#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name	i_deletion_substructures	i_domain	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_header	i_normal_VAF	i_normal_ref_reads	i_normal_var_reads	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_tier	i_title	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_VAF	i_tumor_ref_reads	i_tumor_var_reads	i_type	i_ucsc_cons	i_variant
ACTBL2	345651	genome.wustl.edu	37	5	56777529	56777529	+	Silent	SNP	G	G	T			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr5:56777529G>T	ENST00000423391.1	-	1	1107	c.1006C>A	c.(1006-1008)Cgg>Agg	p.R336R	AC025470.1_ENST00000584598.1_RNA|CTD-2023N9.1_ENST00000506106.1_RNA	NM_001017992.3	NP_001017992.1	Q562R1	ACTBL_HUMAN	actin, beta-like 2	336						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)			breast(2)|endometrium(1)|kidney(2)|large_intestine(10)|lung(7)|ovary(3)|pancreas(1)|prostate(2)	28		Lung NSC(810;0.000135)|Prostate(74;0.055)|Breast(144;0.0707)|Ovarian(174;0.182)		OV - Ovarian serous cystadenocarcinoma(10;4.24e-37)		GAATACTTCCGCTCTGGGGGA	0.517																																																	0													90.0	89.0	89.0					5																	56777529		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS34163.1	5q11.2	2014-08-08			ENSG00000169067	ENSG00000169067			17780	protein-coding gene	gene with protein product		614835					Standard	NM_001017992		Approved	DKFZp686D0972	uc003jrm.3	Q562R1	OTTHUMG00000162330	ENST00000423391.1:c.1006C>A	5.37:g.56777529G>T			B2RPJ1|Q562R2|Q562S9|Q562X8	Silent	SNP	pfam_Actin-related,smart_Actin-related,prints_Actin-related	p.R336	ENST00000423391.1	37	c.1006	CCDS34163.1	5																																																																																			ACTBL2	-	pfam_Actin-related,smart_Actin-related	ENSG00000169067		0.517	ACTBL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACTBL2	HGNC	protein_coding	OTTHUMT00000368579.1		0.00	79	0	G	NM_001017992		56777529	-1			no_errors	ENST00000423391	ensembl	human	known	74_37	silent	5.17	55	3	SNP	1.000	T
ADIPOR1	51094	genome.wustl.edu	37	1	202913041	202913041	+	Missense_Mutation	SNP	A	A	G			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr1:202913041A>G	ENST00000340990.5	-	6	948	c.650T>C	c.(649-651)aTg>aCg	p.M217T	ADIPOR1_ENST00000367254.3_Intron|ADIPOR1_ENST00000436244.1_Missense_Mutation_p.M217T	NM_015999.4	NP_057083.2	Q96A54	ADR1_HUMAN	adiponectin receptor 1	217					adiponectin-activated signaling pathway (GO:0033211)|fatty acid oxidation (GO:0019395)|hormone-mediated signaling pathway (GO:0009755)|leptin-mediated signaling pathway (GO:0033210)|negative regulation of cell growth (GO:0030308)|positive regulation of insulin receptor signaling pathway (GO:0046628)|positive regulation of JAK-STAT cascade (GO:0046427)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	hormone binding (GO:0042562)|protein kinase binding (GO:0019901)|receptor activity (GO:0004872)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(7)|prostate(2)|skin(1)	16			BRCA - Breast invasive adenocarcinoma(75;0.141)			AAAGCTCCCCATAATTAGAAG	0.453																																																	0													54.0	51.0	52.0					1																	202913041		2203	4300	6503	SO:0001583	missense	0				CCDS1430.1	1q32.1	2012-08-22			ENSG00000159346	ENSG00000159346		"""GPCR / Unclassified : Adiponectin receptors"""	24040	protein-coding gene	gene with protein product		607945				12802337	Standard	XM_006711360		Approved	PAQR1, ACDCR1	uc001gyq.5	Q96A54	OTTHUMG00000041391	ENST00000340990.5:c.650T>C	1.37:g.202913041A>G	ENSP00000341785:p.Met217Thr		B3KMB0|Q53HS7|Q53YY6|Q9Y360	Missense_Mutation	SNP	pfam_HlyIII-related	p.M217T	ENST00000340990.5	37	c.650	CCDS1430.1	1	.	.	.	.	.	.	.	.	.	.	A	23.5	4.419514	0.83559	.	.	ENSG00000159346	ENST00000340990;ENST00000436244;ENST00000417068	T;T;T	0.27402	1.67;1.67;1.67	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	T	0.28995	0.0720	N	0.25201	0.72	0.80722	D	1	B	0.32968	0.392	B	0.41174	0.349	T	0.08493	-1.0719	10	0.29301	T	0.29	.	15.6462	0.77055	1.0:0.0:0.0:0.0	.	217	Q96A54	ADR1_HUMAN	T	217	ENSP00000341785:M217T;ENSP00000395469:M217T;ENSP00000402178:M217T	ENSP00000341785:M217T	M	-	2	0	ADIPOR1	201179664	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.324000	0.96373	2.371000	0.80710	0.533000	0.62120	ATG	ADIPOR1	-	pfam_HlyIII-related	ENSG00000159346		0.453	ADIPOR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADIPOR1	HGNC	protein_coding	OTTHUMT00000099160.2	-	0.00	31	0	A	NM_015999		202913041	-1	tier1	-	no_errors	ENST00000340990	ensembl	human	known	74_37	missense	12.50	28	4	SNP	1.000	G
ADIPOR1	51094	genome.wustl.edu	37	1	202915710	202915710	+	Missense_Mutation	SNP	G	G	T	rs141511034		TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr1:202915710G>T	ENST00000340990.5	-	4	585	c.287C>A	c.(286-288)cCa>cAa	p.P96Q	ADIPOR1_ENST00000367254.3_Missense_Mutation_p.P96Q|ADIPOR1_ENST00000436244.1_Missense_Mutation_p.P96Q	NM_015999.4	NP_057083.2	Q96A54	ADR1_HUMAN	adiponectin receptor 1	96					adiponectin-activated signaling pathway (GO:0033211)|fatty acid oxidation (GO:0019395)|hormone-mediated signaling pathway (GO:0009755)|leptin-mediated signaling pathway (GO:0033210)|negative regulation of cell growth (GO:0030308)|positive regulation of insulin receptor signaling pathway (GO:0046628)|positive regulation of JAK-STAT cascade (GO:0046427)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	hormone binding (GO:0042562)|protein kinase binding (GO:0019901)|receptor activity (GO:0004872)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(7)|prostate(2)|skin(1)	16			BRCA - Breast invasive adenocarcinoma(75;0.141)			CACATCATATGGGATGACCCT	0.507																																																	0													199.0	149.0	166.0					1																	202915710		2203	4300	6503	SO:0001583	missense	0				CCDS1430.1	1q32.1	2012-08-22			ENSG00000159346	ENSG00000159346		"""GPCR / Unclassified : Adiponectin receptors"""	24040	protein-coding gene	gene with protein product		607945				12802337	Standard	XM_006711360		Approved	PAQR1, ACDCR1	uc001gyq.5	Q96A54	OTTHUMG00000041391	ENST00000340990.5:c.287C>A	1.37:g.202915710G>T	ENSP00000341785:p.Pro96Gln		B3KMB0|Q53HS7|Q53YY6|Q9Y360	Missense_Mutation	SNP	pfam_HlyIII-related	p.P96Q	ENST00000340990.5	37	c.287	CCDS1430.1	1	.	.	.	.	.	.	.	.	.	.	G	16.58	3.164070	0.57476	.	.	ENSG00000159346	ENST00000340990;ENST00000436244;ENST00000417068;ENST00000367254;ENST00000426229	D;D;D;D;D	0.96396	-4.0;-4.0;-4.0;-4.0;-4.0	6.17	5.25	0.73442	.	0.000000	0.85682	D	0.000000	D	0.93631	0.7966	L	0.52011	1.625	0.80722	D	1	B	0.17268	0.021	B	0.20577	0.03	D	0.89231	0.3577	10	0.13470	T	0.59	.	14.7679	0.69654	0.0707:0.0:0.9293:0.0	.	96	Q96A54	ADR1_HUMAN	Q	96	ENSP00000341785:P96Q;ENSP00000395469:P96Q;ENSP00000402178:P96Q;ENSP00000356223:P96Q;ENSP00000392946:P96Q	ENSP00000341785:P96Q	P	-	2	0	ADIPOR1	201182333	1.000000	0.71417	0.982000	0.44146	0.998000	0.95712	7.997000	0.88414	2.941000	0.99782	0.655000	0.94253	CCA	ADIPOR1	-	NULL	ENSG00000159346		0.507	ADIPOR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADIPOR1	HGNC	protein_coding	OTTHUMT00000099160.2		0.00	56	0	G	NM_015999		202915710	-1			no_errors	ENST00000340990	ensembl	human	known	74_37	missense	5.36	53	3	SNP	1.000	T
AHCTF1	25909	genome.wustl.edu	37	1	247030980	247030980	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr1:247030980G>T	ENST00000391829.2	-	25	3345	c.3222C>A	c.(3220-3222)agC>agA	p.S1074R	AHCTF1_ENST00000326225.3_Missense_Mutation_p.S1083R|AHCTF1_ENST00000366508.1_Missense_Mutation_p.S1109R|AHCTF1_ENST00000470300.1_5'UTR			Q8WYP5	ELYS_HUMAN	AT hook containing transcription factor 1	1074	Disordered. {ECO:0000250}.				cytokinesis (GO:0000910)|mitotic cell cycle (GO:0000278)|mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|protein transport (GO:0015031)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|kinetochore (GO:0000776)|nuclear matrix (GO:0016363)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(6)|cervix(3)|endometrium(8)|kidney(6)|large_intestine(12)|liver(2)|lung(21)|ovary(5)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	74	all_cancers(71;3.05e-05)|all_epithelial(71;6.72e-06)|Ovarian(71;0.0173)|Breast(184;0.0318)|all_lung(81;0.0458)|Lung NSC(105;0.0518)	all_cancers(173;0.0266)	OV - Ovarian serous cystadenocarcinoma(106;0.00271)			AAGGTGTGGTGCTATTTATAG	0.373																																					Colon(145;197 1800 4745 15099 26333)												0													157.0	145.0	149.0					1																	247030980		2203	4300	6503	SO:0001583	missense	0				CCDS1629.1, CCDS1629.2	1q44	2008-09-09			ENSG00000153207	ENSG00000153207			24618	protein-coding gene	gene with protein product	"""ELYS transcription factor like protein TMBS62"""	610853				11952839	Standard	NM_015446		Approved	ELYS	uc001ibv.2	Q8WYP5	OTTHUMG00000040706	ENST00000391829.2:c.3222C>A	1.37:g.247030980G>T	ENSP00000375705:p.Ser1074Arg		A6NGM0|A8MSG9|A8MZ86|Q7Z4E3|Q8IZA4|Q96EH9|Q9Y4Q6	Missense_Mutation	SNP	superfamily_Quinonprotein_ADH-like_supfam	p.S1083R	ENST00000391829.2	37	c.3249		1	.	.	.	.	.	.	.	.	.	.	G	2.451	-0.326260	0.05350	.	.	ENSG00000153207	ENST00000366508;ENST00000326225;ENST00000391829	T;T;T	0.78481	-1.18;-1.18;-1.18	4.65	0.669	0.17918	.	0.853434	0.10797	N	0.633137	T	0.63920	0.2552	L	0.47716	1.5	0.09310	N	1	B;B	0.33583	0.418;0.346	B;B	0.30943	0.122;0.049	T	0.47355	-0.9124	10	0.21014	T	0.42	-2.0E-4	3.8144	0.08809	0.4202:0.0:0.3193:0.2605	.	1109;1074	Q8WYP5-2;Q8WYP5	.;ELYS_HUMAN	R	1109;1083;1074	ENSP00000355464:S1109R;ENSP00000355465:S1083R;ENSP00000375705:S1074R	ENSP00000355465:S1083R	S	-	3	2	AHCTF1	245097603	0.002000	0.14202	0.000000	0.03702	0.003000	0.03518	1.353000	0.34045	-0.060000	0.13132	-0.384000	0.06662	AGC	AHCTF1	-	NULL	ENSG00000153207		0.373	AHCTF1-201	KNOWN	basic|appris_candidate	protein_coding	AHCTF1	HGNC	protein_coding		-	0.00	66	0	G	NM_015446		247030980	-1	tier1	-	no_errors	ENST00000326225	ensembl	human	known	74_37	missense	5.26	72	4	SNP	0.000	T
AHNAK2	113146	genome.wustl.edu	37	14	105404775	105404775	+	Silent	SNP	T	T	C			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr14:105404775T>C	ENST00000333244.5	-	7	17132	c.17013A>G	c.(17011-17013)agA>agG	p.R5671R	AHNAK2_ENST00000557457.1_Silent_p.R669R	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	5671						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)				cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			TGGGAGCAGATCTCTGGACGT	0.458																																																	0													62.0	56.0	58.0					14																	105404775		1907	4126	6033	SO:0001819	synonymous_variant	0			AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.17013A>G	14.37:g.105404775T>C			Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Silent	SNP	superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.R5671	ENST00000333244.5	37	c.17013	CCDS45177.1	14																																																																																			AHNAK2	-	NULL	ENSG00000185567		0.458	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AHNAK2	HGNC	protein_coding	OTTHUMT00000410300.1	-	0.00	93	0	T	NM_138420		105404775	-1	tier1	-	no_errors	ENST00000333244	ensembl	human	known	74_37	silent	20.88	72	19	SNP	0.000	C
AKR1A1	10327	genome.wustl.edu	37	1	46035590	46035590	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr1:46035590G>T	ENST00000372070.3	+	10	1687	c.940G>T	c.(940-942)Gca>Tca	p.A314S	AKR1A1_ENST00000473038.1_3'UTR|AKR1A1_ENST00000351829.4_Missense_Mutation_p.A314S	NM_001202413.1|NM_001202414.1|NM_006066.3	NP_001189342.1|NP_001189343.1|NP_006057.1	P14550	AK1A1_HUMAN	aldo-keto reductase family 1, member A1 (aldehyde reductase)	314					aldehyde catabolic process (GO:0046185)|cellular aldehyde metabolic process (GO:0006081)|D-glucuronate catabolic process (GO:0042840)|glucose metabolic process (GO:0006006)|L-ascorbic acid biosynthetic process (GO:0019853)	apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	alditol:NADP+ 1-oxidoreductase activity (GO:0004032)|electron carrier activity (GO:0009055)|L-glucuronate reductase activity (GO:0047939)			lung(3)|prostate(1)|urinary_tract(1)	5	Acute lymphoblastic leukemia(166;0.155)				Doxorubicin(DB00997)	CCCAAGGGATGCAGGGCATCC	0.527											OREG0013453	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													119.0	101.0	107.0					1																	46035590		2203	4300	6503	SO:0001583	missense	0			J04794	CCDS523.1	1p33-p32	2010-04-08			ENSG00000117448	ENSG00000117448	1.1.1.2	"""Aldo-keto reductases"""	380	protein-coding gene	gene with protein product	"""dihydrodiol dehydrogenase 3"""	103830				2498333, 10393438	Standard	NM_001202414		Approved	ALR, DD3	uc001coe.3	P14550	OTTHUMG00000007740	ENST00000372070.3:c.940G>T	1.37:g.46035590G>T	ENSP00000361140:p.Ala314Ser	936	A8KAL8|D3DQ04|Q6IAZ4	Missense_Mutation	SNP	pfam_NADP_OxRdtase_dom,superfamily_NADP_OxRdtase_dom,prints_Aldo/keto_reductase_subgr	p.A314S	ENST00000372070.3	37	c.940	CCDS523.1	1	.	.	.	.	.	.	.	.	.	.	G	19.75	3.884948	0.72410	.	.	ENSG00000117448	ENST00000372070;ENST00000351829	T;T	0.32023	1.47;1.47	5.72	5.72	0.89469	NADP-dependent oxidoreductase domain (1);	0.046333	0.85682	D	0.000000	T	0.24547	0.0595	N	0.19112	0.55	0.80722	D	1	B	0.20887	0.049	B	0.22152	0.038	T	0.04128	-1.0975	10	0.23891	T	0.37	.	19.9183	0.97074	0.0:0.0:1.0:0.0	.	314	P14550	AK1A1_HUMAN	S	314	ENSP00000361140:A314S;ENSP00000312606:A314S	ENSP00000312606:A314S	A	+	1	0	AKR1A1	45808177	1.000000	0.71417	0.995000	0.50966	0.998000	0.95712	9.379000	0.97198	2.875000	0.98604	0.644000	0.83932	GCA	AKR1A1	-	superfamily_NADP_OxRdtase_dom	ENSG00000117448		0.527	AKR1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AKR1A1	HGNC	protein_coding	OTTHUMT00000020851.1	-	0.00	43	0	G	NM_006066		46035590	+1	tier1	-	no_errors	ENST00000351829	ensembl	human	known	74_37	missense	18.18	27	6	SNP	1.000	T
ANK3	288	genome.wustl.edu	37	10	61932103	61932103	+	Missense_Mutation	SNP	G	G	A	rs374740918		TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr10:61932103G>A	ENST00000280772.2	-	21	2632	c.2441C>T	c.(2440-2442)aCc>aTc	p.T814I	ANK3_ENST00000373827.2_Missense_Mutation_p.T808I|ANK3_ENST00000503366.1_Missense_Mutation_p.T797I	NM_020987.3	NP_066267.2	Q12955	ANK3_HUMAN	ankyrin 3, node of Ranvier (ankyrin G)	814					axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization (GO:0045184)|Golgi to plasma membrane protein transport (GO:0043001)|maintenance of protein location in plasma membrane (GO:0072660)|membrane assembly (GO:0071709)|mitotic cytokinesis (GO:0000281)|neuromuscular junction development (GO:0007528)|neuronal action potential (GO:0019228)|plasma membrane organization (GO:0007009)|positive regulation of cell communication by electrical coupling (GO:0010650)|positive regulation of gene expression (GO:0010628)|positive regulation of homotypic cell-cell adhesion (GO:0034112)|positive regulation of membrane depolarization during cardiac muscle cell action potential (GO:1900827)|positive regulation of membrane potential (GO:0045838)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)|protein localization to plasma membrane (GO:0072659)|protein targeting to plasma membrane (GO:0072661)|regulation of potassium ion transport (GO:0043266)|signal transduction (GO:0007165)	axon initial segment (GO:0043194)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|costamere (GO:0043034)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|lysosome (GO:0005764)|neuromuscular junction (GO:0031594)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|T-tubule (GO:0030315)|Z disc (GO:0030018)	cadherin binding (GO:0045296)|cytoskeletal protein binding (GO:0008092)|ion channel binding (GO:0044325)|protein binding, bridging (GO:0030674)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)	p.T475I(1)|p.T814I(1)		NS(4)|breast(7)|central_nervous_system(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(5)|kidney(14)|large_intestine(30)|liver(2)|lung(59)|ovary(8)|pancreas(2)|prostate(5)|skin(26)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	196						TATCTTCAGGGTGTCCACTAC	0.488																																																	2	Substitution - Missense(2)	lung(2)						G	ILE/THR,ILE/THR,ILE/THR	1,4405	2.1+/-5.4	0,1,2202	132.0	123.0	126.0		2423,2390,2441	5.8	1.0	10		126	0,8600		0,0,4300	no	missense,missense,missense	ANK3	NM_001204403.1,NM_001204404.1,NM_020987.3	89,89,89	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	possibly-damaging,possibly-damaging,possibly-damaging	808/1862,797/1869,814/4378	61932103	1,13005	2203	4300	6503	SO:0001583	missense	0			U13616	CCDS7258.1, CCDS7259.1, CCDS55711.1, CCDS55712.1	10q21	2013-01-10			ENSG00000151150	ENSG00000151150		"""Ankyrin repeat domain containing"""	494	protein-coding gene	gene with protein product	"""ankyrin-3, node of Ranvier"", ""ankyrin-G"""	600465				7665168	Standard	NM_020987		Approved		uc001jky.3	Q12955	OTTHUMG00000018288	ENST00000280772.2:c.2441C>T	10.37:g.61932103G>A	ENSP00000280772:p.Thr814Ile		B1AQT2|B4DIL1|E9PE32|Q13484|Q5CZH9|Q5VXD5|Q7Z3G4|Q9H0P5	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_ZU5,pfam_Death_domain,superfamily_Ankyrin_rpt-contain_dom,superfamily_DEATH-like_dom,smart_Ankyrin_rpt,smart_ZU5,smart_Death_domain,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Death_domain,pfscan_ZU5,prints_Ankyrin_rpt	p.T814I	ENST00000280772.2	37	c.2441	CCDS7258.1	10	.	.	.	.	.	.	.	.	.	.	G	23.3	4.405461	0.83230	2.27E-4	0.0	ENSG00000151150	ENST00000280772;ENST00000373827;ENST00000503366;ENST00000395299;ENST00000373817;ENST00000395293;ENST00000395304;ENST00000536348	T;T;T	0.18960	2.44;2.18;2.18	5.78	5.78	0.91487	Ankyrin repeat-containing domain (3);	0.000000	0.40302	N	0.001140	T	0.28764	0.0713	N	0.04373	-0.215	0.80722	D	1	B;D;D;D;P	0.89917	0.082;0.997;1.0;1.0;0.79	B;D;D;D;B	0.97110	0.046;0.987;0.996;1.0;0.343	T	0.48636	-0.9018	10	0.87932	D	0	.	20.0175	0.97485	0.0:0.0:1.0:0.0	.	797;475;358;808;814	E9PE32;E7EMJ1;Q59G01;Q5CZH9;Q12955	.;.;.;.;ANK3_HUMAN	I	814;808;797;776;49;475;470;358	ENSP00000280772:T814I;ENSP00000362933:T808I;ENSP00000425236:T797I	ENSP00000280772:T814I	T	-	2	0	ANK3	61602109	1.000000	0.71417	0.983000	0.44433	0.788000	0.44548	7.943000	0.87716	2.730000	0.93505	0.650000	0.86243	ACC	ANK3	-	superfamily_Ankyrin_rpt-contain_dom,pfscan_Ankyrin_rpt-contain_dom	ENSG00000151150		0.488	ANK3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ANK3	HGNC	protein_coding	OTTHUMT00000048201.4		0.00	39	0	G	NM_020987		61932103	-1			no_errors	ENST00000280772	ensembl	human	known	74_37	missense	7.69	36	3	SNP	1.000	A
ANKRD20A4	728747	genome.wustl.edu	37	9	69420323	69420323	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr9:69420323G>T	ENST00000357336.3	+	13	1494	c.1213G>T	c.(1213-1215)Gat>Tat	p.D405Y		NM_001098805.1	NP_001092275.1	Q4UJ75	A20A4_HUMAN	ankyrin repeat domain 20 family, member A4	405										breast(1)|large_intestine(1)|liver(1)|lung(9)|pancreas(2)|skin(2)	16						AAATATATGTGATAGTACATC	0.313																																																	0													40.0	69.0	58.0					9																	69420323		1319	2258	3577	SO:0001583	missense	0				CCDS43828.1	9q21.11	2013-01-10			ENSG00000172014	ENSG00000172014		"""Ankyrin repeat domain containing"""	31982	protein-coding gene	gene with protein product							Standard	NM_001098805		Approved	OTTHUMG00000066855	uc004afn.3	Q4UJ75	OTTHUMG00000066855	ENST00000357336.3:c.1213G>T	9.37:g.69420323G>T	ENSP00000349891:p.Asp405Tyr			Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.D405Y	ENST00000357336.3	37	c.1213	CCDS43828.1	9	.	.	.	.	.	.	.	.	.	.	G	6.288	0.421208	0.11928	.	.	ENSG00000172014	ENST00000357336	T	0.37915	1.17	1.4	0.461	0.16689	.	.	.	.	.	T	0.33147	0.0853	L	0.46157	1.445	0.09310	N	1	D	0.63046	0.992	P	0.47941	0.562	T	0.16689	-1.0394	9	0.54805	T	0.06	.	5.5727	0.17206	0.0:0.3517:0.6483:0.0	.	405	Q4UJ75	A20A4_HUMAN	Y	405	ENSP00000349891:D405Y	ENSP00000349891:D405Y	D	+	1	0	ANKRD20A4	68710143	0.056000	0.20664	0.002000	0.10522	0.003000	0.03518	1.747000	0.38298	0.163000	0.19507	-1.121000	0.02013	GAT	ANKRD20A4	-	NULL	ENSG00000172014		0.313	ANKRD20A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD20A4	HGNC	protein_coding	OTTHUMT00000143287.3	-	0.00	87	0	G	NM_001098805		69420323	+1	tier1	-	no_errors	ENST00000357336	ensembl	human	known	74_37	missense	12.50	133	19	SNP	0.002	T
ANKRD30B	374860	genome.wustl.edu	37	18	14784464	14784464	+	Silent	SNP	T	T	A			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr18:14784464T>A	ENST00000358984.4	+	14	1782	c.1602T>A	c.(1600-1602)ccT>ccA	p.P534P	ANKRD30B_ENST00000579292.1_Intron|ANKRD30B_ENST00000447268.2_Silent_p.P534P	NM_001145029.1	NP_001138501.1	Q9BXX2	AN30B_HUMAN	ankyrin repeat domain 30B	534										breast(3)|endometrium(4)|kidney(3)|lung(8)|ovary(1)|prostate(2)|skin(1)	22						CCATTTAGCCTGCCGTTGAAA	0.299																																																	0													143.0	107.0	118.0					18																	14784464		692	1591	2283	SO:0001819	synonymous_variant	0			BC028407	CCDS54182.1	18p11.21	2013-01-10			ENSG00000180777	ENSG00000180777		"""Ankyrin repeat domain containing"""	24165	protein-coding gene	gene with protein product						11280766	Standard	NM_001145029		Approved	NY-BR-1.1	uc010dlo.2	Q9BXX2		ENST00000358984.4:c.1602T>A	18.37:g.14784464T>A			B4DGP1|F8WAG3|Q4G175	Silent	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.P534	ENST00000358984.4	37	c.1602	CCDS54182.1	18																																																																																			ANKRD30B	-	NULL	ENSG00000180777		0.299	ANKRD30B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ANKRD30B	HGNC	protein_coding	OTTHUMT00000443557.1	-	0.00	139	0	T	NM_001145029		14784464	+1	tier1	-	no_errors	ENST00000358984	ensembl	human	known	74_37	silent	16.43	117	23	SNP	0.030	A
ANKRD44	91526	genome.wustl.edu	37	2	197870538	197870538	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr2:197870538C>G	ENST00000328737.2	-	21	2228	c.2152G>C	c.(2152-2154)Gca>Cca	p.A718P	ANKRD44_ENST00000282272.8_Missense_Mutation_p.A735P|ANKRD44_ENST00000450567.1_Missense_Mutation_p.A718P|ANKRD44_ENST00000337207.5_Missense_Mutation_p.A718P			Q8N8A2	ANR44_HUMAN	ankyrin repeat domain 44	743										NS(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(20)|ovary(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	45			OV - Ovarian serous cystadenocarcinoma(117;0.246)			CGAGCAGCTGCATAGTGCAAG	0.517																																																	0													169.0	163.0	165.0					2																	197870538		2203	4300	6503	SO:0001583	missense	0			AK097086	CCDS33355.1, CCDS33355.2, CCDS74619.1	2q33.1	2013-01-10			ENSG00000065413	ENSG00000065413		"""Serine/threonine phosphatases / Protein phosphatase 6, regulatory subunits"", ""Ankyrin repeat domain containing"""	25259	protein-coding gene	gene with protein product	"""protein phosphatase 6 ankyrin repeat subunit B"""						Standard	NM_153697		Approved	PP6-ARS-B	uc021vuj.1	Q8N8A2	OTTHUMG00000154411	ENST00000328737.2:c.2152G>C	2.37:g.197870538C>G	ENSP00000331516:p.Ala718Pro		Q53SL9|Q6P480|Q86VL5|Q8IZ72|Q9UFA4	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.A718P	ENST00000328737.2	37	c.2152		2	.	.	.	.	.	.	.	.	.	.	C	34	5.310997	0.95629	.	.	ENSG00000065413	ENST00000424317;ENST00000282272;ENST00000328737;ENST00000450567;ENST00000337207	D;D;D;D;D	0.87103	-2.21;-2.21;-2.21;-2.21;-2.21	5.29	5.29	0.74685	.	0.000000	0.85682	D	0.000000	D	0.96503	0.8859	H	0.98559	4.265	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.97807	1.0248	10	0.87932	D	0	.	19.1301	0.93402	0.0:1.0:0.0:0.0	.	761	Q8N8A2-2	.	P	558;735;718;718;718	ENSP00000403415:A558P;ENSP00000282272:A735P;ENSP00000331516:A718P;ENSP00000402420:A718P;ENSP00000338794:A718P	ENSP00000282272:A735P	A	-	1	0	ANKRD44	197578783	1.000000	0.71417	0.874000	0.34290	0.983000	0.72400	7.651000	0.83577	2.767000	0.95098	0.655000	0.94253	GCA	ANKRD44	-	superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000065413		0.517	ANKRD44-002	KNOWN	basic|appris_principal	protein_coding	ANKRD44	HGNC	protein_coding	OTTHUMT00000335113.1		0.00	23	0	C	NM_153697		197870538	-1			no_errors	ENST00000328737	ensembl	human	known	74_37	missense	14.63	35	6	SNP	1.000	G
ANKRD50	57182	genome.wustl.edu	37	4	125631531	125631531	+	Missense_Mutation	SNP	T	T	C			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr4:125631531T>C	ENST00000504087.1	-	2	1173	c.136A>G	c.(136-138)Agt>Ggt	p.S46G	ANKRD50_ENST00000515641.1_Intron	NM_020337.2	NP_065070.1	Q9ULJ7	ANR50_HUMAN	ankyrin repeat domain 50	46										NS(1)|breast(3)|central_nervous_system(1)|endometrium(7)|kidney(4)|large_intestine(14)|lung(18)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	55						TTGACAGCACTATTGCAGCAG	0.488																																																	0													99.0	97.0	98.0					4																	125631531		2203	4300	6503	SO:0001583	missense	0			AB033049	CCDS34060.1, CCDS54802.1	4q28.1	2013-01-10			ENSG00000151458	ENSG00000151458		"""Ankyrin repeat domain containing"""	29223	protein-coding gene	gene with protein product							Standard	NM_020337		Approved	KIAA1223	uc010inw.3	Q9ULJ7	OTTHUMG00000161398	ENST00000504087.1:c.136A>G	4.37:g.125631531T>C	ENSP00000425658:p.Ser46Gly		A8K4V3|B4DHJ6|E9PDW0|Q6N064|Q6ZSE6	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,superfamily_P-loop_NTPase,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.S46G	ENST00000504087.1	37	c.136	CCDS34060.1	4	.	.	.	.	.	.	.	.	.	.	T	12.17	1.856657	0.32791	.	.	ENSG00000151458	ENST00000504087	T	0.16897	2.31	5.23	2.63	0.31362	.	0.000000	0.64402	D	0.000001	T	0.09512	0.0234	N	0.12182	0.205	0.36055	D	0.841005	B	0.02656	0.0	B	0.01281	0.0	T	0.11717	-1.0576	10	0.51188	T	0.08	.	10.1941	0.43043	0.0:0.1406:0.0:0.8594	.	46	Q9ULJ7	ANR50_HUMAN	G	46	ENSP00000425658:S46G	ENSP00000425658:S46G	S	-	1	0	ANKRD50	125850981	0.960000	0.32886	0.461000	0.27105	0.980000	0.70556	2.737000	0.47393	0.963000	0.38082	0.459000	0.35465	AGT	ANKRD50	-	superfamily_P-loop_NTPase	ENSG00000151458		0.488	ANKRD50-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD50	HGNC	protein_coding	OTTHUMT00000364775.1	-	0.00	73	0	T	NM_020337		125631531	-1	tier1	-	no_errors	ENST00000504087	ensembl	human	known	74_37	missense	20.83	38	10	SNP	0.327	C
ARFGEF2	10564	genome.wustl.edu	37	20	47538534	47538534	+	Silent	SNP	C	C	T			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr20:47538534C>T	ENST00000371917.4	+	1	108	c.108C>T	c.(106-108)tgC>tgT	p.C36C		NM_006420.2	NP_006411.2	Q9Y6D5	BIG2_HUMAN	ADP-ribosylation factor guanine nucleotide-exchange factor 2 (brefeldin A-inhibited)	36	DCB; DCB:DCB domain and DCB:HUS domain interaction.				endomembrane system organization (GO:0010256)|endosome organization (GO:0007032)|exocytosis (GO:0006887)|Golgi to plasma membrane transport (GO:0006893)|intracellular signal transduction (GO:0035556)|positive regulation of GTPase activity (GO:0043547)|positive regulation of tumor necrosis factor production (GO:0032760)|protein transport (GO:0015031)|receptor recycling (GO:0001881)|regulation of ARF protein signal transduction (GO:0032012)|vesicle-mediated transport (GO:0016192)	asymmetric synapse (GO:0032279)|axonemal microtubule (GO:0005879)|cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|recycling endosome (GO:0055037)|symmetric synapse (GO:0032280)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|GABA receptor binding (GO:0050811)|guanyl-nucleotide exchange factor activity (GO:0005085)|protein kinase A regulatory subunit binding (GO:0034237)			breast(7)|cervix(2)|endometrium(8)|kidney(4)|large_intestine(11)|lung(19)|ovary(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	63			BRCA - Breast invasive adenocarcinoma(12;0.00148)|Colorectal(8;0.198)			GCAGGGCCTGCCAGGTGGCGC	0.701																																					Esophageal Squamous(176;1738 1974 26285 33069 35354)												0													23.0	26.0	25.0					20																	47538534		2164	4243	6407	SO:0001819	synonymous_variant	0			AF084521	CCDS13411.1	20q13.13	2010-08-20			ENSG00000124198	ENSG00000124198		"""A-kinase anchor proteins"""	15853	protein-coding gene	gene with protein product	"""Brefeldin A-inhibited guanine nucleotide-exchange protein 2"""	605371				10212200	Standard	NM_006420		Approved	BIG2	uc002xtx.4	Q9Y6D5	OTTHUMG00000032687	ENST00000371917.4:c.108C>T	20.37:g.47538534C>T			Q5TFT9|Q9NTS1	Silent	SNP	pfam_Sec7_dom,pfam_DUF1981_Sec7_assoc,superfamily_Sec7_dom,superfamily_ARM-type_fold,smart_Sec7_dom,pfscan_Sec7_dom	p.C36	ENST00000371917.4	37	c.108	CCDS13411.1	20																																																																																			ARFGEF2	-	NULL	ENSG00000124198		0.701	ARFGEF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARFGEF2	HGNC	protein_coding	OTTHUMT00000079627.1	-	0.00	58	0	C	NM_006420		47538534	+1	tier1	-	no_errors	ENST00000371917	ensembl	human	known	74_37	silent	19.74	61	15	SNP	1.000	T
ASXL3	80816	genome.wustl.edu	37	18	31319646	31319646	+	Missense_Mutation	SNP	A	A	T			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr18:31319646A>T	ENST00000269197.5	+	11	2278	c.2278A>T	c.(2278-2280)Ata>Tta	p.I760L		NM_030632.1	NP_085135.1	Q9C0F0	ASXL3_HUMAN	additional sex combs like transcriptional regulator 3	760	Ser-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|endometrium(3)|kidney(3)|large_intestine(6)|lung(22)|ovary(2)|pancreas(1)|skin(2)|urinary_tract(1)	43						CAACTCTTCCATAAATGAGAG	0.453																																																	0													109.0	110.0	110.0					18																	31319646		1904	4125	6029	SO:0001583	missense	0			AB051500	CCDS45847.1	18q11	2014-06-17	2014-06-17	2007-02-01		ENSG00000141431			29357	protein-coding gene	gene with protein product		615115	"""KIAA1713"", ""additional sex combs like 3 (Drosophila)"""	KIAA1713		11214970	Standard	NM_030632		Approved		uc010dmg.1	Q9C0F0		ENST00000269197.5:c.2278A>T	18.37:g.31319646A>T	ENSP00000269197:p.Ile760Leu		Q6ZMX6|Q96MU3|Q9UFC5	Missense_Mutation	SNP	superfamily_Znf_FYVE_PHD	p.I760L	ENST00000269197.5	37	c.2278	CCDS45847.1	18	.	.	.	.	.	.	.	.	.	.	A	5.122	0.208214	0.09704	.	.	ENSG00000141431	ENST00000269197	T	0.12984	2.63	5.93	0.562	0.17290	.	1.389290	0.03964	N	0.290478	T	0.06690	0.0171	N	0.08118	0	0.19945	N	0.999947	B	0.02656	0.0	B	0.01281	0.0	T	0.33828	-0.9853	10	0.22109	T	0.4	.	3.0263	0.06092	0.4761:0.2523:0.0621:0.2095	.	760	Q9C0F0	ASXL3_HUMAN	L	760	ENSP00000269197:I760L	ENSP00000269197:I760L	I	+	1	0	ASXL3	29573644	0.358000	0.24947	0.783000	0.31826	0.391000	0.30476	0.392000	0.20801	-0.123000	0.11745	0.460000	0.39030	ATA	ASXL3	-	NULL	ENSG00000141431		0.453	ASXL3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ASXL3	HGNC	protein_coding	OTTHUMT00000441865.2		0.00	18	0	A			31319646	+1			no_errors	ENST00000269197	ensembl	human	known	74_37	missense	15.79	16	3	SNP	0.895	T
ATG3	64422	genome.wustl.edu	37	3	112253120	112253120	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr3:112253120G>A	ENST00000283290.5	-	11	1293	c.859C>T	c.(859-861)Cat>Tat	p.H287Y	ATG3_ENST00000495756.1_5'Flank|ATG3_ENST00000402314.2_Missense_Mutation_p.H287Y	NM_022488.3	NP_071933.2	Q9NT62	ATG3_HUMAN	autophagy related 3	287					autophagic vacuole assembly (GO:0000045)|cellular protein modification process (GO:0006464)|mitochondrial fragmentation involved in apoptotic process (GO:0043653)|mitochondrion degradation (GO:0000422)|nucleophagy (GO:0044804)|protein targeting to membrane (GO:0006612)|protein ubiquitination (GO:0016567)|regulation of cilium assembly (GO:1902017)	cytoplasmic ubiquitin ligase complex (GO:0000153)|cytosol (GO:0005829)	Atg12 ligase activity (GO:0019777)|Atg8 ligase activity (GO:0019776)|enzyme binding (GO:0019899)|small conjugating protein ligase activity (GO:0019787)			breast(1)|kidney(1)|large_intestine(1)|lung(3)|ovary(3)	9						GGATACATATGAACTCCAAGT	0.343																																																	0													128.0	111.0	117.0					3																	112253120		2203	4300	6503	SO:0001583	missense	0				CCDS2966.1, CCDS63721.1	3q13.2	2014-02-12	2012-06-06	2005-09-11	ENSG00000144848	ENSG00000144848			20962	protein-coding gene	gene with protein product		609606	"""APG3 autophagy 3-like (S. cerevisiae)"", ""ATG3 autophagy related 3 homolog (S. cerevisiae)"""	APG3L		11825910	Standard	NM_022488		Approved	PC3-96, FLJ22125, MGC15201, DKFZp564M1178	uc003dzd.3	Q9NT62	OTTHUMG00000159260	ENST00000283290.5:c.859C>T	3.37:g.112253120G>A	ENSP00000283290:p.His287Tyr		Q6PKC5|Q9H6L9	Missense_Mutation	SNP	pfam_Autophagy-rel_prot_3_N,pfam_Autophagy-rel_prot_3,pfam_Autophagy-rel_prot_3_C	p.H287Y	ENST00000283290.5	37	c.859	CCDS2966.1	3	.	.	.	.	.	.	.	.	.	.	G	20.5	3.993663	0.74703	.	.	ENSG00000144848	ENST00000283290;ENST00000402314	.	.	.	5.95	5.95	0.96441	Autophagy-related protein 3, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.77116	0.4083	M	0.71206	2.165	0.80722	D	1	B;B	0.31485	0.179;0.325	B;B	0.44224	0.33;0.444	T	0.75468	-0.3307	9	0.62326	D	0.03	.	20.4024	0.99000	0.0:0.0:1.0:0.0	.	287;287	Q9NT62;Q9NT62-2	ATG3_HUMAN;.	Y	287	.	ENSP00000283290:H287Y	H	-	1	0	ATG3	113735810	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.434000	0.97515	2.827000	0.97445	0.650000	0.86243	CAT	ATG3	-	pfam_Autophagy-rel_prot_3_C	ENSG00000144848		0.343	ATG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATG3	HGNC	protein_coding	OTTHUMT00000354147.1	-	0.00	64	0	G	NM_022488		112253120	-1	tier1	-	no_errors	ENST00000283290	ensembl	human	known	74_37	missense	25.23	80	27	SNP	1.000	A
ATP8B3	148229	genome.wustl.edu	37	19	1809675	1809675	+	Silent	SNP	C	C	T			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr19:1809675C>T	ENST00000310127.6	-	4	607	c.369G>A	c.(367-369)aaG>aaA	p.K123K	ATP8B3_ENST00000539485.1_Silent_p.K123K|ATP8B3_ENST00000526092.2_Silent_p.K70K|ATP8B3_ENST00000525591.1_Silent_p.K70K	NM_138813.3	NP_620168.1	O60423	AT8B3_HUMAN	ATPase, aminophospholipid transporter, class I, type 8B, member 3	123					binding of sperm to zona pellucida (GO:0007339)	acrosomal vesicle (GO:0001669)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(9)|ovary(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	23		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		ACAGGATCACCTTCTCCTTGA	0.622																																																	0													69.0	78.0	75.0					19																	1809675		1969	4153	6122	SO:0001819	synonymous_variant	0			AA827939	CCDS45901.1, CCDS54196.1	19p13.3	2010-04-28	2010-04-28		ENSG00000130270	ENSG00000130270		"""ATPases / P-type"""	13535	protein-coding gene	gene with protein product	"""aminophospholipid translocase ATP8B3"", ""potential phospholipid-transporting ATPase IK"""	605866	"""ATPase, Class I, type 8B, member 3"", ""ATPase, class I, type 8B, member 3"""			11015572	Standard	NM_138813		Approved	ATPIK	uc002ltw.4	O60423	OTTHUMG00000166189	ENST00000310127.6:c.369G>A	19.37:g.1809675C>T			Q7Z485|Q8IVB8|Q8N4Y8|Q96M22	Missense_Mutation	SNP	NULL	p.R86K	ENST00000310127.6	37	c.257	CCDS45901.1	19	.	.	.	.	.	.	.	.	.	.	c	11.08	1.533665	0.27387	.	.	ENSG00000130270	ENST00000533993	.	.	.	4.44	4.44	0.53790	.	.	.	.	.	T	0.61022	0.2314	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.59526	-0.7438	4	.	.	.	.	10.429	0.44395	0.0:0.9019:0.0:0.0981	.	.	.	.	K	86	.	.	R	-	2	0	ATP8B3	1760675	0.001000	0.12720	0.791000	0.31998	0.212000	0.24457	0.173000	0.16724	2.027000	0.59764	0.561000	0.74099	AGG	ATP8B3	-	NULL	ENSG00000130270		0.622	ATP8B3-002	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	ATP8B3	HGNC	protein_coding	OTTHUMT00000388279.1	-	0.00	46	0	C	NM_138813		1809675	-1	tier1	-	no_errors	ENST00000531925	ensembl	human	known	74_37	missense	24.00	38	12	SNP	0.986	T
ATXN8OS	6315	genome.wustl.edu	37	13	70713518	70713518	+	RNA	SNP	G	G	A	rs633100|rs143757288|rs370770198	byFrequency	TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr13:70713518G>A	ENST00000414504.2	+	0	1105					NR_002717.2				ATXN8 opposite strand (non-protein coding)																		tactactactgctgctgctgc	0.393																																																	0																																												0			AF126749		13q21	2012-10-19	2008-08-13	2006-07-18	ENSG00000230223	ENSG00000230223		"""Long non-coding RNAs"", ""-"""	10561	non-coding RNA	RNA, long non-coding	"""non-protein coding RNA 3"""	603680	"""spinocerebellar ataxia 8"", ""kelch-like 1 antisense (Drosophila)"""	SCA8, KLHL1AS		10192387, 16804541	Standard	NR_002717		Approved	NCRNA00003	uc010aej.1		OTTHUMG00000017057		13.37:g.70713518G>A				RNA	SNP	-	NULL	ENST00000414504.2	37	NULL		13																																																																																			ATXN8OS	-	-	ENSG00000230223		0.393	ATXN8OS-002	KNOWN	basic	antisense	ATXN8OS	HGNC	antisense	OTTHUMT00000045233.2		0.00	50	0	G	NR_002717		70713518	+1			no_errors	ENST00000414504	ensembl	human	known	74_37	rna	10.00	27	3	SNP	0.000	A
BPTF	2186	genome.wustl.edu	37	17	65905779	65905779	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr17:65905779C>T	ENST00000321892.4	+	12	3333	c.3272C>T	c.(3271-3273)cCt>cTt	p.P1091L	BPTF_ENST00000335221.5_Missense_Mutation_p.P1091L|BPTF_ENST00000306378.6_Missense_Mutation_p.P965L|BPTF_ENST00000424123.3_Missense_Mutation_p.P952L			Q12830	BPTF_HUMAN	bromodomain PHD finger transcription factor	1091					anterior/posterior pattern specification (GO:0009952)|ATP catabolic process (GO:0006200)|brain development (GO:0007420)|chromatin remodeling (GO:0006338)|embryonic placenta development (GO:0001892)|endoderm development (GO:0007492)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)|NURF complex (GO:0016589)	sequence-specific DNA binding (GO:0043565)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(16)|lung(23)|ovary(3)|pancreas(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	78	all_cancers(12;6e-11)		BRCA - Breast invasive adenocarcinoma(8;7.48e-08)|Colorectal(3;0.0984)|LUSC - Lung squamous cell carcinoma(166;0.24)			AAAATAGAGCCTGATTCTGAA	0.333																																																	0													45.0	47.0	46.0					17																	65905779		2203	4300	6503	SO:0001583	missense	0			AY282495	CCDS11673.1	17q24	2013-01-28	2006-12-01	2006-12-01	ENSG00000171634	ENSG00000171634		"""Zinc fingers, PHD-type"""	3581	protein-coding gene	gene with protein product		601819	"""fetal Alzheimer antigen"""	FALZ		8975731, 10662542, 16728976	Standard	NM_182641		Approved	FAC1, NURF301	uc002jgf.3	Q12830	OTTHUMG00000132254	ENST00000321892.4:c.3272C>T	17.37:g.65905779C>T	ENSP00000315454:p.Pro1091Leu		Q6NX67|Q7Z7D6|Q9UIG2	Missense_Mutation	SNP	pfam_Bromodomain,pfam_DDT_dom,pfam_Znf_PHD-finger,superfamily_Bromodomain,superfamily_Znf_FYVE_PHD,superfamily_Adenylate_cyclase-assoc_CAP_N,smart_DDT_dom_subgr,smart_Znf_PHD,smart_Bromodomain,pfscan_Znf_PHD-finger,pfscan_DDT_dom_superfamily,pfscan_Bromodomain,prints_Bromodomain	p.P1091L	ENST00000321892.4	37	c.3272		17	.	.	.	.	.	.	.	.	.	.	C	11.03	1.519182	0.27211	.	.	ENSG00000171634	ENST00000306378;ENST00000335221;ENST00000321892	T;T;T	0.61859	0.08;0.07;0.08	6.07	-0.0978	0.13631	.	.	.	.	.	T	0.32496	0.0831	N	0.14661	0.345	0.30902	N	0.729219	B;B	0.09022	0.001;0.002	B;B	0.09377	0.004;0.001	T	0.22695	-1.0209	9	0.45353	T	0.12	-0.0061	1.7479	0.02966	0.1458:0.3635:0.302:0.1887	.	965;1091	Q12830-2;Q12830-4	.;.	L	965;1091;1091	ENSP00000307208:P965L;ENSP00000334351:P1091L;ENSP00000315454:P1091L	ENSP00000307208:P965L	P	+	2	0	BPTF	63336241	0.996000	0.38824	0.992000	0.48379	0.981000	0.71138	0.584000	0.23864	0.063000	0.16370	-0.140000	0.14226	CCT	BPTF	-	NULL	ENSG00000171634		0.333	BPTF-201	KNOWN	basic	protein_coding	BPTF	HGNC	protein_coding		-	0.00	46	0	C	NM_182641, NM_004459		65905779	+1	tier1	-	no_errors	ENST00000321892	ensembl	human	known	74_37	missense	14.29	30	5	SNP	0.981	T
BRCA2	675	genome.wustl.edu	37	13	32954213	32954213	+	Missense_Mutation	SNP	C	C	T	rs80359176		TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr13:32954213C>T	ENST00000380152.3	+	24	9420	c.9187C>T	c.(9187-9189)Cca>Tca	p.P3063S	BRCA2_ENST00000544455.1_Missense_Mutation_p.P3063S			P51587	BRCA2_HUMAN	breast cancer 2, early onset	3063			P -> S (in a patient with ovarian cancer; unknown pathological significance). {ECO:0000269|PubMed:14746861}.		brain development (GO:0007420)|cell aging (GO:0007569)|centrosome duplication (GO:0051298)|cytokinesis (GO:0000910)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|female gonad development (GO:0008585)|hemopoiesis (GO:0030097)|histone H3 acetylation (GO:0043966)|histone H4 acetylation (GO:0043967)|inner cell mass cell proliferation (GO:0001833)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|male meiosis I (GO:0007141)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|nucleotide-excision repair (GO:0006289)|oocyte maturation (GO:0001556)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cytokinesis (GO:0032465)|replication fork protection (GO:0048478)|response to gamma radiation (GO:0010332)|response to UV-C (GO:0010225)|response to X-ray (GO:0010165)|spermatogenesis (GO:0007283)	BRCA2-MAGE-D1 complex (GO:0033593)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)|secretory granule (GO:0030141)	gamma-tubulin binding (GO:0043015)|H3 histone acetyltransferase activity (GO:0010484)|H4 histone acetyltransferase activity (GO:0010485)|protease binding (GO:0002020)|single-stranded DNA binding (GO:0003697)			NS(3)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(32)|liver(1)|lung(41)|oesophagus(5)|ovary(22)|pancreas(4)|prostate(3)|salivary_gland(1)|skin(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	183		Lung SC(185;0.0262)		all cancers(112;7.13e-07)|Epithelial(112;1.59e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000732)|BRCA - Breast invasive adenocarcinoma(63;0.0291)|GBM - Glioblastoma multiforme(144;0.0704)		ATTTTTAGATCCAGACTTTCA	0.333			"""D, Mis, N, F, S"""		"""breast, ovarian, pancreatic"""	"""breast, ovarian, pancreatic, leukemia  (FANCB, FANCD1)"""		Homologous recombination	Pancreatic Cancer, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Prostate Cancer;Hereditary Breast-Ovarian Cancer, BRCA2 type;Fanconi Anemia type D1, bi-allelic BRCA2 mutations;Fanconi Anemia	TCGA Ovarian(8;0.087)																											Esophageal Squamous(138;838 1285 7957 30353 30468 36915 49332)		yes	Rec	yes	Hereditary breast/ovarian cancer	13	13q12	675	familial breast/ovarian cancer gene 2		"""L, E"""	0													61.0	62.0	62.0					13																	32954213		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	incl.: Hereditary Pancreatic Adenocarcinoma, Insulin-Dependent Diabetes Mellitus - Exocrine Insufficiency - Familial Pancreatic Cancer, PNCA1;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;HPC; ;FANCD1;Pancytopenia Dysmelia, FA (several complementation groups)	U43746	CCDS9344.1	13q12-q13	2014-09-17	2003-10-14		ENSG00000139618	ENSG00000139618		"""Fanconi anemia, complementation groups"""	1101	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-containing complex, subunit 2"""	600185	"""Fanconi anemia, complementation group D1"""	FANCD1, FACD, FANCD		8091231, 7581463, 15057823	Standard	NM_000059		Approved	FAD, FAD1, BRCC2	uc001uub.1	P51587	OTTHUMG00000017411	ENST00000380152.3:c.9187C>T	13.37:g.32954213C>T	ENSP00000369497:p.Pro3063Ser		O00183|O15008|Q13879|Q5TBJ7	Missense_Mutation	SNP	pfam_DNA_recomb/repair_BRCA2_hlx,pfam_BRCA2_repeat,pfam_BRCA2_OB_3,pfam_BRCA2_OB_1,pfam_Tower,superfamily_DNA_recomb/repair_BRCA2_hlx,superfamily_NA-bd_OB-fold,pirsf_BRCA2,pfscan_BRCA2_repeat	p.P3063S	ENST00000380152.3	37	c.9187	CCDS9344.1	13	.	.	.	.	.	.	.	.	.	.	C	22.5	4.304506	0.81136	.	.	ENSG00000139618	ENST00000380152;ENST00000544455	T;T	0.80653	-1.4;-1.4	5.5	4.66	0.58398	Nucleic acid-binding, OB-fold-like (1);BRCA2, oligonucleotide/oligosaccharide-binding 3 (1);	0.052385	0.85682	N	0.000000	T	0.71048	0.3294	L	0.41573	1.285	0.50813	D	0.999896	P	0.41673	0.759	B	0.36504	0.226	T	0.72743	-0.4201	10	0.52906	T	0.07	.	10.9538	0.47345	0.0:0.7996:0.13:0.0705	.	3063	P51587	BRCA2_HUMAN	S	3063	ENSP00000369497:P3063S;ENSP00000439902:P3063S	ENSP00000369497:P3063S	P	+	1	0	BRCA2	31852213	0.958000	0.32768	0.953000	0.39169	0.996000	0.88848	1.724000	0.38064	1.462000	0.47948	0.650000	0.86243	CCA	BRCA2	-	pfam_BRCA2_OB_3,superfamily_NA-bd_OB-fold,pirsf_BRCA2	ENSG00000139618		0.333	BRCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRCA2	HGNC	protein_coding	OTTHUMT00000046000.2	-	0.00	93	0	C	NM_000059		32954213	+1	tier1	rs80359176	no_errors	ENST00000380152	ensembl	human	known	74_37	missense	21.67	47	13	SNP	0.998	T
C16orf82	162083	genome.wustl.edu	37	16	27079902	27079902	+	lincRNA	SNP	C	C	A			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr16:27079902C>A	ENST00000505035.1	+	0	1875				RP11-673P17.2_ENST00000565783.1_RNA			Q7Z2V1	TNT_HUMAN	chromosome 16 open reading frame 82																		TCATCAGGAGCAGCCAGGGAT	0.567																																																	0																																												0			BC031257		16p12.1	2013-01-24			ENSG00000234186	ENSG00000234186			30755	other	unknown						12477932	Standard	NM_001145545		Approved	TNT	uc010vcm.2	Q7Z2V1	OTTHUMG00000161986		16.37:g.27079902C>A			B9EGC2|Q8NEF0	RNA	SNP	-	NULL	ENST00000505035.1	37	NULL		16																																																																																			C16orf82	-	-	ENSG00000234186		0.567	C16orf82-001	KNOWN	basic	lincRNA	C16orf82	HGNC	lincRNA	OTTHUMT00000366634.1		0.00	13	0	C	NM_001145545		27079902	+1			no_errors	ENST00000418886	ensembl	human	known	74_37	rna	23.08	10	3	SNP	0.000	A
ERICH3	127254	genome.wustl.edu	37	1	75038188	75038188	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr1:75038188G>C	ENST00000326665.5	-	14	3424	c.3206C>G	c.(3205-3207)tCt>tGt	p.S1069C	C1orf173_ENST00000433746.2_5'UTR	NM_001002912.4	NP_001002912.4	Q5RHP9	ERIC3_HUMAN		1069	Glu-rich.									NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(23)|lung(123)|ovary(3)|prostate(10)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)	184						TTTCCTCAGAGATGTTTTTGG	0.408																																																	0													166.0	174.0	171.0					1																	75038188		2203	4300	6503	SO:0001583	missense	0																														ENST00000326665.5:c.3206C>G	1.37:g.75038188G>C	ENSP00000322609:p.Ser1069Cys		Q68DL8|Q6GMR8|Q6ZSF9|Q8ND41	Missense_Mutation	SNP	NULL	p.S1069C	ENST00000326665.5	37	c.3206	CCDS30755.1	1	.	.	.	.	.	.	.	.	.	.	G	10.70	1.424647	0.25639	.	.	ENSG00000178965	ENST00000326665	T	0.13307	2.6	4.47	2.57	0.30868	.	.	.	.	.	T	0.02848	0.0085	N	0.08118	0	0.09310	N	1	B	0.31351	0.32	B	0.36666	0.23	T	0.42430	-0.9452	9	0.56958	D	0.05	0.0011	8.7981	0.34892	0.0:0.3072:0.5345:0.1583	.	1069	Q5RHP9	CA173_HUMAN	C	1069	ENSP00000322609:S1069C	ENSP00000322609:S1069C	S	-	2	0	C1orf173	74810776	0.000000	0.05858	0.001000	0.08648	0.002000	0.02628	0.379000	0.20585	0.513000	0.28278	0.561000	0.74099	TCT	C1orf173	-	NULL	ENSG00000178965		0.408	C1orf173-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C1orf173	HGNC	protein_coding	OTTHUMT00000026516.1	-	0.00	107	0	G			75038188	-1	tier1	-	no_errors	ENST00000326665	ensembl	human	known	74_37	missense	21.05	75	20	SNP	0.000	C
C2orf68	388969	genome.wustl.edu	37	2	85838668	85838668	+	Intron	SNP	G	G	T			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr2:85838668G>T	ENST00000306336.5	-	2	271				C2orf68_ENST00000478626.1_5'UTR|USP39_ENST00000459775.1_Intron|C2orf68_ENST00000409734.3_Missense_Mutation_p.P117T|USP39_ENST00000450066.2_5'Flank	NM_001013649.3	NP_001013671.2	Q2NKX9	CB068_HUMAN	chromosome 2 open reading frame 68											breast(1)|central_nervous_system(1)|endometrium(1)	3						TGAGGTGGAGGTTCCGGAAAG	0.542																																																	0																																										SO:0001627	intron_variant	0				CCDS42704.1	2p11.2	2008-07-18			ENSG00000168887	ENSG00000168887			34353	protein-coding gene	gene with protein product							Standard	NM_001013649		Approved		uc002sqc.2	Q2NKX9	OTTHUMG00000153088	ENST00000306336.5:c.226+122C>A	2.37:g.85838668G>T			B4DT10|Q4G0J7|Q6ZVA6	Missense_Mutation	SNP	pfam_UPF0561	p.P117T	ENST00000306336.5	37	c.349	CCDS42704.1	2	.	.	.	.	.	.	.	.	.	.	G	14.24	2.475269	0.43942	.	.	ENSG00000168887	ENST00000409734	.	.	.	3.99	3.11	0.35812	.	.	.	.	.	T	0.30448	0.0765	.	.	.	0.09310	N	1	B	0.32829	0.386	B	0.28139	0.086	T	0.23084	-1.0198	7	0.87932	D	0	.	7.6994	0.28613	0.1144:0.0:0.8856:0.0	.	117	Q2NKX9-3	.	T	117	.	ENSP00000386301:P117T	P	-	1	0	C2orf68	85692179	0.004000	0.15560	0.002000	0.10522	0.145000	0.21501	1.233000	0.32648	1.277000	0.44412	0.305000	0.20034	CCT	C2orf68	-	NULL	ENSG00000168887		0.542	C2orf68-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C2orf68	HGNC	protein_coding	OTTHUMT00000329451.1	-	0.00	59	0	G	NM_001013649		85838668	-1	tier1	-	no_errors	ENST00000409734	ensembl	human	known	74_37	missense	5.63	67	4	SNP	0.002	T
C7	730	genome.wustl.edu	37	5	40937498	40937498	+	Intron	SNP	T	T	A			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr5:40937498T>A	ENST00000313164.9	+	6	787					NM_000587.2	NP_000578.2	P10643	CO7_HUMAN	complement component 7						cellular sodium ion homeostasis (GO:0006883)|complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane attack complex (GO:0005579)							Ovarian(839;0.0112)				ATTAGGATGCTGTGCTCTTCA	0.353																																																	0																																										SO:0001627	intron_variant	0			J03507	CCDS47201.1	5p13.1	2014-09-17			ENSG00000112936	ENSG00000112936		"""Complement system"""	1346	protein-coding gene	gene with protein product		217070					Standard	NM_000587		Approved		uc003jmh.3	P10643	OTTHUMG00000150340	ENST00000313164.9:c.429-156T>A	5.37:g.40937498T>A			Q6P3T5|Q92489	RNA	SNP	-	NULL	ENST00000313164.9	37	NULL	CCDS47201.1	5																																																																																			C7	-	-	ENSG00000112936		0.353	C7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C7	HGNC	protein_coding	OTTHUMT00000317680.1	-	0.00	21	0	T			40937498	+1	tier1	-	no_errors	ENST00000489457	ensembl	human	putative	74_37	rna	37.50	10	6	SNP	0.003	A
C9orf78	51759	genome.wustl.edu	37	9	132596001	132596001	+	Intron	DEL	A	A	-			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr9:132596001delA	ENST00000372447.3	-	3	197				USP20_ENST00000372429.3_5'Flank|C9orf78_ENST00000461762.1_5'UTR|USP20_ENST00000358355.1_5'Flank|USP20_ENST00000315480.4_5'Flank	NM_016520.2	NP_057604.1	Q9NZ63	CI078_HUMAN	chromosome 9 open reading frame 78							cytoplasm (GO:0005737)|nucleus (GO:0005634)				kidney(2)|lung(7)|ovary(1)|prostate(1)|stomach(2)	13		Ovarian(14;0.00556)				GAGCAAAACCAAAAAAAAAAG	0.478																																																	0													28.0	25.0	26.0					9																	132596001		2203	4299	6502	SO:0001627	intron_variant	0			BC017570	CCDS6931.1	9q34.2	2012-03-16			ENSG00000136819	ENSG00000136819			24932	protein-coding gene	gene with protein product	"""Hepatocellular carcinoma-associated antigen 59"""					11042152, 12097419	Standard	NM_016520		Approved	HSPC220, HCA59	uc004byp.3	Q9NZ63	OTTHUMG00000020796	ENST00000372447.3:c.144-13T>-	9.37:g.132596001delA			B3KPX8|Q8WVU6|Q9NT39	RNA	DEL	-	NULL	ENST00000372447.3	37	NULL	CCDS6931.1	9																																																																																			C9orf78	-	-	ENSG00000136819		0.478	C9orf78-007	KNOWN	basic|appris_principal|CCDS	protein_coding	C9orf78	HGNC	protein_coding	OTTHUMT00000054625.1		0.00	25	0	A	NM_016520		132596001	-1	tier1		no_errors	ENST00000461762	ensembl	human	known	74_37	rna	10.00	18	2	DEL	0.115	-
CAPN13	92291	genome.wustl.edu	37	2	31010157	31010157	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr2:31010157G>T	ENST00000295055.8	-	2	211	c.35C>A	c.(34-36)tCc>tAc	p.S12Y	CAPN13_ENST00000465960.2_5'UTR|CAPN13_ENST00000534090.2_Missense_Mutation_p.S12Y	NM_144575.2	NP_653176.2	Q6MZZ7	CAN13_HUMAN	calpain 13	12					proteolysis (GO:0006508)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(5)|large_intestine(5)|lung(11)|ovary(1)|prostate(1)|stomach(2)|urinary_tract(1)	30	all_hematologic(175;0.0487)|Acute lymphoblastic leukemia(172;0.155)					CTTGATGATGGAGGTCTCCAC	0.502																																																	0													45.0	45.0	45.0					2																	31010157		1996	4159	6155	SO:0001583	missense	0				CCDS46252.1	2p22-p21	2008-02-05			ENSG00000162949	ENSG00000162949			16663	protein-coding gene	gene with protein product		610228				11675017	Standard	NM_144575		Approved	FLJ23523	uc021vfm.1	Q6MZZ7	OTTHUMG00000152053	ENST00000295055.8:c.35C>A	2.37:g.31010157G>T	ENSP00000295055:p.Ser12Tyr		Q17RF0|Q580X1|Q8TE80	Missense_Mutation	SNP	pfam_Peptidase_C2_calpain_cat,pfam_Calpain_domain_III,superfamily_Calpain_domain_III,smart_Peptidase_C2_calpain_cat,pfscan_Peptidase_C2_calpain_cat,prints_Calpain_cysteine_protease	p.S12Y	ENST00000295055.8	37	c.35	CCDS46252.1	2	.	.	.	.	.	.	.	.	.	.	G	14.78	2.638685	0.47153	.	.	ENSG00000162949	ENST00000295055;ENST00000534090	D;D	0.88509	-2.39;-2.38	5.59	3.66	0.41972	.	0.582488	0.17309	N	0.178965	D	0.85452	0.5700	L	0.38531	1.155	0.09310	N	1	D	0.56521	0.976	P	0.47744	0.556	T	0.78021	-0.2367	10	0.72032	D	0.01	.	9.3888	0.38361	0.0:0.1478:0.6791:0.1731	.	12	Q6MZZ7	CAN13_HUMAN	Y	12	ENSP00000295055:S12Y;ENSP00000431298:S12Y	ENSP00000295055:S12Y	S	-	2	0	CAPN13	30863661	0.014000	0.17966	0.007000	0.13788	0.013000	0.08279	2.072000	0.41510	1.463000	0.47967	-0.274000	0.10170	TCC	CAPN13	-	NULL	ENSG00000162949		0.502	CAPN13-001	KNOWN	basic|CCDS	protein_coding	CAPN13	HGNC	protein_coding	OTTHUMT00000325101.2	-	0.00	51	0	G	NM_144575		31010157	-1	tier1	-	no_errors	ENST00000295055	ensembl	human	known	74_37	missense	5.80	65	4	SNP	0.003	T
CAPNS1	826	genome.wustl.edu	37	19	36632053	36632053	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr19:36632053G>A	ENST00000246533.3	+	2	738	c.140G>A	c.(139-141)gGc>gAc	p.G47D	CAPNS1_ENST00000588815.1_Missense_Mutation_p.G47D|AD001527.7_ENST00000604228.1_RNA|CAPNS1_ENST00000588780.1_Missense_Mutation_p.G47D|CAPNS1_ENST00000587718.1_Missense_Mutation_p.G47D|CAPNS1_ENST00000589146.1_Intron|CAPNS1_ENST00000590874.1_Missense_Mutation_p.G47D	NM_001003962.1|NM_001749.2	NP_001003962.1|NP_001740.1	P04632	CPNS1_HUMAN	calpain, small subunit 1	47	Gly-rich (hydrophobic).|Poly-Gly.				extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of cell proliferation (GO:0008284)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)			cervix(1)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)	5	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.06)			ggcggcggcggcggtggtgga	0.766																																					Esophageal Squamous(129;1541 1691 5780 18353 34150)												0													2.0	2.0	2.0					19																	36632053		1240	2623	3863	SO:0001583	missense	0			X04106	CCDS12489.1	19q13.1	2013-01-10		2001-08-10	ENSG00000126247	ENSG00000126247	3.4.22.52	"""EF-hand domain containing"""	1481	protein-coding gene	gene with protein product		114170		CAPN4		3024120, 3016651	Standard	NM_001003962		Approved	CANP, CANPS, 30K, CDPS	uc002odj.3	P04632		ENST00000246533.3:c.140G>A	19.37:g.36632053G>A	ENSP00000246533:p.Gly47Asp		A8K0P1|Q8WTX3|Q96EW0	Missense_Mutation	SNP	pfscan_EF_hand_dom	p.G47D	ENST00000246533.3	37	c.140	CCDS12489.1	19	.	.	.	.	.	.	.	.	.	.	g	11.07	1.530236	0.27387	.	.	ENSG00000126247	ENST00000246533	D	0.98666	-5.06	4.42	4.42	0.53409	.	0.458108	0.17315	N	0.178731	D	0.97315	0.9122	N	0.08118	0	0.80722	D	1	D	0.76494	0.999	D	0.68621	0.959	D	0.97276	0.9914	10	0.87932	D	0	.	12.3881	0.55343	0.0:0.0:1.0:0.0	.	47	P04632	CPNS1_HUMAN	D	47	ENSP00000246533:G47D	ENSP00000246533:G47D	G	+	2	0	CAPNS1	41323893	0.000000	0.05858	0.257000	0.24404	0.003000	0.03518	0.342000	0.19926	2.298000	0.77334	0.561000	0.74099	GGC	CAPNS1	-	NULL	ENSG00000126247		0.766	CAPNS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CAPNS1	HGNC	protein_coding	OTTHUMT00000457411.2		0.00	18	0	G			36632053	+1			no_errors	ENST00000588780	ensembl	human	known	74_37	missense	35.00	13	7	SNP	0.363	A
CAPZA1	829	genome.wustl.edu	37	1	113212985	113212985	+	3'UTR	DEL	T	T	-			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr1:113212985delT	ENST00000263168.3	+	0	1764				CAPZA1_ENST00000476936.1_3'UTR	NM_006135.2	NP_006126.1	P52907	CAZA1_HUMAN	capping protein (actin filament) muscle Z-line, alpha 1						actin cytoskeleton organization (GO:0030036)|actin filament capping (GO:0051693)|blood coagulation (GO:0007596)|cellular component movement (GO:0006928)|innate immune response (GO:0045087)|protein complex assembly (GO:0006461)	actin cytoskeleton (GO:0015629)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|F-actin capping protein complex (GO:0008290)|WASH complex (GO:0071203)	actin binding (GO:0003779)			breast(1)|kidney(2)|large_intestine(2)|lung(3)|prostate(1)	9	Lung SC(450;0.246)	all_cancers(81;1.44e-07)|all_epithelial(167;7.64e-07)|all_lung(203;2.16e-05)|Lung NSC(69;3.86e-05)		Lung(183;0.0234)|all cancers(265;0.0246)|Epithelial(280;0.0342)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		TCtttttttcttttttttttt	0.308																																																	0																																										SO:0001624	3_prime_UTR_variant	0			U56637	CCDS30805.1	1p13.2	2014-05-09			ENSG00000116489	ENSG00000116489			1488	protein-coding gene	gene with protein product		601580				7665558, 9119363	Standard	NM_006135		Approved		uc001ecj.1	P52907	OTTHUMG00000011769	ENST00000263168.3:c.*231T>-	1.37:g.113212985delT			Q53FQ6|Q6FHD5	RNA	DEL	-	NULL	ENST00000263168.3	37	NULL	CCDS30805.1	1																																																																																			CAPZA1	-	-	ENSG00000116489		0.308	CAPZA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CAPZA1	HGNC	protein_coding	OTTHUMT00000032567.2		0.00	34	0	T	NM_006135		113212985	+1	tier1		no_errors	ENST00000476936	ensembl	human	known	74_37	rna	8.33	33	3	DEL	0.001	-
CCDC142	84865	genome.wustl.edu	37	2	74701784	74701784	+	Silent	SNP	C	C	T			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr2:74701784C>T	ENST00000393965.3	-	9	2538	c.2142G>A	c.(2140-2142)ccG>ccA	p.P714P	CCDC142_ENST00000290418.4_Silent_p.P707P|MRPL53_ENST00000409710.1_5'Flank|MRPL53_ENST00000258105.7_5'Flank	NM_032779.3	NP_116168.3	Q17RM4	CC142_HUMAN	coiled-coil domain containing 142	714										central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(2)|skin(2)|urinary_tract(2)	16						GGTAGCCCTCCGGGCTAGGTC	0.617																																																	0													51.0	51.0	51.0					2																	74701784		2203	4300	6503	SO:0001819	synonymous_variant	0			AK075543	CCDS1945.1	2p13.1	2008-02-05			ENSG00000135637	ENSG00000135637			25889	protein-coding gene	gene with protein product							Standard	NM_032779		Approved	FLJ14397	uc002slq.3	Q17RM4	OTTHUMG00000129962	ENST00000393965.3:c.2142G>A	2.37:g.74701784C>T			B7ZKV5|Q8NBJ3|Q8NBV2|Q96KA7	Silent	SNP	NULL	p.P714	ENST00000393965.3	37	c.2142		2																																																																																			CCDC142	-	NULL	ENSG00000135637		0.617	CCDC142-003	KNOWN	basic	protein_coding	CCDC142	HGNC	protein_coding	OTTHUMT00000328391.1	-	0.00	57	0	C	NM_032779		74701784	-1	tier1	-	no_errors	ENST00000393965	ensembl	human	known	74_37	silent	18.92	60	14	SNP	0.011	T
CCDC151	115948	genome.wustl.edu	37	19	11537524	11537524	+	Silent	SNP	C	C	A			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr19:11537524C>A	ENST00000356392.4	-	5	780	c.693G>T	c.(691-693)ctG>ctT	p.L231L	CCDC151_ENST00000591179.1_Intron|CCDC151_ENST00000545100.1_Silent_p.L177L|CCDC151_ENST00000586836.1_Silent_p.L40L	NM_145045.4	NP_659482.3	A5D8V7	CC151_HUMAN	coiled-coil domain containing 151	231										endometrium(2)|large_intestine(1)|lung(7)|ovary(1)|prostate(1)	12						CCTTGAGCTGCAGGTACACGC	0.612																																																	0													66.0	68.0	67.0					19																	11537524		2106	4233	6339	SO:0001819	synonymous_variant	0				CCDS42501.1	19p13.2	2014-02-20				ENSG00000198003			28303	protein-coding gene	gene with protein product		615956				24067530	Standard	NM_145045		Approved	MGC20983	uc002mrs.3	A5D8V7		ENST00000356392.4:c.693G>T	19.37:g.11537524C>A			B4DXT0|Q96CG5	Silent	SNP	NULL	p.L231	ENST00000356392.4	37	c.693	CCDS42501.1	19																																																																																			CCDC151	-	NULL	ENSG00000198003		0.612	CCDC151-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC151	HGNC	protein_coding	OTTHUMT00000458800.1	-	0.00	52	0	C	NM_145045		11537524	-1	tier1	-	no_errors	ENST00000356392	ensembl	human	known	74_37	silent	43.33	17	13	SNP	1.000	A
CCDC37	348807	genome.wustl.edu	37	3	126155263	126155263	+	3'UTR	SNP	G	G	T			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr3:126155263G>T	ENST00000352312.1	+	0	1951				CCDC37_ENST00000506204.1_3'UTR|CCDC37_ENST00000505024.1_3'UTR|CCDC37_ENST00000393425.1_3'UTR	NM_182628.2	NP_872434.2	Q494V2	CCD37_HUMAN	coiled-coil domain containing 37											NS(1)|autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(5)|ovary(1)|skin(3)	23				GBM - Glioblastoma multiforme(114;0.166)		GCAGACCATAGCTGTTCTGGC	0.522																																																	0													163.0	156.0	159.0					3																	126155263		2203	4300	6503	SO:0001624	3_prime_UTR_variant	0			AK097402	CCDS3037.1	3q21.2	2014-07-31			ENSG00000163885	ENSG00000163885			26842	protein-coding gene	gene with protein product						23569216	Standard	NM_182628		Approved	FLJ40083, MIA1	uc003eiu.1	Q494V2	OTTHUMG00000162691	ENST00000352312.1:c.*16G>T	3.37:g.126155263G>T			D3DNA8|Q494V1|Q494V4|Q8N838	RNA	SNP	-	NULL	ENST00000352312.1	37	NULL	CCDS3037.1	3																																																																																			CCDC37	-	-	ENSG00000163885		0.522	CCDC37-001	KNOWN	basic|appris_candidate|exp_conf|CCDS	protein_coding	CCDC37	HGNC	protein_coding	OTTHUMT00000370099.4	-	0.00	59	0	G	NM_182628		126155263	+1	tier1	-	no_errors	ENST00000506204	ensembl	human	known	74_37	rna	7.84	47	4	SNP	0.000	T
CD300LG	146894	genome.wustl.edu	37	17	41926113	41926113	+	Silent	SNP	C	C	A			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr17:41926113C>A	ENST00000317310.4	+	2	272	c.231C>A	c.(229-231)ggC>ggA	p.G77G	CD300LG_ENST00000586233.1_Silent_p.G77G|CD300LG_ENST00000377203.4_Silent_p.G77G|CD300LG_ENST00000539718.1_Silent_p.G77G|CD300LG_ENST00000588884.1_Silent_p.G77G|CD300LG_ENST00000293396.8_Silent_p.G77G	NM_145273.3	NP_660316.2	Q6UXG3	CLM9_HUMAN	CD300 molecule-like family member g	77	Ig-like V-type.				immune system process (GO:0002376)|immunoglobulin transcytosis in epithelial cells (GO:0002414)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(2)|lung(5)|skin(4)	19		Breast(137;0.0199)		BRCA - Breast invasive adenocarcinoma(366;0.115)		CAATGAAGGGCAGGGTGTCCA	0.592																																																	0													100.0	87.0	92.0					17																	41926113		2203	4300	6503	SO:0001819	synonymous_variant	0			BC025395	CCDS11470.1, CCDS54131.1, CCDS54132.1, CCDS54133.1	17q21.31	2013-01-11	2006-03-29					"""Immunoglobulin superfamily / V-set domain containing"""	30455	protein-coding gene	gene with protein product	"""nepmucin"""	610520	"""CD300 antigen like family member G"""			16876123, 16754720	Standard	NM_001168322		Approved	Trem4, CLM9	uc002iem.3	Q6UXG3		ENST00000317310.4:c.231C>A	17.37:g.41926113C>A			B4DNY5|F5H7P9|F8W9M3|Q8IX38|Q8IX39|Q8TA95	Silent	SNP	pfam_Ig_V-set,smart_Ig_sub,pfscan_Ig-like_dom	p.G77	ENST00000317310.4	37	c.231	CCDS11470.1	17																																																																																			CD300LG	-	pfam_Ig_V-set,smart_Ig_sub,pfscan_Ig-like_dom	ENSG00000161649		0.592	CD300LG-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CD300LG	HGNC	protein_coding	OTTHUMT00000457646.1	-	0.00	15	0	C	NM_145273		41926113	+1	tier1	-	no_errors	ENST00000317310	ensembl	human	known	74_37	silent	17.24	24	5	SNP	0.001	A
CD93	22918	genome.wustl.edu	37	20	23066789	23066791	+	In_Frame_Del	DEL	AGC	AGC	-			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	AGC	AGC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr20:23066789_23066791delAGC	ENST00000246006.4	-	1	186_188	c.39_41delGCT	c.(37-42)ctgctc>ctc	p.13_14LL>L		NM_012072.3	NP_036204.2	Q9NPY3	C1QR1_HUMAN	CD93 molecule	13					macrophage activation (GO:0042116)|phagocytosis (GO:0006909)|single organismal cell-cell adhesion (GO:0016337)|viral process (GO:0016032)	cell surface (GO:0009986)|cytoplasmic membrane-bounded vesicle (GO:0016023)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|complement component C1q binding (GO:0001849)|receptor activity (GO:0004872)			NS(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(10)|lung(14)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	39	Colorectal(13;0.0352)|Lung NSC(19;0.0542)|all_lung(19;0.118)					CTGGGTcaggagcagcagcagca	0.709																																																	0										4,187,3873		0,0,4,17,153,1858						-10.7	0.0			6	5,391,7426		0,0,5,22,347,3537	no	codingComplex	CD93	NM_012072.3		0,0,9,39,500,5395	A1A1,A1A2,A1R,A2A2,A2R,RR		5.0626,4.6998,4.9386				9,578,11299				SO:0001651	inframe_deletion	0			U94333	CCDS13149.1	20p11.21	2009-01-29	2006-03-28	2006-02-22	ENSG00000125810	ENSG00000125810		"""CD molecules"""	15855	protein-coding gene	gene with protein product		120577	"""matrix-remodelling associated 4"", ""complement component 1, q subcomponent, receptor 1"", ""CD93 antigen"""	MXRA4, C1QR1		9047234, 10648005	Standard	NM_012072		Approved	C1qRP, C1qR(P), dJ737E23.1, CDw93, ECSM3	uc002wsv.3	Q9NPY3	OTTHUMG00000032058	ENST00000246006.4:c.39_41delGCT	20.37:g.23066798_23066800delAGC	ENSP00000246006:p.Leu15del		O00274	In_Frame_Del	DEL	pirsf_CD93/CD141,pfam_EGF-like_Ca-bd_dom,pfam_EG-like_dom,pfam_C-type_lectin,superfamily_C-type_lectin_fold,superfamily_MFS_dom_general_subst_transpt,smart_C-type_lectin,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,pfscan_EG-like_dom,pfscan_C-type_lectin	p.L15in_frame_del	ENST00000246006.4	37	c.41_39	CCDS13149.1	20																																																																																			CD93	-	pirsf_CD93/CD141	ENSG00000125810		0.709	CD93-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CD93	HGNC	protein_coding	OTTHUMT00000078312.2		0.00	24	0	AGC	NM_012072		23066791	-1	tier1		no_errors	ENST00000246006	ensembl	human	known	74_37	in_frame_del	17.65	14	3	DEL	0.176:0.289:0.517	-
CDH10	1008	genome.wustl.edu	37	5	24535839	24535839	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr5:24535839G>T	ENST00000264463.4	-	4	1126	c.619C>A	c.(619-621)Ccc>Acc	p.P207T		NM_006727.3	NP_006718.2	Q9Y6N8	CAD10_HUMAN	cadherin 10, type 2 (T2-cadherin)	207	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.P207S(1)		NS(1)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(29)|lung(111)|ovary(6)|pancreas(6)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)	185				STAD - Stomach adenocarcinoma(35;0.0556)		GAGAAATAGGGCTGCCCTTGA	0.448										HNSCC(23;0.051)																																							1	Substitution - Missense(1)	skin(1)											127.0	117.0	120.0					5																	24535839		2203	4300	6503	SO:0001583	missense	0			AF039747	CCDS3892.1	5p14.2	2010-01-26			ENSG00000040731	ENSG00000040731		"""Cadherins / Major cadherins"""	1749	protein-coding gene	gene with protein product		604555				2059658	Standard	NM_006727		Approved		uc003jgr.2	Q9Y6N8	OTTHUMG00000090667	ENST00000264463.4:c.619C>A	5.37:g.24535839G>T	ENSP00000264463:p.Pro207Thr		Q9ULB3	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.P207T	ENST00000264463.4	37	c.619	CCDS3892.1	5	.	.	.	.	.	.	.	.	.	.	G	24.2	4.508073	0.85282	.	.	ENSG00000040731	ENST00000264463	T	0.01665	4.7	6.17	5.3	0.74995	Cadherin (4);Cadherin-like (1);	0.047638	0.85682	D	0.000000	T	0.05547	0.0146	L	0.28192	0.835	0.54753	D	0.999982	D	0.89917	1.0	D	0.91635	0.999	T	0.49244	-0.8960	10	0.87932	D	0	.	14.6	0.68435	0.0693:0.0:0.9307:0.0	.	207	Q9Y6N8	CAD10_HUMAN	T	207	ENSP00000264463:P207T	ENSP00000264463:P207T	P	-	1	0	CDH10	24571596	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.841000	0.99482	1.621000	0.50320	0.655000	0.94253	CCC	CDH10	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000040731		0.448	CDH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH10	HGNC	protein_coding	OTTHUMT00000207345.2	-	0.00	41	0	G	NM_006727		24535839	-1	tier1	-	no_errors	ENST00000264463	ensembl	human	known	74_37	missense	13.89	31	5	SNP	1.000	T
CDHR5	53841	genome.wustl.edu	37	11	617432	617432	+	Silent	SNP	G	G	A			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr11:617432G>A	ENST00000358353.3	-	16	2779	c.2457C>T	c.(2455-2457)tcC>tcT	p.S819S	IRF7_ENST00000330243.5_5'Flank|IRF7_ENST00000397562.3_5'Flank|IRF7_ENST00000348655.6_5'Flank|CDHR5_ENST00000397542.2_Silent_p.S819S|IRF7_ENST00000397566.1_5'Flank|IRF7_ENST00000397574.2_5'Flank|IRF7_ENST00000397570.1_5'Flank|CDHR5_ENST00000349570.7_Silent_p.S625S|IRF7_ENST00000525445.1_5'Flank			Q9HBB8	CDHR5_HUMAN	cadherin-related family member 5	819					cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(7)|ovary(1)|skin(2)	23						CGCCGCTGCCGGAGTCACTGG	0.677																																																	0													37.0	32.0	34.0					11																	617432		2203	4300	6503	SO:0001819	synonymous_variant	0			AF258675	CCDS7707.1, CCDS7708.1	11p15.5	2011-07-01	2010-01-25	2010-01-25	ENSG00000099834	ENSG00000099834		"""Cadherins / Cadherin-related"""	7521	protein-coding gene	gene with protein product		606839	"""mucin and cadherin-like"", ""mucin-like protocadherin"""	MUCDHL, MUPCDH		11031102, 10801787	Standard	NM_021924		Approved	FLJ20219, MU-PCDH	uc001lqj.3	Q9HBB8	OTTHUMG00000132018	ENST00000358353.3:c.2457C>T	11.37:g.617432G>A			C9J7X1|Q9H746|Q9HAU3|Q9HBB5|Q9HBB6|Q9HBB7|Q9NX86|Q9NXI9	Silent	SNP	superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	p.S819	ENST00000358353.3	37	c.2457	CCDS7707.1	11																																																																																			CDHR5	-	NULL	ENSG00000099834		0.677	CDHR5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CDHR5	HGNC	protein_coding	OTTHUMT00000255023.2	-	0.00	43	0	G	NM_021924		617432	-1	tier1	-	no_errors	ENST00000358353	ensembl	human	known	74_37	silent	22.22	21	6	SNP	0.000	A
