#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name	i_deletion_substructures	i_domain	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_header	i_normal_VAF	i_normal_ref_reads	i_normal_var_reads	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_tier	i_title	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_VAF	i_tumor_ref_reads	i_tumor_var_reads	i_type	i_ucsc_cons	i_variant
ABCC9	10060	genome.wustl.edu	37	12	21995350	21995350	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr12:21995350G>T	ENST00000261201.4	-	27	3370	c.3371C>A	c.(3370-3372)gCc>gAc	p.A1124D	ABCC9_ENST00000345162.2_Missense_Mutation_p.A1088D|ABCC9_ENST00000261200.4_Missense_Mutation_p.A1124D|RP11-729I10.2_ENST00000539874.1_RNA	NM_005691.2	NP_005682.2	O60706	ABCC9_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 9	1124	ABC transmembrane type-1 2. {ECO:0000255|PROSITE-ProRule:PRU00441}.				defense response to virus (GO:0051607)|potassium ion import (GO:0010107)|potassium ion transport (GO:0006813)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	ATP-sensitive potassium channel complex (GO:0008282)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcomere (GO:0030017)|voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|ion channel binding (GO:0044325)|potassium channel activity (GO:0005267)|potassium channel regulator activity (GO:0015459)|sulfonylurea receptor activity (GO:0008281)|transporter activity (GO:0005215)			NS(2)|breast(5)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(15)|lung(56)|ovary(4)|pancreas(1)|prostate(4)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(5)	118					Adenosine triphosphate(DB00171)|Glyburide(DB01016)	CATCCCAATGGCAGACAGGCA	0.443																																																	0													167.0	145.0	152.0					12																	21995350		2203	4300	6503	SO:0001583	missense	0			AF061323	CCDS8693.1, CCDS8694.1	12p12.1	2014-09-17			ENSG00000069431	ENSG00000069431		"""ATP binding cassette transporters / subfamily C"""	60	protein-coding gene	gene with protein product	"""sulfonylurea receptor 2"""	601439				9457174, 15034580	Standard	NM_020297		Approved	SUR2, CMD1O	uc001rfh.3	O60706	OTTHUMG00000169094	ENST00000261201.4:c.3371C>A	12.37:g.21995350G>T	ENSP00000261201:p.Ala1124Asp		O60707	Missense_Mutation	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_P-loop_NTPase,superfamily_ABC1_TM_dom,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC1_TM_dom,prints_Sulphorea_rcpt,prints_Sulphonylurea_rcpt-2	p.A1124D	ENST00000261201.4	37	c.3371	CCDS8694.1	12	.	.	.	.	.	.	.	.	.	.	G	28.3	4.904081	0.92035	.	.	ENSG00000069431	ENST00000261200;ENST00000544039;ENST00000261201;ENST00000345162	D;D;D;D	0.90133	-2.62;-2.62;-2.62;-2.62	5.31	5.31	0.75309	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.000000	0.85682	D	0.000000	D	0.96068	0.8719	M	0.91818	3.245	0.80722	D	1	P;P	0.47962	0.851;0.903	P;P	0.59424	0.857;0.7	D	0.96523	0.9387	10	0.87932	D	0	-13.6272	19.1722	0.93583	0.0:0.0:1.0:0.0	.	1124;1124	O60706;O60706-2	ABCC9_HUMAN;.	D	1124;751;1124;1088	ENSP00000261200:A1124D;ENSP00000440521:A751D;ENSP00000261201:A1124D;ENSP00000261202:A1088D	ENSP00000261200:A1124D	A	-	2	0	ABCC9	21886617	1.000000	0.71417	0.994000	0.49952	0.756000	0.42949	7.725000	0.84808	2.763000	0.94921	0.563000	0.77884	GCC	ABCC9	-	pfam_ABC_transptr_TM_dom,superfamily_ABC1_TM_dom,pfscan_ABC1_TM_dom	ENSG00000069431		0.443	ABCC9-002	KNOWN	not_organism_supported|basic|CCDS	protein_coding	ABCC9	HGNC	protein_coding	OTTHUMT00000402230.1	-	0.00	42	0	G	NM_005691		21995350	-1	tier1	-	no_errors	ENST00000261200	ensembl	human	known	74_37	missense	6.15	61	4	SNP	1.000	T
ABHD8	79575	genome.wustl.edu	37	19	17411829	17411829	+	Silent	SNP	C	C	G			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr19:17411829C>G	ENST00000247706.3	-	2	836	c.597G>C	c.(595-597)gtG>gtC	p.V199V	MRPL34_ENST00000595444.1_Intron|MRPL34_ENST00000594999.1_5'Flank|MRPL34_ENST00000600434.1_Intron	NM_024527.4	NP_078803.4	Q96I13	ABHD8_HUMAN	abhydrolase domain containing 8	199							hydrolase activity (GO:0016787)			central_nervous_system(1)|endometrium(1)|kidney(1)|lung(5)|urinary_tract(1)	9						AGCCTAGGCGCACAAAGAAGT	0.642																																					Ovarian(156;1368 2543 15275 41187)												0													67.0	77.0	73.0					19																	17411829		2203	4300	6503	SO:0001819	synonymous_variant	0			AK021805	CCDS12355.1	19p13.12	2010-12-09			ENSG00000127220	ENSG00000127220		"""Abhydrolase domain containing"""	23759	protein-coding gene	gene with protein product						12477932	Standard	NM_024527		Approved	FLJ11743, MGC14280, MGC2512	uc002ngb.4	Q96I13		ENST00000247706.3:c.597G>C	19.37:g.17411829C>G			Q9HAE9	Silent	SNP	pfam_AB_hydrolase_1,prints_AB_hydrolase_1,prints_Epox_hydrolase-like	p.V199	ENST00000247706.3	37	c.597	CCDS12355.1	19																																																																																			ABHD8	-	prints_Epox_hydrolase-like	ENSG00000127220		0.642	ABHD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABHD8	HGNC	protein_coding	OTTHUMT00000462937.1	-	0.00	30	0	C	NM_024527		17411829	-1	tier1	-	no_errors	ENST00000247706	ensembl	human	known	74_37	silent	16.67	55	11	SNP	0.052	G
ABHD8	79575	genome.wustl.edu	37	19	17412239	17412239	+	Missense_Mutation	SNP	C	C	A	rs374386420		TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr19:17412239C>A	ENST00000247706.3	-	2	426	c.187G>T	c.(187-189)Gca>Tca	p.A63S	MRPL34_ENST00000595444.1_Intron|MRPL34_ENST00000594999.1_5'Flank|MRPL34_ENST00000600434.1_Intron	NM_024527.4	NP_078803.4	Q96I13	ABHD8_HUMAN	abhydrolase domain containing 8	63							hydrolase activity (GO:0016787)			central_nervous_system(1)|endometrium(1)|kidney(1)|lung(5)|urinary_tract(1)	9						TCCGAGGATGCGGATGATGGT	0.667																																					Ovarian(156;1368 2543 15275 41187)												0													20.0	25.0	23.0					19																	17412239		2195	4289	6484	SO:0001583	missense	0			AK021805	CCDS12355.1	19p13.12	2010-12-09			ENSG00000127220	ENSG00000127220		"""Abhydrolase domain containing"""	23759	protein-coding gene	gene with protein product						12477932	Standard	NM_024527		Approved	FLJ11743, MGC14280, MGC2512	uc002ngb.4	Q96I13		ENST00000247706.3:c.187G>T	19.37:g.17412239C>A	ENSP00000247706:p.Ala63Ser		Q9HAE9	Missense_Mutation	SNP	pfam_AB_hydrolase_1,prints_AB_hydrolase_1,prints_Epox_hydrolase-like	p.A63S	ENST00000247706.3	37	c.187	CCDS12355.1	19	.	.	.	.	.	.	.	.	.	.	C	0.005	-2.211615	0.00289	.	.	ENSG00000127220	ENST00000247706;ENST00000544788	T	0.31247	1.5	1.59	-3.18	0.05186	.	0.496656	0.14259	U	0.330929	T	0.10551	0.0258	N	0.08118	0	0.09310	N	1	B	0.15930	0.015	B	0.06405	0.002	T	0.27088	-1.0084	10	0.16896	T	0.51	.	4.2714	0.10789	0.0:0.3731:0.4229:0.204	.	63	Q96I13	ABHD8_HUMAN	S	63;9	ENSP00000247706:A63S	ENSP00000247706:A63S	A	-	1	0	ABHD8	17273239	0.730000	0.28100	0.000000	0.03702	0.023000	0.10783	0.878000	0.28126	-0.771000	0.04608	-0.339000	0.08088	GCA	ABHD8	-	NULL	ENSG00000127220		0.667	ABHD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABHD8	HGNC	protein_coding	OTTHUMT00000462937.1		0.00	22	0	C	NM_024527		17412239	-1			no_errors	ENST00000247706	ensembl	human	known	74_37	missense	41.67	14	10	SNP	0.000	A
ADAM29	11086	genome.wustl.edu	37	4	175898320	175898320	+	Missense_Mutation	SNP	T	T	A			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr4:175898320T>A	ENST00000359240.3	+	5	2314	c.1644T>A	c.(1642-1644)gaT>gaA	p.D548E	RP13-577H12.2_ENST00000507525.1_RNA|ADAM29_ENST00000404450.4_Missense_Mutation_p.D548E|ADAM29_ENST00000445694.1_Missense_Mutation_p.D548E|ADAM29_ENST00000514159.1_Missense_Mutation_p.D548E	NM_001278125.1|NM_014269.4	NP_001265054.1|NP_055084.3	Q9UKF5	ADA29_HUMAN	ADAM metallopeptidase domain 29	548	Cys-rich.				spermatogenesis (GO:0007283)	integral component of plasma membrane (GO:0005887)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(25)|ovary(3)|pancreas(1)|prostate(7)|skin(24)|urinary_tract(2)	93		Breast(14;0.00908)|Melanoma(52;0.00951)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;3.08e-19)|Epithelial(43;6.24e-18)|OV - Ovarian serous cystadenocarcinoma(60;1.78e-09)|STAD - Stomach adenocarcinoma(60;0.00303)|GBM - Glioblastoma multiforme(59;0.0106)|LUSC - Lung squamous cell carcinoma(193;0.0286)		ATATCTCAGATGTCCAGTGTG	0.398																																					Ovarian(140;1727 1835 21805 25838 41440)												0													114.0	115.0	115.0					4																	175898320		2203	4300	6503	SO:0001583	missense	0			AF171929	CCDS3823.1	4q34.1	2012-05-16	2005-08-18		ENSG00000168594	ENSG00000168594		"""ADAM metallopeptidase domain containing"""	207	protein-coding gene	gene with protein product	"""cancer/testis antigen 73"""	604778	"""a disintegrin and metalloproteinase domain 29"""			10644455	Standard	NM_014269		Approved	svph1, CT73	uc031shw.1	Q9UKF5	OTTHUMG00000160764	ENST00000359240.3:c.1644T>A	4.37:g.175898320T>A	ENSP00000352177:p.Asp548Glu		Q4W5F3|Q9UHP1|Q9UKF3|Q9UKF4	Missense_Mutation	SNP	pfam_Peptidase_M12B,pfam_ADAM_Cys-rich,pfam_Peptidase_M12B_N,pfam_Blood-coag_inhib_Disintegrin,superfamily_Blood-coag_inhib_Disintegrin,smart_Blood-coag_inhib_Disintegrin,smart_ADAM_Cys-rich,pfscan_Blood-coag_inhib_Disintegrin,pfscan_Peptidase_M12B,prints_Blood-coag_inhib_Disintegrin	p.D548E	ENST00000359240.3	37	c.1644	CCDS3823.1	4	.	.	.	.	.	.	.	.	.	.	T	15.37	2.812125	0.50527	.	.	ENSG00000168594	ENST00000359240;ENST00000445694;ENST00000404450;ENST00000514159	T;T;T;T	0.28069	1.63;1.63;1.63;1.63	3.48	-2.01	0.07410	ADAM, cysteine-rich (2);	0.216103	0.22414	U	0.060369	T	0.64962	0.2646	H	0.98769	4.325	0.09310	N	1	D	0.89917	1.0	D	0.87578	0.998	T	0.56860	-0.7909	9	.	.	.	.	7.8111	0.29232	0.0:0.5545:0.0:0.4455	.	548	Q9UKF5	ADA29_HUMAN	E	548	ENSP00000352177:D548E;ENSP00000414544:D548E;ENSP00000384229:D548E;ENSP00000423517:D548E	.	D	+	3	2	ADAM29	176134895	0.015000	0.18098	0.000000	0.03702	0.093000	0.18481	0.036000	0.13819	-0.351000	0.08249	-0.269000	0.10298	GAT	ADAM29	-	pfam_ADAM_Cys-rich,smart_ADAM_Cys-rich	ENSG00000168594		0.398	ADAM29-201	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	ADAM29	HGNC	protein_coding		-	0.00	28	0	T			175898320	+1	tier1	-	no_errors	ENST00000359240	ensembl	human	known	74_37	missense	17.65	28	6	SNP	0.001	A
AHRR	57491	genome.wustl.edu	37	5	432961	432961	+	Silent	SNP	A	A	G			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr5:432961A>G	ENST00000505113.1	+	10	1067	c.1023A>G	c.(1021-1023)gaA>gaG	p.E341E	AHRR_ENST00000506456.1_Silent_p.E197E|AHRR_ENST00000512529.1_Silent_p.E187E|AHRR_ENST00000316418.5_Silent_p.E359E	NM_001242412.1	NP_001229341.1	A9YTQ3	AHRR_HUMAN	aryl-hydrocarbon receptor repressor	341					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of protein sumoylation (GO:0033235)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|signal transducer activity (GO:0004871)			breast(2)|endometrium(4)|large_intestine(1)|lung(12)|prostate(1)	20			Epithelial(17;0.0011)|OV - Ovarian serous cystadenocarcinoma(19;0.00353)|all cancers(22;0.00354)|Lung(60;0.0863)			TGCTCAGGGAACAGACTGACG	0.657																																																	0													39.0	45.0	43.0					5																	432961		2015	4171	6186	SO:0001819	synonymous_variant	0			AB033060	CCDS43297.1, CCDS56355.1	5p15.33	2013-05-21	2003-09-11	2003-09-12	ENSG00000063438	ENSG00000063438		"""Basic helix-loop-helix proteins"""	346	protein-coding gene	gene with protein product		606517	"""aryl hydrocarbon receptor regulator"""	AHH, AHHR		1070014, 11423533	Standard	NM_020731		Approved	KIAA1234, bHLHe77	uc003jaw.3	A9YTQ3	OTTHUMG00000162171	ENST00000505113.1:c.1023A>G	5.37:g.432961A>G			A7MBN5|D6RAZ1|Q9HAZ3|Q9ULI6	Silent	SNP	pfam_PAS_fold,pfam_bHLH_dom,superfamily_PAS,superfamily_bHLH_dom,smart_bHLH_dom,smart_PAS,pfscan_PAS,pfscan_bHLH_dom	p.E359	ENST00000505113.1	37	c.1077	CCDS56355.1	5																																																																																			AHRR	-	NULL	ENSG00000063438		0.657	AHRR-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	AHRR	HGNC	protein_coding	OTTHUMT00000367720.1	-	0.00	34	0	A	NM_020731		432961	+1	tier1	-	no_errors	ENST00000316418	ensembl	human	known	74_37	silent	36.84	12	7	SNP	0.000	G
AK5	26289	genome.wustl.edu	37	1	77949036	77949036	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr1:77949036C>G	ENST00000354567.2	+	9	1357	c.1094C>G	c.(1093-1095)aCt>aGt	p.T365S	AK5_ENST00000344720.5_Missense_Mutation_p.T339S	NM_174858.2	NP_777283.1	Q9Y6K8	KAD5_HUMAN	adenylate kinase 5	365					ADP biosynthetic process (GO:0006172)|ATP metabolic process (GO:0046034)|dADP biosynthetic process (GO:0006173)|nucleobase-containing small molecule interconversion (GO:0015949)|nucleobase-containing small molecule metabolic process (GO:0055086)|nucleoside diphosphate phosphorylation (GO:0006165)|nucleoside triphosphate biosynthetic process (GO:0009142)|pyrimidine ribonucleotide biosynthetic process (GO:0009220)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|microtubule organizing center (GO:0005815)	adenylate kinase activity (GO:0004017)|ATP binding (GO:0005524)|nucleoside diphosphate kinase activity (GO:0004550)|nucleoside kinase activity (GO:0019206)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(27)|prostate(1)|skin(2)|stomach(1)	40						GGAGAGGACACTATGGGAGGT	0.328																																																	0													154.0	150.0	152.0					1																	77949036		2203	4300	6503	SO:0001583	missense	0			AF062595	CCDS675.1, CCDS676.1	1p31	2008-02-05			ENSG00000154027	ENSG00000154027		"""Adenylate kinases"""	365	protein-coding gene	gene with protein product		608009				10215863	Standard	NM_012093		Approved		uc001dhn.3	Q9Y6K8	OTTHUMG00000009796	ENST00000354567.2:c.1094C>G	1.37:g.77949036C>G	ENSP00000346577:p.Thr365Ser		Q5U622|Q6FH66|Q7Z4T5|Q86YS0|Q8N464|Q96EC9	Missense_Mutation	SNP	pfam_Adenylate_kin,pfam_Dpy-30_motif,superfamily_P-loop_NTPase,superfamily_cAMP_dep_PK_reg_su_I/II_a/b,prints_Adenylate_kin,tigrfam_Adenylate_kin1	p.T365S	ENST00000354567.2	37	c.1094	CCDS675.1	1	.	.	.	.	.	.	.	.	.	.	C	0.271	-0.992677	0.02162	.	.	ENSG00000154027	ENST00000354567;ENST00000344720	T;T	0.71579	-0.58;-0.57	4.25	3.34	0.38264	.	0.865320	0.10197	N	0.703907	T	0.24774	0.0601	N	0.08118	0	0.19300	N	0.999979	B	0.02656	0.0	B	0.04013	0.001	T	0.20438	-1.0275	10	0.13108	T	0.6	-15.9637	8.2833	0.31913	0.0:0.8929:0.0:0.1071	.	365	Q9Y6K8	KAD5_HUMAN	S	365;339	ENSP00000346577:T365S;ENSP00000341430:T339S	ENSP00000341430:T339S	T	+	2	0	AK5	77721624	0.079000	0.21365	0.035000	0.18076	0.101000	0.19017	0.988000	0.29616	1.390000	0.46547	0.655000	0.94253	ACT	AK5	-	NULL	ENSG00000154027		0.328	AK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AK5	HGNC	protein_coding	OTTHUMT00000026993.4	-	0.00	58	0	C	NM_174858		77949036	+1	tier1	-	no_errors	ENST00000354567	ensembl	human	known	74_37	missense	29.00	71	29	SNP	0.040	G
ALDH1L1	10840	genome.wustl.edu	37	3	125824715	125824715	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr3:125824715G>A	ENST00000393434.2	-	22	2856	c.2507C>T	c.(2506-2508)tCt>tTt	p.S836F	ALDH1L1_ENST00000452905.2_Missense_Mutation_p.S735F|ALDH1L1_ENST00000273450.3_Missense_Mutation_p.S846F|ALDH1L1-AS1_ENST00000512384.1_RNA|ALDH1L1_ENST00000393431.2_3'UTR|ALDH1L1_ENST00000472186.1_Missense_Mutation_p.S836F	NM_012190.3	NP_036322.2	O75891	AL1L1_HUMAN	aldehyde dehydrogenase 1 family, member L1	836	Aldehyde dehydrogenase.				10-formyltetrahydrofolate catabolic process (GO:0009258)|biosynthetic process (GO:0009058)|one-carbon metabolic process (GO:0006730)	extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	catalytic activity (GO:0003824)|formyltetrahydrofolate dehydrogenase activity (GO:0016155)|hydroxymethyl-, formyl- and related transferase activity (GO:0016742)|methyltransferase activity (GO:0008168)|oxidoreductase activity, acting on the aldehyde or oxo group of donors, NAD or NADP as acceptor (GO:0016620)			NS(1)|breast(2)|central_nervous_system(3)|endometrium(2)|kidney(5)|large_intestine(10)|lung(22)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	52				GBM - Glioblastoma multiforme(114;0.0462)	Tetrahydrofolic acid(DB00116)	GAAGACACCAGAAGCCAGGCC	0.567																																																	0													149.0	138.0	142.0					3																	125824715		2203	4300	6503	SO:0001583	missense	0			AF052732	CCDS3034.1, CCDS58850.1, CCDS58851.1	3q21.2	2010-07-19		2005-01-27	ENSG00000144908	ENSG00000144908	1.5.1.6	"""Aldehyde dehydrogenases"""	3978	protein-coding gene	gene with protein product	"""cytosolic 10-formyltetrahydrofolate dehydrogenase"""	600249	"""formyltetrahydrofolate dehydrogenase"""	FTHFD			Standard	NM_012190		Approved	10-fTHF	uc031sbp.1	O75891	OTTHUMG00000125551	ENST00000393434.2:c.2507C>T	3.37:g.125824715G>A	ENSP00000377083:p.Ser836Phe		B4DG36|E9PBX3|Q68CS1	Missense_Mutation	SNP	pfam_Aldehyde_DH_dom,pfam_Formyl_transf_N,pfam_Formyl_trans_C,pfam_Acyl_carrier_prot-like,superfamily_Ald_DH/histidinol_DH,superfamily_Formyl_transf_N,superfamily_Formyl_transferase_C-like,superfamily_Acyl_carrier_prot-like,pirsf_10_FTHF_DH,pfscan_Acyl_carrier_prot-like	p.S836F	ENST00000393434.2	37	c.2507	CCDS3034.1	3	.	.	.	.	.	.	.	.	.	.	G	24.2	4.506754	0.85282	.	.	ENSG00000144908	ENST00000273450;ENST00000472186;ENST00000452905;ENST00000393434	T;T;T;T	0.78707	-1.2;-1.2;-1.2;-1.2	4.39	4.39	0.52855	Aldehyde dehydrogenase domain (1);Aldehyde dehydrogenase, C-terminal (1);Aldehyde/histidinol dehydrogenase (1);	0.000000	0.85682	D	0.000000	D	0.90191	0.6934	M	0.93106	3.38	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;0.999	D	0.92534	0.6036	10	0.87932	D	0	.	14.4773	0.67554	0.0:0.0:1.0:0.0	.	735;371;836	E9PBX3;Q6ZV71;O75891	.;.;AL1L1_HUMAN	F	846;836;735;836	ENSP00000273450:S846F;ENSP00000420293:S836F;ENSP00000395881:S735F;ENSP00000377083:S836F	ENSP00000273450:S846F	S	-	2	0	ALDH1L1	127307405	1.000000	0.71417	0.999000	0.59377	0.992000	0.81027	9.304000	0.96190	2.259000	0.74868	0.491000	0.48974	TCT	ALDH1L1	-	pfam_Aldehyde_DH_dom,superfamily_Ald_DH/histidinol_DH,pirsf_10_FTHF_DH	ENSG00000144908		0.567	ALDH1L1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ALDH1L1	HGNC	protein_coding	OTTHUMT00000354391.1		0.00	34	0	G	NM_012190		125824715	-1			no_errors	ENST00000393434	ensembl	human	known	74_37	missense	7.14	39	3	SNP	1.000	A
ALK	238	genome.wustl.edu	37	2	29917827	29917827	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr2:29917827G>T	ENST00000389048.3	-	3	1747	c.841C>A	c.(841-843)Cat>Aat	p.H281N	ALK_ENST00000431873.1_Intron	NM_004304.4	NP_004295.2	Q9UM73	ALK_HUMAN	anaplastic lymphoma receptor tyrosine kinase	281	MAM 1. {ECO:0000255|PROSITE- ProRule:PRU00128}.				activation of MAPK activity (GO:0000187)|cell proliferation (GO:0008283)|neuron development (GO:0048666)|NIK/NF-kappaB signaling (GO:0038061)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphorylation (GO:0016310)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein autophosphorylation (GO:0046777)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|protein complex (GO:0043234)	ATP binding (GO:0005524)|NF-kappaB-inducing kinase activity (GO:0004704)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)		ATIC/ALK(24)|FN1/ALK(2)|C2orf44/ALK(2)|TPM3/ALK(33)|KLC1/ALK(2)|VCL/ALK(4)|TPM4/ALK(12)|KIF5B/ALK(8)|RANBP2/ALK(34)|SQSTM1/ALK(2)|EML4/ALK(543)|PPFIBP1/ALK(3)|SEC31A/ALK(3)|NPM1/ALK(632)|CLTC/ALK(44)|CARS/ALK(5)|MSN/ALK(6)|TFG/ALK(9)	NS(2)|autonomic_ganglia(198)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(7)|kidney(4)|large_intestine(25)|lung(61)|ovary(6)|pancreas(1)|prostate(2)|skin(5)|soft_tissue(3)|stomach(2)|thyroid(2)	340	Acute lymphoblastic leukemia(172;0.155)				Adenosine triphosphate(DB00171)|Crizotinib(DB08865)	CTGAGGTCATGCAGTGGAGGG	0.567			"""T, Mis, A"""	"""NPM1, TPM3, TFG, TPM4, ATIC, CLTC, MSN, ALO17, CARS, EML4, KIF5B, C2orf22"""	"""ALCL, NSCLC, Neuroblastoma"""	neuroblastoma			Neuroblastoma, Familial Clustering of;Congenital Central Hypoventilation Syndrome																														yes	Dom	yes	Familial neuroblastoma	2	2p23	238	anaplastic lymphoma kinase (Ki-1)		"""L, E, M"""	0													100.0	97.0	98.0					2																	29917827		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Familial Neuroblastoma;CCHS, Ondine Curse, incl. Ondine-Hirschsprung Disease	D45915	CCDS33172.1	2p23	2014-09-17	2008-01-23		ENSG00000171094	ENSG00000171094		"""CD molecules"""	427	protein-coding gene	gene with protein product		105590	"""anaplastic lymphoma kinase (Ki-1)"""			8122112	Standard	NM_004304		Approved	CD246	uc002rmy.3	Q9UM73	OTTHUMG00000152034	ENST00000389048.3:c.841C>A	2.37:g.29917827G>T	ENSP00000373700:p.His281Asn		Q4ZFX9|Q53QQ6|Q53RZ4|Q59FI3|Q9Y4K6	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_MAM_dom,superfamily_Kinase-like_dom,superfamily_ConA-like_lec_gl_sf,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_MAM_dom,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.H281N	ENST00000389048.3	37	c.841	CCDS33172.1	2	.	.	.	.	.	.	.	.	.	.	G	15.20	2.761702	0.49468	.	.	ENSG00000171094	ENST00000389048	T	0.01787	4.64	6.07	6.07	0.98685	Concanavalin A-like lectin/glucanase (1);MAM domain (1);	.	.	.	.	T	0.01730	0.0055	N	0.08118	0	0.80722	D	1	P	0.37914	0.611	B	0.41036	0.346	T	0.76307	-0.3007	8	.	.	.	.	16.1594	0.81686	0.0:0.0:1.0:0.0	.	281	Q9UM73	ALK_HUMAN	N	281	ENSP00000373700:H281N	.	H	-	1	0	ALK	29771331	1.000000	0.71417	0.996000	0.52242	0.520000	0.34377	3.566000	0.53805	2.885000	0.99019	0.655000	0.94253	CAT	ALK	-	superfamily_ConA-like_lec_gl_sf,pfscan_MAM_dom	ENSG00000171094		0.567	ALK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALK	HGNC	protein_coding	OTTHUMT00000324994.1	-	0.00	19	0	G	NM_004304		29917827	-1	tier1	-	no_errors	ENST00000389048	ensembl	human	known	74_37	missense	35.71	18	10	SNP	1.000	T
ANK1	286	genome.wustl.edu	37	8	41581100	41581100	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr8:41581100C>T	ENST00000347528.4	-	8	846	c.763G>A	c.(763-765)Gtg>Atg	p.V255M	ANK1_ENST00000265709.8_Missense_Mutation_p.V288M|ANK1_ENST00000396945.1_Missense_Mutation_p.V255M|ANK1_ENST00000379758.2_Missense_Mutation_p.V255M|ANK1_ENST00000352337.4_Missense_Mutation_p.V255M|ANK1_ENST00000289734.7_Missense_Mutation_p.V255M|ANK1_ENST00000396942.1_Missense_Mutation_p.V255M	NM_020475.2|NM_020476.2|NM_020477.2	NP_065208.2|NP_065209.2|NP_065210.2	P16157	ANK1_HUMAN	ankyrin 1, erythrocytic	255	89 kDa domain.				axon guidance (GO:0007411)|cytoskeleton organization (GO:0007010)|ER to Golgi vesicle-mediated transport (GO:0006888)|erythrocyte development (GO:0048821)|exocytosis (GO:0006887)|maintenance of epithelial cell apical/basal polarity (GO:0045199)|monovalent inorganic cation transport (GO:0015672)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of organelle organization (GO:0010638)|protein targeting to plasma membrane (GO:0072661)|signal transduction (GO:0007165)	axolemma (GO:0030673)|basolateral plasma membrane (GO:0016323)|cortical cytoskeleton (GO:0030863)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|M band (GO:0031430)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|cytoskeletal adaptor activity (GO:0008093)|enzyme binding (GO:0019899)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			breast(5)|central_nervous_system(4)|endometrium(9)|kidney(1)|large_intestine(26)|lung(62)|ovary(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	122	Ovarian(28;0.00541)|Colorectal(14;0.0398)|Lung SC(25;0.211)	all_lung(54;0.000626)|Lung NSC(58;0.00245)|Esophageal squamous(32;0.0559)|Hepatocellular(245;0.0663)|Renal(179;0.188)	OV - Ovarian serous cystadenocarcinoma(14;0.000984)|Lung(22;0.00108)|Colorectal(10;0.00245)|LUSC - Lung squamous cell carcinoma(45;0.00392)|COAD - Colon adenocarcinoma(11;0.0264)			AGCAGCCGCACCATGATCACG	0.642																																																	0													114.0	84.0	94.0					8																	41581100		2203	4300	6503	SO:0001583	missense	0			M28880	CCDS6119.1, CCDS6121.1, CCDS6122.1, CCDS47849.1, CCDS55227.1	8p11.21	2013-01-10			ENSG00000029534	ENSG00000029534		"""Ankyrin repeat domain containing"""	492	protein-coding gene	gene with protein product		612641		ANK		1689849	Standard	NM_001142445		Approved	SPH1	uc003xom.3	P16157	OTTHUMG00000150281	ENST00000347528.4:c.763G>A	8.37:g.41581100C>T	ENSP00000339620:p.Val255Met		A0PJN8|A6NJ23|E5RFL7|O43400|Q13768|Q53ER1|Q59FP2|Q8N604|Q99407	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_ZU5,pfam_Death_domain,superfamily_Ankyrin_rpt-contain_dom,superfamily_DEATH-like_dom,smart_Ankyrin_rpt,smart_ZU5,smart_Death_domain,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Death_domain,pfscan_ZU5,prints_Ankyrin_rpt	p.V255M	ENST00000347528.4	37	c.763	CCDS6119.1	8	.	.	.	.	.	.	.	.	.	.	C	33	5.284942	0.95517	.	.	ENSG00000029534	ENST00000347528;ENST00000289734;ENST00000379758;ENST00000396945;ENST00000396942;ENST00000352337;ENST00000265709;ENST00000358820	T;T;T;T;T;T;T	0.73152	-0.72;-0.72;-0.72;-0.72;-0.72;-0.72;-0.72	5.58	5.58	0.84498	Ankyrin repeat-containing domain (3);	0.000000	0.85682	D	0.000000	D	0.83413	0.5249	M	0.63208	1.945	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;0.998;0.997;1.0	D	0.84456	0.0591	10	0.87932	D	0	.	19.5547	0.95338	0.0:1.0:0.0:0.0	.	288;255;255;255;255	P16157-21;P16157-4;P16157;P16157-5;P16157-3	.;.;ANK1_HUMAN;.;.	M	255;255;255;255;255;255;288;255	ENSP00000339620:V255M;ENSP00000289734:V255M;ENSP00000369082:V255M;ENSP00000380149:V255M;ENSP00000380147:V255M;ENSP00000309131:V255M;ENSP00000265709:V288M	ENSP00000265709:V288M	V	-	1	0	ANK1	41700257	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.818000	0.86416	2.619000	0.88677	0.655000	0.94253	GTG	ANK1	-	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000029534		0.642	ANK1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ANK1	HGNC	protein_coding	OTTHUMT00000317297.1	-	0.00	56	0	C	NM_020475		41581100	-1	tier1	-	no_errors	ENST00000396942	ensembl	human	known	74_37	missense	15.89	90	17	SNP	1.000	T
ANK2	287	genome.wustl.edu	37	4	114279791	114279791	+	Silent	SNP	G	G	A			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr4:114279791G>A	ENST00000357077.4	+	38	10070	c.10017G>A	c.(10015-10017)gcG>gcA	p.A3339A	ANK2_ENST00000394537.3_Intron|ANK2_ENST00000510275.2_Intron|ANK2_ENST00000264366.6_Silent_p.A3306A|ANK2_ENST00000506722.1_Intron|ANK2_ENST00000509550.1_Intron	NM_001148.4	NP_001139.3	Q01484	ANK2_HUMAN	ankyrin 2, neuronal	3339					atrial cardiac muscle cell action potential (GO:0086014)|atrial cardiac muscle cell to AV node cell communication (GO:0086066)|atrial septum development (GO:0003283)|axon guidance (GO:0007411)|cardiac muscle contraction (GO:0060048)|cellular calcium ion homeostasis (GO:0006874)|cellular protein localization (GO:0034613)|membrane depolarization during SA node cell action potential (GO:0086046)|paranodal junction assembly (GO:0030913)|positive regulation of calcium ion transmembrane transporter activity (GO:1901021)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cation channel activity (GO:2001259)|positive regulation of gene expression (GO:0010628)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein localization to cell surface (GO:0034394)|protein localization to endoplasmic reticulum (GO:0070972)|protein localization to M-band (GO:0036309)|protein localization to organelle (GO:0033365)|protein localization to plasma membrane (GO:0072659)|protein localization to T-tubule (GO:0036371)|protein stabilization (GO:0050821)|protein targeting to plasma membrane (GO:0072661)|regulation of calcium ion transmembrane transporter activity (GO:1901019)|regulation of calcium ion transport (GO:0051924)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to methylmercury (GO:0051597)|SA node cell action potential (GO:0086015)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|T-tubule organization (GO:0033292)|ventricular cardiac muscle cell action potential (GO:0086005)	A band (GO:0031672)|basolateral plasma membrane (GO:0016323)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intracellular (GO:0005622)|M band (GO:0031430)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)	p.A3339A(1)		NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(54)|liver(2)|lung(112)|ovary(8)|pancreas(1)|prostate(7)|skin(11)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(10)	248		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		AAAATAAGGCGGATGAAGCAA	0.468																																																	1	Substitution - coding silent(1)	central_nervous_system(1)											122.0	124.0	123.0					4																	114279791		2203	4300	6503	SO:0001819	synonymous_variant	0			M37123	CCDS3702.1, CCDS43261.1, CCDS54796.1	4q25-q26	2014-09-17	2003-03-12		ENSG00000145362	ENSG00000145362		"""Ankyrin repeat domain containing"""	493	protein-coding gene	gene with protein product		106410	"""long (electrocardiographic) QT syndrome 4"""	LQT4		7485162, 12571597	Standard	NM_001148		Approved		uc003ibe.4	Q01484	OTTHUMG00000132912	ENST00000357077.4:c.10017G>A	4.37:g.114279791G>A			Q01485|Q08AC7|Q08AC8|Q7Z3L5	Silent	SNP	pfam_Ankyrin_rpt,pfam_ZU5,pfam_Death_domain,superfamily_Ankyrin_rpt-contain_dom,superfamily_DEATH-like_dom,smart_Ankyrin_rpt,smart_ZU5,smart_Death_domain,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Death_domain,pfscan_ZU5,prints_Ankyrin_rpt	p.A3339	ENST00000357077.4	37	c.10017	CCDS3702.1	4																																																																																			ANK2	-	NULL	ENSG00000145362		0.468	ANK2-001	KNOWN	basic|CCDS	protein_coding	ANK2	HGNC	protein_coding	OTTHUMT00000256422.2	-	0.00	21	0	G	NM_001148		114279791	+1	tier1	-	no_errors	ENST00000357077	ensembl	human	known	74_37	silent	23.08	20	6	SNP	0.380	A
ANKRD20A11P	391267	genome.wustl.edu	37	21	15313135	15313135	+	RNA	SNP	C	C	T			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr21:15313135C>T	ENST00000344693.5	-	0	1088					NR_027270.1				ankyrin repeat domain 20 family, member A11, pseudogene																		GGCTTACTTACCTATCATGCT	0.393																																																	0																																												0					21q11.2	2011-11-23			ENSG00000215559	ENSG00000215559			42024	pseudogene	pseudogene			"""chromosome 21 open reading frame 81"""	C21orf81			Standard	NR_027270		Approved		uc002yjj.4		OTTHUMG00000074237		21.37:g.15313135C>T				Splice_Site	SNP	-	NULL	ENST00000344693.5	37	c.NULL		21																																																																																			ANKRD20A11P	-	-	ENSG00000215559		0.393	ANKRD20A11P-005	KNOWN	basic	processed_transcript	ANKRD20A11P	HGNC	pseudogene	OTTHUMT00000157750.1	-	0.00	55	0	C			15313135	-1	tier1	-	no_errors	ENST00000428576	ensembl	human	known	74_37	splice_site	26.67	55	20	SNP	0.158	T
ANKRD20A5P	440482	genome.wustl.edu	37	18	14184340	14184341	+	RNA	INS	-	-	T	rs374531085		TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr18:14184340_14184341insT	ENST00000581935.1	+	0	1029_1030							A0PJZ0	A20A5_HUMAN	ankyrin repeat domain 20 family, member A5, pseudogene											lung(3)	3						AACCTTTTCAACTTTTTTTCTA	0.297																																																	0																																												0			BC022023		18p11.21	2011-06-01	2011-06-01	2011-06-01	ENSG00000186481	ENSG00000186481			33833	pseudogene	pseudogene			"""ankyrin repeat domain 20 family, member A5"""	ANKRD20A5			Standard	NR_040113		Approved	MGC26718	uc010xag.2	A0PJZ0	OTTHUMG00000157172		18.37:g.14184340_14184341insT			Q4G1B6	RNA	INS	-	NULL	ENST00000581935.1	37	NULL		18																																																																																			ANKRD20A5P	-	-	ENSG00000186481		0.297	ANKRD20A5P-002	KNOWN	basic	processed_transcript	ANKRD20A5P	HGNC	pseudogene	OTTHUMT00000442833.1		0.00	15	0	-			14184341	+1	tier1		no_errors	ENST00000581935	ensembl	human	known	74_37	rna	37.50	5	3	INS	0.000:0.000	T
AP2B1	163	genome.wustl.edu	37	17	34044277	34044277	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr17:34044277G>T	ENST00000262325.7	+	20	3201	c.2648G>T	c.(2647-2649)gGg>gTg	p.G883V	AP2B1_ENST00000589344.1_Missense_Mutation_p.G897V|AP2B1_ENST00000537622.2_Missense_Mutation_p.G897V|AP2B1_ENST00000545922.2_3'UTR|AP2B1_ENST00000312678.8_Missense_Mutation_p.G897V|AP2B1_ENST00000592545.1_Missense_Mutation_p.G859V|AP2B1_ENST00000538556.1_Missense_Mutation_p.G826V	NM_001282.2	NP_001273.1	P63010	AP2B1_HUMAN	adaptor-related protein complex 2, beta 1 subunit	883	Interaction with ARRB1.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon guidance (GO:0007411)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|intracellular protein transport (GO:0006886)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of defense response to virus by virus (GO:0050690)|synaptic transmission (GO:0007268)|viral process (GO:0016032)	clathrin adaptor complex (GO:0030131)|clathrin-coated endocytic vesicle membrane (GO:0030669)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|plasma membrane (GO:0005886)	clathrin binding (GO:0030276)|protein transporter activity (GO:0008565)			NS(1)|breast(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(6)|ovary(3)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	28		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0227)		AATGTGGAAGGGCAGGACATG	0.433																																																	0													135.0	117.0	123.0					17																	34044277		2203	4300	6503	SO:0001583	missense	0			M34175	CCDS32621.1, CCDS32622.1	17q11.2-q12	2010-06-18			ENSG00000006125	ENSG00000006125			563	protein-coding gene	gene with protein product		601025		ADTB2, CLAPB1		8262066, 8595912	Standard	XM_005257937		Approved		uc002hjq.3	P63010		ENST00000262325.7:c.2648G>T	17.37:g.34044277G>T	ENSP00000262325:p.Gly883Val		A6NJP3|P21851|Q7Z451|Q96J19	Missense_Mutation	SNP	pfam_Clathrin/coatomer_adapt-like_N,pfam_B-adaptin_app_sub_C,pfam_HEAT,pfam_Clathrin_a/b/g-adaptin_app_Ig,superfamily_ARM-type_fold,superfamily_Coatomer/calthrin_app_sub_C,superfamily_Coatomer/clathrin_app_Ig-like,smart_Armadillo,smart_Clathrin_a/b/g-adaptin_app_Ig,pirsf_AP_complex_bsu_1_2_4	p.G897V	ENST00000262325.7	37	c.2690	CCDS32622.1	17	.	.	.	.	.	.	.	.	.	.	G	29.7	5.027745	0.93518	.	.	ENSG00000006125	ENST00000262325;ENST00000312678;ENST00000538556;ENST00000537622;ENST00000545922	T;T;T;T	0.43294	1.21;1.22;0.95;1.22	5.86	5.86	0.93980	Coatomer/calthrin adaptor appendage, C-terminal subdomain (1);Clathrin adaptor, beta-adaptin, appendage, C-terminal subdomain (1);Beta2-adaptin/TATA-box binding, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.66906	0.2837	M	0.83953	2.67	0.80722	D	1	D;D;P;D	0.76494	0.999;0.988;0.892;0.985	P;P;P;P	0.61070	0.838;0.847;0.775;0.883	T	0.69939	-0.5009	10	0.87932	D	0	-11.8983	19.5509	0.95319	0.0:0.0:1.0:0.0	.	634;859;883;897	F5GYG9;B4DWG4;P63010;P63010-2	.;.;AP2B1_HUMAN;.	V	883;897;826;897;634	ENSP00000262325:G883V;ENSP00000314414:G897V;ENSP00000440563:G826V;ENSP00000437413:G897V	ENSP00000262325:G883V	G	+	2	0	AP2B1	31068390	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	9.869000	0.99810	2.937000	0.99478	0.650000	0.86243	GGG	AP2B1	-	pfam_B-adaptin_app_sub_C,superfamily_Coatomer/calthrin_app_sub_C	ENSG00000006125		0.433	AP2B1-001	KNOWN	basic|CCDS	protein_coding	AP2B1	HGNC	protein_coding	OTTHUMT00000448969.1	-	0.00	52	0	G			34044277	+1	tier1	-	no_errors	ENST00000312678	ensembl	human	known	74_37	missense	37.50	30	18	SNP	1.000	T
AP3S1	1176	genome.wustl.edu	37	5	115249588	115249588	+	3'UTR	SNP	G	G	A	rs6895932		TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr5:115249588G>A	ENST00000316788.7	+	0	1540				AP3S1_ENST00000505423.1_3'UTR	NM_001284.2	NP_001275.1	Q92572	AP3S1_HUMAN	adaptor-related protein complex 3, sigma 1 subunit						anterograde axon cargo transport (GO:0008089)|anterograde synaptic vesicle transport (GO:0048490)|insulin receptor signaling pathway (GO:0008286)|intracellular protein transport (GO:0006886)	AP-3 adaptor complex (GO:0030123)|AP-type membrane coat adaptor complex (GO:0030119)|Golgi apparatus (GO:0005794)|transport vesicle (GO:0030133)	protein transporter activity (GO:0008565)|transporter activity (GO:0005215)			cervix(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(2)|ovary(1)|pancreas(1)|prostate(1)	12		all_cancers(142;0.00377)|all_epithelial(76;0.000129)|Prostate(80;0.0132)|Ovarian(225;0.0776)|Lung NSC(810;0.245)		OV - Ovarian serous cystadenocarcinoma(64;1.08e-07)|Epithelial(69;1.11e-06)|all cancers(49;5.2e-05)		ATGTCACACAGTTGTTATTTG	0.328																																																	0																																										SO:0001624	3_prime_UTR_variant	0			D63643	CCDS4123.1	5q22	2010-06-29			ENSG00000177879	ENSG00000177879			2013	protein-coding gene	gene with protein product		601507		CLAPS3		8697810, 9118953	Standard	NM_001284		Approved		uc003krl.3	Q92572	OTTHUMG00000128887	ENST00000316788.7:c.*401G>A	5.37:g.115249588G>A			O00647|O00676|O00721|O00727|Q53XL4|Q6ICQ2	RNA	SNP	-	NULL	ENST00000316788.7	37	NULL	CCDS4123.1	5																																																																																			AP3S1	-	-	ENSG00000177879		0.328	AP3S1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AP3S1	HGNC	protein_coding	OTTHUMT00000250847.2	-	0.00	32	0	G			115249588	+1	tier1	rs6895932	no_errors	ENST00000505423	ensembl	human	putative	74_37	rna	13.89	31	5	SNP	0.013	A
APLP1	333	genome.wustl.edu	37	19	36368698	36368698	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr19:36368698G>T	ENST00000221891.4	+	12	1715	c.1523G>T	c.(1522-1524)gGt>gTt	p.G508V	APLP1_ENST00000537454.2_Missense_Mutation_p.G469V|APLP1_ENST00000586861.1_Missense_Mutation_p.G502V|APLP1_ENST00000589298.2_3'UTR	NM_001024807.1|NM_005166.3	NP_001019978.1|NP_005157.1	P51693	APLP1_HUMAN	amyloid beta (A4) precursor-like protein 1	508					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|apoptotic process (GO:0006915)|cell adhesion (GO:0007155)|cellular response to norepinephrine stimulus (GO:0071874)|endocytosis (GO:0006897)|extracellular matrix organization (GO:0030198)|forebrain development (GO:0030900)|mRNA polyadenylation (GO:0006378)|negative regulation of cAMP biosynthetic process (GO:0030818)|nervous system development (GO:0007399)|organ morphogenesis (GO:0009887)|regulation of translation (GO:0006417)	basement membrane (GO:0005604)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	alpha-2A adrenergic receptor binding (GO:0031694)|alpha-2B adrenergic receptor binding (GO:0031695)|alpha-2C adrenergic receptor binding (GO:0031696)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|transition metal ion binding (GO:0046914)			breast(4)|endometrium(2)|kidney(2)|large_intestine(12)|liver(1)|lung(9)|ovary(2)|upper_aerodigestive_tract(1)	33	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			GAGGACAAGGGTGGGCTGCAG	0.577																																																	0													57.0	56.0	56.0					19																	36368698		2203	4300	6503	SO:0001583	missense	0			U48437	CCDS32997.1	19q	2008-07-15							597	protein-coding gene	gene with protein product	"""amyloid-like protein 1"", ""amyloid precursor-like protein 1"""	104775				8432545	Standard	NM_001024807		Approved	APLP	uc002ocf.3	P51693		ENST00000221891.4:c.1523G>T	19.37:g.36368698G>T	ENSP00000221891:p.Gly508Val		O00113|Q96A92	Missense_Mutation	SNP	pfam_Amyloid_glyco_heparin-bd,pfam_APP_amyloid_C,superfamily_Amyloid_glyco_E2_domain,superfamily_Amyloid_glyco_heparin-bd,superfamily_Amyloid_glyco_Cu-bd,smart_Amyloid_glyco_extra,prints_Amyloid_glyco	p.G508V	ENST00000221891.4	37	c.1523	CCDS32997.1	19	.	.	.	.	.	.	.	.	.	.	G	5.989	0.366356	0.11352	.	.	ENSG00000105290	ENST00000537454;ENST00000221891	D;D	0.94232	-3.22;-3.38	5.47	3.34	0.38264	.	0.660669	0.13196	N	0.406394	D	0.84266	0.5434	N	0.08118	0	0.47245	D	0.999368	B;B;B;B	0.29432	0.244;0.004;0.006;0.003	B;B;B;B	0.31686	0.134;0.021;0.003;0.001	T	0.76334	-0.2997	10	0.33141	T	0.24	-0.2876	7.7007	0.28621	0.0878:0.1639:0.7483:0.0	.	502;469;508;508	B7Z4G8;F5GZ08;P51693-2;P51693	.;.;.;APLP1_HUMAN	V	469;508	ENSP00000441501:G469V;ENSP00000221891:G508V	ENSP00000221891:G508V	G	+	2	0	APLP1	41060538	1.000000	0.71417	0.694000	0.30210	0.273000	0.26683	1.328000	0.33758	0.693000	0.31634	-0.165000	0.13383	GGT	APLP1	-	NULL	ENSG00000105290		0.577	APLP1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	APLP1	HGNC	protein_coding	OTTHUMT00000452564.1	-	0.00	12	0	G	NM_001024807		36368698	+1	tier1	-	no_errors	ENST00000221891	ensembl	human	known	74_37	missense	17.02	39	8	SNP	0.858	T
ARGLU1	55082	genome.wustl.edu	37	13	107211906	107211906	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr13:107211906C>A	ENST00000400198.3	-	2	691	c.447G>T	c.(445-447)agG>agT	p.R149S	ARGLU1_ENST00000375926.1_5'UTR|ARGLU1_ENST00000472226.1_5'Flank	NM_018011.3	NP_060481.3	Q9NWB6	ARGL1_HUMAN	arginine and glutamate rich 1	149	Glu-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	mitochondrion (GO:0005739)|nucleus (GO:0005634)				large_intestine(1)|lung(5)|pancreas(1)	7	Lung NSC(43;0.015)|all_neural(89;0.0741)|Lung SC(71;0.14)|Medulloblastoma(90;0.169)					TTTCATCCTTCCTTTTCTCCA	0.458																																																	0													204.0	200.0	201.0					13																	107211906		1879	4115	5994	SO:0001583	missense	0			BC071587	CCDS41906.1	13q33.3	2011-10-03	2007-11-28		ENSG00000134884	ENSG00000134884			25482	protein-coding gene	gene with protein product		614046				21454576	Standard	NM_018011		Approved	FLJ10154	uc001vqk.4	Q9NWB6	OTTHUMG00000017321	ENST00000400198.3:c.447G>T	13.37:g.107211906C>A	ENSP00000383059:p.Arg149Ser		B4E0Y3|Q5T257|Q6IQ34	Missense_Mutation	SNP	NULL	p.R149S	ENST00000400198.3	37	c.447	CCDS41906.1	13	.	.	.	.	.	.	.	.	.	.	C	17.45	3.392161	0.62066	.	.	ENSG00000134884	ENST00000400198;ENST00000426600	.	.	.	5.51	2.88	0.33553	.	0.108848	0.64402	D	0.000007	T	0.76076	0.3937	M	0.80183	2.485	0.80722	D	1	D	0.57899	0.981	D	0.66351	0.943	T	0.75892	-0.3157	9	0.72032	D	0.01	-9.8302	10.1744	0.42931	0.0:0.7268:0.0:0.2732	.	149	Q9NWB6	ARGL1_HUMAN	S	149;99	.	ENSP00000383059:R149S	R	-	3	2	ARGLU1	106009907	0.989000	0.36119	1.000000	0.80357	0.999000	0.98932	0.308000	0.19314	0.307000	0.22880	0.655000	0.94253	AGG	ARGLU1	-	NULL	ENSG00000134884		0.458	ARGLU1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARGLU1	HGNC	protein_coding	OTTHUMT00000045727.1	-	0.00	104	0	C	NM_018011		107211906	-1	tier1	-	no_errors	ENST00000400198	ensembl	human	known	74_37	missense	49.23	66	64	SNP	1.000	A
ARHGEF18	23370	genome.wustl.edu	37	19	7523441	7523442	+	Frame_Shift_Del	DEL	GG	GG	-			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	GG	GG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr19:7523441_7523442delGG	ENST00000359920.6	+	9	1914_1915	c.1661_1662delGG	c.(1660-1662)aggfs	p.R554fs	ARHGEF18_ENST00000319670.9_Frame_Shift_Del_p.R396fs|CTD-2207O23.3_ENST00000593531.1_Frame_Shift_Del_p.G512fs	NM_001130955.1	NP_001124427.1	Q6ZSZ5	ARHGI_HUMAN	Rho/Rac guanine nucleotide exchange factor (GEF) 18	554	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|transforming growth factor beta receptor signaling pathway (GO:0007179)	apical part of cell (GO:0045177)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)	guanyl-nucleotide exchange factor activity (GO:0005085)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(4)|ovary(2)|prostate(2)|stomach(1)|urinary_tract(1)	23		Renal(5;0.0902)				CTCATCGTGAGGGAAGTGGCCA	0.54																																																	0																																										SO:0001589	frameshift_variant	0			AK074372	CCDS12177.1, CCDS45946.1	19p13.3	2013-01-10	2009-06-12			ENSG00000104880		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	17090	protein-coding gene	gene with protein product	"""Rho-specific guanine nucleotide exchange factor p114"""		"""rho/rac guanine nucleotide exchange factor (GEF) 18"""			9628581, 11318610	Standard	NM_015318		Approved	P114-RhoGEF, KIAA0521, MGC15913	uc002mgi.3	Q6ZSZ5		ENST00000359920.6:c.1661_1662delGG	19.37:g.7523441_7523442delGG	ENSP00000352995:p.Arg554fs		A8MV62|B5ME81|O60274|Q6DD92	Frame_Shift_Del	DEL	pfam_DH-domain,pfam_Pleckstrin_homology,superfamily_DH-domain,smart_DH-domain,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_DH-domain	p.E555fs	ENST00000359920.6	37	c.1661_1662	CCDS45946.1	19																																																																																			ARHGEF18	-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	ENSG00000104880		0.540	ARHGEF18-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ARHGEF18	HGNC	protein_coding	OTTHUMT00000436340.1		0.00	57	0	GG	NM_015318		7523442	+1	tier1		no_errors	ENST00000359920	ensembl	human	known	74_37	frame_shift_del	35.90	25	14	DEL	1.000:1.000	-
ARHGAP35	2909	genome.wustl.edu	37	19	47503672	47503672	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr19:47503672C>A	ENST00000404338.3	+	6	4227	c.4227C>A	c.(4225-4227)ttC>ttA	p.F1409L		NM_004491.4	NP_004482.4	Q9NRY4	RHG35_HUMAN	Rho GTPase activating protein 35	1409	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				axon guidance (GO:0007411)|camera-type eye development (GO:0043010)|forebrain development (GO:0030900)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of vascular permeability (GO:0043116)|neural tube closure (GO:0001843)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|transcription, DNA-templated (GO:0006351)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|nucleus (GO:0005634)	DNA binding (GO:0003677)|GTP binding (GO:0005525)|Rho GTPase activator activity (GO:0005100)|transcription corepressor activity (GO:0003714)										GACCTGATTTCAGCACTATGG	0.542																																																	0													258.0	271.0	266.0					19																	47503672		2177	4265	6442	SO:0001583	missense	0			M73077	CCDS46127.1	19q13.32	2011-06-29	2011-06-07	2011-06-07	ENSG00000160007	ENSG00000160007		"""Rho GTPase activating proteins"""	4591	protein-coding gene	gene with protein product		605277	"""glucocorticoid receptor DNA binding factor 1"""	GRLF1		1894621, 20675588	Standard	NM_004491		Approved	GRF-1, p190ARhoGAP, P190A, KIAA1722, p190RhoGAP	uc010ekv.3	Q9NRY4		ENST00000404338.3:c.4227C>A	19.37:g.47503672C>A	ENSP00000385720:p.Phe1409Leu		A7E2A4|Q14452|Q9C0E1	Missense_Mutation	SNP	pfam_RhoGAP_dom,pfam_Small_GTPase,pfam_FF_domain,superfamily_Rho_GTPase_activation_prot,superfamily_P-loop_NTPase,superfamily_FF_domain,smart_FF_domain,smart_RhoGAP_dom,pfscan_RhoGAP_dom	p.F1409L	ENST00000404338.3	37	c.4227	CCDS46127.1	19	.	.	.	.	.	.	.	.	.	.	C	17.63	3.436252	0.62955	.	.	ENSG00000160007	ENST00000317082;ENST00000404338	T	0.18502	2.21	5.08	3.99	0.46301	.	0.000000	0.85682	D	0.000000	T	0.12987	0.0315	L	0.46567	1.45	0.54753	D	0.999987	B	0.33694	0.421	B	0.23716	0.048	T	0.03212	-1.1060	10	0.56958	D	0.05	-25.2108	8.5615	0.33514	0.0:0.8212:0.0:0.1788	.	1409	Q9NRY4-2	.	L	1409	ENSP00000385720:F1409L	ENSP00000324820:F1409L	F	+	3	2	ARHGAP35	52195512	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	3.097000	0.50251	2.643000	0.89663	0.650000	0.86243	TTC	ARHGAP35	-	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	ENSG00000160007		0.542	ARHGAP35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGAP35	HGNC	protein_coding	OTTHUMT00000466652.1	-	0.00	27	0	C	NM_004491		47503672	+1	tier1	-	no_errors	ENST00000404338	ensembl	human	known	74_37	missense	40.54	22	15	SNP	1.000	A
ASB13	79754	genome.wustl.edu	37	10	5682028	5682028	+	3'UTR	SNP	C	C	T			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr10:5682028C>T	ENST00000357700.6	-	0	1501				ASB13_ENST00000479033.1_5'UTR	NM_024701.3	NP_078977.2	Q8WXK3	ASB13_HUMAN	ankyrin repeat and SOCS box containing 13						intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)					NS(1)|endometrium(3)|lung(3)|ovary(1)	8				GBM - Glioblastoma multiforme(2;9.59e-09)		CCAGGGCCTTCCCCCACAAAG	0.488																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AK091935	CCDS7070.1	10p15.1	2013-01-10	2011-01-25		ENSG00000196372	ENSG00000196372		"""Ankyrin repeat domain containing"""	19765	protein-coding gene	gene with protein product		615055	"""ankyrin repeat and SOCS box-containing 13"""			12076535	Standard	NM_024701		Approved	FLJ13134, MGC19879	uc001iig.2	Q8WXK3	OTTHUMG00000017603	ENST00000357700.6:c.*638G>A	10.37:g.5682028C>T			A8K7Q6|D3DRR2|Q96EP7|Q9H8Z1	RNA	SNP	-	NULL	ENST00000357700.6	37	NULL	CCDS7070.1	10																																																																																			ASB13	-	-	ENSG00000196372		0.488	ASB13-004	KNOWN	basic|appris_principal|CCDS	protein_coding	ASB13	HGNC	protein_coding	OTTHUMT00000046564.1	-	0.00	30	0	C			5682028	-1	tier1	-	no_errors	ENST00000479033	ensembl	human	known	74_37	rna	10.91	48	6	SNP	0.000	T
ASIC4	55515	genome.wustl.edu	37	2	220396750	220396750	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr2:220396750G>C	ENST00000347842.3	+	3	1150	c.1136G>C	c.(1135-1137)cGg>cCg	p.R379P	ASIC4_ENST00000358078.4_Missense_Mutation_p.R379P|ASIC4_ENST00000473709.1_3'UTR	NM_182847.2	NP_878267.2	Q96FT7	ASIC4_HUMAN	acid-sensing (proton-gated) ion channel family member 4	379					ion transmembrane transport (GO:0034220)|sodium ion transmembrane transport (GO:0035725)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)	ion channel activity (GO:0005216)|sodium channel activity (GO:0005272)|sodium ion transmembrane transporter activity (GO:0015081)										GCAGGTATTCGGGTGCAGATC	0.632																																																	0													103.0	111.0	108.0					2																	220396750		2203	4300	6503	SO:0001583	missense	0			AJ271643	CCDS2442.1	2q36.1	2012-02-22	2012-02-22	2012-02-22	ENSG00000072182	ENSG00000072182		"""Ion channels / Acid-sensing (proton-gated) ion channels"""	21263	protein-coding gene	gene with protein product		606715	"""amiloride-sensitive cation channel 4, pituitary"", ""amiloride-sensitive cation channel family member 4, pituitary"""	ACCN4		10852210	Standard	NM_182847		Approved	BNAC4	uc002vma.3	Q96FT7	OTTHUMG00000058928	ENST00000347842.3:c.1136G>C	2.37:g.220396750G>C	ENSP00000326627:p.Arg379Pro		Q53SB7|Q6GMS1|Q6PIN9|Q9NQA4	Missense_Mutation	SNP	pfam_Na+channel_ASC,prints_Na+channel_ASC	p.R379P	ENST00000347842.3	37	c.1136	CCDS2442.1	2	.	.	.	.	.	.	.	.	.	.	G	20.3	3.960573	0.74016	.	.	ENSG00000072182	ENST00000347842;ENST00000358078	T;T	0.66460	-0.21;-0.21	3.8	3.8	0.43715	.	0.000000	0.64402	D	0.000001	T	0.81273	0.4788	M	0.82630	2.6	0.54753	D	0.999984	D;D;D	0.67145	0.988;0.992;0.996	P;D;P	0.64237	0.831;0.923;0.805	D	0.85531	0.1209	10	0.87932	D	0	-18.7352	15.8578	0.78994	0.0:0.0:1.0:0.0	.	379;379;379	Q96FT7;Q96FT7-4;Q96FT7-2	ACCN4_HUMAN;.;.	P	379	ENSP00000326627:R379P;ENSP00000350786:R379P	ENSP00000326627:R379P	R	+	2	0	ACCN4	220104994	1.000000	0.71417	0.999000	0.59377	0.885000	0.51271	3.339000	0.52135	2.152000	0.67230	0.561000	0.74099	CGG	ASIC4	-	pfam_Na+channel_ASC	ENSG00000072182		0.632	ASIC4-001	KNOWN	basic|CCDS	protein_coding	ASIC4	HGNC	protein_coding	OTTHUMT00000130263.1	-	0.00	18	0	G	NM_018674		220396750	+1	tier1	-	no_errors	ENST00000347842	ensembl	human	known	74_37	missense	76.00	6	19	SNP	1.000	C
ATP10D	57205	genome.wustl.edu	37	4	47589054	47589054	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr4:47589054G>T	ENST00000273859.3	+	22	4041	c.3772G>T	c.(3772-3774)Gtc>Ttc	p.V1258F		NM_020453.3	NP_065186.3	Q9P241	AT10D_HUMAN	ATPase, class V, type 10D	1258					cation transport (GO:0006812)|ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(2)|endometrium(5)|kidney(5)|large_intestine(14)|liver(2)|lung(26)|ovary(2)|pancreas(1)|prostate(5)|skin(2)|stomach(1)|urinary_tract(1)	66						TCACTTGCTGGTCATCATTGG	0.418																																																	0													246.0	207.0	220.0					4																	47589054		2203	4300	6503	SO:0001583	missense	0			AB040920	CCDS3476.1	4p12	2010-04-20	2007-09-19		ENSG00000145246	ENSG00000145246		"""ATPases / P-type"""	13549	protein-coding gene	gene with protein product			"""ATPase, Class V, type 10D"""			12532265	Standard	NM_020453		Approved	ATPVD, KIAA1487	uc003gxk.1	Q9P241	OTTHUMG00000160784	ENST00000273859.3:c.3772G>T	4.37:g.47589054G>T	ENSP00000273859:p.Val1258Phe		A2RRC8|D6REN2|Q8NC70|Q96SR3	Missense_Mutation	SNP	pfam_ATPase_P-typ_transduc_dom_A,pfam_HAD-like_dom,superfamily_HAD-like_dom,superfamily_ATPase_P-typ_cyto_domN,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Plipid-transp,tigrfam_Cation_transp_P_typ_ATPase	p.V1258F	ENST00000273859.3	37	c.3772	CCDS3476.1	4	.	.	.	.	.	.	.	.	.	.	G	8.148	0.786721	0.16189	.	.	ENSG00000145246	ENST00000273859	D	0.86230	-2.09	5.11	5.11	0.69529	.	0.000000	0.85682	D	0.000000	T	0.81894	0.4919	L	0.28400	0.85	0.80722	D	1	B	0.15930	0.015	B	0.20767	0.031	T	0.76069	-0.3094	10	0.33940	T	0.23	-13.1112	17.7053	0.88308	0.0:0.0:1.0:0.0	.	1258	Q9P241	AT10D_HUMAN	F	1258	ENSP00000273859:V1258F	ENSP00000273859:V1258F	V	+	1	0	ATP10D	47283811	0.943000	0.32029	1.000000	0.80357	0.202000	0.24057	1.621000	0.36986	2.665000	0.90641	0.655000	0.94253	GTC	ATP10D	-	tigrfam_ATPase_P-typ_Plipid-transp	ENSG00000145246		0.418	ATP10D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP10D	HGNC	protein_coding	OTTHUMT00000216900.1	-	0.00	66	0	G	NM_020453		47589054	+1	tier1	-	no_errors	ENST00000273859	ensembl	human	known	74_37	missense	36.43	82	47	SNP	1.000	T
AZU1	566	genome.wustl.edu	37	19	828365	828365	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr19:828365C>T	ENST00000233997.2	+	2	215	c.194C>T	c.(193-195)gCg>gTg	p.A65V		NM_001700.3	NP_001691.1	P20160	CAP7_HUMAN	azurocidin 1	65	Hydrophobic.|Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.|Possesses antibiotic activity.				cellular extravasation (GO:0045123)|defense response to Gram-negative bacterium (GO:0050829)|glial cell migration (GO:0008347)|induction of positive chemotaxis (GO:0050930)|inflammatory response (GO:0006954)|macrophage chemotaxis (GO:0048246)|microglial cell activation (GO:0001774)|monocyte activation (GO:0042117)|negative regulation of apoptotic process (GO:0043066)|positive regulation of cell adhesion (GO:0045785)|positive regulation of fractalkine biosynthetic process (GO:0050754)|positive regulation of interleukin-1 beta biosynthetic process (GO:0050725)|positive regulation of MHC class II biosynthetic process (GO:0045348)|positive regulation of phagocytosis (GO:0050766)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of vascular permeability (GO:0043114)	azurophil granule (GO:0042582)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	heparin binding (GO:0008201)|serine-type endopeptidase activity (GO:0004252)|toxic substance binding (GO:0015643)			NS(1)|endometrium(1)|kidney(1)|lung(4)|pancreas(1)|upper_aerodigestive_tract(2)	10		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;6.59e-06)|all_lung(49;9.97e-06)|Breast(49;0.000172)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GTGATGACCGCGGCCAGCTGC	0.657																																																	0													35.0	41.0	39.0					19																	828365		2200	4293	6493	SO:0001583	missense	0			X58794	CCDS12044.1	19p13.3	2012-03-30	2008-08-01		ENSG00000172232	ENSG00000172232			913	protein-coding gene	gene with protein product	"""cationic antimicrobial protein 37"", ""heparin-binding protein"", ""neutrophil azurocidin"""	162815				1919011	Standard	NM_001700		Approved	AZU, CAP37, AZAMP, HBP, NAZC, HUMAZUR	uc002lpz.1	P20160		ENST00000233997.2:c.194C>T	19.37:g.828365C>T	ENSP00000233997:p.Ala65Val		P80014|Q52LG4|Q9UCM1|Q9UCT5	Missense_Mutation	SNP	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1,prints_Peptidase_S1A	p.A65V	ENST00000233997.2	37	c.194	CCDS12044.1	19	.	.	.	.	.	.	.	.	.	.	C	15.14	2.744795	0.49151	.	.	ENSG00000172232	ENST00000334630;ENST00000233997	D	0.95238	-3.65	2.4	2.4	0.29515	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	.	.	.	.	D	0.97898	0.9309	H	0.97240	3.965	0.09310	N	1	D	0.89917	1.0	D	0.97110	1.0	D	0.91243	0.5023	9	0.62326	D	0.03	.	8.2927	0.31967	0.0:1.0:0.0:0.0	.	65	P20160	CAP7_HUMAN	V	79;65	ENSP00000233997:A65V	ENSP00000233997:A65V	A	+	2	0	AZU1	779365	0.074000	0.21230	0.009000	0.14445	0.035000	0.12851	1.349000	0.33998	1.344000	0.45657	0.511000	0.50034	GCG	AZU1	-	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1,prints_Peptidase_S1A	ENSG00000172232		0.657	AZU1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AZU1	HGNC	protein_coding	OTTHUMT00000457472.2	-	0.00	12	0	C	NM_001700		828365	+1	tier1	-	no_errors	ENST00000233997	ensembl	human	known	74_37	missense	73.33	4	11	SNP	0.009	T
BAZ2A	11176	genome.wustl.edu	37	12	56994255	56994255	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr12:56994255G>A	ENST00000551812.1	-	24	4821	c.4628C>T	c.(4627-4629)cCa>cTa	p.P1543L	BAZ2A_ENST00000553222.1_5'UTR|BAZ2A_ENST00000179765.5_Missense_Mutation_p.P1511L|BAZ2A_ENST00000549884.1_Missense_Mutation_p.P1541L|BAZ2A_ENST00000379441.3_Missense_Mutation_p.P1513L	NM_013449.3	NP_038477.2	Q9UIF9	BAZ2A_HUMAN	bromodomain adjacent to zinc finger domain, 2A	1543					chromatin remodeling (GO:0006338)|chromatin silencing at rDNA (GO:0000183)|DNA methylation (GO:0006306)|heterochromatin assembly involved in chromatin silencing (GO:0070869)|histone deacetylation (GO:0016575)|histone H3-K9 methylation (GO:0051567)|histone H4 deacetylation (GO:0070933)|histone H4-K20 methylation (GO:0034770)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	chromatin silencing complex (GO:0005677)|nucleolus (GO:0005730)|rDNA heterochromatin (GO:0033553)	DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|lysine-acetylated histone binding (GO:0070577)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			breast(1)|cervix(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(15)|urinary_tract(1)	31						GGTAGAGTCTGGGCTAGGACA	0.502																																																	0													65.0	64.0	64.0					12																	56994255		1908	4118	6026	SO:0001583	missense	0			AB032254	CCDS44924.1, CCDS73483.1	12q13.3	2013-01-28				ENSG00000076108		"""Zinc fingers, PHD-type"""	962	protein-coding gene	gene with protein product	"""TTF-I interacting peptide 5"""	605682				10662543, 11532953	Standard	XM_005268596		Approved	KIAA0314, TIP5, WALp3	uc001slq.1	Q9UIF9	OTTHUMG00000170332	ENST00000551812.1:c.4628C>T	12.37:g.56994255G>A	ENSP00000446880:p.Pro1543Leu		B3KN66|O00536|O15030|Q68DI8|Q96H26	Missense_Mutation	SNP	pfam_Bromodomain,pfam_Methyl_CpG_DNA-bd,pfam_DDT_dom,pfam_Znf_PHD-finger,superfamily_Bromodomain,superfamily_DNA-bd_dom,superfamily_Znf_FYVE_PHD,smart_Methyl_CpG_DNA-bd,smart_AT_hook_DNA-bd_motif,smart_DDT_dom_subgr,smart_Znf_PHD,smart_Bromodomain,pfscan_Methyl_CpG_DNA-bd,pfscan_Znf_PHD-finger,pfscan_DDT_dom_superfamily,pfscan_Bromodomain,prints_Bromodomain	p.P1543L	ENST00000551812.1	37	c.4628	CCDS44924.1	12	.	.	.	.	.	.	.	.	.	.	G	17.56	3.420521	0.62622	.	.	ENSG00000076108	ENST00000379441;ENST00000179765;ENST00000551812;ENST00000549787;ENST00000549884	T;T;T;T;T	0.73897	-0.54;-0.54;-0.59;-0.79;-0.59	5.11	5.11	0.69529	.	0.000000	0.85682	D	0.000000	D	0.85159	0.5633	M	0.65498	2.005	0.80722	D	1	B;B;B;D	0.89917	0.181;0.04;0.023;1.0	B;B;B;D	0.91635	0.074;0.037;0.024;0.999	D	0.85354	0.1103	10	0.56958	D	0.05	-0.053	17.8567	0.88765	0.0:0.0:1.0:0.0	.	1541;1539;1543;1516	F8VU39;Q9UIF9-3;Q9UIF9;Q9UIF9-2	.;.;BAZ2A_HUMAN;.	L	1513;1511;1543;475;1541	ENSP00000368754:P1513L;ENSP00000179765:P1511L;ENSP00000446880:P1543L;ENSP00000448760:P475L;ENSP00000447941:P1541L	ENSP00000179765:P1511L	P	-	2	0	BAZ2A	55280522	1.000000	0.71417	0.999000	0.59377	0.492000	0.33523	4.988000	0.63863	2.832000	0.97577	0.655000	0.94253	CCA	BAZ2A	-	NULL	ENSG00000076108		0.502	BAZ2A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BAZ2A	HGNC	protein_coding	OTTHUMT00000408561.1	-	0.00	24	0	G	NM_013449		56994255	-1	tier1	-	no_errors	ENST00000551812	ensembl	human	known	74_37	missense	65.79	13	25	SNP	1.000	A
BOD1L1	259282	genome.wustl.edu	37	4	13601756	13601756	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr4:13601756G>C	ENST00000040738.5	-	10	6903	c.6768C>G	c.(6766-6768)atC>atG	p.I2256M		NM_148894.2	NP_683692.2	Q8NFC6	BD1L1_HUMAN	biorientation of chromosomes in cell division 1-like 1	2256						nucleus (GO:0005634)	DNA binding (GO:0003677)										AGCTCGTAGAGATGATGCCAC	0.532																																																	0													87.0	75.0	79.0					4																	13601756		2203	4300	6503	SO:0001583	missense	0			AF528529	CCDS3411.2	4p16.1	2012-04-10	2012-04-10	2012-04-10	ENSG00000038219	ENSG00000038219			31792	protein-coding gene	gene with protein product			"""family with sequence similarity 44, member A"", ""biorientation of chromosomes in cell division 1-like"""	FAM44A, BOD1L			Standard	XM_005248150		Approved	FLJ33215, KIAA1327	uc003gmz.1	Q8NFC6	OTTHUMG00000090659	ENST00000040738.5:c.6768C>G	4.37:g.13601756G>C	ENSP00000040738:p.Ile2256Met		Q6P0M8|Q96AL1|Q9H6G0|Q9NTD6|Q9P2L9	Missense_Mutation	SNP	NULL	p.I2256M	ENST00000040738.5	37	c.6768	CCDS3411.2	4	.	.	.	.	.	.	.	.	.	.	G	16.42	3.117482	0.56505	.	.	ENSG00000038219	ENST00000040738	T	0.16897	2.31	5.46	4.62	0.57501	.	0.000000	0.52532	D	0.000067	T	0.34774	0.0909	M	0.62723	1.935	0.34483	D	0.704062	D	0.89917	1.0	D	0.70716	0.97	T	0.49818	-0.8899	10	0.52906	T	0.07	-5.1173	9.441	0.38668	0.0743:0.0:0.7835:0.1422	.	2256	Q8NFC6	BOD1L_HUMAN	M	2256	ENSP00000040738:I2256M	ENSP00000040738:I2256M	I	-	3	3	BOD1L	13210854	1.000000	0.71417	0.994000	0.49952	0.726000	0.41606	2.049000	0.41288	1.303000	0.44873	0.650000	0.86243	ATC	BOD1L1	-	NULL	ENSG00000038219		0.532	BOD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BOD1L1	HGNC	protein_coding	OTTHUMT00000207321.1	-	0.00	40	0	G	NM_148894		13601756	-1	tier1	-	no_errors	ENST00000040738	ensembl	human	known	74_37	missense	31.37	35	16	SNP	1.000	C
C10orf115	387642	genome.wustl.edu	37	10	23512720	23512720	+	Missense_Mutation	SNP	T	T	C			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr10:23512720T>C	ENST00000376501.5	-	2	115	c.94A>G	c.(94-96)Aga>Gga	p.R32G						chromosome 10 open reading frame 115																		ATGGTCGTTCTAGACTGCACT	0.308																																																	0																																										SO:0001583	missense	0					10p12.2	2013-01-15			ENSG00000204566	ENSG00000204566			31449	other	unknown							Standard	NR_103721		Approved	bA215C7.4		Q5QP74	OTTHUMG00000017814	ENST00000376501.5:c.94A>G	10.37:g.23512720T>C	ENSP00000365684:p.Arg32Gly			Missense_Mutation	SNP	NULL	p.R32G	ENST00000376501.5	37	c.94		10	.	.	.	.	.	.	.	.	.	.	T	8.771	0.925899	0.18056	.	.	ENSG00000204566	ENST00000399806;ENST00000376501	.	.	.	4.2	4.2	0.49525	.	.	.	.	.	T	0.56601	0.1996	.	.	.	0.23933	N	0.996424	.	.	.	.	.	.	T	0.67845	-0.5565	4	0.48119	T	0.1	.	9.9618	0.41701	0.0:0.0:0.0:1.0	.	.	.	.	G	32	.	ENSP00000365684:R32G	R	-	1	2	C10orf115	23552726	0.013000	0.17824	0.037000	0.18230	0.186000	0.23388	0.508000	0.22692	2.124000	0.65301	0.533000	0.62120	AGA	C10orf115	-	NULL	ENSG00000204566		0.308	C10orf115-001	KNOWN	basic|appris_principal	protein_coding	C10orf115	HGNC	protein_coding	OTTHUMT00000047209.2	-	0.00	30	0	T			23512720	-1	tier1	-	no_errors	ENST00000376501	ensembl	human	known	74_37	missense	57.69	22	30	SNP	0.045	C
C10orf53	282966	genome.wustl.edu	37	10	50916563	50916563	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr10:50916563C>T	ENST00000374112.3	+	3	386	c.374C>T	c.(373-375)tCa>tTa	p.S125L	C10orf53_ENST00000535836.1_Missense_Mutation_p.S125L	NM_182554.2	NP_872360.2	Q8N6V4	CJ053_HUMAN	chromosome 10 open reading frame 53	0										endometrium(1)|lung(6)	7		all_neural(218;0.107)				cagattggatcatgtatccat	0.493																																																	0													157.0	153.0	154.0					10																	50916563		2203	4300	6503	SO:0001583	missense	0			BC028127	CCDS31202.1, CCDS41521.1	10q11.23	2012-05-24			ENSG00000178645	ENSG00000178645			27421	protein-coding gene	gene with protein product						12477932	Standard	NM_182554		Approved	Em:AC069546.1	uc001jid.1	Q8N6V4	OTTHUMG00000018199	ENST00000374112.3:c.374C>T	10.37:g.50916563C>T	ENSP00000363226:p.Ser125Leu		A6NI81|A6NLE0|B9ZVK6	Missense_Mutation	SNP	NULL	p.S125L	ENST00000374112.3	37	c.374	CCDS31202.1	10	.	.	.	.	.	.	.	.	.	.	C	10.95	1.496355	0.26861	.	.	ENSG00000178645	ENST00000374112;ENST00000535836	.	.	.	1.65	1.65	0.23941	.	.	.	.	.	T	0.17066	0.0410	N	0.08118	0	0.09310	N	1	B	0.31548	0.328	B	0.26094	0.066	T	0.15235	-1.0444	8	0.87932	D	0	.	6.7374	0.23417	0.0:1.0:0.0:0.0	.	125	B9ZVK6	.	L	125	.	ENSP00000363226:S125L	S	+	2	0	C10orf53	50586569	0.002000	0.14202	0.009000	0.14445	0.098000	0.18820	-0.031000	0.12287	1.229000	0.43630	0.491000	0.48974	TCA	C10orf53	-	NULL	ENSG00000178645		0.493	C10orf53-003	KNOWN	basic|CCDS	protein_coding	C10orf53	HGNC	protein_coding	OTTHUMT00000048006.1	-	0.00	90	0	C	NM_182554		50916563	+1	tier1	-	no_errors	ENST00000374112	ensembl	human	known	74_37	missense	16.06	162	31	SNP	0.010	T
C14orf37	145407	genome.wustl.edu	37	14	58604834	58604834	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr14:58604834G>T	ENST00000267485.7	-	2	1437	c.1243C>A	c.(1243-1245)Ctc>Atc	p.L415I	C14orf37_ENST00000334342.5_5'UTR	NM_001001872.2	NP_001001872.2	Q86TY3	CN037_HUMAN	chromosome 14 open reading frame 37	415						integral component of membrane (GO:0016021)				breast(7)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(16)|pancreas(1)|skin(1)	33						GTACTTTGGAGCAAGTTCACA	0.443																																																	0													91.0	87.0	88.0					14																	58604834		2203	4300	6503	SO:0001583	missense	0				CCDS32089.1	14q23.1	2012-09-03			ENSG00000139971	ENSG00000139971			19846	protein-coding gene	gene with protein product							Standard	NM_001001872		Approved		uc001xdc.3	Q86TY3	OTTHUMG00000171173	ENST00000267485.7:c.1243C>A	14.37:g.58604834G>T	ENSP00000267485:p.Leu415Ile		A8K8Z8|Q6P5Q1|Q86TY1	Missense_Mutation	SNP	NULL	p.L415I	ENST00000267485.7	37	c.1243	CCDS32089.1	14	.	.	.	.	.	.	.	.	.	.	G	11.94	1.787520	0.31593	.	.	ENSG00000139971	ENST00000267485;ENST00000438670	T	0.21734	1.99	5.86	1.98	0.26296	.	0.662303	0.15063	N	0.282621	T	0.12135	0.0295	L	0.34521	1.04	0.09310	N	1	B;B;B;B	0.33171	0.137;0.4;0.137;0.137	B;B;B;B	0.26969	0.052;0.075;0.052;0.052	T	0.20505	-1.0273	10	0.35671	T	0.21	-1.3619	4.7747	0.13173	0.4693:0.3364:0.1943:0.0	.	453;415;415;415	B4DMS4;Q86TY3-2;A8K990;Q86TY3	.;.;.;CN037_HUMAN	I	415;453	ENSP00000267485:L415I	ENSP00000267485:L415I	L	-	1	0	C14orf37	57674587	0.000000	0.05858	0.015000	0.15790	0.422000	0.31414	0.036000	0.13819	0.084000	0.17077	-0.345000	0.07892	CTC	C14orf37	-	NULL	ENSG00000139971		0.443	C14orf37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C14orf37	HGNC	protein_coding	OTTHUMT00000412059.1	-	0.00	53	0	G	NM_001001872		58604834	-1	tier1	-	no_errors	ENST00000267485	ensembl	human	known	74_37	missense	8.51	43	4	SNP	0.003	T
C17orf50	146853	genome.wustl.edu	37	17	34091541	34091541	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr17:34091541G>C	ENST00000285023.4	+	3	461	c.429G>C	c.(427-429)aaG>aaC	p.K143N	C17orf50_ENST00000586491.1_Missense_Mutation_p.E114Q|C17orf50_ENST00000588628.1_Missense_Mutation_p.E151Q	NM_145272.3	NP_660315.2	Q8WW18	CQ050_HUMAN	chromosome 17 open reading frame 50	143													Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		TCTTCTGCAAGAAATGCAGGA	0.682																																																	0													10.0	13.0	12.0					17																	34091541		1943	4132	6075	SO:0001583	missense	0			BC021727	CCDS42298.1	17q12	2014-05-06			ENSG00000154768	ENSG00000270806			29581	protein-coding gene	gene with protein product							Standard	NM_145272		Approved		uc002hjx.3	Q8WW18	OTTHUMG00000188389	ENST00000285023.4:c.429G>C	17.37:g.34091541G>C	ENSP00000285023:p.Lys143Asn		Q6Q621	Missense_Mutation	SNP	NULL	p.K143N	ENST00000285023.4	37	c.429	CCDS42298.1	17	.	.	.	.	.	.	.	.	.	.	G	17.13	3.309624	0.60414	.	.	ENSG00000154768	ENST00000285023	T	0.57107	0.42	5.05	3.04	0.35103	.	0.275582	0.25750	N	0.028548	T	0.37046	0.0989	L	0.29908	0.895	0.31371	N	0.680163	P	0.34639	0.461	B	0.34873	0.191	T	0.45425	-0.9262	10	0.72032	D	0.01	-47.3604	6.2083	0.20615	0.0936:0.0:0.7232:0.1832	.	143	Q8WW18	CQ050_HUMAN	N	143	ENSP00000285023:K143N	ENSP00000285023:K143N	K	+	3	2	C17orf50	31115654	1.000000	0.71417	1.000000	0.80357	0.351000	0.29236	2.138000	0.42140	0.692000	0.31613	-0.145000	0.13849	AAG	C17orf50	-	NULL	ENSG00000154768		0.682	C17orf50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C17orf50	HGNC	protein_coding	OTTHUMT00000449132.1	-	0.00	25	0	G	NM_145272		34091541	+1	tier1	-	no_errors	ENST00000285023	ensembl	human	known	74_37	missense	29.63	19	8	SNP	1.000	C
C20orf27	54976	genome.wustl.edu	37	20	3734755	3734755	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr20:3734755C>A	ENST00000379772.3	-	6	1285	c.475G>T	c.(475-477)Gcc>Tcc	p.A159S	C20orf27_ENST00000217195.8_Missense_Mutation_p.A184S	NM_001258429.1	NP_001245358.1	Q9GZN8	CT027_HUMAN	chromosome 20 open reading frame 27	159										central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|lung(4)|urinary_tract(1)	7						TCCAGCTCGGCGCCCACACAC	0.682																																																	0													55.0	44.0	48.0					20																	3734755		2203	4300	6503	SO:0001583	missense	0			AK000557	CCDS33436.1, CCDS58763.1	20p13	2011-01-25			ENSG00000101220	ENSG00000101220			15873	protein-coding gene	gene with protein product	"""hypothetical protein LOC54976"""					11780052	Standard	NM_001258429		Approved	FLJ20550	uc002wjh.2	Q9GZN8	OTTHUMG00000031753	ENST00000379772.3:c.475G>T	20.37:g.3734755C>A	ENSP00000369097:p.Ala159Ser		A8K4J0|D3DVX8|Q5JX81|Q9NWX3	Missense_Mutation	SNP	NULL	p.A184S	ENST00000379772.3	37	c.550	CCDS58763.1	20	.	.	.	.	.	.	.	.	.	.	C	19.10	3.761617	0.69763	.	.	ENSG00000101220	ENST00000379772;ENST00000217195;ENST00000399672;ENST00000379765	.	.	.	5.14	5.14	0.70334	.	.	.	.	.	T	0.47358	0.1441	L	0.44542	1.39	0.38372	D	0.944905	P;P	0.48640	0.67;0.913	B;P	0.44623	0.233;0.455	T	0.54912	-0.8222	8	0.66056	D	0.02	-5.5331	9.4974	0.38997	0.0:0.907:0.0:0.093	.	159;184	Q9GZN8;Q9GZN8-2	CT027_HUMAN;.	S	159;184;159;118	.	ENSP00000217195:A184S	A	-	1	0	C20orf27	3682755	0.955000	0.32602	0.974000	0.42286	0.997000	0.91878	2.312000	0.43726	2.666000	0.90696	0.655000	0.94253	GCC	C20orf27	-	NULL	ENSG00000101220		0.682	C20orf27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C20orf27	HGNC	protein_coding	OTTHUMT00000077750.2	-	0.00	15	0	C	NM_001039140		3734755	-1	tier1	-	no_errors	ENST00000217195	ensembl	human	known	74_37	missense	60.00	4	6	SNP	0.997	A
CAPRIN2	65981	genome.wustl.edu	37	12	30873757	30873757	+	Silent	SNP	T	T	A			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr12:30873757T>A	ENST00000298892.5	-	12	2886	c.2136A>T	c.(2134-2136)tcA>tcT	p.S712S	CAPRIN2_ENST00000251071.5_Silent_p.S712S|CAPRIN2_ENST00000395805.2_Intron|CAPRIN2_ENST00000308433.5_Silent_p.S379S|CAPRIN2_ENST00000417045.1_Silent_p.S712S	NM_023925.3	NP_076414.2			caprin family member 2											breast(1)|central_nervous_system(1)|endometrium(8)|kidney(4)|large_intestine(13)|lung(16)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	48	all_lung(12;1.13e-09)|Lung NSC(12;7.98e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0355)|Lung SC(12;0.0905)|Esophageal squamous(101;0.233)					CAGGAGTCTCTGAGGTCATAA	0.378																																																	0													87.0	90.0	89.0					12																	30873757		2203	4300	6503	SO:0001819	synonymous_variant	0			AY074491	CCDS8720.1, CCDS41766.1, CCDS41766.2, CCDS55816.1	12p11	2010-08-03	2007-03-27	2007-03-27	ENSG00000110888	ENSG00000110888			21259	protein-coding gene	gene with protein product		610375	"""C1q domain containing 1"""	C1QDC1		11347906, 14764709	Standard	NM_001002259		Approved	EEG1, FLJ22569, FLJ11391, caprin-2, RNG140	uc001rji.1	Q6IMN6	OTTHUMG00000169185	ENST00000298892.5:c.2136A>T	12.37:g.30873757T>A				Silent	SNP	pfam_Caprin-1_C,pfam_C1q,superfamily_Tumour_necrosis_fac-like_dom,smart_C1q,pfscan_C1q,prints_C1q	p.S712	ENST00000298892.5	37	c.2136	CCDS8720.1	12																																																																																			CAPRIN2	-	pfam_Caprin-1_C	ENSG00000110888		0.378	CAPRIN2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CAPRIN2	HGNC	protein_coding	OTTHUMT00000402778.1	-	0.00	25	0	T	NM_023925		30873757	-1	tier1	-	no_errors	ENST00000251071	ensembl	human	known	74_37	silent	23.08	30	9	SNP	0.998	A
