#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name	i_deletion_substructures	i_domain	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_header	i_normal_VAF	i_normal_ref_reads	i_normal_var_reads	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_tier	i_title	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_VAF	i_tumor_ref_reads	i_tumor_var_reads	i_type	i_ucsc_cons	i_variant
AGAP1	116987	genome.wustl.edu	37	2	236649666	236649666	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr2:236649666G>T	ENST00000304032.8	+	4	950	c.370G>T	c.(370-372)Gat>Tat	p.D124Y	AGAP1_ENST00000409538.1_Missense_Mutation_p.D389Y|AGAP1_ENST00000409457.1_Missense_Mutation_p.D124Y|AGAP1_ENST00000336665.5_Missense_Mutation_p.D124Y	NM_001037131.2	NP_001032208.1	Q9UPQ3	AGAP1_HUMAN	ArfGAP with GTPase domain, ankyrin repeat and PH domain 1	124	Small GTPase-like.				protein transport (GO:0015031)|regulation of ARF GTPase activity (GO:0032312)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	ARF GTPase activator activity (GO:0008060)|GTP binding (GO:0005525)|phospholipid binding (GO:0005543)|zinc ion binding (GO:0008270)			breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(12)|lung(11)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	41						GCTGATCAGAGATGAAGGGGG	0.488																																																	0													96.0	93.0	94.0					2																	236649666		2203	4300	6503	SO:0001583	missense	0			AF413078	CCDS2514.1, CCDS33408.1, CCDS58756.1	2q37	2013-01-10	2008-09-22	2008-09-22	ENSG00000157985	ENSG00000157985		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16922	protein-coding gene	gene with protein product		608651	"""centaurin, gamma 2"""	CENTG2			Standard	NM_001037131		Approved	KIAA1099, GGAP1	uc002vvs.3	Q9UPQ3	OTTHUMG00000133293	ENST00000304032.8:c.370G>T	2.37:g.236649666G>T	ENSP00000307634:p.Asp124Tyr		B2RTX7|Q541S5|Q6P9D7|Q9NV93	Missense_Mutation	SNP	pfam_ArfGAP,pfam_MIRO-like,pfam_Small_GTPase,pfam_Ankyrin_rpt,pfam_Pleckstrin_homology,superfamily_P-loop_NTPase,superfamily_Ankyrin_rpt-contain_dom,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Pleckstrin_homology,smart_ArfGAP,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Pleckstrin_homology,pfscan_ArfGAP,prints_ArfGAP,prints_Small_GTPase	p.D124Y	ENST00000304032.8	37	c.370	CCDS33408.1	2	.	.	.	.	.	.	.	.	.	.	G	26.5	4.743257	0.89663	.	.	ENSG00000157985	ENST00000409457;ENST00000304032;ENST00000336665;ENST00000402604;ENST00000409538	T;T;T;T;T	0.44482	0.92;0.92;0.92;0.92;0.92	4.8	4.8	0.61643	Mitochondrial Rho-like (1);	0.000000	0.85682	D	0.000000	T	0.78515	0.4295	H	0.97806	4.08	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.87557	0.2469	10	0.87932	D	0	.	18.2419	0.89970	0.0:0.0:1.0:0.0	.	124;124	Q9UPQ3-2;Q9UPQ3	.;AGAP1_HUMAN	Y	124;124;124;71;389	ENSP00000387174:D124Y;ENSP00000307634:D124Y;ENSP00000338378:D124Y;ENSP00000385492:D71Y;ENSP00000386897:D389Y	ENSP00000307634:D124Y	D	+	1	0	AGAP1	236314405	1.000000	0.71417	0.998000	0.56505	0.957000	0.61999	9.687000	0.98667	2.357000	0.79964	0.561000	0.74099	GAT	AGAP1	-	pfam_MIRO-like,pfam_Small_GTPase,superfamily_P-loop_NTPase,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,prints_Small_GTPase	ENSG00000157985		0.488	AGAP1-001	KNOWN	basic|CCDS	protein_coding	AGAP1	HGNC	protein_coding	OTTHUMT00000257076.2	-	0.00	44	0	G	NM_014914		236649666	+1	tier1	-	no_errors	ENST00000304032	ensembl	human	known	74_37	missense	43.55	35	27	SNP	1.000	T
AGO2	27161	genome.wustl.edu	37	8	141542743	141542743	+	Intron	SNP	G	G	A			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr8:141542743G>A	ENST00000220592.5	-	18	2384				AGO2_ENST00000519980.1_Intron	NM_012154.3	NP_036286.2	Q9UKV8	AGO2_HUMAN	argonaute RISC catalytic component 2						epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|innate immune response (GO:0045087)|mRNA cleavage involved in gene silencing by miRNA (GO:0035279)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|negative regulation of translational initiation (GO:0045947)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|post-embryonic development (GO:0009791)|pre-miRNA processing (GO:0031054)|regulation of transcription, DNA-templated (GO:0006355)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|transcription, DNA-templated (GO:0006351)|translation (GO:0006412)|translational initiation (GO:0006413)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|membrane (GO:0016020)|micro-ribonucleoprotein complex (GO:0035068)|mRNA cap binding complex (GO:0005845)|nucleus (GO:0005634)|polysome (GO:0005844)|ribonucleoprotein complex (GO:0030529)|RISC complex (GO:0016442)	endoribonuclease activity (GO:0004521)|endoribonuclease activity, cleaving siRNA-paired mRNA (GO:0070551)|metal ion binding (GO:0046872)|miRNA binding (GO:0035198)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|RNA 7-methylguanosine cap binding (GO:0000340)|siRNA binding (GO:0035197)|translation initiation factor activity (GO:0003743)										TTAGACAGTTGGACTCGCATA	0.433																																																	0													36.0	31.0	33.0					8																	141542743		2203	4300	6503	SO:0001627	intron_variant	0			AF121255	CCDS6380.1, CCDS55279.1	8q24.3	2013-02-15	2013-02-15	2013-02-15	ENSG00000123908	ENSG00000123908		"""Argonaute/PIWI family"""	3263	protein-coding gene	gene with protein product	"""argonaute 2"""	606229	"""eukaryotic translation initiation factor 2C, 2"""	EIF2C2		10534406, 12906857	Standard	NM_012154		Approved	hAGO2, Q10	uc003yvn.3	Q9UKV8	OTTHUMG00000164232	ENST00000220592.5:c.2272-29C>T	8.37:g.141542743G>A			Q8TCZ5|Q8WV58|Q96ID1	RNA	SNP	-	NULL	ENST00000220592.5	37	NULL	CCDS6380.1	8																																																																																			AGO2	-	-	ENSG00000123908		0.433	AGO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AGO2	HGNC	protein_coding	OTTHUMT00000377866.4	-	0.00	25	0	G			141542743	-1	tier1	-	no_errors	ENST00000520628	ensembl	human	putative	74_37	rna	31.03	19	9	SNP	0.000	A
ALDH1L1	10840	genome.wustl.edu	37	3	125855621	125855621	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr3:125855621G>T	ENST00000393434.2	-	11	1679	c.1330C>A	c.(1330-1332)Ccc>Acc	p.P444T	ALDH1L1_ENST00000472186.1_Missense_Mutation_p.P444T|ALDH1L1_ENST00000273450.3_Missense_Mutation_p.P454T|ALDH1L1_ENST00000452905.2_Missense_Mutation_p.P343T|ALDH1L1_ENST00000393431.2_Missense_Mutation_p.P444T	NM_012190.3	NP_036322.2	O75891	AL1L1_HUMAN	aldehyde dehydrogenase 1 family, member L1	444	Aldehyde dehydrogenase.				10-formyltetrahydrofolate catabolic process (GO:0009258)|biosynthetic process (GO:0009058)|one-carbon metabolic process (GO:0006730)	extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	catalytic activity (GO:0003824)|formyltetrahydrofolate dehydrogenase activity (GO:0016155)|hydroxymethyl-, formyl- and related transferase activity (GO:0016742)|methyltransferase activity (GO:0008168)|oxidoreductase activity, acting on the aldehyde or oxo group of donors, NAD or NADP as acceptor (GO:0016620)			NS(1)|breast(2)|central_nervous_system(3)|endometrium(2)|kidney(5)|large_intestine(10)|lung(22)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	52				GBM - Glioblastoma multiforme(114;0.0462)	Tetrahydrofolic acid(DB00116)	CCATCGGTGGGATTGATGGTC	0.627																																																	0													132.0	116.0	121.0					3																	125855621		2197	4298	6495	SO:0001583	missense	0			AF052732	CCDS3034.1, CCDS58850.1, CCDS58851.1	3q21.2	2010-07-19		2005-01-27	ENSG00000144908	ENSG00000144908	1.5.1.6	"""Aldehyde dehydrogenases"""	3978	protein-coding gene	gene with protein product	"""cytosolic 10-formyltetrahydrofolate dehydrogenase"""	600249	"""formyltetrahydrofolate dehydrogenase"""	FTHFD			Standard	NM_012190		Approved	10-fTHF	uc031sbp.1	O75891	OTTHUMG00000125551	ENST00000393434.2:c.1330C>A	3.37:g.125855621G>T	ENSP00000377083:p.Pro444Thr		B4DG36|E9PBX3|Q68CS1	Missense_Mutation	SNP	pfam_Aldehyde_DH_dom,pfam_Formyl_transf_N,pfam_Formyl_trans_C,pfam_Acyl_carrier_prot-like,superfamily_Ald_DH/histidinol_DH,superfamily_Formyl_transf_N,superfamily_Formyl_transferase_C-like,superfamily_Acyl_carrier_prot-like,pirsf_10_FTHF_DH,pfscan_Acyl_carrier_prot-like	p.P444T	ENST00000393434.2	37	c.1330	CCDS3034.1	3	.	.	.	.	.	.	.	.	.	.	G	14.56	2.572619	0.45798	.	.	ENSG00000144908	ENST00000273450;ENST00000472186;ENST00000452905;ENST00000393434;ENST00000393431	T;T;T;T;D	0.87029	1.16;1.16;1.16;1.16;-2.2	3.67	3.67	0.42095	Aldehyde dehydrogenase domain (1);Aldehyde dehydrogenase, N-terminal (1);Aldehyde/histidinol dehydrogenase (1);	0.234366	0.36002	N	0.002854	D	0.96219	0.8767	H	0.99507	4.6	0.80722	D	1	D;D;D	0.71674	0.997;0.998;0.998	D;D;D	0.74023	0.954;0.982;0.964	D	0.97247	0.9895	10	0.87932	D	0	.	13.6963	0.62582	0.0:0.0:1.0:0.0	.	343;496;444	E9PBX3;Q59G10;O75891	.;.;AL1L1_HUMAN	T	454;444;343;444;444	ENSP00000273450:P454T;ENSP00000420293:P444T;ENSP00000395881:P343T;ENSP00000377083:P444T;ENSP00000377081:P444T	ENSP00000273450:P454T	P	-	1	0	ALDH1L1	127338311	1.000000	0.71417	0.959000	0.39883	0.005000	0.04900	8.735000	0.91549	2.347000	0.79759	0.467000	0.42956	CCC	ALDH1L1	-	pfam_Aldehyde_DH_dom,superfamily_Ald_DH/histidinol_DH,pirsf_10_FTHF_DH	ENSG00000144908		0.627	ALDH1L1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ALDH1L1	HGNC	protein_coding	OTTHUMT00000354391.1	-	0.00	38	0	G	NM_012190		125855621	-1	tier1	-	no_errors	ENST00000393434	ensembl	human	known	74_37	missense	28.57	25	10	SNP	1.000	T
AMY2B	280	genome.wustl.edu	37	1	104116487	104116487	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr1:104116487C>A	ENST00000361355.4	+	6	1287	c.671C>A	c.(670-672)gCa>gAa	p.A224E	AMY2B_ENST00000491397.1_3'UTR	NM_020978.3	NP_066188.1	P19961	AMY2B_HUMAN	amylase, alpha 2B (pancreatic)	224					carbohydrate metabolic process (GO:0005975)|digestion (GO:0007586)	extracellular vesicular exosome (GO:0070062)	alpha-amylase activity (GO:0004556)|metal ion binding (GO:0046872)			breast(1)|endometrium(7)|kidney(4)|large_intestine(1)|lung(30)|prostate(1)|skin(1)|urinary_tract(1)	46		all_epithelial(167;3.05e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000451)		Colorectal(144;0.0669)|all cancers(265;0.083)|Epithelial(280;0.094)|Lung(183;0.112)		GACATAAAGGCAATTTTGGAC	0.398																																																	0													199.0	196.0	197.0					1																	104116487		2203	4294	6497	SO:0001583	missense	0			M24895	CCDS782.1	1p21	2010-08-02	2006-04-27		ENSG00000240038	ENSG00000240038	3.2.1.1		478	protein-coding gene	gene with protein product		104660	"""amylase, alpha 2B; pancreatic"""	AMY2		8268204	Standard	NM_020978		Approved		uc001duq.3	P19961	OTTHUMG00000011024	ENST00000361355.4:c.671C>A	1.37:g.104116487C>A	ENSP00000354610:p.Ala224Glu		B3KTI1|B3KXB7|D3DT76|Q9UBH3	Missense_Mutation	SNP	pfam_Glyco_hydro_13_cat_dom,pfam_A-amylase_b_C,superfamily_Glycoside_hydrolase_SF,smart_Glyco_hydro_13_sub_cat_dom,smart_A-amylase_b_C,prints_Alpha_amylase	p.A224E	ENST00000361355.4	37	c.671	CCDS782.1	1	.	.	.	.	.	.	.	.	.	.	C	19.13	3.767148	0.69878	.	.	ENSG00000240038	ENST00000361355	D	0.98060	-4.69	4.47	4.47	0.54385	Glycoside hydrolase, subgroup, catalytic domain (1);Glycosyl hydrolase, family 13, catalytic domain (1);Glycoside hydrolase, superfamily (1);Glycosyl hydrolase, family 13, subfamily, catalytic domain (1);	0.112076	0.64402	D	0.000013	D	0.98416	0.9473	M	0.86651	2.83	0.58432	D	0.999996	D	0.62365	0.991	P	0.62184	0.899	D	0.98225	1.0480	10	0.36615	T	0.2	.	17.1885	0.86873	0.0:1.0:0.0:0.0	.	224	P19961	AMY2B_HUMAN	E	224	ENSP00000354610:A224E	ENSP00000354610:A224E	A	+	2	0	AMY2B	103918010	0.900000	0.30661	0.957000	0.39632	0.911000	0.54048	1.878000	0.39608	2.045000	0.60652	0.552000	0.68991	GCA	AMY2B	-	pfam_Glyco_hydro_13_cat_dom,superfamily_Glycoside_hydrolase_SF,smart_Glyco_hydro_13_sub_cat_dom	ENSG00000240038		0.398	AMY2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AMY2B	HGNC	protein_coding	OTTHUMT00000030318.1	-	0.00	126	0	C	NM_020978		104116487	+1	tier1	-	no_errors	ENST00000361355	ensembl	human	known	74_37	missense	58.54	51	72	SNP	0.991	A
AMY2B	280	genome.wustl.edu	37	1	104117883	104117883	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr1:104117883G>A	ENST00000361355.4	+	8	1533	c.917G>A	c.(916-918)aGa>aAa	p.R306K	AMY2B_ENST00000491397.1_3'UTR	NM_020978.3	NP_066188.1	P19961	AMY2B_HUMAN	amylase, alpha 2B (pancreatic)	306					carbohydrate metabolic process (GO:0005975)|digestion (GO:0007586)	extracellular vesicular exosome (GO:0070062)	alpha-amylase activity (GO:0004556)|metal ion binding (GO:0046872)			breast(1)|endometrium(7)|kidney(4)|large_intestine(1)|lung(30)|prostate(1)|skin(1)|urinary_tract(1)	46		all_epithelial(167;3.05e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000451)		Colorectal(144;0.0669)|all cancers(265;0.083)|Epithelial(280;0.094)|Lung(183;0.112)		CCTTCTGACAGAGCACTTGTC	0.413																																																	0													286.0	284.0	285.0					1																	104117883		2203	4298	6501	SO:0001583	missense	0			M24895	CCDS782.1	1p21	2010-08-02	2006-04-27		ENSG00000240038	ENSG00000240038	3.2.1.1		478	protein-coding gene	gene with protein product		104660	"""amylase, alpha 2B; pancreatic"""	AMY2		8268204	Standard	NM_020978		Approved		uc001duq.3	P19961	OTTHUMG00000011024	ENST00000361355.4:c.917G>A	1.37:g.104117883G>A	ENSP00000354610:p.Arg306Lys		B3KTI1|B3KXB7|D3DT76|Q9UBH3	Missense_Mutation	SNP	pfam_Glyco_hydro_13_cat_dom,pfam_A-amylase_b_C,superfamily_Glycoside_hydrolase_SF,smart_Glyco_hydro_13_sub_cat_dom,smart_A-amylase_b_C,prints_Alpha_amylase	p.R306K	ENST00000361355.4	37	c.917	CCDS782.1	1	.	.	.	.	.	.	.	.	.	.	G	11.72	1.722453	0.30503	.	.	ENSG00000240038	ENST00000361355	D	0.98221	-4.8	5.26	3.38	0.38709	Glycoside hydrolase, subgroup, catalytic domain (1);Glycosyl hydrolase, family 13, catalytic domain (1);Glycoside hydrolase, superfamily (1);Glycosyl hydrolase, family 13, subfamily, catalytic domain (1);	0.100808	0.64402	D	0.000002	D	0.90150	0.6922	N	0.11818	0.18	0.43095	D	0.994779	B	0.06786	0.001	B	0.06405	0.002	D	0.87070	0.2159	10	0.39692	T	0.17	.	9.8394	0.40989	0.2197:0.0:0.7803:0.0	.	306	P19961	AMY2B_HUMAN	K	306	ENSP00000354610:R306K	ENSP00000354610:R306K	R	+	2	0	AMY2B	103919406	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.131000	0.42074	1.219000	0.43474	0.558000	0.71614	AGA	AMY2B	-	pfam_Glyco_hydro_13_cat_dom,superfamily_Glycoside_hydrolase_SF,smart_Glyco_hydro_13_sub_cat_dom,prints_Alpha_amylase	ENSG00000240038		0.413	AMY2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AMY2B	HGNC	protein_coding	OTTHUMT00000030318.1	-	0.00	107	0	G	NM_020978		104117883	+1	tier1	-	no_errors	ENST00000361355	ensembl	human	known	74_37	missense	25.00	69	23	SNP	1.000	A
ANKHD1	54882	genome.wustl.edu	37	5	139917797	139917797	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr5:139917797C>G	ENST00000360839.2	+	32	7509	c.7355C>G	c.(7354-7356)tCt>tGt	p.S2452C	ANKHD1_ENST00000297183.6_Missense_Mutation_p.S2452C|ANKHD1-EIF4EBP3_ENST00000532219.1_Missense_Mutation_p.S2452C|ANKHD1_ENST00000544120.1_Missense_Mutation_p.S776C	NM_017747.2	NP_060217.1	Q8IWZ3	ANKH1_HUMAN	ankyrin repeat and KH domain containing 1	2452						cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(8)|kidney(6)|large_intestine(14)|lung(18)|ovary(5)|prostate(2)|skin(3)|urinary_tract(2)	60			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GTAGCCCCCTCTAACATTTTT	0.423																																																	0													255.0	243.0	247.0					5																	139917797		2203	4300	6503	SO:0001583	missense	0			AF521882	CCDS4225.1, CCDS43371.1, CCDS43372.1, CCDS75319.1	5q31.3	2013-01-10			ENSG00000131503	ENSG00000131503		"""Ankyrin repeat domain containing"""	24714	protein-coding gene	gene with protein product		610500				10470851, 11230166, 16098192	Standard	NM_017747		Approved	MASK, FLJ20288, FLJ11979, FLJ10042, FLJ14127, KIAA1085		Q8IWZ3	OTTHUMG00000161610	ENST00000360839.2:c.7355C>G	5.37:g.139917797C>G	ENSP00000354085:p.Ser2452Cys		A6NH85|Q149P2|Q8IWZ2|Q8WY90|Q96G77|Q96GK0|Q9H2U0|Q9HA95|Q9NWG4|Q9UPR7	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_KH_dom_type_1,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_KH_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_KH_dom_type_1,prints_Ankyrin_rpt	p.S2452C	ENST00000360839.2	37	c.7355	CCDS4225.1	5	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	21.3|21.3	4.125262|4.125262	0.77436|0.77436	.|.	.|.	ENSG00000131503|ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000254996;ENSG00000254996	ENST00000421706|ENST00000360839;ENST00000297183;ENST00000253810;ENST00000431508;ENST00000433049;ENST00000544120;ENST00000532219;ENST00000437495	.|T;T;T;T;T;T;T	.|0.73469	.|-0.64;-0.75;1.44;1.56;1.01;-0.75;0.52	5.55|5.55	5.55|5.55	0.83447|0.83447	.|.	.|0.118444	.|0.64402	.|D	.|0.000015	D|D	0.82370|0.82370	0.5022|0.5022	L|L	0.52573|0.52573	1.65|1.65	0.43745|0.43745	D|D	0.996244|0.996244	.|P;P;D;P;P;P	.|0.55605	.|0.953;0.916;0.972;0.698;0.778;0.574	.|P;P;P;B;B;P	.|0.59948	.|0.738;0.738;0.866;0.326;0.371;0.572	T|T	0.83029|0.83029	-0.0163|-0.0163	5|10	.|0.87932	.|D	.|0	.|.	19.7069|19.7069	0.96076|0.96076	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|776;899;776;2469;2452;2452	.|Q8IWG5;Q9H059;F6WFL0;E9PF56;Q8IWZ2;Q8IWZ3	.|.;.;.;.;.;ANKH1_HUMAN	V|C	110|2452;2452;2469;1125;991;776;2452;480	.|ENSP00000354085:S2452C;ENSP00000297183:S2452C;ENSP00000393204:S1125C;ENSP00000390034:S991C;ENSP00000437687:S776C;ENSP00000432016:S2452C;ENSP00000396882:S480C	.|ENSP00000396882:S480C	L|S	+|+	1|2	2|0	ANKHD1|ANKHD1-EIF4EBP3;ANKHD1	139897981|139897981	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	7.278000|7.278000	0.78587|0.78587	2.894000|2.894000	0.99253|0.99253	0.591000|0.591000	0.81541|0.81541	CTA|TCT	ANKHD1	-	NULL	ENSG00000131503		0.423	ANKHD1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	ANKHD1	HGNC	protein_coding	OTTHUMT00000251672.1	-	0.00	54	0	C	NM_017747		139917797	+1	tier1	-	no_errors	ENST00000297183	ensembl	human	known	74_37	missense	24.32	28	9	SNP	1.000	G
AP4E1	23431	genome.wustl.edu	37	15	51250986	51250986	+	Silent	SNP	T	T	C			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr15:51250986T>C	ENST00000261842.5	+	14	1952	c.1846T>C	c.(1846-1848)Ttg>Ctg	p.L616L	AP4E1_ENST00000560508.1_Silent_p.L541L	NM_001252127.1|NM_007347.4	NP_001239056.1|NP_031373.2	Q9UPM8	AP4E1_HUMAN	adaptor-related protein complex 4, epsilon 1 subunit	616					intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	coated pit (GO:0005905)|Golgi apparatus (GO:0005794)|membrane coat (GO:0030117)				breast(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(5)|skin(2)	27				all cancers(107;0.000893)|GBM - Glioblastoma multiforme(94;0.00364)		TTGTGAAGACTTGGTGGTAAG	0.348																																																	0													140.0	150.0	146.0					15																	51250986		2196	4294	6490	SO:0001819	synonymous_variant	0			AB030653	CCDS32240.1, CCDS58362.1	15q21.2	2014-09-17			ENSG00000081014	ENSG00000081014			573	protein-coding gene	gene with protein product		607244				10436028, 21620353	Standard	NM_007347		Approved	AP-4-EPSILON, SPG51	uc001zyx.2	Q9UPM8	OTTHUMG00000172458	ENST00000261842.5:c.1846T>C	15.37:g.51250986T>C			A0AVD6|A1L4A9|A6NNX7|H0YKX4|Q68D31|Q9Y588	Silent	SNP	pfam_Clathrin/coatomer_adapt-like_N,pfam_Coatomer_bsu_C,superfamily_ARM-type_fold,pirsf_AP4_complex_esu	p.L616	ENST00000261842.5	37	c.1846	CCDS32240.1	15																																																																																			AP4E1	-	superfamily_ARM-type_fold,pirsf_AP4_complex_esu	ENSG00000081014		0.348	AP4E1-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	AP4E1	HGNC	protein_coding	OTTHUMT00000418656.1	-	0.00	30	0	T			51250986	+1	tier1	-	no_errors	ENST00000261842	ensembl	human	known	74_37	silent	11.43	31	4	SNP	0.421	C
APOB	338	genome.wustl.edu	37	2	21227283	21227283	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr2:21227283G>A	ENST00000233242.1	-	28	12072	c.11945C>T	c.(11944-11946)gCg>gTg	p.A3982V		NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	3982					artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)			NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					ATCGGTGAACGCTGGGCTTTT	0.502																																																	0													145.0	140.0	142.0					2																	21227283		2203	4300	6503	SO:0001583	missense	0			M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.11945C>T	2.37:g.21227283G>A	ENSP00000233242:p.Ala3982Val		O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Missense_Mutation	SNP	pfam_Lipid_transpt_N,pfam_Vitellinogen_open_b-sht,pfam_ApoB100_C,pfam_Lipid_transpt_open_b-sht,superfamily_Lipid_transp_b-sht_shell,superfamily_Vitellinogen_superhlx,superfamily_ARM-type_fold,smart_Lipid_transpt_N,pfscan_Lipid_transpt_N	p.A3982V	ENST00000233242.1	37	c.11945	CCDS1703.1	2	.	.	.	.	.	.	.	.	.	.	G	14.67	2.605847	0.46527	.	.	ENSG00000084674	ENST00000233242;ENST00000535079	T	0.18657	2.2	5.99	-1.51	0.08664	.	1.052620	0.07415	N	0.893008	T	0.15522	0.0374	L	0.44542	1.39	0.09310	N	0.999999	B	0.15719	0.014	B	0.06405	0.002	T	0.33727	-0.9857	10	0.51188	T	0.08	.	3.0621	0.06203	0.3098:0.1058:0.483:0.1014	.	3982	P04114	APOB_HUMAN	V	3982	ENSP00000233242:A3982V	ENSP00000233242:A3982V	A	-	2	0	APOB	21080788	0.000000	0.05858	0.000000	0.03702	0.025000	0.11179	0.644000	0.24766	-0.619000	0.05648	0.655000	0.94253	GCG	APOB	-	NULL	ENSG00000084674		0.502	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APOB	HGNC	protein_coding	OTTHUMT00000207571.1	-	0.00	114	0	G			21227283	-1	tier1	-	no_errors	ENST00000233242	ensembl	human	known	74_37	missense	42.98	69	52	SNP	0.000	A
APOB	338	genome.wustl.edu	37	2	21234621	21234621	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr2:21234621C>T	ENST00000233242.1	-	26	5246	c.5119G>A	c.(5119-5121)Gag>Aag	p.E1707K		NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	1707					artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)			NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					AGTGATAGCTCTGTGAGGGCG	0.463																																																	0													152.0	144.0	147.0					2																	21234621		2203	4300	6503	SO:0001583	missense	0			M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.5119G>A	2.37:g.21234621C>T	ENSP00000233242:p.Glu1707Lys		O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Missense_Mutation	SNP	pfam_Lipid_transpt_N,pfam_Vitellinogen_open_b-sht,pfam_ApoB100_C,pfam_Lipid_transpt_open_b-sht,superfamily_Lipid_transp_b-sht_shell,superfamily_Vitellinogen_superhlx,superfamily_ARM-type_fold,smart_Lipid_transpt_N,pfscan_Lipid_transpt_N	p.E1707K	ENST00000233242.1	37	c.5119	CCDS1703.1	2	.	.	.	.	.	.	.	.	.	.	C	22.0	4.233329	0.79688	.	.	ENSG00000084674	ENST00000233242;ENST00000535079	T	0.01084	5.36	5.97	5.97	0.96955	.	0.000000	0.64402	D	0.000013	T	0.06781	0.0173	M	0.64997	1.995	0.80722	D	1	D	0.89917	1.0	D	0.74674	0.984	T	0.03875	-1.0996	10	0.66056	D	0.02	.	20.4238	0.99064	0.0:1.0:0.0:0.0	.	1707	P04114	APOB_HUMAN	K	1707	ENSP00000233242:E1707K	ENSP00000233242:E1707K	E	-	1	0	APOB	21088126	0.996000	0.38824	0.998000	0.56505	0.903000	0.53119	3.333000	0.52090	2.834000	0.97654	0.650000	0.86243	GAG	APOB	-	NULL	ENSG00000084674		0.463	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APOB	HGNC	protein_coding	OTTHUMT00000207571.1	-	0.00	28	0	C			21234621	-1	tier1	-	no_errors	ENST00000233242	ensembl	human	known	74_37	missense	39.02	25	16	SNP	1.000	T
ARHGAP21	57584	genome.wustl.edu	37	10	24874807	24874807	+	Missense_Mutation	SNP	T	T	C			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr10:24874807T>C	ENST00000396432.2	-	26	4897	c.4411A>G	c.(4411-4413)Atc>Gtc	p.I1471V		NM_020824.3	NP_065875.3	Q5T5U3	RHG21_HUMAN	Rho GTPase activating protein 21	1470					establishment of Golgi localization (GO:0051683)|Golgi organization (GO:0007030)|maintenance of Golgi location (GO:0051684)|organelle transport along microtubule (GO:0072384)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)			NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(11)|kidney(4)|large_intestine(17)|lung(21)|ovary(7)|pancreas(1)|prostate(5)|skin(2)|stomach(2)|urinary_tract(1)	78						GCAATGATGATCTTCTGTTTT	0.398																																																	0													256.0	239.0	245.0					10																	24874807		2203	4300	6503	SO:0001583	missense	0			AF480466	CCDS7144.2	10p12.31	2013-01-10			ENSG00000107863	ENSG00000107863		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	23725	protein-coding gene	gene with protein product		609870				12056806	Standard	NM_020824		Approved	KIAA1424, ARHGAP10	uc001isb.2	Q5T5U3	OTTHUMG00000017825	ENST00000396432.2:c.4411A>G	10.37:g.24874807T>C	ENSP00000379709:p.Ile1471Val		Q0VF98|Q7Z3P7|Q8N3A2|Q8NI19|Q8TBV5|Q9P2C3	Missense_Mutation	SNP	pfam_RhoGAP_dom,pfam_Pleckstrin_homology,pfam_PDZ,superfamily_Rho_GTPase_activation_prot,superfamily_PDZ,smart_PDZ,smart_Pleckstrin_homology,smart_RhoGAP_dom,pfscan_PDZ,pfscan_Pleckstrin_homology,pfscan_RhoGAP_dom	p.I1471V	ENST00000396432.2	37	c.4411	CCDS7144.2	10	.	.	.	.	.	.	.	.	.	.	T	8.715	0.912874	0.17907	.	.	ENSG00000107863	ENST00000396432;ENST00000447364	T	0.09445	2.98	4.83	-7.54	0.01332	.	2.258190	0.01301	N	0.010313	T	0.02533	0.0077	N	0.00583	-1.355	0.09310	N	0.99999	B	0.02656	0.0	B	0.01281	0.0	T	0.40098	-0.9581	10	0.17369	T	0.5	.	7.0999	0.25332	0.0:0.343:0.3397:0.3173	.	1470	Q5T5U3	RHG21_HUMAN	V	1471;920	ENSP00000379709:I1471V	ENSP00000379709:I1471V	I	-	1	0	ARHGAP21	24914813	0.000000	0.05858	0.000000	0.03702	0.012000	0.07955	-0.885000	0.04161	-1.711000	0.01395	0.482000	0.46254	ATC	ARHGAP21	-	NULL	ENSG00000107863		0.398	ARHGAP21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGAP21	HGNC	protein_coding	OTTHUMT00000047229.4	-	0.00	147	0	T	NM_020824		24874807	-1	tier1	-	no_errors	ENST00000396432	ensembl	human	known	74_37	missense	26.36	176	63	SNP	0.000	C
ARMC10	83787	genome.wustl.edu	37	7	102738985	102738985	+	Missense_Mutation	SNP	A	A	G			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr7:102738985A>G	ENST00000323716.3	+	7	1409	c.1017A>G	c.(1015-1017)atA>atG	p.I339M	ARMC10_ENST00000425331.1_Missense_Mutation_p.I280M|ARMC10_ENST00000454559.1_Missense_Mutation_p.I245M|ARMC10_ENST00000441711.2_Missense_Mutation_p.I304M|ARMC10_ENST00000541300.1_Missense_Mutation_p.I221M|ARMC10_ENST00000428183.2_Missense_Mutation_p.I280M	NM_031905.4	NP_114111.2	Q8N2F6	ARM10_HUMAN	armadillo repeat containing 10	339					regulation of growth (GO:0040008)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)				NS(1)|breast(1)|central_nervous_system(1)|large_intestine(2)|lung(3)|ovary(1)|prostate(1)|urinary_tract(1)	11						TTGTAACAATAATACCCAAAA	0.373																																																	0													44.0	46.0	45.0					7																	102738985		2178	4260	6438	SO:0001583	missense	0			AY150853	CCDS5728.1, CCDS55145.1, CCDS55146.1, CCDS55147.1, CCDS55148.1, CCDS55149.1	7q22.1	2013-02-14			ENSG00000170632	ENSG00000170632		"""Armadillo repeat containing"""	21706	protein-coding gene	gene with protein product	"""specific Splicing Variant involved in Hepatocarcinogenesis"""	611864				12839973	Standard	NM_031905		Approved	MGC3195, SVH	uc003vaw.2	Q8N2F6	OTTHUMG00000157201	ENST00000323716.3:c.1017A>G	7.37:g.102738985A>G	ENSP00000319412:p.Ile339Met		A8K703|B4DWJ8|F5GX65|Q75K91|Q75MG6|Q75ML8|Q8IZC1|Q8IZC2|Q8IZC3|Q9BTM6	Missense_Mutation	SNP	pfam_ARM-rpt_dom,superfamily_ARM-type_fold	p.I339M	ENST00000323716.3	37	c.1017	CCDS5728.1	7	.	.	.	.	.	.	.	.	.	.	A	20.1	3.933572	0.73442	.	.	ENSG00000170632	ENST00000323716;ENST00000428183;ENST00000441711;ENST00000454559;ENST00000425331;ENST00000541300;ENST00000431642	T;T;T;T;T;T;T	0.38401	1.14;1.14;1.14;1.14;1.14;1.14;1.14	5.68	-6.19	0.02078	Armadillo-type fold (1);	0.268073	0.46145	N	0.000306	T	0.26268	0.0641	N	0.16656	0.425	0.09310	N	1	B;B;D;B;B;B	0.69078	0.382;0.053;0.997;0.134;0.13;0.209	B;B;D;B;B;B	0.69142	0.064;0.015;0.962;0.045;0.099;0.045	T	0.24799	-1.0150	10	0.41790	T	0.15	-5.5203	0.815	0.01100	0.2817:0.3116:0.2093:0.1974	.	280;221;245;280;304;339	B4DWJ8;F5GX65;Q8N2F6-4;Q8N2F6-3;Q8N2F6-2;Q8N2F6	.;.;.;.;.;ARM10_HUMAN	M	339;280;304;245;280;221;181	ENSP00000319412:I339M;ENSP00000396654:I280M;ENSP00000413619:I304M;ENSP00000405612:I245M;ENSP00000397969:I280M;ENSP00000440463:I221M;ENSP00000406840:I181M	ENSP00000319412:I339M	I	+	3	3	ARMC10	102526221	0.104000	0.21937	0.002000	0.10522	0.729000	0.41735	1.022000	0.30052	-0.729000	0.04875	0.482000	0.46254	ATA	ARMC10	-	superfamily_ARM-type_fold	ENSG00000170632		0.373	ARMC10-001	KNOWN	basic|CCDS	protein_coding	ARMC10	HGNC	protein_coding	OTTHUMT00000347882.1		0.00	39	0	A	NM_031905		102738985	+1			no_errors	ENST00000323716	ensembl	human	known	74_37	missense	5.56	68	4	SNP	0.000	G
ARRDC3	57561	genome.wustl.edu	37	5	90670002	90670002	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr5:90670002G>T	ENST00000265138.3	-	6	1228	c.962C>A	c.(961-963)aCc>aAc	p.T321N	ARRDC3_ENST00000503192.1_5'Flank	NM_020801.2	NP_065852.1	Q96B67	ARRD3_HUMAN	arrestin domain containing 3	321					fat pad development (GO:0060613)|negative regulation of heat generation (GO:0031651)|negative regulation of locomotion involved in locomotory behavior (GO:0090327)|negative regulation of multicellular organismal metabolic process (GO:0044252)|positive regulation of adrenergic receptor signaling pathway (GO:0071879)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|skin development (GO:0043588)|temperature homeostasis (GO:0001659)	endosome (GO:0005768)|plasma membrane (GO:0005886)	beta-3 adrenergic receptor binding (GO:0031699)			breast(2)|endometrium(3)|large_intestine(3)|lung(7)|ovary(1)|prostate(1)|urinary_tract(1)	18		all_cancers(142;2.22e-05)|all_epithelial(76;1.58e-07)|all_lung(232;0.000521)|Lung NSC(167;0.000548)|Ovarian(174;0.0798)|Colorectal(57;0.207)		OV - Ovarian serous cystadenocarcinoma(54;4.56e-30)|Epithelial(54;7.55e-26)|all cancers(79;3.63e-22)		TACACTTGAGGTTCTGCTACC	0.378																																																	0													186.0	182.0	184.0					5																	90670002		2203	4300	6503	SO:0001583	missense	0			AB037797	CCDS34202.1	5q14.3	2013-10-11			ENSG00000113369	ENSG00000113369			29263	protein-coding gene	gene with protein product	"""alpha-arrestin 3"""	612464				10718198, 19605364	Standard	NM_020801		Approved	KIAA1376	uc003kjz.2	Q96B67	OTTHUMG00000162616	ENST00000265138.3:c.962C>A	5.37:g.90670002G>T	ENSP00000265138:p.Thr321Asn		A8K6T8|Q9P2H1	Missense_Mutation	SNP	pfam_Arrestin-like_N,pfam_Arrestin_C-like,superfamily_Ig_E-set	p.T321N	ENST00000265138.3	37	c.962	CCDS34202.1	5	.	.	.	.	.	.	.	.	.	.	G	20.8	4.057332	0.76074	.	.	ENSG00000113369	ENST00000265138	T	0.06849	3.25	5.86	5.86	0.93980	Immunoglobulin E-set (1);	0.000000	0.85682	D	0.000000	T	0.08133	0.0203	L	0.31371	0.925	0.80722	D	1	P	0.40970	0.734	B	0.37198	0.243	T	0.40683	-0.9550	10	0.13853	T	0.58	-20.9116	20.1986	0.98248	0.0:0.0:1.0:0.0	.	321	Q96B67	ARRD3_HUMAN	N	321	ENSP00000265138:T321N	ENSP00000265138:T321N	T	-	2	0	ARRDC3	90705758	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.008000	0.88588	2.781000	0.95711	0.650000	0.86243	ACC	ARRDC3	-	superfamily_Ig_E-set	ENSG00000113369		0.378	ARRDC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARRDC3	HGNC	protein_coding	OTTHUMT00000369763.2	-	0.00	26	0	G	NM_020801		90670002	-1	tier1	-	no_errors	ENST00000265138	ensembl	human	known	74_37	missense	12.00	21	3	SNP	1.000	T
ATP13A5	344905	genome.wustl.edu	37	3	192997166	192997166	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr3:192997166G>T	ENST00000342358.4	-	28	3421	c.3304C>A	c.(3304-3306)Cgt>Agt	p.R1102S	ATP13A5_ENST00000495496.1_5'UTR	NM_198505.2	NP_940907.2	Q4VNC0	AT135_HUMAN	ATPase type 13A5	1102						integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|metal ion binding (GO:0046872)			NS(1)|autonomic_ganglia(2)|breast(1)|endometrium(6)|kidney(4)|large_intestine(15)|liver(2)|lung(26)|ovary(5)|prostate(1)|skin(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	76	all_cancers(143;1.08e-08)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;5.56e-18)|LUSC - Lung squamous cell carcinoma(58;6.08e-06)|Lung(62;6.49e-06)	GBM - Glioblastoma multiforme(46;0.000307)		TCCATTCCACGGTATATAACT	0.363																																																	0													87.0	89.0	89.0					3																	192997166		2203	4300	6503	SO:0001583	missense	0			AK122613	CCDS33914.1	3q29	2010-04-20			ENSG00000187527	ENSG00000187527		"""ATPases / P-type"""	31789	protein-coding gene	gene with protein product							Standard	NM_198505		Approved	FLJ16025	uc011bsq.2	Q4VNC0	OTTHUMG00000156101	ENST00000342358.4:c.3304C>A	3.37:g.192997166G>T	ENSP00000341942:p.Arg1102Ser		Q6UWS4|Q6ZWL0	Missense_Mutation	SNP	pfam_ATPase_P-typ_transduc_dom_A,pfam_ATPase_P-typ_Cation_typ_V,pfam_ATPase_P-typ_cation-transptr_N,superfamily_HAD-like_dom,superfamily_ATPase_P-typ_cyto_domN,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Cation_typ_V,tigrfam_Cation_transp_P_typ_ATPase	p.R1102S	ENST00000342358.4	37	c.3304	CCDS33914.1	3	.	.	.	.	.	.	.	.	.	.	G	0.378	-0.930031	0.02359	.	.	ENSG00000187527	ENST00000342358	D	0.88277	-2.36	5.14	2.16	0.27623	.	0.724007	0.13559	N	0.378951	T	0.76097	0.3940	N	0.22421	0.69	0.09310	N	0.999998	B	0.09022	0.002	B	0.04013	0.001	T	0.58875	-0.7559	10	0.06236	T	0.91	1.4974	7.0098	0.24855	0.0:0.169:0.4828:0.3483	.	1102	Q4VNC0	AT135_HUMAN	S	1102	ENSP00000341942:R1102S	ENSP00000341942:R1102S	R	-	1	0	ATP13A5	194479860	0.024000	0.19004	0.690000	0.30148	0.278000	0.26855	0.193000	0.17116	1.272000	0.44329	-0.188000	0.12872	CGT	ATP13A5	-	tigrfam_ATPase_P-typ_Cation_typ_V	ENSG00000187527		0.363	ATP13A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP13A5	HGNC	protein_coding	OTTHUMT00000343012.1		0.00	13	0	G	NM_198505		192997166	-1			no_errors	ENST00000342358	ensembl	human	known	74_37	missense	5.41	35	2	SNP	0.231	T
BEND2	139105	genome.wustl.edu	37	X	18189223	18189223	+	Nonsense_Mutation	SNP	G	G	A			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chrX:18189223G>A	ENST00000380033.4	-	13	2215	c.2083C>T	c.(2083-2085)Cag>Tag	p.Q695*	BEND2_ENST00000380030.3_Nonsense_Mutation_p.Q604*	NM_153346.4	NP_699177.2	Q8NDZ0	BEND2_HUMAN	BEN domain containing 2	695	BEN 2. {ECO:0000255|PROSITE- ProRule:PRU00784}.									NS(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(11)|liver(1)|lung(21)|ovary(3)|prostate(1)	49						AAGAGTTTCTGAATAAGGTAT	0.448																																																	0													180.0	157.0	165.0					X																	18189223		2203	4300	6503	SO:0001587	stop_gained	0			AK128155	CCDS14184.1, CCDS55375.1	Xp22.22	2012-11-22	2008-10-03	2008-10-03	ENSG00000177324	ENSG00000177324		"""BEN domain containing"""	28509	protein-coding gene	gene with protein product			"""chromosome X open reading frame 20"""	CXorf20		12477932	Standard	NM_153346		Approved	MGC33653	uc004cyj.4	Q8NDZ0	OTTHUMG00000021211	ENST00000380033.4:c.2083C>T	X.37:g.18189223G>A	ENSP00000369372:p.Gln695*		E9PFY2|Q4V9S2|Q5JXE5	Nonsense_Mutation	SNP	pfam_BEN_domain	p.Q695*	ENST00000380033.4	37	c.2083	CCDS14184.1	X	.	.	.	.	.	.	.	.	.	.	G	16.39	3.111254	0.56398	.	.	ENSG00000177324	ENST00000380033;ENST00000380030	.	.	.	5.49	3.71	0.42584	.	0.479094	0.17820	N	0.160895	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.12430	T	0.62	-0.2253	3.9627	0.09418	0.0898:0.1567:0.5887:0.1648	.	.	.	.	X	695;604	.	ENSP00000369369:Q604X	Q	-	1	0	BEND2	18099144	0.975000	0.34042	0.002000	0.10522	0.009000	0.06853	2.492000	0.45311	0.491000	0.27793	0.556000	0.70494	CAG	BEND2	-	pfam_BEN_domain	ENSG00000177324		0.448	BEND2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BEND2	HGNC	protein_coding	OTTHUMT00000055940.1	-	0.00	17	0	G	NM_153346		18189223	-1	tier1	-	no_errors	ENST00000380033	ensembl	human	known	74_37	nonsense	81.82	2	9	SNP	0.004	A
C7orf31	136895	genome.wustl.edu	37	7	25191224	25191224	+	Silent	SNP	T	T	C			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr7:25191224T>C	ENST00000409280.1	-	7	983	c.675A>G	c.(673-675)gtA>gtG	p.V225V	C7orf31_ENST00000283905.3_Silent_p.V225V			Q8N865	CG031_HUMAN	chromosome 7 open reading frame 31	225										autonomic_ganglia(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(6)|skin(2)|stomach(1)	14						CATCATAATATACACCTTGAC	0.323																																																	0													81.0	80.0	81.0					7																	25191224		2203	4300	6503	SO:0001819	synonymous_variant	0			AK097248	CCDS5394.1	7p15.2	2011-11-24			ENSG00000153790	ENSG00000153790			21722	protein-coding gene	gene with protein product							Standard	NM_138811		Approved		uc003sxn.1	Q8N865	OTTHUMG00000128497	ENST00000409280.1:c.675A>G	7.37:g.25191224T>C			A4D165|Q6MZV8|Q6P989|Q7LE28|Q86XK1|Q8N1H5|Q96BN4	Silent	SNP	NULL	p.V225	ENST00000409280.1	37	c.675	CCDS5394.1	7																																																																																			C7orf31	-	NULL	ENSG00000153790		0.323	C7orf31-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	C7orf31	HGNC	protein_coding	OTTHUMT00000326929.1	-	0.00	36	0	T	NM_138811		25191224	-1	tier1	-	no_errors	ENST00000283905	ensembl	human	known	74_37	silent	54.05	17	20	SNP	0.220	C
C9orf78	51759	genome.wustl.edu	37	9	132596001	132596001	+	Intron	DEL	A	A	-			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr9:132596001delA	ENST00000372447.3	-	3	197				USP20_ENST00000372429.3_5'Flank|USP20_ENST00000358355.1_5'Flank|USP20_ENST00000315480.4_5'Flank|C9orf78_ENST00000461762.1_5'UTR	NM_016520.2	NP_057604.1	Q9NZ63	CI078_HUMAN	chromosome 9 open reading frame 78							cytoplasm (GO:0005737)|nucleus (GO:0005634)				kidney(2)|lung(7)|ovary(1)|prostate(1)|stomach(2)	13		Ovarian(14;0.00556)				GAGCAAAACCAAAAAAAAAAG	0.478																																																	0													28.0	25.0	26.0					9																	132596001		2203	4299	6502	SO:0001627	intron_variant	0			BC017570	CCDS6931.1	9q34.2	2012-03-16			ENSG00000136819	ENSG00000136819			24932	protein-coding gene	gene with protein product	"""Hepatocellular carcinoma-associated antigen 59"""					11042152, 12097419	Standard	NM_016520		Approved	HSPC220, HCA59	uc004byp.3	Q9NZ63	OTTHUMG00000020796	ENST00000372447.3:c.144-13T>-	9.37:g.132596001delA			B3KPX8|Q8WVU6|Q9NT39	RNA	DEL	-	NULL	ENST00000372447.3	37	NULL	CCDS6931.1	9																																																																																			C9orf78	-	-	ENSG00000136819		0.478	C9orf78-007	KNOWN	basic|appris_principal|CCDS	protein_coding	C9orf78	HGNC	protein_coding	OTTHUMT00000054625.1		0.00	20	0	A	NM_016520		132596001	-1	tier1		no_errors	ENST00000461762	ensembl	human	known	74_37	rna	12.00	22	3	DEL	0.115	-
CAND1	55832	genome.wustl.edu	37	12	67700046	67700046	+	Silent	SNP	A	A	T			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr12:67700046A>T	ENST00000545606.1	+	10	3035	c.2598A>T	c.(2596-2598)tcA>tcT	p.S866S		NM_018448.3	NP_060918.2	Q86VP6	CAND1_HUMAN	cullin-associated and neddylation-dissociated 1	866					cell differentiation (GO:0030154)|negative regulation of catalytic activity (GO:0043086)|positive regulation of RNA polymerase II transcriptional preinitiation complex assembly (GO:0045899)|protein ubiquitination (GO:0016567)|SCF complex assembly (GO:0010265)	cullin-RING ubiquitin ligase complex (GO:0031461)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)				NS(1)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(10)|lung(12)|prostate(1)|skin(2)|stomach(1)	35			GBM - Glioblastoma multiforme(1;1.13e-10)|Lung(24;0.000342)|LUSC - Lung squamous cell carcinoma(43;0.196)	GBM - Glioblastoma multiforme(28;0.0279)		AAGCTTTCTCATCTCCTAGTG	0.413																																																	0													117.0	115.0	116.0					12																	67700046		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS8977.1	12q14	2008-02-05			ENSG00000111530	ENSG00000111530			30688	protein-coding gene	gene with protein product	"""TBP interacting protein"""	607727				10048485, 8954946	Standard	NM_018448		Approved	TIP120A, DKFZp434M1414, KIAA0829, TIP120	uc001stn.2	Q86VP6	OTTHUMG00000169060	ENST00000545606.1:c.2598A>T	12.37:g.67700046A>T			B2RAU3|O94918|Q6PIY4|Q8NDJ4|Q96JZ9|Q96T19|Q9BTC4|Q9H0G2|Q9P0H7|Q9UF85	Silent	SNP	pfam_TATA-bd_TIP120,pfam_HEAT,superfamily_ARM-type_fold	p.S866	ENST00000545606.1	37	c.2598	CCDS8977.1	12																																																																																			CAND1	-	superfamily_ARM-type_fold	ENSG00000111530		0.413	CAND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CAND1	HGNC	protein_coding	OTTHUMT00000402105.1	-	0.00	22	0	A	NM_018448		67700046	+1	tier1	-	no_errors	ENST00000545606	ensembl	human	known	74_37	silent	48.15	14	13	SNP	0.147	T
CBL	867	genome.wustl.edu	37	11	119149355	119149355	+	Missense_Mutation	SNP	T	T	A	rs397507494		TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr11:119149355T>A	ENST00000264033.4	+	9	1739	c.1363T>A	c.(1363-1365)Tat>Aat	p.Y455N		NM_005188.3	NP_005179.2	P22681	CBL_HUMAN	Cbl proto-oncogene, E3 ubiquitin protein ligase	455	Asp/Glu-rich (acidic).				cell surface receptor signaling pathway (GO:0007166)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of receptor-mediated endocytosis (GO:0048260)|protein ubiquitination (GO:0016567)|regulation of transcription, DNA-templated (GO:0006355)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|flotillin complex (GO:0016600)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|ephrin receptor binding (GO:0046875)|ligase activity (GO:0016874)|sequence-specific DNA binding transcription factor activity (GO:0003700)|SH3 domain binding (GO:0017124)|signal transducer activity (GO:0004871)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.E366_K477del(1)		breast(2)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(194)|kidney(3)|large_intestine(9)|lung(30)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	251		Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;4.92e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.000784)		CTCCCCAAATTATGATGATGA	0.473			"""T, Mis S, O"""	MLL	"""AML, JMML, MDS"""				Noonan syndrome;CBL gene-associated Juvenile Myelomonocytic Leukemia and Developmental Anomalies																															"""Dom, Rec"""	yes		11	11q23.3	867	Cas-Br-M (murine) ecotropic retroviral transforming		L	1	Deletion - In frame(1)	haematopoietic_and_lymphoid_tissue(1)											98.0	99.0	99.0					11																	119149355		2199	4295	6494	SO:0001583	missense	0	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CBL-associated JMML	X57110	CCDS8418.1	11q23.3	2014-09-17	2012-02-23		ENSG00000110395	ENSG00000110395		"""RING-type (C3HC4) zinc fingers"""	1541	protein-coding gene	gene with protein product	"""oncogene CBL2"""	165360	"""Cas-Br-M (murine) ecotropic retroviral transforming sequence"""	CBL2		2013228	Standard	NM_005188		Approved	RNF55, c-Cbl	uc001pwe.4	P22681	OTTHUMG00000166170	ENST00000264033.4:c.1363T>A	11.37:g.119149355T>A	ENSP00000264033:p.Tyr455Asn		A3KMP8	Missense_Mutation	SNP	pfam_Adaptor_Cbl_N_hlx,pfam_Adaptor_Cbl_SH2-like,pfam_Adaptor_Cbl_EF_hand-like,pfam_Znf_C3HC4_RING-type,pfam_UBA/Ts_N,superfamily_Adaptor_Cbl_N_hlx,superfamily_UBA-like,smart_Znf_RING,smart_UBA/transl_elong_EF1B_N_euk,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Znf_RING	p.Y455N	ENST00000264033.4	37	c.1363	CCDS8418.1	11	.	.	.	.	.	.	.	.	.	.	T	13.74	2.327552	0.41197	.	.	ENSG00000110395	ENST00000264033	T	0.76839	-1.05	5.96	5.96	0.96718	.	0.060003	0.64402	D	0.000002	T	0.71384	0.3333	L	0.41236	1.265	0.51233	D	0.99991	B	0.14438	0.01	B	0.10450	0.005	T	0.65389	-0.6180	10	0.30854	T	0.27	-46.1149	16.4484	0.83959	0.0:0.0:0.0:1.0	.	455	P22681	CBL_HUMAN	N	455	ENSP00000264033:Y455N	ENSP00000264033:Y455N	Y	+	1	0	CBL	118654565	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	4.696000	0.61774	2.285000	0.76669	0.533000	0.62120	TAT	CBL	-	NULL	ENSG00000110395		0.473	CBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CBL	HGNC	protein_coding	OTTHUMT00000388219.4	-	0.00	30	0	T	NM_005188		119149355	+1	tier1	-	no_errors	ENST00000264033	ensembl	human	known	74_37	missense	26.32	14	5	SNP	1.000	A
CCDC39	339829	genome.wustl.edu	37	3	180337677	180337677	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr3:180337677C>T	ENST00000442201.2	-	15	2199	c.2080G>A	c.(2080-2082)Gct>Act	p.A694T	CCDC39_ENST00000273654.4_Intron	NM_181426.1	NP_852091.1	Q9UFE4	CCD39_HUMAN	coiled-coil domain containing 39	694					axonemal dynein complex assembly (GO:0070286)|cilium-dependent cell motility (GO:0060285)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of liver left/right asymmetry (GO:0071910)|determination of pancreatic left/right asymmetry (GO:0035469)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|heart looping (GO:0001947)|lung development (GO:0030324)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)				NS(1)|breast(1)|endometrium(4)|large_intestine(9)|lung(22)|ovary(6)|prostate(2)	45	all_cancers(143;9.31e-15)|Ovarian(172;0.0212)		OV - Ovarian serous cystadenocarcinoma(80;5.62e-23)|GBM - Glioblastoma multiforme(14;0.000558)			TTTTCTAGAGCGTAGATTTCT	0.353																																																	0													107.0	93.0	97.0					3																	180337677		1816	4076	5892	SO:0001583	missense	0			BC047103	CCDS46964.1	3q26.33	2012-07-27			ENSG00000145075	ENSG00000145075			25244	protein-coding gene	gene with protein product		613798				21131972	Standard	NM_181426		Approved	DKFZp434A128, CILD14, FAP59	uc010hxe.3	Q9UFE4	OTTHUMG00000157857	ENST00000442201.2:c.2080G>A	3.37:g.180337677C>T	ENSP00000405708:p.Ala694Thr		B4E2H1	Missense_Mutation	SNP	superfamily_Prefoldin,superfamily_tRNA-bd_arm	p.A694T	ENST00000442201.2	37	c.2080	CCDS46964.1	3	.	.	.	.	.	.	.	.	.	.	C	22.7	4.320155	0.81469	.	.	ENSG00000145075	ENST00000442201	T	0.77620	-1.11	5.55	5.55	0.83447	.	.	.	.	.	D	0.85944	0.5815	M	0.82517	2.595	0.80722	D	1	D	0.65815	0.995	P	0.54312	0.748	D	0.84180	0.0439	9	0.26408	T	0.33	.	19.5017	0.95097	0.0:1.0:0.0:0.0	.	694	Q9UFE4	CCD39_HUMAN	T	694	ENSP00000405708:A694T	ENSP00000405708:A694T	A	-	1	0	CCDC39	181820371	1.000000	0.71417	0.996000	0.52242	0.944000	0.59088	6.977000	0.76141	2.596000	0.87737	0.563000	0.77884	GCT	CCDC39	-	superfamily_Prefoldin	ENSG00000145075		0.353	CCDC39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC39	HGNC	protein_coding	OTTHUMT00000349783.3	-	0.00	38	0	C	XM_291028		180337677	-1	tier1	-	no_errors	ENST00000442201	ensembl	human	known	74_37	missense	36.25	51	29	SNP	0.999	T
CCT8L2	150160	genome.wustl.edu	37	22	17072831	17072831	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr22:17072831C>T	ENST00000359963.3	-	1	869	c.610G>A	c.(610-612)Ggg>Agg	p.G204R		NM_014406.4	NP_055221.1	Q96SF2	TCPQM_HUMAN	chaperonin containing TCP1, subunit 8 (theta)-like 2	204					anion transport (GO:0006820)|cellular protein metabolic process (GO:0044267)|potassium ion transmembrane transport (GO:0071805)|transport (GO:0006810)	cytoplasm (GO:0005737)	anion channel activity (GO:0005253)|ATP binding (GO:0005524)|calcium-activated potassium channel activity (GO:0015269)			breast(3)|endometrium(7)|kidney(1)|large_intestine(8)|liver(2)|lung(37)|ovary(3)|prostate(3)|skin(2)|stomach(1)	67	all_hematologic(4;0.00567)|Acute lymphoblastic leukemia(84;0.0977)	all_epithelial(15;0.0157)|Lung NSC(13;0.147)|all_lung(157;0.175)				GCGCACACCCCAACACGCTCA	0.612																																																	0													66.0	64.0	65.0					22																	17072831		2203	4300	6503	SO:0001583	missense	0			AP003553	CCDS13738.1	22q11.1	2011-09-01			ENSG00000198445	ENSG00000198445			15553	protein-coding gene	gene with protein product							Standard	NM_014406		Approved	CESK1	uc002zlp.1	Q96SF2	OTTHUMG00000141302	ENST00000359963.3:c.610G>A	22.37:g.17072831C>T	ENSP00000353048:p.Gly204Arg		A4QPH3|Q9UJS3	Missense_Mutation	SNP	pfam_Cpn60/TCP-1,superfamily_Cpn60/TCP-1,superfamily_GroEL-like_apical_dom,prints_Chaperone_TCP-1	p.G204R	ENST00000359963.3	37	c.610	CCDS13738.1	22	.	.	.	.	.	.	.	.	.	.	c	3.177	-0.168722	0.06461	.	.	ENSG00000198445	ENST00000359963	T	0.80214	-1.35	1.98	1.98	0.26296	.	0.520533	0.14294	U	0.328760	T	0.53514	0.1801	N	0.03608	-0.345	0.09310	N	1	B	0.15141	0.012	B	0.15052	0.012	T	0.40776	-0.9545	10	0.08837	T	0.75	-12.081	7.4423	0.27190	0.0:1.0:0.0:0.0	.	204	Q96SF2	TCPQM_HUMAN	R	204	ENSP00000353048:G204R	ENSP00000353048:G204R	G	-	1	0	CCT8L2	15452831	0.000000	0.05858	0.043000	0.18650	0.047000	0.14425	-0.109000	0.10840	1.115000	0.41800	0.379000	0.24179	GGG	CCT8L2	-	pfam_Cpn60/TCP-1,superfamily_Cpn60/TCP-1	ENSG00000198445		0.612	CCT8L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCT8L2	HGNC	protein_coding	OTTHUMT00000280580.1	-	0.00	63	0	C			17072831	-1	tier1	-	no_errors	ENST00000359963	ensembl	human	known	74_37	missense	40.91	13	9	SNP	0.008	T
CDC27	996	genome.wustl.edu	37	17	45214646	45214646	+	Silent	SNP	T	T	C			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr17:45214646T>C	ENST00000066544.3	-	14	1878	c.1785A>G	c.(1783-1785)caA>caG	p.Q595Q	CDC27_ENST00000527547.1_Silent_p.Q594Q|CDC27_ENST00000531206.1_Silent_p.Q601Q|CDC27_ENST00000446365.2_Silent_p.Q534Q	NM_001114091.1|NM_001256.3	NP_001107563.1|NP_001247.3	P30260	CDC27_HUMAN	cell division cycle 27	595					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell proliferation (GO:0008283)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cell cycle (GO:0000278)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	protein phosphatase binding (GO:0019903)			NS(1)|breast(5)|central_nervous_system(3)|cervix(1)|endometrium(2)|kidney(17)|large_intestine(18)|lung(11)|ovary(5)|pancreas(1)|prostate(19)|skin(5)|upper_aerodigestive_tract(2)	90						TTGGATCAACTTGGATAGCTC	0.388																																																	0													55.0	58.0	57.0					17																	45214646		2203	4299	6502	SO:0001819	synonymous_variant	0			U00001	CCDS11509.1, CCDS45720.1, CCDS74090.1	17q21.32	2013-01-17	2013-01-17		ENSG00000004897	ENSG00000004897		"""Anaphase promoting complex subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	1728	protein-coding gene	gene with protein product	"""anaphase promoting complex subunit 3"""	116946	"""cell division cycle 27"", ""cell division cycle 27 homolog (S. cerevisiae)"""	D0S1430E, D17S978E		8234252	Standard	XM_005257892		Approved	APC3, ANAPC3, NUC2	uc002ile.4	P30260	OTTHUMG00000166429	ENST00000066544.3:c.1785A>G	17.37:g.45214646T>C			G3V1C4|Q16349|Q96F35	Silent	SNP	pfam_TPR_1,pfam_TPR_2,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.Q601	ENST00000066544.3	37	c.1803	CCDS11509.1	17																																																																																			CDC27	-	pfam_TPR_1,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	ENSG00000004897		0.388	CDC27-001	KNOWN	basic|CCDS	protein_coding	CDC27	HGNC	protein_coding	OTTHUMT00000389742.2		0.00	32	0	T			45214646	-1			no_errors	ENST00000531206	ensembl	human	known	74_37	silent	7.02	53	4	SNP	1.000	C
CDK18	5129	genome.wustl.edu	37	1	205498558	205498558	+	Splice_Site	SNP	G	G	T			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr1:205498558G>T	ENST00000360066.2	+	12	1479		c.e12+1		CDK18_ENST00000429964.2_Splice_Site|CDK18_ENST00000506784.1_Splice_Site|CDK18_ENST00000509056.1_3'UTR	NM_002596.3|NM_212502.2|NM_212503.2	NP_002587.2|NP_997667.1|NP_997668.1	Q07002	CDK18_HUMAN	cyclin-dependent kinase 18								ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)			breast(2)|endometrium(2)|large_intestine(2)|lung(10)|stomach(2)|urinary_tract(1)	19						ACGCGCCCAGGTAGCCCCTGC	0.677											OREG0014157	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									Pancreas(180;489 2072 28461 40831 44265)												0													36.0	40.0	39.0					1																	205498558		2203	4299	6502	SO:0001630	splice_region_variant	0			X66362	CCDS1454.1, CCDS44300.1	1q31-q32	2011-11-08	2009-12-16	2009-12-16	ENSG00000117266	ENSG00000117266		"""Cyclin-dependent kinases"""	8751	protein-coding gene	gene with protein product		169190	"""PCTAIRE protein kinase 3"""	PCTK3		1437147, 19884882	Standard	NM_002596		Approved	PCTAIRE3	uc010pri.2	Q07002	OTTHUMG00000037203	ENST00000360066.2:c.1178+1G>T	1.37:g.205498558G>T		2152	Q5VXQ2|Q6V3A2|Q6V3A3|Q96F90	Splice_Site	SNP	-	e11+1	ENST00000360066.2	37	c.1268+1	CCDS44300.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	24.3|24.3	4.517244|4.517244	0.85495|0.85495	.|.	.|.	ENSG00000117266|ENSG00000117266	ENST00000429964;ENST00000506784;ENST00000360066|ENST00000437052	.|.	.|.	.|.	4.74|4.74	4.74|4.74	0.60224|0.60224	.|.	.|.	.|.	.|.	.|.	.|T	.|0.72095	.|0.3418	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.71721	.|-0.4507	.|4	.|.	.|.	.|.	.|-27.9848	16.6722|16.6722	0.85270|0.85270	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	.|S	-1|157	.|.	.|.	.|R	+|+	.|3	.|2	CDK18|CDK18	203765181|203765181	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.904000|0.904000	0.53231|0.53231	9.651000|9.651000	0.98493|0.98493	2.361000|2.361000	0.80049|0.80049	0.563000|0.563000	0.77884|0.77884	.|AGG	CDK18	-	-	ENSG00000117266		0.677	CDK18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDK18	HGNC	protein_coding	OTTHUMT00000090407.2	-	0.00	29	0	G	NM_002596	Intron	205498558	+1	tier1	-	no_errors	ENST00000506784	ensembl	human	known	74_37	splice_site	62.50	6	10	SNP	1.000	T
CDK18	5129	genome.wustl.edu	37	1	205498560	205498560	+	3'UTR	SNP	A	A	T			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr1:205498560A>T	ENST00000509056.1	+	0	1527				CDK18_ENST00000429964.2_Intron|CDK18_ENST00000360066.2_Intron|CDK18_ENST00000506784.1_Intron			Q07002	CDK18_HUMAN	cyclin-dependent kinase 18								ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)			breast(2)|endometrium(2)|large_intestine(2)|lung(10)|stomach(2)|urinary_tract(1)	19						GCGCCCAGGTAGCCCCTGCGC	0.672											OREG0014157	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									Pancreas(180;489 2072 28461 40831 44265)												0													36.0	40.0	38.0					1																	205498560		2202	4299	6501	SO:0001624	3_prime_UTR_variant	0			X66362	CCDS1454.1, CCDS44300.1	1q31-q32	2011-11-08	2009-12-16	2009-12-16	ENSG00000117266	ENSG00000117266		"""Cyclin-dependent kinases"""	8751	protein-coding gene	gene with protein product		169190	"""PCTAIRE protein kinase 3"""	PCTK3		1437147, 19884882	Standard	NM_002596		Approved	PCTAIRE3	uc010pri.2	Q07002	OTTHUMG00000037203	ENST00000509056.1:c.*1524A>T	1.37:g.205498560A>T		2152	Q5VXQ2|Q6V3A2|Q6V3A3|Q96F90	RNA	SNP	-	NULL	ENST00000509056.1	37	NULL		1	.	.	.	.	.	.	.	.	.	.	A	15.13	2.742139	0.49151	.	.	ENSG00000117266	ENST00000437052	.	.	.	4.74	4.74	0.60224	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.3747	0.60732	1.0:0.0:0.0:0.0	.	.	.	.	L	158	.	.	X	+	2	0	CDK18	203765183	1.000000	0.71417	0.879000	0.34478	0.665000	0.39181	4.958000	0.63660	1.913000	0.55393	0.460000	0.39030	TAG	CDK18	-	-	ENSG00000117266		0.672	CDK18-016	KNOWN	basic	processed_transcript	CDK18	HGNC	protein_coding	OTTHUMT00000358281.1	-	0.00	27	0	A	NM_002596		205498560	+1	tier1	-	no_errors	ENST00000468954	ensembl	human	known	74_37	rna	58.82	7	10	SNP	0.989	T