CEACAM19	56971	genome.wustl.edu	37	19	45182195	45182195	+	Missense_Mutation	SNP	A	A	G			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr19:45182195A>G	ENST00000403660.3	+	4	856	c.646A>G	c.(646-648)Acg>Gcg	p.T216A	CTB-171A8.1_ENST00000590796.1_RNA|CEACAM19_ENST00000358777.4_Missense_Mutation_p.T216A|CEACAM19_ENST00000480278.1_3'UTR			Q7Z692	CEA19_HUMAN	carcinoembryonic antigen-related cell adhesion molecule 19	216						integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(5)	11	Lung NSC(12;0.00308)|all_lung(12;0.00806)	Prostate(69;0.0376)				gccttcagtgacgcccagcac	0.483																																																	0													136.0	115.0	122.0					19																	45182195		2203	4300	6503	SO:0001583	missense	0			AF406955	CCDS12641.1, CCDS46108.1	19q13.31	2013-01-11			ENSG00000186567	ENSG00000186567		"""Immunoglobulin superfamily / V-set domain containing"""	31951	protein-coding gene	gene with protein product		606691					Standard	NM_020219		Approved	CEAL1	uc002ozo.4	Q7Z692	OTTHUMG00000151528	ENST00000403660.3:c.646A>G	19.37:g.45182195A>G	ENSP00000384887:p.Thr216Ala		Q5XJ15|Q7Z693	Missense_Mutation	SNP	pfam_Ig_V-set	p.T216A	ENST00000403660.3	37	c.646	CCDS12641.1	19	.	.	.	.	.	.	.	.	.	.	a	1.999	-0.429962	0.04701	.	.	ENSG00000186567	ENST00000358777;ENST00000403660	T;T	0.02395	4.31;4.31	.	.	.	.	.	.	.	.	T	0.01835	0.0058	N	0.19112	0.55	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.49542	-0.8929	7	0.13853	T	0.58	.	.	.	.	.	216;216	Q5XJ15;Q7Z692	.;CEA19_HUMAN	A	216	ENSP00000351627:T216A;ENSP00000384887:T216A	ENSP00000351627:T216A	T	+	1	0	CEACAM19	49874035	0.251000	0.23961	0.481000	0.27354	0.486000	0.33341	-0.402000	0.07223	0.151000	0.19162	0.149000	0.16113	ACG	CEACAM19	-	NULL	ENSG00000186567		0.483	CEACAM19-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CEACAM19	HGNC	protein_coding	OTTHUMT00000323022.1	-	0.00	80	0	A	NM_020219		45182195	+1	tier1	-	no_errors	ENST00000403660	ensembl	human	known	74_37	missense	5.33	71	4	SNP	0.544	G
TMEM127	55654	genome.wustl.edu	37	2	96934312	96934312	+	5'Flank	SNP	G	G	C			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr2:96934312G>C	ENST00000258439.3	-	0	0				CIAO1_ENST00000488633.1_Missense_Mutation_p.D203H|TMEM127_ENST00000432959.1_5'Flank	NM_001193304.2|NM_017849.3	NP_001180233.1|NP_060319.1	O75204	TM127_HUMAN	transmembrane protein 127						negative regulation of cell proliferation (GO:0008285)|negative regulation of TOR signaling (GO:0032007)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(1)|large_intestine(1)|lung(1)|prostate(1)|stomach(1)	5						CTTGGCCTTTGACCCGAGTGG	0.542																																																	0													115.0	103.0	107.0					2																	96934312		2203	4300	6503	SO:0001631	upstream_gene_variant	0			AK000514	CCDS2018.1	2q11.2	2014-09-17			ENSG00000135956	ENSG00000135956			26038	protein-coding gene	gene with protein product		613403				10493829	Standard	NM_017849		Approved	FLJ20507, FLJ22257	uc002svr.3	O75204	OTTHUMG00000130454		2.37:g.96934312G>C	Exception_encountered		D3DXH0	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.D203H	ENST00000258439.3	37	c.607	CCDS2018.1	2	.	.	.	.	.	.	.	.	.	.	G	29.3	4.996617	0.93167	.	.	ENSG00000144021	ENST00000488633	T	0.65732	-0.17	5.82	5.82	0.92795	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.56775	0.2008	N	0.01188	-0.97	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.74346	-0.3695	10	0.66056	D	0.02	-44.9586	17.5946	0.88007	0.0:0.0:1.0:0.0	.	203	O76071	CIAO1_HUMAN	H	203	ENSP00000418287:D203H	ENSP00000418287:D203H	D	+	1	0	CIAO1	96298039	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.404000	0.97306	2.756000	0.94617	0.563000	0.77884	GAC	CIAO1	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000144021		0.542	TMEM127-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CIAO1	HGNC	protein_coding	OTTHUMT00000252845.3	-	0.00	49	0	G	NM_017849		96934312	+1	tier1	-	no_errors	ENST00000488633	ensembl	human	known	74_37	missense	15.49	60	11	SNP	1.000	C
CLLU1	574028	genome.wustl.edu	37	12	92818799	92818799	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr12:92818799C>A	ENST00000378485.1	+	1	1065	c.343C>A	c.(343-345)Caa>Aaa	p.Q115K	CLLU1OS_ENST00000378487.2_Intron|RP11-693J15.4_ENST00000508671.1_RNA|CLLU1_ENST00000472839.2_Intron|CLLU1OS_ENST00000538965.1_Intron	NM_001025233.1	NP_001020404.1	Q5K131	CLLU1_HUMAN	chronic lymphocytic leukemia up-regulated 1	115						cytoplasm (GO:0005737)				NS(1)|breast(1)|large_intestine(1)|lung(2)|ovary(1)|urinary_tract(1)	7						TTTTAAATTTCAACTGTTGCG	0.323																																																	0													37.0	37.0	37.0					12																	92818799		1819	4057	5876	SO:0001583	missense	0			AJ845162		12q22	2012-04-19			ENSG00000257127	ENSG00000257127			29841	protein-coding gene	gene with protein product						19726446	Standard	NR_027932		Approved		uc001tcg.1	Q5K131	OTTHUMG00000170103	ENST00000378485.1:c.343C>A	12.37:g.92818799C>A	ENSP00000367746:p.Gln115Lys			Missense_Mutation	SNP	NULL	p.Q115K	ENST00000378485.1	37	c.343		12	.	.	.	.	.	.	.	.	.	.	C	7.413	0.635198	0.14322	.	.	ENSG00000257127	ENST00000378485	T	0.50548	0.74	3.5	0.702	0.18110	.	.	.	.	.	T	0.27027	0.0662	N	0.08118	0	0.09310	N	1	.	.	.	.	.	.	T	0.24835	-1.0149	7	0.87932	D	0	.	5.6135	0.17418	0.0:0.6404:0.0:0.3596	.	.	.	.	K	115	ENSP00000367746:Q115K	ENSP00000367746:Q115K	Q	+	1	0	AC063949.1	91342930	0.099000	0.21834	0.008000	0.14137	0.212000	0.24457	-0.269000	0.08596	0.142000	0.18901	0.643000	0.83706	CAA	CLLU1	-	NULL	ENSG00000257127		0.323	CLLU1-003	KNOWN	NMD_exception|basic|appris_principal	protein_coding	CLLU1	HGNC	protein_coding	OTTHUMT00000366643.1	-	0.00	42	0	C	NM_001025233		92818799	+1	tier1	-	no_errors	ENST00000378485	ensembl	human	known	74_37	missense	14.29	42	7	SNP	0.014	A
CLSPN	63967	genome.wustl.edu	37	1	36203660	36203662	+	In_Frame_Del	DEL	TTC	TTC	-	rs200760879	byFrequency	TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	TTC	TTC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr1:36203660_36203662delTTC	ENST00000318121.3	-	22	3652_3654	c.3595_3597delGAA	c.(3595-3597)gaadel	p.E1199del	CLSPN_ENST00000251195.5_In_Frame_Del_p.E1199del|CLSPN_ENST00000520551.1_In_Frame_Del_p.E1146del|CLSPN_ENST00000373220.3_In_Frame_Del_p.E1135del|RP11-435D7.3_ENST00000373226.2_RNA|CLSPN_ENST00000466308.1_5'Flank	NM_022111.3	NP_071394.2	Q9HAW4	CLSPN_HUMAN	claspin	1199					activation of protein kinase activity (GO:0032147)|apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|G2 DNA damage checkpoint (GO:0031572)|mitotic DNA replication checkpoint (GO:0033314)|peptidyl-serine phosphorylation (GO:0018105)	nucleoplasm (GO:0005654)	anaphase-promoting complex binding (GO:0010997)|DNA binding (GO:0003677)			NS(2)|breast(3)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(8)|lung(20)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	56		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				CCTCCCCAATTTCTTCTTCTTCT	0.365														141	0.028155	0.0015	0.0346	5008	,	,		11091	0.001		0.0676	False		,,,				2504	0.047																0									,	42,4224		0,42,2091					,	1.1	1.0			153	536,7718		22,492,3613	no	coding,coding	CLSPN	NM_022111.3,NM_001190481.1	,	22,534,5704	A1A1,A1R,RR		6.4938,0.9845,4.6166	,	,		578,11942				SO:0001651	inframe_deletion	0			AF297866	CCDS396.1, CCDS53297.1	1p34.3	2010-06-24	2010-06-24		ENSG00000092853	ENSG00000092853			19715	protein-coding gene	gene with protein product		605434	"""claspin homolog (Xenopus laevis)"""			11090622, 12766152	Standard	NM_022111		Approved		uc001bzi.3	Q9HAW4	OTTHUMG00000004168	ENST00000318121.3:c.3595_3597delGAA	1.37:g.36203669_36203671delTTC	ENSP00000312995:p.Glu1199del		A6NFL4|Q1RMC6|Q2KHM3|Q5VYG0|Q6P6H5|Q8IWI1	In_Frame_Del	DEL	NULL	p.E1199in_frame_del	ENST00000318121.3	37	c.3597_3595	CCDS396.1	1																																																																																			CLSPN	-	NULL	ENSG00000092853		0.365	CLSPN-005	KNOWN	basic|appris_principal|CCDS	protein_coding	CLSPN	HGNC	protein_coding	OTTHUMT00000377857.1		0.00	28	0	TTC	NM_022111		36203662	-1	tier1		no_errors	ENST00000318121	ensembl	human	known	74_37	in_frame_del	15.00	17	3	DEL	0.998:1.000:0.950	-
CLTC	1213	genome.wustl.edu	37	17	57742246	57742246	+	Missense_Mutation	SNP	A	A	T			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr17:57742246A>T	ENST00000269122.3	+	10	1894	c.1620A>T	c.(1618-1620)gaA>gaT	p.E540D	CLTC_ENST00000393043.1_Missense_Mutation_p.E540D|CLTC_ENST00000579456.1_Intron	NM_004859.3	NP_004850.1	Q00610	CLH1_HUMAN	clathrin, heavy chain (Hc)	540	Distal segment.|Heavy chain arm.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|mitotic nuclear division (GO:0007067)|negative regulation of hyaluronan biosynthetic process (GO:1900126)|negative regulation of protein localization to plasma membrane (GO:1903077)|osteoblast differentiation (GO:0001649)|post-Golgi vesicle-mediated transport (GO:0006892)|receptor internalization (GO:0031623)|receptor-mediated endocytosis (GO:0006898)|transferrin transport (GO:0033572)	clathrin coat (GO:0030118)|clathrin coat of coated pit (GO:0030132)|clathrin coat of trans-Golgi network vesicle (GO:0030130)|clathrin complex (GO:0071439)|clathrin-coated endocytic vesicle membrane (GO:0030669)|clathrin-coated vesicle (GO:0030136)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|spindle (GO:0005819)|trans-Golgi network membrane (GO:0032588)|vesicle (GO:0031982)	clathrin light chain binding (GO:0032051)|double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|structural molecule activity (GO:0005198)		CLTC/ALK(44)|CLTC/TFE3(2)	breast(2)|large_intestine(6)|ovary(1)	9	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)					TTCAAGATGAAGAGCCTCTTG	0.433			T	"""ALK, TFE3"""	"""ALCL, renal """																																			Dom	yes		17	17q11-qter	1213	"""clathrin, heavy polypeptide (Hc)"""		L	0													112.0	106.0	108.0					17																	57742246		2203	4300	6503	SO:0001583	missense	0			X55878	CCDS32696.1, CCDS74115.1	17q23.1	2013-09-19	2006-09-29		ENSG00000141367	ENSG00000141367			2092	protein-coding gene	gene with protein product		118955	"""clathrin, heavy polypeptide (Hc)"", ""clathrin, heavy chain"", ""clathrin, heavy polypeptide-like 2"""	CLTCL2		1765375, 7584026	Standard	NM_004859		Approved	Hc	uc002ixq.1	Q00610	OTTHUMG00000134279	ENST00000269122.3:c.1620A>T	17.37:g.57742246A>T	ENSP00000269122:p.Glu540Asp		D3DU00|Q6N0A0|Q86TF2	Missense_Mutation	SNP	pfam_Clathrin_H-chain/VPS_repeat,pfam_Clathrin_H-chain_propeller_rpt,pfam_Clathrin_H-chain_linker_core,superfamily_Clathrin_H-chain_propeller_N,superfamily_ARM-type_fold,smart_Clathrin_H-chain/VPS_repeat,pirsf_Clathrin_heavy_chain	p.E540D	ENST00000269122.3	37	c.1620	CCDS32696.1	17	.	.	.	.	.	.	.	.	.	.	A	14.41	2.526595	0.44969	.	.	ENSG00000141367	ENST00000269122;ENST00000393043	T;T	0.22336	1.96;1.96	5.45	4.37	0.52481	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.12603	0.0306	N	0.04387	-0.21	0.80722	D	1	P;B	0.36282	0.546;0.0	P;B	0.44946	0.465;0.006	T	0.26883	-1.0090	10	0.19590	T	0.45	.	8.5919	0.33693	0.8518:0.0:0.1482:0.0	.	540;540	Q00610;Q00610-2	CLH1_HUMAN;.	D	540	ENSP00000269122:E540D;ENSP00000376763:E540D	ENSP00000269122:E540D	E	+	3	2	CLTC	55097028	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.662000	0.46766	1.021000	0.39600	0.460000	0.39030	GAA	CLTC	-	superfamily_ARM-type_fold,smart_Clathrin_H-chain/VPS_repeat,pirsf_Clathrin_heavy_chain	ENSG00000141367		0.433	CLTC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLTC	HGNC	protein_coding	OTTHUMT00000258859.1	-	0.00	55	0	A	NM_004859		57742246	+1	tier1	-	no_errors	ENST00000269122	ensembl	human	known	74_37	missense	17.39	57	12	SNP	1.000	T
COG5	10466	genome.wustl.edu	37	7	106897227	106897227	+	Intron	SNP	G	G	A			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr7:106897227G>A	ENST00000347053.3	-	15	1830				COG5_ENST00000297135.3_Nonsense_Mutation_p.Q598*|COG5_ENST00000393603.2_Nonsense_Mutation_p.Q598*	NM_181733.2	NP_859422.2	Q9UP83	COG5_HUMAN	component of oligomeric golgi complex 5						intra-Golgi vesicle-mediated transport (GO:0006891)|protein transport (GO:0015031)	Golgi apparatus (GO:0005794)|Golgi transport complex (GO:0017119)|membrane (GO:0016020)				breast(3)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(17)|ovary(2)|skin(4)|stomach(1)	40						AATGAGCTCTGACTGGAAACA	0.333																																																	0													77.0	77.0	77.0					7																	106897227		2203	4300	6503	SO:0001627	intron_variant	0			AF058718	CCDS5742.1, CCDS5743.1, CCDS55152.1	7q31	2010-06-24	2001-12-07	2002-05-10	ENSG00000164597	ENSG00000164597		"""Components of oligomeric golgi complex"""	14857	protein-coding gene	gene with protein product		606821	"""golgi transport complex 1 (90 kDa subunit)"""	GOLTC1		9792665, 11980916	Standard	NM_006348		Approved	GTC90	uc003vec.2	Q9UP83	OTTHUMG00000023895	ENST00000347053.3:c.1779+1490C>T	7.37:g.106897227G>A			A4D0R6|A4D0R7|O14555|O95008|Q6NUL5	Nonsense_Mutation	SNP	pfam_Cog5	p.Q598*	ENST00000347053.3	37	c.1792	CCDS5743.1	7	.	.	.	.	.	.	.	.	.	.	G	41	9.031606	0.99042	.	.	ENSG00000164597	ENST00000297135;ENST00000393603	.	.	.	5.33	5.33	0.75918	.	0.193250	0.45361	D	0.000365	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.28530	T	0.3	-8.0608	18.1711	0.89745	0.0:0.0:1.0:0.0	.	.	.	.	X	598	.	ENSP00000297135:Q598X	Q	-	1	0	COG5	106684463	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	5.080000	0.64437	2.650000	0.89964	0.655000	0.94253	CAG	COG5	-	NULL	ENSG00000164597		0.333	COG5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	COG5	HGNC	protein_coding	OTTHUMT00000060216.4	-	0.00	53	0	G			106897227	-1	tier1	-	no_errors	ENST00000297135	ensembl	human	known	74_37	nonsense	15.56	38	7	SNP	1.000	A
COL11A1	1301	genome.wustl.edu	37	1	103354301	103354301	+	Frame_Shift_Del	DEL	G	G	-			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr1:103354301delG	ENST00000370096.3	-	61	4844	c.4532delC	c.(4531-4533)ccafs	p.P1511fs	COL11A1_ENST00000512756.1_Frame_Shift_Del_p.P1395fs|COL11A1_ENST00000353414.4_Frame_Shift_Del_p.P1472fs|COL11A1_ENST00000358392.2_Frame_Shift_Del_p.P1523fs	NM_001854.3	NP_001845.3	P12107	COBA1_HUMAN	collagen, type XI, alpha 1	1511	Collagen-like 8.|Triple-helical region.				cartilage condensation (GO:0001502)|chondrocyte development (GO:0002063)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|embryonic skeletal system morphogenesis (GO:0048704)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|proteoglycan metabolic process (GO:0006029)|sensory perception of sound (GO:0007605)|tendon development (GO:0035989)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visual perception (GO:0007601)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)			NS(3)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(17)|kidney(8)|large_intestine(28)|lung(157)|ovary(6)|pancreas(2)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(1)	258		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		GTTACCCTTTGGGCCTTGAGG	0.353																																																	0													63.0	65.0	64.0					1																	103354301		2203	4299	6502	SO:0001589	frameshift_variant	0			J04177	CCDS778.1, CCDS780.1, CCDS780.2, CCDS53348.1	1p21	2013-01-16			ENSG00000060718	ENSG00000060718		"""Collagens"""	2186	protein-coding gene	gene with protein product	"""collagen XI, alpha-1 polypeptide"""	120280		COLL6		3182841	Standard	NM_080630		Approved	STL2, CO11A1	uc001dul.3	P12107	OTTHUMG00000010872	ENST00000370096.3:c.4532delC	1.37:g.103354301delG	ENSP00000359114:p.Pro1511fs		B1ASK7|D3DT73|E9PCU0|Q14034|Q149N0|Q9UIT4|Q9UIT5|Q9UIT6	Frame_Shift_Del	DEL	pfam_Collagen,pfam_Fib_collagen_C,pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,superfamily_Fibrinogen_a/b/g_C_dom,smart_Laminin_G,smart_Fib_collagen_C	p.P1523fs	ENST00000370096.3	37	c.4568	CCDS778.1	1																																																																																			COL11A1	-	pfam_Collagen	ENSG00000060718		0.353	COL11A1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	COL11A1	HGNC	protein_coding	OTTHUMT00000029997.1		0.00	47	0	G	NM_080630		103354301	-1	tier1		no_errors	ENST00000358392	ensembl	human	known	74_37	frame_shift_del	10.34	52	6	DEL	1.000	-
COPS5	10987	genome.wustl.edu	37	8	67971544	67971544	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr8:67971544C>T	ENST00000357849.4	-	2	600	c.280G>A	c.(280-282)Gac>Aac	p.D94N	COPS5_ENST00000519963.1_5'Flank|COPS5_ENST00000517736.1_Missense_Mutation_p.D30N|PPP1R42_ENST00000517834.1_5'Flank|AC109335.1_ENST00000578628.1_RNA	NM_006837.2	NP_006828.2	Q92905	CSN5_HUMAN	COP9 signalosome subunit 5	94	MPN.				cullin deneddylation (GO:0010388)|exosomal secretion (GO:1990182)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein deneddylation (GO:0000338)|protein deubiquitination (GO:0016579)|regulation of cell cycle (GO:0051726)|regulation of JNK cascade (GO:0046328)|transcription from RNA polymerase II promoter (GO:0006366)|translation (GO:0006412)|translational initiation (GO:0006413)	cell junction (GO:0030054)|COP9 signalosome (GO:0008180)|cytoplasm (GO:0005737)|eukaryotic translation initiation factor 3 complex (GO:0005852)|nucleus (GO:0005634)|synaptic vesicle (GO:0008021)	metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|transcription coactivator activity (GO:0003713)|translation initiation factor activity (GO:0003743)|ubiquitin-specific protease activity (GO:0004843)			endometrium(2)|kidney(1)|large_intestine(1)|lung(6)|ovary(1)|skin(3)	14	Breast(64;0.214)	Lung NSC(129;0.0908)|all_lung(136;0.152)	Epithelial(68;0.00389)|OV - Ovarian serous cystadenocarcinoma(28;0.00691)|all cancers(69;0.0205)|BRCA - Breast invasive adenocarcinoma(89;0.153)			GCAAAACTGTCCATAATGATC	0.478																																																	0													185.0	146.0	159.0					8																	67971544		2203	4300	6503	SO:0001583	missense	0			U65928	CCDS6198.1	8q13.1	2013-03-14	2013-03-14		ENSG00000121022	ENSG00000121022			2240	protein-coding gene	gene with protein product		604850	"""COP9 (constitutive photomorphogenic, Arabidopsis, homolog) subunit 5"", ""COP9 constitutive photomorphogenic homolog subunit 5 (Arabidopsis)"""			8837781, 9341143	Standard	NM_006837		Approved	JAB1, SGN5, MOV-34, CSN5	uc003xxe.3	Q92905	OTTHUMG00000164563	ENST00000357849.4:c.280G>A	8.37:g.67971544C>T	ENSP00000350512:p.Asp94Asn		O15386|Q6AW95|Q86WQ4|Q9BQ17	Missense_Mutation	SNP	pfam_JAB_MPN_dom,smart_JAB_MPN_dom	p.D94N	ENST00000357849.4	37	c.280	CCDS6198.1	8	.	.	.	.	.	.	.	.	.	.	C	36	5.808411	0.96967	.	.	ENSG00000121022	ENST00000357849;ENST00000517736;ENST00000518747	T;T;T	0.50548	0.74;0.74;0.74	5.38	5.38	0.77491	.	0.000000	0.85682	D	0.000000	T	0.75184	0.3815	M	0.88377	2.95	0.80722	D	1	D;D;D	0.89917	1.0;0.992;0.998	D;D;D	0.77557	0.982;0.976;0.99	T	0.79964	-0.1581	10	0.87932	D	0	-8.4837	19.4952	0.95069	0.0:1.0:0.0:0.0	.	63;30;94	Q59GH5;E5RHH5;Q92905	.;.;CSN5_HUMAN	N	94;30;30	ENSP00000350512:D94N;ENSP00000429774:D30N;ENSP00000428586:D30N	ENSP00000350512:D94N	D	-	1	0	COPS5	68134098	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.771000	0.85420	2.675000	0.91044	0.655000	0.94253	GAC	COPS5	-	pfam_JAB_MPN_dom,smart_JAB_MPN_dom	ENSG00000121022		0.478	COPS5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COPS5	HGNC	protein_coding	OTTHUMT00000379245.2	-	0.00	44	0	C			67971544	-1	tier1	-	no_errors	ENST00000357849	ensembl	human	known	74_37	missense	20.00	40	10	SNP	1.000	T
CPAMD8	27151	genome.wustl.edu	37	19	17119359	17119359	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr19:17119359C>A	ENST00000443236.1	-	7	687	c.656G>T	c.(655-657)gGc>gTc	p.G219V	CPAMD8_ENST00000388925.4_Missense_Mutation_p.G172V|CTD-2528A14.1_ENST00000595134.1_RNA	NM_015692.2	NP_056507.2	Q8IZJ3	CPMD8_HUMAN	C3 and PZP-like, alpha-2-macroglobulin domain containing 8	172						extracellular space (GO:0005615)|plasma membrane (GO:0005886)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(11)|central_nervous_system(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(17)|lung(14)|ovary(7)|pancreas(2)|prostate(4)|skin(5)	82						CATCCGAGAGCCTCGGGGGTC	0.542																																																	0													51.0	52.0	52.0					19																	17119359		1937	4146	6083	SO:0001583	missense	0			AY101765	CCDS42519.1	19p13.12	2008-02-05			ENSG00000160111	ENSG00000160111			23228	protein-coding gene	gene with protein product		608841				10574462	Standard	NM_015692		Approved	KIAA1283, VIP, K-CAP	uc002nfb.3	Q8IZJ3	OTTHUMG00000133549	ENST00000443236.1:c.656G>T	19.37:g.17119359C>A	ENSP00000402505:p.Gly219Val		Q8NC09|Q9ULD7	Missense_Mutation	SNP	pfam_A2M_comp,pfam_A2M_N_2,pfam_Methyltransf_FA,pfam_Macroglobln_a2,pfam_A-macroglobulin_rcpt-bd,pfam_A2M_N,pfam_MacrogloblnA2_thiol-ester-bond,pfam_Kazal_dom,superfamily_Terpenoid_cyclase/PrenylTrfase,superfamily_A-macroglobulin_rcpt-bd,smart_Kazal_dom	p.G219V	ENST00000443236.1	37	c.656	CCDS42519.1	19	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	17.48|17.48	3.401308|3.401308	0.62288|0.62288	.|.	.|.	ENSG00000160111|ENSG00000160111	ENST00000443236|ENST00000291440;ENST00000388925	.|T;T	.|0.79845	.|-1.31;-1.31	2.84|2.84	2.84|2.84	0.33178|0.33178	.|Alpha-2-macroglobulin, N-terminal (1);	.|0.000000	.|0.64402	.|U	.|0.000013	D|D	0.91136|0.91136	0.7209|0.7209	M|M	0.93241|0.93241	3.395|3.395	0.80722|0.80722	D|D	1|1	.|D	.|0.89917	.|1.0	.|D	.|0.83275	.|0.996	D|D	0.92204|0.92204	0.5770|0.5770	5|10	.|0.54805	.|T	.|0.06	.|.	12.5835|12.5835	0.56403|0.56403	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|172	.|Q8IZJ3	.|CPMD8_HUMAN	S|V	230|219;172	.|ENSP00000291440:G219V;ENSP00000373577:G172V	.|ENSP00000291440:G219V	A|G	-|-	1|2	0|0	CPAMD8|CPAMD8	16980359|16980359	1.000000|1.000000	0.71417|0.71417	0.991000|0.991000	0.47740|0.47740	0.727000|0.727000	0.41649|0.41649	5.730000|5.730000	0.68546|0.68546	1.145000|1.145000	0.42336|0.42336	0.563000|0.563000	0.77884|0.77884	GCT|GGC	CPAMD8	-	pfam_A2M_N	ENSG00000160111		0.542	CPAMD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPAMD8	HGNC	protein_coding	OTTHUMT00000257531.2	-	0.00	43	0	C	NM_015692		17119359	-1	tier1	-	no_errors	ENST00000443236	ensembl	human	known	74_37	missense	18.42	31	7	SNP	1.000	A
CPNE8	144402	genome.wustl.edu	37	12	39047698	39047698	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr12:39047698G>T	ENST00000331366.5	-	20	1777	c.1681C>A	c.(1681-1683)Cag>Aag	p.Q561K	CPNE8_ENST00000538596.2_Missense_Mutation_p.Q230K|CPNE8_ENST00000360449.3_Missense_Mutation_p.Q549K|CPNE8_ENST00000546603.1_5'UTR	NM_153634.2	NP_705898.1	Q86YQ8	CPNE8_HUMAN	copine VIII	561						extracellular vesicular exosome (GO:0070062)				NS(1)|breast(1)|endometrium(1)|large_intestine(6)|lung(6)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(2)	21	Esophageal squamous(101;0.187)	Lung NSC(34;0.137)|Melanoma(24;0.152)|all_lung(34;0.157)				ATTTGAGTCTGTAACACATGT	0.473																																																	0													87.0	81.0	83.0					12																	39047698		2203	4300	6503	SO:0001583	missense	0			AY177785	CCDS8733.1	12q12	2008-02-05				ENSG00000139117			23498	protein-coding gene	gene with protein product						12670487	Standard	NM_153634		Approved		uc001rls.1	Q86YQ8	OTTHUMG00000169396	ENST00000331366.5:c.1681C>A	12.37:g.39047698G>T	ENSP00000329748:p.Gln561Lys		Q2TB41|Q86VY2	Missense_Mutation	SNP	pfam_Copine,pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,smart_VWF_A,pfscan_C2_dom,pfscan_VWF_A	p.Q561K	ENST00000331366.5	37	c.1681	CCDS8733.1	12	.	.	.	.	.	.	.	.	.	.	G	13.05	2.122498	0.37436	.	.	ENSG00000139117	ENST00000331366;ENST00000538596;ENST00000360449	T;T;T	0.23754	1.89;2.01;1.89	4.14	4.14	0.48551	.	0.000000	0.64402	D	0.000001	T	0.15435	0.0372	N	0.08118	0	0.52501	D	0.999954	B	0.26002	0.139	B	0.22152	0.038	T	0.11567	-1.0582	10	0.72032	D	0.01	-3.9177	16.0695	0.80914	0.0:0.0:1.0:0.0	.	561	Q86YQ8	CPNE8_HUMAN	K	561;230;549	ENSP00000329748:Q561K;ENSP00000439237:Q230K;ENSP00000353633:Q549K	ENSP00000329748:Q561K	Q	-	1	0	CPNE8	37333965	1.000000	0.71417	0.995000	0.50966	0.865000	0.49528	8.149000	0.89632	2.230000	0.72887	0.655000	0.94253	CAG	CPNE8	-	NULL	ENSG00000139117		0.473	CPNE8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPNE8	HGNC	protein_coding	OTTHUMT00000403856.1	-	0.00	69	0	G	NM_153634		39047698	-1	tier1	-	no_errors	ENST00000331366	ensembl	human	known	74_37	missense	5.48	69	4	SNP	1.000	T
CPS1	1373	genome.wustl.edu	37	2	211541847	211541847	+	Missense_Mutation	SNP	T	T	C			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr2:211541847T>C	ENST00000233072.5	+	37	4587	c.4391T>C	c.(4390-4392)cTc>cCc	p.L1464P	CPS1_ENST00000430249.2_Missense_Mutation_p.L1470P|CPS1_ENST00000451903.2_Missense_Mutation_p.L1013P	NM_001875.4	NP_001866.2	P31327	CPSM_HUMAN	carbamoyl-phosphate synthase 1, mitochondrial	1464					anion homeostasis (GO:0055081)|carbamoyl phosphate biosynthetic process (GO:0070409)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to cAMP (GO:0071320)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to glucagon stimulus (GO:0071377)|cellular response to oleic acid (GO:0071400)|citrulline biosynthetic process (GO:0019240)|glutamine catabolic process (GO:0006543)|glycogen catabolic process (GO:0005980)|hepatocyte differentiation (GO:0070365)|homocysteine metabolic process (GO:0050667)|midgut development (GO:0007494)|nitric oxide metabolic process (GO:0046209)|positive regulation of vasodilation (GO:0045909)|response to amine (GO:0014075)|response to amino acid (GO:0043200)|response to dexamethasone (GO:0071548)|response to drug (GO:0042493)|response to food (GO:0032094)|response to growth hormone (GO:0060416)|response to lipopolysaccharide (GO:0032496)|response to starvation (GO:0042594)|response to toxic substance (GO:0009636)|response to zinc ion (GO:0010043)|small molecule metabolic process (GO:0044281)|triglyceride catabolic process (GO:0019433)|urea cycle (GO:0000050)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|carbamoyl-phosphate synthase (ammonia) activity (GO:0004087)|endopeptidase activity (GO:0004175)|glutamate binding (GO:0016595)|modified amino acid binding (GO:0072341)|phospholipid binding (GO:0005543)			breast(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(17)|lung(85)|ovary(8)|pancreas(1)|prostate(6)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	142				Epithelial(149;0.00697)|Lung(261;0.0521)|LUSC - Lung squamous cell carcinoma(261;0.0544)|all cancers(144;0.0843)	Carglumic Acid(DB06775)	ATCCCTCTCCTCACTAATTTT	0.398																																																	0													187.0	180.0	182.0					2																	211541847		2203	4300	6503	SO:0001583	missense	0			AF154830	CCDS2393.1, CCDS46505.1, CCDS46506.1	2p	2014-09-17	2010-05-11		ENSG00000021826	ENSG00000021826	6.3.4.16		2323	protein-coding gene	gene with protein product		608307	"""carbamoyl-phosphate synthetase 1, mitochondrial"""				Standard	NM_001122633		Approved		uc002vee.4	P31327	OTTHUMG00000132994	ENST00000233072.5:c.4391T>C	2.37:g.211541847T>C	ENSP00000233072:p.Leu1464Pro		B7Z818|J3KQL0|O43774|Q53TL5|Q59HF8|Q7Z5I5	Missense_Mutation	SNP	pfam_CbamoylP_synth_lsu-like_ATP-bd,pfam_CarbamoylP_synth_ssu_N,pfam_CarbamoylP_synth_lsu_oligo,pfam_GATASE,pfam_CarbamoylP_synth_lsu_N,pfam_MGS-like_dom,pfam_ATP-grasp_carboxylate-amine,pfam_Dala_Dala_lig_C,superfamily_CarbamoylP_synth_lsu_oligo,superfamily_CarbamoylP_synth_ssu_N,superfamily_PreATP-grasp_dom,superfamily_MGS-like_dom,smart_MGS-like_dom,pfscan_ATP-grasp,prints_CbamoylP_synth_lsu_CPSase_dom,tigrfam_CarbamoylP_synth_lsu,tigrfam_CarbamoylP_synth_ssu	p.L1470P	ENST00000233072.5	37	c.4409	CCDS2393.1	2	.	.	.	.	.	.	.	.	.	.	T	19.64	3.866302	0.71949	.	.	ENSG00000021826	ENST00000430249;ENST00000539150;ENST00000233072;ENST00000451903	T;T;T	0.80738	-1.41;-1.41;-1.41	5.66	5.66	0.87406	Methylglyoxal synthase-like domain (4);	0.062767	0.64402	D	0.000005	D	0.90363	0.6984	M	0.87456	2.885	0.80722	D	1	D;D	0.67145	0.996;0.996	D;D	0.65573	0.936;0.936	D	0.92082	0.5673	10	0.87932	D	0	-7.9673	15.8969	0.79341	0.0:0.0:0.0:1.0	.	1474;1464	Q59HF8;P31327	.;CPSM_HUMAN	P	1470;1472;1464;1013	ENSP00000402608:L1470P;ENSP00000233072:L1464P;ENSP00000406136:L1013P	ENSP00000233072:L1464P	L	+	2	0	CPS1	211250092	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	7.207000	0.77899	2.155000	0.67459	0.379000	0.24179	CTC	CPS1	-	pfam_MGS-like_dom,superfamily_MGS-like_dom,smart_MGS-like_dom,tigrfam_CarbamoylP_synth_lsu	ENSG00000021826		0.398	CPS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPS1	HGNC	protein_coding	OTTHUMT00000256569.5	-	0.00	67	0	T			211541847	+1	tier1	-	no_errors	ENST00000430249	ensembl	human	known	74_37	missense	14.29	72	12	SNP	1.000	C
CREB3L4	148327	genome.wustl.edu	37	1	153945466	153945468	+	In_Frame_Del	DEL	AAG	AAG	-			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	AAG	AAG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr1:153945466_153945468delAAG	ENST00000368607.3	+	6	921_923	c.655_657delAAG	c.(655-657)aagdel	p.K220del	CREB3L4_ENST00000368601.1_3'UTR|JTB_ENST00000471173.1_5'Flank|CREB3L4_ENST00000368603.1_In_Frame_Del_p.K220del|CREB3L4_ENST00000405694.3_In_Frame_Del_p.K73del|CREB3L4_ENST00000368600.3_In_Frame_Del_p.K200del|CREB3L4_ENST00000271889.4_In_Frame_Del_p.K220del|CREB3L4_ENST00000468845.1_3'UTR	NM_001255978.1|NM_001255980.1|NM_130898.3	NP_001242907.1|NP_001242909.1|NP_570968.1	Q8TEY5	CR3L4_HUMAN	cAMP responsive element binding protein 3-like 4	220	Basic motif. {ECO:0000255|PROSITE- ProRule:PRU00978}.|bZIP. {ECO:0000255|PROSITE- ProRule:PRU00978}.				response to unfolded protein (GO:0006986)|spermatogenesis (GO:0007283)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(2)|ovary(1)|prostate(3)	13	all_lung(78;3.05e-32)|Lung NSC(65;3.74e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			GAGGGTCCTCAAGAAGGTCAGGA	0.581																																																	0																																										SO:0001651	inframe_deletion	0			AF394167	CCDS1056.1, CCDS58029.1	1q21.2	2013-01-10			ENSG00000143578	ENSG00000143578		"""basic leucine zipper proteins"""	18854	protein-coding gene	gene with protein product		607138					Standard	NM_130898		Approved	AIbZIP, CREB4, CREB3, hJAL, ATCE1	uc001fdr.3	Q8TEY5	OTTHUMG00000037159	ENST00000368607.3:c.655_657delAAG	1.37:g.153945469_153945471delAAG	ENSP00000357596:p.Lys220del		D3DV62|Q5T4L0|Q86YW6	In_Frame_Del	DEL	pfam_bZIP,superfamily_TF_DNA-bd,smart_bZIP,pfscan_bZIP	p.K220in_frame_del	ENST00000368607.3	37	c.655_657	CCDS1056.1	1																																																																																			CREB3L4	-	pfam_bZIP,superfamily_TF_DNA-bd,smart_bZIP,pfscan_bZIP	ENSG00000143578		0.581	CREB3L4-002	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	CREB3L4	HGNC	protein_coding	OTTHUMT00000090291.1		0.00	60	0	AAG	NM_130898		153945468	+1	tier1		no_errors	ENST00000271889	ensembl	human	known	74_37	in_frame_del	10.64	42	5	DEL	1.000:1.000:1.000	-
DDOST	1650	genome.wustl.edu	37	1	20987472	20987472	+	Missense_Mutation	SNP	T	T	A			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr1:20987472T>A	ENST00000375048.3	-	2	323	c.218A>T	c.(217-219)gAg>gTg	p.E73V	DDOST_ENST00000477229.1_5'UTR|DDOST_ENST00000415136.2_Intron|DDOST_ENST00000602624.2_Missense_Mutation_p.E56V	NM_005216.4	NP_005207	P39656	OST48_HUMAN	dolichyl-diphosphooligosaccharide--protein glycosyltransferase subunit (non-catalytic)	73					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|innate immune response (GO:0045087)|post-translational protein modification (GO:0043687)|protein glycosylation (GO:0006486)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)|response to cytokine (GO:0034097)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|T cell activation (GO:0042110)|translation (GO:0006412)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|oligosaccharyltransferase complex (GO:0008250)|protein complex (GO:0043234)	dolichyl-diphosphooligosaccharide-protein glycotransferase activity (GO:0004579)			endometrium(2)|kidney(1)|large_intestine(6)|lung(2)|ovary(1)|skin(1)	13		all_lung(284;2.98e-05)|Lung NSC(340;3.25e-05)|Colorectal(325;3.46e-05)|Renal(390;0.000147)|Breast(348;0.00179)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0181)|COAD - Colon adenocarcinoma(152;1.17e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000141)|Kidney(64;0.000177)|GBM - Glioblastoma multiforme(114;0.00046)|KIRC - Kidney renal clear cell carcinoma(64;0.00262)|STAD - Stomach adenocarcinoma(196;0.00303)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)		GAATGTGAGCTCAAAGCCCCG	0.537																																																	0													62.0	62.0	62.0					1																	20987472		2203	4300	6503	SO:0001583	missense	0			D29643	CCDS212.1	1p36.1	2013-03-06	2013-03-06		ENSG00000244038	ENSG00000244038	2.4.1.119		2728	protein-coding gene	gene with protein product	"""oligosaccharyltransferase subunit 48"""	602202	"""dolichyl-diphosphooligosaccharide-protein glycosyltransferase"", ""dolichyl-diphosphooligosaccharide--protein glycosyltransferase"""			9367678	Standard	NM_005216		Approved	OST, KIAA0115, OST48, WBP1	uc001bdo.1	P39656	OTTHUMG00000002844	ENST00000375048.3:c.218A>T	1.37:g.20987472T>A	ENSP00000364188:p.Glu73Val		B2RDQ4|B4DJE3|B4DLI2|O43244|Q5VWA5|Q8NI93|Q9BUI2	Missense_Mutation	SNP	pfam_WBP1	p.E73V	ENST00000375048.3	37	c.218	CCDS212.1	1	.	.	.	.	.	.	.	.	.	.	T	17.08	3.297852	0.60086	.	.	ENSG00000244038	ENST00000375048	T	0.78595	-1.19	5.1	3.96	0.45880	.	0.109047	0.64402	N	0.000006	T	0.70902	0.3277	L	0.45470	1.425	0.80722	D	1	B;B	0.14805	0.011;0.006	B;B	0.21151	0.022;0.033	T	0.66081	-0.6012	10	0.48119	T	0.1	-11.5095	11.2798	0.49188	0.1424:0.0:0.0:0.8576	.	73;73	B4DLI2;P39656	.;OST48_HUMAN	V	73	ENSP00000364188:E73V	ENSP00000364188:E73V	E	-	2	0	DDOST	20860059	1.000000	0.71417	0.990000	0.47175	0.994000	0.84299	5.013000	0.64023	0.879000	0.35944	0.533000	0.62120	GAG	DDOST	-	pfam_WBP1	ENSG00000244038		0.537	DDOST-001	KNOWN	basic|CCDS	protein_coding	DDOST	HGNC	protein_coding	OTTHUMT00000007961.2	-	0.00	75	0	T	NM_005216		20987472	-1	tier1	-	no_errors	ENST00000375048	ensembl	human	known	74_37	missense	32.35	46	22	SNP	1.000	A
CYB5RL	606495	genome.wustl.edu	37	1	54640384	54640384	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr1:54640384C>T	ENST00000534324.1	-	6	855	c.856G>A	c.(856-858)Gca>Aca	p.A286T	RP11-446E24.4_ENST00000311841.7_Intron|CYB5RL_ENST00000287899.8_Missense_Mutation_p.A218T|CYB5RL_ENST00000537208.1_Missense_Mutation_p.A218T|CYB5RL_ENST00000542737.1_Missense_Mutation_p.A286T|RP11-446E24.4_ENST00000525949.1_5'Flank|CYB5RL_ENST00000401046.3_Missense_Mutation_p.A138T|AL357673.1_ENST00000536061.1_5'Flank|CYB5RL_ENST00000419823.2_Missense_Mutation_p.A286T			Q6IPT4	NB5R5_HUMAN	cytochrome b5 reductase-like	286							cytochrome-b5 reductase activity, acting on NAD(P)H (GO:0004128)	p.A286T(1)		endometrium(1)|kidney(2)|large_intestine(2)|lung(2)|urinary_tract(1)	8						CAGACCAGTGCGAATGGCTTT	0.552																																																	1	Substitution - Missense(1)	large_intestine(1)											39.0	41.0	40.0					1																	54640384		1956	4175	6131	SO:0001583	missense	0				CCDS44151.1	1p32.3	2011-04-08			ENSG00000215883	ENSG00000215883			32220	protein-coding gene	gene with protein product						12477932	Standard	NM_001031672		Approved	LOC606495	uc009vzo.3	Q6IPT4	OTTHUMG00000008082	ENST00000534324.1:c.856G>A	1.37:g.54640384C>T	ENSP00000434343:p.Ala286Thr		B7ZBS4|Q8NF25	Missense_Mutation	SNP	pfam_OxRdtase_FAD-bd_dom,pfam_Oxidoreductase-like_N,pfam_OxRdtase_FAD/NAD-bd,superfamily_Riboflavin_synthase-like_b-brl,prints_NADH-Cyt_B5_reductase,prints_Phe_hydroxylase	p.A286T	ENST00000534324.1	37	c.856	CCDS44151.1	1	.	.	.	.	.	.	.	.	.	.	C	11.71	1.721192	0.30503	.	.	ENSG00000215883	ENST00000419823;ENST00000401046;ENST00000534324;ENST00000287899;ENST00000542737;ENST00000537208	D;D;D;D;D;D	0.87412	-2.25;-2.25;-2.25;-1.97;-2.25;-1.97	5.14	4.22	0.49857	Oxidoreductase FAD/NAD(P)-binding (1);	0.406939	0.17610	N	0.168135	T	0.75421	0.3847	N	0.13003	0.285	0.26081	N	0.981084	B;B	0.22211	0.066;0.048	B;B	0.17098	0.013;0.017	T	0.62358	-0.6871	10	0.25751	T	0.34	-25.7752	11.1905	0.48681	0.0:0.9143:0.0:0.0857	.	286;138	Q6IPT4;Q6IPT4-3	NB5R5_HUMAN;.	T	286;138;286;218;286;218	ENSP00000409075:A286T;ENSP00000383825:A138T;ENSP00000434343:A286T;ENSP00000287899:A218T;ENSP00000438151:A286T;ENSP00000443797:A218T	ENSP00000287899:A218T	A	-	1	0	CYB5RL	54412972	1.000000	0.71417	0.479000	0.27329	0.534000	0.34807	3.607000	0.54102	1.369000	0.46134	0.555000	0.69702	GCA	CYB5RL	-	pfam_OxRdtase_FAD/NAD-bd,prints_NADH-Cyt_B5_reductase	ENSG00000215883		0.552	CYB5RL-010	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	CYB5RL	HGNC	protein_coding	OTTHUMT00000388318.1	-	0.00	56	0	C	NM_001031672		54640384	-1	tier1	-	no_errors	ENST00000419823	ensembl	human	known	74_37	missense	24.62	49	16	SNP	0.975	T
DDX41	51428	genome.wustl.edu	37	5	176940721	176940721	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr5:176940721C>T	ENST00000507955.1	-	10	1586	c.1063G>A	c.(1063-1065)Gag>Aag	p.E355K	DDX41_ENST00000506965.1_5'Flank	NM_016222.2	NP_057306.2	Q9UJV9	DDX41_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 41	355	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				apoptotic process (GO:0006915)|cellular response to interferon-beta (GO:0035458)|defense response to virus (GO:0051607)|innate immune response (GO:0045087)|mRNA splicing, via spliceosome (GO:0000398)|multicellular organismal development (GO:0007275)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|regulation of type I interferon production (GO:0032479)|RNA processing (GO:0006396)	catalytic step 2 spliceosome (GO:0071013)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)					all_cancers(89;0.00033)|Renal(175;0.000269)|Lung NSC(126;0.00161)|all_lung(126;0.00286)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)|Epithelial(233;0.191)			ATGTCACCCTCGAAGCCCATG	0.632																																																	0													111.0	88.0	96.0					5																	176940721		2203	4300	6503	SO:0001583	missense	0			AF195417	CCDS4427.1	5q35.3	2008-02-05			ENSG00000183258	ENSG00000183258		"""DEAD-boxes"""	18674	protein-coding gene	gene with protein product		608170				10607561	Standard	NM_016222		Approved	ABS, MGC8828	uc003mho.3	Q9UJV9	OTTHUMG00000130858	ENST00000507955.1:c.1063G>A	5.37:g.176940721C>T	ENSP00000422753:p.Glu355Lys		B2RDC8|Q96BK6|Q96K05|Q9NT96|Q9NW04	Missense_Mutation	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,superfamily_P-loop_NTPase,superfamily_Znf_CCHC,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_RNA_helicase_DEAD_Q_motif	p.E355K	ENST00000507955.1	37	c.1063	CCDS4427.1	5	.	.	.	.	.	.	.	.	.	.	C	27.3	4.821464	0.90873	.	.	ENSG00000183258	ENST00000330503;ENST00000507955	T;T	0.14893	2.47;2.47	5.91	5.05	0.67936	DEAD-like helicase (2);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.051567	0.85682	N	0.000000	T	0.33000	0.0848	L	0.38649	1.16	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.85130	0.956;0.997	T	0.07520	-1.0768	10	0.87932	D	0	-35.7793	15.1973	0.73104	0.0:0.9325:0.0:0.0675	.	229;355	B3KRK2;Q9UJV9	.;DDX41_HUMAN	K	373;355	ENSP00000330349:E373K;ENSP00000422753:E355K	ENSP00000330349:E373K	E	-	1	0	DDX41	176873327	1.000000	0.71417	0.951000	0.38953	0.539000	0.34962	7.770000	0.85390	1.515000	0.48885	0.655000	0.94253	GAG	DDX41	-	pfam_DNA/RNA_helicase_DEAD/DEAH_N,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,pfscan_Helicase_ATP-bd	ENSG00000183258		0.632	DDX41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX41	HGNC	protein_coding	OTTHUMT00000253432.2	-	0.00	49	0	C	NM_016222		176940721	-1	tier1	-	no_errors	ENST00000507955	ensembl	human	known	74_37	missense	13.89	31	5	SNP	1.000	T
DFNB31	25861	genome.wustl.edu	37	9	117168862	117168862	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr9:117168862G>A	ENST00000362057.3	-	9	2177	c.2009C>T	c.(2008-2010)gCc>gTc	p.A670V	DFNB31_ENST00000265134.6_Missense_Mutation_p.A287V|DFNB31_ENST00000374059.3_Missense_Mutation_p.A319V	NM_001173425.1|NM_015404.3	NP_001166896.1|NP_056219	Q9P202	WHRN_HUMAN	deafness, autosomal recessive 31	670	Pro-rich.				inner ear receptor stereocilium organization (GO:0060122)|retina homeostasis (GO:0001895)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	actin filament (GO:0005884)|cilium (GO:0005929)|cytoplasm (GO:0005737)|stereocilia ankle link complex (GO:0002142)|stereocilium (GO:0032420)				central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(9)|liver(1)|lung(14)|ovary(5)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						GTTGACCAGGGCCAGATGGGC	0.667																																																	0													56.0	66.0	63.0					9																	117168862		2203	4300	6503	SO:0001583	missense	0			AK056190	CCDS6806.1, CCDS43870.1	9q32	2013-06-19			ENSG00000095397	ENSG00000095397			16361	protein-coding gene	gene with protein product	"""whirlin"""	607928				12833159, 17171570	Standard	NM_015404		Approved	CIP98, WHRN, USH2D, PDZD7B	uc004biz.4	Q9P202	OTTHUMG00000020539	ENST00000362057.3:c.2009C>T	9.37:g.117168862G>A	ENSP00000354623:p.Ala670Val		A5PKU1|A5PKZ9|Q5TAU9|Q5TAV0|Q5TAV1|Q5TAV2|Q96MZ9|Q9H9F4|Q9UFZ3	Missense_Mutation	SNP	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.A670V	ENST00000362057.3	37	c.2009	CCDS6806.1	9	.	.	.	.	.	.	.	.	.	.	G	14.43	2.534400	0.45073	.	.	ENSG00000095397	ENST00000265134;ENST00000374059;ENST00000362057	T;T;T	0.07327	4.08;4.06;3.2	5.06	5.06	0.68205	.	0.382721	0.26975	N	0.021550	T	0.13713	0.0332	L	0.54323	1.7	0.80722	D	1	P;P;P	0.48911	0.917;0.862;0.843	P;B;P	0.47346	0.501;0.293;0.544	T	0.00643	-1.1630	10	0.52906	T	0.07	-31.5057	12.8304	0.57742	0.0788:0.0:0.9212:0.0	.	670;670;319	B9EGE6;Q9P202;Q9P202-4	.;WHRN_HUMAN;.	V	287;319;670	ENSP00000265134:A287V;ENSP00000363172:A319V;ENSP00000354623:A670V	ENSP00000265134:A287V	A	-	2	0	DFNB31	116208683	1.000000	0.71417	1.000000	0.80357	0.008000	0.06430	7.215000	0.77966	2.354000	0.79902	0.591000	0.81541	GCC	DFNB31	-	NULL	ENSG00000095397		0.667	DFNB31-004	KNOWN	basic|appris_principal|CCDS	protein_coding	DFNB31	HGNC	protein_coding	OTTHUMT00000053776.2	-	0.00	79	0	G	NM_015404		117168862	-1	tier1	-	no_errors	ENST00000362057	ensembl	human	known	74_37	missense	53.85	36	42	SNP	0.998	A
DGKD	8527	genome.wustl.edu	37	2	234367025	234367025	+	Silent	SNP	G	G	A			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr2:234367025G>A	ENST00000264057.2	+	22	2688	c.2676G>A	c.(2674-2676)caG>caA	p.Q892Q	DGKD_ENST00000409813.3_Silent_p.Q848Q	NM_152879.2	NP_690618.2	Q16760	DGKD_HUMAN	diacylglycerol kinase, delta 130kDa	892					blood coagulation (GO:0007596)|cell growth (GO:0016049)|diacylglycerol metabolic process (GO:0046339)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|multicellular organismal development (GO:0007275)|platelet activation (GO:0030168)|protein homooligomerization (GO:0051260)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein transport (GO:0015031)|response to organic substance (GO:0010033)|second-messenger-mediated signaling (GO:0019932)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol binding (GO:0019992)|diacylglycerol kinase activity (GO:0004143)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			central_nervous_system(2)|endometrium(4)|kidney(1)|large_intestine(13)|lung(15)|ovary(1)|pancreas(1)|skin(1)	38		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0179)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0538)		Epithelial(121;1.31e-16)|BRCA - Breast invasive adenocarcinoma(100;0.000416)|Lung(119;0.00285)|LUSC - Lung squamous cell carcinoma(224;0.00655)	Phosphatidylserine(DB00144)	TCAGGCTACAGCATCATCGGA	0.597																																																	0													110.0	83.0	92.0					2																	234367025		2203	4300	6503	SO:0001819	synonymous_variant	0			D63479	CCDS2504.1, CCDS46546.1	2q37	2013-01-10	2002-08-29		ENSG00000077044	ENSG00000077044		"""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"""	2851	protein-coding gene	gene with protein product	"""diglyceride kinase"""	601826	"""diacylglycerol kinase, delta (130kD)"""			8626538, 12810723	Standard	NM_003648		Approved	KIAA0145, DGKdelta	uc002vui.1	Q16760	OTTHUMG00000133290	ENST00000264057.2:c.2676G>A	2.37:g.234367025G>A			Q14158|Q6PK55|Q8NG53	Silent	SNP	pfam_Diacylglycerol_kin_accessory,pfam_Diacylglycerol_kinase_cat_dom,pfam_SAM_2,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_SAM_type1,pfam_Pleckstrin_homology,superfamily_SAM/pointed,smart_Pleckstrin_homology,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Diacylglycerol_kinase_cat_dom,smart_Diacylglycerol_kin_accessory,smart_SAM,pfscan_Pleckstrin_homology,pfscan_SAM,pfscan_Prot_Kinase_C-like_PE/DAG-bd	p.Q892	ENST00000264057.2	37	c.2676	CCDS2504.1	2																																																																																			DGKD	-	pfam_Diacylglycerol_kin_accessory,smart_Diacylglycerol_kin_accessory	ENSG00000077044		0.597	DGKD-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DGKD	HGNC	protein_coding	OTTHUMT00000257072.2	-	0.00	32	0	G	NM_003648		234367025	+1	tier1	-	no_errors	ENST00000264057	ensembl	human	known	74_37	silent	9.30	39	4	SNP	1.000	A
DIAPH1	1729	genome.wustl.edu	37	5	140953564	140953566	+	In_Frame_Del	DEL	GGA	GGA	-			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	GGA	GGA					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr5:140953564_140953566delGGA	ENST00000398557.4	-	16	1991_1993	c.1851_1853delTCC	c.(1849-1854)cctcca>cca	p.617_618PP>P	DIAPH1_ENST00000389057.5_In_Frame_Del_p.608_609PP>P|DIAPH1_ENST00000518047.1_In_Frame_Del_p.608_609PP>P|DIAPH1_ENST00000520569.1_In_Frame_Del_p.563_564PP>P|DIAPH1_ENST00000398566.3_In_Frame_Del_p.608_609PP>P|DIAPH1_ENST00000389054.3_In_Frame_Del_p.617_618PP>P|DIAPH1_ENST00000253811.6_In_Frame_Del_p.617_618PP>P|DIAPH1_ENST00000398562.2_In_Frame_Del_p.608_609PP>P	NM_005219.4	NP_005210.3	O60610	DIAP1_HUMAN	diaphanous-related formin 1	617	FH1.				actin filament polymerization (GO:0030041)|cellular response to histamine (GO:0071420)|cytoskeleton organization (GO:0007010)|positive regulation of cell migration (GO:0030335)|protein localization to microtubule (GO:0035372)|regulation of cell shape (GO:0008360)|regulation of microtubule-based process (GO:0032886)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|mitotic spindle (GO:0072686)|ruffle membrane (GO:0032587)	ion channel binding (GO:0044325)|poly(A) RNA binding (GO:0044822)|receptor binding (GO:0005102)			breast(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(12)|pancreas(1)|skin(2)|stomach(2)	23			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CAAaggaggtggaggaggaggag	0.576																																																	0																																										SO:0001651	inframe_deletion	0			BC007411		5q31	2013-05-24	2013-05-24		ENSG00000131504	ENSG00000131504			2876	protein-coding gene	gene with protein product		602121	"""diaphanous (Drosophila, homolog) 1"", ""diaphanous homolog 1 (Drosophila)"""	DFNA1		9360932, 1350680	Standard	NM_005219		Approved	hDIA1, LFHL1	uc003llb.4	O60610	OTTHUMG00000149893	ENST00000398557.4:c.1851_1853delTCC	5.37:g.140953573_140953575delGGA	ENSP00000381565:p.Pro620del		A6NF18|B7ZKW2|E9PEZ2|Q17RN4|Q59FH8|Q9UC76	In_Frame_Del	DEL	pfam_FH2_Formin,pfam_FH3_dom,pfam_GTPase-bd,pfam_Formin_homology_1,pfam_Drf_DAD,superfamily_ARM-type_fold,superfamily_tRNA-bd_arm,smart_FH2_Formin	p.P620in_frame_del	ENST00000398557.4	37	c.1853_1851	CCDS43374.1	5																																																																																			DIAPH1	-	pfam_Formin_homology_1	ENSG00000131504		0.576	DIAPH1-203	KNOWN	basic|appris_candidate|CCDS	protein_coding	DIAPH1	HGNC	protein_coding			0.00	24	0	GGA	NM_005219		140953566	-1	tier1		no_errors	ENST00000253811	ensembl	human	known	74_37	in_frame_del	21.43	11	3	DEL	0.010:0.008:0.007	-
DMD	1756	genome.wustl.edu	37	X	32503127	32503128	+	Missense_Mutation	DNP	GG	GG	AT			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chrX:32503127_32503128GG>AT	ENST00000357033.4	-	21	2917_2918	c.2711_2712CC>AT	c.(2710-2712)cCC>cAT	p.P904H	DMD_ENST00000378677.2_Missense_Mutation_p.P900H	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin	904					cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				CCAGGAACATGGGTCCTTGTCC	0.411																																																	0																																										SO:0001583	missense	0			AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.2711_2712delinsAT	X.37:g.32503127_32503128delinsAT	ENSP00000354923:p.Pro904His		E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Silent|Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_EF-hand_dom_typ1,pfam_EF-hand_dom_typ2,pfam_CH-domain,pfam_Znf_ZZ,pfam_WW_dom,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_WW_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_WW_dom,smart_Znf_ZZ,pirsf_Dystrophin/utrophin,pfscan_CH-domain,pfscan_WW_dom,pfscan_Znf_ZZ	p.P904|p.P904H	ENST00000357033.4	37	c.2712|c.2711	CCDS14233.1	X																																																																																			DMD	-	pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin,pirsf_Dystrophin/utrophin	ENSG00000198947		0.411	DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DMD	HGNC	protein_coding	OTTHUMT00000056182.2	-	0.00	23	0	G	NM_004006		32503127|32503128	-1	tier1	-	no_errors	ENST00000357033	ensembl	human	known	74_37	silent|missense	60.87	9	14	SNP	0.997|1.000	A|T
DMXL1	1657	genome.wustl.edu	37	5	118576136	118576136	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr5:118576136C>T	ENST00000311085.8	+	41	8691	c.8611C>T	c.(8611-8613)Ctt>Ttt	p.L2871F	DMXL1_ENST00000539542.1_Missense_Mutation_p.L2892F|DMXL1_ENST00000505312.1_3'UTR	NM_005509.4	NP_005500.4	Q9Y485	DMXL1_HUMAN	Dmx-like 1	2871										breast(3)|central_nervous_system(1)|endometrium(14)|kidney(4)|large_intestine(20)|liver(6)|lung(28)|ovary(2)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)	86		all_cancers(142;0.0314)|all_epithelial(76;0.00559)|Prostate(80;0.11)|Breast(839;0.231)		OV - Ovarian serous cystadenocarcinoma(64;0.000563)|Epithelial(69;0.00179)|all cancers(49;0.0243)		GTGGGATACTCTTGTAGCACC	0.289																																																	0													78.0	88.0	84.0					5																	118576136		2201	4299	6500	SO:0001583	missense	0			AJ005821	CCDS4125.1, CCDS75289.1	5q22	2013-01-10			ENSG00000172869	ENSG00000172869		"""WD repeat domain containing"""	2937	protein-coding gene	gene with protein product		605671				10708522	Standard	NM_005509		Approved		uc003ksd.2	Q9Y485	OTTHUMG00000128898	ENST00000311085.8:c.8611C>T	5.37:g.118576136C>T	ENSP00000309690:p.Leu2871Phe			Missense_Mutation	SNP	pfam_Rav1p_C,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.L2892F	ENST00000311085.8	37	c.8674	CCDS4125.1	5	.	.	.	.	.	.	.	.	.	.	C	22.8	4.338837	0.81911	.	.	ENSG00000172869	ENST00000311085;ENST00000539542	T;T	0.01323	5.01;5.01	5.34	5.34	0.76211	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.08223	0.0205	M	0.75615	2.305	0.58432	D	0.999997	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	T	0.00491	-1.1708	10	0.87932	D	0	-14.1446	14.3471	0.66675	0.0:0.9263:0.0:0.0737	.	2892;2871	F5H269;Q9Y485	.;DMXL1_HUMAN	F	2871;2892	ENSP00000309690:L2871F;ENSP00000439479:L2892F	ENSP00000309690:L2871F	L	+	1	0	DMXL1	118604035	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.224000	0.51238	2.512000	0.84698	0.650000	0.86243	CTT	DMXL1	-	superfamily_WD40_repeat_dom	ENSG00000172869		0.289	DMXL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DMXL1	HGNC	protein_coding	OTTHUMT00000250862.1	-	0.00	39	0	C	NM_005509		118576136	+1	tier1	-	no_errors	ENST00000539542	ensembl	human	known	74_37	missense	28.57	15	6	SNP	1.000	T
DOCK3	1795	genome.wustl.edu	37	3	50927459	50927459	+	Silent	SNP	G	G	A			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr3:50927459G>A	ENST00000266037.9	+	4	188	c.165G>A	c.(163-165)ggG>ggA	p.G55G		NM_004947.4	NP_004938.1	Q8IZD9	DOCK3_HUMAN	dedicator of cytokinesis 3	55	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(2)|cervix(1)|endometrium(10)|kidney(4)|lung(22)|prostate(5)|urinary_tract(1)	45				BRCA - Breast invasive adenocarcinoma(193;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00449)|Kidney(197;0.00518)		TTTTACAGGGGATCTTTCCTG	0.299																																																	0													89.0	76.0	80.0					3																	50927459		692	1585	2277	SO:0001819	synonymous_variant	0			AB002297	CCDS46835.1	3p21	2008-02-01			ENSG00000088538	ENSG00000088538			2989	protein-coding gene	gene with protein product		603123	"""dedicator of cyto-kinesis 3"""			9205841	Standard	NM_004947		Approved	KIAA0299, MOCA, PBP	uc011bds.2	Q8IZD9	OTTHUMG00000156892	ENST00000266037.9:c.165G>A	3.37:g.50927459G>A			O15017	Silent	SNP	pfam_DOCK_C,pfam_SH3_2,superfamily_SH3_domain,superfamily_ARM-type_fold,smart_SH3_domain,pfscan_SH3_domain	p.G55	ENST00000266037.9	37	c.165	CCDS46835.1	3																																																																																			DOCK3	-	pfam_SH3_2,superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain	ENSG00000088538		0.299	DOCK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK3	HGNC	protein_coding	OTTHUMT00000346478.5	-	0.00	48	0	G	NM_004947		50927459	+1	tier1	-	no_errors	ENST00000266037	ensembl	human	known	74_37	silent	36.17	29	17	SNP	1.000	A
DPY19L2P1	554236	genome.wustl.edu	37	7	35121037	35121037	+	IGR	SNP	A	A	C			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr7:35121037A>C								DPY19L1 (43384 upstream) : DPY19L2P1 (8418 downstream)																							CAATGAACAGAAAAGTAATTT	0.239																																																	0																																										SO:0001628	intergenic_variant	0																															7.37:g.35121037A>C				RNA	SNP	-	NULL		37	NULL		7																																																																																			DPY19L2P1	-	-	ENSG00000189212	0	0.239					DPY19L2P1	HGNC			-	0.00	15	0	A			35121037	-1	tier1	-	no_errors	ENST00000458672	ensembl	human	known	74_37	rna	50.00	4	4	SNP	0.005	C
EBPL	84650	genome.wustl.edu	37	13	50235208	50235209	+	Frame_Shift_Ins	INS	-	-	A	rs369293935		TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr13:50235208_50235209insA	ENST00000242827.6	-	4	566_567	c.516_517insT	c.(514-519)tttaacfs	p.N173fs	EBPL_ENST00000378270.5_Stop_Codon_Ins|EBPL_ENST00000378272.5_3'UTR|EBPL_ENST00000495963.2_5'UTR|EBPL_ENST00000378284.2_3'UTR	NM_032565.3	NP_115954.1	Q9BY08	EBPL_HUMAN	emopamil binding protein-like	173					sterol metabolic process (GO:0016125)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	cholestenol delta-isomerase activity (GO:0047750)	p.F172fs*7(1)		endometrium(8)|kidney(6)|lung(3)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	21		Lung NSC(96;0.000468)|Breast(56;0.0011)|Prostate(109;0.00243)|Hepatocellular(98;0.0556)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(99;2.06e-09)		CACACACCGTTAAAAAAAAACA	0.48																																					NSCLC(39;857 1083 36109 42364 51411)												1	Deletion - Frameshift(1)	ovary(1)																																								SO:0001589	frameshift_variant	0			AF243433	CCDS9420.1, CCDS61334.1	13q12-q13	2008-02-05			ENSG00000123179	ENSG00000123179			18061	protein-coding gene	gene with protein product							Standard	NM_032565		Approved	EBRP	uc001vdg.3	Q9BY08	OTTHUMG00000016920	ENST00000242827.6:c.517dupT	13.37:g.50235217_50235217dupA	ENSP00000242827:p.Asn173fs		A6NJ59|Q569H7|Q5JVN2|Q5JVN3|Q5JVN4|Q5JVN5|Q5JVN6	Frame_Shift_Ins	INS	pfam_EBP	p.N172fs	ENST00000242827.6	37	c.517_516	CCDS9420.1	13																																																																																			EBPL	-	pfam_EBP	ENSG00000123179		0.480	EBPL-002	KNOWN	basic|appris_principal|CCDS	protein_coding	EBPL	HGNC	protein_coding	OTTHUMT00000044932.2		0.00	53	0	-	NM_032565		50235209	-1	tier1		no_errors	ENST00000242827	ensembl	human	known	74_37	frame_shift_ins	7.89	35	3	INS	1.000:0.997	A
EIF3E	3646	genome.wustl.edu	37	8	109229586	109229586	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr8:109229586C>T	ENST00000220849.5	-	8	888	c.826G>A	c.(826-828)Gat>Aat	p.D276N	EIF3E_ENST00000519030.1_Missense_Mutation_p.D183N|EIF3E_ENST00000519517.1_5'UTR	NM_001568.2	NP_001559.1			eukaryotic translation initiation factor 3, subunit E										EIF3E/RSPO2(6)	NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(10)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30			OV - Ovarian serous cystadenocarcinoma(57;6.84e-10)			TTAACTAGATCTTTTAGAACC	0.318																																					GBM(15;360 410 8460 34179 52246)												0													54.0	50.0	51.0					8																	109229586		2197	4297	6494	SO:0001583	missense	0			U94175	CCDS6308.1	8q22-q23	2010-03-10	2007-07-27	2007-07-27	ENSG00000104408	ENSG00000104408			3277	protein-coding gene	gene with protein product		602210	"""eukaryotic translation initiation factor 3, subunit 6 48kDa"""	INT6, EIF3S6		9403073, 9295280	Standard	NM_001568		Approved	eIF3-p48, eIF3e	uc003ymu.3	P60228	OTTHUMG00000164858	ENST00000220849.5:c.826G>A	8.37:g.109229586C>T	ENSP00000220849:p.Asp276Asn			Missense_Mutation	SNP	pfam_eIF3e_N,pfam_PCI_dom,smart_PCI_dom,pirsf_eIF3e	p.D276N	ENST00000220849.5	37	c.826	CCDS6308.1	8	.	.	.	.	.	.	.	.	.	.	C	21.7	4.188035	0.78789	.	.	ENSG00000104408	ENST00000220849;ENST00000519030;ENST00000519627	T;T;T	0.42900	0.96;0.96;0.96	5.29	5.29	0.74685	.	0.099158	0.64402	D	0.000002	T	0.71533	0.3351	M	0.90309	3.105	0.80722	D	1	P;D	0.89917	0.821;1.0	B;D	0.79108	0.313;0.992	T	0.77986	-0.2381	10	0.87932	D	0	-17.3244	17.4742	0.87655	0.0:1.0:0.0:0.0	.	276;276	B2R806;P60228	.;EIF3E_HUMAN	N	276;183;149	ENSP00000220849:D276N;ENSP00000428796:D183N;ENSP00000430839:D149N	ENSP00000220849:D276N	D	-	1	0	EIF3E	109298762	1.000000	0.71417	0.998000	0.56505	0.211000	0.24417	7.776000	0.85560	2.640000	0.89533	0.655000	0.94253	GAT	EIF3E	-	pirsf_eIF3e	ENSG00000104408		0.318	EIF3E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EIF3E	HGNC	protein_coding	OTTHUMT00000380612.2	-	0.00	54	0	C	NM_001568		109229586	-1	tier1	-	no_errors	ENST00000220849	ensembl	human	known	74_37	missense	45.05	50	41	SNP	1.000	T
EIF3J	8669	genome.wustl.edu	37	15	44846786	44846786	+	Silent	SNP	A	A	G			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr15:44846786A>G	ENST00000535391.1	+	5	342	c.330A>G	c.(328-330)ccA>ccG	p.P110P	EIF3J_ENST00000424492.3_Silent_p.P61P|EIF3J_ENST00000261868.5_Silent_p.P110P					eukaryotic translation initiation factor 3, subunit J											endometrium(1)|large_intestine(5)|liver(2)|skin(1)	9		all_cancers(109;2.81e-14)|all_epithelial(112;2.8e-12)|Lung NSC(122;1.66e-07)|all_lung(180;1.47e-06)|Melanoma(134;0.0122)		all cancers(107;3.13e-20)|GBM - Glioblastoma multiforme(94;9.81e-07)|COAD - Colon adenocarcinoma(120;0.0754)|Colorectal(105;0.0758)		TGCTAACACCAGAAGAACAAT	0.373																																																	0													104.0	101.0	102.0					15																	44846786		2198	4298	6496	SO:0001819	synonymous_variant	0			U97670	CCDS10111.1, CCDS61612.1, CCDS61613.1	15q21.1	2014-05-13	2007-07-27	2007-07-27	ENSG00000104131	ENSG00000104131			3270	protein-coding gene	gene with protein product		603910	"""eukaryotic translation initiation factor 3, subunit 1 alpha, 35kDa"""	EIF3S1		9822659	Standard	NM_001284335		Approved	eIF3-p35, eIF3-alpha, eIF3j	uc001ztv.3	O75822	OTTHUMG00000131158	ENST00000535391.1:c.330A>G	15.37:g.44846786A>G				Silent	SNP	pfam_eIF3j	p.P110	ENST00000535391.1	37	c.330		15																																																																																			EIF3J	-	pfam_eIF3j	ENSG00000104131		0.373	EIF3J-002	NOVEL	basic|exp_conf	protein_coding	EIF3J	HGNC	protein_coding	OTTHUMT00000396804.1	-	0.00	58	0	A	NM_003758		44846786	+1	tier1	-	no_errors	ENST00000261868	ensembl	human	known	74_37	silent	22.41	45	13	SNP	0.998	G
ELMO2	63916	genome.wustl.edu	37	20	45017766	45017766	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr20:45017766C>G	ENST00000290246.6	-	7	531	c.337G>C	c.(337-339)Gac>Cac	p.D113H	ELMO2_ENST00000439931.2_Missense_Mutation_p.D113H|ELMO2_ENST00000372176.1_Missense_Mutation_p.D25H|ELMO2_ENST00000488853.1_5'UTR|ELMO2_ENST00000445496.2_5'UTR|ELMO2_ENST00000352077.2_Missense_Mutation_p.D113H|ELMO2_ENST00000396391.1_Missense_Mutation_p.D113H	NM_133171.3	NP_573403.1	Q96JJ3	ELMO2_HUMAN	engulfment and cell motility 2	113					apoptotic process (GO:0006915)|cell chemotaxis (GO:0060326)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|membrane (GO:0016020)	receptor tyrosine kinase binding (GO:0030971)			breast(1)|endometrium(1)|large_intestine(4)|lung(8)|ovary(1)|urinary_tract(1)	16		Myeloproliferative disorder(115;0.0122)				AAAGTCACGTCGGCAGAGAGC	0.557																																																	0													152.0	114.0	127.0					20																	45017766		2203	4300	6503	SO:0001583	missense	0			AF398886	CCDS13398.1	20q13	2010-03-18	2006-01-20		ENSG00000062598	ENSG00000062598		"""Engulfment and cell motility proteins"""	17233	protein-coding gene	gene with protein product		606421	"""engulfment and cell motility 2 (ced-12 homolog, C. elegans)"""			11595183	Standard	NM_133171		Approved	CED12, ELMO-2, CED-12, KIAA1834, FLJ11656	uc002xru.1	Q96JJ3	OTTHUMG00000033070	ENST00000290246.6:c.337G>C	20.37:g.45017766C>G	ENSP00000290246:p.Asp113His		E1P5T3|Q5JVZ6|Q7Z5G9|Q96CJ2|Q96ME5|Q96PA9|Q9H938|Q9H9L5|Q9HAH0|Q9NQQ6	Missense_Mutation	SNP	pfam_DUF3361,pfam_Engulfment_cell_motility_ELMO,superfamily_ARM-type_fold	p.D113H	ENST00000290246.6	37	c.337	CCDS13398.1	20	.	.	.	.	.	.	.	.	.	.	C	27.8	4.861167	0.91433	.	.	ENSG00000062598	ENST00000290246;ENST00000372176;ENST00000396391;ENST00000439931;ENST00000352077;ENST00000450812	T;T;T;T;T;T	0.54479	0.57;0.57;0.57;0.57;0.57;0.57	5.31	5.31	0.75309	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.75803	0.3899	M	0.83223	2.63	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	T	0.79831	-0.1637	10	0.87932	D	0	-25.1672	17.9654	0.89099	0.0:1.0:0.0:0.0	.	113;113	B4DRL5;Q96JJ3	.;ELMO2_HUMAN	H	113;25;113;113;113;113	ENSP00000290246:D113H;ENSP00000361249:D25H;ENSP00000379673:D113H;ENSP00000396519:D113H;ENSP00000326172:D113H;ENSP00000416181:D113H	ENSP00000290246:D113H	D	-	1	0	ELMO2	44451173	1.000000	0.71417	0.664000	0.29753	0.970000	0.65996	7.676000	0.84012	2.461000	0.83175	0.591000	0.81541	GAC	ELMO2	-	superfamily_ARM-type_fold	ENSG00000062598		0.557	ELMO2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ELMO2	HGNC	protein_coding	OTTHUMT00000080466.1	-	0.00	42	0	C	NM_022086		45017766	-1	tier1	-	no_errors	ENST00000439931	ensembl	human	known	74_37	missense	19.51	66	16	SNP	1.000	G
EML4	27436	genome.wustl.edu	37	2	42508024	42508024	+	Silent	SNP	G	G	A			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr2:42508024G>A	ENST00000318522.5	+	7	964	c.702G>A	c.(700-702)cgG>cgA	p.R234R	EML4_ENST00000402711.2_Silent_p.R176R|EML4_ENST00000401738.3_Silent_p.R245R	NM_019063.3	NP_061936	Q9HC35	EMAL4_HUMAN	echinoderm microtubule associated protein like 4	234					microtubule-based process (GO:0007017)|mitotic nuclear division (GO:0007067)|negative regulation of microtubule depolymerization (GO:0007026)	cytoplasm (GO:0005737)|membrane (GO:0016020)|microtubule (GO:0005874)|mitotic spindle (GO:0072686)			EML4/ALK(543)	NS(2)|breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	12						TGCGCGGTCGGCCAATTACCA	0.398			T	ALK	NSCLC																																			Dom	yes		2	2p21	27436	echinoderm microtubule associated protein like 4		E	0													100.0	90.0	93.0					2																	42508024		2203	4300	6503	SO:0001819	synonymous_variant	0			AF177377	CCDS1807.1, CCDS46266.1	2p21	2013-01-10		2002-02-15	ENSG00000143924	ENSG00000143924		"""WD repeat domain containing"""	1316	protein-coding gene	gene with protein product		607442		C2orf2			Standard	NM_019063		Approved	ROPP120, ELP120	uc002rsi.3	Q9HC35	OTTHUMG00000128603	ENST00000318522.5:c.702G>A	2.37:g.42508024G>A			A6H8Y6|B2RBK3|B2RTW7|B5MCW9|Q3SWW0|Q53R29|Q53TW8|Q6PJ45|Q9NV40	Silent	SNP	pfam_HELP,pfam_WD40_repeat,superfamily_Quinonprotein_ADH-like_supfam,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.R234	ENST00000318522.5	37	c.702	CCDS1807.1	2																																																																																			EML4	-	pfam_HELP	ENSG00000143924		0.398	EML4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EML4	HGNC	protein_coding	OTTHUMT00000250463.3	-	0.00	65	0	G	NM_019063		42508024	+1	tier1	-	no_errors	ENST00000318522	ensembl	human	known	74_37	silent	5.26	72	4	SNP	0.998	A
EML5	161436	genome.wustl.edu	37	14	89124637	89124637	+	Silent	SNP	G	G	A			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr14:89124637G>A	ENST00000380664.5	-	26	3770	c.3771C>T	c.(3769-3771)ggC>ggT	p.G1257G	EML5_ENST00000352093.5_Silent_p.G1219G|EML5_ENST00000554922.1_Silent_p.G1257G			Q05BV3	EMAL5_HUMAN	echinoderm microtubule associated protein like 5	1257						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)	catalytic activity (GO:0003824)			breast(1)|endometrium(3)|kidney(4)|large_intestine(17)|lung(14)|ovary(3)|pancreas(1)|prostate(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	50						TATCTGTACCGCCTAGGGTAA	0.413																																																	0													142.0	130.0	134.0					14																	89124637		1899	4118	6017	SO:0001819	synonymous_variant	0			AY357725	CCDS45148.1	14q31.3	2013-01-10				ENSG00000165521		"""WD repeat domain containing"""	18197	protein-coding gene	gene with protein product							Standard	NM_183387		Approved	HuEMAP-2, EMAP-2	uc021ryf.1	Q05BV3		ENST00000380664.5:c.3771C>T	14.37:g.89124637G>A			B9EK59|Q5H9N6|Q6UYC9|Q6ZRP3|Q6ZT03	Silent	SNP	pfam_WD40_repeat,pfam_HELP,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.G1257	ENST00000380664.5	37	c.3771	CCDS45148.1	14																																																																																			EML5	-	superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat	ENSG00000165521		0.413	EML5-010	KNOWN	basic|CCDS	protein_coding	EML5	HGNC	protein_coding	OTTHUMT00000410491.1	-	0.00	49	0	G			89124637	-1	tier1	-	no_errors	ENST00000554922	ensembl	human	known	74_37	silent	15.00	51	9	SNP	1.000	A
RP11-382F24.2	0	genome.wustl.edu	37	X	55308300	55308300	+	RNA	SNP	A	A	G			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chrX:55308300A>G	ENST00000440645.2	+	0	100																											CCTTAGGTCCAGCAGCCCACT	0.418																																																	0																																												0																															X.37:g.55308300A>G				RNA	SNP	-	NULL	ENST00000440645.2	37	NULL		X																																																																																			RP11-382F24.2	-	-	ENSG00000232765		0.418	RP11-382F24.2-001	KNOWN	basic	processed_transcript	ENSG00000232765	Clone_based_vega_gene	processed_transcript	OTTHUMT00000056864.2	-	0.00	35	0	A			55308300	+1	tier1	-	no_errors	ENST00000440645	ensembl	human	known	74_37	rna	69.57	7	16	SNP	0.002	G
LAMA4	3910	genome.wustl.edu	37	6	112476699	112476699	+	Intron	SNP	G	G	T	rs143949369	byFrequency	TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr6:112476699G>T	ENST00000230538.7	-	15	2357				RP1-142L7.5_ENST00000585373.1_RNA|LAMA4_ENST00000389463.4_Intron|LAMA4_ENST00000424408.2_Intron|RP1-142L7.5_ENST00000588689.1_RNA|RP1-142L7.5_ENST00000425503.1_RNA|LAMA4_ENST00000522006.1_Intron	NM_001105206.2	NP_001098676.2	Q16363	LAMA4_HUMAN	laminin, alpha 4						blood vessel development (GO:0001568)|brown fat cell differentiation (GO:0050873)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)	extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(42)|ovary(4)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(8)	100		all_cancers(87;0.000196)|all_hematologic(75;0.000114)|all_epithelial(87;0.00542)|Colorectal(196;0.0209)		all cancers(137;0.0335)|OV - Ovarian serous cystadenocarcinoma(136;0.0578)|Epithelial(106;0.0748)|BRCA - Breast invasive adenocarcinoma(108;0.242)		AAGTTCAAGAGATGACATCAG	0.418																																																	0																																										SO:0001627	intron_variant	0				CCDS34514.1, CCDS43491.1, CCDS43492.1	6q21	2014-09-17			ENSG00000112769	ENSG00000112769		"""Laminins"""	6484	protein-coding gene	gene with protein product		600133				7959779	Standard	NM_001105206		Approved	LAMA3	uc003pvu.3	Q16363	OTTHUMG00000015386	ENST00000230538.7:c.1959+67C>A	6.37:g.112476699G>T			Q14731|Q14735|Q15335|Q4LE44|Q5SZG8|Q9BTB8|Q9UE18|Q9UJN9	RNA	SNP	-	NULL	ENST00000230538.7	37	NULL	CCDS43491.1	6																																																																																			RP1-142L7.5	-	-	ENSG00000237234		0.418	LAMA4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ENSG00000237234	Clone_based_vega_gene	protein_coding	OTTHUMT00000041876.2	-	0.00	27	0	G	NM_001105206		112476699	+1	tier1	-	no_errors	ENST00000425503	ensembl	human	known	74_37	rna	13.04	20	3	SNP	0.156	T
C5orf17	439936	genome.wustl.edu	37	5	23972401	23972401	+	Intron	SNP	C	C	T			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr5:23972401C>T	ENST00000507936.1	+	2	240				SNORA40_ENST00000516274.1_RNA			Q8NAS9	CE017_HUMAN	chromosome 5 open reading frame 17																		GTCCACAAGACCTCAATGTTT	0.333																																																	0																																										SO:0001627	intron_variant	0			AK092155		5p14.2	2011-11-24			ENSG00000248874	ENSG00000248874			26630	protein-coding gene	gene with protein product							Standard			Approved	FLJ34836		Q8NAS9	OTTHUMG00000161911	ENST00000507936.1:c.241-3705C>T	5.37:g.23972401C>T			Q2I376	RNA	SNP	-	NULL	ENST00000507936.1	37	NULL		5																																																																																			SNORA40	-	-	ENSG00000252083		0.333	C5orf17-002	KNOWN	basic|appris_principal	protein_coding	ENSG00000252083	RFAM	protein_coding	OTTHUMT00000366366.1	-	0.00	12	0	C	NM_173668		23972401	-1	tier1	-	no_errors	ENST00000516274	ensembl	human	novel	74_37	rna	37.50	10	6	SNP	0.569	T
MGAM2	93432	genome.wustl.edu	37	7	141864787	141864787	+	Silent	SNP	C	C	T			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr7:141864787C>T	ENST00000477922.3	+	24	2670	c.2616C>T	c.(2614-2616)acC>acT	p.T872T																	endometrium(1)|lung(5)	6						ATGTTGCCACCTCCAGTCCAA	0.468																																																	0																																										SO:0001819	synonymous_variant	0																														ENST00000477922.3:c.2616C>T	7.37:g.141864787C>T				Silent	SNP	pfam_Glyco_hydro_31,pfam_P_trefoil,superfamily_Glycoside_hydrolase_SF,superfamily_Gal_mutarotase_SF_dom,superfamily_P_trefoil,smart_P_trefoil	p.T872	ENST00000477922.3	37	c.2616		7																																																																																			RP11-1220K2.2	-	NULL	ENSG00000257743		0.468	RP11-1220K2.2-003	PUTATIVE	not_best_in_genome_evidence|basic|appris_principal|exp_conf	protein_coding	ENSG00000257743	Clone_based_vega_gene	protein_coding	OTTHUMT00000351325.3	-	0.00	34	0	C			141864787	+1	tier1	-	no_errors	ENST00000477922	ensembl	human	putative	74_37	silent	14.29	47	8	SNP	0.000	T
