	0.02654	T	1	-28.2502	8.9077	0.35535	0.1676:0.0:0.8324:0.0	.	32	Q765P7	MTSSL_HUMAN	L	32	ENSP00000341171:F32L	ENSP00000254951:F32L	F	-	3	2	MTSS1L	69272403	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	6.064000	0.71169	2.191000	0.70037	0.457000	0.33378	TTC	MTSS1L	-	pfam_IRSp53/MIM_homology_IMD	ENSG00000132613		0.662	MTSS1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTSS1L	HGNC	protein_coding	OTTHUMT00000434927.3	-	0.00	96	0	G	NM_138383		70714902	-1	tier1	-	no_errors	ENST00000338779	ensembl	human	known	74_37	missense	16.22	31	6	SNP	1.000	C
MUC17	140453	genome.wustl.edu	37	7	100683000	100683000	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr7:100683000C>T	ENST00000306151.4	+	3	8367	c.8303C>T	c.(8302-8304)gCt>gTt	p.A2768V		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	2768	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					AGTTCTGAGGCTAGCACCGTT	0.493																																																	0													255.0	247.0	250.0					7																	100683000		2203	4300	6503	SO:0001583	missense	0			AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.8303C>T	7.37:g.100683000C>T	ENSP00000302716:p.Ala2768Val		O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	pfam_SEA_dom,smart_SEA_dom,pfscan_EG-like_dom,pfscan_SEA_dom	p.A2768V	ENST00000306151.4	37	c.8303	CCDS34711.1	7	.	.	.	.	.	.	.	.	.	.	C	7.016	0.557824	0.13436	.	.	ENSG00000169876	ENST00000306151	T	0.03801	3.8	0.778	-1.56	0.08532	.	.	.	.	.	T	0.05823	0.0152	L	0.34521	1.04	0.09310	N	1	D	0.57571	0.98	P	0.53988	0.739	T	0.32824	-0.9892	9	0.15952	T	0.53	.	5.2376	0.15454	0.0:0.5823:0.0:0.4177	.	2768	Q685J3	MUC17_HUMAN	V	2768	ENSP00000302716:A2768V	ENSP00000302716:A2768V	A	+	2	0	MUC17	100469720	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-0.027000	0.12371	-0.665000	0.05317	-1.404000	0.01136	GCT	MUC17	-	NULL	ENSG00000169876		0.493	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC17	HGNC	protein_coding	OTTHUMT00000347161.1	-	0.00	75	0	C	NM_001040105		100683000	+1	tier1	-	no_errors	ENST00000306151	ensembl	human	known	74_37	missense	36.36	35	20	SNP	0.000	T
MUC4	4585	genome.wustl.edu	37	3	195508300	195508300	+	Missense_Mutation	SNP	G	G	A	rs201335957		TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr3:195508300G>A	ENST00000463781.3	-	2	10610	c.10151C>T	c.(10150-10152)tCg>tTg	p.S3384L	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.S3384L|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		TGTGGATGCCGAGGAAATGTC	0.577																																																	0													38.0	32.0	34.0					3																	195508300		686	1583	2269	SO:0001583	missense	0			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.10151C>T	3.37:g.195508300G>A	ENSP00000417498:p.Ser3384Leu		O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	pfam_Nidogen_extracell_dom,pfam_AMOP,pfam_VWF_type-D,smart_Nidogen_extracell_dom,smart_AMOP,smart_VWF_type-D,smart_EG-like_dom,pfscan_AMOP,pfscan_EG-like_dom	p.S3384L	ENST00000463781.3	37	c.10151	CCDS54700.1	3	.	.	.	.	.	.	.	.	.	.	g	7.832	0.720006	0.15372	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.35048	1.33;1.44	1.18	1.18	0.20946	.	.	.	.	.	T	0.14787	0.0357	N	0.19112	0.55	0.09310	N	1	D	0.57571	0.98	B	0.32149	0.141	T	0.12785	-1.0534	8	.	.	.	.	4.5388	0.12047	0.0:0.0:0.6238:0.3762	.	3256	E7ESK3	.	L	3384	ENSP00000417498:S3384L;ENSP00000420243:S3384L	.	S	-	2	0	MUC4	196993079	0.015000	0.18098	0.004000	0.12327	0.007000	0.05969	2.271000	0.43364	0.625000	0.30304	0.089000	0.15464	TCG	MUC4	-	NULL	ENSG00000145113		0.577	MUC4-001	KNOWN	basic|CCDS	protein_coding	MUC4	HGNC	protein_coding	OTTHUMT00000324081.6	-	0.00	105	0	G	NM_018406		195508300	-1	tier1	rs201335957	no_errors	ENST00000463781	ensembl	human	known	74_37	missense	38.03	44	27	SNP	0.002	A
MUC4	4585	genome.wustl.edu	37	3	195516523	195516523	+	Missense_Mutation	SNP	G	G	T	rs540356612		TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr3:195516523G>T	ENST00000463781.3	-	2	2387	c.1928C>A	c.(1927-1929)cCg>cAg	p.P643Q	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.P643Q|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	648					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.P643Q(1)|p.P643L(1)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		TGTGGTCTGCGGGGCTTGAGT	0.522																																																	2	Substitution - Missense(2)	lung(1)|endometrium(1)											279.0	285.0	283.0					3																	195516523		2073	4206	6279	SO:0001583	missense	0			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.1928C>A	3.37:g.195516523G>T	ENSP00000417498:p.Pro643Gln		O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	pfam_Nidogen_extracell_dom,pfam_AMOP,pfam_VWF_type-D,smart_Nidogen_extracell_dom,smart_AMOP,smart_VWF_type-D,smart_EG-like_dom,pfscan_AMOP,pfscan_EG-like_dom	p.P643Q	ENST00000463781.3	37	c.1928	CCDS54700.1	3	.	.	.	.	.	.	.	.	.	.	-	4.479	0.088843	0.08583	.	.	ENSG00000145113	ENST00000463781;ENST00000475231;ENST00000392409	T;T	0.57752	0.38;0.41	3.16	-2.45	0.06481	.	1.645620	0.03906	N	0.281156	T	0.25865	0.0630	N	0.08118	0	0.09310	N	1	P;B	0.42010	0.768;0.085	B;B	0.38803	0.282;0.038	T	0.05007	-1.0912	10	0.24483	T	0.36	0.222	0.6309	0.00794	0.3256:0.1713:0.3292:0.1739	.	643;648	E7ESK3;Q99102	.;MUC4_HUMAN	Q	643;643;617	ENSP00000417498:P643Q;ENSP00000420243:P643Q	ENSP00000376209:P617Q	P	-	2	0	MUC4	197000918	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.693000	0.05121	-0.603000	0.05767	0.627000	0.83407	CCG	MUC4	-	NULL	ENSG00000145113		0.522	MUC4-001	KNOWN	basic|CCDS	protein_coding	MUC4	HGNC	protein_coding	OTTHUMT00000324081.6		0.00	44	0	G	NM_018406		195516523	-1			no_errors	ENST00000463781	ensembl	human	known	74_37	missense	5.41	35	2	SNP	0.000	T
MUC5B	727897	genome.wustl.edu	37	11	1272862	1272862	+	Missense_Mutation	SNP	G	G	A	rs377582994		TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr11:1272862G>A	ENST00000529681.1	+	31	14810	c.14752G>A	c.(14752-14754)Gtg>Atg	p.V4918M	RP11-532E4.2_ENST00000532061.2_RNA|MUC5B_ENST00000447027.1_Missense_Mutation_p.V4921M	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	4918	Thr-rich.				cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		AACCTTCAGCGTGTCCACTGT	0.632																																																	0								G	MET/VAL	1,4343		0,1,2171	60.0	71.0	67.0		14752	-7.2	0.0	11		67	1,8509		0,1,4254	no	missense	MUC5B	NM_002458.2	21	0,2,6425	AA,AG,GG		0.0118,0.023,0.0156	benign	4918/5763	1272862	2,12852	2172	4255	6427	SO:0001583	missense	0			U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.14752G>A	11.37:g.1272862G>A	ENSP00000436812:p.Val4918Met		O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Missense_Mutation	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,pfam_VWF_C,superfamily_TIL_dom,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_VWF_C,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_VWF_C	p.V4921M	ENST00000529681.1	37	c.14761	CCDS44515.2	11	.	.	.	.	.	.	.	.	.	.	G	5.088	0.201895	0.09652	2.3E-4	1.18E-4	ENSG00000117983	ENST00000529681;ENST00000447027;ENST00000349637;ENST00000406844	T;T	0.19105	2.17;2.36	3.63	-7.15	0.01521	.	.	.	.	.	T	0.07007	0.0178	N	0.11255	0.115	0.09310	N	1	B;B	0.27117	0.168;0.168	B;B	0.15052	0.012;0.012	T	0.30208	-0.9986	9	0.87932	D	0	.	0.6236	0.00782	0.3767:0.1181:0.1835:0.3218	.	5240;4921	A7Y9J9;E9PBJ0	.;.	M	4918;4921;4862;4617	ENSP00000436812:V4918M;ENSP00000415793:V4921M	ENSP00000343037:V4862M	V	+	1	0	MUC5B	1229438	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-2.229000	0.01208	-1.163000	0.02793	-2.078000	0.00380	GTG	MUC5B	-	NULL	ENSG00000117983		0.632	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	MUC5B	HGNC	protein_coding	OTTHUMT00000390041.2		0.00	44	0	G	XM_001126093		1272862	+1			no_errors	ENST00000447027	ensembl	human	known	74_37	missense	14.29	12	2	SNP	0.000	A
MUSK	4593	genome.wustl.edu	37	9	113563101	113563101	+	Missense_Mutation	SNP	G	G	A	rs551520537		TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr9:113563101G>A	ENST00000374448.4	+	15	2577	c.2443G>A	c.(2443-2445)Gtg>Atg	p.V815M	MUSK_ENST00000416899.2_Missense_Mutation_p.V807M|MUSK_ENST00000189978.5_Missense_Mutation_p.V815M	NM_001166281.1|NM_005592.3	NP_001159753.1|NP_005583.1	O15146	MUSK_HUMAN	muscle, skeletal, receptor tyrosine kinase	815	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell differentiation (GO:0030154)|extracellular matrix organization (GO:0030198)|memory (GO:0007613)|multicellular organismal development (GO:0007275)|neuromuscular junction development (GO:0007528)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of gene expression (GO:0010628)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of protein geranylgeranylation (GO:2000541)|positive regulation of protein phosphorylation (GO:0001934)|protein autophosphorylation (GO:0046777)|regulation of synaptic growth at neuromuscular junction (GO:0008582)|regulation of transcription, DNA-templated (GO:0006355)|skeletal muscle acetylcholine-gated channel clustering (GO:0071340)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|neuromuscular junction (GO:0031594)|postsynaptic membrane (GO:0045211)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(7)|lung(23)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	49						CATTTACTACGTGCGAGATGG	0.562																																																	0													63.0	62.0	63.0					9																	113563101		2058	4201	6259	SO:0001583	missense	0			AF006464	CCDS48005.1, CCDS75874.1	9q31.3-q32	2013-01-29			ENSG00000030304	ENSG00000030304		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	7525	protein-coding gene	gene with protein product		601296				7546737	Standard	NM_005592		Approved		uc022blv.1	O15146	OTTHUMG00000020485	ENST00000374448.4:c.2443G>A	9.37:g.113563101G>A	ENSP00000363571:p.Val815Met		Q32MJ8|Q32MJ9|Q5VZW7|Q5VZW8	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ig_I-set,pfam_Prot_kinase_dom,pfam_Frizzled_dom,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Kinase-like_dom,superfamily_Frizzled_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Frizzled_dom,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.V815M	ENST00000374448.4	37	c.2443	CCDS48005.1	9	.	.	.	.	.	.	.	.	.	.	G	28.1	4.893579	0.91889	.	.	ENSG00000030304	ENST00000189978;ENST00000374448;ENST00000543335;ENST00000374447;ENST00000545907;ENST00000416899	D	0.84442	-1.85	5.62	5.62	0.85841	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.92179	0.7520	M	0.71206	2.165	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.92380	0.5912	10	0.87932	D	0	.	19.0078	0.92859	0.0:0.0:1.0:0.0	.	815	O15146	MUSK_HUMAN	M	821;815;815;729;729;813	ENSP00000363571:V815M	ENSP00000189978:V821M	V	+	1	0	MUSK	112602922	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.813000	0.99286	2.809000	0.96659	0.557000	0.71058	GTG	MUSK	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000030304		0.562	MUSK-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MUSK	HGNC	protein_coding			0.00	31	0	G			113563101	+1			no_errors	ENST00000374448	ensembl	human	known	74_37	missense	12.50	13	2	SNP	1.000	A
MYBL2	4605	genome.wustl.edu	37	20	42311443	42311443	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr20:42311443G>A	ENST00000217026.4	+	4	323	c.196G>A	c.(196-198)Gac>Aac	p.D66N	MYBL2_ENST00000396863.4_Missense_Mutation_p.D42N	NM_002466.2	NP_002457.1	P10244	MYBB_HUMAN	v-myb avian myeloblastosis viral oncogene homolog-like 2	66	HTH myb-type 1. {ECO:0000255|PROSITE- ProRule:PRU00625}.				G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell cycle (GO:0051726)|spindle assembly involved in mitosis (GO:0090307)	Myb complex (GO:0031523)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(7)|liver(2)|lung(18)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	46		Myeloproliferative disorder(115;0.00452)	COAD - Colon adenocarcinoma(18;0.0031)			GAACCGCACTGACCAGCAATG	0.517																																																	0													226.0	222.0	223.0					20																	42311443		2203	4300	6503	SO:0001583	missense	0				CCDS13322.1, CCDS63276.1	20q13.1	2013-07-09	2013-07-09		ENSG00000101057	ENSG00000101057			7548	protein-coding gene	gene with protein product		601415				8812502	Standard	NM_002466		Approved	BMYB, B-MYB	uc002xlb.1	P10244	OTTHUMG00000033062	ENST00000217026.4:c.196G>A	20.37:g.42311443G>A	ENSP00000217026:p.Asp66Asn		B2RBS5|B7Z8D9|F8W6N6|Q53F07	Missense_Mutation	SNP	pfam_C-myb_C,pfam_SANT/Myb,superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_Myb-like_dom	p.D66N	ENST00000217026.4	37	c.196	CCDS13322.1	20	.	.	.	.	.	.	.	.	.	.	G	34	5.379599	0.95945	.	.	ENSG00000101057	ENST00000396863;ENST00000217026	T;T	0.14893	2.47;2.47	5.31	5.31	0.75309	Transcription regulator HTH, Myb-type, DNA-binding (1);Myb, DNA-binding (1);SANT domain, DNA binding (1);Homeodomain-related (1);Homeodomain-like (1);	0.097033	0.64402	D	0.000001	T	0.21227	0.0511	L	0.46741	1.465	0.58432	D	0.99999	P;P	0.51537	0.946;0.751	B;B	0.43536	0.41;0.423	T	0.00842	-1.1544	10	0.52906	T	0.07	-30.88	18.1318	0.89604	0.0:0.0:1.0:0.0	.	42;66	F8W6N6;P10244	.;MYBB_HUMAN	N	42;66	ENSP00000380072:D42N;ENSP00000217026:D66N	ENSP00000217026:D66N	D	+	1	0	MYBL2	41744857	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.652000	0.98499	2.665000	0.90641	0.655000	0.94253	GAC	MYBL2	-	pfam_SANT/Myb,superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_Myb-like_dom	ENSG00000101057		0.517	MYBL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYBL2	HGNC	protein_coding	OTTHUMT00000080408.1	-	0.00	61	0	G	NM_002466		42311443	+1	tier1	-	no_errors	ENST00000217026	ensembl	human	known	74_37	missense	21.43	44	12	SNP	1.000	A
MYH1	4619	genome.wustl.edu	37	17	10405218	10405218	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr17:10405218G>T	ENST00000226207.5	-	25	3216	c.3122C>A	c.(3121-3123)tCt>tAt	p.S1041Y	RP11-799N11.1_ENST00000581304.1_RNA|CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000399342.2_RNA	NM_005963.3	NP_005954.3	P12882	MYH1_HUMAN	myosin, heavy chain 1, skeletal muscle, adult	1041					muscle contraction (GO:0006936)	A band (GO:0031672)|cytoplasmic ribonucleoprotein granule (GO:0036464)|intercalated disc (GO:0014704)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(7)|breast(4)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(22)|lung(78)|ovary(11)|pancreas(1)|prostate(3)|skin(13)|upper_aerodigestive_tract(4)|urinary_tract(5)	176						TTGTTCCAAAGATCCTTCAAG	0.343																																																	0													66.0	57.0	60.0					17																	10405218		2202	4298	6500	SO:0001583	missense	0				CCDS11155.1	17p13.1	2013-09-19	2006-09-29		ENSG00000109061	ENSG00000109061		"""Myosins / Myosin superfamily : Class II"""	7567	protein-coding gene	gene with protein product	"""myosin heavy chain IIx/d"""	160730	"""myosin, heavy polypeptide 1, skeletal muscle, adult"""			6304733	Standard	NM_005963		Approved	MYHSA1, MYHa, MyHC-2X/D, MGC133384	uc002gmo.3	P12882	OTTHUMG00000130362	ENST00000226207.5:c.3122C>A	17.37:g.10405218G>T	ENSP00000226207:p.Ser1041Tyr		Q14CA4|Q9Y622	Missense_Mutation	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_P-loop_NTPase,superfamily_Prefoldin,superfamily_tRNA-bd_arm,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.S1041Y	ENST00000226207.5	37	c.3122	CCDS11155.1	17	.	.	.	.	.	.	.	.	.	.	G	24.0	4.487915	0.84854	.	.	ENSG00000109061	ENST00000226207	D	0.91237	-2.81	5.62	5.62	0.85841	.	0.000000	0.42964	U	0.000630	D	0.95310	0.8478	M	0.93898	3.47	0.80722	D	1	P	0.48998	0.918	P	0.49708	0.62	D	0.96020	0.9008	10	0.87932	D	0	.	20.0377	0.97569	0.0:0.0:1.0:0.0	.	1041	P12882	MYH1_HUMAN	Y	1041	ENSP00000226207:S1041Y	ENSP00000226207:S1041Y	S	-	2	0	MYH1	10345943	1.000000	0.71417	0.996000	0.52242	0.997000	0.91878	9.704000	0.98716	2.822000	0.97130	0.650000	0.86243	TCT	MYH1	-	NULL	ENSG00000109061		0.343	MYH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH1	HGNC	protein_coding	OTTHUMT00000252725.1	-	0.00	45	0	G	NM_005963		10405218	-1	tier1	-	no_errors	ENST00000226207	ensembl	human	known	74_37	missense	50.00	10	10	SNP	1.000	T
MYO3B	140469	genome.wustl.edu	37	2	171262126	171262126	+	Nonsense_Mutation	SNP	C	C	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr2:171262126C>T	ENST00000408978.4	+	21	2646	c.2503C>T	c.(2503-2505)Cag>Tag	p.Q835*	MYO3B_ENST00000334231.6_Nonsense_Mutation_p.Q844*|MYO3B_ENST00000409044.3_Nonsense_Mutation_p.Q835*|MYO3B_ENST00000602629.1_3'UTR	NM_138995.4	NP_620482.3	Q8WXR4	MYO3B_HUMAN	myosin IIIB	835	Myosin motor.				peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of filopodium assembly (GO:0051491)|protein autophosphorylation (GO:0046777)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|filopodium tip (GO:0032433)|myosin complex (GO:0016459)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|stereocilium bundle tip (GO:0032426)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(25)|ovary(6)|pancreas(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	59						CTTTGGCATTCAGCATTATGC	0.418																																																	0													107.0	102.0	104.0					2																	171262126		1916	4137	6053	SO:0001587	stop_gained	0				CCDS42773.1, CCDS46446.1	2q31.1-q31.2	2011-09-27			ENSG00000071909	ENSG00000071909		"""Myosins / Myosin superfamily : Class III"""	15576	protein-coding gene	gene with protein product		610040					Standard	NM_001083615		Approved		uc002ufy.3	Q8WXR4	OTTHUMG00000154002	ENST00000408978.4:c.2503C>T	2.37:g.171262126C>T	ENSP00000386213:p.Gln835*		B8ZZR2|Q53QE1|Q53T08|Q8IX64|Q8IX65|Q8IX66|Q8IX67|Q8IX68|Q96N94	Nonsense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_IQ_motif_EF-hand-BS,superfamily_P-loop_NTPase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,pfscan_Prot_kinase_dom,prints_Myosin_head_motor_dom	p.Q844*	ENST00000408978.4	37	c.2530	CCDS42773.1	2	.	.	.	.	.	.	.	.	.	.	C	40	8.264704	0.98732	.	.	ENSG00000071909	ENST00000409044;ENST00000408978;ENST00000317915;ENST00000484338;ENST00000334231	.	.	.	5.5	4.63	0.57726	.	0.206543	0.52532	D	0.000067	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.19590	T	0.45	.	14.5763	0.68249	0.0:0.9297:0.0:0.0703	.	.	.	.	X	835;835;834;844;844	.	ENSP00000314213:Q834X	Q	+	1	0	MYO3B	170970372	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.942000	0.56614	1.469000	0.48083	0.655000	0.94253	CAG	MYO3B	-	pfam_Myosin_head_motor_dom,superfamily_P-loop_NTPase,smart_Myosin_head_motor_dom	ENSG00000071909		0.418	MYO3B-004	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	MYO3B	HGNC	protein_coding	OTTHUMT00000333410.1	-	0.00	60	0	C			171262126	+1	tier1	-	no_errors	ENST00000334231	ensembl	human	known	74_37	nonsense	9.09	30	3	SNP	1.000	T
MYO5C	55930	genome.wustl.edu	37	15	52553245	52553245	+	Missense_Mutation	SNP	C	C	T	rs199654190		TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr15:52553245C>T	ENST00000261839.7	-	10	1288	c.1127G>A	c.(1126-1128)cGc>cAc	p.R376H	MYO5C_ENST00000541028.1_5'UTR|MYO5C_ENST00000443683.2_Missense_Mutation_p.R319H	NM_018728.3	NP_061198.2	Q9NQX4	MYO5C_HUMAN	myosin VC	376	Myosin motor.					extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)	ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(8)|kidney(7)|large_intestine(15)|lung(12)|ovary(7)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	66				all cancers(107;0.0137)		GACGATTTTGCGATTGCACAG	0.537													C|||	1	0.000199681	0.0	0.0	5008	,	,		19207	0.001		0.0	False		,,,				2504	0.0																0													81.0	84.0	83.0					15																	52553245		2034	4198	6232	SO:0001583	missense	0			AF272390	CCDS42036.1	15q21	2011-09-27				ENSG00000128833		"""Myosins / Myosin superfamily : Class V"""	7604	protein-coding gene	gene with protein product	"""myosin 5C"""	610022				11870218	Standard	NM_018728		Approved	MGC74969	uc010bff.3	Q9NQX4		ENST00000261839.7:c.1127G>A	15.37:g.52553245C>T	ENSP00000261839:p.Arg376His		Q6P1W8	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_Dil_domain,pfam_IQ_motif_EF-hand-BS,superfamily_P-loop_NTPase,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_Dilute,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.R376H	ENST00000261839.7	37	c.1127	CCDS42036.1	15	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	19.54	3.846316	0.71603	.	.	ENSG00000128833	ENST00000261839;ENST00000443683	D;D	0.89270	-2.49;-2.49	5.51	5.51	0.81932	Myosin head, motor domain (2);	0.119463	0.56097	D	0.000025	D	0.95436	0.8518	M	0.87758	2.905	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.95773	0.8810	10	0.87932	D	0	.	19.4119	0.94677	0.0:1.0:0.0:0.0	.	376	Q9NQX4	MYO5C_HUMAN	H	376;319	ENSP00000261839:R376H;ENSP00000410582:R319H	ENSP00000261839:R376H	R	-	2	0	MYO5C	50340537	1.000000	0.71417	0.436000	0.26797	0.024000	0.10985	7.818000	0.86416	2.609000	0.88269	0.655000	0.94253	CGC	MYO5C	-	pfam_Myosin_head_motor_dom,superfamily_P-loop_NTPase,smart_Myosin_head_motor_dom	ENSG00000128833		0.537	MYO5C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO5C	HGNC	protein_coding	OTTHUMT00000419562.1		0.00	43	0	C	NM_018728		52553245	-1			no_errors	ENST00000261839	ensembl	human	known	74_37	missense	7.69	24	2	SNP	1.000	T
MYO9A	4649	genome.wustl.edu	37	15	72193556	72193556	+	Silent	SNP	C	C	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr15:72193556C>T	ENST00000356056.5	-	23	3598	c.3126G>A	c.(3124-3126)ctG>ctA	p.L1042L	MYO9A_ENST00000424560.1_Silent_p.L1042L|MYO9A_ENST00000564571.1_Silent_p.L1042L|MYO9A_ENST00000566885.1_Silent_p.L662L|MYO9A_ENST00000563542.1_5'UTR|MYO9A_ENST00000444904.1_Silent_p.L1023L	NM_006901.3	NP_008832.2	B2RTY4	MYO9A_HUMAN	myosin IXA	1042	IQ 2. {ECO:0000255|PROSITE- ProRule:PRU00116}.|Neck or regulatory domain.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|visual perception (GO:0007601)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|unconventional myosin complex (GO:0016461)	ATP binding (GO:0005524)|GTPase activator activity (GO:0005096)|metal ion binding (GO:0046872)|motor activity (GO:0003774)			NS(4)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(29)|lung(27)|ovary(1)|pancreas(1)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	88						ATGCTTGTCTCAGATGGAGGA	0.428																																																	0													119.0	98.0	105.0					15																	72193556		2199	4297	6496	SO:0001819	synonymous_variant	0			AF117888	CCDS10239.1	15q22-q23	2011-09-27			ENSG00000066933	ENSG00000066933		"""Myosins / Myosin superfamily : Class IX"""	7608	protein-coding gene	gene with protein product		604875				10409426	Standard	NM_006901		Approved	FLJ11061, FLJ13244, MGC71859	uc002atl.5	B2RTY4	OTTHUMG00000133440	ENST00000356056.5:c.3126G>A	15.37:g.72193556C>T			B0I1T5|C9IYB3|C9JA86|Q14787|Q3YLD7|Q3YLD8|Q6P986|Q9H8T5|Q9NTG2|Q9NUY2|Q9UEP3|Q9UNJ2	Silent	SNP	pfam_Myosin_head_motor_dom,pfam_RhoGAP_dom,pfam_Ras-assoc,pfam_IQ_motif_EF-hand-BS,superfamily_P-loop_NTPase,superfamily_Rho_GTPase_activation_prot,smart_Ras-assoc,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_RhoGAP_dom,pfscan_IQ_motif_EF-hand-BS,pfscan_Ras-assoc,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_RhoGAP_dom,prints_Myosin_head_motor_dom	p.L1042	ENST00000356056.5	37	c.3126	CCDS10239.1	15																																																																																			MYO9A	-	superfamily_P-loop_NTPase,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS	ENSG00000066933		0.428	MYO9A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO9A	HGNC	protein_coding	OTTHUMT00000257308.1	-	0.00	36	0	C	NM_006901		72193556	-1	tier1	-	no_errors	ENST00000424560	ensembl	human	known	74_37	silent	15.00	17	3	SNP	1.000	T
NAGLU	4669	genome.wustl.edu	37	17	40695907	40695907	+	Missense_Mutation	SNP	C	C	T	rs535336259		TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr17:40695907C>T	ENST00000225927.2	+	6	1984	c.1883C>T	c.(1882-1884)gCg>gTg	p.A628V	RP11-400F19.8_ENST00000585572.1_RNA	NM_000263.3	NP_000254.2	P54802	ANAG_HUMAN	N-acetylglucosaminidase, alpha	628					carbohydrate metabolic process (GO:0005975)|cerebellar Purkinje cell layer development (GO:0021680)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|inner ear receptor cell development (GO:0060119)|locomotor rhythm (GO:0045475)|lysosome organization (GO:0007040)|middle ear morphogenesis (GO:0042474)|nervous system development (GO:0007399)|retinal rod cell development (GO:0046548)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)	alpha-N-acetylglucosaminidase activity (GO:0004561)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(1)|ovary(2)|skin(1)	12		all_cancers(22;1.58e-05)|Breast(137;0.000153)|all_epithelial(22;0.000344)		BRCA - Breast invasive adenocarcinoma(366;0.13)	N-Acetyl-D-glucosamine(DB00141)	GCCCGAGCAGCGGCAGTCAGT	0.632																																																	0													22.0	21.0	21.0					17																	40695907		2201	4299	6500	SO:0001583	missense	0				CCDS11427.1	17q21.2	2010-07-27	2010-07-27		ENSG00000108784	ENSG00000108784	3.2.1.50		7632	protein-coding gene	gene with protein product	"""Sanfilippo disease IIIB"""	609701					Standard	XM_006721920		Approved	NAG	uc002hzv.3	P54802		ENST00000225927.2:c.1883C>T	17.37:g.40695907C>T	ENSP00000225927:p.Ala628Val			Missense_Mutation	SNP	pfam_NAGLU_tim-barrel,superfamily_Glycoside_hydrolase_SF	p.A628V	ENST00000225927.2	37	c.1883	CCDS11427.1	17	.	.	.	.	.	.	.	.	.	.	C	1.057	-0.674120	0.03378	.	.	ENSG00000108784	ENST00000225927;ENST00000377405	D	0.98550	-4.99	4.69	-5.16	0.02857	Alpha-N-acetylglucosaminidase, C-terminal (1);	1.067650	0.07060	N	0.833636	D	0.91831	0.7415	N	0.02721	-0.515	0.09310	N	1	B	0.13145	0.007	B	0.10450	0.005	D	0.83423	0.0034	10	0.22109	T	0.4	-0.3261	12.8682	0.57951	0.0:0.2523:0.0:0.7477	.	628	P54802	ANAG_HUMAN	V	628;304	ENSP00000225927:A628V	ENSP00000225927:A628V	A	+	2	0	NAGLU	37949433	0.000000	0.05858	0.000000	0.03702	0.045000	0.14185	-2.126000	0.01316	-0.742000	0.04790	-0.459000	0.05422	GCG	NAGLU	-	pfam_NAGLU_tim-barrel	ENSG00000108784		0.632	NAGLU-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NAGLU	HGNC	protein_coding	OTTHUMT00000450385.1	-	0.00	42	0	C	NM_000263		40695907	+1	tier1	-	no_errors	ENST00000225927	ensembl	human	known	74_37	missense	13.16	33	5	SNP	0.000	T
NANS	54187	genome.wustl.edu	37	9	100840540	100840540	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr9:100840540G>A	ENST00000210444.5	+	4	584	c.514G>A	c.(514-516)Gtg>Atg	p.V172M	TRIM14_ENST00000375098.3_Intron|NANS_ENST00000461452.1_3'UTR|TRIM14_ENST00000478530.1_5'Flank	NM_018946.3	NP_061819.2	Q9NR45	SIAS_HUMAN	N-acetylneuraminic acid synthase	172					lipopolysaccharide biosynthetic process (GO:0009103)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	N-acetylneuraminate synthase activity (GO:0050462)|N-acylneuraminate cytidylyltransferase activity (GO:0008781)|N-acylneuraminate-9-phosphate synthase activity (GO:0047444)			breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(2)|ovary(1)|prostate(1)|skin(1)	11		Acute lymphoblastic leukemia(62;0.0559)				TTATCAGATCGTGAAGCCCCT	0.547																																																	0													226.0	177.0	194.0					9																	100840540		2203	4300	6503	SO:0001583	missense	0			AF161387	CCDS6733.1	9p24.1-p23	2008-07-31	2008-07-31		ENSG00000095380	ENSG00000095380			19237	protein-coding gene	gene with protein product	"""sialic acid synthase"""	605202				10749855	Standard	NM_018946		Approved	SAS	uc004ayc.3	Q9NR45	OTTHUMG00000020341	ENST00000210444.5:c.514G>A	9.37:g.100840540G>A	ENSP00000210444:p.Val172Met		B2RE98|Q8WUV9|Q9BWS6|Q9NVD4	Missense_Mutation	SNP	pfam_Neu5Ac_N,pfam_SAF,superfamily_AFP_Neu5c_C,smart_SAF,pfscan_AFP_Neu5c_C,prints_Antifreeze_III	p.V172M	ENST00000210444.5	37	c.514	CCDS6733.1	9	.	.	.	.	.	.	.	.	.	.	G	13.79	2.342759	0.41498	.	.	ENSG00000095380	ENST00000210444;ENST00000415280	T;T	0.45668	0.89;0.89	5.32	5.32	0.75619	Aldolase-type TIM barrel (1);N-acetylneuraminic acid synthase, N-terminal (1);	0.054374	0.64402	D	0.000001	T	0.27594	0.0678	N	0.17278	0.47	0.80722	D	1	P;B	0.49447	0.924;0.386	B;B	0.36134	0.218;0.094	T	0.18555	-1.0333	10	0.62326	D	0.03	-26.0614	16.9588	0.86267	0.0:0.0:1.0:0.0	.	8;172	E9PGK0;Q9NR45	.;SIAS_HUMAN	M	172;31	ENSP00000210444:V172M;ENSP00000404107:V31M	ENSP00000210444:V172M	V	+	1	0	NANS	99880361	1.000000	0.71417	0.999000	0.59377	0.713000	0.41058	9.410000	0.97335	2.674000	0.91012	0.644000	0.83932	GTG	NANS	-	pfam_Neu5Ac_N	ENSG00000095380		0.547	NANS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NANS	HGNC	protein_coding	OTTHUMT00000053359.1	-	0.00	49	0	G	NM_018946		100840540	+1	tier1	-	no_errors	ENST00000210444	ensembl	human	known	74_37	missense	44.44	20	16	SNP	1.000	A
NAV1	89796	genome.wustl.edu	37	1	201780815	201780815	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr1:201780815G>T	ENST00000367296.4	+	25	5302	c.4882G>T	c.(4882-4884)Gat>Tat	p.D1628Y	MIR1231_ENST00000408101.1_RNA|NAV1_ENST00000367300.3_Missense_Mutation_p.D1568Y|IPO9-AS1_ENST00000413035.1_RNA|NAV1_ENST00000367302.1_Missense_Mutation_p.D1581Y|NAV1_ENST00000295624.6_Missense_Mutation_p.D1625Y|NAV1_ENST00000367295.1_Missense_Mutation_p.D1234Y|NAV1_ENST00000367297.4_Missense_Mutation_p.D1620Y	NM_020443.4	NP_065176.3	Q8NEY1	NAV1_HUMAN	neuron navigator 1	1628					microtubule bundle formation (GO:0001578)|neuron migration (GO:0001764)	cytoplasm (GO:0005737)|microtubule (GO:0005874)				breast(5)|central_nervous_system(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(5)|kidney(3)|large_intestine(10)|lung(29)|ovary(4)|prostate(3)|skin(1)|stomach(2)	70						GATTCTATTGGATGACCTGAG	0.468																																																	0													160.0	156.0	157.0					1																	201780815		2203	4300	6503	SO:0001583	missense	0			AF086348	CCDS1414.1, CCDS1414.2, CCDS53456.1	1q32.3	2008-07-18			ENSG00000134369	ENSG00000134369			15989	protein-coding gene	gene with protein product	"""neuron navigator-1"", ""pore membrane and/or filament interacting like protein 3"""	611628				12079279, 12062803	Standard	NM_020443		Approved	FLJ12560, FLJ14203, KIAA1151, MGC14961, POMFIL3, steerin-1, DKFZp781D0314	uc001gwu.3	Q8NEY1	OTTHUMG00000035766	ENST00000367296.4:c.4882G>T	1.37:g.201780815G>T	ENSP00000356265:p.Asp1628Tyr		A8MS88|Q5SVH1|Q5SVH2|Q5SVH3|Q5SVH7|Q5VUY9|Q8IVL2|Q96II1|Q9H7V9|Q9H9S9|Q9H9T5|Q9UGI1|Q9ULK7|Q9ULR9	Missense_Mutation	SNP	superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.D1628Y	ENST00000367296.4	37	c.4882	CCDS1414.2	1	.	.	.	.	.	.	.	.	.	.	G	27.7	4.854757	0.91355	.	.	ENSG00000134369	ENST00000367302;ENST00000367296;ENST00000295624;ENST00000367297;ENST00000367300;ENST00000367295;ENST00000367301	D;D;D;D;D;D	0.96073	-3.9;-3.9;-3.9;-3.9;-3.9;-3.9	5.29	5.29	0.74685	.	0.000000	0.85682	D	0.000000	D	0.97864	0.9298	M	0.83774	2.66	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.98523	1.0624	10	0.87932	D	0	-23.575	18.893	0.92412	0.0:0.0:1.0:0.0	.	1234;1625	Q8NEY1-5;Q8NEY1-3	.;.	Y	1581;1628;1625;1620;1568;1234;36	ENSP00000356271:D1581Y;ENSP00000356265:D1628Y;ENSP00000295624:D1625Y;ENSP00000356266:D1620Y;ENSP00000356269:D1568Y;ENSP00000356264:D1234Y	ENSP00000295624:D1625Y	D	+	1	0	NAV1	200047438	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	9.783000	0.99037	2.634000	0.89283	0.555000	0.69702	GAT	NAV1	-	superfamily_P-loop_NTPase,smart_AAA+_ATPase	ENSG00000134369		0.468	NAV1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NAV1	HGNC	protein_coding	OTTHUMT00000087013.1	-	0.00	42	0	G	NM_020443		201780815	+1	tier1	-	no_errors	ENST00000367296	ensembl	human	known	74_37	missense	30.00	14	6	SNP	1.000	T
NCAM1	4684	genome.wustl.edu	37	11	113102449	113102449	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr11:113102449G>C	ENST00000533760.1	+	9	1387	c.788G>C	c.(787-789)gGa>gCa	p.G263A	NCAM1_ENST00000401611.2_Missense_Mutation_p.G390A|NCAM1_ENST00000316851.7_Missense_Mutation_p.G381A|NCAM1_ENST00000397957.4_3'UTR	NM_001242608.1	NP_001229537.1	P13591	NCAM1_HUMAN	neural cell adhesion molecule 1	391	Ig-like C2-type 3.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cytokine-mediated signaling pathway (GO:0019221)|extracellular matrix organization (GO:0030198)|interferon-gamma-mediated signaling pathway (GO:0060333)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)			breast(1)|endometrium(3)|kidney(1)|large_intestine(11)|lung(27)|ovary(3)|prostate(2)|upper_aerodigestive_tract(1)	49		all_cancers(61;5.82e-19)|all_epithelial(67;6.87e-12)|Melanoma(852;1.99e-05)|all_hematologic(158;3.66e-05)|Acute lymphoblastic leukemia(157;0.00119)|Breast(348;0.0109)|all_neural(223;0.0299)|Medulloblastoma(222;0.0458)|Renal(330;0.198)|Prostate(24;0.207)		BRCA - Breast invasive adenocarcinoma(274;1.78e-05)|Epithelial(105;0.000114)|all cancers(92;0.000467)|OV - Ovarian serous cystadenocarcinoma(223;0.212)		ACTGATGCCGGAGAGTACATC	0.597																																																	0													83.0	89.0	87.0					11																	113102449		2168	4276	6444	SO:0001583	missense	0				CCDS73384.1, CCDS73385.1, CCDS73386.1, CCDS73387.1, CCDS73388.1	11q23.2	2013-02-11			ENSG00000149294	ENSG00000149294		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7656	protein-coding gene	gene with protein product		116930					Standard	NM_000615		Approved	NCAM, CD56	uc021qqp.1	P13591	OTTHUMG00000167196	ENST00000533760.1:c.788G>C	11.37:g.113102449G>C	ENSP00000473281:p.Gly263Ala		A8K8T8|P13592|P13593|Q05C58|Q15829|Q16180|Q16209|Q59FL7|Q86X47|Q96CJ3	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom,prints_Neural_cell_adh	p.G381A	ENST00000533760.1	37	c.1142		11	.	.	.	.	.	.	.	.	.	.	G	23.9	4.468111	0.84533	.	.	ENSG00000149294	ENST00000531044;ENST00000401611;ENST00000316851	T;T	0.80738	-1.41;-1.41	4.87	4.87	0.63330	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	U	0.000000	D	0.82674	0.5088	.	.	.	0.80722	D	1	P;P;P;P	0.42161	0.656;0.772;0.704;0.51	B;B;P;B	0.44897	0.333;0.333;0.463;0.333	D	0.85347	0.1099	9	0.87932	D	0	-30.2851	18.5486	0.91055	0.0:0.0:1.0:0.0	.	391;381;391;381	P13591-5;P13591-1;P13591;P13591-3	.;.;NCAM1_HUMAN;.	A	263;390;381	ENSP00000384055:G390A;ENSP00000318472:G381A	ENSP00000318472:G381A	G	+	2	0	NCAM1	112607659	1.000000	0.71417	0.955000	0.39395	0.888000	0.51559	9.565000	0.98154	2.688000	0.91661	0.491000	0.48974	GGA	NCAM1	-	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000149294		0.597	NCAM1-003	NOVEL	basic|appris_principal	protein_coding	NCAM1	HGNC	protein_coding	OTTHUMT00000394068.2		0.00	37	0	G	NM_000615		113102449	+1			no_errors	ENST00000316851	ensembl	human	known	74_37	missense	11.11	24	3	SNP	1.000	C
NCOA3	8202	genome.wustl.edu	37	20	46281290	46281290	+	Nonsense_Mutation	SNP	A	A	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr20:46281290A>T	ENST00000371998.3	+	21	4278	c.4087A>T	c.(4087-4089)Aag>Tag	p.K1363*	NCOA3_ENST00000341724.6_Nonsense_Mutation_p.K1289*|NCOA3_ENST00000372004.3_Nonsense_Mutation_p.K1359*|NCOA3_ENST00000371997.3_Nonsense_Mutation_p.K1354*			Q9Y6Q9	NCOA3_HUMAN	nuclear receptor coactivator 3	1363					androgen receptor signaling pathway (GO:0030521)|developmental growth (GO:0048589)|histone acetylation (GO:0016573)|labyrinthine layer morphogenesis (GO:0060713)|mammary gland branching involved in thelarche (GO:0060744)|multicellular organism growth (GO:0035264)|positive regulation of gene expression (GO:0010628)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|receptor transactivation (GO:0035624)|regulation of RNA biosynthetic process (GO:2001141)|transcription, DNA-templated (GO:0006351)|vagina development (GO:0060068)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|histone acetyltransferase activity (GO:0004402)|ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nuclear hormone receptor binding (GO:0035257)|protein N-terminus binding (GO:0047485)|signal transducer activity (GO:0004871)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)			breast(3)|endometrium(3)|kidney(4)|large_intestine(12)|lung(19)|ovary(4)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	52						CTCAGAAATGAAGGGCTGGCC	0.463																																																	0													61.0	54.0	56.0					20																	46281290		2203	4300	6503	SO:0001587	stop_gained	0			AF012108	CCDS13406.1, CCDS13407.1, CCDS54472.1	20q12	2011-07-01			ENSG00000124151	ENSG00000124151		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Basic helix-loop-helix proteins"""	7670	protein-coding gene	gene with protein product	"""receptor-associated coactivator 3"", ""thyroid hormone receptor activator molecule 1"""	601937				9252329, 9346901	Standard	NM_181659		Approved	RAC3, AIB1, ACTR, p/CIP, TRAM-1, CAGH16, TNRC16, KAT13B, bHLHe42, SRC-3, SRC3	uc002xtk.3	Q9Y6Q9	OTTHUMG00000033061	ENST00000371998.3:c.4087A>T	20.37:g.46281290A>T	ENSP00000361066:p.Lys1363*		A4LAZ5|Q0VF45|Q5JYD9|Q5JYE0|Q9BR49|Q9UPC9|Q9UPG4|Q9UPG7	Nonsense_Mutation	SNP	pfam_Nuc_rcpt_coact_Ncoa-typ,pfam_SRC-1,pfam_PAS_fold,superfamily_PAS,superfamily_Nuc_rcpt_coact,superfamily_bHLH_dom,smart_bHLH_dom,smart_PAS,pirsf_Nuclear_rcpt_coactivator,pfscan_PAS,pfscan_bHLH_dom	p.K1363*	ENST00000371998.3	37	c.4087	CCDS13407.1	20	.	.	.	.	.	.	.	.	.	.	A	44	10.964497	0.99495	.	.	ENSG00000124151	ENST00000340189;ENST00000341724;ENST00000372004;ENST00000371998;ENST00000371997	.	.	.	5.23	5.23	0.72850	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-29.181	15.4188	0.74995	1.0:0.0:0.0:0.0	.	.	.	.	X	1359;1289;1359;1363;1354	.	ENSP00000345671:K1359X	K	+	1	0	NCOA3	45714697	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.634000	0.91002	2.099000	0.63709	0.533000	0.62120	AAG	NCOA3	-	pirsf_Nuclear_rcpt_coactivator	ENSG00000124151		0.463	NCOA3-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NCOA3	HGNC	protein_coding	OTTHUMT00000080405.1	-	0.00	43	0	A	NM_006534		46281290	+1	tier1	-	no_errors	ENST00000371998	ensembl	human	known	74_37	nonsense	32.43	25	12	SNP	1.000	T
NCR2	9436	genome.wustl.edu	37	6	41309806	41309806	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr6:41309806C>T	ENST00000373089.5	+	4	651	c.563C>T	c.(562-564)gCa>gTa	p.A188V	NCR2_ENST00000373086.3_Missense_Mutation_p.A200V|NCR2_ENST00000373083.4_Missense_Mutation_p.A188V	NM_004828.3	NP_004819.2	O95944	NCTR2_HUMAN	natural cytotoxicity triggering receptor 2	188					cellular defense response (GO:0006968)|innate immune response (GO:0045087)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|urinary_tract(1)	14	Ovarian(28;0.0327)|Colorectal(47;0.196)					CCTGGCCCTGCAGCCCCCATT	0.657																																																	0													134.0	122.0	126.0					6																	41309806		2203	4300	6503	SO:0001583	missense	0			AJ225109	CCDS4855.1, CCDS56428.1, CCDS56429.1	6p21.1	2013-01-11	2002-11-13	2002-11-15	ENSG00000096264	ENSG00000096264		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	6732	protein-coding gene	gene with protein product		604531	"""lymphocyte antigen 95 (activating NK-receptor; NK-p44)"""	LY95		10049942	Standard	NM_004828		Approved	NK-p44, CD336	uc003oqh.2	O95944	OTTHUMG00000014678	ENST00000373089.5:c.563C>T	6.37:g.41309806C>T	ENSP00000362181:p.Ala188Val		Q9H562|Q9H563|Q9H564|Q9UMT1|Q9UMT2	Missense_Mutation	SNP	pfam_Ig_V-set,smart_Ig_sub,pfscan_Ig-like_dom	p.A188V	ENST00000373089.5	37	c.563	CCDS4855.1	6	.	.	.	.	.	.	.	.	.	.	C	12.75	2.031969	0.35893	.	.	ENSG00000096264	ENST00000373083;ENST00000373089;ENST00000373086	T;T;T	0.15139	2.61;2.76;2.45	1.88	-1.7	0.08159	.	.	.	.	.	T	0.07324	0.0185	L	0.29908	0.895	0.09310	N	1	D;D;P	0.54207	0.965;0.965;0.941	P;P;P	0.55615	0.78;0.702;0.607	T	0.11251	-1.0595	9	0.59425	D	0.04	.	2.9556	0.05875	0.4578:0.3804:0.0:0.1618	.	188;200;188	O95944-3;O95944-2;O95944	.;.;NCTR2_HUMAN	V	188;188;200	ENSP00000362175:A188V;ENSP00000362181:A188V;ENSP00000362178:A200V	ENSP00000362175:A188V	A	+	2	0	NCR2	41417784	0.000000	0.05858	0.018000	0.16275	0.063000	0.16089	-0.046000	0.11983	-0.480000	0.06803	-0.518000	0.04402	GCA	NCR2	-	NULL	ENSG00000096264		0.657	NCR2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NCR2	HGNC	protein_coding	OTTHUMT00000040511.3		0.00	36	0	C			41309806	+1			no_errors	ENST00000373089	ensembl	human	known	74_37	missense	18.75	13	3	SNP	0.019	T
NDUFC2	4718	genome.wustl.edu	37	11	77784146	77784147	+	Frame_Shift_Ins	INS	-	-	A			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr11:77784146_77784147insA	ENST00000281031.4	-	2	681_682	c.207_208insT	c.(205-210)tttgctfs	p.A70fs	NDUFC2_ENST00000528164.1_Frame_Shift_Ins_p.A70fs|NDUFC2_ENST00000527806.1_Frame_Shift_Ins_p.A70fs|NDUFC2_ENST00000534029.1_Intron|NDUFC2_ENST00000525085.1_Intron|NDUFC2-KCTD14_ENST00000528251.1_Intron|NDUFC2-KCTD14_ENST00000530054.1_Frame_Shift_Ins_p.A70fs	NM_001204055.1|NM_004549.5	NP_001190984.1|NP_004540.1	O95298	NDUC2_HUMAN	NADH dehydrogenase (ubiquinone) 1, subcomplex unknown, 2, 14.5kDa	70					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)	p.F69fs*7(1)		large_intestine(1)|lung(2)|prostate(1)	4	all_cancers(14;2.23e-19)|all_epithelial(13;7.49e-22)|Breast(9;6.38e-17)|Ovarian(111;0.152)		OV - Ovarian serous cystadenocarcinoma(8;2.15e-25)		Carvedilol(DB01136)	TAATATCCAGCAAAAAAAAAGG	0.356																																																	1	Deletion - Frameshift(1)	large_intestine(1)																																								SO:0001589	frameshift_variant	0			AF087659	CCDS8257.1, CCDS55779.1, CCDS55781.1	11q14.1	2011-07-04	2002-08-29		ENSG00000151366	ENSG00000151366		"""Mitochondrial respiratory chain complex / Complex I"""	7706	protein-coding gene	gene with protein product	"""human lung cancer oncogene 1"", ""complex I subunit B14.5b"""	603845	"""NADH dehydrogenase (ubiquinone) 1, subcomplex unknown, 2 (14.5kD, B14.5b)"""			9878551	Standard	NM_001204055		Approved	B14.5b, HLC-1		O95298		ENST00000281031.4:c.208dupT	11.37:g.77784155_77784155dupA	ENSP00000281031:p.Ala70fs		E9PNU8|E9PRB2|Q549M5|Q6FIH8|Q9UBJ9	Frame_Shift_Ins	INS	pfam_NADH-UbQ_OxRdtase_b14.5b_su,pirsf_NADH-UbQ_OxRdtase_b14.5b_su	p.A69fs	ENST00000281031.4	37	c.208_207	CCDS8257.1	11																																																																																			NDUFC2	-	pfam_NADH-UbQ_OxRdtase_b14.5b_su,pirsf_NADH-UbQ_OxRdtase_b14.5b_su	ENSG00000151366		0.356	NDUFC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NDUFC2	HGNC	protein_coding	OTTHUMT00000390821.1		0.00	39	0	-	NM_004549		77784147	-1	tier1		no_errors	ENST00000281031	ensembl	human	known	74_37	frame_shift_ins	11.11	24	3	INS	0.050:0.809	A
NEK11	79858	genome.wustl.edu	37	3	130893611	130893611	+	Splice_Site	SNP	C	C	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr3:130893611C>T	ENST00000511262.1	+	15	1693	c.1400C>T	c.(1399-1401)gCa>gTa	p.A467V	NEK11_ENST00000510769.1_Intron|NEK11_ENST00000383366.4_Intron|NEK11_ENST00000508196.1_Intron|NEK11_ENST00000429253.2_Intron|NEK11_ENST00000510688.1_Intron|NEK11_ENST00000507910.1_Intron|NEK11_ENST00000356918.4_Intron|NEK11_ENST00000412440.2_Intron	NM_145910.3	NP_665917.1			NIMA-related kinase 11											breast(2)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(8)|lung(14)|stomach(1)|urinary_tract(2)	33						TATTTTTTAGCAACTCACAGC	0.383																																																	0													67.0	60.0	62.0					3																	130893611		1820	4075	5895	SO:0001630	splice_region_variant	0			AK027148	CCDS3069.1, CCDS46915.1, CCDS54639.1	3q22.1	2012-11-15	2012-11-15		ENSG00000114670	ENSG00000114670			18593	protein-coding gene	gene with protein product		609779	"""NIMA (never in mitosis gene a)- related kinase 11"""				Standard	NM_024800		Approved	FLJ23495	uc003eny.3	Q8NG66	OTTHUMG00000159654	ENST00000511262.1:c.1400-1C>T	3.37:g.130893611C>T				Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.A467V	ENST00000511262.1	37	c.1400	CCDS46915.1	3	.	.	.	.	.	.	.	.	.	.	C	5.201	0.222588	0.09863	.	.	ENSG00000114670	ENST00000511262	T	0.70749	-0.51	2.25	0.307	0.15811	.	.	.	.	.	T	0.47600	0.1454	.	.	.	0.09310	N	0.999998	P	0.44659	0.84	B	0.34590	0.186	T	0.36480	-0.9746	7	.	.	.	.	2.8537	0.05565	0.27:0.5657:0.0:0.1643	.	467	Q8NG66-2	.	V	467	ENSP00000425114:A467V	.	A	+	2	0	NEK11	132376301	0.000000	0.05858	0.002000	0.10522	0.075000	0.17131	-0.710000	0.05024	0.057000	0.16193	-0.263000	0.10527	GCA	NEK11	-	NULL	ENSG00000114670		0.383	NEK11-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	NEK11	HGNC	protein_coding	OTTHUMT00000356756.1	-	0.00	22	0	C	NM_024800	Missense_Mutation	130893611	+1	tier1	-	no_errors	ENST00000511262	ensembl	human	known	74_37	missense	33.33	14	7	SNP	0.002	T
NID1	4811	genome.wustl.edu	37	1	236195817	236195817	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr1:236195817C>A	ENST00000264187.6	-	6	1503	c.1421G>T	c.(1420-1422)aGc>aTc	p.S474I	NID1_ENST00000366595.3_Missense_Mutation_p.S474I	NM_002508.2	NP_002499.2	P14543	NID1_HUMAN	nidogen 1	474	Nidogen G2 beta-barrel. {ECO:0000255|PROSITE-ProRule:PRU00348}.				basement membrane organization (GO:0071711)|cell-matrix adhesion (GO:0007160)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glomerular basement membrane development (GO:0032836)|positive regulation of cell-substrate adhesion (GO:0010811)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|cell periphery (GO:0071944)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|laminin binding (GO:0043236)|proteoglycan binding (GO:0043394)			breast(4)|endometrium(9)|kidney(1)|large_intestine(23)|lung(20)|pancreas(1)|prostate(4)|skin(3)|urinary_tract(1)	66	Ovarian(103;0.0544)|Breast(184;0.23)	all_cancers(173;0.00491)|Prostate(94;0.184)|Acute lymphoblastic leukemia(190;0.229)	OV - Ovarian serous cystadenocarcinoma(106;0.00162)		Urokinase(DB00013)	GGGAATGGTGCTGATGGCTGT	0.527																																																	0													108.0	92.0	98.0					1																	236195817		2203	4300	6503	SO:0001583	missense	0			BC045606	CCDS1608.1	1q43	2011-05-08	2005-06-02	2005-06-02	ENSG00000116962	ENSG00000116962			7821	protein-coding gene	gene with protein product		131390	"""nidogen (enactin)"""	NID		2471408, 7557988	Standard	NM_002508		Approved	entactin	uc001hxo.3	P14543	OTTHUMG00000040071	ENST00000264187.6:c.1421G>T	1.37:g.236195817C>A	ENSP00000264187:p.Ser474Ile		Q14942|Q59FL2|Q5TAF2|Q5TAF3|Q86XD7	Missense_Mutation	SNP	pfam_G2_nidogen/fibulin_G2F,pfam_LDLR_classB_rpt,pfam_Nidogen_extracell_dom,pfam_Thyroglobulin_1,pfam_EGF-like_Ca-bd_dom,superfamily_GFP,superfamily_Thyroglobulin_1,smart_Nidogen_extracell_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,smart_G2_nidogen/fibulin_G2F,smart_Thyroglobulin_1,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDLR_classB_rpt,pfscan_G2_nidogen/fibulin_G2F,pfscan_Thyroglobulin_1	p.S474I	ENST00000264187.6	37	c.1421	CCDS1608.1	1	.	.	.	.	.	.	.	.	.	.	C	33	5.215414	0.95104	.	.	ENSG00000116962	ENST00000264187;ENST00000366595	T;T	0.28454	1.61;1.61	5.87	5.87	0.94306	G2 nidogen/fibulin G2F (3);Green fluorescent protein-like (1);	0.074859	0.85682	D	0.000000	T	0.65386	0.2686	M	0.88775	2.98	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.70428	-0.4874	10	0.87932	D	0	.	20.2192	0.98319	0.0:1.0:0.0:0.0	.	474;474	P14543-2;P14543	.;NID1_HUMAN	I	474	ENSP00000264187:S474I;ENSP00000355554:S474I	ENSP00000264187:S474I	S	-	2	0	NID1	234262440	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.487000	0.81328	2.780000	0.95670	0.655000	0.94253	AGC	NID1	-	pfam_G2_nidogen/fibulin_G2F,superfamily_GFP,smart_G2_nidogen/fibulin_G2F,pfscan_G2_nidogen/fibulin_G2F	ENSG00000116962		0.527	NID1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NID1	HGNC	protein_coding	OTTHUMT00000096647.2		0.00	30	0	C	NM_002508		236195817	-1			no_errors	ENST00000264187	ensembl	human	known	74_37	missense	15.38	11	2	SNP	1.000	A
NLRC4	58484	genome.wustl.edu	37	2	32477679	32477679	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr2:32477679G>T	ENST00000404025.2	-	4	559	c.71C>A	c.(70-72)aCa>aAa	p.T24K	NLRC4_ENST00000342905.6_Missense_Mutation_p.T24K|NLRC4_ENST00000402280.1_Missense_Mutation_p.T24K|NLRC4_ENST00000360906.5_Missense_Mutation_p.T24K			Q9NPP4	NLRC4_HUMAN	NLR family, CARD domain containing 4	24	CARD. {ECO:0000255|PROSITE- ProRule:PRU00046}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of innate immune response (GO:0002218)|defense response to bacterium (GO:0042742)|detection of bacterium (GO:0016045)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interleukin-1 beta secretion (GO:0050702)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of apoptotic process (GO:0043065)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein homooligomerization (GO:0051260)|pyroptosis (GO:0070269)	cytosol (GO:0005829)|intracellular (GO:0005622)|IPAF inflammasome complex (GO:0072557)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|magnesium ion binding (GO:0000287)|protein homodimerization activity (GO:0042803)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(1)|ovary(3)|skin(2)|stomach(2)	16	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.208)					TAGGTCATCTGTGATTTGCTT	0.398																																																	0													126.0	116.0	119.0					2																	32477679		2203	4300	6503	SO:0001583	missense	0			AF376061	CCDS33174.1	2p22-p21	2008-08-27	2006-12-08	2006-12-08	ENSG00000091106	ENSG00000091106		"""Nucleotide-binding domain and leucine rich repeat containing"""	16412	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 4"", ""NOD-like receptor C4"""	606831	"""caspase recruitment domain family, member 12"""	CARD12		11374873	Standard	NM_021209		Approved	CLAN1, ipaf, CLANA, CLANB, CLANC, CLAND, CLR2.1, CLAN	uc021vfq.1	Q9NPP4	OTTHUMG00000152107	ENST00000404025.2:c.71C>A	2.37:g.32477679G>T	ENSP00000385090:p.Thr24Lys		A8K9F8|B2RBQ3|B3KTF0|D6W580|Q96J81|Q96J82|Q96J83	Missense_Mutation	SNP	pfam_CARD,superfamily_DEATH-like_dom,superfamily_P-loop_NTPase,pfscan_NACHT_NTPase,pfscan_CARD	p.T24K	ENST00000404025.2	37	c.71	CCDS33174.1	2	.	.	.	.	.	.	.	.	.	.	G	5.097	0.203619	0.09704	.	.	ENSG00000091106	ENST00000360906;ENST00000402280;ENST00000342905;ENST00000404025	T;T;T;T	0.23348	1.91;1.91;1.91;1.91	4.16	-4.65	0.03339	DEATH-like (2);Caspase Recruitment (2);	3.088290	0.01633	N	0.023644	T	0.14184	0.0343	N	0.19112	0.55	0.25465	N	0.987882	B;B	0.23128	0.065;0.08	B;B	0.22601	0.024;0.04	T	0.13388	-1.0511	9	0.27082	T	0.32	2.7074	3.8149	0.08811	0.2118:0.1511:0.4978:0.1393	.	24;24	Q9NPP4-2;Q9NPP4	.;NLRC4_HUMAN	K	24	ENSP00000354159:T24K;ENSP00000385428:T24K;ENSP00000339666:T24K;ENSP00000385090:T24K	ENSP00000339666:T24K	T	-	2	0	NLRC4	32331183	0.000000	0.05858	0.003000	0.11579	0.001000	0.01503	-0.242000	0.08928	-0.572000	0.06006	-0.474000	0.04947	ACA	NLRC4	-	pfam_CARD,superfamily_DEATH-like_dom,pfscan_CARD	ENSG00000091106		0.398	NLRC4-001	KNOWN	non_canonical_other|basic|appris_principal|CCDS	protein_coding	NLRC4	HGNC	protein_coding	OTTHUMT00000325222.2	-	0.00	56	0	G	NM_021209		32477679	-1	tier1	-	no_errors	ENST00000360906	ensembl	human	known	74_37	missense	52.94	8	9	SNP	0.001	T
NLRP14	338323	genome.wustl.edu	37	11	7067930	7067930	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr11:7067930G>T	ENST00000299481.4	+	5	2336	c.1990G>T	c.(1990-1992)Gat>Tat	p.D664Y		NM_176822.3	NP_789792.1	Q86W24	NAL14_HUMAN	NLR family, pyrin domain containing 14	664					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)		ATP binding (GO:0005524)			breast(3)|large_intestine(7)|lung(1)|ovary(3)|pancreas(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	21				Epithelial(150;4.62e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0871)		CTGTTGGCAAGATCTCTGTTC	0.383																																																	0													251.0	214.0	227.0					11																	7067930		2201	4296	6497	SO:0001583	missense	0			BK001107	CCDS7776.1	11p15.4	2006-12-08	2006-12-08	2006-12-08		ENSG00000158077		"""Nucleotide-binding domain and leucine rich repeat containing"""	22939	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 14"""	609665	"""NACHT, leucine rich repeat and PYD containing 14"""	NALP14		12563287	Standard	NM_176822		Approved	NOD5, GC-LRR, Nalp-iota, PAN8, CLR11.2	uc001mfb.1	Q86W24		ENST00000299481.4:c.1990G>T	11.37:g.7067930G>T	ENSP00000299481:p.Asp664Tyr		Q7RTR6	Missense_Mutation	SNP	pfam_DAPIN,superfamily_DEATH-like_dom,superfamily_P-loop_NTPase,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,pfscan_DAPIN	p.D664Y	ENST00000299481.4	37	c.1990	CCDS7776.1	11	.	.	.	.	.	.	.	.	.	.	G	15.33	2.802526	0.50315	.	.	ENSG00000158077	ENST00000299481	D	0.91464	-2.85	4.52	2.26	0.28386	.	0.300651	0.24094	N	0.041617	D	0.93012	0.7776	M	0.70275	2.135	0.35232	D	0.777044	D	0.89917	1.0	D	0.67231	0.95	D	0.93163	0.6559	10	0.72032	D	0.01	.	7.9418	0.29963	0.1525:0.0:0.8475:0.0	.	664	Q86W24	NAL14_HUMAN	Y	664	ENSP00000299481:D664Y	ENSP00000299481:D664Y	D	+	1	0	NLRP14	7024506	0.999000	0.42202	0.984000	0.44739	0.854000	0.48673	1.117000	0.31234	0.435000	0.26365	0.585000	0.79938	GAT	NLRP14	-	NULL	ENSG00000158077		0.383	NLRP14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NLRP14	HGNC	protein_coding	OTTHUMT00000384551.1		0.00	63	0	G	NM_176822		7067930	+1			no_errors	ENST00000299481	ensembl	human	known	74_37	missense	10.53	17	2	SNP	0.953	T
NOP16	51491	genome.wustl.edu	37	5	175813854	175813854	+	Silent	SNP	G	G	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr5:175813854G>T	ENST00000389158.5	-	3	708	c.273C>A	c.(271-273)ccC>ccA	p.P91P	HIGD2A_ENST00000274787.2_5'Flank|NOP16_ENST00000507413.1_Intron|NOP16_ENST00000509257.1_Silent_p.P91P|NOP16_ENST00000510123.1_Silent_p.P91P			Q9Y3C1	NOP16_HUMAN	NOP16 nucleolar protein	91						intracellular membrane-bounded organelle (GO:0043231)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|endometrium(2)|lung(4)|ovary(1)	8						TCAGCACATAGGGCTTCCGTA	0.512																																																	0													137.0	139.0	138.0					5																	175813854		1993	4163	6156	SO:0001819	synonymous_variant	0				CCDS43403.1, CCDS58991.1	5q35.2	2012-12-10	2012-12-10		ENSG00000048162	ENSG00000048162			26934	protein-coding gene	gene with protein product	"""hypothetical protein HSPC111"", ""HBV pre-S2 trans-regulated protein 3"""	612861	"""nucleolar protein 16 homolog (yeast)"", ""NOP16 nucleolar protein homolog (yeast)"""			10810093, 11042152	Standard	NM_001291308		Approved	HSPC111, HSPC185, LOC51491	uc003mee.4	Q9Y3C1	OTTHUMG00000163186	ENST00000389158.5:c.273C>A	5.37:g.175813854G>T			B4DV13|D6RGD3|Q05D05|Q6IAI6|Q8IXL5	Silent	SNP	pfam_Ribosome_biogenesis_Nop16	p.P91	ENST00000389158.5	37	c.273	CCDS43403.1	5																																																																																			NOP16	-	pfam_Ribosome_biogenesis_Nop16	ENSG00000048162		0.512	NOP16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOP16	HGNC	protein_coding	OTTHUMT00000371963.1	-	0.00	46	0	G	NM_016391		175813854	-1	tier1	-	no_errors	ENST00000389158	ensembl	human	known	74_37	silent	11.11	32	4	SNP	0.997	T
NOP56	10528	genome.wustl.edu	37	20	2638861	2638861	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr20:2638861G>T	ENST00000329276.5	+	12	2222	c.1706G>T	c.(1705-1707)aGc>aTc	p.S569I	SNORD86_ENST00000391196.1_RNA|SNORD57_ENST00000448188.1_RNA|SNORD56_ENST00000413522.1_RNA|IDH3B_ENST00000488299.1_5'Flank|NOP56_ENST00000492135.1_3'UTR	NM_006392.3	NP_006383.2	O00567	NOP56_HUMAN	NOP56 ribonucleoprotein	569	Lys-rich.				cell death (GO:0008219)|rRNA processing (GO:0006364)	box C/D snoRNP complex (GO:0031428)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|pre-snoRNP complex (GO:0070761)|small nucleolar ribonucleoprotein complex (GO:0005732)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|snoRNA binding (GO:0030515)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(6)|ovary(2)|pancreas(1)|skin(2)|urinary_tract(1)	25						GAGCCGGTCAGCAGTGGGCCT	0.488																																																	0													9.0	11.0	11.0					20																	2638861		2168	4269	6437	SO:0001583	missense	0			Y12065	CCDS13030.1	20p13	2012-12-10	2012-12-10	2009-01-13	ENSG00000101361	ENSG00000101361			15911	protein-coding gene	gene with protein product	"""spinocerebellar ataxia 36"""	614154	"""nucleolar protein 5A (56kD with KKE/D repeat)"", ""nucleolar protein 5A (56kDa with KKE/D repeat)"", ""NOP56 ribonucleoprotein homolog (yeast)"""	NOL5A		9372940, 21683323	Standard	NR_027700		Approved	SCA36	uc002wgh.3	O00567	OTTHUMG00000031703	ENST00000329276.5:c.1706G>T	20.37:g.2638861G>T	ENSP00000370589:p.Ser569Ile		Q2M3T6|Q9NQ05	Missense_Mutation	SNP	pfam_Nop_dom,pfam_NOSIC,pfam_NOP5_N,smart_NOSIC	p.S569I	ENST00000329276.5	37	c.1706	CCDS13030.1	20	.	.	.	.	.	.	.	.	.	.	G	8.926	0.962210	0.18583	.	.	ENSG00000101361	ENST00000329276	T	0.58652	0.32	4.81	3.87	0.44632	.	0.544875	0.21889	N	0.067608	T	0.40932	0.1137	N	0.19112	0.55	0.25624	N	0.986368	P	0.36733	0.567	B	0.36608	0.229	T	0.38067	-0.9678	10	0.87932	D	0	-9.3594	8.8878	0.35414	0.1005:0.0:0.8995:0.0	.	569	O00567	NOP56_HUMAN	I	569	ENSP00000370589:S569I	ENSP00000370589:S569I	S	+	2	0	NOP56	2586861	1.000000	0.71417	0.877000	0.34402	0.012000	0.07955	3.700000	0.54786	1.266000	0.44231	-0.147000	0.13772	AGC	NOP56	-	NULL	ENSG00000101361		0.488	NOP56-009	KNOWN	basic|appris_principal|CCDS	protein_coding	NOP56	HGNC	protein_coding	OTTHUMT00000077631.2		0.00	48	0	G	NM_006392		2638861	+1			no_errors	ENST00000329276	ensembl	human	known	74_37	missense	15.79	16	3	SNP	0.977	T
NR5A2	2494	genome.wustl.edu	37	1	200017357	200017357	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr1:200017357G>C	ENST00000367362.3	+	5	767	c.521G>C	c.(520-522)aGa>aCa	p.R174T	NR5A2_ENST00000236914.3_Missense_Mutation_p.R128T|NR5A2_ENST00000544748.1_Missense_Mutation_p.R102T	NM_001276464.1|NM_205860.1	NP_001263393.1|NP_995582.1	O00482	NR5A2_HUMAN	nuclear receptor subfamily 5, group A, member 2	174					bile acid metabolic process (GO:0008206)|cholesterol homeostasis (GO:0042632)|embryo development (GO:0009790)|endocrine pancreas development (GO:0031018)|gene expression (GO:0010467)|homeostatic process (GO:0042592)|intracellular receptor signaling pathway (GO:0030522)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of viral genome replication (GO:0045070)|regulation of cell proliferation (GO:0042127)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|phospholipid binding (GO:0005543)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(1)|kidney(3)|large_intestine(6)|lung(15)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	31	Prostate(682;0.19)					ATGTACAAGAGAGACAGGGCC	0.522																																					Melanoma(179;1138 2773 15678 26136)												0													116.0	112.0	113.0					1																	200017357		2203	4300	6503	SO:0001583	missense	0			U93553	CCDS1400.1, CCDS1401.1, CCDS60383.1	1q32.11	2013-01-16			ENSG00000116833	ENSG00000116833		"""Nuclear hormone receptors"""	7984	protein-coding gene	gene with protein product	"""liver receptor homolog-1"""	604453		FTF		9858833, 7680097	Standard	NM_205860		Approved	FTZ-F1beta, hB1F, LRH-1, FTZ-F1, hB1F-2, B1F2	uc001gvb.4	O00482	OTTHUMG00000035635	ENST00000367362.3:c.521G>C	1.37:g.200017357G>C	ENSP00000356331:p.Arg174Thr		B4E2P3|O95642|Q147U3	Missense_Mutation	SNP	pfam_Nucl_hrmn_rcpt_lig-bd_core,pfam_Znf_hrmn_rcpt,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pirsf_Steroidogenic_factor_1,pfscan_Znf_hrmn_rcpt,prints_Str_hrmn_rcpt,prints_Znf_hrmn_rcpt	p.R174T	ENST00000367362.3	37	c.521	CCDS1401.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	28.0|28.0	4.882567|4.882567	0.91740|0.91740	.|.	.|.	ENSG00000116833|ENSG00000116833	ENST00000367357|ENST00000367362;ENST00000236914;ENST00000544748;ENST00000235480	.|D;D;D	.|0.94862	.|-3.5;-3.54;-3.52	5.76|5.76	5.76|5.76	0.90799|0.90799	.|Zinc finger, NHR/GATA-type (1);Nuclear hormone receptor, ligand-binding (1);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.97090|0.97090	0.9049|0.9049	M|M	0.78049|0.78049	2.395|2.395	0.80722|0.80722	D|D	1|1	.|D;P	.|0.57257	.|0.979;0.956	.|D;P	.|0.64687	.|0.928;0.903	D|D	0.96248|0.96248	0.9181|0.9181	5|9	.|.	.|.	.|.	.|.	20.3316|20.3316	0.98722|0.98722	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|128;174	.|F1D8R9;O00482	.|.;NR5A2_HUMAN	Q|T	95|174;128;102;94	.|ENSP00000356331:R174T;ENSP00000236914:R128T;ENSP00000439116:R102T	.|.	E|R	+|+	1|2	0|0	NR5A2|NR5A2	198283980|198283980	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	9.747000|9.747000	0.98863|0.98863	2.871000|2.871000	0.98454|0.98454	0.655000|0.655000	0.94253|0.94253	GAG|AGA	NR5A2	-	superfamily_Nucl_hormone_rcpt_ligand-bd,pirsf_Steroidogenic_factor_1	ENSG00000116833		0.522	NR5A2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NR5A2	HGNC	protein_coding	OTTHUMT00000086497.2		0.00	38	0	G			200017357	+1			no_errors	ENST00000367362	ensembl	human	known	74_37	missense	7.69	24	2	SNP	1.000	C
NRXN2	9379	genome.wustl.edu	37	11	64402742	64402742	+	Splice_Site	SNP	C	C	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr11:64402742C>T	ENST00000377551.1	-	17	3797		c.e17+1		NRXN2_ENST00000377559.3_Splice_Site|NRXN2_ENST00000409571.1_Splice_Site|NRXN2_ENST00000301894.2_Splice_Site|NRXN2_ENST00000265459.6_Splice_Site			Q9P2S2	NRX2A_HUMAN	neurexin 2						adult behavior (GO:0030534)|gephyrin clustering (GO:0097116)|neuroligin clustering (GO:0097118)|neuron cell-cell adhesion (GO:0007158)|neurotransmitter secretion (GO:0007269)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	integral component of membrane (GO:0016021)	calcium channel regulator activity (GO:0005246)|cell adhesion molecule binding (GO:0050839)|metal ion binding (GO:0046872)|neuroligin family protein binding (GO:0097109)			breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|liver(1)|lung(34)|ovary(6)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(6)|urinary_tract(1)	71						AGGGTCCTTACGATGTGCAGC	0.622																																																	0													46.0	44.0	45.0					11																	64402742		2197	4288	6485	SO:0001630	splice_region_variant	0				CCDS8077.1, CCDS31597.1, CCDS8078.1	11q13	2008-07-18			ENSG00000110076	ENSG00000110076			8009	protein-coding gene	gene with protein product	"""neurexin II"""	600566				1621094	Standard	NM_015080		Approved		uc021qkw.1	P58401	OTTHUMG00000045214	ENST00000377551.1:c.3585+1G>A	11.37:g.64402742C>T			A7E2C1|Q9Y2D6	Splice_Site	SNP	-	e17+1	ENST00000377551.1	37	c.3585+1	CCDS8077.1	11	.	.	.	.	.	.	.	.	.	.	C	20.9	4.058609	0.76074	.	.	ENSG00000110076	ENST00000301894;ENST00000377551;ENST00000377559;ENST00000265459;ENST00000345863;ENST00000409571;ENST00000423049	.	.	.	4.63	4.63	0.57726	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.3528	0.74402	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	NRXN2	64159318	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	7.728000	0.84847	2.290000	0.77057	0.561000	0.74099	.	NRXN2	-	-	ENSG00000110076		0.622	NRXN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NRXN2	HGNC	protein_coding	OTTHUMT00000104967.3	-	0.00	40	0	C	NM_015080	Intron	64402742	-1	tier1	-	no_errors	ENST00000265459	ensembl	human	known	74_37	splice_site	15.38	22	4	SNP	1.000	T
TSC2	7249	genome.wustl.edu	37	16	2094744	2094744	+	5'Flank	SNP	C	C	A			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr16:2094744C>A	ENST00000219476.3	+	0	0				NTHL1_ENST00000562951.1_5'Flank|NTHL1_ENST00000219066.1_Missense_Mutation_p.V146L	NM_000548.3	NP_000539.2	P49815	TSC2_HUMAN	tuberous sclerosis 2						acute-phase response (GO:0006953)|cell cycle arrest (GO:0007050)|cell projection organization (GO:0030030)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of TOR signaling (GO:0032007)|negative regulation of Wnt signaling pathway (GO:0030178)|neural tube closure (GO:0001843)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive chemotaxis (GO:0050918)|positive regulation of Ras GTPase activity (GO:0032320)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|protein import into nucleus (GO:0006606)|protein kinase B signaling (GO:0043491)|protein localization (GO:0008104)|regulation of cell cycle (GO:0051726)|regulation of endocytosis (GO:0030100)|regulation of insulin receptor signaling pathway (GO:0046626)|response to hypoxia (GO:0001666)|vesicle-mediated transport (GO:0016192)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|TSC1-TSC2 complex (GO:0033596)	GTPase activator activity (GO:0005096)|phosphatase binding (GO:0019902)|protein homodimerization activity (GO:0042803)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(4)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(3)|lung(19)|ovary(2)|pancreas(1)|prostate(2)|skin(7)|soft_tissue(1)	56		Hepatocellular(780;0.0202)				CCCGCCGTCACCTGGTCTTTG	0.657			"""D, Mis, N, F, S"""			"""hamartoma, renal cell"""			Tuberous Sclerosis																														yes	Rec		Tuberous sclerosis 2	16	16p13.3	7249	tuberous sclerosis 2 gene		"""E, O"""	0													39.0	31.0	34.0					16																	2094744		2196	4299	6495	SO:0001631	upstream_gene_variant	0	Familial Cancer Database	TS, Tuberous Sclerosis Complex, TSC, Bourneville-Pringle disease	AB014460	CCDS10458.1, CCDS45384.1, CCDS58408.1	16p13.3	2014-09-17			ENSG00000103197	ENSG00000103197			12363	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 160"""	191092		TSC4		1303246, 7558029	Standard	NM_001077183		Approved	tuberin, LAM, PPP1R160	uc002con.3	P49815	OTTHUMG00000128745		16.37:g.2094744C>A	Exception_encountered		A7E2E2|B4DIL8|B4DIQ7|B4DRN2|B7Z2B8|C9J378|O75275|Q4LE71|Q8TAZ1	Missense_Mutation	SNP	pfam_HhH-GPD_domain,pfam_HhH_motif,superfamily_DNA_glycosylase,smart_HhH-GPD_domain,smart_Endouclease3_FeS-loop_motif	p.V146L	ENST00000219476.3	37	c.436	CCDS10458.1	16	.	.	.	.	.	.	.	.	.	.	C	16.30	3.083508	0.55861	.	.	ENSG00000065057	ENST00000219066	D	0.86432	-2.12	5.44	5.44	0.79542	HhH-GPD domain (2);DNA glycosylase (2);	0.000000	0.85682	D	0.000000	D	0.88566	0.6471	M	0.64676	1.99	0.80722	D	1	P;P	0.40909	0.732;0.732	B;B	0.44278	0.445;0.445	D	0.89142	0.3517	10	0.56958	D	0.05	-26.4183	18.2317	0.89937	0.0:1.0:0.0:0.0	.	146;146	E5KTI5;P78549	.;NTHL1_HUMAN	L	146	ENSP00000219066:V146L	ENSP00000219066:V146L	V	-	1	0	NTHL1	2034745	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	5.505000	0.66981	2.561000	0.86390	0.561000	0.74099	GTG	NTHL1	-	pfam_HhH-GPD_domain,superfamily_DNA_glycosylase,smart_HhH-GPD_domain	ENSG00000065057		0.657	TSC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NTHL1	HGNC	protein_coding	OTTHUMT00000250657.2	-	0.00	105	0	C	NM_000548		2094744	-1	tier1	-	no_errors	ENST00000219066	ensembl	human	known	74_37	missense	10.20	88	10	SNP	1.000	A
NTSR1	4923	genome.wustl.edu	37	20	61341150	61341150	+	Silent	SNP	C	C	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr20:61341150C>T	ENST00000370501.3	+	1	962	c.591C>T	c.(589-591)gcC>gcT	p.A197A		NM_002531.2	NP_002522.2	P30989	NTR1_HUMAN	neurotensin receptor 1 (high affinity)	197					adult locomotory behavior (GO:0008344)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of apoptotic process (GO:0043066)|neuropeptide signaling pathway (GO:0007218)|synaptic transmission (GO:0007268)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	G-protein coupled neurotensin receptor activity (GO:0016492)|G-protein coupled receptor activity (GO:0004930)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(16)|prostate(1)|skin(3)	27	Breast(26;3.65e-08)		BRCA - Breast invasive adenocarcinoma(19;3.63e-06)			TCGCCTCGGCCCTGCTGGCGG	0.667																																					GBM(37;400 780 6403 19663 35669)												0													63.0	52.0	56.0					20																	61341150		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS13502.1	20q13	2012-08-08			ENSG00000101188	ENSG00000101188		"""GPCR / Class A : Neurotensin receptors"""	8039	protein-coding gene	gene with protein product		162651				8075503	Standard	NM_002531		Approved	NTR	uc002ydf.3	P30989	OTTHUMG00000032932	ENST00000370501.3:c.591C>T	20.37:g.61341150C>T			Q9H4H1|Q9H4T5	Silent	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_serpentine_rcpt_Srv,pfscan_GPCR_Rhodpsn_7TM,prints_NT1_rcpt,prints_GPCR_Rhodpsn,prints_NT_rcpt	p.A197	ENST00000370501.3	37	c.591	CCDS13502.1	20																																																																																			NTSR1	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_serpentine_rcpt_Srv,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000101188		0.667	NTSR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NTSR1	HGNC	protein_coding	OTTHUMT00000080061.1	-	0.00	42	0	C			61341150	+1	tier1	-	no_errors	ENST00000370501	ensembl	human	known	74_37	silent	15.56	38	7	SNP	0.855	T
NUP160	23279	genome.wustl.edu	37	11	47861421	47861421	+	Missense_Mutation	SNP	A	A	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr11:47861421A>T	ENST00000378460.2	-	4	768	c.722T>A	c.(721-723)cTt>cAt	p.L241H	NUP160_ENST00000528071.1_Missense_Mutation_p.L127H|NUP160_ENST00000532747.1_Intron|NUP160_ENST00000530326.1_Missense_Mutation_p.L127H|NUP160_ENST00000526870.1_3'UTR	NM_015231.1	NP_056046.1	Q12769	NU160_HUMAN	nucleoporin 160kDa	241					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA export from nucleus (GO:0006406)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)|nuclear pore outer ring (GO:0031080)	nucleocytoplasmic transporter activity (GO:0005487)			NS(1)|biliary_tract(2)|breast(7)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(8)|lung(15)|ovary(6)|prostate(2)|skin(2)|urinary_tract(2)	53						AGGTAGCTTAAGAACAAAGAT	0.453																																																	0													167.0	161.0	163.0					11																	47861421		2201	4298	6499	SO:0001583	missense	0			D83781	CCDS31484.1	11p11.12	2008-07-21	2002-08-29		ENSG00000030066	ENSG00000030066			18017	protein-coding gene	gene with protein product		607614	"""nucleoporin 160kD"""			11684705	Standard	NM_015231		Approved	KIAA0197, FLJ22583	uc001ngm.3	Q12769	OTTHUMG00000166534	ENST00000378460.2:c.722T>A	11.37:g.47861421A>T	ENSP00000367721:p.Leu241His		B4DYE8|B4E2J9|Q08AD3|Q7Z5X6|Q96GB3|Q9H660	Missense_Mutation	SNP	pfam_Nucleoporin_Nup160	p.L241H	ENST00000378460.2	37	c.722	CCDS31484.1	11	.	.	.	.	.	.	.	.	.	.	A	28.9	4.959999	0.92791	.	.	ENSG00000030066	ENST00000378460;ENST00000530326;ENST00000528071	T;T;T	0.55234	0.53;0.53;0.53	5.53	5.53	0.82687	.	0.274152	0.36665	N	0.002477	T	0.63815	0.2543	L	0.46157	1.445	0.80722	D	1	D	0.56746	0.977	P	0.60609	0.877	T	0.65274	-0.6208	10	0.54805	T	0.06	.	15.6701	0.77267	1.0:0.0:0.0:0.0	.	241	Q12769	NU160_HUMAN	H	241;127;127	ENSP00000367721:L241H;ENSP00000433590:L127H;ENSP00000432367:L127H	ENSP00000367721:L241H	L	-	2	0	NUP160	47817997	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	7.966000	0.87956	2.108000	0.64289	0.533000	0.62120	CTT	NUP160	-	pfam_Nucleoporin_Nup160	ENSG00000030066		0.453	NUP160-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUP160	HGNC	protein_coding	OTTHUMT00000390239.2	-	0.00	33	0	A	NM_015231		47861421	-1	tier1	-	no_errors	ENST00000378460	ensembl	human	known	74_37	missense	10.00	36	4	SNP	1.000	T
NYAP2	57624	genome.wustl.edu	37	2	226447094	226447094	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr2:226447094G>A	ENST00000272907.6	+	4	1374	c.961G>A	c.(961-963)Gac>Aac	p.D321N	NYAP2_ENST00000409269.2_Intron	NM_020864.1	NP_065915.1	Q9P242	NYAP2_HUMAN	neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 2	321	Pro-rich.				neuron projection morphogenesis (GO:0048812)|phosphatidylinositol 3-kinase signaling (GO:0014065)												GCTGCTTTGCGACATCCCTCC	0.642																																																	0													49.0	52.0	51.0					2																	226447094		1985	4146	6131	SO:0001583	missense	0			AB040919	CCDS46529.1	2q36.3	2011-11-30	2011-11-30	2011-11-30	ENSG00000144460	ENSG00000144460			29291	protein-coding gene	gene with protein product		615478	"""KIAA1486"""	KIAA1486		10819331, 21946561	Standard	NM_020864		Approved		uc002voe.2	Q9P242	OTTHUMG00000153450	ENST00000272907.6:c.961G>A	2.37:g.226447094G>A	ENSP00000272907:p.Asp321Asn		A2RRN4|Q96NL2	Missense_Mutation	SNP	NULL	p.D321N	ENST00000272907.6	37	c.961	CCDS46529.1	2	.	.	.	.	.	.	.	.	.	.	G	22.3	4.268026	0.80469	.	.	ENSG00000144460	ENST00000272907	T	0.55930	0.49	5.84	5.84	0.93424	.	0.000000	0.85682	D	0.000000	T	0.69949	0.3168	M	0.80422	2.495	0.80722	D	1	D	0.60160	0.987	P	0.53450	0.726	T	0.73113	-0.4085	10	0.62326	D	0.03	-30.8854	20.1381	0.98040	0.0:0.0:1.0:0.0	.	321	Q9P242	K1486_HUMAN	N	321	ENSP00000272907:D321N	ENSP00000272907:D321N	D	+	1	0	KIAA1486	226155338	1.000000	0.71417	0.985000	0.45067	0.673000	0.39480	9.476000	0.97823	2.763000	0.94921	0.650000	0.86243	GAC	NYAP2	-	NULL	ENSG00000144460		0.642	NYAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NYAP2	HGNC	protein_coding	OTTHUMT00000331258.1		0.00	13	0	G	NM_020864		226447094	+1			no_errors	ENST00000272907	ensembl	human	known	74_37	missense	28.57	10	4	SNP	1.000	A
OIT3	170392	genome.wustl.edu	37	10	74684281	74684281	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr10:74684281C>T	ENST00000334011.5	+	7	1464	c.1246C>T	c.(1246-1248)Ctc>Ttc	p.L416F		NM_152635.1	NP_689848.1	Q8WWZ8	OIT3_HUMAN	oncoprotein induced transcript 3	416	ZP. {ECO:0000255|PROSITE- ProRule:PRU00375}.					nucleus (GO:0005634)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(9)|liver(2)|lung(14)|ovary(2)|prostate(1)|skin(2)	35	Prostate(51;0.0198)					TCGTGACTCCCTCTACTTTGG	0.542																																					Colon(7;19 345 13446 17537)												0													125.0	114.0	118.0					10																	74684281		2203	4300	6503	SO:0001583	missense	0				CCDS7318.1	10q22.2-q22.3	2004-04-21			ENSG00000138315	ENSG00000138315			29953	protein-coding gene	gene with protein product		609330				12975309, 12939600	Standard	NM_152635		Approved	LZP, FLJ39116	uc001jte.1	Q8WWZ8	OTTHUMG00000018444	ENST00000334011.5:c.1246C>T	10.37:g.74684281C>T	ENSP00000333900:p.Leu416Phe		A0AVP3|Q8N1M8	Missense_Mutation	SNP	pfam_ZP_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_ZP_dom,pfscan_ZP_dom,prints_ZP_dom	p.L416F	ENST00000334011.5	37	c.1246	CCDS7318.1	10	.	.	.	.	.	.	.	.	.	.	C	22.8	4.339308	0.81911	.	.	ENSG00000138315	ENST00000334011	D	0.85702	-2.02	5.5	5.5	0.81552	Zona pellucida sperm-binding protein (3);	0.000000	0.50627	D	0.000118	D	0.91274	0.7249	M	0.71036	2.16	0.58432	D	0.999999	D	0.89917	1.0	D	0.91635	0.999	D	0.91874	0.5510	10	0.87932	D	0	-31.4928	13.6568	0.62344	0.0:0.9256:0.0:0.0744	.	416	Q8WWZ8	OIT3_HUMAN	F	416	ENSP00000333900:L416F	ENSP00000333900:L416F	L	+	1	0	OIT3	74354287	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	4.711000	0.61881	2.574000	0.86865	0.563000	0.77884	CTC	OIT3	-	pfam_ZP_dom,smart_ZP_dom,pfscan_ZP_dom	ENSG00000138315		0.542	OIT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OIT3	HGNC	protein_coding	OTTHUMT00000048596.1		0.00	35	0	C	NM_152635		74684281	+1			no_errors	ENST00000334011	ensembl	human	known	74_37	missense	7.14	26	2	SNP	1.000	T
OMP	4975	genome.wustl.edu	37	11	76814112	76814112	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr11:76814112G>A	ENST00000529803.1	+	1	227	c.227G>A	c.(226-228)gGc>gAc	p.G76D	CAPN5_ENST00000456580.2_Intron|CAPN5_ENST00000278559.3_Intron|CAPN5_ENST00000531028.1_Intron|CAPN5_ENST00000529629.1_Intron	NM_006189.1	NP_006180.1	P47874	OMP_HUMAN	olfactory marker protein	76					neurogenesis (GO:0022008)|sensory perception of smell (GO:0007608)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	axon (GO:0030424)|cytoplasm (GO:0005737)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)	signal transducer activity (GO:0004871)			endometrium(1)|kidney(1)|large_intestine(2)|lung(1)	5						GACAAGCCGGGCAAGGTCACC	0.617																																																	0													55.0	66.0	62.0					11																	76814112		2183	4271	6454	SO:0001583	missense	0			U01212	CCDS53682.1	11q14-q21	2008-07-21				ENSG00000254550			8136	protein-coding gene	gene with protein product		164340				8499899	Standard	NM_006189		Approved		uc010rsk.2	P47874		ENST00000529803.1:c.227G>A	11.37:g.76814112G>A	ENSP00000436376:p.Gly76Asp		Q562G2	Missense_Mutation	SNP	pfam_Olfactory_marker,superfamily_Olfactory_marker	p.G76D	ENST00000529803.1	37	c.227	CCDS53682.1	11	.	.	.	.	.	.	.	.	.	.	G	22.8	4.335860	0.81801	.	.	ENSG00000254550	ENST00000529803	T	0.58358	0.34	5.81	5.81	0.92471	.	.	.	.	.	T	0.65471	0.2694	L	0.34521	1.04	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.67031	-0.5773	9	0.87932	D	0	.	19.0668	0.93114	0.0:0.0:1.0:0.0	.	76	P47874	OMP_HUMAN	D	76	ENSP00000436376:G76D	ENSP00000436376:G76D	G	+	2	0	OMP	76491760	1.000000	0.71417	1.000000	0.80357	0.535000	0.34838	9.405000	0.97313	2.757000	0.94681	0.462000	0.41574	GGC	OMP	-	pfam_Olfactory_marker,superfamily_Olfactory_marker	ENSG00000254550		0.617	OMP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OMP	HGNC	protein_coding	OTTHUMT00000382570.1	-	0.00	44	0	G	NM_006189		76814112	+1	tier1	-	no_errors	ENST00000529803	ensembl	human	known	74_37	missense	31.58	26	12	SNP	1.000	A
OR1N1	138883	genome.wustl.edu	37	9	125289266	125289266	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr9:125289266G>C	ENST00000304880.2	-	1	306	c.307C>G	c.(307-309)Ctg>Gtg	p.L103V		NM_012363.1	NP_036495.1	Q8NGS0	OR1N1_HUMAN	olfactory receptor, family 1, subfamily N, member 1	103						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|central_nervous_system(1)|large_intestine(2)|lung(6)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	15						CCAAACATCAGAAAGAAATAC	0.507																																																	0													91.0	88.0	89.0					9																	125289266		2203	4300	6503	SO:0001583	missense	0			U86216	CCDS6844.1	9q34.11	2012-08-09			ENSG00000171505	ENSG00000171505		"""GPCR / Class A : Olfactory receptors"""	8221	protein-coding gene	gene with protein product				OR1N3		9500546	Standard	NM_012363		Approved	OR1-26	uc004bmn.1	Q8NGS0	OTTHUMG00000020608	ENST00000304880.2:c.307C>G	9.37:g.125289266G>C	ENSP00000306974:p.Leu103Val		A3KFM1|O43870|Q6IF16|Q96R93	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L103V	ENST00000304880.2	37	c.307	CCDS6844.1	9	.	.	.	.	.	.	.	.	.	.	G	16.74	3.208206	0.58343	.	.	ENSG00000171505	ENST00000304880	T	0.00538	6.71	3.75	0.369	0.16151	GPCR, rhodopsin-like superfamily (1);	0.289193	0.18339	U	0.144259	T	0.00440	0.0014	N	0.16862	0.45	0.09310	N	1	D	0.54207	0.965	P	0.47118	0.538	T	0.58702	-0.7590	10	0.44086	T	0.13	.	6.8292	0.23900	0.0:0.2661:0.296:0.4379	.	103	Q8NGS0	OR1N1_HUMAN	V	103	ENSP00000306974:L103V	ENSP00000306974:L103V	L	-	1	2	OR1N1	124329087	0.000000	0.05858	0.035000	0.18076	0.992000	0.81027	-5.879000	0.00093	0.235000	0.21160	0.545000	0.68477	CTG	OR1N1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000171505		0.507	OR1N1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR1N1	HGNC	protein_coding	OTTHUMT00000053938.1		0.00	35	0	G			125289266	-1			no_errors	ENST00000304880	ensembl	human	known	74_37	missense	8.00	23	2	SNP	0.000	C
OR1B1	347169	genome.wustl.edu	37	9	125391809	125391809	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr9:125391809C>T	ENST00000304833.3	-	1	43	c.6G>A	c.(4-6)atG>atA	p.M2I	RP11-64P14.7_ENST00000431442.1_RNA|RP11-64P14.7_ENST00000419604.1_RNA	NM_001004450.1	NP_001004450.1	Q8NGR6	OR1B1_HUMAN	olfactory receptor, family 1, subfamily B, member 1	2						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(6)|prostate(1)	16						GGGCAAAGCTCATCATGAGTG	0.428																																																	0													70.0	72.0	72.0					9																	125391809		2195	4278	6473	SO:0001583	missense	0			AC006313	CCDS35126.1	9q33.2	2012-08-09			ENSG00000171484	ENSG00000171484		"""GPCR / Class A : Olfactory receptors"""	8181	protein-coding gene	gene with protein product							Standard	NM_001004450		Approved	OR9-B	uc011lyz.2	Q8NGR6	OTTHUMG00000020616	ENST00000304833.3:c.6G>A	9.37:g.125391809C>T	ENSP00000303151:p.Met2Ile		Q6IFN3	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.M2I	ENST00000304833.3	37	c.6	CCDS35126.1	9	.	.	.	.	.	.	.	.	.	.	C	12.65	2.001622	0.35320	.	.	ENSG00000171484	ENST00000304833	T	0.00352	7.96	4.59	2.71	0.32032	.	0.145674	0.31370	N	0.007766	T	0.00178	0.0005	L	0.27053	0.805	0.21020	N	0.999806	B	0.02656	0.0	B	0.04013	0.001	T	0.42699	-0.9436	10	0.62326	D	0.03	-3.3678	6.7177	0.23312	0.0:0.7225:0.1786:0.0988	.	2	Q8NGR6	OR1B1_HUMAN	I	2	ENSP00000303151:M2I	ENSP00000303151:M2I	M	-	3	0	OR1B1	124431630	0.223000	0.23663	0.308000	0.25141	0.131000	0.20780	1.121000	0.31283	0.463000	0.27118	-0.226000	0.12346	ATG	OR1B1	-	NULL	ENSG00000171484		0.428	OR1B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR1B1	HGNC	protein_coding	OTTHUMT00000053947.2		0.00	14	0	C	NM_001004450		125391809	-1			no_errors	ENST00000304833	ensembl	human	known	74_37	missense	16.67	15	3	SNP	0.752	T