CDKL3	51265	genome.wustl.edu	37	5	133643980	133643980	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr5:133643980G>T	ENST00000265334.4	-	9	1331	c.1213C>A	c.(1213-1215)Cca>Aca	p.P405T	CDKL3_ENST00000521755.1_3'UTR|CTD-2410N18.4_ENST00000518409.1_RNA|CDKL3_ENST00000536186.1_Missense_Mutation_p.P110T|CDKL3_ENST00000523832.1_Missense_Mutation_p.P405T|CDKL3_ENST00000609383.1_Missense_Mutation_p.P110T|CDKL3_ENST00000521118.1_Missense_Mutation_p.P405T|CDKL3_ENST00000609654.1_Missense_Mutation_p.P216T|CDKL3_ENST00000435240.2_Missense_Mutation_p.P110T|CDKL3_ENST00000435211.1_Missense_Mutation_p.P405T|CDKL3_ENST00000523054.1_Missense_Mutation_p.P216T	NM_001113575.1	NP_001107047.1	Q8IVW4	CDKL3_HUMAN	cyclin-dependent kinase-like 3	405					cellular protein modification process (GO:0006464)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|protein kinase activity (GO:0004672)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(3)|prostate(3)	11			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			GGGTTTGGTGGTTCAATGGTT	0.403																																																	0													187.0	175.0	178.0					5																	133643980		1891	4112	6003	SO:0001583	missense	0			AF130372	CCDS47264.1, CCDS47265.1, CCDS75303.1	5q31.1	2014-09-09			ENSG00000006837	ENSG00000006837	2.7.11.22	"""Cyclin-dependent kinases"""	15483	protein-coding gene	gene with protein product	"""serine-threonine protein kinase NKIAMRE"""	608459				10463609	Standard	NM_016508		Approved	NKIAMRE	uc003kzf.4	Q8IVW4	OTTHUMG00000186341	ENST00000265334.4:c.1213C>A	5.37:g.133643980G>T	ENSP00000265334:p.Pro405Thr		D3DQA0|D3DQA1|Q9P114	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.P405T	ENST00000265334.4	37	c.1213	CCDS47264.1	5	.	.	.	.	.	.	.	.	.	.	G	2.059	-0.415950	0.04766	.	.	ENSG00000006837	ENST00000536186;ENST00000435240;ENST00000265334;ENST00000523054;ENST00000521118;ENST00000523832;ENST00000435211	T;T;T;T;T;T;T	0.72505	0.95;0.91;-0.61;-0.45;-0.66;-0.61;-0.61	5.56	2.39	0.29439	.	0.447160	0.21429	N	0.074697	T	0.52709	0.1751	N	0.24115	0.695	0.09310	N	1	B;P;P;B;B	0.38677	0.418;0.573;0.642;0.164;0.049	B;B;B;B;B	0.39217	0.121;0.294;0.274;0.06;0.026	T	0.44982	-0.9292	10	0.49607	T	0.09	-27.0197	5.5924	0.17309	0.2707:0.1494:0.5799:0.0	.	216;110;110;216;405	B4DX41;B4DRK6;B4DGS2;B7Z2C5;Q8IVW4	.;.;.;.;CDKL3_HUMAN	T	110;110;405;216;405;405;405	ENSP00000441545:P110T;ENSP00000399807:P110T;ENSP00000265334:P405T;ENSP00000428500:P216T;ENSP00000428689:P405T;ENSP00000430496:P405T;ENSP00000395559:P405T	ENSP00000265334:P405T	P	-	1	0	CDKL3	133671879	0.001000	0.12720	0.017000	0.16124	0.029000	0.11900	0.396000	0.20867	0.738000	0.32606	-0.142000	0.14014	CCA	CDKL3	-	NULL	ENSG00000006837		0.403	CDKL3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CDKL3	HGNC	protein_coding	OTTHUMT00000377697.1	-	0.00	98	0	G	NM_001113575		133643980	-1	tier1	-	no_errors	ENST00000265334	ensembl	human	known	74_37	missense	53.62	32	37	SNP	0.001	T
CDKN2A	1029	genome.wustl.edu	37	9	21971111	21971111	+	Missense_Mutation	SNP	G	G	A	rs121913385		TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr9:21971111G>A	ENST00000304494.5	-	2	517	c.247C>T	c.(247-249)Cac>Tac	p.H83Y	CDKN2A_ENST00000497750.1_Missense_Mutation_p.H32Y|CDKN2A_ENST00000578845.2_Missense_Mutation_p.H32Y|CDKN2A_ENST00000498124.1_Missense_Mutation_p.H83Y|RP11-145E5.5_ENST00000404796.2_Intron|CDKN2A_ENST00000530628.2_Missense_Mutation_p.A97V|CDKN2A_ENST00000579755.1_Missense_Mutation_p.A97V|CDKN2A_ENST00000494262.1_Missense_Mutation_p.H32Y|CDKN2A_ENST00000498628.2_Missense_Mutation_p.H32Y|CDKN2A_ENST00000446177.1_Missense_Mutation_p.H83Y|CDKN2A_ENST00000361570.3_Missense_Mutation_p.A138V|CDKN2A_ENST00000479692.2_Missense_Mutation_p.H32Y|CDKN2A_ENST00000579122.1_Missense_Mutation_p.H83Y	NM_000077.4	NP_000068.1	P42771	CD2A1_HUMAN	cyclin-dependent kinase inhibitor 2A	83			H -> N (in a lung tumor).|H -> Q (in dbSNP:rs34968276).|H -> Y (in a pancreas and a head and neck tumor).		cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of phosphorylation (GO:0042326)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cellular senescence (GO:2000774)|positive regulation of macrophage apoptotic process (GO:2000111)|positive regulation of smooth muscle cell apoptotic process (GO:0034393)|Ras protein signal transduction (GO:0007265)|replicative senescence (GO:0090399)|senescence-associated heterochromatin focus assembly (GO:0035986)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|senescence-associated heterochromatin focus (GO:0035985)	cyclin-dependent protein serine/threonine kinase inhibitor activity (GO:0004861)|NF-kappaB binding (GO:0051059)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)	p.0?(1315)|p.?(44)|p.H83Y(30)|p.A138V(2)|p.H83fs*2(2)|p.H83N(1)|p.V82fs*62(1)|p.0(1)|p.V82_G89>G(1)|p.E61_L94del(1)|p.R137fs*48(1)|p.A68fs*3(1)|p.P81_A85del(1)|p.R80fs*34(1)|p.V82_E88del(1)		NS(28)|adrenal_gland(6)|autonomic_ganglia(11)|biliary_tract(74)|bone(84)|breast(46)|central_nervous_system(522)|cervix(23)|endometrium(14)|eye(4)|genital_tract(15)|haematopoietic_and_lymphoid_tissue(698)|kidney(39)|large_intestine(11)|liver(92)|lung(365)|meninges(18)|oesophagus(239)|ovary(98)|pancreas(263)|pleura(94)|prostate(13)|salivary_gland(10)|skin(541)|small_intestine(1)|soft_tissue(93)|stomach(48)|thymus(4)|thyroid(24)|upper_aerodigestive_tract(436)|urinary_tract(283)|vulva(2)	4199		all_cancers(5;0)|Acute lymphoblastic leukemia(3;0)|all_hematologic(3;0)|all_epithelial(2;2.37e-290)|Lung NSC(2;1.26e-139)|all_lung(2;4.48e-131)|Glioma(2;3.26e-60)|all_neural(2;2.1e-52)|Renal(3;1.07e-46)|Esophageal squamous(3;3.83e-46)|Melanoma(2;2.74e-34)|Breast(3;1.14e-11)|Ovarian(3;0.000128)|Hepatocellular(5;0.00162)|Colorectal(97;0.172)		all cancers(2;0)|GBM - Glioblastoma multiforme(3;0)|Lung(2;4.07e-74)|Epithelial(2;1.08e-61)|LUSC - Lung squamous cell carcinoma(2;3.82e-48)|LUAD - Lung adenocarcinoma(2;4.56e-26)|OV - Ovarian serous cystadenocarcinoma(39;7.64e-10)|BRCA - Breast invasive adenocarcinoma(2;5.01e-09)|STAD - Stomach adenocarcinoma(4;4.63e-07)|Kidney(2;5.79e-07)|KIRC - Kidney renal clear cell carcinoma(2;7.27e-07)|COAD - Colon adenocarcinoma(8;5.15e-05)		GCAGCGTCGTGCACGGGTCGG	0.741	H83Y(CALU3_LUNG)|H83Y(HS944T_SKIN)|H83Y(JHH2_LIVER)|H83Y(OPM2_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|H83Y(SEM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)	17								HNSCC(2;<9.43e_08)|TSP Lung(5;3.83e-07)																																							1403	Whole gene deletion(1316)|Unknown(44)|Substitution - Missense(33)|Deletion - Frameshift(6)|Deletion - In frame(3)|Complex - deletion inframe(1)	haematopoietic_and_lymphoid_tissue(284)|skin(175)|central_nervous_system(171)|lung(154)|urinary_tract(93)|bone(74)|oesophagus(59)|soft_tissue(58)|upper_aerodigestive_tract(56)|pleura(51)|ovary(36)|pancreas(34)|breast(33)|kidney(32)|thyroid(13)|NS(12)|biliary_tract(12)|stomach(12)|autonomic_ganglia(9)|liver(7)|meninges(7)|large_intestine(6)|salivary_gland(5)|thymus(4)|vulva(2)|endometrium(2)|prostate(2)	GRCh37	CM053801|CM056557	CDKN2A	M	rs121913385						12.0	15.0	14.0					9																	21971111		2176	4259	6435	SO:0001583	missense	0			L27211	CCDS6510.1, CCDS6511.1, CCDS6511.2, CCDS56565.1	9p21	2014-09-17	2012-03-08		ENSG00000147889	ENSG00000147889			1787	protein-coding gene	gene with protein product		600160	"""cyclin-dependent kinase inhibitor 2A (melanoma, p16, inhibits CDK4)"""	CDKN2, MLM		8152487, 7606716	Standard	NM_058195		Approved	CDK4I, p16, INK4a, MTS1, CMM2, ARF, p19, p14, INK4, p16INK4a, p19Arf	uc003zpk.3	P42771	OTTHUMG00000019686	ENST00000304494.5:c.247C>T	9.37:g.21971111G>A	ENSP00000307101:p.His83Tyr		A5X2G7|D3DRK1|O95440|Q15191|Q5VVJ5|Q96B52|Q9NP05	Missense_Mutation	SNP	pfam_Cyclin_kinase-Inhib_2A	p.A138V	ENST00000304494.5	37	c.413	CCDS6510.1	9	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	26.7|26.7	4.762523|4.762523	0.89932|0.89932	.|.	.|.	ENSG00000147889|ENSG00000147889	ENST00000361570;ENST00000530628|ENST00000304494;ENST00000446177	T;T|T;T	0.80393|0.71222	-1.37;-1.31|-0.55;-0.55	5.93|5.93	5.93|5.93	0.95920|0.95920	.|Ankyrin repeat-containing domain (4);	0.000000|.	0.37261|.	N|.	0.002164|.	T|T	0.77579|0.77579	0.4151|0.4151	L|L	0.27053|0.27053	0.805|0.805	0.46521|0.46521	D|D	0.999085|0.999085	P|D	0.47191|0.76494	0.891|0.999	B|D	0.44044|0.75484	0.439|0.986	T|T	0.79024|0.79024	-0.1972|-0.1972	10|9	0.62326|0.66056	D|D	0.03|0.02	-15.192|-15.192	19.1026|19.1026	0.93279|0.93279	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	138|83	Q8N726|P42771	CD2A2_HUMAN|CD2A1_HUMAN	V|Y	138;97|83	ENSP00000355153:A138V;ENSP00000432664:A97V|ENSP00000307101:H83Y;ENSP00000394932:H83Y	ENSP00000355153:A138V|ENSP00000307101:H83Y	A|H	-|-	2|1	0|0	CDKN2A|CDKN2A	21961111|21961111	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.915000|0.915000	0.54546|0.54546	8.665000|8.665000	0.91144|0.91144	2.803000|2.803000	0.96430|0.96430	0.650000|0.650000	0.86243|0.86243	GCA|CAC	CDKN2A	-	NULL	ENSG00000147889		0.741	CDKN2A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CDKN2A	HGNC	protein_coding	OTTHUMT00000051915.1	-	0.00	12	0	G	NM_000077		21971111	-1	tier1	rs121913385	no_errors	ENST00000361570	ensembl	human	known	74_37	missense	91.67	1	11	SNP	1.000	A
CEL	1056	genome.wustl.edu	37	9	135945858	135945858	+	Missense_Mutation	SNP	A	A	G			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr9:135945858A>G	ENST00000372080.4	+	10	1322	c.1306A>G	c.(1306-1308)Acc>Gcc	p.T436A	CEL_ENST00000351304.7_Intron	NM_001807.3	NP_001798.2	P19835	CEL_HUMAN	carboxyl ester lipase	433					cholesterol catabolic process (GO:0006707)|fatty acid catabolic process (GO:0009062)|intestinal cholesterol absorption (GO:0030299)|intestinal lipid catabolic process (GO:0044258)|lipid digestion (GO:0044241)|lipid metabolic process (GO:0006629)|pancreatic juice secretion (GO:0030157)|protein esterification (GO:0018350)|small molecule metabolic process (GO:0044281)|triglyceride metabolic process (GO:0006641)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	acylglycerol lipase activity (GO:0047372)|catalytic activity (GO:0003824)|heparin binding (GO:0008201)|hydrolase activity (GO:0016787)|sterol esterase activity (GO:0004771)|triglyceride lipase activity (GO:0004806)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(9)|pancreas(2)|skin(1)	20				OV - Ovarian serous cystadenocarcinoma(145;1.03e-40)|Epithelial(140;3.58e-37)|GBM - Glioblastoma multiforme(294;0.00164)|READ - Rectum adenocarcinoma(205;0.196)		GAGTGCCAAGACCTACGCCTA	0.617																																																	0													43.0	44.0	43.0					9																	135945858		1852	4081	5933	SO:0001583	missense	0			M54994	CCDS43896.1	9q34.3	2013-03-13	2013-03-13		ENSG00000170835	ENSG00000170835	3.1.1.3, 3.1.1.13		1848	protein-coding gene	gene with protein product	"""bile salt-stimulated lipase"""	114840				1676983	Standard	NM_001807		Approved	BSSL, MODY8	uc010naa.2	P19835	OTTHUMG00000020855	ENST00000372080.4:c.1306A>G	9.37:g.135945858A>G	ENSP00000361151:p.Thr436Ala		Q16398|Q5T7U7|Q9UCH1|Q9UP41	Missense_Mutation	SNP	pfam_CarbesteraseB,pfam_AB_hydrolase_3	p.T436A	ENST00000372080.4	37	c.1306	CCDS43896.1	9	.	.	.	.	.	.	.	.	.	.	A	14.52	2.558834	0.45590	.	.	ENSG00000170835	ENST00000372080;ENST00000303626	T	0.59906	0.23	5.74	3.39	0.38822	Carboxylesterase, type B (1);	0.045671	0.85682	D	0.000000	T	0.67239	0.2872	L	0.51914	1.62	0.80722	D	1	D	0.89917	1.0	D	0.75484	0.986	T	0.65191	-0.6228	10	0.56958	D	0.05	.	9.7795	0.40640	0.8595:0.0:0.1405:0.0	.	433	P19835	CEL_HUMAN	A	436;435	ENSP00000361151:T436A	ENSP00000304021:T435A	T	+	1	0	CEL	134935679	1.000000	0.71417	0.093000	0.20910	0.158000	0.22134	8.640000	0.91028	0.439000	0.26476	-0.512000	0.04463	ACC	CEL	-	pfam_CarbesteraseB	ENSG00000170835		0.617	CEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEL	HGNC	protein_coding	OTTHUMT00000054823.1	-	0.00	25	0	A			135945858	+1	tier1	-	no_errors	ENST00000372080	ensembl	human	known	74_37	missense	49.12	29	28	SNP	0.996	G
CENPO	79172	genome.wustl.edu	37	2	25037312	25037312	+	Missense_Mutation	SNP	A	A	C			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr2:25037312A>C	ENST00000380834.2	+	4	709	c.284A>C	c.(283-285)gAa>gCa	p.E95A	CENPO_ENST00000473706.1_Missense_Mutation_p.E89A|CENPO_ENST00000260662.1_Missense_Mutation_p.E95A			Q9BU64	CENPO_HUMAN	centromere protein O	95					CENP-A containing nucleosome assembly (GO:0034080)|mitotic cell cycle (GO:0000278)|nucleosome assembly (GO:0006334)	cytosol (GO:0005829)|kinetochore (GO:0000776)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				breast(2)|kidney(1)|large_intestine(3)|lung(1)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	10	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.203)					GAAGCATTGGAAGAGAAATTG	0.388																																																	0													203.0	202.0	202.0					2																	25037312		2203	4300	6503	SO:0001583	missense	0			AK027859	CCDS1714.1, CCDS56113.1	2p23.3	2013-11-05			ENSG00000138092	ENSG00000138092			28152	protein-coding gene	gene with protein product		611504				16622420, 16622419	Standard	NM_024322		Approved	MGC11266, CENP-O	uc002rfp.2	Q9BU64	OTTHUMG00000125525	ENST00000380834.2:c.284A>C	2.37:g.25037312A>C	ENSP00000370214:p.Glu95Ala		B2RDC0|D6W536|Q53T55|Q96JV3	Missense_Mutation	SNP	pfam_CENP-O	p.E95A	ENST00000380834.2	37	c.284	CCDS1714.1	2	.	.	.	.	.	.	.	.	.	.	A	11.69	1.714521	0.30413	.	.	ENSG00000138092	ENST00000380834;ENST00000473706;ENST00000260662	T;T;T	0.49139	0.79;0.79;0.79	5.28	4.12	0.48240	.	0.352201	0.29218	N	0.012791	T	0.42017	0.1184	L	0.54323	1.7	0.09310	N	1	P;P	0.45531	0.86;0.657	B;B	0.41510	0.359;0.197	T	0.41324	-0.9515	10	0.72032	D	0.01	-10.7162	7.8498	0.29448	0.9078:0.0:0.0922:0.0	.	89;95	Q9BU64-2;Q9BU64	.;CENPO_HUMAN	A	95;89;95	ENSP00000370214:E95A;ENSP00000417787:E89A;ENSP00000260662:E95A	ENSP00000260662:E95A	E	+	2	0	CENPO	24890816	0.559000	0.26562	0.018000	0.16275	0.026000	0.11368	2.544000	0.45761	1.012000	0.39366	0.528000	0.53228	GAA	CENPO	-	NULL	ENSG00000138092		0.388	CENPO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CENPO	HGNC	protein_coding	OTTHUMT00000246856.2	-	0.00	62	0	A	NM_024322		25037312	+1	tier1	-	no_errors	ENST00000260662	ensembl	human	known	74_37	missense	51.85	26	28	SNP	0.076	C
CEP290	80184	genome.wustl.edu	37	12	88477689	88477689	+	Missense_Mutation	SNP	T	T	A			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr12:88477689T>A	ENST00000552810.1	-	36	5090	c.4747A>T	c.(4747-4749)Att>Ttt	p.I1583F	CEP290_ENST00000397838.3_Missense_Mutation_p.I643F|CEP290_ENST00000547691.2_Missense_Mutation_p.I643F|CEP290_ENST00000309041.7_Missense_Mutation_p.I1585F	NM_025114.3	NP_079390.3	O15078	CE290_HUMAN	centrosomal protein 290kDa	1583					cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|establishment or maintenance of cell polarity (GO:0007163)|eye photoreceptor cell development (GO:0042462)|G2/M transition of mitotic cell cycle (GO:0000086)|hindbrain development (GO:0030902)|mitotic cell cycle (GO:0000278)|otic vesicle formation (GO:0030916)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of transcription, DNA-templated (GO:0045893)|pronephros development (GO:0048793)|protein transport (GO:0015031)|regulation of cAMP metabolic process (GO:0030814)|regulation of establishment of protein localization (GO:0070201)|retina development in camera-type eye (GO:0060041)	centriolar satellite (GO:0034451)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|photoreceptor connecting cilium (GO:0032391)|protein complex (GO:0043234)|TCTN-B9D complex (GO:0036038)				breast(4)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(20)|liver(1)|lung(18)|ovary(5)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	73						TGATGAAGAATATGAAGGTCT	0.308																																																	0													132.0	118.0	122.0					12																	88477689		1804	4070	5874	SO:0001583	missense	0			AB002371	CCDS55858.1	12q21.33	2014-09-17				ENSG00000198707			29021	protein-coding gene	gene with protein product	"""Joubert syndrome 5"", ""nephrocystin-6"", ""cancer/testis antigen 87"", ""POC3 centriolar protein homolog (Chlamydomonas)"", ""Meckel syndrome, type 4"""	610142				15474516, 16682973, 16632484	Standard	NM_025114		Approved	KIAA0373, FLJ13615, 3H11Ag, rd16, NPHP6, JBTS5, SLSN6, LCA10, MKS4, BBS14, CT87, POC3	uc001tar.3	O15078		ENST00000552810.1:c.4747A>T	12.37:g.88477689T>A	ENSP00000448012:p.Ile1583Phe		Q1PSK5|Q66GS8|Q9H2G6|Q9H6Q7|Q9H8I0	Missense_Mutation	SNP	NULL	p.I1585F	ENST00000552810.1	37	c.4753	CCDS55858.1	12	.	.	.	.	.	.	.	.	.	.	T	15.19	2.759722	0.49468	.	.	ENSG00000198707	ENST00000547691;ENST00000552810;ENST00000309041;ENST00000397838	D;D;D;D	0.92048	-2.96;-2.96;-2.96;-2.96	5.43	0.402	0.16344	.	0.831534	0.11365	N	0.571523	D	0.84316	0.5445	N	0.22421	0.69	0.09310	N	1	B	0.31383	0.321	B	0.33799	0.17	T	0.74813	-0.3537	10	0.56958	D	0.05	.	5.4287	0.16440	0.1293:0.3549:0.0:0.5158	.	1583	O15078	CE290_HUMAN	F	643;1583;1585;643	ENSP00000446905:I643F;ENSP00000448012:I1583F;ENSP00000308021:I1585F;ENSP00000380938:I643F	ENSP00000308021:I1585F	I	-	1	0	CEP290	87001820	0.000000	0.05858	0.991000	0.47740	0.989000	0.77384	0.497000	0.22514	0.106000	0.17784	0.528000	0.53228	ATT	CEP290	-	NULL	ENSG00000198707		0.308	CEP290-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CEP290	HGNC	protein_coding	OTTHUMT00000406344.1	-	0.00	32	0	T	NM_025114		88477689	-1	tier1	-	no_errors	ENST00000309041	ensembl	human	known	74_37	missense	31.58	13	6	SNP	0.119	A
CLEC18B	497190	genome.wustl.edu	37	16	74452168	74452168	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr16:74452168G>A	ENST00000339953.5	-	3	366	c.245C>T	c.(244-246)gCt>gTt	p.A82V		NM_001011880.2	NP_001011880.2	Q6UXF7	CL18B_HUMAN	C-type lectin domain family 18, member B	82	SCP.					extracellular region (GO:0005576)	carbohydrate binding (GO:0030246)			endometrium(3)|kidney(9)|large_intestine(3)|lung(7)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	27						CCTGGCTTGAGCCAGTTGGGC	0.647																																																	0													9.0	10.0	10.0					16																	74452168		1895	3990	5885	SO:0001583	missense	0			AY358373	CCDS32484.1	16q22.3	2010-04-27	2009-03-10	2009-03-10		ENSG00000140839		"""C-type lectin domain containing"""	33849	protein-coding gene	gene with protein product							Standard	NM_001011880		Approved		uc002fct.3	Q6UXF7		ENST00000339953.5:c.245C>T	16.37:g.74452168G>A	ENSP00000341051:p.Ala82Val		B4DF90	Missense_Mutation	SNP	pfam_CAP_domain,pfam_C-type_lectin,superfamily_CAP_domain,superfamily_C-type_lectin_fold,smart_Allrgn_V5/Tpx1,smart_EG-like_dom,smart_C-type_lectin,pfscan_EG-like_dom,pfscan_C-type_lectin,prints_Allrgn_V5/Tpx1	p.A82V	ENST00000339953.5	37	c.245	CCDS32484.1	16	.	.	.	.	.	.	.	.	.	.	g	22.2	4.251676	0.80135	.	.	ENSG00000140839	ENST00000429489;ENST00000339953;ENST00000268492	T	0.33865	1.39	3.57	3.57	0.40892	CAP domain (3);	0.130767	0.49305	D	0.000141	T	0.63319	0.2501	H	0.95850	3.73	0.53005	D	0.999966	P;P	0.47191	0.747;0.891	P;P	0.54431	0.674;0.752	T	0.73917	-0.3831	10	0.87932	D	0	.	10.55	0.45083	0.0:0.0:1.0:0.0	.	82;82	C9JSV1;Q6UXF7	.;CL18B_HUMAN	V	82	ENSP00000341051:A82V	ENSP00000268492:A82V	A	-	2	0	CLEC18B	73009669	1.000000	0.71417	0.592000	0.28758	0.857000	0.48899	6.946000	0.75953	1.821000	0.53095	0.531000	0.56144	GCT	CLEC18B	-	pfam_CAP_domain,superfamily_CAP_domain,smart_Allrgn_V5/Tpx1,prints_Allrgn_V5/Tpx1	ENSG00000140839		0.647	CLEC18B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLEC18B	HGNC	protein_coding	OTTHUMT00000434697.1	-	0.00	40	0	G	NM_001011880		74452168	-1	tier1	-	no_errors	ENST00000339953	ensembl	human	known	74_37	missense	13.33	39	6	SNP	0.875	A
CMYA5	202333	genome.wustl.edu	37	5	79025179	79025179	+	Silent	SNP	C	C	A			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr5:79025179C>A	ENST00000446378.2	+	2	622	c.591C>A	c.(589-591)acC>acA	p.T197T		NM_153610.3	NP_705838.3	Q8N3K9	CMYA5_HUMAN	cardiomyopathy associated 5	197					negative regulation of calcineurin-NFAT signaling cascade (GO:0070885)|negative regulation of protein phosphatase type 2B activity (GO:0032513)|regulation of skeletal muscle adaptation (GO:0014733)	costamere (GO:0043034)				NS(2)|breast(4)|central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(37)|lung(34)|ovary(6)|pancreas(2)|prostate(5)|skin(5)|stomach(11)|upper_aerodigestive_tract(3)|urinary_tract(1)	128		Lung NSC(167;0.00296)|all_lung(232;0.00327)|Ovarian(174;0.0262)		OV - Ovarian serous cystadenocarcinoma(54;9.85e-46)|Epithelial(54;3.38e-40)|all cancers(79;3.43e-35)		AAAAGAAGACCACTTCAAATA	0.368																																																	0													48.0	46.0	47.0					5																	79025179		1833	4096	5929	SO:0001819	synonymous_variant	0			AW755254, AL831986	CCDS47238.1	5q14.1	2013-02-11			ENSG00000164309	ENSG00000164309		"""Tripartite motif containing / Tripartite motif containing"", ""A-kinase anchor proteins"", ""Fibronectin type III domain containing"""	14305	protein-coding gene	gene with protein product	"""genethonin-3"", ""tripartite motif-containing 76"""	612193	"""chromosome 5 open reading frame 10"""	C5orf10		14688250	Standard	NM_153610		Approved	myospryn, SPRYD2, DKFZp451G223, TRIM76	uc003kgc.3	Q8N3K9	OTTHUMG00000162548	ENST00000446378.2:c.591C>A	5.37:g.79025179C>A			A0PJB7|Q05CT4|Q2NKX1|Q2T9G9|Q69YQ8|Q69YQ9|Q6P517|Q6P5U3|Q7Z4I1|Q86T34|Q86T49|Q8N3S4|Q8N3S7|Q8NAG8|Q9UK88	Silent	SNP	pfam_Fibronectin_type3,pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_B30.2/SPRY,pfscan_Fibronectin_type3	p.T197	ENST00000446378.2	37	c.591	CCDS47238.1	5																																																																																			CMYA5	-	NULL	ENSG00000164309		0.368	CMYA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CMYA5	HGNC	protein_coding	OTTHUMT00000369497.1	-	0.00	16	0	C	NM_153610		79025179	+1	tier1	-	no_errors	ENST00000446378	ensembl	human	known	74_37	silent	31.58	13	6	SNP	0.017	A
COBL	23242	genome.wustl.edu	37	7	51096150	51096150	+	Silent	SNP	G	G	C			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr7:51096150G>C	ENST00000265136.7	-	10	2808	c.2643C>G	c.(2641-2643)gtC>gtG	p.V881V	COBL_ENST00000395542.2_Silent_p.V963V	NM_015198.3	NP_056013.2	O75128	COBL_HUMAN	cordon-bleu WH2 repeat protein	881				V -> A (in Ref. 5; AAI44100). {ECO:0000305}.	actin filament network formation (GO:0051639)|actin filament polymerization (GO:0030041)|collateral sprouting in absence of injury (GO:0048669)|digestive tract development (GO:0048565)|embryonic axis specification (GO:0000578)|floor plate development (GO:0033504)|liver development (GO:0001889)|neural tube closure (GO:0001843)|notochord development (GO:0030903)|positive regulation of dendrite development (GO:1900006)|somite specification (GO:0001757)	actin filament (GO:0005884)|axon (GO:0030424)|axonal growth cone (GO:0044295)|cell cortex (GO:0005938)|dendrite (GO:0030425)|dendritic growth cone (GO:0044294)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	actin monomer binding (GO:0003785)			NS(2)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(26)|ovary(3)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	65	Glioma(55;0.08)					CATCAGCATGGACTTTTGGGG	0.552																																					NSCLC(189;2119 2138 12223 30818 34679)												0													132.0	117.0	122.0					7																	51096150		2203	4300	6503	SO:0001819	synonymous_variant	0			AB014533	CCDS34637.1, CCDS75601.1, CCDS75602.1	7p12.2-p12.1	2012-12-07	2012-12-07		ENSG00000106078	ENSG00000106078			22199	protein-coding gene	gene with protein product		610317	"""cordon-bleu homolog (mouse)"""				Standard	NM_015198		Approved	KIAA0633	uc003tpr.4	O75128	OTTHUMG00000155999	ENST00000265136.7:c.2643C>G	7.37:g.51096150G>C			A4D257|A7E2B0|B7ZLW9|B9EGF8|Q2T9J3|Q504Y4|Q86XA7|Q8N304|Q8TCM1	Silent	SNP	pfam_Cordon-bleu_ubiquitin_domain,pfam_WH2_dom,smart_WH2_dom,pfscan_WH2_dom	p.V963	ENST00000265136.7	37	c.2889	CCDS34637.1	7																																																																																			COBL	-	NULL	ENSG00000106078		0.552	COBL-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	COBL	HGNC	protein_coding	OTTHUMT00000342682.1	-	0.00	51	0	G	NM_015198		51096150	-1	tier1	-	no_errors	ENST00000395542	ensembl	human	known	74_37	silent	52.94	24	27	SNP	0.004	C
COL17A1	1308	genome.wustl.edu	37	10	105792467	105792468	+	Frame_Shift_Ins	INS	-	-	CA			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr10:105792467_105792468insCA	ENST00000353479.5	-	55	4692_4693	c.4402_4403insTG	c.(4402-4404)ggcfs	p.G1468fs	COL17A1_ENST00000369733.3_Frame_Shift_Ins_p.G1386fs	NM_000494.3	NP_000485.3	Q9UMD9	COHA1_HUMAN	collagen, type XVII, alpha 1	1468	Triple-helical region.				cell junction assembly (GO:0034329)|cell-matrix adhesion (GO:0007160)|collagen catabolic process (GO:0030574)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|hemidesmosome (GO:0030056)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				NS(1)|breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|liver(1)|lung(22)|ovary(5)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)	62		Colorectal(252;0.103)|Breast(234;0.122)		Epithelial(162;2.5e-09)|all cancers(201;7.94e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0165)		TCCTCGAGGGCCAGGTGGCCCA	0.55																																																	0																																										SO:0001589	frameshift_variant	0			M91669	CCDS7554.1	10q24.3	2013-01-16			ENSG00000065618	ENSG00000065618		"""Collagens"""	2194	protein-coding gene	gene with protein product		113811		BPAG2		7916703	Standard	NM_000494		Approved	BP180	uc001kxr.3	Q9UMD9	OTTHUMG00000018998	ENST00000353479.5:c.4401_4402dupTG	10.37:g.105792468_105792469dupCA	ENSP00000340937:p.Gly1468fs		Q02802|Q5JV36|Q99018|Q9NQK9|Q9UC14	Frame_Shift_Ins	INS	pfam_Collagen	p.G1468fs	ENST00000353479.5	37	c.4403_4402	CCDS7554.1	10																																																																																			COL17A1	-	pfam_Collagen	ENSG00000065618		0.550	COL17A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL17A1	HGNC	protein_coding	OTTHUMT00000050181.1		0.00	51	0	-	NM_130778, NM_000494		105792468	-1	tier1		no_errors	ENST00000353479	ensembl	human	known	74_37	frame_shift_ins	72.22	10	26	INS	1.000:0.998	CA
COL7A1	1294	genome.wustl.edu	37	3	48615783	48615783	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr3:48615783C>A	ENST00000328333.8	-	64	5610	c.5503G>T	c.(5503-5505)Gat>Tat	p.D1835Y	COL7A1_ENST00000454817.1_Missense_Mutation_p.D1835Y|MIR711_ENST00000390201.1_RNA	NM_000094.3	NP_000085.1	Q02388	CO7A1_HUMAN	collagen, type VII, alpha 1	1835	Triple-helical region.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	basement membrane (GO:0005604)|collagen type VII trimer (GO:0005590)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	serine-type endopeptidase inhibitor activity (GO:0004867)			NS(3)|breast(8)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(57)|ovary(7)|prostate(5)|skin(9)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(5)	137				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		GGTTTGCCATCCTCGCCTGGC	0.557																																																	0													111.0	96.0	101.0					3																	48615783		2203	4300	6503	SO:0001583	missense	0			L02870	CCDS2773.1	3p21.1	2014-09-17	2008-08-01		ENSG00000114270	ENSG00000114270		"""Collagens"", ""Fibronectin type III domain containing"""	2214	protein-coding gene	gene with protein product	"""collagen VII, alpha-1 polypeptide"", ""LC collagen"""	120120	"""epidermolysis bullosa, dystrophic, dominant and recessive"""	EBDCT, EBD1, EBR1		1871109	Standard	NM_000094		Approved		uc003ctz.2	Q02388	OTTHUMG00000133541	ENST00000328333.8:c.5503G>T	3.37:g.48615783C>A	ENSP00000332371:p.Asp1835Tyr		Q14054|Q16507	Missense_Mutation	SNP	pfam_Collagen,pfam_Fibronectin_type3,pfam_VWF_A,pfam_Prot_inh_Kunz-m,superfamily_Fibronectin_type3,superfamily_Prot_inh_Kunz-m,smart_VWF_A,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_VWF_A,pfscan_Prot_inh_Kunz-m,prints_Prot_inh_Kunz-m	p.D1835Y	ENST00000328333.8	37	c.5503	CCDS2773.1	3	.	.	.	.	.	.	.	.	.	.	C	17.72	3.459349	0.63401	.	.	ENSG00000114270	ENST00000328333;ENST00000454817	D;D	0.93426	-3.22;-1.82	5.2	5.2	0.72013	.	0.178262	0.27563	N	0.018810	D	0.96800	0.8955	M	0.85777	2.775	0.43368	D	0.995458	D	0.89917	1.0	D	0.91635	0.999	D	0.96708	0.9523	10	0.54805	T	0.06	.	15.598	0.76602	0.0:1.0:0.0:0.0	.	1835	Q02388	CO7A1_HUMAN	Y	1835	ENSP00000332371:D1835Y;ENSP00000412569:D1835Y	ENSP00000332371:D1835Y	D	-	1	0	COL7A1	48590787	0.995000	0.38212	1.000000	0.80357	0.980000	0.70556	3.310000	0.51911	2.698000	0.92095	0.563000	0.77884	GAT	COL7A1	-	NULL	ENSG00000114270		0.557	COL7A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL7A1	HGNC	protein_coding	OTTHUMT00000257519.1	-	0.00	41	0	C	NM_000094		48615783	-1	tier1	-	no_errors	ENST00000328333	ensembl	human	known	74_37	missense	75.00	6	18	SNP	1.000	A
CSGALNACT2	55454	genome.wustl.edu	37	10	43659419	43659419	+	Missense_Mutation	SNP	G	G	T	rs79064394		TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr10:43659419G>T	ENST00000374466.3	+	5	1421	c.1086G>T	c.(1084-1086)ttG>ttT	p.L362F		NM_018590.3	NP_061060.3	Q8N6G5	CGAT2_HUMAN	chondroitin sulfate N-acetylgalactosaminyltransferase 2	362					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|chondroitin sulfate proteoglycan biosynthetic process (GO:0050650)|chondroitin sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process (GO:0050653)|dermatan sulfate proteoglycan biosynthetic process (GO:0050651)|dermatan sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process (GO:0050652)|glycosaminoglycan metabolic process (GO:0030203)|proteoglycan biosynthetic process (GO:0030166)|small molecule metabolic process (GO:0044281)	Golgi cisterna membrane (GO:0032580)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)|membrane (GO:0016020)	acetylgalactosaminyltransferase activity (GO:0008376)|glucuronylgalactosylproteoglycan 4-beta-N-acetylgalactosaminyltransferase activity (GO:0047237)|metal ion binding (GO:0046872)	p.L362F(5)		endometrium(12)|kidney(3)|large_intestine(5)|lung(16)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	42						GAGAGGTCTTGATGTTTTTCT	0.433																																																	5	Substitution - Missense(5)	endometrium(4)|kidney(1)											223.0	221.0	222.0					10																	43659419		2203	4300	6503	SO:0001583	missense	0			AF116646	CCDS7201.1	10q11.21	2013-02-19			ENSG00000169826	ENSG00000169826		"""Beta 4-glycosyltransferases"""	24292	protein-coding gene	gene with protein product	"""chondroitin beta1,4 N-acetylgalactosaminyltransferase 2"""					12446672	Standard	NM_018590		Approved	GALNACT2, MGC40204, PRO0082, GALNACT-2	uc001jan.4	Q8N6G5	OTTHUMG00000018023	ENST00000374466.3:c.1086G>T	10.37:g.43659419G>T	ENSP00000363590:p.Leu362Phe		B3KWL7|Q6MZJ5|Q6MZP6|Q8TCH4|Q9P1I6	Missense_Mutation	SNP	pfam_Chond_GalNAc	p.L362F	ENST00000374466.3	37	c.1086	CCDS7201.1	10	.	.	.	.	.	.	.	.	.	.	G	24.2	4.499782	0.85176	.	.	ENSG00000169826	ENST00000374466	T	0.27256	1.68	6.08	5.17	0.71159	.	0.064535	0.64402	D	0.000004	T	0.57359	0.2048	M	0.89095	3.005	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.63721	-0.6573	10	0.87932	D	0	-11.7375	14.8306	0.70146	0.0683:0.0:0.9317:0.0	.	362	Q8N6G5	CGAT2_HUMAN	F	362	ENSP00000363590:L362F	ENSP00000363590:L362F	L	+	3	2	CSGALNACT2	42979425	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.683000	0.37638	2.894000	0.99253	0.591000	0.81541	TTG	CSGALNACT2	-	pfam_Chond_GalNAc	ENSG00000169826		0.433	CSGALNACT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSGALNACT2	HGNC	protein_coding	OTTHUMT00000047693.1		0.00	68	0	G	NM_018590		43659419	+1			no_errors	ENST00000374466	ensembl	human	known	74_37	missense	5.36	53	3	SNP	1.000	T
CSMD3	114788	genome.wustl.edu	37	8	113678609	113678609	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr8:113678609C>A	ENST00000297405.5	-	17	2957	c.2713G>T	c.(2713-2715)Gtg>Ttg	p.V905L	CSMD3_ENST00000455883.2_Missense_Mutation_p.V801L|CSMD3_ENST00000352409.3_Missense_Mutation_p.V905L|CSMD3_ENST00000343508.3_Missense_Mutation_p.V865L	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	905	CUB 5. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						GAGAGAATCACTCCACTGGGA	0.383										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																																							0													56.0	54.0	55.0					8																	113678609		2203	4300	6503	SO:0001583	missense	0			AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.2713G>T	8.37:g.113678609C>A	ENSP00000297405:p.Val905Leu		Q96PZ3	Missense_Mutation	SNP	pfam_CUB_dom,pfam_Sushi_SCR_CCP,superfamily_CUB_dom,superfamily_Sushi_SCR_CCP,smart_CUB_dom,smart_Sushi_SCR_CCP,pfscan_CUB_dom,pfscan_Sushi_SCR_CCP	p.V905L	ENST00000297405.5	37	c.2713	CCDS6315.1	8	.	.	.	.	.	.	.	.	.	.	C	15.27	2.784184	0.49997	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000339701;ENST00000455883;ENST00000352409	T;T;T;T;T	0.60424	0.19;0.19;0.19;0.19;0.19	6.1	2.12	0.27331	CUB (5);	0.086288	0.46145	N	0.000308	T	0.46541	0.1398	L	0.48935	1.535	0.26346	N	0.977288	B;B;B	0.11235	0.001;0.004;0.0	B;B;B	0.23574	0.009;0.047;0.011	T	0.33675	-0.9859	10	0.09084	T	0.74	.	12.2335	0.54500	0.1563:0.6491:0.1946:0.0	.	801;905;865	Q7Z407-3;Q7Z407;Q7Z407-2	.;CSMD3_HUMAN;.	L	865;905;245;801;905	ENSP00000345799:V865L;ENSP00000297405:V905L;ENSP00000341558:V245L;ENSP00000412263:V801L;ENSP00000343124:V905L	ENSP00000297405:V905L	V	-	1	0	CSMD3	113747785	0.998000	0.40836	0.975000	0.42487	0.998000	0.95712	1.515000	0.35845	0.094000	0.17404	0.650000	0.86243	GTG	CSMD3	-	pfam_CUB_dom,superfamily_CUB_dom,smart_CUB_dom,pfscan_CUB_dom	ENSG00000164796		0.383	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSMD3	HGNC	protein_coding	OTTHUMT00000347141.1	-	0.00	35	0	C	NM_052900		113678609	-1	tier1	-	no_errors	ENST00000297405	ensembl	human	known	74_37	missense	34.43	40	21	SNP	1.000	A
DARS2	55157	genome.wustl.edu	37	1	173807358	173807358	+	Missense_Mutation	SNP	T	T	G			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr1:173807358T>G	ENST00000361951.4	+	9	1528	c.801T>G	c.(799-801)gaT>gaG	p.D267E	DARS2_ENST00000239457.5_De_novo_Start_OutOfFrame	NM_018122.4	NP_060592.2	Q6PI48	SYDM_HUMAN	aspartyl-tRNA synthetase 2, mitochondrial	267					gene expression (GO:0010467)|mitochondrial asparaginyl-tRNA aminoacylation (GO:0070145)|tRNA aminoacylation (GO:0043039)|tRNA aminoacylation for protein translation (GO:0006418)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	aspartate-tRNA ligase activity (GO:0004815)|aspartate-tRNA(Asn) ligase activity (GO:0050560)|ATP binding (GO:0005524)|protein homodimerization activity (GO:0042803)|tRNA binding (GO:0000049)			breast(4)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(4)|lung(10)|ovary(1)|pancreas(1)|urinary_tract(1)	30					L-Aspartic Acid(DB00128)	GTTATCGAGATGAAGGTTCAA	0.333																																																	0													133.0	126.0	128.0					1																	173807358		2203	4300	6503	SO:0001583	missense	0			AK022754	CCDS1311.1	1q25.1	2011-07-01	2007-02-23		ENSG00000117593	ENSG00000117593	6.1.1.12	"""Aminoacyl tRNA synthetases / Class II"""	25538	protein-coding gene	gene with protein product	"""aspartate tRNA ligase 2, mitochondrial"""	610956				15779907	Standard	NM_018122		Approved	FLJ10514	uc001gjh.2	Q6PI48	OTTHUMG00000034803	ENST00000361951.4:c.801T>G	1.37:g.173807358T>G	ENSP00000355086:p.Asp267Glu			Missense_Mutation	SNP	pfam_aa-tRNA-synt_II,pfam_GAD_dom,pfam_NA-bd_OB_tRNA,superfamily_GAD_dom,superfamily_NA-bd_OB-fold,pfscan_aa-tRNA-synth_II,prints_Asp/Asn-tRNA-synth_IIb,prints_Lys-tRNA-synth_II_C,tigrfam_Asp-tRNA-ligase_IIb_bac/mt	p.D267E	ENST00000361951.4	37	c.801	CCDS1311.1	1	.	.	.	.	.	.	.	.	.	.	T	23.0	4.367675	0.82463	.	.	ENSG00000117593	ENST00000361951	D	0.85258	-1.96	5.68	2.14	0.27477	Aminoacyl-tRNA synthetase, class II (1);Aminoacyl-tRNA synthetase, class II (D/K/N) (1);	0.000000	0.85682	D	0.000000	D	0.93416	0.7900	H	0.98833	4.345	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.92105	0.5691	10	0.87932	D	0	-21.1225	8.6193	0.33851	0.0:0.2247:0.0:0.7753	.	267	Q6PI48	SYDM_HUMAN	E	267	ENSP00000355086:D267E	ENSP00000355086:D267E	D	+	3	2	DARS2	172073981	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	0.856000	0.27818	0.120000	0.18254	0.455000	0.32223	GAT	DARS2	-	pfam_aa-tRNA-synt_II,pfscan_aa-tRNA-synth_II,prints_Asp/Asn-tRNA-synth_IIb,prints_Lys-tRNA-synth_II_C,tigrfam_Asp-tRNA-ligase_IIb_bac/mt	ENSG00000117593		0.333	DARS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DARS2	HGNC	protein_coding	OTTHUMT00000084220.1	-	0.00	56	0	T	NM_018122		173807358	+1	tier1	-	no_errors	ENST00000361951	ensembl	human	known	74_37	missense	21.57	40	11	SNP	1.000	G
DAZAP2	9802	genome.wustl.edu	37	12	51634217	51634218	+	Frame_Shift_Ins	INS	-	-	T			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr12:51634217_51634218insT	ENST00000412716.3	+	2	720_721	c.104_105insT	c.(103-108)tataccfs	p.T36fs	DAZAP2_ENST00000549555.1_Frame_Shift_Ins_p.T36fs|DAZAP2_ENST00000449723.3_Frame_Shift_Ins_p.T36fs|DAZAP2_ENST00000425012.2_Frame_Shift_Ins_p.T36fs|DAZAP2_ENST00000439799.2_Frame_Shift_Ins_p.T36fs|DAZAP2_ENST00000551534.1_3'UTR|DAZAP2_ENST00000604900.1_Frame_Shift_Ins_p.T36fs|DAZAP2_ENST00000549732.2_Frame_Shift_Ins_p.T36fs|DAZAP2_ENST00000551313.1_5'UTR			Q15038	DAZP2_HUMAN	DAZ associated protein 2	36	Pro-rich.					cytoplasm (GO:0005737)|nucleus (GO:0005634)	WW domain binding (GO:0050699)			haematopoietic_and_lymphoid_tissue(3)|lung(2)|urinary_tract(1)	6						GCTCCACCCTATACCGATGCTC	0.5																																																	0																																										SO:0001589	frameshift_variant	0			D31767	CCDS8809.1, CCDS44884.1, CCDS44885.1, CCDS44886.1, CCDS44887.1, CCDS44888.1	12q13.13	2012-04-04			ENSG00000183283	ENSG00000183283			2684	protein-coding gene	gene with protein product		607431				10857750, 7584044	Standard	NM_014764		Approved	KIAA0058	uc010snd.2	Q15038	OTTHUMG00000169649	ENST00000412716.3:c.105dupT	12.37:g.51634218_51634218dupT	ENSP00000394699:p.Thr36fs		A8K254|B4DDT5|B4E1G3|C9JA96|C9JP84|E9PB45|F8VU62	Frame_Shift_Ins	INS	pfam_DAZ_assoc-2	p.T36fs	ENST00000412716.3	37	c.104_105	CCDS8809.1	12																																																																																			DAZAP2	-	pfam_DAZ_assoc-2	ENSG00000183283		0.500	DAZAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DAZAP2	HGNC	protein_coding	OTTHUMT00000405259.2		0.00	61	0	-	NM_014764		51634218	+1	tier1		no_errors	ENST00000549555	ensembl	human	known	74_37	frame_shift_ins	43.64	31	24	INS	1.000:1.000	T
DGCR2	9993	genome.wustl.edu	37	22	19052582	19052582	+	Splice_Site	SNP	T	T	C			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr22:19052582T>C	ENST00000263196.7	-	4	576		c.e4-2		DGCR2_ENST00000537045.1_Splice_Site|DGCR2_ENST00000545799.1_Intron|DGCR2_ENST00000473832.1_Intron	NM_001184781.1|NM_005137.2	NP_001171710.1|NP_005128.1	P98153	IDD_HUMAN	DiGeorge syndrome critical region gene 2						cell adhesion (GO:0007155)|cognition (GO:0050890)|organ morphogenesis (GO:0009887)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(9)|ovary(1)|skin(1)	18	Colorectal(54;0.0993)					CTAGGAAACATAAAGGACAGA	0.547																																																	0													26.0	23.0	24.0					22																	19052582		2203	4300	6503	SO:0001630	splice_region_variant	0			D79985	CCDS33598.1, CCDS54496.1	22q11.21	2008-06-12			ENSG00000070413	ENSG00000070413			2845	protein-coding gene	gene with protein product	"""integral membrane protein DGCR2"""	600594				7655455, 8630060	Standard	NM_005137		Approved	KIAA0163, LAN, IDD, DGS-C, SEZ-12	uc002zoq.1	P98153	OTTHUMG00000150141	ENST00000263196.7:c.329-2A>G	22.37:g.19052582T>C			A6NIB5|A8K6K5|B5TY34|B7Z935	Splice_Site	SNP	-	e4-2	ENST00000263196.7	37	c.329-2	CCDS33598.1	22	.	.	.	.	.	.	.	.	.	.	T	18.98	3.737462	0.69304	.	.	ENSG00000070413	ENST00000537045;ENST00000263196;ENST00000447928	.	.	.	5.17	5.17	0.71159	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.7087	0.69211	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	DGCR2	17432582	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	4.055000	0.57441	1.956000	0.56807	0.383000	0.25322	.	DGCR2	-	-	ENSG00000070413		0.547	DGCR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	DGCR2	HGNC	protein_coding	OTTHUMT00000316504.1	-	0.00	15	0	T	NM_005137	Intron	19052582	-1	tier1	-	no_errors	ENST00000263196	ensembl	human	known	74_37	splice_site	52.94	8	9	SNP	1.000	C
DIO2	1734	genome.wustl.edu	37	14	80669418	80669418	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr14:80669418G>T	ENST00000557010.1	-	4	821	c.436C>A	c.(436-438)Ctg>Atg	p.L146M	DIO2_ENST00000557125.1_Missense_Mutation_p.N20K|DIO2_ENST00000555750.1_Missense_Mutation_p.L182M|DIO2_ENST00000438257.4_Missense_Mutation_p.L146M|DIO2_ENST00000422005.3_3'UTR	NM_000793.5|NM_001242502.1|NM_001242503.1	NP_000784.2|NP_001229431.1|NP_001229432.1	Q92813	IOD2_HUMAN	deiodinase, iodothyronine, type II	146					cellular nitrogen compound metabolic process (GO:0034641)|hormone biosynthetic process (GO:0042446)|selenocysteine incorporation (GO:0001514)|small molecule metabolic process (GO:0044281)|thyroid hormone generation (GO:0006590)|thyroid hormone metabolic process (GO:0042403)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	selenium binding (GO:0008430)|thyroxine 5'-deiodinase activity (GO:0004800)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(14)|skin(1)|stomach(1)	25				BRCA - Breast invasive adenocarcinoma(234;0.0281)		TCTTCCACCAGTTTGCGGAAG	0.567											OREG0022848	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													52.0	56.0	55.0					14																	80669418		2082	4229	6311	SO:0001583	missense	0			AF007144	CCDS45146.1, CCDS55934.1	14q24.2-q24.3	2014-05-02			ENSG00000211448	ENSG00000211448	1.97.1.10		2884	protein-coding gene	gene with protein product	"""thyroxine deiodinase, type II"", ""deiodonase-2"", ""deiodinase-2"""	601413				8755651, 10343107	Standard	NM_001007023		Approved	TXDI2, SelY	uc021rxb.1	Q92813	OTTHUMG00000171443	ENST00000557010.1:c.436C>A	14.37:g.80669418G>T	ENSP00000451419:p.Leu146Met	1200	B9EGK0|G3V315|Q6B0A3|Q9HCP8|Q9P1W4|Q9UDZ1	Missense_Mutation	SNP	NULL	p.N20K	ENST00000557010.1	37	c.60	CCDS45146.1	14	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.21|13.21	2.169652|2.169652	0.38315|0.38315	.|.	.|.	ENSG00000211448|ENSG00000211448	ENST00000438257;ENST00000557010;ENST00000555750|ENST00000557125	T;T;T|.	0.52295|.	0.67;0.67;0.67|.	5.67|5.67	4.77|4.77	0.60923|0.60923	Thioredoxin-like fold (1);|.	0.139961|.	0.31167|.	N|.	0.008128|.	T|T	0.63189|0.63189	0.2490|0.2490	L|L	0.50333|0.50333	1.59|1.59	0.80722|0.80722	D|D	1|1	P;P;P|.	0.52316|.	0.717;0.76;0.952|.	B;B;P|.	0.45310|.	0.243;0.357;0.476|.	T|T	0.60900|0.60900	-0.7171|-0.7171	10|5	0.41790|.	T|.	0.15|.	.|.	15.0079|15.0079	0.71527|0.71527	0.0694:0.0:0.9306:0.0|0.0694:0.0:0.9306:0.0	.|.	182;146;182|.	Q92813-2;Q92813;G3V315|.	.;IOD2_HUMAN;.|.	M|K	146;146;182|20	ENSP00000405854:L146M;ENSP00000451419:L146M;ENSP00000450980:L182M|.	ENSP00000405854:L146M|.	L|N	-|-	1|3	2|2	DIO2|DIO2	79739171|79739171	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	1.999000|1.999000	0.40806|0.40806	1.372000|1.372000	0.46190|0.46190	0.585000|0.585000	0.79938|0.79938	CTG|AAC	DIO2	-	NULL	ENSG00000211448		0.567	DIO2-001	KNOWN	basic|appris_principal|CCDS|seleno	protein_coding	DIO2	HGNC	protein_coding	OTTHUMT00000413428.2	-	0.00	35	0	G			80669418	-1	tier1	-	no_errors	ENST00000557125	ensembl	human	putative	74_37	missense	54.17	11	13	SNP	1.000	T
DMD	1756	genome.wustl.edu	37	X	32472792	32472792	+	Missense_Mutation	SNP	A	A	T			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chrX:32472792A>T	ENST00000357033.4	-	26	3796	c.3590T>A	c.(3589-3591)gTt>gAt	p.V1197D	DMD_ENST00000378677.2_Missense_Mutation_p.V1193D	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin	1197			V -> F (in dbSNP:rs1800262). {ECO:0000269|PubMed:2668885}.		cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				CATCTCTTCAACTGCTTTCTG	0.308																																																	0													82.0	78.0	79.0					X																	32472792		2201	4300	6501	SO:0001583	missense	0			AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.3590T>A	X.37:g.32472792A>T	ENSP00000354923:p.Val1197Asp		E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_EF-hand_dom_typ1,pfam_EF-hand_dom_typ2,pfam_CH-domain,pfam_Znf_ZZ,pfam_WW_dom,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_WW_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_WW_dom,smart_Znf_ZZ,pirsf_Dystrophin/utrophin,pfscan_CH-domain,pfscan_WW_dom,pfscan_Znf_ZZ	p.V1197D	ENST00000357033.4	37	c.3590	CCDS14233.1	X	.	.	.	.	.	.	.	.	.	.	A	20.7	4.041706	0.75732	.	.	ENSG00000198947	ENST00000534884;ENST00000378677;ENST00000357033;ENST00000542849;ENST00000535280	T;T	0.35789	1.29;1.29	5.25	5.25	0.73442	.	0.000000	0.33496	U	0.004856	T	0.48077	0.1480	L	0.32530	0.975	0.80722	D	1	D;D;D	0.71674	0.99;0.998;0.992	P;D;D	0.68483	0.885;0.958;0.93	T	0.49123	-0.8972	10	0.59425	D	0.04	.	14.2916	0.66281	1.0:0.0:0.0:0.0	.	1189;1197;1193	P11532-4;P11532;E9PDN5	.;DMD_HUMAN;.	D	1189;1193;1197;1197;1074	ENSP00000367948:V1193D;ENSP00000354923:V1197D	ENSP00000354923:V1197D	V	-	2	0	DMD	32382713	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	9.212000	0.95126	1.753000	0.51906	0.481000	0.45027	GTT	DMD	-	pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin,pirsf_Dystrophin/utrophin	ENSG00000198947		0.308	DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DMD	HGNC	protein_coding	OTTHUMT00000056182.2	-	0.00	28	0	A	NM_004006		32472792	-1	tier1	-	no_errors	ENST00000357033	ensembl	human	known	74_37	missense	25.00	12	4	SNP	1.000	T
DNAJC1	64215	genome.wustl.edu	37	10	22208845	22208845	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr10:22208845C>A	ENST00000376980.3	-	5	841	c.551G>T	c.(550-552)aGt>aTt	p.S184I		NM_022365.3	NP_071760.2	Q96KC8	DNJC1_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 1	184					negative regulation of proteolysis (GO:0045861)|positive regulation of ATPase activity (GO:0032781)|protein folding (GO:0006457)|regulation of protein secretion (GO:0050708)|regulation of translation (GO:0006417)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	ATPase activator activity (GO:0001671)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)			cervix(1)|endometrium(1)|large_intestine(2)|lung(13)|skin(2)|upper_aerodigestive_tract(2)	21		Breast(68;0.00869)|Prostate(175;0.0181)|Lung SC(717;0.0262)				CTTTTTTCTACTTAGTAGTTC	0.338																																																	0													81.0	85.0	84.0					10																	22208845		2201	4292	6493	SO:0001583	missense	0			AK026062	CCDS7136.1	10p11.23	2011-09-02			ENSG00000136770	ENSG00000136770		"""Heat shock proteins / DNAJ (HSP40)"""	20090	protein-coding gene	gene with protein product		611207					Standard	NM_022365		Approved	DNAJL1, ERdj1, MTJ1	uc001irc.3	Q96KC8	OTTHUMG00000017800	ENST00000376980.3:c.551G>T	10.37:g.22208845C>A	ENSP00000366179:p.Ser184Ile		B0YIZ8|Q5VX89|Q9H6B8	Missense_Mutation	SNP	pfam_DnaJ_domain,pfam_SANT/Myb,superfamily_DnaJ_domain,superfamily_Homeodomain-like,smart_DnaJ_domain,smart_SANT/Myb,pfscan_Myb-like_dom,pfscan_DnaJ_domain,prints_DnaJ_domain	p.S184I	ENST00000376980.3	37	c.551	CCDS7136.1	10	.	.	.	.	.	.	.	.	.	.	C	19.91	3.914978	0.72983	.	.	ENSG00000136770	ENST00000376980	T	0.55052	0.54	5.7	5.7	0.88788	.	0.160788	0.64402	D	0.000001	T	0.68403	0.2997	M	0.67953	2.075	0.80722	D	1	D	0.62365	0.991	P	0.57620	0.824	T	0.67983	-0.5529	10	0.49607	T	0.09	-1.3244	19.8436	0.96701	0.0:1.0:0.0:0.0	.	184	Q96KC8	DNJC1_HUMAN	I	184	ENSP00000366179:S184I	ENSP00000366179:S184I	S	-	2	0	DNAJC1	22248851	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.282000	0.51693	2.695000	0.91970	0.650000	0.86243	AGT	DNAJC1	-	NULL	ENSG00000136770		0.338	DNAJC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAJC1	HGNC	protein_coding	OTTHUMT00000047149.1	-	0.00	28	0	C	NM_022365		22208845	-1	tier1	-	no_errors	ENST00000376980	ensembl	human	known	74_37	missense	9.52	38	4	SNP	1.000	A
DNAJC13	23317	genome.wustl.edu	37	3	132169648	132169648	+	Missense_Mutation	SNP	A	A	G			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr3:132169648A>G	ENST00000260818.6	+	6	742	c.494A>G	c.(493-495)tAt>tGt	p.Y165C	DNAJC13_ENST00000486798.1_3'UTR	NM_015268.3	NP_056083.3	O75165	DJC13_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 13	165					osteoblast differentiation (GO:0001649)	extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)				breast(4)|endometrium(2)|kidney(2)|large_intestine(5)|lung(15)|ovary(1)|pancreas(2)|prostate(2)|urinary_tract(1)	34						CTCTCAGATTATCAAGGAGGA	0.333																																																	0													52.0	58.0	56.0					3																	132169648		2203	4300	6503	SO:0001583	missense	0			AB014578	CCDS33857.1	3q22.1	2011-09-02			ENSG00000138246	ENSG00000138246		"""Heat shock proteins / DNAJ (HSP40)"""	30343	protein-coding gene	gene with protein product		614334				12438707	Standard	NM_015268		Approved	RME8, KIAA0678	uc003eor.3	O75165	OTTHUMG00000159674	ENST00000260818.6:c.494A>G	3.37:g.132169648A>G	ENSP00000260818:p.Tyr165Cys		Q3L0T1|Q6PI82|Q6UJ77|Q6ZSW1|Q6ZUT5|Q86XG3|Q96DC1|Q9BWK9	Missense_Mutation	SNP	pfam_DnaJ_domain,superfamily_ARM-type_fold,superfamily_GYF,smart_DnaJ_domain,pfscan_DnaJ_domain	p.Y165C	ENST00000260818.6	37	c.494	CCDS33857.1	3	.	.	.	.	.	.	.	.	.	.	A	12.48	1.949392	0.34377	.	.	ENSG00000138246	ENST00000260818	T	0.43688	0.94	5.79	4.64	0.57946	.	0.065353	0.64402	N	0.000006	T	0.35068	0.0919	L	0.42744	1.35	0.58432	D	0.999999	B;B	0.09022	0.0;0.002	B;B	0.06405	0.0;0.002	T	0.08554	-1.0716	10	0.37606	T	0.19	.	11.7252	0.51706	0.9313:0.0:0.0687:0.0	.	165;165	A7E2Y5;O75165	.;DJC13_HUMAN	C	165	ENSP00000260818:Y165C	ENSP00000260818:Y165C	Y	+	2	0	DNAJC13	133652338	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.231000	0.78106	1.020000	0.39573	0.533000	0.62120	TAT	DNAJC13	-	NULL	ENSG00000138246		0.333	DNAJC13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAJC13	HGNC	protein_coding	OTTHUMT00000356807.2	-	0.00	19	0	A	NM_015268		132169648	+1	tier1	-	no_errors	ENST00000260818	ensembl	human	known	74_37	missense	80.00	11	44	SNP	1.000	G
DTL	51514	genome.wustl.edu	37	1	212241588	212241588	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr1:212241588C>T	ENST00000366991.4	+	9	1050	c.736C>T	c.(736-738)Cgt>Tgt	p.R246C	DTL_ENST00000475419.1_Intron|DTL_ENST00000542077.1_Missense_Mutation_p.R204C	NM_016448.2	NP_057532.2	Q9NZJ0	DTL_HUMAN	denticleless E3 ubiquitin protein ligase homolog (Drosophila)	246					cellular response to DNA damage stimulus (GO:0006974)|DNA replication (GO:0006260)|G2 DNA damage checkpoint (GO:0031572)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|regulation of cell cycle (GO:0051726)|response to UV (GO:0009411)|translesion synthesis (GO:0019985)|ubiquitin-dependent protein catabolic process (GO:0006511)	centrosome (GO:0005813)|chromosome (GO:0005694)|Cul4A-RING E3 ubiquitin ligase complex (GO:0031464)|Cul4B-RING E3 ubiquitin ligase complex (GO:0031465)|cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)				breast(3)|central_nervous_system(1)|endometrium(3)|large_intestine(6)|lung(6)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	23				OV - Ovarian serous cystadenocarcinoma(81;0.00796)|all cancers(67;0.0385)|Epithelial(68;0.102)		ATGGGATTTACGTAAGAATTA	0.373																																																	0													87.0	84.0	85.0					1																	212241588		2203	4300	6503	SO:0001583	missense	0			AF195765	CCDS1502.1, CCDS65778.1	1q32	2013-01-10	2012-02-23		ENSG00000143476	ENSG00000143476		"""DDB1 and CUL4 associated factors"", ""WD repeat domain containing"""	30288	protein-coding gene	gene with protein product	"""RA regulated nuclear matrix associated protein"", ""DDB1 and CUL4 associated factor 2"""	610617	"""denticleless homolog (Drosophila)"""			11278750	Standard	NM_001286229		Approved	RAMP, L2DTL, DCAF2	uc009xdc.3	Q9NZJ0	OTTHUMG00000037133	ENST00000366991.4:c.736C>T	1.37:g.212241588C>T	ENSP00000355958:p.Arg246Cys		A8K8H8|D3DT98|Q5VT77|Q96SN0|Q9NW03|Q9NW34|Q9NWM5	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.R246C	ENST00000366991.4	37	c.736	CCDS1502.1	1	.	.	.	.	.	.	.	.	.	.	C	19.13	3.768431	0.69878	.	.	ENSG00000143476	ENST00000366991;ENST00000542077	T;T	0.23754	1.89;1.89	5.58	4.67	0.58626	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.55673	0.1935	M	0.91196	3.185	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.62506	-0.6840	10	0.66056	D	0.02	-12.4337	8.8354	0.35109	0.1483:0.7749:0.0:0.0768	.	204;246	F5GZ90;Q9NZJ0	.;DTL_HUMAN	C	246;204	ENSP00000355958:R246C;ENSP00000443870:R204C	ENSP00000355958:R246C	R	+	1	0	DTL	210308211	1.000000	0.71417	0.948000	0.38648	0.983000	0.72400	3.473000	0.53122	1.491000	0.48482	0.637000	0.83480	CGT	DTL	-	superfamily_WD40_repeat_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000143476		0.373	DTL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DTL	HGNC	protein_coding	OTTHUMT00000090182.1	-	0.00	71	0	C	NM_016448		212241588	+1	tier1	-	no_errors	ENST00000366991	ensembl	human	known	74_37	missense	27.59	42	16	SNP	1.000	T
DYSF	8291	genome.wustl.edu	37	2	71896314	71896314	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr2:71896314G>T	ENST00000258104.3	+	49	5779	c.5502G>T	c.(5500-5502)aaG>aaT	p.K1834N	DYSF_ENST00000413539.2_Missense_Mutation_p.K1865N|DYSF_ENST00000409744.1_Missense_Mutation_p.K1842N|DYSF_ENST00000394120.2_Missense_Mutation_p.K1835N|DYSF_ENST00000410020.3_Missense_Mutation_p.K1873N|DYSF_ENST00000409582.3_Missense_Mutation_p.K1872N|DYSF_ENST00000429174.2_Missense_Mutation_p.K1855N|DYSF_ENST00000410041.1_Missense_Mutation_p.K1852N|DYSF_ENST00000479049.2_3'UTR|DYSF_ENST00000409366.1_Missense_Mutation_p.K1856N|DYSF_ENST00000409762.1_Missense_Mutation_p.K1851N|DYSF_ENST00000409651.1_Missense_Mutation_p.K1866N	NM_001130976.1|NM_003494.3	NP_001124448.1|NP_003485.1	O75923	DYSF_HUMAN	dysferlin	1834	C2 7. {ECO:0000255|PROSITE- ProRule:PRU00041}.				plasma membrane repair (GO:0001778)|vesicle fusion (GO:0006906)	cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|phospholipid binding (GO:0005543)			autonomic_ganglia(2)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|lung(57)|ovary(3)|pancreas(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(2)	111						CGGGGGAGAAGATGAGCGACA	0.552																																																	0													60.0	54.0	56.0					2																	71896314		2203	4300	6503	SO:0001583	missense	0			AF075575	CCDS1918.1, CCDS46323.1, CCDS46324.1, CCDS46325.1, CCDS46326.1, CCDS46327.1, CCDS46328.1, CCDS46329.1, CCDS46330.1, CCDS46331.1, CCDS46332.1	2p13.3	2014-09-17	2013-09-12		ENSG00000135636	ENSG00000135636			3097	protein-coding gene	gene with protein product	"""fer-1-like family member 1"""	603009	"""limb girdle muscular dystrophy 2B (autosomal recessive)"""	LGMD2B		8320700	Standard	NM_003494		Approved	FER1L1	uc010fen.3	O75923	OTTHUMG00000129757	ENST00000258104.3:c.5502G>T	2.37:g.71896314G>T	ENSP00000258104:p.Lys1834Asn		A0FK00|B1PZ70|B1PZ71|B1PZ72|B1PZ73|B1PZ74|B1PZ75|B1PZ76|B1PZ77|B1PZ78|B1PZ79|B1PZ80|B1PZ81|B3KQB9|O75696|Q09EX5|Q0H395|Q53QY3|Q53TD2|Q8TEL8|Q9UEN7	Missense_Mutation	SNP	pfam_C2_dom,pfam_Ferlin_B-domain,pfam_FerIin-domain,pfam_Ferlin_A-domain,superfamily_C2_dom,superfamily_MFS_dom_general_subst_transpt,smart_C2_dom,smart_Peroxin/Ferlin,pfscan_C2_dom	p.K1865N	ENST00000258104.3	37	c.5595	CCDS1918.1	2	.	.	.	.	.	.	.	.	.	.	G	17.78	3.474257	0.63737	.	.	ENSG00000135636	ENST00000413539;ENST00000409762;ENST00000409582;ENST00000429174;ENST00000258104;ENST00000409651;ENST00000394120;ENST00000409744;ENST00000409366;ENST00000410020;ENST00000410041	D;D;D;D;D;D;D;D;D;D;D	0.86562	-2.14;-2.14;-2.14;-2.14;-2.14;-2.14;-2.14;-2.14;-2.14;-2.14;-2.14	5.38	4.5	0.54988	C2 calcium-dependent membrane targeting (1);C2 calcium/lipid-binding domain, CaLB (1);	0.094256	0.85682	D	0.000000	D	0.88325	0.6406	L	0.39514	1.22	0.50171	D	0.999852	B;D;D;D;D;B;B;B;B;D;B;B;D;D;D	0.60575	0.05;0.968;0.985;0.985;0.985;0.017;0.017;0.017;0.086;0.985;0.079;0.22;0.971;0.985;0.988	B;P;P;P;P;B;B;B;B;P;B;B;P;P;D	0.65323	0.058;0.856;0.892;0.892;0.892;0.051;0.034;0.051;0.051;0.892;0.034;0.217;0.892;0.892;0.934	D	0.86469	0.1784	10	0.37606	T	0.19	-34.1086	9.9393	0.41570	0.0941:0.0:0.9059:0.0	.	598;1866;1873;1856;1821;1852;1842;1851;1841;1865;1872;1855;1820;1835;1834	B7Z8G4;O75923-8;O75923-13;O75923-10;O75923-9;O75923-11;O75923-12;O75923-5;O75923-6;O75923-2;O75923-7;O75923-4;O75923-3;O75923-14;O75923	.;.;.;.;.;.;.;.;.;.;.;.;.;.;DYSF_HUMAN	N	1865;1851;1872;1855;1834;1866;1835;1842;1856;1873;1852	ENSP00000407046:K1865N;ENSP00000387137:K1851N;ENSP00000386547:K1872N;ENSP00000398305:K1855N;ENSP00000258104:K1834N;ENSP00000386683:K1866N;ENSP00000377678:K1835N;ENSP00000386285:K1842N;ENSP00000386512:K1856N;ENSP00000386881:K1873N;ENSP00000386617:K1852N	ENSP00000258104:K1834N	K	+	3	2	DYSF	71749822	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	2.797000	0.47877	1.273000	0.44346	0.650000	0.86243	AAG	DYSF	-	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom	ENSG00000135636		0.552	DYSF-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	DYSF	HGNC	protein_coding	OTTHUMT00000251970.3	-	0.00	46	0	G	NM_003494		71896314	+1	tier1	-	no_errors	ENST00000413539	ensembl	human	known	74_37	missense	25.00	27	9	SNP	1.000	T
