#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name	i_deletion_substructures	i_domain	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_header	i_normal_VAF	i_normal_ref_reads	i_normal_var_reads	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_tier	i_title	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_VAF	i_tumor_ref_reads	i_tumor_var_reads	i_type	i_ucsc_cons	i_variant
MRC1	4360	genome.wustl.edu	37	10	17908632	17908632	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr10:17908632G>C	ENST00000331429.2	+	12	1948	c.1845G>C	c.(1843-1845)ttG>ttC	p.L615F																	breast(1)|endometrium(1)|large_intestine(1)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	14						GGGATGTTTTGAAATGTGATG	0.502																																																	0													6.0	7.0	7.0					10																	17908632		971	2966	3937	SO:0001583	missense	0																														ENST00000331429.2:c.1845G>C	10.37:g.17908632G>C	ENSP00000332124:p.Leu615Phe			Missense_Mutation	SNP	pfam_C-type_lectin,pfam_FN_type2_col-bd,pfam_Ricin_B_lectin,pfam_Herpes_UL45-like,superfamily_C-type_lectin_fold,superfamily_Ricin_B_lectin,superfamily_Kringle-like,smart_Ricin_B_lectin,smart_FN_type2_col-bd,smart_C-type_lectin,pfscan_FN_type2_col-bd,pfscan_C-type_lectin,pfscan_Ricin_B_lectin,prints_AntifreezeII	p.L615F	ENST00000331429.2	37	c.1845		10	.	.	.	.	.	.	.	.	.	.	G	15.95	2.984971	0.53934	.	.	ENSG00000183748	ENST00000331429	T	0.19105	2.17	4.12	4.12	0.48240	.	0.683124	0.12139	U	0.496038	T	0.39118	0.1066	.	.	.	0.37601	D	0.920565	D	0.71674	0.998	D	0.71656	0.974	T	0.43653	-0.9378	8	0.39692	T	0.17	-29.2453	7.977	0.30161	0.198:0.0:0.802:0.0	.	615	B9EJA8	.	F	615	ENSP00000332124:L615F	ENSP00000332124:L615F	L	+	3	2	AL928580.1	17948638	1.000000	0.71417	0.987000	0.45799	0.986000	0.74619	1.182000	0.32029	2.016000	0.59253	0.552000	0.68991	TTG	MRC1L1	-	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin	ENSG00000183748		0.502	MRC1L1-001	NOVEL	basic|appris_principal	protein_coding	101928757	Clone_based_vega_gene	protein_coding	OTTHUMT00000047054.1	-	0.00	60	0	G			17908632	+1	tier1	-	no_errors	ENST00000331429	ensembl	human	novel	74_37	missense	48.57	17	17	SNP	0.994	C
ABCA10	10349	genome.wustl.edu	37	17	67193205	67193205	+	Splice_Site	SNP	C	C	T			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr17:67193205C>T	ENST00000269081.4	-	12	2143	c.1234G>A	c.(1234-1236)Ggc>Agc	p.G412S	ABCA10_ENST00000416101.2_Splice_Site_p.G412S|ABCA10_ENST00000432313.2_Splice_Site_p.G412R	NM_080282.3	NP_525021.3	Q8WWZ4	ABCAA_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 10	412	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(20)|lung(34)|ovary(2)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(4)	81	Breast(10;6.95e-12)					TTCTTTTTACCTTGCAATGCT	0.438																																																	0													143.0	134.0	137.0					17																	67193205		2198	4298	6496	SO:0001630	splice_region_variant	0			AY247065	CCDS11684.1	17q24	2012-03-14			ENSG00000154263	ENSG00000154263		"""ATP binding cassette transporters / subfamily A"""	30	protein-coding gene	gene with protein product		612508				12821155, 11435397	Standard	NM_080282		Approved	EST698739	uc010dfa.1	Q8WWZ4	OTTHUMG00000164716	ENST00000269081.4:c.1234+1G>A	17.37:g.67193205C>T			C9JZH2|C9K035|Q6PIQ6|Q7Z2I9|Q7Z7P7|Q86TD2	Missense_Mutation	SNP	pfam_ABC_transporter-like,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.G412S	ENST00000269081.4	37	c.1234	CCDS11684.1	17	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	18.06|18.06	3.538221|3.538221	0.65085|0.65085	.|.	.|.	ENSG00000154263|ENSG00000154263	ENST00000432313|ENST00000269081;ENST00000416101	D|T;D	0.86956|0.94232	-2.19|0.96;-3.38	3.6|3.6	3.6|3.6	0.41247|0.41247	.|ABC transporter-like (1);	0.000000|0.000000	0.33005|0.33005	U|U	0.005387|0.005387	D|D	0.89918|0.89918	0.6854|0.6854	L|L	0.42744|0.42744	1.35|1.35	0.80722|0.80722	D|D	1|1	.|P	.|0.51791	.|0.948	.|P	.|0.46885	.|0.53	D|D	0.87512|0.87512	0.2440|0.2440	7|9	.|.	.|.	.|.	.|.	7.6137|7.6137	0.28145|0.28145	0.0:0.8278:0.0:0.1722|0.0:0.8278:0.0:0.1722	.|.	.|412	.|Q8WWZ4	.|ABCAA_HUMAN	R|S	412|412	ENSP00000387674:G412R|ENSP00000269081:G412S;ENSP00000407772:G412S	.|.	G|G	-|-	1|1	0|0	ABCA10|ABCA10	64704800|64704800	1.000000|1.000000	0.71417|0.71417	0.982000|0.982000	0.44146|0.44146	0.686000|0.686000	0.39977|0.39977	2.001000|2.001000	0.40825|0.40825	1.822000|1.822000	0.53115|0.53115	0.460000|0.460000	0.39030|0.39030	GGA|GGC	ABCA10	-	superfamily_P-loop_NTPase,pfscan_ABC_transporter-like	ENSG00000154263		0.438	ABCA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA10	HGNC	protein_coding	OTTHUMT00000379881.4	-	0.00	46	0	C	NM_080282	Missense_Mutation	67193205	-1	tier1	-	no_errors	ENST00000269081	ensembl	human	known	74_37	missense	29.41	24	10	SNP	1.000	T
ABCA3	21	genome.wustl.edu	37	16	2328323	2328323	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr16:2328323C>G	ENST00000301732.5	-	30	5384	c.4684G>C	c.(4684-4686)Gag>Cag	p.E1562Q	ABCA3_ENST00000382381.3_Missense_Mutation_p.E1504Q	NM_001089.2	NP_001080.2	Q99758	ABCA3_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 3	1562	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				response to drug (GO:0042493)|transmembrane transport (GO:0055085)|transport (GO:0006810)	alveolar lamellar body (GO:0097208)|alveolar lamellar body membrane (GO:0097233)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)			breast(7)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(11)|liver(1)|lung(20)|ovary(7)|prostate(5)|skin(6)|upper_aerodigestive_tract(1)	70		Ovarian(90;0.17)			Imatinib(DB00619)	TTGCCAGACTCTCGGGCTCGT	0.642																																																	0													53.0	58.0	56.0					16																	2328323		2198	4300	6498	SO:0001583	missense	0			U78735	CCDS10466.1	16p13.3	2012-03-14			ENSG00000167972	ENSG00000167972		"""ATP binding cassette transporters / subfamily A"""	33	protein-coding gene	gene with protein product		601615		ABC3		8706931	Standard	NM_001089		Approved	ABC-C, EST111653, LBM180	uc002cpy.1	Q99758	OTTHUMG00000128845	ENST00000301732.5:c.4684G>C	16.37:g.2328323C>G	ENSP00000301732:p.Glu1562Gln		B2RU09|Q54A95|Q6P5P9|Q92473	Missense_Mutation	SNP	pfam_ABC_transporter-like,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.E1562Q	ENST00000301732.5	37	c.4684	CCDS10466.1	16	.	.	.	.	.	.	.	.	.	.	C	15.56	2.869519	0.51588	.	.	ENSG00000167972	ENST00000301732;ENST00000382381	D	0.84660	-1.88	5.41	4.45	0.53987	ATPase, AAA+ type, core (1);ABC transporter-like (1);	0.052363	0.85682	N	0.000000	D	0.86255	0.5889	L	0.28740	0.885	0.80722	D	1	P;D	0.58268	0.813;0.982	B;D	0.64321	0.387;0.924	D	0.84462	0.0594	10	0.27785	T	0.31	.	15.2036	0.73159	0.0:0.8584:0.1416:0.0	.	1566;1562	Q4LE27;Q99758	.;ABCA3_HUMAN	Q	1562;1566	ENSP00000301732:E1562Q	ENSP00000301732:E1562Q	E	-	1	0	ABCA3	2268324	0.998000	0.40836	0.235000	0.24058	0.000000	0.00434	3.763000	0.55257	1.394000	0.46624	-0.305000	0.09177	GAG	ABCA3	-	superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like	ENSG00000167972		0.642	ABCA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA3	HGNC	protein_coding	OTTHUMT00000250784.2	-	0.00	58	0	C	NM_001089		2328323	-1	tier1	-	no_errors	ENST00000301732	ensembl	human	known	74_37	missense	18.97	47	11	SNP	0.999	G
ACSS2	55902	genome.wustl.edu	37	20	33515022	33515022	+	3'UTR	SNP	G	G	A			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr20:33515022G>A	ENST00000360596.2	+	0	2322				ACSS2_ENST00000253382.5_3'UTR|ACSS2_ENST00000336325.4_3'UTR|ACSS2_ENST00000476922.1_3'UTR	NM_018677.3	NP_061147.1	Q9NR19	ACSA_HUMAN	acyl-CoA synthetase short-chain family member 2						acetate biosynthetic process (GO:0019413)|acetyl-CoA biosynthetic process from acetate (GO:0019427)|ethanol oxidation (GO:0006069)|lipid biosynthetic process (GO:0008610)|propionate biosynthetic process (GO:0019542)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	acetate-CoA ligase activity (GO:0003987)|AMP binding (GO:0016208)|ATP binding (GO:0005524)			cervix(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(6)|lung(9)	21					Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)	CAGTGAACATGATCCTGACCT	0.557																																																	0													198.0	164.0	175.0					20																	33515022		2203	4300	6503	SO:0001624	3_prime_UTR_variant	0			AF263614	CCDS13243.1, CCDS42868.1, CCDS42868.2	20q11.22	2012-07-13	2005-09-08	2005-09-08	ENSG00000131069	ENSG00000131069	6.2.1.1	"""Acyl-CoA synthetase family"""	15814	protein-coding gene	gene with protein product		605832	"""acetyl-Coenzyme A synthetase 2 (ADP forming)"""	ACAS2		10843999	Standard	NM_018677		Approved	ACS, ACSA, AceCS, dJ1161H23.1	uc010gey.2	Q9NR19	OTTHUMG00000032317	ENST00000360596.2:c.*5G>A	20.37:g.33515022G>A			A6NE90|Q5QPH2|Q5QPH3|Q8N238|Q96EL0|Q9NQP7|Q9UJ15	RNA	SNP	-	NULL	ENST00000360596.2	37	NULL	CCDS13243.1	20																																																																																			ACSS2	-	-	ENSG00000131069		0.557	ACSS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACSS2	HGNC	protein_coding	OTTHUMT00000078823.3	-	0.00	54	0	G	NM_018677		33515022	+1	tier1	-	no_errors	ENST00000476922	ensembl	human	known	74_37	rna	11.63	38	5	SNP	0.772	A
ACTR6	64431	genome.wustl.edu	37	12	100603884	100603884	+	Missense_Mutation	SNP	A	A	G			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr12:100603884A>G	ENST00000188312.2	+	5	1178	c.413A>G	c.(412-414)gAt>gGt	p.D138G	ACTR6_ENST00000551617.1_Missense_Mutation_p.D56G|ACTR6_ENST00000546902.1_Missense_Mutation_p.D56G|ACTR6_ENST00000552376.1_Missense_Mutation_p.D138G	NM_022496.4	NP_071941.1	Q9GZN1	ARP6_HUMAN	ARP6 actin-related protein 6 homolog (yeast)	138						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)				autonomic_ganglia(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(5)|ovary(2)|skin(1)	14						TATTTCCGAGATAATCCTTCC	0.294																																																	0													126.0	119.0	122.0					12																	100603884		2203	4299	6502	SO:0001583	missense	0			AF212251	CCDS9074.1	12q23.1	2012-07-09			ENSG00000075089	ENSG00000075089			24025	protein-coding gene	gene with protein product						11368909	Standard	NM_022496		Approved	ARP6, FLJ13433	uc001thb.2	Q9GZN1	OTTHUMG00000170245	ENST00000188312.2:c.413A>G	12.37:g.100603884A>G	ENSP00000188312:p.Asp138Gly		B3KW37|B4DLG9|Q53GH2|Q9BY39|Q9H8H6	Missense_Mutation	SNP	pfam_Actin-related,smart_Actin-related	p.D138G	ENST00000188312.2	37	c.413	CCDS9074.1	12	.	.	.	.	.	.	.	.	.	.	A	14.76	2.632430	0.46944	.	.	ENSG00000075089	ENST00000551652;ENST00000188312;ENST00000546902;ENST00000552376;ENST00000551617	D;D;D;D;D	0.94184	-3.37;-3.37;-3.37;-3.37;-3.37	5.2	5.2	0.72013	.	0.274200	0.41294	D	0.000908	D	0.89301	0.6676	L	0.31476	0.935	0.80722	D	1	B;B;B	0.13145	0.007;0.002;0.002	B;B;B	0.12156	0.004;0.004;0.007	D	0.86089	0.1549	10	0.62326	D	0.03	.	15.5171	0.75833	1.0:0.0:0.0:0.0	.	56;138;138	F8VSD1;F8W057;Q9GZN1	.;.;ARP6_HUMAN	G	150;138;56;138;56	ENSP00000448508:D150G;ENSP00000188312:D138G;ENSP00000448669:D56G;ENSP00000447237:D138G;ENSP00000448356:D56G	ENSP00000188312:D138G	D	+	2	0	ACTR6	99128015	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.469000	0.60169	2.299000	0.77371	0.528000	0.53228	GAT	ACTR6	-	pfam_Actin-related,smart_Actin-related	ENSG00000075089		0.294	ACTR6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACTR6	HGNC	protein_coding	OTTHUMT00000408159.1	-	0.00	51	0	A	NM_022496		100603884	+1	tier1	-	no_errors	ENST00000188312	ensembl	human	known	74_37	missense	17.07	34	7	SNP	1.000	G
ACVR1C	130399	genome.wustl.edu	37	2	158390538	158390538	+	Silent	SNP	C	C	T			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr2:158390538C>T	ENST00000243349.8	-	9	1734	c.1374G>A	c.(1372-1374)ggG>ggA	p.G458G	ACVR1C_ENST00000409680.3_Silent_p.G408G|ACVR1C_ENST00000335450.7_Silent_p.G378G|ACVR1C_ENST00000348328.5_Silent_p.G301G	NM_001111032.1|NM_145259.2	NP_001104502.1|NP_660302.2			activin A receptor, type IC											NS(1)|breast(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(6)|liver(1)|lung(18)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	42						GCATTATTCTCCCCATGACTC	0.413																																																	0													74.0	81.0	79.0					2																	158390538		2203	4300	6503	SO:0001819	synonymous_variant	0			BC022530	CCDS2205.1, CCDS46432.1, CCDS46433.1, CCDS46434.1	2q24.2	2008-02-05			ENSG00000123612	ENSG00000123612			18123	protein-coding gene	gene with protein product		608981					Standard	NM_145259		Approved	ALK7, ACVRLK7	uc002tzk.4	Q8NER5	OTTHUMG00000131964	ENST00000243349.8:c.1374G>A	2.37:g.158390538C>T				Silent	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_TGF_beta_rcpt_GS,pfam_Activin_rcpt,superfamily_Kinase-like_dom,smart_TGF_beta_rcpt_GS,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.G458	ENST00000243349.8	37	c.1374	CCDS2205.1	2																																																																																			ACVR1C	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000123612		0.413	ACVR1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACVR1C	HGNC	protein_coding	OTTHUMT00000254924.2	-	0.00	34	0	C	NM_145259		158390538	-1	tier1	-	no_errors	ENST00000243349	ensembl	human	known	74_37	silent	23.81	16	5	SNP	0.799	T
ADAMTS9	56999	genome.wustl.edu	37	3	64636815	64636815	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr3:64636815G>T	ENST00000498707.1	-	9	1683	c.1341C>A	c.(1339-1341)aaC>aaA	p.N447K	ADAMTS9_ENST00000295903.4_Missense_Mutation_p.N419K|ADAMTS9_ENST00000459780.1_Missense_Mutation_p.N447K	NM_182920.1	NP_891550.1	Q9P2N4	ATS9_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 9	447	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				glycoprotein catabolic process (GO:0006516)|multicellular organismal development (GO:0007275)|positive regulation of melanocyte differentiation (GO:0045636)|protein transport (GO:0015031)|proteolysis (GO:0006508)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(4)|cervix(1)|endometrium(9)|kidney(4)|large_intestine(17)|liver(4)|lung(43)|ovary(3)|prostate(3)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	100		Lung NSC(201;0.00682)		BRCA - Breast invasive adenocarcinoma(55;0.00142)|Kidney(15;0.00202)|KIRC - Kidney renal clear cell carcinoma(15;0.00221)		TACATTTGTTGTTGTCATCAT	0.423																																																	0													197.0	174.0	182.0					3																	64636815		2203	4300	6503	SO:0001583	missense	0			AF261918	CCDS2903.1	3p14.1	2008-05-15	2005-08-19		ENSG00000163638	ENSG00000163638		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	13202	protein-coding gene	gene with protein product		605421	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 9"""			10936055	Standard	NM_182920		Approved	KIAA1312	uc003dmg.3	Q9P2N4	OTTHUMG00000158722	ENST00000498707.1:c.1341C>A	3.37:g.64636815G>T	ENSP00000418735:p.Asn447Lys		A1L4L0|B7ZVX9|B9ZVN0|Q9NR29	Missense_Mutation	SNP	pfam_Pept_M12B_GON-ADAMTSs,pfam_Thrombospondin_1_rpt,pfam_Peptidase_M12B_N,pfam_ADAM_spacer1,pfam_Peptidase_M12B,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Pept_M12B_GON-ADAMTSs,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Peptidase_M12B_ADAM-TS	p.N447K	ENST00000498707.1	37	c.1341	CCDS2903.1	3	.	.	.	.	.	.	.	.	.	.	G	16.00	2.998967	0.54147	.	.	ENSG00000163638	ENST00000295903;ENST00000498707;ENST00000459780	D;D;D	0.86769	-2.17;-2.17;-2.17	5.89	5.01	0.66863	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	0.216401	0.47093	D	0.000244	D	0.82944	0.5147	L	0.39085	1.19	0.37040	D	0.897083	B;B;B;B	0.31949	0.277;0.234;0.348;0.066	B;B;B;B	0.38378	0.201;0.272;0.22;0.099	D	0.83792	0.0231	10	0.46703	T	0.11	.	11.6325	0.51185	0.1321:0.0:0.8679:0.0	.	419;447;447;447	B7ZVX9;Q9P2N4-2;Q9P2N4-1;Q9P2N4	.;.;.;ATS9_HUMAN	K	419;447;447	ENSP00000295903:N419K;ENSP00000418735:N447K;ENSP00000419217:N447K	ENSP00000295903:N419K	N	-	3	2	ADAMTS9	64611855	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.837000	0.39201	2.788000	0.95919	0.585000	0.79938	AAC	ADAMTS9	-	pfam_Peptidase_M12B,pfscan_Peptidase_M12B	ENSG00000163638		0.423	ADAMTS9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS9	HGNC	protein_coding	OTTHUMT00000351891.1	-	0.00	54	0	G			64636815	-1	tier1	-	no_errors	ENST00000498707	ensembl	human	known	74_37	missense	50.00	16	16	SNP	1.000	T