OR51G1	79324	genome.wustl.edu	37	11	4945468	4945468	+	Silent	SNP	G	G	A			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr11:4945468G>A	ENST00000321961.2	-	1	169	c.102C>T	c.(100-102)tgC>tgT	p.C34C	MMP26_ENST00000380390.1_Intron|MMP26_ENST00000477339.1_Intron	NM_001005237.1	NP_001005237.1	Q8NGK1	O51G1_HUMAN	olfactory receptor, family 51, subfamily G, member 1	34						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(1)|large_intestine(2)|lung(11)|ovary(2)|prostate(3)|skin(4)|soft_tissue(1)	25		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;2.58e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0284)|LUSC - Lung squamous cell carcinoma(625;0.19)		GGTAGATGAAGCAGAAGGGAA	0.478																																																	0													96.0	78.0	84.0					11																	4945468		2201	4298	6499	SO:0001819	synonymous_variant	0			AB065793	CCDS31366.1	11p15.4	2012-08-09			ENSG00000176879	ENSG00000176879		"""GPCR / Class A : Olfactory receptors"""	14738	protein-coding gene	gene with protein product				OR51G3P			Standard	NM_001005237		Approved		uc010qyr.2	Q8NGK1	OTTHUMG00000066532	ENST00000321961.2:c.102C>T	11.37:g.4945468G>A			B9EGW8|Q6IFH6	Silent	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.C34	ENST00000321961.2	37	c.102	CCDS31366.1	11																																																																																			OR51G1	-	prints_GPCR_Rhodpsn	ENSG00000176879		0.478	OR51G1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR51G1	HGNC	protein_coding	OTTHUMT00000142345.1	-	0.00	49	0	G	NM_001005237		4945468	-1	tier1	-	no_errors	ENST00000321961	ensembl	human	known	74_37	silent	50.00	9	9	SNP	0.550	A
OR52J3	119679	genome.wustl.edu	37	11	5068158	5068158	+	Missense_Mutation	SNP	G	G	A	rs143834741		TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr11:5068158G>A	ENST00000380370.1	+	1	403	c.403G>A	c.(403-405)Gca>Aca	p.A135T		NM_001001916.2	NP_001001916.2	Q8NH60	O52J3_HUMAN	olfactory receptor, family 52, subfamily J, member 3	135						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(1)|kidney(6)|large_intestine(6)|lung(19)|ovary(1)|skin(2)	36		Medulloblastoma(188;0.00131)|all_neural(188;0.0189)|Breast(177;0.0204)		Epithelial(150;9.29e-10)|BRCA - Breast invasive adenocarcinoma(625;0.135)|LUSC - Lung squamous cell carcinoma(625;0.19)		ACTACATTACGCAACCATCTT	0.483																																																	0								G	THR/ALA	0,4402		0,0,2201	183.0	118.0	140.0		403	1.8	0.1	11	dbSNP_134	140	2,8594	2.2+/-6.3	0,2,4296	no	missense	OR52J3	NM_001001916.2	58	0,2,6497	AA,AG,GG		0.0233,0.0,0.0154	benign	135/312	5068158	2,12996	2201	4298	6499	SO:0001583	missense	0			AB065530	CCDS31370.1	11p15.4	2012-08-09			ENSG00000205495	ENSG00000205495		"""GPCR / Class A : Olfactory receptors"""	14799	protein-coding gene	gene with protein product							Standard	NM_001001916		Approved		uc010qyv.2	Q8NH60	OTTHUMG00000066600	ENST00000380370.1:c.403G>A	11.37:g.5068158G>A	ENSP00000369728:p.Ala135Thr		Q6IFE4	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.A135T	ENST00000380370.1	37	c.403	CCDS31370.1	11	.	.	.	.	.	.	.	.	.	.	G	0	-2.670198	0.00105	0.0	2.33E-4	ENSG00000205495	ENST00000380370	T	0.13901	2.55	4.19	1.81	0.25067	GPCR, rhodopsin-like superfamily (1);	0.621539	0.14166	N	0.337008	T	0.03477	0.0100	N	0.01874	-0.695	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.43750	-0.9372	10	0.02654	T	1	.	4.6817	0.12738	0.6543:0.1643:0.1814:0.0	.	135	Q8NH60	O52J3_HUMAN	T	135	ENSP00000369728:A135T	ENSP00000369728:A135T	A	+	1	0	OR52J3	5024734	0.000000	0.05858	0.053000	0.19242	0.001000	0.01503	-0.981000	0.03766	0.162000	0.19483	-0.285000	0.09966	GCA	OR52J3	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt	ENSG00000205495		0.483	OR52J3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR52J3	HGNC	protein_coding	OTTHUMT00000142807.1	-	0.00	30	0	G	NM_001001916		5068158	+1	tier1	-	no_errors	ENST00000380370	ensembl	human	known	74_37	missense	16.67	15	3	SNP	0.095	A
OR4A47	403253	genome.wustl.edu	37	11	48511187	48511187	+	Silent	SNP	C	C	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr11:48511187C>T	ENST00000446524.1	+	1	919	c.843C>T	c.(841-843)aaC>aaT	p.N281N		NM_001005512.2	NP_001005512.2	Q6IF82	O4A47_HUMAN	olfactory receptor, family 4, subfamily A, member 47	281						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(2)|endometrium(1)|kidney(1)|large_intestine(2)|lung(18)|ovary(1)|skin(1)|urinary_tract(2)	29						CAATGCTGAACCCCTTAATCT	0.403																																																	0													147.0	143.0	144.0					11																	48511187		2201	4295	6496	SO:0001819	synonymous_variant	0			BK004380	CCDS31490.1	11p11.2	2012-08-09			ENSG00000237388	ENSG00000237388		"""GPCR / Class A : Olfactory receptors"""	31266	protein-coding gene	gene with protein product							Standard	NM_001005512		Approved		uc010rhx.2	Q6IF82	OTTHUMG00000166581	ENST00000446524.1:c.843C>T	11.37:g.48511187C>T				Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.N281	ENST00000446524.1	37	c.843	CCDS31490.1	11																																																																																			OR4A47	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	ENSG00000237388		0.403	OR4A47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4A47	HGNC	protein_coding	OTTHUMT00000390559.1	-	0.00	63	0	C	NM_001005512		48511187	+1	tier1	-	no_errors	ENST00000446524	ensembl	human	known	74_37	silent	24.14	22	7	SNP	1.000	T
OR5I1	10798	genome.wustl.edu	37	11	55703203	55703203	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr11:55703203A>G	ENST00000301532.3	-	1	673	c.674T>C	c.(673-675)cTc>cCc	p.L225P		NM_006637.1	NP_006628.1	Q13606	OR5I1_HUMAN	olfactory receptor, family 5, subfamily I, member 1	225					signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(34)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	52						TAAGACTGAGAGAAGAATGAA	0.443																																																	0													46.0	47.0	47.0					11																	55703203		2201	4296	6497	SO:0001583	missense	0			BC069093	CCDS7949.1	11q11	2012-08-09			ENSG00000167825	ENSG00000167825		"""GPCR / Class A : Olfactory receptors"""	8347	protein-coding gene	gene with protein product		608496				9017400, 9787077	Standard	NM_006637		Approved	HSOlf1, OLF1	uc010ris.2	Q13606	OTTHUMG00000166821	ENST00000301532.3:c.674T>C	11.37:g.55703203A>G	ENSP00000301532:p.Leu225Pro		Q6IEU4	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L225P	ENST00000301532.3	37	c.674	CCDS7949.1	11	.	.	.	.	.	.	.	.	.	.	A	12.26	1.884597	0.33255	.	.	ENSG00000167825	ENST00000301532	T	0.39406	1.08	5.06	-3.69	0.04450	GPCR, rhodopsin-like superfamily (1);	0.787865	0.10766	N	0.636620	T	0.41050	0.1142	L	0.54908	1.71	0.19300	N	0.999975	P	0.46512	0.879	P	0.54210	0.745	T	0.35450	-0.9788	10	0.59425	D	0.04	.	0.4273	0.00465	0.3532:0.2516:0.1504:0.2448	.	225	Q13606	OR5I1_HUMAN	P	225	ENSP00000301532:L225P	ENSP00000301532:L225P	L	-	2	0	OR5I1	55459779	0.000000	0.05858	0.000000	0.03702	0.302000	0.27658	-1.637000	0.02015	-0.627000	0.05589	-0.353000	0.07706	CTC	OR5I1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000167825		0.443	OR5I1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5I1	HGNC	protein_coding	OTTHUMT00000391528.1		0.00	30	0	A	NM_006637		55703203	-1			no_errors	ENST00000301532	ensembl	human	known	74_37	missense	17.65	14	3	SNP	0.000	G
OR6B1	135946	genome.wustl.edu	37	7	143701170	143701170	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr7:143701170G>T	ENST00000408922.2	+	1	149	c.81G>T	c.(79-81)atG>atT	p.M27I		NM_001005281.1	NP_001005281.1	O95007	OR6B1_HUMAN	olfactory receptor, family 6, subfamily B, member 1	27						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(3)|large_intestine(3)|lung(15)|ovary(2)|skin(2)|urinary_tract(1)	27	Melanoma(164;0.0783)					GGGCAGCCATGTTTCTGATAT	0.488																																																	0													115.0	109.0	111.0					7																	143701170		2002	4187	6189	SO:0001583	missense	0				CCDS43667.1	7q33-q35	2012-08-09			ENSG00000221813	ENSG00000221813		"""GPCR / Class A : Olfactory receptors"""	8354	protein-coding gene	gene with protein product							Standard	NM_001005281		Approved	OR7-3	uc003wdt.1	O95007	OTTHUMG00000157765	ENST00000408922.2:c.81G>T	7.37:g.143701170G>T	ENSP00000386151:p.Met27Ile		A4D2G2|B9EH47|Q6IFP6|Q96R38	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.M27I	ENST00000408922.2	37	c.81	CCDS43667.1	7	.	.	.	.	.	.	.	.	.	.	G	8.684	0.905791	0.17760	.	.	ENSG00000221813	ENST00000408922	T	0.02863	4.13	5.37	-2.69	0.06022	.	0.564974	0.12909	U	0.429102	T	0.00906	0.0030	N	0.01081	-1.03	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.44892	-0.9298	10	0.72032	D	0.01	.	1.9457	0.03356	0.2916:0.3376:0.2562:0.1146	.	27	O95007	OR6B1_HUMAN	I	27	ENSP00000386151:M27I	ENSP00000386151:M27I	M	+	3	0	OR6B1	143332103	0.007000	0.16637	0.026000	0.17262	0.452000	0.32318	-1.059000	0.03479	-0.372000	0.07992	0.557000	0.71058	ATG	OR6B1	-	prints_GPCR_Rhodpsn	ENSG00000221813		0.488	OR6B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR6B1	HGNC	protein_coding	OTTHUMT00000349566.1	-	0.00	73	0	G			143701170	+1	tier1	-	no_errors	ENST00000408922	ensembl	human	known	74_37	missense	8.70	42	4	SNP	0.002	T
OSBPL1A	114876	genome.wustl.edu	37	18	21746571	21746571	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr18:21746571G>T	ENST00000319481.3	-	26	2837	c.2631C>A	c.(2629-2631)gaC>gaA	p.D877E	OSBPL1A_ENST00000357041.4_Missense_Mutation_p.D495E|OSBPL1A_ENST00000399443.3_Missense_Mutation_p.D364E	NM_080597.3	NP_542164.2	Q9BXW6	OSBL1_HUMAN	oxysterol binding protein-like 1A	877					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|late endosome (GO:0005770)|lysosomal membrane (GO:0005765)|nucleus (GO:0005634)	cholesterol binding (GO:0015485)|phospholipid binding (GO:0005543)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(16)|ovary(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	36	all_cancers(21;0.000396)|all_epithelial(16;4.36e-06)|Lung NSC(20;0.00171)|all_lung(20;0.0055)|Colorectal(14;0.0505)|Ovarian(20;0.17)					TGGCTCTGATGTCAGGCCGTA	0.433																																																	0													218.0	191.0	200.0					18																	21746571		2203	4300	6503	SO:0001583	missense	0			AF392449, AF274714	CCDS11884.1, CCDS11885.1, CCDS56056.1	18q11.2	2014-06-03	2014-06-03	2014-06-03	ENSG00000141447	ENSG00000141447		"""Oxysterol binding proteins"", ""Ankyrin repeat domain containing"""	16398	protein-coding gene	gene with protein product		606730	"""oxysterol binding protein-like 1B"""	OSBPL1B		11279184, 10588946	Standard	NM_080597		Approved	ORP-1, ORP1	uc002kve.3	Q9BXW6	OTTHUMG00000131944	ENST00000319481.3:c.2631C>A	18.37:g.21746571G>T	ENSP00000320291:p.Asp877Glu		B7Z7D3|Q9BZF5|Q9NW87	Missense_Mutation	SNP	pfam_Oxysterol-bd,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_Pleckstrin_homology,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Pleckstrin_homology,prints_Ankyrin_rpt	p.D877E	ENST00000319481.3	37	c.2631	CCDS11884.1	18	.	.	.	.	.	.	.	.	.	.	G	12.14	1.849882	0.32699	.	.	ENSG00000141447	ENST00000319481;ENST00000399443;ENST00000357041	T;T;T	0.38240	1.15;1.15;1.15	5.5	1.51	0.23008	.	0.000000	0.85682	D	0.000000	T	0.68393	0.2996	H	0.97516	4.02	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.71384	-0.4609	10	0.87932	D	0	-34.2715	8.3085	0.32058	0.552:0.0:0.448:0.0	.	877	Q9BXW6	OSBL1_HUMAN	E	877;364;495	ENSP00000320291:D877E;ENSP00000382372:D364E;ENSP00000349545:D495E	ENSP00000320291:D877E	D	-	3	2	OSBPL1A	20000569	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	0.740000	0.26188	0.325000	0.23359	0.585000	0.79938	GAC	OSBPL1A	-	pfam_Oxysterol-bd	ENSG00000141447		0.433	OSBPL1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OSBPL1A	HGNC	protein_coding	OTTHUMT00000254902.1	-	0.00	45	0	G	NM_080597		21746571	-1	tier1	-	no_errors	ENST00000319481	ensembl	human	known	74_37	missense	12.82	34	5	SNP	0.998	T
OSGIN1	29948	genome.wustl.edu	37	16	83999150	83999150	+	Silent	SNP	G	G	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr16:83999150G>T	ENST00000343939.2	+	7	1604	c.1221G>T	c.(1219-1221)ctG>ctT	p.L407L	OSGIN1_ENST00000361711.3_Silent_p.L324L|OSGIN1_ENST00000393306.1_Silent_p.L324L			Q9UJX0	OSGI1_HUMAN	oxidative stress induced growth inhibitor 1	407					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|negative regulation of cell growth (GO:0030308)|positive regulation of apoptotic process (GO:0043065)		growth factor activity (GO:0008083)			autonomic_ganglia(1)|large_intestine(1)|lung(7)|prostate(2)|upper_aerodigestive_tract(1)	12						ACCCTGGCCTGGTGTTCAACC	0.652																																																	0													52.0	48.0	49.0					16																	83999150		2200	4299	6499	SO:0001819	synonymous_variant	0			AY258066	CCDS10939.1	16q23.3	2010-11-23			ENSG00000140961	ENSG00000140961			30093	protein-coding gene	gene with protein product	"""bone marrow stromal cell-derived growth inhibitor"", ""pregnancy induced growth inhibitor"""	607975				11459809, 14570898	Standard	NM_182981		Approved	BDGI, OKL38	uc002fhc.3	Q9UJX0	OTTHUMG00000137640	ENST00000343939.2:c.1221G>T	16.37:g.83999150G>T			Q52M33|Q86UQ1|Q96S88|Q9BZ70	Silent	SNP	pfam_Pyr_nucl-diS_OxRdtase_FAD/NAD	p.L324	ENST00000343939.2	37	c.972		16																																																																																			OSGIN1	-	pfam_Pyr_nucl-diS_OxRdtase_FAD/NAD	ENSG00000140961		0.652	OSGIN1-001	PUTATIVE	basic	protein_coding	OSGIN1	HGNC	protein_coding	OTTHUMT00000269081.1		0.00	21	0	G	NM_013370		83999150	+1			no_errors	ENST00000361711	ensembl	human	known	74_37	silent	11.76	15	2	SNP	1.000	T
SLC7A7	9056	genome.wustl.edu	37	14	23240489	23240489	+	IGR	SNP	C	C	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr14:23240489C>T	ENST00000397532.3	-	0	2447				OXA1L_ENST00000285848.5_Missense_Mutation_p.A432V|SLC7A7_ENST00000554061.1_5'Flank|OXA1L_ENST00000604262.1_Missense_Mutation_p.A372V|OXA1L_ENST00000412791.1_Intron|OXA1L_ENST00000358043.5_Missense_Mutation_p.A356V			Q9UM01	YLAT1_HUMAN	solute carrier family 7 (amino acid transporter light chain, y+L system), member 7						amino acid transport (GO:0006865)|blood coagulation (GO:0007596)|cellular amino acid metabolic process (GO:0006520)|ion transport (GO:0006811)|leukocyte migration (GO:0050900)|protein complex assembly (GO:0006461)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	amino acid transmembrane transporter activity (GO:0015171)			breast(2)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|skin(2)	20	all_cancers(95;8.44e-05)			GBM - Glioblastoma multiforme(265;0.00741)		TGGAAAAATGCTGAAATGACG	0.478																																																	0													64.0	67.0	66.0					14																	23240489		2203	4300	6503	SO:0001628	intergenic_variant	0			AF092032	CCDS9574.1	14q11.2	2014-09-17	2011-07-12		ENSG00000155465	ENSG00000155465		"""Solute carriers"""	11065	protein-coding gene	gene with protein product		603593		LPI		9829974	Standard	NM_001126106		Approved	y+LAT-1	uc001wgs.4	Q9UM01	OTTHUMG00000028692		14.37:g.23240489C>T			B2RAU0|D3DS26|O95984|Q53XC1|Q86U07|Q9P2V5	Missense_Mutation	SNP	pfam_Membrane_insert_OXA1/ALB3/YidC,tigrfam_Membr_insert_YidC/Oxa1_C	p.A432V	ENST00000397532.3	37	c.1295	CCDS9574.1	14	.	.	.	.	.	.	.	.	.	.	C	28.6	4.935901	0.92458	.	.	ENSG00000155463	ENST00000285848;ENST00000358043	T;T	0.35973	1.28;1.33	5.71	5.71	0.89125	.	0.104089	0.64402	D	0.000004	T	0.61800	0.2376	M	0.80183	2.485	0.80722	D	1	P;D	0.89917	0.952;1.0	P;D	0.70935	0.776;0.971	T	0.60219	-0.7306	10	0.36615	T	0.2	-14.5822	16.7594	0.85507	0.0:1.0:0.0:0.0	.	372;432	Q15070;Q2M1J6	OXA1L_HUMAN;.	V	432;356	ENSP00000285848:A432V;ENSP00000350740:A356V	ENSP00000285848:A432V	A	+	2	0	OXA1L	22310329	0.999000	0.42202	0.967000	0.41034	0.849000	0.48306	4.376000	0.59556	2.677000	0.91161	0.609000	0.83330	GCT	OXA1L	-	NULL	ENSG00000155463		0.478	SLC7A7-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	OXA1L	HGNC	protein_coding	OTTHUMT00000071636.3	-	0.00	50	0	C			23240489	+1	tier1	-	no_errors	ENST00000285848	ensembl	human	known	74_37	missense	10.53	34	4	SNP	1.000	T
PABPC5	140886	genome.wustl.edu	37	X	90691007	90691007	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chrX:90691007C>G	ENST00000312600.3	+	2	645	c.431C>G	c.(430-432)tCt>tGt	p.S144C	PABPC5-AS1_ENST00000456187.1_RNA|PABPC5_ENST00000373105.1_Intron	NM_080832.2	NP_543022.1	Q96DU9	PABP5_HUMAN	poly(A) binding protein, cytoplasmic 5	144	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.					mitochondrion (GO:0005739)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(20)|ovary(1)|pancreas(1)	42						GACAACGGCTCTAAGGGTTAT	0.473																																																	0													84.0	74.0	78.0					X																	90691007		2203	4300	6503	SO:0001583	missense	0			AJ278963	CCDS14460.1	Xq21.3	2013-02-12	2001-11-28		ENSG00000174740	ENSG00000174740		"""RNA binding motif (RRM) containing"""	13629	protein-coding gene	gene with protein product		300407	"""poly(A)-binding protein, cytoplasmic 5"""			11374897	Standard	NM_080832		Approved	PABP5	uc004efg.3	Q96DU9	OTTHUMG00000021959	ENST00000312600.3:c.431C>G	X.37:g.90691007C>G	ENSP00000308012:p.Ser144Cys		A8K240|Q5JQF4|Q6P529|Q9UFE5	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,smart_RRM_dom_euk,pfscan_RRM_dom,tigrfam_PABP_1234	p.S144C	ENST00000312600.3	37	c.431	CCDS14460.1	X	.	.	.	.	.	.	.	.	.	.	C	17.79	3.476649	0.63737	.	.	ENSG00000174740	ENST00000312600;ENST00000402906	T	0.21543	2.0	4.43	4.43	0.53597	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.85682	D	0.000000	T	0.48943	0.1528	M	0.83483	2.645	0.58432	D	0.999999	D	0.89917	1.0	D	0.91635	0.999	T	0.55218	-0.8175	10	0.87932	D	0	.	13.8904	0.63736	0.0:1.0:0.0:0.0	.	144	Q96DU9	PABP5_HUMAN	C	144;112	ENSP00000308012:S144C	ENSP00000308012:S144C	S	+	2	0	PABPC5	90577663	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	4.540000	0.60664	2.450000	0.82876	0.600000	0.82982	TCT	PABPC5	-	pfam_RRM_dom,smart_RRM_dom_euk,smart_RRM_dom,pfscan_RRM_dom,tigrfam_PABP_1234	ENSG00000174740		0.473	PABPC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PABPC5	HGNC	protein_coding	OTTHUMT00000057429.1	-	0.00	31	0	C	NM_080832		90691007	+1	tier1	-	no_errors	ENST00000312600	ensembl	human	known	74_37	missense	60.00	8	12	SNP	1.000	G
PAFAH1B1	5048	genome.wustl.edu	37	17	2579890	2579890	+	Frame_Shift_Del	DEL	T	T	-			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr17:2579890delT	ENST00000397195.5	+	9	1443	c.992delT	c.(991-993)cttfs	p.L331fs	PAFAH1B1_ENST00000572915.2_Intron|PAFAH1B1_ENST00000451360.2_Intron	NM_000430.3	NP_000421.1			platelet-activating factor acetylhydrolase 1b, regulatory subunit 1 (45kDa)											endometrium(2)|kidney(1)|large_intestine(4)|liver(2)|lung(1)|skin(1)	11						GGCATGTGCCTTATGACCCTC	0.363																																																	0													193.0	162.0	173.0					17																	2579890		2203	4300	6503	SO:0001589	frameshift_variant	0			L25107	CCDS32528.1	17p13.3	2014-04-04	2010-02-10		ENSG00000007168	ENSG00000007168		"""WD repeat domain containing"""	8574	protein-coding gene	gene with protein product	"""lissencephaly-1"""	601545	"""platelet-activating factor acetylhydrolase, isoform Ib, alpha subunit (45kD)"", ""Miller-Dieker syndrome chromosome region"", ""platelet-activating factor acetylhydrolase, isoform Ib, alpha subunit 45kDa"", ""platelet-activating factor acetylhydrolase, isoform Ib, subunit 1 (45kDa)"""	MDCR, MDS		8355785, 9063735	Standard	NM_000430		Approved	LIS1, PAFAH	uc002fuw.4	P43034	OTTHUMG00000177574	ENST00000397195.5:c.992delT	17.37:g.2579890delT	ENSP00000380378:p.Leu331fs			Frame_Shift_Del	DEL	pfam_WD40_repeat,pfam_LisH_dimerisation_subgr,superfamily_WD40_repeat_dom,smart_LisH_dimerisation,smart_WD40_repeat,pirsf_Dynein_regulator_LIS1,pfscan_LisH_dimerisation,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.M332fs	ENST00000397195.5	37	c.992	CCDS32528.1	17																																																																																			PAFAH1B1	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pirsf_Dynein_regulator_LIS1,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000007168		0.363	PAFAH1B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAFAH1B1	HGNC	protein_coding	OTTHUMT00000437797.2		0.00	39	0	T	NM_000430		2579890	+1	tier1		no_errors	ENST00000397195	ensembl	human	known	74_37	frame_shift_del	15.38	11	2	DEL	1.000	-
PAK6	56924	genome.wustl.edu	37	15	40558592	40558592	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr15:40558592C>T	ENST00000542403.2	+	3	865	c.754C>T	c.(754-756)Cgg>Tgg	p.R252W	PAK6_ENST00000260404.4_Missense_Mutation_p.R252W|PAK6_ENST00000453867.1_Missense_Mutation_p.R252W|PAK6_ENST00000559901.1_3'UTR|PAK6_ENST00000455577.2_Missense_Mutation_p.R252W|PAK6_ENST00000441369.1_Missense_Mutation_p.R252W|RP11-133K1.2_ENST00000558658.1_3'UTR|PAK6_ENST00000560346.1_Missense_Mutation_p.R252W	NM_001276717.1	NP_001263646.1	Q9NQU5	PAK6_HUMAN	p21 protein (Cdc42/Rac)-activated kinase 6	252	Linker.				apoptotic process (GO:0006915)|cytoskeleton organization (GO:0007010)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|cervix(1)|endometrium(3)|large_intestine(2)|liver(1)|lung(11)|ovary(2)|prostate(1)|skin(2)	24		all_cancers(109;1.13e-18)|all_epithelial(112;1.62e-15)|Lung NSC(122;5.67e-11)|all_lung(180;1.41e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0823)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;1.51e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0544)		CCCTAAGACCCGGGAGAGCAG	0.662																																																	0													31.0	34.0	33.0					15																	40558592		2199	4296	6495	SO:0001583	missense	0			AF276893	CCDS10054.1, CCDS61590.1	15q14	2008-06-17	2008-06-17		ENSG00000137843	ENSG00000137843			16061	protein-coding gene	gene with protein product		608110	"""p21(CDKN1A)-activated kinase 6"""			11278661	Standard	NM_020168		Approved	PAK5	uc001zlb.3	Q9NQU5	OTTHUMG00000129921	ENST00000542403.2:c.754C>T	15.37:g.40558592C>T	ENSP00000439597:p.Arg252Trp		A8K2G2|B3KYB0|G5E9R2	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_CRIB_dom,superfamily_Kinase-like_dom,smart_CRIB_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_CRIB_dom,pfscan_Prot_kinase_dom	p.R252W	ENST00000542403.2	37	c.754	CCDS10054.1	15	.	.	.	.	.	.	.	.	.	.	C	16.95	3.262284	0.59431	.	.	ENSG00000137843	ENST00000441369;ENST00000453867;ENST00000455577;ENST00000260404;ENST00000542403	T;T;T;T;T	0.74737	-0.83;-0.83;-0.87;-0.83;-0.83	5.35	5.35	0.76521	.	0.923198	0.09243	N	0.828997	T	0.65811	0.2727	N	0.19112	0.55	0.24219	N	0.995443	P;P	0.52842	0.926;0.956	B;B	0.42882	0.226;0.401	T	0.60831	-0.7185	10	0.59425	D	0.04	.	14.6188	0.68569	0.2131:0.7869:0.0:0.0	.	252;252	Q9NQU5;G5E9R2	PAK6_HUMAN;.	W	252	ENSP00000406873:R252W;ENSP00000401153:R252W;ENSP00000409465:R252W;ENSP00000260404:R252W;ENSP00000439597:R252W	ENSP00000260404:R252W	R	+	1	2	PAK6	38345884	0.555000	0.26530	0.991000	0.47740	0.955000	0.61496	1.145000	0.31577	2.521000	0.84997	0.462000	0.41574	CGG	PAK6	-	NULL	ENSG00000137843		0.662	PAK6-004	NOVEL	alternative_3_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	PAK6	HGNC	protein_coding	OTTHUMT00000418355.1	-	0.00	58	0	C			40558592	+1	tier1	-	no_errors	ENST00000260404	ensembl	human	known	74_37	missense	19.23	21	5	SNP	0.944	T
PAK7	57144	genome.wustl.edu	37	20	9561234	9561234	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr20:9561234G>T	ENST00000378429.3	-	5	1094	c.548C>A	c.(547-549)tCt>tAt	p.S183Y	PAK7_ENST00000353224.5_Missense_Mutation_p.S183Y|RP5-986I17.2_ENST00000428769.1_RNA|PAK7_ENST00000378423.1_Missense_Mutation_p.S183Y	NM_020341.3	NP_065074.1	Q9P286	PAK7_HUMAN	p21 protein (Cdc42/Rac)-activated kinase 7	183	Linker.				apoptotic process (GO:0006915)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cytoskeleton organization (GO:0007010)|learning (GO:0007612)|locomotory behavior (GO:0007626)|memory (GO:0007613)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|signal transduction (GO:0007165)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|central_nervous_system(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(44)|ovary(2)|skin(13)|stomach(1)|upper_aerodigestive_tract(3)	81			COAD - Colon adenocarcinoma(9;0.194)			CTTCACCTCAGAATAGTAGGC	0.458																																																	0													130.0	126.0	127.0					20																	9561234		2203	4300	6503	SO:0001583	missense	0			AB033090	CCDS13107.1	20p12	2008-06-17	2008-06-17		ENSG00000101349	ENSG00000101349			15916	protein-coding gene	gene with protein product		608038	"""p21(CDKN1A)-activated kinase 7"""			11756552, 10574462	Standard	NM_020341		Approved	KIAA1264, PAK5	uc002wnk.2	Q9P286	OTTHUMG00000031857	ENST00000378429.3:c.548C>A	20.37:g.9561234G>T	ENSP00000367686:p.Ser183Tyr		A8K5T6|D3DW14|Q5W115|Q9BX09|Q9ULF6	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_CRIB_dom,superfamily_Kinase-like_dom,smart_CRIB_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_CRIB_dom,pfscan_Prot_kinase_dom	p.S183Y	ENST00000378429.3	37	c.548	CCDS13107.1	20	.	.	.	.	.	.	.	.	.	.	G	14.44	2.534613	0.45073	.	.	ENSG00000101349	ENST00000378429;ENST00000353224;ENST00000378423;ENST00000439520	T;T;T	0.44881	0.91;0.91;0.91	5.55	5.55	0.83447	.	0.270585	0.44285	D	0.000475	T	0.30198	0.0757	N	0.22421	0.69	0.31371	N	0.680158	B;B	0.22480	0.07;0.036	B;B	0.25140	0.058;0.023	T	0.21861	-1.0233	9	.	.	.	.	13.7685	0.63010	0.0731:0.0:0.9269:0.0	.	183;183	B0AZM9;Q9P286	.;PAK7_HUMAN	Y	183;183;183;131	ENSP00000367686:S183Y;ENSP00000322957:S183Y;ENSP00000367679:S183Y	.	S	-	2	0	PAK7	9509234	1.000000	0.71417	0.985000	0.45067	0.660000	0.38997	5.974000	0.70465	2.631000	0.89168	0.544000	0.68410	TCT	PAK7	-	NULL	ENSG00000101349		0.458	PAK7-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PAK7	HGNC	protein_coding	OTTHUMT00000077962.1		0.00	57	0	G			9561234	-1			no_errors	ENST00000353224	ensembl	human	known	74_37	missense	7.69	24	2	SNP	1.000	T
PAPSS2	9060	genome.wustl.edu	37	10	89474760	89474760	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr10:89474760A>C	ENST00000361175.4	+	6	1027	c.658A>C	c.(658-660)Ata>Cta	p.I220L	PAPSS2_ENST00000427144.2_Missense_Mutation_p.I224L|PAPSS2_ENST00000456849.1_Missense_Mutation_p.I220L	NM_004670.3	NP_004661.2	O95340	PAPS2_HUMAN	3'-phosphoadenosine 5'-phosphosulfate synthase 2	220					3'-phosphoadenosine 5'-phosphosulfate biosynthetic process (GO:0050428)|3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|blood coagulation (GO:0007596)|bone development (GO:0060348)|carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)|sulfate assimilation (GO:0000103)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	adenylylsulfate kinase activity (GO:0004020)|ATP binding (GO:0005524)|nucleotidyltransferase activity (GO:0016779)|sulfate adenylyltransferase (ATP) activity (GO:0004781)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)|skin(1)|stomach(1)	20		Melanoma(5;0.019)|Colorectal(252;0.123)		UCEC - Uterine corpus endometrioid carcinoma (6;0.00164)|Colorectal(12;0.000323)|COAD - Colon adenocarcinoma(12;0.00124)		ACCCTATACTATAATCAAAGA	0.368																																																	0													75.0	73.0	73.0					10																	89474760		2203	4300	6503	SO:0001583	missense	0			AF091242	CCDS7385.1, CCDS44453.1	10q24	2008-02-07			ENSG00000198682	ENSG00000198682	2.7.7.4, 2.7.1.25		8604	protein-coding gene	gene with protein product		603005				9771708	Standard	NM_004670		Approved	ATPSK2	uc001kex.3	O95340	OTTHUMG00000018683	ENST00000361175.4:c.658A>C	10.37:g.89474760A>C	ENSP00000354436:p.Ile220Leu		Q9BZL2|Q9P0G6|Q9UHM1|Q9UKD3|Q9UP30	Missense_Mutation	SNP	pfam_Sulfurylase_cat_dom,pfam_APS_kinase,superfamily_PUA-like_domain,superfamily_P-loop_NTPase,tigrfam_Sulphate_adenylyltransferase,tigrfam_APS_kinase	p.I220L	ENST00000361175.4	37	c.658	CCDS7385.1	10	.	.	.	.	.	.	.	.	.	.	A	1.018	-0.685858	0.03328	.	.	ENSG00000198682	ENST00000361175;ENST00000456849;ENST00000427144;ENST00000371981	T;T;T	0.21191	2.02;2.02;2.02	6.06	-7.21	0.01490	PUA-like domain (1);	0.995545	0.08163	N	0.988206	T	0.13030	0.0316	L	0.28344	0.845	0.09310	N	1	B;B	0.13594	0.0;0.008	B;B	0.12837	0.001;0.008	T	0.38478	-0.9659	10	0.15066	T	0.55	-0.1831	15.8035	0.78473	0.2468:0.0:0.6593:0.0939	.	220;220	O95340;O95340-2	PAPS2_HUMAN;.	L	220;220;224;219	ENSP00000354436:I220L;ENSP00000406157:I220L;ENSP00000397123:I224L	ENSP00000354436:I220L	I	+	1	0	PAPSS2	89464740	0.000000	0.05858	0.000000	0.03702	0.117000	0.20001	-0.163000	0.09997	-1.320000	0.02283	-0.256000	0.11100	ATA	PAPSS2	-	superfamily_PUA-like_domain	ENSG00000198682		0.368	PAPSS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAPSS2	HGNC	protein_coding	OTTHUMT00000049229.1		0.00	51	0	A			89474760	+1			no_errors	ENST00000456849	ensembl	human	known	74_37	missense	6.82	41	3	SNP	0.000	C
PAX6	5080	genome.wustl.edu	37	11	31815069	31815069	+	Nonsense_Mutation	SNP	G	G	A			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr11:31815069G>A	ENST00000379132.3	-	10	1229	c.949C>T	c.(949-951)Cga>Tga	p.R317*	PAX6_ENST00000379111.2_Nonsense_Mutation_p.R317*|PAX6_ENST00000379129.2_Nonsense_Mutation_p.R331*|PAX6_ENST00000241001.8_Nonsense_Mutation_p.R317*|PAX6_ENST00000379115.4_Nonsense_Mutation_p.R331*|PAX6_ENST00000419022.1_Nonsense_Mutation_p.R331*|PAX6_ENST00000379107.2_Nonsense_Mutation_p.R331*|PAX6_ENST00000379123.5_Nonsense_Mutation_p.R317*			P26367	PAX6_HUMAN	paired box 6	317	Pro/Ser/Thr-rich.			R -> L (in Ref. 1; AAA59962). {ECO:0000305}.	astrocyte differentiation (GO:0048708)|axon guidance (GO:0007411)|blood vessel development (GO:0001568)|cell fate determination (GO:0001709)|central nervous system development (GO:0007417)|cerebral cortex regionalization (GO:0021796)|commitment of neuronal cell to specific neuron type in forebrain (GO:0021902)|cornea development in camera-type eye (GO:0061303)|dorsal/ventral axis specification (GO:0009950)|embryonic camera-type eye morphogenesis (GO:0048596)|eye development (GO:0001654)|eye photoreceptor cell development (GO:0042462)|forebrain anterior/posterior pattern specification (GO:0021797)|forebrain dorsal/ventral pattern formation (GO:0021798)|forebrain-midbrain boundary formation (GO:0021905)|glucose homeostasis (GO:0042593)|hindbrain development (GO:0030902)|iris morphogenesis (GO:0061072)|keratinocyte differentiation (GO:0030216)|lacrimal gland development (GO:0032808)|lens development in camera-type eye (GO:0002088)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of neurogenesis (GO:0050768)|negative regulation of neuron differentiation (GO:0045665)|neuron fate commitment (GO:0048663)|neuron migration (GO:0001764)|oligodendrocyte cell fate specification (GO:0021778)|organ morphogenesis (GO:0009887)|pancreatic A cell development (GO:0003322)|pituitary gland development (GO:0021983)|positive regulation of cell fate specification (GO:0042660)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of gene expression (GO:0010628)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein localization to organelle (GO:0033365)|protein ubiquitination (GO:0016567)|regulation of cell migration (GO:0030334)|regulation of timing of cell differentiation (GO:0048505)|regulation of transcription from RNA polymerase II promoter involved in somatic motor neuron fate commitment (GO:0021918)|regulation of transcription from RNA polymerase II promoter involved in spinal cord motor neuron fate specification (GO:0021912)|regulation of transcription from RNA polymerase II promoter involved in ventral spinal cord interneuron specification (GO:0021913)|response to wounding (GO:0009611)|retina development in camera-type eye (GO:0060041)|salivary gland morphogenesis (GO:0007435)|signal transduction involved in regulation of gene expression (GO:0023019)|smoothened signaling pathway (GO:0007224)|transcription from RNA polymerase II promoter (GO:0006366)|type B pancreatic cell differentiation (GO:0003309)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	AT DNA binding (GO:0003680)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|histone acetyltransferase binding (GO:0035035)|protein kinase binding (GO:0019901)|R-SMAD binding (GO:0070412)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|ubiquitin-protein transferase activity (GO:0004842)			central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(7)|lung(15)|ovary(3)|pancreas(1)|prostate(1)|skin(2)	35	Lung SC(675;0.225)					GTGTCTGTTCGGCCCAACATG	0.532									Wilms' tumor-Aniridia-ambiguous Genitals-mental Retardation																																								0			GRCh37	CM930573	PAX6	M							130.0	133.0	132.0					11																	31815069		2202	4299	6501	SO:0001587	stop_gained	0	Familial Cancer Database	WAGR syndrome	AY707088	CCDS31451.1, CCDS31452.1	11p13	2014-09-17	2007-07-12		ENSG00000007372	ENSG00000007372		"""Paired boxes"", ""Homeoboxes / PRD class"""	8620	protein-coding gene	gene with protein product	"""aniridia, keratitis"""	607108	"""paired box gene 6 (aniridia, keratitis)"""	AN2		1302030	Standard	NM_001127612		Approved	D11S812E, AN, WAGR	uc021qfm.1	P26367	OTTHUMG00000041447	ENST00000379132.3:c.949C>T	11.37:g.31815069G>A	ENSP00000368427:p.Arg317*		Q6N006|Q99413	Nonsense_Mutation	SNP	pfam_Paired_dom,pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Paired_dom,smart_Homeobox_dom,prints_Paired_dom,pfscan_Homeobox_dom,pfscan_Paired_dom	p.R331*	ENST00000379132.3	37	c.991	CCDS31451.1	11	.	.	.	.	.	.	.	.	.	.	G	39	7.560442	0.98358	.	.	ENSG00000007372	ENST00000419022;ENST00000379132;ENST00000379129;ENST00000531633;ENST00000379107;ENST00000464174;ENST00000241001;ENST00000379115;ENST00000379111;ENST00000379123;ENST00000494377;ENST00000470027;ENST00000379109;ENST00000533333;ENST00000530373	.	.	.	5.77	4.8	0.61643	.	0.209907	0.47093	D	0.000241	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.11182	T	0.66	.	12.1119	0.53844	0.0:0.0:0.6686:0.3314	.	.	.	.	X	331;317;331;146;331;116;317;331;317;317;181;181;317;272;116	.	ENSP00000241001:R317X	R	-	1	2	PAX6	31771645	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.321000	0.59209	2.698000	0.92095	0.643000	0.83706	CGA	PAX6	-	NULL	ENSG00000007372		0.532	PAX6-008	KNOWN	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	PAX6	HGNC	protein_coding	OTTHUMT00000099293.4		0.00	22	0	G	NM_001604		31815069	-1			no_errors	ENST00000379107	ensembl	human	known	74_37	nonsense	8.70	21	2	SNP	1.000	A
PCDH20	64881	genome.wustl.edu	37	13	61987310	61987310	+	Missense_Mutation	SNP	T	T	A	rs370995261		TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr13:61987310T>A	ENST00000409186.1	-	5	3027	c.922A>T	c.(922-924)Att>Ttt	p.I308F	PCDH20_ENST00000409204.4_Missense_Mutation_p.I308F			Q8N6Y1	PCD20_HUMAN	protocadherin 20	308	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)			breast(3)|central_nervous_system(2)|endometrium(3)|kidney(4)|large_intestine(14)|liver(1)|lung(23)|ovary(5)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	58		Breast(118;0.195)|Prostate(109;0.229)		GBM - Glioblastoma multiforme(99;0.000118)		CTGATGCCAATGGTGAGAGTG	0.502																																																	0								T	PHE/ILE	0,4406		0,0,2203	83.0	78.0	80.0		922	5.8	1.0	13		80	1,8599	1.2+/-3.3	0,1,4299	no	missense	PCDH20	NM_022843.3	21	0,1,6502	AA,AT,TT		0.0116,0.0,0.0077	probably-damaging	308/952	61987310	1,13005	2203	4300	6503	SO:0001583	missense	0			AF169693	CCDS9442.2	13q21	2010-01-26			ENSG00000197991	ENSG00000197991		"""Cadherins / Protocadherins : Non-clustered"""	14257	protein-coding gene	gene with protein product		614449					Standard	NM_022843		Approved	PCDH13, FLJ22218	uc001vid.4	Q8N6Y1	OTTHUMG00000017012	ENST00000409186.1:c.922A>T	13.37:g.61987310T>A	ENSP00000386653:p.Ile308Phe		A8K1K9|B1AQU2|Q8NDN4|Q9NRT9	Missense_Mutation	SNP	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.I308F	ENST00000409186.1	37	c.922	CCDS9442.2	13	.	.	.	.	.	.	.	.	.	.	T	18.36	3.607138	0.66558	0.0	1.16E-4	ENSG00000197991	ENST00000409204;ENST00000409186;ENST00000358674	T;T	0.74209	-0.82;-0.82	5.76	5.76	0.90799	.	0.000000	0.64402	D	0.000004	D	0.88804	0.6536	M	0.91663	3.23	0.80722	D	1	D	0.76494	0.999	D	0.69824	0.966	D	0.91276	0.5048	10	0.87932	D	0	.	16.0796	0.80995	0.0:0.0:0.0:1.0	.	308	A8K1K9	.	F	308;308;54	ENSP00000387250:I308F;ENSP00000386653:I308F	ENSP00000351500:I54F	I	-	1	0	PCDH20	60885311	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.124000	0.64709	2.206000	0.71126	0.533000	0.62120	ATT	PCDH20	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000197991		0.502	PCDH20-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PCDH20	HGNC	protein_coding	OTTHUMT00000333054.2		0.00	15	0	T	NM_022843		61987310	-1			no_errors	ENST00000409186	ensembl	human	known	74_37	missense	25.00	9	3	SNP	1.000	A
PCDH20	64881	genome.wustl.edu	37	13	61987586	61987586	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr13:61987586C>T	ENST00000409186.1	-	5	2751	c.646G>A	c.(646-648)Gtg>Atg	p.V216M	PCDH20_ENST00000409204.4_Missense_Mutation_p.V216M			Q8N6Y1	PCD20_HUMAN	protocadherin 20	216	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)			breast(3)|central_nervous_system(2)|endometrium(3)|kidney(4)|large_intestine(14)|liver(1)|lung(23)|ovary(5)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	58		Breast(118;0.195)|Prostate(109;0.229)		GBM - Glioblastoma multiforme(99;0.000118)		GGGACCCACACCGAGATCTGG	0.527																																																	0													110.0	98.0	102.0					13																	61987586		2203	4300	6503	SO:0001583	missense	0			AF169693	CCDS9442.2	13q21	2010-01-26			ENSG00000197991	ENSG00000197991		"""Cadherins / Protocadherins : Non-clustered"""	14257	protein-coding gene	gene with protein product		614449					Standard	NM_022843		Approved	PCDH13, FLJ22218	uc001vid.4	Q8N6Y1	OTTHUMG00000017012	ENST00000409186.1:c.646G>A	13.37:g.61987586C>T	ENSP00000386653:p.Val216Met		A8K1K9|B1AQU2|Q8NDN4|Q9NRT9	Missense_Mutation	SNP	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.V216M	ENST00000409186.1	37	c.646	CCDS9442.2	13	.	.	.	.	.	.	.	.	.	.	c	18.74	3.687533	0.68157	.	.	ENSG00000197991	ENST00000409204;ENST00000409186	T;T	0.54479	0.57;0.57	5.76	3.93	0.45458	.	0.255736	0.27558	N	0.018839	T	0.43211	0.1237	L	0.47016	1.485	0.09310	N	1	B	0.23128	0.08	B	0.25614	0.062	T	0.43507	-0.9387	10	0.72032	D	0.01	.	6.4657	0.21980	0.0:0.5816:0.2497:0.1687	.	216	A8K1K9	.	M	216	ENSP00000387250:V216M;ENSP00000386653:V216M	ENSP00000386653:V216M	V	-	1	0	PCDH20	60885587	0.959000	0.32827	0.012000	0.15200	0.963000	0.63663	1.901000	0.39838	1.441000	0.47550	0.651000	0.88453	GTG	PCDH20	-	pfam_Cadherin,superfamily_Cadherin-like,pfscan_Cadherin	ENSG00000197991		0.527	PCDH20-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PCDH20	HGNC	protein_coding	OTTHUMT00000333054.2		0.00	18	0	C	NM_022843		61987586	-1			no_errors	ENST00000409186	ensembl	human	known	74_37	missense	11.76	15	2	SNP	0.108	T
PCDH9	5101	genome.wustl.edu	37	13	67801399	67801399	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr13:67801399C>T	ENST00000377865.2	-	1	1308	c.1174G>A	c.(1174-1176)Gac>Aac	p.D392N	PCDH9_ENST00000544246.1_Missense_Mutation_p.D392N|PCDH9_ENST00000456367.1_Missense_Mutation_p.D392N|PCDH9_ENST00000377861.3_Missense_Mutation_p.D392N|PCDH9_ENST00000328454.5_Missense_Mutation_p.D392N			Q9HC56	PCDH9_HUMAN	protocadherin 9	392	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				forebrain development (GO:0030900)|homophilic cell adhesion (GO:0007156)	cell-cell contact zone (GO:0044291)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(3)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(33)|lung(30)|ovary(5)|pancreas(2)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(3)	103		Hepatocellular(98;0.0906)|Breast(118;0.107)		GBM - Glioblastoma multiforme(99;0.00819)		ACATCTGTGTCCTTATCTGAA	0.383																																																	0													119.0	115.0	116.0					13																	67801399		2203	4300	6503	SO:0001583	missense	0			AF169692	CCDS9443.1, CCDS9444.1	13q21.32	2010-02-22			ENSG00000184226	ENSG00000184226		"""Cadherins / Protocadherins : Non-clustered"""	8661	protein-coding gene	gene with protein product		603581				9787079	Standard	NM_020403		Approved		uc001vik.3	Q9HC56	OTTHUMG00000017040	ENST00000377865.2:c.1174G>A	13.37:g.67801399C>T	ENSP00000367096:p.Asp392Asn		A2A6U1|Q5VT83|Q7Z3U0|Q8N3K7	Missense_Mutation	SNP	pfam_Cadherin,pfam_Protocadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.D392N	ENST00000377865.2	37	c.1174	CCDS9444.1	13	.	.	.	.	.	.	.	.	.	.	C	18.75	3.691303	0.68271	.	.	ENSG00000184226	ENST00000544246;ENST00000377865;ENST00000456367;ENST00000328454;ENST00000377861	T;T;T;T;T	0.74002	-0.8;-0.8;-0.8;-0.8;-0.8	6.17	6.17	0.99709	Cadherin (4);Cadherin-like (1);	0.000000	0.85682	D	0.000000	D	0.92351	0.7573	H	0.98111	4.15	0.80722	D	1	D;D;D;D	0.89917	0.972;1.0;1.0;1.0	P;D;D;D	0.97110	0.895;1.0;0.999;1.0	D	0.94000	0.7274	10	0.87932	D	0	.	20.8794	0.99867	0.0:1.0:0.0:0.0	.	392;392;392;392	B7ZM79;Q5VT82;Q9HC56-2;Q9HC56	.;.;.;PCDH9_HUMAN	N	392	ENSP00000442186:D392N;ENSP00000367096:D392N;ENSP00000401699:D392N;ENSP00000332060:D392N;ENSP00000367092:D392N	ENSP00000332060:D392N	D	-	1	0	PCDH9	66699400	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.818000	0.86416	2.941000	0.99782	0.655000	0.94253	GAC	PCDH9	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000184226		0.383	PCDH9-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PCDH9	HGNC	protein_coding	OTTHUMT00000276387.1		0.00	33	0	C	NM_203487		67801399	-1			no_errors	ENST00000377865	ensembl	human	known	74_37	missense	13.33	13	2	SNP	1.000	T
PCDHA12	56137	genome.wustl.edu	37	5	140255825	140255825	+	Missense_Mutation	SNP	A	A	C	rs375639572		TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr5:140255825A>C	ENST00000398631.2	+	1	768	c.768A>C	c.(766-768)caA>caC	p.Q256H	PCDHA10_ENST00000506939.2_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA11_ENST00000398640.2_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA10_ENST00000307360.5_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA8_ENST00000531613.1_Intron	NM_018903.2|NM_031864.2	NP_061726.1|NP_114070.1	Q9UN75	PCDAC_HUMAN	protocadherin alpha 12	256	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(4)|breast(2)|cervix(1)|endometrium(19)|kidney(8)|large_intestine(8)|liver(2)|lung(25)|prostate(1)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(1)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AAAATGTCCAAAACGACACAA	0.428																																					Pancreas(113;759 1672 13322 24104 50104)												0													111.0	110.0	110.0					5																	140255825		1884	4106	5990	SO:0001583	missense	0			AF152477	CCDS47285.1, CCDS75327.1	5q31	2010-11-26			ENSG00000251664	ENSG00000251664		"""Cadherins / Protocadherins : Clustered"""	8666	other	complex locus constituent	"""KIAA0345-like 2"""	606318				10380929	Standard	NM_018903		Approved	PCDH-ALPHA12	uc003lic.2	Q9UN75	OTTHUMG00000163366	ENST00000398631.2:c.768A>C	5.37:g.140255825A>C	ENSP00000381628:p.Gln256His		O75278|Q2M1N8	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.Q256H	ENST00000398631.2	37	c.768	CCDS47285.1	5	.	.	.	.	.	.	.	.	.	.	A	9.210	1.030731	0.19512	.	.	ENSG00000251664	ENST00000398631	T	0.52983	0.64	5.07	3.83	0.44106	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.33933	0.0880	L	0.34521	1.04	0.09310	N	1	B;B	0.09022	0.002;0.002	B;B	0.12156	0.001;0.007	T	0.19289	-1.0310	9	0.66056	D	0.02	.	4.1854	0.10395	0.5348:0.0:0.0905:0.3747	.	256;256	Q9UN75-2;Q9UN75	.;PCDAC_HUMAN	H	256	ENSP00000381628:Q256H	ENSP00000381628:Q256H	Q	+	3	2	PCDHA12	140236009	0.000000	0.05858	0.491000	0.27477	0.887000	0.51463	-4.285000	0.00259	1.910000	0.55303	0.482000	0.46254	CAA	PCDHA12	-	pfam_Cadherin,superfamily_Cadherin-like,prints_Cadherin,pfscan_Cadherin	ENSG00000251664		0.428	PCDHA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA12	HGNC	protein_coding	OTTHUMT00000372882.2	-	0.00	40	0	A	NM_018903		140255825	+1	tier1	-	no_errors	ENST00000398631	ensembl	human	known	74_37	missense	19.05	17	4	SNP	0.000	C
PCDHB2	56133	genome.wustl.edu	37	5	140475221	140475221	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr5:140475221T>C	ENST00000194155.4	+	1	995	c.847T>C	c.(847-849)Ttt>Ctt	p.F283L		NM_018936.2	NP_061759.1	Q9Y5E7	PCDB2_HUMAN	protocadherin beta 2	283	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(22)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(2)	71			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			ATCTTATGCATTTTCCCAAGC	0.458																																																	0													81.0	81.0	81.0					5																	140475221		2203	4300	6503	SO:0001583	missense	0			AF152495	CCDS4244.1	5q31	2010-01-26			ENSG00000112852	ENSG00000112852		"""Cadherins / Protocadherins : Clustered"""	8687	other	protocadherin		606328				10380929	Standard	NM_018936		Approved	PCDH-BETA2	uc003lil.3	Q9Y5E7	OTTHUMG00000129606	ENST00000194155.4:c.847T>C	5.37:g.140475221T>C	ENSP00000194155:p.Phe283Leu		Q4KMU1	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.F283L	ENST00000194155.4	37	c.847	CCDS4244.1	5	.	.	.	.	.	.	.	.	.	.	T	4.332	0.061068	0.08339	.	.	ENSG00000112852	ENST00000194155	T	0.43688	0.94	5.42	3.02	0.34903	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.31606	0.0802	L	0.41124	1.26	0.35333	D	0.785803	B	0.18461	0.028	B	0.24155	0.051	T	0.25537	-1.0129	9	0.16896	T	0.51	.	9.6696	0.40004	0.0:0.1436:0.0:0.8564	.	283	Q9Y5E7	PCDB2_HUMAN	L	283	ENSP00000194155:F283L	ENSP00000194155:F283L	F	+	1	0	PCDHB2	140455405	0.127000	0.22367	0.510000	0.27712	0.825000	0.46686	0.423000	0.21313	0.444000	0.26612	0.533000	0.62120	TTT	PCDHB2	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000112852		0.458	PCDHB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB2	HGNC	protein_coding	OTTHUMT00000251801.2		0.00	28	0	T	NM_018936		140475221	+1			no_errors	ENST00000194155	ensembl	human	known	74_37	missense	16.67	10	2	SNP	0.713	C
PCDHB3	56132	genome.wustl.edu	37	5	140482266	140482266	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr5:140482266C>T	ENST00000231130.2	+	1	2033	c.2033C>T	c.(2032-2034)cCg>cTg	p.P678L	AC005754.7_ENST00000607216.1_RNA	NM_018937.2	NP_061760.1	Q9Y5E6	PCDB3_HUMAN	protocadherin beta 3	678					calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(19)|lung(24)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	72			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GAGGCGGCACCGGCCCAGGCC	0.672																																																	0													67.0	73.0	71.0					5																	140482266		2154	4222	6376	SO:0001583	missense	0			AF152496	CCDS4245.1	5q31	2010-01-26			ENSG00000113205	ENSG00000113205		"""Cadherins / Protocadherins : Clustered"""	8688	other	protocadherin		606329				10380929	Standard	NM_018937		Approved	PCDH-BETA3	uc003lio.3	Q9Y5E6	OTTHUMG00000129622	ENST00000231130.2:c.2033C>T	5.37:g.140482266C>T	ENSP00000231130:p.Pro678Leu		B2R8P2	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.P678L	ENST00000231130.2	37	c.2033	CCDS4245.1	5	.	.	.	.	.	.	.	.	.	.	C	11.33	1.606500	0.28623	.	.	ENSG00000113205	ENST00000231130	T	0.51817	0.69	4.29	-1.54	0.08584	.	.	.	.	.	T	0.41351	0.1155	M	0.76170	2.325	0.09310	N	1	B	0.10296	0.003	B	0.04013	0.001	T	0.45673	-0.9245	9	0.54805	T	0.06	.	3.1527	0.06494	0.1244:0.4593:0.2571:0.1591	.	678	Q9Y5E6	PCDB3_HUMAN	L	678	ENSP00000231130:P678L	ENSP00000231130:P678L	P	+	2	0	PCDHB3	140462450	0.005000	0.15991	0.000000	0.03702	0.058000	0.15608	0.878000	0.28126	0.014000	0.14944	0.485000	0.47835	CCG	PCDHB3	-	NULL	ENSG00000113205		0.672	PCDHB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB3	HGNC	protein_coding	OTTHUMT00000251817.2	-	0.00	136	0	C	NM_018937		140482266	+1	tier1	-	no_errors	ENST00000231130	ensembl	human	known	74_37	missense	12.33	64	9	SNP	0.000	T
PCDHB8	56128	genome.wustl.edu	37	5	140559207	140559207	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr5:140559207G>A	ENST00000239444.2	+	1	1837	c.1592G>A	c.(1591-1593)cGg>cAg	p.R531Q	PCDHB16_ENST00000361016.2_5'Flank	NM_019120.3	NP_061993.2	Q9UN66	PCDB8_HUMAN	protocadherin beta 8	531	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.R531Q(1)		NS(2)|breast(1)|cervix(2)|endometrium(5)|kidney(6)|large_intestine(14)|liver(1)|lung(38)|prostate(6)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	83			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TTCGAGTTCCGGGTGGGCGCT	0.672																																																	1	Substitution - Missense(1)	lung(1)											86.0	142.0	123.0					5																	140559207		2203	4300	6503	SO:0001583	missense	0			AF152501	CCDS4250.1	5q31	2010-01-26			ENSG00000120322	ENSG00000120322		"""Cadherins / Protocadherins : Clustered"""	8693	other	protocadherin		606334				10380929	Standard	NM_019120		Approved	PCDH-BETA8, PCDH3I	uc011dai.2	Q9UN66	OTTHUMG00000129621	ENST00000239444.2:c.1592G>A	5.37:g.140559207G>A	ENSP00000239444:p.Arg531Gln		B9EGV1	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.R531Q	ENST00000239444.2	37	c.1592	CCDS4250.1	5	.	.	.	.	.	.	.	.	.	.	G	4.255	0.046262	0.08243	.	.	ENSG00000120322	ENST00000239444	T	0.01725	4.67	4.22	1.18	0.20946	Cadherin (5);Cadherin-like (1);	.	.	.	.	T	0.01254	0.0041	N	0.16567	0.415	0.09310	N	1	B	0.24368	0.102	B	0.23150	0.044	T	0.49634	-0.8919	9	0.23891	T	0.37	.	5.11	0.14804	0.3402:0.2748:0.3849:0.0	.	531	Q9UN66	PCDB8_HUMAN	Q	531	ENSP00000239444:R531Q	ENSP00000239444:R531Q	R	+	2	0	PCDHB8	140539391	0.000000	0.05858	0.761000	0.31378	0.153000	0.21895	-1.080000	0.03407	0.245000	0.21373	0.298000	0.19748	CGG	PCDHB8	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	ENSG00000120322		0.672	PCDHB8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB8	HGNC	protein_coding	OTTHUMT00000251816.2	-	0.00	450	0	G	NM_019120		140559207	+1	tier1	-	no_errors	ENST00000239444	ensembl	human	known	74_37	missense	20.33	196	50	SNP	0.014	A
PCDHGB7	56099	genome.wustl.edu	37	5	140798870	140798870	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr5:140798870G>T	ENST00000398594.2	+	1	1444	c.1444G>T	c.(1444-1446)Ggg>Tgg	p.G482W	PCDHGA7_ENST00000518325.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGA11_ENST00000518882.1_5'Flank|PCDHGA10_ENST00000398610.2_Intron|PCDHGA11_ENST00000398587.2_5'Flank|PCDHGB6_ENST00000520790.1_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA5_ENST00000518069.1_Intron	NM_018927.3	NP_061750.1	Q9Y5F8	PCDGJ_HUMAN	protocadherin gamma subfamily B, 7	482	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			central_nervous_system(2)|endometrium(9)|kidney(6)|large_intestine(13)|lung(15)|ovary(4)|prostate(3)|stomach(1)|upper_aerodigestive_tract(3)	56			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCCAGACTTCGGGCTCAACGG	0.622																																																	0													77.0	89.0	85.0					5																	140798870		2137	4233	6370	SO:0001583	missense	0			AF152523	CCDS47293.1, CCDS75344.1	5q31	2010-01-26			ENSG00000254122	ENSG00000254122		"""Cadherins / Protocadherins : Clustered"""	8714	other	protocadherin	"""cadherin ME6"""	606304				10380929	Standard	NM_032101		Approved	ME6, PCDH-GAMMA-B7		Q9Y5F8	OTTHUMG00000164054	ENST00000398594.2:c.1444G>T	5.37:g.140798870G>T	ENSP00000381594:p.Gly482Trp		Q9UN63	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.G482W	ENST00000398594.2	37	c.1444	CCDS47293.1	5	.	.	.	.	.	.	.	.	.	.	g	9.730	1.162034	0.21538	.	.	ENSG00000254122	ENST00000398594	T	0.67523	-0.27	5.19	5.19	0.71726	Cadherin (4);Cadherin-like (1);	0.558425	0.13074	U	0.415836	D	0.88937	0.6573	H	0.97077	3.935	0.09310	N	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.82967	-0.0194	10	0.87932	D	0	.	18.3236	0.90246	0.0:0.0:1.0:0.0	.	482;482	Q9Y5F8;Q9Y5F8-2	PCDGJ_HUMAN;.	W	482	ENSP00000381594:G482W	ENSP00000381594:G482W	G	+	1	0	PCDHGB7	140779054	0.653000	0.27358	0.624000	0.29186	0.167000	0.22549	1.627000	0.37050	2.410000	0.81850	0.491000	0.48974	GGG	PCDHGB7	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000254122		0.622	PCDHGB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGB7	HGNC	protein_coding	OTTHUMT00000376973.1		0.00	34	0	G	NM_018927		140798870	+1			no_errors	ENST00000398594	ensembl	human	known	74_37	missense	8.70	21	2	SNP	0.034	T
PCNX	22990	genome.wustl.edu	37	14	71522254	71522254	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr14:71522254G>T	ENST00000304743.2	+	25	5057	c.4611G>T	c.(4609-4611)ttG>ttT	p.L1537F	PCNX_ENST00000439984.3_Missense_Mutation_p.L1426F|PCNX_ENST00000238570.5_Missense_Mutation_p.L1537F	NM_014982.2	NP_055797.2	Q96RV3	PCX1_HUMAN	pecanex homolog (Drosophila)	1537						integral component of membrane (GO:0016021)				NS(2)|biliary_tract(1)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(14)|liver(2)|lung(40)|ovary(1)|prostate(7)|skin(2)|urinary_tract(1)	87			KIRC - Kidney renal clear cell carcinoma(12;0.206)	all cancers(60;0.00835)|BRCA - Breast invasive adenocarcinoma(234;0.00951)|OV - Ovarian serous cystadenocarcinoma(108;0.0417)		ATACCAGATTGGCTTCCCAGC	0.294																																																	0													111.0	118.0	115.0					14																	71522254		2203	4299	6502	SO:0001583	missense	0			AF233450, AB018348	CCDS9806.1	14q24.2	2014-07-03							19740	protein-coding gene	gene with protein product			"""pecanex-like 1 (Drosophila)"""	PCNXL1		9244429, 15777640	Standard	NM_014982		Approved	KIAA0995, KIAA0805, pecanex	uc001xmo.2	Q96RV3		ENST00000304743.2:c.4611G>T	14.37:g.71522254G>T	ENSP00000304192:p.Leu1537Phe		B2RTR6|O94897|Q96AI7|Q9Y2J9	Missense_Mutation	SNP	pfam_Pecanex	p.L1537F	ENST00000304743.2	37	c.4611	CCDS9806.1	14	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.01|19.01	3.743714|3.743714	0.69418|0.69418	.|.	.|.	ENSG00000100731|ENSG00000100731	ENST00000304743;ENST00000238570;ENST00000439984|ENST00000554691	T;T;T|.	0.19669|.	2.44;2.23;2.13|.	5.65|5.65	4.77|4.77	0.60923|0.60923	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.77811|0.77811	0.4186|0.4186	M|M	0.88310|0.88310	2.945|2.945	0.58432|0.58432	D|D	0.999999|0.999999	D;D;D|.	0.89917|.	0.999;1.0;0.999|.	D;D;D|.	0.83275|.	0.996;0.993;0.994|.	T|T	0.80487|0.80487	-0.1361|-0.1361	10|5	0.87932|.	D|.	0|.	.|.	10.76|10.76	0.46259|0.46259	0.1445:0.0:0.8555:0.0|0.1445:0.0:0.8555:0.0	.|.	1537;1426;1537|.	Q96RV3-3;B2RTR6;Q96RV3|.	.;.;PCX1_HUMAN|.	F|L	1537;1537;1426|596	ENSP00000304192:L1537F;ENSP00000238570:L1537F;ENSP00000396617:L1426F|.	ENSP00000238570:L1537F|.	L|W	+|+	3|2	2|0	PCNX|PCNX	70592007|70592007	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.992000|0.992000	0.81027|0.81027	1.638000|1.638000	0.37165|0.37165	1.400000|1.400000	0.46741|0.46741	0.650000|0.650000	0.86243|0.86243	TTG|TGG	PCNX	-	NULL	ENSG00000100731		0.294	PCNX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCNX	HGNC	protein_coding	OTTHUMT00000412479.1	-	0.00	36	0	G	NM_014982		71522254	+1	tier1	-	no_errors	ENST00000304743	ensembl	human	known	74_37	missense	8.51	43	4	SNP	1.000	T
PDGFRB	5159	genome.wustl.edu	37	5	149499606	149499606	+	Frame_Shift_Del	DEL	G	G	-	rs527843077		TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr5:149499606delG	ENST00000261799.4	-	19	3136	c.2667delC	c.(2665-2667)ttcfs	p.F889fs		NM_002609.3	NP_002600.1	P09619	PGFRB_HUMAN	platelet-derived growth factor receptor, beta polypeptide	889	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				adrenal gland development (GO:0030325)|aorta morphogenesis (GO:0035909)|cardiac myofibril assembly (GO:0055003)|cell chemotaxis (GO:0060326)|cell migration (GO:0016477)|cell migration involved in coronary angiogenesis (GO:0060981)|cell migration involved in vasculogenesis (GO:0035441)|cellular response to platelet-derived growth factor stimulus (GO:0036120)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled receptor signaling pathway (GO:0007186)|glycosaminoglycan biosynthetic process (GO:0006024)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|inner ear development (GO:0048839)|metanephric comma-shaped body morphogenesis (GO:0072278)|metanephric glomerular capillary formation (GO:0072277)|metanephric glomerular mesangial cell proliferation involved in metanephros development (GO:0072262)|metanephric mesenchymal cell migration (GO:0035789)|metanephric mesenchyme development (GO:0072075)|metanephric S-shaped body morphogenesis (GO:0072284)|negative regulation of apoptotic process (GO:0043066)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol metabolic process (GO:0046488)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|platelet-derived growth factor receptor-beta signaling pathway (GO:0035791)|positive regulation of calcium ion import (GO:0090280)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell proliferation by VEGF-activated platelet derived growth factor receptor signaling pathway (GO:0038091)|positive regulation of chemotaxis (GO:0050921)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of metanephric mesenchymal cell migration by platelet-derived growth factor receptor-beta signaling pathway (GO:0035793)|positive regulation of mitosis (GO:0045840)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of smooth muscle cell migration (GO:0014911)|positive regulation of smooth muscle cell proliferation (GO:0048661)|protein autophosphorylation (GO:0046777)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|response to estradiol (GO:0032355)|response to fluid shear stress (GO:0034405)|response to hydrogen peroxide (GO:0042542)|response to hyperoxia (GO:0055093)|response to retinoic acid (GO:0032526)|response to toxic substance (GO:0009636)|retina vasculature development in camera-type eye (GO:0061298)|signal transduction (GO:0007165)|skeletal system morphogenesis (GO:0048705)|smooth muscle cell chemotaxis (GO:0071670)|smooth muscle tissue development (GO:0048745)|tissue homeostasis (GO:0001894)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intrinsic component of plasma membrane (GO:0031226)|lysosome (GO:0005764)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|platelet activating factor receptor activity (GO:0004992)|platelet-derived growth factor beta-receptor activity (GO:0005019)|platelet-derived growth factor binding (GO:0048407)|platelet-derived growth factor receptor binding (GO:0005161)|platelet-derived growth factor-activated receptor activity (GO:0005017)|protein kinase binding (GO:0019901)|protein tyrosine kinase activity (GO:0004713)|receptor binding (GO:0005102)|vascular endothelial growth factor binding (GO:0038085)			breast(3)|central_nervous_system(5)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(9)|kidney(3)|large_intestine(12)|lung(20)|ovary(3)|prostate(3)|skin(3)|stomach(6)|urinary_tract(1)	75		all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		Becaplermin(DB00102)|Dasatinib(DB01254)|Imatinib(DB00619)|Pazopanib(DB06589)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	GCAGGATCCCGAAGGACCACA	0.567			T	"""ETV6, TRIP11, HIP1, RAB5EP, H4, NIN, HCMOGT-1, PDE4DIP"""	"""MPD, AML, CMML, CML"""																																			Dom	yes		5	5q31-q32	5159	"""platelet-derived growth factor receptor, beta polypeptide"""		L	0													128.0	105.0	112.0					5																	149499606		2203	4300	6503	SO:0001589	frameshift_variant	0			M21616	CCDS4303.1	5q33.1	2013-01-29			ENSG00000113721	ENSG00000113721		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	8804	protein-coding gene	gene with protein product		173410		PDGFR			Standard	XM_005268464		Approved	JTK12, CD140b, PDGFR1	uc003lro.3	P09619	OTTHUMG00000130053	ENST00000261799.4:c.2667delC	5.37:g.149499606delG	ENSP00000261799:p.Phe889fs		B5A957|Q8N5L4	Frame_Shift_Del	DEL	pirsf_Tyr_kinase_CSF1/PDGF_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_Ig_I-set,pfam_Immunoglobulin,superfamily_Kinase-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.F889fs	ENST00000261799.4	37	c.2667	CCDS4303.1	5																																																																																			PDGFRB	-	pirsf_Tyr_kinase_CSF1/PDGF_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000113721		0.567	PDGFRB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDGFRB	HGNC	protein_coding	OTTHUMT00000252332.1		0.00	31	0	G	NM_002609		149499606	-1	tier1		no_errors	ENST00000261799	ensembl	human	known	74_37	frame_shift_del	22.22	7	2	DEL	0.947	-
PDSS2	57107	genome.wustl.edu	37	6	107595332	107595332	+	Silent	SNP	T	T	C			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr6:107595332T>C	ENST00000369037.4	-	3	808	c.531A>G	c.(529-531)ccA>ccG	p.P177P	PDSS2_ENST00000369031.4_Silent_p.P177P|PDSS2_ENST00000453874.2_Silent_p.P177P	NM_020381.3	NP_065114.3	Q86YH6	DLP1_HUMAN	prenyl (decaprenyl) diphosphate synthase, subunit 2	177					isoprenoid biosynthetic process (GO:0008299)|protein heterotetramerization (GO:0051290)|regulation of body fluid levels (GO:0050878)|small molecule metabolic process (GO:0044281)|ubiquinone biosynthetic process (GO:0006744)	cytoplasm (GO:0005737)|mitochondrial matrix (GO:0005759)	protein heterodimerization activity (GO:0046982)|trans-hexaprenyltranstransferase activity (GO:0000010)|trans-octaprenyltranstransferase activity (GO:0050347)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(8)|ovary(3)	19	Breast(9;0.0127)	all_cancers(87;3.63e-05)|Acute lymphoblastic leukemia(125;2.86e-08)|all_hematologic(75;1.14e-06)|all_epithelial(87;0.0108)|Colorectal(196;0.156)|Lung NSC(302;0.211)	BRCA - Breast invasive adenocarcinoma(8;0.0101)|all cancers(7;0.243)	BRCA - Breast invasive adenocarcinoma(108;0.112)|OV - Ovarian serous cystadenocarcinoma(136;0.173)|all cancers(137;0.191)		TGTCTTTCAGTGGACCATCAG	0.408																																																	0													110.0	104.0	106.0					6																	107595332		2203	4300	6503	SO:0001819	synonymous_variant	0			AF254956	CCDS5059.1	6q21	2006-02-14	2006-02-14	2006-02-14	ENSG00000164494	ENSG00000164494			23041	protein-coding gene	gene with protein product		610564	"""chromosome 6 open reading frame 210"""	C6orf210		16262699	Standard	NM_020381		Approved	bA59I9.3	uc003prt.2	Q86YH6	OTTHUMG00000059359	ENST00000369037.4:c.531A>G	6.37:g.107595332T>C			Q33DR4|Q4G158|Q5VU38|Q5VU39|Q9NR58	Silent	SNP	pfam_Polyprenyl_synt,superfamily_Terpenoid_synth	p.P177	ENST00000369037.4	37	c.531	CCDS5059.1	6																																																																																			PDSS2	-	pfam_Polyprenyl_synt,superfamily_Terpenoid_synth	ENSG00000164494		0.408	PDSS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDSS2	HGNC	protein_coding	OTTHUMT00000131954.1		0.00	54	0	T	NM_020381		107595332	-1			no_errors	ENST00000369037	ensembl	human	known	74_37	silent	10.71	25	3	SNP	0.988	C
PEG3	5178	genome.wustl.edu	37	19	57327528	57327528	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr19:57327528T>G	ENST00000326441.9	-	10	2645	c.2282A>C	c.(2281-2283)aAg>aCg	p.K761T	ZIM2_ENST00000601070.1_Intron|PEG3_ENST00000598410.1_Missense_Mutation_p.K637T|ZIM2_ENST00000599935.1_Intron|ZIM2_ENST00000221722.5_Intron|ZIM2_ENST00000593711.1_Intron|PEG3_ENST00000593695.1_Missense_Mutation_p.K635T|PEG3_ENST00000423103.2_Missense_Mutation_p.K761T|ZIM2_ENST00000391708.3_Intron	NM_006210.2	NP_006201.1	Q9GZU2	PEG3_HUMAN	paternally expressed 3	761					apoptotic process (GO:0006915)|genetic imprinting (GO:0071514)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			NS(1)|biliary_tract(4)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(27)|lung(84)|ovary(8)|pancreas(5)|prostate(6)|skin(8)|stomach(2)|upper_aerodigestive_tract(6)	170		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0269)		AGTGGGAATCTTCTGGTTTTC	0.408																																																	0													165.0	162.0	163.0					19																	57327528		2203	4300	6503	SO:0001583	missense	0			AB006625	CCDS12948.1, CCDS58684.1, CCDS58685.1	19q13.4	2013-01-09				ENSG00000198300		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	8826	protein-coding gene	gene with protein product		601483				9149948	Standard	NM_006210		Approved	ZKSCAN22, KIAA0287, ZNF904, ZSCAN24	uc010etr.2	Q9GZU2		ENST00000326441.9:c.2282A>C	19.37:g.57327528T>G	ENSP00000326581:p.Lys761Thr		A7E2B8|B4DIM4|C9JP50|P78418|Q5H9P9|Q7Z7H7|Q8TF75|Q9GZY2	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Tscrpt_reg_SCAN,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Tscrpt_reg_SCAN	p.K761T	ENST00000326441.9	37	c.2282	CCDS12948.1	19	.	.	.	.	.	.	.	.	.	.	T	10.82	1.458638	0.26248	.	.	ENSG00000198300	ENST00000326441;ENST00000423103	T;T	0.02787	4.16;4.16	4.16	-0.824	0.10812	.	0.609688	0.14777	N	0.299023	T	0.02970	0.0088	L	0.49778	1.585	.	.	.	B;B;B	0.17852	0.004;0.024;0.024	B;B;B	0.12156	0.003;0.007;0.007	T	0.21245	-1.0251	9	0.54805	T	0.06	-4.1014	4.5709	0.12208	0.0:0.3255:0.342:0.3325	.	637;761;696	A7E2B8;Q9GZU2;Q96Q96	.;PEG3_HUMAN;.	T	761	ENSP00000326581:K761T;ENSP00000403051:K761T	ENSP00000326581:K761T	K	-	2	0	ZIM2	62019340	0.000000	0.05858	0.000000	0.03702	0.207000	0.24258	-1.235000	0.02928	-0.218000	0.10018	0.438000	0.28831	AAG	PEG3	-	NULL	ENSG00000198300		0.408	PEG3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PEG3	HGNC	protein_coding	OTTHUMT00000416099.2	-	0.00	45	0	T			57327528	-1	tier1	-	no_errors	ENST00000326441	ensembl	human	known	74_37	missense	34.48	19	10	SNP	0.000	G
JADE1	79960	genome.wustl.edu	37	4	129783293	129783293	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr4:129783293T>G	ENST00000226319.6	+	9	1696	c.1416T>G	c.(1414-1416)gaT>gaG	p.D472E	PHF17_ENST00000511647.1_Missense_Mutation_p.D472E|PHF17_ENST00000452328.2_Missense_Mutation_p.D460E|PHF17_ENST00000512960.1_Missense_Mutation_p.D472E|PHF17_ENST00000413543.2_Missense_Mutation_p.D472E	NM_199320.2	NP_955352.1														NS(1)|breast(2)|endometrium(1)|kidney(2)|large_intestine(10)|lung(10)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	29						CAAAGAAAGATGAAGAGGACA	0.517																																																	0													72.0	75.0	74.0					4																	129783293		2203	4300	6503	SO:0001583	missense	0																														ENST00000226319.6:c.1416T>G	4.37:g.129783293T>G	ENSP00000226319:p.Asp472Glu			Missense_Mutation	SNP	pfam_Enhancer_polycomb-like_N,pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,pfscan_Znf_PHD-finger	p.D472E	ENST00000226319.6	37	c.1416	CCDS34062.1	4	.	.	.	.	.	.	.	.	.	.	T	10.23	1.293052	0.23564	.	.	ENSG00000077684	ENST00000226319;ENST00000511647;ENST00000452328;ENST00000512960;ENST00000535321;ENST00000413543	T;T;T;T;T	0.39997	1.15;1.05;1.16;1.15;1.05	5.22	0.296	0.15757	.	0.047154	0.85682	D	0.000000	T	0.36220	0.0959	L	0.43757	1.38	0.47905	D	0.99954	P;D;B	0.54207	0.668;0.965;0.007	B;P;B	0.49708	0.283;0.62;0.044	T	0.07908	-1.0748	9	.	.	.	.	5.8645	0.18767	0.0:0.3038:0.1465:0.5497	.	460;472;472	Q6IE81-2;Q6IE81;Q6IE81-3	.;JADE1_HUMAN;.	E	472;472;460;472;472;472	ENSP00000226319:D472E;ENSP00000423737:D472E;ENSP00000388015:D460E;ENSP00000425730:D472E;ENSP00000404211:D472E	.	D	+	3	2	PHF17	130002743	0.003000	0.15002	0.992000	0.48379	0.222000	0.24845	-1.413000	0.02473	-0.158000	0.11040	-1.125000	0.01998	GAT	PHF17	-	NULL	ENSG00000077684		0.517	PHF17-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PHF17	HGNC	protein_coding	OTTHUMT00000364280.1	-	0.00	37	0	T			129783293	+1	tier1	-	no_errors	ENST00000226319	ensembl	human	known	74_37	missense	16.67	15	3	SNP	0.981	G
PHYHIPL	84457	genome.wustl.edu	37	10	60994184	60994184	+	Nonsense_Mutation	SNP	C	C	G			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr10:60994184C>G	ENST00000373880.4	+	2	491	c.227C>G	c.(226-228)tCa>tGa	p.S76*	PHYHIPL_ENST00000373878.3_Nonsense_Mutation_p.S50*	NM_032439.3	NP_115815.2	Q96FC7	PHIPL_HUMAN	phytanoyl-CoA 2-hydroxylase interacting protein-like	76	Fibronectin type-III. {ECO:0000255|PROSITE-ProRule:PRU00316}.					cytoplasm (GO:0005737)|mitochondrion (GO:0005739)				NS(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(3)|liver(2)|lung(3)|skin(1)|urinary_tract(1)	18						GATTCAAAATCAAAGGATCGC	0.338																																																	0													107.0	95.0	99.0					10																	60994184		2203	4300	6503	SO:0001587	stop_gained	0			AL834339	CCDS7254.1, CCDS44405.1	10q21.1	2013-02-11	2006-01-09		ENSG00000165443	ENSG00000165443		"""Fibronectin type III domain containing"""	29378	protein-coding gene	gene with protein product			"""phytanoyl-CoA hydroxylase interacting protein-like"""			11347906	Standard	NM_032439		Approved	KIAA1796, Em:AC025038.1	uc001jkk.4	Q96FC7	OTTHUMG00000018276	ENST00000373880.4:c.227C>G	10.37:g.60994184C>G	ENSP00000362987:p.Ser76*		B7WP61|Q68DF3|Q6UXY3|Q8N3W3|Q96JM9|Q96NP7	Nonsense_Mutation	SNP	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,pfscan_Fibronectin_type3	p.S76*	ENST00000373880.4	37	c.227	CCDS7254.1	10	.	.	.	.	.	.	.	.	.	.	C	38	6.646211	0.97730	.	.	ENSG00000165443	ENST00000373880;ENST00000373878	.	.	.	5.62	5.62	0.85841	.	0.184743	0.38058	N	0.001831	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.45353	T	0.12	-40.441	20.024	0.97514	0.0:1.0:0.0:0.0	.	.	.	.	X	76;50	.	ENSP00000362985:S50X	S	+	2	0	PHYHIPL	60664190	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.021000	0.41020	2.809000	0.96659	0.655000	0.94253	TCA	PHYHIPL	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000165443		0.338	PHYHIPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHYHIPL	HGNC	protein_coding	OTTHUMT00000048156.1	-	0.00	36	0	C	NM_032439		60994184	+1	tier1	-	no_errors	ENST00000373880	ensembl	human	known	74_37	nonsense	22.86	27	8	SNP	1.000	G
PIGQ	9091	genome.wustl.edu	37	16	631226	631226	+	Intron	SNP	C	C	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr16:631226C>T	ENST00000026218.5	+	9	1619				PIGQ_ENST00000321878.5_Intron|PIGQ_ENST00000409527.2_Intron	NM_148920.2	NP_683721.1	Q9BRB3	PIGQ_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class Q						C-terminal protein lipidation (GO:0006501)|carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|preassembly of GPI anchor in ER membrane (GO:0016254)	endoplasmic reticulum membrane (GO:0005789)|glycosylphosphatidylinositol-N-acetylglucosaminyltransferase (GPI-GnT) complex (GO:0000506)|integral component of membrane (GO:0016021)	phosphatidylinositol N-acetylglucosaminyltransferase activity (GO:0017176)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)	13		Hepatocellular(780;0.00335)				CCTGAGGCCACAGGCCTTTGT	0.612																																																	0																																										SO:0001627	intron_variant	0			AB003723	CCDS10411.1, CCDS10412.1	16p13.3	2013-03-28	2006-06-28		ENSG00000007541	ENSG00000007541		"""Phosphatidylinositol glycan anchor biosynthesis"""	14135	protein-coding gene	gene with protein product		605754	"""phosphatidylinositol glycan, class Q"""			9463366, 9729469	Standard	NM_004204		Approved	hGPI1, GPI1	uc002cho.3	Q9BRB3	OTTHUMG00000168047	ENST00000026218.5:c.1531+254C>T	16.37:g.631226C>T			A2IDE1|D3DU52|O14927|Q96G00|Q96S22|Q9UJH4	Missense_Mutation	SNP	pfam_GlcNAc_Gpi1	p.T534I	ENST00000026218.5	37	c.1601	CCDS10411.1	16																																																																																			PIGQ	-	NULL	ENSG00000007541		0.612	PIGQ-002	KNOWN	basic|CCDS	protein_coding	PIGQ	HGNC	protein_coding	OTTHUMT00000239270.2	-	0.00	43	0	C	NM_004204		631226	+1	tier1	-	no_errors	ENST00000443147	ensembl	human	known	74_37	missense	26.09	17	6	SNP	0.000	T
PIEZO1	9780	genome.wustl.edu	37	16	88787614	88787614	+	Silent	SNP	C	C	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr16:88787614C>T	ENST00000301015.9	-	39	5874	c.5628G>A	c.(5626-5628)agG>agA	p.R1876R	PIEZO1_ENST00000327397.7_5'Flank|RP5-1142A6.9_ENST00000564984.1_RNA	NM_001142864.2	NP_001136336.2	Q92508	PIEZ1_HUMAN	piezo-type mechanosensitive ion channel component 1	1876					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|detection of mechanical stimulus (GO:0050982)|positive regulation of cell-cell adhesion mediated by integrin (GO:0033634)|positive regulation of integrin activation (GO:0033625)|regulation of membrane potential (GO:0042391)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cation channel activity (GO:0005261)|mechanically-gated ion channel activity (GO:0008381)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(2)|prostate(2)|skin(1)	10						CCTCCTTCTTCCTTCTTCTAA	0.607																																																	0													32.0	32.0	32.0					16																	88787614		691	1584	2275	SO:0001819	synonymous_variant	0			D87071	CCDS54058.1	16q24.3	2011-08-31	2011-08-31	2011-08-31	ENSG00000103335	ENSG00000103335			28993	protein-coding gene	gene with protein product		611184	"""family with sequence similarity 38, member A"""	FAM38A		20813920, 21056836, 21299953, 21696149	Standard	NM_001142864		Approved	KIAA0233	uc010vpb.2	Q92508	OTTHUMG00000156776	ENST00000301015.9:c.5628G>A	16.37:g.88787614C>T			A6NHT9|A7E2B7|Q0KKZ9	Silent	SNP	pfam_Piezo	p.R1876	ENST00000301015.9	37	c.5628	CCDS54058.1	16	.	.	.	.	.	.	.	.	.	.	C	0.731	-0.779812	0.02929	.	.	ENSG00000103335	ENST00000451779	.	.	.	4.63	1.54	0.23209	.	.	.	.	.	T	0.32823	0.0842	.	.	.	0.19300	N	0.999976	.	.	.	.	.	.	T	0.23619	-1.0183	4	.	.	.	-17.7773	7.6862	0.28542	0.0:0.6453:0.0:0.3547	.	.	.	.	K	1822	.	.	E	-	1	0	FAM38A	87315115	0.000000	0.05858	0.004000	0.12327	0.015000	0.08874	-0.255000	0.08769	0.135000	0.18707	0.448000	0.29417	GAA	PIEZO1	-	NULL	ENSG00000103335		0.607	PIEZO1-001	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	PIEZO1	HGNC	protein_coding	OTTHUMT00000345699.4		0.00	34	0	C	NM_014745		88787614	-1			no_errors	ENST00000301015	ensembl	human	novel	74_37	silent	6.90	27	2	SNP	0.190	T
PIK3C2A	5286	genome.wustl.edu	37	11	17144279	17144279	+	Frame_Shift_Del	DEL	T	T	-			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr11:17144279delT	ENST00000265970.7	-	13	2480	c.2481delA	c.(2479-2481)aaafs	p.K827fs	PIK3C2A_ENST00000531428.1_Intron|PIK3C2A_ENST00000540361.1_Frame_Shift_Del_p.K447fs	NM_002645.2	NP_002636.2	O00443	P3C2A_HUMAN	phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 alpha	827	C2 PI3K-type. {ECO:0000255|PROSITE- ProRule:PRU00041, ECO:0000255|PROSITE- ProRule:PRU00880}.				clathrin coat assembly (GO:0048268)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|exocytosis (GO:0006887)|insulin receptor signaling pathway (GO:0008286)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|small molecule metabolic process (GO:0044281)|vascular smooth muscle contraction (GO:0014829)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol binding (GO:0035091)			central_nervous_system(4)|endometrium(5)|kidney(5)|large_intestine(7)|lung(24)|ovary(3)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	58						TGACATATCCTTTTTTGGTAA	0.333																																																	0																																										SO:0001589	frameshift_variant	0			Y13367	CCDS7824.1	11p15.5-p14	2012-07-13	2012-07-13			ENSG00000011405	2.7.1.154		8971	protein-coding gene	gene with protein product		603601	"""phosphoinositide-3-kinase, class 2, alpha polypeptide"""			9337861	Standard	NM_002645		Approved	PI3K-C2alpha	uc001mmq.4	O00443		ENST00000265970.7:c.2481delA	11.37:g.17144279delT	ENSP00000265970:p.Lys827fs		B0LPH2|B4E2G4|Q14CQ9	Frame_Shift_Del	DEL	pfam_PI3/4_kinase_cat_dom,pfam_PInositide-3_kin_accessory_dom,pfam_PI3K_C2_dom,pfam_PI3K_Ras-bd_dom,pfam_Phox,pfam_C2_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_dom,superfamily_Phox,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,smart_Phox,pfscan_C2_dom,pfscan_Phox,pfscan_PI3/4_kinase_cat_dom	p.G828fs	ENST00000265970.7	37	c.2481	CCDS7824.1	11																																																																																			PIK3C2A	-	pfam_PI3K_C2_dom,superfamily_C2_dom	ENSG00000011405		0.333	PIK3C2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIK3C2A	HGNC	protein_coding	OTTHUMT00000387553.1		0.00	54	0	T	NM_002645		17144279	-1	tier1		no_errors	ENST00000265970	ensembl	human	known	74_37	frame_shift_del	9.09	30	3	DEL	1.000	-
PIK3R4	30849	genome.wustl.edu	37	3	130409453	130409453	+	Silent	SNP	G	G	A			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr3:130409453G>A	ENST00000356763.3	-	14	3701	c.3144C>T	c.(3142-3144)ctC>ctT	p.L1048L	PIK3R4_ENST00000512677.1_5'UTR	NM_014602.2	NP_055417.1	Q99570	PI3R4_HUMAN	phosphoinositide-3-kinase, regulatory subunit 4	1048					innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)	axoneme (GO:0005930)|cytosol (GO:0005829)|late endosome (GO:0005770)|membrane (GO:0016020)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.L1048L(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(6)|kidney(6)|large_intestine(16)|lung(28)|ovary(6)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|urinary_tract(1)	77						GGCAGAATGTGAGCGTCTTGA	0.403																																																	1	Substitution - coding silent(1)	large_intestine(1)											113.0	108.0	110.0					3																	130409453		2203	4300	6503	SO:0001819	synonymous_variant	0			Y08991	CCDS3067.1	3q22.1	2013-01-10	2008-02-04		ENSG00000196455	ENSG00000196455		"""WD repeat domain containing"""	8982	protein-coding gene	gene with protein product		602610				8999962	Standard	NM_014602		Approved	VPS15, p150	uc003enj.3	Q99570	OTTHUMG00000159645	ENST00000356763.3:c.3144C>T	3.37:g.130409453G>A			Q2TBF4	Silent	SNP	pfam_Prot_kinase_dom,pfam_WD40_repeat,pfam_HEAT,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_WD40_repeat,pfscan_HEAT_type_2,pfscan_Prot_kinase_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.L1048	ENST00000356763.3	37	c.3144	CCDS3067.1	3																																																																																			PIK3R4	-	superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000196455		0.403	PIK3R4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIK3R4	HGNC	protein_coding	OTTHUMT00000356668.1	-	0.00	25	0	G	NM_014602		130409453	-1	tier1	-	no_errors	ENST00000356763	ensembl	human	known	74_37	silent	52.17	11	12	SNP	0.962	A
PIP	5304	genome.wustl.edu	37	7	142836654	142836654	+	Missense_Mutation	SNP	A	A	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr7:142836654A>T	ENST00000291009.3	+	4	400	c.360A>T	c.(358-360)ttA>ttT	p.L120F		NM_002652.2	NP_002643.1	P12273	PIP_HUMAN	prolactin-induced protein	120					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|negative regulation of T cell apoptotic process (GO:0070233)|positive regulation of gene expression (GO:0010628)|proteolysis (GO:0006508)|regulation of immune system process (GO:0002682)|retina homeostasis (GO:0001895)	apical plasma membrane (GO:0016324)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	actin binding (GO:0003779)|aspartic-type endopeptidase activity (GO:0004190)|glycoprotein binding (GO:0001948)|IgG binding (GO:0019864)|protein dimerization activity (GO:0046983)			NS(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(7)|ovary(1)|skin(1)	18	Melanoma(164;0.059)	Ovarian(593;2.82e-05)|Breast(660;0.012)		BRCA - Breast invasive adenocarcinoma(188;0.0026)|LUSC - Lung squamous cell carcinoma(290;0.0733)|Lung(243;0.08)		TTCGGGAATTAGGCATCTGCC	0.453																																																	0													172.0	163.0	166.0					7																	142836654		2203	4299	6502	SO:0001583	missense	0				CCDS34768.1	7q34	2013-09-19			ENSG00000159763	ENSG00000159763			8993	protein-coding gene	gene with protein product	"""prolactin-inducible protein"""	176720				2727805, 1955075	Standard	NM_002652		Approved	GCDFP-15, GCDFP15, GPIP4	uc003wcf.1	P12273	OTTHUMG00000152635	ENST00000291009.3:c.360A>T	7.37:g.142836654A>T	ENSP00000291009:p.Leu120Phe		A0A963|A0A9C3|A0A9F3|A4D2I1	Missense_Mutation	SNP	pfam_SV_autoAg,pirsf_SV_autoAg	p.L120F	ENST00000291009.3	37	c.360	CCDS34768.1	7	.	.	.	.	.	.	.	.	.	.	A	11.83	1.755317	0.31046	.	.	ENSG00000159763	ENST00000291009	T	0.14640	2.49	4.78	-5.36	0.02689	.	2.647220	0.01594	N	0.021737	T	0.24431	0.0592	L	0.57536	1.79	0.09310	N	1	D	0.61697	0.99	P	0.57679	0.825	T	0.46076	-0.9217	10	0.52906	T	0.07	.	6.4326	0.21805	0.4144:0.0:0.4541:0.1315	.	120	P12273	PIP_HUMAN	F	120	ENSP00000291009:L120F	ENSP00000291009:L120F	L	+	3	2	PIP	142546776	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	-0.499000	0.06413	-1.074000	0.03132	-0.250000	0.11733	TTA	PIP	-	pfam_SV_autoAg,pirsf_SV_autoAg	ENSG00000159763		0.453	PIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIP	HGNC	protein_coding	OTTHUMT00000327089.1	-	0.00	45	0	A	NM_002652		142836654	+1	tier1	-	no_errors	ENST00000291009	ensembl	human	known	74_37	missense	15.79	16	3	SNP	0.000	T
PIWIL1	9271	genome.wustl.edu	37	12	130833904	130833904	+	Silent	SNP	C	C	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr12:130833904C>T	ENST00000245255.3	+	8	1127	c.855C>T	c.(853-855)aaC>aaT	p.N285N		NM_001190971.1|NM_004764.4	NP_001177900.1|NP_004755.2	Q96J94	PIWL1_HUMAN	piwi-like RNA-mediated gene silencing 1	285	PAZ. {ECO:0000255|PROSITE- ProRule:PRU00142}.				gene silencing by RNA (GO:0031047)|meiotic nuclear division (GO:0007126)|multicellular organismal development (GO:0007275)|piRNA metabolic process (GO:0034587)|regulation of translation (GO:0006417)|spermatid development (GO:0007286)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|mRNA cap binding complex (GO:0005845)|P granule (GO:0043186)|polysome (GO:0005844)	mRNA binding (GO:0003729)|piRNA binding (GO:0034584)|single-stranded RNA binding (GO:0003727)			breast(6)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(8)|lung(26)|ovary(2)|prostate(4)|skin(3)|urinary_tract(1)	57	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;3.02e-06)|Epithelial(86;3.85e-05)|all cancers(50;4.65e-05)		TCATGTTCAACTTTTATCATC	0.358																																																	0													98.0	90.0	93.0					12																	130833904		2203	4300	6503	SO:0001819	synonymous_variant	0			AF104260	CCDS9268.1	12q24.33	2014-01-21	2013-02-15		ENSG00000125207	ENSG00000125207		"""Argonaute/PIWI family"""	9007	protein-coding gene	gene with protein product		605571	"""piwi (Drosophila)-like 1"", ""piwi-like 1 (Drosophila)"""			9851978, 12906857	Standard	NM_004764		Approved	PIWI, HIWI, CT80.1	uc001uik.3	Q96J94	OTTHUMG00000168382	ENST00000245255.3:c.855C>T	12.37:g.130833904C>T			A4F266|O95404|Q8NA60|Q8TBY5|Q96JD5	Silent	SNP	pfam_Piwi,pfam_PAZ_dom,pfam_GAGE,superfamily_RNaseH-like_dom,superfamily_PAZ_dom,smart_PAZ_dom,smart_Piwi,pfscan_PAZ_dom,pfscan_Piwi	p.N285	ENST00000245255.3	37	c.855	CCDS9268.1	12																																																																																			PIWIL1	-	pfam_PAZ_dom,superfamily_PAZ_dom,smart_PAZ_dom,pfscan_PAZ_dom	ENSG00000125207		0.358	PIWIL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIWIL1	HGNC	protein_coding	OTTHUMT00000399510.1	-	0.00	66	0	C			130833904	+1	tier1	-	no_errors	ENST00000245255	ensembl	human	known	74_37	silent	20.59	27	7	SNP	0.218	T