ACOT6	641372	genome.wustl.edu	37	14	74083849	74083849	+	5'UTR	SNP	C	C	G			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr14:74083849C>G	ENST00000381139.1	+	0	302				RP3-414A15.10_ENST00000555011.1_RNA|RP3-414A15.10_ENST00000555500.1_RNA	NM_001037162.1	NP_001032239.1	Q3I5F7	ACOT6_HUMAN	acyl-CoA thioesterase 6							cytosol (GO:0005829)	carboxylic ester hydrolase activity (GO:0052689)			endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|urinary_tract(1)	7				BRCA - Breast invasive adenocarcinoma(234;0.00331)		TGATGTACATCTGGAGTACTT	0.507																																																	0													166.0	175.0	172.0					14																	74083849		2203	4300	6503	SO:0001623	5_prime_UTR_variant	0			DQ082756, BF109853	CCDS32118.1	14q24.3	2011-02-16			ENSG00000205669	ENSG00000205669		"""Acyl CoA thioesterases"""	33159	protein-coding gene	gene with protein product		614267	"""chromosome 14 open reading frame 42"""	C14orf42		16940157	Standard	NM_001037162		Approved		uc001xop.3	Q3I5F7		ENST00000381139.1:c.-30C>G	14.37:g.74083849C>G				RNA	SNP	-	NULL	ENST00000381139.1	37	NULL	CCDS32118.1	14																																																																																			RP3-414A15.10	-	-	ENSG00000258603		0.507	ACOT6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000258603	Clone_based_vega_gene	protein_coding	OTTHUMT00000414437.1	-	0.00	59	0	C	NM_001037162		74083849	-1	tier1	-	no_errors	ENST00000555011	ensembl	human	known	74_37	rna	38.10	39	24	SNP	0.971	G
ERN2	10595	genome.wustl.edu	37	16	23706340	23706340	+	Splice_Site	SNP	C	C	T			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr16:23706340C>T	ENST00000457008.2	-	15	1782	c.1744G>A	c.(1744-1746)Gtg>Atg	p.V582M	ERN2_ENST00000256797.4_Splice_Site_p.V682M					endoplasmic reticulum to nucleus signaling 2											large_intestine(2)|lung(2)|ovary(2)	6				GBM - Glioblastoma multiforme(48;0.0156)		GTGCGGGTACCTATGTGTAAA	0.637																																																	0													82.0	91.0	88.0					16																	23706340		2197	4300	6497	SO:0001630	splice_region_variant	0			AA527544	CCDS32407.1	16p12.2	2008-02-05	2007-08-14			ENSG00000134398			16942	protein-coding gene	gene with protein product		604034	"""ER to nucleus signalling 2"""			9755171, 11175748	Standard	NM_033266		Approved	IRE1b	uc002dma.4	Q76MJ5		ENST00000457008.2:c.1744+1G>A	16.37:g.23706340C>T				Missense_Mutation	SNP	pfam_KEN_dom,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Quinonprotein_ADH-like_supfam,smart_PQQ_beta_propeller_repeat,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_PUG-dom,pfscan_Prot_kinase_dom	p.V682M	ENST00000457008.2	37	c.2044		16	.	.	.	.	.	.	.	.	.	.	C	31	5.083054	0.94050	.	.	ENSG00000134398	ENST00000256797;ENST00000457008	T;T	0.55930	0.49;0.49	5.39	5.39	0.77823	.	0.000000	0.85682	D	0.000000	T	0.70064	0.3181	M	0.61703	1.905	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.68337	-0.5435	9	.	.	.	.	16.9969	0.86370	0.0:1.0:0.0:0.0	.	582;634	E7ETG2;A5YM65	.;.	M	682;582	ENSP00000256797:V682M;ENSP00000413812:V582M	.	V	-	1	0	ERN2	23613841	1.000000	0.71417	1.000000	0.80357	0.895000	0.52256	7.392000	0.79840	2.676000	0.91093	0.655000	0.94253	GTG	ERN2	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000134398		0.637	ERN2-002	NOVEL	basic|exp_conf	protein_coding	ERN2	HGNC	protein_coding	OTTHUMT00000434886.1	-	0.00	73	0	C		Missense_Mutation	23706340	-1	tier1	-	no_errors	ENST00000256797	ensembl	human	known	74_37	missense	26.03	54	19	SNP	1.000	T
TANGO6	79613	genome.wustl.edu	37	16	68961461	68961461	+	Intron	SNP	C	C	T			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr16:68961461C>T	ENST00000261778.1	+	13	2139				RP11-521L9.1_ENST00000562790.1_lincRNA	NM_024562.1	NP_078838.1	Q9C0B7	TNG6_HUMAN	transport and golgi organization 6 homolog (Drosophila)							integral component of membrane (GO:0016021)											TTTTTTATTTCATTTTGTAGT	0.388																																																	0													135.0	128.0	131.0					16																	68961461		1913	4128	6041	SO:0001627	intron_variant	0				CCDS45516.1	16q22.1	2012-12-13	2012-12-13	2012-12-13	ENSG00000103047	ENSG00000103047			25749	protein-coding gene	gene with protein product			"""transmembrane and coiled-coil domains 7"""	TMCO7		11214970	Standard	NM_024562		Approved	FLJ12688, KIAA1746	uc002ewi.4	Q9C0B7	OTTHUMG00000176743	ENST00000261778.1:c.2128-10C>T	16.37:g.68961461C>T			Q569F9|Q9H9K1	RNA	SNP	-	NULL	ENST00000261778.1	37	NULL	CCDS45516.1	16																																																																																			RP11-521L9.1	-	-	ENSG00000260999		0.388	TANGO6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000260999	Clone_based_vega_gene	protein_coding	OTTHUMT00000433471.2	-	0.00	99	0	C	XM_928235.2		68961461	-1	tier1	-	no_errors	ENST00000562790	ensembl	human	known	74_37	rna	52.15	89	97	SNP	0.001	T
ESYT3	83850	genome.wustl.edu	37	3	138183220	138183220	+	Nonsense_Mutation	SNP	C	C	T			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr3:138183220C>T	ENST00000389567.4	+	9	1135	c.949C>T	c.(949-951)Cag>Tag	p.Q317*		NM_031913.3	NP_114119.2	A0FGR9	ESYT3_HUMAN	extended synaptotagmin-like protein 3	317	C2 1. {ECO:0000255|PROSITE- ProRule:PRU00041}.				lipid transport (GO:0006869)	extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|integral component of plasma membrane (GO:0005887)|intrinsic component of endoplasmic reticulum membrane (GO:0031227)|organelle membrane contact site (GO:0044232)	lipid binding (GO:0008289)|metal ion binding (GO:0046872)			breast(1)|endometrium(5)|large_intestine(7)|lung(9)|prostate(1)|skin(1)|urinary_tract(1)	25						GGAGGCAGAGCAGCTGGCCCA	0.582																																																	0													65.0	63.0	64.0					3																	138183220		2203	4300	6503	SO:0001587	stop_gained	0			AJ303366	CCDS3101.2	3q22.3	2014-07-02	2009-06-23	2009-06-23	ENSG00000158220	ENSG00000158220		"""Synaptotagmins"""	24295	protein-coding gene	gene with protein product			"""family with sequence similarity 62 (C2 domain containing), member C"""	FAM62C		11543631, 17672888	Standard	NM_031913		Approved	CHR3SYT	uc003esk.3	A0FGR9	OTTHUMG00000147354	ENST00000389567.4:c.949C>T	3.37:g.138183220C>T	ENSP00000374218:p.Gln317*		A8K0G5|Q6ZV21|Q8NDZ5|Q9BQR9	Nonsense_Mutation	SNP	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,prints_C2_dom,pfscan_C2_dom	p.Q317*	ENST00000389567.4	37	c.949	CCDS3101.2	3	.	.	.	.	.	.	.	.	.	.	C	23.8	4.457095	0.84317	.	.	ENSG00000158220	ENST00000389567	.	.	.	4.78	-0.27	0.12926	.	0.605324	0.17749	N	0.163289	.	.	.	.	.	.	0.22489	N	0.999056	.	.	.	.	.	.	.	.	.	.	0.29301	T	0.29	-14.4777	4.877	0.13662	0.4766:0.1673:0.3562:0.0	.	.	.	.	X	317	.	ENSP00000374218:Q317X	Q	+	1	0	ESYT3	139665910	0.112000	0.22096	0.042000	0.18584	0.827000	0.46813	0.528000	0.23002	-0.180000	0.10637	-1.478000	0.00992	CAG	ESYT3	-	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom	ENSG00000158220		0.582	ESYT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ESYT3	HGNC	protein_coding	OTTHUMT00000303993.1	-	0.00	37	0	C	NM_031913		138183220	+1	tier1	-	no_errors	ENST00000389567	ensembl	human	known	74_37	nonsense	18.92	30	7	SNP	0.068	T
FAM205B	389715	genome.wustl.edu	37	9	34832891	34832891	+	RNA	SNP	C	C	G			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr9:34832891C>G	ENST00000455647.2	-	0	3502							Q63HN1	F205B_HUMAN	family with sequence similarity 205, member B																		CTTGCAGGTCCTTCTCAGACT	0.532																																																	0																																												0					9p13.3	2013-05-22	2011-08-15	2011-08-15	ENSG00000257198	ENSG00000257198			24504	other	unknown			"""chromosome 9 open reading frame 144"""	C9orf144			Standard	NR_024481		Approved	DKFZp434J193, C9orf144A	uc003zvp.4	Q63HN1	OTTHUMG00000019839		9.37:g.34832891C>G			Q6ZRJ7	RNA	SNP	-	NULL	ENST00000455647.2	37	NULL		9																																																																																			FAM205B	-	-	ENSG00000257198		0.532	FAM205B-001	KNOWN	basic	processed_transcript	FAM205B	HGNC	pseudogene	OTTHUMT00000052246.5	-	0.00	129	0	C	NR_024481		34832891	-1	tier1	-	no_errors	ENST00000455647	ensembl	human	known	74_37	rna	30.00	70	30	SNP	0.000	G
FAM205B	389715	genome.wustl.edu	37	9	34833094	34833094	+	RNA	SNP	G	G	T	rs551052492	byFrequency	TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr9:34833094G>T	ENST00000455647.2	-	0	3299							Q63HN1	F205B_HUMAN	family with sequence similarity 205, member B																		GTTGAGGAGCGCCCAAACCCC	0.602																																																	0																																												0					9p13.3	2013-05-22	2011-08-15	2011-08-15	ENSG00000257198	ENSG00000257198			24504	other	unknown			"""chromosome 9 open reading frame 144"""	C9orf144			Standard	NR_024481		Approved	DKFZp434J193, C9orf144A	uc003zvp.4	Q63HN1	OTTHUMG00000019839		9.37:g.34833094G>T			Q6ZRJ7	RNA	SNP	-	NULL	ENST00000455647.2	37	NULL		9																																																																																			FAM205B	-	-	ENSG00000257198		0.602	FAM205B-001	KNOWN	basic	processed_transcript	FAM205B	HGNC	pseudogene	OTTHUMT00000052246.5	-	0.00	111	0	G	NR_024481		34833094	-1	tier1	-	no_errors	ENST00000455647	ensembl	human	known	74_37	rna	5.33	71	4	SNP	0.000	T
FAM78A	286336	genome.wustl.edu	37	9	134134513	134134513	+	3'UTR	SNP	C	C	T	rs541401038		TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr9:134134513C>T	ENST00000372271.3	-	0	2915				FAM78A_ENST00000247295.4_5'UTR|FAM78A_ENST00000372269.3_3'UTR	NM_033387.3	NP_203745.2	Q5JUQ0	FA78A_HUMAN	family with sequence similarity 78, member A											NS(1)|endometrium(1)|large_intestine(2)|lung(3)|ovary(1)|skin(1)	9	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;2.15e-05)|Epithelial(140;0.000267)		TCTAAATGGACGGTTTTCTGT	0.537																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AK095423	CCDS6941.2	9q34	2008-02-05	2005-07-18	2005-07-18	ENSG00000126882	ENSG00000126882			25465	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 59"""	C9orf59		11214971	Standard	NM_033387		Approved	FLJ00024	uc004cak.3	Q5JUQ0	OTTHUMG00000020821	ENST00000372271.3:c.*1696G>A	9.37:g.134134513C>T			Q86VQ9|Q9H7P4	RNA	SNP	-	NULL	ENST00000372271.3	37	NULL	CCDS6941.2	9																																																																																			FAM78A	-	-	ENSG00000126882		0.537	FAM78A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM78A	HGNC	protein_coding	OTTHUMT00000054720.1	-	0.00	83	0	C	NM_033387		134134513	-1	tier1	-	no_errors	ENST00000247295	ensembl	human	known	74_37	rna	7.38	113	9	SNP	0.000	T
FANCM	57697	genome.wustl.edu	37	14	45644391	45644391	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr14:45644391C>G	ENST00000267430.5	+	14	2519	c.2434C>G	c.(2434-2436)Cac>Gac	p.H812D	FANCM_ENST00000542564.2_Missense_Mutation_p.H786D	NM_020937.2	NP_065988.1	Q8IYD8	FANCM_HUMAN	Fanconi anemia, complementation group M	812					DNA repair (GO:0006281)|replication fork processing (GO:0031297)|resolution of meiotic recombination intermediates (GO:0000712)	FANCM-MHF complex (GO:0071821)|Fanconi anaemia nuclear complex (GO:0043240)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|nuclease activity (GO:0004518)			breast(4)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(18)|liver(2)|lung(31)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	85						CTTTATCACTCACAAGAAATC	0.328								Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																																								0													86.0	83.0	84.0					14																	45644391		2203	4299	6502	SO:0001583	missense	0	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	AK001672	CCDS32070.1	14q21.3	2014-09-17	2005-09-01	2005-09-01		ENSG00000187790		"""Fanconi anemia, complementation groups"""	23168	protein-coding gene	gene with protein product		609644	"""KIAA1596"""	KIAA1596		10997877, 16116422	Standard	NM_020937		Approved	FAAP250	uc001wwd.4	Q8IYD8		ENST00000267430.5:c.2434C>G	14.37:g.45644391C>G	ENSP00000267430:p.His812Asp		B2RTQ9|Q3YFH9|Q8N9X6|Q9HCH6	Missense_Mutation	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,pfam_Helicase/UvrB_dom,superfamily_P-loop_NTPase,superfamily_Restrct_endonuc-II-like,superfamily_RuvA_2-like,smart_Helicase_ATP-bd,smart_Helicase_C,smart_ERCC4_domain,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.H812D	ENST00000267430.5	37	c.2434	CCDS32070.1	14	.	.	.	.	.	.	.	.	.	.	C	0.010	-1.789002	0.00623	.	.	ENSG00000187790	ENST00000267430;ENST00000542564;ENST00000556250	T;T;T	0.18960	2.79;2.79;2.18	5.08	0.366	0.16136	.	0.964586	0.08590	N	0.923147	T	0.09949	0.0244	N	0.14661	0.345	0.09310	N	1	B;B	0.17667	0.011;0.023	B;B	0.14023	0.01;0.01	T	0.40175	-0.9577	10	0.13470	T	0.59	.	4.7931	0.13259	0.1942:0.5917:0.1092:0.1049	.	786;812	B2RTQ9;Q8IYD8	.;FANCM_HUMAN	D	812;786;328	ENSP00000267430:H812D;ENSP00000442493:H786D;ENSP00000452033:H328D	ENSP00000267430:H812D	H	+	1	0	FANCM	44714141	0.000000	0.05858	0.006000	0.13384	0.135000	0.20990	0.115000	0.15540	0.466000	0.27193	0.585000	0.79938	CAC	FANCM	-	NULL	ENSG00000187790		0.328	FANCM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FANCM	HGNC	protein_coding	OTTHUMT00000410474.1		0.00	32	0	C	XM_048128		45644391	+1			no_errors	ENST00000267430	ensembl	human	known	74_37	missense	9.52	38	4	SNP	0.041	G
FASTKD3	79072	genome.wustl.edu	37	5	7867383	7867383	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr5:7867383C>T	ENST00000264669.5	-	2	950	c.814G>A	c.(814-816)Gaa>Aaa	p.E272K	FASTKD3_ENST00000513658.1_Intron|MTRR_ENST00000341013.6_5'Flank|MTRR_ENST00000440940.2_5'Flank|MTRR_ENST00000264668.2_5'Flank|MTRR_ENST00000502509.1_Intron	NM_024091.3	NP_076996.2	Q14CZ7	FAKD3_HUMAN	FAST kinase domains 3	272					cellular respiration (GO:0045333)	mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)			breast(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|liver(2)|lung(11)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	39						GTTTGGTGTTCATCCACTTTT	0.368																																																	0													84.0	94.0	91.0					5																	7867383		2202	4300	6502	SO:0001583	missense	0			AK026927	CCDS3873.1	5p15.31	2008-02-05			ENSG00000124279	ENSG00000124279			28758	protein-coding gene	gene with protein product						12477932	Standard	NM_024091		Approved	MGC5297, FLJ23274	uc003jeb.3	Q14CZ7	OTTHUMG00000131029	ENST00000264669.5:c.814G>A	5.37:g.7867383C>T	ENSP00000264669:p.Glu272Lys		Q9BVD3	Missense_Mutation	SNP	pfam_FAST_2,pfam_FAST_Leu-rich,pfam_RAP,smart_RAP	p.E272K	ENST00000264669.5	37	c.814	CCDS3873.1	5	.	.	.	.	.	.	.	.	.	.	C	1.282	-0.609978	0.03690	.	.	ENSG00000124279	ENST00000264669	T	0.12984	2.63	4.85	-0.527	0.11909	.	0.367362	0.31697	N	0.007216	T	0.03608	0.0103	N	0.02142	-0.665	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.44097	-0.9350	10	0.05959	T	0.93	-0.3888	9.7752	0.40614	0.0:0.3451:0.3054:0.3495	.	272	Q14CZ7	FAKD3_HUMAN	K	272	ENSP00000264669:E272K	ENSP00000264669:E272K	E	-	1	0	FASTKD3	7920383	0.119000	0.22226	0.000000	0.03702	0.535000	0.34838	0.680000	0.25306	-0.323000	0.08602	-0.171000	0.13296	GAA	FASTKD3	-	NULL	ENSG00000124279		0.368	FASTKD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FASTKD3	HGNC	protein_coding	OTTHUMT00000253673.1		0.00	24	0	C	NM_024091		7867383	-1			no_errors	ENST00000264669	ensembl	human	known	74_37	missense	14.29	18	3	SNP	0.006	T
FHOD3	80206	genome.wustl.edu	37	18	34298061	34298061	+	Missense_Mutation	SNP	C	C	T	rs373880183		TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr18:34298061C>T	ENST00000359247.4	+	15	2224	c.2224C>T	c.(2224-2226)Cgg>Tgg	p.R742W	FHOD3_ENST00000590592.1_Missense_Mutation_p.R934W|FHOD3_ENST00000592128.1_5'Flank|FHOD3_ENST00000591635.1_Intron|FHOD3_ENST00000257209.4_Missense_Mutation_p.R759W|FHOD3_ENST00000445677.1_Missense_Mutation_p.R721W	NM_001281739.1	NP_001268668.1	Q2V2M9	FHOD3_HUMAN	formin homology 2 domain containing 3	742					actin filament network formation (GO:0051639)|cardiac myofibril assembly (GO:0055003)|negative regulation of actin filament polymerization (GO:0030837)|sarcomere organization (GO:0045214)	striated muscle thin filament (GO:0005865)				NS(1)|breast(5)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(25)|liver(2)|lung(29)|ovary(3)|prostate(4)|skin(5)|upper_aerodigestive_tract(1)	90		all_epithelial(2;0.0181)|Colorectal(2;0.0195)				TTTGGACAATCGGGGCAGTGT	0.562																																																	0													90.0	96.0	94.0					18																	34298061		2203	4300	6503	SO:0001583	missense	0			AK091899	CCDS32816.1, CCDS62418.1, CCDS62419.1	18q12	2007-08-02				ENSG00000134775			26178	protein-coding gene	gene with protein product		609691				11214970	Standard	NM_025135		Approved	FHOS2, KIAA1695, FLJ22297, FLJ22717	uc021uiv.1	Q2V2M9		ENST00000359247.4:c.2224C>T	18.37:g.34298061C>T	ENSP00000352186:p.Arg742Trp		A8MQT4|E5F5Q0|Q642I2|Q6ZRQ7|Q86TF9|Q8N3A5|Q9C0G8|Q9H604|Q9H6G7	Missense_Mutation	SNP	pfam_FH2_Formin,superfamily_ARM-type_fold,smart_FH2_Formin	p.R759W	ENST00000359247.4	37	c.2275		18	.	.	.	.	.	.	.	.	.	.	C	17.94	3.512145	0.64522	.	.	ENSG00000134775	ENST00000257209;ENST00000359247;ENST00000445677	T;T;T	0.33216	1.42;1.42;1.43	4.78	2.95	0.34219	.	0.061523	0.64402	D	0.000004	T	0.42966	0.1226	L	0.36672	1.1	0.37716	D	0.924732	D;D;D	0.89917	1.0;1.0;0.993	D;D;P	0.75020	0.985;0.947;0.555	T	0.45131	-0.9282	10	0.72032	D	0.01	.	12.3521	0.55155	0.3078:0.6922:0.0:0.0	.	721;742;759	Q2V2M9-2;Q2V2M9;Q2V2M9-3	.;FHOD3_HUMAN;.	W	759;742;721	ENSP00000257209:R759W;ENSP00000352186:R742W;ENSP00000411430:R721W	ENSP00000257209:R759W	R	+	1	2	FHOD3	32552059	0.995000	0.38212	0.995000	0.50966	0.980000	0.70556	2.960000	0.49161	0.412000	0.25729	0.455000	0.32223	CGG	FHOD3	-	NULL	ENSG00000134775		0.562	FHOD3-001	PUTATIVE	basic	protein_coding	FHOD3	HGNC	protein_coding	OTTHUMT00000460884.1	-	0.00	105	0	C	XM_371114		34298061	+1	tier1	-	no_errors	ENST00000257209	ensembl	human	known	74_37	missense	20.54	89	23	SNP	1.000	T
FMN2	56776	genome.wustl.edu	37	1	240370836	240370836	+	Silent	SNP	G	G	T			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr1:240370836G>T	ENST00000319653.9	+	5	2954	c.2724G>T	c.(2722-2724)ctG>ctT	p.L908L		NM_020066.4	NP_064450.3	Q9NZ56	FMN2_HUMAN	formin 2	908	FH1.|Pro-rich.				cellular response to DNA damage stimulus (GO:0006974)|cellular response to hypoxia (GO:0071456)|establishment of meiotic spindle localization (GO:0051295)|formin-nucleated actin cable assembly (GO:0070649)|homologous chromosome movement towards spindle pole involved in homologous chromosome segregation (GO:0051758)|intracellular signal transduction (GO:0035556)|intracellular transport (GO:0046907)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein catabolic process (GO:0042177)|oogenesis (GO:0048477)|polar body extrusion after meiotic divisions (GO:0040038)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cell cortex (GO:0005938)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|microvillus (GO:0005902)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|spindle (GO:0005819)	actin binding (GO:0003779)			NS(1)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(13)|lung(87)|ovary(6)|pancreas(3)|prostate(12)|skin(7)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(2)	178	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)			CAGAAATGCTGCCACCCCCTC	0.662																																																	0													49.0	53.0	51.0					1																	240370836		2203	4299	6502	SO:0001819	synonymous_variant	0			AF218942	CCDS31069.2	1q43	2008-02-05			ENSG00000155816	ENSG00000155816			14074	protein-coding gene	gene with protein product		606373				10781961	Standard	NM_020066		Approved		uc010pyd.2	Q9NZ56	OTTHUMG00000039883	ENST00000319653.9:c.2724G>T	1.37:g.240370836G>T			B0QZA7|B4DP05|Q59GF6|Q5VU37|Q9NZ55	Silent	SNP	pfam_FH2_Formin,pfam_Formin_homology_1,smart_FH2_Formin,pfscan_DEP_dom	p.L908	ENST00000319653.9	37	c.2724	CCDS31069.2	1																																																																																			FMN2	-	smart_FH2_Formin	ENSG00000155816		0.662	FMN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FMN2	HGNC	protein_coding	OTTHUMT00000096217.2	-	0.00	45	0	G	XM_371352		240370836	+1	tier1	-	no_errors	ENST00000319653	ensembl	human	known	74_37	silent	13.79	50	8	SNP	0.614	T
FOXR2	139628	genome.wustl.edu	37	X	55650456	55650456	+	Silent	SNP	G	G	C			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chrX:55650456G>C	ENST00000339140.3	+	1	624	c.312G>C	c.(310-312)ctG>ctC	p.L104L		NM_198451.3	NP_940853.1	Q6PJQ5	FOXR2_HUMAN	forkhead box R2	104					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			biliary_tract(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(1)|liver(1)|lung(8)|prostate(1)|skin(1)|urinary_tract(1)	19						AAGAGGATCTGACAAACATTT	0.547																																																	0													65.0	59.0	61.0					X																	55650456		2203	4300	6503	SO:0001819	synonymous_variant	0			BC012934	CCDS35308.1	Xp11	2006-12-15			ENSG00000189299	ENSG00000189299		"""Forkhead boxes"""	30469	protein-coding gene	gene with protein product						15202009, 15202027	Standard	NM_198451		Approved	MGC21658, FOXN6	uc004duo.3	Q6PJQ5	OTTHUMG00000021661	ENST00000339140.3:c.312G>C	X.37:g.55650456G>C				Silent	SNP	pfam_TF_fork_head,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head	p.L104	ENST00000339140.3	37	c.312	CCDS35308.1	X																																																																																			FOXR2	-	NULL	ENSG00000189299		0.547	FOXR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOXR2	HGNC	protein_coding	OTTHUMT00000056877.2	-	0.00	20	0	G	NM_198451		55650456	+1	tier1	-	no_errors	ENST00000339140	ensembl	human	known	74_37	silent	55.56	4	5	SNP	0.000	C
FSIP2	401024	genome.wustl.edu	37	2	186669080	186669080	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr2:186669080G>A	ENST00000424728.1	+	17	15047	c.15047G>A	c.(15046-15048)aGa>aAa	p.R5016K	FSIP2_ENST00000343098.5_Missense_Mutation_p.R5105K			Q5CZC0	FSIP2_HUMAN	fibrous sheath interacting protein 2	5016										NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(4)|kidney(1)|large_intestine(11)|lung(46)|pancreas(1)|urinary_tract(2)	69						TTCTCAGAAAGATACAAAGAA	0.294																																																	0																																										SO:0001583	missense	0			AK092099	CCDS54426.1	2q32.1	2010-06-18			ENSG00000188738	ENSG00000188738			21675	protein-coding gene	gene with protein product		615796				14702039	Standard	NM_173651		Approved	FLJ34780	uc002upl.3	Q5CZC0	OTTHUMG00000153874	ENST00000424728.1:c.15047G>A	2.37:g.186669080G>A	ENSP00000401306:p.Arg5016Lys		Q53TL3|Q53TN5|Q5HYH2|Q6ZTZ5|Q6ZU14|Q6ZU21	Missense_Mutation	SNP	NULL	p.R5105K	ENST00000424728.1	37	c.15314		2	.	.	.	.	.	.	.	.	.	.	G	2.479	-0.320092	0.05386	.	.	ENSG00000188738	ENST00000343098;ENST00000424728	T;T	0.41065	1.01;1.01	5.66	-0.87	0.10646	.	.	.	.	.	T	0.16214	0.0390	N	0.14661	0.345	0.09310	N	1	.	.	.	.	.	.	T	0.24584	-1.0156	7	0.05959	T	0.93	.	1.4613	0.02396	0.2194:0.2936:0.3461:0.1408	.	.	.	.	K	5105;5016	ENSP00000344403:R5105K;ENSP00000401306:R5016K	ENSP00000344403:R5105K	R	+	2	0	FSIP2	186377325	0.000000	0.05858	0.010000	0.14722	0.163000	0.22366	-0.469000	0.06648	-0.496000	0.06650	0.585000	0.79938	AGA	FSIP2	-	NULL	ENSG00000188738		0.294	FSIP2-001	KNOWN	basic	protein_coding	FSIP2	HGNC	protein_coding	OTTHUMT00000332778.3	-	0.00	42	0	G	NM_173651		186669080	+1	tier1	-	no_errors	ENST00000343098	ensembl	human	known	74_37	missense	15.79	48	9	SNP	0.003	A
FZD7	8324	genome.wustl.edu	37	2	202899887	202899887	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr2:202899887G>T	ENST00000286201.1	+	1	578	c.517G>T	c.(517-519)Ggc>Tgc	p.G173C	RP11-107N15.1_ENST00000608741.1_lincRNA	NM_003507.1	NP_003498.1	O75084	FZD7_HUMAN	frizzled class receptor 7	173					axonogenesis (GO:0007409)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|cellular response to retinoic acid (GO:0071300)|G-protein coupled receptor signaling pathway coupled to cGMP nucleotide second messenger (GO:0007199)|gonad development (GO:0008406)|mesenchymal to epithelial transition (GO:0060231)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of ectodermal cell fate specification (GO:0042666)|neuron differentiation (GO:0030182)|non-canonical Wnt signaling pathway via JNK cascade (GO:0038031)|positive regulation of epithelial cell proliferation involved in wound healing (GO:0060054)|positive regulation of JNK cascade (GO:0046330)|positive regulation of phosphorylation (GO:0042327)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of catenin import into nucleus (GO:0035412)|regulation of transcription, DNA-templated (GO:0006355)|skeletal muscle satellite cell maintenance involved in skeletal muscle regeneration (GO:0014834)|somatic stem cell division (GO:0048103)|stem cell maintenance (GO:0019827)|substrate adhesion-dependent cell spreading (GO:0034446)|T cell differentiation in thymus (GO:0033077)|vasculature development (GO:0001944)|Wnt signaling pathway, calcium modulating pathway (GO:0007223)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|neuron projection membrane (GO:0032589)|plasma membrane (GO:0005886)	frizzled binding (GO:0005109)|G-protein coupled receptor activity (GO:0004930)|PDZ domain binding (GO:0030165)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			breast(1)|endometrium(6)|large_intestine(6)|lung(11)|ovary(2)|skin(3)|upper_aerodigestive_tract(2)	31						CGGGGGCCCAGGCGGCGGCCC	0.746											OREG0015146	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													11.0	14.0	13.0					2																	202899887		2166	4250	6416	SO:0001583	missense	0			AB010881	CCDS2351.1	2q33	2014-01-29	2014-01-29		ENSG00000155760	ENSG00000155760		"""GPCR / Class F : Frizzled receptors"""	4045	protein-coding gene	gene with protein product		603410	"""frizzled (Drosophila) homolog 7"", ""frizzled homolog 7 (Drosophila)"", ""frizzled 7, seven transmembrane spanning receptor"", ""frizzled family receptor 7"""			9707618, 9813155	Standard	NM_003507		Approved	FzE3	uc002uyw.1	O75084	OTTHUMG00000132841	ENST00000286201.1:c.517G>T	2.37:g.202899887G>T	ENSP00000286201:p.Gly173Cys	2133	O94816|Q53S59|Q96B74	Missense_Mutation	SNP	pfam_Frizzled,pfam_Frizzled_dom,superfamily_Frizzled_dom,smart_Frizzled_dom,pfscan_Frizzled_dom,pfscan_GPCR_2-like,prints_Frizzled	p.G173C	ENST00000286201.1	37	c.517	CCDS2351.1	2	.	.	.	.	.	.	.	.	.	.	G	15.26	2.782048	0.49891	.	.	ENSG00000155760	ENST00000286201	T	0.76709	-1.04	5.46	5.46	0.80206	.	.	.	.	.	T	0.65883	0.2734	N	0.22421	0.69	0.42079	D	0.991247	D	0.56521	0.976	P	0.44447	0.45	T	0.69277	-0.5187	9	0.59425	D	0.04	.	8.3657	0.32385	0.0788:0.0:0.7654:0.1558	.	173	O75084	FZD7_HUMAN	C	173	ENSP00000286201:G173C	ENSP00000286201:G173C	G	+	1	0	FZD7	202608132	0.559000	0.26562	0.950000	0.38849	0.562000	0.35680	1.568000	0.36418	2.563000	0.86464	0.563000	0.77884	GGC	FZD7	-	NULL	ENSG00000155760		0.746	FZD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FZD7	HGNC	protein_coding	OTTHUMT00000256314.1	-	0.00	74	0	G	NM_003507		202899887	+1	tier1	-	no_errors	ENST00000286201	ensembl	human	known	74_37	missense	7.41	50	4	SNP	0.977	T
GJB4	127534	genome.wustl.edu	37	1	35227148	35227148	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr1:35227148G>A	ENST00000339480.1	+	2	663	c.293G>A	c.(292-294)cGc>cAc	p.R98H	RP1-34M23.5_ENST00000542839.1_RNA	NM_153212.2	NP_694944.1	Q9NTQ9	CXB4_HUMAN	gap junction protein, beta 4, 30.3kDa	98					cell communication (GO:0007154)|olfactory behavior (GO:0042048)|sensory perception of smell (GO:0007608)	connexon complex (GO:0005922)|integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(6)|ovary(2)|skin(1)	16		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.234)				GTGGCCTACCGCGAGGAACGC	0.637																																																	0													86.0	65.0	72.0					1																	35227148		2203	4300	6503	SO:0001583	missense	0				CCDS383.1	1p35-p34	2008-05-14	2007-11-06		ENSG00000189433	ENSG00000189433		"""Ion channels / Gap junction proteins (connexins)"""	4286	protein-coding gene	gene with protein product	"""connexin 30.3"""	605425	"""gap junction protein, beta 4 (connexin 30.3)"", ""gap junction protein, beta 4"""				Standard	NM_153212		Approved	CX30.3	uc001bxv.1	Q9NTQ9	OTTHUMG00000004052	ENST00000339480.1:c.293G>A	1.37:g.35227148G>A	ENSP00000345868:p.Arg98His		B3KQ82	Missense_Mutation	SNP	pfam_Connexin_N,pfam_Connexin_CCC,smart_Connexin_N,prints_Connexin,prints_Connexin303	p.R98H	ENST00000339480.1	37	c.293	CCDS383.1	1	.	.	.	.	.	.	.	.	.	.	G	23.5	4.423700	0.83559	.	.	ENSG00000189433	ENST00000339480	D	0.99129	-5.46	5.73	4.82	0.62117	Connexin, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.98902	0.9628	M	0.77103	2.36	0.42241	D	0.991933	D	0.76494	0.999	P	0.57204	0.815	D	0.99100	1.0843	10	0.52906	T	0.07	.	14.3259	0.66521	0.0717:0.0:0.9283:0.0	.	98	Q9NTQ9	CXB4_HUMAN	H	98	ENSP00000345868:R98H	ENSP00000345868:R98H	R	+	2	0	GJB4	34999735	0.868000	0.29978	0.878000	0.34440	0.479000	0.33129	4.164000	0.58190	1.445000	0.47624	0.655000	0.94253	CGC	GJB4	-	pfam_Connexin_N	ENSG00000189433		0.637	GJB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GJB4	HGNC	protein_coding	OTTHUMT00000011560.1		0.00	45	0	G	NM_153212		35227148	+1			no_errors	ENST00000339480	ensembl	human	known	74_37	missense	5.41	35	2	SNP	1.000	A
GLB1	2720	genome.wustl.edu	37	3	33060008	33060008	+	Missense_Mutation	SNP	T	T	G			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr3:33060008T>G	ENST00000399402.3	-	13	1320	c.1189A>C	c.(1189-1191)Agc>Cgc	p.S397R	GLB1_ENST00000307363.5_Missense_Mutation_p.S427R|GLB1_ENST00000497796.1_5'UTR|GLB1_ENST00000445488.2_Missense_Mutation_p.S475R|GLB1_ENST00000307377.8_Missense_Mutation_p.S296R	NM_001079811.1	NP_001073279	P16278	BGAL_HUMAN	galactosidase, beta 1	427			P -> A (in MPS4B; 24.0% of wild-type enzyme activity). {ECO:0000269|PubMed:19472408}.		carbohydrate metabolic process (GO:0005975)|galactose catabolic process (GO:0019388)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|glycosphingolipid metabolic process (GO:0006687)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)	beta-galactosidase activity (GO:0004565)|galactoside binding (GO:0016936)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(6)|lung(3)|ovary(1)|skin(1)|urinary_tract(1)	21		Melanoma(143;0.104)				GCTGGGTTGCTGCAATCTTGA	0.443																																																	0													170.0	167.0	168.0					3																	33060008		1972	4162	6134	SO:0001583	missense	0			M22590	CCDS43061.1, CCDS43062.1, CCDS46785.1	3p22.3	2012-10-02			ENSG00000170266	ENSG00000170266	3.2.1.23		4298	protein-coding gene	gene with protein product		611458	"""elastin receptor 1, 67kDa"", ""elastin receptor 1 (67kD)"""	ELNR1		110522, 3143362	Standard	NM_000404		Approved	EBP	uc003cfi.1	P16278	OTTHUMG00000155781	ENST00000399402.3:c.1189A>C	3.37:g.33060008T>G	ENSP00000382333:p.Ser397Arg		B2R7H8|B7Z6B0|P16279	Missense_Mutation	SNP	pfam_Glycoside_Hdrlase_35,pfam_Glyco_hydro_42_N,superfamily_Glycoside_hydrolase_SF,superfamily_Galactose-bd-like,prints_Glycoside_Hdrlase_35	p.S475R	ENST00000399402.3	37	c.1423	CCDS43062.1	3	.	.	.	.	.	.	.	.	.	.	T	7.316	0.616011	0.14129	.	.	ENSG00000170266	ENST00000399402;ENST00000307363;ENST00000445488;ENST00000307377	D;D;D;D	0.95137	-3.62;-3.62;-3.62;-3.62	4.94	3.79	0.43588	.	0.410133	0.31554	N	0.007444	D	0.90820	0.7117	M	0.69823	2.125	0.41152	D	0.986033	B;B;B;B	0.32467	0.172;0.372;0.172;0.172	B;B;B;B	0.22601	0.015;0.04;0.015;0.039	D	0.86139	0.1580	10	0.15499	T	0.54	-16.2654	9.5775	0.39468	0.0:0.0838:0.0:0.9162	.	427;296;427;475	Q53G40;E7EQ29;P16278;B7Z6Q5	.;.;BGAL_HUMAN;.	R	397;427;475;296	ENSP00000382333:S397R;ENSP00000306920:S427R;ENSP00000393377:S475R;ENSP00000305920:S296R	ENSP00000306920:S427R	S	-	1	0	GLB1	33035012	0.992000	0.36948	0.656000	0.29637	0.345000	0.29048	2.022000	0.41030	0.926000	0.37118	0.477000	0.44152	AGC	GLB1	-	NULL	ENSG00000170266		0.443	GLB1-002	NOVEL	basic|exp_conf|CCDS	protein_coding	GLB1	HGNC	protein_coding	OTTHUMT00000341570.2	-	0.00	92	0	T	NM_000404		33060008	-1	tier1	-	no_errors	ENST00000445488	ensembl	human	known	74_37	missense	22.54	55	16	SNP	0.995	G
GLP2R	9340	genome.wustl.edu	37	17	9760839	9760839	+	Silent	SNP	C	C	T			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr17:9760839C>T	ENST00000262441.5	+	6	1224	c.711C>T	c.(709-711)aaC>aaT	p.N237N	GLP2R_ENST00000574745.1_Silent_p.N57N	NM_004246.1	NP_004237.1	O95838	GLP2R_HUMAN	glucagon-like peptide 2 receptor	237					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|positive regulation of cell proliferation (GO:0008284)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|glucagon receptor activity (GO:0004967)			endometrium(4)|large_intestine(7)|lung(22)|ovary(2)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)	44					Glucagon recombinant(DB00040)|Teduglutide(DB08900)	TCTTCTACAACTCTTACTCCA	0.507																																																	0													203.0	161.0	175.0					17																	9760839		2203	4300	6503	SO:0001819	synonymous_variant	0			AF105367	CCDS11150.1	17p13.3	2012-08-10			ENSG00000065325	ENSG00000065325		"""GPCR / Class B : Glucagon receptors"""	4325	protein-coding gene	gene with protein product		603659				9990065	Standard	NM_004246		Approved		uc002gmd.1	O95838	OTTHUMG00000130269	ENST00000262441.5:c.711C>T	17.37:g.9760839C>T			Q4VAT3	Silent	SNP	pfam_GPCR_2_secretin-like,pfam_GPCR_2_extracellular_dom,smart_GPCR_2_extracellular_dom,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_GPCR_2_secretin-like	p.N237	ENST00000262441.5	37	c.711	CCDS11150.1	17	.	.	.	.	.	.	.	.	.	.	C	9.382	1.073151	0.20147	.	.	ENSG00000065325	ENST00000458005	.	.	.	5.28	0.342	0.15996	.	.	.	.	.	T	0.50480	0.1618	.	.	.	0.48696	D	0.999698	.	.	.	.	.	.	T	0.37478	-0.9704	4	.	.	.	.	4.6812	0.12736	0.6297:0.2244:0.0:0.1459	.	.	.	.	I	90	.	.	T	+	2	0	GLP2R	9701564	0.038000	0.19896	0.750000	0.31169	0.980000	0.70556	0.042000	0.13949	0.234000	0.21139	0.655000	0.94253	ACT	GLP2R	-	pfam_GPCR_2_secretin-like,pfscan_GPCR_2-like	ENSG00000065325		0.507	GLP2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLP2R	HGNC	protein_coding	OTTHUMT00000252601.4	-	0.00	94	0	C			9760839	+1	tier1	-	no_errors	ENST00000262441	ensembl	human	known	74_37	silent	17.07	68	14	SNP	0.654	T
GLRA3	8001	genome.wustl.edu	37	4	175644129	175644129	+	Intron	SNP	G	G	T			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr4:175644129G>T	ENST00000274093.3	-	4	994				GLRA3_ENST00000340217.5_Intron|GLRA3_ENST00000436738.1_5'UTR	NM_006529.2	NP_006520.2	O75311	GLRA3_HUMAN	glycine receptor, alpha 3						ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	extracellular-glycine-gated chloride channel activity (GO:0016934)|glycine binding (GO:0016594)|transmitter-gated ion channel activity (GO:0022824)			endometrium(2)|kidney(1)|large_intestine(12)|lung(11)|ovary(3)|prostate(1)|skin(3)|stomach(1)|urinary_tract(1)	35		Prostate(90;0.00601)|Breast(14;0.0091)|Melanoma(52;0.00959)|Renal(120;0.0183)|all_neural(102;0.0891)|all_hematologic(60;0.107)		all cancers(43;4.99e-18)|Epithelial(43;1.18e-16)|OV - Ovarian serous cystadenocarcinoma(60;5.88e-09)|STAD - Stomach adenocarcinoma(60;0.00442)|GBM - Glioblastoma multiforme(59;0.0102)|LUSC - Lung squamous cell carcinoma(193;0.0421)	Glycine(DB00145)|Ivermectin(DB00602)|Lindane(DB00431)	tgtttcatttgaattcatact	0.308																																																	0																																										SO:0001627	intron_variant	0			AF017724	CCDS3822.1, CCDS43283.1	4q34.1	2012-02-07			ENSG00000145451	ENSG00000145451		"""Ligand-gated ion channels / Glycine receptors"""	4328	protein-coding gene	gene with protein product		600421				9677400	Standard	NM_001042543		Approved		uc003ity.1	O75311	OTTHUMG00000149816	ENST00000274093.3:c.491+5496C>A	4.37:g.175644129G>T			D3DP44|O75816|Q5D0E3	RNA	SNP	-	NULL	ENST00000274093.3	37	NULL	CCDS3822.1	4																																																																																			GLRA3	-	-	ENSG00000145451		0.308	GLRA3-001	KNOWN	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	GLRA3	HGNC	protein_coding	OTTHUMT00000313427.1	-	0.00	47	0	G			175644129	-1	tier1	-	no_errors	ENST00000436738	ensembl	human	putative	74_37	rna	10.00	36	4	SNP	0.032	T
GPR89A	653519	genome.wustl.edu	37	1	145787778	145787778	+	Missense_Mutation	SNP	A	A	C			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr1:145787778A>C	ENST00000313835.9	-	10	1046	c.903T>G	c.(901-903)atT>atG	p.I301M	GPR89A_ENST00000478703.1_5'UTR|GPR89A_ENST00000534502.1_Missense_Mutation_p.I276M|GPR89A_ENST00000462900.2_Missense_Mutation_p.I276M|GPR89A_ENST00000454423.3_Missense_Mutation_p.I181M			B7ZAQ6	GPHRA_HUMAN	G protein-coupled receptor 89A	301					intracellular pH reduction (GO:0051452)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|protein transport (GO:0015031)|regulation of anion transport (GO:0044070)|signal transduction (GO:0007165)	Golgi cisterna membrane (GO:0032580)|Golgi-associated vesicle membrane (GO:0030660)|integral component of membrane (GO:0016021)	signal transducer activity (GO:0004871)|voltage-gated anion channel activity (GO:0008308)			breast(1)|large_intestine(3)|lung(1)|skin(1)	6	all_hematologic(18;0.00473)|Acute lymphoblastic leukemia(18;0.0786)		KIRC - Kidney renal clear cell carcinoma(6;0.0764)|Kidney(552;0.118)|Colorectal(543;0.229)			TTACCATGAAAATTTTCCAAA	0.313																																																	0													7.0	6.0	6.0					1																	145787778		1645	3603	5248	SO:0001583	missense	0			AB097024	CCDS72857.1, CCDS72858.1	1q21.1	2008-12-17	2007-06-06	2007-06-06	ENSG00000117262	ENSG00000117262			31984	protein-coding gene	gene with protein product		612821					Standard	NM_001097612		Approved	UNQ192	uc001eot.2	B7ZAQ6	OTTHUMG00000013738	ENST00000313835.9:c.903T>G	1.37:g.145787778A>C	ENSP00000319673:p.Ile301Met		A6NN37|B2RUV3|B3KMN3|B4DLT3|B4DXE7|Q53FQ9|Q5T2V8|Q5T5P5|Q659E2|Q6NVY5|Q9P0S4|Q9Y302	Missense_Mutation	SNP	pfam_ABA_GPCR_dom,pfam_Golgi_pH-regulator_cons_dom	p.I301M	ENST00000313835.9	37	c.903	CCDS41377.1	1	.	.	.	.	.	.	.	.	.	.	A	9.312	1.055866	0.19907	.	.	ENSG00000117262	ENST00000313835;ENST00000454423;ENST00000534502;ENST00000462900	.	.	.	4.91	3.76	0.43208	.	0.000000	0.85682	D	0.000000	T	0.55226	0.1907	L	0.59436	1.845	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.56450	-0.7977	9	0.34782	T	0.22	-21.3544	5.8317	0.18584	0.7693:0.0:0.2307:0.0	.	301;301	P0CG08;B7ZAQ6	GPHRB_HUMAN;GPHRA_HUMAN	M	301;181;276;276	.	ENSP00000319673:I301M	I	-	3	3	GPR89A	144499135	1.000000	0.71417	1.000000	0.80357	0.409000	0.31022	2.376000	0.44292	0.722000	0.32252	0.172000	0.16884	ATT	GPR89A	-	pfam_ABA_GPCR_dom	ENSG00000117262		0.313	GPR89A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR89A	HGNC	protein_coding	OTTHUMT00000038507.2	-	0.00	52	0	A	NM_001097612		145787778	-1	tier1	-	no_errors	ENST00000313835	ensembl	human	known	74_37	missense	20.90	53	14	SNP	1.000	C
HAGH	3029	genome.wustl.edu	37	16	1859322	1859322	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr16:1859322G>A	ENST00000397356.3	-	9	1295	c.889C>T	c.(889-891)Cgc>Tgc	p.R297C	HAGH_ENST00000455446.2_3'UTR|HAGH_ENST00000566709.1_3'UTR|HAGH_ENST00000397353.2_Missense_Mutation_p.R249C|HAGH_ENST00000567398.1_5'UTR	NM_005326.4	NP_005317.2	Q16775	GLO2_HUMAN	hydroxyacylglutathione hydrolase	297	Substrate binding.				glutathione biosynthetic process (GO:0006750)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	hydroxyacylglutathione hydrolase activity (GO:0004416)|zinc ion binding (GO:0008270)			kidney(2)|lung(1)|ovary(1)|skin(1)	5		Hepatocellular(780;0.00335)			Glutathione(DB00143)	TTCTCCCTGCGCACGGCCCGC	0.652																																					Pancreas(55;1048 1176 25227 40124 41333)												0													125.0	110.0	115.0					16																	1859322		2199	4300	6499	SO:0001583	missense	0			X90999	CCDS32366.1, CCDS10447.2, CCDS66900.1	16p13.3	2012-10-02	2003-11-04		ENSG00000063854	ENSG00000063854	3.1.2.6		4805	protein-coding gene	gene with protein product		138760	"""hydroxyacyl glutathione hydrolase"""			3025077, 7327557	Standard	NM_001286249		Approved	GLO2, GLXII, HAGH1	uc002cna.3	Q16775	OTTHUMG00000128662	ENST00000397356.3:c.889C>T	16.37:g.1859322G>A	ENSP00000380514:p.Arg297Cys		A8K290|B4DP33|B4DRA7|E7EN93	Missense_Mutation	SNP	pfam_Beta-lactamas-like,smart_Beta-lactamas-like,tigrfam_Hydroxyacylglutathione_Hdrlase	p.R297C	ENST00000397356.3	37	c.889	CCDS10447.2	16	.	.	.	.	.	.	.	.	.	.	G	16.04	3.011192	0.54361	.	.	ENSG00000063854	ENST00000397356;ENST00000397353	D;D	0.96459	-4.02;-4.02	4.98	4.98	0.66077	.	0.064955	0.64402	D	0.000010	D	0.98280	0.9430	M	0.93507	3.425	0.80722	D	1	D	0.89917	1.0	D	0.64877	0.93	D	0.98548	1.0635	10	0.52906	T	0.07	-12.815	13.2658	0.60133	0.0:0.0:0.8308:0.1692	.	297	Q16775	GLO2_HUMAN	C	297;249	ENSP00000380514:R297C;ENSP00000380511:R249C	ENSP00000380511:R249C	R	-	1	0	HAGH	1799323	1.000000	0.71417	1.000000	0.80357	0.069000	0.16628	3.860000	0.55995	2.476000	0.83614	0.555000	0.69702	CGC	HAGH	-	tigrfam_Hydroxyacylglutathione_Hdrlase	ENSG00000063854		0.652	HAGH-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	HAGH	HGNC	protein_coding	OTTHUMT00000250548.2	-	0.00	52	0	G	NM_005326		1859322	-1	tier1	-	no_errors	ENST00000397356	ensembl	human	known	74_37	missense	6.67	56	4	SNP	1.000	A
HIP1R	9026	genome.wustl.edu	37	12	123346457	123346457	+	3'UTR	SNP	G	G	A			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr12:123346457G>A	ENST00000253083.4	+	0	3489				HIP1R_ENST00000537322.1_3'UTR	NM_003959.1	NP_003950.1	O75146	HIP1R_HUMAN	huntingtin interacting protein 1 related						receptor-mediated endocytosis (GO:0006898)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|intracellular membrane-bounded organelle (GO:0043231)	phosphatidylinositol binding (GO:0035091)			breast(1)|endometrium(5)|kidney(6)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	26	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;4.6e-05)|Epithelial(86;0.000119)|BRCA - Breast invasive adenocarcinoma(302;0.2)		TACTGAGCCTGCAGGGTCCTG	0.622																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AB013384	CCDS31922.1	12q24	2007-12-07			ENSG00000130787	ENSG00000130787			18415	protein-coding gene	gene with protein product		605613				16415883	Standard	NM_003959		Approved	KIAA0655, HIP3, HIP12, FLJ14000, ILWEQ	uc001udj.1	O75146	OTTHUMG00000168765	ENST00000253083.4:c.*157G>A	12.37:g.123346457G>A			A6NHQ6|Q6NXG8|Q9UED9	RNA	SNP	-	NULL	ENST00000253083.4	37	NULL	CCDS31922.1	12																																																																																			HIP1R	-	-	ENSG00000130787		0.622	HIP1R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIP1R	HGNC	protein_coding	OTTHUMT00000400935.1	-	0.00	13	0	G	NM_003959		123346457	+1	tier1	-	no_errors	ENST00000537322	ensembl	human	known	74_37	rna	18.52	22	5	SNP	0.000	A
HIVEP1	3096	genome.wustl.edu	37	6	12125243	12125243	+	Nonsense_Mutation	SNP	G	G	T			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr6:12125243G>T	ENST00000379388.2	+	4	5547	c.5215G>T	c.(5215-5217)Gaa>Taa	p.E1739*	HIVEP1_ENST00000541134.1_5'Flank	NM_002114.2	NP_002105.2	P15822	ZEP1_HUMAN	human immunodeficiency virus type I enhancer binding protein 1	1739					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(11)|liver(1)|lung(31)|ovary(4)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	90	Breast(50;0.0639)|Ovarian(93;0.0816)	all_hematologic(90;0.117)				CCCTCAACAAGAATCTTCAGC	0.408																																																	0													67.0	65.0	66.0					6																	12125243		1837	4086	5923	SO:0001587	stop_gained	0			J05011	CCDS43426.1	6p24-p22.3	2012-10-05	2001-11-28		ENSG00000095951	ENSG00000095951		"""Zinc fingers, C2H2-type"""	4920	protein-coding gene	gene with protein product		194540	"""human immunodeficiency virus type I enhancer-binding protein 1"", ""zinc finger protein 40"""	ZNF40		2037300	Standard	XR_241895		Approved	CIRIP, MBP-1, CRYBP1, PRDII-BF1, ZAS1, Schnurri-1, ZNF40A	uc003nac.3	P15822	OTTHUMG00000014265	ENST00000379388.2:c.5215G>T	6.37:g.12125243G>T	ENSP00000368698:p.Glu1739*		B2RTU3|Q14122|Q5MPB1|Q5VW60	Nonsense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.E1739*	ENST00000379388.2	37	c.5215	CCDS43426.1	6	.	.	.	.	.	.	.	.	.	.	G	49	15.328855	0.99830	.	.	ENSG00000095951	ENST00000379388	.	.	.	5.73	5.73	0.89815	.	0.000000	0.34046	N	0.004318	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-29.0195	19.8951	0.96955	0.0:0.0:1.0:0.0	.	.	.	.	X	1739	.	.	E	+	1	0	HIVEP1	12233229	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	9.476000	0.97823	2.694000	0.91930	0.655000	0.94253	GAA	HIVEP1	-	NULL	ENSG00000095951		0.408	HIVEP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIVEP1	HGNC	protein_coding	OTTHUMT00000039870.2	-	0.00	26	0	G	NM_002114		12125243	+1	tier1	-	no_errors	ENST00000379388	ensembl	human	known	74_37	nonsense	16.67	20	4	SNP	1.000	T
HIST1H4L	8368	genome.wustl.edu	37	6	27841109	27841110	+	Missense_Mutation	DNP	TT	TT	AC			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr6:27841109_27841110TT>AC	ENST00000355981.2	-	1	179_180	c.179_180AA>GT	c.(178-180)aAA>aGT	p.K60S	HIST1H3I_ENST00000328488.2_5'Flank	NM_003546.2	NP_003537.1	P62805	H4_HUMAN	histone cluster 1, H4l	60					CENP-A containing nucleosome assembly (GO:0034080)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|DNA replication-independent nucleosome assembly (GO:0006336)|histone H4-K20 demethylation (GO:0035574)|mitotic cell cycle (GO:0000278)|negative regulation of megakaryocyte differentiation (GO:0045653)|nucleosome assembly (GO:0006334)|telomere maintenance (GO:0000723)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|histone demethylase activity (H4-K20 specific) (GO:0035575)|poly(A) RNA binding (GO:0044822)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(2)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)	13						CCAAAAACACTTTAAGAACTCC	0.559																																																	0																																										SO:0001583	missense	0			X83548	CCDS4637.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000198558	ENSG00000275126		"""Histones / Replication-dependent"""	4791	protein-coding gene	gene with protein product		602831	"""H4 histone family, member K"", ""histone 1, H4l"""	H4FK		9031620, 9439656, 12408966	Standard	NM_003546		Approved	H4.k, H4/k	uc003njz.3	P62805	OTTHUMG00000016211	ENST00000355981.2:c.179_180delinsAC	6.37:g.27841109_27841110delinsAC	ENSP00000348258:p.Lys60Ser		A2VCL0|P02304|P02305|Q6DRA9|Q6FGB8|Q6NWP7	Missense_Mutation	SNP	pfam_Histone_core_D,pfam_TAF_TATA-bd,superfamily_Histone-fold,smart_Histone_H4,smart_TAF_TATA-bd,prints_Histone_H4	p.K60N|p.K60R	ENST00000355981.2	37	c.180|c.179	CCDS4637.1	6																																																																																			HIST1H4L	-	pfam_Histone_core_D,superfamily_Histone-fold,smart_Histone_H4,smart_TAF_TATA-bd,prints_Histone_H4	ENSG00000198558		0.559	HIST1H4L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H4L	HGNC	protein_coding	OTTHUMT00000043513.1	-	0.00	106|104	0	T	NM_003546		27841109|27841110	-1	tier1	-	no_errors	ENST00000355981	ensembl	human	known	74_37	missense	26.39|25.00	53|54	19|18	SNP	1.000	A|C
ICMT	23463	genome.wustl.edu	37	1	6294509	6294509	+	Intron	SNP	G	G	A			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr1:6294509G>A	ENST00000343813.5	-	2	313				LINC00337_ENST00000441724.1_RNA|ICMT_ENST00000362035.3_Missense_Mutation_p.P116L	NM_012405.3	NP_036537.1	O60725	ICMT_HUMAN	isoprenylcysteine carboxyl methyltransferase						C-terminal protein methylation (GO:0006481)|cellular protein modification process (GO:0006464)|in utero embryonic development (GO:0001701)|liver development (GO:0001889)|multicellular organism growth (GO:0035264)|positive regulation of cell proliferation (GO:0008284)|protein targeting to membrane (GO:0006612)|regulation of Ras protein signal transduction (GO:0046578)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	cAMP response element binding protein binding (GO:0008140)|protein C-terminal carboxyl O-methyltransferase activity (GO:0003880)|protein C-terminal S-isoprenylcysteine carboxyl O-methyltransferase activity (GO:0004671)			NS(1)|endometrium(2)	3	Ovarian(185;0.0634)	all_cancers(23;5.85e-39)|all_epithelial(116;2.4e-22)|all_lung(118;2.65e-08)|Lung NSC(185;6.45e-07)|all_neural(13;3.18e-06)|all_hematologic(16;8.99e-06)|Acute lymphoblastic leukemia(12;0.000365)|Breast(487;0.000688)|Renal(390;0.0007)|Colorectal(325;0.00104)|Glioma(11;0.00203)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0392)|Medulloblastoma(700;0.211)		Epithelial(90;5.52e-38)|GBM - Glioblastoma multiforme(13;6.51e-32)|OV - Ovarian serous cystadenocarcinoma(86;3.03e-19)|Colorectal(212;7.08e-08)|COAD - Colon adenocarcinoma(227;8.35e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000911)|BRCA - Breast invasive adenocarcinoma(365;0.00109)|STAD - Stomach adenocarcinoma(132;0.00313)|READ - Rectum adenocarcinoma(331;0.0642)|Lung(427;0.182)		gaagGCTCAAGGGACTGAAAT	0.408																																																	0													14.0	13.0	13.0					1																	6294509		875	1986	2861	SO:0001627	intron_variant	0			AF064084	CCDS61.1	1p36	2010-04-29			ENSG00000116237	ENSG00000116237	2.1.1.100		5350	protein-coding gene	gene with protein product	"""protein-S-isoprenylcysteine O-methyltransferase"""	605851				9614111, 10441503	Standard	XM_005263437		Approved	PCCMT, HSTE14, PPMT	uc001amk.3	O60725	OTTHUMG00000001254	ENST00000343813.5:c.284+436C>T	1.37:g.6294509G>A			Q6FHT0	Missense_Mutation	SNP	NULL	p.P116L	ENST00000343813.5	37	c.347	CCDS61.1	1	.	.	.	.	.	.	.	.	.	.	G	14.31	2.497113	0.44352	.	.	ENSG00000116237	ENST00000362035	.	.	.	4.34	2.44	0.29823	.	.	.	.	.	T	0.42630	0.1211	.	.	.	0.27712	N	0.945431	.	.	.	.	.	.	T	0.38802	-0.9644	5	0.87932	D	0	.	6.9744	0.24666	0.2166:0.0:0.7834:0.0	.	.	.	.	L	116	.	ENSP00000354894:P116L	P	-	2	0	ICMT	6217096	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	0.582000	0.23834	0.404000	0.25506	0.655000	0.94253	CCT	ICMT	-	NULL	ENSG00000116237		0.408	ICMT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ICMT	HGNC	protein_coding	OTTHUMT00000003681.1	-	0.00	39	0	G	NM_012405		6294509	-1	tier1	-	no_errors	ENST00000362035	ensembl	human	known	74_37	missense	29.79	33	14	SNP	1.000	A
IARS2	55699	genome.wustl.edu	37	1	220318982	220318982	+	Silent	SNP	C	C	T			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr1:220318982C>T	ENST00000302637.5	+	22	2987	c.2883C>T	c.(2881-2883)ctC>ctT	p.L961L	IARS2_ENST00000366922.1_Silent_p.L889L	NM_018060.3	NP_060530.3	Q9NSE4	SYIM_HUMAN	isoleucyl-tRNA synthetase 2, mitochondrial	961					gene expression (GO:0010467)|isoleucyl-tRNA aminoacylation (GO:0006428)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	aminoacyl-tRNA editing activity (GO:0002161)|ATP binding (GO:0005524)|isoleucine-tRNA ligase activity (GO:0004822)	p.L961L(1)		NS(1)|breast(1)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(7)|lung(17)|ovary(2)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	51				GBM - Glioblastoma multiforme(131;0.0554)	L-Isoleucine(DB00167)	GGAAATTCCTCATCAACTTAG	0.388																																																	1	Substitution - coding silent(1)	kidney(1)											52.0	48.0	50.0					1																	220318982		2203	4300	6503	SO:0001819	synonymous_variant	0			AK022665	CCDS1523.1	1q41	2011-07-01	2007-02-26		ENSG00000067704	ENSG00000067704	6.1.1.5	"""Aminoacyl tRNA synthetases / Class I"""	29685	protein-coding gene	gene with protein product	"""isoleucine tRNA ligase 2, mitochondrial"""	612801					Standard	NM_018060		Approved	FLJ10326	uc001hmc.3	Q9NSE4	OTTHUMG00000037287	ENST00000302637.5:c.2883C>T	1.37:g.220318982C>T			B2RPG8|Q1M2P9|Q6PI85|Q7L439|Q86WU9|Q96D91|Q9H9Q8|Q9NW42	Silent	SNP	pfam_aa-tRNA-synth_Ia,pfam_V/L/I-tRNA-synth_anticodon-bd,pfam_Methionyl/Leucyl_tRNA_Synth,pfam_Znf_DNA_glyclase/IsotRNA_synth,superfamily_tRNAsynth_1a_anticodon-bd,superfamily_Val/Leu/Ile-tRNA-synth_edit,prints_Ile-tRNA-ligase,tigrfam_Ile-tRNA-ligase	p.L961	ENST00000302637.5	37	c.2883	CCDS1523.1	1																																																																																			IARS2	-	superfamily_tRNAsynth_1a_anticodon-bd	ENSG00000067704		0.388	IARS2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	IARS2	HGNC	protein_coding			0.00	35	0	C	NM_018060		220318982	+1			no_errors	ENST00000302637	ensembl	human	known	74_37	silent	6.90	27	2	SNP	0.329	T
IDH3B	3420	genome.wustl.edu	37	20	2641145	2641145	+	Missense_Mutation	SNP	T	T	C			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr20:2641145T>C	ENST00000380843.4	-	7	653	c.623A>G	c.(622-624)aAg>aGg	p.K208R	IDH3B_ENST00000380851.5_Missense_Mutation_p.K208R|IDH3B_ENST00000488299.1_5'UTR	NM_006899.3	NP_008830.2	O43837	IDH3B_HUMAN	isocitrate dehydrogenase 3 (NAD+) beta	208					2-oxoglutarate metabolic process (GO:0006103)|cellular metabolic process (GO:0044237)|isocitrate metabolic process (GO:0006102)|NADH metabolic process (GO:0006734)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	electron carrier activity (GO:0009055)|isocitrate dehydrogenase (NAD+) activity (GO:0004449)|magnesium ion binding (GO:0000287)|NAD binding (GO:0051287)			breast(1)|endometrium(3)|kidney(2)|lung(7)|prostate(1)	14						GCCCCGCCCCTTCTTGGTGGC	0.532																																																	0													120.0	107.0	111.0					20																	2641145		2203	4300	6503	SO:0001583	missense	0				CCDS13031.1, CCDS13032.1, CCDS74696.1	20p13	2013-02-14			ENSG00000101365	ENSG00000101365	1.1.1.41		5385	protein-coding gene	gene with protein product		604526				10575215	Standard	NM_006899		Approved	RP46	uc002wgp.4	O43837	OTTHUMG00000031699	ENST00000380843.4:c.623A>G	20.37:g.2641145T>C	ENSP00000370223:p.Lys208Arg		B2RDR1|D3DVX2|D3DVX3|O95106|Q5JXS8|Q9NQ06|Q9NQ07|Q9NUZ0|Q9UEX0|Q9UG99	Missense_Mutation	SNP	pfam_IsoPropMal-DH-like_dom,tigrfam_Isocitrate_DH_NAD	p.K208R	ENST00000380843.4	37	c.623	CCDS13032.1	20	.	.	.	.	.	.	.	.	.	.	T	14.86	2.661287	0.47572	.	.	ENSG00000101365	ENST00000380851;ENST00000380843;ENST00000435594	T;T	0.67698	-0.28;-0.28	5.02	5.02	0.67125	Isopropylmalate dehydrogenase-like domain (2);	0.047372	0.85682	D	0.000000	T	0.47192	0.1432	N	0.05124	-0.11	0.80722	D	1	B;B;B	0.16166	0.016;0.009;0.011	B;B;B	0.22152	0.033;0.022;0.038	T	0.49409	-0.8943	10	0.72032	D	0.01	-17.9953	12.759	0.57352	0.0:0.0:0.0:1.0	.	56;208;208	O43837-3;O43837-2;O43837	.;.;IDH3B_HUMAN	R	208;208;56	ENSP00000370232:K208R;ENSP00000370223:K208R	ENSP00000370223:K208R	K	-	2	0	IDH3B	2589145	1.000000	0.71417	0.999000	0.59377	0.424000	0.31475	3.972000	0.56838	2.117000	0.64856	0.533000	0.62120	AAG	IDH3B	-	pfam_IsoPropMal-DH-like_dom,tigrfam_Isocitrate_DH_NAD	ENSG00000101365		0.532	IDH3B-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	IDH3B	HGNC	protein_coding	OTTHUMT00000077613.1	-	0.00	82	0	T			2641145	-1	tier1	-	no_errors	ENST00000380843	ensembl	human	known	74_37	missense	22.41	45	13	SNP	1.000	C
IL17D	53342	genome.wustl.edu	37	13	21277449	21277449	+	5'Flank	SNP	T	T	C			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr13:21277449T>C	ENST00000304920.3	+	0	0				IL17D_ENST00000498088.1_3'UTR|AL161772.1_ENST00000581760.1_RNA	NM_138284.1	NP_612141.1	Q8TAD2	IL17D_HUMAN	interleukin 17D						inflammatory response (GO:0006954)	extracellular space (GO:0005615)				endometrium(1)|skin(1)	2		all_cancers(29;9.63e-24)|all_epithelial(30;1.09e-19)|all_lung(29;2.38e-16)|Lung SC(185;0.0262)|Hepatocellular(188;0.244)		all cancers(112;0.000301)|Epithelial(112;0.000633)|OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Lung(94;0.0154)|LUSC - Lung squamous cell carcinoma(192;0.0414)		GAGAAGATGTTGGGGGCACTG	0.607																																																	0																																										SO:0001631	upstream_gene_variant	0			AY078238	CCDS9292.1	13q11	2008-07-18			ENSG00000172458	ENSG00000172458		"""Interleukins and interleukin receptors"""	5984	protein-coding gene	gene with protein product	"""interleukin 27"""	607587				12097364	Standard	NM_138284		Approved	IL-22, IL-27, IL-17D, IL27, FLJ30846	uc001unm.3	Q8TAD2	OTTHUMG00000016521		13.37:g.21277449T>C	Exception_encountered		B1AM69	RNA	SNP	-	NULL	ENST00000304920.3	37	NULL	CCDS9292.1	13																																																																																			IL17D	-	-	ENSG00000172458		0.607	IL17D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL17D	HGNC	protein_coding	OTTHUMT00000044087.1	-	0.00	47	0	T	NM_138284		21277449	+1	tier1	-	no_errors	ENST00000498088	ensembl	human	known	74_37	rna	12.90	27	4	SNP	0.001	C
INO80D	54891	genome.wustl.edu	37	2	206869439	206869439	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr2:206869439G>C	ENST00000403263.1	-	11	3141	c.2737C>G	c.(2737-2739)Ctt>Gtt	p.L913V		NM_017759.4	NP_060229.3	Q53TQ3	IN80D_HUMAN	INO80 complex subunit D	736					DNA recombination (GO:0006310)|DNA repair (GO:0006281)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				NS(1)|cervix(2)|endometrium(3)|kidney(3)|large_intestine(3)|lung(9)|ovary(2)|prostate(1)|urinary_tract(2)	26						GTGGAAAGAAGATGTCCATCT	0.577																																																	0													124.0	136.0	132.0					2																	206869439		2114	4212	6326	SO:0001583	missense	0				CCDS46500.1	2q33.3	2011-07-06			ENSG00000114933	ENSG00000114933		"""INO80 complex subunits"""	25997	protein-coding gene	gene with protein product						16230350	Standard	NM_017759		Approved	FLJ20309	uc002vaz.4	Q53TQ3	OTTHUMG00000154649	ENST00000403263.1:c.2737C>G	2.37:g.206869439G>C	ENSP00000384198:p.Leu913Val		B3KU68|B9EG77|Q6PJC6|Q6PJU1|Q6PKA1|Q9NXD5	Missense_Mutation	SNP	NULL	p.L913V	ENST00000403263.1	37	c.2737	CCDS46500.1	2	.	.	.	.	.	.	.	.	.	.	G	18.93	3.728688	0.69074	.	.	ENSG00000114933	ENST00000403263	T	0.52754	0.65	5.84	5.84	0.93424	.	.	.	.	.	T	0.57784	0.2077	N	0.24115	0.695	0.58432	D	0.999997	D	0.67145	0.996	D	0.80764	0.994	T	0.55585	-0.8118	9	0.39692	T	0.17	.	20.1533	0.98095	0.0:0.0:1.0:0.0	.	913	Q53TQ3-2	.	V	913	ENSP00000384198:L913V	ENSP00000384198:L913V	L	-	1	0	INO80D	206577684	1.000000	0.71417	1.000000	0.80357	0.921000	0.55340	8.926000	0.92839	2.758000	0.94735	0.655000	0.94253	CTT	INO80D	-	NULL	ENSG00000114933		0.577	INO80D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INO80D	HGNC	protein_coding	OTTHUMT00000336459.1	-	0.00	64	0	G	NM_017759		206869439	-1	tier1	-	no_errors	ENST00000403263	ensembl	human	known	74_37	missense	11.94	59	8	SNP	1.000	C
IQUB	154865	genome.wustl.edu	37	7	123097574	123097574	+	Nonsense_Mutation	SNP	G	G	C			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr7:123097574G>C	ENST00000466202.1	-	12	2630	c.2054C>G	c.(2053-2055)tCa>tGa	p.S685*	RP11-332K15.1_ENST00000419832.1_RNA|IQUB_ENST00000324698.6_Nonsense_Mutation_p.S685*|RNU6-296P_ENST00000384608.1_RNA	NM_001282855.1	NP_001269784.1	Q8NA54	IQUB_HUMAN	IQ motif and ubiquitin domain containing	685					cilium morphogenesis (GO:0060271)|smoothened signaling pathway (GO:0007224)	acrosomal vesicle (GO:0001669)|motile cilium (GO:0031514)				breast(1)|endometrium(5)|kidney(3)|large_intestine(9)|lung(18)|ovary(3)|prostate(2)|stomach(3)|upper_aerodigestive_tract(1)	45						ACTGAGGACTGACTGGGACGC	0.423																																																	0													175.0	171.0	172.0					7																	123097574		2203	4300	6503	SO:0001587	stop_gained	0			AK093153	CCDS5787.1	7q31.32	2010-03-19			ENSG00000164675	ENSG00000164675			21995	protein-coding gene	gene with protein product							Standard	NM_178827		Approved	FLJ35834	uc003vko.3	Q8NA54	OTTHUMG00000157347	ENST00000466202.1:c.2054C>G	7.37:g.123097574G>C	ENSP00000417769:p.Ser685*		A4D0X0|Q49AL6|Q4G189|Q5BJD9|Q6NUH6|Q8N9Y2	Nonsense_Mutation	SNP	pfam_Ubiquitin_dom,pfscan_Ubiquitin_supergroup	p.S685*	ENST00000466202.1	37	c.2054	CCDS5787.1	7	.	.	.	.	.	.	.	.	.	.	G	38	7.119986	0.98077	.	.	ENSG00000164675	ENST00000466202;ENST00000324698	.	.	.	5.64	5.64	0.86602	.	0.062781	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	19.711	0.96096	0.0:0.0:1.0:0.0	.	.	.	.	X	685	.	ENSP00000324882:S685X	S	-	2	0	IQUB	122884810	1.000000	0.71417	0.958000	0.39756	0.350000	0.29205	9.075000	0.94004	2.653000	0.90120	0.637000	0.83480	TCA	IQUB	-	NULL	ENSG00000164675		0.423	IQUB-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	IQUB	HGNC	protein_coding	OTTHUMT00000348529.1	-	0.00	50	0	G	NM_178827		123097574	-1	tier1	-	no_errors	ENST00000324698	ensembl	human	known	74_37	nonsense	8.22	67	6	SNP	1.000	C
KANK1	23189	genome.wustl.edu	37	9	712721	712721	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr9:712721C>G	ENST00000382303.1	+	7	2607	c.1955C>G	c.(1954-1956)aCt>aGt	p.T652S	KANK1_ENST00000489369.1_3'UTR|KANK1_ENST00000382293.3_Missense_Mutation_p.T494S|KANK1_ENST00000382297.2_Missense_Mutation_p.T652S	NM_001256876.1	NP_001243805.1	Q14678	KANK1_HUMAN	KN motif and ankyrin repeat domains 1	652					negative regulation of actin filament polymerization (GO:0030837)|negative regulation of cell migration (GO:0030336)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of lamellipodium morphogenesis (GO:2000393)|negative regulation of neuron projection development (GO:0010977)|negative regulation of Rho protein signal transduction (GO:0035024)|negative regulation of ruffle assembly (GO:1900028)|negative regulation of substrate adhesion-dependent cell spreading (GO:1900025)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of Wnt signaling pathway (GO:0030177)|positive regulation of wound healing (GO:0090303)|regulation of establishment of cell polarity (GO:2000114)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|ruffle membrane (GO:0032587)	beta-catenin binding (GO:0008013)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(3)|large_intestine(9)|lung(8)|ovary(3)|pancreas(1)|prostate(3)|stomach(4)|upper_aerodigestive_tract(1)	43		Lung NSC(10;9.84e-12)|all_lung(10;1.02e-11)|Breast(48;0.128)		Epithelial(6;0.000153)|OV - Ovarian serous cystadenocarcinoma(1;0.000358)|Lung(218;0.0222)		GGCGTGAACACTGAGGCTGTT	0.547																																																	0													57.0	44.0	48.0					9																	712721		2203	4300	6503	SO:0001583	missense	0			AL833161	CCDS6441.1, CCDS34976.1	9p24.3	2013-01-10	2008-01-29	2008-01-29	ENSG00000107104	ENSG00000107104		"""KN motif and ankyrin repeat domain containing"", ""Ankyrin repeat domain containing"""	19309	protein-coding gene	gene with protein product		607704	"""ankyrin repeat domain 15"""	ANKRD15		12133830, 17996375, 19554261	Standard	NM_015158		Approved	KIAA0172, KANK	uc003zgn.2	Q14678	OTTHUMG00000019434	ENST00000382303.1:c.1955C>G	9.37:g.712721C>G	ENSP00000371740:p.Thr652Ser		A2A2W8|D3DRH3|Q5W0W0|Q8IY65|Q8WX74	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_KN_motif,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.T652S	ENST00000382303.1	37	c.1955	CCDS34976.1	9	.	.	.	.	.	.	.	.	.	.	C	19.03	3.748131	0.69533	.	.	ENSG00000107104	ENST00000382303;ENST00000354485;ENST00000382297;ENST00000382293	T;T;T	0.80214	-1.35;-1.35;-1.35	5.97	5.97	0.96955	.	0.000000	0.64402	D	0.000017	D	0.89677	0.6784	M	0.75264	2.295	0.80722	D	1	D;D	0.71674	0.997;0.998	D;P	0.68039	0.955;0.888	D	0.89622	0.3849	10	0.72032	D	0.01	-18.1431	20.0338	0.97549	0.0:1.0:0.0:0.0	.	652;652	Q5W0W1;Q14678	.;KANK1_HUMAN	S	652;652;652;494	ENSP00000371740:T652S;ENSP00000371734:T652S;ENSP00000371730:T494S	ENSP00000346479:T652S	T	+	2	0	KANK1	702721	1.000000	0.71417	0.950000	0.38849	0.569000	0.35902	7.706000	0.84615	2.836000	0.97738	0.655000	0.94253	ACT	KANK1	-	NULL	ENSG00000107104		0.547	KANK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KANK1	HGNC	protein_coding	OTTHUMT00000051484.2	-	0.00	27	0	C	NM_015158		712721	+1	tier1	-	no_errors	ENST00000382297	ensembl	human	known	74_37	missense	50.00	10	10	SNP	0.997	G
KCNQ3	3786	genome.wustl.edu	37	8	133492507	133492507	+	Silent	SNP	G	G	C			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr8:133492507G>C	ENST00000388996.4	-	1	693	c.273C>G	c.(271-273)acC>acG	p.T91T	KCNQ3_ENST00000519445.1_Silent_p.T91T	NM_004519.3	NP_004510.1	O43525	KCNQ3_HUMAN	potassium voltage-gated channel, KQT-like subfamily, member 3	91					axon guidance (GO:0007411)|membrane hyperpolarization (GO:0060081)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	axon initial segment (GO:0043194)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|lung(22)|ovary(2)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	70	Esophageal squamous(12;0.00507)|Ovarian(258;0.00579)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000311)		Amitriptyline(DB00321)|Diclofenac(DB00586)|Ezogabine(DB04953)|Meclofenamic acid(DB00939)	GGCTCAGCGGGGTCTTGGCCA	0.692																																																	0													36.0	41.0	39.0					8																	133492507		2203	4298	6501	SO:0001819	synonymous_variant	0			AB208890	CCDS34943.1, CCDS56554.1	8q24	2012-07-05			ENSG00000184156	ENSG00000184156		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6297	protein-coding gene	gene with protein product		602232		EBN2		9425900, 16382104	Standard	NM_004519		Approved	Kv7.3	uc003ytj.3	O43525	OTTHUMG00000137472	ENST00000388996.4:c.273C>G	8.37:g.133492507G>C			A2VCT8|B4DJY4|E7EQ89	Silent	SNP	pfam_K_chnl_volt-dep_KCNQ_C,pfam_Ankyrin-G_BS,pfam_Ion_trans_dom,pfam_2pore_dom_K_chnl_dom,prints_K_chnl_volt-dep_KCNQ3,prints_K_chnl_volt-dep_KCNQ,prints_K_chnl	p.T91	ENST00000388996.4	37	c.273	CCDS34943.1	8																																																																																			KCNQ3	-	prints_K_chnl_volt-dep_KCNQ3	ENSG00000184156		0.692	KCNQ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNQ3	HGNC	protein_coding	OTTHUMT00000268621.2	-	0.00	93	0	G	NM_004519		133492507	-1	tier1	-	no_errors	ENST00000388996	ensembl	human	known	74_37	silent	21.88	100	28	SNP	1.000	C
KEAP1	9817	genome.wustl.edu	37	19	10610154	10610154	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr19:10610154C>T	ENST00000171111.5	-	2	1103	c.556G>A	c.(556-558)Ggc>Agc	p.G186S	KEAP1_ENST00000393623.2_Missense_Mutation_p.G186S|KEAP1_ENST00000588024.1_5'UTR	NM_203500.1	NP_987096.1	Q14145	KEAP1_HUMAN	kelch-like ECH-associated protein 1	186	BACK.				cellular response to interleukin-4 (GO:0071353)|in utero embryonic development (GO:0001701)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|protein ubiquitination (GO:0016567)|regulation of epidermal cell differentiation (GO:0045604)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|nucleus (GO:0005634)				breast(3)|endometrium(2)|kidney(4)|large_intestine(4)|liver(2)|lung(69)|ovary(2)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	92			OV - Ovarian serous cystadenocarcinoma(20;2.71e-09)|Epithelial(33;2.32e-06)|all cancers(31;1.42e-05)		Dimethyl fumarate(DB08908)	TTGGCGATGCCGATGGCATTG	0.592																																																	0													105.0	85.0	92.0					19																	10610154		2203	4300	6503	SO:0001583	missense	0			AF361886	CCDS12239.1	19p13.2	2013-01-30				ENSG00000079999		"""Kelch-like"", ""BTB/POZ domain containing"""	23177	protein-coding gene	gene with protein product	"""kelch-like family member 19"""	606016					Standard	NM_012289		Approved	KIAA0132, MGC10630, MGC1114, MGC20887, MGC4407, MGC9454, INrf2, KLHL19	uc002mor.1	Q14145		ENST00000171111.5:c.556G>A	19.37:g.10610154C>T	ENSP00000171111:p.Gly186Ser		B3KPD5|Q6LEP0|Q8WTX1|Q9BPY9	Missense_Mutation	SNP	pfam_Kelch_1,pfam_BACK,pfam_BTB_POZ,pfam_Kelch_2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.G186S	ENST00000171111.5	37	c.556	CCDS12239.1	19	.	.	.	.	.	.	.	.	.	.	C	29.3	4.990571	0.93106	.	.	ENSG00000079999	ENST00000171111;ENST00000393623	T;T	0.70282	-0.47;-0.47	4.81	4.81	0.61882	BTB/Kelch-associated (2);	0.000000	0.85682	D	0.000000	D	0.82912	0.5140	M	0.71296	2.17	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.85287	0.1065	10	0.87932	D	0	.	15.3825	0.74669	0.0:1.0:0.0:0.0	.	186	Q14145	KEAP1_HUMAN	S	186	ENSP00000171111:G186S;ENSP00000377245:G186S	ENSP00000171111:G186S	G	-	1	0	KEAP1	10471154	1.000000	0.71417	0.996000	0.52242	0.916000	0.54674	5.912000	0.69948	2.232000	0.73038	0.561000	0.74099	GGC	KEAP1	-	pfam_BACK,smart_BACK,pirsf_Kelch-like_gigaxonin	ENSG00000079999		0.592	KEAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KEAP1	HGNC	protein_coding	OTTHUMT00000452000.1	-	0.00	24	0	C	NM_012289		10610154	-1	tier1	-	no_errors	ENST00000171111	ensembl	human	known	74_37	missense	14.29	18	3	SNP	1.000	T
KIAA0319L	79932	genome.wustl.edu	37	1	36020037	36020037	+	Missense_Mutation	SNP	T	T	C			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr1:36020037T>C	ENST00000325722.3	-	2	290	c.56A>G	c.(55-57)tAt>tGt	p.Y19C		NM_024874.4	NP_079150.3	Q8IZA0	K319L_HUMAN	KIAA0319-like	19						cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|kidney(3)|large_intestine(7)|lung(12)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|urinary_tract(1)	34		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				CTGCCAATAATATCCTGATAA	0.453																																																	0													79.0	80.0	80.0					1																	36020037		2203	4300	6503	SO:0001583	missense	0			AY163234	CCDS390.1	1p34.3	2008-10-24			ENSG00000142687	ENSG00000142687			30071	protein-coding gene	gene with protein product		613535				11347906	Standard	NM_024874		Approved	KIAA1837	uc001byx.3	Q8IZA0	OTTHUMG00000004370	ENST00000325722.3:c.56A>G	1.37:g.36020037T>C	ENSP00000318406:p.Tyr19Cys		B1AN13|D3DPR8|O95010|Q6PJJ7|Q7L1C9|Q8N2B3|Q8NDA0|Q8WY39|Q8WYZ5|Q96IC3|Q96JJ0|Q9BUW6|Q9H7V0	Missense_Mutation	SNP	pfam_PKD/REJ-like,superfamily_PKD_dom,smart_PKD/Chitinase_dom,pfscan_MANSC,pfscan_PKD_dom	p.Y19C	ENST00000325722.3	37	c.56	CCDS390.1	1	.	.	.	.	.	.	.	.	.	.	T	14.77	2.635306	0.47049	.	.	ENSG00000142687	ENST00000325722;ENST00000426982;ENST00000440579;ENST00000373258;ENST00000469892;ENST00000494948	T;T;T;T;T	0.54479	3.12;3.11;2.54;1.21;0.57	5.68	-0.909	0.10514	.	0.480260	0.19408	N	0.115011	T	0.30759	0.0775	N	0.19112	0.55	0.26485	N	0.975033	B;B;B	0.09022	0.002;0.001;0.0	B;B;B	0.12156	0.007;0.002;0.0	T	0.12293	-1.0553	10	0.45353	T	0.12	2.2886	5.9598	0.19293	0.157:0.275:0.0:0.568	.	19;19;19	B4DYG9;B1AN14;Q8IZA0	.;.;K319L_HUMAN	C	19	ENSP00000318406:Y19C;ENSP00000395883:Y19C;ENSP00000407576:Y19C;ENSP00000362355:Y19C;ENSP00000419396:Y19C	ENSP00000318406:Y19C	Y	-	2	0	KIAA0319L	35792624	0.854000	0.29725	0.995000	0.50966	0.893000	0.52053	0.060000	0.14342	-0.183000	0.10585	-1.052000	0.02337	TAT	KIAA0319L	-	NULL	ENSG00000142687		0.453	KIAA0319L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0319L	HGNC	protein_coding	OTTHUMT00000012684.2	-	0.00	47	0	T	NM_024874		36020037	-1	tier1	-	no_errors	ENST00000325722	ensembl	human	known	74_37	missense	30.23	30	13	SNP	0.923	C