ADARB2	105	genome.wustl.edu	37	10	1229040	1229040	+	3'UTR	SNP	T	T	C			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr10:1229040T>C	ENST00000381312.1	-	0	2638				ADARB2_ENST00000381310.3_3'UTR	NM_018702.3	NP_061172.1	Q9NS39	RED2_HUMAN	adenosine deaminase, RNA-specific, B2 (non-functional)						mRNA processing (GO:0006397)	nucleus (GO:0005634)	adenosine deaminase activity (GO:0004000)|double-stranded RNA binding (GO:0003725)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|single-stranded RNA binding (GO:0003727)			breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|lung(17)|prostate(2)|skin(1)|urinary_tract(1)	41		all_epithelial(10;0.059)|Colorectal(49;0.0815)		all cancers(11;0.0224)|GBM - Glioblastoma multiforme(2;0.0414)|Epithelial(11;0.165)		GTAAAACGAATGCAGGGAACC	0.607																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AF034837	CCDS7058.1	10p15.3	2013-05-20	2013-05-20		ENSG00000185736	ENSG00000185736	3.5.-.-		227	protein-coding gene	gene with protein product	"""RED2 homolog (rat)"""	602065	"""adenosine deaminase, RNA-specific, B2 (RED2 homolog rat)"", ""adenosine deaminase, RNA-specific, B2"""			9272162, 10836796	Standard	NM_018702		Approved	RED2, hRED2, ADAR3	uc009xhq.3	Q9NS39	OTTHUMG00000017543	ENST00000381312.1:c.*93A>G	10.37:g.1229040T>C			B2RPJ5|Q5VUT6|Q5VW42	RNA	SNP	-	NULL	ENST00000381312.1	37	NULL	CCDS7058.1	10																																																																																			ADARB2	-	-	ENSG00000185736		0.607	ADARB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADARB2	HGNC	protein_coding	OTTHUMT00000046426.1	-	0.00	36	0	T	NM_018702		1229040	-1	tier1	-	no_errors	ENST00000474762	ensembl	human	known	74_37	rna	28.12	23	9	SNP	0.000	C
ADCK4	79934	genome.wustl.edu	37	19	41206003	41206003	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr19:41206003G>T	ENST00000324464.3	-	12	1413	c.1112C>A	c.(1111-1113)gCc>gAc	p.A371D	ADCK4_ENST00000450541.1_Missense_Mutation_p.A330D|ADCK4_ENST00000243583.6_Missense_Mutation_p.A330D	NM_024876.3	NP_079152.3	Q96D53	ADCK4_HUMAN	aarF domain containing kinase 4	371	Protein kinase.					integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(1)|endometrium(3)|large_intestine(3)|lung(6)|stomach(2)|urinary_tract(1)	17			Lung(22;9.49e-05)|LUSC - Lung squamous cell carcinoma(20;0.000219)			CAGGAAGTTGGCCCAGTTGGG	0.502																																																	0													112.0	93.0	100.0					19																	41206003		2203	4300	6503	SO:0001583	missense	0			AK022291	CCDS12562.1, CCDS46081.1	19q13.2	2008-02-05				ENSG00000123815			19041	protein-coding gene	gene with protein product		615567					Standard	NM_024876		Approved	FLJ12229, COQ8	uc002oor.2	Q96D53		ENST00000324464.3:c.1112C>A	19.37:g.41206003G>T	ENSP00000315118:p.Ala371Asp		Q8TAJ1|Q9HA52	Missense_Mutation	SNP	pfam_UbiB_dom,superfamily_Kinase-like_dom	p.A371D	ENST00000324464.3	37	c.1112	CCDS12562.1	19	.	.	.	.	.	.	.	.	.	.	G	36	5.618120	0.96649	.	.	ENSG00000123815	ENST00000324464;ENST00000450541;ENST00000243583	T;T;T	0.70631	-0.5;-0.5;-0.5	5.88	5.88	0.94601	Protein kinase-like domain (1);	0.107186	0.64402	D	0.000006	D	0.85496	0.5710	M	0.87180	2.865	0.58432	D	0.999997	D;D	0.59357	0.985;0.961	P;P	0.60541	0.811;0.876	D	0.87244	0.2268	10	0.87932	D	0	-16.6763	18.9943	0.92806	0.0:0.0:1.0:0.0	.	371;330	Q96D53;Q96D53-2	ADCK4_HUMAN;.	D	371;330;330	ENSP00000315118:A371D;ENSP00000412839:A330D;ENSP00000243583:A330D	ENSP00000243583:A330D	A	-	2	0	ADCK4	45897843	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	9.631000	0.98424	2.789000	0.95967	0.655000	0.94253	GCC	ADCK4	-	superfamily_Kinase-like_dom	ENSG00000123815		0.502	ADCK4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ADCK4	HGNC	protein_coding	OTTHUMT00000462731.1	-	0.00	34	0	G	NM_024876		41206003	-1	tier1	-	no_errors	ENST00000324464	ensembl	human	known	74_37	missense	18.18	18	4	SNP	1.000	T
ADD2	119	genome.wustl.edu	37	2	70890767	70890767	+	Silent	SNP	C	C	T	rs540699345		TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr2:70890767C>T	ENST00000264436.4	-	16	2415	c.1971G>A	c.(1969-1971)acG>acA	p.T657T	ADD2_ENST00000355733.3_3'UTR|ADD2_ENST00000407644.2_Silent_p.T657T	NM_001617.3	NP_001608.1	P35612	ADDB_HUMAN	adducin 2 (beta)	657					actin cytoskeleton organization (GO:0030036)|actin filament bundle assembly (GO:0051017)|barbed-end actin filament capping (GO:0051016)|hemopoiesis (GO:0030097)|positive regulation of protein binding (GO:0032092)|protein complex assembly (GO:0006461)	cytoplasmic membrane-bounded vesicle (GO:0016023)|F-actin capping protein complex (GO:0008290)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|spectrin binding (GO:0030507)|structural molecule activity (GO:0005198)	p.T657T(1)		autonomic_ganglia(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|large_intestine(11)|lung(13)|ovary(3)|pancreas(1)|skin(2)	36						TTTCCTCTGCCGTCTGCTCCT	0.572													C|||	1	0.000199681	0.0	0.0	5008	,	,		16900	0.0		0.0	False		,,,				2504	0.001																1	Substitution - coding silent(1)	large_intestine(1)											159.0	134.0	143.0					2																	70890767		2203	4300	6503	SO:0001819	synonymous_variant	0			X58199	CCDS1906.1, CCDS1909.1, CCDS46318.1, CCDS54365.1	2p13.3	2008-02-05			ENSG00000075340	ENSG00000075340			244	protein-coding gene	gene with protein product		102681				1840603	Standard	NM_001617		Approved	ADDB	uc021vjc.1	P35612	OTTHUMG00000129710	ENST00000264436.4:c.1971G>A	2.37:g.70890767C>T			A8K4P2|B4DM17|D6W5G7|D6W5G8|Q13482|Q16412|Q59G82|Q5U5P4|Q6P0P2|Q6PGQ4|Q7Z688|Q7Z689|Q7Z690|Q7Z691	Silent	SNP	pfam_Aldolase_II/adducin_N,superfamily_Aldolase_II/adducin_N	p.T657	ENST00000264436.4	37	c.1971	CCDS1906.1	2																																																																																			ADD2	-	NULL	ENSG00000075340		0.572	ADD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ADD2	HGNC	protein_coding	OTTHUMT00000251918.4	-	0.00	56	0	C	NM_001617		70890767	-1	tier1	-	no_errors	ENST00000264436	ensembl	human	known	74_37	silent	23.21	43	13	SNP	0.000	T
ADORA2B	136	genome.wustl.edu	37	17	15878282	15878282	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr17:15878282G>T	ENST00000304222.2	+	2	957	c.625G>T	c.(625-627)Gcc>Tcc	p.A209S	ZSWIM7_ENST00000399280.2_5'Flank	NM_000676.2	NP_000667.1	P29275	AA2BR_HUMAN	adenosine A2b receptor	209					activation of adenylate cyclase activity (GO:0007190)|activation of MAPK activity (GO:0000187)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|cellular defense response (GO:0006968)|cellular response to extracellular stimulus (GO:0031668)|excretion (GO:0007588)|G-protein coupled receptor signaling pathway (GO:0007186)|JNK cascade (GO:0007254)|positive regulation of cGMP biosynthetic process (GO:0030828)|positive regulation of chemokine production (GO:0032722)|positive regulation of chronic inflammatory response to non-antigenic stimulus (GO:0002882)|positive regulation of guanylate cyclase activity (GO:0031284)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of mast cell degranulation (GO:0043306)|positive regulation vascular endothelial growth factor production (GO:0010575)|relaxation of vascular smooth muscle (GO:0060087)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled adenosine receptor activity (GO:0001609)			breast(1)|kidney(1)|large_intestine(1)|lung(4)|ovary(2)	9				UCEC - Uterine corpus endometrioid carcinoma (92;0.0855)	Adenosine(DB00640)|Defibrotide(DB04932)|Enprofylline(DB00824)|Theophylline(DB00277)	CTTCCTGGTGGCCTGCAGGCA	0.527																																																	0													114.0	96.0	102.0					17																	15878282		2203	4300	6503	SO:0001583	missense	0			M97759	CCDS11173.1	17p12	2012-08-08			ENSG00000170425	ENSG00000170425		"""GPCR / Class A : Adenosine receptors"""	264	protein-coding gene	gene with protein product		600446				7558011	Standard	NM_000676		Approved		uc002gpd.1	P29275	OTTHUMG00000059140	ENST00000304222.2:c.625G>T	17.37:g.15878282G>T	ENSP00000304501:p.Ala209Ser			Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Adeno_A2B_rcpt,prints_GPCR_Rhodpsn,prints_Adenosn_rcpt	p.A209S	ENST00000304222.2	37	c.625	CCDS11173.1	17	.	.	.	.	.	.	.	.	.	.	G	27.5	4.832758	0.91036	.	.	ENSG00000170425	ENST00000304222	T	0.38240	1.15	5.59	5.59	0.84812	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.66809	0.2827	M	0.87827	2.91	0.80722	D	1	D	0.67145	0.996	D	0.79108	0.992	T	0.71034	-0.4709	10	0.56958	D	0.05	-10.5007	18.5682	0.91124	0.0:0.0:1.0:0.0	.	209	P29275	AA2BR_HUMAN	S	209	ENSP00000304501:A209S	ENSP00000304501:A209S	A	+	1	0	ADORA2B	15819007	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.869000	0.99810	2.634000	0.89283	0.563000	0.77884	GCC	ADORA2B	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM	ENSG00000170425		0.527	ADORA2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADORA2B	HGNC	protein_coding	OTTHUMT00000131032.1	-	0.00	72	0	G			15878282	+1	tier1	-	no_errors	ENST00000304222	ensembl	human	known	74_37	missense	5.26	71	4	SNP	1.000	T
AKR1A1	10327	genome.wustl.edu	37	1	46035627	46035627	+	Silent	SNP	G	G	A	rs368164790	byFrequency	TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr1:46035627G>A	ENST00000372070.3	+	10	1724	c.977G>A	c.(976-978)tGa>tAa	p.*326*	AKR1A1_ENST00000351829.4_Silent_p.*326*|AKR1A1_ENST00000473038.1_3'UTR	NM_001202413.1|NM_001202414.1|NM_006066.3	NP_001189342.1|NP_001189343.1|NP_006057.1	P14550	AK1A1_HUMAN	aldo-keto reductase family 1, member A1 (aldehyde reductase)	0					aldehyde catabolic process (GO:0046185)|cellular aldehyde metabolic process (GO:0006081)|D-glucuronate catabolic process (GO:0042840)|glucose metabolic process (GO:0006006)|L-ascorbic acid biosynthetic process (GO:0019853)	apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	alditol:NADP+ 1-oxidoreductase activity (GO:0004032)|electron carrier activity (GO:0009055)|L-glucuronate reductase activity (GO:0047939)			lung(3)|prostate(1)|urinary_tract(1)	5	Acute lymphoblastic leukemia(166;0.155)				Doxorubicin(DB00997)	GACCCGTACTGAGACCACAGC	0.512											OREG0013453	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													115.0	98.0	104.0					1																	46035627		2203	4300	6503	SO:0001819	synonymous_variant	0			J04794	CCDS523.1	1p33-p32	2010-04-08			ENSG00000117448	ENSG00000117448	1.1.1.2	"""Aldo-keto reductases"""	380	protein-coding gene	gene with protein product	"""dihydrodiol dehydrogenase 3"""	103830				2498333, 10393438	Standard	NM_001202414		Approved	ALR, DD3	uc001coe.3	P14550	OTTHUMG00000007740	ENST00000372070.3:c.977G>A	1.37:g.46035627G>A		936	A8KAL8|D3DQ04|Q6IAZ4	Silent	SNP	pfam_NADP_OxRdtase_dom,superfamily_NADP_OxRdtase_dom,prints_Aldo/keto_reductase_subgr	p.*326	ENST00000372070.3	37	c.977	CCDS523.1	1																																																																																			AKR1A1	-	NULL	ENSG00000117448		0.512	AKR1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AKR1A1	HGNC	protein_coding	OTTHUMT00000020851.1	-	0.00	49	0	G	NM_006066		46035627	+1	tier1	-	no_errors	ENST00000351829	ensembl	human	known	74_37	silent	26.67	33	12	SNP	1.000	A
ANKRD34C	390616	genome.wustl.edu	37	15	79586906	79586906	+	Missense_Mutation	SNP	C	C	T	rs449340		TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr15:79586906C>T	ENST00000558647.2	+	1	1280	c.1280C>T	c.(1279-1281)cCt>cTt	p.P427L	ANKRD34C_ENST00000421388.2_Missense_Mutation_p.P427L			P0C6C1	AN34C_HUMAN	ankyrin repeat domain 34C	427			P -> H (in dbSNP:rs449340).							endometrium(3)|kidney(1)|skin(1)	5						GACACTGTACCTAGCACATCC	0.527																																																	0													66.0	62.0	63.0					15																	79586906		685	1584	2269	SO:0001583	missense	0				CCDS53965.1	15q25.1	2013-01-10			ENSG00000235711	ENSG00000235711		"""Ankyrin repeat domain containing"""	33888	protein-coding gene	gene with protein product							Standard	NM_001146341		Approved		uc002bet.3	P0C6C1		ENST00000558647.2:c.1280C>T	15.37:g.79586906C>T	ENSP00000454921:p.Pro427Leu		H3BNM1	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.P427L	ENST00000558647.2	37	c.1280	CCDS53965.1	15	.	.	.	.	.	.	.	.	.	.	C	10.13	1.264838	0.23136	.	.	ENSG00000235711	ENST00000421388	T	0.15372	2.43	4.5	4.5	0.54988	.	.	.	.	.	T	0.21962	0.0529	M	0.64404	1.975	0.43793	D	0.996339	B	0.23377	0.084	B	0.24155	0.051	T	0.05582	-1.0876	9	0.87932	D	0	.	14.7231	0.69323	0.0:1.0:0.0:0.0	.	427	P0C6C1	AN34C_HUMAN	L	427	ENSP00000401089:P427L	ENSP00000401089:P427L	P	+	2	0	ANKRD34C	77373961	0.918000	0.31147	0.014000	0.15608	0.002000	0.02628	5.432000	0.66514	2.309000	0.77851	0.655000	0.94253	CCT	ANKRD34C	-	NULL	ENSG00000235711		0.527	ANKRD34C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD34C	HGNC	protein_coding	OTTHUMT00000416713.2	-	0.00	33	0	C	NM_001146341		79586906	+1	tier1	-	no_errors	ENST00000421388	ensembl	human	known	74_37	missense	51.61	15	16	SNP	0.955	T