PIWIL3	440822	genome.wustl.edu	37	22	25151828	25151828	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr22:25151828C>G	ENST00000332271.5	-	6	1031	c.615G>C	c.(613-615)aaG>aaC	p.K205N	PIWIL3_ENST00000533313.1_Missense_Mutation_p.K96N|PIWIL3_ENST00000532537.2_5'UTR|PIWIL3_ENST00000527701.1_Missense_Mutation_p.K96N	NM_001008496.3|NM_001255975.1	NP_001008496.2|NP_001242904.1	Q7Z3Z3	PIWL3_HUMAN	piwi-like RNA-mediated gene silencing 3	205					cell differentiation (GO:0030154)|gene silencing by RNA (GO:0031047)|meiotic nuclear division (GO:0007126)|multicellular organismal development (GO:0007275)|regulation of translation (GO:0006417)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)	RNA binding (GO:0003723)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(14)|lung(15)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	50						CAACTGTAATCTTCACGATGT	0.378																																																	0													147.0	139.0	142.0					22																	25151828		2203	4300	6503	SO:0001583	missense	0			AB079368	CCDS33623.1	22q11.23	2013-02-15	2013-02-15		ENSG00000184571	ENSG00000184571		"""Argonaute/PIWI family"""	18443	protein-coding gene	gene with protein product		610314	"""piwi-like 3 (Drosophila)"""			12906857	Standard	NM_001008496		Approved	HIWI3	uc003abd.2	Q7Z3Z3	OTTHUMG00000150788	ENST00000332271.5:c.615G>C	22.37:g.25151828C>G	ENSP00000330031:p.Lys205Asn			Missense_Mutation	SNP	pfam_Piwi,pfam_PAZ_dom,superfamily_RNaseH-like_dom,superfamily_PAZ_dom,smart_PAZ_dom,smart_Piwi,pfscan_PAZ_dom,pfscan_Piwi	p.K205N	ENST00000332271.5	37	c.615	CCDS33623.1	22	.	.	.	.	.	.	.	.	.	.	C	11.69	1.714139	0.30413	.	.	ENSG00000184571	ENST00000332271;ENST00000533313;ENST00000527701	T;T;T	0.10192	2.9;2.9;2.9	2.52	2.52	0.30459	Argonaute/Dicer protein, PAZ (1);	0.421963	0.25052	U	0.033508	T	0.15825	0.0381	L	0.57536	1.79	0.34246	D	0.678179	P;P;P	0.47910	0.902;0.613;0.781	P;B;B	0.47626	0.552;0.179;0.334	T	0.29366	-1.0014	10	0.56958	D	0.05	-7.5414	11.1927	0.48693	0.0:1.0:0.0:0.0	.	96;205;205	E9PIP6;B4DYF7;Q7Z3Z3	.;.;PIWL3_HUMAN	N	205;96;96	ENSP00000330031:K205N;ENSP00000431843:K96N;ENSP00000435718:K96N	ENSP00000330031:K205N	K	-	3	2	PIWIL3	23481828	1.000000	0.71417	0.027000	0.17364	0.004000	0.04260	2.160000	0.42348	1.739000	0.51704	0.462000	0.41574	AAG	PIWIL3	-	superfamily_PAZ_dom	ENSG00000184571		0.378	PIWIL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIWIL3	HGNC	protein_coding	OTTHUMT00000320084.2	-	0.00	43	0	C	NM_001008496		25151828	-1	tier1	-	no_errors	ENST00000332271	ensembl	human	known	74_37	missense	20.00	32	8	SNP	0.787	G
PKD1L3	342372	genome.wustl.edu	37	16	72020240	72020240	+	RNA	SNP	G	G	A	rs372906367	byFrequency	TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr16:72020240G>A	ENST00000534738.1	-	0	713							Q7Z443	PK1L3_HUMAN	polycystic kidney disease 1-like 3						cation transport (GO:0006812)|cellular response to acidic pH (GO:0071468)|detection of chemical stimulus involved in sensory perception of sour taste (GO:0001581)|neuropeptide signaling pathway (GO:0007218)|sensory perception of sour taste (GO:0050915)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|carbohydrate binding (GO:0030246)			autonomic_ganglia(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|lung(3)|skin(2)	22						TGACAGACACGGGCATGGTGA	0.488													G|||	7	0.00139776	0.0053	0.0	5008	,	,		19583	0.0		0.0	False		,,,				2504	0.0																0								G		2,1382		0,2,690	184.0	143.0	155.0		714	-0.9	0.0	16		155	0,3182		0,0,1591	no	coding-synonymous	PKD1L3	NM_181536.1		0,2,2281	AA,AG,GG		0.0,0.1445,0.0438		238/1733	72020240	2,4564	692	1591	2283			0			AY164485	CCDS73912.1	16q22.2	2008-02-05				ENSG00000277481			21716	protein-coding gene	gene with protein product		607895				12782129	Standard	NM_181536		Approved		uc010vmm.2	Q7Z443			16.37:g.72020240G>A				RNA	SNP	-	NULL	ENST00000534738.1	37	NULL		16																																																																																			PKD1L3	-	-	ENSG00000187008		0.488	PKD1L3-001	KNOWN	basic	processed_transcript	PKD1L3	HGNC	processed_transcript	OTTHUMT00000387876.1		0.00	46	0	G	NM_181536		72020240	-1			no_errors	ENST00000335106	ensembl	human	known	74_37	rna	14.29	18	3	SNP	0.000	A
PKD2	5311	genome.wustl.edu	37	4	88967995	88967995	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr4:88967995G>T	ENST00000237596.2	+	6	1587	c.1521G>T	c.(1519-1521)tgG>tgT	p.W507C	PKD2_ENST00000508588.1_Intron	NM_000297.3	NP_000288.1	Q9BZL6	KPCD2_HUMAN	polycystic kidney disease 2 (autosomal dominant)	0	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell death (GO:0008219)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|endothelial tube morphogenesis (GO:0061154)|intracellular signal transduction (GO:0035556)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell adhesion (GO:0045785)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of endothelial cell chemotaxis (GO:2001028)|positive regulation of endothelial cell chemotaxis by VEGF-activated vascular endothelial growth factor receptor signaling pathway (GO:0038033)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of histone deacetylase activity (GO:1901727)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of intracellular signal transduction (GO:1902533)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of T cell receptor signaling pathway (GO:0050862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|T cell receptor signaling pathway (GO:0050852)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|endometrium(4)|kidney(1)|large_intestine(8)|liver(2)|lung(15)|skin(4)|upper_aerodigestive_tract(1)	36		Hepatocellular(203;0.114)|Acute lymphoblastic leukemia(40;0.221)		OV - Ovarian serous cystadenocarcinoma(123;9.98e-10)|COAD - Colon adenocarcinoma(81;0.0237)		GGAGTTTCTGGAATTGTCTGG	0.363																																																	0													150.0	146.0	147.0					4																	88967995		2203	4300	6503	SO:0001583	missense	0			U50928	CCDS3627.1	4q22.1	2014-01-28			ENSG00000118762	ENSG00000118762		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""EF-hand domain containing"""	9009	protein-coding gene	gene with protein product	"""transient receptor potential cation channel, subfamily P, member 2"""	173910				8298643	Standard	NM_000297		Approved	PKD4, PC2, Pc-2, TRPP2	uc003hre.3	Q13563	OTTHUMG00000160982	ENST00000237596.2:c.1521G>T	4.37:g.88967995G>T	ENSP00000237596:p.Trp507Cys		Q8TB08|Q9P0T6|Q9Y3X8	Missense_Mutation	SNP	pfam_PKD1_2_channel,pfam_Ion_trans_dom,pfscan_EF_hand_dom,prints_PKD_2,prints_PKD_1	p.W507C	ENST00000237596.2	37	c.1521	CCDS3627.1	4	.	.	.	.	.	.	.	.	.	.	G	19.88	3.909800	0.72983	.	.	ENSG00000118762	ENST00000237596	T	0.79940	-1.32	5.62	4.78	0.61160	Polycystin cation channel, PKD1/PKD2 (1);	0.000000	0.85682	D	0.000000	D	0.91653	0.7362	M	0.92691	3.335	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.93293	0.6670	10	0.66056	D	0.02	-14.6466	14.4727	0.67526	0.0704:0.0:0.9296:0.0	.	507	Q13563	PKD2_HUMAN	C	507	ENSP00000237596:W507C	ENSP00000237596:W507C	W	+	3	0	PKD2	89187019	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.823000	0.99369	1.377000	0.46286	0.591000	0.81541	TGG	PKD2	-	pfam_PKD1_2_channel,pfam_Ion_trans_dom,prints_PKD_2	ENSG00000118762		0.363	PKD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PKD2	HGNC	protein_coding	OTTHUMT00000253042.4		0.00	88	0	G	NM_000297		88967995	+1			no_errors	ENST00000237596	ensembl	human	known	74_37	missense	5.88	32	2	SNP	1.000	T
PKHD1	5314	genome.wustl.edu	37	6	51503655	51503655	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr6:51503655G>A	ENST00000371117.3	-	64	11773	c.11498C>T	c.(11497-11499)tCt>tTt	p.S3833F		NM_138694.3	NP_619639.3	P08F94	PKHD1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)	3833					cellular calcium ion homeostasis (GO:0006874)|cilium assembly (GO:0042384)|homeostatic process (GO:0042592)|kidney development (GO:0001822)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular component movement (GO:0051271)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein kinase B signaling (GO:0051898)|positive regulation of cell proliferation (GO:0008284)|regulation of centrosome duplication (GO:0010824)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of TOR signaling (GO:0032006)|single organismal cell-cell adhesion (GO:0016337)	anchored component of external side of plasma membrane (GO:0031362)|apical plasma membrane (GO:0016324)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|primary cilium (GO:0072372)	receptor activity (GO:0004872)			NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(5)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(59)|lung(139)|ovary(16)|prostate(8)|skin(20)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(7)|urinary_tract(5)	304	Lung NSC(77;0.0605)					ACCTGGAGGAGAAGTGACAGT	0.373																																																	0													137.0	140.0	139.0					6																	51503655		2203	4300	6503	SO:0001583	missense	0			AF480064	CCDS4935.1, CCDS4936.1	6p21.2-p12	2012-11-26	2003-04-16		ENSG00000170927	ENSG00000170927			9016	protein-coding gene	gene with protein product	"""tigmin"", ""polyductin"", ""fibrocystin"""	606702	"""TIG multiple domains 1"""	TIGM1		9503014	Standard	NM_138694		Approved	ARPKD, FCYT	uc003pah.1	P08F94	OTTHUMG00000014841	ENST00000371117.3:c.11498C>T	6.37:g.51503655G>A	ENSP00000360158:p.Ser3833Phe		Q5VUA2|Q5VUA3|Q5VWV1|Q86Z26|Q8TCZ9	Missense_Mutation	SNP	pfam_IPT,pfam_G8_domain,superfamily_Ig_E-set,superfamily_Pectin_lyase_fold/virulence,smart_IPT,smart_PbH1	p.S3833F	ENST00000371117.3	37	c.11498	CCDS4935.1	6	.	.	.	.	.	.	.	.	.	.	G	12.87	2.066936	0.36470	.	.	ENSG00000170927	ENST00000371117	D	0.86627	-2.15	5.7	1.92	0.25849	.	0.337841	0.29225	N	0.012777	T	0.63663	0.2530	L	0.31664	0.95	0.80722	D	1	B	0.32071	0.355	B	0.28638	0.092	T	0.59172	-0.7504	10	0.39692	T	0.17	.	7.3509	0.26691	0.3473:0.0:0.6527:0.0	.	3833	P08F94	PKHD1_HUMAN	F	3833	ENSP00000360158:S3833F	ENSP00000360158:S3833F	S	-	2	0	PKHD1	51611614	0.998000	0.40836	0.985000	0.45067	0.976000	0.68499	1.313000	0.33585	0.331000	0.23511	0.585000	0.79938	TCT	PKHD1	-	NULL	ENSG00000170927		0.373	PKHD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PKHD1	HGNC	protein_coding	OTTHUMT00000040893.1		0.00	52	0	G	NM_138694		51503655	-1			no_errors	ENST00000371117	ensembl	human	known	74_37	missense	10.71	25	3	SNP	0.853	A
PLA2G4F	255189	genome.wustl.edu	37	15	42434796	42434796	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr15:42434796C>A	ENST00000382396.4	-	19	2345	c.2259G>T	c.(2257-2259)gaG>gaT	p.E753D	PLA2G4F_ENST00000397272.3_Missense_Mutation_p.E755D			Q68DD2	PA24F_HUMAN	phospholipase A2, group IVF	753	PLA2c. {ECO:0000255|PROSITE- ProRule:PRU00555}.				arachidonic acid secretion (GO:0050482)|cellular response to antibiotic (GO:0071236)|cellular response to organic cyclic compound (GO:0071407)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid catabolic process (GO:0009395)|phospholipid metabolic process (GO:0006644)|prostaglandin biosynthetic process (GO:0001516)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|lysosome (GO:0005764)|ruffle membrane (GO:0032587)|vesicle (GO:0031982)	calcium-dependent phospholipase A2 activity (GO:0047498)|lysophospholipase activity (GO:0004622)|metal ion binding (GO:0046872)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|liver(1)|lung(12)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	32		all_cancers(109;4.82e-12)|all_epithelial(112;5.64e-11)|Lung NSC(122;2.17e-07)|all_lung(180;8.79e-07)|Melanoma(134;0.091)		GBM - Glioblastoma multiforme(94;8.97e-07)		AGCGGGGGTCCTCAGCCTTGG	0.622																																																	0													77.0	70.0	72.0					15																	42434796		2203	4299	6502	SO:0001583	missense	0				CCDS32204.1	15q15.1	2008-09-19				ENSG00000168907	3.1.1.4		27396	protein-coding gene	gene with protein product						14702039, 15866882	Standard	NM_213600		Approved	PLA2G4F/Z	uc001zoz.3	Q68DD2		ENST00000382396.4:c.2259G>T	15.37:g.42434796C>A	ENSP00000371833:p.Glu753Asp		Q6ZMC8	Missense_Mutation	SNP	pfam_LysoPLipase_cat_dom,pfam_C2_dom,superfamily_Acyl_Trfase/lysoPLipase,superfamily_C2_dom,smart_C2_dom,smart_LysoPLipase_cat_dom,pfscan_C2_dom,pfscan_LysoPLipase_cat_dom	p.E755D	ENST00000382396.4	37	c.2265	CCDS32204.1	15	.	.	.	.	.	.	.	.	.	.	C	2.705	-0.270189	0.05716	.	.	ENSG00000168907	ENST00000290497;ENST00000397272;ENST00000382396;ENST00000443825	T;T	0.03860	3.78;3.78	4.88	-5.52	0.02560	Acyl transferase/acyl hydrolase/lysophospholipase (1);Lysophospholipase, catalytic domain (2);	0.803881	0.11226	N	0.586163	T	0.02119	0.0066	N	0.16368	0.405	0.09310	N	0.999997	B;B;B	0.10296	0.003;0.0;0.002	B;B;B	0.10450	0.002;0.005;0.002	T	0.45716	-0.9242	10	0.18710	T	0.47	-4.3982	2.9045	0.05716	0.3481:0.2009:0.3278:0.1232	.	540;755;753	A2RRC4;C9J281;Q68DD2	.;.;PA24F_HUMAN	D	749;755;753;753	ENSP00000380442:E755D;ENSP00000371833:E753D	ENSP00000290497:E749D	E	-	3	2	PLA2G4F	40222088	0.003000	0.15002	0.052000	0.19188	0.303000	0.27691	-0.839000	0.04368	-0.874000	0.04027	-0.274000	0.10170	GAG	PLA2G4F	-	superfamily_Acyl_Trfase/lysoPLipase,smart_LysoPLipase_cat_dom,pfscan_LysoPLipase_cat_dom	ENSG00000168907		0.622	PLA2G4F-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PLA2G4F	HGNC	protein_coding	OTTHUMT00000420463.1	-	0.00	74	0	C	NM_213600		42434796	-1	tier1	-	no_errors	ENST00000397272	ensembl	human	known	74_37	missense	11.54	23	3	SNP	0.008	A
PLA2R1	22925	genome.wustl.edu	37	2	160798256	160798256	+	3'UTR	DEL	C	C	-			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr2:160798256delC	ENST00000283243.7	-	0	4631				PLA2R1_ENST00000460710.1_Splice_Site	NM_001195641.1|NM_007366.4	NP_001182570.1|NP_031392.3	Q13018	PLA2R_HUMAN	phospholipase A2 receptor 1, 180kDa						cytokine production (GO:0001816)|negative regulation of arachidonic acid secretion (GO:1900139)|negative regulation of phospholipase A2 activity (GO:1900138)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of arachidonic acid secretion (GO:0090238)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|reactive oxygen species metabolic process (GO:0072593)|receptor-mediated endocytosis (GO:0006898)|replicative senescence (GO:0090399)	cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	carbohydrate binding (GO:0030246)|phospholipase binding (GO:0043274)|receptor activity (GO:0004872)		PLA2R1/RBMS1(2)	central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(17)|lung(20)|ovary(1)|pancreas(1)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)	60						TCTTTACTTACCCTGGTGTCT	0.358																																																	0													32.0	33.0	33.0					2																	160798256		2198	4297	6495	SO:0001624	3_prime_UTR_variant	0			U17033	CCDS33309.1, CCDS42767.1	2q23-q24	2011-08-30	2002-08-29		ENSG00000153246	ENSG00000153246		"""C-type lectin domain containing"""	9042	protein-coding gene	gene with protein product		604939	"""phospholipase A2 receptor 1, 180kD"""			7721806, 7925459	Standard	NM_007366		Approved	PLA2G1R, PLA2IR, PLA2-R, CLEC13C	uc002ube.2	Q13018	OTTHUMG00000154087	ENST00000283243.7:c.*33G>-	2.37:g.160798256delC			B2RTU9|D3DPB1|Q13019|Q15095|Q53R45|Q53RR7	Splice_Site	DEL	-	NULL	ENST00000283243.7	37	c.NULL	CCDS33309.1	2																																																																																			PLA2R1	-	-	ENSG00000153246		0.358	PLA2R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLA2R1	HGNC	protein_coding	OTTHUMT00000333820.1		0.00	26	0	C			160798256	-1	tier1		no_errors	ENST00000460710	ensembl	human	known	74_37	splice_site_del	21.43	11	3	DEL	0.000	-
PLCG2	5336	genome.wustl.edu	37	16	81819602	81819602	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr16:81819602C>G	ENST00000359376.3	+	2	222	c.8C>G	c.(7-9)aCc>aGc	p.T3S		NM_002661.3	NP_002652.2	P16885	PLCG2_HUMAN	phospholipase C, gamma 2 (phosphatidylinositol-specific)	3					B cell differentiation (GO:0030183)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|calcium-mediated signaling (GO:0019722)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|inositol phosphate metabolic process (GO:0043647)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid catabolic process (GO:0009395)|platelet activation (GO:0030168)|release of sequestered calcium ion into cytosol (GO:0051209)|small molecule metabolic process (GO:0044281)|T cell receptor signaling pathway (GO:0050852)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|signal transducer activity (GO:0004871)			NS(1)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(18)|lung(21)|ovary(1)|prostate(2)|skin(2)|urinary_tract(1)	58						ACAATGTCCACCACGGTCAAT	0.507																																																	0													75.0	78.0	78.0					16																	81819602		1929	4128	6057	SO:0001583	missense	0				CCDS42204.1	16q24.1	2014-09-17				ENSG00000197943	3.1.4.11	"""SH2 domain containing"""	9066	protein-coding gene	gene with protein product		600220				7835906	Standard	XR_248240		Approved		uc002fgt.3	P16885		ENST00000359376.3:c.8C>G	16.37:g.81819602C>G	ENSP00000352336:p.Thr3Ser		D3DUL3|Q3ZTS2|Q59H45|Q969T5	Missense_Mutation	SNP	pfam_PLipase_C_PInositol-sp_X_dom,pfam_SH2,pfam_PLipase_C_Pinositol-sp_Y,pfam_SH3_domain,pfam_C2_dom,pfam_PLipase_C_EF-hand-like,pfam_SH3_2,superfamily_PLC-like_Pdiesterase_TIM-brl,superfamily_C2_dom,superfamily_SH3_domain,smart_Pleckstrin_homology,smart_PLipase_C_PInositol-sp_X_dom,smart_SH2,smart_SH3_domain,smart_PLipase_C_Pinositol-sp_Y,smart_C2_dom,pirsf_PLC-gamma,pfscan_C2_dom,pfscan_Pleckstrin_homology,pfscan_SH2,pfscan_SH3_domain,pfscan_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_Pinositol-sp_Y,prints_Pinositol_PLipase_C,prints_SH2,prints_SH3_domain	p.T3S	ENST00000359376.3	37	c.8	CCDS42204.1	16	.	.	.	.	.	.	.	.	.	.	C	1.169	-0.641570	0.03531	.	.	ENSG00000197943	ENST00000359376	T	0.65732	-0.17	5.14	5.14	0.70334	Pleckstrin homology domain (1);	0.988640	0.08249	N	0.974951	T	0.39682	0.1087	N	0.08118	0	0.21861	N	0.999504	B	0.13594	0.008	B	0.12156	0.007	T	0.12041	-1.0563	10	0.02654	T	1	.	11.2608	0.49083	0.1824:0.8176:0.0:0.0	.	3	P16885	PLCG2_HUMAN	S	3	ENSP00000352336:T3S	ENSP00000352336:T3S	T	+	2	0	PLCG2	80377103	0.004000	0.15560	0.763000	0.31416	0.251000	0.25915	0.739000	0.26173	2.388000	0.81334	0.655000	0.94253	ACC	PLCG2	-	pirsf_PLC-gamma,pfscan_Pleckstrin_homology	ENSG00000197943		0.507	PLCG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLCG2	HGNC	protein_coding	OTTHUMT00000432429.1	-	0.00	38	0	C			81819602	+1	tier1	-	no_errors	ENST00000359376	ensembl	human	known	74_37	missense	19.05	17	4	SNP	0.700	G
PLSCR4	57088	genome.wustl.edu	37	3	145924348	145924348	+	Missense_Mutation	SNP	C	C	T	rs34752991	byFrequency	TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr3:145924348C>T	ENST00000354952.2	-	4	559	c.319G>A	c.(319-321)Gca>Aca	p.A107T	PLSCR4_ENST00000433593.2_Missense_Mutation_p.A92T|PLSCR4_ENST00000493382.1_Missense_Mutation_p.A107T|PLSCR4_ENST00000383083.2_Missense_Mutation_p.A107T|PLSCR4_ENST00000446574.2_Missense_Mutation_p.A107T	NM_020353.2	NP_065086.2	Q9NRQ2	PLS4_HUMAN	phospholipid scramblase 4	107					cellular response to lipopolysaccharide (GO:0071222)|phospholipid scrambling (GO:0017121)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|CD4 receptor binding (GO:0042609)|enzyme binding (GO:0019899)|phospholipid scramblase activity (GO:0017128)			kidney(1)|large_intestine(6)|lung(9)|urinary_tract(1)	17						GGGCAGTTTGCCATAGGAGTT	0.443																																																	0													127.0	121.0	123.0					3																	145924348		2203	4300	6503	SO:0001583	missense	0			AF199023	CCDS3133.1, CCDS54651.1	3q24	2008-07-18			ENSG00000114698	ENSG00000114698			16497	protein-coding gene	gene with protein product		607612				10930526	Standard	NM_020353		Approved		uc003evt.4	Q9NRQ2	OTTHUMG00000159415	ENST00000354952.2:c.319G>A	3.37:g.145924348C>T	ENSP00000347038:p.Ala107Thr		A8K2E9|Q2TTR3|Q658L3|Q6ZR73|Q7Z505	Missense_Mutation	SNP	pfam_Scramblase	p.A107T	ENST00000354952.2	37	c.319	CCDS3133.1	3	.	.	.	.	.	.	.	.	.	.	C	12.67	2.006930	0.35415	.	.	ENSG00000114698	ENST00000354952;ENST00000383083;ENST00000433593;ENST00000446574;ENST00000493382;ENST00000460350;ENST00000460885;ENST00000476202;ENST00000481701	T;T;T;T;T;T;T;T;T	0.42131	1.93;1.5;1.53;1.93;1.93;1.93;0.98;1.93;1.93	4.33	2.47	0.30058	.	0.346258	0.25109	N	0.033066	T	0.24353	0.0590	N	0.16368	0.405	0.09310	N	1	B;B	0.27625	0.001;0.183	B;B	0.26693	0.003;0.072	T	0.14337	-1.0476	10	0.33141	T	0.24	.	9.0571	0.36412	0.0:0.3136:0.5377:0.1487	.	107;107	E9PHR9;Q9NRQ2	.;PLS4_HUMAN	T	107;107;92;107;107;107;107;107;107	ENSP00000347038:A107T;ENSP00000372561:A107T;ENSP00000415605:A92T;ENSP00000399315:A107T;ENSP00000419040:A107T;ENSP00000417896:A107T;ENSP00000420385:A107T;ENSP00000418173:A107T;ENSP00000418419:A107T	ENSP00000347038:A107T	A	-	1	0	PLSCR4	147407038	0.051000	0.20477	0.007000	0.13788	0.479000	0.33129	0.692000	0.25482	0.542000	0.28846	-0.171000	0.13296	GCA	PLSCR4	-	pfam_Scramblase	ENSG00000114698		0.443	PLSCR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLSCR4	HGNC	protein_coding	OTTHUMT00000355172.1	-	0.00	42	0	C	NM_020353		145924348	-1	tier1	-	no_errors	ENST00000354952	ensembl	human	known	74_37	missense	42.31	15	11	SNP	0.025	T
PLXDC1	57125	genome.wustl.edu	37	17	37234173	37234173	+	Frame_Shift_Del	DEL	G	G	-			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr17:37234173delG	ENST00000315392.4	-	11	1390	c.1179delC	c.(1177-1179)accfs	p.T394fs	CTD-2206N4.4_ENST00000583447.1_RNA|PLXDC1_ENST00000539608.1_3'UTR|PLXDC1_ENST00000493200.1_5'UTR|PLXDC1_ENST00000444911.2_Frame_Shift_Del_p.T354fs	NM_020405.4	NP_065138.2	Q8IUK5	PLDX1_HUMAN	plexin domain containing 1	394					angiogenesis (GO:0001525)|spinal cord development (GO:0021510)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|tight junction (GO:0005923)	receptor activity (GO:0004872)			kidney(2)|large_intestine(6)|liver(1)|lung(10)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	23						TACCTTCTGTGGTGAGGCTGT	0.607																																																	0													119.0	93.0	102.0					17																	37234173		2203	4300	6503	SO:0001589	frameshift_variant	0			AF279144	CCDS11333.1	17q21.1	2006-04-12			ENSG00000161381	ENSG00000161381			20945	protein-coding gene	gene with protein product	"""tumor endothelial marker 7 precursor"""	606826				10947988, 11559528	Standard	NM_020405		Approved	TEM3, TEM7	uc002hrg.2	Q8IUK5	OTTHUMG00000133183	ENST00000315392.4:c.1179delC	17.37:g.37234173delG	ENSP00000323927:p.Thr394fs		B2R7I8|Q5QCZ7|Q5QCZ8|Q5QCZ9|Q9HCT9	Frame_Shift_Del	DEL	pfam_Plexin_repeat,superfamily_Plexin-like_fold	p.T394fs	ENST00000315392.4	37	c.1179	CCDS11333.1	17																																																																																			PLXDC1	-	NULL	ENSG00000161381		0.607	PLXDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLXDC1	HGNC	protein_coding	OTTHUMT00000256892.2		0.00	25	0	G	NM_020405		37234173	-1	tier1		no_errors	ENST00000315392	ensembl	human	known	74_37	frame_shift_del	47.37	10	9	DEL	1.000	-
PLXNB3	5365	genome.wustl.edu	37	X	153037063	153037063	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chrX:153037063C>A	ENST00000361971.5	+	14	2584	c.2470C>A	c.(2470-2472)Ccg>Acg	p.P824T	PLXNB3_ENST00000538966.1_Missense_Mutation_p.P847T|PLXNB3_ENST00000538543.1_Intron|PLXNB3_ENST00000538282.1_Missense_Mutation_p.P434T|PLXNB3_ENST00000538776.1_Missense_Mutation_p.P477T	NM_005393.2	NP_005384.2	Q9ULL4	PLXB3_HUMAN	plexin B3	824	PSI 3.				axon guidance (GO:0007411)|cell chemotaxis (GO:0060326)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell migration (GO:0030336)|negative regulation of GTPase activity (GO:0034260)|negative regulation of lamellipodium assembly (GO:0010593)|positive chemotaxis (GO:0050918)|positive regulation of endothelial cell proliferation (GO:0001938)|semaphorin-plexin signaling pathway (GO:0071526)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	protein domain specific binding (GO:0019904)|semaphorin receptor activity (GO:0017154)			central_nervous_system(1)|endometrium(7)|large_intestine(2)|lung(15)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	32	all_hematologic(71;4.25e-06)|all_lung(58;3.83e-05)|Lung NSC(58;5.54e-05)|Acute lymphoblastic leukemia(192;6.56e-05)					GCCCTTGTGCCCGCCGGGGGC	0.706																																																	0													20.0	22.0	21.0					X																	153037063		2184	4290	6474	SO:0001583	missense	0			AF149019	CCDS14729.1, CCDS55536.1	Xq28	2008-02-05			ENSG00000198753	ENSG00000198753		"""Plexins"""	9105	protein-coding gene	gene with protein product		300214		PLXN6		10520995	Standard	NM_005393		Approved	PLEXR, PLEXB3	uc010nuk.2	Q9ULL4	OTTHUMG00000024217	ENST00000361971.5:c.2470C>A	X.37:g.153037063C>A	ENSP00000355378:p.Pro824Thr		B7Z3E6|F5H773|Q9HDA4	Missense_Mutation	SNP	pfam_Plexin_cytoplasmic_RasGAP_dom,pfam_IPT,pfam_Plexin_repeat,pfam_Semap_dom,superfamily_Semap_dom,superfamily_Rho_GTPase_activation_prot,superfamily_Ig_E-set,superfamily_Plexin-like_fold,smart_Semap_dom,smart_Plexin-like_fold,smart_IPT,pfscan_Semap_dom	p.P847T	ENST00000361971.5	37	c.2539	CCDS14729.1	X	.	.	.	.	.	.	.	.	.	.	C	6.645	0.487423	0.12641	.	.	ENSG00000198753	ENST00000538966;ENST00000361971;ENST00000538776;ENST00000538282	T;T;T;T	0.69306	5.19;5.15;4.57;-0.39	5.11	4.24	0.50183	.	0.575706	0.18420	N	0.141776	T	0.50017	0.1591	L	0.39898	1.24	0.29768	N	0.835005	B;P;B;B	0.35411	0.011;0.5;0.022;0.006	B;B;B;B	0.25614	0.011;0.062;0.015;0.011	T	0.42378	-0.9455	10	0.10111	T	0.7	.	12.2683	0.54691	0.0:0.818:0.182:0.0	.	477;506;847;824	B7Z3H9;B7Z9A5;F5H773;Q9ULL4	.;.;.;PLXB3_HUMAN	T	847;824;477;434	ENSP00000442736:P847T;ENSP00000355378:P824T;ENSP00000445569:P477T;ENSP00000441919:P434T	ENSP00000355378:P824T	P	+	1	0	PLXNB3	152690257	0.000000	0.05858	0.779000	0.31741	0.010000	0.07245	-0.017000	0.12590	0.916000	0.36871	-0.347000	0.07816	CCG	PLXNB3	-	superfamily_Plexin-like_fold,smart_Plexin-like_fold	ENSG00000198753		0.706	PLXNB3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PLXNB3	HGNC	protein_coding	OTTHUMT00000061063.1	-	0.00	9	0	C			153037063	+1	tier1	-	no_errors	ENST00000538966	ensembl	human	known	74_37	missense	41.67	7	5	SNP	0.940	A
PMS2	5395	genome.wustl.edu	37	7	6035236	6035236	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr7:6035236G>C	ENST00000265849.7	-	8	937	c.832C>G	c.(832-834)Cat>Gat	p.H278D	PMS2_ENST00000382321.4_Intron|PMS2_ENST00000441476.2_Missense_Mutation_p.H172D|PMS2_ENST00000406569.3_Missense_Mutation_p.H278D|PMS2_ENST00000469652.1_Intron	NM_000535.5	NP_000526	P54278	PMS2_HUMAN	PMS2 postmeiotic segregation increased 2 (S. cerevisiae)	278					ATP catabolic process (GO:0006200)|mismatch repair (GO:0006298)|response to drug (GO:0042493)|somatic hypermutation of immunoglobulin genes (GO:0016446)|somatic recombination of immunoglobulin gene segments (GO:0016447)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|MutLalpha complex (GO:0032389)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|endonuclease activity (GO:0004519)|single base insertion or deletion binding (GO:0032138)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(6)|kidney(2)|large_intestine(11)|lung(13)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	46		Ovarian(82;0.0694)		UCEC - Uterine corpus endometrioid carcinoma (126;0.101)|OV - Ovarian serous cystadenocarcinoma(56;4.39e-15)		CCAACTCCATGCGTGCATTGT	0.398			"""Mis, N, F"""			"""colorectal, endometrial, ovarian, medulloblastoma, glioma"""		Direct reversal of damage;Mismatch excision repair (MMR)	Turcot syndrome;Lynch syndrome;Constitutional Mismatch Repair Deficiency Syndrome																														yes	Rec		"""Hereditary non-polyposis colorectal cancer, Turcot syndrome"""	7	7p22	5395	PMS2 postmeiotic segregation increased 2 (S. cerevisiae)		E	0													134.0	119.0	124.0					7																	6035236		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Hereditary Non-Polyposis Colorectal Cancer, HNPCC, Lynch syndromes 1 and 2 (= Cancer Family Syndrome), Hereditary Mismatch Repair Deficiency syndrome, HMRDS;Mismatch Repair Cancer syndrome, MMRCS, Childhood Cancer Syndrome, CCS, Biallelic Mismatch Repair Gene Mutations Associated Early Onset Cancer, Lynch syndrome type III		CCDS5343.1	7p22.1	2014-09-17	2001-11-28		ENSG00000122512	ENSG00000122512			9122	protein-coding gene	gene with protein product		600259	"""postmeiotic segregation increased (S. cerevisiae) 2"""	PMSL2		8072530	Standard	NM_000535		Approved	H_DJ0042M02.9, HNPCC4	uc003spl.3	P54278	OTTHUMG00000023135	ENST00000265849.7:c.832C>G	7.37:g.6035236G>C	ENSP00000265849:p.His278Asp		B2R610|Q52LH6|Q5FBW9|Q5FBX1|Q5FBX2|Q75MR2	Missense_Mutation	SNP	pfam_MutL_C,pfam_DNA_mismatch_repair_C,pfam_HATPase_ATP-bd,superfamily_HATPase_ATP-bd,superfamily_Ribosomal_S5_D2-typ_fold,smart_MutL_C,tigrfam_DNA_mismatch_repair_N	p.H278D	ENST00000265849.7	37	c.832	CCDS5343.1	7	.	.	.	.	.	.	.	.	.	.	g	14.70	2.613044	0.46631	.	.	ENSG00000122512	ENST00000265849;ENST00000382322;ENST00000441476;ENST00000406569	T;T;T	0.81163	-1.46;-1.46;-1.46	5.85	5.85	0.93711	Ribosomal protein S5 domain 2-type fold (1);DNA mismatch repair protein, N-terminal (1);Ribosomal protein S5 domain 2-type fold, subgroup (1);DNA mismatch repair protein, C-terminal (1);	0.299910	0.36066	N	0.002808	D	0.88548	0.6466	M	0.85197	2.74	0.80722	D	1	P;D;P	0.53885	0.713;0.963;0.907	P;P;B	0.52514	0.54;0.701;0.391	D	0.88950	0.3386	10	0.54805	T	0.06	-9.9971	20.2225	0.98327	0.0:0.0:1.0:0.0	.	278;278;172	P54278-3;P54278;C9J167	.;PMS2_HUMAN;.	D	278;231;172;278	ENSP00000265849:H278D;ENSP00000392843:H172D;ENSP00000384308:H278D	ENSP00000265849:H278D	H	-	1	0	PMS2	6001762	1.000000	0.71417	0.559000	0.28332	0.088000	0.18126	9.439000	0.97543	2.778000	0.95560	0.650000	0.86243	CAT	PMS2	-	pfam_DNA_mismatch_repair_C,superfamily_Ribosomal_S5_D2-typ_fold,tigrfam_DNA_mismatch_repair_N	ENSG00000122512		0.398	PMS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PMS2	HGNC	protein_coding	OTTHUMT00000207353.3	-	0.00	34	0	G	NM_000535		6035236	-1	tier1	-	no_errors	ENST00000265849	ensembl	human	known	74_37	missense	41.18	10	7	SNP	1.000	C
POLE	5426	genome.wustl.edu	37	12	133233814	133233814	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr12:133233814G>C	ENST00000320574.5	-	29	3533	c.3490C>G	c.(3490-3492)Ccc>Gcc	p.P1164A	POLE_ENST00000535270.1_Missense_Mutation_p.P1137A	NM_006231.2	NP_006222.2	Q07864	DPOE1_HUMAN	polymerase (DNA directed), epsilon, catalytic subunit	1164					base-excision repair, gap-filling (GO:0006287)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA synthesis involved in DNA repair (GO:0000731)|G1/S transition of mitotic cell cycle (GO:0000082)|in utero embryonic development (GO:0001701)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	cytoplasm (GO:0005737)|epsilon DNA polymerase complex (GO:0008622)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	4 iron, 4 sulfur cluster binding (GO:0051539)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|nucleotide binding (GO:0000166)|zinc ion binding (GO:0008270)			NS(2)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(41)|ovary(3)|pancreas(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	89	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0416)		OV - Ovarian serous cystadenocarcinoma(86;5.22e-08)|Epithelial(86;4.03e-07)|all cancers(50;1.18e-05)	Cladribine(DB00242)	AGCCAGTCGGGGTGTTTGACA	0.527								DNA polymerases (catalytic subunits)																																									0													102.0	100.0	101.0					12																	133233814		2203	4300	6503	SO:0001583	missense	0				CCDS9278.1	12q24.3	2014-09-17	2012-05-18		ENSG00000177084	ENSG00000177084		"""DNA polymerases"""	9177	protein-coding gene	gene with protein product	"""DNA polymerase epsilon catalytic subunit A"""	174762	"""polymerase (DNA directed), epsilon"""			8020968	Standard	NM_006231		Approved	POLE1	uc001uks.1	Q07864	OTTHUMG00000168045	ENST00000320574.5:c.3490C>G	12.37:g.133233814G>C	ENSP00000322570:p.Pro1164Ala		Q13533|Q86VH9	Missense_Mutation	SNP	pfam_DNA_pol_e_suA_C,pfam_DNA-dir_DNA_pol_B_exonuc,pfam_DNA-dir_DNA_pol_B_multi_dom,pfam_3'-5'_exonuclease_PolB-like,superfamily_RNaseH-like_dom,smart_DNA-dir_DNA_pol_B	p.P1164A	ENST00000320574.5	37	c.3490	CCDS9278.1	12	.	.	.	.	.	.	.	.	.	.	G	33	5.196819	0.94960	.	.	ENSG00000177084	ENST00000320574;ENST00000455752;ENST00000535270;ENST00000539006;ENST00000536445;ENST00000376577	T;T;T;T	0.16457	2.34;2.34;2.34;2.34	6.14	6.14	0.99180	.	0.000000	0.85682	D	0.000000	T	0.52853	0.1760	M	0.89095	3.005	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.998	T	0.56805	-0.7918	10	0.87932	D	0	.	20.8597	0.99761	0.0:0.0:1.0:0.0	.	1137;1164	F5H1D6;Q07864	.;DPOE1_HUMAN	A	1164;1175;1137;944;141;1099	ENSP00000322570:P1164A;ENSP00000406383:P1175A;ENSP00000445753:P1137A;ENSP00000442519:P944A	ENSP00000322570:P1164A	P	-	1	0	POLE	131743887	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	9.702000	0.98712	2.937000	0.99478	0.650000	0.86243	CCC	POLE	-	NULL	ENSG00000177084		0.527	POLE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POLE	HGNC	protein_coding	OTTHUMT00000397689.2	-	0.00	49	0	G	NM_006231		133233814	-1	tier1	-	no_errors	ENST00000320574	ensembl	human	known	74_37	missense	25.00	18	6	SNP	1.000	C
POLE2	5427	genome.wustl.edu	37	14	50133089	50133089	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr14:50133089C>T	ENST00000216367.5	-	7	634	c.535G>A	c.(535-537)Gga>Aga	p.G179R	POLE2_ENST00000554396.1_Missense_Mutation_p.G179R|POLE2_ENST00000539565.2_Missense_Mutation_p.G153R|POLE2_ENST00000556584.1_5'UTR	NM_002692.3	NP_002683.2	P56282	DPOE2_HUMAN	polymerase (DNA directed), epsilon 2, accessory subunit	179					DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	epsilon DNA polymerase complex (GO:0008622)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)			kidney(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	10	all_epithelial(31;0.0021)|Breast(41;0.0124)				Cladribine(DB00242)	ATCGCATCTCCGATTTTGGTT	0.289																																																	0													95.0	98.0	97.0					14																	50133089		2203	4300	6503	SO:0001583	missense	0			AF025840	CCDS32073.1, CCDS55914.1, CCDS55915.1	14q21-q22	2012-05-18	2012-05-18		ENSG00000100479	ENSG00000100479		"""DNA polymerases"""	9178	protein-coding gene	gene with protein product	"""DNA polymerase epsilon subunit B"""	602670	"""polymerase (DNA directed), epsilon 2 (p59 subunit)"""			9405441, 9443964	Standard	NM_002692		Approved	DPE2	uc001wwu.3	P56282	OTTHUMG00000170813	ENST00000216367.5:c.535G>A	14.37:g.50133089C>T	ENSP00000216367:p.Gly179Arg		A0AV55|A4FU92|A4LBB7|A6NH58|B4DDE6|O43560	Missense_Mutation	SNP	pfam_DNA_pol_alpha/epsilon_bsu,pfam_DNA_pol_e_bsu_N,pirsf_DNA_pol_e_bsu	p.G179R	ENST00000216367.5	37	c.535	CCDS32073.1	14	.	.	.	.	.	.	.	.	.	.	C	11.88	1.770205	0.31320	.	.	ENSG00000100479	ENST00000216367;ENST00000539565;ENST00000554396	T;T;T	0.34667	1.77;1.83;1.35	5.69	2.93	0.34026	.	0.047041	0.85682	D	0.000000	T	0.28366	0.0701	M	0.64997	1.995	0.47949	D	0.999559	P	0.35383	0.498	B	0.25884	0.064	T	0.04413	-1.0953	10	0.41790	T	0.15	-10.1919	7.3504	0.26686	0.0:0.6707:0.1217:0.2076	.	179	P56282	DPOE2_HUMAN	R	179;153;179	ENSP00000216367:G179R;ENSP00000446313:G153R;ENSP00000451621:G179R	ENSP00000216367:G179R	G	-	1	0	POLE2	49202839	1.000000	0.71417	0.517000	0.27799	0.982000	0.71751	5.108000	0.64609	0.366000	0.24427	-0.142000	0.14014	GGA	POLE2	-	pirsf_DNA_pol_e_bsu	ENSG00000100479		0.289	POLE2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	POLE2	HGNC	protein_coding	OTTHUMT00000410512.1	-	0.00	34	0	C	NM_002692		50133089	-1	tier1	-	no_errors	ENST00000216367	ensembl	human	known	74_37	missense	10.81	33	4	SNP	0.875	T
POLR1B	84172	genome.wustl.edu	37	2	113332935	113332935	+	Silent	SNP	A	A	C			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr2:113332935A>C	ENST00000263331.5	+	15	3617	c.3037A>C	c.(3037-3039)Agg>Cgg	p.R1013R	POLR1B_ENST00000409894.3_Silent_p.R830R|POLR1B_ENST00000417433.2_Silent_p.R957R|POLR1B_ENST00000537335.1_Silent_p.R802R|POLR1B_ENST00000541869.1_Silent_p.R1051R	NM_019014.4	NP_061887.2	Q9H9Y6	RPA2_HUMAN	polymerase (RNA) I polypeptide B, 128kDa	1013					gene expression (GO:0010467)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|metal ion binding (GO:0046872)|ribonucleoside binding (GO:0032549)			breast(3)|endometrium(9)|kidney(2)|large_intestine(9)|lung(14)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	42						ATTTCAAGTAAGGACAACTGG	0.483																																					Ovarian(16;256 576 9537 23969 41147)												0													81.0	87.0	85.0					2																	113332935		2203	4300	6503	SO:0001819	synonymous_variant	0			AK001678	CCDS2097.1, CCDS46395.1, CCDS62988.1, CCDS62989.1, CCDS62990.1	2q13	2013-01-21			ENSG00000125630	ENSG00000125630		"""RNA polymerase subunits"""	20454	protein-coding gene	gene with protein product		602000					Standard	NM_001137604		Approved	Rpo1-2, FLJ21921, FLJ10816, RPA2	uc002thw.2	Q9H9Y6	OTTHUMG00000131314	ENST00000263331.5:c.3037A>C	2.37:g.113332935A>C			B7Z6Y7|B7Z823|F5GZX4|F8W898|Q2TAM4|Q585T5|Q6ZRR2|Q9H9D3	Silent	SNP	pfam_DNA-dir_RNA_pol_su2_6,pfam_RNA_pol_bsu_protrusion,pfam_RNA_pol_Rpb2_3,pfam_RNA_pol_Rpb2_7,pfam_RNA_pol_Rpa2-specific,pfam_RNA_pol_Rpb2_2,pfam_RNA_pol_Rpb2_5	p.R1051	ENST00000263331.5	37	c.3151	CCDS2097.1	2																																																																																			POLR1B	-	pfam_DNA-dir_RNA_pol_su2_6	ENSG00000125630		0.483	POLR1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POLR1B	HGNC	protein_coding	OTTHUMT00000254083.1	-	0.00	40	0	A	NM_019014		113332935	+1	tier1	-	no_errors	ENST00000541869	ensembl	human	known	74_37	silent	15.00	34	6	SNP	0.962	C
PPM1H	57460	genome.wustl.edu	37	12	63328397	63328397	+	Frame_Shift_Del	DEL	G	G	-			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr12:63328397delG	ENST00000228705.6	-	1	420	c.120delC	c.(118-120)cccfs	p.P40fs	Y_RNA_ENST00000516851.1_RNA	NM_020700.1	NP_065751.1	Q9ULR3	PPM1H_HUMAN	protein phosphatase, Mg2+/Mn2+ dependent, 1H	40							phosphoprotein phosphatase activity (GO:0004721)			breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(9)|ovary(1)	18			GBM - Glioblastoma multiforme(1;0.000443)|BRCA - Breast invasive adenocarcinoma(9;0.209)	GBM - Glioblastoma multiforme(28;0.0126)		GCCGCCCGTAGGGGAAACGCA	0.692																																																	0													7.0	11.0	9.0					12																	63328397		1907	4070	5977	SO:0001589	frameshift_variant	0			AB032983	CCDS44934.1	12q14.1	2012-04-17	2010-03-05	2004-03-26	ENSG00000111110	ENSG00000111110	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	18583	protein-coding gene	gene with protein product	"""neurite extension-related protein phosphatase related to PP2C"""		"""ras homolog gene family, member C like 1"", ""protein phosphatase 1H (PP2C domain containing)"""	ARHCL1			Standard	NM_020700		Approved	KIAA1157, FLJ13253, NERPP-2C	uc001srk.3	Q9ULR3	OTTHUMG00000169990	ENST00000228705.6:c.120delC	12.37:g.63328397delG	ENSP00000228705:p.Pro40fs		B1Q2A9|B2RXG4|Q6PI86	Frame_Shift_Del	DEL	pfam_PP2C-like_dom,superfamily_PP2C-like_dom,smart_PP2C-like_dom	p.Y41fs	ENST00000228705.6	37	c.120	CCDS44934.1	12																																																																																			PPM1H	-	NULL	ENSG00000111110		0.692	PPM1H-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPM1H	HGNC	protein_coding	OTTHUMT00000406760.2		0.00	16	0	G	NM_020700		63328397	-1			no_errors	ENST00000228705	ensembl	human	known	74_37	frame_shift_del	50.00	4	4	DEL	0.999	0
PPP1R26	9858	genome.wustl.edu	37	9	138378543	138378543	+	Silent	SNP	G	G	A			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr9:138378543G>A	ENST00000356818.2	+	4	2736	c.2187G>A	c.(2185-2187)acG>acA	p.T729T	PPP1R26_ENST00000604351.1_Silent_p.T729T|PPP1R26_ENST00000602993.1_Intron|PPP1R26_ENST00000605660.1_Silent_p.T729T|PPP1R26_ENST00000401470.3_Silent_p.T729T|PPP1R26_ENST00000605286.1_Silent_p.T729T	NM_014811.3	NP_055626.3	Q5T8A7	PPR26_HUMAN	protein phosphatase 1, regulatory subunit 26	729					negative regulation of phosphatase activity (GO:0010923)	nucleus (GO:0005634)	phosphatase binding (GO:0019902)|protein phosphatase inhibitor activity (GO:0004864)										CAGCCCAGACGCACTTCTTGG	0.602																																																	0													11.0	12.0	12.0					9																	138378543		2196	4295	6491	SO:0001819	synonymous_variant	0			AB014549	CCDS6988.1	9q34.3	2012-04-17	2011-10-11	2011-10-11	ENSG00000196422	ENSG00000196422		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	29089	protein-coding gene	gene with protein product	"""DRIM/UTP20 interacting protein"", ""1A6/DRIM (down-regulated in metastasis) interacting protein"""	614056	"""KIAA0649"""	KIAA0649		9734811, 16053918	Standard	NM_014811		Approved		uc004cfr.1	Q5T8A7	OTTHUMG00000020904	ENST00000356818.2:c.2187G>A	9.37:g.138378543G>A			Q86WU0|Q8WVV0|Q9Y4D3	Silent	SNP	NULL	p.T729	ENST00000356818.2	37	c.2187	CCDS6988.1	9																																																																																			PPP1R26	-	NULL	ENSG00000196422		0.602	PPP1R26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1R26	HGNC	protein_coding	OTTHUMT00000054987.1		0.00	13	0	G	NM_014811		138378543	+1			no_errors	ENST00000356818	ensembl	human	known	74_37	silent	37.50	5	3	SNP	0.000	A
PPP6R2	9701	genome.wustl.edu	37	22	50845231	50845231	+	Missense_Mutation	SNP	C	C	T	rs550603081		TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr22:50845231C>T	ENST00000216061.5	+	5	711	c.341C>T	c.(340-342)cCg>cTg	p.P114L	PPP6R2_ENST00000395744.3_Missense_Mutation_p.P114L|PPP6R2_ENST00000359139.3_Missense_Mutation_p.P114L|PPP6R2_ENST00000395741.3_Missense_Mutation_p.P114L			O75170	PP6R2_HUMAN	protein phosphatase 6, regulatory subunit 2	114						cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)				NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(2)|liver(1)|lung(6)|ovary(2)|skin(1)|urinary_tract(1)	22						GACCATGAGCCGCCTCTCAAT	0.547													c|||	1	0.000199681	0.0008	0.0	5008	,	,		19675	0.0		0.0	False		,,,				2504	0.0																0													226.0	226.0	226.0					22																	50845231		2203	4300	6503	SO:0001583	missense	0			AB014585	CCDS33681.1, CCDS56235.1, CCDS56236.1, CCDS74881.1	22q13.33	2012-04-17	2010-06-28	2010-06-28	ENSG00000100239	ENSG00000100239		"""Serine/threonine phosphatases / Protein phosphatase 6, regulatory subunits"""	19253	protein-coding gene	gene with protein product		610877	"""KIAA0685"", ""SAPS domain family, member 2"""	KIAA0685, SAPS2		16769727	Standard	NM_014678		Approved	dJ579N16.1, SAP190	uc003blc.3	O75170	OTTHUMG00000150199	ENST00000216061.5:c.341C>T	22.37:g.50845231C>T	ENSP00000216061:p.Pro114Leu		A6PVG3|B7Z7T3|Q5U5P3|Q7Z2L2|Q7Z5G5|Q7Z731|Q9UGB9	Missense_Mutation	SNP	pfam_SAPS,superfamily_ARM-type_fold	p.P114L	ENST00000216061.5	37	c.341		22	.	.	.	.	.	.	.	.	.	.	c	17.00	3.277529	0.59758	.	.	ENSG00000100239	ENST00000359139;ENST00000395741;ENST00000395744;ENST00000216061	T;T;T;T	0.34072	1.39;1.39;1.39;1.38	5.28	5.28	0.74379	.	0.000000	0.85682	D	0.000000	T	0.47857	0.1468	M	0.89478	3.035	0.80722	D	1	B;P;B;P;B	0.38677	0.305;0.509;0.187;0.642;0.187	B;B;B;B;B	0.34652	0.086;0.091;0.105;0.187;0.105	T	0.60860	-0.7179	10	0.66056	D	0.02	-19.4322	17.6863	0.88257	0.0:1.0:0.0:0.0	.	114;114;114;114;114	O75170-5;O75170;O75170-3;O75170-4;O75170-2	.;PP6R2_HUMAN;.;.;.	L	114	ENSP00000352051:P114L;ENSP00000379090:P114L;ENSP00000379093:P114L;ENSP00000216061:P114L	ENSP00000216061:P114L	P	+	2	0	PPP6R2	49192097	1.000000	0.71417	0.975000	0.42487	0.446000	0.32137	7.568000	0.82369	2.478000	0.83669	0.550000	0.68814	CCG	PPP6R2	-	superfamily_ARM-type_fold	ENSG00000100239		0.547	PPP6R2-004	KNOWN	basic|appris_candidate_longest	protein_coding	PPP6R2	HGNC	protein_coding	OTTHUMT00000316809.1		0.00	32	0	C	NM_014678		50845231	+1			no_errors	ENST00000216061	ensembl	human	known	74_37	missense	21.43	11	3	SNP	1.000	T
PPWD1	23398	genome.wustl.edu	37	5	64875276	64875276	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr5:64875276G>C	ENST00000261308.5	+	7	1258	c.1186G>C	c.(1186-1188)Gaa>Caa	p.E396Q	PPWD1_ENST00000538977.1_Missense_Mutation_p.E240Q|PPWD1_ENST00000535264.1_Missense_Mutation_p.E366Q	NM_015342.3	NP_056157.1	Q96BP3	PPWD1_HUMAN	peptidylprolyl isomerase domain and WD repeat containing 1	396					mRNA splicing, via spliceosome (GO:0000398)|protein folding (GO:0006457)	catalytic step 2 spliceosome (GO:0071013)|nucleus (GO:0005634)	peptidyl-prolyl cis-trans isomerase activity (GO:0003755)			breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(6)|ovary(1)|prostate(1)	19		Lung NSC(167;7.21e-05)|Prostate(74;0.0174)|Ovarian(174;0.186)		Lung(70;0.00451)		AGGCAAACAAGAAAATATTAG	0.343																																																	0													90.0	94.0	93.0					5																	64875276		2203	4300	6503	SO:0001583	missense	0			AK025679	CCDS3985.1, CCDS64161.1, CCDS64162.1	5q12.3	2013-01-09			ENSG00000113593	ENSG00000113593		"""WD repeat domain containing"""	28954	protein-coding gene	gene with protein product						7584044	Standard	NM_015342		Approved	KIAA0073	uc003jtv.5	Q96BP3	OTTHUMG00000131226	ENST00000261308.5:c.1186G>C	5.37:g.64875276G>C	ENSP00000261308:p.Glu396Gln		B4DWR9|Q15002|Q7KZ89	Missense_Mutation	SNP	pfam_Cyclophilin-like_PPIase_dom,pfam_WD40_repeat,superfamily_Cyclophilin-like_PPIase_dom,superfamily_WD40_repeat_dom,smart_WD40_repeat,prints_Cyclophilin-like_PPIase_dom,pfscan_Cyclophilin-like_PPIase_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.E396Q	ENST00000261308.5	37	c.1186	CCDS3985.1	5	.	.	.	.	.	.	.	.	.	.	G	29.3	4.992413	0.93167	.	.	ENSG00000113593	ENST00000261308;ENST00000535264;ENST00000538977	T;T;T	0.70986	-0.53;-0.35;1.41	5.58	5.58	0.84498	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.103338	0.64402	D	0.000004	D	0.87220	0.6123	M	0.91972	3.26	0.80722	D	1	D;D	0.76494	0.999;0.997	D;P	0.63703	0.917;0.827	D	0.89427	0.3714	10	0.66056	D	0.02	.	19.5704	0.95409	0.0:0.0:1.0:0.0	.	366;396	F5H7P7;Q96BP3	.;PPWD1_HUMAN	Q	396;366;240	ENSP00000261308:E396Q;ENSP00000442371:E366Q;ENSP00000444496:E240Q	ENSP00000261308:E396Q	E	+	1	0	PPWD1	64911032	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.402000	0.97298	2.624000	0.88883	0.655000	0.94253	GAA	PPWD1	-	superfamily_WD40_repeat_dom	ENSG00000113593		0.343	PPWD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPWD1	HGNC	protein_coding	OTTHUMT00000253970.2		0.00	54	0	G	NM_015342		64875276	+1			no_errors	ENST00000261308	ensembl	human	known	74_37	missense	10.00	27	3	SNP	1.000	C
PRB3	5544	genome.wustl.edu	37	12	11420839	11420839	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr12:11420839G>C	ENST00000279573.7	-	3	479	c.344C>G	c.(343-345)cCt>cGt	p.P115R	PRB3_ENST00000538488.1_Missense_Mutation_p.P115R|PRB3_ENST00000440870.3_Intron|PRB3_ENST00000381842.3_Missense_Mutation_p.P115R			Q04118	PRB3_HUMAN	proline-rich protein BstNI subfamily 3	115	10 X 21 AA tandem repeats of [RH]-P-G-K- P-[EQ]-G-[PQS]-P-[PS]-Q-[GE]-G-N-[QK]- [SP]-[QR]-[GR]-P-P-P.|Pro-rich.				defense response to Gram-negative bacterium (GO:0050829)	extracellular region (GO:0005576)				breast(2)|endometrium(1)|kidney(2)|large_intestine(1)|lung(13)|ovary(1)|skin(5)	25			OV - Ovarian serous cystadenocarcinoma(49;0.201)			TCCCGGACGAGGTGGGGGACC	0.637																																																	0													97.0	122.0	114.0					12																	11420839		1894	4047	5941	SO:0001583	missense	0					12p13.2	2012-10-02				ENSG00000197870			9339	protein-coding gene	gene with protein product		168840				1894623	Standard	NM_006249		Approved	PRG	uc001qzs.3	Q04118		ENST00000279573.7:c.344C>G	12.37:g.11420839G>C	ENSP00000279573:p.Pro115Arg		Q15188|Q4VAY3|Q4VAY4|Q7M4M9|Q9UCT9	Missense_Mutation	SNP	NULL	p.P115R	ENST00000279573.7	37	c.344		12	.	.	.	.	.	.	.	.	.	.	.	4.154	0.027024	0.08054	.	.	ENSG00000197870	ENST00000381842;ENST00000538488	T;T	0.04234	3.67;3.67	0.52	-1.04	0.10068	.	0.593826	0.12416	U	0.470874	T	0.03095	0.0091	.	.	.	0.09310	N	1	B	0.10296	0.003	B	0.04013	0.001	T	0.41822	-0.9487	9	0.49607	T	0.09	.	2.2823	0.04117	0.2799:0.3366:0.3835:0.0	.	115	Q04118	PRB3_HUMAN	R	115	ENSP00000371264:P115R;ENSP00000442626:P115R	ENSP00000279573:P115R	P	-	2	0	PRB3	11312106	0.000000	0.05858	0.002000	0.10522	0.005000	0.04900	-0.137000	0.10389	-0.424000	0.07382	0.134000	0.15878	CCT	PRB3	-	NULL	ENSG00000197870		0.637	PRB3-001	KNOWN	basic|appris_candidate	protein_coding	PRB3	HGNC	protein_coding	OTTHUMT00000402119.5	-	0.00	88	0	G	NM_006249		11420839	-1	tier1	-	no_errors	ENST00000381842	ensembl	human	known	74_37	missense	24.53	40	13	SNP	0.001	C
PRKCH	5583	genome.wustl.edu	37	14	61915966	61915966	+	Nonsense_Mutation	SNP	C	C	G			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr14:61915966C>G	ENST00000332981.5	+	5	1083	c.698C>G	c.(697-699)tCa>tGa	p.S233*	PRKCH_ENST00000555082.1_Nonsense_Mutation_p.S72*	NM_006255.3	NP_006246.2	P24723	KPCL_HUMAN	protein kinase C, eta	233					blood coagulation (GO:0007596)|negative regulation of glial cell apoptotic process (GO:0034351)|platelet activation (GO:0030168)|positive regulation of B cell receptor signaling pathway (GO:0050861)|positive regulation of glial cell proliferation (GO:0060252)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein kinase C signaling (GO:0070528)|protein phosphorylation (GO:0006468)|regulation of tight junction assembly (GO:2000810)|signal transduction (GO:0007165)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium-independent protein kinase C activity (GO:0004699)|enzyme binding (GO:0019899)|metal ion binding (GO:0046872)|protein kinase C activity (GO:0004697)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(4)|ovary(2)|pancreas(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	25				OV - Ovarian serous cystadenocarcinoma(108;0.045)|BRCA - Breast invasive adenocarcinoma(234;0.0906)|KIRC - Kidney renal clear cell carcinoma(182;0.182)		AAAGTGGATTCAAAGGTAAGA	0.453																																					Melanoma(135;863 1779 8064 14443 26348)												0													162.0	153.0	156.0					14																	61915966		2203	4300	6503	SO:0001587	stop_gained	0			M55284	CCDS9752.1	14q23.1	2009-07-10			ENSG00000027075	ENSG00000027075	2.7.11.1		9403	protein-coding gene	gene with protein product		605437		PRKCL		1986216, 1545821	Standard	NM_006255		Approved	PKC-L, PKCL	uc001xfn.3	P24723	OTTHUMG00000152341	ENST00000332981.5:c.698C>G	14.37:g.61915966C>G	ENSP00000329127:p.Ser233*		B4DJN5|Q16246|Q8NE03	Nonsense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_Pkinase_C,pfam_C2_dom,superfamily_Kinase-like_dom,superfamily_C2_dom,smart_C2_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pirsf_Prot_kin_PKC_delta,pfscan_C2_dom,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_dom,prints_DAG/PE-bd	p.S233*	ENST00000332981.5	37	c.698	CCDS9752.1	14	.	.	.	.	.	.	.	.	.	.	C	23.5	4.418060	0.83449	.	.	ENSG00000027075	ENST00000556778;ENST00000555906;ENST00000332981;ENST00000555082;ENST00000553831;ENST00000553265;ENST00000557585;ENST00000557473	.	.	.	5.76	4.82	0.62117	.	0.808617	0.11014	N	0.609095	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.37606	T	0.19	.	7.4568	0.27272	0.2866:0.632:0.0:0.0814	.	.	.	.	X	72;72;233;72;72;72;72;72	.	ENSP00000329127:S233X	S	+	2	0	PRKCH	60985719	0.985000	0.35326	0.998000	0.56505	0.939000	0.58152	2.177000	0.42509	2.739000	0.93911	0.555000	0.69702	TCA	PRKCH	-	pirsf_Prot_kin_PKC_delta	ENSG00000027075		0.453	PRKCH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKCH	HGNC	protein_coding	OTTHUMT00000276974.2		0.00	35	0	C	NM_006255		61915966	+1			no_errors	ENST00000332981	ensembl	human	known	74_37	nonsense	8.33	22	2	SNP	0.830	G
PRKCQ	5588	genome.wustl.edu	37	10	6472851	6472851	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr10:6472851C>T	ENST00000263125.5	-	17	1985	c.1886G>A	c.(1885-1887)cGc>cAc	p.R629H	PRKCQ_ENST00000397176.2_Missense_Mutation_p.R566H|PRKCQ_ENST00000539722.1_Missense_Mutation_p.R504H	NM_001282644.1|NM_006257.3	NP_001269573.1|NP_006248.1	Q04759	KPCT_HUMAN	protein kinase C, theta	629	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|Fc-epsilon receptor signaling pathway (GO:0038095)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|membrane protein ectodomain proteolysis (GO:0006509)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of T cell apoptotic process (GO:0070233)|phototransduction, visible light (GO:0007603)|platelet activation (GO:0030168)|positive regulation of interleukin-17 production (GO:0032740)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of interleukin-4 production (GO:0032753)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of T cell activation (GO:0050870)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of T-helper 17 type immune response (GO:2000318)|positive regulation of T-helper 2 cell activation (GO:2000570)|protein ubiquitination (GO:0016567)|regulation of cell growth (GO:0001558)|regulation of platelet aggregation (GO:0090330)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|regulation of transcription, DNA-templated (GO:0006355)|rhodopsin mediated signaling pathway (GO:0016056)|T cell receptor signaling pathway (GO:0050852)	cytosol (GO:0005829)|immunological synapse (GO:0001772)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|liver(1)|lung(13)|ovary(4)|prostate(1)|skin(4)|stomach(2)	45					Tamoxifen(DB00675)	AGGGTGCTGGCGGATGTCTCC	0.587																																					Ovarian(50;572 1126 10530 25349 30594)												0													99.0	86.0	90.0					10																	6472851		2203	4300	6503	SO:0001583	missense	0			L07032	CCDS7079.1, CCDS55701.1, CCDS60482.1	10p15	2009-07-10			ENSG00000065675	ENSG00000065675	2.7.11.1		9410	protein-coding gene	gene with protein product		600448				8444877	Standard	NM_001282645		Approved		uc001ijj.2	Q04759	OTTHUMG00000017623	ENST00000263125.5:c.1886G>A	10.37:g.6472851C>T	ENSP00000263125:p.Arg629His		B4DF52|Q14DH6|Q3MJF1|Q64FY5|Q9H508|Q9H549	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_Pkinase_C,superfamily_Kinase-like_dom,superfamily_C2_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pirsf_Prot_kin_PKC_delta,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_dom,prints_DAG/PE-bd,prints_Ser-Thr/Tyr_kinase_cat_dom	p.R629H	ENST00000263125.5	37	c.1886	CCDS7079.1	10	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	27.8|27.8	4.859626|4.859626	0.91433|0.91433	.|.	.|.	ENSG00000065675|ENSG00000065675	ENST00000397178|ENST00000263125;ENST00000397176;ENST00000539722	.|T;T;T	.|0.54071	.|0.59;0.59;0.59	5.05|5.05	4.14|4.14	0.48551|0.48551	.|Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	.|0.111362	.|0.64402	.|D	.|0.000010	T|T	0.69602|0.69602	0.3129|0.3129	M|M	0.66939|0.66939	2.045|2.045	0.80722|0.80722	D|D	1|1	.|D;D;D;D	.|0.89917	.|1.0;1.0;1.0;1.0	.|D;D;D;D	.|0.79108	.|0.973;0.984;0.992;0.983	T|T	0.73116|0.73116	-0.4084|-0.4084	5|10	.|0.72032	.|D	.|0.01	.|.	14.2694|14.2694	0.66143|0.66143	0.0:0.85:0.15:0.0|0.0:0.85:0.15:0.0	.|.	.|504;401;566;629	.|B4DF52;Q5JUN8;Q04759-2;Q04759	.|.;.;.;KPCT_HUMAN	T|H	402|629;566;504	.|ENSP00000263125:R629H;ENSP00000380361:R566H;ENSP00000441752:R504H	.|ENSP00000263125:R629H	A|R	-|-	1|2	0|0	PRKCQ|PRKCQ	6512857|6512857	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	7.275000|7.275000	0.78548|0.78548	1.095000|1.095000	0.41419|0.41419	0.650000|0.650000	0.86243|0.86243	GCC|CGC	PRKCQ	-	pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,pirsf_Prot_kin_PKC_delta,pfscan_Prot_kinase_dom	ENSG00000065675		0.587	PRKCQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKCQ	HGNC	protein_coding	OTTHUMT00000046665.1		0.00	47	0	C	NM_006257		6472851	-1			no_errors	ENST00000263125	ensembl	human	known	74_37	missense	5.71	32	2	SNP	1.000	T
PRKCQ	5588	genome.wustl.edu	37	10	6527138	6527138	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr10:6527138A>C	ENST00000263125.5	-	10	1093	c.994T>G	c.(994-996)Tgt>Ggt	p.C332G	PRKCQ_ENST00000397176.2_Missense_Mutation_p.C332G|PRKCQ_ENST00000539722.1_Missense_Mutation_p.C207G	NM_001282644.1|NM_006257.3	NP_001269573.1|NP_006248.1	Q04759	KPCT_HUMAN	protein kinase C, theta	332					apoptotic process (GO:0006915)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|Fc-epsilon receptor signaling pathway (GO:0038095)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|membrane protein ectodomain proteolysis (GO:0006509)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of T cell apoptotic process (GO:0070233)|phototransduction, visible light (GO:0007603)|platelet activation (GO:0030168)|positive regulation of interleukin-17 production (GO:0032740)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of interleukin-4 production (GO:0032753)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of T cell activation (GO:0050870)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of T-helper 17 type immune response (GO:2000318)|positive regulation of T-helper 2 cell activation (GO:2000570)|protein ubiquitination (GO:0016567)|regulation of cell growth (GO:0001558)|regulation of platelet aggregation (GO:0090330)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|regulation of transcription, DNA-templated (GO:0006355)|rhodopsin mediated signaling pathway (GO:0016056)|T cell receptor signaling pathway (GO:0050852)	cytosol (GO:0005829)|immunological synapse (GO:0001772)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|liver(1)|lung(13)|ovary(4)|prostate(1)|skin(4)|stomach(2)	45					Tamoxifen(DB00675)	GTCGGTAAACATGGCGGCCTT	0.458																																					Ovarian(50;572 1126 10530 25349 30594)												0													184.0	178.0	180.0					10																	6527138		2203	4300	6503	SO:0001583	missense	0			L07032	CCDS7079.1, CCDS55701.1, CCDS60482.1	10p15	2009-07-10			ENSG00000065675	ENSG00000065675	2.7.11.1		9410	protein-coding gene	gene with protein product		600448				8444877	Standard	NM_001282645		Approved		uc001ijj.2	Q04759	OTTHUMG00000017623	ENST00000263125.5:c.994T>G	10.37:g.6527138A>C	ENSP00000263125:p.Cys332Gly		B4DF52|Q14DH6|Q3MJF1|Q64FY5|Q9H508|Q9H549	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_Pkinase_C,superfamily_Kinase-like_dom,superfamily_C2_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pirsf_Prot_kin_PKC_delta,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_dom,prints_DAG/PE-bd,prints_Ser-Thr/Tyr_kinase_cat_dom	p.C332G	ENST00000263125.5	37	c.994	CCDS7079.1	10	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	5.899|5.899	0.350011|0.350011	0.11182|0.11182	.|.	.|.	ENSG00000065675|ENSG00000065675	ENST00000263125;ENST00000397176;ENST00000539722|ENST00000397178	T;T;T|.	0.67345|.	-0.25;-0.19;-0.26|.	5.22|5.22	-1.43|-1.43	0.08884|0.08884	.|.	1.063330|.	0.07274|.	N|.	0.869585|.	T|T	0.15912|0.15912	0.0383|0.0383	N|N	0.14661|0.14661	0.345|0.345	0.09310|0.09310	N|N	1|1	B;B;B;B|.	0.02656|.	0.0;0.0;0.0;0.0|.	B;B;B;B|.	0.01281|.	0.0;0.0;0.0;0.0|.	T|T	0.23404|0.23404	-1.0189|-1.0189	10|5	0.09590|.	T|.	0.72|.	.|.	1.7584|1.7584	0.02987|0.02987	0.3895:0.1524:0.3268:0.1313|0.3895:0.1524:0.3268:0.1313	.|.	207;104;332;332|.	B4DF52;Q5JUN8;Q04759-2;Q04759|.	.;.;.;KPCT_HUMAN|.	G|Q	332;332;207|104	ENSP00000263125:C332G;ENSP00000380361:C332G;ENSP00000441752:C207G|.	ENSP00000263125:C332G|.	C|H	-|-	1|3	0|2	PRKCQ|PRKCQ	6567144|6567144	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.002000|0.002000	0.02628|0.02628	-0.402000|-0.402000	0.07223|0.07223	-0.190000|-0.190000	0.10465|0.10465	0.533000|0.533000	0.62120|0.62120	TGT|CAT	PRKCQ	-	pirsf_Prot_kin_PKC_delta	ENSG00000065675		0.458	PRKCQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKCQ	HGNC	protein_coding	OTTHUMT00000046665.1		0.00	67	0	A	NM_006257		6527138	-1			no_errors	ENST00000263125	ensembl	human	known	74_37	missense	9.68	28	3	SNP	0.000	C
PRKD2	25865	genome.wustl.edu	37	19	47200420	47200420	+	Silent	SNP	G	G	A			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr19:47200420G>A	ENST00000291281.4	-	9	1536	c.1311C>T	c.(1309-1311)taC>taT	p.Y437Y	PRKD2_ENST00000433867.1_Silent_p.Y437Y|PRKD2_ENST00000601806.1_Silent_p.Y280Y|PRKD2_ENST00000600194.1_Silent_p.Y280Y|PRKD2_ENST00000595515.1_Silent_p.Y437Y			Q9BZL6	KPCD2_HUMAN	protein kinase D2	437	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell death (GO:0008219)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|endothelial tube morphogenesis (GO:0061154)|intracellular signal transduction (GO:0035556)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell adhesion (GO:0045785)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of endothelial cell chemotaxis (GO:2001028)|positive regulation of endothelial cell chemotaxis by VEGF-activated vascular endothelial growth factor receptor signaling pathway (GO:0038033)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of histone deacetylase activity (GO:1901727)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of intracellular signal transduction (GO:1902533)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of T cell receptor signaling pathway (GO:0050862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|T cell receptor signaling pathway (GO:0050852)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)			central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(13)|ovary(2)|prostate(2)|skin(1)|stomach(2)|urinary_tract(1)	41		Ovarian(192;0.0129)|all_neural(266;0.0459)|Breast(70;0.212)		OV - Ovarian serous cystadenocarcinoma(262;0.000189)|all cancers(93;0.000545)|Epithelial(262;0.0219)|GBM - Glioblastoma multiforme(486;0.0353)		TTACCTTATAGTATCTGTTGG	0.532																																																	0													142.0	116.0	125.0					19																	47200420		2203	4300	6503	SO:0001819	synonymous_variant	0			AF151021	CCDS12689.1, CCDS59401.1	19q13.2	2013-01-10				ENSG00000105287		"""Pleckstrin homology (PH) domain containing"""	17293	protein-coding gene	gene with protein product		607074				11042152, 11062248	Standard	NM_001079880		Approved	PKD2, HSPC187, DKFZP586E0820	uc002pfj.3	Q9BZL6		ENST00000291281.4:c.1311C>T	19.37:g.47200420G>A			Q8TB08|Q9P0T6|Q9Y3X8	Silent	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_Pleckstrin_homology,superfamily_Kinase-like_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Pleckstrin_homology,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Pleckstrin_homology,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_dom,prints_DAG/PE-bd	p.Y437	ENST00000291281.4	37	c.1311	CCDS12689.1	19																																																																																			PRKD2	-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	ENSG00000105287		0.532	PRKD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKD2	HGNC	protein_coding	OTTHUMT00000466591.1		0.00	15	0	G	NM_016457		47200420	-1			no_errors	ENST00000291281	ensembl	human	known	74_37	silent	33.33	6	3	SNP	1.000	A
PRPF38A	84950	genome.wustl.edu	37	1	52874343	52874343	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr1:52874343G>C	ENST00000257181.9	+	3	579	c.393G>C	c.(391-393)aaG>aaC	p.K131N	PRPF38A_ENST00000474048.1_Intron|snoU13_ENST00000458879.1_RNA	NM_032864.3	NP_116253.2	Q8NAV1	PR38A_HUMAN	pre-mRNA processing factor 38A	131					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	spliceosomal complex (GO:0005681)	poly(A) RNA binding (GO:0044822)			cervix(2)|kidney(1)|large_intestine(2)|liver(1)|lung(2)|stomach(1)	9						GAAAAATCAAGAGCCAGAACC	0.418																																																	0													94.0	87.0	89.0					1																	52874343		2203	4300	6503	SO:0001583	missense	0			AK092038	CCDS567.1	1p32.3	2013-10-03	2013-10-03		ENSG00000134748	ENSG00000134748			25930	protein-coding gene	gene with protein product			"""PRP38 pre-mRNA processing factor 38 (yeast) domain containing A"""			12477932	Standard	NM_032864		Approved	FLJ14936, Prp38	uc001ctw.4	Q8NAV1	OTTHUMG00000008199	ENST00000257181.9:c.393G>C	1.37:g.52874343G>C	ENSP00000257181:p.Lys131Asn		Q96JW1|Q9BVZ8	Missense_Mutation	SNP	pfam_PRP38	p.K131N	ENST00000257181.9	37	c.393	CCDS567.1	1	.	.	.	.	.	.	.	.	.	.	G	19.76	3.887474	0.72410	.	.	ENSG00000134748	ENST00000257181	.	.	.	5.37	5.37	0.77165	.	0.000000	0.85682	D	0.000000	T	0.71434	0.3339	M	0.80982	2.52	0.80722	D	1	D	0.63046	0.992	D	0.64410	0.925	T	0.73861	-0.3849	9	0.52906	T	0.07	-26.7184	7.0073	0.24844	0.212:0.0:0.788:0.0	.	131	Q8NAV1	PR38A_HUMAN	N	131	.	ENSP00000257181:K131N	K	+	3	2	PRPF38A	52646931	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.461000	0.53035	2.507000	0.84556	0.557000	0.71058	AAG	PRPF38A	-	pfam_PRP38	ENSG00000134748		0.418	PRPF38A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PRPF38A	HGNC	protein_coding	OTTHUMT00000022459.2	-	0.00	43	0	G	NM_032864		52874343	+1	tier1	-	no_errors	ENST00000257181	ensembl	human	known	74_37	missense	11.76	30	4	SNP	1.000	C
PRPF39	55015	genome.wustl.edu	37	14	45581661	45581661	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr14:45581661G>T	ENST00000355765.6	+	11	1883	c.1713G>T	c.(1711-1713)caG>caT	p.Q571H	SNORD127_ENST00000458892.1_RNA	NM_017922.3	NP_060392.3	Q86UA1	PRP39_HUMAN	pre-mRNA processing factor 39	571					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)				breast(2)|endometrium(2)|kidney(4)|lung(3)|ovary(1)	12						CATTTTCTCAGAGAAAAGTGG	0.274																																																	0													44.0	48.0	47.0					14																	45581661		2200	4293	6493	SO:0001583	missense	0			AK000673	CCDS9682.2	14q21.1	2013-10-03	2013-10-03		ENSG00000185246	ENSG00000185246			20314	protein-coding gene	gene with protein product		614907	"""PRP39 pre-mRNA processing factor 39 homolog (yeast)"", ""PRP39 pre-mRNA processing factor 39 homolog (S. cerevisiae)"""				Standard	NM_017922		Approved	FLJ20666, FLJ11128	uc001wvz.4	Q86UA1	OTTHUMG00000140265	ENST00000355765.6:c.1713G>T	14.37:g.45581661G>T	ENSP00000348010:p.Gln571His		Q08AL1|Q08AL2|Q9NUU5	Missense_Mutation	SNP	smart_HAT	p.Q571H	ENST00000355765.6	37	c.1713	CCDS9682.2	14	.	.	.	.	.	.	.	.	.	.	G	13.85	2.360798	0.41801	.	.	ENSG00000185246	ENST00000355765	T	0.35973	1.28	5.61	2.42	0.29668	.	0.000000	0.85682	D	0.000000	T	0.36276	0.0961	M	0.81802	2.56	0.80722	D	1	B;B	0.33755	0.127;0.424	B;B	0.31337	0.093;0.128	T	0.11743	-1.0575	10	0.51188	T	0.08	-10.8868	7.3237	0.26542	0.4032:0.0:0.5968:0.0	.	175;571	Q86UA1-2;Q86UA1	.;PRP39_HUMAN	H	571	ENSP00000348010:Q571H	ENSP00000348010:Q571H	Q	+	3	2	PRPF39	44651411	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	1.226000	0.32563	0.173000	0.19788	0.467000	0.42956	CAG	PRPF39	-	NULL	ENSG00000185246		0.274	PRPF39-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PRPF39	HGNC	protein_coding	OTTHUMT00000319683.2	-	0.00	64	0	G			45581661	+1	tier1	-	no_errors	ENST00000355765	ensembl	human	known	74_37	missense	6.35	59	4	SNP	1.000	T
PRPF8	10594	genome.wustl.edu	37	17	1564934	1564934	+	Silent	SNP	G	G	C			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr17:1564934G>C	ENST00000572621.1	-	25	4438	c.4173C>G	c.(4171-4173)ctC>ctG	p.L1391L	PRPF8_ENST00000304992.6_Silent_p.L1391L			Q6P2Q9	PRP8_HUMAN	pre-mRNA processing factor 8	1391	Linker.				gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|U5 snRNP (GO:0005682)	poly(A) RNA binding (GO:0044822)|U5 snRNA binding (GO:0030623)|U6 snRNA binding (GO:0017070)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(13)|lung(24)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(3)	77				UCEC - Uterine corpus endometrioid carcinoma (25;0.0855)		CTTGCCTCTTGAGTGCGTACT	0.572																																																	0													98.0	81.0	87.0					17																	1564934		2203	4300	6503	SO:0001819	synonymous_variant	0			AB007510	CCDS11010.1	17p13.3	2013-07-16	2013-06-10		ENSG00000174231	ENSG00000174231			17340	protein-coding gene	gene with protein product		607300	"""PRP8 pre-mRNA processing factor 8 homolog (yeast)"", ""PRP8 pre-mRNA processing factor 8 homolog (S. cerevisiae)"""	RP13		11468273, 10411133	Standard	NM_006445		Approved	PRPC8, Prp8, hPrp8, SNRNP220	uc002fte.3	Q6P2Q9	OTTHUMG00000090553	ENST00000572621.1:c.4173C>G	17.37:g.1564934G>C			O14547|O75965	Silent	SNP	pfam_PROCN,pfam_PRP8_domainIV,pfam_Prp8_U6-snRNA-bd,pfam_PRO8NT,pfam_Prp8_U5-snRNA-bd,pfam_PROCT,pfam_RRM_spliceosomal_PrP8,pfam_JAB_MPN_dom,superfamily_Cupredoxin,superfamily_Histone-fold,smart_JAB_MPN_dom	p.L1391	ENST00000572621.1	37	c.4173	CCDS11010.1	17																																																																																			PRPF8	-	NULL	ENSG00000174231		0.572	PRPF8-002	NOVEL	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	PRPF8	HGNC	protein_coding	OTTHUMT00000438412.2	-	0.00	20	0	G			1564934	-1	tier1	-	no_errors	ENST00000304992	ensembl	human	known	74_37	silent	27.27	8	3	SNP	1.000	C
PRRT2	112476	genome.wustl.edu	37	16	29825222	29825222	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr16:29825222G>A	ENST00000358758.7	+	2	1130	c.847G>A	c.(847-849)Gtc>Atc	p.V283I	AC009133.20_ENST00000569039.1_RNA|PAGR1_ENST00000320330.6_5'Flank|PAGR1_ENST00000609618.1_5'Flank|PRRT2_ENST00000567659.1_Missense_Mutation_p.V283I|AC009133.14_ENST00000569981.1_RNA|PRRT2_ENST00000300797.6_Missense_Mutation_p.V283I	NM_001256442.1|NM_001256443.1|NM_145239.2	NP_001243371.1|NP_001243372.1|NP_660282.2	Q7Z6L0	PRRT2_HUMAN	proline-rich transmembrane protein 2	283					neuromuscular process controlling posture (GO:0050884)|response to biotic stimulus (GO:0009607)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synapse (GO:0045202)				central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)	8						CATGTGGCCTGTCAACATCGT	0.622																																																	0													102.0	95.0	97.0					16																	29825222		2197	4300	6497	SO:0001583	missense	0			BC011405	CCDS10654.1, CCDS58445.1, CCDS58446.1	16p11.2	2014-02-03			ENSG00000167371	ENSG00000167371		"""Proline-rich transmembrane proteins"""	30500	protein-coding gene	gene with protein product	"""interferon induced transmembrane protein domain containing 1"""	614386	"""infantile convulsions and paroxysmal choreoathetosis"""	ICCA		22101681, 22243967	Standard	NM_145239		Approved	FLJ25513, DKFZp547J199, IFITMD1, FICCA	uc002dud.3	Q7Z6L0	OTTHUMG00000177142	ENST00000358758.7:c.847G>A	16.37:g.29825222G>A	ENSP00000351608:p.Val283Ile		A8K8M8|Q8N2N8|Q8NAQ7|Q8ND36|Q96FA8	Missense_Mutation	SNP	pfam_CD225/Dispanin_fam	p.V283I	ENST00000358758.7	37	c.847	CCDS10654.1	16	.	.	.	.	.	.	.	.	.	.	G	3.369	-0.128911	0.06753	.	.	ENSG00000167371	ENST00000358758;ENST00000300797	D;D	0.85861	-2.04;-2.04	4.33	2.3	0.28687	.	0.324920	0.30547	N	0.009381	T	0.67382	0.2887	N	0.02985	-0.445	0.30554	N	0.765138	P;P;P	0.46142	0.873;0.573;0.518	P;B;B	0.46452	0.517;0.429;0.303	T	0.66101	-0.6007	10	0.22706	T	0.39	-13.1015	7.1641	0.25681	0.0994:0.1774:0.7232:0.0	.	283;283;283	Q7Z6L0-3;Q7Z6L0;Q7Z6L0-2	.;PRRT2_HUMAN;.	I	283	ENSP00000351608:V283I;ENSP00000300797:V283I	ENSP00000300797:V283I	V	+	1	0	PRRT2	29732723	1.000000	0.71417	1.000000	0.80357	0.016000	0.09150	2.599000	0.46231	0.939000	0.37446	-0.182000	0.12963	GTC	PRRT2	-	pfam_CD225/Dispanin_fam	ENSG00000167371		0.622	PRRT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRRT2	HGNC	protein_coding	OTTHUMT00000255161.3	-	0.00	38	0	G	NM_145239		29825222	+1	tier1	-	no_errors	ENST00000567659	ensembl	human	known	74_37	missense	25.00	11	4	SNP	1.000	A
PRSS36	146547	genome.wustl.edu	37	16	31151676	31151676	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr16:31151676C>T	ENST00000268281.4	-	14	2286	c.2228G>A	c.(2227-2229)gGc>gAc	p.G743D	PRSS36_ENST00000569305.1_Missense_Mutation_p.G738D|PRSS36_ENST00000418068.2_Intron	NM_001258290.1|NM_173502.4	NP_001245219.1|NP_775773.2	Q5K4E3	POLS2_HUMAN	protease, serine, 36	743	Peptidase S1 3. {ECO:0000255|PROSITE- ProRule:PRU00274}.					cytoplasm (GO:0005737)|proteinaceous extracellular matrix (GO:0005578)	serine-type endopeptidase activity (GO:0004252)			kidney(2)|large_intestine(4)|lung(8)|ovary(3)	17						GGGCAGGATGCCCTGATAGAG	0.602																																																	0													86.0	83.0	84.0					16																	31151676		2197	4300	6497	SO:0001583	missense	0			AK075142	CCDS32436.1, CCDS58452.1, CCDS58453.1	16p11.2	2014-09-04			ENSG00000178226			"""Serine peptidases / Serine peptidases"""	26906	protein-coding gene	gene with protein product	"""polyserase 2"""	610560				15536082	Standard	NM_173502		Approved	FLJ90661	uc002ebd.4	Q5K4E3	OTTHUMG00000176751	ENST00000268281.4:c.2228G>A	16.37:g.31151676C>T	ENSP00000268281:p.Gly743Asp		A8K2P5|B4DW80|B7ZMK8|E7EX56|Q8NBY4	Missense_Mutation	SNP	pirsf_Pept_S1A_polyserase-2,pfam_Peptidase_S1,pfam_Peptidase_S1A_nudel,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,prints_Peptidase_S1A,pfscan_Peptidase_S1	p.G743D	ENST00000268281.4	37	c.2228	CCDS32436.1	16	.	.	.	.	.	.	.	.	.	.	C	10.44	1.349867	0.24426	.	.	ENSG00000178226	ENST00000268281	D	0.89270	-2.49	4.74	4.74	0.60224	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	.	.	.	.	D	0.90079	0.6901	M	0.62723	1.935	0.30878	N	0.731706	D;D	0.56968	0.978;0.978	P;P	0.54372	0.75;0.75	D	0.85795	0.1370	9	0.12430	T	0.62	.	13.581	0.61903	0.0:1.0:0.0:0.0	.	738;743	B7ZMK8;Q5K4E3	.;POLS2_HUMAN	D	743	ENSP00000268281:G743D	ENSP00000268281:G743D	G	-	2	0	PRSS36	31059177	0.926000	0.31397	0.877000	0.34402	0.052000	0.14988	2.463000	0.45058	2.339000	0.79563	0.555000	0.69702	GGC	PRSS36	-	pirsf_Pept_S1A_polyserase-2,pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1	ENSG00000178226		0.602	PRSS36-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PRSS36	HGNC	protein_coding	OTTHUMT00000433542.1	-	0.00	43	0	C	NM_173502		31151676	-1	tier1	-	no_errors	ENST00000268281	ensembl	human	known	74_37	missense	39.29	17	11	SNP	0.981	T
PRUNE2	158471	genome.wustl.edu	37	9	79322773	79322773	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr9:79322773C>G	ENST00000376718.3	-	8	4540	c.4417G>C	c.(4417-4419)Gag>Cag	p.E1473Q	PRUNE2_ENST00000428286.1_Missense_Mutation_p.E1114Q	NM_015225.2	NP_056040.2	Q8WUY3	PRUN2_HUMAN	prune homolog 2 (Drosophila)	1473					apoptotic process (GO:0006915)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|pyrophosphatase activity (GO:0016462)			endometrium(1)|kidney(4)|large_intestine(3)|lung(7)|prostate(1)	16						TTCTCTGGCTCTAGAAAGTTA	0.448																																																	0													47.0	49.0	48.0					9																	79322773		1568	3582	5150	SO:0001583	missense	0			BC019095	CCDS47982.1	9q21.32	2013-04-29	2006-11-24	2006-11-24	ENSG00000106772	ENSG00000106772			25209	protein-coding gene	gene with protein product	"""olfaxin"""	610691	"""chromosome 9 open reading frame 65"", ""KIAA0367"""	C9orf65, KIAA0367		16288218	Standard	NM_015225		Approved	BMCC1, BNIPXL, A214N16.3, bA214N16.3	uc010mpk.3	Q8WUY3	OTTHUMG00000020047	ENST00000376718.3:c.4417G>C	9.37:g.79322773C>G	ENSP00000365908:p.Glu1473Gln		B3KYC4|B4DQH8|O15073|Q58A63|Q5JUB6|Q5T304|Q5T476|Q6T2V6|Q6T2V7|Q8N665	Missense_Mutation	SNP	pfam_Bcl2-/adenovirus-E1B,pfam_CRAL-TRIO_dom,superfamily_CRAL-TRIO_dom,smart_CRAL-TRIO_dom,pfscan_CRAL-TRIO_dom	p.E1114Q	ENST00000376718.3	37	c.3340	CCDS47982.1	9	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	5.009|5.009	0.187271|0.187271	0.09547|0.09547	.|.	.|.	ENSG00000106772|ENSG00000106772	ENST00000376718;ENST00000428286;ENST00000422033|ENST00000426088	T;T|.	0.52295|.	0.67;0.68|.	5.49|5.49	2.51|2.51	0.30379|0.30379	.|.	1.399160|.	0.04521|.	N|.	0.384647|.	T|T	0.40322|0.40322	0.1112|0.1112	L|L	0.51422|0.51422	1.61|1.61	0.09310|0.09310	N|N	0.999998|0.999998	B|.	0.25048|.	0.117|.	B|.	0.24155|.	0.051|.	T|T	0.25222|0.25222	-1.0138|-1.0138	10|5	0.66056|.	D|.	0.02|.	-1.5801|-1.5801	7.293|7.293	0.26376|0.26376	0.0:0.7109:0.138:0.1511|0.0:0.7109:0.138:0.1511	.|.	1473|.	Q8WUY3|.	PRUN2_HUMAN|.	Q|T	1473;1114;1472|794	ENSP00000365908:E1473Q;ENSP00000397425:E1114Q|.	ENSP00000365908:E1473Q|.	E|R	-|-	1|2	0|0	PRUNE2|PRUNE2	78512593|78512593	0.009000|0.009000	0.17119|0.17119	0.045000|0.045000	0.18777|0.18777	0.018000|0.018000	0.09664|0.09664	1.102000|1.102000	0.31050|0.31050	0.317000|0.317000	0.23160|0.23160	0.655000|0.655000	0.94253|0.94253	GAG|AGA	PRUNE2	-	NULL	ENSG00000106772		0.448	PRUNE2-003	NOVEL	basic|appris_principal|CCDS	protein_coding	PRUNE2	HGNC	protein_coding	OTTHUMT00000052730.2		0.00	21	0	C	NM_138818		79322773	-1			no_errors	ENST00000428286	ensembl	human	known	74_37	missense	17.65	14	3	SNP	0.002	G
PSD2	84249	genome.wustl.edu	37	5	139219750	139219750	+	Frame_Shift_Del	DEL	T	T	-			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr5:139219750delT	ENST00000274710.3	+	14	2312	c.2107delT	c.(2107-2109)ttcfs	p.F703fs		NM_032289.2	NP_115665.1	Q9BQI7	PSD2_HUMAN	pleckstrin and Sec7 domain containing 2	703					neuron differentiation (GO:0030182)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|phospholipid binding (GO:0005543)			breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(10)|liver(2)|lung(15)|ovary(1)|prostate(2)	38			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTATCTCACCTTCGAGGTGAG	0.602																																																	0													104.0	93.0	97.0					5																	139219750		2203	4300	6503	SO:0001589	frameshift_variant	0			AL136559	CCDS4216.1	5q31.3	2013-01-10			ENSG00000146005	ENSG00000146005		"""Pleckstrin homology (PH) domain containing"""	19092	protein-coding gene	gene with protein product							Standard	NM_032289		Approved	DKFZp761B0514	uc003leu.1	Q9BQI7	OTTHUMG00000129240	ENST00000274710.3:c.2107delT	5.37:g.139219750delT	ENSP00000274710:p.Phe703fs		D3DQD3|Q8N3J8	Frame_Shift_Del	DEL	pfam_Sec7_dom,pfam_Pleckstrin_homology,superfamily_Sec7_dom,smart_Sec7_dom,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_Sec7_dom,prints_PH_dom-spectrin-type	p.F703fs	ENST00000274710.3	37	c.2107	CCDS4216.1	5																																																																																			PSD2	-	NULL	ENSG00000146005		0.602	PSD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSD2	HGNC	protein_coding	OTTHUMT00000251339.1		0.00	33	0	T	NM_032289		139219750	+1	tier1		no_errors	ENST00000274710	ensembl	human	known	74_37	frame_shift_del	22.22	7	2	DEL	0.961	-