KIAA0355	9710	genome.wustl.edu	37	19	34839998	34839998	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr19:34839998G>T	ENST00000299505.6	+	12	3638	c.2765G>T	c.(2764-2766)gGg>gTg	p.G922V	AC010504.2_ENST00000591311.1_RNA	NM_014686.3	NP_055501.2	O15063	K0355_HUMAN	KIAA0355	922										breast(1)|endometrium(7)|kidney(1)|large_intestine(4)|lung(15)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	41	Esophageal squamous(110;0.162)					TCAGCCAACGGGGACAGCTTG	0.567																																																	0													127.0	93.0	104.0					19																	34839998		2203	4300	6503	SO:0001583	missense	0				CCDS12436.1	19q13.12	2012-11-29			ENSG00000166398	ENSG00000166398			29016	protein-coding gene	gene with protein product						9205841	Standard	NM_014686		Approved		uc002nvd.4	O15063	OTTHUMG00000180505	ENST00000299505.6:c.2765G>T	19.37:g.34839998G>T	ENSP00000299505:p.Gly922Val		Q2M3W4	Missense_Mutation	SNP	NULL	p.G922V	ENST00000299505.6	37	c.2765	CCDS12436.1	19	.	.	.	.	.	.	.	.	.	.	G	29.4	5.001305	0.93227	.	.	ENSG00000166398	ENST00000299505	T	0.25250	1.81	5.73	5.73	0.89815	.	0.000000	0.85682	D	0.000000	T	0.43144	0.1234	L	0.29908	0.895	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.33033	-0.9884	10	0.87932	D	0	-10.6721	19.8981	0.96973	0.0:0.0:1.0:0.0	.	922	O15063	K0355_HUMAN	V	922	ENSP00000299505:G922V	ENSP00000299505:G922V	G	+	2	0	KIAA0355	39531838	1.000000	0.71417	0.845000	0.33349	0.877000	0.50540	9.238000	0.95380	2.710000	0.92621	0.591000	0.81541	GGG	KIAA0355	-	NULL	ENSG00000166398		0.567	KIAA0355-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0355	HGNC	protein_coding	OTTHUMT00000451678.4	-	0.00	82	0	G	NM_014686		34839998	+1	tier1	-	no_errors	ENST00000299505	ensembl	human	known	74_37	missense	5.00	76	4	SNP	1.000	T
KIAA1429	25962	genome.wustl.edu	37	8	95547194	95547194	+	Silent	SNP	A	A	G			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr8:95547194A>G	ENST00000297591.5	-	5	432	c.357T>C	c.(355-357)tgT>tgC	p.C119C	RP11-267M23.3_ENST00000521010.1_RNA|KIAA1429_ENST00000437199.1_Silent_p.C119C|KIAA1429_ENST00000421249.2_Silent_p.C119C	NM_015496.4	NP_056311.2	Q69YN4	VIR_HUMAN	KIAA1429	119					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|kidney(5)|large_intestine(16)|lung(28)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	66	Breast(36;3.29e-05)		BRCA - Breast invasive adenocarcinoma(8;0.00185)			CCAGTGTCAGACAGTTATACC	0.458																																																	0													117.0	104.0	108.0					8																	95547194		2203	4300	6503	SO:0001819	synonymous_variant	0			AB037850	CCDS34923.1, CCDS47894.1	8q22.1	2008-11-25			ENSG00000164944	ENSG00000164944			24500	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 121"""					10718198	Standard	NM_015496		Approved	DKFZP434I116, fSAP121	uc003ygo.2	Q69YN4	OTTHUMG00000164426	ENST00000297591.5:c.357T>C	8.37:g.95547194A>G			Q2M1N0|Q6AHX9|Q6NT78|Q7Z6C7|Q8IXH4|Q9BTH4|Q9H9C9|Q9NWR3|Q9P2B8|Q9UFW1	Silent	SNP	superfamily_ARM-type_fold	p.C119	ENST00000297591.5	37	c.357	CCDS34923.1	8																																																																																			KIAA1429	-	NULL	ENSG00000164944		0.458	KIAA1429-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1429	HGNC	protein_coding	OTTHUMT00000378720.2	-	0.00	66	0	A	NM_015496		95547194	-1	tier1	-	no_errors	ENST00000297591	ensembl	human	known	74_37	silent	31.43	48	22	SNP	1.000	G
KLF1	10661	genome.wustl.edu	37	19	12995819	12995819	+	Silent	SNP	C	C	T			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr19:12995819C>T	ENST00000264834.4	-	3	1009	c.969G>A	c.(967-969)tcG>tcA	p.S323S	CTD-2265O21.7_ENST00000592400.1_RNA	NM_006563.3	NP_006554.1	Q13351	KLF1_HUMAN	Kruppel-like factor 1 (erythroid)	323					cellular response to peptide (GO:1901653)|chromatin remodeling (GO:0006338)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|erythrocyte maturation (GO:0043249)|in utero embryonic development (GO:0001701)|liver development (GO:0001889)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	core promoter proximal region sequence-specific DNA binding (GO:0000987)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			endometrium(3)|large_intestine(1)|skin(1)	5		Hepatocellular(1079;0.137)		GBM - Glioblastoma multiforme(1328;0.00016)|Lung(535;0.171)|STAD - Stomach adenocarcinoma(1328;0.18)		TCAGCTCGTCCGAGCGCGCGA	0.652																																																	0													35.0	39.0	38.0					19																	12995819		2203	4300	6503	SO:0001819	synonymous_variant	0			U37106	CCDS12285.1	19p13.2	2014-07-18			ENSG00000105610	ENSG00000105610		"""Kruppel-like transcription factors"", ""Zinc fingers, C2H2-type"""	6345	protein-coding gene	gene with protein product	"""erythroid Kruppel-like factor"""	600599				8924208, 9119377	Standard	NM_006563		Approved	EKLF	uc002mvo.3	Q13351	OTTHUMG00000180536	ENST00000264834.4:c.969G>A	19.37:g.12995819C>T			Q6PIJ5|Q92899	Silent	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S323	ENST00000264834.4	37	c.969	CCDS12285.1	19																																																																																			KLF1	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000105610		0.652	KLF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLF1	HGNC	protein_coding	OTTHUMT00000451794.1	-	0.00	53	0	C	NM_006563		12995819	-1	tier1	-	no_errors	ENST00000264834	ensembl	human	known	74_37	silent	14.63	35	6	SNP	0.004	T
KLF7	8609	genome.wustl.edu	37	2	207988643	207988643	+	Silent	SNP	A	A	G			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr2:207988643A>G	ENST00000309446.6	-	2	964	c.588T>C	c.(586-588)agT>agC	p.S196S	KLF7_ENST00000423015.1_Intron|KLF7_ENST00000458272.1_Intron|KLF7_ENST00000467833.1_Intron|KLF7-IT1_ENST00000428777.1_RNA|KLF7_ENST00000421199.1_Silent_p.S163S|KLF7_ENST00000412414.2_Silent_p.S168S	NM_003709.3	NP_003700.1	O75840	KLF7_HUMAN	Kruppel-like factor 7 (ubiquitous)	196					axon guidance (GO:0007411)|dendrite morphogenesis (GO:0048813)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|large_intestine(3)|liver(1)|lung(4)|skin(1)	11				LUSC - Lung squamous cell carcinoma(261;0.0856)|Lung(261;0.166)|Epithelial(149;0.173)		CGCTCTGTCCACTCTTAACGG	0.592																																																	0													59.0	62.0	61.0					2																	207988643		2203	4300	6503	SO:0001819	synonymous_variant	0			AB015132	CCDS2373.1, CCDS59438.1, CCDS59439.1, CCDS59440.1	2q32	2013-01-08			ENSG00000118263	ENSG00000118263		"""Kruppel-like transcription factors"", ""Zinc fingers, C2H2-type"""	6350	protein-coding gene	gene with protein product		604865				9774444	Standard	NM_003709		Approved	UKLF	uc010zix.2	O75840	OTTHUMG00000132935	ENST00000309446.6:c.588T>C	2.37:g.207988643A>G			B2RB03|B7Z4F7|C9JF04|E7EWH1|L0R4P2|Q7Z3H8|Q96E51	Silent	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S196	ENST00000309446.6	37	c.588	CCDS2373.1	2																																																																																			KLF7	-	NULL	ENSG00000118263		0.592	KLF7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLF7	HGNC	protein_coding	OTTHUMT00000256466.2	-	0.00	57	0	A	NM_003709		207988643	-1	tier1	-	no_errors	ENST00000309446	ensembl	human	known	74_37	silent	25.00	27	9	SNP	1.000	G
KLHDC2	23588	genome.wustl.edu	37	14	50249303	50249303	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr14:50249303C>T	ENST00000298307.5	+	12	1949	c.1088C>T	c.(1087-1089)tCt>tTt	p.S363F	KLHDC2_ENST00000554589.1_Intron|KLHDC2_ENST00000557247.1_Intron|NEMF_ENST00000556925.1_5'Flank	NM_014315.2	NP_055130.1	Q9Y2U9	KLDC2_HUMAN	kelch domain containing 2	363						nucleus (GO:0005634)				endometrium(3)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16	all_epithelial(31;0.000959)|Breast(41;0.0117)					CAACCAAAATCTCTTGTACGG	0.299																																																	0													56.0	55.0	55.0					14																	50249303		2203	4300	6503	SO:0001583	missense	0			AK001771	CCDS9693.1	14q21.3	2003-01-15			ENSG00000165516	ENSG00000165516			20231	protein-coding gene	gene with protein product		611280				11384994	Standard	NM_014315		Approved	HCLP-1, LCP	uc001wwx.3	Q9Y2U9	OTTHUMG00000140288	ENST00000298307.5:c.1088C>T	14.37:g.50249303C>T	ENSP00000298307:p.Ser363Phe		B3KPF9|Q6IAF0|Q86TY9	Missense_Mutation	SNP	pfam_Kelch_2	p.S363F	ENST00000298307.5	37	c.1088	CCDS9693.1	14	.	.	.	.	.	.	.	.	.	.	C	26.1	4.705052	0.88924	.	.	ENSG00000165516	ENST00000298307	T	0.04654	3.58	5.47	5.47	0.80525	.	0.000000	0.85682	D	0.000000	T	0.22205	0.0535	M	0.69823	2.125	0.80722	D	1	D	0.65815	0.995	D	0.75484	0.986	T	0.00019	-1.2360	10	0.72032	D	0.01	-22.8696	18.4873	0.90834	0.0:1.0:0.0:0.0	.	363	Q9Y2U9	KLDC2_HUMAN	F	363	ENSP00000298307:S363F	ENSP00000298307:S363F	S	+	2	0	KLHDC2	49319053	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	5.293000	0.65680	2.847000	0.97988	0.655000	0.94253	TCT	KLHDC2	-	NULL	ENSG00000165516		0.299	KLHDC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHDC2	HGNC	protein_coding	OTTHUMT00000276869.1	-	0.00	36	0	C			50249303	+1	tier1	-	no_errors	ENST00000298307	ensembl	human	known	74_37	missense	12.50	28	4	SNP	1.000	T
KLHL14	57565	genome.wustl.edu	37	18	30260215	30260215	+	Missense_Mutation	SNP	T	T	C			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr18:30260215T>C	ENST00000359358.4	-	7	1943	c.1505A>G	c.(1504-1506)cAa>cGa	p.Q502R		NM_020805.1	NP_065856.1	Q9P2G3	KLH14_HUMAN	kelch-like family member 14	502						endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)				breast(3)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(20)|ovary(2)	31						GTTCATATCTTGTTTTCGAGC	0.378																																																	0													163.0	142.0	149.0					18																	30260215		2203	4300	6503	SO:0001583	missense	0			AB037805	CCDS32813.1	18q12.1	2013-10-15	2013-01-30		ENSG00000197705	ENSG00000197705		"""Kelch-like"", ""BTB/POZ domain containing"""	29266	protein-coding gene	gene with protein product	"""printor"""	613772	"""kelch-like 14 (Drosophila)"""			10718198, 19535332	Standard	NM_020805		Approved	KIAA1384	uc002kxm.1	Q9P2G3	OTTHUMG00000179819	ENST00000359358.4:c.1505A>G	18.37:g.30260215T>C	ENSP00000352314:p.Gln502Arg		A6NNW1|B4DHA0|Q8WU41	Missense_Mutation	SNP	pfam_Kelch_1,pfam_BTB_POZ,pfam_BACK,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.Q502R	ENST00000359358.4	37	c.1505	CCDS32813.1	18	.	.	.	.	.	.	.	.	.	.	T	21.8	4.196560	0.79015	.	.	ENSG00000197705	ENST00000359358	T	0.77489	-1.1	5.87	5.87	0.94306	Galactose oxidase, beta-propeller (1);	0.000000	0.85682	D	0.000000	T	0.74635	0.3742	N	0.02842	-0.48	0.80722	D	1	P	0.49559	0.925	D	0.67900	0.954	T	0.82653	-0.0351	10	0.66056	D	0.02	.	16.2674	0.82597	0.0:0.0:0.0:1.0	.	502	Q9P2G3	KLH14_HUMAN	R	502	ENSP00000352314:Q502R	ENSP00000352314:Q502R	Q	-	2	0	KLHL14	28514213	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.673000	0.83973	2.242000	0.73789	0.533000	0.62120	CAA	KLHL14	-	pfam_Kelch_1,smart_Kelch_1,pirsf_Kelch-like_gigaxonin	ENSG00000197705		0.378	KLHL14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHL14	HGNC	protein_coding	OTTHUMT00000448376.1	-	0.00	54	0	T			30260215	-1	tier1	-	no_errors	ENST00000359358	ensembl	human	known	74_37	missense	22.64	41	12	SNP	1.000	C
KLHL22	84861	genome.wustl.edu	37	22	20819524	20819524	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr22:20819524G>A	ENST00000328879.4	-	4	889	c.733C>T	c.(733-735)Cgg>Tgg	p.R245W	KLHL22_ENST00000440659.2_Missense_Mutation_p.R102W	NM_032775.3	NP_116164.2	Q53GT1	KLH22_HUMAN	kelch-like family member 22	245					cell division (GO:0051301)|mitotic sister chromatid segregation (GO:0000070)|mitotic spindle assembly checkpoint (GO:0007094)|protein monoubiquitination (GO:0006513)	centrosome (GO:0005813)|Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|mitotic spindle (GO:0072686)|polar microtubule (GO:0005827)				breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(12)|skin(2)|upper_aerodigestive_tract(1)	20	Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0221)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.00102)|Lung(15;0.0173)			AGCGGAAACCGCACTGTCTCA	0.607																																																	0													35.0	32.0	33.0					22																	20819524		2203	4300	6503	SO:0001583	missense	0				CCDS13780.1	22q11.21	2013-01-30	2013-01-30		ENSG00000099910	ENSG00000099910		"""Kelch-like"", ""BTB/POZ domain containing"""	25888	protein-coding gene	gene with protein product			"""kelch-like 22 (Drosophila)"""			12477932	Standard	NM_032775		Approved	FLJ14360, KELCHL	uc002zsl.2	Q53GT1	OTTHUMG00000150778	ENST00000328879.4:c.733C>T	22.37:g.20819524G>A	ENSP00000331682:p.Arg245Trp		A8K3Q4|A8MTV3|B7Z2G1|D3DX30|Q96B68|Q96KC6	Missense_Mutation	SNP	pfam_Kelch_1,pfam_BTB_POZ,pfam_Kelch_2,pfam_BACK,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.R245W	ENST00000328879.4	37	c.733	CCDS13780.1	22	.	.	.	.	.	.	.	.	.	.	G	26.2	4.711758	0.89112	.	.	ENSG00000099910	ENST00000328879;ENST00000440659;ENST00000451553;ENST00000444967	T;T;T;T	0.81078	-1.45;-1.45;-1.45;-1.45	5.32	5.32	0.75619	BTB/Kelch-associated (2);	0.000000	0.85682	D	0.000000	D	0.91476	0.7309	M	0.89534	3.04	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.997	D	0.93083	0.6493	10	0.87932	D	0	.	16.477	0.84135	0.0:0.0:1.0:0.0	.	102;245	B7Z2G1;Q53GT1	.;KLH22_HUMAN	W	245;102;168;277	ENSP00000331682:R245W;ENSP00000405521:R102W;ENSP00000400095:R168W;ENSP00000403999:R277W	ENSP00000331682:R245W	R	-	1	2	KLHL22	19149524	1.000000	0.71417	0.992000	0.48379	0.999000	0.98932	9.085000	0.94083	2.483000	0.83821	0.655000	0.94253	CGG	KLHL22	-	pfam_BACK,smart_BACK,pirsf_Kelch-like_gigaxonin	ENSG00000099910		0.607	KLHL22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHL22	HGNC	protein_coding	OTTHUMT00000320045.2	-	0.00	49	0	G	NM_032775		20819524	-1	tier1	-	no_errors	ENST00000328879	ensembl	human	known	74_37	missense	6.46	246	17	SNP	1.000	A
KMT2E	55904	genome.wustl.edu	37	7	104703927	104703927	+	Missense_Mutation	SNP	A	A	G			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr7:104703927A>G	ENST00000311117.3	+	5	861	c.316A>G	c.(316-318)Atc>Gtc	p.I106V	KMT2E_ENST00000334914.7_5'UTR|KMT2E_ENST00000476671.1_Missense_Mutation_p.I106V|KMT2E_ENST00000334877.4_Missense_Mutation_p.I106V|KMT2E_ENST00000257745.4_Missense_Mutation_p.I106V	NM_182931.2	NP_891847.1	Q8IZD2	KMT2E_HUMAN	lysine (K)-specific methyltransferase 2E	106					cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|DNA methylation (GO:0006306)|erythrocyte differentiation (GO:0030218)|histone H3-K4 methylation (GO:0051568)|neutrophil activation (GO:0042119)|neutrophil mediated immunity (GO:0002446)|positive regulation of granulocyte differentiation (GO:0030854)|positive regulation of transcription, DNA-templated (GO:0045893)|retinoic acid receptor signaling pathway (GO:0048384)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|MLL5-L complex (GO:0070688)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)										TGCTACTACAATCAGCACATC	0.418																																																	0													153.0	135.0	141.0					7																	104703927		2203	4300	6503	SO:0001583	missense	0			AF067804	CCDS34723.1	7q22.1	2013-05-09	2013-05-09	2013-05-09	ENSG00000005483	ENSG00000005483		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	18541	protein-coding gene	gene with protein product		608444	"""myeloid/lymphoid or mixed-lineage leukemia 5 (trithorax homolog, Drosophila)"""	MLL5		9218106, 7672722	Standard	XM_005250493		Approved	HDCMC04P		Q8IZD2	OTTHUMG00000157403	ENST00000311117.3:c.316A>G	7.37:g.104703927A>G	ENSP00000312379:p.Ile106Val		B6ZDE4|B6ZDM3|M4K8J3|Q6P5Y2|Q6PKG4|Q6T316|Q86TI3|Q86W12|Q86WG0|Q86WL2|Q8IV78|Q8IWR5|Q8NFF8|Q9NWE7	Missense_Mutation	SNP	pfam_SET_dom,pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,smart_SET_dom,pfscan_SET_dom,pfscan_Znf_PHD-finger	p.I106V	ENST00000311117.3	37	c.316	CCDS34723.1	7	.	.	.	.	.	.	.	.	.	.	A	9.086	1.000436	0.19121	.	.	ENSG00000005483	ENST00000311117;ENST00000393656;ENST00000334877;ENST00000351043;ENST00000257745;ENST00000495267;ENST00000476671;ENST00000537308	D;D;D;T;D	0.93076	-2.8;-2.43;-2.8;1.65;-3.16	5.46	5.46	0.80206	Zinc finger, FYVE/PHD-type (1);	0.058810	0.64402	D	0.000001	D	0.84615	0.5511	N	0.08118	0	0.80722	D	1	P;B	0.44690	0.841;0.112	B;B	0.37451	0.25;0.079	D	0.85423	0.1144	10	0.26408	T	0.33	.	15.8148	0.78592	1.0:0.0:0.0:0.0	.	106;106	Q8IZD2;Q8IZD2-3	MLL5_HUMAN;.	V	106;106;106;106;106;106;106;40	ENSP00000312379:I106V;ENSP00000335599:I106V;ENSP00000257745:I106V;ENSP00000420415:I106V;ENSP00000417888:I106V	ENSP00000257745:I106V	I	+	1	0	MLL5	104491163	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.607000	0.74163	2.200000	0.70718	0.477000	0.44152	ATC	KMT2E	-	superfamily_Znf_FYVE_PHD	ENSG00000005483		0.418	KMT2E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KMT2E	HGNC	protein_coding	OTTHUMT00000348697.1	-	0.00	38	0	A			104703927	+1	tier1	-	no_errors	ENST00000257745	ensembl	human	known	74_37	missense	19.67	49	12	SNP	0.999	G
KRT8	3856	genome.wustl.edu	37	12	53292281	53292281	+	Missense_Mutation	SNP	T	T	A			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr12:53292281T>A	ENST00000552551.1	-	8	1657	c.1225A>T	c.(1225-1227)Atg>Ttg	p.M409L	KRT8_ENST00000293308.6_Missense_Mutation_p.M409L|KRT8_ENST00000546897.1_Missense_Mutation_p.M409L|KRT8_ENST00000552150.1_Missense_Mutation_p.M437L			P05787	K2C8_HUMAN	keratin 8	409	Tail.				cell differentiation involved in embryonic placenta development (GO:0060706)|extrinsic apoptotic signaling pathway (GO:0097191)|hepatocyte apoptotic process (GO:0097284)|response to hydrostatic pressure (GO:0051599)|response to other organism (GO:0051707)|sarcomere organization (GO:0045214)|tumor necrosis factor-mediated signaling pathway (GO:0033209)|viral process (GO:0016032)	cell-cell junction (GO:0005911)|costamere (GO:0043034)|cytoplasm (GO:0005737)|dystrophin-associated glycoprotein complex (GO:0016010)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)|nucleus (GO:0005634)|sarcolemma (GO:0042383)|Z disc (GO:0030018)	scaffold protein binding (GO:0097110)|structural molecule activity (GO:0005198)			endometrium(5)|large_intestine(1)|liver(1)|lung(3)|ovary(1)|prostate(1)|skin(1)	13				BRCA - Breast invasive adenocarcinoma(357;0.108)	Tenecteplase(DB00031)	TGAATACTCATGTTCTGCATC	0.612																																																	0													35.0	34.0	34.0					12																	53292281		2203	4300	6503	SO:0001583	missense	0			BC000654	CCDS8841.1, CCDS58234.1	12q13.13	2013-01-16			ENSG00000170421	ENSG00000170421		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6446	protein-coding gene	gene with protein product		148060				2434381, 1705144, 16831889	Standard	NM_002273		Approved	CARD2, K8, CK8, CYK8, K2C8, KO	uc009zmk.1	P05787	OTTHUMG00000169881	ENST00000552551.1:c.1225A>T	12.37:g.53292281T>A	ENSP00000447566:p.Met409Leu		A8K4H3|B0AZN5|F8VXB4|Q14099|Q14716|Q14717|Q53GJ0|Q6DHW5|Q6GMY0|Q6P4C7|Q96J60	Missense_Mutation	SNP	pfam_IF,superfamily_Prefoldin,prints_Keratin_II,prints_Keratin_I	p.M409L	ENST00000552551.1	37	c.1225	CCDS8841.1	12	.	.	.	.	.	.	.	.	.	.	T	12.76	2.033323	0.35893	.	.	ENSG00000170421	ENST00000552551;ENST00000293308;ENST00000546897;ENST00000552150	T;T;T;T	0.80653	-1.32;-1.32;-1.32;-1.4	4.32	-1.62	0.08372	.	0.475713	0.24145	N	0.041122	T	0.67325	0.2881	L	0.49256	1.55	0.30033	N	0.813272	B;B	0.14438	0.01;0.001	B;B	0.19148	0.024;0.005	T	0.55952	-0.8059	10	0.56958	D	0.05	.	1.4489	0.02370	0.2715:0.082:0.2794:0.3671	.	437;409	F8VXB4;P05787	.;K2C8_HUMAN	L	409;409;409;437	ENSP00000447566:M409L;ENSP00000293308:M409L;ENSP00000447402:M409L;ENSP00000449404:M437L	ENSP00000293308:M409L	M	-	1	0	KRT8	51578548	0.023000	0.18921	0.995000	0.50966	0.939000	0.58152	-0.601000	0.05687	-0.377000	0.07930	0.459000	0.35465	ATG	KRT8	-	NULL	ENSG00000170421		0.612	KRT8-001	KNOWN	alternative_5_UTR|overlapping_uORF|basic|appris_principal|CCDS	protein_coding	KRT8	HGNC	protein_coding	OTTHUMT00000406385.1	-	0.00	89	0	T	NM_002273		53292281	-1	tier1	-	no_errors	ENST00000293308	ensembl	human	known	74_37	missense	13.68	82	13	SNP	0.979	A
LAMA2	3908	genome.wustl.edu	37	6	129475680	129475680	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr6:129475680G>A	ENST00000421865.2	+	8	1107	c.1058G>A	c.(1057-1059)tGc>tAc	p.C353Y		NM_000426.3|NM_001079823.1	NP_000417|NP_001073291.1	P24043	LAMA2_HUMAN	laminin, alpha 2	353	Laminin EGF-like 2. {ECO:0000255|PROSITE- ProRule:PRU00460}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|myelination in peripheral nervous system (GO:0022011)|positive regulation of synaptic transmission, cholinergic (GO:0032224)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basement membrane (GO:0005604)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|sarcolemma (GO:0042383)	structural molecule activity (GO:0005198)			NS(2)|biliary_tract(2)|breast(10)|central_nervous_system(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(35)|lung(84)|ovary(10)|prostate(4)|skin(9)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(2)	194				OV - Ovarian serous cystadenocarcinoma(136;0.178)|all cancers(137;0.245)		GCTGAAGAATGCTATTATGAT	0.318																																																	0													78.0	80.0	80.0					6																	129475680		2203	4300	6503	SO:0001583	missense	0			Z26653	CCDS5138.1	6q22-q23	2014-09-17	2008-08-01		ENSG00000196569	ENSG00000196569		"""Laminins"""	6482	protein-coding gene	gene with protein product	"""merosin"", ""congenital muscular dystrophy"""	156225		LAMM		2185464, 8294519	Standard	NM_000426		Approved		uc003qbn.3	P24043	OTTHUMG00000015545	ENST00000421865.2:c.1058G>A	6.37:g.129475680G>A	ENSP00000400365:p.Cys353Tyr		Q14736|Q5VUM2|Q93022	Missense_Mutation	SNP	pfam_Laminin_G,pfam_EGF_laminin,pfam_Laminin_N,pfam_Laminin_I,pfam_Laminin_B_type_IV,pfam_Laminin_II,superfamily_ConA-like_lec_gl_sf,superfamily_Galactose-bd-like,superfamily_t-SNARE,smart_Laminin_N,smart_EGF_laminin,smart_EG-like_dom,smart_Laminin_B_subgr,smart_Laminin_G,pfscan_Laminin_B_type_IV,pfscan_EGF_laminin,pfscan_Laminin_G,pfscan_Laminin_N	p.C353Y	ENST00000421865.2	37	c.1058	CCDS5138.1	6	.	.	.	.	.	.	.	.	.	.	G	26.7	4.762386	0.89932	.	.	ENSG00000196569	ENST00000358023;ENST00000354729;ENST00000421865	D	0.94330	-3.4	6.06	6.06	0.98353	EGF-like, laminin (3);	0.000000	0.85682	D	0.000000	D	0.98476	0.9492	H	0.99058	4.415	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.99150	1.0858	10	0.87932	D	0	.	20.2233	0.98332	0.0:0.0:1.0:0.0	.	353;353	A6NF00;P24043	.;LAMA2_HUMAN	Y	353	ENSP00000400365:C353Y	ENSP00000346769:C353Y	C	+	2	0	LAMA2	129517373	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.532000	0.98057	2.871000	0.98454	0.655000	0.94253	TGC	LAMA2	-	pfam_EGF_laminin,smart_EGF_laminin	ENSG00000196569		0.318	LAMA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMA2	HGNC	protein_coding	OTTHUMT00000042180.1	-	0.00	46	0	G			129475680	+1	tier1	-	no_errors	ENST00000421865	ensembl	human	known	74_37	missense	25.00	21	7	SNP	1.000	A
LAMB2	3913	genome.wustl.edu	37	3	49166737	49166737	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr3:49166737G>T	ENST00000418109.1	-	13	1703	c.1539C>A	c.(1537-1539)agC>agA	p.S513R	LAMB2_ENST00000305544.4_Missense_Mutation_p.S513R	NM_002292.3	NP_002283.3	P55268	LAMB2_HUMAN	laminin, beta 2 (laminin S)	513	Laminin EGF-like 4. {ECO:0000255|PROSITE- ProRule:PRU00460}.				astrocyte development (GO:0014002)|axon extension involved in regeneration (GO:0048677)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|metanephric glomerular basement membrane development (GO:0072274)|metanephric glomerular visceral epithelial cell development (GO:0072249)|neuromuscular junction development (GO:0007528)|retina development in camera-type eye (GO:0060041)|Schwann cell development (GO:0014044)|visual perception (GO:0007601)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-11 complex (GO:0043260)|laminin-3 complex (GO:0005608)|synapse (GO:0045202)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|endometrium(15)|kidney(3)|large_intestine(6)|lung(21)|ovary(4)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	61				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00219)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		GCAGGTCGTGGCTCAGGCCCC	0.622																																																	0													32.0	36.0	35.0					3																	49166737		2203	4300	6503	SO:0001583	missense	0				CCDS2789.1	3p21.3-p21.2	2013-03-01			ENSG00000172037	ENSG00000172037		"""Laminins"""	6487	protein-coding gene	gene with protein product	"""laminin S"""	150325		LAMS		2922051, 10393422	Standard	NM_002292		Approved		uc003cwe.3	P55268	OTTHUMG00000156807	ENST00000418109.1:c.1539C>A	3.37:g.49166737G>T	ENSP00000388325:p.Ser513Arg		Q16321	Missense_Mutation	SNP	pfam_EGF_laminin,pfam_Laminin_N,smart_Laminin_N,smart_EGF_laminin,smart_EG-like_dom,pfscan_Laminin_IV,pfscan_EGF_laminin,pfscan_Laminin_N	p.S513R	ENST00000418109.1	37	c.1539	CCDS2789.1	3	.	.	.	.	.	.	.	.	.	.	G	16.18	3.050131	0.55218	.	.	ENSG00000172037	ENST00000418109;ENST00000305544	T;T	0.61627	0.09;0.09	5.06	3.14	0.36123	EGF-like, laminin (4);	0.047266	0.85682	D	0.000000	T	0.69477	0.3115	M	0.72624	2.21	0.80722	D	1	D	0.76494	0.999	D	0.65874	0.939	T	0.70267	-0.4919	10	0.54805	T	0.06	.	9.4349	0.38632	0.0754:0.0:0.7821:0.1425	.	513	P55268	LAMB2_HUMAN	R	513	ENSP00000388325:S513R;ENSP00000307156:S513R	ENSP00000307156:S513R	S	-	3	2	LAMB2	49141741	1.000000	0.71417	1.000000	0.80357	0.741000	0.42261	2.979000	0.49313	1.115000	0.41800	-0.150000	0.13652	AGC	LAMB2	-	pfam_EGF_laminin,smart_EGF_laminin,pfscan_EGF_laminin	ENSG00000172037		0.622	LAMB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMB2	HGNC	protein_coding	OTTHUMT00000345939.1	-	0.00	22	0	G	NM_002292		49166737	-1	tier1	-	no_errors	ENST00000305544	ensembl	human	known	74_37	missense	21.05	15	4	SNP	1.000	T
LBP	3929	genome.wustl.edu	37	20	36982828	36982828	+	Silent	SNP	G	G	A			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr20:36982828G>A	ENST00000217407.2	+	4	674	c.513G>A	c.(511-513)tcG>tcA	p.S171S		NM_004139.3	NP_004130.2	P18428	LBP_HUMAN	lipopolysaccharide binding protein	171					acute-phase response (GO:0006953)|cellular defense response (GO:0006968)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to lipoteichoic acid (GO:0071223)|defense response to Gram-negative bacterium (GO:0050829)|defense response to Gram-positive bacterium (GO:0050830)|detection of molecule of bacterial origin (GO:0032490)|innate immune response (GO:0045087)|leukocyte chemotaxis involved in inflammatory response (GO:0002232)|lipopolysaccharide transport (GO:0015920)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|macrophage activation involved in immune response (GO:0002281)|negative regulation of growth of symbiont in host (GO:0044130)|negative regulation of tumor necrosis factor production (GO:0032720)|opsonization (GO:0008228)|positive regulation of chemokine production (GO:0032722)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of macrophage activation (GO:0043032)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation of respiratory burst involved in inflammatory response (GO:0060265)|positive regulation of toll-like receptor 4 signaling pathway (GO:0034145)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|positive regulation of tumor necrosis factor production (GO:0032760)|response to lipopolysaccharide (GO:0032496)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)	cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	lipopolysaccharide binding (GO:0001530)|lipoteichoic acid binding (GO:0070891)|receptor binding (GO:0005102)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(16)|ovary(2)|prostate(1)|urinary_tract(1)	28		Myeloproliferative disorder(115;0.00878)				TGGACATGTCGGGAGACTTGG	0.617																																																	0													42.0	37.0	39.0					20																	36982828		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS13304.1	20q11.23	2011-08-16	2001-11-28		ENSG00000129988	ENSG00000129988		"""BPI fold containing"""	6517	protein-coding gene	gene with protein product	"""BPI fold containing family D, member 2"""	151990	"""lipopolysaccharide-binding protein"""			8432532	Standard	NM_004139		Approved	BPIFD2	uc002xic.2	P18428	OTTHUMG00000032447	ENST00000217407.2:c.513G>A	20.37:g.36982828G>A			B2R938|O43438|Q92672|Q9H403|Q9UD66	Silent	SNP	pfam_Lipid-bd_serum_glycop_C,pfam_Lipid-bd_serum_glycop_N,superfamily_Bactericidal_perm-incr_a/b_dom,smart_Lipid-bd_serum_glycop_N,smart_Lipid-bd_serum_glycop_C	p.S171	ENST00000217407.2	37	c.513	CCDS13304.1	20																																																																																			LBP	-	pfam_Lipid-bd_serum_glycop_N,superfamily_Bactericidal_perm-incr_a/b_dom,smart_Lipid-bd_serum_glycop_N	ENSG00000129988		0.617	LBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LBP	HGNC	protein_coding	OTTHUMT00000079174.2		0.00	26	0	G	NM_004139		36982828	+1			no_errors	ENST00000217407	ensembl	human	known	74_37	silent	16.67	25	5	SNP	0.000	A
LCT	3938	genome.wustl.edu	37	2	136579638	136579638	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr2:136579638C>T	ENST00000264162.2	-	5	948	c.938G>A	c.(937-939)gGg>gAg	p.G313E	AC011893.3_ENST00000437007.1_RNA	NM_002299.2	NP_002290.2	P09848	LPH_HUMAN	lactase	313	4 X approximate repeats.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	glycosylceramidase activity (GO:0017042)|lactase activity (GO:0000016)			breast(6)|central_nervous_system(3)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(26)|lung(57)|ovary(7)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(4)	124				BRCA - Breast invasive adenocarcinoma(221;0.169)	Vitamin C(DB00126)	AATATCAAACCCAATGGTGAG	0.333																																																	0													131.0	135.0	134.0					2																	136579638		2203	4300	6503	SO:0001583	missense	0			X07994	CCDS2178.1	2q21	2014-09-17			ENSG00000115850	ENSG00000115850	3.2.1.108, 3.2.1.62		6530	protein-coding gene	gene with protein product		603202					Standard	NM_002299		Approved		uc002tuu.1	P09848	OTTHUMG00000131738	ENST00000264162.2:c.938G>A	2.37:g.136579638C>T	ENSP00000264162:p.Gly313Glu		Q4ZG58	Missense_Mutation	SNP	pfam_Glyco_hydro_1,superfamily_Glycoside_hydrolase_SF,prints_Glyco_hydro_1	p.G313E	ENST00000264162.2	37	c.938	CCDS2178.1	2	.	.	.	.	.	.	.	.	.	.	C	24.7	4.559040	0.86335	.	.	ENSG00000115850	ENST00000264162	T	0.34472	1.36	5.44	5.44	0.79542	.	0.000000	0.85682	D	0.000000	T	0.59514	0.2199	M	0.63843	1.955	0.53688	D	0.999976	D	0.89917	1.0	D	0.83275	0.996	T	0.60188	-0.7312	10	0.87932	D	0	-32.4761	17.9984	0.89191	0.0:1.0:0.0:0.0	.	313	P09848	LPH_HUMAN	E	313	ENSP00000264162:G313E	ENSP00000264162:G313E	G	-	2	0	LCT	136296108	0.998000	0.40836	0.913000	0.36048	0.996000	0.88848	4.791000	0.62460	2.832000	0.97577	0.655000	0.94253	GGG	LCT	-	NULL	ENSG00000115850		0.333	LCT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LCT	HGNC	protein_coding	OTTHUMT00000254657.1	-	0.00	81	0	C	NM_002299		136579638	-1	tier1	-	no_errors	ENST00000264162	ensembl	human	known	74_37	missense	18.46	53	12	SNP	0.996	T
LGSN	51557	genome.wustl.edu	37	6	63989979	63989979	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr6:63989979C>G	ENST00000370657.4	-	4	1510	c.1477G>C	c.(1477-1479)Gag>Cag	p.E493Q	LGSN_ENST00000370658.5_3'UTR			Q5TDP6	LGSN_HUMAN	lengsin, lens protein with glutamine synthetase domain	493					glutamine biosynthetic process (GO:0006542)	plasma membrane (GO:0005886)	glutamate-ammonia ligase activity (GO:0004356)			NS(1)|endometrium(2)|large_intestine(5)|lung(16)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	34						TCTTCATTCTCCAACTCATAT	0.358																																																	0													69.0	73.0	72.0					6																	63989979		2203	4300	6503	SO:0001583	missense	0			AF242388	CCDS4964.1, CCDS55027.1	6q12	2013-09-19	2008-09-19	2008-09-19	ENSG00000146166	ENSG00000146166			21016	protein-coding gene	gene with protein product		611470	"""glutamate-ammonia ligase (glutamine synthetase) domain containing 1"""	GLULD1		12107412	Standard	NM_016571		Approved	LGS	uc003peh.3	Q5TDP6	OTTHUMG00000014946	ENST00000370657.4:c.1477G>C	6.37:g.63989979C>G	ENSP00000359691:p.Glu493Gln		A1L421|Q0PVN9|Q0PVP0|Q9NYJ0	Missense_Mutation	SNP	pfam_Gln_synth_cat_dom,pfam_Gln_synt_beta,superfamily_Gln_synt_beta	p.E493Q	ENST00000370657.4	37	c.1477	CCDS4964.1	6	.	.	.	.	.	.	.	.	.	.	C	18.89	3.718974	0.68844	.	.	ENSG00000146166	ENST00000370657	D	0.86432	-2.12	5.96	5.96	0.96718	Glutamine synthetase/guanido kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.88644	0.6492	M	0.78801	2.425	0.80722	D	1	P	0.41710	0.76	P	0.46110	0.504	D	0.88669	0.3194	10	0.52906	T	0.07	-31.8128	19.4101	0.94667	0.0:1.0:0.0:0.0	.	493	Q5TDP6	LGSN_HUMAN	Q	493	ENSP00000359691:E493Q	ENSP00000359691:E493Q	E	-	1	0	LGSN	64047938	1.000000	0.71417	1.000000	0.80357	0.527000	0.34593	7.487000	0.81328	2.832000	0.97577	0.655000	0.94253	GAG	LGSN	-	NULL	ENSG00000146166		0.358	LGSN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LGSN	HGNC	protein_coding	OTTHUMT00000041076.2	-	0.00	35	0	C	NM_016571		63989979	-1	tier1	-	no_errors	ENST00000370657	ensembl	human	known	74_37	missense	20.00	16	4	SNP	1.000	G
LIN7C	55327	genome.wustl.edu	37	11	27523398	27523398	+	Missense_Mutation	SNP	T	T	C			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr11:27523398T>C	ENST00000278193.2	-	2	127	c.107A>G	c.(106-108)cAg>cGg	p.Q36R	LIN7C_ENST00000524596.1_Missense_Mutation_p.Q36R	NM_018362.3	NP_060832.1	Q9NUP9	LIN7C_HUMAN	lin-7 homolog C (C. elegans)	36	L27. {ECO:0000255|PROSITE- ProRule:PRU00365}.				exocytosis (GO:0006887)|morphogenesis of an epithelial sheet (GO:0002011)|neurotransmitter secretion (GO:0007269)|protein transport (GO:0015031)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|MPP7-DLG1-LIN7 complex (GO:0097025)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|tight junction (GO:0005923)	cytoskeletal protein binding (GO:0008092)|L27 domain binding (GO:0097016)|protein domain specific binding (GO:0019904)			endometrium(2)|lung(2)|upper_aerodigestive_tract(1)	5						TTGCAAAGCCTGAAGTTTCTG	0.338																																																	0													91.0	88.0	89.0					11																	27523398		2201	4297	6498	SO:0001583	missense	0			AK002077	CCDS7864.1	11p14	2008-07-18				ENSG00000148943			17789	protein-coding gene	gene with protein product	"""LIN-7 protein 3"""	612332				10341223	Standard	NM_018362		Approved	MALS-3, Lin7c, LIN-7C, LIN-7-C, VELI3, FLJ11215	uc001mrl.3	Q9NUP9		ENST00000278193.2:c.107A>G	11.37:g.27523398T>C	ENSP00000278193:p.Gln36Arg			Missense_Mutation	SNP	pfam_PDZ,pfam_L27_C,superfamily_PDZ,smart_L27,smart_PDZ,pirsf_Lin-7_homologue,pfscan_L27,pfscan_PDZ	p.Q36R	ENST00000278193.2	37	c.107	CCDS7864.1	11	.	.	.	.	.	.	.	.	.	.	T	19.39	3.817638	0.70912	.	.	ENSG00000148943	ENST00000278193;ENST00000524596	T;T	0.19938	2.29;2.11	5.69	5.69	0.88448	L27, C-terminal (1);L27 (2);	0.048881	0.85682	D	0.000000	T	0.16896	0.0406	L	0.34521	1.04	0.80722	D	1	P;P	0.37731	0.552;0.607	B;B	0.36335	0.211;0.222	T	0.05533	-1.0879	10	0.12430	T	0.62	.	16.2484	0.82467	0.0:0.0:0.0:1.0	.	36;36	G3V1D4;Q9NUP9	.;LIN7C_HUMAN	R	36	ENSP00000278193:Q36R;ENSP00000435353:Q36R	ENSP00000278193:Q36R	Q	-	2	0	LIN7C	27479974	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.997000	0.88414	2.291000	0.77112	0.533000	0.62120	CAG	LIN7C	-	pfam_L27_C,smart_L27,pirsf_Lin-7_homologue,pfscan_L27	ENSG00000148943		0.338	LIN7C-002	KNOWN	basic|appris_principal|CCDS	protein_coding	LIN7C	HGNC	protein_coding	OTTHUMT00000388311.2	-	0.00	65	0	T	NM_018362		27523398	-1	tier1	-	no_errors	ENST00000278193	ensembl	human	known	74_37	missense	6.25	60	4	SNP	1.000	C
LINC00937	389634	genome.wustl.edu	37	12	8542937	8542937	+	lincRNA	SNP	C	C	A			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr12:8542937C>A	ENST00000544461.1	-	0	1009									long intergenic non-protein coding RNA 937																		TGCCCGTCCTCGCAGTCCTGG	0.726																																																	0																																												0			BC073935		12p13.31	2013-05-30			ENSG00000226091	ENSG00000226091		"""Long non-coding RNAs"""	48629	non-coding RNA	RNA, long non-coding							Standard	NR_024420		Approved				OTTHUMG00000168663		12.37:g.8542937C>A				RNA	SNP	-	NULL	ENST00000544461.1	37	NULL		12																																																																																			LINC00937	-	-	ENSG00000226091		0.726	LINC00937-001	KNOWN	basic	lincRNA	LINC00937	HGNC	lincRNA	OTTHUMT00000400511.1	-	0.00	27	0	C			8542937	-1	tier1	-	no_errors	ENST00000420040	ensembl	human	known	74_37	rna	15.79	48	9	SNP	0.039	A
LOC100240735	100240735	genome.wustl.edu	37	9	44869983	44869983	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr9:44869983G>T	ENST00000377548.2	+	3	361	c.119G>T	c.(118-120)tGt>tTt	p.C40F	RP11-160N1.10_ENST00000448436.2_Missense_Mutation_p.C40F																							CTTCTGGGCTGTGTTGGGAGC	0.562																																																	0																																										SO:0001583	missense	0																														ENST00000377548.2:c.119G>T	9.37:g.44869983G>T	ENSP00000366771:p.Cys40Phe			Missense_Mutation	SNP	NULL	p.C40F	ENST00000377548.2	37	c.119		9	.	.	.	.	.	.	.	.	.	.	.	7.924	0.739294	0.15642	.	.	ENSG00000204814	ENST00000377548;ENST00000448436	.	.	.	1.65	1.65	0.23941	.	.	.	.	.	T	0.48502	0.1503	.	.	.	.	.	.	.	.	.	.	.	.	T	0.60203	-0.7309	4	0.87932	D	0	.	6.7997	0.23744	0.0:0.0:1.0:0.0	.	.	.	.	F	40	.	ENSP00000366771:C40F	C	+	2	0	RP11-160N1.10	44809979	0.008000	0.16893	0.413000	0.26509	0.060000	0.15804	0.448000	0.21726	1.224000	0.43551	0.194000	0.17425	TGT	RP11-160N1.10	-	NULL	ENSG00000204814		0.562	RP11-160N1.10-002	NOVEL	alternative_5_UTR|basic|appris_principal	protein_coding	LOC101928102	Clone_based_vega_gene	protein_coding	OTTHUMT00000192591.2	-	0.00	340	0	G			44869983	+1	tier1	-	no_errors	ENST00000448436	ensembl	human	putative	74_37	missense	8.36	252	23	SNP	0.546	T
LOC728715	728715	genome.wustl.edu	37	12	9720700	9720700	+	RNA	SNP	A	A	G	rs202077417		TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr12:9720700A>G	ENST00000520314.1	+	0	4943																											catattcagaagccaagaagt	0.443																																																	0																																												0																															12.37:g.9720700A>G				RNA	SNP	-	NULL	ENST00000520314.1	37	NULL		12																																																																																			RP11-726G1.1	-	-	ENSG00000214776		0.443	RP11-726G1.1-002	KNOWN	basic	processed_transcript	LOC728715	Clone_based_vega_gene	pseudogene	OTTHUMT00000381543.1		0.00	9	0	A			9720700	+1			no_errors	ENST00000520314	ensembl	human	known	74_37	rna	18.75	13	3	SNP	0.000	G
LRIG2	9860	genome.wustl.edu	37	1	113667283	113667283	+	3'UTR	DEL	T	T	-			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr1:113667283delT	ENST00000361127.5	+	0	3956				LRIG2_ENST00000492207.1_3'UTR	NM_014813.1	NP_055628.1	O94898	LRIG2_HUMAN	leucine-rich repeats and immunoglobulin-like domains 2						innervation (GO:0060384)|regulation of platelet-derived growth factor receptor signaling pathway (GO:0010640)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(2)|kidney(7)|large_intestine(3)|lung(10)|ovary(4)|prostate(2)|stomach(1)|urinary_tract(1)	31	Lung SC(450;0.246)	all_cancers(81;1.56e-05)|all_epithelial(167;2.62e-05)|all_lung(203;0.000665)|Lung NSC(69;0.000986)		Lung(183;0.0279)|Colorectal(144;0.0885)|COAD - Colon adenocarcinoma(174;0.134)|all cancers(265;0.139)|Epithelial(280;0.143)|LUSC - Lung squamous cell carcinoma(189;0.15)		TTCTTGTGAATTTTTTTTTTT	0.363																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AB018349	CCDS30808.1	1p13.1	2013-01-11			ENSG00000198799	ENSG00000198799		"""Immunoglobulin superfamily / I-set domain containing"""	20889	protein-coding gene	gene with protein product		608869					Standard	XM_005271369		Approved	KIAA0806	uc001edf.1	O94898	OTTHUMG00000012133	ENST00000361127.5:c.*560T>-	1.37:g.113667283delT			Q9NSN2	RNA	DEL	-	NULL	ENST00000361127.5	37	NULL	CCDS30808.1	1																																																																																			LRIG2	-	-	ENSG00000198799		0.363	LRIG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRIG2	HGNC	protein_coding	OTTHUMT00000033549.2		0.00	8	0	T	NM_014813		113667283	+1	tier1		no_errors	ENST00000466161	ensembl	human	known	74_37	rna	54.55	5	6	DEL	0.014	-
LOC730102	730102	genome.wustl.edu	37	1	178006918	178006918	+	RNA	SNP	G	G	A			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr1:178006918G>A	ENST00000476232.2	-	0	72					NR_037167.1																						AGTGCCGGCCGCTGCCCTGTC	0.687																																																	0																																												0																															1.37:g.178006918G>A				RNA	SNP	-	NULL	ENST00000476232.2	37	NULL		1																																																																																			RP11-568K15.1	-	-	ENSG00000242193		0.687	RP11-568K15.1-002	KNOWN	basic	processed_transcript	LOC730102	Clone_based_vega_gene	pseudogene	OTTHUMT00000337461.2	-	0.00	26	0	G			178006918	-1	tier1	-	no_errors	ENST00000476232	ensembl	human	known	74_37	rna	25.71	26	9	SNP	0.000	A
LRRC66	339977	genome.wustl.edu	37	4	52861261	52861261	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr4:52861261C>T	ENST00000343457.3	-	4	1933	c.1927G>A	c.(1927-1929)Gca>Aca	p.A643T		NM_001024611.1	NP_001019782.1	Q68CR7	LRC66_HUMAN	leucine rich repeat containing 66	643						integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(9)|kidney(1)|large_intestine(8)|lung(34)|ovary(1)|pancreas(1)|prostate(2)|skin(1)	58						TCAGCCCTTGCCCCGGACAGC	0.527																																																	0													71.0	70.0	70.0					4																	52861261		2008	4175	6183	SO:0001583	missense	0			BC040414	CCDS43229.1	4q12	2008-08-08			ENSG00000188993	ENSG00000188993			34299	protein-coding gene	gene with protein product							Standard	XM_005265739		Approved		uc003gzi.3	Q68CR7	OTTHUMG00000160623	ENST00000343457.3:c.1927G>A	4.37:g.52861261C>T	ENSP00000341944:p.Ala643Thr			Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.A643T	ENST00000343457.3	37	c.1927	CCDS43229.1	4	.	.	.	.	.	.	.	.	.	.	C	12.56	1.975852	0.34848	.	.	ENSG00000188993	ENST00000343457	T	0.32753	1.44	4.26	-0.513	0.11962	.	0.970350	0.08456	N	0.943152	T	0.16214	0.0390	L	0.27053	0.805	0.09310	N	1	B	0.30584	0.286	B	0.21546	0.035	T	0.23691	-1.0181	10	0.25751	T	0.34	0.6888	4.223	0.10567	0.1565:0.4721:0.0:0.3713	.	643	Q68CR7	LRC66_HUMAN	T	643	ENSP00000341944:A643T	ENSP00000341944:A643T	A	-	1	0	LRRC66	52556018	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-1.398000	0.02509	-0.040000	0.13580	0.491000	0.48974	GCA	LRRC66	-	NULL	ENSG00000188993		0.527	LRRC66-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC66	HGNC	protein_coding	OTTHUMT00000361473.1	-	0.00	42	0	C	NM_001024611		52861261	-1	tier1	-	no_errors	ENST00000343457	ensembl	human	known	74_37	missense	23.40	36	11	SNP	0.000	T
MAGEC3	139081	genome.wustl.edu	37	X	140985578	140985578	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chrX:140985578C>A	ENST00000298296.1	+	8	1892	c.1892C>A	c.(1891-1893)gCa>gAa	p.A631E	MAGEC3_ENST00000544766.1_3'UTR|MAGEC3_ENST00000443323.2_3'UTR|MAGEC3_ENST00000409007.1_3'UTR|MAGEC3_ENST00000536088.1_3'UTR	NM_138702.1	NP_619647.1	Q8TD91	MAGC3_HUMAN	melanoma antigen family C, 3	631	MAGE 2. {ECO:0000255|PROSITE- ProRule:PRU00127}.									NS(2)|breast(3)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(6)|liver(1)|lung(32)|ovary(1)|prostate(1)|skin(5)|stomach(1)|urinary_tract(2)	69	Acute lymphoblastic leukemia(192;6.56e-05)					ATGGCCAGTGCAAGCCCCAGT	0.507																																																	0													77.0	65.0	69.0					X																	140985578		2203	4300	6503	SO:0001583	missense	0			AF490508	CCDS14676.1, CCDS14677.1	Xq27.2	2009-03-25			ENSG00000165509	ENSG00000165509			23798	protein-coding gene	gene with protein product	"""cancer/testis antigen family 7, member 2"""	300469				10861452	Standard	NM_138702		Approved	HCA2, MAGE-C3, CT7.2	uc011mwp.2	Q8TD91	OTTHUMG00000022570	ENST00000298296.1:c.1892C>A	X.37:g.140985578C>A	ENSP00000298296:p.Ala631Glu		Q3SYA7|Q5JZ43|Q9BZ80	Missense_Mutation	SNP	pfam_MAGE,pfscan_MAGE	p.A631E	ENST00000298296.1	37	c.1892	CCDS14676.1	X	.	.	.	.	.	.	.	.	.	.	c	7.165	0.586508	0.13749	.	.	ENSG00000165509	ENST00000298296	T	0.03094	4.05	1.18	1.18	0.20946	.	.	.	.	.	T	0.02807	0.0084	L	0.28556	0.865	0.09310	N	1	B	0.26483	0.15	B	0.20767	0.031	T	0.44711	-0.9310	9	0.30854	T	0.27	.	5.2968	0.15756	0.0:1.0:0.0:0.0	.	631	Q8TD91	MAGC3_HUMAN	E	631	ENSP00000298296:A631E	ENSP00000298296:A631E	A	+	2	0	MAGEC3	140813244	0.000000	0.05858	0.021000	0.16686	0.153000	0.21895	0.456000	0.21859	0.860000	0.35481	0.179000	0.17066	GCA	MAGEC3	-	NULL	ENSG00000165509		0.507	MAGEC3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MAGEC3	HGNC	protein_coding	OTTHUMT00000058606.1	-	0.00	59	0	C	NM_138702		140985578	+1	tier1	-	no_errors	ENST00000298296	ensembl	human	known	74_37	missense	32.35	46	22	SNP	0.021	A
MAP3K9	4293	genome.wustl.edu	37	14	71209128	71209128	+	Missense_Mutation	SNP	C	C	A	rs111385383	byFrequency	TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr14:71209128C>A	ENST00000554752.2	-	6	1506	c.1507G>T	c.(1507-1509)Ggc>Tgc	p.G503C	MAP3K9_ENST00000554146.1_Missense_Mutation_p.G240C|MAP3K9_ENST00000555993.2_Missense_Mutation_p.G503C|MAP3K9_ENST00000381250.4_Missense_Mutation_p.G503C|MAP3K9_ENST00000553414.1_Missense_Mutation_p.G197C	NM_001284230.1	NP_001271159.1	P80192	M3K9_HUMAN	mitogen-activated protein kinase kinase kinase 9	503	Arg/Lys-rich (basic).				activation of JNKK activity (GO:0007256)|activation of JUN kinase activity (GO:0007257)|apoptotic process (GO:0006915)|positive regulation of apoptotic process (GO:0043065)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)		ATP binding (GO:0005524)|JUN kinase kinase kinase activity (GO:0004706)|MAP kinase kinase activity (GO:0004708)|protein homodimerization activity (GO:0042803)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(25)|ovary(2)|prostate(1)|skin(3)|stomach(2)	46				all cancers(60;0.00779)|BRCA - Breast invasive adenocarcinoma(234;0.00884)|OV - Ovarian serous cystadenocarcinoma(108;0.08)		CTGAACTTGCCCTTGCGTTTC	0.617																																					GBM(114;411 1587 13539 28235 50070)												0													97.0	85.0	89.0					14																	71209128		2203	4300	6503	SO:0001583	missense	0			AF251442	CCDS32112.1, CCDS61485.1, CCDS61488.1, CCDS73650.1	14q24.2	2012-10-02			ENSG00000006432	ENSG00000006432		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6861	protein-coding gene	gene with protein product		600136		MLK1			Standard	NM_001284231		Approved	PRKE1, MEKK9	uc001xml.3	P80192	OTTHUMG00000171249	ENST00000554752.2:c.1507G>T	14.37:g.71209128C>A	ENSP00000451612:p.Gly503Cys		A3KN85|Q0D2G7|Q6EH31|Q9H2N5	Missense_Mutation	SNP	pirsf_MAPKKK9/10/11,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_SH3_2,pfam_SH3_domain,superfamily_Kinase-like_dom,superfamily_SH3_domain,superfamily_Regulat_G_prot_signal_superfam,smart_SH3_domain,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_SH3_domain,pfscan_SH3_domain,pfscan_Prot_kinase_dom	p.G503C	ENST00000554752.2	37	c.1507		14	.	.	.	.	.	.	.	.	.	.	C	28.7	4.940747	0.92526	.	.	ENSG00000006432	ENST00000554752;ENST00000005198;ENST00000553414;ENST00000381250;ENST00000554146;ENST00000542284	T;T;T;T	0.12984	2.63;2.63;2.63;2.63	6.06	6.06	0.98353	Protein kinase-like domain (1);	0.000000	0.85682	D	0.000000	T	0.42381	0.1200	M	0.75085	2.285	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;0.999;1.0;1.0	T	0.11891	-1.0569	10	0.87932	D	0	.	20.6208	0.99490	0.0:1.0:0.0:0.0	.	240;503;503;197	G3V4P9;P80192;P80192-4;G3V347	.;M3K9_HUMAN;.;.	C	503;503;197;503;240;231	ENSP00000451612:G503C;ENSP00000451038:G197C;ENSP00000370649:G503C;ENSP00000451921:G240C	ENSP00000005198:G503C	G	-	1	0	MAP3K9	70278881	1.000000	0.71417	1.000000	0.80357	0.758000	0.43043	7.760000	0.85248	2.882000	0.98803	0.655000	0.94253	GGC	MAP3K9	-	pirsf_MAPKKK9/10/11,superfamily_Kinase-like_dom	ENSG00000006432		0.617	MAP3K9-001	KNOWN	basic	protein_coding	MAP3K9	HGNC	protein_coding	OTTHUMT00000412550.2	-	0.00	53	0	C			71209128	-1	tier1	-	no_errors	ENST00000555993	ensembl	human	known	74_37	missense	25.00	48	16	SNP	1.000	A
MAPK3	5595	genome.wustl.edu	37	16	30129094	30129094	+	Silent	SNP	C	C	T			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr16:30129094C>T	ENST00000263025.4	-	5	756	c.672G>A	c.(670-672)aaG>aaA	p.K224K	MAPK3_ENST00000395199.3_Silent_p.K224K|MAPK3_ENST00000322266.5_Silent_p.K224K|MAPK3_ENST00000484663.1_Silent_p.K110K|MAPK3_ENST00000395202.1_Silent_p.K224K|MAPK3_ENST00000403394.1_Silent_p.K224K|MAPK3_ENST00000395200.1_Silent_p.K156K|MAPK3_ENST00000494643.1_5'Flank	NM_002746.2	NP_002737.2	P27361	MK03_HUMAN	mitogen-activated protein kinase 3	224	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|BMP signaling pathway (GO:0030509)|cartilage development (GO:0051216)|caveolin-mediated endocytosis (GO:0072584)|cell cycle (GO:0007049)|cellular response to mechanical stimulus (GO:0071260)|cytokine-mediated signaling pathway (GO:0019221)|DNA damage induced protein phosphorylation (GO:0006975)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|interleukin-1-mediated signaling pathway (GO:0070498)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|MAPK cascade (GO:0000165)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apolipoprotein binding (GO:2000657)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ morphogenesis (GO:0009887)|peptidyl-tyrosine autophosphorylation (GO:0038083)|phosphorylation (GO:0016310)|platelet activation (GO:0030168)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of histone acetylation (GO:0035066)|positive regulation of histone phosphorylation (GO:0033129)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|Ras protein signal transduction (GO:0007265)|regulation of cytoskeleton organization (GO:0051493)|regulation of early endosome to late endosome transport (GO:2000641)|regulation of Golgi inheritance (GO:0090170)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|regulation of stress-activated MAPK cascade (GO:0032872)|response to epidermal growth factor (GO:0070849)|response to exogenous dsRNA (GO:0043330)|sensory perception of pain (GO:0019233)|small GTPase mediated signal transduction (GO:0007264)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|viral process (GO:0016032)	caveola (GO:0005901)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|late endosome (GO:0005770)|microtubule cytoskeleton (GO:0015630)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|pseudopodium (GO:0031143)	ATP binding (GO:0005524)|MAP kinase activity (GO:0004707)|phosphatase binding (GO:0019902)									Arsenic trioxide(DB01169)|Sulindac(DB00605)	TGTCGATGGACTTGGTATAGC	0.582																																																	0													90.0	88.0	88.0					16																	30129094		2197	4300	6497	SO:0001819	synonymous_variant	0			M84490	CCDS10672.1, CCDS42148.1, CCDS42149.1	16p11.2	2011-06-10			ENSG00000102882	ENSG00000102882	2.7.11.1	"""Mitogen-activated protein kinase cascade / Kinases"""	6877	protein-coding gene	gene with protein product		601795		PRKM3		9628824	Standard	NM_001109891		Approved	ERK1, p44mapk, p44erk1	uc002dws.3	P27361	OTTHUMG00000132149	ENST00000263025.4:c.672G>A	16.37:g.30129094C>T			A8CZ58|B0LPG3|Q8NHX1	Silent	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,prints_MAPK_ERK1/2,prints_MAPK_ERK3/4	p.K224	ENST00000263025.4	37	c.672	CCDS10672.1	16	.	.	.	.	.	.	.	.	.	.	C	9.780	1.174979	0.21704	.	.	ENSG00000102882	ENST00000495629	.	.	.	5.97	2.65	0.31530	.	.	.	.	.	T	0.55625	0.1932	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.49579	-0.8925	4	.	.	.	-8.6552	7.3197	0.26521	0.0:0.591:0.0:0.409	.	.	.	.	N	185	.	.	S	-	2	0	MAPK3	30036595	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.032000	0.30178	0.848000	0.35191	0.655000	0.94253	AGT	MAPK3	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,prints_MAPK_ERK3/4	ENSG00000102882		0.582	MAPK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAPK3	HGNC	protein_coding	OTTHUMT00000255196.2	-	0.00	40	0	C			30129094	-1	tier1	-	no_errors	ENST00000263025	ensembl	human	known	74_37	silent	23.53	26	8	SNP	1.000	T
MASP2	10747	genome.wustl.edu	37	1	11105562	11105562	+	Silent	SNP	C	C	T			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr1:11105562C>T	ENST00000400897.3	-	4	462	c.447G>A	c.(445-447)gcG>gcA	p.A149A	MASP2_ENST00000400898.3_Silent_p.A149A	NM_006610.3	NP_006601.2	O00187	MASP2_HUMAN	mannan-binding lectin serine peptidase 2	149	EGF-like; calcium-binding.				complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|complement activation, lectin pathway (GO:0001867)|innate immune response (GO:0045087)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|calcium-dependent protein binding (GO:0048306)|complement component C4b binding (GO:0001855)|peptidase activity (GO:0008233)|serine-type endopeptidase activity (GO:0004252)			biliary_tract(1)|endometrium(2)|large_intestine(6)|lung(5)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	23	Ovarian(185;0.249)	Lung NSC(185;1.04e-05)|all_lung(284;1.31e-05)|Renal(390;0.000147)|Colorectal(325;0.00205)|Breast(348;0.00262)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)	STAD - Stomach adenocarcinoma(5;0.071)	UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.12e-07)|COAD - Colon adenocarcinoma(227;7.07e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|Kidney(185;0.000722)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|READ - Rectum adenocarcinoma(331;0.0487)|STAD - Stomach adenocarcinoma(313;0.192)		CGCAGGTGGGCGCCTCTCCCG	0.672																																					GBM(35;611 746 20780 22741 36496)												0													35.0	36.0	36.0					1																	11105562		2202	4300	6502	SO:0001819	synonymous_variant	0			X98400	CCDS123.1, CCDS124.1	1p36.3-p36.2	2014-09-17	2005-08-17		ENSG00000009724	ENSG00000009724			6902	protein-coding gene	gene with protein product		605102	"""mannan-binding lectin serine protease 2"", ""mannan-binding lectin serine peptidase 1 pseudogene 1"", ""mannan-binding lectin serine protease 1 pseudogene 1"""	MASP1P1		9087411, 9777418	Standard	NM_006610		Approved		uc001aru.3	O00187	OTTHUMG00000002121	ENST00000400897.3:c.447G>A	1.37:g.11105562C>T			A8K458|A8MWJ2|O75754|Q5TEQ5|Q5TER0|Q96QG4|Q9BZH0|Q9H498|Q9H499|Q9UBP3|Q9UC48|Q9ULC7|Q9UMV3|Q9Y270	Silent	SNP	pfam_Peptidase_S1,pfam_CUB_dom,pfam_Sushi_SCR_CCP,pfam_EGF-like_Ca-bd_dom,superfamily_Trypsin-like_Pept_dom,superfamily_CUB_dom,superfamily_Sushi_SCR_CCP,smart_CUB_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,smart_Sushi_SCR_CCP,smart_Peptidase_S1,pfscan_CUB_dom,pfscan_Sushi_SCR_CCP,pfscan_Peptidase_S1,prints_Peptidase_S1A	p.A149	ENST00000400897.3	37	c.447	CCDS123.1	1																																																																																			MASP2	-	pfam_EGF-like_Ca-bd_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom	ENSG00000009724		0.672	MASP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MASP2	HGNC	protein_coding	OTTHUMT00000006072.1	-	0.00	140	0	C	NM_006610		11105562	-1	tier1	-	no_errors	ENST00000400897	ensembl	human	known	74_37	silent	20.00	112	28	SNP	0.069	T
MCC	4163	genome.wustl.edu	37	5	112362988	112362988	+	3'UTR	SNP	G	G	T	rs374300739	byFrequency	TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr5:112362988G>T	ENST00000302475.4	-	0	3064				MCC_ENST00000515367.2_3'UTR|MCC_ENST00000514701.3_5'UTR	NM_002387.2	NP_002378	P23508	CRCM_HUMAN	mutated in colorectal cancers						negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of epithelial cell proliferation (GO:0050680)|signal transduction (GO:0007165)|Wnt signaling pathway (GO:0016055)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			endometrium(4)|kidney(3)|large_intestine(15)|liver(2)|lung(8)|ovary(2)|pancreas(1)|prostate(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	42		all_cancers(142;5.89e-08)|all_epithelial(76;3.57e-11)|all_lung(232;0.000605)|Lung NSC(810;0.000697)|Colorectal(10;0.00146)|Prostate(80;0.00174)|Ovarian(225;0.0175)|Breast(839;0.198)		OV - Ovarian serous cystadenocarcinoma(64;2.04e-54)|Epithelial(69;9.69e-49)|all cancers(49;6.25e-44)|COAD - Colon adenocarcinoma(37;0.0432)|Colorectal(14;0.0766)		ACTCCGGTGCGTGAGTGCTGA	0.542																																																	0													166.0	148.0	154.0					5																	112362988		2202	4300	6502	SO:0001624	3_prime_UTR_variant	0				CCDS4111.1, CCDS43351.1	5q21-q22	2013-01-10			ENSG00000171444	ENSG00000171444		"""EF-hand domain containing"""	6935	protein-coding gene	gene with protein product		159350				1848370	Standard	NM_002387		Approved		uc003kql.4	P23508	OTTHUMG00000128804	ENST00000302475.4:c.*11C>A	5.37:g.112362988G>T			D3DT05|Q6ZR04	RNA	SNP	-	NULL	ENST00000302475.4	37	NULL	CCDS4111.1	5																																																																																			MCC	-	-	ENSG00000171444		0.542	MCC-001	KNOWN	basic|CCDS	protein_coding	MCC	HGNC	protein_coding	OTTHUMT00000250736.3	-	0.00	83	0	G	NM_001085377		112362988	-1	tier1	-	no_errors	ENST00000514701	ensembl	human	known	74_37	rna	5.00	76	4	SNP	0.011	T
MDN1	23195	genome.wustl.edu	37	6	90459388	90459388	+	Silent	SNP	C	C	T			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr6:90459388C>T	ENST00000369393.3	-	25	3604	c.3489G>A	c.(3487-3489)gcG>gcA	p.A1163A	MDN1_ENST00000428876.1_Silent_p.A1163A			Q9NU22	MDN1_HUMAN	MDN1, midasin homolog (yeast)	1163					ATP catabolic process (GO:0006200)|protein complex assembly (GO:0006461)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|unfolded protein binding (GO:0051082)			NS(1)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(22)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(52)|liver(1)|lung(83)|ovary(10)|pancreas(1)|prostate(10)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	218		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)		GCCTATTCAGCGCCTCTAACA	0.398																																																	0													121.0	122.0	122.0					6																	90459388		2203	4300	6503	SO:0001819	synonymous_variant	0			AF503925	CCDS5024.1	6q15	2014-01-28			ENSG00000112159	ENSG00000112159			18302	protein-coding gene	gene with protein product						9205841, 12102729	Standard	XM_005248699		Approved	KIAA0301	uc003pnn.1	Q9NU22	OTTHUMG00000015213	ENST00000369393.3:c.3489G>A	6.37:g.90459388C>T			O15019|Q5T794	Silent	SNP	pfam_ATPase_dyneun-rel_AAA,pfam_ATPase_AAA-3,superfamily_P-loop_NTPase,superfamily_ARM-type_fold,smart_AAA+_ATPase,smart_VWF_A,pirsf_Midasin,pfscan_VWF_A	p.A1163	ENST00000369393.3	37	c.3489	CCDS5024.1	6																																																																																			MDN1	-	pfam_ATPase_dyneun-rel_AAA,pfam_ATPase_AAA-3,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pirsf_Midasin	ENSG00000112159		0.398	MDN1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	MDN1	HGNC	protein_coding	OTTHUMT00000041514.2	-	0.00	38	0	C			90459388	-1	tier1	-	no_errors	ENST00000369393	ensembl	human	known	74_37	silent	38.89	11	7	SNP	0.953	T
MFSD8	256471	genome.wustl.edu	37	4	128864988	128864988	+	Missense_Mutation	SNP	G	G	T	rs144845312		TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr4:128864988G>T	ENST00000296468.3	-	5	485	c.358C>A	c.(358-360)Ctc>Atc	p.L120I	MFSD8_ENST00000541133.1_Missense_Mutation_p.L75I|MFSD8_ENST00000515130.1_5'UTR|MFSD8_ENST00000513559.1_Missense_Mutation_p.L75I	NM_152778.2	NP_689991.1	Q8NHS3	MFSD8_HUMAN	major facilitator superfamily domain containing 8	120					cell death (GO:0008219)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal membrane (GO:0005765)|nucleus (GO:0005634)		p.L120F(1)		cervix(2)|endometrium(1)|large_intestine(4)|liver(1)|lung(11)|ovary(1)|prostate(2)|skin(1)	23						TATGCATAGAGGCAGTTGGCT	0.413																																																	1	Substitution - Missense(1)	skin(1)											107.0	103.0	104.0					4																	128864988		2203	4300	6503	SO:0001583	missense	0			AK074564	CCDS3736.1	4q28.2	2014-09-17			ENSG00000164073	ENSG00000164073			28486	protein-coding gene	gene with protein product		611124	"""ceroid-lipofuscinosis, neuronal 7, late infantile, variant"""	CLN7		17564970	Standard	NM_152778		Approved	MGC33302	uc003ifp.3	Q8NHS3	OTTHUMG00000133303	ENST00000296468.3:c.358C>A	4.37:g.128864988G>T	ENSP00000296468:p.Leu120Ile		B2RDM1|B7Z205|Q8N2P3	Missense_Mutation	SNP	pfam_MFS,pfam_Sub_transporter,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.L120I	ENST00000296468.3	37	c.358	CCDS3736.1	4	.	.	.	.	.	.	.	.	.	.	G	11.49	1.654316	0.29425	.	.	ENSG00000164073	ENST00000296468;ENST00000513559;ENST00000541133	T;T;T	0.61510	0.1;0.1;0.1	5.16	4.31	0.51392	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.132695	0.52532	D	0.000072	T	0.60353	0.2262	L	0.33137	0.985	0.33676	D	0.611498	P;D;D	0.57899	0.776;0.981;0.962	P;P;P	0.60117	0.536;0.869;0.78	T	0.65660	-0.6114	10	0.20519	T	0.43	-10.3949	14.0775	0.64900	0.0736:0.0:0.9264:0.0	.	75;120;120	B7Z2B2;B7Z280;Q8NHS3	.;.;MFSD8_HUMAN	I	120;75;75	ENSP00000296468:L120I;ENSP00000425000:L75I;ENSP00000439616:L75I	ENSP00000296468:L120I	L	-	1	0	MFSD8	129084438	1.000000	0.71417	0.996000	0.52242	0.513000	0.34164	5.261000	0.65496	1.150000	0.42419	0.551000	0.68910	CTC	MFSD8	-	pfam_MFS,pfam_Sub_transporter,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	ENSG00000164073		0.413	MFSD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MFSD8	HGNC	protein_coding	OTTHUMT00000257097.1		0.00	36	0	G	NM_152778		128864988	-1			no_errors	ENST00000296468	ensembl	human	known	74_37	missense	5.41	35	2	SNP	1.000	T
MGAM	8972	genome.wustl.edu	37	7	141740561	141740561	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr7:141740561G>C	ENST00000549489.2	+	21	2508	c.2413G>C	c.(2413-2415)Gaa>Caa	p.E805Q	MGAM_ENST00000475668.2_Missense_Mutation_p.E805Q	NM_004668.2	NP_004659.2	O43451	MGA_HUMAN	maltase-glucoamylase (alpha-glucosidase)	805	Maltase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)			cervix(1)|endometrium(1)|large_intestine(4)|lung(3)|ovary(2)|skin(2)	13	Melanoma(164;0.0272)				Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	AGTCGAGATGGAACTTCCTGG	0.478																																																	0													117.0	118.0	118.0					7																	141740561		1991	4176	6167	SO:0001583	missense	0			AF016833	CCDS47727.1	7q34	2012-10-03			ENSG00000257335	ENSG00000257335			7043	protein-coding gene	gene with protein product		154360				9446624	Standard	NM_004668		Approved	MGA	uc003vwy.3	O43451	OTTHUMG00000158395	ENST00000549489.2:c.2413G>C	7.37:g.141740561G>C	ENSP00000447378:p.Glu805Gln		Q0VAX6|Q75ME7|Q86UM5	Missense_Mutation	SNP	pfam_Glyco_hydro_31,pfam_P_trefoil,superfamily_Glycoside_hydrolase_SF,superfamily_Gal_mutarotase_SF_dom,smart_P_trefoil	p.E805Q	ENST00000549489.2	37	c.2413	CCDS47727.1	7	.	.	.	.	.	.	.	.	.	.	G	11.10	1.539463	0.27563	.	.	ENSG00000257335	ENST00000549489;ENST00000475668;ENST00000548812	D	0.91894	-2.93	5.48	-5.59	0.02505	.	1.588820	0.03756	N	0.257366	T	0.80954	0.4723	N	0.13003	0.285	0.09310	N	0.999999	B	0.06786	0.001	B	0.06405	0.002	T	0.70781	-0.4779	10	0.11794	T	0.64	.	7.0987	0.25325	0.0676:0.4878:0.1345:0.3101	.	805	O43451	MGA_HUMAN	Q	805;805;682	ENSP00000447378:E805Q	ENSP00000316431:E682Q	E	+	1	0	MGAM	141387030	0.367000	0.25023	0.177000	0.23020	0.970000	0.65996	0.044000	0.13992	-0.566000	0.06054	0.650000	0.86243	GAA	MGAM	-	pfam_Glyco_hydro_31	ENSG00000257335		0.478	MGAM-001	KNOWN	basic|CCDS	protein_coding	MGAM	HGNC	protein_coding	OTTHUMT00000351244.3	-	0.00	58	0	G			141740561	+1	tier1	-	no_errors	ENST00000549489	ensembl	human	known	74_37	missense	20.00	52	13	SNP	0.001	C
SHANK2	22941	genome.wustl.edu	37	11	70718410	70718411	+	Intron	INS	-	-	A			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr11:70718410_70718411insA	ENST00000338508.4	-	17	1177				MIR3664_ENST00000579074.1_RNA			Q9UPX8	SHAN2_HUMAN	SH3 and multiple ankyrin repeat domains 2						adult behavior (GO:0030534)|learning (GO:0007612)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|vocalization behavior (GO:0071625)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|cell junction (GO:0030054)|ciliary membrane (GO:0060170)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|growth cone (GO:0030426)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	GKAP/Homer scaffold activity (GO:0030160)|ionotropic glutamate receptor binding (GO:0035255)			NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(30)|ovary(3)|pancreas(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	62			LUSC - Lung squamous cell carcinoma(11;4.72e-09)|STAD - Stomach adenocarcinoma(18;0.071)			gTCTTTACTCCTGAGAGCTCGT	0.47																																																	0																																										SO:0001627	intron_variant	0			AF141901		11q13.2	2013-01-10			ENSG00000162105	ENSG00000162105		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	14295	protein-coding gene	gene with protein product		603290	"""cortactin binding protein 1"""	CORTBP1		10506216	Standard	XM_005277930		Approved	CTTNBP1, ProSAP1, SHANK, SPANK-3	uc001oqc.3	Q9UPX8	OTTHUMG00000154615	ENST00000338508.4:c.1177+24194->T	11.37:g.70718410_70718411insA			C0SPG8|C0SPG9|Q3Y8G9|Q52LK2|Q9UKP1	RNA	INS	-	NULL	ENST00000338508.4	37	NULL		11																																																																																			MIR3664	-	-	ENSG00000263744		0.470	SHANK2-201	KNOWN	basic|appris_principal	protein_coding	MIR3664	HGNC	protein_coding			0.00	53	0	-	NM_012309		70718411	-1	tier1		no_errors	ENST00000579074	ensembl	human	known	74_37	rna	43.94	37	29	INS	0.000:0.000	A
SHANK2	22941	genome.wustl.edu	37	11	70718415	70718415	+	Intron	SNP	A	A	G			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr11:70718415A>G	ENST00000338508.4	-	17	1177				MIR3664_ENST00000579074.1_RNA			Q9UPX8	SHAN2_HUMAN	SH3 and multiple ankyrin repeat domains 2						adult behavior (GO:0030534)|learning (GO:0007612)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|vocalization behavior (GO:0071625)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|cell junction (GO:0030054)|ciliary membrane (GO:0060170)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|growth cone (GO:0030426)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	GKAP/Homer scaffold activity (GO:0030160)|ionotropic glutamate receptor binding (GO:0035255)			NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(30)|ovary(3)|pancreas(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	62			LUSC - Lung squamous cell carcinoma(11;4.72e-09)|STAD - Stomach adenocarcinoma(18;0.071)			TACTCCTGAGAGCTCGTGTTG	0.483																																																	0																																										SO:0001627	intron_variant	0			AF141901		11q13.2	2013-01-10			ENSG00000162105	ENSG00000162105		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	14295	protein-coding gene	gene with protein product		603290	"""cortactin binding protein 1"""	CORTBP1		10506216	Standard	XM_005277930		Approved	CTTNBP1, ProSAP1, SHANK, SPANK-3	uc001oqc.3	Q9UPX8	OTTHUMG00000154615	ENST00000338508.4:c.1177+24190T>C	11.37:g.70718415A>G			C0SPG8|C0SPG9|Q3Y8G9|Q52LK2|Q9UKP1	RNA	SNP	-	NULL	ENST00000338508.4	37	NULL		11																																																																																			MIR3664	-	-	ENSG00000263744		0.483	SHANK2-201	KNOWN	basic|appris_principal	protein_coding	MIR3664	HGNC	protein_coding		-	0.00	47	0	A	NM_012309		70718415	-1	tier1	-	no_errors	ENST00000579074	ensembl	human	known	74_37	rna	46.43	30	26	SNP	0.001	G
C3orf52	79669	genome.wustl.edu	37	3	111831723	111831724	+	Intron	INS	-	-	AAA	rs550597963|rs76778672	byFrequency	TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr3:111831723_111831724insAAA	ENST00000264848.5	+	5	526				MIR567_ENST00000385205.1_RNA|C3orf52_ENST00000431717.2_Intron|C3orf52_ENST00000430855.1_Intron|C3orf52_ENST00000467942.2_Intron	NM_024616.2	NP_078892	Q5BVD1	TTMP_HUMAN	chromosome 3 open reading frame 52							endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(1)|lung(1)|urinary_tract(1)	4						CATGCAAAACTAAAAAAAAAAA	0.327																																																	0																																										SO:0001627	intron_variant	0			AY830714	CCDS46887.1, CCDS54620.1	3q13.2	2006-01-30			ENSG00000114529	ENSG00000114529			26255	protein-coding gene	gene with protein product	"""TPA induced trans-membrane protein"""	611956				15737651	Standard	NM_024616		Approved	FLJ23186, TTMP	uc011bhs.2	Q5BVD1	OTTHUMG00000159230	ENST00000264848.5:c.468-87->AAA	3.37:g.111831730_111831732dupAAA			B4DNV2|B4E0Z2|Q96AJ4|Q9H5Q1	RNA	INS	-	NULL	ENST00000264848.5	37	NULL	CCDS46887.1	3																																																																																			MIR567	-	-	ENSG00000207940		0.327	C3orf52-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MIR567	HGNC	protein_coding	OTTHUMT00000353961.1		0.00	40	0	-	NM_024616		111831724	+1	tier1		no_errors	ENST00000385205	ensembl	human	known	74_37	rna	11.11	32	4	INS	0.000:0.000	AAA