CCDC22	28952	genome.wustl.edu	37	X	49093493	49093493	+	Intron	SNP	G	G	C			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chrX:49093493G>C	ENST00000376227.3	+	2	220				CCDC22_ENST00000496651.1_Intron	NM_014008.3	NP_054727.1	O60826	CCD22_HUMAN	coiled-coil domain containing 22											NS(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(5)|prostate(2)|skin(1)	18						AAGGCTGCAGGGCTCAGCCTG	0.547																																																	0																																										SO:0001627	intron_variant	0			BC000972	CCDS14322.1	Xp11.23	2008-02-05	2005-07-24	2005-07-24	ENSG00000101997	ENSG00000101997			28909	protein-coding gene	gene with protein product		300859	"""chromosome X open reading frame 37"""	CXorf37		12477932	Standard	NM_014008		Approved	JM1	uc004dnd.2	O60826	OTTHUMG00000024141	ENST00000376227.3:c.51-60G>C	X.37:g.49093493G>C			A8K7G1	RNA	SNP	-	NULL	ENST00000376227.3	37	NULL	CCDS14322.1	X																																																																																			CCDC22	-	-	ENSG00000101997		0.547	CCDC22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC22	HGNC	protein_coding	OTTHUMT00000060822.1	-	0.00	18	0	G	NM_014008		49093493	+1	tier1	-	no_errors	ENST00000490300	ensembl	human	known	74_37	rna	27.91	31	12	SNP	0.000	C
CCDC58	131076	genome.wustl.edu	37	3	122087027	122087027	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr3:122087027G>T	ENST00000291458.5	-	3	326	c.320C>A	c.(319-321)aCa>aAa	p.T107K	CCDC58_ENST00000479899.1_Missense_Mutation_p.T93K|CCDC58_ENST00000497726.1_Intron|CCDC58_ENST00000466854.1_5'Flank	NM_001017928.2	NP_001017928.1	Q4VC31	CCD58_HUMAN	coiled-coil domain containing 58	107						mitochondrion (GO:0005739)				large_intestine(1)|lung(1)	2				GBM - Glioblastoma multiforme(114;0.148)		ACTTACCTTTGTCTGCTCTTT	0.318																																																	0													100.0	101.0	101.0					3																	122087027		2202	4298	6500	SO:0001583	missense	0			AK090592	CCDS33838.1	3q21.1	2006-01-17			ENSG00000160124	ENSG00000160124			31136	protein-coding gene	gene with protein product							Standard	XM_005247108		Approved	FLJ33273	uc003eey.3	Q4VC31	OTTHUMG00000159490	ENST00000291458.5:c.320C>A	3.37:g.122087027G>T	ENSP00000291458:p.Thr107Lys		Q32LY6	Missense_Mutation	SNP	pfam_Caffeine_induced_death_Cid2	p.T107K	ENST00000291458.5	37	c.320	CCDS33838.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	24.2|24.2	4.505762|4.505762	0.85282|0.85282	.|.	.|.	ENSG00000160124|ENSG00000160124	ENST00000479414|ENST00000291458;ENST00000479899	.|.	.|.	.|.	5.17|5.17	5.17|5.17	0.71159|0.71159	.|.	.|0.046783	.|0.85682	.|D	.|0.000000	T|T	0.72550|0.72550	0.3474|0.3474	M|M	0.78801|0.78801	2.425|2.425	0.53688|0.53688	D|D	0.999977|0.999977	.|D	.|0.54772	.|0.968	.|P	.|0.50314	.|0.637	T|T	0.76008|0.76008	-0.3116|-0.3116	5|9	.|0.52906	.|T	.|0.07	.|.	17.846|17.846	0.88730|0.88730	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|107	.|Q4VC31	.|CCD58_HUMAN	E|K	103|107;93	.|.	.|ENSP00000291458:T107K	D|T	-|-	3|2	2|0	CCDC58|CCDC58	123569717|123569717	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	8.696000|8.696000	0.91302|0.91302	2.692000|2.692000	0.91855|0.91855	0.655000|0.655000	0.94253|0.94253	GAC|ACA	CCDC58	-	pfam_Caffeine_induced_death_Cid2	ENSG00000160124		0.318	CCDC58-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC58	HGNC	protein_coding	OTTHUMT00000355754.1	-	0.00	22	0	G	NM_001017928		122087027	-1	tier1	-	no_errors	ENST00000291458	ensembl	human	known	74_37	missense	23.08	50	15	SNP	1.000	T
CCDC37	348807	genome.wustl.edu	37	3	126137616	126137616	+	Splice_Site	SNP	G	G	T			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr3:126137616G>T	ENST00000352312.1	+	7	748	c.649G>T	c.(649-651)Gcg>Tcg	p.A217S	CCDC37_ENST00000393425.1_Splice_Site_p.A218S|CCDC37_ENST00000505024.1_Splice_Site_p.A218S	NM_182628.2	NP_872434.2	Q494V2	CCD37_HUMAN	coiled-coil domain containing 37	217										NS(1)|autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(5)|ovary(1)|skin(3)	23				GBM - Glioblastoma multiforme(114;0.166)		GGCCATGAGAGCGTGAGCCTG	0.667																																																	0																																										SO:0001630	splice_region_variant	0			AK097402	CCDS3037.1	3q21.2	2014-07-31			ENSG00000163885	ENSG00000163885			26842	protein-coding gene	gene with protein product						23569216	Standard	NM_182628		Approved	FLJ40083, MIA1	uc003eiu.1	Q494V2	OTTHUMG00000162691	ENST00000352312.1:c.650+1G>T	3.37:g.126137616G>T			D3DNA8|Q494V1|Q494V4|Q8N838	Missense_Mutation	SNP	superfamily_SuperAg_toxin_C	p.A218S	ENST00000352312.1	37	c.652	CCDS3037.1	3	.	.	.	.	.	.	.	.	.	.	G	7.218	0.596881	0.13875	.	.	ENSG00000163885	ENST00000352312;ENST00000393425;ENST00000505024	T;T;T	0.16743	2.32;2.32;2.32	5.09	-7.49	0.01355	.	1.763500	0.02520	N	0.092454	T	0.12135	0.0295	L	0.42245	1.32	0.09310	N	1	B;B	0.20164	0.034;0.042	B;B	0.18871	0.014;0.023	T	0.27606	-1.0069	10	0.09338	T	0.73	-0.0075	8.7281	0.34483	0.3968:0.4653:0.138:0.0	.	218;217	Q494V2-2;Q494V2	.;CCD37_HUMAN	S	217;218;218	ENSP00000344749:A217S;ENSP00000377076:A218S;ENSP00000423046:A218S	ENSP00000344749:A217S	A	+	1	0	CCDC37	127620306	0.001000	0.12720	0.000000	0.03702	0.006000	0.05464	-0.043000	0.12043	-1.433000	0.01977	-0.339000	0.08088	GCG	CCDC37	-	NULL	ENSG00000163885		0.667	CCDC37-001	KNOWN	basic|appris_candidate|exp_conf|CCDS	protein_coding	CCDC37	HGNC	protein_coding	OTTHUMT00000370099.4	-	0.00	44	0	G	NM_182628	Missense_Mutation	126137616	+1	tier1	-	no_errors	ENST00000393425	ensembl	human	known	74_37	missense	14.08	61	10	SNP	0.000	T
CCDC64B	146439	genome.wustl.edu	37	16	3079364	3079364	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr16:3079364C>G	ENST00000572449.1	-	7	1086	c.1024G>C	c.(1024-1026)Gag>Cag	p.E342Q	CCDC64B_ENST00000389347.4_Missense_Mutation_p.E342Q|CCDC64B_ENST00000573514.1_Missense_Mutation_p.E135Q			A1A5D9	BICR2_HUMAN	coiled-coil domain containing 64B	342										breast(1)|endometrium(2)|large_intestine(1)	4						TTGGGGGGCTCTAAGATCTCT	0.607																																																	0													40.0	39.0	39.0					16																	3079364		1963	4142	6105	SO:0001583	missense	0			BC128602	CCDS45393.1	16p13.3	2008-07-04				ENSG00000162069			33584	protein-coding gene	gene with protein product							Standard	NM_001103175		Approved		uc002ctf.4	A1A5D9		ENST00000572449.1:c.1024G>C	16.37:g.3079364C>G	ENSP00000459043:p.Glu342Gln		Q658L9	Missense_Mutation	SNP	superfamily_Sig_transdc_His_kinase_dimeric	p.E342Q	ENST00000572449.1	37	c.1024	CCDS45393.1	16	.	.	.	.	.	.	.	.	.	.	C	16.07	3.017779	0.54576	.	.	ENSG00000162069	ENST00000389347	T	0.33865	1.39	4.44	4.44	0.53790	.	0.324362	0.28016	N	0.016926	T	0.52289	0.1725	L	0.57536	1.79	0.38672	D	0.952339	D	0.76494	0.999	D	0.66351	0.943	T	0.56860	-0.7909	10	0.54805	T	0.06	-28.1477	12.4271	0.55553	0.0:1.0:0.0:0.0	.	342	A1A5D9	BICR2_HUMAN	Q	342	ENSP00000373998:E342Q	ENSP00000373998:E342Q	E	-	1	0	CCDC64B	3019365	1.000000	0.71417	1.000000	0.80357	0.180000	0.23129	3.692000	0.54727	2.313000	0.78055	0.561000	0.74099	GAG	CCDC64B	-	NULL	ENSG00000162069		0.607	CCDC64B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC64B	HGNC	protein_coding	OTTHUMT00000436991.1	-	0.00	30	0	C			3079364	-1	tier1	-	no_errors	ENST00000389347	ensembl	human	known	74_37	missense	46.67	8	7	SNP	1.000	G
CD34	947	genome.wustl.edu	37	1	208070876	208070876	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr1:208070876G>C	ENST00000310833.7	-	4	880	c.559C>G	c.(559-561)Cag>Gag	p.Q187E	CD34_ENST00000537704.1_Missense_Mutation_p.Q52E|CD34_ENST00000485761.1_5'UTR|CD34_ENST00000356522.4_Missense_Mutation_p.Q187E	NM_001025109.1	NP_001020280.1	P28906	CD34_HUMAN	CD34 molecule	187				Q -> E (in Ref. 9; AA sequence). {ECO:0000305}.	cell motility (GO:0048870)|cell proliferation (GO:0008283)|endothelial cell proliferation (GO:0001935)|endothelium development (GO:0003158)|extracellular vesicular exosome assembly (GO:0071971)|glomerular endothelium development (GO:0072011)|glomerular filtration (GO:0003094)|glutamate metabolic process (GO:0006536)|hematopoietic stem cell proliferation (GO:0071425)|hemopoiesis (GO:0030097)|leukocyte migration (GO:0050900)|mesangial cell-matrix adhesion (GO:0035759)|metanephric glomerular mesangial cell differentiation (GO:0072254)|negative regulation of blood coagulation (GO:0030195)|negative regulation of cellular response to heat (GO:1900035)|negative regulation of cellular response to hypoxia (GO:1900038)|negative regulation of gene expression (GO:0010629)|negative regulation of interleukin-2 secretion (GO:1900041)|negative regulation of neuron death (GO:1901215)|negative regulation of nitric oxide biosynthetic process (GO:0045019)|negative regulation of tumor necrosis factor production (GO:0032720)|paracrine signaling (GO:0038001)|positive regulation of angiogenesis (GO:0045766)|positive regulation of gene expression (GO:0010628)|positive regulation of glial cell line-derived neurotrophic factor secretion (GO:1900168)|positive regulation of granulocyte colony-stimulating factor production (GO:0071657)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of odontogenesis (GO:0042482)|positive regulation of transforming growth factor beta production (GO:0071636)|positive regulation of vasculogenesis (GO:2001214)|regulation of blood pressure (GO:0008217)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|stem cell proliferation (GO:0072089)|tissue homeostasis (GO:0001894)|transdifferentiation (GO:0060290)|vascular wound healing (GO:0061042)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|glomerular endothelium fenestra (GO:0036053)|integral component of plasma membrane (GO:0005887)|intercellular bridge (GO:0045171)|lysosome (GO:0005764)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|sulfate binding (GO:0043199)|transcription factor binding (GO:0008134)			kidney(2)|large_intestine(2)|lung(8)|ovary(1)	13						CAGATGCCCTGAGTCAATTTC	0.453																																																	0													67.0	57.0	60.0					1																	208070876		2199	4285	6484	SO:0001583	missense	0			M81104	CCDS31011.1, CCDS31012.1	1q32	2008-02-05	2006-03-28		ENSG00000174059	ENSG00000174059		"""CD molecules"""	1662	protein-coding gene	gene with protein product		142230	"""CD34 antigen"""			1370171, 1374051	Standard	NM_001025109		Approved		uc001hgw.1	P28906	OTTHUMG00000036565	ENST00000310833.7:c.559C>G	1.37:g.208070876G>C	ENSP00000310036:p.Gln187Glu		A8K664|Q15970|Q15971|Q5JTA3|Q5JTA4|Q9UJB1	Missense_Mutation	SNP	pfam_CD34/Podocalyxin,prints_CD34	p.Q187E	ENST00000310833.7	37	c.559	CCDS31011.1	1	.	.	.	.	.	.	.	.	.	.	G	10.54	1.378950	0.24944	.	.	ENSG00000174059	ENST00000310833;ENST00000356522;ENST00000537704;ENST00000367037	T;T;T	0.11277	2.79;2.79;2.79	5.28	3.15	0.36227	.	1.037320	0.07589	N	0.921541	T	0.13415	0.0325	L	0.61218	1.895	0.09310	N	1	P;P;B	0.39782	0.688;0.573;0.131	B;B;B	0.33454	0.078;0.164;0.058	T	0.24012	-1.0172	10	0.49607	T	0.09	0.5451	11.3159	0.49392	0.0:0.0:0.658:0.342	.	52;187;187	B4DG27;P28906-2;P28906	.;.;CD34_HUMAN	E	187;187;52;157	ENSP00000310036:Q187E;ENSP00000348916:Q187E;ENSP00000442874:Q52E	ENSP00000310036:Q187E	Q	-	1	0	CD34	206137499	0.001000	0.12720	0.011000	0.14972	0.832000	0.47134	0.744000	0.26245	1.192000	0.43071	0.655000	0.94253	CAG	CD34	-	NULL	ENSG00000174059		0.453	CD34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CD34	HGNC	protein_coding	OTTHUMT00000088933.1	-	0.00	16	0	G	NM_001773		208070876	-1	tier1	-	no_errors	ENST00000310833	ensembl	human	known	74_37	missense	16.22	31	6	SNP	0.002	C
CDC27	996	genome.wustl.edu	37	17	45219311	45219311	+	Missense_Mutation	SNP	T	T	C	rs140737545		TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr17:45219311T>C	ENST00000066544.3	-	12	1552	c.1459A>G	c.(1459-1461)Att>Gtt	p.I487V	CDC27_ENST00000527547.1_Missense_Mutation_p.I486V|CDC27_ENST00000531206.1_Missense_Mutation_p.I493V|CDC27_ENST00000446365.2_Missense_Mutation_p.I426V	NM_001114091.1|NM_001256.3	NP_001107563.1|NP_001247.3	P30260	CDC27_HUMAN	cell division cycle 27	487					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell proliferation (GO:0008283)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cell cycle (GO:0000278)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	protein phosphatase binding (GO:0019903)			NS(1)|breast(5)|central_nervous_system(3)|cervix(1)|endometrium(2)|kidney(17)|large_intestine(18)|lung(11)|ovary(5)|pancreas(1)|prostate(19)|skin(5)|upper_aerodigestive_tract(2)	90						TGGCTCAAAATATTTATAGCT	0.383																																																	0													112.0	118.0	116.0					17																	45219311		2203	4299	6502	SO:0001583	missense	0			U00001	CCDS11509.1, CCDS45720.1, CCDS74090.1	17q21.32	2013-01-17	2013-01-17		ENSG00000004897	ENSG00000004897		"""Anaphase promoting complex subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	1728	protein-coding gene	gene with protein product	"""anaphase promoting complex subunit 3"""	116946	"""cell division cycle 27"", ""cell division cycle 27 homolog (S. cerevisiae)"""	D0S1430E, D17S978E		8234252	Standard	XM_005257892		Approved	APC3, ANAPC3, NUC2	uc002ile.4	P30260	OTTHUMG00000166429	ENST00000066544.3:c.1459A>G	17.37:g.45219311T>C	ENSP00000066544:p.Ile487Val		G3V1C4|Q16349|Q96F35	Missense_Mutation	SNP	pfam_TPR_1,pfam_TPR_2,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.I493V	ENST00000066544.3	37	c.1477	CCDS11509.1	17	.	.	.	.	.	.	.	.	.	.	T	4.731	0.135890	0.09032	.	.	ENSG00000004897	ENST00000066544;ENST00000531206;ENST00000446365;ENST00000527547	T;T;T;T	0.73681	-0.77;-0.77;-0.77;-0.77	5.92	3.6	0.41247	.	0.089833	0.85682	D	0.000000	T	0.53384	0.1793	L	0.31476	0.935	0.49798	D	0.999821	B;B;B;B	0.23316	0.05;0.083;0.083;0.024	B;B;B;B	0.17098	0.008;0.017;0.017;0.005	T	0.44590	-0.9318	10	0.02654	T	1	-23.2923	6.9274	0.24422	0.0:0.0792:0.1504:0.7704	.	426;486;493;487	B4DL80;G5EA36;G3V1C4;P30260	.;.;.;CDC27_HUMAN	V	487;493;426;486	ENSP00000066544:I487V;ENSP00000434614:I493V;ENSP00000392802:I426V;ENSP00000437339:I486V	ENSP00000066544:I487V	I	-	1	0	CDC27	42574310	1.000000	0.71417	0.998000	0.56505	0.990000	0.78478	4.907000	0.63300	1.072000	0.40860	0.528000	0.53228	ATT	CDC27	-	NULL	ENSG00000004897		0.383	CDC27-001	KNOWN	basic|CCDS	protein_coding	CDC27	HGNC	protein_coding	OTTHUMT00000389742.2	-	0.00	33	0	T			45219311	-1	tier1	rs140737545	no_errors	ENST00000531206	ensembl	human	known	74_37	missense	14.63	35	6	SNP	1.000	C
CFL1	1072	genome.wustl.edu	37	11	65623715	65623715	+	Splice_Site	SNP	T	T	A			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr11:65623715T>A	ENST00000525451.2	-	3	719		c.e3-2		CFL1_ENST00000527344.1_Splice_Site|CFL1_ENST00000531407.1_Splice_Site|CFL1_ENST00000308162.5_Splice_Site|CFL1_ENST00000524553.1_Splice_Site|CFL1_ENST00000531413.1_Splice_Site|CFL1_ENST00000534769.1_Splice_Site			P23528	COF1_HUMAN	cofilin 1 (non-muscle)						actin cytoskeleton organization (GO:0030036)|actin filament depolymerization (GO:0030042)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytoskeleton organization (GO:0007010)|establishment of cell polarity (GO:0030010)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|mitotic cytokinesis (GO:0000281)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell size (GO:0045792)|neural crest cell migration (GO:0001755)|neural fold formation (GO:0001842)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of actin filament depolymerization (GO:0030836)|protein import into nucleus (GO:0006606)|protein phosphorylation (GO:0006468)|regulation of cell morphogenesis (GO:0022604)|response to amino acid (GO:0043200)|response to virus (GO:0009615)|Rho protein signal transduction (GO:0007266)	cell-cell junction (GO:0005911)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				breast(1)|kidney(1)|large_intestine(2)|lung(2)	6				READ - Rectum adenocarcinoma(159;0.169)		ACCGGAGGCCTAGGAGACATG	0.517																																					Esophageal Squamous(90;820 1366 3932 32351 42291)												0													62.0	60.0	60.0					11																	65623715		2201	4297	6498	SO:0001630	splice_region_variant	0			X95404	CCDS8114.1	11q13.1	2010-12-03			ENSG00000172757	ENSG00000172757			1874	protein-coding gene	gene with protein product		601442		CFL		8800436	Standard	NM_005507		Approved		uc001ofs.3	P23528		ENST00000525451.2:c.4-2A>T	11.37:g.65623715T>A			B3KUQ1|Q53Y87|Q9UCA2	Splice_Site	SNP	-	e2-2	ENST00000525451.2	37	c.4-2	CCDS8114.1	11	.	.	.	.	.	.	.	.	.	.	T	15.12	2.738919	0.49045	.	.	ENSG00000172757	ENST00000525451;ENST00000308162;ENST00000534769;ENST00000532134;ENST00000526975	.	.	.	3.62	3.62	0.41486	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.8546	0.46792	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	CFL1	65380291	1.000000	0.71417	0.899000	0.35326	0.634000	0.38068	7.694000	0.84235	1.888000	0.54679	0.459000	0.35465	.	CFL1	-	-	ENSG00000172757		0.517	CFL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CFL1	HGNC	protein_coding	OTTHUMT00000390701.3	-	0.00	26	0	T	NM_005507	Intron	65623715	-1	tier1	-	no_errors	ENST00000308162	ensembl	human	known	74_37	splice_site	25.00	24	8	SNP	0.997	A
CGNL1	84952	genome.wustl.edu	37	15	57754058	57754058	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr15:57754058G>T	ENST00000281282.5	+	8	2449	c.2371G>T	c.(2371-2373)Gcc>Tcc	p.A791S		NM_001252335.1|NM_032866.4	NP_001239264.1|NP_116255.2	Q0VF96	CGNL1_HUMAN	cingulin-like 1	791						myosin complex (GO:0016459)|tight junction (GO:0005923)	motor activity (GO:0003774)			autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|endometrium(5)|kidney(4)|large_intestine(12)|lung(14)|ovary(4)|prostate(4)|skin(10)|stomach(2)|upper_aerodigestive_tract(1)	60				all cancers(107;0.121)|GBM - Glioblastoma multiforme(80;0.186)		TGAGTTGCAGGCCCTGAGGGA	0.542																																																	0													95.0	90.0	91.0					15																	57754058		2192	4292	6484	SO:0001583	missense	0			AY274808	CCDS10161.1	15q21.3	2011-06-10			ENSG00000128849	ENSG00000128849			25931	protein-coding gene	gene with protein product		607856				11214970	Standard	NM_001252335		Approved	FLJ14957, JACOP, KIAA1749, paracingulin	uc002aeg.3	Q0VF96	OTTHUMG00000166485	ENST00000281282.5:c.2371G>T	15.37:g.57754058G>T	ENSP00000281282:p.Ala791Ser		Q05BZ4|Q52LR0|Q695C7|Q7Z2L3|Q96JV2|Q96MN6|Q9C0B4	Missense_Mutation	SNP	pfam_Myosin_tail,prints_Tropomyosin	p.A791S	ENST00000281282.5	37	c.2371	CCDS10161.1	15	.	.	.	.	.	.	.	.	.	.	G	6.589	0.477108	0.12521	.	.	ENSG00000128849	ENST00000281282	T	0.77358	-1.09	5.41	4.48	0.54585	.	0.230286	0.30528	N	0.009428	T	0.64227	0.2579	L	0.45581	1.43	0.24942	N	0.99184	B	0.14012	0.009	B	0.12156	0.007	T	0.47394	-0.9121	10	0.07813	T	0.8	-6.9017	5.8545	0.18712	0.1871:0.0:0.6599:0.153	.	791	Q0VF96	CGNL1_HUMAN	S	791	ENSP00000281282:A791S	ENSP00000281282:A791S	A	+	1	0	CGNL1	55541350	1.000000	0.71417	1.000000	0.80357	0.559000	0.35586	2.560000	0.45896	1.261000	0.44149	-0.332000	0.08345	GCC	CGNL1	-	NULL	ENSG00000128849		0.542	CGNL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CGNL1	HGNC	protein_coding	OTTHUMT00000255482.2	-	0.00	45	0	G	NM_032866		57754058	+1	tier1	-	no_errors	ENST00000281282	ensembl	human	known	74_37	missense	5.88	64	4	SNP	1.000	T
CHAT	1103	genome.wustl.edu	37	10	50854688	50854688	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr10:50854688G>A	ENST00000337653.2	+	8	1402	c.1249G>A	c.(1249-1251)Ggg>Agg	p.G417R	CHAT_ENST00000395559.2_Missense_Mutation_p.G299R|CHAT_ENST00000351556.3_Missense_Mutation_p.G299R|CHAT_ENST00000395562.2_Missense_Mutation_p.G335R|CHAT_ENST00000455728.2_Missense_Mutation_p.G299R|CHAT_ENST00000339797.1_Missense_Mutation_p.G299R	NM_001142929.1|NM_020549.4	NP_001136401.1|NP_065574	P28329	CLAT_HUMAN	choline O-acetyltransferase	417					adult walking behavior (GO:0007628)|dendrite development (GO:0016358)|establishment of synaptic specificity at neuromuscular junction (GO:0007529)|glycerophospholipid biosynthetic process (GO:0046474)|muscle organ development (GO:0007517)|neuromuscular synaptic transmission (GO:0007274)|neurotransmitter biosynthetic process (GO:0042136)|neurotransmitter secretion (GO:0007269)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|rhythmic behavior (GO:0007622)|rhythmic excitation (GO:0043179)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)	choline O-acetyltransferase activity (GO:0004102)			central_nervous_system(3)|endometrium(2)|kidney(2)|large_intestine(11)|lung(34)|prostate(3)|urinary_tract(1)	56		all_neural(218;0.107)		GBM - Glioblastoma multiforme(2;0.000585)	Choline(DB00122)|Nicotine(DB00184)	CAGCAAGAACGGGGCCAATCG	0.642																																																	0													78.0	67.0	71.0					10																	50854688		2203	4300	6503	SO:0001583	missense	0			AF305907	CCDS7232.1, CCDS7233.1, CCDS44389.1	10q11.2	2010-05-11	2010-05-11		ENSG00000070748	ENSG00000070748	2.3.1.6		1912	protein-coding gene	gene with protein product		118490	"""choline acetyltransferase"""			1840566	Standard	NM_020984		Approved		uc001jhz.2	P28329	OTTHUMG00000018198	ENST00000337653.2:c.1249G>A	10.37:g.50854688G>A	ENSP00000337103:p.Gly417Arg		A2BDF4|A2BDF5|Q16488|Q9BQ23|Q9BQ35|Q9BQE1	Missense_Mutation	SNP	pfam_Carn_acyl_trans	p.G417R	ENST00000337653.2	37	c.1249	CCDS7232.1	10	.	.	.	.	.	.	.	.	.	.	G	24.9	4.579561	0.86645	.	.	ENSG00000070748	ENST00000339797;ENST00000351556;ENST00000395559;ENST00000337653;ENST00000395562;ENST00000455728	D;D;D;D;D;D	0.91295	-2.82;-2.82;-2.82;-2.82;-2.82;-2.82	5.46	5.46	0.80206	.	0.110722	0.64402	D	0.000005	D	0.95918	0.8671	M	0.85542	2.76	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.996;0.999	D	0.95761	0.8800	10	0.54805	T	0.06	-28.1281	19.2976	0.94129	0.0:0.0:1.0:0.0	.	299;417	F8W8I2;P28329	.;CLAT_HUMAN	R	299;299;299;417;335;299	ENSP00000343486:G299R;ENSP00000345878:G299R;ENSP00000378926:G299R;ENSP00000337103:G417R;ENSP00000378929:G335R;ENSP00000390521:G299R	ENSP00000337103:G417R	G	+	1	0	CHAT	50524694	1.000000	0.71417	0.886000	0.34754	0.812000	0.45895	5.956000	0.70315	2.569000	0.86673	0.655000	0.94253	GGG	CHAT	-	pfam_Carn_acyl_trans	ENSG00000070748		0.642	CHAT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CHAT	HGNC	protein_coding	OTTHUMT00000047997.1	-	0.00	23	0	G	NM_020549		50854688	+1	tier1	-	no_errors	ENST00000337653	ensembl	human	known	74_37	missense	45.28	29	24	SNP	1.000	A
CHKB	1120	genome.wustl.edu	37	22	51018462	51018462	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr22:51018462G>T	ENST00000406938.2	-	8	1085	c.868C>A	c.(868-870)Cac>Aac	p.H290N	CPT1B_ENST00000405237.3_5'Flank|CPT1B_ENST00000440709.1_5'Flank|CHKB-AS1_ENST00000380711.3_RNA|CHKB-CPT1B_ENST00000453634.1_5'Flank|CHKB_ENST00000463053.1_5'Flank|CPT1B_ENST00000457250.1_5'Flank|CPT1B_ENST00000434492.2_5'Flank|CHKB-CPT1B_ENST00000452668.1_5'Flank|CPT1B_ENST00000395650.2_5'Flank|CPT1B_ENST00000312108.7_5'Flank|CPT1B_ENST00000360719.2_5'Flank	NM_005198.4	NP_005189.2	Q9Y259	CHKB_HUMAN	choline kinase beta	290					CDP-choline pathway (GO:0006657)|glycerophospholipid biosynthetic process (GO:0046474)|muscle organ development (GO:0007517)|phosphatidylcholine biosynthetic process (GO:0006656)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	ATP binding (GO:0005524)|choline kinase activity (GO:0004103)|ethanolamine kinase activity (GO:0004305)			NS(1)|breast(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(5)|ovary(3)|skin(1)|urinary_tract(1)	15		all_cancers(38;8.8e-15)|all_epithelial(38;1.12e-12)|all_lung(38;3.07e-05)|Breast(42;6.27e-05)|Lung NSC(38;0.000813)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		all cancers(3;4.04e-77)|OV - Ovarian serous cystadenocarcinoma(4;5.79e-74)|Epithelial(4;6.17e-70)|GBM - Glioblastoma multiforme(4;5.68e-08)|LUAD - Lung adenocarcinoma(64;0.0016)|Lung(4;0.00942)|BRCA - Breast invasive adenocarcinoma(115;0.205)	Choline(DB00122)	CATTCCTCGTGAGTATAATCA	0.532																																																	0													95.0	100.0	99.0					22																	51018462		2203	4300	6503	SO:0001583	missense	0			AB029886	CCDS14099.1	22q13.33	2011-02-16	2004-04-19	2004-04-19	ENSG00000100288	ENSG00000100288			1938	protein-coding gene	gene with protein product		612395	"""choline kinase-like"""	CHKL		9224698, 15003397	Standard	NM_005198		Approved	CHETK	uc003bmv.3	Q9Y259	OTTHUMG00000150275	ENST00000406938.2:c.868C>A	22.37:g.51018462G>T	ENSP00000384400:p.His290Asn		A0PJM6|Q13388	Missense_Mutation	SNP	pfam_Aminoglycoside_PTrfase,pfam_DUF227,superfamily_Kinase-like_dom	p.H290N	ENST00000406938.2	37	c.868	CCDS14099.1	22	.	.	.	.	.	.	.	.	.	.	G	13.90	2.374845	0.42105	.	.	ENSG00000100288	ENST00000406938	T	0.51574	0.7	5.11	2.98	0.34508	Protein kinase-like domain (1);Choline/ethanolamine kinase (1);	0.116130	0.64402	D	0.000013	T	0.44871	0.1314	L	0.44542	1.39	0.27150	N	0.961421	B	0.31318	0.319	B	0.43274	0.414	T	0.37686	-0.9695	10	0.27785	T	0.31	-19.3067	9.2624	0.37621	0.1882:0.0:0.8118:0.0	.	290	Q9Y259	CHKB_HUMAN	N	290	ENSP00000384400:H290N	ENSP00000384400:H290N	H	-	1	0	CHKB	49365328	0.738000	0.28186	0.889000	0.34880	0.989000	0.77384	1.271000	0.33098	1.116000	0.41820	0.655000	0.94253	CAC	CHKB	-	pfam_Aminoglycoside_PTrfase,superfamily_Kinase-like_dom	ENSG00000100288		0.532	CHKB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHKB	HGNC	protein_coding	OTTHUMT00000317267.3		0.00	46	0	G	NM_005198		51018462	-1			no_errors	ENST00000406938	ensembl	human	known	74_37	missense	6.82	41	3	SNP	0.720	T
CLN6	54982	genome.wustl.edu	37	15	68504072	68504072	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr15:68504072G>T	ENST00000249806.5	-	4	584	c.427C>A	c.(427-429)Cag>Aag	p.Q143K	CLN6_ENST00000418702.2_Intron|CLN6_ENST00000565471.1_Intron|RP11-315D16.2_ENST00000562767.1_Intron|CLN6_ENST00000538696.1_Missense_Mutation_p.Q175K|CLN6_ENST00000564752.1_Missense_Mutation_p.Q143K|CLN6_ENST00000566347.1_Intron	NM_017882.2	NP_060352.1	Q9NWW5	CLN6_HUMAN	ceroid-lipofuscinosis, neuronal 6, late infantile, variant	143					cell death (GO:0008219)|cellular macromolecule catabolic process (GO:0044265)|cholesterol metabolic process (GO:0008203)|ganglioside metabolic process (GO:0001573)|glycosaminoglycan metabolic process (GO:0030203)|locomotion involved in locomotory behavior (GO:0031987)|lysosomal lumen acidification (GO:0007042)|positive regulation of proteolysis (GO:0045862)|protein catabolic process (GO:0030163)|visual perception (GO:0007601)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)	protein homodimerization activity (GO:0042803)			large_intestine(1)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	7						AGGTGGTGCTGGTAGCCACTG	0.582																																																	0													123.0	121.0	121.0					15																	68504072		2200	4298	6498	SO:0001583	missense	0			AK000568	CCDS10227.1	15q23	2014-09-17			ENSG00000128973	ENSG00000128973			2077	protein-coding gene	gene with protein product		606725				9097964, 11727201	Standard	NM_017882		Approved	FLJ20561, HsT18960, nclf	uc002arf.3	Q9NWW5	OTTHUMG00000133286	ENST00000249806.5:c.427C>A	15.37:g.68504072G>T	ENSP00000249806:p.Gln143Lys		A8K560|B4DDH6|Q6IAB1|Q96SR0	Missense_Mutation	SNP	NULL	p.Q143K	ENST00000249806.5	37	c.427	CCDS10227.1	15	.	.	.	.	.	.	.	.	.	.	G	18.91	3.724139	0.68959	.	.	ENSG00000128973	ENST00000249806;ENST00000538696	D;D	0.95342	-3.68;-3.68	5.14	5.14	0.70334	.	0.000000	0.85682	D	0.000000	D	0.92038	0.7477	L	0.39147	1.195	0.80722	D	1	B;B	0.23377	0.084;0.02	B;B	0.20184	0.028;0.027	D	0.89438	0.3721	10	0.72032	D	0.01	-24.8775	18.6234	0.91328	0.0:0.0:1.0:0.0	.	175;143	B4DDH6;Q9NWW5	.;CLN6_HUMAN	K	143;175	ENSP00000249806:Q143K;ENSP00000445770:Q175K	ENSP00000249806:Q143K	Q	-	1	0	CLN6	66291126	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.312000	0.96287	2.388000	0.81334	0.511000	0.50034	CAG	CLN6	-	NULL	ENSG00000128973		0.582	CLN6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLN6	HGNC	protein_coding	OTTHUMT00000257066.1	-	0.00	30	0	G	NM_017882		68504072	-1	tier1	-	no_errors	ENST00000249806	ensembl	human	known	74_37	missense	35.56	29	16	SNP	1.000	T
CMTR2	55783	genome.wustl.edu	37	16	71319539	71319539	+	Silent	SNP	C	C	A	rs3826247	byFrequency	TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr16:71319539C>A	ENST00000338099.5	-	3	621	c.285G>T	c.(283-285)gcG>gcT	p.A95A	CMTR2_ENST00000434935.2_Silent_p.A95A			Q8IYT2	CMTR2_HUMAN	cap methyltransferase 2	95					7-methylguanosine mRNA capping (GO:0006370)|cap2 mRNA methylation (GO:0097310)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	mRNA (nucleoside-2'-O-)-methyltransferase activity (GO:0004483)										TGATTTTCCCCGCTTTATTAG	0.373																																																	0													102.0	97.0	99.0					16																	71319539		2198	4300	6498	SO:0001819	synonymous_variant	0			BC035005	CCDS10898.1	16q22.2	2013-07-23	2013-07-23	2013-07-23	ENSG00000180917	ENSG00000180917			25635	protein-coding gene	gene with protein product	"""adrift homolog (Drosophila)"""		"""FtsJ methyltransferase domain containing 1"""	FTSJD1		21310715	Standard	NM_018348		Approved	FLJ11171, AFT, MTr2	uc010cga.3	Q8IYT2	OTTHUMG00000137587	ENST00000338099.5:c.285G>T	16.37:g.71319539C>A			B2RCD5|D3DWS1|Q8NE77|Q8NFR5|Q9H8Z4|Q9NUS3|Q9NXF5	Silent	SNP	pfam_rRNA_MeTrfase_FtsJ_dom	p.A95	ENST00000338099.5	37	c.285	CCDS10898.1	16																																																																																			CMTR2	-	NULL	ENSG00000180917		0.373	CMTR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CMTR2	HGNC	protein_coding	OTTHUMT00000268984.2	-	0.00	11	0	C	NM_018348		71319539	-1	tier1	-	no_errors	ENST00000338099	ensembl	human	known	74_37	silent	57.14	6	8	SNP	0.684	A
CNTN6	27255	genome.wustl.edu	37	3	1339605	1339605	+	Missense_Mutation	SNP	G	G	C	rs373831062		TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr3:1339605G>C	ENST00000446702.2	+	7	1318	c.691G>C	c.(691-693)Gtg>Ctg	p.V231L	CNTN6_ENST00000350110.2_Missense_Mutation_p.V231L|CNTN6_ENST00000539053.1_Missense_Mutation_p.V159L			Q9UQ52	CNTN6_HUMAN	contactin 6	231	Ig-like C2-type 3.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|central nervous system development (GO:0007417)|Notch signaling pathway (GO:0007219)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)				breast(6)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(25)|lung(34)|ovary(1)|pancreas(1)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	90		all_cancers(2;0.000164)|all_epithelial(2;0.107)		Epithelial(13;0.000233)|all cancers(10;0.0013)|OV - Ovarian serous cystadenocarcinoma(96;0.0139)		AAAGATTGAAGTGCGTTTTCC	0.353																																																	0								G	LEU/VAL	0,4406		0,0,2203	130.0	137.0	135.0		691	4.0	1.0	3		135	1,8599	1.2+/-3.3	0,1,4299	no	missense	CNTN6	NM_014461.2	32	0,1,6502	CC,CG,GG		0.0116,0.0,0.0077	benign	231/1029	1339605	1,13005	2203	4300	6503	SO:0001583	missense	0			AB003592	CCDS2557.1	3p26-p25	2013-02-11			ENSG00000134115	ENSG00000134115		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	2176	protein-coding gene	gene with protein product	"""neural adhesion molecule"""	607220				9486763	Standard	NM_014461		Approved	NB-3	uc003bpa.3	Q9UQ52	OTTHUMG00000119030	ENST00000446702.2:c.691G>C	3.37:g.1339605G>C	ENSP00000407822:p.Val231Leu		Q2KHM2	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Ig_V-set,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.V231L	ENST00000446702.2	37	c.691	CCDS2557.1	3	.	.	.	.	.	.	.	.	.	.	G	19.01	3.744425	0.69418	0.0	1.16E-4	ENSG00000134115	ENST00000446702;ENST00000539053;ENST00000350110	T;T;T	0.77489	-1.1;-1.1;-1.1	4.95	4.01	0.46588	Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.117868	0.38111	N	0.001809	T	0.76730	0.4028	L	0.39633	1.23	0.48135	D	0.999597	P;P	0.40398	0.664;0.716	P;B	0.48571	0.582;0.393	T	0.76629	-0.2889	10	0.40728	T	0.16	.	14.6986	0.69139	0.0:0.1457:0.8542:0.0	.	159;231	B4DGV0;Q9UQ52	.;CNTN6_HUMAN	L	231;159;231	ENSP00000407822:V231L;ENSP00000442791:V159L;ENSP00000341882:V231L	ENSP00000341882:V231L	V	+	1	0	CNTN6	1314605	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.285000	0.72658	2.443000	0.82685	0.650000	0.86243	GTG	CNTN6	-	pfscan_Ig-like_dom	ENSG00000134115		0.353	CNTN6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTN6	HGNC	protein_coding	OTTHUMT00000239235.2	-	0.00	53	0	G	NM_014461		1339605	+1	tier1	-	no_errors	ENST00000350110	ensembl	human	known	74_37	missense	11.67	53	7	SNP	1.000	C
CNTN6	27255	genome.wustl.edu	37	3	1444141	1444141	+	Missense_Mutation	SNP	G	G	T	rs200347218	byFrequency	TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr3:1444141G>T	ENST00000446702.2	+	22	3584	c.2957G>T	c.(2956-2958)aGt>aTt	p.S986I	CNTN6_ENST00000350110.2_Missense_Mutation_p.S986I|CNTN6_ENST00000539053.1_Missense_Mutation_p.S914I			Q9UQ52	CNTN6_HUMAN	contactin 6	986	Fibronectin type-III 4. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|central nervous system development (GO:0007417)|Notch signaling pathway (GO:0007219)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)				breast(6)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(25)|lung(34)|ovary(1)|pancreas(1)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	90		all_cancers(2;0.000164)|all_epithelial(2;0.107)		Epithelial(13;0.000233)|all cancers(10;0.0013)|OV - Ovarian serous cystadenocarcinoma(96;0.0139)		GGAAGCAGCAGTGAGGAAATT	0.398																																																	0													117.0	112.0	114.0					3																	1444141		2203	4299	6502	SO:0001583	missense	0			AB003592	CCDS2557.1	3p26-p25	2013-02-11			ENSG00000134115	ENSG00000134115		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	2176	protein-coding gene	gene with protein product	"""neural adhesion molecule"""	607220				9486763	Standard	NM_014461		Approved	NB-3	uc003bpa.3	Q9UQ52	OTTHUMG00000119030	ENST00000446702.2:c.2957G>T	3.37:g.1444141G>T	ENSP00000407822:p.Ser986Ile		Q2KHM2	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Ig_V-set,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.S986I	ENST00000446702.2	37	c.2957	CCDS2557.1	3	.	.	.	.	.	.	.	.	.	.	G	27.0	4.787808	0.90367	.	.	ENSG00000134115	ENST00000446702;ENST00000539053;ENST00000350110	T;T;T	0.63913	-0.07;-0.07;-0.07	5.46	5.46	0.80206	Fibronectin, type III (2);Immunoglobulin-like fold (1);	0.000000	0.64402	D	0.000001	T	0.81772	0.4893	M	0.83012	2.62	0.80722	D	1	D	0.76494	0.999	D	0.87578	0.998	D	0.83463	0.0055	10	0.59425	D	0.04	.	19.3156	0.94211	0.0:0.0:1.0:0.0	.	986	Q9UQ52	CNTN6_HUMAN	I	986;914;986	ENSP00000407822:S986I;ENSP00000442791:S914I;ENSP00000341882:S986I	ENSP00000341882:S986I	S	+	2	0	CNTN6	1419141	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.199000	0.95003	2.567000	0.86603	0.655000	0.94253	AGT	CNTN6	-	superfamily_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000134115		0.398	CNTN6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTN6	HGNC	protein_coding	OTTHUMT00000239235.2		0.00	16	0	G	NM_014461		1444141	+1			no_errors	ENST00000350110	ensembl	human	known	74_37	missense	10.00	36	4	SNP	1.000	T
COG4	25839	genome.wustl.edu	37	16	70546283	70546283	+	Silent	SNP	G	G	C			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr16:70546283G>C	ENST00000323786.5	-	5	618	c.597C>G	c.(595-597)ctC>ctG	p.L199L	COG4_ENST00000564653.1_Intron|COG4_ENST00000393612.4_Silent_p.L195L	NM_001195139.1|NM_015386.2	NP_001182068.1|NP_056201.2	Q9H9E3	COG4_HUMAN	component of oligomeric golgi complex 4	195					Golgi organization (GO:0007030)|Golgi vesicle prefusion complex stabilization (GO:0048213)|protein transport (GO:0015031)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	Golgi transport complex (GO:0017119)|membrane (GO:0016020)				breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(12)|pancreas(1)|prostate(2)	33		Ovarian(137;0.0694)				CAATGGCTTTGAGACGTTGCT	0.483																																																	0													85.0	73.0	77.0					16																	70546283		2198	4300	6498	SO:0001819	synonymous_variant	0			AL050101	CCDS10892.2, CCDS73909.1	16q22.1	2013-09-20			ENSG00000103051	ENSG00000103051		"""Components of oligomeric golgi complex"""	18620	protein-coding gene	gene with protein product		606976				11980916	Standard	NM_015386		Approved	COD1, DKFZP586E1519	uc002ezc.3	Q9H9E3	OTTHUMG00000128515	ENST00000323786.5:c.597C>G	16.37:g.70546283G>C			B4DMN8|C9JS23|Q96D40|Q9BRF0|Q9BVZ2|Q9H5Y4|Q9Y3W3	Silent	SNP	pfam_COG_su4,smart_COG_su4	p.L199	ENST00000323786.5	37	c.597	CCDS10892.2	16																																																																																			COG4	-	pfam_COG_su4,smart_COG_su4	ENSG00000103051		0.483	COG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COG4	HGNC	protein_coding	OTTHUMT00000250326.3	-	0.00	17	0	G			70546283	-1	tier1	-	no_errors	ENST00000323786	ensembl	human	known	74_37	silent	33.33	14	7	SNP	1.000	C
COPS5	10987	genome.wustl.edu	37	8	67968797	67968797	+	Missense_Mutation	SNP	T	T	C			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr8:67968797T>C	ENST00000357849.4	-	5	936	c.616A>G	c.(616-618)Att>Gtt	p.I206V	PPP1R42_ENST00000517834.1_5'UTR|COPS5_ENST00000517736.1_Missense_Mutation_p.I142V|AC109335.1_ENST00000578628.1_RNA	NM_006837.2	NP_006828.2	Q92905	CSN5_HUMAN	COP9 signalosome subunit 5	206					cullin deneddylation (GO:0010388)|exosomal secretion (GO:1990182)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein deneddylation (GO:0000338)|protein deubiquitination (GO:0016579)|regulation of cell cycle (GO:0051726)|regulation of JNK cascade (GO:0046328)|transcription from RNA polymerase II promoter (GO:0006366)|translation (GO:0006412)|translational initiation (GO:0006413)	cell junction (GO:0030054)|COP9 signalosome (GO:0008180)|cytoplasm (GO:0005737)|eukaryotic translation initiation factor 3 complex (GO:0005852)|nucleus (GO:0005634)|synaptic vesicle (GO:0008021)	metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|transcription coactivator activity (GO:0003713)|translation initiation factor activity (GO:0003743)|ubiquitin-specific protease activity (GO:0004843)			endometrium(2)|kidney(1)|large_intestine(1)|lung(6)|ovary(1)|skin(3)	14	Breast(64;0.214)	Lung NSC(129;0.0908)|all_lung(136;0.152)	Epithelial(68;0.00389)|OV - Ovarian serous cystadenocarcinoma(28;0.00691)|all cancers(69;0.0205)|BRCA - Breast invasive adenocarcinoma(89;0.153)			TTAAGTGGAATAGTCTGGTAC	0.333																																																	0													81.0	84.0	83.0					8																	67968797		2203	4300	6503	SO:0001583	missense	0			U65928	CCDS6198.1	8q13.1	2013-03-14	2013-03-14		ENSG00000121022	ENSG00000121022			2240	protein-coding gene	gene with protein product		604850	"""COP9 (constitutive photomorphogenic, Arabidopsis, homolog) subunit 5"", ""COP9 constitutive photomorphogenic homolog subunit 5 (Arabidopsis)"""			8837781, 9341143	Standard	NM_006837		Approved	JAB1, SGN5, MOV-34, CSN5	uc003xxe.3	Q92905	OTTHUMG00000164563	ENST00000357849.4:c.616A>G	8.37:g.67968797T>C	ENSP00000350512:p.Ile206Val		O15386|Q6AW95|Q86WQ4|Q9BQ17	Missense_Mutation	SNP	pfam_JAB_MPN_dom,smart_JAB_MPN_dom	p.I206V	ENST00000357849.4	37	c.616	CCDS6198.1	8	.	.	.	.	.	.	.	.	.	.	T	15.08	2.725997	0.48833	.	.	ENSG00000121022	ENST00000357849;ENST00000517736;ENST00000518747	.	.	.	4.96	4.96	0.65561	.	0.000000	0.85682	D	0.000000	T	0.60222	0.2252	M	0.73372	2.23	0.80722	D	1	P;B;P	0.42203	0.773;0.292;0.671	B;B;B	0.42361	0.253;0.309;0.385	T	0.62191	-0.6906	9	0.34782	T	0.22	-14.9449	14.9341	0.70938	0.0:0.0:0.0:1.0	.	175;142;206	Q59GH5;E5RHH5;Q92905	.;.;CSN5_HUMAN	V	206;142;142	.	ENSP00000350512:I206V	I	-	1	0	COPS5	68131351	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	8.000000	0.88501	1.987000	0.57996	0.528000	0.53228	ATT	COPS5	-	NULL	ENSG00000121022		0.333	COPS5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COPS5	HGNC	protein_coding	OTTHUMT00000379245.2	-	0.00	36	0	T			67968797	-1	tier1	-	no_errors	ENST00000357849	ensembl	human	known	74_37	missense	27.78	26	10	SNP	1.000	C
CPSF1	29894	genome.wustl.edu	37	8	145624685	145624685	+	Missense_Mutation	SNP	A	A	G			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr8:145624685A>G	ENST00000349769.3	-	14	1467	c.1373T>C	c.(1372-1374)cTg>cCg	p.L458P	MIR1234_ENST00000408875.1_RNA	NM_013291.2	NP_037423.2	Q10570	CPSF1_HUMAN	cleavage and polyadenylation specific factor 1, 160kDa	458					gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA cleavage (GO:0006379)|mRNA export from nucleus (GO:0006406)|mRNA polyadenylation (GO:0006378)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	mRNA cleavage and polyadenylation specificity factor complex (GO:0005847)|nucleoplasm (GO:0005654)	mRNA 3'-UTR binding (GO:0003730)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(15)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	38	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.88e-41)|Epithelial(56;1.67e-40)|all cancers(56;1.2e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0323)|Colorectal(110;0.055)			GTAGGTGGCCAGCTGTGTTCC	0.647																																					NSCLC(133;1088 1848 27708 34777 35269)												0													41.0	36.0	38.0					8																	145624685		2202	4300	6502	SO:0001583	missense	0			U37012	CCDS34966.1	8q24	2014-05-06	2002-08-29		ENSG00000071894	ENSG00000071894			2324	protein-coding gene	gene with protein product		606027	"""cleavage and polyadenylation specific factor 1, 160kD subunit"""			7651824, 7590244	Standard	NM_013291		Approved		uc003zcj.3	Q10570	OTTHUMG00000174612	ENST00000349769.3:c.1373T>C	8.37:g.145624685A>G	ENSP00000339353:p.Leu458Pro		Q96AF0	Missense_Mutation	SNP	pfam_Cleavage/polyA-sp_fac_asu_C	p.L458P	ENST00000349769.3	37	c.1373	CCDS34966.1	8	.	.	.	.	.	.	.	.	.	.	A	18.28	3.590209	0.66105	.	.	ENSG00000071894	ENST00000349769	T	0.47869	0.83	5.67	5.67	0.87782	.	0.000000	0.64402	D	0.000001	T	0.59582	0.2204	L	0.45581	1.43	0.80722	D	1	D	0.65815	0.995	D	0.72982	0.979	T	0.54543	-0.8278	10	0.23891	T	0.37	-16.0952	13.8497	0.63489	1.0:0.0:0.0:0.0	.	458	Q10570	CPSF1_HUMAN	P	458	ENSP00000339353:L458P	ENSP00000339353:L458P	L	-	2	0	CPSF1	145595493	1.000000	0.71417	1.000000	0.80357	0.585000	0.36419	8.546000	0.90661	2.151000	0.67156	0.374000	0.22700	CTG	CPSF1	-	NULL	ENSG00000071894		0.647	CPSF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPSF1	HGNC	protein_coding	OTTHUMT00000382422.2	-	0.00	43	0	A	NM_013291		145624685	-1	tier1	-	no_errors	ENST00000349769	ensembl	human	known	74_37	missense	37.50	20	12	SNP	1.000	G
CRIP3	401262	genome.wustl.edu	37	6	43274241	43274241	+	Missense_Mutation	SNP	T	T	G			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr6:43274241T>G	ENST00000274990.4	-	5	347	c.343A>C	c.(343-345)Aag>Cag	p.K115Q	ZNF318_ENST00000607252.1_5'Flank|CRIP3_ENST00000372569.3_Missense_Mutation_p.K115Q			Q6Q6R5	CRIP3_HUMAN	cysteine-rich protein 3	115					T cell proliferation (GO:0042098)	cytoplasm (GO:0005737)	zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	10			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.00998)|OV - Ovarian serous cystadenocarcinoma(102;0.0305)			GTGAATGTCTTCATATGGGGA	0.557																																																	0													52.0	52.0	52.0					6																	43274241		2203	4300	6503	SO:0001583	missense	0			AY555741	CCDS4894.2	6p21	2008-02-05			ENSG00000146215	ENSG00000146215			17751	protein-coding gene	gene with protein product						15380775	Standard	NM_206922		Approved	TLP-A, bA480N24.2, TLP	uc003ouu.1	Q6Q6R5	OTTHUMG00000014727	ENST00000274990.4:c.343A>C	6.37:g.43274241T>G	ENSP00000274990:p.Lys115Gln		A2A436|Q5T043|Q6Q6R4|Q6Q6R6|Q6Q6R7	Missense_Mutation	SNP	pfam_Znf_LIM,smart_Znf_LIM,pfscan_Znf_LIM	p.K115Q	ENST00000274990.4	37	c.343		6	.	.	.	.	.	.	.	.	.	.	T	14.37	2.515047	0.44763	.	.	ENSG00000146215	ENST00000372569;ENST00000274990	T;T	0.42513	0.97;0.97	4.75	4.75	0.60458	.	0.370065	0.23672	N	0.045714	T	0.10551	0.0258	N	0.19112	0.55	0.31938	N	0.611334	P;P	0.41313	0.745;0.527	B;B	0.31686	0.134;0.114	T	0.07385	-1.0775	10	0.19590	T	0.45	-33.6687	12.5041	0.55972	0.0:0.0:0.0:1.0	.	115;115	Q6Q6R5;Q6Q6R5-3	CRIP3_HUMAN;.	Q	115	ENSP00000361650:K115Q;ENSP00000274990:K115Q	ENSP00000274990:K115Q	K	-	1	0	CRIP3	43382219	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	4.640000	0.61368	1.899000	0.54978	0.459000	0.35465	AAG	CRIP3	-	NULL	ENSG00000146215		0.557	CRIP3-004	KNOWN	basic	protein_coding	CRIP3	HGNC	protein_coding	OTTHUMT00000313968.1	-	0.00	18	0	T			43274241	-1	tier1	-	no_errors	ENST00000274990	ensembl	human	known	74_37	missense	17.86	23	5	SNP	1.000	G
CSPG4	1464	genome.wustl.edu	37	15	75980366	75980366	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr15:75980366C>T	ENST00000308508.5	-	3	3132	c.3040G>A	c.(3040-3042)Gtg>Atg	p.V1014M		NM_001897.4	NP_001888.2	Q6UVK1	CSPG4_HUMAN	chondroitin sulfate proteoglycan 4	1014	Gly/Ser-rich (glycosaminoglycan attachment domain).|Interaction with COL5A1. {ECO:0000250}.|Interaction with COL6A2. {ECO:0000250}.				activation of MAPK activity (GO:0000187)|angiogenesis (GO:0001525)|carbohydrate metabolic process (GO:0005975)|cell proliferation (GO:0008283)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|intracellular signal transduction (GO:0035556)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|small molecule metabolic process (GO:0044281)|tissue remodeling (GO:0048771)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell projection (GO:0042995)|cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)	protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)			breast(1)|cervix(2)|endometrium(5)|kidney(5)|large_intestine(3)|liver(2)|lung(18)|ovary(2)|pancreas(2)|prostate(4)|skin(4)	48						TGGTCATTCACGGGCTGGATG	0.627																																																	0													48.0	52.0	51.0					15																	75980366		2197	4291	6488	SO:0001583	missense	0			X96753, AY359468	CCDS10284.1	15q24.2	2010-04-19	2007-02-16		ENSG00000173546	ENSG00000173546		"""Proteoglycans / Cell surface : Other"""	2466	protein-coding gene	gene with protein product	"""melanoma-associated chondroitin sulfate proteoglycan"""	601172	"""chondroitin sulfate proteoglycan 4 (melanoma-associated)"""			8790396, 16407841	Standard	NM_001897		Approved	MCSPG, MEL-CSPG, MSK16, NG2, MCSP, HMW-MAA	uc002baw.3	Q6UVK1	OTTHUMG00000142836	ENST00000308508.5:c.3040G>A	15.37:g.75980366C>T	ENSP00000312506:p.Val1014Met		D3DW77|Q92675	Missense_Mutation	SNP	pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,pfscan_Laminin_G	p.V1014M	ENST00000308508.5	37	c.3040	CCDS10284.1	15	.	.	.	.	.	.	.	.	.	.	.	13.21	2.169897	0.38315	.	.	ENSG00000173546	ENST00000308508	T	0.48836	0.8	4.89	3.96	0.45880	.	0.101850	0.41712	D	0.000828	T	0.59662	0.2210	M	0.63843	1.955	0.22424	N	0.999111	D	0.89917	1.0	P	0.62435	0.902	T	0.51164	-0.8740	10	0.49607	T	0.09	.	11.282	0.49199	0.0:0.8489:0.0:0.1511	.	1014	Q6UVK1	CSPG4_HUMAN	M	1014	ENSP00000312506:V1014M	ENSP00000312506:V1014M	V	-	1	0	CSPG4	73767421	0.001000	0.12720	0.635000	0.29338	0.646000	0.38490	0.611000	0.24268	2.253000	0.74438	0.555000	0.69702	GTG	CSPG4	-	NULL	ENSG00000173546		0.627	CSPG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSPG4	HGNC	protein_coding	OTTHUMT00000286472.1	-	0.00	43	0	C	NM_001897		75980366	-1	tier1	-	no_errors	ENST00000308508	ensembl	human	known	74_37	missense	17.44	71	15	SNP	0.418	T
DCLRE1C	64421	genome.wustl.edu	37	10	14950954	14950955	+	Missense_Mutation	DNP	GT	GT	TG			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	G|T	G|T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr10:14950954_14950955GT>TG	ENST00000378278.2	-	14	1568_1569	c.1531_1532AC>CA	c.(1531-1533)ACa>CAa	p.T511Q	DCLRE1C_ENST00000378254.1_Missense_Mutation_p.T391Q|DCLRE1C_ENST00000378246.2_Missense_Mutation_p.T396Q|DCLRE1C_ENST00000378249.1_Missense_Mutation_p.T396Q|DCLRE1C_ENST00000357717.2_Missense_Mutation_p.T396Q|DCLRE1C_ENST00000378258.1_Missense_Mutation_p.T391Q|DCLRE1C_ENST00000453695.2_Missense_Mutation_p.T391Q|DCLRE1C_ENST00000378242.1_Missense_Mutation_p.T164Q|DCLRE1C_ENST00000378289.4_Intron|DCLRE1C_ENST00000378255.1_Missense_Mutation_p.T391Q|DCLRE1C_ENST00000492201.1_5'UTR|DCLRE1C_ENST00000396817.2_Missense_Mutation_p.T391Q			Q96SD1	DCR1C_HUMAN	DNA cross-link repair 1C	511					B cell differentiation (GO:0030183)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA recombination (GO:0006310)|double-strand break repair (GO:0006302)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|response to ionizing radiation (GO:0010212)|telomere maintenance (GO:0000723)	nucleus (GO:0005634)	5'-3' exonuclease activity (GO:0008409)|single-stranded DNA endodeoxyribonuclease activity (GO:0000014)			breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)	17						CCCTGCCACTGTGGAGGAAGGG	0.45								Non-homologous end-joining																																									0																																										SO:0001583	missense	0			BC022254	CCDS7105.1, CCDS31149.1, CCDS31150.1	10p13	2014-09-17	2010-06-24		ENSG00000152457	ENSG00000152457			17642	protein-coding gene	gene with protein product	"""PSO2 homolog (S. cerevisiae)"""	605988	"""severe combined immunodeficiency, type a (Athabascan)"", ""DNA cross-link repair 1C (PSO2 homolog, S. cerevisiae)"""	SCIDA		11336668, 9443881	Standard	XM_005252558		Approved	ARTEMIS, FLJ11360, SNM1C, A-SCID	uc001inn.3	Q96SD1	OTTHUMG00000017716	ENST00000378278.2:c.1531_1532delinsTG	10.37:g.14950954_14950955delinsTG	ENSP00000367527:p.Thr511Gln		D3DRT6|Q1HCL2|Q5JSR4|Q5JSR5|Q5JSR7|Q5JSR8|Q5JSR9|Q5JSS0|Q5JSS7|Q6PK14|Q8N101|Q8N132|Q8TBW9|Q9BVW9|Q9HAM4	Missense_Mutation	SNP	pfam_DRMBL	p.T511K|p.T511P	ENST00000378278.2	37	c.1532|c.1531	CCDS31149.1	10																																																																																			DCLRE1C	-	NULL	ENSG00000152457		0.450	DCLRE1C-009	KNOWN	basic|appris_principal|CCDS	protein_coding	DCLRE1C	HGNC	protein_coding	OTTHUMT00000046934.1	-	0.00	36|35	0	G|T	NM_022487		14950954|14950955	-1	tier1	-	no_errors	ENST00000378278	ensembl	human	known	74_37	missense	22.89	64	19	SNP	0.957|0.958	T|G
CUBN	8029	genome.wustl.edu	37	10	17171716	17171716	+	Missense_Mutation	SNP	T	T	C			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr10:17171716T>C	ENST00000377833.4	-	1	114	c.49A>G	c.(49-51)Ata>Gta	p.I17V	CUBN_ENST00000377823.1_Missense_Mutation_p.I17V	NM_001081.3	NP_001072.2	O60494	CUBN_HUMAN	cubilin (intrinsic factor-cobalamin receptor)	17					cholesterol metabolic process (GO:0008203)|cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|tissue homeostasis (GO:0001894)|vitamin D metabolic process (GO:0042359)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|cobalamin binding (GO:0031419)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)|transporter activity (GO:0005215)			breast(8)|central_nervous_system(4)|cervix(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(42)|liver(1)|lung(107)|ovary(9)|pancreas(2)|prostate(3)|skin(9)|stomach(3)|upper_aerodigestive_tract(11)|urinary_tract(8)	241					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	TCAGCAAATATTAATAAGGTA	0.428																																																	0													157.0	152.0	154.0					10																	17171716		2203	4300	6503	SO:0001583	missense	0			AF034611	CCDS7113.1	10p12	2014-09-17			ENSG00000107611	ENSG00000107611			2548	protein-coding gene	gene with protein product		602997		MGA1		9572993, 9478979	Standard	NM_001081		Approved	IFCR, gp280	uc001ioo.3	O60494	OTTHUMG00000017741	ENST00000377833.4:c.49A>G	10.37:g.17171716T>C	ENSP00000367064:p.Ile17Val		B0YIZ4|Q5VTA6|Q96RU9	Missense_Mutation	SNP	pfam_CUB_dom,pfam_EG-like_dom,pfam_EGF-like_Ca-bd_dom,superfamily_CUB_dom,superfamily_Growth_fac_rcpt_N_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,smart_CUB_dom,pfscan_CUB_dom,pfscan_EG-like_dom	p.I17V	ENST00000377833.4	37	c.49	CCDS7113.1	10	.	.	.	.	.	.	.	.	.	.	T	0.005	-2.150314	0.00328	.	.	ENSG00000107611	ENST00000377833;ENST00000377823	T;D	0.89270	-0.86;-2.49	5.3	-0.325	0.12702	.	1.025100	0.07812	N	0.958279	T	0.73513	0.3596	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.09377	0.004	T	0.59263	-0.7487	10	0.34782	T	0.22	.	2.6368	0.04960	0.1384:0.0797:0.2867:0.4952	.	17	O60494	CUBN_HUMAN	V	17	ENSP00000367064:I17V;ENSP00000367054:I17V	ENSP00000367054:I17V	I	-	1	0	CUBN	17211722	0.005000	0.15991	0.003000	0.11579	0.013000	0.08279	0.149000	0.16243	0.059000	0.16252	0.482000	0.46254	ATA	CUBN	-	NULL	ENSG00000107611		0.428	CUBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CUBN	HGNC	protein_coding	OTTHUMT00000047009.1	-	0.00	65	0	T	NM_001081		17171716	-1	tier1	-	no_errors	ENST00000377833	ensembl	human	known	74_37	missense	25.98	94	33	SNP	0.004	C
DDIT4	54541	genome.wustl.edu	37	10	74034859	74034859	+	Silent	SNP	C	C	T			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr10:74034859C>T	ENST00000307365.3	+	3	813	c.612C>T	c.(610-612)ttC>ttT	p.F204F	RP11-442H21.2_ENST00000491934.2_RNA	NM_019058.2	NP_061931.1	Q9NX09	DDIT4_HUMAN	DNA-damage-inducible transcript 4	204					brain development (GO:0007420)|cell proliferation (GO:0008283)|defense response to virus (GO:0051607)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|negative regulation of glycolytic process (GO:0045820)|negative regulation of intracellular signal transduction (GO:1902532)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|negative regulation of peptidyl-threonine phosphorylation (GO:0010801)|negative regulation of TOR signaling (GO:0032007)|neuron differentiation (GO:0030182)|neuron migration (GO:0001764)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of neuron death (GO:1901216)|protein complex disassembly (GO:0043241)|reactive oxygen species metabolic process (GO:0072593)|response to hypoxia (GO:0001666)	cytoplasm (GO:0005737)|intracellular (GO:0005622)|mitochondrion (GO:0005739)				cervix(1)|endometrium(2)|lung(5)|pancreas(1)|prostate(2)|urinary_tract(1)	12						TCCCTGGCTTCAGCCAGTCCC	0.582											OREG0020262	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													23.0	22.0	22.0					10																	74034859		2202	4299	6501	SO:0001819	synonymous_variant	0			AK000507	CCDS7315.1	10q22.1	2008-05-14			ENSG00000168209	ENSG00000168209			24944	protein-coding gene	gene with protein product	"""HIF-1 responsive RTP801"""	607729				11884613	Standard	NM_019058		Approved	RTP801, FLJ20500, REDD-1, REDD1, Dig2	uc001jsx.1	Q9NX09	OTTHUMG00000018435	ENST00000307365.3:c.612C>T	10.37:g.74034859C>T		1149	Q9H0S3	Silent	SNP	pfam_RTP801-like	p.F204	ENST00000307365.3	37	c.612	CCDS7315.1	10																																																																																			DDIT4	-	pfam_RTP801-like	ENSG00000168209		0.582	DDIT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDIT4	HGNC	protein_coding	OTTHUMT00000048577.1	-	0.00	29	0	C	NM_019058		74034859	+1	tier1	-	no_errors	ENST00000307365	ensembl	human	known	74_37	silent	45.95	20	17	SNP	1.000	T
DNAH2	146754	genome.wustl.edu	37	17	7719967	7719967	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr17:7719967G>A	ENST00000572933.1	+	64	11268	c.9808G>A	c.(9808-9810)Gaa>Aaa	p.E3270K	DNAH2_ENST00000389173.2_Missense_Mutation_p.E3270K			Q9P225	DYH2_HUMAN	dynein, axonemal, heavy chain 2	3270	Stalk. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(3)|breast(11)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(53)|liver(2)|lung(49)|ovary(7)|prostate(7)|skin(15)|upper_aerodigestive_tract(1)|urinary_tract(1)	189		all_cancers(10;4.66e-07)|Prostate(122;0.081)				CAAGAAGTCTGAAGAGATGGA	0.537																																																	0													152.0	139.0	143.0					17																	7719967		2203	4300	6503	SO:0001583	missense	0			U83570, AK128517	CCDS32551.1	17p13.1	2007-10-05	2006-09-04			ENSG00000183914		"""Axonemal dyneins"""	2948	protein-coding gene	gene with protein product		603333	"""dynein, axonemal, heavy polypeptide 2"", ""dynein heavy chain domain 3"""	DNHD3		9256245	Standard	XM_005256470		Approved	KIAA1503, FLJ46675	uc002giu.1	Q9P225		ENST00000572933.1:c.9808G>A	17.37:g.7719967G>A	ENSP00000458355:p.Glu3270Lys		A8K992|B5MDX5|O15434|Q6PIH3|Q6ZR42	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,pfam_Dynein_heavy_dom-1,pfam_ATPase_dyneun-rel_AAA,pfam_ATPase_AAA_core,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.E3270K	ENST00000572933.1	37	c.9808	CCDS32551.1	17	.	.	.	.	.	.	.	.	.	.	G	18.35	3.605066	0.66445	.	.	ENSG00000183914	ENST00000360606;ENST00000389173	T	0.77358	-1.09	4.58	3.61	0.41365	Dynein heavy chain, coiled coil stalk (1);	0.179711	0.48286	N	0.000194	T	0.72851	0.3512	L	0.55017	1.72	0.80722	D	1	B;B	0.12013	0.004;0.005	B;B	0.22880	0.025;0.042	T	0.71163	-0.4673	10	0.52906	T	0.07	.	11.9592	0.52999	0.0867:0.0:0.9133:0.0	.	3231;3270	Q9P225-2;Q9P225	.;DYH2_HUMAN	K	3231;3270	ENSP00000373825:E3270K	ENSP00000353818:E3231K	E	+	1	0	DNAH2	7660692	1.000000	0.71417	0.534000	0.28014	0.987000	0.75469	5.123000	0.64703	1.284000	0.44531	0.561000	0.74099	GAA	DNAH2	-	NULL	ENSG00000183914		0.537	DNAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH2	HGNC	protein_coding	OTTHUMT00000440241.1	-	0.00	68	0	G	NM_020877		7719967	+1	tier1	-	no_errors	ENST00000389173	ensembl	human	known	74_37	missense	30.00	49	21	SNP	0.992	A
DNAJC11	55735	genome.wustl.edu	37	1	6694732	6694732	+	3'UTR	SNP	C	C	T			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr1:6694732C>T	ENST00000377577.5	-	0	2806				THAP3_ENST00000377627.3_3'UTR|DNAJC11_ENST00000349363.6_Missense_Mutation_p.E271K|DNAJC11_ENST00000465508.1_5'UTR	NM_018198.3	NP_060668.2	Q9NVH1	DJC11_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 11							extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)				NS(1)|breast(2)|endometrium(4)|kidney(2)|large_intestine(11)|lung(8)|ovary(2)|skin(1)|urinary_tract(1)	32	Ovarian(185;0.0265)|all_lung(157;0.154)	all_cancers(23;1.97e-27)|all_epithelial(116;1.76e-17)|all_lung(118;2.27e-05)|Lung NSC(185;9.97e-05)|Renal(390;0.00188)|Breast(487;0.00289)|Colorectal(325;0.00342)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.156)		Colorectal(212;2.34e-07)|COAD - Colon adenocarcinoma(227;2.05e-05)|Kidney(185;7.67e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000639)|KIRC - Kidney renal clear cell carcinoma(229;0.00128)|STAD - Stomach adenocarcinoma(132;0.00179)|READ - Rectum adenocarcinoma(331;0.0649)		CCGCTGCATTCTGCATCCCAA	0.637											OREG0013046	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													28.0	28.0	28.0					1																	6694732		876	1991	2867	SO:0001624	3_prime_UTR_variant	0			AF306695	CCDS87.1	1p36.23	2011-09-02			ENSG00000007923	ENSG00000007923		"""Heat shock proteins / DNAJ (HSP40)"""	25570	protein-coding gene	gene with protein product		614827				12964007	Standard	NM_018198		Approved	FLJ10737	uc001aof.2	Q9NVH1	OTTHUMG00000001443	ENST00000377577.5:c.*1003G>A	1.37:g.6694732C>T		636	Q4VWF5|Q5VZN0|Q6PK20|Q6PK70|Q8NDM2|Q96CL7	Missense_Mutation	SNP	pfam_DnaJ_domain,superfamily_DnaJ_domain,pfscan_DnaJ_domain,prints_DnaJ_domain	p.E271K	ENST00000377577.5	37	c.811	CCDS87.1	1	.	.	.	.	.	.	.	.	.	.	C	12.97	2.096550	0.36952	.	.	ENSG00000007923	ENST00000451196;ENST00000349363	T;T	0.37752	1.61;1.18	2.94	1.94	0.25998	.	.	.	.	.	T	0.26085	0.0636	.	.	.	0.19300	N	0.99997	B	0.20261	0.043	B	0.19391	0.025	T	0.22382	-1.0218	8	0.51188	T	0.08	.	6.8364	0.23939	0.2774:0.7226:0.0:0.0	.	285	Q5TH61	.	K	285;271	ENSP00000415871:E285K;ENSP00000326304:E271K	ENSP00000326304:E271K	E	-	1	0	DNAJC11	6617319	0.005000	0.15991	0.003000	0.11579	0.055000	0.15305	0.417000	0.21214	0.496000	0.27904	0.462000	0.41574	GAA	DNAJC11	-	NULL	ENSG00000007923		0.637	DNAJC11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAJC11	HGNC	protein_coding	OTTHUMT00000004216.3	-	0.00	29	0	C	NM_018198		6694732	-1	tier1	-	no_errors	ENST00000349363	ensembl	human	known	74_37	missense	33.33	26	13	SNP	0.010	T
DPP10	57628	genome.wustl.edu	37	2	116525872	116525872	+	Splice_Site	SNP	G	G	T			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr2:116525872G>T	ENST00000410059.1	+	13	1593		c.e13-1		DPP10_ENST00000393147.2_Splice_Site|DPP10_ENST00000409163.1_Splice_Site|DPP10_ENST00000310323.8_Splice_Site	NM_001178037.1|NM_020868.3	NP_001171508.1|NP_065919	Q8N608	DPP10_HUMAN	dipeptidyl-peptidase 10 (non-functional)							integral component of membrane (GO:0016021)|membrane (GO:0016020)	serine-type peptidase activity (GO:0008236)			breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(24)|liver(2)|lung(48)|ovary(6)|prostate(1)|skin(5)|soft_tissue(1)	101						CTGTATTTTAGAATGAGGAGC	0.428																																																	0													106.0	101.0	103.0					2																	116525872		2203	4300	6503	SO:0001630	splice_region_variant	0			AY172661	CCDS33278.1, CCDS46400.1, CCDS54388.1, CCDS54389.1	2q14.1	2010-05-04	2010-05-04		ENSG00000175497	ENSG00000175497			20823	protein-coding gene	gene with protein product		608209	"""dipeptidylpeptidase 10"", ""dipeptidyl-peptidase 10"""			10819331, 12662155	Standard	NM_020868		Approved	DPRP3	uc002tle.3	Q8N608	OTTHUMG00000153294	ENST00000410059.1:c.1114-1G>T	2.37:g.116525872G>T			A8K1Q2|J3KPP2|J3KQ46|Q0GLB8|Q53QT3|Q53S86|Q53SL8|Q53SS4|Q6TTV4|Q86YR9|Q9P236	Splice_Site	SNP	-	e13-1	ENST00000410059.1	37	c.1126-1	CCDS46400.1	2	.	.	.	.	.	.	.	.	.	.	G	23.1	4.368861	0.82463	.	.	ENSG00000175497	ENST00000410059;ENST00000409163;ENST00000393147;ENST00000310323;ENST00000476155	.	.	.	5.25	5.25	0.73442	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.5891	0.87991	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	DPP10	116242342	1.000000	0.71417	1.000000	0.80357	0.885000	0.51271	8.473000	0.90410	2.724000	0.93272	0.655000	0.94253	.	DPP10	-	-	ENSG00000175497		0.428	DPP10-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	DPP10	HGNC	protein_coding	OTTHUMT00000330580.4	-	0.00	29	0	G	NM_020868	Intron	116525872	+1	tier1	-	no_errors	ENST00000393147	ensembl	human	known	74_37	splice_site	25.00	27	9	SNP	1.000	T
DOCK10	55619	genome.wustl.edu	37	2	225664979	225664979	+	Splice_Site	SNP	G	G	T			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr2:225664979G>T	ENST00000258390.7	-	41	4462	c.4395C>A	c.(4393-4395)agC>agA	p.S1465R	DOCK10_ENST00000409592.3_Splice_Site_p.S1459R	NM_014689.2	NP_055504.2	Q96BY6	DOC10_HUMAN	dedicator of cytokinesis 10	1465					regulation of cell migration (GO:0030334)|small GTPase mediated signal transduction (GO:0007264)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(3)|cervix(1)|endometrium(6)|kidney(10)|large_intestine(16)|lung(40)|ovary(2)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	87		Renal(207;0.0113)|all_lung(227;0.0486)|Lung NSC(271;0.0653)|all_hematologic(139;0.14)		Epithelial(121;2.37e-10)|all cancers(144;2.26e-07)|Lung(261;0.0143)|LUSC - Lung squamous cell carcinoma(224;0.0178)		CATTGGAGTTGCCTATAAAAT	0.378																																																	0													87.0	80.0	82.0					2																	225664979		1846	4095	5941	SO:0001630	splice_region_variant	0			AB014594	CCDS46528.1, CCDS74661.1	2q36.3	2013-01-10			ENSG00000135905	ENSG00000135905		"""Pleckstrin homology (PH) domain containing"""	23479	protein-coding gene	gene with protein product	"""zizimin3"""	611518				12432077	Standard	NM_014689		Approved	ZIZ3, KIAA0694	uc010fwz.1	Q96BY6	OTTHUMG00000153428	ENST00000258390.7:c.4394-1C>A	2.37:g.225664979G>T			B3FL70|O75178|Q9NW06|Q9NXI8	Missense_Mutation	SNP	pfam_DOCK_C,pfam_DOCK_C/D_N,pfam_Pleckstrin_homology,superfamily_ARM-type_fold,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.S1465R	ENST00000258390.7	37	c.4395	CCDS46528.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	8.709|8.709	0.911644|0.911644	0.17833|0.17833	.|.	.|.	ENSG00000135905|ENSG00000135905	ENST00000422684|ENST00000409592;ENST00000258390;ENST00000373702	.|T;T	.|0.67865	.|3.49;-0.29	5.65|5.65	3.81|3.81	0.43845|0.43845	.|.	.|0.450854	.|0.29145	.|N	.|0.013004	T|T	0.45796|0.45796	0.1360|0.1360	N|N	0.19112|0.19112	0.55|0.55	0.29738|0.29738	N|N	0.83733|0.83733	.|P;B;P;B	.|0.47841	.|0.536;0.165;0.901;0.186	.|B;B;B;B	.|0.38616	.|0.189;0.043;0.277;0.122	T|T	0.43956|0.43956	-0.9359|-0.9359	5|10	.|0.25751	.|T	.|0.34	.|.	9.7563|9.7563	0.40504|0.40504	0.2697:0.0:0.7303:0.0|0.2697:0.0:0.7303:0.0	.|.	.|1465;319;1459;127	.|Q96BY6;B4DF07;B3FL70;B4DEY4	.|DOC10_HUMAN;.;.;.	E|R	347|1459;1465;3	.|ENSP00000386694:S1459R;ENSP00000258390:S1465R	.|ENSP00000258390:S1465R	A|S	-|-	2|3	0|2	DOCK10|DOCK10	225373223|225373223	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.617000|0.617000	0.37484|0.37484	1.051000|1.051000	0.30417|0.30417	1.505000|1.505000	0.48720|0.48720	0.650000|0.650000	0.86243|0.86243	GCA|AGC	DOCK10	-	superfamily_ARM-type_fold	ENSG00000135905		0.378	DOCK10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK10	HGNC	protein_coding	OTTHUMT00000331246.1		0.00	12	0	G		Missense_Mutation	225664979	-1			no_errors	ENST00000258390	ensembl	human	known	74_37	missense	10.00	36	4	SNP	1.000	T
DPP6	1804	genome.wustl.edu	37	7	154667636	154667636	+	Missense_Mutation	SNP	A	A	T			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr7:154667636A>T	ENST00000377770.3	+	20	2045	c.1904A>T	c.(1903-1905)cAg>cTg	p.Q635L	DPP6_ENST00000332007.3_Missense_Mutation_p.Q573L|DPP6_ENST00000404039.1_Missense_Mutation_p.Q571L|DPP6_ENST00000427557.1_Missense_Mutation_p.Q528L			P42658	DPP6_HUMAN	dipeptidyl-peptidase 6	635					cell death (GO:0008219)|neuronal action potential (GO:0019228)|positive regulation of potassium ion transmembrane transport (GO:1901381)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	dipeptidyl-peptidase activity (GO:0008239)|serine-type peptidase activity (GO:0008236)			NS(3)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(4)|lung(35)|pancreas(4)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	71	all_neural(206;0.181)	all_hematologic(28;0.0044)|all_lung(21;0.0176)|Lung NSC(21;0.0204)	OV - Ovarian serous cystadenocarcinoma(82;0.0562)			CCAGGCAGCCAGAGTGTGGCT	0.647																																					NSCLC(125;1384 1783 2490 7422 34254)												0													26.0	31.0	29.0					7																	154667636		2074	4189	6263	SO:0001583	missense	0			M96859	CCDS75682.1, CCDS75683.1, CCDS75684.1	7q36.2	2006-08-07	2006-01-12		ENSG00000130226	ENSG00000130226			3010	protein-coding gene	gene with protein product		126141	"""dipeptidylpeptidase VI"", ""dipeptidylpeptidase 6"""			1729689	Standard	XM_006715871		Approved	DPPX	uc003wlk.3	P42658	OTTHUMG00000151511	ENST00000377770.3:c.1904A>T	7.37:g.154667636A>T	ENSP00000367001:p.Gln635Leu			Missense_Mutation	SNP	pfam_Peptidase_S9B,pfam_Peptidase_S9,pfam_PD40	p.Q635L	ENST00000377770.3	37	c.1904		7	.	.	.	.	.	.	.	.	.	.	A	16.92	3.254462	0.59212	.	.	ENSG00000130226	ENST00000404039;ENST00000377770;ENST00000332007;ENST00000427557	T;T;T;T	0.43688	0.94;0.94;0.94;0.94	4.92	4.92	0.64577	.	0.000000	0.85682	D	0.000000	T	0.70107	0.3186	M	0.93241	3.395	0.80722	D	1	D;P;D;P	0.56035	0.971;0.83;0.974;0.858	P;B;P;B	0.61070	0.883;0.316;0.644;0.281	T	0.79636	-0.1721	10	0.87932	D	0	-22.7146	14.5321	0.67934	1.0:0.0:0.0:0.0	.	528;573;635;571	E9PDL2;P42658-2;P42658;E9PF59	.;.;DPP6_HUMAN;.	L	571;635;573;528	ENSP00000385578:Q571L;ENSP00000367001:Q635L;ENSP00000328226:Q573L;ENSP00000397303:Q528L	ENSP00000328226:Q573L	Q	+	2	0	DPP6	154298569	1.000000	0.71417	1.000000	0.80357	0.071000	0.16799	8.890000	0.92477	1.820000	0.53075	0.352000	0.21897	CAG	DPP6	-	NULL	ENSG00000130226		0.647	DPP6-003	KNOWN	basic|appris_principal	protein_coding	DPP6	HGNC	protein_coding	OTTHUMT00000322932.1	-	0.00	95	0	A	NM_130797		154667636	+1	tier1	-	no_errors	ENST00000377770	ensembl	human	known	74_37	missense	55.56	24	30	SNP	1.000	T
DST	667	genome.wustl.edu	37	6	56470194	56470194	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr6:56470194C>T	ENST00000361203.3	-	36	8606	c.8599G>A	c.(8599-8601)Ggt>Agt	p.G2867S	DST_ENST00000370788.2_Intron|DST_ENST00000244364.6_Intron|DST_ENST00000312431.6_Missense_Mutation_p.G2867S|DST_ENST00000370769.4_Missense_Mutation_p.G2867S|DST_ENST00000421834.2_Intron|DST_ENST00000446842.2_Missense_Mutation_p.G2541S|DST_ENST00000370754.5_Missense_Mutation_p.G3045S			Q03001	DYST_HUMAN	dystonin	2867					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)			NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			GTATTTTTACCAGGCAAAAGT	0.333																																																	0													99.0	91.0	93.0					6																	56470194		1820	4075	5895	SO:0001583	missense	0			M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000361203.3:c.8599G>A	6.37:g.56470194C>T	ENSP00000354508:p.Gly2867Ser		B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_Plectin_repeat,pfam_CH-domain,pfam_GAS2_dom,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_GAS2_dom,superfamily_ABC1_TM_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Plectin_repeat,smart_EF_hand_dom,smart_GAS2_dom,pfscan_CH-domain,pfscan_EF_hand_dom	p.G3045S	ENST00000361203.3	37	c.9133		6	.	.	.	.	.	.	.	.	.	.	C	5.346	0.249119	0.10130	.	.	ENSG00000151914	ENST00000370754;ENST00000370769;ENST00000446842;ENST00000312431;ENST00000361203;ENST00000439203	T;T;T;T;T;T	0.79247	0.22;0.23;1.18;-1.25;0.22;-0.03	6.03	-0.583	0.11706	.	1.197490	0.05800	N	0.612005	T	0.33614	0.0869	.	.	.	0.24345	N	0.994944	B	0.06786	0.001	B	0.04013	0.001	T	0.02933	-1.1092	8	0.15952	T	0.53	.	4.0837	0.09937	0.3149:0.3334:0.0:0.3517	.	2541	Q03001-9	.	S	3045;2867;2541;2867;2867;2541	ENSP00000359790:G3045S;ENSP00000359805:G2867S;ENSP00000393645:G2541S;ENSP00000307959:G2867S;ENSP00000354508:G2867S;ENSP00000404924:G2541S	ENSP00000307959:G2867S	G	-	1	0	DST	56578153	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.400000	0.07241	-0.314000	0.08716	-0.302000	0.09304	GGT	DST	-	superfamily_ABC1_TM_dom	ENSG00000151914		0.333	DST-004	NOVEL	not_organism_supported|basic|appris_candidate	protein_coding	DST	HGNC	protein_coding	OTTHUMT00000041021.3	-	0.00	38	0	C	NM_001723		56470194	-1	tier1	-	no_errors	ENST00000370754	ensembl	human	known	74_37	missense	27.54	50	19	SNP	0.000	T
DST	667	genome.wustl.edu	37	6	56472332	56472332	+	Missense_Mutation	SNP	A	A	C			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr6:56472332A>C	ENST00000361203.3	-	36	6468	c.6461T>G	c.(6460-6462)aTa>aGa	p.I2154R	DST_ENST00000370788.2_Intron|DST_ENST00000244364.6_Intron|DST_ENST00000312431.6_Missense_Mutation_p.I2154R|DST_ENST00000370769.4_Missense_Mutation_p.I2154R|DST_ENST00000421834.2_Intron|DST_ENST00000446842.2_Missense_Mutation_p.I1828R|DST_ENST00000370754.5_Missense_Mutation_p.I2332R			Q03001	DYST_HUMAN	dystonin	2154					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)			NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			GTTTGTAAGTATGTTTTCAGA	0.348																																																	0													75.0	64.0	67.0					6																	56472332		1867	4111	5978	SO:0001583	missense	0			M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000361203.3:c.6461T>G	6.37:g.56472332A>C	ENSP00000354508:p.Ile2154Arg		B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_Plectin_repeat,pfam_CH-domain,pfam_GAS2_dom,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_GAS2_dom,superfamily_ABC1_TM_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Plectin_repeat,smart_EF_hand_dom,smart_GAS2_dom,pfscan_CH-domain,pfscan_EF_hand_dom	p.I2332R	ENST00000361203.3	37	c.6995		6	.	.	.	.	.	.	.	.	.	.	A	3.633	-0.075076	0.07184	.	.	ENSG00000151914	ENST00000370754;ENST00000370769;ENST00000446842;ENST00000312431;ENST00000361203;ENST00000439203	T;T;T;D;T;T	0.83075	-0.21;-0.22;0.72;-1.68;-0.22;-0.47	5.4	-0.219	0.13135	.	0.580537	0.15596	N	0.254158	T	0.63200	0.2491	.	.	.	0.28761	N	0.900915	B	0.06786	0.001	B	0.09377	0.004	T	0.50224	-0.8853	8	0.66056	D	0.02	.	12.8945	0.58091	0.4638:0.5362:0.0:0.0	.	1828	Q03001-9	.	R	2332;2154;1828;2154;2154;1828	ENSP00000359790:I2332R;ENSP00000359805:I2154R;ENSP00000393645:I1828R;ENSP00000307959:I2154R;ENSP00000354508:I2154R;ENSP00000404924:I1828R	ENSP00000307959:I2154R	I	-	2	0	DST	56580291	0.000000	0.05858	0.002000	0.10522	0.235000	0.25334	0.182000	0.16900	-0.255000	0.09486	-0.418000	0.06021	ATA	DST	-	superfamily_ABC1_TM_dom	ENSG00000151914		0.348	DST-004	NOVEL	not_organism_supported|basic|appris_candidate	protein_coding	DST	HGNC	protein_coding	OTTHUMT00000041021.3	-	0.00	47	0	A	NM_001723		56472332	-1	tier1	-	no_errors	ENST00000370754	ensembl	human	known	74_37	missense	25.40	47	16	SNP	0.005	C