PSEN1	5663	genome.wustl.edu	37	14	73673101	73673101	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr14:73673101G>C	ENST00000324501.5	+	9	1148	c.876G>C	c.(874-876)atG>atC	p.M292I	PSEN1_ENST00000357710.4_Missense_Mutation_p.M288I|PSEN1_ENST00000557511.1_Missense_Mutation_p.M292I|PSEN1_ENST00000261970.3_Missense_Mutation_p.M292I|PSEN1_ENST00000394164.1_Missense_Mutation_p.M288I|PSEN1_ENST00000406768.1_Missense_Mutation_p.M200I|PSEN1_ENST00000344094.3_Missense_Mutation_p.M292I	NM_000021.3|NM_007318.2	NP_000012.1|NP_015557.2	P49768	PSN1_HUMAN	presenilin 1	292		Cleavage; alternate.			activation of MAPKK activity (GO:0000186)|amyloid precursor protein catabolic process (GO:0042987)|anagen (GO:0042640)|autophagic vacuole assembly (GO:0000045)|beta-amyloid formation (GO:0034205)|beta-amyloid metabolic process (GO:0050435)|blood vessel development (GO:0001568)|brain morphogenesis (GO:0048854)|Cajal-Retzius cell differentiation (GO:0021870)|calcium ion transmembrane transport (GO:0070588)|canonical Wnt signaling pathway (GO:0060070)|cell fate specification (GO:0001708)|cellular response to DNA damage stimulus (GO:0006974)|cerebral cortex cell migration (GO:0021795)|choline transport (GO:0015871)|dorsal/ventral neural tube patterning (GO:0021904)|embryonic limb morphogenesis (GO:0030326)|endoplasmic reticulum calcium ion homeostasis (GO:0032469)|epithelial cell proliferation (GO:0050673)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart looping (GO:0001947)|hematopoietic progenitor cell differentiation (GO:0002244)|intracellular signal transduction (GO:0035556)|L-glutamate transport (GO:0015813)|membrane protein ectodomain proteolysis (GO:0006509)|memory (GO:0007613)|mitochondrial transport (GO:0006839)|myeloid leukocyte differentiation (GO:0002573)|negative regulation of apoptotic process (GO:0043066)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of axonogenesis (GO:0050771)|negative regulation of epidermal growth factor-activated receptor activity (GO:0007175)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000059)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of ubiquitin-protein transferase activity (GO:0051444)|neuron apoptotic process (GO:0051402)|neuron development (GO:0048666)|neuron migration (GO:0001764)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|positive regulation of apoptotic process (GO:0043065)|positive regulation of catalytic activity (GO:0043085)|positive regulation of coagulation (GO:0050820)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of receptor recycling (GO:0001921)|post-embryonic development (GO:0009791)|protein glycosylation (GO:0006486)|protein processing (GO:0016485)|protein transport (GO:0015031)|regulation of phosphorylation (GO:0042325)|regulation of protein binding (GO:0043393)|regulation of resting membrane potential (GO:0060075)|regulation of synaptic plasticity (GO:0048167)|regulation of synaptic transmission, glutamatergic (GO:0051966)|response to oxidative stress (GO:0006979)|single organismal cell-cell adhesion (GO:0016337)|skeletal system morphogenesis (GO:0048705)|skin morphogenesis (GO:0043589)|smooth endoplasmic reticulum calcium ion homeostasis (GO:0051563)|somitogenesis (GO:0001756)|synaptic vesicle targeting (GO:0016080)|T cell activation involved in immune response (GO:0002286)|T cell receptor signaling pathway (GO:0050852)|thymus development (GO:0048538)	apical plasma membrane (GO:0016324)|axon (GO:0030424)|cell cortex (GO:0005938)|cell surface (GO:0009986)|centrosome (GO:0005813)|ciliary rootlet (GO:0035253)|cytoplasmic vesicle (GO:0031410)|dendritic shaft (GO:0043198)|endoplasmic reticulum (GO:0005783)|gamma-secretase complex (GO:0070765)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|kinetochore (GO:0000776)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|nuclear membrane (GO:0031965)|nuclear outer membrane (GO:0005640)|perinuclear region of cytoplasm (GO:0048471)|rough endoplasmic reticulum (GO:0005791)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	aspartic-type endopeptidase activity (GO:0004190)|beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|calcium channel activity (GO:0005262)|endopeptidase activity (GO:0004175)|PDZ domain binding (GO:0030165)			breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(7)|prostate(1)|urinary_tract(1)	18				BRCA - Breast invasive adenocarcinoma(234;0.00394)|OV - Ovarian serous cystadenocarcinoma(108;0.075)		CAGCAACAATGGTGTGGTTGG	0.408																																																	0													101.0	95.0	97.0					14																	73673101		2203	4300	6503	SO:0001583	missense	0			AJ008005	CCDS9812.1, CCDS9813.1	14q24.3	2014-09-17	2008-07-28		ENSG00000080815	ENSG00000080815			9508	protein-coding gene	gene with protein product		104311	"""Alzheimer disease 3"""	AD3		1411576	Standard	NM_007318		Approved	FAD, S182, PS1	uc001xnr.3	P49768	OTTHUMG00000141279	ENST00000324501.5:c.876G>C	14.37:g.73673101G>C	ENSP00000326366:p.Met292Ile		B2R6D3|O95465|Q14762|Q15719|Q15720|Q96P33|Q9UIF0	Missense_Mutation	SNP	pfam_Peptidase_A22A,smart_Preselin/SPP,prints_Pept_A22A_PS1,prints_Peptidase_A22A	p.M292I	ENST00000324501.5	37	c.876	CCDS9812.1	14	.	.	.	.	.	.	.	.	.	.	G	18.49	3.635406	0.67130	.	.	ENSG00000080815	ENST00000324501;ENST00000357710;ENST00000261970;ENST00000344094;ENST00000394164;ENST00000557511;ENST00000406768	D;D;D;D;D;D;D	0.99488	-6.0;-6.0;-6.0;-6.0;-6.0;-6.0;-6.0	5.29	5.29	0.74685	.	0.000000	0.85682	D	0.000000	D	0.99390	0.9785	M	0.70275	2.135	0.80722	D	1	B;D	0.60575	0.078;0.988	B;D	0.75020	0.155;0.985	D	0.99911	1.1201	10	0.29301	T	0.29	-25.0433	18.5235	0.90962	0.0:0.0:1.0:0.0	.	288;292	P49768-2;P49768	.;PSN1_HUMAN	I	292;288;292;292;288;292;200	ENSP00000326366:M292I;ENSP00000350342:M288I;ENSP00000261970:M292I;ENSP00000339523:M292I;ENSP00000377719:M288I;ENSP00000451429:M292I;ENSP00000385948:M200I	ENSP00000261970:M292I	M	+	3	0	PSEN1	72742854	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.496000	0.90485	2.471000	0.83476	0.650000	0.86243	ATG	PSEN1	-	pfam_Peptidase_A22A,smart_Preselin/SPP	ENSG00000080815		0.408	PSEN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSEN1	HGNC	protein_coding	OTTHUMT00000280500.2	-	0.00	50	0	G			73673101	+1	tier1	-	no_errors	ENST00000324501	ensembl	human	known	74_37	missense	20.59	27	7	SNP	1.000	C
PSG5	5673	genome.wustl.edu	37	19	43683274	43683274	+	Intron	SNP	A	A	G			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr19:43683274A>G	ENST00000366175.3	-	3	561				PSG5_ENST00000404580.1_Intron|PSG5_ENST00000342951.6_Intron|PSG5_ENST00000599812.1_Silent_p.L156L|PSG5_ENST00000407356.1_Intron|PSG5_ENST00000407568.1_Intron			Q15238	PSG5_HUMAN	pregnancy specific beta-1-glycoprotein 5						female pregnancy (GO:0007565)	extracellular region (GO:0005576)				breast(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(18)|prostate(1)|skin(6)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	35		Prostate(69;0.00899)				CTGGGGTTTAAGTTGCTACTG	0.512																																																	0													266.0	246.0	252.0					19																	43683274		876	1990	2866	SO:0001627	intron_variant	0				CCDS12617.1	19q13.2	2013-01-29			ENSG00000204941	ENSG00000204941		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9522	protein-coding gene	gene with protein product	"""pregnancy-specific beta-1 glycoprotein"", ""pregnancy-specific beta 1 glycoprotein"""	176394				2735907	Standard	NM_002781		Approved	FL-NCA-3, PSG	uc002ovx.3	Q15238	OTTHUMG00000151539	ENST00000366175.3:c.431-2974T>C	19.37:g.43683274A>G			Q15239|Q96QJ1|Q9UQ75	Silent	SNP	pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.L156	ENST00000366175.3	37	c.466	CCDS12617.1	19																																																																																			PSG5	-	smart_Ig_sub,pfscan_Ig-like_dom	ENSG00000204941		0.512	PSG5-001	KNOWN	basic|CCDS	protein_coding	PSG5	HGNC	protein_coding	OTTHUMT00000323055.1	-	0.00	118	0	A	NM_002781		43683274	-1	tier1	-	no_errors	ENST00000599812	ensembl	human	novel	74_37	silent	37.08	56	33	SNP	0.000	G
PSTPIP1	9051	genome.wustl.edu	37	15	77323585	77323585	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr15:77323585A>G	ENST00000558012.1	+	10	1196	c.707A>G	c.(706-708)aAc>aGc	p.N236S	PSTPIP1_ENST00000379595.3_Missense_Mutation_p.N236S|PSTPIP1_ENST00000267939.5_Missense_Mutation_p.N235S|PSTPIP1_ENST00000559295.1_Missense_Mutation_p.N236S|PSTPIP1_ENST00000557995.1_3'UTR	NM_003978.3	NP_003969.2	O43586	PPIP1_HUMAN	proline-serine-threonine phosphatase interacting protein 1	236					cell adhesion (GO:0007155)|endocytosis (GO:0006897)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|signal transduction (GO:0007165)	actomyosin contractile ring (GO:0005826)|cell projection (GO:0042995)|cleavage furrow (GO:0032154)|cytosol (GO:0005829)|membrane (GO:0016020)|stress fiber (GO:0001725)				breast(1)|endometrium(3)|lung(2)|ovary(2)|upper_aerodigestive_tract(1)	9						GTGCACAGCAACCAGCTCTCC	0.617																																																	0													123.0	132.0	129.0					15																	77323585		2117	4240	6357	SO:0001583	missense	0			U94778	CCDS45312.1	15q24.3	2014-09-17			ENSG00000140368	ENSG00000140368			9580	protein-coding gene	gene with protein product	"""CD2 cytoplasmic tail-binding protein"", ""CD2 antigen-binding protein 1"", ""PEST phosphatase-interacting protein 1"""	606347				9857189	Standard	NM_003978		Approved	PSTPIP, CD2BP1L, CD2BP1, CD2BP1S, H-PIP, PAPAS	uc002bcf.2	O43586	OTTHUMG00000172594	ENST00000558012.1:c.707A>G	15.37:g.77323585A>G	ENSP00000452746:p.Asn236Ser		B5BU74|B5BUK4|O43585|O95657	Missense_Mutation	SNP	pfam_FCH_dom,superfamily_Prismane-like,smart_FCH_dom,pfscan_FCH_dom	p.N301S	ENST00000558012.1	37	c.902	CCDS45312.1	15	.	.	.	.	.	.	.	.	.	.	A	24.2	4.503003	0.85176	.	.	ENSG00000140368	ENST00000379595;ENST00000267939	T;T	0.42513	0.97;2.58	4.69	4.69	0.59074	.	0.000000	0.85682	D	0.000000	T	0.68659	0.3025	M	0.88450	2.955	0.58432	D	0.999996	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.996;1.0;0.999;0.999	T	0.75584	-0.3267	10	0.72032	D	0.01	-6.2594	13.1558	0.59516	1.0:0.0:0.0:0.0	.	114;236;235;236	B4DQC0;O43586-2;C9K004;O43586	.;.;.;PPIP1_HUMAN	S	236;235	ENSP00000368914:N236S;ENSP00000267939:N235S	ENSP00000267939:N235S	N	+	2	0	PSTPIP1	75110640	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	8.159000	0.89651	1.756000	0.51951	0.379000	0.24179	AAC	PSTPIP1	-	NULL	ENSG00000140368		0.617	PSTPIP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PSTPIP1	HGNC	protein_coding	OTTHUMT00000419373.2	-	0.00	28	0	A	NM_003978		77323585	+1	tier1	-	no_errors	ENST00000559785	ensembl	human	known	74_37	missense	27.27	8	3	SNP	1.000	G
PTCHD2	57540	genome.wustl.edu	37	1	11577655	11577655	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr1:11577655A>G	ENST00000294484.6	+	7	2023	c.1885A>G	c.(1885-1887)Acc>Gcc	p.T629A	PTCHD2_ENST00000389575.3_Missense_Mutation_p.T629A	NM_020780.1	NP_065831.1	Q9P2K9	PTHD2_HUMAN	patched domain containing 2	629					cholesterol homeostasis (GO:0042632)|regulation of lipid transport (GO:0032368)|smoothened signaling pathway (GO:0007224)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nuclear membrane (GO:0031965)	hedgehog receptor activity (GO:0008158)			NS(3)|breast(2)|endometrium(9)|kidney(4)|large_intestine(5)|lung(34)|ovary(3)|pancreas(1)|prostate(6)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	76	Ovarian(185;0.249)	Lung NSC(185;4.16e-05)|all_lung(284;4.76e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.13e-07)|COAD - Colon adenocarcinoma(227;4.83e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000325)|Kidney(185;0.000877)|KIRC - Kidney renal clear cell carcinoma(229;0.00273)|STAD - Stomach adenocarcinoma(313;0.00766)|READ - Rectum adenocarcinoma(331;0.0549)		CTCCTGCCAGACCAGGTAAGT	0.597																																																	0													38.0	41.0	40.0					1																	11577655		1991	4164	6155	SO:0001583	missense	0			AB037758	CCDS41247.1	1p36.22	2010-02-17			ENSG00000204624	ENSG00000204624			29251	protein-coding gene	gene with protein product		611251				15738394	Standard	NM_020780		Approved	KIAA1337, DISP3	uc001ash.4	Q9P2K9	OTTHUMG00000002074	ENST00000294484.6:c.1885A>G	1.37:g.11577655A>G	ENSP00000294484:p.Thr629Ala		Q5VTU9|Q9UJD6	Missense_Mutation	SNP	pfam_Patched,pfam_MMPL_dom,pfscan_SSD	p.T629A	ENST00000294484.6	37	c.1885	CCDS41247.1	1	.	.	.	.	.	.	.	.	.	.	A	6.085	0.383949	0.11524	.	.	ENSG00000204624	ENST00000294484;ENST00000389575	D;D	0.85013	-1.93;-1.93	5.67	-4.66	0.03329	.	1.092760	0.06771	N	0.783428	T	0.62171	0.2406	N	0.03608	-0.345	0.09310	N	0.999998	B	0.02656	0.0	B	0.04013	0.001	T	0.58042	-0.7706	10	0.05620	T	0.96	-12.7437	10.8089	0.46535	0.3552:0.0:0.5435:0.1013	.	629	Q9P2K9	PTHD2_HUMAN	A	629	ENSP00000294484:T629A;ENSP00000374226:T629A	ENSP00000294484:T629A	T	+	1	0	PTCHD2	11500242	0.260000	0.24053	0.898000	0.35279	0.749000	0.42624	0.202000	0.17295	-0.909000	0.03852	-0.441000	0.05720	ACC	PTCHD2	-	pfam_Patched	ENSG00000204624		0.597	PTCHD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PTCHD2	HGNC	protein_coding	OTTHUMT00000005770.2		0.00	29	0	A	XM_052561		11577655	+1			no_errors	ENST00000294484	ensembl	human	known	74_37	missense	9.09	20	2	SNP	0.234	G
PTPRZ1	5803	genome.wustl.edu	37	7	121650873	121650873	+	Silent	SNP	C	C	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr7:121650873C>T	ENST00000393386.2	+	12	2184	c.1773C>T	c.(1771-1773)ccC>ccT	p.P591P	PTPRZ1_ENST00000449182.1_Silent_p.P591P	NM_001206838.1|NM_002851.2	NP_001193767.1|NP_002842.2	P23471	PTPRZ_HUMAN	protein tyrosine phosphatase, receptor-type, Z polypeptide 1	591					axonogenesis (GO:0007409)|central nervous system development (GO:0007417)|hematopoietic progenitor cell differentiation (GO:0002244)|learning or memory (GO:0007611)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of oligodendrocyte progenitor proliferation (GO:0070445)	integral component of plasma membrane (GO:0005887)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)	protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(3)|central_nervous_system(4)|cervix(1)|endometrium(4)|kidney(12)|large_intestine(17)|liver(1)|lung(42)|ovary(4)|prostate(5)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(2)	106						GCTCCAGTCCCGCAACTTCTG	0.398																																																	0													40.0	41.0	40.0					7																	121650873		2202	4300	6502	SO:0001819	synonymous_variant	0			M93426	CCDS34740.1, CCDS56505.1	7q31.3	2013-02-11			ENSG00000106278	ENSG00000106278		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9685	protein-coding gene	gene with protein product		176891		PTPZ, PTPRZ		7736789, 8387522	Standard	NM_001206838		Approved	PTP18, RPTPB, phosphacan	uc003vjy.3	P23471	OTTHUMG00000157057	ENST00000393386.2:c.1773C>T	7.37:g.121650873C>T			A4D0W5|C9JFM0|O76043|Q9UDR6	Silent	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_Carbonic_anhydrase_a,pfam_Fibronectin_type3,superfamily_Carbonic_anhydrase_a,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,pfscan_Carbonic_anhydrase_a,prints_Tyr_Pase_rcpt/non-rcpt	p.P591	ENST00000393386.2	37	c.1773	CCDS34740.1	7																																																																																			PTPRZ1	-	NULL	ENSG00000106278		0.398	PTPRZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPRZ1	HGNC	protein_coding	OTTHUMT00000347288.1	-	0.00	30	0	C	NM_002851		121650873	+1	tier1	-	no_errors	ENST00000393386	ensembl	human	known	74_37	silent	20.00	16	4	SNP	0.001	T
PVRL2	5819	genome.wustl.edu	37	19	45381749	45381751	+	Intron	DEL	GAG	GAG	-	rs558397688	byFrequency	TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	GAG	GAG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr19:45381749_45381751delGAG	ENST00000252483.5	+	6	1042				PVRL2_ENST00000252485.4_In_Frame_Del_p.E445del	NM_001042724.1	NP_001036189.1	Q92692	PVRL2_HUMAN	poliovirus receptor-related 2 (herpesvirus entry mediator B)						acrosome assembly (GO:0001675)|adherens junction organization (GO:0034332)|adhesion of symbiont to host (GO:0044406)|cell junction assembly (GO:0034329)|cell part morphogenesis (GO:0032990)|cell-cell junction organization (GO:0045216)|cilium organization (GO:0044782)|coreceptor-mediated virion attachment to host cell (GO:0046814)|cytoskeleton organization (GO:0007010)|establishment of mitochondrion localization (GO:0051654)|fertilization (GO:0009566)|fusion of virus membrane with host plasma membrane (GO:0019064)|homophilic cell adhesion (GO:0007156)|positive regulation of immunoglobulin mediated immune response (GO:0002891)|positive regulation of mast cell activation (GO:0033005)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)|positive regulation of natural killer cell mediated cytotoxicity directed against tumor cell target (GO:0002860)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)|sperm mitochondrion organization (GO:0030382)|spermatid development (GO:0007286)|spermatid nucleus differentiation (GO:0007289)|susceptibility to natural killer cell mediated cytotoxicity (GO:0042271)|susceptibility to T cell mediated cytotoxicity (GO:0060370)	cell surface (GO:0009986)|cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|zonula adherens (GO:0005915)	cell adhesion molecule binding (GO:0050839)|coreceptor activity (GO:0015026)|identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|virus receptor activity (GO:0001618)			breast(1)|endometrium(1)|large_intestine(6)|lung(5)	13	Lung NSC(12;0.00195)|all_lung(12;0.00522)	Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0143)		TGGCAaggatgaggaggaggagg	0.591														41	0.0081869	0.0197	0.0014	5008	,	,		15541	0.003		0.003	False		,,,				2504	0.0082																0									,	121,4143		6,109,2017					,	-4.6	0.1			51	244,8010		12,220,3895	no	coding,intron	PVRL2	NM_002856.2,NM_001042724.1	,	18,329,5912	A1A1,A1R,RR		2.9561,2.8377,2.9158	,	,		365,12153				SO:0001627	intron_variant	0			X80038	CCDS12645.1, CCDS42576.1	19q13.32	2013-01-29			ENSG00000130202	ENSG00000130202		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9707	protein-coding gene	gene with protein product		600798		HVEB		7622062, 10196354	Standard	NM_001042724		Approved	PVRR2, PRR2, CD112	uc002ozw.1	Q92692	OTTHUMG00000180839	ENST00000252483.5:c.1043-3717GAG>-	19.37:g.45381758_45381760delGAG			A8K5L5|O75455|Q6IBI6|Q96J29	In_Frame_Del	DEL	pfam_CD80_C2-set,pfam_Immunoglobulin,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_V-set_subgr,pfscan_Ig-like_dom	p.E441in_frame_del	ENST00000252483.5	37	c.1312_1314	CCDS42576.1	19																																																																																			PVRL2	-	NULL	ENSG00000130202		0.591	PVRL2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PVRL2	HGNC	protein_coding	OTTHUMT00000453231.1		0.00	18	0	GAG	NM_002856		45381751	+1	tier1		no_errors	ENST00000252485	ensembl	human	known	74_37	in_frame_del	15.38	11	2	DEL	0.686:0.659:0.301	-
PWP1	11137	genome.wustl.edu	37	12	108102887	108102887	+	Splice_Site	SNP	G	G	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr12:108102887G>T	ENST00000412830.3	+	13	1336		c.e13-1		PWP1_ENST00000541166.1_Splice_Site	NM_007062.1	NP_008993.1	Q13610	PWP1_HUMAN	PWP1 homolog (S. cerevisiae)						transcription, DNA-templated (GO:0006351)	Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleus (GO:0005634)				breast(3)|endometrium(4)|kidney(1)|large_intestine(8)|lung(6)|urinary_tract(1)	23						TCTTCCTTTAGGTCTTGATCT	0.388																																																	0													116.0	109.0	111.0					12																	108102887		2203	4300	6503	SO:0001630	splice_region_variant	0			BC000067	CCDS9114.1	12q23.3	2013-06-10				ENSG00000136045		"""WD repeat domain containing"""	17015	protein-coding gene	gene with protein product	"""endonuclein"""					7828893, 11850830	Standard	NM_007062		Approved	IEF-SSP-9502	uc001tmo.1	Q13610	OTTHUMG00000169913	ENST00000412830.3:c.1169-1G>T	12.37:g.108102887G>T			A8K3R6|Q7Z3X9	Splice_Site	SNP	-	e13-1	ENST00000412830.3	37	c.1169-1	CCDS9114.1	12	.	.	.	.	.	.	.	.	.	.	G	12.21	1.869653	0.33069	.	.	ENSG00000136045	ENST00000412830;ENST00000258531;ENST00000541166	.	.	.	5.67	3.77	0.43336	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	9.7561	0.40504	0.076:0.0:0.7856:0.1385	.	.	.	.	.	-1	.	.	.	+	.	.	PWP1	106627017	1.000000	0.71417	0.186000	0.23195	0.362000	0.29581	9.471000	0.97696	0.669000	0.31146	-0.182000	0.12963	.	PWP1	-	-	ENSG00000136045		0.388	PWP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PWP1	HGNC	protein_coding	OTTHUMT00000406539.1	-	0.00	31	0	G	NM_007062	Intron	108102887	+1	tier1	-	no_errors	ENST00000412830	ensembl	human	known	74_37	splice_site	11.11	24	3	SNP	1.000	T
RALYL	138046	genome.wustl.edu	37	8	85441593	85441593	+	Nonsense_Mutation	SNP	A	A	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr8:85441593A>T	ENST00000521268.1	+	2	1142	c.37A>T	c.(37-39)Aag>Tag	p.K13*	RALYL_ENST00000521695.1_Nonsense_Mutation_p.K13*|RALYL_ENST00000518566.1_Nonsense_Mutation_p.K13*|RALYL_ENST00000522455.1_Nonsense_Mutation_p.K13*|RALYL_ENST00000517638.1_Nonsense_Mutation_p.K26*	NM_173848.5	NP_776247.3	Q86SE5	RALYL_HUMAN	RALY RNA binding protein-like	13							nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			endometrium(2)|kidney(2)|large_intestine(6)|lung(13)|ovary(1)	24						CGTCACCAATAAGAATGACCC	0.378																																																	0													64.0	69.0	67.0					8																	85441593		2008	4203	6211	SO:0001587	stop_gained	0				CCDS55252.1, CCDS55253.1, CCDS75760.1, CCDS75761.1	8q21.2	2013-07-16			ENSG00000184672	ENSG00000184672		"""RNA binding motif (RRM) containing"""	27036	protein-coding gene	gene with protein product		614648				12688537	Standard	NM_001100391		Approved	HNRPCL3	uc003yct.4	Q86SE5	OTTHUMG00000164628	ENST00000521268.1:c.37A>T	8.37:g.85441593A>T	ENSP00000430367:p.Lys13*		B3KTH2|G3V129|Q6ZW87|Q8N1C2	Nonsense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pirsf_hnRNP_C_Raly,pfscan_RRM_dom	p.K13*	ENST00000521268.1	37	c.37	CCDS55253.1	8	.	.	.	.	.	.	.	.	.	.	A	36	5.878072	0.97055	.	.	ENSG00000184672	ENST00000522613;ENST00000522455;ENST00000521695;ENST00000521268;ENST00000518566;ENST00000517988;ENST00000517638;ENST00000522647	.	.	.	5.26	5.26	0.73747	.	0.226765	0.34879	N	0.003614	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.5058	0.75739	1.0:0.0:0.0:0.0	.	.	.	.	X	13;13;13;13;13;13;26;13	.	ENSP00000430128:K26X	K	+	1	0	RALYL	85604148	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.286000	0.95898	2.125000	0.65367	0.456000	0.33151	AAG	RALYL	-	pirsf_hnRNP_C_Raly	ENSG00000184672		0.378	RALYL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RALYL	HGNC	protein_coding	OTTHUMT00000379448.1	-	0.00	70	0	A			85441593	+1	tier1	-	no_errors	ENST00000521268	ensembl	human	known	74_37	nonsense	9.62	47	5	SNP	1.000	T
RANBP17	64901	genome.wustl.edu	37	5	170640676	170640676	+	Missense_Mutation	SNP	G	G	A	rs149025321	byFrequency	TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr5:170640676G>A	ENST00000523189.1	+	21	2437	c.2273G>A	c.(2272-2274)cGg>cAg	p.R758Q	RANBP17_ENST00000521759.1_3'UTR	NM_022897.3	NP_075048.1	Q9H2T7	RBP17_HUMAN	RAN binding protein 17	758					mRNA transport (GO:0051028)|protein import into nucleus (GO:0006606)	cytoplasm (GO:0005737)|nuclear pore (GO:0005643)	GTP binding (GO:0005525)	p.R758L(1)		breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(25)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	50	Renal(175;0.000159)|Lung NSC(126;0.00751)|all_lung(126;0.0123)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			GCTGTTGAACGGTGGTATGGA	0.398			T	TRD@	ALL																																			Dom	yes		5	5q34	64901	RAN binding protein 17		L	1	Substitution - Missense(1)	upper_aerodigestive_tract(1)						G	GLN/ARG	0,4406		0,0,2203	201.0	187.0	192.0		2273	-5.3	0.2	5	dbSNP_134	192	5,8595	3.7+/-12.6	0,5,4295	yes	missense	RANBP17	NM_022897.3	43	0,5,6498	AA,AG,GG		0.0581,0.0,0.0384	benign	758/1089	170640676	5,13001	2203	4300	6503	SO:0001583	missense	0			AF222747	CCDS34287.1	5q34	2009-01-12			ENSG00000204764	ENSG00000204764			14428	protein-coding gene	gene with protein product		606141				11024021	Standard	NM_022897		Approved		uc003mba.3	Q9H2T7	OTTHUMG00000163203	ENST00000523189.1:c.2273G>A	5.37:g.170640676G>A	ENSP00000427975:p.Arg758Gln		Q8IU74	Missense_Mutation	SNP	pfam_Importin-beta_N,superfamily_ARM-type_fold,smart_Importin-beta_N	p.R758Q	ENST00000523189.1	37	c.2273	CCDS34287.1	5	.	.	.	.	.	.	.	.	.	.	G	12.03	1.815678	0.32145	0.0	5.81E-4	ENSG00000204764	ENST00000523189;ENST00000534916	T	0.21191	2.02	5.97	-5.26	0.02772	Armadillo-type fold (1);	0.799987	0.10761	N	0.637151	T	0.05593	0.0147	N	0.02539	-0.55	0.25104	N	0.990767	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.40850	-0.9541	10	0.11794	T	0.64	0.295	6.2695	0.20947	0.5104:0.0:0.1902:0.2994	.	758;758	Q546R4;Q9H2T7	.;RBP17_HUMAN	Q	758;188	ENSP00000427975:R758Q	ENSP00000427975:R758Q	R	+	2	0	RANBP17	170573281	0.999000	0.42202	0.225000	0.23894	0.121000	0.20230	0.642000	0.24735	-1.048000	0.03238	0.655000	0.94253	CGG	RANBP17	-	superfamily_ARM-type_fold	ENSG00000204764		0.398	RANBP17-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	RANBP17	HGNC	protein_coding	OTTHUMT00000372036.1		0.00	58	0	G	NM_022897		170640676	+1			no_errors	ENST00000523189	ensembl	human	known	74_37	missense	12.00	22	3	SNP	0.915	A
RASAL2	9462	genome.wustl.edu	37	1	178411903	178411903	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr1:178411903C>A	ENST00000462775.1	+	6	702	c.577C>A	c.(577-579)Ctt>Att	p.L193I	RASAL2_ENST00000367649.3_Missense_Mutation_p.L341I|RASAL2_ENST00000448150.3_Missense_Mutation_p.L323I	NM_004841.3	NP_004832.1	Q9UJF2	NGAP_HUMAN	RAS protein activator like 2	193	C2.				negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of Ras GTPase activity (GO:0032320)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)	Ras GTPase activator activity (GO:0005099)			biliary_tract(1)|breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(2)|lung(25)|ovary(2)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	54						CGAACTGTGCCTTGATGATAC	0.423																																																	0													90.0	89.0	89.0					1																	178411903		2203	4300	6503	SO:0001583	missense	0			AF047711	CCDS1321.1, CCDS1322.1, CCDS1321.2	1q25	2013-01-10			ENSG00000075391	ENSG00000075391		"""Pleckstrin homology (PH) domain containing"""	9874	protein-coding gene	gene with protein product	"""Ras GTPase activating protein-like"", ""Ras protein activator like 1"""	606136				9877179	Standard	NM_004841		Approved	nGAP	uc001glq.3	Q9UJF2	OTTHUMG00000035022	ENST00000462775.1:c.577C>A	1.37:g.178411903C>A	ENSP00000420558:p.Leu193Ile		F8W755|O95174|Q2TB22|Q5TFU9	Missense_Mutation	SNP	pfam_DUF3498,pfam_RasGAP,pfam_Pleckstrin_homology,pfam_C2_dom,superfamily_Rho_GTPase_activation_prot,superfamily_C2_dom,superfamily_PP1_inhibitor,smart_Pleckstrin_homology,smart_C2_dom,smart_RasGAP,pfscan_Pleckstrin_homology,pfscan_RasGAP	p.L341I	ENST00000462775.1	37	c.1021	CCDS1322.1	1	.	.	.	.	.	.	.	.	.	.	C	23.1	4.376087	0.82682	.	.	ENSG00000075391	ENST00000448150;ENST00000367649;ENST00000462775	T;T;T	0.71579	-0.58;-0.58;-0.58	5.75	4.83	0.62350	C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.138314	0.49305	D	0.000146	D	0.85191	0.5640	M	0.83852	2.665	0.80722	D	1	D;D	0.89917	1.0;0.996	D;D	0.91635	0.999;0.994	D	0.87812	0.2632	10	0.87932	D	0	.	16.102	0.81178	0.1351:0.8649:0.0:0.0	.	193;341	Q9UJF2;F8W755	NGAP_HUMAN;.	I	323;341;193	ENSP00000407768:L323I;ENSP00000356621:L341I;ENSP00000420558:L193I	ENSP00000356621:L341I	L	+	1	0	RASAL2	176678526	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.711000	0.84669	1.408000	0.46895	0.650000	0.86243	CTT	RASAL2	-	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom	ENSG00000075391		0.423	RASAL2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	RASAL2	HGNC	protein_coding	OTTHUMT00000084758.3	-	0.00	55	0	C	NM_170692		178411903	+1	tier1	-	no_errors	ENST00000367649	ensembl	human	known	74_37	missense	8.00	46	4	SNP	1.000	A
RBM25	58517	genome.wustl.edu	37	14	73577780	73577780	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr14:73577780G>T	ENST00000261973.7	+	15	2219	c.1934G>T	c.(1933-1935)gGt>gTt	p.G645V	RBM25_ENST00000532483.1_3'UTR|RBM25_ENST00000527432.1_Missense_Mutation_p.G645V	NM_021239.2	NP_067062.1	P49756	RBM25_HUMAN	RNA binding motif protein 25	645					mRNA processing (GO:0006397)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of apoptotic process (GO:0042981)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(6)|ovary(2)|pancreas(1)	31				BRCA - Breast invasive adenocarcinoma(234;0.00362)|OV - Ovarian serous cystadenocarcinoma(108;0.0688)		TCTCCCTGTGGTATTATTATT	0.468																																																	0													98.0	87.0	91.0					14																	73577780		2203	4300	6503	SO:0001583	missense	0			BX647116	CCDS32113.1	14q24.3	2013-02-12	2004-04-23	2004-04-29	ENSG00000119707	ENSG00000119707		"""RNA binding motif (RRM) containing"""	23244	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 94"""	612427	"""RNA-binding region (RNP1, RRM) containing 7"""	RNPC7		9847074, 7596406	Standard	NM_021239		Approved	S164, fSAP94, NET52, Snu71	uc001xno.3	P49756	OTTHUMG00000167540	ENST00000261973.7:c.1934G>T	14.37:g.73577780G>T	ENSP00000261973:p.Gly645Val		A0PJL9|B2RNA8|B3KT03|Q2TA72|Q5XJ17|Q6P665|Q9H6A1|Q9UEQ5|Q9UIE9	Missense_Mutation	SNP	pfam_PWI_dom,pfam_RRM_dom,superfamily_PWI_dom,smart_RRM_dom,smart_PWI_dom,pfscan_RRM_dom	p.G645V	ENST00000261973.7	37	c.1934	CCDS32113.1	14	.	.	.	.	.	.	.	.	.	.	G	23.3	4.396306	0.83011	.	.	ENSG00000119707	ENST00000261973;ENST00000527432	T;T	0.13307	2.6;2.6	5.62	5.62	0.85841	.	0.000000	0.85682	D	0.000000	T	0.35682	0.0940	L	0.60455	1.87	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.00701	-1.1603	10	0.30854	T	0.27	.	19.6585	0.95853	0.0:0.0:1.0:0.0	.	645	P49756	RBM25_HUMAN	V	645	ENSP00000261973:G645V;ENSP00000431150:G645V	ENSP00000261973:G645V	G	+	2	0	RBM25	72647533	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	9.476000	0.97823	2.657000	0.90304	0.467000	0.42956	GGT	RBM25	-	NULL	ENSG00000119707		0.468	RBM25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBM25	HGNC	protein_coding	OTTHUMT00000394966.1	-	0.00	25	0	G	XM_027330		73577780	+1	tier1	-	no_errors	ENST00000261973	ensembl	human	known	74_37	missense	18.18	18	4	SNP	1.000	T
RBM26	64062	genome.wustl.edu	37	13	79940817	79940817	+	Silent	SNP	G	G	A			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr13:79940817G>A	ENST00000438737.2	-	7	1526	c.1086C>T	c.(1084-1086)ccC>ccT	p.P362P	RBM26_ENST00000461008.1_5'UTR|RBM26_ENST00000267229.7_Silent_p.P362P|RBM26_ENST00000438724.1_Silent_p.P362P			Q5T8P6	RBM26_HUMAN	RNA binding motif protein 26	362	Pro-rich.				mRNA processing (GO:0006397)|negative regulation of phosphatase activity (GO:0010923)		metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|biliary_tract(1)|breast(2)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(6)|lung(7)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	33		Acute lymphoblastic leukemia(28;0.0279)		GBM - Glioblastoma multiforme(99;0.0188)		GTGGTACTGGGGGCCTGAGAT	0.527																																																	0													40.0	45.0	43.0					13																	79940817		2203	4300	6503	SO:0001819	synonymous_variant	0			AF116667	CCDS9462.1, CCDS66566.1, CCDS73591.1	13q31.1	2014-06-13	2006-06-22	2006-06-22	ENSG00000139746	ENSG00000139746		"""Zinc fingers, CCCH-type domain containing"", ""RNA binding motif (RRM) containing"""	20327	protein-coding gene	gene with protein product	"""acidic rich RS domain containing 2"", ""protein phosphatase 1, regulatory 132"""		"""chromosome 13 open reading frame 10"""	C13orf10		11149944, 15741184	Standard	XM_005266497		Approved	PRO1777, SE70-2, FLJ20957, ZC3H17, ARRS2, PPP1R132	uc001vky.2	Q5T8P6	OTTHUMG00000017133	ENST00000438737.2:c.1086C>T	13.37:g.79940817G>A			B4DZE0|Q2NKM2|Q2NKQ2|Q5CZH8|Q5T8P5|Q5T8P8|Q5U5P5|Q5W0G7|Q8N3H5|Q96K92|Q96SZ3|Q9H2F8|Q9H7F9|Q9P1G7	Silent	SNP	pfam_PWI_dom,superfamily_PWI_dom,smart_Znf_CCCH,smart_RRM_dom,pfscan_RRM_dom	p.P362	ENST00000438737.2	37	c.1086		13																																																																																			RBM26	-	NULL	ENSG00000139746		0.527	RBM26-004	NOVEL	not_organism_supported|basic	protein_coding	RBM26	HGNC	protein_coding	OTTHUMT00000045373.4	-	0.00	71	0	G	NM_022118		79940817	-1	tier1	-	no_errors	ENST00000438724	ensembl	human	known	74_37	silent	20.59	26	7	SNP	0.988	A
RBM6	10180	genome.wustl.edu	37	3	50005402	50005402	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr3:50005402G>T	ENST00000266022.4	+	3	803	c.544G>T	c.(544-546)Gat>Tat	p.D182Y	RBM6_ENST00000539992.1_Intron|RBM6_ENST00000442092.1_Intron|RBM6_ENST00000443081.1_Missense_Mutation_p.D50Y|RBM6_ENST00000422955.1_Intron|RBM6_ENST00000441115.1_Intron	NM_005777.2	NP_005768.1	P78332	RBM6_HUMAN	RNA binding motif protein 6	182					RNA processing (GO:0006396)	nucleus (GO:0005634)	DNA binding (GO:0003677)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(10)|ovary(3)|prostate(1)|skin(4)|urinary_tract(1)	33				BRCA - Breast invasive adenocarcinoma(193;6.81e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.0084)|Kidney(197;0.00977)		GGGCACTTATGATTTAGATTT	0.493																																																	0													46.0	49.0	48.0					3																	50005402		2203	4300	6503	SO:0001583	missense	0			AF069517	CCDS2809.1, CCDS54586.1	3p21.3	2013-01-28			ENSG00000004534	ENSG00000004534		"""RNA binding motif (RRM) containing"", ""G patch domain containing"""	9903	protein-coding gene	gene with protein product		606886				10352938	Standard	NM_001167582		Approved	DEF-3, 3G2, NY-LU-12, g16, DEF3	uc003cyc.3	P78332	OTTHUMG00000156736	ENST00000266022.4:c.544G>T	3.37:g.50005402G>T	ENSP00000266022:p.Asp182Tyr		O60549|O75524|Q86SS3	Missense_Mutation	SNP	pfam_G_patch_dom,smart_RRM_dom,smart_G_patch_dom,pfscan_G_patch_dom,pfscan_RRM_dom	p.D182Y	ENST00000266022.4	37	c.544	CCDS2809.1	3	.	.	.	.	.	.	.	.	.	.	G	15.56	2.868977	0.51588	.	.	ENSG00000004534	ENST00000266022;ENST00000443081	T;T	0.34072	1.38;1.43	6.04	6.04	0.98038	.	0.141160	0.51477	D	0.000099	T	0.55321	0.1913	L	0.48642	1.525	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.42068	-0.9473	9	.	.	.	-17.5556	18.7597	0.91845	0.0:0.0:1.0:0.0	.	182	P78332	RBM6_HUMAN	Y	182;50	ENSP00000266022:D182Y;ENSP00000396466:D50Y	.	D	+	1	0	RBM6	49980406	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.314000	0.59166	2.873000	0.98535	0.561000	0.74099	GAT	RBM6	-	NULL	ENSG00000004534		0.493	RBM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBM6	HGNC	protein_coding	OTTHUMT00000345528.4	-	0.00	49	0	G	NM_005777		50005402	+1	tier1	-	no_errors	ENST00000266022	ensembl	human	known	74_37	missense	16.67	15	3	SNP	1.000	T
RBMXL2	27288	genome.wustl.edu	37	11	7110456	7110456	+	Silent	SNP	C	C	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr11:7110456C>T	ENST00000306904.5	+	1	292	c.105C>T	c.(103-105)gtC>gtT	p.V35V		NM_014469.4	NP_055284.3	O75526	RMXL2_HUMAN	RNA binding motif protein, X-linked-like 2	35	RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.					nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)	p.V35V(1)		NS(1)|breast(1)|endometrium(2)|large_intestine(2)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	15				Epithelial(150;5.14e-08)|BRCA - Breast invasive adenocarcinoma(625;0.189)		GCCGCATCGTCGAGGTGCTCC	0.597																																																	1	Substitution - coding silent(1)	breast(1)											42.0	43.0	43.0					11																	7110456		2201	4296	6497	SO:0001819	synonymous_variant	0			AF069682	CCDS7777.1	11p15	2013-07-16				ENSG00000170748		"""RNA binding motif (RRM) containing"""	17886	protein-coding gene	gene with protein product	"""heterogeneous nuclear ribonucleoprotein G T"""	605444				10958650	Standard	NM_014469		Approved	HNRNPG-T, HNRPGT	uc001mfc.2	O75526		ENST00000306904.5:c.105C>T	11.37:g.7110456C>T			Q6PEZ2|Q9NQU0	Silent	SNP	pfam_RRM_dom,pfam_RBM1CTR,smart_RRM_dom_euk,smart_RRM_dom,pfscan_RRM_dom	p.V35	ENST00000306904.5	37	c.105	CCDS7777.1	11																																																																																			RBMXL2	-	pfam_RRM_dom,smart_RRM_dom_euk,smart_RRM_dom,pfscan_RRM_dom	ENSG00000170748		0.597	RBMXL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBMXL2	HGNC	protein_coding	OTTHUMT00000384552.1	-	0.00	67	0	C	NM_014469		7110456	+1	tier1	-	no_errors	ENST00000306904	ensembl	human	known	74_37	silent	36.84	24	14	SNP	0.007	T
RFC4	5984	genome.wustl.edu	37	3	186508161	186508161	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr3:186508161G>A	ENST00000392481.2	-	9	1117	c.836C>T	c.(835-837)gCt>gTt	p.A279V	RFC4_ENST00000296273.2_Missense_Mutation_p.A279V|RFC4_ENST00000433496.1_Intron|SNORA4_ENST00000584302.1_RNA|SNORA63_ENST00000363450.1_RNA	NM_181573.2	NP_853551.1	P35249	RFC4_HUMAN	replication factor C (activator 1) 4, 37kDa	279					DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA strand elongation involved in DNA replication (GO:0006271)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	DNA replication factor C complex (GO:0005663)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)			breast(3)|kidney(3)|large_intestine(5)|lung(9)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	26	all_cancers(143;2.92e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;7.41e-21)	GBM - Glioblastoma multiforme(93;0.0739)		CTGACAGGCAGCAAATACTCC	0.388																																																	0													111.0	112.0	112.0					3																	186508161		2203	4300	6503	SO:0001583	missense	0				CCDS3283.1	3q27	2010-04-21	2002-08-29		ENSG00000163918	ENSG00000163918		"""ATPases / AAA-type"""	9972	protein-coding gene	gene with protein product	"""A1 37 kDa subunit"", ""activator 1 37 kDa subunit"", ""RFC 37 kDa subunit"""	102577	"""replication factor C (activator 1) 4 (37kD)"""			7774928	Standard	NM_181573		Approved	A1, RFC37	uc003fqz.3	P35249	OTTHUMG00000156515	ENST00000392481.2:c.836C>T	3.37:g.186508161G>A	ENSP00000376272:p.Ala279Val		B4DM41|D3DNV2|Q6FHX7	Missense_Mutation	SNP	pfam_Rep_factorC_C_dom,pfam_ATPase_AAA_core,superfamily_P-loop_NTPase,superfamily_DNA_pol3_clamp-load_cplx_C,smart_AAA+_ATPase	p.A279V	ENST00000392481.2	37	c.836	CCDS3283.1	3	.	.	.	.	.	.	.	.	.	.	G	10.09	1.256157	0.22965	.	.	ENSG00000163918	ENST00000392481;ENST00000296273;ENST00000417876	T;T;T	0.44482	0.92;0.92;0.92	5.32	2.3	0.28687	Replication factor C (1);DNA polymerase III, clamp loader complex, gamma/delta/delta subunit, C-terminal (1);	0.708200	0.15878	N	0.240169	T	0.23886	0.0578	N	0.17474	0.49	0.09310	N	1	B	0.02656	0.0	B	0.09377	0.004	T	0.14531	-1.0469	10	0.35671	T	0.21	.	7.0599	0.25119	0.0814:0.0:0.4835:0.4351	.	279	P35249	RFC4_HUMAN	V	279;279;54	ENSP00000376272:A279V;ENSP00000296273:A279V;ENSP00000401429:A54V	ENSP00000296273:A279V	A	-	2	0	RFC4	187990855	0.997000	0.39634	0.091000	0.20842	0.513000	0.34164	2.374000	0.44274	0.699000	0.31761	0.561000	0.74099	GCT	RFC4	-	pfam_Rep_factorC_C_dom,superfamily_DNA_pol3_clamp-load_cplx_C	ENSG00000163918		0.388	RFC4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	RFC4	HGNC	protein_coding	OTTHUMT00000344471.1	-	0.00	32	0	G	NM_002916		186508161	-1	tier1	-	no_errors	ENST00000296273	ensembl	human	known	74_37	missense	15.79	16	3	SNP	0.259	A
RIBC1	158787	genome.wustl.edu	37	X	53457932	53457932	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chrX:53457932G>A	ENST00000375327.3	+	8	1289	c.1136G>A	c.(1135-1137)cGc>cAc	p.R379H	RP3-339A18.6_ENST00000418049.1_RNA|HSD17B10_ENST00000495986.1_5'Flank	NM_001031745.2	NP_001026915.1	Q8N443	RIBC1_HUMAN	RIB43A domain with coiled-coils 1	379										lung(2)	2						ACCAGCAGCCGCTAAGTTCAG	0.468																																																	0													178.0	142.0	154.0					X																	53457932		2203	4300	6503	SO:0001583	missense	0			AK057345	CCDS14353.1, CCDS35299.1, CCDS59168.1	Xp11.23	2006-04-12			ENSG00000158423	ENSG00000158423			26537	protein-coding gene	gene with protein product							Standard	NM_144968		Approved	FLJ32783	uc004dsk.4	Q8N443	OTTHUMG00000021615	ENST00000375327.3:c.1136G>A	X.37:g.53457932G>A	ENSP00000364476:p.Arg379His		B4E297|E9PDU2|Q5H931|Q96A80	Missense_Mutation	SNP	pfam_RIB43A	p.R379H	ENST00000375327.3	37	c.1136	CCDS35299.1	X	.	.	.	.	.	.	.	.	.	.	G	18.42	3.620621	0.66787	.	.	ENSG00000158423	ENST00000375327	T	0.58652	0.32	5.32	4.45	0.53987	.	0.049576	0.85682	N	0.000000	T	0.77644	0.4161	M	0.86502	2.82	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.80712	-0.1260	10	0.87932	D	0	-15.8619	11.9115	0.52741	0.0885:0.0:0.9115:0.0	.	379	Q8N443	RIBC1_HUMAN	H	379	ENSP00000364476:R379H	ENSP00000364476:R379H	R	+	2	0	RIBC1	53474657	1.000000	0.71417	0.998000	0.56505	0.616000	0.37450	4.847000	0.62867	1.016000	0.39470	0.600000	0.82982	CGC	RIBC1	-	pfam_RIB43A	ENSG00000158423		0.468	RIBC1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	RIBC1	HGNC	protein_coding	OTTHUMT00000056762.1	-	0.00	34	0	G	NM_144968		53457932	+1	tier1	-	no_errors	ENST00000375327	ensembl	human	known	74_37	missense	12.50	28	4	SNP	1.000	A
RIC3	79608	genome.wustl.edu	37	11	8161539	8161539	+	Frame_Shift_Del	DEL	A	A	-	rs267603218		TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr11:8161539delA	ENST00000309737.6	-	2	325	c.326delT	c.(325-327)ttafs	p.L109fs	RIC3_ENST00000539720.1_Frame_Shift_Del_p.L60fs|RIC3_ENST00000530060.1_5'Flank|RIC3_ENST00000335425.7_Intron|RIC3_ENST00000425599.2_Frame_Shift_Del_p.L109fs|RIC3_ENST00000343202.4_Frame_Shift_Del_p.L109fs|RIC3_ENST00000419822.2_Frame_Shift_Del_p.L109fs			Q7Z5B4	RIC3_HUMAN	RIC3 acetylcholine receptor chaperone	109					cellular protein complex assembly (GO:0043623)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|protein folding (GO:0006457)|synaptic transmission, cholinergic (GO:0007271)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|large_intestine(2)|lung(9)|ovary(2)|pancreas(1)	17				Epithelial(150;2.89e-07)|BRCA - Breast invasive adenocarcinoma(625;0.204)		CAGTATATATAAAAAAATCCC	0.353																																																	0													64.0	76.0	72.0					11																	8161539		2201	4296	6497	SO:0001589	frameshift_variant	0				CCDS7788.1, CCDS44533.1, CCDS55741.1, CCDS55742.1	11p15.4	2013-08-05	2013-08-05		ENSG00000166405	ENSG00000166405			30338	protein-coding gene	gene with protein product		610509	"""resistance to inhibitors of cholinesterase 3 homolog (C. elegans)"""			12821669	Standard	NM_024557		Approved	FLJ11608, PRO1385, AYST720	uc001mgd.2	Q7Z5B4	OTTHUMG00000165694	ENST00000309737.6:c.326delT	11.37:g.8161539delA	ENSP00000308820:p.Leu109fs		B0B1U0|B2RD25|D3DQU5|Q6UX78|Q7Z5B3|Q86T94|Q8TBJ9|Q9HAH8	Frame_Shift_Del	DEL	NULL	p.L109fs	ENST00000309737.6	37	c.326	CCDS55742.1	11																																																																																			RIC3	-	NULL	ENSG00000166405		0.353	RIC3-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RIC3	HGNC	protein_coding	OTTHUMT00000385900.1		0.00	69	0	A	NM_024557		8161539	-1			no_errors	ENST00000309737	ensembl	human	known	74_37	frame_shift_del	10.34	26	3	DEL	1.000	0
RIOK2	55781	genome.wustl.edu	37	5	96514853	96514853	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr5:96514853C>G	ENST00000283109.3	-	2	179	c.111G>C	c.(109-111)ttG>ttC	p.L37F	RIOK2_ENST00000508447.1_Missense_Mutation_p.L37F|CTD-2215E18.1_ENST00000509481.1_Intron	NM_018343.2	NP_060813.2	Q9BVS4	RIOK2_HUMAN	RIO kinase 2	37							ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(9)|pancreas(1)|prostate(1)|urinary_tract(2)	23		all_cancers(142;0.000125)|all_epithelial(76;8.48e-07)|all_lung(232;0.0131)|Lung NSC(167;0.0161)|Colorectal(57;0.0676)|Ovarian(225;0.105)		COAD - Colon adenocarcinoma(37;0.0657)		TAGAAGCAATCAAACTGCCGG	0.353																																																	0													83.0	79.0	81.0					5																	96514853		2203	4300	6503	SO:0001583	missense	0			AK002021	CCDS4089.1, CCDS54884.1	5q14	2012-12-10	2012-12-10		ENSG00000058729	ENSG00000058729			18999	protein-coding gene	gene with protein product			"""RIO kinase 2 (yeast)"""				Standard	NM_018343		Approved	FLJ11159	uc003kmz.3	Q9BVS4	OTTHUMG00000128723	ENST00000283109.3:c.111G>C	5.37:g.96514853C>G	ENSP00000283109:p.Leu37Phe		D6RDI3|Q9NUT0	Missense_Mutation	SNP	pfam_RIO-like_kinase,pfam_RIO2_kinase_winged_hlx_N,pfam_LipoPS_kinase,superfamily_Kinase-like_dom,smart_RIO_kinase	p.L37F	ENST00000283109.3	37	c.111	CCDS4089.1	5	.	.	.	.	.	.	.	.	.	.	c	13.50	2.257104	0.39896	.	.	ENSG00000058729	ENST00000283109;ENST00000508447	T;T	0.07114	3.3;3.22	5.72	2.02	0.26589	Winged helix-turn-helix transcription repressor DNA-binding (1);RIO2 kinase, winged helix, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.31765	0.0807	M	0.93062	3.375	0.80722	D	1	D;D	0.69078	0.993;0.997	D;D	0.70016	0.956;0.967	T	0.09271	-1.0682	10	0.87932	D	0	3.4668	8.6589	0.34079	0.0:0.5666:0.0:0.4334	.	37;37	D6RDI3;Q9BVS4	.;RIOK2_HUMAN	F	37	ENSP00000283109:L37F;ENSP00000420932:L37F	ENSP00000283109:L37F	L	-	3	2	RIOK2	96540609	1.000000	0.71417	0.996000	0.52242	0.238000	0.25445	0.776000	0.26704	0.372000	0.24591	-0.142000	0.14014	TTG	RIOK2	-	pfam_RIO2_kinase_winged_hlx_N	ENSG00000058729		0.353	RIOK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RIOK2	HGNC	protein_coding	OTTHUMT00000250628.1	-	0.00	42	0	C	NM_018343		96514853	-1	tier1	-	no_errors	ENST00000283109	ensembl	human	known	74_37	missense	46.15	7	6	SNP	0.895	G
RNF169	254225	genome.wustl.edu	37	11	74547540	74547540	+	Nonsense_Mutation	SNP	T	T	A			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr11:74547540T>A	ENST00000299563.4	+	6	1905	c.1892T>A	c.(1891-1893)tTa>tAa	p.L631*		NM_001098638.1	NP_001092108.1	Q8NCN4	RN169_HUMAN	ring finger protein 169	631					cellular response to DNA damage stimulus (GO:0006974)|negative regulation of double-strand break repair (GO:2000780)|protein ubiquitination (GO:0016567)	intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|site of double-strand break (GO:0035861)	K63-linked polyubiquitin binding (GO:0070530)|ligase activity (GO:0016874)|nucleosome binding (GO:0031491)|zinc ion binding (GO:0008270)			breast(3)|endometrium(1)|kidney(1)|large_intestine(5)|lung(3)|ovary(1)|urinary_tract(1)	15						ACCAAGCACTTAGAACAAAAT	0.502																																																	0													68.0	66.0	66.0					11																	74547540		1886	4112	5998	SO:0001587	stop_gained	0			AB082522	CCDS41691.1	11q13.4	2008-02-05			ENSG00000166439	ENSG00000166439		"""RING-type (C3HC4) zinc fingers"""	26961	protein-coding gene	gene with protein product						12056414	Standard	NM_001098638		Approved	KIAA1991	uc001ovl.4	Q8NCN4	OTTHUMG00000165516	ENST00000299563.4:c.1892T>A	11.37:g.74547540T>A	ENSP00000299563:p.Leu631*		Q6N015	Nonsense_Mutation	SNP	smart_Znf_RING,pfscan_Znf_RING	p.L631*	ENST00000299563.4	37	c.1892	CCDS41691.1	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	35|35	5.559357|5.559357	0.96514|0.96514	.|.	.|.	ENSG00000166439|ENSG00000166439	ENST00000299563|ENST00000527301	.|.	.|.	.|.	5.83|5.83	4.67|4.67	0.58626|0.58626	.|.	0.165886|.	0.39274|.	N|.	0.001403|.	.|.	.|.	.|.	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	0.02654|.	T|.	1|.	-0.1144|-0.1144	10.3748|10.3748	0.44075|0.44075	0.1469:0.0:0.0:0.8531|0.1469:0.0:0.0:0.8531	.|.	.|.	.|.	.|.	X|K	631|2	.|.	ENSP00000299563:L631X|.	L|X	+|+	2|1	0|0	RNF169|RNF169	74225188|74225188	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.991000|0.991000	0.79684|0.79684	4.887000|4.887000	0.63156|0.63156	0.979000|0.979000	0.38497|0.38497	0.533000|0.533000	0.62120|0.62120	TTA|TAG	RNF169	-	NULL	ENSG00000166439		0.502	RNF169-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF169	HGNC	protein_coding	OTTHUMT00000384741.1	-	0.00	26	0	T	XM_495886		74547540	+1	tier1	-	no_errors	ENST00000299563	ensembl	human	known	74_37	nonsense	36.36	14	8	SNP	1.000	A
RNF17	56163	genome.wustl.edu	37	13	25453387	25453387	+	Silent	SNP	G	G	A	rs576396754		TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr13:25453387G>A	ENST00000255324.5	+	35	4888	c.4836G>A	c.(4834-4836)ccG>ccA	p.P1612P	RNF17_ENST00000381921.1_Silent_p.P1570P|RNF17_ENST00000339524.3_Silent_p.P622P	NM_001184993.1|NM_031277.2	NP_001171922.1|NP_112567.2	Q9BXT8	RNF17_HUMAN	ring finger protein 17	1612					multicellular organismal development (GO:0007275)|spermatid development (GO:0007286)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	hydrolase activity, acting on ester bonds (GO:0016788)|nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(15)|ovary(1)|prostate(3)|skin(6)	36		Lung SC(185;0.0225)|Breast(139;0.077)		all cancers(112;0.0114)|OV - Ovarian serous cystadenocarcinoma(117;0.0311)|Epithelial(112;0.0524)		TTCATATGCCGTTGGTAGAAA	0.393													A|||	1	0.000199681	0.0	0.0	5008	,	,		21934	0.0		0.0	False		,,,				2504	0.001																0													107.0	90.0	96.0					13																	25453387		2203	4300	6503	SO:0001819	synonymous_variant	0			AF285602, AK001907	CCDS9308.2	13q12.13	2013-01-23			ENSG00000132972	ENSG00000132972		"""RING-type (C3HC4) zinc fingers"", ""Tudor domain containing"""	10060	protein-coding gene	gene with protein product	"""spermatogenesis associated 23"""	605793	"""tudor domain containing 4"""	TDRD4		11279525	Standard	NM_001184993		Approved	Mmip-2, SPATA23, FLJ11045	uc001upr.3	Q9BXT8	OTTHUMG00000016589	ENST00000255324.5:c.4836G>A	13.37:g.25453387G>A			Q5T2J9|Q6P1W3|Q9BXT7|Q9NUY9	Silent	SNP	pfam_Tudor,smart_Tudor,pfscan_Tudor,pfscan_Znf_RING	p.P1612	ENST00000255324.5	37	c.4836	CCDS9308.2	13																																																																																			RNF17	-	NULL	ENSG00000132972		0.393	RNF17-003	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF17	HGNC	protein_coding	OTTHUMT00000044217.1	-	0.00	34	0	G	NM_031994		25453387	+1	tier1	-	no_errors	ENST00000255324	ensembl	human	known	74_37	silent	47.83	12	11	SNP	0.004	A
RNF40	9810	genome.wustl.edu	37	16	30777483	30777483	+	Splice_Site	SNP	G	G	C			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr16:30777483G>C	ENST00000324685.6	+	9	1428		c.e9-1		RNF40_ENST00000402121.3_Intron|RNF40_ENST00000563683.1_Intron|RNF40_ENST00000357890.5_Intron	NM_001207033.1|NM_014771.3	NP_001193962.1|NP_055586	O75150	BRE1B_HUMAN	ring finger protein 40, E3 ubiquitin protein ligase						histone H2B ubiquitination (GO:0033523)|histone monoubiquitination (GO:0010390)|ubiquitin-dependent protein catabolic process (GO:0006511)	HULC complex (GO:0033503)|membrane (GO:0016020)|neuron projection (GO:0043005)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	ligase activity (GO:0016874)|protein homodimerization activity (GO:0042803)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			central_nervous_system(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(6)|lung(10)|prostate(2)	30			Colorectal(24;0.198)			CCACTCCTTAGTTTGAGATGC	0.602																																																	0													59.0	62.0	61.0					16																	30777483		2197	4300	6497	SO:0001630	splice_region_variant	0			AB014561	CCDS10691.1, CCDS55994.1	16p11.2-p11.1	2012-02-23	2012-02-23		ENSG00000103549	ENSG00000103549		"""RING-type (C3HC4) zinc fingers"""	16867	protein-coding gene	gene with protein product	"""BRE1 E3 ubiquitin ligase homolog B (S. cerevisiae)"""	607700	"""ring finger protein 40"""			9734811, 10944455, 12121982	Standard	NM_014771		Approved	KIAA0661, RBP95, BRE1B, STARING	uc002dzq.3	O75150	OTTHUMG00000132394	ENST00000324685.6:c.994-1G>C	16.37:g.30777483G>C			Q6AHZ6|Q6N005|Q7L3T6|Q8N615|Q96T18|Q9BSV9|Q9HC82	Splice_Site	SNP	-	e8-1	ENST00000324685.6	37	c.994-1	CCDS10691.1	16	.	.	.	.	.	.	.	.	.	.	G	17.73	3.462078	0.63513	.	.	ENSG00000103549	ENST00000324685;ENST00000452273	.	.	.	5.8	4.83	0.62350	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.9314	0.70916	0.0:0.0:0.8555:0.1445	.	.	.	.	.	-1	.	.	.	+	.	.	RNF40	30684984	1.000000	0.71417	0.999000	0.59377	0.896000	0.52359	8.988000	0.93501	1.416000	0.47057	0.462000	0.41574	.	RNF40	-	-	ENSG00000103549		0.602	RNF40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF40	HGNC	protein_coding	OTTHUMT00000255524.2		0.00	34	0	G	NM_014771	Intron	30777483	+1			no_errors	ENST00000324685	ensembl	human	known	74_37	splice_site	9.09	20	2	SNP	1.000	C
RPN2	6185	genome.wustl.edu	37	20	35865066	35865066	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr20:35865066A>G	ENST00000237530.6	+	16	2148	c.1837A>G	c.(1837-1839)Acg>Gcg	p.T613A	RPN2_ENST00000373622.5_Missense_Mutation_p.T581A|RPN2_ENST00000470352.1_3'UTR	NM_002951.3	NP_002942.2	P04844	RPN2_HUMAN	ribophorin II	613					aging (GO:0007568)|cellular protein metabolic process (GO:0044267)|cellular protein modification process (GO:0006464)|gene expression (GO:0010467)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|response to drug (GO:0042493)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)	autophagic vacuole membrane (GO:0000421)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)|oligosaccharyltransferase complex (GO:0008250)|rough endoplasmic reticulum (GO:0005791)	ribosome binding (GO:0043022)|transferase activity, transferring glycosyl groups (GO:0016757)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(7)|ovary(2)|pancreas(1)|skin(2)|stomach(1)	24		Myeloproliferative disorder(115;0.00878)				GGGCAGTGTGACGTTTCTGGC	0.527																																																	0													121.0	98.0	106.0					20																	35865066		2203	4300	6503	SO:0001583	missense	0			Y00282	CCDS13291.1, CCDS46599.1	20q12-q13.1	2013-03-06			ENSG00000118705	ENSG00000118705			10382	protein-coding gene	gene with protein product	"""oligosaccharyltransferase complex subunit (non-catalytic)"""	180490					Standard	NM_002951		Approved	SWP1, RPNII, RIBIIR, RPN-II	uc002xgp.3	P04844	OTTHUMG00000032409	ENST00000237530.6:c.1837A>G	20.37:g.35865066A>G	ENSP00000237530:p.Thr613Ala		Q5JYR6|Q6IBA5|Q96E21|Q9BUQ3|Q9UBE1	Missense_Mutation	SNP	pfam_Swp1	p.T613A	ENST00000237530.6	37	c.1837	CCDS13291.1	20	.	.	.	.	.	.	.	.	.	.	A	21.8	4.199487	0.79015	.	.	ENSG00000118705	ENST00000237530;ENST00000373622;ENST00000397161;ENST00000437329	T;T;T	0.52057	0.68;0.68;0.68	5.0	5.0	0.66597	.	0.000000	0.85682	D	0.000000	T	0.65291	0.2677	M	0.73962	2.25	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	T	0.63065	-0.6720	10	0.22109	T	0.4	-7.8054	12.7073	0.57067	1.0:0.0:0.0:0.0	.	581;613	Q5JYR6;P04844	.;RPN2_HUMAN	A	613;581;120;120	ENSP00000237530:T613A;ENSP00000362724:T581A;ENSP00000409580:T120A	ENSP00000237530:T613A	T	+	1	0	RPN2	35298480	1.000000	0.71417	1.000000	0.80357	0.941000	0.58515	8.761000	0.91691	2.099000	0.63709	0.379000	0.24179	ACG	RPN2	-	pfam_Swp1	ENSG00000118705		0.527	RPN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPN2	HGNC	protein_coding	OTTHUMT00000079076.2	-	0.00	38	0	A	NM_002951		35865066	+1	tier1	-	no_errors	ENST00000237530	ensembl	human	known	74_37	missense	10.71	25	3	SNP	1.000	G
RYR3	6263	genome.wustl.edu	37	15	34064293	34064293	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr15:34064293C>A	ENST00000389232.4	+	63	9059	c.8989C>A	c.(8989-8991)Ctg>Atg	p.L2997M	RYR3_ENST00000415757.3_Missense_Mutation_p.L2997M	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	2997					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)			NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		TACAGTGGCTCTGCTCCCCAT	0.448																																																	0													95.0	90.0	92.0					15																	34064293		1966	4150	6116	SO:0001583	missense	0				CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.8989C>A	15.37:g.34064293C>A	ENSP00000373884:p.Leu2997Met		O15175|Q15412	Missense_Mutation	SNP	pfam_Ryanodine_rcpt,pfam_Ca-rel_channel,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR_motif,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR_motif,superfamily_ConA-like_lec_gl_sf,superfamily_4_helix_cytokine-like_core,superfamily_ARM-type_fold,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_EF_hand_dom,pfscan_MIR_motif	p.L2997M	ENST00000389232.4	37	c.8989	CCDS45210.1	15	.	.	.	.	.	.	.	.	.	.	C	17.34	3.366089	0.61513	.	.	ENSG00000198838	ENST00000389232;ENST00000415757;ENST00000361728	D;D	0.97870	-4.57;-4.58	5.65	5.65	0.86999	.	0.000000	0.64402	D	0.000015	D	0.97742	0.9259	L	0.52266	1.64	0.45662	D	0.998582	D;D	0.89917	0.998;1.0	D;D	0.91635	0.955;0.999	D	0.96687	0.9508	10	0.56958	D	0.05	.	9.7911	0.40706	0.0:0.8483:0.0:0.1517	.	2997;2997	Q15413-2;Q15413	.;RYR3_HUMAN	M	2997	ENSP00000373884:L2997M;ENSP00000399610:L2997M	ENSP00000354735:L2997M	L	+	1	2	RYR3	31851585	0.970000	0.33590	1.000000	0.80357	0.680000	0.39746	1.613000	0.36900	2.941000	0.99782	0.655000	0.94253	CTG	RYR3	-	superfamily_ARM-type_fold	ENSG00000198838		0.448	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RYR3	HGNC	protein_coding	OTTHUMT00000417514.1		0.00	40	0	C			34064293	+1			no_errors	ENST00000389232	ensembl	human	known	74_37	missense	6.06	31	2	SNP	1.000	A
SACS	26278	genome.wustl.edu	37	13	23904549	23904549	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr13:23904549T>C	ENST00000382292.3	-	9	13739	c.13466A>G	c.(13465-13467)gAc>gGc	p.D4489G	SACS_ENST00000402364.1_Missense_Mutation_p.D3739G|SACS_ENST00000382298.3_Missense_Mutation_p.D4489G			Q9NZJ4	SACS_HUMAN	sacsin molecular chaperone	4489	HEPN. {ECO:0000255|PROSITE- ProRule:PRU00105}.				cell death (GO:0008219)|negative regulation of inclusion body assembly (GO:0090084)|protein folding (GO:0006457)	axon (GO:0030424)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chaperone binding (GO:0051087)|Hsp70 protein binding (GO:0030544)|proteasome binding (GO:0070628)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(54)|lung(49)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(11)	189		all_cancers(29;1.51e-22)|all_epithelial(30;7.82e-19)|all_lung(29;4.71e-18)|Lung SC(185;0.0225)|Breast(139;0.128)		all cancers(112;0.00197)|Epithelial(112;0.00854)|OV - Ovarian serous cystadenocarcinoma(117;0.0298)|Lung(94;0.189)		CACAGCATAGTCAGCTGCAAT	0.403																																																	0													156.0	150.0	152.0					13																	23904549		2203	4300	6503	SO:0001583	missense	0			AF193556	CCDS9300.2	13q11	2014-06-13	2014-01-30		ENSG00000151835	ENSG00000151835		"""Heat shock proteins / DNAJ (HSP40)"""	10519	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 138"""	604490	"""spastic ataxia of Charlevoix-Saguenay (sacsin)"""			10610707, 15057823, 21726565	Standard	NM_001278055		Approved	ARSACS, KIAA0730, DKFZp686B15167, DNAJC29, SPAX6, PPP1R138	uc001uon.3	Q9NZJ4	OTTHUMG00000016562	ENST00000382292.3:c.13466A>G	13.37:g.23904549T>C	ENSP00000371729:p.Asp4489Gly		O94835|Q5T9J5|Q5T9J7|Q5T9J8|Q68DF5|Q6MZR4|Q8NBF9	Missense_Mutation	SNP	pfam_HEPN,pfam_Ubiquitin_dom,superfamily_HATPase_ATP-bd,superfamily_DnaJ_domain,smart_HEPN,pfscan_HEPN,pfscan_DnaJ_domain,pfscan_Ubiquitin_supergroup	p.D4489G	ENST00000382292.3	37	c.13466	CCDS9300.2	13	.	.	.	.	.	.	.	.	.	.	T	20.2	3.950773	0.73787	.	.	ENSG00000151835	ENST00000382292;ENST00000402364;ENST00000382298	D;D;D	0.85411	-1.98;-1.98;-1.98	5.85	5.85	0.93711	HEPN (3);	0.000000	0.85682	D	0.000000	D	0.85936	0.5813	N	0.14661	0.345	0.80722	D	1	D	0.76494	0.999	D	0.75484	0.986	D	0.87022	0.2129	10	0.41790	T	0.15	.	16.2271	0.82306	0.0:0.0:0.0:1.0	.	4489	Q9NZJ4	SACS_HUMAN	G	4489;3739;4489	ENSP00000371729:D4489G;ENSP00000385844:D3739G;ENSP00000371735:D4489G	ENSP00000371729:D4489G	D	-	2	0	SACS	22802549	1.000000	0.71417	1.000000	0.80357	0.675000	0.39556	8.040000	0.89188	2.234000	0.73211	0.460000	0.39030	GAC	SACS	-	pfam_HEPN,smart_HEPN,pfscan_HEPN	ENSG00000151835		0.403	SACS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SACS	HGNC	protein_coding	OTTHUMT00000044148.3	-	0.00	43	0	T	NM_014363		23904549	-1	tier1	-	no_errors	ENST00000382292	ensembl	human	known	74_37	missense	37.50	9	6	SNP	1.000	C
SAMD15	161394	genome.wustl.edu	37	14	77845169	77845169	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr14:77845169G>C	ENST00000216471.4	+	1	1694	c.1408G>C	c.(1408-1410)Gaa>Caa	p.E470Q	SAMD15_ENST00000533095.2_Intron|TMED8_ENST00000216468.7_5'Flank	NM_001010860.1	NP_001010860.1	Q9P1V8	SAM15_HUMAN	sterile alpha motif domain containing 15	470										breast(2)|endometrium(3)|kidney(2)|large_intestine(4)|lung(10)|pancreas(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	28						AGAAAGTGAAGAATCAATTGG	0.388																																																	0													98.0	99.0	98.0					14																	77845169		2203	4300	6503	SO:0001583	missense	0			AK093282	CCDS32126.1	14q24.3	2013-01-10	2010-10-20	2010-10-20	ENSG00000100583	ENSG00000100583		"""Sterile alpha motif (SAM) domain containing"""	18631	protein-coding gene	gene with protein product			"""family with sequence similarity 15, member A"", ""chromosome 14 open reading frame 174"""	FAM15A, C14orf174			Standard	XM_006720069		Approved	FLJ35963	uc001xtq.1	Q9P1V8		ENST00000216471.4:c.1408G>C	14.37:g.77845169G>C	ENSP00000216471:p.Glu470Gln		Q2M3P3	Missense_Mutation	SNP	pfam_SAM_type1,pfam_SAM_2,superfamily_SAM/pointed,smart_SAM,pfscan_SAM	p.E470Q	ENST00000216471.4	37	c.1408	CCDS32126.1	14	.	.	.	.	.	.	.	.	.	.	G	7.952	0.745014	0.15710	.	.	ENSG00000100583	ENST00000216471	T	0.21191	2.02	4.03	-0.189	0.13260	.	2.742020	0.01529	N	0.018717	T	0.11879	0.0289	N	0.14661	0.345	0.09310	N	1	P	0.38978	0.652	B	0.35813	0.211	T	0.16630	-1.0396	10	0.18276	T	0.48	1.0202	6.1244	0.20172	0.5441:0.0:0.4559:0.0	.	470	Q9P1V8	SAM15_HUMAN	Q	470	ENSP00000216471:E470Q	ENSP00000216471:E470Q	E	+	1	0	SAMD15	76914922	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.026000	0.12392	0.063000	0.16370	-0.266000	0.10368	GAA	SAMD15	-	NULL	ENSG00000100583		0.388	SAMD15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SAMD15	HGNC	protein_coding	OTTHUMT00000394587.2		0.00	36	0	G	NM_001010860		77845169	+1			no_errors	ENST00000216471	ensembl	human	known	74_37	missense	8.00	23	2	SNP	0.000	C
SATB2	23314	genome.wustl.edu	37	2	200136975	200136975	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr2:200136975C>G	ENST00000417098.1	-	11	2977	c.2161G>C	c.(2161-2163)Gac>Cac	p.D721H	SATB2_ENST00000443023.1_Missense_Mutation_p.D662H|SATB2_ENST00000457245.1_Missense_Mutation_p.D721H|SATB2_ENST00000428695.1_Missense_Mutation_p.D603H|SATB2_ENST00000260926.5_Missense_Mutation_p.D721H	NM_001172509.1	NP_001165980.1	Q9UPW6	SATB2_HUMAN	SATB homeobox 2	721					cartilage development (GO:0051216)|cellular response to organic substance (GO:0071310)|chromatin remodeling (GO:0006338)|embryonic pattern specification (GO:0009880)|embryonic skeletal system morphogenesis (GO:0048704)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|osteoblast development (GO:0002076)|palate development (GO:0060021)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|histone deacetylase complex (GO:0000118)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|sequence-specific DNA binding (GO:0043565)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(40)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	62						TTGCTTTTGTCAGCATTTTCC	0.478																																					Colon(30;262 767 11040 24421 36230)												0													122.0	119.0	120.0					2																	200136975		2203	4300	6503	SO:0001583	missense	0			AB028957	CCDS2327.1	2q33.1	2011-06-20	2007-02-15		ENSG00000119042	ENSG00000119042		"""Homeoboxes / CUT class"""	21637	protein-coding gene	gene with protein product		608148	"""SATB family member 2"""				Standard	NM_015265		Approved	KIAA1034, FLJ21474	uc002uva.2	Q9UPW6	OTTHUMG00000132767	ENST00000417098.1:c.2161G>C	2.37:g.200136975C>G	ENSP00000401112:p.Asp721His		A8K5Z8|Q3ZB87|Q4V763	Missense_Mutation	SNP	pfam_Hmoeo_CUT,pfam_Homeobox_dom,superfamily_Lambda_DNA-bd_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom,pfscan_Hmoeo_CUT	p.D721H	ENST00000417098.1	37	c.2161	CCDS2327.1	2	.	.	.	.	.	.	.	.	.	.	C	10.34	1.324269	0.24080	.	.	ENSG00000119042	ENST00000417098;ENST00000443023;ENST00000260926;ENST00000428695;ENST00000457245	T;T;T;T;T	0.47177	0.86;0.85;0.86;0.85;0.86	5.63	5.63	0.86233	.	0.544085	0.19246	N	0.119045	T	0.31702	0.0805	N	0.08118	0	0.38863	D	0.956531	P;B	0.41041	0.736;0.07	B;B	0.35550	0.205;0.043	T	0.40478	-0.9561	10	0.56958	D	0.05	-6.4245	20.0401	0.97581	0.0:1.0:0.0:0.0	.	603;721	Q3ZB87;Q9UPW6	.;SATB2_HUMAN	H	721;662;721;603;721	ENSP00000401112:D721H;ENSP00000388764:D662H;ENSP00000260926:D721H;ENSP00000388581:D603H;ENSP00000405420:D721H	ENSP00000260926:D721H	D	-	1	0	SATB2	199845220	0.972000	0.33761	0.122000	0.21767	0.081000	0.17604	3.512000	0.53407	2.805000	0.96524	0.655000	0.94253	GAC	SATB2	-	NULL	ENSG00000119042		0.478	SATB2-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SATB2	HGNC	protein_coding	OTTHUMT00000256140.1		0.00	46	0	C	NM_015265		200136975	-1			no_errors	ENST00000260926	ensembl	human	known	74_37	missense	8.00	23	2	SNP	0.778	G
SCAF1	58506	genome.wustl.edu	37	19	50154128	50154128	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr19:50154128C>G	ENST00000360565.3	+	7	606	c.482C>G	c.(481-483)tCt>tGt	p.S161C		NM_021228.2	NP_067051.2	Q9H7N4	SFR19_HUMAN	SR-related CTD-associated factor 1	161					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	RNA binding (GO:0003723)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(2)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	20		all_lung(116;1.05e-05)|Lung NSC(112;3.77e-05)|all_neural(266;0.196)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.00113)|GBM - Glioblastoma multiforme(134;0.0204)		TTTGCAGTTTCTCCACAGTCG	0.677																																																	0													46.0	34.0	38.0					19																	50154128		2203	4299	6502	SO:0001583	missense	0			AK024444	CCDS33074.1	19q13.3-q13.4	2011-01-10			ENSG00000126461	ENSG00000126461			30403	protein-coding gene	gene with protein product						11461075	Standard	NM_021228		Approved	SR-A1, FLJ00034	uc002poq.3	Q9H7N4		ENST00000360565.3:c.482C>G	19.37:g.50154128C>G	ENSP00000353769:p.Ser161Cys		Q7Z5V7|Q8WVA1|Q9NR59	Missense_Mutation	SNP	NULL	p.S161C	ENST00000360565.3	37	c.482	CCDS33074.1	19	.	.	.	.	.	.	.	.	.	.	c	10.60	1.396421	0.25205	.	.	ENSG00000126461	ENST00000360565;ENST00000447618	T	0.35605	1.3	4.26	3.21	0.36854	.	0.417842	0.17869	N	0.159223	T	0.40886	0.1135	N	0.19112	0.55	0.28797	N	0.898994	D	0.89917	1.0	D	0.68353	0.957	T	0.23726	-1.0180	10	0.87932	D	0	-3.3222	10.0111	0.41986	0.0:0.8984:0.0:0.1016	.	161	Q9H7N4	SFR19_HUMAN	C	161	ENSP00000353769:S161C	ENSP00000353769:S161C	S	+	2	0	SCAF1	54845940	0.999000	0.42202	1.000000	0.80357	0.918000	0.54935	1.589000	0.36644	1.154000	0.42482	0.645000	0.84053	TCT	SCAF1	-	NULL	ENSG00000126461		0.677	SCAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCAF1	HGNC	protein_coding	OTTHUMT00000465764.1		0.00	13	0	C	NM_021228		50154128	+1			no_errors	ENST00000360565	ensembl	human	known	74_37	missense	57.14	3	4	SNP	1.000	G
SCAPER	49855	genome.wustl.edu	37	15	76696914	76696914	+	Missense_Mutation	SNP	C	C	G	rs3743176	byFrequency	TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr15:76696914C>G	ENST00000563290.1	-	27	3513	c.3418G>C	c.(3418-3420)Gca>Cca	p.A1140P	SCAPER_ENST00000324767.7_Missense_Mutation_p.A1140P|SCAPER_ENST00000538941.2_Missense_Mutation_p.A894P			Q9BY12	SCAPE_HUMAN	S-phase cyclin A-associated protein in the ER	1140			A -> T (in dbSNP:rs3743176).			endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			NS(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(16)|ovary(2)|prostate(2)|skin(1)|urinary_tract(2)	39						AAGAGTCCTGCGGCATGCTGC	0.478																																																	0													202.0	185.0	191.0					15																	76696914		2060	4199	6259	SO:0001583	missense	0			AB040887, AF242528	CCDS53961.1, CCDS53962.1	15q24.3	2012-10-05	2009-03-11	2007-08-20	ENSG00000140386	ENSG00000140386		"""Zinc fingers, C2H2-type"""	13081	protein-coding gene	gene with protein product		611611	"""zinc finger protein 291"""	ZNF291		17698606	Standard	NM_020843		Approved	Zfp291	uc002bby.3	Q9BY12	OTTHUMG00000172655	ENST00000563290.1:c.3418G>C	15.37:g.76696914C>G	ENSP00000454973:p.Ala1140Pro		F5H7X8|H3BNR7|Q3B7X7|Q96BS9|Q9H3D8|Q9NT03|Q9P274	Missense_Mutation	SNP	smart_Znf_U1	p.A1140P	ENST00000563290.1	37	c.3418	CCDS53962.1	15	.	.	.	.	.	.	.	.	.	.	C	12.40	1.928139	0.34002	.	.	ENSG00000140386	ENST00000324767;ENST00000538941;ENST00000303521	T;T	0.23754	1.89;1.89	5.96	-4.1	0.03940	.	0.439260	0.26058	N	0.026593	T	0.18257	0.0438	L	0.36672	1.1	0.09310	N	0.999999	B;P	0.37015	0.318;0.578	B;B	0.38562	0.107;0.276	T	0.19160	-1.0314	10	0.49607	T	0.09	.	12.3177	0.54966	0.0:0.3164:0.0:0.6836	.	1139;894	Q9BY12;F5H7X8	SCAPE_HUMAN;.	P	1140;894;1162	ENSP00000326924:A1140P;ENSP00000442190:A894P	ENSP00000303560:A1162P	A	-	1	0	SCAPER	74483969	0.032000	0.19561	0.001000	0.08648	0.573000	0.36030	-0.256000	0.08757	-0.502000	0.06596	-0.937000	0.02696	GCA	SCAPER	-	NULL	ENSG00000140386		0.478	SCAPER-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCAPER	HGNC	protein_coding	OTTHUMT00000419698.1	-	0.00	35	0	C	NM_020843		76696914	-1	tier1	-	no_errors	ENST00000324767	ensembl	human	known	74_37	missense	21.05	15	4	SNP	0.161	G
SCN10A	6336	genome.wustl.edu	37	3	38738990	38738990	+	Missense_Mutation	SNP	G	G	T	rs376432760		TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr3:38738990G>T	ENST00000449082.2	-	27	5720	c.5721C>A	c.(5719-5721)gaC>gaA	p.D1907E		NM_006514.2	NP_006505.2	Q9Y5Y9	SCNAA_HUMAN	sodium channel, voltage-gated, type X, alpha subunit	1907					AV node cell to bundle of His cell communication (GO:0086067)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of cardiac muscle contraction (GO:0055117)|regulation of heart rate (GO:0002027)|regulation of ion transmembrane transport (GO:0034765)|sensory perception (GO:0007600)|sensory perception of pain (GO:0019233)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	C-fiber (GO:0044299)|extracellular vesicular exosome (GO:0070062)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(5)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(14)|kidney(5)|large_intestine(33)|lung(54)|ovary(5)|pancreas(1)|prostate(5)|skin(13)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	150				KIRC - Kidney renal clear cell carcinoma(284;0.0769)|Kidney(284;0.0945)	Benzocaine(DB01086)|Bupivacaine(DB00297)|Chloroprocaine(DB01161)|Cinchocaine(DB00527)|Cocaine(DB00907)|Dyclonine(DB00645)|Hexylcaine(DB00473)|Lacosamide(DB06218)|Levobupivacaine(DB01002)|Lidocaine(DB00281)|Mepivacaine(DB00961)|Orphenadrine(DB01173)|Oxybuprocaine(DB00892)|Procaine(DB00721)|Proparacaine(DB00807)|Ropivacaine(DB00296)|Valproic Acid(DB00313)	TTTCAGATTTGTCTGGGAGTA	0.473																																																	0													177.0	162.0	167.0					3																	38738990		2203	4300	6503	SO:0001583	missense	0			AF117907	CCDS33736.1	3p22.2	2012-02-26	2007-01-23		ENSG00000185313	ENSG00000185313		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10582	protein-coding gene	gene with protein product		604427	"""sodium channel, voltage-gated, type X, alpha polypeptide"""			9839820, 10198179, 16382098	Standard	NM_006514		Approved	Nav1.8, hPN3, SNS, PN3	uc003ciq.3	Q9Y5Y9	OTTHUMG00000048245	ENST00000449082.2:c.5721C>A	3.37:g.38738990G>T	ENSP00000390600:p.Asp1907Glu		A6NDQ1	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_Na_trans_assoc,pfam_PKD1_2_channel,prints_Na_channel_asu,prints_PKD_2	p.D1907E	ENST00000449082.2	37	c.5721	CCDS33736.1	3	.	.	.	.	.	.	.	.	.	.	G	0.005	-2.159804	0.00321	.	.	ENSG00000185313	ENST00000449082	D	0.95307	-3.67	5.38	3.61	0.41365	.	0.221517	0.27258	U	0.020188	D	0.87712	0.6246	N	0.08118	0	0.27459	N	0.953209	D	0.59767	0.986	P	0.54401	0.751	T	0.80979	-0.1140	10	0.02654	T	1	.	6.58	0.22588	0.214:0.1301:0.6559:0.0	.	1907	Q9Y5Y9	SCNAA_HUMAN	E	1907	ENSP00000390600:D1907E	ENSP00000390600:D1907E	D	-	3	2	SCN10A	38713994	0.724000	0.28038	1.000000	0.80357	0.146000	0.21551	-0.091000	0.11146	0.849000	0.35215	-0.136000	0.14681	GAC	SCN10A	-	NULL	ENSG00000185313		0.473	SCN10A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	SCN10A	HGNC	protein_coding	OTTHUMT00000109745.3	-	0.00	50	0	G	NM_006514		38738990	-1	tier1	-	no_errors	ENST00000449082	ensembl	human	known	74_37	missense	20.83	19	5	SNP	1.000	T
SCN2B	6327	genome.wustl.edu	37	11	118037675	118037675	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr11:118037675C>G	ENST00000278947.5	-	4	816	c.575G>C	c.(574-576)aGc>aCc	p.S192T		NM_004588.4	NP_004579.1	O60939	SCN2B_HUMAN	sodium channel, voltage-gated, type II, beta subunit	192					cardiac muscle cell action potential involved in contraction (GO:0086002)|cardiac muscle contraction (GO:0060048)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|nervous system development (GO:0007399)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of sodium ion transmembrane transporter activity (GO:2000649)|response to pyrethroid (GO:0046684)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)	voltage-gated sodium channel complex (GO:0001518)	sodium channel regulator activity (GO:0017080)|voltage-gated sodium channel activity involved in cardiac muscle cell action potential (GO:0086006)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(2)	7	all_hematologic(175;0.046)	Medulloblastoma(222;0.0425)|Breast(348;0.181)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;3.19e-05)|Epithelial(105;0.00117)	Valproic Acid(DB00313)|Zonisamide(DB00909)	GTCATCTGTGCTCAGCTTCTG	0.607																																																	0													260.0	193.0	216.0					11																	118037675		2200	4296	6496	SO:0001583	missense	0			AY358945	CCDS8390.1	11q23.3	2013-09-19	2012-02-28		ENSG00000149575	ENSG00000149575		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"", ""Immunoglobulin superfamily / V-set domain containing"""	10589	protein-coding gene	gene with protein product		601327	"""sodium channel, voltage-gated, type II, beta polypeptide"", ""sodium channel, voltage-gated, type II, beta"""			10198179	Standard	NM_004588		Approved		uc001psf.2	O60939	OTTHUMG00000048248	ENST00000278947.5:c.575G>C	11.37:g.118037675C>G	ENSP00000278947:p.Ser192Thr		O75302|Q9UNN3	Missense_Mutation	SNP	pfam_Ig_V-set,smart_Ig_sub,pfscan_Ig-like_dom,prints_Myelin_P0	p.S192T	ENST00000278947.5	37	c.575	CCDS8390.1	11	.	.	.	.	.	.	.	.	.	.	C	12.15	1.851469	0.32699	.	.	ENSG00000149575	ENST00000278947	D	0.97232	-4.3	5.04	4.11	0.48088	.	0.264228	0.42964	D	0.000631	D	0.89462	0.6722	N	0.08118	0	0.31611	N	0.65155	B	0.26672	0.156	B	0.22386	0.039	D	0.85137	0.0978	10	0.26408	T	0.33	-49.1393	6.3563	0.21402	0.0:0.7242:0.0:0.2758	.	192	O60939	SCN2B_HUMAN	T	192	ENSP00000278947:S192T	ENSP00000278947:S192T	S	-	2	0	SCN2B	117542885	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.813000	0.38962	2.640000	0.89533	0.655000	0.94253	AGC	SCN2B	-	NULL	ENSG00000149575		0.607	SCN2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCN2B	HGNC	protein_coding	OTTHUMT00000109748.2		0.00	43	0	C	NM_004588		118037675	-1			no_errors	ENST00000278947	ensembl	human	known	74_37	missense	17.65	14	3	SNP	1.000	G
SCUBE3	222663	genome.wustl.edu	37	6	35216419	35216419	+	Silent	SNP	G	G	A			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr6:35216419G>A	ENST00000274938.7	+	22	2919	c.2919G>A	c.(2917-2919)ctG>ctA	p.L973L	SCUBE3_ENST00000394681.1_Silent_p.L989L	NM_152753.2	NP_689966.2			signal peptide, CUB domain, EGF-like 3											breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(12)|lung(11)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	37						AGGAGATGCTGCCAAAATCCT	0.498																																																	0													157.0	146.0	150.0					6																	35216419		2203	4300	6503	SO:0001819	synonymous_variant	0			AF452494.1	CCDS4800.1	6p21.3	2008-02-05	2004-05-19	2004-05-21		ENSG00000146197			13655	protein-coding gene	gene with protein product		614708	"""CUB domain and EGF-like repeat containing 3"""	CEGF3		12270931	Standard	NM_152753		Approved	FLJ34743	uc003okf.1	Q8IX30		ENST00000274938.7:c.2919G>A	6.37:g.35216419G>A				Silent	SNP	pfam_EGF-like_Ca-bd_dom,pfam_Tyr-kin_ephrin_A/B_rcpt-like,pfam_EG-like_dom,pfam_CUB_dom,superfamily_CUB_dom,superfamily_Growth_fac_rcpt_N_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,smart_CUB_dom,pfscan_CUB_dom,pfscan_EG-like_dom,prints_Thrombomodulin	p.L989	ENST00000274938.7	37	c.2967	CCDS4800.1	6																																																																																			SCUBE3	-	NULL	ENSG00000146197		0.498	SCUBE3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCUBE3	HGNC	protein_coding	OTTHUMT00000040275.1	-	0.00	35	0	G	NM_152753		35216419	+1	tier1	-	no_errors	ENST00000394681	ensembl	human	known	74_37	silent	16.67	15	3	SNP	1.000	A
SDC4	6385	genome.wustl.edu	37	20	43955992	43955992	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr20:43955992T>G	ENST00000372733.3	-	5	548	c.509A>C	c.(508-510)tAc>tCc	p.Y170S	SDC4_ENST00000537976.1_Missense_Mutation_p.Y98S	NM_002999.3	NP_002990.2	P31431	SDC4_HUMAN	syndecan 4	170					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|extracellular matrix organization (GO:0030198)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|phototransduction, visible light (GO:0007603)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of stress fiber assembly (GO:0051496)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|ureteric bud development (GO:0001657)	cell surface (GO:0009986)|costamere (GO:0043034)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	thrombospondin receptor activity (GO:0070053)		SDC4/ROS1(7)	NS(1)|breast(1)|endometrium(1)|large_intestine(2)	5		Myeloproliferative disorder(115;0.0122)				CTTCATACGGTACATGAGCAG	0.537			T	ROS1	NSCLC																																			Dom	yes		20	20q12	6385	syndecan 4		E	0													112.0	98.0	103.0					20																	43955992		2203	4300	6503	SO:0001583	missense	0			X67016, D13292	CCDS13350.1	20q12	2010-03-25	2007-02-15		ENSG00000124145	ENSG00000124145		"""Proteoglycans / Cell Surface : Syndecans"""	10661	protein-coding gene	gene with protein product	"""syndecan proteoglycan 4"""	600017	"""syndecan 4 (amphiglycan, ryudocan)"""			7916598, 1500433	Standard	NM_002999		Approved	SYND4, amphiglycan, ryudocan	uc002xnu.3	P31431	OTTHUMG00000033083	ENST00000372733.3:c.509A>C	20.37:g.43955992T>G	ENSP00000361818:p.Tyr170Ser		O00773|Q16833|Q53FN9|Q6FGN3	Missense_Mutation	SNP	pfam_Syndecan/Neurexin_dom,smart_Neurexin-like	p.Y170S	ENST00000372733.3	37	c.509	CCDS13350.1	20	.	.	.	.	.	.	.	.	.	.	T	24.2	4.503066	0.85176	.	.	ENSG00000124145	ENST00000372733;ENST00000537976	T	0.62941	-0.01	5.37	5.37	0.77165	Neurexin/syndecan/glycophorin C (1);	0.066178	0.64402	D	0.000007	T	0.80808	0.4694	M	0.84683	2.71	0.58432	D	0.999999	D	0.89917	1.0	D	0.77557	0.99	D	0.84321	0.0516	10	0.87932	D	0	-17.6537	14.5644	0.68165	0.0:0.0:0.0:1.0	.	170	P31431	SDC4_HUMAN	S	170;98	ENSP00000361818:Y170S	ENSP00000361818:Y170S	Y	-	2	0	SDC4	43389406	1.000000	0.71417	1.000000	0.80357	0.857000	0.48899	6.256000	0.72473	2.034000	0.60081	0.533000	0.62120	TAC	SDC4	-	pfam_Syndecan/Neurexin_dom,smart_Neurexin-like	ENSG00000124145		0.537	SDC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SDC4	HGNC	protein_coding	OTTHUMT00000080515.1	-	0.00	25	0	T	NM_002999		43955992	-1	tier1	-	no_errors	ENST00000372733	ensembl	human	known	74_37	missense	26.47	25	9	SNP	1.000	G
SDK1	221935	genome.wustl.edu	37	7	4152946	4152946	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr7:4152946G>A	ENST00000404826.2	+	24	3599	c.3460G>A	c.(3460-3462)Gtt>Att	p.V1154I	SDK1_ENST00000389531.3_Missense_Mutation_p.V1154I	NM_152744.3	NP_689957.3	Q7Z5N4	SDK1_HUMAN	sidekick cell adhesion molecule 1	1154	Fibronectin type-III 5. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				NS(1)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(42)|lung(55)|ovary(4)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(4)	153		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)		AGTGAACATTGTTGGGCCGAG	0.542																																																	0													187.0	197.0	193.0					7																	4152946		2203	4300	6503	SO:0001583	missense	0			AK074077	CCDS34590.1	7p22.3	2013-02-11	2011-12-09		ENSG00000146555	ENSG00000146555		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19307	protein-coding gene	gene with protein product		607216	"""sidekick homolog 1 (chicken)"", ""sidekick homolog 1, cell adhesion molecule (chicken)"""			12230981, 17307840, 15213259	Standard	NM_001079653		Approved	FLJ31425	uc003smx.3	Q7Z5N4	OTTHUMG00000151733	ENST00000404826.2:c.3460G>A	7.37:g.4152946G>A	ENSP00000385899:p.Val1154Ile		Q8TEN9|Q8TEP5|Q96N44	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.V1154I	ENST00000404826.2	37	c.3460	CCDS34590.1	7	.	.	.	.	.	.	.	.	.	.	G	25.3	4.627643	0.87560	.	.	ENSG00000146555	ENST00000404826;ENST00000389531	T;T	0.57752	0.38;0.38	5.22	5.22	0.72569	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.64402	D	0.000014	T	0.72137	0.3423	M	0.66560	2.04	0.58432	D	0.999998	P;D	0.54397	0.462;0.966	B;D	0.75020	0.417;0.985	T	0.74783	-0.3548	10	0.72032	D	0.01	.	18.8007	0.92015	0.0:0.0:1.0:0.0	.	1154;1154	F8W6X9;Q7Z5N4	.;SDK1_HUMAN	I	1154	ENSP00000385899:V1154I;ENSP00000374182:V1154I	ENSP00000374182:V1154I	V	+	1	0	SDK1	4119472	1.000000	0.71417	0.132000	0.22025	0.775000	0.43874	9.315000	0.96313	2.437000	0.82529	0.655000	0.94253	GTT	SDK1	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000146555		0.542	SDK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SDK1	HGNC	protein_coding	OTTHUMT00000323702.1	-	0.00	72	0	G	NM_152744		4152946	+1	tier1	-	no_errors	ENST00000404826	ensembl	human	known	74_37	missense	8.89	41	4	SNP	0.996	A
SEC22B	9554	genome.wustl.edu	37	1	145112376	145112376	+	RNA	SNP	C	C	G			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr1:145112376C>G	ENST00000453618.1	+	0	677							O75396	SC22B_HUMAN	SEC22 vesicle trafficking protein homolog B (S. cerevisiae) (gene/pseudogene)						ER to Golgi vesicle-mediated transport (GO:0006888)|protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)											ATTCTAGATACTTTCATTCAG	0.428																																																	0													103.0	89.0	94.0					1																	145112376		1997	4179	6176			0			AF047442		1q21.1	2012-04-20	2010-03-12	2006-04-25	ENSG00000223380				10700	protein-coding gene	gene with protein product		604029	"""SEC22, vesicle trafficking protein (S. cerevisiae)-like 1"", ""SEC22 vesicle trafficking protein-like 1 (S. cerevisiae)"", ""SEC22 vesicle trafficking protein homolog B (S. cerevisiae)"""	SEC22L1		9094723, 16354670	Standard	NM_004892		Approved	sec22b, ERS-24	uc031poa.1	O75396	OTTHUMG00000013745		1.37:g.145112376C>G			A8K1G0	RNA	SNP	-	NULL	ENST00000453618.1	37	NULL		1																																																																																			SEC22B	-	-	ENSG00000223380		0.428	SEC22B-001	KNOWN	basic	processed_transcript	SEC22B	HGNC	processed_transcript	OTTHUMT00000038523.5	-	0.00	85	0	C	NM_004892		145112376	+1	tier1	-	no_errors	ENST00000453618	ensembl	human	known	74_37	rna	7.35	63	5	SNP	1.000	G