MAP2K4	6416	genome.wustl.edu	37	17	11985228	11985228	+	Intron	SNP	C	C	T			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr17:11985228C>T	ENST00000353533.5	+	3	456				MAP2K4_ENST00000581941.1_Intron|MAP2K4_ENST00000415385.3_Intron|MIR744_ENST00000578242.1_RNA	NM_003010.2	NP_003001.1	P45985	MP2K4_HUMAN	mitogen-activated protein kinase kinase 4						apoptotic process (GO:0006915)|cellular response to mechanical stimulus (GO:0071260)|cellular response to sorbitol (GO:0072709)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|JNK cascade (GO:0007254)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|positive regulation of DNA replication (GO:0045740)|positive regulation of neuron apoptotic process (GO:0043525)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|dendrite cytoplasm (GO:0032839)|nucleus (GO:0005634)|perikaryon (GO:0043204)	ATP binding (GO:0005524)|JUN kinase kinase activity (GO:0008545)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)	p.0?(10)|p.?(1)		NS(1)|biliary_tract(2)|breast(22)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(26)|lung(15)|ovary(8)|pancreas(11)|skin(3)|stomach(2)|testis(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	100		all_cancers(5;0.0413)|Breast(5;0.000625)|all_epithelial(5;0.00978)|all_lung(20;0.0449)|Lung NSC(33;0.163)		Epithelial(2;4.12e-09)|all cancers(2;6.86e-07)|BRCA - Breast invasive adenocarcinoma(2;8.74e-07)|Colorectal(4;5.32e-05)|COAD - Colon adenocarcinoma(4;0.0039)|READ - Rectum adenocarcinoma(10;0.0681)		GGGCAAGGTGCGGGGCTAGGG	0.617			"""D, Mis, N"""		"""pancreatic, breast, colorectal"""																																			Rec	yes		17	17p11.2	6416	mitogen-activated protein kinase kinase 4		E	11	Whole gene deletion(10)|Unknown(1)	ovary(4)|breast(4)|biliary_tract(1)|large_intestine(1)|pancreas(1)											77.0	80.0	79.0					17																	11985228		1568	3581	5149	SO:0001627	intron_variant	0			L36870	CCDS11162.1, CCDS62095.1	17p12	2012-03-23			ENSG00000065559	ENSG00000065559	2.7.12.2	"""Mitogen-activated protein kinase cascade / Kinase kinases"""	6844	protein-coding gene	gene with protein product		601335		SERK1		7716521	Standard	NM_003010		Approved	MEK4, JNKK1, PRKMK4, MKK4	uc002gnj.3	P45985		ENST00000353533.5:c.393+381C>T	17.37:g.11985228C>T			B2R7N7|B3KYB2|D3DTS5|Q5U0B8|Q6FHX4|Q6P9H2|Q6PIE6	RNA	SNP	-	NULL	ENST00000353533.5	37	NULL	CCDS11162.1	17																																																																																			MIR744	-	-	ENSG00000266297		0.617	MAP2K4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MIR744	HGNC	protein_coding	OTTHUMT00000441226.1	-	0.00	40	0	C			11985228	+1	tier1	-	no_errors	ENST00000578242	ensembl	human	known	74_37	rna	14.58	41	7	SNP	1.000	T
MNDA	4332	genome.wustl.edu	37	1	158815756	158815756	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr1:158815756C>A	ENST00000368141.4	+	5	1211	c.950C>A	c.(949-951)tCt>tAt	p.S317Y		NM_002432.1	NP_002423.1	P41218	MNDA_HUMAN	myeloid cell nuclear differentiation antigen	317	HIN-200. {ECO:0000255|PROSITE- ProRule:PRU00106}.				B cell receptor signaling pathway (GO:0050853)|cellular defense response (GO:0006968)|cellular response to DNA damage stimulus (GO:0006974)|negative regulation of B cell proliferation (GO:0030889)|positive regulation of apoptotic process (GO:0043065)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(2)|breast(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|liver(1)|lung(26)|ovary(2)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	65	all_hematologic(112;0.0378)					AAGCAAGCATCTGGAACAATG	0.323																																																	0													71.0	75.0	74.0					1																	158815756		2203	4300	6503	SO:0001583	missense	0			BC032319	CCDS1177.1	1q22	2008-02-05			ENSG00000163563	ENSG00000163563			7183	protein-coding gene	gene with protein product		159553				1644857, 7512843	Standard	NM_002432		Approved	PYHIN3	uc001fsz.1	P41218	OTTHUMG00000022776	ENST00000368141.4:c.950C>A	1.37:g.158815756C>A	ENSP00000357123:p.Ser317Tyr			Missense_Mutation	SNP	pfam_HIN200/IF120x,pfam_DAPIN,pfscan_DAPIN,pfscan_HIN200/IF120x	p.S317Y	ENST00000368141.4	37	c.950	CCDS1177.1	1	.	.	.	.	.	.	.	.	.	.	C	16.22	3.060310	0.55432	.	.	ENSG00000163563	ENST00000368141	T	0.16196	2.36	4.28	2.24	0.28232	HIN-200/IF120x (2);Nucleic acid-binding, OB-fold (1);	0.504521	0.14974	N	0.287653	T	0.19644	0.0472	M	0.68593	2.085	0.09310	N	1	D	0.89917	1.0	D	0.79784	0.993	T	0.03750	-1.1007	10	0.62326	D	0.03	-0.321	4.689	0.12771	0.2143:0.6738:0.0:0.1119	.	317	P41218	MNDA_HUMAN	Y	317	ENSP00000357123:S317Y	ENSP00000357123:S317Y	S	+	2	0	MNDA	157082380	0.000000	0.05858	0.017000	0.16124	0.607000	0.37147	-0.310000	0.08135	1.132000	0.42129	0.655000	0.94253	TCT	MNDA	-	pfam_HIN200/IF120x,pfscan_HIN200/IF120x	ENSG00000163563		0.323	MNDA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MNDA	HGNC	protein_coding	OTTHUMT00000059069.1	-	0.00	74	0	C	NM_002432		158815756	+1	tier1	-	no_errors	ENST00000368141	ensembl	human	known	74_37	missense	26.85	78	29	SNP	0.002	A
MTMR4	9110	genome.wustl.edu	37	17	56569953	56569953	+	Missense_Mutation	SNP	C	C	T	rs369998064		TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr17:56569953C>T	ENST00000323456.5	-	18	3453	c.3329G>A	c.(3328-3330)cGc>cAc	p.R1110H	MTMR4_ENST00000579925.1_Missense_Mutation_p.R1053H	NM_004687.4	NP_004678.3	Q9NYA4	MTMR4_HUMAN	myotubularin related protein 4	1110					negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|protein dephosphorylation (GO:0006470)|response to denervation involved in regulation of muscle adaptation (GO:0014894)|small molecule metabolic process (GO:0044281)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytosol (GO:0005829)|early endosome membrane (GO:0031901)|extracellular space (GO:0005615)	metal ion binding (GO:0046872)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)			breast(10)|endometrium(2)|kidney(2)|large_intestine(5)|lung(12)|skin(5)	36	Medulloblastoma(34;0.127)|all_neural(34;0.237)					TGGAACCCAGCGAGTCACCTA	0.448																																																	0								C	HIS/ARG	0,4406		0,0,2203	157.0	150.0	152.0		3329	5.8	1.0	17		152	1,8599	1.2+/-3.3	0,1,4299	no	missense	MTMR4	NM_004687.4	29	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	1110/1196	56569953	1,13005	2203	4300	6503	SO:0001583	missense	0			AB014547	CCDS11608.1	17q22-q23	2011-06-09				ENSG00000108389		"""Zinc fingers, FYVE domain containing"", ""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	7452	protein-coding gene	gene with protein product		603559				9736772	Standard	NM_004687		Approved	KIAA0647, ZFYVE11	uc002iwj.2	Q9NYA4		ENST00000323456.5:c.3329G>A	17.37:g.56569953C>T	ENSP00000325285:p.Arg1110His		D3DTZ6|Q8IV27|Q9Y4D5	Missense_Mutation	SNP	pfam_Myotubularin-like_Pase_dom,pfam_Znf_FYVE,superfamily_Znf_FYVE_PHD,smart_Znf_FYVE,pfscan_Znf_FYVE-rel,pfscan_Tyr/Dual-sp_Pase	p.R1110H	ENST00000323456.5	37	c.3329	CCDS11608.1	17	.	.	.	.	.	.	.	.	.	.	C	34	5.336233	0.95758	0.0	1.16E-4	ENSG00000108389	ENST00000323456	T	0.72394	-0.65	5.82	5.82	0.92795	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, FYVE-type (2);	0.000000	0.85682	D	0.000000	T	0.77651	0.4162	N	0.25485	0.75	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.78858	-0.2038	10	0.59425	D	0.04	.	19.0936	0.93240	0.0:1.0:0.0:0.0	.	1110	Q9NYA4	MTMR4_HUMAN	H	1110	ENSP00000325285:R1110H	ENSP00000325285:R1110H	R	-	2	0	MTMR4	53924952	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.487000	0.81328	2.757000	0.94681	0.655000	0.94253	CGC	MTMR4	-	pfam_Znf_FYVE,smart_Znf_FYVE	ENSG00000108389		0.448	MTMR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTMR4	HGNC	protein_coding	OTTHUMT00000444721.1	-	0.00	42	0	C	NM_004687		56569953	-1	tier1	-	no_errors	ENST00000323456	ensembl	human	known	74_37	missense	27.45	37	14	SNP	1.000	T
MUC16	94025	genome.wustl.edu	37	19	9073177	9073177	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr19:9073177G>A	ENST00000397910.4	-	3	14472	c.14269C>T	c.(14269-14271)Cct>Tct	p.P4757S		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	4759	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						ACAGAAGAAGGTAAGGTTGTG	0.483																																																	0													112.0	107.0	108.0					19																	9073177		2091	4212	6303	SO:0001583	missense	0			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.14269C>T	19.37:g.9073177G>A	ENSP00000381008:p.Pro4757Ser		Q6ZQW5|Q96RK2	Missense_Mutation	SNP	pfam_SEA_dom,smart_SEA_dom,pfscan_SEA_dom	p.P4757S	ENST00000397910.4	37	c.14269	CCDS54212.1	19	.	.	.	.	.	.	.	.	.	.	g	1.998	-0.430250	0.04701	.	.	ENSG00000181143	ENST00000397910	T	0.24723	1.84	1.48	-2.91	0.05631	.	.	.	.	.	T	0.13713	0.0332	L	0.29908	0.895	.	.	.	B	0.20459	0.045	B	0.12837	0.008	T	0.31916	-0.9926	8	0.87932	D	0	.	0.522	0.00613	0.1842:0.2434:0.3264:0.246	.	4757	B5ME49	.	S	4757	ENSP00000381008:P4757S	ENSP00000381008:P4757S	P	-	1	0	MUC16	8934177	0.000000	0.05858	0.000000	0.03702	0.029000	0.11900	-0.323000	0.07997	-0.733000	0.04850	-0.828000	0.03084	CCT	MUC16	-	NULL	ENSG00000181143		0.483	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	HGNC	protein_coding	OTTHUMT00000402806.1	-	0.00	90	0	G	NM_024690		9073177	-1	tier1	-	no_errors	ENST00000397910	ensembl	human	known	74_37	missense	25.00	63	21	SNP	0.001	A
MYADM	91663	genome.wustl.edu	37	19	54377333	54377333	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr19:54377333G>T	ENST00000391769.2	+	3	830	c.550G>T	c.(550-552)Gcc>Tcc	p.A184S	MYADM_ENST00000391770.4_Missense_Mutation_p.A184S|MYADM_ENST00000391771.1_Missense_Mutation_p.A184S|AC008440.5_ENST00000413496.2_RNA|MYADM_ENST00000336967.3_Missense_Mutation_p.A184S|MYADM_ENST00000391768.2_Missense_Mutation_p.A184S	NM_001020821.1	NP_001018657.1	Q96S97	MYADM_HUMAN	myeloid-associated differentiation marker	184	MARVEL 2. {ECO:0000255|PROSITE- ProRule:PRU00581}.				establishment of endothelial barrier (GO:0061028)|membrane raft organization (GO:0031579)|negative regulation of actin filament polymerization (GO:0030837)|negative regulation of gene expression (GO:0010629)|negative regulation of heterotypic cell-cell adhesion (GO:0034115)|negative regulation of protein kinase C signaling (GO:0090038)|negative regulation of protein phosphorylation (GO:0001933)|positive regulation of cell migration (GO:0030335)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|protein targeting to plasma membrane (GO:0072661)	cell-cell junction (GO:0005911)|cortical actin cytoskeleton (GO:0030864)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|ruffle (GO:0001726)				central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	12	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.0488)		GACCTTCGTTGCCTGCATCAT	0.642																																																	0													144.0	120.0	128.0					19																	54377333		2203	4300	6503	SO:0001583	missense	0			AF087882	CCDS12866.1	19q13.33-q13.4	2004-07-23			ENSG00000179820	ENSG00000179820			7544	protein-coding gene	gene with protein product		609959				10733104, 12075932	Standard	NM_001020818		Approved		uc002qcl.3	Q96S97	OTTHUMG00000060775	ENST00000391769.2:c.550G>T	19.37:g.54377333G>T	ENSP00000375649:p.Ala184Ser		B2RE58|Q542Z1|Q7Z507|Q8N9R4|Q96CS6|Q96SK9	Missense_Mutation	SNP	pfam_Marvel	p.A184S	ENST00000391769.2	37	c.550	CCDS12866.1	19	.	.	.	.	.	.	.	.	.	.	G	23.5	4.419132	0.83559	.	.	ENSG00000179820	ENST00000421337;ENST00000336967;ENST00000391770;ENST00000448420;ENST00000439000;ENST00000391771;ENST00000415619;ENST00000391769;ENST00000391768	T;T;T;T;T;T;T	0.27890	1.64;1.64;1.64;1.64;1.64;1.64;1.64	4.21	4.21	0.49690	Marvel (1);MARVEL-like domain (1);	0.000000	0.64402	D	0.000001	T	0.56804	0.2010	M	0.80028	2.48	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.62497	-0.6842	10	0.54805	T	0.06	-5.2544	14.4575	0.67425	0.0:0.0:1.0:0.0	.	184	Q96S97	MYADM_HUMAN	S	184;184;184;184;184;184;147;184;184	ENSP00000398269:A184S;ENSP00000337222:A184S;ENSP00000375650:A184S;ENSP00000416919:A184S;ENSP00000375651:A184S;ENSP00000375649:A184S;ENSP00000375648:A184S	ENSP00000337222:A184S	A	+	1	0	MYADM	59069145	1.000000	0.71417	0.998000	0.56505	0.601000	0.36947	9.742000	0.98846	2.080000	0.62538	0.313000	0.20887	GCC	MYADM	-	pfam_Marvel	ENSG00000179820		0.642	MYADM-002	KNOWN	basic|appris_principal|CCDS	protein_coding	MYADM	HGNC	protein_coding	OTTHUMT00000134337.1	-	0.00	53	0	G	NM_138373		54377333	+1	tier1	-	no_errors	ENST00000336967	ensembl	human	known	74_37	missense	27.03	27	10	SNP	1.000	T
MYH1	4619	genome.wustl.edu	37	17	10408304	10408304	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr17:10408304G>T	ENST00000226207.5	-	22	2608	c.2514C>A	c.(2512-2514)ttC>ttA	p.F838L	CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA|RP11-799N11.1_ENST00000399342.2_RNA	NM_005963.3	NP_005954.3	P12882	MYH1_HUMAN	myosin, heavy chain 1, skeletal muscle, adult	838					muscle contraction (GO:0006936)	A band (GO:0031672)|cytoplasmic ribonucleoprotein granule (GO:0036464)|intercalated disc (GO:0014704)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(7)|breast(4)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(22)|lung(78)|ovary(11)|pancreas(1)|prostate(3)|skin(13)|upper_aerodigestive_tract(4)|urinary_tract(5)	176						GTTTGATCTTGAAATACAGCT	0.463																																																	0													120.0	112.0	115.0					17																	10408304		2203	4300	6503	SO:0001583	missense	0				CCDS11155.1	17p13.1	2013-09-19	2006-09-29		ENSG00000109061	ENSG00000109061		"""Myosins / Myosin superfamily : Class II"""	7567	protein-coding gene	gene with protein product	"""myosin heavy chain IIx/d"""	160730	"""myosin, heavy polypeptide 1, skeletal muscle, adult"""			6304733	Standard	NM_005963		Approved	MYHSA1, MYHa, MyHC-2X/D, MGC133384	uc002gmo.3	P12882	OTTHUMG00000130362	ENST00000226207.5:c.2514C>A	17.37:g.10408304G>T	ENSP00000226207:p.Phe838Leu		Q14CA4|Q9Y622	Missense_Mutation	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_P-loop_NTPase,superfamily_Prefoldin,superfamily_tRNA-bd_arm,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.F838L	ENST00000226207.5	37	c.2514	CCDS11155.1	17	.	.	.	.	.	.	.	.	.	.	G	32	5.151013	0.94645	.	.	ENSG00000109061	ENST00000226207	T	0.70986	-0.53	5.47	5.47	0.80525	.	0.000000	0.45126	U	0.000399	T	0.81083	0.4749	M	0.91920	3.255	0.80722	D	1	B	0.33266	0.404	B	0.38020	0.263	T	0.83127	-0.0115	10	0.62326	D	0.03	.	19.6961	0.96026	0.0:0.0:1.0:0.0	.	838	P12882	MYH1_HUMAN	L	838	ENSP00000226207:F838L	ENSP00000226207:F838L	F	-	3	2	MYH1	10349029	1.000000	0.71417	1.000000	0.80357	0.798000	0.45092	4.517000	0.60503	2.745000	0.94114	0.650000	0.86243	TTC	MYH1	-	superfamily_P-loop_NTPase	ENSG00000109061		0.463	MYH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH1	HGNC	protein_coding	OTTHUMT00000252725.1	-	0.00	83	0	G	NM_005963		10408304	-1	tier1	-	no_errors	ENST00000226207	ensembl	human	known	74_37	missense	51.14	43	45	SNP	1.000	T
MYO18B	84700	genome.wustl.edu	37	22	26299712	26299712	+	Nonsense_Mutation	SNP	G	G	T			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr22:26299712G>T	ENST00000407587.2	+	31	5234	c.5065G>T	c.(5065-5067)Gag>Tag	p.E1689*	CTA-125H2.2_ENST00000453457.3_RNA|MYO18B_ENST00000335473.7_Nonsense_Mutation_p.E1688*|CTA-125H2.2_ENST00000599080.1_RNA|MYO18B_ENST00000536101.1_Nonsense_Mutation_p.E1688*|CTA-125H2.2_ENST00000609275.1_RNA|CTA-125H2.2_ENST00000600211.1_RNA|CTA-125H2.2_ENST00000608115.1_RNA|CTA-125H2.2_ENST00000608257.1_RNA|CTA-125H2.2_ENST00000597284.1_RNA|CTA-125H2.2_ENST00000609570.1_RNA|CTA-125H2.2_ENST00000609157.1_RNA|CTA-125H2.2_ENST00000609889.1_RNA|MYO18B_ENST00000536204.1_3'UTR			Q8IUG5	MY18B_HUMAN	myosin XVIIIB	1688	Gln-rich.|Tail.					cytoplasm (GO:0005737)|nucleus (GO:0005634)|unconventional myosin complex (GO:0016461)	ATP binding (GO:0005524)|motor activity (GO:0003774)	p.K1688_E1689>N*(1)|p.E1689*(1)		NS(2)|breast(6)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(27)|liver(2)|lung(60)|ovary(7)|prostate(8)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	146						TGGCTTGAAGGAGAGGCTCTG	0.557																																																	2	Substitution - Nonsense(1)|Complex - compound substitution(1)	lung(2)											45.0	50.0	48.0					22																	26299712		1924	4134	6058	SO:0001587	stop_gained	0			AJ310931	CCDS54507.1	22q12.1	2011-09-27			ENSG00000133454	ENSG00000133454		"""Myosins / Myosin superfamily : Class XVIII"""	18150	protein-coding gene	gene with protein product		607295				12209013, 12547197	Standard	NM_032608		Approved	BK125H2.1	uc003abz.1	Q8IUG5	OTTHUMG00000151129	ENST00000407587.2:c.5065G>T	22.37:g.26299712G>T	ENSP00000386096:p.Glu1689*		B2RWP3|F5GYU7|Q8NDI8|Q8TE65|Q8WWS0|Q96KH2|Q96KR8|Q96KR9	Nonsense_Mutation	SNP	pfam_Myosin_head_motor_dom,superfamily_P-loop_NTPase,superfamily_tRNA-bd_arm,superfamily_Ribosomal_zn-bd,smart_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.E1688*	ENST00000407587.2	37	c.5062		22	.	.	.	.	.	.	.	.	.	.	G	42	9.248304	0.99113	.	.	ENSG00000133454	ENST00000536101;ENST00000335473;ENST00000407587	.	.	.	4.74	2.51	0.30379	.	0.514876	0.20004	N	0.101269	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.15952	T	0.53	.	3.0695	0.06225	0.1908:0.0:0.5678:0.2414	.	.	.	.	X	1688;1688;1689	.	ENSP00000334563:E1688X	E	+	1	0	MYO18B	24629712	1.000000	0.71417	0.885000	0.34714	0.088000	0.18126	4.124000	0.57924	1.199000	0.43173	0.655000	0.94253	GAG	MYO18B	-	NULL	ENSG00000133454		0.557	MYO18B-006	NOVEL	non_canonical_conserved|basic|appris_candidate_longest|exp_conf	protein_coding	MYO18B	HGNC	protein_coding	OTTHUMT00000400691.1		0.00	31	0	G	NM_032608		26299712	+1			no_errors	ENST00000335473	ensembl	human	known	74_37	nonsense	5.13	37	2	SNP	0.793	T
MYO7B	4648	genome.wustl.edu	37	2	128370116	128370116	+	Silent	SNP	C	C	T			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr2:128370116C>T	ENST00000409816.2	+	24	3290	c.3258C>T	c.(3256-3258)ccC>ccT	p.P1086P	MYO7B_ENST00000389524.4_Silent_p.P1086P|MYO7B_ENST00000428314.1_Silent_p.P1086P			Q6PIF6	MYO7B_HUMAN	myosin VIIB	1086	MyTH4 1. {ECO:0000255|PROSITE- ProRule:PRU00359}.					extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(46)|ovary(3)|pancreas(1)|prostate(3)|urinary_tract(1)	75	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0753)		CAGACCGGCCCATGTCCAACC	0.602																																																	0													67.0	74.0	72.0					2																	128370116		2127	4237	6364	SO:0001819	synonymous_variant	0				CCDS46405.1	2q21.1	2011-09-27			ENSG00000169994	ENSG00000169994		"""Myosins / Myosin superfamily : Class VII"""	7607	protein-coding gene	gene with protein product		606541				8022818, 8884266	Standard	NM_001080527		Approved		uc002top.3	Q6PIF6	OTTHUMG00000153419	ENST00000409816.2:c.3258C>T	2.37:g.128370116C>T			Q14786|Q8TEE1	Silent	SNP	pfam_Myosin_head_motor_dom,pfam_MyTH4_dom,pfam_FERM_central,pfam_IQ_motif_EF-hand-BS,pfam_SH3_2,superfamily_P-loop_NTPase,superfamily_FERM_central,superfamily_SH3_domain,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,smart_MyTH4_dom,smart_Band_41_domain,smart_SH3_domain,pfscan_FERM_domain,pfscan_IQ_motif_EF-hand-BS,pfscan_MyTH4_dom,pfscan_SH3_domain,prints_Myosin_head_motor_dom	p.P1086	ENST00000409816.2	37	c.3258	CCDS46405.1	2																																																																																			MYO7B	-	smart_MyTH4_dom,pfscan_MyTH4_dom	ENSG00000169994		0.602	MYO7B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MYO7B	HGNC	protein_coding	OTTHUMT00000331124.3	-	0.00	31	0	C	XM_291001		128370116	+1	tier1	-	no_errors	ENST00000389524	ensembl	human	known	74_37	silent	21.95	32	9	SNP	1.000	T
NCOA4	8031	genome.wustl.edu	37	10	51584855	51584855	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr10:51584855G>C	ENST00000443446.1	+	8	1183	c.954G>C	c.(952-954)gaG>gaC	p.E318D	NCOA4_ENST00000414907.2_Missense_Mutation_p.E152D|NCOA4_ENST00000438493.1_Missense_Mutation_p.E334D|NCOA4_ENST00000452682.1_Missense_Mutation_p.E334D|NCOA4_ENST00000374082.1_Missense_Mutation_p.E318D|NCOA4_ENST00000344348.6_Missense_Mutation_p.E318D|NCOA4_ENST00000374087.4_Missense_Mutation_p.E318D|NCOA4_ENST00000430396.2_Missense_Mutation_p.E218D	NM_001145262.1	NP_001138734.1	Q13772	NCOA4_HUMAN	nuclear receptor coactivator 4	318					androgen receptor signaling pathway (GO:0030521)|male gonad development (GO:0008584)|positive regulation of transcription, DNA-templated (GO:0045893)|response to hormone (GO:0009725)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|transcription coactivator activity (GO:0003713)			NS(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|skin(1)	5						GGAAGCCTGAGAATGGCAGTC	0.463			T	RET	papillary thyroid																																			Dom	yes		10	10q11.2	8031	nuclear receptor coactivator 4 - PTC3 (ELE1)		E	0													85.0	85.0	85.0					10																	51584855		2203	4300	6503	SO:0001583	missense	0			L49399	CCDS73092.1, CCDS73093.1, CCDS73094.1	10q11.2	2014-04-10			ENSG00000138293	ENSG00000266412			7671	protein-coding gene	gene with protein product	"""RET-activating gene ELE1"""	601984				8290261, 8643607, 24695223	Standard	NM_001145260		Approved	ARA70, RFG, ELE1, PTC3, DKFZp762E1112	uc009xon.3	Q13772	OTTHUMG00000188314	ENST00000443446.1:c.954G>C	10.37:g.51584855G>C	ENSP00000390713:p.Glu318Asp		A8K8W5|B4E260|E9PAV7|J3KQN8|Q14239	Missense_Mutation	SNP	pfam_ARA70	p.E334D	ENST00000443446.1	37	c.1002	CCDS7237.1	10	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	11.13|11.13	1.548970|1.548970	0.27652|0.27652	.|.	.|.	ENSG00000138293|ENSG00000138293	ENST00000438493;ENST00000452682;ENST00000430396;ENST00000374087;ENST00000414907;ENST00000344348;ENST00000374082;ENST00000443446|ENST00000431200	T;T;T;T;T;T;T;T|T	0.32753|0.32515	1.44;1.44;1.44;1.44;1.44;1.44;1.44;1.44|1.45	5.96|5.96	1.89|1.89	0.25635|0.25635	.|.	0.709437|0.709437	0.15140|0.15140	N|N	0.278331|0.278331	T|T	0.27098|0.27098	0.0664|0.0664	L|L	0.53249|0.53249	1.67|1.67	0.19300|0.19300	N|N	0.999977|0.999977	P;P;P;P|.	0.43938|.	0.822;0.722;0.822;0.549|.	P;P;P;P|.	0.45998|.	0.5;0.5;0.5;0.5|.	T|T	0.23583|0.23583	-1.0184|-1.0184	9|7	.|.	.|.	.|.	0.0137|0.0137	1.2956|1.2956	0.02069|0.02069	0.2289:0.2903:0.3325:0.1483|0.2289:0.2903:0.3325:0.1483	.|.	218;334;334;318|.	B4DF87;B4E260;E9PAV7;Q13772|.	.;.;.;NCOA4_HUMAN|.	D|Q	334;334;218;318;152;318;318;318|234	ENSP00000405146:E334D;ENSP00000395465:E334D;ENSP00000393053:E218D;ENSP00000363200:E318D;ENSP00000411018:E152D;ENSP00000344552:E318D;ENSP00000363195:E318D;ENSP00000390713:E318D|ENSP00000400928:E234Q	.|.	E|E	+|+	3|1	2|0	NCOA4|NCOA4	51254861|51254861	0.987000|0.987000	0.35691|0.35691	0.073000|0.073000	0.20177|0.20177	0.356000|0.356000	0.29392|0.29392	0.995000|0.995000	0.29706|0.29706	0.087000|0.087000	0.17167|0.17167	0.655000|0.655000	0.94253|0.94253	GAG|GAA	NCOA4	-	pfam_ARA70	ENSG00000138293		0.463	NCOA4-204	KNOWN	basic|appris_principal|CCDS	protein_coding	NCOA4	HGNC	protein_coding	OTTHUMT00000048052.1	-	0.00	58	0	G	NM_005437		51584855	+1	tier1	-	no_errors	ENST00000452682	ensembl	human	known	74_37	missense	21.21	52	14	SNP	0.471	C
NDUFA8	4702	genome.wustl.edu	37	9	124914553	124914553	+	Silent	SNP	C	C	A			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr9:124914553C>A	ENST00000373768.3	-	2	327	c.186G>T	c.(184-186)ctG>ctT	p.L62L	NDUFA8_ENST00000537618.1_Silent_p.L62L	NM_014222.2	NP_055037.1	P51970	NDUA8_HUMAN	NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 8, 19kDa	62	CHCH 1.				cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrial respiratory chain complex I (GO:0005747)|mitochondrion (GO:0005739)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)|protein complex binding (GO:0032403)			breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)	9						ACTTGTTGACCAGTTTGCCTT	0.443																																																	0													113.0	100.0	104.0					9																	124914553		2203	4300	6503	SO:0001819	synonymous_variant	0			AF044953	CCDS6835.1	9q33.2	2011-07-04	2002-08-29		ENSG00000119421	ENSG00000119421		"""Mitochondrial respiratory chain complex / Complex I"""	7692	protein-coding gene	gene with protein product	"""complex I PGIV subunit"""	603359	"""NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 8 (19kD, PGIV)"""			9763677	Standard	NM_014222		Approved	PGIV, MGC793	uc004blv.3	P51970	OTTHUMG00000020598	ENST00000373768.3:c.186G>T	9.37:g.124914553C>A			B1AM93|Q9Y6N0	Silent	SNP	pfam_CHCH,pirsf_NADH_Ub_cplx-1_asu_su-8	p.L62	ENST00000373768.3	37	c.186	CCDS6835.1	9																																																																																			NDUFA8	-	pirsf_NADH_Ub_cplx-1_asu_su-8	ENSG00000119421		0.443	NDUFA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NDUFA8	HGNC	protein_coding	OTTHUMT00000053909.1	-	0.00	23	0	C	NM_014222		124914553	-1	tier1	-	no_errors	ENST00000373768	ensembl	human	known	74_37	silent	30.56	25	11	SNP	0.998	A
NKRF	55922	genome.wustl.edu	37	X	118722358	118722358	+	3'UTR	DEL	T	T	-			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chrX:118722358delT	ENST00000371527.1	-	0	3682				NKRF_ENST00000542113.1_3'UTR|NKRF_ENST00000487600.1_5'UTR|NKRF_ENST00000304449.5_3'UTR	NM_001173488.1	NP_001166959.1	O15226	NKRF_HUMAN	NFKB repressing factor						negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|endometrium(8)|kidney(3)|large_intestine(2)|lung(9)|ovary(1)|prostate(3)|skin(1)|urinary_tract(1)	30						TTTTTATACATTTTTTTTTTT	0.368																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AJ011812	CCDS35375.1, CCDS55486.1	Xq24	2013-01-28	2008-03-26		ENSG00000186416	ENSG00000186416		"""G patch domain containing"""	19374	protein-coding gene	gene with protein product		300440	"""NF-kappaB repressing factor"""			10562553	Standard	NM_017544		Approved	ITBA4, NRF	uc022cdk.1	O15226	OTTHUMG00000022277	ENST00000371527.1:c.*957A>-	X.37:g.118722358delT			G3V1N1|Q4VC41|Q9UJ91	RNA	DEL	-	NULL	ENST00000371527.1	37	NULL	CCDS35375.1	X																																																																																			NKRF	-	-	ENSG00000186416		0.368	NKRF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NKRF	HGNC	protein_coding	OTTHUMT00000058044.1		0.00	20	0	T	NM_017544		118722358	-1	tier1		no_errors	ENST00000487600	ensembl	human	known	74_37	rna	12.20	36	5	DEL	0.949	-
NME8	51314	genome.wustl.edu	37	7	37934120	37934120	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr7:37934120G>T	ENST00000199447.4	+	16	1824	c.1452G>T	c.(1450-1452)aaG>aaT	p.K484N	NME8_ENST00000440017.1_Missense_Mutation_p.K484N|EPDR1_ENST00000476620.1_Intron	NM_016616.4	NP_057700.3	Q8N427	TXND3_HUMAN	NME/NM23 family member 8	484	NDK 3.				cell differentiation (GO:0030154)|cell redox homeostasis (GO:0045454)|CTP biosynthetic process (GO:0006241)|GTP biosynthetic process (GO:0006183)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)|UTP biosynthetic process (GO:0006228)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|nucleoside diphosphate kinase activity (GO:0004550)										CACAGGTGAAGAAAATGTTCC	0.318																																																	0													75.0	78.0	77.0					7																	37934120		2203	4298	6501	SO:0001583	missense	0			AF202051	CCDS5452.1	7p15.2	2012-05-18	2012-05-18	2012-05-18	ENSG00000086288	ENSG00000086288			16473	protein-coding gene	gene with protein product	"""sperm-specific thioredoxin 2"""	607421	"""thioredoxin domain containing 3 (spermatozoa)"""	TXNDC3		11737268, 11768308, 19852809	Standard	NM_016616		Approved	CILD6, SPTRX2, NM23-H8	uc003tfn.3	Q8N427	OTTHUMG00000023716	ENST00000199447.4:c.1452G>T	7.37:g.37934120G>T	ENSP00000199447:p.Lys484Asn		Q9NZH1	Missense_Mutation	SNP	pfam_Nucleoside_diP_kinase,pfam_Thioredoxin_domain,superfamily_Nucleoside_diP_kinase,superfamily_Thioredoxin-like_fold,smart_Nucleoside_diP_kinase	p.K484N	ENST00000199447.4	37	c.1452	CCDS5452.1	7	.	.	.	.	.	.	.	.	.	.	G	13.34	2.207354	0.39003	.	.	ENSG00000086288	ENST00000199447;ENST00000440017	T;T	0.63913	-0.07;-0.07	4.05	-2.2	0.06994	.	0.139077	0.32819	N	0.005606	T	0.79257	0.4415	H	0.95780	3.72	0.09310	N	0.999993	D	0.89917	1.0	D	0.87578	0.998	T	0.68526	-0.5385	10	0.72032	D	0.01	-18.654	5.0283	0.14396	0.4618:0.1537:0.3845:0.0	.	484	Q8N427	TXND3_HUMAN	N	484	ENSP00000199447:K484N;ENSP00000397063:K484N	ENSP00000199447:K484N	K	+	3	2	TXNDC3	37900645	0.988000	0.35896	0.000000	0.03702	0.009000	0.06853	0.164000	0.16542	-0.489000	0.06716	0.467000	0.42956	AAG	NME8	-	pfam_Nucleoside_diP_kinase,superfamily_Nucleoside_diP_kinase,smart_Nucleoside_diP_kinase	ENSG00000086288		0.318	NME8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NME8	HGNC	protein_coding	OTTHUMT00000219946.1	-	0.00	46	0	G	NM_016616		37934120	+1	tier1	-	no_errors	ENST00000199447	ensembl	human	known	74_37	missense	16.44	61	12	SNP	0.004	T
NPTX2	4885	genome.wustl.edu	37	7	98256586	98256586	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr7:98256586G>A	ENST00000265634.3	+	4	1163	c.998G>A	c.(997-999)gGc>gAc	p.G333D		NM_002523.2	NP_002514.1	P47972	NPTX2_HUMAN	neuronal pentraxin II	333	Pentaxin.				synaptic transmission (GO:0007268)	extracellular region (GO:0005576)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(2)|endometrium(1)|large_intestine(5)|lung(5)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	18	all_cancers(62;2.28e-09)|all_epithelial(64;4.86e-10)|Esophageal squamous(72;0.00918)|Lung NSC(181;0.0128)|all_lung(186;0.0142)		STAD - Stomach adenocarcinoma(171;0.215)			GAGAAGCTGGGCACTGGGGAG	0.642																																																	0													93.0	76.0	82.0					7																	98256586		2203	4300	6503	SO:0001583	missense	0				CCDS5657.1	7q21.3-q22.1	2008-04-30			ENSG00000106236	ENSG00000106236			7953	protein-coding gene	gene with protein product	"""apexin"""	600750				8530029	Standard	NM_002523		Approved		uc003upl.2	P47972	OTTHUMG00000154369	ENST00000265634.3:c.998G>A	7.37:g.98256586G>A	ENSP00000265634:p.Gly333Asp		A4D267|Q86XV7|Q96G70	Missense_Mutation	SNP	pfam_Pentaxin,superfamily_ConA-like_lec_gl_sf,smart_Pentaxin,prints_Pentaxin	p.G333D	ENST00000265634.3	37	c.998	CCDS5657.1	7	.	.	.	.	.	.	.	.	.	.	G	34	5.321762	0.95682	.	.	ENSG00000106236	ENST00000265634	T	0.61158	0.13	5.39	5.39	0.77823	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);	0.000000	0.85682	D	0.000000	T	0.73737	0.3625	L	0.58583	1.82	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.73154	-0.4072	10	0.49607	T	0.09	-16.073	18.4968	0.90867	0.0:0.0:1.0:0.0	.	333	P47972	NPTX2_HUMAN	D	333	ENSP00000265634:G333D	ENSP00000265634:G333D	G	+	2	0	NPTX2	98094522	1.000000	0.71417	1.000000	0.80357	0.933000	0.57130	9.807000	0.99171	2.682000	0.91365	0.655000	0.94253	GGC	NPTX2	-	pfam_Pentaxin,superfamily_ConA-like_lec_gl_sf,smart_Pentaxin	ENSG00000106236		0.642	NPTX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPTX2	HGNC	protein_coding	OTTHUMT00000334982.1	-	0.00	46	0	G	NM_002523		98256586	+1	tier1	-	no_errors	ENST00000265634	ensembl	human	known	74_37	missense	23.73	45	14	SNP	1.000	A
NUMBL	9253	genome.wustl.edu	37	19	41173875	41173877	+	In_Frame_Del	DEL	TGC	TGC	-			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	TGC	TGC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr19:41173875_41173877delTGC	ENST00000252891.4	-	10	1493_1495	c.1326_1328delGCA	c.(1324-1329)cagcaa>caa	p.442_443QQ>Q	NUMBL_ENST00000540131.1_In_Frame_Del_p.401_402QQ>Q|NUMBL_ENST00000598779.1_In_Frame_Del_p.401_402QQ>Q	NM_004756.3	NP_004747.1	Q9Y6R0	NUMBL_HUMAN	numb homolog (Drosophila)-like	442	Poly-Gln.				adherens junction organization (GO:0034332)|axonogenesis (GO:0007409)|cytokine-mediated signaling pathway (GO:0019221)|lateral ventricle development (GO:0021670)|nervous system development (GO:0007399)|neuroblast division in subventricular zone (GO:0021849)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of neurogenesis (GO:0050769)|protein metabolic process (GO:0019538)	cytoplasm (GO:0005737)				NS(1)|breast(1)|endometrium(1)|large_intestine(5)|lung(6)|ovary(2)	16			Lung(22;0.000393)|LUSC - Lung squamous cell carcinoma(20;0.00105)			ttgctgctgttgctgctgctgct	0.66																																																	0																																										SO:0001651	inframe_deletion	0			AF015401	CCDS12561.1	19q13.13-q13.2	2008-07-17	2001-11-28			ENSG00000105245			8061	protein-coding gene	gene with protein product		604018	"""numb (Drosophila) homolog-like"""			9225980, 9303539	Standard	XM_006723471		Approved	NUMB-R, CTG3a, CAG3A, TNRC23, NUMBR, NUMBLIKE	uc002oon.3	Q9Y6R0		ENST00000252891.4:c.1326_1328delGCA	19.37:g.41173884_41173886delTGC	ENSP00000252891:p.Gln446del		Q7Z4J9	In_Frame_Del	DEL	pfam_Numb_domain,pfam_PTB/PI_dom,pfam_PTB,smart_PTB/PI_dom,pirsf_Numb/numb-like,pfscan_PTB/PI_dom	p.Q446in_frame_del	ENST00000252891.4	37	c.1328_1326	CCDS12561.1	19																																																																																			NUMBL	-	pirsf_Numb/numb-like	ENSG00000105245		0.660	NUMBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUMBL	HGNC	protein_coding	OTTHUMT00000462749.2		0.00	26	0	TGC	NM_004756		41173877	-1	tier1		no_errors	ENST00000252891	ensembl	human	known	74_37	in_frame_del	15.79	16	3	DEL	0.967:0.971:0.977	-
NUP214	8021	genome.wustl.edu	37	9	134019999	134019999	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr9:134019999G>A	ENST00000359428.5	+	12	1771	c.1627G>A	c.(1627-1629)Gct>Act	p.A543T	NUP214_ENST00000411637.2_Missense_Mutation_p.A543T|RP11-544A12.4_ENST00000587264.1_RNA|RP11-544A12.4_ENST00000587408.1_RNA|NUP214_ENST00000451030.1_Missense_Mutation_p.A543T|RP11-544A12.4_ENST00000589540.1_RNA|RP11-544A12.4_ENST00000589667.1_RNA|RP11-544A12.4_ENST00000415391.2_RNA|RP11-544A12.4_ENST00000590461.1_RNA|RP11-544A12.4_ENST00000588378.1_RNA|RP11-544A12.4_ENST00000586290.1_RNA			P35658	NU214_HUMAN	nucleoporin 214kDa	543	11 X 5 AA approximate repeats.				carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|gene expression (GO:0010467)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|protein export from nucleus (GO:0006611)|protein import into nucleus (GO:0006606)|regulation of cell cycle (GO:0051726)|regulation of glucose transport (GO:0010827)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|focal adhesion (GO:0005925)|intracellular membrane-bounded organelle (GO:0043231)|nuclear pore (GO:0005643)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleocytoplasmic transporter activity (GO:0005487)|transporter activity (GO:0005215)			NS(1)|breast(9)|central_nervous_system(3)|endometrium(13)|kidney(2)|large_intestine(9)|liver(2)|lung(29)|ovary(2)|prostate(3)|skin(7)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	86	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;3.42e-05)|Epithelial(140;0.000256)		GGCTCCATCAGCTGCTTCATT	0.542			T	"""DEK, SET, ABL1"""	"""AML, T-ALL"""																																Pancreas(4;24 48 25510 30394 32571)			Dom	yes		9	9q34.1	8021	nucleoporin 214kDa (CAN)		L	0													80.0	77.0	78.0					9																	134019999		2203	4300	6503	SO:0001583	missense	0			X64228	CCDS6940.1	9q34	2008-07-21	2002-08-29		ENSG00000126883	ENSG00000126883			8064	protein-coding gene	gene with protein product	"""nuclear pore complex protein Nup214"", ""CAN protein, putative oncogene"""	114350	"""nucleoporin 214kD (CAIN)"""			8108440, 2370860	Standard	NM_005085		Approved	CAIN, CAN, D9S46E, N214	uc004cag.3	P35658	OTTHUMG00000020816	ENST00000359428.5:c.1627G>A	9.37:g.134019999G>A	ENSP00000352400:p.Ala543Thr		A6NFQ0|Q15010|Q3KQZ0|Q5JUP7|Q75R47|Q86XD3	Missense_Mutation	SNP	smart_WD40_repeat	p.A543T	ENST00000359428.5	37	c.1627	CCDS6940.1	9	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.43|13.43	2.234466|2.234466	0.39498|0.39498	.|.	.|.	ENSG00000126883|ENSG00000126883	ENST00000359428;ENST00000411637;ENST00000451030;ENST00000541375;ENST00000540899|ENST00000530863	T;T;T|T	0.34667|0.76316	1.38;1.35;1.36|-1.01	5.55|5.55	1.47|1.47	0.22746|0.22746	.|.	0.000000|.	0.42821|.	D|.	0.000652|.	T|T	0.52419|0.52419	0.1733|0.1733	N|N	0.08118|0.08118	0|0	0.09310|0.09310	N|N	1|1	B;B|.	0.24426|.	0.103;0.103|.	B;B|.	0.24848|.	0.056;0.056|.	T|T	0.36187|0.36187	-0.9758|-0.9758	10|7	0.29301|0.17369	T|T	0.29|0.5	-2.5165|-2.5165	5.3182|5.3182	0.15866|0.15866	0.073:0.2657:0.5238:0.1375|0.073:0.2657:0.5238:0.1375	.|.	543;543|.	P35658-4;P35658|.	.;NU214_HUMAN|.	T|N	543;543;543;543;136|118	ENSP00000352400:A543T;ENSP00000396576:A543T;ENSP00000405014:A543T|ENSP00000434223:S118N	ENSP00000352400:A543T|ENSP00000434223:S118N	A|S	+|+	1|2	0|0	NUP214|NUP214	133009820|133009820	0.155000|0.155000	0.22806|0.22806	0.002000|0.002000	0.10522|0.10522	0.450000|0.450000	0.32258|0.32258	1.465000|1.465000	0.35299|0.35299	0.004000|0.004000	0.14682|0.14682	0.655000|0.655000	0.94253|0.94253	GCT|AGC	NUP214	-	NULL	ENSG00000126883		0.542	NUP214-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	NUP214	HGNC	protein_coding	OTTHUMT00000054694.2	-	0.00	32	0	G	NM_005085		134019999	+1	tier1	-	no_errors	ENST00000451030	ensembl	human	known	74_37	missense	7.41	50	4	SNP	0.008	A
OAS2	4939	genome.wustl.edu	37	12	113440810	113440810	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr12:113440810G>C	ENST00000342315.4	+	6	1296	c.1082G>C	c.(1081-1083)tGc>tCc	p.C361S	RP1-71H24.1_ENST00000552784.1_RNA|OAS2_ENST00000392583.2_Missense_Mutation_p.C361S	NM_016817.2	NP_058197.2	P29728	OAS2_HUMAN	2'-5'-oligoadenylate synthetase 2, 69/71kDa	361	OAS domain 2.				cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|interferon-gamma-mediated signaling pathway (GO:0060333)|nucleobase-containing compound metabolic process (GO:0006139)|protein glycosylation (GO:0006486)|protein myristoylation (GO:0018377)|purine nucleotide biosynthetic process (GO:0006164)|response to virus (GO:0009615)|RNA catabolic process (GO:0006401)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	2'-5'-oligoadenylate synthetase activity (GO:0001730)|ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|metal ion binding (GO:0046872)|zinc ion binding (GO:0008270)	p.C361Y(1)		NS(1)|breast(2)|endometrium(4)|large_intestine(7)|lung(8)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	28						CCCAACAAATGCTTCCTAGAG	0.498																																					Pancreas(199;709 2232 18410 33584 35052)												1	Substitution - Missense(1)	endometrium(1)											306.0	290.0	296.0					12																	113440810		2203	4300	6503	SO:0001583	missense	0			M87284	CCDS31906.1, CCDS41839.1, CCDS44982.1	12q24.2	2008-05-02	2002-08-29			ENSG00000111335			8087	protein-coding gene	gene with protein product		603350	"""2'-5'-oligoadenylate synthetase 2 (69-71 kD)"""			9790745	Standard	NM_002535		Approved		uc001tuj.3	P29728	OTTHUMG00000169802	ENST00000342315.4:c.1082G>C	12.37:g.113440810G>C	ENSP00000342278:p.Cys361Ser		A8K9T1|Q6PJ33|Q86XX8	Missense_Mutation	SNP	pfam_2-5-oligoAdlate_synth_1_dom2/C,pfam_Nucleotidyltransferase,pfscan_2-5-oligoadenylate_synth_N	p.C361S	ENST00000342315.4	37	c.1082	CCDS31906.1	12	.	.	.	.	.	.	.	.	.	.	.	0.001	-4.605640	0.00000	.	.	ENSG00000111335	ENST00000342315;ENST00000392583	T;T	0.06528	3.29;3.29	3.8	-7.59	0.01308	2-5-oligoadenylate synthetase, N-terminal (1);	15.362500	0.00166	N	0.000002	T	0.02533	0.0077	N	0.03050	-0.425	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.42749	-0.9433	10	0.21540	T	0.41	15.5161	3.7276	0.08481	0.0958:0.3149:0.1347:0.4546	.	361;361	P29728;P29728-2	OAS2_HUMAN;.	S	361	ENSP00000342278:C361S;ENSP00000376362:C361S	ENSP00000342278:C361S	C	+	2	0	OAS2	111925193	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.200000	0.01237	-7.732000	0.00000	-5.592000	0.00000	TGC	OAS2	-	pfscan_2-5-oligoadenylate_synth_N	ENSG00000111335		0.498	OAS2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	OAS2	HGNC	protein_coding	OTTHUMT00000405937.1	-	0.00	60	0	G			113440810	+1	tier1	-	no_errors	ENST00000342315	ensembl	human	known	74_37	missense	13.46	45	7	SNP	0.001	C
OAT	4942	genome.wustl.edu	37	10	126097158	126097158	+	Missense_Mutation	SNP	T	T	C	rs386833611		TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr10:126097158T>C	ENST00000368845.5	-	4	565	c.473A>G	c.(472-474)tAt>tGt	p.Y158C	OAT_ENST00000467675.1_5'UTR|OAT_ENST00000539214.1_Missense_Mutation_p.Y20C	NM_000274.3	NP_000265.1	P04181	OAT_HUMAN	ornithine aminotransferase	158					cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|L-proline biosynthetic process (GO:0055129)|protein hexamerization (GO:0034214)|small molecule metabolic process (GO:0044281)|visual perception (GO:0007601)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ornithine-oxo-acid transaminase activity (GO:0004587)|pyridoxal phosphate binding (GO:0030170)			endometrium(2)|large_intestine(1)|lung(2)	5		all_lung(145;0.0271)|Lung NSC(174;0.0436)|Colorectal(57;0.102)|all_neural(114;0.116)			L-Ornithine(DB00129)	CTTCACGGTATAGCCCCACTT	0.333																																																	0													67.0	67.0	67.0					10																	126097158		2203	4300	6503	SO:0001583	missense	0			BC016928	CCDS7639.1, CCDS53586.1	10q26	2014-09-17	2010-01-20		ENSG00000065154	ENSG00000065154	2.6.1.13		8091	protein-coding gene	gene with protein product	"""Ornithine aminotransferase"", ""ornithine aminotransferase precursor"", ""gyrate atrophy"""	613349				1682785	Standard	NM_000274		Approved	HOGA	uc001lhp.3	P04181	OTTHUMG00000019213	ENST00000368845.5:c.473A>G	10.37:g.126097158T>C	ENSP00000357838:p.Tyr158Cys		D3DRF0|Q16068|Q16069|Q68CS0|Q6IAV9|Q9UD03	Missense_Mutation	SNP	pfam_Aminotrans_3,superfamily_PyrdxlP-dep_Trfase,tigrfam_Orn_aminotrans	p.Y158C	ENST00000368845.5	37	c.473	CCDS7639.1	10	.	.	.	.	.	.	.	.	.	.	T	15.38	2.817829	0.50633	.	.	ENSG00000065154	ENST00000539214;ENST00000368845	D;D	0.87256	-2.23;-2.23	5.07	5.07	0.68467	Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.000000	0.85682	D	0.000000	D	0.92583	0.7644	M	0.87269	2.87	0.80722	D	1	D	0.61080	0.989	P	0.60886	0.88	D	0.93393	0.6753	10	0.87932	D	0	-28.7143	10.7525	0.46217	0.142:0.0:0.0:0.858	.	158	P04181	OAT_HUMAN	C	20;158	ENSP00000439042:Y20C;ENSP00000357838:Y158C	ENSP00000357838:Y158C	Y	-	2	0	OAT	126087148	1.000000	0.71417	0.427000	0.26684	0.381000	0.30169	5.820000	0.69250	2.223000	0.72356	0.455000	0.32223	TAT	OAT	-	pfam_Aminotrans_3,superfamily_PyrdxlP-dep_Trfase,tigrfam_Orn_aminotrans	ENSG00000065154		0.333	OAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OAT	HGNC	protein_coding	OTTHUMT00000050863.1	-	0.00	63	0	T	NM_000274		126097158	-1	tier1	-	no_errors	ENST00000368845	ensembl	human	known	74_37	missense	28.07	41	16	SNP	0.923	C
OMA1	115209	genome.wustl.edu	37	1	58993006	58993006	+	Splice_Site	SNP	T	T	C			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr1:58993006T>C	ENST00000371226.3	-	7	1255	c.1142A>G	c.(1141-1143)tAt>tGt	p.Y381C	DAB1_ENST00000485760.1_5'UTR|OMA1_ENST00000358603.2_Splice_Site_p.Y381C	NM_145243.3	NP_660286.1	Q96E52	OMA1_HUMAN	OMA1 zinc metallopeptidase	381					cristae formation (GO:0042407)|diet induced thermogenesis (GO:0002024)|energy homeostasis (GO:0097009)|glucose metabolic process (GO:0006006)|lipid metabolic process (GO:0006629)|misfolded or incompletely synthesized protein catabolic process (GO:0006515)|mitochondrial protein processing (GO:0034982)|negative regulation of mitochondrial fusion (GO:0010637)|response to stress (GO:0006950)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial membrane (GO:0031966)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			NS(1)|breast(1)|large_intestine(6)|liver(2)|lung(6)|prostate(1)|skin(1)	18	all_cancers(7;6.54e-05)					ATTAAACATATACTAAGAAGA	0.338																																																	0													87.0	85.0	86.0					1																	58993006		2202	4300	6502	SO:0001630	splice_region_variant	0			AK091101	CCDS608.1	1p32.2-p32.1	2013-05-03	2013-05-03		ENSG00000162600	ENSG00000162600			29661	protein-coding gene	gene with protein product	"""overlapping activity with M-AAA protease"", ""zinc metallopeptidase OMA1"""		"""OMA1 zinc metallopeptidase homolog (S. cerevisiae)"""			12477932	Standard	NM_145243		Approved	MPRP-1, YKR087C, ZMPOMA1, FLJ33782	uc001cyy.3	Q96E52	OTTHUMG00000010068	ENST00000371226.3:c.1141-1A>G	1.37:g.58993006T>C			D3DQ54|Q5T3G6|Q5T3G7|Q5T3G8|Q5T3G9|Q5T3H0|Q8NBB3	Missense_Mutation	SNP	pfam_Peptidase_M48	p.Y381C	ENST00000371226.3	37	c.1142	CCDS608.1	1	.	.	.	.	.	.	.	.	.	.	T	16.43	3.122501	0.56613	.	.	ENSG00000162600	ENST00000358603;ENST00000371226	T;T	0.74106	-0.81;-0.81	5.12	-3.92	0.04155	.	0.486726	0.20693	N	0.087424	T	0.80232	0.4585	M	0.82823	2.61	0.28338	N	0.921492	D;P	0.55172	0.97;0.931	P;P	0.56474	0.799;0.77	T	0.77281	-0.2646	10	0.59425	D	0.04	-6.3578	11.4042	0.49887	0.7651:0.0681:0.0:0.1668	.	381;381	Q96E52;Q96E52-2	OMA1_HUMAN;.	C	381	ENSP00000351417:Y381C;ENSP00000360270:Y381C	ENSP00000351417:Y381C	Y	-	2	0	OMA1	58765594	1.000000	0.71417	0.890000	0.34922	0.749000	0.42624	1.604000	0.36804	-0.958000	0.03622	0.533000	0.62120	TAT	OMA1	-	pfam_Peptidase_M48	ENSG00000162600		0.338	OMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OMA1	HGNC	protein_coding	OTTHUMT00000027819.1	-	0.00	58	0	T	NM_145243	Missense_Mutation	58993006	-1	tier1	-	no_errors	ENST00000371226	ensembl	human	known	74_37	missense	18.87	43	10	SNP	0.554	C
OLFM3	118427	genome.wustl.edu	37	1	102312449	102312449	+	Silent	SNP	T	T	A			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr1:102312449T>A	ENST00000338858.5	-	1	80	c.81A>T	c.(79-81)ccA>ccT	p.P27P	OLFM3_ENST00000462354.1_Intron|OLFM3_ENST00000359814.3_Silent_p.P27P|OLFM3_ENST00000370103.4_Intron			Q96PB7	NOE3_HUMAN	olfactomedin 3	27					eye photoreceptor cell development (GO:0042462)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|synapse (GO:0045202)				breast(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(24)|ovary(3)|prostate(1)|skin(1)|soft_tissue(1)|upper_aerodigestive_tract(2)	43		all_epithelial(167;1.87e-06)|all_lung(203;8.12e-05)|Lung NSC(277;0.000189)		all cancers(265;0.0843)|Epithelial(280;0.0921)|COAD - Colon adenocarcinoma(174;0.145)		CCACCAAGGATGGGAGAGTTT	0.502																																																	0													138.0	121.0	126.0					1																	102312449		876	1991	2867	SO:0001819	synonymous_variant	0			AF397392	CCDS30781.1, CCDS72832.1	1p22	2008-05-23			ENSG00000118733	ENSG00000118733			17990	protein-coding gene	gene with protein product	"""optimedin"""	607567				12019210, 16115881	Standard	NM_001288821		Approved	NOE3	uc001dug.2	Q96PB7	OTTHUMG00000010941	ENST00000338858.5:c.81A>T	1.37:g.102312449T>A			Q5T3V6|Q6IMI7|Q6IMI8|Q6IMI9|Q6IMJ1|Q8TBG1|Q96PB2|Q96PB3|Q96PB4|Q96PB5|Q96PB6	Silent	SNP	pfam_Olfac-like,pfam_Noelin-1,superfamily_Quino_amine_DH_bsu,smart_Olfac-like,pfscan_Olfac-like	p.P27	ENST00000338858.5	37	c.81		1																																																																																			OLFM3	-	NULL	ENSG00000118733		0.502	OLFM3-001	KNOWN	basic|appris_principal	protein_coding	OLFM3	HGNC	protein_coding	OTTHUMT00000030142.1	-	0.00	101	0	T			102312449	-1	tier1	-	no_errors	ENST00000338858	ensembl	human	known	74_37	silent	25.27	68	23	SNP	1.000	A
OBSCN	84033	genome.wustl.edu	37	1	228434246	228434246	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr1:228434246G>T	ENST00000422127.1	+	13	3819	c.3775G>T	c.(3775-3777)Gcc>Tcc	p.A1259S	OBSCN_ENST00000570156.2_Missense_Mutation_p.A1351S|OBSCN_ENST00000366707.4_5'UTR|OBSCN_ENST00000366709.4_5'UTR|OBSCN_ENST00000284548.11_Missense_Mutation_p.A1259S	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	1259	Ig-like 13.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				GGCAGTGTTTGCCAAGGAGCA	0.577																																																	0													97.0	95.0	96.0					1																	228434246		2059	4192	6251	SO:0001583	missense	0			AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.3775G>T	1.37:g.228434246G>T	ENSP00000409493:p.Ala1259Ser		Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Fibronectin_type3,pfam_DH-domain,pfam_IQ_motif_EF-hand-BS,superfamily_Kinase-like_dom,superfamily_DH-domain,superfamily_Fibronectin_type3,superfamily_SH3_domain,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_IQ_motif_EF-hand-BS,smart_DH-domain,smart_Pleckstrin_homology,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_IQ_motif_EF-hand-BS,pfscan_Pleckstrin_homology,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom,pfscan_DH-domain	p.A1259S	ENST00000422127.1	37	c.3775	CCDS58065.1	1	.	.	.	.	.	.	.	.	.	.	.	6.819	0.520245	0.13005	.	.	ENSG00000154358	ENST00000284548;ENST00000422127	T;T	0.04551	3.6;3.6	4.84	3.9	0.45041	Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.252928	0.33631	N	0.004712	T	0.04227	0.0117	L	0.54863	1.705	0.80722	D	1	B;P	0.36789	0.402;0.57	B;B	0.33454	0.119;0.164	T	0.38156	-0.9674	10	0.08381	T	0.77	.	6.2806	0.21005	0.1621:0.1607:0.6772:0.0	.	1259;1259	Q5VST9;Q5VST9-3	OBSCN_HUMAN;.	S	1259	ENSP00000284548:A1259S;ENSP00000409493:A1259S	ENSP00000284548:A1259S	A	+	1	0	OBSCN	226500869	0.010000	0.17322	0.999000	0.59377	0.324000	0.28378	0.424000	0.21330	0.968000	0.38212	0.563000	0.77884	GCC	OBSCN	-	pfscan_Ig-like_dom	ENSG00000154358		0.577	OBSCN-204	KNOWN	basic|CCDS	protein_coding	OBSCN	HGNC	protein_coding		-	0.00	70	0	G	NM_052843		228434246	+1	tier1	-	no_errors	ENST00000422127	ensembl	human	known	74_37	missense	20.00	64	16	SNP	0.999	T
OR4A16	81327	genome.wustl.edu	37	11	55110883	55110883	+	Silent	SNP	C	C	A			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr11:55110883C>A	ENST00000314721.2	+	1	257	c.207C>A	c.(205-207)gcC>gcA	p.A69A		NM_001005274.1	NP_001005274.1	Q8NH70	O4A16_HUMAN	olfactory receptor, family 4, subfamily A, member 16	69						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(28)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	51						TTATGGATGCCATATATTCCA	0.453																																																	0													196.0	179.0	184.0					11																	55110883		2201	4296	6497	SO:0001819	synonymous_variant	0			AB065519	CCDS31499.1	11q11	2012-08-09			ENSG00000181961	ENSG00000181961		"""GPCR / Class A : Olfactory receptors"""	15153	protein-coding gene	gene with protein product							Standard	NM_001005274		Approved	OR4A16Q	uc010rie.2	Q8NH70	OTTHUMG00000166710	ENST00000314721.2:c.207C>A	11.37:g.55110883C>A			Q6IFL3	Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.A69	ENST00000314721.2	37	c.207	CCDS31499.1	11																																																																																			OR4A16	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000181961		0.453	OR4A16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4A16	HGNC	protein_coding	OTTHUMT00000391160.1	-	0.00	45	0	C	NM_001005274		55110883	+1	tier1	-	no_errors	ENST00000314721	ensembl	human	known	74_37	silent	14.58	41	7	SNP	0.003	A
OR4K14	122740	genome.wustl.edu	37	14	20482510	20482510	+	Silent	SNP	T	T	C			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr14:20482510T>C	ENST00000305045.2	-	1	842	c.843A>G	c.(841-843)ccA>ccG	p.P281P		NM_001004712.1	NP_001004712.1	Q8NGD5	OR4KE_HUMAN	olfactory receptor, family 4, subfamily K, member 14	281						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(3)|endometrium(3)|kidney(1)|large_intestine(4)|lung(20)|skin(6)	37	all_cancers(95;0.00108)		Epithelial(56;4.65e-07)|all cancers(55;2e-06)	GBM - Glioblastoma multiforme(265;0.00124)		GGTTCAGGAGTGGAGTAAAAA	0.433																																																	0													98.0	92.0	94.0					14																	20482510		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS32027.1	14q11.2	2013-09-23			ENSG00000169484	ENSG00000169484		"""GPCR / Class A : Olfactory receptors"""	15352	protein-coding gene	gene with protein product							Standard	NM_001004712		Approved		uc010tky.2	Q8NGD5	OTTHUMG00000170780	ENST00000305045.2:c.843A>G	14.37:g.20482510T>C			Q6IEU1|Q96R71	Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.P281	ENST00000305045.2	37	c.843	CCDS32027.1	14																																																																																			OR4K14	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	ENSG00000169484		0.433	OR4K14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4K14	HGNC	protein_coding	OTTHUMT00000410343.1	-	0.00	30	0	T			20482510	-1	tier1	-	no_errors	ENST00000305045	ensembl	human	known	74_37	silent	30.00	13	6	SNP	0.001	C
OR52L1	338751	genome.wustl.edu	37	11	6007674	6007674	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr11:6007674C>T	ENST00000332249.4	-	1	541	c.487G>A	c.(487-489)Gga>Aga	p.G163R		NM_001005173.2	NP_001005173.2	Q8NGH7	O52L1_HUMAN	olfactory receptor, family 52, subfamily L, member 1	163						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(6)|lung(11)|pancreas(1)|skin(3)|soft_tissue(1)	30		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;1.98e-08)|BRCA - Breast invasive adenocarcinoma(625;0.135)		ACCACCATTCCGATGCACCCT	0.517																																					Melanoma(121;653 1666 10547 22796 51255)												0													81.0	77.0	78.0					11																	6007674		2033	4188	6221	SO:0001583	missense	0			AB065819	CCDS44529.1	11p15.4	2012-08-09			ENSG00000183313	ENSG00000183313		"""GPCR / Class A : Olfactory receptors"""	14785	protein-coding gene	gene with protein product							Standard	NM_001005173		Approved		uc001mcd.2	Q8NGH7	OTTHUMG00000165374	ENST00000332249.4:c.487G>A	11.37:g.6007674C>T	ENSP00000330338:p.Gly163Arg		B2RPA6|Q6IFK9	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.G163R	ENST00000332249.4	37	c.487	CCDS44529.1	11	.	.	.	.	.	.	.	.	.	.	C	8.766	0.924760	0.18056	.	.	ENSG00000183313	ENST00000332249	T	0.37411	1.2	3.85	1.91	0.25777	GPCR, rhodopsin-like superfamily (1);	0.165132	0.28790	N	0.014132	T	0.68109	0.2965	H	0.97564	4.03	0.09310	N	1	D	0.89917	1.0	D	0.74674	0.984	T	0.61038	-0.7143	10	0.87932	D	0	.	8.5008	0.33156	0.0:0.7983:0.0:0.2017	.	163	Q8NGH7	O52L1_HUMAN	R	163	ENSP00000330338:G163R	ENSP00000330338:G163R	G	-	1	0	OR52L1	5964250	0.002000	0.14202	0.028000	0.17463	0.022000	0.10575	-0.229000	0.09098	0.735000	0.32537	-0.671000	0.03813	GGA	OR52L1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000183313		0.517	OR52L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR52L1	HGNC	protein_coding	OTTHUMT00000383754.1	-	0.00	64	0	C	NM_001005173		6007674	-1	tier1	-	no_errors	ENST00000332249	ensembl	human	known	74_37	missense	31.71	28	13	SNP	0.046	T
OR7D4	125958	genome.wustl.edu	37	19	9324685	9324685	+	Missense_Mutation	SNP	T	T	G			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr19:9324685T>G	ENST00000308682.2	-	1	857	c.829A>C	c.(829-831)Atg>Ctg	p.M277L		NM_001005191.2	NP_001005191.1	Q8NG98	OR7D4_HUMAN	olfactory receptor, family 7, subfamily D, member 4	277						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(10)|ovary(2)|skin(3)|stomach(1)	26						ATGGCGTACATCACTGAGGCG	0.562																																																	0													71.0	63.0	66.0					19																	9324685		2203	4300	6503	SO:0001583	missense	0				CCDS32901.1	19p13.2	2013-12-17		2004-03-10	ENSG00000174667	ENSG00000174667		"""GPCR / Class A : Olfactory receptors"""	8380	protein-coding gene	gene with protein product		611538		OR7D4P			Standard	NM_001005191		Approved	hg105, OR19-B	uc002mla.2	Q8NG98	OTTHUMG00000179936	ENST00000308682.2:c.829A>C	19.37:g.9324685T>G	ENSP00000310488:p.Met277Leu		A8CAH8|A8CAH9|A8CAI0|A8CAI1|B9EH79	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.M277L	ENST00000308682.2	37	c.829	CCDS32901.1	19	.	.	.	.	.	.	.	.	.	.	T	4.478	0.088631	0.08583	.	.	ENSG00000174667	ENST00000308682	T	0.00021	9.03	3.49	2.46	0.29980	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	D	0.000002	T	0.00109	0.0003	L	0.37561	1.115	0.18873	N	0.999983	B	0.20052	0.041	B	0.24269	0.052	T	0.27536	-1.0071	10	0.59425	D	0.04	.	5.3414	0.15986	0.0:0.1365:0.0:0.8635	.	277	Q8NG98	OR7D4_HUMAN	L	277	ENSP00000310488:M277L	ENSP00000310488:M277L	M	-	1	0	OR7D4	9185685	0.000000	0.05858	0.398000	0.26321	0.092000	0.18411	-0.890000	0.04140	0.558000	0.29135	0.172000	0.16884	ATG	OR7D4	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000174667		0.562	OR7D4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR7D4	HGNC	protein_coding	OTTHUMT00000449004.1	-	0.00	55	0	T			9324685	-1	tier1	-	no_errors	ENST00000308682	ensembl	human	known	74_37	missense	15.79	32	6	SNP	0.020	G
PALM2	114299	genome.wustl.edu	37	9	112642907	112642907	+	Missense_Mutation	SNP	G	G	A	rs145553769		TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr9:112642907G>A	ENST00000374531.2	+	4	283	c.209G>A	c.(208-210)cGg>cAg	p.R70Q	PALM2_ENST00000448454.2_Missense_Mutation_p.R70Q|PALM2-AKAP2_ENST00000374530.3_Missense_Mutation_p.R68Q|AKAP2_ENST00000555236.1_Missense_Mutation_p.R68Q|PALM2-AKAP2_ENST00000302798.7_Missense_Mutation_p.R68Q|AKAP2_ENST00000510514.5_Missense_Mutation_p.R68Q|PALM2_ENST00000483909.1_Missense_Mutation_p.R68Q|PALM2_ENST00000314527.4_Missense_Mutation_p.R68Q	NM_001037293.2	NP_001032370.1	Q8IXS6	PALM2_HUMAN	paralemmin 2	70				Missing (in Ref. 2; BAC04472). {ECO:0000305}.	regulation of cell shape (GO:0008360)	plasma membrane (GO:0005886)				breast(1)|endometrium(1)|large_intestine(3)|lung(5)|ovary(2)|pancreas(2)|skin(3)|upper_aerodigestive_tract(1)	18						GCCAGGAGGCGGCAGTCTGAA	0.532																																																	0													97.0	92.0	94.0					9																	112642907		2203	4300	6503	SO:0001583	missense	0			AJ312216	CCDS35099.1, CCDS48002.1, CCDS48002.2	9q31.3	2009-10-16			ENSG00000243444	ENSG00000243444			15845	protein-coding gene	gene with protein product						11478809	Standard	NM_001037293		Approved			Q8IXS6	OTTHUMG00000020479	ENST00000374531.2:c.209G>A	9.37:g.112642907G>A	ENSP00000363656:p.Arg70Gln		A9Z1X9|Q8N9D5|Q96DU1	Missense_Mutation	SNP	pfam_Paralemmin,pfam_RII_binding_1	p.R68Q	ENST00000374531.2	37	c.203	CCDS35099.1	9	.	.	.	.	.	.	.	.	.	.	G	21.2	4.113087	0.77210	.	.	ENSG00000243444;ENSG00000243444;ENSG00000243444;ENSG00000243444;ENSG00000243444;ENSG00000157654;ENSG00000157654;ENSG00000157654;ENSG00000241978;ENSG00000241978	ENST00000374531;ENST00000448454;ENST00000483909;ENST00000314527;ENST00000497711;ENST00000374530;ENST00000413420;ENST00000302798;ENST00000555236;ENST00000510514	T;T;T;T;T;T;T;T;T;T	0.19250	2.16;2.16;2.16;2.16;2.16;2.16;2.16;2.16;2.16;2.16	5.36	5.36	0.76844	.	1.101910	0.06975	N	0.818864	T	0.41903	0.1179	L	0.60455	1.87	0.24342	N	0.994951	D;D;P;D	0.76494	0.999;0.999;0.898;0.958	P;P;B;B	0.62014	0.897;0.897;0.15;0.207	T	0.27872	-1.0061	10	0.87932	D	0	-21.832	10.4041	0.44246	0.0892:0.0:0.9108:0.0	.	68;68;70;70	Q9Y2D5-6;Q9Y2D5-4;Q8IXS6;D3YTA4	.;.;PALM2_HUMAN;.	Q	70;70;68;68;54;68;68;68;68;68	ENSP00000363656:R70Q;ENSP00000400206:R70Q;ENSP00000417525:R68Q;ENSP00000323805:R68Q;ENSP00000419747:R54Q;ENSP00000363654:R68Q;ENSP00000397839:R68Q;ENSP00000305861:R68Q;ENSP00000451476:R68Q;ENSP00000421522:R68Q	ENSP00000305861:R68Q	R	+	2	0	PALM2-AKAP2;PALM2;AKAP2	111682728	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	2.176000	0.42500	2.693000	0.91896	0.650000	0.86243	CGG	PALM2-AKAP2	-	pfam_Paralemmin	ENSG00000157654		0.532	PALM2-002	KNOWN	basic|CCDS	protein_coding	PALM2-AKAP2	HGNC	protein_coding	OTTHUMT00000053604.1	-	0.00	32	0	G	NM_001037293		112642907	+1	tier1	-	no_errors	ENST00000374530	ensembl	human	known	74_37	missense	9.30	39	4	SNP	1.000	A
PARP10	84875	genome.wustl.edu	37	8	145059977	145059977	+	Silent	SNP	C	C	G	rs201830961	byFrequency	TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr8:145059977C>G	ENST00000313028.7	-	3	442	c.348G>C	c.(346-348)tcG>tcC	p.S116S	PARP10_ENST00000533665.1_5'UTR|PARP10_ENST00000524918.1_Silent_p.S116S|PARP10_ENST00000525773.1_Silent_p.S128S	NM_032789.3	NP_116178.2	Q53GL7	PAR10_HUMAN	poly (ADP-ribose) polymerase family, member 10	116					negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of gene expression (GO:0010629)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein import into nucleus, translocation (GO:0033159)|negative regulation of protein K63-linked ubiquitination (GO:1900045)|negative regulation of viral genome replication (GO:0045071)|protein ADP-ribosylation (GO:0006471)|protein auto-ADP-ribosylation (GO:0070213)|protein poly-ADP-ribosylation (GO:0070212)|regulation of chromatin assembly (GO:0010847)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	K63-linked polyubiquitin binding (GO:0070530)|NAD+ ADP-ribosyltransferase activity (GO:0003950)			NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(5)|lung(9)|ovary(4)|pancreas(1)|upper_aerodigestive_tract(2)	27	all_cancers(97;8.2e-11)|all_epithelial(106;1.1e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.31e-40)|Epithelial(56;1.16e-39)|all cancers(56;6.43e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			CTGGGAGCCCCGAGGCCCGCA	0.697																																																	0													19.0	24.0	22.0					8																	145059977		2153	4261	6414	SO:0001819	synonymous_variant	0			AK027370	CCDS34960.1	8q24	2010-02-16				ENSG00000178685		"""Poly (ADP-ribose) polymerases"""	25895	protein-coding gene	gene with protein product		609564				15273990	Standard	NM_032789		Approved	FLJ14464	uc003zal.4	Q53GL7		ENST00000313028.7:c.348G>C	8.37:g.145059977C>G			Q8N2I0|Q8WV05|Q96CH7|Q96K72	Silent	SNP	pfam_Poly(ADP-ribose)pol_cat_dom,pfscan_Poly(ADP-ribose)pol_cat_dom	p.S116	ENST00000313028.7	37	c.348	CCDS34960.1	8																																																																																			PARP10	-	NULL	ENSG00000178685		0.697	PARP10-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PARP10	HGNC	protein_coding	OTTHUMT00000383866.1	-	0.00	28	0	C	NM_032789		145059977	-1	tier1	-	no_errors	ENST00000313028	ensembl	human	known	74_37	silent	17.14	29	6	SNP	0.001	G
PCDH19	57526	genome.wustl.edu	37	X	99661679	99661679	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chrX:99661679C>A	ENST00000373034.4	-	1	3592	c.1917G>T	c.(1915-1917)gaG>gaT	p.E639D	PCDH19_ENST00000420881.2_Missense_Mutation_p.E639D|PCDH19_ENST00000255531.7_Missense_Mutation_p.E639D	NM_001184880.1	NP_001171809.1	Q8TAB3	PCD19_HUMAN	protocadherin 19	639	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(5)|endometrium(11)|kidney(1)|large_intestine(14)|liver(1)|lung(23)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	68						CCACGATAAGCTCATAGGAGG	0.562																																																	0													58.0	60.0	59.0					X																	99661679		2060	4191	6251	SO:0001583	missense	0			AB037734	CCDS43976.1, CCDS48141.1, CCDS55462.1	Xq22.1	2014-06-28			ENSG00000165194	ENSG00000165194		"""Cadherins / Protocadherins : Non-clustered"""	14270	protein-coding gene	gene with protein product		300460	"""epilepsy, female restricted, with mental retardation (Juberg-Hellman syndrome)"""	EFMR		11549318, 18469813, 19752159	Standard	NM_020766		Approved	KIAA1313, EIEE9	uc010nmz.3	Q8TAB3	OTTHUMG00000022000	ENST00000373034.4:c.1917G>T	X.37:g.99661679C>A	ENSP00000362125:p.Glu639Asp		B0LDS4|E9PAM6|Q5JTG1|Q5JTG2|Q68DT7|Q9P2N3	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.E639D	ENST00000373034.4	37	c.1917	CCDS55462.1	X	.	.	.	.	.	.	.	.	.	.	C	13.76	2.333410	0.41297	.	.	ENSG00000165194	ENST00000420881;ENST00000373034;ENST00000255531	T;T;T	0.55413	0.52;0.52;0.52	5.84	3.78	0.43462	Cadherin (4);Cadherin-like (1);	0.050035	0.85682	D	0.000000	T	0.62245	0.2412	M	0.68593	2.085	0.49483	D	0.999794	P;D;D	0.59357	0.946;0.982;0.985	P;P;P	0.59115	0.741;0.769;0.852	T	0.57808	-0.7747	10	0.36615	T	0.2	.	8.8704	0.35311	0.0:0.7341:0.0:0.2659	.	639;639;639	Q8TAB3;Q8TAB3-2;E9PAM6	PCD19_HUMAN;.;.	D	639	ENSP00000400327:E639D;ENSP00000362125:E639D;ENSP00000255531:E639D	ENSP00000255531:E639D	E	-	3	2	PCDH19	99548335	1.000000	0.71417	1.000000	0.80357	0.920000	0.55202	1.276000	0.33156	0.400000	0.25396	0.513000	0.50165	GAG	PCDH19	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000165194		0.562	PCDH19-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PCDH19	HGNC	protein_coding	OTTHUMT00000057479.2	-	0.00	20	0	C	NM_020766		99661679	-1	tier1	-	no_errors	ENST00000373034	ensembl	human	known	74_37	missense	57.14	9	12	SNP	1.000	A
PKD2	5311	genome.wustl.edu	37	4	88929174	88929176	+	In_Frame_Del	DEL	GAG	GAG	-			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	GAG	GAG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr4:88929174_88929176delGAG	ENST00000237596.2	+	1	355_357	c.289_291delGAG	c.(289-291)gagdel	p.E102del		NM_000297.3	NP_000288.1	Q9BZL6	KPCD2_HUMAN	polycystic kidney disease 2 (autosomal dominant)	0					angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell death (GO:0008219)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|endothelial tube morphogenesis (GO:0061154)|intracellular signal transduction (GO:0035556)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell adhesion (GO:0045785)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of endothelial cell chemotaxis (GO:2001028)|positive regulation of endothelial cell chemotaxis by VEGF-activated vascular endothelial growth factor receptor signaling pathway (GO:0038033)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of histone deacetylase activity (GO:1901727)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of intracellular signal transduction (GO:1902533)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of T cell receptor signaling pathway (GO:0050862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|T cell receptor signaling pathway (GO:0050852)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|endometrium(4)|kidney(1)|large_intestine(8)|liver(2)|lung(15)|skin(4)|upper_aerodigestive_tract(1)	36		Hepatocellular(203;0.114)|Acute lymphoblastic leukemia(40;0.221)		OV - Ovarian serous cystadenocarcinoma(123;9.98e-10)|COAD - Colon adenocarcinoma(81;0.0237)		CTTCGAGGCCgaggaggaggagg	0.739																																																	0										18,82,2250		6,0,6,18,46,1099						-3.4	0.9			2	8,117,4707		2,0,4,14,89,2307	no	codingComplex	PKD2	NM_000297.3		8,0,10,32,135,3406	A1A1,A1A2,A1R,A2A2,A2R,RR		2.5869,4.2553,3.1328				26,199,6957				SO:0001651	inframe_deletion	0			U50928	CCDS3627.1	4q22.1	2014-01-28			ENSG00000118762	ENSG00000118762		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""EF-hand domain containing"""	9009	protein-coding gene	gene with protein product	"""transient receptor potential cation channel, subfamily P, member 2"""	173910				8298643	Standard	NM_000297		Approved	PKD4, PC2, Pc-2, TRPP2	uc003hre.3	Q13563	OTTHUMG00000160982	ENST00000237596.2:c.289_291delGAG	4.37:g.88929183_88929185delGAG	ENSP00000237596:p.Glu102del		Q8TB08|Q9P0T6|Q9Y3X8	In_Frame_Del	DEL	pfam_PKD1_2_channel,pfam_Ion_trans_dom,pfscan_EF_hand_dom,prints_PKD_2,prints_PKD_1	p.E100in_frame_del	ENST00000237596.2	37	c.289_291	CCDS3627.1	4																																																																																			PKD2	-	NULL	ENSG00000118762		0.739	PKD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PKD2	HGNC	protein_coding	OTTHUMT00000253042.4		0.00	30	0	GAG	NM_000297		88929176	+1	tier1		no_errors	ENST00000237596	ensembl	human	known	74_37	in_frame_del	10.26	35	4	DEL	1.000:1.000:1.000	-
PKDREJ	10343	genome.wustl.edu	37	22	46652641	46652641	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr22:46652641C>T	ENST00000253255.5	-	1	6578	c.6579G>A	c.(6577-6579)atG>atA	p.M2193I		NM_006071.1	NP_006062.1	Q9NTG1	PKDRE_HUMAN	polycystin (PKD) family receptor for egg jelly	2193					acrosome reaction (GO:0007340)|calcium ion transmembrane transport (GO:0070588)|detection of mechanical stimulus (GO:0050982)|neuropeptide signaling pathway (GO:0007218)|regulation of acrosome reaction (GO:0060046)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)			NS(2)|breast(7)|central_nervous_system(1)|cervix(3)|endometrium(4)|kidney(5)|large_intestine(21)|lung(16)|ovary(2)|prostate(6)|skin(4)|upper_aerodigestive_tract(2)	73		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00459)		ACAAATAGGTCATTGCTTCCA	0.458																																																	0													109.0	89.0	95.0					22																	46652641		2203	4300	6503	SO:0001583	missense	0			AF116458	CCDS14073.1	22q13.31	2013-07-31	2013-07-31		ENSG00000130943	ENSG00000130943			9015	protein-coding gene	gene with protein product		604670	"""polycystic kidney disease (polycystin) and REJ (sperm receptor for egg jelly, sea urchin homolog)-like"", ""polycystic kidney disease (polycystin) and REJ (sperm receptor for egg jelly homolog, sea urchin)-like"", ""polycystic kidney disease (polycystin) and REJ homolog (sperm receptor for egg jelly homolog, sea urchin)"""			9949214, 10591208	Standard	NM_006071		Approved		uc003bhh.3	Q9NTG1	OTTHUMG00000150493	ENST00000253255.5:c.6579G>A	22.37:g.46652641C>T	ENSP00000253255:p.Met2193Ile		B1AJY3|O95850	Missense_Mutation	SNP	pfam_PKD1_2_channel,pfam_PKD/REJ-like,pfam_PLAT/LH2_dom,pfam_Ion_trans_dom,superfamily_Lipase_LipOase,smart_GPS_dom,smart_PLAT/LH2_dom,pfscan_PLAT/LH2_dom,pfscan_REJ-like,prints_PKD_2	p.M2193I	ENST00000253255.5	37	c.6579	CCDS14073.1	22	.	.	.	.	.	.	.	.	.	.	C	1.948	-0.441930	0.04604	.	.	ENSG00000130943	ENST00000253255	T	0.32753	1.44	5.56	0.245	0.15512	.	0.524714	0.20467	N	0.091764	T	0.11836	0.0288	N	0.17082	0.46	0.09310	N	1	B	0.22276	0.067	B	0.15052	0.012	T	0.19289	-1.0310	10	0.11485	T	0.65	-31.7556	1.9557	0.03375	0.1309:0.3817:0.2796:0.2078	.	2193	Q9NTG1	PKDRE_HUMAN	I	2193	ENSP00000253255:M2193I	ENSP00000253255:M2193I	M	-	3	0	PKDREJ	45031305	0.005000	0.15991	0.014000	0.15608	0.012000	0.07955	-0.460000	0.06720	0.194000	0.20326	0.557000	0.71058	ATG	PKDREJ	-	NULL	ENSG00000130943		0.458	PKDREJ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PKDREJ	HGNC	protein_coding	OTTHUMT00000318466.1	-	0.00	28	0	C	NM_006071		46652641	-1	tier1	-	no_errors	ENST00000253255	ensembl	human	known	74_37	missense	56.00	11	14	SNP	0.000	T