CRACR2B	283229	genome.wustl.edu	37	11	829507	829508	+	Frame_Shift_Ins	INS	-	-	G			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr11:829507_829508insG	ENST00000525077.1	+	3	526_527	c.425_426insG	c.(424-429)ctggagfs	p.E143fs	AP006621.8_ENST00000532946.1_RNA|EFCAB4A_ENST00000450448.1_Frame_Shift_Ins_p.E143fs|EFCAB4A_ENST00000528542.2_Frame_Shift_Ins_p.E143fs			Q8N4Y2	EFC4A_HUMAN		143					cellular protein localization (GO:0034613)|regulation of store-operated calcium entry (GO:2001256)|store-operated calcium entry (GO:0002115)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)			endometrium(1)|large_intestine(1)|lung(1)	3		all_cancers(49;2.31e-08)|all_epithelial(84;3.72e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.179)|all_lung(207;0.227)		all cancers(45;1.45e-25)|Epithelial(43;1.17e-24)|OV - Ovarian serous cystadenocarcinoma(40;6.76e-19)|BRCA - Breast invasive adenocarcinoma(625;4.23e-05)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		CACACTGTGCTGGAGCAGCTGG	0.673																																																	0																																										SO:0001589	frameshift_variant	0																														ENST00000525077.1:c.427dupG	11.37:g.829509_829509dupG	ENSP00000435299:p.Glu143fs		D5LPR2|Q8NBW8	Frame_Shift_Ins	INS	pfscan_EF_hand_dom	p.E143fs	ENST00000525077.1	37	c.425_426		11																																																																																			EFCAB4A	-	NULL	ENSG00000177685		0.673	EFCAB4A-007	NOVEL	basic|appris_principal	protein_coding	EFCAB4A	HGNC	protein_coding	OTTHUMT00000383097.1		0.00	58	0	-			829508	+1	tier1		no_errors	ENST00000450448	ensembl	human	known	74_37	frame_shift_ins	18.87	43	10	INS	0.928:0.997	G
EFTUD1P1	648809	genome.wustl.edu	37	15	84789874	84789874	+	IGR	SNP	G	G	T			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr15:84789874G>T								EFTUD1P1 (7446 upstream) : RP13-262C2.3 (50055 downstream)																							GCTCAGAGACGTGAGCGTGCA	0.498																																																	0																																										SO:0001628	intergenic_variant	0																															15.37:g.84789874G>T				RNA	SNP	-	NULL		37	NULL		15																																																																																			EFTUD1P1	-	-	ENSG00000259404	0	0.498					EFTUD1P1	HGNC			-	0.00	47	0	G			84789874	+1	tier1	-	no_errors	ENST00000560381	ensembl	human	known	74_37	rna	23.08	40	12	SNP	0.985	T
EGR2	1959	genome.wustl.edu	37	10	64575631	64575631	+	Silent	SNP	T	T	G			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr10:64575631T>G	ENST00000242480.3	-	1	484	c.159A>C	c.(157-159)ggA>ggC	p.G53G	EGR2_ENST00000411732.1_Silent_p.G3G|EGR2_ENST00000439032.1_Silent_p.G53G|EGR2_ENST00000493899.2_5'UTR	NM_000399.3|NM_001136177.1	NP_000390.2|NP_001129649.1	P11161	EGR2_HUMAN	early growth response 2	53					brain development (GO:0007420)|brain segmentation (GO:0035284)|cell death (GO:0008219)|cellular response to cAMP (GO:0071320)|cellular response to gonadotropin stimulus (GO:0071371)|facial nerve structural organization (GO:0021612)|fat cell differentiation (GO:0045444)|learning or memory (GO:0007611)|motor neuron axon guidance (GO:0008045)|myelination (GO:0042552)|negative regulation of apoptotic process (GO:0043066)|peripheral nervous system development (GO:0007422)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein export from nucleus (GO:0006611)|protein sumoylation (GO:0016925)|regulation of neuronal synaptic plasticity (GO:0048168)|regulation of ossification (GO:0030278)|response to insulin (GO:0032868)|rhombomere 3 formation (GO:0021660)|rhombomere 5 formation (GO:0021666)|rhythmic behavior (GO:0007622)|Schwann cell differentiation (GO:0014037)|skeletal muscle cell differentiation (GO:0035914)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|ligase activity (GO:0016874)|metal ion binding (GO:0046872)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)			endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(10)|lung(13)|ovary(2)|prostate(4)|upper_aerodigestive_tract(1)	36	Prostate(12;0.0297)|all_hematologic(501;0.228)					CTCCGGCCACTCCGTTCATCT	0.647																																																	0													62.0	60.0	61.0					10																	64575631		2203	4300	6503	SO:0001819	synonymous_variant	0			BC035625	CCDS7267.1, CCDS44409.1	10q21.1	2014-09-17	2009-04-23		ENSG00000122877	ENSG00000122877		"""Zinc fingers, C2H2-type"""	3239	protein-coding gene	gene with protein product	"""Krox-20 homolog, Drosophila"""	129010	"""early growth response 2 (Krox-20 homolog, Drosophila)"""	KROX20			Standard	NM_000399		Approved		uc001jmi.3	P11161	OTTHUMG00000018308	ENST00000242480.3:c.159A>C	10.37:g.64575631T>G			B2R724|B3KRD7|Q68CZ5|Q8IV26|Q9UNA6	Silent	SNP	pfam_DUF3446,pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.G53	ENST00000242480.3	37	c.159	CCDS7267.1	10																																																																																			EGR2	-	NULL	ENSG00000122877		0.647	EGR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EGR2	HGNC	protein_coding	OTTHUMT00000048245.2	-	0.00	16	0	T	NM_000399		64575631	-1	tier1	-	no_errors	ENST00000242480	ensembl	human	known	74_37	silent	93.33	1	14	SNP	1.000	G
ELFN2	114794	genome.wustl.edu	37	22	37771876	37771877	+	5'UTR	INS	-	-	CCT	rs553606382|rs142158248|rs370069619	byFrequency	TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr22:37771876_37771877insCCT	ENST00000402918.2	-	0	483_484				RP1-63G5.5_ENST00000430883.1_RNA|RP1-63G5.8_ENST00000609322.1_RNA|ELFN2_ENST00000435824.1_5'UTR	NM_052906.3	NP_443138.2	Q5R3F8	PPR29_HUMAN	extracellular leucine-rich repeat and fibronectin type III domain containing 2						negative regulation of phosphatase activity (GO:0010923)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	phosphatase binding (GO:0019902)|protein phosphatase inhibitor activity (GO:0004864)			NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(13)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	35	Melanoma(58;0.0574)					GACTtcctctccctcctcctcc	0.634														1306	0.260783	0.2088	0.2161	5008	,	,		16480	0.3343		0.2763	False		,,,				2504	0.271																0																																										SO:0001623	5_prime_UTR_variant	0			BC041596	CCDS33642.1	22q13.1	2013-02-11	2011-10-27	2011-10-27	ENSG00000166897	ENSG00000166897		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Fibronectin type III domain containing"""	29396	protein-coding gene	gene with protein product			"""leucine rich repeat containing 62"", ""extracellular leucine-rich repeat and fibronectin type III containing 2"", ""extracellular leucine-rich repeat and fibronectin type III domain containing 2"", ""protein phosphatase 1, regulatory subunit 29"""	LRRC62, PPP1R29		17868438	Standard	XR_244427		Approved	dJ63G5.3, KIAA1904	uc003asq.4	Q5R3F8	OTTHUMG00000150558	ENST00000402918.2:c.-303->AGG	22.37:g.37771883_37771885dupCCT			Q96PY3	RNA	INS	-	NULL	ENST00000402918.2	37	NULL	CCDS33642.1	22																																																																																			ELFN2	-	-	ENSG00000166897		0.634	ELFN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ELFN2	HGNC	protein_coding	OTTHUMT00000318900.2		0.00	22	0	-	NM_052906		37771877	-1	tier1		no_errors	ENST00000414347	ensembl	human	known	74_37	rna	31.58	13	6	INS	0.001:0.043	CCT
ELMOD3	84173	genome.wustl.edu	37	2	85618819	85618820	+	3'UTR	INS	-	-	AGGC			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr2:85618819_85618820insAGGC	ENST00000409890.2	+	0	2547_2548				ELMOD3_ENST00000315658.7_3'UTR|ELMOD3_ENST00000490508.1_3'UTR|ELMOD3_ENST00000393852.4_3'UTR|ELMOD3_ENST00000409013.3_3'UTR|ELMOD3_ENST00000409344.3_3'UTR			Q96FG2	ELMD3_HUMAN	ELMO/CED-12 domain containing 3						phagocytosis (GO:0006909)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(2)|prostate(1)	12						TGGCCTAATTGAGGGAAGGAGG	0.475											OREG0014744	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0																																										SO:0001624	3_prime_UTR_variant	0			AF258573	CCDS1973.1, CCDS46352.1	2p11.2	2014-01-28	2008-08-14	2008-08-14	ENSG00000115459	ENSG00000115459		"""RNA binding motif (RRM) containing"""	26158	protein-coding gene	gene with protein product		615427	"""RNA binding motif protein 29"", ""RNA binding motif and ELMO/CED-12 domain 1"", ""deafness, autosomal recessive 88"""	RBM29, RBED1, DFNB88		24039609	Standard	NM_032213		Approved	FLJ21977	uc010ysn.2	Q96FG2	OTTHUMG00000130170	ENST00000409890.2:c.*735->AGGC	2.37:g.85618819_85618820insAGGC		1238	B8ZZD6|D6W5K4|Q2M1K3|Q2XSU3|Q2XSU4|Q8NAC1|Q8TCK4|Q8WV70|Q8WY75|Q9H6Q8	RNA	INS	-	NULL	ENST00000409890.2	37	NULL	CCDS46352.1	2																																																																																			ELMOD3	-	-	ENSG00000115459		0.475	ELMOD3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ELMOD3	HGNC	protein_coding	OTTHUMT00000329124.1		0.00	25	0	-	NM_032213		85618820	+1	tier1		no_errors	ENST00000490508	ensembl	human	known	74_37	rna	39.39	20	13	INS	0.004:0.001	AGGC
UNC93B6	255620	genome.wustl.edu	37	11	71316597	71316597	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr11:71316597G>A	ENST00000343767.3	-	1	1890	c.40C>T	c.(40-42)Cgt>Tgt	p.R14C	UNC93B6_ENST00000525262.2_RNA|KRTAP5-11_ENST00000526239.1_5'Flank																							CTTCCTAAACGCCACCCCTTC	0.627																																																	0																																										SO:0001583	missense	0																														ENST00000343767.3:c.40C>T	11.37:g.71316597G>A	ENSP00000345469:p.Arg14Cys			Missense_Mutation	SNP	NULL	p.R14C	ENST00000343767.3	37	c.40		11	.	.	.	.	.	.	.	.	.	.	.	1.158	-0.644759	0.03531	.	.	ENSG00000187811	ENST00000343767	.	.	.	.	.	.	.	.	.	.	.	T	0.48314	0.1493	.	.	.	.	.	.	.	.	.	.	.	.	T	0.58399	-0.7643	2	0.87932	D	0	.	.	.	.	.	.	.	.	C	14	.	ENSP00000345469:R14C	R	-	1	0	AP000867.1	70994245	0.290000	0.24343	0.275000	0.24674	0.276000	0.26787	0.163000	0.16520	0.064000	0.16427	0.064000	0.15345	CGT	AP000867.1	-	NULL	ENSG00000187811		0.627	AP000867.1-201	KNOWN	basic|appris_principal	protein_coding	ENSG00000187811	Clone_based_ensembl_gene	protein_coding		-	0.00	113	0	G			71316597	-1	tier1	-	no_errors	ENST00000343767	ensembl	human	known	74_37	missense	6.88	457	34	SNP	0.100	A
CROCC	9696	genome.wustl.edu	37	1	17185596	17185597	+	lincRNA	INS	-	-	A			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr1:17185596_17185597insA	ENST00000414128.1	+	0	699_700				MIR3675_ENST00000583661.1_RNA																							TTACCTACGGCAAAAAATACGA	0.431																																																	0																																												0																															1.37:g.17185602_17185602dupA				RNA	INS	-	NULL	ENST00000414128.1	37	NULL		1																																																																																			RP11-108M9.2	-	-	ENSG00000230239		0.431	RP11-108M9.2-001	KNOWN	not_best_in_genome_evidence|basic	lincRNA	ENSG00000230239	Clone_based_vega_gene	lincRNA	OTTHUMT00000006253.1		0.00	207	0	-			17185597	+1	tier1		no_errors	ENST00000414128	ensembl	human	known	74_37	rna	26.75	167	61	INS	1.000:1.000	A
RP5-1063M23.1	0	genome.wustl.edu	37	12	3409292	3409292	+	lincRNA	SNP	G	G	T			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr12:3409292G>T	ENST00000505276.2	-	0	98																											AAGGCCAACCGGGTTGGGCCG	0.622											OREG0021589	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0																																												0																															12.37:g.3409292G>T		611		RNA	SNP	-	NULL	ENST00000505276.2	37	NULL		12																																																																																			RP5-1063M23.1	-	-	ENSG00000250770		0.622	RP5-1063M23.1-001	KNOWN	basic	lincRNA	ENSG00000250770	Clone_based_vega_gene	lincRNA	OTTHUMT00000398632.1	-	0.00	89	0	G			3409292	-1	tier1	-	no_errors	ENST00000505276	ensembl	human	known	74_37	rna	5.94	95	6	SNP	0.000	T
RP11-467N20.5	0	genome.wustl.edu	37	15	23406970	23406970	+	Silent	SNP	C	C	T			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr15:23406970C>T	ENST00000558241.1	-	8	1956	c.1866G>A	c.(1864-1866)cgG>cgA	p.R622R																	endometrium(1)	1						cctcctgctcccgtatcttct	0.532																																																	0																																										SO:0001819	synonymous_variant	0																														ENST00000558241.1:c.1866G>A	15.37:g.23406970C>T				Silent	SNP	superfamily_Ribosomal_L7/12_C/ClpS-like,prints_Tropomyosin	p.R622	ENST00000558241.1	37	c.1866		15																																																																																			RP11-467N20.5	-	NULL	ENSG00000259455		0.532	RP11-467N20.5-001	NOVEL	not_best_in_genome_evidence|basic|appris_principal|exp_conf	protein_coding	ENSG00000259455	Clone_based_vega_gene	protein_coding	OTTHUMT00000415942.1	-	0.00	234	0	C			23406970	-1	tier1	-	no_errors	ENST00000558241	ensembl	human	novel	74_37	silent	6.17	213	14	SNP	0.001	T
UCKL1	54963	genome.wustl.edu	37	20	62585290	62585290	+	Intron	SNP	G	G	A			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr20:62585290G>A	ENST00000354216.6	-	1	156				UCKL1_ENST00000369892.3_Intron|UCKL1_ENST00000358711.3_Intron|AL118506.1_ENST00000595604.1_Missense_Mutation_p.R95H|UCKL1_ENST00000369908.5_5'Flank	NM_017859.3	NP_060329.2	Q9NWZ5	UCKL1_HUMAN	uridine-cytidine kinase 1-like 1						CTP salvage (GO:0044211)|UMP salvage (GO:0044206)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|uridine kinase activity (GO:0004849)			endometrium(3)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	8	all_cancers(38;2.14e-11)|all_epithelial(29;3.41e-13)|Lung NSC(23;3.41e-09)|all_lung(23;1.06e-08)					GGTCACCATCGCCCACGGACC	0.592																																																	0																																										SO:0001627	intron_variant	0			AK000524	CCDS13547.1, CCDS54479.1	20q13.33	2012-09-20	2004-07-13	2004-07-13	ENSG00000198276	ENSG00000198276			15938	protein-coding gene	gene with protein product		610866	"""uridine kinase-like 1"""	URKL1			Standard	NM_017859		Approved	FLJ20517	uc010gkn.3	Q9NWZ5	OTTHUMG00000033003	ENST00000354216.6:c.113+2322C>T	20.37:g.62585290G>A			B7Z8N2|Q5JWV0|Q70AQ5|Q8N524|Q9H3Z2	Missense_Mutation	SNP	NULL	p.R95H	ENST00000354216.6	37	c.284	CCDS13547.1	20																																																																																			AL118506.1	-	NULL	ENSG00000267848		0.592	UCKL1-001	KNOWN	basic|CCDS	protein_coding	ENSG00000267848	Clone_based_ensembl_gene	protein_coding	OTTHUMT00000080236.1	-	0.00	20	0	G	NM_017859		62585290	+1	tier1	-	no_errors	ENST00000595604	ensembl	human	known	74_37	missense	60.87	9	14	SNP	0.000	A
LA16c-380H5.4	0	genome.wustl.edu	37	16	3050153	3050153	+	lincRNA	SNP	C	C	T			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr16:3050153C>T	ENST00000573315.1	+	0	0				LA16c-380H5.3_ENST00000572086.2_lincRNA																							CCATGTTGAGCGGAAGCTGGC	0.582																																																	0																																												0																															16.37:g.3050153C>T				RNA	SNP	-	NULL	ENST00000573315.1	37	NULL		16																																																																																			LA16c-380H5.3	-	-	ENSG00000270097		0.582	LA16c-380H5.4-001	KNOWN	basic	lincRNA	ENSG00000270097	Clone_based_vega_gene	lincRNA	OTTHUMT00000436959.1	-	0.00	47	0	C			3050153	+1	tier1	-	no_errors	ENST00000572086	ensembl	human	known	74_37	rna	53.06	23	26	SNP	0.000	T
ESRP2	80004	genome.wustl.edu	37	16	68266687	68266688	+	Frame_Shift_Ins	INS	-	-	T			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr16:68266687_68266688insT	ENST00000565858.1	-	6	772_773	c.686_687insA	c.(685-687)aagfs	p.K229fs	ESRP2_ENST00000473183.2_Frame_Shift_Ins_p.K229fs	NM_024939.2	NP_079215.2	Q9H6T0	ESRP2_HUMAN	epithelial splicing regulatory protein 2	229					mRNA processing (GO:0006397)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|central_nervous_system(1)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|prostate(2)	16						CGTATTTCTGCTTTATCACCTC	0.569																																																	0																																										SO:0001589	frameshift_variant	0			AK025571	CCDS10863.1	16q22.1	2013-02-12	2009-03-10	2009-03-10	ENSG00000103067	ENSG00000103067		"""RNA binding motif (RRM) containing"""	26152	protein-coding gene	gene with protein product		612960	"""RNA binding motif protein 35B"""	RBM35B		12477932	Standard	NM_024939		Approved	FLJ21918	uc002evq.1	Q9H6T0	OTTHUMG00000137557	ENST00000565858.1:c.687dupA	16.37:g.68266690_68266690dupT	ENSP00000454554:p.Lys229fs		Q8N6H8|Q8WZ15|Q9H6I4	Frame_Shift_Ins	INS	superfamily_RNaseH-like_dom,smart_RRM_dom	p.Q230fs	ENST00000565858.1	37	c.687_686		16																																																																																			ESRP2	-	NULL	ENSG00000103067		0.569	ESRP2-004	KNOWN	basic|appris_candidate_longest	protein_coding	ESRP2	HGNC	protein_coding	OTTHUMT00000433083.1		0.00	18	0	-	NM_024939		68266688	-1	tier1		no_errors	ENST00000565858	ensembl	human	known	74_37	frame_shift_ins	56.00	11	14	INS	1.000:1.000	T
FAM126B	285172	genome.wustl.edu	37	2	201846144	201846144	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr2:201846144G>T	ENST00000418596.3	-	12	1629	c.1442C>A	c.(1441-1443)gCc>gAc	p.A481D	AC005037.3_ENST00000332935.6_RNA|AC005037.3_ENST00000413848.1_RNA	NM_173822.3	NP_776183.1	Q8IXS8	F126B_HUMAN	family with sequence similarity 126, member B	481						intracellular (GO:0005622)				endometrium(2)|kidney(1)|large_intestine(3)|lung(5)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	16						AGCATTGTTGGCTGCTAAATT	0.502																																																	0													123.0	95.0	105.0					2																	201846144		2203	4300	6503	SO:0001583	missense	0			BC039295	CCDS2335.1	2q33.1	2008-10-02			ENSG00000155744	ENSG00000155744			28593	protein-coding gene	gene with protein product						12477932	Standard	NM_173822		Approved	MGC39518, HYCC2	uc002uws.4	Q8IXS8	OTTHUMG00000132823	ENST00000418596.3:c.1442C>A	2.37:g.201846144G>T	ENSP00000393667:p.Ala481Asp		B2RCG7|Q4ZG87|Q53TX6	Missense_Mutation	SNP	pfam_Hyccin	p.A481D	ENST00000418596.3	37	c.1442	CCDS2335.1	2	.	.	.	.	.	.	.	.	.	.	G	8.470	0.857334	0.17106	.	.	ENSG00000155744	ENST00000418596	T	0.80033	-1.33	5.86	1.65	0.23941	.	0.597065	0.17746	N	0.163392	T	0.73984	0.3657	L	0.29908	0.895	0.34934	D	0.749666	B;B	0.14438	0.01;0.01	B;B	0.18263	0.021;0.021	T	0.72297	-0.4335	10	0.66056	D	0.02	-0.4515	19.8299	0.96631	0.0:0.4218:0.5782:0.0	.	287;481	B3KUG1;Q8IXS8	.;F126B_HUMAN	D	481	ENSP00000393667:A481D	ENSP00000393667:A481D	A	-	2	0	FAM126B	201554389	0.151000	0.22747	0.607000	0.28956	0.874000	0.50279	1.451000	0.35145	0.364000	0.24374	-0.913000	0.02753	GCC	FAM126B	-	NULL	ENSG00000155744		0.502	FAM126B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM126B	HGNC	protein_coding	OTTHUMT00000256285.3	-	0.00	32	0	G	NM_173822		201846144	-1	tier1	-	no_errors	ENST00000418596	ensembl	human	known	74_37	missense	10.00	36	4	SNP	0.661	T
FAM13B	51306	genome.wustl.edu	37	5	137275979	137275979	+	Missense_Mutation	SNP	T	T	C			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr5:137275979T>C	ENST00000033079.3	-	23	3134	c.2683A>G	c.(2683-2685)Att>Gtt	p.I895V	PKD2L2_ENST00000502810.1_3'UTR|PKD2L2_ENST00000508883.1_Intron|PKD2L2_ENST00000290431.5_3'UTR|FAM13B_ENST00000420893.2_Missense_Mutation_p.I867V|PKD2L2_ENST00000508638.1_3'UTR|FAM13B_ENST00000425075.2_Missense_Mutation_p.I771V	NM_016603.2	NP_057687.2	Q9NYF5	FA13B_HUMAN	family with sequence similarity 13, member B	895					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)			endometrium(4)|kidney(2)|lung(5)	11						TTGGCTTTAATTTTCTTGTAC	0.348																																																	0													108.0	106.0	106.0					5																	137275979		2203	4300	6503	SO:0001583	missense	0			AF251038	CCDS4195.1, CCDS47269.1, CCDS47270.1	5q31	2011-09-07	2009-01-20	2009-01-20	ENSG00000031003	ENSG00000031003		"""Rho GTPase activating proteins"""	1335	protein-coding gene	gene with protein product		609371	"""chromosome 5 open reading frame 5"", ""family with sequence similarity 13, member B1"""	C5orf5, FAM13B1		11087669, 11161817	Standard	NM_016603		Approved	N61, KHCHP, ARHGAP49	uc003lbz.2	Q9NYF5	OTTHUMG00000129202	ENST00000033079.3:c.2683A>G	5.37:g.137275979T>C	ENSP00000033079:p.Ile895Val		D3DQB5|G3V0H9|Q3ZCR0|Q6PGQ2|Q9P0I7	Missense_Mutation	SNP	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	p.I895V	ENST00000033079.3	37	c.2683	CCDS4195.1	5	.	.	.	.	.	.	.	.	.	.	T	16.96	3.266295	0.59540	.	.	ENSG00000031003	ENST00000033079;ENST00000425075;ENST00000420893	T;T;T	0.23147	2.98;1.92;3.03	5.37	5.37	0.77165	.	0.054863	0.64402	D	0.000001	T	0.13329	0.0323	N	0.11427	0.14	0.45464	D	0.998438	B;B;B	0.24258	0.043;0.1;0.014	B;B;B	0.27887	0.084;0.01;0.012	T	0.17623	-1.0363	10	0.23302	T	0.38	-11.8585	8.2173	0.31519	0.0:0.1505:0.0:0.8495	.	771;867;895	G3V0H9;Q9NYF5-2;Q9NYF5	.;.;FA13B_HUMAN	V	895;771;867	ENSP00000033079:I895V;ENSP00000394669:I771V;ENSP00000388521:I867V	ENSP00000033079:I895V	I	-	1	0	FAM13B	137303878	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	2.069000	0.41481	2.163000	0.67991	0.482000	0.46254	ATT	FAM13B	-	NULL	ENSG00000031003		0.348	FAM13B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM13B	HGNC	protein_coding	OTTHUMT00000251279.1	-	0.00	35	0	T			137275979	-1	tier1	-	no_errors	ENST00000033079	ensembl	human	known	74_37	missense	58.06	13	18	SNP	1.000	C
FAM200B	285550	genome.wustl.edu	37	4	15691676	15691676	+	IGR	SNP	C	C	T	rs75806234		TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr4:15691676C>T	ENST00000422728.2	+	0	2962				FAM200B_ENST00000504137.1_3'UTR	NM_001145191.1	NP_001138663.1	P0CF97	F200B_HUMAN	family with sequence similarity 200, member B								nucleic acid binding (GO:0003676)			endometrium(1)|kidney(1)	2						tacctaacatctctaatttgc	0.303																																																	0																																										SO:0001628	intergenic_variant	0			BC048993	CCDS47028.1	4p15.32	2014-04-02			ENSG00000237765	ENSG00000237765			27740	protein-coding gene	gene with protein product	"""chromosome 4 open reading frame 53"""						Standard	NM_001145191		Approved	C4orf53	uc003gof.4	P0CF97	OTTHUMG00000160279		4.37:g.15691676C>T				RNA	SNP	-	NULL	ENST00000422728.2	37	NULL	CCDS47028.1	4																																																																																			FAM200B	-	-	ENSG00000237765		0.303	FAM200B-005	PUTATIVE	basic|appris_principal|CCDS	protein_coding	FAM200B	HGNC	protein_coding	OTTHUMT00000360100.1	-	0.00	23	0	C	NM_001145191		15691676	+1	tier1	-	no_errors	ENST00000504137	ensembl	human	known	74_37	rna	73.33	4	11	SNP	0.000	T
FAM227A	646851	genome.wustl.edu	37	22	39046033	39046033	+	Splice_Site	SNP	G	G	T			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr22:39046033G>T	ENST00000535113.1	-	2	744	c.141C>A	c.(139-141)ccC>ccA	p.P47P	FAM227A_ENST00000406767.2_Splice_Site_p.P41P|FAM227A_ENST00000540952.1_5'UTR|FAM227A_ENST00000355830.6_Splice_Site_p.P41P	NM_001013647.1	NP_001013669.1	F5H4B4	F227A_HUMAN	family with sequence similarity 227, member A	47																	GAAGGATACAGGGTGGATTGT	0.463																																																	0													299.0	240.0	258.0					22																	39046033		692	1591	2283	SO:0001630	splice_region_variant	0					22q13.1	2012-07-04			ENSG00000184949	ENSG00000184949			44197	protein-coding gene	gene with protein product							Standard	NM_001013647		Approved		uc011anw.1	F5H4B4	OTTHUMG00000151133	ENST00000535113.1:c.142+1C>A	22.37:g.39046033G>T			B0QY52|B7Z7C6|Q5TG08	Silent	SNP	superfamily_Staphylcoagulase_N	p.P41	ENST00000535113.1	37	c.123		22																																																																																			FAM227A	-	NULL	ENSG00000184949		0.463	FAM227A-202	KNOWN	basic|appris_principal	protein_coding	FAM227A	HGNC	protein_coding		-	0.00	69	0	G	NM_001013647	Silent	39046033	-1	tier1	-	no_errors	ENST00000406767	ensembl	human	known	74_37	silent	7.84	47	4	SNP	0.118	T
FBXO21	23014	genome.wustl.edu	37	12	117595684	117595684	+	Missense_Mutation	SNP	T	T	G			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr12:117595684T>G	ENST00000330622.5	-	10	1531	c.1532A>C	c.(1531-1533)cAt>cCt	p.H511P	FBXO21_ENST00000427718.2_Missense_Mutation_p.H504P			O94952	FBX21_HUMAN	F-box protein 21	511					protein ubiquitination (GO:0016567)|ubiquitin-dependent protein catabolic process (GO:0006511)	ubiquitin ligase complex (GO:0000151)	DNA binding (GO:0003677)|ubiquitin-protein transferase activity (GO:0004842)			breast(4)|endometrium(3)|kidney(2)|large_intestine(6)|lung(8)|pancreas(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	29	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.0291)		TCACCTCTTATGCTTCATAAT	0.572																																					GBM(168;452 2038 13535 17701 43680)												0													132.0	110.0	117.0					12																	117595684		2203	4300	6503	SO:0001583	missense	0			AB020682	CCDS9184.1, CCDS44989.1	12q24.23	2004-06-15	2004-06-15					"""F-boxes /  ""other"""""	13592	protein-coding gene	gene with protein product		609095	"""F-box only protein 21"""			10048485, 10531035	Standard	NM_033624		Approved	FBX21, KIAA0875	uc001twk.3	O94952	OTTHUMG00000169495	ENST00000330622.5:c.1532A>C	12.37:g.117595684T>G	ENSP00000328187:p.His511Pro		B3KMF0|Q5BJG0|Q9H087	Missense_Mutation	SNP	pfam_Hemimethylated_DNA-bd_dom,superfamily_Hemimethylated_DNA-bd_dom,superfamily_F-box_dom,tigrfam_Hemimethylated_DNA-bd_dom	p.H511P	ENST00000330622.5	37	c.1532	CCDS9184.1	12	.	.	.	.	.	.	.	.	.	.	T	23.3	4.401304	0.83120	.	.	ENSG00000135108	ENST00000427718;ENST00000257563;ENST00000535590;ENST00000330622;ENST00000548840	T;T	0.73681	-0.72;-0.77	5.02	5.02	0.67125	Hemimethylated DNA-binding domain (2);F-box domain, Skp2-like (1);	0.000000	0.85682	D	0.000000	D	0.89026	0.6598	M	0.92555	3.32	0.80722	D	1	D;D;D;D	0.89917	1.0;0.999;0.997;1.0	D;D;D;D	0.97110	1.0;0.989;0.996;0.999	D	0.91742	0.5405	10	0.87932	D	0	-1.8453	14.9146	0.70785	0.0:0.0:0.0:1.0	.	360;254;511;504	Q8IUQ5;B3KQC8;O94952;O94952-1	.;.;FBX21_HUMAN;.	P	504;420;360;511;163	ENSP00000414468:H504P;ENSP00000328187:H511P	ENSP00000257563:H420P	H	-	2	0	FBXO21	116080067	1.000000	0.71417	0.997000	0.53966	0.995000	0.86356	7.525000	0.81892	2.108000	0.64289	0.533000	0.62120	CAT	FBXO21	-	pfam_Hemimethylated_DNA-bd_dom,superfamily_Hemimethylated_DNA-bd_dom,superfamily_F-box_dom,tigrfam_Hemimethylated_DNA-bd_dom	ENSG00000135108		0.572	FBXO21-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FBXO21	HGNC	protein_coding	OTTHUMT00000404409.1	-	0.00	33	0	T	NM_033624		117595684	-1	tier1	-	no_errors	ENST00000330622	ensembl	human	known	74_37	missense	29.41	23	10	SNP	1.000	G
FBXO9	26268	genome.wustl.edu	37	6	52960336	52960336	+	Missense_Mutation	SNP	A	A	G			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr6:52960336A>G	ENST00000244426.6	+	11	1281	c.1109A>G	c.(1108-1110)tAt>tGt	p.Y370C	FBXO9_ENST00000323557.7_Missense_Mutation_p.Y360C|FBXO9_ENST00000370939.3_Missense_Mutation_p.Y326C	NM_012347.4	NP_036479.1	Q9UK97	FBX9_HUMAN	F-box protein 9	370					fat cell differentiation (GO:0045444)|innate immune response (GO:0045087)|protein ubiquitination (GO:0016567)|regulation of TOR signaling (GO:0032006)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)	cytoplasm (GO:0005737)|SCF ubiquitin ligase complex (GO:0019005)|ubiquitin ligase complex (GO:0000151)	ubiquitin-protein transferase activity (GO:0004842)			kidney(1)|large_intestine(4)|lung(1)|pancreas(2)|skin(1)	9	Lung NSC(77;0.103)					AAATACAGATATTTTCGTCGT	0.383																																																	0													78.0	74.0	75.0					6																	52960336		1835	4093	5928	SO:0001583	missense	0			AF155114	CCDS55022.1, CCDS55023.1, CCDS55024.1	6p12.3-p11.2	2004-06-15	2004-06-15		ENSG00000112146	ENSG00000112146		"""F-boxes /  ""other"""""	13588	protein-coding gene	gene with protein product		609091	"""F-box only protein 9"""			10531035, 10531037	Standard	NM_012347		Approved	FBX9, NY-REN-57	uc021zao.1	Q9UK97	OTTHUMG00000014869	ENST00000244426.6:c.1109A>G	6.37:g.52960336A>G	ENSP00000244426:p.Tyr370Cys		A6NFW3|B3KMM6|O75986|Q59EH8|Q6PKH7|Q9NT57|Q9Y593	Missense_Mutation	SNP	pfam_F-box_dom,superfamily_F-box_dom,pfscan_F-box_dom	p.Y370C	ENST00000244426.6	37	c.1109	CCDS55023.1	6	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	A|A|A	16.02|16.02|16.02	3.005290|3.005290|3.005290	0.54254|0.54254|0.54254	.|.|.	.|.|.	ENSG00000112146|ENSG00000112146|ENSG00000112146	ENST00000484436|ENST00000473318|ENST00000370939;ENST00000323557;ENST00000244426	.|.|T;T;T	.|.|0.77229	.|.|-1.07;-1.07;-1.08	5.13|5.13|5.13	3.88|3.88|3.88	0.44766|0.44766|0.44766	.|.|F-box domain, Skp2-like (1);	.|.|0.105878	.|.|0.64402	.|.|D	.|.|0.000003	T|T|T	0.69287|0.69287|0.69287	0.3094|0.3094|0.3094	L|L|L	0.44542|0.44542|0.44542	1.39|1.39|1.39	0.50039|0.50039|0.50039	D|D|D	0.999841|0.999841|0.999841	.|.|D;D;P	.|.|0.57257	.|.|0.978;0.979;0.878	.|.|P;P;B	.|.|0.52710	.|.|0.707;0.598;0.346	T|T|T	0.70121|0.70121|0.70121	-0.4959|-0.4959|-0.4959	5|5|10	.|.|0.39692	.|.|T	.|.|0.17	-5.5294|-5.5294|-5.5294	11.08|11.08|11.08	0.48053|0.48053|0.48053	0.8613:0.0:0.0:0.1387|0.8613:0.0:0.0:0.1387|0.8613:0.0:0.0:0.1387	.|.|.	.|.|360;477;370	.|.|Q9UK97-2;Q59EH8;Q9UK97	.|.|.;.;FBX9_HUMAN	M|V|C	80|119|326;360;370	.|.|ENSP00000359977:Y326C;ENSP00000326968:Y360C;ENSP00000244426:Y370C	.|.|ENSP00000244426:Y370C	I|I|Y	+|+|+	3|1|2	3|0|0	FBXO9|FBXO9|FBXO9	53068295|53068295|53068295	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	0.995000|0.995000|0.995000	0.50966|0.50966|0.50966	0.998000|0.998000|0.998000	0.95712|0.95712|0.95712	5.092000|5.092000|5.092000	0.64511|0.64511|0.64511	2.054000|2.054000|2.054000	0.61138|0.61138|0.61138	0.528000|0.528000|0.528000	0.53228|0.53228|0.53228	ATA|ATT|TAT	FBXO9	-	superfamily_F-box_dom	ENSG00000112146		0.383	FBXO9-002	KNOWN	non_canonical_conserved|basic|CCDS	protein_coding	FBXO9	HGNC	protein_coding	OTTHUMT00000040950.3	-	0.00	48	0	A			52960336	+1	tier1	-	no_errors	ENST00000244426	ensembl	human	known	74_37	missense	57.69	22	30	SNP	1.000	G
FBXW12	285231	genome.wustl.edu	37	3	48420016	48420016	+	Splice_Site	SNP	G	G	A			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr3:48420016G>A	ENST00000296438.5	+	6	801	c.615G>A	c.(613-615)atG>atA	p.M205I	FBXW12_ENST00000445170.1_Splice_Site_p.M186I|RN7SL321P_ENST00000581742.1_RNA|FBXW12_ENST00000436231.1_Splice_Site_p.M48I|FBXW12_ENST00000415155.1_Intron	NM_207102.2	NP_996985.2	Q6X9E4	FBW12_HUMAN	F-box and WD repeat domain containing 12	205										breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	16				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		CATTCCTGATGGTAAGTGAGC	0.468																																																	0													49.0	43.0	45.0					3																	48420016		2203	4300	6503	SO:0001630	splice_region_variant	0			AK097594, AY247969	CCDS2764.1, CCDS54577.1, CCDS54578.1	3p21.31	2011-07-01	2007-02-08	2004-07-21	ENSG00000164049	ENSG00000164049		"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	20729	protein-coding gene	gene with protein product		609075	"""F-box only protein 35"", ""F-box and WD-40 domain protein 12"""	FBXO35		15040455	Standard	NM_207102		Approved	Fbw12	uc010hjv.3	Q6X9E4	OTTHUMG00000133530	ENST00000296438.5:c.615+1G>A	3.37:g.48420016G>A			E9PG36|Q494Y9|Q494Z0	Missense_Mutation	SNP	pfam_F-box_dom,superfamily_Quino_amine_DH_bsu,superfamily_F-box_dom,smart_F-box_dom,pfscan_F-box_dom	p.M205I	ENST00000296438.5	37	c.615	CCDS2764.1	3	.	.	.	.	.	.	.	.	.	.	G	14.01	2.408051	0.42715	.	.	ENSG00000164049	ENST00000458736;ENST00000296438;ENST00000436231;ENST00000445170	T;T;T	0.60797	1.7;0.16;1.7	4.09	2.25	0.28309	WD40/YVTN repeat-like-containing domain (1);Quinoprotein amine dehydrogenase, beta chain-like (1);	0.465379	0.22871	N	0.054623	T	0.39517	0.1081	N	0.25647	0.755	0.54753	D	0.999983	B;B;B	0.19200	0.034;0.034;0.02	B;B;B	0.22601	0.04;0.025;0.018	T	0.25293	-1.0136	10	0.46703	T	0.11	2.8679	5.5768	0.17228	0.2481:0.0:0.7519:0.0	.	104;186;205	E9PCA2;E9PG36;Q6X9E4	.;.;FBW12_HUMAN	I	104;205;48;186	ENSP00000296438:M205I;ENSP00000413866:M48I;ENSP00000406139:M186I	ENSP00000296438:M205I	M	+	3	0	FBXW12	48395020	0.907000	0.30839	0.315000	0.25238	0.414000	0.31173	1.246000	0.32803	1.018000	0.39521	0.650000	0.86243	ATG	FBXW12	-	superfamily_Quino_amine_DH_bsu	ENSG00000164049		0.468	FBXW12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FBXW12	HGNC	protein_coding	OTTHUMT00000257505.1	-	0.00	16	0	G	NM_207102	Missense_Mutation	48420016	+1	tier1	-	no_errors	ENST00000296438	ensembl	human	known	74_37	missense	78.95	4	15	SNP	0.583	A
FOLR3	2352	genome.wustl.edu	37	11	71847151	71847151	+	Missense_Mutation	SNP	C	C	A	rs151190708	byFrequency	TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr11:71847151C>A	ENST00000445078.2	+	2	218	c.147C>A	c.(145-147)gaC>gaA	p.D49E	FOLR3_ENST00000456237.1_Missense_Mutation_p.D51E|FOLR3_ENST00000442948.2_Missense_Mutation_p.D51E			P41439	FOLR3_HUMAN	folate receptor 3 (gamma)	49					folic acid transport (GO:0015884)	extracellular region (GO:0005576)|extrinsic component of membrane (GO:0019898)|membrane (GO:0016020)	folic acid binding (GO:0005542)			large_intestine(3)|lung(8)|prostate(2)	13					Folic Acid(DB00158)	GCCCCGAGGACGAGCTGTATG	0.637																																																	0													92.0	95.0	94.0					11																	71847151		2200	4293	6493	SO:0001583	missense	0			U08471	CCDS73344.1	11q13.4	2012-11-14			ENSG00000110203	ENSG00000110203			3795	protein-coding gene	gene with protein product		602469				8110752	Standard	NM_000804		Approved	FR-G	uc001orx.1	P41439	OTTHUMG00000167870	ENST00000445078.2:c.147C>A	11.37:g.71847151C>A	ENSP00000390338:p.Asp49Glu		J3KQ90|Q05C14	Missense_Mutation	SNP	pfam_Folate_rcpt-like	p.D51E	ENST00000445078.2	37	c.153		11	.	.	.	.	.	.	.	.	.	.	N	14.76	2.631512	0.46944	.	.	ENSG00000110203	ENST00000445078;ENST00000456237;ENST00000442948;ENST00000546166	T;T;T;T	0.64260	-0.09;-0.09;-0.09;-0.09	3.8	-1.56	0.08532	Folate receptor-like (1);	0.190251	0.32769	U	0.005678	T	0.48943	0.1528	.	.	.	0.09310	N	1	P;B	0.52463	0.953;0.337	P;B	0.46172	0.506;0.273	T	0.46190	-0.9209	9	0.41790	T	0.15	.	4.5404	0.12054	0.0:0.2002:0.3331:0.4667	.	51;49	E9PGT2;P41439	.;FOLR3_HUMAN	E	49;51;51;49	ENSP00000390338:D49E;ENSP00000399235:D51E;ENSP00000411161:D51E;ENSP00000446279:D49E	ENSP00000325032:D49E	D	+	3	2	FOLR3	71524799	0.003000	0.15002	0.003000	0.11579	0.003000	0.03518	-0.083000	0.11286	-0.174000	0.10743	-0.320000	0.08662	GAC	FOLR3	-	NULL	ENSG00000110203		0.637	FOLR3-001	NOVEL	upstream_ATG|basic	protein_coding	FOLR3	HGNC	protein_coding	OTTHUMT00000396739.1	-	0.00	32	0	C	NM_000804		71847151	+1	tier1	-	no_errors	ENST00000456237	ensembl	human	known	74_37	missense	10.85	115	14	SNP	0.012	A
FRYL	285527	genome.wustl.edu	37	4	48555255	48555255	+	Missense_Mutation	SNP	T	T	A			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr4:48555255T>A	ENST00000503238.1	-	33	4411	c.4412A>T	c.(4411-4413)tAt>tTt	p.Y1471F	FRYL_ENST00000507873.2_5'UTR|FRYL_ENST00000507711.1_Missense_Mutation_p.Y1471F|FRYL_ENST00000264319.7_5'UTR|FRYL_ENST00000537810.1_Missense_Mutation_p.Y1471F|FRYL_ENST00000358350.4_Missense_Mutation_p.Y1471F			O94915	FRYL_HUMAN	FRY-like	1471					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)					breast(2)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(21)|lung(38)|ovary(1)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	91						AGGGATTTTATAGCTGGAAGT	0.443																																																	0													91.0	91.0	91.0					4																	48555255		1887	4124	6011	SO:0001583	missense	0			AL833170	CCDS43227.1	4p12	2011-08-03	2006-11-17	2005-11-24	ENSG00000075539	ENSG00000075539			29127	protein-coding gene	gene with protein product			"""KIAA0826"", ""furry homolog-like (Drosophila)"""	KIAA0826		10048485	Standard	NM_015030		Approved	DKFZp686E205	uc003gyh.1	O94915	OTTHUMG00000160608	ENST00000503238.1:c.4412A>T	4.37:g.48555255T>A	ENSP00000426064:p.Tyr1471Phe		O95640|Q8WTZ5|Q9NT40	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.Y1471F	ENST00000503238.1	37	c.4412	CCDS43227.1	4	.	.	.	.	.	.	.	.	.	.	T	7.383	0.629203	0.14257	.	.	ENSG00000075539	ENST00000503238;ENST00000358350;ENST00000537810;ENST00000507711	T;T;T;T	0.42513	1.97;1.97;1.97;0.97	6.06	-1.72	0.08107	Armadillo-type fold (1);	0.298284	0.38605	N	0.001633	T	0.20170	0.0485	N	0.22421	0.69	0.58432	D	0.999999	B;B;B;B	0.31413	0.322;0.0;0.0;0.0	B;B;B;B	0.31016	0.123;0.002;0.004;0.003	T	0.12760	-1.0535	10	0.10902	T	0.67	.	6.9252	0.24412	0.1093:0.3887:0.0:0.502	.	1471;302;1471;1471	F2Z2S2;Q6ZR29;O94915;F5GX82	.;.;FRYL_HUMAN;.	F	1471	ENSP00000426064:Y1471F;ENSP00000351113:Y1471F;ENSP00000441114:Y1471F;ENSP00000421584:Y1471F	ENSP00000351113:Y1471F	Y	-	2	0	FRYL	48250012	0.999000	0.42202	0.020000	0.16555	0.462000	0.32619	2.012000	0.40932	-0.482000	0.06782	-0.408000	0.06270	TAT	FRYL	-	superfamily_ARM-type_fold	ENSG00000075539		0.443	FRYL-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FRYL	HGNC	protein_coding	OTTHUMT00000369265.2	-	0.00	34	0	T			48555255	-1	tier1	-	no_errors	ENST00000358350	ensembl	human	known	74_37	missense	72.00	7	18	SNP	0.234	A
FUBP1	8880	genome.wustl.edu	37	1	78414589	78414589	+	Intron	SNP	T	T	C			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr1:78414589T>C	ENST00000370768.2	-	20	2008				FUBP1_ENST00000489495.1_5'Flank|FUBP1_ENST00000370767.1_Missense_Mutation_p.N646S|FUBP1_ENST00000436586.2_Intron	NM_003902.3	NP_003893.2	Q96AE4	FUBP1_HUMAN	far upstream element (FUSE) binding protein 1						positive regulation of gene expression (GO:0010628)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)			central_nervous_system(7)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(1)|upper_aerodigestive_tract(3)	17						TCTTGCATGATTTGCAAATCC	0.318			"""F, N"""		oligodendroglioma																																			Rec	yes		1	1p13.1	8880	far upstream element (FUSE) binding protein 1		O	0																																										SO:0001627	intron_variant	0			U05040	CCDS683.1	1p31.1	2008-02-05			ENSG00000162613	ENSG00000162613			4004	protein-coding gene	gene with protein product		603444		FUBP		8125259	Standard	XM_005271309		Approved	FBP	uc001dii.3	Q96AE4	OTTHUMG00000040799	ENST00000370768.2:c.1927-130A>G	1.37:g.78414589T>C			Q12828	Missense_Mutation	SNP	pfam_KH_dom_type_1,pfam_KH_dom_type_2,pfam_DUF1897,smart_KH_dom,pfscan_KH_dom_type_1	p.N646S	ENST00000370768.2	37	c.1937	CCDS683.1	1	.	.	.	.	.	.	.	.	.	.	T	7.249	0.602747	0.13939	.	.	ENSG00000162613	ENST00000370767	T	0.29917	1.55	5.71	5.71	0.89125	.	0.622764	0.14944	N	0.289324	T	0.27697	0.0681	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.03335	-1.1047	6	.	.	.	.	11.084	0.48076	0.0:0.0722:0.0:0.9278	.	.	.	.	S	646	ENSP00000359803:N646S	.	N	-	2	0	FUBP1	78187177	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	3.878000	0.56130	2.162000	0.67917	0.460000	0.39030	AAT	FUBP1	-	NULL	ENSG00000162613		0.318	FUBP1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	FUBP1	HGNC	protein_coding	OTTHUMT00000098030.3	-	0.00	15	0	T	NM_003902		78414589	-1	tier1	-	no_errors	ENST00000370767	ensembl	human	putative	74_37	missense	22.58	24	7	SNP	1.000	C
GGA2	23062	genome.wustl.edu	37	16	23497446	23497446	+	Missense_Mutation	SNP	T	T	C			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr16:23497446T>C	ENST00000309859.4	-	8	770	c.688A>G	c.(688-690)Aag>Gag	p.K230E	GGA2_ENST00000567468.1_Intron	NM_015044.4	NP_055859.1	Q9UJY4	GGA2_HUMAN	golgi-associated, gamma adaptin ear containing, ARF binding protein 2	230	GAT. {ECO:0000255|PROSITE- ProRule:PRU00373}.				intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	clathrin adaptor complex (GO:0030131)|clathrin-coated vesicle (GO:0030136)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|trans-Golgi network (GO:0005802)	ADP-ribosylation factor binding (GO:0030306)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(4)|ovary(1)	21				GBM - Glioblastoma multiforme(48;0.0386)		CTGACCCTCTTGGACACCTTC	0.572																																																	0													145.0	104.0	118.0					16																	23497446		2197	4300	6497	SO:0001583	missense	0			AF190863	CCDS10611.1	16p12	2010-02-12	2010-02-12		ENSG00000103365	ENSG00000103365			16064	protein-coding gene	gene with protein product		606005				10747088, 10749927	Standard	NM_015044		Approved	VEAR, KIAA1080	uc002dlq.3	Q9UJY4	OTTHUMG00000096957	ENST00000309859.4:c.688A>G	16.37:g.23497446T>C	ENSP00000311962:p.Lys230Glu		D3DWF0|O14564|Q9NYN2|Q9UPS2	Missense_Mutation	SNP	pfam_VHS,pfam_GAT,pfam_Clathrin_a/b/g-adaptin_app_Ig,superfamily_ENTH_VHS,superfamily_Coatomer/clathrin_app_Ig-like,smart_VHS_subgr,smart_Clathrin_a/b/g-adaptin_app_Ig,pfscan_Clathrin_g-adaptin_app,pfscan_GAT,pfscan_VHS	p.K230E	ENST00000309859.4	37	c.688	CCDS10611.1	16	.	.	.	.	.	.	.	.	.	.	T	21.9	4.217531	0.79352	.	.	ENSG00000103365	ENST00000309859	T	0.43688	0.94	6.07	3.75	0.43078	GAT (2);	0.288040	0.39274	N	0.001419	T	0.44393	0.1291	L	0.49778	1.585	0.80722	D	1	B	0.34241	0.444	B	0.42959	0.403	T	0.32134	-0.9918	10	0.51188	T	0.08	-7.7307	11.4261	0.50012	0.0:0.0:0.3136:0.6864	.	230	Q9UJY4	GGA2_HUMAN	E	230	ENSP00000311962:K230E	ENSP00000311962:K230E	K	-	1	0	GGA2	23404947	1.000000	0.71417	0.052000	0.19188	0.961000	0.63080	2.985000	0.49362	0.492000	0.27815	0.533000	0.62120	AAG	GGA2	-	pfam_GAT,pfscan_GAT	ENSG00000103365		0.572	GGA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GGA2	HGNC	protein_coding	OTTHUMT00000214019.1	-	0.00	43	0	T			23497446	-1	tier1	-	no_errors	ENST00000309859	ensembl	human	known	74_37	missense	36.36	28	16	SNP	0.761	C
GINM1	116254	genome.wustl.edu	37	6	149900994	149900994	+	Missense_Mutation	SNP	A	A	G			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr6:149900994A>G	ENST00000367419.5	+	5	575	c.454A>G	c.(454-456)Att>Gtt	p.I152V		NM_138785.3	NP_620140.1	Q9NU53	GINM1_HUMAN	glycoprotein integral membrane 1	152						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)											TGTCACTGAAATTGATATTTT	0.338																																																	0													55.0	53.0	53.0					6																	149900994		2202	4299	6501	SO:0001583	missense	0			BC014320	CCDS5216.1	6q24.3	2012-07-20	2012-07-20	2012-07-20	ENSG00000055211	ENSG00000055211			21074	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 72"""	C6orf72			Standard	NM_138785		Approved	dJ12G14.2	uc003qmq.1	Q9NU53	OTTHUMG00000015789	ENST00000367419.5:c.454A>G	6.37:g.149900994A>G	ENSP00000356389:p.Ile152Val		B2RDY7|E1P5A2	Missense_Mutation	SNP	NULL	p.I152V	ENST00000367419.5	37	c.454	CCDS5216.1	6	.	.	.	.	.	.	.	.	.	.	A	7.114	0.576667	0.13686	.	.	ENSG00000055211	ENST00000367423;ENST00000367419;ENST00000433539	.	.	.	5.77	-1.4	0.08968	.	0.273592	0.35349	N	0.003264	T	0.14056	0.0340	L	0.42245	1.32	0.29727	N	0.83821	B;B	0.12013	0.005;0.005	B;B	0.14023	0.01;0.01	T	0.23226	-1.0194	8	.	.	.	-4.8507	6.6301	0.22851	0.5603:0.1226:0.317:0.0	.	152;152	A8K037;Q9NU53	.;CF072_HUMAN	V	32;152;26	.	.	I	+	1	0	C6orf72	149942687	0.999000	0.42202	0.996000	0.52242	0.984000	0.73092	0.638000	0.24674	-0.120000	0.11809	-0.274000	0.10170	ATT	GINM1	-	NULL	ENSG00000055211		0.338	GINM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GINM1	HGNC	protein_coding	OTTHUMT00000042644.1	-	0.00	34	0	A	NM_138785		149900994	+1	tier1	-	no_errors	ENST00000367419	ensembl	human	known	74_37	missense	95.00	1	19	SNP	0.994	G
GOLM1	51280	genome.wustl.edu	37	9	88650485	88650485	+	Silent	SNP	C	C	T			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr9:88650485C>T	ENST00000388712.3	-	8	981	c.813G>A	c.(811-813)ccG>ccA	p.P271P	GOLM1_ENST00000257504.6_5'Flank|GOLM1_ENST00000388711.3_Silent_p.P271P	NM_016548.3	NP_057632.2	Q8NBJ4	GOLM1_HUMAN	golgi membrane protein 1	271					nucleus organization (GO:0006997)|regulation of lipid metabolic process (GO:0019216)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)				breast(1)|endometrium(1)|kidney(2)|large_intestine(4)|liver(1)|lung(4)|pancreas(1)|prostate(1)|skin(1)|stomach(1)	17						CTGGCTCCTGCGGCAGCCTGT	0.597											OREG0019278	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													135.0	147.0	143.0					9																	88650485		2203	4300	6503	SO:0001819	synonymous_variant	0			AF236056	CCDS35054.1	9q21.33	2012-12-13	2007-07-30	2007-07-30	ENSG00000135052	ENSG00000135052			15451	protein-coding gene	gene with protein product		606804	"""golgi phosphoprotein 2"", ""chromosome 9 open reading frame 155"""	GOLPH2, C9orf155		10831838, 18953438, 22542941	Standard	NM_016548		Approved	GP73, FLJ23608, bA379P1.3	uc004aol.3	Q8NBJ4	OTTHUMG00000020130	ENST00000388712.3:c.813G>A	9.37:g.88650485C>T		1261	Q6IAF4|Q9NRB9	Silent	SNP	NULL	p.P271	ENST00000388712.3	37	c.813	CCDS35054.1	9																																																																																			GOLM1	-	NULL	ENSG00000135052		0.597	GOLM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GOLM1	HGNC	protein_coding	OTTHUMT00000052904.2	-	0.00	47	0	C	NM_177937		88650485	-1	tier1	-	no_errors	ENST00000388711	ensembl	human	known	74_37	silent	88.89	3	24	SNP	0.000	T
GP2	2813	genome.wustl.edu	37	16	20327307	20327307	+	Missense_Mutation	SNP	A	A	G			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr16:20327307A>G	ENST00000381362.4	-	10	1557	c.1481T>C	c.(1480-1482)gTt>gCt	p.V494A	GP2_ENST00000381360.5_Missense_Mutation_p.V347A|GP2_ENST00000341642.5_Missense_Mutation_p.V344A|GP2_ENST00000302555.5_Missense_Mutation_p.V491A|GP2_ENST00000573897.1_5'Flank	NM_001007240.1|NM_001502.2	NP_001007241.2|NP_001493.2	P55259	GP2_HUMAN	glycoprotein 2 (zymogen granule membrane)	494					antigen transcytosis by M cells in mucosal-associated lymphoid tissue (GO:0002412)	anchored component of membrane (GO:0031225)|apical plasma membrane (GO:0016324)|extracellular vesicular exosome (GO:0070062)	antigen binding (GO:0003823)			breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(25)|ovary(3)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	48						CAAATCTAGAACCCGGGCTAG	0.493																																																	0													110.0	102.0	105.0					16																	20327307		2203	4300	6503	SO:0001583	missense	0			U36221	CCDS10582.2, CCDS42128.1, CCDS45432.1, CCDS45433.1	16p12.3	2008-02-05			ENSG00000169347	ENSG00000169347			4441	protein-coding gene	gene with protein product		602977				9605860	Standard	XM_005255259		Approved		uc002dgw.3	P55259	OTTHUMG00000131489	ENST00000381362.4:c.1481T>C	16.37:g.20327307A>G	ENSP00000370767:p.Val494Ala		A6NFM9|A6NJA8|Q13338|Q9UIF1	Missense_Mutation	SNP	pfam_ZP_dom,smart_ZP_dom,pfscan_ZP_dom,prints_ZP_dom	p.V494A	ENST00000381362.4	37	c.1481	CCDS42128.1	16	.	.	.	.	.	.	.	.	.	.	A	16.39	3.111021	0.56398	.	.	ENSG00000169347	ENST00000302555;ENST00000381362;ENST00000381360;ENST00000341642;ENST00000537520	D;D;D;D	0.91124	-2.79;-2.78;-1.56;-1.58	5.37	4.25	0.50352	.	.	.	.	.	D	0.93562	0.7945	M	0.72118	2.19	0.28321	N	0.922214	D;D;D;D	0.89917	0.984;0.972;1.0;0.972	P;P;D;P	0.83275	0.885;0.906;0.996;0.77	D	0.86321	0.1692	9	0.30854	T	0.27	-2.2005	8.4614	0.32929	0.8268:0.0:0.0:0.1732	.	344;472;491;494	P55259-4;B7Z1G2;P55259-3;P55259	.;.;.;GP2_HUMAN	A	491;494;347;344;472	ENSP00000304044:V491A;ENSP00000370767:V494A;ENSP00000370765:V347A;ENSP00000343861:V344A	ENSP00000304044:V491A	V	-	2	0	GP2	20234808	0.752000	0.28338	0.132000	0.22025	0.471000	0.32888	2.674000	0.46867	0.821000	0.34540	0.533000	0.62120	GTT	GP2	-	NULL	ENSG00000169347		0.493	GP2-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GP2	HGNC	protein_coding	OTTHUMT00000436920.1	-	0.00	46	0	A	NM_016295		20327307	-1	tier1	-	no_errors	ENST00000381362	ensembl	human	known	74_37	missense	11.76	30	4	SNP	0.711	G
GPC2	221914	genome.wustl.edu	37	7	99767517	99767517	+	3'UTR	SNP	C	C	A			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr7:99767517C>A	ENST00000292377.2	-	0	2243				GAL3ST4_ENST00000411994.1_5'Flank|GAL3ST4_ENST00000426974.2_5'Flank|GPC2_ENST00000471050.1_5'UTR|GAL3ST4_ENST00000413800.1_5'Flank|GAL3ST4_ENST00000482469.1_5'Flank|GAL3ST4_ENST00000360039.4_5'Flank|GAL3ST4_ENST00000423751.1_5'Flank	NM_152742.1	NP_689955.1	Q8N158	GPC2_HUMAN	glypican 2						carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|neuron differentiation (GO:0030182)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|smoothened signaling pathway (GO:0007224)	anchored component of membrane (GO:0031225)|endoplasmic reticulum (GO:0005783)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)				NS(1)|breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(8)|pancreas(1)|skin(3)	18	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					CAAACCCCTTCCCCAGCTGCA	0.547																																																	0																																										SO:0001624	3_prime_UTR_variant	0			BX375153	CCDS5689.1	7q22.1	2007-02-16	2007-02-15		ENSG00000213420	ENSG00000213420		"""Proteoglycans / Cell Surface : Glypicans"""	4450	protein-coding gene	gene with protein product	"""glypican proteoglycan 2, cerebroglycan proteoglycan"""		"""glypican 2 (cerebroglycan)"""			8294498	Standard	NM_152742		Approved	cerebroglycan, FLJ38962, DKFZp547M109	uc003utv.3	Q8N158	OTTHUMG00000154894	ENST00000292377.2:c.*336G>T	7.37:g.99767517C>A			A4D2A7	RNA	SNP	-	NULL	ENST00000292377.2	37	NULL	CCDS5689.1	7																																																																																			GPC2	-	-	ENSG00000213420		0.547	GPC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPC2	HGNC	protein_coding	OTTHUMT00000337556.1	-	0.00	50	0	C	NM_152742		99767517	-1	tier1	-	no_errors	ENST00000471050	ensembl	human	known	74_37	rna	44.26	34	27	SNP	0.002	A
GRM8	2918	genome.wustl.edu	37	7	126409920	126409920	+	Splice_Site	SNP	A	A	T			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr7:126409920A>T	ENST00000339582.2	-	7	2164	c.1356T>A	c.(1354-1356)aaT>aaA	p.N452K	GRM8_ENST00000480995.1_5'UTR|GRM8_ENST00000405249.1_Splice_Site_p.N452K|GRM8_ENST00000358373.3_Splice_Site_p.N452K|GRM8_ENST00000444921.2_Splice_Site_p.N452K			O00222	GRM8_HUMAN	glutamate receptor, metabotropic 8	452					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|negative regulation of cAMP biosynthetic process (GO:0030818)|regulation of synaptic transmission, glutamatergic (GO:0051966)|sensory perception of smell (GO:0007608)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group III metabotropic glutamate receptor activity (GO:0001642)			breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(16)|lung(62)|ovary(5)|pancreas(1)|prostate(1)|skin(14)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(4)	125		Prostate(267;0.186)				GTAACTTACCATTAAAATTTA	0.413										HNSCC(24;0.065)																																							0													101.0	94.0	96.0					7																	126409920		2203	4300	6503	SO:0001630	splice_region_variant	0				CCDS5794.1, CCDS47696.1	7q31.3-q32.1	2012-08-29			ENSG00000179603	ENSG00000179603		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4600	protein-coding gene	gene with protein product		601116				8824806	Standard	NM_000845		Approved	GLUR8, GPRC1H, mGlu8, MGLUR8	uc003vlr.2	O00222	OTTHUMG00000022888	ENST00000339582.2:c.1357+1T>A	7.37:g.126409920A>T			A4D0Y3|B0FZ74|B0M0L0|O15493|O95945|O95946|Q3MIV9|Q52M02|Q6J165	Missense_Mutation	SNP	pfam_ANF_lig-bd_rcpt,pfam_GPCR_3_C,pfam_GPCR_3_9-Cys_dom,superfamily_Peripla_BP_I,prints_GPCR_3,prints_GPCR_3_mtglu_rcpt_8,prints_GPCR_3_mtglu_rcpt,prints_GPCR_3_mtglu_rcpt_4,pfscan_GPCR_3_C	p.N452K	ENST00000339582.2	37	c.1356	CCDS5794.1	7	.	.	.	.	.	.	.	.	.	.	A	12.97	2.098154	0.37048	.	.	ENSG00000179603	ENST00000339582;ENST00000444921;ENST00000358373;ENST00000405249	D;D;D;D	0.82255	-1.59;-1.59;-1.59;-1.59	5.78	2.15	0.27550	Extracellular ligand-binding receptor (1);	0.050245	0.85682	D	0.000000	D	0.85004	0.5598	L	0.55103	1.725	0.51482	D	0.99992	B;D;B	0.71674	0.389;0.998;0.045	B;D;B	0.80764	0.124;0.994;0.06	T	0.79650	-0.1715	10	0.09843	T	0.71	.	9.4915	0.38962	0.7268:0.0:0.2732:0.0	.	452;452;452	O00222-3;O00222-2;O00222	.;.;GRM8_HUMAN	K	452	ENSP00000344173:N452K;ENSP00000409790:N452K;ENSP00000351142:N452K;ENSP00000385731:N452K	ENSP00000344173:N452K	N	-	3	2	GRM8	126197156	0.963000	0.33076	1.000000	0.80357	0.988000	0.76386	0.291000	0.18994	0.127000	0.18452	0.533000	0.62120	AAT	GRM8	-	pfam_ANF_lig-bd_rcpt,superfamily_Peripla_BP_I	ENSG00000179603		0.413	GRM8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GRM8	HGNC	protein_coding	OTTHUMT00000059209.4	-	0.00	53	0	A		Missense_Mutation	126409920	-1	tier1	-	no_errors	ENST00000339582	ensembl	human	known	74_37	missense	22.22	21	6	SNP	0.994	T
HERC3	8916	genome.wustl.edu	37	4	89601387	89601387	+	Splice_Site	SNP	G	G	T	rs377674381		TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr4:89601387G>T	ENST00000402738.1	+	20	2579	c.2340G>T	c.(2338-2340)acG>acT	p.T780T	HERC3_ENST00000264345.3_Splice_Site_p.T780T|HERC3_ENST00000543130.1_Splice_Site_p.T224T	NM_001271602.1|NM_014606.1	NP_001258531.1|NP_055421.1	Q15034	HERC3_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase 3	780					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasmic vesicle (GO:0031410)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)	p.T780T(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(10)|lung(14)|prostate(2)|skin(2)	45				OV - Ovarian serous cystadenocarcinoma(123;0.000319)		TTTCAGACACGGTAAGTAAGT	0.333																																																	1	Substitution - coding silent(1)	prostate(1)											80.0	85.0	83.0					4																	89601387		2202	4300	6502	SO:0001630	splice_region_variant	0			D25215	CCDS34028.1	4q21	2012-02-23	2012-02-23		ENSG00000138641	ENSG00000138641			4876	protein-coding gene	gene with protein product		605200	"""hect domain and RLD 3"""			10702688	Standard	NM_014606		Approved	KIAA0032	uc003hrw.2	Q15034	OTTHUMG00000150436	ENST00000402738.1:c.2340+1G>T	4.37:g.89601387G>T			A8K1S5|Q8IXX3	Silent	SNP	pfam_Reg_chr_condens,pfam_HECT,superfamily_HECT,superfamily_RCC1/BLIP-II,smart_HECT,pfscan_HECT,pfscan_Reg_chr_condens,prints_Reg_chr_condens	p.T780	ENST00000402738.1	37	c.2340	CCDS34028.1	4																																																																																			HERC3	-	pfam_HECT,superfamily_HECT,smart_HECT,pfscan_HECT	ENSG00000138641		0.333	HERC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HERC3	HGNC	protein_coding	OTTHUMT00000318081.2		0.00	34	0	G	NM_014606	Silent	89601387	+1			no_errors	ENST00000264345	ensembl	human	known	74_37	silent	5.71	33	2	SNP	0.995	T