DYNC1I1	1780	genome.wustl.edu	37	7	95457368	95457368	+	Splice_Site	SNP	G	G	A			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr7:95457368G>A	ENST00000324972.6	+	5	558		c.e5-1		DYNC1I1_ENST00000537881.1_Intron|DYNC1I1_ENST00000457059.1_Splice_Site|DYNC1I1_ENST00000437599.1_Intron|DYNC1I1_ENST00000447467.2_Splice_Site|DYNC1I1_ENST00000359388.4_Intron	NM_004411.4	NP_004402.1	O14576	DC1I1_HUMAN	dynein, cytoplasmic 1, intermediate chain 1						antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|metabolic process (GO:0008152)|vesicle transport along microtubule (GO:0047496)	cytoplasmic dynein complex (GO:0005868)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|kinetochore (GO:0000776)|microtubule (GO:0005874)|perinuclear region of cytoplasm (GO:0048471)|spindle pole (GO:0000922)|vesicle (GO:0031982)	microtubule binding (GO:0008017)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)|spectrin binding (GO:0030507)			NS(2)|autonomic_ganglia(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(27)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	54	all_cancers(62;9.39e-10)|all_epithelial(64;2.28e-09)|Lung NSC(181;0.165)|all_lung(186;0.191)		STAD - Stomach adenocarcinoma(171;0.0957)			TGCACAATTAGGACCCTGCAG	0.428																																																	0													292.0	289.0	290.0					7																	95457368		2203	4300	6503	SO:0001630	splice_region_variant	0			AF063228	CCDS5644.1, CCDS47645.1, CCDS47646.1, CCDS64718.1	7q21.3-q22.1	2013-01-18	2005-11-24	2005-11-24	ENSG00000158560	ENSG00000158560		"""Cytoplasmic dyneins"", ""WD repeat domain containing"""	2963	protein-coding gene	gene with protein product		603772	"""dynein, cytoplasmic, intermediate polypeptide 1"""	DNCI1		10049579, 16260502	Standard	NM_004411		Approved	DNCIC1	uc003uoc.4	O14576	OTTHUMG00000153983	ENST00000324972.6:c.366-1G>A	7.37:g.95457368G>A			B4DME3|F5H050|G5E9K1|Q8TBF7|Q9Y2X1	Splice_Site	SNP	-	e4-1	ENST00000324972.6	37	c.366-1	CCDS5644.1	7	.	.	.	.	.	.	.	.	.	.	G	18.98	3.738687	0.69304	.	.	ENSG00000158560	ENST00000447467;ENST00000324972;ENST00000518089;ENST00000457059	.	.	.	4.59	4.59	0.56863	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.134	0.81465	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	DYNC1I1	95295304	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.243000	0.78219	2.558000	0.86282	0.655000	0.94253	.	DYNC1I1	-	-	ENSG00000158560		0.428	DYNC1I1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DYNC1I1	HGNC	protein_coding	OTTHUMT00000333432.1	-	0.00	82	0	G	NM_004411	Intron	95457368	+1	tier1	-	no_errors	ENST00000324972	ensembl	human	known	74_37	splice_site	43.51	74	57	SNP	1.000	A
DYNC1I2	1781	genome.wustl.edu	37	2	172585301	172585301	+	Silent	SNP	C	C	A			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr2:172585301C>A	ENST00000397119.3	+	14	1499	c.1332C>A	c.(1330-1332)gtC>gtA	p.V444V	DYNC1I2_ENST00000409197.1_Silent_p.V418V|DYNC1I2_ENST00000409453.1_Silent_p.V444V|DYNC1I2_ENST00000358002.6_Silent_p.V436V|DYNC1I2_ENST00000410079.3_Silent_p.V436V|DYNC1I2_ENST00000534253.2_Silent_p.V444V|DYNC1I2_ENST00000263811.4_Silent_p.V438V|DYNC1I2_ENST00000340296.4_Silent_p.V418V|DYNC1I2_ENST00000409317.1_Silent_p.V438V|DYNC1I2_ENST00000508530.1_Silent_p.V418V|DYNC1I2_ENST00000409773.1_Silent_p.V444V	NM_001378.1	NP_001369.1	Q13409	DC1I2_HUMAN	dynein, cytoplasmic 1, intermediate chain 2	444					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|G2/M transition of mitotic cell cycle (GO:0000086)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|transport (GO:0006810)|viral process (GO:0016032)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic dynein complex (GO:0005868)|cytosol (GO:0005829)|microtubule (GO:0005874)|vesicle (GO:0031982)	microtubule motor activity (GO:0003777)			breast(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(2)|ovary(1)	15			OV - Ovarian serous cystadenocarcinoma(117;0.198)			TTGGAGATGTCAACAACTTTG	0.403																																																	0													68.0	65.0	66.0					2																	172585301		1863	4096	5959	SO:0001819	synonymous_variant	0			AK055491	CCDS46450.1, CCDS63054.1, CCDS63056.1, CCDS63057.1	2q31.1	2013-01-10	2005-11-24	2005-11-24	ENSG00000077380	ENSG00000077380		"""Cytoplasmic dyneins"", ""WD repeat domain containing"""	2964	protein-coding gene	gene with protein product		603331	"""dynein, cytoplasmic, intermediate polypeptide 2"""	DNCI2		10049579, 16260502	Standard	NM_001378		Approved		uc002uha.2	Q13409	OTTHUMG00000154061	ENST00000397119.3:c.1332C>A	2.37:g.172585301C>A			B7ZA04|D3DPD4|D3DPD5|D3DPD6|Q32LY9|Q53S84|Q5BJF8|Q7Z4X1|Q96NG7|Q96S87|Q9BXZ5|Q9NT58	Silent	SNP	pfam_Dynein_IC_1/2,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom	p.V444	ENST00000397119.3	37	c.1332	CCDS46450.1	2																																																																																			DYNC1I2	-	superfamily_WD40_repeat_dom,pfscan_WD40_repeat_dom	ENSG00000077380		0.403	DYNC1I2-001	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	DYNC1I2	HGNC	protein_coding	OTTHUMT00000333683.2		0.00	68	0	C	NM_001378		172585301	+1			no_errors	ENST00000397119	ensembl	human	known	74_37	silent	5.00	56	3	SNP	1.000	A
DYNC2H1	79659	genome.wustl.edu	37	11	103031676	103031676	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr11:103031676G>T	ENST00000375735.2	+	29	4538	c.4394G>T	c.(4393-4395)tGc>tTc	p.C1465F	DYNC2H1_ENST00000398093.3_Missense_Mutation_p.C1465F|DYNC2H1_ENST00000334267.7_Intron	NM_001080463.1|NM_001377.2	NP_001073932.1|NP_001368.2	Q8NCM8	DYHC2_HUMAN	dynein, cytoplasmic 2, heavy chain 1	1465	Stem. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|asymmetric protein localization (GO:0008105)|cilium assembly (GO:0042384)|determination of left/right symmetry (GO:0007368)|dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|forebrain development (GO:0030900)|Golgi organization (GO:0007030)|intraciliary retrograde transport (GO:0035721)|positive regulation of smoothened signaling pathway (GO:0045880)|protein processing (GO:0016485)|spinal cord motor neuron differentiation (GO:0021522)	apical part of cell (GO:0045177)|axoneme (GO:0005930)|cytosol (GO:0005829)|dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|motile primary cilium (GO:0031512)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(1)|endometrium(4)|kidney(5)|large_intestine(9)|lung(9)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)	33		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00348)		BRCA - Breast invasive adenocarcinoma(274;0.000177)|Epithelial(105;0.0785)		AACAGTGTTTGCTTTGATGAG	0.269																																																	0													26.0	27.0	27.0					11																	103031676		1778	3983	5761	SO:0001583	missense	0			AB082528	CCDS44717.1, CCDS53701.1	11q21-q22.1	2011-06-02	2005-11-24	2005-11-24	ENSG00000187240	ENSG00000187240		"""Cytoplasmic dyneins"""	2962	protein-coding gene	gene with protein product		603297	"""dynein, cytoplasmic, heavy polypeptide 2"""	DNCH2		9763680, 9373155	Standard	NM_001080463		Approved	hdhc11, DHC2, DHC1b, DYH1B	uc001phn.1	Q8NCM8	OTTHUMG00000165941	ENST00000375735.2:c.4394G>T	11.37:g.103031676G>T	ENSP00000364887:p.Cys1465Phe		O00432|Q16693|Q3C1U8|Q4AC93|Q6ZMX7|Q6ZUM6|Q7Z363|Q8N977|Q92815|Q9HAE4	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,pfam_Dynein_heavy_dom-1,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.C1465F	ENST00000375735.2	37	c.4394	CCDS53701.1	11	.	.	.	.	.	.	.	.	.	.	G	11.41	1.632026	0.29068	.	.	ENSG00000187240	ENST00000375735;ENST00000398093	T;T	0.60548	0.18;0.18	5.33	5.33	0.75918	Dynein heavy chain, domain-2 (1);	0.565553	0.14589	U	0.310377	T	0.50205	0.1602	L	0.39898	1.24	0.32612	N	0.524495	B;B	0.26400	0.148;0.122	B;B	0.19391	0.025;0.024	T	0.59674	-0.7410	10	0.59425	D	0.04	.	14.077	0.64895	0.0:0.0:0.85:0.15	.	1465;1465	Q8NCM8;Q8NCM8-2	DYHC2_HUMAN;.	F	1465	ENSP00000364887:C1465F;ENSP00000381167:C1465F	ENSP00000364887:C1465F	C	+	2	0	DYNC2H1	102536886	1.000000	0.71417	0.998000	0.56505	0.867000	0.49689	1.687000	0.37680	2.652000	0.90054	0.467000	0.42956	TGC	DYNC2H1	-	pfam_Dynein_heavy_dom-2	ENSG00000187240		0.269	DYNC2H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DYNC2H1	HGNC	protein_coding	OTTHUMT00000387196.1	-	0.00	27	0	G	XM_370652		103031676	+1	tier1	-	no_errors	ENST00000398093	ensembl	human	known	74_37	missense	9.52	38	4	SNP	0.998	T
EDC3	80153	genome.wustl.edu	37	15	74925075	74925075	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr15:74925075C>T	ENST00000315127.4	-	7	1586	c.1405G>A	c.(1405-1407)Gag>Aag	p.E469K	EDC3_ENST00000426797.3_Missense_Mutation_p.E469K|EDC3_ENST00000568176.1_Missense_Mutation_p.E469K	NM_001142444.1|NM_025083.3	NP_001135916.1|NP_079359.2	Q96F86	EDC3_HUMAN	enhancer of mRNA decapping 3	469	YjeF N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00719}.				exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA metabolic process (GO:0016070)	cytosol (GO:0005829)|membrane (GO:0016020)	identical protein binding (GO:0042802)|RNA binding (GO:0003723)			breast(3)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(2)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	16						CCTGCGTGCTCCCCCAGTGGC	0.577											OREG0023286	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													78.0	68.0	71.0					15																	74925075		2197	4296	6493	SO:0001583	missense	0			BC011534	CCDS10267.1	15q24.1	2013-05-02	2013-05-02	2006-07-07	ENSG00000179151	ENSG00000179151			26114	protein-coding gene	gene with protein product		609842	"""yjeF domain containing (E.coli)"", ""LSM16 homolog (EDC3, S. cerevisiae)"", ""enhancer of mRNA decapping 3 homolog (S. cerevisiae)"""	YJDC, LSM16		15225602, 17533573, 22483619	Standard	NM_025083		Approved	FLJ21128, hYjeF_N2-15q23, YJEFN2	uc002aym.3	Q96F86	OTTHUMG00000142815	ENST00000315127.4:c.1405G>A	15.37:g.74925075C>T	ENSP00000320503:p.Glu469Lys	1156	B3KPH0|D3DW61|Q9H797	Missense_Mutation	SNP	pfam_YjeF_N_dom,pfam_FDF_dom,superfamily_YjeF_N_dom	p.E469K	ENST00000315127.4	37	c.1405	CCDS10267.1	15	.	.	.	.	.	.	.	.	.	.	C	21.5	4.159542	0.78226	.	.	ENSG00000179151	ENST00000315127;ENST00000426797	T;T	0.44482	0.92;0.92	5.52	5.52	0.82312	YjeF-related protein, N-terminal (3);	0.044386	0.85682	D	0.000000	T	0.35770	0.0943	L	0.46157	1.445	0.80722	D	1	P	0.48589	0.912	B	0.39935	0.314	T	0.24905	-1.0147	10	0.06757	T	0.87	-1.3629	19.4249	0.94737	0.0:1.0:0.0:0.0	.	469	Q96F86	EDC3_HUMAN	K	469	ENSP00000320503:E469K;ENSP00000401343:E469K	ENSP00000320503:E469K	E	-	1	0	EDC3	72712128	1.000000	0.71417	0.929000	0.37066	0.812000	0.45895	7.653000	0.83643	2.589000	0.87451	0.561000	0.74099	GAG	EDC3	-	superfamily_YjeF_N_dom	ENSG00000179151		0.577	EDC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EDC3	HGNC	protein_coding	OTTHUMT00000286399.1	-	0.00	40	0	C	NM_025083		74925075	-1	tier1	-	no_errors	ENST00000315127	ensembl	human	known	74_37	missense	8.62	53	5	SNP	1.000	T
EMC1	23065	genome.wustl.edu	37	1	19559220	19559220	+	Nonsense_Mutation	SNP	A	A	T			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr1:19559220A>T	ENST00000477853.1	-	15	1722	c.1680T>A	c.(1678-1680)taT>taA	p.Y560*	RP1-43E13.2_ENST00000437898.1_RNA|EMC1_ENST00000375208.3_Nonsense_Mutation_p.Y538*|EMC1_ENST00000375199.3_Nonsense_Mutation_p.Y559*	NM_001271427.1|NM_001271428.1|NM_015047.2	NP_001258356.1|NP_001258357.1|NP_055862.1	Q8N766	EMC1_HUMAN	ER membrane protein complex subunit 1	560						ER membrane protein complex (GO:0072546)|integral component of membrane (GO:0016021)											CATTGGGTAGATACTGTTTCC	0.473																																																	0													179.0	176.0	177.0					1																	19559220		2203	4300	6503	SO:0001587	stop_gained	0				CCDS190.1, CCDS59190.1, CCDS59191.1	1p36.13	2012-05-23	2012-05-23	2012-05-23	ENSG00000127463	ENSG00000127463			28957	protein-coding gene	gene with protein product			"""KIAA0090"""	KIAA0090		22119785	Standard	NM_015047		Approved		uc001bbo.4	Q8N766	OTTHUMG00000002497	ENST00000477853.1:c.1680T>A	1.37:g.19559220A>T	ENSP00000420608:p.Tyr560*		A8K6F3|Q14700|Q5TG62|Q63HL0|Q63HL3|Q8NBH8	Nonsense_Mutation	SNP	pfam_DUF1620,superfamily_Quinonprotein_ADH-like_supfam	p.Y560*	ENST00000477853.1	37	c.1680	CCDS190.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	36|36	5.971868|5.971868	0.97162|0.97162	.|.	.|.	ENSG00000127463|ENSG00000127463	ENST00000375197|ENST00000477853;ENST00000375199;ENST00000375208	.|.	.|.	.|.	5.94|5.94	4.82|4.82	0.62117|0.62117	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|.	0.48554|.	0.1506|.	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.49457|.	-0.8938|.	4|.	.|.	.|.	.|.	-13.0003|-13.0003	4.0296|4.0296	0.09703|0.09703	0.7407:0.0:0.2593:0.0|0.7407:0.0:0.2593:0.0	.|.	.|.	.|.	.|.	T|X	294|560;559;538	.|.	.|.	S|Y	-|-	1|3	0|2	KIAA0090|KIAA0090	19431807|19431807	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.923000|0.923000	0.55619|0.55619	1.450000|1.450000	0.35134|0.35134	2.272000|2.272000	0.75746|0.75746	0.460000|0.460000	0.39030|0.39030	TCT|TAT	EMC1	-	NULL	ENSG00000127463		0.473	EMC1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EMC1	HGNC	protein_coding	OTTHUMT00000007076.2	-	0.00	54	0	A	NM_015047		19559220	-1	tier1	-	no_errors	ENST00000477853	ensembl	human	known	74_37	nonsense	23.53	52	16	SNP	1.000	T
NRXN1	9378	genome.wustl.edu	37	2	50923314	50923317	+	Intron	DEL	GTGT	GTGT	-	rs202071380|rs201534178|rs200473527		TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	GTGT	GTGT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr2:50923314_50923317delGTGT	ENST00000406316.2	-	6	2309				NRXN1_ENST00000406859.3_Intron|NRXN1_ENST00000405472.3_Intron|AC009234.2_ENST00000401372.1_RNA|NRXN1_ENST00000401669.2_Intron|NRXN1_ENST00000402717.3_Intron|NRXN1_ENST00000404971.1_Intron	NM_004801.4	NP_004792.1	Q9ULB1	NRX1A_HUMAN	neurexin 1						adult behavior (GO:0030534)|axon guidance (GO:0007411)|calcium-dependent cell-cell adhesion (GO:0016339)|cerebellar granule cell differentiation (GO:0021707)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|gamma-aminobutyric acid receptor clustering (GO:0097112)|gephyrin clustering (GO:0097116)|guanylate kinase-associated protein clustering (GO:0097117)|heterophilic cell-cell adhesion (GO:0007157)|learning (GO:0007612)|N-methyl-D-aspartate receptor clustering (GO:0097114)|negative regulation of filopodium assembly (GO:0051490)|neuroligin clustering (GO:0097118)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|neuron maturation (GO:0042551)|neurotransmitter secretion (GO:0007269)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|receptor localization to synapse (GO:0097120)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic vesicle clustering (GO:0097091)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	axonal growth cone (GO:0044295)|cell junction (GO:0030054)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	acetylcholine receptor binding (GO:0033130)|calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)|receptor activity (GO:0004872)			breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(33)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	58		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			Gtacatatacgtgtgtgtgtgtgt	0.436																																																	0																																										SO:0001627	intron_variant	0			AB011150	CCDS1845.1, CCDS46282.1, CCDS54360.1	2p16.3	2008-05-15			ENSG00000179915	ENSG00000179915			8008	protein-coding gene	gene with protein product		600565					Standard	NM_001135659		Approved	KIAA0578, Hs.22998	uc021vhj.1	P58400	OTTHUMG00000129263	ENST00000406316.2:c.833-72561ACAC>-	2.37:g.50923322_50923325delGTGT			A7KRL9|O60323|Q53TJ9|Q53TQ1|Q9C079|Q9C080|Q9C081|Q9H3M2|Q9UDM6	RNA	DEL	-	NULL	ENST00000406316.2	37	NULL	CCDS54360.1	2																																																																																			AC009234.2	-	-	ENSG00000216191		0.436	NRXN1-001	KNOWN	basic|CCDS	protein_coding	ENSG00000216191	Clone_based_ensembl_gene	protein_coding	OTTHUMT00000325291.2		0.00	8	0	GTGT			50923317	-1	tier1		no_errors	ENST00000401372	ensembl	human	novel	74_37	rna	50.00	2	2	DEL	0.006:0.004:0.003:0.002	-
AP001623.1	0	genome.wustl.edu	37	21	43720386	43720387	+	RNA	DEL	GT	GT	-	rs142198765		TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	GT	GT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr21:43720386_43720387delGT	ENST00000401378.1	-	0	68_69																											ACAGGGGCTGgtgtgtgtgtgt	0.55																																																	0										117,2837		8,101,1368						-0.2	0.0		dbSNP_134	70	210,4996		37,136,2430	no	intergenic				45,237,3798	A1A1,A1R,RR		4.0338,3.9607,4.0074				327,7833						0																															21.37:g.43720396_43720397delGT				RNA	DEL	-	NULL	ENST00000401378.1	37	NULL		21																																																																																			AP001623.1	-	-	ENSG00000216197		0.550	AP001623.1-201	NOVEL	basic	miRNA	ENSG00000216197	Clone_based_ensembl_gene	miRNA			0.00	51	0	GT			43720387	-1			no_errors	ENST00000401378	ensembl	human	novel	74_37	rna	6.73	97	7	DEL	0.001:0.000	0
MARK1	4139	genome.wustl.edu	37	1	220835947	220835947	+	3'UTR	SNP	A	A	G			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr1:220835947A>G	ENST00000366918.4	+	0	3313				MARK1_ENST00000402574.1_3'UTR|RP11-322F10.2_ENST00000446040.1_RNA					MAP/microtubule affinity-regulating kinase 1											central_nervous_system(2)|endometrium(9)|kidney(6)|large_intestine(12)|lung(22)|ovary(4)|pancreas(1)|skin(3)|stomach(3)|urinary_tract(1)	63				GBM - Glioblastoma multiforme(131;0.0407)		TTAAAAGTGCATAGAAATAGC	0.274																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AF154845	CCDS31029.2, CCDS65789.1, CCDS73033.1, CCDS73034.1	1q41	2013-06-27			ENSG00000116141	ENSG00000116141			6896	protein-coding gene	gene with protein product		606511				9108484	Standard	NM_018650		Approved	MARK, PAR-1C	uc001hmn.4	Q9P0L2	OTTHUMG00000037351	ENST00000366918.4:c.*439A>G	1.37:g.220835947A>G				RNA	SNP	-	NULL	ENST00000366918.4	37	NULL		1																																																																																			RP11-322F10.2	-	-	ENSG00000225782		0.274	MARK1-001	KNOWN	basic	protein_coding	ENSG00000225782	Clone_based_vega_gene	protein_coding	OTTHUMT00000090898.2	-	0.00	50	0	A			220835947	-1	tier1	-	no_errors	ENST00000446040	ensembl	human	known	74_37	rna	19.77	69	17	SNP	1.000	G
MUC3A	4584	genome.wustl.edu	37	7	100608197	100608198	+	Intron	INS	-	-	GGG	rs373235112		TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr7:100608197_100608198insGGG	ENST00000319509.7	+	6	2041				RP11-395B7.2_ENST00000420080.1_RNA|RP11-395B7.2_ENST00000434775.1_RNA			Q02505	MUC3A_HUMAN	mucin 3A, cell surface associated						cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|extracellular matrix structural constituent (GO:0005201)			breast(3)|central_nervous_system(3)|endometrium(1)|kidney(1)|large_intestine(1)|lung(32)|prostate(3)	44						GCCCCTCCACACTCCCCCAGAC	0.609																																																	0																																										SO:0001627	intron_variant	0			AF113616		7q22.1	2012-04-20	2006-03-14		ENSG00000169894	ENSG00000169894		"""Mucins"""	7513	protein-coding gene	gene with protein product		158371	"""mucin 3A, intestinal"""	MUC3		2393399, 10973822	Standard	XM_006710192		Approved		uc003uxl.1	Q02505	OTTHUMG00000157038	ENST00000319509.7:c.2042-109->GGG	7.37:g.100608197_100608198insGGG			O14650|O14651|O43418|O43421|Q02506|Q6W763|Q9H3Q7|Q9UKW9|Q9UN93|Q9UN94|Q9UN95	RNA	INS	-	NULL	ENST00000319509.7	37	NULL		7																																																																																			RP11-395B7.2	-	-	ENSG00000225946		0.609	MUC3A-001	KNOWN	mRNA_start_NF|cds_start_NF|basic|appris_candidate_longest	protein_coding	ENSG00000225946	Clone_based_vega_gene	protein_coding	OTTHUMT00000347215.1		0.00	19	0	-	XM_001725354		100608198	-1	tier1		no_errors	ENST00000420080	ensembl	human	known	74_37	rna	20.83	19	5	INS	0.000:0.000	GGG
XPC	7508	genome.wustl.edu	37	3	14189622	14189622	+	Intron	SNP	C	C	T	rs543293245		TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr3:14189622C>T	ENST00000285021.7	-	14	2635				AC093495.4_ENST00000428681.3_RNA|AC093495.4_ENST00000420253.1_RNA|XPC_ENST00000449060.2_Intron	NM_001145769.1|NM_004628.4	NP_001139241.1|NP_004619.3	Q01831	XPC_HUMAN	xeroderma pigmentosum, complementation group C						DNA repair (GO:0006281)|intra-S DNA damage checkpoint (GO:0031573)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage recognition (GO:0000715)|nucleotide-excision repair, DNA damage removal (GO:0000718)|regulation of mitotic cell cycle phase transition (GO:1901990)|response to drug (GO:0042493)|response to UV-B (GO:0010224)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|XPC complex (GO:0071942)	bubble DNA binding (GO:0000405)|damaged DNA binding (GO:0003684)|heteroduplex DNA loop binding (GO:0000404)|single-stranded DNA binding (GO:0003697)			NS(1)|breast(2)|endometrium(1)|kidney(3)|large_intestine(4)|lung(5)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						AAGGATGTCGCGGGTCAGCCA	0.607			"""Mis, N, F, S"""			"""skin basal cell, skin squamous cell, melanoma"""		Nucleotide excision repair (NER)	Xeroderma Pigmentosum																														yes	Rec		Xeroderma pigmentosum (C)	3	3p25	7508	"""xeroderma pigmentosum, complementation group C"""		E	0																																										SO:0001627	intron_variant	0	Familial Cancer Database	incl. XPA, XPB, XPC, XPD, XPE, XPF, XPG, XP Variant, XPV		CCDS46763.1	3p25.1	2014-09-17			ENSG00000154767	ENSG00000154767			12816	protein-coding gene	gene with protein product	"""xeroderma pigmentosum group C protein"""	613208				1522891	Standard	NM_004628		Approved	XPCC, RAD4	uc011ave.2	Q01831	OTTHUMG00000155526	ENST00000285021.7:c.2421-121G>A	3.37:g.14189622C>T			B4DIP3|E9PB96|E9PH69|Q53GT7|Q96AX0	RNA	SNP	-	NULL	ENST00000285021.7	37	NULL	CCDS46763.1	3																																																																																			AC093495.4	-	-	ENSG00000228242		0.607	XPC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ENSG00000228242	Clone_based_vega_gene	protein_coding	OTTHUMT00000340517.3	-	0.00	19	0	C	NM_004628		14189622	+1	tier1	-	no_errors	ENST00000420253	ensembl	human	known	74_37	rna	76.92	3	10	SNP	0.000	T
PCDHB6	56130	genome.wustl.edu	37	5	140535760	140535760	+	IGR	SNP	G	G	A			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr5:140535760G>A	ENST00000231136.1	+	0	3030				PCDHB17_ENST00000539533.1_Missense_Mutation_p.A62T	NM_018939.2	NP_061762.1	Q9Y5E3	PCDB6_HUMAN	protocadherin beta 6						calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			cervix(1)|endometrium(14)|kidney(6)|large_intestine(16)|liver(1)|lung(33)|ovary(1)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	84			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GGAACTGGCCGCGAGAGGCGC	0.502																																																	0																																										SO:0001628	intergenic_variant	0			AF152499	CCDS4248.1	5q31	2010-01-26			ENSG00000113211	ENSG00000113211		"""Cadherins / Protocadherins : Clustered"""	8691	other	protocadherin		606332				10380929	Standard	NM_018939		Approved	PCDH-BETA6	uc003lir.3	Q9Y5E3	OTTHUMG00000129623		5.37:g.140535760G>A			B2R8R9	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.A62T	ENST00000231136.1	37	c.184	CCDS4248.1	5	.	.	.	.	.	.	.	.	.	.	G	5.394	0.257819	0.10239	.	.	ENSG00000255622	ENST00000539533	T	0.28666	1.6	5.48	-1.49	0.08718	.	.	.	.	.	T	0.16428	0.0395	.	.	.	.	.	.	B	0.33528	0.416	B	0.33690	0.168	T	0.26292	-1.0107	7	0.26408	T	0.33	.	3.7255	0.08473	0.3084:0.0:0.3214:0.3702	.	62	Q96T98	.	T	62	ENSP00000438685:A62T	ENSP00000438685:A62T	A	+	1	0	AC005754.1	140515944	0.000000	0.05858	0.000000	0.03702	0.101000	0.19017	-0.814000	0.04486	-0.527000	0.06374	0.491000	0.48974	GCG	PCDHB17	-	pfam_Cadherin_N,superfamily_Cadherin-like,pfscan_Cadherin	ENSG00000255622		0.502	PCDHB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000255622	Uniprot_gn	protein_coding	OTTHUMT00000251818.2	-	0.00	26	0	G	NM_018939		140535760	+1	tier1	-	no_errors	ENST00000539533	ensembl	human	known	74_37	missense	51.72	14	15	SNP	0.000	A
GPR146	115330	genome.wustl.edu	37	7	1098155	1098155	+	3'UTR	SNP	C	C	A			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr7:1098155C>A	ENST00000397095.1	+	0	1227				C7orf50_ENST00000357429.6_Intron|GPR146_ENST00000297468.3_3'UTR|C7orf50_ENST00000397098.3_Intron|C7orf50_ENST00000488073.1_Intron|C7orf50_ENST00000397100.2_Intron|RP11-449P15.1_ENST00000549241.1_RNA			Q96CH1	GP146_HUMAN	G protein-coupled receptor 146							integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			autonomic_ganglia(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(1)|ovary(1)|skin(1)	8		Ovarian(82;0.0779)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0178)|OV - Ovarian serous cystadenocarcinoma(56;1.74e-15)		CTGGCGTAGGCGGCCCAGCCC	0.642																																																	0													22.0	25.0	24.0					7																	1098155		2200	4299	6499	SO:0001624	3_prime_UTR_variant	0			BC014241	CCDS5321.1	7p22.3	2012-08-21			ENSG00000164849	ENSG00000164849		"""GPCR / Class A : Orphans"""	21718	protein-coding gene	gene with protein product							Standard	NM_138445		Approved	PGR8	uc003sjy.1	Q96CH1	OTTHUMG00000023934	ENST00000397095.1:c.*2C>A	7.37:g.1098155C>A			Q86SP5	RNA	SNP	-	NULL	ENST00000397095.1	37	NULL	CCDS5321.1	7																																																																																			RP11-449P15.1	-	-	ENSG00000257607		0.642	GPR146-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000257607	Clone_based_vega_gene	protein_coding	OTTHUMT00000206855.1	-	0.00	10	0	C	NM_138445		1098155	-1	tier1	-	no_errors	ENST00000549241	ensembl	human	known	74_37	rna	71.43	2	5	SNP	0.755	A
PRTG	283659	genome.wustl.edu	37	15	55972660	55972661	+	Intron	INS	-	-	T	rs35467969		TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr15:55972660_55972661insT	ENST00000389286.4	-	5	862				RP11-420M1.2_ENST00000561155.1_RNA	NM_173814.4	NP_776175.2			protogenin											breast(1)|endometrium(6)|kidney(4)|large_intestine(7)|liver(1)|lung(18)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	41				all cancers(107;0.00891)|GBM - Glioblastoma multiforme(80;0.135)		AAGGAAAAGACTTTTTTTTTTT	0.322																																																	0																																										SO:0001627	intron_variant	0			AK098622	CCDS42040.1	15q21.3	2013-02-11	2010-06-24		ENSG00000166450	ENSG00000166450		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	26373	protein-coding gene	gene with protein product	"""immunoglobulin superfamily, DCC subclass, member 5"""	613261	"""protogenin homolog (Gallus gallus)"""				Standard	NM_173814		Approved	FLJ25756, IGDCC5	uc002adg.3	Q2VWP7		ENST00000389286.4:c.814+27->A	15.37:g.55972671_55972671dupT				RNA	INS	-	NULL	ENST00000389286.4	37	NULL	CCDS42040.1	15																																																																																			RP11-420M1.2	-	-	ENSG00000259180		0.322	PRTG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000259180	Clone_based_vega_gene	protein_coding	OTTHUMT00000419357.1		0.00	13	0	-	NM_173814		55972661	+1	tier1		no_errors	ENST00000561155	ensembl	human	known	74_37	rna	14.29	18	3	INS	0.000:0.000	T
ZNF551	90233	genome.wustl.edu	37	19	58193488	58193488	+	5'UTR	SNP	C	C	T	rs531782402	byFrequency	TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr19:58193488C>T	ENST00000282296.5	+	0	142				ZNF551_ENST00000356715.4_5'UTR|AC003006.7_ENST00000599221.1_3'UTR|ZNF551_ENST00000596085.1_5'UTR|ZNF551_ENST00000599402.1_3'UTR|AC003006.7_ENST00000594684.1_5'UTR			Q7Z340	ZN551_HUMAN	zinc finger protein 551						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(4)|large_intestine(5)|lung(4)|ovary(1)|prostate(1)	15		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0257)		GACACCACCTCGGGTGAGCTG	0.662													C|||	2	0.000399361	0.0	0.0	5008	,	,		14986	0.0		0.0	False		,,,				2504	0.002																0																																										SO:0001623	5_prime_UTR_variant	0			BX538151	CCDS12959.1, CCDS12959.2	19q13.43	2013-09-20			ENSG00000204519	ENSG00000204519		"""Zinc fingers, C2H2-type"", ""-"""	25108	protein-coding gene	gene with protein product							Standard	NM_138347		Approved	DKFZp686H1038	uc002qpw.5	Q7Z340	OTTHUMG00000183470	ENST00000282296.5:c.-44C>T	19.37:g.58193488C>T			B4DU22|P17034|Q8N246|Q9BRY1	RNA	SNP	-	NULL	ENST00000282296.5	37	NULL	CCDS12959.2	19																																																																																			AC003006.7	-	-	ENSG00000269026		0.662	ZNF551-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ENSG00000269026	Clone_based_vega_gene	protein_coding	OTTHUMT00000466803.2	-	0.00	79	0	C	NM_138347		58193488	+1	tier1	-	no_errors	ENST00000599221	ensembl	human	known	74_37	rna	29.41	60	25	SNP	0.000	T
TTN	7273	genome.wustl.edu	37	2	179509452	179509452	+	Intron	SNP	A	A	T			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr2:179509452A>T	ENST00000591111.1	-	168	35710				TTN-AS1_ENST00000589487.1_RNA|TTN_ENST00000589042.1_Intron|TTN-AS1_ENST00000431752.1_RNA|TTN_ENST00000342992.6_Intron|TTN_ENST00000342175.6_Intron|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000418062.1_RNA|TTN-AS1_ENST00000585451.1_RNA|RP11-171I2.3_ENST00000605021.1_lincRNA|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron|TTN-AS1_ENST00000589830.1_RNA			Q8WZ42	TITIN_HUMAN	titin						adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ACCAGAAAGCATTAATAACAG	0.318																																																	0																																										SO:0001627	intron_variant	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.35486-109T>A	2.37:g.179509452A>T			A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	RNA	SNP	-	NULL	ENST00000591111.1	37	NULL		2																																																																																			RP11-171I2.3	-	-	ENSG00000271401		0.318	TTN-019	PUTATIVE	basic	protein_coding	ENSG00000271401	Clone_based_vega_gene	protein_coding	OTTHUMT00000460310.1	-	0.00	16	0	A	NM_133378		179509452	+1	tier1	-	no_errors	ENST00000605021	ensembl	human	known	74_37	rna	64.29	5	9	SNP	0.529	T
ESPNP	284729	genome.wustl.edu	37	1	17034125	17034126	+	RNA	INS	-	-	AGCT	rs141324796|rs79472512	byFrequency	TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr1:17034125_17034126insAGCT	ENST00000492551.1	-	0	477_478					NR_026567.1				espin pseudogene																		CAGCAGCAGCCAGCTGAGCACC	0.718														1500	0.299521	0.1188	0.3444	5008	,	,		24180	0.4177		0.3101	False		,,,				2504	0.3793																0																																												0			AL035288		1p36.13	2013-05-22			ENSG00000268869	ENSG00000268869			23285	pseudogene	pseudogene						15286153	Standard	NR_026567		Approved		uc001azn.1		OTTHUMG00000000803		1.37:g.17034126_17034129dupAGCT				RNA	INS	-	NULL	ENST00000492551.1	37	NULL		1																																																																																			ESPNP	-	-	ENSG00000268869		0.718	ESPNP-002	KNOWN	basic	processed_transcript	ESPNP	HGNC	pseudogene	OTTHUMT00000326311.1		0.00	8	0	-			17034126	-1	tier1		no_errors	ENST00000492551	ensembl	human	known	74_37	rna	42.86	4	3	INS	1.000:1.000	AGCT
EPHA8	2046	genome.wustl.edu	37	1	22903214	22903214	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr1:22903214G>A	ENST00000166244.3	+	3	736	c.664G>A	c.(664-666)Gac>Aac	p.D222N	EPHA8_ENST00000538803.1_Missense_Mutation_p.D222N|EPHA8_ENST00000374644.4_Missense_Mutation_p.D222N	NM_020526.3	NP_065387.1	P29322	EPHA8_HUMAN	EPH receptor A8	222	Cys-rich.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|ephrin receptor signaling pathway (GO:0048013)|neuron projection development (GO:0031175)|neuron remodeling (GO:0016322)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|protein autophosphorylation (GO:0046777)|regulation of cell adhesion (GO:0030155)|regulation of cell adhesion mediated by integrin (GO:0033628)|substrate-dependent cell migration (GO:0006929)	endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)	ATP binding (GO:0005524)|GPI-linked ephrin receptor activity (GO:0005004)			breast(3)|central_nervous_system(5)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(9)|large_intestine(6)|lung(22)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	61		Colorectal(325;3.46e-05)|Lung NSC(340;6.55e-05)|all_lung(284;9.87e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;7.29e-27)|Colorectal(126;1.61e-07)|COAD - Colon adenocarcinoma(152;1.14e-05)|GBM - Glioblastoma multiforme(114;1.74e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000554)|KIRC - Kidney renal clear cell carcinoma(1967;0.00272)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)		GACGGGGGCCGACTCGTCCTC	0.642																																																	0													49.0	46.0	47.0					1																	22903214		2203	4300	6503	SO:0001583	missense	0			BC038796	CCDS225.1, CCDS30626.1	1p36.12	2013-02-11	2004-10-28		ENSG00000070886	ENSG00000070886	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3391	protein-coding gene	gene with protein product		176945	"""EphA8"""	EEK		1648701	Standard	NM_001006943		Approved	Hek3	uc001bfx.1	P29322	OTTHUMG00000002892	ENST00000166244.3:c.664G>A	1.37:g.22903214G>A	ENSP00000166244:p.Asp222Asn		Q6IN80|Q8IUX6|Q9NUA9|Q9P269	Missense_Mutation	SNP	pirsf_Tyr_kinase_ephrin_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ephrin_rcpt_lig-bd_dom,pfam_Prot_kinase_dom,pfam_Fibronectin_type3,pfam_SAM_type1,pfam_SAM_2,superfamily_Galactose-bd-like,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_SAM/pointed,superfamily_Growth_fac_rcpt_N_dom,smart_Ephrin_rcpt_lig-bd_dom,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_SAM,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_SAM,pfscan_Prot_kinase_dom	p.D222N	ENST00000166244.3	37	c.664	CCDS225.1	1	.	.	.	.	.	.	.	.	.	.	G	21.9	4.212253	0.79240	.	.	ENSG00000070886	ENST00000166244;ENST00000374644;ENST00000538803	T;T;T	0.73681	-0.77;5.07;5.07	4.0	4.0	0.46444	.	0.000000	0.85682	D	0.000000	D	0.85093	0.5618	M	0.76170	2.325	0.58432	D	0.999998	D;D	0.89917	1.0;1.0	D;D	0.97110	0.996;1.0	D	0.87476	0.2417	10	0.87932	D	0	.	14.8153	0.70031	0.0:0.0:1.0:0.0	.	222;222	P29322;P29322-2	EPHA8_HUMAN;.	N	222	ENSP00000166244:D222N;ENSP00000363775:D222N;ENSP00000440274:D222N	ENSP00000166244:D222N	D	+	1	0	EPHA8	22775801	1.000000	0.71417	0.964000	0.40570	0.673000	0.39480	9.657000	0.98554	2.045000	0.60652	0.442000	0.29010	GAC	EPHA8	-	pirsf_Tyr_kinase_ephrin_rcpt	ENSG00000070886		0.642	EPHA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPHA8	HGNC	protein_coding	OTTHUMT00000008085.1	-	0.00	50	0	G	NM_020526		22903214	+1	tier1	-	no_errors	ENST00000166244	ensembl	human	known	74_37	missense	34.29	46	24	SNP	1.000	A
ESRRG	2104	genome.wustl.edu	37	1	216741436	216741436	+	Silent	SNP	C	C	G			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr1:216741436C>G	ENST00000408911.3	-	4	747	c.594G>C	c.(592-594)gtG>gtC	p.V198V	ESRRG_ENST00000360012.3_Silent_p.V175V|ESRRG_ENST00000463665.1_Silent_p.V136V|ESRRG_ENST00000366938.2_Silent_p.V175V|ESRRG_ENST00000359162.2_Silent_p.V175V|ESRRG_ENST00000366940.2_Silent_p.V175V|ESRRG_ENST00000487276.1_Silent_p.V175V|ESRRG_ENST00000493603.1_Silent_p.V175V|ESRRG_ENST00000391890.3_Silent_p.V175V|ESRRG_ENST00000361525.3_Silent_p.V175V|ESRRG_ENST00000493748.1_Silent_p.V175V|ESRRG_ENST00000366937.1_Silent_p.V203V|ESRRG_ENST00000361395.2_Silent_p.V175V	NM_001438.3	NP_001429.2	P62508	ERR3_HUMAN	estrogen-related receptor gamma	198					gene expression (GO:0010467)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)	AF-2 domain binding (GO:0050682)|retinoic acid receptor activity (GO:0003708)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|steroid binding (GO:0005496)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			endometrium(5)|kidney(1)|large_intestine(8)|liver(1)|lung(29)|ovary(1)|skin(2)|stomach(1)|urinary_tract(1)	49				OV - Ovarian serous cystadenocarcinoma(81;0.0358)|all cancers(67;0.0693)|GBM - Glioblastoma multiforme(131;0.0713)	Diethylstilbestrol(DB00255)	TGTCAAGACGCACCCCTGTGA	0.512																																																	0													113.0	100.0	104.0					1																	216741436		2203	4300	6503	SO:0001819	synonymous_variant	0			AF058291	CCDS1517.1, CCDS41468.1, CCDS58060.1, CCDS58061.1	1q41	2014-02-18			ENSG00000196482	ENSG00000196482		"""Nuclear hormone receptors"""	3474	protein-coding gene	gene with protein product		602969				9676434, 10072763	Standard	NM_001243505		Approved	NR3B3	uc001hkw.2	P62508	OTTHUMG00000037025	ENST00000408911.3:c.594G>C	1.37:g.216741436C>G			A8K4I0|A8K6I2|B3KY84|E9PGB7|F8W8J3|O75454|O96021|Q68DA0|Q6P274|Q6PK28|Q6TS38|Q9R1F3|Q9UNJ4	Silent	SNP	pfam_Nucl_hrmn_rcpt_lig-bd_core,pfam_Znf_hrmn_rcpt,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_Str_hrmn_rcpt,prints_Znf_hrmn_rcpt,prints_Retinoic_acid_rcpt	p.V198	ENST00000408911.3	37	c.594	CCDS41468.1	1																																																																																			ESRRG	-	superfamily_Nucl_hormone_rcpt_ligand-bd,pfscan_Znf_hrmn_rcpt,prints_Str_hrmn_rcpt	ENSG00000196482		0.512	ESRRG-001	KNOWN	basic|CCDS	protein_coding	ESRRG	HGNC	protein_coding	OTTHUMT00000089882.2	-	0.00	39	0	C	NM_206595		216741436	-1	tier1	-	no_errors	ENST00000408911	ensembl	human	known	74_37	silent	10.53	85	10	SNP	0.978	G
ESYT2	57488	genome.wustl.edu	37	7	158534278	158534278	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr7:158534278C>T	ENST00000251527.5	-	17	2250	c.2185G>A	c.(2185-2187)Gcc>Acc	p.A729T	ESYT2_ENST00000435514.2_Missense_Mutation_p.A164T	NM_020728.2	NP_065779.1	A0FGR8	ESYT2_HUMAN	extended synaptotagmin-like protein 2	757					endocytosis (GO:0006897)|lipid transport (GO:0006869)	extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|integral component of plasma membrane (GO:0005887)|intrinsic component of endoplasmic reticulum membrane (GO:0031227)|membrane (GO:0016020)|organelle membrane contact site (GO:0044232)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|identical protein binding (GO:0042802)|phosphatidylcholine binding (GO:0031210)|phosphatidylethanolamine binding (GO:0008429)|phosphatidylinositol binding (GO:0035091)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(16)|prostate(2)	32						ATGTCCGAGGCGATGCTGGGG	0.637																																																	0													50.0	48.0	49.0					7																	158534278		2203	4300	6503	SO:0001583	missense	0			AB033054	CCDS34791.1	7q36.3	2014-07-02	2009-06-23	2009-06-23	ENSG00000117868	ENSG00000117868		"""Synaptotagmins"""	22211	protein-coding gene	gene with protein product			"""family with sequence similarity 62 (C2 domain containing), member B"""	FAM62B		17672888	Standard	NM_020728		Approved	KIAA1228, CHR2SYT	uc003wob.1	A0FGR8	OTTHUMG00000151436	ENST00000251527.5:c.2185G>A	7.37:g.158534278C>T	ENSP00000251527:p.Ala729Thr		A4D229|Q69YJ2|Q6UKI4|Q6ZTU0|Q6ZVU1|Q9BQS0|Q9NW47|Q9ULJ2	Missense_Mutation	SNP	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom	p.A729T	ENST00000251527.5	37	c.2185	CCDS34791.1	7	.	.	.	.	.	.	.	.	.	.	C	24.6	4.554548	0.86231	.	.	ENSG00000117868	ENST00000251527;ENST00000421679;ENST00000275418;ENST00000435514;ENST00000377650	T;T;T	0.22336	1.96;1.99;2.35	5.11	5.11	0.69529	.	0.000000	0.85682	D	0.000000	T	0.43433	0.1247	M	0.70275	2.135	0.80722	D	1	D;D	0.89917	1.0;0.991	D;P	0.66497	0.944;0.788	T	0.16070	-1.0415	10	0.19147	T	0.46	-17.3281	17.885	0.88851	0.0:1.0:0.0:0.0	.	729;757	A0FGR8-2;A0FGR8	.;ESYT2_HUMAN	T	729;778;720;164;164	ENSP00000251527:A729T;ENSP00000275418:A720T;ENSP00000411488:A164T	ENSP00000251527:A729T	A	-	1	0	ESYT2	158227039	1.000000	0.71417	0.977000	0.42913	0.238000	0.25445	7.422000	0.80217	2.541000	0.85698	0.655000	0.94253	GCC	ESYT2	-	NULL	ENSG00000117868		0.637	ESYT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ESYT2	HGNC	protein_coding	OTTHUMT00000322647.1	-	0.00	60	0	C	NM_020728		158534278	-1	tier1	-	no_errors	ENST00000251527	ensembl	human	known	74_37	missense	25.00	32	11	SNP	1.000	T
FAM111A	63901	genome.wustl.edu	37	11	58920609	58920609	+	Nonsense_Mutation	SNP	C	C	T			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr11:58920609C>T	ENST00000528737.1	+	5	4286	c.1468C>T	c.(1468-1470)Cag>Tag	p.Q490*	FAM111A_ENST00000420244.1_Nonsense_Mutation_p.Q490*|FAM111A_ENST00000531147.1_Nonsense_Mutation_p.Q490*|FAM111A_ENST00000361723.3_Nonsense_Mutation_p.Q490*|FAM111A_ENST00000533703.1_Nonsense_Mutation_p.Q490*			Q96PZ2	F111A_HUMAN	family with sequence similarity 111, member A	490	Interaction with SV40 large T antigen.				defense response to virus (GO:0051607)|DNA replication (GO:0006260)|negative regulation of viral genome replication (GO:0045071)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	catalytic activity (GO:0003824)			breast(2)|endometrium(2)|kidney(1)|large_intestine(5)|lung(5)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	22		all_epithelial(135;0.139)				TGTGATCCCTCAGGGTCAGCG	0.393																																																	0													97.0	100.0	99.0					11																	58920609		2201	4295	6496	SO:0001587	stop_gained	0			AK092953	CCDS7973.1	11q12.1	2014-03-13				ENSG00000166801			24725	protein-coding gene	gene with protein product		615292				11572484, 23996431, 23684011	Standard	NM_022074		Approved	FLJ22794, KIAA1895	uc001nnq.3	Q96PZ2		ENST00000528737.1:c.1468C>T	11.37:g.58920609C>T	ENSP00000434435:p.Gln490*		A8K5Y8|Q5RKS9|Q5XKM2|Q68DK9|Q6IPR7|Q9H5Y1	Nonsense_Mutation	SNP	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom	p.Q490*	ENST00000528737.1	37	c.1468	CCDS7973.1	11	.	.	.	.	.	.	.	.	.	.	C	32	5.157542	0.94686	.	.	ENSG00000166801	ENST00000528737;ENST00000420244;ENST00000361723;ENST00000533703;ENST00000531147	.	.	.	5.04	5.04	0.67666	.	0.404159	0.24801	N	0.035487	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.54805	T	0.06	-6.0154	11.8894	0.52620	0.0:0.8245:0.1755:0.0	.	.	.	.	X	490	.	ENSP00000355264:Q490X	Q	+	1	0	FAM111A	58677185	0.000000	0.05858	0.243000	0.24186	0.007000	0.05969	0.361000	0.20267	2.791000	0.96007	0.655000	0.94253	CAG	FAM111A	-	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom	ENSG00000166801		0.393	FAM111A-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	FAM111A	HGNC	protein_coding	OTTHUMT00000393975.1	-	0.00	22	0	C	NM_022074		58920609	+1	tier1	-	no_errors	ENST00000361723	ensembl	human	known	74_37	nonsense	33.33	10	5	SNP	0.025	T
FAM19A4	151647	genome.wustl.edu	37	3	68802149	68802149	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr3:68802149C>T	ENST00000295569.7	-	4	643	c.151G>A	c.(151-153)Ggg>Agg	p.G51R		NM_001005527.2|NM_182522.4	NP_001005527.1|NP_872328.1	Q96LR4	F19A4_HUMAN	family with sequence similarity 19 (chemokine (C-C motif)-like), member A4	51						extracellular region (GO:0005576)				haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(5)|skin(2)	10		Lung NSC(201;0.0198)		BRCA - Breast invasive adenocarcinoma(55;1.38e-05)|Epithelial(33;0.000124)|LUSC - Lung squamous cell carcinoma(21;0.0248)|KIRC - Kidney renal clear cell carcinoma(39;0.0729)|Kidney(39;0.0904)		TCACAGGTCCCTTGCTTGATT	0.507																																																	0													70.0	61.0	64.0					3																	68802149		2203	4300	6503	SO:0001583	missense	0			AY325117	CCDS2907.1	3p14.1	2014-08-14			ENSG00000163377	ENSG00000163377			21591	protein-coding gene	gene with protein product						15028294, 25109685	Standard	NM_182522		Approved	TAFA-4	uc021xah.1	Q96LR4	OTTHUMG00000158744	ENST00000295569.7:c.151G>A	3.37:g.68802149C>T	ENSP00000295569:p.Gly51Arg		A8MVT2	Missense_Mutation	SNP	pfam_Chemokine-like_FAM19A2	p.G51R	ENST00000295569.7	37	c.151	CCDS2907.1	3	.	.	.	.	.	.	.	.	.	.	C	32	5.159526	0.94686	.	.	ENSG00000163377	ENST00000295569;ENST00000495737	.	.	.	5.36	5.36	0.76844	.	0.000000	0.85682	D	0.000000	D	0.83959	0.5367	M	0.82323	2.585	0.58432	D	0.999994	D	0.89917	1.0	D	0.97110	1.0	D	0.86223	0.1632	9	0.87932	D	0	-24.5778	19.0949	0.93246	0.0:1.0:0.0:0.0	.	51	Q96LR4	F19A4_HUMAN	R	51	.	ENSP00000295569:G51R	G	-	1	0	FAM19A4	68884839	1.000000	0.71417	0.994000	0.49952	0.908000	0.53690	7.764000	0.85297	2.508000	0.84585	0.591000	0.81541	GGG	FAM19A4	-	pfam_Chemokine-like_FAM19A2	ENSG00000163377		0.507	FAM19A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM19A4	HGNC	protein_coding	OTTHUMT00000352002.1	-	0.00	16	0	C	NM_182522		68802149	-1	tier1	-	no_errors	ENST00000295569	ensembl	human	known	74_37	missense	60.87	9	14	SNP	1.000	T
FAM230B	642633	genome.wustl.edu	37	22	21538152	21538152	+	RNA	SNP	C	C	A			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr22:21538152C>A	ENST00000451257.1	+	0	1138									family with sequence similarity 230, member B (non-protein coding)																		CCGCCCACGGCATCGCCAGCG	0.731																																																	0																																												0			BC039313, AK128837		22q11.21	2014-01-24	2014-01-06		ENSG00000215498	ENSG00000215498			32943	non-coding RNA	RNA, long non-coding			"""family with sequence similarity 230, member B"""				Standard	NR_108107		Approved	FLJ46366			OTTHUMG00000150782		22.37:g.21538152C>A				RNA	SNP	-	NULL	ENST00000451257.1	37	NULL		22																																																																																			FAM230B	-	-	ENSG00000215498		0.731	FAM230B-002	KNOWN	basic	lincRNA	FAM230B	HGNC	processed_transcript	OTTHUMT00000320063.1		0.00	11	0	C	NR_108107		21538152	+1			no_errors	ENST00000451257	ensembl	human	known	74_37	rna	50.00	8	8	SNP	0.000	A
FAM27E3	100131997	genome.wustl.edu	37	9	67786176	67786176	+	Missense_Mutation	SNP	G	G	A	rs200531573	byFrequency	TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr9:67786176G>A	ENST00000455764.2	-	2	273	c.79C>T	c.(79-81)Cgt>Tgt	p.R27C	RP11-12A20.2_ENST00000515258.2_RNA			Q08E93	F27E3_HUMAN	family with sequence similarity 27, member E3	27																	TTTCGCCGACGCGGTTCCGCT	0.562																																																	0																																										SO:0001583	missense	0					9q13	2014-05-06			ENSG00000232833	ENSG00000274026			28655	protein-coding gene	gene with protein product						12477932	Standard	NR_103833		Approved	MGC42630	uc004adi.4	Q08E93	OTTHUMG00000188582	ENST00000455764.2:c.79C>T	9.37:g.67786176G>A	ENSP00000463817:p.Arg27Cys			Missense_Mutation	SNP	NULL	p.R27C	ENST00000455764.2	37	c.79		9																																																																																			FAM27E3	-	NULL	ENSG00000232833		0.562	FAM27E3-001	KNOWN	basic|appris_principal	protein_coding	FAM27E3	HGNC	protein_coding	OTTHUMT00000144019.2	-	0.00	9	0	G	XM_001720463		67786176	-1	tier1	rs200531573	no_errors	ENST00000455764	ensembl	human	known	74_37	missense	55.56	4	5	SNP	0.010	A
FANCF	2188	genome.wustl.edu	37	11	22647031	22647031	+	Missense_Mutation	SNP	T	T	C			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr11:22647031T>C	ENST00000327470.3	-	1	356	c.326A>G	c.(325-327)tAc>tGc	p.Y109C	AC103801.2_ENST00000428556.2_5'UTR	NM_022725.3	NP_073562.1	Q9NPI8	FANCF_HUMAN	Fanconi anemia, complementation group F	109					DNA repair (GO:0006281)|ovarian follicle development (GO:0001541)|spermatogenesis (GO:0007283)	Fanconi anaemia nuclear complex (GO:0043240)|nucleoplasm (GO:0005654)	ubiquitin-protein transferase activity (GO:0004842)			kidney(3)|large_intestine(3)|lung(6)|skin(1)	13						CACCAGGTGGTAACGAGCTGC	0.677			"""N, F"""			"""AML, leukemia"""		Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia		OREG0020844	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											yes	Rec		Fanconi anaemia F	11	11p15	2188	"""Fanconi anemia, complementation group F"""		L	0													67.0	81.0	76.0					11																	22647031		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)		CCDS7857.1	11p15	2014-09-17				ENSG00000183161		"""Fanconi anemia, complementation groups"""	3587	protein-coding gene	gene with protein product		613897				9382107	Standard	NM_022725		Approved	FAF	uc001mql.1	Q9NPI8		ENST00000327470.3:c.326A>G	11.37:g.22647031T>C	ENSP00000330875:p.Tyr109Cys	757	Q52LM0	Missense_Mutation	SNP	NULL	p.Y109C	ENST00000327470.3	37	c.326	CCDS7857.1	11	.	.	.	.	.	.	.	.	.	.	T	12.91	2.079120	0.36662	.	.	ENSG00000183161	ENST00000327470	T	0.30182	1.54	5.43	-4.3	0.03710	.	0.627416	0.15155	U	0.277518	T	0.21227	0.0511	N	0.08118	0	0.09310	N	1	B	0.29835	0.258	B	0.40565	0.333	T	0.30327	-0.9982	10	0.59425	D	0.04	-0.4274	16.8877	0.86079	0.0:0.7416:0.0:0.2584	.	109	Q9NPI8	FANCF_HUMAN	C	109	ENSP00000330875:Y109C	ENSP00000330875:Y109C	Y	-	2	0	FANCF	22603607	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	0.022000	0.13511	-1.035000	0.03291	-0.250000	0.11733	TAC	FANCF	-	NULL	ENSG00000183161		0.677	FANCF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FANCF	HGNC	protein_coding	OTTHUMT00000387712.2	-	0.00	47	0	T	NM_022725		22647031	-1	tier1	-	no_errors	ENST00000327470	ensembl	human	known	74_37	missense	60.61	13	20	SNP	0.000	C
FAM86C2P	645332	genome.wustl.edu	37	11	67560494	67560494	+	RNA	SNP	T	T	C	rs61894309		TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr11:67560494T>C	ENST00000528089.1	-	0	1256							A6NEL3	F86C2_HUMAN	family with sequence similarity 86, member C2, pseudogene																		AGCACCCACATGCTTAGATAG	0.403																																																	0																																												0					11q13.2	2011-07-07			ENSG00000160172	ENSG00000160172			42392	pseudogene	pseudogene							Standard	NR_024249		Approved		uc001omt.4	A6NEL3	OTTHUMG00000167222		11.37:g.67560494T>C				RNA	SNP	-	NULL	ENST00000528089.1	37	NULL		11																																																																																			FAM86C2P	-	-	ENSG00000160172		0.403	FAM86C2P-004	KNOWN	basic	processed_transcript	FAM86C2P	HGNC	pseudogene	OTTHUMT00000393796.1		0.00	58	0	T			67560494	-1			no_errors	ENST00000528089	ensembl	human	known	74_37	rna	6.82	41	3	SNP	0.001	C
FLJ40288	286023	genome.wustl.edu	37	7	132412352	132412352	+	Silent	SNP	G	G	A			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr7:132412352G>A	ENST00000332558.4	+	5	822	c.204G>A	c.(202-204)ctG>ctA	p.L68L																								GTCTATCACTGCCTGGGGGAC	0.587																																																	0													82.0	76.0	78.0					7																	132412352		692	1591	2283	SO:0001819	synonymous_variant	0																														ENST00000332558.4:c.204G>A	7.37:g.132412352G>A				Silent	SNP	NULL	p.L68	ENST00000332558.4	37	c.204		7																																																																																			AC009365.3	-	NULL	ENSG00000183470		0.587	AC009365.3-001	PUTATIVE	basic|appris_principal|exp_conf	protein_coding	FLJ40288	Clone_based_vega_gene	protein_coding	OTTHUMT00000318676.5	-	0.00	31	0	G			132412352	+1	tier1	-	no_errors	ENST00000332558	ensembl	human	putative	74_37	silent	16.95	49	10	SNP	0.001	A
FNBP1	23048	genome.wustl.edu	37	9	132681440	132681440	+	Intron	SNP	C	C	A			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr9:132681440C>A	ENST00000446176.2	-	11	1357				FNBP1_ENST00000420781.1_Intron|FNBP1_ENST00000355681.3_Intron|FNBP1_ENST00000443566.2_Missense_Mutation_p.V18F|FNBP1_ENST00000478129.1_Intron	NM_015033.2	NP_055848.1	Q96RU3	FNBP1_HUMAN	formin binding protein 1						endocytosis (GO:0006897)	coated pit (GO:0005905)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|lysosome (GO:0005764)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)|lipid binding (GO:0008289)						Ovarian(14;0.000536)		GBM - Glioblastoma multiforme(294;0.0378)		GAACTTACAACATAGTCCCTA	0.488			T	MLL	AML																																			Dom	yes		9	9q23	23048	formin binding protein 1 (FBP17)		L	0																																										SO:0001627	intron_variant	0			AB011126	CCDS48040.1	9q34	2008-02-05			ENSG00000187239	ENSG00000187239			17069	protein-coding gene	gene with protein product		606191				9628581, 11438682	Standard	XM_005251815		Approved	FBP17, KIAA0554	uc004byw.1	Q96RU3	OTTHUMG00000020800	ENST00000446176.2:c.1171-3181G>T	9.37:g.132681440C>A			O60301|Q3MIN8|Q5TC87|Q5TC88|Q6P658|Q7LGG2|Q9H8H8|Q9NWD1	Missense_Mutation	SNP	pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,superfamily_HR1_rho-bd,smart_SH3_domain,pfscan_SH3_domain	p.V18F	ENST00000446176.2	37	c.52	CCDS48040.1	9	.	.	.	.	.	.	.	.	.	.	C	17.42	3.385157	0.61956	.	.	ENSG00000187239	ENST00000443566	T	0.58060	0.36	5.87	3.94	0.45596	.	.	.	.	.	T	0.44808	0.1311	.	.	.	0.32959	D	0.520831	B	0.29508	0.246	B	0.30029	0.11	T	0.58940	-0.7547	8	0.72032	D	0.01	.	9.897	0.41324	0.1386:0.7895:0.0:0.0719	.	18	E7EPB7	.	F	18	ENSP00000389117:V18F	ENSP00000389117:V18F	V	-	1	0	FNBP1	131721261	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.392000	0.52537	1.503000	0.48686	0.650000	0.86243	GTT	FNBP1	-	NULL	ENSG00000187239		0.488	FNBP1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	FNBP1	HGNC	protein_coding	OTTHUMT00000054630.2	-	0.00	34	0	C			132681440	-1	tier1	-	no_errors	ENST00000443566	ensembl	human	known	74_37	missense	36.84	24	14	SNP	1.000	A
FNDC3A	22862	genome.wustl.edu	37	13	49580412	49580412	+	Missense_Mutation	SNP	A	A	G			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr13:49580412A>G	ENST00000492622.2	+	2	391	c.86A>G	c.(85-87)gAt>gGt	p.D29G	FNDC3A_ENST00000541916.1_Missense_Mutation_p.D29G	NM_001079673.1	NP_001073141.1	Q9Y2H6	FND3A_HUMAN	fibronectin type III domain containing 3A	29					fertilization (GO:0009566)|Sertoli cell development (GO:0060009)|single organismal cell-cell adhesion (GO:0016337)|spermatid development (GO:0007286)	acrosomal vesicle (GO:0001669)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|vesicle membrane (GO:0012506)	poly(A) RNA binding (GO:0044822)			endometrium(5)|kidney(3)|large_intestine(10)|lung(15)|prostate(5)|skin(2)|urinary_tract(1)	41		all_lung(13;7.44e-08)|Lung NSC(96;4.08e-06)|Breast(56;0.000111)|Prostate(109;0.00174)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|Lung SC(185;0.187)|all_neural(104;0.19)	KIRC - Kidney renal clear cell carcinoma(9;0.206)	GBM - Glioblastoma multiforme(99;2.94e-09)		GTAAGTGCAGATGGAACACAA	0.333																																																	0													139.0	124.0	128.0					13																	49580412		1845	4093	5938	SO:0001583	missense	0			AB023187	CCDS9413.2, CCDS41886.1	13q14.12	2013-02-11	2005-01-20	2005-01-22	ENSG00000102531	ENSG00000102531		"""Fibronectin type III domain containing"""	20296	protein-coding gene	gene with protein product		615794	"""fibronectin type III domain containing 3"""	FNDC3			Standard	NM_001079673		Approved	bA203I16.5, KIAA0970	uc001vcm.3	Q9Y2H6	OTTHUMG00000016911	ENST00000492622.2:c.86A>G	13.37:g.49580412A>G	ENSP00000417257:p.Asp29Gly		B4DYG1|Q5HYC9|Q5JVF8|Q5JVF9|Q6EVH3|Q6EVH4|Q6N020|Q6P9D5|Q6ZME4|Q9H1W1	Missense_Mutation	SNP	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	p.D29G	ENST00000492622.2	37	c.86	CCDS41886.1	13	.	.	.	.	.	.	.	.	.	.	A	21.3	4.135101	0.77662	.	.	ENSG00000102531	ENST00000492622;ENST00000541916	T;T	0.79845	-1.31;-1.31	5.35	5.35	0.76521	.	0.085998	0.48286	D	0.000191	T	0.71945	0.3400	L	0.39147	1.195	0.41420	D	0.987792	P	0.35328	0.495	B	0.28465	0.09	T	0.75676	-0.3235	10	0.72032	D	0.01	-4.7194	13.5657	0.61817	1.0:0.0:0.0:0.0	.	29	Q9Y2H6	FND3A_HUMAN	G	29	ENSP00000417257:D29G;ENSP00000441831:D29G	ENSP00000420275:D29G	D	+	2	0	FNDC3A	48478413	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	5.815000	0.69215	2.149000	0.67028	0.460000	0.39030	GAT	FNDC3A	-	NULL	ENSG00000102531		0.333	FNDC3A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	FNDC3A	HGNC	protein_coding	OTTHUMT00000354845.2	-	0.00	36	0	A	NM_014923		49580412	+1	tier1	-	no_errors	ENST00000492622	ensembl	human	known	74_37	missense	37.93	18	11	SNP	1.000	G
FOCAD	54914	genome.wustl.edu	37	9	20982419	20982419	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr9:20982419G>T	ENST00000380249.1	+	41	5066	c.4702G>T	c.(4702-4704)Gcc>Tcc	p.A1568S	FOCAD_ENST00000605086.1_Missense_Mutation_p.A1004S|FOCAD_ENST00000338382.6_Missense_Mutation_p.A1568S	NM_017794.3	NP_060264.3	Q5VW36	FOCAD_HUMAN	focadhesin	1568						focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)											AGATGATGATGCCAATCGGAT	0.343																																																	0													131.0	136.0	134.0					9																	20982419		2203	4300	6503	SO:0001583	missense	0			AB058700	CCDS34993.1	9p21	2012-03-23	2012-03-23	2012-03-23	ENSG00000188352	ENSG00000188352			23377	protein-coding gene	gene with protein product		614606	"""KIAA1797"""	KIAA1797		22427331	Standard	XM_006716794		Approved	FLJ20375	uc003zog.1	Q5VW36	OTTHUMG00000066930	ENST00000380249.1:c.4702G>T	9.37:g.20982419G>T	ENSP00000369599:p.Ala1568Ser		D3DRJ9|Q6ZME1|Q8IZG0|Q96JM8|Q96MS9|Q9BVF3|Q9NX87	Missense_Mutation	SNP	pfam_DUF3028,pfam_DUF3730,superfamily_ARM-type_fold	p.A1568S	ENST00000380249.1	37	c.4702	CCDS34993.1	9	.	.	.	.	.	.	.	.	.	.	G	13.90	2.373859	0.42105	.	.	ENSG00000188352	ENST00000380249;ENST00000338382	T;T	0.19806	2.12;2.12	5.83	3.75	0.43078	.	0.458832	0.24407	N	0.038781	T	0.16896	0.0406	L	0.36672	1.1	0.09310	N	1	B	0.31459	0.324	B	0.36418	0.224	T	0.16660	-1.0395	10	0.66056	D	0.02	-34.3225	5.2446	0.15490	0.1394:0.0:0.6511:0.2096	.	1568	Q5VW36	K1797_HUMAN	S	1568	ENSP00000369599:A1568S;ENSP00000344307:A1568S	ENSP00000344307:A1568S	A	+	1	0	KIAA1797	20972419	0.727000	0.28069	0.037000	0.18230	0.737000	0.42083	1.954000	0.40362	1.457000	0.47850	0.561000	0.74099	GCC	FOCAD	-	pfam_DUF3028	ENSG00000188352		0.343	FOCAD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOCAD	HGNC	protein_coding	OTTHUMT00000143442.1		0.00	31	0	G	NM_017794		20982419	+1			no_errors	ENST00000338382	ensembl	human	known	74_37	missense	8.00	23	2	SNP	0.166	T
FOXD4L5	653427	genome.wustl.edu	37	9	70177146	70177146	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr9:70177146C>T	ENST00000377420.1	-	1	1669	c.838G>A	c.(838-840)Ggg>Agg	p.G280R		NM_001126334.1	NP_001119806.1	Q5VV16	FX4L5_HUMAN	forkhead box D4-like 5	280					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.G280W(2)		endometrium(5)|lung(2)	7						TTCGGTGCCCCGGCATAGACG	0.687																																																	2	Substitution - Missense(2)	lung(2)											2.0	3.0	3.0					9																	70177146		498	1280	1778	SO:0001583	missense	0				CCDS47977.1	9q13	2008-07-21			ENSG00000204779	ENSG00000204779			18522	protein-coding gene	gene with protein product						12234674	Standard	NM_001126334		Approved	bA15J10.2, OTTHUMG00000013332	uc010moc.3	Q5VV16	OTTHUMG00000013332	ENST00000377420.1:c.838G>A	9.37:g.70177146C>T	ENSP00000366637:p.Gly280Arg			Missense_Mutation	SNP	pfam_TF_fork_head,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head	p.G280R	ENST00000377420.1	37	c.838	CCDS47977.1	9	.	.	.	.	.	.	.	.	.	.	c	5.330	0.246252	0.10130	.	.	ENSG00000204779	ENST00000377420	D	0.93547	-3.24	.	.	.	.	0.804204	0.10057	U	0.721372	T	0.80984	0.4729	N	0.19112	0.55	0.09310	N	1	P	0.45011	0.848	B	0.19946	0.027	T	0.71619	-0.4538	8	0.27082	T	0.32	.	.	.	.	.	280	Q5VV16	FX4L5_HUMAN	R	280	ENSP00000366637:G280R	ENSP00000366637:G280R	G	-	1	0	FOXD4L5	69466966	0.003000	0.15002	0.051000	0.19133	0.229000	0.25112	-0.001000	0.12947	0.534000	0.28695	0.074000	0.15403	GGG	FOXD4L5	-	NULL	ENSG00000204779		0.687	FOXD4L5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOXD4L5	HGNC	protein_coding	OTTHUMT00000037122.1	-	0.00	61	0	C	NM_001126334		70177146	-1	tier1	-	no_errors	ENST00000377420	ensembl	human	known	74_37	missense	11.70	83	11	SNP	0.115	T
GALE	2582	genome.wustl.edu	37	1	24125155	24125155	+	Missense_Mutation	SNP	C	C	G	rs370693766		TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr1:24125155C>G	ENST00000374497.3	-	4	278	c.187G>C	c.(187-189)Gag>Cag	p.E63Q	GALE_ENST00000470383.1_5'UTR	NM_000403.3|NM_001008216.1|NM_001127621.1	NP_000394.2|NP_001008217.1|NP_001121093.1			UDP-galactose-4-epimerase											endometrium(1)|kidney(1)|large_intestine(3)|liver(1)|lung(2)	8		Colorectal(325;3.46e-05)|Renal(390;0.000219)|Lung NSC(340;0.000233)|all_lung(284;0.000321)|Breast(348;0.0044)|Ovarian(437;0.00539)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;1.79e-24)|Colorectal(126;4.8e-08)|COAD - Colon adenocarcinoma(152;2.83e-06)|GBM - Glioblastoma multiforme(114;4.22e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000946)|KIRC - Kidney renal clear cell carcinoma(1967;0.00314)|STAD - Stomach adenocarcinoma(196;0.0123)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.0827)|LUSC - Lung squamous cell carcinoma(448;0.184)		TCCATCTCCTCAAACTCCACA	0.597																																					Colon(17;142 583 2667 10036 24961)												0								C	GLN/GLU,GLN/GLU,GLN/GLU	0,4406		0,0,2203	65.0	61.0	62.0		187,187,187	3.6	1.0	1		62	2,8598	2.2+/-6.3	0,2,4298	no	missense,missense,missense	GALE	NM_000403.3,NM_001008216.1,NM_001127621.1	29,29,29	0,2,6501	GG,GC,CC		0.0233,0.0,0.0154	benign,benign,benign	63/349,63/349,63/349	24125155	2,13004	2203	4300	6503	SO:0001583	missense	0			BC050685	CCDS242.1	1p36-p35	2012-10-02	2004-11-17		ENSG00000117308	ENSG00000117308	5.1.3.2	"""Short chain dehydrogenase/reductase superfamily / Extended SDR fold"""	4116	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 1E, member 1"", ""UDP-glucose 4-epimerase"""	606953	"""galactose-4-epimerase, UDP-"""			8593531, 19027726	Standard	NM_001127621		Approved	SDR1E1	uc009vqo.1	Q14376	OTTHUMG00000002958	ENST00000374497.3:c.187G>C	1.37:g.24125155C>G	ENSP00000363621:p.Glu63Gln			Missense_Mutation	SNP	pfam_Epimerase_deHydtase,pfam_3Beta_OHSteriod_DH/Estase,pfam_dTDP_dehydrorham_reduct,pfam_Polysac_CapD-like,pfam_DH_sc/Rdtase_SDR,pfam_Male_sterile_NAD-bd,pfam_PKS_KR,prints_Nuc_sugar_epim,tigrfam_GalE	p.E63Q	ENST00000374497.3	37	c.187	CCDS242.1	1	.	.	.	.	.	.	.	.	.	.	C	14.85	2.659267	0.47467	0.0	2.33E-4	ENSG00000117308	ENST00000374497;ENST00000425913;ENST00000445705	D;D;D	0.88277	-2.36;-2.36;-2.36	4.47	3.56	0.40772	NAD-dependent epimerase/dehydratase (1);NAD(P)-binding domain (1);	0.229741	0.45126	D	0.000400	T	0.80232	0.4585	N	0.21545	0.675	0.42313	D	0.992222	B;B;B	0.10296	0.003;0.002;0.002	B;B;B	0.08055	0.002;0.003;0.003	T	0.76366	-0.2985	10	0.72032	D	0.01	-21.7676	8.8479	0.35181	0.0:0.719:0.1932:0.0879	.	63;63;63	Q5QPP1;Q38G75;Q14376	.;.;GALE_HUMAN	Q	63	ENSP00000363621:E63Q;ENSP00000393359:E63Q;ENSP00000398257:E63Q	ENSP00000363621:E63Q	E	-	1	0	GALE	23997742	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	3.740000	0.55082	1.256000	0.44068	-0.253000	0.11424	GAG	GALE	-	pfam_Epimerase_deHydtase,pfam_3Beta_OHSteriod_DH/Estase,pfam_dTDP_dehydrorham_reduct,pfam_Polysac_CapD-like,pfam_DH_sc/Rdtase_SDR,pfam_PKS_KR,tigrfam_GalE	ENSG00000117308		0.597	GALE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GALE	HGNC	protein_coding	OTTHUMT00000008232.1		0.00	14	0	C	NM_000403		24125155	-1			no_errors	ENST00000374497	ensembl	human	known	74_37	missense	19.05	17	4	SNP	1.000	G
GGN	199720	genome.wustl.edu	37	19	38876738	38876738	+	Silent	SNP	G	G	T			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr19:38876738G>T	ENST00000334928.6	-	3	1296	c.1164C>A	c.(1162-1164)ggC>ggA	p.G388G	AC005789.9_ENST00000585411.1_RNA|GGN_ENST00000591809.1_Intron|SPRED3_ENST00000587013.1_5'Flank	NM_152657.3	NP_689870.3	Q86UU5	GGN_HUMAN	gametogenetin	388	Interaction with GGNBP1. {ECO:0000250}.|Pro-rich.				cell differentiation (GO:0030154)|gamete generation (GO:0007276)|multicellular organismal development (GO:0007275)|protein localization (GO:0008104)|spermatogenesis (GO:0007283)	nucleolus (GO:0005730)|perinuclear region of cytoplasm (GO:0048471)				breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(7)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	24	all_cancers(60;3.4e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)			GCGGAGGGGAGCCCCAAGGCC	0.731																																																	0													13.0	17.0	16.0					19																	38876738		2165	4211	6376	SO:0001819	synonymous_variant	0			AF538035	CCDS12516.1	19q13.2	2008-09-04				ENSG00000179168			18869	protein-coding gene	gene with protein product		609966				12574169	Standard	NM_152657		Approved	FLJ35713, MGC33369	uc002oij.1	Q86UU5		ENST00000334928.6:c.1164C>A	19.37:g.38876738G>T			Q7RTU6|Q86UU4|Q8NAA1	Silent	SNP	NULL	p.G388	ENST00000334928.6	37	c.1164	CCDS12516.1	19																																																																																			GGN	-	NULL	ENSG00000179168		0.731	GGN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GGN	HGNC	protein_coding	OTTHUMT00000459205.1	-	0.00	15	0	G	NM_152657		38876738	-1	tier1	-	no_errors	ENST00000334928	ensembl	human	known	74_37	silent	31.25	22	10	SNP	0.990	T
GOLGA6L4	643707	genome.wustl.edu	37	15	84911216	84911216	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr15:84911216C>T	ENST00000510439.2	+	9	1659	c.1597C>T	c.(1597-1599)Ccc>Tcc	p.P533S	GOLGA6L4_ENST00000422563.2_Missense_Mutation_p.P209S	NM_001267536.1	NP_001254465.1	A6NEF3	GG6L4_HUMAN	golgin A6 family-like 4	533																	ATGCAGGACTCCCCAGGAGCA	0.602																																																	0																																										SO:0001583	missense	0			BC101294	CCDS73774.1	15q25.2	2012-11-16	2010-02-12		ENSG00000184206	ENSG00000184206			27256	protein-coding gene	gene with protein product			"""golgi autoantigen, golgin subfamily a, 6-like 4"""			12477932	Standard	NG_006151		Approved		uc021stn.2	A6NEF3	OTTHUMG00000163050	ENST00000510439.2:c.1597C>T	15.37:g.84911216C>T	ENSP00000421586:p.Pro533Ser		D6REZ9	Missense_Mutation	SNP	NULL	p.P209S	ENST00000510439.2	37	c.625		15	.	.	.	.	.	.	.	.	.	.	.	10.40	1.340084	0.24339	.	.	ENSG00000184206	ENST00000510439;ENST00000512109;ENST00000422563	T	0.32988	1.43	.	.	.	.	.	.	.	.	T	0.31040	0.0784	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.27905	-1.0060	3	0.66056	D	0.02	.	.	.	.	.	.	.	.	S	533;153;209	ENSP00000421586:P533S	ENSP00000389305:P209S	P	+	1	0	GOLGA6L4	82702220	0.009000	0.17119	.	.	.	.	-0.343000	0.07791	.	.	.	.	CCC	GOLGA6L4	-	NULL	ENSG00000184206		0.602	GOLGA6L4-001	NOVEL	not_best_in_genome_evidence|basic|appris_candidate_longest	protein_coding	GOLGA6L4	HGNC	protein_coding	OTTHUMT00000371478.2	-	0.00	36	0	C	NM_001267536		84911216	+1	tier1	-	no_errors	ENST00000422563	ensembl	human	known	74_37	missense	18.60	35	8	SNP	0.000	T
GP6	51206	genome.wustl.edu	37	19	55526285	55526286	+	3'UTR	DNP	GC	GC	AA			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	G|C	G|C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr19:55526285_55526286GC>AA	ENST00000417454.1	-	0	1050_1051				CTC-550B14.7_ENST00000593060.1_RNA|GP6_ENST00000310373.3_Missense_Mutation_p.A343F|GP6_ENST00000333884.2_3'UTR|CTC-550B14.7_ENST00000586845.1_RNA	NM_016363.4	NP_057447	Q9HCN6	GPVI_HUMAN	glycoprotein VI (platelet)						blood coagulation (GO:0007596)|enzyme linked receptor protein signaling pathway (GO:0007167)|leukocyte migration (GO:0050900)|platelet activation (GO:0030168)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|tetraspanin-enriched microdomain (GO:0097197)	collagen binding (GO:0005518)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			NS(2)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(6)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19			BRCA - Breast invasive adenocarcinoma(297;0.156)	GBM - Glioblastoma multiforme(193;0.0515)		CTGGGGTTCAGCGGTCATGAAC	0.634																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AB035073	CCDS42626.1, CCDS46184.1, CCDS58678.1	19q13.4	2013-01-29			ENSG00000088053	ENSG00000088053		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	14388	protein-coding gene	gene with protein product		605546				11027634	Standard	NM_001083899		Approved	GPVI	uc002qil.3	Q9HCN6	OTTHUMG00000159709	ENST00000417454.1:c.1018_1018delinsAA	19.37:g.55526285_55526286delinsAA			Q9HCN7|Q9UIF2	Missense_Mutation	SNP	smart_Ig_sub,smart_Ig_sub2	p.A343V|p.A343S	ENST00000417454.1	37	c.1028|c.1027	CCDS46184.1	19																																																																																			GP6	-	NULL	ENSG00000088053		0.634	GP6-001	KNOWN	basic|CCDS	protein_coding	GP6	HGNC	protein_coding	OTTHUMT00000357006.1	-	0.00	54	0	G|C			55526285|55526286	-1	tier1	-	no_errors	ENST00000310373	ensembl	human	known	74_37	missense	73.58|75.47	14|13	39|40	SNP	0.000	A
GRIA1	2890	genome.wustl.edu	37	5	153175034	153175034	+	Intron	SNP	A	A	G			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr5:153175034A>G	ENST00000285900.5	+	14	2728				GRIA1_ENST00000518783.1_Intron|GRIA1_ENST00000518142.1_Intron|GRIA1_ENST00000521843.2_Intron|GRIA1_ENST00000340592.5_Splice_Site|GRIA1_ENST00000448073.4_Splice_Site	NM_000827.3|NM_001258019.1	NP_000818.2|NP_001244948.1	P42261	GRIA1_HUMAN	glutamate receptor, ionotropic, AMPA 1						ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|long-term memory (GO:0007616)|receptor internalization (GO:0031623)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|axonal spine (GO:0044308)|cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|dendrite membrane (GO:0032590)|dendritic spine (GO:0043197)|endocytic vesicle membrane (GO:0030666)|endoplasmic reticulum (GO:0005783)|neuron spine (GO:0044309)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|synaptic vesicle (GO:0008021)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|PDZ domain binding (GO:0030165)			NS(1)|breast(4)|endometrium(7)|kidney(3)|large_intestine(24)|liver(2)|lung(23)|ovary(4)|pancreas(1)|prostate(5)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	81		Medulloblastoma(196;0.0391)|all_neural(177;0.16)|all_hematologic(541;0.21)	Kidney(363;0.000173)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)		Desflurane(DB01189)|Enflurane(DB00228)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Perampanel(DB08883)|Sevoflurane(DB01236)	CCCTGGTTGAAGAGGTCCCGT	0.388																																																	0													138.0	114.0	121.0					5																	153175034		692	1591	2283	SO:0001627	intron_variant	0				CCDS4322.1, CCDS47318.1, CCDS58986.1, CCDS58987.1, CCDS58988.1, CCDS58989.1	5q33	2012-08-29			ENSG00000155511	ENSG00000155511		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4571	protein-coding gene	gene with protein product		138248		GLUR1		1652753, 1319477	Standard	NM_000827		Approved	GluA1, GLURA	uc011dcy.2	P42261	OTTHUMG00000130148	ENST00000285900.5:c.2385+739A>G	5.37:g.153175034A>G			B7Z2S0|B7Z2W8|B7Z3F6|B7Z9G9|D3DQI4|E7ESV8|Q2NKM6	Splice_Site	SNP	-	e14-2	ENST00000285900.5	37	c.2301-2	CCDS4322.1	5	.	.	.	.	.	.	.	.	.	.	A	18.01	3.527517	0.64860	.	.	ENSG00000155511	ENST00000544403;ENST00000340592;ENST00000448073	.	.	.	5.45	5.45	0.79879	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.6932	0.69101	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	GRIA1	153155227	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.050000	0.93843	2.071000	0.62044	0.528000	0.53228	.	GRIA1	-	-	ENSG00000155511		0.388	GRIA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GRIA1	HGNC	protein_coding	OTTHUMT00000252456.3	-	0.00	65	0	A			153175034	+1	tier1	-	no_errors	ENST00000448073	ensembl	human	known	74_37	splice_site	27.78	39	15	SNP	1.000	G