ANO4	121601	genome.wustl.edu	37	12	101295550	101295550	+	5'UTR	SNP	G	G	A			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr12:101295550G>A	ENST00000392977.3	+	0	197				ANO4_ENST00000392979.3_5'UTR|ANO4_ENST00000299222.9_5'UTR|ANO4_ENST00000538618.1_Missense_Mutation_p.R162K			Q32M45	ANO4_HUMAN	anoctamin 4						chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	intracellular calcium activated chloride channel activity (GO:0005229)			NS(1)|biliary_tract(1)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(33)|ovary(4)|prostate(5)|skin(7)|stomach(2)|urinary_tract(1)	78						CCACCAGGCAGAAGGTCAATA	0.532										HNSCC(74;0.22)																																							0													105.0	102.0	103.0					12																	101295550		2203	4300	6503	SO:0001623	5_prime_UTR_variant	0			AK091540	CCDS31884.1, CCDS66445.1	12q23.3	2014-04-09	2008-08-28	2008-08-28	ENSG00000151572	ENSG00000151572		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	23837	protein-coding gene	gene with protein product		610111	"""transmembrane protein 16D"""	TMEM16D		12739008, 15067359, 24692353	Standard	NM_178826		Approved	FLJ34221, FLJ34272, FLJ35277	uc001thw.2	Q32M45		ENST00000392977.3:c.-14G>A	12.37:g.101295550G>A			Q8NAJ0|Q8NB39|Q8NB53	Missense_Mutation	SNP	NULL	p.R162K	ENST00000392977.3	37	c.485		12	.	.	.	.	.	.	.	.	.	.	G	19.79	3.892998	0.72524	.	.	ENSG00000151572	ENST00000538618	T	0.77229	-1.08	5.64	4.75	0.60458	.	.	.	.	.	D	0.83064	0.5173	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.82596	-0.0379	6	0.40728	T	0.16	.	14.4902	0.67645	0.0706:0.0:0.9294:0.0	.	.	.	.	K	162	ENSP00000443751:R162K	ENSP00000443751:R162K	R	+	2	0	ANO4	99819681	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	4.384000	0.59607	1.390000	0.46547	0.655000	0.94253	AGA	ANO4	-	NULL	ENSG00000151572		0.532	ANO4-002	KNOWN	basic	protein_coding	ANO4	HGNC	protein_coding	OTTHUMT00000409295.1	-	0.00	34	0	G	NM_178826		101295550	+1	tier1	-	no_errors	ENST00000538618	ensembl	human	known	74_37	missense	36.84	11	7	SNP	1.000	A
ANXA1	301	genome.wustl.edu	37	9	75780136	75780136	+	Intron	SNP	A	A	G			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr9:75780136A>G	ENST00000376911.1	+	8	1588				ANXA1_ENST00000257497.6_Intron			P04083	ANXA1_HUMAN	annexin A1						alpha-beta T cell differentiation (GO:0046632)|arachidonic acid secretion (GO:0050482)|cell surface receptor signaling pathway (GO:0007166)|cellular component movement (GO:0006928)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to hydrogen peroxide (GO:0070301)|endocrine pancreas development (GO:0031018)|estrous cycle phase (GO:0060206)|gliogenesis (GO:0042063)|hepatocyte differentiation (GO:0070365)|inflammatory response (GO:0006954)|insulin secretion (GO:0030073)|keratinocyte differentiation (GO:0030216)|negative regulation of acute inflammatory response (GO:0002674)|negative regulation of apoptotic process (GO:0043066)|negative regulation of catalytic activity (GO:0043086)|negative regulation of interleukin-8 secretion (GO:2000483)|neutrophil clearance (GO:0097350)|neutrophil homeostasis (GO:0001780)|peptide cross-linking (GO:0018149)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of neutrophil apoptotic process (GO:0033031)|positive regulation of prostaglandin biosynthetic process (GO:0031394)|positive regulation of vesicle fusion (GO:0031340)|regulation of cell proliferation (GO:0042127)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to interleukin-1 (GO:0070555)|response to peptide hormone (GO:0043434)|response to X-ray (GO:0010165)|signal transduction (GO:0007165)	cell surface (GO:0009986)|cilium (GO:0005929)|cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|endosome (GO:0005768)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|mitochondrial membrane (GO:0031966)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|vesicle (GO:0031982)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|calcium-dependent protein binding (GO:0048306)|phospholipase A2 inhibitor activity (GO:0019834)|phospholipid binding (GO:0005543)|protein binding, bridging (GO:0030674)|receptor binding (GO:0005102)|structural molecule activity (GO:0005198)			breast(1)|central_nervous_system(1)|large_intestine(1)|lung(5)	8		all_epithelial(88;2.54e-11)		OV - Ovarian serous cystadenocarcinoma(323;2.82e-06)|GBM - Glioblastoma multiforme(74;0.0325)	Amcinonide(DB00288)|Dexamethasone(DB01234)|Hydrocortisone(DB00741)	GTAACAATAAATTTCTTTTTC	0.363																																																	0													98.0	96.0	96.0					9																	75780136		2203	4300	6503	SO:0001627	intron_variant	0			X05908	CCDS6645.1	9q21.13	2013-02-25			ENSG00000135046	ENSG00000135046		"""Annexins"", ""Endogenous ligands"""	533	protein-coding gene	gene with protein product		151690		ANX1, LPC1		2936963	Standard	NM_000700		Approved		uc004ajf.1	P04083	OTTHUMG00000020016	ENST00000376911.1:c.706+11A>G	9.37:g.75780136A>G				RNA	SNP	-	NULL	ENST00000376911.1	37	NULL	CCDS6645.1	9																																																																																			ANXA1	-	-	ENSG00000135046		0.363	ANXA1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ANXA1	HGNC	protein_coding	OTTHUMT00000052665.1	-	0.00	31	0	A	NM_000700		75780136	+1	tier1	-	no_errors	ENST00000489109	ensembl	human	known	74_37	rna	51.28	19	20	SNP	0.001	G
AOC3	8639	genome.wustl.edu	37	17	41006530	41006530	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr17:41006530G>C	ENST00000308423.2	+	2	1826	c.1666G>C	c.(1666-1668)Gag>Cag	p.E556Q	AOC3_ENST00000591562.1_Missense_Mutation_p.E13Q	NM_003734.2	NP_003725.1	Q16853	AOC3_HUMAN	amine oxidase, copper containing 3	556					amine metabolic process (GO:0009308)|cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|cell adhesion (GO:0007155)|inflammatory response (GO:0006954)|response to antibiotic (GO:0046677)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	aliphatic-amine oxidase activity (GO:0052595)|aminoacetone:oxygen oxidoreductase(deaminating) activity (GO:0052594)|calcium ion binding (GO:0005509)|cation channel activity (GO:0005261)|copper ion binding (GO:0005507)|phenethylamine:oxygen oxidoreductase (deaminating) activity (GO:0052596)|primary amine oxidase activity (GO:0008131)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|quinone binding (GO:0048038)|tryptamine:oxygen oxidoreductase (deaminating) activity (GO:0052593)			breast(1)|central_nervous_system(4)|endometrium(4)|kidney(1)|large_intestine(8)|lung(14)|ovary(1)|skin(8)	41		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.156)	Hydralazine(DB01275)|Phenelzine(DB00780)	CTGGAGCCCTGAGCACCAGCT	0.652																																					NSCLC(3;192 220 10664 11501 16477)												0													45.0	42.0	43.0					17																	41006530		2203	4300	6503	SO:0001583	missense	0			AF067406	CCDS11444.1, CCDS62198.1, CCDS74071.1	17q21	2013-05-08	2013-05-08			ENSG00000131471	1.4.3.21		550	protein-coding gene	gene with protein product	"""vascular adhesion protein 1"""	603735				9653080, 8972912	Standard	NM_003734		Approved	VAP1, HPAO, VAP-1	uc002ibv.4	Q16853		ENST00000308423.2:c.1666G>C	17.37:g.41006530G>C	ENSP00000312326:p.Glu556Gln		B2RCI5|K7ESB3|L0L8N9|Q45F94	Missense_Mutation	SNP	pfam_Cu_amine_oxidase_C,pfam_Cu_amine_oxidase_N2,pfam_Cu_amine_oxidase_N3,superfamily_Cu_amine_oxidase_C,superfamily_Cu_amine_oxidase_N-reg,prints_Cu_amine_oxidase	p.E556Q	ENST00000308423.2	37	c.1666	CCDS11444.1	17	.	.	.	.	.	.	.	.	.	.	G	16.23	3.064879	0.55432	.	.	ENSG00000131471	ENST00000308423	T	0.03635	3.86	5.32	4.34	0.51931	Copper amine oxidase, C-terminal (3);	0.191023	0.44097	D	0.000500	T	0.09512	0.0234	M	0.85945	2.785	0.47374	D	0.999401	B	0.23806	0.091	B	0.23419	0.046	T	0.02533	-1.1145	10	0.42905	T	0.14	.	15.7111	0.77629	0.0:0.1455:0.8545:0.0	.	556	Q16853	AOC3_HUMAN	Q	556	ENSP00000312326:E556Q	ENSP00000312326:E556Q	E	+	1	0	AOC3	38260056	0.814000	0.29104	0.998000	0.56505	0.989000	0.77384	0.882000	0.28186	1.230000	0.43646	0.563000	0.77884	GAG	AOC3	-	pfam_Cu_amine_oxidase_C,superfamily_Cu_amine_oxidase_C	ENSG00000131471		0.652	AOC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AOC3	HGNC	protein_coding	OTTHUMT00000452444.1	-	0.00	92	0	G	NM_003734		41006530	+1	tier1	-	no_errors	ENST00000308423	ensembl	human	known	74_37	missense	38.81	41	26	SNP	0.983	C
APOE	348	genome.wustl.edu	37	19	45411884	45411884	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr19:45411884C>A	ENST00000252486.4	+	4	442	c.331C>A	c.(331-333)Ctg>Atg	p.L111M		NM_000041.2	NP_000032.1	P02649	APOE_HUMAN	apolipoprotein E	111	8 X 22 AA approximate tandem repeats.				aging (GO:0007568)|alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor clustering (GO:0097113)|artery morphogenesis (GO:0048844)|cell death (GO:0008219)|cellular calcium ion homeostasis (GO:0006874)|cellular response to cholesterol (GO:0071397)|cellular response to growth factor stimulus (GO:0071363)|cellular response to interleukin-1 (GO:0071347)|cGMP-mediated signaling (GO:0019934)|cholesterol catabolic process (GO:0006707)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|chylomicron remnant clearance (GO:0034382)|cytoskeleton organization (GO:0007010)|fatty acid homeostasis (GO:0055089)|G-protein coupled receptor signaling pathway (GO:0007186)|high-density lipoprotein particle assembly (GO:0034380)|high-density lipoprotein particle clearance (GO:0034384)|high-density lipoprotein particle remodeling (GO:0034375)|intracellular transport (GO:0046907)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|long-chain fatty acid transport (GO:0015909)|low-density lipoprotein particle remodeling (GO:0034374)|maintenance of location in cell (GO:0051651)|N-methyl-D-aspartate receptor clustering (GO:0097114)|negative regulation of beta-amyloid formation (GO:1902430)|negative regulation of blood coagulation (GO:0030195)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|negative regulation of cholesterol biosynthetic process (GO:0045541)|negative regulation of cholesterol efflux (GO:0090370)|negative regulation of dendritic spine development (GO:0061000)|negative regulation of dendritic spine maintenance (GO:1902951)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of inflammatory response (GO:0050728)|negative regulation of lipid biosynthetic process (GO:0051055)|negative regulation of lipid transport across blood brain barrier (GO:1903001)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of neuron death (GO:1901215)|negative regulation of phospholipid efflux (GO:1902999)|negative regulation of platelet activation (GO:0010544)|negative regulation of postsynaptic membrane organization (GO:1901627)|negative regulation of presynaptic membrane organization (GO:1901630)|nitric oxide mediated signal transduction (GO:0007263)|oligodendrocyte differentiation (GO:0048709)|peripheral nervous system axon regeneration (GO:0014012)|phospholipid efflux (GO:0033700)|phototransduction, visible light (GO:0007603)|positive regulation of axon extension (GO:0045773)|positive regulation of beta-amyloid formation (GO:1902004)|positive regulation of cGMP biosynthetic process (GO:0030828)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of cholesterol esterification (GO:0010873)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of dendritic spine maintenance (GO:1902952)|positive regulation of lipid biosynthetic process (GO:0046889)|positive regulation of lipid transport across blood brain barrier (GO:1903002)|positive regulation of low-density lipoprotein particle receptor catabolic process (GO:0032805)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|positive regulation of neurofibrillary tangle assembly (GO:1902998)|positive regulation of neuron death (GO:1901216)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of phospholipid efflux (GO:1902995)|positive regulation of postsynaptic membrane organization (GO:1901628)|positive regulation of presynaptic membrane organization (GO:1901631)|protein import (GO:0017038)|receptor-mediated endocytosis (GO:0006898)|regulation of axon extension (GO:0030516)|regulation of beta-amyloid clearance (GO:1900221)|regulation of Cdc42 protein signal transduction (GO:0032489)|regulation of neuron death (GO:1901214)|regulation of neuronal synaptic plasticity (GO:0048168)|regulation of tau-protein kinase activity (GO:1902947)|response to dietary excess (GO:0002021)|response to ethanol (GO:0045471)|response to insulin (GO:0032868)|response to reactive oxygen species (GO:0000302)|response to retinoic acid (GO:0032526)|retinoid metabolic process (GO:0001523)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)|synaptic transmission, cholinergic (GO:0007271)|triglyceride metabolic process (GO:0006641)|vasodilation (GO:0042311)|very-low-density lipoprotein particle clearance (GO:0034447)|very-low-density lipoprotein particle remodeling (GO:0034372)	blood microparticle (GO:0072562)|chylomicron (GO:0042627)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|high-density lipoprotein particle (GO:0034364)|intermediate-density lipoprotein particle (GO:0034363)|late endosome (GO:0005770)|low-density lipoprotein particle (GO:0034362)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)|vesicle (GO:0031982)	antioxidant activity (GO:0016209)|beta-amyloid binding (GO:0001540)|cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|hydroxyapatite binding (GO:0046848)|identical protein binding (GO:0042802)|lipid binding (GO:0008289)|lipid transporter activity (GO:0005319)|lipoprotein particle binding (GO:0071813)|low-density lipoprotein particle receptor binding (GO:0050750)|metal chelating activity (GO:0046911)|phosphatidylcholine-sterol O-acyltransferase activator activity (GO:0060228)|phospholipid binding (GO:0005543)|protein homodimerization activity (GO:0042803)|tau protein binding (GO:0048156)|very-low-density lipoprotein particle receptor binding (GO:0070326)			large_intestine(1)|lung(2)|prostate(1)	4	Lung NSC(12;0.0018)|all_lung(12;0.00481)	Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00327)|Epithelial(262;0.174)	Human Serum Albumin(DB00062)|Serum albumin iodonated(DB00064)	GCGGGCACGGCTGTCCAAGGA	0.682																																																	0													22.0	19.0	20.0					19																	45411884		2195	4299	6494	SO:0001583	missense	0			K00396	CCDS12647.1	19q13.31	2013-01-24			ENSG00000130203	ENSG00000130203		"""Apolipoproteins"""	613	protein-coding gene	gene with protein product		107741	"""Alzheimer disease 2 (APOE*E4-associated, late onset)"""	AD2		10662539	Standard	NM_000041		Approved		uc002pab.3	P02649	OTTHUMG00000128901	ENST00000252486.4:c.331C>A	19.37:g.45411884C>A	ENSP00000252486:p.Leu111Met		B2RC15|C0JYY5|Q9P2S4	Missense_Mutation	SNP	pfam_ApoA1_A4_E	p.L111M	ENST00000252486.4	37	c.331	CCDS12647.1	19	.	.	.	.	.	.	.	.	.	.	C	15.83	2.950012	0.53186	.	.	ENSG00000130203	ENST00000252486;ENST00000446996;ENST00000434152;ENST00000425718	D;D;D	0.83591	-1.74;-1.74;-1.74	5.36	-3.62	0.04543	Apolipoprotein/apolipophorin (1);	0.877167	0.09610	N	0.779039	D	0.83348	0.5235	M	0.71581	2.175	0.09310	N	1	P	0.40083	0.702	P	0.45167	0.472	T	0.78254	-0.2275	10	0.72032	D	0.01	-13.0477	12.715	0.57109	0.2042:0.1776:0.6182:0.0	.	111	P02649	APOE_HUMAN	M	111;111;156;111	ENSP00000252486:L111M;ENSP00000413135:L111M;ENSP00000410423:L111M	ENSP00000252486:L111M	L	+	1	2	APOE	50103724	0.033000	0.19621	0.004000	0.12327	0.854000	0.48673	-0.368000	0.07543	-0.316000	0.08690	0.561000	0.74099	CTG	APOE	-	pfam_ApoA1_A4_E	ENSG00000130203		0.682	APOE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APOE	HGNC	protein_coding	OTTHUMT00000250865.2	-	0.00	43	0	C	NM_000041		45411884	+1	tier1	-	no_errors	ENST00000252486	ensembl	human	known	74_37	missense	15.38	33	6	SNP	0.010	A