HIVEP1	3096	genome.wustl.edu	37	6	12125356	12125356	+	Silent	SNP	C	C	T	rs539525903		TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr6:12125356C>T	ENST00000379388.2	+	4	5660	c.5328C>T	c.(5326-5328)gaC>gaT	p.D1776D	HIVEP1_ENST00000541134.1_5'Flank	NM_002114.2	NP_002105.2	P15822	ZEP1_HUMAN	human immunodeficiency virus type I enhancer binding protein 1	1776					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(11)|liver(1)|lung(31)|ovary(4)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	90	Breast(50;0.0639)|Ovarian(93;0.0816)	all_hematologic(90;0.117)				GTGCAACAGACGTGAGACCTT	0.448																																																	0													115.0	113.0	114.0					6																	12125356		1880	4111	5991	SO:0001819	synonymous_variant	0			J05011	CCDS43426.1	6p24-p22.3	2012-10-05	2001-11-28		ENSG00000095951	ENSG00000095951		"""Zinc fingers, C2H2-type"""	4920	protein-coding gene	gene with protein product		194540	"""human immunodeficiency virus type I enhancer-binding protein 1"", ""zinc finger protein 40"""	ZNF40		2037300	Standard	XR_241895		Approved	CIRIP, MBP-1, CRYBP1, PRDII-BF1, ZAS1, Schnurri-1, ZNF40A	uc003nac.3	P15822	OTTHUMG00000014265	ENST00000379388.2:c.5328C>T	6.37:g.12125356C>T			B2RTU3|Q14122|Q5MPB1|Q5VW60	Silent	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.D1776	ENST00000379388.2	37	c.5328	CCDS43426.1	6																																																																																			HIVEP1	-	NULL	ENSG00000095951		0.448	HIVEP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIVEP1	HGNC	protein_coding	OTTHUMT00000039870.2	-	0.00	16	0	C	NM_002114		12125356	+1	tier1	-	no_errors	ENST00000379388	ensembl	human	known	74_37	silent	29.41	24	10	SNP	0.000	T
HIST1H1E	3008	genome.wustl.edu	37	6	26156820	26156820	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr6:26156820G>T	ENST00000304218.3	+	1	262	c.202G>T	c.(202-204)Gcc>Tcc	p.A68S	HIST1H2BD_ENST00000377777.4_5'Flank|HIST1H2BD_ENST00000289316.2_5'Flank	NM_005321.2	NP_005312.1	P10412	H14_HUMAN	histone cluster 1, H1e	68	H15. {ECO:0000255|PROSITE- ProRule:PRU00837}.				nucleosome assembly (GO:0006334)|nucleosome positioning (GO:0016584)	extracellular vesicular exosome (GO:0070062)|nuclear heterochromatin (GO:0005720)|nucleosome (GO:0000786)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|poly(A) RNA binding (GO:0044822)			NS(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(1)|liver(1)|lung(9)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	26						AGCGCTGGCAGCCGCTGGCTA	0.627																																																	0													36.0	39.0	38.0					6																	26156820		2203	4300	6503	SO:0001583	missense	0			M60748	CCDS4586.1	6p22.1	2012-05-04	2006-10-11	2003-02-21	ENSG00000168298	ENSG00000168298		"""Histones / Replication-dependent"""	4718	protein-coding gene	gene with protein product		142220	"""H1 histone family, member 4"", ""histone 1, H1e"""	H1F4		1916825, 12408966	Standard	NM_005321		Approved	H1.4, H1e, H1s-4	uc003ngq.3	P10412	OTTHUMG00000014422	ENST00000304218.3:c.202G>T	6.37:g.26156820G>T	ENSP00000307705:p.Ala68Ser		Q4VB25	Missense_Mutation	SNP	pfam_Histone_H1/H5_H15,smart_Histone_H1/H5_H15,prints_Histone_H5	p.A68S	ENST00000304218.3	37	c.202	CCDS4586.1	6	.	.	.	.	.	.	.	.	.	.	.	25.4	4.636681	0.87760	.	.	ENSG00000168298	ENST00000304218	T	0.11277	2.79	5.11	5.11	0.69529	Histone H1/H5 (3);Winged helix-turn-helix transcription repressor DNA-binding (1);	0.118143	0.56097	D	0.000023	T	0.21631	0.0521	M	0.64997	1.995	0.80722	D	1	P	0.42248	0.774	P	0.58577	0.841	T	0.00180	-1.1949	10	0.87932	D	0	-4.424	17.8759	0.88825	0.0:0.0:1.0:0.0	.	68	P10412	H14_HUMAN	S	68	ENSP00000307705:A68S	ENSP00000307705:A68S	A	+	1	0	HIST1H1E	26264799	1.000000	0.71417	0.995000	0.50966	0.930000	0.56654	6.418000	0.73341	2.542000	0.85734	0.561000	0.74099	GCC	HIST1H1E	-	pfam_Histone_H1/H5_H15,smart_Histone_H1/H5_H15	ENSG00000168298		0.627	HIST1H1E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H1E	HGNC	protein_coding	OTTHUMT00000040084.1	-	0.00	47	0	G	NM_005321		26156820	+1	tier1	-	no_errors	ENST00000304218	ensembl	human	known	74_37	missense	10.20	44	5	SNP	1.000	T
HSD3B2	3284	genome.wustl.edu	37	1	119964528	119964528	+	Frame_Shift_Del	DEL	A	A	-			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr1:119964528delA	ENST00000543831.1	+	4	653	c.404delA	c.(403-405)gaafs	p.E135fs	HSD3B2_ENST00000369416.3_Frame_Shift_Del_p.E135fs	NM_001166120.1	NP_001159592.1	P26439	3BHS2_HUMAN	hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 2	135					androgen biosynthetic process (GO:0006702)|glucocorticoid biosynthetic process (GO:0006704)|mineralocorticoid biosynthetic process (GO:0006705)|small molecule metabolic process (GO:0044281)|steroid biosynthetic process (GO:0006694)|steroid metabolic process (GO:0008202)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrial membrane (GO:0031966)|smooth endoplasmic reticulum membrane (GO:0030868)	3-beta-hydroxy-delta5-steroid dehydrogenase activity (GO:0003854)|steroid delta-isomerase activity (GO:0004769)			breast(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(19)|ovary(2)|skin(1)	27	all_neural(166;0.187)	all_lung(203;1.06e-06)|Lung NSC(69;7.5e-06)|all_epithelial(167;0.000284)		Lung(183;0.015)|LUSC - Lung squamous cell carcinoma(189;0.0836)	Corticotropin(DB01285)|Medroxyprogesterone Acetate(DB00603)|Trilostane(DB01108)	TCCTACAAGGAAATCATCCAG	0.552																																																	0													106.0	106.0	106.0					1																	119964528		2203	4300	6503	SO:0001589	frameshift_variant	0			BC038419	CCDS902.1	1p12	2014-06-03			ENSG00000203859	ENSG00000203859	1.1.1.145, 5.3.3.1	"""Short chain dehydrogenase/reductase superfamily / Extended SDR fold"""	5218	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 11E, member 2"""	613890				1363812, 19027726	Standard	NM_000198		Approved	SDR11E2	uc001eht.3	P26439	OTTHUMG00000012526	ENST00000543831.1:c.404delA	1.37:g.119964528delA	ENSP00000445122:p.Glu135fs		A2RRA5|Q16010|Q53GD4|Q6AI10|Q6LDB9|Q99890|Q9UD08	Frame_Shift_Del	DEL	pfam_3Beta_OHSteriod_DH/Estase,pfam_Epimerase_deHydtase,pfam_Male_sterile_NAD-bd,pfam_Polysac_CapD-like,pfam_DH_sc/Rdtase_SDR,pfam_dTDP_dehydrorham_reduct,pfam_NmrA,pfam_PKS_KR	p.I136fs	ENST00000543831.1	37	c.404	CCDS902.1	1																																																																																			HSD3B2	-	pfam_3Beta_OHSteriod_DH/Estase,pfam_Epimerase_deHydtase,pfam_Male_sterile_NAD-bd,pfam_dTDP_dehydrorham_reduct	ENSG00000203859		0.552	HSD3B2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	HSD3B2	HGNC	protein_coding	OTTHUMT00000034994.1		0.00	28	0	A	NM_000198		119964528	+1	tier1		no_errors	ENST00000369416	ensembl	human	known	74_37	frame_shift_del	30.95	29	13	DEL	0.264	-
HMCN1	83872	genome.wustl.edu	37	1	186092111	186092111	+	Silent	SNP	G	G	A			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr1:186092111G>A	ENST00000271588.4	+	81	12487	c.12258G>A	c.(12256-12258)aaG>aaA	p.K4086K	HMCN1_ENST00000367492.2_Silent_p.K4086K	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	4086	Ig-like C2-type 40.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						CTCATCTAAAGGAATATGTTA	0.403																																																	0													100.0	90.0	93.0					1																	186092111		2203	4300	6503	SO:0001819	synonymous_variant	0			AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.12258G>A	1.37:g.186092111G>A			A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Silent	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_G2_nidogen/fibulin_G2F,pfam_EGF-like_Ca-bd_dom,pfam_Thrombospondin_1_rpt,superfamily_GFP,superfamily_Thrombospondin_1_rpt,superfamily_Growth_fac_rcpt_N_dom,superfamily_Cadherin-like,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Thrombospondin_1_rpt,smart_G2_nidogen/fibulin_G2F,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_G2_nidogen/fibulin_G2F,pfscan_Thrombospondin_1_rpt,pfscan_Ig-like_dom	p.K4086	ENST00000271588.4	37	c.12258	CCDS30956.1	1																																																																																			HMCN1	-	pfam_Ig_I-set,smart_Ig_sub,pfscan_Ig-like_dom	ENSG00000143341		0.403	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HMCN1	HGNC	protein_coding	OTTHUMT00000131848.1	-	0.00	30	0	G	NM_031935		186092111	+1	tier1	-	no_errors	ENST00000271588	ensembl	human	known	74_37	silent	53.85	12	14	SNP	0.111	A
HUWE1	10075	genome.wustl.edu	37	X	53579695	53579695	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chrX:53579695G>T	ENST00000342160.3	-	61	9111	c.8654C>A	c.(8653-8655)gCa>gAa	p.A2885E	HUWE1_ENST00000262854.6_Missense_Mutation_p.A2885E			Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase	2885					base-excision repair (GO:0006284)|cell differentiation (GO:0030154)|histone ubiquitination (GO:0016574)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(15)|central_nervous_system(1)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|liver(2)|lung(52)|ovary(11)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	153						GGAGCTGCCTGCTCTGGGCTG	0.597																																																	0													47.0	44.0	45.0					X																	53579695		2203	4300	6503	SO:0001583	missense	0			AB071605	CCDS35301.1	Xp11.22	2014-06-09	2012-02-23		ENSG00000086758	ENSG00000086758			30892	protein-coding gene	gene with protein product		300697	"""HECT, UBA and WWE domain containing 1"""			9205841, 10998601	Standard	NM_031407		Approved	Ib772, KIAA0312, UREB1	uc004dsp.4	Q7Z6Z7	OTTHUMG00000021617	ENST00000342160.3:c.8654C>A	X.37:g.53579695G>T	ENSP00000340648:p.Ala2885Glu		O15029|Q4G2Z2|Q5H961|Q6P4D0|Q8NG67|Q9BUI0|Q9HCJ4|Q9NSL6|Q9P0A9	Missense_Mutation	SNP	pfam_E3_Ub_ligase_DUF913,pfam_HECT,pfam_E3_Ub_ligase_DUF908,pfam_WWE-dom,pfam_UBA/Ts_N,superfamily_HECT,superfamily_UBA-like,superfamily_ARM-type_fold,smart_UBA/transl_elong_EF1B_N_euk,smart_HECT,pfscan_HECT,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_WWE-dom	p.A2885E	ENST00000342160.3	37	c.8654	CCDS35301.1	X	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	10.03|10.03	1.238702|1.238702	0.22711|0.22711	.|.	.|.	ENSG00000086758|ENSG00000086758	ENST00000342160;ENST00000262854|ENST00000427052	T;T|.	0.37235|.	1.21;1.21|.	5.58|5.58	2.77|2.77	0.32553|0.32553	.|.	0.502966|.	0.19842|.	N|.	0.104834|.	T|T	0.24392|0.24392	0.0591|0.0591	N|N	0.08118|0.08118	0|0	0.34039|0.34039	D|D	0.654786|0.654786	B;B|.	0.02656|.	0.0;0.0|.	B;B|.	0.04013|.	0.0;0.001|.	T|T	0.25813|0.25813	-1.0121|-1.0121	10|5	0.10111|.	T|.	0.7|.	.|.	5.2051|5.2051	0.15287|0.15287	0.2499:0.1523:0.5978:0.0|0.2499:0.1523:0.5978:0.0	.|.	2885;2885|.	Q7Z6Z7;Q7Z6Z7-2|.	HUWE1_HUMAN;.|.	E|R	2885|1918	ENSP00000340648:A2885E;ENSP00000262854:A2885E|.	ENSP00000262854:A2885E|.	A|S	-|-	2|3	0|2	HUWE1|HUWE1	53596420|53596420	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.857000|0.857000	0.48899|0.48899	1.921000|1.921000	0.40035|0.40035	0.613000|0.613000	0.30089|0.30089	0.600000|0.600000	0.82982|0.82982	GCA|AGC	HUWE1	-	NULL	ENSG00000086758		0.597	HUWE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HUWE1	HGNC	protein_coding	OTTHUMT00000056766.1	-	0.00	20	0	G	XM_497119		53579695	-1	tier1	-	no_errors	ENST00000262854	ensembl	human	known	74_37	missense	25.00	8	3	SNP	0.973	T
IGDCC4	57722	genome.wustl.edu	37	15	65686860	65686860	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr15:65686860G>T	ENST00000352385.2	-	9	1812	c.1603C>A	c.(1603-1605)Ctg>Atg	p.L535M		NM_020962.1	NP_066013.1	Q8TDY8	IGDC4_HUMAN	immunoglobulin superfamily, DCC subclass, member 4	535	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(24)|ovary(1)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)	44						GGGCTGGACAGGGAGAGCTGG	0.607																																																	0													63.0	59.0	60.0					15																	65686860		2201	4299	6500	SO:0001583	missense	0				CCDS10206.1	15q22.31	2013-02-11			ENSG00000103742	ENSG00000103742		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	13770	protein-coding gene	gene with protein product	"""likely ortholog of mouse neighbor of Punc E11"""						Standard	NM_020962		Approved	NOPE, LOC57722	uc002aou.1	Q8TDY8	OTTHUMG00000133136	ENST00000352385.2:c.1603C>A	15.37:g.65686860G>T	ENSP00000319623:p.Leu535Met		Q9HCE4	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.L535M	ENST00000352385.2	37	c.1603	CCDS10206.1	15	.	.	.	.	.	.	.	.	.	.	G	18.70	3.679730	0.68042	.	.	ENSG00000103742	ENST00000352385;ENST00000356152	T	0.58652	0.32	5.58	3.32	0.38043	Fibronectin, type III (5);Immunoglobulin-like fold (1);	0.075404	0.56097	D	0.000040	T	0.78110	0.4232	M	0.88704	2.975	0.38500	D	0.948201	D	0.89917	1.0	D	0.81914	0.995	D	0.84417	0.0569	10	0.72032	D	0.01	-5.6283	13.609	0.62065	0.1499:0.0:0.8501:0.0	.	535	Q8TDY8	IGDC4_HUMAN	M	535;264	ENSP00000319623:L535M	ENSP00000319623:L535M	L	-	1	2	IGDCC4	63473913	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	2.351000	0.44071	1.329000	0.45376	0.650000	0.86243	CTG	IGDCC4	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000103742		0.607	IGDCC4-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	IGDCC4	HGNC	protein_coding	OTTHUMT00000256825.2	-	0.00	25	0	G	NM_020962		65686860	-1	tier1	-	no_errors	ENST00000352385	ensembl	human	novel	74_37	missense	11.76	30	4	SNP	1.000	T
IGSF9B	22997	genome.wustl.edu	37	11	133794746	133794746	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr11:133794746C>A	ENST00000321016.8	-	15	2318	c.2088G>T	c.(2086-2088)gaG>gaT	p.E696D	IGSF9B_ENST00000533871.2_Missense_Mutation_p.E696D			Q9UPX0	TUTLB_HUMAN	immunoglobulin superfamily, member 9B	696	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				homophilic cell adhesion (GO:0007156)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)	dendrite (GO:0030425)|inhibitory synapse (GO:0060077)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)				breast(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(18)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	44	all_hematologic(175;0.127)	all_cancers(12;1.58e-21)|all_epithelial(12;5.17e-16)|all_lung(97;1.6e-05)|Lung NSC(97;3.86e-05)|Breast(109;0.000126)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)		Epithelial(10;7.19e-10)|BRCA - Breast invasive adenocarcinoma(10;9.69e-09)|all cancers(11;1.23e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00328)|Lung(977;0.221)		TGTTGCTGGGCTCGCTGATCA	0.572																																																	0													108.0	118.0	114.0					11																	133794746		2079	4210	6289	SO:0001583	missense	0			AK097578	CCDS61010.1	11q25	2013-02-11	2005-10-12	2005-11-20				"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	32326	protein-coding gene	gene with protein product		613773					Standard	NM_001277285		Approved	KIAA1030	uc031qfh.1	Q9UPX0		ENST00000321016.8:c.2088G>T	11.37:g.133794746C>A	ENSP00000317980:p.Glu696Asp		G5EA26	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.E696D	ENST00000321016.8	37	c.2088		11	.	.	.	.	.	.	.	.	.	.	C	12.31	1.900300	0.33535	.	.	ENSG00000080854	ENST00000321016;ENST00000533871;ENST00000527648	T;T;T	0.58060	0.36;0.36;0.36	5.02	3.13	0.36017	Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.000000	0.40728	N	0.001029	T	0.42517	0.1206	L	0.46157	1.445	0.35789	D	0.822276	B	0.29508	0.246	B	0.34038	0.174	T	0.45411	-0.9263	10	0.24483	T	0.36	.	7.3866	0.26886	0.0:0.7043:0.0:0.2957	.	696	Q9UPX0	TUTLB_HUMAN	D	696;538;696	ENSP00000317980:E696D;ENSP00000436552:E538D;ENSP00000436576:E696D	ENSP00000317980:E696D	E	-	3	2	IGSF9B	133299956	0.994000	0.37717	1.000000	0.80357	0.999000	0.98932	0.398000	0.20899	1.252000	0.44001	0.655000	0.94253	GAG	IGSF9B	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000080854		0.572	IGSF9B-201	KNOWN	basic|appris_candidate	protein_coding	IGSF9B	HGNC	protein_coding		-	0.00	43	0	C	XM_290502		133794746	-1	tier1	-	no_errors	ENST00000321016	ensembl	human	known	74_37	missense	70.83	7	17	SNP	1.000	A
INTU	27152	genome.wustl.edu	37	4	128584699	128584699	+	Missense_Mutation	SNP	A	A	G			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr4:128584699A>G	ENST00000335251.6	+	4	1035	c.932A>G	c.(931-933)tAt>tGt	p.Y311C	INTU_ENST00000296461.5_Missense_Mutation_p.Y311C	NM_015693.3	NP_056508.2	Q9ULD6	INTU_HUMAN	inturned planar cell polarity protein	311					cilium assembly (GO:0042384)|hair follicle morphogenesis (GO:0031069)|keratinocyte differentiation (GO:0030216)|limb development (GO:0060173)|negative regulation of cell division (GO:0051782)|negative regulation of keratinocyte proliferation (GO:0010839)|nervous system development (GO:0007399)|positive regulation of smoothened signaling pathway (GO:0045880)|regulation of smoothened signaling pathway (GO:0008589)|spinal cord dorsal/ventral patterning (GO:0021513)	cytoplasm (GO:0005737)				breast(3)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(8)|liver(2)|lung(17)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	43						ATCATTATGTATCTCACACTA	0.423																																																	0													108.0	109.0	109.0					4																	128584699		2203	4300	6503	SO:0001583	missense	0			BC051698	CCDS34061.1	4q28.2	2013-03-05	2013-03-05	2006-10-24	ENSG00000164066	ENSG00000164066			29239	protein-coding gene	gene with protein product		610621	"""PDZ domain containing 6"", ""inturned planar cell polarity effector homolog (Drosophila)"""	PDZK6, PDZD6		10574462, 21761479	Standard	NM_015693		Approved	KIAA1284	uc003ifk.2	Q9ULD6	OTTHUMG00000161202	ENST00000335251.6:c.932A>G	4.37:g.128584699A>G	ENSP00000334003:p.Tyr311Cys		A1L4N5|D6RAE6|D6RBT4|Q4W5I8|Q86V55	Missense_Mutation	SNP	superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.Y311C	ENST00000335251.6	37	c.932	CCDS34061.1	4	.	.	.	.	.	.	.	.	.	.	A	13.33	2.203626	0.38905	.	.	ENSG00000164066	ENST00000335251;ENST00000296461	T	0.55760	0.5	4.74	2.29	0.28610	.	0.245252	0.35525	N	0.003159	T	0.45115	0.1326	M	0.68952	2.095	0.46499	D	0.999078	P	0.35272	0.493	B	0.32928	0.155	T	0.40720	-0.9548	10	0.87932	D	0	-10.3833	5.9291	0.19128	0.7706:0.0:0.0824:0.147	.	311	Q9ULD6	PDZD6_HUMAN	C	311	ENSP00000296461:Y311C	ENSP00000296461:Y311C	Y	+	2	0	INTU	128804149	1.000000	0.71417	0.960000	0.40013	0.400000	0.30750	2.801000	0.47908	0.402000	0.25451	0.477000	0.44152	TAT	INTU	-	NULL	ENSG00000164066		0.423	INTU-003	KNOWN	basic|appris_principal|CCDS	protein_coding	INTU	HGNC	protein_coding	OTTHUMT00000364147.2	-	0.00	18	0	A	XM_371707		128584699	+1	tier1	-	no_errors	ENST00000335251	ensembl	human	known	74_37	missense	83.33	2	10	SNP	0.996	G
ITGA2B	3674	genome.wustl.edu	37	17	42466775	42466775	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr17:42466775G>T	ENST00000262407.5	-	1	98	c.67C>A	c.(67-69)Cct>Act	p.P23T	ITGA2B_ENST00000353281.4_Missense_Mutation_p.P23T	NM_000419.3	NP_000410.2	P08514	ITA2B_HUMAN	integrin, alpha 2b (platelet glycoprotein IIb of IIb/IIIa complex, antigen CD41)	23				P -> A (in Ref. 2; AAA35926). {ECO:0000305}.	axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of leukocyte migration (GO:0002687)	blood microparticle (GO:0072562)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)|platelet alpha granule membrane (GO:0031092)	extracellular matrix binding (GO:0050840)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)			biliary_tract(1)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|lung(8)|ovary(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	36		Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.191)	Abciximab(DB00054)|Tirofiban(DB00775)	GCAGCACAAGGTCCCAAGAGC	0.582																																																	0													82.0	82.0	82.0					17																	42466775		2203	4300	6503	SO:0001583	missense	0				CCDS32665.1	17q21.32	2014-09-17	2006-02-22			ENSG00000005961		"""CD molecules"", ""Integrins"""	6138	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 93"""	607759	"""integrin, alpha 2b (platelet glycoprotein IIb of IIb/IIIa complex, antigen CD41B)"""	GP2B			Standard	NM_000419		Approved	CD41B, CD41, PPP1R93	uc002igt.1	P08514		ENST00000262407.5:c.67C>A	17.37:g.42466775G>T	ENSP00000262407:p.Pro23Thr		B2RCY8|O95366|Q14443|Q17R67	Missense_Mutation	SNP	pfam_Integrin_alpha-2,pfam_FG-GAP,pfam_Integrin_alpha_C_CS,smart_Int_alpha_beta-p,prints_Integrin_alpha	p.P23T	ENST00000262407.5	37	c.67	CCDS32665.1	17	.	.	.	.	.	.	.	.	.	.	G	16.58	3.162999	0.57476	.	.	ENSG00000005961	ENST00000262407;ENST00000353281	D;D	0.92048	-2.96;-2.96	5.82	4.85	0.62838	.	0.000000	0.34932	N	0.003571	D	0.91503	0.7317	M	0.75447	2.3	0.80722	D	1	P	0.43024	0.798	B	0.42062	0.374	D	0.91094	0.4909	10	0.51188	T	0.08	.	12.5647	0.56304	0.0806:0.0:0.9194:0.0	.	23	P08514	ITA2B_HUMAN	T	23	ENSP00000262407:P23T;ENSP00000340536:P23T	ENSP00000262407:P23T	P	-	1	0	ITGA2B	39822301	0.990000	0.36364	0.793000	0.32043	0.545000	0.35147	4.839000	0.62810	1.457000	0.47850	0.561000	0.74099	CCT	ITGA2B	-	NULL	ENSG00000005961		0.582	ITGA2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGA2B	HGNC	protein_coding	OTTHUMT00000439823.1		0.00	39	0	G			42466775	-1			no_errors	ENST00000262407	ensembl	human	known	74_37	missense	5.66	50	3	SNP	0.963	T
ITGAX	3687	genome.wustl.edu	37	16	31373951	31373951	+	Silent	SNP	C	C	G			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr16:31373951C>G	ENST00000268296.4	+	12	1357	c.1236C>G	c.(1234-1236)gcC>gcG	p.A412A	ITGAX_ENST00000562522.1_Silent_p.A412A	NM_000887.3	NP_000878.2	P20702	ITAX_HUMAN	integrin, alpha X (complement component 3 receptor 4 subunit)	412					blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|organ morphogenesis (GO:0009887)	cell surface (GO:0009986)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|receptor activity (GO:0004872)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(42)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	77						CCGAGCTGGCCCTCTGGAAAG	0.672																																																	0													18.0	19.0	18.0					16																	31373951		2197	4297	6494	SO:0001819	synonymous_variant	0			BC038237	CCDS10711.1, CCDS67014.1	16p11.2	2010-03-23	2006-02-10		ENSG00000140678	ENSG00000140678		"""CD molecules"", ""Complement system"", ""Integrins"""	6152	protein-coding gene	gene with protein product		151510	"""integrin, alpha X (antigen CD11C (p150), alpha polypeptide)"""	CD11C		3284962, 2303426	Standard	NM_001286375		Approved	CD11c	uc002ebu.1	P20702	OTTHUMG00000132465	ENST00000268296.4:c.1236C>G	16.37:g.31373951C>G			Q8IVA6	Silent	SNP	pfam_Integrin_alpha-2,pfam_VWF_A,pfam_FG-GAP,pfam_Integrin_alpha_C_CS,smart_Int_alpha_beta-p,smart_VWF_A,pfscan_VWF_A,prints_Integrin_alpha	p.A412	ENST00000268296.4	37	c.1236	CCDS10711.1	16																																																																																			ITGAX	-	smart_Int_alpha_beta-p,prints_Integrin_alpha	ENSG00000140678		0.672	ITGAX-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ITGAX	HGNC	protein_coding	OTTHUMT00000255628.2	-	0.00	33	0	C	NM_000887		31373951	+1	tier1	-	no_errors	ENST00000268296	ensembl	human	known	74_37	silent	26.32	13	5	SNP	0.001	G
ITGB1	3688	genome.wustl.edu	37	10	33196044	33196044	+	Intron	SNP	T	T	C			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr10:33196044T>C	ENST00000396033.2	-	15	2467				ITGB1_ENST00000374956.4_Intron|ITGB1_ENST00000423113.1_Missense_Mutation_p.I787V|ITGB1_ENST00000302278.3_Intron	NM_133376.2	NP_596867.1	P05556	ITB1_HUMAN	integrin, beta 1 (fibronectin receptor, beta polypeptide, antigen CD29 includes MDF2, MSK12)						axon extension (GO:0048675)|axon guidance (GO:0007411)|B cell differentiation (GO:0030183)|blood coagulation (GO:0007596)|calcium-independent cell-matrix adhesion (GO:0007161)|cardiac muscle cell differentiation (GO:0055007)|cell fate specification (GO:0001708)|cell junction assembly (GO:0034329)|cell migration (GO:0016477)|cell migration involved in sprouting angiogenesis (GO:0002042)|cell-cell adhesion mediated by integrin (GO:0033631)|cell-matrix adhesion (GO:0007160)|cell-substrate adhesion (GO:0031589)|cellular calcium ion homeostasis (GO:0006874)|cellular defense response (GO:0006968)|cellular response to ionizing radiation (GO:0071479)|cellular response to mechanical stimulus (GO:0071260)|cellular response to vitamin D (GO:0071305)|extracellular matrix organization (GO:0030198)|formation of radial glial scaffolds (GO:0021943)|G1/S transition of mitotic cell cycle (GO:0000082)|germ cell migration (GO:0008354)|heterotypic cell-cell adhesion (GO:0034113)|homophilic cell adhesion (GO:0007156)|in utero embryonic development (GO:0001701)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte tethering or rolling (GO:0050901)|maternal process involved in female pregnancy (GO:0060135)|mesodermal cell differentiation (GO:0048333)|negative regulation of anoikis (GO:2000811)|negative regulation of cell projection organization (GO:0031345)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron differentiation (GO:0045665)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of endocytosis (GO:0045807)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|protein transport within lipid bilayer (GO:0032594)|regulation of cell cycle (GO:0051726)|regulation of collagen catabolic process (GO:0010710)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|regulation of immune response (GO:0050776)|response to activity (GO:0014823)|response to drug (GO:0042493)|response to gonadotropin (GO:0034698)|response to transforming growth factor beta (GO:0071559)|sarcomere organization (GO:0045214)|tight junction assembly (GO:0070830)|tissue homeostasis (GO:0001894)|viral process (GO:0016032)	acrosomal vesicle (GO:0001669)|basement membrane (GO:0005604)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integrin alpha1-beta1 complex (GO:0034665)|integrin alpha10-beta1 complex (GO:0034680)|integrin alpha11-beta1 complex (GO:0034681)|integrin alpha2-beta1 complex (GO:0034666)|integrin alpha3-beta1 complex (GO:0034667)|integrin alpha7-beta1 complex (GO:0034677)|integrin alpha8-beta1 complex (GO:0034678)|integrin alpha9-beta1 complex (GO:0034679)|integrin complex (GO:0008305)|intercalated disc (GO:0014704)|invadopodium membrane (GO:0071438)|membrane (GO:0016020)|membrane raft (GO:0045121)|myelin sheath abaxonal region (GO:0035748)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|ruffle (GO:0001726)|ruffle membrane (GO:0032587)|sarcolemma (GO:0042383)	actin binding (GO:0003779)|cell adhesion molecule binding (GO:0050839)|collagen binding involved in cell-matrix adhesion (GO:0098639)|metal ion binding (GO:0046872)|peptide binding (GO:0042277)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|virus receptor activity (GO:0001618)			autonomic_ganglia(1)|breast(2)|endometrium(5)|kidney(2)|large_intestine(8)|lung(11)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	37		Ovarian(717;1.34e-05)|Breast(68;0.0634)			Antithymocyte globulin(DB00098)	AAATTATTAATAGGACTCTTG	0.313																																																	0													141.0	147.0	145.0					10																	33196044		2203	4300	6503	SO:0001627	intron_variant	0			BC020057	CCDS7174.1	10p11.2	2010-10-13			ENSG00000150093	ENSG00000150093		"""CD molecules"", ""Integrins"""	6153	protein-coding gene	gene with protein product		135630		FNRB, MSK12, MDF2		2524991	Standard	NM_033668		Approved	CD29, GPIIA	uc001iwt.4	P05556	OTTHUMG00000017928	ENST00000396033.2:c.2331+1251A>G	10.37:g.33196044T>C			A8K6N2|D3DRX9|D3DRY3|D3DRY4|D3DRY5|P78466|P78467|Q13089|Q13090|Q13091|Q13212|Q14622|Q14647|Q29RW2|Q7Z3V1|Q8WUM6	Missense_Mutation	SNP	pirsf_Integrin_bsu,pfam_Integrin_bsu_N,pfam_Integrin_bsu_tail,pfam_Integrin_bsu_cyt_dom,pfam_EGF_extracell,superfamily_Integrin_bsu_tail,superfamily_Plexin-like_fold,smart_Plexin-like_fold,smart_Integrin_bsu_N,prints_Integrin_bsu	p.I787V	ENST00000396033.2	37	c.2359	CCDS7174.1	10	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	5.994|5.994	0.367262|0.367262	0.11352|0.11352	.|.	.|.	ENSG00000150093|ENSG00000150093	ENST00000423113|ENST00000488427	D|.	0.87729|.	-2.29|.	6.06|6.06	4.94|4.94	0.65067|0.65067	.|.	.|.	.|.	.|.	.|.	T|T	0.40196|0.40196	0.1107|0.1107	.|.	.|.	.|.	0.19945|0.19945	N|N	0.999945|0.999945	B|.	0.02656|.	0.0|.	B|.	0.04013|.	0.001|.	T|T	0.24764|0.24764	-1.0151|-1.0151	8|4	0.27785|.	T|.	0.31|.	.|.	10.7235|10.7235	0.46055|0.46055	0.0:0.0714:0.0:0.9286|0.0:0.0714:0.0:0.9286	.|.	787|.	P05556-5|.	.|.	V|C	787|55	ENSP00000388694:I787V|.	ENSP00000388694:I787V|.	I|Y	-|-	1|2	0|0	ITGB1|ITGB1	33236050|33236050	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.982000|0.982000	0.71751|0.71751	6.288000|6.288000	0.72679|0.72679	1.126000|1.126000	0.42016|0.42016	0.528000|0.528000	0.53228|0.53228	ATT|TAT	ITGB1	-	pirsf_Integrin_bsu,pfam_Integrin_bsu_cyt_dom,prints_Integrin_bsu	ENSG00000150093		0.313	ITGB1-202	KNOWN	basic|appris_candidate|CCDS	protein_coding	ITGB1	HGNC	protein_coding	OTTHUMT00000047496.1	-	0.00	34	0	T	NM_002211		33196044	-1	tier1	-	no_errors	ENST00000423113	ensembl	human	known	74_37	missense	72.73	9	24	SNP	1.000	C
KIAA1731	85459	genome.wustl.edu	37	11	93440055	93440055	+	Missense_Mutation	SNP	A	A	G			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr11:93440055A>G	ENST00000325212.6	+	18	5903	c.5741A>G	c.(5740-5742)gAt>gGt	p.D1914G	KIAA1731_ENST00000531700.1_Missense_Mutation_p.D94G|KIAA1731_ENST00000411936.1_Missense_Mutation_p.D1914G|KIAA1731_ENST00000344196.4_Missense_Mutation_p.D94G			Q9C0D2	K1731_HUMAN	KIAA1731	1914						centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)	11		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)				GATGACTATGATGAAGCAGGT	0.383																																																	0													154.0	137.0	142.0					11																	93440055		692	1591	2283	SO:0001583	missense	0			AB051518	CCDS44708.1	11q21	2014-03-11			ENSG00000166004	ENSG00000166004			29366	protein-coding gene	gene with protein product						20844083	Standard	NM_033395		Approved		uc009ywb.1	Q9C0D2	OTTHUMG00000167449	ENST00000325212.6:c.5741A>G	11.37:g.93440055A>G	ENSP00000316681:p.Asp1914Gly		C9J5H9|C9JQY8|Q8N7L4|Q8N919|Q8N9B0|Q96LT8	Missense_Mutation	SNP	NULL	p.D1914G	ENST00000325212.6	37	c.5741	CCDS44708.1	11	.	.	.	.	.	.	.	.	.	.	A	15.05	2.717583	0.48622	.	.	ENSG00000166004	ENST00000325212;ENST00000411936;ENST00000344196;ENST00000531700;ENST00000530425	T;T;T;T;T	0.48201	0.82;0.82;0.82;0.82;0.82	5.14	1.0	0.19881	.	1.300170	0.05670	N	0.588429	T	0.41119	0.1145	L	0.48642	1.525	0.09310	N	1	B;P	0.36909	0.386;0.573	B;B	0.36666	0.124;0.23	T	0.26503	-1.0101	10	0.16420	T	0.52	-1.5362	10.2494	0.43360	0.4579:0.5421:0.0:0.0	.	1914;94	Q9C0D2;Q9C0D2-2	K1731_HUMAN;.	G	1914;1914;94;94;94	ENSP00000316681:D1914G;ENSP00000406505:D1914G;ENSP00000341318:D94G;ENSP00000437323:D94G;ENSP00000431853:D94G	ENSP00000316681:D1914G	D	+	2	0	KIAA1731	93079703	0.015000	0.18098	0.015000	0.15790	0.188000	0.23474	0.064000	0.14437	0.313000	0.23062	0.533000	0.62120	GAT	KIAA1731	-	NULL	ENSG00000166004		0.383	KIAA1731-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	KIAA1731	HGNC	protein_coding	OTTHUMT00000394640.1	-	0.00	63	0	A	NM_033395		93440055	+1	tier1	-	no_errors	ENST00000411936	ensembl	human	known	74_37	missense	11.76	30	4	SNP	0.015	G
KMT2D	8085	genome.wustl.edu	37	12	49431645	49431646	+	Frame_Shift_Ins	INS	-	-	C			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr12:49431645_49431646insC	ENST00000301067.7	-	34	9492_9493	c.9493_9494insG	c.(9493-9495)gatfs	p.D3165fs	KMT2D_ENST00000549743.1_5'Flank	NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	3165					chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)										CATCCGGGTATCCCGGCTGCCC	0.619																																																	0																																										SO:0001589	frameshift_variant	0			AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.9494dupG	12.37:g.49431648_49431648dupC	ENSP00000301067:p.Asp3165fs		O14687	Frame_Shift_Ins	INS	pfam_Znf_PHD-finger,pfam_SET_dom,pfam_FYrich_C,pfam_FYrich_N,superfamily_Znf_FYVE_PHD,superfamily_HMG_box_dom,smart_Znf_PHD,smart_Znf_RING,smart_HMG_box_dom,smart_FYrich_N,smart_FYrich_C,smart_SET_dom,smart_Post-SET_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_PHD-finger,pfscan_Znf_RING	p.D3165fs	ENST00000301067.7	37	c.9494_9493	CCDS44873.1	12																																																																																			KMT2D	-	NULL	ENSG00000167548		0.619	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KMT2D	HGNC	protein_coding	OTTHUMT00000390183.2		0.00	23	0	-			49431646	-1	tier1		no_errors	ENST00000301067	ensembl	human	known	74_37	frame_shift_ins	43.75	9	7	INS	0.987:1.000	C
KPNA1	3836	genome.wustl.edu	37	3	122144649	122144649	+	3'UTR	SNP	A	A	G			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr3:122144649A>G	ENST00000344337.6	-	0	2976				RP11-299J3.8_ENST00000608015.1_RNA|RP11-299J3.8_ENST00000608346.1_RNA|RP11-299J3.8_ENST00000609469.1_RNA|KPNA1_ENST00000466923.1_5'Flank|RP11-299J3.8_ENST00000608756.1_RNA	NM_002264.3	NP_002255.3	P52294	IMA5_HUMAN	karyopherin alpha 1 (importin alpha 5)						apoptotic DNA fragmentation (GO:0006309)|apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cytokine-mediated signaling pathway (GO:0019221)|intracellular transport of virus (GO:0075733)|NLS-bearing protein import into nucleus (GO:0006607)|positive regulation of protein import into nucleus (GO:0042307)|regulation of DNA recombination (GO:0000018)|viral life cycle (GO:0019058)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|nuclear pore (GO:0005643)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nuclear localization sequence binding (GO:0008139)|protein transporter activity (GO:0008565)			NS(1)|breast(1)|cervix(2)|endometrium(2)|kidney(1)|large_intestine(7)|lung(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	21				GBM - Glioblastoma multiforme(114;0.0898)		CACTGTTCTTATTTGGGTTAA	0.388																																					Melanoma(12;340 801 11196 19797)												0																																										SO:0001624	3_prime_UTR_variant	0			S75295	CCDS3013.1	3q21	2013-02-14			ENSG00000114030	ENSG00000114030		"""Importins"", ""Armadillo repeat containing"""	6394	protein-coding gene	gene with protein product		600686				8052633	Standard	NM_002264		Approved	SRP1, RCH2, NPI-1, IPOA5	uc003efe.2	P52294	OTTHUMG00000159487	ENST00000344337.6:c.*1183T>C	3.37:g.122144649A>G			D3DN93|Q6IBQ9|Q9BQ56	RNA	SNP	-	NULL	ENST00000344337.6	37	NULL	CCDS3013.1	3																																																																																			KPNA1	-	-	ENSG00000114030		0.388	KPNA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KPNA1	HGNC	protein_coding	OTTHUMT00000355740.1	-	0.00	34	0	A	NM_002264		122144649	-1	tier1	-	no_errors	ENST00000470904	ensembl	human	known	74_37	rna	62.86	13	22	SNP	0.233	G
LINC00623	728855	genome.wustl.edu	37	1	149581234	149581235	+	RNA	INS	-	-	T	rs368537587		TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr1:149581234_149581235insT	ENST00000598569.1	+	0	711_712																											GAGACCTCACATTTTTTTCACC	0.262																																																	0																																												0																															1.37:g.149581241_149581241dupT				RNA	INS	-	NULL	ENST00000598569.1	37	NULL		1																																																																																			RP11-353N4.6	-	-	ENSG00000269501		0.262	RP11-353N4.6-002	KNOWN	basic	processed_transcript	LINC00623	Clone_based_vega_gene	pseudogene	OTTHUMT00000462966.1		0.00	31	0	-			149581235	+1	tier1		no_errors	ENST00000598569	ensembl	human	known	74_37	rna	9.30	39	4	INS	0.000:0.005	T
LINC00302	388699	genome.wustl.edu	37	1	152627985	152627985	+	lincRNA	SNP	G	G	C			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr1:152627985G>C	ENST00000444515.1	+	0	33									long intergenic non-protein coding RNA 302																		ACCAGGGTGAGTGGATCTTTT	0.522																																																	0																																												0			AF005082		1q21.3	2012-10-12	2011-08-10	2011-08-10	ENSG00000176075	ENSG00000176075		"""Long non-coding RNAs"""	31825	non-coding RNA	RNA, long non-coding			"""chromosome 1 open reading frame 46"", ""non-protein coding RNA 302"""	C1orf46, NCRNA00302		9344646	Standard			Approved	XP33			OTTHUMG00000012386		1.37:g.152627985G>C				RNA	SNP	-	NULL	ENST00000444515.1	37	NULL		1																																																																																			LINC00302	-	-	ENSG00000176075		0.522	LINC00302-001	KNOWN	non_canonical_conserved|basic	lincRNA	LINC00302	HGNC	lincRNA	OTTHUMT00000034506.2	-	0.00	29	0	G			152627985	+1	tier1	-	no_errors	ENST00000444515	ensembl	human	known	74_37	rna	27.27	16	6	SNP	0.995	C
LMAN2L	81562	genome.wustl.edu	37	2	97373133	97373133	+	Missense_Mutation	SNP	T	T	A			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr2:97373133T>A	ENST00000264963.4	-	8	929	c.907A>T	c.(907-909)Aca>Tca	p.T303S	LMAN2L_ENST00000426463.2_Missense_Mutation_p.T169S|LMAN2L_ENST00000534882.1_Missense_Mutation_p.T158S|LMAN2L_ENST00000537039.1_Missense_Mutation_p.T165S|LMAN2L_ENST00000377079.4_Missense_Mutation_p.T314S|FER1L5_ENST00000457909.1_RNA	NM_030805.3	NP_110432.1	Q9H0V9	LMA2L_HUMAN	lectin, mannose-binding 2-like	303					ER to Golgi vesicle-mediated transport (GO:0006888)|protein folding (GO:0006457)|protein transport (GO:0015031)	endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle (GO:0030134)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	mannose binding (GO:0005537)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(1)|lung(2)|skin(1)|urinary_tract(1)	7						AGTGGAGCTGTCACTGAGGAA	0.512																																																	0													28.0	26.0	27.0					2																	97373133		2202	4299	6501	SO:0001583	missense	0			AL136617	CCDS2023.1, CCDS46365.1	2q11.1	2008-02-05			ENSG00000114988	ENSG00000114988			19263	protein-coding gene	gene with protein product		609552				12609988	Standard	NM_001142292		Approved	DKFZp564L2423, VIPL	uc002swv.3	Q9H0V9	OTTHUMG00000130453	ENST00000264963.4:c.907A>T	2.37:g.97373133T>A	ENSP00000264963:p.Thr303Ser		B4DSH3|D3DXH6|Q53GV3|Q53S67|Q63HN6|Q8NBQ6|Q9BQ14	Missense_Mutation	SNP	pfam_Lectin_leg,superfamily_ConA-like_lec_gl_sf	p.T314S	ENST00000264963.4	37	c.940	CCDS2023.1	2	.	.	.	.	.	.	.	.	.	.	T	9.347	1.064511	0.20067	.	.	ENSG00000114988	ENST00000264963;ENST00000377079;ENST00000426463;ENST00000537039;ENST00000534882	T;T;T;T;T	0.76578	0.98;0.99;-1.03;-1.01;-1.02	5.44	4.2	0.49525	.	1.392810	0.03994	N	0.295345	T	0.59280	0.2182	N	0.14661	0.345	0.39900	D	0.973884	B;B;B;B;B	0.10296	0.001;0.0;0.001;0.003;0.001	B;B;B;B;B	0.06405	0.001;0.002;0.001;0.002;0.002	T	0.60161	-0.7317	10	0.09590	T	0.72	.	3.3012	0.06984	0.1762:0.1617:0.0:0.6622	.	158;176;169;314;303	B4DVH1;B4DI83;B4DSH3;Q9H0V9-2;Q9H0V9	.;.;.;.;LMA2L_HUMAN	S	303;314;169;165;158	ENSP00000264963:T303S;ENSP00000366280:T314S;ENSP00000396391:T169S;ENSP00000441701:T165S;ENSP00000438501:T158S	ENSP00000264963:T303S	T	-	1	0	LMAN2L	96736860	0.998000	0.40836	1.000000	0.80357	0.959000	0.62525	1.412000	0.34714	2.183000	0.69458	0.533000	0.62120	ACA	LMAN2L	-	NULL	ENSG00000114988		0.512	LMAN2L-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	LMAN2L	HGNC	protein_coding	OTTHUMT00000252844.1	-	0.00	29	0	T	NM_030805		97373133	-1	tier1	-	no_errors	ENST00000377079	ensembl	human	known	74_37	missense	37.04	17	10	SNP	0.953	A
LMNB2	84823	genome.wustl.edu	37	19	2434295	2434295	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr19:2434295C>G	ENST00000582871.1	-	7	1226	c.1140G>C	c.(1138-1140)gaG>gaC	p.E380D	LMNB2_ENST00000475819.1_5'Flank|LMNB2_ENST00000325327.3_Missense_Mutation_p.E400D	NM_032737.3	NP_116126.3	Q03252	LMNB2_HUMAN	lamin B2	380	Coil 2.|Rod.					lamin filament (GO:0005638)|nuclear inner membrane (GO:0005637)	structural molecule activity (GO:0005198)			NS(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	18		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TGCCGCACCTCTCCTCCTCGC	0.687																																																	0													39.0	31.0	34.0					19																	2434295		2200	4299	6499	SO:0001583	missense	0			M94362	CCDS12090.1, CCDS12090.2	19p13.3	2013-01-16			ENSG00000176619	ENSG00000176619		"""Intermediate filaments type V, lamins"""	6638	protein-coding gene	gene with protein product		150341		LMN2		1630457	Standard	NM_032737		Approved		uc002lvy.4	Q03252	OTTHUMG00000150626	ENST00000582871.1:c.1140G>C	19.37:g.2434295C>G	ENSP00000462730:p.Glu380Asp		O75292|Q14734|Q96DF6	Missense_Mutation	SNP	pfam_IF,pfam_Lamin_tail_dom,superfamily_Prefoldin	p.E400D	ENST00000582871.1	37	c.1200		19	.	.	.	.	.	.	.	.	.	.	C	15.30	2.792471	0.50102	.	.	ENSG00000176619	ENST00000325327	.	.	.	4.25	3.18	0.36537	Filament (1);	0.114460	0.56097	D	0.000021	T	0.41834	0.1176	L	0.48642	1.525	0.50632	D	0.999882	P	0.35628	0.513	B	0.35510	0.204	T	0.29274	-1.0017	9	0.51188	T	0.08	.	6.5618	0.22491	0.0:0.6996:0.0:0.3004	.	380	Q03252	LMNB2_HUMAN	D	380	.	ENSP00000327054:E380D	E	-	3	2	LMNB2	2385295	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	1.355000	0.34068	0.745000	0.32763	0.561000	0.74099	GAG	LMNB2	-	pfam_IF	ENSG00000176619		0.687	LMNB2-201	KNOWN	basic|appris_principal	protein_coding	LMNB2	HGNC	protein_coding		-	0.00	30	0	C	NM_032737		2434295	-1	tier1	-	no_errors	ENST00000325327	ensembl	human	known	74_37	missense	44.12	19	15	SNP	1.000	G
PLXDC1	57125	genome.wustl.edu	37	17	37237471	37237471	+	Intron	SNP	T	T	C			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr17:37237471T>C	ENST00000315392.4	-	10	1201				PLXDC1_ENST00000493200.1_Intron|AC091178.1_ENST00000410562.1_RNA|PLXDC1_ENST00000539608.1_Intron|PLXDC1_ENST00000444911.2_Intron|CTD-2206N4.4_ENST00000583447.1_RNA	NM_020405.4	NP_065138.2	Q8IUK5	PLDX1_HUMAN	plexin domain containing 1						angiogenesis (GO:0001525)|spinal cord development (GO:0021510)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|tight junction (GO:0005923)	receptor activity (GO:0004872)			kidney(2)|large_intestine(6)|liver(1)|lung(10)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	23						CTGCAGACTATTCTGCAACGC	0.498																																																	0																																										SO:0001627	intron_variant	0			AF279144	CCDS11333.1	17q21.1	2006-04-12			ENSG00000161381	ENSG00000161381			20945	protein-coding gene	gene with protein product	"""tumor endothelial marker 7 precursor"""	606826				10947988, 11559528	Standard	NM_020405		Approved	TEM3, TEM7	uc002hrg.2	Q8IUK5	OTTHUMG00000133183	ENST00000315392.4:c.990-2054A>G	17.37:g.37237471T>C			B2R7I8|Q5QCZ7|Q5QCZ8|Q5QCZ9|Q9HCT9	RNA	SNP	-	NULL	ENST00000315392.4	37	NULL	CCDS11333.1	17																																																																																			CTD-2206N4.4	-	-	ENSG00000263818		0.498	PLXDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC100131347	Clone_based_vega_gene	protein_coding	OTTHUMT00000256892.2	-	0.00	26	0	T	NM_020405		37237471	+1	tier1	-	no_errors	ENST00000583447	ensembl	human	known	74_37	rna	33.33	10	5	SNP	0.000	C
BAALC-AS1	100499183	genome.wustl.edu	37	8	104258475	104258475	+	RNA	SNP	G	G	T			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr8:104258475G>T	ENST00000499522.2	-	0	892				RP11-318M2.2_ENST00000523614.2_RNA|RP11-318M2.2_ENST00000521383.1_RNA|RP11-318M2.2_ENST00000519801.1_RNA																							TGGCTATACAGGAAAGCAAAG	0.483																																																	0																																												0																															8.37:g.104258475G>T				RNA	SNP	-	NULL	ENST00000499522.2	37	NULL		8																																																																																			RP11-318M2.2	-	-	ENSG00000247081		0.483	RP11-318M2.2-004	KNOWN	basic	antisense	LOC101927343	Clone_based_vega_gene	antisense	OTTHUMT00000380348.1	-	0.00	36	0	G			104258475	-1	tier1	-	no_errors	ENST00000519801	ensembl	human	known	74_37	rna	9.30	39	4	SNP	0.000	T
LINC01123	440894	genome.wustl.edu	37	2	110746139	110746139	+	lincRNA	SNP	A	A	G			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr2:110746139A>G	ENST00000419296.1	+	0	1130					NR_046110.1																						gggtttgtatatattcacaga	0.398																																																	0																																												0																															2.37:g.110746139A>G				RNA	SNP	-	NULL	ENST00000419296.1	37	NULL		2																																																																																			AC013268.5	-	-	ENSG00000204588		0.398	AC013268.5-003	KNOWN	basic	lincRNA	LOC440894	Clone_based_vega_gene	lincRNA	OTTHUMT00000337869.1	-	0.00	29	0	A			110746139	+1	tier1	-	no_errors	ENST00000336905	ensembl	human	known	74_37	rna	55.17	13	16	SNP	0.110	G
LRRC37B	114659	genome.wustl.edu	37	17	30374917	30374917	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr17:30374917G>T	ENST00000341671.7	+	9	2385	c.2380G>T	c.(2380-2382)Ggg>Tgg	p.G794W	LRRC37B_ENST00000584368.1_Missense_Mutation_p.G755W|LRRC37B_ENST00000327564.7_Missense_Mutation_p.G821W|LRRC37B_ENST00000394713.3_Missense_Mutation_p.G743W|LRRC37B_ENST00000543378.2_Missense_Mutation_p.G712W	NM_052888.2	NP_443120.2	Q96QE4	LR37B_HUMAN	leucine rich repeat containing 37B	794						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)				endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(3)|lung(10)|ovary(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	29		Myeloproliferative disorder(56;0.0255)|all_hematologic(16;0.111)|Ovarian(249;0.182)|Breast(31;0.244)				GTCAGGCTTTGGGGGTGAGCA	0.498																																																	0													192.0	193.0	193.0					17																	30374917		2203	4300	6503	SO:0001583	missense	0			AJ314647	CCDS32609.1	17q11.2	2006-11-29		2005-08-09	ENSG00000185158	ENSG00000185158			29070	protein-coding gene	gene with protein product	"""KIAA0563-related"""					11468690, 10843809	Standard	NM_052888		Approved		uc002hgu.3	Q96QE4	OTTHUMG00000132785	ENST00000341671.7:c.2380G>T	17.37:g.30374917G>T	ENSP00000340519:p.Gly794Trp		Q17RC9|Q5YKG6	Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.G794W	ENST00000341671.7	37	c.2380	CCDS32609.1	17	.	.	.	.	.	.	.	.	.	.	N	1.596	-0.527870	0.04112	.	.	ENSG00000185158	ENST00000543378;ENST00000327564;ENST00000394713;ENST00000341671	T;T;T;T	0.66099	-0.13;-0.19;0.93;-0.18	1.75	-3.16	0.05217	.	.	.	.	.	T	0.65811	0.2727	L	0.60455	1.87	0.09310	N	1	D;P	0.69078	0.997;0.938	D;B	0.64144	0.922;0.096	T	0.57100	-0.7869	9	0.72032	D	0.01	.	3.1104	0.06356	0.3415:0.257:0.4015:0.0	.	743;794	Q17RC9;Q96QE4	.;LR37B_HUMAN	W	712;821;743;794	ENSP00000443345:G712W;ENSP00000332536:G821W;ENSP00000378202:G743W;ENSP00000340519:G794W	ENSP00000332536:G821W	G	+	1	0	LRRC37B	27399030	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.608000	0.05641	-0.781000	0.04548	-0.423000	0.05987	GGG	LRRC37B	-	NULL	ENSG00000185158		0.498	LRRC37B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC37B	HGNC	protein_coding	OTTHUMT00000446508.1	-	0.00	100	0	G	NM_052888		30374917	+1	tier1	-	no_errors	ENST00000341671	ensembl	human	known	74_37	missense	39.00	59	39	SNP	0.000	T
MAGEC2	51438	genome.wustl.edu	37	X	141291732	141291732	+	Silent	SNP	G	G	A			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chrX:141291732G>A	ENST00000247452.3	-	3	389	c.42C>T	c.(40-42)aaC>aaT	p.N14N		NM_016249.3	NP_057333.1	Q9UBF1	MAGC2_HUMAN	melanoma antigen family C, 2	14					cellular protein catabolic process (GO:0044257)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ubiquitin protein ligase binding (GO:0031625)			NS(2)|breast(3)|endometrium(3)|kidney(2)|large_intestine(8)|lung(18)|ovary(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(3)	47	Acute lymphoblastic leukemia(192;6.56e-05)					TCGGGGAGTCGTTGTCAACGT	0.527										HNSCC(46;0.14)																																							0													124.0	114.0	118.0					X																	141291732		2203	4300	6503	SO:0001819	synonymous_variant	0			AF116195	CCDS14678.1	Xq27	2009-03-25	2004-06-08	2004-06-09	ENSG00000046774	ENSG00000046774			13574	protein-coding gene	gene with protein product	"""cancer/testis antigen 10"""	300468	"""melanoma antigen, family E, 1, cancer/testis specific"""	MAGEE1		10699956	Standard	NM_016249		Approved	CT10, MAGE-C2	uc004fbu.2	Q9UBF1	OTTHUMG00000022574	ENST00000247452.3:c.42C>T	X.37:g.141291732G>A			Q5JZ00|Q96D45|Q9P1M6|Q9P1M7	Silent	SNP	pfam_MAGE,pfam_Melanoma_ass_antigen_N,pfscan_MAGE	p.N14	ENST00000247452.3	37	c.42	CCDS14678.1	X																																																																																			MAGEC2	-	NULL	ENSG00000046774		0.527	MAGEC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAGEC2	HGNC	protein_coding	OTTHUMT00000058611.1	-	0.00	19	0	G	NM_016249		141291732	-1	tier1	-	no_errors	ENST00000247452	ensembl	human	known	74_37	silent	80.00	3	12	SNP	0.000	A
MALAT1	378938	genome.wustl.edu	37	11	65271780	65271780	+	lincRNA	DEL	T	T	-	rs36002528		TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr11:65271780delT	ENST00000534336.1	+	0	6548					NR_002819.2		Q9UHZ2	MALAT_HUMAN	metastasis associated lung adenocarcinoma transcript 1 (non-protein coding)																		TTGTTGTAGCTTTTTTTTTTT	0.433																																																	0													25.0	28.0	27.0					11																	65271780		874	1988	2862			0			AF001540		11q13.1	2013-12-11	2007-11-20		ENSG00000251562	ENSG00000251562		"""Long non-coding RNAs"", ""-"""	29665	non-coding RNA	RNA, long non-coding	"""metastasis associated in lung adenocarcinoma transcript 1"", ""non-protein coding RNA 47"", ""hepcarcin"", ""nuclear enriched abundant transcript 2"", ""nuclear paraspeckle assembly transcript 2 (non-protein coding)"", ""long intergenic non-protein coding RNA 47"""	607924				12970751, 22560368	Standard	NR_002819		Approved	PRO1073, MALAT-1, NCRNA00047, HCN, NEAT2, LINC00047, mascRNA	uc010roh.3	Q9UHZ2	OTTHUMG00000166322		11.37:g.65271780delT				RNA	DEL	-	NULL	ENST00000534336.1	37	NULL		11																																																																																			MALAT1	-	-	ENSG00000251562		0.433	MALAT1-001	KNOWN	basic	lincRNA	MALAT1	HGNC	lincRNA	OTTHUMT00000389143.1		0.00	17	0	T	NR_002819		65271780	+1	tier1		no_errors	ENST00000534336	ensembl	human	known	74_37	rna	21.05	15	4	DEL	0.994	-
MAP2K5	5607	genome.wustl.edu	37	15	67923233	67923233	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr15:67923233C>G	ENST00000178640.5	+	9	1180	c.553C>G	c.(553-555)Cat>Gat	p.H185D	MAP2K5_ENST00000560591.1_3'UTR|MAP2K5_ENST00000354498.5_Missense_Mutation_p.H149D|MAP2K5_ENST00000395476.2_Missense_Mutation_p.H185D	NM_145160.2	NP_660143.1	Q13163	MP2K5_HUMAN	mitogen-activated protein kinase kinase 5	185	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|cellular response to growth factor stimulus (GO:0071363)|cellular response to laminar fluid shear stress (GO:0071499)|ERK5 cascade (GO:0070375)|heart development (GO:0007507)|negative regulation of cell migration involved in sprouting angiogenesis (GO:0090051)|negative regulation of chemokine (C-X-C motif) ligand 2 production (GO:2000342)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of heterotypic cell-cell adhesion (GO:0034115)|negative regulation of interleukin-8 biosynthetic process (GO:0045415)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of response to cytokine stimulus (GO:0060761)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell growth (GO:0030307)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of protein metabolic process (GO:0051247)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|signal transduction (GO:0007165)	cytosol (GO:0005829)|nucleus (GO:0005634)|spindle (GO:0005819)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)			breast(2)|endometrium(2)|kidney(1)|large_intestine(3)|lung(7)|skin(1)	16						TAGAGCATATCATGTCCCGAG	0.343																																																	0													103.0	104.0	104.0					15																	67923233		2200	4298	6498	SO:0001583	missense	0			U25265	CCDS10224.1, CCDS42051.1, CCDS55970.1	15q22.31	2011-06-09			ENSG00000137764	ENSG00000137764		"""Mitogen-activated protein kinase cascade / Kinase kinases"""	6845	protein-coding gene	gene with protein product		602520		PRKMK5		7759517	Standard	NM_002757		Approved	MEK5, MAPKK5, HsT17454	uc002aqu.3	Q13163	OTTHUMG00000133264	ENST00000178640.5:c.553C>G	15.37:g.67923233C>G	ENSP00000178640:p.His185Asp		B4DE43|Q92961|Q92962	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_OPR_PB1,superfamily_Kinase-like_dom,smart_OPR_PB1,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.H185D	ENST00000178640.5	37	c.553	CCDS10224.1	15	.	.	.	.	.	.	.	.	.	.	C	21.1	4.095674	0.76870	.	.	ENSG00000137764	ENST00000541298;ENST00000395476;ENST00000178640;ENST00000354498;ENST00000439036	T;T;T;T	0.64803	-0.12;-0.12;-0.12;1.21	5.27	5.27	0.74061	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.73171	0.3553	L	0.35723	1.085	0.80722	D	1	P;D;P	0.89917	0.937;1.0;0.949	P;D;P	0.97110	0.66;1.0;0.77	T	0.76116	-0.3077	10	0.87932	D	0	-18.0886	18.9153	0.92503	0.0:1.0:0.0:0.0	.	185;185;185	Q13163-2;Q13163;B2RD76	.;MP2K5_HUMAN;.	D	185;185;185;149;118	ENSP00000378859:H185D;ENSP00000178640:H185D;ENSP00000346493:H149D;ENSP00000390196:H118D	ENSP00000178640:H185D	H	+	1	0	MAP2K5	65710287	1.000000	0.71417	1.000000	0.80357	0.930000	0.56654	5.497000	0.66924	2.461000	0.83175	0.655000	0.94253	CAT	MAP2K5	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000137764		0.343	MAP2K5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAP2K5	HGNC	protein_coding	OTTHUMT00000257041.1	-	0.00	28	0	C	NM_145162		67923233	+1	tier1	-	no_errors	ENST00000178640	ensembl	human	known	74_37	missense	51.28	19	20	SNP	1.000	G
MCC	4163	genome.wustl.edu	37	5	112824048	112824049	+	In_Frame_Ins	INS	-	-	GCC	rs35336557|rs531679771|rs370593160	byFrequency	TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr5:112824048_112824049insGCC	ENST00000408903.3	-	1	478_479	c.63_64insGGC	c.(61-66)ggcagc>ggcGGCagc	p.21_22insG		NM_001085377.1	NP_001078846	P23508	CRCM_HUMAN	mutated in colorectal cancers	0					negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of epithelial cell proliferation (GO:0050680)|signal transduction (GO:0007165)|Wnt signaling pathway (GO:0016055)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			endometrium(4)|kidney(3)|large_intestine(15)|liver(2)|lung(8)|ovary(2)|pancreas(1)|prostate(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	42		all_cancers(142;5.89e-08)|all_epithelial(76;3.57e-11)|all_lung(232;0.000605)|Lung NSC(810;0.000697)|Colorectal(10;0.00146)|Prostate(80;0.00174)|Ovarian(225;0.0175)|Breast(839;0.198)		OV - Ovarian serous cystadenocarcinoma(64;2.04e-54)|Epithelial(69;9.69e-49)|all cancers(49;6.25e-44)|COAD - Colon adenocarcinoma(37;0.0432)|Colorectal(14;0.0766)		ctgctgccgctgccgccgccgc	0.738														1663	0.332069	0.0227	0.3487	5008	,	,		8489	0.5208		0.3668	False		,,,				2504	0.5082																0																																										SO:0001652	inframe_insertion	0				CCDS4111.1, CCDS43351.1	5q21-q22	2013-01-10			ENSG00000171444	ENSG00000171444		"""EF-hand domain containing"""	6935	protein-coding gene	gene with protein product		159350				1848370	Standard	NM_002387		Approved		uc003kql.4	P23508	OTTHUMG00000128804	ENST00000408903.3:c.61_63dupGGC	5.37:g.112824055_112824057dupGCC	ENSP00000386227:p.Gly22_Gly23dup		D3DT05|Q6ZR04	In_Frame_Ins	INS	pfam_USH1C-bd_PDZ_domain,superfamily_tRNA-bd_arm,smart_EF_hand_dom,pfscan_EF_hand_dom	p.21in_frame_insG	ENST00000408903.3	37	c.64_63	CCDS43351.1	5																																																																																			MCC	-	NULL	ENSG00000171444		0.738	MCC-003	PUTATIVE	basic|appris_principal|CCDS	protein_coding	MCC	HGNC	protein_coding	OTTHUMT00000370839.1		0.00	12	0	-	NM_001085377		112824049	-1	tier1		no_errors	ENST00000408903	ensembl	human	putative	74_37	in_frame_ins	60.00	2	3	INS	0.854:0.894	GCC