GRIK4	2900	genome.wustl.edu	37	11	120776146	120776146	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr11:120776146G>C	ENST00000527524.2	+	13	1707	c.1420G>C	c.(1420-1422)Ggc>Cgc	p.G474R	GRIK4_ENST00000438375.2_Missense_Mutation_p.G474R	NM_001282470.1	NP_001269399.1	Q16099	GRIK4_HUMAN	glutamate receptor, ionotropic, kainate 4	474					glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|response to corticosteroid (GO:0031960)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|nucleus (GO:0005634)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	extracellular-glutamate-gated ion channel activity (GO:0005234)|kainate selective glutamate receptor activity (GO:0015277)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(20)|liver(1)|lung(29)|ovary(2)|pancreas(1)|prostate(4)|skin(2)|urinary_tract(1)	69		Breast(109;0.000868)|Medulloblastoma(222;0.0453)|all_neural(223;0.116)|all_hematologic(192;0.21)		BRCA - Breast invasive adenocarcinoma(274;1.24e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.116)		TGGCGTGTACGGCGTTCCCGA	0.607																																																	0													133.0	131.0	132.0					11																	120776146		2203	4299	6502	SO:0001583	missense	0			S67803	CCDS8433.1	11q23.3	2012-08-29			ENSG00000149403	ENSG00000149403		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4582	protein-coding gene	gene with protein product		600282		GRIK			Standard	NM_001282470		Approved	GluK4, KA1	uc009zax.1	Q16099	OTTHUMG00000048255	ENST00000527524.2:c.1420G>C	11.37:g.120776146G>C	ENSP00000435648:p.Gly474Arg		A8K9L1	Missense_Mutation	SNP	pfam_ANF_lig-bd_rcpt,pfam_Iontro_glu_rcpt,pfam_Glu_rcpt_Glu/Gly-bd,pfam_SBP_bac_3,superfamily_Peripla_BP_I,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.G474R	ENST00000527524.2	37	c.1420	CCDS8433.1	11	.	.	.	.	.	.	.	.	.	.	G	32	5.130299	0.94473	.	.	ENSG00000149403	ENST00000527524;ENST00000438375	D;D	0.93076	-3.16;-3.16	5.33	5.33	0.75918	Glutamate receptor, L-glutamate/glycine-binding (2);Ionotropic glutamate receptor (1);	0.000000	0.85682	D	0.000000	D	0.98204	0.9406	H	0.97940	4.11	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.99679	1.0998	10	0.87932	D	0	.	19.0102	0.92870	0.0:0.0:1.0:0.0	.	474;474	A6H8K8;Q16099	.;GRIK4_HUMAN	R	474	ENSP00000435648:G474R;ENSP00000404063:G474R	ENSP00000404063:G474R	G	+	1	0	GRIK4	120281356	1.000000	0.71417	0.954000	0.39281	0.927000	0.56198	9.869000	0.99810	2.473000	0.83533	0.655000	0.94253	GGC	GRIK4	-	pfam_Glu_rcpt_Glu/Gly-bd,pfam_SBP_bac_3,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	ENSG00000149403		0.607	GRIK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIK4	HGNC	protein_coding	OTTHUMT00000109760.4	-	0.00	17	0	G	NM_014619		120776146	+1	tier1	-	no_errors	ENST00000527524	ensembl	human	known	74_37	missense	53.33	7	8	SNP	1.000	C
GRK7	131890	genome.wustl.edu	37	3	141499459	141499459	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr3:141499459C>T	ENST00000264952.2	+	2	993	c.856C>T	c.(856-858)Cgt>Tgt	p.R286C		NM_139209.2	NP_631948.1	Q8WTQ7	GRK7_HUMAN	G protein-coupled receptor kinase 7	286	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				protein autophosphorylation (GO:0046777)|signal transduction (GO:0007165)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|visual perception (GO:0007601)	membrane (GO:0016020)	ATP binding (GO:0005524)|G-protein coupled receptor kinase activity (GO:0004703)|rhodopsin kinase activity (GO:0050254)			endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(14)|ovary(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	26						CGTGGGCACGCGTGGCCTGGA	0.562																																																	0													106.0	100.0	102.0					3																	141499459		2203	4300	6503	SO:0001583	missense	0				CCDS3120.1	3q24	2004-02-04	2004-02-04	2004-02-04	ENSG00000114124	ENSG00000114124			17031	protein-coding gene	gene with protein product		606987		GPRK7		11717351, 11754336	Standard	NM_139209		Approved		uc011bnd.2	Q8WTQ7	OTTHUMG00000159068	ENST00000264952.2:c.856C>T	3.37:g.141499459C>T	ENSP00000264952:p.Arg286Cys			Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_RGS_dom,superfamily_Kinase-like_dom,superfamily_Regulat_G_prot_signal_superfam,smart_Regulat_G_prot_signal_superfam,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pfscan_Regulat_G_prot_signal_superfam,pfscan_Prot_kinase_dom,prints_GPCR_kinase	p.R286C	ENST00000264952.2	37	c.856	CCDS3120.1	3	.	.	.	.	.	.	.	.	.	.	C	11.70	1.717102	0.30413	.	.	ENSG00000114124	ENST00000264952	T	0.66815	-0.23	4.79	4.79	0.61399	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.120019	0.56097	D	0.000030	T	0.71685	0.3369	L	0.48260	1.515	0.19300	N	0.999973	D	0.76494	0.999	P	0.59643	0.861	T	0.65063	-0.6259	10	0.72032	D	0.01	-6.1678	11.3174	0.49401	0.3174:0.6826:0.0:0.0	.	286	Q8WTQ7	GRK7_HUMAN	C	286	ENSP00000264952:R286C	ENSP00000264952:R286C	R	+	1	0	GRK7	142982149	0.190000	0.23276	0.354000	0.25760	0.070000	0.16714	0.807000	0.27140	2.197000	0.70478	0.655000	0.94253	CGT	GRK7	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000114124		0.562	GRK7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRK7	HGNC	protein_coding	OTTHUMT00000353168.1	-	0.00	26	0	C	NM_139209		141499459	+1	tier1	-	no_errors	ENST00000264952	ensembl	human	known	74_37	missense	20.27	59	15	SNP	0.033	T
GSE1	23199	genome.wustl.edu	37	16	85689343	85689343	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr16:85689343C>A	ENST00000253458.7	+	6	985	c.809C>A	c.(808-810)tCc>tAc	p.S270Y	GSE1_ENST00000405402.2_Missense_Mutation_p.S166Y|GSE1_ENST00000393243.1_Missense_Mutation_p.S197Y	NM_014615.2	NP_055430.1	Q14687	GSE1_HUMAN	Gse1 coiled-coil protein	270																	ATGGACGACTCCTACTGCCTG	0.632																																																	0													106.0	91.0	96.0					16																	85689343		2195	4299	6494	SO:0001583	missense	0			D80004	CCDS10952.1, CCDS45539.1, CCDS62007.1	16q24.1	2012-12-07	2012-12-07	2012-10-02	ENSG00000131149	ENSG00000131149			28979	protein-coding gene	gene with protein product	"""genetic suppressor element 1"""		"""KIAA0182"", ""Gse1 coiled-coil protein homolog (mouse)"""	KIAA0182		8724849, 8786132	Standard	NM_014615		Approved		uc002fix.4	Q14687	OTTHUMG00000137650	ENST00000253458.7:c.809C>A	16.37:g.85689343C>A	ENSP00000253458:p.Ser270Tyr		D3DUM4|Q8IY61|Q96GA4|Q9BW09	Missense_Mutation	SNP	pfam_GSE-like	p.S270Y	ENST00000253458.7	37	c.809	CCDS10952.1	16	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	17.87|17.87	3.495463|3.495463	0.64186|0.64186	.|.	.|.	ENSG00000131149|ENSG00000131149	ENST00000412692|ENST00000405402;ENST00000411612;ENST00000253458;ENST00000393243	.|T;T;T	.|0.33865	.|1.39;1.39;1.39	4.79|4.79	4.79|4.79	0.61399|0.61399	.|.	.|0.052612	.|0.85682	.|D	.|0.000000	T|T	0.49643|0.49643	0.1569|0.1569	L|L	0.48362|0.48362	1.52|1.52	0.58432|0.58432	D|D	0.999992|0.999992	.|D;D	.|0.71674	.|0.998;0.996	.|D;P	.|0.65443	.|0.935;0.862	T|T	0.34750|0.34750	-0.9816|-0.9816	5|10	.|0.12766	.|T	.|0.61	-30.5813|-30.5813	17.8254|17.8254	0.88664|0.88664	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|197;270	.|Q14687-3;Q14687	.|.;GSE1_HUMAN	T|Y	77|166;166;270;197	.|ENSP00000384839:S166Y;ENSP00000253458:S270Y;ENSP00000376934:S197Y	.|ENSP00000253458:S270Y	P|S	+|+	1|2	0|0	KIAA0182|KIAA0182	84246844|84246844	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.915000|0.915000	0.54546|0.54546	7.498000|7.498000	0.81546|0.81546	2.211000|2.211000	0.71520|0.71520	0.555000|0.555000	0.69702|0.69702	CCT|TCC	GSE1	-	NULL	ENSG00000131149		0.632	GSE1-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	GSE1	HGNC	protein_coding	OTTHUMT00000325527.1	-	0.00	39	0	C	NM_014615		85689343	+1	tier1	-	no_errors	ENST00000253458	ensembl	human	known	74_37	missense	32.14	19	9	SNP	1.000	A
H2AFV	94239	genome.wustl.edu	37	7	44874131	44874131	+	Missense_Mutation	SNP	A	A	G	rs114398265		TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr7:44874131A>G	ENST00000308153.4	-	5	447	c.356T>C	c.(355-357)aTt>aCt	p.I119T	H2AFV_ENST00000222690.6_Intron|H2AFV_ENST00000350771.3_Missense_Mutation_p.I93T|H2AFV_ENST00000437072.1_Intron|H2AFV_ENST00000381124.5_3'UTR|H2AFV_ENST00000521529.1_3'UTR|H2AFV_ENST00000349299.3_Missense_Mutation_p.I81T	NM_012412.4	NP_036544.1	Q71UI9	H2AV_HUMAN	H2A histone family, member V	119						extracellular vesicular exosome (GO:0070062)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.I119T(1)		endometrium(2)|large_intestine(1)|lung(4)|prostate(1)|urinary_tract(1)	9						CTTCTTTCCAATCAGAGATTT	0.368																																																	1	Substitution - Missense(1)	prostate(1)											88.0	76.0	80.0					7																	44874131		2203	4300	6503	SO:0001583	missense	0			AF081192	CCDS5495.1, CCDS5496.1, CCDS5497.1, CCDS5498.1, CCDS47581.1	7p13	2011-01-27		2004-03-26	ENSG00000105968	ENSG00000105968		"""Histones / Replication-independent"""	20664	protein-coding gene	gene with protein product				H2AV			Standard	NM_012412		Approved	MGC10170, MGC10831, MGC1947	uc003tma.2	Q71UI9	OTTHUMG00000129217	ENST00000308153.4:c.356T>C	7.37:g.44874131A>G	ENSP00000308405:p.Ile119Thr		A6NFA8|A6NKY0|A6NN01|A8MQC5|Q59GV8|Q6PK98	Missense_Mutation	SNP	pfam_Histone_core_D,superfamily_Histone-fold,smart_Histone_H2A,prints_Histone_H2A	p.I119T	ENST00000308153.4	37	c.356	CCDS5496.1	7	.	.	.	.	.	.	.	.	.	.	A	15.33	2.801702	0.50315	.	.	ENSG00000105968	ENST00000349299;ENST00000308153;ENST00000350771	T;D;T	0.83163	0.93;-1.69;0.89	5.61	5.61	0.85477	Histone-fold (1);Histone H2A (2);	.	.	.	.	D	0.82444	0.5038	M	0.69523	2.12	0.80722	D	1	B;B;B	0.17852	0.001;0.024;0.0	B;B;B	0.18871	0.005;0.023;0.001	T	0.80027	-0.1554	9	0.62326	D	0.03	-10.9595	14.0456	0.64704	1.0:0.0:0.0:0.0	.	93;81;119	A6NKY0;A6NFA8;Q71UI9	.;.;H2AV_HUMAN	T	81;119;93	ENSP00000342714:I81T;ENSP00000308405:I119T;ENSP00000340708:I93T	ENSP00000308405:I119T	I	-	2	0	H2AFV	44840656	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.631000	0.90991	2.261000	0.74972	0.533000	0.62120	ATT	H2AFV	-	smart_Histone_H2A,prints_Histone_H2A	ENSG00000105968		0.368	H2AFV-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	H2AFV	HGNC	protein_coding	OTTHUMT00000251305.1	-	0.00	53	0	A	NM_012412		44874131	-1	tier1	rs114398265	no_errors	ENST00000308153	ensembl	human	known	74_37	missense	25.00	21	7	SNP	1.000	G
HEATR1	55127	genome.wustl.edu	37	1	236751319	236751319	+	Missense_Mutation	SNP	T	T	C			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr1:236751319T>C	ENST00000366582.3	-	13	1669	c.1555A>G	c.(1555-1557)Aaa>Gaa	p.K519E	HEATR1_ENST00000366581.2_Missense_Mutation_p.K519E	NM_018072.5	NP_060542.4	Q9H583	HEAT1_HUMAN	HEAT repeat containing 1	519					rRNA processing (GO:0006364)	membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)			NS(2)|breast(7)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(18)|lung(28)|ovary(3)|prostate(1)|skin(4)|stomach(3)|upper_aerodigestive_tract(3)	87	Ovarian(103;0.0634)|Breast(184;0.133)	all_cancers(173;0.0255)|Prostate(94;0.175)	OV - Ovarian serous cystadenocarcinoma(106;0.00117)			ACAGCTTCTTTTATGAAAGAT	0.348																																																	0													105.0	99.0	101.0					1																	236751319		2203	4300	6503	SO:0001583	missense	0			BC065205	CCDS31066.1	1q43	2011-08-12			ENSG00000119285	ENSG00000119285			25517	protein-coding gene	gene with protein product	"""UTP10, small subunit (SSU) processome component, homolog (yeast)"""					17699751	Standard	NM_018072		Approved	FLJ10359, BAP28, UTP10	uc001hyd.2	Q9H583	OTTHUMG00000040061	ENST00000366582.3:c.1555A>G	1.37:g.236751319T>C	ENSP00000355541:p.Lys519Glu		Q5T3Q8|Q6P197|Q9NW23	Missense_Mutation	SNP	pfam_BP28_C_dom,pfam_U3snoRNP10,superfamily_ARM-type_fold	p.K519E	ENST00000366582.3	37	c.1555	CCDS31066.1	1	.	.	.	.	.	.	.	.	.	.	T	20.5	4.007389	0.75046	.	.	ENSG00000119285	ENST00000366582;ENST00000366581	T;T	0.66638	-0.1;-0.22	5.8	5.8	0.92144	Armadillo-like helical (1);Armadillo-type fold (1);	0.252691	0.45361	D	0.000370	T	0.55369	0.1916	L	0.50333	1.59	0.80722	D	1	B	0.13145	0.007	B	0.17722	0.019	T	0.53208	-0.8471	10	0.24483	T	0.36	.	5.2476	0.15506	0.0:0.1124:0.1727:0.7149	.	519	Q9H583	HEAT1_HUMAN	E	519	ENSP00000355541:K519E;ENSP00000355540:K519E	ENSP00000355540:K519E	K	-	1	0	HEATR1	234817942	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.795000	0.38784	2.225000	0.72522	0.529000	0.55759	AAA	HEATR1	-	superfamily_ARM-type_fold	ENSG00000119285		0.348	HEATR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HEATR1	HGNC	protein_coding	OTTHUMT00000096635.1	-	0.00	44	0	T	XM_375853		236751319	-1	tier1	-	no_errors	ENST00000366582	ensembl	human	known	74_37	missense	24.72	67	22	SNP	0.993	C
HEPH	9843	genome.wustl.edu	37	X	65411972	65411972	+	Splice_Site	SNP	A	A	T			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chrX:65411972A>T	ENST00000343002.2	+	6	1728	c.1064A>T	c.(1063-1065)gAt>gTt	p.D355V	HEPH_ENST00000419594.1_Splice_Site_p.D358V|HEPH_ENST00000336279.5_Splice_Site_p.D88V|HEPH_ENST00000374727.3_Splice_Site_p.D358V|HEPH_ENST00000441993.2_Splice_Site_p.D358V|HEPH_ENST00000519389.1_Splice_Site_p.D409V			Q9BQS7	HEPH_HUMAN	hephaestin	355	Plastocyanin-like 2.				cellular iron ion homeostasis (GO:0006879)|copper ion transport (GO:0006825)|iron ion transport (GO:0006826)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	copper ion binding (GO:0005507)|ferrous iron binding (GO:0008198)|ferroxidase activity (GO:0004322)			endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(5)|lung(56)|ovary(5)|prostate(1)|skin(8)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	89						CTTCCTTCAGATGGCATGCAG	0.507																																																	0													102.0	82.0	88.0					X																	65411972		2203	4300	6503	SO:0001630	splice_region_variant	0			AB014598	CCDS14384.2, CCDS14385.1, CCDS48133.1, CCDS14384.3, CCDS65277.1	Xq11-q12	2008-02-05			ENSG00000089472	ENSG00000089472			4866	protein-coding gene	gene with protein product		300167				9988272, 9734811	Standard	NM_014799		Approved	KIAA0698, CPL	uc011moz.2	Q9BQS7	OTTHUMG00000021732	ENST00000343002.2:c.1064-1A>T	X.37:g.65411972A>T			B1AJX8|D3DVT7|E9PHN8|O75180|Q6UW45|Q9C058	Missense_Mutation	SNP	pfam_Cu-oxidase_3,pfam_Cu-oxidase_2,superfamily_Cupredoxin	p.D409V	ENST00000343002.2	37	c.1226		X	.	.	.	.	.	.	.	.	.	.	A	12.08	1.831616	0.32329	.	.	ENSG00000089472	ENST00000519389;ENST00000374727;ENST00000336279;ENST00000441993;ENST00000419594;ENST00000343002;ENST00000425114	D;D;D;D;D;D;D	0.99789	-6.75;-6.75;-6.75;-6.75;-6.75;-6.75;-6.75	5.03	3.63	0.41609	Cupredoxin (2);	0.196571	0.44483	D	0.000454	D	0.98573	0.9523	L	0.50333	1.59	0.50632	D	0.99988	B;B;B	0.23058	0.009;0.079;0.061	B;B;B	0.23150	0.007;0.025;0.044	D	0.97092	0.9791	9	.	.	.	.	3.607	0.08046	0.551:0.1895:0.2595:0.0	.	409;358;355	E9PHN8;E7ES21;Q9BQS7	.;.;HEPH_HUMAN	V	409;358;88;358;358;355;355	ENSP00000430620:D409V;ENSP00000363859:D358V;ENSP00000337418:D88V;ENSP00000411687:D358V;ENSP00000413211:D358V;ENSP00000343939:D355V;ENSP00000398078:D355V	.	D	+	2	0	HEPH	65328697	1.000000	0.71417	0.978000	0.43139	0.914000	0.54420	0.959000	0.29240	0.450000	0.26774	0.430000	0.28490	GAT	HEPH	-	superfamily_Cupredoxin	ENSG00000089472		0.507	HEPH-002	KNOWN	alternative_5_UTR|basic|appris_candidate	protein_coding	HEPH	HGNC	protein_coding	OTTHUMT00000056995.1	-	0.00	20	0	A	NM_138737	Missense_Mutation	65411972	+1	tier1	-	no_errors	ENST00000519389	ensembl	human	known	74_37	missense	38.18	34	21	SNP	1.000	T
HSD3B7	80270	genome.wustl.edu	37	16	30999400	30999400	+	Missense_Mutation	SNP	G	G	T	rs372114914		TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr16:30999400G>T	ENST00000297679.5	+	7	1099	c.1006G>T	c.(1006-1008)Gac>Tac	p.D336Y	HSD3B7_ENST00000262520.6_3'UTR|HSD3B7_ENST00000353250.5_3'UTR|AC135048.1_ENST00000602217.1_5'Flank	NM_025193.3	NP_079469.2	Q9H2F3	3BHS7_HUMAN	hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 7	336					bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	3-beta-hydroxy-delta5-steroid dehydrogenase activity (GO:0003854)|cholest-5-ene-3-beta,7-alpha-diol 3-beta-dehydrogenase activity (GO:0047016)			central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	12						CGTCAGCACCGACAAGGCTCA	0.642																																																	0													43.0	39.0	40.0					16																	30999400		2197	4300	6497	SO:0001583	missense	0			AF277719	CCDS10698.1, CCDS45466.1	16p11.2	2011-09-14			ENSG00000099377	ENSG00000099377	1.1.1.-	"""Short chain dehydrogenase/reductase superfamily / Extended SDR fold"""	18324	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 11E, member 3"""	607764				11067870, 19027726	Standard	NM_001142777		Approved	C(27)-3BETA-HSD, SDR11E3	uc002eaf.2	Q9H2F3	OTTHUMG00000132417	ENST00000297679.5:c.1006G>T	16.37:g.30999400G>T	ENSP00000297679:p.Asp336Tyr		Q96M28|Q9BSN9	Missense_Mutation	SNP	pfam_3Beta_OHSteriod_DH/Estase,pfam_Epimerase_deHydtase,pfam_Male_sterile_NAD-bd,pfam_DH_sc/Rdtase_SDR,pfam_PKS_KR,pfam_Polysac_CapD-like,pfam_dTDP_dehydrorham_reduct,pfam_NmrA	p.D336Y	ENST00000297679.5	37	c.1006	CCDS10698.1	16	.	.	.	.	.	.	.	.	.	.	G	18.10	3.547662	0.65311	.	.	ENSG00000099377	ENST00000297679	T	0.65549	-0.16	5.17	-3.38	0.04883	.	0.312207	0.39909	N	0.001228	T	0.72228	0.3434	M	0.68317	2.08	0.80722	D	1	D	0.71674	0.998	D	0.65233	0.933	T	0.73845	-0.3854	10	0.87932	D	0	-20.0423	16.1139	0.81289	0.1234:0.0:0.8766:0.0	.	336	Q9H2F3	3BHS7_HUMAN	Y	336	ENSP00000297679:D336Y	ENSP00000297679:D336Y	D	+	1	0	HSD3B7	30906901	0.924000	0.31332	0.756000	0.31282	0.874000	0.50279	1.359000	0.34113	-0.968000	0.03578	-0.345000	0.07892	GAC	HSD3B7	-	NULL	ENSG00000099377		0.642	HSD3B7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSD3B7	HGNC	protein_coding	OTTHUMT00000255554.2	-	0.00	49	0	G			30999400	+1	tier1	-	no_errors	ENST00000297679	ensembl	human	known	74_37	missense	18.33	49	11	SNP	0.907	T
HTATIP2	10553	genome.wustl.edu	37	11	20388759	20388759	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr11:20388759G>T	ENST00000451739.2	+	2	676	c.235G>T	c.(235-237)Gcc>Tcc	p.A79S	HTATIP2_ENST00000532505.1_Missense_Mutation_p.A79S|HTATIP2_ENST00000530266.1_Missense_Mutation_p.A79S|HTATIP2_ENST00000443524.2_Missense_Mutation_p.A79S|HTATIP2_ENST00000531058.1_Missense_Mutation_p.A79S|HTATIP2_ENST00000421577.2_Missense_Mutation_p.A79S|HTATIP2_ENST00000419348.2_Missense_Mutation_p.A113S|HTATIP2_ENST00000532081.1_Missense_Mutation_p.A79S	NM_001098522.1	NP_001091992.1			HIV-1 Tat interactive protein 2, 30kDa											large_intestine(2)|lung(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	8						GGATGACTACGCCTCTGCCTT	0.453																																																	0													233.0	222.0	226.0					11																	20388759		2203	4300	6503	SO:0001583	missense	0			AF039103	CCDS7852.1, CCDS44553.1, CCDS53613.1	11p15.1	2011-09-14	2002-08-29		ENSG00000109854	ENSG00000109854	1.1.1.-	"""Short chain dehydrogenase/reductase superfamily / Atypical members"""	16637	protein-coding gene	gene with protein product	"""Tat-interacting protein (30kD)"", ""short chain dehydrogenase/reductase family 44U, member 1"""	605628	"""HIV-1 Tat interactive protein 2, 30 kDa"""			9482853, 9174052, 19027726	Standard	NM_006410		Approved	TIP30, CC3, FLJ26963, SDR44U1	uc001mpx.2	Q9BUP3	OTTHUMG00000166015	ENST00000451739.2:c.235G>T	11.37:g.20388759G>T	ENSP00000394259:p.Ala79Ser			Missense_Mutation	SNP	pfam_Semialdehyde_DH_NAD-bd	p.A113S	ENST00000451739.2	37	c.337	CCDS7852.1	11	.	.	.	.	.	.	.	.	.	.	G	9.561	1.118571	0.20877	.	.	ENSG00000109854	ENST00000530266;ENST00000421577;ENST00000443524;ENST00000419348;ENST00000451739;ENST00000532505;ENST00000532081;ENST00000531058	T;T;T;T;T;T;T;T	0.32753	1.44;1.44;1.44;1.44;1.44;1.44;1.44;1.44	5.71	2.55	0.30701	Semialdehyde dehydrogenase, NAD-binding (1);NAD(P)-binding domain (1);	0.305787	0.40222	N	0.001147	T	0.20210	0.0486	N	0.21583	0.68	0.09310	N	0.999998	B;P;B	0.41978	0.002;0.767;0.089	B;B;B	0.43123	0.023;0.409;0.096	T	0.05818	-1.0862	10	0.36615	T	0.2	-20.2686	7.0645	0.25143	0.0869:0.0:0.6136:0.2995	.	79;79;113	Q9BUP3;Q9BUP3-2;Q9BUP3-3	HTAI2_HUMAN;.;.	S	79;79;79;113;79;79;79;79	ENSP00000436548:A79S;ENSP00000397752:A79S;ENSP00000387876:A79S;ENSP00000392985:A113S;ENSP00000394259:A79S;ENSP00000432338:A79S;ENSP00000432107:A79S;ENSP00000436729:A79S	ENSP00000392985:A113S	A	+	1	0	HTATIP2	20345335	0.190000	0.23276	0.009000	0.14445	0.133000	0.20885	1.418000	0.34782	1.424000	0.47217	0.555000	0.69702	GCC	HTATIP2	-	pfam_Semialdehyde_DH_NAD-bd	ENSG00000109854		0.453	HTATIP2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	HTATIP2	HGNC	protein_coding	OTTHUMT00000387445.2		0.00	28	0	G	NM_001098521		20388759	+1			no_errors	ENST00000419348	ensembl	human	known	74_37	missense	6.98	40	3	SNP	0.033	T
HTRA1	5654	genome.wustl.edu	37	10	124273783	124273783	+	Missense_Mutation	SNP	G	G	A	rs149822364	byFrequency	TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr10:124273783G>A	ENST00000368984.3	+	9	1479	c.1351G>A	c.(1351-1353)Gtc>Atc	p.V451I		NM_002775.4	NP_002766.1	Q92743	HTRA1_HUMAN	HtrA serine peptidase 1	451	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.				negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|proteolysis (GO:0006508)|regulation of cell growth (GO:0001558)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			endometrium(1)|kidney(1)|large_intestine(8)|lung(7)	17		all_neural(114;0.0765)|Lung NSC(174;0.133)|all_lung(145;0.163)|Breast(234;0.238)				TGTCAGCGACGTCATTAAAAG	0.483																																																	0								G	ILE/VAL	0,4406		0,0,2203	250.0	220.0	230.0		1351	4.5	1.0	10	dbSNP_134	230	4,8596	3.7+/-12.6	0,4,4296	yes	missense	HTRA1	NM_002775.4	29	0,4,6499	AA,AG,GG		0.0465,0.0,0.0308	benign	451/481	124273783	4,13002	2203	4300	6503	SO:0001583	missense	0			AF097709	CCDS7630.1	10q26.3	2014-01-28	2005-08-18	2005-08-18	ENSG00000166033	ENSG00000166033		"""Serine peptidases / Serine peptidases"""	9476	protein-coding gene	gene with protein product		602194	"""protease, serine, 11 (IGF binding)"""	PRSS11		8977104	Standard	NM_002775		Approved	HtrA, IGFBP5-protease, ARMD7	uc001lgj.2	Q92743	OTTHUMG00000019186	ENST00000368984.3:c.1351G>A	10.37:g.124273783G>A	ENSP00000357980:p.Val451Ile		D3DRE4|Q9UNS5	Missense_Mutation	SNP	pfam_Peptidase_S1,pfam_PDZ,pfam_Kazal_dom,pfam_IGFBP-like,superfamily_Trypsin-like_Pept_dom,superfamily_PDZ,smart_IGFBP-like,smart_Kazal_dom,smart_PDZ,pfscan_PDZ,prints_Peptidase_S1C	p.V451I	ENST00000368984.3	37	c.1351	CCDS7630.1	10	.	.	.	.	.	.	.	.	.	.	G	12.47	1.949000	0.34377	0.0	4.65E-4	ENSG00000166033	ENST00000368984;ENST00000435263;ENST00000420892	T;T	0.27557	1.66;1.66	5.38	4.47	0.54385	PDZ/DHR/GLGF (4);	0.363555	0.28156	N	0.016395	T	0.13329	0.0323	N	0.03224	-0.385	0.27811	N	0.942133	B	0.09022	0.002	B	0.11329	0.006	T	0.11743	-1.0575	10	0.36615	T	0.2	-9.7112	7.8443	0.29417	0.1094:0.1619:0.7286:0.0	.	451	Q92743	HTRA1_HUMAN	I	451;418;192	ENSP00000357980:V451I;ENSP00000412676:V192I	ENSP00000357980:V451I	V	+	1	0	HTRA1	124263773	1.000000	0.71417	0.993000	0.49108	0.545000	0.35147	3.478000	0.53158	1.254000	0.44035	0.655000	0.94253	GTC	HTRA1	-	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	ENSG00000166033		0.483	HTRA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HTRA1	HGNC	protein_coding	OTTHUMT00000128327.1	-	0.00	74	0	G	NM_002775		124273783	+1	tier1	rs149822364	no_errors	ENST00000368984	ensembl	human	known	74_37	missense	59.38	13	19	SNP	0.997	A
ICAM2	3384	genome.wustl.edu	37	17	62082482	62082482	+	Missense_Mutation	SNP	T	T	G			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr17:62082482T>G	ENST00000412356.1	-	4	667	c.313A>C	c.(313-315)Aac>Cac	p.N105H	ICAM2_ENST00000418105.1_Missense_Mutation_p.N105H|ICAM2_ENST00000578892.1_Missense_Mutation_p.N81H|ICAM2_ENST00000578379.1_Missense_Mutation_p.N4H|ICAM2_ENST00000579687.1_Missense_Mutation_p.N105H|ICAM2_ENST00000449662.2_Missense_Mutation_p.N105H|ICAM2_ENST00000579788.1_Missense_Mutation_p.N105H|ICAM2_ENST00000581417.1_5'UTR	NM_001099786.1	NP_001093256.1	P13598	ICAM2_HUMAN	intercellular adhesion molecule 2	105					extracellular matrix organization (GO:0030198)|regulation of immune response (GO:0050776)|single organismal cell-cell adhesion (GO:0016337)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|uropod (GO:0001931)	integrin binding (GO:0005178)			large_intestine(1)|lung(2)|ovary(1)|skin(2)	6						ACGCTGACGTTGGAATTCATT	0.572																																																	0													100.0	71.0	81.0					17																	62082482		2203	4300	6503	SO:0001583	missense	0				CCDS11657.1	17q23.3	2014-01-30			ENSG00000108622	ENSG00000108622		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Endogenous ligands"""	5345	protein-coding gene	gene with protein product		146630				1769660	Standard	NM_001099786		Approved	CD102	uc002jdx.4	P13598		ENST00000412356.1:c.313A>C	17.37:g.62082482T>G	ENSP00000415283:p.Asn105His		Q14600	Missense_Mutation	SNP	pfam_ICAM_N,prints_ICAM_VCAM_N,prints_ICAM	p.N105H	ENST00000412356.1	37	c.313	CCDS11657.1	17	.	.	.	.	.	.	.	.	.	.	T	14.05	2.419165	0.42918	.	.	ENSG00000108622	ENST00000412356;ENST00000418105;ENST00000449662	T;T;T	0.16073	2.37;2.37;2.37	5.38	1.93	0.25924	Intercellular adhesion molecule, N-terminal (1);Immunoglobulin-like fold (1);	0.396304	0.25607	N	0.029506	T	0.30916	0.0780	M	0.64997	1.995	0.09310	N	1	D;D	0.89917	1.0;1.0	D;D	0.78314	0.991;0.972	T	0.04855	-1.0922	10	0.44086	T	0.13	-16.6134	5.416	0.16374	0.0:0.0893:0.3497:0.561	.	105;105	B7Z316;P13598	.;ICAM2_HUMAN	H	105	ENSP00000415283:N105H;ENSP00000388666:N105H;ENSP00000392634:N105H	ENSP00000415283:N105H	N	-	1	0	ICAM2	59436214	0.001000	0.12720	0.000000	0.03702	0.005000	0.04900	1.000000	0.29770	0.334000	0.23590	0.459000	0.35465	AAC	ICAM2	-	pfam_ICAM_N	ENSG00000108622		0.572	ICAM2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ICAM2	HGNC	protein_coding	OTTHUMT00000443687.1	-	0.00	51	0	T			62082482	-1	tier1	-	no_errors	ENST00000412356	ensembl	human	known	74_37	missense	29.55	31	13	SNP	0.000	G
IFT172	26160	genome.wustl.edu	37	2	27668210	27668210	+	Missense_Mutation	SNP	A	A	G			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr2:27668210A>G	ENST00000260570.3	-	46	5124	c.5021T>C	c.(5020-5022)cTa>cCa	p.L1674P	KRTCAP3_ENST00000543753.1_Intron	NM_015662.1	NP_056477.1	Q9UG01	IF172_HUMAN	intraflagellar transport 172	1674					bone development (GO:0060348)|brain development (GO:0007420)|cilium assembly (GO:0042384)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|epidermis development (GO:0008544)|heart looping (GO:0001947)|hindgut development (GO:0061525)|left/right axis specification (GO:0070986)|limb development (GO:0060173)|negative regulation of epithelial cell proliferation (GO:0050680)|neural tube closure (GO:0001843)|Notch signaling pathway (GO:0007219)|palate development (GO:0060021)|positive regulation of smoothened signaling pathway (GO:0045880)|protein processing (GO:0016485)|smoothened signaling pathway (GO:0007224)|spinal cord motor neuron differentiation (GO:0021522)	axoneme (GO:0005930)|ciliary basal body (GO:0036064)|cilium (GO:0005929)|intraciliary transport particle B (GO:0030992)|sperm midpiece (GO:0097225)|sperm principal piece (GO:0097228)|vesicle (GO:0031982)				central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(17)|lung(17)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	43	Acute lymphoblastic leukemia(172;0.155)					CGCTGCCACTAGGGAGGCCTC	0.592																																																	0													28.0	28.0	28.0					2																	27668210		2203	4300	6503	SO:0001583	missense	0			AB033005	CCDS1755.1	2p23.3	2014-07-03	2014-07-03		ENSG00000138002	ENSG00000138002		"""Intraflagellar transport homologs"", ""WD repeat domain containing"""	30391	protein-coding gene	gene with protein product	"""wimple homolog"""	607386	"""intraflagellar transport 172 homolog (Chlamydomonas)"""			10788441, 10574461, 24140113	Standard	XM_005264254		Approved	SLB, wim, osm-1, NPHP17	uc002rku.3	Q9UG01	OTTHUMG00000128425	ENST00000260570.3:c.5021T>C	2.37:g.27668210A>G	ENSP00000260570:p.Leu1674Pro		A5PKZ0|B2RNU5|Q86X44|Q96HW4|Q9UFJ9|Q9ULP1	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_WD40_repeat	p.L1674P	ENST00000260570.3	37	c.5021	CCDS1755.1	2	.	.	.	.	.	.	.	.	.	.	A	18.45	3.627511	0.66901	.	.	ENSG00000138002	ENST00000260570	T	0.57107	0.42	5.22	5.22	0.72569	.	0.000000	0.64402	D	0.000002	T	0.75568	0.3867	M	0.88450	2.955	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.80634	-0.1295	10	0.87932	D	0	-7.1416	12.4452	0.55647	1.0:0.0:0.0:0.0	.	1674	Q9UG01	IF172_HUMAN	P	1674	ENSP00000260570:L1674P	ENSP00000260570:L1674P	L	-	2	0	IFT172	27521714	1.000000	0.71417	1.000000	0.80357	0.596000	0.36781	8.746000	0.91604	1.980000	0.57719	0.459000	0.35465	CTA	IFT172	-	NULL	ENSG00000138002		0.592	IFT172-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IFT172	HGNC	protein_coding	OTTHUMT00000250213.2	-	0.00	32	0	A	NM_015662		27668210	-1	tier1	-	no_errors	ENST00000260570	ensembl	human	known	74_37	missense	12.12	29	4	SNP	1.000	G
JAM3	83700	genome.wustl.edu	37	11	134014718	134014718	+	Silent	SNP	G	G	A	rs371009569		TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr11:134014718G>A	ENST00000299106.4	+	5	600	c.441G>A	c.(439-441)ccG>ccA	p.P147P	JAM3_ENST00000441717.3_Silent_p.P96P|JAM3_ENST00000529443.2_Silent_p.P192P|JAM3_ENST00000524969.1_3'UTR			Q9BX67	JAM3_HUMAN	junctional adhesion molecule 3	147	Ig-like C2-type.				adaptive immune response (GO:0002250)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|establishment of cell polarity (GO:0030010)|extracellular matrix organization (GO:0030198)|leukocyte migration (GO:0050900)|leukocyte migration involved in inflammatory response (GO:0002523)|myelination (GO:0042552)|myeloid progenitor cell differentiation (GO:0002318)|neutrophil homeostasis (GO:0001780)|regulation of actin cytoskeleton organization by cell-cell adhesion (GO:0090138)|regulation of neutrophil chemotaxis (GO:0090022)|spermatid development (GO:0007286)|transmission of nerve impulse (GO:0019226)	cell-cell contact zone (GO:0044291)|desmosome (GO:0030057)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|paranodal junction (GO:0033010)|plasma membrane (GO:0005886)|Schmidt-Lanterman incisure (GO:0043220)|tight junction (GO:0005923)	integrin binding (GO:0005178)			breast(1)|endometrium(1)|large_intestine(3)|lung(3)|ovary(1)|pancreas(1)	10	all_hematologic(175;0.127)	all_cancers(12;1.06e-21)|all_epithelial(12;3.37e-16)|all_lung(97;7.03e-06)|Lung NSC(97;1.67e-05)|Breast(109;0.000182)|Medulloblastoma(222;0.0245)|all_neural(223;0.0506)|Esophageal squamous(93;0.0566)		Epithelial(10;1.55e-09)|BRCA - Breast invasive adenocarcinoma(10;1.35e-08)|all cancers(11;2.81e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00402)|Lung(977;0.245)		GTAGAGTGCCGAAGGCTGTAC	0.537																																																	0								G	,	1,4401	2.1+/-5.4	0,1,2200	90.0	87.0	88.0		288,441	-10.2	0.0	11		88	0,8594		0,0,4297	no	coding-synonymous,coding-synonymous	JAM3	NM_001205329.1,NM_032801.4	,	0,1,6497	AA,AG,GG		0.0,0.0227,0.0077	,	96/260,147/311	134014718	1,12995	2201	4297	6498	SO:0001819	synonymous_variant	0			AF356518	CCDS8494.1, CCDS55799.1, CCDS8494.2	11q25	2013-01-29			ENSG00000166086	ENSG00000166086		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15532	protein-coding gene	gene with protein product		606871					Standard	NM_032801		Approved	JAM-C, JAMC	uc001qhb.3	Q9BX67	OTTHUMG00000167130	ENST00000299106.4:c.441G>A	11.37:g.134014718G>A			B3KWG9|Q8WWL8|Q96FL1	Silent	SNP	pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,pfam_CD80_C2-set,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,pfscan_Ig-like_dom	p.P192	ENST00000299106.4	37	c.576	CCDS8494.2	11	.	.	.	.	.	.	.	.	.	.	G	0.286	-0.983204	0.02180	2.27E-4	0.0	ENSG00000166086	ENST00000534549;ENST00000529443	.	.	.	5.1	-10.2	0.00374	.	.	.	.	.	T	0.43277	0.1240	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.51779	-0.8662	4	.	.	.	.	6.4721	0.22013	0.2108:0.5278:0.1352:0.1263	.	.	.	.	K	92;101	.	.	E	+	1	0	JAM3	133519928	0.000000	0.05858	0.004000	0.12327	0.021000	0.10359	-3.451000	0.00466	-2.335000	0.00629	-0.778000	0.03378	GAA	JAM3	-	pfam_Ig_V-set,smart_Ig_sub,pfscan_Ig-like_dom	ENSG00000166086		0.537	JAM3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	JAM3	HGNC	protein_coding	OTTHUMT00000393303.4	-	0.00	46	0	G	NM_032801		134014718	+1	tier1	-	no_errors	ENST00000529443	ensembl	human	known	74_37	silent	35.48	20	11	SNP	0.081	A
KALRN	8997	genome.wustl.edu	37	3	124174024	124174024	+	Splice_Site	SNP	C	C	A			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr3:124174024C>A	ENST00000240874.3	+	22	3704	c.3547C>A	c.(3547-3549)Caa>Aaa	p.Q1183K	KALRN_ENST00000460856.1_Splice_Site_p.Q1174K|KALRN_ENST00000360013.3_Splice_Site_p.Q1183K	NM_003947.4	NP_003938.1	O60229	KALRN_HUMAN	kalirin, RhoGEF kinase	1183					apoptotic signaling pathway (GO:0097190)|intracellular signal transduction (GO:0035556)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|protein phosphorylation (GO:0006468)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|vesicle-mediated transport (GO:0016192)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(21)|lung(28)|ovary(4)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	83						TTTGGGGCAGCAAACAAAGGA	0.473																																																	0													93.0	87.0	89.0					3																	124174024		2203	4300	6503	SO:0001630	splice_region_variant	0			U94190	CCDS3027.1, CCDS3028.1	3q21.2	2013-02-11	2005-03-11	2005-03-12	ENSG00000160145	ENSG00000160145		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	4814	protein-coding gene	gene with protein product	"""serine/threonine kinase with Dbl and pleckstrin homology domains"""	604605	"""huntingtin-associated protein interacting protein (duo)"""	HAPIP		9285789, 10023074	Standard	NM_001024660		Approved	duo, Hs.8004, TRAD, DUET, Kalirin, ARHGEF24	uc003ehd.3	O60229	OTTHUMG00000125545	ENST00000240874.3:c.3547-1C>A	3.37:g.124174024C>A			A8MSI4|C9JQ37|Q6ZN45|Q8TBQ5|Q9NSZ4|Q9Y2A5	Missense_Mutation	SNP	pfam_DH-domain,pfam_Prot_kinase_dom,pfam_Spectrin_repeat,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Ig_V-set,pfam_Immunoglobulin,superfamily_Kinase-like_dom,superfamily_DH-domain,superfamily_Fibronectin_type3,superfamily_SH3_domain,superfamily_CRAL-TRIO_dom,smart_CRAL-TRIO_dom,smart_Spectrin/alpha-actinin,smart_DH-domain,smart_Pleckstrin_homology,smart_SH3_domain,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_CRAL-TRIO_dom,pfscan_Fibronectin_type3,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom,pfscan_DH-domain	p.Q1183K	ENST00000240874.3	37	c.3547	CCDS3027.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	20.4|20.4	3.979596|3.979596	0.74360|0.74360	.|.	.|.	ENSG00000160145|ENSG00000160145	ENST00000460856;ENST00000240874;ENST00000360013|ENST00000354186	T;T;T|.	0.40476|.	1.03;1.03;1.03|.	4.71|4.71	4.71|4.71	0.59529|0.59529	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.71400|0.71400	0.3335|0.3335	L|L	0.56769|0.56769	1.78|1.78	0.80722|0.80722	D|D	1|1	P;P;D;P|.	0.53885|.	0.884;0.542;0.963;0.859|.	P;B;D;P|.	0.68621|.	0.626;0.216;0.959;0.492|.	T|T	0.69950|0.69950	-0.5006|-0.5006	10|5	0.36615|.	T|.	0.2|.	.|.	17.8492|17.8492	0.88740|0.88740	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	1174;529;1183;1183|.	C9IZQ6;F2Z3Q6;O60229;O60229-2|.	.;.;KALRN_HUMAN;.|.	K|R	1174;1183;1183|1151	ENSP00000418611:Q1174K;ENSP00000240874:Q1183K;ENSP00000353109:Q1183K|.	ENSP00000240874:Q1183K|.	Q|S	+|+	1|3	0|2	KALRN|KALRN	125656714|125656714	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.977000|0.977000	0.68977|0.68977	7.644000|7.644000	0.83416|0.83416	2.450000|2.450000	0.82876|0.82876	0.446000|0.446000	0.29264|0.29264	CAA|AGC	KALRN	-	pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin	ENSG00000160145		0.473	KALRN-005	KNOWN	basic|CCDS	protein_coding	KALRN	HGNC	protein_coding	OTTHUMT00000258843.4	-	0.00	34	0	C	NM_003947	Missense_Mutation	124174024	+1	tier1	-	no_errors	ENST00000360013	ensembl	human	known	74_37	missense	37.93	36	22	SNP	1.000	A
KIT	3815	genome.wustl.edu	37	4	55593704	55593704	+	Missense_Mutation	SNP	T	T	G			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr4:55593704T>G	ENST00000288135.5	+	11	1867	c.1770T>G	c.(1768-1770)agT>agG	p.S590R		NM_000222.2|NM_001093772.1	NP_000213.1|NP_001087241.1	P10721	KIT_HUMAN	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	590	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				actin cytoskeleton reorganization (GO:0031532)|activation of MAPK activity (GO:0000187)|cell chemotaxis (GO:0060326)|cellular response to thyroid hormone stimulus (GO:0097067)|cytokine-mediated signaling pathway (GO:0019221)|dendritic cell cytokine production (GO:0002371)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|digestive tract development (GO:0048565)|ectopic germ cell programmed cell death (GO:0035234)|embryonic hemopoiesis (GO:0035162)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell proliferation (GO:0050673)|erythrocyte differentiation (GO:0030218)|erythropoietin-mediated signaling pathway (GO:0038162)|Fc receptor signaling pathway (GO:0038093)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|germ cell migration (GO:0008354)|glycosphingolipid metabolic process (GO:0006687)|hemopoiesis (GO:0030097)|immature B cell differentiation (GO:0002327)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|Kit signaling pathway (GO:0038109)|lamellipodium assembly (GO:0030032)|lymphoid progenitor cell differentiation (GO:0002320)|male gonad development (GO:0008584)|mast cell chemotaxis (GO:0002551)|mast cell cytokine production (GO:0032762)|mast cell degranulation (GO:0043303)|mast cell differentiation (GO:0060374)|mast cell proliferation (GO:0070662)|megakaryocyte development (GO:0035855)|melanocyte adhesion (GO:0097326)|melanocyte differentiation (GO:0030318)|melanocyte migration (GO:0097324)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of programmed cell death (GO:0043069)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ovarian follicle development (GO:0001541)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|pigmentation (GO:0043473)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of pseudopodium assembly (GO:0031274)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|regulation of cell proliferation (GO:0042127)|regulation of cell shape (GO:0008360)|regulation of developmental pigmentation (GO:0048070)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|somatic stem cell division (GO:0048103)|somatic stem cell maintenance (GO:0035019)|spermatid development (GO:0007286)|spermatogenesis (GO:0007283)|stem cell differentiation (GO:0048863)|stem cell maintenance (GO:0019827)|T cell differentiation (GO:0030217)|visual learning (GO:0008542)	acrosomal vesicle (GO:0001669)|cell-cell junction (GO:0005911)|cytoplasmic side of plasma membrane (GO:0009898)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|mast cell granule (GO:0042629)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cytokine binding (GO:0019955)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|stem cell factor receptor activity (GO:0005020)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			NS(8)|autonomic_ganglia(1)|bone(21)|breast(2)|central_nervous_system(4)|endometrium(10)|eye(12)|genital_tract(18)|haematopoietic_and_lymphoid_tissue(1820)|kidney(17)|large_intestine(17)|lung(27)|ovary(23)|pancreas(4)|prostate(1)|salivary_gland(15)|skin(228)|soft_tissue(4117)|stomach(3)|testis(55)|thymus(7)|upper_aerodigestive_tract(1)	6411	all_cancers(7;0.00453)|all_lung(4;0.000565)|Lung NSC(11;0.00129)|all_epithelial(27;0.0104)|Glioma(25;0.08)|all_neural(26;0.101)		LUSC - Lung squamous cell carcinoma(32;0.000276)|Epithelial(7;0.209)	Colorectal(1;0.0276)|COAD - Colon adenocarcinoma(1;0.171)	Dasatinib(DB01254)|Imatinib(DB00619)|Nilotinib(DB04868)|Pazopanib(DB06589)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	ACAGGCTGAGTTTTGGTCAGT	0.413		1	"""Mis, O"""		"""GIST, AML, TGCT, mastocytosis, mucosal melanoma"""	"""GIST, epithelioma"""	Piebald trait		Piebaldism;Mast Cell disease, Familial Clustering of;Gastrointestinal Stromal Tumors, Sporadic Multiple Primary;Familial Gastrointestinal Stromal Tumors																														yes	Dom	yes	Familial gastrointestinal stromal tumour	4	4q12	3815	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	yes	"""L, M, O, E"""	0													65.0	63.0	64.0					4																	55593704		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Piebald trait;incl.: Familial Cutaneous Mastocytosis (Urticaria Pigmentosum);Sporadic Multiple GIST;Familial GIST, incl. Multiple Familial Gastrointestinal Autonomic Nerve Tumors (GANT)	S67773	CCDS3496.1, CCDS47058.1	4q12	2014-09-17			ENSG00000157404	ENSG00000157404		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6342	protein-coding gene	gene with protein product		164920	"""piebald trait"""	PBT		9027509	Standard	NM_001093772		Approved	CD117, SCFR, C-Kit	uc010igr.3	P10721	OTTHUMG00000128713	ENST00000288135.5:c.1770T>G	4.37:g.55593704T>G	ENSP00000288135:p.Ser590Arg		B5A956|D5LXN2|D5M931|F5H8F8|Q6IQ28|Q99662|Q9UM99	Missense_Mutation	SNP	pirsf_Tyr_kinase_CSF1/PDGF_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_Ig_I-set,pfam_Immunoglobulin,superfamily_Kinase-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.S590R	ENST00000288135.5	37	c.1770	CCDS3496.1	4	.	.	.	.	.	.	.	.	.	.	T	8.678	0.904442	0.17760	.	.	ENSG00000157404	ENST00000288135;ENST00000412167	D;D	0.82711	-1.64;-1.64	6.06	3.65	0.41850	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.74215	0.3687	N	0.10685	0.025	0.80722	D	1	B;B;D	0.58268	0.002;0.061;0.982	B;B;P	0.60541	0.006;0.019;0.876	T	0.68443	-0.5407	10	0.07175	T	0.84	.	8.5686	0.33556	0.0:0.2059:0.0:0.7941	.	97;586;590	D5MAV8;P10721-2;P10721	.;.;KIT_HUMAN	R	590;586	ENSP00000288135:S590R;ENSP00000390987:S586R	ENSP00000288135:S590R	S	+	3	2	KIT	55288461	0.998000	0.40836	1.000000	0.80357	0.905000	0.53344	0.343000	0.19944	0.541000	0.28827	0.533000	0.62120	AGT	KIT	-	pirsf_Tyr_kinase_CSF1/PDGF_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000157404		0.413	KIT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIT	HGNC	protein_coding	OTTHUMT00000250618.1	-	0.00	30	0	T			55593704	+1	tier1	-	no_errors	ENST00000288135	ensembl	human	known	74_37	missense	36.96	29	17	SNP	1.000	G
KLHL6	89857	genome.wustl.edu	37	3	183273193	183273193	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr3:183273193G>T	ENST00000341319.3	-	1	284	c.249C>A	c.(247-249)ttC>ttA	p.F83L		NM_130446.2	NP_569713.2	Q8WZ60	KLHL6_HUMAN	kelch-like family member 6	83	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.				B cell receptor signaling pathway (GO:0050853)|germinal center formation (GO:0002467)					breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(7)|kidney(1)|large_intestine(6)|liver(1)|lung(16)|ovary(2)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	44	all_cancers(143;9.2e-12)|Ovarian(172;0.0172)		all cancers(12;1.29e-44)|Epithelial(37;1.24e-38)|LUSC - Lung squamous cell carcinoma(7;2.58e-24)|Lung(8;1.79e-22)|OV - Ovarian serous cystadenocarcinoma(80;2.32e-22)			GGTGGCAGGAGAATTCCTGAA	0.522																																																	0													112.0	102.0	105.0					3																	183273193		2203	4300	6503	SO:0001583	missense	0			AF441792	CCDS3245.2	3q27.3	2013-01-30	2013-01-30		ENSG00000172578	ENSG00000172578		"""Kelch-like"", ""BTB/POZ domain containing"""	18653	protein-coding gene	gene with protein product	"""kelch-like protein KLHL6"""	614214	"""kelch-like 6 (Drosophila)"""			11214971, 12617994	Standard	NM_130446		Approved	FLJ00029	uc003flr.3	Q8WZ60	OTTHUMG00000148673	ENST00000341319.3:c.249C>A	3.37:g.183273193G>T	ENSP00000341342:p.Phe83Leu		B2RB31|D3DNS8|Q8N5I1|Q8N892	Missense_Mutation	SNP	pfam_Kelch_1,pfam_BACK,pfam_BTB_POZ,pfam_Kelch_2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.F83L	ENST00000341319.3	37	c.249	CCDS3245.2	3	.	.	.	.	.	.	.	.	.	.	G	27.3	4.815562	0.90790	.	.	ENSG00000172578	ENST00000341319	T	0.69175	-0.38	5.56	5.56	0.83823	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	0.000000	0.85682	D	0.000000	T	0.80019	0.4547	M	0.73372	2.23	0.58432	D	0.999998	D	0.89917	1.0	D	0.83275	0.996	T	0.79940	-0.1591	10	0.48119	T	0.1	.	13.7732	0.63038	0.0733:0.0:0.9267:0.0	.	83	Q8WZ60	KLHL6_HUMAN	L	83	ENSP00000341342:F83L	ENSP00000341342:F83L	F	-	3	2	KLHL6	184755887	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.321000	0.51999	2.608000	0.88229	0.655000	0.94253	TTC	KLHL6	-	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	ENSG00000172578		0.522	KLHL6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHL6	HGNC	protein_coding	OTTHUMT00000309024.1	-	0.00	24	0	G	NM_130446		183273193	-1	tier1	-	no_errors	ENST00000341319	ensembl	human	known	74_37	missense	27.59	21	8	SNP	1.000	T
KLRF2	100431172	genome.wustl.edu	37	12	10048387	10048387	+	Silent	SNP	C	C	T			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr12:10048387C>T	ENST00000535540.1	+	6	686	c.579C>T	c.(577-579)tgC>tgT	p.C193C		NM_001190765.1	NP_001177694.1	D3W0D1	KLRF2_HUMAN	killer cell lectin-like receptor subfamily F, member 2	193	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				cytokine secretion (GO:0050663)|natural killer cell degranulation (GO:0043320)	integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)|protein homodimerization activity (GO:0042803)										AGGGCATTTGCCAGAGAGATG	0.423																																																	0																																										SO:0001819	synonymous_variant	0				CCDS53743.1	12p13.31	2010-06-30				ENSG00000256797		"""Killer cell lectin-like receptors"", ""C-type lectin domain containing"""	37646	protein-coding gene	gene with protein product						20194751	Standard	NM_001190765		Approved	NKp65	uc021quy.1	D3W0D1		ENST00000535540.1:c.579C>T	12.37:g.10048387C>T				Silent	SNP	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin,prints_AntifreezeII	p.C193	ENST00000535540.1	37	c.579	CCDS53743.1	12																																																																																			KLRF2	-	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin	ENSG00000256797		0.423	KLRF2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	KLRF2	HGNC	protein_coding		-	0.00	33	0	C	NM_001190765		10048387	+1	tier1	-	no_errors	ENST00000535540	ensembl	human	known	74_37	silent	7.84	47	4	SNP	0.994	T
KRT73	319101	genome.wustl.edu	37	12	53009995	53009995	+	Missense_Mutation	SNP	G	G	C	rs200530085	byFrequency	TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr12:53009995G>C	ENST00000305748.3	-	2	651	c.617C>G	c.(616-618)tCg>tGg	p.S206W	RP11-641A6.2_ENST00000551089.1_RNA|RP11-641A6.2_ENST00000549180.1_RNA|RP11-641A6.2_ENST00000552364.1_RNA	NM_175068.2	NP_778238.1	Q86Y46	K2C73_HUMAN	keratin 73	206	Coil 1B.|Rod.					extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)|nucleus (GO:0005634)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(22)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	44				BRCA - Breast invasive adenocarcinoma(357;0.189)		CCTCAGCTCCGAGTCCAGCCT	0.607																																																	0													165.0	148.0	154.0					12																	53009995		2203	4300	6503	SO:0001583	missense	0			AJ508776	CCDS8834.1	12q13.13	2013-06-25			ENSG00000186049	ENSG00000186049		"""-"", ""Intermediate filaments type II, keratins (basic)"""	28928	protein-coding gene	gene with protein product		608247				12648212, 16831889	Standard	NM_175068		Approved	KRT6IRS3, K6IRS3	uc001sas.3	Q86Y46	OTTHUMG00000169746	ENST00000305748.3:c.617C>G	12.37:g.53009995G>C	ENSP00000307014:p.Ser206Trp		Q32MB2	Missense_Mutation	SNP	pfam_IF,superfamily_Prefoldin,prints_Keratin_II	p.S206W	ENST00000305748.3	37	c.617	CCDS8834.1	12	.	.	.	.	.	.	.	.	.	.	G	14.07	2.424691	0.43020	.	.	ENSG00000186049	ENST00000305748	D	0.89196	-2.48	5.07	5.07	0.68467	Filament (1);	0.000000	0.46145	D	0.000304	D	0.95943	0.8679	H	0.95504	3.68	0.19575	N	0.999963	D	0.89917	1.0	D	0.97110	1.0	D	0.90355	0.4369	10	0.87932	D	0	.	14.054	0.64756	0.0:0.0:0.7446:0.2554	.	206	Q86Y46	K2C73_HUMAN	W	206	ENSP00000307014:S206W	ENSP00000307014:S206W	S	-	2	0	KRT73	51296262	0.000000	0.05858	0.966000	0.40874	0.463000	0.32649	0.675000	0.25232	2.739000	0.93911	0.655000	0.94253	TCG	KRT73	-	pfam_IF	ENSG00000186049		0.607	KRT73-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT73	HGNC	protein_coding	OTTHUMT00000405700.1	-	0.00	58	0	G	NM_175068		53009995	-1	tier1	-	no_errors	ENST00000305748	ensembl	human	known	74_37	missense	16.04	89	17	SNP	0.041	C
KRT2	3849	genome.wustl.edu	37	12	53045389	53045389	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr12:53045389C>T	ENST00000309680.3	-	1	559	c.538G>A	c.(538-540)Gag>Aag	p.E180K		NM_000423.2	NP_000414.2	P35908	K22E_HUMAN	keratin 2	180	Coil 1A.|Rod.				epidermis development (GO:0008544)|keratinization (GO:0031424)|keratinocyte activation (GO:0032980)|keratinocyte migration (GO:0051546)|keratinocyte proliferation (GO:0043616)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|keratin filament (GO:0045095)|membrane (GO:0016020)|nucleus (GO:0005634)	structural constituent of cytoskeleton (GO:0005200)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(18)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	32				BRCA - Breast invasive adenocarcinoma(357;0.19)		TTGATCTGCTCACGCTCTTGG	0.522																																																	0													152.0	143.0	146.0					12																	53045389		2203	4300	6503	SO:0001583	missense	0				CCDS8835.1	12q13.13	2013-01-16	2008-08-01	2006-07-17	ENSG00000172867	ENSG00000172867		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6439	protein-coding gene	gene with protein product	"""epidermal ichthyosis bullosa of Siemens"""	600194	"""keratin 2A (epidermal ichthyosis bullosa of Siemens)"""	KRT2A		7524919, 16831889	Standard	NM_000423		Approved	KRTE	uc001sat.3	P35908	OTTHUMG00000169748	ENST00000309680.3:c.538G>A	12.37:g.53045389C>T	ENSP00000310861:p.Glu180Lys		Q4VAQ2	Missense_Mutation	SNP	pfam_IF,superfamily_Prefoldin,prints_Keratin_II	p.E180K	ENST00000309680.3	37	c.538	CCDS8835.1	12	.	.	.	.	.	.	.	.	.	.	C	24.1	4.489445	0.84962	.	.	ENSG00000172867	ENST00000309680	T	0.77750	-1.12	5.54	4.65	0.58169	Filament (1);	.	.	.	.	D	0.89812	0.6823	M	0.90145	3.09	0.44745	D	0.997748	D	0.89917	1.0	D	0.85130	0.997	D	0.92023	0.5627	9	0.87932	D	0	.	14.9169	0.70805	0.0:0.9309:0.0:0.0691	.	180	P35908	K22E_HUMAN	K	180	ENSP00000310861:E180K	ENSP00000310861:E180K	E	-	1	0	KRT2	51331656	1.000000	0.71417	1.000000	0.80357	0.621000	0.37620	4.886000	0.63149	1.498000	0.48600	0.655000	0.94253	GAG	KRT2	-	pfam_IF,prints_Keratin_II	ENSG00000172867		0.522	KRT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT2	HGNC	protein_coding	OTTHUMT00000405704.1	-	0.00	41	0	C	NM_000423		53045389	-1	tier1	-	no_errors	ENST00000309680	ensembl	human	known	74_37	missense	18.60	70	16	SNP	1.000	T
KRTAP2-2	728279	genome.wustl.edu	37	17	39211182	39211182	+	Nonsense_Mutation	SNP	C	C	T	rs201126380		TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr17:39211182C>T	ENST00000398477.1	-	1	300	c.282G>A	c.(280-282)tgG>tgA	p.W94*	KRTAP2-2_ENST00000542910.1_Nonsense_Mutation_p.W94*	NM_033032.2	NP_149021.2	Q9BYT5	KRA22_HUMAN	keratin associated protein 2-2	94	11 X 5 AA repeats of C-C-[CDPQRWG]- [APRS]-[CIPSTVD].					keratin filament (GO:0045095)											AGGTGGTGGCCCAGCAGCAGG	0.701																																																	0													1.0	2.0	2.0					17																	39211182		77	431	508	SO:0001587	stop_gained	0			AJ302536	CCDS32648.1, CCDS54122.1	17q21.2	2013-06-25			ENSG00000214518	ENSG00000214518		"""Keratin associated proteins"""	18905	protein-coding gene	gene with protein product							Standard	NM_033032		Approved	KAP2.2	uc010cxj.3	Q9BYT5	OTTHUMG00000133593	ENST00000398477.1:c.282G>A	17.37:g.39211182C>T	ENSP00000381494:p.Trp94*		A8MTN3|A8MXM4	Nonsense_Mutation	SNP	pfam_Keratin-assoc	p.W94*	ENST00000398477.1	37	c.282	CCDS54122.1	17	.	.	.	.	.	.	.	.	.	.	.	20.6	4.019518	0.75275	.	.	ENSG00000214518	ENST00000398477;ENST00000542910	.	.	.	5.45	5.45	0.79879	.	0.186828	0.26248	N	0.025475	.	.	.	.	.	.	0.58432	D	0.999996	.	.	.	.	.	.	.	.	.	.	0.40728	T	0.16	.	14.721	0.69305	0.0:1.0:0.0:0.0	.	.	.	.	X	94	.	ENSP00000381494:W94X	W	-	3	0	KRTAP2-2	36464708	0.824000	0.29247	1.000000	0.80357	0.992000	0.81027	0.741000	0.26202	2.855000	0.98099	0.586000	0.80456	TGG	KRTAP2-2	-	NULL	ENSG00000214518		0.701	KRTAP2-2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	KRTAP2-2	HGNC	protein_coding	OTTHUMT00000257697.1	-	0.00	33	0	C			39211182	-1	tier1	rs201126380	no_errors	ENST00000542910	ensembl	human	known	74_37	nonsense	42.86	16	12	SNP	1.000	T
LPAL2	80350	genome.wustl.edu	37	6	160888611	160888611	+	RNA	SNP	C	C	G			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr6:160888611C>G	ENST00000335388.5	-	0	1645					NR_028092.1		Q16609	LPAL2_HUMAN	lipoprotein, Lp(a)-like 2, pseudogene							extracellular region (GO:0005576)				large_intestine(1)|lung(4)	5		Breast(66;0.000496)|Ovarian(120;0.0303)|Prostate(117;0.214)		OV - Ovarian serous cystadenocarcinoma(65;2.5e-17)|BRCA - Breast invasive adenocarcinoma(81;6.48e-06)		ACCTGGATAACAGTCGGAGGA	0.512																																																	0																																												0			U19517		6q26-q27	2010-10-27	2010-10-27	2004-02-18	ENSG00000213071	ENSG00000213071			21210	pseudogene	pseudogene		611682	"""apolipoprotein A-like"", ""lipoprotein, Lp(a)-like 2"""	APOAL		7749817, 7679504	Standard	NR_028092		Approved	APOARGC	uc011efy.2	Q16609	OTTHUMG00000015952		6.37:g.160888611C>G			E1P5B4	RNA	SNP	-	NULL	ENST00000335388.5	37	NULL		6																																																																																			LPAL2	-	-	ENSG00000213071		0.512	LPAL2-003	KNOWN	basic	processed_transcript	LPAL2	HGNC	pseudogene	OTTHUMT00000042950.1	-	0.00	27	0	C	NM_024492		160888611	-1	tier1	-	no_errors	ENST00000335388	ensembl	human	known	74_37	rna	15.52	49	9	SNP	0.000	G
LPP	4026	genome.wustl.edu	37	3	188242454	188242454	+	Splice_Site	SNP	G	G	T			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr3:188242454G>T	ENST00000312675.4	+	5	554	c.308G>T	c.(307-309)gGg>gTg	p.G103V	LPP_ENST00000543006.1_Splice_Site_p.G103V|LPP_ENST00000448637.1_Splice_Site_p.G103V	NM_001167672.1|NM_005578.3	NP_001161144.1|NP_005569.1	Q93052	LPP_HUMAN	LIM domain containing preferred translocation partner in lipoma	103	Pro-rich.				cell adhesion (GO:0007155)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	zinc ion binding (GO:0008270)		HMGA2/LPP(161)	NS(1)|breast(1)|large_intestine(3)|lung(2)|ovary(1)|upper_aerodigestive_tract(2)	10	all_cancers(143;1.37e-09)|all_hematologic(3;0.0429)|Ovarian(172;0.088)	all_lung(153;0.00139)|Lung NSC(153;0.00202)		GBM - Glioblastoma multiforme(93;0.00602)		TTCCAACAGGGGAATCCCGGA	0.468			T	"""HMGA2, MLL, C12orf9"""	"""lipoma, leukemia"""																																			Dom	yes		3	3q28	4026	LIM domain containing preferred translocation partner in lipoma		"""L, M"""	0													91.0	92.0	91.0					3																	188242454		2203	4300	6503	SO:0001630	splice_region_variant	0			AL833171	CCDS3291.1	3q27-q28	2004-03-02	2002-01-14		ENSG00000145012	ENSG00000145012			6679	protein-coding gene	gene with protein product		600700	"""LIM domain-containing preferred translocation partner in lipoma"""			8812423	Standard	XM_005247453		Approved		uc003frs.2	Q93052	OTTHUMG00000156387	ENST00000312675.4:c.307-1G>T	3.37:g.188242454G>T			A1L4L6|D3DNV6|Q8NFX5	Missense_Mutation	SNP	pfam_Znf_LIM,smart_Znf_LIM,pfscan_Znf_LIM	p.G103V	ENST00000312675.4	37	c.308	CCDS3291.1	3	.	.	.	.	.	.	.	.	.	.	G	0.015	-1.564792	0.00903	.	.	ENSG00000145012	ENST00000448637;ENST00000416784;ENST00000420410;ENST00000312675;ENST00000543006	T;T;T;T	0.55413	1.92;0.96;0.52;0.52	5.62	1.22	0.21188	.	1.229440	0.05476	N	0.554007	T	0.30665	0.0772	N	0.13235	0.315	0.50039	D	0.999847	B;B;B	0.22080	0.064;0.005;0.001	B;B;B	0.12837	0.008;0.007;0.001	T	0.31613	-0.9937	10	0.16420	T	0.52	.	3.2615	0.06850	0.0885:0.123:0.3424:0.4462	.	103;103;103	B7Z8W0;C9JUT4;Q93052	.;.;LPP_HUMAN	V	103	ENSP00000393602:G103V;ENSP00000410340:G103V;ENSP00000318089:G103V;ENSP00000438891:G103V	ENSP00000318089:G103V	G	+	2	0	LPP	189725148	1.000000	0.71417	0.989000	0.46669	0.103000	0.19146	3.012000	0.49575	0.293000	0.22520	0.655000	0.94253	GGG	LPP	-	NULL	ENSG00000145012		0.468	LPP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LPP	HGNC	protein_coding	OTTHUMT00000344030.1		0.00	42	0	G	NM_005578	Missense_Mutation	188242454	+1			no_errors	ENST00000312675	ensembl	human	known	74_37	missense	7.32	38	3	SNP	0.992	T
LRCH1	23143	genome.wustl.edu	37	13	47243194	47243194	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr13:47243194G>T	ENST00000389798.3	+	3	679	c.482G>T	c.(481-483)tGc>tTc	p.C161F	LRCH1_ENST00000389797.3_Missense_Mutation_p.C161F|LRCH1_ENST00000311191.6_Missense_Mutation_p.C161F	NM_015116.2	NP_055931	Q9Y2L9	LRCH1_HUMAN	leucine-rich repeats and calponin homology (CH) domain containing 1	161								p.C161>?(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(3)|lung(11)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	26		all_lung(13;5.61e-07)|Lung NSC(96;0.000117)|Breast(56;0.000141)|Prostate(109;0.0029)|Lung SC(185;0.0367)|Myeloproliferative disorder(33;0.0505)|Hepatocellular(98;0.0556)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;0.000123)		CTGCCTGCCTGCCTGTGTGGT	0.443																																																	1	Complex(1)	skin(1)											170.0	159.0	163.0					13																	47243194		2203	4300	6503	SO:0001583	missense	0			AB023233	CCDS31972.1, CCDS53865.1, CCDS53866.1	13q14.11	2008-02-05	2004-05-27	2004-05-28	ENSG00000136141	ENSG00000136141			20309	protein-coding gene	gene with protein product		610368	"""calponin homology (CH) domain containing 1"""	CHDC1		10231032	Standard	NM_015116		Approved	KIAA1016	uc001vbk.3	Q9Y2L9	OTTHUMG00000016877	ENST00000389798.3:c.482G>T	13.37:g.47243194G>T	ENSP00000374448:p.Cys161Phe		B7ZLL5|F8W6F0|Q17R43|Q2KHR1|Q5TBU9|Q7Z5F6|Q7Z5F7	Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_CH-domain,pfam_CAMSAP_CH,superfamily_CH-domain,smart_Leu-rich_rpt_typical-subtyp,smart_CH-domain,pfscan_CH-domain	p.C161F	ENST00000389798.3	37	c.482	CCDS31972.1	13	.	.	.	.	.	.	.	.	.	.	G	11.85	1.760583	0.31137	.	.	ENSG00000136141	ENST00000311191;ENST00000389798;ENST00000389797	T;T;T	0.28895	1.59;1.59;1.59	5.98	4.16	0.48862	.	0.097668	0.64402	D	0.000001	T	0.26846	0.0657	N	0.10685	0.025	0.58432	D	0.999999	D;D;D;P	0.63880	0.987;0.987;0.993;0.847	P;D;D;B	0.63703	0.828;0.917;0.917;0.396	T	0.05435	-1.0885	10	0.10636	T	0.68	-2.9469	10.6544	0.45667	0.0713:0.1326:0.7962:0.0	.	161;161;161;161	Q17R43;Q9Y2L9-2;F8W6F0;Q9Y2L9	.;.;.;LRCH1_HUMAN	F	161	ENSP00000308493:C161F;ENSP00000374448:C161F;ENSP00000374447:C161F	ENSP00000308493:C161F	C	+	2	0	LRCH1	46141195	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.709000	0.47160	1.544000	0.49359	0.655000	0.94253	TGC	LRCH1	-	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	ENSG00000136141		0.443	LRCH1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	LRCH1	HGNC	protein_coding	OTTHUMT00000044824.2		0.00	45	0	G	NM_015116		47243194	+1			no_errors	ENST00000389798	ensembl	human	known	74_37	missense	5.56	51	3	SNP	1.000	T
LRRK1	79705	genome.wustl.edu	37	15	101597188	101597188	+	Missense_Mutation	SNP	C	C	G	rs201964335		TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr15:101597188C>G	ENST00000388948.3	+	28	4819	c.4460C>G	c.(4459-4461)cCg>cGg	p.P1487R	LRRK1_ENST00000284395.5_Missense_Mutation_p.P1484R|RP11-505E24.2_ENST00000559857.1_RNA	NM_024652.3	NP_078928.3			leucine-rich repeat kinase 1											breast(2)|central_nervous_system(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|lung(25)|ovary(4)|prostate(1)|skin(1)	72	Melanoma(26;0.00505)|Lung NSC(78;0.00793)|all_lung(78;0.0094)		OV - Ovarian serous cystadenocarcinoma(32;0.000932)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			CTGGGGCAGCCGGAGGAAGTG	0.632																																																	0													67.0	77.0	74.0					15																	101597188		1992	4171	6163	SO:0001583	missense	0			AB058693	CCDS42086.1	15q26.3	2007-01-29			ENSG00000154237	ENSG00000154237			18608	protein-coding gene	gene with protein product		610986				11347906, 14654223	Standard	XM_005254979		Approved	FLJ23119, KIAA1790, Roco1, RIPK6	uc002bwr.3	Q38SD2	OTTHUMG00000165514	ENST00000388948.3:c.4460C>G	15.37:g.101597188C>G	ENSP00000373600:p.Pro1487Arg			Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Leu-rich_rpt,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_Small_GTPase,superfamily_Kinase-like_dom,superfamily_P-loop_NTPase,superfamily_Ankyrin_rpt-contain_dom,superfamily_WD40_repeat_dom,smart_Ankyrin_rpt,smart_Leu-rich_rpt_typical-subtyp,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Ankyrin_rpt-contain_dom,pfscan_Prot_kinase_dom	p.P1487R	ENST00000388948.3	37	c.4460	CCDS42086.1	15	.	.	.	.	.	.	.	.	.	.	c	14.93	2.682727	0.47991	.	.	ENSG00000154237	ENST00000388948;ENST00000284395;ENST00000529762;ENST00000542170	T;T	0.64438	-0.1;-0.1	5.03	3.14	0.36123	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.058771	0.64402	D	0.000001	T	0.62696	0.2449	L	0.43152	1.355	0.46849	D	0.999228	D	0.65815	0.995	P	0.60789	0.879	T	0.60068	-0.7335	10	0.06099	T	0.92	.	11.495	0.50402	0.0:0.8517:0.0:0.1483	.	1487	Q38SD2	LRRK1_HUMAN	R	1487;1484;178;41	ENSP00000373600:P1487R;ENSP00000284395:P1484R	ENSP00000284395:P1484R	P	+	2	0	LRRK1	99414711	0.970000	0.33590	0.773000	0.31616	0.456000	0.32438	2.556000	0.45862	0.532000	0.28657	-0.359000	0.07587	CCG	LRRK1	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000154237		0.632	LRRK1-003	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	LRRK1	HGNC	protein_coding	OTTHUMT00000384567.2	-	0.00	12	0	C	NM_024652		101597188	+1	tier1	-	no_errors	ENST00000388948	ensembl	human	known	74_37	missense	31.25	11	5	SNP	0.975	G
MAF1	84232	genome.wustl.edu	37	8	145160882	145160882	+	Nonsense_Mutation	SNP	C	C	A			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr8:145160882C>A	ENST00000322428.5	+	3	598	c.194C>A	c.(193-195)tCa>tAa	p.S65*	MAF1_ENST00000534585.1_Nonsense_Mutation_p.S65*|SHARPIN_ENST00000398712.2_5'Flank|MAF1_ENST00000532522.1_Nonsense_Mutation_p.S65*|SHARPIN_ENST00000533948.1_5'Flank|KIAA1875_ENST00000323662.8_5'Flank	NM_032272.4	NP_115648.2	Q9H063	MAF1_HUMAN	MAF1 homolog (S. cerevisiae)	65					negative regulation of transcription from RNA polymerase III promoter (GO:0016480)|transcription, DNA-templated (GO:0006351)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|inhibitory synapse (GO:0060077)|intracellular (GO:0005622)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	RNA polymerase III type 1 promoter DNA binding (GO:0001030)|RNA polymerase III type 2 promoter DNA binding (GO:0001031)|RNA polymerase III type 3 promoter DNA binding (GO:0001032)			central_nervous_system(1)|lung(8)|urinary_tract(1)	10	all_cancers(97;2.87e-11)|all_epithelial(106;2.16e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;3.1e-42)|Epithelial(56;1.23e-40)|all cancers(56;4.84e-36)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			CCCCAGACTTCAGGACTGAGC	0.602																																																	0													73.0	77.0	76.0					8																	145160882		2203	4300	6503	SO:0001587	stop_gained	0				CCDS6416.1	8q24.3	2012-10-29			ENSG00000179632	ENSG00000179632			24966	protein-coding gene	gene with protein product		610210				11230166, 11438659	Standard	NM_032272		Approved	DKFZp586G1123	uc003zbc.1	Q9H063	OTTHUMG00000165244	ENST00000322428.5:c.194C>A	8.37:g.145160882C>A	ENSP00000318604:p.Ser65*		D3DWL4	Nonsense_Mutation	SNP	pfam_Maf1,pirsf_Maf1	p.S65*	ENST00000322428.5	37	c.194	CCDS6416.1	8	.	.	.	.	.	.	.	.	.	.	C	31	5.087606	0.94100	.	.	ENSG00000179632	ENST00000322428;ENST00000534585;ENST00000532522;ENST00000527572;ENST00000527058	.	.	.	5.41	4.51	0.55191	.	0.127864	0.53938	D	0.000051	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-10.2301	11.1771	0.48606	0.184:0.816:0.0:0.0	.	.	.	.	X	65	.	ENSP00000318604:S65X	S	+	2	0	MAF1	145232870	0.978000	0.34361	0.047000	0.18901	0.627000	0.37826	3.236000	0.51336	1.225000	0.43566	0.655000	0.94253	TCA	MAF1	-	pfam_Maf1,pirsf_Maf1	ENSG00000179632		0.602	MAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAF1	HGNC	protein_coding	OTTHUMT00000382910.1	-	0.00	20	0	C	NM_032272		145160882	+1	tier1	-	no_errors	ENST00000322428	ensembl	human	known	74_37	nonsense	42.86	8	6	SNP	0.690	A
MAP1LC3A	84557	genome.wustl.edu	37	20	33147159	33147159	+	Silent	SNP	C	C	T			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr20:33147159C>T	ENST00000360668.3	+	3	866	c.105C>T	c.(103-105)atC>atT	p.I35I	MAP1LC3A_ENST00000476428.1_3'UTR|MAP1LC3A_ENST00000374837.3_Silent_p.I39I|MAP1LC3A_ENST00000397709.1_Silent_p.I35I			Q9H492	MLP3A_HUMAN	microtubule-associated protein 1 light chain 3 alpha	35					autophagic vacuole assembly (GO:0000045)|mitochondrion degradation (GO:0000422)	autophagic vacuole (GO:0005776)|autophagic vacuole membrane (GO:0000421)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|late endosome (GO:0005770)|microtubule (GO:0005874)|organelle membrane (GO:0031090)	phosphatidylethanolamine binding (GO:0008429)|phospholipid binding (GO:0005543)			cervix(1)|kidney(1)|large_intestine(1)|upper_aerodigestive_tract(2)	5						AGGTGATCATCGAGCGCTACA	0.647																																																	0													35.0	35.0	35.0					20																	33147159		2195	4290	6485	SO:0001819	synonymous_variant	0				CCDS13237.1, CCDS13238.1	20q11.22	2014-02-12			ENSG00000101460	ENSG00000101460			6838	protein-coding gene	gene with protein product		601242				8833088, 17580304	Standard	NM_032514		Approved	MAP1BLC3, MAP1ALC3, LC3, LC3A, ATG8E	uc002xaq.2	Q9H492	OTTHUMG00000032306	ENST00000360668.3:c.105C>T	20.37:g.33147159C>T			E1P5P4|E1P5P5|Q9BXW5	Silent	SNP	pfam_Atg8_fam,pfam_Atg12	p.I35	ENST00000360668.3	37	c.105	CCDS13238.1	20																																																																																			MAP1LC3A	-	pfam_Atg8_fam	ENSG00000101460		0.647	MAP1LC3A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	MAP1LC3A	HGNC	protein_coding	OTTHUMT00000078801.2	-	0.00	9	0	C	NM_181509		33147159	+1	tier1	-	no_errors	ENST00000360668	ensembl	human	known	74_37	silent	50.00	12	12	SNP	0.870	T
MAPK6	5597	genome.wustl.edu	37	15	52353571	52353571	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr15:52353571C>T	ENST00000261845.5	+	5	1748	c.941C>T	c.(940-942)cCt>cTt	p.P314L	CTD-2184D3.5_ENST00000558607.1_RNA	NM_002748.3	NP_002739.1	Q16659	MK06_HUMAN	mitogen-activated protein kinase 6	314	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell cycle (GO:0007049)|MAPK cascade (GO:0000165)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|MAP kinase activity (GO:0004707)|protein serine/threonine kinase activity (GO:0004674)			breast(3)|endometrium(1)|kidney(3)|large_intestine(3)|lung(7)|ovary(1)|skin(2)	20				all cancers(107;0.0028)		CTCTCCCATCCTTACATGAGC	0.378																																																	0													149.0	131.0	137.0					15																	52353571		2195	4293	6488	SO:0001583	missense	0			L77964	CCDS10147.1	15q21	2011-06-10			ENSG00000069956	ENSG00000069956		"""Mitogen-activated protein kinase cascade / Kinases"""	6879	protein-coding gene	gene with protein product		602904		PRKM6		8875998	Standard	NM_002748		Approved	ERK3, p97MAPK, HsT17250	uc002abp.3	Q16659	OTTHUMG00000131891	ENST00000261845.5:c.941C>T	15.37:g.52353571C>T	ENSP00000261845:p.Pro314Leu		B2R945|B5BU65|Q68DH4|Q8IYN8	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,prints_MAPK_ERK3/4	p.P314L	ENST00000261845.5	37	c.941	CCDS10147.1	15	.	.	.	.	.	.	.	.	.	.	C	29.8	5.040353	0.93630	.	.	ENSG00000069956	ENST00000261845	T	0.54479	0.57	5.13	5.13	0.70059	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.76421	0.3985	M	0.87827	2.91	0.80722	D	1	D	0.63880	0.993	D	0.67103	0.949	T	0.81508	-0.0901	10	0.87932	D	0	-11.2255	18.5662	0.91118	0.0:1.0:0.0:0.0	.	314	Q16659	MK06_HUMAN	L	314	ENSP00000261845:P314L	ENSP00000261845:P314L	P	+	2	0	MAPK6	50140863	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.815000	0.86186	2.399000	0.81585	0.585000	0.79938	CCT	MAPK6	-	pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,pfscan_Prot_kinase_dom	ENSG00000069956		0.378	MAPK6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAPK6	HGNC	protein_coding	OTTHUMT00000254841.2	-	0.00	50	0	C	NM_002748		52353571	+1	tier1	-	no_errors	ENST00000261845	ensembl	human	known	74_37	missense	34.21	25	13	SNP	1.000	T
MARCH10	162333	genome.wustl.edu	37	17	60865859	60865859	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr17:60865859G>T	ENST00000311269.5	-	3	466	c.192C>A	c.(190-192)agC>agA	p.S64R	MARCH10_ENST00000456609.2_Missense_Mutation_p.S64R|MARCH10_ENST00000583600.1_Missense_Mutation_p.S64R|MARCH10_ENST00000544856.2_Missense_Mutation_p.S64R	NM_152598.2	NP_689811.2	Q8NA82	MARHA_HUMAN	membrane-associated ring finger (C3HC4) 10, E3 ubiquitin protein ligase	64					protein ubiquitination (GO:0016567)		ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(11)|liver(1)|lung(15)	38						AAGATGACCTGCTAGAAAACC	0.493																																																	0													102.0	89.0	94.0					17																	60865859		2203	4300	6503	SO:0001583	missense	0			AK093076	CCDS11635.1, CCDS74122.1, CCDS74123.1	17q23.3	2013-01-09	2012-02-23	2007-08-20		ENSG00000173838		"""RING-type (C3HC4) zinc fingers"", ""MARCH membrane-associated ring fingers"""	26655	protein-coding gene	gene with protein product		613337	"""ring finger protein 190"", ""membrane-associated ring finger (C3HC4) 10"""	RNF190		17604280	Standard	XM_005257103		Approved	FLJ35757, MARCH-X	uc002jag.4	Q8NA82		ENST00000311269.5:c.192C>A	17.37:g.60865859G>T	ENSP00000311496:p.Ser64Arg		D3DU09|Q8IYS7|Q8N7Z7	Missense_Mutation	SNP	pfam_Znf_C3HC4_RING-type,smart_Znf_RING-CH	p.S64R	ENST00000311269.5	37	c.192	CCDS11635.1	17	.	.	.	.	.	.	.	.	.	.	G	3.275	-0.148283	0.06627	.	.	ENSG00000173838	ENST00000456609;ENST00000311269;ENST00000544856	T;T;T	0.16897	2.31;2.31;2.31	5.28	-3.53	0.04667	.	0.267434	0.26987	N	0.021483	T	0.28267	0.0698	M	0.71581	2.175	0.09310	N	1	D;D;D	0.56746	0.961;0.977;0.961	P;P;P	0.58873	0.708;0.847;0.708	T	0.16276	-1.0408	10	0.28530	T	0.3	-6.4399	12.0102	0.53282	0.3698:0.0:0.6302:0.0	.	64;64;64	B3KVK0;G3V1Q5;Q8NA82	.;.;MARHA_HUMAN	R	64	ENSP00000416177:S64R;ENSP00000311496:S64R;ENSP00000443746:S64R	ENSP00000311496:S64R	S	-	3	2	MARCH10	58219591	0.049000	0.20398	0.324000	0.25361	0.145000	0.21501	-0.231000	0.09069	-0.461000	0.06993	-1.069000	0.02264	AGC	MARCH10	-	NULL	ENSG00000173838		0.493	MARCH10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MARCH10	HGNC	protein_coding	OTTHUMT00000445252.1	-	0.00	68	0	G	NM_152598		60865859	-1	tier1	-	no_errors	ENST00000311269	ensembl	human	known	74_37	missense	28.30	38	15	SNP	0.046	T
MCC	4163	genome.wustl.edu	37	5	112420928	112420928	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr5:112420928C>T	ENST00000302475.4	-	7	1471	c.908G>A	c.(907-909)cGc>cAc	p.R303H	MCC_ENST00000515367.2_Missense_Mutation_p.R240H|MCC_ENST00000514701.3_5'UTR|MCC_ENST00000408903.3_Missense_Mutation_p.R493H	NM_002387.2	NP_002378	P23508	CRCM_HUMAN	mutated in colorectal cancers	303					negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of epithelial cell proliferation (GO:0050680)|signal transduction (GO:0007165)|Wnt signaling pathway (GO:0016055)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			endometrium(4)|kidney(3)|large_intestine(15)|liver(2)|lung(8)|ovary(2)|pancreas(1)|prostate(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	42		all_cancers(142;5.89e-08)|all_epithelial(76;3.57e-11)|all_lung(232;0.000605)|Lung NSC(810;0.000697)|Colorectal(10;0.00146)|Prostate(80;0.00174)|Ovarian(225;0.0175)|Breast(839;0.198)		OV - Ovarian serous cystadenocarcinoma(64;2.04e-54)|Epithelial(69;9.69e-49)|all cancers(49;6.25e-44)|COAD - Colon adenocarcinoma(37;0.0432)|Colorectal(14;0.0766)		GTTAATCGGGCGGTTGGTGGA	0.577																																																	0													168.0	165.0	166.0					5																	112420928		2202	4300	6502	SO:0001583	missense	0				CCDS4111.1, CCDS43351.1	5q21-q22	2013-01-10			ENSG00000171444	ENSG00000171444		"""EF-hand domain containing"""	6935	protein-coding gene	gene with protein product		159350				1848370	Standard	NM_002387		Approved		uc003kql.4	P23508	OTTHUMG00000128804	ENST00000302475.4:c.908G>A	5.37:g.112420928C>T	ENSP00000305617:p.Arg303His		D3DT05|Q6ZR04	Missense_Mutation	SNP	pfam_USH1C-bd_PDZ_domain,superfamily_tRNA-bd_arm	p.R303H	ENST00000302475.4	37	c.908	CCDS4111.1	5	.	.	.	.	.	.	.	.	.	.	C	34	5.397906	0.96030	.	.	ENSG00000171444	ENST00000302475;ENST00000515367;ENST00000408903	T;T;T	0.37235	2.37;2.37;1.21	5.73	5.73	0.89815	.	0.000000	0.85682	D	0.000000	T	0.46328	0.1387	N	0.14661	0.345	0.80722	D	1	D;D;D;D	0.76494	0.998;0.998;0.999;0.998	D;D;D;D	0.77004	0.964;0.964;0.989;0.964	T	0.50432	-0.8829	10	0.52906	T	0.07	-25.3763	19.8927	0.96935	0.0:1.0:0.0:0.0	.	303;265;493;303	B7Z6G0;B3KTX0;P23508-2;P23508	.;.;.;CRCM_HUMAN	H	303;240;493	ENSP00000305617:R303H;ENSP00000421615:R240H;ENSP00000386227:R493H	ENSP00000305617:R303H	R	-	2	0	MCC	112448827	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	6.013000	0.70776	2.711000	0.92665	0.655000	0.94253	CGC	MCC	-	NULL	ENSG00000171444		0.577	MCC-001	KNOWN	basic|CCDS	protein_coding	MCC	HGNC	protein_coding	OTTHUMT00000250736.3	-	0.00	50	0	C	NM_001085377		112420928	-1	tier1	-	no_errors	ENST00000302475	ensembl	human	known	74_37	missense	11.43	62	8	SNP	1.000	T