PLCB1	23236	genome.wustl.edu	37	20	8741066	8741066	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr20:8741066C>T	ENST00000338037.6	+	25	2696	c.2669C>T	c.(2668-2670)gCa>gTa	p.A890V	PLCB1_ENST00000378641.3_Missense_Mutation_p.A890V|PLCB1_ENST00000494924.1_3'UTR|PLCB1_ENST00000378637.2_Missense_Mutation_p.A890V	NM_015192.2	NP_056007.1	Q9NQ66	PLCB1_HUMAN	phospholipase C, beta 1 (phosphoinositide-specific)	890					activation of meiosis involved in egg activation (GO:0060466)|cerebral cortex development (GO:0021987)|fat cell differentiation (GO:0045444)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|G2/M transition of mitotic cell cycle (GO:0000086)|glutamate receptor signaling pathway (GO:0007215)|inositol phosphate metabolic process (GO:0043647)|insulin-like growth factor receptor signaling pathway (GO:0048009)|interleukin-1-mediated signaling pathway (GO:0070498)|interleukin-12-mediated signaling pathway (GO:0035722)|interleukin-15-mediated signaling pathway (GO:0035723)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|memory (GO:0007613)|negative regulation of monocyte extravasation (GO:2000438)|negative regulation of transcription, DNA-templated (GO:0045892)|phosphatidylinositol metabolic process (GO:0046488)|positive regulation of acrosome reaction (GO:2000344)|positive regulation of CD24 biosynthetic process (GO:2000560)|positive regulation of developmental growth (GO:0048639)|positive regulation of embryonic development (GO:0040019)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of GTPase activity (GO:0043547)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of JNK cascade (GO:0046330)|positive regulation of myoblast differentiation (GO:0045663)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of fertilization (GO:0080154)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|GTPase activator activity (GO:0005096)|phosphatidylinositol phospholipase C activity (GO:0004435)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein homodimerization activity (GO:0042803)|signal transducer activity (GO:0004871)			NS(2)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(11)|liver(2)|lung(41)|ovary(4)|prostate(3)|skin(12)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(4)	95						TCTGTAAAGGCACCTGCCAAA	0.358																																																	0													50.0	49.0	49.0					20																	8741066		2203	4300	6503	SO:0001583	missense	0			AB011153	CCDS13102.1, CCDS13103.1	20p12	2008-03-18			ENSG00000182621	ENSG00000182621	3.1.4.11		15917	protein-coding gene	gene with protein product		607120				10760467, 11118617	Standard	NM_015192		Approved	KIAA0581, PLC-I, PLC154	uc002wnb.4	Q9NQ66	OTTHUMG00000031849	ENST00000338037.6:c.2669C>T	20.37:g.8741066C>T	ENSP00000338185:p.Ala890Val		D3DW12|D3DW13|O60325|Q17RQ6|Q5TFF7|Q5TGC9|Q8IV93|Q9BQW2|Q9H4H2|Q9H8H5|Q9NQ65|Q9NQH9|Q9NTH4|Q9UJP6|Q9UM26	Missense_Mutation	SNP	pirsf_PLC-beta,pfam_PLC-beta_C,pfam_PLipase_C_PInositol-sp_X_dom,pfam_PLipase_C_Pinositol-sp_Y,pfam_PLipase_C_EF-hand-like,superfamily_PLC-like_Pdiesterase_TIM-brl,superfamily_C2_dom,smart_PLipase_C_PInositol-sp_X_dom,smart_PLipase_C_Pinositol-sp_Y,smart_C2_dom,prints_Pinositol_PLipase_C,pfscan_C2_dom,pfscan_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_Pinositol-sp_Y	p.A890V	ENST00000338037.6	37	c.2669	CCDS13102.1	20	.	.	.	.	.	.	.	.	.	.	C	16.58	3.161772	0.57368	.	.	ENSG00000182621	ENST00000378641;ENST00000338037;ENST00000378637;ENST00000441163;ENST00000535719	T;T;T	0.19669	2.13;2.13;2.13	6.07	6.07	0.98685	.	0.174068	0.51477	D	0.000083	T	0.08802	0.0218	N	0.02011	-0.69	0.36992	D	0.894842	B;B	0.06786	0.001;0.0	B;B	0.09377	0.001;0.004	T	0.24333	-1.0163	10	0.38643	T	0.18	.	10.8974	0.47031	0.0:0.8615:0.0:0.1385	.	890;890	Q9NQ66;Q9NQ66-2	PLCB1_HUMAN;.	V	890;890;890;810;810	ENSP00000367908:A890V;ENSP00000338185:A890V;ENSP00000367904:A890V	ENSP00000338185:A890V	A	+	2	0	PLCB1	8689066	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.333000	0.59285	2.885000	0.99019	0.655000	0.94253	GCA	PLCB1	-	pirsf_PLC-beta	ENSG00000182621		0.358	PLCB1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PLCB1	HGNC	protein_coding	OTTHUMT00000077938.3	-	0.00	67	0	C			8741066	+1	tier1	-	no_errors	ENST00000338037	ensembl	human	known	74_37	missense	16.92	54	11	SNP	1.000	T
PLCG1	5335	genome.wustl.edu	37	20	39800921	39800922	+	Frame_Shift_Ins	INS	-	-	G	rs367697370		TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr20:39800921_39800922insG	ENST00000373271.1	+	25	3302_3303	c.2897_2898insG	c.(2896-2901)gatgaafs	p.DE966fs	PLCG1_ENST00000244007.3_Frame_Shift_Ins_p.DE966fs|PLCG1_ENST00000373272.2_Frame_Shift_Ins_p.DE966fs	NM_182811.1	NP_877963.1	P19174	PLCG1_HUMAN	phospholipase C, gamma 1	966	PI-PLC Y-box. {ECO:0000255|PROSITE- ProRule:PRU00271}.				activation of MAPKK activity (GO:0000186)|activation of phospholipase C activity (GO:0007202)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium-mediated signaling (GO:0019722)|cell migration (GO:0016477)|cellular response to epidermal growth factor stimulus (GO:0071364)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|inositol phosphate metabolic process (GO:0043647)|leukocyte migration (GO:0050900)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phospholipid catabolic process (GO:0009395)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|T cell receptor signaling pathway (GO:0050852)|viral process (GO:0016032)	cell projection (GO:0042995)|cell-cell junction (GO:0005911)|COP9 signalosome (GO:0008180)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	calcium ion binding (GO:0005509)|neurotrophin TRKA receptor binding (GO:0005168)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|protein kinase binding (GO:0019901)|receptor signaling protein activity (GO:0005057)			breast(5)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(16)|skin(6)|urinary_tract(2)	46		Myeloproliferative disorder(115;0.00878)				GTTCCCTTTGATGAAGAGAGTA	0.559																																																	0																																										SO:0001589	frameshift_variant	0			M34667	CCDS13313.1, CCDS13314.1	20q12-q13.1	2013-02-14	2004-01-29		ENSG00000124181	ENSG00000124181	3.1.4.11	"""Pleckstrin homology (PH) domain containing"", ""EF-hand domain containing"", ""SH2 domain containing"""	9065	protein-coding gene	gene with protein product		172420	"""phospholipase C, gamma 1 (formerly subtype 148)"""	PLC1		2167438, 3254788	Standard	NM_182811		Approved	PLC148, PLC-II, PLCgamma1, NCKAP3	uc002xjo.1	P19174	OTTHUMG00000033082	Exception_encountered	20.37:g.39800921_39800922insG	ENSP00000362368:p.Asp966fs		B7ZLY7|B9EGH4|E1P5W4|Q2V575	Frame_Shift_Ins	INS	pfam_PLipase_C_PInositol-sp_X_dom,pfam_SH2,pfam_PLipase_C_Pinositol-sp_Y,pfam_Pleckstrin_homology,pfam_C2_dom,pfam_SH3_domain,pfam_SH3_2,pfam_PLipase_C_EF-hand-like,superfamily_PLC-like_Pdiesterase_TIM-brl,superfamily_C2_dom,superfamily_SH3_domain,smart_Pleckstrin_homology,smart_PLipase_C_PInositol-sp_X_dom,smart_SH2,smart_SH3_domain,smart_PLipase_C_Pinositol-sp_Y,smart_C2_dom,pirsf_PLC-gamma,pfscan_EF_hand_dom,pfscan_C2_dom,pfscan_Pleckstrin_homology,pfscan_SH2,pfscan_SH3_domain,pfscan_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_Pinositol-sp_Y,prints_Pinositol_PLipase_C,prints_SH2	p.D966fs	ENST00000373271.1	37	c.2897_2898	CCDS13314.1	20																																																																																			PLCG1	-	pfam_PLipase_C_Pinositol-sp_Y,superfamily_PLC-like_Pdiesterase_TIM-brl,smart_PLipase_C_Pinositol-sp_Y,pirsf_PLC-gamma,pfscan_PLipase_C_Pinositol-sp_Y	ENSG00000124181		0.559	PLCG1-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	PLCG1	HGNC	protein_coding	OTTHUMT00000080514.3		0.00	71	0	-	NM_182811		39800922	+1	tier1		no_errors	ENST00000244007	ensembl	human	known	74_37	frame_shift_ins	12.90	54	8	INS	0.999:0.993	G
PLOD1	5351	genome.wustl.edu	37	1	12008070	12008070	+	Silent	SNP	C	C	T	rs11553679		TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr1:12008070C>T	ENST00000196061.4	+	2	141	c.114C>T	c.(112-114)acC>acT	p.T38T	PLOD1_ENST00000376369.3_Silent_p.T85T|PLOD1_ENST00000485046.1_3'UTR	NM_000302.3	NP_000293.2	Q02809	PLOD1_HUMAN	procollagen-lysine, 2-oxoglutarate 5-dioxygenase 1	38					cellular protein modification process (GO:0006464)|epidermis development (GO:0008544)|extracellular matrix organization (GO:0030198)|hydroxylysine biosynthetic process (GO:0046947)|oxidation-reduction process (GO:0055114)|response to hypoxia (GO:0001666)	endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)	iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|procollagen-lysine 5-dioxygenase activity (GO:0008475)|protein homodimerization activity (GO:0042803)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(15)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)	29	Ovarian(185;0.249)	Lung NSC(185;8.69e-05)|all_lung(284;9.87e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.06e-06)|COAD - Colon adenocarcinoma(227;0.000273)|BRCA - Breast invasive adenocarcinoma(304;0.000311)|Kidney(185;0.000809)|KIRC - Kidney renal clear cell carcinoma(229;0.00267)|STAD - Stomach adenocarcinoma(313;0.00743)|READ - Rectum adenocarcinoma(331;0.0649)	Succinic acid(DB00139)|Vitamin C(DB00126)	CTAAGGAGACCGAGGGATTCC	0.557																																																	0													155.0	138.0	143.0					1																	12008070		2203	4300	6503	SO:0001819	synonymous_variant	0			BC016657	CCDS142.1	1p36.22	2011-08-25	2011-08-24	2004-12-14	ENSG00000083444	ENSG00000083444	1.14.11.4		9081	protein-coding gene	gene with protein product	"""lysyl hydroxlase 1"""	153454	"""procollagen-lysine 1, 2-oxoglutarate 5-dioxygenase (lysine hydroxylase, Ehlers-Danlos syndrome type VI)"""	LLH, PLOD		1577494	Standard	NM_000302		Approved	LH1	uc001atm.3	Q02809	OTTHUMG00000002393	ENST00000196061.4:c.114C>T	1.37:g.12008070C>T			B4DR87|Q96AV9|Q9H132	Silent	SNP	pfam_Oxoglu/Fe-dep_dioxygenase,smart_Pro_4_hyd_alph	p.T85	ENST00000196061.4	37	c.255	CCDS142.1	1																																																																																			PLOD1	-	NULL	ENSG00000083444		0.557	PLOD1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PLOD1	HGNC	protein_coding	OTTHUMT00000006865.1	-	0.00	106	0	C	NM_000302		12008070	+1	tier1	-	no_errors	ENST00000376369	ensembl	human	known	74_37	silent	25.61	61	21	SNP	0.000	T
PLXNB2	23654	genome.wustl.edu	37	22	50722588	50722589	+	Nonsense_Mutation	DNP	CG	CG	AT	rs532944576|rs551050919		TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	C|G	C|G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr22:50722588_50722589CG>AT	ENST00000449103.1	-	13	2375_2376	c.2235_2236CG>AT	c.(2233-2238)taCGgc>taATgc	p.745_746YG>*C	PLXNB2_ENST00000496720.1_5'UTR|PLXNB2_ENST00000359337.4_Nonsense_Mutation_p.745_746YG>*C			O15031	PLXB2_HUMAN	plexin B2	745					brain development (GO:0007420)|neural tube closure (GO:0001843)|neuroblast proliferation (GO:0007405)|positive regulation of axonogenesis (GO:0050772)|regulation of cell shape (GO:0008360)|regulation of neuron migration (GO:2001222)|regulation of protein phosphorylation (GO:0001932)|regulation of Rho GTPase activity (GO:0032319)|semaphorin-plexin signaling pathway (GO:0071526)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)	GTPase activator activity (GO:0005096)|semaphorin receptor activity (GO:0017154)	p.Y788Y(1)|p.G789S(1)		breast(2)|central_nervous_system(4)|cervix(2)|endometrium(11)|kidney(4)|large_intestine(3)|liver(1)|lung(20)|ovary(5)|prostate(6)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	66		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		ATATTCTTGCCGTAAGACTTGA	0.678																																																	2	Substitution - Missense(1)|Substitution - coding silent(1)	prostate(1)|endometrium(1)																																								SO:0001587	stop_gained	0				CCDS43035.1	22q13.33	2008-06-12			ENSG00000196576	ENSG00000196576		"""Plexins"""	9104	protein-coding gene	gene with protein product		604293				10520995, 12183458	Standard	NM_012401		Approved	MM1, KIAA0315, PLEXB2	uc003bkv.4	O15031	OTTHUMG00000150219	ENST00000449103.1:c.2235_2236delinsAT	22.37:g.50722588_50722589delinsAT	ENSP00000409171:p.Y745_G746delins*C		A6QRH0|Q7KZU3|Q9BSU7	Missense_Mutation|Nonsense_Mutation	SNP	pfam_Plexin_cytoplasmic_RasGAP_dom,pfam_IPT,pfam_Semap_dom,pfam_Plexin_repeat,superfamily_Semap_dom,superfamily_Rho_GTPase_activation_prot,superfamily_Ig_E-set,superfamily_Plexin-like_fold,smart_Semap_dom,smart_Plexin-like_fold,smart_IPT,pfscan_Semap_dom	p.G746C|p.Y745*	ENST00000449103.1	37	c.2236|c.2235	CCDS43035.1	22																																																																																			PLXNB2	-	NULL	ENSG00000196576		0.678	PLXNB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLXNB2	HGNC	protein_coding	OTTHUMT00000316874.3		0.00	163|165	0	C|G	NM_012401		50722588|50722589	-1			no_errors	ENST00000359337	ensembl	human	known	74_37	missense|nonsense	5.26|6.78	54|55	3|4	SNP	0.725|0.034	A|T
PMS1	5378	genome.wustl.edu	37	2	190732645	190732645	+	Silent	SNP	A	A	G			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr2:190732645A>G	ENST00000441310.2	+	11	2696	c.2463A>G	c.(2461-2463)aaA>aaG	p.K821K	PMS1_ENST00000447232.2_Silent_p.K659K|PMS1_ENST00000418224.3_Silent_p.K645K|PMS1_ENST00000409823.3_Silent_p.K782K|PMS1_ENST00000432292.3_Silent_p.K645K	NM_000534.4	NP_000525.1	P54277	PMS1_HUMAN	PMS1 postmeiotic segregation increased 1 (S. cerevisiae)	821					ATP catabolic process (GO:0006200)|mismatch repair (GO:0006298)|response to drug (GO:0042493)	MutLalpha complex (GO:0032389)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|mismatched DNA binding (GO:0030983)|single-stranded DNA binding (GO:0003697)			breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(5)|lung(16)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	36			OV - Ovarian serous cystadenocarcinoma(117;0.0013)|Epithelial(96;0.0263)|all cancers(119;0.0751)			TCAAGATAAAATTGATACCAG	0.338			"""Mis, N"""			"""colorectal, endometrial, ovarian"""		Direct reversal of damage;Mismatch excision repair (MMR)																															yes	Rec		Hereditary non-polyposis colorectal cancer	2	2q31-q33	5378	PMS1 postmeiotic segregation increased 1 (S. cerevisiae)		E	0													113.0	114.0	114.0					2																	190732645		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS2302.1, CCDS46473.1, CCDS46474.1, CCDS74615.1	2q31-q33	2014-09-17	2001-11-28		ENSG00000064933	ENSG00000064933			9121	protein-coding gene	gene with protein product		600258	"""postmeiotic segregation increased (S. cerevisiae) 1"""	PMSL1		8072530	Standard	NM_000534		Approved		uc002urh.4	P54277	OTTHUMG00000132664	ENST00000441310.2:c.2463A>G	2.37:g.190732645A>G			D3DPI1|Q4VAL4|Q5FBZ3|Q5FBZ6|Q5FBZ8	Silent	SNP	pfam_DNA_mismatch_repair_C,pfam_HMG_box_dom,pfam_HATPase_ATP-bd,superfamily_HATPase_ATP-bd,superfamily_Ribosomal_S5_D2-typ_fold,superfamily_HMG_box_dom,smart_HMG_box_dom,pfscan_HMG_box_dom,tigrfam_DNA_mismatch_repair_N	p.K821	ENST00000441310.2	37	c.2463	CCDS2302.1	2																																																																																			PMS1	-	NULL	ENSG00000064933		0.338	PMS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PMS1	HGNC	protein_coding	OTTHUMT00000255918.2	-	0.00	43	0	A			190732645	+1	tier1	-	no_errors	ENST00000441310	ensembl	human	known	74_37	silent	21.05	45	12	SNP	0.909	G
PNISR	25957	genome.wustl.edu	37	6	99848035	99848036	+	3'UTR	INS	-	-	AA			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr6:99848035_99848036insAA	ENST00000369239.5	-	0	3002_3003				PNISR_ENST00000438806.1_3'UTR	NM_032870.2	NP_116259.2	Q8TF01	PNISR_HUMAN	PNN-interacting serine/arginine-rich protein							cytoplasm (GO:0005737)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(2)|cervix(1)|endometrium(3)|large_intestine(5)|lung(8)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	24						ATTTACAGATTAAAAAAAAAAA	0.307																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AK027759	CCDS5043.1	6q16.3	2011-06-06	2011-06-06	2011-06-06	ENSG00000132424	ENSG00000132424			21222	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 111"", ""splicing factor, arginine/serine-rich 18"""	C6orf111, SFRS18		14578391	Standard	NM_032870		Approved	FLJ14752, bA98I9.2, DKFZp564B0769, SRrp130	uc021zdd.1	Q8TF01	OTTHUMG00000015262	ENST00000369239.5:c.*381->TT	6.37:g.99848044_99848045dupAA			A8K540|E1P5D2|Q5T064|Q5T065|Q6P2B4|Q6P2N4|Q6PJ93|Q6PK36|Q7Z640|Q8N2L1|Q8TF00|Q96K10|Q96SI3|Q96SM5|Q9P076|Q9P0C0|Q9Y4N3	RNA	INS	-	NULL	ENST00000369239.5	37	NULL	CCDS5043.1	6																																																																																			PNISR	-	-	ENSG00000132424		0.307	PNISR-007	KNOWN	basic|appris_principal|CCDS	protein_coding	PNISR	HGNC	protein_coding	OTTHUMT00000041598.1		0.00	28	0	-	NM_032870		99848036	-1	tier1		no_errors	ENST00000481229	ensembl	human	known	74_37	rna	14.29	30	5	INS	0.988:0.986	AA
TMEM199	147007	genome.wustl.edu	37	17	26684529	26684529	+	5'Flank	DEL	G	G	-	rs113967755		TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr17:26684529delG	ENST00000292114.3	+	0	0				TMEM199_ENST00000509083.1_5'Flank|POLDIP2_ENST00000540200.1_5'Flank|POLDIP2_ENST00000003607.4_5'UTR|CTB-96E2.3_ENST00000591482.1_RNA|TMEM199_ENST00000395404.3_5'Flank	NM_152464.1	NP_689677.1	Q8N511	TM199_HUMAN	transmembrane protein 199							integral component of membrane (GO:0016021)				endometrium(1)|kidney(2)|large_intestine(1)|lung(2)	6	all_lung(13;0.000354)|Lung NSC(42;0.00115)			UCEC - Uterine corpus endometrioid carcinoma (53;0.153)		GCGGCCGGGCGGTTCCGCCCC	0.771																																																	0																																										SO:0001631	upstream_gene_variant	0			AY074907	CCDS11228.1	17q11.2	2007-12-17	2007-12-17	2007-12-17	ENSG00000244045	ENSG00000244045			18085	protein-coding gene	gene with protein product			"""chromosome 17 open reading frame 32"""	C17orf32			Standard	NM_152464		Approved	MGC45714	uc002hba.3	Q8N511	OTTHUMG00000132498		17.37:g.26684529delG	Exception_encountered			RNA	DEL	-	NULL	ENST00000292114.3	37	NULL	CCDS11228.1	17																																																																																			POLDIP2	-	-	ENSG00000004142		0.771	TMEM199-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POLDIP2	HGNC	protein_coding	OTTHUMT00000255676.2		0.00	8	0	G	NM_152464		26684529	-1	tier1		no_errors	ENST00000003607	ensembl	human	known	74_37	rna	54.55	5	6	DEL	0.993	-
POLR3K	51728	genome.wustl.edu	37	16	97516	97516	+	Nonsense_Mutation	SNP	G	G	A			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr16:97516G>A	ENST00000293860.5	-	3	282	c.241C>T	c.(241-243)Cag>Tag	p.Q81*		NM_016310.3	NP_057394.2	Q9Y2Y1	RPC10_HUMAN	polymerase (RNA) III (DNA directed) polypeptide K, 12.3 kDa	81					defense response to virus (GO:0051607)|gene expression (GO:0010467)|innate immune response (GO:0045087)|positive regulation of type I interferon production (GO:0032481)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase III promoter (GO:0006383)	cytosol (GO:0005829)|DNA-directed RNA polymerase III complex (GO:0005666)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|zinc ion binding (GO:0008270)			central_nervous_system(1)|large_intestine(1)|skin(1)	3		all_cancers(16;9.01e-08)|all_epithelial(16;7.64e-07)|Hepatocellular(780;0.000325)|Lung NSC(18;0.0104)|all_lung(18;0.0239)				GTCTGAAGCTGCATGAAGTAA	0.507																																																	0													94.0	80.0	85.0					16																	97516		2203	4300	6503	SO:0001587	stop_gained	0			AF051316	CCDS10395.1	16p13.3	2013-01-21	2002-08-29		ENSG00000161980	ENSG00000161980		"""RNA polymerase subunits"""	14121	protein-coding gene	gene with protein product		606007	"""polymerase (RNA) III (DNA directed) polypeptide K (12.3 kDa)"""			9869639, 10079944	Standard	NM_016310		Approved	RPC11	uc002cfi.2	Q9Y2Y1	OTTHUMG00000060722	ENST00000293860.5:c.241C>T	16.37:g.97516G>A	ENSP00000293860:p.Gln81*		Q1W6H4|Q96S35	Nonsense_Mutation	SNP	pfam_Znf_TFIIS,pfam_DNA-dir_RNA_pol_M/15kDasu,smart_DNA-dir_RNA_pol_M/15kDasu,smart_Znf_TFIIS,pfscan_Znf_TFIIS	p.Q81*	ENST00000293860.5	37	c.241	CCDS10395.1	16	.	.	.	.	.	.	.	.	.	.	.	24.0	4.482338	0.84747	.	.	ENSG00000161980	ENST00000293860	.	.	.	4.59	3.63	0.41609	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-31.8494	11.9106	0.52737	0.0871:0.0:0.9129:0.0	.	.	.	.	X	81	.	ENSP00000293860:Q81X	Q	-	1	0	POLR3K	37516	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	8.209000	0.89751	1.085000	0.41206	0.449000	0.29647	CAG	POLR3K	-	pfam_Znf_TFIIS,smart_Znf_TFIIS,pfscan_Znf_TFIIS	ENSG00000161980		0.507	POLR3K-001	KNOWN	mRNA_start_NF|basic|appris_principal|CCDS	protein_coding	POLR3K	HGNC	protein_coding	OTTHUMT00000134192.1	-	0.00	35	0	G	NM_016310		97516	-1	tier1	-	no_errors	ENST00000293860	ensembl	human	known	74_37	nonsense	7.14	52	4	SNP	1.000	A
PRDM9	56979	genome.wustl.edu	37	5	23527403	23527403	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr5:23527403C>A	ENST00000296682.3	+	11	2388	c.2206C>A	c.(2206-2208)Ctc>Atc	p.L736I		NM_020227.2	NP_064612.2	Q9NQV7	PRDM9_HUMAN	PR domain containing 9	736					meiotic gene conversion (GO:0006311)|positive regulation of meiosis I (GO:0060903)|positive regulation of reciprocal meiotic recombination (GO:0010845)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)	histone methyltransferase activity (H3-K4 specific) (GO:0042800)|metal ion binding (GO:0046872)|recombination hotspot binding (GO:0010844)|sequence-specific DNA binding (GO:0043565)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(27)|lung(87)|ovary(6)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(11)	172						GTCACACCTCCTCAGACACCA	0.587										HNSCC(3;0.000094)																																							0													19.0	22.0	21.0					5																	23527403		2036	4142	6178	SO:0001583	missense	0			AF275816	CCDS43307.1	5p14.2	2014-06-03			ENSG00000164256	ENSG00000164256		"""-"", ""Zinc fingers, C2H2-type"""	13994	protein-coding gene	gene with protein product	"""PR-domain containing protein 9"""	609760	"""minisatellite binding protein 3, 115kDa"", ""minisatellite binding protein 3 (115kD)"""	MSBP3		10668202, 2062643, 24634223	Standard	NM_020227		Approved	PFM6, ZNF899	uc003jgo.3	Q9NQV7	OTTHUMG00000161918	ENST00000296682.3:c.2206C>A	5.37:g.23527403C>A	ENSP00000296682:p.Leu736Ile		B4DX22|Q27Q50	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_SSXRD_motif,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_SET_dom,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box,pfscan_Krueppel-associated_box-rel	p.L736I	ENST00000296682.3	37	c.2206	CCDS43307.1	5	.	.	.	.	.	.	.	.	.	.	C	0.001	-3.106164	0.00033	.	.	ENSG00000164256	ENST00000296682	T	0.19105	2.17	3.0	-3.9	0.04181	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.05914	0.0154	N	0.03930	-0.32	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.39143	-0.9628	9	0.02654	T	1	.	5.9235	0.19096	0.2102:0.5151:0.0:0.2747	.	736	Q9NQV7	PRDM9_HUMAN	I	736	ENSP00000296682:L736I	ENSP00000296682:L736I	L	+	1	0	PRDM9	23563160	0.000000	0.05858	0.014000	0.15608	0.003000	0.03518	-3.971000	0.00322	-0.720000	0.04935	-0.347000	0.07816	CTC	PRDM9	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000164256		0.587	PRDM9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRDM9	HGNC	protein_coding	OTTHUMT00000366375.1	-	0.00	78	0	C	NM_020227		23527403	+1	tier1	-	no_errors	ENST00000296682	ensembl	human	known	74_37	missense	18.18	63	14	SNP	0.002	A
PRG3	10394	genome.wustl.edu	37	11	57147010	57147010	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr11:57147010C>T	ENST00000287143.2	-	3	441	c.332G>A	c.(331-333)cGc>cAc	p.R111H		NM_006093.3	NP_006084.2	Q8TBJ4	LPPR1_HUMAN	proteoglycan 3	0					nervous system development (GO:0007399)	integral component of membrane (GO:0016021)	catalytic activity (GO:0003824)			large_intestine(3)|lung(5)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	13						CAATAGGTAGCGGCAGATCTT	0.532																																					Melanoma(154;1456 2519 19358 45229)												0													128.0	126.0	127.0					11																	57147010		2201	4296	6497	SO:0001583	missense	0			AF132209	CCDS7954.1	11q12.1	2008-02-05			ENSG00000156575	ENSG00000156575			9363	protein-coding gene	gene with protein product		606814				10318872, 11170744	Standard	NM_006093		Approved	MBPH	uc001njv.2	Q9Y2Y8	OTTHUMG00000167026	ENST00000287143.2:c.332G>A	11.37:g.57147010C>T	ENSP00000287143:p.Arg111His		Q5VX23|Q9NXE2	Missense_Mutation	SNP	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin,prints_Eosinophil_major_basic	p.R111H	ENST00000287143.2	37	c.332	CCDS7954.1	11	.	.	.	.	.	.	.	.	.	.	C	8.927	0.962469	0.18583	.	.	ENSG00000156575	ENST00000287143	T	0.39787	1.06	5.27	-10.5	0.00291	C-type lectin fold (1);C-type lectin (1);	1.246370	0.05475	N	0.553753	T	0.31009	0.0783	L	0.49455	1.56	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.23904	-1.0175	10	0.15066	T	0.55	-0.2423	12.365	0.55224	0.0:0.3303:0.0792:0.5905	.	111	Q9Y2Y8	PRG3_HUMAN	H	111	ENSP00000287143:R111H	ENSP00000287143:R111H	R	-	2	0	PRG3	56903586	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-4.435000	0.00234	-3.785000	0.00107	-2.153000	0.00332	CGC	PRG3	-	superfamily_C-type_lectin_fold,smart_C-type_lectin	ENSG00000156575		0.532	PRG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRG3	HGNC	protein_coding	OTTHUMT00000392467.1	-	0.00	63	0	C	NM_006093		57147010	-1	tier1	-	no_errors	ENST00000287143	ensembl	human	known	74_37	missense	25.00	36	12	SNP	0.000	T
RAB10	10890	genome.wustl.edu	37	2	26350815	26350815	+	Nonsense_Mutation	SNP	C	C	T			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr2:26350815C>T	ENST00000264710.4	+	5	1013	c.514C>T	c.(514-516)Cga>Tga	p.R172*	RAB10_ENST00000462003.1_3'UTR	NM_016131.4	NP_057215.3	P61026	RAB10_HUMAN	RAB10, member RAS oncogene family	172					antigen processing and presentation (GO:0019882)|axonogenesis (GO:0007409)|basolateral protein localization (GO:0061467)|cellular response to insulin stimulus (GO:0032869)|endoplasmic reticulum tubular network organization (GO:0071786)|endosomal transport (GO:0016197)|establishment of neuroblast polarity (GO:0045200)|establishment of protein localization to endoplasmic reticulum membrane (GO:0097051)|establishment of protein localization to membrane (GO:0090150)|Golgi to plasma membrane protein transport (GO:0043001)|Golgi to plasma membrane transport (GO:0006893)|GTP catabolic process (GO:0006184)|membrane organization (GO:0061024)|polarized epithelial cell differentiation (GO:0030859)|protein localization to plasma membrane (GO:0072659)|small GTPase mediated signal transduction (GO:0007264)|vesicle-mediated transport (GO:0016192)	cytoplasmic vesicle membrane (GO:0030659)|endoplasmic reticulum membrane (GO:0005789)|endoplasmic reticulum tubular network (GO:0071782)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|insulin-responsive compartment (GO:0032593)|primary cilium (GO:0072372)|recycling endosome (GO:0055037)|trans-Golgi network (GO:0005802)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|myosin V binding (GO:0031489)			lung(2)|ovary(1)	3	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					AGATATCCTTCGAAAGGTAAG	0.368																																																	0													159.0	154.0	156.0					2																	26350815		2203	4300	6503	SO:0001587	stop_gained	0			AF106681	CCDS1720.1	2p23.3	2008-05-21			ENSG00000084733	ENSG00000084733		"""RAB, member RAS oncogene"""	9759	protein-coding gene	gene with protein product	"""ras-related GTP-binding protein"""	612672				7688123	Standard	NM_016131		Approved		uc002rgv.3	P61026	OTTHUMG00000094796	ENST00000264710.4:c.514C>T	2.37:g.26350815C>T	ENSP00000264710:p.Arg172*		D6W538|O88386|Q6IA52|Q9D7X6|Q9H0T3	Nonsense_Mutation	SNP	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_Gtr1_RagA,pfam_EF_GTP-bd_dom,superfamily_P-loop_NTPase,smart_Small_GTPase_ARF,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.R172*	ENST00000264710.4	37	c.514	CCDS1720.1	2	.	.	.	.	.	.	.	.	.	.	C	40	8.373634	0.98781	.	.	ENSG00000084733	ENST00000264710	.	.	.	5.45	5.45	0.79879	.	0.308007	0.32563	N	0.005928	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.30078	T	0.28	.	16.3594	0.83251	0.0:1.0:0.0:0.0	.	.	.	.	X	172	.	ENSP00000264710:R172X	R	+	1	2	RAB10	26204319	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	5.507000	0.66999	2.712000	0.92718	0.650000	0.86243	CGA	RAB10	-	superfamily_P-loop_NTPase,smart_Small_GTPase_ARF,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase	ENSG00000084733		0.368	RAB10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAB10	HGNC	protein_coding	OTTHUMT00000211610.1	-	0.00	46	0	C	NM_016131		26350815	+1	tier1	-	no_errors	ENST00000264710	ensembl	human	known	74_37	nonsense	23.40	72	22	SNP	1.000	T
PSD4	23550	genome.wustl.edu	37	2	113942993	113942993	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr2:113942993G>T	ENST00000245796.6	+	4	1420	c.1225G>T	c.(1225-1227)Gtg>Ttg	p.V409L	PSD4_ENST00000441564.3_Missense_Mutation_p.V409L	NM_012455.2	NP_036587.2	Q8NDX1	PSD4_HUMAN	pleckstrin and Sec7 domain containing 4	409					neuron differentiation (GO:0030182)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|phospholipid binding (GO:0005543)			cervix(1)|endometrium(2)|large_intestine(4)|lung(13)|ovary(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						TTGGCCCCAGGTGACTCTTAA	0.542																																																	0													84.0	89.0	88.0					2																	113942993		2203	4300	6503	SO:0001583	missense	0			U63127	CCDS33276.1	2q13	2013-01-10			ENSG00000125637	ENSG00000125637		"""Pleckstrin homology (PH) domain containing"""	19096	protein-coding gene	gene with protein product		614442				12082148	Standard	XM_005263634		Approved	TIC, EFA6B	uc002tjc.3	Q8NDX1	OTTHUMG00000153339	ENST00000245796.6:c.1225G>T	2.37:g.113942993G>T	ENSP00000245796:p.Val409Leu		A6NEG7|A8K1Y0|O95621|Q4ZG34|Q6GPH8|Q8IYP4	Missense_Mutation	SNP	pfam_Sec7_dom,pfam_Pleckstrin_homology,superfamily_Sec7_dom,smart_Sec7_dom,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_Sec7_dom,prints_PH_dom-spectrin-type	p.V409L	ENST00000245796.6	37	c.1225	CCDS33276.1	2	.	.	.	.	.	.	.	.	.	.	G	11.91	1.779922	0.31502	.	.	ENSG00000125637	ENST00000245796;ENST00000441564	T;T	0.10382	2.98;2.88	3.63	2.74	0.32292	.	1.427400	0.04698	N	0.415269	T	0.09379	0.0231	N	0.24115	0.695	0.09310	N	0.999995	B;B	0.27732	0.187;0.118	B;B	0.29785	0.107;0.05	T	0.35574	-0.9783	10	0.33141	T	0.24	.	7.465	0.27316	0.1213:0.0:0.8787:0.0	.	409;409	Q8NDX1-2;Q8NDX1	.;PSD4_HUMAN	L	409	ENSP00000245796:V409L;ENSP00000413997:V409L	ENSP00000245796:V409L	V	+	1	0	PSD4	113659464	0.000000	0.05858	0.004000	0.12327	0.248000	0.25809	0.426000	0.21363	1.065000	0.40693	0.563000	0.77884	GTG	PSD4	-	NULL	ENSG00000125637		0.542	PSD4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PSD4	HGNC	protein_coding	OTTHUMT00000330789.1	-	0.00	34	0	G	NM_012455		113942993	+1	tier1	-	no_errors	ENST00000245796	ensembl	human	known	74_37	missense	6.15	61	4	SNP	0.004	T
RAP1GAP	5909	genome.wustl.edu	37	1	21929326	21929326	+	Missense_Mutation	SNP	G	G	C	rs373868217		TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr1:21929326G>C	ENST00000374765.4	-	19	1709	c.1509C>G	c.(1507-1509)atC>atG	p.I503M	RAP1GAP_ENST00000374761.2_Missense_Mutation_p.I534M|RAP1GAP_ENST00000290101.4_Missense_Mutation_p.I567M|RAP1GAP_ENST00000374763.2_Missense_Mutation_p.I588M|RAP1GAP_ENST00000542643.2_Missense_Mutation_p.I529M	NM_002885.2	NP_002876.2	P47736	RPGP1_HUMAN	RAP1 GTPase activating protein	503					GTP catabolic process (GO:0006184)|positive regulation of Rap GTPase activity (GO:0032854)|regulation of Ras GTPase activity (GO:0032318)|signal transduction (GO:0007165)	cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)|GTPase activity (GO:0003924)|protein homodimerization activity (GO:0042803)|Rap GTPase activator activity (GO:0046582)|Ras GTPase binding (GO:0017016)			breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(7)|ovary(2)|skin(1)	17		Colorectal(325;0.000147)|Renal(390;0.000734)|Lung NSC(340;0.000861)|all_lung(284;0.000901)|Breast(348;0.012)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0427)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0192)|OV - Ovarian serous cystadenocarcinoma(117;2.3e-26)|COAD - Colon adenocarcinoma(152;1.59e-05)|GBM - Glioblastoma multiforme(114;2.7e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000354)|STAD - Stomach adenocarcinoma(196;0.00645)|KIRC - Kidney renal clear cell carcinoma(1967;0.00862)|READ - Rectum adenocarcinoma(331;0.0625)|Lung(427;0.146)		GTATGTTCTCGATGCCAATGG	0.632																																																	0													98.0	79.0	85.0					1																	21929326		2203	4300	6503	SO:0001583	missense	0			BC054490	CCDS218.1, CCDS53276.1, CCDS53277.1	1p36.1-p35	2009-09-14	2006-04-12	2006-04-12	ENSG00000076864	ENSG00000076864			9858	protein-coding gene	gene with protein product		600278	"""RAP1, GTPase activating protein 1"""	RAP1GA1		1904317	Standard	NM_001145657		Approved	KIAA0474, RAP1GAP1, RAP1GAPII	uc001bew.3	P47736	OTTHUMG00000007513	ENST00000374765.4:c.1509C>G	1.37:g.21929326G>C	ENSP00000363897:p.Ile503Met		J3QSS6|O75062|Q5T3S9|Q5T3T4|Q7Z5S8|Q9UQ51	Missense_Mutation	SNP	pfam_Rap_GAP_dom,pfam_GoLoco_motif,smart_GoLoco_motif,pfscan_GoLoco_motif,pfscan_Rap_GAP_dom	p.I567M	ENST00000374765.4	37	c.1701	CCDS218.1	1	.	.	.	.	.	.	.	.	.	.	G	16.57	3.160866	0.57368	.	.	ENSG00000076864	ENST00000290101;ENST00000374761;ENST00000542643;ENST00000374765;ENST00000374763;ENST00000374758	D;D;D;D	0.91351	-2.67;-2.67;-2.83;-2.66	5.08	-2.24	0.06909	.	0.187598	0.44902	D	0.000419	D	0.92179	0.7520	M	0.69823	2.125	0.44825	D	0.997833	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;0.998;0.995;0.999	D	0.88171	0.2864	10	0.48119	T	0.1	-25.2221	6.3093	0.21156	0.5174:0.0:0.3566:0.126	.	529;503;533;503	P47736-2;P47736;P47736-3;Q7Z5S8	.;RPGP1_HUMAN;.;.	M	567;534;529;503;533;588	ENSP00000290101:I567M;ENSP00000363893:I534M;ENSP00000441661:I529M;ENSP00000363897:I503M	ENSP00000290101:I567M	I	-	3	3	RAP1GAP	21801913	0.358000	0.24947	0.992000	0.48379	0.991000	0.79684	-0.385000	0.07379	-0.297000	0.08934	-0.258000	0.10820	ATC	RAP1GAP	-	NULL	ENSG00000076864		0.632	RAP1GAP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	RAP1GAP	HGNC	protein_coding	OTTHUMT00000019759.2		0.00	46	0	G	NM_002885		21929326	-1			no_errors	ENST00000290101	ensembl	human	known	74_37	missense	7.50	37	3	SNP	0.763	C
RAPGEF1	2889	genome.wustl.edu	37	9	134501526	134501526	+	Silent	SNP	G	G	A	rs368148839	byFrequency	TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr9:134501526G>A	ENST00000372189.3	-	10	1557	c.1434C>T	c.(1432-1434)taC>taT	p.Y478Y	RAPGEF1_ENST00000372190.3_Silent_p.Y496Y|RAPGEF1_ENST00000372195.1_Silent_p.Y495Y|RAPGEF1_ENST00000481260.1_5'Flank	NM_005312.2	NP_005303.2	Q13905	RPGF1_HUMAN	Rap guanine nucleotide exchange factor (GEF) 1	478					activation of MAPKK activity (GO:0000186)|blood vessel development (GO:0001568)|cellular response to cAMP (GO:0071320)|cellular response to nerve growth factor stimulus (GO:1990090)|establishment of endothelial barrier (GO:0061028)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of neural precursor cell proliferation (GO:2000178)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of Ras protein signal transduction (GO:0046580)|nerve growth factor signaling pathway (GO:0038180)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of neuron projection development (GO:0010976)|positive regulation of Rap GTPase activity (GO:0032854)|Rap protein signal transduction (GO:0032486)|regulation of cell junction assembly (GO:1901888)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytosol (GO:0005829)|early endosome (GO:0005769)|endosome (GO:0005768)	Rap guanyl-nucleotide exchange factor activity (GO:0017034)			NS(2)|breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(8)|lung(9)|ovary(2)|prostate(4)|skin(1)|urinary_tract(1)	39		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;2.19e-05)|Epithelial(140;0.000364)		GATGCCGCTCGTAGGACACCC	0.652													G|||	2	0.000399361	0.0	0.0	5008	,	,		17014	0.002		0.0	False		,,,				2504	0.0																0													41.0	49.0	46.0					9																	134501526		2063	4203	6266	SO:0001819	synonymous_variant	0			BC041710	CCDS48047.1	9q34.3	2008-02-05	2004-03-01	2004-03-02	ENSG00000107263	ENSG00000107263			4568	protein-coding gene	gene with protein product		600303	"""guanine nucleotide-releasing factor 2 (specific for crk proto-oncogene)"""	GRF2		7959692, 7512734	Standard	NM_005312		Approved	C3G	uc022bos.1	Q13905	OTTHUMG00000020829	ENST00000372189.3:c.1434C>T	9.37:g.134501526G>A			Q5JUE4|Q8IV73	Silent	SNP	pfam_RasGRF_CDC25,pfam_Ras-like_Gua-exchang_fac_N,superfamily_Ras_GEF_dom,smart_Ras-like_Gua-exchang_fac_N,smart_RasGRF_CDC25,pfscan_RasGRF_CDC25,pfscan_Ras-like_Gua-exchang_fac_N	p.Y496	ENST00000372189.3	37	c.1488	CCDS48047.1	9																																																																																			RAPGEF1	-	NULL	ENSG00000107263		0.652	RAPGEF1-001	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	RAPGEF1	HGNC	protein_coding	OTTHUMT00000054759.2	-	0.00	60	0	G	NM_005312		134501526	-1	tier1	-	no_errors	ENST00000372190	ensembl	human	known	74_37	silent	31.03	40	18	SNP	0.864	A
RBMS1	5937	genome.wustl.edu	37	2	161130979	161130982	+	3'UTR	DEL	TTTC	TTTC	-	rs201326280|rs200119683	byFrequency	TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	TTTC	TTTC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr2:161130979_161130982delTTTC	ENST00000348849.3	-	0	1952_1955				RBMS1_ENST00000409289.2_3'UTR|RBMS1_ENST00000409075.1_3'UTR|ITGB6_ENST00000485635.1_5'Flank|RBMS1_ENST00000474820.1_5'UTR	NM_002897.4|NM_016836.3	NP_002888.1|NP_058520.1	P29558	RBMS1_HUMAN	RNA binding motif, single stranded interacting protein 1						DNA replication (GO:0006260)|RNA processing (GO:0006396)	nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)		PLA2R1/RBMS1(2)								tctttttttttttctttttctttt	0.284														613	0.122404	0.0045	0.0576	5008	,	,		17165	0.2748		0.1352	False		,,,				2504	0.1575																0																																										SO:0001624	3_prime_UTR_variant	0			D28482	CCDS2213.1	2q24.2	2013-02-12			ENSG00000153250	ENSG00000153250		"""RNA binding motif (RRM) containing"""	9907	protein-coding gene	gene with protein product	"""suppressor of cdc 2 (cdc13) with RNA binding motif 2"", ""c-myc gene single strand binding protein 2"""	602310	"""chromosome 2 open reading frame 12"""	C2orf12		8041632, 8134115, 7838710	Standard	NM_016836		Approved	SCR2, MSSP-1, MSSP-2, MSSP-3, YC1, HCC-4, DKFZp564H0764	uc002ubo.3	P29558	OTTHUMG00000132031	ENST00000348849.3:c.*304GAAA>-	2.37:g.161130979_161130982delTTTC			Q14869|Q15433|Q53P46|Q53QX8|Q53RG6|Q8WV20	RNA	DEL	-	NULL	ENST00000348849.3	37	NULL	CCDS2213.1	2																																																																																			RBMS1	-	-	ENSG00000153250		0.284	RBMS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBMS1	HGNC	protein_coding	OTTHUMT00000255043.4		0.00	22	0	TTTC	NM_016836		161130982	-1	tier1		no_errors	ENST00000474820	ensembl	human	known	74_37	rna	25.00	24	8	DEL	0.121:0.138:0.129:0.057	-
RECQL	5965	genome.wustl.edu	37	12	21628683	21628683	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr12:21628683C>A	ENST00000444129.2	-	9	1493	c.1025G>T	c.(1024-1026)gGt>gTt	p.G342V	RECQL_ENST00000421138.2_Missense_Mutation_p.G342V	NM_002907.3|NM_032941.2	NP_002898.2|NP_116559.1	P46063	RECQ1_HUMAN	RecQ helicase-like	342	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA strand renaturation (GO:0000733)	membrane (GO:0016020)|nucleus (GO:0005634)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|ATP-dependent 3'-5' DNA helicase activity (GO:0043140)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)			endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	17						ATGGTAAGCACCTGCATGAAT	0.383								Other identified genes with known or suspected DNA repair function																																									0													104.0	93.0	97.0					12																	21628683		2203	4300	6503	SO:0001583	missense	0			D37984	CCDS31756.1	12p12.1	2014-03-07	2014-03-07	2014-03-07	ENSG00000004700	ENSG00000004700			9948	protein-coding gene	gene with protein product	"""DNA helicase Q1-like"""	600537	"""RecQ protein-like (DNA helicase Q1-like)"""			7527136, 7961977	Standard	NM_002907		Approved	RecQ1, RecQL1	uc001rex.3	P46063	OTTHUMG00000169131	ENST00000444129.2:c.1025G>T	12.37:g.21628683C>A	ENSP00000416739:p.Gly342Val		A8K6G2	Missense_Mutation	SNP	pfam_Helicase_C,pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_RQC_domain,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,tigrfam_DNA_helicase_ATP-dep_RecQ	p.G342V	ENST00000444129.2	37	c.1025	CCDS31756.1	12	.	.	.	.	.	.	.	.	.	.	C	15.61	2.885237	0.51908	.	.	ENSG00000004700	ENST00000444129;ENST00000421138	T;T	0.74632	-0.86;-0.86	5.37	4.42	0.53409	Helicase, C-terminal (3);	0.427699	0.27782	N	0.017878	T	0.73156	0.3551	N	0.25094	0.71	0.58432	D	0.999999	D	0.53462	0.96	P	0.59889	0.865	T	0.67221	-0.5725	10	0.16896	T	0.51	-14.9441	15.8606	0.79017	0.0:0.8644:0.1356:0.0	.	342	P46063	RECQ1_HUMAN	V	342	ENSP00000416739:G342V;ENSP00000395449:G342V	ENSP00000395449:G342V	G	-	2	0	RECQL	21519950	0.533000	0.26354	0.993000	0.49108	0.794000	0.44872	1.281000	0.33214	2.658000	0.90341	0.591000	0.81541	GGT	RECQL	-	pfam_Helicase_C,superfamily_P-loop_NTPase,smart_Helicase_C,pfscan_Helicase_C,tigrfam_DNA_helicase_ATP-dep_RecQ	ENSG00000004700		0.383	RECQL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RECQL	HGNC	protein_coding	OTTHUMT00000402371.1	-	0.00	14	0	C	NM_002907		21628683	-1	tier1	-	no_errors	ENST00000421138	ensembl	human	known	74_37	missense	57.14	6	8	SNP	0.832	A
REG3A	5068	genome.wustl.edu	37	2	79384410	79384410	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr2:79384410C>A	ENST00000409839.3	-	6	506	c.470G>T	c.(469-471)aGg>aTg	p.R157M	AC011754.1_ENST00000415201.1_RNA|REG3A_ENST00000305165.2_Missense_Mutation_p.R157M|REG3A_ENST00000393878.1_Missense_Mutation_p.R157M	NM_002580.2|NM_138937.2	NP_002571.1|NP_620354.1	Q06141	REG3A_HUMAN	regenerating islet-derived 3 alpha	157	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				acute-phase response (GO:0006953)|cell proliferation (GO:0008283)|heterophilic cell-cell adhesion (GO:0007157)|multicellular organismal development (GO:0007275)|negative regulation of keratinocyte differentiation (GO:0045617)|positive regulation of keratinocyte proliferation (GO:0010838)|positive regulation of wound healing (GO:0090303)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	carbohydrate binding (GO:0030246)			breast(2)|large_intestine(4)|lung(41)|prostate(2)|skin(1)	50						ATCTTTCCACCTCAGAAATGC	0.458																																																	0													87.0	83.0	84.0					2																	79384410		2203	4300	6503	SO:0001583	missense	0			S51768	CCDS1965.1	2p12	2008-02-05	2005-02-11	2005-02-11	ENSG00000172016	ENSG00000172016			8601	protein-coding gene	gene with protein product		167805	"""pancreatitis-associated protein"""	PAP		8188210	Standard	NM_002580		Approved	HIP, REG-III, REG3, PBCGF, PAP1	uc002sof.2	Q06141	OTTHUMG00000130017	ENST00000409839.3:c.470G>T	2.37:g.79384410C>A	ENSP00000386630:p.Arg157Met			Missense_Mutation	SNP	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin	p.R157M	ENST00000409839.3	37	c.470	CCDS1965.1	2	.	.	.	.	.	.	.	.	.	.	c	15.73	2.919633	0.52653	.	.	ENSG00000172016	ENST00000409839;ENST00000393878;ENST00000305165	T;T;T	0.19532	2.14;2.14;2.14	3.96	-6.05	0.02172	C-type lectin fold (1);C-type lectin, conserved site (1);C-type lectin-like (1);C-type lectin (3);	0.610776	0.15484	N	0.259913	T	0.15305	0.0369	M	0.66939	2.045	0.09310	N	1	B	0.16396	0.017	B	0.17979	0.02	T	0.29941	-0.9995	10	0.87932	D	0	.	1.8381	0.03143	0.1591:0.3821:0.1443:0.3145	.	157	Q06141	REG3A_HUMAN	M	157	ENSP00000386630:R157M;ENSP00000377456:R157M;ENSP00000304311:R157M	ENSP00000304311:R157M	R	-	2	0	REG3A	79237918	0.000000	0.05858	0.001000	0.08648	0.347000	0.29111	-2.352000	0.01091	-1.047000	0.03242	-1.334000	0.01262	AGG	REG3A	-	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin	ENSG00000172016		0.458	REG3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	REG3A	HGNC	protein_coding	OTTHUMT00000252290.2	-	0.00	66	0	C	NM_002580		79384410	-1	tier1	-	no_errors	ENST00000305165	ensembl	human	known	74_37	missense	21.62	58	16	SNP	0.001	A
RELN	5649	genome.wustl.edu	37	7	103143467	103143467	+	Nonsense_Mutation	SNP	C	C	A			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr7:103143467C>A	ENST00000428762.1	-	52	8644	c.8485G>T	c.(8485-8487)Gga>Tga	p.G2829*	RELN_ENST00000343529.5_Nonsense_Mutation_p.G2829*|CTB-107G13.1_ENST00000422488.1_RNA|RELN_ENST00000424685.2_Nonsense_Mutation_p.G2829*	NM_005045.3	NP_005036.2	P78509	RELN_HUMAN	reelin	2829					associative learning (GO:0008306)|axon guidance (GO:0007411)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|central nervous system development (GO:0007417)|cerebral cortex tangential migration (GO:0021800)|dendrite development (GO:0016358)|glial cell differentiation (GO:0010001)|hippocampus development (GO:0021766)|lateral motor column neuron migration (GO:0097477)|layer formation in cerebral cortex (GO:0021819)|long-term memory (GO:0007616)|N-methyl-D-aspartate receptor clustering (GO:0097114)|neuron migration (GO:0001764)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of lateral motor column neuron migration (GO:1902078)|positive regulation of long-term synaptic potentiation (GO:1900273)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of TOR signaling (GO:0032008)|postsynaptic density protein 95 clustering (GO:0097119)|receptor localization to synapse (GO:0097120)|reelin-mediated signaling pathway (GO:0038026)|regulation of behavior (GO:0050795)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of synaptic transmission (GO:0050804)|response to pain (GO:0048265)|spinal cord patterning (GO:0021511)|ventral spinal cord development (GO:0021517)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	lipoprotein particle receptor binding (GO:0070325)|metal ion binding (GO:0046872)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|serine-type peptidase activity (GO:0008236)|very-low-density lipoprotein particle receptor binding (GO:0070326)			NS(3)|breast(8)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|lung(101)|ovary(9)|pancreas(2)|prostate(4)|skin(14)|stomach(2)|upper_aerodigestive_tract(12)|urinary_tract(2)	227				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		ACTTACTTTCCCACTAAGCTT	0.423																																					NSCLC(146;835 1944 15585 22231 52158)												0													106.0	94.0	98.0					7																	103143467		2203	4300	6503	SO:0001587	stop_gained	0				CCDS34722.1, CCDS47680.1	7q22	2008-07-18			ENSG00000189056	ENSG00000189056			9957	protein-coding gene	gene with protein product		600514				9049633	Standard	NM_005045		Approved	RL, PRO1598	uc010liz.3	P78509	OTTHUMG00000157247	ENST00000428762.1:c.8485G>T	7.37:g.103143467C>A	ENSP00000392423:p.Gly2829*		A4D0P9|A4D0Q0|Q86UJ0|Q86UJ8|Q8NDV0|Q9UDQ2	Nonsense_Mutation	SNP	pfam_EGF_extracell,pfam_Reeler_dom,pfam_BNR_rpt,superfamily_Sialidases,superfamily_Growth_fac_rcpt_N_dom,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_Reeler_dom	p.G2829*	ENST00000428762.1	37	c.8485	CCDS47680.1	7	.	.	.	.	.	.	.	.	.	.	C	51	17.713177	0.99892	.	.	ENSG00000189056	ENST00000428762;ENST00000343529;ENST00000424685;ENST00000424828;ENST00000448171	.	.	.	5.23	5.23	0.72850	.	0.170735	0.51477	D	0.000093	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	18.8293	0.92132	0.0:1.0:0.0:0.0	.	.	.	.	X	2829;2829;2829;346;2829	.	ENSP00000345694:G2829X	G	-	1	0	RELN	102930703	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.155000	0.77445	2.433000	0.82419	0.655000	0.94253	GGA	RELN	-	superfamily_Sialidases	ENSG00000189056		0.423	RELN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RELN	HGNC	protein_coding	OTTHUMT00000348148.1	-	0.00	135	0	C	NM_005045		103143467	-1	tier1	-	no_errors	ENST00000424685	ensembl	human	known	74_37	nonsense	23.02	97	29	SNP	1.000	A
RINT1	60561	genome.wustl.edu	37	7	105206037	105206037	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr7:105206037C>T	ENST00000257700.2	+	14	2359	c.2128C>T	c.(2128-2130)Cgg>Tgg	p.R710W	EFCAB10_ENST00000490493.1_5'Flank|EFCAB10_ENST00000480514.1_Intron|EFCAB10_ENST00000485614.1_Missense_Mutation_p.E137K	NM_021930.4	NP_068749.3	Q6NUQ1	RINT1_HUMAN	RAD50 interactor 1	710	RINT1/TIP20. {ECO:0000255|PROSITE- ProRule:PRU00717}.				G2 DNA damage checkpoint (GO:0031572)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)				central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(9)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	22						TGATATGACTCGGAATCTTTT	0.308																																																	0													84.0	82.0	83.0					7																	105206037		2203	4300	6503	SO:0001583	missense	0			AF317622	CCDS34726.1	7q22.2	2007-05-03			ENSG00000135249	ENSG00000135249			21876	protein-coding gene	gene with protein product		610089				11096100, 15029241	Standard	NM_021930		Approved	FLJ11785, RINT-1	uc003vda.1	Q6NUQ1	OTTHUMG00000157400	ENST00000257700.2:c.2128C>T	7.37:g.105206037C>T	ENSP00000257700:p.Arg710Trp		Q75MG9|Q75MH0|Q96IW8|Q9H229|Q9HAD9	Missense_Mutation	SNP	pfam_RINT1_TIP1	p.R710W	ENST00000257700.2	37	c.2128	CCDS34726.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	21.2|21.2	4.115595|4.115595	0.77323|0.77323	.|.	.|.	ENSG00000185055|ENSG00000135249	ENST00000485614|ENST00000257700	.|T	.|0.34072	.|1.38	5.71|5.71	4.81|4.81	0.61882|0.61882	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.60457|0.60457	0.2270|0.2270	M|M	0.76574|0.76574	2.34|2.34	0.80722|0.80722	D|D	1|1	.|D	.|0.89917	.|1.0	.|D	.|0.91635	.|0.999	T|T	0.65697|0.65697	-0.6105|-0.6105	6|10	0.87932|0.87932	D|D	0|0	-20.2722|-20.2722	14.6104|14.6104	0.68512|0.68512	0.3523:0.6477:0.0:0.0|0.3523:0.6477:0.0:0.0	.|.	.|710	.|Q6NUQ1	.|RINT1_HUMAN	K|W	137|710	.|ENSP00000257700:R710W	ENSP00000417841:E137K|ENSP00000257700:R710W	E|R	-|+	1|1	0|2	EFCAB10|RINT1	104993273|104993273	0.998000|0.998000	0.40836|0.40836	0.991000|0.991000	0.47740|0.47740	0.982000|0.982000	0.71751|0.71751	2.759000|2.759000	0.47573|0.47573	1.357000|1.357000	0.45904|0.45904	0.650000|0.650000	0.86243|0.86243	GAG|CGG	RINT1	-	pfam_RINT1_TIP1	ENSG00000135249		0.308	RINT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RINT1	HGNC	protein_coding	OTTHUMT00000348686.1	-	0.00	26	0	C	NM_021930		105206037	+1	tier1	-	no_errors	ENST00000257700	ensembl	human	known	74_37	missense	18.18	27	6	SNP	0.986	T
RNF126P1	376412	genome.wustl.edu	37	17	55123062	55123062	+	RNA	SNP	G	G	A			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr17:55123062G>A	ENST00000567452.1	+	0	224					NR_002818.2				ring finger protein 126 pseudogene 1																		GACCAGAGCCGGCCGCCGTTG	0.597																																																	0																																												0			BC033555		17q23.2	2004-04-22				ENSG00000261192		"""RING-type (C3HC4) zinc fingers"""	30340	pseudogene	pseudogene						12477932	Standard	NR_002818		Approved		uc002iuw.3				17.37:g.55123062G>A				RNA	SNP	-	NULL	ENST00000567452.1	37	NULL		17																																																																																			RNF126P1	-	-	ENSG00000261192		0.597	RNF126P1-002	KNOWN	basic	processed_transcript	RNF126P1	HGNC	pseudogene	OTTHUMT00000431453.1	-	0.00	81	0	G			55123062	+1	tier1	-	no_errors	ENST00000567452	ensembl	human	known	74_37	rna	12.68	62	9	SNP	0.015	A
RNF145	153830	genome.wustl.edu	37	5	158630641	158630642	+	5'UTR	INS	-	-	T	rs74770414|rs202186112|rs74841177|rs368977591		TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr5:158630641_158630642insT	ENST00000424310.2	-	0	343_344				RNF145_ENST00000274542.2_Frame_Shift_Ins_p.K23fs|RNF145_ENST00000521606.2_Frame_Shift_Ins_p.K12fs|RNF145_ENST00000518802.1_Frame_Shift_Ins_p.K25fs|RNF145_ENST00000520638.1_Frame_Shift_Ins_p.K9fs|RNF145_ENST00000519865.1_5'UTR	NM_001199383.1	NP_001186312.1	Q96MT1	RN145_HUMAN	ring finger protein 145							integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)			endometrium(7)|kidney(2)|large_intestine(5)|lung(9)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	30	Renal(175;0.00196)	Medulloblastoma(196;0.0523)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			ttttttttttcttttttttttt	0.361																																																	0																																										SO:0001623	5_prime_UTR_variant	0			BC042684	CCDS4344.1, CCDS56390.1, CCDS56391.1, CCDS56392.1, CCDS56393.1	5q33.3	2013-01-09			ENSG00000145860	ENSG00000145860		"""RING-type (C3HC4) zinc fingers"""	20853	protein-coding gene	gene with protein product							Standard	NM_001199380		Approved	FLJ31951	uc003lxo.2	Q96MT1	OTTHUMG00000130306	ENST00000424310.2:c.-17->A	5.37:g.158630652_158630652dupT			B7Z903|B7Z949|E7EVI7|Q8IVP7	Frame_Shift_Ins	INS	pfam_Znf_C3HC4_RING-type,smart_Znf_RING-CH,smart_Znf_RING,pfscan_Znf_RING	p.K26fs	ENST00000424310.2	37	c.75_74	CCDS56390.1	5																																																																																			RNF145	-	NULL	ENSG00000145860		0.361	RNF145-002	PUTATIVE	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	RNF145	HGNC	protein_coding	OTTHUMT00000374048.1		0.00	43	0	-	NM_144726		158630642	-1	tier1		no_errors	ENST00000518802	ensembl	human	known	74_37	frame_shift_ins	12.90	27	4	INS	0.000:0.000	T
RP1	6101	genome.wustl.edu	37	8	55540391	55540391	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr8:55540391C>G	ENST00000220676.1	+	4	4097	c.3949C>G	c.(3949-3951)Caa>Gaa	p.Q1317E		NM_006269.1	NP_006260.1	P56715	RP1_HUMAN	retinitis pigmentosa 1 (autosomal dominant)	1317					axoneme assembly (GO:0035082)|cellular response to light stimulus (GO:0071482)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|photoreceptor cell outer segment organization (GO:0035845)|phototransduction, visible light (GO:0007603)|retinal cone cell development (GO:0046549)|retinal rod cell development (GO:0046548)|visual perception (GO:0007601)	axoneme (GO:0005930)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|photoreceptor connecting cilium (GO:0032391)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)	microtubule binding (GO:0008017)			NS(4)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(29)|lung(69)|ovary(6)|pancreas(1)|prostate(9)|skin(17)|upper_aerodigestive_tract(3)|urinary_tract(2)	169		all_lung(136;0.0831)|Lung NSC(129;0.109)|all_epithelial(80;0.123)	OV - Ovarian serous cystadenocarcinoma(7;4.4e-07)|Epithelial(17;3.37e-05)|all cancers(17;0.000285)			GGCTTGTGCTCAAAAGGAGAA	0.408																																					Colon(91;1014 1389 7634 14542 40420)												0													146.0	143.0	144.0					8																	55540391		2203	4300	6503	SO:0001583	missense	0			AF146592	CCDS6160.1	8q12.1	2013-01-08				ENSG00000104237			10263	protein-coding gene	gene with protein product		603937				1783394	Standard	NM_006269		Approved	DCDC4A	uc003xsd.1	P56715		ENST00000220676.1:c.3949C>G	8.37:g.55540391C>G	ENSP00000220676:p.Gln1317Glu			Missense_Mutation	SNP	pfam_Doublecortin_dom,smart_Doublecortin_dom,pfscan_Doublecortin_dom	p.Q1317E	ENST00000220676.1	37	c.3949	CCDS6160.1	8	.	.	.	.	.	.	.	.	.	.	C	5.271	0.235508	0.10023	.	.	ENSG00000104237	ENST00000220676	T	0.19938	2.11	4.51	1.53	0.23141	.	1.193380	0.05975	N	0.643049	T	0.11707	0.0285	N	0.19112	0.55	0.09310	N	1	B	0.09022	0.002	B	0.09377	0.004	T	0.34950	-0.9808	10	0.10111	T	0.7	.	4.6009	0.12352	0.0:0.6139:0.1767:0.2094	.	1317	P56715	RP1_HUMAN	E	1317	ENSP00000220676:Q1317E	ENSP00000220676:Q1317E	Q	+	1	0	RP1	55702944	0.000000	0.05858	0.077000	0.20336	0.965000	0.64279	0.538000	0.23160	0.325000	0.23359	0.655000	0.94253	CAA	RP1	-	NULL	ENSG00000104237		0.408	RP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RP1	HGNC	protein_coding	OTTHUMT00000378532.2	-	0.00	135	0	C	NM_006269		55540391	+1	tier1	-	no_errors	ENST00000220676	ensembl	human	known	74_37	missense	22.40	97	28	SNP	0.218	G
RRBP1	6238	genome.wustl.edu	37	20	17614113	17614113	+	Nonsense_Mutation	SNP	G	G	A			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr20:17614113G>A	ENST00000377813.1	-	8	2905	c.2602C>T	c.(2602-2604)Cag>Tag	p.Q868*	RRBP1_ENST00000246043.4_Nonsense_Mutation_p.Q868*|RRBP1_ENST00000377807.2_Nonsense_Mutation_p.Q435*|RRBP1_ENST00000360807.4_Nonsense_Mutation_p.Q435*|RRBP1_ENST00000455029.2_Nonsense_Mutation_p.Q209*			Q9P2E9	RRBP1_HUMAN	ribosome binding protein 1	868					osteoblast differentiation (GO:0001649)|protein transport (GO:0015031)|translation (GO:0006412)	endoplasmic reticulum (GO:0005783)|integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|receptor activity (GO:0004872)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(9)|ovary(2)|prostate(6)	28						ACCTGCAGCTGCAGGACCTGC	0.637																																																	0													63.0	56.0	58.0					20																	17614113		2203	4300	6503	SO:0001587	stop_gained	0			AB037819	CCDS13128.1	20p12	2012-12-07	2012-12-07		ENSG00000125844	ENSG00000125844			10448	protein-coding gene	gene with protein product		601418	"""ribosome binding protein 1 (dog 180kD homolog)"", ""ribosome binding protein 1 homolog 180kDa (dog)"""			8812507	Standard	NM_001042576		Approved	ES/130, hES	uc002wpw.1	Q9P2E9	OTTHUMG00000031945	ENST00000377813.1:c.2602C>T	20.37:g.17614113G>A	ENSP00000367044:p.Gln868*		A2A2S6|A6NCN6|O75300|O75301|Q5W165|Q96SB2|Q9BWP1|Q9H476	Nonsense_Mutation	SNP	pfam_Rib_rcpt_KP,superfamily_Ribosome_recyc_fac_dom	p.Q868*	ENST00000377813.1	37	c.2602		20	.	.	.	.	.	.	.	.	.	.	G	41	8.871637	0.98984	.	.	ENSG00000125844	ENST00000360807;ENST00000377813;ENST00000377807;ENST00000246043;ENST00000455029	.	.	.	5.45	5.45	0.79879	.	0.000000	0.35585	N	0.003117	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.23891	T	0.37	-31.6756	18.6332	0.91368	0.0:0.0:1.0:0.0	.	.	.	.	X	435;868;435;868;209	.	ENSP00000246043:Q868X	Q	-	1	0	RRBP1	17562113	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	6.520000	0.73773	2.714000	0.92807	0.561000	0.74099	CAG	RRBP1	-	NULL	ENSG00000125844		0.637	RRBP1-002	NOVEL	basic	protein_coding	RRBP1	HGNC	protein_coding	OTTHUMT00000078125.1	-	0.00	58	0	G	NM_001042576		17614113	-1	tier1	-	no_errors	ENST00000246043	ensembl	human	known	74_37	nonsense	6.67	56	4	SNP	1.000	A
COA7	65260	genome.wustl.edu	37	1	53163915	53163915	+	Nonsense_Mutation	SNP	G	G	T			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr1:53163915G>T	ENST00000371538.3	-	1	123	c.84C>A	c.(82-84)tgC>tgA	p.C28*	SELRC1_ENST00000486918.1_5'Flank	NM_023077.2	NP_075565.2														breast(1)|lung(3)|prostate(1)|urinary_tract(1)	6						TCTCGTGGTAGCAGTGGTAGT	0.647																																																	0													81.0	78.0	79.0					1																	53163915		2203	4300	6503	SO:0001587	stop_gained	0																														ENST00000371538.3:c.84C>A	1.37:g.53163915G>T	ENSP00000360593:p.Cys28*			Nonsense_Mutation	SNP	pfam_Sel1-like,smart_Sel1-like	p.C28*	ENST00000371538.3	37	c.84	CCDS570.1	1	.	.	.	.	.	.	.	.	.	.	.	38	6.693050	0.97768	.	.	ENSG00000162377	ENST00000371538	.	.	.	6.04	5.13	0.70059	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-22.5902	11.3276	0.49458	0.14:0.0:0.86:0.0	.	.	.	.	X	28	.	ENSP00000360593:C28X	C	-	3	2	SELRC1	52936503	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	2.722000	0.47269	1.572000	0.49736	0.561000	0.74099	TGC	SELRC1	-	NULL	ENSG00000162377		0.647	SELRC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SELRC1	HGNC	protein_coding	OTTHUMT00000023462.1		0.00	65	0	G			53163915	-1			no_errors	ENST00000371538	ensembl	human	known	74_37	nonsense	5.13	74	4	SNP	1.000	T
SENP3	26168	genome.wustl.edu	37	17	7475156	7475156	+	3'UTR	SNP	T	T	A			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr17:7475156T>A	ENST00000429205.2	+	0	2129				EIF4A1_ENST00000380512.5_5'Flank|EIF4A1_ENST00000582746.1_5'Flank|SNORA48_ENST00000386847.1_RNA|EIF4A1_ENST00000293831.8_5'Flank|SENP3_ENST00000321337.7_3'UTR|SENP3_ENST00000578868.1_3'UTR|EIF4A1_ENST00000577269.1_5'Flank|SENP3-EIF4A1_ENST00000579777.1_RNA			Q9H4L4	SENP3_HUMAN	SUMO1/sentrin/SMT3 specific peptidase 3							cytoplasm (GO:0005737)|MLL1 complex (GO:0071339)|nucleolus (GO:0005730)	cysteine-type peptidase activity (GO:0008234)			central_nervous_system(1)|ovary(1)	2		Prostate(122;0.157)				TTCAAACTTTtatatatatat	0.343																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AK000923	CCDS73958.1	17p13	2012-05-02	2005-08-17			ENSG00000161956			17862	protein-coding gene	gene with protein product		612844	"""SUMO1/sentrin/SMT3 specific protease 3"""			10806345, 11230166	Standard	NM_015670		Approved	DKFZP586K0919, SSP3, DKFZp762A152, SMT3IP1, Ulp1	uc002ghm.3	Q9H4L4		ENST00000429205.2:c.*355T>A	17.37:g.7475156T>A			Q66K15|Q86VS7|Q96PS4|Q9Y3W9	RNA	SNP	-	NULL	ENST00000429205.2	37	NULL		17																																																																																			SENP3	-	-	ENSG00000161956		0.343	SENP3-202	KNOWN	basic|appris_candidate_longest	protein_coding	SENP3	HGNC	protein_coding			0.00	12	0	T	NM_015670		7475156	+1			no_errors	ENST00000578813	ensembl	human	known	74_37	rna	17.65	14	3	SNP	0.997	A
SERPINH1	871	genome.wustl.edu	37	11	75277524	75277524	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr11:75277524G>A	ENST00000524558.1	+	2	1565	c.130G>A	c.(130-132)Gcc>Acc	p.A44T	SERPINH1_ENST00000525876.1_5'Flank|SERPINH1_ENST00000530284.1_Missense_Mutation_p.A44T|SERPINH1_ENST00000358171.3_Missense_Mutation_p.A44T|SERPINH1_ENST00000533603.1_Missense_Mutation_p.A44T			P50454	SERPH_HUMAN	serpin peptidase inhibitor, clade H (heat shock protein 47), member 1, (collagen binding protein 1)	44					chondrocyte development involved in endochondral bone morphogenesis (GO:0003433)|collagen biosynthetic process (GO:0032964)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|negative regulation of endopeptidase activity (GO:0010951)|protein maturation (GO:0051604)|regulation of proteolysis (GO:0030162)|response to unfolded protein (GO:0006986)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	collagen binding (GO:0005518)|poly(A) RNA binding (GO:0044822)|serine-type endopeptidase inhibitor activity (GO:0004867)			endometrium(4)|large_intestine(3)|liver(1)|lung(4)|ovary(2)|stomach(1)	15	Ovarian(111;0.11)					GGCCACGCTTGCCGAGCGCAG	0.682																																																	0													32.0	26.0	28.0					11																	75277524		2199	4293	6492	SO:0001583	missense	0			X61598	CCDS8239.1	11q13.5	2014-02-18	2005-08-18		ENSG00000149257	ENSG00000149257		"""Serine (or cysteine) peptidase inhibitors"""	1546	protein-coding gene	gene with protein product		600943	"""serine (or cysteine) proteinase inhibitor, clade H (heat shock protein 47), member 2"", ""serine (or cysteine) proteinase inhibitor, clade H (heat shock protein 47), member 1, (collagen binding protein 1)"""	CBP1, CBP2, SERPINH2		7656593, 9533029, 24172014	Standard	NM_001207014		Approved	HSP47, colligen	uc001owr.3	P50454	OTTHUMG00000165362	ENST00000524558.1:c.130G>A	11.37:g.75277524G>A	ENSP00000434412:p.Ala44Thr		B3KVJ3|P29043|Q5XPB4|Q6NSJ6|Q8IY96|Q9NP88	Missense_Mutation	SNP	pfam_Serpin_dom,superfamily_Serpin_dom,smart_Serpin_dom	p.A44T	ENST00000524558.1	37	c.130	CCDS8239.1	11	.	.	.	.	.	.	.	.	.	.	G	16.75	3.210693	0.58343	.	.	ENSG00000149257	ENST00000533603;ENST00000358171;ENST00000526242;ENST00000526397;ENST00000421448;ENST00000529643;ENST00000530284;ENST00000532356;ENST00000524558;ENST00000528990;ENST00000533449;ENST00000525611;ENST00000528760	D;D;D;D;T;D;D;D;T;D;D	0.88509	-2.39;-2.39;-1.74;-2.39;-0.95;-2.39;-2.39;-2.39;-0.95;-2.39;-2.39	4.76	4.76	0.60689	Serpin domain (1);	0.106432	0.64402	D	0.000005	D	0.90338	0.6977	L	0.36672	1.1	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.66084	0.941;0.941	D	0.88527	0.3100	10	0.29301	T	0.29	.	15.3136	0.74056	0.0:0.0:1.0:0.0	.	44;44	E9PPV6;P50454	.;SERPH_HUMAN	T	44;44;19;44;44;44;44;44;44;44;44;44;44	ENSP00000434657:A44T;ENSP00000350894:A44T;ENSP00000431384:A19T;ENSP00000434964:A44T;ENSP00000435936:A44T;ENSP00000436305:A44T;ENSP00000436040:A44T;ENSP00000434412:A44T;ENSP00000431827:A44T;ENSP00000435452:A44T;ENSP00000437108:A44T	ENSP00000350894:A44T	A	+	1	0	SERPINH1	74955172	1.000000	0.71417	0.951000	0.38953	0.119000	0.20118	7.434000	0.80377	2.470000	0.83445	0.563000	0.77884	GCC	SERPINH1	-	superfamily_Serpin_dom	ENSG00000149257		0.682	SERPINH1-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SERPINH1	HGNC	protein_coding	OTTHUMT00000383610.1	-	0.00	51	0	G	NM_004353		75277524	+1	tier1	-	no_errors	ENST00000358171	ensembl	human	known	74_37	missense	35.90	25	14	SNP	1.000	A
SIN3A	25942	genome.wustl.edu	37	15	75692462	75692462	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr15:75692462C>A	ENST00000394947.3	-	12	2087	c.1773G>T	c.(1771-1773)tgG>tgT	p.W591C	SIN3A_ENST00000360439.4_Missense_Mutation_p.W591C|SIN3A_ENST00000394949.4_Missense_Mutation_p.W591C	NM_001145358.1	NP_001138830.1			SIN3 transcription regulator family member A											breast(2)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(15)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)	63						AGTCCTCAGACCACGAAGGGA	0.393																																																	0													101.0	95.0	97.0					15																	75692462		2197	4294	6491	SO:0001583	missense	0			AK027559	CCDS10279.1	15q22.33	2013-08-21	2013-08-21		ENSG00000169375	ENSG00000169375			19353	protein-coding gene	gene with protein product		607776	"""SIN3 homolog A, transcription regulator (yeast)"", ""SIN3 transcription regulator homolog A (yeast)"""			10773092, 7601471	Standard	NM_001145357		Approved	KIAA0700, DKFZP434K2235	uc002bai.3	Q96ST3	OTTHUMG00000142834	ENST00000394947.3:c.1773G>T	15.37:g.75692462C>A	ENSP00000378402:p.Trp591Cys			Missense_Mutation	SNP	pfam_PAH,pfam_HDAC_interact,superfamily_PAH,smart_HDAC_interact	p.W591C	ENST00000394947.3	37	c.1773	CCDS10279.1	15	.	.	.	.	.	.	.	.	.	.	C	26.4	4.730322	0.89390	.	.	ENSG00000169375	ENST00000394947;ENST00000394949;ENST00000360439	T;T;T	0.54675	0.56;0.56;0.56	6.08	6.08	0.98989	Histone deacetylase interacting (2);	0.000000	0.85682	D	0.000000	T	0.81182	0.4769	M	0.93550	3.43	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.84604	0.0674	10	0.72032	D	0.01	-9.6549	19.6603	0.95864	0.0:1.0:0.0:0.0	.	591	Q96ST3	SIN3A_HUMAN	C	591	ENSP00000378402:W591C;ENSP00000378403:W591C;ENSP00000353622:W591C	ENSP00000353622:W591C	W	-	3	0	SIN3A	73479515	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.817000	0.86213	2.894000	0.99253	0.591000	0.81541	TGG	SIN3A	-	pfam_HDAC_interact,smart_HDAC_interact	ENSG00000169375		0.393	SIN3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIN3A	HGNC	protein_coding	OTTHUMT00000286469.1	-	0.00	20	0	C	NM_015477		75692462	-1	tier1	-	no_errors	ENST00000360439	ensembl	human	known	74_37	missense	21.21	26	7	SNP	1.000	A
SIPA1L2	57568	genome.wustl.edu	37	1	232575095	232575095	+	Missense_Mutation	SNP	C	C	T	rs532670311		TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr1:232575095C>T	ENST00000366630.1	-	14	4148	c.3790G>A	c.(3790-3792)Gac>Aac	p.D1264N	SIPA1L2_ENST00000308942.4_Missense_Mutation_p.D338N|SIPA1L2_ENST00000262861.4_Missense_Mutation_p.D1264N			Q9P2F8	SI1L2_HUMAN	signal-induced proliferation-associated 1 like 2	1264					regulation of small GTPase mediated signal transduction (GO:0051056)		GTPase activator activity (GO:0005096)			NS(1)|breast(5)|central_nervous_system(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(49)|ovary(2)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	103		all_cancers(173;0.00605)|Prostate(94;0.128)|all_epithelial(177;0.186)				ATGCCACTGTCGGTGGAGGCC	0.637													C|||	1	0.000199681	0.0	0.0	5008	,	,		18329	0.001		0.0	False		,,,				2504	0.0																0													52.0	57.0	56.0					1																	232575095		2101	4242	6343	SO:0001583	missense	0			AB037810	CCDS41474.1	1q42.2	2008-02-05			ENSG00000116991	ENSG00000116991			23800	protein-coding gene	gene with protein product		611609					Standard	NM_020808		Approved	KIAA1389	uc001hvg.3	Q9P2F8	OTTHUMG00000037820	ENST00000366630.1:c.3790G>A	1.37:g.232575095C>T	ENSP00000355589:p.Asp1264Asn		Q2TV88|Q5VXR7|Q5VXR8|Q641Q4|Q8NA38|Q96DZ3|Q9H9F6	Missense_Mutation	SNP	pfam_DUF3401,pfam_Rap_GAP_dom,pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ,pfscan_Rap_GAP_dom	p.D1264N	ENST00000366630.1	37	c.3790	CCDS41474.1	1	.	.	.	.	.	.	.	.	.	.	C	34	5.405917	0.96051	.	.	ENSG00000116991	ENST00000366630;ENST00000262861;ENST00000308942	T;T;T	0.58210	0.35;0.35;0.35	5.39	5.39	0.77823	.	0.050050	0.85682	D	0.000000	T	0.75019	0.3793	M	0.80422	2.495	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.78314	0.945;0.991	T	0.75445	-0.3315	10	0.49607	T	0.09	-39.9965	19.3359	0.94319	0.0:1.0:0.0:0.0	.	1264;338	Q9P2F8;Q9P2F8-2	SI1L2_HUMAN;.	N	1264;1264;338	ENSP00000355589:D1264N;ENSP00000262861:D1264N;ENSP00000309102:D338N	ENSP00000262861:D1264N	D	-	1	0	SIPA1L2	230641718	1.000000	0.71417	0.983000	0.44433	0.981000	0.71138	7.220000	0.78008	2.804000	0.96469	0.650000	0.86243	GAC	SIPA1L2	-	NULL	ENSG00000116991		0.637	SIPA1L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIPA1L2	HGNC	protein_coding	OTTHUMT00000092318.1	-	0.00	79	0	C	XM_045839		232575095	-1	tier1	-	no_errors	ENST00000262861	ensembl	human	known	74_37	missense	13.89	93	15	SNP	1.000	T
SKIDA1	387640	genome.wustl.edu	37	10	21805720	21805720	+	Silent	SNP	A	A	G			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr10:21805720A>G	ENST00000449193.2	-	4	3284	c.1032T>C	c.(1030-1032)caT>caC	p.H344H	SKIDA1_ENST00000444772.3_Silent_p.H265H|SKIDA1_ENST00000487107.1_5'Flank	NM_207371.3	NP_997254.3	Q1XH10	SKDA1_HUMAN	SKI/DACH domain containing 1	263	Glu-rich.|Ser-rich.					nucleus (GO:0005634)											ggtggtggtgatggtggtggt	0.716																																																	0													4.0	6.0	5.0					10																	21805720		1658	3602	5260	SO:0001819	synonymous_variant	0			AK131456	CCDS44363.1	10p12.31	2012-06-13	2012-06-13	2012-06-13	ENSG00000180592	ENSG00000180592			32697	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 140"""	C10orf140			Standard	NM_207371		Approved	FLJ45187	uc021pnx.1	Q1XH10	OTTHUMG00000017797	ENST00000449193.2:c.1032T>C	10.37:g.21805720A>G			B1ANA5|Q6ZMX4|Q8N3C3	Silent	SNP	pfam_Transform_Ski,superfamily_DNA-bd_dom_put	p.H344	ENST00000449193.2	37	c.1032	CCDS44363.1	10																																																																																			SKIDA1	-	NULL	ENSG00000180592		0.716	SKIDA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SKIDA1	HGNC	protein_coding	OTTHUMT00000286950.2		0.00	74	0	A	NM_207371		21805720	-1			no_errors	ENST00000449193	ensembl	human	known	74_37	silent	5.97	63	4	SNP	0.972	G