MED13L	23389	genome.wustl.edu	37	12	116408453	116408453	+	Missense_Mutation	SNP	T	T	C			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr12:116408453T>C	ENST00000281928.3	-	27	6219	c.6013A>G	c.(6013-6015)Atc>Gtc	p.I2005V		NM_015335.4	NP_056150.1	Q71F56	MD13L_HUMAN	mediator complex subunit 13-like	2005						mediator complex (GO:0016592)	RNA polymerase II transcription cofactor activity (GO:0001104)			NS(2)|breast(1)|endometrium(9)|kidney(3)|large_intestine(18)|lung(34)|ovary(4)|prostate(4)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	85	all_neural(191;0.117)|Medulloblastoma(191;0.163)			BRCA - Breast invasive adenocarcinoma(302;0.0407)		GCCACCTGGATGGTTGATGAT	0.493																																																	0													199.0	163.0	175.0					12																	116408453		2203	4300	6503	SO:0001583	missense	0			AB028948	CCDS9177.1	12q24.22	2010-07-29	2007-07-30	2007-07-30	ENSG00000123066	ENSG00000123066			22962	protein-coding gene	gene with protein product		608771	"""thyroid hormone receptor associated protein 2"""	THRAP2			Standard	NM_015335		Approved	KIAA1025, TRAP240L	uc001tvw.3	Q71F56	OTTHUMG00000169404	ENST00000281928.3:c.6013A>G	12.37:g.116408453T>C	ENSP00000281928:p.Ile2005Val		A1L469|Q68DN4|Q9H8C0|Q9NSY9|Q9UFD8|Q9UPX5	Missense_Mutation	SNP	pfam_Mediator_Med13,pfam_Mediator_Med13_N_met/fun	p.I2005V	ENST00000281928.3	37	c.6013	CCDS9177.1	12	.	.	.	.	.	.	.	.	.	.	T	10.41	1.341842	0.24339	.	.	ENSG00000123066	ENST00000281928	D	0.82433	-1.61	5.55	5.55	0.83447	.	0.050311	0.85682	D	0.000000	T	0.56761	0.2007	N	0.00746	-1.225	0.47308	D	0.999388	B	0.30326	0.276	B	0.32393	0.145	T	0.65994	-0.6033	10	0.02654	T	1	-14.9114	15.8583	0.79000	0.0:0.0:0.0:1.0	.	2005	Q71F56	MD13L_HUMAN	V	2005	ENSP00000281928:I2005V	ENSP00000281928:I2005V	I	-	1	0	MED13L	114892836	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.084000	0.50143	2.326000	0.78906	0.533000	0.62120	ATC	MED13L	-	pfam_Mediator_Med13	ENSG00000123066		0.493	MED13L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MED13L	HGNC	protein_coding	OTTHUMT00000403879.3	-	0.00	49	0	T			116408453	-1	tier1	-	no_errors	ENST00000281928	ensembl	human	known	74_37	missense	58.14	36	50	SNP	1.000	C
MT-CO1	4512	genome.wustl.edu	37	M	7428	7428	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chrM:7428G>A	ENST00000361624.2	+	1	1525	c.1525G>A	c.(1525-1527)Gta>Ata	p.V509I	MT-CO3_ENST00000362079.2_5'Flank|MT-TM_ENST00000387377.1_RNA|MT-TD_ENST00000387419.1_RNA|MT-TK_ENST00000387421.1_RNA|MT-ND3_ENST00000361227.2_5'Flank|MT-ATP6_ENST00000361899.2_5'Flank|MT-TG_ENST00000387429.1_RNA|MT-TW_ENST00000387382.1_RNA|MT-TA_ENST00000387392.1_RNA|MT-TN_ENST00000387400.1_RNA|MT-TY_ENST00000387409.1_RNA|MT-CO2_ENST00000361739.1_5'Flank|MT-TS1_ENST00000387416.2_RNA|MT-TR_ENST00000387439.1_RNA|MT-TC_ENST00000387405.1_RNA|MT-ATP8_ENST00000361851.1_5'Flank			P00395	COX1_HUMAN	mitochondrially encoded cytochrome c oxidase I	509					aerobic respiration (GO:0009060)|cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|oxidative phosphorylation (GO:0006119)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex IV (GO:0005751)|respiratory chain complex IV (GO:0045277)	cytochrome-c oxidase activity (GO:0004129)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(4)|endometrium(25)|kidney(19)|lung(3)|prostate(3)	54						TCGAAGAACCCGTATACATAA	0.453																																																	0																																										SO:0001583	missense	0					mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198804	ENSG00000198804		"""Mitochondrial respiratory chain complex / Complex IV"""	7419	protein-coding gene	gene with protein product		516030	"""cytochrome c oxidase I"""	MTCO1		7219534	Standard			Approved	COX1, COI		P00395		ENST00000361624.2:c.1525G>A	M.37:g.7428G>A	ENSP00000354499:p.Val509Ile		Q34770	Missense_Mutation	SNP	pfam_Cyt_c_Oxase_su1,superfamily_Cyt_c_Oxase_su1_dom,pfscan_Cyt_c_Oxase_su1_dom,prints_Cyt_c_Oxase_su1	p.V509M	ENST00000361624.2	37	c.1525		MT																																																																																			MT-CO1	-	superfamily_Cyt_c_Oxase_su1_dom,pfscan_Cyt_c_Oxase_su1_dom	ENSG00000198804		0.453	MT-CO1-201	KNOWN	basic|appris_principal	protein_coding	MT-CO1	HGNC	protein_coding		-	0.00	32	0	G	YP_003024028		7428	+1	tier1	-	no_errors	ENST00000361624	ensembl	human	known	74_37	missense	59.38	26	38	SNP	NULL	A
MTHFD2L	441024	genome.wustl.edu	37	4	75025854	75025855	+	Intron	INS	-	-	TA	rs531009106		TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr4:75025854_75025855insTA	ENST00000395759.2	+	1	170				MTHFD2L_ENST00000325278.6_Intron|AC093677.1_ENST00000600169.1_5'Flank|MTHFD2L_ENST00000331145.6_Intron|MTHFD2L_ENST00000433372.1_Intron|MTHFD2L_ENST00000461101.1_3'UTR	NM_001144978.1	NP_001138450.1	Q9H903	MTD2L_HUMAN	methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2-like						folic acid-containing compound biosynthetic process (GO:0009396)|histidine biosynthetic process (GO:0000105)|methionine biosynthetic process (GO:0009086)|one-carbon metabolic process (GO:0006730)|purine nucleotide biosynthetic process (GO:0006164)|tetrahydrofolate interconversion (GO:0035999)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	methenyltetrahydrofolate cyclohydrolase activity (GO:0004477)|methylenetetrahydrofolate dehydrogenase (NAD+) activity (GO:0004487)|methylenetetrahydrofolate dehydrogenase (NADP+) activity (GO:0004488)			central_nervous_system(1)|endometrium(1)|lung(4)|ovary(2)	8			all cancers(17;0.0101)|Lung(101;0.196)			GTCATCTTTTTTATATATATAA	0.386																																																	0																																										SO:0001627	intron_variant	0			BC065771	CCDS47075.1	4q13.3	2011-08-03			ENSG00000163738	ENSG00000163738			31865	protein-coding gene	gene with protein product		614047				21163947	Standard	NM_001144978		Approved	MGC72244	uc011cbk.2	Q9H903	OTTHUMG00000157135	ENST00000395759.2:c.143+1856->TA	4.37:g.75025863_75025864dupTA			Q6P079|Q8N560	RNA	INS	-	NULL	ENST00000395759.2	37	NULL	CCDS47075.1	4																																																																																			MTHFD2L	-	-	ENSG00000163738		0.386	MTHFD2L-202	KNOWN	basic|appris_principal|CCDS	protein_coding	MTHFD2L	HGNC	protein_coding			0.00	54	0	-	NM_001004346		75025855	+1	tier1		no_errors	ENST00000461101	ensembl	human	putative	74_37	rna	12.94	74	11	INS	0.147:0.040	TA
MTIF2	4528	genome.wustl.edu	37	2	55490950	55490950	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr2:55490950G>T	ENST00000263629.4	-	4	360	c.45C>A	c.(43-45)caC>caA	p.H15Q	MTIF2_ENST00000403721.1_Missense_Mutation_p.H15Q|MTIF2_ENST00000394600.3_Missense_Mutation_p.H15Q|MTIF2_ENST00000446660.1_5'UTR	NM_002453.2	NP_002444.2	P46199	IF2M_HUMAN	mitochondrial translational initiation factor 2	15					formation of translation initiation complex (GO:0001732)|regulation of translational initiation (GO:0006446)|ribosome disassembly (GO:0032790)	mitochondrion (GO:0005739)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)|ribosomal small subunit binding (GO:0043024)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)			breast(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(5)|ovary(1)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	24						TATAAATAGTGTGAAATCGTA	0.393																																																	0													202.0	193.0	196.0					2																	55490950		2203	4300	6503	SO:0001583	missense	0			L34600	CCDS1853.1	2p16.1	2008-02-05			ENSG00000085760	ENSG00000085760			7441	protein-coding gene	gene with protein product		603766				9925935, 7829522	Standard	XM_005264335		Approved	IF-2mt	uc002ryo.3	P46199	OTTHUMG00000129338	ENST00000263629.4:c.45C>A	2.37:g.55490950G>T	ENSP00000263629:p.His15Gln		D6W5D0	Missense_Mutation	SNP	pfam_EF_GTP-bd_dom,pfam_TIF_IF2_dom3,pfam_Transl_elong_EFTu/EF1A_2,pfam_MIRO-like,pfam_GTP_binding_domain,pfam_Small_GTPase,pfam_SRP_receptor_beta_su,superfamily_P-loop_NTPase,superfamily_TIF_IF2_dom3,superfamily_Transl_B-barrel,tigrfam_Small_GTP-bd_dom	p.H15Q	ENST00000263629.4	37	c.45	CCDS1853.1	2	.	.	.	.	.	.	.	.	.	.	G	6.568	0.473187	0.12461	.	.	ENSG00000085760	ENST00000403721;ENST00000263629;ENST00000394600;ENST00000535023;ENST00000366137;ENST00000441307;ENST00000404297;ENST00000420637	T;T;T;T;T;T	0.57595	0.39;0.39;0.39;0.45;0.43;0.42	5.18	-0.0154	0.13976	.	0.355769	0.27522	N	0.018993	T	0.37183	0.0994	L	0.56769	1.78	0.09310	N	1	B	0.32245	0.361	B	0.24006	0.05	T	0.15636	-1.0430	10	0.22109	T	0.4	0.0458	5.7261	0.18015	0.4148:0.0:0.4622:0.123	.	15	P46199	IF2M_HUMAN	Q	15	ENSP00000384481:H15Q;ENSP00000263629:H15Q;ENSP00000378099:H15Q;ENSP00000393337:H15Q;ENSP00000388640:H15Q;ENSP00000383880:H15Q	ENSP00000263629:H15Q	H	-	3	2	MTIF2	55344454	0.001000	0.12720	0.055000	0.19348	0.754000	0.42855	0.101000	0.15251	-0.003000	0.14444	0.555000	0.69702	CAC	MTIF2	-	NULL	ENSG00000085760		0.393	MTIF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTIF2	HGNC	protein_coding	OTTHUMT00000251486.4	-	0.00	33	0	G	NM_002453		55490950	-1	tier1	-	no_errors	ENST00000263629	ensembl	human	known	74_37	missense	8.51	43	4	SNP	0.008	T
MUC4	4585	genome.wustl.edu	37	3	195509501	195509501	+	Missense_Mutation	SNP	A	A	T			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr3:195509501A>T	ENST00000463781.3	-	2	9409	c.8950T>A	c.(8950-8952)Tca>Aca	p.S2984T	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.S2984T|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GTGGATGCTGAGGAAGTGTCG	0.572																																																	0													18.0	10.0	12.0					3																	195509501		652	1550	2202	SO:0001583	missense	0			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.8950T>A	3.37:g.195509501A>T	ENSP00000417498:p.Ser2984Thr		O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	pfam_Nidogen_extracell_dom,pfam_AMOP,pfam_VWF_type-D,smart_Nidogen_extracell_dom,smart_AMOP,smart_VWF_type-D,smart_EG-like_dom,pfscan_AMOP,pfscan_EG-like_dom	p.S2984T	ENST00000463781.3	37	c.8950	CCDS54700.1	3	.	.	.	.	.	.	.	.	.	.	a	3.943	-0.013822	0.07681	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.34472	1.36;1.43	.	.	.	.	.	.	.	.	T	0.22044	0.0531	N	0.19112	0.55	0.22066	N	0.999386	B	0.26041	0.14	B	0.32805	0.153	T	0.33059	-0.9883	7	.	.	.	.	5.904	0.18982	1.0:0.0:0.0:0.0	.	2856	E7ESK3	.	T	2984	ENSP00000417498:S2984T;ENSP00000420243:S2984T	.	S	-	1	0	MUC4	196994280	.	.	0.019000	0.16419	0.000000	0.00434	.	.	0.402000	0.25451	0.000000	0.15137	TCA	MUC4	-	NULL	ENSG00000145113		0.572	MUC4-001	KNOWN	basic|CCDS	protein_coding	MUC4	HGNC	protein_coding	OTTHUMT00000324081.6	-	0.00	197	0	A	NM_018406		195509501	-1	tier1	-	no_errors	ENST00000463781	ensembl	human	known	74_37	missense	9.43	240	25	SNP	0.906	T
MXD1	4084	genome.wustl.edu	37	2	70148870	70148870	+	Nonsense_Mutation	SNP	C	C	G			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr2:70148870C>G	ENST00000264444.2	+	3	436	c.176C>G	c.(175-177)tCa>tGa	p.S59*	MXD1_ENST00000540449.1_Intron	NM_001202513.1|NM_001202514.1|NM_002357.3	NP_001189442.1|NP_001189443.1|NP_002348.1	Q05195	MAD1_HUMAN	MAX dimerization protein 1	59	bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.				cell proliferation (GO:0008283)|multicellular organismal development (GO:0007275)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription cofactor activity (GO:0003712)|transcription corepressor activity (GO:0003714)			breast(1)|endometrium(1)|large_intestine(3)|lung(1)|upper_aerodigestive_tract(1)	7						TCTTTCAGATCAACTCACAAT	0.378																																																	0													100.0	91.0	94.0					2																	70148870		2203	4300	6503	SO:0001587	stop_gained	0				CCDS1896.1, CCDS56123.1	2p13-p12	2010-07-07		2005-02-11	ENSG00000059728	ENSG00000059728		"""MAX dimerization proteins"", ""Basic helix-loop-helix proteins"""	6761	protein-coding gene	gene with protein product		600021		MAD		7829091	Standard	NM_002357		Approved	MAD1, bHLHc58	uc002sfy.3	Q05195	OTTHUMG00000129646	ENST00000264444.2:c.176C>G	2.37:g.70148870C>G	ENSP00000264444:p.Ser59*		B2R6V8|B7ZLI6|D6W5G2|Q6FI41	Nonsense_Mutation	SNP	pfam_bHLH_dom,superfamily_bHLH_dom,smart_bHLH_dom,pfscan_bHLH_dom	p.S59*	ENST00000264444.2	37	c.176	CCDS1896.1	2	.	.	.	.	.	.	.	.	.	.	C	37	6.474388	0.97594	.	.	ENSG00000059728	ENST00000435990;ENST00000264444	.	.	.	5.03	5.03	0.67393	.	0.073236	0.56097	D	0.000027	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	16.2477	0.82454	0.0:1.0:0.0:0.0	.	.	.	.	X	27;59	.	ENSP00000264444:S59X	S	+	2	0	MXD1	70002374	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.940000	0.63533	2.777000	0.95525	0.591000	0.81541	TCA	MXD1	-	pfam_bHLH_dom,superfamily_bHLH_dom,pfscan_bHLH_dom	ENSG00000059728		0.378	MXD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MXD1	HGNC	protein_coding	OTTHUMT00000251845.3	-	0.00	77	0	C	NM_002357		70148870	+1	tier1	-	no_errors	ENST00000264444	ensembl	human	known	74_37	nonsense	6.52	85	6	SNP	1.000	G
MYO18A	399687	genome.wustl.edu	37	17	27448072	27448072	+	Missense_Mutation	SNP	T	T	C			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr17:27448072T>C	ENST00000527372.1	-	6	1709	c.1529A>G	c.(1528-1530)cAt>cGt	p.H510R	MYO18A_ENST00000533112.1_Missense_Mutation_p.H510R|MYO18A_ENST00000354329.4_Missense_Mutation_p.H510R|MYO18A_ENST00000531253.1_Missense_Mutation_p.H510R	NM_078471.3	NP_510880.2	Q92614	MY18A_HUMAN	myosin XVIIIA	510	Myosin motor.				actomyosin structure organization (GO:0031032)|cell migration (GO:0016477)|DNA metabolic process (GO:0006259)|Golgi organization (GO:0007030)|Golgi vesicle budding (GO:0048194)|negative regulation of apoptotic process (GO:0043066)|positive regulation of protein secretion (GO:0050714)	actomyosin (GO:0042641)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|myosin complex (GO:0016459)|trans-Golgi network (GO:0005802)	actin filament binding (GO:0051015)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|motor activity (GO:0003774)|poly(A) RNA binding (GO:0044822)			NS(1)|cervix(1)|endometrium(6)|kidney(6)|lung(20)|urinary_tract(2)	36			Epithelial(11;4.97e-05)|BRCA - Breast invasive adenocarcinoma(11;0.000221)|all cancers(11;0.000234)|Colorectal(6;0.0102)|COAD - Colon adenocarcinoma(6;0.031)			CTGCACCAGATGCTGGCAGCT	0.592																																					Esophageal Squamous(182;472 2015 7001 15270 22562)												0													47.0	49.0	48.0					17																	27448072		2084	4217	6301	SO:0001583	missense	0			D86970	CCDS45641.1, CCDS45642.1	17q11.2	2011-09-27			ENSG00000196535	ENSG00000196535		"""Myosins / Myosin superfamily : Class XVIII"""	31104	protein-coding gene	gene with protein product		610067				12761286	Standard	NM_078471		Approved	KIAA0216, MysPDZ	uc002hdt.1	Q92614	OTTHUMG00000166360	ENST00000527372.1:c.1529A>G	17.37:g.27448072T>C	ENSP00000437073:p.His510Arg		Q5H9U3|Q5W9F9|Q5W9G1|Q8IXP8	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_Myosin_tail,pfam_PDZ,superfamily_P-loop_NTPase,superfamily_PDZ,superfamily_Regulat_G_prot_signal_superfam,smart_PDZ,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,pfscan_PDZ,pfscan_RecA_monomer-monomer_interface,prints_Myosin_head_motor_dom	p.H510R	ENST00000527372.1	37	c.1529	CCDS45642.1	17	.	.	.	.	.	.	.	.	.	.	T	25.2	4.616933	0.87359	.	.	ENSG00000196535	ENST00000354329;ENST00000359450;ENST00000533112;ENST00000531253;ENST00000527372;ENST00000458428	T;T;T;T	0.71461	-0.57;-0.57;-0.57;-0.57	5.92	5.92	0.95590	Myosin head, motor domain (3);	0.046663	0.85682	D	0.000000	T	0.74473	0.3721	L	0.33710	1.025	0.58432	D	0.99999	P;D;D;D;D	0.89917	0.679;1.0;0.98;0.98;0.993	B;D;P;P;D	0.83275	0.43;0.996;0.773;0.773;0.931	T	0.68383	-0.5423	10	0.07325	T	0.83	.	16.0368	0.80635	0.0:0.0:0.0:1.0	.	179;122;510;510;510	Q92614-2;F8W6Y3;Q92614-3;Q92614-4;Q92614	.;.;.;.;MY18A_HUMAN	R	510;510;510;510;510;122	ENSP00000346291:H510R;ENSP00000435932:H510R;ENSP00000434228:H510R;ENSP00000437073:H510R	ENSP00000346291:H510R	H	-	2	0	MYO18A	24472198	1.000000	0.71417	0.982000	0.44146	0.996000	0.88848	5.970000	0.70431	2.270000	0.75569	0.459000	0.35465	CAT	MYO18A	-	pfam_Myosin_head_motor_dom,superfamily_P-loop_NTPase,smart_Myosin_head_motor_dom,prints_Myosin_head_motor_dom	ENSG00000196535		0.592	MYO18A-001	KNOWN	basic|CCDS	protein_coding	MYO18A	HGNC	protein_coding	OTTHUMT00000389396.1	-	0.00	74	0	T	NM_078471		27448072	-1	tier1	-	no_errors	ENST00000354329	ensembl	human	known	74_37	missense	38.89	33	21	SNP	1.000	C
NASP	4678	genome.wustl.edu	37	1	46073323	46073323	+	Missense_Mutation	SNP	G	G	A	rs201683842		TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr1:46073323G>A	ENST00000350030.3	+	6	827	c.740G>A	c.(739-741)gGa>gAa	p.G247E	NASP_ENST00000537798.1_Missense_Mutation_p.G183E|NASP_ENST00000351223.3_Intron|NASP_ENST00000402363.3_Missense_Mutation_p.G249E|NASP_ENST00000372052.4_Intron	NM_002482.3	NP_002473.2	P49321	NASP_HUMAN	nuclear autoantigenic sperm protein (histone-binding)	247	Glu-rich (acidic).				blastocyst development (GO:0001824)|cell cycle (GO:0007049)|cell proliferation (GO:0008283)|DNA replication (GO:0006260)|DNA replication-dependent nucleosome assembly (GO:0006335)|DNA replication-independent nucleosome assembly (GO:0006336)|histone exchange (GO:0043486)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|protein complex (GO:0043234)	Hsp90 protein binding (GO:0051879)	p.G249E(1)		breast(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(6)|ovary(1)|pancreas(1)|prostate(3)|skin(1)	17	Acute lymphoblastic leukemia(166;0.155)|Lung SC(450;0.211)					TCAGTTTCTGGAACTGATGTC	0.473																																																	1	Substitution - Missense(1)	lung(1)											43.0	46.0	45.0					1																	46073323		2203	4300	6503	SO:0001583	missense	0			M97856	CCDS524.1, CCDS525.1, CCDS55597.1	1p34.1	2013-01-10			ENSG00000132780	ENSG00000132780		"""Tetratricopeptide (TTC) repeat domain containing"""	7644	protein-coding gene	gene with protein product		603185				1426632	Standard	NM_002482		Approved	FLB7527, FLJ31599, FLJ35510, MGC19722, MGC20372, MGC2297, DKFZp547F162, PRO1999	uc001coi.2	P49321	OTTHUMG00000007826	ENST00000350030.3:c.740G>A	1.37:g.46073323G>A	ENSP00000255120:p.Gly247Glu		A8K6H2|B4DQP3|D3DQ07|F5H3J2|Q53GW5|Q5T622|Q5T625|Q96A69|Q9BTW2	Missense_Mutation	SNP	pfam_Tetratricopeptide_SHNi-TPR_dom,pfam_TPR_1,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.G249E	ENST00000350030.3	37	c.746	CCDS524.1	1	.	.	.	.	.	.	.	.	.	.	G	0.121	-1.126170	0.01770	.	.	ENSG00000132780	ENST00000537798;ENST00000402363;ENST00000341288;ENST00000350030;ENST00000470768	D;D;D;D	0.95377	-3.69;-3.69;-3.69;-3.69	5.19	-1.08	0.09936	.	0.955842	0.08790	N	0.893395	D	0.86657	0.5985	N	0.17082	0.46	0.09310	N	1	B;B;B;B;B	0.10296	0.001;0.001;0.003;0.001;0.001	B;B;B;B;B	0.09377	0.002;0.002;0.004;0.001;0.003	T	0.73990	-0.3808	9	.	.	.	-2.703	1.0065	0.01488	0.3429:0.1482:0.3567:0.1523	.	183;247;147;247;249	F5H3J2;Q53H03;B4DS57;P49321;P49321-3	.;.;.;NASP_HUMAN;.	E	183;249;147;247;210	ENSP00000438871:G183E;ENSP00000384529:G249E;ENSP00000255120:G247E;ENSP00000436924:G210E	.	G	+	2	0	NASP	45845910	0.026000	0.19158	0.163000	0.22734	0.251000	0.25915	0.266000	0.18534	-0.078000	0.12730	-0.157000	0.13467	GGA	NASP	-	NULL	ENSG00000132780		0.473	NASP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NASP	HGNC	protein_coding	OTTHUMT00000021533.2		0.00	25	0	G	NM_002482		46073323	+1			no_errors	ENST00000402363	ensembl	human	known	74_37	missense	10.00	18	2	SNP	0.008	A
NCKAP5L	57701	genome.wustl.edu	37	12	50186300	50186300	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr12:50186300C>G	ENST00000335999.6	-	12	3922	c.3721G>C	c.(3721-3723)Gca>Cca	p.A1241P		NM_001037806.3	NP_001032895.2	Q9HCH0	NCK5L_HUMAN	NCK-associated protein 5-like	1237	Pro-rich.									central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(8)|prostate(2)	18						CTGCCGGCTGCCCTAGTATTG	0.617																																																	0													46.0	52.0	50.0					12																	50186300		1896	4122	6018	SO:0001583	missense	0			AB046822	CCDS41781.2	12q13.12	2009-08-14	2009-08-14	2009-08-14	ENSG00000167566	ENSG00000167566			29321	protein-coding gene	gene with protein product		615104	"""KIAA1602"""	KIAA1602			Standard	NM_001037806		Approved		uc009zlk.2	Q9HCH0	OTTHUMG00000156969	ENST00000335999.6:c.3721G>C	12.37:g.50186300C>G	ENSP00000337998:p.Ala1241Pro		Q2TB26|Q71RH1|Q8N4W1|Q96HX2	Missense_Mutation	SNP	NULL	p.A1241P	ENST00000335999.6	37	c.3721	CCDS41781.2	12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	17.92|17.92	3.506969|3.506969	0.64410|0.64410	.|.	.|.	ENSG00000167566|ENSG00000167566	ENST00000335999;ENST00000354423|ENST00000433948	T|.	0.52983|.	0.64|.	5.15|5.15	3.31|3.31	0.37934|0.37934	.|.	0.145686|.	0.32287|.	N|.	0.006319|.	T|T	0.39572|0.39572	0.1083|0.1083	L|L	0.29908|0.29908	0.895|0.895	0.32875|0.32875	D|D	0.509739|0.509739	P;P;P|.	0.50617|.	0.937;0.912;0.937|.	P;P;P|.	0.52343|.	0.604;0.696;0.679|.	T|T	0.48198|0.48198	-0.9056|-0.9056	10|5	0.56958|.	D|.	0.05|.	-6.095|-6.095	9.9827|9.9827	0.41824|0.41824	0.0:0.8296:0.0:0.1704|0.0:0.8296:0.0:0.1704	.|.	1215;1237;1237|.	E2QRB5;Q9HCH0;Q9HCH0-2|.	.;NCK5L_HUMAN;.|.	P|A	1241;1215|955	ENSP00000337998:A1241P|.	ENSP00000337998:A1241P|.	A|G	-|-	1|2	0|0	NCKAP5L|NCKAP5L	48472567|48472567	0.943000|0.943000	0.32029|0.32029	1.000000|1.000000	0.80357|0.80357	0.804000|0.804000	0.45430|0.45430	1.081000|1.081000	0.30791|0.30791	0.681000|0.681000	0.31386|0.31386	0.561000|0.561000	0.74099|0.74099	GCA|GGC	NCKAP5L	-	NULL	ENSG00000167566		0.617	NCKAP5L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCKAP5L	HGNC	protein_coding	OTTHUMT00000346884.2		0.00	30	0	C	XM_035497		50186300	-1			no_errors	ENST00000335999	ensembl	human	known	74_37	missense	11.43	31	4	SNP	1.000	G
NEFM	4741	genome.wustl.edu	37	8	24775457	24775457	+	Missense_Mutation	SNP	G	G	T	rs59726684	byFrequency	TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr8:24775457G>T	ENST00000221166.5	+	3	2871	c.2089G>T	c.(2089-2091)Ggg>Tgg	p.G697W	NEFM_ENST00000433454.2_Missense_Mutation_p.G321W|NEFM_ENST00000521540.1_Intron|NEFM_ENST00000518131.1_Intron|NEFM_ENST00000437366.2_Missense_Mutation_p.G658W			P07197	NFM_HUMAN	neurofilament, medium polypeptide	697	Tail.				axon cargo transport (GO:0008088)|microtubule cytoskeleton organization (GO:0000226)|neurofilament bundle assembly (GO:0033693)|regulation of axon diameter (GO:0031133)	axon (GO:0030424)|neurofibrillary tangle (GO:0097418)|neurofilament (GO:0005883)|neuromuscular junction (GO:0031594)	microtubule binding (GO:0008017)|structural constituent of cytoskeleton (GO:0005200)			breast(3)|endometrium(7)|kidney(4)|large_intestine(5)|lung(14)|ovary(1)|prostate(1)|urinary_tract(1)	36		Prostate(55;0.157)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0197)|Epithelial(17;2.44e-10)|Colorectal(74;0.0108)|COAD - Colon adenocarcinoma(73;0.0375)		agcagaagtggggaaaggtga	0.453																																																	0													57.0	62.0	60.0					8																	24775457		2203	4300	6503	SO:0001583	missense	0			BC002421	CCDS6046.1, CCDS47831.1	8p21	2013-01-16	2008-09-19	2006-11-20	ENSG00000104722	ENSG00000104722		"""Intermediate filaments type IV"""	7734	protein-coding gene	gene with protein product		162250	"""neurofilament, medium polypeptide 150kDa"""	NEF3		1348579	Standard	NM_001105541		Approved	NFM, NF-M	uc003xed.4	P07197	OTTHUMG00000131990	ENST00000221166.5:c.2089G>T	8.37:g.24775457G>T	ENSP00000221166:p.Gly697Trp		B4DGN2|E9PBF7|Q4QRK6	Missense_Mutation	SNP	pfam_IF,pfam_Intermed_filament_DNA-bd,superfamily_Prefoldin,prints_Keratin_I	p.G697W	ENST00000221166.5	37	c.2089	CCDS6046.1	8	.	.	.	.	.	.	.	.	.	.	G	6.646	0.487609	0.12641	.	.	ENSG00000104722	ENST00000221166;ENST00000437366;ENST00000433454	D;D;D	0.94232	-1.8;-1.67;-3.38	3.31	-0.908	0.10517	.	1.331490	0.05366	N	0.534543	D	0.83505	0.5269	N	0.19112	0.55	0.09310	N	1	P	0.44006	0.824	B	0.30251	0.113	T	0.75596	-0.3263	10	0.66056	D	0.02	.	4.7715	0.13158	0.4719:0.1587:0.3695:0.0	.	697	P07197	NFM_HUMAN	W	697;658;321	ENSP00000221166:G697W;ENSP00000410137:G658W;ENSP00000412295:G321W	ENSP00000221166:G697W	G	+	1	0	NEFM	24831362	0.000000	0.05858	0.000000	0.03702	0.649000	0.38597	-0.320000	0.08028	-0.615000	0.05679	0.205000	0.17691	GGG	NEFM	-	NULL	ENSG00000104722		0.453	NEFM-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NEFM	HGNC	protein_coding	OTTHUMT00000254954.2		0.00	21	0	G	NM_005382		24775457	+1			no_errors	ENST00000221166	ensembl	human	known	74_37	missense	8.11	34	3	SNP	0.000	T
NF1	4763	genome.wustl.edu	37	17	29554303	29554303	+	Silent	SNP	C	C	T			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr17:29554303C>T	ENST00000358273.4	+	19	2702	c.2319C>T	c.(2317-2319)aaC>aaT	p.N773N	NF1_ENST00000356175.3_Silent_p.N773N	NM_001042492.2	NP_001035957.1	P21359	NF1_HUMAN	neurofibromin 1	773					actin cytoskeleton organization (GO:0030036)|adrenal gland development (GO:0030325)|artery morphogenesis (GO:0048844)|brain development (GO:0007420)|camera-type eye morphogenesis (GO:0048593)|cell communication (GO:0007154)|cerebral cortex development (GO:0021987)|cognition (GO:0050890)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|forebrain astrocyte development (GO:0021897)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|liver development (GO:0001889)|MAPK cascade (GO:0000165)|metanephros development (GO:0001656)|myelination in peripheral nervous system (GO:0022011)|negative regulation of angiogenesis (GO:0016525)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell migration (GO:0030336)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of neurotransmitter secretion (GO:0046929)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of transcription factor import into nucleus (GO:0042992)|neural tube development (GO:0021915)|osteoblast differentiation (GO:0001649)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|pigmentation (GO:0043473)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of apoptotic process (GO:0043065)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|regulation of angiogenesis (GO:0045765)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of bone resorption (GO:0045124)|regulation of cell-matrix adhesion (GO:0001952)|regulation of glial cell differentiation (GO:0045685)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of Ras GTPase activity (GO:0032318)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to hypoxia (GO:0001666)|Schwann cell development (GO:0014044)|skeletal muscle tissue development (GO:0007519)|smooth muscle tissue development (GO:0048745)|spinal cord development (GO:0021510)|sympathetic nervous system development (GO:0048485)|visual learning (GO:0008542)|wound healing (GO:0042060)	axon (GO:0030424)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|membrane (GO:0016020)|nucleus (GO:0005634)	phosphatidylcholine binding (GO:0031210)|phosphatidylethanolamine binding (GO:0008429)|Ras GTPase activator activity (GO:0005099)	p.0?(8)|p.?(4)	NF1/ACCN1(2)	autonomic_ganglia(12)|breast(11)|central_nervous_system(72)|cervix(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(59)|kidney(9)|large_intestine(39)|liver(1)|lung(80)|ovary(20)|pancreas(2)|prostate(2)|skin(8)|soft_tissue(249)|stomach(2)|thyroid(1)|upper_aerodigestive_tract(5)|urinary_tract(9)	599		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		CTGCAGGAAACACTGAGGTAT	0.478			"""D, Mis, N, F, S, O"""		"""neurofibroma, glioma"""	"""neurofibroma, glioma"""			Neurofibromatosis, type 1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)																													yes	Rec	yes	Neurofibromatosis type 1	17	17q12	4763	neurofibromatosis type 1 gene		O	12	Whole gene deletion(8)|Unknown(4)	soft_tissue(7)|autonomic_ganglia(2)|central_nervous_system(2)|lung(1)											60.0	59.0	60.0					17																	29554303		2203	4300	6503	SO:0001819	synonymous_variant	0	Familial Cancer Database	NF1, von Recklinghausen disease, incl.: Hereditary Spinal Neurofibromatosis, Neurofibromatosis-Noonan syndrome		CCDS11264.1, CCDS42292.1, CCDS45645.1	17q11.2	2014-09-17	2008-07-31		ENSG00000196712	ENSG00000196712			7765	protein-coding gene	gene with protein product	"""neurofibromatosis"", ""von Recklinghausen disease"", ""Watson disease"""	613113				1715669	Standard	NM_000267		Approved		uc002hgg.3	P21359	OTTHUMG00000132871	ENST00000358273.4:c.2319C>T	17.37:g.29554303C>T			O00662|Q14284|Q14930|Q14931|Q9UMK3	Silent	SNP	pfam_RasGAP,superfamily_Rho_GTPase_activation_prot,superfamily_ARM-type_fold,superfamily_CRAL-TRIO_dom,smart_RasGAP,smart_CRAL-TRIO_dom,pfscan_CRAL-TRIO_dom,pfscan_RasGAP	p.N773	ENST00000358273.4	37	c.2319	CCDS42292.1	17																																																																																			NF1	-	superfamily_ARM-type_fold	ENSG00000196712		0.478	NF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NF1	HGNC	protein_coding	OTTHUMT00000256351.2	-	0.00	29	0	C	NM_000267		29554303	+1	tier1	-	no_errors	ENST00000358273	ensembl	human	known	74_37	silent	57.14	9	12	SNP	1.000	T
NFE2L2	4780	genome.wustl.edu	37	2	178098945	178098945	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr2:178098945G>C	ENST00000397062.3	-	2	654	c.100C>G	c.(100-102)Cga>Gga	p.R34G	NFE2L2_ENST00000423513.1_Missense_Mutation_p.R18G|NFE2L2_ENST00000446151.2_Missense_Mutation_p.R18G|NFE2L2_ENST00000464747.1_Missense_Mutation_p.R18G|NFE2L2_ENST00000397063.4_Missense_Mutation_p.R18G	NM_006164.4	NP_006155.2	Q16236	NF2L2_HUMAN	nuclear factor, erythroid 2-like 2	34					cellular response to hydrogen peroxide (GO:0070301)|cellular response to laminar fluid shear stress (GO:0071499)|cellular response to tumor necrosis factor (GO:0071356)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902176)|positive regulation of blood coagulation (GO:0030194)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to stress (GO:0036003)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination (GO:0016567)|regulation of embryonic development (GO:0045995)|regulation of removal of superoxide radicals (GO:2000121)|transcription from RNA polymerase II promoter (GO:0006366)	centrosome (GO:0005813)|chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|protein domain specific binding (GO:0019904)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R34G(4)		central_nervous_system(1)|cervix(4)|endometrium(14)|kidney(5)|large_intestine(4)|liver(13)|lung(71)|oesophagus(29)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	158			Epithelial(96;0.00442)|OV - Ovarian serous cystadenocarcinoma(117;0.00739)|all cancers(119;0.0195)|LUSC - Lung squamous cell carcinoma(2;0.036)|Lung(16;0.0935)			AATACTTCTCGACTTACTCCA	0.368			Mis		"""NSCLC, HNSCC"""					HNSCC(56;0.16)																														Dom	yes		2	2q31	4780	nuclear factor (erythroid-derived 2)-like 2 (NRF2)		E	4	Substitution - Missense(4)	lung(2)|endometrium(2)											75.0	68.0	70.0					2																	178098945		1847	4103	5950	SO:0001583	missense	0				CCDS42782.1, CCDS46457.1, CCDS46458.1	2q31	2013-08-23	2013-08-23		ENSG00000116044	ENSG00000116044		"""basic leucine zipper proteins"""	7782	protein-coding gene	gene with protein product	"""NF-E2-related factor 2"""	600492	"""nuclear factor (erythroid-derived 2)-like 2"""			7937919	Standard	NM_006164		Approved	NRF2	uc002ulh.5	Q16236	OTTHUMG00000133620	ENST00000397062.3:c.100C>G	2.37:g.178098945G>C	ENSP00000380252:p.Arg34Gly		B2RBU2|B4E338|E9PGJ7|Q53RW6|Q59HH2|Q96F71	Missense_Mutation	SNP	pfam_bZIP,superfamily_TF_DNA-bd,superfamily_Serpin_dom,smart_bZIP,pfscan_bZIP	p.R34G	ENST00000397062.3	37	c.100	CCDS42782.1	2	.	.	.	.	.	.	.	.	.	.	G	16.68	3.190279	0.58017	.	.	ENSG00000116044	ENST00000397063;ENST00000397062;ENST00000446151;ENST00000449627;ENST00000448782;ENST00000421929;ENST00000423513	T;T;T;T;T;T;T	0.33438	1.41;1.41;1.41;1.41;1.41;1.41;1.41	5.78	2.87	0.33458	.	0.000000	0.85682	D	0.000000	T	0.60011	0.2236	M	0.86740	2.835	0.58432	D	0.999999	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.87578	0.998;0.995;0.998;0.998	T	0.66862	-0.5816	10	0.72032	D	0.01	.	14.8506	0.70295	0.0:0.0:0.6243:0.3757	.	18;18;18;34	E9PGJ7;B4DNB0;C9JFL6;Q16236	.;.;.;NF2L2_HUMAN	G	18;34;18;18;18;18;18	ENSP00000380253:R18G;ENSP00000380252:R34G;ENSP00000411575:R18G;ENSP00000391590:R18G;ENSP00000400073:R18G;ENSP00000412191:R18G;ENSP00000410015:R18G	ENSP00000380252:R34G	R	-	1	2	NFE2L2	177807191	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.376000	0.73141	0.300000	0.22699	0.563000	0.77884	CGA	NFE2L2	-	NULL	ENSG00000116044		0.368	NFE2L2-001	KNOWN	basic|CCDS	protein_coding	NFE2L2	HGNC	protein_coding	OTTHUMT00000257752.4	-	0.00	48	0	G	NM_006164		178098945	-1	tier1	-	no_errors	ENST00000397062	ensembl	human	known	74_37	missense	52.63	18	20	SNP	1.000	C
NNT	23530	genome.wustl.edu	37	5	43653133	43653133	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr5:43653133G>T	ENST00000264663.5	+	14	2098	c.1877G>T	c.(1876-1878)gGc>gTc	p.G626V	NNT_ENST00000344920.4_Missense_Mutation_p.G626V|NNT_ENST00000512996.2_Missense_Mutation_p.G495V	NM_012343.3	NP_036475.3	Q13423	NNTM_HUMAN	nicotinamide nucleotide transhydrogenase	626					cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|oxidation-reduction process (GO:0055114)|proton transport (GO:0015992)|reactive oxygen species metabolic process (GO:0072593)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain (GO:0005746)|mitochondrion (GO:0005739)	NAD binding (GO:0051287)|NAD(P)+ transhydrogenase (AB-specific) activity (GO:0008750)|NAD(P)+ transhydrogenase (B-specific) activity (GO:0003957)|NAD(P)+ transhydrogenase activity (GO:0008746)|NADP binding (GO:0050661)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(7)|large_intestine(6)|liver(2)|lung(20)|ovary(3)|prostate(2)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	Lung NSC(6;2.58e-06)					ATGTACCTAGGCTCGGGTTTG	0.468																																																	0													83.0	77.0	79.0					5																	43653133		2203	4300	6503	SO:0001583	missense	0			U40490	CCDS3949.1	5p12	2008-02-05			ENSG00000112992	ENSG00000112992	1.6.1.1		7863	protein-coding gene	gene with protein product		607878				9271681, 9524818	Standard	NM_182977		Approved		uc003jof.3	Q13423	OTTHUMG00000096961	ENST00000264663.5:c.1877G>T	5.37:g.43653133G>T	ENSP00000264663:p.Gly626Val		Q16796|Q2TB60|Q8N3V4	Missense_Mutation	SNP	pfam_NADH_DH_b,pfam_AlaDH/PNT_NAD(H)-bd,pfam_AlaDH/PNT_N,tigrfam_NADP_transhyd_a	p.G626V	ENST00000264663.5	37	c.1877	CCDS3949.1	5	.	.	.	.	.	.	.	.	.	.	G	11.31	1.600305	0.28534	.	.	ENSG00000112992	ENST00000542759;ENST00000264663;ENST00000344920;ENST00000512996	D;D;D	0.90788	-2.73;-2.73;-2.73	5.96	4.17	0.49024	.	0.088571	0.85682	D	0.000000	D	0.83552	0.5279	N	0.05414	-0.055	0.80722	D	1	P	0.44044	0.825	P	0.48770	0.589	T	0.79838	-0.1634	10	0.02654	T	1	-2.7985	16.8941	0.86095	0.0:0.2416:0.7583:0.0	.	626	Q13423	NNTM_HUMAN	V	141;626;626;495	ENSP00000264663:G626V;ENSP00000343873:G626V;ENSP00000426343:G495V	ENSP00000264663:G626V	G	+	2	0	NNT	43688890	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.399000	0.73248	0.847000	0.35167	0.650000	0.86243	GGC	NNT	-	pfam_NADH_DH_b	ENSG00000112992		0.468	NNT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NNT	HGNC	protein_coding	OTTHUMT00000214026.1	-	0.00	55	0	G	NM_182977		43653133	+1	tier1	-	no_errors	ENST00000264663	ensembl	human	known	74_37	missense	5.88	64	4	SNP	1.000	T
NPAP1	23742	genome.wustl.edu	37	15	24924081	24924081	+	Missense_Mutation	SNP	A	A	C			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr15:24924081A>C	ENST00000329468.2	+	1	3541	c.3067A>C	c.(3067-3069)Agc>Cgc	p.S1023R		NM_018958.2	NP_061831.2	Q9NZP6	NPAP1_HUMAN	nuclear pore associated protein 1	1023					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)											CATTGGGTTCAGCATGTCTGC	0.522																																																	0													59.0	56.0	57.0					15																	24924081		2203	4300	6503	SO:0001583	missense	0			AF179681	CCDS10015.1	15q11-q13	2012-07-19	2012-06-14	2012-06-14	ENSG00000185823	ENSG00000185823			1190	protein-coding gene	gene with protein product		610922	"""chromosome 15 open reading frame 2"""	C15orf2		10783265, 22694955	Standard	NM_018958		Approved		uc001ywo.3	Q9NZP6	OTTHUMG00000129179	ENST00000329468.2:c.3067A>C	15.37:g.24924081A>C	ENSP00000333735:p.Ser1023Arg			Missense_Mutation	SNP	NULL	p.S1023R	ENST00000329468.2	37	c.3067	CCDS10015.1	15	.	.	.	.	.	.	.	.	.	.	.	7.296	0.612137	0.14066	.	.	ENSG00000185823	ENST00000329468	T	0.07800	3.16	1.74	-0.611	0.11601	.	2.143740	0.02121	N	0.055637	T	0.04815	0.0130	N	0.14661	0.345	0.09310	N	1	B	0.31174	0.311	B	0.21151	0.033	T	0.29792	-1.0000	10	0.35671	T	0.21	.	4.1181	0.10092	0.5646:0.0:0.4354:0.0	.	1023	Q9NZP6	CO002_HUMAN	R	1023	ENSP00000333735:S1023R	ENSP00000333735:S1023R	S	+	1	0	C15orf2	22475174	0.000000	0.05858	0.000000	0.03702	0.017000	0.09413	-0.653000	0.05360	-0.187000	0.10516	0.260000	0.18958	AGC	NPAP1	-	NULL	ENSG00000185823		0.522	NPAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPAP1	HGNC	protein_coding	OTTHUMT00000251253.1	-	0.00	35	0	A	NM_018958		24924081	+1	tier1	-	no_errors	ENST00000329468	ensembl	human	known	74_37	missense	21.74	18	5	SNP	0.000	C
MPG	4350	genome.wustl.edu	37	16	136688	136688	+	IGR	SNP	C	C	T	rs376243144		TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr16:136688C>T	ENST00000219431.4	+	0	1193				NPRL3_ENST00000405960.3_5'UTR|NPRL3_ENST00000399953.3_3'UTR|NPRL3_ENST00000399951.3_3'UTR	NM_002434.3	NP_002425.2	P29372	3MG_HUMAN	N-methylpurine-DNA glycosylase						base-excision repair (GO:0006284)|base-excision repair, AP site formation (GO:0006285)|depurination (GO:0045007)|DNA dealkylation involved in DNA repair (GO:0006307)|DNA repair (GO:0006281)	mitochondrial nucleoid (GO:0042645)|nucleoplasm (GO:0005654)	alkylbase DNA N-glycosylase activity (GO:0003905)|damaged DNA binding (GO:0003684)|DNA-3-methyladenine glycosylase activity (GO:0008725)|DNA-3-methylguanine glycosylase activity (GO:0052822)|DNA-7-methyladenine glycosylase activity (GO:0052821)|DNA-7-methylguanine glycosylase activity (GO:0043916)			endometrium(4)|kidney(1)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	9		all_cancers(16;9.01e-08)|all_epithelial(16;7.64e-07)|Hepatocellular(780;0.000325)|Lung NSC(18;0.0104)|all_lung(18;0.0239)				AGCAGCCTTCCGCCCTCCGCC	0.692								Base excision repair (BER), DNA glycosylases					C|||	1	0.000199681	0.0	0.0	5008	,	,		14716	0.0		0.001	False		,,,				2504	0.0																0								C	,	0,3946		0,0,1973	17.0	20.0	19.0		,	-2.5	0.0	16		19	1,8125		0,1,4062	no	utr-3,utr-3	NPRL3	NM_001039476.2,NM_001077350.2	,	0,1,6035	TT,TC,CC		0.0123,0.0,0.0083	,	,	136688	1,12071	1973	4063	6036	SO:0001628	intergenic_variant	0				CCDS32345.1, CCDS32346.1, CCDS42087.1	16p13.3	2008-07-29			ENSG00000103152	ENSG00000103152	3.2.2.21		7211	protein-coding gene	gene with protein product	"""alkyladenine DNA glycosylase"""	156565				1874728	Standard	NM_002434		Approved	MDG	uc002cfo.4	P29372	OTTHUMG00000047887		16.37:g.136688C>T			G5E9E2|Q13770|Q15275|Q15961|Q5J9I4|Q96BZ6|Q96S33|Q9NNX5	RNA	SNP	-	NULL	ENST00000219431.4	37	NULL	CCDS32346.1	16																																																																																			NPRL3	-	-	ENSG00000103148		0.692	MPG-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NPRL3	HGNC	protein_coding	OTTHUMT00000109121.4	-	0.00	23	0	C			136688	-1	tier1	-	no_errors	ENST00000405960	ensembl	human	known	74_37	rna	62.96	10	17	SNP	0.000	T
NSMF	26012	genome.wustl.edu	37	9	140346852	140346852	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr9:140346852C>G	ENST00000371475.3	-	12	1432	c.1201G>C	c.(1201-1203)Gga>Cga	p.G401R	NSMF_ENST00000437259.1_Missense_Mutation_p.G378R|NSMF_ENST00000265663.7_Missense_Mutation_p.G399R|NSMF_ENST00000371473.3_Missense_Mutation_p.G371R|NSMF_ENST00000484316.1_5'UTR|NSMF_ENST00000371474.3_Missense_Mutation_p.G376R|NSMF_ENST00000541195.1_Missense_Mutation_p.G198R|NSMF_ENST00000371482.1_Missense_Mutation_p.G65R|NSMF_ENST00000392812.4_Missense_Mutation_p.G378R|NSMF_ENST00000339554.3_Missense_Mutation_p.G198R|NSMF_ENST00000371472.2_Missense_Mutation_p.G399R	NM_001130969.1	NP_001124441.1	Q6X4W1	NSMF_HUMAN	NMDA receptor synaptonuclear signaling and neuronal migration factor	401					cellular response to amino acid stimulus (GO:0071230)|cellular response to electrical stimulus (GO:0071257)|cellular response to gonadotropin stimulus (GO:0071371)|positive regulation of neuron migration (GO:2001224)|positive regulation of protein dephosphorylation (GO:0035307)|regulation of dendrite morphogenesis (GO:0048814)|regulation of neuron apoptotic process (GO:0043523)|regulation of neuronal synaptic plasticity (GO:0048168)	apical dendrite (GO:0097440)|cell junction (GO:0030054)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|membrane (GO:0016020)|neuron projection (GO:0043005)|nuclear envelope (GO:0005635)|nuclear euchromatin (GO:0005719)|nuclear matrix (GO:0016363)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|perikaryon (GO:0043204)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	calcium-dependent protein binding (GO:0048306)										ATCTTGGCTCCCTTGTGGTAG	0.612																																																	0													187.0	168.0	174.0					9																	140346852		2200	4298	6498	SO:0001583	missense	0				CCDS7044.1, CCDS48067.1, CCDS48068.1, CCDS48069.1, CCDS55357.1	9q34.3	2013-01-14	2013-01-14	2013-01-14	ENSG00000165802	ENSG00000165802			29843	protein-coding gene	gene with protein product		608137	"""nasal embryonic LHRH factor"""	NELF		11230166, 10898796	Standard	NM_015537		Approved		uc004cna.3	Q6X4W1	OTTHUMG00000020989	ENST00000371475.3:c.1201G>C	9.37:g.140346852C>G	ENSP00000360530:p.Gly401Arg		Q2TB96|Q6X4V7|Q6X4V8|Q6X4V9|Q8N2M2|Q96SY1|Q9NPM4|Q9NPP3|Q9NPS3	Missense_Mutation	SNP	superfamily_P-loop_NTPase	p.G401R	ENST00000371475.3	37	c.1201	CCDS48069.1	9	.	.	.	.	.	.	.	.	.	.	C	27.4	4.825811	0.90955	.	.	ENSG00000165802	ENST00000339554;ENST00000371475;ENST00000265663;ENST00000437259;ENST00000392812;ENST00000371474;ENST00000371473;ENST00000371482;ENST00000371472;ENST00000541195	T;T;T;T;T;T;T;T;T;T	0.42513	0.97;0.97;0.97;0.97;0.97;0.97;0.97;0.97;0.97;0.97	4.67	4.67	0.58626	.	0.000000	0.85682	D	0.000000	T	0.60689	0.2288	L	0.59436	1.845	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	0.999;1.0;1.0;0.999;0.999;0.999;0.999	T	0.64110	-0.6484	10	0.87932	D	0	-9.3929	15.0992	0.72258	0.0:1.0:0.0:0.0	.	378;198;152;376;371;401;399	Q6X4W1-3;F5GZW0;Q9NTU2;Q2TB96;Q6X4W1-4;Q6X4W1;Q6X4W1-2	.;.;.;.;.;NELF_HUMAN;.	R	198;401;399;378;378;376;371;65;399;198	ENSP00000342966:G198R;ENSP00000360530:G401R;ENSP00000265663:G399R;ENSP00000412007:G378R;ENSP00000376559:G378R;ENSP00000360529:G376R;ENSP00000360528:G371R;ENSP00000360537:G65R;ENSP00000360527:G399R;ENSP00000444177:G198R	ENSP00000265663:G399R	G	-	1	0	NELF	139466673	1.000000	0.71417	1.000000	0.80357	0.841000	0.47740	7.329000	0.79170	2.434000	0.82447	0.455000	0.32223	GGA	NSMF	-	NULL	ENSG00000165802		0.612	NSMF-204	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NSMF	HGNC	protein_coding		-	0.00	33	0	C	NM_015537		140346852	-1	tier1	-	no_errors	ENST00000371475	ensembl	human	known	74_37	missense	35.14	24	13	SNP	1.000	G
NTNG1	22854	genome.wustl.edu	37	1	107961248	107961248	+	Intron	SNP	G	G	T			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr1:107961248G>T	ENST00000370068.1	+	5	1933				NTNG1_ENST00000370061.3_Missense_Mutation_p.E378D|NTNG1_ENST00000370070.2_Missense_Mutation_p.E378D|NTNG1_ENST00000370066.1_Missense_Mutation_p.E378D|NTNG1_ENST00000370074.4_Intron|NTNG1_ENST00000370065.1_Intron|NTNG1_ENST00000370073.2_Intron|NTNG1_ENST00000370072.3_Intron|NTNG1_ENST00000542803.1_Intron|NTNG1_ENST00000370071.2_Missense_Mutation_p.E378D|NTNG1_ENST00000370067.1_Missense_Mutation_p.E378D			Q9Y2I2	NTNG1_HUMAN	netrin G1						axonogenesis (GO:0007409)	anchored component of plasma membrane (GO:0046658)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(8)|liver(1)|lung(15)|ovary(2)|prostate(2)|skin(3)|soft_tissue(1)|urinary_tract(1)	37		all_epithelial(167;1.39e-05)|all_lung(203;0.000115)|Lung NSC(277;0.000238)|Breast(1374;0.243)		Lung(183;0.0946)|BRCA - Breast invasive adenocarcinoma(282;0.237)|Epithelial(280;0.245)		CTTCCCTTGAGGTTTCTAACC	0.373																																																	0													88.0	76.0	80.0					1																	107961248		1567	3581	5148	SO:0001627	intron_variant	0			AB023193	CCDS30785.1, CCDS44179.1, CCDS44180.1	1p13.2-p13.1	2013-03-01			ENSG00000162631	ENSG00000162631		"""Netrins"""	23319	protein-coding gene	gene with protein product	"""netrin G1f"", ""Netrin-G1"""	608818				10964959	Standard	NM_001113226		Approved	KIAA0976, Lmnt1	uc001dvh.4	Q9Y2I2	OTTHUMG00000010965	ENST00000370068.1:c.1087+10918G>T	1.37:g.107961248G>T			Q5VU86|Q5VU87|Q5VU89|Q5VU90|Q5VU91|Q7Z2Y3|Q8N633	Missense_Mutation	SNP	pfam_Laminin_N,pfam_EGF_laminin,smart_Laminin_N,smart_EGF_laminin,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_EGF_laminin,pfscan_Laminin_N	p.E378D	ENST00000370068.1	37	c.1134	CCDS44180.1	1	.	.	.	.	.	.	.	.	.	.	G	7.407	0.633924	0.14322	.	.	ENSG00000162631	ENST00000370071;ENST00000370061;ENST00000370070;ENST00000370064;ENST00000370062;ENST00000370067;ENST00000370066	T;T;T;T;T	0.70516	-0.38;0.21;-0.49;-0.46;-0.38	5.92	4.95	0.65309	.	.	.	.	.	T	0.24928	0.0605	N	0.08118	0	0.09310	N	0.999997	B;B	0.20368	0.0;0.044	B;B	0.17979	0.001;0.02	T	0.05468	-1.0883	9	0.02654	T	1	.	11.5845	0.50910	0.0:0.134:0.727:0.139	.	378;378	B4DKF0;Q9Y2I2-4	.;.	D	378;378;378;139;139;378;378	ENSP00000359088:E378D;ENSP00000359078:E378D;ENSP00000359087:E378D;ENSP00000359084:E378D;ENSP00000359083:E378D	ENSP00000359078:E378D	E	+	3	2	NTNG1	107762771	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	3.081000	0.50120	2.809000	0.96659	0.557000	0.71058	GAG	NTNG1	-	NULL	ENSG00000162631		0.373	NTNG1-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NTNG1	HGNC	protein_coding	OTTHUMT00000030340.1	-	0.00	22	0	G	NM_014917		107961248	+1	tier1	-	no_errors	ENST00000370061	ensembl	human	known	74_37	missense	44.83	16	13	SNP	1.000	T
NUDCD1	84955	genome.wustl.edu	37	8	110305659	110305659	+	Missense_Mutation	SNP	A	A	G			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr8:110305659A>G	ENST00000239690.4	-	4	928	c.554T>C	c.(553-555)cTt>cCt	p.L185P	NUDCD1_ENST00000427660.2_Missense_Mutation_p.L156P	NM_032869.3	NP_116258.2			NudC domain containing 1											breast(1)|kidney(1)|large_intestine(4)|lung(15)|ovary(1)|prostate(2)|skin(1)	25	all_neural(195;0.219)		OV - Ovarian serous cystadenocarcinoma(57;1.56e-12)			CTCTATTCGAAGAAGTAGGGT	0.343																																																	0													132.0	138.0	136.0					8																	110305659		2203	4300	6503	SO:0001583	missense	0			AF283302	CCDS6312.1, CCDS47910.1	8q23	2005-02-07			ENSG00000120526	ENSG00000120526			24306	protein-coding gene	gene with protein product		606109				11416219	Standard	NM_032869		Approved	CML66, FLJ14991	uc003ynb.4	Q96RS6	OTTHUMG00000164931	ENST00000239690.4:c.554T>C	8.37:g.110305659A>G	ENSP00000239690:p.Leu185Pro			Missense_Mutation	SNP	pfam_CS_dom,superfamily_HSP20-like_chaperone,pfscan_CS_dom	p.L185P	ENST00000239690.4	37	c.554	CCDS6312.1	8	.	.	.	.	.	.	.	.	.	.	A	21.4	4.140152	0.77775	.	.	ENSG00000120526	ENST00000239690;ENST00000427660	T;T	0.20881	2.05;2.04	5.93	5.93	0.95920	.	0.000000	0.85682	D	0.000000	T	0.46190	0.1380	M	0.68952	2.095	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.85130	0.992;0.982;0.997	T	0.41106	-0.9527	10	0.66056	D	0.02	-6.8048	15.5755	0.76380	1.0:0.0:0.0:0.0	.	98;185;156	Q96RS6-3;Q96RS6;Q96RS6-2	.;NUDC1_HUMAN;.	P	185;156	ENSP00000239690:L185P;ENSP00000410707:L156P	ENSP00000239690:L185P	L	-	2	0	NUDCD1	110374835	1.000000	0.71417	1.000000	0.80357	0.934000	0.57294	7.506000	0.81665	2.281000	0.76405	0.533000	0.62120	CTT	NUDCD1	-	NULL	ENSG00000120526		0.343	NUDCD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUDCD1	HGNC	protein_coding	OTTHUMT00000380996.1	-	0.00	31	0	A	NM_032869		110305659	-1	tier1	-	no_errors	ENST00000239690	ensembl	human	known	74_37	missense	13.16	33	5	SNP	1.000	G
NUFIP1	26747	genome.wustl.edu	37	13	45523975	45523975	+	Splice_Site	SNP	T	T	A	rs77897726	byFrequency	TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr13:45523975T>A	ENST00000379161.4	-	8	1068		c.e8-2			NM_012345.2	NP_036477.2	Q9UHK0	NUFP1_HUMAN	nuclear fragile X mental retardation protein interacting protein 1						box C/D snoRNP assembly (GO:0000492)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|RNA processing (GO:0006396)	cytosolic ribosome (GO:0022626)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perichromatin fibrils (GO:0005726)|pre-snoRNP complex (GO:0070761)|presynaptic active zone (GO:0048786)|transcription elongation factor complex (GO:0008023)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)|RNA binding (GO:0003723)			breast(2)|cervix(1)|endometrium(2)|large_intestine(2)|lung(4)|prostate(4)|skin(3)	18		Lung NSC(96;8.23e-05)|Breast(139;0.00378)|Prostate(109;0.0107)|all_hematologic(4;0.014)|Lung SC(185;0.0262)|Hepatocellular(98;0.0524)|Acute lymphoblastic leukemia(4;0.143)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;0.000306)|BRCA - Breast invasive adenocarcinoma(63;0.125)		TATCAGACTCTGAAGGGAAAA	0.413																																																	0													124.0	109.0	114.0					13																	45523975		2203	4300	6503	SO:0001630	splice_region_variant	0			AF159548	CCDS9393.1	13q14	2008-02-05			ENSG00000083635	ENSG00000083635			8057	protein-coding gene	gene with protein product		604354				10556305, 10894927	Standard	NM_012345		Approved	NUFIP	uc001uzp.2	Q9UHK0	OTTHUMG00000016842	ENST00000379161.4:c.1022-2A>T	13.37:g.45523975T>A			Q8WVM5|Q96SG1	Splice_Site	SNP	-	e8-2	ENST00000379161.4	37	c.1022-2	CCDS9393.1	13	.	.	.	.	.	.	.	.	.	.	T	22.1	4.248941	0.80024	.	.	ENSG00000083635	ENST00000379161	.	.	.	5.93	5.93	0.95920	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.7696	0.57412	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	NUFIP1	44421975	1.000000	0.71417	0.997000	0.53966	0.954000	0.61252	4.813000	0.62620	2.268000	0.75426	0.519000	0.50382	.	NUFIP1	-	-	ENSG00000083635		0.413	NUFIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUFIP1	HGNC	protein_coding	OTTHUMT00000044755.2		0.00	70	0	T	NM_012345	Intron	45523975	-1			no_errors	ENST00000379161	ensembl	human	known	74_37	splice_site	8.77	52	5	SNP	1.000	A
OR10G7	390265	genome.wustl.edu	37	11	123909033	123909033	+	Missense_Mutation	SNP	G	G	A	rs150421981	byFrequency	TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr11:123909033G>A	ENST00000330487.5	-	1	684	c.676C>T	c.(676-678)Cgg>Tgg	p.R226W		NM_001004463.1	NP_001004463.1	Q8NGN6	O10G7_HUMAN	olfactory receptor, family 10, subfamily G, member 7	226						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(7)|large_intestine(6)|lung(20)|ovary(2)|prostate(2)|stomach(3)|urinary_tract(1)	47		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0521)		GTGCGGATCCGCAGGATGGAA	0.532													G|||	2	0.000399361	0.0015	0.0	5008	,	,		19788	0.0		0.0	False		,,,				2504	0.0																0								G	TRP/ARG	5,4397	9.9+/-24.2	0,5,2196	137.0	119.0	125.0		676	-0.5	1.0	11	dbSNP_134	125	0,8598		0,0,4299	no	missense	OR10G7	NM_001004463.1	101	0,5,6495	AA,AG,GG		0.0,0.1136,0.0385	probably-damaging	226/312	123909033	5,12995	2201	4299	6500	SO:0001583	missense	0			AB065754	CCDS31705.1	11q24.1	2012-08-09			ENSG00000182634	ENSG00000182634		"""GPCR / Class A : Olfactory receptors"""	14842	protein-coding gene	gene with protein product							Standard	NM_001004463		Approved		uc001pzq.1	Q8NGN6	OTTHUMG00000165969	ENST00000330487.5:c.676C>T	11.37:g.123909033G>A	ENSP00000329689:p.Arg226Trp		Q6IFE8	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.R226W	ENST00000330487.5	37	c.676	CCDS31705.1	11	.	.	.	.	.	.	.	.	.	.	G	9.720	1.159348	0.21454	0.001136	0.0	ENSG00000182634	ENST00000330487	T	0.00269	8.37	3.38	-0.522	0.11928	GPCR, rhodopsin-like superfamily (1);	0.805161	0.10846	N	0.627629	T	0.00496	0.0016	M	0.89095	3.005	0.09310	N	1	D	0.71674	0.998	P	0.61722	0.893	T	0.41752	-0.9491	10	0.87932	D	0	.	6.5252	0.22297	0.1421:0.0:0.321:0.5369	.	226	Q8NGN6	O10G7_HUMAN	W	226	ENSP00000329689:R226W	ENSP00000329689:R226W	R	-	1	2	OR10G7	123414243	0.000000	0.05858	0.992000	0.48379	0.262000	0.26303	0.016000	0.13377	-0.213000	0.10094	-1.601000	0.00813	CGG	OR10G7	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000182634		0.532	OR10G7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10G7	HGNC	protein_coding	OTTHUMT00000387271.1	-	0.00	136	0	G	NM_001004463		123909033	-1	tier1	rs150421981	no_errors	ENST00000330487	ensembl	human	known	74_37	missense	66.67	30	62	SNP	0.032	A
OR11A1	26531	genome.wustl.edu	37	6	29394522	29394522	+	Silent	SNP	A	A	G			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr6:29394522A>G	ENST00000377149.1	-	5	1369	c.897T>C	c.(895-897)caT>caC	p.H299H	OR5V1_ENST00000377154.1_Intron|OR11A1_ENST00000377148.1_Silent_p.H299H|OR11A1_ENST00000377147.2_Silent_p.H299H			Q9GZK7	O11A1_HUMAN	olfactory receptor, family 11, subfamily A, member 1	299						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|large_intestine(1)|lung(12)|ovary(1)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)	19						GAAGTGCCTGATGCACCTCCT	0.473																																																	0													114.0	111.0	112.0					6																	29394522		1511	2709	4220	SO:0001819	synonymous_variant	0				CCDS34363.1	6p22.2-p21.31	2014-02-19	2002-02-28		ENSG00000204694	ENSG00000204694		"""GPCR / Class A : Olfactory receptors"""	8176	protein-coding gene	gene with protein product			"""olfactory receptor, family 11, subfamily A, member 2"""	OR11A2			Standard	XM_005249001		Approved	hs6M1-18	uc003nmg.3	Q9GZK7	OTTHUMG00000031225	ENST00000377149.1:c.897T>C	6.37:g.29394522A>G			A2BF33|A6NFQ3|B0S7T2|Q5ST16|Q9GZK8	Silent	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_GPCR_Rhodpsn,prints_Olfact_rcpt,pfscan_GPCR_Rhodpsn_7TM	p.H299	ENST00000377149.1	37	c.897	CCDS34363.1	6																																																																																			OR11A1	-	prints_GPCR_Rhodpsn	ENSG00000204694		0.473	OR11A1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	OR11A1	HGNC	protein_coding	OTTHUMT00000193778.1	-	0.00	24	0	A			29394522	-1	tier1	-	no_errors	ENST00000377147	ensembl	human	known	74_37	silent	57.14	9	12	SNP	0.645	G