MCTP2	55784	genome.wustl.edu	37	15	94899379	94899379	+	Missense_Mutation	SNP	G	G	T	rs142627007	byFrequency	TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr15:94899379G>T	ENST00000357742.4	+	8	1019	c.1019G>T	c.(1018-1020)cGc>cTc	p.R340L	MCTP2_ENST00000451018.3_Missense_Mutation_p.R340L|MCTP2_ENST00000543482.1_Missense_Mutation_p.R340L|MCTP2_ENST00000331706.4_5'UTR|MCTP2_ENST00000557742.1_5'UTR	NM_018349.3	NP_060819.3	Q6DN12	MCTP2_HUMAN	multiple C2 domains, transmembrane 2	340					calcium-mediated signaling (GO:0019722)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(4)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(12)|liver(1)|lung(12)|ovary(1)|pancreas(1)|skin(9)|stomach(2)	49	Lung NSC(78;0.0821)|all_lung(78;0.148)		BRCA - Breast invasive adenocarcinoma(143;0.0323)|OV - Ovarian serous cystadenocarcinoma(32;0.0593)			TCTTTGATACGCAACCTACGG	0.388																																																	0													133.0	134.0	134.0					15																	94899379		2197	4298	6495	SO:0001583	missense	0			AK002037	CCDS32338.1, CCDS53975.1, CCDS53976.1	15q26.2	2006-02-08				ENSG00000140563			25636	protein-coding gene	gene with protein product						15528213	Standard	NM_018349		Approved	FLJ11175, FLJ33303	uc002btj.3	Q6DN12		ENST00000357742.4:c.1019G>T	15.37:g.94899379G>T	ENSP00000350377:p.Arg340Leu		A2RRC2|C6G483|C6G484|Q49AB0|Q8TAX2|Q9NUS2|Q9NUW7	Missense_Mutation	SNP	pfam_C2_dom,pfam_PRibTrfase_C,superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom	p.R340L	ENST00000357742.4	37	c.1019	CCDS32338.1	15	.	.	.	.	.	.	.	.	.	.	G	24.9	4.584462	0.86748	.	.	ENSG00000140563	ENST00000543482;ENST00000451018;ENST00000357742	T;T;T	0.73152	-0.72;-0.29;-0.13	5.77	5.77	0.91146	.	0.505681	0.23258	N	0.050167	T	0.73164	0.3552	N	0.22421	0.69	0.80722	D	1	D;P;D;D	0.63046	0.992;0.87;0.974;0.986	P;B;P;P	0.58577	0.841;0.283;0.554;0.501	T	0.71968	-0.4432	10	0.37606	T	0.19	.	19.6048	0.95576	0.0:0.0:1.0:0.0	.	340;340;340;340	F5H415;Q6DN12-2;Q6DN12;B7Z6H2	.;.;MCTP2_HUMAN;.	L	340	ENSP00000438521:R340L;ENSP00000395109:R340L;ENSP00000350377:R340L	ENSP00000350377:R340L	R	+	2	0	MCTP2	92700383	1.000000	0.71417	0.997000	0.53966	0.850000	0.48378	5.791000	0.69045	2.720000	0.93068	0.557000	0.71058	CGC	MCTP2	-	NULL	ENSG00000140563		0.388	MCTP2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	MCTP2	HGNC	protein_coding	OTTHUMT00000415060.3		0.00	38	0	G	NM_018349		94899379	+1			no_errors	ENST00000357742	ensembl	human	known	74_37	missense	5.00	76	4	SNP	1.000	T
MICALL1	85377	genome.wustl.edu	37	22	38333778	38333778	+	Nonsense_Mutation	SNP	G	G	T			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr22:38333778G>T	ENST00000215957.6	+	15	2575	c.2449G>T	c.(2449-2451)Gaa>Taa	p.E817*	MICALL1_ENST00000402631.1_3'UTR	NM_033386.3	NP_203744.1	Q8N3F8	MILK1_HUMAN	MICAL-like 1	817	Necessary and sufficient to associate with tubular recycling endosome membranes, mediate phosphatidic acid- binding and membrane tubulation.|RAB-binding domain (RBD); mediates the interaction with RAB13 and RAB35 and intramolecular interaction with the CH domain.		E -> K (in a breast cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.		endocytosis (GO:0006897)|membrane tubulation (GO:0097320)|neuron projection development (GO:0031175)|protein localization to endosome (GO:0036010)|protein targeting to membrane (GO:0006612)|receptor-mediated endocytosis (GO:0006898)|retrograde transport, endosome to plasma membrane (GO:1990126)|slow endocytic recycling (GO:0032458)	extrinsic component of membrane (GO:0019898)|late endosome (GO:0005770)|recycling endosome membrane (GO:0055038)	identical protein binding (GO:0042802)|phosphatidic acid binding (GO:0070300)|Rab GTPase binding (GO:0017137)|zinc ion binding (GO:0008270)	p.E817K(1)		breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(8)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	24	Melanoma(58;0.045)					CAAGATGTTGGAAGCCATGAT	0.542																																																	1	Substitution - Missense(1)	breast(1)											225.0	192.0	203.0					22																	38333778		2203	4300	6503	SO:0001587	stop_gained	0			BK000466	CCDS13961.1	22q13.1	2006-11-24			ENSG00000100139	ENSG00000100139			29804	protein-coding gene	gene with protein product	"""molecule interacting with Rab13"""					11258795, 12110185	Standard	NM_033386		Approved	MIRAB13, KIAA1668, MICAL-L1	uc003aui.3	Q8N3F8	OTTHUMG00000150670	ENST00000215957.6:c.2449G>T	22.37:g.38333778G>T	ENSP00000215957:p.Glu817*		Q5TI16|Q7RTP5|Q8N3N8|Q9BVL9|Q9BY92|Q9UH43|Q9UH44|Q9UH45	Nonsense_Mutation	SNP	pfam_DUF3585,pfam_CH-domain,pfam_CAMSAP_CH,pfam_Znf_LIM,superfamily_CH-domain,smart_CH-domain,smart_Znf_LIM,pfscan_CH-domain,pfscan_Znf_LIM	p.E817*	ENST00000215957.6	37	c.2449	CCDS13961.1	22	.	.	.	.	.	.	.	.	.	.	G	44	10.997397	0.99500	.	.	ENSG00000100139	ENST00000215957;ENST00000402631;ENST00000424008	.	.	.	5.46	5.46	0.80206	.	0.000000	0.64402	D	0.000017	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.56958	D	0.05	.	19.3011	0.94144	0.0:0.0:1.0:0.0	.	.	.	.	X	817;244;131	.	ENSP00000215957:E817X	E	+	1	0	MICALL1	36663724	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	7.423000	0.80229	2.564000	0.86499	0.591000	0.81541	GAA	MICALL1	-	pfam_DUF3585	ENSG00000100139		0.542	MICALL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MICALL1	HGNC	protein_coding	OTTHUMT00000319545.4	-	0.00	27	0	G	NM_033386		38333778	+1	tier1	-	no_errors	ENST00000215957	ensembl	human	known	74_37	nonsense	16.67	25	5	SNP	1.000	T
MCM7	4176	genome.wustl.edu	37	7	99691652	99691652	+	Intron	SNP	C	C	T	rs72631827	byFrequency	TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr7:99691652C>T	ENST00000303887.5	-	13	2494				MIR106B_ENST00000385301.1_RNA|MCM7_ENST00000354230.3_Intron|MIR25_ENST00000384816.1_RNA|MIR93_ENST00000385024.1_RNA|MCM7_ENST00000343023.6_Intron	NM_005916.3	NP_005907.3	P33993	MCM7_HUMAN	minichromosome maintenance complex component 7						cell proliferation (GO:0008283)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to epidermal growth factor stimulus (GO:0071364)|DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA strand elongation involved in DNA replication (GO:0006271)|DNA unwinding involved in DNA replication (GO:0006268)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|regulation of phosphorylation (GO:0042325)|response to drug (GO:0042493)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|MCM complex (GO:0042555)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA helicase activity (GO:0003678)|single-stranded DNA binding (GO:0003697)			endometrium(1)|kidney(5)|large_intestine(5)|lung(4)|ovary(1)|stomach(1)	17	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					TGCGGTAGCACGGAGAGGACC	0.612																																																	0													40.0	40.0	40.0					7																	99691652		1568	3579	5147	SO:0001627	intron_variant	0				CCDS5683.1, CCDS5684.1	7q21.3-q22.1	2014-06-12	2007-04-04		ENSG00000166508	ENSG00000166508			6950	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 104"""	600592	"""minichromosome maintenance deficient (S. cerevisiae) 7"", ""MCM7 minichromosome maintenance deficient 7 (S. cerevisiae)"""	MCM2		7842741	Standard	NM_005916		Approved	CDC47, PPP1R104	uc003usw.1	P33993	OTTHUMG00000154671	ENST00000303887.5:c.1848+143G>A	7.37:g.99691652C>T			A4D2A1|A4D2A2|E9PGN9|Q15076|Q96D34|Q96GL1	RNA	SNP	-	NULL	ENST00000303887.5	37	NULL	CCDS5683.1	7																																																																																			MIR106B	-	-	ENSG00000208036		0.612	MCM7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MIR106B	HGNC	protein_coding	OTTHUMT00000336534.3	-	0.00	27	0	C			99691652	-1	tier1	-	no_errors	ENST00000385301	ensembl	human	known	74_37	rna	37.50	30	18	SNP	1.000	T
MOB4	25843	genome.wustl.edu	37	2	198400257	198400257	+	Missense_Mutation	SNP	A	A	G			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr2:198400257A>G	ENST00000323303.4	+	3	382	c.127A>G	c.(127-129)Att>Gtt	p.I43V	MOB4_ENST00000448447.2_Missense_Mutation_p.I22V|MOB4_ENST00000233892.4_Missense_Mutation_p.I11V|MOB4_ENST00000409360.1_Missense_Mutation_p.I11V|HSPE1-MOB4_ENST00000604458.1_Missense_Mutation_p.I79V|MOB4_ENST00000409916.1_5'UTR|MOB4_ENST00000497443.1_Intron	NM_001202485.1|NM_015387.4	NP_001189414.1|NP_056202.2	Q9Y3A3	PHOCN_HUMAN	MOB family member 4, phocein	43					transport (GO:0006810)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	metal ion binding (GO:0046872)										TTTTTAGTATATTCAACAGAA	0.308																																																	0													84.0	90.0	88.0					2																	198400257		2203	4300	6503	SO:0001583	missense	0			AF151853	CCDS2321.1, CCDS2322.1, CCDS46480.1	2q33.1	2011-09-28	2011-09-28	2011-09-28	ENSG00000115540	ENSG00000115540		"""MOB kinase activators"""	17261	protein-coding gene	gene with protein product	"""phocein"", ""phocein, Mob-like protein"""	609361	"""preimplantation protein 3"", ""MOB1, Mps One Binder kinase activator-like 3 (yeast)"""	PREI3, MOBKL3		17853115, 10810093, 11230166, 11319234	Standard	NM_199482		Approved	MOB3, DKFZP564M112, CGI-95, 2C4D, PHOCN		Q9Y3A3	OTTHUMG00000132748	ENST00000323303.4:c.127A>G	2.37:g.198400257A>G	ENSP00000315702:p.Ile43Val		B4DML0|Q53SE0|Q7Z4Y6|Q9H2P3|Q9H5J1|Q9Y4T8	Missense_Mutation	SNP	pfam_Mob1_phocein,superfamily_Mob1_phocein	p.I43V	ENST00000323303.4	37	c.127	CCDS2321.1	2	.	.	.	.	.	.	.	.	.	.	A	23.0	4.366208	0.82463	.	.	ENSG00000115540	ENST00000233892;ENST00000323303;ENST00000448447;ENST00000409360	.	.	.	4.99	4.99	0.66335	.	0.000000	0.85682	D	0.000000	D	0.85168	0.5635	M	0.92649	3.33	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.997;0.998	D	0.87556	0.2468	9	0.44086	T	0.13	.	14.9787	0.71296	1.0:0.0:0.0:0.0	.	22;43	Q9Y3A3-3;Q9Y3A3	.;PHOCN_HUMAN	V	11;43;22;11	.	ENSP00000233892:I11V	I	+	1	0	PHOCN	198108502	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	9.163000	0.94750	2.009000	0.58944	0.377000	0.23210	ATT	MOB4	-	pfam_Mob1_phocein,superfamily_Mob1_phocein	ENSG00000115540		0.308	MOB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MOB4	HGNC	protein_coding	OTTHUMT00000256110.4	-	0.00	24	0	A	NM_015387		198400257	+1	tier1	-	no_errors	ENST00000323303	ensembl	human	known	74_37	missense	22.64	41	12	SNP	1.000	G
MS4A4E	643680	genome.wustl.edu	37	11	59982060	59982060	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr11:59982060C>T	ENST00000528394.1	-	3	300	c.301G>A	c.(301-303)Gaa>Aaa	p.E101K	MS4A4E_ENST00000526086.1_Missense_Mutation_p.R69K|MS4A4E_ENST00000398984.2_Missense_Mutation_p.E101K|MS4A4E_ENST00000398986.2_Missense_Mutation_p.R69K|MS4A4E_ENST00000427611.2_Missense_Mutation_p.E88K|MS4A4E_ENST00000425663.1_Missense_Mutation_p.E58K			Q96PG1	M4A4E_HUMAN	membrane-spanning 4-domains, subfamily A, member 4E	101						integral component of membrane (GO:0016021)				ovary(1)	1						TTTTGTTGTTCTAATTCCTGC	0.318																																																	0																																										SO:0001583	missense	0			AF354936		11q12.2	2012-04-20			ENSG00000214787	ENSG00000214787			14284	protein-coding gene	gene with protein product		608401				11486273	Standard	XM_005275707		Approved		uc001noy.2	Q96PG1	OTTHUMG00000167354	ENST00000528394.1:c.301G>A	11.37:g.59982060C>T	ENSP00000436446:p.Glu101Lys		Q3C1W1|Q3C1W3|Q3C1W4	Missense_Mutation	SNP	NULL	p.E88K	ENST00000528394.1	37	c.262		11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	13.32|13.32	2.202855|2.202855	0.38905|0.38905	.|.	.|.	ENSG00000214787|ENSG00000214787	ENST00000427611;ENST00000425663;ENST00000398984;ENST00000528394|ENST00000398986;ENST00000526086	T;T;T|T;T	0.56611|0.57595	0.45;0.58;0.58|0.39;0.39	1.82|1.82	0.888|0.888	0.19206|0.19206	.|.	0.536026|.	0.17193|.	U|.	0.183406|.	T|T	0.30792|0.30792	0.0776|0.0776	.|.	.|.	.|.	0.21386|0.21386	N|N	0.999704|0.999704	B;B|B	0.31290|0.12630	0.318;0.284|0.006	B;B|B	0.21546|0.15484	0.035;0.024|0.013	T|T	0.18147|0.18147	-1.0346|-1.0346	8|7	.|.	.|.	.|.	.|.	4.2357|4.2357	0.10625|0.10625	0.0:0.7872:0.0:0.2128|0.0:0.7872:0.0:0.2128	.|.	101;58|69	Q96PG1;Q96PG1-2|Q96PG1-3	M4A4E_HUMAN;.|.	K|K	88;58;101;101|69	ENSP00000389556:E58K;ENSP00000381954:E101K;ENSP00000436446:E101K|ENSP00000381956:R69K;ENSP00000435601:R69K	.|.	E|R	-|-	1|2	0|0	MS4A4E|MS4A4E	59738636|59738636	0.289000|0.289000	0.24334|0.24334	0.633000|0.633000	0.29310|0.29310	0.020000|0.020000	0.10135|0.10135	-0.124000|-0.124000	0.10595|0.10595	0.326000|0.326000	0.23384|0.23384	0.505000|0.505000	0.49811|0.49811	GAA|AGA	MS4A4E	-	NULL	ENSG00000214787		0.318	MS4A4E-003	NOVEL	basic|appris_candidate	protein_coding	MS4A4E	HGNC	protein_coding	OTTHUMT00000394290.1	-	0.00	28	0	C	XM_003119183		59982060	-1	tier1	-	no_errors	ENST00000427611	ensembl	human	known	74_37	missense	23.08	20	6	SNP	0.726	T
MTR	4548	genome.wustl.edu	37	1	236969525	236969525	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr1:236969525G>C	ENST00000366577.5	+	3	725	c.331G>C	c.(331-333)Gaa>Caa	p.E111Q	MTR_ENST00000418145.2_Missense_Mutation_p.E167Q|MTR_ENST00000535889.1_Missense_Mutation_p.E111Q	NM_000254.2	NP_000245.2	Q99707	METH_HUMAN	5-methyltetrahydrofolate-homocysteine methyltransferase	111	Hcy-binding. {ECO:0000255|PROSITE- ProRule:PRU00333}.				cellular nitrogen compound metabolic process (GO:0034641)|cobalamin metabolic process (GO:0009235)|methylation (GO:0032259)|nervous system development (GO:0007399)|pteridine-containing compound metabolic process (GO:0042558)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	cobalamin binding (GO:0031419)|methionine synthase activity (GO:0008705)|S-adenosylmethionine-homocysteine S-methyltransferase activity (GO:0008898)|zinc ion binding (GO:0008270)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(8)|lung(30)|ovary(1)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	67	Ovarian(103;0.0634)|Breast(184;0.221)	all_cancers(173;2.79e-22)|all_epithelial(177;4.84e-14)|Breast(1374;0.00123)|Prostate(94;0.0181)|Lung SC(1967;0.0262)|Acute lymphoblastic leukemia(190;0.117)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)	KIRC - Kidney renal clear cell carcinoma(1967;0.248)	Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)|L-Methionine(DB00134)|Tetrahydrofolic acid(DB00116)	CTATGGCCTTGAACACTTGGT	0.428																																																	0													133.0	123.0	127.0					1																	236969525		2203	4300	6503	SO:0001583	missense	0			U73338	CCDS1614.1, CCDS73054.1	1q43	2011-05-12			ENSG00000116984	ENSG00000116984	2.1.1.13		7468	protein-coding gene	gene with protein product		156570				8968735	Standard	NM_000254		Approved	cblG	uc001hyi.4	Q99707	OTTHUMG00000040060	ENST00000366577.5:c.331G>C	1.37:g.236969525G>C	ENSP00000355536:p.Glu111Gln		A1L4N8|A9Z1W4|B9EGF7|Q99713|Q99723	Missense_Mutation	SNP	pfam_S_MeTrfase,pfam_VitB12-dep_Met_synth_activ_dom,pfam_Pterin-binding,pfam_Cbl-bd_cap,pfam_Cobalamin-bd,superfamily_VitB12-dep_Met_synth_activ_dom,superfamily_S_MeTrfase,superfamily_Dihydropteroate_synth-like,superfamily_Cobalamin-bd,superfamily_Cbl-bd_cap,pirsf_MetH,pfscan_VitB12-dep_Met_synth_activ_dom,pfscan_S_MeTrfase,pfscan_Pterin-binding,tigrfam_MetH	p.E111Q	ENST00000366577.5	37	c.331	CCDS1614.1	1	.	.	.	.	.	.	.	.	.	.	G	28.4	4.919424	0.92249	.	.	ENSG00000116984	ENST00000417743;ENST00000366577;ENST00000418145;ENST00000535889	T;T;T	0.13778	2.56;2.56;2.56	6.03	6.03	0.97812	Homocysteine S-methyltransferase (4);	0.000000	0.85682	D	0.000000	T	0.22475	0.0542	L	0.35593	1.075	0.58432	D	0.999993	P;P;P	0.41848	0.763;0.763;0.763	P;P;P	0.50617	0.646;0.646;0.646	T	0.00277	-1.1854	10	0.30078	T	0.28	-27.849	20.5666	0.99351	0.0:0.0:1.0:0.0	.	111;111;111	B7ZLW8;B7ZLW7;Q99707	.;.;METH_HUMAN	Q	111;111;167;111	ENSP00000355536:E111Q;ENSP00000402255:E167Q;ENSP00000441845:E111Q	ENSP00000355536:E111Q	E	+	1	0	MTR	235036148	1.000000	0.71417	0.999000	0.59377	0.997000	0.91878	7.964000	0.87933	2.854000	0.98071	0.655000	0.94253	GAA	MTR	-	pfam_S_MeTrfase,superfamily_S_MeTrfase,pirsf_MetH,pfscan_S_MeTrfase,tigrfam_MetH	ENSG00000116984		0.428	MTR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTR	HGNC	protein_coding	OTTHUMT00000096632.2		0.00	18	0	G	NM_000254		236969525	+1			no_errors	ENST00000366577	ensembl	human	known	74_37	missense	10.67	67	8	SNP	1.000	C
MUC12	10071	genome.wustl.edu	37	7	100638793	100638793	+	Missense_Mutation	SNP	A	A	G			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr7:100638793A>G	ENST00000379442.3	+	5	5378	c.5378A>G	c.(5377-5379)aAc>aGc	p.N1793S	MUC12_ENST00000536621.1_Missense_Mutation_p.N1650S			Q9UKN1	MUC12_HUMAN	mucin 12, cell surface associated	1793	28 X 19 AA approximate tandem repeats of E-E-S-X-X-X-H-X-X-P-X-X-T-X-T-X-X-X-P.|Ser-rich.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|regulation of cell growth (GO:0001558)	Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)				breast(6)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|prostate(1)|stomach(13)	25						TTACCTGACAACACCACAGCC	0.557																																																	0													59.0	79.0	73.0					7																	100638793		692	1591	2283	SO:0001583	missense	0			AF147790, AF147791	CCDS55139.1	7q22	2007-01-17	2006-03-14		ENSG00000205277	ENSG00000205277		"""Mucins"""	7510	protein-coding gene	gene with protein product		604609	"""mucin 11"""	MUC11		10463611	Standard	NM_001164462		Approved		uc003uxo.3	Q9UKN1	OTTHUMG00000157042	ENST00000379442.3:c.5378A>G	7.37:g.100638793A>G	ENSP00000368755:p.Asn1793Ser		A6ND38|F5GWV9|Q9UKN0	Missense_Mutation	SNP	pfam_SEA_dom	p.N1650S	ENST00000379442.3	37	c.4949		7	.	.	.	.	.	.	.	.	.	.	-	2.049	-0.418239	0.04766	.	.	ENSG00000205277	ENST00000379442;ENST00000536621	T;T	0.11604	2.76;2.76	1.17	-2.09	0.07232	.	.	.	.	.	T	0.03305	0.0096	N	0.08118	0	0.09310	N	1	.	.	.	.	.	.	T	0.43343	-0.9397	7	0.07990	T	0.79	.	1.6505	0.02770	0.2695:0.0:0.4029:0.3276	.	.	.	.	S	1793;1650	ENSP00000368755:N1793S;ENSP00000441929:N1650S	ENSP00000368755:N1793S	N	+	2	0	MUC12	100425513	0.000000	0.05858	0.004000	0.12327	0.030000	0.12068	-1.442000	0.02407	-0.518000	0.06452	0.163000	0.16589	AAC	MUC12	-	NULL	ENSG00000205277		0.557	MUC12-001	NOVEL	basic|appris_candidate_longest	protein_coding	MUC12	HGNC	protein_coding	OTTHUMT00000347234.1	-	0.00	101	0	A	XM_379904		100638793	+1	tier1	-	no_errors	ENST00000536621	ensembl	human	known	74_37	missense	38.69	84	53	SNP	0.004	G
MUM1L1	139221	genome.wustl.edu	37	X	105450626	105450626	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chrX:105450626C>G	ENST00000357175.2	+	4	1850	c.1201C>G	c.(1201-1203)Cag>Gag	p.Q401E	MUM1L1_ENST00000337685.2_Missense_Mutation_p.Q401E|MUM1L1_ENST00000372552.1_Missense_Mutation_p.Q401E	NM_001171020.1	NP_001164491.1	Q5H9M0	MUML1_HUMAN	melanoma associated antigen (mutated) 1-like 1	401	PWWP.					extracellular vesicular exosome (GO:0070062)				autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(11)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	31						GTTTAAATATCAGAAATATCC	0.358																																																	0													39.0	33.0	35.0					X																	105450626		1835	4078	5913	SO:0001583	missense	0			AK090835	CCDS55469.1	Xq22.3	2008-02-05			ENSG00000157502	ENSG00000157502			26583	protein-coding gene	gene with protein product							Standard	NM_152423		Approved	FLJ33516	uc004emf.2	Q5H9M0	OTTHUMG00000022146	ENST00000357175.2:c.1201C>G	X.37:g.105450626C>G	ENSP00000349699:p.Gln401Glu		D3DUX2|Q49AS5|Q8N2C0|Q96MT6	Missense_Mutation	SNP	superfamily_PyrdxlP-dep_Trfase	p.Q401E	ENST00000357175.2	37	c.1201	CCDS55469.1	X	.	.	.	.	.	.	.	.	.	.	C	10.25	1.298711	0.23650	.	.	ENSG00000157502	ENST00000357175;ENST00000337685;ENST00000372552	T;T;T	0.69306	-0.39;-0.39;-0.39	4.31	-1.21	0.09524	.	0.280487	0.25433	N	0.030701	T	0.60856	0.2301	L	0.58810	1.83	0.29550	N	0.851401	B	0.32101	0.356	B	0.35182	0.197	T	0.60647	-0.7222	10	0.72032	D	0.01	-9.0154	12.1757	0.54184	0.75:0.25:0.0:0.0	.	401	Q5H9M0	MUML1_HUMAN	E	401	ENSP00000349699:Q401E;ENSP00000338641:Q401E;ENSP00000361632:Q401E	ENSP00000338641:Q401E	Q	+	1	0	MUM1L1	105337282	0.117000	0.22190	0.927000	0.36925	0.917000	0.54804	-0.186000	0.09670	-0.398000	0.07679	0.529000	0.55759	CAG	MUM1L1	-	NULL	ENSG00000157502		0.358	MUM1L1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	MUM1L1	HGNC	protein_coding	OTTHUMT00000057795.1	-	0.00	24	0	C	NM_152423		105450626	+1	tier1	-	no_errors	ENST00000337685	ensembl	human	known	74_37	missense	51.92	25	27	SNP	0.927	G
NAE1	8883	genome.wustl.edu	37	16	66847533	66847533	+	Nonsense_Mutation	SNP	A	A	C			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr16:66847533A>C	ENST00000290810.3	-	13	1065	c.968T>G	c.(967-969)tTa>tGa	p.L323*	NAE1_ENST00000359087.4_Nonsense_Mutation_p.L326*|NAE1_ENST00000379463.2_Nonsense_Mutation_p.L317*|NAE1_ENST00000394074.2_Nonsense_Mutation_p.L234*			Q13564	ULA1_HUMAN	NEDD8 activating enzyme E1 subunit 1	323					mitotic DNA replication checkpoint (GO:0033314)|neuron apoptotic process (GO:0051402)|protein neddylation (GO:0045116)|regulation of apoptotic process (GO:0042981)|regulation of neuron apoptotic process (GO:0043523)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	catalytic activity (GO:0003824)|protein heterodimerization activity (GO:0046982)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0914)|Epithelial(162;0.214)	Adenosine triphosphate(DB00171)	TCGAACAGGTAAATTTCCTTG	0.338																																																	0													110.0	107.0	108.0					16																	66847533		2200	4300	6500	SO:0001587	stop_gained	0			U50939	CCDS10820.1, CCDS42171.1, CCDS42172.1, CCDS67050.1	16q22	2013-09-26	2007-12-11	2007-12-11	ENSG00000159593	ENSG00000159593		"""Ubiquitin-like modifier activating enzymes"""	621	protein-coding gene	gene with protein product		603385	"""amyloid beta precursor protein binding protein 1, 59kDa"""	APPBP1		8626687, 12740388	Standard	XM_005256215		Approved	ula-1	uc002eqf.3	Q13564	OTTHUMG00000137513	ENST00000290810.3:c.968T>G	16.37:g.66847533A>C	ENSP00000290810:p.Leu323*		A6NCK0|A6NFN4|A8MU28|B2R700|B3KUP9	Nonsense_Mutation	SNP	pfam_ThiF_NAD_FAD-bd,superfamily_Molybdenum_cofac_synth_MoeB	p.L323*	ENST00000290810.3	37	c.968	CCDS10820.1	16	.	.	.	.	.	.	.	.	.	.	A	37	6.428510	0.97559	.	.	ENSG00000159593	ENST00000359087;ENST00000290810;ENST00000379463;ENST00000394074	.	.	.	5.72	5.72	0.89469	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-20.8449	15.9967	0.80256	1.0:0.0:0.0:0.0	.	.	.	.	X	326;323;317;234	.	ENSP00000290810:L323X	L	-	2	0	NAE1	65405034	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.904000	0.92590	2.181000	0.69327	0.477000	0.44152	TTA	NAE1	-	superfamily_Molybdenum_cofac_synth_MoeB	ENSG00000159593		0.338	NAE1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	NAE1	HGNC	protein_coding	OTTHUMT00000268832.1	-	0.00	32	0	A	NM_003905		66847533	-1	tier1	-	no_errors	ENST00000290810	ensembl	human	known	74_37	nonsense	55.56	24	30	SNP	1.000	C
NALCN	259232	genome.wustl.edu	37	13	101910850	101910850	+	Missense_Mutation	SNP	T	T	C			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr13:101910850T>C	ENST00000251127.6	-	11	1291	c.1210A>G	c.(1210-1212)Aac>Gac	p.N404D	NALCN_ENST00000470333.1_5'UTR|NALCN_ENST00000376196.3_Missense_Mutation_p.N404D	NM_052867.2	NP_443099.1	Q8IZF0	NALCN_HUMAN	sodium leak channel, non-selective	404					calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|cell death (GO:0008219)|ion transmembrane transport (GO:0034220)|membrane depolarization during action potential (GO:0086010)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium channel activity (GO:0005272)|voltage-gated calcium channel activity (GO:0005245)			NS(1)|autonomic_ganglia(2)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(33)|liver(2)|lung(81)|ovary(8)|pancreas(3)|prostate(5)|skin(6)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	177	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					TTGTAGTAGTTGCTAGCCGCC	0.547																																																	0													80.0	60.0	66.0					13																	101910850		2203	4300	6503	SO:0001583	missense	0			AY141972	CCDS9498.1	13q32.3	2012-02-21	2007-04-26	2007-04-26	ENSG00000102452	ENSG00000102452		"""Ion channels / Sodium leak channels, non-selective"""	19082	protein-coding gene	gene with protein product		611549	"""voltage gated channel like 1"""	VGCNL1		17448995	Standard	XM_006719943		Approved	bA430M15.1, CanIon	uc001vox.1	Q8IZF0	OTTHUMG00000017295	ENST00000251127.6:c.1210A>G	13.37:g.101910850T>C	ENSP00000251127:p.Asn404Asp		Q6P2S6|Q6ZMI7|Q8IZZ1|Q8TAH1	Missense_Mutation	SNP	pfam_Ion_trans_dom	p.N404D	ENST00000251127.6	37	c.1210	CCDS9498.1	13	.	.	.	.	.	.	.	.	.	.	T	20.7	4.030032	0.75504	.	.	ENSG00000102452	ENST00000251127;ENST00000376196	D;D	0.97352	-4.35;-4.35	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	D	0.93074	0.7795	N	0.08118	0	0.80722	D	1	D;P;D	0.57257	0.979;0.81;0.964	P;B;P	0.46275	0.51;0.306;0.51	D	0.93384	0.6746	10	0.34782	T	0.22	.	15.6114	0.76721	0.0:0.0:0.0:1.0	.	404;404;404	F2Z323;B3KSZ6;Q8IZF0	.;.;NALCN_HUMAN	D	404	ENSP00000251127:N404D;ENSP00000365367:N404D	ENSP00000251127:N404D	N	-	1	0	NALCN	100708851	1.000000	0.71417	1.000000	0.80357	0.708000	0.40852	7.557000	0.82243	2.326000	0.78906	0.533000	0.62120	AAC	NALCN	-	NULL	ENSG00000102452		0.547	NALCN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NALCN	HGNC	protein_coding	OTTHUMT00000045663.2	-	0.00	29	0	T	NM_052867		101910850	-1	tier1	-	no_errors	ENST00000251127	ensembl	human	known	74_37	missense	27.27	24	9	SNP	1.000	C
NARF	26502	genome.wustl.edu	37	17	80439050	80439050	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr17:80439050G>T	ENST00000309794.11	+	7	930	c.732G>T	c.(730-732)ttG>ttT	p.L244F	NARF_ENST00000457415.3_Missense_Mutation_p.L290F|NARF_ENST00000412079.2_Missense_Mutation_p.L116F|NARF-IT1_ENST00000584012.1_RNA|NARF_ENST00000390006.4_Missense_Mutation_p.L185F|NARF_ENST00000345415.7_Missense_Mutation_p.L196F	NM_012336.3|NM_031968.2	NP_036468.1|NP_114174.1	Q9UHQ1	NARF_HUMAN	nuclear prelamin A recognition factor	244						lamin filament (GO:0005638)|nuclear lamina (GO:0005652)|nuclear lumen (GO:0031981)|nucleus (GO:0005634)	lamin binding (GO:0005521)			endometrium(2)|kidney(2)|large_intestine(5)|lung(8)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	24	Breast(20;0.00106)|all_neural(118;0.0804)		OV - Ovarian serous cystadenocarcinoma(97;0.0143)|BRCA - Breast invasive adenocarcinoma(99;0.0369)			CCCCTGCTTTGCATGGCTCCC	0.577																																																	0													82.0	83.0	82.0					17																	80439050		2203	4300	6503	SO:0001583	missense	0			BC000438	CCDS32777.1, CCDS42403.1, CCDS42404.1	17q25.3	2011-12-19			ENSG00000141562	ENSG00000141562			29916	protein-coding gene	gene with protein product	"""iron-only hydrogenase-like protein 2"""	605349				10514485, 15667261	Standard	NM_031968		Approved	FLJ10067, DKFZp434G0420, IOP2	uc002kfg.4	Q9UHQ1		ENST00000309794.11:c.732G>T	17.37:g.80439050G>T	ENSP00000309899:p.Leu244Phe		A6NCJ3|B3KPX2|K4DI98|Q96AY9|Q9BWC6	Missense_Mutation	SNP	pfam_Fe_hydrogenase_lsu_C,pfam_Fe_hydrogenase_ssu-like,superfamily_Fe_hydrogenase,smart_Fe_hydrogenase_ssu-like	p.L244F	ENST00000309794.11	37	c.732	CCDS32777.1	17	.	.	.	.	.	.	.	.	.	.	.	9.686	1.150560	0.21371	.	.	ENSG00000141562	ENST00000390006;ENST00000374611;ENST00000309794;ENST00000345415;ENST00000412079;ENST00000457415	T;T;T	0.46063	0.88;0.88;0.88	5.1	-4.25	0.03766	Iron hydrogenase, large subunit, C-terminal (1);Iron hydrogenase (1);	1.684820	0.03572	N	0.228728	T	0.48132	0.1483	L	0.31926	0.97	0.09310	N	0.999997	B;D;D;P;D;P	0.56746	0.298;0.961;0.977;0.855;0.961;0.94	B;D;P;P;D;P	0.65573	0.149;0.936;0.888;0.757;0.936;0.882	T	0.52185	-0.8609	10	0.56958	D	0.05	.	7.3503	0.26686	0.4364:0.0:0.4577:0.1059	.	116;199;244;196;244;244	B4DZZ6;B4DND8;Q9UHQ1-2;Q9UHQ1-3;E9PH27;Q9UHQ1	.;.;.;.;.;NARF_HUMAN	F	185;244;244;196;116;199	ENSP00000374656:L185F;ENSP00000309899:L244F;ENSP00000283996:L196F	ENSP00000309899:L244F	L	+	3	2	NARF	78032339	0.003000	0.15002	0.000000	0.03702	0.005000	0.04900	0.822000	0.27352	-0.642000	0.05480	-0.339000	0.08088	TTG	NARF	-	pfam_Fe_hydrogenase_lsu_C,superfamily_Fe_hydrogenase	ENSG00000141562		0.577	NARF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NARF	HGNC	protein_coding	OTTHUMT00000443573.2	-	0.00	26	0	G	NM_031968		80439050	+1	tier1	-	no_errors	ENST00000309794	ensembl	human	known	74_37	missense	70.45	13	31	SNP	0.000	T
NBEAL2	23218	genome.wustl.edu	37	3	47039969	47039969	+	Missense_Mutation	SNP	G	G	T	rs373596976		TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr3:47039969G>T	ENST00000450053.3	+	22	3314	c.3135G>T	c.(3133-3135)atG>atT	p.M1045I	NBEAL2_ENST00000292309.5_Missense_Mutation_p.M1045I|NBEAL2_ENST00000383740.2_5'UTR	NM_015175.2	NP_055990.1	Q6ZNJ1	NBEL2_HUMAN	neurobeachin-like 2	1045					blood coagulation (GO:0007596)|megakaryocyte development (GO:0035855)|platelet alpha granule organization (GO:0070889)|platelet formation (GO:0030220)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)				NS(1)|breast(1)|central_nervous_system(3)|cervix(2)|endometrium(8)|kidney(5)|large_intestine(9)|lung(9)|ovary(4)|pancreas(1)|prostate(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	51		Acute lymphoblastic leukemia(5;0.0534)		BRCA - Breast invasive adenocarcinoma(193;0.0012)|KIRC - Kidney renal clear cell carcinoma(197;0.00575)|Kidney(197;0.00656)		TCCAGTACATGTCCAGCATAG	0.592											OREG0015546	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													48.0	50.0	49.0					3																	47039969		2069	4216	6285	SO:0001583	missense	0			AB011112	CCDS46817.1	3p21.31	2014-09-17			ENSG00000160796	ENSG00000160796		"""WD repeat domain containing"""	31928	protein-coding gene	gene with protein product		614169					Standard	NM_015175		Approved	KIAA0540	uc003cqp.3	Q6ZNJ1	OTTHUMG00000156497	ENST00000450053.3:c.3135G>T	3.37:g.47039969G>T	ENSP00000415034:p.Met1045Ile	943	O60288|Q6P994|Q6UX91|Q8NAC9	Missense_Mutation	SNP	pfam_BEACH_dom,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_WD40_repeat_dom,superfamily_ConA-like_lec_gl_sf,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_BEACH_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.M1045I	ENST00000450053.3	37	c.3135	CCDS46817.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.68|13.68	2.309360|2.309360	0.40895|0.40895	.|.	.|.	ENSG00000160796|ENSG00000160796	ENST00000416683|ENST00000292309;ENST00000450053	.|T;T	.|0.51325	.|1.1;0.71	5.31|5.31	4.43|4.43	0.53597|0.53597	.|Armadillo-like helical (1);	.|0.252028	.|0.40302	.|N	.|0.001122	T|T	0.31702|0.31702	0.0805|0.0805	N|N	0.24115|0.24115	0.695|0.695	0.80722|0.80722	D|D	1|1	.|B	.|0.06786	.|0.001	.|B	.|0.04013	.|0.001	T|T	0.10989|0.10989	-1.0606|-1.0606	5|10	.|0.45353	.|T	.|0.12	.|.	8.5399|8.5399	0.33386|0.33386	0.082:0.1542:0.7638:0.0|0.082:0.1542:0.7638:0.0	.|.	.|1045	.|Q6ZNJ1	.|NBEL2_HUMAN	F|I	517|1045	.|ENSP00000292309:M1045I;ENSP00000415034:M1045I	.|ENSP00000292309:M1045I	C|M	+|+	2|3	0|0	NBEAL2|NBEAL2	47014973|47014973	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.933000|0.933000	0.57130|0.57130	1.266000|1.266000	0.33039|0.33039	1.468000|1.468000	0.48064|0.48064	0.561000|0.561000	0.74099|0.74099	TGT|ATG	NBEAL2	-	NULL	ENSG00000160796		0.592	NBEAL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NBEAL2	HGNC	protein_coding	OTTHUMT00000344363.3		0.00	24	0	G	XM_291064		47039969	+1			no_errors	ENST00000450053	ensembl	human	known	74_37	missense	17.65	14	3	SNP	1.000	T
NEK1	4750	genome.wustl.edu	37	4	170520292	170520292	+	Nonsense_Mutation	SNP	G	G	A			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr4:170520292G>A	ENST00000439128.2	-	4	911	c.271C>T	c.(271-273)Cga>Tga	p.R91*	NEK1_ENST00000510533.1_Nonsense_Mutation_p.R91*|NEK1_ENST00000511633.1_Nonsense_Mutation_p.R91*|NEK1_ENST00000512193.1_Nonsense_Mutation_p.R91*|NEK1_ENST00000507142.1_Nonsense_Mutation_p.R91*	NM_012224.2	NP_036356.1	Q96PY6	NEK1_HUMAN	NIMA-related kinase 1	91	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cellular response to DNA damage stimulus (GO:0006974)|cilium assembly (GO:0042384)|mitotic nuclear division (GO:0007067)|response to ionizing radiation (GO:0010212)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|pericentriolar material (GO:0000242)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)			NS(1)|breast(3)|endometrium(3)|kidney(2)|large_intestine(13)|lung(18)|ovary(2)|prostate(2)|stomach(1)	45		Prostate(90;0.00601)|Renal(120;0.0183)		GBM - Glioblastoma multiforme(119;0.0287)|KIRC - Kidney renal clear cell carcinoma(143;0.0325)|Kidney(143;0.0385)|LUSC - Lung squamous cell carcinoma(193;0.14)		GCATTTATTCGCTTAAACAGA	0.338																																																	0													94.0	90.0	91.0					4																	170520292		1826	4095	5921	SO:0001587	stop_gained	0			AB067488	CCDS47162.1, CCDS56348.1, CCDS56349.1, CCDS56350.1, CCDS56351.1	4q32.3	2012-11-15	2012-11-15		ENSG00000137601	ENSG00000137601			7744	protein-coding gene	gene with protein product		604588	"""NIMA (never in mitosis gene a)-related kinase 1"""			1382974, 8274451	Standard	NM_012224		Approved	NY-REN-55, KIAA1901	uc003isd.2	Q96PY6	OTTHUMG00000160963	ENST00000439128.2:c.271C>T	4.37:g.170520292G>A	ENSP00000408020:p.Arg91*		G5E9Z3|Q05DG5|Q14CB7|Q5H9T1|Q6PIB8|Q96SS2|Q9H6P7|Q9Y594	Nonsense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.R91*	ENST00000439128.2	37	c.271	CCDS47162.1	4	.	.	.	.	.	.	.	.	.	.	G	44	11.124862	0.99519	.	.	ENSG00000137601	ENST00000439128;ENST00000511633;ENST00000510533;ENST00000507142;ENST00000512193	.	.	.	5.91	1.95	0.26073	.	0.124697	0.34802	N	0.003668	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	10.5073	0.44841	0.0:0.1036:0.3025:0.5938	.	.	.	.	X	91	.	ENSP00000408020:R91X	R	-	1	2	NEK1	170756867	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	3.502000	0.53332	0.367000	0.24454	0.650000	0.86243	CGA	NEK1	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	ENSG00000137601		0.338	NEK1-001	KNOWN	basic|CCDS	protein_coding	NEK1	HGNC	protein_coding	OTTHUMT00000363157.3	-	0.00	20	0	G			170520292	-1	tier1	-	no_errors	ENST00000507142	ensembl	human	known	74_37	nonsense	25.71	26	9	SNP	1.000	A
NFKBIZ	64332	genome.wustl.edu	37	3	101575996	101575996	+	Missense_Mutation	SNP	T	T	G	rs1043339		TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr3:101575996T>G	ENST00000326172.5	+	10	2019	c.1904T>G	c.(1903-1905)cTg>cGg	p.L635R	NFKBIZ_ENST00000394054.2_Missense_Mutation_p.L535R|NFKBIZ_ENST00000326151.5_Missense_Mutation_p.L513R	NM_031419.3	NP_113607.1	Q9BYH8	IKBZ_HUMAN	nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, zeta	635	Interaction with NFKB1/p50. {ECO:0000250}.				inflammatory response (GO:0006954)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				breast(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	24						TTTTTGGAGCTGCCCAGTTGC	0.483																																																	0													106.0	120.0	116.0					3																	101575996		2203	4300	6503	SO:0001583	missense	0			AF548362	CCDS2946.1, CCDS43123.1	3p12-q12	2013-01-10			ENSG00000144802	ENSG00000144802		"""Ankyrin repeat domain containing"""	29805	protein-coding gene	gene with protein product	"""IL-1 inducible nuclear ankyrin-repeat protein"""	608004				12565889, 16513645	Standard	NM_031419		Approved	MAIL, FLJ34463, INAP	uc003dvp.3	Q9BYH8	OTTHUMG00000159194	ENST00000326172.5:c.1904T>G	3.37:g.101575996T>G	ENSP00000325663:p.Leu635Arg		B3KNR2|D3DN54|Q8IUL4|Q8NAZ8	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.L635R	ENST00000326172.5	37	c.1904	CCDS2946.1	3	.	.	.	.	.	.	.	.	.	.	T	17.90	3.502366	0.64298	.	.	ENSG00000144802	ENST00000483180;ENST00000394054;ENST00000326151;ENST00000326172	T;T;T;T	0.36699	1.24;1.24;1.24;1.24	5.98	5.98	0.97165	Ankyrin repeat-containing domain (4);	0.087947	0.47852	D	0.000211	T	0.44477	0.1295	N	0.20574	0.59	0.45995	D	0.998806	D;D	0.71674	0.994;0.998	P;D	0.72625	0.905;0.978	T	0.30794	-0.9966	10	0.23891	T	0.37	-14.4252	16.4696	0.84102	0.0:0.0:0.0:1.0	rs1043339;rs1043339	513;635	Q9BYH8-3;Q9BYH8	.;IKBZ_HUMAN	R	535;535;513;635	ENSP00000419800:L535R;ENSP00000377618:L535R;ENSP00000325593:L513R;ENSP00000325663:L635R	ENSP00000325593:L513R	L	+	2	0	NFKBIZ	103058686	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	3.321000	0.51999	2.289000	0.77006	0.482000	0.46254	CTG	NFKBIZ	-	superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000144802		0.483	NFKBIZ-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NFKBIZ	HGNC	protein_coding	OTTHUMT00000353793.1	-	0.00	25	0	T	NM_031419		101575996	+1	tier1	rs1043339	no_errors	ENST00000326172	ensembl	human	known	74_37	missense	22.92	37	11	SNP	1.000	G
NLRP13	126204	genome.wustl.edu	37	19	56416358	56416358	+	Silent	SNP	C	C	T			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr19:56416358C>T	ENST00000342929.3	-	8	2567	c.2568G>A	c.(2566-2568)aaG>aaA	p.K856K	NLRP13_ENST00000588751.1_Silent_p.K856K	NM_176810.2	NP_789780.2	Q86W25	NAL13_HUMAN	NLR family, pyrin domain containing 13	856							ATP binding (GO:0005524)			NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(13)|lung(58)|ovary(4)|pancreas(2)|prostate(2)|skin(13)|stomach(2)|urinary_tract(1)	109		Colorectal(82;3.48e-05)|Ovarian(87;0.0481)|Renal(1328;0.218)		GBM - Glioblastoma multiforme(193;0.0642)		CACACAATAGCTTTATGCCAT	0.493																																																	0													141.0	112.0	122.0					19																	56416358		2203	4300	6503	SO:0001819	synonymous_variant	0			AY154468	CCDS33119.1	19q13.43	2008-02-05	2006-12-08	2006-12-08	ENSG00000173572	ENSG00000173572		"""Nucleotide-binding domain and leucine rich repeat containing"""	22937	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 13"""	609660	"""NACHT, leucine rich repeat and PYD containing 13"""	NALP13		12563287	Standard	NM_176810		Approved	NOD14, PAN13, CLR19.7	uc010ygg.2	Q86W25	OTTHUMG00000167839	ENST00000342929.3:c.2568G>A	19.37:g.56416358C>T			Q7RTR5	Silent	SNP	pfam_DAPIN,superfamily_DEATH-like_dom,superfamily_P-loop_NTPase,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,pfscan_DAPIN	p.K856	ENST00000342929.3	37	c.2568	CCDS33119.1	19																																																																																			NLRP13	-	smart_Leu-rich_rpt_RNase_inh_sub-typ	ENSG00000173572		0.493	NLRP13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NLRP13	HGNC	protein_coding	OTTHUMT00000396560.1	-	0.00	42	0	C	NM_176810		56416358	-1	tier1	-	no_errors	ENST00000342929	ensembl	human	known	74_37	silent	96.23	2	51	SNP	0.000	T
NLRP13	126204	genome.wustl.edu	37	19	56424072	56424072	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr19:56424072G>T	ENST00000342929.3	-	5	1110	c.1111C>A	c.(1111-1113)Ctt>Att	p.L371I	NLRP13_ENST00000588751.1_Missense_Mutation_p.L371I	NM_176810.2	NP_789780.2	Q86W25	NAL13_HUMAN	NLR family, pyrin domain containing 13	371	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.						ATP binding (GO:0005524)			NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(13)|lung(58)|ovary(4)|pancreas(2)|prostate(2)|skin(13)|stomach(2)|urinary_tract(1)	109		Colorectal(82;3.48e-05)|Ovarian(87;0.0481)|Renal(1328;0.218)		GBM - Glioblastoma multiforme(193;0.0642)		GAGGCCTTAAGATCTCTCACA	0.448																																																	0													120.0	114.0	116.0					19																	56424072		2203	4300	6503	SO:0001583	missense	0			AY154468	CCDS33119.1	19q13.43	2008-02-05	2006-12-08	2006-12-08	ENSG00000173572	ENSG00000173572		"""Nucleotide-binding domain and leucine rich repeat containing"""	22937	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 13"""	609660	"""NACHT, leucine rich repeat and PYD containing 13"""	NALP13		12563287	Standard	NM_176810		Approved	NOD14, PAN13, CLR19.7	uc010ygg.2	Q86W25	OTTHUMG00000167839	ENST00000342929.3:c.1111C>A	19.37:g.56424072G>T	ENSP00000343891:p.Leu371Ile		Q7RTR5	Missense_Mutation	SNP	pfam_DAPIN,superfamily_DEATH-like_dom,superfamily_P-loop_NTPase,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,pfscan_DAPIN	p.L371I	ENST00000342929.3	37	c.1111	CCDS33119.1	19	.	.	.	.	.	.	.	.	.	.	G	12.45	1.940565	0.34283	.	.	ENSG00000173572	ENST00000342929	T	0.79940	-1.32	2.81	0.181	0.15073	.	.	.	.	.	T	0.81522	0.4840	L	0.46157	1.445	0.09310	N	1	D	0.69078	0.997	D	0.68765	0.96	T	0.67409	-0.5678	9	0.56958	D	0.05	.	2.8295	0.05495	0.1636:0.0:0.5641:0.2724	.	371	Q86W25	NAL13_HUMAN	I	371	ENSP00000343891:L371I	ENSP00000343891:L371I	L	-	1	0	NLRP13	61115884	0.003000	0.15002	0.001000	0.08648	0.008000	0.06430	0.633000	0.24598	0.491000	0.27793	0.591000	0.81541	CTT	NLRP13	-	NULL	ENSG00000173572		0.448	NLRP13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NLRP13	HGNC	protein_coding	OTTHUMT00000396560.1	-	0.00	38	0	G	NM_176810		56424072	-1	tier1	-	no_errors	ENST00000342929	ensembl	human	known	74_37	missense	31.37	35	16	SNP	0.000	T
NOTCH2NL	388677	genome.wustl.edu	37	1	145290819	145290819	+	3'UTR	SNP	G	G	A	rs4659318	byFrequency	TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr1:145290819G>A	ENST00000344859.3	+	0	1118				NOTCH2NL_ENST00000479995.2_3'UTR|NBPF10_ENST00000369339.3_Intron|NBPF10_ENST00000369338.1_5'Flank|RP11-458D21.5_ENST00000468030.1_Intron|NBPF10_ENST00000342960.5_5'Flank			Q7Z3S9	NT2NL_HUMAN	notch 2 N-terminal like						cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|Notch signaling pathway (GO:0007219)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(10)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	27						ATGGAATTGCGCAGTGCATGG	0.527																																																	0																																										SO:0001624	3_prime_UTR_variant	0				CCDS72880.1	1q21.2	2010-06-24	2010-06-24		ENSG00000213240	ENSG00000213240			31862	protein-coding gene	gene with protein product			"""Notch homolog 2 (Drosophila) N-terminal like"""			14673143	Standard	NM_203458		Approved	N2N	uc001emn.4	Q7Z3S9	OTTHUMG00000013754	ENST00000344859.3:c.*63G>A	1.37:g.145290819G>A			Q5BKT8|Q5VTG9|Q5XG84|Q6P192|Q8NC23|Q8WUQ9|Q96FY1	RNA	SNP	-	NULL	ENST00000344859.3	37	NULL		1																																																																																			NOTCH2NL	-	-	ENSG00000213240		0.527	NOTCH2NL-001	KNOWN	basic|appris_candidate	protein_coding	NOTCH2NL	HGNC	protein_coding	OTTHUMT00000038544.1	-	0.00	8	0	G	NM_203458		145290819	+1	tier1	rs4659318	no_errors	ENST00000479995	ensembl	human	known	74_37	rna	23.33	23	7	SNP	0.001	A
NPAT	4863	genome.wustl.edu	37	11	108031840	108031840	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr11:108031840C>G	ENST00000278612.8	-	17	4078	c.3973G>C	c.(3973-3975)Gaa>Caa	p.E1325Q		NM_002519.2	NP_002510.2	Q14207	NPAT_HUMAN	nuclear protein, ataxia-telangiectasia locus	1325	Required for acceleration of G1 phase.				positive regulation of transcription, DNA-templated (GO:0045893)|regulation of gene expression (GO:0010468)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|transcription, DNA-templated (GO:0006351)	Cajal body (GO:0015030)|cytoplasm (GO:0005737)|Gemini of coiled bodies (GO:0097504)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(21)|ovary(2)|prostate(2)|skin(5)	46		all_cancers(61;2.31e-10)|all_epithelial(67;1.11e-06)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		BRCA - Breast invasive adenocarcinoma(274;1.05e-05)|Epithelial(105;3.01e-05)|all cancers(92;0.000816)|Colorectal(284;0.116)		ACACTGTTTTCACTTCCTGTT	0.468																																																	0													91.0	91.0	91.0					11																	108031840		1898	4115	6013	SO:0001583	missense	0			X97186	CCDS41710.1	11q22-q23	2008-02-01			ENSG00000149308	ENSG00000149308			7896	protein-coding gene	gene with protein product		601448				9205109	Standard	NM_002519		Approved	E14	uc001pjz.4	Q14207	OTTHUMG00000166385	ENST00000278612.8:c.3973G>C	11.37:g.108031840C>G	ENSP00000278612:p.Glu1325Gln		A8K1V5|A8K6M2|Q13632|Q14967|Q16580|Q86W55|Q8IWE9	Missense_Mutation	SNP	smart_LisH_dimerisation,pfscan_LisH_dimerisation	p.E1325Q	ENST00000278612.8	37	c.3973	CCDS41710.1	11	.	.	.	.	.	.	.	.	.	.	C	25.2	4.616563	0.87359	.	.	ENSG00000149308	ENST00000278612	T	0.15139	2.45	5.13	5.13	0.70059	.	0.000000	0.85682	D	0.000000	T	0.45216	0.1331	M	0.74258	2.255	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.44832	-0.9302	10	0.87932	D	0	-19.9927	18.9451	0.92620	0.0:1.0:0.0:0.0	.	1325	Q14207	NPAT_HUMAN	Q	1325	ENSP00000278612:E1325Q	ENSP00000278612:E1325Q	E	-	1	0	NPAT	107537050	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.211000	0.77933	2.559000	0.86315	0.555000	0.69702	GAA	NPAT	-	NULL	ENSG00000149308		0.468	NPAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPAT	HGNC	protein_coding	OTTHUMT00000389506.2	-	0.00	47	0	C	NM_002519		108031840	-1	tier1	-	no_errors	ENST00000278612	ensembl	human	known	74_37	missense	41.46	24	17	SNP	1.000	G
NRDE2	55051	genome.wustl.edu	37	14	90770449	90770449	+	Missense_Mutation	SNP	T	T	C			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr14:90770449T>C	ENST00000354366.3	-	5	1067	c.835A>G	c.(835-837)Acc>Gcc	p.T279A	NRDE2_ENST00000357904.3_Missense_Mutation_p.T48A	NM_017970.3	NP_060440.2	Q9H7Z3	NRDE2_HUMAN	NRDE-2, necessary for RNA interference, domain containing	279																	CAATGTGTGGTTGACTGATCA	0.532																																																	0													148.0	141.0	143.0					14																	90770449		2203	4300	6503	SO:0001583	missense	0			AK000870	CCDS9890.1	14q32.11	2012-12-14	2012-09-25	2012-09-25	ENSG00000119720	ENSG00000119720			20186	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 102"""	C14orf102			Standard	NM_017970		Approved	FLJ14051	uc001xyi.2	Q9H7Z3	OTTHUMG00000171020	ENST00000354366.3:c.835A>G	14.37:g.90770449T>C	ENSP00000346335:p.Thr279Ala		B4DH71|Q4G0A7|Q9NWH6	Missense_Mutation	SNP	pfam_NRDE-2	p.T279A	ENST00000354366.3	37	c.835	CCDS9890.1	14	.	.	.	.	.	.	.	.	.	.	T	25.3	4.623949	0.87460	.	.	ENSG00000119720	ENST00000354366;ENST00000357904	T;T	0.41065	1.81;1.01	5.79	4.61	0.57282	.	0.000000	0.85682	D	0.000000	T	0.58623	0.2135	M	0.76002	2.32	0.80722	D	1	D	0.89917	1.0	D	0.77557	0.99	T	0.59537	-0.7436	10	0.09084	T	0.74	-27.4634	12.0948	0.53748	0.1288:0.0:0.0:0.8712	.	279	Q9H7Z3	CN102_HUMAN	A	279;48	ENSP00000346335:T279A;ENSP00000350579:T48A	ENSP00000346335:T279A	T	-	1	0	C14orf102	89840202	1.000000	0.71417	0.997000	0.53966	0.993000	0.82548	6.069000	0.71209	0.972000	0.38314	0.533000	0.62120	ACC	NRDE2	-	NULL	ENSG00000119720		0.532	NRDE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NRDE2	HGNC	protein_coding	OTTHUMT00000411264.1	-	0.00	50	0	T	NM_017970		90770449	-1	tier1	-	no_errors	ENST00000354366	ensembl	human	known	74_37	missense	35.56	29	16	SNP	1.000	C
NRXN1	9378	genome.wustl.edu	37	2	50573871	50573871	+	Intron	SNP	T	T	C			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr2:50573871T>C	ENST00000406316.2	-	18	4841				NRXN1_ENST00000406859.3_Intron|NRXN1_ENST00000401710.1_Intron|NRXN1_ENST00000405472.3_Intron|NRXN1_ENST00000331040.5_Intron|NRXN1_ENST00000401669.2_Intron|NRXN1_ENST00000402717.3_Intron|NRXN1_ENST00000342183.5_Missense_Mutation_p.I73V|NRXN1_ENST00000404971.1_Intron	NM_004801.4	NP_004792.1	Q9ULB1	NRX1A_HUMAN	neurexin 1						adult behavior (GO:0030534)|axon guidance (GO:0007411)|calcium-dependent cell-cell adhesion (GO:0016339)|cerebellar granule cell differentiation (GO:0021707)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|gamma-aminobutyric acid receptor clustering (GO:0097112)|gephyrin clustering (GO:0097116)|guanylate kinase-associated protein clustering (GO:0097117)|heterophilic cell-cell adhesion (GO:0007157)|learning (GO:0007612)|N-methyl-D-aspartate receptor clustering (GO:0097114)|negative regulation of filopodium assembly (GO:0051490)|neuroligin clustering (GO:0097118)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|neuron maturation (GO:0042551)|neurotransmitter secretion (GO:0007269)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|receptor localization to synapse (GO:0097120)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic vesicle clustering (GO:0097091)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	axonal growth cone (GO:0044295)|cell junction (GO:0030054)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	acetylcholine receptor binding (GO:0033130)|calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)|receptor activity (GO:0004872)			breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(33)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	58		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			TAGATTGCAATAGGCACTGAA	0.602																																																	0													101.0	79.0	87.0					2																	50573871		2203	4300	6503	SO:0001627	intron_variant	0			AB011150	CCDS1845.1, CCDS46282.1, CCDS54360.1	2p16.3	2008-05-15			ENSG00000179915	ENSG00000179915			8008	protein-coding gene	gene with protein product		600565					Standard	NM_001135659		Approved	KIAA0578, Hs.22998	uc021vhj.1	P58400	OTTHUMG00000129263	ENST00000406316.2:c.3365-109763A>G	2.37:g.50573871T>C			A7KRL9|O60323|Q53TJ9|Q53TQ1|Q9C079|Q9C080|Q9C081|Q9H3M2|Q9UDM6	Missense_Mutation	SNP	pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,smart_Neurexin-like,pfscan_Laminin_G	p.I73V	ENST00000406316.2	37	c.217	CCDS54360.1	2	.	.	.	.	.	.	.	.	.	.	T	12.61	1.989517	0.35131	.	.	ENSG00000179915	ENST00000342183	T	0.43294	0.95	5.05	3.9	0.45041	.	.	.	.	.	T	0.32526	0.0832	L	0.36672	1.1	0.80722	D	1	B	0.20459	0.045	B	0.12837	0.008	T	0.22452	-1.0216	9	0.66056	D	0.02	.	10.1274	0.42658	0.0:0.0792:0.0:0.9208	.	73	P58400	NRX1B_HUMAN	V	73	ENSP00000341184:I73V	ENSP00000341184:I73V	I	-	1	0	NRXN1	50427375	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.940000	0.56599	1.916000	0.55485	0.379000	0.24179	ATT	NRXN1	-	NULL	ENSG00000179915		0.602	NRXN1-001	KNOWN	basic|CCDS	protein_coding	NRXN1	HGNC	protein_coding	OTTHUMT00000325291.2	-	0.00	9	0	T			50573871	-1	tier1	-	no_errors	ENST00000342183	ensembl	human	known	74_37	missense	23.81	16	5	SNP	1.000	C
NRXN2	9379	genome.wustl.edu	37	11	64428408	64428408	+	Nonsense_Mutation	SNP	G	G	A			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr11:64428408G>A	ENST00000377551.1	-	9	2213	c.2002C>T	c.(2002-2004)Cga>Tga	p.R668*	NRXN2_ENST00000496291.1_5'UTR|NRXN2_ENST00000409571.1_Nonsense_Mutation_p.R661*|NRXN2_ENST00000265459.6_Nonsense_Mutation_p.R668*|AP001092.4_ENST00000433606.1_RNA|NRXN2_ENST00000377559.3_Nonsense_Mutation_p.R637*			Q9P2S2	NRX2A_HUMAN	neurexin 2	668	Laminin G-like 3. {ECO:0000255|PROSITE- ProRule:PRU00122}.				adult behavior (GO:0030534)|gephyrin clustering (GO:0097116)|neuroligin clustering (GO:0097118)|neuron cell-cell adhesion (GO:0007158)|neurotransmitter secretion (GO:0007269)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	integral component of membrane (GO:0016021)	calcium channel regulator activity (GO:0005246)|cell adhesion molecule binding (GO:0050839)|metal ion binding (GO:0046872)|neuroligin family protein binding (GO:0097109)			breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|liver(1)|lung(34)|ovary(6)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(6)|urinary_tract(1)	71						CGGAGGTCTCGGCTACGCCCA	0.687																																																	0													37.0	36.0	36.0					11																	64428408		2201	4297	6498	SO:0001587	stop_gained	0				CCDS8077.1, CCDS31597.1, CCDS8078.1	11q13	2008-07-18			ENSG00000110076	ENSG00000110076			8009	protein-coding gene	gene with protein product	"""neurexin II"""	600566				1621094	Standard	NM_015080		Approved		uc021qkw.1	P58401	OTTHUMG00000045214	ENST00000377551.1:c.2002C>T	11.37:g.64428408G>A	ENSP00000366774:p.Arg668*		A7E2C1|Q9Y2D6	Nonsense_Mutation	SNP	pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,smart_EG-like_dom,smart_Neurexin-like,pfscan_EG-like_dom,pfscan_Laminin_G	p.R668*	ENST00000377551.1	37	c.2002	CCDS8077.1	11	.	.	.	.	.	.	.	.	.	.	G	40	8.294943	0.98747	.	.	ENSG00000110076	ENST00000377551;ENST00000377559;ENST00000265459;ENST00000345863;ENST00000409571	.	.	.	4.52	4.52	0.55395	.	0.000000	0.37857	U	0.001906	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.30854	T	0.27	.	9.9422	0.41587	0.0:0.0:0.7974:0.2026	.	.	.	.	X	668;637;668;637;661	.	ENSP00000265459:R668X	R	-	1	2	NRXN2	64184984	0.998000	0.40836	1.000000	0.80357	0.971000	0.66376	2.143000	0.42187	2.355000	0.79922	0.555000	0.69702	CGA	NRXN2	-	superfamily_ConA-like_lec_gl_sf,pfscan_Laminin_G	ENSG00000110076		0.687	NRXN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NRXN2	HGNC	protein_coding	OTTHUMT00000104967.3	-	0.00	14	0	G	NM_015080		64428408	-1	tier1	-	no_errors	ENST00000265459	ensembl	human	known	74_37	nonsense	31.58	13	6	SNP	1.000	A
OPTN	10133	genome.wustl.edu	37	10	13151284	13151284	+	Silent	SNP	G	G	A			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr10:13151284G>A	ENST00000378748.3	+	4	524	c.162G>A	c.(160-162)ctG>ctA	p.L54L	OPTN_ENST00000378747.3_Silent_p.L54L|OPTN_ENST00000378752.3_Silent_p.L54L|OPTN_ENST00000378764.2_Silent_p.L54L|OPTN_ENST00000263036.5_Silent_p.L54L|OPTN_ENST00000378757.2_Silent_p.L54L|OPTN_ENST00000482140.1_3'UTR	NM_001008211.1|NM_001008213.1	NP_001008212|NP_001008214	Q96CV9	OPTN_HUMAN	optineurin	54					cell death (GO:0008219)|defense response to Gram-negative bacterium (GO:0050829)|G2/M transition of mitotic cell cycle (GO:0000086)|Golgi organization (GO:0007030)|Golgi ribbon formation (GO:0090161)|Golgi to plasma membrane protein transport (GO:0043001)|macroautophagy (GO:0016236)|mitotic cell cycle (GO:0000278)|negative regulation of receptor recycling (GO:0001920)|protein targeting to Golgi (GO:0000042)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|nucleoplasm (GO:0005654)|perinuclear region of cytoplasm (GO:0048471)|trans-Golgi network (GO:0005802)	polyubiquitin binding (GO:0031593)|protein C-terminus binding (GO:0008022)|Rab GTPase binding (GO:0017137)			breast(1)|endometrium(2)|large_intestine(5)|lung(9)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	22						ACCACCAGCTGAAAGGTGAGC	0.602																																																	0													55.0	57.0	56.0					10																	13151284		2203	4300	6503	SO:0001819	synonymous_variant	0			AF420371	CCDS7094.1	10p14	2014-01-28	2003-09-08		ENSG00000123240	ENSG00000123240			17142	protein-coding gene	gene with protein product		602432	"""glaucoma 1, open angle, E (adult-onset)"""	GLC1E		11834836, 9488477	Standard	NM_001008211		Approved	FIP2, HYPL, FIP-2, TFIIIA-INTP, NRP, HIP7	uc001ilx.1	Q96CV9	OTTHUMG00000017690	ENST00000378748.3:c.162G>A	10.37:g.13151284G>A			B3KP00|D3DRS4|D3DRS8|Q5T672|Q5T673|Q5T674|Q5T675|Q7LDL9|Q8N562|Q9UET9|Q9UEV4|Q9Y218	Silent	SNP	pfam_NEMO_N	p.L54	ENST00000378748.3	37	c.162	CCDS7094.1	10																																																																																			OPTN	-	pfam_NEMO_N	ENSG00000123240		0.602	OPTN-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	OPTN	HGNC	protein_coding	OTTHUMT00000046834.1		0.00	12	0	G	NM_021980		13151284	+1			no_errors	ENST00000263036	ensembl	human	known	74_37	silent	18.18	18	4	SNP	0.977	A
OR13C5	138799	genome.wustl.edu	37	9	107361179	107361182	+	Frame_Shift_Del	DEL	GTTA	GTTA	-	rs202235686	byFrequency	TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	GTTA	GTTA					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr9:107361179_107361182delGTTA	ENST00000374779.2	-	1	606_609	c.513_516delTAAC	c.(511-516)aataacfs	p.NN171fs		NM_001004482.1	NP_001004482.1	Q8NGS8	O13C5_HUMAN	olfactory receptor, family 13, subfamily C, member 5	171						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(4)|kidney(1)|large_intestine(2)|lung(11)|ovary(2)|pancreas(2)|prostate(2)|skin(4)	28						GATTGATGATGTTATTCCTGCAGA	0.451														276	0.0551118	0.0817	0.0202	5008	,	,		25393	0.0585		0.0089	False		,,,				2504	0.0879																0																																										SO:0001589	frameshift_variant	0				CCDS35091.1	9q31.1	2012-10-03			ENSG00000255800	ENSG00000277556		"""GPCR / Class A : Olfactory receptors"""	15100	protein-coding gene	gene with protein product							Standard	NM_001004482		Approved		uc011lvp.2	Q8NGS8	OTTHUMG00000020408	ENST00000374779.2:c.513_516delTAAC	9.37:g.107361179_107361182delGTTA	ENSP00000363911:p.Asn171fs		B2RNE5|B9EGW5|Q6IF53	Frame_Shift_Del	DEL	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.N171fs	ENST00000374779.2	37	c.516_513	CCDS35091.1	9																																																																																			OR13C5	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000255800		0.451	OR13C5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR13C5	HGNC	protein_coding	OTTHUMT00000053479.2		0.00	62	0	GTTA	NM_001004482		107361182	-1			no_errors	ENST00000374779	ensembl	human	known	74_37	frame_shift_del	8.08	91	8	DEL	0.000:0.000:0.000:0.000	0
OR1L6	392390	genome.wustl.edu	37	9	125512324	125512324	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr9:125512324C>A	ENST00000373684.1	+	1	306	c.306C>A	c.(304-306)aaC>aaA	p.N102K	OR1L6_ENST00000304720.2_Missense_Mutation_p.N66K			Q8NGR2	OR1L6_HUMAN	olfactory receptor, family 1, subfamily L, member 6	102						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|large_intestine(5)|lung(4)|ovary(1)|stomach(1)	12						TTCTCAGCAACTTGTCTTTCA	0.488																																																	0													94.0	89.0	91.0					9																	125512324		2203	4297	6500	SO:0001583	missense	0				CCDS35130.1, CCDS35130.2	9q33.2	2013-09-20			ENSG00000171459	ENSG00000171459		"""GPCR / Class A : Olfactory receptors"""	8218	protein-coding gene	gene with protein product				OR1L7			Standard	NM_001004453		Approved		uc022bna.1	Q8NGR2	OTTHUMG00000020621	ENST00000373684.1:c.306C>A	9.37:g.125512324C>A	ENSP00000362788:p.Asn102Lys		Q6IFM8|Q96R80	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.N102K	ENST00000373684.1	37	c.306		9	.	.	.	.	.	.	.	.	.	.	.	15.35	2.808120	0.50421	.	.	ENSG00000171459	ENST00000373684;ENST00000304720	T;T	0.01947	4.54;4.54	4.35	1.48	0.22813	GPCR, rhodopsin-like superfamily (1);	0.108803	0.40302	N	0.001139	T	0.04815	0.0130	M	0.75884	2.315	0.32881	D	0.510531	P	0.48503	0.911	P	0.45998	0.5	T	0.14811	-1.0459	10	0.87932	D	0	-22.1104	8.6478	0.34016	0.0:0.7379:0.0:0.2621	.	102	Q8NGR2	OR1L6_HUMAN	K	102;66	ENSP00000362788:N102K;ENSP00000304235:N66K	ENSP00000304235:N66K	N	+	3	2	OR1L6	124552145	0.000000	0.05858	0.838000	0.33150	0.989000	0.77384	-0.910000	0.04054	0.207000	0.20607	0.655000	0.94253	AAC	OR1L6	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000171459		0.488	OR1L6-201	KNOWN	basic	protein_coding	OR1L6	HGNC	protein_coding		-	0.00	62	0	C			125512324	+1	tier1	-	no_errors	ENST00000373684	ensembl	human	known	74_37	missense	63.38	26	45	SNP	0.949	A
OR2M7	391196	genome.wustl.edu	37	1	248487170	248487171	+	Frame_Shift_Ins	INS	-	-	G			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr1:248487170_248487171insG	ENST00000317965.2	-	1	728_729	c.700_701insC	c.(700-702)cgtfs	p.R234fs		NM_001004691.1	NP_001004691.1	Q8NG81	OR2M7_HUMAN	olfactory receptor, family 2, subfamily M, member 7	234						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(6)|large_intestine(3)|lung(29)|skin(3)	42	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			AGCTTTGCGACGTCCCTCTCCA	0.45																																																	0																																										SO:0001589	frameshift_variant	0			BK004486	CCDS31111.1	1q44	2012-08-09			ENSG00000177186	ENSG00000177186		"""GPCR / Class A : Olfactory receptors"""	19594	protein-coding gene	gene with protein product							Standard	NM_001004691		Approved		uc010pzk.2	Q8NG81	OTTHUMG00000040461	ENST00000317965.2:c.701dupC	1.37:g.248487171_248487171dupG	ENSP00000324557:p.Arg234fs		B2RNL0|Q6IEX6	Frame_Shift_Ins	INS	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.R234fs	ENST00000317965.2	37	c.701_700	CCDS31111.1	1																																																																																			OR2M7	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000177186		0.450	OR2M7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2M7	HGNC	protein_coding	OTTHUMT00000097357.1		0.00	85	0	-	NM_001004691		248487171	-1	tier1		no_errors	ENST00000317965	ensembl	human	known	74_37	frame_shift_ins	23.88	153	48	INS	0.001:0.001	G
OR2M7	391196	genome.wustl.edu	37	1	248487173	248487174	+	Frame_Shift_Del	DEL	CC	CC	-			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	CC	CC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr1:248487173_248487174delCC	ENST00000317965.2	-	1	725_726	c.697_698delGG	c.(697-699)ggafs	p.G233fs		NM_001004691.1	NP_001004691.1	Q8NG81	OR2M7_HUMAN	olfactory receptor, family 2, subfamily M, member 7	233						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(6)|large_intestine(3)|lung(29)|skin(3)	42	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			TTTGCGACGTCCCTCTCCAGAT	0.446																																																	0																																										SO:0001589	frameshift_variant	0			BK004486	CCDS31111.1	1q44	2012-08-09			ENSG00000177186	ENSG00000177186		"""GPCR / Class A : Olfactory receptors"""	19594	protein-coding gene	gene with protein product							Standard	NM_001004691		Approved		uc010pzk.2	Q8NG81	OTTHUMG00000040461	ENST00000317965.2:c.697_698delGG	1.37:g.248487173_248487174delCC	ENSP00000324557:p.Gly233fs		B2RNL0|Q6IEX6	Frame_Shift_Del	DEL	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.G233fs	ENST00000317965.2	37	c.698_697	CCDS31111.1	1																																																																																			OR2M7	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000177186		0.446	OR2M7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2M7	HGNC	protein_coding	OTTHUMT00000097357.1		0.00	88	0	CC	NM_001004691		248487174	-1	tier1		no_errors	ENST00000317965	ensembl	human	known	74_37	frame_shift_del	22.75	163	48	DEL	0.335:0.354	-
OR2T3	343173	genome.wustl.edu	37	1	248637291	248637291	+	Missense_Mutation	SNP	G	G	A	rs1770109	byFrequency	TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr1:248637291G>A	ENST00000359594.2	+	1	665	c.640G>A	c.(640-642)Gcc>Acc	p.A214T		NM_001005495.1	NP_001005495.1	Q8NH03	OR2T3_HUMAN	olfactory receptor, family 2, subfamily T, member 3	214						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.A214T(1)		breast(2)|endometrium(5)|lung(19)|ovary(1)|prostate(1)|skin(3)	31	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			CATGCTTCTCGCCCCCATCAT	0.557													.|||	954	0.190495	0.1263	0.1916	5008	,	,		17132	0.2867		0.1064	False		,,,				2504	0.2638																1	Substitution - Missense(1)	skin(1)											211.0	168.0	182.0					1																	248637291		2136	4233	6369	SO:0001583	missense	0				CCDS31117.1	1q44	2012-08-09			ENSG00000196539	ENSG00000196539		"""GPCR / Class A : Olfactory receptors"""	14727	protein-coding gene	gene with protein product							Standard	NM_001005495		Approved		uc001iel.1	Q8NH03	OTTHUMG00000040452	ENST00000359594.2:c.640G>A	1.37:g.248637291G>A	ENSP00000352604:p.Ala214Thr		B2RNJ1	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.A214T	ENST00000359594.2	37	c.640	CCDS31117.1	1	537	0.24587912087912087	86	0.17479674796747968	71	0.19613259668508287	238	0.4160839160839161	142	0.18733509234828497	g	13.03	2.115628	0.37339	.	.	ENSG00000196539	ENST00000359594	T	0.37235	1.21	2.37	-2.22	0.06952	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00012	0.0000	N	0.10629	0.01	0.09310	N	1	P	0.39535	0.677	B	0.33568	0.166	T	0.42275	-0.9461	9	0.56958	D	0.05	.	0.5423	0.00647	0.2646:0.2059:0.3262:0.2032	rs1770109	214	Q8NH03	OR2T3_HUMAN	T	214	ENSP00000352604:A214T	ENSP00000352604:A214T	A	+	1	0	OR2T3	246703914	0.000000	0.05858	0.163000	0.22734	0.269000	0.26545	-1.638000	0.02013	0.011000	0.14865	0.186000	0.17326	GCC	OR2T3	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000196539		0.557	OR2T3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2T3	HGNC	protein_coding	OTTHUMT00000097348.1		0.00	23	0	G	NM_001005495		248637291	+1			no_errors	ENST00000359594	ensembl	human	known	74_37	missense	12.12	58	8	SNP	0.002	A
OR4C16	219428	genome.wustl.edu	37	11	55339985	55339985	+	Silent	SNP	C	C	T			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr11:55339985C>T	ENST00000314634.3	+	1	382	c.382C>T	c.(382-384)Ctg>Ttg	p.L128L		NM_001004701.2	NP_001004701.2	Q8NGL9	OR4CG_HUMAN	olfactory receptor, family 4, subfamily C, member 16 (gene/pseudogene)	128						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(1)|lung(28)|ovary(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	41		all_epithelial(135;0.0748)				CTGTAAGCCCCTGCACTACAT	0.498																																																	0													185.0	176.0	179.0					11																	55339985		2201	4296	6497	SO:0001819	synonymous_variant	0			AB065773	CCDS31502.1	11q11	2013-10-10	2013-10-10		ENSG00000181935	ENSG00000181935		"""GPCR / Class A : Olfactory receptors"""	15172	protein-coding gene	gene with protein product			"""olfactory receptor, family 4, subfamily C, member 16"""				Standard	NM_001004701		Approved		uc010rih.2	Q8NGL9	OTTHUMG00000165198	ENST00000314634.3:c.382C>T	11.37:g.55339985C>T			Q6IEV8	Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L128	ENST00000314634.3	37	c.382	CCDS31502.1	11																																																																																			OR4C16	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt	ENSG00000181935		0.498	OR4C16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4C16	HGNC	protein_coding	OTTHUMT00000382627.1	-	0.00	52	0	C	NM_001004701		55339985	+1	tier1	-	no_errors	ENST00000314634	ensembl	human	known	74_37	silent	67.24	19	39	SNP	0.839	T
OR9G1	390174	genome.wustl.edu	37	11	56468326	56468326	+	Missense_Mutation	SNP	T	T	C			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr11:56468326T>C	ENST00000312153.1	+	1	463	c.463T>C	c.(463-465)Tct>Cct	p.S155P		NM_001005213.1	NP_001005213.1	Q8NH87	OR9G1_HUMAN	olfactory receptor, family 9, subfamily G, member 1	155						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|kidney(1)|lung(25)|stomach(2)|upper_aerodigestive_tract(1)	31						CTTTATTAACTCTTCAATCAT	0.458																																																	0													192.0	181.0	185.0					11																	56468326		2201	4296	6497	SO:0001583	missense	0			AB065500	CCDS31536.1	11q11	2012-08-09			ENSG00000174914	ENSG00000174914		"""GPCR / Class A : Olfactory receptors"""	15319	protein-coding gene	gene with protein product				OR9G5			Standard	NM_001005213		Approved			Q8NH87	OTTHUMG00000167112	ENST00000312153.1:c.463T>C	11.37:g.56468326T>C	ENSP00000309012:p.Ser155Pro		Q6IEU9|Q8NGQ0	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.S155P	ENST00000312153.1	37	c.463	CCDS31536.1	11	.	.	.	.	.	.	.	.	.	.	T	11.91	1.778519	0.31502	.	.	ENSG00000174914	ENST00000312153	T	0.46063	0.88	4.52	-1.38	0.09027	GPCR, rhodopsin-like superfamily (1);	0.677681	0.13601	N	0.375861	T	0.52565	0.1742	M	0.75264	2.295	0.09310	N	1	P	0.49961	0.93	P	0.57720	0.826	T	0.45512	-0.9256	10	0.87932	D	0	-9.7503	6.4433	0.21861	0.2354:0.0:0.3176:0.4471	.	155	Q8NH87	OR9G1_HUMAN	P	155	ENSP00000309012:S155P	ENSP00000309012:S155P	S	+	1	0	OR9G1	56224902	0.000000	0.05858	0.829000	0.32907	0.259000	0.26198	-1.975000	0.01498	-0.018000	0.14079	-0.507000	0.04495	TCT	OR9G1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000174914		0.458	OR9G1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR9G1	HGNC	protein_coding	OTTHUMT00000393253.1	-	0.00	114	0	T	NM_001005213		56468326	+1	tier1	-	no_errors	ENST00000312153	ensembl	human	known	74_37	missense	15.74	91	17	SNP	0.000	C
PARPBP	55010	genome.wustl.edu	37	12	102558360	102558360	+	Nonsense_Mutation	SNP	C	C	T			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr12:102558360C>T	ENST00000358383.5	+	5	685	c.640C>T	c.(640-642)Cga>Tga	p.R214*	PARPBP_ENST00000327680.2_Nonsense_Mutation_p.R133*|PARPBP_ENST00000541394.1_Nonsense_Mutation_p.R291*|PARPBP_ENST00000392911.2_Nonsense_Mutation_p.R133*|PARPBP_ENST00000543784.1_Nonsense_Mutation_p.R100*|PARPBP_ENST00000378128.3_Nonsense_Mutation_p.R214*|PARPBP_ENST00000535811.1_Intron			Q9NWS1	PARI_HUMAN	PARP1 binding protein	214					DNA repair (GO:0006281)|negative regulation of double-strand break repair via homologous recombination (GO:2000042)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(1)|lung(8)|urinary_tract(2)	11						ACATGCTGCTCGAGAGAAACA	0.388																																																	0													157.0	166.0	163.0					12																	102558360		2203	4300	6503	SO:0001587	stop_gained	0			AK000648	CCDS9090.1, CCDS9090.2	12q23.2	2013-03-14	2012-01-24	2012-01-24		ENSG00000185480			26074	protein-coding gene	gene with protein product	"""PARP-1 binding protein"""	613687	"""chromosome 12 open reading frame 48"""	C12orf48		20931645	Standard	NM_017915		Approved	FLJ20641, PARI	uc001tjf.3	Q9NWS1		ENST00000358383.5:c.640C>T	12.37:g.102558360C>T	ENSP00000351153:p.Arg214*		B4E0Y0|Q05C00|Q499L8|Q4FZA0|Q4KMW7|Q6NSC6|Q6PJA1|Q86W36	Nonsense_Mutation	SNP	superfamily_P-loop_NTPase	p.R214*	ENST00000358383.5	37	c.640	CCDS9090.2	12	.	.	.	.	.	.	.	.	.	.	C	36	5.622579	0.96660	.	.	ENSG00000185480	ENST00000378128;ENST00000327680;ENST00000541394;ENST00000543784;ENST00000358383;ENST00000392911;ENST00000417507;ENST00000412715	.	.	.	5.81	4.92	0.64577	.	0.498508	0.23624	N	0.046205	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-0.0089	17.1553	0.86790	0.0:0.8736:0.1264:0.0	.	.	.	.	X	214;133;291;100;214;133;181;181	.	ENSP00000332915:R133X	R	+	1	2	C12orf48	101082490	0.995000	0.38212	0.994000	0.49952	0.962000	0.63368	4.551000	0.60740	1.477000	0.48234	-0.367000	0.07326	CGA	PARPBP	-	superfamily_P-loop_NTPase	ENSG00000185480		0.388	PARPBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PARPBP	HGNC	protein_coding	OTTHUMT00000397030.2	-	0.00	35	0	C	NM_017915		102558360	+1	tier1	-	no_errors	ENST00000358383	ensembl	human	known	74_37	nonsense	30.77	27	12	SNP	0.998	T
PCBP3	54039	genome.wustl.edu	37	21	47316257	47316257	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr21:47316257G>A	ENST00000400314.1	+	4	484	c.146G>A	c.(145-147)cGc>cAc	p.R49H	PCBP3_ENST00000400304.1_Missense_Mutation_p.R17H|PCBP3_ENST00000400310.1_Missense_Mutation_p.R49H|PCBP3_ENST00000400308.1_Missense_Mutation_p.R49H|PCBP3_ENST00000449640.1_Missense_Mutation_p.R49H|PCBP3_ENST00000400309.1_Missense_Mutation_p.R49H			P57721	PCBP3_HUMAN	poly(rC) binding protein 3	49	KH 1. {ECO:0000255|PROSITE- ProRule:PRU00117}.				mRNA metabolic process (GO:0016071)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			biliary_tract(1)|endometrium(3)|large_intestine(2)|lung(7)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	17	all_hematologic(128;0.24)			Colorectal(79;0.0411)|READ - Rectum adenocarcinoma(84;0.0649)		CTCACCATCCGCCTGCTGATG	0.582																																																	0													41.0	48.0	46.0					21																	47316257		1897	3903	5800	SO:0001583	missense	0			AF176329	CCDS42974.2, CCDS46652.1	21q22.3	2013-07-16	2001-11-28		ENSG00000183570	ENSG00000183570			8651	protein-coding gene	gene with protein product		608502	"""poly(rC)-binding protein 3"""			10936052	Standard	NM_020528		Approved		uc002zhq.2	P57721	OTTHUMG00000090399	ENST00000400314.1:c.146G>A	21.37:g.47316257G>A	ENSP00000383168:p.Arg49His		A8MPS2|A8MQ26|B7WNN9|B7WPC1|Q8N9K6|Q96EP6	Missense_Mutation	SNP	pfam_KH_dom_type_1,pfam_KH_dom_type_2,smart_KH_dom,pfscan_KH_dom_type_1	p.R49H	ENST00000400314.1	37	c.146	CCDS42974.2	21	.	.	.	.	.	.	.	.	.	.	G	33	5.264606	0.95399	.	.	ENSG00000183570	ENST00000400314;ENST00000400310;ENST00000400309;ENST00000400308;ENST00000449640;ENST00000346743;ENST00000400305;ENST00000400304	T;T;T;T;T;T;T	0.35973	1.28;1.28;1.28;1.28;1.28;1.28;1.28	5.08	5.08	0.68730	K Homology (1);K Homology, type 1, subgroup (1);K Homology, type 1 (1);	0.000000	0.85682	D	0.000000	T	0.68915	0.3053	M	0.91818	3.245	0.80722	D	1	P;D;D;D;P;D;D	0.89917	0.899;0.976;1.0;0.997;0.877;0.999;0.995	P;P;D;P;P;D;D	0.73708	0.694;0.556;0.981;0.907;0.52;0.969;0.943	T	0.77267	-0.2651	10	0.87932	D	0	-13.4921	18.4955	0.90864	0.0:0.0:1.0:0.0	.	17;49;17;49;49;49;49	Q5MJP6;P57721-3;E9PFP8;P57721-2;P57721-4;P57721;P57721-5	.;.;.;.;.;PCBP3_HUMAN;.	H	49;49;49;49;49;49;25;17	ENSP00000383168:R49H;ENSP00000383165:R49H;ENSP00000383164:R49H;ENSP00000383163:R49H;ENSP00000401198:R49H;ENSP00000383160:R25H;ENSP00000383159:R17H	ENSP00000330225:R49H	R	+	2	0	PCBP3	46140685	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.157000	0.94714	2.538000	0.85594	0.643000	0.83706	CGC	PCBP3	-	pfam_KH_dom_type_1,smart_KH_dom,pfscan_KH_dom_type_1	ENSG00000183570		0.582	PCBP3-001	KNOWN	basic|CCDS	protein_coding	PCBP3	HGNC	protein_coding	OTTHUMT00000206808.2	-	0.00	61	0	G			47316257	+1	tier1	-	no_errors	ENST00000400314	ensembl	human	known	74_37	missense	51.75	55	59	SNP	1.000	A