SEC16B	89866	genome.wustl.edu	37	1	177905447	177905447	+	Missense_Mutation	SNP	T	T	A			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr1:177905447T>A	ENST00000308284.6	-	20	2646	c.2557A>T	c.(2557-2559)Att>Ttt	p.I853F	RP4-798P15.3_ENST00000354921.3_RNA|SEC16B_ENST00000495165.1_5'UTR	NM_033127.2	NP_149118.2	Q96JE7	SC16B_HUMAN	SEC16 homolog B (S. cerevisiae)	853					COPII vesicle coating (GO:0048208)|endoplasmic reticulum organization (GO:0007029)|peroxisome fission (GO:0016559)|peroxisome organization (GO:0007031)|positive regulation of gene expression (GO:0010628)|positive regulation of protein exit from endoplasmic reticulum (GO:0070863)|protein localization to endoplasmic reticulum (GO:0070972)|protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|Golgi membrane (GO:0000139)|intracellular membrane-bounded organelle (GO:0043231)				central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(7)|lung(14)|ovary(3)|skin(1)|stomach(1)	35						GGTTTGGAAATGACCTCTTGG	0.468																																																	0													140.0	138.0	138.0					1																	177905447		2016	4190	6206	SO:0001583	missense	0			AK090411	CCDS44281.1	1q25.2	2012-10-08	2007-06-20	2007-06-20	ENSG00000120341	ENSG00000120341			30301	protein-coding gene	gene with protein product	"""regucalcin gene promotor region related protein"""	612855	"""leucine zipper transcription regulator 2"""	LZTR2		11572484, 11605020	Standard	NM_033127		Approved	RGPR, PGPR-p117	uc001gli.1	Q96JE7	OTTHUMG00000167206	ENST00000308284.6:c.2557A>T	1.37:g.177905447T>A	ENSP00000308339:p.Ile853Phe		A3EYF1|Q5HYF6|Q8N7D6|Q96GX6	Missense_Mutation	SNP	NULL	p.I853F	ENST00000308284.6	37	c.2557	CCDS44281.1	1	.	.	.	.	.	.	.	.	.	.	T	11.75	1.732227	0.30684	.	.	ENSG00000120341	ENST00000308284;ENST00000414025;ENST00000239472	T	0.14266	2.52	4.88	-1.74	0.08056	.	1.566720	0.03419	N	0.206069	T	0.13457	0.0326	L	0.59436	1.845	0.09310	N	1	P;P;P;P	0.42409	0.744;0.779;0.779;0.61	B;B;B;B	0.36666	0.23;0.125;0.125;0.125	T	0.30650	-0.9971	10	0.49607	T	0.09	0.0086	4.7921	0.13254	0.1455:0.2278:0.0:0.6267	.	408;854;853;550	B1AM07;B1AM08;Q96JE7;Q96PW0	.;.;SC16B_HUMAN;.	F	853;537;568	ENSP00000308339:I853F	ENSP00000239472:I568F	I	-	1	0	AL359075.1	176172070	0.000000	0.05858	0.000000	0.03702	0.507000	0.33981	-1.660000	0.01974	-0.374000	0.07967	0.533000	0.62120	ATT	SEC16B	-	NULL	ENSG00000120341		0.468	SEC16B-004	KNOWN	basic|appris_principal|CCDS	protein_coding	SEC16B	HGNC	protein_coding	OTTHUMT00000084773.16	-	0.00	57	0	T	NM_033127		177905447	-1	tier1	-	no_errors	ENST00000308284	ensembl	human	known	74_37	missense	13.21	46	7	SNP	0.002	A
SEMA5B	54437	genome.wustl.edu	37	3	122680064	122680064	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr3:122680064G>T	ENST00000357599.3	-	2	433	c.47C>A	c.(46-48)cCt>cAt	p.P16H	SEMA5B_ENST00000451055.2_Missense_Mutation_p.P70H|SEMA5B_ENST00000465147.1_Intron|SEMA5B_ENST00000195173.4_Missense_Mutation_p.P16H	NM_001031702.3|NM_001256348.1	NP_001026872.2|NP_001243277.1	Q9P283	SEM5B_HUMAN	sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5B	16					cell differentiation (GO:0030154)|nervous system development (GO:0007399)	integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(13)|lung(26)|ovary(2)|pancreas(3)|skin(2)|upper_aerodigestive_tract(3)	55				GBM - Glioblastoma multiforme(114;0.0367)		AGGCGGCCCAGGGACGAGGTG	0.612																																																	0													75.0	67.0	70.0					3																	122680064		2203	4300	6503	SO:0001583	missense	0			AB040878	CCDS35491.1, CCDS58848.1, CCDS74995.1	3q21.1	2008-07-18			ENSG00000082684	ENSG00000082684		"""Semaphorins"""	10737	protein-coding gene	gene with protein product		609298		SEMAG		8817451	Standard	NM_001256346		Approved	SemG, KIAA1445, FLJ10372	uc031sbm.1	Q9P283	OTTHUMG00000140392	ENST00000357599.3:c.47C>A	3.37:g.122680064G>T	ENSP00000350215:p.Pro16His		A8K5U2|B7Z393|F8W9U8|Q6DD89|Q6UY12|Q9NW17	Missense_Mutation	SNP	pfam_Semap_dom,pfam_Thrombospondin_1_rpt,superfamily_Semap_dom,superfamily_Thrombospondin_1_rpt,superfamily_Plexin-like_fold,smart_Semap_dom,smart_Plexin-like_fold,smart_Thrombospondin_1_rpt,pfscan_Semap_dom,pfscan_Thrombospondin_1_rpt	p.P70H	ENST00000357599.3	37	c.209	CCDS35491.1	3	.	.	.	.	.	.	.	.	.	.	G	11.93	1.785091	0.31593	.	.	ENSG00000082684	ENST00000357599;ENST00000195173;ENST00000451055;ENST00000393583;ENST00000421053;ENST00000449546	T;T;T;T	0.36699	1.31;1.24;1.3;1.41	3.1	-1.53	0.08611	.	.	.	.	.	T	0.17238	0.0414	N	0.08118	0	0.09310	N	1	B	0.28900	0.227	B	0.33042	0.157	T	0.26430	-1.0103	9	0.62326	D	0.03	.	3.3284	0.07075	0.4436:0.2158:0.3407:0.0	.	16	Q9P283	SEM5B_HUMAN	H	16;16;70;16;16;16	ENSP00000350215:P16H;ENSP00000195173:P16H;ENSP00000389588:P70H;ENSP00000377208:P16H	ENSP00000195173:P16H	P	-	2	0	SEMA5B	124162754	0.026000	0.19158	0.000000	0.03702	0.003000	0.03518	0.235000	0.17948	-0.231000	0.09825	-0.216000	0.12614	CCT	SEMA5B	-	NULL	ENSG00000082684		0.612	SEMA5B-001	KNOWN	basic|CCDS	protein_coding	SEMA5B	HGNC	protein_coding	OTTHUMT00000277165.1	-	0.00	40	0	G	NM_001031702		122680064	-1	tier1	-	no_errors	ENST00000451055	ensembl	human	known	74_37	missense	15.38	33	6	SNP	0.000	T
SEPT7	989	genome.wustl.edu	37	7	35872451	35872452	+	Frame_Shift_Ins	INS	-	-	A			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr7:35872451_35872452insA	ENST00000399034.2	+	3	306_307	c.113_114insA	c.(112-117)ccaaatfs	p.N39fs	SEPT7_ENST00000469679.2_Frame_Shift_Ins_p.N37fs|SEPT7_ENST00000435235.1_5'UTR|SEPT7_ENST00000475109.1_3'UTR|SEPT7_ENST00000494488.2_Frame_Shift_Ins_p.N24fs|SEPT7_ENST00000350320.6_Frame_Shift_Ins_p.N37fs|SEPT7_ENST00000399035.3_Frame_Shift_Ins_p.N37fs			Q16181	SEPT7_HUMAN	septin 7	38					cilium morphogenesis (GO:0060271)|cytokinesis (GO:0000910)|mitotic nuclear division (GO:0007067)|protein heterooligomerization (GO:0051291)|regulation of embryonic cell shape (GO:0016476)	actin cytoskeleton (GO:0015629)|axoneme (GO:0005930)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|kinetochore (GO:0000776)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|septin complex (GO:0031105)|stress fiber (GO:0001725)	GTP binding (GO:0005525)|identical protein binding (GO:0042802)|structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(7)|prostate(1)	14						GCCAATCTCCCAAATCAAGTAT	0.366																																																	0																																										SO:0001589	frameshift_variant	0			S72008	CCDS75582.1	7p14.2	2013-01-21	2005-01-11	2005-01-12	ENSG00000122545	ENSG00000122545		"""Septins"""	1717	protein-coding gene	gene with protein product		603151	"""CDC10 cell division cycle 10 homolog (S. cerevisiae)"""	CDC10		8037772	Standard	NM_001788		Approved	CDC3, SEPT7A	uc011kau.2	Q16181	OTTHUMG00000155063	ENST00000399034.2:c.116dupA	7.37:g.35872454_35872454dupA	ENSP00000381992:p.Asn39fs		Q52M76|Q6NX50	Frame_Shift_Ins	INS	pfam_Cell_div_GTP-bd,superfamily_P-loop_NTPase,pirsf_Septin,prints_Septin7	p.N39fs	ENST00000399034.2	37	c.113_114		7																																																																																			SEPT7	-	pirsf_Septin	ENSG00000122545		0.366	SEPT7-202	KNOWN	basic|appris_candidate_longest	protein_coding	SEPT7	HGNC	protein_coding			0.00	38	0	-	NM_001788		35872452	+1	tier1		no_errors	ENST00000399034	ensembl	human	known	74_37	frame_shift_ins	5.13	37	2	INS	1.000:1.000	A
SERPINA10	51156	genome.wustl.edu	37	14	94752565	94752565	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr14:94752565C>A	ENST00000393096.1	-	4	1488	c.1023G>T	c.(1021-1023)aaG>aaT	p.K341N	SERPINA10_ENST00000554173.1_Missense_Mutation_p.K341N|SERPINA10_ENST00000261994.4_Missense_Mutation_p.K341N|SERPINA10_ENST00000554723.1_Missense_Mutation_p.K381N	NM_016186.2	NP_057270.1	Q9UK55	ZPI_HUMAN	serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 10	341					blood coagulation (GO:0007596)|negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	heparin binding (GO:0008201)|serine-type endopeptidase inhibitor activity (GO:0004867)			haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(4)|lung(6)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)	33		all_cancers(154;0.105)		Epithelial(152;0.135)|COAD - Colon adenocarcinoma(157;0.207)|all cancers(159;0.221)		TCTGATCTAGCTTGAACTTCG	0.433																																																	0													148.0	135.0	139.0					14																	94752565		2203	4300	6503	SO:0001583	missense	0			AF181467	CCDS9923.1	14q32.13	2014-02-18	2005-08-18		ENSG00000140093	ENSG00000140093		"""Serine (or cysteine) peptidase inhibitors"""	15996	protein-coding gene	gene with protein product		605271	"""serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 10"""			10460162, 9689066, 24172014	Standard	NM_016186		Approved	PZI, ZPI	uc001yct.3	Q9UK55	OTTHUMG00000171345	ENST00000393096.1:c.1023G>T	14.37:g.94752565C>A	ENSP00000376809:p.Lys341Asn		A5Z2A5|Q6UWX9|Q86U20	Missense_Mutation	SNP	pfam_Serpin_dom,superfamily_Serpin_dom,smart_Serpin_dom	p.K341N	ENST00000393096.1	37	c.1023	CCDS9923.1	14	.	.	.	.	.	.	.	.	.	.	C	12.88	2.071119	0.36566	.	.	ENSG00000140093	ENST00000554723;ENST00000393096;ENST00000261994;ENST00000554173	D;D;D;D	0.86366	-2.11;-2.11;-2.11;-2.11	5.34	5.34	0.76211	Serpin domain (3);	0.000000	0.64402	D	0.000009	D	0.89849	0.6834	M	0.87456	2.885	0.52501	D	0.999957	D	0.56968	0.978	P	0.49953	0.627	D	0.90395	0.4398	10	0.62326	D	0.03	.	7.349	0.26680	0.0:0.7914:0.0:0.2086	.	341	Q9UK55	ZPI_HUMAN	N	381;341;341;341	ENSP00000450896:K381N;ENSP00000376809:K341N;ENSP00000261994:K341N;ENSP00000450971:K341N	ENSP00000261994:K341N	K	-	3	2	SERPINA10	93822318	1.000000	0.71417	0.981000	0.43875	0.019000	0.09904	2.399000	0.44495	2.512000	0.84698	0.563000	0.77884	AAG	SERPINA10	-	pfam_Serpin_dom,superfamily_Serpin_dom,smart_Serpin_dom	ENSG00000140093		0.433	SERPINA10-201	KNOWN	basic|appris_principal|CCDS	protein_coding	SERPINA10	HGNC	protein_coding	OTTHUMT00000413061.1		0.00	26	0	C	NM_016186		94752565	-1			no_errors	ENST00000261994	ensembl	human	known	74_37	missense	6.90	27	2	SNP	1.000	A
SF3B3	23450	genome.wustl.edu	37	16	70599151	70599151	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr16:70599151G>C	ENST00000302516.5	+	19	2858	c.2647G>C	c.(2647-2649)Gaa>Caa	p.E883Q		NM_012426.4	NP_036558.3	Q15393	SF3B3_HUMAN	splicing factor 3b, subunit 3, 130kDa	883					gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|protein complex assembly (GO:0006461)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|nucleoplasm (GO:0005654)|small nuclear ribonucleoprotein complex (GO:0030532)|spliceosomal complex (GO:0005681)|U12-type spliceosomal complex (GO:0005689)	nucleic acid binding (GO:0003676)			breast(2)|endometrium(8)|kidney(2)|large_intestine(8)|liver(3)|lung(21)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	53		Ovarian(137;0.0694)				TGTCCAGCTGGAACAGAATGA	0.532																																																	0													79.0	78.0	78.0					16																	70599151		2198	4300	6498	SO:0001583	missense	0			AJ001443	CCDS10894.1	16q22	2008-08-01	2002-08-29		ENSG00000189091	ENSG00000189091			10770	protein-coding gene	gene with protein product		605592	"""splicing factor 3b, subunit 3, 130kD"""			10490618	Standard	NM_012426		Approved	SAP130, SF3b130, RSE1, KIAA0017	uc002ezf.3	Q15393	OTTHUMG00000137582	ENST00000302516.5:c.2647G>C	16.37:g.70599151G>C	ENSP00000305790:p.Glu883Gln		Q6NTI8|Q96GC0|Q9BPY2|Q9UFX7|Q9UJ29	Missense_Mutation	SNP	pfam_Cleavage/polyA-sp_fac_asu_C,superfamily_WD40_repeat_dom	p.E883Q	ENST00000302516.5	37	c.2647	CCDS10894.1	16	.	.	.	.	.	.	.	.	.	.	G	26.6	4.751758	0.89753	.	.	ENSG00000189091	ENST00000302516	T	0.47869	0.83	5.96	5.96	0.96718	Cleavage/polyadenylation specificity factor, A subunit, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.48114	0.1482	L	0.46614	1.455	0.80722	D	1	B	0.24721	0.11	B	0.32211	0.142	T	0.30650	-0.9971	10	0.21540	T	0.41	.	20.422	0.99049	0.0:0.0:1.0:0.0	.	883	Q15393	SF3B3_HUMAN	Q	883	ENSP00000305790:E883Q	ENSP00000305790:E883Q	E	+	1	0	SF3B3	69156652	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.789000	0.99068	2.832000	0.97577	0.655000	0.94253	GAA	SF3B3	-	pfam_Cleavage/polyA-sp_fac_asu_C,superfamily_WD40_repeat_dom	ENSG00000189091		0.532	SF3B3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SF3B3	HGNC	protein_coding	OTTHUMT00000268972.1	-	0.00	54	0	G	NM_012426		70599151	+1	tier1	-	no_errors	ENST00000302516	ensembl	human	known	74_37	missense	12.50	21	3	SNP	1.000	C
SGCZ	137868	genome.wustl.edu	37	8	13947970	13947970	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr8:13947970G>T	ENST00000382080.1	-	8	1636	c.921C>A	c.(919-921)aaC>aaA	p.N307K	SGCZ_ENST00000421524.2_Missense_Mutation_p.N260K	NM_139167.2	NP_631906.2	Q96LD1	SGCZ_HUMAN	sarcoglycan, zeta	294					membrane organization (GO:0061024)|muscle cell cellular homeostasis (GO:0046716)|muscle cell development (GO:0055001)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|sarcoglycan complex (GO:0016012)				NS(1)|central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(14)|lung(15)|ovary(2)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	47				all cancers(2;0.000643)|Colorectal(111;0.00674)|COAD - Colon adenocarcinoma(73;0.0193)|GBM - Glioblastoma multiforme(2;0.026)		ACAGGCAGATGTTGCTACTGG	0.493																																																	0													181.0	167.0	172.0					8																	13947970		2203	4300	6503	SO:0001583	missense	0			AY028700	CCDS5992.2	8p22	2014-09-17	2010-04-21		ENSG00000185053	ENSG00000185053			14075	protein-coding gene	gene with protein product		608113				12189167	Standard	XM_006716287		Approved	ZSG1	uc003wwq.3	Q96LD1	OTTHUMG00000090827	ENST00000382080.1:c.921C>A	8.37:g.13947970G>T	ENSP00000371512:p.Asn307Lys		Q6REU0	Missense_Mutation	SNP	pfam_Sarcoglycan	p.N307K	ENST00000382080.1	37	c.921	CCDS5992.2	8	.	.	.	.	.	.	.	.	.	.	G	12.29	1.892218	0.33442	.	.	ENSG00000185053	ENST00000382080;ENST00000421524	T;T	0.10763	2.84;2.84	5.5	5.5	0.81552	.	0.368863	0.35805	N	0.002970	T	0.11879	0.0289	L	0.53249	1.67	0.25229	N	0.989848	B;B	0.30634	0.084;0.288	B;B	0.32533	0.07;0.147	T	0.22941	-1.0202	10	0.15066	T	0.55	.	12.131	0.53942	0.0781:0.0:0.9219:0.0	.	260;307	Q08AT0;Q96LD1-2	.;.	K	307;260	ENSP00000371512:N307K;ENSP00000405224:N260K	ENSP00000371512:N307K	N	-	3	2	SGCZ	13992341	1.000000	0.71417	0.996000	0.52242	0.993000	0.82548	3.963000	0.56773	2.760000	0.94817	0.655000	0.94253	AAC	SGCZ	-	NULL	ENSG00000185053		0.493	SGCZ-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	SGCZ	HGNC	protein_coding	OTTHUMT00000207636.2	-	0.00	40	0	G	NM_139167		13947970	-1	tier1	-	no_errors	ENST00000382080	ensembl	human	known	74_37	missense	13.04	20	3	SNP	0.999	T
SH3D19	152503	genome.wustl.edu	37	4	152086755	152086755	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr4:152086755G>T	ENST00000409252.2	-	7	1495	c.788C>A	c.(787-789)gCc>gAc	p.A263D	SH3D19_ENST00000424281.1_Intron|SH3D19_ENST00000427414.2_Intron|SH3D19_ENST00000409598.4_Missense_Mutation_p.A263D|SH3D19_ENST00000514152.1_Missense_Mutation_p.A263D|SH3D19_ENST00000304527.4_Missense_Mutation_p.A263D|SH3D19_ENST00000455740.1_Missense_Mutation_p.A263D			Q5HYK7	SH319_HUMAN	SH3 domain containing 19	263	Pro-rich.				cytoskeleton organization (GO:0007010)|membrane organization (GO:0061024)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of cell morphogenesis (GO:0022604)	cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	proline-rich region binding (GO:0070064)			autonomic_ganglia(1)|endometrium(1)|large_intestine(3)|lung(10)|ovary(1)|skin(3)|urinary_tract(1)	20	all_hematologic(180;0.093)	Acute lymphoblastic leukemia(8;0.138)				TCCTGGTTTGGCTGGAATTCG	0.403																																																	0													221.0	196.0	204.0					4																	152086755		2203	4300	6503	SO:0001583	missense	0			BX647422	CCDS34077.2, CCDS47143.1, CCDS47144.1	4q31.3	2009-03-05	2009-03-05	2009-03-05	ENSG00000109686	ENSG00000109686			30418	protein-coding gene	gene with protein product	"""EEN binding protein"""	608674				12477932	Standard	NM_001009555		Approved	DKFZp434D0215, EVE1, EBP, Kryn, SH3P19	uc010ipl.1	Q5HYK7	OTTHUMG00000154051	ENST00000409252.2:c.788C>A	4.37:g.152086755G>T	ENSP00000386848:p.Ala263Asp		B7Z296|Q08EK1|Q32N10|Q5U3B8|Q86XB3|Q8N5E7|Q9UFC8	Missense_Mutation	SNP	pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain,prints_p67phox,prints_SH3_domain	p.A263D	ENST00000409252.2	37	c.788	CCDS34077.2	4	.	.	.	.	.	.	.	.	.	.	G	18.37	3.609744	0.66558	.	.	ENSG00000109686	ENST00000409598;ENST00000304527;ENST00000455740;ENST00000409252;ENST00000514152	T;T;T;T;T	0.74947	-0.89;-0.14;-0.89;-0.14;-0.89	6.02	6.02	0.97574	.	0.909002	0.09156	N	0.840912	D	0.84215	0.5423	M	0.62723	1.935	0.80722	D	1	D;D;P	0.63046	0.986;0.992;0.905	P;P;B	0.59948	0.738;0.866;0.439	T	0.79322	-0.1851	10	0.59425	D	0.04	-9.6655	15.9588	0.79910	0.0:0.134:0.866:0.0	.	263;263;41	Q5HYK7;Q5HYK7-2;B3KY23	SH319_HUMAN;.;.	D	263	ENSP00000387030:A263D;ENSP00000302913:A263D;ENSP00000416708:A263D;ENSP00000386848:A263D;ENSP00000423449:A263D	ENSP00000302913:A263D	A	-	2	0	SH3D19	152306205	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.435000	0.59941	2.865000	0.98341	0.655000	0.94253	GCC	SH3D19	-	NULL	ENSG00000109686		0.403	SH3D19-002	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	SH3D19	HGNC	protein_coding	OTTHUMT00000335132.3	-	0.00	162	0	G	NM_001009555		152086755	-1	tier1	-	no_errors	ENST00000304527	ensembl	human	known	74_37	missense	5.13	74	4	SNP	1.000	T
SHROOM2	357	genome.wustl.edu	37	X	9905366	9905367	+	Frame_Shift_Ins	INS	-	-	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chrX:9905366_9905367insT	ENST00000380913.3	+	7	3870_3871	c.3780_3781insT	c.(3781-3783)tgtfs	p.C1261fs	SHROOM2_ENST00000418909.2_Frame_Shift_Ins_p.C96fs	NM_001649.2	NP_001640.1	Q13796	SHRM2_HUMAN	shroom family member 2	1261					apical protein localization (GO:0045176)|brain development (GO:0007420)|camera-type eye development (GO:0043010)|camera-type eye morphogenesis (GO:0048593)|cell migration (GO:0016477)|cell-cell junction maintenance (GO:0045217)|cellular pigment accumulation (GO:0043482)|ear development (GO:0043583)|establishment of melanosome localization (GO:0032401)|eye pigment granule organization (GO:0008057)|lens morphogenesis in camera-type eye (GO:0002089)|melanosome organization (GO:0032438)|negative regulation of actin filament depolymerization (GO:0030835)|sodium ion transmembrane transport (GO:0035725)	apical plasma membrane (GO:0016324)|cell cortex (GO:0005938)|cell-cell adherens junction (GO:0005913)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|microtubule (GO:0005874)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|beta-catenin binding (GO:0008013)|ligand-gated sodium channel activity (GO:0015280)			breast(4)|central_nervous_system(2)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(13)|ovary(3)|prostate(3)|skin(6)|upper_aerodigestive_tract(2)	57		Hepatocellular(5;0.000888)				ACTCGCGCTTCTGTCTGTACAC	0.678																																																	0																																										SO:0001589	frameshift_variant	0			X83543	CCDS14135.1	Xp22.3	2008-02-05	2006-07-20	2006-07-20	ENSG00000146950	ENSG00000146950			630	protein-coding gene	gene with protein product		300103	"""apical protein, Xenopus laevis-like"", ""apical protein-like (Xenopus laevis)"""	APXL		7795590, 16615870	Standard	NM_001649		Approved		uc004csu.1	Q13796	OTTHUMG00000021121	ENST00000380913.3:c.3781dupT	X.37:g.9905367_9905367dupT	ENSP00000370299:p.Cys1261fs		B9EIQ7	Frame_Shift_Ins	INS	pfam_ASD2,pfam_ASD1,pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.C1260fs	ENST00000380913.3	37	c.3780_3781	CCDS14135.1	X																																																																																			SHROOM2	-	NULL	ENSG00000146950		0.678	SHROOM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SHROOM2	HGNC	protein_coding	OTTHUMT00000055721.1		0.00	21	0	-	NM_001649		9905367	+1	tier1		no_errors	ENST00000380913	ensembl	human	known	74_37	frame_shift_ins	27.78	13	5	INS	1.000:1.000	T
SLC12A6	9990	genome.wustl.edu	37	15	34546616	34546616	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr15:34546616C>T	ENST00000354181.3	-	9	1543	c.1051G>A	c.(1051-1053)Gtc>Atc	p.V351I	SLC12A6_ENST00000397702.2_Missense_Mutation_p.V292I|SLC12A6_ENST00000451844.2_Missense_Mutation_p.V163I|SLC12A6_ENST00000290209.5_Missense_Mutation_p.V300I|SLC12A6_ENST00000558589.1_Missense_Mutation_p.V342I|RP11-1084A12.2_ENST00000559867.1_RNA|SLC12A6_ENST00000458406.2_Missense_Mutation_p.V292I|SLC12A6_ENST00000560611.1_Missense_Mutation_p.V351I|SLC12A6_ENST00000558667.1_Missense_Mutation_p.V351I|SLC12A6_ENST00000397707.2_Missense_Mutation_p.V336I|SLC12A6_ENST00000560164.1_Missense_Mutation_p.V163I			Q9UHW9	S12A6_HUMAN	solute carrier family 12 (potassium/chloride transporter), member 6	351					angiogenesis (GO:0001525)|cellular hypotonic response (GO:0071476)|cellular hypotonic salinity response (GO:0071477)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transport (GO:0006811)|potassium ion import (GO:0010107)|potassium ion transport (GO:0006813)|rubidium ion transport (GO:0035826)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium ion transmembrane transporter activity (GO:0015079)|potassium:chloride symporter activity (GO:0015379)|protein kinase binding (GO:0019901)|rubidium ion transmembrane transporter activity (GO:0035827)			central_nervous_system(5)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(8)|lung(17)|ovary(4)|skin(3)	45		all_lung(180;2.78e-08)		all cancers(64;3.43e-17)|GBM - Glioblastoma multiforme(113;2.6e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0301)	Potassium Chloride(DB00761)	GACACAATGACACAGGCCAGG	0.488																																																	0													156.0	131.0	140.0					15																	34546616		2201	4298	6499	SO:0001583	missense	0			AF108831	CCDS10036.1, CCDS42010.1, CCDS42011.1, CCDS42012.1, CCDS58352.1	15q13	2014-09-17	2013-07-18		ENSG00000140199	ENSG00000140199		"""Solute carriers"""	10914	protein-coding gene	gene with protein product		604878	"""agenesis of corpus callosum and peripheral neuropathy (Andermann syndrome)"""	KCC3, ACCPN		10187864, 10347194	Standard	NM_133647		Approved		uc001zhw.3	Q9UHW9	OTTHUMG00000129441	ENST00000354181.3:c.1051G>A	15.37:g.34546616C>T	ENSP00000346112:p.Val351Ile		A0AV76|Q2VI00|Q7Z2E7|Q7Z4G5|Q8TDD4|Q9UFR2|Q9Y642|Q9Y665	Missense_Mutation	SNP	pfam_AA-permease/SLC12A_dom,pfam_K/Cl_cotranspt_1/3,prints_KCL_cotranspt,tigrfam_Na/K/Cl_cotransptS	p.V342I	ENST00000354181.3	37	c.1024	CCDS58352.1	15	.	.	.	.	.	.	.	.	.	.	C	34	5.339841	0.95783	.	.	ENSG00000140199	ENST00000290209;ENST00000397707;ENST00000354181;ENST00000397702;ENST00000458406;ENST00000451844	D;D;D;D;D	0.98717	-5.09;-5.09;-5.09;-5.09;-5.09	5.1	5.1	0.69264	Amino acid permease domain (1);	0.000000	0.64402	D	0.000002	D	0.98588	0.9528	L	0.45285	1.41	0.80722	D	1	D;D;D;D	0.89917	1.0;0.999;0.999;0.997	D;D;D;D	0.81914	0.986;0.988;0.985;0.995	D	0.99894	1.1143	10	0.87932	D	0	.	17.4519	0.87594	0.0:1.0:0.0:0.0	.	336;351;300;163	Q9UHW9-3;Q9UHW9;A0AV76;B3KXX3	.;S12A6_HUMAN;.;.	I	300;336;342;292;292;163	ENSP00000290209:V300I;ENSP00000380819:V336I;ENSP00000380814:V292I;ENSP00000387725:V292I;ENSP00000390199:V163I	ENSP00000290209:V300I	V	-	1	0	SLC12A6	32333908	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.651000	0.83577	2.634000	0.89283	0.655000	0.94253	GTC	SLC12A6	-	pfam_AA-permease/SLC12A_dom,tigrfam_Na/K/Cl_cotransptS	ENSG00000140199		0.488	SLC12A6-003	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	SLC12A6	HGNC	protein_coding	OTTHUMT00000417991.1	-	0.00	54	0	C	NM_005135		34546616	-1	tier1	-	no_errors	ENST00000558589	ensembl	human	known	74_37	missense	23.08	20	6	SNP	1.000	T
SLC16A2	6567	genome.wustl.edu	37	X	73641366	73641366	+	5'UTR	SNP	G	G	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chrX:73641366G>T	ENST00000587091.1	+	0	71				SLC16A2_ENST00000276033.5_Missense_Mutation_p.G39V	NM_006517.4	NP_006508.2	P36021	MOT8_HUMAN	solute carrier family 16, member 2 (thyroid hormone transporter)						monocarboxylic acid transport (GO:0015718)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	monocarboxylic acid transmembrane transporter activity (GO:0008028)|symporter activity (GO:0015293)|transporter activity (GO:0005215)			breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(4)|ovary(1)|skin(2)	21					L-Leucine(DB00149)|L-Tryptophan(DB00150)|L-Tyrosine(DB00135)|Levothyroxine(DB00451)|Liotrix(DB01583)|Pyruvic acid(DB00119)	GGAGgcagcggcagcggcagc	0.706																																																	0													16.0	14.0	14.0					X																	73641366		2124	4182	6306	SO:0001623	5_prime_UTR_variant	0				CCDS14426.1, CCDS14426.2	Xq13.2	2013-05-22	2012-03-20		ENSG00000147100	ENSG00000147100		"""Solute carriers"""	10923	protein-coding gene	gene with protein product		300095	"""solute carrier family 16 (monocarboxylic acid transporters), member 2 (putative transporter)"", ""Allan-Herndon-Dudley syndrome"", ""solute carrier family 16 (monocarboxylic acid transporters), member 2"", ""mental retardation, X-linked 22"", ""solute carrier family 16, member 2 (monocarboxylic acid transporter 8)"""	DXS128, AHDS, MRX22		7981683, 12871948, 15889350	Standard	NM_006517		Approved	XPCT, MCT8, MCT7	uc031tjy.1	P36021	OTTHUMG00000021857	ENST00000587091.1:c.-107G>T	X.37:g.73641366G>T			Q7Z797	Missense_Mutation	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.G39V	ENST00000587091.1	37	c.116	CCDS14426.2	X	.	.	.	.	.	.	.	.	.	.	G	6.847	0.525521	0.13066	.	.	ENSG00000147100	ENST00000276033	T	0.27402	1.67	2.97	-0.0277	0.13925	.	.	.	.	.	T	0.14098	0.0341	N	0.08118	0	0.09310	N	1	.	.	.	.	.	.	T	0.21759	-1.0236	7	0.72032	D	0.01	.	2.9166	0.05755	0.1232:0.171:0.5315:0.1743	.	.	.	.	V	39	ENSP00000276033:G39V	ENSP00000276033:G39V	G	+	2	0	SLC16A2	73558091	0.393000	0.25237	0.000000	0.03702	0.195000	0.23768	0.607000	0.24209	-0.704000	0.05042	-2.007000	0.00441	GGC	SLC16A2	-	NULL	ENSG00000147100		0.706	SLC16A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC16A2	HGNC	protein_coding	OTTHUMT00000057266.3	-	0.00	13	0	G			73641366	+1	tier1	-	no_errors	ENST00000276033	ensembl	human	known	74_37	missense	50.00	4	4	SNP	0.000	T
SLC1A5	6510	genome.wustl.edu	37	19	47278775	47278775	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr19:47278775C>T	ENST00000542575.2	-	8	2246	c.1618G>A	c.(1618-1620)Gtc>Atc	p.V540I	SLC1A5_ENST00000594991.1_Missense_Mutation_p.V364I|FKRP_ENST00000600646.1_Intron|SLC1A5_ENST00000412532.2_Missense_Mutation_p.V312I|SLC1A5_ENST00000434726.2_Missense_Mutation_p.V338I	NM_005628.2	NP_005619.1	Q15758	AAAT_HUMAN	solute carrier family 1 (neutral amino acid transporter), member 5	540					amino acid transport (GO:0006865)|extracellular amino acid transport (GO:0006860)|glutamine transport (GO:0006868)|ion transport (GO:0006811)|neutral amino acid transport (GO:0015804)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	L-glutamine transmembrane transporter activity (GO:0015186)|L-serine transmembrane transporter activity (GO:0015194)|neutral amino acid transmembrane transporter activity (GO:0015175)|receptor activity (GO:0004872)|sodium:dicarboxylate symporter activity (GO:0017153)|virus receptor activity (GO:0001618)			cervix(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(2)|stomach(1)	13		all_epithelial(76;0.00314)|Ovarian(192;0.0798)|all_neural(266;0.107)		OV - Ovarian serous cystadenocarcinoma(262;0.000338)|all cancers(93;0.000882)|Epithelial(262;0.0211)|GBM - Glioblastoma multiforme(486;0.0341)	L-Asparagine(DB00174)|L-Glutamine(DB00130)	GTTTACATGACTGATTCCTTC	0.597																																																	0													77.0	88.0	84.0					19																	47278775		2203	4300	6503	SO:0001583	missense	0			U53347	CCDS12692.1, CCDS46125.1, CCDS46126.1	19q13.32	2013-07-15			ENSG00000105281	ENSG00000105281		"""Solute carriers"""	10943	protein-coding gene	gene with protein product		109190		RDRC, M7V1		8702519, 10051606	Standard	NM_005628		Approved	AAAT, ASCT2	uc002pfs.3	Q15758	OTTHUMG00000183434	ENST00000542575.2:c.1618G>A	19.37:g.47278775C>T	ENSP00000444408:p.Val540Ile		A8K9H5|B4DR77|B4DWS4|B7ZB81|D0EYG6|E9PC01|O95720|Q96RL9|Q9BWQ3|Q9UNP2	Missense_Mutation	SNP	pfam_Na-dicarboxylate_symporter,prints_Na-dicarboxylate_symporter	p.V540I	ENST00000542575.2	37	c.1618	CCDS12692.1	19	.	.	.	.	.	.	.	.	.	.	c	15.42	2.828155	0.50845	.	.	ENSG00000105281	ENST00000542575;ENST00000434726;ENST00000412532;ENST00000306894	T;T;T	0.65732	0.6;-0.17;-0.14	4.88	3.85	0.44370	.	0.092112	0.42294	D	0.000730	T	0.63581	0.2523	L	0.33485	1.01	0.30271	N	0.792227	D;P;D	0.61697	0.968;0.952;0.99	P;P;P	0.61397	0.632;0.724;0.888	T	0.62826	-0.6772	10	0.54805	T	0.06	-24.7449	8.7383	0.34541	0.0:0.824:0.0:0.176	.	338;540;540	E9PC01;Q15758;Q71UA6	.;AAAT_HUMAN;.	I	540;338;312;547	ENSP00000444408:V540I;ENSP00000406532:V338I;ENSP00000397924:V312I	ENSP00000303623:V547I	V	-	1	0	SLC1A5	51970615	0.991000	0.36638	0.838000	0.33150	0.213000	0.24496	2.929000	0.48916	1.295000	0.44724	-0.273000	0.10243	GTC	SLC1A5	-	NULL	ENSG00000105281		0.597	SLC1A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC1A5	HGNC	protein_coding	OTTHUMT00000466630.1	-	0.00	48	0	C			47278775	-1	tier1	-	no_errors	ENST00000542575	ensembl	human	known	74_37	missense	10.00	36	4	SNP	0.981	T
SLC22A5	6584	genome.wustl.edu	37	5	131721070	131721071	+	Frame_Shift_Del	DEL	GT	GT	-			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	GT	GT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr5:131721070_131721071delGT	ENST00000245407.3	+	4	924_925	c.703_704delGT	c.(703-705)gtgfs	p.V235fs	SLC22A5_ENST00000435065.2_Frame_Shift_Del_p.V259fs	NM_003060.3	NP_003051.1	O76082	S22A5_HUMAN	solute carrier family 22 (organic cation/carnitine transporter), member 5	235					carnitine transmembrane transport (GO:1902603)|carnitine transport (GO:0015879)|drug transmembrane transport (GO:0006855)|drug transport (GO:0015893)|positive regulation of intestinal epithelial structure maintenance (GO:0060731)|quaternary ammonium group transport (GO:0015697)|quorum sensing involved in interaction with host (GO:0052106)|sodium ion transport (GO:0006814)|sodium-dependent organic cation transport (GO:0070715)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|brush border membrane (GO:0031526)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	antibiotic transporter activity (GO:0042895)|ATP binding (GO:0005524)|carnitine transmembrane transporter activity (GO:0015226)|drug transmembrane transporter activity (GO:0015238)|PDZ domain binding (GO:0030165)|quaternary ammonium group transmembrane transporter activity (GO:0015651)|symporter activity (GO:0015293)			NS(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|stomach(1)	8		all_cancers(142;0.0751)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)		Acetylcarnitine(DB08842)|Aminohippurate(DB00345)|Amphetamine(DB00182)|Ampicillin(DB00415)|Azidocillin(DB08795)|Benzylpenicillin(DB01053)|Cefadroxil(DB01140)|Cefalotin(DB00456)|Cefdinir(DB00535)|Cefepime(DB01413)|Cefixime(DB00671)|Cefradine(DB01333)|Ceftazidime(DB00438)|Cephalexin(DB00567)|Cephaloglycin(DB00689)|Choline(DB00122)|Cimetidine(DB00501)|Clonidine(DB00575)|Creatine(DB00148)|Cyclacillin(DB01000)|Dactinomycin(DB00970)|Desipramine(DB01151)|Diphenhydramine(DB01075)|Dopamine(DB00988)|Epinephrine(DB00668)|Furosemide(DB00695)|Guanidine(DB00536)|Histamine Phosphate(DB00667)|Ipratropium bromide(DB00332)|L-Arginine(DB00125)|L-Carnitine(DB00583)|Lidocaine(DB00281)|Lomefloxacin(DB00978)|Mepyramine(DB06691)|Methamphetamine(DB01577)|Niacin(DB00627)|Nicotine(DB00184)|Norepinephrine(DB00368)|Norfloxacin(DB01059)|Ofloxacin(DB01165)|Probenecid(DB01032)|Procainamide(DB01035)|Quinidine(DB00908)|Quinine(DB00468)|Sparfloxacin(DB01208)|Thiamine(DB00152)|Tiotropium(DB01409)|Valproic Acid(DB00313)|Verapamil(DB00661)	TACGTTAGGAGTGTGCATATTT	0.48											OREG0016766	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0																																										SO:0001589	frameshift_variant	0			AF057164	CCDS4154.1	5q23.3	2013-05-22	2008-01-11		ENSG00000197375	ENSG00000197375		"""Solute carriers"""	10969	protein-coding gene	gene with protein product		603377		CDSP		9618255, 9916797, 9685390	Standard	NM_003060		Approved	OCTN2, SCD	uc003kww.4	O76082	OTTHUMG00000059634	ENST00000245407.3:c.703_704delGT	5.37:g.131721072_131721073delGT	ENSP00000245407:p.Val235fs	1589	A2Q0V1|B2R844|D3DQ87|Q6ZQZ8|Q96EH6	Frame_Shift_Del	DEL	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_Orgcat_transp	p.C260fs	ENST00000245407.3	37	c.775_776	CCDS4154.1	5																																																																																			SLC22A5	-	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_Orgcat_transp	ENSG00000197375		0.480	SLC22A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC22A5	HGNC	protein_coding	OTTHUMT00000132631.1		0.00	81	0	GT	NM_003060		131721071	+1	tier1		no_errors	ENST00000435065	ensembl	human	known	74_37	frame_shift_del	20.41	39	10	DEL	0.995:0.980	-
SLC25A25	114789	genome.wustl.edu	37	9	130866068	130866068	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr9:130866068G>A	ENST00000373064.5	+	5	858	c.595G>A	c.(595-597)Gta>Ata	p.V199I	SLC25A25_ENST00000373066.5_Missense_Mutation_p.V231I|SLC25A25_ENST00000432073.2_Missense_Mutation_p.V219I|SLC25A25_ENST00000433501.1_Missense_Mutation_p.V96I|SLC25A25_ENST00000373069.5_Missense_Mutation_p.V245I|SLC25A25_ENST00000373068.2_Missense_Mutation_p.V233I	NM_052901.4	NP_443133.2	Q6KCM7	SCMC2_HUMAN	solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 25	199					adipose tissue development (GO:0060612)|ATP metabolic process (GO:0046034)|calcium ion transmembrane transport (GO:0070588)|camera-type eye development (GO:0043010)|cellular respiration (GO:0045333)|multicellular organism growth (GO:0035264)|response to activity (GO:0014823)|response to dietary excess (GO:0002021)|response to food (GO:0032094)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	calcium ion binding (GO:0005509)			breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(3)	10						GGCAGGGGCCGTATCCAGAAC	0.632																																																	0													53.0	56.0	55.0					9																	130866068		2203	4300	6503	SO:0001583	missense	0			AJ619963	CCDS6890.1, CCDS35151.1, CCDS48031.1, CCDS59146.1	9q34	2013-05-22			ENSG00000148339	ENSG00000148339		"""Solute carriers"", ""EF-hand domain containing"""	20663	protein-coding gene	gene with protein product		608745				15123600	Standard	NM_052901		Approved	KIAA1896, PCSCL, MCSC	uc004btb.4	Q6KCM7	OTTHUMG00000020736	ENST00000373064.5:c.595G>A	9.37:g.130866068G>A	ENSP00000362155:p.Val199Ile		Q5SYW7|Q5SYW8|Q5SYX3|Q5VWU2|Q5VWU3|Q5VWU4|Q6KCM4|Q6KCM6|Q6UX48|Q705K2|Q96PZ1|Q9BSA6	Missense_Mutation	SNP	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,smart_EF_hand_dom,pfscan_EF_hand_dom,pfscan_Mitochondrial_sb/sol_carrier,prints_Mit_carrier,prints_Graves_DC	p.V245I	ENST00000373064.5	37	c.733	CCDS6890.1	9	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	28.6|28.6	4.938107|4.938107	0.92526|0.92526	.|.	.|.	ENSG00000148339|ENSG00000148339	ENST00000466983|ENST00000373068;ENST00000373069;ENST00000432073;ENST00000373066;ENST00000373064;ENST00000433501	.|T;T;T;T;T;T	.|0.78481	.|-1.18;-1.18;-1.18;-1.18;-1.18;-1.18	5.67|5.67	5.67|5.67	0.87782|0.87782	.|Mitochondrial carrier domain (2);	.|0.165424	.|0.52532	.|D	.|0.000063	T|T	0.82213|0.82213	0.4988|0.4988	L|L	0.51914|0.51914	1.62|1.62	0.80722|0.80722	D|D	1|1	.|P;D;P;D	.|0.61080	.|0.778;0.971;0.936;0.989	.|P;P;P;P	.|0.55055	.|0.483;0.592;0.471;0.767	T|T	0.80476|0.80476	-0.1366|-0.1366	5|10	.|0.37606	.|T	.|0.19	-8.0164|-8.0164	18.8156|18.8156	0.92076|0.92076	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|199;231;219;233	.|Q6KCM7;Q6KCM7-5;Q6KCM7-4;Q6KCM7-2	.|SCMC2_HUMAN;.;.;.	H|I	23|233;245;219;231;199;96	.|ENSP00000362159:V233I;ENSP00000362160:V245I;ENSP00000410053:V219I;ENSP00000362157:V231I;ENSP00000362155:V199I;ENSP00000401672:V96I	.|ENSP00000362155:V199I	R|V	+|+	2|1	0|0	SLC25A25|SLC25A25	129905889|129905889	1.000000|1.000000	0.71417|0.71417	0.201000|0.201000	0.23476|0.23476	0.931000|0.931000	0.56810|0.56810	9.869000|9.869000	0.99810|0.99810	2.684000|2.684000	0.91462|0.91462	0.650000|0.650000	0.86243|0.86243	CGT|GTA	SLC25A25	-	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier,prints_Mit_carrier,prints_Graves_DC	ENSG00000148339		0.632	SLC25A25-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC25A25	HGNC	protein_coding	OTTHUMT00000054407.1		0.00	34	0	G	NM_052901		130866068	+1			no_errors	ENST00000373069	ensembl	human	known	74_37	missense	20.00	16	4	SNP	0.998	A
SLC2A1	6513	genome.wustl.edu	37	1	43394677	43394677	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr1:43394677G>A	ENST00000426263.3	-	8	1178	c.1000C>T	c.(1000-1002)Cgg>Tgg	p.R334W	SLC2A1_ENST00000475162.1_Intron	NM_006516.2	NP_006507.2	P11166	GTR1_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 1	334					carbohydrate metabolic process (GO:0005975)|cellular response to glucose starvation (GO:0042149)|energy reserve metabolic process (GO:0006112)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|L-ascorbic acid metabolic process (GO:0019852)|protein complex assembly (GO:0006461)|regulation of insulin secretion (GO:0050796)|response to osmotic stress (GO:0006970)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	basolateral plasma membrane (GO:0016323)|blood microparticle (GO:0072562)|caveola (GO:0005901)|cell-cell junction (GO:0005911)|cortical actin cytoskeleton (GO:0030864)|extracellular vesicular exosome (GO:0070062)|female pronucleus (GO:0001939)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|midbody (GO:0030496)|plasma membrane (GO:0005886)	D-glucose transmembrane transporter activity (GO:0055056)|dehydroascorbic acid transporter activity (GO:0033300)|glucose transmembrane transporter activity (GO:0005355)|identical protein binding (GO:0042802)|protein self-association (GO:0043621)|xenobiotic transporter activity (GO:0042910)			autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|endometrium(2)|large_intestine(1)|lung(2)|ovary(1)|pancreas(2)	13	Ovarian(52;0.00579)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0122)			Etomidate(DB00292)	TGCAGGGTCCGCCGGCCTGCT	0.622																																																	0													97.0	92.0	94.0					1																	43394677		2203	4300	6503	SO:0001583	missense	0			K03195	CCDS477.1	1p34.2	2013-05-22			ENSG00000117394	ENSG00000117394		"""Solute carriers"""	11005	protein-coding gene	gene with protein product		138140	"""human T-cell leukemia virus (I and II) receptor"""	GLUT1, GLUT, HTLVR		8839927, 14622599, 18451999	Standard	NM_006516		Approved	DYT18	uc001cik.2	P11166	OTTHUMG00000007657	ENST00000426263.3:c.1000C>T	1.37:g.43394677G>A	ENSP00000416293:p.Arg334Trp		A8K9S6|B2R620|D3DPX0|O75535|Q147X2	Missense_Mutation	SNP	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,prints_Sugar/inositol_transpt,prints_Glu_transpt_1,tigrfam_Sugar/inositol_transpt	p.R334W	ENST00000426263.3	37	c.1000	CCDS477.1	1	.	.	.	.	.	.	.	.	.	.	G	26.0	4.692615	0.88735	.	.	ENSG00000117394	ENST00000426263;ENST00000372501;ENST00000397019	D	0.84873	-1.91	5.52	5.52	0.82312	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);Sugar transporter, conserved site (1);	0.050292	0.85682	D	0.000000	D	0.95802	0.8634	H	0.99507	4.6	0.80722	D	1	D	0.63880	0.993	D	0.63488	0.915	D	0.97705	1.0187	10	0.87932	D	0	.	16.9679	0.86291	0.0:0.0:1.0:0.0	.	334	P11166	GTR1_HUMAN	W	334;334;276	ENSP00000416293:R334W	ENSP00000361579:R334W	R	-	1	2	SLC2A1	43167264	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.149000	0.58091	2.601000	0.87937	0.650000	0.86243	CGG	SLC2A1	-	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_Sugar/inositol_transpt	ENSG00000117394		0.622	SLC2A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC2A1	HGNC	protein_coding	OTTHUMT00000020358.2	-	0.00	23	0	G	NM_006516		43394677	-1	tier1	-	no_errors	ENST00000426263	ensembl	human	known	74_37	missense	40.00	9	6	SNP	0.998	A
SLC39A12	221074	genome.wustl.edu	37	10	18282149	18282149	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr10:18282149C>A	ENST00000377369.2	+	9	1735	c.1462C>A	c.(1462-1464)Cac>Aac	p.H488N	SLC39A12_ENST00000377371.3_Missense_Mutation_p.H487N|SLC39A12_ENST00000377374.4_Intron|SLC39A12_ENST00000539911.1_Missense_Mutation_p.H354N	NM_001145195.1|NM_001282733.1|NM_001282734.1	NP_001138667.1|NP_001269662.1|NP_001269663.1	Q504Y0	S39AC_HUMAN	solute carrier family 39 (zinc transporter), member 12	488					regulation of microtubule polymerization (GO:0031113)|regulation of neuron projection development (GO:0010975)|signal transduction (GO:0007165)|zinc ion transmembrane import (GO:0071578)	integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	zinc ion transmembrane transporter activity (GO:0005385)			NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|kidney(3)|large_intestine(5)|lung(38)|ovary(3)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	60						GGGTCATTCCCACCATCTTGC	0.468																																																	0													205.0	155.0	170.0					10																	18282149		692	1591	2283	SO:0001583	missense	0				CCDS7124.1, CCDS44362.1, CCDS60493.1, CCDS60494.1	10p12.33	2013-05-22			ENSG00000148482	ENSG00000148482		"""Solute carriers"""	20860	protein-coding gene	gene with protein product		608734	"""solute carrier family 39 (metal ion transporter), member 12"""			12659941	Standard	NM_152725		Approved	FLJ30499	uc001ipo.2	Q504Y0	OTTHUMG00000017759	ENST00000377369.2:c.1462C>A	10.37:g.18282149C>A	ENSP00000366586:p.His488Asn		B7ZL35|C9JJL4|Q49AN8|Q4G0L3|Q5VWV8|Q5VWV9|Q6NZY5|Q96NN4	Missense_Mutation	SNP	pfam_ZIP	p.H488N	ENST00000377369.2	37	c.1462	CCDS44362.1	10	.	.	.	.	.	.	.	.	.	.	C	18.34	3.601993	0.66445	.	.	ENSG00000148482	ENST00000377369;ENST00000377371;ENST00000539911;ENST00000425219	T;T;T	0.48201	0.82;0.83;0.82	5.42	4.52	0.55395	.	0.449996	0.25327	N	0.031469	T	0.68284	0.2984	M	0.90425	3.115	0.42346	D	0.992351	D;D	0.61697	0.974;0.99	P;P	0.60236	0.738;0.871	T	0.71941	-0.4440	10	0.14656	T	0.56	-4.8553	14.7688	0.69659	0.1452:0.8547:0.0:0.0	.	487;488	Q504Y0-4;Q504Y0	.;S39AC_HUMAN	N	488;487;354;408	ENSP00000366586:H488N;ENSP00000366588:H487N;ENSP00000440445:H354N	ENSP00000366586:H488N	H	+	1	0	SLC39A12	18322155	1.000000	0.71417	0.053000	0.19242	0.984000	0.73092	2.837000	0.48191	1.290000	0.44636	0.563000	0.77884	CAC	SLC39A12	-	pfam_ZIP	ENSG00000148482		0.468	SLC39A12-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SLC39A12	HGNC	protein_coding		-	0.00	51	0	C	NM_152725		18282149	+1	tier1	-	no_errors	ENST00000377369	ensembl	human	known	74_37	missense	13.64	19	3	SNP	0.998	A
SLC9C1	285335	genome.wustl.edu	37	3	111996674	111996674	+	Missense_Mutation	SNP	T	T	A			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr3:111996674T>A	ENST00000305815.5	-	5	604	c.352A>T	c.(352-354)Aat>Tat	p.N118Y	SLC9C1_ENST00000467397.1_5'Flank|SLC9C1_ENST00000487372.1_Missense_Mutation_p.N118Y	NM_183061.1	NP_898884.1	Q4G0N8	SL9C1_HUMAN	solute carrier family 9, subfamily C (Na+-transporting carboxylic acid decarboxylase), member 1	118					cell differentiation (GO:0030154)|ion transmembrane transport (GO:0034220)|multicellular organismal development (GO:0007275)|sodium ion transport (GO:0006814)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|motile cilium (GO:0031514)|plasma membrane (GO:0005886)	solute:proton antiporter activity (GO:0015299)										AAGATATAATTAACCAAAAAG	0.308																																																	0													55.0	62.0	60.0					3																	111996674		2198	4298	6496	SO:0001583	missense	0			AK128084	CCDS33817.1	3q13	2013-05-22	2012-03-22	2012-03-22	ENSG00000172139	ENSG00000172139		"""Solute carriers"""	31401	protein-coding gene	gene with protein product	"""sperm-NHE"""	612738	"""solute carrier family 9, isoform 10"", ""solute carrier family 9, member 10"""	SLC9A10		12783626	Standard	NM_183061		Approved	NHE	uc003dyu.3	Q4G0N8	OTTHUMG00000159245	ENST00000305815.5:c.352A>T	3.37:g.111996674T>A	ENSP00000306627:p.Asn118Tyr		Q6ZRP4|Q7RTP2	Missense_Mutation	SNP	pfam_Cation/H_exchanger,pfam_cNMP-bd_dom,superfamily_cNMP-bd-like,pfscan_cNMP-bd_dom	p.N118Y	ENST00000305815.5	37	c.352	CCDS33817.1	3	.	.	.	.	.	.	.	.	.	.	T	13.36	2.212936	0.39102	.	.	ENSG00000172139	ENST00000305815;ENST00000487372;ENST00000486574	T;T;T	0.13657	2.57;2.57;2.57	5.13	5.13	0.70059	Cation/H+ exchanger (1);	0.000000	0.53938	D	0.000047	T	0.30916	0.0780	L	0.53249	1.67	0.34217	D	0.674945	D;D	0.89917	0.999;1.0	D;D	0.97110	0.984;1.0	T	0.43877	-0.9364	10	0.62326	D	0.03	.	11.3459	0.49561	0.0:0.0:0.0:1.0	.	118;118	Q4G0N8-2;Q4G0N8	.;S9A10_HUMAN	Y	118;118;45	ENSP00000306627:N118Y;ENSP00000420688:N118Y;ENSP00000417274:N45Y	ENSP00000306627:N118Y	N	-	1	0	SLC9A10	113479364	0.998000	0.40836	0.526000	0.27913	0.059000	0.15707	3.858000	0.55979	1.925000	0.55765	0.533000	0.62120	AAT	SLC9C1	-	pfam_Cation/H_exchanger	ENSG00000172139		0.308	SLC9C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC9C1	HGNC	protein_coding	OTTHUMT00000354066.1	-	0.00	40	0	T	NM_183061		111996674	-1	tier1	-	no_errors	ENST00000305815	ensembl	human	known	74_37	missense	15.00	34	6	SNP	0.954	A
SMC6	79677	genome.wustl.edu	37	2	17898069	17898069	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr2:17898069G>T	ENST00000448223.2	-	14	1554	c.1285C>A	c.(1285-1287)Caa>Aaa	p.Q429K	SMC6_ENST00000351948.4_Missense_Mutation_p.Q429K|SMC6_ENST00000402989.1_Missense_Mutation_p.Q429K|SMC6_ENST00000381272.4_Missense_Mutation_p.Q455K	NM_001142286.1	NP_001135758.1	Q96SB8	SMC6_HUMAN	structural maintenance of chromosomes 6	429					cellular senescence (GO:0090398)|double-strand break repair via homologous recombination (GO:0000724)|telomere maintenance via recombination (GO:0000722)	chromosome, telomeric region (GO:0000781)|intracellular (GO:0005622)|nucleolus (GO:0005730)|nucleus (GO:0005634)|PML body (GO:0016605)|Smc5-Smc6 complex (GO:0030915)	ATP binding (GO:0005524)			NS(1)|biliary_tract(1)|breast(6)|central_nervous_system(4)|cervix(1)|endometrium(4)|kidney(6)|large_intestine(3)|lung(13)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	43	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.158)					TCGATCTCTTGATTGACTGAA	0.333																																																	0													156.0	146.0	150.0					2																	17898069		2202	4299	6501	SO:0001583	missense	0			AJ310551	CCDS1690.1	2p24.3	2008-02-05	2006-07-06	2006-07-06	ENSG00000163029	ENSG00000163029		"""Structural maintenance of chromosomes proteins"""	20466	protein-coding gene	gene with protein product		609387	"""SMC6 structural maintenance of chromosomes 6-like 1 (yeast)"""	SMC6L1		11230166	Standard	NM_024624		Approved	FLJ22116	uc002rcn.3	Q96SB8	OTTHUMG00000090675	ENST00000448223.2:c.1285C>A	2.37:g.17898069G>T	ENSP00000404092:p.Gln429Lys		A8K8Q6|D6W518|Q05BV4|Q9H0X3|Q9H6M0	Missense_Mutation	SNP	superfamily_P-loop_NTPase	p.Q455K	ENST00000448223.2	37	c.1363	CCDS1690.1	2	.	.	.	.	.	.	.	.	.	.	G	22.4	4.281232	0.80692	.	.	ENSG00000163029	ENST00000448223;ENST00000351948;ENST00000381272;ENST00000402989;ENST00000446852	T;T;T;T;T	0.30981	1.55;1.55;1.55;1.55;1.51	5.79	4.88	0.63580	RecF/RecN/SMC (1);	0.049250	0.85682	D	0.000000	T	0.46425	0.1392	L	0.58101	1.795	0.54753	D	0.999984	D;B;P	0.58970	0.984;0.34;0.793	P;B;P	0.61592	0.891;0.171;0.683	T	0.15122	-1.0448	10	0.13470	T	0.59	.	16.9484	0.86236	0.0:0.1272:0.8728:0.0	.	455;455;429	C9JMN1;Q96SB8-2;Q96SB8	.;.;SMC6_HUMAN	K	429;429;455;429;455	ENSP00000404092:Q429K;ENSP00000323439:Q429K;ENSP00000370672:Q455K;ENSP00000384539:Q429K;ENSP00000408644:Q455K	ENSP00000323439:Q429K	Q	-	1	0	SMC6	17761550	1.000000	0.71417	0.998000	0.56505	0.826000	0.46750	7.946000	0.87746	2.740000	0.93945	0.561000	0.74099	CAA	SMC6	-	superfamily_P-loop_NTPase	ENSG00000163029		0.333	SMC6-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SMC6	HGNC	protein_coding	OTTHUMT00000207359.1	-	0.00	94	0	G	NM_024624		17898069	-1	tier1	-	no_errors	ENST00000381272	ensembl	human	known	74_37	missense	8.89	40	4	SNP	1.000	T
SMG1	23049	genome.wustl.edu	37	16	18856783	18856783	+	Nonsense_Mutation	SNP	T	T	A			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr16:18856783T>A	ENST00000446231.2	-	39	6599	c.6187A>T	c.(6187-6189)Aag>Tag	p.K2063*	SMG1_ENST00000389467.3_Nonsense_Mutation_p.K2063*			Q96Q15	SMG1_HUMAN	SMG1 phosphatidylinositol 3-kinase-related kinase	2063					DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol phosphorylation (GO:0046854)|protein autophosphorylation (GO:0046777)|response to stress (GO:0006950)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(8)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(37)|ovary(1)|skin(1)|stomach(4)|urinary_tract(1)	92						CTCCCAGGCTTTGCAGGGTTC	0.428																																																	0													73.0	68.0	70.0					16																	18856783		1864	4100	5964	SO:0001587	stop_gained	0			AB061371	CCDS45430.1	16p12.3	2013-07-02	2013-07-02		ENSG00000157106	ENSG00000157106			30045	protein-coding gene	gene with protein product	"""phosphatidylinositol 3-kinase-related kinase"""	607032	"""smg-1 homolog, phosphatidylinositol 3-kinase-related kinase (C. elegans)"""			9455477, 11331269, 17229728	Standard	NM_015092		Approved	LIP, KIAA0421, ATX	uc002dfm.3	Q96Q15	OTTHUMG00000166900	ENST00000446231.2:c.6187A>T	16.37:g.18856783T>A	ENSP00000402515:p.Lys2063*		O43305|Q13284|Q8NFX2|Q96QV0|Q96RW3	Nonsense_Mutation	SNP	pfam_PI3/4_kinase_cat_dom,pfam_FATC,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_PI3/4_kinase_cat_dom,pfscan_PIK_FAT,pfscan_FATC,pfscan_PI3/4_kinase_cat_dom	p.K2063*	ENST00000446231.2	37	c.6187	CCDS45430.1	16	.	.	.	.	.	.	.	.	.	.	T	50	16.143936	0.99855	.	.	ENSG00000157106	ENST00000446231;ENST00000389467	.	.	.	5.79	5.79	0.91817	.	0.000000	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	16.1343	0.81471	0.0:0.0:0.0:1.0	.	.	.	.	X	2063	.	ENSP00000374118:K2063X	K	-	1	0	SMG1	18764284	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	8.008000	0.88588	2.209000	0.71365	0.533000	0.62120	AAG	SMG1	-	superfamily_Kinase-like_dom,superfamily_ARM-type_fold	ENSG00000157106		0.428	SMG1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SMG1	HGNC	protein_coding	OTTHUMT00000391817.1	-	0.00	68	0	T	NM_015092		18856783	-1	tier1	-	no_errors	ENST00000389467	ensembl	human	known	74_37	nonsense	11.11	40	5	SNP	1.000	A
SMG8	55181	genome.wustl.edu	37	17	57290842	57290842	+	Silent	SNP	C	C	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr17:57290842C>T	ENST00000543872.2	+	4	2922	c.2658C>T	c.(2656-2658)gaC>gaT	p.D886D	SMG8_ENST00000300917.5_Silent_p.D886D|CTD-2510F5.6_ENST00000577660.1_Intron			Q8ND04	SMG8_HUMAN	SMG8 nonsense mediated mRNA decay factor	886					gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of protein kinase activity (GO:0045859)|RNA metabolic process (GO:0016070)	cytosol (GO:0005829)				NS(1)|breast(5)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(8)|lung(9)|ovary(3)|prostate(1)|skin(1)	33						TAAATAGTGACATGCCCTTAT	0.443																																																	0													117.0	122.0	120.0					17																	57290842		2203	4300	6503	SO:0001819	synonymous_variant	0			AL834490	CCDS11615.1	17q23.2	2013-07-02	2013-07-02	2011-06-21					25551	protein-coding gene	gene with protein product		613175	"""chromosome 17 open reading frame 71"", ""smg-8 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	C17orf71		19417104	Standard	NM_018149		Approved	FLJ10587, FLJ23205	uc002ixi.3	Q8ND04		ENST00000543872.2:c.2658C>T	17.37:g.57290842C>T			Q8N5U5|Q8TDN0|Q9H5P5|Q9NVQ1	Silent	SNP	pfam_Smg8/Smg9	p.D886	ENST00000543872.2	37	c.2658	CCDS11615.1	17																																																																																			SMG8	-	pfam_Smg8/Smg9	ENSG00000167447		0.443	SMG8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMG8	HGNC	protein_coding	OTTHUMT00000445960.2	-	0.00	34	0	C	NM_018149		57290842	+1	tier1	-	no_errors	ENST00000300917	ensembl	human	known	74_37	silent	34.38	21	11	SNP	1.000	T
SMIM15	643155	genome.wustl.edu	37	5	60455836	60455836	+	Nonsense_Mutation	SNP	G	G	A			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr5:60455836G>A	ENST00000339020.3	-	3	588	c.163C>T	c.(163-165)Caa>Taa	p.Q55*	SMIM15_ENST00000507416.1_Nonsense_Mutation_p.Q55*|CTC-436P18.1_ENST00000506902.1_RNA	NM_001048249.3	NP_001041714.1	Q7Z3B0	SIM15_HUMAN	small integral membrane protein 15	55						integral component of membrane (GO:0016021)											TTCTTCTTTTGCTCCTTCTCC	0.423																																																	0													190.0	173.0	179.0					5																	60455836		2203	4300	6503	SO:0001587	stop_gained	0				CCDS34165.1	5q12	2013-06-21	2012-12-03	2012-12-03	ENSG00000188725	ENSG00000188725			33861	protein-coding gene	gene with protein product			"""chromosome 5 open reading frame 43"""	C5orf43			Standard	NM_001048249		Approved	DKFZP686E2158	uc010iwm.1	Q7Z3B0	OTTHUMG00000162241	ENST00000339020.3:c.163C>T	5.37:g.60455836G>A	ENSP00000339324:p.Gln55*		B9EJC4	Nonsense_Mutation	SNP	NULL	p.Q55*	ENST00000339020.3	37	c.163	CCDS34165.1	5	.	.	.	.	.	.	.	.	.	.	G	38	7.178243	0.98118	.	.	ENSG00000188725	ENST00000339020;ENST00000507416	.	.	.	5.22	5.22	0.72569	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.19147	T	0.46	-14.2147	18.7716	0.91894	0.0:0.0:1.0:0.0	.	.	.	.	X	55	.	ENSP00000339324:Q55X	Q	-	1	0	C5orf43	60491593	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.313000	0.96297	2.447000	0.82792	0.650000	0.86243	CAA	SMIM15	-	NULL	ENSG00000188725		0.423	SMIM15-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SMIM15	HGNC	protein_coding	OTTHUMT00000368078.1	-	0.00	55	0	G	NM_001048249		60455836	-1	tier1	-	no_errors	ENST00000339020	ensembl	human	known	74_37	nonsense	16.00	21	4	SNP	1.000	A
SMYD5	10322	genome.wustl.edu	37	2	73448309	73448309	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr2:73448309C>T	ENST00000389501.4	+	5	529	c.484C>T	c.(484-486)Cct>Tct	p.P162S	SMYD5_ENST00000474652.1_3'UTR	NM_006062.2	NP_006053.2	Q6GMV2	SMYD5_HUMAN	SMYD family member 5	162	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.						metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)			NS(1)|breast(1)|endometrium(1)|large_intestine(3)|lung(5)|pancreas(1)|upper_aerodigestive_tract(1)	13						TCACTACCCACCTGAGACTGC	0.527																																																	0													105.0	96.0	99.0					2																	73448309		2203	4300	6503	SO:0001583	missense	0			U50383	CCDS33221.2	2p12	2007-02-09	2003-05-14	2003-05-16	ENSG00000135632	ENSG00000135632		"""Zinc fingers, MYND-type"""	16258	protein-coding gene	gene with protein product			"""retinoic acid induced 15"""	RAI15		8754834	Standard	NM_006062		Approved	RRG1, NN8-4AG, ZMYND23	uc002siw.2	Q6GMV2	OTTHUMG00000150482	ENST00000389501.4:c.484C>T	2.37:g.73448309C>T	ENSP00000374152:p.Pro162Ser		D6W5H3|Q13558	Missense_Mutation	SNP	pfam_SET_dom,smart_SET_dom,pfscan_SET_dom	p.P162S	ENST00000389501.4	37	c.484	CCDS33221.2	2	.	.	.	.	.	.	.	.	.	.	C	24.1	4.494167	0.85069	.	.	ENSG00000135632	ENST00000389501;ENST00000443900	T	0.52057	0.68	5.46	5.46	0.80206	SET domain (2);	0.050959	0.85682	D	0.000000	T	0.67924	0.2945	M	0.74258	2.255	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.61802	-0.6988	10	0.18710	T	0.47	-4.9596	18.2596	0.90030	0.0:1.0:0.0:0.0	.	162	Q6GMV2	SMYD5_HUMAN	S	162;135	ENSP00000374152:P162S	ENSP00000374152:P162S	P	+	1	0	SMYD5	73301817	1.000000	0.71417	0.998000	0.56505	0.707000	0.40811	7.022000	0.76431	2.743000	0.94032	0.609000	0.83330	CCT	SMYD5	-	pfam_SET_dom,smart_SET_dom	ENSG00000135632		0.527	SMYD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMYD5	HGNC	protein_coding	OTTHUMT00000318301.1	-	0.00	29	0	C	NM_006062		73448309	+1	tier1	-	no_errors	ENST00000389501	ensembl	human	known	74_37	missense	21.43	11	3	SNP	1.000	T
SNHG14	104472715	genome.wustl.edu	37	15	25415799	25415799	+	RNA	SNP	C	C	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr15:25415799C>T	ENST00000441592.2	+	0	0				SNHG14_ENST00000553149.1_RNA|SNORD115-2_ENST00000362842.1_RNA|SNORD115-1_ENST00000364961.1_RNA					small nucleolar RNA host gene 14 (non-protein coding)																		CCCTGGCCTCCTGCACTGAGC	0.617																																																	0																																												0					15q11.2	2014-01-17	2011-08-22	2011-08-22	ENSG00000224078	ENSG00000224078		"""Long non-coding RNAs"""	37462	non-coding RNA	RNA, long non-coding	"""non-protein coding RNA 214"""		"""UBE3A antisense RNA 1 (non-protein coding)"""	UBE3A-AS1		23771028	Standard			Approved	NCRNA00214, UBE3A-AS			OTTHUMG00000056661		15.37:g.25415799C>T				RNA	SNP	-	NULL	ENST00000441592.2	37	NULL		15																																																																																			SNHG14	-	-	ENSG00000224078		0.617	SNHG14-009	KNOWN	basic	antisense	SNHG14	HGNC	processed_transcript	OTTHUMT00000126736.3	-	0.00	43	0	C			25415799	+1	tier1	-	no_errors	ENST00000553149	ensembl	human	known	74_37	rna	17.39	19	4	SNP	0.004	T
SNTG1	54212	genome.wustl.edu	37	8	51617190	51617190	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr8:51617190T>C	ENST00000522124.1	+	16	1730	c.1069T>C	c.(1069-1071)Tgc>Cgc	p.C357R	SNTG1_ENST00000276467.5_Missense_Mutation_p.C357R|SNTG1_ENST00000517473.1_Missense_Mutation_p.C357R|SNTG1_ENST00000518864.1_Missense_Mutation_p.C357R	NM_018967.2	NP_061840.1	Q9NSN8	SNTG1_HUMAN	syntrophin, gamma 1	357	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				cell communication (GO:0007154)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|ruffle membrane (GO:0032587)|syntrophin complex (GO:0016013)	protein C-terminus binding (GO:0008022)			NS(1)|breast(1)|endometrium(6)|kidney(3)|large_intestine(6)|lung(36)|ovary(6)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	66		all_cancers(86;0.00754)|all_epithelial(80;9.76e-05)|Lung NSC(129;0.000865)|all_lung(136;0.00249)|Colorectal(162;0.22)				ACGGAAACAGTGCTTCACCGT	0.547																																																	0													149.0	123.0	132.0					8																	51617190		2203	4300	6503	SO:0001583	missense	0			AJ003030	CCDS6147.1, CCDS75737.1	8q11-q12	2008-07-03				ENSG00000147481			13740	protein-coding gene	gene with protein product		608714				10747910	Standard	NM_018967		Approved	SYN4, G1SYN	uc003xqs.1	Q9NSN8		ENST00000522124.1:c.1069T>C	8.37:g.51617190T>C	ENSP00000429842:p.Cys357Arg		Q2M3Q0|Q9NY98	Missense_Mutation	SNP	pfam_PDZ,superfamily_PDZ,smart_PDZ,smart_Pleckstrin_homology,pfscan_PDZ,pfscan_Pleckstrin_homology	p.C357R	ENST00000522124.1	37	c.1069	CCDS6147.1	8	.	.	.	.	.	.	.	.	.	.	T	18.47	3.631871	0.67015	.	.	ENSG00000147481	ENST00000518864;ENST00000522124;ENST00000517473;ENST00000276467	T;T;T;T	0.34275	1.37;1.37;1.37;1.37	5.19	5.19	0.71726	Pleckstrin homology-type (1);Pleckstrin homology domain (2);	0.000000	0.85682	D	0.000000	T	0.59183	0.2175	M	0.76170	2.325	0.80722	D	1	P;P	0.47604	0.898;0.612	D;B	0.64321	0.924;0.188	T	0.63545	-0.6613	10	0.87932	D	0	-16.2713	14.5341	0.67947	0.0:0.0:0.0:1.0	.	357;357	Q9NSN8-2;Q9NSN8	.;SNTG1_HUMAN	R	357	ENSP00000429276:C357R;ENSP00000429842:C357R;ENSP00000431123:C357R;ENSP00000276467:C357R	ENSP00000276467:C357R	C	+	1	0	SNTG1	51779743	1.000000	0.71417	0.999000	0.59377	0.650000	0.38633	4.599000	0.61076	2.083000	0.62718	0.523000	0.50628	TGC	SNTG1	-	smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	ENSG00000147481		0.547	SNTG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNTG1	HGNC	protein_coding	OTTHUMT00000377964.1	-	0.00	29	0	T			51617190	+1	tier1	-	no_errors	ENST00000518864	ensembl	human	known	74_37	missense	28.57	15	6	SNP	1.000	C
SOX10	6663	genome.wustl.edu	37	22	38374120	38374120	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr22:38374120G>C	ENST00000396884.2	-	3	733	c.451C>G	c.(451-453)Cgc>Ggc	p.R151G	SOX10_ENST00000470555.1_5'UTR|SOX10_ENST00000360880.2_Missense_Mutation_p.R151G|POLR2F_ENST00000407936.1_Intron|POLR2F_ENST00000405557.1_Intron	NM_006941.3	NP_008872.1	P56693	SOX10_HUMAN	SRY (sex determining region Y)-box 10	151					anatomical structure morphogenesis (GO:0009653)|cell maturation (GO:0048469)|developmental growth (GO:0048589)|digestive tract morphogenesis (GO:0048546)|enteric nervous system development (GO:0048484)|in utero embryonic development (GO:0001701)|melanocyte differentiation (GO:0030318)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of transcription, DNA-templated (GO:0045892)|neural crest cell migration (GO:0001755)|oligodendrocyte differentiation (GO:0048709)|peripheral nervous system development (GO:0007422)|positive regulation of gliogenesis (GO:0014015)|positive regulation of neuroblast proliferation (GO:0002052)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	extrinsic component of mitochondrial outer membrane (GO:0031315)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|identical protein binding (GO:0042802)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|transcription coactivator activity (GO:0003713)			NS(6)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(4)|skin(2)	20	Melanoma(58;0.045)					ATGAAGGGGCGCTTGTCACTT	0.637																																					Melanoma(39;342 1098 6220 32775 40068)|GBM(21;140 497 5227 16059 19275)												0													19.0	18.0	18.0					22																	38374120		2203	4300	6503	SO:0001583	missense	0				CCDS13964.1	22q13.1	2014-09-17			ENSG00000100146	ENSG00000100146		"""SRY (sex determining region Y)-boxes"""	11190	protein-coding gene	gene with protein product	"""dominant megacolon, mouse, human homolog of"""	602229				9462749, 10441344, 12944398	Standard	NM_006941		Approved	DOM, WS4, WS2E	uc003aun.1	P56693	OTTHUMG00000149913	ENST00000396884.2:c.451C>G	22.37:g.38374120G>C	ENSP00000380093:p.Arg151Gly		B4DV62|Q6FHW7	Missense_Mutation	SNP	pfam_Sox_N,pfam_HMG_box_dom,superfamily_HMG_box_dom,smart_HMG_box_dom,pfscan_HMG_box_dom	p.R151G	ENST00000396884.2	37	c.451	CCDS13964.1	22	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.99|18.99	3.740726|3.740726	0.69304|0.69304	.|.	.|.	ENSG00000100146|ENSG00000100146	ENST00000396884;ENST00000360880;ENST00000416937;ENST00000427770|ENST00000446929	D;D;D|.	0.98012|.	-4.66;-4.66;-4.66|.	4.45|4.45	3.33|3.33	0.38152|0.38152	High mobility group, superfamily (1);High mobility group, HMG1/HMG2 (4);|.	0.000000|.	0.64402|.	D|.	0.000001|.	T|T	0.69931|0.69931	0.3166|0.3166	M|M	0.67517|0.67517	2.055|2.055	0.80722|0.80722	D|D	1|1	D|.	0.65815|.	0.995|.	D|.	0.70935|.	0.971|.	T|T	0.70669|0.70669	-0.4808|-0.4808	10|5	0.87932|.	D|.	0|.	.|.	13.2882|13.2882	0.60255|0.60255	0.0:0.0:0.7347:0.2653|0.0:0.0:0.7347:0.2653	.|.	151|.	P56693|.	SOX10_HUMAN|.	G|R	151|27	ENSP00000380093:R151G;ENSP00000354130:R151G;ENSP00000414853:R151G|.	ENSP00000354130:R151G|.	R|S	-|-	1|3	0|2	SOX10|SOX10	36704066|36704066	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.969000|0.969000	0.65631|0.65631	4.493000|4.493000	0.60341|0.60341	2.020000|2.020000	0.59435|0.59435	0.455000|0.455000	0.32223|0.32223	CGC|AGC	SOX10	-	pfam_HMG_box_dom,superfamily_HMG_box_dom,smart_HMG_box_dom,pfscan_HMG_box_dom	ENSG00000100146		0.637	SOX10-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SOX10	HGNC	protein_coding	OTTHUMT00000313875.1	-	0.00	23	0	G	NM_006941		38374120	-1	tier1	-	no_errors	ENST00000360880	ensembl	human	known	74_37	missense	22.22	14	4	SNP	1.000	C
SPATA6	54558	genome.wustl.edu	37	1	48821377	48821377	+	Silent	SNP	A	A	G			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr1:48821377A>G	ENST00000371847.3	-	11	1323	c.1159T>C	c.(1159-1161)Ttg>Ctg	p.L387L	SPATA6_ENST00000371843.3_Intron|SPATA6_ENST00000396199.3_Silent_p.L315L	NM_019073.2	NP_061946.1	Q9NWH7	SPAT6_HUMAN	spermatogenesis associated 6	387					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	extracellular region (GO:0005576)				breast(1)|endometrium(2)|large_intestine(6)|lung(7)|ovary(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	21						TGTGATTTCAAGACATTTTTT	0.313																																																	0													93.0	94.0	94.0					1																	48821377		2203	4300	6503	SO:0001819	synonymous_variant	0			AK000869	CCDS551.1, CCDS65535.1, CCDS72787.1	1p32.3	2012-03-15			ENSG00000132122	ENSG00000132122			18309	protein-coding gene	gene with protein product	"""spermatogenesis-related factor-1"""	613947					Standard	XM_005270948		Approved	SRF1, FLJ10007, SRF-1	uc001crr.2	Q9NWH7	OTTHUMG00000007794	ENST00000371847.3:c.1159T>C	1.37:g.48821377A>G			Q5T3N7|Q8WUE6	Silent	SNP	NULL	p.L387	ENST00000371847.3	37	c.1159	CCDS551.1	1																																																																																			SPATA6	-	NULL	ENSG00000132122		0.313	SPATA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPATA6	HGNC	protein_coding	OTTHUMT00000021347.1		0.00	36	0	A	NM_019073		48821377	-1			no_errors	ENST00000371847	ensembl	human	known	74_37	silent	6.06	31	2	SNP	1.000	G
SPDYA	245711	genome.wustl.edu	37	2	29045256	29045256	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr2:29045256G>T	ENST00000334056.5	+	5	549	c.360G>T	c.(358-360)agG>agT	p.R120S	SPDYA_ENST00000379579.4_Missense_Mutation_p.R120S|SPDYA_ENST00000462832.1_3'UTR	NM_182756.3	NP_877433.2			speedy/RINGO cell cycle regulator family member A											cervix(1)|endometrium(1)|large_intestine(2)|lung(1)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	9	Acute lymphoblastic leukemia(172;0.155)					AGCATACCAGGATAAATTTCT	0.259																																																	0													48.0	49.0	49.0					2																	29045256		2177	4245	6422	SO:0001583	missense	0			AA424209	CCDS1767.2	2p23	2013-05-08	2013-05-08	2006-03-31	ENSG00000163806	ENSG00000163806		"""Speedy homologs"""	30613	protein-coding gene	gene with protein product		614029	"""speedy homolog 1 (Drosophila)"", ""speedy homolog A (Xenopus laevis)"""	SPDY1		11980914, 12839962, 15611625	Standard	NM_182756		Approved	SPY1, Ringo3	uc002rmk.3	Q5MJ70	OTTHUMG00000074041	ENST00000334056.5:c.360G>T	2.37:g.29045256G>T	ENSP00000335628:p.Arg120Ser			Missense_Mutation	SNP	pfam_Cell_cycle_regulatory_Spy1	p.R120S	ENST00000334056.5	37	c.360	CCDS1767.2	2	.	.	.	.	.	.	.	.	.	.	G	15.28	2.785672	0.49997	.	.	ENSG00000163806	ENST00000379579;ENST00000334056;ENST00000449210	.	.	.	5.32	4.43	0.53597	.	0.119778	0.51477	U	0.000088	T	0.65048	0.2654	M	0.80183	2.485	0.52501	D	0.999955	B;B	0.33528	0.416;0.363	B;B	0.35859	0.212;0.135	T	0.70992	-0.4721	9	0.72032	D	0.01	-41.923	12.5624	0.56288	0.1294:0.0:0.8706:0.0	.	120;120	Q5MJ70;Q5MJ70-1	SPDYA_HUMAN;.	S	120	.	ENSP00000335628:R120S	R	+	3	2	SPDYA	28898760	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.031000	0.41117	2.642000	0.89623	0.585000	0.79938	AGG	SPDYA	-	pfam_Cell_cycle_regulatory_Spy1	ENSG00000163806		0.259	SPDYA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SPDYA	HGNC	protein_coding	OTTHUMT00000157171.1	-	0.00	94	0	G	NM_182756		29045256	+1	tier1	-	no_errors	ENST00000334056	ensembl	human	known	74_37	missense	6.35	59	4	SNP	1.000	T
SPATS2L	26010	genome.wustl.edu	37	2	201342432	201342432	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr2:201342432C>T	ENST00000358677.5	+	13	1602	c.1355C>T	c.(1354-1356)tCg>tTg	p.S452L	SPATS2L_ENST00000460095.1_3'UTR|SPATS2L_ENST00000360760.5_Missense_Mutation_p.S383L|SPATS2L_ENST00000409385.1_Missense_Mutation_p.S392L|SPATS2L_ENST00000409140.3_Missense_Mutation_p.S452L|SPATS2L_ENST00000409755.3_Missense_Mutation_p.S482L|SPATS2L_ENST00000409151.1_Missense_Mutation_p.S460L|SPATS2L_ENST00000409718.1_Missense_Mutation_p.S452L|SPATS2L_ENST00000451764.2_Missense_Mutation_p.S452L|SPATS2L_ENST00000409988.3_Missense_Mutation_p.S452L	NM_001282735.1|NM_001282743.1|NM_001282744.1|NM_015535.2	NP_001269664.1|NP_001269672.1|NP_001269673.1|NP_056350.2	Q9NUQ6	SPS2L_HUMAN	spermatogenesis associated, serine-rich 2-like	452						cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|protein complex (GO:0043234)	poly(A) RNA binding (GO:0044822)			endometrium(1)|kidney(1)|lung(4)|ovary(2)|pancreas(1)|prostate(1)	10						CCTGCCAAGTCGCAGGGCAGT	0.493																																																	0													16.0	20.0	19.0					2																	201342432		1946	4134	6080	SO:0001583	missense	0			AF193059	CCDS46483.1, CCDS46484.1, CCDS74621.1, CCDS74622.1	2q33.1	2009-06-12			ENSG00000196141	ENSG00000196141			24574	protein-coding gene	gene with protein product	"""DNA polymerase transactivated protein 6"""	613817				11230166	Standard	NM_001100422		Approved	DNAPTP6	uc002uvr.4	Q9NUQ6	OTTHUMG00000154589	ENST00000358677.5:c.1355C>T	2.37:g.201342432C>T	ENSP00000351503:p.Ser452Leu		A8K381|B4DRE6|B4DT67|B7WNZ7|Q53T22|Q8WV53|Q8WYG1|Q9NTW4	Missense_Mutation	SNP	pfam_DUF1387,superfamily_UBA-like	p.S482L	ENST00000358677.5	37	c.1445	CCDS46483.1	2	.	.	.	.	.	.	.	.	.	.	C	8.684	0.905723	0.17760	.	.	ENSG00000196141	ENST00000409718;ENST00000358677;ENST00000409988;ENST00000409385;ENST00000451764;ENST00000360760;ENST00000409140;ENST00000409755;ENST00000409151	.	.	.	5.65	2.65	0.31530	.	0.508271	0.18468	N	0.140310	T	0.25644	0.0624	N	0.19112	0.55	0.09310	N	0.999995	B;B;B	0.06786	0.001;0.001;0.0	B;B;B	0.06405	0.001;0.002;0.001	T	0.19160	-1.0314	9	0.66056	D	0.02	-0.0106	6.7436	0.23449	0.1393:0.7066:0.0:0.1541	.	482;383;452	B4DT67;Q9NUQ6-2;Q9NUQ6	.;.;SPS2L_HUMAN	L	452;452;452;392;452;383;452;482;460	.	ENSP00000351503:S452L	S	+	2	0	SPATS2L	201050677	0.189000	0.23263	0.204000	0.23530	0.791000	0.44710	1.259000	0.32956	0.386000	0.24997	0.655000	0.94253	TCG	SPATS2L	-	NULL	ENSG00000196141		0.493	SPATS2L-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SPATS2L	HGNC	protein_coding	OTTHUMT00000336208.3		0.00	35	0	C	NM_015535		201342432	+1			no_errors	ENST00000409755	ensembl	human	known	74_37	missense	8.57	32	3	SNP	0.326	T
SPTBN5	51332	genome.wustl.edu	37	15	42169048	42169048	+	Silent	SNP	G	G	A			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr15:42169048G>A	ENST00000320955.6	-	19	4037	c.3810C>T	c.(3808-3810)caC>caT	p.H1270H		NM_016642.2	NP_057726.4	Q9NRC6	SPTN5_HUMAN	spectrin, beta, non-erythrocytic 5	1270					actin cytoskeleton organization (GO:0030036)|actin filament capping (GO:0051693)|axon guidance (GO:0007411)|Golgi organization (GO:0007030)|lysosomal transport (GO:0007041)|protein homooligomerization (GO:0051260)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|photoreceptor connecting cilium (GO:0032391)|photoreceptor disc membrane (GO:0097381)|spectrin (GO:0008091)	actin binding (GO:0003779)|dynactin binding (GO:0034452)|dynein intermediate chain binding (GO:0045505)|kinesin binding (GO:0019894)|myosin tail binding (GO:0032029)|protein self-association (GO:0043621)|spectrin binding (GO:0030507)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(6)|lung(18)|ovary(5)|prostate(8)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	62		all_cancers(109;1.84e-17)|all_epithelial(112;1.12e-15)|Lung NSC(122;7.6e-10)|all_lung(180;4.15e-09)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.173)		all cancers(2;4.33e-34)|Epithelial(2;1.72e-25)|OV - Ovarian serous cystadenocarcinoma(18;8.32e-20)|GBM - Glioblastoma multiforme(94;4.69e-07)|Colorectal(2;0.00104)|COAD - Colon adenocarcinoma(120;0.0405)|READ - Rectum adenocarcinoma(92;0.0908)		GCTTCTCGCCGTGTGCCCGCA	0.667																																																	0													30.0	38.0	35.0					15																	42169048		2087	4208	6295	SO:0001819	synonymous_variant	0			AF233523	CCDS61599.1	15q21	2010-08-17			ENSG00000137877	ENSG00000137877			15680	protein-coding gene	gene with protein product	"""beta V spectrin"""	605916				10764729	Standard	NM_016642		Approved	HUSPECV, BSPECV, HUBSPECV	uc001zos.4	Q9NRC6		ENST00000320955.6:c.3810C>T	15.37:g.42169048G>A				Silent	SNP	pfam_Spectrin_repeat,pfam_CH-domain,superfamily_CH-domain,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Pleckstrin_homology,pfscan_CH-domain,pfscan_Pleckstrin_homology	p.H1270	ENST00000320955.6	37	c.3810		15																																																																																			SPTBN5	-	pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin	ENSG00000137877		0.667	SPTBN5-001	KNOWN	basic|appris_principal	protein_coding	SPTBN5	HGNC	protein_coding	OTTHUMT00000420237.1	-	0.00	44	0	G	NM_016642		42169048	-1	tier1	-	no_errors	ENST00000320955	ensembl	human	known	74_37	silent	14.29	18	3	SNP	0.000	A
SRCIN1	80725	genome.wustl.edu	37	17	36719671	36719671	+	Missense_Mutation	SNP	T	T	A			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr17:36719671T>A	ENST00000264659.7	-	5	852	c.628A>T	c.(628-630)Atc>Ttc	p.I210F	SRCIN1_ENST00000398579.4_5'UTR|SRCIN1_ENST00000578925.1_Missense_Mutation_p.I244F	NM_025248.2	NP_079524.2	Q9C0H9	SRCN1_HUMAN	SRC kinase signaling inhibitor 1	82					exocytosis (GO:0006887)|negative regulation of protein tyrosine kinase activity (GO:0061099)|positive regulation of protein tyrosine kinase activity (GO:0061098)|regulation of cell migration (GO:0030334)|regulation of dendritic spine morphogenesis (GO:0061001)|substrate adhesion-dependent cell spreading (GO:0034446)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	protein kinase binding (GO:0019901)			endometrium(2)|kidney(1)|large_intestine(6)|lung(9)|prostate(1)	19						ATGTGCGCGATGAGTGCGTGC	0.607																																																	0													47.0	51.0	50.0					17																	36719671		2187	4267	6454	SO:0001583	missense	0				CCDS45660.1	17q12	2009-12-14			ENSG00000017373	ENSG00000277363			29506	protein-coding gene	gene with protein product	"""p130Cas-associated protein"", ""SNAP-25-interacting protein"""	610786				11214970	Standard	NM_025248		Approved	SNIP, p140Cap, KIAA1684	uc002hqd.3	Q9C0H9		ENST00000264659.7:c.628A>T	17.37:g.36719671T>A	ENSP00000264659:p.Ile210Phe		Q75T46|Q8N4W8	Missense_Mutation	SNP	pfam_AIP3_C	p.I210F	ENST00000264659.7	37	c.628	CCDS45660.1	17	.	.	.	.	.	.	.	.	.	.	T	12.32	1.904068	0.33628	.	.	ENSG00000017373	ENST00000264659;ENST00000398579	T	0.58060	0.36	5.0	3.92	0.45320	.	0.000000	0.85682	D	0.000000	T	0.48502	0.1503	N	0.16790	0.44	0.52099	D	0.999947	P;D;D;D	0.89917	0.917;0.971;0.971;1.0	P;P;P;D	0.87578	0.804;0.835;0.835;0.998	T	0.49062	-0.8978	10	0.02654	T	1	-16.6874	9.9255	0.41489	0.0:0.0826:0.0:0.9174	.	64;82;82;210	B4DHC2;Q9C0H9-2;Q9C0H9;Q9C0H9-5	.;.;SRCN1_HUMAN;.	F	210;64	ENSP00000264659:I210F	ENSP00000264659:I210F	I	-	1	0	SRCIN1	33973197	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.951000	0.70273	0.859000	0.35456	0.528000	0.53228	ATC	SRCIN1	-	pfam_AIP3_C	ENSG00000017373		0.607	SRCIN1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SRCIN1	HGNC	protein_coding	OTTHUMT00000441878.4	-	0.00	48	0	T	NM_025248		36719671	-1	tier1	-	no_errors	ENST00000264659	ensembl	human	known	74_37	missense	18.18	18	4	SNP	1.000	A
SRMS	6725	genome.wustl.edu	37	20	62178745	62178745	+	Silent	SNP	G	G	A			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr20:62178745G>A	ENST00000217188.1	-	1	112	c.72C>T	c.(70-72)ggC>ggT	p.G24G		NM_080823.2	NP_543013.1	Q9H3Y6	SRMS_HUMAN	src-related kinase lacking C-terminal regulatory tyrosine and N-terminal myristylation sites	24	N-terminal.				peptidyl-tyrosine autophosphorylation (GO:0038083)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(1)|lung(9)|prostate(2)|stomach(1)	19	all_cancers(38;2.51e-11)|all_epithelial(29;8.27e-13)		Epithelial(9;9.69e-09)|all cancers(9;5.84e-08)|BRCA - Breast invasive adenocarcinoma(10;3.63e-06)			GGTCCGGCTCGCCGCCCGCCG	0.706																																																	0													40.0	46.0	44.0					20																	62178745		2136	4156	6292	SO:0001819	synonymous_variant	0				CCDS13525.1	20q13.33	2013-02-14	2003-08-22		ENSG00000125508	ENSG00000125508		"""SH2 domain containing"""	11298	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 148"""	C20orf148		7935409	Standard	NM_080823		Approved	SRM, dJ697K14.1	uc002yfi.1	Q9H3Y6	OTTHUMG00000032977	ENST00000217188.1:c.72C>T	20.37:g.62178745G>A				Silent	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_SH2,superfamily_Kinase-like_dom,superfamily_SH3_domain,smart_SH3_domain,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_SH2,pfscan_SH3_domain,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_SH2	p.G24	ENST00000217188.1	37	c.72	CCDS13525.1	20																																																																																			SRMS	-	NULL	ENSG00000125508		0.706	SRMS-001	KNOWN	mRNA_end_NF|basic|appris_principal|CCDS	protein_coding	SRMS	HGNC	protein_coding	OTTHUMT00000080148.1		0.00	41	0	G	NM_080823		62178745	-1			no_errors	ENST00000217188	ensembl	human	known	74_37	silent	29.63	15	8	SNP	0.000	A
SRP54	6729	genome.wustl.edu	37	14	35465940	35465940	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr14:35465940A>C	ENST00000556994.1	+	3	422	c.25A>C	c.(25-27)Aaa>Caa	p.K9Q	SRP54_ENST00000216774.6_Missense_Mutation_p.K9Q|SRP54_ENST00000555535.1_3'UTR|SRP54_ENST00000555557.1_5'UTR|SRP54_ENST00000546080.1_5'UTR			P61011	SRP54_HUMAN	signal recognition particle 54kDa	9	G-domain.				cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|GTP catabolic process (GO:0006184)|protein targeting to ER (GO:0045047)|response to drug (GO:0042493)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|SRP-dependent cotranslational protein targeting to membrane, signal sequence recognition (GO:0006617)|SRP-dependent cotranslational protein targeting to membrane, translocation (GO:0006616)|translation (GO:0006412)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleolus (GO:0005730)|nucleus (GO:0005634)|signal recognition particle, endoplasmic reticulum targeting (GO:0005786)	7S RNA binding (GO:0008312)|drug binding (GO:0008144)|endoplasmic reticulum signal peptide binding (GO:0030942)|GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)|ribonucleoprotein complex binding (GO:0043021)			NS(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	14	Breast(36;0.0545)|Hepatocellular(127;0.158)		LUAD - Lung adenocarcinoma(48;2.48e-05)|Lung(238;3.13e-05)|Epithelial(34;0.0314)|all cancers(34;0.0797)|BRCA - Breast invasive adenocarcinoma(188;0.243)	GBM - Glioblastoma multiforme(112;0.0396)		CCTTGGAAGAAAAATAACATC	0.318																																																	0													118.0	124.0	122.0					14																	35465940		2203	4300	6503	SO:0001583	missense	0			X86373	CCDS9652.1, CCDS53893.1	14q13.2	2014-06-02	2002-08-29		ENSG00000100883	ENSG00000100883			11301	protein-coding gene	gene with protein product		604857	"""signal recognition particle 54kD"""			8722571	Standard	NM_003136		Approved		uc001wso.3	P61011	OTTHUMG00000140214	ENST00000556994.1:c.25A>C	14.37:g.35465940A>C	ENSP00000451818:p.Lys9Gln		B2R759|B4DUW6|P13624	Missense_Mutation	SNP	pfam_SRP54_GTPase_dom,pfam_Signal_recog_particle_SRP54_M,pfam_Signal_recog_particl_SRP54_hlx,pfam_CobW/HypB/UreG_dom,pfam_CobQ/CobB/MinD/ParA_Nub-bd_dom,superfamily_P-loop_NTPase,superfamily_Signal_recog_particle_SRP54_M,superfamily_Signal_recog_particl_SRP54_hlx,smart_Signal_recog_particl_SRP54_hlx,smart_AAA+_ATPase,smart_SRP54_GTPase_dom,tigrfam_SRP54_euk	p.K9Q	ENST00000556994.1	37	c.25	CCDS9652.1	14	.	.	.	.	.	.	.	.	.	.	A	23.9	4.465070	0.84425	.	.	ENSG00000100883	ENST00000556994;ENST00000554803;ENST00000555746;ENST00000216774	.	.	.	6.04	6.04	0.98038	Signal recognition particle, SRP54 subunit, helical bundle (4);	0.000000	0.85682	D	0.000000	T	0.72700	0.3493	M	0.63208	1.945	0.80722	D	1	D	0.59767	0.986	P	0.56916	0.809	T	0.72225	-0.4355	9	0.40728	T	0.16	-22.2933	16.2378	0.82389	1.0:0.0:0.0:0.0	.	9	P61011	SRP54_HUMAN	Q	9	.	ENSP00000216774:K9Q	K	+	1	0	SRP54	34535691	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.062000	0.89475	2.317000	0.78254	0.459000	0.35465	AAA	SRP54	-	pfam_Signal_recog_particl_SRP54_hlx,superfamily_Signal_recog_particl_SRP54_hlx,smart_Signal_recog_particl_SRP54_hlx,tigrfam_SRP54_euk	ENSG00000100883		0.318	SRP54-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRP54	HGNC	protein_coding	OTTHUMT00000276643.2		0.00	52	0	A	NM_003136		35465940	+1			no_errors	ENST00000216774	ensembl	human	known	74_37	missense	5.71	33	2	SNP	1.000	C
PMS2P4	5382	genome.wustl.edu	37	7	66767611	66767611	+	RNA	DEL	T	T	-	rs12531701	byFrequency	TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr7:66767611delT	ENST00000414507.1	-	0	0				STAG3L4_ENST00000416602.2_RNA					postmeiotic segregation increased 2 pseudogene 4																		ACCGGACTGCTTTTTTTTTTT	0.542																																																	0																																												0			D38438		7q11.22	2010-10-26	2010-10-26	2010-10-26	ENSG00000067601	ENSG00000067601			9129	pseudogene	pseudogene	"""PMS2 pseudogene"""		"""postmeiotic segregation increased 2-like 4"", ""postmeiotic segregation increased 2-like 4 pseudogene"""	PMS2L4		8586419	Standard	NR_046297		Approved	PMS6	uc003tvo.3		OTTHUMG00000156923		7.37:g.66767611delT				RNA	DEL	-	NULL	ENST00000414507.1	37	NULL		7																																																																																			STAG3L4	-	-	ENSG00000106610		0.542	PMS2P4-002	KNOWN	basic	processed_transcript	STAG3L4	HGNC	pseudogene	OTTHUMT00000346632.1		0.00	86	0	T	NR_022007		66767611	+1	tier1		no_errors	ENST00000416602	ensembl	human	known	74_37	rna	11.76	45	6	DEL	0.034	-