OXNAD1	92106	genome.wustl.edu	37	3	16312569	16312569	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr3:16312569C>T	ENST00000285083.5	+	3	575	c.110C>T	c.(109-111)aCt>aTt	p.T37I	OXNAD1_ENST00000544043.1_Missense_Mutation_p.T55I|OXNAD1_ENST00000606098.1_Missense_Mutation_p.T37I|OXNAD1_ENST00000605932.1_Missense_Mutation_p.T37I|OXNAD1_ENST00000435829.2_Missense_Mutation_p.T55I	NM_138381.3	NP_612390.1	Q96HP4	OXND1_HUMAN	oxidoreductase NAD-binding domain containing 1	37						mitochondrion (GO:0005739)	oxidoreductase activity (GO:0016491)			endometrium(3)|kidney(1)|large_intestine(2)|lung(5)|skin(2)	13						CGCCACCTTACTCTAACCAGG	0.488																																																	0													147.0	138.0	141.0					3																	16312569		2203	4300	6503	SO:0001583	missense	0			AL832787	CCDS2630.1	3p25-p24	2010-03-19			ENSG00000154814	ENSG00000154814			25128	protein-coding gene	gene with protein product						12477932	Standard	NM_138381		Approved	MGC15763	uc003caw.3	Q96HP4	OTTHUMG00000129867	ENST00000285083.5:c.110C>T	3.37:g.16312569C>T	ENSP00000285083:p.Thr37Ile		Q2HYC7|Q59FA4	Missense_Mutation	SNP	pfam_OxRdtase_FAD/NAD-bd,pfam_Fe_red_NAD-bd_6,superfamily_Riboflavin_synthase-like_b-brl,prints_Phe_hydroxylase,prints_NADH-Cyt_B5_reductase	p.T55I	ENST00000285083.5	37	c.164	CCDS2630.1	3	.	.	.	.	.	.	.	.	.	.	C	17.98	3.521710	0.64747	.	.	ENSG00000154814	ENST00000285083;ENST00000435829;ENST00000544043	T;T;T	0.25085	2.18;1.82;2.16	4.73	4.73	0.59995	.	0.391553	0.29537	N	0.011871	T	0.28366	0.0701	M	0.68952	2.095	0.20489	N	0.999892	P;B	0.40107	0.703;0.18	B;B	0.37047	0.24;0.052	T	0.31052	-0.9957	10	0.52906	T	0.07	-1.6047	13.4233	0.61011	0.0:1.0:0.0:0.0	.	55;37	F5H620;Q96HP4	.;OXND1_HUMAN	I	37;37;55	ENSP00000285083:T37I;ENSP00000389872:T37I;ENSP00000437967:T55I	ENSP00000285083:T37I	T	+	2	0	OXNAD1	16287573	0.015000	0.18098	0.021000	0.16686	0.143000	0.21401	3.336000	0.52113	2.619000	0.88677	0.650000	0.86243	ACT	OXNAD1	-	NULL	ENSG00000154814		0.488	OXNAD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	OXNAD1	HGNC	protein_coding	OTTHUMT00000252109.1	-	0.00	50	0	C	NM_138381		16312569	+1	tier1	-	no_errors	ENST00000544043	ensembl	human	known	74_37	missense	78.26	5	18	SNP	0.033	T
PCDHB4	56131	genome.wustl.edu	37	5	140502263	140502263	+	Missense_Mutation	SNP	G	G	T	rs367626652		TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr5:140502263G>T	ENST00000194152.1	+	1	683	c.683G>T	c.(682-684)cGa>cTa	p.R228L	AC005754.8_ENST00000606030.1_lincRNA	NM_018938.2	NP_061761.1	Q9Y5E5	PCDB4_HUMAN	protocadherin beta 4	228	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(2)|endometrium(4)|kidney(2)|large_intestine(12)|lung(35)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	67			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GTCATGGTTCGAATCCTGATC	0.537																																																	0													130.0	120.0	123.0					5																	140502263		2203	4300	6503	SO:0001583	missense	0			AF152497	CCDS4246.1	5q31	2010-01-26			ENSG00000081818	ENSG00000081818		"""Cadherins / Protocadherins : Clustered"""	8689	other	protocadherin		606330				10380929	Standard	NM_018938		Approved	PCDH-BETA4	uc003lip.1	Q9Y5E5	OTTHUMG00000129617	ENST00000194152.1:c.683G>T	5.37:g.140502263G>T	ENSP00000194152:p.Arg228Leu		Q4V761	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.R228L	ENST00000194152.1	37	c.683	CCDS4246.1	5	.	.	.	.	.	.	.	.	.	.	G	3.557	-0.090539	0.07053	.	.	ENSG00000081818	ENST00000194152	T	0.53206	0.63	4.31	-0.709	0.11237	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.28830	0.0715	N	0.13198	0.31	0.09310	N	1	B	0.06786	0.001	B	0.19391	0.025	T	0.24048	-1.0171	9	0.24483	T	0.36	.	11.0503	0.47882	0.5953:0.0:0.4047:0.0	.	228	Q9Y5E5	PCDB4_HUMAN	L	228	ENSP00000194152:R228L	ENSP00000194152:R228L	R	+	2	0	PCDHB4	140482447	0.000000	0.05858	0.054000	0.19295	0.749000	0.42624	-3.184000	0.00567	-0.281000	0.09141	-0.781000	0.03364	CGA	PCDHB4	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000081818		0.537	PCDHB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB4	HGNC	protein_coding	OTTHUMT00000251812.2		0.00	27	0	G	NM_018938		140502263	+1			no_errors	ENST00000194152	ensembl	human	known	74_37	missense	9.09	20	2	SNP	0.000	T
PDCD2	5134	genome.wustl.edu	37	6	170892195	170892195	+	Missense_Mutation	SNP	A	A	G			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr6:170892195A>G	ENST00000541970.1	-	3	686	c.608T>C	c.(607-609)aTg>aCg	p.M203T	PDCD2_ENST00000443345.2_Missense_Mutation_p.M170T|PDCD2_ENST00000542896.1_Missense_Mutation_p.M203T|PDCD2_ENST00000392090.2_Missense_Mutation_p.M170T|PDCD2_ENST00000453163.2_Missense_Mutation_p.M203T|PDCD2_ENST00000537445.1_Missense_Mutation_p.M170T	NM_001199462.1|NM_002598.3	NP_001186391.1|NP_002589.2	Q16342	PDCD2_HUMAN	programmed cell death 2	203					apoptotic process (GO:0006915)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|large_intestine(1)|lung(5)	9		Breast(66;5.08e-05)|Ovarian(120;0.125)|Esophageal squamous(34;0.246)		OV - Ovarian serous cystadenocarcinoma(33;6.91e-23)|BRCA - Breast invasive adenocarcinoma(81;4.82e-06)|GBM - Glioblastoma multiforme(31;0.142)		AACCTCAGGCATAATCTCATC	0.368																																					Colon(60;1476 1726 39478)												0													131.0	129.0	130.0					6																	170892195		2203	4300	6503	SO:0001583	missense	0			AJ420535	CCDS5316.1, CCDS47521.1, CCDS56460.1, CCDS56461.1, CCDS56462.1, CCDS75557.1	6q27	2008-02-05			ENSG00000071994	ENSG00000071994		"""Zinc fingers, MYND-type"""	8762	protein-coding gene	gene with protein product		600866				7606924	Standard	NM_002598		Approved	ZMYND7, RP8	uc003qxw.3	Q16342	OTTHUMG00000016083	ENST00000541970.1:c.608T>C	6.37:g.170892195A>G	ENSP00000439467:p.Met203Thr		E9PCU7|F5GYS7|Q58HM9|Q58HN0|Q9UH12	Missense_Mutation	SNP	pfam_PDCD2_C,pfam_Znf_MYND,pfscan_Znf_MYND	p.M203T	ENST00000541970.1	37	c.608	CCDS5316.1	6	.	.	.	.	.	.	.	.	.	.	.	4.052	0.007261	0.07866	.	.	ENSG00000071994	ENST00000541970;ENST00000392090;ENST00000542896;ENST00000538195;ENST00000453163;ENST00000537445;ENST00000443345	.	.	.	4.65	-8.33	0.00992	Programmed cell death protein 2, C-terminal (1);	2.708770	0.00718	N	0.000865	T	0.02047	0.0064	N	0.01800	-0.715	0.09310	N	1	B;B;B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0;0.0;0.0	B;B;B;B;B;B;B	0.01281	0.0;0.0;0.0;0.0;0.0;0.0;0.0	T	0.18555	-1.0333	8	.	.	.	-14.5689	1.8344	0.03137	0.1865:0.1029:0.4041:0.3065	.	152;170;203;170;203;203;170	Q7Z6S7;F5GYS7;E9PCU7;Q58HM9;F5H4V9;Q16342;Q58HN0	.;.;.;.;.;PDCD2_HUMAN;.	T	203;170;203;1;203;170;170	.	.	M	-	2	0	PDCD2	170734120	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.607000	0.05648	-1.418000	0.02014	-1.309000	0.01313	ATG	PDCD2	-	pfam_PDCD2_C	ENSG00000071994		0.368	PDCD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDCD2	HGNC	protein_coding	OTTHUMT00000043269.2	-	0.00	30	0	A	NM_002598		170892195	-1	tier1	-	no_errors	ENST00000541970	ensembl	human	known	74_37	missense	85.71	5	30	SNP	0.000	G
PHF20L1	51105	genome.wustl.edu	37	8	133806767	133806767	+	Frame_Shift_Del	DEL	G	G	-			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr8:133806767delG	ENST00000395386.2	+	3	494	c.195delG	c.(193-195)ttgfs	p.L65fs	PHF20L1_ENST00000337920.4_Frame_Shift_Del_p.L65fs|PHF20L1_ENST00000395376.1_Frame_Shift_Del_p.L65fs|PHF20L1_ENST00000220847.7_5'UTR|PHF20L1_ENST00000395390.2_Frame_Shift_Del_p.L65fs|PHF20L1_ENST00000395379.1_Frame_Shift_Del_p.L65fs	NM_016018.4	NP_057102.4	A8MW92	P20L1_HUMAN	PHD finger protein 20-like 1	65	Tudor 1.						zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|large_intestine(1)|lung(10)|ovary(2)	15	all_neural(3;2.72e-06)|Medulloblastoma(3;7.08e-05)|Ovarian(258;0.00438)|Esophageal squamous(12;0.00507)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;4.46e-05)			GCAATAGATTGCGACCCCTTG	0.408																																																	0													127.0	116.0	120.0					8																	133806767		2203	4300	6503	SO:0001589	frameshift_variant	0			AF230666	CCDS6367.2, CCDS6368.1, CCDS75791.1	8q24.22	2014-03-24			ENSG00000129292	ENSG00000129292		"""Tudor domain containing"", ""Zinc fingers, PHD-type"""	24280	protein-coding gene	gene with protein product	"""tudor domain containing 20B"""					10810093, 24492612	Standard	NM_016018		Approved	CGI-72, FLJ13649, MGC64923, FLJ21615, TDRD20B	uc003ytt.3	A8MW92	OTTHUMG00000148656	ENST00000395386.2:c.195delG	8.37:g.133806767delG	ENSP00000378784:p.Leu65fs		A8MZC9|Q86U89|Q86W43|Q96BT0|Q9H702|Q9HBK3|Q9NYR3|Q9Y381	Frame_Shift_Del	DEL	pfam_DUF3776,smart_Tudor,smart_Tudor-like_plant	p.L65fs	ENST00000395386.2	37	c.195	CCDS6367.2	8																																																																																			PHF20L1	-	smart_Tudor,smart_Tudor-like_plant	ENSG00000129292		0.408	PHF20L1-008	PUTATIVE	basic|appris_principal|CCDS	protein_coding	PHF20L1	HGNC	protein_coding	OTTHUMT00000308949.3		0.00	51	0	G	NM_016018		133806767	+1	tier1		no_errors	ENST00000486199	ensembl	human	known	74_37	frame_shift_del	55.45	45	56	DEL	0.999	-
PHIP	55023	genome.wustl.edu	37	6	79698018	79698018	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr6:79698018G>T	ENST00000275034.4	-	21	2535	c.2368C>A	c.(2368-2370)Cag>Aag	p.Q790K		NM_017934.5	NP_060404	Q8WWQ0	PHIP_HUMAN	pleckstrin homology domain interacting protein	790					cytoskeleton organization (GO:0007010)|insulin receptor signaling pathway (GO:0008286)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of mitosis (GO:0045840)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein import into nucleus (GO:0006606)|regulation of cell morphogenesis (GO:0022604)|regulation of growth (GO:0040008)|regulation of protein phosphorylation (GO:0001932)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	insulin receptor binding (GO:0005158)|lysine-acetylated histone binding (GO:0070577)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(10)|kidney(4)|large_intestine(20)|lung(20)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	68		all_cancers(76;0.00125)|Acute lymphoblastic leukemia(125;1.1e-05)|all_hematologic(105;0.00117)|all_epithelial(107;0.219)		BRCA - Breast invasive adenocarcinoma(397;0.231)		TGATTTGTCTGTTGCTTTTTG	0.343																																																	0													168.0	155.0	159.0					6																	79698018		2203	4300	6503	SO:0001583	missense	0			AF310250	CCDS4987.1	6q14	2013-01-09			ENSG00000146247	ENSG00000146247		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	15673	protein-coding gene	gene with protein product	"""DDB1 and CUL4 associated factor 14"""	612870		WDR11		11018022	Standard	NM_017934		Approved	ndrp, FLJ20705, DCAF14, BRWD2	uc003pir.3	Q8WWQ0	OTTHUMG00000015071	ENST00000275034.4:c.2368C>A	6.37:g.79698018G>T	ENSP00000275034:p.Gln790Lys		A7J992|B2RPK4|Q05CQ9|Q5VVH4|Q66I29|Q69YV1|Q8NBZ5|Q96H52|Q96ME2|Q9H261	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_Bromodomain,superfamily_Quinonprotein_ADH-like_supfam,superfamily_Bromodomain,smart_WD40_repeat,smart_Bromodomain,pfscan_Bromodomain,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_Bromodomain	p.Q790K	ENST00000275034.4	37	c.2368	CCDS4987.1	6	.	.	.	.	.	.	.	.	.	.	G	12.79	2.043339	0.36085	.	.	ENSG00000146247	ENST00000275034	T	0.27890	1.64	4.68	4.68	0.58851	.	0.173337	0.40818	N	0.001007	T	0.14442	0.0349	L	0.50333	1.59	0.38922	D	0.957752	B;B	0.23316	0.083;0.083	B;B	0.17433	0.018;0.018	T	0.03750	-1.1007	9	.	.	.	-9.1336	12.6393	0.56700	0.0:0.1661:0.8339:0.0	.	790;790	A7J992;Q8WWQ0	.;PHIP_HUMAN	K	790	ENSP00000275034:Q790K	.	Q	-	1	0	PHIP	79754737	1.000000	0.71417	0.950000	0.38849	0.981000	0.71138	7.125000	0.77193	2.296000	0.77279	0.585000	0.79938	CAG	PHIP	-	NULL	ENSG00000146247		0.343	PHIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHIP	HGNC	protein_coding	OTTHUMT00000041297.2	-	0.00	64	0	G			79698018	-1	tier1	-	no_errors	ENST00000275034	ensembl	human	known	74_37	missense	50.00	14	14	SNP	0.946	T
PKD1L1	168507	genome.wustl.edu	37	7	47955185	47955186	+	Frame_Shift_Ins	INS	-	-	A	rs544774439	byFrequency	TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr7:47955185_47955186insA	ENST00000289672.2	-	8	1121_1122	c.1071_1072insT	c.(1069-1074)tttcatfs	p.H358fs		NM_138295.3	NP_612152.1	Q8TDX9	PK1L1_HUMAN	polycystic kidney disease 1 like 1	358					detection of mechanical stimulus (GO:0050982)|detection of nodal flow (GO:0003127)|left/right axis specification (GO:0070986)|single organismal cell-cell adhesion (GO:0016337)	calcium channel complex (GO:0034704)|cilium (GO:0005929)|membrane (GO:0016020)|nonmotile primary cilium (GO:0031513)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)		BBS9/PKD1L1(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(27)|lung(44)|ovary(12)|prostate(5)|skin(8)|stomach(4)|upper_aerodigestive_tract(5)	142						tgtaaaagatgaaaaaaaatac	0.297																																																	0										1,4263		0,1,2131						0.3	0.0			50	4,8250		0,4,4123	no	frameshift	PKD1L1	NM_138295.3		0,5,6254	A1A1,A1R,RR		0.0485,0.0235,0.0399				5,12513				SO:0001589	frameshift_variant	0			AB061683	CCDS34633.1	7p12.3	2008-07-18			ENSG00000158683	ENSG00000158683			18053	protein-coding gene	gene with protein product	"""polycystin-1L1"""	609721				11863367	Standard	NM_138295		Approved	PRO19563	uc003tny.2	Q8TDX9	OTTHUMG00000155649	ENST00000289672.2:c.1072dupT	7.37:g.47955193_47955193dupA	ENSP00000289672:p.His358fs		Q6UWK1	Frame_Shift_Ins	INS	pfam_PKD/REJ-like,pfam_PKD1_2_channel,pfam_PKD_dom,pfam_PLAT/LH2_dom,superfamily_Lipase_LipOase,superfamily_PKD_dom,smart_PKD/Chitinase_dom,smart_PLAT/LH2_dom,pfscan_PKD_dom,pfscan_PLAT/LH2_dom,pfscan_REJ-like	p.H357fs	ENST00000289672.2	37	c.1072_1071	CCDS34633.1	7																																																																																			PKD1L1	-	NULL	ENSG00000158683		0.297	PKD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PKD1L1	HGNC	protein_coding	OTTHUMT00000340974.1		0.00	22	0	0	NM_138295		47955186	-1			no_errors	ENST00000289672	ensembl	human	known	74_37	frame_shift_ins	26.67	11	4	INS	0.003:0.006	A
PLEKHG6	55200	genome.wustl.edu	37	12	6427985	6427985	+	Silent	SNP	G	G	A			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr12:6427985G>A	ENST00000396988.3	+	12	1580	c.1350G>A	c.(1348-1350)aaG>aaA	p.K450K	PLEKHG6_ENST00000449001.2_Silent_p.K418K|PLEKHG6_ENST00000536531.1_Silent_p.K450K|PLEKHG6_ENST00000011684.7_Silent_p.K450K|PLEKHG6_ENST00000304581.8_5'Flank	NM_001144856.1	NP_001138328.1	Q3KR16	PKHG6_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 6	450	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.					cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	GTPase activator activity (GO:0005096)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|kidney(3)|large_intestine(4)|lung(6)|ovary(1)|prostate(2)|skin(4)	23						ACAAAGCCAAGGTCATCCGAC	0.592																																																	0													149.0	131.0	137.0					12																	6427985		2203	4300	6503	SO:0001819	synonymous_variant	0			AK001527	CCDS8541.1, CCDS44808.1	12p13.31	2013-01-11			ENSG00000008323	ENSG00000008323		"""Pleckstrin homology (PH) domain containing"""	25562	protein-coding gene	gene with protein product		611743					Standard	NM_018173		Approved	FLJ10665	uc001qnr.3	Q3KR16	OTTHUMG00000168266	ENST00000396988.3:c.1350G>A	12.37:g.6427985G>A			Q3SWR1|Q8N1P1|Q8WYY1|Q9H8F4|Q9NVK9	Silent	SNP	pfam_DH-domain,superfamily_DH-domain,smart_DH-domain,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_DH-domain	p.K450	ENST00000396988.3	37	c.1350	CCDS8541.1	12																																																																																			PLEKHG6	-	smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	ENSG00000008323		0.592	PLEKHG6-003	NOVEL	basic|appris_principal|CCDS	protein_coding	PLEKHG6	HGNC	protein_coding	OTTHUMT00000399031.1	-	0.00	52	0	G	NM_018173		6427985	+1	tier1	-	no_errors	ENST00000011684	ensembl	human	known	74_37	silent	36.07	39	22	SNP	1.000	A
POLD2	5425	genome.wustl.edu	37	7	44156828	44156828	+	Missense_Mutation	SNP	A	A	T			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr7:44156828A>T	ENST00000406581.2	-	6	1134	c.485T>A	c.(484-486)tTt>tAt	p.F162Y	POLD2_ENST00000452185.1_Missense_Mutation_p.F162Y|POLD2_ENST00000223361.3_Missense_Mutation_p.F162Y	NM_001256879.1	NP_001243808.1	P49005	DPOD2_HUMAN	polymerase (DNA directed), delta 2, accessory subunit	162					base-excision repair (GO:0006284)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA strand elongation involved in DNA replication (GO:0006271)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	delta DNA polymerase complex (GO:0043625)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)			breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|ovary(2)|skin(1)|urinary_tract(1)	12						CACGGAGCCAAACACAGCCAG	0.597																																																	0													52.0	48.0	49.0					7																	44156828		2203	4300	6503	SO:0001583	missense	0				CCDS5477.1, CCDS75586.1	7p13	2012-05-18	2012-05-18		ENSG00000106628	ENSG00000106628		"""DNA polymerases"""	9176	protein-coding gene	gene with protein product	"""Pol delta B subunit (p50)"", ""DNA polymerase delta subunit p50"""	600815	"""polymerase (DNA directed), delta 2, regulatory subunit (50kD)"", ""polymerase (DNA directed), delta 2, regulatory subunit 50kDa"""			8530069	Standard	NM_001127218		Approved		uc003tkf.5	P49005	OTTHUMG00000022909	ENST00000406581.2:c.485T>A	7.37:g.44156828A>T	ENSP00000386105:p.Phe162Tyr		A4D2J4|B2R5S4	Missense_Mutation	SNP	pfam_DNA_pol_alpha/epsilon_bsu	p.F162Y	ENST00000406581.2	37	c.485	CCDS5477.1	7	.	.	.	.	.	.	.	.	.	.	A	11.58	1.680529	0.29872	.	.	ENSG00000106628	ENST00000406581;ENST00000223361;ENST00000452185;ENST00000436844;ENST00000433715	T;T;T;T	0.41065	1.02;1.02;1.02;1.01	5.35	2.77	0.32553	.	0.814634	0.11484	N	0.559414	T	0.12178	0.0296	N	0.01009	-1.055	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.31668	-0.9935	10	0.02654	T	1	22.8815	6.4337	0.21811	0.5729:0.25:0.0:0.177	.	162;162	P49005;F8W8R3	DPOD2_HUMAN;.	Y	162;162;162;80;162	ENSP00000386105:F162Y;ENSP00000223361:F162Y;ENSP00000395231:F162Y;ENSP00000416203:F80Y	ENSP00000223361:F162Y	F	-	2	0	POLD2	44123353	0.020000	0.18652	0.290000	0.24890	0.861000	0.49209	1.871000	0.39539	0.831000	0.34780	0.533000	0.62120	TTT	POLD2	-	NULL	ENSG00000106628		0.597	POLD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POLD2	HGNC	protein_coding	OTTHUMT00000250994.2		0.00	35	0	A	NM_001127218		44156828	-1			no_errors	ENST00000406581	ensembl	human	known	74_37	missense	7.69	36	3	SNP	0.003	T
POP1	10940	genome.wustl.edu	37	8	99139945	99139945	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr8:99139945G>T	ENST00000401707.2	+	3	346	c.265G>T	c.(265-267)Gca>Tca	p.A89S	POP1_ENST00000349693.3_Missense_Mutation_p.A89S	NM_001145860.1|NM_001145861.1	NP_001139332.1|NP_001139333.1	Q99575	POP1_HUMAN	processing of precursor 1, ribonuclease P/MRP subunit (S. cerevisiae)	89					RNA phosphodiester bond hydrolysis (GO:0090501)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|tRNA 5'-leader removal (GO:0001682)|tRNA catabolic process (GO:0016078)	extracellular space (GO:0005615)|nucleolar ribonuclease P complex (GO:0005655)|ribonuclease MRP complex (GO:0000172)	poly(A) RNA binding (GO:0044822)|ribonuclease MRP activity (GO:0000171)|ribonuclease P activity (GO:0004526)			autonomic_ganglia(1)|breast(3)|endometrium(4)|large_intestine(9)|lung(15)|ovary(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	36	Breast(36;1.78e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.145)			AGGATGGAAAGCAGGTCCCGA	0.488																																																	0													112.0	109.0	110.0					8																	99139945		2203	4300	6503	SO:0001583	missense	0			D31765	CCDS6277.1	8q22.2	2012-05-21			ENSG00000104356	ENSG00000104356			30129	protein-coding gene	gene with protein product	"""processing of precursors 1"""	602486				10199568, 8918471	Standard	NM_015029		Approved		uc011lgv.2	Q99575	OTTHUMG00000164635	ENST00000401707.2:c.265G>T	8.37:g.99139945G>T	ENSP00000385787:p.Ala89Ser		A8K5W9|Q15037	Missense_Mutation	SNP	pfam_RNase_P/MRP_POP1,pfam_POPLD	p.A89S	ENST00000401707.2	37	c.265	CCDS6277.1	8	.	.	.	.	.	.	.	.	.	.	G	16.08	3.020684	0.54576	.	.	ENSG00000104356	ENST00000522319;ENST00000401707;ENST00000349693	T;T;T	0.43294	0.95;1.28;1.28	6.08	5.21	0.72293	.	0.135866	0.49916	D	0.000122	T	0.29028	0.0721	L	0.29908	0.895	0.26699	N	0.971193	B	0.20780	0.048	B	0.20577	0.03	T	0.17018	-1.0383	10	0.09338	T	0.73	-12.8456	12.5463	0.56201	0.0771:0.0:0.9229:0.0	.	89	Q99575	POP1_HUMAN	S	89	ENSP00000428945:A89S;ENSP00000385787:A89S;ENSP00000339529:A89S	ENSP00000339529:A89S	A	+	1	0	POP1	99209121	1.000000	0.71417	1.000000	0.80357	0.936000	0.57629	3.257000	0.51500	1.584000	0.49913	0.591000	0.81541	GCA	POP1	-	NULL	ENSG00000104356		0.488	POP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POP1	HGNC	protein_coding	OTTHUMT00000379470.1	-	0.00	38	0	G	NM_015029		99139945	+1	tier1	-	no_errors	ENST00000349693	ensembl	human	known	74_37	missense	9.52	38	4	SNP	1.000	T
POTEC	388468	genome.wustl.edu	37	18	14542753	14542753	+	Silent	SNP	C	C	T			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr18:14542753C>T	ENST00000358970.5	-	1	392	c.393G>A	c.(391-393)ccG>ccA	p.P131P	POTEC_ENST00000389891.4_5'UTR	NM_001137671.1	NP_001131143.1	B2RU33	POTEC_HUMAN	POTE ankyrin domain family, member C	131										NS(2)|breast(1)|endometrium(9)|kidney(13)|lung(14)|prostate(3)|skin(6)|soft_tissue(1)|urinary_tract(3)	52						CGTGGTACCTCGGCTCCATGA	0.617																																																	0													45.0	53.0	51.0					18																	14542753		692	1590	2282	SO:0001819	synonymous_variant	0			BX649118	CCDS45835.1	18p11.21	2013-01-10	2008-11-26	2008-11-26	ENSG00000183206	ENSG00000183206		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33894	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 6"""		"""ANKRD26-like family B, member 2"""	A26B2			Standard	NM_001137671		Approved	POTE18, POTE-18, DKFZp686J0529, CT104.6	uc010dln.3	B2RU33	OTTHUMG00000162963	ENST00000358970.5:c.393G>A	18.37:g.14542753C>T				Silent	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.P131	ENST00000358970.5	37	c.393	CCDS45835.1	18																																																																																			POTEC	-	NULL	ENSG00000183206		0.617	POTEC-002	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	POTEC	HGNC	protein_coding	OTTHUMT00000371179.1	-	0.00	191	0	C	XM_496269		14542753	-1	tier1	-	no_errors	ENST00000358970	ensembl	human	known	74_37	silent	25.17	110	37	SNP	0.000	T
POTEG	404785	genome.wustl.edu	37	14	19574339	19574339	+	Nonsense_Mutation	SNP	G	G	T			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr14:19574339G>T	ENST00000409832.3	+	9	1448	c.1396G>T	c.(1396-1398)Gaa>Taa	p.E466*		NM_001005356.2	NP_001005356.1	Q6S5H5	POTEG_HUMAN	POTE ankyrin domain family, member G	466										cervix(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(31)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	47						CACTGAGAATGAACAGTATCA	0.403																																																	0													1.0	1.0	1.0					14																	19574339		48	179	227	SO:0001587	stop_gained	0				CCDS73610.1	14q11.2	2013-01-10	2008-11-26	2008-11-26	ENSG00000222036	ENSG00000222036		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33896	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 4"""	608916	"""ANKRD26-like family C, member 2"""	A26C2			Standard	NR_027480		Approved	POTE14, POTE-14, POTE14alpha, CT104.4	uc001vuz.1	Q6S5H5	OTTHUMG00000170340	ENST00000409832.3:c.1396G>T	14.37:g.19574339G>T	ENSP00000386971:p.Glu466*		A1L153|A6NMI9|Q6S5H6|Q6S8J2	Nonsense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.E466*	ENST00000409832.3	37	c.1396	CCDS32018.1	14	.	.	.	.	.	.	.	.	.	.	G	15.42	2.828452	0.50845	.	.	ENSG00000222036	ENST00000409832	.	.	.	1.58	0.646	0.17789	.	.	.	.	.	.	.	.	.	.	.	0.54753	A	0.999989	.	.	.	.	.	.	.	.	.	.	0.30078	T	0.28	.	3.7906	0.08718	0.2442:0.0:0.7558:0.0	.	.	.	.	X	466	.	ENSP00000386971:E466X	E	+	1	0	POTEG	18644339	0.006000	0.16342	0.004000	0.12327	0.019000	0.09904	0.046000	0.14035	0.230000	0.21059	0.184000	0.17185	GAA	POTEG	-	NULL	ENSG00000222036		0.403	POTEG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POTEG	HGNC	protein_coding	OTTHUMT00000408579.1	-	0.00	17	0	G	NM_001005356		19574339	+1	tier1	-	no_errors	ENST00000409832	ensembl	human	known	74_37	nonsense	46.15	7	6	SNP	0.005	T
POTEH	23784	genome.wustl.edu	37	22	16278128	16278128	+	Intron	SNP	A	A	G	rs199670027		TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr22:16278128A>G	ENST00000343518.6	-	5	1080				POTEH-AS1_ENST00000422014.1_RNA|RNU6-816P_ENST00000390914.1_RNA	NM_001136213.1	NP_001129685.1	Q6S545	POTEH_HUMAN	POTE ankyrin domain family, member H											NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|lung(20)|ovary(1)|skin(7)|urinary_tract(2)	37						CTACTAATTTAAAGTCCTTTG	0.358																																																	0																																										SO:0001627	intron_variant	0			AY462874	CCDS74808.1	22q11.1	2013-01-10	2008-11-26	2008-11-26	ENSG00000198062	ENSG00000198062		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	133	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 7"""	608913	"""actin, beta-like 1"", ""ANKRD26-like family C, member 3"""	ACTBL1, A26C3		10591208, 15276201, 21439273	Standard	NM_001136213		Approved	POTE22, CT104.7	uc010gqp.2	Q6S545	OTTHUMG00000140314	ENST00000343518.6:c.1029-243T>C	22.37:g.16278128A>G			A2CEK4|A6NCI1|A9Z1W0	RNA	SNP	-	NULL	ENST00000343518.6	37	NULL	CCDS46658.1	22																																																																																			POTEH-AS1	-	-	ENSG00000236666		0.358	POTEH-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	POTEH-AS1	HGNC	protein_coding	OTTHUMT00000276918.4	-	0.00	13	0	A	NM_001136213		16278128	+1	tier1	rs199670027	no_errors	ENST00000422014	ensembl	human	known	74_37	rna	37.50	5	3	SNP	0.230	G
PPFIA3	8541	genome.wustl.edu	37	19	49652529	49652529	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr19:49652529G>A	ENST00000334186.4	+	27	3650	c.3301G>A	c.(3301-3303)Gag>Aag	p.E1101K	PPFIA3_ENST00000602351.1_Missense_Mutation_p.E1092K	NM_003660.2	NP_003651.1	O75145	LIPA3_HUMAN	protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 3	1101	SAM 3. {ECO:0000255|PROSITE- ProRule:PRU00184}.				cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|presynaptic active zone (GO:0048786)				NS(1)|breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|liver(2)|lung(16)|pancreas(1)|prostate(1)|skin(4)|urinary_tract(1)	35		all_lung(116;3.16e-06)|Lung NSC(112;6.25e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)		all cancers(93;2.36e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.000203)|GBM - Glioblastoma multiforme(486;0.00307)|Epithelial(262;0.00677)		GCAGCTTCTGGAGAAGGAATT	0.667																																																	0													35.0	40.0	39.0					19																	49652529		2203	4300	6503	SO:0001583	missense	0			AF034800	CCDS12758.1	19q13.33	2013-09-23			ENSG00000177380	ENSG00000177380		"""Sterile alpha motif (SAM) domain containing"""	9247	protein-coding gene	gene with protein product	"""protein tyrosine phosphatase, receptor type, f polypeptide, alpha 3"", ""liprin-alpha 3"", ""liprin"""	603144				9624153, 9734811	Standard	NM_003660		Approved	KIAA0654, LPNA3, MGC126567, MGC126569	uc002pmr.3	O75145	OTTHUMG00000183213	ENST00000334186.4:c.3301G>A	19.37:g.49652529G>A	ENSP00000335614:p.Glu1101Lys		A8K142|Q3MJA0|Q9H8B5|Q9UEW4	Missense_Mutation	SNP	pfam_SAM_2,pfam_SAM_type1,superfamily_SAM/pointed,smart_SAM,pfscan_SAM	p.E1101K	ENST00000334186.4	37	c.3301	CCDS12758.1	19	.	.	.	.	.	.	.	.	.	.	G	35	5.472922	0.96274	.	.	ENSG00000177380	ENST00000334186	D	0.84370	-1.84	4.29	4.29	0.51040	Sterile alpha motif domain (2);Sterile alpha motif/pointed domain (1);Sterile alpha motif, type 2 (1);	0.000000	0.47852	D	0.000218	D	0.88720	0.6513	M	0.69463	2.115	0.80722	D	1	P;D	0.61697	0.483;0.99	B;P	0.53861	0.15;0.736	D	0.90490	0.4466	10	0.87932	D	0	-19.9551	16.0255	0.80541	0.0:0.0:1.0:0.0	.	1092;1101	O75145-2;O75145	.;LIPA3_HUMAN	K	1101	ENSP00000335614:E1101K	ENSP00000335614:E1101K	E	+	1	0	PPFIA3	54344341	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	9.543000	0.98089	2.390000	0.81377	0.561000	0.74099	GAG	PPFIA3	-	pfam_SAM_2,superfamily_SAM/pointed,smart_SAM,pfscan_SAM	ENSG00000177380		0.667	PPFIA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPFIA3	HGNC	protein_coding	OTTHUMT00000465688.1	-	0.00	49	0	G	NM_003660		49652529	+1	tier1	-	no_errors	ENST00000334186	ensembl	human	known	74_37	missense	23.68	29	9	SNP	1.000	A
PRPF3	9129	genome.wustl.edu	37	1	150300856	150300856	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr1:150300856G>T	ENST00000324862.6	+	4	519	c.354G>T	c.(352-354)gaG>gaT	p.E118D	PRPF3_ENST00000414970.2_Intron|PRPF3_ENST00000467329.1_3'UTR|PRPF3_ENST00000543398.1_5'UTR	NM_004698.2	NP_004689.1	O43395	PRPF3_HUMAN	pre-mRNA processing factor 3	118					mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	Cajal body (GO:0015030)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U4/U6 x U5 tri-snRNP complex (GO:0046540)	identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)			breast(1)|kidney(3)|large_intestine(2)|lung(9)|ovary(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21	Lung NSC(24;5.57e-29)|Breast(34;0.000844)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)	Colorectal(1306;0.0149)		GTTTTGAGGAGGTGGAAGAAG	0.498																																					Ovarian(168;1070 2670 5178 20729)												0													129.0	135.0	133.0					1																	150300856		2203	4300	6503	SO:0001583	missense	0			AF001947	CCDS951.1	1q21.1	2013-07-16	2013-06-10		ENSG00000117360	ENSG00000117360			17348	protein-coding gene	gene with protein product		607301	"""retinitis pigmentosa 18 (autosomal dominant)"", ""PRP3 pre-mRNA processing factor 3 homolog (yeast)"", ""PRP3 pre-mRNA processing factor 3 homolog (S. cerevisiae)"""	RP18			Standard	NM_004698		Approved	Prp3, hPrp3, SNRNP90	uc001eum.4	O43395	OTTHUMG00000012807	ENST00000324862.6:c.354G>T	1.37:g.150300856G>T	ENSP00000315379:p.Glu118Asp		B4DSY9|O43446|Q5VT54	Missense_Mutation	SNP	pfam_Pre-mRNA_splic_Prp3,pfam_DUF1115,pfam_PWI_dom,superfamily_PWI_dom,smart_PWI_dom	p.E118D	ENST00000324862.6	37	c.354	CCDS951.1	1	.	.	.	.	.	.	.	.	.	.	G	8.936	0.964624	0.18583	.	.	ENSG00000117360	ENST00000324862	T	0.78003	-1.14	5.91	3.05	0.35203	.	0.047975	0.85682	D	0.000000	T	0.43255	0.1239	L	0.34521	1.04	0.80722	D	1	B;B	0.25486	0.127;0.002	B;B	0.23419	0.046;0.001	T	0.30592	-0.9973	10	0.10636	T	0.68	-20.4701	8.591	0.33688	0.3604:0.0:0.6396:0.0	.	118;118	B2R791;O43395	.;PRPF3_HUMAN	D	118	ENSP00000315379:E118D	ENSP00000315379:E118D	E	+	3	2	PRPF3	148567480	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	0.582000	0.23834	0.411000	0.25702	0.655000	0.94253	GAG	PRPF3	-	NULL	ENSG00000117360		0.498	PRPF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRPF3	HGNC	protein_coding	OTTHUMT00000035836.1	-	0.00	44	0	G	NM_004698		150300856	+1	tier1	-	no_errors	ENST00000324862	ensembl	human	known	74_37	missense	7.55	49	4	SNP	1.000	T
PRR16	51334	genome.wustl.edu	37	5	120022338	120022338	+	Silent	SNP	G	G	T			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr5:120022338G>T	ENST00000407149.2	+	2	1058	c.849G>T	c.(847-849)gtG>gtT	p.V283V	PRR16_ENST00000379551.2_Silent_p.V260V|PRR16_ENST00000505123.1_Silent_p.V213V|PRR16_ENST00000446965.1_Silent_p.V213V			Q569H4	LARGN_HUMAN	proline rich 16	283	Pro-rich.				positive regulation of cell size (GO:0045793)|positive regulation of translation (GO:0045727)			p.V260V(1)		endometrium(2)|kidney(2)|large_intestine(5)|lung(12)|ovary(1)|pancreas(2)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	28		all_cancers(142;0.0464)|Prostate(80;0.00446)	KIRC - Kidney renal clear cell carcinoma(527;0.159)|Kidney(363;0.221)	OV - Ovarian serous cystadenocarcinoma(64;0.000126)|Epithelial(69;0.000331)|all cancers(49;0.00169)		CTGCAACTGTGCCTCCTCCCA	0.468																																																	1	Substitution - coding silent(1)	large_intestine(1)											59.0	61.0	60.0					5																	120022338		2203	4300	6503	SO:0001819	synonymous_variant	0			AF242769	CCDS4127.1, CCDS75290.1	5q23.1	2006-08-22			ENSG00000184838	ENSG00000184838			29654	protein-coding gene	gene with protein product		615931				15971941	Standard	XM_005272010		Approved	DSC54	uc003ksp.3	Q569H4	OTTHUMG00000128903	ENST00000407149.2:c.849G>T	5.37:g.120022338G>T			D3DSZ0|Q8IXY1|Q9NYI5	Silent	SNP	NULL	p.V283	ENST00000407149.2	37	c.849		5																																																																																			PRR16	-	NULL	ENSG00000184838		0.468	PRR16-002	KNOWN	basic|appris_principal	protein_coding	PRR16	HGNC	protein_coding	OTTHUMT00000371059.1		0.00	26	0	G	NM_016644		120022338	+1			no_errors	ENST00000407149	ensembl	human	known	74_37	silent	8.33	22	2	SNP	1.000	T
PTCH1	5727	genome.wustl.edu	37	9	98242324	98242324	+	Nonsense_Mutation	SNP	T	T	A			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr9:98242324T>A	ENST00000331920.6	-	7	1293	c.994A>T	c.(994-996)Aga>Tga	p.R332*	PTCH1_ENST00000430669.2_Nonsense_Mutation_p.R266*|PTCH1_ENST00000421141.1_Nonsense_Mutation_p.R181*|PTCH1_ENST00000375274.2_Nonsense_Mutation_p.R331*|PTCH1_ENST00000418258.1_Nonsense_Mutation_p.R181*|PTCH1_ENST00000429896.2_Nonsense_Mutation_p.R181*|PTCH1_ENST00000548379.1_5'Flank|PTCH1_ENST00000437951.1_Nonsense_Mutation_p.R266*	NM_000264.3	NP_000255.2	Q13635	PTC1_HUMAN	patched 1	332					brain development (GO:0007420)|branching involved in ureteric bud morphogenesis (GO:0001658)|cell differentiation involved in kidney development (GO:0061005)|cell proliferation involved in metanephros development (GO:0072203)|cellular response to cholesterol (GO:0071397)|dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|embryonic organ development (GO:0048568)|epidermis development (GO:0008544)|glucose homeostasis (GO:0042593)|heart morphogenesis (GO:0003007)|hindlimb morphogenesis (GO:0035137)|in utero embryonic development (GO:0001701)|keratinocyte proliferation (GO:0043616)|limb morphogenesis (GO:0035108)|mammary gland duct morphogenesis (GO:0060603)|mammary gland epithelial cell differentiation (GO:0060644)|negative regulation of cell division (GO:0051782)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of multicellular organism growth (GO:0040015)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural plate axis specification (GO:0021997)|neural tube closure (GO:0001843)|neural tube patterning (GO:0021532)|organ morphogenesis (GO:0009887)|pharyngeal system development (GO:0060037)|positive regulation of cholesterol efflux (GO:0010875)|protein processing (GO:0016485)|protein targeting to plasma membrane (GO:0072661)|regulation of mitotic cell cycle (GO:0007346)|regulation of protein localization (GO:0032880)|regulation of smoothened signaling pathway (GO:0008589)|renal system development (GO:0072001)|response to chlorate (GO:0010157)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to mechanical stimulus (GO:0009612)|response to retinoic acid (GO:0032526)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)|somite development (GO:0061053)|spinal cord motor neuron differentiation (GO:0021522)	axonal growth cone (GO:0044295)|caveola (GO:0005901)|dendritic growth cone (GO:0044294)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|midbody (GO:0030496)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|primary cilium (GO:0072372)	cholesterol binding (GO:0015485)|cyclin binding (GO:0030332)|hedgehog family protein binding (GO:0097108)|hedgehog receptor activity (GO:0008158)|heparin binding (GO:0008201)|smoothened binding (GO:0005119)	p.R332*(1)		NS(8)|bone(33)|breast(10)|central_nervous_system(95)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(8)|kidney(2)|large_intestine(18)|lung(22)|meninges(1)|oesophagus(3)|ovary(6)|prostate(2)|skin(262)|upper_aerodigestive_tract(11)|urinary_tract(2)|vulva(1)	490		Medulloblastoma(1;7.87e-06)|all_neural(1;0.000555)|Acute lymphoblastic leukemia(62;0.136)				ATATACTTTCTGGATAAGCCA	0.448																																																	1	Substitution - Nonsense(1)	skin(1)											157.0	144.0	148.0					9																	98242324		2203	4300	6503	SO:0001587	stop_gained	0			AI494442	CCDS6714.1, CCDS43851.1, CCDS47995.1, CCDS47996.1	9q22.1-q31	2014-09-17	2010-06-24	2006-09-26	ENSG00000185920	ENSG00000185920			9585	protein-coding gene	gene with protein product		601309	"""patched (Drosophila) homolog"", ""patched homolog (Drosophila)"", ""patched homolog 1 (Drosophila)"""	NBCCS, PTCH		8658145	Standard	NM_001083603		Approved	BCNS	uc004avk.4	Q13635	OTTHUMG00000020280	ENST00000331920.6:c.994A>T	9.37:g.98242324T>A	ENSP00000332353:p.Arg332*		A3KBI9|E9PEJ8|Q13463|Q5R1U7|Q5R1U9|Q5R1V0|Q5VZC0|Q5VZC2|Q86XG7	Nonsense_Mutation	SNP	pfam_Patched,pfscan_SSD,tigrfam_TM_rcpt_patched	p.R332*	ENST00000331920.6	37	c.994	CCDS6714.1	9	.	.	.	.	.	.	.	.	.	.	T	37	6.180490	0.97352	.	.	ENSG00000185920	ENST00000331920;ENST00000437951;ENST00000421141;ENST00000418258;ENST00000430669;ENST00000429896;ENST00000375274;ENST00000375271;ENST00000548420	.	.	.	5.97	-1.1	0.09872	.	0.083884	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.11182	T	0.66	-13.0811	17.4185	0.87507	0.0:0.0:0.4907:0.5093	.	.	.	.	X	332;266;181;181;266;181;331;49;52	.	ENSP00000332353:R332X	R	-	1	2	PTCH1	97282145	1.000000	0.71417	0.641000	0.29422	0.682000	0.39822	2.087000	0.41653	-0.376000	0.07943	-1.255000	0.01485	AGA	PTCH1	-	tigrfam_TM_rcpt_patched	ENSG00000185920		0.448	PTCH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTCH1	HGNC	protein_coding	OTTHUMT00000053229.2	-	0.00	28	0	T	NM_000264		98242324	-1	tier1	-	no_errors	ENST00000331920	ensembl	human	known	74_37	nonsense	80.00	6	24	SNP	0.596	A
PTPN14	5784	genome.wustl.edu	37	1	214705746	214705746	+	Intron	SNP	A	A	G			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr1:214705746A>G	ENST00000366956.5	-	1	41				PTPN14_ENST00000491277.1_5'UTR	NM_005401.4	NP_005392.2	Q15678	PTN14_HUMAN	protein tyrosine phosphatase, non-receptor type 14						lymphangiogenesis (GO:0001946)|negative regulation of cell proliferation (GO:0008285)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of protein export from nucleus (GO:0046825)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	protein tyrosine phosphatase activity (GO:0004725)|receptor tyrosine kinase binding (GO:0030971)|transcription cofactor activity (GO:0003712)			NS(2)|breast(3)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(9)|liver(3)|lung(21)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	58				OV - Ovarian serous cystadenocarcinoma(81;0.00181)|all cancers(67;0.00194)|Epithelial(68;0.0157)|GBM - Glioblastoma multiforme(131;0.155)		TGGCAGGAATAGGAGGCATCC	0.617																																					Colon(92;557 1424 24372 34121 40073)												0																																										SO:0001627	intron_variant	0			X82676	CCDS1514.1	1q32.2	2011-06-09			ENSG00000152104	ENSG00000152104		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9647	protein-coding gene	gene with protein product		603155				7733990	Standard	NM_005401		Approved	PEZ	uc001hkk.2	Q15678	OTTHUMG00000037039	ENST00000366956.5:c.153+18779T>C	1.37:g.214705746A>G			Q5VSI0	RNA	SNP	-	NULL	ENST00000366956.5	37	NULL	CCDS1514.1	1																																																																																			PTPN14	-	-	ENSG00000152104		0.617	PTPN14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPN14	HGNC	protein_coding	OTTHUMT00000089918.2	-	0.00	37	0	A	NM_005401		214705746	-1	tier1	-	no_errors	ENST00000491277	ensembl	human	putative	74_37	rna	48.57	18	17	SNP	0.954	G
PTPRK	5796	genome.wustl.edu	37	6	128718824	128718824	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr6:128718824G>T	ENST00000368215.3	-	2	109	c.110C>A	c.(109-111)aCt>aAt	p.T37N	PTPRK_ENST00000524481.1_5'UTR|PTPRK_ENST00000532331.1_Missense_Mutation_p.T37N|PTPRK_ENST00000368210.3_Missense_Mutation_p.T37N|PTPRK_ENST00000368227.3_Missense_Mutation_p.T37N|PTPRK_ENST00000368213.5_Missense_Mutation_p.T37N|PTPRK_ENST00000525459.1_Missense_Mutation_p.T37N|PTPRK_ENST00000368207.3_Missense_Mutation_p.T37N|PTPRK_ENST00000368226.4_Missense_Mutation_p.T37N			Q15262	PTPRK_HUMAN	protein tyrosine phosphatase, receptor type, K	37	MAM. {ECO:0000255|PROSITE- ProRule:PRU00128}.				cell adhesion (GO:0007155)|cell migration (GO:0016477)|cellular response to reactive oxygen species (GO:0034614)|cellular response to UV (GO:0034644)|focal adhesion assembly (GO:0048041)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of keratinocyte proliferation (GO:0010839)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|protein localization to cell surface (GO:0034394)|signal transduction (GO:0007165)|transforming growth factor beta receptor signaling pathway (GO:0007179)	axon (GO:0030424)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|leading edge membrane (GO:0031256)|neuronal cell body (GO:0043025)|photoreceptor outer segment (GO:0001750)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)		PTPRK/RSPO3(10)	autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(14)|lung(24)|ovary(3)|pancreas(1)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	72				all cancers(137;0.0118)|GBM - Glioblastoma multiforme(226;0.0372)|OV - Ovarian serous cystadenocarcinoma(136;0.24)		ATCATCAAAAGTACAGCCACC	0.398																																																	0													143.0	146.0	145.0					6																	128718824		2203	4300	6503	SO:0001583	missense	0			L77886	CCDS5137.1, CCDS47473.1, CCDS75517.1	6q22.2-q22.3	2013-02-11			ENSG00000152894	ENSG00000152894		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9674	protein-coding gene	gene with protein product		602545				9047348, 8663237	Standard	NM_002844		Approved	R-PTP-kappa	uc010kfc.3	Q15262	OTTHUMG00000015536	ENST00000368215.3:c.110C>A	6.37:g.128718824G>T	ENSP00000357198:p.Thr37Asn		B2RTQ8|B7ZMG0|Q14763|Q5TG10|Q5TG11	Nonsense_Mutation	SNP	NULL	p.Y76*	ENST00000368215.3	37	c.228		6	.	.	.	.	.	.	.	.	.	.	G	39	7.801302	0.98498	.	.	ENSG00000152894	ENST00000368226;ENST00000368227;ENST00000532331;ENST00000368213;ENST00000368210;ENST00000368215;ENST00000368207;ENST00000525459	T;T;T;T;T;T;T;T	0.01821	4.62;4.62;4.62;4.62;4.62;4.62;4.62;4.62	5.54	5.54	0.83059	Concanavalin A-like lectin/glucanase (1);MAM domain (3);	0.067619	0.56097	D	0.000025	T	0.03348	0.0097	L	0.37697	1.125	0.37429	D	0.913946	B;P;D;P;P	0.61697	0.085;0.605;0.99;0.77;0.728	B;B;D;B;B	0.64410	0.124;0.388;0.925;0.327;0.219	T	0.62431	-0.6856	10	0.42905	T	0.14	.	18.8132	0.92065	0.0:0.0:1.0:0.0	.	37;37;37;37;37	B4DHC3;B7ZMG0;Q15262-3;Q15262;Q15262-2	.;.;.;PTPRK_HUMAN;.	N	37	ENSP00000357209:T37N;ENSP00000357210:T37N;ENSP00000432973:T37N;ENSP00000357196:T37N;ENSP00000357193:T37N;ENSP00000357198:T37N;ENSP00000357190:T37N;ENSP00000434116:T37N	ENSP00000357190:T37N	T	-	2	0	PTPRK	128760517	1.000000	0.71417	0.997000	0.53966	0.853000	0.48598	6.840000	0.75369	2.754000	0.94517	0.655000	0.94253	ACT	PTPRK	-	NULL	ENSG00000152894		0.398	PTPRK-005	KNOWN	basic|appris_candidate	protein_coding	PTPRK	HGNC	protein_coding	OTTHUMT00000042163.1	-	0.00	26	0	G			128718824	-1	tier1	-	no_errors	ENST00000392449	ensembl	human	known	74_37	nonsense	20.00	16	4	SNP	0.983	T
PTPRO	5800	genome.wustl.edu	37	12	15734634	15734634	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr12:15734634C>T	ENST00000281171.4	+	23	3484	c.3154C>T	c.(3154-3156)Cca>Tca	p.P1052S	PTPRO_ENST00000445537.2_Missense_Mutation_p.P241S|PTPRO_ENST00000442921.2_Missense_Mutation_p.P241S|PTPRO_ENST00000348962.2_Missense_Mutation_p.P1024S|PTPRO_ENST00000544244.1_Missense_Mutation_p.P213S|PTPRO_ENST00000542557.1_Missense_Mutation_p.P213S	NM_030667.2	NP_109592.1	Q16827	PTPRO_HUMAN	protein tyrosine phosphatase, receptor type, O	1052	Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.				axon guidance (GO:0007411)|cell morphogenesis (GO:0000902)|glomerular visceral epithelial cell differentiation (GO:0072112)|glomerulus development (GO:0032835)|lamellipodium assembly (GO:0030032)|monocyte chemotaxis (GO:0002548)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of glomerular filtration (GO:0003105)|negative regulation of neuron projection development (GO:0010977)|negative regulation of retinal ganglion cell axon guidance (GO:0090260)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of glomerular filtration (GO:0003093)|slit diaphragm assembly (GO:0036060)	apical plasma membrane (GO:0016324)|axon (GO:0030424)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	phosphatase activity (GO:0016791)|protein homodimerization activity (GO:0042803)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)|Wnt-protein binding (GO:0017147)			NS(2)|central_nervous_system(1)|endometrium(7)|kidney(2)|large_intestine(11)|lung(30)|ovary(2)|prostate(1)|skin(17)|upper_aerodigestive_tract(1)	74		Hepatocellular(102;0.244)				CCATTACTGGCCATTCACGGA	0.438																																																	0													109.0	98.0	101.0					12																	15734634		2203	4300	6503	SO:0001583	missense	0			U20489	CCDS8674.1, CCDS8675.1, CCDS44837.1, CCDS53754.1	12p13-p12	2013-02-11			ENSG00000151490	ENSG00000151490		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9678	protein-coding gene	gene with protein product	"""osteoclastic transmembrane protein-tyrosine phosphatase"""	600579				7519601, 7665166, 21722858	Standard	NM_030667		Approved	PTPU2, GLEPP1, PTP-U2, PTP-oc, NPHS6	uc001rcv.2	Q16827	OTTHUMG00000168786	ENST00000281171.4:c.3154C>T	12.37:g.15734634C>T	ENSP00000281171:p.Pro1052Ser		A0AV39|Q13101|Q8IYG3|Q9UBF0|Q9UBT5	Missense_Mutation	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt	p.P1052S	ENST00000281171.4	37	c.3154	CCDS8675.1	12	.	.	.	.	.	.	.	.	.	.	C	20.4	3.989542	0.74589	.	.	ENSG00000151490	ENST00000281171;ENST00000348962;ENST00000442921;ENST00000542557;ENST00000445537;ENST00000544244;ENST00000535322	T;T;T;T;T;T;T	0.19105	2.17;2.17;2.17;2.17;2.17;2.17;2.17	5.1	5.1	0.69264	Protein-tyrosine phosphatase, receptor/non-receptor type (3);	0.135420	0.33834	N	0.004510	T	0.46151	0.1378	M	0.84511	2.7	0.80722	D	1	P;P;P	0.50819	0.939;0.869;0.893	P;B;B	0.53593	0.73;0.244;0.357	T	0.52997	-0.8500	10	0.87932	D	0	.	19.1017	0.93276	0.0:1.0:0.0:0.0	.	213;1024;1052	Q9UBT5;Q16827-2;Q16827	.;.;PTPRO_HUMAN	S	1052;1024;241;213;241;213;31	ENSP00000281171:P1052S;ENSP00000343434:P1024S;ENSP00000404188:P241S;ENSP00000437571:P213S;ENSP00000393449:P241S;ENSP00000439234:P213S;ENSP00000446201:P31S	ENSP00000281171:P1052S	P	+	1	0	PTPRO	15625901	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.257000	0.78362	2.827000	0.97445	0.650000	0.86243	CCA	PTPRO	-	pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_rcpt/non-rcpt,pfscan_Tyr_Pase_rcpt/non-rcpt	ENSG00000151490		0.438	PTPRO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPRO	HGNC	protein_coding	OTTHUMT00000401079.1	-	0.00	33	0	C			15734634	+1	tier1	-	no_errors	ENST00000281171	ensembl	human	known	74_37	missense	15.79	32	6	SNP	1.000	T
PTPRZ1	5803	genome.wustl.edu	37	7	121650743	121650743	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr7:121650743C>A	ENST00000393386.2	+	12	2054	c.1643C>A	c.(1642-1644)tCt>tAt	p.S548Y	PTPRZ1_ENST00000449182.1_Missense_Mutation_p.S548Y	NM_001206838.1|NM_002851.2	NP_001193767.1|NP_002842.2	P23471	PTPRZ_HUMAN	protein tyrosine phosphatase, receptor-type, Z polypeptide 1	548					axonogenesis (GO:0007409)|central nervous system development (GO:0007417)|hematopoietic progenitor cell differentiation (GO:0002244)|learning or memory (GO:0007611)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of oligodendrocyte progenitor proliferation (GO:0070445)	integral component of plasma membrane (GO:0005887)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)	protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(3)|central_nervous_system(4)|cervix(1)|endometrium(4)|kidney(12)|large_intestine(17)|liver(1)|lung(42)|ovary(4)|prostate(5)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(2)	106						GTTCTTAGATCTCCACATATG	0.403																																																	0													67.0	64.0	65.0					7																	121650743		2203	4300	6503	SO:0001583	missense	0			M93426	CCDS34740.1, CCDS56505.1	7q31.3	2013-02-11			ENSG00000106278	ENSG00000106278		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9685	protein-coding gene	gene with protein product		176891		PTPZ, PTPRZ		7736789, 8387522	Standard	NM_001206838		Approved	PTP18, RPTPB, phosphacan	uc003vjy.3	P23471	OTTHUMG00000157057	ENST00000393386.2:c.1643C>A	7.37:g.121650743C>A	ENSP00000377047:p.Ser548Tyr		A4D0W5|C9JFM0|O76043|Q9UDR6	Missense_Mutation	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_Carbonic_anhydrase_a,pfam_Fibronectin_type3,superfamily_Carbonic_anhydrase_a,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,pfscan_Carbonic_anhydrase_a,prints_Tyr_Pase_rcpt/non-rcpt	p.S548Y	ENST00000393386.2	37	c.1643	CCDS34740.1	7	.	.	.	.	.	.	.	.	.	.	C	0.464	-0.887709	0.02511	.	.	ENSG00000106278	ENST00000393386;ENST00000449182	T;T	0.41758	1.03;0.99	5.81	-6.12	0.02124	.	0.665018	0.14466	N	0.317899	T	0.17831	0.0428	N	0.22421	0.69	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.39683	-0.9602	10	0.02654	T	1	.	8.2038	0.31441	0.6339:0.0668:0.0:0.2993	.	548;548	C9JFM0;P23471	.;PTPRZ_HUMAN	Y	548	ENSP00000377047:S548Y;ENSP00000410000:S548Y	ENSP00000377047:S548Y	S	+	2	0	PTPRZ1	121437979	0.000000	0.05858	0.012000	0.15200	0.881000	0.50899	-0.632000	0.05489	-1.341000	0.02225	-0.953000	0.02652	TCT	PTPRZ1	-	NULL	ENSG00000106278		0.403	PTPRZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPRZ1	HGNC	protein_coding	OTTHUMT00000347288.1		0.00	45	0	C	NM_002851		121650743	+1			no_errors	ENST00000393386	ensembl	human	known	74_37	missense	8.00	23	2	SNP	0.001	A
RACGAP1	29127	genome.wustl.edu	37	12	50398047	50398047	+	Missense_Mutation	SNP	T	T	C			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr12:50398047T>C	ENST00000427314.2	-	7	689	c.466A>G	c.(466-468)Atc>Gtc	p.I156V	RACGAP1_ENST00000547905.1_Missense_Mutation_p.I156V|RACGAP1_ENST00000434422.1_Missense_Mutation_p.I156V|RACGAP1_ENST00000547061.1_5'Flank|RACGAP1_ENST00000312377.5_Missense_Mutation_p.I156V|RACGAP1_ENST00000454520.2_Missense_Mutation_p.I156V|RACGAP1_ENST00000551016.1_Missense_Mutation_p.I156V	NM_013277.3	NP_037409.2			Rac GTPase activating protein 1											cervix(1)|endometrium(1)|kidney(3)|large_intestine(3)|lung(6)	14						TCAAAGCTGATATCTGATAAA	0.368																																																	0													143.0	132.0	136.0					12																	50398047		2203	4300	6503	SO:0001583	missense	0				CCDS8795.1	12q13	2004-05-17				ENSG00000161800			9804	protein-coding gene	gene with protein product		604980				9497316	Standard	NM_013277		Approved	MgcRacGAP	uc001rvs.2	Q9H0H5		ENST00000427314.2:c.466A>G	12.37:g.50398047T>C	ENSP00000404190:p.Ile156Val			Missense_Mutation	SNP	pfam_RhoGAP_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,superfamily_Rho_GTPase_activation_prot,superfamily_Regulat_G_prot_signal_superfam,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_RhoGAP_dom,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_RhoGAP_dom	p.I156V	ENST00000427314.2	37	c.466	CCDS8795.1	12	.	.	.	.	.	.	.	.	.	.	T	26.7	4.764980	0.90020	.	.	ENSG00000161800	ENST00000427314;ENST00000312377;ENST00000434422;ENST00000454520;ENST00000551016;ENST00000547905;ENST00000552310;ENST00000550149;ENST00000546786;ENST00000546595;ENST00000551145;ENST00000548824;ENST00000548644	T;T;T;T;T;T;T;T;T;T;T;T;T	0.79554	-1.28;-1.28;-1.28;-1.28;-1.28;-1.28;-1.28;-0.49;-0.49;-1.28;-1.28;-1.28;-1.28	6.11	6.11	0.99139	.	0.000000	0.85682	D	0.000000	D	0.88153	0.6360	M	0.78801	2.425	0.80722	D	1	D	0.71674	0.998	P	0.59761	0.863	D	0.87593	0.2492	10	0.39692	T	0.17	-10.0223	16.7021	0.85357	0.0:0.0:0.0:1.0	.	156	Q9H0H5	RGAP1_HUMAN	V	156;156;156;156;156;156;156;82;82;98;98;156;168	ENSP00000404190:I156V;ENSP00000309871:I156V;ENSP00000413241:I156V;ENSP00000404808:I156V;ENSP00000449374:I156V;ENSP00000449370:I156V;ENSP00000448697:I156V;ENSP00000446642:I82V;ENSP00000447429:I82V;ENSP00000449963:I98V;ENSP00000450064:I98V;ENSP00000449170:I156V;ENSP00000449620:I168V	ENSP00000309871:I156V	I	-	1	0	RACGAP1	48684314	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.698000	0.84413	2.343000	0.79666	0.533000	0.62120	ATC	RACGAP1	-	NULL	ENSG00000161800		0.368	RACGAP1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	RACGAP1	HGNC	protein_coding	OTTHUMT00000405997.1	-	0.00	28	0	T	NM_013277		50398047	-1	tier1	-	no_errors	ENST00000312377	ensembl	human	known	74_37	missense	35.48	20	11	SNP	1.000	C
RBAK	57786	genome.wustl.edu	37	7	5104863	5104863	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr7:5104863G>C	ENST00000353796.3	+	6	2100	c.1776G>C	c.(1774-1776)gaG>gaC	p.E592D	RBAK-RBAKDN_ENST00000407184.1_Intron|RBAK_ENST00000396912.1_Missense_Mutation_p.E592D|RBAK-RBAKDN_ENST00000396904.2_Intron	NM_001204456.1	NP_001191385.1	Q9NYW8	RBAK_HUMAN	RB-associated KRAB zinc finger	592	Interaction with AR.				negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			NS(1)|kidney(1)|large_intestine(2)|ovary(4)|skin(1)|upper_aerodigestive_tract(1)	10		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0916)|OV - Ovarian serous cystadenocarcinoma(56;2.44e-14)		ACACAGGCGAGAAACCCTATG	0.383																																																	0													45.0	48.0	47.0					7																	5104863		2203	4299	6502	SO:0001583	missense	0			AF226869	CCDS5337.1	7p22.1	2013-01-08			ENSG00000146587	ENSG00000146587		"""Zinc fingers, C2H2-type"", ""-"""	17680	protein-coding gene	gene with protein product		608191					Standard	NM_021163		Approved	ZNF769	uc003sns.1	Q9NYW8	OTTHUMG00000121155	ENST00000353796.3:c.1776G>C	7.37:g.5104863G>C	ENSP00000275423:p.Glu592Asp		A6NDF2|A8KAK4|B2RN44|B9EGS1|F8W6M7	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E592D	ENST00000353796.3	37	c.1776	CCDS5337.1	7	.	.	.	.	.	.	.	.	.	.	G	16.94	3.259720	0.59321	.	.	ENSG00000146587	ENST00000353796;ENST00000396912	T;T	0.26810	1.71;1.71	3.76	2.88	0.33553	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.50627	D	0.000113	T	0.33789	0.0875	L	0.33189	0.99	0.36780	D	0.884277	P	0.46656	0.882	D	0.66351	0.943	T	0.39683	-0.9602	8	.	.	.	.	9.2294	0.37428	0.1108:0.0:0.8892:0.0	.	592	Q9NYW8	RBAK_HUMAN	D	592	ENSP00000275423:E592D;ENSP00000380120:E592D	.	E	+	3	2	RBAK	5071389	1.000000	0.71417	0.999000	0.59377	0.974000	0.67602	4.128000	0.57951	1.155000	0.42497	0.555000	0.69702	GAG	RBAK	-	pfscan_Znf_C2H2	ENSG00000146587		0.383	RBAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBAK	HGNC	protein_coding	OTTHUMT00000241640.2	-	0.00	21	0	G	NM_021163		5104863	+1	tier1	-	no_errors	ENST00000353796	ensembl	human	known	74_37	missense	36.00	16	9	SNP	1.000	C