PCDH10	57575	genome.wustl.edu	37	4	134073552	134073552	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr4:134073552G>A	ENST00000264360.5	+	1	3083	c.2257G>A	c.(2257-2259)Gcc>Acc	p.A753T		NM_032961.1	NP_116586.1	Q9P2E7	PCD10_HUMAN	protocadherin 10	753	Cys-rich.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(30)|liver(1)|lung(72)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(2)	136				LUSC - Lung squamous cell carcinoma(193;0.227)		TACTTGTCTGGCCAGCGATTG	0.592																																																	0													56.0	61.0	59.0					4																	134073552		2203	4300	6503	SO:0001583	missense	0			AB037821	CCDS34063.1, CCDS75192.1	4q28.3	2010-01-26				ENSG00000138650		"""Cadherins / Protocadherins : Non-clustered"""	13404	protein-coding gene	gene with protein product		608286				10835267	Standard	NM_020815		Approved	OL-PCDH, KIAA1400	uc003iha.3	Q9P2E7		ENST00000264360.5:c.2257G>A	4.37:g.134073552G>A	ENSP00000264360:p.Ala753Thr		Q4W5F6|Q96SF0	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.A753T	ENST00000264360.5	37	c.2257	CCDS34063.1	4	.	.	.	.	.	.	.	.	.	.	G	13.49	2.254145	0.39896	.	.	ENSG00000138650	ENST00000264360;ENST00000394248	T	0.52754	0.65	4.48	4.48	0.54585	.	0.162599	0.29053	N	0.013298	T	0.35828	0.0945	L	0.34521	1.04	0.44852	D	0.997869	B;B	0.23540	0.087;0.017	B;B	0.17433	0.018;0.007	T	0.16305	-1.0407	10	0.10377	T	0.69	.	16.9557	0.86258	0.0:0.0:1.0:0.0	.	753;753	Q9P2E7;Q96SF0	PCD10_HUMAN;.	T	753	ENSP00000264360:A753T	ENSP00000264360:A753T	A	+	1	0	PCDH10	134293002	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	2.994000	0.49433	2.322000	0.78497	0.561000	0.74099	GCC	PCDH10	-	NULL	ENSG00000138650		0.592	PCDH10-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PCDH10	HGNC	protein_coding	OTTHUMT00000364457.2	-	0.00	28	0	G	NM_032961		134073552	+1	tier1	-	no_errors	ENST00000264360	ensembl	human	known	74_37	missense	30.56	25	11	SNP	1.000	A
PCDHA10	56139	genome.wustl.edu	37	5	140237801	140237801	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr5:140237801C>T	ENST00000307360.5	+	1	2168	c.2168C>T	c.(2167-2169)gCg>gTg	p.A723V	PCDHA1_ENST00000504120.2_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA1_ENST00000394633.3_Intron	NM_018901.2	NP_061724.1	Q9Y5I2	PCDAA_HUMAN	protocadherin alpha 10	723					cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(11)|cervix(1)|endometrium(11)|kidney(5)|large_intestine(13)|liver(2)|lung(20)|ovary(3)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(2)	79			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGGTGCTCGGCGGCGCCCACC	0.662																																																	0													25.0	22.0	23.0					5																	140237801		1321	2291	3612	SO:0001583	missense	0			AF152475	CCDS34255.1, CCDS54921.1, CCDS75325.1	5q31	2010-11-26			ENSG00000250120	ENSG00000250120		"""Cadherins / Protocadherins : Clustered"""	8664	other	complex locus constituent	"""KIAA0345-like 4"", ""ortholog to mouse CNR8"""	606316		CNRS8		10380929	Standard	NM_018901		Approved	CNR8, CRNR8, CNRN8, PCDH-ALPHA10		Q9Y5I2	OTTHUMG00000163372	ENST00000307360.5:c.2168C>T	5.37:g.140237801C>T	ENSP00000304234:p.Ala723Val		A1L493|O75280|Q9NRU2	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.A723V	ENST00000307360.5	37	c.2168	CCDS54921.1	5	.	.	.	.	.	.	.	.	.	.	C	4.762	0.141785	0.09083	.	.	ENSG00000250120	ENST00000307360	T	0.15487	2.42	3.66	1.74	0.24563	.	.	.	.	.	T	0.14485	0.0350	L	0.46947	1.48	0.09310	N	0.999998	B;B	0.27192	0.171;0.06	B;B	0.26969	0.075;0.014	T	0.23440	-1.0188	9	0.41790	T	0.15	.	6.5474	0.22414	0.4415:0.3975:0.161:0.0	.	723;723	Q9Y5I2-3;Q9Y5I2	.;PCDAA_HUMAN	V	723	ENSP00000304234:A723V	ENSP00000304234:A723V	A	+	2	0	PCDHA10	140217985	0.000000	0.05858	0.280000	0.24747	0.065000	0.16274	-0.338000	0.07842	0.284000	0.22305	0.491000	0.48974	GCG	PCDHA10	-	NULL	ENSG00000250120		0.662	PCDHA10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA10	HGNC	protein_coding	OTTHUMT00000372895.2	-	0.00	57	0	C	NM_018901		140237801	+1	tier1	-	no_errors	ENST00000307360	ensembl	human	known	74_37	missense	50.00	20	20	SNP	0.305	T
PEAK1	79834	genome.wustl.edu	37	15	77471471	77471471	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr15:77471471C>T	ENST00000560626.2	-	4	3273	c.2798G>A	c.(2797-2799)cGc>cAc	p.R933H	PEAK1_ENST00000558305.1_Missense_Mutation_p.R933H|PEAK1_ENST00000312493.4_Missense_Mutation_p.R933H			Q9H792	PEAK1_HUMAN	pseudopodium-enriched atypical kinase 1	933					cell migration (GO:0016477)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein autophosphorylation (GO:0046777)|substrate adhesion-dependent cell spreading (GO:0034446)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)										TTTCCGACGGCGGAAGAAGCT	0.507																																																	0													102.0	112.0	109.0					15																	77471471		1944	4140	6084	SO:0001583	missense	0				CCDS42062.1	15q24.3	2013-09-27			ENSG00000173517	ENSG00000173517			29431	protein-coding gene	gene with protein product		614248				16879967, 20534451	Standard	NM_024776		Approved	KIAA2002, sgk269		Q9H792	OTTHUMG00000172618	ENST00000560626.2:c.2798G>A	15.37:g.77471471C>T	ENSP00000452796:p.Arg933His		Q6ZS78|Q8NAZ4|Q8NCM3|Q8TEG7	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,pfscan_Prot_kinase_dom	p.R933H	ENST00000560626.2	37	c.2798	CCDS42062.1	15	.	.	.	.	.	.	.	.	.	.	C	26.2	4.712761	0.89112	.	.	ENSG00000173517	ENST00000312493	T	0.74842	-0.88	5.91	5.91	0.95273	.	0.000000	0.64402	D	0.000010	T	0.79753	0.4500	L	0.32530	0.975	0.44652	D	0.997636	D	0.89917	1.0	D	0.85130	0.997	T	0.80917	-0.1168	10	0.87932	D	0	-11.2796	13.4829	0.61348	0.0:0.9291:0.0:0.0708	.	933	Q9H792	PEAK1_HUMAN	H	933	ENSP00000309230:R933H	ENSP00000309230:R933H	R	-	2	0	AC087465.1	75258526	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.677000	0.61634	2.793000	0.96121	0.655000	0.94253	CGC	PEAK1	-	NULL	ENSG00000173517		0.507	PEAK1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	PEAK1	HGNC	protein_coding	OTTHUMT00000419483.3		0.00	28	0	C			77471471	-1			no_errors	ENST00000312493	ensembl	human	known	74_37	missense	5.26	36	2	SNP	1.000	T
PHIP	55023	genome.wustl.edu	37	6	79655198	79655198	+	Silent	SNP	C	C	T			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr6:79655198C>T	ENST00000275034.4	-	39	4814	c.4647G>A	c.(4645-4647)gtG>gtA	p.V1549V	PHIP_ENST00000479165.1_5'UTR	NM_017934.5	NP_060404	Q8WWQ0	PHIP_HUMAN	pleckstrin homology domain interacting protein	1549					cytoskeleton organization (GO:0007010)|insulin receptor signaling pathway (GO:0008286)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of mitosis (GO:0045840)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein import into nucleus (GO:0006606)|regulation of cell morphogenesis (GO:0022604)|regulation of growth (GO:0040008)|regulation of protein phosphorylation (GO:0001932)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	insulin receptor binding (GO:0005158)|lysine-acetylated histone binding (GO:0070577)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(10)|kidney(4)|large_intestine(20)|lung(20)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	68		all_cancers(76;0.00125)|Acute lymphoblastic leukemia(125;1.1e-05)|all_hematologic(105;0.00117)|all_epithelial(107;0.219)		BRCA - Breast invasive adenocarcinoma(397;0.231)		TGGAATGTTTCACAGAATTCT	0.294																																																	0													63.0	60.0	61.0					6																	79655198		2203	4300	6503	SO:0001819	synonymous_variant	0			AF310250	CCDS4987.1	6q14	2013-01-09			ENSG00000146247	ENSG00000146247		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	15673	protein-coding gene	gene with protein product	"""DDB1 and CUL4 associated factor 14"""	612870		WDR11		11018022	Standard	NM_017934		Approved	ndrp, FLJ20705, DCAF14, BRWD2	uc003pir.3	Q8WWQ0	OTTHUMG00000015071	ENST00000275034.4:c.4647G>A	6.37:g.79655198C>T			A7J992|B2RPK4|Q05CQ9|Q5VVH4|Q66I29|Q69YV1|Q8NBZ5|Q96H52|Q96ME2|Q9H261	Silent	SNP	pfam_WD40_repeat,pfam_Bromodomain,superfamily_Quinonprotein_ADH-like_supfam,superfamily_Bromodomain,smart_WD40_repeat,smart_Bromodomain,pfscan_Bromodomain,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_Bromodomain	p.V1549	ENST00000275034.4	37	c.4647	CCDS4987.1	6																																																																																			PHIP	-	NULL	ENSG00000146247		0.294	PHIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHIP	HGNC	protein_coding	OTTHUMT00000041297.2	-	0.00	42	0	C			79655198	-1	tier1	-	no_errors	ENST00000275034	ensembl	human	known	74_37	silent	23.91	35	11	SNP	0.998	T
PI4KA	5297	genome.wustl.edu	37	22	21064264	21064264	+	Silent	SNP	G	G	C			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr22:21064264G>C	ENST00000572273.1	-	53	6161	c.5931C>G	c.(5929-5931)gtC>gtG	p.V1977V	PI4KA_ENST00000255882.6_Silent_p.V2035V|PI4KA_ENST00000414196.3_Silent_p.V787V			P42356	PI4KA_HUMAN	phosphatidylinositol 4-kinase, catalytic, alpha	1977	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.				phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi-associated vesicle membrane (GO:0030660)|membrane (GO:0016020)|plasma membrane (GO:0005886)	1-phosphatidylinositol 4-kinase activity (GO:0004430)|ATP binding (GO:0005524)			breast(3)|endometrium(8)|kidney(9)|large_intestine(19)|lung(29)|ovary(1)|pancreas(1)|prostate(3)|salivary_gland(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	79	all_cancers(11;7.59e-25)|all_epithelial(7;1.34e-22)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000536)|Lung(15;0.0108)|Epithelial(17;0.196)			TGACCAGGGAGACGACCGCGT	0.617																																					GBM(136;1332 1831 3115 23601 50806)												0													123.0	96.0	105.0					22																	21064264		2203	4300	6503	SO:0001819	synonymous_variant	0			L36151	CCDS33603.1, CCDS33603.2	22q11.21	2011-05-25	2007-08-14	2007-08-02	ENSG00000241973	ENSG00000241973			8983	protein-coding gene	gene with protein product		600286		PIK4CA		7961848, 8662589	Standard	NM_002650		Approved	PI4K-ALPHA, pi4K230	uc002zsz.5	P42356	OTTHUMG00000167440	ENST00000572273.1:c.5931C>G	22.37:g.21064264G>C			Q7Z625|Q9UPG2	Silent	SNP	pfam_PI3/4_kinase_cat_dom,pfam_PInositide-3_kin_accessory_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.V2035	ENST00000572273.1	37	c.6105		22																																																																																			PI4KA	-	pfam_PI3/4_kinase_cat_dom,superfamily_Kinase-like_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	ENSG00000241973		0.617	PI4KA-202	KNOWN	basic|appris_principal	protein_coding	PI4KA	HGNC	protein_coding		-	0.00	48	0	G	NM_058004		21064264	-1	tier1	-	no_errors	ENST00000255882	ensembl	human	known	74_37	silent	30.00	35	15	SNP	1.000	C
PIGK	10026	genome.wustl.edu	37	1	77620211	77620211	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr1:77620211G>T	ENST00000370812.3	-	9	932	c.909C>A	c.(907-909)ttC>ttA	p.F303L	PIGK_ENST00000359130.1_Missense_Mutation_p.F303L|PIGK_ENST00000445065.1_Missense_Mutation_p.F209L|PIGK_ENST00000370813.5_Missense_Mutation_p.F227L|PIGK_ENST00000478391.1_5'UTR	NM_005482.2	NP_005473.1	Q92643	GPI8_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class K	303					attachment of GPI anchor to protein (GO:0016255)|C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)	endoplasmic reticulum membrane (GO:0005789)|GPI-anchor transamidase complex (GO:0042765)|integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)	cysteine-type endopeptidase activity (GO:0004197)|GPI-anchor transamidase activity (GO:0003923)|protein disulfide isomerase activity (GO:0003756)			endometrium(5)|kidney(1)|large_intestine(4)|lung(3)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(2)	19						CACTTCCAAAGAAATCAGTTA	0.368																																																	0													124.0	117.0	120.0					1																	77620211		2203	4300	6503	SO:0001583	missense	0			AF022913	CCDS674.1	1p31.1	2013-02-26	2006-06-28		ENSG00000142892	ENSG00000142892		"""Phosphatidylinositol glycan anchor biosynthesis"""	8965	protein-coding gene	gene with protein product	"""GPI transamidase subunit"""	605087	"""phosphatidylinositol glycan, class K"""			9356492	Standard	NM_005482		Approved	hGPI8, GPI8	uc001dhk.3	Q92643	OTTHUMG00000009686	ENST00000370812.3:c.909C>A	1.37:g.77620211G>T	ENSP00000359848:p.Phe303Leu		B2R7K3|B4E2M3|O14822|Q5TG77	Missense_Mutation	SNP	pfam_Peptidase_C13,prints_Peptidase_C13	p.F303L	ENST00000370812.3	37	c.909	CCDS674.1	1	.	.	.	.	.	.	.	.	.	.	G	21.2	4.116089	0.77323	.	.	ENSG00000142892	ENST00000370812;ENST00000445065;ENST00000370813;ENST00000359130	T;T;T;T	0.64991	-0.1;-0.07;-0.13;-0.09	5.2	2.32	0.28847	.	0.000000	0.85682	D	0.000000	T	0.76442	0.3988	H	0.95004	3.61	0.58432	D	0.999999	D;D;D;D	0.76494	0.999;0.998;0.999;0.988	D;D;D;D	0.81914	0.995;0.988;0.991;0.939	T	0.78583	-0.2148	10	0.72032	D	0.01	-9.1611	8.602	0.33751	0.2953:0.0:0.7047:0.0	.	227;209;303;303	B4E2M3;B1AK81;A6NEM5;Q92643	.;.;.;GPI8_HUMAN	L	303;209;227;303	ENSP00000359848:F303L;ENSP00000388854:F209L;ENSP00000359849:F227L;ENSP00000352041:F303L	ENSP00000352041:F303L	F	-	3	2	PIGK	77392799	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.664000	0.46783	0.296000	0.22592	0.655000	0.94253	TTC	PIGK	-	NULL	ENSG00000142892		0.368	PIGK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIGK	HGNC	protein_coding	OTTHUMT00000026687.1	-	0.00	49	0	G	NM_005482		77620211	-1	tier1	-	no_errors	ENST00000370812	ensembl	human	known	74_37	missense	22.50	62	18	SNP	1.000	T
POU2F1	5451	genome.wustl.edu	37	1	167343527	167343527	+	Silent	SNP	C	C	T	rs562014026		TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr1:167343527C>T	ENST00000541643.3	+	7	678	c.516C>T	c.(514-516)atC>atT	p.I172I	POU2F1_ENST00000367865.1_3'UTR|POU2F1_ENST00000420254.3_Silent_p.I172I|POU2F1_ENST00000367862.5_Silent_p.I184I|POU2F1_ENST00000452019.1_Silent_p.I172I|POU2F1_ENST00000367866.2_Silent_p.I195I|POU2F1_ENST00000429375.2_Intron			P14859	PO2F1_HUMAN	POU class 2 homeobox 1	172					gene expression (GO:0010467)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription from RNA polymerase III promoter (GO:0006383)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(3)|liver(2)|lung(7)|ovary(2)|prostate(2)|skin(3)|urinary_tract(1)	30						CCATACAGATCGCACAGGTGA	0.527																																																	0													25.0	26.0	26.0					1																	167343527		2201	4300	6501	SO:0001819	synonymous_variant	0			BC001664	CCDS1259.1, CCDS1259.2, CCDS55655.1, CCDS55656.1	1q24.2	2011-06-20	2007-07-13		ENSG00000143190	ENSG00000143190		"""Homeoboxes / POU class"""	9212	protein-coding gene	gene with protein product		164175	"""POU domain class 2, transcription factor 1"""	OTF1		1887216	Standard	NM_002697		Approved	OCT1	uc001gee.3	P14859	OTTHUMG00000034436	ENST00000541643.3:c.516C>T	1.37:g.167343527C>T			B1AL91|B1AL93|B4E029|J3KP77|Q5TBT7|Q6PK46|Q8NEU9|Q9BPV1	Silent	SNP	pfam_POU_specific,pfam_Homeobox_dom,superfamily_Lambda_DNA-bd_dom,superfamily_Homeodomain-like,smart_POU_specific,smart_Homeobox_dom,pfscan_Homeobox_dom,pfscan_POU_specific,prints_POU,prints_TF_octamer	p.I195	ENST00000541643.3	37	c.585		1																																																																																			POU2F1	-	NULL	ENSG00000143190		0.527	POU2F1-203	KNOWN	basic|appris_candidate	protein_coding	POU2F1	HGNC	protein_coding		-	0.00	32	0	C	NM_002697		167343527	+1	tier1	-	no_errors	ENST00000367866	ensembl	human	known	74_37	silent	12.82	68	10	SNP	0.879	T
PPP1R26	9858	genome.wustl.edu	37	9	138377490	138377490	+	Silent	SNP	G	G	A			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr9:138377490G>A	ENST00000356818.2	+	4	1683	c.1134G>A	c.(1132-1134)caG>caA	p.Q378Q	PPP1R26_ENST00000401470.3_Silent_p.Q378Q|PPP1R26_ENST00000602993.1_Intron|PPP1R26_ENST00000604351.1_Silent_p.Q378Q|PPP1R26_ENST00000605660.1_Silent_p.Q378Q|PPP1R26_ENST00000605286.1_Silent_p.Q378Q	NM_014811.3	NP_055626.3	Q5T8A7	PPR26_HUMAN	protein phosphatase 1, regulatory subunit 26	378					negative regulation of phosphatase activity (GO:0010923)	nucleus (GO:0005634)	phosphatase binding (GO:0019902)|protein phosphatase inhibitor activity (GO:0004864)										ACCAGCTGCAGAAAACACGCA	0.642																																																	0													41.0	47.0	45.0					9																	138377490		2203	4300	6503	SO:0001819	synonymous_variant	0			AB014549	CCDS6988.1	9q34.3	2012-04-17	2011-10-11	2011-10-11	ENSG00000196422	ENSG00000196422		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	29089	protein-coding gene	gene with protein product	"""DRIM/UTP20 interacting protein"", ""1A6/DRIM (down-regulated in metastasis) interacting protein"""	614056	"""KIAA0649"""	KIAA0649		9734811, 16053918	Standard	NM_014811		Approved		uc004cfr.1	Q5T8A7	OTTHUMG00000020904	ENST00000356818.2:c.1134G>A	9.37:g.138377490G>A			Q86WU0|Q8WVV0|Q9Y4D3	Silent	SNP	NULL	p.Q378	ENST00000356818.2	37	c.1134	CCDS6988.1	9																																																																																			PPP1R26	-	NULL	ENSG00000196422		0.642	PPP1R26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1R26	HGNC	protein_coding	OTTHUMT00000054987.1	-	0.00	61	0	G	NM_014811		138377490	+1	tier1	-	no_errors	ENST00000356818	ensembl	human	known	74_37	silent	30.91	38	17	SNP	1.000	A
PPP4R1L	55370	genome.wustl.edu	37	20	56814841	56814841	+	3'UTR	SNP	G	G	C			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr20:56814841G>C	ENST00000334187.8	-	0	1787							Q9P1A2	PP4RL_HUMAN	protein phosphatase 4, regulatory subunit 1-like																		TCGACAGTCTGGGCTCGAGCT	0.532																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AF119843		20q13.32	2013-03-28			ENSG00000124224	ENSG00000124224			15755	other	unknown				C20orf192		14702039, 11780052	Standard	NR_003505		Approved	bA196N14.4, bA196N14.5	uc002xyy.1	Q9P1A2	OTTHUMG00000032838	ENST00000334187.8:c.*526C>G	20.37:g.56814841G>C			B4DRM4|Q96LY6|Q9BZ17|Q9BZ18	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.Q125E	ENST00000334187.8	37	c.373		20	.	.	.	.	.	.	.	.	.	.	G	28.8	4.951010	0.92660	.	.	ENSG00000124224	ENST00000457990	.	.	.	5.5	5.5	0.81552	.	.	.	.	.	T	0.75406	0.3845	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.73610	-0.3928	4	.	.	.	.	19.3852	0.94554	0.0:0.0:1.0:0.0	.	.	.	.	R	32	.	.	P	-	2	0	PPP4R1L	56248247	1.000000	0.71417	0.988000	0.46212	0.952000	0.60782	9.062000	0.93920	2.570000	0.86706	0.650000	0.86243	CCA	PPP4R1L	-	NULL	ENSG00000124224		0.532	PPP4R1L-201	KNOWN	basic|appris_candidate_longest	protein_coding	PPP4R1L	HGNC	protein_coding		-	0.00	30	0	G	NR_003505		56814841	-1	tier1	-	no_errors	ENST00000497138	ensembl	human	known	74_37	missense	26.09	17	6	SNP	1.000	C
PPP4R4	57718	genome.wustl.edu	37	14	94712823	94712823	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr14:94712823G>C	ENST00000304338.3	+	14	1712	c.1558G>C	c.(1558-1560)Gat>Cat	p.D520H		NM_058237.1	NP_478144.1	Q6NUP7	PP4R4_HUMAN	protein phosphatase 4, regulatory subunit 4	520					negative regulation of phosphoprotein phosphatase activity (GO:0032515)|regulation of protein serine/threonine phosphatase activity (GO:0080163)	cytoplasm (GO:0005737)|protein serine/threonine phosphatase complex (GO:0008287)	protein phosphatase regulator activity (GO:0019888)	p.D520N(1)		NS(1)|breast(2)|central_nervous_system(1)|kidney(2)|large_intestine(15)|lung(10)|skin(7)|upper_aerodigestive_tract(2)	40						CATATCAAGCGATCAGATTTA	0.403																																																	1	Substitution - Missense(1)	central_nervous_system(1)											120.0	118.0	118.0					14																	94712823		2203	4300	6503	SO:0001583	missense	0			AB046842, BC068491	CCDS9921.1, CCDS9922.1	14q32.2	2014-07-18	2008-09-16	2008-09-16	ENSG00000119698	ENSG00000119698		"""Serine/threonine phosphatases / Protein phosphatase 4, regulatory subunits"""	23788	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 14"""		"""KIAA1622"""	KIAA1622		18715871	Standard	NM_020958		Approved	PP4R4, CFAP14	uc001ycs.1	Q6NUP7		ENST00000304338.3:c.1558G>C	14.37:g.94712823G>C	ENSP00000305924:p.Asp520His		Q9BUF8|Q9HCF0	Missense_Mutation	SNP	superfamily_ARM-type_fold,pfscan_HEAT_type_2	p.D520H	ENST00000304338.3	37	c.1558	CCDS9921.1	14	.	.	.	.	.	.	.	.	.	.	G	25.1	4.604205	0.87157	.	.	ENSG00000119698	ENST00000304338	T	0.34472	1.36	5.78	5.78	0.91487	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.64000	0.2559	M	0.76574	2.34	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.64664	-0.6354	10	0.87932	D	0	-21.5366	20.3681	0.98887	0.0:0.0:1.0:0.0	.	520	Q6NUP7	PP4R4_HUMAN	H	520	ENSP00000305924:D520H	ENSP00000305924:D520H	D	+	1	0	PPP4R4	93782576	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	8.601000	0.90864	2.890000	0.99128	0.655000	0.94253	GAT	PPP4R4	-	superfamily_ARM-type_fold	ENSG00000119698		0.403	PPP4R4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP4R4	HGNC	protein_coding	OTTHUMT00000413056.1	-	0.00	36	0	G	NM_058237		94712823	+1	tier1	-	no_errors	ENST00000304338	ensembl	human	known	74_37	missense	38.89	33	21	SNP	1.000	C
PRKCB	5579	genome.wustl.edu	37	16	24105592	24105592	+	Missense_Mutation	SNP	A	A	T			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr16:24105592A>T	ENST00000321728.7	+	7	970	c.795A>T	c.(793-795)gaA>gaT	p.E265D	PRKCB_ENST00000482000.1_3'UTR|PRKCB_ENST00000303531.7_Missense_Mutation_p.E265D	NM_212535.2	NP_997700.1	P05771	KPCB_HUMAN	protein kinase C, beta	265					apoptotic process (GO:0006915)|B cell activation (GO:0042113)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|calcium ion transport (GO:0006816)|cellular calcium ion homeostasis (GO:0006874)|cellular response to carbohydrate stimulus (GO:0071322)|histone H3-T6 phosphorylation (GO:0035408)|intracellular signal transduction (GO:0035556)|lipoprotein transport (GO:0042953)|negative regulation of glucose transport (GO:0010829)|negative regulation of insulin receptor signaling pathway (GO:0046627)|platelet activation (GO:0030168)|positive regulation of angiogenesis (GO:0045766)|positive regulation of B cell receptor signaling pathway (GO:0050861)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein phosphorylation (GO:0006468)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	androgen receptor binding (GO:0050681)|ATP binding (GO:0005524)|calcium channel regulator activity (GO:0005246)|chromatin binding (GO:0003682)|histone binding (GO:0042393)|histone kinase activity (H3-T6 specific) (GO:0035403)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|protein kinase C activity (GO:0004697)|protein kinase C binding (GO:0005080)|protein serine/threonine kinase activity (GO:0004674)|zinc ion binding (GO:0008270)			central_nervous_system(3)|large_intestine(1)|lung(2)|ovary(3)	9					Tamoxifen(DB00675)|Vitamin E(DB00163)	GGATTTCTGAACTTCAGAAAG	0.433																																																	0													152.0	138.0	143.0					16																	24105592		2197	4300	6497	SO:0001583	missense	0			M13975	CCDS10618.1, CCDS10619.1	16p12	2009-07-10	2008-08-18	2008-08-18	ENSG00000166501	ENSG00000166501	2.7.11.1		9395	protein-coding gene	gene with protein product		176970	"""protein kinase C, beta 1"""	PRKCB2, PKCB, PRKCB1		3658678	Standard	NM_002738		Approved		uc002dme.3	P05771	OTTHUMG00000131615	ENST00000321728.7:c.795A>T	16.37:g.24105592A>T	ENSP00000318315:p.Glu265Asp		C5IFJ8|D3DWF5|O43744|P05127|Q15138|Q93060|Q9UE49|Q9UE50|Q9UEH8|Q9UJ30|Q9UJ33	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_C2_dom,pfam_Pkinase_C,superfamily_Kinase-like_dom,superfamily_C2_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_C2_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pirsf_Protein_kinase_C_a/b/g,pfscan_C2_dom,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_dom,prints_DAG/PE-bd,prints_C2_dom	p.E265D	ENST00000321728.7	37	c.795	CCDS10618.1	16	.	.	.	.	.	.	.	.	.	.	A	23.2	4.384838	0.82792	.	.	ENSG00000166501	ENST00000321728;ENST00000303531	T;T	0.40756	1.02;1.02	5.52	-3.37	0.04898	C2 calcium-dependent membrane targeting (1);C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.85682	D	0.000000	T	0.62744	0.2453	M	0.88105	2.93	0.58432	D	0.99999	D;D	0.61080	0.989;0.981	D;P	0.66497	0.944;0.844	T	0.69669	-0.5083	10	0.40728	T	0.16	.	15.0193	0.71617	0.2833:0.0:0.7167:0.0	.	265;265	P05771-2;P05771	.;KPCB_HUMAN	D	265	ENSP00000318315:E265D;ENSP00000305355:E265D	ENSP00000305355:E265D	E	+	3	2	PRKCB	24013093	1.000000	0.71417	0.989000	0.46669	0.932000	0.56968	1.008000	0.29872	-0.433000	0.07286	-0.290000	0.09829	GAA	PRKCB	-	superfamily_C2_dom,smart_C2_dom,pirsf_Protein_kinase_C_a/b/g	ENSG00000166501		0.433	PRKCB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKCB	HGNC	protein_coding	OTTHUMT00000254504.2	-	0.00	39	0	A	NM_212535		24105592	+1	tier1	-	no_errors	ENST00000303531	ensembl	human	known	74_37	missense	37.50	44	27	SNP	0.999	T
PROM1	8842	genome.wustl.edu	37	4	16010698	16010698	+	Missense_Mutation	SNP	T	T	C			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr4:16010698T>C	ENST00000510224.1	-	12	1423	c.1175A>G	c.(1174-1176)gAt>gGt	p.D392G	PROM1_ENST00000540805.1_Missense_Mutation_p.D392G|RNU6-350P_ENST00000515949.1_RNA|PROM1_ENST00000505450.1_Missense_Mutation_p.D383G|PROM1_ENST00000539194.1_Missense_Mutation_p.D392G|PROM1_ENST00000508167.1_Missense_Mutation_p.D383G|PROM1_ENST00000543373.1_Missense_Mutation_p.D383G|PROM1_ENST00000447510.2_Missense_Mutation_p.D392G			O43490	PROM1_HUMAN	prominin 1	392					camera-type eye photoreceptor cell differentiation (GO:0060219)|glomerular parietal epithelial cell differentiation (GO:0072139)|glomerular visceral epithelial cell differentiation (GO:0072112)|photoreceptor cell maintenance (GO:0045494)|positive regulation of nephron tubule epithelial cell differentiation (GO:2000768)|retina layer formation (GO:0010842)|retina morphogenesis in camera-type eye (GO:0060042)	apical plasma membrane (GO:0016324)|brush border (GO:0005903)|cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|photoreceptor outer segment (GO:0001750)|photoreceptor outer segment membrane (GO:0042622)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|vesicle (GO:0031982)	actinin binding (GO:0042805)|cadherin binding (GO:0045296)			breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(4)|liver(1)|lung(11)|ovary(3)|pancreas(1)|upper_aerodigestive_tract(2)	35						ATTGTCGATATCTGAACCAAT	0.348																																																	0													82.0	76.0	78.0					4																	16010698		1859	4094	5953	SO:0001583	missense	0			AF027208	CCDS47029.1, CCDS54746.1, CCDS54747.1, CCDS54748.1	4p15	2013-06-06	2001-11-28	2003-03-28	ENSG00000007062	ENSG00000007062		"""CD molecules"""	9454	protein-coding gene	gene with protein product		604365	"""prominin (mouse)-like 1"", ""macular dystrophy, retinal 2"", ""Stargardt disease 4 (autosomal dominant)"""	PROML1, MCDR2, STGD4		11467842	Standard	NM_006017		Approved	AC133, CD133, RP41, CORD12	uc003goo.2	O43490	OTTHUMG00000160180	ENST00000510224.1:c.1175A>G	4.37:g.16010698T>C	ENSP00000426809:p.Asp392Gly		Q6SV49|Q6SV50|Q6SV51|Q6SV52|Q6SV53|Q96EN6	Missense_Mutation	SNP	pfam_Prominin	p.D392G	ENST00000510224.1	37	c.1175	CCDS47029.1	4	.	.	.	.	.	.	.	.	.	.	T	12.81	2.050603	0.36181	.	.	ENSG00000007062	ENST00000447510;ENST00000540805;ENST00000539194;ENST00000505450;ENST00000508167;ENST00000510224;ENST00000543373	T;T;T;T;T;T;T	0.77358	-1.09;-1.09;-1.09;-1.09;-1.09;-1.09;-1.09	5.52	0.346	0.16017	.	1.165200	0.06030	N	0.652957	T	0.75206	0.3818	L	0.34521	1.04	0.09310	N	1	P;P;P;P;P;P	0.51933	0.73;0.73;0.73;0.73;0.792;0.949	B;B;B;B;B;P	0.53722	0.406;0.406;0.312;0.406;0.194;0.733	T	0.62020	-0.6942	10	0.24483	T	0.36	-11.5056	8.2098	0.31478	0.0:0.3191:0.0:0.6809	.	383;392;383;392;383;392	O43490-5;O43490-6;O43490-4;O43490-7;O43490-2;O43490	.;.;.;.;.;PROM1_HUMAN	G	392;392;392;383;383;392;383	ENSP00000415481:D392G;ENSP00000438045:D392G;ENSP00000443620:D392G;ENSP00000426090:D383G;ENSP00000427346:D383G;ENSP00000426809:D392G;ENSP00000445526:D383G	ENSP00000415481:D392G	D	-	2	0	PROM1	15619796	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.442000	0.21628	-0.139000	0.11414	-0.290000	0.09829	GAT	PROM1	-	pfam_Prominin	ENSG00000007062		0.348	PROM1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PROM1	HGNC	protein_coding	OTTHUMT00000359595.2	-	0.00	30	0	T	NM_006017		16010698	-1	tier1	-	no_errors	ENST00000447510	ensembl	human	known	74_37	missense	40.54	22	15	SNP	0.000	C
PRKG2	5593	genome.wustl.edu	37	4	82027067	82027067	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr4:82027067G>T	ENST00000395578.1	-	16	2079	c.1963C>A	c.(1963-1965)Caa>Aaa	p.Q655K	PRKG2_ENST00000509169.1_5'UTR|PRKG2_ENST00000545647.1_Missense_Mutation_p.Q235K|PRKG2_ENST00000418486.2_Missense_Mutation_p.Q626K|PRKG2_ENST00000264399.1_Missense_Mutation_p.Q655K			Q13237	KGP2_HUMAN	protein kinase, cGMP-dependent, type II	655	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				blood coagulation (GO:0007596)|circadian regulation of gene expression (GO:0032922)|nitric oxide metabolic process (GO:0046209)|protein phosphorylation (GO:0006468)|regulation of nitric-oxide synthase activity (GO:0050999)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cGMP binding (GO:0030553)|cGMP-dependent protein kinase activity (GO:0004692)|protein kinase activity (GO:0004672)			NS(1)|breast(4)|central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(7)|lung(14)|ovary(1)|skin(2)	37						GTCATCATTTGGTCAACCCCA	0.403																																																	0													96.0	95.0	95.0					4																	82027067		2203	4300	6503	SO:0001583	missense	0			X94612	CCDS3589.1, CCDS75150.1	4q13.1-q21.1	2009-07-10			ENSG00000138669	ENSG00000138669	2.7.11.1		9416	protein-coding gene	gene with protein product		601591				7498513	Standard	XM_005263126		Approved	cGKII, PRKGR2	uc003hmh.2	Q13237	OTTHUMG00000130296	ENST00000395578.1:c.1963C>A	4.37:g.82027067G>T	ENSP00000378945:p.Gln655Lys		B4DMX3|E7EPE6|O00125|O60916	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_cNMP-bd_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pirsf_cGMP-dependent_protein_kinase,pfscan_cNMP-bd_dom,pfscan_Prot_kinase_dom,prints_cGMP_dep_kinase,prints_cAMP/cGMP_kin	p.Q655K	ENST00000395578.1	37	c.1963	CCDS3589.1	4	.	.	.	.	.	.	.	.	.	.	g	20.4	3.989492	0.74589	.	.	ENSG00000138669	ENST00000395578;ENST00000264399;ENST00000418486;ENST00000545647	T;T;T;T	0.65916	-0.18;-0.18;-0.18;-0.18	5.41	5.41	0.78517	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.052041	0.85682	D	0.000000	T	0.69052	0.3068	L	0.42744	1.35	0.80722	D	1	B;B	0.29571	0.022;0.249	B;P	0.45538	0.074;0.484	T	0.70063	-0.4975	10	0.72032	D	0.01	-16.7794	18.7774	0.91916	0.0:0.0:1.0:0.0	.	626;655	E7EPE6;Q13237	.;KGP2_HUMAN	K	655;655;626;235	ENSP00000378945:Q655K;ENSP00000264399:Q655K;ENSP00000389038:Q626K;ENSP00000439967:Q235K	ENSP00000264399:Q655K	Q	-	1	0	PRKG2	82246091	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	9.595000	0.98260	2.553000	0.86117	0.491000	0.48974	CAA	PRKG2	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_cGMP-dependent_protein_kinase,pfscan_Prot_kinase_dom	ENSG00000138669		0.403	PRKG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKG2	HGNC	protein_coding	OTTHUMT00000252639.1	-	0.00	38	0	G	NM_006259		82027067	-1	tier1	-	no_errors	ENST00000264399	ensembl	human	known	74_37	missense	30.56	25	11	SNP	1.000	T
PRRC2B	84726	genome.wustl.edu	37	9	134346214	134346214	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr9:134346214C>T	ENST00000357304.4	+	13	2006	c.1951C>T	c.(1951-1953)Ccc>Tcc	p.P651S	PRRC2B_ENST00000372249.1_5'UTR|PRRC2B_ENST00000458550.1_Missense_Mutation_p.P651S|PRRC2B_ENST00000405995.1_Missense_Mutation_p.P651S	NM_013318.3	NP_037450.2	Q5JSZ5	PRC2B_HUMAN	proline-rich coiled-coil 2B	651							poly(A) RNA binding (GO:0044822)			cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(20)|ovary(2)	44						GCCGGTGTACCCCCCGCCGTC	0.627																																																	0													27.0	32.0	30.0					9																	134346214		2105	4221	6326	SO:0001583	missense	0			AB011087	CCDS48044.1	9q34.13	2010-12-09	2010-12-09	2010-12-09	ENSG00000130723	ENSG00000130723			28121	protein-coding gene	gene with protein product			"""KIAA0515"", ""HLA-B associated transcript 2-like"", ""HLA-B associated transcript 2-like 1"""	KIAA0515, BAT2L, BAT2L1		9628581	Standard	NM_013318		Approved	MGC10526, LQFBS-1	uc004can.4	Q5JSZ5	OTTHUMG00000020827	ENST00000357304.4:c.1951C>T	9.37:g.134346214C>T	ENSP00000349856:p.Pro651Ser		O60270|Q5JSZ7|Q66VZ2|Q68CR0|Q96EI9|Q9H683	Missense_Mutation	SNP	pfam_BAT2_N	p.P651S	ENST00000357304.4	37	c.1951	CCDS48044.1	9	.	.	.	.	.	.	.	.	.	.	C	16.49	3.136827	0.56936	.	.	ENSG00000130723	ENST00000405995;ENST00000357304;ENST00000458550	T;T;T	0.16457	2.34;2.34;2.34	5.71	5.71	0.89125	.	0.000000	0.41605	U	0.000857	T	0.32285	0.0824	L	0.55213	1.73	0.80722	D	1	D	0.63880	0.993	P	0.56343	0.796	T	0.00494	-1.1706	10	0.25106	T	0.35	-0.5704	18.8439	0.92196	0.0:1.0:0.0:0.0	.	651	Q5JSZ5	PRC2B_HUMAN	S	651	ENSP00000384606:P651S;ENSP00000349856:P651S;ENSP00000398853:P651S	ENSP00000349856:P651S	P	+	1	0	PRRC2B	133336035	1.000000	0.71417	0.998000	0.56505	0.633000	0.38033	5.731000	0.68554	2.707000	0.92482	0.655000	0.94253	CCC	PRRC2B	-	NULL	ENSG00000130723		0.627	PRRC2B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	PRRC2B	HGNC	protein_coding			0.00	20	0	C			134346214	+1			no_errors	ENST00000357304	ensembl	human	known	74_37	missense	23.53	13	4	SNP	1.000	T
PRTN3	5657	genome.wustl.edu	37	19	846216	846216	+	Frame_Shift_Del	DEL	C	C	-			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr19:846216delC	ENST00000234347.5	+	4	485	c.439delC	c.(439-441)cccfs	p.P147fs	PRTN3_ENST00000544537.2_Frame_Shift_Del_p.P106fs	NM_002777.3	NP_002768.3	P24158	PRTN3_HUMAN	proteinase 3	147	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				collagen catabolic process (GO:0030574)|mature dendritic cell differentiation (GO:0097029)|negative regulation of phagocytosis (GO:0050765)|positive regulation of cell proliferation (GO:0008284)	cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			lung(1)|ovary(2)|urinary_tract(1)	4		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;6.59e-06)|all_lung(49;9.97e-06)|Breast(49;0.000172)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CCAGCCAGTGCCCCACGGCAC	0.701																																																	0													22.0	18.0	19.0					19																	846216		2169	4248	6417	SO:0001589	frameshift_variant	0				CCDS32860.1	19p13.3	2008-07-31	2008-07-31			ENSG00000196415			9495	protein-coding gene	gene with protein product	"""myeloblastin"", ""serine proteinase, neutrophil"", ""Wegener granulomatosis autoantigen"""	177020				2258701	Standard	NM_002777		Approved	PR-3, ACPA, C-ANCA, AGP7, MBT, P29	uc002lqa.1	P24158		ENST00000234347.5:c.439delC	19.37:g.846216delC	ENSP00000234347:p.Pro147fs		P15637|P18078|Q4VB08|Q4VB09|Q6LBM7|Q6LBN2|Q9UD25|Q9UQD8	Frame_Shift_Del	DEL	pfam_Peptidase_S1,pfam_Peptidase_S1A_nudel,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1,prints_Peptidase_S1A	p.H148fs	ENST00000234347.5	37	c.439	CCDS32860.1	19																																																																																			PRTN3	-	pfam_Peptidase_S1,pfam_Peptidase_S1A_nudel,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1	ENSG00000196415		0.701	PRTN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRTN3	HGNC	protein_coding	OTTHUMT00000457888.2		0.00	25	0	C	NM_002777		846216	+1	tier1		no_errors	ENST00000234347	ensembl	human	known	74_37	frame_shift_del	34.21	25	13	DEL	0.001	-
PSAP	5660	genome.wustl.edu	37	10	73587809	73587809	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr10:73587809C>G	ENST00000394936.3	-	6	829	c.682G>C	c.(682-684)Gag>Cag	p.E228Q	PSAP_ENST00000394934.1_Missense_Mutation_p.E228Q			P07602	SAP_HUMAN	prosaposin	228	Saposin B-type 2. {ECO:0000255|PROSITE- ProRule:PRU00415}.				blood coagulation (GO:0007596)|cellular response to organic substance (GO:0071310)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|glycosphingolipid metabolic process (GO:0006687)|lipid transport (GO:0006869)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of catalytic activity (GO:0043085)|prostate gland growth (GO:0060736)|regulation of lipid metabolic process (GO:0019216)|regulation of MAPK cascade (GO:0043408)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal lumen (GO:0043202)|lysosomal membrane (GO:0005765)|mitochondrion (GO:0005739)	enzyme activator activity (GO:0008047)|lipid binding (GO:0008289)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	13						TCACACTCCTCCTTGACATGT	0.582																																																	0													146.0	105.0	119.0					10																	73587809		2203	4300	6503	SO:0001583	missense	0			BC004275	CCDS7311.1	10q21-q22	2014-01-30	2008-07-31		ENSG00000197746	ENSG00000197746		"""Endogenous ligands"""	9498	protein-coding gene	gene with protein product	"""variant Gaucher disease and variant metachromatic leukodystrophy"""	176801	"""sphingolipid activator protein-1"""	SAP1, GLBA		2717620	Standard	NM_001042465		Approved		uc001jsm.3	P07602	OTTHUMG00000018429	ENST00000394936.3:c.682G>C	10.37:g.73587809C>G	ENSP00000378394:p.Glu228Gln		P07292|P15793|P78538|P78541|P78546|P78547|P78558|Q53Y86|Q6IBQ6|Q92739|Q92740|Q92741|Q92742	Missense_Mutation	SNP	pirsf_Saposin_chordata,pfam_SapB_1,pfam_SapB_2,pfam_SapA,superfamily_Saposin-like,smart_SapA,smart_SaposinB,prints_Saposin,pfscan_SapA,pfscan_SaposinB	p.E228Q	ENST00000394936.3	37	c.682	CCDS7311.1	10	.	.	.	.	.	.	.	.	.	.	C	15.10	2.732196	0.48939	.	.	ENSG00000197746	ENST00000394936;ENST00000373120;ENST00000357471;ENST00000394934;ENST00000404083;ENST00000394940	D;D	0.84370	-1.84;-1.84	5.6	5.6	0.85130	Saposin-like (2);Saposin-like type B, 1 (1);Saposin B (2);	0.428540	0.29745	N	0.011308	D	0.85557	0.5724	M	0.67953	2.075	0.41463	D	0.988056	B	0.25272	0.122	B	0.35312	0.2	T	0.80979	-0.1140	10	0.27082	T	0.32	-10.6703	15.1294	0.72511	0.0:0.8589:0.1411:0.0	.	228	P07602	SAP_HUMAN	Q	228;228;228;228;231;153	ENSP00000378394:E228Q;ENSP00000378392:E228Q	ENSP00000350063:E228Q	E	-	1	0	PSAP	73257815	0.946000	0.32159	0.996000	0.52242	0.913000	0.54294	0.333000	0.19768	2.802000	0.96397	0.542000	0.68232	GAG	PSAP	-	pirsf_Saposin_chordata,pfam_SapB_1,superfamily_Saposin-like,smart_SaposinB,pfscan_SaposinB	ENSG00000197746		0.582	PSAP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PSAP	HGNC	protein_coding	OTTHUMT00000048553.1	-	0.00	38	0	C	NM_002778		73587809	-1	tier1	-	no_errors	ENST00000394934	ensembl	human	known	74_37	missense	20.37	43	11	SNP	1.000	G
PSMD8	5714	genome.wustl.edu	37	19	38865577	38865577	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr19:38865577C>G	ENST00000215071.4	+	1	402	c.336C>G	c.(334-336)tgC>tgG	p.C112W	PSMD8_ENST00000592035.1_5'Flank|PSMD8_ENST00000602911.1_Missense_Mutation_p.C49W	NM_002812.4	NP_002803.2	P48556	PSMD8_HUMAN	proteasome (prosome, macropain) 26S subunit, non-ATPase, 8	112					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)|proteasome regulatory particle (GO:0005838)				central_nervous_system(2)|endometrium(1)|large_intestine(2)|lung(1)	6	all_cancers(60;3.4e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)			TTAGCAAGTGCGGGGAAGAGC	0.632																																																	0													19.0	10.0	13.0					19																	38865577		1998	4010	6008	SO:0001583	missense	0			D38047	CCDS12515.2	19q13.2	2009-05-07			ENSG00000099341	ENSG00000099341		"""Proteasome (prosome, macropain) subunits"""	9566	protein-coding gene	gene with protein product						7621825	Standard	NM_002812		Approved	S14, Nin1p, p31, HIP6, HYPF, Rpn12	uc002oii.4	P48556	OTTHUMG00000150691	ENST00000215071.4:c.336C>G	19.37:g.38865577C>G	ENSP00000215071:p.Cys112Trp		B4DX18|Q6P1L7	Missense_Mutation	SNP	pfam_SAC3/GANP/Nin1/mts3/eIF-3-p25	p.C112W	ENST00000215071.4	37	c.336	CCDS12515.2	19	.	.	.	.	.	.	.	.	.	.	C	18.96	3.733129	0.69189	.	.	ENSG00000099341	ENST00000215071	.	.	.	4.91	-0.271	0.12922	.	0.000000	0.85682	D	0.000000	T	0.76321	0.3971	M	0.86573	2.825	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.73839	-0.3856	9	0.87932	D	0	-30.5549	6.9147	0.24354	0.0:0.5151:0.0:0.4849	.	112	P48556	PSMD8_HUMAN	W	112	.	ENSP00000215071:C112W	C	+	3	2	PSMD8	43557417	1.000000	0.71417	0.996000	0.52242	0.969000	0.65631	0.652000	0.24888	-0.100000	0.12241	0.555000	0.69702	TGC	PSMD8	-	NULL	ENSG00000099341		0.632	PSMD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSMD8	HGNC	protein_coding	OTTHUMT00000319627.1	-	0.00	33	0	C	NM_002812		38865577	+1	tier1	-	no_errors	ENST00000215071	ensembl	human	known	74_37	missense	14.43	83	14	SNP	1.000	G
PYGM	5837	genome.wustl.edu	37	11	64519395	64519395	+	Splice_Site	DEL	C	C	-			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr11:64519395delC	ENST00000164139.3	-	14	2167		c.e14+1		PYGM_ENST00000462303.1_Splice_Site|PYGM_ENST00000377432.3_Splice_Site	NM_005609.2	NP_005600.1	P11217	PYGM_HUMAN	phosphorylase, glycogen, muscle						carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|glycogen metabolic process (GO:0005977)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	glycogen phosphorylase activity (GO:0008184)|nucleotide binding (GO:0000166)|pyridoxal phosphate binding (GO:0030170)			cervix(1)|endometrium(2)|kidney(3)|large_intestine(4)|lung(21)|ovary(3)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						CTGCCACTCACGGTTGTACAG	0.522																																																	0			GRCh37	CS941537	PYGM	S							106.0	96.0	99.0					11																	64519395		2201	4297	6498	SO:0001630	splice_region_variant	0				CCDS8079.1, CCDS53659.1	11q12-q13.2	2013-03-01	2008-07-31		ENSG00000068976	ENSG00000068976	2.4.1.1	"""Glycogen phosphorylases"""	9726	protein-coding gene	gene with protein product	"""McArdle syndrome"", ""glycogen storage disease type V"", ""glycogen phosphorylase, muscle form"""	608455	"""phosphorylase, glycogen; muscle"""				Standard	NM_005609		Approved		uc001oax.4	P11217	OTTHUMG00000066835	ENST00000164139.3:c.1768+1G>-	11.37:g.64519395delC			A0AVK1|A6NDY6	Splice_Site	DEL	-	e14+1	ENST00000164139.3	37	c.1768+1	CCDS8079.1	11																																																																																			PYGM	-	-	ENSG00000068976		0.522	PYGM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PYGM	HGNC	protein_coding	OTTHUMT00000143254.2		0.00	119	0	C	NM_005609	Intron	64519395	-1			no_errors	ENST00000164139	ensembl	human	known	74_37	splice_site_del	8.33	88	8	DEL	1.000	0
R3HDM2	22864	genome.wustl.edu	37	12	57704142	57704142	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr12:57704142C>T	ENST00000347140.3	-	3	460	c.70G>A	c.(70-72)Gaa>Aaa	p.E24K	R3HDM2_ENST00000403821.2_Missense_Mutation_p.E24K|R3HDM2_ENST00000402412.1_Missense_Mutation_p.E24K|R3HDM2_ENST00000358907.2_Missense_Mutation_p.E24K			Q9Y2K5	R3HD2_HUMAN	R3H domain containing 2	24						nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(3)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	22						TTTACAGATTCTTCCACCAGT	0.363																																																	0													347.0	269.0	293.0					12																	57704142		692	1591	2283	SO:0001583	missense	0			AB023219	CCDS8937.2	12q13.3	2012-11-19			ENSG00000179912	ENSG00000179912			29167	protein-coding gene	gene with protein product							Standard	NM_014925		Approved	KIAA1002	uc009zpm.1	Q9Y2K5	OTTHUMG00000171568	ENST00000347140.3:c.70G>A	12.37:g.57704142C>T	ENSP00000317903:p.Glu24Lys		Q2M1T9|Q3ZCT5	Missense_Mutation	SNP	pfam_R3H_ss-bd,smart_R3H_ss-bd,pfscan_R3H_ss-bd	p.E24K	ENST00000347140.3	37	c.70	CCDS8937.2	12	.	.	.	.	.	.	.	.	.	.	C	32	5.113218	0.94339	.	.	ENSG00000179912	ENST00000347140;ENST00000402412;ENST00000358907;ENST00000403821;ENST00000448732	T;T;T;T	0.25085	1.82;1.82;1.82;1.82	4.88	4.88	0.63580	.	0.000000	0.64402	D	0.000001	T	0.37320	0.0999	L	0.29908	0.895	0.80722	D	1	P;P	0.52842	0.956;0.956	P;P	0.62184	0.899;0.899	T	0.04216	-1.0968	10	0.42905	T	0.14	-11.9405	17.4112	0.87486	0.0:1.0:0.0:0.0	.	24;24	B5MCU0;Q9Y2K5	.;R3HD2_HUMAN	K	24	ENSP00000317903:E24K;ENSP00000385839:E24K;ENSP00000351784:E24K;ENSP00000385169:E24K	ENSP00000317903:E24K	E	-	1	0	R3HDM2	55990409	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.776000	0.62354	2.740000	0.93945	0.555000	0.69702	GAA	R3HDM2	-	NULL	ENSG00000179912		0.363	R3HDM2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	R3HDM2	HGNC	protein_coding	OTTHUMT00000326570.2	-	0.00	58	0	C	NM_014925		57704142	-1	tier1	-	no_errors	ENST00000347140	ensembl	human	known	74_37	missense	23.46	62	19	SNP	1.000	T
RABGGTB	5876	genome.wustl.edu	37	1	76255288	76255288	+	Intron	SNP	G	G	T			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr1:76255288G>T	ENST00000319942.3	+	3	380				SNORD45B_ENST00000364617.1_RNA|SNORD45C_ENST00000383893.1_RNA|RABGGTB_ENST00000535300.1_Intron|RABGGTB_ENST00000370826.3_Intron|RABGGTB_ENST00000496055.1_3'UTR|SNORD45A_ENST00000384512.1_RNA	NM_004582.3	NP_004573.2	P53611	PGTB2_HUMAN	Rab geranylgeranyltransferase, beta subunit						cellular protein modification process (GO:0006464)|protein geranylgeranylation (GO:0018344)|visual perception (GO:0007601)	Rab-protein geranylgeranyltransferase complex (GO:0005968)	Rab geranylgeranyltransferase activity (GO:0004663)|Rab GTPase binding (GO:0017137)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(7)|ovary(1)	19						TAGCTAAATGGAGCTATTTGA	0.358																																																	0																																										SO:0001627	intron_variant	0			U49245	CCDS669.1	1p31	2008-02-05			ENSG00000137955	ENSG00000137955			9796	protein-coding gene	gene with protein product		179080				8706741, 8954794	Standard	NM_004582		Approved		uc001dgy.2	P53611	OTTHUMG00000009786	ENST00000319942.3:c.309+247G>T	1.37:g.76255288G>T			Q92697	RNA	SNP	-	NULL	ENST00000319942.3	37	NULL	CCDS669.1	1																																																																																			RABGGTB	-	-	ENSG00000137955		0.358	RABGGTB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RABGGTB	HGNC	protein_coding	OTTHUMT00000026972.1	-	0.00	37	0	G	NM_004582		76255288	+1	tier1	-	no_errors	ENST00000461653	ensembl	human	known	74_37	rna	22.22	35	10	SNP	0.006	T
RAB3GAP2	25782	genome.wustl.edu	37	1	220387305	220387305	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr1:220387305G>C	ENST00000358951.2	-	3	313	c.197C>G	c.(196-198)aCt>aGt	p.T66S		NM_012414.3	NP_036546.2	Q9H2M9	RBGPR_HUMAN	RAB3 GTPase activating protein subunit 2 (non-catalytic)	66					establishment of protein localization to endoplasmic reticulum membrane (GO:0097051)|intracellular protein transport (GO:0006886)|positive regulation of catalytic activity (GO:0043085)|positive regulation of endoplasmic reticulum tubular network organization (GO:1903373)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Rab GTPase activity (GO:0032851)|regulation of GTPase activity (GO:0043087)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	enzyme activator activity (GO:0008047)|enzyme regulator activity (GO:0030234)|GTPase activator activity (GO:0005096)|protein heterodimerization activity (GO:0046982)|Rab GTPase binding (GO:0017137)			breast(1)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(8)|lung(13)|ovary(1)|pancreas(1)|prostate(4)|skin(1)|urinary_tract(1)	39				GBM - Glioblastoma multiforme(131;0.0443)		TGTTTTGCAAGTATTTCCTTC	0.393																																																	0													108.0	102.0	104.0					1																	220387305		2202	4300	6502	SO:0001583	missense	0			AB020646	CCDS31028.1	1q41	2014-03-03			ENSG00000118873	ENSG00000118873			17168	protein-coding gene	gene with protein product		609275				15696165, 16532399, 24482476	Standard	NM_012414		Approved	RAB3-GAP150, KIAA0839, DKFZP434D245, SPG69	uc010puk.1	Q9H2M9	OTTHUMG00000037139	ENST00000358951.2:c.197C>G	1.37:g.220387305G>C	ENSP00000351832:p.Thr66Ser		A6H8V0|O75872|Q9HAB0|Q9UFJ7|Q9UQ15	Missense_Mutation	SNP	superfamily_WD40_repeat_dom	p.T66S	ENST00000358951.2	37	c.197	CCDS31028.1	1	.	.	.	.	.	.	.	.	.	.	G	6.860	0.527932	0.13127	.	.	ENSG00000118873	ENST00000358951	T	0.29397	1.57	5.7	2.82	0.32997	.	0.837021	0.11347	N	0.573406	T	0.10766	0.0263	N	0.02011	-0.69	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.33929	-0.9849	10	0.08179	T	0.78	.	8.7065	0.34358	0.1377:0.1255:0.7368:0.0	.	66;66	Q9H2M9-2;Q9H2M9	.;RBGPR_HUMAN	S	66	ENSP00000351832:T66S	ENSP00000351832:T66S	T	-	2	0	RAB3GAP2	218453928	0.506000	0.26139	0.000000	0.03702	0.624000	0.37722	2.613000	0.46351	0.342000	0.23796	0.591000	0.81541	ACT	RAB3GAP2	-	NULL	ENSG00000118873		0.393	RAB3GAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAB3GAP2	HGNC	protein_coding	OTTHUMT00000090205.2	-	0.00	86	0	G	NM_012414		220387305	-1	tier1	-	no_errors	ENST00000358951	ensembl	human	known	74_37	missense	54.81	61	74	SNP	0.005	C
RASGRP4	115727	genome.wustl.edu	37	19	38904097	38904097	+	Silent	SNP	G	G	A			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr19:38904097G>A	ENST00000587738.1	-	10	1318	c.1248C>T	c.(1246-1248)ttC>ttT	p.F416F	RASGRP4_ENST00000433821.2_Silent_p.F324F|RASGRP4_ENST00000454404.2_Silent_p.F382F|RASGRP4_ENST00000587753.1_Silent_p.F347F|RASGRP4_ENST00000293062.9_Silent_p.F319F|RASGRP4_ENST00000426920.2_Silent_p.F227F|RASGRP4_ENST00000586305.1_Silent_p.F402F			Q8TDF6	GRP4_HUMAN	RAS guanyl releasing protein 4	416	Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00168}.				activation of phospholipase C activity (GO:0007202)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|myeloid cell differentiation (GO:0030099)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Ras protein signal transduction (GO:0046579)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|response to extracellular stimulus (GO:0009991)|small GTPase mediated signal transduction (GO:0007264)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytoplasm (GO:0005737)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|diacylglycerol binding (GO:0019992)|GTP-dependent protein binding (GO:0030742)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)			cervix(1)|kidney(1)|large_intestine(4)|lung(12)|pancreas(1)|prostate(3)|skin(1)	23	all_cancers(60;4.21e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)			CTTCCGTGTAGAAGAGGTCCA	0.597																																																	0													30.0	37.0	35.0					19																	38904097		2020	4174	6194	SO:0001819	synonymous_variant	0			AY048119	CCDS46068.1, CCDS54262.1, CCDS54263.1, CCDS54264.1	19q13.1	2013-01-10						"""EF-hand domain containing"""	18958	protein-coding gene	gene with protein product		607320				11956218	Standard	NM_170604		Approved		uc021uub.1	Q8TDF6		ENST00000587738.1:c.1248C>T	19.37:g.38904097G>A			A6H8M4|C0LTP2|C0LTP3|C0LTP4|C0LTP5|C0LTP7|C9J416|C9JHZ1|Q8N858|Q96QN5|Q96QN6|Q96QN7	Silent	SNP	pfam_RasGRF_CDC25,pfam_Prot_Kinase_C-like_PE/DAG-bd,superfamily_Ras_GEF_dom,smart_RasGRF_CDC25,smart_Prot_Kinase_C-like_PE/DAG-bd,pfscan_EF_hand_dom,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_RasGRF_CDC25,pfscan_Ras-like_Gua-exchang_fac_N,prints_DAG/PE-bd	p.F416	ENST00000587738.1	37	c.1248	CCDS46068.1	19																																																																																			RASGRP4	-	superfamily_Ras_GEF_dom,smart_RasGRF_CDC25,pfscan_RasGRF_CDC25	ENSG00000171777		0.597	RASGRP4-013	KNOWN	non_canonical_other|basic|appris_principal|CCDS	protein_coding	RASGRP4	HGNC	protein_coding	OTTHUMT00000460540.1	-	0.00	26	0	G	NM_170604		38904097	-1	tier1	-	no_errors	ENST00000587738	ensembl	human	known	74_37	silent	15.38	55	10	SNP	1.000	A
RBM19	9904	genome.wustl.edu	37	12	114356247	114356247	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr12:114356247G>T	ENST00000545145.2	-	20	2469	c.2391C>A	c.(2389-2391)caC>caA	p.H797Q	RBM19_ENST00000392561.3_Missense_Mutation_p.H797Q|RBM19_ENST00000261741.5_Missense_Mutation_p.H797Q	NM_001146699.1	NP_001140171.1	Q9Y4C8	RBM19_HUMAN	RNA binding motif protein 19	797	RRM 5. {ECO:0000255|PROSITE- ProRule:PRU00176}.				multicellular organismal development (GO:0007275)|positive regulation of embryonic development (GO:0040019)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(10)|liver(1)|lung(22)|ovary(1)|skin(3)|stomach(4)	55	Medulloblastoma(191;0.163)|all_neural(191;0.178)					CGTCCACGACGTGACCCTAAG	0.547																																																	0													120.0	101.0	108.0					12																	114356247		2203	4300	6503	SO:0001583	missense	0			AL117547	CCDS9172.1	12q24.21	2013-02-12				ENSG00000122965		"""RNA binding motif (RRM) containing"""	29098	protein-coding gene	gene with protein product						9734811, 11230166	Standard	NM_016196		Approved	DKFZp586F1023, KIAA0682	uc009zwi.2	Q9Y4C8	OTTHUMG00000169646	ENST00000545145.2:c.2391C>A	12.37:g.114356247G>T	ENSP00000442053:p.His797Gln		A8K5X9|Q9BPY6|Q9UFN5	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,smart_RRM_dom_euk,pfscan_RRM_dom	p.H797Q	ENST00000545145.2	37	c.2391	CCDS9172.1	12	.	.	.	.	.	.	.	.	.	.	G	5.434	0.265149	0.10294	.	.	ENSG00000122965	ENST00000545145;ENST00000392561;ENST00000261741	T;T;T	0.15256	2.44;2.44;2.44	4.48	1.61	0.23674	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.262410	0.44483	D	0.000450	T	0.11153	0.0272	N	0.16862	0.45	0.18873	N	0.999989	B	0.27853	0.191	B	0.37780	0.258	T	0.33059	-0.9883	10	0.28530	T	0.3	-17.5688	6.7711	0.23594	0.3937:0.0:0.6063:0.0	.	797	Q9Y4C8	RBM19_HUMAN	Q	797	ENSP00000442053:H797Q;ENSP00000376344:H797Q;ENSP00000261741:H797Q	ENSP00000261741:H797Q	H	-	3	2	RBM19	112840630	0.133000	0.22466	0.774000	0.31636	0.185000	0.23345	0.490000	0.22403	0.146000	0.19002	-0.140000	0.14226	CAC	RBM19	-	pfam_RRM_dom,smart_RRM_dom_euk,smart_RRM_dom,pfscan_RRM_dom	ENSG00000122965		0.547	RBM19-003	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	RBM19	HGNC	protein_coding	OTTHUMT00000405251.1		0.00	19	0	G	NM_016196		114356247	-1			no_errors	ENST00000261741	ensembl	human	known	74_37	missense	13.64	19	3	SNP	0.189	T
RBMY1J	378951	genome.wustl.edu	37	Y	24460678	24460678	+	Intron	SNP	G	G	T			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chrY:24460678G>T	ENST00000414629.2	+	1	148				RBMY2FP_ENST00000303922.3_RNA|RBMY1J_ENST00000445779.2_Intron			Q15415	RBY1F_HUMAN	RNA binding motif protein, Y-linked, family 1, member J						mRNA processing (GO:0006397)|RNA splicing (GO:0008380)|spermatogenesis (GO:0007283)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)										AACAAGCCAAGAAACCATCTT	0.408																																																	0																																										SO:0001627	intron_variant	0				CCDS35484.1	Yq11.223	2013-02-12			ENSG00000226941	ENSG00000226941		"""RNA binding motif (RRM) containing"""	23917	protein-coding gene	gene with protein product						12815422	Standard	NM_001006117		Approved			Q15415	OTTHUMG00000043594	ENST00000414629.2:c.-5+5561G>T	Y.37:g.24460678G>T			B2R916	RNA	SNP	-	NULL	ENST00000414629.2	37	NULL	CCDS35484.1	Y																																																																																			RBMY2FP	-	-	ENSG00000243040		0.408	RBMY1J-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RBMY2FP	HGNC	protein_coding	OTTHUMT00000101937.2	-	0.00	102	0	G	NM_001006117		24460678	+1	tier1	-	no_errors	ENST00000303922	ensembl	human	known	74_37	rna	44.63	67	54	SNP	1.000	T
RFTN1	23180	genome.wustl.edu	37	3	16368365	16368365	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr3:16368365C>A	ENST00000334133.4	-	8	1437	c.1165G>T	c.(1165-1167)Gac>Tac	p.D389Y	OXNAD1_ENST00000605932.1_Intron|OXNAD1_ENST00000606098.1_Intron|RFTN1_ENST00000483671.1_5'UTR|RFTN1_ENST00000432519.1_Missense_Mutation_p.D353Y|OXNAD1_ENST00000435829.2_Intron|OXNAD1_ENST00000544043.1_Intron	NM_015150.1	NP_055965.1	Q14699	RFTN1_HUMAN	raftlin, lipid raft linker 1	389					B cell receptor signaling pathway (GO:0050853)|dsRNA transport (GO:0033227)|growth (GO:0040007)|interleukin-17 production (GO:0032620)|membrane raft assembly (GO:0001765)|protein localization to membrane raft (GO:1903044)|protein transport into membrane raft (GO:0032596)|response to exogenous dsRNA (GO:0043330)|T cell antigen processing and presentation (GO:0002457)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 3 signaling pathway (GO:0034138)	cytoplasm (GO:0005737)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	double-stranded RNA binding (GO:0003725)			central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(5)|kidney(3)|large_intestine(8)|lung(8)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	38						GGCACGTAGTCTGTCTGCACT	0.572																																																	0													52.0	44.0	47.0					3																	16368365		2203	4300	6503	SO:0001583	missense	0			D42043	CCDS33712.1	3p24.3	2010-04-09			ENSG00000131378	ENSG00000131378			30278	protein-coding gene	gene with protein product	"""raft-linking protein"""					7788527, 12805216	Standard	NM_015150		Approved	MIG2, KIAA0084, FLJ23866, Raftlin	uc003cay.3	Q14699	OTTHUMG00000156973	ENST00000334133.4:c.1165G>T	3.37:g.16368365C>A	ENSP00000334153:p.Asp389Tyr		Q0D2G0|Q496Y2|Q4QQI7|Q5JB48|Q7Z7P2	Missense_Mutation	SNP	NULL	p.D389Y	ENST00000334133.4	37	c.1165	CCDS33712.1	3	.	.	.	.	.	.	.	.	.	.	C	23.7	4.449219	0.84101	.	.	ENSG00000131378	ENST00000432519;ENST00000334133	T;T	0.60672	0.17;0.17	5.31	5.31	0.75309	.	0.049657	0.85682	D	0.000000	T	0.77465	0.4134	M	0.79258	2.445	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.80437	-0.1383	10	0.87932	D	0	-32.2596	17.7582	0.88456	0.0:1.0:0.0:0.0	.	353;389	G3XAJ6;Q14699	.;RFTN1_HUMAN	Y	353;389	ENSP00000403926:D353Y;ENSP00000334153:D389Y	ENSP00000334153:D389Y	D	-	1	0	RFTN1	16343369	1.000000	0.71417	0.993000	0.49108	0.883000	0.51084	7.023000	0.76437	2.494000	0.84150	0.650000	0.86243	GAC	RFTN1	-	NULL	ENSG00000131378		0.572	RFTN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RFTN1	HGNC	protein_coding	OTTHUMT00000346908.1	-	0.00	45	0	C	NM_015150		16368365	-1	tier1	-	no_errors	ENST00000334133	ensembl	human	known	74_37	missense	26.42	39	14	SNP	1.000	A
ROBO3	64221	genome.wustl.edu	37	11	124743663	124743663	+	Silent	SNP	G	G	C			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr11:124743663G>C	ENST00000397801.1	+	11	1881	c.1689G>C	c.(1687-1689)gtG>gtC	p.V563V	ROBO3_ENST00000538940.1_Silent_p.V541V	NM_022370.3	NP_071765.2	Q96MS0	ROBO3_HUMAN	roundabout, axon guidance receptor, homolog 3 (Drosophila)	563	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|neuron migration (GO:0001764)	axon (GO:0030424)|integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(17)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	35	all_hematologic(175;0.215)	Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|Breast(109;0.0481)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.5e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0296)		CTCAGCCAGTGGTCACTGAGA	0.537																																																	0													38.0	40.0	40.0					11																	124743663		1874	4096	5970	SO:0001819	synonymous_variant	0			AK024697	CCDS44755.1	11q24	2013-02-11	2001-11-28		ENSG00000154134	ENSG00000154134		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	13433	protein-coding gene	gene with protein product		608630	"""roundabout (axon guidance receptor, Drosophila) homolog 3"", ""horizontal gaze palsy with progressive scoliosis"""	HGPPS		15105459	Standard	NM_022370		Approved	RBIG1, FLJ21044, HGPS	uc001qbc.3	Q96MS0	OTTHUMG00000165934	ENST00000397801.1:c.1689G>C	11.37:g.124743663G>C				Silent	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Fibronectin_type3,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.V563	ENST00000397801.1	37	c.1689	CCDS44755.1	11																																																																																			ROBO3	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000154134		0.537	ROBO3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ROBO3	HGNC	protein_coding	OTTHUMT00000387091.1	-	0.00	20	0	G	XM_370663		124743663	+1	tier1	-	no_errors	ENST00000397801	ensembl	human	known	74_37	silent	38.10	13	8	SNP	0.829	C
SERHL2	253190	genome.wustl.edu	37	22	42970659	42970659	+	IGR	SNP	C	C	A			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr22:42970659C>A	ENST00000327678.5	+	0	1374				RRP7B_ENST00000357802.2_RNA	NM_014509.3	NP_055324.2	Q9NQF3	SERHL_HUMAN	serine hydrolase-like 2								hydrolase activity (GO:0016787)			breast(1)|endometrium(2)|lung(3)|skin(1)|stomach(1)	8						CTCGGCCTCTCAGAGACCGCT	0.652																																																	0																																										SO:0001628	intergenic_variant	0				CCDS14037.1, CCDS63498.1	22q13	2005-08-09			ENSG00000183569	ENSG00000183569			29446	protein-coding gene	gene with protein product							Standard	NM_014509		Approved		uc003bcr.3	Q9H4I8	OTTHUMG00000150892		22.37:g.42970659C>A			Q5JZ95|Q9UH21	RNA	SNP	-	NULL	ENST00000327678.5	37	NULL	CCDS14037.1	22																																																																																			RRP7B	-	-	ENSG00000182841		0.652	SERHL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RRP7B	HGNC	protein_coding	OTTHUMT00000320454.1	-	0.00	19	0	C	NM_014509		42970659	-1	tier1	-	no_errors	ENST00000458605	ensembl	human	known	74_37	rna	56.52	10	13	SNP	0.000	A
RTN1	6252	genome.wustl.edu	37	14	60194345	60194345	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr14:60194345C>T	ENST00000267484.5	-	3	1392	c.1057G>A	c.(1057-1059)Gag>Aag	p.E353K		NM_021136.2	NP_066959.1	Q16799	RTN1_HUMAN	reticulon 1	353					neuron differentiation (GO:0030182)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)				central_nervous_system(2)|kidney(2)|large_intestine(9)|lung(30)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	49				OV - Ovarian serous cystadenocarcinoma(108;0.0968)		AGCTCATCCTCGGAGATGCTG	0.597																																																	0													24.0	22.0	23.0					14																	60194345		2197	4288	6485	SO:0001583	missense	0			L10333	CCDS9740.1, CCDS9741.1	14q21-q22	2008-08-29			ENSG00000139970	ENSG00000139970			10467	protein-coding gene	gene with protein product		600865	"""neuroendocrine-specific protein"""	NSP		8275708	Standard	NM_206852		Approved		uc001xen.1	Q16799	OTTHUMG00000028947	ENST00000267484.5:c.1057G>A	14.37:g.60194345C>T	ENSP00000267484:p.Glu353Lys		Q16800|Q16801|Q5BKZ4|Q9BQ59	Missense_Mutation	SNP	pfam_Reticulon,pfscan_Reticulon	p.E353K	ENST00000267484.5	37	c.1057	CCDS9740.1	14	.	.	.	.	.	.	.	.	.	.	C	20.6	4.013473	0.75161	.	.	ENSG00000139970	ENST00000267484;ENST00000433623	T	0.27256	1.68	5.53	5.53	0.82687	.	0.351770	0.30043	N	0.010560	T	0.29783	0.0744	M	0.68952	2.095	0.58432	D	0.999996	P	0.49358	0.923	B	0.36030	0.216	T	0.27938	-1.0059	10	0.59425	D	0.04	.	19.4439	0.94838	0.0:1.0:0.0:0.0	.	353	Q16799	RTN1_HUMAN	K	353;279	ENSP00000267484:E353K	ENSP00000267484:E353K	E	-	1	0	RTN1	59264098	0.999000	0.42202	0.983000	0.44433	0.979000	0.70002	5.299000	0.65716	2.603000	0.88011	0.609000	0.83330	GAG	RTN1	-	NULL	ENSG00000139970		0.597	RTN1-001	KNOWN	basic|CCDS	protein_coding	RTN1	HGNC	protein_coding	OTTHUMT00000072278.2	-	0.00	13	0	C			60194345	-1	tier1	-	no_errors	ENST00000267484	ensembl	human	known	74_37	missense	42.86	8	6	SNP	0.998	T
RTL1	388015	genome.wustl.edu	37	14	101347804	101347804	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr14:101347804G>A	ENST00000534062.1	-	1	3380	c.3322C>T	c.(3322-3324)Cgg>Tgg	p.R1108W	MIR127_ENST00000384876.1_RNA|MIR431_ENST00000385266.1_RNA|MIR433_ENST00000384837.1_RNA	NM_001134888.2	NP_001128360.1	A6NKG5	RTL1_HUMAN	retrotransposon-like 1	1108					multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)				breast(1)|endometrium(5)|kidney(4)|large_intestine(1)|lung(5)|pancreas(1)|prostate(2)|skin(2)	21						GGTGCCGGCCGCAGCGAGAGG	0.652																																																	0													31.0	29.0	30.0					14																	101347804		692	1591	2283	SO:0001583	missense	0				CCDS53910.1	14q32.2	2012-04-18			ENSG00000254656	ENSG00000254656			14665	protein-coding gene	gene with protein product		611896				16155747, 15854907, 12796779	Standard	NM_001134888		Approved	PEG11, MART1, Mar1	uc010txj.1	A6NKG5	OTTHUMG00000167573	ENST00000534062.1:c.3322C>T	14.37:g.101347804G>A	ENSP00000435342:p.Arg1108Trp		E9PKS8	Missense_Mutation	SNP	pfam_Retrotrans_gag_dom,superfamily_Peptidase_aspartic_dom	p.R1108W	ENST00000534062.1	37	c.3322	CCDS53910.1	14	.	.	.	.	.	.	.	.	.	.	G	10.80	1.451263	0.26074	.	.	ENSG00000254656	ENST00000534062	T	0.22945	1.93	3.11	2.19	0.27852	.	.	.	.	.	T	0.11623	0.0283	N	0.14661	0.345	0.09310	N	1	P	0.41929	0.765	B	0.28638	0.092	T	0.11446	-1.0587	9	0.66056	D	0.02	.	8.4036	0.32601	0.0:0.2399:0.7601:0.0	.	1108	E9PKS8	.	W	1108	ENSP00000435342:R1108W	ENSP00000435342:R1108W	R	-	1	2	RTL1	100417557	0.023000	0.18921	0.001000	0.08648	0.002000	0.02628	0.372000	0.20467	0.838000	0.34948	0.491000	0.48974	CGG	RTL1	-	NULL	ENSG00000254656		0.652	RTL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RTL1	HGNC	protein_coding	OTTHUMT00000395127.1	-	0.00	34	0	G	NM_001134888		101347804	-1	tier1	-	no_errors	ENST00000534062	ensembl	human	known	74_37	missense	30.43	16	7	SNP	0.000	A
RYR2	6262	genome.wustl.edu	37	1	237753263	237753263	+	Nonsense_Mutation	SNP	C	C	T			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr1:237753263C>T	ENST00000366574.2	+	30	4086	c.3769C>T	c.(3769-3771)Cag>Tag	p.Q1257*	RYR2_ENST00000360064.6_Nonsense_Mutation_p.Q1255*|RYR2_ENST00000542537.1_Nonsense_Mutation_p.Q1241*	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	1257	4 X approximate repeats.				BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			GAGGCTTCCTCAGTTTCTTCA	0.368																																																	0													93.0	87.0	89.0					1																	237753263		1868	4116	5984	SO:0001587	stop_gained	0			X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.3769C>T	1.37:g.237753263C>T	ENSP00000355533:p.Gln1257*		Q15411|Q546N8|Q5T3P2	Nonsense_Mutation	SNP	pfam_Ca-rel_channel,pfam_Ryanodine_rcpt,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR_motif,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR_motif,superfamily_ConA-like_lec_gl_sf,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_EF_hand_dom,pfscan_MIR_motif	p.Q1255*	ENST00000366574.2	37	c.3763	CCDS55691.1	1	.	.	.	.	.	.	.	.	.	.	c	43	10.132471	0.99343	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537	.	.	.	5.64	5.64	0.86602	.	0.000000	0.64402	D	0.000009	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.20519	T	0.43	.	19.6894	0.95993	0.0:1.0:0.0:0.0	.	.	.	.	X	1257;1255;1241	.	ENSP00000353174:Q1255X	Q	+	1	0	RYR2	235819886	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	4.740000	0.62087	2.645000	0.89757	0.650000	0.86243	CAG	RYR2	-	NULL	ENSG00000198626		0.368	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	RYR2	HGNC	protein_coding	OTTHUMT00000095402.2	-	0.00	39	0	C	NM_001035		237753263	+1	tier1	-	no_errors	ENST00000360064	ensembl	human	known	74_37	nonsense	10.87	82	10	SNP	1.000	T
SAG	6295	genome.wustl.edu	37	2	234224723	234224723	+	Silent	SNP	G	G	T			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr2:234224723G>T	ENST00000409110.1	+	3	308	c.78G>T	c.(76-78)gtG>gtT	p.V26V		NM_000541.4	NP_000532.2	P10523	ARRS_HUMAN	S-antigen; retina and pineal gland (arrestin)	26					cell surface receptor signaling pathway (GO:0007166)|negative regulation of catalytic activity (GO:0043086)|phototransduction, visible light (GO:0007603)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|visual perception (GO:0007601)	cytosol (GO:0005829)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)	protein phosphatase inhibitor activity (GO:0004864)			cervix(1)|kidney(2)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	9		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.018)|Acute lymphoblastic leukemia(138;0.0327)|Lung NSC(271;0.054)		Epithelial(121;2.86e-17)|BRCA - Breast invasive adenocarcinoma(100;0.00037)|LUSC - Lung squamous cell carcinoma(224;0.00608)|Lung(119;0.00714)|GBM - Glioblastoma multiforme(43;0.207)		TCTTGCAGGTGACCATCTACC	0.507																																																	0													103.0	98.0	99.0					2																	234224723		1952	4158	6110	SO:0001819	synonymous_variant	0				CCDS46545.1	2q37.1	2013-02-14			ENSG00000130561	ENSG00000130561			10521	protein-coding gene	gene with protein product	"""arrestin 1"""	181031				2249983	Standard	NM_000541		Approved	ARRESTIN, RP47	uc002vuh.2	P10523	OTTHUMG00000153213	ENST00000409110.1:c.78G>T	2.37:g.234224723G>T			A0FDN6|Q53SV3|Q99858	Silent	SNP	pfam_Arrestin-like_N,pfam_Arrestin_C-like,superfamily_Ig_E-set,prints_Arrestin	p.V26	ENST00000409110.1	37	c.78	CCDS46545.1	2																																																																																			SAG	-	pfam_Arrestin-like_N,superfamily_Ig_E-set	ENSG00000130561		0.507	SAG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SAG	HGNC	protein_coding	OTTHUMT00000330126.1		0.00	40	0	G	NM_000541		234224723	+1			no_errors	ENST00000409110	ensembl	human	known	74_37	silent	6.12	46	3	SNP	1.000	T
SCCPDH	51097	genome.wustl.edu	37	1	246887741	246887741	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr1:246887741G>A	ENST00000366510.3	+	1	393	c.17G>A	c.(16-18)aGg>aAg	p.R6K		NM_016002.2	NP_057086.2	Q8NBX0	SCPDL_HUMAN	saccharopine dehydrogenase (putative)	6						lipid particle (GO:0005811)|membrane (GO:0016020)|midbody (GO:0030496)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	oxidoreductase activity (GO:0016491)			cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|lung(9)|ovary(1)	17	all_cancers(71;6.8e-05)|all_epithelial(71;7.93e-06)|Ovarian(71;0.0173)|Breast(184;0.0318)|all_lung(81;0.0545)|Lung NSC(105;0.0618)	all_cancers(173;0.0343)	OV - Ovarian serous cystadenocarcinoma(106;0.00323)	GBM - Glioblastoma multiforme(49;0.0896)		ACCGAGCAGAGGCCTTTCCAC	0.731																																																	0													21.0	22.0	22.0					1																	246887741		2200	4294	6494	SO:0001583	missense	0				CCDS31084.1	1q44	2009-11-06			ENSG00000143653	ENSG00000143653			24275	protein-coding gene	gene with protein product						10810093	Standard	NM_016002		Approved	CGI-49, NET11	uc001ibr.3	Q8NBX0	OTTHUMG00000040221	ENST00000366510.3:c.17G>A	1.37:g.246887741G>A	ENSP00000355467:p.Arg6Lys		Q8TAR0|Q9Y363	Missense_Mutation	SNP	pfam_Saccharopine_DH/HSpermid_syn	p.R6K	ENST00000366510.3	37	c.17	CCDS31084.1	1	.	.	.	.	.	.	.	.	.	.	G	20.3	3.958822	0.74016	.	.	ENSG00000143653	ENST00000366510	T	0.57595	0.39	5.15	4.24	0.50183	.	0.000000	0.85682	D	0.000000	T	0.50905	0.1643	M	0.64630	1.985	0.41226	D	0.986548	P	0.35174	0.488	B	0.39094	0.29	T	0.51309	-0.8722	10	0.42905	T	0.14	.	9.7337	0.40376	0.1607:0.0:0.8393:0.0	.	6	Q8NBX0	SCPDL_HUMAN	K	6	ENSP00000355467:R6K	ENSP00000355467:R6K	R	+	2	0	SCCPDH	244954364	1.000000	0.71417	0.991000	0.47740	0.232000	0.25224	3.490000	0.53245	1.174000	0.42811	0.454000	0.30748	AGG	SCCPDH	-	NULL	ENSG00000143653		0.731	SCCPDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCCPDH	HGNC	protein_coding	OTTHUMT00000096902.2		0.00	16	0	G	NM_016002		246887741	+1			no_errors	ENST00000366510	ensembl	human	known	74_37	missense	13.51	32	5	SNP	0.996	A