ARHGAP26	23092	genome.wustl.edu	37	5	142513550	142513550	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr5:142513550G>T	ENST00000274498.4	+	19	2095	c.1717G>T	c.(1717-1719)Gat>Tat	p.D573Y	ARHGAP26_ENST00000378004.3_Missense_Mutation_p.D573Y	NM_015071.4	NP_055886.1	Q9UNA1	RHG26_HUMAN	Rho GTPase activating protein 26	573					actin cytoskeleton organization (GO:0030036)|filopodium assembly (GO:0046847)|nervous system development (GO:0007399)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell junction (GO:0030054)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)	phospholipid binding (GO:0005543)|Rho GTPase activator activity (GO:0005100)			autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(6)|lung(7)|ovary(1)	25		all_hematologic(541;0.0416)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CACCGTGCCCGATATGCCTCT	0.537																																																	0													190.0	181.0	184.0					5																	142513550		2203	4300	6503	SO:0001583	missense	0			AB014521	CCDS4277.1, CCDS47297.1	5q31	2011-06-29			ENSG00000145819	ENSG00000145819		"""Rho GTPase activating proteins"""	17073	protein-coding gene	gene with protein product	"""GTPase regulator associated with the focal adhesion kinase pp125"""	605370				9858476, 8649427	Standard	NM_001135608		Approved	GRAF, KIAA0621, OPHN1L, OPHN1L1	uc011dbj.2	Q9UNA1	OTTHUMG00000059705	ENST00000274498.4:c.1717G>T	5.37:g.142513550G>T	ENSP00000274498:p.Asp573Tyr		O75117|Q5D035|Q9BYS6|Q9BYS7|Q9UJ00	Missense_Mutation	SNP	pfam_RhoGAP_dom,pfam_SH3_domain,pfam_SH3_2,pfam_IRSp53/MIM_homology_IMD,superfamily_Rho_GTPase_activation_prot,superfamily_SH3_domain,smart_Pleckstrin_homology,smart_RhoGAP_dom,smart_SH3_domain,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_RhoGAP_dom	p.D573Y	ENST00000274498.4	37	c.1717	CCDS4277.1	5	.	.	.	.	.	.	.	.	.	.	G	21.5	4.165528	0.78339	.	.	ENSG00000145819	ENST00000274498;ENST00000378004;ENST00000418668	T;T	0.09817	2.94;2.99	5.95	5.95	0.96441	Rho GTPase-activating protein domain (1);Rho GTPase activation protein (1);	0.213333	0.48767	D	0.000170	T	0.25044	0.0608	L	0.41492	1.28	0.53005	D	0.99996	D;D;P	0.61697	0.989;0.99;0.936	P;P;P	0.61201	0.869;0.885;0.651	T	0.00051	-1.2192	10	0.87932	D	0	.	19.1568	0.93514	0.0:0.0:1.0:0.0	.	573;146;573	Q9UNA1;B3KT96;Q9UNA1-2	RHG26_HUMAN;.;.	Y	573;573;146	ENSP00000274498:D573Y;ENSP00000367243:D573Y	ENSP00000274498:D573Y	D	+	1	0	ARHGAP26	142493743	1.000000	0.71417	0.942000	0.38095	0.876000	0.50452	5.115000	0.64655	2.825000	0.97269	0.655000	0.94253	GAT	ARHGAP26	-	superfamily_Rho_GTPase_activation_prot	ENSG00000145819		0.537	ARHGAP26-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ARHGAP26	HGNC	protein_coding	OTTHUMT00000132744.3	-	0.00	90	0	G	NM_015071		142513550	+1	tier1	-	no_errors	ENST00000274498	ensembl	human	known	74_37	missense	52.86	33	37	SNP	0.990	T
ASTN2	23245	genome.wustl.edu	37	9	119976989	119976991	+	In_Frame_Del	DEL	CAG	CAG	-			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	CAG	CAG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr9:119976989_119976991delCAG	ENST00000313400.4	-	3	761_763	c.661_663delCTG	c.(661-663)ctgdel	p.L221del	ASTN2_ENST00000361477.3_5'UTR|ASTN2_ENST00000373996.3_In_Frame_Del_p.L221del|ASTN2_ENST00000361209.2_In_Frame_Del_p.L221del			O75129	ASTN2_HUMAN	astrotactin 2	221					negative regulation of protein localization to cell surface (GO:2000009)	cell pole (GO:0060187)|endosome (GO:0005768)|integral component of membrane (GO:0016021)				breast(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(21)|lung(45)|ovary(4)|pancreas(2)|prostate(2)|skin(9)|stomach(1)|urinary_tract(1)	102						CGGTGAACACCAGCAGCAGCAGC	0.601																																																	0																																										SO:0001651	inframe_deletion	0			AF116574	CCDS6814.1, CCDS6815.1, CCDS48009.1, CCDS48009.2, CCDS55334.1	9q33	2008-02-05			ENSG00000148219	ENSG00000148219			17021	protein-coding gene	gene with protein product		612856				9734811	Standard	NM_014010		Approved	KIAA0634	uc004bjt.2	O75129	OTTHUMG00000021013	ENST00000313400.4:c.661_663delCTG	9.37:g.119976998_119977000delCAG	ENSP00000314038:p.Leu221del		A2A2T7|A2A2T9|Q52LQ2|Q5JVX8|Q5JVX9|Q5JVY1|Q5VXG8|Q5VZX6|Q8N6P8|Q8WV47|Q96FL4|Q9UHW6	In_Frame_Del	DEL	pfam_MACPF,superfamily_Fibronectin_type3,smart_MACPF	p.L221in_frame_del	ENST00000313400.4	37	c.663_661		9																																																																																			ASTN2	-	NULL	ENSG00000148219		0.601	ASTN2-201	KNOWN	basic	protein_coding	ASTN2	HGNC	protein_coding			0.00	39	0	CAG	NM_014010		119976991	-1	tier1		no_errors	ENST00000313400	ensembl	human	known	74_37	in_frame_del	13.33	13	2	DEL	0.994:1.000:1.000	-
ATN1	1822	genome.wustl.edu	37	12	7046294	7046294	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr12:7046294G>C	ENST00000356654.4	+	5	2101	c.1864G>C	c.(1864-1866)Gct>Cct	p.A622P	ATN1_ENST00000396684.2_Missense_Mutation_p.A622P	NM_001007026.1	NP_001007027.1	P54259	ATN1_HUMAN	atrophin 1	622					cell migration (GO:0016477)|central nervous system development (GO:0007417)|maintenance of cell polarity (GO:0030011)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron apoptotic process (GO:0051402)|toxin metabolic process (GO:0009404)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	protein domain specific binding (GO:0019904)|transcription corepressor activity (GO:0003714)			breast(5)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(15)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	40						TGCCACCGTGGCTTCCTCGCC	0.677																																																	0													54.0	60.0	58.0					12																	7046294		2203	4300	6503	SO:0001583	missense	0			U23851	CCDS31734.1	12p	2007-08-01	2005-03-15	2005-03-17		ENSG00000111676			3033	protein-coding gene	gene with protein product		607462	"""dentatorubral-pallidoluysian atrophy (atrophin-1)"""	D12S755E, DRPLA		8136826	Standard	NM_001940		Approved	B37	uc001qrw.1	P54259		ENST00000356654.4:c.1864G>C	12.37:g.7046294G>C	ENSP00000349076:p.Ala622Pro		Q99495|Q99621|Q9UEK7	Missense_Mutation	SNP	pfam_Atrophin-like,prints_Atrophin-1	p.A622P	ENST00000356654.4	37	c.1864	CCDS31734.1	12	.	.	.	.	.	.	.	.	.	.	g	11.07	1.529432	0.27387	.	.	ENSG00000111676	ENST00000356654;ENST00000396684;ENST00000544325;ENST00000229279	T;T;T	0.54071	0.59;0.59;0.59	3.6	2.7	0.31948	.	0.000000	0.33772	U	0.004567	T	0.54515	0.1863	L	0.54323	1.7	0.52099	D	0.99994	D	0.58970	0.984	P	0.60012	0.867	T	0.58691	-0.7592	10	0.02654	T	1	.	9.5803	0.39484	0.1:0.0:0.9:0.0	.	622	P54259	ATN1_HUMAN	P	622;622;622;207	ENSP00000349076:A622P;ENSP00000379915:A622P;ENSP00000441744:A622P	ENSP00000229279:A207P	A	+	1	0	ATN1	6916555	1.000000	0.71417	0.999000	0.59377	0.286000	0.27126	1.353000	0.34045	0.865000	0.35603	0.586000	0.80456	GCT	ATN1	-	pfam_Atrophin-like	ENSG00000111676		0.677	ATN1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ATN1	HGNC	protein_coding	OTTHUMT00000401948.2	-	0.00	29	0	G	NM_001940		7046294	+1	tier1	-	no_errors	ENST00000356654	ensembl	human	known	74_37	missense	59.57	19	28	SNP	0.984	C
ATP13A1	57130	genome.wustl.edu	37	19	19766338	19766338	+	Splice_Site	SNP	T	T	C			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr19:19766338T>C	ENST00000357324.6	-	10	1421	c.1395A>G	c.(1393-1395)gaA>gaG	p.E465E	ATP13A1_ENST00000496082.1_5'UTR|ATP13A1_ENST00000291503.5_Splice_Site_p.E347E	NM_020410.2	NP_065143.2	Q9HD20	AT131_HUMAN	ATPase type 13A1	465						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|metal ion binding (GO:0046872)			central_nervous_system(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|liver(2)|lung(7)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	29						GGCGCTTACCTTCAATCCATA	0.612																																					Esophageal Squamous(142;920 1789 9047 14684 24777)												0													80.0	73.0	75.0					19																	19766338		2203	4300	6503	SO:0001630	splice_region_variant	0			AK056420	CCDS32970.2	19p13.11	2010-04-20	2005-01-12	2005-01-12	ENSG00000105726	ENSG00000105726		"""ATPases / P-type"""	24215	protein-coding gene	gene with protein product	"""cation transporting ATPase"""		"""ATPase type 13A"""	ATP13A		11347906	Standard	NM_020410		Approved	KIAA1825, FLJ31858, CGI-152	uc002nnh.4	Q9HD20	OTTHUMG00000153016	ENST00000357324.6:c.1396+1A>G	19.37:g.19766338T>C			B3KPJ2|B3KTA7|Q6NT90|Q6ZMG7|Q9H6C6	Silent	SNP	pfam_ATPase_P-typ_transduc_dom_A,pfam_HAD-like_dom,superfamily_HAD-like_dom,superfamily_ATPase_P-typ_cyto_domN,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Cation_typ_V,tigrfam_Cation_transp_P_typ_ATPase	p.E465	ENST00000357324.6	37	c.1395	CCDS32970.2	19																																																																																			ATP13A1	-	pfam_ATPase_P-typ_transduc_dom_A,tigrfam_ATPase_P-typ_Cation_typ_V,tigrfam_Cation_transp_P_typ_ATPase	ENSG00000105726		0.612	ATP13A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP13A1	HGNC	protein_coding	OTTHUMT00000329005.1	-	0.00	72	0	T	NM_020410	Silent	19766338	-1	tier1	-	no_errors	ENST00000357324	ensembl	human	known	74_37	silent	25.93	39	14	SNP	1.000	C
B3GNT5	84002	genome.wustl.edu	37	3	182987961	182987961	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr3:182987961C>G	ENST00000326505.3	+	2	905	c.375C>G	c.(373-375)atC>atG	p.I125M	B3GNT5_ENST00000465010.1_Missense_Mutation_p.I125M|MCF2L2_ENST00000447025.2_Intron|MCF2L2_ENST00000328913.3_Intron|B3GNT5_ENST00000460419.1_Missense_Mutation_p.I125M|MCF2L2_ENST00000473233.1_Intron	NM_032047.4	NP_114436.1	Q9BYG0	B3GN5_HUMAN	UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 5	125					cellular protein metabolic process (GO:0044267)|central nervous system development (GO:0007417)|glycolipid biosynthetic process (GO:0009247)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein glycosylation (GO:0006486)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)	beta-galactosyl-N-acetylglucosaminylgalactosylglucosyl-ceramide beta-1,3-acetylglucosaminyltransferase activity (GO:0008457)|galactosyltransferase activity (GO:0008378)|lactosylceramide 1,3-N-acetyl-beta-D-glucosaminyltransferase activity (GO:0047256)|lipopolysaccharide N-acetylglucosaminyltransferase activity (GO:0008917)			endometrium(2)|large_intestine(1)|lung(3)|ovary(1)|skin(1)	8	all_cancers(143;8.52e-13)|Ovarian(172;0.0355)		all cancers(12;4.52e-44)|Epithelial(37;8.82e-38)|LUSC - Lung squamous cell carcinoma(7;7.12e-25)|Lung(8;6.39e-23)|OV - Ovarian serous cystadenocarcinoma(80;6.75e-21)			ATGCCAACATCAAAACTCTGT	0.413																																																	0													69.0	71.0	70.0					3																	182987961		2203	4300	6503	SO:0001583	missense	0			AB045278	CCDS3244.1	3q28	2013-02-21			ENSG00000176597	ENSG00000176597	2.4.1.206	"""Beta 3-glycosyltransferases"""	15684	protein-coding gene	gene with protein product	"""lactosylceramide 1,3-N-acetyl-beta-D-glucosaminyltransferase"""	615333				11283017	Standard	XM_005247824		Approved	B3GN-T5, beta3Gn-T5	uc003flk.3	Q9BYG0	OTTHUMG00000158436	ENST00000326505.3:c.375C>G	3.37:g.182987961C>G	ENSP00000316173:p.Ile125Met		D3DNS5|Q59FE3|Q7L9Z5|Q8WWP9	Missense_Mutation	SNP	pfam_Glyco_trans_31,superfamily_Luciferase-like_dom	p.I125M	ENST00000326505.3	37	c.375	CCDS3244.1	3	.	.	.	.	.	.	.	.	.	.	C	16.82	3.228588	0.58777	.	.	ENSG00000176597	ENST00000326505;ENST00000460419;ENST00000465010	T;T;T	0.49720	0.77;0.77;0.77	5.91	2.73	0.32206	.	0.124608	0.53938	D	0.000053	T	0.60702	0.2289	M	0.82517	2.595	0.41042	D	0.985234	D	0.58620	0.983	P	0.60012	0.867	T	0.61402	-0.7070	10	0.62326	D	0.03	.	4.3736	0.11260	0.1544:0.488:0.0:0.3576	.	125	Q9BYG0	B3GN5_HUMAN	M	125	ENSP00000316173:I125M;ENSP00000420778:I125M;ENSP00000417868:I125M	ENSP00000316173:I125M	I	+	3	3	B3GNT5	184470655	0.997000	0.39634	1.000000	0.80357	0.896000	0.52359	0.326000	0.19646	0.840000	0.34995	0.650000	0.86243	ATC	B3GNT5	-	pfam_Glyco_trans_31	ENSG00000176597		0.413	B3GNT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	B3GNT5	HGNC	protein_coding	OTTHUMT00000351009.1	-	0.00	33	0	C	NM_032047		182987961	+1	tier1	-	no_errors	ENST00000326505	ensembl	human	known	74_37	missense	34.88	28	15	SNP	0.995	G
BNC2	54796	genome.wustl.edu	37	9	16552681	16552681	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr9:16552681G>T	ENST00000380672.4	-	5	573	c.516C>A	c.(514-516)agC>agA	p.S172R	BNC2_ENST00000545497.1_Missense_Mutation_p.S77R|BNC2_ENST00000380667.2_Missense_Mutation_p.S105R|BNC2_ENST00000380666.2_Missense_Mutation_p.S172R	NM_017637.5	NP_060107.3			basonuclin 2											NS(2)|breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(16)|liver(1)|lung(22)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	60				GBM - Glioblastoma multiforme(50;9.01e-08)		GCATCAGGCTGCTGATGTCAA	0.562																																																	0													140.0	111.0	121.0					9																	16552681		2203	4300	6503	SO:0001583	missense	0			AK092247	CCDS6482.2	9p22.2	2013-05-20			ENSG00000173068	ENSG00000173068		"""Zinc fingers, C2H2-type"""	30988	protein-coding gene	gene with protein product		608669				14702039	Standard	XM_006716784		Approved	BSN2, FLJ20043	uc003zml.3	Q6ZN30	OTTHUMG00000019593	ENST00000380672.4:c.516C>A	9.37:g.16552681G>T	ENSP00000370047:p.Ser172Arg			Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S172R	ENST00000380672.4	37	c.516	CCDS6482.2	9	.	.	.	.	.	.	.	.	.	.	G	35	5.469563	0.96274	.	.	ENSG00000173068	ENST00000380672;ENST00000418777;ENST00000456672;ENST00000436939;ENST00000380667;ENST00000545497;ENST00000380666;ENST00000540340;ENST00000451290	D;D;D;D;D	0.86366	-2.11;-2.11;-2.11;-2.11;-2.11	5.98	5.98	0.97165	.	0.000000	0.85682	D	0.000000	D	0.92760	0.7698	L	0.60455	1.87	0.80722	D	1	D;D;D;D;D	0.76494	0.999;0.998;0.997;0.995;0.989	D;D;D;D;P	0.79108	0.929;0.992;0.991;0.969;0.857	D	0.92551	0.6050	10	0.87932	D	0	-18.387	20.4366	0.99092	0.0:0.0:1.0:0.0	.	77;209;172;130;172	F5H586;Q06HC4;Q6ZN30-2;Q5H9S4;Q6ZN30	.;.;.;.;BNC2_HUMAN	R	172;129;209;200;105;77;172;172;95	ENSP00000370047:S172R;ENSP00000408370:S129R;ENSP00000370042:S105R;ENSP00000444640:S77R;ENSP00000370041:S172R	ENSP00000370041:S172R	S	-	3	2	BNC2	16542681	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.013000	0.88655	2.837000	0.97791	0.591000	0.81541	AGC	BNC2	-	NULL	ENSG00000173068		0.562	BNC2-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BNC2	HGNC	protein_coding	OTTHUMT00000216901.5	-	0.00	66	0	G	NM_017637		16552681	-1	tier1	-	no_errors	ENST00000380672	ensembl	human	known	74_37	missense	6.56	57	4	SNP	1.000	T