REV3L	5980	genome.wustl.edu	37	6	111694879	111694879	+	Missense_Mutation	SNP	T	T	C			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr6:111694879T>C	ENST00000358835.3	-	14	5133	c.4679A>G	c.(4678-4680)aAt>aGt	p.N1560S	REV3L_ENST00000435970.1_Missense_Mutation_p.N1482S|REV3L_ENST00000368802.3_Missense_Mutation_p.N1560S|REV3L_ENST00000368805.1_Missense_Mutation_p.N1560S			O60673	DPOLZ_HUMAN	REV3-like, polymerase (DNA directed), zeta, catalytic subunit	1560					DNA-dependent DNA replication (GO:0006261)|translesion synthesis (GO:0019985)	chromosome (GO:0005694)|nucleus (GO:0005634)|zeta DNA polymerase complex (GO:0016035)	4 iron, 4 sulfur cluster binding (GO:0051539)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)			NS(2)|breast(1)|endometrium(6)|kidney(7)|large_intestine(30)|lung(25)|ovary(3)|prostate(5)|skin(8)|upper_aerodigestive_tract(1)	88		all_cancers(87;7.57e-06)|Acute lymphoblastic leukemia(125;2.46e-08)|all_hematologic(75;1.08e-06)|all_epithelial(87;0.00138)|Colorectal(196;0.021)		OV - Ovarian serous cystadenocarcinoma(136;0.0314)|Epithelial(106;0.057)|all cancers(137;0.0663)		ACCAGAAATATTTTTATTTGG	0.363								DNA polymerases (catalytic subunits)																																									0													212.0	217.0	216.0					6																	111694879		2203	4300	6503	SO:0001583	missense	0			AF058701	CCDS5091.2, CCDS69177.1	6q22	2012-05-18	2012-05-18		ENSG00000009413	ENSG00000009413		"""DNA polymerases"""	9968	protein-coding gene	gene with protein product	"""polymerase, DNA, zeta"""	602776	"""REV3 (yeast homolog)-like, catalytic subunit of DNA polymerase zeta"", ""REV3-like, catalytic subunit of DNA polymerase zeta (yeast)"""			9618506, 9925914	Standard	NM_001286431		Approved	POLZ, REV3	uc003puy.4	O60673	OTTHUMG00000016318	ENST00000358835.3:c.4679A>G	6.37:g.111694879T>C	ENSP00000351697:p.Asn1560Ser		O43214|Q5TC33	Missense_Mutation	SNP	pfam_DNA-dir_DNA_pol_B_multi_dom,pfam_DNA-dir_DNA_pol_B_exonuc,superfamily_RNaseH-like_dom,smart_DNA-dir_DNA_pol_B,prints_DNA-dir_DNA_pol_B	p.N1560S	ENST00000358835.3	37	c.4679	CCDS5091.2	6	.	.	.	.	.	.	.	.	.	.	T	0.468	-0.886004	0.02511	.	.	ENSG00000009413	ENST00000368802;ENST00000368805;ENST00000358835;ENST00000435970	T;T;T;T	0.01406	5.02;5.02;5.02;4.93	6.04	2.28	0.28536	Ribonuclease H-like (1);	0.496781	0.21821	N	0.068606	T	0.00241	0.0007	N	0.08118	0	0.28464	N	0.915746	B	0.02656	0.0	B	0.04013	0.001	T	0.41610	-0.9499	10	0.16420	T	0.52	-0.8532	0.2818	0.00246	0.2373:0.1475:0.2458:0.3693	.	1560	O60673	DPOLZ_HUMAN	S	1560;1560;1560;1482	ENSP00000357792:N1560S;ENSP00000357795:N1560S;ENSP00000351697:N1560S;ENSP00000402003:N1482S	ENSP00000351697:N1560S	N	-	2	0	REV3L	111801572	0.485000	0.25972	0.989000	0.46669	0.651000	0.38670	0.378000	0.20569	0.487000	0.27698	0.460000	0.39030	AAT	REV3L	-	superfamily_RNaseH-like_dom	ENSG00000009413		0.363	REV3L-201	KNOWN	basic|appris_principal|CCDS	protein_coding	REV3L	HGNC	protein_coding	OTTHUMT00000043695.1	-	0.00	85	0	T	NM_002912		111694879	-1	tier1	-	no_errors	ENST00000358835	ensembl	human	known	74_37	missense	10.34	52	6	SNP	0.961	C
RGPD4	285190	genome.wustl.edu	37	2	108489085	108489085	+	Missense_Mutation	SNP	G	G	T	rs572730041	byFrequency	TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr2:108489085G>T	ENST00000408999.3	+	20	4702	c.4625G>T	c.(4624-4626)gGt>gTt	p.G1542V	RGPD4_ENST00000354986.4_Missense_Mutation_p.G1542V	NM_182588.2	NP_872394.2	Q7Z3J3	RGPD4_HUMAN	RANBP2-like and GRIP domain containing 4	1542					protein targeting to Golgi (GO:0000042)					breast(1)|endometrium(7)|kidney(4)|lung(23)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(3)	43						TTTGTATTTGGTTCAGAGTCT	0.373													N|||	34	0.00678914	0.0227	0.0029	5008	,	,		24830	0.002		0.0	False		,,,				2504	0.0																0													28.0	23.0	25.0					2																	108489085		691	1578	2269	SO:0001583	missense	0			BX537861	CCDS46381.1	2q12.3	2013-01-10			ENSG00000196862	ENSG00000196862		"""Tetratricopeptide (TTC) repeat domain containing"""	32417	protein-coding gene	gene with protein product		612707				15710750, 15815621	Standard	NM_182588		Approved	RGP4, DKFZp686P0288	uc010ywk.2	Q7Z3J3	OTTHUMG00000153208	ENST00000408999.3:c.4625G>T	2.37:g.108489085G>T	ENSP00000386810:p.Gly1542Val		B9A029	Missense_Mutation	SNP	pfam_Ran_bind_dom,pfam_GRIP,pfam_TPR_1,pfam_TPR_2,superfamily_GRIP,smart_TPR_repeat,smart_Ran_bind_dom,smart_GRIP,pfscan_GRIP,pfscan_TPR_repeat,pfscan_TPR-contain_dom,pfscan_Ran_bind_dom	p.G1542V	ENST00000408999.3	37	c.4625	CCDS46381.1	2	.	.	.	.	.	.	.	.	.	.	-	10.12	1.263996	0.23136	.	.	ENSG00000196862	ENST00000354986;ENST00000408999	T;T	0.45276	0.9;0.9	2.33	2.33	0.28932	.	.	.	.	.	T	0.56630	0.1998	M	0.66939	2.045	0.53688	D	0.999971	D	0.89917	1.0	D	0.71656	0.974	T	0.54344	-0.8308	9	0.27082	T	0.32	-14.3465	11.5771	0.50869	0.0:0.0:1.0:0.0	.	1542	Q7Z3J3	RGPD4_HUMAN	V	1542	ENSP00000347081:G1542V;ENSP00000386810:G1542V	ENSP00000347081:G1542V	G	+	2	0	RGPD4	107855517	1.000000	0.71417	0.998000	0.56505	0.166000	0.22503	9.139000	0.94554	1.303000	0.44873	0.162000	0.16502	GGT	RGPD4	-	NULL	ENSG00000196862		0.373	RGPD4-001	NOVEL	not_best_in_genome_evidence|basic|appris_candidate|CCDS	protein_coding	RGPD4	HGNC	protein_coding	OTTHUMT00000330096.2	-	0.00	30	0	G	XM_496581		108489085	+1	tier1	-	no_errors	ENST00000354986	ensembl	human	known	74_37	missense	22.86	27	8	SNP	1.000	T
RMND5B	64777	genome.wustl.edu	37	5	177565148	177565148	+	Nonsense_Mutation	SNP	G	G	T			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr5:177565148G>T	ENST00000515098.1	+	4	379	c.28G>T	c.(28-30)Gag>Tag	p.E10*	RMND5B_ENST00000313386.4_Nonsense_Mutation_p.E10*|RMND5B_ENST00000542098.1_Intron			Q96G75	RMD5B_HUMAN	required for meiotic nuclear division 5 homolog B (S. cerevisiae)	10										endometrium(3)|large_intestine(5)|lung(6)|ovary(1)|skin(2)	17	all_cancers(89;0.00294)|Renal(175;0.000269)|Lung NSC(126;0.00858)|all_lung(126;0.0139)	all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CGTGGAGAGAGAGCTGGACAA	0.667																																																	0													65.0	52.0	57.0					5																	177565148		2203	4299	6502	SO:0001587	stop_gained	0			BC009911	CCDS4431.1, CCDS75382.1	5q35.3	2012-07-20			ENSG00000145916	ENSG00000145916			26181	protein-coding gene	gene with protein product	"""GID complex subunit 2 homolog B"""					12975309	Standard	NM_022762		Approved	FLJ22318, GID2, GID2B	uc003mim.3	Q96G75	OTTHUMG00000130897	ENST00000515098.1:c.28G>T	5.37:g.177565148G>T	ENSP00000420875:p.Glu10*		Q1HE27|Q6UVY7|Q9H6F6	Nonsense_Mutation	SNP	smart_LisH_dimerisation,smart_CTLH_C,smart_CRA_dom,pfscan_LisH_dimerisation,pfscan_CTLH_C	p.E10*	ENST00000515098.1	37	c.28	CCDS4431.1	5	.	.	.	.	.	.	.	.	.	.	G	41	8.738890	0.98935	.	.	ENSG00000145916	ENST00000313386;ENST00000515098;ENST00000502814;ENST00000507457;ENST00000508647	.	.	.	5.15	4.27	0.50696	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-20.284	13.3758	0.60739	0.0:0.1597:0.8403:0.0	.	.	.	.	X	10	.	ENSP00000320623:E10X	E	+	1	0	RMND5B	177497754	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	7.071000	0.76770	1.116000	0.41820	0.563000	0.77884	GAG	RMND5B	-	NULL	ENSG00000145916		0.667	RMND5B-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	RMND5B	HGNC	protein_coding	OTTHUMT00000373542.1	-	0.00	36	0	G	NM_022762		177565148	+1	tier1	-	no_errors	ENST00000313386	ensembl	human	known	74_37	nonsense	51.72	14	15	SNP	1.000	T
RPLP0P2	113157	genome.wustl.edu	37	11	61404336	61404336	+	RNA	SNP	G	G	A	rs17626916	byFrequency	TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr11:61404336G>A	ENST00000496593.1	+	0	940					NR_002775.2				ribosomal protein, large, P0 pseudogene 2																		GCCATGACGCGCAAGGCCATC	0.587													G|||	697	0.139177	0.0439	0.2017	5008	,	,		21300	0.0208		0.2913	False		,,,				2504	0.1892																0																																												0			BC010523		11q12.2	2014-08-07			ENSG00000243742	ENSG00000243742		"""L ribosomal proteins"""	17960	pseudogene	pseudogene						19123937, 25089627	Standard	NR_002775		Approved		uc001nrz.1		OTTHUMG00000158396		11.37:g.61404336G>A				RNA	SNP	-	NULL	ENST00000496593.1	37	NULL		11																																																																																			RPLP0P2	-	-	ENSG00000243742		0.587	RPLP0P2-002	KNOWN	basic	processed_transcript	RPLP0P2	HGNC	pseudogene	OTTHUMT00000350911.1		0.00	45	0	G	NR_002775		61404336	+1			no_errors	ENST00000496593	ensembl	human	known	74_37	rna	9.38	29	3	SNP	1.000	A
RNF169	254225	genome.wustl.edu	37	11	74546844	74546844	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr11:74546844G>A	ENST00000299563.4	+	6	1209	c.1196G>A	c.(1195-1197)gGc>gAc	p.G399D		NM_001098638.1	NP_001092108.1	Q8NCN4	RN169_HUMAN	ring finger protein 169	399					cellular response to DNA damage stimulus (GO:0006974)|negative regulation of double-strand break repair (GO:2000780)|protein ubiquitination (GO:0016567)	intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|site of double-strand break (GO:0035861)	K63-linked polyubiquitin binding (GO:0070530)|ligase activity (GO:0016874)|nucleosome binding (GO:0031491)|zinc ion binding (GO:0008270)			breast(3)|endometrium(1)|kidney(1)|large_intestine(5)|lung(3)|ovary(1)|urinary_tract(1)	15						CTCCCTGATGGCCGTGTGCTA	0.498																																																	0													157.0	162.0	160.0					11																	74546844		2011	4188	6199	SO:0001583	missense	0			AB082522	CCDS41691.1	11q13.4	2008-02-05			ENSG00000166439	ENSG00000166439		"""RING-type (C3HC4) zinc fingers"""	26961	protein-coding gene	gene with protein product						12056414	Standard	NM_001098638		Approved	KIAA1991	uc001ovl.4	Q8NCN4	OTTHUMG00000165516	ENST00000299563.4:c.1196G>A	11.37:g.74546844G>A	ENSP00000299563:p.Gly399Asp		Q6N015	Missense_Mutation	SNP	smart_Znf_RING,pfscan_Znf_RING	p.G399D	ENST00000299563.4	37	c.1196	CCDS41691.1	11	.	.	.	.	.	.	.	.	.	.	G	25.2	4.615178	0.87359	.	.	ENSG00000166439	ENST00000299563	D	0.85411	-1.98	5.99	5.99	0.97316	.	0.000000	0.85682	D	0.000000	D	0.92586	0.7645	M	0.79475	2.455	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.92766	0.6228	10	0.87932	D	0	-37.6931	17.9695	0.89108	0.0:0.0:1.0:0.0	.	399	Q8NCN4	RN169_HUMAN	D	399	ENSP00000299563:G399D	ENSP00000299563:G399D	G	+	2	0	RNF169	74224492	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.230000	0.95299	2.847000	0.97988	0.655000	0.94253	GGC	RNF169	-	NULL	ENSG00000166439		0.498	RNF169-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF169	HGNC	protein_coding	OTTHUMT00000384741.1	-	0.00	41	0	G	XM_495886		74546844	+1	tier1	-	no_errors	ENST00000299563	ensembl	human	known	74_37	missense	20.31	51	13	SNP	1.000	A
RPP38	10557	genome.wustl.edu	37	10	15145535	15145535	+	Missense_Mutation	SNP	A	A	T			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr10:15145535A>T	ENST00000378197.4	+	3	736	c.222A>T	c.(220-222)aaA>aaT	p.K74N	RPP38_ENST00000378202.5_Missense_Mutation_p.K74N|RPP38_ENST00000451677.1_Intron|NMT2_ENST00000466201.1_5'UTR	NM_183005.4	NP_892117.1	P78345	RPP38_HUMAN	ribonuclease P/MRP 38kDa subunit	74					RNA phosphodiester bond hydrolysis (GO:0090501)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|tRNA processing (GO:0008033)	nucleolar ribonuclease P complex (GO:0005655)|nucleus (GO:0005634)	ribonuclease P activity (GO:0004526)			breast(1)|endometrium(3)|large_intestine(1)|lung(2)|ovary(1)	8						TTCTGAAAAAAGAAAGCAGAG	0.413																																					GBM(118;1591 1611 9649 34378 50720)												0													50.0	52.0	52.0					10																	15145535		2203	4300	6503	SO:0001583	missense	0			U77664	CCDS7108.1	10p13	2012-05-21			ENSG00000152464	ENSG00000152464			30329	protein-coding gene	gene with protein product		606116				9037013, 9630247	Standard	NM_183005		Approved		uc001inx.5	P78345	OTTHUMG00000017728	ENST00000378197.4:c.222A>T	10.37:g.15145535A>T	ENSP00000367439:p.Lys74Asn		B3KPY0|D3DRT8|Q53F71|Q8NHS8	Missense_Mutation	SNP	pfam_Ribosomal_L7Ae/L30e/S12e/Gad45	p.K74N	ENST00000378197.4	37	c.222	CCDS7108.1	10	.	.	.	.	.	.	.	.	.	.	A	8.165	0.790320	0.16258	.	.	ENSG00000152464	ENST00000378203;ENST00000378201;ENST00000378202;ENST00000378197;ENST00000441850	T;T;T;T	0.26067	2.73;2.73;2.73;1.76	4.82	-5.54	0.02544	.	0.396184	0.26991	N	0.021476	T	0.14830	0.0358	L	0.50919	1.6	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.10314	-1.0635	10	0.49607	T	0.09	-4.5707	2.3662	0.04319	0.517:0.2081:0.1722:0.1027	.	74	P78345	RPP38_HUMAN	N	74	ENSP00000367445:K74N;ENSP00000367444:K74N;ENSP00000367439:K74N;ENSP00000402635:K74N	ENSP00000367439:K74N	K	+	3	2	RPP38	15185541	0.071000	0.21146	0.000000	0.03702	0.002000	0.02628	0.164000	0.16542	-0.881000	0.03992	0.528000	0.53228	AAA	RPP38	-	NULL	ENSG00000152464		0.413	RPP38-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	RPP38	HGNC	protein_coding	OTTHUMT00000046976.1		0.00	11	0	A	NM_006414		15145535	+1			no_errors	ENST00000378197	ensembl	human	known	74_37	missense	15.79	16	3	SNP	0.000	T
RUNDC1	146923	genome.wustl.edu	37	17	41143344	41143344	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr17:41143344G>T	ENST00000361677.1	+	5	1465	c.1453G>T	c.(1453-1455)Ggc>Tgc	p.G485C		NM_173079.2	NP_775102	Q96C34	RUND1_HUMAN	RUN domain containing 1	485	RUN. {ECO:0000255|PROSITE- ProRule:PRU00178}.									breast(1)|large_intestine(2)|lung(4)|prostate(1)	8		Breast(137;0.00499)		BRCA - Breast invasive adenocarcinoma(366;0.161)		TGCTAAGAACGGCCGTGCTTA	0.567																																																	0													72.0	72.0	72.0					17																	41143344		2203	4300	6503	SO:0001583	missense	0			AL831813	CCDS11448.1	17q21.31	2004-02-27				ENSG00000198863			25418	protein-coding gene	gene with protein product						12477932	Standard	NM_173079		Approved	DKFZp761H0421	uc002ici.1	Q96C34		ENST00000361677.1:c.1453G>T	17.37:g.41143344G>T	ENSP00000354622:p.Gly485Cys		Q6Y2K8|Q8IXT9|Q8N3W1	Missense_Mutation	SNP	pfam_Run,smart_Run,pfscan_Run	p.G485C	ENST00000361677.1	37	c.1453	CCDS11448.1	17	.	.	.	.	.	.	.	.	.	.	G	26.4	4.729931	0.89390	.	.	ENSG00000198863	ENST00000361677	T	0.32515	1.45	5.02	5.02	0.67125	RUN (2);	0.000000	0.85682	D	0.000000	T	0.61085	0.2319	M	0.83953	2.67	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.67043	-0.5770	10	0.87932	D	0	-28.4733	18.5295	0.90986	0.0:0.0:1.0:0.0	.	485	Q96C34	RUND1_HUMAN	C	485	ENSP00000354622:G485C	ENSP00000354622:G485C	G	+	1	0	RUNDC1	38396870	1.000000	0.71417	0.999000	0.59377	0.995000	0.86356	9.652000	0.98499	2.598000	0.87819	0.655000	0.94253	GGC	RUNDC1	-	pfam_Run,pfscan_Run	ENSG00000198863		0.567	RUNDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RUNDC1	HGNC	protein_coding	OTTHUMT00000452464.1		0.00	33	0	G	NM_173079		41143344	+1			no_errors	ENST00000361677	ensembl	human	known	74_37	missense	8.57	32	3	SNP	1.000	T
SACS	26278	genome.wustl.edu	37	13	23912397	23912397	+	Missense_Mutation	SNP	T	T	C			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr13:23912397T>C	ENST00000382292.3	-	9	5891	c.5618A>G	c.(5617-5619)tAt>tGt	p.Y1873C	SACS_ENST00000402364.1_Missense_Mutation_p.Y1123C|SACS_ENST00000382298.3_Missense_Mutation_p.Y1873C			Q9NZJ4	SACS_HUMAN	sacsin molecular chaperone	1873					cell death (GO:0008219)|negative regulation of inclusion body assembly (GO:0090084)|protein folding (GO:0006457)	axon (GO:0030424)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chaperone binding (GO:0051087)|Hsp70 protein binding (GO:0030544)|proteasome binding (GO:0070628)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(54)|lung(49)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(11)	189		all_cancers(29;1.51e-22)|all_epithelial(30;7.82e-19)|all_lung(29;4.71e-18)|Lung SC(185;0.0225)|Breast(139;0.128)		all cancers(112;0.00197)|Epithelial(112;0.00854)|OV - Ovarian serous cystadenocarcinoma(117;0.0298)|Lung(94;0.189)		TAAAGGTAAATAGCAAAACAC	0.423																																																	0													114.0	113.0	114.0					13																	23912397		2203	4300	6503	SO:0001583	missense	0			AF193556	CCDS9300.2	13q11	2014-06-13	2014-01-30		ENSG00000151835	ENSG00000151835		"""Heat shock proteins / DNAJ (HSP40)"""	10519	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 138"""	604490	"""spastic ataxia of Charlevoix-Saguenay (sacsin)"""			10610707, 15057823, 21726565	Standard	NM_001278055		Approved	ARSACS, KIAA0730, DKFZp686B15167, DNAJC29, SPAX6, PPP1R138	uc001uon.3	Q9NZJ4	OTTHUMG00000016562	ENST00000382292.3:c.5618A>G	13.37:g.23912397T>C	ENSP00000371729:p.Tyr1873Cys		O94835|Q5T9J5|Q5T9J7|Q5T9J8|Q68DF5|Q6MZR4|Q8NBF9	Missense_Mutation	SNP	pfam_HEPN,pfam_Ubiquitin_dom,superfamily_HATPase_ATP-bd,superfamily_DnaJ_domain,smart_HEPN,pfscan_HEPN,pfscan_DnaJ_domain,pfscan_Ubiquitin_supergroup	p.Y1873C	ENST00000382292.3	37	c.5618	CCDS9300.2	13	.	.	.	.	.	.	.	.	.	.	T	25.4	4.634656	0.87660	.	.	ENSG00000151835	ENST00000382292;ENST00000402364;ENST00000382298	D;D;D	0.87571	-2.16;-2.27;-2.16	5.75	5.75	0.90469	.	0.000000	0.85682	D	0.000000	D	0.91971	0.7457	M	0.63428	1.95	0.58432	D	0.999991	D	0.76494	0.999	D	0.66847	0.947	D	0.92411	0.5937	10	0.59425	D	0.04	.	16.0591	0.80826	0.0:0.0:0.0:1.0	.	1873	Q9NZJ4	SACS_HUMAN	C	1873;1123;1873	ENSP00000371729:Y1873C;ENSP00000385844:Y1123C;ENSP00000371735:Y1873C	ENSP00000371729:Y1873C	Y	-	2	0	SACS	22810397	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	7.698000	0.84413	2.190000	0.69967	0.482000	0.46254	TAT	SACS	-	NULL	ENSG00000151835		0.423	SACS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SACS	HGNC	protein_coding	OTTHUMT00000044148.3	-	0.00	20	0	T	NM_014363		23912397	-1	tier1	-	no_errors	ENST00000382292	ensembl	human	known	74_37	missense	72.22	5	13	SNP	1.000	C
SCLT1	132320	genome.wustl.edu	37	4	129858002	129858002	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr4:129858002C>A	ENST00000281142.5	-	18	2140	c.1637G>T	c.(1636-1638)aGt>aTt	p.S546I	SCLT1_ENST00000503215.1_Intron|SCLT1_ENST00000434680.1_Intron|SCLT1_ENST00000439369.2_Intron|SCLT1_ENST00000502495.1_5'UTR	NM_144643.2	NP_653244.2	Q96NL6	SCLT1_HUMAN	sodium channel and clathrin linker 1	546					cilium assembly (GO:0042384)|clustering of voltage-gated sodium channels (GO:0045162)	centriole (GO:0005814)|centrosome (GO:0005813)|ciliary transition fiber (GO:0097539)|clathrin complex (GO:0071439)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule cytoskeleton (GO:0015630)	sodium channel regulator activity (GO:0017080)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(10)|ovary(3)|prostate(1)|skin(1)|stomach(1)	29						TTCCATTGTACTGATCTAAAG	0.299																																																	0													61.0	55.0	57.0					4																	129858002		2202	4297	6499	SO:0001583	missense	0			AK055217	CCDS3740.1	4q28.2	2008-05-02			ENSG00000151466	ENSG00000151466			26406	protein-coding gene	gene with protein product		611399				15797711	Standard	XM_005262732		Approved	hCAP-1A, FLJ30655	uc003igp.2	Q96NL6	OTTHUMG00000133346	ENST00000281142.5:c.1637G>T	4.37:g.129858002C>A	ENSP00000281142:p.Ser546Ile		A4QN04|Q0VAH2|Q6P2M4	Missense_Mutation	SNP	NULL	p.S546I	ENST00000281142.5	37	c.1637	CCDS3740.1	4	.	.	.	.	.	.	.	.	.	.	C	16.92	3.256637	0.59321	.	.	ENSG00000151466	ENST00000281142	T	0.51574	0.7	4.57	4.57	0.56435	.	0.216498	0.47852	D	0.000207	T	0.58192	0.2105	L	0.34521	1.04	0.80722	D	1	D	0.76494	0.999	D	0.83275	0.996	T	0.56378	-0.7989	9	.	.	.	-10.5392	17.3543	0.87331	0.0:1.0:0.0:0.0	.	546	Q96NL6	SCLT1_HUMAN	I	546	ENSP00000281142:S546I	.	S	-	2	0	SCLT1	130077452	1.000000	0.71417	1.000000	0.80357	0.813000	0.45954	3.614000	0.54160	2.261000	0.74972	0.591000	0.81541	AGT	SCLT1	-	NULL	ENSG00000151466		0.299	SCLT1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SCLT1	HGNC	protein_coding	OTTHUMT00000257176.2		0.00	39	0	C	NM_144643		129858002	-1			no_errors	ENST00000281142	ensembl	human	known	74_37	missense	13.04	20	3	SNP	1.000	A
SEMA3F	6405	genome.wustl.edu	37	3	50222050	50222050	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr3:50222050C>A	ENST00000002829.3	+	13	1743	c.1259C>A	c.(1258-1260)tCt>tAt	p.S420Y	SEMA3F_ENST00000434342.1_Missense_Mutation_p.S389Y|SEMA3F_ENST00000413852.1_Missense_Mutation_p.S321Y	NM_004186.3	NP_004177.3	Q13275	SEM3F_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3F	420	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|branchiomotor neuron axon guidance (GO:0021785)|facial nerve structural organization (GO:0021612)|negative regulation of axon extension involved in axon guidance (GO:0048843)|nerve development (GO:0021675)|neural crest cell migration (GO:0001755)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|semaphorin-plexin signaling pathway involved in neuron projection guidance (GO:1902285)|sympathetic ganglion development (GO:0061549)|sympathetic neuron projection extension (GO:0097490)|sympathetic neuron projection guidance (GO:0097491)|trigeminal nerve structural organization (GO:0021637)	extracellular space (GO:0005615)|membrane (GO:0016020)	chemorepellent activity (GO:0045499)|receptor activity (GO:0004872)			central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(1)|skin(2)	17				BRCA - Breast invasive adenocarcinoma(193;0.00013)|KIRC - Kidney renal clear cell carcinoma(197;0.00599)|Kidney(197;0.00688)		TTCACGCCATCTATGAAGTCC	0.602																																																	0													82.0	71.0	75.0					3																	50222050		2203	4300	6503	SO:0001583	missense	0			U33920	CCDS2811.1	3p21.3	2013-01-11			ENSG00000001617	ENSG00000001617		"""Semaphorins"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10728	protein-coding gene	gene with protein product	"""sema IV"""	601124				8786119, 8649831	Standard	NM_004186		Approved	SEMAK, Sema4	uc003cyj.3	Q13275	OTTHUMG00000156806	ENST00000002829.3:c.1259C>A	3.37:g.50222050C>A	ENSP00000002829:p.Ser420Tyr		C9JQ85|Q13274|Q13372|Q15704|Q6GTR4	Missense_Mutation	SNP	pfam_Semap_dom,superfamily_Semap_dom,superfamily_Plexin-like_fold,smart_Semap_dom,smart_Plexin-like_fold,smart_Ig_sub,smart_Ig_sub2,pfscan_Semap_dom,pfscan_Ig-like_dom	p.S420Y	ENST00000002829.3	37	c.1259	CCDS2811.1	3	.	.	.	.	.	.	.	.	.	.	C	11.19	1.566963	0.28003	.	.	ENSG00000001617	ENST00000413852;ENST00000002829;ENST00000434342	T;T;T	0.22945	1.93;1.93;1.93	5.48	5.48	0.80851	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.094876	0.64402	D	0.000001	T	0.42944	0.1225	L	0.53249	1.67	0.39997	D	0.975113	P;D	0.58970	0.91;0.984	P;D	0.63381	0.752;0.914	T	0.19778	-1.0295	10	0.46703	T	0.11	.	13.6395	0.62241	0.0:0.9236:0.0:0.0764	.	389;420	C9JQ85;Q13275	.;SEM3F_HUMAN	Y	321;420;389	ENSP00000388931:S321Y;ENSP00000002829:S420Y;ENSP00000409859:S389Y	ENSP00000002829:S420Y	S	+	2	0	SEMA3F	50197054	0.968000	0.33430	0.990000	0.47175	0.490000	0.33462	1.766000	0.38491	2.584000	0.87258	0.561000	0.74099	TCT	SEMA3F	-	pfam_Semap_dom,superfamily_Semap_dom,smart_Semap_dom,pfscan_Semap_dom	ENSG00000001617		0.602	SEMA3F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEMA3F	HGNC	protein_coding	OTTHUMT00000345929.1	-	0.00	55	0	C	NM_004186		50222050	+1	tier1	-	no_errors	ENST00000002829	ensembl	human	known	74_37	missense	88.00	3	22	SNP	0.998	A
SEMA6C	10500	genome.wustl.edu	37	1	151105028	151105028	+	Silent	SNP	G	G	A			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr1:151105028G>A	ENST00000341697.3	-	19	4416	c.2725C>T	c.(2725-2727)Ctg>Ttg	p.L909L	SEMA6C_ENST00000479820.1_Intron|RP11-68I18.10_ENST00000563624.1_RNA			Q9H3T2	SEM6C_HUMAN	sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6C	909					axon guidance (GO:0007411)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(5)|lung(15)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	28	Lung SC(34;0.00471)|Ovarian(49;0.0147)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)			GGAGGCTTCAGGGACAACTGG	0.711																																																	0													4.0	7.0	6.0					1																	151105028		1945	3879	5824	SO:0001819	synonymous_variant	0			AF339154	CCDS984.1, CCDS53363.1, CCDS53364.1	1q21.2	2008-02-05			ENSG00000143434	ENSG00000143434		"""Semaphorins"""	10740	protein-coding gene	gene with protein product	"""m-Sema Y2"""	609294				12110693	Standard	NM_030913		Approved	KIAA1869	uc001ewv.3	Q9H3T2	OTTHUMG00000012261	ENST00000341697.3:c.2725C>T	1.37:g.151105028G>A			D3DV15|Q5JR71|Q5JR72|Q5JR73|Q8WXT8|Q8WXT9|Q8WXU0|Q96JF8	Silent	SNP	pfam_Semap_dom,pfam_Plexin_repeat,superfamily_Semap_dom,superfamily_Plexin-like_fold,smart_Semap_dom,pfscan_Semap_dom	p.L941	ENST00000341697.3	37	c.2821	CCDS984.1	1	.	.	.	.	.	.	.	.	.	.	G	2.216	-0.379521	0.05000	.	.	ENSG00000143434	ENST00000392792	.	.	.	3.73	2.8	0.32819	.	.	.	.	.	T	0.44871	0.1314	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.37865	-0.9687	4	.	.	.	.	8.9436	0.35745	0.0:0.2286:0.7714:0.0	.	.	.	.	L	420	.	.	P	-	2	0	SEMA6C	149371652	1.000000	0.71417	0.127000	0.21898	0.432000	0.31715	1.794000	0.38774	0.739000	0.32628	-0.519000	0.04390	CCT	SEMA6C	-	NULL	ENSG00000143434		0.711	SEMA6C-004	KNOWN	alternative_5_UTR|mRNA_start_NF|basic|CCDS	protein_coding	SEMA6C	HGNC	protein_coding	OTTHUMT00000034074.1	-	0.00	63	0	G	NM_030913		151105028	-1	tier1	-	no_errors	ENST00000368913	ensembl	human	known	74_37	silent	47.62	33	30	SNP	0.997	A
SLC14A1	6563	genome.wustl.edu	37	18	43310429	43310429	+	Silent	SNP	G	G	A			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr18:43310429G>A	ENST00000321925.4	+	3	376	c.144G>A	c.(142-144)caG>caA	p.Q48Q	RP11-116O18.3_ENST00000589510.1_RNA|SLC14A1_ENST00000535474.1_Intron|SLC14A1_ENST00000436407.3_Silent_p.Q104Q|SLC14A1_ENST00000591943.1_3'UTR|SLC14A1_ENST00000589700.1_Silent_p.Q48Q|SLC14A1_ENST00000502059.2_Intron|SLC14A1_ENST00000402943.2_Intron|SLC14A1_ENST00000586142.1_Silent_p.Q48Q|RP11-116O18.3_ENST00000586213.1_RNA|SLC14A1_ENST00000415427.3_Silent_p.Q104Q	NM_001128588.3|NM_001146036.2|NM_015865.6	NP_001122060.3|NP_001139508.2|NP_056949.4	Q13336	UT1_HUMAN	solute carrier family 14 (urea transporter), member 1 (Kidd blood group)	48					transmembrane transport (GO:0055085)|urea transmembrane transport (GO:0071918)|urea transport (GO:0015840)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	urea channel activity (GO:0015265)|urea transmembrane transporter activity (GO:0015204)|water transmembrane transporter activity (GO:0005372)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(11)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	21						TTGCCAACCAGCTTAAAGGTA	0.438																																																	0													94.0	89.0	90.0					18																	43310429		2203	4300	6503	SO:0001819	synonymous_variant	0			BC040128	CCDS11925.1, CCDS45860.1	18q11-q12	2014-07-19	2014-01-02		ENSG00000141469	ENSG00000141469		"""Blood group antigens"", ""Solute carriers"""	10918	protein-coding gene	gene with protein product		613868	"""Kidd blood group"", ""solute carrier family 14 (urea transporter), member 1"""	JK		7797558	Standard	NM_001146037		Approved	HsT1341, RACH1, RACH2	uc010dnk.3	Q13336	OTTHUMG00000132617	ENST00000321925.4:c.144G>A	18.37:g.43310429G>A			A8K0P3|B3KR62|B3KVX3|C9EHF2|Q86VM5	Silent	SNP	pfam_Urea_transporter	p.Q104	ENST00000321925.4	37	c.312	CCDS11925.1	18																																																																																			SLC14A1	-	NULL	ENSG00000141469		0.438	SLC14A1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	SLC14A1	HGNC	protein_coding	OTTHUMT00000255860.2	-	0.00	21	0	G	NM_015865		43310429	+1	tier1	-	no_errors	ENST00000415427	ensembl	human	known	74_37	silent	29.41	12	5	SNP	1.000	A
SLC38A7	55238	genome.wustl.edu	37	16	58701331	58701331	+	Silent	SNP	G	G	A			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr16:58701331G>A	ENST00000570101.1	-	11	2230	c.1347C>T	c.(1345-1347)ggC>ggT	p.G449G	SLC38A7_ENST00000566953.1_5'UTR|SLC38A7_ENST00000564100.1_Missense_Mutation_p.A315V|SLC38A7_ENST00000564010.1_Silent_p.G360G|SLC38A7_ENST00000219320.4_Silent_p.G449G			Q9NVC3	S38A7_HUMAN	solute carrier family 38, member 7	449					sodium ion transport (GO:0006814)	axon (GO:0030424)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)	L-alanine transmembrane transporter activity (GO:0015180)|L-amino acid transmembrane transporter activity (GO:0015179)|L-asparagine transmembrane transporter activity (GO:0015182)|L-aspartate transmembrane transporter activity (GO:0015183)|L-glutamate transmembrane transporter activity (GO:0005313)|L-glutamine transmembrane transporter activity (GO:0015186)|L-histidine transmembrane transporter activity (GO:0005290)|L-leucine transmembrane transporter activity (GO:0015190)|L-methionine transmembrane transporter activity (GO:0015191)|L-serine transmembrane transporter activity (GO:0015194)			endometrium(1)|large_intestine(2)|lung(6)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	13						CTGTGGTCTGGCCGAAGATGA	0.562																																																	0													160.0	135.0	144.0					16																	58701331		2198	4300	6498	SO:0001819	synonymous_variant	0			BC001961	CCDS10800.1	16q21	2013-05-22			ENSG00000103042	ENSG00000103042		"""Solute carriers"""	25582	protein-coding gene	gene with protein product		614236					Standard	XM_006721229		Approved	FLJ10815	uc002eod.1	Q9NVC3	OTTHUMG00000133491	ENST00000570101.1:c.1347C>T	16.37:g.58701331G>A			Q53GJ9|Q9H9I5	Missense_Mutation	SNP	pfam_AA_transpt_TM,pfam_Tryptophan/tyrosine_permease	p.A315V	ENST00000570101.1	37	c.944	CCDS10800.1	16																																																																																			SLC38A7	-	NULL	ENSG00000103042		0.562	SLC38A7-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SLC38A7	HGNC	protein_coding	OTTHUMT00000422206.2	-	0.00	26	0	G	NM_018231		58701331	-1	tier1	-	no_errors	ENST00000564100	ensembl	human	putative	74_37	missense	21.43	22	6	SNP	1.000	A
SLC6A18	348932	genome.wustl.edu	37	5	1238137	1238137	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr5:1238137G>C	ENST00000324642.3	+	5	817	c.694G>C	c.(694-696)Ggg>Cgg	p.G232R	SLC6A18_ENST00000296821.4_Missense_Mutation_p.G232R	NM_182632.2	NP_872438.2	Q96N87	S6A18_HUMAN	solute carrier family 6 (neutral amino acid transporter), member 18	232					amino acid transmembrane transport (GO:0003333)|amino acid transport (GO:0006865)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)	brush border membrane (GO:0031526)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	neurotransmitter:sodium symporter activity (GO:0005328)			endometrium(1)|kidney(2)|large_intestine(3)|lung(16)|ovary(1)|prostate(1)|skin(5)|stomach(4)|upper_aerodigestive_tract(1)	34	all_cancers(3;2.99e-16)|Lung NSC(6;8.55e-15)|all_lung(6;7.2e-14)|all_epithelial(6;1.76e-10)		Epithelial(17;0.000356)|all cancers(22;0.00124)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|Lung(60;0.185)			GACCCTGCCAGGGGCAACAAA	0.502																																																	0													141.0	127.0	132.0					5																	1238137		2203	4300	6503	SO:0001583	missense	0			AK055798	CCDS3860.1	5p15	2013-07-19	2013-07-19		ENSG00000164363	ENSG00000164363		"""Solute carriers"""	26441	protein-coding gene	gene with protein product		610300	"""solute carrier family 6 (neurotransmitter transporter), member 18"", ""solute carrier family 6, member 18"""			19478081	Standard	NM_182632		Approved	FLJ31236, Xtrp2	uc003jby.2	Q96N87	OTTHUMG00000090356	ENST00000324642.3:c.694G>C	5.37:g.1238137G>C	ENSP00000323549:p.Gly232Arg			Missense_Mutation	SNP	pfam_Na/ntran_symport,pfscan_Na/ntran_symport,prints_Na/ntran_symport,prints_Na/ntran_symport_orphan	p.G232R	ENST00000324642.3	37	c.694	CCDS3860.1	5	.	.	.	.	.	.	.	.	.	.	G	16.36	3.100520	0.56183	.	.	ENSG00000164363	ENST00000324642;ENST00000296821	D;D	0.87729	-2.29;-2.29	4.48	4.48	0.54585	.	0.000000	0.64402	D	0.000001	D	0.96204	0.8762	H	0.98466	4.24	0.58432	D	0.999999	D	0.89917	1.0	D	0.87578	0.998	D	0.98111	1.0420	10	0.87932	D	0	.	16.2544	0.82505	0.0:0.0:1.0:0.0	.	232	Q96N87	S6A18_HUMAN	R	232	ENSP00000323549:G232R;ENSP00000296821:G232R	ENSP00000296821:G232R	G	+	1	0	SLC6A18	1291137	1.000000	0.71417	0.832000	0.32986	0.011000	0.07611	7.248000	0.78268	2.183000	0.69458	0.561000	0.74099	GGG	SLC6A18	-	pfam_Na/ntran_symport,pfscan_Na/ntran_symport	ENSG00000164363		0.502	SLC6A18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC6A18	HGNC	protein_coding	OTTHUMT00000206728.3	-	0.00	33	0	G	NM_182632		1238137	+1	tier1	-	no_errors	ENST00000324642	ensembl	human	known	74_37	missense	62.96	20	34	SNP	1.000	C
SMCHD1	23347	genome.wustl.edu	37	18	2688439	2688439	+	Missense_Mutation	SNP	A	A	G	rs371805529		TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr18:2688439A>G	ENST00000320876.6	+	6	1024	c.686A>G	c.(685-687)aAt>aGt	p.N229S	SMCHD1_ENST00000261598.8_Missense_Mutation_p.N229S|RP11-703M24.5_ENST00000583546.1_RNA	NM_015295.2	NP_056110.2	A6NHR9	SMHD1_HUMAN	structural maintenance of chromosomes flexible hinge domain containing 1	229					chromosome organization (GO:0051276)|inactivation of X chromosome by DNA methylation (GO:0060821)	Barr body (GO:0001740)	ATP binding (GO:0005524)			NS(3)|breast(3)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(16)|lung(15)|pancreas(1)	45						CGCAGTTTAAATAGTGATATT	0.348																																																	0								A	SER/ASN	1,3763		0,1,1881	106.0	102.0	103.0		686	5.1	1.0	18		103	0,8206		0,0,4103	no	missense	SMCHD1	NM_015295.2	46	0,1,5984	GG,GA,AA		0.0,0.0266,0.0084	probably-damaging	229/2006	2688439	1,11969	1882	4103	5985	SO:0001583	missense	0			AB014550	CCDS45822.1	18p11.32	2010-05-12			ENSG00000101596	ENSG00000101596			29090	protein-coding gene	gene with protein product		614982				9734811	Standard	NM_015295		Approved	KIAA0650	uc002klm.4	A6NHR9		ENST00000320876.6:c.686A>G	18.37:g.2688439A>G	ENSP00000326603:p.Asn229Ser		O75141|Q6AHX6|Q6ZTQ8|Q9H6Q2|Q9UG39	Missense_Mutation	SNP	pfam_SMC_hinge,superfamily_SMC_hinge,superfamily_HATPase_ATP-bd,smart_SMC_hinge	p.N229S	ENST00000320876.6	37	c.686	CCDS45822.1	18	.	.	.	.	.	.	.	.	.	.	A	20.4	3.988375	0.74589	2.66E-4	0.0	ENSG00000101596	ENST00000320876;ENST00000261598	T;T	0.25912	1.77;1.78	5.08	5.08	0.68730	ATPase-like, ATP-binding domain (2);	0.058123	0.64402	D	0.000002	T	0.36608	0.0973	N	0.20401	0.57	0.38392	D	0.94542	D	0.76494	0.999	D	0.83275	0.996	T	0.41840	-0.9486	10	0.66056	D	0.02	.	15.1383	0.72586	1.0:0.0:0.0:0.0	.	229	A6NHR9	SMHD1_HUMAN	S	229	ENSP00000326603:N229S;ENSP00000261598:N229S	ENSP00000261598:N229S	N	+	2	0	SMCHD1	2678439	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.446000	0.90329	2.024000	0.59613	0.533000	0.62120	AAT	SMCHD1	-	superfamily_HATPase_ATP-bd	ENSG00000101596		0.348	SMCHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMCHD1	HGNC	protein_coding	OTTHUMT00000441082.2	-	0.00	56	0	A			2688439	+1	tier1	-	no_errors	ENST00000320876	ensembl	human	known	74_37	missense	51.11	22	23	SNP	1.000	G
SMG7	9887	genome.wustl.edu	37	1	183506344	183506344	+	Missense_Mutation	SNP	A	A	G			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr1:183506344A>G	ENST00000347615.2	+	11	1347	c.1228A>G	c.(1228-1230)Att>Gtt	p.I410V	SMG7_ENST00000508461.1_Missense_Mutation_p.I368V|SMG7_ENST00000515829.2_Missense_Mutation_p.I410V|SMG7_ENST00000507469.1_Missense_Mutation_p.I410V|SMG7_ENST00000367537.3_Missense_Mutation_p.I439V|SMG7_ENST00000456731.2_Missense_Mutation_p.I368V	NM_173156.2	NP_775179.1	Q92540	SMG7_HUMAN	SMG7 nonsense mediated mRNA decay factor	410					gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of dephosphorylation (GO:0035303)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)	protein phosphatase 2A binding (GO:0051721)			breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|lung(16)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	46						CCTCTCAAGTATTAGTGGTAA	0.388																																																	0													151.0	133.0	140.0					1																	183506344		2203	4300	6503	SO:0001583	missense	0			D87437	CCDS1355.1, CCDS41445.1, CCDS41445.2, CCDS53444.1, CCDS53445.1	1q25	2013-07-02	2013-07-02	2006-02-16	ENSG00000116698	ENSG00000116698			16792	protein-coding gene	gene with protein product	"""EST1 telomerase component homolog C (S. cerevisiae)"""	610964	"""chromosome 1 open reading frame 16"", ""smg-7 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	C1orf16		14636577, 15721257	Standard	NM_173156		Approved	KIAA0250, EST1C, SGA56M, SMG-7	uc001gqf.3	Q92540	OTTHUMG00000035221	ENST00000347615.2:c.1228A>G	1.37:g.183506344A>G	ENSP00000340766:p.Ile410Val		B4DRB2|E9PCI0|E9PEH2|Q5T1Q0|Q6PIE0|Q7Z7H9|Q8IXC1|Q8IXC2	Missense_Mutation	SNP	pfam_EST1	p.I410V	ENST00000347615.2	37	c.1228	CCDS1355.1	1	.	.	.	.	.	.	.	.	.	.	A	7.321	0.616912	0.14129	.	.	ENSG00000116698	ENST00000456731;ENST00000367537;ENST00000508461;ENST00000419169;ENST00000347615;ENST00000507469;ENST00000515829	T;T;T;T;T;T;T	0.28069	1.63;1.63;1.63;1.63;1.63;1.63;1.63	5.69	4.57	0.56435	.	0.337409	0.35179	N	0.003392	T	0.13329	0.0323	N	0.08118	0	0.18873	N	0.999987	B;B;B;B;B;B	0.13145	0.006;0.003;0.001;0.001;0.002;0.007	B;B;B;B;B;B	0.18561	0.012;0.013;0.008;0.005;0.012;0.022	T	0.25117	-1.0141	10	0.17832	T	0.49	-3.8014	5.4274	0.16433	0.7044:0.1485:0.1471:0.0	.	368;439;368;410;410;410	E9PCI0;E9PD50;E9PCE5;Q92540-2;Q92540;E9PEH2	.;.;.;.;SMG7_HUMAN;.	V	368;439;368;368;410;410;410	ENSP00000407629:I368V;ENSP00000356507:I439V;ENSP00000426915:I368V;ENSP00000388390:I368V;ENSP00000340766:I410V;ENSP00000425133:I410V;ENSP00000421358:I410V	ENSP00000340766:I410V	I	+	1	0	SMG7	181772967	0.998000	0.40836	1.000000	0.80357	0.735000	0.41995	2.217000	0.42880	1.001000	0.39076	0.528000	0.53228	ATT	SMG7	-	NULL	ENSG00000116698		0.388	SMG7-002	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	SMG7	HGNC	protein_coding	OTTHUMT00000085432.1	-	0.00	84	0	A	NM_014837		183506344	+1	tier1	-	no_errors	ENST00000507469	ensembl	human	known	74_37	missense	24.62	49	16	SNP	0.999	G
SNRPN	6638	genome.wustl.edu	37	15	25219552	25219552	+	5'UTR	SNP	G	G	A			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr15:25219552G>A	ENST00000400100.1	+	0	842				SNRPN_ENST00000390687.4_5'UTR|SNRPN_ENST00000444203.2_5'UTR|SNRPN_ENST00000577565.1_5'UTR|SNURF_ENST00000338094.6_3'UTR|SNRPN_ENST00000554227.2_5'UTR|SNRPN_ENST00000400098.1_5'UTR|SNRPN_ENST00000346403.6_5'UTR|SNRPN_ENST00000553597.1_3'UTR|SNRPN_ENST00000400097.1_5'UTR|SNURF_ENST00000551312.2_Intron	NM_022807.2	NP_073718.1	P63162	RSMN_HUMAN	small nuclear ribonucleoprotein polypeptide N						response to hormone (GO:0009725)|RNA splicing (GO:0008380)	small nuclear ribonucleoprotein complex (GO:0030532)|spliceosomal complex (GO:0005681)|U1 snRNP (GO:0005685)|U2 snRNP (GO:0005686)	RNA binding (GO:0003723)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(14)|ovary(1)|skin(2)	24		all_cancers(20;9.33e-22)|Breast(32;0.000625)		all cancers(64;3.38e-08)|Epithelial(43;3.45e-07)|BRCA - Breast invasive adenocarcinoma(123;0.000207)|GBM - Glioblastoma multiforme(186;0.125)		TAGGTCTTCAGAAGCATCAAG	0.458									Prader-Willi syndrome																																								0													160.0	149.0	152.0					15																	25219552		1888	4127	6015	SO:0001623	5_prime_UTR_variant	0	Familial Cancer Database	Prader-Labhart-Willi syndrome	L80005	CCDS10017.1	15q11.2	2013-07-16			ENSG00000128739	ENSG00000128739			11164	protein-coding gene	gene with protein product	"""tissue-specific splicing protein"", ""SM protein N"", ""small nuclear ribonucleoprotein N"""	182279	"""Prader-Willi syndrome chromosome region"""	PWCR		1533223	Standard	NM_022805		Approved	SMN, SM-D, HCERN3, SNRNP-N, SNURF-SNRPN, RT-LI	uc001ywt.1	P63162	OTTHUMG00000129180	ENST00000400100.1:c.-49G>A	15.37:g.25219552G>A			B3KVR1|P14648|P17135|Q0D2Q5	RNA	SNP	-	NULL	ENST00000400100.1	37	NULL	CCDS10017.1	15																																																																																			SNRPN	-	-	ENSG00000128739		0.458	SNRPN-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SNRPN	HGNC	protein_coding	OTTHUMT00000413849.10	-	0.00	75	0	G	NM_003097		25219552	+1	tier1	-	no_errors	ENST00000553597	ensembl	human	known	74_37	rna	26.15	48	17	SNP	0.007	A
SRPK1	6732	genome.wustl.edu	37	6	35810356	35810356	+	Missense_Mutation	SNP	T	T	C	rs368604697		TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr6:35810356T>C	ENST00000373825.2	-	14	1931	c.1646A>G	c.(1645-1647)tAt>tGt	p.Y549C	SRPK1_ENST00000373822.1_Missense_Mutation_p.Y441C|SRPK1_ENST00000423325.2_Missense_Mutation_p.Y533C					SRSF protein kinase 1											endometrium(2)|large_intestine(10)|lung(6)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	21						TTCAAACAAATAGTCACCTGT	0.418																																					NSCLC(31;67 978 16289 24856 26454)												0													77.0	71.0	73.0					6																	35810356		1896	4120	6016	SO:0001583	missense	0			U09564	CCDS47415.1	6p21.31	2010-06-23	2010-06-23		ENSG00000096063	ENSG00000096063			11305	protein-coding gene	gene with protein product	"""SR protein kinase 1"", ""serine/arginine-rich splicing factor kinase 1"""	601939	"""SFRS protein kinase 1"""			8208298, 10198174	Standard	NM_003137		Approved	SFRSK1	uc003olj.3	Q96SB4	OTTHUMG00000014583	ENST00000373825.2:c.1646A>G	6.37:g.35810356T>C	ENSP00000362931:p.Tyr549Cys			Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.Y549C	ENST00000373825.2	37	c.1646	CCDS47415.1	6	.	.	.	.	.	.	.	.	.	.	T	23.5	4.428384	0.83667	.	.	ENSG00000096063	ENST00000373825;ENST00000361690;ENST00000423325;ENST00000373822	T;T;T;T	0.20598	2.06;2.06;2.06;2.06	5.18	5.18	0.71444	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	.	.	.	.	T	0.33118	0.0852	L	0.53617	1.68	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	T	0.11717	-1.0576	9	0.87932	D	0	-11.6433	15.3152	0.74069	0.0:0.0:0.0:1.0	.	533;549	B4DS61;Q96SB4	.;SRPK1_HUMAN	C	549;565;533;441	ENSP00000362931:Y549C;ENSP00000354674:Y565C;ENSP00000391069:Y533C;ENSP00000362928:Y441C	ENSP00000354674:Y565C	Y	-	2	0	SRPK1	35918334	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.651000	0.83577	2.079000	0.62486	0.402000	0.26972	TAT	SRPK1	-	pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,pfscan_Prot_kinase_dom	ENSG00000096063		0.418	SRPK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRPK1	HGNC	protein_coding	OTTHUMT00000040319.3	-	0.00	12	0	T	NM_003137		35810356	-1	tier1	-	no_errors	ENST00000373825	ensembl	human	known	74_37	missense	29.41	12	5	SNP	1.000	C
SV2C	22987	genome.wustl.edu	37	5	75428155	75428155	+	Splice_Site	SNP	G	G	A			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr5:75428155G>A	ENST00000502798.2	+	2	1022	c.580G>A	c.(580-582)Ggc>Agc	p.G194S	SV2C_ENST00000322285.7_Splice_Site_p.G194S	NM_014979.1	NP_055794.1	Q496J9	SV2C_HUMAN	synaptic vesicle glycoprotein 2C	194					neurotransmitter transport (GO:0006836)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|synaptic vesicle (GO:0008021)	transmembrane transporter activity (GO:0022857)			NS(1)|breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(14)|ovary(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	37		all_lung(232;0.007)|Lung NSC(167;0.0148)|Ovarian(174;0.0798)|Prostate(461;0.184)		OV - Ovarian serous cystadenocarcinoma(47;1.16e-50)|all cancers(79;7.25e-40)		TGGATGGCTAGGTGAGTGTGT	0.458																																																	0													90.0	82.0	85.0					5																	75428155		2049	4212	6261	SO:0001630	splice_region_variant	0			AB028977	CCDS43331.1, CCDS75261.1	5q13	2008-02-05			ENSG00000122012	ENSG00000122012			30670	protein-coding gene	gene with protein product		610291				10470851, 9801366	Standard	XM_005248470		Approved		uc003kei.1	Q496J9	OTTHUMG00000162384	ENST00000502798.2:c.580+1G>A	5.37:g.75428155G>A			Q496K1|Q9UPU8	Missense_Mutation	SNP	pfam_MFS,pfam_Sub_transporter,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_SV2	p.G194S	ENST00000502798.2	37	c.580	CCDS43331.1	5	.	.	.	.	.	.	.	.	.	.	G	23.7	4.453133	0.84209	.	.	ENSG00000122012	ENST00000502798;ENST00000322285	T;T	0.73681	-0.77;-0.77	5.44	5.44	0.79542	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.048093	0.85682	D	0.000000	D	0.82834	0.5123	L	0.54965	1.715	0.80722	D	1	D	0.64830	0.994	D	0.63033	0.91	T	0.82004	-0.0672	10	0.44086	T	0.13	-17.8523	19.2647	0.93980	0.0:0.0:1.0:0.0	.	194	Q496J9	SV2C_HUMAN	S	194	ENSP00000423541:G194S;ENSP00000316983:G194S	ENSP00000316983:G194S	G	+	1	0	SV2C	75463911	1.000000	0.71417	0.998000	0.56505	0.840000	0.47671	9.869000	0.99810	2.569000	0.86673	0.655000	0.94253	GGC	SV2C	-	pfam_MFS,pfam_Sub_transporter,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_SV2	ENSG00000122012		0.458	SV2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SV2C	HGNC	protein_coding	OTTHUMT00000368700.4	-	0.00	47	0	G		Missense_Mutation	75428155	+1	tier1	-	no_errors	ENST00000502798	ensembl	human	known	74_37	missense	78.95	8	30	SNP	1.000	A
TAF5	6877	genome.wustl.edu	37	10	105147814	105147814	+	Missense_Mutation	SNP	A	A	G			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr10:105147814A>G	ENST00000369839.3	+	11	2260	c.2237A>G	c.(2236-2238)gAt>gGt	p.D746G	TAF5_ENST00000351396.4_Missense_Mutation_p.D691G	NM_006951.3	NP_008882.2	Q15542	TAF5_HUMAN	TAF5 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 100kDa	746					chromatin modification (GO:0016568)|DNA-templated transcription, initiation (GO:0006352)|gene expression (GO:0010467)|histone acetylation (GO:0016573)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	actin cytoskeleton (GO:0015629)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)|transcription factor TFTC complex (GO:0033276)	protein dimerization activity (GO:0046983)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(5)|lung(4)|ovary(2)	15		Colorectal(252;0.0747)|Breast(234;0.128)		Epithelial(162;1.83e-09)|all cancers(201;1.4e-08)|BRCA - Breast invasive adenocarcinoma(275;0.198)		GCCTTTGAAGATTTAGAGACC	0.373																																																	0													129.0	129.0	129.0					10																	105147814		2203	4300	6503	SO:0001583	missense	0			X95525	CCDS7547.1	10q24-q25.2	2013-01-10	2002-08-29	2001-12-07	ENSG00000148835	ENSG00000148835		"""WD repeat domain containing"""	11539	protein-coding gene	gene with protein product		601787	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, D, 100kD"""	TAF2D		8884287, 8942982	Standard	NM_006951		Approved	TAFII100	uc001kwv.3	Q15542	OTTHUMG00000018985	ENST00000369839.3:c.2237A>G	10.37:g.105147814A>G	ENSP00000358854:p.Asp746Gly		A8K5B4|B2RMR0|B7ZKJ6|Q53EM4|Q5SYD5|Q86UZ7|Q9Y4K5	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_TFIID-su_WD40-assoc_reg,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_LisH_dimerisation,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.D746G	ENST00000369839.3	37	c.2237	CCDS7547.1	10	.	.	.	.	.	.	.	.	.	.	A	17.35	3.367941	0.61513	.	.	ENSG00000148835	ENST00000369839;ENST00000351396	T;T	0.57752	0.58;0.38	5.79	5.79	0.91817	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.64778	0.2629	L	0.55481	1.735	0.80722	D	1	D;D	0.64830	0.994;0.988	P;P	0.58013	0.831;0.76	T	0.67352	-0.5692	10	0.66056	D	0.02	-14.7564	16.1299	0.81422	1.0:0.0:0.0:0.0	.	691;746	Q15542-2;Q15542	.;TAF5_HUMAN	G	746;691	ENSP00000358854:D746G;ENSP00000311024:D691G	ENSP00000311024:D691G	D	+	2	0	TAF5	105137804	1.000000	0.71417	1.000000	0.80357	0.873000	0.50193	8.946000	0.92992	2.213000	0.71641	0.455000	0.32223	GAT	TAF5	-	superfamily_WD40_repeat_dom,pfscan_WD40_repeat_dom	ENSG00000148835		0.373	TAF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAF5	HGNC	protein_coding	OTTHUMT00000050144.1	-	0.00	32	0	A			105147814	+1	tier1	-	no_errors	ENST00000369839	ensembl	human	known	74_37	missense	78.57	6	22	SNP	1.000	G
TANK	10010	genome.wustl.edu	37	2	162036193	162036193	+	Missense_Mutation	SNP	A	A	T			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr2:162036193A>T	ENST00000392749.2	+	2	259	c.20A>T	c.(19-21)gAg>gTg	p.E7V	TANK_ENST00000406287.1_Missense_Mutation_p.E65V|TANK_ENST00000405852.1_Missense_Mutation_p.E7V|TANK_ENST00000259075.2_Missense_Mutation_p.E7V|TANK_ENST00000457476.1_Missense_Mutation_p.E7V|TANK_ENST00000402568.1_Missense_Mutation_p.E65V|TANK_ENST00000403609.1_Missense_Mutation_p.E7V	NM_001199135.1	NP_001186064.1	Q92844	TANK_HUMAN	TRAF family member-associated NFKB activator	7					I-kappaB kinase/NF-kappaB signaling (GO:0007249)|innate immune response (GO:0045087)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	metal ion binding (GO:0046872)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(7)|ovary(1)|prostate(1)	21						AACATTGGCGAGCAACTCAAT	0.388																																																	0													122.0	112.0	115.0					2																	162036193		2203	4300	6503	SO:0001583	missense	0			U59863	CCDS2215.1, CCDS46436.1	2q24-q31	2008-02-05			ENSG00000136560	ENSG00000136560			11562	protein-coding gene	gene with protein product		603893		TRAF2		8710854, 8855313	Standard	NM_004180		Approved	I-TRAF	uc002ubr.2	Q92844	OTTHUMG00000132037	ENST00000392749.2:c.20A>T	2.37:g.162036193A>T	ENSP00000376505:p.Glu7Val		D3DPB5|Q7Z4J6|Q92885	Missense_Mutation	SNP	NULL	p.E7V	ENST00000392749.2	37	c.20	CCDS2215.1	2	.	.	.	.	.	.	.	.	.	.	A	23.4	4.406447	0.83230	.	.	ENSG00000136560	ENST00000259075;ENST00000432002;ENST00000457476;ENST00000392749;ENST00000440506;ENST00000429217;ENST00000406287;ENST00000402568;ENST00000405852;ENST00000456358;ENST00000403609	T;T;T;T;T	0.53423	1.09;1.09;2.55;0.62;2.55	6.04	6.04	0.98038	.	0.106326	0.64402	D	0.000006	T	0.60958	0.2309	L	0.36672	1.1	0.45554	D	0.998503	D;D	0.89917	1.0;1.0	D;D	0.83275	0.975;0.996	T	0.63563	-0.6609	10	0.87932	D	0	-8.5124	16.2378	0.82389	1.0:0.0:0.0:0.0	.	7;7	Q92844;Q7Z4J6	TANK_HUMAN;.	V	7;7;7;7;7;7;65;65;7;33;7	ENSP00000259075:E7V;ENSP00000376505:E7V;ENSP00000384492:E65V;ENSP00000385487:E7V;ENSP00000392776:E33V	ENSP00000259075:E7V	E	+	2	0	TANK	161744439	1.000000	0.71417	0.988000	0.46212	0.991000	0.79684	7.042000	0.76565	2.317000	0.78254	0.459000	0.35465	GAG	TANK	-	NULL	ENSG00000136560		0.388	TANK-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TANK	HGNC	protein_coding	OTTHUMT00000324232.1	-	0.00	34	0	A	NM_133484		162036193	+1	tier1	-	no_errors	ENST00000259075	ensembl	human	known	74_37	missense	48.78	21	20	SNP	1.000	T
TAS1R3	83756	genome.wustl.edu	37	1	1266824	1266824	+	Silent	SNP	G	G	T			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr1:1266824G>T	ENST00000339381.5	+	1	131	c.99G>T	c.(97-99)ggG>ggT	p.G33G		NM_152228.1	NP_689414	Q7RTX0	TS1R3_HUMAN	taste receptor, type 1, member 3	33					detection of chemical stimulus involved in sensory perception of sweet taste (GO:0001582)|G-protein coupled receptor signaling pathway (GO:0007186)|sensory perception of sweet taste (GO:0050916)|sensory perception of umami taste (GO:0050917)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein heterodimerization activity (GO:0046982)|taste receptor activity (GO:0008527)			kidney(2)|lung(8)|upper_aerodigestive_tract(1)|urinary_tract(1)	12	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		Epithelial(90;3.01e-35)|OV - Ovarian serous cystadenocarcinoma(86;3.88e-21)|Colorectal(212;0.000157)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00229)|BRCA - Breast invasive adenocarcinoma(365;0.00251)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.034)|Lung(427;0.146)		GGATGAAGGGGGACTACGTGC	0.692																																																	0													15.0	17.0	16.0					1																	1266824		2181	4264	6445	SO:0001819	synonymous_variant	0			AC026283	CCDS30556.1	1p36	2012-08-22			ENSG00000169962	ENSG00000169962		"""Taste receptors / Type 1"", ""GPCR / Unclassified : Taste receptors"""	15661	protein-coding gene	gene with protein product		605865				11319557	Standard	XM_006710939		Approved	T1R3	uc010nyk.2	Q7RTX0	OTTHUMG00000003071	ENST00000339381.5:c.99G>T	1.37:g.1266824G>T			Q5TA49|Q8NGW9	Silent	SNP	pfam_ANF_lig-bd_rcpt,pfam_GPCR_3_C,pfam_GPCR_3_9-Cys_dom,superfamily_Peripla_BP_I,pfscan_GPCR_3_C,prints_GPCR_3	p.G33	ENST00000339381.5	37	c.99	CCDS30556.1	1																																																																																			TAS1R3	-	superfamily_Peripla_BP_I,prints_GPCR_3	ENSG00000169962		0.692	TAS1R3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAS1R3	HGNC	protein_coding	OTTHUMT00000008493.1	-	0.00	34	0	G			1266824	+1	tier1	-	no_errors	ENST00000339381	ensembl	human	known	74_37	silent	29.41	24	10	SNP	0.998	T
TAS2R4	50832	genome.wustl.edu	37	7	141478419	141478419	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr7:141478419C>G	ENST00000247881.2	+	1	178	c.131C>G	c.(130-132)tCt>tGt	p.S44C	SSBP1_ENST00000465582.1_Intron	NM_016944.1	NP_058640.1	Q9NYW5	TA2R4_HUMAN	taste receptor, type 2, member 4	44					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|respiratory gaseous exchange (GO:0007585)|sensory perception of taste (GO:0050909)|signal transduction (GO:0007165)	cilium (GO:0005929)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)|taste receptor activity (GO:0008527)			endometrium(1)|large_intestine(4)|lung(2)	7	Melanoma(164;0.0171)			BRCA - Breast invasive adenocarcinoma(188;0.196)		ATCTCCTCTTCTGATAGGATT	0.388																																																	0													169.0	166.0	167.0					7																	141478419		2203	4300	6503	SO:0001583	missense	0			AF227131	CCDS5868.1	7q31.3-q32	2012-08-22			ENSG00000127364	ENSG00000127364		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	14911	protein-coding gene	gene with protein product		604869				10761934, 10761935	Standard	NM_016944		Approved	T2R4	uc003vwq.1	Q9NYW5	OTTHUMG00000157634	ENST00000247881.2:c.131C>G	7.37:g.141478419C>G	ENSP00000247881:p.Ser44Cys		Q645W5|Q75MV8	Missense_Mutation	SNP	pfam_TAS2_rcpt	p.S44C	ENST00000247881.2	37	c.131	CCDS5868.1	7	.	.	.	.	.	.	.	.	.	.	C	16.71	3.199056	0.58126	.	.	ENSG00000127364	ENST00000247881	T	0.38401	1.14	5.57	4.62	0.57501	.	0.367248	0.27856	N	0.017570	T	0.50222	0.1603	M	0.61703	1.905	0.24303	N	0.995113	D	0.71674	0.998	D	0.68192	0.956	T	0.44862	-0.9300	10	0.66056	D	0.02	.	6.3895	0.21579	0.0:0.7149:0.1873:0.0978	.	44	Q9NYW5	TA2R4_HUMAN	C	44	ENSP00000247881:S44C	ENSP00000247881:S44C	S	+	2	0	TAS2R4	141124888	0.005000	0.15991	0.937000	0.37676	0.825000	0.46686	0.351000	0.20096	2.902000	0.99343	0.650000	0.86243	TCT	TAS2R4	-	pfam_TAS2_rcpt	ENSG00000127364		0.388	TAS2R4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAS2R4	HGNC	protein_coding	OTTHUMT00000349285.1	-	0.00	62	0	C			141478419	+1	tier1	-	no_errors	ENST00000247881	ensembl	human	known	74_37	missense	11.11	32	4	SNP	0.980	G
TBC1D26	353149	genome.wustl.edu	37	17	15641610	15641610	+	Missense_Mutation	SNP	A	A	G	rs202131240		TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr17:15641610A>G	ENST00000437605.2	+	7	546	c.296A>G	c.(295-297)tAc>tGc	p.Y99C	AC005324.6_ENST00000580194.1_RNA|AC005324.6_ENST00000434017.1_RNA|TBC1D26_ENST00000579428.1_Missense_Mutation_p.Y99C|AC005324.6_ENST00000433873.1_RNA|ZNF286A_ENST00000413242.2_3'UTR	NM_178571.4	NP_848666	Q86UD7	TBC26_HUMAN	TBC1 domain family, member 26	99							Rab GTPase activator activity (GO:0005097)			endometrium(1)|large_intestine(1)|lung(4)|skin(1)	7				UCEC - Uterine corpus endometrioid carcinoma (92;0.0822)|READ - Rectum adenocarcinoma(1115;0.0222)|BRCA - Breast invasive adenocarcinoma(8;0.078)		CAAAGAGTATACAAAGTCATT	0.527																																																	0													94.0	90.0	91.0					17																	15641610		1953	4139	6092	SO:0001583	missense	0				CCDS42265.1	17p11.2	2008-11-04			ENSG00000214946	ENSG00000214946			28745	protein-coding gene	gene with protein product						11347906	Standard	NM_178571		Approved	MGC51025	uc010cov.3	Q86UD7	OTTHUMG00000059071	ENST00000437605.2:c.296A>G	17.37:g.15641610A>G	ENSP00000410111:p.Tyr99Cys		A8K929|Q4G172	Missense_Mutation	SNP	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	p.Y99C	ENST00000437605.2	37	c.296	CCDS42265.1	17	.	.	.	.	.	.	.	.	.	.	a	6.884	0.532498	0.13127	.	.	ENSG00000214946	ENST00000437605	T	0.40756	1.02	1.44	-0.0271	0.13927	Rab-GAP/TBC domain (2);	0.436109	0.22940	U	0.053784	T	0.48943	0.1528	L	0.58583	1.82	0.19945	N	0.999948	D;D	0.76494	0.999;0.981	D;D	0.67231	0.95;0.914	T	0.36601	-0.9741	10	0.52906	T	0.07	.	3.1782	0.06576	0.6204:0.0:0.0:0.3796	.	99;99	Q86UD7;Q86UD7-2	TBC26_HUMAN;.	C	99	ENSP00000410111:Y99C	ENSP00000410111:Y99C	Y	+	2	0	TBC1D26	15582335	0.952000	0.32445	0.008000	0.14137	0.029000	0.11900	1.676000	0.37565	-0.258000	0.09446	0.338000	0.21704	TAC	TBC1D26	-	superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom	ENSG00000214946		0.527	TBC1D26-201	KNOWN	basic|appris_principal|CCDS	protein_coding	TBC1D26	HGNC	protein_coding			0.00	50	0	A	NM_178571		15641610	+1			no_errors	ENST00000437605	ensembl	human	known	74_37	missense	5.33	71	4	SNP	0.413	G