SLC11A1	6556	genome.wustl.edu	37	2	219259680	219259680	+	Silent	SNP	C	C	A			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr2:219259680C>A	ENST00000233202.6	+	15	1915	c.1575C>A	c.(1573-1575)acC>acA	p.T525T	SLC11A1_ENST00000539932.1_Silent_p.T407T	NM_000578.3	NP_000569.3	P49279	NRAM1_HUMAN	solute carrier family 11 (proton-coupled divalent metal ion transporter), member 1	525					activation of protein kinase activity (GO:0032147)|antigen processing and presentation of peptide antigen (GO:0048002)|cadmium ion transmembrane transport (GO:0070574)|cellular cadmium ion homeostasis (GO:0006876)|cellular iron ion homeostasis (GO:0006879)|defense response to bacterium (GO:0042742)|defense response to Gram-negative bacterium (GO:0050829)|defense response to protozoan (GO:0042832)|divalent metal ion export (GO:0070839)|inflammatory response (GO:0006954)|interaction with host (GO:0051701)|interleukin-2 production (GO:0032623)|interleukin-3 production (GO:0032632)|iron ion homeostasis (GO:0055072)|iron ion transport (GO:0006826)|L-arginine import (GO:0043091)|macrophage activation (GO:0042116)|manganese ion transport (GO:0006828)|MHC class II biosynthetic process (GO:0045342)|mRNA stabilization (GO:0048255)|multicellular organismal iron ion homeostasis (GO:0060586)|negative regulation of cytokine production (GO:0001818)|nitrite transport (GO:0015707)|phagocytosis (GO:0006909)|phagosome maturation (GO:0090382)|positive regulation of cytokine production (GO:0001819)|positive regulation of dendritic cell antigen processing and presentation (GO:0002606)|positive regulation of gene expression (GO:0010628)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of phagocytosis (GO:0050766)|positive regulation of T-helper 1 type immune response (GO:0002827)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein import into nucleus, translocation (GO:0000060)|respiratory burst (GO:0045730)|response to bacterium (GO:0009617)|response to interferon-gamma (GO:0034341)|response to lipopolysaccharide (GO:0032496)|T cell cytokine production (GO:0002369)|T cell proliferation involved in immune response (GO:0002309)|transmembrane transport (GO:0055085)|vacuolar acidification (GO:0007035)|wound healing (GO:0042060)	cell outer membrane (GO:0009279)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|late endosome membrane (GO:0031902)|lysosome (GO:0005764)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)|tertiary granule membrane (GO:0070821)	manganese ion transmembrane transporter activity (GO:0005384)|metal ion:proton antiporter activity (GO:0051139)|protein homodimerization activity (GO:0042803)|transition metal ion transmembrane transporter activity (GO:0046915)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(3)|ovary(3)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	19		Renal(207;0.0474)		Epithelial(149;1.16e-06)|all cancers(144;0.000195)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		ACGGAGCCACCTTTCTGGCCC	0.632																																																	0													52.0	39.0	43.0					2																	219259680		2203	4300	6503	SO:0001819	synonymous_variant	0			D38171	CCDS2415.1	2q35	2013-07-18	2013-07-18		ENSG00000018280	ENSG00000018280		"""Solute carriers"""	10907	protein-coding gene	gene with protein product	"""natural resistance-associated macrophage protein 1"""	600266		LSH, NRAMP, NRAMP1		7964458, 7980580	Standard	NM_000578		Approved		uc002vhv.3	P49279	OTTHUMG00000086747	ENST00000233202.6:c.1575C>A	2.37:g.219259680C>A			C0H5Y3	Silent	SNP	pfam_NRAMP-like,prints_NRAMP-like,tigrfam_NRAMP-like	p.T525	ENST00000233202.6	37	c.1575	CCDS2415.1	2																																																																																			SLC11A1	-	NULL	ENSG00000018280		0.632	SLC11A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC11A1	HGNC	protein_coding	OTTHUMT00000195076.2	-	0.00	63	0	C	NM_000578		219259680	+1	tier1	-	no_errors	ENST00000233202	ensembl	human	known	74_37	silent	11.11	56	7	SNP	0.000	A
SLC23A2	9962	genome.wustl.edu	37	20	4893541	4893541	+	Silent	SNP	G	G	A	rs201503850	byFrequency	TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr20:4893541G>A	ENST00000379333.1	-	4	584	c.192C>T	c.(190-192)aaC>aaT	p.N64N	SLC23A2_ENST00000424750.2_Silent_p.N64N|SLC23A2_ENST00000468355.1_5'UTR|SLC23A2_ENST00000338244.1_Silent_p.N64N	NM_203327.1	NP_976072.1	Q9UGH3	S23A2_HUMAN	solute carrier family 23 (ascorbic acid transporter), member 2	64					L-ascorbic acid metabolic process (GO:0019852)|L-ascorbic acid transport (GO:0015882)|molecular hydrogen transport (GO:0015993)|nucleobase transport (GO:0015851)|nucleobase-containing compound metabolic process (GO:0006139)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)|transepithelial L-ascorbic acid transport (GO:0070904)|vitamin metabolic process (GO:0006766)|vitamin transmembrane transport (GO:0035461)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	L-ascorbate:sodium symporter activity (GO:0008520)|L-ascorbic acid transporter activity (GO:0015229)|nucleobase transmembrane transporter activity (GO:0015205)|sodium-dependent L-ascorbate transmembrane transporter activity (GO:0070890)|sodium-dependent multivitamin transmembrane transporter activity (GO:0008523)			endometrium(1)|kidney(3)|large_intestine(9)|lung(7)|ovary(3)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	27						CTGCAATGCCGTTTTCCGTAG	0.587													G|||	2	0.000399361	0.0	0.0	5008	,	,		12388	0.0		0.0	False		,,,				2504	0.002																0													248.0	200.0	216.0					20																	4893541		2203	4300	6503	SO:0001819	synonymous_variant	0			AF058319	CCDS13085.1	20p13	2013-07-18	2013-07-18	2003-03-21	ENSG00000089057	ENSG00000089057		"""Solute carriers"""	10973	protein-coding gene	gene with protein product		603791	"""solute carrier family 23 (nucleobase transporters), member 1"""	SLC23A1		9804989, 10331392	Standard	NM_005116		Approved	SVCT2, KIAA0238, YSPL2	uc002wlh.1	Q9UGH3	OTTHUMG00000031793	ENST00000379333.1:c.192C>T	20.37:g.4893541G>A			B4DJZ1|Q8WWR4|Q92512|Q96D54|Q9UNU1|Q9UP85	Silent	SNP	pfam_Xant/urac/vitC	p.N64	ENST00000379333.1	37	c.192	CCDS13085.1	20																																																																																			SLC23A2	-	NULL	ENSG00000089057		0.587	SLC23A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC23A2	HGNC	protein_coding	OTTHUMT00000077832.1		0.00	25	0	G			4893541	-1			no_errors	ENST00000338244	ensembl	human	known	74_37	silent	9.68	28	3	SNP	0.610	A
SLC30A4	7782	genome.wustl.edu	37	15	45814394	45814394	+	Silent	SNP	G	G	A			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr15:45814394G>A	ENST00000261867.4	-	2	473	c.159C>T	c.(157-159)gaC>gaT	p.D53D	SLC30A4_ENST00000559667.1_5'UTR|HMGN2P46_ENST00000409454.1_RNA	NM_013309.4	NP_037441.2	O14863	ZNT4_HUMAN	solute carrier family 30 (zinc transporter), member 4	53	Asp-rich (acidic).				regulation of sequestering of zinc ion (GO:0061088)|response to toxic substance (GO:0009636)|zinc ion homeostasis (GO:0055069)|zinc ion transmembrane transport (GO:0071577)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)	zinc ion transmembrane transporter activity (GO:0005385)			endometrium(3)|large_intestine(2)|lung(8)|prostate(1)|stomach(1)	15		Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;1.58e-16)|GBM - Glioblastoma multiforme(94;2.15e-06)		CTTCGGAACCGTCATCGGCCA	0.567																																																	0													70.0	76.0	74.0					15																	45814394		2198	4298	6496	SO:0001819	synonymous_variant	0				CCDS10125.1	15q21.1	2013-05-22			ENSG00000104154	ENSG00000104154		"""Solute carriers"""	11015	protein-coding gene	gene with protein product		602095		ZNT4			Standard	NM_013309		Approved		uc001zvj.3	O14863	OTTHUMG00000131439	ENST00000261867.4:c.159C>T	15.37:g.45814394G>A			Q8TC39	Silent	SNP	pfam_Cation_efflux,tigrfam_Cation_efflux	p.D53	ENST00000261867.4	37	c.159	CCDS10125.1	15																																																																																			SLC30A4	-	NULL	ENSG00000104154		0.567	SLC30A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC30A4	HGNC	protein_coding	OTTHUMT00000254236.1	-	0.00	52	0	G			45814394	-1	tier1	-	no_errors	ENST00000261867	ensembl	human	known	74_37	silent	7.27	51	4	SNP	0.299	A
SLC44A1	23446	genome.wustl.edu	37	9	108127763	108127763	+	Splice_Site	SNP	G	G	C			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr9:108127763G>C	ENST00000374720.3	+	11	1500		c.e11-1		SLC44A1_ENST00000374724.1_Splice_Site|SLC44A1_ENST00000343170.7_Splice_Site|SLC44A1_ENST00000374723.1_Splice_Site	NM_080546.3	NP_536856.2	Q8WWI5	CTL1_HUMAN	solute carrier family 44 (choline transporter), member 1						choline transport (GO:0015871)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|plasma membrane (GO:0005886)	choline transmembrane transporter activity (GO:0015220)			breast(4)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(16)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	38					Choline(DB00122)	TTTTTAAATAGGGATAAAAGG	0.363																																																	0													65.0	67.0	66.0					9																	108127763		2203	4300	6503	SO:0001630	splice_region_variant	0			AJ420812	CCDS6763.1, CCDS75868.1	9q31.2	2014-01-28	2013-07-17	2005-09-06	ENSG00000070214	ENSG00000070214		"""CD molecules"", ""Solute carriers"""	18798	protein-coding gene	gene with protein product		606105	"""CDW92 antigen"""	CDW92		11698453, 10677542	Standard	NM_080546		Approved	CDw92, CTL1, CHTL1, CD92	uc004bcn.3	Q8WWI5	OTTHUMG00000020421	ENST00000374720.3:c.1254-1G>C	9.37:g.108127763G>C			A6NLZ9|Q5VUB3|Q8WVB0|Q96KU3|Q9NY69	Splice_Site	SNP	-	e11-1	ENST00000374720.3	37	c.1254-1	CCDS6763.1	9	.	.	.	.	.	.	.	.	.	.	G	25.3	4.621978	0.87460	.	.	ENSG00000070214	ENST00000374723;ENST00000374720;ENST00000374724;ENST00000343170	.	.	.	5.82	5.82	0.92795	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.1064	0.97896	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	SLC44A1	107167584	1.000000	0.71417	0.998000	0.56505	0.967000	0.64934	9.831000	0.99420	2.745000	0.94114	0.650000	0.86243	.	SLC44A1	-	-	ENSG00000070214		0.363	SLC44A1-003	KNOWN	alternative_3_UTR|basic|appris_candidate_longest|CCDS	protein_coding	SLC44A1	HGNC	protein_coding	OTTHUMT00000053500.1	-	0.00	98	0	G	NM_080546	Intron	108127763	+1	tier1	-	no_errors	ENST00000374720	ensembl	human	known	74_37	splice_site	34.74	59	33	SNP	1.000	C
SLCO4C1	353189	genome.wustl.edu	37	5	101583042	101583042	+	Silent	SNP	C	C	T	rs574597658		TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr5:101583042C>T	ENST00000310954.6	-	10	2011	c.1725G>A	c.(1723-1725)gcG>gcA	p.A575A		NM_180991.4	NP_851322.3			solute carrier organic anion transporter family, member 4C1											breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(16)|ovary(1)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(5)	50		all_cancers(142;1.86e-08)|all_epithelial(76;5.24e-12)|Prostate(80;0.00124)|Colorectal(57;0.00332)|Ovarian(225;0.024)|Lung NSC(167;0.0402)|all_lung(232;0.0486)		Epithelial(69;4.07e-14)|COAD - Colon adenocarcinoma(37;0.00986)		TGGGCAGTTTCGCACAATGAG	0.353													C|||	1	0.000199681	0.0	0.0	5008	,	,		18979	0.0		0.0	False		,,,				2504	0.001																0													122.0	131.0	128.0					5																	101583042		2203	4300	6503	SO:0001819	synonymous_variant	0			AY273896	CCDS34205.1	5q21	2013-05-22	2003-11-25		ENSG00000173930	ENSG00000173930		"""Solute carriers"""	23612	protein-coding gene	gene with protein product		609013					Standard	NM_180991		Approved	SLC21A20, OATP4C1, OATPX, OATP-H	uc003knm.3	Q6ZQN7	OTTHUMG00000162757	ENST00000310954.6:c.1725G>A	5.37:g.101583042C>T				Silent	SNP	pfam_OA_transporter,pfam_MFS,pfam_Kazal_dom,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_OA_transporter	p.A575	ENST00000310954.6	37	c.1725	CCDS34205.1	5																																																																																			SLCO4C1	-	pfam_OA_transporter,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_OA_transporter	ENSG00000173930		0.353	SLCO4C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLCO4C1	HGNC	protein_coding	OTTHUMT00000370332.1	-	0.00	76	0	C	NM_180991		101583042	-1	tier1	-	no_errors	ENST00000310954	ensembl	human	known	74_37	silent	21.74	36	10	SNP	0.000	T
SMIM11	54065	genome.wustl.edu	37	21	35774491	35774492	+	3'UTR	INS	-	-	T	rs534668511|rs371965936	byFrequency	TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr21:35774491_35774492insT	ENST00000399299.1	+	0	449_450				AP000322.54_ENST00000410005.1_5'Flank|SMIM11_ENST00000481710.1_3'UTR			P58511	SIM11_HUMAN	small integral membrane protein 11							integral component of membrane (GO:0016021)											ATGGAGGAGGATTTTTTTTTTT	0.376																																																	0																																										SO:0001624	3_prime_UTR_variant	0			BC015596	CCDS33550.1	21q22.12	2012-12-03	2012-12-03	2012-12-03	ENSG00000205670	ENSG00000205670			1293	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 51"", ""family with sequence similarity 165, member B"""	C21orf51, FAM165B			Standard	NM_058182		Approved		uc002ytu.4	P58511	OTTHUMG00000086193	ENST00000399299.1:c.*98->T	21.37:g.35774502_35774502dupT				RNA	INS	-	NULL	ENST00000399299.1	37	NULL		21																																																																																			SMIM11	-	-	ENSG00000205670		0.376	SMIM11-002	PUTATIVE	basic|exp_conf	protein_coding	SMIM11	HGNC	protein_coding	OTTHUMT00000194076.1		0.00	33	0	-	NM_058182		35774492	+1	tier1		no_errors	ENST00000481710	ensembl	human	known	74_37	rna	7.14	26	2	INS	0.000:0.002	T
SNHG11	128439	genome.wustl.edu	37	20	37076786	37076786	+	RNA	SNP	A	A	T			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr20:37076786A>T	ENST00000365032.1	+	0	60				SNORA60_ENST00000362396.1_RNA					small nucleolar RNA host gene 11 (non-protein coding)																		GTGCAGGCAGAGGAAATGCGG	0.547																																																	0													200.0	192.0	194.0					20																	37076786		876	1991	2867			0			AF497716		20q11.23	2012-10-16	2008-09-05	2008-04-16	ENSG00000174365	ENSG00000174365		"""Long non-coding RNAs"""	25046	non-coding RNA	RNA, long non-coding	"""long intergenic non-protein coding RNA 101"""		"""chromosome 20 open reading frame 198"""	C20orf198		12477932	Standard	NR_003239		Approved	LINC00101	uc002xis.1		OTTHUMG00000032449		20.37:g.37076786A>T				RNA	SNP	-	NULL	ENST00000365032.1	37	NULL		20																																																																																			SNHG11	-	-	ENSG00000174365		0.547	SNHG11-201	KNOWN	basic	snoRNA	SNHG11	HGNC	processed_transcript		-	0.00	127	0	A	NR_003239		37076786	+1	tier1	-	no_errors	ENST00000365032	ensembl	human	known	74_37	rna	14.17	109	18	SNP	0.950	T
FAM69B	138311	genome.wustl.edu	37	9	139621262	139621262	+	IGR	SNP	C	C	T			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr9:139621262C>T	ENST00000371692.4	+	0	1668				SNHG7_ENST00000362567.2_RNA|SNHG7_ENST00000436596.1_RNA|SNHG7_ENST00000447221.1_RNA|SNHG7_ENST00000391185.1_RNA|SNHG7_ENST00000414282.1_RNA|SNHG7_ENST00000416970.1_RNA	NM_152421.3	NP_689634.2	Q5VUD6	FA69B_HUMAN	family with sequence similarity 69, member B							endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				NS(1)|endometrium(3)|large_intestine(2)|lung(1)|prostate(1)	8	all_cancers(76;0.0882)|all_epithelial(76;0.228)	Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;1.03e-05)|Epithelial(140;0.00013)		GACATAGCCTCTCTAATCTCT	0.488											OREG0019621	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													57.0	54.0	55.0					9																	139621262		875	1991	2866	SO:0001628	intergenic_variant	0				CCDS7004.1	9q34.3	2012-08-03			ENSG00000165716	ENSG00000165716			28290	protein-coding gene	gene with protein product		614543				21334309	Standard	NM_152421		Approved	MGC20262, C9orf136	uc004cik.3	Q5VUD6	OTTHUMG00000020940		9.37:g.139621262C>T		1650	Q5VUD7|Q8N5N0|Q8WYU5	RNA	SNP	-	NULL	ENST00000371692.4	37	NULL	CCDS7004.1	9																																																																																			SNHG7	-	-	ENSG00000233016		0.488	FAM69B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNHG7	HGNC	protein_coding	OTTHUMT00000055102.1	-	0.00	50	0	C	NM_152421		139621262	-1	tier1	-	no_errors	ENST00000391185	ensembl	human	known	74_37	rna	18.42	31	7	SNP	0.154	T
SNX29	92017	genome.wustl.edu	37	16	12162928	12162928	+	Missense_Mutation	SNP	A	A	G			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr16:12162928A>G	ENST00000566228.1	+	10	1327	c.1258A>G	c.(1258-1260)Agc>Ggc	p.S420G	SNX29_ENST00000323433.4_Missense_Mutation_p.S35G|SNX29_ENST00000306030.3_Missense_Mutation_p.S35G	NM_032167.3	NP_115543.3	Q8TEQ0	SNX29_HUMAN	sorting nexin 29	420						extracellular vesicular exosome (GO:0070062)	phosphatidylinositol binding (GO:0035091)			endometrium(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)	7						CCCCCTCGGAAGCCTGGAGAA	0.493																																																	0													95.0	104.0	101.0					16																	12162928		1912	4120	6032	SO:0001583	missense	0			AK074072	CCDS10553.2	16p13.13-p13.12	2011-08-16			ENSG00000048471	ENSG00000048471		"""Sorting nexins"""	30542	protein-coding gene	gene with protein product			"""RUN domain containing 2A"""	RUNDC2A		16782399	Standard	XM_005255682		Approved	FLJ12363	uc002dby.5	Q8TEQ0		ENST00000566228.1:c.1258A>G	16.37:g.12162928A>G	ENSP00000456480:p.Ser420Gly		B5MDW2|Q8N2X2|Q9HA26	Missense_Mutation	SNP	pfam_Phox,superfamily_Phox,smart_Phox,pfscan_Phox	p.S35G	ENST00000566228.1	37	c.103	CCDS10553.2	16	.	.	.	.	.	.	.	.	.	.	a	15.43	2.830715	0.50845	.	.	ENSG00000048471	ENST00000306030;ENST00000323433	.	.	.	5.34	5.34	0.76211	.	.	.	.	.	T	0.28466	0.0704	N	0.16478	0.41	0.21675	N	0.999595	B	0.29378	0.243	B	0.27380	0.079	T	0.16335	-1.0406	8	0.38643	T	0.18	-13.224	11.7517	0.51852	1.0:0.0:0.0:0.0	.	420	Q8TEQ0	SNX29_HUMAN	G	35	.	ENSP00000306940:S35G	S	+	1	0	SNX29	12070429	0.997000	0.39634	0.991000	0.47740	0.885000	0.51271	3.791000	0.55469	2.024000	0.59613	0.456000	0.33151	AGC	SNX29	-	NULL	ENSG00000048471		0.493	SNX29-005	PUTATIVE	not_organism_supported|basic|appris_principal|CCDS	protein_coding	SNX29	HGNC	protein_coding	OTTHUMT00000422622.1	-	0.00	57	0	A			12162928	+1	tier1	-	no_errors	ENST00000306030	ensembl	human	known	74_37	missense	27.78	39	15	SNP	0.962	G
SRCAP	10847	genome.wustl.edu	37	16	30721919	30721919	+	Intron	SNP	A	A	T			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr16:30721919A>T	ENST00000262518.4	+	9	1519				SRCAP_ENST00000344771.4_Intron|SNORA30_ENST00000384028.1_RNA|SRCAP_ENST00000395059.2_Intron	NM_006662.2	NP_006653.2	Q6ZRS2	SRCAP_HUMAN	Snf2-related CREBBP activator protein						histone acetylation (GO:0016573)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|histone acetyltransferase activity (GO:0004402)|transcription coactivator activity (GO:0003713)			NS(1)|breast(3)|cervix(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(22)|liver(3)|lung(62)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(5)	136			Colorectal(24;0.198)			TGGTGCTGAGAGAAAACCCTT	0.493																																																	0													92.0	81.0	84.0					16																	30721919		876	1991	2867	SO:0001627	intron_variant	0			AB002307	CCDS10689.2	16p11.2	2009-08-06			ENSG00000080603	ENSG00000080603			16974	protein-coding gene	gene with protein product	"""Swi2/Snf2-related ATPase homolog (S. cerevisiae)"", ""domino homolog 1 (Drosophila)"""	611421				10347196, 9205841	Standard	NM_006662		Approved	KIAA0309, EAF1, SWR1, DOMO1	uc002dze.1	Q6ZRS2	OTTHUMG00000132393	ENST00000262518.4:c.1135-156A>T	16.37:g.30721919A>T			B0JZA6|O15026|Q7Z744|Q9Y5L9	RNA	SNP	-	NULL	ENST00000262518.4	37	NULL	CCDS10689.2	16																																																																																			SNORA30	-	-	ENSG00000206755		0.493	SRCAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNORA30	HGNC	protein_coding	OTTHUMT00000255523.1	-	0.00	43	0	A	NM_006662		30721919	+1	tier1	-	no_errors	ENST00000384028	ensembl	human	known	74_37	rna	21.05	45	12	SNP	1.000	T
SPATA31A3	727830	genome.wustl.edu	37	9	40705844	40705844	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr9:40705844C>G	ENST00000356699.5	+	4	3530	c.3501C>G	c.(3499-3501)atC>atG	p.I1167M	RP11-395E19.5_ENST00000432614.1_lincRNA	NM_001083124.1	NP_001076593.1	Q5VYP0	S31A3_HUMAN	SPATA31 subfamily A, member 3	1167					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											GAGAAAACATCAAGCAAATTT	0.433																																																	0													14.0	12.0	12.0					9																	40705844		1432	2875	4307	SO:0001583	missense	0					9p12	2012-10-15	2012-10-12	2012-10-12	ENSG00000147926				32003	protein-coding gene	gene with protein product			"""family with sequence similarity 75, member A3"""	FAM75A3		20850414	Standard	NM_001083124		Approved	OTTHUMG00000013164, DKFZp434B204	uc010mmj.3	Q5VYP0	OTTHUMG00000013164	ENST00000356699.5:c.3501C>G	9.37:g.40705844C>G	ENSP00000349132:p.Ile1167Met			Missense_Mutation	SNP	NULL	p.I1167M	ENST00000356699.5	37	c.3501	CCDS47969.1	9	.	.	.	.	.	.	.	.	.	.	C	1.646	-0.515158	0.04200	.	.	ENSG00000147926	ENST00000356699	T	0.04706	3.57	2.69	-5.39	0.02664	.	1.808030	0.03316	N	0.191217	T	0.03564	0.0102	N	0.25485	0.75	0.09310	N	1	P	0.34864	0.473	B	0.31751	0.135	T	0.31503	-0.9941	10	0.42905	T	0.14	0.9012	5.7729	0.18263	0.2869:0.1967:0.5164:0.0	.	1167	Q5VYP0	F75A3_HUMAN	M	1167	ENSP00000349132:I1167M	ENSP00000349132:I1167M	I	+	3	3	FAM75A3	40695844	0.000000	0.05858	0.000000	0.03702	0.013000	0.08279	-1.100000	0.03339	-1.408000	0.02040	0.398000	0.26397	ATC	SPATA31A3	-	NULL	ENSG00000147926		0.433	SPATA31A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPATA31A3	HGNC	protein_coding	OTTHUMT00000036919.1	-	0.00	85	0	C	NM_001083124		40705844	+1	tier1	-	no_errors	ENST00000356699	ensembl	human	known	74_37	missense	25.68	55	19	SNP	0.000	G
SPG11	80208	genome.wustl.edu	37	15	44905697	44905698	+	Frame_Shift_Ins	INS	-	-	T	rs374397452|rs312262752		TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr15:44905697_44905698insT	ENST00000261866.7	-	17	3091_3092	c.3075_3076insA	c.(3073-3078)aaagagfs	p.E1026fs	SPG11_ENST00000558319.1_Frame_Shift_Ins_p.E1026fs|SPG11_ENST00000427534.2_Frame_Shift_Ins_p.E1026fs|SPG11_ENST00000535302.2_Frame_Shift_Ins_p.E1026fs	NM_025137.3	NP_079413.3	Q96JI7	SPTCS_HUMAN	spastic paraplegia 11 (autosomal recessive)	1026					cell death (GO:0008219)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)				autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(16)|lung(24)|ovary(5)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	72		all_cancers(109;1.29e-14)|all_epithelial(112;1.26e-12)|Lung NSC(122;1.34e-07)|all_lung(180;1.21e-06)|Melanoma(134;0.0122)		all cancers(107;2.93e-22)|GBM - Glioblastoma multiforme(94;1.55e-06)|COAD - Colon adenocarcinoma(120;0.0432)|Colorectal(105;0.0484)|Lung(196;0.104)|LUSC - Lung squamous cell carcinoma(244;0.214)		TCATGTAACTCTTTTTTTTCCA	0.327																																																	0			GRCh37	CI077004	SPG11	I																																				SO:0001589	frameshift_variant	0				CCDS10112.1, CCDS53939.1	15q13-q15	2007-11-13			ENSG00000104133	ENSG00000104133			11226	protein-coding gene	gene with protein product	"""spatacsin"""	610844	"""KIAA1840"""	KIAA1840		10408536, 17322883	Standard	NM_001160227		Approved	FLJ21439	uc001ztx.3	Q96JI7	OTTHUMG00000131199	ENST00000261866.7:c.3076dupA	15.37:g.44905705_44905705dupT	ENSP00000261866:p.Glu1026fs		A8KAX9|B9EK60|F5H3N6|Q4VC11|Q58G86|Q69YG6|Q6NW01|Q8N270|Q8TBU9|Q9H734	Frame_Shift_Ins	INS	NULL	p.E1025fs	ENST00000261866.7	37	c.3076_3075	CCDS10112.1	15																																																																																			SPG11	-	NULL	ENSG00000104133		0.327	SPG11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SPG11	HGNC	protein_coding	OTTHUMT00000253927.1		0.00	29	0	-			44905698	-1	tier1		no_errors	ENST00000261866	ensembl	human	known	74_37	frame_shift_ins	5.88	32	2	INS	1.000:1.000	T
SPOCK3	50859	genome.wustl.edu	37	4	167656208	167656208	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr4:167656208C>G	ENST00000357154.3	-	12	1312	c.1175G>C	c.(1174-1176)aGt>aCt	p.S392T	SPOCK3_ENST00000507137.1_5'UTR|SPOCK3_ENST00000510741.1_Missense_Mutation_p.S349T|SPOCK3_ENST00000535728.1_Missense_Mutation_p.S260T|SPOCK3_ENST00000511269.1_Missense_Mutation_p.S389T|SPOCK3_ENST00000506886.1_Missense_Mutation_p.S392T|SPOCK3_ENST00000511531.1_Missense_Mutation_p.S392T|SPOCK3_ENST00000357545.4_Missense_Mutation_p.S389T|SPOCK3_ENST00000534949.1_Missense_Mutation_p.S296T|SPOCK3_ENST00000541637.1_Missense_Mutation_p.S294T|SPOCK3_ENST00000541354.1_Missense_Mutation_p.S272T|SPOCK3_ENST00000421836.2_Missense_Mutation_p.S341T|SPOCK3_ENST00000504953.1_Missense_Mutation_p.S389T|SPOCK3_ENST00000512681.1_Missense_Mutation_p.S294T|SPOCK3_ENST00000502330.1_Missense_Mutation_p.S392T	NM_016950.2	NP_058646.2	Q9BQ16	TICN3_HUMAN	sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 3	392					negative regulation of endopeptidase activity (GO:0010951)|peptide cross-linking via chondroitin 4-sulfate glycosaminoglycan (GO:0019800)|signal transduction (GO:0007165)	extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|glycosaminoglycan binding (GO:0005539)|metalloendopeptidase inhibitor activity (GO:0008191)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(13)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	38	all_hematologic(180;0.221)	Prostate(90;0.0181)|Renal(120;0.0184)|Melanoma(52;0.0198)		GBM - Glioblastoma multiforme(119;0.02)		aaaatcgccactagcaaaatc	0.333																																																	0													131.0	125.0	127.0					4																	167656208		2203	4300	6503	SO:0001583	missense	0			AJ001454	CCDS34095.1, CCDS54817.1, CCDS56343.1, CCDS56344.1, CCDS56346.1, CCDS56347.1, CCDS58931.1, CCDS75207.1	4q32.3	2011-10-10			ENSG00000196104	ENSG00000196104			13565	protein-coding gene	gene with protein product		607989				11751414	Standard	NM_001204352		Approved	testican-3	uc003iri.1	Q9BQ16	OTTHUMG00000161190	ENST00000357154.3:c.1175G>C	4.37:g.167656208C>G	ENSP00000349677:p.Ser392Thr		B2R7M7|B3KR67|B4DGK5|B4DHB4|B4DHV3|B4DI46|B4DJY3|E7EP61|F5H099|O75705|Q6UW53|Q96Q26	Missense_Mutation	SNP	pfam_SPARC/Testican_Ca-bd-dom,pfam_Thyroglobulin_1,pfam_Kazal_dom,superfamily_Thyroglobulin_1,smart_Kazal_dom,smart_Thyroglobulin_1,pfscan_Thyroglobulin_1	p.S392T	ENST00000357154.3	37	c.1175	CCDS54817.1	4	.	.	.	.	.	.	.	.	.	.	C	14.18	2.457889	0.43634	.	.	ENSG00000196104	ENST00000357154;ENST00000357545;ENST00000504953;ENST00000506886;ENST00000511531;ENST00000502330;ENST00000510741;ENST00000541354;ENST00000512681;ENST00000511269;ENST00000535728;ENST00000421836;ENST00000541637;ENST00000534949	T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.48522	1.36;1.36;1.36;1.36;1.36;1.36;1.41;1.3;0.81;1.36;1.4;1.16;0.81;1.06	5.14	5.14	0.70334	.	0.179666	0.64402	D	0.000016	T	0.67711	0.2922	M	0.72576	2.205	0.45118	D	0.998132	D;D;D;D;D;D;D	0.89917	0.986;0.986;1.0;0.982;0.982;0.99;0.982	D;P;D;D;D;D;D	0.87578	0.965;0.827;0.998;0.952;0.952;0.979;0.952	T	0.70691	-0.4802	10	0.72032	D	0.01	-9.9103	15.2763	0.73745	0.0:0.8592:0.1407:0.0	.	294;296;341;401;349;389;392	B4DGK5;F5H099;B4DHB4;B4DFW5;E7EP61;Q9BQ16-1;Q9BQ16	.;.;.;.;.;.;TICN3_HUMAN	T	392;389;389;392;392;392;349;272;294;389;260;341;294;296	ENSP00000349677:S392T;ENSP00000350153:S389T;ENSP00000425570:S389T;ENSP00000420920:S392T;ENSP00000423421:S392T;ENSP00000423606:S392T;ENSP00000426716:S349T;ENSP00000444789:S272T;ENSP00000426318:S294T;ENSP00000425502:S389T;ENSP00000441396:S260T;ENSP00000411344:S341T;ENSP00000445430:S294T;ENSP00000438142:S296T	ENSP00000349677:S392T	S	-	2	0	SPOCK3	167892783	1.000000	0.71417	1.000000	0.80357	0.448000	0.32197	3.783000	0.55409	2.561000	0.86390	0.637000	0.83480	AGT	SPOCK3	-	NULL	ENSG00000196104		0.333	SPOCK3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SPOCK3	HGNC	protein_coding	OTTHUMT00000364091.1	-	0.00	62	0	C			167656208	-1	tier1	-	no_errors	ENST00000357154	ensembl	human	known	74_37	missense	23.08	40	12	SNP	1.000	G
ST6GALNAC5	81849	genome.wustl.edu	37	1	77510243	77510243	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr1:77510243C>T	ENST00000477717.1	+	3	851	c.616C>T	c.(616-618)Cgc>Tgc	p.R206C		NM_030965.1	NP_112227.1	Q9BVH7	SIA7E_HUMAN	ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 5	206					glycosphingolipid biosynthetic process (GO:0006688)|oligosaccharide biosynthetic process (GO:0009312)|protein glycosylation (GO:0006486)|sialylation (GO:0097503)	integral component of Golgi membrane (GO:0030173)	alpha-N-acetylgalactosaminide alpha-2,6-sialyltransferase activity (GO:0001665)|sialyltransferase activity (GO:0008373)			endometrium(2)|kidney(1)|large_intestine(6)|lung(5)|pancreas(2)|skin(1)|upper_aerodigestive_tract(1)	18						CATGATTACTCGCCACAAGAT	0.572																																																	0													122.0	123.0	123.0					1																	77510243		2203	4300	6503	SO:0001583	missense	0				CCDS673.1	1p31.1	2013-03-01	2005-02-07	2005-02-07	ENSG00000117069	ENSG00000117069		"""Sialyltransferases"""	19342	protein-coding gene	gene with protein product		610134	"""sialyltransferase 7 ((alpha-N-acetylneuraminyl-2,3-beta-galactosyl-1,3)-N-acetyl galactosaminide alpha-2,6-sialyltransferase) E"""	SIAT7E		10521438, 10601645	Standard	NM_030965		Approved	MGC3184, ST6GalNAcV	uc001dhi.3	Q9BVH7	OTTHUMG00000009687	ENST00000477717.1:c.616C>T	1.37:g.77510243C>T	ENSP00000417583:p.Arg206Cys		B1AK82	Missense_Mutation	SNP	pfam_Glyco_trans_29,pirsf_Sialyl_trans	p.R206C	ENST00000477717.1	37	c.616	CCDS673.1	1	.	.	.	.	.	.	.	.	.	.	C	18.62	3.662544	0.67700	.	.	ENSG00000117069	ENST00000477717;ENST00000438953	T	0.29142	1.58	5.46	5.46	0.80206	.	0.105732	0.64402	D	0.000002	T	0.50480	0.1618	M	0.73962	2.25	0.80722	D	1	D	0.89917	1.0	D	0.68621	0.959	T	0.53851	-0.8380	10	0.66056	D	0.02	-25.7814	19.307	0.94167	0.0:1.0:0.0:0.0	.	206	Q9BVH7	SIA7E_HUMAN	C	206;116	ENSP00000417583:R206C	ENSP00000436263:R206C	R	+	1	0	ST6GALNAC5	77282831	0.952000	0.32445	0.999000	0.59377	0.958000	0.62258	1.989000	0.40707	2.543000	0.85770	0.655000	0.94253	CGC	ST6GALNAC5	-	pfam_Glyco_trans_29,pirsf_Sialyl_trans	ENSG00000117069		0.572	ST6GALNAC5-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ST6GALNAC5	HGNC	protein_coding	OTTHUMT00000026692.2		0.00	22	0	C	NM_030965		77510243	+1			no_errors	ENST00000477717	ensembl	human	known	74_37	missense	11.54	23	3	SNP	0.988	T
STARD7	56910	genome.wustl.edu	37	2	96858916	96858916	+	Intron	SNP	C	C	A			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr2:96858916C>A	ENST00000337288.5	-	5	1044				STARD7_ENST00000462501.1_5'UTR	NM_020151.3	NP_064536.2	Q9NQZ5	STAR7_HUMAN	StAR-related lipid transfer (START) domain containing 7							mitochondrion (GO:0005739)	lipid binding (GO:0008289)			endometrium(2)|kidney(1)|large_intestine(1)|lung(8)|stomach(2)	14						AATGGAGGAGCAGGATTAGTG	0.423																																																	0													123.0	103.0	110.0					2																	96858916		2203	4300	6503	SO:0001627	intron_variant	0			AF270647	CCDS2017.2	2p11.1	2011-09-12	2007-08-16		ENSG00000084090	ENSG00000084090		"""StAR-related lipid transfer (START) domain containing"""	18063	protein-coding gene	gene with protein product			"""START domain containing 7"""				Standard	NM_020151		Approved	GTT1	uc002svm.4	Q9NQZ5	OTTHUMG00000130457	ENST00000337288.5:c.661-18G>T	2.37:g.96858916C>A			D3DXG9|Q53T44|Q6GU43|Q969M6	RNA	SNP	-	NULL	ENST00000337288.5	37	NULL	CCDS2017.2	2																																																																																			STARD7	-	-	ENSG00000084090		0.423	STARD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STARD7	HGNC	protein_coding	OTTHUMT00000252848.2	-	0.00	63	0	C			96858916	-1	tier1	-	no_errors	ENST00000462501	ensembl	human	known	74_37	rna	18.00	41	9	SNP	0.002	A
STK10	6793	genome.wustl.edu	37	5	171614953	171614953	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr5:171614953G>T	ENST00000176763.5	-	1	437	c.94C>A	c.(94-96)Ccc>Acc	p.P32T		NM_005990.3	NP_005981.3	O94804	STK10_HUMAN	serine/threonine kinase 10	32					cell cycle (GO:0007049)|lymphocyte aggregation (GO:0071593)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of lymphocyte migration (GO:2000401)|signal transduction by phosphorylation (GO:0023014)	extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|polo kinase kinase activity (GO:0042801)|protein homodimerization activity (GO:0042803)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(15)|ovary(6)|pancreas(1)|prostate(1)|testis(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	47	Renal(175;0.000159)|Lung NSC(126;0.0056)|all_lung(126;0.0094)	Medulloblastoma(196;0.00868)|all_neural(177;0.026)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			ACCTCGTTGGGGTCCAGGTCG	0.652																																																	0													39.0	38.0	39.0					5																	171614953		2203	4300	6503	SO:0001583	missense	0			AB015718	CCDS34290.1	5q35.1	2008-07-18			ENSG00000072786	ENSG00000072786			11388	protein-coding gene	gene with protein product		603919				10199912	Standard	NM_005990		Approved	LOK, PRO2729	uc003mbo.1	O94804	OTTHUMG00000163265	ENST00000176763.5:c.94C>A	5.37:g.171614953G>T	ENSP00000176763:p.Pro32Thr		A6ND35|B2R8F5|B3KMY1|Q6NSK0|Q9UIW4	Missense_Mutation	SNP	pfam_PKK,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.P32T	ENST00000176763.5	37	c.94	CCDS34290.1	5	.	.	.	.	.	.	.	.	.	.	G	29.8	5.033867	0.93575	.	.	ENSG00000072786	ENST00000176763;ENST00000545839	T	0.13307	2.6	4.03	4.03	0.46877	Protein kinase-like domain (1);	0.069882	0.64402	D	0.000020	T	0.33294	0.0858	M	0.61703	1.905	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	T	0.08953	-1.0697	10	0.87932	D	0	.	13.7235	0.62743	0.0:0.0:1.0:0.0	.	32	O94804	STK10_HUMAN	T	32	ENSP00000176763:P32T	ENSP00000176763:P32T	P	-	1	0	STK10	171547558	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.366000	0.97143	2.086000	0.62901	0.462000	0.41574	CCC	STK10	-	superfamily_Kinase-like_dom	ENSG00000072786		0.652	STK10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STK10	HGNC	protein_coding	OTTHUMT00000372374.2	-	0.00	88	0	G	NM_005990		171614953	-1	tier1	-	no_errors	ENST00000176763	ensembl	human	known	74_37	missense	30.00	35	15	SNP	1.000	T
STRA13	201254	genome.wustl.edu	37	17	79977072	79977072	+	3'UTR	SNP	C	C	T			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr17:79977072C>T	ENST00000392359.3	-	0	311				STRA13_ENST00000583767.1_5'UTR|STRA13_ENST00000580435.1_3'UTR|STRA13_ENST00000584347.1_Missense_Mutation_p.S129N|STRA13_ENST00000306704.6_3'UTR	NM_001271006.1	NP_001257935.1	A8MT69	CENPX_HUMAN	stimulated by retinoic acid 13						DNA repair (GO:0006281)|kinetochore assembly (GO:0051382)|mitotic nuclear division (GO:0007067)|positive regulation of protein ubiquitination (GO:0031398)|replication fork processing (GO:0031297)|resolution of meiotic recombination intermediates (GO:0000712)	FANCM-MHF complex (GO:0071821)|Fanconi anaemia nuclear complex (GO:0043240)|kinetochore (GO:0000776)	DNA binding (GO:0003677)					all_neural(118;0.0878)|Ovarian(332;0.12)|all_lung(278;0.246)		BRCA - Breast invasive adenocarcinoma(99;0.0114)|OV - Ovarian serous cystadenocarcinoma(97;0.0191)			TCAGCCACGGCTGAGATCCCT	0.642																																					NSCLC(66;370 1886 11380 28417)												0													25.0	33.0	30.0					17																	79977072		2197	4297	6494	SO:0001624	3_prime_UTR_variant	0			BC009571	CCDS32772.1, CCDS59303.1, CCDS59302.1	17q25.3	2013-11-05	2012-12-07		ENSG00000169689	ENSG00000169689			11422	protein-coding gene	gene with protein product		615128	"""stimulated by retinoic acid 13 homolog (mouse)"""			8839844	Standard	NM_144998		Approved	MGC14480, MHF2, FAAP10	uc031rey.1	A8MT69	OTTHUMG00000132129	ENST00000392359.3:c.*9G>A	17.37:g.79977072C>T			O00281|O00282|Q96DD4|Q96F51	Missense_Mutation	SNP	pfam_CENP-X	p.S129N	ENST00000392359.3	37	c.386	CCDS59303.1	17																																																																																			STRA13	-	NULL	ENSG00000169689		0.642	STRA13-002	KNOWN	basic|appris_principal|CCDS	protein_coding	STRA13	HGNC	protein_coding	OTTHUMT00000255174.1	-	0.00	99	0	C	NM_144998		79977072	-1	tier1	-	no_errors	ENST00000584347	ensembl	human	putative	74_37	missense	16.36	92	18	SNP	0.001	T
TAL1	6886	genome.wustl.edu	37	1	47684909	47684909	+	3'UTR	SNP	G	G	A			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr1:47684909G>A	ENST00000294339.3	-	0	2055				TAL1_ENST00000371884.2_3'UTR|TAL1_ENST00000371883.3_3'UTR|TAL1_ENST00000459729.1_5'UTR	NM_003189.2	NP_003180.1	P17542	TAL1_HUMAN	T-cell acute lymphocytic leukemia 1						angiogenesis (GO:0001525)|astrocyte fate commitment (GO:0060018)|basophil differentiation (GO:0030221)|cell fate commitment (GO:0045165)|definitive hemopoiesis (GO:0060216)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|erythrocyte maturation (GO:0043249)|hemangioblast cell differentiation (GO:0060217)|hematopoietic stem cell differentiation (GO:0060218)|hemopoiesis (GO:0030097)|locomotory behavior (GO:0007626)|megakaryocyte development (GO:0035855)|megakaryocyte differentiation (GO:0030219)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|platelet formation (GO:0030220)|positive regulation of cell division (GO:0051781)|positive regulation of chromatin assembly or disassembly (GO:0045799)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell proliferation (GO:0042127)|regulation of mast cell differentiation (GO:0060375)|regulation of stem cell maintenance (GO:2000036)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|spinal cord association neuron differentiation (GO:0021527)	nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|E-box binding (GO:0070888)|enzyme binding (GO:0019899)|histone deacetylase binding (GO:0042826)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			haematopoietic_and_lymphoid_tissue(1)|lung(12)|prostate(1)|upper_aerodigestive_tract(1)	15						CCTGGGTGAAGATGGGGCTCA	0.547			T	"""TRD@, SIL"""	lymphoblastic leukemia/biphasic																																			Dom	yes		1	1p32	6886	T-cell acute lymphocytic leukemia 1 (SCL)		L	0																																										SO:0001624	3_prime_UTR_variant	0			M29038	CCDS547.1	1p32	2013-05-21	2001-12-04		ENSG00000162367	ENSG00000162367		"""Basic helix-loop-helix proteins"""	11556	protein-coding gene	gene with protein product		187040		TCL5		2740341	Standard	NM_001287347		Approved	SCL, bHLHa17	uc009vyq.2	P17542	OTTHUMG00000007847	ENST00000294339.3:c.*483C>T	1.37:g.47684909G>A			D3DQ24	RNA	SNP	-	NULL	ENST00000294339.3	37	NULL	CCDS547.1	1																																																																																			TAL1	-	-	ENSG00000162367		0.547	TAL1-002	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	TAL1	HGNC	protein_coding	OTTHUMT00000021640.1	-	0.00	52	0	G	NM_003189		47684909	-1	tier1	-	no_errors	ENST00000459729	ensembl	human	known	74_37	rna	32.56	29	14	SNP	1.000	A
TADA1	117143	genome.wustl.edu	37	1	166829469	166829469	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr1:166829469G>A	ENST00000367874.4	-	6	739	c.646C>T	c.(646-648)Cca>Tca	p.P216S	TADA1_ENST00000467021.1_5'UTR	NM_053053.3	NP_444281.1	Q96BN2	TADA1_HUMAN	transcriptional adaptor 1	216					chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|STAGA complex (GO:0030914)	transcription coactivator activity (GO:0003713)			endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(1)|stomach(1)	11						TTCAGGTATGGCTGCGGGGTC	0.373																																																	0													110.0	101.0	105.0					1																	166829469		2203	4300	6503	SO:0001583	missense	0			BC015401	CCDS1255.1	1q24.1	2009-10-02	2009-10-02	2009-10-02	ENSG00000152382	ENSG00000152382			30631	protein-coding gene	gene with protein product		612763	"""transcriptional adaptor 1 (HFI1 homolog, yeast)-like"", ""transcriptional adaptor 1 (HFI1 homolog, yeast)"""	TADA1L		11564863	Standard	NM_053053		Approved	STAF42, ADA1, hADA1, HFI1	uc001gdw.3	Q96BN2	OTTHUMG00000034321	ENST00000367874.4:c.646C>T	1.37:g.166829469G>A	ENSP00000356848:p.Pro216Ser		A8K4J9	Missense_Mutation	SNP	superfamily_Histone-fold	p.P216S	ENST00000367874.4	37	c.646	CCDS1255.1	1	.	.	.	.	.	.	.	.	.	.	G	18.74	3.689000	0.68271	.	.	ENSG00000152382	ENST00000367874	T	0.51325	0.71	5.73	5.73	0.89815	.	0.049495	0.85682	N	0.000000	T	0.27349	0.0671	L	0.39245	1.2	0.49687	D	0.999817	P	0.37330	0.59	B	0.34180	0.177	T	0.11084	-1.0602	9	0.32370	T	0.25	-8.036	17.41	0.87482	0.0:0.0:1.0:0.0	.	216	Q96BN2	TADA1_HUMAN	S	216	ENSP00000356848:P216S	ENSP00000356848:P216S	P	-	1	0	TADA1	165096093	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.091000	0.94151	2.710000	0.92621	0.650000	0.86243	CCA	TADA1	-	NULL	ENSG00000152382		0.373	TADA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TADA1	HGNC	protein_coding	OTTHUMT00000082881.1		0.00	40	0	G	NM_053053		166829469	-1			no_errors	ENST00000367874	ensembl	human	known	74_37	missense	5.48	69	4	SNP	1.000	A
SYT14	255928	genome.wustl.edu	37	1	210334142	210334142	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr1:210334142C>T	ENST00000472886.1	+	8	1437	c.1423C>T	c.(1423-1425)Cgc>Tgc	p.R475C	SYT14_ENST00000534859.1_Missense_Mutation_p.R501C|SYT14_ENST00000367015.1_Missense_Mutation_p.R437C|SYT14_ENST00000367019.1_Missense_Mutation_p.R494C|SYT14_ENST00000422431.1_Missense_Mutation_p.R539C|SYT14_ENST00000271745.7_3'UTR|SYT14_ENST00000537238.1_Missense_Mutation_p.R437C|SYT14_ENST00000399639.2_3'UTR			Q8NB59	SYT14_HUMAN	synaptotagmin XIV	475	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				cell death (GO:0008219)	integral component of membrane (GO:0016021)	phospholipid binding (GO:0005543)			endometrium(4)|large_intestine(11)|lung(17)|ovary(1)|prostate(1)|skin(3)	37				OV - Ovarian serous cystadenocarcinoma(81;0.085)		GACATCCATCCGCAGAGGGCA	0.378																																																	0													110.0	115.0	113.0					1																	210334142		2203	4299	6502	SO:0001583	missense	0			AK091517	CCDS31014.1, CCDS53470.1, CCDS58058.1	1q32.2	2013-01-21			ENSG00000143469	ENSG00000143469		"""Synaptotagmins"""	23143	protein-coding gene	gene with protein product		610949					Standard	NM_001256006		Approved	sytXIV, FLJ34198	uc001hhs.5	Q8NB59	OTTHUMG00000036652	ENST00000472886.1:c.1423C>T	1.37:g.210334142C>T	ENSP00000418901:p.Arg475Cys		B1AJU0|B1AJU1|F5H426|Q5THX7|Q707N3|Q707N4|Q707N5|Q707N6|Q707N7	Missense_Mutation	SNP	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom	p.R539C	ENST00000472886.1	37	c.1615	CCDS31014.1	1	.	.	.	.	.	.	.	.	.	.	C	10.44	1.351773	0.24512	.	.	ENSG00000143469	ENST00000422431;ENST00000534859;ENST00000537238;ENST00000367019;ENST00000472886;ENST00000367015	T;T;T;T;T;T	0.72051	-0.62;-0.62;-0.62;-0.62;-0.62;-0.62	5.84	5.84	0.93424	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.128347	0.64402	D	0.000019	T	0.70316	0.3210	L	0.53249	1.67	0.80722	D	1	P;B;B;P	0.44627	0.786;0.376;0.009;0.839	B;B;B;B	0.41088	0.329;0.168;0.007;0.347	T	0.71073	-0.4698	10	0.44086	T	0.13	-6.4563	20.1251	0.97974	0.0:1.0:0.0:0.0	.	522;475;494;539	A1L3Y1;Q8NB59;Q8NB59-6;F5H426	.;SYT14_HUMAN;.;.	C	539;501;437;494;475;437	ENSP00000389039:R539C;ENSP00000442891:R501C;ENSP00000437423:R437C;ENSP00000355986:R494C;ENSP00000418901:R475C;ENSP00000355982:R437C	ENSP00000355982:R437C	R	+	1	0	SYT14	208400765	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	5.686000	0.68211	2.751000	0.94390	0.585000	0.79938	CGC	SYT14	-	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom	ENSG00000143469		0.378	SYT14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYT14	HGNC	protein_coding	OTTHUMT00000089124.1	-	0.00	44	0	C	NM_153262		210334142	+1	tier1	-	no_errors	ENST00000422431	ensembl	human	known	74_37	missense	18.18	36	8	SNP	1.000	T
TAS2R16	50833	genome.wustl.edu	37	7	122635287	122635287	+	Silent	SNP	C	C	G			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr7:122635287C>G	ENST00000249284.2	-	1	467	c.402G>C	c.(400-402)ctG>ctC	p.L134L		NM_016945.2	NP_058641.1	Q9NYV7	T2R16_HUMAN	taste receptor, type 2, member 16	134					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|G-protein coupled receptor signaling pathway (GO:0007186)	endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	bitter taste receptor activity (GO:0033038)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(18)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	31						AAGTAATCATCAGAGAACCCA	0.413																																																	0													118.0	114.0	116.0					7																	122635287		2203	4300	6503	SO:0001819	synonymous_variant	0			AF227139	CCDS5785.1	7q31.1-q31.3	2012-08-22			ENSG00000128519	ENSG00000128519		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	14921	protein-coding gene	gene with protein product		604867				10761934	Standard	NM_016945		Approved	T2R16	uc003vkl.1	Q9NYV7	OTTHUMG00000157090	ENST00000249284.2:c.402G>C	7.37:g.122635287C>G			A4D0X2|Q502V3|Q549U8|Q645W1	Silent	SNP	pfam_TAS2_rcpt	p.L134	ENST00000249284.2	37	c.402	CCDS5785.1	7																																																																																			TAS2R16	-	pfam_TAS2_rcpt	ENSG00000128519		0.413	TAS2R16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAS2R16	HGNC	protein_coding	OTTHUMT00000347409.1	-	0.00	23	0	C	NM_016945		122635287	-1	tier1	-	no_errors	ENST00000249284	ensembl	human	known	74_37	silent	16.00	21	4	SNP	0.001	G
TAS2R31	259290	genome.wustl.edu	37	12	11183889	11183889	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr12:11183889G>C	ENST00000390675.2	-	1	117	c.46C>G	c.(46-48)Cta>Gta	p.L16V	TAS2R14_ENST00000381852.4_Intron|PRR4_ENST00000536668.1_Intron	NM_176885.2	NP_795366.2	P59538	T2R31_HUMAN	taste receptor, type 2, member 31	16					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)			kidney(1)|lung(6)	7						ATAACAAATAGAACCACTACC	0.373																																																	0													44.0	45.0	45.0					12																	11183889		1873	4128	6001	SO:0001583	missense	0			AX097748, AF494228	CCDS53747.1	12p13.2	2012-08-22				ENSG00000256436		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	19113	protein-coding gene	gene with protein product		612669	"""taste receptor, type 2, member 44"""	TAS2R44			Standard	NM_176885		Approved	T2R31, T2R53	uc001qzo.1	P59538		ENST00000390675.2:c.46C>G	12.37:g.11183889G>C	ENSP00000375093:p.Leu16Val		P59547|Q17R84|Q645X5	Missense_Mutation	SNP	pfam_TAS2_rcpt	p.L16V	ENST00000390675.2	37	c.46	CCDS53747.1	12	.	.	.	.	.	.	.	.	.	.	T	8.383	0.837947	0.16891	.	.	ENSG00000256436	ENST00000390675	T	0.37235	1.21	2.29	-0.117	0.13551	.	.	.	.	.	T	0.25754	0.0627	L	0.49126	1.545	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.28554	-1.0040	9	0.19590	T	0.45	.	4.1987	0.10455	0.0:0.356:0.4746:0.1694	.	16	P59538	T2R31_HUMAN	V	16	ENSP00000375093:L16V	ENSP00000375093:L16V	L	-	1	2	TAS2R31	11075156	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.058000	0.14301	-0.086000	0.12550	-1.142000	0.01873	CTA	TAS2R31	-	pfam_TAS2_rcpt	ENSG00000256436		0.373	TAS2R31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAS2R31	HGNC	protein_coding	OTTHUMT00000400233.1	-	0.00	41	0	G	NM_176885		11183889	-1	tier1	-	no_errors	ENST00000390675	ensembl	human	known	74_37	missense	32.22	60	29	SNP	0.000	C
TLE2	7089	genome.wustl.edu	37	19	3005571	3005571	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr19:3005571C>A	ENST00000262953.6	-	17	2022	c.1760G>T	c.(1759-1761)gGc>gTc	p.G587V	TLE2_ENST00000443826.3_Missense_Mutation_p.G465V|TLE2_ENST00000590536.1_Missense_Mutation_p.G588V|TLE2_ENST00000586422.1_Intron|TLE2_ENST00000455444.2_Missense_Mutation_p.G465V|TLE2_ENST00000426948.2_Missense_Mutation_p.G601V|TLE2_ENST00000591529.1_Missense_Mutation_p.G601V|TLE2_ENST00000447365.2_Missense_Mutation_p.G254V	NM_003260.4	NP_003251.2	Q04725	TLE2_HUMAN	transducin-like enhancer of split 2	587					negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	extracellular space (GO:0005615)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(6)|prostate(1)	13				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GTCCGTGTGGCCCTGGAACTG	0.657																																																	0													39.0	45.0	43.0					19																	3005571		2054	4230	6284	SO:0001583	missense	0			M99436	CCDS45911.1, CCDS45912.1, CCDS45913.1, CCDS74255.1	19p13.3	2014-03-07	2014-03-07					"""WD repeat domain containing"""	11838	protein-coding gene	gene with protein product	"""enhancer of split groucho 2"""	601041	"""transducin-like enhancer of split 2, homolog of Drosophila E(sp1)"", ""transducin-like enhancer of split 2 (E(sp1) homolog, Drosophila)"""			8808280	Standard	NM_003260		Approved	ESG2, GRG2, ESG, FLJ41188	uc002lww.3	Q04725		ENST00000262953.6:c.1760G>T	19.37:g.3005571C>A	ENSP00000262953:p.Gly587Val		B4DE03|E9PEV7|F8WCH2|Q8WVY0|Q9Y6S0	Missense_Mutation	SNP	pfam_Groucho/TLE_N,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,prints_Groucho_enhance,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.G587V	ENST00000262953.6	37	c.1760	CCDS45911.1	19	.	.	.	.	.	.	.	.	.	.	C	17.12	3.306975	0.60305	.	.	ENSG00000065717	ENST00000262953;ENST00000455444;ENST00000360654;ENST00000450017;ENST00000447365;ENST00000443826;ENST00000426948	T;T;T;T;T	0.70516	-0.49;-0.49;-0.49;-0.49;-0.49	4.36	3.3	0.37823	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.82098	0.4963	M	0.75615	2.305	0.80722	D	1	D;D;D;D;D	0.89917	0.995;1.0;1.0;0.991;0.991	D;D;D;P;P	0.97110	0.935;1.0;0.999;0.906;0.906	D	0.84003	0.0344	10	0.87932	D	0	-14.7759	12.289	0.54807	0.0:0.8272:0.1728:0.0	.	465;254;601;465;587	E9PEV7;B4DE62;F8WCH2;B4DE03;Q04725	.;.;.;.;TLE2_HUMAN	V	587;465;136;581;254;465;601	ENSP00000262953:G587V;ENSP00000413107:G465V;ENSP00000406523:G254V;ENSP00000392427:G465V;ENSP00000392869:G601V	ENSP00000262953:G587V	G	-	2	0	TLE2	2956571	1.000000	0.71417	1.000000	0.80357	0.866000	0.49608	5.879000	0.69690	1.163000	0.42636	0.462000	0.41574	GGC	TLE2	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000065717		0.657	TLE2-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	TLE2	HGNC	protein_coding	OTTHUMT00000452194.2	-	0.00	35	0	C	NM_003260		3005571	-1	tier1	-	no_errors	ENST00000262953	ensembl	human	known	74_37	missense	18.18	18	4	SNP	1.000	A
TMC1	117531	genome.wustl.edu	37	9	75404064	75404064	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr9:75404064C>A	ENST00000297784.5	+	15	1595	c.1055C>A	c.(1054-1056)gCc>gAc	p.A352D	TMC1_ENST00000396237.3_Missense_Mutation_p.A352D|TMC1_ENST00000340019.3_Missense_Mutation_p.A352D	NM_138691.2	NP_619636.2	Q8TDI8	TMC1_HUMAN	transmembrane channel-like 1	352					auditory receptor cell development (GO:0060117)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|vestibular reflex (GO:0060005)	external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|stereocilium bundle tip (GO:0032426)	voltage-gated calcium channel activity (GO:0005245)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(4)|lung(21)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	36						GAAAAAGCAGCCCAAGTAGAA	0.368																																					Pancreas(75;173 1345 14232 34245 43413)												0													102.0	95.0	97.0					9																	75404064		2203	4300	6503	SO:0001583	missense	0			AF417578	CCDS6643.1	9q21	2014-01-28			ENSG00000165091	ENSG00000165091			16513	protein-coding gene	gene with protein product		606706	"""transmembrane, cochlear expressed, 1"""	DFNA36, DFNB7, DFNB11		11850618, 11850623	Standard	NM_138691		Approved		uc004aiz.1	Q8TDI8	OTTHUMG00000020014	ENST00000297784.5:c.1055C>A	9.37:g.75404064C>A	ENSP00000297784:p.Ala352Asp		A8MVZ2|B1AM91	Missense_Mutation	SNP	pfam_TMC	p.A352D	ENST00000297784.5	37	c.1055	CCDS6643.1	9	.	.	.	.	.	.	.	.	.	.	C	16.67	3.188648	0.57909	.	.	ENSG00000165091	ENST00000297784;ENST00000340019;ENST00000396235;ENST00000537917;ENST00000538054;ENST00000542143;ENST00000396237	T;T;T	0.52057	0.68;0.68;0.68	6.17	5.23	0.72850	.	0.103621	0.64402	D	0.000007	T	0.29914	0.0748	N	0.11427	0.14	0.35499	D	0.799622	B;B;B	0.30793	0.295;0.295;0.295	B;B;B	0.36666	0.23;0.23;0.23	T	0.34875	-0.9811	10	0.23891	T	0.37	-16.7003	10.0958	0.42475	0.1205:0.6516:0.2279:0.0	.	319;319;352	A5D8Y1;A4FUA6;Q8TDI8	.;.;TMC1_HUMAN	D	352;352;319;319;319;346;352	ENSP00000297784:A352D;ENSP00000341433:A352D;ENSP00000379538:A352D	ENSP00000297784:A352D	A	+	2	0	TMC1	74593884	1.000000	0.71417	0.996000	0.52242	0.989000	0.77384	1.746000	0.38288	2.941000	0.99782	0.655000	0.94253	GCC	TMC1	-	NULL	ENSG00000165091		0.368	TMC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMC1	HGNC	protein_coding	OTTHUMT00000052655.1	-	0.00	9	0	C			75404064	+1	tier1	-	no_errors	ENST00000297784	ensembl	human	known	74_37	missense	64.29	5	9	SNP	1.000	A
TMEFF2	23671	genome.wustl.edu	37	2	192863843	192863843	+	Nonsense_Mutation	SNP	C	C	A			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr2:192863843C>A	ENST00000272771.5	-	6	1812	c.628G>T	c.(628-630)Gaa>Taa	p.E210*	AC098617.1_ENST00000428980.2_RNA|AC098617.1_ENST00000424116.2_RNA|TMEFF2_ENST00000392314.1_Nonsense_Mutation_p.E210*|TMEFF2_ENST00000487771.1_5'UTR	NM_016192.2	NP_057276.2	Q9UIK5	TEFF2_HUMAN	transmembrane protein with EGF-like and two follistatin-like domains 2	210	Kazal-like 2. {ECO:0000255|PROSITE- ProRule:PRU00798}.					extracellular region (GO:0005576)|integral component of membrane (GO:0016021)				breast(2)|cervix(1)|kidney(2)|large_intestine(4)|liver(1)|lung(12)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	27			OV - Ovarian serous cystadenocarcinoma(117;0.0835)			CACGATGCTTCTTTGATTTGG	0.363																																					Pancreas(50;1277 1381 28487 47072)												0													148.0	137.0	141.0					2																	192863843		2203	4300	6503	SO:0001587	stop_gained	0			AB017269	CCDS2314.1	2q32.3	2010-05-04			ENSG00000144339	ENSG00000144339			11867	protein-coding gene	gene with protein product	"""transmembrane protein TENB2"", ""tomoregulin"", ""cancer/testis antigen family 120, member 2"""	605734				10903839	Standard	NM_016192		Approved	TENB2, HPP1, TR, TPEF, CT120.2	uc002utc.3	Q9UIK5	OTTHUMG00000132723	ENST00000272771.5:c.628G>T	2.37:g.192863843C>A	ENSP00000272771:p.Glu210*		Q2FA44|Q4ZFW4|Q53H90|Q53RE1|Q8N2R5|Q9NR15|Q9NSS5|Q9P2Y9|Q9UK65	Nonsense_Mutation	SNP	pfam_Kazal_dom,smart_Kazal_dom,pfscan_EG-like_dom	p.E210*	ENST00000272771.5	37	c.628	CCDS2314.1	2	.	.	.	.	.	.	.	.	.	.	C	49	15.746702	0.99844	.	.	ENSG00000144339	ENST00000392314;ENST00000272771	.	.	.	5.74	5.74	0.90152	.	0.100830	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.15499	T	0.54	-18.3853	20.2982	0.98569	0.0:1.0:0.0:0.0	.	.	.	.	X	210	.	ENSP00000272771:E210X	E	-	1	0	TMEFF2	192572088	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.445000	0.80570	2.873000	0.98535	0.563000	0.77884	GAA	TMEFF2	-	pfam_Kazal_dom,smart_Kazal_dom	ENSG00000144339		0.363	TMEFF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEFF2	HGNC	protein_coding	OTTHUMT00000256065.2	-	0.00	100	0	C	NM_016192		192863843	-1	tier1	-	no_errors	ENST00000272771	ensembl	human	known	74_37	nonsense	18.18	117	26	SNP	1.000	A
TNN	63923	genome.wustl.edu	37	1	175066783	175066783	+	Nonsense_Mutation	SNP	C	C	T			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr1:175066783C>T	ENST00000239462.4	+	8	1932	c.1819C>T	c.(1819-1821)Cga>Tga	p.R607*		NM_022093.1	NP_071376.1	Q9UQP3	TENN_HUMAN	tenascin N	607	Fibronectin type-III 4. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axonogenesis (GO:0007409)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)	cell surface (GO:0009986)|proteinaceous extracellular matrix (GO:0005578)				NS(1)|central_nervous_system(2)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(29)|liver(1)|lung(81)|ovary(5)|prostate(6)|skin(5)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	156		Breast(1374;0.000962)		KIRC - Kidney renal clear cell carcinoma(1967;0.00198)		GAAGGGGGACCGAGAGAGCAA	0.532																																																	0													77.0	71.0	73.0					1																	175066783		2203	4300	6503	SO:0001587	stop_gained	0			AK127044	CCDS30943.1	1q23-q24	2013-02-11			ENSG00000120332	ENSG00000120332		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	22942	protein-coding gene	gene with protein product							Standard	NM_022093		Approved		uc001gkl.1	Q9UQP3	OTTHUMG00000034882	ENST00000239462.4:c.1819C>T	1.37:g.175066783C>T	ENSP00000239462:p.Arg607*		B9EGP3|Q5R360	Nonsense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Fibrinogen_a/b/g_C_dom,pfam_EGF_extracell,superfamily_Fibrinogen_a/b/g_C_dom,superfamily_Fibronectin_type3,smart_EG-like_dom,smart_Fibronectin_type3,smart_Fibrinogen_a/b/g_C_dom,pfscan_Fibronectin_type3	p.R607*	ENST00000239462.4	37	c.1819	CCDS30943.1	1	.	.	.	.	.	.	.	.	.	.	C	39	7.444221	0.98289	.	.	ENSG00000120332	ENST00000239462	.	.	.	5.63	3.67	0.42095	.	0.586078	0.16519	N	0.210872	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	14.1635	0.65461	0.2739:0.7261:0.0:0.0	.	.	.	.	X	607	.	ENSP00000239462:R607X	R	+	1	2	TNN	173333406	0.085000	0.21516	0.023000	0.16930	0.936000	0.57629	1.994000	0.40757	0.645000	0.30675	0.655000	0.94253	CGA	TNN	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000120332		0.532	TNN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNN	HGNC	protein_coding	OTTHUMT00000084422.1	-	0.00	39	0	C	XM_040527		175066783	+1	tier1	-	no_errors	ENST00000239462	ensembl	human	known	74_37	nonsense	11.76	45	6	SNP	0.139	T
TP53	7157	genome.wustl.edu	37	17	7578457	7578457	+	Missense_Mutation	SNP	C	C	T	rs587782144		TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr17:7578457C>T	ENST00000269305.4	-	5	662	c.473G>A	c.(472-474)cGc>cAc	p.R158H	TP53_ENST00000574684.1_5'Flank|TP53_ENST00000420246.2_Missense_Mutation_p.R158H|TP53_ENST00000455263.2_Missense_Mutation_p.R158H|TP53_ENST00000413465.2_Missense_Mutation_p.R158H|TP53_ENST00000359597.4_Missense_Mutation_p.R158H|TP53_ENST00000445888.2_Missense_Mutation_p.R158H	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	158	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		R -> C (in sporadic cancers; somatic mutation).|R -> F (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|R -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> H (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> L (in sporadic cancers; somatic mutation).|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in a sporadic cancer; somatic mutation).|R -> S (in sporadic cancers; somatic mutation).|R -> Y (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R158L(77)|p.R158H(74)|p.R158P(9)|p.R65L(8)|p.0?(8)|p.R26L(8)|p.R158fs(6)|p.R158fs*11(6)|p.R65H(5)|p.R26H(5)|p.R158_A159insX(4)|p.R65fs(2)|p.R158_A159delRA(2)|p.R156_I162delRVRAMAI(2)|p.V157fs*9(2)|p.P153fs*22(2)|p.R26fs(2)|p.V157fs*22(2)|p.V157_C176del20(1)|p.R156_A161delRVRAMA(1)|p.R158F(1)|p.P151_V173del23(1)|p.R156_R158delRVR(1)|p.R156fs*18(1)|p.R26fs*11(1)|p.R156_A161del(1)|p.V157_M160delVRAM(1)|p.V157_R158delVR(1)|p.S149fs*72(1)|p.A159fs*21(1)|p.T155_A161delTRVRAMA(1)|p.G154fs*22(1)|p.R65fs*11(1)|p.R156fs*20(1)|p.R158C(1)|p.V157_I162delVRAMAI(1)|p.V157fs*21(1)|p.R158fs*8(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GGCCATGGCGCGGACGCGGGT	0.627		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	244	Substitution - Missense(188)|Deletion - Frameshift(19)|Deletion - In frame(13)|Complex(10)|Whole gene deletion(8)|Insertion - In frame(4)|Complex - frameshift(2)	lung(78)|central_nervous_system(33)|oesophagus(20)|haematopoietic_and_lymphoid_tissue(19)|large_intestine(18)|upper_aerodigestive_tract(12)|stomach(12)|urinary_tract(9)|prostate(7)|kidney(6)|liver(6)|breast(5)|bone(4)|soft_tissue(3)|ovary(3)|pancreas(3)|thyroid(2)|biliary_tract(2)|vulva(1)|thymus(1)	GRCh37	CM994513	TP53	M							49.0	51.0	50.0					17																	7578457		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.473G>A	17.37:g.7578457C>T	ENSP00000269305:p.Arg158His		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.R158H	ENST00000269305.4	37	c.473	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	13.67	2.306299	0.40795	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315;ENST00000508793	D;D;D;D;D;D;D;D;D	0.99868	-7.32;-7.32;-7.32;-7.32;-7.32;-7.32;-7.32;-7.32;-7.32	5.59	4.63	0.57726	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.110116	0.64402	D	0.000010	D	0.99809	0.9917	M	0.77486	2.375	0.58432	D	0.999999	D;P;D;D;P;P;D	0.89917	0.998;0.631;0.984;0.982;0.831;0.48;1.0	P;B;P;P;P;B;D	0.97110	0.907;0.274;0.76;0.751;0.516;0.242;1.0	D	0.96738	0.9544	10	0.87932	D	0	-10.4795	12.6491	0.56751	0.0:0.9196:0.0:0.0804	.	119;158;158;65;158;158;158	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	H	158;158;158;158;158;158;147;65;26;65;26;158	ENSP00000410739:R158H;ENSP00000352610:R158H;ENSP00000269305:R158H;ENSP00000398846:R158H;ENSP00000391127:R158H;ENSP00000391478:R158H;ENSP00000425104:R26H;ENSP00000423862:R65H;ENSP00000424104:R158H	ENSP00000269305:R158H	R	-	2	0	TP53	7519182	1.000000	0.71417	0.034000	0.17996	0.175000	0.22909	7.775000	0.85489	1.514000	0.48869	-0.140000	0.14226	CGC	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor	ENSG00000141510		0.627	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	-	0.00	483	0	C	NM_000546		7578457	-1	tier1	-	no_errors	ENST00000269305	ensembl	human	known	74_37	missense	21.26	299	81	SNP	0.989	T
TP53	7157	genome.wustl.edu	37	17	7578556	7578556	+	Splice_Site	SNP	T	T	A			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr17:7578556T>A	ENST00000269305.4	-	5	565		c.e5-2		TP53_ENST00000574684.1_5'Flank|TP53_ENST00000420246.2_Splice_Site|TP53_ENST00000455263.2_Splice_Site|TP53_ENST00000413465.2_Splice_Site|TP53_ENST00000359597.4_Splice_Site|TP53_ENST00000445888.2_Splice_Site	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53						apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.?(34)|p.0?(8)|p.V73fs*9(1)|p.Y126fs*11(1)|p.P13fs*18(1)|p.T125_Y126insX(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	AGGGGAGTACTGTAGGAAGAG	0.552		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	46	Unknown(34)|Whole gene deletion(8)|Deletion - Frameshift(3)|Insertion - In frame(1)	lung(19)|breast(7)|central_nervous_system(4)|ovary(4)|bone(4)|upper_aerodigestive_tract(2)|large_intestine(2)|oesophagus(2)|stomach(1)|haematopoietic_and_lymphoid_tissue(1)											41.0	42.0	41.0					17																	7578556		2203	4300	6503	SO:0001630	splice_region_variant	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.376-2A>T	17.37:g.7578556T>A			Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Splice_Site	SNP	-	e4-2	ENST00000269305.4	37	c.376-2	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	T	17.69	3.452205	0.63290	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000514944;ENST00000508793;ENST00000503591	.	.	.	4.62	4.62	0.57501	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.6026	0.45375	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	TP53	7519281	1.000000	0.71417	0.994000	0.49952	0.902000	0.53008	6.214000	0.72200	2.078000	0.62432	0.533000	0.62120	.	TP53	-	-	ENSG00000141510		0.552	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	-	0.00	309	0	T	NM_000546	Intron	7578556	-1	tier1	-	no_errors	ENST00000269305	ensembl	human	known	74_37	splice_site	42.79	130	98	SNP	1.000	A
TRAIP	10293	genome.wustl.edu	37	3	49867177	49867177	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr3:49867177C>T	ENST00000331456.2	-	13	1222	c.1109G>A	c.(1108-1110)gGc>gAc	p.G370D	TRAIP_ENST00000469027.1_Missense_Mutation_p.G215D	NM_005879.2	NP_005870.2	Q9BWF2	TRAIP_HUMAN	TRAF interacting protein	370	Interaction with CYLD.				apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|receptor signaling protein activity (GO:0005057)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|kidney(2)|large_intestine(2)|liver(2)|lung(9)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	24				BRCA - Breast invasive adenocarcinoma(193;4.71e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		ACAGCTCTGGCCACCCAGTGA	0.582																																																	0													38.0	39.0	38.0					3																	49867177		2203	4300	6503	SO:0001583	missense	0			BC019283	CCDS2806.1	3p21.31	2013-01-09			ENSG00000183763	ENSG00000183763		"""RING-type (C3HC4) zinc fingers"""	30764	protein-coding gene	gene with protein product	"""ring finger protein 206"""	605958				9104814	Standard	NM_005879		Approved	TRIP, RNF206	uc003cxs.1	Q9BWF2	OTTHUMG00000158269	ENST00000331456.2:c.1109G>A	3.37:g.49867177C>T	ENSP00000328203:p.Gly370Asp		B5BU84|B5BUL3|O00467	Missense_Mutation	SNP	pfam_Znf_C3HC4_RING-type,superfamily_Prefoldin,smart_Znf_RING,pfscan_Znf_RING	p.G370D	ENST00000331456.2	37	c.1109	CCDS2806.1	3	.	.	.	.	.	.	.	.	.	.	C	6.867	0.529382	0.13127	.	.	ENSG00000183763	ENST00000331456;ENST00000469027	T	0.43688	0.94	5.21	3.37	0.38596	.	0.477402	0.23377	N	0.048852	T	0.27349	0.0671	L	0.31294	0.92	0.23445	N	0.997666	B;B	0.21309	0.053;0.054	B;B	0.20767	0.028;0.031	T	0.18999	-1.0319	10	0.09590	T	0.72	-22.3962	11.0596	0.47940	0.0:0.8324:0.0:0.1676	.	370;370	A8K807;Q9BWF2	.;TRAIP_HUMAN	D	370;215	ENSP00000420085:G215D	ENSP00000328203:G370D	G	-	2	0	TRAIP	49842181	0.974000	0.33945	0.989000	0.46669	0.582000	0.36321	1.023000	0.30065	0.787000	0.33731	-0.797000	0.03246	GGC	TRAIP	-	NULL	ENSG00000183763		0.582	TRAIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRAIP	HGNC	protein_coding	OTTHUMT00000350518.1		0.00	32	0	C	NM_005879		49867177	-1			no_errors	ENST00000331456	ensembl	human	known	74_37	missense	18.75	13	3	SNP	0.972	T
TRIP10	9322	genome.wustl.edu	37	19	6751205	6751205	+	Nonsense_Mutation	SNP	C	C	T			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr19:6751205C>T	ENST00000313244.9	+	15	1824	c.1789C>T	c.(1789-1791)Cga>Tga	p.R597*	CTD-3128G10.6_ENST00000594056.1_RNA|TRIP10_ENST00000313285.8_Nonsense_Mutation_p.R541*|TRIP10_ENST00000600428.1_Nonsense_Mutation_p.R433*|TRIP10_ENST00000596758.1_Silent_p.S550S			Q15642	CIP4_HUMAN	thyroid hormone receptor interactor 10	597	Interaction with ARHGAP17, DAAM1, DIAPH1 and DIAPH2.|Interaction with DNM1 and WASL.|Interaction with PDE6G. {ECO:0000250}.|Interaction with WAS.|Required for interaction with FASLG and localization to lysosomes.|Required for podosome formation.|SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				actin cytoskeleton organization (GO:0030036)|cell communication (GO:0007154)|endocytosis (GO:0006897)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|lysosome (GO:0005764)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)|lipid binding (GO:0008289)			NS(1)|breast(1)|endometrium(1)|large_intestine(1)|liver(2)|lung(7)|ovary(1)|prostate(1)|urinary_tract(1)	16						CTCCTACCTCCGAGTCACGCT	0.617																																																	0													63.0	69.0	67.0					19																	6751205		2203	4300	6503	SO:0001587	stop_gained	0			AB072596	CCDS12172.1, CCDS74271.1, CCDS74272.1	19p13.3	2008-02-05			ENSG00000125733	ENSG00000125733			12304	protein-coding gene	gene with protein product	"""Cdc42-interacting protein"""	604504	"""salt tolerator"""	STOT		7776974, 9210375, 11294612	Standard	XM_005259683		Approved	STP, HSTP, CIP4	uc002mfr.3	Q15642	OTTHUMG00000150255	ENST00000313244.9:c.1789C>T	19.37:g.6751205C>T	ENSP00000320117:p.Arg597*		B2R8A6|B7WP22|D6W645|O15184|Q53G22|Q5TZN1|Q6FI24|Q8NFL1|Q8TCY1|Q8TDX3|Q96RJ1	Nonsense_Mutation	SNP	pfam_FCH_dom,pfam_SH3_domain,superfamily_SH3_domain,smart_FCH_dom,smart_SH3_domain,pfscan_FCH_dom,pfscan_SH3_domain	p.R597*	ENST00000313244.9	37	c.1789		19	.	.	.	.	.	.	.	.	.	.	C	21.4	4.145906	0.77888	.	.	ENSG00000125733	ENST00000313285;ENST00000313244	.	.	.	4.84	3.79	0.43588	.	0.569877	0.16222	N	0.224005	.	.	.	.	.	.	0.58432	D	0.999999	.	.	.	.	.	.	.	.	.	.	0.27785	T	0.31	-11.8101	11.7263	0.51712	0.0:0.6556:0.3444:0.0	.	.	.	.	X	541;597	.	ENSP00000320117:R597X	R	+	1	2	TRIP10	6702205	0.160000	0.22878	0.993000	0.49108	0.148000	0.21650	0.697000	0.25556	1.379000	0.46325	0.305000	0.20034	CGA	TRIP10	-	superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain	ENSG00000125733		0.617	TRIP10-003	KNOWN	basic	protein_coding	TRIP10	HGNC	protein_coding	OTTHUMT00000317129.2	-	0.00	35	0	C			6751205	+1	tier1	-	no_errors	ENST00000313244	ensembl	human	known	74_37	nonsense	23.33	23	7	SNP	0.991	T
TSPAN33	340348	genome.wustl.edu	37	7	128802357	128802357	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr7:128802357C>A	ENST00000289407.4	+	3	392	c.283C>A	c.(283-285)Cag>Aag	p.Q95K	Y_RNA_ENST00000363759.1_RNA	NM_178562.3	NP_848657.1	Q86UF1	TSN33_HUMAN	tetraspanin 33	95					establishment of protein localization to plasma membrane (GO:0090002)|protein maturation (GO:0051604)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tetraspanin-enriched microdomain (GO:0097197)	enzyme binding (GO:0019899)			NS(1)|endometrium(1)|large_intestine(3)|lung(7)|ovary(1)|prostate(1)	14						CTGCCTCCTGCAGACGGTGAG	0.607																																																	0													96.0	77.0	83.0					7																	128802357		2203	4300	6503	SO:0001583	missense	0				CCDS5810.1	7q32.3	2013-02-14			ENSG00000158457	ENSG00000158457		"""Tetraspanins"""	28743	protein-coding gene	gene with protein product		610120				16213355, 16242907	Standard	XM_006715960		Approved	MGC50844, Penumbra	uc003vop.2	Q86UF1	OTTHUMG00000158420	ENST00000289407.4:c.283C>A	7.37:g.128802357C>A	ENSP00000289407:p.Gln95Lys			Missense_Mutation	SNP	pfam_Tetraspanin/Peripherin,superfamily_Tetraspanin_EC2,prints_Tetraspanin	p.Q95K	ENST00000289407.4	37	c.283	CCDS5810.1	7	.	.	.	.	.	.	.	.	.	.	C	10.77	1.443063	0.25987	.	.	ENSG00000158457	ENST00000289407	T	0.78481	-1.18	5.82	5.82	0.92795	.	0.000000	0.85682	D	0.000000	T	0.51092	0.1654	N	0.01454	-0.855	0.80722	D	1	B	0.14012	0.009	B	0.15052	0.012	T	0.57148	-0.7861	10	0.02654	T	1	-14.0862	17.6515	0.88165	0.0:1.0:0.0:0.0	.	95	Q86UF1	TSN33_HUMAN	K	95	ENSP00000289407:Q95K	ENSP00000289407:Q95K	Q	+	1	0	TSPAN33	128589593	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.188000	0.58351	2.773000	0.95371	0.650000	0.86243	CAG	TSPAN33	-	pfam_Tetraspanin/Peripherin,prints_Tetraspanin	ENSG00000158457		0.607	TSPAN33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSPAN33	HGNC	protein_coding	OTTHUMT00000350983.1	-	0.00	64	0	C	NM_178562		128802357	+1	tier1	-	no_errors	ENST00000289407	ensembl	human	known	74_37	missense	25.00	39	13	SNP	1.000	A
TSPEAR	54084	genome.wustl.edu	37	21	45949798	45949798	+	Missense_Mutation	SNP	C	C	T	rs146216896		TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr21:45949798C>T	ENST00000323084.4	-	5	738	c.673G>A	c.(673-675)Gcc>Acc	p.A225T	TSPEAR_ENST00000397916.1_Missense_Mutation_p.A157T	NM_001272037.1|NM_144991.2	NP_001258966.1|NP_659428.2	Q8WU66	TSEAR_HUMAN	thrombospondin-type laminin G domain and EAR repeats	225	Laminin G-like.				sensory perception of sound (GO:0007605)	cell surface (GO:0009986)|ciliary membrane (GO:0060170)|extracellular region (GO:0005576)|stereocilium (GO:0032420)				breast(1)|central_nervous_system(6)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(7)|ovary(1)|pancreas(1)|skin(6)|soft_tissue(1)|upper_aerodigestive_tract(2)	37						CTTGGGGTGGCGTCTGAGCCC	0.672																																																	0								C	THR/ALA	0,4406		0,0,2203	33.0	37.0	36.0		673	5.1	1.0	21	dbSNP_134	36	1,8599	1.2+/-3.3	0,1,4299	yes	missense	TSPEAR	NM_144991.2	58	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	225/670	45949798	1,13005	2203	4300	6503	SO:0001583	missense	0			AJ487962	CCDS13712.1, CCDS74801.1	21q22.3	2012-10-30	2011-01-25	2011-01-25	ENSG00000175894	ENSG00000175894			1268	protein-coding gene	gene with protein product		612920	"""chromosome 21 open reading frame 29"", ""deafness, autosomal recessive 98"""	C21orf29, DFNB98		12095917, 22678063	Standard	NM_144991		Approved	MGC11251, TSP-EAR	uc002zfe.1	Q8WU66	OTTHUMG00000041215	ENST00000323084.4:c.673G>A	21.37:g.45949798C>T	ENSP00000321987:p.Ala225Thr			Missense_Mutation	SNP	pfam_EPTP,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,pfscan_EAR	p.A225T	ENST00000323084.4	37	c.673	CCDS13712.1	21	.	.	.	.	.	.	.	.	.	.	C	29.4	5.004857	0.93287	0.0	1.16E-4	ENSG00000175894	ENST00000323084;ENST00000397916;ENST00000341581	T;T	0.45668	0.89;0.89	5.11	5.11	0.69529	Concanavalin A-like lectin/glucanase (1);	0.000000	0.85682	D	0.000000	T	0.65123	0.2661	M	0.79475	2.455	0.80722	D	1	D	0.89917	1.0	D	0.63283	0.913	T	0.70648	-0.4814	10	0.87932	D	0	-12.0784	18.5157	0.90935	0.0:1.0:0.0:0.0	.	225	Q8WU66	TSEAR_HUMAN	T	225;157;225	ENSP00000321987:A225T;ENSP00000381012:A157T	ENSP00000321987:A225T	A	-	1	0	TSPEAR	44774226	1.000000	0.71417	0.994000	0.49952	0.721000	0.41392	6.738000	0.74822	2.382000	0.81193	0.491000	0.48974	GCC	TSPEAR	-	superfamily_ConA-like_lec_gl_sf	ENSG00000175894		0.672	TSPEAR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSPEAR	HGNC	protein_coding	OTTHUMT00000098761.1	-	0.00	42	0	C	NM_144991		45949798	-1	tier1	rs146216896	no_errors	ENST00000323084	ensembl	human	known	74_37	missense	14.04	49	8	SNP	1.000	T