BSG	682	genome.wustl.edu	37	19	577776	577776	+	Missense_Mutation	SNP	G	G	A	rs539913003	byFrequency	TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr19:577776G>A	ENST00000333511.3	+	2	140	c.70G>A	c.(70-72)Ggc>Agc	p.G24S	BSG_ENST00000574970.1_3'UTR|BSG_ENST00000346916.4_Intron|BSG_ENST00000545507.2_Intron|BSG_ENST00000353555.4_Intron	NM_001728.3	NP_001719.2	P35613	BASI_HUMAN	basigin (Ok blood group)	24					blood coagulation (GO:0007596)|cell surface receptor signaling pathway (GO:0007166)|cellular metabolic process (GO:0044237)|decidualization (GO:0046697)|embryo implantation (GO:0007566)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|leukocyte migration (GO:0050900)|odontogenesis of dentin-containing tooth (GO:0042475)|protein targeting to plasma membrane (GO:0072661)|pyruvate metabolic process (GO:0006090)|response to cAMP (GO:0051591)|response to mercury ion (GO:0046689)|response to peptide hormone (GO:0043434)|small molecule metabolic process (GO:0044281)	acrosomal membrane (GO:0002080)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)	mannose binding (GO:0005537)			central_nervous_system(1)|endometrium(3)|lung(1)	5		all_epithelial(18;2.78e-22)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;3.55e-06)|all_lung(49;5.41e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CCCCACAGCCGGCTTCGTCCA	0.706													G|||	3	0.000599042	0.0	0.0	5008	,	,		14875	0.003		0.0	False		,,,				2504	0.0																0													6.0	6.0	6.0					19																	577776		2066	4010	6076	SO:0001583	missense	0			L10240	CCDS12032.1, CCDS12033.1, CCDS12034.1, CCDS58635.1	19p13.3	2014-07-19	2014-01-02		ENSG00000172270	ENSG00000172270		"""CD molecules"", ""Blood group antigens"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1116	protein-coding gene	gene with protein product	"""Ok blood group"""	109480	"""basigin"""	OK		8404035, 7812975	Standard	NM_198591		Approved	EMMPRIN, CD147	uc002loz.4	P35613		ENST00000333511.3:c.70G>A	19.37:g.577776G>A	ENSP00000333769:p.Gly24Ser		A6NJW1|D3YLG5|Q7Z796|Q8IZL7	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.G24S	ENST00000333511.3	37	c.70	CCDS12033.1	19	.	.	.	.	.	.	.	.	.	.	G	23.7	4.452598	0.84209	.	.	ENSG00000172270	ENST00000333511	T	0.59638	0.25	3.15	3.15	0.36227	Immunoglobulin-like fold (1);	0.000000	0.64402	U	0.000001	T	0.62368	0.2422	L	0.39397	1.21	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.57271	-0.7840	10	0.08381	T	0.77	-26.1149	13.1633	0.59557	0.0:0.0:1.0:0.0	.	24	P35613	BASI_HUMAN	S	24	ENSP00000333769:G24S	ENSP00000333769:G24S	G	+	1	0	BSG	528776	1.000000	0.71417	0.487000	0.27428	0.016000	0.09150	6.666000	0.74446	1.438000	0.47492	0.455000	0.32223	GGC	BSG	-	NULL	ENSG00000172270		0.706	BSG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BSG	HGNC	protein_coding	OTTHUMT00000438630.2	-	0.00	16	0	G	NM_001728		577776	+1	tier1	-	no_errors	ENST00000333511	ensembl	human	known	74_37	missense	30.77	9	4	SNP	1.000	A
BRD4	23476	genome.wustl.edu	37	19	15367010	15367010	+	Missense_Mutation	SNP	T	T	C			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr19:15367010T>C	ENST00000263377.2	-	9	1837	c.1616A>G	c.(1615-1617)aAg>aGg	p.K539R	BRD4_ENST00000371835.4_Missense_Mutation_p.K539R|BRD4_ENST00000360016.5_Missense_Mutation_p.K539R|BRD4_ENST00000602230.1_5'UTR	NM_058243.2	NP_490597.1	O60885	BRD4_HUMAN	bromodomain containing 4	539	BID region.|Lys-rich.				cellular response to DNA damage stimulus (GO:0006974)|chromatin remodeling (GO:0006338)|chromosome segregation (GO:0007059)|histone H3-K14 acetylation (GO:0044154)|histone H4-K12 acetylation (GO:0043983)|inner cell mass cell proliferation (GO:0001833)|negative regulation of DNA damage checkpoint (GO:2000002)|positive regulation of DNA binding (GO:0043388)|positive regulation of G2/M transition of mitotic cell cycle (GO:0010971)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|regulation of inflammatory response (GO:0050727)|regulation of phosphorylation of RNA polymerase II C-terminal domain (GO:1901407)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromosome (GO:0005694)|condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|positive transcription elongation factor complex b (GO:0008024)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(7)|ovary(2)|urinary_tract(1)	21			OV - Ovarian serous cystadenocarcinoma(3;3.02e-24)|Epithelial(3;4.71e-20)|all cancers(3;2.26e-18)			gtctttctcctttttctttgg	0.458			T	C15orf55	lethal midline carcinoma of young people																																			Dom	yes		19	19p13.1	23476	bromodomain containing 4		E	0													149.0	140.0	143.0					19																	15367010		2203	4300	6503	SO:0001583	missense	0			Y12059	CCDS12328.1, CCDS46004.1	19p13.12	2013-09-20	2002-01-14		ENSG00000141867	ENSG00000141867			13575	protein-coding gene	gene with protein product	"""chromosome-associated protein"""	608749	"""bromodomain-containing 4"""			10938129	Standard	NM_058243		Approved	HUNKI, MCAP, CAP, HUNK1	uc002nar.3	O60885	OTTHUMG00000183252	ENST00000263377.2:c.1616A>G	19.37:g.15367010T>C	ENSP00000263377:p.Lys539Arg		O60433|Q4G0X8|Q86YS8|Q96PD3	Missense_Mutation	SNP	pfam_Bromodomain,superfamily_Bromodomain,smart_Bromodomain,pfscan_Bromodomain,prints_Bromodomain	p.K539R	ENST00000263377.2	37	c.1616	CCDS12328.1	19	.	.	.	.	.	.	.	.	.	.	T	24.5	4.542994	0.86022	.	.	ENSG00000141867	ENST00000263377;ENST00000371835;ENST00000360016	T;T;T	0.13657	2.57;2.57;2.57	5.55	5.55	0.83447	.	0.176912	0.39020	N	0.001500	T	0.33731	0.0873	L	0.58669	1.825	0.54753	D	0.999985	D;D;D	0.69078	0.997;0.996;0.993	D;D;D	0.75484	0.985;0.986;0.978	T	0.02464	-1.1155	10	0.56958	D	0.05	-21.8564	14.6817	0.69023	0.0:0.0:0.0:1.0	.	539;539;539	Q4G0X8;O60885-2;O60885	.;.;BRD4_HUMAN	R	539	ENSP00000263377:K539R;ENSP00000360901:K539R;ENSP00000353112:K539R	ENSP00000263377:K539R	K	-	2	0	BRD4	15228010	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.040000	0.89188	2.122000	0.65172	0.459000	0.35465	AAG	BRD4	-	NULL	ENSG00000141867		0.458	BRD4-001	KNOWN	overlapping_uORF|basic|appris_candidate_longest|CCDS	protein_coding	BRD4	HGNC	protein_coding	OTTHUMT00000465800.3	-	0.00	78	0	T	NM_058243		15367010	-1	tier1	-	no_errors	ENST00000263377	ensembl	human	known	74_37	missense	37.35	52	31	SNP	1.000	C
BTG3	10950	genome.wustl.edu	37	21	18977308	18977308	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr21:18977308G>T	ENST00000348354.6	-	3	437	c.181C>A	c.(181-183)Cgt>Agt	p.R61S	BTG3_ENST00000339775.6_Missense_Mutation_p.R61S	NM_006806.4	NP_006797.3	Q14201	BTG3_HUMAN	BTG family, member 3	61					negative regulation of cell proliferation (GO:0008285)|negative regulation of mitotic cell cycle (GO:0045930)	cytoplasm (GO:0005737)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(4)	8				Epithelial(23;0.000283)|all cancers(11;0.0012)|Lung(58;0.0191)|OV - Ovarian serous cystadenocarcinoma(11;0.0206)|COAD - Colon adenocarcinoma(22;0.0315)|LUSC - Lung squamous cell carcinoma(23;0.0703)|Colorectal(24;0.0971)		TTATTGACACGAATACATCTA	0.373																																																	0													71.0	68.0	69.0					21																	18977308		2203	4300	6503	SO:0001583	missense	0			D64110	CCDS13569.1, CCDS46636.1	21q21.1	2006-12-16			ENSG00000154640	ENSG00000154640			1132	protein-coding gene	gene with protein product		605674				9632145	Standard	NM_006806		Approved	ANA, tob55	uc002ykk.3	Q14201	OTTHUMG00000074501	ENST00000348354.6:c.181C>A	21.37:g.18977308G>T	ENSP00000284879:p.Arg61Ser		D3DSC4|Q53XV1|Q96ET7	Missense_Mutation	SNP	pfam_Anti_prolifrtn,smart_Anti_prolifrtn,prints_Anti_prolifrtn	p.R61S	ENST00000348354.6	37	c.181	CCDS13569.1	21	.	.	.	.	.	.	.	.	.	.	G	23.5	4.418267	0.83449	.	.	ENSG00000154640	ENST00000339775;ENST00000348354	.	.	.	5.45	5.45	0.79879	Anti-proliferative protein (3);	0.000000	0.85682	D	0.000000	D	0.84835	0.5560	M	0.88979	2.995	0.48975	D	0.999731	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.996	D	0.86542	0.1829	9	0.66056	D	0.02	-16.1342	17.5912	0.87997	0.0:0.0:1.0:0.0	.	61;61	Q14201-2;Q14201	.;BTG3_HUMAN	S	61	.	ENSP00000344609:R61S	R	-	1	0	BTG3	17899179	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	3.293000	0.51779	2.941000	0.99782	0.655000	0.94253	CGT	BTG3	-	pfam_Anti_prolifrtn,smart_Anti_prolifrtn	ENSG00000154640		0.373	BTG3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	BTG3	HGNC	protein_coding	OTTHUMT00000158196.1		0.00	43	0	G	NM_006806		18977308	-1			no_errors	ENST00000339775	ensembl	human	known	74_37	missense	6.45	29	2	SNP	1.000	T
C16orf78	123970	genome.wustl.edu	37	16	49430446	49430446	+	Missense_Mutation	SNP	G	G	C	rs374900464	byFrequency	TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr16:49430446G>C	ENST00000299191.3	+	4	624	c.507G>C	c.(505-507)caG>caC	p.Q169H		NM_144602.2	NP_653203.1	Q8WTQ4	CP078_HUMAN	chromosome 16 open reading frame 78	169						nucleus (GO:0005634)				breast(2)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(11)|upper_aerodigestive_tract(1)	22						TTAACAGCCAGAGGGCAACCT	0.507																																																	0													97.0	87.0	90.0					16																	49430446		2199	4300	6499	SO:0001583	missense	0			BC021181	CCDS10738.1	16q12.1	2008-02-05			ENSG00000166152	ENSG00000166152			28479	protein-coding gene	gene with protein product						12477932	Standard	NM_144602		Approved	MGC33367	uc002efr.3	Q8WTQ4	OTTHUMG00000133149	ENST00000299191.3:c.507G>C	16.37:g.49430446G>C	ENSP00000299191:p.Gln169His			Missense_Mutation	SNP	NULL	p.Q169H	ENST00000299191.3	37	c.507	CCDS10738.1	16	.	.	.	.	.	.	.	.	.	.	G	11.72	1.723473	0.30593	.	.	ENSG00000166152	ENST00000299191	T	0.42900	0.96	5.29	-0.539	0.11865	.	0.307141	0.23353	N	0.049115	T	0.22820	0.0551	N	0.22421	0.69	0.09310	N	1	B	0.22683	0.073	B	0.24155	0.051	T	0.16867	-1.0388	9	.	.	.	-33.0572	6.9834	0.24715	0.1659:0.3976:0.4365:0.0	.	169	Q8WTQ4	CP078_HUMAN	H	169	ENSP00000299191:Q169H	.	Q	+	3	2	C16orf78	47987947	0.096000	0.21769	0.003000	0.11579	0.007000	0.05969	0.479000	0.22228	0.005000	0.14708	0.655000	0.94253	CAG	C16orf78	-	NULL	ENSG00000166152		0.507	C16orf78-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C16orf78	HGNC	protein_coding	OTTHUMT00000256846.1	-	0.00	28	0	G	NM_144602		49430446	+1	tier1	-	no_errors	ENST00000299191	ensembl	human	known	74_37	missense	27.59	21	8	SNP	0.002	C
C1QC	714	genome.wustl.edu	37	1	22974181	22974181	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr1:22974181G>A	ENST00000374639.3	+	3	761	c.643G>A	c.(643-645)Gag>Aag	p.E215K	C1QC_ENST00000374637.1_Missense_Mutation_p.E215K|C1QC_ENST00000374640.4_Missense_Mutation_p.E215K	NM_001114101.1	NP_001107573.1	P02747	C1QC_HUMAN	complement component 1, q subcomponent, C chain	215	C1q. {ECO:0000255|PROSITE- ProRule:PRU00368}.			E -> G (in Ref. 3; BAB71575). {ECO:0000305}.	complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|immune response (GO:0006955)|innate immune response (GO:0045087)|negative regulation of granulocyte differentiation (GO:0030853)|negative regulation of macrophage differentiation (GO:0045650)	blood microparticle (GO:0072562)|collagen trimer (GO:0005581)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				endometrium(2)|kidney(1)|large_intestine(3)|lung(4)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	15		Colorectal(325;3.46e-05)|Lung NSC(340;6.55e-05)|all_lung(284;9.87e-05)|Renal(390;0.000219)|Breast(348;0.00262)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;6.21e-27)|Colorectal(126;1.5e-07)|COAD - Colon adenocarcinoma(152;1.12e-05)|GBM - Glioblastoma multiforme(114;1.61e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000538)|KIRC - Kidney renal clear cell carcinoma(1967;0.00269)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.196)	Abciximab(DB00054)|Adalimumab(DB00051)|Alefacept(DB00092)|Alemtuzumab(DB00087)|Basiliximab(DB00074)|Bevacizumab(DB00112)|Cetuximab(DB00002)|Daclizumab(DB00111)|Efalizumab(DB00095)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Muromonab(DB00075)|Natalizumab(DB00108)|Palivizumab(DB00110)|Rituximab(DB00073)|Tositumomab(DB00081)|Trastuzumab(DB00072)	GCAGGTGGGCGAGGAGGTGTG	0.612																																					Ovarian(26;671 750 8290 29071 43278)												0													114.0	109.0	111.0					1																	22974181		2203	4300	6503	SO:0001583	missense	0			AK057792	CCDS227.1	1p36.11	2014-09-17	2006-02-09	2006-02-09	ENSG00000159189	ENSG00000159189		"""Complement system"""	1245	protein-coding gene	gene with protein product		120575	"""complement component 1, q subcomponent, gamma polypeptide"""	C1QG		1706597	Standard	NM_001114101		Approved		uc001bga.4	P02747	OTTHUMG00000002891	ENST00000374639.3:c.643G>A	1.37:g.22974181G>A	ENSP00000363770:p.Glu215Lys		Q7Z502|Q96DL2|Q96H05	Missense_Mutation	SNP	pfam_C1q,pfam_Collagen,superfamily_Tumour_necrosis_fac-like_dom,smart_C1q,pfscan_C1q,prints_C1q	p.E215K	ENST00000374639.3	37	c.643	CCDS227.1	1	.	.	.	.	.	.	.	.	.	.	G	16.78	3.216532	0.58452	.	.	ENSG00000159189	ENST00000374640;ENST00000374639;ENST00000374637	T;T;T	0.76578	-1.03;-1.03;-1.03	4.79	0.0566	0.14319	Tumour necrosis factor-like (2);Complement C1q protein (4);	0.924886	0.09343	N	0.815226	D	0.82866	0.5130	M	0.77486	2.375	0.23406	N	0.997745	D	0.58268	0.982	P	0.52672	0.706	T	0.73110	-0.4086	10	0.87932	D	0	.	11.2507	0.49024	0.0835:0.6231:0.2934:0.0	.	215	P02747	C1QC_HUMAN	K	215	ENSP00000363771:E215K;ENSP00000363770:E215K;ENSP00000363768:E215K	ENSP00000363768:E215K	E	+	1	0	C1QC	22846768	0.166000	0.22962	0.311000	0.25182	0.482000	0.33219	0.521000	0.22893	0.399000	0.25367	0.561000	0.74099	GAG	C1QC	-	pfam_C1q,superfamily_Tumour_necrosis_fac-like_dom,smart_C1q,pfscan_C1q,prints_C1q	ENSG00000159189		0.612	C1QC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C1QC	HGNC	protein_coding	OTTHUMT00000008083.1	-	0.00	54	0	G	NM_172369		22974181	+1	tier1	-	no_errors	ENST00000374637	ensembl	human	known	74_37	missense	30.77	27	12	SNP	0.489	A