TDRD3	81550	genome.wustl.edu	37	13	61103130	61103130	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr13:61103130G>A	ENST00000196169.3	+	11	2280	c.1492G>A	c.(1492-1494)Gta>Ata	p.V498I	TDRD3_ENST00000377894.2_Missense_Mutation_p.V498I|TDRD3_ENST00000535286.1_Missense_Mutation_p.V591I|TDRD3_ENST00000377881.2_Missense_Mutation_p.V498I	NM_001146071.1|NM_030794.2	NP_001139543.1|NP_110421.1	Q9H7E2	TDRD3_HUMAN	tudor domain containing 3	498					chromatin modification (GO:0016568)|regulation of RNA biosynthetic process (GO:2001141)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|methylated histone binding (GO:0035064)|poly(A) RNA binding (GO:0044822)|transcription coactivator activity (GO:0003713)			breast(1)|endometrium(3)|kidney(2)|large_intestine(10)|liver(1)|lung(16)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	40		Prostate(109;0.173)|Breast(118;0.174)		GBM - Glioblastoma multiforme(99;0.000291)		AAATGGAGAAGTAGAAATGCC	0.363																																					Colon(36;164 906 35820 50723)												0													49.0	49.0	49.0					13																	61103130		2203	4300	6503	SO:0001583	missense	0			AK023578	CCDS9441.1, CCDS53872.1	13q14.3	2013-01-23			ENSG00000083544	ENSG00000083544		"""Tudor domain containing"""	20612	protein-coding gene	gene with protein product		614392					Standard	NM_030794		Approved	FLJ21007	uc010aeg.3	Q9H7E2	OTTHUMG00000017007	ENST00000196169.3:c.1492G>A	13.37:g.61103130G>A	ENSP00000196169:p.Val498Ile		B2MWP9|Q53XA6|Q6P992	Missense_Mutation	SNP	pfam_DUF1767,pfam_Tudor,pfam_Survival_motor_neuron,pfam_UBA/Ts_N,superfamily_UBA-like,smart_UBA/transl_elong_EF1B_N_euk,smart_Tudor,pfscan_Tudor,pfscan_UBA/transl_elong_EF1B_N_euk	p.V591I	ENST00000196169.3	37	c.1771	CCDS9441.1	13	.	.	.	.	.	.	.	.	.	.	G	6.597	0.478448	0.12521	.	.	ENSG00000083544	ENST00000196169;ENST00000377881;ENST00000377894;ENST00000535286	D;D;D;D	0.93426	-3.22;-3.22;-3.22;-3.22	5.84	1.78	0.24846	.	0.822854	0.11458	N	0.562031	T	0.82148	0.4974	N	0.08118	0	0.23101	N	0.998293	B;B;B	0.13594	0.008;0.001;0.001	B;B;B	0.14023	0.01;0.003;0.003	T	0.69548	-0.5116	10	0.28530	T	0.3	-5.5607	3.7899	0.08716	0.5247:0.0:0.2282:0.2471	.	591;497;498	Q9H7E2-3;Q9H7E2-2;Q9H7E2	.;.;TDRD3_HUMAN	I	498;498;498;591	ENSP00000196169:V498I;ENSP00000367113:V498I;ENSP00000367126:V498I;ENSP00000440190:V591I	ENSP00000196169:V498I	V	+	1	0	TDRD3	60001131	0.144000	0.22641	1.000000	0.80357	0.869000	0.49853	0.313000	0.19415	0.452000	0.26830	-0.355000	0.07637	GTA	TDRD3	-	NULL	ENSG00000083544		0.363	TDRD3-201	KNOWN	basic|CCDS	protein_coding	TDRD3	HGNC	protein_coding	OTTHUMT00000045175.2	-	0.00	27	0	G	NM_030794		61103130	+1	tier1	-	no_errors	ENST00000535286	ensembl	human	known	74_37	missense	70.97	8	22	SNP	0.961	A
TDRD9	122402	genome.wustl.edu	37	14	104457550	104457550	+	Missense_Mutation	SNP	T	T	A			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr14:104457550T>A	ENST00000409874.4	+	9	1217	c.1169T>A	c.(1168-1170)gTg>gAg	p.V390E	TDRD9_ENST00000339063.5_Missense_Mutation_p.V390E	NM_153046.2	NP_694591.2	Q8NDG6	TDRD9_HUMAN	tudor domain containing 9	390	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				cell differentiation (GO:0030154)|DNA methylation involved in gamete generation (GO:0043046)|fertilization (GO:0009566)|gene silencing by RNA (GO:0031047)|male meiosis (GO:0007140)|multicellular organismal development (GO:0007275)|piRNA metabolic process (GO:0034587)|spermatogenesis (GO:0007283)	nucleus (GO:0005634)|piP-body (GO:0071547)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|nucleic acid binding (GO:0003676)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(10)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)	33		all_cancers(154;0.109)|Melanoma(154;0.0525)|all_epithelial(191;0.0768)				AGTGTGTTGGTGTTTTTGCCA	0.403																																																	0													206.0	183.0	191.0					14																	104457550		2203	4300	6503	SO:0001583	missense	0			AK093483	CCDS9987.2	14q32.33	2013-01-23	2004-04-01	2004-04-02	ENSG00000156414	ENSG00000156414		"""Tudor domain containing"""	20122	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 75"""	C14orf75			Standard	NM_153046		Approved	DKFZp434N0820, FLJ36164, NET54	uc001yom.4	Q8NDG6	OTTHUMG00000152876	ENST00000409874.4:c.1169T>A	14.37:g.104457550T>A	ENSP00000387303:p.Val390Glu		A1A4S7|Q6ZU54|Q8N7T3|Q8N827|Q8N9V5|Q96AS9	Missense_Mutation	SNP	pfam_Helicase-assoc_dom,pfam_Tudor,pfam_Helicase_C,pfam_DNA/RNA_helicase_DEAD/DEAH_N,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,smart_Helicase-assoc_dom,smart_Tudor,pfscan_Tudor,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.V390E	ENST00000409874.4	37	c.1169	CCDS9987.2	14	.	.	.	.	.	.	.	.	.	.	T	24.1	4.498399	0.85069	.	.	ENSG00000156414	ENST00000409874;ENST00000339063	T;T	0.03035	4.07;4.07	5.63	5.63	0.86233	Helicase, C-terminal (1);	0.000000	0.53938	D	0.000041	T	0.31358	0.0794	H	0.97415	4	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.81914	0.995;0.99	T	0.53143	-0.8480	10	0.87932	D	0	.	15.4927	0.75624	0.0:0.0:0.0:1.0	.	390;390	Q8NDG6-2;Q8NDG6	.;TDRD9_HUMAN	E	390	ENSP00000387303:V390E;ENSP00000343545:V390E	ENSP00000343545:V390E	V	+	2	0	TDRD9	103527303	1.000000	0.71417	0.969000	0.41365	0.975000	0.68041	5.796000	0.69080	2.130000	0.65690	0.533000	0.62120	GTG	TDRD9	-	superfamily_P-loop_NTPase,pfscan_Helicase_C	ENSG00000156414		0.403	TDRD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TDRD9	HGNC	protein_coding	OTTHUMT00000328325.3	-	0.00	73	0	T	NM_153046		104457550	+1	tier1	-	no_errors	ENST00000409874	ensembl	human	known	74_37	missense	10.81	98	12	SNP	1.000	A
TECRL	253017	genome.wustl.edu	37	4	65145912	65145912	+	Missense_Mutation	SNP	T	T	C			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr4:65145912T>C	ENST00000381210.3	-	12	1080	c.970A>G	c.(970-972)Att>Gtt	p.I324V	TECRL_ENST00000507440.1_Intron	NM_001010874.4	NP_001010874.2	Q5HYJ1	TECRL_HUMAN	trans-2,3-enoyl-CoA reductase-like	324					lipid metabolic process (GO:0006629)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)	oxidoreductase activity, acting on the CH-CH group of donors (GO:0016627)	p.I324F(1)		endometrium(2)|kidney(5)|large_intestine(7)|lung(30)|prostate(1)|skin(1)|stomach(1)	47						AGTGTAAAAATTCCAACTAGA	0.274																																																	1	Substitution - Missense(1)	large_intestine(1)											29.0	30.0	30.0					4																	65145912		2175	4239	6414	SO:0001583	missense	0			AL833108	CCDS33990.1	4q13.1	2009-07-21			ENSG00000205678	ENSG00000205678			27365	protein-coding gene	gene with protein product	"""glycoprotein, synaptic 2-like"""					12477932	Standard	NM_001010874		Approved	GPSN2L, SRD5A2L2, DKFZp313D0829, DKFZp313B2333, TERL	uc003hcv.3	Q5HYJ1	OTTHUMG00000160680	ENST00000381210.3:c.970A>G	4.37:g.65145912T>C	ENSP00000370607:p.Ile324Val			Missense_Mutation	SNP	pfam_3-oxo-5_a-steroid_4-DH_C,pfscan_3-oxo-5_a-steroid_4-DH_C	p.I324V	ENST00000381210.3	37	c.970	CCDS33990.1	4	.	.	.	.	.	.	.	.	.	.	T	9.948	1.219316	0.22373	.	.	ENSG00000205678	ENST00000381210	T	0.27557	1.66	5.09	1.37	0.22104	3-oxo-5-alpha-steroid 4-dehydrogenase, C-terminal (2);	0.311884	0.34932	N	0.003578	T	0.14960	0.0361	N	0.20685	0.6	0.33659	D	0.609403	B	0.06786	0.001	B	0.11329	0.006	T	0.21690	-1.0238	10	0.14656	T	0.56	-11.881	6.2514	0.20848	0.0:0.3002:0.0:0.6998	.	324	Q5HYJ1	TECRL_HUMAN	V	324	ENSP00000370607:I324V	ENSP00000370607:I324V	I	-	1	0	TECRL	64828507	0.150000	0.22732	0.896000	0.35187	0.998000	0.95712	0.186000	0.16978	0.364000	0.24374	0.528000	0.53228	ATT	TECRL	-	pfam_3-oxo-5_a-steroid_4-DH_C,pfscan_3-oxo-5_a-steroid_4-DH_C	ENSG00000205678		0.274	TECRL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TECRL	HGNC	protein_coding	OTTHUMT00000361705.4	-	0.00	31	0	T	NM_001010874		65145912	-1	tier1	-	no_errors	ENST00000381210	ensembl	human	known	74_37	missense	55.56	12	15	SNP	0.777	C
TFR2	7036	genome.wustl.edu	37	7	100218538	100218538	+	Missense_Mutation	SNP	A	A	G			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr7:100218538A>G	ENST00000462107.1	-	19	2635	c.2348T>C	c.(2347-2349)cTg>cCg	p.L783P	TFR2_ENST00000544242.1_Missense_Mutation_p.L324P|TFR2_ENST00000223051.3_Missense_Mutation_p.L783P|TFR2_ENST00000431692.1_3'UTR			Q9UP52	TFR2_HUMAN	transferrin receptor 2	783					cellular iron ion homeostasis (GO:0006879)|iron ion transport (GO:0006826)|receptor-mediated endocytosis (GO:0006898)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)	transferrin receptor activity (GO:0004998)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(6)|liver(1)|lung(8)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	23	Lung NSC(181;0.0261)|all_lung(186;0.0392)|Esophageal squamous(72;0.0439)				Gallium nitrate(DB05260)	TGCCCCTTGCAGCGTCCAGGT	0.637																																																	0													42.0	39.0	40.0					7																	100218538		2203	4300	6503	SO:0001583	missense	0			AF053356	CCDS34707.1	7q22	2003-01-27			ENSG00000106327	ENSG00000106327			11762	protein-coding gene	gene with protein product		604720				9799793, 12130528	Standard	NM_003227		Approved	HFE3, TFRC2	uc003uvv.1	Q9UP52	OTTHUMG00000159598	ENST00000462107.1:c.2348T>C	7.37:g.100218538A>G	ENSP00000420525:p.Leu783Pro		A6NGM7|O75422|Q1HE13|Q9HA99|Q9NX67	Missense_Mutation	SNP	pfam_TFR-like_dimer_dom,pfam_Peptidase_M28,pfam_Protease-assoc_domain,superfamily_TFR-like_dimer_dom	p.L783P	ENST00000462107.1	37	c.2348	CCDS34707.1	7	.	.	.	.	.	.	.	.	.	.	A	22.3	4.269578	0.80469	.	.	ENSG00000106327	ENST00000223051;ENST00000462107;ENST00000544242	T;T;T	0.61742	0.08;0.08;0.08	5.54	5.54	0.83059	Transferrin receptor-like, dimerisation domain (3);	0.083185	0.50627	D	0.000105	T	0.68595	0.3018	L	0.42245	1.32	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	T	0.71307	-0.4632	10	0.87932	D	0	-4.784	13.6792	0.62474	1.0:0.0:0.0:0.0	.	783	Q9UP52	TFR2_HUMAN	P	783;783;324	ENSP00000223051:L783P;ENSP00000420525:L783P;ENSP00000443656:L324P	ENSP00000223051:L783P	L	-	2	0	TFR2	100056474	0.995000	0.38212	1.000000	0.80357	0.788000	0.44548	8.131000	0.89601	2.330000	0.79161	0.528000	0.53228	CTG	TFR2	-	pfam_TFR-like_dimer_dom,superfamily_TFR-like_dimer_dom	ENSG00000106327		0.637	TFR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TFR2	HGNC	protein_coding	OTTHUMT00000356392.3	-	0.00	46	0	A	NM_003227		100218538	-1	tier1	-	no_errors	ENST00000223051	ensembl	human	known	74_37	missense	6.41	73	5	SNP	1.000	G
THSD7B	80731	genome.wustl.edu	37	2	138320891	138320891	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr2:138320891G>T	ENST00000409968.1	+	16	3417	c.3239G>T	c.(3238-3240)cGc>cTc	p.R1080L	THSD7B_ENST00000543459.1_Intron|THSD7B_ENST00000413152.2_Missense_Mutation_p.R1052L|THSD7B_ENST00000272643.3_Missense_Mutation_p.R1083L			Q9C0I4	THS7B_HUMAN	thrombospondin, type I, domain containing 7B	1082	TSP type-1 13. {ECO:0000255|PROSITE- ProRule:PRU00210}.					integral component of membrane (GO:0016021)				NS(3)|breast(3)|central_nervous_system(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(14)|lung(57)|ovary(4)|pancreas(3)|prostate(11)|skin(4)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	134				BRCA - Breast invasive adenocarcinoma(221;0.19)		AGGTCCCTGCGCTGTGGAGGA	0.423																																																	0													96.0	89.0	91.0					2																	138320891		1958	4148	6106	SO:0001583	missense	0					2q22.1	2006-11-24			ENSG00000144229	ENSG00000144229			29348	protein-coding gene	gene with protein product						11214970	Standard	NM_001080427		Approved	KIAA1679	uc002tva.1	Q9C0I4	OTTHUMG00000153590	ENST00000409968.1:c.3239G>T	2.37:g.138320891G>T	ENSP00000387145:p.Arg1080Leu			Missense_Mutation	SNP	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	p.R1083L	ENST00000409968.1	37	c.3248		2	.	.	.	.	.	.	.	.	.	.	G	11.42	1.632643	0.29068	.	.	ENSG00000144229	ENST00000409968;ENST00000272643;ENST00000413152	T;T;T	0.60424	0.19;0.19;0.19	5.41	3.47	0.39725	.	0.295924	0.38837	N	0.001543	T	0.32526	0.0832	N	0.13003	0.285	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.12268	-1.0554	10	0.28530	T	0.3	.	3.2826	0.06921	0.0828:0.273:0.3827:0.2615	.	1052	C9JKN6	.	L	1080;1083;1052	ENSP00000387145:R1080L;ENSP00000272643:R1083L;ENSP00000413841:R1052L	ENSP00000272643:R1083L	R	+	2	0	THSD7B	138037361	0.975000	0.34042	1.000000	0.80357	0.984000	0.73092	1.068000	0.30629	1.420000	0.47138	0.585000	0.79938	CGC	THSD7B	-	superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	ENSG00000144229		0.423	THSD7B-001	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	THSD7B	HGNC	protein_coding	OTTHUMT00000331769.2	-	0.00	35	0	G	XM_046570.9		138320891	+1	tier1	-	no_errors	ENST00000272643	ensembl	human	known	74_37	missense	38.46	16	10	SNP	0.983	T
TLR1	7096	genome.wustl.edu	37	4	38798859	38798859	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr4:38798859G>C	ENST00000502213.2	-	3	1823	c.1594C>G	c.(1594-1596)Cta>Gta	p.L532V	TLR1_ENST00000510552.1_5'Flank|TLR1_ENST00000308979.2_Missense_Mutation_p.L532V			Q15399	TLR1_HUMAN	toll-like receptor 1	532	LRRCT.				cellular response to triacyl bacterial lipopeptide (GO:0071727)|detection of triacyl bacterial lipopeptide (GO:0042495)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|macrophage activation (GO:0042116)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|positive regulation of interleukin-6 biosynthetic process (GO:0045410)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|regulation of cytokine secretion (GO:0050707)|signal transduction (GO:0007165)|toll-like receptor 1 signaling pathway (GO:0034130)	cytoplasmic vesicle (GO:0031410)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|Toll-like receptor 1-Toll-like receptor 2 protein complex (GO:0035354)	protein heterodimerization activity (GO:0046982)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|skin(4)|stomach(2)	28						AATTCTCCTAGCTCACAGGTA	0.433																																					GBM(5;216 373 40795 46382)												0													267.0	273.0	271.0					4																	38798859		2203	4300	6503	SO:0001583	missense	0			U88540	CCDS33973.1	4p14	2008-02-05				ENSG00000174125		"""CD molecules"""	11847	protein-coding gene	gene with protein product		601194				9435236, 7584026	Standard	NM_003263		Approved	rsc786, KIAA0012, CD281	uc003gtl.3	Q15399		ENST00000502213.2:c.1594C>G	4.37:g.38798859G>C	ENSP00000421259:p.Leu532Val		D1CS39|D1CS41|O15452|Q32MK3|Q32MK4|Q9UG90	Missense_Mutation	SNP	pirsf_Toll-like_receptor,pfam_TIR_dom,pfam_Leu-rich_rpt,superfamily_TIR_dom,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_TIR_dom,pfscan_TIR_dom	p.L532V	ENST00000502213.2	37	c.1594	CCDS33973.1	4	.	.	.	.	.	.	.	.	.	.	G	11.05	1.525069	0.27299	.	.	ENSG00000174125	ENST00000308979;ENST00000502213	T;T	0.20200	2.09;2.09	4.75	0.94	0.19513	Cysteine-rich flanking region, C-terminal (1);	0.000000	0.49305	D	0.000146	T	0.45856	0.1363	M	0.86502	2.82	0.44816	D	0.997827	D	0.76494	0.999	D	0.75484	0.986	T	0.42032	-0.9475	10	0.87932	D	0	.	8.8946	0.35455	0.4754:0.0:0.5246:0.0	.	532	Q15399	TLR1_HUMAN	V	532	ENSP00000354932:L532V;ENSP00000421259:L532V	ENSP00000354932:L532V	L	-	1	2	TLR1	38475254	0.480000	0.25933	0.930000	0.37139	0.395000	0.30598	0.845000	0.27668	0.031000	0.15407	0.650000	0.86243	CTA	TLR1	-	pirsf_Toll-like_receptor,smart_Cys-rich_flank_reg_C	ENSG00000174125		0.433	TLR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TLR1	HGNC	protein_coding	OTTHUMT00000360510.3	-	0.00	83	0	G			38798859	-1	tier1	-	no_errors	ENST00000308979	ensembl	human	known	74_37	missense	77.91	19	67	SNP	0.861	C
TMCC1	23023	genome.wustl.edu	37	3	129547076	129547076	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr3:129547076C>T	ENST00000393238.3	-	3	486	c.146G>A	c.(145-147)gGc>gAc	p.G49D	TMCC1_ENST00000426664.2_Intron	NM_001017395.3	NP_001017395.2	O94876	TMCC1_HUMAN	transmembrane and coiled-coil domain family 1	49						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)		p.G49D(2)	PLXND1/TMCC1(4)	breast(1)|endometrium(3)|large_intestine(8)|lung(12)|skin(1)	25						CAAGCCTTGGCCAATCACGTT	0.468																																																	2	Substitution - Missense(2)	large_intestine(2)											90.0	80.0	84.0					3																	129547076		2203	4300	6503	SO:0001583	missense	0			AB018322	CCDS33855.1	3q21.3	2010-04-19	2005-07-13		ENSG00000172765	ENSG00000172765		"""Transmembrane and coiled-coil domain containing"""	29116	protein-coding gene	gene with protein product			"""transmembrane and coiled-coil domains 1"""			9872452	Standard	NR_033361		Approved	KIAA0779	uc021xdy.1	O94876	OTTHUMG00000159579	ENST00000393238.3:c.146G>A	3.37:g.129547076C>T	ENSP00000376930:p.Gly49Asp		A8K5Y3|B4DE04|Q68E06|Q8IXM8	Missense_Mutation	SNP	pfam_Predicted_TM_coiled-coil_2	p.G49D	ENST00000393238.3	37	c.146	CCDS33855.1	3	.	.	.	.	.	.	.	.	.	.	C	26.1	4.700406	0.88924	.	.	ENSG00000172765	ENST00000393238	T	0.43688	0.94	5.64	5.64	0.86602	.	0.182306	0.46442	N	0.000289	T	0.65101	0.2659	L	0.61218	1.895	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.65438	-0.6168	10	0.87932	D	0	-16.992	20.1358	0.98028	0.0:1.0:0.0:0.0	.	49	O94876	TMCC1_HUMAN	D	49	ENSP00000376930:G49D	ENSP00000376930:G49D	G	-	2	0	TMCC1	131029766	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.399000	0.79935	2.834000	0.97654	0.586000	0.80456	GGC	TMCC1	-	NULL	ENSG00000172765		0.468	TMCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMCC1	HGNC	protein_coding	OTTHUMT00000356418.2	-	0.00	46	0	C	NM_015008		129547076	-1	tier1	-	no_errors	ENST00000393238	ensembl	human	known	74_37	missense	14.58	82	14	SNP	1.000	T
TMEM144	55314	genome.wustl.edu	37	4	159156622	159156622	+	Missense_Mutation	SNP	G	G	T	rs539307030	byFrequency	TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr4:159156622G>T	ENST00000296529.6	+	8	1048	c.528G>T	c.(526-528)tgG>tgT	p.W176C	TMEM144_ENST00000503404.1_3'UTR	NM_018342.4	NP_060812.2	Q7Z5S9	TM144_HUMAN	transmembrane protein 144	176						integral component of membrane (GO:0016021)		p.W176C(1)		autonomic_ganglia(1)|endometrium(1)|large_intestine(7)|lung(9)|prostate(1)	19	all_hematologic(180;0.24)	Renal(120;0.0854)		COAD - Colon adenocarcinoma(41;0.0539)		CCTGTTCCTGGGTGGATAAAC	0.383																																																	1	Substitution - Missense(1)	prostate(1)											147.0	132.0	137.0					4																	159156622		2203	4300	6503	SO:0001583	missense	0			AK002017	CCDS3799.1	4q32.1	2008-02-05			ENSG00000164124	ENSG00000164124			25633	protein-coding gene	gene with protein product						12477932	Standard	NM_018342		Approved	FLJ11155	uc003ipx.3	Q7Z5S9	OTTHUMG00000162013	ENST00000296529.6:c.528G>T	4.37:g.159156622G>T	ENSP00000296529:p.Trp176Cys		D3DP24|Q49A05|Q9NUT3	Missense_Mutation	SNP	pfam_DUF1632_TMEM144,pfam_Sugar_transport	p.W176C	ENST00000296529.6	37	c.528	CCDS3799.1	4	.	.	.	.	.	.	.	.	.	.	G	19.78	3.891141	0.72524	.	.	ENSG00000164124	ENST00000296529	T	0.41065	1.01	5.25	5.25	0.73442	.	0.000000	0.85682	D	0.000000	T	0.67458	0.2895	M	0.83483	2.645	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.68074	-0.5505	10	0.45353	T	0.12	-79.1375	16.6276	0.84975	0.0:0.0:1.0:0.0	.	176	Q7Z5S9	TM144_HUMAN	C	176	ENSP00000296529:W176C	ENSP00000296529:W176C	W	+	3	0	TMEM144	159376072	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	4.786000	0.62425	2.835000	0.97688	0.650000	0.86243	TGG	TMEM144	-	pfam_DUF1632_TMEM144	ENSG00000164124		0.383	TMEM144-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM144	HGNC	protein_coding	OTTHUMT00000365597.1		0.00	53	0	G	NM_018342		159156622	+1			no_errors	ENST00000296529	ensembl	human	known	74_37	missense	6.52	43	3	SNP	1.000	T
TMIGD1	388364	genome.wustl.edu	37	17	28656289	28656289	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr17:28656289G>A	ENST00000328886.4	-	3	413	c.341C>T	c.(340-342)tCg>tTg	p.S114L	TMIGD1_ENST00000538566.2_Missense_Mutation_p.S114L	NM_206832.1	NP_996663.1	Q6UXZ0	TMIG1_HUMAN	transmembrane and immunoglobulin domain containing 1	114	Ig-like C2-type 1.					integral component of membrane (GO:0016021)				breast(1)|kidney(3)|large_intestine(1)|lung(5)|skin(2)	12						CAGCACCACCGAAACGGACAC	0.463																																																	0													118.0	99.0	105.0					17																	28656289		2203	4300	6503	SO:0001583	missense	0			AY358153	CCDS32605.1	17q11.2	2013-01-29	2006-07-05	2006-07-05		ENSG00000182271		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	32431	protein-coding gene	gene with protein product				TMIGD		12975309	Standard	NM_206832		Approved	UNQ9372	uc002hfa.1	Q6UXZ0		ENST00000328886.4:c.341C>T	17.37:g.28656289G>A	ENSP00000332404:p.Ser114Leu		A8K2K1|Q6ZMC6	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.S114L	ENST00000328886.4	37	c.341	CCDS32605.1	17	.	.	.	.	.	.	.	.	.	.	G	17.06	3.293685	0.60086	.	.	ENSG00000182271	ENST00000328886;ENST00000538566	T;T	0.19938	2.11;2.11	5.48	5.48	0.80851	Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.130118	0.53938	D	0.000051	T	0.44644	0.1303	M	0.61703	1.905	0.42771	D	0.993831	D;D	0.76494	0.997;0.999	P;D	0.66351	0.766;0.943	T	0.34750	-0.9816	10	0.66056	D	0.02	-5.7294	18.3372	0.90293	0.0:0.0:1.0:0.0	.	114;114	Q6UXZ0-2;Q6UXZ0	.;TMIG1_HUMAN	L	114	ENSP00000332404:S114L;ENSP00000446118:S114L	ENSP00000332404:S114L	S	-	2	0	TMIGD1	25680415	1.000000	0.71417	0.621000	0.29145	0.098000	0.18820	6.398000	0.73244	2.582000	0.87167	0.579000	0.79373	TCG	TMIGD1	-	smart_Ig_sub,pfscan_Ig-like_dom	ENSG00000182271		0.463	TMIGD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMIGD1	HGNC	protein_coding	OTTHUMT00000447955.1	-	0.00	45	0	G	NM_206832		28656289	-1	tier1	-	no_errors	ENST00000328886	ensembl	human	known	74_37	missense	25.64	29	10	SNP	0.916	A
TNR	7143	genome.wustl.edu	37	1	175372316	175372316	+	Silent	SNP	G	G	A			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr1:175372316G>A	ENST00000367674.2	-	4	1644	c.936C>T	c.(934-936)tgC>tgT	p.C312C	TNR_ENST00000263525.2_Silent_p.C312C			Q92752	TENR_HUMAN	tenascin R	312	Cys-rich.|EGF-like 5.				associative learning (GO:0008306)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|locomotory exploration behavior (GO:0035641)|long-term synaptic potentiation (GO:0060291)|negative regulation of axon extension involved in regeneration (GO:0048692)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of synaptic transmission (GO:0050805)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transmission of nerve impulse (GO:0051971)|synapse organization (GO:0050808)|telencephalon cell migration (GO:0022029)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)				NS(3)|breast(7)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|lung(98)|ovary(4)|pancreas(5)|prostate(4)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	177	Renal(580;0.146)					CTTCACAGACGCAGAGCCCCT	0.607																																																	0													92.0	76.0	82.0					1																	175372316		2203	4300	6503	SO:0001819	synonymous_variant	0			X98085	CCDS1318.1	1q24	2013-02-11	2012-07-12		ENSG00000116147	ENSG00000116147		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11953	protein-coding gene	gene with protein product	"""restrictin"", ""janusin"""	601995				8626505, 8940128	Standard	NM_003285		Approved		uc009wwu.1	Q92752	OTTHUMG00000034876	ENST00000367674.2:c.936C>T	1.37:g.175372316G>A			C9J563|Q15568|Q5R3G0	Silent	SNP	pfam_Fibronectin_type3,pfam_Fibrinogen_a/b/g_C_dom,pfam_EGF_extracell,superfamily_Fibrinogen_a/b/g_C_dom,superfamily_Fibronectin_type3,smart_EG-like_dom,smart_Fibronectin_type3,smart_Fibrinogen_a/b/g_C_dom,pfscan_Fibronectin_type3	p.C312	ENST00000367674.2	37	c.936	CCDS1318.1	1																																																																																			TNR	-	pfam_EGF_extracell,smart_EG-like_dom	ENSG00000116147		0.607	TNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNR	HGNC	protein_coding	OTTHUMT00000084414.4	-	0.00	12	0	G	NM_003285		175372316	-1	tier1	-	no_errors	ENST00000263525	ensembl	human	known	74_37	silent	64.29	5	9	SNP	0.652	A
TNRC6A	27327	genome.wustl.edu	37	16	24802699	24802699	+	Missense_Mutation	SNP	A	A	T			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr16:24802699A>T	ENST00000395799.3	+	6	2865	c.2736A>T	c.(2734-2736)gaA>gaT	p.E912D	TNRC6A_ENST00000315183.7_Missense_Mutation_p.E912D	NM_014494.2	NP_055309.2	Q8NDV7	TNR6A_HUMAN	trinucleotide repeat containing 6A	912	Interaction with argonaute family proteins.|Sufficient for interaction with AGO1 and AGO4.				cellular response to starvation (GO:0009267)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|micro-ribonucleoprotein complex (GO:0035068)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(13)|kidney(5)|large_intestine(13)|liver(1)|lung(20)|ovary(3)|skin(2)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	64				GBM - Glioblastoma multiforme(48;0.0394)		GATGGGATGAATCTTCTAAAC	0.458																																																	0													74.0	73.0	73.0					16																	24802699		2197	4300	6497	SO:0001583	missense	0			U80739	CCDS10624.2	16p11.2	2009-09-22	2004-12-17	2004-12-17	ENSG00000090905	ENSG00000090905		"""Trinucleotide (CAG) repeat containing"""	11969	protein-coding gene	gene with protein product		610739	"""trinucleotide repeat containing 6"""	TNRC6		9225980	Standard	NM_014494		Approved	CAGH26, KIAA1460, GW182	uc002dmm.3	Q8NDV7	OTTHUMG00000096999	ENST00000395799.3:c.2736A>T	16.37:g.24802699A>T	ENSP00000379144:p.Glu912Asp		C9JAR8|O15408|Q658L5|Q6NVB5|Q8NEZ0|Q8TBT8|Q8TCR0|Q9NV59|Q9P268	Missense_Mutation	SNP	pfam_Argonaute_hook_dom,superfamily_UBA-like	p.E912D	ENST00000395799.3	37	c.2736	CCDS10624.2	16	.	.	.	.	.	.	.	.	.	.	A	12.29	1.893054	0.33442	.	.	ENSG00000090905	ENST00000315183;ENST00000395799	T;T	0.12672	2.66;2.67	5.62	2.0	0.26442	.	0.165805	0.52532	D	0.000062	T	0.06280	0.0162	N	0.12961	0.28	0.80722	D	1	B;B;B	0.12013	0.001;0.004;0.005	B;B;B	0.14578	0.002;0.011;0.003	T	0.35276	-0.9795	10	0.17369	T	0.5	-11.4414	5.6582	0.17654	0.6336:0.1353:0.2311:0.0	.	659;912;912	Q8NDV7-2;Q8NDV7-6;Q8NDV7	.;.;TNR6A_HUMAN	D	912	ENSP00000326900:E912D;ENSP00000379144:E912D	ENSP00000326900:E912D	E	+	3	2	TNRC6A	24710200	0.798000	0.28890	0.999000	0.59377	0.968000	0.65278	0.251000	0.18257	0.422000	0.26005	0.533000	0.62120	GAA	TNRC6A	-	NULL	ENSG00000090905		0.458	TNRC6A-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	TNRC6A	HGNC	protein_coding	OTTHUMT00000214081.1		0.00	16	0	A	NM_020847		24802699	+1			no_errors	ENST00000395799	ensembl	human	known	74_37	missense	18.75	13	3	SNP	0.995	T
TNRC6A	27327	genome.wustl.edu	37	16	24815534	24815534	+	Missense_Mutation	SNP	A	A	T	rs146427035	byFrequency	TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr16:24815534A>T	ENST00000395799.3	+	12	3860	c.3731A>T	c.(3730-3732)cAt>cTt	p.H1244L	CTD-2515A14.1_ENST00000568895.1_RNA|TNRC6A_ENST00000315183.7_Missense_Mutation_p.H1244L	NM_014494.2	NP_055309.2	Q8NDV7	TNR6A_HUMAN	trinucleotide repeat containing 6A	1244	Sufficient for interaction with AGO1 and AGO4.				cellular response to starvation (GO:0009267)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|micro-ribonucleoprotein complex (GO:0035068)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(13)|kidney(5)|large_intestine(13)|liver(1)|lung(20)|ovary(3)|skin(2)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	64				GBM - Glioblastoma multiforme(48;0.0394)		ATAGATAAACATAGCCTAAAT	0.403																																																	0													91.0	85.0	87.0					16																	24815534		2197	4300	6497	SO:0001583	missense	0			U80739	CCDS10624.2	16p11.2	2009-09-22	2004-12-17	2004-12-17	ENSG00000090905	ENSG00000090905		"""Trinucleotide (CAG) repeat containing"""	11969	protein-coding gene	gene with protein product		610739	"""trinucleotide repeat containing 6"""	TNRC6		9225980	Standard	NM_014494		Approved	CAGH26, KIAA1460, GW182	uc002dmm.3	Q8NDV7	OTTHUMG00000096999	ENST00000395799.3:c.3731A>T	16.37:g.24815534A>T	ENSP00000379144:p.His1244Leu		C9JAR8|O15408|Q658L5|Q6NVB5|Q8NEZ0|Q8TBT8|Q8TCR0|Q9NV59|Q9P268	Missense_Mutation	SNP	pfam_Argonaute_hook_dom,superfamily_UBA-like	p.H1244L	ENST00000395799.3	37	c.3731	CCDS10624.2	16	.	.	.	.	.	.	.	.	.	.	A	18.42	3.620490	0.66787	.	.	ENSG00000090905	ENST00000315183;ENST00000395799	T;T	0.12569	2.67;2.69	6.08	6.08	0.98989	UBA-like (1);	0.151017	0.52532	D	0.000064	T	0.12518	0.0304	N	0.19112	0.55	0.80722	D	1	P;P	0.44734	0.557;0.842	P;P	0.45343	0.447;0.477	T	0.08680	-1.0710	10	0.38643	T	0.18	-2.8395	12.4913	0.55901	0.8608:0.1392:0.0:0.0	.	1244;1244	Q8NDV7-6;Q8NDV7	.;TNR6A_HUMAN	L	1244	ENSP00000326900:H1244L;ENSP00000379144:H1244L	ENSP00000326900:H1244L	H	+	2	0	TNRC6A	24723035	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.926000	0.48892	2.333000	0.79357	0.482000	0.46254	CAT	TNRC6A	-	superfamily_UBA-like	ENSG00000090905		0.403	TNRC6A-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	TNRC6A	HGNC	protein_coding	OTTHUMT00000214081.1	-	0.00	21	0	A	NM_020847		24815534	+1	tier1	-	no_errors	ENST00000395799	ensembl	human	known	74_37	missense	38.71	19	12	SNP	1.000	T
TOX2	84969	genome.wustl.edu	37	20	42697596	42697596	+	3'UTR	SNP	C	C	A			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr20:42697596C>A	ENST00000358131.5	+	0	1945				TOX2_ENST00000435864.2_3'UTR|TOX2_ENST00000341197.4_3'UTR|TOX2_ENST00000372999.1_3'UTR	NM_001098798.1	NP_001092268.1	Q96NM4	TOX2_HUMAN	TOX high mobility group box family member 2						female gonad development (GO:0008585)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to gonadotropin (GO:0034698)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(13)|ovary(1)|skin(2)	26		Myeloproliferative disorder(115;0.00452)	COAD - Colon adenocarcinoma(18;0.00189)			CTGTCCTCGCCCTGCGCACGG	0.692																																																	0																																										SO:0001624	3_prime_UTR_variant	0			BC007636	CCDS13324.1, CCDS42875.1, CCDS46603.1	20q13.12	2007-03-20	2007-03-20	2007-03-20					16095	protein-coding gene	gene with protein product	"""granulosa cell HMG box 1"""	611163	"""chromosome 20 open reading frame 100"""	C20orf100		14764631	Standard	NM_001098796		Approved	dJ1108D11.2, GCX-1	uc010ggo.3	Q96NM4		ENST00000358131.5:c.*270C>A	20.37:g.42697596C>A			A8K1J1|E1P5X0|G3XAC7|Q5TE33|Q5TE34|Q5TE35|Q96IC9|Q9BQN5	RNA	SNP	-	NULL	ENST00000358131.5	37	NULL	CCDS42875.1	20																																																																																			TOX2	-	-	ENSG00000124191		0.692	TOX2-001	KNOWN	basic|CCDS	protein_coding	TOX2	HGNC	protein_coding	OTTHUMT00000079329.2	-	0.00	33	0	C			42697596	+1	tier1	-	no_errors	ENST00000435864	ensembl	human	known	74_37	rna	51.28	19	20	SNP	0.630	A
TP53	7157	genome.wustl.edu	37	17	7578370	7578370	+	Splice_Site	SNP	C	C	A			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr17:7578370C>A	ENST00000269305.4	-	5	749		c.e5+1		TP53_ENST00000420246.2_Splice_Site|TP53_ENST00000455263.2_Splice_Site|TP53_ENST00000359597.4_Splice_Site|TP53_ENST00000574684.1_Splice_Site|TP53_ENST00000413465.2_Splice_Site|TP53_ENST00000445888.2_Splice_Site	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53						apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.?(54)|p.0?(8)|p.G187fs*16(2)|p.D186_P191delDGLAPP(1)|p.L188fs*19(1)|p.G187_L188delGL(1)|p.G187fs*22(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CAGCTGCTCACCATCGCTATC	0.632		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	68	Unknown(54)|Whole gene deletion(8)|Deletion - Frameshift(3)|Deletion - In frame(2)|Insertion - Frameshift(1)	lung(12)|breast(9)|oesophagus(7)|ovary(7)|liver(7)|urinary_tract(5)|NS(5)|haematopoietic_and_lymphoid_tissue(4)|bone(4)|upper_aerodigestive_tract(2)|large_intestine(2)|central_nervous_system(2)|stomach(1)|soft_tissue(1)											48.0	46.0	47.0					17																	7578370		2203	4300	6503	SO:0001630	splice_region_variant	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.559+1G>T	17.37:g.7578370C>A			Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Splice_Site	SNP	-	e4+1	ENST00000269305.4	37	c.559+1	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	11.69	1.713974	0.30413	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	.	.	.	4.7	3.7	0.42460	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.0738	0.59075	0.0:0.8363:0.1637:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	TP53	7519095	1.000000	0.71417	0.967000	0.41034	0.201000	0.24016	3.085000	0.50151	1.248000	0.43934	0.655000	0.94253	.	TP53	-	-	ENSG00000141510		0.632	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	-	0.00	27	0	C	NM_000546	Intron	7578370	-1	tier1	-	no_errors	ENST00000269305	ensembl	human	known	74_37	splice_site	93.02	3	40	SNP	1.000	A
TP53BP1	7158	genome.wustl.edu	37	15	43748729	43748729	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr15:43748729G>T	ENST00000263801.3	-	12	2314	c.2062C>A	c.(2062-2064)Ccg>Acg	p.P688T	TP53BP1_ENST00000382039.3_Missense_Mutation_p.P693T|TP53BP1_ENST00000450115.2_Missense_Mutation_p.P693T|TP53BP1_ENST00000382044.4_Missense_Mutation_p.P693T|TP53BP1_ENST00000605155.1_5'Flank	NM_005657.2	NP_005648.1	Q12888	TP53B_HUMAN	tumor protein p53 binding protein 1	688					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|kinetochore (GO:0000776)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|replication fork (GO:0005657)	damaged DNA binding (GO:0003684)|methylated histone binding (GO:0035064)|p53 binding (GO:0002039)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II transcription cofactor activity (GO:0001104)|telomeric DNA binding (GO:0042162)	p.P688S(3)		breast(4)|endometrium(5)|kidney(7)|large_intestine(22)|lung(13)|ovary(4)|pancreas(2)|prostate(1)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(3)	72		all_cancers(109;6.94e-11)|all_epithelial(112;2.69e-09)|Lung NSC(122;7.86e-07)|all_lung(180;7.84e-06)|Melanoma(134;0.0728)		GBM - Glioblastoma multiforme(94;1.59e-06)		AGGTGCAACGGAACACTCTCC	0.453								Other conserved DNA damage response genes																																									3	Substitution - Missense(3)	skin(2)|lung(1)											108.0	111.0	110.0					15																	43748729		2201	4298	6499	SO:0001583	missense	0			U09477	CCDS10096.1, CCDS45250.1, CCDS45251.1	15q15-q21	2007-08-02	2007-08-02		ENSG00000067369	ENSG00000067369			11999	protein-coding gene	gene with protein product		605230	"""tumor protein p53-binding protein, 1"""			8016121, 9748285	Standard	NM_005657		Approved	53BP1, p202	uc001zrr.4	Q12888	OTTHUMG00000059757	ENST00000263801.3:c.2062C>A	15.37:g.43748729G>T	ENSP00000263801:p.Pro688Thr		F8VY86|Q2M1Z7|Q4LE46|Q5FWZ3|Q7Z3U4	Missense_Mutation	SNP	pfam_53-BP1_Tudor,superfamily_BRCT_dom,smart_BRCT_dom,pfscan_BRCT_dom	p.P693T	ENST00000263801.3	37	c.2077	CCDS10096.1	15	.	.	.	.	.	.	.	.	.	.	G	3.394	-0.123739	0.06795	.	.	ENSG00000067369	ENST00000263801;ENST00000382044;ENST00000382039;ENST00000450115;ENST00000413546	T;T;T;T;T	0.54279	0.58;0.58;0.58;0.58;0.58	4.94	0.882	0.19172	.	1.006500	0.07983	N	0.985927	T	0.31918	0.0812	N	0.19112	0.55	0.09310	N	1	B;B;B;B	0.09022	0.002;0.0;0.0;0.0	B;B;B;B	0.08055	0.003;0.001;0.002;0.002	T	0.21759	-1.0236	10	0.35671	T	0.21	0.0069	1.6473	0.02764	0.1856:0.1651:0.479:0.1703	.	693;688;693;693	B7Z3E7;Q12888;Q12888-2;F8VY86	.;TP53B_HUMAN;.;.	T	688;693;693;693;693	ENSP00000263801:P688T;ENSP00000371475:P693T;ENSP00000371470:P693T;ENSP00000393497:P693T;ENSP00000388028:P693T	ENSP00000263801:P688T	P	-	1	0	TP53BP1	41536021	0.096000	0.21769	0.004000	0.12327	0.435000	0.31806	1.087000	0.30865	0.220000	0.20860	0.563000	0.77884	CCG	TP53BP1	-	NULL	ENSG00000067369		0.453	TP53BP1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	TP53BP1	HGNC	protein_coding	OTTHUMT00000132897.3		0.00	27	0	G			43748729	-1			no_errors	ENST00000382044	ensembl	human	known	74_37	missense	5.71	33	2	SNP	0.003	T
TRAF7	84231	genome.wustl.edu	37	16	2225837	2225837	+	Silent	SNP	C	C	T			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr16:2225837C>T	ENST00000326181.6	+	18	1761	c.1629C>T	c.(1627-1629)atC>atT	p.I543I		NM_032271.2	NP_115647.2	Q6Q0C0	TRAF7_HUMAN	TNF receptor-associated factor 7, E3 ubiquitin protein ligase	543					activation of MAPKKK activity (GO:0000185)|apoptotic process (GO:0006915)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of MAPK cascade (GO:0043410)|protein ubiquitination (GO:0016567)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasmic vesicle (GO:0031410)|ubiquitin ligase complex (GO:0000151)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)|pancreas(1)|prostate(2)|skin(1)	23						ACTCATAGATCTGGGACATCC	0.612																																																	0													109.0	98.0	102.0					16																	2225837		2196	4300	6496	SO:0001819	synonymous_variant	0			AL136921	CCDS10461.1	16p13.3	2013-01-10	2012-02-23	2004-06-04	ENSG00000131653	ENSG00000131653		"""RING-type (C3HC4) zinc fingers"", ""WD repeat domain containing"""	20456	protein-coding gene	gene with protein product		606692	"""ring finger and WD repeat domain 1"", ""TNF receptor-associated factor 7"""	RFWD1		11230166, 15001576	Standard	NM_032271		Approved	RNF119, DKFZp586I021, MGC7807	uc002cow.3	Q6Q0C0	OTTHUMG00000128826	ENST00000326181.6:c.1629C>T	16.37:g.2225837C>T			Q9H073	Silent	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,superfamily_TRAF-like,smart_Znf_RING,smart_WD40_repeat,pfscan_Znf_RING,pfscan_Znf_TRAF,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.I543	ENST00000326181.6	37	c.1629	CCDS10461.1	16																																																																																			TRAF7	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000131653		0.612	TRAF7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRAF7	HGNC	protein_coding	OTTHUMT00000250762.1	-	0.00	20	0	C	NM_032271		2225837	+1	tier1	-	no_errors	ENST00000326181	ensembl	human	known	74_37	silent	38.71	19	12	SNP	1.000	T
UBE2L6	9246	genome.wustl.edu	37	11	57322082	57322082	+	Nonsense_Mutation	SNP	G	G	T			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr11:57322082G>T	ENST00000287156.4	-	3	333	c.138C>A	c.(136-138)taC>taA	p.Y46*	UBE2L6_ENST00000340573.4_5'UTR	NM_004223.4	NP_004214.1	O14933	UB2L6_HUMAN	ubiquitin-conjugating enzyme E2L 6	46					cellular protein modification process (GO:0006464)|cytokine-mediated signaling pathway (GO:0019221)|innate immune response (GO:0045087)|ISG15-protein conjugation (GO:0032020)|modification-dependent protein catabolic process (GO:0019941)|negative regulation of type I interferon production (GO:0032480)	cytosol (GO:0005829)	ISG15 ligase activity (GO:0042296)|ubiquitin-protein transferase activity (GO:0004842)			large_intestine(1)|lung(3)|ovary(1)	5						CTTTCAGGTGGTAGGGAGGTT	0.557																																																	0													118.0	113.0	115.0					11																	57322082		2201	4296	6497	SO:0001587	stop_gained	0			AF031141, AK093462, BC032491	CCDS7960.1, CCDS7961.1	11q12.1	2008-02-01			ENSG00000156587	ENSG00000156587		"""Ubiquitin-conjugating enzymes E2"""	12490	protein-coding gene	gene with protein product		603890				9153201	Standard	NM_004223		Approved	UBCH8	uc001nkn.2	O14933	OTTHUMG00000167047	ENST00000287156.4:c.138C>A	11.37:g.57322082G>T	ENSP00000287156:p.Tyr46*		A6NDM6|A8MY53|Q8N5D8|Q9UEZ0	Nonsense_Mutation	SNP	pfam_UBQ-conjugat_E2,pfam_RWD-domain,superfamily_UBQ-conjugating_enzyme/RWD,pfscan_UBQ-conjugat_E2	p.Y46*	ENST00000287156.4	37	c.138	CCDS7960.1	11	.	.	.	.	.	.	.	.	.	.	G	36	5.733292	0.96865	.	.	ENSG00000156587	ENST00000287156;ENST00000526659	.	.	.	6.06	3.17	0.36434	.	0.000000	0.51477	D	0.000081	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	8.3419	0.32249	0.3099:0.0:0.6901:0.0	.	.	.	.	X	46;53	.	ENSP00000287156:Y46X	Y	-	3	2	UBE2L6	57078658	0.981000	0.34729	0.975000	0.42487	0.962000	0.63368	0.405000	0.21015	0.435000	0.26365	0.655000	0.94253	TAC	UBE2L6	-	pfam_UBQ-conjugat_E2,pfam_RWD-domain,superfamily_UBQ-conjugating_enzyme/RWD,pfscan_UBQ-conjugat_E2	ENSG00000156587		0.557	UBE2L6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBE2L6	HGNC	protein_coding	OTTHUMT00000392657.1	-	0.00	106	0	G	NM_004223		57322082	-1	tier1	-	no_errors	ENST00000287156	ensembl	human	known	74_37	nonsense	33.33	64	32	SNP	1.000	T
UGGT1	56886	genome.wustl.edu	37	2	128872722	128872722	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr2:128872722C>T	ENST00000259253.6	+	7	768	c.721C>T	c.(721-723)Ctc>Ttc	p.L241F	UGGT1_ENST00000375990.3_Missense_Mutation_p.L217F	NM_020120.3	NP_064505.1	Q9NYU2	UGGG1_HUMAN	UDP-glucose glycoprotein glucosyltransferase 1	241					'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular vesicular exosome (GO:0070062)	UDP-glucose:glycoprotein glucosyltransferase activity (GO:0003980)|unfolded protein binding (GO:0051082)			NS(1)|breast(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(14)|lung(20)|ovary(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	63						GCCTGTTTACCTCTCTGGCTA	0.448																																																	0													106.0	95.0	98.0					2																	128872722		2203	4300	6503	SO:0001583	missense	0			AF227905	CCDS2154.1	2q14.3	2009-07-23	2009-07-23	2009-07-23	ENSG00000136731	ENSG00000136731			15663	protein-coding gene	gene with protein product		605897	"""UDP-glucose ceramide glucosyltransferase-like 1"""	UGCGL1		10694380	Standard	NM_020120		Approved	HUGT1	uc002tps.3	Q9NYU2	OTTHUMG00000131570	ENST00000259253.6:c.721C>T	2.37:g.128872722C>T	ENSP00000259253:p.Leu241Phe		Q53QP2|Q53SL3|Q8IW30|Q9H8I4	Missense_Mutation	SNP	pfam_UDP-g_GGtrans	p.L241F	ENST00000259253.6	37	c.721	CCDS2154.1	2	.	.	.	.	.	.	.	.	.	.	C	33	5.231156	0.95207	.	.	ENSG00000136731	ENST00000375990;ENST00000259253	T;T	0.23147	1.94;1.92	6.13	6.13	0.99165	.	0.000000	0.85682	D	0.000000	T	0.64405	0.2595	M	0.92691	3.335	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	T	0.69764	-0.5057	10	0.62326	D	0.03	.	20.8599	0.99761	0.0:1.0:0.0:0.0	.	217;241	Q9NYU2-2;Q9NYU2	.;UGGG1_HUMAN	F	217;241	ENSP00000365158:L217F;ENSP00000259253:L241F	ENSP00000259253:L241F	L	+	1	0	UGGT1	128589192	1.000000	0.71417	0.993000	0.49108	0.914000	0.54420	6.848000	0.75409	2.937000	0.99478	0.650000	0.86243	CTC	UGGT1	-	NULL	ENSG00000136731		0.448	UGGT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UGGT1	HGNC	protein_coding	OTTHUMT00000254435.2	-	0.00	61	0	C	NM_020120		128872722	+1	tier1	-	no_errors	ENST00000259253	ensembl	human	known	74_37	missense	53.52	33	38	SNP	1.000	T
ZNF134	7693	genome.wustl.edu	37	19	58131694	58131694	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr19:58131694G>T	ENST00000396161.5	+	3	517	c.207G>T	c.(205-207)caG>caT	p.Q69H	ZNF134_ENST00000597975.1_3'UTR	NM_003435.3	NP_003426.3	P52741	ZN134_HUMAN	zinc finger protein 134	69					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(3)|prostate(1)	11		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0265)		ATGAACACCAGGGTACACACC	0.473																																																	0													111.0	107.0	108.0					19																	58131694		2045	4224	6269	SO:0001583	missense	0			U09412	CCDS42638.1	19q13.4	2013-01-08	2006-06-13			ENSG00000213762		"""Zinc fingers, C2H2-type"""	12918	protein-coding gene	gene with protein product		604076	"""zinc finger protein 134 (clone pHZ-15)"""			7557990	Standard	NM_003435		Approved	pHZ-15	uc002qpn.2	P52741		ENST00000396161.5:c.207G>T	19.37:g.58131694G>T	ENSP00000379464:p.Gln69His		Q9Y4B2	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.Q69H	ENST00000396161.5	37	c.207	CCDS42638.1	19	.	.	.	.	.	.	.	.	.	.	G	18.92	3.725256	0.68959	.	.	ENSG00000213762	ENST00000418193;ENST00000396161	T	0.18502	2.21	3.83	-2.85	0.05734	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.16514	0.0397	M	0.79123	2.44	0.09310	N	1	B	0.10296	0.003	B	0.10450	0.005	T	0.41680	-0.9495	9	0.52906	T	0.07	.	1.2677	0.02014	0.2782:0.1391:0.4222:0.1605	.	69	P52741	ZN134_HUMAN	H	136;69	ENSP00000379464:Q69H	ENSP00000379464:Q69H	Q	+	3	2	ZNF134	62823506	0.000000	0.05858	0.000000	0.03702	0.930000	0.56654	-1.322000	0.02695	-0.535000	0.06307	-0.274000	0.10170	CAG	ZNF134	-	smart_Znf_C2H2-like	ENSG00000213762		0.473	ZNF134-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF134	HGNC	protein_coding	OTTHUMT00000466808.1	-	0.00	48	0	G	NM_003435		58131694	+1	tier1	-	no_errors	ENST00000396161	ensembl	human	known	74_37	missense	38.89	22	14	SNP	0.000	T
ZNF274	10782	genome.wustl.edu	37	19	58718140	58718140	+	Missense_Mutation	SNP	C	C	T	rs201074514		TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr19:58718140C>T	ENST00000326804.4	+	5	769	c.310C>T	c.(310-312)Ccc>Tcc	p.P104S	ZNF274_ENST00000424679.2_5'UTR|ZNF274_ENST00000345813.3_Missense_Mutation_p.P72S|ZNF274_ENST00000597818.1_3'UTR	NM_001278734.1|NM_133502.1	NP_001265663.1|NP_598009.1	Q96GC6	ZN274_HUMAN	zinc finger protein 274	104					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			breast(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(13)|ovary(1)|prostate(1)|skin(1)	21		Colorectal(82;5.46e-05)|all_neural(62;0.0182)|Ovarian(87;0.0443)|Breast(46;0.0889)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0168)|Lung(386;0.215)		TGCTGAGAGTCCCCTAATGAA	0.498																																																	0													26.0	28.0	28.0					19																	58718140		1961	4167	6128	SO:0001583	missense	0			AB029149	CCDS74473.1, CCDS74474.1, CCDS74475.1, CCDS74476.1	19q13.43	2013-01-09				ENSG00000171606		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	13068	protein-coding gene	gene with protein product		605467				10777669	Standard	NM_133502		Approved	ZKSCAN19, ZSCAN51	uc002qrs.1	Q96GC6		ENST00000326804.4:c.310C>T	19.37:g.58718140C>T	ENSP00000321209:p.Pro104Ser		Q53XU4|Q6MZG1|Q8WY37|Q8WY38|Q92969|Q9UII0|Q9UII1	Missense_Mutation	SNP	pfam_Krueppel-associated_box,pfam_Tscrpt_reg_SCAN,pfam_Znf_C2H2,superfamily_Retrov_capsid_C,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box,pfscan_Tscrpt_reg_SCAN	p.P104S	ENST00000326804.4	37	c.310		19	.	.	.	.	.	.	.	.	.	.	C	15.80	2.939763	0.52972	.	.	ENSG00000171606	ENST00000326804;ENST00000345813	T;T	0.06371	3.34;3.31	3.74	3.74	0.42951	.	0.462814	0.16136	N	0.227945	T	0.16896	0.0406	L	0.59436	1.845	0.53688	D	0.999974	D;D	0.61080	0.989;0.982	P;P	0.61132	0.884;0.769	T	0.00317	-1.1822	10	0.56958	D	0.05	-12.0344	11.3464	0.49563	0.0:1.0:0.0:0.0	.	72;104	Q96GC6-2;Q96GC6	.;ZN274_HUMAN	S	104;72	ENSP00000321209:P104S;ENSP00000321187:P72S	ENSP00000321209:P104S	P	+	1	0	ZNF274	63409952	0.506000	0.26139	0.222000	0.23844	0.920000	0.55202	1.958000	0.40402	2.394000	0.81467	0.462000	0.41574	CCC	ZNF274	-	NULL	ENSG00000171606		0.498	ZNF274-201	KNOWN	basic|appris_candidate_longest	protein_coding	ZNF274	HGNC	protein_coding		-	0.00	64	0	C	NM_133502		58718140	+1	tier1	-	no_errors	ENST00000326804	ensembl	human	known	74_37	missense	51.52	31	34	SNP	0.229	T
ZNF385D	79750	genome.wustl.edu	37	3	21552422	21552422	+	Missense_Mutation	SNP	T	T	C			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr3:21552422T>C	ENST00000281523.2	-	4	888	c.370A>G	c.(370-372)Aag>Gag	p.K124E	ZNF385D_ENST00000494118.1_5'UTR	NM_024697.2	NP_078973.1	Q9H6B1	Z385D_HUMAN	zinc finger protein 385D	124						nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			NS(2)|breast(2)|endometrium(3)|kidney(2)|large_intestine(13)|lung(18)|ovary(1)|prostate(1)|skin(4)	46						GCGCTGTCCTTGGCAGTTACA	0.453																																																	0													373.0	302.0	326.0					3																	21552422		2203	4300	6503	SO:0001583	missense	0			BC007212	CCDS2636.1	3p24.3	2012-10-05	2007-12-06	2007-12-06	ENSG00000151789	ENSG00000151789			26191	protein-coding gene	gene with protein product			"""zinc finger protein 659"""	ZNF659		12477932	Standard	NM_024697		Approved	FLJ22419	uc003cce.3	Q9H6B1	OTTHUMG00000130484	ENST00000281523.2:c.370A>G	3.37:g.21552422T>C	ENSP00000281523:p.Lys124Glu			Missense_Mutation	SNP	pfam_Znf_C2H2_jaz,smart_Znf_U1,smart_Znf_C2H2-like	p.K124E	ENST00000281523.2	37	c.370	CCDS2636.1	3	.	.	.	.	.	.	.	.	.	.	t	12.31	1.898187	0.33535	.	.	ENSG00000151789	ENST00000281523	T	0.31247	1.5	5.56	5.56	0.83823	.	0.138597	0.47455	D	0.000236	T	0.22936	0.0554	L	0.29908	0.895	0.32674	N	0.516386	P	0.38827	0.649	B	0.33042	0.157	T	0.27191	-1.0081	10	0.35671	T	0.21	-20.9528	15.7269	0.77766	0.0:0.0:0.0:1.0	.	124	Q9H6B1	Z385D_HUMAN	E	124	ENSP00000281523:K124E	ENSP00000281523:K124E	K	-	1	0	ZNF385D	21527426	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	3.878000	0.56130	2.114000	0.64651	0.524000	0.50904	AAG	ZNF385D	-	NULL	ENSG00000151789		0.453	ZNF385D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF385D	HGNC	protein_coding	OTTHUMT00000252884.1	-	0.00	153	0	T	NM_024697		21552422	-1	tier1	-	no_errors	ENST00000281523	ensembl	human	known	74_37	missense	31.87	62	29	SNP	1.000	C
ZNF394	84124	genome.wustl.edu	37	7	99091249	99091249	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr7:99091249C>G	ENST00000337673.6	-	3	1792	c.1589G>C	c.(1588-1590)tGt>tCt	p.C530S	ZNF789_ENST00000494186.1_Intron|ZNF789_ENST00000493485.1_Intron|ZNF394_ENST00000426306.2_3'UTR|ZNF394_ENST00000394177.3_5'Flank	NM_032164.2	NP_115540.2	Q53GI3	ZN394_HUMAN	zinc finger protein 394	530					transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|liver(1)|lung(5)|stomach(1)|urinary_tract(1)	16	all_cancers(62;2.54e-08)|all_epithelial(64;2.55e-09)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)					TCTTTCCCCACATTCAAGACA	0.448																																					Ovarian(24;589 697 9939 12704 40742)												0													182.0	177.0	178.0					7																	99091249		2203	4300	6503	SO:0001583	missense	0			BC025241	CCDS5666.1	7q22.1	2014-01-28			ENSG00000160908	ENSG00000160908		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	18832	protein-coding gene	gene with protein product							Standard	NM_032164		Approved	ZKSCAN14, FLJ12298, ZSCAN46	uc003uqs.3	Q53GI3	OTTHUMG00000154660	ENST00000337673.6:c.1589G>C	7.37:g.99091249C>G	ENSP00000337363:p.Cys530Ser		A4D281|Q05DA6|Q6P5X9|Q8TB27|Q9HA37|Q9UD51	Missense_Mutation	SNP	pfam_Tscrpt_reg_SCAN,pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Retrov_capsid_C,superfamily_Krueppel-associated_box,smart_Tscrpt_reg_SCAN,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box,pfscan_Tscrpt_reg_SCAN	p.C530S	ENST00000337673.6	37	c.1589	CCDS5666.1	7	.	.	.	.	.	.	.	.	.	.	C	20.7	4.031116	0.75504	.	.	ENSG00000160908	ENST00000337673	D	0.85861	-2.04	3.58	3.58	0.41010	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.51477	D	0.000094	D	0.93877	0.8041	H	0.94582	3.555	0.80722	D	1	D	0.76494	0.999	D	0.83275	0.996	D	0.95096	0.8226	10	0.87932	D	0	.	13.493	0.61407	0.0:1.0:0.0:0.0	.	530	Q53GI3	ZN394_HUMAN	S	530	ENSP00000337363:C530S	ENSP00000337363:C530S	C	-	2	0	ZNF394	98929185	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.638000	0.67861	2.292000	0.77174	0.655000	0.94253	TGT	ZNF394	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000160908		0.448	ZNF394-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF394	HGNC	protein_coding	OTTHUMT00000336498.1	-	0.00	71	0	C	NM_032164		99091249	-1	tier1	-	no_errors	ENST00000337673	ensembl	human	known	74_37	missense	53.68	44	51	SNP	1.000	G
ZNF99	7652	genome.wustl.edu	37	19	22940554	22940554	+	Silent	SNP	A	A	G	rs12980594		TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr19:22940554A>G	ENST00000596209.1	-	4	2247	c.2157T>C	c.(2155-2157)acT>acC	p.T719T	ZNF99_ENST00000397104.3_Silent_p.T628T|CTC-451A6.4_ENST00000442497.2_lincRNA	NM_001080409.2	NP_001073878.2	A8MXY4	ZNF99_HUMAN	zinc finger protein 99	719					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.T628T(2)		NS(1)|breast(1)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(20)|lung(55)|ovary(2)|prostate(10)|skin(5)|stomach(9)|upper_aerodigestive_tract(2)|urinary_tract(3)	124		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.102)				GTTTTCTAAGAGTTGAGGACT	0.363																																																	2	Substitution - coding silent(2)	prostate(2)											41.0	43.0	43.0					19																	22940554		2080	4217	6297	SO:0001819	synonymous_variant	0			BC021822	CCDS59369.1	19p12	2013-01-08	2006-01-17		ENSG00000213973	ENSG00000213973		"""Zinc fingers, C2H2-type"", ""-"""	13175	protein-coding gene	gene with protein product		603981	"""zinc finger protein 99 (F8281)"", ""chromosome 19 open reading frame 9"""	C19orf9			Standard	NM_001080409		Approved	MGC24986	uc021urt.1	A8MXY4		ENST00000596209.1:c.2157T>C	19.37:g.22940554A>G			M0R335	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.T628	ENST00000596209.1	37	c.1884	CCDS59369.1	19																																																																																			ZNF99	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000213973		0.363	ZNF99-001	NOVEL	not_best_in_genome_evidence|basic|CCDS	protein_coding	ZNF99	HGNC	protein_coding	OTTHUMT00000464591.1		0.00	24	0	A	XM_065124		22940554	-1			no_errors	ENST00000397104	ensembl	human	known	74_37	silent	6.45	29	2	SNP	0.001	G
ZNF543	125919	genome.wustl.edu	37	19	57839161	57839161	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A49R-01A-11D-A247-09	TCGA-LN-A49R-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7974aaf3-a7cb-40eb-8732-050581665d20	64b8eb74-7f4f-4df6-83c4-84fa94ee7f32	g.chr19:57839161G>A	ENST00000321545.4	+	4	676	c.331G>A	c.(331-333)Gga>Aga	p.G111R		NM_213598.3	NP_998763.2	Q08ER8	ZN543_HUMAN	zinc finger protein 543	111					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|kidney(2)|large_intestine(8)|lung(11)|pancreas(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	28		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0257)		ACTGACACAAGGAGCCTCAAA	0.512																																																	0													69.0	70.0	70.0					19																	57839161		2203	4300	6503	SO:0001583	missense	0			AL834534	CCDS33130.1	19q13.43	2013-01-08				ENSG00000178229		"""Zinc fingers, C2H2-type"", ""-"""	25281	protein-coding gene	gene with protein product							Standard	NM_213598		Approved	DKFZp434H055	uc002qoi.2	Q08ER8		ENST00000321545.4:c.331G>A	19.37:g.57839161G>A	ENSP00000322545:p.Gly111Arg		Q495U9|Q495V0|Q6ZMP4|Q8NCX4	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.G111R	ENST00000321545.4	37	c.331	CCDS33130.1	19	.	.	.	.	.	.	.	.	.	.	G	2.330	-0.353608	0.05173	.	.	ENSG00000178229	ENST00000321545	T	0.34275	1.37	2.87	-0.694	0.11294	.	.	.	.	.	T	0.14570	0.0352	N	0.05230	-0.09	0.09310	N	1	B	0.15141	0.012	B	0.13407	0.009	T	0.26258	-1.0108	9	0.23891	T	0.37	.	4.3987	0.11376	0.2678:0.2246:0.5076:0.0	.	111	Q08ER8	ZN543_HUMAN	R	111	ENSP00000322545:G111R	ENSP00000322545:G111R	G	+	1	0	ZNF543	62530973	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	-0.763000	0.04740	-0.174000	0.10743	0.555000	0.69702	GGA	ZNF543	-	NULL	ENSG00000178229		0.512	ZNF543-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF543	HGNC	protein_coding	OTTHUMT00000465780.1	-	0.00	37	0	G	XM_064865		57839161	+1	tier1	-	no_errors	ENST00000321545	ensembl	human	known	74_37	missense	27.59	21	8	SNP	0.000	A