TSPYL1	7259	genome.wustl.edu	37	6	116600515	116600515	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr6:116600515C>A	ENST00000368608.3	-	1	551	c.479G>T	c.(478-480)tGc>tTc	p.C160F	DSE_ENST00000540275.1_Intron|DSE_ENST00000452085.3_5'Flank|RP1-93H18.1_ENST00000449314.1_lincRNA	NM_003309.3	NP_003300.1	Q9H0U9	TSYL1_HUMAN	TSPY-like 1	160					nucleosome assembly (GO:0006334)	nucleus (GO:0005634)	enzyme binding (GO:0019899)			breast(1)|endometrium(2)|large_intestine(2)|lung(2)|ovary(3)|urinary_tract(1)	11		all_cancers(87;0.0144)|all_epithelial(87;0.021)|Colorectal(196;0.234)		all cancers(137;0.0235)|OV - Ovarian serous cystadenocarcinoma(136;0.0469)|GBM - Glioblastoma multiforme(226;0.0503)|Epithelial(106;0.094)		GACGGTGGCGCACTTTCCTGT	0.637																																																	0													57.0	61.0	60.0					6																	116600515		2203	4300	6503	SO:0001583	missense	0			AF042181	CCDS34518.1	6q22.1	2014-09-17	2004-04-05	2004-04-07	ENSG00000189241	ENSG00000189241			12382	protein-coding gene	gene with protein product		604714	"""TSPY-like"""	TSPYL		9730615	Standard	NM_003309		Approved		uc003pwp.4	Q9H0U9	OTTHUMG00000015427	ENST00000368608.3:c.479G>T	6.37:g.116600515C>A	ENSP00000357597:p.Cys160Phe		O75885|Q5TFE6	Missense_Mutation	SNP	pfam_NAP_family	p.C160F	ENST00000368608.3	37	c.479	CCDS34518.1	6	.	.	.	.	.	.	.	.	.	.	C	4.455	0.084359	0.08583	.	.	ENSG00000189241	ENST00000368608;ENST00000545830	T	0.20738	2.05	3.35	1.53	0.23141	.	2.437550	0.01842	N	0.035415	T	0.05410	0.0143	L	0.39898	1.24	0.09310	N	1	P	0.50943	0.94	B	0.41571	0.36	T	0.17137	-1.0379	10	0.09843	T	0.71	0.1799	4.8626	0.13592	0.0:0.6581:0.2185:0.1234	.	160	Q9H0U9	TSYL1_HUMAN	F	160	ENSP00000357597:C160F	ENSP00000357597:C160F	C	-	2	0	TSPYL1	116707208	0.000000	0.05858	0.006000	0.13384	0.129000	0.20672	-0.166000	0.09954	0.394000	0.25230	0.561000	0.74099	TGC	TSPYL1	-	NULL	ENSG00000189241		0.637	TSPYL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSPYL1	HGNC	protein_coding	OTTHUMT00000041929.1	-	0.00	156	0	C			116600515	-1	tier1	-	no_errors	ENST00000368608	ensembl	human	known	74_37	missense	27.17	67	25	SNP	0.007	A
TTC9C	283237	genome.wustl.edu	37	11	62496120	62496120	+	5'UTR	SNP	G	G	T			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr11:62496120G>T	ENST00000316461.4	+	0	110				HNRNPUL2-BSCL2_ENST00000403734.2_5'Flank|TTC9C_ENST00000513247.2_Missense_Mutation_p.L95F|HNRNPUL2_ENST00000301785.5_5'Flank|TTC9C_ENST00000532583.1_5'UTR	NM_173810.3	NP_776171.1	Q8N5M4	TTC9C_HUMAN	tetratricopeptide repeat domain 9C											breast(1)|endometrium(1)|lung(2)|ovary(1)|pancreas(1)	6						TGCACTTCTTGAGAAAAAGAC	0.493																																																	0																																										SO:0001623	5_prime_UTR_variant	0			BC032123	CCDS8033.1	11q12.3	2013-01-10			ENSG00000162222	ENSG00000162222		"""Tetratricopeptide (TTC) repeat domain containing"""	28432	protein-coding gene	gene with protein product							Standard	NM_173810		Approved	MGC29649	uc001nuy.3	Q8N5M4	OTTHUMG00000167607	ENST00000316461.4:c.-201G>T	11.37:g.62496120G>T			Q8WYY7	Missense_Mutation	SNP	NULL	p.L95F	ENST00000316461.4	37	c.285	CCDS8033.1	11	.	.	.	.	.	.	.	.	.	.	G	13.75	2.330921	0.41297	.	.	ENSG00000162222	ENST00000513247	T	0.73152	-0.72	5.65	1.75	0.24633	.	3.777900	0.00531	N	0.000207	T	0.63616	0.2526	.	.	.	0.09310	N	1	B	0.12013	0.005	B	0.11329	0.006	T	0.51450	-0.8704	9	0.87932	D	0	.	8.1062	0.30887	0.3228:0.0:0.6772:0.0	.	95	Q8WYY7	.	F	95	ENSP00000444031:L95F	ENSP00000444031:L95F	L	+	3	2	TTC9C	62252696	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	0.398000	0.20899	0.142000	0.18901	-0.137000	0.14449	TTG	TTC9C	-	NULL	ENSG00000162222		0.493	TTC9C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTC9C	HGNC	protein_coding	OTTHUMT00000395338.1	-	0.00	68	0	G	NM_173810		62496120	+1	tier1	-	no_errors	ENST00000513247	ensembl	human	known	74_37	missense	5.19	73	4	SNP	0.000	T
TTN	7273	genome.wustl.edu	37	2	179549092	179549092	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr2:179549092G>A	ENST00000591111.1	-	130	31960	c.31736C>T	c.(31735-31737)gCt>gTt	p.A10579V	TTN_ENST00000342175.6_Intron|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.A10896V|TTN_ENST00000342992.6_Missense_Mutation_p.A9652V|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000431752.1_RNA|TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron|TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000589487.1_RNA			Q8WZ42	TITIN_HUMAN	titin	0	Glu-rich.|Pro-rich.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTTAGTTACAGCAACAAGAAC	0.388																																																	0													124.0	113.0	117.0					2																	179549092		1831	4078	5909	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.31736C>T	2.37:g.179549092G>A	ENSP00000465570:p.Ala10579Val		A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.A9652V	ENST00000591111.1	37	c.28955		2	.	.	.	.	.	.	.	.	.	.	G	16.35	3.097376	0.56075	.	.	ENSG00000155657	ENST00000342992	T	0.65364	-0.15	5.71	4.83	0.62350	Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);	.	.	.	.	T	0.49457	0.1558	N	0.19112	0.55	0.80722	D	1	B	0.10296	0.003	B	0.11329	0.006	T	0.47471	-0.9115	9	0.87932	D	0	.	14.616	0.68549	0.0698:0.0:0.9302:0.0	.	10579	Q8WZ42	TITIN_HUMAN	V	9652	ENSP00000343764:A9652V	ENSP00000343764:A9652V	A	-	2	0	TTN	179257337	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.784000	0.55416	1.422000	0.47177	0.655000	0.94253	GCT	TTN	-	pfam_PPAK_motif,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom	ENSG00000155657		0.388	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	-	0.00	49	0	G	NM_133378		179549092	-1	tier1	-	no_errors	ENST00000342992	ensembl	human	known	74_37	missense	7.27	50	4	SNP	1.000	A
TTN	7273	genome.wustl.edu	37	2	179575994	179575994	+	Silent	SNP	G	G	T			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr2:179575994G>T	ENST00000591111.1	-	95	27242	c.27018C>A	c.(27016-27018)gcC>gcA	p.A9006A	TTN_ENST00000342175.6_Intron|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000589042.1_Silent_p.A9323A|TTN_ENST00000342992.6_Silent_p.A8079A|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000431752.1_RNA|TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron|TTN-AS1_ENST00000589830.1_RNA			Q8WZ42	TITIN_HUMAN	titin	13145	Ig-like 73.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ATCCACTTATGGCACAATCAA	0.393																																																	0													162.0	156.0	158.0					2																	179575994		1873	4111	5984	SO:0001819	synonymous_variant	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.27018C>A	2.37:g.179575994G>T			A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.A8079	ENST00000591111.1	37	c.24237		2																																																																																			TTN	-	pfam_Ig_I-set,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000155657		0.393	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	-	0.00	72	0	G	NM_133378		179575994	-1	tier1	-	no_errors	ENST00000342992	ensembl	human	known	74_37	silent	14.47	65	11	SNP	0.008	T
UACA	55075	genome.wustl.edu	37	15	70964305	70964305	+	Splice_Site	SNP	G	G	T			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr15:70964305G>T	ENST00000322954.6	-	14	1352	c.1167C>A	c.(1165-1167)aaC>aaA	p.N389K	UACA_ENST00000560441.1_Intron|UACA_ENST00000379983.2_Splice_Site_p.N376K|UACA_ENST00000539319.1_Splice_Site_p.N280K	NM_018003.2	NP_060473.2	Q9BZF9	UACA_HUMAN	uveal autoantigen with coiled-coil domains and ankyrin repeats	389					intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|negative regulation of inflammatory response (GO:0050728)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of protein import into nucleus (GO:0042307)|response to UV (GO:0009411)	apoptosome (GO:0043293)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)				breast(2)|endometrium(7)|kidney(4)|large_intestine(13)|lung(17)|ovary(2)|pancreas(1)|prostate(2)|skin(2)	50						TATACTTACGGTTACTGAAAT	0.303																																																	0													78.0	72.0	74.0					15																	70964305		2199	4291	6490	SO:0001630	splice_region_variant	0			AF322916	CCDS10235.1, CCDS32280.1	15q22-q24	2013-01-10			ENSG00000137831	ENSG00000137831		"""Ankyrin repeat domain containing"""	15947	protein-coding gene	gene with protein product		612516				11162650, 10997877	Standard	NM_001008224		Approved	FLJ10128, KIAA1561	uc002asr.3	Q9BZF9	OTTHUMG00000133363	ENST00000322954.6:c.1168+1C>A	15.37:g.70964305G>T			G3XAG2|Q14DD3|Q8N3B8|Q96NH6|Q9HCL1|Q9NWC6	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,superfamily_Prefoldin,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_T_SNARE_dom,prints_Ankyrin_rpt	p.N389K	ENST00000322954.6	37	c.1167	CCDS10235.1	15	.	.	.	.	.	.	.	.	.	.	G	11.66	1.704771	0.30232	.	.	ENSG00000137831	ENST00000322954;ENST00000379983;ENST00000395362;ENST00000539319	T;T;T	0.32023	1.47;1.49;1.93	4.48	2.58	0.30949	.	0.085303	0.49916	D	0.000138	T	0.22551	0.0544	L	0.45581	1.43	0.38329	D	0.943749	B;B;B;B	0.19935	0.04;0.024;0.01;0.008	B;B;B;B	0.22386	0.039;0.011;0.011;0.008	T	0.07290	-1.0780	10	0.13470	T	0.59	-2.7535	8.2789	0.31889	0.1987:0.0:0.8013:0.0	.	280;389;389;376	F5H2B9;B7ZKM6;Q9BZF9;G3XAG2	.;.;UACA_HUMAN;.	K	389;376;365;280	ENSP00000314556:N389K;ENSP00000369319:N376K;ENSP00000438667:N280K	ENSP00000314556:N389K	N	-	3	2	UACA	68751359	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	0.537000	0.23144	1.218000	0.43458	0.591000	0.81541	AAC	UACA	-	NULL	ENSG00000137831		0.303	UACA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	UACA	HGNC	protein_coding	OTTHUMT00000257199.2	-	0.00	27	0	G		Missense_Mutation	70964305	-1	tier1	-	no_errors	ENST00000322954	ensembl	human	known	74_37	missense	11.11	32	4	SNP	1.000	T
UBAP2	55833	genome.wustl.edu	37	9	33956094	33956094	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr9:33956094G>T	ENST00000379238.1	-	11	966	c.849C>A	c.(847-849)caC>caA	p.H283Q	UBAP2_ENST00000449054.1_Missense_Mutation_p.H283Q|UBAP2_ENST00000379239.4_Intron|UBAP2_ENST00000360802.1_Missense_Mutation_p.H283Q|UBAP2_ENST00000539807.1_Missense_Mutation_p.H38Q|UBAP2_ENST00000418786.2_Missense_Mutation_p.H230Q					ubiquitin associated protein 2											endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|lung(13)|ovary(3)|stomach(1)	32			LUSC - Lung squamous cell carcinoma(29;0.00575)	GBM - Glioblastoma multiforme(74;0.168)		CAGGTAAGATGTGATTCTCTG	0.343																																																	0													116.0	125.0	122.0					9																	33956094		2203	4300	6503	SO:0001583	missense	0			AB040924	CCDS6547.1, CCDS75828.1	9p11.2	2008-02-05			ENSG00000137073	ENSG00000137073			14185	protein-coding gene	gene with protein product						8871400	Standard	NM_018449		Approved	KIAA1491, bA176F3.5, FLJ22435	uc003ztq.1	Q5T6F2	OTTHUMG00000000427	ENST00000379238.1:c.849C>A	9.37:g.33956094G>T	ENSP00000368540:p.His283Gln			Missense_Mutation	SNP	pfam_DUF3697_Uba2,pfam_UBA/Ts_N,superfamily_UBA-like,smart_UBA/transl_elong_EF1B_N_euk	p.H283Q	ENST00000379238.1	37	c.849	CCDS6547.1	9	.	.	.	.	.	.	.	.	.	.	G	7.448	0.642071	0.14451	.	.	ENSG00000137073	ENST00000379238;ENST00000449054;ENST00000360802;ENST00000431417;ENST00000379260;ENST00000539807;ENST00000418786;ENST00000412543;ENST00000421278	T;T;T;T;T;T	0.31769	2.72;2.72;2.72;2.49;2.18;1.48	5.2	-2.11	0.07187	.	0.211227	0.48286	N	0.000190	T	0.23249	0.0562	M	0.62723	1.935	0.25496	N	0.987598	B;B;B;B;B;B	0.33103	0.002;0.307;0.001;0.001;0.205;0.397	B;B;B;B;B;B	0.30179	0.002;0.112;0.002;0.002;0.052;0.093	T	0.16394	-1.0404	10	0.29301	T	0.29	-0.3642	8.5422	0.33399	0.3888:0.1274:0.4838:0.0	.	230;208;38;192;208;283	E7EWG4;F5H4D5;F5H2U4;F5H2C8;B4DH66;Q5T6F2	.;.;.;.;.;UBAP2_HUMAN	Q	283;283;283;192;201;38;230;230;137	ENSP00000368540:H283Q;ENSP00000416932:H283Q;ENSP00000354039:H283Q;ENSP00000439329:H38Q;ENSP00000404436:H230Q;ENSP00000414800:H230Q	ENSP00000354039:H283Q	H	-	3	2	UBAP2	33946094	0.055000	0.20627	0.003000	0.11579	0.713000	0.41058	-0.177000	0.09796	-0.384000	0.07845	0.491000	0.48974	CAC	UBAP2	-	NULL	ENSG00000137073		0.343	UBAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBAP2	HGNC	protein_coding	OTTHUMT00000001071.1		0.00	76	0	G	NM_018449		33956094	-1			no_errors	ENST00000360802	ensembl	human	known	74_37	missense	6.78	55	4	SNP	0.013	T
UGDH	7358	genome.wustl.edu	37	4	39501789	39501789	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr4:39501789G>T	ENST00000316423.6	-	12	1801	c.1459C>A	c.(1459-1461)Cca>Aca	p.P487T	UGDH_ENST00000506179.1_Missense_Mutation_p.P487T|UGDH_ENST00000501493.2_Missense_Mutation_p.P420T|UGDH_ENST00000507089.1_Missense_Mutation_p.P390T	NM_001184701.1|NM_003359.3	NP_001171630.1|NP_003350.1	O60701	UGDH_HUMAN	UDP-glucose 6-dehydrogenase	487					cellular glucuronidation (GO:0052695)|gastrulation with mouth forming second (GO:0001702)|glycosaminoglycan biosynthetic process (GO:0006024)|small molecule metabolic process (GO:0044281)|UDP-glucose metabolic process (GO:0006011)|UDP-glucuronate biosynthetic process (GO:0006065)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	electron carrier activity (GO:0009055)|NAD binding (GO:0051287)|UDP-glucose 6-dehydrogenase activity (GO:0003979)			breast(1)|central_nervous_system(1)|cervix(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(10)|ovary(3)|skin(1)|urinary_tract(2)	27						TTGTTAGGTGGATCTTGAAGA	0.303																																																	0													76.0	76.0	76.0					4																	39501789		2203	4299	6502	SO:0001583	missense	0			AF061016	CCDS3455.1, CCDS54757.1, CCDS54758.1	4p14	2011-11-16	2010-04-28		ENSG00000109814	ENSG00000109814	1.1.1.22		12525	protein-coding gene	gene with protein product		603370	"""UDP-glucose dehydrogenase"""			9737970, 10575217	Standard	NM_003359		Approved		uc003guk.2	O60701	OTTHUMG00000099371	ENST00000316423.6:c.1459C>A	4.37:g.39501789G>T	ENSP00000319501:p.Pro487Thr		B3KUU2|B4DN25|O60589	Missense_Mutation	SNP	pfam_UDP-Glc/GDP-Man_DH_N,pfam_UDP-Glc/GDP-Man_DH_C,pfam_UDP-Glc/GDP-Man_DH_dimer,superfamily_UDP-Glc/GDP-Man_DH_C,superfamily_6-PGluconate_DH_C-like,tigrfam_UDP-Glc/GDP-Man	p.P487T	ENST00000316423.6	37	c.1459	CCDS3455.1	4	.	.	.	.	.	.	.	.	.	.	G	15.74	2.921918	0.52653	.	.	ENSG00000109814	ENST00000316423;ENST00000501493;ENST00000506179;ENST00000507089	D;T;D;D	0.82167	-1.58;-1.01;-1.58;-1.58	5.88	4.14	0.48551	.	0.156556	0.64402	D	0.000017	T	0.68403	0.2997	N	0.08118	0	0.47308	D	0.999388	B;B	0.29432	0.244;0.079	B;B	0.24541	0.054;0.014	T	0.66559	-0.5893	10	0.62326	D	0.03	-8.2129	15.1928	0.73060	0.0:0.0:0.7908:0.2091	.	420;487	B3KUU2;O60701	.;UGDH_HUMAN	T	487;420;487;390	ENSP00000319501:P487T;ENSP00000422909:P420T;ENSP00000421757:P487T;ENSP00000426560:P390T	ENSP00000319501:P487T	P	-	1	0	UGDH	39178184	1.000000	0.71417	0.998000	0.56505	0.987000	0.75469	4.551000	0.60740	0.803000	0.34113	0.655000	0.94253	CCA	UGDH	-	NULL	ENSG00000109814		0.303	UGDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UGDH	HGNC	protein_coding	OTTHUMT00000216818.3	-	0.00	95	0	G	NM_003359		39501789	-1	tier1	-	no_errors	ENST00000316423	ensembl	human	known	74_37	missense	5.26	72	4	SNP	1.000	T
USH2A	7399	genome.wustl.edu	37	1	216052380	216052380	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr1:216052380G>T	ENST00000307340.3	-	42	8670	c.8284C>A	c.(8284-8286)Cct>Act	p.P2762T	USH2A_ENST00000366943.2_Missense_Mutation_p.P2762T	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	2762	Fibronectin type-III 14. {ECO:0000255|PROSITE-ProRule:PRU00316}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)	p.P2762S(1)		NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		TGAGGGTCAGGCATGTGAATC	0.403										HNSCC(13;0.011)																																							1	Substitution - Missense(1)	endometrium(1)											156.0	157.0	157.0					1																	216052380		2203	4300	6503	SO:0001583	missense	0			AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.8284C>A	1.37:g.216052380G>T	ENSP00000305941:p.Pro2762Thr		Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_EGF_laminin,pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_LamG-like,smart_Laminin_N,smart_EGF_laminin,smart_Fibronectin_type3,smart_Laminin_G,pfscan_EGF_laminin,pfscan_Fibronectin_type3,pfscan_Laminin_G,pfscan_Laminin_N	p.P2762T	ENST00000307340.3	37	c.8284	CCDS31025.1	1	.	.	.	.	.	.	.	.	.	.	G	20.2	3.957694	0.73902	.	.	ENSG00000042781	ENST00000307340;ENST00000366943	T;T	0.56275	0.47;0.47	6.16	4.29	0.51040	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.44902	D	0.000420	T	0.64103	0.2568	M	0.62723	1.935	0.49051	D	0.99974	D	0.63880	0.993	P	0.61070	0.883	T	0.61959	-0.6955	10	0.35671	T	0.21	.	12.1916	0.54275	0.0642:0.1211:0.8147:0.0	.	2762	O75445	USH2A_HUMAN	T	2762	ENSP00000305941:P2762T;ENSP00000355910:P2762T	ENSP00000305941:P2762T	P	-	1	0	USH2A	214119003	1.000000	0.71417	0.920000	0.36463	0.975000	0.68041	7.302000	0.78861	0.925000	0.37094	0.650000	0.86243	CCT	USH2A	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000042781		0.403	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	USH2A	HGNC	protein_coding	OTTHUMT00000128138.1		0.00	14	0	G	NM_007123		216052380	-1			no_errors	ENST00000366943	ensembl	human	known	74_37	missense	7.69	24	2	SNP	1.000	T
USP14	9097	genome.wustl.edu	37	18	211238	211238	+	Missense_Mutation	SNP	A	A	G			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr18:211238A>G	ENST00000261601.7	+	16	1530	c.1439A>G	c.(1438-1440)tAt>tGt	p.Y480C	USP14_ENST00000400266.3_Missense_Mutation_p.Y469C|USP14_ENST00000582707.1_Missense_Mutation_p.Y445C|USP14_ENST00000383589.2_Missense_Mutation_p.Y434C	NM_005151.3	NP_005142.1	P54578	UBP14_HUMAN	ubiquitin specific peptidase 14 (tRNA-guanine transglycosylase)	480	USP.				negative regulation of endopeptidase activity (GO:0010951)|protein deubiquitination (GO:0016579)|regulation of chemotaxis (GO:0050920)|regulation of proteasomal protein catabolic process (GO:0061136)|synaptic transmission (GO:0007268)|ubiquitin-dependent protein catabolic process (GO:0006511)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|proteasome complex (GO:0000502)|synapse (GO:0045202)	cysteine-type endopeptidase activity (GO:0004197)|endopeptidase inhibitor activity (GO:0004866)|proteasome binding (GO:0070628)|tRNA guanylyltransferase activity (GO:0008193)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			endometrium(1)|large_intestine(1)|lung(5)|ovary(2)|skin(2)	11		all_cancers(4;0.0896)|Myeloproliferative disorder(11;0.0412)				GTTCTACTCTATGGGCCTCGC	0.373																																																	0													108.0	99.0	102.0					18																	211238		2203	4300	6503	SO:0001583	missense	0			U30888	CCDS32780.1, CCDS32781.1	18p11.32	2006-10-06	2005-08-08			ENSG00000101557		"""Ubiquitin-specific peptidases"""	12612	protein-coding gene	gene with protein product		607274	"""ubiquitin specific protease 14 (tRNA-guanine transglycosylase)"""			12838346	Standard	NM_001037334		Approved	TGT	uc002kkf.1	P54578		ENST00000261601.7:c.1439A>G	18.37:g.211238A>G	ENSP00000261601:p.Tyr480Cys		J3QRZ5|Q53XY5	Missense_Mutation	SNP	pfam_Peptidase_C19/C67,smart_Ubiquitin_dom,pfscan_Peptidase_C19/C67,pfscan_Ubiquitin_supergroup	p.Y480C	ENST00000261601.7	37	c.1439	CCDS32780.1	18	.	.	.	.	.	.	.	.	.	.	A	22.2	4.258889	0.80246	.	.	ENSG00000101557	ENST00000261601;ENST00000383589;ENST00000400266	T;T	0.70045	-0.45;-0.45	6.03	6.03	0.97812	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.053294	0.85682	D	0.000000	D	0.87916	0.6298	H	0.96833	3.89	0.80722	D	1	D;D;D	0.76494	0.999;0.994;0.997	D;D;D	0.71656	0.974;0.957;0.957	D	0.91838	0.5481	10	0.87932	D	0	-19.2159	16.5582	0.84512	1.0:0.0:0.0:0.0	.	469;445;480	B7Z4N8;A6NJA2;P54578	.;.;UBP14_HUMAN	C	480;445;469	ENSP00000261601:Y480C;ENSP00000383125:Y469C	ENSP00000261601:Y480C	Y	+	2	0	USP14	201238	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.339000	0.96797	2.308000	0.77769	0.533000	0.62120	TAT	USP14	-	pfam_Peptidase_C19/C67,pfscan_Peptidase_C19/C67	ENSG00000101557		0.373	USP14-003	KNOWN	basic|appris_principal|CCDS	protein_coding	USP14	HGNC	protein_coding	OTTHUMT00000440305.3	-	0.00	38	0	A	NM_005151		211238	+1	tier1	-	no_errors	ENST00000261601	ensembl	human	known	74_37	missense	16.33	41	8	SNP	1.000	G
USP33	23032	genome.wustl.edu	37	1	78191334	78191334	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr1:78191334G>A	ENST00000370793.1	-	12	1688	c.1342C>T	c.(1342-1344)Cca>Tca	p.P448S	USP33_ENST00000370792.3_Missense_Mutation_p.P448S|USP33_ENST00000370794.3_Missense_Mutation_p.P417S|USP33_ENST00000357428.1_Missense_Mutation_p.P448S	NM_015017.4	NP_055832.3	Q8TEY7	UBP33_HUMAN	ubiquitin specific peptidase 33	448	USP.				axon guidance (GO:0007411)|cell migration (GO:0016477)|centrosome duplication (GO:0051298)|endocytosis (GO:0006897)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|ubiquitin-dependent protein catabolic process (GO:0006511)	cell body (GO:0044297)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|VCB complex (GO:0030891)	cysteine-type endopeptidase activity (GO:0004197)|G-protein coupled receptor binding (GO:0001664)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(4)|kidney(4)|large_intestine(10)|lung(19)|ovary(1)|prostate(2)|urinary_tract(1)	44						GCCAATCCTGGCCACAAATTG	0.408																																					Melanoma(152;72 1870 11110 26780 42647)												0													145.0	126.0	132.0					1																	78191334		2203	4300	6503	SO:0001583	missense	0			AF383173	CCDS678.1, CCDS679.1, CCDS680.1	1p31	2008-02-05	2005-08-08		ENSG00000077254	ENSG00000077254		"""Ubiquitin-specific peptidases"""	20059	protein-coding gene	gene with protein product		615146	"""ubiquitin specific protease 33"""			12838346	Standard	NM_015017		Approved	KIAA1097, VDU1	uc001dht.4	Q8TEY7	OTTHUMG00000009651	ENST00000370793.1:c.1342C>T	1.37:g.78191334G>A	ENSP00000359829:p.Pro448Ser		Q8TEY6|Q96AV6|Q9H9F0|Q9UPQ5	Missense_Mutation	SNP	pfam_Peptidase_C19/C67,pfam_Pept_C19_DUSP,pfam_Znf_UBP,smart_Znf_UBP,smart_Pept_C19_DUSP,pfscan_Znf_UBP,pfscan_Peptidase_C19/C67	p.P448S	ENST00000370793.1	37	c.1342	CCDS678.1	1	.	.	.	.	.	.	.	.	.	.	G	4.324	0.059528	0.08339	.	.	ENSG00000077254	ENST00000370794;ENST00000370793;ENST00000357428;ENST00000370792	T;T;T;T	0.08896	3.05;3.05;3.05;3.04	5.62	3.67	0.42095	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	1.157260	0.06077	N	0.661132	T	0.00906	0.0030	N	0.03224	-0.385	0.30680	N	0.752434	B;B;B	0.06786	0.0;0.001;0.001	B;B;B	0.11329	0.001;0.004;0.006	T	0.46331	-0.9199	10	0.08599	T	0.76	.	3.0935	0.06302	0.2858:0.0:0.5166:0.1975	.	448;417;448	Q8TEY7-3;Q8TEY7-2;Q8TEY7	.;.;UBP33_HUMAN	S	417;448;448;448	ENSP00000359830:P417S;ENSP00000359829:P448S;ENSP00000350009:P448S;ENSP00000359828:P448S	ENSP00000350009:P448S	P	-	1	0	USP33	77963922	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	1.071000	0.30666	1.468000	0.48064	0.585000	0.79938	CCA	USP33	-	pfam_Peptidase_C19/C67,pfscan_Peptidase_C19/C67	ENSG00000077254		0.408	USP33-002	KNOWN	basic|CCDS	protein_coding	USP33	HGNC	protein_coding	OTTHUMT00000026923.2	-	0.00	59	0	G	NM_015017		78191334	-1	tier1	-	no_errors	ENST00000357428	ensembl	human	known	74_37	missense	6.41	73	5	SNP	1.000	A
USP8	9101	genome.wustl.edu	37	15	50785054	50785054	+	Silent	SNP	C	C	T	rs199814360		TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr15:50785054C>T	ENST00000396444.3	+	15	2729	c.2391C>T	c.(2389-2391)aaC>aaT	p.N797N	USP8_ENST00000307179.4_Silent_p.N797N|USP8_ENST00000425032.3_Silent_p.N691N|RP11-562A8.5_ENST00000560159.1_lincRNA|USP8_ENST00000433963.1_Silent_p.N797N	NM_001128610.1|NM_005154.3	NP_001122082.1|NP_005145.3	P40818	UBP8_HUMAN	ubiquitin specific peptidase 8	797	USP.				cell proliferation (GO:0008283)|endosome organization (GO:0007032)|mitotic cytokinesis (GO:0000281)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)|Ras protein signal transduction (GO:0007265)|ubiquitin-dependent protein catabolic process (GO:0006511)	acrosomal vesicle (GO:0001669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|extrinsic component of plasma membrane (GO:0019897)|midbody (GO:0030496)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|ubiquitin-specific protease activity (GO:0004843)			central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(5)|lung(16)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	35				all cancers(107;0.000225)|GBM - Glioblastoma multiforme(94;0.000771)		GCCTATGTAACGCTCCACATT	0.363																																																	0													105.0	96.0	99.0					15																	50785054		2196	4293	6489	SO:0001819	synonymous_variant	0			D29956	CCDS10137.1, CCDS61632.1	15q21.1	2014-03-03	2005-08-08		ENSG00000138592	ENSG00000138592		"""Ubiquitin-specific peptidases"""	12631	protein-coding gene	gene with protein product		603158	"""ubiquitin specific protease 8"""			12838346, 9582025, 24482476	Standard	NM_005154		Approved	HumORF8, KIAA0055, UBPY, SPG59	uc001zyl.4	P40818	OTTHUMG00000131645	ENST00000396444.3:c.2391C>T	15.37:g.50785054C>T			B4DKA8|Q2TB31|Q7Z3U2|Q86VA0|Q8IWI7	Silent	SNP	pfam_Peptidase_C19/C67,pfam_USP8_dimer,pfam_Rhodanese-like_dom,superfamily_Rhodanese-like_dom,superfamily_WW_dom,pfscan_Rhodanese-like_dom,pfscan_Peptidase_C19/C67	p.N797	ENST00000396444.3	37	c.2391	CCDS10137.1	15																																																																																			USP8	-	pfam_Peptidase_C19/C67,pfscan_Peptidase_C19/C67	ENSG00000138592		0.363	USP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP8	HGNC	protein_coding	OTTHUMT00000254541.1	-	0.00	38	0	C	NM_005154		50785054	+1	tier1	rs199814360	no_errors	ENST00000307179	ensembl	human	known	74_37	silent	10.26	35	4	SNP	1.000	T
VCL	7414	genome.wustl.edu	37	10	75758009	75758009	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr10:75758009C>T	ENST00000211998.4	+	1	138	c.44C>T	c.(43-45)cCg>cTg	p.P15L	VCL_ENST00000372755.3_Missense_Mutation_p.P15L|VCL_ENST00000417648.2_Missense_Mutation_p.P15L|VCL_ENST00000478896.2_3'UTR	NM_014000.2	NP_054706.1	P18206	VINC_HUMAN	vinculin	15	N-terminal globular head.				adherens junction assembly (GO:0034333)|apical junction assembly (GO:0043297)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|cellular component movement (GO:0006928)|epithelial cell-cell adhesion (GO:0090136)|lamellipodium assembly (GO:0030032)|morphogenesis of an epithelium (GO:0002009)|muscle contraction (GO:0006936)|negative regulation of cell migration (GO:0030336)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|protein localization to cell surface (GO:0034394)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cell-substrate junction (GO:0030055)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|vesicle (GO:0031982)	actin binding (GO:0003779)|alpha-catenin binding (GO:0045294)|beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|dystroglycan binding (GO:0002162)|structural molecule activity (GO:0005198)		VCL/ALK(4)	breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(8)|ovary(2)|upper_aerodigestive_tract(1)	20	Prostate(51;0.0112)					ATCCTGGAGCCGGTGGCACAG	0.672																																																	0													39.0	30.0	33.0					10																	75758009		2203	4300	6503	SO:0001583	missense	0			M33308	CCDS7340.1, CCDS7341.1	10q22.1-q23	2014-09-17			ENSG00000035403	ENSG00000035403			12665	protein-coding gene	gene with protein product	"""metavinculin"""	193065				1339348	Standard	NM_014000		Approved		uc001jwd.3	P18206	OTTHUMG00000018498	ENST00000211998.4:c.44C>T	10.37:g.75758009C>T	ENSP00000211998:p.Pro15Leu		Q16450|Q5SWX2|Q7Z3B8|Q8IXU7	Missense_Mutation	SNP	pfam_Vinculin/catenin,superfamily_Vinculin/catenin,prints_Vinculin	p.P15L	ENST00000211998.4	37	c.44	CCDS7341.1	10	.	.	.	.	.	.	.	.	.	.	C	33	5.260885	0.95368	.	.	ENSG00000035403	ENST00000372755;ENST00000211998;ENST00000417648	T;T;T	0.52983	0.64;0.64;0.64	4.35	4.35	0.52113	.	0.000000	0.64402	D	0.000001	T	0.70482	0.3229	M	0.79926	2.475	0.49130	D	0.999752	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.97110	0.986;0.959;1.0	T	0.76539	-0.2922	10	0.87932	D	0	.	16.6521	0.85219	0.0:1.0:0.0:0.0	.	15;15;15	B4DTM7;P18206-2;P18206	.;.;VINC_HUMAN	L	15	ENSP00000361841:P15L;ENSP00000211998:P15L;ENSP00000411887:P15L	ENSP00000211998:P15L	P	+	2	0	VCL	75428015	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	6.889000	0.75627	2.245000	0.73994	0.313000	0.20887	CCG	VCL	-	pfam_Vinculin/catenin	ENSG00000035403		0.672	VCL-201	KNOWN	basic|appris_principal|CCDS	protein_coding	VCL	HGNC	protein_coding		-	0.00	83	0	C	NM_003373, NM_014000		75758009	+1	tier1	-	no_errors	ENST00000211998	ensembl	human	known	74_37	missense	27.45	37	14	SNP	1.000	T
VNN1	8876	genome.wustl.edu	37	6	133015315	133015315	+	Silent	SNP	G	G	A			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr6:133015315G>A	ENST00000367928.4	-	3	361	c.348C>T	c.(346-348)ggC>ggT	p.G116G		NM_004666.2	NP_004657.2	O95497	VNN1_HUMAN	vanin 1	116	CN hydrolase. {ECO:0000255|PROSITE- ProRule:PRU00054}.				acute inflammatory response (GO:0002526)|cellular component movement (GO:0006928)|chronic inflammatory response (GO:0002544)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902176)|pantothenate metabolic process (GO:0015939)|positive regulation of T cell differentiation in thymus (GO:0033089)|response to oxidative stress (GO:0006979)|single organismal cell-cell adhesion (GO:0016337)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	GPI anchor binding (GO:0034235)|pantetheine hydrolase activity (GO:0017159)	p.G116G(1)		NS(2)|endometrium(3)|kidney(2)|large_intestine(8)|lung(10)|ovary(4)|prostate(1)|upper_aerodigestive_tract(1)	31	Breast(56;0.135)			OV - Ovarian serous cystadenocarcinoma(155;0.0027)|GBM - Glioblastoma multiforme(226;0.0189)		CTGGGGTCTGGCCAAATCTGA	0.388																																																	1	Substitution - coding silent(1)	kidney(1)											96.0	89.0	91.0					6																	133015315		2203	4300	6503	SO:0001819	synonymous_variant	0			AJ132099	CCDS5159.1	6q23-q24	2013-02-13			ENSG00000112299	ENSG00000112299	3.5.1.92	"""Vanins"""	12705	protein-coding gene	gene with protein product		603570				9790769	Standard	NM_004666		Approved	Tiff66	uc003qdo.3	O95497	OTTHUMG00000015587	ENST00000367928.4:c.348C>T	6.37:g.133015315G>A			A8K310|Q4JFW6|Q4VAS7|Q4VAS8|Q4VAS9|Q9UF16|Q9UJF4	Silent	SNP	pfam_C-N_Hydrolase,superfamily_C-N_Hydrolase,pirsf_Biotinidase_euk,pfscan_C-N_Hydrolase	p.G116	ENST00000367928.4	37	c.348	CCDS5159.1	6																																																																																			VNN1	-	pfam_C-N_Hydrolase,superfamily_C-N_Hydrolase,pirsf_Biotinidase_euk,pfscan_C-N_Hydrolase	ENSG00000112299		0.388	VNN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VNN1	HGNC	protein_coding	OTTHUMT00000042263.1		0.00	67	0	G			133015315	-1			no_errors	ENST00000367928	ensembl	human	known	74_37	silent	8.82	31	3	SNP	0.002	A
VNN2	8875	genome.wustl.edu	37	6	133072386	133072386	+	Silent	SNP	G	G	A			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr6:133072386G>A	ENST00000326499.6	-	5	1222	c.1098C>T	c.(1096-1098)tgC>tgT	p.C366C	VNN2_ENST00000525270.1_Silent_p.C313C|VNN2_ENST00000525289.1_Intron|RP1-55C23.7_ENST00000430895.1_RNA|VNN2_ENST00000526192.1_5'Flank	NM_004665.2	NP_004656	O95498	VNN2_HUMAN	vanin 2	366					cellular component movement (GO:0006928)|pantothenate metabolic process (GO:0015939)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)	pantetheine hydrolase activity (GO:0017159)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(7)|lung(14)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	36				OV - Ovarian serous cystadenocarcinoma(155;0.00237)|GBM - Glioblastoma multiforme(226;0.0267)		TTAAATGACAGCAAAGCTCCT	0.393																																																	0													122.0	125.0	124.0					6																	133072386		2203	4300	6503	SO:0001819	synonymous_variant	0			AB026705	CCDS5161.1, CCDS5162.1, CCDS56451.1	6q23-q24	2013-02-13			ENSG00000112303	ENSG00000112303	3.5.1.92	"""Vanins"""	12706	protein-coding gene	gene with protein product	"""pantetheinase"""	603571				9790769, 11491533	Standard	NM_078488		Approved	FOAP-4, GPI-80	uc003qdt.3	O95498	OTTHUMG00000015588	ENST00000326499.6:c.1098C>T	6.37:g.133072386G>A			A0AUZ3|A6NDY1|A8K4E3|A8K7W0|B2DFZ0|B2DFZ1|B2DFZ2|B2DFZ3|F6XL73|Q2XUN1|Q9UJF3|Q9UMW2	Missense_Mutation	SNP	pfam_C-N_Hydrolase,superfamily_C-N_Hydrolase,pfscan_C-N_Hydrolase	p.A190V	ENST00000326499.6	37	c.569	CCDS5161.1	6																																																																																			VNN2	-	pfscan_C-N_Hydrolase	ENSG00000112303		0.393	VNN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VNN2	HGNC	protein_coding	OTTHUMT00000042264.2	-	0.00	39	0	G			133072386	-1	tier1	-	no_errors	ENST00000532053	ensembl	human	known	74_37	missense	34.48	19	10	SNP	0.999	A
WDR43	23160	genome.wustl.edu	37	2	29150504	29150504	+	Missense_Mutation	SNP	A	A	G			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr2:29150504A>G	ENST00000407426.3	+	10	1299	c.1243A>G	c.(1243-1245)Atc>Gtc	p.I415V	Y_RNA_ENST00000410292.1_RNA|SNORD53_SNORD92_ENST00000577887.1_RNA|SNORD53_ENST00000579969.1_RNA	NM_015131.1	NP_055946.1	Q15061	WDR43_HUMAN	WD repeat domain 43	415						nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(3)|endometrium(2)|kidney(1)|large_intestine(3)|lung(9)|ovary(1)|prostate(1)	20	Acute lymphoblastic leukemia(172;0.155)					TCATGCAGCTATCAAGCCCGC	0.463																																																	0													80.0	80.0	80.0					2																	29150504		1985	4172	6157	SO:0001583	missense	0			D87716	CCDS46251.1	2p23.3	2013-01-09			ENSG00000163811	ENSG00000163811		"""WD repeat domain containing"""	28945	protein-coding gene	gene with protein product	"""UTP5, small subunit (SSU) processome component, homolog (yeast)"""					7584026, 7584028, 17699751	Standard	NM_015131		Approved	KIAA0007, NET12, UTP5	uc002rmo.2	Q15061	OTTHUMG00000152015	ENST00000407426.3:c.1243A>G	2.37:g.29150504A>G	ENSP00000384302:p.Ile415Val		Q15395|Q92577	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_SSU_processome_Utp12,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.I415V	ENST00000407426.3	37	c.1243	CCDS46251.1	2	.	.	.	.	.	.	.	.	.	.	A	1.294	-0.606713	0.03717	.	.	ENSG00000163811	ENST00000407426	T	0.72942	-0.7	5.69	-2.79	0.05841	.	0.665977	0.16260	N	0.222287	T	0.52108	0.1714	L	0.32530	0.975	0.20638	N	0.999874	B	0.02656	0.0	B	0.04013	0.001	T	0.30851	-0.9964	10	0.27082	T	0.32	-0.1255	8.965	0.35872	0.3975:0.1183:0.4842:0.0	.	415	Q15061	WDR43_HUMAN	V	415	ENSP00000384302:I415V	ENSP00000384302:I415V	I	+	1	0	WDR43	29004008	0.096000	0.21769	0.016000	0.15963	0.459000	0.32528	0.503000	0.22610	-0.753000	0.04721	-0.911000	0.02809	ATC	WDR43	-	NULL	ENSG00000163811		0.463	WDR43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR43	HGNC	protein_coding	OTTHUMT00000324865.1	-	0.00	60	0	A	XM_087089		29150504	+1	tier1	-	no_errors	ENST00000407426	ensembl	human	known	74_37	missense	26.58	58	21	SNP	0.014	G
CFAP44	55779	genome.wustl.edu	37	3	113025140	113025140	+	Nonsense_Mutation	SNP	G	G	A			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr3:113025140G>A	ENST00000393845.2	-	30	4732	c.4666C>T	c.(4666-4668)Cga>Tga	p.R1556*	WDR52_ENST00000308346.6_Nonsense_Mutation_p.R159*	NM_001164496.1	NP_001157968.1														breast(2)|central_nervous_system(3)|endometrium(3)|kidney(5)|large_intestine(7)|lung(26)|prostate(1)|urinary_tract(2)	49						CTTTTCTCTCGAAGGTGAAGG	0.363																																																	0													177.0	142.0	152.0					3																	113025140		692	1591	2283	SO:0001587	stop_gained	0																														ENST00000393845.2:c.4666C>T	3.37:g.113025140G>A	ENSP00000377428:p.Arg1556*			Nonsense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.R1556*	ENST00000393845.2	37	c.4666	CCDS54624.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	44|44	10.978179|10.978179	0.99498|0.99498	.|.	.|.	ENSG00000206530|ENSG00000206530	ENST00000393845;ENST00000308346|ENST00000465636	.|.	.|.	.|.	5.84|5.84	4.95|4.95	0.65309|0.65309	.|.	0.123680|.	0.56097|.	D|.	0.000031|.	.|T	.|0.65228	.|0.2671	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.70992	.|-0.4721	.|3	0.02654|.	T|.	1|.	-5.4781|-5.4781	14.249|14.249	0.66007|0.66007	0.0:0.0:0.7291:0.2709|0.0:0.0:0.7291:0.2709	.|.	.|.	.|.	.|.	X|L	1556;159|692	.|.	ENSP00000311497:R159X|.	R|S	-|-	1|2	2|0	WDR52|WDR52	114507830|114507830	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.902000|0.902000	0.53008|0.53008	2.567000|2.567000	0.45956|0.45956	1.445000|1.445000	0.47624|0.47624	0.591000|0.591000	0.81541|0.81541	CGA|TCG	WDR52	-	superfamily_ARM-type_fold	ENSG00000206530		0.363	WDR52-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	WDR52	HGNC	protein_coding		-	0.00	94	0	G			113025140	-1	tier1	-	no_errors	ENST00000393845	ensembl	human	known	74_37	nonsense	14.16	97	16	SNP	1.000	A
WDR76	79968	genome.wustl.edu	37	15	44158510	44158510	+	Missense_Mutation	SNP	A	A	C			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr15:44158510A>C	ENST00000263795.6	+	13	1871	c.1801A>C	c.(1801-1803)Atg>Ctg	p.M601L	Y_RNA_ENST00000363521.1_RNA|WDR76_ENST00000381246.2_Missense_Mutation_p.M537L|WDR76_ENST00000478130.1_3'UTR	NM_001167941.1|NM_024908.3	NP_001161413.1|NP_079184.2	Q9H967	WDR76_HUMAN	WD repeat domain 76	601										breast(1)|cervix(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|skin(2)	20		all_cancers(109;3.26e-11)|all_epithelial(112;4.82e-09)|Lung NSC(122;1.61e-06)|all_lung(180;1.5e-05)|Melanoma(134;0.0417)		all cancers(107;3.78e-21)|GBM - Glioblastoma multiforme(94;5.04e-07)		CATCAATGCCATGCACCCAAC	0.448																																																	0													181.0	151.0	161.0					15																	44158510		2198	4298	6496	SO:0001583	missense	0			AK023035	CCDS10106.1, CCDS53938.1	15q15.3	2013-01-09			ENSG00000092470	ENSG00000092470		"""WD repeat domain containing"""	25773	protein-coding gene	gene with protein product						12860291	Standard	NM_024908		Approved	FLJ12973	uc001zti.2	Q9H967	OTTHUMG00000060143	ENST00000263795.6:c.1801A>C	15.37:g.44158510A>C	ENSP00000263795:p.Met601Leu		A0MNP5|Q05CI4	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat	p.M601L	ENST00000263795.6	37	c.1801	CCDS10106.1	15	.	.	.	.	.	.	.	.	.	.	A	12.02	1.811342	0.32053	.	.	ENSG00000092470	ENST00000263795;ENST00000381246	T;T	0.63580	-0.05;-0.05	6.17	2.34	0.29019	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.248257	0.49916	D	0.000122	T	0.40694	0.1127	L	0.31664	0.95	0.23704	N	0.997066	B	0.02656	0.0	B	0.04013	0.001	T	0.11842	-1.0571	10	0.26408	T	0.33	-19.1737	2.2021	0.03926	0.5636:0.1199:0.2009:0.1156	.	601	Q9H967	WDR76_HUMAN	L	601;537	ENSP00000263795:M601L;ENSP00000370645:M537L	ENSP00000263795:M601L	M	+	1	0	WDR76	41945802	0.381000	0.25140	0.998000	0.56505	0.951000	0.60555	0.868000	0.27982	0.525000	0.28522	-0.290000	0.09829	ATG	WDR76	-	superfamily_WD40_repeat_dom,smart_WD40_repeat	ENSG00000092470		0.448	WDR76-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	WDR76	HGNC	protein_coding	OTTHUMT00000133482.2	-	0.00	167	0	A	NM_024908		44158510	+1	tier1	-	no_errors	ENST00000263795	ensembl	human	known	74_37	missense	18.71	126	29	SNP	0.522	C
WRN	7486	genome.wustl.edu	37	8	30982124	30982124	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr8:30982124G>C	ENST00000298139.5	+	22	2966	c.2717G>C	c.(2716-2718)aGc>aCc	p.S906T		NM_000553.4	NP_000544.2	Q14191	WRN_HUMAN	Werner syndrome, RecQ helicase-like	906					aging (GO:0007568)|ATP catabolic process (GO:0006200)|base-excision repair (GO:0006284)|cell aging (GO:0007569)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|cellular response to starvation (GO:0009267)|DNA duplex unwinding (GO:0032508)|DNA metabolic process (GO:0006259)|DNA recombination (GO:0006310)|DNA replication (GO:0006260)|DNA synthesis involved in DNA repair (GO:0000731)|double-strand break repair (GO:0006302)|multicellular organismal aging (GO:0010259)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleolus to nucleoplasm transport (GO:0032066)|positive regulation of hydrolase activity (GO:0051345)|regulation of apoptotic process (GO:0042981)|regulation of growth rate (GO:0040009)|replication fork processing (GO:0031297)|replicative cell aging (GO:0001302)|response to oxidative stress (GO:0006979)|response to UV-C (GO:0010225)|telomere maintenance (GO:0000723)	centrosome (GO:0005813)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	3'-5' DNA helicase activity (GO:0043138)|3'-5' exonuclease activity (GO:0008408)|ATP binding (GO:0005524)|ATP-dependent 3'-5' DNA helicase activity (GO:0043140)|ATP-dependent DNA helicase activity (GO:0004003)|ATPase activity (GO:0016887)|bubble DNA binding (GO:0000405)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|exonuclease activity (GO:0004527)|four-way junction helicase activity (GO:0009378)|G-quadruplex DNA binding (GO:0051880)|helicase activity (GO:0004386)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|protein complex binding (GO:0032403)|protein homodimerization activity (GO:0042803)|Y-form DNA binding (GO:0000403)			central_nervous_system(2)|endometrium(4)|kidney(4)|large_intestine(13)|lung(28)|ovary(3)|skin(3)|upper_aerodigestive_tract(3)	60		Breast(100;0.195)		KIRC - Kidney renal clear cell carcinoma(542;0.147)|Kidney(114;0.176)|Colorectal(111;0.192)		CTTCATTCTAGCAGATGTAGG	0.303			"""Mis, N, F, S"""			"""osteosarcoma, meningioma, others"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Werner syndrome																												Ovarian(18;161 598 2706 14834 27543)		yes	Rec		Werner Syndrome	8	8p12-p11.2	7486	Werner syndrome (RECQL2)		"""L, E, M, O"""	0													64.0	64.0	64.0					8																	30982124		2203	4292	6495	SO:0001583	missense	0	Familial Cancer Database	WS, Adult Progeria		CCDS6082.1	8p12	2014-09-17	2009-03-19		ENSG00000165392	ENSG00000165392			12791	protein-coding gene	gene with protein product		604611	"""Werner syndrome"""			9288107	Standard	NM_000553		Approved	RECQL2, RECQ3	uc003xio.4	Q14191	OTTHUMG00000163894	ENST00000298139.5:c.2717G>C	8.37:g.30982124G>C	ENSP00000298139:p.Ser906Thr		A1KYY9	Missense_Mutation	SNP	pfam_3'-5'_exonuclease_dom,pfam_Helicase_C,pfam_RQC_domain,pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_HRDC_dom,superfamily_P-loop_NTPase,superfamily_RNaseH-like_dom,superfamily_HRDC-like,smart_3'-5'_exonuclease_dom,smart_Helicase_ATP-bd,smart_Helicase_C,smart_RQC_domain,smart_HRDC_dom,pfscan_HRDC_dom,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,tigrfam_DNA_helicase_ATP-dep_RecQ	p.S906T	ENST00000298139.5	37	c.2717	CCDS6082.1	8	.	.	.	.	.	.	.	.	.	.	G	0.395	-0.921498	0.02396	.	.	ENSG00000165392	ENST00000298139	T	0.41065	1.01	5.58	2.82	0.32997	.	0.404146	0.29066	N	0.013258	T	0.24774	0.0601	N	0.24115	0.695	0.22648	N	0.998893	B;B	0.19706	0.002;0.038	B;B	0.14023	0.009;0.01	T	0.14200	-1.0481	10	0.36615	T	0.2	-1.1211	6.1008	0.20045	0.2638:0.1337:0.6024:0.0	.	316;906	Q59F09;Q14191	.;WRN_HUMAN	T	906	ENSP00000298139:S906T	ENSP00000298139:S906T	S	+	2	0	WRN	31101666	0.530000	0.26330	0.156000	0.22583	0.007000	0.05969	0.789000	0.26886	0.312000	0.23038	-0.300000	0.09419	AGC	WRN	-	tigrfam_DNA_helicase_ATP-dep_RecQ	ENSG00000165392		0.303	WRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WRN	HGNC	protein_coding	OTTHUMT00000376248.1	-	0.00	55	0	G			30982124	+1	tier1	-	no_errors	ENST00000298139	ensembl	human	known	74_37	missense	19.05	34	8	SNP	0.472	C
XIRP2	129446	genome.wustl.edu	37	2	168101152	168101152	+	Missense_Mutation	SNP	A	A	G			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr2:168101152A>G	ENST00000409195.1	+	9	3339	c.3250A>G	c.(3250-3252)Aga>Gga	p.R1084G	XIRP2_ENST00000409605.1_Intron|XIRP2_ENST00000295237.9_Missense_Mutation_p.R1084G|XIRP2_ENST00000409756.2_Intron|XIRP2_ENST00000409728.1_Intron|XIRP2_ENST00000409273.1_Missense_Mutation_p.R862G|XIRP2_ENST00000409043.1_Intron|XIRP2_ENST00000420519.1_Intron	NM_152381.5	NP_689594.4	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2	909					actin cytoskeleton organization (GO:0030036)|cardiac muscle tissue morphogenesis (GO:0055008)|cell-cell junction organization (GO:0045216)|ventricular septum development (GO:0003281)	cell junction (GO:0030054)|Z disc (GO:0030018)				NS(3)|biliary_tract(2)|breast(5)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(51)|lung(160)|ovary(7)|pancreas(3)|prostate(11)|skin(14)|stomach(5)|upper_aerodigestive_tract(8)|urinary_tract(7)	315						TGAACAAACTAGAGATATTGT	0.348																																																	0													31.0	29.0	30.0					2																	168101152		1805	4073	5878	SO:0001583	missense	0			AK056582	CCDS42768.1, CCDS42769.1, CCDS56143.1, CCDS56144.1, CCDS56145.1	2q31.1	2013-10-25	2007-06-27	2007-06-27	ENSG00000163092	ENSG00000163092			14303	protein-coding gene	gene with protein product	"""myomaxin"""	609778	"""cardiomyopathy associated 3"""	CMYA3		17046827, 12203715, 15454575	Standard	NM_001079810		Approved		uc002udx.3	A4UGR9	OTTHUMG00000154027	ENST00000409195.1:c.3250A>G	2.37:g.168101152A>G	ENSP00000386840:p.Arg1084Gly		A0PJ94|B2BBS0|B2BBS1|B2BBS4|B3KVH0|J3KNB1|Q53R52|Q5MJ67|Q702N7|Q86T36|Q86T38|Q86T46|Q86T51|Q86T53|Q86T55|Q86T79|Q86TB6|Q8N1M9|Q8N3R5|Q8TBV6	Missense_Mutation	SNP	pfam_Actin-binding_Xin_repeat	p.R1084G	ENST00000409195.1	37	c.3250	CCDS42769.1	2	.	.	.	.	.	.	.	.	.	.	A	1.699	-0.502136	0.04261	.	.	ENSG00000163092	ENST00000409195;ENST00000295237;ENST00000409273	T;T;T	0.02525	4.26;4.26;4.26	6.08	3.72	0.42706	.	0.692346	0.14820	N	0.296507	T	0.01661	0.0053	N	0.03608	-0.345	0.19575	N	0.999967	B;B;B	0.11235	0.002;0.004;0.004	B;B;B	0.13407	0.004;0.009;0.009	T	0.49351	-0.8949	10	0.26408	T	0.33	-3.2325	9.7023	0.40194	0.8588:0.0:0.1412:0.0	.	909;909;862	A4UGR9;A4UGR9-3;A4UGR9-2	XIRP2_HUMAN;.;.	G	1084;1084;862	ENSP00000386840:R1084G;ENSP00000295237:R1084G;ENSP00000387255:R862G	ENSP00000295237:R1084G	R	+	1	2	XIRP2	167809398	0.028000	0.19301	0.447000	0.26932	0.666000	0.39218	1.181000	0.32017	0.547000	0.28938	0.533000	0.62120	AGA	XIRP2	-	NULL	ENSG00000163092		0.348	XIRP2-001	KNOWN	basic|CCDS	protein_coding	XIRP2	HGNC	protein_coding	OTTHUMT00000333547.1	-	0.00	40	0	A	NM_152381		168101152	+1	tier1	-	no_errors	ENST00000295237	ensembl	human	known	74_37	missense	21.28	37	10	SNP	0.507	G
XIST	7503	genome.wustl.edu	37	X	73065303	73065304	+	lincRNA	INS	-	-	C			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chrX:73065303_73065304insC	ENST00000429829.1	-	0	7284_7285					NR_001564.2				X inactive specific transcript (non-protein coding)																		AATGTAAGGGTATATGGAGTGG	0.47																																																	0																																												0			M97168		Xq13.2	2013-12-18	2013-02-07		ENSG00000229807	ENSG00000229807		"""Long non-coding RNAs"", ""-"""	12810	non-coding RNA	RNA, long non-coding	"""long intergenic non-protein coding RNA 1"""	314670	"""X (inactive)-specific transcript"", ""X (inactive)-specific transcript (non-protein coding)"""	DXS399E		1985261, 2034279	Standard	NR_001564		Approved	NCRNA00001, DXS1089, swd66, LINC00001	uc004ebm.2		OTTHUMG00000021839		X.37:g.73065303_73065304insC				RNA	INS	-	NULL	ENST00000429829.1	37	NULL		X																																																																																			XIST	-	-	ENSG00000229807		0.470	XIST-001	KNOWN	basic	lincRNA	XIST	HGNC	lincRNA	OTTHUMT00000057239.1		0.00	55	0	-	NR_001564		73065304	-1	tier1		no_errors	ENST00000429829	ensembl	human	known	74_37	rna	11.11	16	2	INS	0.000:0.000	C
XKR5	389610	genome.wustl.edu	37	8	6669476	6669476	+	RNA	SNP	G	G	A			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr8:6669476G>A	ENST00000518724.1	-	0	1455							Q6UX68	XKR5_HUMAN	XK, Kell blood group complex subunit-related family, member 5							integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(1)|lung(1)	3			STAD - Stomach adenocarcinoma(24;0.0984)	READ - Rectum adenocarcinoma(644;0.137)|COAD - Colon adenocarcinoma(149;0.166)		CAACCCCCATGCAGGTGGACA	0.522																																																	0													89.0	77.0	80.0					8																	6669476		692	1591	2283			0			AY358489		8p23.1	2006-01-12	2006-01-12		ENSG00000186530	ENSG00000275591			20782	protein-coding gene	gene with protein product			"""X Kell blood group precursor-related family, member 5"""				Standard	NM_207411		Approved		uc022aqv.1	Q6UX68	OTTHUMG00000153652		8.37:g.6669476G>A			Q5GH74	RNA	SNP	-	NULL	ENST00000518724.1	37	NULL		8																																																																																			XKR5	-	-	ENSG00000186530		0.522	XKR5-001	KNOWN	basic	processed_transcript	XKR5	HGNC	processed_transcript	OTTHUMT00000331969.2	-	0.00	51	0	G	NM_207411		6669476	-1	tier1	-	no_errors	ENST00000405979	ensembl	human	known	74_37	rna	10.53	34	4	SNP	0.000	A
ZCCHC8	55596	genome.wustl.edu	37	12	122958783	122958783	+	Missense_Mutation	SNP	A	A	C			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr12:122958783A>C	ENST00000336229.4	-	14	1515	c.1385T>G	c.(1384-1386)tTt>tGt	p.F462C	ZCCHC8_ENST00000538116.1_Missense_Mutation_p.F73C|ZCCHC8_ENST00000543897.1_Missense_Mutation_p.F224C|ZCCHC8_ENST00000536306.1_Missense_Mutation_p.F224C	NM_017612.3	NP_060082.2	Q6NZY4	ZCHC8_HUMAN	zinc finger, CCHC domain containing 8	462					mRNA splicing, via spliceosome (GO:0000398)	catalytic step 2 spliceosome (GO:0071013)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			endometrium(4)|kidney(2)|large_intestine(8)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	23	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;5.25e-05)|Epithelial(86;0.000113)|BRCA - Breast invasive adenocarcinoma(302;0.202)		TTGAAACTGAAAACTTTCGCT	0.478																																																	0													63.0	67.0	66.0					12																	122958783		2027	4194	6221	SO:0001583	missense	0			BC017704		12q24.31	2014-04-14				ENSG00000033030		"""Zinc fingers, CCHC domain containing"""	25265	protein-coding gene	gene with protein product						12477932	Standard	XM_005253581		Approved	DKFZp434E2220	uc001ucn.3	Q6NZY4		ENST00000336229.4:c.1385T>G	12.37:g.122958783A>C	ENSP00000337313:p.Phe462Cys		Q7L2P6|Q8N2K5|Q96SK7|Q9NSS2|Q9NSS3	Missense_Mutation	SNP	pfam_PSP,pfam_Znf_CCHC,superfamily_Znf_CCHC,smart_Znf_CCHC,smart_PSP,pfscan_Znf_CCHC	p.F462C	ENST00000336229.4	37	c.1385		12	.	.	.	.	.	.	.	.	.	.	A	13.74	2.327771	0.41197	.	.	ENSG00000033030	ENST00000536306;ENST00000543897;ENST00000336229;ENST00000538116;ENST00000542892	T;T;T;T	0.58797	0.7;0.7;0.7;0.31	5.96	3.61	0.41365	.	0.144170	0.64402	D	0.000005	T	0.62258	0.2413	M	0.66939	2.045	0.47094	D	0.999318	D	0.69078	0.997	P	0.55667	0.781	T	0.59107	-0.7516	10	0.39692	T	0.17	-5.715	5.5006	0.16827	0.7363:0.0:0.1361:0.1275	.	462	Q6NZY4	ZCHC8_HUMAN	C	224;224;462;73;73	ENSP00000441423:F224C;ENSP00000438993:F224C;ENSP00000337313:F462C;ENSP00000440028:F73C	ENSP00000337313:F462C	F	-	2	0	ZCCHC8	121524736	1.000000	0.71417	0.008000	0.14137	0.196000	0.23810	3.215000	0.51169	0.509000	0.28195	0.528000	0.53228	TTT	ZCCHC8	-	NULL	ENSG00000033030		0.478	ZCCHC8-201	KNOWN	basic|appris_principal	protein_coding	ZCCHC8	HGNC	protein_coding			0.00	15	0	A	NM_017612		122958783	-1			no_errors	ENST00000336229	ensembl	human	known	74_37	missense	16.67	15	3	SNP	0.990	C
ZFHX3	463	genome.wustl.edu	37	16	72828727	72828727	+	Silent	SNP	C	C	T	rs139779175		TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr16:72828727C>T	ENST00000268489.5	-	9	8526	c.7854G>A	c.(7852-7854)ctG>ctA	p.L2618L	ZFHX3_ENST00000397992.5_Silent_p.L1704L	NM_006885.3	NP_008816.3	Q15911	ZFHX3_HUMAN	zinc finger homeobox 3	2618					brain development (GO:0007420)|cell cycle arrest (GO:0007050)|muscle organ development (GO:0007517)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of myoblast differentiation (GO:0045663)|regulation of neuron differentiation (GO:0045664)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	enzyme binding (GO:0019899)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			NS(3)|breast(7)|cervix(2)|endometrium(18)|haematopoietic_and_lymphoid_tissue(5)|kidney(8)|large_intestine(22)|liver(1)|lung(46)|ovary(5)|pancreas(1)|prostate(15)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(11)	153		Ovarian(137;0.13)				CCTTTTCCTCCAGCTTCCTCT	0.547																																																	0								C	,	3,4393	6.2+/-15.9	0,3,2195	221.0	227.0	225.0		5112,7854	5.6	1.0	16	dbSNP_134	225	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	ZFHX3	NM_001164766.1,NM_006885.3	,	0,3,6495	TT,TC,CC		0.0,0.0682,0.0231	,	1704/2790,2618/3704	72828727	3,12993	2198	4300	6498	SO:0001819	synonymous_variant	0			D10250	CCDS10908.1, CCDS54035.1	16q22.3	2012-03-09	2007-08-09	2007-08-09	ENSG00000140836	ENSG00000140836		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	777	protein-coding gene	gene with protein product		104155	"""AT-binding transcription factor 1"""	ATBF1		1719379, 7592926	Standard	NM_006885		Approved	ZNF927	uc002fck.3	Q15911	OTTHUMG00000137599	ENST00000268489.5:c.7854G>A	16.37:g.72828727C>T			D3DWS8|O15101|Q13719	Silent	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,superfamily_Adenylate_cyclase-assoc_CAP_N,smart_Znf_C2H2-like,smart_Znf_U1,smart_Homeobox_dom,pfscan_Homeobox_dom,pfscan_Znf_C2H2	p.L2618	ENST00000268489.5	37	c.7854	CCDS10908.1	16																																																																																			ZFHX3	-	NULL	ENSG00000140836		0.547	ZFHX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFHX3	HGNC	protein_coding	OTTHUMT00000269008.1	-	0.00	80	0	C	NM_006885		72828727	-1	tier1	rs139779175	no_errors	ENST00000268489	ensembl	human	known	74_37	silent	6.25	60	4	SNP	1.000	T
ZFYVE9	9372	genome.wustl.edu	37	1	52810443	52810443	+	Frame_Shift_Del	DEL	T	T	-			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr1:52810443delT	ENST00000371591.1	+	17	4074	c.3943delT	c.(3943-3945)tttfs	p.F1316fs	ZFYVE9_ENST00000357206.2_Frame_Shift_Del_p.F1257fs|ZFYVE9_ENST00000287727.3_Frame_Shift_Del_p.F1316fs	NM_004799.2|NM_007324.2	NP_004790.2|NP_015563.2	O95405	ZFYV9_HUMAN	zinc finger, FYVE domain containing 9	1316					endocytosis (GO:0006897)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|proteolysis (GO:0006508)|SMAD protein complex assembly (GO:0007183)|SMAD protein import into nucleus (GO:0007184)|transforming growth factor beta receptor signaling pathway (GO:0007179)	early endosome (GO:0005769)|early endosome membrane (GO:0031901)	1-phosphatidylinositol binding (GO:0005545)|metal ion binding (GO:0046872)|serine-type peptidase activity (GO:0008236)			breast(1)|central_nervous_system(4)|endometrium(3)|kidney(1)|large_intestine(12)|lung(17)|ovary(2)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(6)	53						GGAACAGGTGTTTTTCCTAGA	0.428																																																	0													96.0	82.0	87.0					1																	52810443		2203	4300	6503	SO:0001589	frameshift_variant	0			AF104304	CCDS563.1, CCDS564.1	1p32.3	2014-06-13	2004-05-21	2004-05-26	ENSG00000157077	ENSG00000157077		"""Zinc fingers, FYVE domain containing"""	6775	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 173"""	603755	"""MAD, mothers against decapentaplegic homolog (Drosophila) interacting protein, receptor activation anchor"""	MADHIP		9865696	Standard	NM_007324		Approved	SMADIP, SARA, PPP1R173	uc001cto.4	O95405	OTTHUMG00000008061	ENST00000371591.1:c.3943delT	1.37:g.52810443delT	ENSP00000360647:p.Phe1316fs		Q5T0F6|Q5T0F7|Q9UNE1|Q9Y5R7	Frame_Shift_Del	DEL	pfam_DUF3480,pfam_SARA_Smad-bd,pfam_Znf_FYVE,superfamily_Znf_FYVE_PHD,smart_Znf_FYVE,pirsf_Znf_FYVE_SARA/endofin,pfscan_Znf_FYVE-rel	p.F1316fs	ENST00000371591.1	37	c.3943	CCDS563.1	1																																																																																			ZFYVE9	-	pfam_DUF3480,pirsf_Znf_FYVE_SARA/endofin	ENSG00000157077		0.428	ZFYVE9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFYVE9	HGNC	protein_coding	OTTHUMT00000022083.1		0.00	44	0	T	NM_007324		52810443	+1	tier1		no_errors	ENST00000287727	ensembl	human	known	74_37	frame_shift_del	13.33	26	4	DEL	1.000	-
ZNF214	7761	genome.wustl.edu	37	11	7021545	7021545	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr11:7021545G>T	ENST00000278314.4	-	3	1684	c.1369C>A	c.(1369-1371)Ctt>Att	p.L457I	ZNF214_ENST00000531083.1_5'Flank|ZNF214_ENST00000536068.1_Missense_Mutation_p.L457I	NM_013249.2	NP_037381.2	Q9UL59	ZN214_HUMAN	zinc finger protein 214	457					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(10)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	29				Epithelial(150;3.87e-08)|BRCA - Breast invasive adenocarcinoma(625;0.081)		TGAATGCGAAGATCTGAGCTG	0.433																																					Ovarian(22;251 657 736 21522 46864)												0													121.0	124.0	123.0					11																	7021545		2201	4296	6497	SO:0001583	missense	0			AF056617	CCDS31418.1	11p15.4	2013-01-08				ENSG00000149050		"""Zinc fingers, C2H2-type"", ""-"""	13006	protein-coding gene	gene with protein product		605015					Standard	NM_013249		Approved		uc001mfa.2	Q9UL59		ENST00000278314.4:c.1369C>A	11.37:g.7021545G>T	ENSP00000278314:p.Leu457Ile		B2R8Q1	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.L457I	ENST00000278314.4	37	c.1369	CCDS31418.1	11	.	.	.	.	.	.	.	.	.	.	G	17.71	3.457653	0.63401	.	.	ENSG00000149050	ENST00000278314;ENST00000536068	T;T	0.53857	0.6;0.6	4.05	4.05	0.47172	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.38058	N	0.001828	T	0.78381	0.4274	M	0.93150	3.385	0.26617	N	0.972736	D	0.89917	1.0	D	0.85130	0.997	T	0.73477	-0.3970	10	0.72032	D	0.01	.	14.5016	0.67724	0.0:0.0:1.0:0.0	.	457	Q9UL59	ZN214_HUMAN	I	457	ENSP00000278314:L457I;ENSP00000445373:L457I	ENSP00000278314:L457I	L	-	1	0	ZNF214	6978121	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.969000	0.49232	2.536000	0.85505	0.561000	0.74099	CTT	ZNF214	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000149050		0.433	ZNF214-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF214	HGNC	protein_coding	OTTHUMT00000385349.1		0.00	52	0	G			7021545	-1			no_errors	ENST00000278314	ensembl	human	known	74_37	missense	5.00	38	2	SNP	1.000	T
ZNF578	147660	genome.wustl.edu	37	19	53014266	53014266	+	Missense_Mutation	SNP	A	A	T			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr19:53014266A>T	ENST00000421239.2	+	6	876	c.632A>T	c.(631-633)aAt>aTt	p.N211I	CTD-3099C6.5_ENST00000599143.1_RNA	NM_001099694.1	NP_001093164.1	Q96N58	ZN578_HUMAN	zinc finger protein 578	211					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)								GBM - Glioblastoma multiforme(134;0.00819)|OV - Ovarian serous cystadenocarcinoma(262;0.01)		TATGGGAATAATTTTTTCCAT	0.363																																																	0													65.0	69.0	67.0					19																	53014266		2201	4298	6499	SO:0001583	missense	0			AK095562	CCDS54310.1	19q13.41	2013-09-20			ENSG00000258405	ENSG00000258405		"""Zinc fingers, C2H2-type"", ""-"""	26449	protein-coding gene	gene with protein product							Standard	NM_001099694		Approved	FLJ31384	uc002pzp.4	Q96N58	OTTHUMG00000156468	ENST00000421239.2:c.632A>T	19.37:g.53014266A>T	ENSP00000459216:p.Asn211Ile		B4DR51|I3L1Y6	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.N211I	ENST00000421239.2	37	c.632	CCDS54310.1	19	.	.	.	.	.	.	.	.	.	.	-	9.540	1.113044	0.20795	.	.	ENSG00000258405	ENST00000553364	.	.	.	1.42	-2.83	0.05769	.	.	.	.	.	T	0.35158	0.0922	L	0.41356	1.27	0.09310	N	1	D	0.61697	0.99	P	0.59487	0.858	T	0.17961	-1.0352	7	.	.	.	.	0.4879	0.00559	0.2728:0.2741:0.2619:0.1911	.	211	G3V4F6	.	I	211	.	.	N	+	2	0	ZNF578	57706078	0.000000	0.05858	0.000000	0.03702	0.307000	0.27823	-4.005000	0.00315	-2.079000	0.00871	0.113000	0.15668	AAT	ZNF578	-	NULL	ENSG00000258405		0.363	ZNF578-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	ZNF578	HGNC	protein_coding	OTTHUMT00000344298.3	-	0.00	74	0	A	NM_152472		53014266	+1	tier1	-	no_errors	ENST00000421239	ensembl	human	known	74_37	missense	18.18	45	10	SNP	0.001	T
ZNF582	147948	genome.wustl.edu	37	19	56896193	56896193	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr19:56896193G>T	ENST00000301310.4	-	5	751	c.593C>A	c.(592-594)cCc>cAc	p.P198H	ZNF582_ENST00000586929.1_Missense_Mutation_p.P198H|AC006116.12_ENST00000589671.1_RNA	NM_144690.1	NP_653291.1	Q96NG8	ZN582_HUMAN	zinc finger protein 582	198					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(7)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	26		Colorectal(82;0.000256)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0547)		ACATTTATAGGGTTTCTCATT	0.323																																					Ovarian(183;1887 2032 4349 30507 51343)												0													64.0	67.0	66.0					19																	56896193		2203	4300	6503	SO:0001583	missense	0			AK055489	CCDS33121.1	19q13.43	2013-07-15			ENSG00000018869	ENSG00000018869		"""Zinc fingers, C2H2-type"", ""-"""	26421	protein-coding gene	gene with protein product		615600				12477932	Standard	NM_144690		Approved	FLJ30927	uc002qmz.1	Q96NG8	OTTHUMG00000181939	ENST00000301310.4:c.593C>A	19.37:g.56896193G>T	ENSP00000301310:p.Pro198His		B4DQZ9|B7Z9R3|Q6PJT6	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.P198H	ENST00000301310.4	37	c.593	CCDS33121.1	19	.	.	.	.	.	.	.	.	.	.	G	10.78	1.447831	0.26074	.	.	ENSG00000018869	ENST00000301310	T	0.17528	2.27	4.78	2.68	0.31781	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.35262	N	0.003328	T	0.35335	0.0928	M	0.78456	2.415	0.24819	N	0.992592	P;D	0.89917	0.926;1.0	B;D	0.74674	0.379;0.984	T	0.04840	-1.0923	10	0.59425	D	0.04	.	5.6908	0.17829	0.1747:0.0:0.6642:0.161	.	198;229	Q96NG8;B4DQZ9	ZN582_HUMAN;.	H	198	ENSP00000301310:P198H	ENSP00000301310:P198H	P	-	2	0	ZNF582	61588005	0.981000	0.34729	0.323000	0.25347	0.001000	0.01503	2.337000	0.43947	1.369000	0.46134	0.591000	0.81541	CCC	ZNF582	-	pfscan_Znf_C2H2	ENSG00000018869		0.323	ZNF582-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF582	HGNC	protein_coding	OTTHUMT00000458387.2		0.00	59	0	G	NM_144690		56896193	-1			no_errors	ENST00000301310	ensembl	human	known	74_37	missense	6.00	47	3	SNP	0.783	T
ZNF646	9726	genome.wustl.edu	37	16	31091869	31091869	+	Silent	SNP	G	G	A	rs369374909		TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr16:31091869G>A	ENST00000394979.2	+	1	4647	c.4224G>A	c.(4222-4224)gcG>gcA	p.A1408A	ZNF646_ENST00000300850.5_Silent_p.A1408A			O15015	ZN646_HUMAN	zinc finger protein 646	1408					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(4)|cervix(2)|endometrium(8)|kidney(4)|large_intestine(1)|lung(21)|ovary(1)|prostate(4)|skin(3)	49						CCAGTGAGGCGAACCTGACTG	0.642																																																	0								G		0,4394		0,0,2197	39.0	39.0	39.0		4224	2.7	0.0	16		39	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	ZNF646	NM_014699.3		0,1,6496	AA,AG,GG		0.0116,0.0,0.0077		1408/1833	31091869	1,12993	2197	4300	6497	SO:0001819	synonymous_variant	0			AB002294	CCDS10702.1	16p11.2	2013-01-08			ENSG00000167395	ENSG00000167395		"""Zinc fingers, C2H2-type"""	29004	protein-coding gene	gene with protein product							Standard	NM_014699		Approved	KIAA0296	uc002eap.3	O15015	OTTHUMG00000047355	ENST00000394979.2:c.4224G>A	16.37:g.31091869G>A			Q8IVD8	Silent	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.A1408	ENST00000394979.2	37	c.4224		16																																																																																			ZNF646	-	NULL	ENSG00000167395		0.642	ZNF646-003	KNOWN	basic	protein_coding	ZNF646	HGNC	protein_coding	OTTHUMT00000108510.2	-	0.00	102	0	G	NM_014699		31091869	+1	tier1	-	no_errors	ENST00000300850	ensembl	human	known	74_37	silent	32.22	61	29	SNP	0.001	A
ZNF679	168417	genome.wustl.edu	37	7	63726929	63726929	+	Silent	SNP	C	C	T			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr7:63726929C>T	ENST00000421025.1	+	5	1187	c.918C>T	c.(916-918)agC>agT	p.S306S	ZNF679_ENST00000255746.4_Silent_p.S306S	NM_001159524.1|NM_153363.2	NP_001152996.1|NP_699194.2	Q8IYX0	ZN679_HUMAN	zinc finger protein 679	306					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|kidney(3)|lung(11)|skin(1)|stomach(1)	18						AAGCCTTTAGCTTATCCTCAT	0.448																																																	0													32.0	31.0	31.0					7																	63726929		692	1591	2283	SO:0001819	synonymous_variant	0			BC033523	CCDS47592.1	7q11.21	2013-01-08			ENSG00000197123	ENSG00000197123		"""Zinc fingers, C2H2-type"", ""-"""	28650	protein-coding gene	gene with protein product	"""hypothetical protein MGC42415"""					12477932	Standard	NM_153363		Approved	MGC42415	uc003tsx.3	Q8IYX0	OTTHUMG00000156486	ENST00000421025.1:c.918C>T	7.37:g.63726929C>T				Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.S306	ENST00000421025.1	37	c.918	CCDS47592.1	7																																																																																			ZNF679	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000197123		0.448	ZNF679-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF679	HGNC	protein_coding	OTTHUMT00000344317.2	-	0.00	77	0	C	NM_153363		63726929	+1	tier1	-	no_errors	ENST00000255746	ensembl	human	known	74_37	silent	5.56	68	4	SNP	0.018	T
ZNF655	79027	genome.wustl.edu	37	7	99170870	99170870	+	Missense_Mutation	SNP	A	A	G			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr7:99170870A>G	ENST00000394163.2	+	3	1322	c.1139A>G	c.(1138-1140)tAt>tGt	p.Y380C	GS1-259H13.10_ENST00000486324.1_Intron|ZNF655_ENST00000252713.4_Missense_Mutation_p.Y380C|ZNF655_ENST00000419215.2_3'UTR|GS1-259H13.10_ENST00000455905.1_Intron|ZNF655_ENST00000493277.1_Missense_Mutation_p.Y415C|ZNF655_ENST00000424881.1_Missense_Mutation_p.Y415C|ZNF655_ENST00000425063.1_3'UTR	NM_001009960.1|NM_138494.2	NP_001009960.1|NP_612503.1	Q8N720	ZN655_HUMAN	zinc finger protein 655	380					negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.Y380C(1)		NS(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	16	all_epithelial(64;3.19e-09)|Lung NSC(181;0.0066)|all_lung(186;0.011)|Esophageal squamous(72;0.0166)					GAAAAGCCCTATACGTGTAGT	0.368																																																	1	Substitution - Missense(1)	upper_aerodigestive_tract(1)											95.0	101.0	99.0					7																	99170870		2203	4300	6503	SO:0001583	missense	0			AY099353	CCDS5669.1, CCDS5670.1, CCDS34695.1, CCDS47655.1	7q22.1	2013-01-08			ENSG00000197343	ENSG00000197343		"""Zinc fingers, C2H2-type"", ""-"""	30899	protein-coding gene	gene with protein product						11179890, 15558030	Standard	NM_001083956		Approved	VIK-1, VIK	uc010lgc.3	Q8N720	OTTHUMG00000156637	ENST00000394163.2:c.1139A>G	7.37:g.99170870A>G	ENSP00000377718:p.Tyr380Cys		A4D291|A6NGD3|B4E3M4|B7Z9Q9|D6W5T4|Q8IV00|Q8TA89|Q96EZ3|Q9BQ85	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.Y415C	ENST00000394163.2	37	c.1244	CCDS5669.1	7	.	.	.	.	.	.	.	.	.	.	A	11.25	1.583333	0.28268	.	.	ENSG00000197343	ENST00000252713;ENST00000493277;ENST00000424881;ENST00000394163	T;T;T;T	0.69306	-0.39;-0.39;-0.39;-0.39	5.07	-0.548	0.11833	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.38663	N	0.001617	T	0.70850	0.3271	L	0.58969	1.84	0.26415	N	0.976198	D;D	0.76494	0.998;0.999	D;D	0.66716	0.911;0.946	T	0.61874	-0.6973	10	0.87932	D	0	-2.0722	5.5184	0.16919	0.401:0.0:0.0792:0.5198	.	415;380	Q8N720-3;Q8N720	.;ZN655_HUMAN	C	380;415;415;380	ENSP00000252713:Y380C;ENSP00000419135:Y415C;ENSP00000393876:Y415C;ENSP00000377718:Y380C	ENSP00000252713:Y380C	Y	+	2	0	ZNF655	99008806	0.007000	0.16637	0.025000	0.17156	0.650000	0.38633	0.391000	0.20784	-0.159000	0.11021	0.528000	0.53228	TAT	ZNF655	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000197343		0.368	ZNF655-009	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	ZNF655	HGNC	protein_coding	OTTHUMT00000344929.1	-	0.00	32	0	A	NM_138494		99170870	+1	tier1	-	no_errors	ENST00000424881	ensembl	human	known	74_37	missense	32.14	19	9	SNP	0.008	G
ZNF749	388567	genome.wustl.edu	37	19	57955022	57955022	+	Missense_Mutation	SNP	A	A	G			TCGA-LN-A4A2-01A-31D-A27G-09	TCGA-LN-A4A2-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0428f112-5bb2-4587-b9e5-99c74ca18527	adec6642-1095-4cd8-9077-dd8f22d1cf14	g.chr19:57955022A>G	ENST00000334181.4	+	3	756	c.506A>G	c.(505-507)cAg>cGg	p.Q169R	AC004076.9_ENST00000596831.1_Intron	NM_001023561.2	NP_001018855.2	O43361	ZN749_HUMAN	zinc finger protein 749	169					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(6)|kidney(2)|lung(3)|prostate(1)	13		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0264)|Lung(386;0.177)		GACCTTCTCCAGCAACAGGTC	0.522																																																	0													73.0	60.0	65.0					19																	57955022		2203	4300	6503	SO:0001583	missense	0			AK122740	CCDS33132.2	19q13.43	2013-01-08			ENSG00000186230	ENSG00000186230		"""Zinc fingers, C2H2-type"", ""-"""	32783	protein-coding gene	gene with protein product							Standard	NM_001023561		Approved	FLJ16360	uc002qoq.2	O43361	OTTHUMG00000150372	ENST00000334181.4:c.506A>G	19.37:g.57955022A>G	ENSP00000333980:p.Gln169Arg			Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.Q169R	ENST00000334181.4	37	c.506	CCDS33132.2	19	.	.	.	.	.	.	.	.	.	.	A	8.093	0.775003	0.16051	.	.	ENSG00000186230	ENST00000334181	T	0.01455	4.87	2.06	0.955	0.19602	.	.	.	.	.	T	0.01061	0.0035	N	0.11927	0.2	0.09310	N	1	P	0.43826	0.818	B	0.38842	0.283	T	0.50816	-0.8783	9	0.16420	T	0.52	.	6.3126	0.21173	0.7065:0.2934:0.0:0.0	.	169	O43361	ZN749_HUMAN	R	169	ENSP00000333980:Q169R	ENSP00000333980:Q169R	Q	+	2	0	ZNF749	62646834	0.000000	0.05858	0.001000	0.08648	0.122000	0.20287	-2.183000	0.01255	0.230000	0.21059	0.254000	0.18369	CAG	ZNF749	-	NULL	ENSG00000186230		0.522	ZNF749-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF749	HGNC	protein_coding	OTTHUMT00000317879.1	-	0.00	44	0	A	NM_001023561		57955022	+1	tier1	-	no_errors	ENST00000334181	ensembl	human	known	74_37	missense	25.00	26	9	SNP	0.005	G