KDF1	126695	genome.wustl.edu	37	1	27278224	27278224	+	Nonsense_Mutation	SNP	G	G	C			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr1:27278224G>C	ENST00000320567.5	-	2	736	c.648C>G	c.(646-648)taC>taG	p.Y216*		NM_152365.2	NP_689578.2	Q8NAX2	KDF1_HUMAN		216					developmental growth (GO:0048589)|establishment of skin barrier (GO:0061436)|keratinocyte development (GO:0003334)|limb epidermis development (GO:0060887)|morphogenesis of embryonic epithelium (GO:0016331)|negative regulation of keratinocyte proliferation (GO:0010839)|negative regulation of stem cell proliferation (GO:2000647)|positive regulation of epidermal cell differentiation (GO:0045606)|regulation of epidermal cell division (GO:0010482)	cell cortex (GO:0005938)|cell junction (GO:0030054)|cell leading edge (GO:0031252)|cytoplasm (GO:0005737)				NS(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	17		all_cancers(24;1.29e-21)|all_epithelial(13;2.35e-19)|Colorectal(325;0.000147)|all_lung(284;0.00122)|Lung NSC(340;0.00128)|Breast(348;0.00131)|Renal(390;0.00211)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0707)|all_neural(195;0.0966)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Epithelial(14;3.37e-51)|OV - Ovarian serous cystadenocarcinoma(117;2.22e-29)|Colorectal(126;5.31e-09)|COAD - Colon adenocarcinoma(152;9.31e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000272)|STAD - Stomach adenocarcinoma(196;0.000588)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|READ - Rectum adenocarcinoma(331;0.0419)		GGAAAGAATAGTACTCCTCGG	0.587																																																	0													40.0	42.0	41.0					1																	27278224		2203	4300	6503	SO:0001587	stop_gained	0																														ENST00000320567.5:c.648C>G	1.37:g.27278224G>C	ENSP00000319179:p.Tyr216*		Q5QP32|Q8N0S7	Nonsense_Mutation	SNP	NULL	p.Y216*	ENST00000320567.5	37	c.648	CCDS293.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.12|17.12	3.309165|3.309165	0.60414|0.60414	.|.	.|.	ENSG00000175707|ENSG00000175707	ENST00000374109|ENST00000320567	.|.	.|.	.|.	4.77|4.77	3.78|3.78	0.43462|0.43462	.|.	.|0.170166	.|0.43110	.|D	.|0.000611	T|.	0.23688|.	0.0573|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.27123|.	-1.0083|.	4|.	0.52906|0.02654	T|T	0.07|1	.|.	9.9699|9.9699	0.41747|0.41747	0.1696:0.0:0.8304:0.0|0.1696:0.0:0.8304:0.0	.|.	.|.	.|.	.|.	S|X	177|216	.|.	ENSP00000363223:T177S|ENSP00000319179:Y216X	T|Y	-|-	2|3	0|2	C1orf172|C1orf172	27150811|27150811	0.995000|0.995000	0.38212|0.38212	1.000000|1.000000	0.80357|0.80357	0.715000|0.715000	0.41141|0.41141	0.267000|0.267000	0.18552|0.18552	2.487000|2.487000	0.83934|0.83934	0.555000|0.555000	0.69702|0.69702	ACT|TAC	C1orf172	-	NULL	ENSG00000175707		0.587	C1orf172-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C1orf172	HGNC	protein_coding	OTTHUMT00000012340.1	-	0.00	51	0	G			27278224	-1	tier1	-	no_errors	ENST00000320567	ensembl	human	known	74_37	nonsense	18.18	27	6	SNP	1.000	C
C3	718	genome.wustl.edu	37	19	6697514	6697514	+	Silent	SNP	C	C	T			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr19:6697514C>T	ENST00000245907.6	-	21	2729	c.2637G>A	c.(2635-2637)aaG>aaA	p.K879K		NM_000064.2	NP_000055.2	P01024	CO3_HUMAN	complement component 3	879					complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|fatty acid metabolic process (GO:0006631)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|positive regulation of activation of membrane attack complex (GO:0001970)|positive regulation of angiogenesis (GO:0045766)|positive regulation of apoptotic cell clearance (GO:2000427)|positive regulation of G-protein coupled receptor protein signaling pathway (GO:0045745)|positive regulation of glucose transport (GO:0010828)|positive regulation of lipid storage (GO:0010884)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of type IIa hypersensitivity (GO:0001798)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of complement activation (GO:0030449)|regulation of immune response (GO:0050776)|regulation of triglyceride biosynthetic process (GO:0010866)|signal transduction (GO:0007165)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	C5L2 anaphylatoxin chemotactic receptor binding (GO:0031715)|endopeptidase inhibitor activity (GO:0004866)|receptor binding (GO:0005102)			breast(5)|endometrium(7)|kidney(6)|large_intestine(18)|liver(1)|lung(18)|ovary(1)|pancreas(1)|prostate(5)|skin(7)|upper_aerodigestive_tract(3)	72				GBM - Glioblastoma multiforme(1328;1.36e-05)|Lung(535;0.00661)	Intravenous Immunoglobulin(DB00028)	GGTGACGCCTCTTGGTGGTGG	0.582																																																	0													107.0	84.0	92.0					19																	6697514		2203	4300	6503	SO:0001819	synonymous_variant	0			J04763	CCDS32883.1	19p13.3-p13.2	2014-09-17			ENSG00000125730	ENSG00000125730	3.4.21.43	"""Complement system"", ""Endogenous ligands"""	1318	protein-coding gene	gene with protein product	"""C3a anaphylatoxin"", ""complement component C3a"", ""complement component C3b"", ""prepro-C3"""	120700					Standard	NM_000064		Approved	CPAMD1, ARMD9, C3a, C3b	uc002mfm.3	P01024	OTTHUMG00000150335	ENST00000245907.6:c.2637G>A	19.37:g.6697514C>T			A7E236	Silent	SNP	pfam_A2M_comp,pfam_A-macroglobulin_rcpt-bd,pfam_Macroglobln_a2,pfam_Netrin_module_non-TIMP,pfam_A2M_N_2,pfam_A2M_N,pfam_MacrogloblnA2_thiol-ester-bond,pfam_Anaphylatoxin/fibulin,superfamily_Terpenoid_cyclase/PrenylTrfase,superfamily_TIMP-like_OB-fold,superfamily_A-macroglobulin_rcpt-bd,superfamily_Anaphylatoxin_comp_syst,smart_Anaphylatoxin/fibulin,smart_Netrin_module_non-TIMP,prints_Anaphylatoxn_comp_syst_dom,pfscan_Anaphylatoxin/fibulin,pfscan_Netrin_domain	p.K879	ENST00000245907.6	37	c.2637	CCDS32883.1	19																																																																																			C3	-	NULL	ENSG00000125730		0.582	C3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C3	HGNC	protein_coding	OTTHUMT00000317636.2	-	0.00	100	0	C	NM_000064		6697514	-1	tier1	-	no_errors	ENST00000245907	ensembl	human	known	74_37	silent	36.52	73	42	SNP	0.969	T
C4orf27	54969	genome.wustl.edu	37	4	170652975	170652975	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr4:170652975C>G	ENST00000393381.2	-	7	864	c.789G>C	c.(787-789)gaG>gaC	p.E263D		NM_017867.2	NP_060337.2	Q9NWY4	CD027_HUMAN	chromosome 4 open reading frame 27	263						nucleus (GO:0005634)				NS(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(1)|pancreas(1)	12		Prostate(90;0.00601)|Renal(120;0.0183)		GBM - Glioblastoma multiforme(119;0.018)|LUSC - Lung squamous cell carcinoma(193;0.116)		CTTTTAGTCTCTCCTCATCAC	0.368																																																	0													90.0	78.0	82.0					4																	170652975		2203	4300	6503	SO:0001583	missense	0			BC010367	CCDS3813.1	4q33	2011-01-25			ENSG00000056050	ENSG00000056050			26051	protein-coding gene	gene with protein product						11230166	Standard	NM_017867		Approved	FLJ20534	uc003isl.4	Q9NWY4	OTTHUMG00000160960	ENST00000393381.2:c.789G>C	4.37:g.170652975C>G	ENSP00000406598:p.Glu263Asp			Missense_Mutation	SNP	pfam_DUF2228_C2H2_APLF-like	p.E263D	ENST00000393381.2	37	c.789	CCDS3813.1	4	.	.	.	.	.	.	.	.	.	.	C	11.54	1.670421	0.29693	.	.	ENSG00000056050	ENST00000393381	T	0.48836	0.8	4.79	0.715	0.18186	.	0.414056	0.30320	N	0.009893	T	0.34424	0.0897	L	0.39898	1.24	0.42909	D	0.994259	B	0.09022	0.002	B	0.13407	0.009	T	0.11641	-1.0579	10	0.21014	T	0.42	-12.8002	11.0783	0.48045	0.0:0.4077:0.5207:0.0716	.	263	Q9NWY4	CD027_HUMAN	D	263	ENSP00000406598:E263D	ENSP00000406598:E263D	E	-	3	2	C4orf27	170889550	0.883000	0.30277	0.934000	0.37439	0.936000	0.57629	0.008000	0.13197	-0.116000	0.11893	0.462000	0.41574	GAG	C4orf27	-	pfam_DUF2228_C2H2_APLF-like	ENSG00000056050		0.368	C4orf27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C4orf27	HGNC	protein_coding	OTTHUMT00000363140.1	-	0.00	59	0	C	NM_017867		170652975	-1	tier1	-	no_errors	ENST00000393381	ensembl	human	known	74_37	missense	29.55	62	26	SNP	1.000	G
LY6G6C	80740	genome.wustl.edu	37	6	31692525	31692525	+	5'Flank	SNP	C	C	T			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr6:31692525C>T	ENST00000375819.2	-	0	0				C6orf25_ENST00000375809.3_Silent_p.L182L|C6orf25_ENST00000480039.1_Intron|C6orf25_ENST00000375805.2_Silent_p.L151L|DDAH2_ENST00000480913.1_5'Flank|C6orf25_ENST00000375810.4_Silent_p.L182L	NM_025261.2	NP_079537.1	O95867	LY66C_HUMAN	lymphocyte antigen 6 complex, locus G6C							anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)				NS(1)|large_intestine(1)|lung(1)|skin(1)	4						TCCTTCAGCTCTGTCCCCCCC	0.562																																																	0													75.0	68.0	70.0					6																	31692525		2203	4300	6503	SO:0001631	upstream_gene_variant	0				CCDS4714.1	6p21	2008-08-29	2002-07-29	2002-08-01	ENSG00000204421	ENSG00000204421			13936	protein-coding gene	gene with protein product		610435	"""chromosome 6 open reading frame 24"""	C6orf24		10384126, 12079290	Standard	NM_025261		Approved	G6c, NG24	uc003nwh.3	O95867	OTTHUMG00000031251		6.37:g.31692525C>T	Exception_encountered		Q5SRS8|Q8IY94	Silent	SNP	NULL	p.L182	ENST00000375819.2	37	c.544	CCDS4714.1	6																																																																																			C6orf25	-	NULL	ENSG00000204420		0.562	LY6G6C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C6orf25	HGNC	protein_coding	OTTHUMT00000076530.2	-	0.00	30	0	C			31692525	+1	tier1	-	no_errors	ENST00000375809	ensembl	human	known	74_37	silent	33.33	18	9	SNP	1.000	T
C8G	733	genome.wustl.edu	37	9	139841200	139841200	+	Intron	SNP	G	G	C			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr9:139841200G>C	ENST00000224181.3	+	7	655				C8G_ENST00000465773.1_3'UTR|FBXW5_ENST00000325285.3_5'Flank|FBXW5_ENST00000483559.1_5'Flank	NM_000606.2	NP_000597.2	P07360	CO8G_HUMAN	complement component 8, gamma polypeptide						complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane attack complex (GO:0005579)	retinol binding (GO:0019841)			NS(1)|prostate(1)|skin(1)	3	all_cancers(76;0.11)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.19)	OV - Ovarian serous cystadenocarcinoma(145;7.88e-06)|Epithelial(140;0.000107)		GCCACCGGCTGAGTCTCGTCT	0.667																																																	0													33.0	35.0	34.0					9																	139841200		2201	4297	6498	SO:0001627	intron_variant	0			X06465	CCDS7017.1	9q	2011-11-15			ENSG00000176919	ENSG00000176919		"""Complement system"", ""Lipocalins"""	1354	protein-coding gene	gene with protein product		120930					Standard	NM_000606		Approved		uc004cka.2	P07360	OTTHUMG00000020955	ENST00000224181.3:c.596-20G>C	9.37:g.139841200G>C			Q14CT8|Q14CU0|Q5SQ07	RNA	SNP	-	NULL	ENST00000224181.3	37	NULL	CCDS7017.1	9																																																																																			C8G	-	-	ENSG00000176919		0.667	C8G-004	KNOWN	basic|appris_principal|CCDS	protein_coding	C8G	HGNC	protein_coding	OTTHUMT00000055178.1	-	0.00	88	0	G			139841200	+1	tier1	-	no_errors	ENST00000465773	ensembl	human	known	74_37	rna	34.85	43	23	SNP	0.281	C
CACNA1B	774	genome.wustl.edu	37	9	141016131	141016131	+	Nonsense_Mutation	SNP	G	G	T	rs202111201		TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr9:141016131G>T	ENST00000371372.1	+	47	6845	c.6700G>T	c.(6700-6702)Gaa>Taa	p.E2234*	CACNA1B_ENST00000371363.1_Nonsense_Mutation_p.E2232*|CACNA1B_ENST00000371355.4_Nonsense_Mutation_p.E2235*|CACNA1B_ENST00000371357.1_Nonsense_Mutation_p.E2233*|CACNA1B_ENST00000277549.5_Nonsense_Mutation_p.E1428*|CACNA1B_ENST00000277551.2_Silent_p.P2171P	NM_000718.3|NM_001243812.1	NP_000709.1|NP_001230741.1	Q00975	CAC1B_HUMAN	calcium channel, voltage-dependent, N type, alpha 1B subunit	2234					calcium ion import (GO:0070509)|locomotory behavior (GO:0007626)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|neurotransmitter secretion (GO:0007269)|regulation of blood pressure (GO:0008217)|regulation of calcium ion transport (GO:0051924)|regulation of heart contraction (GO:0008016)|response to pain (GO:0048265)|synaptic transmission (GO:0007268)|transport (GO:0006810)	dendrite (GO:0030425)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|protein C-terminus binding (GO:0008022)|voltage-gated calcium channel activity (GO:0005245)			NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(17)|lung(31)|ovary(1)|prostate(1)|skin(2)|stomach(2)|urinary_tract(2)	80	all_cancers(76;0.166)			OV - Ovarian serous cystadenocarcinoma(145;1.16e-05)|Epithelial(140;0.000476)	Amlodipine(DB00381)|Gabapentin(DB00996)|Levetiracetam(DB01202)|Spironolactone(DB00421)|Verapamil(DB00661)	TGGGCTTTCCGAACACAACGC	0.652																																																	0													35.0	42.0	40.0					9																	141016131		2052	4186	6238	SO:0001587	stop_gained	0			AB209467	CCDS59522.1, CCDS59523.1	9q34	2013-01-10	2007-02-16		ENSG00000148408	ENSG00000148408		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1389	protein-coding gene	gene with protein product		601012		CACNL1A5		8825650, 16382099	Standard	NM_000718		Approved	Cav2.2, CACNN	uc004cog.3	Q00975	OTTHUMG00000021002	ENST00000371372.1:c.6700G>T	9.37:g.141016131G>T	ENSP00000360423:p.Glu2234*		B1AQK5	Nonsense_Mutation	SNP	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,pfscan_EF_hand_dom,prints_VDCCAlpha1,prints_VDCC_N_a1su,prints_PKD_2	p.E2235*	ENST00000371372.1	37	c.6703	CCDS59522.1	9	.	.	.	.	.	.	.	.	.	.	G	56	27.069305	0.99970	.	.	ENSG00000148408	ENST00000371372;ENST00000277549;ENST00000371363;ENST00000371357;ENST00000371355	.	.	.	5.11	5.11	0.69529	.	1.074110	0.07212	N	0.859423	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.36615	T	0.2	.	18.5267	0.90975	0.0:0.0:1.0:0.0	.	.	.	.	X	2234;1428;2232;2233;2235	.	ENSP00000277549:E1428X	E	+	1	0	CACNA1B	140135952	1.000000	0.71417	0.958000	0.39756	0.556000	0.35491	7.270000	0.78493	2.381000	0.81170	0.555000	0.69702	GAA	CACNA1B	-	NULL	ENSG00000148408		0.652	CACNA1B-001	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	CACNA1B	HGNC	protein_coding	OTTHUMT00000055380.1	-	0.00	51	0	G	NM_000718		141016131	+1	tier1	-	no_errors	ENST00000371355	ensembl	human	known	74_37	nonsense	42.86	16	12	SNP	0.998	T
CACNA1H	8912	genome.wustl.edu	37	16	1261716	1261716	+	Splice_Site	SNP	G	G	A			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr16:1261716G>A	ENST00000348261.5	+	24	4725	c.4477G>A	c.(4477-4479)Gcc>Acc	p.A1493T	CACNA1H_ENST00000358590.4_Splice_Site_p.A1493T|CACNA1H_ENST00000565831.1_Splice_Site_p.A1493T	NM_021098.2	NP_066921.2	O95180	CAC1H_HUMAN	calcium channel, voltage-dependent, T type, alpha 1H subunit	1493					aldosterone biosynthetic process (GO:0032342)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|cellular response to hormone stimulus (GO:0032870)|cellular response to potassium ion (GO:0035865)|cortisol biosynthetic process (GO:0034651)|membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|muscle organ development (GO:0007517)|myoblast fusion (GO:0007520)|positive regulation of acrosome reaction (GO:2000344)|regulation of heart contraction (GO:0008016)|regulation of membrane potential (GO:0042391)|transport (GO:0006810)	caveola (GO:0005901)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|voltage-gated calcium channel complex (GO:0005891)	low voltage-gated calcium channel activity (GO:0008332)|metal ion binding (GO:0046872)|scaffold protein binding (GO:0097110)			breast(4)|endometrium(5)|kidney(2)|lung(23)	34		Hepatocellular(780;0.00369)			Amiodarone(DB01118)|Bepridil(DB01244)|Cinnarizine(DB00568)|Felodipine(DB01023)|Flunarizine(DB04841)|Isradipine(DB00270)|Nifedipine(DB01115)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Zonisamide(DB00909)	TGGCCCTCAGGCCCTGATGTC	0.672																																																	0													52.0	55.0	54.0					16																	1261716		2056	4197	6253	SO:0001630	splice_region_variant	0			AL031703	CCDS45375.1, CCDS45376.1	16p13.3	2012-03-07	2007-02-16					"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1395	protein-coding gene	gene with protein product		607904				9670923, 16382099	Standard	NM_021098		Approved	Cav3.2	uc002cks.3	O95180		ENST00000348261.5:c.4477-1G>A	16.37:g.1261716G>A			B5ME00|F8WFD1|O95802|Q8WWI6|Q96QI6|Q96RZ9|Q9NYY4|Q9NYY5	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_PKD1_2_channel,prints_VDCC_T_a1su,prints_PKD_2	p.A1493T	ENST00000348261.5	37	c.4477	CCDS45375.1	16	.	.	.	.	.	.	.	.	.	.	G	18.18	3.567494	0.65651	.	.	ENSG00000196557	ENST00000348261;ENST00000358590	D;D	0.98876	-5.2;-5.2	4.49	3.54	0.40534	Ion transport (1);	0.056574	0.64402	N	0.000001	D	0.99127	0.9699	M	0.90814	3.15	0.51012	D	0.999908	D;D;D;D;D	0.89917	0.957;1.0;1.0;0.997;0.992	P;D;D;D;D	0.85130	0.71;0.997;0.997;0.984;0.968	D	0.99433	1.0936	9	.	.	.	.	11.8646	0.52486	0.0859:0.0:0.914:0.0	.	234;234;234;1493;1493	A2SX38;A2SX35;A2SX37;O95180-2;O95180	.;.;.;.;CAC1H_HUMAN	T	1493	ENSP00000334198:A1493T;ENSP00000351401:A1493T	.	A	+	1	0	CACNA1H	1201717	1.000000	0.71417	1.000000	0.80357	0.146000	0.21551	9.341000	0.97041	1.245000	0.43885	-0.339000	0.08088	GCC	CACNA1H	-	pfam_Ion_trans_dom	ENSG00000196557		0.672	CACNA1H-001	KNOWN	basic|CCDS	protein_coding	CACNA1H	HGNC	protein_coding	OTTHUMT00000421601.1	-	0.00	35	0	G	NM_001005407	Missense_Mutation	1261716	+1	tier1	-	no_errors	ENST00000348261	ensembl	human	known	74_37	missense	12.00	44	6	SNP	1.000	A