STK39	27347	genome.wustl.edu	37	2	168810763	168810763	+	3'UTR	SNP	C	C	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr2:168810763C>T	ENST00000355999.4	-	0	3586				STK39_ENST00000487143.1_5'UTR	NM_013233.2	NP_037365.2	Q9UEW8	STK39_HUMAN	serine threonine kinase 39						cellular hypotonic response (GO:0071476)|intracellular signal transduction (GO:0035556)|negative regulation of potassium ion transmembrane transport (GO:1901380)|negative regulation of potassium ion transmembrane transporter activity (GO:1901017)|negative regulation of rubidium ion transmembrane transporter activity (GO:2000687)|negative regulation of rubidium ion transport (GO:2000681)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of potassium ion transport (GO:0043268)|protein phosphorylation (GO:0006468)|regulation of inflammatory response (GO:0050727)|response to stress (GO:0006950)|signal transduction by phosphorylation (GO:0023014)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein serine/threonine kinase activity (GO:0004702)			central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(3)|prostate(2)|skin(2)	13						TAGGAAAGAGCAATGGTACCA	0.363																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AF099989	CCDS42770.1	2q24.3	2010-06-25	2010-06-25		ENSG00000198648	ENSG00000198648			17717	protein-coding gene	gene with protein product	"""STE20/SPS1 homolog (yeast)"""	607648				10980603	Standard	NM_013233		Approved	DCHT, SPAK	uc002uea.3	Q9UEW8	OTTHUMG00000133745	ENST00000355999.4:c.*1243G>A	2.37:g.168810763C>T			O14774|Q53S90|Q53SL7|Q53SS1|Q9UER4|X5D9C8	RNA	SNP	-	NULL	ENST00000355999.4	37	NULL	CCDS42770.1	2																																																																																			STK39	-	-	ENSG00000198648		0.363	STK39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STK39	HGNC	protein_coding	OTTHUMT00000258112.2	-	0.00	62	0	C	NM_013233		168810763	-1	tier1	-	no_errors	ENST00000487143	ensembl	human	known	74_37	rna	9.52	38	4	SNP	1.000	T
STOX1	219736	genome.wustl.edu	37	10	70646130	70646130	+	Missense_Mutation	SNP	G	G	C	rs201329017		TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr10:70646130G>C	ENST00000298596.6	+	3	2661	c.2578G>C	c.(2578-2580)Gca>Cca	p.A860P	STOX1_ENST00000399169.4_Missense_Mutation_p.A860P|STOX1_ENST00000421961.2_Missense_Mutation_p.A750P|STOX1_ENST00000399165.4_Intron|STOX1_ENST00000399162.2_Intron	NM_152709.4	NP_689922.3	Q6ZVD7	STOX1_HUMAN	storkhead box 1	860						cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(5)|endometrium(2)|kidney(2)|large_intestine(5)|liver(2)|lung(8)|prostate(1)|skin(3)	28						TTACTATAGCGCAAGAAAAGC	0.443																																																	0													84.0	83.0	84.0					10																	70646130		2007	4208	6215	SO:0001583	missense	0			AK057891	CCDS41535.1, CCDS44416.1, CCDS44417.1	10q22.1	2005-11-29	2005-04-04	2005-04-04	ENSG00000165730	ENSG00000165730			23508	protein-coding gene	gene with protein product		609397	"""chromosome 10 open reading frame 24"""	C10orf24			Standard	NM_152709		Approved	FLJ25162	uc001joq.3	Q6ZVD7	OTTHUMG00000018367	ENST00000298596.6:c.2578G>C	10.37:g.70646130G>C	ENSP00000298596:p.Ala860Pro		A2A3Q9|A5D6Y7|B0QZA4|B0QZA5|B0QZA6|Q4F8Q6|Q5I946|Q5I947|Q5I948|Q5VX38|Q5VX39|Q6ZRY3|Q96LR3|Q96LS0	Missense_Mutation	SNP	pfam_Storkhead-box_winged-helix	p.A860P	ENST00000298596.6	37	c.2578	CCDS41535.1	10	.	.	.	.	.	.	.	.	.	.	G	7.258	0.604641	0.14002	.	.	ENSG00000165730	ENST00000399169;ENST00000298596;ENST00000421961	T;T;T	0.65364	-0.15;-0.15;-0.15	6.17	-0.625	0.11548	.	0.603254	0.18611	N	0.136143	T	0.39682	0.1087	N	0.08118	0	0.09310	N	1	D	0.55385	0.971	P	0.46320	0.512	T	0.40515	-0.9559	10	0.66056	D	0.02	.	5.9317	0.19142	0.3639:0.0:0.4232:0.2129	.	860	Q6ZVD7	STOX1_HUMAN	P	860;860;750	ENSP00000382121:A860P;ENSP00000298596:A860P;ENSP00000394509:A750P	ENSP00000298596:A860P	A	+	1	0	STOX1	70316136	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.049000	0.11924	-0.292000	0.08999	-0.982000	0.02568	GCA	STOX1	-	NULL	ENSG00000165730		0.443	STOX1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	STOX1	HGNC	protein_coding	OTTHUMT00000276849.3	-	0.00	25	0	G	NM_152709		70646130	+1	tier1	-	no_errors	ENST00000298596	ensembl	human	known	74_37	missense	23.81	16	5	SNP	0.001	C
SUSD4	55061	genome.wustl.edu	37	1	223438154	223438154	+	Missense_Mutation	SNP	A	A	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr1:223438154A>T	ENST00000343846.3	-	4	1175	c.542T>A	c.(541-543)cTg>cAg	p.L181Q	SUSD4_ENST00000494793.2_Missense_Mutation_p.L181Q|SUSD4_ENST00000344029.6_Missense_Mutation_p.L181Q|SUSD4_ENST00000484758.2_Missense_Mutation_p.L110Q|SUSD4_ENST00000366878.4_Missense_Mutation_p.L181Q|SUSD4_ENST00000478605.1_5'UTR|SUSD4_ENST00000454695.2_Missense_Mutation_p.L21Q			Q5VX71	SUSD4_HUMAN	sushi domain containing 4	181	Sushi 3. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)				cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(5)|liver(1)|lung(5)|skin(1)	17				GBM - Glioblastoma multiforme(131;0.0611)		TAGAGGTCTCAGGCAGCCTGT	0.483																																																	0													49.0	53.0	51.0					1																	223438154		2203	4300	6503	SO:0001583	missense	0			AK096265	CCDS31034.1, CCDS41471.1	1q41	2008-05-14			ENSG00000143502	ENSG00000143502			25470	protein-coding gene	gene with protein product		615827				12477932	Standard	NM_017982		Approved	FLJ10052	uc001hny.4	Q5VX71	OTTHUMG00000037936	ENST00000343846.3:c.542T>A	1.37:g.223438154A>T	ENSP00000344219:p.Leu181Gln		D3DTB9|Q6UX62|Q9BSR0|Q9NWG0	Missense_Mutation	SNP	pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	p.L181Q	ENST00000343846.3	37	c.542	CCDS41471.1	1	.	.	.	.	.	.	.	.	.	.	A	11.39	1.624831	0.28889	.	.	ENSG00000143502	ENST00000343846;ENST00000366878;ENST00000542750;ENST00000454695;ENST00000271787;ENST00000344029	T;T;T;T	0.64803	-0.12;-0.12;-0.12;-0.12	5.45	5.45	0.79879	Complement control module (2);Sushi/SCR/CCP (3);	0.000000	0.37053	N	0.002272	T	0.69984	0.3172	L	0.45422	1.42	0.80722	D	1	D;D;D	0.89917	0.999;0.999;1.0	D;D;D	0.83275	0.987;0.996;0.991	T	0.64041	-0.6500	10	0.12430	T	0.62	-17.4256	14.8509	0.70295	1.0:0.0:0.0:0.0	.	110;181;181	B7Z369;Q5VX71-3;Q5VX71	.;.;SUSD4_HUMAN	Q	181;181;110;21;181;181	ENSP00000344219:L181Q;ENSP00000355843:L181Q;ENSP00000399288:L21Q;ENSP00000339926:L181Q	ENSP00000271787:L181Q	L	-	2	0	SUSD4	221504777	1.000000	0.71417	1.000000	0.80357	0.336000	0.28762	6.997000	0.76270	2.287000	0.76781	0.482000	0.46254	CTG	SUSD4	-	pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	ENSG00000143502		0.483	SUSD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SUSD4	HGNC	protein_coding	OTTHUMT00000092592.2	-	0.00	26	0	A	NM_017982		223438154	-1	tier1	-	no_errors	ENST00000343846	ensembl	human	known	74_37	missense	40.00	9	6	SNP	1.000	T
SWI5	375757	genome.wustl.edu	37	9	131046829	131046829	+	Missense_Mutation	SNP	A	A	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr9:131046829A>T	ENST00000320188.5	+	3	467	c.467A>T	c.(466-468)gAg>gTg	p.E156V	SWI5_ENST00000608796.1_Missense_Mutation_p.E91V|SWI5_ENST00000495313.1_Missense_Mutation_p.E60V|SWI5_ENST00000418976.1_Missense_Mutation_p.E51V|SWI5_ENST00000419867.2_Missense_Mutation_p.E91V	NM_001040011.1	NP_001035100.1	Q1ZZU3	SWI5_HUMAN	SWI5 recombination repair homolog (yeast)	156					cellular response to ionizing radiation (GO:0071479)|double-strand break repair via homologous recombination (GO:0000724)	nucleus (GO:0005634)|Swi5-Sfr1 complex (GO:0032798)											GGGACCAGCGAGGAGTCTCTG	0.507																																																	0													123.0	126.0	125.0					9																	131046829		1974	4174	6148	SO:0001583	missense	0			BC029911	CCDS43883.1	9q34.13	2011-07-29	2011-07-29	2011-07-29	ENSG00000175854	ENSG00000175854			31412	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 119"""	C9orf119		21252223, 20976249	Standard	NM_001040011		Approved	bA395P17.9	uc004bup.3	Q1ZZU3	OTTHUMG00000020729	ENST00000320188.5:c.467A>T	9.37:g.131046829A>T	ENSP00000316609:p.Glu156Val		Q5SYX7|Q5SYX8|Q8N2W6	Missense_Mutation	SNP	pfam_DNA-repair_Swi5	p.E156V	ENST00000320188.5	37	c.467	CCDS43883.1	9	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	13.33|13.33	2.203787|2.203787	0.38905|0.38905	.|.	.|.	ENSG00000175854|ENSG00000175854	ENST00000320188|ENST00000495313;ENST00000372898	.|.	.|.	.|.	5.5|5.5	5.5|5.5	0.81552|0.81552	.|.	0.263587|.	0.35040|.	N|.	0.003488|.	T|T	0.55369|0.55369	0.1916|0.1916	M|M	0.70595|0.70595	2.14|2.14	0.29215|0.29215	N|N	0.874349|0.874349	D|.	0.71674|.	0.998|.	D|.	0.69824|.	0.966|.	T|T	0.57608|0.57608	-0.7782|-0.7782	9|5	0.33940|.	T|.	0.23|.	.|.	8.5261|8.5261	0.33307|0.33307	0.9128:0.0:0.0872:0.0|0.9128:0.0:0.0872:0.0	.|.	156|.	Q1ZZU3|.	SWI5_HUMAN|.	V|W	156|70;66	.|.	ENSP00000316609:E156V|.	E|R	+|+	2|1	0|2	SWI5|SWI5	130086650|130086650	0.601000|0.601000	0.26907|0.26907	0.136000|0.136000	0.22124|0.22124	0.090000|0.090000	0.18270|0.18270	1.867000|1.867000	0.39499|0.39499	2.209000|2.209000	0.71365|0.71365	0.533000|0.533000	0.62120|0.62120	GAG|AGG	SWI5	-	pfam_DNA-repair_Swi5	ENSG00000175854		0.507	SWI5-201	KNOWN	basic|appris_principal|CCDS	protein_coding	SWI5	HGNC	protein_coding		-	0.00	33	0	A	NM_001040011		131046829	+1	tier1	-	no_errors	ENST00000320188	ensembl	human	known	74_37	missense	46.15	7	6	SNP	0.593	T
SYCP2	10388	genome.wustl.edu	37	20	58443550	58443550	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr20:58443550C>T	ENST00000357552.3	-	38	4131	c.3906G>A	c.(3904-3906)atG>atA	p.M1302I	SYCP2_ENST00000371001.2_Missense_Mutation_p.M1302I			Q9BX26	SYCP2_HUMAN	synaptonemal complex protein 2	1302					female meiotic division (GO:0007143)|fertilization (GO:0009566)|male genitalia morphogenesis (GO:0048808)|male meiosis (GO:0007140)|negative regulation of apoptotic process (GO:0043066)|synaptonemal complex assembly (GO:0007130)	lateral element (GO:0000800)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)	DNA binding (GO:0003677)			NS(4)|breast(2)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(14)|lung(12)|ovary(4)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	53	all_lung(29;0.00344)		BRCA - Breast invasive adenocarcinoma(7;1.19e-09)			CTTTCTCTTCCATTTCTACTT	0.353																																																	0													185.0	176.0	179.0					20																	58443550		2203	4299	6502	SO:0001583	missense	0			Y08982	CCDS13482.1	20q13.33	2007-07-02			ENSG00000196074	ENSG00000196074			11490	protein-coding gene	gene with protein product		604105				10341103, 9592139	Standard	NM_014258		Approved	SCP2	uc002yaz.3	Q9BX26	OTTHUMG00000032872	ENST00000357552.3:c.3906G>A	20.37:g.58443550C>T	ENSP00000350162:p.Met1302Ile		A2RUE5|O75763|Q5JX11|Q9NTX8|Q9UG27	Missense_Mutation	SNP	NULL	p.M1302I	ENST00000357552.3	37	c.3906	CCDS13482.1	20	.	.	.	.	.	.	.	.	.	.	C	7.206	0.594439	0.13875	.	.	ENSG00000196074	ENST00000371001;ENST00000357552	T;T	0.12984	2.63;2.63	5.67	-0.297	0.12820	.	1.227210	0.05626	N	0.580746	T	0.08802	0.0218	N	0.19112	0.55	0.09310	N	1	B	0.10296	0.003	B	0.10450	0.005	T	0.40459	-0.9562	10	0.11485	T	0.65	0.3265	9.1968	0.37233	0.0:0.5173:0.0:0.4827	.	1302	Q9BX26	SYCP2_HUMAN	I	1302	ENSP00000360040:M1302I;ENSP00000350162:M1302I	ENSP00000350162:M1302I	M	-	3	0	SYCP2	57876945	0.137000	0.22531	0.020000	0.16555	0.724000	0.41520	0.307000	0.19296	0.065000	0.16485	-0.218000	0.12543	ATG	SYCP2	-	NULL	ENSG00000196074		0.353	SYCP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYCP2	HGNC	protein_coding	OTTHUMT00000079930.3		0.00	53	0	C	NM_014258		58443550	-1			no_errors	ENST00000357552	ensembl	human	known	74_37	missense	5.88	48	3	SNP	0.006	T
SYNE1	23345	genome.wustl.edu	37	6	152590290	152590290	+	Splice_Site	SNP	T	T	G			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr6:152590290T>G	ENST00000367255.5	-	99	19306	c.18705A>C	c.(18703-18705)aaA>aaC	p.K6235N	SYNE1_ENST00000423061.1_Splice_Site_p.K6164N|SYNE1_ENST00000341594.5_Splice_Site_p.K5847N|SYNE1_ENST00000265368.4_Splice_Site_p.K6235N|SYNE1_ENST00000356820.4_Splice_Site_p.K759N|SYNE1_ENST00000448038.1_Splice_Site_p.K6164N	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	6235					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		AACACTTTACTTTTTGTTGCT	0.527										HNSCC(10;0.0054)																																							0													100.0	96.0	98.0					6																	152590290		2203	4300	6503	SO:0001630	splice_region_variant	0			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.18705+1A>C	6.37:g.152590290T>G			E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_CH-domain,pfam_KASH,superfamily_CH-domain,superfamily_Calpain_domain_III,superfamily_ABC1_TM_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,pfscan_CH-domain,pfscan_KASH	p.K6235N	ENST00000367255.5	37	c.18705	CCDS5236.2	6	.	.	.	.	.	.	.	.	.	.	T	20.5	4.003416	0.74932	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594;ENST00000356820	T;T;T;T;T;T	0.61510	0.19;0.16;0.1;0.17;0.34;0.95	5.57	1.73	0.24493	.	0.000000	0.64402	D	0.000004	T	0.60457	0.2270	M	0.67953	2.075	0.49213	D	0.999763	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.74348	0.962;0.962;0.983	T	0.61778	-0.6993	9	.	.	.	.	10.8447	0.46737	0.0:0.2548:0.0:0.7452	.	6235;6235;6164	Q8NF91;E7EQI5;Q8NF91-4	SYNE1_HUMAN;.;.	N	6235;6164;6235;6164;5847;759	ENSP00000356224:K6235N;ENSP00000396024:K6164N;ENSP00000265368:K6235N;ENSP00000390975:K6164N;ENSP00000341887:K5847N;ENSP00000349276:K759N	.	K	-	3	2	SYNE1	152631983	0.994000	0.37717	1.000000	0.80357	0.915000	0.54546	0.288000	0.18939	0.448000	0.26722	0.533000	0.62120	AAA	SYNE1	-	superfamily_Calpain_domain_III,superfamily_ABC1_TM_dom,smart_Spectrin/alpha-actinin	ENSG00000131018		0.527	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYNE1	HGNC	protein_coding	OTTHUMT00000334755.2		0.00	50	0	T	NM_182961	Missense_Mutation	152590290	-1			no_errors	ENST00000265368	ensembl	human	known	74_37	missense	9.68	28	3	SNP	1.000	G
SYNE1	23345	genome.wustl.edu	37	6	152658135	152658135	+	Silent	SNP	G	G	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr6:152658135G>T	ENST00000367255.5	-	76	12970	c.12369C>A	c.(12367-12369)gtC>gtA	p.V4123V	SYNE1_ENST00000423061.1_Silent_p.V4052V|SYNE1_ENST00000341594.5_Silent_p.V3988V|SYNE1_ENST00000265368.4_Silent_p.V4123V|SYNE1_ENST00000448038.1_Silent_p.V4052V	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	4123					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		TCTGGGCCTGGACAAGCTTTT	0.423										HNSCC(10;0.0054)																																							0													64.0	59.0	60.0					6																	152658135		2203	4300	6503	SO:0001819	synonymous_variant	0			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.12369C>A	6.37:g.152658135G>T			E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Silent	SNP	pfam_Spectrin_repeat,pfam_CH-domain,pfam_KASH,superfamily_CH-domain,superfamily_Calpain_domain_III,superfamily_ABC1_TM_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,pfscan_CH-domain,pfscan_KASH	p.V4123	ENST00000367255.5	37	c.12369	CCDS5236.2	6																																																																																			SYNE1	-	superfamily_Calpain_domain_III,superfamily_ABC1_TM_dom	ENSG00000131018		0.423	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYNE1	HGNC	protein_coding	OTTHUMT00000334755.2		0.00	37	0	G	NM_182961		152658135	-1			no_errors	ENST00000265368	ensembl	human	known	74_37	silent	7.41	25	2	SNP	0.000	T
SYNE1	23345	genome.wustl.edu	37	6	152804261	152804261	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr6:152804261C>T	ENST00000367255.5	-	14	1910	c.1309G>A	c.(1309-1311)Gaa>Aaa	p.E437K	SYNE1_ENST00000413186.2_Missense_Mutation_p.E437K|SYNE1_ENST00000423061.1_Missense_Mutation_p.E444K|SYNE1_ENST00000341594.5_Missense_Mutation_p.E437K|SYNE1_ENST00000367248.3_Missense_Mutation_p.E427K|SYNE1_ENST00000265368.4_Missense_Mutation_p.E437K|SYNE1_ENST00000466159.2_Missense_Mutation_p.E437K|SYNE1_ENST00000448038.1_Missense_Mutation_p.E444K|SYNE1_ENST00000367253.4_Missense_Mutation_p.E437K	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	437					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		TTTGCTGTTTCCTCGTGGACC	0.493										HNSCC(10;0.0054)																																							0													345.0	324.0	331.0					6																	152804261		2203	4300	6503	SO:0001583	missense	0			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.1309G>A	6.37:g.152804261C>T	ENSP00000356224:p.Glu437Lys		E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_CH-domain,pfam_KASH,superfamily_CH-domain,superfamily_Calpain_domain_III,superfamily_ABC1_TM_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,pfscan_CH-domain,pfscan_KASH	p.E437K	ENST00000367255.5	37	c.1309	CCDS5236.2	6	.	.	.	.	.	.	.	.	.	.	C	35	5.466821	0.96257	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594;ENST00000367253;ENST00000367248;ENST00000413186;ENST00000466159;ENST00000537750	T;T;T;T;T;D;D;D;D;D	0.91631	0.49;0.5;0.4;0.49;0.69;-2.29;-2.44;-2.42;-2.64;-2.88	5.87	5.87	0.94306	.	0.000000	0.56097	D	0.000021	D	0.95915	0.8670	M	0.78801	2.425	0.80722	D	1	D;D;D;D;D	0.89917	1.0;0.986;0.967;0.986;0.992	D;P;P;P;D	0.83275	0.996;0.864;0.817;0.864;0.936	D	0.94264	0.7505	10	0.45353	T	0.12	.	20.5827	0.99408	0.0:1.0:0.0:0.0	.	420;437;437;437;444	B3W695;Q8NF91;F5H4Q0;E7EQI5;Q8NF91-4	.;SYNE1_HUMAN;.;.;.	K	437;444;437;444;437;437;427;437;437;420	ENSP00000356224:E437K;ENSP00000396024:E444K;ENSP00000265368:E437K;ENSP00000390975:E444K;ENSP00000341887:E437K;ENSP00000356222:E437K;ENSP00000356217:E427K;ENSP00000414510:E437K;ENSP00000446021:E437K;ENSP00000441264:E420K	ENSP00000265368:E437K	E	-	1	0	SYNE1	152845954	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	5.726000	0.68515	2.941000	0.99782	0.655000	0.94253	GAA	SYNE1	-	superfamily_Calpain_domain_III,superfamily_ABC1_TM_dom	ENSG00000131018		0.493	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYNE1	HGNC	protein_coding	OTTHUMT00000334755.2		0.00	58	0	C	NM_182961		152804261	-1			no_errors	ENST00000265368	ensembl	human	known	74_37	missense	5.88	32	2	SNP	1.000	T
TAOK1	57551	genome.wustl.edu	37	17	27794201	27794201	+	Silent	SNP	G	G	A			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr17:27794201G>A	ENST00000261716.3	+	3	690	c.171G>A	c.(169-171)aaG>aaA	p.K57K	TAOK1_ENST00000536202.1_Silent_p.K57K	NM_020791.2	NP_065842.1	Q7L7X3	TAOK1_HUMAN	TAO kinase 1	57	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|execution phase of apoptosis (GO:0097194)|G2 DNA damage checkpoint (GO:0031572)|mitotic cell cycle (GO:0000278)|positive regulation of JNK cascade (GO:0046330)|positive regulation of stress-activated MAPK cascade (GO:0032874)|protein phosphorylation (GO:0006468)|regulation of cytoskeleton organization (GO:0051493)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|transferase activity (GO:0016740)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(4)|lung(14)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	28			Colorectal(6;0.198)			TGGCCATCAAGAAAATGTCTT	0.323																																																	0													122.0	121.0	121.0					17																	27794201		2203	4300	6503	SO:0001819	synonymous_variant	0			AB037782	CCDS32601.1, CCDS56024.1	17q11.2	2014-01-28				ENSG00000160551			29259	protein-coding gene	gene with protein product		610266				10718198, 14517247	Standard	NM_020791		Approved	KIAA1361, MARKK, PSK2, MAP3K16, FLJ14314, TAO1	uc002hdz.2	Q7L7X3		ENST00000261716.3:c.171G>A	17.37:g.27794201G>A			A2RUT8|B7ZLV6|Q96L75|Q9H2K7|Q9H7S5|Q9P2I6	Silent	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Homeodomain-like,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.K57	ENST00000261716.3	37	c.171	CCDS32601.1	17																																																																																			TAOK1	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000160551		0.323	TAOK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAOK1	HGNC	protein_coding	OTTHUMT00000447790.1		0.00	24	0	G	NM_020791		27794201	+1			no_errors	ENST00000261716	ensembl	human	known	74_37	silent	15.38	11	2	SNP	1.000	A
TAOK1	57551	genome.wustl.edu	37	17	27822704	27822704	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr17:27822704G>A	ENST00000261716.3	+	11	1477	c.958G>A	c.(958-960)Gca>Aca	p.A320T	TAOK1_ENST00000536202.1_Missense_Mutation_p.A320T	NM_020791.2	NP_065842.1	Q7L7X3	TAOK1_HUMAN	TAO kinase 1	320					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|execution phase of apoptosis (GO:0097194)|G2 DNA damage checkpoint (GO:0031572)|mitotic cell cycle (GO:0000278)|positive regulation of JNK cascade (GO:0046330)|positive regulation of stress-activated MAPK cascade (GO:0032874)|protein phosphorylation (GO:0006468)|regulation of cytoskeleton organization (GO:0051493)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|transferase activity (GO:0016740)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(4)|lung(14)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	28			Colorectal(6;0.198)			TTTCCAGGAGGCACATAATGG	0.388																																																	0													87.0	80.0	83.0					17																	27822704		2203	4300	6503	SO:0001583	missense	0			AB037782	CCDS32601.1, CCDS56024.1	17q11.2	2014-01-28				ENSG00000160551			29259	protein-coding gene	gene with protein product		610266				10718198, 14517247	Standard	NM_020791		Approved	KIAA1361, MARKK, PSK2, MAP3K16, FLJ14314, TAO1	uc002hdz.2	Q7L7X3		ENST00000261716.3:c.958G>A	17.37:g.27822704G>A	ENSP00000261716:p.Ala320Thr		A2RUT8|B7ZLV6|Q96L75|Q9H2K7|Q9H7S5|Q9P2I6	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Homeodomain-like,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.A320T	ENST00000261716.3	37	c.958	CCDS32601.1	17	.	.	.	.	.	.	.	.	.	.	G	12.11	1.839622	0.32513	.	.	ENSG00000160551	ENST00000261716;ENST00000536202	D;D	0.85088	-1.94;-1.94	5.21	5.21	0.72293	Protein kinase-like domain (1);	0.000000	0.85682	D	0.000000	T	0.71753	0.3377	N	0.08118	0	0.80722	D	1	B;B;B	0.11235	0.004;0.0;0.001	B;B;B	0.04013	0.001;0.001;0.001	T	0.67245	-0.5719	10	0.09590	T	0.72	.	19.1313	0.93408	0.0:0.0:1.0:0.0	.	320;146;320	B7ZLV6;Q7L7X3-2;Q7L7X3	.;.;TAOK1_HUMAN	T	320	ENSP00000261716:A320T;ENSP00000438819:A320T	ENSP00000261716:A320T	A	+	1	0	TAOK1	24846830	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.862000	0.87013	2.595000	0.87683	0.557000	0.71058	GCA	TAOK1	-	superfamily_Kinase-like_dom	ENSG00000160551		0.388	TAOK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAOK1	HGNC	protein_coding	OTTHUMT00000447790.1		0.00	37	0	G	NM_020791		27822704	+1			no_errors	ENST00000261716	ensembl	human	known	74_37	missense	6.25	30	2	SNP	1.000	A
TARS	6897	genome.wustl.edu	37	5	33445442	33445442	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr5:33445442G>A	ENST00000265112.3	+	2	381	c.70G>A	c.(70-72)Gaa>Aaa	p.E24K	TARS_ENST00000541634.1_5'UTR|TARS_ENST00000414361.2_5'UTR|TARS_ENST00000455217.2_Missense_Mutation_p.E24K|TARS_ENST00000502553.1_Missense_Mutation_p.E24K	NM_152295.4	NP_689508.3	P26639	SYTC_HUMAN	threonyl-tRNA synthetase	24					gene expression (GO:0010467)|threonyl-tRNA aminoacylation (GO:0006435)|translation (GO:0006412)|tRNA aminoacylation for protein translation (GO:0006418)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|protein homodimerization activity (GO:0042803)|threonine-tRNA ligase activity (GO:0004829)			NS(1)|biliary_tract(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(7)|lung(11)|ovary(2)|prostate(1)	29					L-Threonine(DB00156)	TGGTGCTGGTGAAGAGAAGCA	0.393																																																	0													91.0	87.0	88.0					5																	33445442		2203	4300	6503	SO:0001583	missense	0			AK095852	CCDS3899.1, CCDS58943.1	5p13.2	2012-10-02			ENSG00000113407	ENSG00000113407	6.1.1.3	"""Aminoacyl tRNA synthetases / Class II"""	11572	protein-coding gene	gene with protein product	"""threonine tRNA ligase 1, cytoplasmic"""	187790					Standard	NM_152295		Approved		uc011coc.3	P26639	OTTHUMG00000090683	ENST00000265112.3:c.70G>A	5.37:g.33445442G>A	ENSP00000265112:p.Glu24Lys		A8K8I1|B4DEG8|Q96FP5|Q9BWA6	Missense_Mutation	SNP	pfam_aa-tRNA-synt_IIb_cons-dom,pfam_Anticodon-bd,pfam_TGS,pfam_tRNA_SAD,superfamily_Thr/Ala-tRNA-synth_IIc_edit,superfamily_Anticodon-bd,superfamily_TGS-like,smart_tRNA_SAD,prints_Thr-tRNA-ligase_IIa,pfscan_aa-tRNA-synth_II,tigrfam_Thr-tRNA-ligase_IIa	p.E24K	ENST00000265112.3	37	c.70	CCDS3899.1	5	.	.	.	.	.	.	.	.	.	.	G	13.56	2.273401	0.40194	.	.	ENSG00000113407	ENST00000502553;ENST00000514259;ENST00000265112;ENST00000455217	T;T;T;T	0.44083	0.93;0.93;0.93;0.94	5.16	2.32	0.28847	.	0.726724	0.14085	N	0.342403	T	0.27349	0.0671	L	0.34521	1.04	0.26521	N	0.97444	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.28073	-1.0055	10	0.08837	T	0.75	-14.0395	9.3748	0.38277	0.0761:0.2733:0.6506:0.0	.	24;24	B4DEG8;P26639	.;SYTC_HUMAN	K	24	ENSP00000424387:E24K;ENSP00000422130:E24K;ENSP00000265112:E24K;ENSP00000387710:E24K	ENSP00000265112:E24K	E	+	1	0	TARS	33481199	0.996000	0.38824	0.008000	0.14137	0.444000	0.32077	2.578000	0.46051	0.244000	0.21351	0.563000	0.77884	GAA	TARS	-	NULL	ENSG00000113407		0.393	TARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TARS	HGNC	protein_coding	OTTHUMT00000207367.1	-	0.00	48	0	G	NM_152295		33445442	+1	tier1	-	no_errors	ENST00000265112	ensembl	human	known	74_37	missense	44.68	26	21	SNP	0.183	A
TAS2R7	50837	genome.wustl.edu	37	12	10954817	10954817	+	Missense_Mutation	SNP	A	A	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr12:10954817A>T	ENST00000240687.2	-	1	409	c.353T>A	c.(352-354)cTt>cAt	p.L118H		NM_023919.2	NP_076408.1	Q9NYW3	TA2R7_HUMAN	taste receptor, type 2, member 7	118					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)|taste receptor activity (GO:0008527)			kidney(1)|large_intestine(1)|lung(3)|skin(2)|stomach(3)	10						CCAGAGGAAAAGTGGGTGAAA	0.418																																																	0													65.0	63.0	64.0					12																	10954817		2203	4300	6503	SO:0001583	missense	0			AF227133	CCDS8631.1	12p13	2012-08-22			ENSG00000121377	ENSG00000121377		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	14913	protein-coding gene	gene with protein product		604793				10761934, 10766242	Standard	NM_023919		Approved	T2R7, TRB4	uc001qyv.3	Q9NYW3	OTTHUMG00000168505	ENST00000240687.2:c.353T>A	12.37:g.10954817A>T	ENSP00000240687:p.Leu118His		Q645Y1	Missense_Mutation	SNP	pfam_TAS2_rcpt,pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	p.L118H	ENST00000240687.2	37	c.353	CCDS8631.1	12	.	.	.	.	.	.	.	.	.	.	A	13.03	2.114233	0.37339	.	.	ENSG00000121377	ENST00000240687	T	0.00922	5.54	5.49	5.49	0.81192	GPCR, rhodopsin-like superfamily (1);	0.651527	0.14239	N	0.332209	T	0.07052	0.0179	M	0.90425	3.115	0.26134	N	0.980378	P	0.48294	0.908	P	0.61533	0.89	T	0.03296	-1.1051	10	0.87932	D	0	.	13.5695	0.61838	1.0:0.0:0.0:0.0	.	118	Q9NYW3	TA2R7_HUMAN	H	118	ENSP00000240687:L118H	ENSP00000240687:L118H	L	-	2	0	TAS2R7	10846084	0.237000	0.23815	0.588000	0.28705	0.003000	0.03518	2.313000	0.43735	2.300000	0.77407	0.528000	0.53228	CTT	TAS2R7	-	pfam_TAS2_rcpt,pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000121377		0.418	TAS2R7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAS2R7	HGNC	protein_coding	OTTHUMT00000399931.1	-	0.00	39	0	A			10954817	-1	tier1	-	no_errors	ENST00000240687	ensembl	human	known	74_37	missense	25.00	15	5	SNP	0.598	T
TCF7L2	6934	genome.wustl.edu	37	10	114849212	114849212	+	Intron	SNP	C	C	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr10:114849212C>T	ENST00000355995.4	+	5	1059				TCF7L2_ENST00000352065.5_Intron|TCF7L2_ENST00000369397.4_Intron|TCF7L2_ENST00000369395.1_Silent_p.P180P|TCF7L2_ENST00000542695.1_Intron|TCF7L2_ENST00000534894.1_Intron|TCF7L2_ENST00000543371.1_Intron|TCF7L2_ENST00000545257.1_Intron|TCF7L2_ENST00000536810.1_Intron|TCF7L2_ENST00000538897.1_Intron|TCF7L2_ENST00000355717.4_Silent_p.P179P|TCF7L2_ENST00000349937.2_Intron			Q9NQB0	TF7L2_HUMAN	transcription factor 7-like 2 (T-cell specific, HMG-box)						blood vessel development (GO:0001568)|bone mineralization (GO:0030282)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|catenin import into nucleus (GO:0035411)|cell cycle arrest (GO:0007050)|cell proliferation (GO:0008283)|cellular response to starvation (GO:0009267)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic genitalia morphogenesis (GO:0030538)|embryonic hindgut morphogenesis (GO:0048619)|face morphogenesis (GO:0060325)|fat cell differentiation (GO:0045444)|generation of neurons (GO:0048699)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|glycogen metabolic process (GO:0005977)|insulin metabolic process (GO:1901142)|maintenance of DNA repeat elements (GO:0043570)|multicellular organism growth (GO:0035264)|myoblast fate commitment (GO:0048625)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of organ growth (GO:0046621)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of type B pancreatic cell apoptotic process (GO:2000675)|neural tube development (GO:0021915)|odontogenesis of dentin-containing tooth (GO:0042475)|oligodendrocyte development (GO:0014003)|pancreas development (GO:0031016)|pituitary gland development (GO:0021983)|positive regulation of apoptotic process (GO:0043065)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of gluconeogenesis (GO:0045722)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of insulin secretion (GO:0032024)|positive regulation of protein binding (GO:0032092)|positive regulation of protein export from nucleus (GO:0046827)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of triglyceride biosynthetic process (GO:0010867)|post-embryonic development (GO:0009791)|regulation of hormone metabolic process (GO:0032350)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|regulation of myelination (GO:0031641)|regulation of oligodendrocyte differentiation (GO:0048713)|regulation of skeletal muscle tissue development (GO:0048641)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to glucose (GO:0009749)|secretory granule localization (GO:0032252)|skin development (GO:0043588)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	beta-catenin-TCF7L2 complex (GO:0070369)|cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein-DNA complex (GO:0032993)|transcription factor complex (GO:0005667)	armadillo repeat domain binding (GO:0070016)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|gamma-catenin binding (GO:0045295)|nuclear hormone receptor binding (GO:0035257)|protein kinase binding (GO:0019901)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II repressing transcription factor binding (GO:0001103)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)		VTI1A/TCF7L2(8)	central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(24)|liver(2)|lung(8)|ovary(1)|skin(1)	41		Breast(234;0.058)|Colorectal(252;0.0615)		Epithelial(162;0.00554)|all cancers(201;0.02)		TCTACCCCCCCTCAGACTTCA	0.562			T	VTI1A	colorectal																																			Dom	yes		10	10q25.3	6934	transcription factor 7-like 2		E	0													54.0	49.0	51.0					10																	114849212		1568	3582	5150	SO:0001627	intron_variant	0			X62871	CCDS7576.1, CCDS53578.1, CCDS55729.1, CCDS73196.1, CCDS73197.1, CCDS73198.1	10q25.3	2006-11-24			ENSG00000148737	ENSG00000148737			11641	protein-coding gene	gene with protein product		602228		TCF4		1741298	Standard	NM_001146283		Approved	TCF-4	uc001lae.4	Q9NQB0	OTTHUMG00000019070	ENST00000355995.4:c.552+49327C>T	10.37:g.114849212C>T			B4DRJ8|B9X074|C6ZRJ8|C6ZRK0|E2GH14|E2GH19|E2GH20|E2GH24|E2GH25|E9PFH9|F8W742|F8W7T5|O00185|Q9NQB1|Q9NQB2|Q9NQB3|Q9NQB4|Q9NQB5|Q9NQB6|Q9NQB7|Q9ULC2	Silent	SNP	pfam_CTNNB1-bd_N,pfam_HMG_box_dom,superfamily_HMG_box_dom,smart_HMG_box_dom,pfscan_HMG_box_dom	p.P179	ENST00000355995.4	37	c.537		10																																																																																			TCF7L2	-	pfam_CTNNB1-bd_N	ENSG00000148737		0.562	TCF7L2-203	KNOWN	basic	protein_coding	TCF7L2	HGNC	protein_coding		-	0.00	28	0	C	NM_030756		114849212	+1	tier1	-	no_errors	ENST00000355717	ensembl	human	known	74_37	silent	25.00	18	6	SNP	1.000	T
TECPR2	9895	genome.wustl.edu	37	14	102916092	102916092	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr14:102916092G>C	ENST00000359520.7	+	14	3428	c.3202G>C	c.(3202-3204)Gcg>Ccg	p.A1068P	TECPR2_ENST00000558678.1_Missense_Mutation_p.A1068P	NM_014844.3	NP_055659.2	O15040	TCPR2_HUMAN	tectonin beta-propeller repeat containing 2	1068					autophagy (GO:0006914)|cell death (GO:0008219)					breast(1)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(7)|lung(21)|ovary(2)|prostate(3)|skin(4)|stomach(1)|urinary_tract(1)	50						GCTGCGCATGGCGTTTTGGTC	0.552																																																	0													102.0	91.0	94.0					14																	102916092		2203	4300	6503	SO:0001583	missense	0			AB019441	CCDS32162.1, CCDS58337.1	14q32.33	2009-02-27	2009-02-27	2009-02-27		ENSG00000196663			19957	protein-coding gene	gene with protein product		615000	"""KIAA0329"""	KIAA0329		9205841	Standard	NM_014844		Approved		uc001ylw.2	O15040		ENST00000359520.7:c.3202G>C	14.37:g.102916092G>C	ENSP00000352510:p.Ala1068Pro		A5PKY3|A6NFY9|A7E2X3|H0YMM9|Q9UEG6	Missense_Mutation	SNP	pfam_Beta-propeller_rpt_TECPR,superfamily_WD40_repeat_dom,superfamily_RCC1/BLIP-II,smart_WD40_repeat,smart_Beta-propeller_rpt_TECPR	p.A1068P	ENST00000359520.7	37	c.3202	CCDS32162.1	14	.	.	.	.	.	.	.	.	.	.	G	24.7	4.562888	0.86335	.	.	ENSG00000196663	ENST00000359520	T	0.17528	2.27	5.52	5.52	0.82312	.	0.057509	0.64402	D	0.000002	T	0.23688	0.0573	N	0.19112	0.55	0.58432	D	0.999999	D;D;D	0.64830	0.994;0.994;0.994	P;P;P	0.61658	0.883;0.883;0.892	T	0.01363	-1.1374	10	0.62326	D	0.03	.	12.7387	0.57239	0.075:0.0:0.925:0.0	.	251;1068;1068	B4DSD3;A5PKY3;O15040	.;.;TCPR2_HUMAN	P	1068	ENSP00000352510:A1068P	ENSP00000352510:A1068P	A	+	1	0	TECPR2	101985845	1.000000	0.71417	0.998000	0.56505	0.838000	0.47535	6.475000	0.73582	2.606000	0.88127	0.563000	0.77884	GCG	TECPR2	-	superfamily_RCC1/BLIP-II	ENSG00000196663		0.552	TECPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TECPR2	HGNC	protein_coding	OTTHUMT00000415056.2		0.00	31	0	G	NM_014844		102916092	+1			no_errors	ENST00000359520	ensembl	human	known	74_37	missense	8.00	23	2	SNP	1.000	C
TENM2	57451	genome.wustl.edu	37	5	167626888	167626888	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr5:167626888A>G	ENST00000518659.1	+	17	3221	c.3182A>G	c.(3181-3183)gAg>gGg	p.E1061G	TENM2_ENST00000545108.1_Missense_Mutation_p.E1061G|TENM2_ENST00000519204.1_Missense_Mutation_p.E940G|TENM2_ENST00000403607.2_Missense_Mutation_p.E885G|TENM2_ENST00000520394.1_Missense_Mutation_p.E829G	NM_001122679.1	NP_001116151.1	Q9NT68	TEN2_HUMAN	teneurin transmembrane protein 2	1061					axon guidance (GO:0007411)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|heterophilic cell-cell adhesion (GO:0007157)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of filopodium assembly (GO:0051491)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cell-cell junction (GO:0005911)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|endoplasmic reticulum (GO:0005783)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|PML body (GO:0016605)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)										GAAGAAATCGAGCTCCCTGGT	0.498																																																	0													165.0	159.0	161.0					5																	167626888		1933	4151	6084	SO:0001583	missense	0			AB032953		5q35	2012-10-02	2012-10-02	2012-10-02	ENSG00000145934	ENSG00000145934			29943	protein-coding gene	gene with protein product		610119	"""odz, odd Oz/ten-m homolog 2 (Drosophila)"""	ODZ2		10625539	Standard	NM_001122679		Approved	KIAA1127, Ten-M2	uc010jjd.3	Q9NT68	OTTHUMG00000162928	ENST00000518659.1:c.3182A>G	5.37:g.167626888A>G	ENSP00000429430:p.Glu1061Gly		Q9ULU2	Missense_Mutation	SNP	pfam_Ten_N,pfam_EGF_extracell,superfamily_CarboxyPept-like_regulatory,superfamily_Quino_amine_DH_bsu,superfamily_ConA-like_lec_gl_sf,superfamily_Cytokine_IL1-like,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,pfscan_EG-like_dom,tigrfam_YD,tigrfam_Rhs_assc_core	p.E1061G	ENST00000518659.1	37	c.3182		5	.	.	.	.	.	.	.	.	.	.	A	13.07	2.126719	0.37533	.	.	ENSG00000145934	ENST00000518659;ENST00000545108;ENST00000519204;ENST00000520394;ENST00000403607	D;D;D;D;D	0.89746	-2.09;-2.08;-2.19;-2.55;-2.56	5.05	5.05	0.67936	.	0.199119	0.52532	D	0.000078	D	0.92156	0.7513	L	0.50333	1.59	0.47407	D	0.999417	P;B;D	0.67145	0.575;0.439;0.996	B;B;D	0.75484	0.312;0.165;0.986	D	0.91619	0.5309	10	0.39692	T	0.17	.	14.8257	0.70110	1.0:0.0:0.0:0.0	.	1061;1061;829	F5H2D1;Q9NT68;F8VNQ3	.;TEN2_HUMAN;.	G	1061;1061;940;829;885	ENSP00000429430:E1061G;ENSP00000438635:E1061G;ENSP00000428964:E940G;ENSP00000427874:E829G;ENSP00000384905:E885G	ENSP00000384905:E885G	E	+	2	0	ODZ2	167559466	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.306000	0.78905	1.896000	0.54893	0.459000	0.35465	GAG	TENM2	-	superfamily_ConA-like_lec_gl_sf	ENSG00000145934		0.498	TENM2-001	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	TENM2	HGNC	protein_coding	OTTHUMT00000376096.1		0.00	45	0	A	NM_001122679		167626888	+1			no_errors	ENST00000518659	ensembl	human	known	74_37	missense	11.11	16	2	SNP	1.000	G
TENM3	55714	genome.wustl.edu	37	4	183601454	183601454	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr4:183601454G>A	ENST00000511685.1	+	9	1714	c.1591G>A	c.(1591-1593)Gga>Aga	p.G531R	TENM3_ENST00000406950.2_Missense_Mutation_p.G531R			Q9P273	TEN3_HUMAN	teneurin transmembrane protein 3	531	EGF-like 1. {ECO:0000255|PROSITE- ProRule:PRU00076}.				camera-type eye morphogenesis (GO:0048593)|homophilic cell adhesion (GO:0007156)|positive regulation of neuron projection development (GO:0010976)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cell projection (GO:0042995)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)										ATGCGTTTCTGGAACTTGCCA	0.418																																																	0													148.0	135.0	139.0					4																	183601454		1861	4104	5965	SO:0001583	missense	0			AF195420	CCDS47165.1	4q35	2012-10-02	2012-10-02	2012-10-02	ENSG00000218336	ENSG00000218336			29944	protein-coding gene	gene with protein product		610083	"""odz, odd Oz/ten-m homolog 3 (Drosophila)"""	ODZ3		10331952, 10625539	Standard	NM_001080477		Approved	Ten-M3, KIAA1455	uc003ivd.1	Q9P273	OTTHUMG00000160682	ENST00000511685.1:c.1591G>A	4.37:g.183601454G>A	ENSP00000424226:p.Gly531Arg		Q5XUL9|Q96SY2|Q9NV77|Q9NVW1|Q9NZJ2	Missense_Mutation	SNP	pfam_Ten_N,pfam_EGF_extracell,superfamily_CarboxyPept-like_regulatory,superfamily_Cyt_c-like_dom,smart_EG-like_dom,pfscan_EG-like_dom,tigrfam_YD,tigrfam_Rhs_assc_core	p.G531R	ENST00000511685.1	37	c.1591	CCDS47165.1	4	.	.	.	.	.	.	.	.	.	.	G	25.0	4.590427	0.86851	.	.	ENSG00000218336	ENST00000511685;ENST00000406950	T;T	0.25749	1.78;1.78	5.37	5.37	0.77165	EGF, extracellular (1);Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	.	.	.	.	T	0.62245	0.2412	M	0.91249	3.19	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.70447	-0.4869	9	0.87932	D	0	.	19.3071	0.94167	0.0:0.0:1.0:0.0	.	531	Q9P273	TEN3_HUMAN	R	531	ENSP00000424226:G531R;ENSP00000385276:G531R	ENSP00000385276:G531R	G	+	1	0	ODZ3	183838448	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.263000	0.95617	2.793000	0.96121	0.563000	0.77884	GGA	TENM3	-	pfam_EGF_extracell,smart_EG-like_dom	ENSG00000218336		0.418	TENM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TENM3	HGNC	protein_coding	OTTHUMT00000361734.1	-	0.00	62	0	G			183601454	+1	tier1	-	no_errors	ENST00000406950	ensembl	human	known	74_37	missense	13.95	37	6	SNP	1.000	A
TET1	80312	genome.wustl.edu	37	10	70405161	70405161	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr10:70405161T>C	ENST00000373644.4	+	4	2884	c.2675T>C	c.(2674-2676)gTa>gCa	p.V892A		NM_030625.2	NP_085128.2	Q8NFU7	TET1_HUMAN	tet methylcytosine dioxygenase 1	892					chromatin modification (GO:0016568)|DNA demethylation (GO:0080111)|inner cell mass cell differentiation (GO:0001826)|negative regulation of methylation-dependent chromatin silencing (GO:0090310)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein O-linked glycosylation (GO:0006493)|regulation of DNA methylation (GO:0044030)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	iron ion binding (GO:0005506)|methylcytosine dioxygenase activity (GO:0070579)|structure-specific DNA binding (GO:0043566)|zinc ion binding (GO:0008270)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(2)|ovary(5)|prostate(1)|upper_aerodigestive_tract(2)	21						GAGCAAGTGGTAGCCATAGAG	0.448																																																	0													109.0	115.0	113.0					10																	70405161		2202	4299	6501	SO:0001583	missense	0			AF430147	CCDS7281.1	10q21	2014-02-18	2011-09-30	2008-03-12	ENSG00000138336	ENSG00000138336			29484	protein-coding gene	gene with protein product	"""leukemia-associated protein with a CXXC domain"", ""ten-eleven translocation-1"""	607790	"""CXXC zinc finger 6"", ""tet oncogene 1"""	CXXC6		12124344, 12646957	Standard	NM_030625		Approved	LCX, KIAA1676, bA119F7.1	uc001jok.4	Q8NFU7	OTTHUMG00000018359	ENST00000373644.4:c.2675T>C	10.37:g.70405161T>C	ENSP00000362748:p.Val892Ala		Q5VUP7|Q7Z6B6|Q8TCR1|Q9C0I7	Missense_Mutation	SNP	pfam_Znf_CXXC,pfscan_Znf_CXXC	p.V892A	ENST00000373644.4	37	c.2675	CCDS7281.1	10	.	.	.	.	.	.	.	.	.	.	T	19.82	3.898411	0.72639	.	.	ENSG00000138336	ENST00000373644	T	0.12147	2.71	5.79	4.65	0.58169	.	0.245012	0.26665	N	0.023140	T	0.14485	0.0350	L	0.34521	1.04	0.32904	D	0.513626	D	0.58268	0.982	P	0.46885	0.53	T	0.11916	-1.0568	10	0.72032	D	0.01	.	11.0277	0.47755	0.1386:0.0:0.0:0.8614	.	892	Q8NFU7	TET1_HUMAN	A	892	ENSP00000362748:V892A	ENSP00000362748:V892A	V	+	2	0	TET1	70075167	1.000000	0.71417	0.973000	0.42090	0.997000	0.91878	5.030000	0.64128	0.999000	0.39023	0.455000	0.32223	GTA	TET1	-	NULL	ENSG00000138336		0.448	TET1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TET1	HGNC	protein_coding	OTTHUMT00000048354.1	-	0.00	48	0	T	NM_030625		70405161	+1	tier1	-	no_errors	ENST00000373644	ensembl	human	known	74_37	missense	23.81	16	5	SNP	0.978	C
THAP5	168451	genome.wustl.edu	37	7	108206359	108206359	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr7:108206359G>T	ENST00000415914.3	-	2	341	c.188C>A	c.(187-189)cCt>cAt	p.P63H	THAP5_ENST00000493722.1_Intron|THAP5_ENST00000438865.1_Intron|THAP5_ENST00000313516.5_Missense_Mutation_p.P21H	NM_001130475.1	NP_001123947.1	Q7Z6K1	THAP5_HUMAN	THAP domain containing 5	63					cell cycle (GO:0007049)|negative regulation of cell cycle (GO:0045786)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protease binding (GO:0002020)			central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(2)|skin(1)	8						AAGAGAGTCAGGAGTAAAATG	0.378																																																	0													129.0	108.0	114.0					7																	108206359		692	1591	2283	SO:0001583	missense	0			AL833137	CCDS34734.2, CCDS47687.1	7q22.3	2013-01-25			ENSG00000177683	ENSG00000177683		"""THAP (C2CH-type zinc finger) domain containing"""	23188	protein-coding gene	gene with protein product		612534				12575992	Standard	NM_001287598		Approved	DKFZp313O1132	uc003vfm.3	Q7Z6K1	OTTHUMG00000154951	ENST00000415914.3:c.188C>A	7.37:g.108206359G>T	ENSP00000400500:p.Pro63His			Missense_Mutation	SNP	pfam_Znf_C2CH,smart_Znf_C2CH,pfscan_Znf_C2CH	p.P63H	ENST00000415914.3	37	c.188	CCDS47687.1	7	.	.	.	.	.	.	.	.	.	.	G	21.0	4.074795	0.76415	.	.	ENSG00000177683	ENST00000415914;ENST00000313516	D;D	0.96554	-4.05;-4.05	5.4	5.4	0.78164	Zinc finger, C2CH-type (4);	.	.	.	.	D	0.97983	0.9336	M	0.77313	2.365	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	D	0.97929	1.0319	8	.	.	.	.	18.5219	0.90956	0.0:0.0:1.0:0.0	.	63	Q7Z6K1	THAP5_HUMAN	H	63;21	ENSP00000400500:P63H;ENSP00000322440:P21H	.	P	-	2	0	THAP5	107993595	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.936000	0.63506	2.696000	0.92011	0.655000	0.94253	CCT	THAP5	-	pfam_Znf_C2CH,smart_Znf_C2CH,pfscan_Znf_C2CH	ENSG00000177683		0.378	THAP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THAP5	HGNC	protein_coding	OTTHUMT00000337777.2	-	0.00	46	0	G	NM_182529		108206359	-1	tier1	-	no_errors	ENST00000415914	ensembl	human	known	74_37	missense	10.81	33	4	SNP	1.000	T
THNSL1	79896	genome.wustl.edu	37	10	25312532	25312532	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr10:25312532G>T	ENST00000524413.1	+	3	727	c.380G>T	c.(379-381)aGt>aTt	p.S127I	THNSL1_ENST00000376356.4_Missense_Mutation_p.S127I			Q8IYQ7	THNS1_HUMAN	threonine synthase-like 1 (S. cerevisiae)	127						cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleus (GO:0005634)				NS(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|lung(5)|pancreas(1)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	28					L-Threonine(DB00156)	GCATCTGGAAGTGTGATTTCC	0.388																																																	0													83.0	82.0	82.0					10																	25312532		2203	4300	6503	SO:0001583	missense	0			AK025655	CCDS7147.1	10p12.31	2008-02-05	2007-06-20		ENSG00000185875	ENSG00000185875			26160	protein-coding gene	gene with protein product		611260	"""threonine synthase-like 1 (bacterial)"""			12477932	Standard	NM_024838		Approved	FLJ22002	uc001isi.4	Q8IYQ7	OTTHUMG00000017828	ENST00000524413.1:c.380G>T	10.37:g.25312532G>T	ENSP00000434887:p.Ser127Ile		B3KWL1|D3DRV3|Q5VV21	Missense_Mutation	SNP	pfam_Shikimate_kinase/TSH1,pfam_Trp_syn_b_sub_like_PLP_eny_SF,superfamily_Trp_syn_b_sub_like_PLP_eny_SF,superfamily_P-loop_NTPase,prints_Shikimate_kinase/TSH1,tigrfam_Thr_synthase_like	p.S127I	ENST00000524413.1	37	c.380	CCDS7147.1	10	.	.	.	.	.	.	.	.	.	.	G	11.58	1.682029	0.29872	.	.	ENSG00000185875	ENST00000524413;ENST00000376356	T;T	0.43294	0.95;0.95	5.69	4.74	0.60224	.	0.148333	0.64402	D	0.000011	T	0.47893	0.1470	M	0.76170	2.325	0.44927	D	0.997949	B	0.18461	0.028	B	0.15052	0.012	T	0.52533	-0.8563	10	0.87932	D	0	-16.711	18.3077	0.90188	0.0:0.1286:0.8714:0.0	.	127	Q8IYQ7	THNS1_HUMAN	I	127	ENSP00000434887:S127I;ENSP00000365534:S127I	ENSP00000365534:S127I	S	+	2	0	THNSL1	25352538	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.350000	0.66016	2.686000	0.91538	0.650000	0.86243	AGT	THNSL1	-	pfam_Shikimate_kinase/TSH1,superfamily_P-loop_NTPase	ENSG00000185875		0.388	THNSL1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	THNSL1	HGNC	protein_coding	OTTHUMT00000394913.1		0.00	35	0	G	NM_024838		25312532	+1			no_errors	ENST00000376356	ensembl	human	known	74_37	missense	8.70	21	2	SNP	1.000	T
THRAP3	9967	genome.wustl.edu	37	1	36769568	36769568	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr1:36769568G>T	ENST00000354618.5	+	12	3042	c.2818G>T	c.(2818-2820)Ggg>Tgg	p.G940W	THRAP3_ENST00000469141.2_Missense_Mutation_p.G940W|SH3D21_ENST00000453908.2_5'Flank|SH3D21_ENST00000426732.2_5'Flank	NM_005119.3	NP_005110.2	Q9Y2W1	TR150_HUMAN	thyroid hormone receptor associated protein 3	940	Required for mRNA decay activity.				androgen receptor signaling pathway (GO:0030521)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|mRNA processing (GO:0006397)|mRNA stabilization (GO:0048255)|nuclear-transcribed mRNA catabolic process (GO:0000956)|positive regulation of mRNA splicing, via spliceosome (GO:0048026)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA splicing (GO:0008380)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|phosphoprotein binding (GO:0051219)|poly(A) RNA binding (GO:0044822)|receptor activity (GO:0004872)|RNA polymerase II transcription cofactor activity (GO:0001104)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			breast(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(9)|lung(12)|ovary(5)|stomach(1)	37		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				CGACGAGAGTGGGACAGAGAA	0.587			T	USP6	aneurysmal bone cysts																																Pancreas(129;785 1795 20938 23278 32581)			Dom	yes		1	1p34.3	9967	thyroid hormone receptor associated protein 3 (TRAP150)		M	0													59.0	64.0	63.0					1																	36769568		2203	4300	6503	SO:0001583	missense	0			AF117756	CCDS405.1	1p34.3	2008-02-05			ENSG00000054118	ENSG00000054118			22964	protein-coding gene	gene with protein product		603809					Standard	NM_005119		Approved	TRAP150	uc001cae.4	Q9Y2W1	OTTHUMG00000007866	ENST00000354618.5:c.2818G>T	1.37:g.36769568G>T	ENSP00000346634:p.Gly940Trp		D3DPS5|Q5VTK6	Missense_Mutation	SNP	NULL	p.G940W	ENST00000354618.5	37	c.2818	CCDS405.1	1	.	.	.	.	.	.	.	.	.	.	G	16.45	3.127134	0.56721	.	.	ENSG00000054118	ENST00000354618;ENST00000469141	T;T	0.10960	2.82;2.82	5.0	4.08	0.47627	.	0.000000	0.64402	D	0.000003	T	0.14743	0.0356	L	0.36672	1.1	0.53688	D	0.999978	P	0.49447	0.924	P	0.49752	0.621	T	0.01298	-1.1392	10	0.72032	D	0.01	-13.5809	12.688	0.56958	0.0805:0.0:0.9195:0.0	.	940	Q9Y2W1	TR150_HUMAN	W	940	ENSP00000346634:G940W;ENSP00000433825:G940W	ENSP00000346634:G940W	G	+	1	0	THRAP3	36542155	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.687000	0.68219	1.230000	0.43646	0.563000	0.77884	GGG	THRAP3	-	NULL	ENSG00000054118		0.587	THRAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THRAP3	HGNC	protein_coding	OTTHUMT00000021688.2		0.00	72	0	G	NM_005119		36769568	+1			no_errors	ENST00000354618	ensembl	human	known	74_37	missense	5.26	35	2	SNP	1.000	T
THTPA	79178	genome.wustl.edu	37	14	24026198	24026198	+	Nonsense_Mutation	SNP	G	G	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr14:24026198G>T	ENST00000288014.6	+	1	968	c.232G>T	c.(232-234)Gag>Tag	p.E78*	THTPA_ENST00000554970.1_Nonsense_Mutation_p.E78*|RP11-66N24.4_ENST00000555446.1_RNA|THTPA_ENST00000404535.3_Nonsense_Mutation_p.E78*|THTPA_ENST00000556015.1_Nonsense_Mutation_p.E78*|RP11-66N24.4_ENST00000556354.1_RNA|RP11-66N24.4_ENST00000553985.1_RNA|THTPA_ENST00000554789.1_Nonsense_Mutation_p.E78*			Q9BU02	THTPA_HUMAN	thiamine triphosphatase	78	CYTH. {ECO:0000255|PROSITE- ProRule:PRU01044}.				dephosphorylation (GO:0016311)|generation of precursor metabolites and energy (GO:0006091)|small molecule metabolic process (GO:0044281)|thiamine diphosphate metabolic process (GO:0042357)|thiamine metabolic process (GO:0006772)|thiamine-containing compound metabolic process (GO:0042723)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)	hydrolase activity (GO:0016787)|magnesium ion binding (GO:0000287)|thiamin-triphosphatase activity (GO:0050333)			large_intestine(1)|prostate(2)	3	all_cancers(95;0.000251)			GBM - Glioblastoma multiforme(265;0.00643)		ACCCCACACGGAGTATAAGGA	0.597																																																	0													91.0	80.0	84.0					14																	24026198		2203	4300	6503	SO:0001587	stop_gained	0			AF432862	CCDS32053.1, CCDS58306.1, CCDS58307.1	14q11.2	2011-04-28					3.6.1.28		18987	protein-coding gene	gene with protein product		611612				11827967	Standard	NR_046051		Approved	THTPASE	uc001wkh.5	Q9BU02		ENST00000288014.6:c.232G>T	14.37:g.24026198G>T	ENSP00000288014:p.Glu78*		D3DS50|G3V4J3	Nonsense_Mutation	SNP	pfam_CYTH-like_domain,superfamily_CYTH-like_domain,pirsf_ThTPase	p.E78*	ENST00000288014.6	37	c.232	CCDS32053.1	14	.	.	.	.	.	.	.	.	.	.	G	17.54	3.416091	0.62511	.	.	ENSG00000157306	ENST00000404535;ENST00000288014;ENST00000557630;ENST00000556015;ENST00000554970;ENST00000554789	.	.	.	5.38	-1.01	0.10169	.	0.423339	0.28653	N	0.014587	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.24483	T	0.36	-5.6339	5.1877	0.15193	0.4316:0.3019:0.2666:0.0	.	.	.	.	X	78	.	ENSP00000288014:E78X	E	+	1	0	THTPA	23096038	0.005000	0.15991	0.108000	0.21378	0.273000	0.26683	-0.135000	0.10420	-0.072000	0.12864	-0.910000	0.02820	GAG	THTPA	-	pfam_CYTH-like_domain,superfamily_CYTH-like_domain,pirsf_ThTPase	ENSG00000259431		0.597	THTPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THTPA	HGNC	protein_coding	OTTHUMT00000413800.2	-	0.00	56	0	G			24026198	+1	tier1	-	no_errors	ENST00000288014	ensembl	human	known	74_37	nonsense	11.43	31	4	SNP	0.017	T
TM9SF2	9375	genome.wustl.edu	37	13	100190111	100190111	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr13:100190111C>T	ENST00000376387.4	+	6	900	c.710C>T	c.(709-711)cCg>cTg	p.P237L	RNY3P6_ENST00000390895.1_RNA|TM9SF2_ENST00000463709.1_3'UTR	NM_004800.1	NP_004791.1	Q99805	TM9S2_HUMAN	transmembrane 9 superfamily member 2	237					transport (GO:0006810)	endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)				endometrium(3)|kidney(1)|large_intestine(5)|lung(5)|ovary(1)|prostate(2)	17	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.218)					AAACTTGAACCGAAAAGGTAA	0.318																																																	0													47.0	47.0	47.0					13																	100190111		2203	4300	6503	SO:0001583	missense	0			U81006	CCDS9493.1	13q32.2	2011-03-28			ENSG00000125304	ENSG00000125304			11865	protein-coding gene	gene with protein product		604678				9729438	Standard	NM_004800		Approved	P76	uc001voj.2	Q99805	OTTHUMG00000017272	ENST00000376387.4:c.710C>T	13.37:g.100190111C>T	ENSP00000365567:p.Pro237Leu		A8K399|Q2TAY5	Missense_Mutation	SNP	pfam_EMP70	p.P237L	ENST00000376387.4	37	c.710	CCDS9493.1	13	.	.	.	.	.	.	.	.	.	.	C	29.3	4.998539	0.93227	.	.	ENSG00000125304	ENST00000376387	T	0.46451	0.87	5.43	5.43	0.79202	.	0.048458	0.85682	D	0.000000	T	0.70727	0.3257	H	0.95260	3.645	0.80722	D	1	P	0.43024	0.798	P	0.51516	0.672	T	0.79315	-0.1854	10	0.72032	D	0.01	-15.0609	19.6655	0.95891	0.0:1.0:0.0:0.0	.	237	Q99805	TM9S2_HUMAN	L	237	ENSP00000365567:P237L	ENSP00000365567:P237L	P	+	2	0	TM9SF2	98988112	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	7.677000	0.84024	2.713000	0.92767	0.456000	0.33151	CCG	TM9SF2	-	pfam_EMP70	ENSG00000125304		0.318	TM9SF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TM9SF2	HGNC	protein_coding	OTTHUMT00000045602.3	-	0.00	46	0	C			100190111	+1	tier1	-	no_errors	ENST00000376387	ensembl	human	known	74_37	missense	20.00	24	6	SNP	1.000	T
TMEM132E	124842	genome.wustl.edu	37	17	32963118	32963118	+	Silent	SNP	G	G	C			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr17:32963118G>C	ENST00000321639.5	+	9	2128	c.1800G>C	c.(1798-1800)gtG>gtC	p.V600V		NM_207313.1	NP_997196.1	Q6IEE7	T132E_HUMAN	transmembrane protein 132E	600						integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(28)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	57				BRCA - Breast invasive adenocarcinoma(366;0.231)		AGGCCCAGGTGGTGGCCAGCC	0.652																																																	0													64.0	45.0	52.0					17																	32963118		2203	4300	6503	SO:0001819	synonymous_variant	0			BN000149	CCDS11283.1	17q12	2012-11-01			ENSG00000181291	ENSG00000181291			26991	protein-coding gene	gene with protein product							Standard	NM_207313		Approved		uc002hif.3	Q6IEE7	OTTHUMG00000132927	ENST00000321639.5:c.1800G>C	17.37:g.32963118G>C			Q8WUF4|Q8WVA5	Silent	SNP	NULL	p.V600	ENST00000321639.5	37	c.1800	CCDS11283.1	17																																																																																			TMEM132E	-	NULL	ENSG00000181291		0.652	TMEM132E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM132E	HGNC	protein_coding	OTTHUMT00000256440.2	-	0.00	51	0	G	NM_207313		32963118	+1	tier1	-	no_errors	ENST00000321639	ensembl	human	known	74_37	silent	14.63	35	6	SNP	1.000	C
TMEM135	65084	genome.wustl.edu	37	11	86782653	86782653	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr11:86782653A>C	ENST00000305494.5	+	3	397	c.358A>C	c.(358-360)Agc>Cgc	p.S120R	TMEM135_ENST00000355734.4_Missense_Mutation_p.S120R|TMEM135_ENST00000340353.7_Missense_Mutation_p.S120R|TMEM135_ENST00000535167.1_5'UTR|TMEM135_ENST00000532959.1_Intron	NM_022918.3	NP_075069.3	Q86UB9	TM135_HUMAN	transmembrane protein 135	120					peroxisome organization (GO:0007031)	integral component of membrane (GO:0016021)|peroxisome (GO:0005777)				NS(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	17		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)				TGAAAGAAAAAGCAGGTAAAA	0.358																																																	0													51.0	54.0	53.0					11																	86782653		2198	4299	6497	SO:0001583	missense	0			BX648678	CCDS8280.1, CCDS53692.1	11q14.2	2006-03-09			ENSG00000166575	ENSG00000166575			26167	protein-coding gene	gene with protein product						12477932	Standard	NM_022918		Approved	FLJ22104	uc001pch.3	Q86UB9	OTTHUMG00000167248	ENST00000305494.5:c.358A>C	11.37:g.86782653A>C	ENSP00000306344:p.Ser120Arg		Q6AW91|Q8ND01|Q9H6M3	Missense_Mutation	SNP	NULL	p.S120R	ENST00000305494.5	37	c.358	CCDS8280.1	11	.	.	.	.	.	.	.	.	.	.	A	24.4	4.529135	0.85706	.	.	ENSG00000166575	ENST00000340353;ENST00000525018;ENST00000355734;ENST00000305494	T;T;T;T	0.52983	0.71;0.72;2.57;0.64	5.34	5.34	0.76211	.	0.000000	0.85682	D	0.000000	T	0.67116	0.2859	M	0.72353	2.195	0.80722	D	1	D;D;D	0.89917	0.999;1.0;0.997	D;D;D	0.87578	0.974;0.998;0.952	T	0.68462	-0.5402	9	.	.	.	-17.3628	14.5008	0.67719	1.0:0.0:0.0:0.0	.	120;120;120	Q86UB9-2;Q86UB9;Q8N605	.;TM135_HUMAN;.	R	120	ENSP00000345513:S120R;ENSP00000433927:S120R;ENSP00000347973:S120R;ENSP00000306344:S120R	.	S	+	1	0	TMEM135	86460301	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	8.369000	0.90118	2.029000	0.59856	0.533000	0.62120	AGC	TMEM135	-	NULL	ENSG00000166575		0.358	TMEM135-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM135	HGNC	protein_coding	OTTHUMT00000393875.1	-	0.00	110	0	A	NM_022918		86782653	+1	tier1	-	no_errors	ENST00000305494	ensembl	human	known	74_37	missense	14.00	43	7	SNP	1.000	C
TMEM147	10430	genome.wustl.edu	37	19	36038043	36038043	+	Missense_Mutation	SNP	C	C	A	rs376027515		TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr19:36038043C>A	ENST00000222284.5	+	6	597	c.452C>A	c.(451-453)gCt>gAt	p.A151D	TMEM147_ENST00000392204.2_Missense_Mutation_p.A102D|AD000090.2_ENST00000589137.1_RNA|TMEM147_ENST00000392205.1_Missense_Mutation_p.A151D|AD000090.2_ENST00000588286.1_RNA|AD000090.2_ENST00000444728.1_RNA|AD000090.2_ENST00000590717.1_RNA	NM_032635.3	NP_116024.1	Q9BVK8	TM147_HUMAN	transmembrane protein 147	151						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(2)|lung(2)|prostate(1)	6	all_lung(56;1.05e-07)|Lung NSC(56;1.63e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)			GTCGCGTCTGCTCAGGTCTGG	0.552																																																	0													154.0	134.0	141.0					19																	36038043		2203	4300	6503	SO:0001583	missense	0			BC001118	CCDS12466.1, CCDS56091.1	19q13.12	2010-08-13			ENSG00000105677	ENSG00000105677			30414	protein-coding gene	gene with protein product		613585				20538592	Standard	NM_032635		Approved	NIFIE14, MGC1936	uc002oaj.2	Q9BVK8	OTTHUMG00000048105	ENST00000222284.5:c.452C>A	19.37:g.36038043C>A	ENSP00000222284:p.Ala151Asp		A8MWW0|O75790	Missense_Mutation	SNP	pfam_DUF2053_membrane	p.A151D	ENST00000222284.5	37	c.452	CCDS12466.1	19	.	.	.	.	.	.	.	.	.	.	C	27.8	4.865228	0.91511	.	.	ENSG00000105677	ENST00000392204;ENST00000222284;ENST00000392205	T;T;T	0.46063	0.88;0.88;0.88	5.63	5.63	0.86233	.	0.000000	0.85682	D	0.000000	T	0.64605	0.2613	M	0.72894	2.215	0.80722	D	1	D;P	0.89917	1.0;0.934	D;P	0.79784	0.993;0.559	T	0.64407	-0.6415	10	0.51188	T	0.08	.	17.1814	0.86856	0.0:1.0:0.0:0.0	.	102;151	A8MWW0;Q9BVK8	.;TM147_HUMAN	D	102;151;151	ENSP00000376040:A102D;ENSP00000222284:A151D;ENSP00000376041:A151D	ENSP00000222284:A151D	A	+	2	0	TMEM147	40729883	1.000000	0.71417	0.990000	0.47175	0.956000	0.61745	6.846000	0.75399	2.659000	0.90383	0.655000	0.94253	GCT	TMEM147	-	pfam_DUF2053_membrane	ENSG00000105677		0.552	TMEM147-004	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM147	HGNC	protein_coding	OTTHUMT00000109469.2	-	0.00	41	0	C	NM_032635		36038043	+1	tier1	-	no_errors	ENST00000222284	ensembl	human	known	74_37	missense	23.81	16	5	SNP	1.000	A
TMEM2	23670	genome.wustl.edu	37	9	74360015	74360015	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr9:74360015G>C	ENST00000377044.4	-	4	1492	c.953C>G	c.(952-954)gCc>gGc	p.A318G	TMEM2_ENST00000377066.5_Missense_Mutation_p.A318G	NM_001135820.1|NM_013390.2	NP_001129292.1|NP_037522.1	Q9UHN6	TMEM2_HUMAN	transmembrane protein 2	318					multicellular organismal development (GO:0007275)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(15)|liver(1)|lung(19)|ovary(2)|prostate(5)|skin(1)|stomach(1)|urinary_tract(2)	56		all_epithelial(88;4.56e-14)|Myeloproliferative disorder(762;0.0255)		GBM - Glioblastoma multiforme(74;7.45e-21)|OV - Ovarian serous cystadenocarcinoma(323;1.02e-16)		ACTTTTAGCGGCTGAATCCCC	0.507																																																	0													138.0	129.0	132.0					9																	74360015		2203	4300	6503	SO:0001583	missense	0				CCDS6638.1, CCDS47979.1	9q21.13	2011-07-19			ENSG00000135048	ENSG00000135048			11869	protein-coding gene	gene with protein product		605835					Standard	NM_013390		Approved		uc011lsa.1	Q9UHN6	OTTHUMG00000020000	ENST00000377044.4:c.953C>G	9.37:g.74360015G>C	ENSP00000366243:p.Ala318Gly		A6H8W9|B2RTQ6|Q5T838|Q5T839|Q5T840|Q5T841|Q8NBP6|Q9P2D5	Missense_Mutation	SNP	pfam_G8_domain,superfamily_Pectin_lyase_fold/virulence	p.A318G	ENST00000377044.4	37	c.953	CCDS6638.1	9	.	.	.	.	.	.	.	.	.	.	G	16.11	3.030150	0.54790	.	.	ENSG00000135048	ENST00000377044;ENST00000377066	T;T	0.75154	-0.91;-0.91	6.03	6.03	0.97812	.	0.000000	0.85682	D	0.000000	T	0.67515	0.2901	L	0.48935	1.535	0.80722	D	1	B;B	0.21520	0.034;0.057	B;B	0.24006	0.037;0.05	T	0.60321	-0.7286	10	0.19590	T	0.45	.	13.7134	0.62682	0.0699:0.0:0.9301:0.0	.	318;318	Q9UHN6;Q9UHN6-2	TMEM2_HUMAN;.	G	318	ENSP00000366243:A318G;ENSP00000366266:A318G	ENSP00000366243:A318G	A	-	2	0	TMEM2	73549835	1.000000	0.71417	0.996000	0.52242	0.724000	0.41520	7.415000	0.80131	2.861000	0.98227	0.655000	0.94253	GCC	TMEM2	-	NULL	ENSG00000135048		0.507	TMEM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM2	HGNC	protein_coding	OTTHUMT00000052618.2		0.00	28	0	G	NM_013390		74360015	-1			no_errors	ENST00000377044	ensembl	human	known	74_37	missense	10.71	25	3	SNP	1.000	C
TMEM8A	58986	genome.wustl.edu	37	16	427383	427383	+	Missense_Mutation	SNP	A	A	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr16:427383A>T	ENST00000431232.2	-	3	662	c.502T>A	c.(502-504)Ttg>Atg	p.L168M	TMEM8A_ENST00000476735.1_5'UTR|TMEM8A_ENST00000250930.3_De_novo_Start_InFrame	NM_021259.2	NP_067082.2	Q9HCN3	TMM8A_HUMAN	transmembrane protein 8A	168					cell adhesion (GO:0007155)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)				central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(2)|lung(5)|pancreas(1)|prostate(1)	14						CTCACCTTCAACTCGATCTTC	0.662											OREG0003703	type=REGULATORY REGION|Gene=TMEM8|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																																					0													8.0	10.0	10.0					16																	427383		2133	4198	6331	SO:0001583	missense	0			AB045292	CCDS10407.1	16p13.3	2009-06-12	2009-06-12	2009-06-12	ENSG00000129925	ENSG00000129925			17205	protein-coding gene	gene with protein product			"""transmembrane protein 6"", ""transmembrane protein 8 (five membrane-spanning domains)"""	TMEM6, TMEM8		11006113	Standard	NM_021259		Approved	M83	uc002cgu.4	Q9HCN3	OTTHUMG00000047996	ENST00000431232.2:c.502T>A	16.37:g.427383A>T	ENSP00000401338:p.Leu168Met	588	D3DU49|Q4TT35|Q8WU24|Q96S25|Q9BR03|Q9BT97|Q9H7B9	Missense_Mutation	SNP	pfam_DUF3522,pfscan_EG-like_dom	p.L168M	ENST00000431232.2	37	c.502	CCDS10407.1	16	.	.	.	.	.	.	.	.	.	.	A	8.011	0.757509	0.15846	.	.	ENSG00000129925	ENST00000431232	T	0.22743	1.94	4.38	-1.16	0.09678	.	0.667652	0.13433	N	0.388296	T	0.09818	0.0241	N	0.22421	0.69	0.51233	D	0.999918	P	0.45283	0.855	B	0.35859	0.212	T	0.21895	-1.0232	10	0.54805	T	0.06	-3.4259	4.4806	0.11766	0.1518:0.4304:0.0:0.4178	.	168	Q9HCN3	TMM8A_HUMAN	M	168	ENSP00000401338:L168M	ENSP00000401338:L168M	L	-	1	2	TMEM8A	367384	0.224000	0.23674	0.792000	0.32020	0.012000	0.07955	0.286000	0.18902	-0.382000	0.07870	-1.304000	0.01323	TTG	TMEM8A	-	NULL	ENSG00000129925		0.662	TMEM8A-001	KNOWN	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	TMEM8A	HGNC	protein_coding	OTTHUMT00000109257.2	-	0.00	47	0	A	NM_021259		427383	-1	tier1	-	no_errors	ENST00000431232	ensembl	human	known	74_37	missense	18.52	22	5	SNP	0.432	T
TMPRSS11A	339967	genome.wustl.edu	37	4	68780427	68780427	+	Frame_Shift_Del	DEL	C	C	-	rs150048717		TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr4:68780427delC	ENST00000334830.7	-	9	1729	c.983delG	c.(982-984)cgafs	p.R328fs	TMPRSS11A_ENST00000396188.2_Frame_Shift_Del_p.R325fs|TMPRSS11A_ENST00000508048.1_Frame_Shift_Del_p.R324fs|UBA6-AS1_ENST00000500538.2_RNA			Q6ZMR5	TM11A_HUMAN	transmembrane protease, serine 11A	328	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				cell cycle (GO:0007049)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	serine-type endopeptidase activity (GO:0004252)	p.R328Q(1)		breast(1)|cervix(2)|kidney(1)|large_intestine(8)|lung(11)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)	29						TCTGGCTTCTCGGAGATCATT	0.388																																					NSCLC(26;2 894 10941 14480 22546)												1	Substitution - Missense(1)	large_intestine(1)											138.0	130.0	132.0					4																	68780427		2203	4300	6503	SO:0001589	frameshift_variant	0			AF071882	CCDS3519.1	4q13.2	2010-04-13			ENSG00000187054	ENSG00000187054		"""Serine peptidases / Transmembrane"""	27954	protein-coding gene	gene with protein product		611704				15328353	Standard	NM_182606		Approved	ECRG1	uc003hdr.1	Q6ZMR5	OTTHUMG00000129303	ENST00000334830.7:c.983delG	4.37:g.68780427delC	ENSP00000334611:p.Arg328fs		J3KNQ8|Q2NKI9|Q6JE90|Q7RTY4|Q86TK8	Frame_Shift_Del	DEL	pfam_Peptidase_S1,pfam_SEA_dom,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pirsf_Pept_S1A_HAT/DESC1,pfscan_Peptidase_S1,prints_Peptidase_S1A	p.R328fs	ENST00000334830.7	37	c.983	CCDS3519.1	4																																																																																			TMPRSS11A	-	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pirsf_Pept_S1A_HAT/DESC1,pfscan_Peptidase_S1	ENSG00000187054		0.388	TMPRSS11A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TMPRSS11A	HGNC	protein_coding	OTTHUMT00000251433.3		0.00	61	0	C	NM_182606		68780427	-1	tier1		no_errors	ENST00000334830	ensembl	human	known	74_37	frame_shift_del	9.52	19	2	DEL	0.991	-
TNFRSF4	7293	genome.wustl.edu	37	1	1147484	1147484	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr1:1147484C>A	ENST00000379236.3	-	5	476	c.472G>T	c.(472-474)Gcc>Tcc	p.A158S	TNFRSF4_ENST00000453580.1_5'UTR	NM_003327.3	NP_003318.1	P43489	TNR4_HUMAN	tumor necrosis factor receptor superfamily, member 4	158					cellular defense response (GO:0006968)|immune response (GO:0006955)|inflammatory response (GO:0006954)|negative regulation of cytokine secretion (GO:0050710)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of immunoglobulin secretion (GO:0051024)|regulation of apoptotic process (GO:0042981)|regulation of protein kinase activity (GO:0045859)|T cell proliferation (GO:0042098)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)	tumor necrosis factor-activated receptor activity (GO:0005031)			large_intestine(1)|lung(2)|urinary_tract(1)	4	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;3.73e-36)|OV - Ovarian serous cystadenocarcinoma(86;1.01e-21)|Colorectal(212;3.94e-05)|COAD - Colon adenocarcinoma(227;4.22e-05)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.0025)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.199)		CTATTGCTGGCCGGCTGCAGG	0.682																																																	0													31.0	31.0	31.0					1																	1147484		2203	4299	6502	SO:0001583	missense	0			X75962	CCDS11.1	1p36	2008-02-05			ENSG00000186827	ENSG00000186827		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	11918	protein-coding gene	gene with protein product		600315		TXGP1L		7510240, 2828930	Standard	NM_003327		Approved	ACT35, OX40, CD134	uc001ade.3	P43489	OTTHUMG00000001415	ENST00000379236.3:c.472G>T	1.37:g.1147484C>A	ENSP00000368538:p.Ala158Ser		Q13663|Q2M312|Q5T7M0	Missense_Mutation	SNP	pfam_TNFR/NGFR_Cys_rich_reg,smart_TNFR/NGFR_Cys_rich_reg,pfscan_TNFR/NGFR_Cys_rich_reg,prints_TNFR_4	p.A158S	ENST00000379236.3	37	c.472	CCDS11.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.73|16.73	3.203921|3.203921	0.58234|0.58234	.|.	.|.	ENSG00000186827|ENSG00000186827	ENST00000379236|ENST00000453580	T|.	0.70045|.	-0.45|.	3.47|3.47	3.47|3.47	0.39725|0.39725	TNFR/CD27/30/40/95 cysteine-rich region (1);|.	1.052770|.	0.07572|.	N|.	0.918795|.	T|T	0.51805|0.51805	0.1696|0.1696	L|L	0.54323|0.54323	1.7|1.7	0.09310|0.09310	N|N	1|1	D;P|.	0.60160|.	0.987;0.82|.	P;P|.	0.56088|.	0.791;0.527|.	T|T	0.42816|0.42816	-0.9429|-0.9429	10|5	0.62326|.	D|.	0.03|.	-17.3512|-17.3512	12.8273|12.8273	0.57726|0.57726	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	103;158|.	B1AME4;P43489|.	.;TNR4_HUMAN|.	S|V	158|103	ENSP00000368538:A158S|.	ENSP00000368538:A158S|.	A|G	-|-	1|2	0|0	TNFRSF4|TNFRSF4	1137347|1137347	0.016000|0.016000	0.18221|0.18221	0.013000|0.013000	0.15412|0.15412	0.149000|0.149000	0.21700|0.21700	0.990000|0.990000	0.29642|0.29642	1.934000|1.934000	0.56057|0.56057	0.491000|0.491000	0.48974|0.48974	GCC|GGC	TNFRSF4	-	smart_TNFR/NGFR_Cys_rich_reg	ENSG00000186827		0.682	TNFRSF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNFRSF4	HGNC	protein_coding	OTTHUMT00000004086.1	-	0.00	109	0	C			1147484	-1	tier1	-	no_errors	ENST00000379236	ensembl	human	known	74_37	missense	11.65	91	12	SNP	0.040	A
TNFSF15	9966	genome.wustl.edu	37	9	117553227	117553227	+	Intron	SNP	A	A	G			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr9:117553227A>G	ENST00000374045.4	-	4	415				AL390240.1_ENST00000408807.1_RNA|TNFSF15_ENST00000374044.1_Silent_p.S10S	NM_001204344.1|NM_005118.3	NP_001191273.1|NP_005109.2	O95150	TNF15_HUMAN	tumor necrosis factor (ligand) superfamily, member 15						activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of NF-kappaB-inducing kinase activity (GO:0007250)|cytokine metabolic process (GO:0042107)|immune response (GO:0006955)|positive regulation of cytokine secretion (GO:0050715)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(4)|skin(1)	11						TCATTGGGAAACTGTAGACTT	0.373																																																	0													27.0	27.0	27.0					9																	117553227		2203	4300	6503	SO:0001627	intron_variant	0			AF039390	CCDS6809.1	9q32	2008-07-21			ENSG00000181634	ENSG00000181634		"""Tumor necrosis factor (ligand) superfamily"""	11931	protein-coding gene	gene with protein product	"""vascular endothelial cell growth inhibitor"", ""TNF superfamily ligand TL1A"", ""TNF ligand-related molecule 1"", ""vascular endothelial growth inhibitor-192A"""	604052				9434163	Standard	NM_005118		Approved	TL1, VEGI, TL1A, VEGI192A, MGC129934, MGC129935	uc004bjh.3	O95150	OTTHUMG00000021011	ENST00000374045.4:c.302-41T>C	9.37:g.117553227A>G			Q3SX69|Q5VJK8|Q5VWH1|Q8NFE9	Silent	SNP	pfam_TNF_dom,superfamily_Tumour_necrosis_fac-like_dom,smart_TNF_dom,pfscan_TNF_dom,prints_TNF	p.S10	ENST00000374045.4	37	c.30	CCDS6809.1	9																																																																																			TNFSF15	-	NULL	ENSG00000181634		0.373	TNFSF15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNFSF15	HGNC	protein_coding	OTTHUMT00000055424.2	-	0.00	19	0	A	NM_005118		117553227	-1	tier1	-	no_errors	ENST00000374044	ensembl	human	known	74_37	silent	33.33	12	6	SNP	0.000	G
TNIP3	79931	genome.wustl.edu	37	4	122085277	122085277	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr4:122085277C>T	ENST00000509841.1	-	4	313	c.235G>A	c.(235-237)Gca>Aca	p.A79T	TNIP3_ENST00000454328.1_Missense_Mutation_p.A2T|TNIP3_ENST00000057513.3_Missense_Mutation_p.A2T|TNIP3_ENST00000507879.1_Missense_Mutation_p.A72T	NM_001244764.1	NP_001231693.1			TNFAIP3 interacting protein 3											NS(1)|endometrium(4)|large_intestine(4)|lung(9)|ovary(1)|prostate(3)|skin(2)	24						ACAAAATGTGCCATGGAAGCT	0.388																																																	0													110.0	104.0	106.0					4																	122085277		2203	4300	6503	SO:0001583	missense	0			AJ320534	CCDS3718.1, CCDS58925.1, CCDS58926.1	4q27	2008-02-05			ENSG00000050730	ENSG00000050730			19315	protein-coding gene	gene with protein product		608019				11345586	Standard	NM_024873		Approved	LIND, FLJ21162, ABIN-3	uc021xrj.1	Q96KP6	OTTHUMG00000132969	ENST00000509841.1:c.235G>A	4.37:g.122085277C>T	ENSP00000426613:p.Ala79Thr			Missense_Mutation	SNP	NULL	p.A2T	ENST00000509841.1	37	c.4	CCDS58926.1	4	.	.	.	.	.	.	.	.	.	.	C	18.31	3.596442	0.66332	.	.	ENSG00000050730	ENST00000057513;ENST00000454328;ENST00000507879;ENST00000509841	T;T;T;T	0.60424	0.74;0.74;0.2;0.19	4.5	2.71	0.32032	.	0.176081	0.27567	N	0.018781	T	0.48750	0.1517	L	0.57536	1.79	0.09310	N	1	B;B;B	0.33318	0.192;0.408;0.408	B;B;B	0.31751	0.082;0.135;0.077	T	0.48603	-0.9021	10	0.87932	D	0	-4.2012	6.5541	0.22450	0.0:0.7133:0.1842:0.1025	.	72;2;2	B4DVF5;A5HU65;Q96KP6	.;.;TNIP3_HUMAN	T	2;2;72;79	ENSP00000057513:A2T;ENSP00000411817:A2T;ENSP00000427106:A72T;ENSP00000426613:A79T	ENSP00000057513:A2T	A	-	1	0	TNIP3	122304727	0.003000	0.15002	0.088000	0.20740	0.334000	0.28698	0.274000	0.18680	0.564000	0.29238	0.650000	0.86243	GCA	TNIP3	-	NULL	ENSG00000050730		0.388	TNIP3-003	PUTATIVE	basic|appris_candidate_longest|CCDS	protein_coding	TNIP3	HGNC	protein_coding	OTTHUMT00000364000.4		0.00	32	0	C	NM_024873		122085277	-1			no_errors	ENST00000057513	ensembl	human	known	74_37	missense	10.53	17	2	SNP	0.040	T
TNK2	10188	genome.wustl.edu	37	3	195594983	195594983	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr3:195594983C>A	ENST00000333602.6	-	12	2758	c.2141G>T	c.(2140-2142)tGc>tTc	p.C714F	TNK2_ENST00000428187.1_Missense_Mutation_p.C746F|TNK2_ENST00000381916.2_Missense_Mutation_p.C792F|TNK2_ENST00000392400.1_Missense_Mutation_p.C714F	NM_005781.4	NP_005772.3	Q07912	ACK1_HUMAN	tyrosine kinase, non-receptor, 2	714	Pro-rich.			Missing (in Ref. 4; AAH08884). {ECO:0000305}.	cell surface receptor signaling pathway (GO:0007166)|endocytosis (GO:0006897)|negative regulation of catalytic activity (GO:0043086)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphorylation (GO:0016310)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|regulation of clathrin-mediated endocytosis (GO:2000369)|small GTPase mediated signal transduction (GO:0007264)	axon (GO:0030424)|cell junction (GO:0030054)|clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|endosome (GO:0005768)|Grb2-EGFR complex (GO:0070436)|growth cone (GO:0030426)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|epidermal growth factor receptor binding (GO:0005154)|GTPase inhibitor activity (GO:0005095)|metal ion binding (GO:0046872)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)|WW domain binding (GO:0050699)			central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(11)|ovary(3)|prostate(4)|skin(2)|stomach(1)|urinary_tract(1)	29	all_cancers(143;6.48e-09)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;1.46e-22)|OV - Ovarian serous cystadenocarcinoma(49;8.3e-19)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;0.000757)	Adenosine triphosphate(DB00171)	TTGCCTCATGCACTCCTGCTG	0.711																																																	0													12.0	14.0	13.0					3																	195594983		2186	4281	6467	SO:0001583	missense	0			L13738	CCDS33927.1, CCDS33928.1	3q29	2013-09-02			ENSG00000061938	ENSG00000061938			19297	protein-coding gene	gene with protein product	"""activated Cdc42-associated kinase 1"""	606994				8497321, 14506255	Standard	XM_006713460		Approved	p21cdc42Hs, ACK, ACK1	uc003fvt.1	Q07912	OTTHUMG00000155737	ENST00000333602.6:c.2141G>T	3.37:g.195594983C>A	ENSP00000329425:p.Cys714Phe		Q6ZMQ0|Q8N6U7|Q96H59	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_Cdc42_binding_dom_like,pfam_Inhibitor_Mig-6,superfamily_Kinase-like_dom,superfamily_SH3_domain,superfamily_SAM/pointed,superfamily_UBA-like,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_SH3_domain,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_SH3_domain,pfscan_Prot_kinase_dom	p.C792F	ENST00000333602.6	37	c.2375	CCDS33928.1	3	.	.	.	.	.	.	.	.	.	.	C	15.09	2.731084	0.48939	.	.	ENSG00000061938	ENST00000333602;ENST00000381916;ENST00000416152;ENST00000428187;ENST00000392400	T;T;T;T;T	0.58506	0.33;0.33;0.33;0.33;0.33	5.59	5.59	0.84812	.	0.000000	0.85682	D	0.000000	T	0.66925	0.2839	L	0.29908	0.895	0.80722	D	1	D;D;D;D	0.76494	0.998;0.998;0.987;0.999	P;P;P;D	0.71184	0.858;0.899;0.737;0.972	T	0.68953	-0.5273	10	0.62326	D	0.03	.	18.2161	0.89886	0.0:1.0:0.0:0.0	.	714;792;746;239	Q07912;Q07912-3;C9J1X3;B3KXJ4	ACK1_HUMAN;.;.;.	F	714;792;281;746;714	ENSP00000329425:C714F;ENSP00000371341:C792F;ENSP00000398614:C281F;ENSP00000392546:C746F;ENSP00000376201:C714F	ENSP00000329425:C714F	C	-	2	0	TNK2	197079380	1.000000	0.71417	1.000000	0.80357	0.256000	0.26092	3.268000	0.51585	2.649000	0.89929	0.581000	0.79447	TGC	TNK2	-	NULL	ENSG00000061938		0.711	TNK2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TNK2	HGNC	protein_coding	OTTHUMT00000341437.3		0.00	27	0	C	NM_005781		195594983	-1			no_errors	ENST00000381916	ensembl	human	known	74_37	missense	11.76	15	2	SNP	1.000	A
TNKS1BP1	85456	genome.wustl.edu	37	11	57088071	57088071	+	Silent	SNP	A	A	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr11:57088071A>T	ENST00000532437.1	-	2	521	c.210T>A	c.(208-210)ggT>ggA	p.G70G	TNKS1BP1_ENST00000358252.3_Silent_p.G70G			Q9C0C2	TB182_HUMAN	tankyrase 1 binding protein 1, 182kDa	70	Arg/Glu/Lys/Pro-rich (charged).				gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|RNA metabolic process (GO:0016070)|telomere maintenance via telomerase (GO:0007004)	CCR4-NOT complex (GO:0030014)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|nuclear telomeric heterochromatin (GO:0005724)|nucleus (GO:0005634)	ankyrin binding (GO:0030506)|enzyme binding (GO:0019899)			breast(3)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(11)|lung(24)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	64		all_epithelial(135;0.21)				CAGCCAGGGGACCCCGGGGAG	0.672																																																	0													17.0	21.0	19.0					11																	57088071		2199	4292	6491	SO:0001819	synonymous_variant	0			AB051528	CCDS7951.1	11q12.2	2008-07-21			ENSG00000149115	ENSG00000149115			19081	protein-coding gene	gene with protein product		607104				11854288	Standard	NM_033396		Approved	TAB182, KIAA1741, FLJ45975	uc001njs.3	Q9C0C2	OTTHUMG00000167022	ENST00000532437.1:c.210T>A	11.37:g.57088071A>T			A7E2F8|Q6PJ35|Q6ZV74	Silent	SNP	NULL	p.G70	ENST00000532437.1	37	c.210	CCDS7951.1	11																																																																																			TNKS1BP1	-	NULL	ENSG00000149115		0.672	TNKS1BP1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	TNKS1BP1	HGNC	protein_coding	OTTHUMT00000392455.1		0.00	107	0	A	NM_033396		57088071	-1			no_errors	ENST00000358252	ensembl	human	known	74_37	silent	7.69	47	4	SNP	0.909	T
TNKS2	80351	genome.wustl.edu	37	10	93601945	93601946	+	Frame_Shift_Ins	INS	-	-	A			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr10:93601945_93601946insA	ENST00000371627.4	+	16	2235_2236	c.1856_1857insA	c.(1855-1860)acaaaafs	p.TK619fs		NM_025235.3	NP_079511.1	Q9H2K2	TNKS2_HUMAN	tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase 2	619					multicellular organism growth (GO:0035264)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of telomere maintenance via telomerase (GO:0032212)|protein ADP-ribosylation (GO:0006471)|protein auto-ADP-ribosylation (GO:0070213)|protein localization to chromosome, telomeric region (GO:0070198)|protein polyubiquitination (GO:0000209)|regulation of multicellular organism growth (GO:0040014)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nuclear chromosome, telomeric region (GO:0000784)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)|pericentriolar material (GO:0000242)|perinuclear region of cytoplasm (GO:0048471)	enzyme binding (GO:0019899)|metal ion binding (GO:0046872)|NAD+ ADP-ribosyltransferase activity (GO:0003950)	p.N622fs*29(1)		biliary_tract(1)|breast(1)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(11)|lung(14)|ovary(1)|prostate(2)|skin(3)|urinary_tract(1)	48		Colorectal(252;0.162)				GCAGACCCTACAAAAAAAAACA	0.391																																																	1	Deletion - Frameshift(1)	large_intestine(1)																																								SO:0001589	frameshift_variant	0			AF342982	CCDS7417.1	10q23.3	2013-01-10			ENSG00000107854	ENSG00000107854		"""Poly (ADP-ribose) polymerases"", ""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	15677	protein-coding gene	gene with protein product		607128					Standard	NM_025235		Approved	TNKL, TANK2, PARP-5b, PARP-5c, PARP5B, PARP5C, pART6	uc001khp.3	Q9H2K2	OTTHUMG00000018747	ENST00000371627.4:c.1865dupA	10.37:g.93601954_93601954dupA	ENSP00000360689:p.Thr619fs		B2RBD3|Q9H8F2|Q9HAS4	Frame_Shift_Ins	INS	pfam_Ankyrin_rpt,pfam_Poly(ADP-ribose)pol_cat_dom,pfam_SAM_2,pfam_SAM_type1,superfamily_Ankyrin_rpt-contain_dom,superfamily_SAM/pointed,smart_Ankyrin_rpt,smart_SAM,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_SAM,pfscan_Poly(ADP-ribose)pol_cat_dom,prints_Ankyrin_rpt	p.N622fs	ENST00000371627.4	37	c.1856_1857	CCDS7417.1	10																																																																																			TNKS2	-	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000107854		0.391	TNKS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNKS2	HGNC	protein_coding	OTTHUMT00000049374.1		0.00	47	0	0	NM_025235		93601946	+1			no_errors	ENST00000371627	ensembl	human	known	74_37	frame_shift_ins	6.06	31	2	INS	1.000:0.997	A