SCYL2	55681	genome.wustl.edu	37	12	100676832	100676832	+	Silent	SNP	C	C	A			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr12:100676832C>A	ENST00000360820.2	+	2	521	c.84C>A	c.(82-84)gtC>gtA	p.V28V	SCYL2_ENST00000550067.1_3'UTR	NM_017988.4	NP_060458.3	Q6P3W7	SCYL2_HUMAN	SCY1-like 2 (S. cerevisiae)	28					endosome to lysosome transport (GO:0008333)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of clathrin-mediated endocytosis (GO:2000370)|positive regulation of receptor internalization (GO:0002092)|receptor internalization involved in canonical Wnt signaling pathway (GO:2000286)	cytoplasmic vesicle (GO:0031410)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|receptor binding (GO:0005102)			central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(4)|lung(15)|ovary(2)|skin(1)	41						GAAATCCTGTCACTAGAGAAT	0.408																																																	0													103.0	99.0	100.0					12																	100676832		2203	4300	6503	SO:0001819	synonymous_variant	0			AB037781	CCDS9076.1	12q23.1	2005-01-20				ENSG00000136021			19286	protein-coding gene	gene with protein product						10718198	Standard	NM_017988		Approved	KIAA1360	uc001thn.3	Q6P3W7	OTTHUMG00000170319	ENST00000360820.2:c.84C>A	12.37:g.100676832C>A			A8KAB5|Q96EF4|Q96ST4|Q9H7V5|Q9NVH3|Q9P2I7	Silent	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_Ser/Thr_dual-sp_kinase_dom,pfscan_Prot_kinase_dom	p.V28	ENST00000360820.2	37	c.84	CCDS9076.1	12																																																																																			SCYL2	-	superfamily_Kinase-like_dom	ENSG00000136021		0.408	SCYL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCYL2	HGNC	protein_coding	OTTHUMT00000408493.2	-	0.00	34	0	C	NM_017988		100676832	+1	tier1	-	no_errors	ENST00000360820	ensembl	human	known	74_37	silent	27.42	45	17	SNP	1.000	A
SDC2	6383	genome.wustl.edu	37	8	97620584	97620584	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr8:97620584G>C	ENST00000302190.4	+	4	1249	c.328G>C	c.(328-330)Gag>Cag	p.E110Q	SDC2_ENST00000518385.1_Missense_Mutation_p.E74Q|SDC2_ENST00000522911.1_Missense_Mutation_p.E81Q|SDC2_ENST00000519914.1_Missense_Mutation_p.E81Q	NM_002998.3	NP_002989.2	P34741	SDC2_HUMAN	syndecan 2	110					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|dendrite morphogenesis (GO:0048813)|extracellular matrix organization (GO:0030198)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|phototransduction, visible light (GO:0007603)|regulation of dendrite morphogenesis (GO:0048814)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|wound healing (GO:0042060)	Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|lysosomal lumen (GO:0043202)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	PDZ domain binding (GO:0030165)			breast(1)|cervix(1)|large_intestine(5)|lung(4)|ovary(2)|prostate(1)|stomach(2)	16	Breast(36;3.41e-05)				Sargramostim(DB00020)	AACTGATAAAGAGAAAGTTCA	0.383																																																	0													81.0	77.0	78.0					8																	97620584		2203	4300	6503	SO:0001583	missense	0			BC030133	CCDS6272.1	8q22-q23	2011-08-11	2007-02-15		ENSG00000169439	ENSG00000169439		"""Proteoglycans / Cell Surface : Syndecans"", ""CD molecules"""	10659	protein-coding gene	gene with protein product	"""syndecan proteoglycan 2"""	142460	"""heparan sulfate proteoglycan 1, cell surface-associated"""	HSPG, HSPG1		8187643	Standard	NM_002998		Approved	fibroglycan, SYND2, CD362	uc003yhv.1	P34741	OTTHUMG00000164689	ENST00000302190.4:c.328G>C	8.37:g.97620584G>C	ENSP00000307046:p.Glu110Gln		B3KQA3|Q6PIS6|Q9H6V1	Missense_Mutation	SNP	pfam_Syndecan/Neurexin_dom,smart_Neurexin-like	p.E110Q	ENST00000302190.4	37	c.328	CCDS6272.1	8	.	.	.	.	.	.	.	.	.	.	G	12.18	1.859357	0.32884	.	.	ENSG00000169439	ENST00000302190;ENST00000518385;ENST00000545117;ENST00000546193;ENST00000522911;ENST00000519914;ENST00000521590;ENST00000523877	T;T;T;T;T	0.34072	1.43;1.38;1.44;1.44;1.42	6.17	5.29	0.74685	.	0.256528	0.44902	D	0.000417	T	0.31544	0.0800	L	0.47716	1.5	0.35684	D	0.814336	B	0.31459	0.324	B	0.31390	0.129	T	0.39840	-0.9594	10	0.32370	T	0.25	-9.1083	11.2949	0.49272	0.1407:0.0:0.8593:0.0	.	110	P34741	SDC2_HUMAN	Q	110;74;110;100;81;81;81;81	ENSP00000307046:E110Q;ENSP00000429045:E74Q;ENSP00000427784:E81Q;ENSP00000428256:E81Q;ENSP00000429121:E81Q	ENSP00000307046:E110Q	E	+	1	0	SDC2	97689760	1.000000	0.71417	0.948000	0.38648	0.479000	0.33129	2.759000	0.47573	1.599000	0.50093	0.655000	0.94253	GAG	SDC2	-	pfam_Syndecan/Neurexin_dom	ENSG00000169439		0.383	SDC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SDC2	HGNC	protein_coding	OTTHUMT00000379750.1		0.00	37	0	G	NM_002998		97620584	+1			no_errors	ENST00000302190	ensembl	human	known	74_37	missense	6.67	42	3	SNP	0.996	C
SEC14L2	23541	genome.wustl.edu	37	22	30812056	30812056	+	Silent	SNP	C	C	T			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr22:30812056C>T	ENST00000312932.9	+	10	1151	c.891C>T	c.(889-891)ctC>ctT	p.L297L	RP4-539M6.19_ENST00000439838.1_Silent_p.L131L|SEC14L2_ENST00000405717.3_Silent_p.L297L|SEC14L2_ENST00000403484.1_Silent_p.L223L|SEC14L2_ENST00000402592.3_Silent_p.L214L	NM_012429.3	NP_036561.1	O76054	S14L2_HUMAN	SEC14-like 2 (S. cerevisiae)	297	GOLD. {ECO:0000255|PROSITE- ProRule:PRU00096}.				positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cholesterol biosynthetic process (GO:0045540)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	phospholipid binding (GO:0005543)|transporter activity (GO:0005215)|vitamin E binding (GO:0008431)			haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(5)|skin(1)|urinary_tract(1)	10					Vitamin E(DB00163)	ATGAGATCCTCTTCCCTGGCT	0.557																																																	0													92.0	88.0	89.0					22																	30812056		2203	4300	6503	SO:0001819	synonymous_variant	0			AL096881	CCDS13876.1, CCDS46685.1, CCDS56228.1	22q12.2	2010-08-19	2001-11-28		ENSG00000100003	ENSG00000100003			10699	protein-coding gene	gene with protein product	"""supernatant protein factor"""	607558	"""SEC14 (S. cerevisiae)-like 2"""	C22orf6		10591208	Standard	NM_033382		Approved	TAP, SPF, KIAA1186, KIAA1658	uc003ahr.3	O76054	OTTHUMG00000151024	ENST00000312932.9:c.891C>T	22.37:g.30812056C>T			B7Z8Q1|F5H3U4|Q53EQ2|Q6PD61|Q9ULN4	Silent	SNP	pfam_CRAL-TRIO_dom,pfam_CRAL/TRIO_N_dom,superfamily_CRAL-TRIO_dom,superfamily_GOLD,superfamily_CRAL/TRIO_N_dom,smart_CRAL-TRIO_dom,pfscan_CRAL-TRIO_dom,pfscan_GOLD,prints_CRAL-bd_toc_tran	p.L297	ENST00000312932.9	37	c.891	CCDS13876.1	22																																																																																			SEC14L2	-	superfamily_GOLD,pfscan_GOLD	ENSG00000100003		0.557	SEC14L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEC14L2	HGNC	protein_coding	OTTHUMT00000321018.4	-	0.00	34	0	C	NM_012429		30812056	+1	tier1	-	no_errors	ENST00000312932	ensembl	human	known	74_37	silent	72.73	12	32	SNP	1.000	T
SEPT1	1731	genome.wustl.edu	37	16	30393911	30393911	+	5'UTR	SNP	T	T	C			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr16:30393911T>C	ENST00000571393.1	-	0	124				SEPT1_ENST00000321367.3_Missense_Mutation_p.S27G|SEPT1_ENST00000605106.1_5'Flank|SEPT1_ENST00000570039.1_5'Flank			Q8WYJ6	SEPT1_HUMAN	septin 1						cell cycle (GO:0007049)|cell division (GO:0051301)	septin complex (GO:0031105)	GTP binding (GO:0005525)			breast(2)|endometrium(1)|large_intestine(3)|lung(15)|ovary(1)|skin(1)|urinary_tract(1)	24			Colorectal(24;0.193)			GGCAGGAAGCTGAGTGCGGCT	0.617																																																	0													24.0	25.0	25.0					16																	30393911		692	1591	2283	SO:0001623	5_prime_UTR_variant	0			AF308288	CCDS10678.1, CCDS10678.2, CCDS10678.3	16p11.2	2013-01-21		2001-09-10	ENSG00000180096	ENSG00000180096	3.1.5.1	"""Septins"""	2879	protein-coding gene	gene with protein product		612897		DIFF6		8697812	Standard	NM_052838		Approved	PNUTL3	uc002dxy.4	Q8WYJ6	OTTHUMG00000176984	ENST00000571393.1:c.-63A>G	16.37:g.30393911T>C			B4DVE6|Q658T1|Q8NEZ1|Q96EL4|Q9H285	Missense_Mutation	SNP	pfam_Cell_div_GTP-bd,pfam_Ribosome_biogen_GTPase_RsgA,superfamily_P-loop_NTPase,pirsf_Septin	p.S27G	ENST00000571393.1	37	c.79		16																																																																																			SEPT1	-	NULL	ENSG00000180096		0.617	SEPT1-201	KNOWN	basic	protein_coding	SEPT1	HGNC	protein_coding		-	0.00	28	0	T	NM_052838		30393911	-1	tier1	-	no_errors	ENST00000321367	ensembl	human	known	74_37	missense	16.00	42	8	SNP	0.803	C
SGOL1	151648	genome.wustl.edu	37	3	20216539	20216539	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr3:20216539G>C	ENST00000263753.4	-	6	623	c.484C>G	c.(484-486)Cct>Gct	p.P162A	SGOL1_ENST00000419233.2_Missense_Mutation_p.P162A|SGOL1_ENST00000383774.1_Missense_Mutation_p.P162A|SGOL1_ENST00000417364.1_Missense_Mutation_p.P162A|SGOL1_ENST00000452020.1_Intron|SGOL1_ENST00000429446.3_Intron|SGOL1_ENST00000412997.1_Missense_Mutation_p.P162A|SGOL1_ENST00000425061.1_Missense_Mutation_p.P162A|SGOL1_ENST00000443724.1_Missense_Mutation_p.P162A|SGOL1_ENST00000421451.1_Missense_Mutation_p.P162A|SGOL1-AS1_ENST00000441442.1_RNA|SGOL1_ENST00000412868.1_Missense_Mutation_p.P162A|SGOL1_ENST00000442720.1_Intron|SGOL1_ENST00000437051.1_Missense_Mutation_p.P162A|SGOL1_ENST00000306698.2_Intron|SGOL1-AS1_ENST00000448208.1_RNA	NM_001012410.3|NM_001199252.1	NP_001012410.1|NP_001186181.1	Q5FBB7	SGOL1_HUMAN	shugoshin-like 1 (S. pombe)	162	Necessary for interaction with PPP2CA and PPP2R1A.				attachment of spindle microtubules to kinetochore (GO:0008608)|centriole-centriole cohesion (GO:0010457)|chromosome segregation (GO:0007059)|meiotic chromosome segregation (GO:0045132)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	centrosome (GO:0005813)|chromosome, centromeric region (GO:0000775)|condensed chromosome, centromeric region (GO:0000779)|condensed nuclear chromosome, centromeric region (GO:0000780)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|mitotic cohesin complex (GO:0030892)|nucleus (GO:0005634)|spindle pole (GO:0000922)	kinase binding (GO:0019900)			kidney(1)|large_intestine(4)|lung(6)|skin(1)|urinary_tract(2)	14						GGAATAGTAGGTATCTGATCT	0.313																																																	0													37.0	37.0	37.0					3																	20216539		2202	4299	6501	SO:0001583	missense	0			BC001339	CCDS2635.1, CCDS33716.1, CCDS46771.1, CCDS46772.1, CCDS46773.1, CCDS46774.1, CCDS56243.1	3p24.3	2005-07-27			ENSG00000129810	ENSG00000129810			25088	protein-coding gene	gene with protein product		609168				12747765	Standard	NM_001199251		Approved	NY-BR-85	uc003cbu.3	Q5FBB7	OTTHUMG00000130479	ENST00000263753.4:c.484C>G	3.37:g.20216539G>C	ENSP00000263753:p.Pro162Ala		Q588H5|Q5FBB4|Q5FBB5|Q5FBB6|Q5FBB8|Q8N579|Q8WVL0|Q9BVA8|Q9H275	Missense_Mutation	SNP	pfam_Shugoshin_N,pfam_Shugoshin_C	p.P162A	ENST00000263753.4	37	c.484	CCDS33716.1	3	.	.	.	.	.	.	.	.	.	.	G	5.262	0.233744	0.09969	.	.	ENSG00000129810	ENST00000419233;ENST00000263753;ENST00000383774;ENST00000425061;ENST00000443724;ENST00000421451;ENST00000412997;ENST00000437051;ENST00000412868;ENST00000417364	T;T;T;T;T;T;T;T;T;T	0.43688	0.94;1.54;0.95;0.94;0.95;1.54;1.57;0.96;1.57;0.96	6.03	-2.17	0.07059	.	0.511626	0.22674	N	0.057034	T	0.25344	0.0616	L	0.56769	1.78	0.09310	N	0.999997	B;B;B;B;B	0.29988	0.112;0.264;0.112;0.112;0.068	B;B;B;B;B	0.20955	0.032;0.03;0.013;0.019;0.014	T	0.16364	-1.0405	10	0.15499	T	0.54	.	3.0096	0.06040	0.5403:0.1281:0.2013:0.1302	.	162;162;162;162;162	Q5FBB7-7;B5BUA4;Q5FBB7-4;Q5FBB7-2;Q5FBB7	.;.;.;.;SGOL1_HUMAN	A	162	ENSP00000394625:P162A;ENSP00000263753:P162A;ENSP00000373284:P162A;ENSP00000414960:P162A;ENSP00000413070:P162A;ENSP00000414129:P162A;ENSP00000410458:P162A;ENSP00000389034:P162A;ENSP00000406880:P162A;ENSP00000394613:P162A	ENSP00000263753:P162A	P	-	1	0	SGOL1	20191543	0.022000	0.18835	0.000000	0.03702	0.004000	0.04260	0.544000	0.23253	-0.278000	0.09180	-0.300000	0.09419	CCT	SGOL1	-	NULL	ENSG00000129810		0.313	SGOL1-009	KNOWN	basic|CCDS	protein_coding	SGOL1	HGNC	protein_coding	OTTHUMT00000340498.1		0.00	25	0	G	NM_138484		20216539	-1			no_errors	ENST00000263753	ensembl	human	known	74_37	missense	35.48	20	11	SNP	0.000	C
SI	6476	genome.wustl.edu	37	3	164783167	164783167	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr3:164783167G>A	ENST00000264382.3	-	7	751	c.689C>T	c.(688-690)tCa>tTa	p.S230L		NM_001041.3	NP_001032.2	P14410	SUIS_HUMAN	sucrase-isomaltase (alpha-glucosidase)	230	Isomaltase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	brush border (GO:0005903)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|carbohydrate binding (GO:0030246)|oligo-1,6-glucosidase activity (GO:0004574)|sucrose alpha-glucosidase activity (GO:0004575)			NS(4)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(6)|kidney(10)|large_intestine(18)|lung(124)|ovary(9)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(16)|urinary_tract(1)	218		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)			Acarbose(DB00284)|Scopolamine(DB00747)	AAGACGGGTTGAGATCTGTAA	0.338										HNSCC(35;0.089)																																							0													59.0	58.0	58.0					3																	164783167		2203	4300	6503	SO:0001583	missense	0			X63597	CCDS3196.1	3q25.2-q26.2	2004-04-06	2004-04-06		ENSG00000090402	ENSG00000090402	3.2.1.10		10856	protein-coding gene	gene with protein product	"""Oligosaccharide alpha-1,6-glucosidase"""	609845	"""sucrase-isomaltase"""			2962903, 1353958	Standard	NM_001041		Approved		uc003fei.3	P14410	OTTHUMG00000158065	ENST00000264382.3:c.689C>T	3.37:g.164783167G>A	ENSP00000264382:p.Ser230Leu		A2RUC3|Q1JQ80|Q1RMC2	Missense_Mutation	SNP	pfam_Glyco_hydro_31,pfam_P_trefoil,superfamily_Glycoside_hydrolase_SF,superfamily_Gal_mutarotase_SF_dom,smart_P_trefoil	p.S230L	ENST00000264382.3	37	c.689	CCDS3196.1	3	.	.	.	.	.	.	.	.	.	.	G	24.8	4.567002	0.86439	.	.	ENSG00000090402	ENST00000264382	D	0.88201	-2.35	5.9	5.9	0.94986	Glycoside hydrolase-type carbohydrate-binding (1);	0.000000	0.85682	D	0.000000	D	0.97179	0.9078	H	0.98351	4.21	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98061	1.0393	10	0.87932	D	0	.	20.2789	0.98501	0.0:0.0:1.0:0.0	.	230	P14410	SUIS_HUMAN	L	230	ENSP00000264382:S230L	ENSP00000264382:S230L	S	-	2	0	SI	166265861	1.000000	0.71417	0.985000	0.45067	0.456000	0.32438	9.289000	0.96061	2.788000	0.95919	0.650000	0.86243	TCA	SI	-	superfamily_Gal_mutarotase_SF_dom	ENSG00000090402		0.338	SI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SI	HGNC	protein_coding	OTTHUMT00000350116.1	-	0.00	27	0	G	NM_001041		164783167	-1	tier1	-	no_errors	ENST00000264382	ensembl	human	known	74_37	missense	17.07	68	14	SNP	1.000	A
SLC6A5	9152	genome.wustl.edu	37	11	20623033	20623033	+	Missense_Mutation	SNP	A	A	G			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr11:20623033A>G	ENST00000525748.1	+	2	635	c.362A>G	c.(361-363)aAg>aGg	p.K121R		NM_004211.3	NP_004202.2	Q9Y345	SC6A5_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 5	121					glycine import (GO:0036233)|synaptic transmission (GO:0007268)|synaptic transmission, glycinergic (GO:0060012)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	glycine:sodium symporter activity (GO:0015375)|neurotransmitter:sodium symporter activity (GO:0005328)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(34)|ovary(2)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	63					Glycine(DB00145)	CTGCACTGTAAGATCCCTTTT	0.677																																																	0													52.0	52.0	52.0					11																	20623033		2203	4300	6503	SO:0001583	missense	0			AF085412	CCDS7854.1	11p15.1	2013-07-19	2013-07-19		ENSG00000165970	ENSG00000165970		"""Solute carriers"""	11051	protein-coding gene	gene with protein product	"""glycine transporter 2"""	604159	"""solute carrier family 6 (neurotransmitter transporter, glycine), member 5"""	NET1		9845349	Standard	NM_004211		Approved	GLYT2	uc001mqd.3	Q9Y345	OTTHUMG00000166024	ENST00000525748.1:c.362A>G	11.37:g.20623033A>G	ENSP00000434364:p.Lys121Arg		O95288|Q4VAM7|Q9BX77	Missense_Mutation	SNP	pfam_Na/ntran_symport,pfscan_Na/ntran_symport,prints_Na/ntran_symport	p.K121R	ENST00000525748.1	37	c.362	CCDS7854.1	11	.	.	.	.	.	.	.	.	.	.	A	9.042	0.989909	0.18966	.	.	ENSG00000165970	ENST00000525748	T	0.72615	-0.67	5.7	1.64	0.23874	.	1.562850	0.03004	N	0.148597	T	0.49762	0.1576	N	0.11560	0.145	0.28744	N	0.901837	B	0.02656	0.0	B	0.01281	0.0	T	0.40194	-0.9576	10	0.16420	T	0.52	.	4.9085	0.13811	0.6346:0.0:0.2293:0.1361	.	121	Q9Y345	SC6A5_HUMAN	R	121	ENSP00000434364:K121R	ENSP00000298923:K121R	K	+	2	0	SLC6A5	20579609	1.000000	0.71417	0.999000	0.59377	0.414000	0.31173	1.599000	0.36751	0.421000	0.25980	0.379000	0.24179	AAG	SLC6A5	-	NULL	ENSG00000165970		0.677	SLC6A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC6A5	HGNC	protein_coding	OTTHUMT00000387497.2	-	0.00	27	0	A	NM_004211		20623033	+1	tier1	-	no_errors	ENST00000525748	ensembl	human	known	74_37	missense	31.03	20	9	SNP	0.986	G
SLFN12L	100506736	genome.wustl.edu	37	17	33805180	33805180	+	Missense_Mutation	SNP	G	G	C	rs2304967	byFrequency	TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr17:33805180G>C	ENST00000260908.7	-	3	1235	c.1118C>G	c.(1117-1119)gCa>gGa	p.A373G	RP11-686D22.9_ENST00000587076.1_RNA|SLFN12L_ENST00000449046.1_Missense_Mutation_p.A404G|SLFN12L_ENST00000361112.4_Missense_Mutation_p.A402G	NM_001195790.1	NP_001182719.1	Q6IEE8	SN12L_HUMAN	schlafen family member 12-like	373			A -> G (in dbSNP:rs2304967).			integral component of membrane (GO:0016021)	ATP binding (GO:0005524)	p.A404G(2)|p.A402G(1)		breast(1)|endometrium(4)|kidney(5)|large_intestine(2)|lung(3)|ovary(1)	16						TGATGTACTTGCTGGAGAGGG	0.393													G|||	1145	0.228634	0.3245	0.1239	5008	,	,		20242	0.1577		0.164	False		,,,				2504	0.3129																3	Substitution - Missense(3)	kidney(3)											135.0	120.0	125.0					17																	33805180		692	1591	2283	SO:0001583	missense	0			AK172761	CCDS56026.1	17q12	2011-05-24				ENSG00000205045			33920	protein-coding gene	gene with protein product		614956				9846487	Standard	NM_001195790		Approved		uc021tuy.1	Q6IEE8		ENST00000260908.7:c.1118C>G	17.37:g.33805180G>C	ENSP00000437635:p.Ala373Gly		F5H6G3	Missense_Mutation	SNP	pfam_ATPase_AAA-4	p.A404G	ENST00000260908.7	37	c.1211	CCDS56026.1	17	427	0.1955128205128205	161	0.32723577235772355	51	0.1408839779005525	95	0.1660839160839161	120	0.158311345646438	G	1.121	-0.655425	0.03480	.	.	ENSG00000205045	ENST00000260908;ENST00000361112;ENST00000449046	T;T;T	0.03831	3.8;3.9;3.79	1.27	-2.55	0.06288	.	.	.	.	.	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B	0.25904	0.137	B	0.20767	0.031	T	0.46898	-0.9158	8	0.52906	T	0.07	.	0.4961	0.00572	0.2076:0.2871:0.2924:0.2128	rs2304967;rs52790215;rs2304967	402	Q6IEE8-2	.	G	373;402;404	ENSP00000437635:A373G;ENSP00000354412:A402G;ENSP00000389348:A404G	ENSP00000437635:A373G	A	-	2	0	SLFN12L	30829293	0.000000	0.05858	0.000000	0.03702	0.037000	0.13140	-2.608000	0.00887	-1.584000	0.01636	0.205000	0.17691	GCA	SLFN12L	-	NULL	ENSG00000205045		0.393	SLFN12L-004	NOVEL	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	SLFN12L	HGNC	protein_coding	OTTHUMT00000395748.2		0.00	49	0	G	XM_496206		33805180	-1			no_errors	ENST00000449046	ensembl	human	known	74_37	missense	6.00	47	3	SNP	0.000	C
SMEK1	55671	genome.wustl.edu	37	14	91931710	91931710	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr14:91931710G>T	ENST00000554943.1	-	11	1829	c.1714C>A	c.(1714-1716)Cgc>Agc	p.R572S	SMEK1_ENST00000337238.4_Missense_Mutation_p.R559S|SMEK1_ENST00000555718.1_5'UTR|SMEK1_ENST00000554684.1_Missense_Mutation_p.R559S|SMEK1_ENST00000428424.2_Missense_Mutation_p.R333S|SMEK1_ENST00000555462.1_Missense_Mutation_p.R333S			Q6IN85	P4R3A_HUMAN	SMEK homolog 1, suppressor of mek1 (Dictyostelium)	572					positive regulation of gluconeogenesis (GO:0045722)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|protein phosphatase 4 complex (GO:0030289)				NS(1)|endometrium(1)|kidney(1)|liver(1)|lung(1)|stomach(1)	6		all_cancers(154;0.0691)|all_epithelial(191;0.219)		COAD - Colon adenocarcinoma(157;0.221)		ATTATGTAGCGGTTGTAAAAC	0.358																																																	0													102.0	103.0	103.0					14																	91931710		2203	4300	6503	SO:0001583	missense	0			AK000714	CCDS9895.1, CCDS61532.1	14q32.12	2008-09-15	2006-10-12	2006-10-12		ENSG00000100796			20219	protein-coding gene	gene with protein product		610351	"""KIAA2010"""	KIAA2010		16085932, 18487071	Standard	XM_005267842		Approved	FLJ20707, MSTP033, FLFL1, smk-1, smk1	uc001xzm.3	Q6IN85		ENST00000554943.1:c.1714C>A	14.37:g.91931710G>T	ENSP00000450883:p.Arg572Ser		Q69YK6|Q86U23|Q86YI7|Q8IVG1|Q9H3F1|Q9H7U8|Q9NV01|Q9NWP1	Missense_Mutation	SNP	pfam_DUF625,superfamily_ARM-type_fold	p.R572S	ENST00000554943.1	37	c.1714		14	.	.	.	.	.	.	.	.	.	.	G	13.36	2.214790	0.39102	.	.	ENSG00000100796	ENST00000554684;ENST00000337238;ENST00000428424;ENST00000554943;ENST00000555462;ENST00000554390	D;D;D;D;D;D	0.95518	-3.73;-3.73;-3.73;-3.73;-3.73;-3.73	6.17	5.29	0.74685	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.95277	0.8468	M	0.66297	2.02	0.80722	D	1	P;B;P	0.36171	0.491;0.406;0.541	B;B;B	0.42995	0.142;0.165;0.404	D	0.94276	0.7515	10	0.36615	T	0.2	-5.3299	15.6271	0.76870	0.0653:0.0:0.9346:0.0	.	333;572;559	Q6IN85-4;Q6IN85;Q6IN85-2	.;P4R3A_HUMAN;.	S	559;559;333;572;333;559	ENSP00000450864:R559S;ENSP00000337125:R559S;ENSP00000392704:R333S;ENSP00000450883:R572S;ENSP00000450891:R333S;ENSP00000452596:R559S	ENSP00000337125:R559S	R	-	1	0	SMEK1	91001463	1.000000	0.71417	1.000000	0.80357	0.033000	0.12548	9.869000	0.99810	1.632000	0.50472	-0.140000	0.14226	CGC	SMEK1	-	superfamily_ARM-type_fold	ENSG00000100796		0.358	SMEK1-007	KNOWN	basic	protein_coding	SMEK1	HGNC	protein_coding	OTTHUMT00000411665.1		0.00	19	0	G	NM_032560		91931710	-1			no_errors	ENST00000554943	ensembl	human	known	74_37	missense	5.71	33	2	SNP	1.000	T
SPATA31D1	389763	genome.wustl.edu	37	9	84608402	84608402	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr9:84608402C>A	ENST00000344803.2	+	4	3064	c.3017C>A	c.(3016-3018)tCt>tAt	p.S1006Y		NM_001001670.2	NP_001001670.1	Q6ZQQ2	S31D1_HUMAN	SPATA31 subfamily D, member 1	1006					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											AGACAATTTTCTGATACTGAC	0.473																																																	0													154.0	157.0	156.0					9																	84608402		1904	4113	6017	SO:0001583	missense	0				CCDS47986.1	9q21.32	2012-10-12	2012-10-12	2012-10-12	ENSG00000214929	ENSG00000214929			37283	protein-coding gene	gene with protein product			"""family with sequence similarity 75, member D1"""	FAM75D1			Standard	NM_001001670		Approved	FLJ46321	uc004amn.3	Q6ZQQ2	OTTHUMG00000169122	ENST00000344803.2:c.3017C>A	9.37:g.84608402C>A	ENSP00000341988:p.Ser1006Tyr			Missense_Mutation	SNP	NULL	p.S1006Y	ENST00000344803.2	37	c.3017	CCDS47986.1	9	.	.	.	.	.	.	.	.	.	.	C	7.392	0.630973	0.14322	.	.	ENSG00000214929	ENST00000344803	T	0.08807	3.05	1.85	0.926	0.19430	.	1.177410	0.06758	U	0.781296	T	0.11367	0.0277	N	0.19112	0.55	0.09310	N	1	D	0.64830	0.994	P	0.59595	0.86	T	0.32025	-0.9922	10	0.51188	T	0.08	.	4.2595	0.10733	0.0:0.7854:0.0:0.2146	.	1006	Q6ZQQ2	F75D1_HUMAN	Y	1006	ENSP00000341988:S1006Y	ENSP00000341988:S1006Y	S	+	2	0	FAM75D1	83798222	0.004000	0.15560	0.052000	0.19188	0.017000	0.09413	0.225000	0.17757	0.367000	0.24454	0.485000	0.47835	TCT	SPATA31D1	-	NULL	ENSG00000214929		0.473	SPATA31D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPATA31D1	HGNC	protein_coding	OTTHUMT00000402325.1	-	0.00	64	0	C	NM_001001670		84608402	+1	tier1	-	no_errors	ENST00000344803	ensembl	human	known	74_37	missense	25.00	54	18	SNP	0.054	A
SNAPC4	6621	genome.wustl.edu	37	9	139286514	139286514	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr9:139286514C>A	ENST00000298532.2	-	9	1223	c.855G>T	c.(853-855)caG>caT	p.Q285H		NM_003086.2	NP_003077.2			small nuclear RNA activating complex, polypeptide 4, 190kDa											biliary_tract(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(13)|ovary(1)|prostate(3)|skin(2)|urinary_tract(1)	33		Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;5.31e-06)|Epithelial(140;7.13e-06)		GCTCCGAGTTCTGCCAGAACT	0.637																																																	0													118.0	112.0	114.0					9																	139286514		2203	4300	6503	SO:0001583	missense	0			AF032387	CCDS6998.1	9q34.3	2008-07-21	2002-08-29		ENSG00000165684	ENSG00000165684			11137	protein-coding gene	gene with protein product		602777	"""small nuclear RNA activating complex, polypeptide 4, 190kD"""			9418884	Standard	XM_005266096		Approved	SNAP190, PTFalpha, FLJ13451	uc004chh.3	Q5SXM2	OTTHUMG00000020929	ENST00000298532.2:c.855G>T	9.37:g.139286514C>A	ENSP00000298532:p.Gln285His			Missense_Mutation	SNP	pfam_SANT/Myb,superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_Myb-like_dom	p.Q285H	ENST00000298532.2	37	c.855	CCDS6998.1	9	.	.	.	.	.	.	.	.	.	.	C	19.69	3.874939	0.72180	.	.	ENSG00000165684	ENST00000298532	T	0.31769	1.48	5.69	4.8	0.61643	SANT domain, DNA binding (1);Homeodomain-like (1);MYB-like (1);	0.000000	0.85682	D	0.000000	T	0.50188	0.1601	M	0.63843	1.955	0.37453	D	0.914891	D	0.89917	1.0	D	0.87578	0.998	T	0.58730	-0.7585	10	0.72032	D	0.01	-24.4653	10.2909	0.43594	0.0:0.8334:0.0:0.1666	.	285	Q5SXM2	SNPC4_HUMAN	H	285	ENSP00000298532:Q285H	ENSP00000298532:Q285H	Q	-	3	2	SNAPC4	138406335	1.000000	0.71417	1.000000	0.80357	0.785000	0.44390	3.307000	0.51888	1.405000	0.46838	-0.150000	0.13652	CAG	SNAPC4	-	superfamily_Homeodomain-like,smart_SANT/Myb	ENSG00000165684		0.637	SNAPC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNAPC4	HGNC	protein_coding	OTTHUMT00000055071.1	-	0.00	36	0	C	NM_003086		139286514	-1	tier1	-	no_errors	ENST00000298532	ensembl	human	known	74_37	missense	77.27	5	17	SNP	1.000	A
SPATC1L	84221	genome.wustl.edu	37	21	47588410	47588410	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr21:47588410C>G	ENST00000291672.5	-	3	1417	c.356G>C	c.(355-357)aGt>aCt	p.S119T	SPATC1L_ENST00000330205.6_5'UTR	NM_001142854.1	NP_001136326.1	Q9H0A9	SPC1L_HUMAN	spermatogenesis and centriole associated 1-like	119																	CTCTGGGGGACTGAGGAAGGC	0.667																																																	0													48.0	50.0	49.0					21																	47588410		692	1591	2283	SO:0001583	missense	0			BC009497	CCDS13732.1, CCDS46653.1	21q22.3	2013-01-21	2012-11-12	2012-11-12	ENSG00000160284	ENSG00000160284			1298	protein-coding gene	gene with protein product	"""speriolin-like protein"""	612412	"""chromosome 21 open reading frame 56"""	C21orf56			Standard	NM_032261		Approved		uc011afu.2	Q9H0A9	OTTHUMG00000090487	ENST00000291672.5:c.356G>C	21.37:g.47588410C>G	ENSP00000291672:p.Ser119Thr		B4E323|Q52LS9|Q6FIH5|Q6P0L3|Q9NSE5	Missense_Mutation	SNP	NULL	p.S119T	ENST00000291672.5	37	c.356	CCDS46653.1	21	.	.	.	.	.	.	.	.	.	.	C	1.769	-0.484911	0.04352	.	.	ENSG00000160284	ENST00000291672	T	0.39997	1.05	5.31	3.5	0.40072	.	0.214229	0.32753	N	0.005688	T	0.25306	0.0615	N	0.24115	0.695	0.09310	N	1	P	0.35982	0.531	B	0.35278	0.199	T	0.10497	-1.0627	10	0.22706	T	0.39	-18.6643	8.1153	0.30940	0.0:0.813:0.0:0.187	.	119	Q9H0A9	CU056_HUMAN	T	119	ENSP00000291672:S119T	ENSP00000291672:S119T	S	-	2	0	C21orf56	46412838	0.001000	0.12720	0.022000	0.16811	0.078000	0.17371	-0.014000	0.12656	0.635000	0.30488	0.467000	0.42956	AGT	SPATC1L	-	NULL	ENSG00000160284		0.667	SPATC1L-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SPATC1L	HGNC	protein_coding	OTTHUMT00000376654.1	-	0.00	32	0	C	NM_032261		47588410	-1	tier1	-	no_errors	ENST00000291672	ensembl	human	known	74_37	missense	14.29	36	6	SNP	0.066	G
SPEF2	79925	genome.wustl.edu	37	5	35618123	35618123	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr5:35618123G>T	ENST00000356031.3	+	1	178	c.24G>T	c.(22-24)tgG>tgT	p.W8C	SPEF2_ENST00000282469.6_Missense_Mutation_p.W8C|SPEF2_ENST00000509059.1_Missense_Mutation_p.W8C|SPEF2_ENST00000440995.2_Missense_Mutation_p.W8C	NM_024867.3	NP_079143.3	Q9C093	SPEF2_HUMAN	sperm flagellar 2	8	CH. {ECO:0000255|PROSITE- ProRule:PRU00044}.				axoneme assembly (GO:0035082)|brain morphogenesis (GO:0048854)|embryonic neurocranium morphogenesis (GO:0048702)|fertilization (GO:0009566)|immune system development (GO:0002520)|multicellular organismal aging (GO:0010259)|respiratory system development (GO:0060541)|spermatogenesis (GO:0007283)	Golgi apparatus (GO:0005794)|manchette (GO:0002177)|sperm midpiece (GO:0097225)				breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(15)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	37	all_lung(31;7.56e-05)		Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			TGTGCCAGTGGCTCAACAAGG	0.672											OREG0016560	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													55.0	44.0	48.0					5																	35618123		2202	4299	6501	SO:0001583	missense	0			AB051557	CCDS3910.1, CCDS43309.1	5p13.2	2010-05-04			ENSG00000152582	ENSG00000152582			26293	protein-coding gene	gene with protein product	"""cancer/testis antigen 122"""	610172				11214970, 16549801, 17610085	Standard	NM_024867		Approved	KPL2, FLJ23577, CT122	uc003jjo.3	Q9C093	OTTHUMG00000131111	ENST00000356031.3:c.24G>T	5.37:g.35618123G>T	ENSP00000348314:p.Trp8Cys	856	Q2TAC9|Q96LL6|Q9H5C7|Q9H5Q7	Missense_Mutation	SNP	pfam_DUF1042,pfam_Adenylate_kin,pfam_HATC_dom_C,superfamily_P-loop_NTPase,superfamily_CH-domain,pfscan_CH-domain	p.W8C	ENST00000356031.3	37	c.24	CCDS43309.1	5	.	.	.	.	.	.	.	.	.	.	G	22.1	4.248418	0.80024	.	.	ENSG00000152582	ENST00000282469;ENST00000356031;ENST00000509059;ENST00000510777;ENST00000440995	T;T;T;T;T	0.66280	-0.2;-0.2;-0.2;-0.2;-0.2	6.01	6.01	0.97437	Calponin homology domain (1);	0.000000	0.85682	D	0.000000	T	0.79770	0.4503	M	0.81112	2.525	0.80722	D	1	D;D;D	0.76494	0.999;0.999;0.998	D;D;D	0.69479	0.964;0.964;0.912	T	0.81527	-0.0892	10	0.87932	D	0	.	16.0162	0.80441	0.0:0.0:1.0:0.0	.	8;8;8	D6REZ4;Q9C093;Q9C093-3	.;SPEF2_HUMAN;.	C	8	ENSP00000282469:W8C;ENSP00000348314:W8C;ENSP00000421593:W8C;ENSP00000426259:W8C;ENSP00000412125:W8C	ENSP00000282469:W8C	W	+	3	0	SPEF2	35653880	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.952000	0.63618	2.852000	0.98041	0.643000	0.83706	TGG	SPEF2	-	pfam_DUF1042,superfamily_CH-domain,pfscan_CH-domain	ENSG00000152582		0.672	SPEF2-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	SPEF2	HGNC	protein_coding	OTTHUMT00000367199.1	-	0.00	31	0	G	NM_144722		35618123	+1	tier1	-	no_errors	ENST00000356031	ensembl	human	known	74_37	missense	6.67	56	4	SNP	1.000	T
SPIN1	10927	genome.wustl.edu	37	9	91041391	91041391	+	5'UTR	SNP	A	A	T			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr9:91041391A>T	ENST00000375859.3	+	0	215				SPIN1_ENST00000469017.2_3'UTR|SPIN1_ENST00000541629.1_5'UTR	NM_006717.2	NP_006708.2	Q9Y657	SPIN1_HUMAN	spindlin 1						chromatin modification (GO:0016568)|gamete generation (GO:0007276)|meiotic nuclear division (GO:0007126)|multicellular organismal development (GO:0007275)|positive regulation of Wnt signaling pathway (GO:0030177)|rRNA transcription (GO:0009303)|Wnt signaling pathway (GO:0016055)	nucleolus (GO:0005730)|nucleus (GO:0005634)|spindle (GO:0005819)	methylated histone binding (GO:0035064)			endometrium(1)|large_intestine(1)|lung(1)|upper_aerodigestive_tract(1)	4						AAAAGTTTCAAATTGGAGAAT	0.418																																																	0													16.0	17.0	17.0					9																	91041391		692	1591	2283	SO:0001623	5_prime_UTR_variant	0			AF317228	CCDS43843.1	9q22.1	2008-02-05	2007-01-03	2007-01-03	ENSG00000106723	ENSG00000106723			11243	protein-coding gene	gene with protein product		609936	"""spindlin"""	SPIN		16098913	Standard	NM_006717		Approved		uc004apy.3	Q9Y657	OTTHUMG00000020168	ENST00000375859.3:c.-64A>T	9.37:g.91041391A>T			A8K0X6|B3KRQ4|Q7KZJ8|Q9GZT2|Q9H0N7	RNA	SNP	-	NULL	ENST00000375859.3	37	NULL	CCDS43843.1	9																																																																																			SPIN1	-	-	ENSG00000106723		0.418	SPIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPIN1	HGNC	protein_coding	OTTHUMT00000052967.1	-	0.00	13	0	A	NM_006717		91041391	+1	tier1	-	no_errors	ENST00000462844	ensembl	human	known	74_37	rna	78.26	5	18	SNP	0.995	T
SRCIN1	80725	genome.wustl.edu	37	17	36708054	36708054	+	Intron	SNP	A	A	G			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr17:36708054A>G	ENST00000264659.7	-	14	2952				SRCIN1_ENST00000578925.1_Intron|SRCIN1_ENST00000398579.4_Intron	NM_025248.2	NP_079524.2	Q9C0H9	SRCN1_HUMAN	SRC kinase signaling inhibitor 1						exocytosis (GO:0006887)|negative regulation of protein tyrosine kinase activity (GO:0061099)|positive regulation of protein tyrosine kinase activity (GO:0061098)|regulation of cell migration (GO:0030334)|regulation of dendritic spine morphogenesis (GO:0061001)|substrate adhesion-dependent cell spreading (GO:0034446)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	protein kinase binding (GO:0019901)			endometrium(2)|kidney(1)|large_intestine(6)|lung(9)|prostate(1)	19						TCCCCACTCTAGGAAGGATGG	0.547																																																	0																																										SO:0001627	intron_variant	0				CCDS45660.1	17q12	2009-12-14			ENSG00000017373	ENSG00000277363			29506	protein-coding gene	gene with protein product	"""p130Cas-associated protein"", ""SNAP-25-interacting protein"""	610786				11214970	Standard	NM_025248		Approved	SNIP, p140Cap, KIAA1684	uc002hqd.3	Q9C0H9		ENST00000264659.7:c.2727+67T>C	17.37:g.36708054A>G			Q75T46|Q8N4W8	RNA	SNP	-	NULL	ENST00000264659.7	37	NULL	CCDS45660.1	17																																																																																			SRCIN1	-	-	ENSG00000017373		0.547	SRCIN1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SRCIN1	HGNC	protein_coding	OTTHUMT00000441878.4	-	0.00	25	0	A	NM_025248		36708054	-1	tier1	-	no_errors	ENST00000578160	ensembl	human	known	74_37	rna	23.08	20	6	SNP	0.000	G
SRP68	6730	genome.wustl.edu	37	17	74035188	74035188	+	3'UTR	SNP	C	C	T			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr17:74035188C>T	ENST00000307877.2	-	0	2644				SRP68_ENST00000542536.2_5'UTR|SRP68_ENST00000539137.1_3'UTR|SRP68_ENST00000602720.1_3'UTR	NM_014230.3	NP_055045.2	Q9UHB9	SRP68_HUMAN	signal recognition particle 68kDa						cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|response to drug (GO:0042493)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|nucleolus (GO:0005730)|ribosome (GO:0005840)|signal recognition particle, endoplasmic reticulum targeting (GO:0005786)	7S RNA binding (GO:0008312)|endoplasmic reticulum signal peptide binding (GO:0030942)|poly(A) RNA binding (GO:0044822)|signal recognition particle binding (GO:0005047)			NS(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(5)|lung(4)|ovary(2)|prostate(3)	23						GCACAGTCTCCGTCATCTTTG	0.443																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AF195951	CCDS11738.1, CCDS58600.1, CCDS58601.1	17q25.1	2010-04-30	2002-08-29		ENSG00000167881	ENSG00000167881			11302	protein-coding gene	gene with protein product		604858	"""signal recognition particle 68kD"""			10618370	Standard	NM_014230		Approved		uc002jqk.2	Q9UHB9		ENST00000307877.2:c.*599G>A	17.37:g.74035188C>T			B3KUU5|B3KWY7|G3V1U4|Q8NCJ4|Q8WUK2	RNA	SNP	-	NULL	ENST00000307877.2	37	NULL	CCDS11738.1	17																																																																																			SRP68	-	-	ENSG00000167881		0.443	SRP68-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRP68	HGNC	protein_coding	OTTHUMT00000449487.1	-	0.00	45	0	C	NM_014230		74035188	-1	tier1	-	no_errors	ENST00000542536	ensembl	human	known	74_37	rna	30.00	28	12	SNP	0.872	T
STAU2	27067	genome.wustl.edu	37	8	74332366	74332366	+	IGR	SNP	C	C	T			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr8:74332366C>T	ENST00000524300.1	-	0	3065				STAU2-AS1_ENST00000517604.1_lincRNA	NM_001164380.1|NM_001164381.1	NP_001157852.1|NP_001157853.1	Q9NUL3	STAU2_HUMAN	staufen double-stranded RNA binding protein 2						transport (GO:0006810)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|microtubule (GO:0005874)|nucleus (GO:0005634)	double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(5)|liver(1)|lung(6)|ovary(1)	19	Breast(64;0.0138)		Epithelial(68;0.026)|BRCA - Breast invasive adenocarcinoma(89;0.0483)|all cancers(69;0.0972)			GTAGTGTTTTCTCATTGCACA	0.458																																																	0																																										SO:0001628	intergenic_variant	0			Y19062	CCDS6214.1, CCDS55244.1, CCDS55245.1, CCDS55246.1, CCDS55247.1, CCDS55248.1	8q21.11	2013-06-05	2013-06-05		ENSG00000040341	ENSG00000040341			11371	protein-coding gene	gene with protein product		605920	"""staufen (Drosophila, RNA-binding protein) homolog 2"", ""staufen, RNA binding protein, homolog 2 (Drosophila)"""			10585778	Standard	NM_014393		Approved	39K2	uc003xzm.3	Q9NUL3	OTTHUMG00000164499		8.37:g.74332366C>T			B7Z1I6|B7Z292|B7Z8B4|E7ER74|E9PEI3|E9PF26|E9PF50|Q6AHY7|Q96HM0|Q96HM1|Q9NVI5|Q9UGG6	RNA	SNP	-	NULL	ENST00000524300.1	37	NULL	CCDS55247.1	8																																																																																			STAU2-AS1	-	-	ENSG00000253302		0.458	STAU2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STAU2-AS1	HGNC	protein_coding	OTTHUMT00000379000.2	-	0.00	29	0	C	NM_001164380		74332366	+1	tier1	-	no_errors	ENST00000517604	ensembl	human	known	74_37	rna	31.82	15	7	SNP	1.000	T
STT3B	201595	genome.wustl.edu	37	3	31677578	31677579	+	3'UTR	DNP	CT	CT	TG			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	C|T	C|T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr3:31677578_31677579CT>TG	ENST00000295770.2	+	0	2712_2713					NM_178862.1	NP_849193.1	Q8TCJ2	STT3B_HUMAN	STT3B, subunit of the oligosaccharyltransferase complex (catalytic)						co-translational protein modification (GO:0043686)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|glycoprotein catabolic process (GO:0006516)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|response to unfolded protein (GO:0006986)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|oligosaccharyltransferase complex (GO:0008250)	dolichyl-diphosphooligosaccharide-protein glycotransferase activity (GO:0004579)			autonomic_ganglia(1)|biliary_tract(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(3)|prostate(1)|upper_aerodigestive_tract(1)	19						TGGTTCCTAACTTGAAGCAGTT	0.406																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AK027789	CCDS2650.1	3p24.1	2013-03-06	2013-03-06		ENSG00000163527	ENSG00000163527	2.4.99.18		30611	protein-coding gene	gene with protein product	"""source of immunodominant MHC associated peptides"", ""dolichyl-diphosphooligosaccharide protein glycotransferase"""	608605	"""STT3, subunit of the oligosaccharyltransferase complex, homolog B (S. cerevisiae)"""			12887896, 12439619	Standard	XM_006713017		Approved	SIMP, FLJ90106, STT3-B	uc011axe.2	Q8TCJ2	OTTHUMG00000130673	Exception_encountered	3.37:g.31677578_31677579delinsTG			Q96JZ4|Q96KY7	RNA	SNP	-	NULL	ENST00000295770.2	37	NULL	CCDS2650.1	3																																																																																			STT3B	-	-	ENSG00000163527		0.406	STT3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STT3B	HGNC	protein_coding	OTTHUMT00000253166.2	-	0.00	56	0	C|T	NM_178862		31677578|31677579	+1	tier1	-	no_errors	ENST00000463044	ensembl	human	known	74_37	rna	20.00	16	4	SNP	1.000	T|G
SUGP2	10147	genome.wustl.edu	37	19	19120975	19120975	+	Missense_Mutation	SNP	G	G	A	rs372273190		TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr19:19120975G>A	ENST00000601879.1	-	5	2324	c.2027C>T	c.(2026-2028)cCg>cTg	p.P676L	SUGP2_ENST00000337018.6_Missense_Mutation_p.P676L|SUGP2_ENST00000456085.2_Missense_Mutation_p.P445L|SUGP2_ENST00000452918.2_Missense_Mutation_p.P676L|SUGP2_ENST00000600377.1_Missense_Mutation_p.P690L			Q8IX01	SUGP2_HUMAN	SURP and G patch domain containing 2	676					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(1)|endometrium(8)|kidney(1)|large_intestine(9)|lung(13)|ovary(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	43						CCGCTGCCACGGAAGGAGTTT	0.657																																																	0								G	LEU/PRO,LEU/PRO	1,4405	2.1+/-5.4	0,1,2202	78.0	83.0	81.0		2027,2027	5.5	0.8	19		81	0,8600		0,0,4300	no	missense,missense	SUGP2	NM_001017392.3,NM_014884.3	98,98	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging,probably-damaging	676/1083,676/1083	19120975	1,13005	2203	4300	6503	SO:0001583	missense	0			AB002363	CCDS12392.1	19p13	2013-01-28	2010-08-10	2010-08-10	ENSG00000064607	ENSG00000064607		"""G patch domain containing"""	18641	protein-coding gene	gene with protein product		607993	"""splicing factor, arginine/serine-rich 14"""	SFRS14		12594045	Standard	NM_014884		Approved	KIAA0365	uc002nkx.2	Q8IX01		ENST00000601879.1:c.2027C>T	19.37:g.19120975G>A	ENSP00000472286:p.Pro676Leu		C9JI71|O15071|O60369|Q5JPH7|Q8WUF7	Missense_Mutation	SNP	pfam_Surp,pfam_G_patch_dom,superfamily_Surp,smart_Surp,smart_G_patch_dom,pfscan_Surp,pfscan_G_patch_dom	p.P676L	ENST00000601879.1	37	c.2027	CCDS12392.1	19	.	.	.	.	.	.	.	.	.	.	G	19.22	3.785649	0.70337	2.27E-4	0.0	ENSG00000064607	ENST00000337018;ENST00000330854;ENST00000452918;ENST00000456085	T;T;T;T	0.12984	2.77;2.84;2.77;2.63	5.49	5.49	0.81192	.	0.217967	0.32430	N	0.006118	T	0.23054	0.0557	L	0.29908	0.895	0.26417	N	0.976161	D;D;D	0.89917	1.0;1.0;0.999	D;D;P	0.64506	0.926;0.926;0.894	T	0.03750	-1.1007	10	0.87932	D	0	-15.6657	12.0658	0.53588	0.0:0.0:0.8165:0.1835	.	445;676;676	E7ETX7;A8K5G0;Q8IX01	.;.;SUGP2_HUMAN	L	676;676;676;445	ENSP00000337926:P676L;ENSP00000332373:P676L;ENSP00000389380:P676L;ENSP00000409603:P445L	ENSP00000332373:P676L	P	-	2	0	SUGP2	18981975	0.997000	0.39634	0.835000	0.33067	0.781000	0.44180	3.911000	0.56378	2.590000	0.87494	0.655000	0.94253	CCG	SUGP2	-	NULL	ENSG00000064607		0.657	SUGP2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SUGP2	HGNC	protein_coding	OTTHUMT00000464627.1		0.00	20	0	G	NM_001017392		19120975	-1			no_errors	ENST00000337018	ensembl	human	known	74_37	missense	12.50	42	6	SNP	0.286	A
SUSD1	64420	genome.wustl.edu	37	9	114820919	114820919	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr9:114820919G>C	ENST00000374270.3	-	14	2070	c.1898C>G	c.(1897-1899)tCt>tGt	p.S633C	SUSD1_ENST00000374264.2_Missense_Mutation_p.S633C|SUSD1_ENST00000374263.3_Missense_Mutation_p.S633C	NM_022486.3	NP_071931.2	Q6UWL2	SUSD1_HUMAN	sushi domain containing 1	633						integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)		SUSD1/ROD1(2)	central_nervous_system(1)|endometrium(4)|large_intestine(8)|lung(11)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	28						AGAATCACAAGAAAATGTGCT	0.488																																																	0													96.0	100.0	99.0					9																	114820919		2203	4300	6503	SO:0001583	missense	0			AL137432	CCDS6783.1, CCDS65105.1, CCDS65106.1	9q31.3-q33.1	2008-02-05			ENSG00000106868	ENSG00000106868			25413	protein-coding gene	gene with protein product						12975309	Standard	NM_022486		Approved	DKFZP761E1824	uc004bfu.3	Q6UWL2	OTTHUMG00000020499	ENST00000374270.3:c.1898C>G	9.37:g.114820919G>C	ENSP00000363388:p.Ser633Cys		A1A4C5|A8KA03|Q5T8V6|Q5T8V7|Q6P9G7|Q8WU83|Q96DM9|Q9H6V2|Q9NTA7	Missense_Mutation	SNP	pfam_EGF-like_Ca-bd_dom,pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,superfamily_Fibronectin_type3,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_Sushi_SCR_CCP,pfscan_EG-like_dom,pfscan_Sushi_SCR_CCP	p.S633C	ENST00000374270.3	37	c.1898	CCDS6783.1	9	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	11.87|11.87	1.768777|1.768777	0.31320|0.31320	.|.	.|.	ENSG00000106868|ENSG00000106868	ENST00000355396|ENST00000374270;ENST00000374263;ENST00000374264	T|T;T;T	0.27720|0.32515	1.65|1.45;1.45;1.45	5.44|5.44	4.52|4.52	0.55395|0.55395	.|.	.|1.230040	.|0.05837	.|N	.|0.618582	T|T	0.35885|0.35885	0.0947|0.0947	L|L	0.44542|0.44542	1.39|1.39	0.26856|0.26856	N|N	0.968058|0.968058	.|P;D;P	.|0.54964	.|0.911;0.969;0.761	.|P;P;B	.|0.50192	.|0.634;0.634;0.338	T|T	0.12372|0.12372	-1.0550|-1.0550	7|10	0.72032|0.42905	D|T	0.01|0.14	-0.135|-0.135	5.9796|5.9796	0.19399|0.19399	0.1774:0.0:0.6696:0.1529|0.1774:0.0:0.6696:0.1529	.|.	.|633;633;633	.|F8WAQ1;Q6UWL2-2;Q6UWL2	.|.;.;SUSD1_HUMAN	L|C	616|633	ENSP00000347558:F616L|ENSP00000363388:S633C;ENSP00000363381:S633C;ENSP00000363382:S633C	ENSP00000347558:F616L|ENSP00000363381:S633C	F|S	-|-	3|2	2|0	SUSD1|SUSD1	113860740|113860740	0.383000|0.383000	0.25156|0.25156	0.997000|0.997000	0.53966|0.53966	0.155000|0.155000	0.21991|0.21991	0.123000|0.123000	0.15708|0.15708	1.230000|1.230000	0.43646|0.43646	0.561000|0.561000	0.74099|0.74099	TTC|TCT	SUSD1	-	NULL	ENSG00000106868		0.488	SUSD1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	SUSD1	HGNC	protein_coding	OTTHUMT00000053668.3	-	0.00	40	0	G	NM_022486		114820919	-1	tier1	-	no_errors	ENST00000374264	ensembl	human	known	74_37	missense	12.12	58	8	SNP	0.995	C
SV2B	9899	genome.wustl.edu	37	15	91832773	91832773	+	Silent	SNP	A	A	C			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr15:91832773A>C	ENST00000394232.1	+	12	2201	c.1731A>C	c.(1729-1731)gcA>gcC	p.A577A	SV2B_ENST00000330276.4_Silent_p.A577A|SV2B_ENST00000545111.2_Silent_p.A426A	NM_014848.4	NP_055663.1	Q7L1I2	SV2B_HUMAN	synaptic vesicle glycoprotein 2B	577					neurotransmitter transport (GO:0006836)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|synaptic vesicle (GO:0008021)	transmembrane transporter activity (GO:0022857)			NS(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(17)|ovary(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	42	Lung NSC(78;0.0987)|all_lung(78;0.172)		BRCA - Breast invasive adenocarcinoma(143;0.0895)			TAATCTCTGCAGTCTGCTGCT	0.527																																																	0													218.0	187.0	198.0					15																	91832773		2198	4298	6496	SO:0001819	synonymous_variant	0			AB018278	CCDS10370.1, CCDS53972.1	15q26.1	2005-01-10			ENSG00000185518	ENSG00000185518			16874	protein-coding gene	gene with protein product		185861				9872452, 7681585	Standard	NM_014848		Approved	KIAA0735, HsT19680	uc002bqv.3	Q7L1I2	OTTHUMG00000149833	ENST00000394232.1:c.1731A>C	15.37:g.91832773A>C			B4DH30|C6G489|O94840|Q6IAR8	Silent	SNP	pfam_MFS,pfam_Sub_transporter,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_SV2	p.A577	ENST00000394232.1	37	c.1731	CCDS10370.1	15																																																																																			SV2B	-	pfam_MFS,pfam_Sub_transporter,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_SV2	ENSG00000185518		0.527	SV2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SV2B	HGNC	protein_coding	OTTHUMT00000313494.3	-	0.00	46	0	A	NM_014848		91832773	+1	tier1	-	no_errors	ENST00000330276	ensembl	human	known	74_37	silent	22.37	59	17	SNP	0.028	C
SYNRG	11276	genome.wustl.edu	37	17	35930849	35930849	+	Missense_Mutation	SNP	A	A	T			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr17:35930849A>T	ENST00000339208.6	-	10	1374	c.1234T>A	c.(1234-1236)Tcc>Acc	p.S412T	SYNRG_ENST00000502449.2_Missense_Mutation_p.S334T|SYNRG_ENST00000591288.1_Intron|SYNRG_ENST00000585472.1_Missense_Mutation_p.S333T|SYNRG_ENST00000346661.4_Missense_Mutation_p.S412T|SYNRG_ENST00000588194.1_5'UTR|SYNRG_ENST00000345615.4_Missense_Mutation_p.S334T|SYNRG_ENST00000394378.2_Missense_Mutation_p.S334T	NM_001163544.1|NM_001163545.1|NM_007247.4	NP_001157016.1|NP_001157017.1|NP_009178.3	Q9UMZ2	SYNRG_HUMAN	synergin, gamma	412					endocytosis (GO:0006897)|intracellular protein transport (GO:0006886)	AP-1 adaptor complex (GO:0030121)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)	calcium ion binding (GO:0005509)			breast(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(14)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	36						AGGGGCATGGAGCCCGCAGGA	0.542																																																	0													66.0	64.0	65.0					17																	35930849		2203	4300	6503	SO:0001583	missense	0			AF169548	CCDS11321.1, CCDS11322.1, CCDS11322.2, CCDS54113.1, CCDS54114.1, CCDS59284.1, CCDS59285.1	17q12	2014-04-16	2009-07-20	2009-07-20	ENSG00000006114	ENSG00000275066			557	protein-coding gene	gene with protein product	"""gamma-synergin"", ""adaptor-related protein complex 1 gamma subunit-binding protein 1"""	607291	"""AP1 gamma subunit binding protein 1"""	AP1GBP1		10477754	Standard	XM_005256980		Approved	SYNG, MGC104959	uc010wdf.2	Q9UMZ2	OTTHUMG00000188473	ENST00000339208.6:c.1234T>A	17.37:g.35930849A>T	ENSP00000343610:p.Ser412Thr		A8MWU4|B7ZKZ2|B7ZKZ3|Q17RI2|Q5BKU5|Q6ZT17	Missense_Mutation	SNP	smart_EPS15_homology,pfscan_EPS15_homology	p.S412T	ENST00000339208.6	37	c.1234	CCDS11321.1	17	.	.	.	.	.	.	.	.	.	.	A	27.2	4.813110	0.90707	.	.	ENSG00000006114	ENST00000346661;ENST00000345615;ENST00000502449;ENST00000394378	T;T;T	0.49139	1.39;0.79;0.81	5.62	5.62	0.85841	.	0.000000	0.85682	D	0.000000	T	0.66025	0.2748	M	0.63843	1.955	0.80722	D	1	D;P;D;D;D	0.63046	0.962;0.935;0.962;0.992;0.992	P;P;P;D;D	0.75484	0.679;0.679;0.679;0.986;0.986	T	0.65738	-0.6095	10	0.44086	T	0.13	-11.1364	15.8373	0.78808	1.0:0.0:0.0:0.0	.	334;334;334;412;412	Q9UMZ2-3;A8MWU4;Q9UMZ2-4;Q9UMZ2-5;Q9UMZ2	.;.;.;.;SYNRG_HUMAN	T	412;412;334;334	ENSP00000005279:S412T;ENSP00000424893:S334T;ENSP00000377903:S334T	ENSP00000315722:S412T	S	-	1	0	SYNRG	33004962	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	4.978000	0.63799	2.150000	0.67090	0.528000	0.53228	TCC	SYNRG	-	NULL	ENSG00000006114		0.542	SYNRG-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYNRG	HGNC	protein_coding	OTTHUMT00000256811.2	-	0.00	22	0	A	NM_007247		35930849	-1	tier1	-	no_errors	ENST00000339208	ensembl	human	known	74_37	missense	69.05	13	29	SNP	1.000	T
TANGO6	79613	genome.wustl.edu	37	16	69008066	69008066	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr16:69008066C>A	ENST00000261778.1	+	15	2849	c.2837C>A	c.(2836-2838)gCa>gAa	p.A946E		NM_024562.1	NP_078838.1	Q9C0B7	TNG6_HUMAN	transport and golgi organization 6 homolog (Drosophila)	946						integral component of membrane (GO:0016021)											ATCGTCAGGGCATTAGGTGAG	0.478																																																	0													87.0	89.0	88.0					16																	69008066		1979	4168	6147	SO:0001583	missense	0				CCDS45516.1	16q22.1	2012-12-13	2012-12-13	2012-12-13	ENSG00000103047	ENSG00000103047			25749	protein-coding gene	gene with protein product			"""transmembrane and coiled-coil domains 7"""	TMCO7		11214970	Standard	NM_024562		Approved	FLJ12688, KIAA1746	uc002ewi.4	Q9C0B7	OTTHUMG00000176743	ENST00000261778.1:c.2837C>A	16.37:g.69008066C>A	ENSP00000261778:p.Ala946Glu		Q569F9|Q9H9K1	Missense_Mutation	SNP	pfam_DUF2435,pfam_DUF2411,superfamily_ARM-type_fold	p.A946E	ENST00000261778.1	37	c.2837	CCDS45516.1	16	.	.	.	.	.	.	.	.	.	.	C	12.06	1.825897	0.32237	.	.	ENSG00000103047	ENST00000261778	T	0.65178	-0.14	5.59	4.64	0.57946	Armadillo-like helical (1);Armadillo-type fold (1);	0.154165	0.56097	D	0.000021	T	0.46268	0.1384	L	0.42686	1.345	0.09310	N	1	B	0.21606	0.058	B	0.20767	0.031	T	0.36359	-0.9751	10	0.02654	T	1	-3.0157	8.5897	0.33679	0.0:0.7662:0.1521:0.0817	.	946	Q9C0B7	TMCO7_HUMAN	E	946	ENSP00000261778:A946E	ENSP00000261778:A946E	A	+	2	0	TMCO7	67565567	0.143000	0.22626	0.351000	0.25721	0.465000	0.32709	0.728000	0.26013	1.524000	0.49035	-0.143000	0.13931	GCA	TANGO6	-	superfamily_ARM-type_fold	ENSG00000103047		0.478	TANGO6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TANGO6	HGNC	protein_coding	OTTHUMT00000433471.2	-	0.00	55	0	C	XM_928235.2		69008066	+1	tier1	-	no_errors	ENST00000261778	ensembl	human	known	74_37	missense	33.33	29	15	SNP	0.016	A
TAS1R3	83756	genome.wustl.edu	37	1	1268382	1268382	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr1:1268382G>C	ENST00000339381.5	+	4	1389	c.1357G>C	c.(1357-1359)Gag>Cag	p.E453Q		NM_152228.1	NP_689414	Q7RTX0	TS1R3_HUMAN	taste receptor, type 1, member 3	453					detection of chemical stimulus involved in sensory perception of sweet taste (GO:0001582)|G-protein coupled receptor signaling pathway (GO:0007186)|sensory perception of sweet taste (GO:0050916)|sensory perception of umami taste (GO:0050917)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein heterodimerization activity (GO:0046982)|taste receptor activity (GO:0008527)			kidney(2)|lung(8)|upper_aerodigestive_tract(1)|urinary_tract(1)	12	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		Epithelial(90;3.01e-35)|OV - Ovarian serous cystadenocarcinoma(86;3.88e-21)|Colorectal(212;0.000157)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00229)|BRCA - Breast invasive adenocarcinoma(365;0.00251)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.034)|Lung(427;0.146)		CGTGGACATGGAGTACGACCT	0.657																																																	0													57.0	55.0	55.0					1																	1268382		2200	4295	6495	SO:0001583	missense	0			AC026283	CCDS30556.1	1p36	2012-08-22			ENSG00000169962	ENSG00000169962		"""Taste receptors / Type 1"", ""GPCR / Unclassified : Taste receptors"""	15661	protein-coding gene	gene with protein product		605865				11319557	Standard	XM_006710939		Approved	T1R3	uc010nyk.2	Q7RTX0	OTTHUMG00000003071	ENST00000339381.5:c.1357G>C	1.37:g.1268382G>C	ENSP00000344411:p.Glu453Gln		Q5TA49|Q8NGW9	Missense_Mutation	SNP	pfam_ANF_lig-bd_rcpt,pfam_GPCR_3_C,pfam_GPCR_3_9-Cys_dom,superfamily_Peripla_BP_I,pfscan_GPCR_3_C,prints_GPCR_3	p.E453Q	ENST00000339381.5	37	c.1357	CCDS30556.1	1	.	.	.	.	.	.	.	.	.	.	G	10.36	1.328252	0.24080	.	.	ENSG00000169962	ENST00000339381	D	0.82526	-1.62	4.86	0.355	0.16069	Extracellular ligand-binding receptor (1);	2.333990	0.02281	N	0.069417	T	0.78830	0.4345	L	0.36672	1.1	0.09310	N	1	P	0.48407	0.91	P	0.51079	0.658	T	0.65356	-0.6188	10	0.09338	T	0.73	.	3.448	0.07487	0.1482:0.2413:0.487:0.1235	.	453	Q7RTX0	TS1R3_HUMAN	Q	453	ENSP00000344411:E453Q	ENSP00000344411:E453Q	E	+	1	0	TAS1R3	1258245	0.000000	0.05858	0.005000	0.12908	0.632000	0.37999	0.339000	0.19875	0.428000	0.26173	0.456000	0.33151	GAG	TAS1R3	-	pfam_ANF_lig-bd_rcpt,superfamily_Peripla_BP_I	ENSG00000169962		0.657	TAS1R3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAS1R3	HGNC	protein_coding	OTTHUMT00000008493.1	-	0.00	45	0	G			1268382	+1	tier1	-	no_errors	ENST00000339381	ensembl	human	known	74_37	missense	24.39	31	10	SNP	0.000	C
TCAM1P	146771	genome.wustl.edu	37	17	61939715	61939715	+	RNA	SNP	C	C	A			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr17:61939715C>A	ENST00000478379.1	+	0	1486					NR_002947.2				testicular cell adhesion molecule 1, pseudogene																		ATGGAACACACGCTCGCCTGC	0.542																																																	0																																												0			AB026156		17q23.3	2013-09-26	2012-12-07	2010-03-12	ENSG00000240280	ENSG00000240280			30707	pseudogene	pseudogene		612756	"""testicular cell adhesion molecule 1 homolog (mouse)"", ""testicular cell adhesion molecule 1 homolog (mouse), pseudogene"""	TCAM1		11195349, 2744760, 19766163	Standard	NR_002947		Approved		uc031rdl.1		OTTHUMG00000154404		17.37:g.61939715C>A				RNA	SNP	-	NULL	ENST00000478379.1	37	NULL		17																																																																																			TCAM1P	-	-	ENSG00000240280		0.542	TCAM1P-002	KNOWN	basic	processed_transcript	TCAM1P	HGNC	pseudogene	OTTHUMT00000335083.1		0.00	35	0	C			61939715	+1			no_errors	ENST00000478379	ensembl	human	known	74_37	rna	10.26	35	4	SNP	0.037	A
TMEM129	92305	genome.wustl.edu	37	4	1720170	1720171	+	Frame_Shift_Ins	INS	-	-	G			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr4:1720170_1720171insG	ENST00000382936.3	-	2	881_882	c.388_389insC	c.(388-390)ctcfs	p.L130fs	TMEM129_ENST00000536901.1_Frame_Shift_Ins_p.L130fs|TMEM129_ENST00000303277.2_Frame_Shift_Ins_p.L130fs	NM_001127266.1	NP_001120738.1	A0AVI4	TM129_HUMAN	transmembrane protein 129, E3 ubiquitin protein ligase	130					protein ubiquitination (GO:0016567)|response to unfolded protein (GO:0006986)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	ligase activity (GO:0016874)|metal ion binding (GO:0046872)			lung(2)	2			OV - Ovarian serous cystadenocarcinoma(23;0.00765)			GAGGGCGTAGAGGGCCAGGGTG	0.658																																																	0																																										SO:0001589	frameshift_variant	0			BC009331	CCDS3351.1, CCDS46998.1	4p16.3	2014-07-25	2014-07-25		ENSG00000168936	ENSG00000168936			25137	protein-coding gene	gene with protein product		615975	"""transmembrane protein 129"""			24807418, 25030448	Standard	NM_138385		Approved	D4S2561E	uc003gdn.3	A0AVI4	OTTHUMG00000121150	ENST00000382936.3:c.389dupC	4.37:g.1720173_1720173dupG	ENSP00000372394:p.Leu130fs		A6NH49|A6NI98|D3DVP8	Frame_Shift_Ins	INS	pfam_Tmpp129	p.L130fs	ENST00000382936.3	37	c.389_388	CCDS46998.1	4																																																																																			TMEM129	-	pfam_Tmpp129	ENSG00000168936		0.658	TMEM129-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM129	HGNC	protein_coding	OTTHUMT00000350724.1		0.00	24	0	-	NM_138385		1720171	-1	tier1		no_errors	ENST00000382936	ensembl	human	known	74_37	frame_shift_ins	26.92	19	7	INS	0.009:0.016	G
TMEM155	132332	genome.wustl.edu	37	4	122681585	122681585	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr4:122681585C>A	ENST00000337677.5	-	6	815	c.257G>T	c.(256-258)aGc>aTc	p.S86I	TMEM155_ENST00000394396.1_Missense_Mutation_p.S86I|TMEM155_ENST00000394394.1_Missense_Mutation_p.S86I	NM_152399.2	NP_689612.2	Q4W5P6	TM155_HUMAN	transmembrane protein 155	86						extracellular region (GO:0005576)				breast(1)|lung(5)	6						tctctgtgggcttcctccttc	0.512																																																	0													60.0	56.0	57.0					4																	122681585		2176	4233	6409	SO:0001583	missense	0			AK055396	CCDS3721.1	4q27	2008-02-05			ENSG00000164112	ENSG00000164112			26418	protein-coding gene	gene with protein product							Standard	NM_152399		Approved	FLJ30834	uc003idx.1	Q4W5P6	OTTHUMG00000133035	ENST00000337677.5:c.257G>T	4.37:g.122681585C>A	ENSP00000336987:p.Ser86Ile		D3DNW9|Q96NI2	Missense_Mutation	SNP	NULL	p.S86I	ENST00000337677.5	37	c.257	CCDS3721.1	4	.	.	.	.	.	.	.	.	.	.	C	11.37	1.619482	0.28801	.	.	ENSG00000164112	ENST00000394396;ENST00000337677;ENST00000394394	T;T;T	0.55052	0.54;0.54;0.54	4.2	-1.81	0.07882	.	1.176890	0.06262	N	0.694080	T	0.44117	0.1278	N	0.19112	0.55	0.09310	N	1	P	0.47677	0.899	P	0.50896	0.653	T	0.40459	-0.9562	10	0.87932	D	0	1.7054	5.0979	0.14742	0.0:0.394:0.1494:0.4566	.	86	Q4W5P6	TM155_HUMAN	I	86	ENSP00000377919:S86I;ENSP00000336987:S86I;ENSP00000377917:S86I	ENSP00000336987:S86I	S	-	2	0	TMEM155	122901035	0.001000	0.12720	0.001000	0.08648	0.141000	0.21300	-0.046000	0.11983	-0.450000	0.07107	-0.145000	0.13849	AGC	TMEM155	-	NULL	ENSG00000164112		0.512	TMEM155-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM155	HGNC	protein_coding	OTTHUMT00000256637.2	-	0.00	29	0	C	NM_152399		122681585	-1	tier1	-	no_errors	ENST00000337677	ensembl	human	known	74_37	missense	27.08	35	13	SNP	0.002	A
TMEM45A	55076	genome.wustl.edu	37	3	100295770	100295770	+	Splice_Site	SNP	T	T	G			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr3:100295770T>G	ENST00000323523.4	+	6	1049	c.736T>G	c.(736-738)Ttg>Gtg	p.L246V	TMEM45A_ENST00000403410.1_Splice_Site_p.L262V	NM_018004.1	NP_060474.1	Q9NWC5	TM45A_HUMAN	transmembrane protein 45A	246						integral component of membrane (GO:0016021)				breast(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|skin(2)	11						TCTCCTCAGGTTGGTTAAATC	0.383																																																	0													102.0	107.0	105.0					3																	100295770		2203	4300	6503	SO:0001630	splice_region_variant	0			AK000996	CCDS2937.1	3q12.2	2005-02-04			ENSG00000181458	ENSG00000181458			25480	protein-coding gene	gene with protein product						12477932	Standard	XM_005247568		Approved	FLJ10134, DERP7	uc003dtz.1	Q9NWC5	OTTHUMG00000150327	ENST00000323523.4:c.735-1T>G	3.37:g.100295770T>G			Q53YW5	Missense_Mutation	SNP	pfam_DUF716_TMEM45	p.L246V	ENST00000323523.4	37	c.736	CCDS2937.1	3	.	.	.	.	.	.	.	.	.	.	T	13.04	2.118145	0.37339	.	.	ENSG00000181458	ENST00000323523;ENST00000403410	T;T	0.32988	1.44;1.43	5.71	4.55	0.56014	.	0.422043	0.23014	N	0.052940	T	0.26085	0.0636	M	0.62723	1.935	0.30818	N	0.738112	B	0.23442	0.085	B	0.17979	0.02	T	0.23226	-1.0194	10	0.22706	T	0.39	-11.8211	5.2907	0.15725	0.1558:0.0829:0.0:0.7613	.	246	Q9NWC5	TM45A_HUMAN	V	246;262	ENSP00000319009:L246V;ENSP00000385089:L262V	ENSP00000319009:L246V	L	+	1	2	TMEM45A	101778460	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	1.668000	0.37481	0.997000	0.38969	-0.250000	0.11733	TTG	TMEM45A	-	NULL	ENSG00000181458		0.383	TMEM45A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM45A	HGNC	protein_coding	OTTHUMT00000317571.1	-	0.00	26	0	T	NM_018004	Missense_Mutation	100295770	+1	tier1	-	no_errors	ENST00000323523	ensembl	human	known	74_37	missense	30.43	32	14	SNP	1.000	G
TMTC1	83857	genome.wustl.edu	37	12	29936515	29936515	+	Missense_Mutation	SNP	A	A	G			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr12:29936515A>G	ENST00000539277.1	-	1	228	c.170T>C	c.(169-171)aTc>aCc	p.I57T	TMTC1_ENST00000256062.5_Intron|TMTC1_ENST00000381224.2_Intron|TMTC1_ENST00000551659.1_Missense_Mutation_p.I57T|TMTC1_ENST00000552618.1_Missense_Mutation_p.I57T	NM_001193451.1	NP_001180380.1	Q8IUR5	TMTC1_HUMAN	transmembrane and tetratricopeptide repeat containing 1	57						integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)				breast(1)|endometrium(4)|kidney(3)|large_intestine(17)|lung(45)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	75	Lung NSC(12;7.61e-10)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.032)					GTTGTTCACGATCGCCCACAC	0.716																																																	0																																										SO:0001583	missense	0				CCDS8718.1, CCDS53772.1	12p11.22	2014-06-09	2006-01-06			ENSG00000133687		"""Tetratricopeptide (TTC) repeat domain containing"""	24099	protein-coding gene	gene with protein product		615855				24764305	Standard	NM_001193451		Approved	ARG99, OLF, FLJ31400, FLJ41625	uc021qwi.1	Q8IUR5	OTTHUMG00000169324	ENST00000539277.1:c.170T>C	12.37:g.29936515A>G	ENSP00000442046:p.Ile57Thr		D0EP37|F5H8B5|Q6PIU4|Q6ZSM5|Q96N52|Q9BXM2	Missense_Mutation	SNP	pfam_TPR_1,pfam_TPR_2,pfam_DUF1736,pfam_PIK-rel_kinase_FAT,pfam_TPR-3,smart_HAT,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.I57T	ENST00000539277.1	37	c.170	CCDS53772.1	12	.	.	.	.	.	.	.	.	.	.	A	20.8	4.049086	0.75846	.	.	ENSG00000133687	ENST00000551659;ENST00000552618;ENST00000539277	D;D;D	0.93712	-3.27;-3.27;-3.27	3.12	3.12	0.35913	.	.	.	.	.	D	0.96169	0.8751	M	0.90650	3.135	0.80722	D	1	.	.	.	.	.	.	D	0.95955	0.8957	6	.	.	.	.	10.3706	0.44051	1.0:0.0:0.0:0.0	.	.	.	.	T	57	ENSP00000448112:I57T;ENSP00000449043:I57T;ENSP00000442046:I57T	.	I	-	2	0	TMTC1	29827782	1.000000	0.71417	0.998000	0.56505	0.986000	0.74619	6.127000	0.71642	1.306000	0.44926	0.392000	0.25879	ATC	TMTC1	-	NULL	ENSG00000133687		0.716	TMTC1-002	PUTATIVE	basic|CCDS	protein_coding	TMTC1	HGNC	protein_coding	OTTHUMT00000403509.1	-	0.00	39	0	A	NM_031920		29936515	-1	tier1	-	no_errors	ENST00000539277	ensembl	human	putative	74_37	missense	20.83	38	10	SNP	1.000	G
TMTC1	83857	genome.wustl.edu	37	12	29936562	29936562	+	Nonsense_Mutation	SNP	G	G	T			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr12:29936562G>T	ENST00000539277.1	-	1	181	c.123C>A	c.(121-123)taC>taA	p.Y41*	TMTC1_ENST00000256062.5_Intron|TMTC1_ENST00000381224.2_Intron|TMTC1_ENST00000551659.1_Nonsense_Mutation_p.Y41*|TMTC1_ENST00000552618.1_Nonsense_Mutation_p.Y41*	NM_001193451.1	NP_001180380.1	Q8IUR5	TMTC1_HUMAN	transmembrane and tetratricopeptide repeat containing 1	41						integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)				breast(1)|endometrium(4)|kidney(3)|large_intestine(17)|lung(45)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	75	Lung NSC(12;7.61e-10)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.032)					GGGAGCGGCCGTAGCACAGGC	0.776																																																	0																																										SO:0001587	stop_gained	0				CCDS8718.1, CCDS53772.1	12p11.22	2014-06-09	2006-01-06			ENSG00000133687		"""Tetratricopeptide (TTC) repeat domain containing"""	24099	protein-coding gene	gene with protein product		615855				24764305	Standard	NM_001193451		Approved	ARG99, OLF, FLJ31400, FLJ41625	uc021qwi.1	Q8IUR5	OTTHUMG00000169324	ENST00000539277.1:c.123C>A	12.37:g.29936562G>T	ENSP00000442046:p.Tyr41*		D0EP37|F5H8B5|Q6PIU4|Q6ZSM5|Q96N52|Q9BXM2	Nonsense_Mutation	SNP	pfam_TPR_1,pfam_TPR_2,pfam_DUF1736,pfam_PIK-rel_kinase_FAT,pfam_TPR-3,smart_HAT,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.Y41*	ENST00000539277.1	37	c.123	CCDS53772.1	12	.	.	.	.	.	.	.	.	.	.	G	29.0	4.968377	0.92855	.	.	ENSG00000133687	ENST00000551659;ENST00000552618;ENST00000539277	.	.	.	3.11	1.17	0.20885	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	7.7996	0.29166	0.2256:0.0:0.7744:0.0	.	.	.	.	X	41	.	.	Y	-	3	2	TMTC1	29827829	1.000000	0.71417	0.998000	0.56505	0.010000	0.07245	3.470000	0.53100	0.512000	0.28257	-0.350000	0.07774	TAC	TMTC1	-	NULL	ENSG00000133687		0.776	TMTC1-002	PUTATIVE	basic|CCDS	protein_coding	TMTC1	HGNC	protein_coding	OTTHUMT00000403509.1	-	0.00	17	0	G	NM_031920		29936562	-1	tier1	-	no_errors	ENST00000539277	ensembl	human	putative	74_37	nonsense	21.74	17	5	SNP	1.000	T
TNFAIP6	7130	genome.wustl.edu	37	2	152226759	152226759	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr2:152226759G>T	ENST00000243347.3	+	4	695	c.620G>T	c.(619-621)gGa>gTa	p.G207V	RN7SL124P_ENST00000498656.2_RNA|MIR4773-1_ENST00000585225.1_RNA	NM_007115.3	NP_009046.2	P98066	TSG6_HUMAN	tumor necrosis factor, alpha-induced protein 6	207	CUB. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|inflammatory response (GO:0006954)|signal transduction (GO:0007165)		hyaluronic acid binding (GO:0005540)			endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	13				BRCA - Breast invasive adenocarcinoma(221;0.131)	Hyaluronan(DB08818)	GGCTTTGTGGGAAGGTACGTA	0.383																																																	0													169.0	163.0	165.0					2																	152226759		2203	4300	6503	SO:0001583	missense	0				CCDS2193.1	2q23.3	2008-11-18			ENSG00000123610	ENSG00000123610			11898	protein-coding gene	gene with protein product		600410				1730767, 8568267, 15060082	Standard	NM_007115		Approved	TSG6, TSG-6	uc002txk.3	P98066	OTTHUMG00000131884	ENST00000243347.3:c.620G>T	2.37:g.152226759G>T	ENSP00000243347:p.Gly207Val		Q53TI7|Q8WWI9	Missense_Mutation	SNP	pfam_CUB_dom,pfam_Link,superfamily_CUB_dom,superfamily_C-type_lectin_fold,smart_Link,smart_CUB_dom,pfscan_CUB_dom,pfscan_Link,prints_Link	p.G207V	ENST00000243347.3	37	c.620	CCDS2193.1	2	.	.	.	.	.	.	.	.	.	.	G	23.1	4.369644	0.82573	.	.	ENSG00000123610	ENST00000243347	T	0.28666	1.6	5.49	5.49	0.81192	CUB (5);	0.000000	0.85682	D	0.000000	T	0.62877	0.2464	M	0.85945	2.785	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.68538	-0.5382	10	0.87932	D	0	.	19.3531	0.94398	0.0:0.0:1.0:0.0	.	207	P98066	TSG6_HUMAN	V	207	ENSP00000243347:G207V	ENSP00000243347:G207V	G	+	2	0	TNFAIP6	151935005	1.000000	0.71417	1.000000	0.80357	0.742000	0.42306	9.410000	0.97335	2.563000	0.86464	0.555000	0.69702	GGA	TNFAIP6	-	pfam_CUB_dom,superfamily_CUB_dom,smart_CUB_dom,pfscan_CUB_dom	ENSG00000123610		0.383	TNFAIP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNFAIP6	HGNC	protein_coding	OTTHUMT00000254834.2	-	0.00	31	0	G	NM_007115		152226759	+1	tier1	-	no_errors	ENST00000243347	ensembl	human	known	74_37	missense	24.32	28	9	SNP	1.000	T
TP53	7157	genome.wustl.edu	37	17	7578547	7578547	+	Frame_Shift_Del	DEL	G	G	-			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr17:7578547delG	ENST00000269305.4	-	5	572	c.383delC	c.(382-384)cctfs	p.P128fs	TP53_ENST00000413465.2_Frame_Shift_Del_p.P128fs|TP53_ENST00000359597.4_Frame_Shift_Del_p.P128fs|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000445888.2_Frame_Shift_Del_p.P128fs|TP53_ENST00000420246.2_Frame_Shift_Del_p.P128fs|TP53_ENST00000455263.2_Frame_Shift_Del_p.P128fs	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	128	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		P -> A (in sporadic cancers; somatic mutation).|P -> L (in sporadic cancers; somatic mutation).|P -> R (in sporadic cancers; somatic mutation).|P -> S (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.Y126_K132delYSPALNK(6)|p.Y126_N131delYSPALN(3)|p.P128L(3)|p.V73fs*9(1)|p.S127fs*36(1)|p.P128fs*18(1)|p.P128del(1)|p.Y126fs*11(1)|p.S127_Q136del10(1)|p.P13fs*18(1)|p.?(1)|p.Y126fs*18(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GTTGAGGGCAGGGGAGTACTG	0.562		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	29	Deletion - In frame(11)|Whole gene deletion(8)|Deletion - Frameshift(6)|Substitution - Missense(3)|Unknown(1)	upper_aerodigestive_tract(4)|central_nervous_system(4)|bone(4)|large_intestine(3)|breast(3)|urinary_tract(2)|lung(2)|ovary(2)|stomach(1)|haematopoietic_and_lymphoid_tissue(1)|liver(1)|oesophagus(1)|prostate(1)											44.0	45.0	44.0					17																	7578547		2203	4300	6503	SO:0001589	frameshift_variant	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.383delC	17.37:g.7578547delG	ENSP00000269305:p.Pro128fs		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Frame_Shift_Del	DEL	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.P128fs	ENST00000269305.4	37	c.383	CCDS11118.1	17																																																																																			TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor	ENSG00000141510		0.562	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1		0.00	33	0	G	NM_000546		7578547	-1	tier1		no_errors	ENST00000269305	ensembl	human	known	74_37	frame_shift_del	41.18	10	7	DEL	0.106	-
TRAK1	22906	genome.wustl.edu	37	3	42251577	42251578	+	Intron	INS	-	-	GGA	rs10634555|rs35624871		TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr3:42251577_42251578insGGA	ENST00000327628.5	+	14	2363				TRAK1_ENST00000487159.1_Intron|TRAK1_ENST00000341421.3_In_Frame_Ins_p.640_641insE|TRAK1_ENST00000396175.1_Intron	NM_001042646.2	NP_001036111.1	Q9UPV9	TRAK1_HUMAN	trafficking protein, kinesin binding 1						endosome to lysosome transport (GO:0008333)|protein O-linked glycosylation (GO:0006493)|protein targeting (GO:0006605)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|mitochondrion (GO:0005739)|nucleus (GO:0005634)		p.E640delE(1)		central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(8)|lung(6)|ovary(1)|upper_aerodigestive_tract(2)	22						CCAGCGGCCACggaggaggagg	0.629																																					GBM(44;195 884 22595 31865 41850)												1	Deletion - In frame(1)	kidney(1)																																								SO:0001627	intron_variant	0				CCDS2695.1, CCDS43072.1, CCDS58826.1, CCDS74922.1	3p22.1	2012-03-05			ENSG00000182606	ENSG00000182606			29947	protein-coding gene	gene with protein product	"""OGT(O Glc NAc transferase) interacting protein 106 KDa"", ""O-linked N-acetylglucosamine transferase interacting protein 106"", ""milton homolog 1 (Drosophila)"""	608112				10470851, 12435728, 16380713, 20230862	Standard	NM_014965		Approved	OIP106, KIAA1042, MILT1	uc003cky.4	Q9UPV9	OTTHUMG00000131795	ENST00000327628.5:c.1963+100->GGA	3.37:g.42251584_42251586dupGGA			E9PDS2|J3KNT7|Q63HR0|Q659B5|Q96B69	In_Frame_Ins	INS	pfam_HAP1_N,pfam_Traffickng_kinesin-bd_prot_dom	p.634in_frame_insE	ENST00000327628.5	37	c.1889_1890	CCDS43072.1	3																																																																																			TRAK1	-	NULL	ENSG00000182606		0.629	TRAK1-004	PUTATIVE	basic|appris_principal|CCDS	protein_coding	TRAK1	HGNC	protein_coding	OTTHUMT00000343413.1		0.00	15	0	-	NM_014965		42251578	+1	tier1		no_errors	ENST00000341421	ensembl	human	known	74_37	in_frame_ins	33.33	10	5	INS	0.010:0.044	GGA
TRPM7	54822	genome.wustl.edu	37	15	50903479	50903479	+	Silent	SNP	G	G	A			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr15:50903479G>A	ENST00000313478.7	-	17	2372	c.2091C>T	c.(2089-2091)tcC>tcT	p.S697S	TRPM7_ENST00000560955.1_Silent_p.S697S	NM_017672.4	NP_060142.3	Q96QT4	TRPM7_HUMAN	transient receptor potential cation channel, subfamily M, member 7	697					actomyosin structure organization (GO:0031032)|calcium ion transmembrane transport (GO:0070588)|calcium-dependent cell-matrix adhesion (GO:0016340)|cellular magnesium ion homeostasis (GO:0010961)|ion transmembrane transport (GO:0034220)|necroptotic process (GO:0070266)|protein autophosphorylation (GO:0046777)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	ATP binding (GO:0005524)|calcium channel activity (GO:0005262)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			breast(3)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(17)|lung(13)|ovary(4)|pancreas(1)|skin(4)|stomach(3)	52				all cancers(107;0.000819)|GBM - Glioblastoma multiforme(94;0.0045)		CTTGTCTGAAGGACTGTTCTA	0.338																																																	0													91.0	80.0	83.0					15																	50903479		1820	4075	5895	SO:0001819	synonymous_variant	0			AF346629	CCDS42035.1, CCDS73725.1	15q21	2011-12-14				ENSG00000092439		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17994	protein-coding gene	gene with protein product		605692				11161216, 11385574, 16382100	Standard	XM_005254486		Approved	CHAK1, LTRPC7, TRP-PLIK	uc001zyt.4	Q96QT4		ENST00000313478.7:c.2091C>T	15.37:g.50903479G>A			Q6ZMF5|Q86VJ4|Q8NBW2|Q9BXB2|Q9NXQ2	Silent	SNP	pfam_MHCK_EF2_kinase,pfam_Ion_trans_dom,superfamily_Kinase-like_dom,smart_MHCK_EF2_kinase,pfscan_MHCK_EF2_kinase	p.S697	ENST00000313478.7	37	c.2091	CCDS42035.1	15																																																																																			TRPM7	-	NULL	ENSG00000092439		0.338	TRPM7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRPM7	HGNC	protein_coding	OTTHUMT00000418604.1	-	0.00	41	0	G	NM_017672		50903479	-1	tier1	-	no_errors	ENST00000313478	ensembl	human	known	74_37	silent	38.46	24	15	SNP	1.000	A