C19orf68	374920	genome.wustl.edu	37	19	48685630	48685631	+	Intron	INS	-	-	A	rs540757523|rs11373236|rs56182393	byFrequency	TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr19:48685630_48685631insA	ENST00000328759.7	+	3	307				ZNF114_ENST00000597695.1_Intron|CARD8_ENST00000600800.1_5'UTR			Q86XI8	CS068_HUMAN	chromosome 19 open reading frame 68						hematopoietic progenitor cell differentiation (GO:0002244)|ubiquitin-dependent protein catabolic process (GO:0006511)	nucleus (GO:0005634)											ATTCTTAGTTTAAAAAAAAAAA	0.51													|||unknown(HR)	1843	0.368011	0.2572	0.3386	5008	,	,		14404	0.5169		0.3976	False		,,,				2504	0.3548																0																																										SO:0001627	intron_variant	0			BC043386	CCDS74411.1	19q13.32	2008-08-06			ENSG00000185453	ENSG00000185453			34495	protein-coding gene	gene with protein product						12477932	Standard	NM_199341		Approved	LOC374920	uc002pic.3	Q86XI8		ENST00000328759.7:c.276-81->A	19.37:g.48685641_48685641dupA				RNA	INS	-	NULL	ENST00000328759.7	37	NULL		19																																																																																			CARD8	-	-	ENSG00000105483		0.510	C19orf68-001	KNOWN	non_canonical_other|basic|appris_principal	protein_coding	CARD8	HGNC	protein_coding	OTTHUMT00000465598.1		0.00	14	0	-	XM_001713770		48685631	-1	tier1		no_errors	ENST00000600800	ensembl	human	known	74_37	rna	20.00	12	3	INS	0.001:0.000	A
CASP8	841	genome.wustl.edu	37	2	202149834	202149834	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr2:202149834G>T	ENST00000432109.2	+	9	1287	c.1098G>T	c.(1096-1098)caG>caT	p.Q366H	CASP8_ENST00000323492.7_Missense_Mutation_p.Q351H|CASP8_ENST00000392259.2_3'UTR|CASP8_ENST00000392266.3_3'UTR|CASP8_ENST00000264275.5_Missense_Mutation_p.Q383H|CASP8_ENST00000358485.4_Missense_Mutation_p.Q425H|CASP8_ENST00000264274.9_Missense_Mutation_p.Q282H	NM_033355.3	NP_203519.1	Q14790	CASP8_HUMAN	caspase 8, apoptosis-related cysteine peptidase	366					activation of cysteine-type endopeptidase activity (GO:0097202)|activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|B cell activation (GO:0042113)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to mechanical stimulus (GO:0071260)|cellular response to organic cyclic compound (GO:0071407)|execution phase of apoptosis (GO:0097194)|extrinsic apoptotic signaling pathway (GO:0097191)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|heart development (GO:0007507)|hepatocyte apoptotic process (GO:0097284)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway (GO:0097193)|macrophage differentiation (GO:0030225)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|natural killer cell activation (GO:0030101)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of necroptotic process (GO:0060546)|neural tube formation (GO:0001841)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of proteolysis (GO:0045862)|protein heterooligomerization (GO:0051291)|proteolysis (GO:0006508)|proteolysis involved in cellular protein catabolic process (GO:0051603)|regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001239)|regulation of thymocyte apoptotic process (GO:0070243)|response to antibiotic (GO:0046677)|response to cobalt ion (GO:0032025)|response to cold (GO:0009409)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to lipopolysaccharide (GO:0032496)|response to tumor necrosis factor (GO:0034612)|syncytiotrophoblast cell differentiation involved in labyrinthine layer development (GO:0060715)|T cell activation (GO:0042110)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRAIL-activated apoptotic signaling pathway (GO:0036462)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|viral process (GO:0016032)	CD95 death-inducing signaling complex (GO:0031265)|cell body (GO:0044297)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|death-inducing signaling complex (GO:0031264)|membrane raft (GO:0045121)|microtubule organizing center (GO:0005815)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|Noc1p-Noc2p complex (GO:0030690)|nucleus (GO:0005634)|ripoptosome (GO:0097342)	cysteine-type endopeptidase activity (GO:0004197)|cysteine-type endopeptidase activity involved in apoptotic process (GO:0097153)|cysteine-type endopeptidase activity involved in apoptotic signaling pathway (GO:0097199)|cysteine-type peptidase activity (GO:0008234)|death effector domain binding (GO:0035877)|peptidase activity (GO:0008233)|scaffold protein binding (GO:0097110)|ubiquitin protein ligase binding (GO:0031625)			breast(5)|cervix(2)|endometrium(6)|large_intestine(11)|lung(10)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(9)|urinary_tract(3)	52						ATAACTACCAGAAAGGTATAC	0.433										HNSCC(4;0.00038)																											Melanoma(82;831 1348 20716 36952 40159)												0													87.0	89.0	88.0					2																	202149834		2203	4300	6503	SO:0001583	missense	0			U60520	CCDS2342.1, CCDS2343.1, CCDS2345.1, CCDS42798.1, CCDS42799.1	2q33-q34	2014-09-17	2005-08-17		ENSG00000064012	ENSG00000064012		"""Caspases"""	1509	protein-coding gene	gene with protein product		601763	"""caspase 8, apoptosis-related cysteine protease"""			8681376, 8681377	Standard	NM_033355		Approved	MCH5, MACH, FLICE, Casp-8	uc002uxt.1	Q14790	OTTHUMG00000132821	ENST00000432109.2:c.1098G>T	2.37:g.202149834G>T	ENSP00000412523:p.Gln366His		O14676|Q14791|Q14792|Q14793|Q14794|Q14795|Q14796|Q15780|Q15806|Q53TT5|Q8TDI1|Q8TDI2|Q8TDI3|Q8TDI4|Q8TDI5|Q96T22|Q9C0K4|Q9UQ81	Missense_Mutation	SNP	pfam_DED,pfam_Pept_C14_caspase,superfamily_DEATH-like_dom,smart_DED,smart_Pept_C14A_p45_core,pfscan_DED,pfscan_Pept_C14_p10,pfscan_Pept_C14_ICE_p20,prints_Pept_C14A_p45_core	p.Q425H	ENST00000432109.2	37	c.1275	CCDS2342.1	2	.	.	.	.	.	.	.	.	.	.	G	11.32	1.603784	0.28534	.	.	ENSG00000064012	ENST00000392263;ENST00000264274;ENST00000432109;ENST00000264275;ENST00000358485;ENST00000323492;ENST00000444430	T;T;T;T;T;T;T	0.80738	-1.41;-1.41;-1.41;-1.41;-1.41;-1.41;-1.41	5.82	-0.693	0.11298	Peptidase C14, caspase catalytic (1);Peptidase C14, caspase precursor p45, core (1);	0.284092	0.41001	D	0.000961	T	0.68988	0.3061	L	0.57130	1.785	0.51012	D	0.999908	B;B;B;B;B	0.33739	0.287;0.331;0.071;0.422;0.171	B;B;B;B;B	0.33846	0.028;0.049;0.06;0.171;0.071	T	0.57359	-0.7825	10	0.46703	T	0.11	.	1.5192	0.02512	0.1981:0.3036:0.3025:0.1957	.	282;425;366;351;383	Q14790-3;Q14790-9;Q14790;Q14790-2;Q14790-4	.;.;CASP8_HUMAN;.;.	H	351;282;366;383;425;351;145	ENSP00000376091:Q351H;ENSP00000264274:Q282H;ENSP00000412523:Q366H;ENSP00000264275:Q383H;ENSP00000351273:Q425H;ENSP00000325722:Q351H;ENSP00000394434:Q145H	ENSP00000264274:Q282H	Q	+	3	2	CASP8	201858079	0.860000	0.29831	0.578000	0.28575	0.860000	0.49131	1.511000	0.35801	-0.121000	0.11787	0.561000	0.74099	CAG	CASP8	-	pfam_Pept_C14_caspase,smart_Pept_C14A_p45_core	ENSG00000064012		0.433	CASP8-014	KNOWN	basic|appris_candidate|CCDS	protein_coding	CASP8	HGNC	protein_coding	OTTHUMT00000336853.2	-	0.00	41	0	G	NM_001228		202149834	+1	tier1	-	no_errors	ENST00000358485	ensembl	human	known	74_37	missense	57.14	9	12	SNP	0.002	T
CASP8	841	genome.wustl.edu	37	2	202149919	202149919	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr2:202149919G>C	ENST00000432109.2	+	9	1372	c.1183G>C	c.(1183-1185)Gat>Cat	p.D395H	CASP8_ENST00000323492.7_Missense_Mutation_p.D380H|CASP8_ENST00000392259.2_3'UTR|CASP8_ENST00000392266.3_3'UTR|CASP8_ENST00000264275.5_Missense_Mutation_p.D412H|CASP8_ENST00000358485.4_Missense_Mutation_p.D454H|CASP8_ENST00000264274.9_Missense_Mutation_p.D311H	NM_033355.3	NP_203519.1	Q14790	CASP8_HUMAN	caspase 8, apoptosis-related cysteine peptidase	395					activation of cysteine-type endopeptidase activity (GO:0097202)|activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|B cell activation (GO:0042113)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to mechanical stimulus (GO:0071260)|cellular response to organic cyclic compound (GO:0071407)|execution phase of apoptosis (GO:0097194)|extrinsic apoptotic signaling pathway (GO:0097191)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|heart development (GO:0007507)|hepatocyte apoptotic process (GO:0097284)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway (GO:0097193)|macrophage differentiation (GO:0030225)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|natural killer cell activation (GO:0030101)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of necroptotic process (GO:0060546)|neural tube formation (GO:0001841)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of proteolysis (GO:0045862)|protein heterooligomerization (GO:0051291)|proteolysis (GO:0006508)|proteolysis involved in cellular protein catabolic process (GO:0051603)|regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001239)|regulation of thymocyte apoptotic process (GO:0070243)|response to antibiotic (GO:0046677)|response to cobalt ion (GO:0032025)|response to cold (GO:0009409)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to lipopolysaccharide (GO:0032496)|response to tumor necrosis factor (GO:0034612)|syncytiotrophoblast cell differentiation involved in labyrinthine layer development (GO:0060715)|T cell activation (GO:0042110)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRAIL-activated apoptotic signaling pathway (GO:0036462)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|viral process (GO:0016032)	CD95 death-inducing signaling complex (GO:0031265)|cell body (GO:0044297)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|death-inducing signaling complex (GO:0031264)|membrane raft (GO:0045121)|microtubule organizing center (GO:0005815)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|Noc1p-Noc2p complex (GO:0030690)|nucleus (GO:0005634)|ripoptosome (GO:0097342)	cysteine-type endopeptidase activity (GO:0004197)|cysteine-type endopeptidase activity involved in apoptotic process (GO:0097153)|cysteine-type endopeptidase activity involved in apoptotic signaling pathway (GO:0097199)|cysteine-type peptidase activity (GO:0008234)|death effector domain binding (GO:0035877)|peptidase activity (GO:0008233)|scaffold protein binding (GO:0097110)|ubiquitin protein ligase binding (GO:0031625)	p.D412N(1)|p.D454N(1)		breast(5)|cervix(2)|endometrium(6)|large_intestine(11)|lung(10)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(9)|urinary_tract(3)	52						ATATATCCCGGATGAGGCTGA	0.473										HNSCC(4;0.00038)																											Melanoma(82;831 1348 20716 36952 40159)												2	Substitution - Missense(2)	skin(2)											68.0	64.0	65.0					2																	202149919		2203	4300	6503	SO:0001583	missense	0			U60520	CCDS2342.1, CCDS2343.1, CCDS2345.1, CCDS42798.1, CCDS42799.1	2q33-q34	2014-09-17	2005-08-17		ENSG00000064012	ENSG00000064012		"""Caspases"""	1509	protein-coding gene	gene with protein product		601763	"""caspase 8, apoptosis-related cysteine protease"""			8681376, 8681377	Standard	NM_033355		Approved	MCH5, MACH, FLICE, Casp-8	uc002uxt.1	Q14790	OTTHUMG00000132821	ENST00000432109.2:c.1183G>C	2.37:g.202149919G>C	ENSP00000412523:p.Asp395His		O14676|Q14791|Q14792|Q14793|Q14794|Q14795|Q14796|Q15780|Q15806|Q53TT5|Q8TDI1|Q8TDI2|Q8TDI3|Q8TDI4|Q8TDI5|Q96T22|Q9C0K4|Q9UQ81	Missense_Mutation	SNP	pfam_DED,pfam_Pept_C14_caspase,superfamily_DEATH-like_dom,smart_DED,smart_Pept_C14A_p45_core,pfscan_DED,pfscan_Pept_C14_p10,pfscan_Pept_C14_ICE_p20,prints_Pept_C14A_p45_core	p.D454H	ENST00000432109.2	37	c.1360	CCDS2342.1	2	.	.	.	.	.	.	.	.	.	.	G	9.792	1.178120	0.21787	.	.	ENSG00000064012	ENST00000392263;ENST00000264274;ENST00000432109;ENST00000264275;ENST00000358485;ENST00000323492;ENST00000444430	T;T;T;T;T;T;T	0.20598	2.06;2.06;2.06;2.06;2.06;2.06;2.06	5.64	4.75	0.60458	Peptidase C14, caspase catalytic (1);Peptidase C14, caspase non-catalytic subunit p10 (1);Peptidase C14, caspase precursor p45, core (1);	0.695120	0.14912	N	0.291163	T	0.33206	0.0855	L	0.50847	1.595	0.09310	N	0.999999	D;D;B;B;D	0.71674	0.998;0.991;0.25;0.158;0.991	P;P;B;B;P	0.61940	0.896;0.69;0.042;0.039;0.773	T	0.13926	-1.0491	10	0.51188	T	0.08	.	6.9374	0.24474	0.1462:0.0:0.7122:0.1417	.	311;454;395;380;412	Q14790-3;Q14790-9;Q14790;Q14790-2;Q14790-4	.;.;CASP8_HUMAN;.;.	H	380;311;395;412;454;380;174	ENSP00000376091:D380H;ENSP00000264274:D311H;ENSP00000412523:D395H;ENSP00000264275:D412H;ENSP00000351273:D454H;ENSP00000325722:D380H;ENSP00000394434:D174H	ENSP00000264274:D311H	D	+	1	0	CASP8	201858164	0.000000	0.05858	0.973000	0.42090	0.523000	0.34469	0.705000	0.25675	2.655000	0.90218	0.561000	0.74099	GAT	CASP8	-	pfam_Pept_C14_caspase,smart_Pept_C14A_p45_core,pfscan_Pept_C14_p10	ENSG00000064012		0.473	CASP8-014	KNOWN	basic|appris_candidate|CCDS	protein_coding	CASP8	HGNC	protein_coding	OTTHUMT00000336853.2	-	0.00	54	0	G	NM_001228		202149919	+1	tier1	-	no_errors	ENST00000358485	ensembl	human	known	74_37	missense	47.22	19	17	SNP	0.004	C