TP53	7157	genome.wustl.edu	37	17	7577539	7577539	+	Missense_Mutation	SNP	G	G	A	rs397516437|rs121912651		TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr17:7577539G>A	ENST00000269305.4	-	7	931	c.742C>T	c.(742-744)Cgg>Tgg	p.R248W	TP53_ENST00000413465.2_Missense_Mutation_p.R248W|TP53_ENST00000359597.4_Missense_Mutation_p.R248W|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000455263.2_Missense_Mutation_p.R248W|TP53_ENST00000445888.2_Missense_Mutation_p.R248W|TP53_ENST00000420246.2_Missense_Mutation_p.R248W	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	248	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Interacts with the 53BP2 SH3 domain.|Required for interaction with ZNF385A.		NR -> IP (in a sporadic cancer; somatic mutation).|NR -> KW (in sporadic cancers; somatic mutation).|R -> C (in a sporadic cancer; somatic mutation).|R -> G (in sporadic cancers; somatic mutation).|R -> L (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:1394225, ECO:0000269|PubMed:7682763}.|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in LFS; germline mutation and in sporadic cancers; somatic mutation; dbSNP:rs11540652). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:2263646, ECO:0000269|PubMed:7682763, ECO:0000269|PubMed:7887414}.|R -> W (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:1978757, ECO:0000269|PubMed:8829627}.		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R248W(544)|p.R155W(28)|p.R248G(12)|p.0?(8)|p.?(5)|p.N247_R248delNR(2)|p.R248fs*16(2)|p.N247_R248>KW(2)|p.M246_P250delMNRRP(2)|p.R248fs*97(2)|p.R248R(2)|p.R248fs*>39(1)|p.R248_P250delRRP(1)|p.unknown(1)|p.N247_R249delNRR(1)|p.N247_P250delNRRP(1)|p.R248C(1)|p.G245fs*14(1)|p.N247_R248>IP(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	ATGGGCCTCCGGTTCATGCCG	0.577	R248W(786O_KIDNEY)|R248W(CAS1_CENTRAL_NERVOUS_SYSTEM)|R248W(COLO320_LARGE_INTESTINE)|R248W(COLO680N_OESOPHAGUS)|R248W(DB_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248W(GCT_SOFT_TISSUE)|R248W(HCC2157_BREAST)|R248W(JIMT1_BREAST)|R248W(KO52_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248W(LUDLU1_LUNG)|R248W(LXF289_LUNG)|R248W(MIAPACA2_PANCREAS)|R248W(RD_SOFT_TISSUE)|R248W(SW837_LARGE_INTESTINE)|R248W(VCAP_PROSTATE)	111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	617	Substitution - Missense(585)|Whole gene deletion(8)|Deletion - In frame(7)|Unknown(6)|Insertion - Frameshift(3)|Deletion - Frameshift(3)|Complex - compound substitution(3)|Substitution - coding silent(2)	large_intestine(156)|breast(72)|ovary(42)|endometrium(38)|oesophagus(38)|skin(37)|haematopoietic_and_lymphoid_tissue(37)|central_nervous_system(35)|stomach(27)|lung(26)|upper_aerodigestive_tract(25)|urinary_tract(19)|biliary_tract(17)|pancreas(12)|prostate(10)|soft_tissue(6)|bone(6)|thyroid(4)|liver(4)|penis(2)|peritoneum(1)|vulva(1)|kidney(1)|cervix(1)	GRCh37	CM010465|CM900211	TP53	M	rs121912651						151.0	112.0	125.0					17																	7577539		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.742C>T	17.37:g.7577539G>A	ENSP00000269305:p.Arg248Trp		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.R248W	ENST00000269305.4	37	c.742	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	G	18.84	3.710019	0.68730	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	D;D;D;D;D;D;D;D	0.99869	-7.34;-7.34;-7.34;-7.34;-7.34;-7.34;-7.34;-7.34	4.62	2.56	0.30785	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99843	0.9928	M	0.92507	3.315	0.58432	A	0.999997	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;1.0	D	0.97208	0.9869	9	0.87932	D	0	-9.5643	7.568	0.27890	0.0893:0.0:0.7471:0.1636	.	248;248;155;248;248;248	P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;P53_HUMAN;.;.	W	248;248;248;248;248;248;237;155;116;155	ENSP00000410739:R248W;ENSP00000352610:R248W;ENSP00000269305:R248W;ENSP00000398846:R248W;ENSP00000391127:R248W;ENSP00000391478:R248W;ENSP00000425104:R116W;ENSP00000423862:R155W	ENSP00000269305:R248W	R	-	1	2	TP53	7518264	1.000000	0.71417	1.000000	0.80357	0.910000	0.53928	1.447000	0.35101	0.644000	0.30656	0.462000	0.41574	CGG	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor	ENSG00000141510		0.577	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	-	0.00	40	0	G	NM_000546		7577539	-1	tier1	rs121912651	no_errors	ENST00000269305	ensembl	human	known	74_37	missense	45.45	12	10	SNP	1.000	A
TOP2A	7153	genome.wustl.edu	37	17	38567942	38567942	+	Silent	SNP	T	T	C			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr17:38567942T>C	ENST00000423485.1	-	8	1076	c.918A>G	c.(916-918)aaA>aaG	p.K306K		NM_001067.3	NP_001058.2	P11388	TOP2A_HUMAN	topoisomerase (DNA) II alpha 170kDa	306					apoptotic chromosome condensation (GO:0030263)|ATP catabolic process (GO:0006200)|cellular response to DNA damage stimulus (GO:0006974)|chromosome segregation (GO:0007059)|DNA ligation (GO:0006266)|DNA topological change (GO:0006265)|DNA unwinding involved in DNA replication (GO:0006268)|embryonic cleavage (GO:0040016)|hematopoietic progenitor cell differentiation (GO:0002244)|mitotic cell cycle (GO:0000278)|mitotic DNA integrity checkpoint (GO:0044774)|mitotic recombination (GO:0006312)|positive regulation of apoptotic process (GO:0043065)|positive regulation of single stranded viral RNA replication via double stranded DNA intermediate (GO:0045870)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of viral genome replication (GO:0045070)|resolution of meiotic recombination intermediates (GO:0000712)|sister chromatid segregation (GO:0000819)	condensed chromosome (GO:0000793)|cytoplasm (GO:0005737)|DNA topoisomerase complex (ATP-hydrolyzing) (GO:0009330)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA binding, bending (GO:0008301)|DNA topoisomerase type II (ATP-hydrolyzing) activity (GO:0003918)|DNA-dependent ATPase activity (GO:0008094)|drug binding (GO:0008144)|enzyme binding (GO:0019899)|histone deacetylase binding (GO:0042826)|magnesium ion binding (GO:0000287)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase C binding (GO:0005080)|ubiquitin binding (GO:0043130)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(9)|ovary(5)|pancreas(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)	39		Breast(137;0.00328)	STAD - Stomach adenocarcinoma(5;0.00183)		Amsacrine(DB00276)|Ciprofloxacin(DB00537)|Dactinomycin(DB00970)|Daunorubicin(DB00694)|Dexrazoxane(DB00380)|Doxorubicin(DB00997)|Enoxacin(DB00467)|Epirubicin(DB00445)|Etoposide(DB00773)|Fleroxacin(DB04576)|Idarubicin(DB01177)|Levofloxacin(DB01137)|Lomefloxacin(DB00978)|Lucanthone(DB04967)|Mitoxantrone(DB01204)|Moxifloxacin(DB00218)|Norfloxacin(DB01059)|Ofloxacin(DB01165)|Pefloxacin(DB00487)|Podofilox(DB01179)|Sparfloxacin(DB01208)|Teniposide(DB00444)|Trovafloxacin(DB00685)|Valrubicin(DB00385)	GCTGAAAGCCTTTTTCACTCA	0.318																																																	0													117.0	108.0	111.0					17																	38567942		1845	4088	5933	SO:0001819	synonymous_variant	0				CCDS45672.1	17q21-q22	2008-08-06	2002-08-29		ENSG00000131747	ENSG00000131747	5.99.1.2		11989	protein-coding gene	gene with protein product		126430	"""topoisomerase (DNA) II alpha (170kD)"""	TOP2			Standard	NM_001067		Approved		uc002huq.3	P11388	OTTHUMG00000155008	ENST00000423485.1:c.918A>G	17.37:g.38567942T>C			B2RTS1|Q71UN1|Q71UQ5|Q9HB24|Q9HB25|Q9HB26|Q9UP44|Q9UQP9	Silent	SNP	pfam_Topo_IIA_A/C,pfam_Topo_IIA_bsu_dom2,pfam_DTHCT,pfam_HATPase_ATP-bd,superfamily_Topo_IIA_like_dom,superfamily_HATPase_ATP-bd,superfamily_Ribosomal_S5_D2-typ_fold,smart_Topo_IIA,smart_Topo_IIA_A/C,prints_TopoII_euk,prints_Topo_IIA,prints_Transcrpt_fac_NFYB/HAP3	p.K306	ENST00000423485.1	37	c.918	CCDS45672.1	17																																																																																			TOP2A	-	pfam_Topo_IIA_bsu_dom2,superfamily_Ribosomal_S5_D2-typ_fold,smart_Topo_IIA,prints_Transcrpt_fac_NFYB/HAP3	ENSG00000131747		0.318	TOP2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TOP2A	HGNC	protein_coding	OTTHUMT00000338035.1		0.00	47	0	T			38567942	-1			no_errors	ENST00000423485	ensembl	human	known	74_37	silent	6.06	31	2	SNP	1.000	C
TP73	7161	genome.wustl.edu	37	1	3639996	3639996	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr1:3639996G>C	ENST00000378295.4	+	6	850	c.695G>C	c.(694-696)gGc>gCc	p.G232A	TP73_ENST00000357733.3_Missense_Mutation_p.G232A|TP73_ENST00000603362.1_Missense_Mutation_p.G232A|TP73_ENST00000378288.4_Missense_Mutation_p.G183A|TP73_ENST00000604074.1_Missense_Mutation_p.G232A|TP73_ENST00000604479.1_Missense_Mutation_p.G232A|TP73_ENST00000378285.1_Missense_Mutation_p.G183A|TP73_ENST00000378280.1_Missense_Mutation_p.G183A|TP73_ENST00000346387.4_Missense_Mutation_p.G232A|TP73_ENST00000378290.4_Missense_Mutation_p.G161A|TP73_ENST00000354437.4_Missense_Mutation_p.G232A	NM_001204185.1|NM_005427.3	NP_001191114.1|NP_005418.1	O15350	P73_HUMAN	tumor protein p73	232	DNA-binding. {ECO:0000255}.				activation of MAPK activity (GO:0000187)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|cerebrospinal fluid secretion (GO:0033326)|digestive tract morphogenesis (GO:0048546)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|hippocampus development (GO:0021766)|inflammatory response (GO:0006954)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|kidney development (GO:0001822)|mismatch repair (GO:0006298)|mitotic G1 DNA damage checkpoint (GO:0031571)|negative regulation of JUN kinase activity (GO:0043508)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron development (GO:0048666)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell size (GO:0045793)|positive regulation of intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:1902167)|positive regulation of oligodendrocyte differentiation (GO:0048714)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|post-embryonic development (GO:0009791)|protein tetramerization (GO:0051262)|release of cytochrome c from mitochondria (GO:0001836)|response to gamma radiation (GO:0010332)|response to organonitrogen compound (GO:0010243)|response to X-ray (GO:0010165)|transcription, DNA-templated (GO:0006351)	chromatin (GO:0000785)|cytosol (GO:0005829)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|damaged DNA binding (GO:0003684)|double-stranded DNA binding (GO:0003690)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|p53 binding (GO:0002039)|protein kinase binding (GO:0019901)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|lung(8)|ovary(1)|prostate(1)	20	all_cancers(77;0.0395)|Ovarian(185;0.0634)|Lung NSC(156;0.188)|all_lung(157;0.198)	all_epithelial(116;7.42e-17)|all_lung(118;1.86e-06)|Lung NSC(185;0.000163)|Renal(390;0.00357)|Breast(487;0.00446)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Lung SC(97;0.109)|Ovarian(437;0.127)		Epithelial(90;5.57e-38)|OV - Ovarian serous cystadenocarcinoma(86;1.87e-22)|GBM - Glioblastoma multiforme(42;5.72e-16)|Colorectal(212;2.22e-05)|COAD - Colon adenocarcinoma(227;8.48e-05)|Kidney(185;0.000539)|BRCA - Breast invasive adenocarcinoma(365;0.000868)|STAD - Stomach adenocarcinoma(132;0.0072)|KIRC - Kidney renal clear cell carcinoma(229;0.00751)|Lung(427;0.226)		CCTGTCACCGGCAGGCAGAGC	0.647																																																	0													65.0	53.0	57.0					1																	3639996		2198	4292	6490	SO:0001583	missense	0			AB055065	CCDS49.1, CCDS44049.1, CCDS44050.1, CCDS44051.1, CCDS55566.1, CCDS55567.1, CCDS55568.1, CCDS55569.1, CCDS59965.1	1p36.3	2010-06-15			ENSG00000078900	ENSG00000078900			12003	protein-coding gene	gene with protein product		601990				9296498, 9288759	Standard	NM_001204186		Approved	P73	uc001akp.3	O15350	OTTHUMG00000000610	ENST00000378295.4:c.695G>C	1.37:g.3639996G>C	ENSP00000367545:p.Gly232Ala		B7Z7J4|B7Z8Z1|B7Z9C1|C9J521|O15351|Q17RN8|Q5TBV5|Q5TBV6|Q8NHW9|Q8TDY5|Q8TDY6|Q9NTK8	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_SAM_2,superfamily_p53-like_TF_DNA-bd,superfamily_SAM/pointed,superfamily_p53_tetrameristn,smart_SAM,prints_p53_tumour_suppressor	p.G232A	ENST00000378295.4	37	c.695	CCDS49.1	1	.	.	.	.	.	.	.	.	.	.	G	14.15	2.449998	0.43531	.	.	ENSG00000078900	ENST00000378295;ENST00000354437;ENST00000357733;ENST00000346387;ENST00000378288;ENST00000378285;ENST00000378280;ENST00000378290	D;D;D;D;D;D;D;D	0.99766	-6.69;-6.69;-6.69;-6.69;-6.69;-6.69;-6.69;-6.69	3.97	2.98	0.34508	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.053517	0.85682	D	0.000000	D	0.99039	0.9671	L	0.60067	1.865	0.80722	D	1	B;B;B;B;B;B	0.32693	0.025;0.38;0.156;0.041;0.105;0.187	B;B;B;B;B;B	0.36845	0.024;0.234;0.066;0.048;0.085;0.109	D	0.99945	1.1453	10	0.45353	T	0.12	-33.8992	11.252	0.49031	0.0:0.0:0.8178:0.1822	.	183;183;183;183;232;232	B7Z8Z1;O15350-10;O15350-9;O15350-8;O15350-2;O15350	.;.;.;.;.;P73_HUMAN	A	232;232;232;232;183;183;183;161	ENSP00000367545:G232A;ENSP00000346423:G232A;ENSP00000350366:G232A;ENSP00000340740:G232A;ENSP00000367537:G183A;ENSP00000367534:G183A;ENSP00000367529:G183A;ENSP00000367539:G161A	ENSP00000340740:G232A	G	+	2	0	TP73	3629856	1.000000	0.71417	0.998000	0.56505	0.990000	0.78478	7.751000	0.85126	1.959000	0.56917	0.491000	0.48974	GGC	TP73	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd	ENSG00000078900		0.647	TP73-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP73	HGNC	protein_coding	OTTHUMT00000001468.4	-	0.00	42	0	G	NM_005427		3639996	+1	tier1	-	no_errors	ENST00000378295	ensembl	human	known	74_37	missense	15.56	38	7	SNP	1.000	C
TRAPPC12	51112	genome.wustl.edu	37	2	3483161	3483161	+	Nonsense_Mutation	SNP	C	C	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr2:3483161C>T	ENST00000324266.5	+	12	2332	c.2137C>T	c.(2137-2139)Cag>Tag	p.Q713*	TRAPPC12-AS1_ENST00000453806.1_RNA|TRAPPC12_ENST00000382110.2_Nonsense_Mutation_p.Q713*	NM_016030.5	NP_057114.5	Q8WVT3	TPC12_HUMAN	trafficking protein particle complex 12	713					vesicle-mediated transport (GO:0016192)												GCAGAAGAAACAGGCCCTGCT	0.602																																																	0													86.0	87.0	86.0					2																	3483161		2203	4300	6503	SO:0001587	stop_gained	0			BC017475	CCDS1652.1	2p25.3	2013-01-10	2011-12-12	2011-12-12	ENSG00000171853	ENSG00000171853		"""Trafficking protein particle complex"", ""Tetratricopeptide (TTC) repeat domain containing"""	24284	protein-coding gene	gene with protein product		614139	"""tetratricopeptide repeat domain 15"""	TTC15		10810093, 21525244, 20562859	Standard	NM_016030		Approved	CGI-87, TTC-15	uc002qxm.1	Q8WVT3	OTTHUMG00000090328	ENST00000324266.5:c.2137C>T	2.37:g.3483161C>T	ENSP00000324318:p.Gln713*		B3KV01|D6W4Y2|Q8WVW1|Q9Y395	Nonsense_Mutation	SNP	smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.Q713*	ENST00000324266.5	37	c.2137	CCDS1652.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	41|41	8.680753|8.680753	0.98912|0.98912	.|.	.|.	ENSG00000171853|ENSG00000171853	ENST00000382110;ENST00000324266;ENST00000415624|ENST00000416918	.|.	.|.	.|.	5.09|5.09	5.09|5.09	0.68999|0.68999	.|.	0.051973|.	0.85682|.	D|.	0.000000|.	.|T	.|0.74191	.|0.3684	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.72384	.|-0.4310	.|4	0.29301|.	T|.	0.29|.	.|.	18.0312|18.0312	0.89285|0.89285	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|.	.|.	.|.	X|I	713;713;212|99	.|.	ENSP00000324318:Q713X|.	Q|T	+|+	1|2	0|0	TTC15|TTC15	3462168|3462168	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.942000|0.942000	0.58702|0.58702	7.500000|7.500000	0.81588|0.81588	2.804000|2.804000	0.96469|0.96469	0.655000|0.655000	0.94253|0.94253	CAG|ACA	TRAPPC12	-	NULL	ENSG00000171853		0.602	TRAPPC12-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	TRAPPC12	HGNC	protein_coding	OTTHUMT00000206693.2	-	0.00	17	0	C	NM_016030		3483161	+1	tier1	-	no_errors	ENST00000324266	ensembl	human	known	74_37	nonsense	33.33	6	3	SNP	1.000	T
TRAPPC13	80006	genome.wustl.edu	37	5	64946640	64946640	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr5:64946640G>C	ENST00000399438.3	+	6	777	c.432G>C	c.(430-432)ttG>ttC	p.L144F	TRAPPC13_ENST00000545191.1_Missense_Mutation_p.L144F|TRAPPC13_ENST00000505553.1_Missense_Mutation_p.L144F|TRAPPC13_ENST00000231526.4_Missense_Mutation_p.L144F|TRAPPC13_ENST00000438419.2_Missense_Mutation_p.L144F	NM_001093755.1|NM_024941.3	NP_001087224.1|NP_079217.2	A5PLN9	TPC13_HUMAN	trafficking protein particle complex 13	144																	GTTTCAGCTTGGTATGTGCTG	0.294																																																	0													70.0	67.0	68.0					5																	64946640		1798	4067	5865	SO:0001583	missense	0				CCDS47221.1, CCDS47222.1, CCDS47223.1, CCDS58950.1	5q12.3	2013-01-31	2013-01-24	2013-01-24	ENSG00000113597	ENSG00000113597			25828	protein-coding gene	gene with protein product	"""Trs65-related"""		"""chromosome 5 open reading frame 44"""	C5orf44		12477932	Standard	NM_024941		Approved	FLJ13611, FLJ26957, MGC48585	uc010iwu.1	A5PLN9	OTTHUMG00000163649	ENST00000399438.3:c.432G>C	5.37:g.64946640G>C	ENSP00000382367:p.Leu144Phe		Q17RZ9|Q49A23|Q4JHG0|Q6MZG4|Q8TCM2|Q9H8I3	Missense_Mutation	SNP	pfam_DUF974	p.L144F	ENST00000399438.3	37	c.432	CCDS47222.1	5	.	.	.	.	.	.	.	.	.	.	G	18.60	3.659551	0.67586	.	.	ENSG00000113597	ENST00000399438;ENST00000438419;ENST00000231526;ENST00000505553;ENST00000545191	.	.	.	5.7	5.7	0.88788	.	0.000000	0.85682	D	0.000000	D	0.82678	0.5089	H	0.94345	3.525	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.87578	0.997;0.997;0.997;0.998	D	0.85815	0.1382	9	0.87932	D	0	-4.0845	8.836	0.35113	0.1601:0.0:0.8399:0.0	.	144;144;144;144	A5PLN9-4;A5PLN9-2;A5PLN9-5;A5PLN9	.;.;.;CE044_HUMAN	F	144	.	ENSP00000231526:L144F	L	+	3	2	C5orf44	64982396	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	2.880000	0.48530	2.680000	0.91292	0.591000	0.81541	TTG	TRAPPC13	-	pfam_DUF974	ENSG00000113597		0.294	TRAPPC13-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	TRAPPC13	HGNC	protein_coding	OTTHUMT00000370113.1	-	0.00	28	0	G	NM_024941		64946640	+1	tier1	-	no_errors	ENST00000545191	ensembl	human	known	74_37	missense	21.05	15	4	SNP	1.000	C
TRIM49	57093	genome.wustl.edu	37	11	89537599	89537599	+	Silent	SNP	G	G	C			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr11:89537599G>C	ENST00000329758.1	-	3	367	c.39C>G	c.(37-39)ctC>ctG	p.L13L	TRIM49_ENST00000532501.2_Silent_p.L13L	NM_020358.2	NP_065091.1	P0CI25	TRI49_HUMAN	tripartite motif containing 49	13						intracellular (GO:0005622)	zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|liver(1)|lung(14)|prostate(1)|skin(2)|stomach(1)	27		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00556)				GGGGGCAGATGAGTTCCCCCT	0.468																																																	0													15.0	16.0	16.0					11																	89537599		2169	4257	6426	SO:0001819	synonymous_variant	0			AB037682	CCDS8287.1	11p11.12-q12	2012-05-21	2011-01-25	2004-11-17	ENSG00000168930	ENSG00000168930		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	13431	protein-coding gene	gene with protein product		606124	"""ring finger protein 18"", ""tripartite motif-containing 49"""	RNF18		11018261	Standard	NM_020358		Approved	TRIM49A	uc001pdb.3	P0CI25		ENST00000329758.1:c.39C>G	11.37:g.89537599G>C			A0AVR7|A0AVR9|Q6DJV1|Q9NS80	Silent	SNP	pfam_SPRY_rcpt,pfam_Znf_B-box,superfamily_ConA-like_lec_gl_sf,superfamily_Lambda_DNA-bd_dom,smart_Znf_RING,smart_Znf_B-box,smart_SPla/RYanodine_receptor_subgr,prints_Butyrophylin,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING	p.L13	ENST00000329758.1	37	c.39	CCDS8287.1	11																																																																																			TRIM49	-	NULL	ENSG00000168930		0.468	TRIM49-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM49	HGNC	protein_coding	OTTHUMT00000395435.1	-	0.00	173	0	G	NM_020358		89537599	-1	tier1	-	no_errors	ENST00000329758	ensembl	human	known	74_37	silent	18.64	96	22	SNP	0.004	C
TRIOBP	11078	genome.wustl.edu	37	22	38130719	38130719	+	Nonsense_Mutation	SNP	G	G	A			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr22:38130719G>A	ENST00000406386.3	+	9	4631	c.4376G>A	c.(4375-4377)tGg>tAg	p.W1459*		NM_001039141.2	NP_001034230.1	Q9H2D6	TARA_HUMAN	TRIO and F-actin binding protein	1459					actin modification (GO:0030047)|barbed-end actin filament capping (GO:0051016)|mitotic nuclear division (GO:0007067)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	actin filament binding (GO:0051015)|GTP-Rho binding (GO:0017049)|myosin II binding (GO:0045159)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	12	Melanoma(58;0.0574)					CCTGGGGGCTGGTGGGGATGT	0.682																																																	0													7.0	8.0	8.0					22																	38130719		1700	3798	5498	SO:0001587	stop_gained	0			AB051449	CCDS33644.1, CCDS43015.1, CCDS43016.1	22q13.1	2014-06-03			ENSG00000100106	ENSG00000100106		"""Pleckstrin homology (PH) domain containing"""	17009	protein-coding gene	gene with protein product		609761		DFNB28		11148140, 16385457, 16385458	Standard	NM_001039141		Approved	HRIHFB2122, KIAA1662, Tara, TAP68	uc003atr.3	Q9H2D6	OTTHUMG00000150657	ENST00000406386.3:c.4376G>A	22.37:g.38130719G>A	ENSP00000384312:p.Trp1459*		B1AHD4|B1AHD7|F2Z2W0|F8W6V6|O94797|Q2PZW8|Q2Q3Z9|Q2Q400|Q5R3M6|Q96DW1|Q9BT77|Q9BTL7|Q9BY98|Q9Y3L4	Nonsense_Mutation	SNP	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.W1459*	ENST00000406386.3	37	c.4376	CCDS43015.1	22	.	.	.	.	.	.	.	.	.	.	G	43	10.084016	0.99332	.	.	ENSG00000100106	ENST00000406386;ENST00000417174	.	.	.	4.97	3.92	0.45320	.	.	.	.	.	.	.	.	.	.	.	0.28086	N	0.931989	.	.	.	.	.	.	.	.	.	.	0.48119	T	0.1	.	12.4813	0.55844	0.0:0.169:0.831:0.0	.	.	.	.	X	1459;1420	.	ENSP00000384312:W1459X	W	+	2	0	TRIOBP	36460665	1.000000	0.71417	0.039000	0.18376	0.032000	0.12392	4.013000	0.57138	1.062000	0.40625	0.551000	0.68910	TGG	TRIOBP	-	NULL	ENSG00000100106		0.682	TRIOBP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRIOBP	HGNC	protein_coding	OTTHUMT00000319439.2	-	0.00	55	0	G			38130719	+1	tier1	-	no_errors	ENST00000406386	ensembl	human	known	74_37	nonsense	32.14	19	9	SNP	0.127	A
TRMT10B	158234	genome.wustl.edu	37	9	37768143	37768143	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr9:37768143G>T	ENST00000297994.3	+	5	556	c.491G>T	c.(490-492)tGg>tTg	p.W164L	RP11-613M10.9_ENST00000540557.1_Intron|TRMT10B_ENST00000377754.2_Missense_Mutation_p.W69L|TRMT10B_ENST00000377753.2_Missense_Mutation_p.W86L|TRMT10B_ENST00000537911.1_Intron	NM_144964.2	NP_659401.2	Q6PF06	TM10B_HUMAN	tRNA methyltransferase 10 homolog B (S. cerevisiae)	164	SAM-dependent MTase TRM10-type. {ECO:0000255|PROSITE-ProRule:PRU01012}.						methyltransferase activity (GO:0008168)										AGGCCATTTTGGATCTGCCTC	0.408																																																	0													184.0	173.0	176.0					9																	37768143		1851	4099	5950	SO:0001583	missense	0			BC057774	CCDS43804.1, CCDS69598.1, CCDS69600.1, CCDS69601.1	9p13.1	2012-06-28	2012-06-28	2012-06-28	ENSG00000165275	ENSG00000165275			26454	protein-coding gene	gene with protein product			"""RNA (guanine-9-) methyltransferase domain containing 3"""	RG9MTD3		14702039	Standard	XM_005251373		Approved	FLJ31455, bA3J10.9	uc004aai.3	Q6PF06	OTTHUMG00000019933	ENST00000297994.3:c.491G>T	9.37:g.37768143G>T	ENSP00000297994:p.Trp164Leu		B7Z216|B7Z3D3|Q05DJ4|Q5QP83|Q8NAG2|Q96N36	Missense_Mutation	SNP	pfam_tRNA_m1G_MeTrfase	p.W164L	ENST00000297994.3	37	c.491	CCDS43804.1	9	.	.	.	.	.	.	.	.	.	.	G	14.11	2.436148	0.43224	.	.	ENSG00000165275	ENST00000377753;ENST00000377754;ENST00000297994	T;T;T	0.21031	2.03;2.03;2.03	5.46	5.46	0.80206	.	0.128810	0.64402	D	0.000014	T	0.22044	0.0531	L	0.34521	1.04	0.80722	D	1	P;B;B	0.45768	0.866;0.0;0.003	P;B;B	0.47251	0.542;0.005;0.016	T	0.01496	-1.1340	10	0.11182	T	0.66	-8.3898	17.1382	0.86745	0.0:0.0:1.0:0.0	.	86;69;164	B7Z216;Q6PF06-2;Q6PF06	.;.;RG9D3_HUMAN	L	86;69;164	ENSP00000366982:W86L;ENSP00000366983:W69L;ENSP00000297994:W164L	ENSP00000297994:W164L	W	+	2	0	RG9MTD3	37758143	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.402000	0.59722	2.725000	0.93324	0.585000	0.79938	TGG	TRMT10B	-	pfam_tRNA_m1G_MeTrfase	ENSG00000165275		0.408	TRMT10B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRMT10B	HGNC	protein_coding	OTTHUMT00000052482.1	-	0.00	49	0	G	NM_144964		37768143	+1	tier1	-	no_errors	ENST00000297994	ensembl	human	known	74_37	missense	15.00	17	3	SNP	1.000	T
TRPA1	8989	genome.wustl.edu	37	8	72942163	72942163	+	Missense_Mutation	SNP	A	A	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr8:72942163A>T	ENST00000262209.4	-	24	3117	c.2910T>A	c.(2908-2910)caT>caA	p.H970Q	RP11-383H13.1_ENST00000537896.1_Intron|RP11-383H13.1_ENST00000524152.1_Intron|RP11-383H13.1_ENST00000457356.4_Intron	NM_007332.2	NP_015628.2	O75762	TRPA1_HUMAN	transient receptor potential cation channel, subfamily A, member 1	970					calcium ion transmembrane transport (GO:0070588)|detection of chemical stimulus involved in sensory perception of pain (GO:0050968)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|response to cold (GO:0009409)|response to drug (GO:0042493)|response to hydrogen peroxide (GO:0042542)|response to pain (GO:0048265)|thermoception (GO:0050955)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|stereocilium bundle (GO:0032421)	calcium channel activity (GO:0005262)|channel activity (GO:0015267)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(26)|lung(44)|ovary(4)|prostate(6)|stomach(1)	98			Epithelial(68;0.223)		Menthol(DB00825)	TCAATGATGCATGTTTCTGGA	0.388																																																	0													124.0	97.0	106.0					8																	72942163		2203	4300	6503	SO:0001583	missense	0			Y10601	CCDS34908.1	8q13	2013-01-10	2003-11-20	2003-11-20	ENSG00000104321	ENSG00000104321		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	497	protein-coding gene	gene with protein product		604775	"""ankyrin-like with transmembrane domains 1"""	ANKTM1		16382100	Standard	NM_007332		Approved		uc003xza.3	O75762	OTTHUMG00000164516	ENST00000262209.4:c.2910T>A	8.37:g.72942163A>T	ENSP00000262209:p.His970Gln		A6NIN6	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_Ion_trans_dom,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.H970Q	ENST00000262209.4	37	c.2910	CCDS34908.1	8	.	.	.	.	.	.	.	.	.	.	A	17.80	3.477969	0.63849	.	.	ENSG00000104321	ENST00000523582;ENST00000262209	T;T	0.29655	1.56;1.56	6.03	0.889	0.19212	.	0.140401	0.64402	D	0.000008	T	0.28034	0.0691	L	0.60455	1.87	0.38989	D	0.959104	P	0.39665	0.682	B	0.37692	0.256	T	0.14309	-1.0477	10	0.54805	T	0.06	-24.387	10.6591	0.45692	0.6703:0.0:0.3297:0.0	.	970	O75762	TRPA1_HUMAN	Q	822;970	ENSP00000428151:H822Q;ENSP00000262209:H970Q	ENSP00000262209:H970Q	H	-	3	2	TRPA1	73104717	1.000000	0.71417	0.995000	0.50966	0.962000	0.63368	0.945000	0.29056	0.135000	0.18707	0.533000	0.62120	CAT	TRPA1	-	NULL	ENSG00000104321		0.388	TRPA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRPA1	HGNC	protein_coding	OTTHUMT00000379079.2	-	0.00	58	0	A	NM_007332		72942163	-1	tier1	-	no_errors	ENST00000262209	ensembl	human	known	74_37	missense	33.33	28	14	SNP	0.997	T
TRRAP	8295	genome.wustl.edu	37	7	98515105	98515105	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr7:98515105C>G	ENST00000359863.4	+	20	2634	c.2425C>G	c.(2425-2427)Ctg>Gtg	p.L809V	TRRAP_ENST00000355540.3_Missense_Mutation_p.L809V|TRRAP_ENST00000446306.3_Missense_Mutation_p.L808V	NM_001244580.1	NP_001231509.1	Q9Y4A5	TRRAP_HUMAN	transformation/transcription domain-associated protein	809					chromatin organization (GO:0006325)|histone acetylation (GO:0016573)|histone deubiquitination (GO:0016578)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|mitotic cell cycle checkpoint (GO:0007093)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	NuA4 histone acetyltransferase complex (GO:0035267)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PCAF complex (GO:0000125)|STAGA complex (GO:0030914)|Swr1 complex (GO:0000812)|transcription factor TFTC complex (GO:0033276)	phosphotransferase activity, alcohol group as acceptor (GO:0016773)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)			NS(3)|breast(1)|central_nervous_system(10)|endometrium(16)|kidney(7)|large_intestine(36)|liver(1)|lung(54)|ovary(10)|pancreas(1)|prostate(8)|skin(16)|stomach(5)|upper_aerodigestive_tract(6)|urinary_tract(2)	176	all_cancers(62;6.96e-09)|all_epithelial(64;4.86e-09)|Lung NSC(181;0.01)|all_lung(186;0.016)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)			CTTTGTGGAGCTGTGTCTCAC	0.567																																																	0													143.0	121.0	128.0					7																	98515105		2203	4300	6503	SO:0001583	missense	0			AF076974	CCDS5659.1, CCDS59066.1	7q21.2-q22.1	2010-06-22			ENSG00000196367	ENSG00000196367			12347	protein-coding gene	gene with protein product		603015				9708738, 9885574	Standard	NM_003496		Approved	TR-AP, PAF400, Tra1	uc003upp.3	Q9Y4A5	OTTHUMG00000150403	ENST00000359863.4:c.2425C>G	7.37:g.98515105C>G	ENSP00000352925:p.Leu809Val		A4D265|O75218|Q9Y631|Q9Y6H4	Missense_Mutation	SNP	pfam_PIK-rel_kinase_FAT,pfam_PI3/4_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_PI3/4_kinase_cat_dom,pfscan_PIK_FAT,pfscan_FATC,pfscan_PI3/4_kinase_cat_dom	p.L809V	ENST00000359863.4	37	c.2425	CCDS59066.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	20.6|20.6	4.023485|4.023485	0.75390|0.75390	.|.	.|.	ENSG00000196367|ENSG00000196367	ENST00000359863;ENST00000355540;ENST00000446306|ENST00000456197	T;T|.	0.71817|.	3.07;-0.6|.	5.56|5.56	4.68|4.68	0.58851|0.58851	Armadillo-like helical (1);Armadillo-type fold (2);|.	0.000000|.	0.64402|.	D|.	0.000006|.	D|D	0.82981|0.82981	0.5155|0.5155	M|M	0.90425|0.90425	3.115|3.115	0.80722|0.80722	D|D	1|1	D;D;D|.	0.89917|.	1.0;1.0;1.0|.	D;D;D|.	0.91635|.	0.997;0.999;0.996|.	D|D	0.86403|0.86403	0.1743|0.1743	10|5	0.87932|.	D|.	0|.	.|.	14.7507|14.7507	0.69522|0.69522	0.0:0.9302:0.0:0.0698|0.0:0.9302:0.0:0.0698	.|.	809;523;809|.	Q9Y4A5-2;Q59FH1;Q9Y4A5|.	.;.;TRRAP_HUMAN|.	V|R	809;809;807|523	ENSP00000352925:L809V;ENSP00000347733:L809V|.	ENSP00000347733:L809V|.	L|S	+|+	1|3	2|2	TRRAP|TRRAP	98353041|98353041	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.930000|0.930000	0.56654|0.56654	2.700000|2.700000	0.47085|0.47085	1.376000|1.376000	0.46267|0.46267	0.456000|0.456000	0.33151|0.33151	CTG|AGC	TRRAP	-	superfamily_ARM-type_fold	ENSG00000196367		0.567	TRRAP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRRAP	HGNC	protein_coding	OTTHUMT00000317978.1	-	0.00	43	0	C	NM_003496		98515105	+1	tier1	-	no_errors	ENST00000359863	ensembl	human	known	74_37	missense	18.52	22	5	SNP	1.000	G
TSC2	7249	genome.wustl.edu	37	16	2130299	2130299	+	Silent	SNP	G	G	A			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr16:2130299G>A	ENST00000219476.3	+	30	4161	c.3531G>A	c.(3529-3531)gtG>gtA	p.V1177V	TSC2_ENST00000382538.6_Silent_p.V1085V|TSC2_ENST00000568454.1_Silent_p.V1144V|TSC2_ENST00000353929.4_Silent_p.V1134V|TSC2_ENST00000401874.2_Silent_p.V1133V|TSC2_ENST00000350773.4_Silent_p.V1177V|TSC2_ENST00000439673.2_Silent_p.V1097V	NM_000548.3	NP_000539.2	P49815	TSC2_HUMAN	tuberous sclerosis 2	1177					acute-phase response (GO:0006953)|cell cycle arrest (GO:0007050)|cell projection organization (GO:0030030)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of TOR signaling (GO:0032007)|negative regulation of Wnt signaling pathway (GO:0030178)|neural tube closure (GO:0001843)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive chemotaxis (GO:0050918)|positive regulation of Ras GTPase activity (GO:0032320)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|protein import into nucleus (GO:0006606)|protein kinase B signaling (GO:0043491)|protein localization (GO:0008104)|regulation of cell cycle (GO:0051726)|regulation of endocytosis (GO:0030100)|regulation of insulin receptor signaling pathway (GO:0046626)|response to hypoxia (GO:0001666)|vesicle-mediated transport (GO:0016192)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|TSC1-TSC2 complex (GO:0033596)	GTPase activator activity (GO:0005096)|phosphatase binding (GO:0019902)|protein homodimerization activity (GO:0042803)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(4)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(3)|lung(19)|ovary(2)|pancreas(1)|prostate(2)|skin(7)|soft_tissue(1)	56		Hepatocellular(780;0.0202)				GGGTTCCTGTGCAGGAGAAGA	0.682			"""D, Mis, N, F, S"""			"""hamartoma, renal cell"""			Tuberous Sclerosis																														yes	Rec		Tuberous sclerosis 2	16	16p13.3	7249	tuberous sclerosis 2 gene		"""E, O"""	0													59.0	66.0	64.0					16																	2130299		2198	4297	6495	SO:0001819	synonymous_variant	0	Familial Cancer Database	TS, Tuberous Sclerosis Complex, TSC, Bourneville-Pringle disease	AB014460	CCDS10458.1, CCDS45384.1, CCDS58408.1	16p13.3	2014-09-17			ENSG00000103197	ENSG00000103197			12363	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 160"""	191092		TSC4		1303246, 7558029	Standard	NM_001077183		Approved	tuberin, LAM, PPP1R160	uc002con.3	P49815	OTTHUMG00000128745	ENST00000219476.3:c.3531G>A	16.37:g.2130299G>A			A7E2E2|B4DIL8|B4DIQ7|B4DRN2|B7Z2B8|C9J378|O75275|Q4LE71|Q8TAZ1	Silent	SNP	pfam_Tuberin-type_domain,pfam_Tuberin_N,pfam_Rap_GAP_dom,superfamily_ARM-type_fold,pfscan_Rap_GAP_dom,prints_Tuberin	p.V1177	ENST00000219476.3	37	c.3531	CCDS10458.1	16																																																																																			TSC2	-	NULL	ENSG00000103197		0.682	TSC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TSC2	HGNC	protein_coding	OTTHUMT00000250657.2	-	0.00	66	0	G	NM_000548		2130299	+1	tier1	-	no_errors	ENST00000219476	ensembl	human	known	74_37	silent	23.81	48	15	SNP	0.000	A
TSC22D2	9819	genome.wustl.edu	37	3	150128711	150128711	+	Missense_Mutation	SNP	C	C	T	rs139411630	byFrequency	TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr3:150128711C>T	ENST00000361875.3	+	1	2590	c.1574C>T	c.(1573-1575)tCt>tTt	p.S525F	TSC22D2_ENST00000361136.2_Missense_Mutation_p.S525F	NM_014779.2	NP_055594.1	O75157	T22D2_HUMAN	TSC22 domain family, member 2	525					response to osmotic stress (GO:0006970)		sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(2)|endometrium(2)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)	18			LUSC - Lung squamous cell carcinoma(72;0.0538)|Lung(72;0.066)			TCTACCACTTCTGTTACTATG	0.612																																																	0								C	PHE/SER	1,4405	2.1+/-5.4	0,1,2202	60.0	62.0	61.0		1574	4.6	1.0	3	dbSNP_134	61	4,8596	3.7+/-12.6	0,4,4296	yes	missense	TSC22D2	NM_014779.2	155	0,5,6498	TT,TC,CC		0.0465,0.0227,0.0384	probably-damaging	525/781	150128711	5,13001	2203	4300	6503	SO:0001583	missense	0			AB014569	CCDS3149.1	3q25.1	2005-03-01			ENSG00000196428	ENSG00000196428			29095	protein-coding gene	gene with protein product						9734811	Standard	NM_014779		Approved	KIAA0669, TILZ4a, TILZ4b, TILZ4c	uc003exv.3	O75157	OTTHUMG00000159744	ENST00000361875.3:c.1574C>T	3.37:g.150128711C>T	ENSP00000354543:p.Ser525Phe		D3DNI5|Q6PI50|Q9H2Z6|Q9H2Z7|Q9H2Z8	Missense_Mutation	SNP	pfam_TSC-22_Dip_Bun	p.S525F	ENST00000361875.3	37	c.1574	CCDS3149.1	3	.	.	.	.	.	.	.	.	.	.	C	21.1	4.099498	0.76983	2.27E-4	4.65E-4	ENSG00000196428	ENST00000361875;ENST00000361136	T;T	0.34859	1.4;1.34	4.56	4.56	0.56223	.	0.122882	0.35555	N	0.003124	T	0.46678	0.1405	L	0.27053	0.805	0.41827	D	0.990058	D;D	0.69078	0.997;0.995	D;P	0.66497	0.944;0.88	T	0.53294	-0.8459	10	0.72032	D	0.01	.	16.9661	0.86286	0.0:1.0:0.0:0.0	.	525;525	O75157-2;O75157	.;T22D2_HUMAN	F	525	ENSP00000354543:S525F;ENSP00000354893:S525F	ENSP00000354893:S525F	S	+	2	0	TSC22D2	151611401	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.653000	0.46691	2.089000	0.63090	0.563000	0.77884	TCT	TSC22D2	-	NULL	ENSG00000196428		0.612	TSC22D2-001	KNOWN	basic|CCDS	protein_coding	TSC22D2	HGNC	protein_coding	OTTHUMT00000357123.2	-	0.00	41	0	C	NM_014779		150128711	+1	tier1	rs139411630	no_errors	ENST00000361875	ensembl	human	known	74_37	missense	20.00	20	5	SNP	1.000	T
TSHR	7253	genome.wustl.edu	37	14	81610476	81610476	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr14:81610476C>A	ENST00000541158.2	+	11	2396	c.2074C>A	c.(2074-2076)Cta>Ata	p.L692I	TSHR_ENST00000298171.2_Missense_Mutation_p.L692I|RP11-114N19.3_ENST00000557775.1_RNA			P16473	TSHR_HUMAN	thyroid stimulating hormone receptor	692					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adult locomotory behavior (GO:0008344)|B cell differentiation (GO:0030183)|cell-cell signaling (GO:0007267)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|positive regulation of cell proliferation (GO:0008284)|positive regulation of multicellular organism growth (GO:0040018)|regulation of locomotion (GO:0040012)|thyroid-stimulating hormone signaling pathway (GO:0038194)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	thyroid-stimulating hormone receptor activity (GO:0004996)			breast(2)|endometrium(2)|kidney(1)|large_intestine(10)|lung(18)|ovary(6)|prostate(3)|skin(2)|stomach(1)|thyroid(291)|upper_aerodigestive_tract(1)	337				BRCA - Breast invasive adenocarcinoma(234;0.0402)	Thyrotropin Alfa(DB00024)	TGTGTTCATCCTACTCAGCAA	0.478			Mis		toxic thyroid adenoma	thyroid  adenoma	Hereditary nonautoimmune hyperthyroidism; subclinical hypothyroidism																																yes	Dom	yes		14	14q31	7253	thyroid stimulating hormone receptor	yes	E	0													156.0	148.0	150.0					14																	81610476		2203	4300	6503	SO:0001583	missense	0			AY429111	CCDS9872.1, CCDS32131.1, CCDS55935.1	14q24-q31	2014-09-17			ENSG00000165409	ENSG00000165409		"""GPCR / Class A : Gonadotropin and TSH receptors"""	12373	protein-coding gene	gene with protein product		603372				2558651, 2610690	Standard	NM_001018036		Approved	LGR3	uc001xvd.1	P16473		ENST00000541158.2:c.2074C>A	14.37:g.81610476C>A	ENSP00000441235:p.Leu692Ile		A0PJU7|F5GYU5|G3V2A9|Q16503|Q8TB90|Q96GT6|Q9P1V4|Q9ULA3|Q9UPH3	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_TSH_rcpt,prints_Gphrmn_rcpt_fam,prints_GPCR_Rhodpsn,prints_FSH_rcpt,prints_LSH_rcpt	p.L692I	ENST00000541158.2	37	c.2074	CCDS9872.1	14	.	.	.	.	.	.	.	.	.	.	C	17.57	3.422285	0.62622	.	.	ENSG00000165409	ENST00000541158;ENST00000412429;ENST00000298171	D;D	0.94232	-3.38;-3.38	5.23	3.32	0.38043	.	0.000000	0.85682	D	0.000000	D	0.96430	0.8835	M	0.88906	2.99	0.53688	D	0.99997	D	0.89917	1.0	D	0.87578	0.998	D	0.95879	0.8897	10	0.87932	D	0	.	8.6598	0.34086	0.0:0.7465:0.0:0.2535	.	692	F5GYU5	.	I	692;339;692	ENSP00000441235:L692I;ENSP00000298171:L692I	ENSP00000298171:L692I	L	+	1	2	TSHR	80680229	0.999000	0.42202	1.000000	0.80357	0.992000	0.81027	2.183000	0.42565	1.131000	0.42111	0.561000	0.74099	CTA	TSHR	-	prints_Gphrmn_rcpt_fam	ENSG00000165409		0.478	TSHR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSHR	HGNC	protein_coding	OTTHUMT00000413364.1		0.00	74	0	C	NM_000369		81610476	+1			no_errors	ENST00000298171	ensembl	human	known	74_37	missense	5.41	35	2	SNP	1.000	A
TSPAN1	10103	genome.wustl.edu	37	1	46650025	46650025	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr1:46650025G>C	ENST00000372003.1	+	4	684	c.220G>C	c.(220-222)Ggc>Cgc	p.G74R	TSPAN1_ENST00000498443.1_3'UTR	NM_005727.3	NP_005718.2	O60635	TSN1_HUMAN	tetraspanin 1	74					cell migration (GO:0016477)|cell proliferation (GO:0008283)|positive regulation of endocytosis (GO:0045807)|protein stabilization (GO:0050821)|thiamine transmembrane transport (GO:0071934)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	thiamine uptake transmembrane transporter activity (GO:0015403)			kidney(1)|large_intestine(1)|lung(5)|ovary(1)	8	Acute lymphoblastic leukemia(166;0.155)	Medulloblastoma(700;0.00498)|all_neural(321;0.0212)				TGGTTTCCTGGGCTGCTATGG	0.572																																																	0													148.0	113.0	125.0					1																	46650025		2203	4300	6503	SO:0001583	missense	0			BC013404	CCDS530.1	1p33	2013-02-14			ENSG00000117472	ENSG00000117472		"""Tetraspanins"""	20657	protein-coding gene	gene with protein product		613170				9714763, 10719184	Standard	NM_005727		Approved	TSPAN-1, NET-1	uc001cpd.3	O60635	OTTHUMG00000007602	ENST00000372003.1:c.220G>C	1.37:g.46650025G>C	ENSP00000361072:p.Gly74Arg		D3DQ14|O60745|Q5VST0	Missense_Mutation	SNP	pfam_Tetraspanin/Peripherin,superfamily_Tetraspanin_EC2,prints_Tetraspanin	p.G74R	ENST00000372003.1	37	c.220	CCDS530.1	1	.	.	.	.	.	.	.	.	.	.	G	25.1	4.601070	0.87055	.	.	ENSG00000117472	ENST00000372003	D	0.95001	-3.58	4.87	3.96	0.45880	Tetraspanin, conserved site (1);	0.000000	0.85682	D	0.000000	D	0.97742	0.9259	M	0.93678	3.445	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98472	1.0601	10	0.87932	D	0	.	13.3492	0.60593	0.0763:0.0:0.9237:0.0	.	74	O60635	TSN1_HUMAN	R	74	ENSP00000361072:G74R	ENSP00000361072:G74R	G	+	1	0	TSPAN1	46422612	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.718000	0.84743	1.268000	0.44264	0.557000	0.71058	GGC	TSPAN1	-	pfam_Tetraspanin/Peripherin,prints_Tetraspanin	ENSG00000117472		0.572	TSPAN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSPAN1	HGNC	protein_coding	OTTHUMT00000020135.1	-	0.00	50	0	G	NM_005727		46650025	+1	tier1	-	no_errors	ENST00000372003	ensembl	human	known	74_37	missense	23.33	23	7	SNP	1.000	C
TSPAN31	6302	genome.wustl.edu	37	12	58139586	58139586	+	Missense_Mutation	SNP	C	C	T	rs568048822		TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr12:58139586C>T	ENST00000257910.3	+	2	396	c.122C>T	c.(121-123)tCc>tTc	p.S41F	TSPAN31_ENST00000547992.1_Missense_Mutation_p.S41F|TSPAN31_ENST00000553221.1_3'UTR|TSPAN31_ENST00000547472.1_Intron	NM_005981.3	NP_005972.1	Q12999	TSN31_HUMAN	tetraspanin 31	41					positive regulation of cell proliferation (GO:0008284)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)				endometrium(1)|kidney(1)|lung(5)	7	all_cancers(7;4.96e-69)|Lung NSC(6;5.5e-25)|all_lung(6;3.87e-23)|all_epithelial(6;1.66e-15)|Glioma(12;6.95e-05)|all_neural(12;0.00016)|Melanoma(17;0.122)		GBM - Glioblastoma multiforme(5;4.21e-120)|all cancers(5;3.75e-83)|BRCA - Breast invasive adenocarcinoma(9;0.0294)			GGTCTGGTGTCCAGCATCCAC	0.542													C|||	1	0.000199681	0.0008	0.0	5008	,	,		18716	0.0		0.0	False		,,,				2504	0.0																0													164.0	140.0	148.0					12																	58139586		2203	4300	6503	SO:0001583	missense	0				CCDS8952.1	12q13-q14	2013-02-14	2005-08-16	2005-08-16		ENSG00000135452		"""Tetraspanins"""	10539	protein-coding gene	gene with protein product		181035	"""sarcoma amplified sequence"""	SAS			Standard	NM_005981		Approved		uc001spt.3	Q12999		ENST00000257910.3:c.122C>T	12.37:g.58139586C>T	ENSP00000257910:p.Ser41Phe		O00577|Q53X76	Missense_Mutation	SNP	pfam_Tetraspanin/Peripherin,prints_Tetraspanin	p.S41F	ENST00000257910.3	37	c.122	CCDS8952.1	12	.	.	.	.	.	.	.	.	.	.	C	25.3	4.624117	0.87560	.	.	ENSG00000135452	ENST00000257910;ENST00000547992	T	0.80393	-1.37	4.57	4.57	0.56435	.	0.000000	0.85682	D	0.000000	D	0.88908	0.6565	M	0.76574	2.34	0.80722	D	1	D;D	0.76494	0.997;0.999	D;D	0.74348	0.918;0.983	D	0.89764	0.3949	10	0.59425	D	0.04	-0.4483	16.6554	0.85227	0.0:1.0:0.0:0.0	.	41;41	F8VS78;Q12999	.;TSN31_HUMAN	F	41	ENSP00000257910:S41F	ENSP00000257910:S41F	S	+	2	0	TSPAN31	56425853	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.312000	0.59154	2.539000	0.85634	0.460000	0.39030	TCC	TSPAN31	-	pfam_Tetraspanin/Peripherin	ENSG00000135452		0.542	TSPAN31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSPAN31	HGNC	protein_coding	OTTHUMT00000408778.1		0.00	39	0	C			58139586	+1			no_errors	ENST00000257910	ensembl	human	known	74_37	missense	14.29	12	2	SNP	1.000	T
TTC16	158248	genome.wustl.edu	37	9	130485567	130485567	+	Missense_Mutation	SNP	G	G	A	rs377723581		TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr9:130485567G>A	ENST00000373289.3	+	7	907	c.827G>A	c.(826-828)cGt>cAt	p.R276H	TTC16_ENST00000489226.1_3'UTR|PTRH1_ENST00000429848.1_Intron|TTC16_ENST00000393748.4_Missense_Mutation_p.R100H|PTRH1_ENST00000419060.1_Intron	NM_144965.1	NP_659402.1	Q8NEE8	TTC16_HUMAN	tetratricopeptide repeat domain 16	276										central_nervous_system(2)|endometrium(3)|lung(7)|ovary(3)|pancreas(2)|prostate(4)|skin(1)	22						CGGATCAACCGTGCCATCGAG	0.637													G|||	1	0.000199681	0.0008	0.0	5008	,	,		18898	0.0		0.0	False		,,,				2504	0.0																0								G	HIS/ARG	2,4404	4.2+/-10.8	0,2,2201	93.0	72.0	79.0		827	3.2	1.0	9		79	0,8600		0,0,4300	no	missense	TTC16	NM_144965.1	29	0,2,6501	AA,AG,GG		0.0,0.0454,0.0154	benign	276/874	130485567	2,13004	2203	4300	6503	SO:0001583	missense	0			AK057342	CCDS6875.1	9q34.13	2013-01-10			ENSG00000167094	ENSG00000167094		"""Tetratricopeptide (TTC) repeat domain containing"""	26536	protein-coding gene	gene with protein product						12477932	Standard	NM_144965		Approved	FLJ32780	uc004brq.1	Q8NEE8	OTTHUMG00000020711	ENST00000373289.3:c.827G>A	9.37:g.130485567G>A	ENSP00000362386:p.Arg276His		B4DYG4|B5ME24|Q5JU66|Q96M72	Missense_Mutation	SNP	pfam_TPR_2,pfam_TPR_1,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.R276H	ENST00000373289.3	37	c.827	CCDS6875.1	9	.	.	.	.	.	.	.	.	.	.	G	4.516	0.095779	0.08681	4.54E-4	0.0	ENSG00000167094	ENST00000373289;ENST00000393748	T;T	0.64618	-0.11;0.12	5.03	3.17	0.36434	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.358768	0.27668	N	0.018352	T	0.49915	0.1585	L	0.41492	1.28	0.20764	N	0.999859	B;P;B	0.43909	0.241;0.821;0.241	B;B;B	0.41036	0.082;0.346;0.082	T	0.36696	-0.9737	10	0.14656	T	0.56	-6.6721	11.6839	0.51474	0.0:0.3445:0.6555:0.0	.	263;228;276	B4DZ42;B4DH05;Q8NEE8	.;.;TTC16_HUMAN	H	276;100	ENSP00000362386:R276H;ENSP00000377349:R100H	ENSP00000362386:R276H	R	+	2	0	TTC16	129525388	0.402000	0.25311	0.979000	0.43373	0.186000	0.23388	0.290000	0.18975	0.698000	0.31739	-0.467000	0.05162	CGT	TTC16	-	smart_TPR_repeat,pfscan_TPR-contain_dom	ENSG00000167094		0.637	TTC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTC16	HGNC	protein_coding	OTTHUMT00000054224.1	-	0.00	27	0	G	NM_144965		130485567	+1	tier1	-	no_errors	ENST00000373289	ensembl	human	known	74_37	missense	35.00	13	7	SNP	0.985	A
TTC23L	153657	genome.wustl.edu	37	5	34864642	34864642	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr5:34864642A>G	ENST00000505624.1	+	6	740	c.637A>G	c.(637-639)Aac>Gac	p.N213D	TTC23L_ENST00000514080.1_3'UTR	NM_144725.3	NP_653326.3	Q6PF05	TT23L_HUMAN	tetratricopeptide repeat domain 23-like	213										breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(9)|prostate(2)|stomach(1)|urinary_tract(1)	22						AGTCTCTGAGAACGACCTAAC	0.413																																																	0													182.0	177.0	179.0					5																	34864642		1847	4096	5943	SO:0001583	missense	0				CCDS54840.1	5p13.2	2008-07-14			ENSG00000205838	ENSG00000205838			26355	protein-coding gene	gene with protein product						12477932	Standard	NM_144725		Approved	FLJ25439	uc003jiu.3	Q6PF05	OTTHUMG00000162020	ENST00000505624.1:c.637A>G	5.37:g.34864642A>G	ENSP00000422188:p.Asn213Asp		Q6RGS4|Q8N7R3|Q96LJ2	Missense_Mutation	SNP	NULL	p.N213D	ENST00000505624.1	37	c.637	CCDS54840.1	5	.	.	.	.	.	.	.	.	.	.	A	12.35	1.910872	0.33721	.	.	ENSG00000205838	ENST00000505624;ENST00000535797	T	0.73575	-0.76	5.6	5.6	0.85130	.	0.331368	0.31082	N	0.008296	T	0.57533	0.2060	N	0.08118	0	0.23150	N	0.998214	B;B;B	0.23990	0.0;0.095;0.0	B;B;B	0.24155	0.0;0.051;0.0	T	0.54873	-0.8228	10	0.49607	T	0.09	-5.9084	14.7791	0.69751	1.0:0.0:0.0:0.0	.	213;144;213	Q6PF05-2;B4DEX1;Q6PF05	.;.;TT23L_HUMAN	D	213	ENSP00000422188:N213D	ENSP00000425242:N213D	N	+	1	0	TTC23L	34900399	1.000000	0.71417	1.000000	0.80357	0.371000	0.29859	5.189000	0.65098	2.136000	0.66102	0.460000	0.39030	AAC	TTC23L	-	NULL	ENSG00000205838		0.413	TTC23L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTC23L	HGNC	protein_coding	OTTHUMT00000366819.1	-	0.00	51	0	A	NM_144725		34864642	+1	tier1	-	no_errors	ENST00000505624	ensembl	human	known	74_37	missense	11.76	30	4	SNP	1.000	G
CFAP46	54777	genome.wustl.edu	37	10	134686228	134686228	+	Missense_Mutation	SNP	G	G	A	rs181723916		TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr10:134686228G>A	ENST00000368586.5	-	32	4563	c.4463C>T	c.(4462-4464)tCg>tTg	p.S1488L	TTC40_ENST00000368582.2_Missense_Mutation_p.S1488L	NM_001200049.2	NP_001186978.2														breast(1)|endometrium(5)|lung(19)|urinary_tract(3)	28						CACGGAGTCCGAAATCAGCAC	0.532													G|||	1	0.000199681	0.0	0.0	5008	,	,		17821	0.001		0.0	False		,,,				2504	0.0																0																																										SO:0001583	missense	0																														ENST00000368586.5:c.4463C>T	10.37:g.134686228G>A	ENSP00000357575:p.Ser1488Leu			Missense_Mutation	SNP	NULL	p.S1488L	ENST00000368586.5	37	c.4463	CCDS58101.1	10	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	9.179	1.023008	0.19433	.	.	ENSG00000171811	ENST00000368586;ENST00000368582	T;T	0.48201	2.75;0.82	5.33	3.37	0.38596	.	0.814048	0.09982	N	0.730913	T	0.48390	0.1497	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.42155	-0.9468	7	0.72032	D	0.01	.	8.2729	0.31855	0.089:0.1609:0.7501:0.0	.	.	.	.	L	1488	ENSP00000357575:S1488L;ENSP00000357571:S1488L	ENSP00000357571:S1488L	S	-	2	0	C10orf93	134536218	0.191000	0.23288	0.010000	0.14722	0.005000	0.04900	2.631000	0.46502	2.655000	0.90218	0.655000	0.94253	TCG	TTC40	-	NULL	ENSG00000171811		0.532	TTC40-001	PUTATIVE	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	TTC40	HGNC	protein_coding	OTTHUMT00000051095.3		0.00	42	0	G			134686228	-1			no_errors	ENST00000368582	ensembl	human	known	74_37	missense	15.00	17	3	SNP	0.002	A
TTK	7272	genome.wustl.edu	37	6	80721267	80721267	+	Splice_Site	SNP	T	T	A			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr6:80721267T>A	ENST00000369798.2	+	6	839		c.e6+2		TTK_ENST00000230510.3_Splice_Site|TTK_ENST00000509894.1_Splice_Site	NM_001166691.1|NM_003318.4	NP_001160163.1|NP_003309.2	P33981	TTK_HUMAN	TTK protein kinase						chromosome separation (GO:0051304)|mitotic spindle assembly checkpoint (GO:0007094)|mitotic spindle organization (GO:0007052)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell proliferation (GO:0008284)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|spindle organization (GO:0007051)	membrane (GO:0016020)|spindle (GO:0005819)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)			endometrium(4)|kidney(2)|large_intestine(12)|lung(22)|ovary(7)|pancreas(1)|prostate(1)|stomach(3)|urinary_tract(1)	53		all_cancers(76;0.00177)|Acute lymphoblastic leukemia(125;1.24e-05)|all_hematologic(105;0.00223)|all_epithelial(107;0.2)		BRCA - Breast invasive adenocarcinoma(397;0.0321)		TTTATATGGGTAAGGAAACGG	0.348																																																	0													53.0	52.0	53.0					6																	80721267		2200	4297	6497	SO:0001630	splice_region_variant	0				CCDS4993.1, CCDS55040.1	6q14.1	2014-04-07			ENSG00000112742	ENSG00000112742			12401	protein-coding gene	gene with protein product	"""cancer/testis antigen 96"", ""monopolar spindle 1 kinase"""	604092				1639825	Standard	NM_003318		Approved	MPS1, MPS1L1, CT96, MPH1	uc003pjc.3	P33981	OTTHUMG00000015088	ENST00000369798.2:c.728+2T>A	6.37:g.80721267T>A			A8K8U5|B2RDW2|E1P543|Q15272|Q5TCS0|Q9BW51|Q9NTM0	Splice_Site	SNP	-	e5+2	ENST00000369798.2	37	c.728+2	CCDS4993.1	6	.	.	.	.	.	.	.	.	.	.	T	15.61	2.885232	0.51908	.	.	ENSG00000112742	ENST00000509894;ENST00000230510;ENST00000369798	.	.	.	5.23	5.23	0.72850	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.792	0.52075	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	TTK	80777986	1.000000	0.71417	1.000000	0.80357	0.629000	0.37895	2.720000	0.47252	2.092000	0.63282	0.459000	0.35465	.	TTK	-	-	ENSG00000112742		0.348	TTK-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TTK	HGNC	protein_coding	OTTHUMT00000041316.2	-	0.00	34	0	T		Intron	80721267	+1	tier1	-	no_errors	ENST00000369798	ensembl	human	known	74_37	splice_site	26.32	14	5	SNP	1.000	A
TTN	7273	genome.wustl.edu	37	2	179443557	179443557	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr2:179443557G>T	ENST00000591111.1	-	270	63501	c.63277C>A	c.(63277-63279)Cca>Aca	p.P21093T	TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.P13861T|TTN-AS1_ENST00000438095.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.P22734T|TTN-AS1_ENST00000592600.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.P13669T|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.P13794T|TTN-AS1_ENST00000590932.1_RNA|RP11-171I2.2_ENST00000603521.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.P20166T|TTN-AS1_ENST00000592689.1_RNA|RP11-171I2.5_ENST00000604215.1_RNA|TTN-AS1_ENST00000586452.1_RNA			Q8WZ42	TITIN_HUMAN	titin	21093	Fibronectin type-III 52. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GCAACAATTGGCTCCGATTTC	0.408																																																	0													91.0	88.0	89.0					2																	179443557		1899	4113	6012	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.63277C>A	2.37:g.179443557G>T	ENSP00000465570:p.Pro21093Thr		A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.P20166T	ENST00000591111.1	37	c.60496		2	.	.	.	.	.	.	.	.	.	.	G	12.84	2.057143	0.36277	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.55052	0.54;0.54;0.54;0.54	5.87	5.87	0.94306	Fibronectin, type III (3);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.57710	0.2072	M	0.63169	1.94	0.58432	D	0.999999	D;D;D;D	0.55605	0.972;0.972;0.972;0.972	P;P;P;P	0.48304	0.573;0.573;0.573;0.573	T	0.62407	-0.6861	9	0.87932	D	0	.	13.4213	0.60998	0.0713:0.0:0.9287:0.0	.	13669;13794;13861;21093	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	T	20166;13669;13861;13794;13667	ENSP00000343764:P20166T;ENSP00000434586:P13669T;ENSP00000340554:P13861T;ENSP00000352154:P13794T	ENSP00000340554:P13861T	P	-	1	0	TTN	179151803	1.000000	0.71417	0.929000	0.37066	0.903000	0.53119	6.778000	0.75043	2.778000	0.95560	0.650000	0.86243	CCA	TTN	-	superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,pfscan_Fibronectin_type3	ENSG00000155657		0.408	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	-	0.00	50	0	G	NM_133378		179443557	-1	tier1	-	no_errors	ENST00000342992	ensembl	human	known	74_37	missense	31.58	13	6	SNP	1.000	T
TTN	7273	genome.wustl.edu	37	2	179631200	179631200	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr2:179631200C>T	ENST00000591111.1	-	41	9835	c.9611G>A	c.(9610-9612)cGa>cAa	p.R3204Q	TTN_ENST00000342175.6_Missense_Mutation_p.R3158Q|TTN-AS1_ENST00000610005.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.R3204Q|TTN_ENST00000460472.2_Missense_Mutation_p.R3158Q|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.R3158Q|TTN_ENST00000342992.6_Missense_Mutation_p.R3204Q|TTN_ENST00000360870.5_Missense_Mutation_p.R3204Q|TTN-AS1_ENST00000578746.1_RNA			Q8WZ42	TITIN_HUMAN	titin	13534					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GATAAACATTCGGTGGATTCT	0.418																																																	0													175.0	162.0	166.0					2																	179631200		2203	4300	6503	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.9611G>A	2.37:g.179631200C>T	ENSP00000465570:p.Arg3204Gln		A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.R3204Q	ENST00000591111.1	37	c.9611		2	.	.	.	.	.	.	.	.	.	.	C	17.56	3.419283	0.62622	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127;ENST00000360870	T;T;T;T;T	0.67171	-0.25;-0.25;-0.25;-0.25;-0.25	5.55	5.55	0.83447	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.77512	0.4141	L	0.58810	1.83	0.26641	N	0.972283	D;D;D;D;D	0.76494	0.997;0.997;0.997;0.997;0.999	P;P;P;P;D	0.63793	0.778;0.778;0.778;0.778;0.918	T	0.70799	-0.4774	9	0.87932	D	0	.	13.7635	0.62981	0.0:0.9263:0.0:0.0737	.	3158;3158;3158;3204;3204	D3DPF9;E7EQE6;E7ET18;Q8WZ42;Q8WZ42-6	.;.;.;TITIN_HUMAN;.	Q	3204;3158;3158;3158;3158;3204	ENSP00000343764:R3204Q;ENSP00000434586:R3158Q;ENSP00000340554:R3158Q;ENSP00000352154:R3158Q;ENSP00000354117:R3204Q	ENSP00000340554:R3158Q	R	-	2	0	TTN	179339445	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	4.659000	0.61504	2.625000	0.88918	0.591000	0.81541	CGA	TTN	-	pfam_Ig_I-set,superfamily_RNaseH-like_dom,smart_Ig_sub	ENSG00000155657		0.418	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	-	0.00	58	0	C	NM_133378		179631200	-1	tier1	-	no_errors	ENST00000342992	ensembl	human	known	74_37	missense	30.77	18	8	SNP	1.000	T
SH2B1	25970	genome.wustl.edu	37	16	28857357	28857357	+	5'Flank	SNP	G	G	A			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr16:28857357G>A	ENST00000322610.8	+	0	0				MIR4721_ENST00000577590.1_RNA|TUFM_ENST00000313511.3_Silent_p.L41L			Q9NRF2	SH2B1_HUMAN	SH2B adaptor protein 1						blood coagulation (GO:0007596)|cellular component movement (GO:0006928)|intracellular signal transduction (GO:0035556)|lamellipodium assembly (GO:0030032)|positive regulation of mitosis (GO:0045840)|regulation of DNA biosynthetic process (GO:2000278)	cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	signal transducer activity (GO:0004871)			endometrium(2)|kidney(1)|large_intestine(2)|lung(12)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	25						CGCGGCACAAGAGAGGCAATG	0.647																																																	0													40.0	39.0	40.0					16																	28857357		2197	4300	6497	SO:0001631	upstream_gene_variant	0			AK055104	CCDS32424.1, CCDS53996.1, CCDS53997.1	16p11.2	2013-02-14						"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	30417	protein-coding gene	gene with protein product	"""SH2-B homolog"""	608937				11827956, 10594240	Standard	NM_001145812		Approved	FLJ30542, SH2B	uc002drl.3	Q9NRF2			16.37:g.28857357G>A	Exception_encountered		A8K2R7|Q96FK3|Q96SX3|Q9NRF1|Q9NRF3|Q9P2P7|Q9Y3Y3	Silent	SNP	pfam_EF_GTP-bd_dom,pfam_Transl_elong_EFTu/EF1A_C,pfam_Transl_elong_EFTu/EF1A_2,superfamily_P-loop_NTPase,superfamily_Transl_elong_EF1A/Init_IF2_C,superfamily_Transl_B-barrel,prints_EF_GTP-bd_dom,tigrfam_Transl_elong_EFTu/EF1A_bac/org	p.L41	ENST00000322610.8	37	c.123	CCDS53996.1	16																																																																																			TUFM	-	NULL	ENSG00000178952		0.647	SH2B1-001	KNOWN	basic|CCDS	protein_coding	TUFM	HGNC	protein_coding	OTTHUMT00000432666.1	-	0.00	79	0	G	NM_015503		28857357	-1	tier1	-	no_errors	ENST00000313511	ensembl	human	known	74_37	silent	12.50	49	7	SNP	0.002	A
UBA1	7317	genome.wustl.edu	37	X	47058627	47058627	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chrX:47058627G>A	ENST00000335972.6	+	4	379	c.196G>A	c.(196-198)Gca>Aca	p.A66T	UBA1_ENST00000377351.4_Missense_Mutation_p.A66T	NM_003334.3	NP_003325.2	P22314	UBA1_HUMAN	ubiquitin-like modifier activating enzyme 1	66	2 approximate repeats.				cell death (GO:0008219)|cellular response to DNA damage stimulus (GO:0006974)|modification-dependent protein catabolic process (GO:0019941)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|ubiquitin activating enzyme activity (GO:0004839)|ubiquitin-protein transferase activity (GO:0004842)			breast(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(7)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	31						GGGCCATGAGGCAATGAAGCG	0.587																																																	0													85.0	77.0	79.0					X																	47058627		2203	4300	6503	SO:0001583	missense	0			AF258566	CCDS14275.1	Xp11.23	2014-08-13	2007-11-30	2007-11-30	ENSG00000130985	ENSG00000130985	6.3.2.19	"""Ubiquitin-like modifier activating enzymes"""	12469	protein-coding gene	gene with protein product	"""UBA1, ubiquitin-activating enzyme E1 homolog (yeast)"", ""POC20 centriolar protein homolog (Chlamydomonas)"""	314370	"""ubiquitin-activating enzyme E1 (A1S9T and BN75 temperature sensitivity complementing)"", ""ubiquitin-activating enzyme E1"""	A1S9T, GXP1, UBE1		1845793	Standard	NM_153280		Approved	UBE1X, POC20, CFAP124	uc004dhj.4	P22314	OTTHUMG00000021436	ENST00000335972.6:c.196G>A	X.37:g.47058627G>A	ENSP00000338413:p.Ala66Thr		Q5JRR8|Q96E13	Missense_Mutation	SNP	pfam_ThiF_NAD_FAD-bd,pfam_Ub-activating_enz_e1_C,pfam_UBact_repeat,pfam_Ubiquitin-activating_enzyme,superfamily_Molybdenum_cofac_synth_MoeB,prints_UBQ/SUMO-activ_enz_E1-like,tigrfam_UBQ-activ_enz_E1	p.A66T	ENST00000335972.6	37	c.196	CCDS14275.1	X	.	.	.	.	.	.	.	.	.	.	G	24.5	4.533360	0.85812	.	.	ENSG00000130985	ENST00000377351;ENST00000412206;ENST00000427561;ENST00000442035;ENST00000457753;ENST00000335972;ENST00000451702	T;T;T;T;T;T;T	0.46451	0.87;0.87;0.87;0.87;0.87;0.87;0.87	5.07	5.07	0.68467	Molybdenum cofactor biosynthesis, MoeB (1);NAD(P)-binding domain (1);	0.050518	0.85682	D	0.000000	T	0.48857	0.1523	L	0.39692	1.235	0.80722	D	1	P	0.51653	0.947	P	0.54706	0.759	T	0.35226	-0.9797	10	0.34782	T	0.22	-15.005	16.4416	0.83903	0.0:0.0:1.0:0.0	.	66	P22314	UBA1_HUMAN	T	66;66;80;80;117;66;117	ENSP00000366568:A66T;ENSP00000415033:A66T;ENSP00000397816:A80T;ENSP00000389583:A80T;ENSP00000404796:A117T;ENSP00000338413:A66T;ENSP00000401101:A117T	ENSP00000338413:A66T	A	+	1	0	UBA1	46943571	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.366000	0.79548	2.491000	0.84063	0.597000	0.82753	GCA	UBA1	-	superfamily_Molybdenum_cofac_synth_MoeB,tigrfam_UBQ-activ_enz_E1	ENSG00000130985		0.587	UBA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBA1	HGNC	protein_coding	OTTHUMT00000056389.1	-	0.00	28	0	G	NM_003334		47058627	+1	tier1	-	no_errors	ENST00000335972	ensembl	human	known	74_37	missense	54.55	10	12	SNP	1.000	A
UBR1	197131	genome.wustl.edu	37	15	43307940	43307940	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr15:43307940T>G	ENST00000290650.4	-	29	3233	c.3155A>C	c.(3154-3156)tAt>tCt	p.Y1052S	UBR1_ENST00000382177.2_3'UTR|UBR1_ENST00000568782.1_5'UTR	NM_174916.2	NP_777576.1	Q8IWV7	UBR1_HUMAN	ubiquitin protein ligase E3 component n-recognin 1	1052					cellular response to leucine (GO:0071233)|negative regulation of TOR signaling (GO:0032007)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|proteasome complex (GO:0000502)|ubiquitin ligase complex (GO:0000151)	leucine binding (GO:0070728)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(2)|endometrium(2)|kidney(7)|large_intestine(12)|lung(25)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	58		all_cancers(109;4.32e-15)|all_epithelial(112;4.05e-13)|Lung NSC(122;1.75e-08)|all_lung(180;2e-07)|Melanoma(134;0.0179)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;4.08e-07)|COAD - Colon adenocarcinoma(120;0.185)|Colorectal(105;0.214)		TGTATTGTCATACATGAGTTT	0.358																																																	0													186.0	181.0	183.0					15																	43307940		2203	4299	6502	SO:0001583	missense	0				CCDS10091.1	15q13	2008-06-23			ENSG00000159459	ENSG00000159459		"""Ubiquitin protein ligase E3 component n-recognins"""	16808	protein-coding gene	gene with protein product		605981				9653112	Standard	NM_174916		Approved		uc001zqq.3	Q8IWV7	OTTHUMG00000130702	ENST00000290650.4:c.3155A>C	15.37:g.43307940T>G	ENSP00000290650:p.Tyr1052Ser		O60708|O75492|Q14D45|Q68DN9|Q8IWY6|Q96JY4	Missense_Mutation	SNP	pfam_ClpS_core,pfam_Znf_N-recognin,superfamily_Ribosomal_L7/12_C/ClpS-like,smart_Znf_N-recognin_met,pfscan_Znf_N-recognin	p.Y1052S	ENST00000290650.4	37	c.3155	CCDS10091.1	15	.	.	.	.	.	.	.	.	.	.	T	27.6	4.842319	0.91197	.	.	ENSG00000159459	ENST00000290650	T	0.44881	0.91	5.56	5.56	0.83823	.	0.119412	0.64402	D	0.000016	T	0.48537	0.1505	L	0.54323	1.7	0.80722	D	1	P;P	0.51240	0.843;0.943	B;P	0.52109	0.375;0.69	T	0.34775	-0.9815	10	0.12430	T	0.62	-18.8309	15.8606	0.79017	0.0:0.0:0.0:1.0	.	1052;1052	B4DYL2;Q8IWV7	.;UBR1_HUMAN	S	1052	ENSP00000290650:Y1052S	ENSP00000290650:Y1052S	Y	-	2	0	UBR1	41095232	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.525000	0.81892	2.330000	0.79161	0.533000	0.62120	TAT	UBR1	-	NULL	ENSG00000159459		0.358	UBR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBR1	HGNC	protein_coding	OTTHUMT00000253202.1	-	0.00	37	0	T	NM_174916		43307940	-1	tier1	-	no_errors	ENST00000290650	ensembl	human	known	74_37	missense	41.67	14	10	SNP	1.000	G
UMODL1	89766	genome.wustl.edu	37	21	43531564	43531564	+	Intron	SNP	C	C	G			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr21:43531564C>G	ENST00000408910.2	+	12	1899				UMODL1_ENST00000408989.2_Silent_p.T744T|UMODL1_ENST00000400427.1_Silent_p.T672T|UMODL1_ENST00000400424.2_Intron|C21orf128_ENST00000329015.2_5'Flank	NM_001004416.2	NP_001004416	Q5DID0	UROL1_HUMAN	uromodulin-like 1						adipose tissue development (GO:0060612)|cellular response to gonadotropin-releasing hormone (GO:0097211)|multicellular organismal reproductive process (GO:0048609)|regulation of apoptotic process (GO:0042981)|regulation of gene expression (GO:0010468)|regulation of ovarian follicle development (GO:2000354)|single fertilization (GO:0007338)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|peptidase inhibitor activity (GO:0030414)			breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(5)|lung(22)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	47						CTGGGTCAACCCACAGCTTCC	0.647																																					Pancreas(122;680 807 13940 14411 22888 25505 31742 36028 36332 38435)												0													50.0	54.0	53.0					21																	43531564		1975	4142	6117	SO:0001627	intron_variant	0				CCDS42935.1, CCDS42936.1, CCDS56214.1, CCDS56215.1	21q22.3	2008-07-04			ENSG00000177398	ENSG00000177398			12560	protein-coding gene	gene with protein product	"""olfactorin"""	613859				16026467	Standard	NM_173568		Approved		uc002zag.1	Q5DID0	OTTHUMG00000086788	ENST00000408910.2:c.1900-52C>G	21.37:g.43531564C>G			C9JCE6|Q5DIC9|Q6LA40|Q6LA41|Q8N216	Silent	SNP	pfam_ZP_dom,pfam_SEA_dom,pfam_EGF-like_Ca-bd_dom,pfam_EMI_domain,pfam_WAP-type_4-diS_core,superfamily_Fibronectin_type3,superfamily_WAP-type_4-diS_core,smart_WAP-type_4-diS_core,smart_EGF-like_Ca-bd_dom,smart_Fibronectin_type3,smart_ZP_dom,pfscan_EG-like_dom,pfscan_EMI_domain,pfscan_Fibronectin_type3,pfscan_ZP_dom,prints_ZP_dom	p.T744	ENST00000408910.2	37	c.2232	CCDS42936.1	21																																																																																			UMODL1	-	NULL	ENSG00000177398		0.647	UMODL1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	UMODL1	HGNC	protein_coding	OTTHUMT00000195292.2	-	0.00	46	0	C			43531564	+1	tier1	-	no_errors	ENST00000408989	ensembl	human	known	74_37	silent	24.00	19	6	SNP	0.000	G
UNC5C	8633	genome.wustl.edu	37	4	96140250	96140250	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr4:96140250C>A	ENST00000453304.1	-	9	1863	c.1515G>T	c.(1513-1515)atG>atT	p.M505I	UNC5C_ENST00000506749.1_Missense_Mutation_p.M524I	NM_003728.3	NP_003719.3	O95185	UNC5C_HUMAN	unc-5 homolog C (C. elegans)	505					anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|brain development (GO:0007420)|positive regulation of apoptotic process (GO:0043065)|regulation of cell migration (GO:0030334)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	netrin receptor activity (GO:0005042)			NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(14)|lung(25)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	55		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;8.72e-10)		ACGACTGGGTCATCTGAGGGG	0.522																																																	0													165.0	139.0	148.0					4																	96140250		2203	4300	6503	SO:0001583	missense	0			AF055634	CCDS3643.1	4q21-q23	2013-01-11	2001-11-28		ENSG00000182168	ENSG00000182168		"""Immunoglobulin superfamily / I-set domain containing"""	12569	protein-coding gene	gene with protein product		603610	"""unc5 (C.elegans homolog) c"""			9126742, 9782087	Standard	NM_003728		Approved		uc003hto.3	O95185	OTTHUMG00000130989	ENST00000453304.1:c.1515G>T	4.37:g.96140250C>A	ENSP00000406022:p.Met505Ile		Q8IUT0	Missense_Mutation	SNP	pfam_ZU5,pfam_Death_domain,pfam_Ig_I-set,pfam_Thrombospondin_1_rpt,superfamily_DEATH-like_dom,superfamily_Thrombospondin_1_rpt,smart_Ig_sub,smart_Ig_sub2,smart_Thrombospondin_1_rpt,smart_ZU5,smart_Death_domain,pfscan_Thrombospondin_1_rpt,pfscan_ZU5,pfscan_Ig-like_dom	p.M505I	ENST00000453304.1	37	c.1515	CCDS3643.1	4	.	.	.	.	.	.	.	.	.	.	C	8.695	0.908446	0.17833	.	.	ENSG00000182168	ENST00000453304;ENST00000331502;ENST00000513796;ENST00000506749	T;T;T	0.54675	0.87;0.56;0.56	5.45	4.53	0.55603	.	0.269830	0.45606	D	0.000341	T	0.31734	0.0806	N	0.08118	0	0.80722	D	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.14090	-1.0485	10	0.51188	T	0.08	.	11.2471	0.49004	0.167:0.6396:0.1934:0.0	.	505;524;505	A8K385;E0CX15;O95185	.;.;UNC5C_HUMAN	I	505;464;524;524	ENSP00000406022:M505I;ENSP00000426924:M524I;ENSP00000426153:M524I	ENSP00000328673:M464I	M	-	3	0	UNC5C	96359273	0.996000	0.38824	1.000000	0.80357	0.944000	0.59088	0.300000	0.19156	2.555000	0.86185	0.655000	0.94253	ATG	UNC5C	-	NULL	ENSG00000182168		0.522	UNC5C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UNC5C	HGNC	protein_coding	OTTHUMT00000253607.1	-	0.00	45	0	C	NM_003728		96140250	-1	tier1	-	no_errors	ENST00000453304	ensembl	human	known	74_37	missense	19.05	17	4	SNP	0.992	A
CCDC144A	9720	genome.wustl.edu	37	17	16699483	16699483	+	3'UTR	SNP	T	T	A			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr17:16699483T>A	ENST00000443444.2	+	0	5849				USP32P1_ENST00000393005.2_RNA|RP11-219A15.1_ENST00000448331.3_3'UTR|RP11-219A15.4_ENST00000602730.1_RNA			A2RUR9	C144A_HUMAN	coiled-coil domain containing 144A																		GTACTACTGTTCCAAGTGTAA	0.537																																																	0																																										SO:0001624	3_prime_UTR_variant	0			BC133019	CCDS45621.1	17p11.2	2008-10-23			ENSG00000170160	ENSG00000170160			29072	protein-coding gene	gene with protein product						9628581, 11997339	Standard	NM_014695		Approved	KIAA0565, FLJ43983	uc002gqk.1	A2RUR9	OTTHUMG00000059178	ENST00000443444.2:c.*1425T>A	17.37:g.16699483T>A			O60311|Q6ZU57	RNA	SNP	-	NULL	ENST00000443444.2	37	NULL	CCDS45621.1	17																																																																																			USP32P1	-	-	ENSG00000188933		0.537	CCDC144A-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	USP32P1	HGNC	protein_coding		-	0.00	66	0	T			16699483	+1	tier1	-	no_errors	ENST00000393005	ensembl	human	known	74_37	rna	29.41	12	5	SNP	1.000	A
USH1G	124590	genome.wustl.edu	37	17	72915838	72915838	+	Missense_Mutation	SNP	C	C	T	rs538983393		TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr17:72915838C>T	ENST00000319642.1	-	2	1275	c.1093G>A	c.(1093-1095)Gac>Aac	p.D365N		NM_001282489.1|NM_173477.2	NP_001269418.1|NP_775748.2	Q495M9	USH1G_HUMAN	Usher syndrome 1G (autosomal recessive)	365					equilibrioception (GO:0050957)|inner ear morphogenesis (GO:0042472)|inner ear receptor cell differentiation (GO:0060113)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	spectrin binding (GO:0030507)		HN1/USH1G(2)	endometrium(1)|kidney(1)|large_intestine(4)|lung(4)|prostate(1)|skin(3)	14	all_lung(278;0.172)|Lung NSC(278;0.207)					CAGCTGCGGTCCTGCAGGCTG	0.682													C|||	1	0.000199681	0.0	0.0	5008	,	,		15423	0.001		0.0	False		,,,				2504	0.0																0													35.0	39.0	37.0					17																	72915838		2203	4300	6503	SO:0001583	missense	0			AK091243	CCDS32725.1	17q25.1	2013-01-10			ENSG00000182040	ENSG00000182040		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	16356	protein-coding gene	gene with protein product		607696				12588794	Standard	NM_001282489		Approved	Sans, FLJ33924, ANKS4A	uc002jme.1	Q495M9	OTTHUMG00000178864	ENST00000319642.1:c.1093G>A	17.37:g.72915838C>T	ENSP00000320076:p.Asp365Asn		Q8N251	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_SAM_type1,superfamily_Ankyrin_rpt-contain_dom,superfamily_SAM/pointed,smart_Ankyrin_rpt,smart_SAM,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.D365N	ENST00000319642.1	37	c.1093	CCDS32725.1	17	.	.	.	.	.	.	.	.	.	.	C	19.07	3.756357	0.69648	.	.	ENSG00000182040	ENST00000319642	T	0.70516	-0.49	4.53	4.53	0.55603	.	0.249503	0.39146	N	0.001445	T	0.53753	0.1816	N	0.08118	0	0.48830	D	0.999716	B	0.23735	0.09	B	0.24155	0.051	T	0.53892	-0.8374	10	0.44086	T	0.13	-16.3974	17.5258	0.87800	0.0:1.0:0.0:0.0	.	365	Q495M9	USH1G_HUMAN	N	365	ENSP00000320076:D365N	ENSP00000320076:D365N	D	-	1	0	USH1G	70427433	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.612000	0.82975	2.383000	0.81215	0.555000	0.69702	GAC	USH1G	-	NULL	ENSG00000182040		0.682	USH1G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USH1G	HGNC	protein_coding	OTTHUMT00000443676.1	-	0.00	26	0	C	NM_173477		72915838	-1	tier1	-	no_errors	ENST00000319642	ensembl	human	known	74_37	missense	20.00	16	4	SNP	1.000	T
USP8	9101	genome.wustl.edu	37	15	50793017	50793017	+	3'UTR	SNP	C	C	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr15:50793017C>T	ENST00000396444.3	+	0	5427				USP50_ENST00000530218.1_5'Flank|USP50_ENST00000532404.1_Silent_p.L318L|RP11-562A8.4_ENST00000560380.1_RNA|USP8_ENST00000433963.1_3'UTR	NM_001128610.1|NM_005154.3	NP_001122082.1|NP_005145.3	P40818	UBP8_HUMAN	ubiquitin specific peptidase 8						cell proliferation (GO:0008283)|endosome organization (GO:0007032)|mitotic cytokinesis (GO:0000281)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)|Ras protein signal transduction (GO:0007265)|ubiquitin-dependent protein catabolic process (GO:0006511)	acrosomal vesicle (GO:0001669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|extrinsic component of plasma membrane (GO:0019897)|midbody (GO:0030496)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|ubiquitin-specific protease activity (GO:0004843)			central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(5)|lung(16)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	35				all cancers(107;0.000225)|GBM - Glioblastoma multiforme(94;0.000771)		GGCCACCATCCAAATCACCAA	0.418																																																	0													71.0	66.0	67.0					15																	50793017		1881	4107	5988	SO:0001624	3_prime_UTR_variant	0			D29956	CCDS10137.1, CCDS61632.1	15q21.1	2014-03-03	2005-08-08		ENSG00000138592	ENSG00000138592		"""Ubiquitin-specific peptidases"""	12631	protein-coding gene	gene with protein product		603158	"""ubiquitin specific protease 8"""			12838346, 9582025, 24482476	Standard	NM_005154		Approved	HumORF8, KIAA0055, UBPY, SPG59	uc001zyl.4	P40818	OTTHUMG00000131645	ENST00000396444.3:c.*1732C>T	15.37:g.50793017C>T			B4DKA8|Q2TB31|Q7Z3U2|Q86VA0|Q8IWI7	Silent	SNP	pfam_Peptidase_C19/C67,pfscan_Peptidase_C19/C67	p.L318	ENST00000396444.3	37	c.954	CCDS10137.1	15																																																																																			USP50	-	pfam_Peptidase_C19/C67,pfscan_Peptidase_C19/C67	ENSG00000170236		0.418	USP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP50	HGNC	protein_coding	OTTHUMT00000254541.1	-	0.00	27	0	C	NM_005154		50793017	-1	tier1	-	no_errors	ENST00000532404	ensembl	human	known	74_37	silent	21.43	11	3	SNP	1.000	T
USP54	159195	genome.wustl.edu	37	10	75305350	75305350	+	Silent	SNP	G	G	A			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr10:75305350G>A	ENST00000339859.4	-	4	421	c.321C>T	c.(319-321)ttC>ttT	p.F107F	USP54_ENST00000319786.7_Silent_p.F107F|USP54_ENST00000394811.2_5'UTR|USP54_ENST00000408019.1_Silent_p.F107F|USP54_ENST00000428547.1_Silent_p.F107F|USP54_ENST00000497106.1_5'UTR			Q70EL1	UBP54_HUMAN	ubiquitin specific peptidase 54	107	USP.				ubiquitin-dependent protein catabolic process (GO:0006511)		ubiquitinyl hydrolase activity (GO:0036459)			breast(5)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(12)|ovary(1)|prostate(1)	30	Prostate(51;0.0112)					GTTCATCCTGGAAAGTCTTTG	0.483																																					Colon(195;880 2046 8854 25025 38456)												0													95.0	93.0	94.0					10																	75305350		1980	4163	6143	SO:0001819	synonymous_variant	0			AJ583820	CCDS7329.2	10q22.3	2006-09-26	2005-08-08	2004-01-30	ENSG00000166348	ENSG00000166348		"""Ubiquitin-specific peptidases"""	23513	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 29"", ""ubiquitin specific protease 54"""	C10orf29		14715245	Standard	NM_152586		Approved	FLJ37318, bA137L10.3, bA137L10.4	uc001juo.3	Q70EL1	OTTHUMG00000018469	ENST00000339859.4:c.321C>T	10.37:g.75305350G>A			A1L4Q4|A3KFK3|A3KFK5|A3KFK6|A3KFK7|A6PVS4|A6PVS5|A6PVS6|A6PVS7|B3KVY1|B9ZVM1|Q5F2F4|Q6P1N6|Q6ZSP1|Q6ZSR1|Q6ZTM0|Q8N1X2	Silent	SNP	pfam_Peptidase_C19/C67,pfscan_Peptidase_C19/C67	p.F107	ENST00000339859.4	37	c.321	CCDS7329.2	10																																																																																			USP54	-	pfam_Peptidase_C19/C67,pfscan_Peptidase_C19/C67	ENSG00000166348		0.483	USP54-014	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	USP54	HGNC	protein_coding	OTTHUMT00000316563.2		0.00	58	0	G	NM_152586		75305350	-1			no_errors	ENST00000339859	ensembl	human	known	74_37	silent	9.38	29	3	SNP	1.000	A
VASH1	22846	genome.wustl.edu	37	14	77236284	77236284	+	Intron	SNP	G	G	A			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr14:77236284G>A	ENST00000167106.4	+	2	942				VASH1_ENST00000556038.1_3'UTR|VASH1_ENST00000554237.1_Intron	NM_014909.4	NP_055724.1	Q7L8A9	VASH1_HUMAN	vasohibin 1						angiogenesis (GO:0001525)|cell cycle arrest (GO:0007050)|negative regulation of angiogenesis (GO:0016525)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of lymphangiogenesis (GO:1901491)|regulation of cellular senescence (GO:2000772)|response to wounding (GO:0009611)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)				breast(2)|endometrium(1)|large_intestine(1)|lung(1)|prostate(1)|stomach(1)|urinary_tract(3)	10			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0283)		TCTTGTGACCGGAGCTCTTTC	0.622																																																	0													134.0	122.0	126.0					14																	77236284		2203	4300	6503	SO:0001627	intron_variant	0			AB028959	CCDS9851.1	14q24.3	2006-09-25	2005-08-16	2005-08-16		ENSG00000071246			19964	protein-coding gene	gene with protein product		609011	"""KIAA1036"""	KIAA1036			Standard	NM_014909		Approved		uc001xst.2	Q7L8A9		ENST00000167106.4:c.310-22G>A	14.37:g.77236284G>A			Q96H02|Q9UBF4|Q9Y629	RNA	SNP	-	NULL	ENST00000167106.4	37	NULL	CCDS9851.1	14																																																																																			VASH1	-	-	ENSG00000071246		0.622	VASH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VASH1	HGNC	protein_coding	OTTHUMT00000413706.1	-	0.00	58	0	G	NM_014909		77236284	+1	tier1	-	no_errors	ENST00000556038	ensembl	human	known	74_37	rna	29.41	24	10	SNP	0.004	A
VEZF1	7716	genome.wustl.edu	37	17	56060674	56060674	+	Silent	SNP	A	A	C	rs532205407		TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr17:56060674A>C	ENST00000581208.1	-	2	154	c.114T>G	c.(112-114)ccT>ccG	p.P38P	VEZF1_ENST00000584396.1_Silent_p.P29P	NM_007146.2	NP_009077.2	Q14119	VEZF1_HUMAN	vascular endothelial zinc finger 1	38					angiogenesis (GO:0001525)|cellular defense response (GO:0006968)|endothelial cell development (GO:0001885)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(1)|kidney(2)|lung(5)|ovary(1)	10						GTTTCTGATCAGGGGGCTCCA	0.473																																																	0													96.0	104.0	101.0					17																	56060674		2203	4300	6503	SO:0001819	synonymous_variant	0			D28118	CCDS32687.1	17q22	2012-10-05	2006-08-16	2006-08-16	ENSG00000136451	ENSG00000136451		"""Zinc fingers, C2H2-type"""	12949	protein-coding gene	gene with protein product		606747	"""zinc finger protein 161"""	ZNF161		8035792	Standard	XM_005257643		Approved	DB1	uc002ivf.1	Q14119	OTTHUMG00000178777	ENST00000581208.1:c.114T>G	17.37:g.56060674A>C				Silent	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.P38	ENST00000581208.1	37	c.114	CCDS32687.1	17																																																																																			VEZF1	-	NULL	ENSG00000136451		0.473	VEZF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VEZF1	HGNC	protein_coding	OTTHUMT00000443321.1	-	0.00	59	0	A			56060674	-1	tier1	-	no_errors	ENST00000581208	ensembl	human	known	74_37	silent	19.44	29	7	SNP	1.000	C