TTC28	23331	genome.wustl.edu	37	22	28503690	28503690	+	Nonsense_Mutation	SNP	G	G	A			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr22:28503690G>A	ENST00000397906.2	-	7	2284	c.2143C>T	c.(2143-2145)Cga>Tga	p.R715*		NM_001145418.1	NP_001138890.1	Q96AY4	TTC28_HUMAN	tetratricopeptide repeat domain 28	715					mitotic nuclear division (GO:0007067)|regulation of mitotic cell cycle (GO:0007346)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|midbody (GO:0030496)				endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)	12						CCTAGGGCTCGAAATTTAGCC	0.423																																																	0													56.0	48.0	50.0					22																	28503690		692	1591	2283	SO:0001587	stop_gained	0			AB028966	CCDS46678.1	22q12.1	2013-01-10			ENSG00000100154	ENSG00000100154		"""Tetratricopeptide (TTC) repeat domain containing"""	29179	protein-coding gene	gene with protein product		615098				10470851	Standard	NM_001145418		Approved	KIAA1043	uc003adp.4	Q96AY4	OTTHUMG00000151006	ENST00000397906.2:c.2143C>T	22.37:g.28503690G>A	ENSP00000381003:p.Arg715*		K7ZRV2|O95928|O95929|Q5W189|Q9NTE4|Q9UG31|Q9UGG5|Q9UPV8|Q9Y3S5	Nonsense_Mutation	SNP	pfam_TPR_1,pfam_TPR_2,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.R715*	ENST00000397906.2	37	c.2143	CCDS46678.1	22	.	.	.	.	.	.	.	.	.	.	G	39	7.499455	0.98322	.	.	ENSG00000100154	ENST00000397906	.	.	.	5.79	4.77	0.60923	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-7.3596	15.3394	0.74284	0.0:0.0:0.8593:0.1407	.	.	.	.	X	715	.	ENSP00000381003:R715X	R	-	1	2	TTC28	26833690	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.738000	0.68613	1.433000	0.47394	0.655000	0.94253	CGA	TTC28	-	smart_TPR_repeat,pfscan_TPR-contain_dom	ENSG00000100154		0.423	TTC28-001	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	TTC28	HGNC	protein_coding	OTTHUMT00000320930.2	-	0.00	51	0	G	XM_929318		28503690	-1	tier1	-	no_errors	ENST00000397906	ensembl	human	novel	74_37	nonsense	36.67	19	11	SNP	1.000	A
TUBA3E	112714	genome.wustl.edu	37	2	130951687	130951687	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr2:130951687C>A	ENST00000312988.7	-	4	828	c.728G>T	c.(727-729)cGa>cTa	p.R243L		NM_207312.2	NP_997195	Q6PEY2	TBA3E_HUMAN	tubulin, alpha 3e	243					microtubule-based process (GO:0007017)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			endometrium(4)|kidney(7)|large_intestine(6)|lung(9)|skin(2)	28	Colorectal(110;0.1)					CCCATCAAATCGCAGGGAGGC	0.582																																																	0													210.0	151.0	171.0					2																	130951687		2203	4300	6503	SO:0001583	missense	0			BC057811	CCDS2158.1	2q21.1	2007-03-16			ENSG00000152086	ENSG00000152086		"""Tubulins"""	20765	protein-coding gene	gene with protein product							Standard	NM_207312		Approved		uc002tqv.3	Q6PEY2	OTTHUMG00000131626	ENST00000312988.7:c.728G>T	2.37:g.130951687C>A	ENSP00000318197:p.Arg243Leu			Missense_Mutation	SNP	pfam_Tubulin_FtsZ_GTPase,pfam_Tubulin/FtsZ_2-layer-sand-dom,superfamily_Tubulin_FtsZ_GTPase,superfamily_Tub_FtsZ_C,smart_Tubulin_FtsZ_GTPase,smart_Tubulin/FtsZ_2-layer-sand-dom,prints_Alpha_tubulin,prints_Tubulin,prints_Epsilon_tubulin,prints_Delta_tubulin	p.R243L	ENST00000312988.7	37	c.728	CCDS2158.1	2	.	.	.	.	.	.	.	.	.	.	c	7.912	0.736677	0.15574	.	.	ENSG00000152086	ENST00000312988	T	0.74209	-0.82	2.92	-0.0928	0.13655	Tubulin/FtsZ, GTPase domain (3);	0.000000	0.47455	U	0.000225	D	0.87985	0.6316	H	0.99783	4.775	0.37576	D	0.919629	P	0.41159	0.74	P	0.51999	0.687	D	0.84086	0.0387	10	0.87932	D	0	.	4.5937	0.12319	0.0:0.5859:0.1829:0.2312	.	243	Q6PEY2	TBA3E_HUMAN	L	243	ENSP00000318197:R243L	ENSP00000318197:R243L	R	-	2	0	TUBA3E	130668157	0.240000	0.23847	0.152000	0.22495	0.017000	0.09413	2.451000	0.44952	-0.145000	0.11294	-0.384000	0.06662	CGA	TUBA3E	-	superfamily_Tubulin_FtsZ_GTPase,smart_Tubulin_FtsZ_GTPase	ENSG00000152086		0.582	TUBA3E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TUBA3E	HGNC	protein_coding	OTTHUMT00000254519.1		0.00	147	0	C	NM_207312		130951687	-1			no_errors	ENST00000312988	ensembl	human	known	74_37	missense	6.72	124	9	SNP	0.996	A
TUBA3D	113457	genome.wustl.edu	37	2	132237994	132237994	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr2:132237994G>T	ENST00000321253.6	+	4	835	c.728G>T	c.(727-729)cGa>cTa	p.R243L		NM_080386.3	NP_525125.2	Q13748	TBA3C_HUMAN	tubulin, alpha 3d	243					'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|microtubule-based process (GO:0007017)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)	p.R243Q(2)		breast(2)|endometrium(1)|kidney(1)|large_intestine(3)|lung(18)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	32				BRCA - Breast invasive adenocarcinoma(221;0.13)		GCCTCCCTGCGATTTGATGGG	0.567																																					Ovarian(137;2059 2432 35543 39401)												2	Substitution - Missense(2)	large_intestine(2)											87.0	119.0	109.0					2																	132237994		1982	4281	6263	SO:0001583	missense	0			K03460	CCDS33290.1	2q21.1	2007-03-16			ENSG00000075886	ENSG00000075886		"""Tubulins"""	24071	protein-coding gene	gene with protein product	"""alpha-tubulin isotype H2-alpha"""					3785200	Standard	NM_080386		Approved	H2-ALPHA	uc002tsu.4	Q13748	OTTHUMG00000153600	ENST00000321253.6:c.728G>T	2.37:g.132237994G>T	ENSP00000326042:p.Arg243Leu		A6NJQ0|Q5W099|Q6PEY3|Q96F18	Missense_Mutation	SNP	pfam_Tubulin_FtsZ_GTPase,pfam_Tubulin/FtsZ_2-layer-sand-dom,superfamily_Tubulin_FtsZ_GTPase,superfamily_Tub_FtsZ_C,smart_Tubulin_FtsZ_GTPase,smart_Tubulin/FtsZ_2-layer-sand-dom,prints_Alpha_tubulin,prints_Tubulin,prints_Epsilon_tubulin,prints_Delta_tubulin,prints_Beta_tubulin	p.R243L	ENST00000321253.6	37	c.728	CCDS33290.1	2	.	.	.	.	.	.	.	.	.	.	g	5.664	0.307194	0.10733	.	.	ENSG00000075886	ENST00000321253;ENST00000341158	T	0.74209	-0.82	2.24	-1.18	0.09617	Tubulin/FtsZ, GTPase domain (3);	0.000000	0.44688	U	0.000440	D	0.89629	0.6770	H	0.99783	4.775	0.36036	D	0.839721	D	0.71674	0.998	D	0.75020	0.985	D	0.84175	0.0436	10	0.87932	D	0	.	4.0589	0.09829	0.2665:0.1951:0.5383:0.0	.	243	Q13748	TBA3C_HUMAN	L	243	ENSP00000326042:R243L	ENSP00000326042:R243L	R	+	2	0	TUBA3D	131954464	0.879000	0.30193	0.614000	0.29051	0.020000	0.10135	3.620000	0.54203	-0.518000	0.06452	-1.031000	0.02408	CGA	TUBA3D	-	superfamily_Tubulin_FtsZ_GTPase,smart_Tubulin_FtsZ_GTPase	ENSG00000075886		0.567	TUBA3D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TUBA3D	HGNC	protein_coding	OTTHUMT00000331800.2	-	0.00	52	0	G	NM_080386		132237994	+1	tier1	-	no_errors	ENST00000321253	ensembl	human	known	74_37	missense	16.67	35	7	SNP	0.953	T
UBE2N	7334	genome.wustl.edu	37	12	93804730	93804730	+	Intron	SNP	C	C	A			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr12:93804730C>A	ENST00000318066.2	-	3	655				UBE2N_ENST00000550657.1_Nonsense_Mutation_p.E126*|UBE2N_ENST00000552442.1_Intron|UBE2N_ENST00000549833.1_Intron	NM_003348.3	NP_003339.1	P61088	UBE2N_HUMAN	ubiquitin-conjugating enzyme E2N						cellular protein modification process (GO:0006464)|cytokine-mediated signaling pathway (GO:0019221)|DNA double-strand break processing (GO:0000729)|double-strand break repair via homologous recombination (GO:0000724)|Fc-epsilon receptor signaling pathway (GO:0038095)|histone ubiquitination (GO:0016574)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of DNA repair (GO:0045739)|positive regulation of histone modification (GO:0031058)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|postreplication repair (GO:0006301)|protein K63-linked ubiquitination (GO:0070534)|protein ubiquitination (GO:0016567)|proteolysis (GO:0006508)|regulation of DNA repair (GO:0006282)|regulation of histone ubiquitination (GO:0033182)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|protein complex (GO:0043234)|UBC13-MMS2 complex (GO:0031372)|UBC13-UEV1A complex (GO:0035370)|ubiquitin ligase complex (GO:0000151)	acid-amino acid ligase activity (GO:0016881)|ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|ubiquitin binding (GO:0043130)|ubiquitin-protein transferase activity (GO:0004842)			endometrium(3)|liver(2)|lung(5)	10						CCACAGACCTCTCTGATCTTT	0.398								Direct reversal of damage;Rad6 pathway																													Pancreas(197;738 2228 30225 32034 33454)												0																																										SO:0001627	intron_variant	0			D83004	CCDS31875.1	12q22	2011-05-19	2011-05-19			ENSG00000177889		"""Ubiquitin-conjugating enzymes E2"""	12492	protein-coding gene	gene with protein product		603679	"""ubiquitin-conjugating enzyme E2N (homologous to yeast UBC13)"", ""ubiquitin-conjugating enzyme E2N (UBC13 homolog, yeast)"""			8902611	Standard	NM_003348		Approved	UbcH-ben, UBC13, MGC8489	uc001tcp.3	P61088	OTTHUMG00000170156	ENST00000318066.2:c.278-80G>T	12.37:g.93804730C>A			Q16781|Q53Y81	Nonsense_Mutation	SNP	pfam_UBQ-conjugat_E2,superfamily_UBQ-conjugating_enzyme/RWD,pfscan_UBQ-conjugat_E2	p.E126*	ENST00000318066.2	37	c.376	CCDS31875.1	12	.	.	.	.	.	.	.	.	.	.	C	5.619	0.298889	0.10622	.	.	ENSG00000177889	ENST00000550657	.	.	.	4.98	-1.3	0.09259	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	0.42905	T	0.14	.	3.8906	0.09117	0.1695:0.3603:0.0:0.4702	.	.	.	.	X	126	.	ENSP00000449352:E126X	E	-	1	0	UBE2N	92328861	0.000000	0.05858	0.000000	0.03702	0.066000	0.16364	-0.532000	0.06164	-0.042000	0.13535	0.655000	0.94253	GAG	UBE2N	-	NULL	ENSG00000177889		0.398	UBE2N-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBE2N	HGNC	protein_coding	OTTHUMT00000407710.1	-	0.00	19	0	C	NM_003348		93804730	-1	tier1	-	no_errors	ENST00000550657	ensembl	human	novel	74_37	nonsense	33.33	18	9	SNP	0.000	A
UBE3C	9690	genome.wustl.edu	37	7	157000528	157000528	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr7:157000528G>C	ENST00000348165.5	+	13	2068	c.1708G>C	c.(1708-1710)Gaa>Caa	p.E570Q		NM_014671.2	NP_055486.2	Q15386	UBE3C_HUMAN	ubiquitin protein ligase E3C	570					protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|intracellular (GO:0005622)|nucleus (GO:0005634)|proteasome complex (GO:0000502)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			central_nervous_system(2)|endometrium(3)|kidney(16)|large_intestine(13)|lung(25)|ovary(2)|prostate(1)|urinary_tract(1)	63		all_hematologic(28;0.0185)|all_epithelial(9;0.0664)	OV - Ovarian serous cystadenocarcinoma(82;0.00448)	UCEC - Uterine corpus endometrioid carcinoma (81;0.19)		AGAAGTTCGAGAAGAATATAT	0.383																																																	0													117.0	117.0	117.0					7																	157000528		2203	4300	6503	SO:0001583	missense	0			AK127280	CCDS34789.1	7q36.3	2004-05-04			ENSG00000009335	ENSG00000009335			16803	protein-coding gene	gene with protein product		614454				7584026, 11278995	Standard	NM_014671		Approved	KIAA0010, KIAA10	uc010lqs.3	Q15386	OTTHUMG00000157239	ENST00000348165.5:c.1708G>C	7.37:g.157000528G>C	ENSP00000309198:p.Glu570Gln		A4D235|A6NCP3|Q8TC15|Q96CR4|Q9UDU3	Missense_Mutation	SNP	pfam_HECT,superfamily_HECT,superfamily_DHFR-like_dom,smart_IQ_motif_EF-hand-BS,smart_HECT,pfscan_HECT,pfscan_IQ_motif_EF-hand-BS	p.E570Q	ENST00000348165.5	37	c.1708	CCDS34789.1	7	.	.	.	.	.	.	.	.	.	.	G	15.36	2.810603	0.50421	.	.	ENSG00000009335	ENST00000348165	T	0.45668	0.89	5.56	4.67	0.58626	.	0.045379	0.85682	N	0.000000	T	0.60573	0.2279	M	0.65975	2.015	0.80722	D	1	D;D	0.76494	0.998;0.999	P;D	0.69479	0.854;0.964	T	0.58544	-0.7618	10	0.25106	T	0.35	-20.384	16.3096	0.82864	0.0:0.1327:0.8673:0.0	.	570;570	Q15386;Q15386-2	UBE3C_HUMAN;.	Q	570	ENSP00000309198:E570Q	ENSP00000309198:E570Q	E	+	1	0	UBE3C	156693289	1.000000	0.71417	0.428000	0.26697	0.014000	0.08584	7.007000	0.76335	1.313000	0.45069	0.655000	0.94253	GAA	UBE3C	-	NULL	ENSG00000009335		0.383	UBE3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBE3C	HGNC	protein_coding	OTTHUMT00000348108.1	-	0.00	32	0	G	NM_014671		157000528	+1	tier1	-	no_errors	ENST00000348165	ensembl	human	known	74_37	missense	48.28	15	14	SNP	0.999	C
USP34	9736	genome.wustl.edu	37	2	61468742	61468742	+	Nonsense_Mutation	SNP	C	C	A			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr2:61468742C>A	ENST00000398571.2	-	53	6806	c.6730G>T	c.(6730-6732)Gaa>Taa	p.E2244*		NM_014709.3	NP_055524.3	Q70CQ2	UBP34_HUMAN	ubiquitin specific peptidase 34	2244					positive regulation of canonical Wnt signaling pathway (GO:0090263)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|ubiquitin-dependent protein catabolic process (GO:0006511)|Wnt signaling pathway (GO:0016055)		cysteine-type endopeptidase activity (GO:0004197)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			autonomic_ganglia(1)|breast(14)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(24)|lung(52)|ovary(8)|prostate(10)|skin(6)|urinary_tract(2)	138			Epithelial(17;0.229)			CTGCCATTTTCTTCCTCTGGT	0.299																																																	0													172.0	147.0	155.0					2																	61468742		1823	4089	5912	SO:0001587	stop_gained	0			AB011142	CCDS42686.1	2p16.1-p15	2005-08-08	2005-08-08		ENSG00000115464	ENSG00000115464		"""Ubiquitin-specific peptidases"""	20066	protein-coding gene	gene with protein product		615295	"""ubiquitin specific protease 34"""			12838346	Standard	NM_014709		Approved	KIAA0570, KIAA0729	uc002sbe.3	Q70CQ2	OTTHUMG00000152265	ENST00000398571.2:c.6730G>T	2.37:g.61468742C>A	ENSP00000381577:p.Glu2244*		A8MWD0|B3KWU9|O60316|O94834|Q3B777|Q6P6C9|Q7L8P6|Q8N3T9|Q8TBW2|Q9UGA1	Nonsense_Mutation	SNP	pfam_Peptidase_C19/C67,superfamily_ARM-type_fold,pfscan_Peptidase_C19/C67	p.E2244*	ENST00000398571.2	37	c.6730	CCDS42686.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	37|37	6.210468|6.210468	0.97380|0.97380	.|.	.|.	ENSG00000115464|ENSG00000115464	ENST00000263989;ENST00000398569;ENST00000398571;ENST00000453734|ENST00000411912	.|.	.|.	.|.	5.51|5.51	4.63|4.63	0.57726|0.57726	.|.	0.047828|.	0.85682|.	D|.	0.000000|.	.|T	.|0.65471	.|0.2694	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.71119	.|-0.4685	.|3	0.12430|.	T|.	0.62|.	.|.	14.8002|14.8002	0.69909|0.69909	0.0:0.9301:0.0:0.0699|0.0:0.9301:0.0:0.0699	.|.	.|.	.|.	.|.	X|I	2092;2092;2244;522|3	.|.	ENSP00000263989:E2092X|.	E|R	-|-	1|2	0|0	USP34|USP34	61322246|61322246	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.993000|0.993000	0.82548|0.82548	7.776000|7.776000	0.85560|0.85560	1.462000|1.462000	0.47948|0.47948	0.585000|0.585000	0.79938|0.79938	GAA|AGA	USP34	-	superfamily_ARM-type_fold	ENSG00000115464		0.299	USP34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP34	HGNC	protein_coding	OTTHUMT00000325650.4	-	0.00	34	0	C			61468742	-1	tier1	-	no_errors	ENST00000398571	ensembl	human	known	74_37	nonsense	13.33	52	8	SNP	1.000	A
USP47	55031	genome.wustl.edu	37	11	11958055	11958055	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr11:11958055G>A	ENST00000399455.2	+	18	2255	c.2135G>A	c.(2134-2136)gGa>gAa	p.G712E	USP47_ENST00000539466.1_5'UTR|USP47_ENST00000527733.1_Missense_Mutation_p.G692E|USP47_ENST00000339865.5_Missense_Mutation_p.G624E	NM_001282659.1	NP_001269588.1	Q96K76	UBP47_HUMAN	ubiquitin specific peptidase 47	712					base-excision repair (GO:0006284)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|monoubiquitinated protein deubiquitination (GO:0035520)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of G2/M transition of mitotic cell cycle (GO:0010972)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell growth (GO:0030307)|response to drug (GO:0042493)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|SCF ubiquitin ligase complex (GO:0019005)	ubiquitin-specific protease activity (GO:0004843)|WD40-repeat domain binding (GO:0071987)			breast(4)|endometrium(7)|kidney(2)|large_intestine(8)|liver(2)|lung(14)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	46				Epithelial(150;0.000339)		TATAAACCTGGAGGTGAGCAA	0.333																																																	0													63.0	55.0	58.0					11																	11958055		1807	4059	5866	SO:0001583	missense	0			AK027362	CCDS41619.1, CCDS60725.1	11p15.2	2008-02-05	2005-08-08		ENSG00000170242	ENSG00000170242		"""Ubiquitin-specific peptidases"""	20076	protein-coding gene	gene with protein product		614460	"""Trf (TATA binding protein-related factor)-proximal homolog (Drosophila)"", ""ubiquitin specific protease 47"""			12838346	Standard	XM_005252997		Approved		uc001mjr.3	Q96K76	OTTHUMG00000165685	ENST00000399455.2:c.2135G>A	11.37:g.11958055G>A	ENSP00000382382:p.Gly712Glu		B3KXF5|E9PM46|Q658U0|Q86Y73|Q8TEP6|Q9BWI0|Q9NWN1	Missense_Mutation	SNP	pfam_Peptidase_C19/C67,pfscan_Peptidase_C19/C67	p.G712E	ENST00000399455.2	37	c.2135		11	.	.	.	.	.	.	.	.	.	.	G	17.23	3.336690	0.60963	.	.	ENSG00000170242	ENST00000339865;ENST00000527733;ENST00000399455	T;T;T	0.05996	3.38;3.37;3.36	5.37	5.37	0.77165	.	0.000000	0.85682	D	0.000000	T	0.10551	0.0258	L	0.57536	1.79	0.80722	D	1	B;P	0.36010	0.397;0.532	B;B	0.37833	0.189;0.259	T	0.22312	-1.0220	10	0.18276	T	0.48	.	18.6844	0.91558	0.0:0.0:1.0:0.0	.	692;624	E9PM46;Q96K76-2	.;.	E	624;692;712	ENSP00000339957:G624E;ENSP00000433146:G692E;ENSP00000382382:G712E	ENSP00000339957:G624E	G	+	2	0	USP47	11914631	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	9.102000	0.94226	2.495000	0.84180	0.655000	0.94253	GGA	USP47	-	NULL	ENSG00000170242		0.333	USP47-003	KNOWN	basic|appris_candidate_longest	protein_coding	USP47	HGNC	protein_coding	OTTHUMT00000385853.2		0.00	15	0	G	NM_017944		11958055	+1			no_errors	ENST00000399455	ensembl	human	known	74_37	missense	15.15	28	5	SNP	1.000	A
VDR	7421	genome.wustl.edu	37	12	48238609	48238609	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr12:48238609G>C	ENST00000395324.2	-	10	1472	c.1204C>G	c.(1204-1206)Cgc>Ggc	p.R402G	VDR_ENST00000550325.1_Missense_Mutation_p.R452G|VDR_ENST00000229022.3_Missense_Mutation_p.R402G|VDR_ENST00000535672.1_Missense_Mutation_p.R370G|VDR_ENST00000549336.1_Missense_Mutation_p.R402G			P11473	VDR_HUMAN	vitamin D (1,25- dihydroxyvitamin D3) receptor	402	Ligand-binding.				bile acid signaling pathway (GO:0038183)|calcium ion transport (GO:0006816)|cell morphogenesis (GO:0000902)|cellular calcium ion homeostasis (GO:0006874)|decidualization (GO:0046697)|gene expression (GO:0010467)|intestinal absorption (GO:0050892)|lactation (GO:0007595)|mammary gland branching involved in pregnancy (GO:0060745)|negative regulation of cell proliferation (GO:0008285)|negative regulation of keratinocyte proliferation (GO:0010839)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|organ morphogenesis (GO:0009887)|positive regulation of apoptotic process involved in mammary gland involution (GO:0060058)|positive regulation of gene expression (GO:0010628)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of vitamin D 24-hydroxylase activity (GO:0010980)|regulation of calcidiol 1-monooxygenase activity (GO:0060558)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)|transcription initiation from RNA polymerase II promoter (GO:0006367)|vitamin D receptor signaling pathway (GO:0070561)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	calcitriol binding (GO:1902098)|calcitriol receptor activity (GO:0008434)|DNA binding (GO:0003677)|lithocholic acid binding (GO:1902121)|lithocholic acid receptor activity (GO:0038186)|retinoid X receptor binding (GO:0046965)|sequence-specific DNA binding (GO:0043565)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(10)|ovary(3)|skin(2)	22		Acute lymphoblastic leukemia(13;0.109)|all_hematologic(14;0.214)		GBM - Glioblastoma multiforme(48;0.17)	Alfacalcidol(DB01436)|Calcidiol(DB00146)|Calcipotriol(DB02300)|Calcitriol(DB00136)|Cholecalciferol(DB00169)|Dihydrotachysterol(DB01070)|Ergocalciferol(DB00153)|Paricalcitol(DB00910)	GAGAGGCAGCGGTACTGCTTG	0.607																																																	0													105.0	95.0	99.0					12																	48238609		2203	4300	6503	SO:0001583	missense	0			J03258	CCDS8757.1, CCDS55820.1	12q12-q14	2014-06-13				ENSG00000111424		"""Nuclear hormone receptors"""	12679	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 163"""	601769				1662663	Standard	NM_001017536		Approved	NR1I1, PPP1R163	uc001rql.3	P11473		ENST00000395324.2:c.1204C>G	12.37:g.48238609G>C	ENSP00000378734:p.Arg402Gly		B2R5Q1|G3V1V9|Q5PSV3	Missense_Mutation	SNP	pfam_Nucl_hrmn_rcpt_lig-bd_core,pfam_Znf_hrmn_rcpt,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_VitD_rcpt,prints_Str_hrmn_rcpt,prints_Znf_hrmn_rcpt	p.R402G	ENST00000395324.2	37	c.1204	CCDS8757.1	12	.	.	.	.	.	.	.	.	.	.	g	24.6	4.554378	0.86231	.	.	ENSG00000111424	ENST00000395324;ENST00000229022;ENST00000549336;ENST00000550325;ENST00000535672	D;D;D;D;D	0.93604	-3.24;-3.24;-3.24;-3.25;-3.18	4.26	4.26	0.50523	Nuclear hormone receptor, ligand-binding (2);Nuclear hormone receptor, ligand-binding, core (1);	0.062576	0.64402	D	0.000003	D	0.95408	0.8509	L	0.54323	1.7	0.80722	D	1	D;D;D	0.89917	0.996;1.0;1.0	D;D;D	0.77557	0.942;0.984;0.99	D	0.95704	0.8752	10	0.66056	D	0.02	.	15.7681	0.78143	0.0:0.0:1.0:0.0	.	370;402;452	B4DRV7;P11473;G3V1V9	.;VDR_HUMAN;.	G	402;402;402;452;370	ENSP00000378734:R402G;ENSP00000229022:R402G;ENSP00000449573:R402G;ENSP00000447173:R452G;ENSP00000442145:R370G	ENSP00000229022:R402G	R	-	1	0	VDR	46524876	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.389000	0.97243	2.380000	0.81148	0.457000	0.33378	CGC	VDR	-	pfam_Nucl_hrmn_rcpt_lig-bd_core,superfamily_Nucl_hormone_rcpt_ligand-bd	ENSG00000111424		0.607	VDR-001	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	VDR	HGNC	protein_coding	OTTHUMT00000406433.1	-	0.00	74	0	G			48238609	-1	tier1	-	no_errors	ENST00000229022	ensembl	human	known	74_37	missense	17.02	78	16	SNP	1.000	C
VKORC1	79001	genome.wustl.edu	37	16	31106745	31106745	+	5'Flank	SNP	C	C	T			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr16:31106745C>T	ENST00000394975.2	-	0	0				VKORC1_ENST00000300851.6_5'Flank|VKORC1_ENST00000394971.3_5'Flank|RP11-196G11.1_ENST00000529564.1_5'Flank|VKORC1_ENST00000498155.1_Missense_Mutation_p.G79R|VKORC1_ENST00000354895.4_5'Flank|VKORC1_ENST00000319788.7_5'Flank	NM_024006.4	NP_076869.1	Q9BQB6	VKOR1_HUMAN	vitamin K epoxide reductase complex, subunit 1						blood coagulation (GO:0007596)|bone development (GO:0060348)|cellular protein metabolic process (GO:0044267)|drug metabolic process (GO:0017144)|peptidyl-glutamic acid carboxylation (GO:0017187)|post-translational protein modification (GO:0043687)|vitamin K metabolic process (GO:0042373)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	quinone binding (GO:0048038)|vitamin-K-epoxide reductase (warfarin-sensitive) activity (GO:0047057)			lung(3)|urinary_tract(1)	4					Acenocoumarol(DB01418)|Dicoumarol(DB00266)|Menadione(DB00170)|Phenindione(DB00498)|Phenprocoumon(DB00946)|Warfarin(DB00682)	TTGCAGCATCCGGGACCTAGA	0.463																																																	0													15.0	13.0	14.0					16																	31106745		876	1989	2865	SO:0001631	upstream_gene_variant	0				CCDS10703.1, CCDS10704.1	16p11.2	2008-02-05	2004-07-23		ENSG00000167397	ENSG00000167397			23663	protein-coding gene	gene with protein product		608547	"""vitamin K dependent clotting factors deficiency 2"""	VKCFD2			Standard	NM_024006		Approved		uc002eas.3	Q9BQB6	OTTHUMG00000047408		16.37:g.31106745C>T	Exception_encountered		A6NIQ6|B2R4Z6|Q6UX90|Q7Z2R4	Missense_Mutation	SNP	NULL	p.G79R	ENST00000394975.2	37	c.235	CCDS10703.1	16	.	.	.	.	.	.	.	.	.	.	C	6.182	0.401750	0.11696	.	.	ENSG00000167397	ENST00000498155	.	.	.	2.86	0.846	0.18955	.	.	.	.	.	T	0.37972	0.1023	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.37009	-0.9724	5	0.87932	D	0	.	4.4721	0.11717	0.0:0.6648:0.0:0.3352	.	.	.	.	R	79	.	ENSP00000417662:G79R	G	-	1	0	VKORC1	31014246	0.000000	0.05858	0.008000	0.14137	0.019000	0.09904	-0.271000	0.08572	0.252000	0.21531	0.514000	0.50259	GGA	VKORC1	-	NULL	ENSG00000167397		0.463	VKORC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VKORC1	HGNC	protein_coding	OTTHUMT00000108582.1	-	0.00	38	0	C	NM_024006		31106745	-1	tier1	-	no_errors	ENST00000498155	ensembl	human	putative	74_37	missense	33.33	22	11	SNP	0.009	T
VPS9D1	9605	genome.wustl.edu	37	16	89784476	89784476	+	Intron	SNP	C	C	T			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr16:89784476C>T	ENST00000389386.3	-	2	300				ZNF276_ENST00000289816.5_5'Flank|VPS9D1-AS1_ENST00000562866.1_RNA|ZNF276_ENST00000568064.1_5'Flank|ZNF276_ENST00000446326.2_5'Flank|VPS9D1_ENST00000561976.1_Intron|VPS9D1-AS1_ENST00000562298.1_RNA	NM_004913.2	NP_004904.2	Q9Y2B5	VP9D1_HUMAN	VPS9 domain containing 1						ATP synthesis coupled proton transport (GO:0015986)		GTPase activator activity (GO:0005096)|transporter activity (GO:0005215)										TCCCCCTGACCTCTGTGCTCT	0.597																																																	0																																										SO:0001627	intron_variant	0			AB018551	CCDS42220.1	16q24.3	2012-10-09	2012-10-09	2012-10-09	ENSG00000075399	ENSG00000075399			13526	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 7"""	C16orf7		10231027	Standard	NM_004913		Approved	ATP-BL	uc002fom.1	Q9Y2B5	OTTHUMG00000173219	ENST00000389386.3:c.175+958G>A	16.37:g.89784476C>T				RNA	SNP	-	NULL	ENST00000389386.3	37	NULL	CCDS42220.1	16																																																																																			VPS9D1-AS1	-	-	ENSG00000261373		0.597	VPS9D1-002	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	VPS9D1-AS1	HGNC	protein_coding	OTTHUMT00000422508.1	-	0.00	112	0	C	NM_004913		89784476	+1	tier1	-	no_errors	ENST00000562298	ensembl	human	known	74_37	rna	19.62	127	31	SNP	0.418	T
WDFY3	23001	genome.wustl.edu	37	4	85711028	85711028	+	Nonsense_Mutation	SNP	C	C	A			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr4:85711028C>A	ENST00000295888.4	-	22	3927	c.3520G>T	c.(3520-3522)Gaa>Taa	p.E1174*	WDFY3_ENST00000322366.6_Nonsense_Mutation_p.E1174*	NM_014991.4	NP_055806.2	Q8IZQ1	WDFY3_HUMAN	WD repeat and FYVE domain containing 3	1174					aggrephagy (GO:0035973)|positive regulation of macroautophagy (GO:0016239)	autophagic vacuole (GO:0005776)|cytoplasm (GO:0005737)|extrinsic component of membrane (GO:0019898)|inclusion body (GO:0016234)|nuclear envelope (GO:0005635)|PML body (GO:0016605)	1-phosphatidylinositol binding (GO:0005545)|beta-N-acetylglucosaminylglycopeptide beta-1,4-galactosyltransferase activity (GO:0003831)|metal ion binding (GO:0046872)			breast(5)|central_nervous_system(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(32)|lung(50)|ovary(3)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	134		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000808)		GGGAGAATTTCATAAAATGAG	0.383																																																	0													89.0	88.0	88.0					4																	85711028		2203	4300	6503	SO:0001587	stop_gained	0			AB023210	CCDS3609.1	4q21.3	2013-01-09			ENSG00000163625	ENSG00000163625		"""Zinc fingers, FYVE domain containing"", ""WD repeat domain containing"""	20751	protein-coding gene	gene with protein product						10231032	Standard	NM_014991		Approved	KIAA0993, ALFY, ZFYVE25	uc003hpd.3	Q8IZQ1	OTTHUMG00000130424	ENST00000295888.4:c.3520G>T	4.37:g.85711028C>A	ENSP00000295888:p.Glu1174*		Q4W5K5|Q6P0Q5|Q8N1T2|Q8NAV6|Q96BS7|Q96D33|Q96N85|Q9Y2J7	Nonsense_Mutation	SNP	pfam_BEACH_dom,pfam_Znf_FYVE,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_WD40_repeat_dom,superfamily_Znf_FYVE_PHD,superfamily_ConA-like_lec_gl_sf,superfamily_Cyclin-like,superfamily_ARM-type_fold,smart_WD40_repeat,smart_Znf_FYVE,pfscan_BEACH_dom,pfscan_Znf_FYVE-rel,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.E1174*	ENST00000295888.4	37	c.3520	CCDS3609.1	4	.	.	.	.	.	.	.	.	.	.	C	46	12.419801	0.99666	.	.	ENSG00000163625	ENST00000322366;ENST00000295888	.	.	.	4.85	4.85	0.62838	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.10636	T	0.68	.	18.3293	0.90263	0.0:1.0:0.0:0.0	.	.	.	.	X	1174	.	ENSP00000295888:E1174X	E	-	1	0	WDFY3	85930052	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.442000	0.80503	2.365000	0.80145	0.561000	0.74099	GAA	WDFY3	-	superfamily_ConA-like_lec_gl_sf	ENSG00000163625		0.383	WDFY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDFY3	HGNC	protein_coding	OTTHUMT00000252811.2	-	0.00	22	0	C	NM_014991		85711028	-1	tier1	-	no_errors	ENST00000295888	ensembl	human	known	74_37	nonsense	20.00	16	4	SNP	1.000	A
WDR13	64743	genome.wustl.edu	37	X	48458003	48458003	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chrX:48458003G>T	ENST00000218056.5	+	4	926	c.421G>T	c.(421-423)Gca>Tca	p.A141S	WDR13_ENST00000376729.5_Missense_Mutation_p.A141S|WDR13_ENST00000492715.1_3'UTR	NM_001166426.1|NM_017883.4	NP_001159898.1|NP_060353	Q9H1Z4	WDR13_HUMAN	WD repeat domain 13	141						cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(1)|large_intestine(4)|lung(4)|ovary(2)	11						GCCCACGTCAGCAGCAGAGGC	0.612																																																	0													82.0	71.0	74.0					X																	48458003		2203	4300	6503	SO:0001583	missense	0			AF329819	CCDS14302.1	Xp11.23	2013-01-09			ENSG00000101940	ENSG00000101940		"""WD repeat domain containing"""	14352	protein-coding gene	gene with protein product		300512					Standard	NM_017883		Approved		uc004dkj.2	Q9H1Z4	OTTHUMG00000024119	ENST00000218056.5:c.421G>T	X.37:g.48458003G>T	ENSP00000218056:p.Ala141Ser		Q06DW8|Q06DX0|Q06DX1|Q9BUL7|Q9NWW4	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.A141S	ENST00000218056.5	37	c.421	CCDS14302.1	X	.	.	.	.	.	.	.	.	.	.	G	9.679	1.148912	0.21288	.	.	ENSG00000101940	ENST00000376729;ENST00000218056	T;T	0.70516	-0.49;-0.49	5.48	4.62	0.57501	.	0.247539	0.40064	N	0.001190	T	0.50633	0.1627	L	0.29908	0.895	0.23751	N	0.996944	B;B	0.23937	0.094;0.011	B;B	0.20767	0.031;0.014	T	0.35450	-0.9788	10	0.06757	T	0.87	-6.7095	6.9745	0.24666	0.0955:0.1709:0.7336:0.0	.	19;141	B4DVQ7;Q9H1Z4	.;WDR13_HUMAN	S	141	ENSP00000365919:A141S;ENSP00000218056:A141S	ENSP00000218056:A141S	A	+	1	0	WDR13	48342947	1.000000	0.71417	0.011000	0.14972	0.846000	0.48090	6.707000	0.74654	1.077000	0.40990	0.529000	0.55759	GCA	WDR13	-	NULL	ENSG00000101940		0.612	WDR13-006	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR13	HGNC	protein_coding	OTTHUMT00000060743.2		0.00	16	0	G			48458003	+1			no_errors	ENST00000218056	ensembl	human	known	74_37	missense	5.19	73	4	SNP	0.892	T
WDR87	83889	genome.wustl.edu	37	19	38386867	38386867	+	Intron	SNP	G	G	A			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr19:38386867G>A	ENST00000303868.5	-	3	354				WDR87_ENST00000447313.2_Nonsense_Mutation_p.Q53*	NM_031951.3	NP_114157.3	Q6ZQQ6	WDR87_HUMAN	WD repeat domain 87											NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|lung(2)|prostate(1)|skin(3)|stomach(1)	36						GGCATATTTTGAGGATAGCGA	0.488																																																	0													104.0	86.0	92.0					19																	38386867		692	1591	2283	SO:0001627	intron_variant	0			AK128826	CCDS46063.1, CCDS74356.1	19q13.13	2013-01-09			ENSG00000171804	ENSG00000171804		"""WD repeat domain containing"""	29934	protein-coding gene	gene with protein product							Standard	XM_005259304		Approved	NYD-SP11	uc010efu.2	Q6ZQQ6	OTTHUMG00000048187	ENST00000303868.5:c.129+27C>T	19.37:g.38386867G>A			Q9BWV9	Nonsense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,superfamily_Quinolinate_PRibosylTrfase_C,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.Q53*	ENST00000303868.5	37	c.157	CCDS46063.1	19	.	.	.	.	.	.	.	.	.	.	G	34	5.308337	0.95629	.	.	ENSG00000171804	ENST00000447313	.	.	.	5.77	5.77	0.91146	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.08837	T	0.75	.	17.4807	0.87672	0.0:0.0:1.0:0.0	.	.	.	.	X	53	.	ENSP00000405012:Q53X	Q	-	1	0	WDR87	43078707	1.000000	0.71417	1.000000	0.80357	0.837000	0.47467	4.393000	0.59665	2.722000	0.93159	0.643000	0.83706	CAA	WDR87	-	NULL	ENSG00000171804		0.488	WDR87-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	WDR87	HGNC	protein_coding	OTTHUMT00000314628.2	-	0.00	48	0	G	XM_940478		38386867	-1	tier1	-	no_errors	ENST00000447313	ensembl	human	known	74_37	nonsense	59.40	54	79	SNP	1.000	A
WRN	7486	genome.wustl.edu	37	8	31012243	31012243	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr8:31012243C>G	ENST00000298139.5	+	32	4040	c.3791C>G	c.(3790-3792)tCt>tGt	p.S1264C		NM_000553.4	NP_000544.2	Q14191	WRN_HUMAN	Werner syndrome, RecQ helicase-like	1264					aging (GO:0007568)|ATP catabolic process (GO:0006200)|base-excision repair (GO:0006284)|cell aging (GO:0007569)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|cellular response to starvation (GO:0009267)|DNA duplex unwinding (GO:0032508)|DNA metabolic process (GO:0006259)|DNA recombination (GO:0006310)|DNA replication (GO:0006260)|DNA synthesis involved in DNA repair (GO:0000731)|double-strand break repair (GO:0006302)|multicellular organismal aging (GO:0010259)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleolus to nucleoplasm transport (GO:0032066)|positive regulation of hydrolase activity (GO:0051345)|regulation of apoptotic process (GO:0042981)|regulation of growth rate (GO:0040009)|replication fork processing (GO:0031297)|replicative cell aging (GO:0001302)|response to oxidative stress (GO:0006979)|response to UV-C (GO:0010225)|telomere maintenance (GO:0000723)	centrosome (GO:0005813)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	3'-5' DNA helicase activity (GO:0043138)|3'-5' exonuclease activity (GO:0008408)|ATP binding (GO:0005524)|ATP-dependent 3'-5' DNA helicase activity (GO:0043140)|ATP-dependent DNA helicase activity (GO:0004003)|ATPase activity (GO:0016887)|bubble DNA binding (GO:0000405)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|exonuclease activity (GO:0004527)|four-way junction helicase activity (GO:0009378)|G-quadruplex DNA binding (GO:0051880)|helicase activity (GO:0004386)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|protein complex binding (GO:0032403)|protein homodimerization activity (GO:0042803)|Y-form DNA binding (GO:0000403)			central_nervous_system(2)|endometrium(4)|kidney(4)|large_intestine(13)|lung(28)|ovary(3)|skin(3)|upper_aerodigestive_tract(3)	60		Breast(100;0.195)		KIRC - Kidney renal clear cell carcinoma(542;0.147)|Kidney(114;0.176)|Colorectal(111;0.192)		ATCACATACTCTTTATTCCAA	0.338			"""Mis, N, F, S"""			"""osteosarcoma, meningioma, others"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Werner syndrome																												Ovarian(18;161 598 2706 14834 27543)		yes	Rec		Werner Syndrome	8	8p12-p11.2	7486	Werner syndrome (RECQL2)		"""L, E, M, O"""	0													86.0	80.0	82.0					8																	31012243		2203	4299	6502	SO:0001583	missense	0	Familial Cancer Database	WS, Adult Progeria		CCDS6082.1	8p12	2014-09-17	2009-03-19		ENSG00000165392	ENSG00000165392			12791	protein-coding gene	gene with protein product		604611	"""Werner syndrome"""			9288107	Standard	NM_000553		Approved	RECQL2, RECQ3	uc003xio.4	Q14191	OTTHUMG00000163894	ENST00000298139.5:c.3791C>G	8.37:g.31012243C>G	ENSP00000298139:p.Ser1264Cys		A1KYY9	Missense_Mutation	SNP	pfam_3'-5'_exonuclease_dom,pfam_Helicase_C,pfam_RQC_domain,pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_HRDC_dom,superfamily_P-loop_NTPase,superfamily_RNaseH-like_dom,superfamily_HRDC-like,smart_3'-5'_exonuclease_dom,smart_Helicase_ATP-bd,smart_Helicase_C,smart_RQC_domain,smart_HRDC_dom,pfscan_HRDC_dom,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,tigrfam_DNA_helicase_ATP-dep_RecQ	p.S1264C	ENST00000298139.5	37	c.3791	CCDS6082.1	8	.	.	.	.	.	.	.	.	.	.	C	16.70	3.195685	0.58126	.	.	ENSG00000165392	ENST00000298139	T	0.56611	0.45	5.48	3.67	0.42095	.	0.611513	0.17015	N	0.190330	T	0.59865	0.2225	L	0.58101	1.795	0.28972	N	0.889197	D;D	0.65815	0.991;0.995	P;P	0.55785	0.619;0.784	T	0.56390	-0.7987	10	0.62326	D	0.03	-3.4008	9.2304	0.37432	0.0:0.7724:0.1466:0.0809	.	674;1264	Q59F09;Q14191	.;WRN_HUMAN	C	1264	ENSP00000298139:S1264C	ENSP00000298139:S1264C	S	+	2	0	WRN	31131785	0.035000	0.19736	0.239000	0.24122	0.944000	0.59088	0.567000	0.23608	0.677000	0.31305	0.585000	0.79938	TCT	WRN	-	NULL	ENSG00000165392		0.338	WRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WRN	HGNC	protein_coding	OTTHUMT00000376248.1	-	0.00	63	0	C			31012243	+1	tier1	-	no_errors	ENST00000298139	ensembl	human	known	74_37	missense	38.98	36	23	SNP	0.981	G
WSCD1	23302	genome.wustl.edu	37	17	6021393	6021393	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr17:6021393G>A	ENST00000574946.1	+	8	1650	c.1260G>A	c.(1258-1260)atG>atA	p.M420I	WSCD1_ENST00000573634.1_Missense_Mutation_p.M304I|WSCD1_ENST00000539421.1_Missense_Mutation_p.M420I|WSCD1_ENST00000574232.1_Missense_Mutation_p.M420I|WSCD1_ENST00000317744.5_Missense_Mutation_p.M420I			Q658N2	WSCD1_HUMAN	WSC domain containing 1	420						integral component of membrane (GO:0016021)	sulfotransferase activity (GO:0008146)			breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(14)|ovary(1)|prostate(1)	35						AGATTGAGATGTTTGATTCAG	0.547																																																	0													84.0	79.0	81.0					17																	6021393		2203	4300	6503	SO:0001583	missense	0				CCDS32538.1	17p13.2	2008-02-05				ENSG00000179314			29060	protein-coding gene	gene with protein product							Standard	XM_005256572		Approved	KIAA0523	uc002gcn.3	Q658N2		ENST00000574946.1:c.1260G>A	17.37:g.6021393G>A	ENSP00000460825:p.Met420Ile		A8K0N8|D3DTM3|O60276|Q96G45	Missense_Mutation	SNP	pfam_WSC_carb-bd,pfam_Sulfotransferase_dom,superfamily_P-loop_NTPase,smart_WSC_carb-bd_subgr,pfscan_WSC_carb-bd	p.M420I	ENST00000574946.1	37	c.1260	CCDS32538.1	17	.	.	.	.	.	.	.	.	.	.	G	16.36	3.102544	0.56183	.	.	ENSG00000179314	ENST00000317744;ENST00000539421	T;T	0.30448	1.53;1.53	5.47	5.47	0.80525	.	0.037367	0.85682	D	0.000000	T	0.30417	0.0764	L	0.50919	1.6	0.58432	D	0.999999	B	0.19073	0.033	B	0.17433	0.018	T	0.05084	-1.0907	10	0.21540	T	0.41	-38.635	16.8089	0.85713	0.0:0.0:1.0:0.0	.	420	Q658N2	WSCD1_HUMAN	I	420	ENSP00000323087:M420I;ENSP00000446032:M420I	ENSP00000323087:M420I	M	+	3	0	WSCD1	5962117	1.000000	0.71417	1.000000	0.80357	0.922000	0.55478	9.422000	0.97458	2.583000	0.87209	0.655000	0.94253	ATG	WSCD1	-	superfamily_P-loop_NTPase	ENSG00000179314		0.547	WSCD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WSCD1	HGNC	protein_coding	OTTHUMT00000438965.4	-	0.00	22	0	G	NM_015253		6021393	+1	tier1	-	no_errors	ENST00000317744	ensembl	human	known	74_37	missense	52.00	12	13	SNP	1.000	A
XRN1	54464	genome.wustl.edu	37	3	142131431	142131431	+	Missense_Mutation	SNP	T	T	A			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr3:142131431T>A	ENST00000264951.4	-	15	1785	c.1668A>T	c.(1666-1668)aaA>aaT	p.K556N	XRN1_ENST00000392981.2_Missense_Mutation_p.K556N	NM_019001.3	NP_061874.3	Q8IZH2	XRN1_HUMAN	5'-3' exoribonuclease 1	556					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|histone mRNA catabolic process (GO:0071044)|mRNA metabolic process (GO:0016071)|nuclear mRNA surveillance (GO:0071028)|nuclear-transcribed mRNA catabolic process (GO:0000956)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA metabolic process (GO:0016070)|rRNA catabolic process (GO:0016075)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|membrane (GO:0016020)	5'-3' exonuclease activity (GO:0008409)|DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(3)|endometrium(6)|kidney(12)|large_intestine(11)|liver(1)|lung(17)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	61						ATTCCTGTTGTTTCCCATTTA	0.323																																																	0													120.0	113.0	115.0					3																	142131431		2203	4299	6502	SO:0001583	missense	0			AY137776	CCDS3123.1, CCDS63801.1, CCDS75028.1	3q23	2008-02-05			ENSG00000114127	ENSG00000114127			30654	protein-coding gene	gene with protein product		607994				12515382	Standard	XM_005247544		Approved	SEP1	uc003eus.3	Q8IZH2	OTTHUMG00000159251	ENST00000264951.4:c.1668A>T	3.37:g.142131431T>A	ENSP00000264951:p.Lys556Asn		Q4G0S3|Q68D88|Q6AI24|Q6MZS8|Q86WS7|Q8N8U4|Q9UF39	Missense_Mutation	SNP	pfam_Put_53exo,pirsf_5_3_exoribonuclease_1	p.K556N	ENST00000264951.4	37	c.1668	CCDS3123.1	3	.	.	.	.	.	.	.	.	.	.	T	21.0	4.082573	0.76528	.	.	ENSG00000114127	ENST00000264951;ENST00000392981	T;T	0.74632	-0.86;-0.86	5.84	2.21	0.28008	.	0.000000	0.85682	D	0.000000	D	0.85517	0.5715	M	0.88105	2.93	0.80722	D	1	D;D;D	0.76494	0.985;0.999;0.999	D;D;D	0.75484	0.949;0.978;0.986	D	0.84606	0.0675	10	0.66056	D	0.02	-23.309	8.6187	0.33849	0.0:0.3547:0.0:0.6453	.	417;556;556	B3KW17;Q8IZH2-2;Q8IZH2	.;.;XRN1_HUMAN	N	556	ENSP00000264951:K556N;ENSP00000376707:K556N	ENSP00000264951:K556N	K	-	3	2	XRN1	143614121	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	0.853000	0.27777	0.471000	0.27319	0.482000	0.46254	AAA	XRN1	-	pirsf_5_3_exoribonuclease_1	ENSG00000114127		0.323	XRN1-001	KNOWN	basic|CCDS	protein_coding	XRN1	HGNC	protein_coding	OTTHUMT00000354087.2	-	0.00	59	0	T	NM_019001		142131431	-1	tier1	-	no_errors	ENST00000264951	ensembl	human	known	74_37	missense	15.33	127	23	SNP	1.000	A
ZFC3H1	196441	genome.wustl.edu	37	12	72028607	72028608	+	Splice_Site	INS	-	-	A	rs398044490|rs397850786|rs34399921	byFrequency	TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr12:72028607_72028608insA	ENST00000378743.3	-	11	2597		c.e11-2			NM_144982.4	NP_659419.3	O60293	ZC3H1_HUMAN	zinc finger, C3H1-type containing						RNA processing (GO:0006396)	extracellular space (GO:0005615)|intracellular (GO:0005622)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)	p.?(1)		NS(1)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(12)|lung(31)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	69						TGAAGCTTGCTAAAAAAAAAAA	0.327																																																	1	Unknown(1)	ovary(1)																																								SO:0001630	splice_region_variant	0			AB011118	CCDS41813.1	12q21.1	2013-01-25	2008-10-01	2008-10-01		ENSG00000133858		"""Zinc finger, C3H1-type containing"""	28328	protein-coding gene	gene with protein product			"""proline/serine-rich coiled-coil 2"", ""coiled-coil domain containing 131"""	PSRC2, CCDC131		9628581	Standard	NM_144982		Approved	MGC23401, KIAA0546	uc001swo.2	O60293	OTTHUMG00000169545	ENST00000378743.3:c.2239-2->T	12.37:g.72028618_72028618dupA			Q6GMU1|Q6P2S9|Q6ZV36|Q96BE7	Splice_Site	INS	-	e11-2	ENST00000378743.3	37	c.2239-3_2239-2	CCDS41813.1	12																																																																																			ZFC3H1	-	-	ENSG00000133858		0.327	ZFC3H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFC3H1	HGNC	protein_coding	OTTHUMT00000404751.1		0.00	18	0	-	NM_144982	Intron	72028608	-1	tier1		no_errors	ENST00000378743	ensembl	human	known	74_37	splice_site_ins	9.09	30	3	INS	0.902:0.745	A
ZKSCAN3	80317	genome.wustl.edu	37	6	28327648	28327648	+	Silent	SNP	G	G	T			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr6:28327648G>T	ENST00000377255.3	+	3	582	c.285G>T	c.(283-285)ctG>ctT	p.L95L	ZKSCAN3_ENST00000252211.2_Silent_p.L95L|ZKSCAN3_ENST00000341464.5_Intron	NM_001242894.1	NP_001229823.1	Q9BRR0	ZKSC3_HUMAN	zinc finger with KRAB and SCAN domains 3	95	SCAN box. {ECO:0000255|PROSITE- ProRule:PRU00187}.				autophagy (GO:0006914)|lysosome organization (GO:0007040)|negative regulation of autophagy (GO:0010507)|negative regulation of cellular senescence (GO:2000773)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			kidney(4)|large_intestine(3)|lung(8)|pancreas(1)|skin(2)|stomach(2)|urinary_tract(1)	21						AGCAGTTCCTGACCATCCTGC	0.627																																																	0													29.0	32.0	31.0					6																	28327648		2200	4291	6491	SO:0001819	synonymous_variant	0			U71601	CCDS4650.1, CCDS56408.1	6p22.1	2013-01-09	2007-02-20	2007-02-20		ENSG00000189298		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	13853	protein-coding gene	gene with protein product		612791	"""zinc finger protein 306"", ""zinc finger protein 309"""	ZNF306, ZNF309		10520746, 22531714	Standard	NM_024493		Approved	Zfp47, ZF47, ZSCAN35	uc003nle.4	Q9BRR0	OTTHUMG00000014521	ENST00000377255.3:c.285G>T	6.37:g.28327648G>T			B2R8W2|B3KVC0|H7BXX1|Q5VXH3|Q92972|Q9H4T3	Silent	SNP	pfam_Tscrpt_reg_SCAN,pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Retrov_capsid_C,superfamily_Krueppel-associated_box,smart_Tscrpt_reg_SCAN,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Tscrpt_reg_SCAN	p.L95	ENST00000377255.3	37	c.285	CCDS4650.1	6																																																																																			ZKSCAN3	-	pfam_Tscrpt_reg_SCAN,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,pfscan_Tscrpt_reg_SCAN	ENSG00000189298		0.627	ZKSCAN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZKSCAN3	HGNC	protein_coding	OTTHUMT00000040189.3	-	0.00	31	0	G	NM_024493		28327648	+1	tier1	-	no_errors	ENST00000252211	ensembl	human	known	74_37	silent	43.33	34	26	SNP	1.000	T
ZMYM1	79830	genome.wustl.edu	37	1	35580160	35580160	+	Missense_Mutation	SNP	A	A	C			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr1:35580160A>C	ENST00000373330.1	+	11	2903	c.2729A>C	c.(2728-2730)aAa>aCa	p.K910T	ZMYM1_ENST00000359858.4_Missense_Mutation_p.K910T|ZMYM1_ENST00000373329.1_3'UTR			Q5SVZ6	ZMYM1_HUMAN	zinc finger, MYM-type 1	910						nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(5)|lung(8)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)	31		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				GTATACTTTAAAACAATCTGG	0.279																																																	0													18.0	17.0	17.0					1																	35580160		1785	4057	5842	SO:0001583	missense	0			AK096206	CCDS41302.1	1p34.3	2008-05-02	2005-09-12		ENSG00000197056	ENSG00000197056		"""Zinc fingers, MYM type"""	26253	protein-coding gene	gene with protein product			"""zinc finger, MYM domain containing 1"""			12477932	Standard	XM_005271216		Approved	FLJ23151, MYM	uc001bym.3	Q5SVZ6	OTTHUMG00000004374	ENST00000373330.1:c.2729A>C	1.37:g.35580160A>C	ENSP00000362427:p.Lys910Thr		D3DPR7|Q7Z3Q4	Missense_Mutation	SNP	pfam_Znf_MYM,pfam_HATC_dom_C,superfamily_RNaseH-like_dom,smart_TRASH_dom	p.K910T	ENST00000373330.1	37	c.2729	CCDS41302.1	1	.	.	.	.	.	.	.	.	.	.	A	8.773	0.926276	0.18056	.	.	ENSG00000197056	ENST00000359858;ENST00000373329;ENST00000373330	T;T;T	0.23950	1.88;1.88;1.88	4.74	4.74	0.60224	Ribonuclease H-like (1);	0.150568	0.32106	N	0.006573	T	0.39809	0.1092	L	0.51422	1.61	0.22684	N	0.998855	D;D	0.76494	0.999;0.998	D;D	0.78314	0.991;0.987	T	0.16453	-1.0402	9	.	.	.	-18.1957	7.5588	0.27839	0.9017:0.0:0.0983:0.0	.	891;910	B4DSJ9;Q5SVZ6	.;ZMYM1_HUMAN	T	910;835;910	ENSP00000352920:K910T;ENSP00000362426:K835T;ENSP00000362427:K910T	.	K	+	2	0	ZMYM1	35352747	0.987000	0.35691	0.110000	0.21437	0.004000	0.04260	1.801000	0.38843	2.086000	0.62901	0.374000	0.22700	AAA	ZMYM1	-	superfamily_RNaseH-like_dom	ENSG00000197056		0.279	ZMYM1-001	NOVEL	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZMYM1	HGNC	protein_coding	OTTHUMT00000012705.1	-	0.00	28	0	A	NM_024772		35580160	+1	tier1	-	no_errors	ENST00000359858	ensembl	human	novel	74_37	missense	21.15	41	11	SNP	0.573	C
ZNF268	10795	genome.wustl.edu	37	12	133778860	133778860	+	Silent	SNP	A	A	T			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr12:133778860A>T	ENST00000536435.2	+	6	918	c.588A>T	c.(586-588)tcA>tcT	p.S196S	ZNF268_ENST00000541211.2_Missense_Mutation_p.Q154L|ZNF268_ENST00000592241.1_3'UTR|ZNF268_ENST00000541009.2_3'UTR|ZNF268_ENST00000539248.2_Missense_Mutation_p.Q122L|ZNF268_ENST00000542711.2_Missense_Mutation_p.Q87L|ZNF268_ENST00000228289.5_Silent_p.S196S|CTD-2140B24.4_ENST00000540096.2_3'UTR|ZNF268_ENST00000536899.2_Missense_Mutation_p.Q55L|ZNF268_ENST00000537565.1_Silent_p.S35S|ZNF268_ENST00000542986.2_3'UTR|ZNF268_ENST00000416488.1_3'UTR	NM_001165885.1|NM_003415.2	NP_001159357.1|NP_003406.1	Q14587	ZN268_HUMAN	zinc finger protein 268	196					cell differentiation (GO:0030154)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell cycle arrest (GO:0071157)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein homodimerization activity (GO:0090073)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter during mitosis (GO:0046022)|regulation of mitotic cell cycle (GO:0007346)|regulation of protein heterodimerization activity (GO:0043497)|regulation of transcription, DNA-templated (GO:0006355)|release of cytoplasmic sequestered NF-kappaB (GO:0008588)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|breast(3)|endometrium(4)|kidney(2)|large_intestine(2)|liver(2)|lung(7)|ovary(1)|skin(1)	24	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_cancers(7;0.000215)|all_epithelial(31;0.096)		OV - Ovarian serous cystadenocarcinoma(86;3.58e-08)|Epithelial(86;6.6e-07)|all cancers(50;2.28e-05)		AGTATCTTTCAAGACAAAAAC	0.348																																																	0													68.0	69.0	68.0					12																	133778860		1839	4086	5925	SO:0001819	synonymous_variant	0			X78926	CCDS45012.1, CCDS53851.1, CCDS53852.1, CCDS53853.1, CCDS53854.1, CCDS59239.1, CCDS59240.1	12q24.33	2013-01-08				ENSG00000090612		"""Zinc fingers, C2H2-type"", ""-"""	13061	protein-coding gene	gene with protein product		604753				7865130	Standard	NM_003415		Approved	HZF3	uc010tcf.2	Q14587	OTTHUMG00000167946	ENST00000536435.2:c.588A>T	12.37:g.133778860A>T			Q8TDG8|Q96RH4|Q9BZJ9	Missense_Mutation	SNP	NULL	p.Q154L	ENST00000536435.2	37	c.461	CCDS45012.1	12	.	.	.	.	.	.	.	.	.	.	A	6.712	0.500055	0.12762	.	.	ENSG00000090612	ENST00000536435;ENST00000542711;ENST00000536899	.	.	.	3.79	2.59	0.31030	.	.	.	.	.	T	0.36303	0.0962	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.21042	-1.0257	4	.	.	.	.	9.4052	0.38457	0.8197:0.1802:0.0:0.0	.	.	.	.	L	154;87;55	.	.	Q	+	2	0	ZNF268	132288933	0.017000	0.18338	0.004000	0.12327	0.027000	0.11550	1.866000	0.39489	0.602000	0.29896	0.514000	0.50259	CAA	ZNF268	-	NULL	ENSG00000090612		0.348	ZNF268-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF268	HGNC	protein_coding	OTTHUMT00000397191.2	-	0.00	38	0	A	NM_152943		133778860	+1	tier1	-	no_errors	ENST00000541211	ensembl	human	known	74_37	missense	32.00	17	8	SNP	0.002	T
ZNF385D	79750	genome.wustl.edu	37	3	22210428	22210428	+	5'UTR	SNP	A	A	G			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr3:22210428A>G	ENST00000494118.1	-	0	282							Q9H6B1	Z385D_HUMAN	zinc finger protein 385D							nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			NS(2)|breast(2)|endometrium(3)|kidney(2)|large_intestine(13)|lung(18)|ovary(1)|prostate(1)|skin(4)	46						TACATTGCACAAAGTAAAGTT	0.388																																																	0																																										SO:0001623	5_prime_UTR_variant	0			BC007212	CCDS2636.1	3p24.3	2012-10-05	2007-12-06	2007-12-06	ENSG00000151789	ENSG00000151789			26191	protein-coding gene	gene with protein product			"""zinc finger protein 659"""	ZNF659		12477932	Standard	NM_024697		Approved	FLJ22419	uc003cce.3	Q9H6B1	OTTHUMG00000130484	ENST00000494118.1:c.-768T>C	3.37:g.22210428A>G				RNA	SNP	-	NULL	ENST00000494118.1	37	NULL		3																																																																																			ZNF385D	-	-	ENSG00000151789		0.388	ZNF385D-008	KNOWN	basic	processed_transcript	ZNF385D	HGNC	protein_coding	OTTHUMT00000340810.1	-	0.00	67	0	A	NM_024697		22210428	-1	tier1	-	no_errors	ENST00000466511	ensembl	human	known	74_37	rna	24.66	55	18	SNP	1.000	G
ZNF469	84627	genome.wustl.edu	37	16	88499969	88499969	+	Missense_Mutation	SNP	G	G	A	rs273585622		TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr16:88499969G>A	ENST00000437464.1	+	2	6007	c.6007G>A	c.(6007-6009)Gag>Aag	p.E2003K	ZNF469_ENST00000565624.1_Missense_Mutation_p.E2031K	NM_001127464.1	NP_001120936.1	Q96JG9	ZN469_HUMAN	zinc finger protein 469	2003					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(6)|kidney(3)|large_intestine(1)|skin(6)	20						CGGCCCCACCGAGGGTGCAGT	0.642																																																	0													35.0	48.0	44.0					16																	88499969		692	1590	2282	SO:0001583	missense	0			AB058761	CCDS45544.1	16q24	2010-08-04				ENSG00000225614		"""Zinc fingers, C2H2-type"""	23216	protein-coding gene	gene with protein product		612078				11347906	Standard	NM_001127464		Approved	KIAA1858	uc002fku.2	Q96JG9		ENST00000437464.1:c.6007G>A	16.37:g.88499969G>A	ENSP00000402343:p.Glu2003Lys			Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.E2003K	ENST00000437464.1	37	c.6007	CCDS45544.1	16	.	.	.	.	.	.	.	.	.	.	g	9.314	1.056441	0.19907	.	.	ENSG00000225614	ENST00000437464	T	0.05139	3.49	4.88	-5.66	0.02451	.	.	.	.	.	T	0.03520	0.0101	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.40175	-0.9577	9	0.44086	T	0.13	.	13.8054	0.63227	0.6497:0.0:0.3503:0.0	.	2003	Q96JG9	ZN469_HUMAN	K	2003	ENSP00000402343:E2003K	ENSP00000402343:E2003K	E	+	1	0	ZNF469	87027470	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.747000	0.04823	-1.451000	0.01933	-2.226000	0.00293	GAG	ZNF469	-	NULL	ENSG00000225614		0.642	ZNF469-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF469	HGNC	protein_coding		-	0.00	35	0	G	NG_012236		88499969	+1	tier1	-	no_errors	ENST00000437464	ensembl	human	known	74_37	missense	34.21	25	13	SNP	0.000	A
ZNF570	148268	genome.wustl.edu	37	19	37960340	37960340	+	5'UTR	SNP	G	G	T			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr19:37960340G>T	ENST00000330173.1	+	0	359				ZNF569_ENST00000591073.1_5'Flank|ZNF570_ENST00000591380.1_3'UTR|ZNF569_ENST00000316950.6_5'Flank|ZNF569_ENST00000592490.1_5'Flank|ZNF569_ENST00000392149.2_5'Flank|ZNF570_ENST00000586475.1_Intron|ZNF570_ENST00000388801.3_5'UTR	NM_144694.1	NP_653295.1	Q96NI8	ZN570_HUMAN	zinc finger protein 570						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|kidney(3)|large_intestine(6)|lung(12)|ovary(1)|prostate(1)|skin(1)	27			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			CCGAGCCTTCGGGGCAGGAAG	0.632																																																	0																																										SO:0001623	5_prime_UTR_variant	0			AK055353	CCDS12504.1, CCDS74355.1	19q13.12	2013-09-20			ENSG00000171827	ENSG00000171827		"""Zinc fingers, C2H2-type"", ""-"""	26416	protein-coding gene	gene with protein product							Standard	XM_005258567		Approved	FLJ30791	uc002ogk.1	Q96NI8	OTTHUMG00000048176	ENST00000330173.1:c.-171G>T	19.37:g.37960340G>T			A1L472|B4DMP1	RNA	SNP	-	NULL	ENST00000330173.1	37	NULL	CCDS12504.1	19																																																																																			ZNF570	-	-	ENSG00000171827		0.632	ZNF570-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF570	HGNC	protein_coding	OTTHUMT00000109600.1	-	0.00	29	0	G	NM_144694		37960340	+1	tier1	-	no_errors	ENST00000591380	ensembl	human	known	74_37	rna	11.11	32	4	SNP	0.000	T
ZNF653	115950	genome.wustl.edu	37	19	11598149	11598149	+	Missense_Mutation	SNP	T	T	C			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr19:11598149T>C	ENST00000293771.5	-	4	1265	c.1129A>G	c.(1129-1131)Acc>Gcc	p.T377A	CTC-398G3.6_ENST00000585656.1_Intron	NM_138783.3	NP_620138.2	Q96CK0	ZN653_HUMAN	zinc finger protein 653	377					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|kidney(3)|large_intestine(2)|lung(8)|prostate(1)|skin(1)	17						GCGTCCATGGTGCTAGGCTGG	0.682																																					Pancreas(83;980 1446 4542 6441 43352)												0													72.0	60.0	64.0					19																	11598149		2203	4300	6503	SO:0001583	missense	0			AY072704	CCDS12261.1	19p13.2	2013-01-08						"""Zinc fingers, C2H2-type"""	25196	protein-coding gene	gene with protein product		611371				12477932	Standard	NM_138783		Approved	Zip67	uc002mrz.2	Q96CK0		ENST00000293771.5:c.1129A>G	19.37:g.11598149T>C	ENSP00000293771:p.Thr377Ala		Q96AS7	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.T377A	ENST00000293771.5	37	c.1129	CCDS12261.1	19	.	.	.	.	.	.	.	.	.	.	T	4.298	0.054641	0.08291	.	.	ENSG00000161914	ENST00000293771	T	0.10382	2.88	4.26	2.0	0.26442	.	0.867250	0.10170	N	0.707222	T	0.04907	0.0132	N	0.08118	0	0.20403	N	0.999905	B	0.02656	0.0	B	0.01281	0.0	T	0.32877	-0.9890	10	0.41790	T	0.15	-39.8739	3.218	0.06705	0.1829:0.1922:0.0:0.6249	.	377	Q96CK0	ZN653_HUMAN	A	377	ENSP00000293771:T377A	ENSP00000293771:T377A	T	-	1	0	ZNF653	11459149	0.002000	0.14202	0.988000	0.46212	0.176000	0.22953	-0.056000	0.11787	1.686000	0.51046	0.379000	0.24179	ACC	ZNF653	-	NULL	ENSG00000161914		0.682	ZNF653-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF653	HGNC	protein_coding	OTTHUMT00000458836.2	-	0.00	43	0	T	NM_138783		11598149	-1	tier1	-	no_errors	ENST00000293771	ensembl	human	known	74_37	missense	10.00	90	10	SNP	0.410	C
ZNF570	148268	genome.wustl.edu	37	19	37975938	37975938	+	Missense_Mutation	SNP	T	T	C			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr19:37975938T>C	ENST00000330173.1	+	5	1943	c.1414T>C	c.(1414-1416)Tgt>Cgt	p.C472R	CTD-2086O20.3_ENST00000591976.1_lincRNA|ZNF570_ENST00000586475.1_Missense_Mutation_p.C528R|ZNF570_ENST00000388801.3_Missense_Mutation_p.C269R	NM_144694.1	NP_653295.1	Q96NI8	ZN570_HUMAN	zinc finger protein 570	472					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|kidney(3)|large_intestine(6)|lung(12)|ovary(1)|prostate(1)|skin(1)	27			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			ACCTTATGAATGTACTGTTTG	0.408																																																	0													108.0	108.0	108.0					19																	37975938		2203	4300	6503	SO:0001583	missense	0			AK055353	CCDS12504.1, CCDS74355.1	19q13.12	2013-09-20			ENSG00000171827	ENSG00000171827		"""Zinc fingers, C2H2-type"", ""-"""	26416	protein-coding gene	gene with protein product							Standard	XM_005258567		Approved	FLJ30791	uc002ogk.1	Q96NI8	OTTHUMG00000048176	ENST00000330173.1:c.1414T>C	19.37:g.37975938T>C	ENSP00000331540:p.Cys472Arg		A1L472|B4DMP1	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.C472R	ENST00000330173.1	37	c.1414	CCDS12504.1	19	.	.	.	.	.	.	.	.	.	.	T	17.20	3.327993	0.60743	.	.	ENSG00000171827	ENST00000330173;ENST00000388801	D;D	0.85258	-1.96;-1.96	4.25	4.25	0.50352	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.46442	D	0.000297	D	0.94751	0.8306	H	0.97707	4.06	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.96017	0.9006	10	0.87932	D	0	.	12.7631	0.57376	0.0:0.0:0.0:1.0	.	269;472	B4DMP1;Q96NI8	.;ZN570_HUMAN	R	472;269	ENSP00000331540:C472R;ENSP00000373453:C269R	ENSP00000331540:C472R	C	+	1	0	ZNF570	42667778	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	5.754000	0.68743	1.905000	0.55150	0.460000	0.39030	TGT	ZNF570	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000171827		0.408	ZNF570-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF570	HGNC	protein_coding	OTTHUMT00000109600.1	-	0.00	45	0	T	NM_144694		37975938	+1	tier1	-	no_errors	ENST00000330173	ensembl	human	known	74_37	missense	14.61	76	13	SNP	0.998	C
ZNF720	124411	genome.wustl.edu	37	16	31724640	31724640	+	5'UTR	SNP	G	G	A			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr16:31724640G>A	ENST00000316491.9	+	0	86				ZNF720_ENST00000531864.2_3'UTR|ZNF720_ENST00000534369.1_5'UTR|ZNF720_ENST00000398696.3_5'UTR|CTD-2358C21.4_ENST00000569175.2_RNA|ZNF720_ENST00000399681.3_5'UTR|ZNF720_ENST00000539915.1_5'UTR	NM_001130913.1	NP_001124385.1	Q7Z2F6	ZN720_HUMAN	zinc finger protein 720						regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	nucleic acid binding (GO:0003676)			endometrium(1)|kidney(1)|lung(1)|stomach(1)	4						CCTTCCATCTGGGAGGCCAAG	0.607																																																	0																																										SO:0001623	5_prime_UTR_variant	0			AK128671	CCDS45473.1	16p11.2	2013-01-08				ENSG00000197302		"""Zinc fingers, C2H2-type"", ""-"""	26987	protein-coding gene	gene with protein product							Standard	NM_001130913		Approved		uc002ecq.3	Q7Z2F6		ENST00000316491.9:c.-114G>A	16.37:g.31724640G>A			Q6ZQX1	RNA	SNP	-	NULL	ENST00000316491.9	37	NULL	CCDS45473.1	16																																																																																			ZNF720	-	-	ENSG00000197302		0.607	ZNF720-001	KNOWN	basic|CCDS	protein_coding	ZNF720	HGNC	protein_coding	OTTHUMT00000394883.3	-	0.00	20	0	G	NM_001004300		31724640	+1	tier1	-	no_errors	ENST00000531864	ensembl	human	known	74_37	rna	25.81	23	8	SNP	0.000	A
ZNF727	442319	genome.wustl.edu	37	7	63537932	63537932	+	Silent	SNP	A	A	C			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr7:63537932A>C	ENST00000550760.3	+	4	684	c.505A>C	c.(505-507)Aga>Cga	p.R169R	RP11-3N2.13_ENST00000445978.1_RNA	NM_001159522.1	NP_001152994.1	A8MUV8	ZN727_HUMAN	zinc finger protein 727	169					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|kidney(2)|skin(1)|stomach(1)|urinary_tract(1)	8						AATTTTTAGCAGAGAGAAATG	0.358																																																	0													42.0	33.0	36.0					7																	63537932		692	1591	2283	SO:0001819	synonymous_variant	0					7q11.21	2014-09-09	2014-09-09	2014-09-09	ENSG00000214652	ENSG00000214652		"""Zinc fingers, C2H2-type"", ""-"""	22785	pseudogene	pseudogene			"""zinc finger protein 727, pseudogene"""	ZNF727P			Standard	NM_001159522		Approved		uc011kdm.2	A8MUV8	OTTHUMG00000156536	ENST00000550760.3:c.505A>C	7.37:g.63537932A>C				Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R169	ENST00000550760.3	37	c.505	CCDS55113.1	7																																																																																			ZNF727	-	pfscan_Znf_C2H2	ENSG00000257482		0.358	ZNF727-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF727	HGNC	protein_coding		-	0.00	21	0	A	NM_001159522		63537932	+1	tier1	-	no_errors	ENST00000550760	ensembl	human	known	74_37	silent	19.57	37	9	SNP	0.019	C
ZNF736	728927	genome.wustl.edu	37	7	63797361	63797361	+	Splice_Site	SNP	G	G	T			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr7:63797361G>T	ENST00000423484.2	+	3	348		c.e3+1		ZNF736_ENST00000355095.4_Splice_Site			B4DX44	ZN736_HUMAN	zinc finger protein 736						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(6)|stomach(1)|urinary_tract(1)	9						AAACACCCAGGTAGGTGGGAG	0.483																																																	0													66.0	61.0	62.0					7																	63797361		692	1591	2283	SO:0001630	splice_region_variant	0				CCDS55114.1	7q11.21	2013-01-08			ENSG00000234444	ENSG00000234444		"""Zinc fingers, C2H2-type"", ""-"""	32467	protein-coding gene	gene with protein product							Standard	XM_006716104		Approved		uc011kdo.2	B4DX44	OTTHUMG00000156537	ENST00000423484.2:c.226+1G>T	7.37:g.63797361G>T				Splice_Site	SNP	-	e3+1	ENST00000423484.2	37	c.226+1	CCDS55114.1	7	.	.	.	.	.	.	.	.	.	.	G	2.773	-0.255340	0.05829	.	.	ENSG00000234444	ENST00000355095;ENST00000423484	.	.	.	0.235	0.235	0.15431	.	.	.	.	.	.	.	.	.	.	.	0.20638	N	0.999879	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	-1	.	.	.	+	.	.	ZNF736	63434796	0.993000	0.37304	0.040000	0.18447	0.040000	0.13550	1.378000	0.34328	0.308000	0.22923	0.313000	0.20887	.	ZNF736	-	-	ENSG00000234444		0.483	ZNF736-003	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	ZNF736	HGNC	protein_coding	OTTHUMT00000344559.2	-	0.00	29	0	G	NM_001170905	Intron	63797361	+1	tier1	-	no_errors	ENST00000355095	ensembl	human	known	74_37	splice_site	11.27	62	8	SNP	0.045	T
ZNF880	400713	genome.wustl.edu	37	19	52887707	52887707	+	Nonsense_Mutation	SNP	G	G	T			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr19:52887707G>T	ENST00000422689.2	+	4	889	c.874G>T	c.(874-876)Gga>Tga	p.G292*		NM_001145434.1	NP_001138906.1	Q6PDB4	ZN880_HUMAN	zinc finger protein 880	292					regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(2)|skin(1)	10						AATCCACACTGGAGAGAAACC	0.398																																																	0													67.0	62.0	63.0					19																	52887707		1568	3582	5150	SO:0001587	stop_gained	0			BC058819	CCDS46164.1	19q13.41	2013-01-08			ENSG00000221923	ENSG00000221923		"""Zinc fingers, C2H2-type"", ""-"""	37249	protein-coding gene	gene with protein product							Standard	NM_001145434		Approved		uc002pzc.3	Q6PDB4	OTTHUMG00000167972	ENST00000422689.2:c.874G>T	19.37:g.52887707G>T	ENSP00000406318:p.Gly292*		B4DNA6	Nonsense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.G292*	ENST00000422689.2	37	c.874	CCDS46164.1	19	.	.	.	.	.	.	.	.	.	.	G	11.55	1.672750	0.29693	.	.	ENSG00000221923	ENST00000422689	.	.	.	2.03	-2.17	0.07059	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	6.7085	0.23264	0.38:0.0:0.62:0.0	.	.	.	.	X	292	.	.	G	+	1	0	ZNF880	57579519	0.146000	0.22672	0.008000	0.14137	0.214000	0.24535	2.459000	0.45023	-0.649000	0.05430	-0.271000	0.10264	GGA	ZNF880	-	pfscan_Znf_C2H2	ENSG00000221923		0.398	ZNF880-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF880	HGNC	protein_coding	OTTHUMT00000397374.1	-	0.00	45	0	G	NM_001145434		52887707	+1	tier1	-	no_errors	ENST00000422689	ensembl	human	known	74_37	nonsense	36.96	29	17	SNP	0.998	T
ZNF749	388567	genome.wustl.edu	37	19	57955810	57955810	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr19:57955810C>A	ENST00000334181.4	+	3	1544	c.1294C>A	c.(1294-1296)Cat>Aat	p.H432N	AC004076.9_ENST00000596831.1_Intron	NM_001023561.2	NP_001018855.2	O43361	ZN749_HUMAN	zinc finger protein 749	432					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(6)|kidney(2)|lung(3)|prostate(1)	13		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0264)|Lung(386;0.177)		TCTGAAAATTCATACTGGAGA	0.428																																																	0													86.0	84.0	85.0					19																	57955810		2203	4300	6503	SO:0001583	missense	0			AK122740	CCDS33132.2	19q13.43	2013-01-08			ENSG00000186230	ENSG00000186230		"""Zinc fingers, C2H2-type"", ""-"""	32783	protein-coding gene	gene with protein product							Standard	NM_001023561		Approved	FLJ16360	uc002qoq.2	O43361	OTTHUMG00000150372	ENST00000334181.4:c.1294C>A	19.37:g.57955810C>A	ENSP00000333980:p.His432Asn			Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.H432N	ENST00000334181.4	37	c.1294	CCDS33132.2	19	.	.	.	.	.	.	.	.	.	.	C	16.64	3.180066	0.57800	.	.	ENSG00000186230	ENST00000334181	T	0.67345	-0.26	1.82	1.82	0.25136	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.83055	0.5171	M	0.90870	3.155	0.31274	N	0.69138	D	0.76494	0.999	D	0.71414	0.973	T	0.82478	-0.0437	9	0.87932	D	0	.	11.2942	0.49269	0.0:1.0:0.0:0.0	.	432	O43361	ZN749_HUMAN	N	432	ENSP00000333980:H432N	ENSP00000333980:H432N	H	+	1	0	ZNF749	62647622	0.980000	0.34600	0.090000	0.20809	0.244000	0.25665	4.395000	0.59678	1.310000	0.45006	0.460000	0.39030	CAT	ZNF749	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000186230		0.428	ZNF749-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF749	HGNC	protein_coding	OTTHUMT00000317879.1	-	0.00	40	0	C	NM_001023561		57955810	+1	tier1	-	no_errors	ENST00000334181	ensembl	human	known	74_37	missense	63.83	17	30	SNP	0.995	A
ZNRD1-AS1	80862	genome.wustl.edu	37	6	29976907	29976907	+	RNA	SNP	G	G	A			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr6:29976907G>A	ENST00000376797.3	-	0	772				ZNRD1-AS1_ENST00000425604.1_RNA|ZNRD1-AS1_ENST00000448093.1_RNA|ZNRD1-AS1_ENST00000444051.1_RNA|ZNRD1-AS1_ENST00000420251.1_RNA|HLA-J_ENST00000462773.1_RNA			Q2KJ03	ZRAS1_HUMAN	ZNRD1 antisense RNA 1																		CTCACAGGACGTTTTCTTCCC	0.507																																																	0																																												0			AF032110		6p21.33	2014-08-14	2012-08-15	2010-11-25	ENSG00000204623	ENSG00000204623		"""Long non-coding RNAs"""	13924	non-coding RNA	RNA, long non-coding		615714	"""chromosome 6 open reading frame 12"", ""non-protein coding RNA 171"", ""ZNRD1 antisense RNA (non-protein coding)"", ""ZNRD1 antisense RNA 1 (non-protein coding)"""	C6orf12, NCRNA00171, ZNRD1AS, ZNRD1-AS		9553157, 11130983, 25110835	Standard	NR_026751		Approved	HTEX4, Em:AB023056.3	uc003rto.3	Q2KJ03	OTTHUMG00000031109		6.37:g.29976907G>A				RNA	SNP	-	NULL	ENST00000376797.3	37	NULL		6																																																																																			ZNRD1-AS1	-	-	ENSG00000204623		0.507	ZNRD1-AS1-006	KNOWN	basic|exp_conf	antisense	ZNRD1-AS1	HGNC	antisense	OTTHUMT00000253083.1	-	0.00	68	0	G	NR_026751		29976907	-1	tier1	-	no_errors	ENST00000376797	ensembl	human	known	74_37	rna	47.83	48	44	SNP	0.014	A
ZSWIM1	90204	genome.wustl.edu	37	20	44511684	44511684	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr20:44511684C>A	ENST00000372523.1	+	2	548	c.453C>A	c.(451-453)ttC>ttA	p.F151L	ZSWIM1_ENST00000372520.1_Missense_Mutation_p.F151L	NM_080603.4	NP_542170.3	Q9BR11	ZSWM1_HUMAN	zinc finger, SWIM-type containing 1	151						nucleus (GO:0005634)	zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|large_intestine(4)|lung(3)|ovary(1)|skin(1)	13		Myeloproliferative disorder(115;0.028)				ATCCTCATTTCCTTCCACTGC	0.502																																																	0													122.0	111.0	115.0					20																	44511684		2203	4300	6503	SO:0001583	missense	0			AL008726	CCDS13382.2	20q13.12	2013-09-20	2003-12-17	2003-12-19	ENSG00000168612	ENSG00000168612		"""Zinc fingers, SWIM-type"""	16155	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 162"""	C20orf162			Standard	NM_080603		Approved	dJ337O18.5	uc010ghi.3	Q9BR11	OTTHUMG00000074023	ENST00000372523.1:c.453C>A	20.37:g.44511684C>A	ENSP00000361601:p.Phe151Leu		Q5JZH2|Q9BR12|Q9BV30	Missense_Mutation	SNP	pfam_Znf_SWIM,pfscan_Znf_SWIM	p.F151L	ENST00000372523.1	37	c.453	CCDS13382.2	20	.	.	.	.	.	.	.	.	.	.	C	6.067	0.380724	0.11466	.	.	ENSG00000168612	ENST00000372523;ENST00000372520	T;T	0.24723	1.84;1.84	5.38	2.45	0.29901	.	0.122041	0.35207	U	0.003368	T	0.20901	0.0503	L	0.58810	1.83	0.09310	N	0.999997	P	0.48294	0.908	B	0.38106	0.265	T	0.12066	-1.0562	10	0.35671	T	0.21	-15.619	8.5356	0.33362	0.0:0.7046:0.0:0.2954	.	151	Q9BR11	ZSWM1_HUMAN	L	151	ENSP00000361601:F151L;ENSP00000361598:F151L	ENSP00000361598:F151L	F	+	3	2	ZSWIM1	43945091	0.111000	0.22076	0.795000	0.32087	0.025000	0.11179	0.646000	0.24797	0.419000	0.25927	-0.140000	0.14226	TTC	ZSWIM1	-	NULL	ENSG00000168612		0.502	ZSWIM1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZSWIM1	HGNC	protein_coding	OTTHUMT00000157064.2	-	0.00	29	0	C	NM_080603		44511684	+1	tier1	-	no_errors	ENST00000372520	ensembl	human	known	74_37	missense	29.27	29	12	SNP	0.229	A
ZZZ3	26009	genome.wustl.edu	37	1	78030640	78030640	+	3'UTR	SNP	C	C	A			TCGA-LN-A49L-01A-11D-A247-09	TCGA-LN-A49L-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8c1f9eac-d7fb-4794-86f4-1d9c383868b2	eff182c7-0675-4fad-85ef-f59a124a8880	g.chr1:78030640C>A	ENST00000370801.3	-	0	3872				ZZZ3_ENST00000370798.1_3'UTR|ZZZ3_ENST00000476275.1_5'UTR	NM_015534.4	NP_056349.1	Q8IYH5	ZZZ3_HUMAN	zinc finger, ZZ-type containing 3						chromatin organization (GO:0006325)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(2)|endometrium(2)|kidney(2)|large_intestine(8)|lung(17)|ovary(4)|prostate(1)|stomach(1)|urinary_tract(2)	39						TATAACATTACATTTAAAAAA	0.343																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AL080063	CCDS677.1	1p31.1	2012-08-13			ENSG00000036549	ENSG00000036549		"""Zinc fingers, ZZ-type"""	24523	protein-coding gene	gene with protein product	"""ATAC component 1 homolog (Drosophila)"""					16428443, 21304275	Standard	NM_015534		Approved	DKFZP564I052, ATAC1	uc001dhq.3	Q8IYH5	OTTHUMG00000009652	ENST00000370801.3:c.*685G>T	1.37:g.78030640C>A			B7WPC6|Q6N004|Q6N070|Q8IYP0|Q8IYR1|Q8TEK4|Q9Y4U0	RNA	SNP	-	NULL	ENST00000370801.3	37	NULL	CCDS677.1	1																																																																																			ZZZ3	-	-	ENSG00000036549		0.343	ZZZ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZZZ3	HGNC	protein_coding	OTTHUMT00000026615.1	-	0.00	31	0	C	NM_015534		78030640	-1	tier1	-	no_errors	ENST00000476275	ensembl	human	known	74_37	rna	25.71	26	9	SNP	1.000	A