VPS13A	23230	genome.wustl.edu	37	9	79890564	79890564	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr9:79890564C>T	ENST00000360280.3	+	25	2923	c.2663C>T	c.(2662-2664)cCa>cTa	p.P888L	VPS13A_ENST00000376636.3_Missense_Mutation_p.P888L|VPS13A_ENST00000376634.4_Missense_Mutation_p.P888L|VPS13A_ENST00000357409.5_Missense_Mutation_p.P888L	NM_033305.2	NP_150648.2	Q96RL7	VP13A_HUMAN	vacuolar protein sorting 13 homolog A (S. cerevisiae)	888					cell death (GO:0008219)|Golgi to endosome transport (GO:0006895)|locomotory behavior (GO:0007626)|nervous system development (GO:0007399)|protein localization (GO:0008104)|protein transport (GO:0015031)|social behavior (GO:0035176)	dense core granule (GO:0031045)|intracellular (GO:0005622)		p.P888Q(3)		breast(4)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(28)|liver(1)|lung(42)|ovary(3)|pancreas(3)|prostate(3)|skin(9)|upper_aerodigestive_tract(1)|urinary_tract(1)	104						TTTGAAGTACCAAAGGTAGGT	0.308																																																	3	Substitution - Missense(3)	lung(3)											80.0	92.0	88.0					9																	79890564		2203	4298	6501	SO:0001583	missense	0			AB023203	CCDS6655.1, CCDS6656.1, CCDS47983.1, CCDS55321.1	9q21	2014-01-30	2006-04-04	2004-02-11	ENSG00000197969	ENSG00000197969			1908	protein-coding gene	gene with protein product	"""chorein"""	605978	"""chorea acanthocytosis"", ""vacuolar protein sorting 13A (yeast)"""	CHAC		9382101, 11381253	Standard	NM_001018038		Approved	KIAA0986	uc004akr.3	Q96RL7	OTTHUMG00000020055	ENST00000360280.3:c.2663C>T	9.37:g.79890564C>T	ENSP00000353422:p.Pro888Leu		Q5JSX9|Q5JSY0|Q5VYR5|Q702P4|Q709D0|Q86YF8|Q96S61|Q9H995|Q9Y2J1	Missense_Mutation	SNP	pfam_VPSAP_dom,pfam_Autophagy-rel_C	p.P888L	ENST00000360280.3	37	c.2663	CCDS6655.1	9	.	.	.	.	.	.	.	.	.	.	C	12.66	2.004084	0.35320	.	.	ENSG00000197969	ENST00000376634;ENST00000376636;ENST00000360280;ENST00000357409	T;T;T;T	0.16457	2.34;2.34;2.34;2.34	5.6	3.73	0.42828	.	0.497022	0.22311	N	0.061738	T	0.14399	0.0348	L	0.47716	1.5	0.80722	D	1	B;B;B;B	0.28055	0.032;0.121;0.199;0.089	B;B;B;B	0.26969	0.062;0.034;0.075;0.075	T	0.06391	-1.0829	10	0.27785	T	0.31	.	8.6523	0.34042	0.2707:0.6576:0.0:0.0717	.	888;888;888;888	Q96RL7-3;Q96RL7;Q96RL7-2;Q96RL7-4	.;VP13A_HUMAN;.;.	L	888	ENSP00000365821:P888L;ENSP00000365823:P888L;ENSP00000353422:P888L;ENSP00000349985:P888L	ENSP00000349985:P888L	P	+	2	0	VPS13A	79080384	0.993000	0.37304	1.000000	0.80357	0.863000	0.49368	0.855000	0.27805	0.690000	0.31570	0.555000	0.69702	CCA	VPS13A	-	NULL	ENSG00000197969		0.308	VPS13A-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VPS13A	HGNC	protein_coding	OTTHUMT00000052753.2	-	0.00	54	0	C	NM_015186		79890564	+1	tier1	-	no_errors	ENST00000360280	ensembl	human	known	74_37	missense	32.26	21	10	SNP	1.000	T
VPS13A	23230	genome.wustl.edu	37	9	79917908	79917908	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr9:79917908G>T	ENST00000360280.3	+	34	4150	c.3890G>T	c.(3889-3891)cGa>cTa	p.R1297L	VPS13A_ENST00000376636.3_Missense_Mutation_p.R1258L|VPS13A_ENST00000376634.4_Missense_Mutation_p.R1297L|VPS13A_ENST00000423463.2_3'UTR|VPS13A_ENST00000357409.5_Missense_Mutation_p.R1297L	NM_033305.2	NP_150648.2	Q96RL7	VP13A_HUMAN	vacuolar protein sorting 13 homolog A (S. cerevisiae)	1297					cell death (GO:0008219)|Golgi to endosome transport (GO:0006895)|locomotory behavior (GO:0007626)|nervous system development (GO:0007399)|protein localization (GO:0008104)|protein transport (GO:0015031)|social behavior (GO:0035176)	dense core granule (GO:0031045)|intracellular (GO:0005622)				breast(4)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(28)|liver(1)|lung(42)|ovary(3)|pancreas(3)|prostate(3)|skin(9)|upper_aerodigestive_tract(1)|urinary_tract(1)	104						GTGGTTGAACGAAATTTATGC	0.353																																																	0													143.0	138.0	140.0					9																	79917908		2203	4300	6503	SO:0001583	missense	0			AB023203	CCDS6655.1, CCDS6656.1, CCDS47983.1, CCDS55321.1	9q21	2014-01-30	2006-04-04	2004-02-11	ENSG00000197969	ENSG00000197969			1908	protein-coding gene	gene with protein product	"""chorein"""	605978	"""chorea acanthocytosis"", ""vacuolar protein sorting 13A (yeast)"""	CHAC		9382101, 11381253	Standard	NM_001018038		Approved	KIAA0986	uc004akr.3	Q96RL7	OTTHUMG00000020055	ENST00000360280.3:c.3890G>T	9.37:g.79917908G>T	ENSP00000353422:p.Arg1297Leu		Q5JSX9|Q5JSY0|Q5VYR5|Q702P4|Q709D0|Q86YF8|Q96S61|Q9H995|Q9Y2J1	Missense_Mutation	SNP	pfam_VPSAP_dom,pfam_Autophagy-rel_C	p.R1297L	ENST00000360280.3	37	c.3890	CCDS6655.1	9	.	.	.	.	.	.	.	.	.	.	G	23.1	4.370527	0.82573	.	.	ENSG00000197969	ENST00000376634;ENST00000376636;ENST00000360280;ENST00000357409	T;T;T;T	0.16073	2.37;2.37;2.37;2.37	5.31	5.31	0.75309	.	0.084786	0.46145	D	0.000317	T	0.46908	0.1417	M	0.80332	2.49	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.87578	0.998;0.94;0.983;0.983	T	0.48670	-0.9015	10	0.59425	D	0.04	.	18.5866	0.91192	0.0:0.0:1.0:0.0	.	1258;1297;1297;1297	Q96RL7-3;Q96RL7;Q96RL7-2;Q96RL7-4	.;VP13A_HUMAN;.;.	L	1297;1258;1297;1297	ENSP00000365821:R1297L;ENSP00000365823:R1258L;ENSP00000353422:R1297L;ENSP00000349985:R1297L	ENSP00000349985:R1297L	R	+	2	0	VPS13A	79107728	1.000000	0.71417	1.000000	0.80357	0.511000	0.34104	7.098000	0.76974	2.480000	0.83734	0.563000	0.77884	CGA	VPS13A	-	NULL	ENSG00000197969		0.353	VPS13A-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VPS13A	HGNC	protein_coding	OTTHUMT00000052753.2	-	0.00	90	0	G	NM_015186		79917908	+1	tier1	-	no_errors	ENST00000360280	ensembl	human	known	74_37	missense	27.08	34	13	SNP	1.000	T
VPS28	51160	genome.wustl.edu	37	8	145650186	145650186	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr8:145650186G>A	ENST00000526054.1	-	6	354	c.317C>T	c.(316-318)gCc>gTc	p.A106V	VPS28_ENST00000526734.1_5'Flank|VPS28_ENST00000377348.2_Missense_Mutation_p.A106V|VPS28_ENST00000292510.4_Missense_Mutation_p.A106V|VPS28_ENST00000529182.1_Missense_Mutation_p.A106V			Q9UK41	VPS28_HUMAN	vacuolar protein sorting 28 homolog (S. cerevisiae)	106	VPS28 N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00645}.				endosomal transport (GO:0016197)|intracellular transport of virus (GO:0075733)|membrane organization (GO:0061024)|negative regulation of protein ubiquitination (GO:0031397)|protein transport (GO:0015031)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral protein processing (GO:0019082)|virion assembly (GO:0019068)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|endosome membrane (GO:0010008)|ESCRT I complex (GO:0000813)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)		p.A106D(2)		kidney(1)|large_intestine(1)|lung(4)|prostate(1)	7	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.08e-41)|Epithelial(56;8.67e-41)|all cancers(56;1.1e-35)|BRCA - Breast invasive adenocarcinoma(115;0.035)|Colorectal(110;0.055)			CCGCTCCATGGCCAGCGGGCA	0.667																																																	2	Substitution - Missense(2)	lung(2)											115.0	97.0	103.0					8																	145650186		2203	4300	6503	SO:0001583	missense	0			AF316887	CCDS6425.1, CCDS34967.1	8q24.3	2014-08-12	2006-04-04		ENSG00000160948	ENSG00000160948			18178	protein-coding gene	gene with protein product		611952	"""vacuolar protein sorting 28 (yeast)"""				Standard	NM_183057		Approved		uc003zct.1	Q9UK41	OTTHUMG00000165209	ENST00000526054.1:c.317C>T	8.37:g.145650186G>A	ENSP00000434064:p.Ala106Val		Q86VK0	Missense_Mutation	SNP	pfam_VPS28,pirsf_VPS28	p.A106V	ENST00000526054.1	37	c.317	CCDS6425.1	8	.	.	.	.	.	.	.	.	.	.	g	14.61	2.586198	0.46110	.	.	ENSG00000160948	ENST00000529182;ENST00000526054;ENST00000292510;ENST00000377348;ENST00000533806;ENST00000531032	.	.	.	5.83	3.0	0.34707	Vacuolar protein sorting-associated, VPS28, N-terminal (1);	0.050646	0.85682	D	0.000000	T	0.68952	0.3057	M	0.89968	3.075	0.80722	D	1	P;B	0.48503	0.911;0.261	P;B	0.50860	0.652;0.367	T	0.71642	-0.4531	9	0.87932	D	0	.	7.389	0.26899	0.1497:0.0:0.7153:0.135	.	106;106	Q9UK41-2;Q9UK41	.;VPS28_HUMAN	V	106;106;106;106;89;106	.	ENSP00000292510:A106V	A	-	2	0	VPS28	145620994	1.000000	0.71417	0.869000	0.34112	0.170000	0.22686	7.189000	0.77747	0.776000	0.33473	-0.137000	0.14449	GCC	VPS28	-	pfam_VPS28,pirsf_VPS28	ENSG00000160948		0.667	VPS28-003	KNOWN	basic|appris_principal|CCDS	protein_coding	VPS28	HGNC	protein_coding	OTTHUMT00000382694.1	-	0.00	50	0	G			145650186	-1	tier1	-	no_errors	ENST00000377348	ensembl	human	known	74_37	missense	20.00	16	4	SNP	0.998	A
VPS35	55737	genome.wustl.edu	37	16	46717491	46717491	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr16:46717491C>G	ENST00000299138.7	-	2	89	c.31G>C	c.(31-33)Gag>Cag	p.E11Q		NM_018206.4	NP_060676.2	Q96QK1	VPS35_HUMAN	vacuolar protein sorting 35 homolog (S. cerevisiae)	11					cell death (GO:0008219)|protein transport (GO:0015031)|retrograde transport, endosome to Golgi (GO:0042147)	cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|retromer complex (GO:0030904)				breast(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(11)|pancreas(1)|prostate(1)|urinary_tract(1)	23		all_cancers(37;7.65e-05)|all_epithelial(9;0.000154)|all_lung(18;0.00585)|Lung NSC(13;0.0496)|Breast(268;0.116)				TTTTCCTGCTCATCCTGAGGG	0.438																																																	0													76.0	62.0	67.0					16																	46717491		2203	4297	6500	SO:0001583	missense	0			AF175265	CCDS10721.1	16q12	2012-06-27	2006-12-19		ENSG00000069329	ENSG00000069329		"""Parkinson disease"""	13487	protein-coding gene	gene with protein product		601501	"""vacuolar protein sorting 35 (yeast homolog)"", ""vacuolar protein sorting 35 (yeast)"""			11112353, 21763482	Standard	NM_018206		Approved	FLJ10752, MEM3, PARK17	uc002eef.4	Q96QK1	OTTHUMG00000132542	ENST00000299138.7:c.31G>C	16.37:g.46717491C>G	ENSP00000299138:p.Glu11Gln		Q561W2|Q9H016|Q9H096|Q9H4P3|Q9H8J0|Q9NRS7|Q9NVG2|Q9NX80|Q9NZK2	Missense_Mutation	SNP	pfam_VPS35,superfamily_ARM-type_fold	p.E11Q	ENST00000299138.7	37	c.31	CCDS10721.1	16	.	.	.	.	.	.	.	.	.	.	C	20.9	4.062700	0.76187	.	.	ENSG00000069329	ENST00000299138	T	0.42900	0.96	5.42	5.42	0.78866	.	0.000000	0.85682	D	0.000000	T	0.49270	0.1547	M	0.71036	2.16	0.80722	D	1	P	0.36599	0.56	B	0.37422	0.249	T	0.55270	-0.8167	10	0.72032	D	0.01	-23.0696	19.5794	0.95459	0.0:1.0:0.0:0.0	.	11	Q96QK1	VPS35_HUMAN	Q	11	ENSP00000299138:E11Q	ENSP00000299138:E11Q	E	-	1	0	VPS35	45274992	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.752000	0.85141	2.704000	0.92352	0.557000	0.71058	GAG	VPS35	-	NULL	ENSG00000069329		0.438	VPS35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VPS35	HGNC	protein_coding	OTTHUMT00000255742.3		0.00	49	0	C			46717491	-1			no_errors	ENST00000299138	ensembl	human	known	74_37	missense	7.89	35	3	SNP	1.000	G
VPS37C	55048	genome.wustl.edu	37	11	60899821	60899821	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr11:60899821C>T	ENST00000301765.5	-	5	771	c.539G>A	c.(538-540)cGc>cAc	p.R180H		NM_017966.4	NP_060436.4	A5D8V6	VP37C_HUMAN	vacuolar protein sorting 37 homolog C (S. cerevisiae)	180	Pro-rich.				endosomal transport (GO:0016197)|intracellular transport of virus (GO:0075733)|membrane organization (GO:0061024)|protein transport (GO:0015031)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral protein processing (GO:0019082)|virion assembly (GO:0019068)	endosome membrane (GO:0010008)|ESCRT I complex (GO:0000813)|extracellular vesicular exosome (GO:0070062)				breast(1)|kidney(1)|large_intestine(3)|lung(1)|skin(1)	7						GGGGACTGGGCGCACCGGGGG	0.677																																																	0													16.0	19.0	18.0					11																	60899821		2195	4289	6484	SO:0001583	missense	0			AK097326	CCDS31573.1	11q12.2	2008-02-05	2006-04-04			ENSG00000167987			26097	protein-coding gene	gene with protein product		610038	"""vacuolar protein sorting 37C (yeast)"""			15509564	Standard	XM_005274077		Approved	FLJ20847	uc001nqv.1	A5D8V6		ENST00000301765.5:c.539G>A	11.37:g.60899821C>T	ENSP00000301765:p.Arg180His		Q8N3K4	Missense_Mutation	SNP	pfam_Mod_r	p.R180H	ENST00000301765.5	37	c.539	CCDS31573.1	11	.	.	.	.	.	.	.	.	.	.	C	1.676	-0.507685	0.04231	.	.	ENSG00000167987	ENST00000301765;ENST00000540084	T	0.45276	0.9	4.71	2.83	0.33086	.	0.493566	0.17114	N	0.186518	T	0.24044	0.0582	N	0.24115	0.695	0.09310	N	1	B	0.09022	0.002	B	0.04013	0.001	T	0.14839	-1.0458	10	0.33940	T	0.23	-3.4008	3.8872	0.09103	0.1429:0.5487:0.2162:0.0922	.	180	A5D8V6	VP37C_HUMAN	H	180	ENSP00000301765:R180H	ENSP00000301765:R180H	R	-	2	0	VPS37C	60656397	0.044000	0.20184	0.193000	0.23327	0.045000	0.14185	0.577000	0.23758	0.418000	0.25898	0.462000	0.41574	CGC	VPS37C	-	NULL	ENSG00000167987		0.677	VPS37C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VPS37C	HGNC	protein_coding	OTTHUMT00000396467.1	-	0.00	28	0	C	NM_017966		60899821	-1	tier1	-	no_errors	ENST00000301765	ensembl	human	known	74_37	missense	23.81	16	5	SNP	0.026	T
VSX2	338917	genome.wustl.edu	37	14	74726342	74726342	+	Missense_Mutation	SNP	G	G	C	rs138619416		TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr14:74726342G>C	ENST00000261980.2	+	4	707	c.617G>C	c.(616-618)cGg>cCg	p.R206P		NM_182894.2	NP_878314.1	P58304	VSX2_HUMAN	visual system homeobox 2	206					cell fate commitment (GO:0045165)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to stimulus (GO:0050896)|retinal bipolar neuron differentiation (GO:0060040)|transcription, DNA-templated (GO:0006351)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			endometrium(1)|large_intestine(1)|lung(1)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	7				BRCA - Breast invasive adenocarcinoma(234;0.00154)		TGGAGGAAGCGGGAGAAGTGC	0.632																																																	0													122.0	102.0	109.0					14																	74726342		2203	4300	6503	SO:0001583	missense	0			AC005519	CCDS9827.1	14q24.3	2011-06-20	2007-08-21	2007-08-21		ENSG00000119614		"""Homeoboxes / PRD class"""	1975	protein-coding gene	gene with protein product		142993	"""C elegans ceh-10 homeo domain-containing homolog"", ""ceh-10 homeo domain containing homolog (C. elegans)"", ""ceh-10 homeodomain containing homolog (C. elegans)"""	HOX10, CHX10		1973146	Standard	NM_182894		Approved	RET1	uc001xpq.3	P58304		ENST00000261980.2:c.617G>C	14.37:g.74726342G>C	ENSP00000261980:p.Arg206Pro		A1A4X6	Missense_Mutation	SNP	pfam_Homeobox_dom,pfam_OAR_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_OAR_dom,pfscan_Homeobox_dom	p.R206P	ENST00000261980.2	37	c.617	CCDS9827.1	14	.	.	.	.	.	.	.	.	.	.	G	24.1	4.490982	0.84962	.	.	ENSG00000119614	ENST00000261980	D	0.95853	-3.83	5.04	5.04	0.67666	Homeodomain-related (1);Homeobox (2);Homeodomain-like (1);	0.053251	0.64402	D	0.000001	D	0.97263	0.9105	M	0.68593	2.085	0.54753	D	0.999986	D	0.69078	0.997	D	0.70487	0.969	D	0.97807	1.0248	10	0.87932	D	0	.	18.5918	0.91215	0.0:0.0:1.0:0.0	.	206	P58304	VSX2_HUMAN	P	206	ENSP00000261980:R206P	ENSP00000261980:R206P	R	+	2	0	VSX2	73796095	1.000000	0.71417	0.994000	0.49952	0.998000	0.95712	7.693000	0.84214	2.630000	0.89119	0.655000	0.94253	CGG	VSX2	-	superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom	ENSG00000119614		0.632	VSX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VSX2	HGNC	protein_coding	OTTHUMT00000412323.1	-	0.00	59	0	G	NM_182894		74726342	+1	tier1	-	no_errors	ENST00000261980	ensembl	human	known	74_37	missense	26.19	31	11	SNP	0.999	C
WBSCR17	64409	genome.wustl.edu	37	7	71036303	71036303	+	Silent	SNP	C	C	G			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr7:71036303C>G	ENST00000333538.5	+	6	1630	c.996C>G	c.(994-996)gtC>gtG	p.V332V	WBSCR17_ENST00000498380.2_3'UTR	NM_022479.1	NP_071924.1	Q6IS24	GLTL3_HUMAN	Williams-Beuren syndrome chromosome region 17	332	Catalytic subdomain B.				protein glycosylation (GO:0006486)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			NS(5)|breast(2)|central_nervous_system(1)|endometrium(7)|kidney(7)|large_intestine(22)|lung(45)|ovary(2)|pancreas(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	100		all_cancers(73;0.2)|Lung NSC(55;0.094)|all_lung(88;0.125)				CGTTCGTGGTCAACAGGAAGT	0.507																																																	0													206.0	194.0	198.0					7																	71036303		2203	4300	6503	SO:0001819	synonymous_variant	0			AF410457	CCDS5540.1	7q11.23	2014-03-13			ENSG00000185274	ENSG00000185274		"""Glycosyltransferase family 2 domain containing"""	16347	protein-coding gene	gene with protein product	"""polypeptide N-acetylgalactosaminyltransferase-like 3"", ""polypeptide GalNAc transferase 3"""	615137				12073013, 15744064, 22787146	Standard	NM_022479		Approved	GALNTL3, GalNAc-T5L	uc003tvy.4	Q6IS24	OTTHUMG00000129783	ENST00000333538.5:c.996C>G	7.37:g.71036303C>G			Q8NFV9|Q9NTA8	Silent	SNP	pfam_Glyco_trans_2,pfam_Ricin_B_lectin,superfamily_Ricin_B_lectin,smart_Ricin_B_lectin,pfscan_Ricin_B_lectin	p.V332	ENST00000333538.5	37	c.996	CCDS5540.1	7																																																																																			WBSCR17	-	NULL	ENSG00000185274		0.507	WBSCR17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WBSCR17	HGNC	protein_coding	OTTHUMT00000252006.1		0.00	85	0	C	NM_022479		71036303	+1			no_errors	ENST00000333538	ensembl	human	known	74_37	silent	5.71	33	2	SNP	1.000	G
WDR20	91833	genome.wustl.edu	37	14	102676056	102676056	+	Missense_Mutation	SNP	A	A	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr14:102676056A>T	ENST00000342702.3	+	3	1580	c.1549A>T	c.(1549-1551)Atg>Ttg	p.M517L	WDR20_ENST00000299135.6_3'UTR|WDR20_ENST00000556807.1_Missense_Mutation_p.M456L|WDR20_ENST00000556511.2_Missense_Mutation_p.M456L|WDR20_ENST00000424963.2_Missense_Mutation_p.M393L|WDR20_ENST00000454394.2_Missense_Mutation_p.M548L|WDR20_ENST00000335263.5_Missense_Mutation_p.M517L|WDR20_ENST00000545563.1_Missense_Mutation_p.M344L|WDR20_ENST00000499851.2_Missense_Mutation_p.M260L|WDR20_ENST00000322340.5_Intron	NM_001242418.1|NM_144574.3	NP_001229347.1|NP_653175.2	Q8TBZ3	WDR20_HUMAN	WD repeat domain 20	517										breast(1)|large_intestine(2)|lung(4)|prostate(1)	8						GTGTCCTCGAATGGAAGATGT	0.433											OREG0022939	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													98.0	96.0	96.0					14																	102676056		2203	4300	6503	SO:0001583	missense	0			BC028387	CCDS9968.1, CCDS9969.1, CCDS9970.1, CCDS55942.1, CCDS55943.1, CCDS55944.1, CCDS55945.1	14q32.31	2013-01-09				ENSG00000140153		"""WD repeat domain containing"""	19667	protein-coding gene	gene with protein product							Standard	NM_181291		Approved	DMR, MGC33177, FLJ33659	uc010txu.2	Q8TBZ3		ENST00000342702.3:c.1549A>T	14.37:g.102676056A>T	ENSP00000341037:p.Met517Leu	1368	B4DN18|E7EUY8|F8W9S4|G3V2F8|G3V5R0|H0YJJ1|Q86TU2|Q8NCN7|Q8WXX2|Q9UF86	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.M548L	ENST00000342702.3	37	c.1642	CCDS9969.1	14	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	12.63|12.63	1.995416|1.995416	0.35226|0.35226	.|.	.|.	ENSG00000140153|ENSG00000140153	ENST00000335263;ENST00000299135;ENST00000424963;ENST00000342702;ENST00000556807;ENST00000499851;ENST00000454394;ENST00000401892;ENST00000545563|ENST00000556511	T;T;T;T;T;T;T|.	0.71817|.	-0.6;-0.6;-0.6;-0.6;-0.6;-0.6;-0.6|.	5.84|5.84	5.84|5.84	0.93424|0.93424	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.62258|0.62258	0.2413|0.2413	L|L	0.45051|0.45051	1.395|1.395	0.80722|0.80722	D|D	1|1	B;B;B;B;B;B;B|.	0.31790|.	0.004;0.001;0.002;0.002;0.003;0.34;0.001|.	B;B;B;B;B;P;B|.	0.44394|.	0.006;0.002;0.001;0.006;0.009;0.448;0.002|.	T|T	0.58657|0.58657	-0.7598|-0.7598	10|5	0.20046|.	T|.	0.44|.	.|.	16.2159|16.2159	0.82217|0.82217	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	548;529;456;517;456;393;517|.	E7EUY8;Q5JPH5;G3V2F8;Q8TBZ3-2;F8W9S4;B3KR43;Q8TBZ3|.	.;.;.;.;.;.;WDR20_HUMAN|.	L|I	517;456;393;517;456;260;548;447;344|447	ENSP00000335434:M517L;ENSP00000395793:M393L;ENSP00000341037:M517L;ENSP00000450636:M456L;ENSP00000443641:M260L;ENSP00000406084:M548L;ENSP00000437927:M344L|.	ENSP00000299135:M456L|.	M|N	+|+	1|2	0|0	WDR20|WDR20	101745809|101745809	1.000000|1.000000	0.71417|0.71417	0.992000|0.992000	0.48379|0.48379	0.998000|0.998000	0.95712|0.95712	8.954000|8.954000	0.93051|0.93051	2.243000|2.243000	0.73865|0.73865	0.533000|0.533000	0.62120|0.62120	ATG|AAT	WDR20	-	NULL	ENSG00000140153		0.433	WDR20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR20	HGNC	protein_coding	OTTHUMT00000414963.1		0.00	10	0	A	NM_181291		102676056	+1			no_errors	ENST00000454394	ensembl	human	known	74_37	missense	33.33	4	2	SNP	1.000	T
WDR91	29062	genome.wustl.edu	37	7	134891942	134891942	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr7:134891942A>G	ENST00000354475.4	-	4	555	c.524T>C	c.(523-525)aTc>aCc	p.I175T	WDR91_ENST00000344400.5_Missense_Mutation_p.I175T|WDR91_ENST00000485942.1_5'Flank|WDR91_ENST00000423565.1_Missense_Mutation_p.I140T	NM_014149.3	NP_054868.3	A4D1P6	WDR91_HUMAN	WD repeat domain 91	175										breast(3)|endometrium(2)|kidney(2)|large_intestine(12)|lung(14)|ovary(1)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)	40						AAAGTTCAGGATCACAGGGAC	0.463																																																	0													89.0	81.0	84.0					7																	134891942		2203	4300	6503	SO:0001583	missense	0			AF161534	CCDS34758.1	7q33	2013-01-09			ENSG00000105875	ENSG00000105875		"""WD repeat domain containing"""	24997	protein-coding gene	gene with protein product						11042152, 11230166	Standard	NM_014149		Approved	HSPC049	uc003vsp.2	A4D1P6	OTTHUMG00000155414	ENST00000354475.4:c.524T>C	7.37:g.134891942A>G	ENSP00000346466:p.Ile175Thr		A6NK54|C9JMI4|Q6FI65|Q6MZQ1|Q6P4I1|Q96AE5|Q96G63|Q9H062|Q9H9B6|Q9NVG7|Q9NZY6	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.I175T	ENST00000354475.4	37	c.524	CCDS34758.1	7	.	.	.	.	.	.	.	.	.	.	A	19.78	3.891731	0.72524	.	.	ENSG00000105875	ENST00000344400;ENST00000354475;ENST00000423565	D;D;D	0.91464	-2.85;-2.85;-2.85	5.87	5.87	0.94306	.	0.230036	0.46145	D	0.000305	D	0.89150	0.6633	M	0.66939	2.045	0.52501	D	0.999952	B	0.32717	0.381	B	0.25884	0.064	D	0.88800	0.3284	10	0.87932	D	0	-14.1854	16.332	0.83039	1.0:0.0:0.0:0.0	.	175	A4D1P6	WDR91_HUMAN	T	175;175;140	ENSP00000340877:I175T;ENSP00000346466:I175T;ENSP00000392555:I140T	ENSP00000340877:I175T	I	-	2	0	WDR91	134542482	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.814000	0.91968	2.251000	0.74343	0.529000	0.55759	ATC	WDR91	-	NULL	ENSG00000105875		0.463	WDR91-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR91	HGNC	protein_coding	OTTHUMT00000340019.1		0.00	47	0	A	NM_014149		134891942	-1			no_errors	ENST00000354475	ensembl	human	known	74_37	missense	9.52	19	2	SNP	1.000	G
WIPF2	147179	genome.wustl.edu	37	17	38434657	38434657	+	3'UTR	SNP	G	G	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr17:38434657G>T	ENST00000323571.4	+	0	1743				WIPF2_ENST00000494757.1_3'UTR|WIPF2_ENST00000536600.1_3'UTR|WIPF2_ENST00000394103.3_3'UTR|WIPF2_ENST00000585043.1_3'UTR	NM_133264.4	NP_573571.1	Q8TF74	WIPF2_HUMAN	WAS/WASL interacting protein family, member 2						Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)				NS(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(6)|ovary(1)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	30						CTCTGGATTTGGTGATCAGAC	0.483										HNSCC(43;0.11)																																							0																																										SO:0001624	3_prime_UTR_variant	0			BC025965	CCDS11364.1	17q21.2	2006-10-12			ENSG00000171475	ENSG00000171475			30923	protein-coding gene	gene with protein product		609692				12213210, 11829459	Standard	XM_005257083		Approved	WICH, WIRE	uc002hug.1	Q8TF74	OTTHUMG00000133331	ENST00000323571.4:c.*180G>T	17.37:g.38434657G>T			A8K0L3|Q658J8|Q71RE1|Q8TE44	RNA	SNP	-	NULL	ENST00000323571.4	37	NULL	CCDS11364.1	17																																																																																			WIPF2	-	-	ENSG00000171475		0.483	WIPF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	WIPF2	HGNC	protein_coding	OTTHUMT00000257157.2	-	0.00	34	0	G	NM_133264		38434657	+1	tier1	-	no_errors	ENST00000494757	ensembl	human	known	74_37	rna	20.83	19	5	SNP	1.000	T
WFIKKN2	124857	genome.wustl.edu	37	17	48917666	48917666	+	Missense_Mutation	SNP	A	A	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr17:48917666A>T	ENST00000311378.4	+	2	1545	c.1017A>T	c.(1015-1017)gaA>gaT	p.E339D	RP11-506D12.5_ENST00000572491.2_RNA|WFIKKN2_ENST00000426127.1_Missense_Mutation_p.E246D	NM_175575.5	NP_783165.1	Q8TEU8	WFKN2_HUMAN	WAP, follistatin/kazal, immunoglobulin, kunitz and netrin domain containing 2	339	BPTI/Kunitz inhibitor 1. {ECO:0000255|PROSITE-ProRule:PRU00031}.				muscle fiber development (GO:0048747)|negative regulation of DNA binding (GO:0043392)|negative regulation of protein binding (GO:0032091)|palate development (GO:0060021)|skeletal system development (GO:0001501)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular region (GO:0005576)	metalloendopeptidase inhibitor activity (GO:0008191)|serine-type endopeptidase inhibitor activity (GO:0004867)			cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|lung(13)|ovary(4)|skin(1)	29			BRCA - Breast invasive adenocarcinoma(22;1.09e-08)			ACTGTGGCGAAGAGCAGACCC	0.627																																																	0													73.0	63.0	67.0					17																	48917666		2203	4300	6503	SO:0001583	missense	0			AY358142	CCDS11575.1	17q21.33	2013-01-21			ENSG00000173714	ENSG00000173714		"""Immunoglobulin superfamily / I-set domain containing"", ""WAP four-disulfide core domain containing"""	30916	protein-coding gene	gene with protein product	"""WAP four-disulfide core domain 20B"""	610895				11928817, 12709070	Standard	NM_175575		Approved	WFIKKNRP, WFDC20B	uc002isv.4	Q8TEU8	OTTHUMG00000162274	ENST00000311378.4:c.1017A>T	17.37:g.48917666A>T	ENSP00000311184:p.Glu339Asp		Q6UXZ9	Missense_Mutation	SNP	pfam_Prot_inh_Kunz-m,pfam_Ig_I-set,pfam_Netrin_module_non-TIMP,pfam_WAP-type_4-diS_core,pfam_Kazal_dom,pfam_Ig_V-set,superfamily_TIMP-like_OB-fold,superfamily_Prot_inh_Kunz-m,superfamily_WAP-type_4-diS_core,smart_WAP-type_4-diS_core,smart_Ig_sub,smart_Ig_sub2,smart_Prot_inh_Kunz-m,pfscan_Netrin_domain,pfscan_Prot_inh_Kunz-m,pfscan_Ig-like_dom,prints_Prot_inh_Kunz-m	p.E339D	ENST00000311378.4	37	c.1017	CCDS11575.1	17	.	.	.	.	.	.	.	.	.	.	A	12.11	1.840845	0.32513	.	.	ENSG00000173714	ENST00000426127;ENST00000311378	T;T	0.56941	0.43;0.43	5.31	0.524	0.17066	Proteinase inhibitor I2, Kunitz metazoa (5);	0.000000	0.85682	D	0.000000	T	0.35508	0.0934	L	0.31420	0.93	0.44694	D	0.997689	B	0.32781	0.384	B	0.36134	0.218	T	0.05500	-1.0881	10	0.12766	T	0.61	.	9.4947	0.38982	0.5008:0.0:0.4992:0.0	.	339	Q8TEU8	WFKN2_HUMAN	D	246;339	ENSP00000405889:E246D;ENSP00000311184:E339D	ENSP00000311184:E339D	E	+	3	2	WFIKKN2	46272665	0.886000	0.30341	0.990000	0.47175	0.219000	0.24729	0.239000	0.18023	0.227000	0.20999	-0.366000	0.07423	GAA	WFIKKN2	-	pfam_Prot_inh_Kunz-m,superfamily_Prot_inh_Kunz-m,smart_Prot_inh_Kunz-m,pfscan_Prot_inh_Kunz-m	ENSG00000173714		0.627	WFIKKN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WFIKKN2	HGNC	protein_coding	OTTHUMT00000368358.1	-	0.00	45	0	A	NM_175575		48917666	+1	tier1	-	no_errors	ENST00000311378	ensembl	human	known	74_37	missense	16.67	40	8	SNP	0.993	T
XPO7	23039	genome.wustl.edu	37	8	21832255	21832255	+	Frame_Shift_Del	DEL	C	C	-			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr8:21832255delC	ENST00000252512.9	+	6	667	c.567delC	c.(565-567)atcfs	p.I189fs	XPO7_ENST00000434536.1_Frame_Shift_Del_p.I198fs|XPO7_ENST00000518017.1_3'UTR|XPO7_ENST00000433566.4_Frame_Shift_Del_p.I190fs	NM_015024.4	NP_055839.3	Q9UIA9	XPO7_HUMAN	exportin 7	189					mRNA transport (GO:0051028)|protein export from nucleus (GO:0006611)	cytoplasm (GO:0005737)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	nuclear export signal receptor activity (GO:0005049)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(2)|lung(12)|ovary(2)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	36				Colorectal(74;0.0187)|COAD - Colon adenocarcinoma(73;0.0724)		TATTTGATATCTTCACACTTT	0.378																																																	0													123.0	110.0	114.0					8																	21832255		1857	4084	5941	SO:0001589	frameshift_variant	0			AF064729	CCDS47818.1	8p21	2011-04-13	2003-03-11	2003-03-14	ENSG00000130227	ENSG00000130227		"""Exportins"""	14108	protein-coding gene	gene with protein product		606140	"""RAN binding protein 16"""	RANBP16		11024021, 9872452	Standard	NM_015024		Approved	KIAA0745	uc003xaa.4	Q9UIA9	OTTHUMG00000163789	ENST00000252512.9:c.567delC	8.37:g.21832255delC	ENSP00000252512:p.Ile189fs		O94846|Q6PJK9|Q8NEK7	Frame_Shift_Del	DEL	pfam_Importin-beta_N,superfamily_ARM-type_fold,smart_Importin-beta_N,pfscan_Importin-beta_N	p.F199fs	ENST00000252512.9	37	c.594	CCDS47818.1	8																																																																																			XPO7	-	superfamily_ARM-type_fold	ENSG00000130227		0.378	XPO7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XPO7	HGNC	protein_coding	OTTHUMT00000375494.1		0.00	65	0	C	NM_015024		21832255	+1			no_errors	ENST00000434536	ensembl	human	known	74_37	frame_shift_del	14.29	18	3	DEL	1.000	0
XPO7	23039	genome.wustl.edu	37	8	21832259	21832259	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr8:21832259A>C	ENST00000252512.9	+	6	671	c.571A>C	c.(571-573)Aca>Cca	p.T191P	XPO7_ENST00000434536.1_Missense_Mutation_p.T200P|XPO7_ENST00000518017.1_3'UTR|XPO7_ENST00000433566.4_Missense_Mutation_p.T192P	NM_015024.4	NP_055839.3	Q9UIA9	XPO7_HUMAN	exportin 7	191					mRNA transport (GO:0051028)|protein export from nucleus (GO:0006611)	cytoplasm (GO:0005737)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	nuclear export signal receptor activity (GO:0005049)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(2)|lung(12)|ovary(2)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	36				Colorectal(74;0.0187)|COAD - Colon adenocarcinoma(73;0.0724)		TGATATCTTCACACTTTCCTG	0.378																																																	0													119.0	105.0	110.0					8																	21832259		1857	4082	5939	SO:0001583	missense	0			AF064729	CCDS47818.1	8p21	2011-04-13	2003-03-11	2003-03-14	ENSG00000130227	ENSG00000130227		"""Exportins"""	14108	protein-coding gene	gene with protein product		606140	"""RAN binding protein 16"""	RANBP16		11024021, 9872452	Standard	NM_015024		Approved	KIAA0745	uc003xaa.4	Q9UIA9	OTTHUMG00000163789	ENST00000252512.9:c.571A>C	8.37:g.21832259A>C	ENSP00000252512:p.Thr191Pro		O94846|Q6PJK9|Q8NEK7	Missense_Mutation	SNP	pfam_Importin-beta_N,superfamily_ARM-type_fold,smart_Importin-beta_N,pfscan_Importin-beta_N	p.T200P	ENST00000252512.9	37	c.598	CCDS47818.1	8	.	.	.	.	.	.	.	.	.	.	A	16.99	3.273813	0.59649	.	.	ENSG00000130227	ENST00000434536;ENST00000252512;ENST00000433566	T;T;T	0.46819	0.86;0.86;0.86	5.89	5.89	0.94794	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.40119	0.1104	N	0.24115	0.695	0.80722	D	1	B;B;B	0.29909	0.233;0.261;0.261	B;B;B	0.36335	0.157;0.222;0.222	T	0.24584	-1.0156	10	0.31617	T	0.26	-10.3557	15.9812	0.80111	1.0:0.0:0.0:0.0	.	192;200;191	E7ESC6;E9PEN8;Q9UIA9	.;.;XPO7_HUMAN	P	200;191;192	ENSP00000404853:T200P;ENSP00000252512:T191P;ENSP00000410249:T192P	ENSP00000252512:T191P	T	+	1	0	XPO7	21888205	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.283000	0.95860	2.256000	0.74724	0.528000	0.53228	ACA	XPO7	-	superfamily_ARM-type_fold	ENSG00000130227		0.378	XPO7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XPO7	HGNC	protein_coding	OTTHUMT00000375494.1		0.00	65	0	A	NM_015024		21832259	+1			no_errors	ENST00000434536	ensembl	human	known	74_37	missense	15.00	17	3	SNP	1.000	C
XPO7	23039	genome.wustl.edu	37	8	21832262	21832262	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr8:21832262C>G	ENST00000252512.9	+	6	674	c.574C>G	c.(574-576)Ctt>Gtt	p.L192V	XPO7_ENST00000434536.1_Missense_Mutation_p.L201V|XPO7_ENST00000518017.1_3'UTR|XPO7_ENST00000433566.4_Missense_Mutation_p.L193V	NM_015024.4	NP_055839.3	Q9UIA9	XPO7_HUMAN	exportin 7	192					mRNA transport (GO:0051028)|protein export from nucleus (GO:0006611)	cytoplasm (GO:0005737)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	nuclear export signal receptor activity (GO:0005049)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(2)|lung(12)|ovary(2)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	36				Colorectal(74;0.0187)|COAD - Colon adenocarcinoma(73;0.0724)		TATCTTCACACTTTCCTGCAA	0.378																																																	0													120.0	106.0	111.0					8																	21832262		1860	4082	5942	SO:0001583	missense	0			AF064729	CCDS47818.1	8p21	2011-04-13	2003-03-11	2003-03-14	ENSG00000130227	ENSG00000130227		"""Exportins"""	14108	protein-coding gene	gene with protein product		606140	"""RAN binding protein 16"""	RANBP16		11024021, 9872452	Standard	NM_015024		Approved	KIAA0745	uc003xaa.4	Q9UIA9	OTTHUMG00000163789	ENST00000252512.9:c.574C>G	8.37:g.21832262C>G	ENSP00000252512:p.Leu192Val		O94846|Q6PJK9|Q8NEK7	Missense_Mutation	SNP	pfam_Importin-beta_N,superfamily_ARM-type_fold,smart_Importin-beta_N,pfscan_Importin-beta_N	p.L201V	ENST00000252512.9	37	c.601	CCDS47818.1	8	.	.	.	.	.	.	.	.	.	.	C	23.5	4.418614	0.83559	.	.	ENSG00000130227	ENST00000434536;ENST00000252512;ENST00000433566	T;T;T	0.48201	0.82;0.82;0.82	5.89	5.89	0.94794	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.44477	0.1295	L	0.43923	1.385	0.80722	D	1	P;B;B	0.35307	0.494;0.008;0.008	B;B;B	0.34138	0.176;0.02;0.027	T	0.22521	-1.0214	10	0.30854	T	0.27	-12.2134	19.8616	0.96786	0.0:1.0:0.0:0.0	.	193;201;192	E7ESC6;E9PEN8;Q9UIA9	.;.;XPO7_HUMAN	V	201;192;193	ENSP00000404853:L201V;ENSP00000252512:L192V;ENSP00000410249:L193V	ENSP00000252512:L192V	L	+	1	0	XPO7	21888208	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.023000	0.70848	2.796000	0.96246	0.650000	0.86243	CTT	XPO7	-	superfamily_ARM-type_fold	ENSG00000130227		0.378	XPO7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XPO7	HGNC	protein_coding	OTTHUMT00000375494.1		0.00	65	0	C	NM_015024		21832262	+1			no_errors	ENST00000434536	ensembl	human	known	74_37	missense	14.29	18	3	SNP	1.000	G
XPOT	11260	genome.wustl.edu	37	12	64811879	64811879	+	Nonsense_Mutation	SNP	C	C	G			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr12:64811879C>G	ENST00000332707.5	+	5	783	c.254C>G	c.(253-255)tCa>tGa	p.S85*		NM_007235.4	NP_009166.2	O43592	XPOT_HUMAN	exportin, tRNA	85	Necessary for interaction with Ran, nuclear localization and nuclear import.				intracellular protein transport (GO:0006886)|tRNA export from nucleus (GO:0006409)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	tRNA binding (GO:0000049)			NS(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(7)|lung(12)|ovary(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45				GBM - Glioblastoma multiforme(28;0.0404)		ACGCTCATATCATGGCTGCAA	0.328																																																	0													86.0	86.0	86.0					12																	64811879		2203	4299	6502	SO:0001587	stop_gained	0			AF039022	CCDS31852.1	12q14.1	2012-10-17	2012-10-17		ENSG00000184575	ENSG00000184575		"""Exportins"""	12826	protein-coding gene	gene with protein product		603180	"""exportin, tRNA (nuclear export receptor for tRNAs)"""			9660920, 9512417	Standard	NM_007235		Approved	XPO3	uc001ssb.3	O43592	OTTHUMG00000168794	ENST00000332707.5:c.254C>G	12.37:g.64811879C>G	ENSP00000327821:p.Ser85*		A6NLH1|O43784|Q8WUG2|Q9BVS7	Nonsense_Mutation	SNP	pfam_Exportin-1/Importin-b-like,pfam_Importin-beta_N,superfamily_ARM-type_fold,smart_Importin-beta_N	p.S85*	ENST00000332707.5	37	c.254	CCDS31852.1	12	.	.	.	.	.	.	.	.	.	.	C	40	8.083434	0.98646	.	.	ENSG00000184575	ENST00000332707;ENST00000400935	.	.	.	5.32	5.32	0.75619	.	0.174597	0.48767	D	0.000171	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.3771	0.94514	0.0:1.0:0.0:0.0	.	.	.	.	X	85	.	.	S	+	2	0	XPOT	63098146	1.000000	0.71417	0.968000	0.41197	0.863000	0.49368	4.782000	0.62396	2.645000	0.89757	0.650000	0.86243	TCA	XPOT	-	pfam_Importin-beta_N,superfamily_ARM-type_fold,smart_Importin-beta_N	ENSG00000184575		0.328	XPOT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XPOT	HGNC	protein_coding	OTTHUMT00000401122.1		0.00	24	0	C	NM_007235		64811879	+1			no_errors	ENST00000332707	ensembl	human	known	74_37	nonsense	22.22	7	2	SNP	1.000	G
ZCCHC11	23318	genome.wustl.edu	37	1	52991558	52991558	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr1:52991558G>A	ENST00000371544.3	-	2	657	c.395C>T	c.(394-396)cCa>cTa	p.P132L	ZCCHC11_ENST00000355809.4_Missense_Mutation_p.P132L|ZCCHC11_ENST00000257177.4_Missense_Mutation_p.P132L|ZCCHC11_ENST00000371541.1_5'UTR	NM_001009881.2|NM_015269.2	NP_001009881.1|NP_056084.1	Q5TAX3	TUT4_HUMAN	zinc finger, CCHC domain containing 11	132					cytokine production (GO:0001816)|miRNA catabolic process (GO:0010587)|miRNA metabolic process (GO:0010586)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|pre-miRNA processing (GO:0031054)|regulation of lipopolysaccharide-mediated signaling pathway (GO:0031664)|RNA 3'-end processing (GO:0031123)|stem cell maintenance (GO:0019827)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)|RNA uridylyltransferase activity (GO:0050265)|zinc ion binding (GO:0008270)			NS(2)|breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(15)|lung(17)|ovary(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	58						AGGTGACTTTGGTGATTTTTC	0.403																																																	0													175.0	174.0	174.0					1																	52991558		2203	4300	6503	SO:0001583	missense	0			D83776	CCDS30715.1, CCDS30716.1	1p32.3	2014-03-05			ENSG00000134744	ENSG00000134744		"""Zinc fingers, CCHC domain containing"""	28981	protein-coding gene	gene with protein product	"""TUTase4"""	613692				8724849, 12239557	Standard	NM_015269		Approved	KIAA0191, PAPD3, TUT4	uc001cty.2	Q5TAX3	OTTHUMG00000008200	ENST00000371544.3:c.395C>T	1.37:g.52991558G>A	ENSP00000360599:p.Pro132Leu		A2RRP0|B7Z8J5|D3DQ35|Q12764|Q5TAX2|Q5TAX4|Q86XZ3	Missense_Mutation	SNP	pfam_PAP_assoc,pfam_Znf_CCHC,pfam_Nucleotidyltransferase,superfamily_Znf_CCHC,smart_Znf_CCHC,pfscan_Znf_CCHC	p.P132L	ENST00000371544.3	37	c.395	CCDS30716.1	1	.	.	.	.	.	.	.	.	.	.	G	6.573	0.474110	0.12521	.	.	ENSG00000134744	ENST00000257177;ENST00000371544;ENST00000528642;ENST00000355809	T;T;T	0.45276	1.04;1.03;0.9	5.08	4.17	0.49024	.	0.919358	0.09289	N	0.822613	T	0.41858	0.1177	L	0.47716	1.5	0.41324	D	0.987195	B;B;P;B	0.45827	0.003;0.006;0.867;0.0	B;B;B;B	0.43103	0.003;0.009;0.408;0.001	T	0.32025	-0.9922	10	0.66056	D	0.02	.	10.9191	0.47154	0.1543:0.0:0.8457:0.0	.	132;132;132;132	E9PKY2;Q5TAX3-2;E9PRG2;Q5TAX3	.;.;.;TUT4_HUMAN	L	132	ENSP00000257177:P132L;ENSP00000360599:P132L;ENSP00000433486:P132L	ENSP00000257177:P132L	P	-	2	0	ZCCHC11	52764146	1.000000	0.71417	0.976000	0.42696	0.806000	0.45545	2.944000	0.49034	1.473000	0.48159	-0.140000	0.14226	CCA	ZCCHC11	-	NULL	ENSG00000134744		0.403	ZCCHC11-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZCCHC11	HGNC	protein_coding	OTTHUMT00000022462.1	-	0.00	87	0	G	XM_038288		52991558	-1	tier1	-	no_errors	ENST00000257177	ensembl	human	known	74_37	missense	17.31	43	9	SNP	0.934	A
ZDBF2	57683	genome.wustl.edu	37	2	207174791	207174791	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr2:207174791G>T	ENST00000374423.3	+	5	5925	c.5539G>T	c.(5539-5541)Gtg>Ttg	p.V1847L		NM_020923.1	NP_065974.1	Q9HCK1	ZDBF2_HUMAN	zinc finger, DBF-type containing 2	1847							nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			endometrium(4)|kidney(5)|large_intestine(28)|lung(50)|ovary(4)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	95						TAATGCTCTGGTGAAGGAGTT	0.413																																																	0													76.0	73.0	74.0					2																	207174791		1866	4109	5975	SO:0001583	missense	0			AB046791	CCDS46501.1, CCDS74637.1	2q33.3	2013-01-10			ENSG00000204186	ENSG00000204186		"""Zinc fingers, DBF-type"""	29313	protein-coding gene	gene with protein product						10997877	Standard	XM_005246711		Approved	FLJ45338, KIAA1571	uc002vbp.2	Q9HCK1	OTTHUMG00000154648	ENST00000374423.3:c.5539G>T	2.37:g.207174791G>T	ENSP00000363545:p.Val1847Leu		Q6ZNP7|Q6ZSN8	Missense_Mutation	SNP	pfam_Znf_DBF,smart_Znf_DBF	p.V1847L	ENST00000374423.3	37	c.5539	CCDS46501.1	2	.	.	.	.	.	.	.	.	.	.	G	24.5	4.541605	0.85917	.	.	ENSG00000204186	ENST00000374423	T	0.62788	-0.0	5.11	5.11	0.69529	.	.	.	.	.	T	0.74390	0.3710	L	0.44542	1.39	0.32916	D	0.515206	D	0.76494	0.999	D	0.76071	0.987	T	0.80070	-0.1536	9	0.66056	D	0.02	.	18.5847	0.91185	0.0:0.0:1.0:0.0	.	1847	Q9HCK1	ZDBF2_HUMAN	L	1847	ENSP00000363545:V1847L	ENSP00000363545:V1847L	V	+	1	0	ZDBF2	206883036	1.000000	0.71417	0.967000	0.41034	0.868000	0.49771	3.650000	0.54424	2.393000	0.81446	0.551000	0.68910	GTG	ZDBF2	-	NULL	ENSG00000204186		0.413	ZDBF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZDBF2	HGNC	protein_coding	OTTHUMT00000336458.1		0.00	39	0	G	NM_020923		207174791	+1			no_errors	ENST00000374423	ensembl	human	known	74_37	missense	6.67	28	2	SNP	1.000	T
ZFHX4	79776	genome.wustl.edu	37	8	77616662	77616662	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr8:77616662G>C	ENST00000521891.2	+	2	787	c.339G>C	c.(337-339)gaG>gaC	p.E113D	ZFHX4_ENST00000517683.1_Intron|ZFHX4_ENST00000050961.6_Missense_Mutation_p.E113D|ZFHX4_ENST00000518282.1_Missense_Mutation_p.E113D|ZFHX4_ENST00000455469.2_Missense_Mutation_p.E113D	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	113					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			ATGACAACGAGAGCGAGATCA	0.483										HNSCC(33;0.089)																																							0													158.0	153.0	155.0					8																	77616662		2011	4173	6184	SO:0001583	missense	0				CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.339G>C	8.37:g.77616662G>C	ENSP00000430497:p.Glu113Asp		G3V138|Q18PS0|Q6ZN20	Missense_Mutation	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,superfamily_Adenylate_cyclase-assoc_CAP_N,smart_Znf_C2H2-like,smart_Znf_U1,smart_Homeobox_dom,pfscan_Homeobox_dom,pfscan_Znf_C2H2	p.E113D	ENST00000521891.2	37	c.339	CCDS47878.2	8	.	.	.	.	.	.	.	.	.	.	G	7.482	0.648900	0.14516	.	.	ENSG00000091656	ENST00000521891;ENST00000399468;ENST00000455469;ENST00000050961;ENST00000520307;ENST00000517585;ENST00000523809;ENST00000518282	T;T;T;T;T;T;T	0.18960	2.18;2.18;2.18;2.18;2.18;2.18;2.18	5.42	5.42	0.78866	.	0.000000	0.44902	U	0.000406	T	0.19287	0.0463	L	0.43152	1.355	0.44728	D	0.997721	B;B;B;B	0.21309	0.032;0.054;0.054;0.001	B;B;B;B	0.19666	0.012;0.026;0.026;0.004	T	0.03717	-1.1010	10	0.17832	T	0.49	.	14.9587	0.71138	0.0:0.1423:0.8577:0.0	.	113;113;113;113	Q86UP3;Q86UP3-4;G3V138;Q86UP3-3	ZFHX4_HUMAN;.;.;.	D	113	ENSP00000430497:E113D;ENSP00000399605:E113D;ENSP00000050961:E113D;ENSP00000428525:E113D;ENSP00000427775:E113D;ENSP00000427739:E113D;ENSP00000430848:E113D	ENSP00000050961:E113D	E	+	3	2	ZFHX4	77779217	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	5.434000	0.66526	2.821000	0.97095	0.650000	0.86243	GAG	ZFHX4	-	NULL	ENSG00000091656		0.483	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZFHX4	HGNC	protein_coding	OTTHUMT00000379197.2	-	0.00	40	0	G	NM_024721		77616662	+1	tier1	-	no_errors	ENST00000521891	ensembl	human	known	74_37	missense	20.00	16	4	SNP	1.000	C
ZFHX4	79776	genome.wustl.edu	37	8	77765554	77765554	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr8:77765554C>T	ENST00000521891.2	+	10	6845	c.6397C>T	c.(6397-6399)Cgg>Tgg	p.R2133W	ZFHX4_ENST00000050961.6_Missense_Mutation_p.R2088W|ZFHX4_ENST00000518282.1_Missense_Mutation_p.R2107W|ZFHX4_ENST00000455469.2_Missense_Mutation_p.R2088W	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	2088					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			CAAACGCCCACGGACAAGAAT	0.448										HNSCC(33;0.089)																																							0													46.0	45.0	46.0					8																	77765554		1910	4127	6037	SO:0001583	missense	0				CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.6397C>T	8.37:g.77765554C>T	ENSP00000430497:p.Arg2133Trp		G3V138|Q18PS0|Q6ZN20	Missense_Mutation	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,superfamily_Adenylate_cyclase-assoc_CAP_N,smart_Znf_C2H2-like,smart_Znf_U1,smart_Homeobox_dom,pfscan_Homeobox_dom,pfscan_Znf_C2H2	p.R2133W	ENST00000521891.2	37	c.6397	CCDS47878.2	8	.	.	.	.	.	.	.	.	.	.	C	13.54	2.266259	0.40095	.	.	ENSG00000091656	ENST00000521891;ENST00000399468;ENST00000455469;ENST00000050961;ENST00000518282	D;D;D;D	0.99186	-5.53;-5.53;-5.53;-5.53	3.92	2.0	0.26442	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.000000	0.41097	U	0.000946	D	0.99554	0.9840	H	0.99074	4.42	0.58432	D	0.999999	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.998	D	0.98335	1.0535	10	0.87932	D	0	.	11.2307	0.48910	0.481:0.5189:0.0:0.0	.	2088;2088;2133	Q86UP3;Q86UP3-4;G3V138	ZFHX4_HUMAN;.;.	W	2133;2117;2088;2088;2107	ENSP00000430497:R2133W;ENSP00000399605:R2088W;ENSP00000050961:R2088W;ENSP00000430848:R2107W	ENSP00000050961:R2088W	R	+	1	2	ZFHX4	77928109	0.984000	0.35163	0.966000	0.40874	0.975000	0.68041	2.414000	0.44627	0.391000	0.25143	0.455000	0.32223	CGG	ZFHX4	-	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom	ENSG00000091656		0.448	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZFHX4	HGNC	protein_coding	OTTHUMT00000379197.2	-	0.00	35	0	C	NM_024721		77765554	+1	tier1	-	no_errors	ENST00000521891	ensembl	human	known	74_37	missense	17.24	24	5	SNP	1.000	T
ZFYVE9	9372	genome.wustl.edu	37	1	52805903	52805903	+	Splice_Site	SNP	G	G	A			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr1:52805903G>A	ENST00000371591.1	+	16	4070	c.3939G>A	c.(3937-3939)gaG>gaA	p.E1313E	ZFYVE9_ENST00000357206.2_Splice_Site_p.E1254E|ZFYVE9_ENST00000287727.3_Splice_Site_p.E1313E	NM_004799.2|NM_007324.2	NP_004790.2|NP_015563.2	O95405	ZFYV9_HUMAN	zinc finger, FYVE domain containing 9	1313					endocytosis (GO:0006897)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|proteolysis (GO:0006508)|SMAD protein complex assembly (GO:0007183)|SMAD protein import into nucleus (GO:0007184)|transforming growth factor beta receptor signaling pathway (GO:0007179)	early endosome (GO:0005769)|early endosome membrane (GO:0031901)	1-phosphatidylinositol binding (GO:0005545)|metal ion binding (GO:0046872)|serine-type peptidase activity (GO:0008236)			breast(1)|central_nervous_system(4)|endometrium(3)|kidney(1)|large_intestine(12)|lung(17)|ovary(2)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(6)	53						GATGGACAGAGGTAAGGAAAT	0.378																																																	0													67.0	64.0	65.0					1																	52805903		2203	4300	6503	SO:0001630	splice_region_variant	0			AF104304	CCDS563.1, CCDS564.1	1p32.3	2014-06-13	2004-05-21	2004-05-26	ENSG00000157077	ENSG00000157077		"""Zinc fingers, FYVE domain containing"""	6775	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 173"""	603755	"""MAD, mothers against decapentaplegic homolog (Drosophila) interacting protein, receptor activation anchor"""	MADHIP		9865696	Standard	NM_007324		Approved	SMADIP, SARA, PPP1R173	uc001cto.4	O95405	OTTHUMG00000008061	ENST00000371591.1:c.3939+1G>A	1.37:g.52805903G>A			Q5T0F6|Q5T0F7|Q9UNE1|Q9Y5R7	Silent	SNP	pfam_DUF3480,pfam_SARA_Smad-bd,pfam_Znf_FYVE,superfamily_Znf_FYVE_PHD,smart_Znf_FYVE,pirsf_Znf_FYVE_SARA/endofin,pfscan_Znf_FYVE-rel	p.E1313	ENST00000371591.1	37	c.3939	CCDS563.1	1																																																																																			ZFYVE9	-	pfam_DUF3480,pirsf_Znf_FYVE_SARA/endofin	ENSG00000157077		0.378	ZFYVE9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFYVE9	HGNC	protein_coding	OTTHUMT00000022083.1	-	0.00	50	0	G	NM_007324	Silent	52805903	+1	tier1	-	no_errors	ENST00000287727	ensembl	human	known	74_37	silent	10.00	36	4	SNP	1.000	A
ZIM2	23619	genome.wustl.edu	37	19	57293467	57293467	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr19:57293467C>G	ENST00000391708.3	-	10	1042	c.500G>C	c.(499-501)gGa>gCa	p.G167A	ZIM2_ENST00000601070.1_Missense_Mutation_p.G167A|ZIM2_ENST00000599935.1_Missense_Mutation_p.G167A|ZIM2_ENST00000221722.5_Missense_Mutation_p.G167A|AC006115.3_ENST00000597946.1_RNA|ZIM2_ENST00000593711.1_Missense_Mutation_p.G167A|AC006115.3_ENST00000595954.1_RNA|AC006115.3_ENST00000594400.1_RNA	NM_001146326.1|NM_001146327.1	NP_001139798.1|NP_001139799.1	Q9NZV7	ZIM2_HUMAN	zinc finger, imprinted 2	167					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(10)|lung(20)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	44		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0314)		CAGAAATGTTCCTAAGTGTTT	0.498																																																	0													141.0	121.0	128.0					19																	57293467		2203	4300	6503	SO:0001583	missense	0			AF166122	CCDS33123.1	19q13.4	2012-10-31				ENSG00000269699		"""Zinc fingers, C2H2-type"""	12875	protein-coding gene	gene with protein product							Standard	NM_015363		Approved	ZNF656		Q9NZV7		ENST00000391708.3:c.500G>C	19.37:g.57293467C>G	ENSP00000375589:p.Gly167Ala		Q2M3K1	Missense_Mutation	SNP	pfam_Krueppel-associated_box,pfam_Znf_C2H2,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.G167A	ENST00000391708.3	37	c.500	CCDS33123.1	19	.	.	.	.	.	.	.	.	.	.	C	4.923	0.171481	0.09391	.	.	ENSG00000198300	ENST00000391708;ENST00000221722	T;T	0.04194	3.68;3.68	5.21	0.582	0.17412	.	.	.	.	.	T	0.01523	0.0049	N	0.08118	0	.	.	.	P	0.46784	0.884	B	0.32211	0.142	T	0.34750	-0.9816	8	0.09338	T	0.73	.	3.6652	0.08253	0.1713:0.5425:0.0:0.2863	.	167	Q9NZV7	ZIM2_HUMAN	A	167	ENSP00000375589:G167A;ENSP00000221722:G167A	ENSP00000221722:G167A	G	-	2	0	ZIM2	61985279	0.000000	0.05858	0.000000	0.03702	0.028000	0.11728	0.449000	0.21744	0.119000	0.18210	0.655000	0.94253	GGA	ZIM2	-	NULL	ENSG00000269699		0.498	ZIM2-202	KNOWN	basic|appris_principal|CCDS	protein_coding	ZIM2	HGNC	protein_coding	OTTHUMT00000416094.2	-	0.00	30	0	C			57293467	-1	tier1	-	no_errors	ENST00000221722	ensembl	human	known	74_37	missense	29.41	12	5	SNP	0.000	G
ZKSCAN4	387032	genome.wustl.edu	37	6	28213173	28213173	+	Silent	SNP	A	A	G			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr6:28213173A>G	ENST00000377294.2	-	5	1602	c.1359T>C	c.(1357-1359)atT>atC	p.I453I	ZKSCAN4_ENST00000423974.2_Silent_p.I298I	NM_019110.3	NP_061983.2	Q969J2	ZKSC4_HUMAN	zinc finger with KRAB and SCAN domains 4	453					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|large_intestine(2)|lung(10)|ovary(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	18						TATCACCATGAATCCTCTGAT	0.473																																																	0													113.0	116.0	115.0					6																	28213173		2203	4300	6503	SO:0001819	synonymous_variant	0			AK056698	CCDS4647.1	6p21	2013-01-09	2007-02-20	2007-02-20	ENSG00000187626	ENSG00000187626		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	13854	protein-coding gene	gene with protein product		611643	"""zinc finger protein 307"", ""zinc finger protein 427"""	ZNF307, ZNF427		12477932	Standard	NM_019110		Approved	p373c6.1, P1P373C6, FLJ32136, ZSCAN36	uc003nks.1	Q969J2	OTTHUMG00000014511	ENST00000377294.2:c.1359T>C	6.37:g.28213173A>G			B2RE32|Q5U7L4	Silent	SNP	pfam_Tscrpt_reg_SCAN,pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Retrov_capsid_C,superfamily_Krueppel-associated_box,smart_Tscrpt_reg_SCAN,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box,pfscan_Tscrpt_reg_SCAN	p.I453	ENST00000377294.2	37	c.1359	CCDS4647.1	6																																																																																			ZKSCAN4	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000187626		0.473	ZKSCAN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZKSCAN4	HGNC	protein_coding	OTTHUMT00000040179.1	-	0.00	59	0	A	NM_019110		28213173	-1	tier1	-	no_errors	ENST00000377294	ensembl	human	known	74_37	silent	9.30	39	4	SNP	1.000	G
ZNF207	7756	genome.wustl.edu	37	17	30696738	30696738	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr17:30696738G>C	ENST00000321233.6	+	11	1551	c.1397G>C	c.(1396-1398)gGa>gCa	p.G466A	ZNF207_ENST00000577908.1_Missense_Mutation_p.G482A|ZNF207_ENST00000394673.2_Missense_Mutation_p.G451A|ZNF207_ENST00000342555.6_Missense_Mutation_p.G485A|ZNF207_ENST00000341711.6_Missense_Mutation_p.G383A|ZNF207_ENST00000394670.4_Missense_Mutation_p.G482A	NM_003457.3	NP_003448.1	O43670	ZN207_HUMAN	zinc finger protein 207	466					attachment of spindle microtubules to kinetochore (GO:0008608)|mitotic sister chromatid segregation (GO:0000070)|mitotic spindle assembly checkpoint (GO:0007094)|protein stabilization (GO:0050821)|regulation of chromosome segregation (GO:0051983)|regulation of transcription, DNA-templated (GO:0006355)	kinetochore (GO:0000776)|microtubule (GO:0005874)|nucleus (GO:0005634)	DNA binding (GO:0003677)|heparin binding (GO:0008201)|microtubule binding (GO:0008017)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|kidney(2)|lung(3)|urinary_tract(2)	10		Breast(31;0.116)|Ovarian(249;0.182)	BRCA - Breast invasive adenocarcinoma(9;0.239)			CCTCCGATGGGAATGAGACCT	0.532																																																	0													84.0	74.0	77.0					17																	30696738		2203	4300	6503	SO:0001583	missense	0			AF046001	CCDS11271.1, CCDS32614.1, CCDS42294.1	17q11.2	2008-07-10			ENSG00000010244	ENSG00000010244		"""Zinc fingers, C2H2-type"""	12998	protein-coding gene	gene with protein product		603428				9799612	Standard	NM_001098507		Approved		uc002hhj.4	O43670	OTTHUMG00000132810	ENST00000321233.6:c.1397G>C	17.37:g.30696738G>C	ENSP00000322777:p.Gly466Ala		A8K6Y6|E1P660|E1P661|E1P662|Q53XS9|Q96HW5|Q9BUQ7	Missense_Mutation	SNP	smart_Znf_C2H2-like	p.G482A	ENST00000321233.6	37	c.1445	CCDS11271.1	17	.	.	.	.	.	.	.	.	.	.	G	17.69	3.452703	0.63290	.	.	ENSG00000010244	ENST00000394670;ENST00000394673;ENST00000394679;ENST00000321233;ENST00000341711;ENST00000342555	T;T;T	0.55413	0.54;0.52;0.76	5.85	5.85	0.93711	.	0.000000	0.85682	D	0.000000	T	0.63438	0.2511	L	0.27053	0.805	0.80722	D	1	D;D;D;D;D	0.76494	0.999;0.999;0.999;0.999;0.999	D;D;D;D;D	0.83275	0.996;0.996;0.996;0.996;0.996	T	0.61143	-0.7122	10	0.40728	T	0.16	.	20.1518	0.98089	0.0:0.0:1.0:0.0	.	435;485;482;451;466	A8MTG3;Q59G94;E1P660;O43670-2;O43670	.;.;.;.;ZN207_HUMAN	A	482;435;485;451;383;466	ENSP00000378165:G482A;ENSP00000344913:G383A;ENSP00000340029:G466A	ENSP00000322777:G451A	G	+	2	0	ZNF207	27720851	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	8.019000	0.88732	2.769000	0.95229	0.491000	0.48974	GGA	ZNF207	-	NULL	ENSG00000010244		0.532	ZNF207-003	KNOWN	basic|CCDS	protein_coding	ZNF207	HGNC	protein_coding	OTTHUMT00000256251.2	-	0.00	18	0	G			30696738	+1	tier1	-	no_errors	ENST00000394670	ensembl	human	known	74_37	missense	32.00	17	8	SNP	1.000	C
ZNF219	51222	genome.wustl.edu	37	14	21558826	21558826	+	Frame_Shift_Del	DEL	G	G	-			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr14:21558826delG	ENST00000360947.3	-	5	2449	c.2038delC	c.(2038-2040)cagfs	p.Q680fs	ZNF219_ENST00000421093.2_Frame_Shift_Del_p.Q680fs|RP11-998D10.7_ENST00000554733.2_lincRNA|ZNF219_ENST00000451119.2_Frame_Shift_Del_p.Q680fs|ZNF219_ENST00000556101.1_5'Flank	NM_016423.2	NP_057507.2	Q9P2Y4	ZN219_HUMAN	zinc finger protein 219	680					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of neurotransmitter levels (GO:0001505)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histamine receptor activity (GO:0004969)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|cervix(1)|large_intestine(1)|lung(1)|ovary(1)|prostate(2)	8	all_cancers(95;0.00185)		OV - Ovarian serous cystadenocarcinoma(11;9.86e-11)|Epithelial(56;1.27e-08)|all cancers(55;6.06e-08)	GBM - Glioblastoma multiforme(265;0.0191)		GCGTCAGCCTGGGGTGGCCGG	0.701																																																	0													15.0	19.0	18.0					14																	21558826		2195	4290	6485	SO:0001589	frameshift_variant	0			AB015427	CCDS9568.1	14q11	2013-01-08			ENSG00000165804	ENSG00000165804		"""Zinc fingers, C2H2-type"""	13011	protein-coding gene	gene with protein product		605036				10819330	Standard	NM_016423		Approved		uc001vzs.2	Q9P2Y4	OTTHUMG00000029647	ENST00000360947.3:c.2038delC	14.37:g.21558826delG	ENSP00000354206:p.Gln680fs		D3DS16|Q53Y57|Q8IYC1|Q9BW28	Frame_Shift_Del	DEL	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2,prints_Histamine_H3_rcpt	p.Q680fs	ENST00000360947.3	37	c.2038	CCDS9568.1	14																																																																																			ZNF219	-	NULL	ENSG00000165804		0.701	ZNF219-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF219	HGNC	protein_coding	OTTHUMT00000073931.2		0.00	25	0	G			21558826	-1	tier1		no_errors	ENST00000360947	ensembl	human	known	74_37	frame_shift_del	15.38	11	2	DEL	0.999	-
ZNF384	171017	genome.wustl.edu	37	12	6777029	6777029	+	Frame_Shift_Del	DEL	G	G	-			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr12:6777029delG	ENST00000396801.3	-	11	1792	c.1585delC	c.(1585-1587)cagfs	p.Q529fs	ZNF384_ENST00000396799.2_Frame_Shift_Del_p.Q468fs|RP4-761J14.8_ENST00000589924.1_RNA|ZNF384_ENST00000361959.3_Frame_Shift_Del_p.Q529fs|RP4-761J14.8_ENST00000586338.1_RNA|ZNF384_ENST00000355772.4_Frame_Shift_Del_p.Q413fs|ZNF384_ENST00000319770.3_Frame_Shift_Del_p.Q452fs|ZNF384_ENST00000396795.1_Frame_Shift_Del_p.Q468fs	NM_001135734.2	NP_001129206.1	Q8TF68	ZN384_HUMAN	zinc finger protein 384	529					nucleocytoplasmic transport (GO:0006913)|positive regulation of protein secretion (GO:0050714)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	focal adhesion (GO:0005925)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)		EWSR1/ZNF384(4)	breast(3)|central_nervous_system(3)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|prostate(1)|urinary_tract(1)	18						CCCCCACCCTGGGGGGCTGCC	0.632			T	"""EWSR1, TAF15 """	ALL																																			Dom	yes		12	12p13	171017	zinc finger protein 384 (CIZ/NMP4)		L	0													48.0	53.0	51.0					12																	6777029		2203	4300	6503	SO:0001589	frameshift_variant	0			U80738	CCDS8557.1, CCDS31732.1, CCDS44817.1	12p12	2013-01-08	2002-05-23	2002-05-24		ENSG00000126746		"""Zinc fingers, C2H2-type"""	11955	protein-coding gene	gene with protein product		609951	"""trinucleotide repeat containing 1"""	TNRC1		9225980, 11149472	Standard	NM_001135734		Approved	CAGH1A, CIZ, NMP4, NP	uc010sfh.2	Q8TF68		ENST00000396801.3:c.1585delC	12.37:g.6777029delG	ENSP00000380019:p.Gln529fs		O15407|Q7Z722|Q8N938	Frame_Shift_Del	DEL	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.Q529fs	ENST00000396801.3	37	c.1585	CCDS44817.1	12																																																																																			ZNF384	-	NULL	ENSG00000126746		0.632	ZNF384-001	NOVEL	basic|appris_principal|CCDS	protein_coding	ZNF384	HGNC	protein_coding	OTTHUMT00000400712.1		0.00	52	0	G			6777029	-1	tier1		no_errors	ENST00000361959	ensembl	human	known	74_37	frame_shift_del	13.16	33	5	DEL	1.000	-
ZNF461	92283	genome.wustl.edu	37	19	37128584	37128585	+	IGR	INS	-	-	A	rs377169661		TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr19:37128584_37128585insA	ENST00000588268.1	-	0	2584				ZNF461_ENST00000540605.2_5'Flank	NM_153257.2	NP_694989.2	Q8TAF7	ZN461_HUMAN	zinc finger protein 461						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(4)|kidney(1)|large_intestine(4)|lung(17)|prostate(1)|urinary_tract(2)	29	Esophageal squamous(110;0.198)		COAD - Colon adenocarcinoma(19;0.0454)|Colorectal(19;0.065)			gggtgtgtctcaaaaaaaaaaa	0.411																																																	0																																										SO:0001628	intergenic_variant	0			BX649031	CCDS54257.1, CCDS74348.1	19q13.13	2013-01-08				ENSG00000197808		"""Zinc fingers, C2H2-type"", ""-"""	21629	protein-coding gene	gene with protein product		608640				11579202, 15004467	Standard	XM_005259402		Approved	GIOT-1, MGC33911	uc002oem.3	Q8TAF7			19.37:g.37128595_37128595dupA			A8K9W9|Q6VSF7|Q9ULZ8	RNA	INS	-	NULL	ENST00000588268.1	37	NULL	CCDS54257.1	19																																																																																			ZNF461	-	-	ENSG00000197808		0.411	ZNF461-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF461	HGNC	protein_coding	OTTHUMT00000453202.1		0.00	28	0	-	NM_153257		37128585	-1	tier1		no_errors	ENST00000589442	ensembl	human	known	74_37	rna	9.68	28	3	INS	0.003:0.035	A
ZNF460	10794	genome.wustl.edu	37	19	57802868	57802868	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr19:57802868G>A	ENST00000360338.3	+	3	1281	c.959G>A	c.(958-960)aGt>aAt	p.S320N	ZNF460_ENST00000537645.1_Missense_Mutation_p.S279N	NM_006635.3	NP_006626.3	Q14592	ZN460_HUMAN	zinc finger protein 460	320					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(3)|large_intestine(2)|lung(9)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0694)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		TTTTATGAGAGTACAGCCCTC	0.478																																																	0													103.0	90.0	94.0					19																	57802868		2203	4300	6503	SO:0001583	missense	0			X78931	CCDS12949.1	19q13.4	2013-01-08				ENSG00000197714		"""Zinc fingers, C2H2-type"", ""-"""	21628	protein-coding gene	gene with protein product		604755	"""zinc finger protein 272"""	ZNF272		15004467	Standard	NM_006635		Approved	HZF8	uc002qog.2	Q14592		ENST00000360338.3:c.959G>A	19.37:g.57802868G>A	ENSP00000353491:p.Ser320Asn		A4FU64|B4DNX9|Q2VPC7|Q6VSF8	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.S320N	ENST00000360338.3	37	c.959	CCDS12949.1	19	.	.	.	.	.	.	.	.	.	.	G	7.603	0.673218	0.14776	.	.	ENSG00000197714	ENST00000537645;ENST00000360338	T;T	0.15952	2.38;2.38	1.75	1.75	0.24633	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.14570	0.0352	L	0.45228	1.405	0.09310	N	1	B	0.11235	0.004	B	0.08055	0.003	T	0.21042	-1.0257	9	0.24483	T	0.36	.	11.1318	0.48351	0.0:0.0:1.0:0.0	.	320	Q14592	ZN460_HUMAN	N	279;320	ENSP00000446167:S279N;ENSP00000353491:S320N	ENSP00000353491:S320N	S	+	2	0	ZNF460	62494680	0.000000	0.05858	0.002000	0.10522	0.040000	0.13550	-0.113000	0.10774	1.264000	0.44198	0.650000	0.86243	AGT	ZNF460	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000197714		0.478	ZNF460-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF460	HGNC	protein_coding	OTTHUMT00000465727.1	-	0.00	40	0	G	NM_006635		57802868	+1	tier1	-	no_errors	ENST00000360338	ensembl	human	known	74_37	missense	40.62	19	13	SNP	0.003	A
ZNF469	84627	genome.wustl.edu	37	16	88500503	88500503	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr16:88500503G>T	ENST00000437464.1	+	2	6541	c.6541G>T	c.(6541-6543)Gcc>Tcc	p.A2181S	ZNF469_ENST00000565624.1_Missense_Mutation_p.A2209S	NM_001127464.1	NP_001120936.1	Q96JG9	ZN469_HUMAN	zinc finger protein 469	2181					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(6)|kidney(3)|large_intestine(1)|skin(6)	20						TCCCAAGGAAGCCCTGGCTGG	0.637																																																	0													34.0	37.0	36.0					16																	88500503		692	1590	2282	SO:0001583	missense	0			AB058761	CCDS45544.1	16q24	2010-08-04				ENSG00000225614		"""Zinc fingers, C2H2-type"""	23216	protein-coding gene	gene with protein product		612078				11347906	Standard	NM_001127464		Approved	KIAA1858	uc002fku.2	Q96JG9		ENST00000437464.1:c.6541G>T	16.37:g.88500503G>T	ENSP00000402343:p.Ala2181Ser			Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.A2181S	ENST00000437464.1	37	c.6541	CCDS45544.1	16	.	.	.	.	.	.	.	.	.	.	G	9.273	1.046121	0.19748	.	.	ENSG00000225614	ENST00000437464	T	0.39592	1.07	4.33	-7.27	0.01461	.	.	.	.	.	T	0.15696	0.0378	N	0.12182	0.205	0.09310	N	1	B	0.12013	0.005	B	0.04013	0.001	T	0.36016	-0.9765	9	0.02654	T	1	.	7.4494	0.27229	0.6845:0.1222:0.1933:0.0	.	2181	Q96JG9	ZN469_HUMAN	S	2181	ENSP00000402343:A2181S	ENSP00000402343:A2181S	A	+	1	0	ZNF469	87028004	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.259000	0.02861	-1.556000	0.01695	-0.291000	0.09656	GCC	ZNF469	-	NULL	ENSG00000225614		0.637	ZNF469-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF469	HGNC	protein_coding		-	0.00	110	0	G	NG_012236		88500503	+1	tier1	-	no_errors	ENST00000437464	ensembl	human	known	74_37	missense	8.77	52	5	SNP	0.000	T
ZNF483	158399	genome.wustl.edu	37	9	114305075	114305075	+	Silent	SNP	G	G	T	rs142830150		TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr9:114305075G>T	ENST00000309235.5	+	6	2018	c.1860G>T	c.(1858-1860)acG>acT	p.T620T	ZNF483_ENST00000358151.4_Intron	NM_133464.2	NP_597721.2	Q8TF39	ZN483_HUMAN	zinc finger protein 483	620					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(1)|kidney(1)|large_intestine(11)|lung(11)|ovary(1)|skin(5)	31						GCCATTTTACGTCTGTGATTT	0.408																																																	0													65.0	67.0	66.0					9																	114305075		2203	4300	6503	SO:0001819	synonymous_variant	0			AB075842	CCDS35105.1, CCDS35106.1	9q32	2013-01-09			ENSG00000173258	ENSG00000173258		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	23384	protein-coding gene	gene with protein product							Standard	NM_001007169		Approved	ZKSCAN16, KIAA1962, ZSCAN48	uc004bff.2	Q8TF39	OTTHUMG00000020490	ENST00000309235.5:c.1860G>T	9.37:g.114305075G>T			Q5VZN2|Q8NAE1	Silent	SNP	pfam_Znf_C2H2,pfam_Tscrpt_reg_SCAN,pfam_Krueppel-associated_box,superfamily_Retrov_capsid_C,superfamily_Krueppel-associated_box,smart_Tscrpt_reg_SCAN,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box,pfscan_Tscrpt_reg_SCAN	p.T620	ENST00000309235.5	37	c.1860	CCDS35106.1	9																																																																																			ZNF483	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000173258		0.408	ZNF483-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF483	HGNC	protein_coding	OTTHUMT00000053641.1		0.00	64	0	G	XM_088567		114305075	+1			no_errors	ENST00000309235	ensembl	human	known	74_37	silent	5.00	38	2	SNP	0.009	T
ZNF485	220992	genome.wustl.edu	37	10	44112087	44112087	+	Nonsense_Mutation	SNP	C	C	G			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr10:44112087C>G	ENST00000361807.3	+	5	790	c.596C>G	c.(595-597)tCa>tGa	p.S199*	ZNF485_ENST00000374437.2_Nonsense_Mutation_p.S108*|ZNF485_ENST00000374435.3_Nonsense_Mutation_p.S199*	NM_145312.3	NP_660355.2	Q8NCK3	ZN485_HUMAN	zinc finger protein 485	199					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(8)|skin(1)|urinary_tract(1)	16						AAGAAGCACTCAACGTTTATC	0.378																																																	0													74.0	76.0	75.0					10																	44112087		2203	4300	6503	SO:0001587	stop_gained	0			AK074679	CCDS7205.2	10q11.21	2013-01-08			ENSG00000198298	ENSG00000198298		"""Zinc fingers, C2H2-type"", ""-"""	23440	protein-coding gene	gene with protein product							Standard	NM_145312		Approved		uc010qfc.2	Q8NCK3	OTTHUMG00000018040	ENST00000361807.3:c.596C>G	10.37:g.44112087C>G	ENSP00000354694:p.Ser199*		B4DSE6|Q96CL0	Nonsense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.S199*	ENST00000361807.3	37	c.596	CCDS7205.2	10	.	.	.	.	.	.	.	.	.	.	C	16.32	3.088729	0.55968	.	.	ENSG00000198298	ENST00000361807;ENST00000374437;ENST00000374435	.	.	.	2.34	0.44	0.16572	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	6.0093	0.19567	0.0:0.7075:0.0:0.2925	.	.	.	.	X	199;108;199	.	ENSP00000354694:S199X	S	+	2	0	ZNF485	43432093	0.000000	0.05858	0.173000	0.22940	0.508000	0.34012	0.900000	0.28431	0.104000	0.17725	-0.379000	0.06801	TCA	ZNF485	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000198298		0.378	ZNF485-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF485	HGNC	protein_coding	OTTHUMT00000047719.2		0.00	44	0	C	NM_145312		44112087	+1			no_errors	ENST00000361807	ensembl	human	known	74_37	nonsense	6.45	29	2	SNP	0.552	G
ZNF491	126069	genome.wustl.edu	37	19	11915443	11915443	+	5'UTR	SNP	G	G	C			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr19:11915443G>C	ENST00000323169.5	+	0	285				ZNF491_ENST00000492230.1_3'UTR	NM_152356.3	NP_689569.2	Q8N8L2	ZN491_HUMAN	zinc finger protein 491						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(14)|lung(6)|ovary(2)|skin(1)	26						TCTCTACAGAGATGTGATGCA	0.463																																																	0																																										SO:0001623	5_prime_UTR_variant	0			AK092110	CCDS12267.1	19p13.2	2013-01-08			ENSG00000177599	ENSG00000177599		"""Zinc fingers, C2H2-type"""	23706	protein-coding gene	gene with protein product							Standard	XM_005259730		Approved	FLJ34791	uc002mso.1	Q8N8L2	OTTHUMG00000156529	ENST00000323169.5:c.-47G>C	19.37:g.11915443G>C			Q3MJ35|Q8NAT8	RNA	SNP	-	NULL	ENST00000323169.5	37	NULL	CCDS12267.1	19																																																																																			ZNF491	-	-	ENSG00000177599		0.463	ZNF491-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF491	HGNC	protein_coding	OTTHUMT00000344518.1	-	0.00	83	0	G	NM_152356		11915443	+1	tier1	-	no_errors	ENST00000492230	ensembl	human	known	74_37	rna	7.69	48	4	SNP	0.909	C
ZNF702P	79986	genome.wustl.edu	37	19	53473854	53473854	+	RNA	SNP	T	T	A			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr19:53473854T>A	ENST00000600068.1	-	0	489				ZNF702P_ENST00000270443.4_RNA																							CAGCATGCCTTTGATCATATC	0.383																																																	0																																												0																															19.37:g.53473854T>A				RNA	SNP	-	NULL	ENST00000600068.1	37	NULL		19																																																																																			ZNF702P	-	-	ENSG00000242779		0.383	CTD-2620I22.1-001	KNOWN	basic|readthrough_transcript	processed_transcript	ZNF702P	HGNC	processed_transcript	OTTHUMT00000463881.1	-	0.00	71	0	T			53473854	-1	tier1	-	no_errors	ENST00000270443	ensembl	human	known	74_37	rna	29.55	31	13	SNP	0.001	A
ZNF710	374655	genome.wustl.edu	37	15	90611143	90611143	+	Silent	SNP	G	G	A			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr15:90611143G>A	ENST00000268154.4	+	2	1025	c.774G>A	c.(772-774)acG>acA	p.T258T		NM_198526.2	NP_940928.2	Q8N1W2	ZN710_HUMAN	zinc finger protein 710	258					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(1)|ovary(2)|prostate(1)|stomach(1)|urinary_tract(3)	19	Melanoma(11;0.00551)|Lung NSC(78;0.0196)|all_lung(78;0.04)		BRCA - Breast invasive adenocarcinoma(143;0.00769)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|STAD - Stomach adenocarcinoma(125;0.129)			AGGCTGACACGGCGGGTTCGA	0.657																																																	0													37.0	45.0	42.0					15																	90611143		2198	4290	6488	SO:0001819	synonymous_variant	0			AK094712	CCDS10358.1	15q26.1	2013-01-08			ENSG00000140548	ENSG00000140548		"""Zinc fingers, C2H2-type"""	25352	protein-coding gene	gene with protein product							Standard	XM_005254905		Approved	DKFZp547K1113, FLJ37393, FLJ00306	uc002bov.2	Q8N1W2	OTTHUMG00000149812	ENST00000268154.4:c.774G>A	15.37:g.90611143G>A			A0AVS3|Q6ZMK9|Q8NDU0	Silent	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.T258	ENST00000268154.4	37	c.774	CCDS10358.1	15																																																																																			ZNF710	-	NULL	ENSG00000140548		0.657	ZNF710-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF710	HGNC	protein_coding	OTTHUMT00000313423.1		0.00	80	0	G	NM_198526		90611143	+1			no_errors	ENST00000268154	ensembl	human	known	74_37	silent	16.67	45	9	SNP	0.091	A
ZNF749	388567	genome.wustl.edu	37	19	57955138	57955138	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr19:57955138C>G	ENST00000334181.4	+	3	872	c.622C>G	c.(622-624)Caa>Gaa	p.Q208E	AC004076.9_ENST00000596831.1_Intron	NM_001023561.2	NP_001018855.2	O43361	ZN749_HUMAN	zinc finger protein 749	208					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(6)|kidney(2)|lung(3)|prostate(1)	13		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0264)|Lung(386;0.177)		CTTTTGCCACCAACATGGGCT	0.468																																																	0													49.0	46.0	47.0					19																	57955138		2203	4300	6503	SO:0001583	missense	0			AK122740	CCDS33132.2	19q13.43	2013-01-08			ENSG00000186230	ENSG00000186230		"""Zinc fingers, C2H2-type"", ""-"""	32783	protein-coding gene	gene with protein product							Standard	NM_001023561		Approved	FLJ16360	uc002qoq.2	O43361	OTTHUMG00000150372	ENST00000334181.4:c.622C>G	19.37:g.57955138C>G	ENSP00000333980:p.Gln208Glu			Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.Q208E	ENST00000334181.4	37	c.622	CCDS33132.2	19	.	.	.	.	.	.	.	.	.	.	C	12.69	2.012240	0.35511	.	.	ENSG00000186230	ENST00000334181	T	0.27890	1.64	1.79	-3.17	0.05202	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.11281	0.0275	N	0.14661	0.345	0.09310	N	1	B	0.10296	0.003	B	0.04013	0.001	T	0.32666	-0.9898	9	0.10636	T	0.68	.	0.7406	0.00973	0.4694:0.2038:0.1452:0.1817	.	208	O43361	ZN749_HUMAN	E	208	ENSP00000333980:Q208E	ENSP00000333980:Q208E	Q	+	1	0	ZNF749	62646950	0.000000	0.05858	0.000000	0.03702	0.482000	0.33219	-0.285000	0.08410	-0.889000	0.03950	0.305000	0.20034	CAA	ZNF749	-	pfscan_Znf_C2H2	ENSG00000186230		0.468	ZNF749-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF749	HGNC	protein_coding	OTTHUMT00000317879.1	-	0.00	28	0	C	NM_001023561		57955138	+1	tier1	-	no_errors	ENST00000334181	ensembl	human	known	74_37	missense	18.18	18	4	SNP	0.000	G
ZNF772	400720	genome.wustl.edu	37	19	57987094	57987094	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr19:57987094C>G	ENST00000343280.4	-	3	393	c.133G>C	c.(133-135)Gat>Cat	p.D45H	AC003005.2_ENST00000595422.1_lincRNA|ZNF772_ENST00000600175.1_Intron|AC004076.9_ENST00000415705.3_Intron|ZNF772_ENST00000425074.3_Intron|ZNF772_ENST00000601768.1_Intron|ZNF772_ENST00000427512.2_Intron|ZNF772_ENST00000356584.3_Missense_Mutation_p.D45H|AC004076.9_ENST00000596831.1_Missense_Mutation_p.D45H	NM_001024596.2	NP_001019767.1	Q68DY9	ZN772_HUMAN	zinc finger protein 772	45	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(1)|large_intestine(4)|lung(3)	9		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)|Lung(386;0.174)		TGAGCCTCATCAAGGAGCACC	0.557																																					Melanoma(5;289 436 14293 15924 30817)												0													204.0	176.0	186.0					19																	57987094		2203	4300	6503	SO:0001583	missense	0			BX647068	CCDS33133.1, CCDS46210.1	19q13.43	2013-01-08				ENSG00000197128		"""Zinc fingers, C2H2-type"", ""-"""	33106	protein-coding gene	gene with protein product							Standard	NM_001024596		Approved	DKFZp686I1569	uc002qot.3	Q68DY9		ENST00000343280.4:c.133G>C	19.37:g.57987094C>G	ENSP00000341165:p.Asp45His		A6NJK9|B4DH56|B4DYS0	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.D45H	ENST00000343280.4	37	c.133	CCDS33133.1	19	.	.	.	.	.	.	.	.	.	.	C	17.28	3.349389	0.61183	.	.	ENSG00000197128	ENST00000343280;ENST00000319969;ENST00000356584;ENST00000291809	T;T	0.02763	4.17;4.17	3.52	2.47	0.30058	Krueppel-associated box (4);	.	.	.	.	T	0.16471	0.0396	M	0.92604	3.325	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	T	0.00245	-1.1882	9	0.62326	D	0.03	.	6.8777	0.24156	0.0:0.8693:0.0:0.1307	.	45;45	A6NJK9;Q68DY9	.;ZN772_HUMAN	H	45;32;45;32	ENSP00000341165:D45H;ENSP00000348992:D45H	ENSP00000291809:D32H	D	-	1	0	ZNF772	62678906	0.398000	0.25279	1.000000	0.80357	0.994000	0.84299	1.509000	0.35780	0.815000	0.34398	0.585000	0.79938	GAT	ZNF772	-	pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box	ENSG00000197128		0.557	ZNF772-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF772	HGNC	protein_coding	OTTHUMT00000397447.1		0.00	99	0	C	NM_001024596		57987094	-1			no_errors	ENST00000343280	ensembl	human	known	74_37	missense	7.02	53	4	SNP	0.999	G
ZNF81	347344	genome.wustl.edu	37	X	47775831	47775831	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chrX:47775831C>G	ENST00000376954.1	+	6	2154	c.1786C>G	c.(1786-1788)Cat>Gat	p.H596D	ZNF81_ENST00000338637.7_Missense_Mutation_p.H596D			P51508	ZNF81_HUMAN	zinc finger protein 81	596					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|large_intestine(1)|lung(1)|skin(1)	4		all_lung(315;0.0973)				CAAGAAACCACATCTCAAAGT	0.383																																																	0													55.0	55.0	55.0					X																	47775831		2154	4262	6416	SO:0001583	missense	0			AK126949	CCDS43933.1	Xp11.23	2013-01-08	2006-05-12		ENSG00000197779	ENSG00000197779		"""Zinc fingers, C2H2-type"", ""-"""	13156	protein-coding gene	gene with protein product		314998	"""zinc finger protein 81 (HFZ20)"", ""mental retardation, X-linked 45"""	MRX45		8507979, 15121780	Standard	NM_007137		Approved	HFZ20	uc022bvq.1	P51508	OTTHUMG00000021462	ENST00000376954.1:c.1786C>G	X.37:g.47775831C>G	ENSP00000366153:p.His596Asp		Q6RX22|Q96QH6	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.H596D	ENST00000376954.1	37	c.1786	CCDS43933.1	X	.	.	.	.	.	.	.	.	.	.	C	10.15	1.270574	0.23221	.	.	ENSG00000197779	ENST00000376954;ENST00000338637	T;T	0.16743	2.32;2.32	4.21	4.21	0.49690	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.43110	D	0.000607	T	0.17280	0.0415	N	0.05619	-0.005	0.24286	N	0.995185	D	0.67145	0.996	D	0.64776	0.929	T	0.15549	-1.0433	10	0.23891	T	0.37	.	10.9628	0.47395	0.0:1.0:0.0:0.0	.	596	P51508	ZNF81_HUMAN	D	596	ENSP00000366153:H596D;ENSP00000341151:H596D	ENSP00000341151:H596D	H	+	1	0	ZNF81	47660775	0.000000	0.05858	1.000000	0.80357	0.978000	0.69477	-1.606000	0.02072	2.353000	0.79882	0.513000	0.50165	CAT	ZNF81	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000197779		0.383	ZNF81-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF81	HGNC	protein_coding	OTTHUMT00000056455.2	-	0.00	30	0	C	NM_007137		47775831	+1	tier1	-	no_errors	ENST00000338637	ensembl	human	known	74_37	missense	61.11	7	11	SNP	1.000	G
ZNF98	148198	genome.wustl.edu	37	19	22574641	22574641	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr19:22574641C>T	ENST00000357774.5	-	4	1517	c.1396G>A	c.(1396-1398)Gaa>Aaa	p.E466K		NM_001098626.1	NP_001092096.1	A6NK75	ZNF98_HUMAN	zinc finger protein 98	466					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(8)|lung(16)|ovary(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)	37		all_cancers(12;0.0536)|all_lung(12;0.00187)|Lung NSC(12;0.0019)|all_epithelial(12;0.00542)|Hepatocellular(1079;0.244)				TTGCCACATTCTTCACATTTG	0.373																																																	0													24.0	21.0	22.0					19																	22574641		1500	3319	4819	SO:0001583	missense	0				CCDS46031.1	19p12	2014-02-14	2010-04-20	2008-06-12	ENSG00000197360	ENSG00000197360		"""Zinc fingers, C2H2-type"", ""-"""	13174	protein-coding gene	gene with protein product	"""zinc finger protein 739"""	603980					Standard	NM_001098626		Approved	ZNF739, F7175	uc002nqt.2	A6NK75	OTTHUMG00000182940	ENST00000357774.5:c.1396G>A	19.37:g.22574641C>T	ENSP00000350418:p.Glu466Lys			Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E466K	ENST00000357774.5	37	c.1396	CCDS46031.1	19	.	.	.	.	.	.	.	.	.	.	.	8.588	0.883830	0.17467	.	.	ENSG00000197360	ENST00000357774	T	0.35605	1.3	1.26	-2.53	0.06326	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.29288	0.0729	L	0.42581	1.335	0.09310	N	1	P	0.39060	0.657	B	0.39935	0.314	T	0.29822	-0.9999	9	0.59425	D	0.04	.	9.0399	0.36311	0.0:0.4789:0.5211:0.0	.	466	A6NK75	ZNF98_HUMAN	K	466	ENSP00000350418:E466K	ENSP00000350418:E466K	E	-	1	0	ZNF98	22366481	0.000000	0.05858	0.014000	0.15608	0.092000	0.18411	-0.635000	0.05471	-0.229000	0.09854	0.289000	0.19496	GAA	ZNF98	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000197360		0.373	ZNF98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF98	HGNC	protein_coding	OTTHUMT00000464398.1	-	0.00	60	0	C	NM_001098626		22574641	-1	tier1	-	no_errors	ENST00000357774	ensembl	human	known	74_37	missense	14.29	24	4	SNP	0.004	T
ZYG11A	440590	genome.wustl.edu	37	1	53323273	53323273	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NS-01A-12D-A37C-09	TCGA-L5-A8NS-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2174ecb1-09fd-4f64-ad02-328e19aff1d8	e9e4d67d-bc41-464a-9021-ff58fe4f406f	g.chr1:53323273T>C	ENST00000371528.1	+	3	1008	c.860T>C	c.(859-861)gTt>gCt	p.V287A	ZYG11A_ENST00000371532.1_Intron	NM_001004339.2	NP_001004339.2	Q6WRX3	ZY11A_HUMAN	zyg-11 family member A, cell cycle regulator	287										breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|skin(1)	10						CTGCCCAATGTTGTGTCATTG	0.438																																																	0													43.0	32.0	35.0					1																	53323273		692	1591	2283	SO:0001583	missense	0				CCDS44148.1	1p32.3	2013-01-17	2012-12-10		ENSG00000203995	ENSG00000203995		"""ZYG11 cell cycle regulator family"""	32058	protein-coding gene	gene with protein product			"""zyg-11 homolog A (C. elegans)"""				Standard	NM_001004339		Approved	ZYG11	uc001cuk.2	Q6WRX3	OTTHUMG00000008923	ENST00000371528.1:c.860T>C	1.37:g.53323273T>C	ENSP00000360583:p.Val287Ala		A6NCK5	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.V287A	ENST00000371528.1	37	c.860	CCDS44148.1	1	.	.	.	.	.	.	.	.	.	.	T	9.939	1.216845	0.22373	.	.	ENSG00000203995	ENST00000371528	T	0.00995	5.46	5.35	4.23	0.50019	.	0.701703	0.14007	N	0.347706	T	0.00967	0.0032	N	0.14661	0.345	0.09310	N	1	B	0.21905	0.062	B	0.25506	0.061	T	0.50398	-0.8833	10	0.87932	D	0	-0.4589	10.8644	0.46847	0.0:0.0739:0.0:0.9261	.	287	Q6WRX3	ZY11A_HUMAN	A	287	ENSP00000360583:V287A	ENSP00000360583:V287A	V	+	2	0	ZYG11A	53095861	0.963000	0.33076	0.001000	0.08648	0.123000	0.20343	7.507000	0.81676	0.880000	0.35969	0.460000	0.39030	GTT	ZYG11A	-	NULL	ENSG00000203995		0.438	ZYG11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZYG11A	HGNC	protein_coding	OTTHUMT00000024856.3	-	0.00	33	0	T	NM_001004339		53323273	+1	tier1	-	no_errors	ENST00000371528	ensembl	human	known	74_37	missense	16.00	21	4	SNP	0.042	C