CCDC178	374864	genome.wustl.edu	37	18	30873263	30873263	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr18:30873263G>T	ENST00000383096.3	-	12	1218	c.1036C>A	c.(1036-1038)Caa>Aaa	p.Q346K	CCDC178_ENST00000579916.1_Intron|CCDC178_ENST00000583930.1_Missense_Mutation_p.Q346K|CCDC178_ENST00000579947.1_Missense_Mutation_p.Q346K|CCDC178_ENST00000402325.1_Missense_Mutation_p.Q346K|CCDC178_ENST00000406524.2_Missense_Mutation_p.Q346K|CCDC178_ENST00000403303.1_Missense_Mutation_p.Q346K|CCDC178_ENST00000300227.8_Missense_Mutation_p.Q346K			Q5BJE1	CC178_HUMAN	coiled-coil domain containing 178	346																	CTGTTAAGTTGATATATCTCT	0.313																																																	0													82.0	77.0	78.0					18																	30873263		2196	4288	6484	SO:0001583	missense	0			AK126038	CCDS11906.1, CCDS42424.1	18q12.1	2012-10-15	2012-10-15	2012-10-15	ENSG00000166960	ENSG00000166960			29588	protein-coding gene	gene with protein product			"""chromosome 18 open reading frame 34"""	C18orf34			Standard	NM_198995		Approved	FLJ44050	uc002kxn.2	Q5BJE1	OTTHUMG00000132279	ENST00000383096.3:c.1036C>A	18.37:g.30873263G>T	ENSP00000372576:p.Gln346Lys		A6NDC6|J3KS92|Q6ZP67|Q6ZU20	Missense_Mutation	SNP	NULL	p.Q346K	ENST00000383096.3	37	c.1036	CCDS42424.1	18	.	.	.	.	.	.	.	.	.	.	G	0.005	-2.209326	0.00292	.	.	ENSG00000166960	ENST00000403303;ENST00000383096;ENST00000300227;ENST00000406524;ENST00000402325	T;T;T;T;T	0.26373	1.74;1.74;1.74;1.74;1.74	3.68	1.22	0.21188	.	.	.	.	.	T	0.09113	0.0225	N	0.04508	-0.205	0.09310	N	1	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.01281	0.0;0.0;0.0;0.0	T	0.36817	-0.9732	9	0.02654	T	1	-7.2244	7.9536	0.30029	0.0:0.0:0.4508:0.5492	.	346;346;346;346	F8W7A7;B5MD75;Q5BJE1-2;Q5BJE1	.;.;.;CR034_HUMAN	K	346	ENSP00000385591:Q346K;ENSP00000372576:Q346K;ENSP00000300227:Q346K;ENSP00000385867:Q346K;ENSP00000385234:Q346K	ENSP00000300227:Q346K	Q	-	1	0	C18orf34	29127261	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	0.258000	0.18387	0.246000	0.21394	-0.500000	0.04577	CAA	CCDC178	-	NULL	ENSG00000166960		0.313	CCDC178-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CCDC178	HGNC	protein_coding	OTTHUMT00000255373.2	-	0.00	34	0	G	NM_198995		30873263	-1	tier1	-	no_errors	ENST00000406524	ensembl	human	known	74_37	missense	13.04	20	3	SNP	0.002	T
CCDC34	91057	genome.wustl.edu	37	11	27384468	27384468	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr11:27384468C>T	ENST00000328697.6	-	1	947	c.274G>A	c.(274-276)Gat>Aat	p.D92N	CCDC34_ENST00000317945.6_Missense_Mutation_p.D92N	NM_030771.1	NP_110398.1	Q96HJ3	CCD34_HUMAN	coiled-coil domain containing 34	92	Asp-rich.									endometrium(2)|large_intestine(4)|lung(1)|prostate(1)|urinary_tract(1)	9						TCTTCCTCATCATCCACGTCT	0.582																																																	0													199.0	174.0	182.0					11																	27384468		2202	4299	6501	SO:0001583	missense	0			AF382034	CCDS7863.1, CCDS31448.1	11p14.1	2010-03-30			ENSG00000109881	ENSG00000109881			25079	protein-coding gene	gene with protein product		612324				11173847	Standard	NM_080654		Approved	NY-REN-41, L15, RAMA3	uc001mrh.1	Q96HJ3	OTTHUMG00000166211	ENST00000328697.6:c.274G>A	11.37:g.27384468C>T	ENSP00000330240:p.Asp92Asn		B2R8G2|Q8IX69|Q9H2A6|Q9Y599	Missense_Mutation	SNP	NULL	p.D92N	ENST00000328697.6	37	c.274	CCDS31448.1	11	.	.	.	.	.	.	.	.	.	.	-	15.34	2.803251	0.50315	.	.	ENSG00000109881	ENST00000328697;ENST00000317945	T;T	0.21361	2.01;2.01	4.22	-1.21	0.09524	.	0.673781	0.13472	N	0.385375	T	0.07548	0.0190	N	0.08118	0	0.09310	N	1	B;B	0.11235	0.004;0.003	B;B	0.10450	0.004;0.005	T	0.26573	-1.0099	10	0.35671	T	0.21	.	0.7583	0.01002	0.3237:0.3277:0.1581:0.1905	.	92;92	Q96HJ3-2;Q96HJ3	.;CCD34_HUMAN	N	92	ENSP00000330240:D92N;ENSP00000321563:D92N	ENSP00000321563:D92N	D	-	1	0	CCDC34	27341044	0.014000	0.17966	0.158000	0.22627	0.226000	0.24999	-0.012000	0.12699	-0.206000	0.10203	-0.140000	0.14226	GAT	CCDC34	-	NULL	ENSG00000109881		0.582	CCDC34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC34	HGNC	protein_coding	OTTHUMT00000388396.2	-	0.00	39	0	C	NM_030771		27384468	-1	tier1	-	no_errors	ENST00000328697	ensembl	human	known	74_37	missense	29.73	26	11	SNP	0.215	T
CCDC62	84660	genome.wustl.edu	37	12	123286164	123286164	+	Nonsense_Mutation	SNP	G	G	T			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr12:123286164G>T	ENST00000253079.6	+	9	1815	c.1471G>T	c.(1471-1473)Gaa>Taa	p.E491*	CCDC62_ENST00000537566.1_Nonsense_Mutation_p.E252*|CCDC62_ENST00000392441.4_Nonsense_Mutation_p.E491*|CCDC62_ENST00000392440.2_Nonsense_Mutation_p.E252*	NM_201435.4	NP_958843.2	Q6P9F0	CCD62_HUMAN	coiled-coil domain containing 62	491					cellular response to estradiol stimulus (GO:0071392)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	estrogen receptor binding (GO:0030331)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)			breast(1)|kidney(1)|large_intestine(4)|lung(9)|ovary(2)|pancreas(1)|skin(1)|urinary_tract(1)	20	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;6.51e-06)|Epithelial(86;2.65e-05)|BRCA - Breast invasive adenocarcinoma(302;0.206)		AGATCAGATGGAAAGGTCCGA	0.468																																																	0													70.0	65.0	67.0					12																	123286164		2203	4300	6503	SO:0001587	stop_gained	0				CCDS9238.1	12q24.31	2009-08-18			ENSG00000130783	ENSG00000130783			30723	protein-coding gene	gene with protein product	"""cancer/testis antigen 109"""	613481				18563714, 19126643	Standard	NM_201435		Approved	TSP-NY, FLJ40344, CT109, ERAP75	uc001udc.3	Q6P9F0	OTTHUMG00000168764	ENST00000253079.6:c.1471G>T	12.37:g.123286164G>T	ENSP00000253079:p.Glu491*		A8K8V1|B3KUP3|Q6ZVF2|Q86VJ0|Q9BYZ5	Nonsense_Mutation	SNP	superfamily_Prefoldin	p.E491*	ENST00000253079.6	37	c.1471	CCDS9238.1	12	.	.	.	.	.	.	.	.	.	.	G	47	13.577264	0.99750	.	.	ENSG00000130783	ENST00000253079;ENST00000392441;ENST00000537566;ENST00000392440	.	.	.	5.34	4.43	0.53597	.	0.804035	0.10799	N	0.632862	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-2.2648	11.8953	0.52654	0.0:0.1758:0.8242:0.0	.	.	.	.	X	491;491;252;252	.	ENSP00000253079:E491X	E	+	1	0	CCDC62	121852117	0.025000	0.19082	0.006000	0.13384	0.582000	0.36321	1.829000	0.39121	1.213000	0.43380	0.591000	0.81541	GAA	CCDC62	-	NULL	ENSG00000130783		0.468	CCDC62-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC62	HGNC	protein_coding	OTTHUMT00000400930.1	-	0.00	61	0	G	NM_032573		123286164	+1	tier1	-	no_errors	ENST00000253079	ensembl	human	known	74_37	nonsense	20.83	38	10	SNP	0.011	T
CCDC67	159989	genome.wustl.edu	37	11	93141459	93141459	+	Silent	SNP	G	G	A			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr11:93141459G>A	ENST00000298050.3	+	12	1489	c.1389G>A	c.(1387-1389)gaG>gaA	p.E463E	AP004242.1_ENST00000408638.1_RNA|CCDC67_ENST00000525646.1_Silent_p.E205E	NM_181645.3	NP_857596.2	Q05D60	DEUP1_HUMAN	coiled-coil domain containing 67	463					cell projection organization (GO:0030030)|de novo centriole assembly (GO:0098535)	cytoplasm (GO:0005737)|deuterosome (GO:0098536)				endometrium(3)|kidney(1)|large_intestine(1)|lung(10)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22		Acute lymphoblastic leukemia(157;2.35e-05)|all_hematologic(158;0.00824)				TGCAATATGAGAATGAAAGGC	0.353																																																	0													42.0	37.0	39.0					11																	93141459		1817	4085	5902	SO:0001819	synonymous_variant	0			AK058122	CCDS44707.1	11q21	2014-02-20				ENSG00000165325			26344	protein-coding gene	gene with protein product						24240477	Standard	NM_181645		Approved	FLJ25393	uc001pdq.3	Q05D60		ENST00000298050.3:c.1389G>A	11.37:g.93141459G>A			Q8NEF1|Q96LL7	Silent	SNP	superfamily_MHC_II-assoc_invariant_trimer	p.E463	ENST00000298050.3	37	c.1389	CCDS44707.1	11																																																																																			CCDC67	-	NULL	ENSG00000165325		0.353	CCDC67-201	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC67	HGNC	protein_coding		-	0.00	29	0	G	NM_181645		93141459	+1	tier1	-	no_errors	ENST00000298050	ensembl	human	known	74_37	silent	42.11	11	8	SNP	1.000	A
CD22	933	genome.wustl.edu	37	19	35828840	35828840	+	Missense_Mutation	SNP	A	A	G			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr19:35828840A>G	ENST00000085219.5	+	5	967	c.901A>G	c.(901-903)Aag>Gag	p.K301E	CD22_ENST00000536635.2_Missense_Mutation_p.K301E|CD22_ENST00000419549.2_Missense_Mutation_p.K129E|CD22_ENST00000341773.6_Intron|CD22_ENST00000544992.2_Missense_Mutation_p.K301E|CD22_ENST00000594250.1_Intron|CD22_ENST00000270311.6_Missense_Mutation_p.K181E	NM_001771.3	NP_001762.2	P20273	CD22_HUMAN	CD22 molecule	301	Ig-like C2-type 2.				cell adhesion (GO:0007155)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)			breast(2)|endometrium(2)|kidney(3)|large_intestine(14)|lung(21)|ovary(5)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	54	all_lung(56;9.78e-09)|Lung NSC(56;1.46e-08)|Esophageal squamous(110;0.162)		Epithelial(14;5.83e-19)|OV - Ovarian serous cystadenocarcinoma(14;3.19e-18)|all cancers(14;3.41e-16)|LUSC - Lung squamous cell carcinoma(66;0.0417)			CGAAGTGACCAAGGACCAGAG	0.577																																					Ovarian(42;1009 1133 23674 26041)												0													109.0	73.0	85.0					19																	35828840		2203	4300	6503	SO:0001583	missense	0			X52785	CCDS12457.1, CCDS54247.1, CCDS54248.1, CCDS54249.1, CCDS62634.1	19q13.1	2013-01-29	2006-03-28		ENSG00000012124	ENSG00000012124		"""CD molecules"", ""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1643	protein-coding gene	gene with protein product	"""sialic acid binding Ig-like lectin 2"""	107266	"""CD22 antigen"""			8496602, 1691828	Standard	NM_001185099		Approved	SIGLEC-2, SIGLEC2	uc010edt.3	P20273		ENST00000085219.5:c.901A>G	19.37:g.35828840A>G	ENSP00000085219:p.Lys301Glu		F5GYU4|F5H7U3|O95699|O95701|O95702|O95703|Q01665|Q32M46|Q92872|Q92873|Q9UQA6|Q9UQA7|Q9UQA8|Q9UQA9|Q9UQB0|Q9Y2A6	Missense_Mutation	SNP	pfam_Immunoglobulin,pfam_Ig_I-set,pfam_CD80_C2-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.K301E	ENST00000085219.5	37	c.901	CCDS12457.1	19	.	.	.	.	.	.	.	.	.	.	A	17.91	3.504195	0.64410	.	.	ENSG00000012124	ENST00000085219;ENST00000536635;ENST00000544992;ENST00000270311;ENST00000419549	T;T;T;T;T	0.11277	2.79;2.79;2.79;2.79;2.79	5.02	3.92	0.45320	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.517070	0.17941	N	0.156848	T	0.12561	0.0305	N	0.20530	0.585	0.22656	N	0.998882	P;D;D;D	0.63046	0.814;0.992;0.992;0.992	P;D;D;D	0.64877	0.719;0.93;0.917;0.914	T	0.09400	-1.0676	10	0.07325	T	0.83	.	8.4499	0.32864	0.813:0.0:0.0:0.187	.	129;301;301;301	Q32M46;F5GYU4;F5H7U3;P20273	.;.;.;CD22_HUMAN	E	301;301;301;181;129	ENSP00000085219:K301E;ENSP00000442279:K301E;ENSP00000441237:K301E;ENSP00000270311:K181E;ENSP00000403822:K129E	ENSP00000085219:K301E	K	+	1	0	CD22	40520680	0.760000	0.28428	0.959000	0.39883	0.005000	0.04900	1.801000	0.38843	1.894000	0.54839	0.383000	0.25322	AAG	CD22	-	pfam_Immunoglobulin,pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000012124		0.577	CD22-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CD22	HGNC	protein_coding	OTTHUMT00000466099.1	-	0.00	55	0	A	NM_001771		35828840	+1	tier1	-	no_errors	ENST00000085219	ensembl	human	known	74_37	missense	10.42	43	5	SNP	0.494	G
CD38	952	genome.wustl.edu	37	4	15780234	15780234	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr4:15780234G>C	ENST00000226279.3	+	1	334	c.197G>C	c.(196-198)cGa>cCa	p.R66P		NM_001775.2	NP_001766.2	P28907	CD38_HUMAN	CD38 molecule	66					apoptotic signaling pathway (GO:0097190)|B cell receptor signaling pathway (GO:0050853)|female pregnancy (GO:0007565)|long term synaptic depression (GO:0060292)|negative regulation of apoptotic process (GO:0043066)|negative regulation of bone resorption (GO:0045779)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cell growth (GO:0030307)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of insulin secretion (GO:0032024)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of vasoconstriction (GO:0045907)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to hydroperoxide (GO:0033194)|response to hypoxia (GO:0001666)|response to interleukin-1 (GO:0070555)|response to progesterone (GO:0032570)|response to retinoic acid (GO:0032526)|signal transduction (GO:0007165)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	NAD(P)+ nucleosidase activity (GO:0050135)|NAD+ nucleosidase activity (GO:0003953)|phosphorus-oxygen lyase activity (GO:0016849)|transferase activity (GO:0016740)			endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(2)|prostate(1)|stomach(1)	14						GTCCTGGCGCGATGCGTCAAG	0.672																																																	0													70.0	72.0	71.0					4																	15780234		2203	4300	6503	SO:0001583	missense	0			D84276	CCDS3417.1	4p15.32	2010-05-04	2006-03-28		ENSG00000004468	ENSG00000004468	3.2.2.5	"""CD molecules"""	1667	protein-coding gene	gene with protein product	"""ADP-ribosyl cyclase 1"", ""NAD(+) nucleosidase"""	107270	"""CD38 antigen (p45)"""			9074508, 2319135	Standard	NM_001775		Approved		uc003gol.1	P28907	OTTHUMG00000048206	ENST00000226279.3:c.197G>C	4.37:g.15780234G>C	ENSP00000226279:p.Arg66Pro		O00121|O00122|Q96HY4	Missense_Mutation	SNP	pfam_ADP-ribosyl_cyclase	p.R66P	ENST00000226279.3	37	c.197	CCDS3417.1	4	.	.	.	.	.	.	.	.	.	.	G	15.23	2.772255	0.49680	.	.	ENSG00000004468	ENST00000226279;ENST00000540195	T	0.25250	1.81	2.98	2.98	0.34508	.	0.065284	0.64402	D	0.000016	T	0.50667	0.1629	M	0.84948	2.725	0.24627	N	0.993648	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.35599	-0.9782	10	0.87932	D	0	.	9.6733	0.40026	0.0:0.0:1.0:0.0	.	66;66	P28907;B2R880	CD38_HUMAN;.	P	66	ENSP00000226279:R66P	ENSP00000226279:R66P	R	+	2	0	CD38	15389332	0.265000	0.24102	0.027000	0.17364	0.009000	0.06853	3.075000	0.50073	1.990000	0.58119	0.462000	0.41574	CGA	CD38	-	pfam_ADP-ribosyl_cyclase	ENSG00000004468		0.672	CD38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CD38	HGNC	protein_coding	OTTHUMT00000250322.2	-	0.00	73	0	G	NM_001775		15780234	+1	tier1	-	no_errors	ENST00000226279	ensembl	human	known	74_37	missense	44.64	31	25	SNP	0.027	C
CDR2	1039	genome.wustl.edu	37	16	22358728	22358728	+	Missense_Mutation	SNP	C	C	T	rs541082194		TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr16:22358728C>T	ENST00000268383.2	-	5	1230	c.923G>A	c.(922-924)cGc>cAc	p.R308H		NM_001802.1	NP_001793.1	Q01850	CDR2_HUMAN	cerebellar degeneration-related protein 2, 62kDa	308						cytoplasm (GO:0005737)				endometrium(3)|large_intestine(3)|lung(3)|skin(1)|urinary_tract(1)	11				GBM - Glioblastoma multiforme(48;0.0188)		ACTGCTGCTGCGCTTGAGAGG	0.562																																																	0													56.0	46.0	49.0					16																	22358728		2197	4300	6497	SO:0001583	missense	0			M63256	CCDS32404.1	16p13.1-p12	2008-02-05	2002-08-29			ENSG00000140743			1799	protein-coding gene	gene with protein product	"""Yo paraneoplastic antigen"""	117340	"""cerebellar degeneration-related protein (62kD)"""			2014264	Standard	NM_001802		Approved	CDR62, Yo	uc002dkn.3	Q01850		ENST00000268383.2:c.923G>A	16.37:g.22358728C>T	ENSP00000268383:p.Arg308His		A8K8A8|Q13977	Missense_Mutation	SNP	NULL	p.R308H	ENST00000268383.2	37	c.923	CCDS32404.1	16	.	.	.	.	.	.	.	.	.	.	C	29.1	4.976339	0.92982	.	.	ENSG00000140743	ENST00000268383	T	0.54279	0.58	5.79	5.79	0.91817	.	0.049885	0.85682	D	0.000000	T	0.73194	0.3556	M	0.70275	2.135	0.58432	D	0.999997	D	0.89917	1.0	D	0.72982	0.979	T	0.72683	-0.4219	10	0.52906	T	0.07	-18.8966	20.0321	0.97543	0.0:1.0:0.0:0.0	.	308	Q01850	CDR2_HUMAN	H	308	ENSP00000268383:R308H	ENSP00000268383:R308H	R	-	2	0	CDR2	22266229	1.000000	0.71417	0.999000	0.59377	0.658000	0.38924	5.444000	0.66587	2.728000	0.93425	0.655000	0.94253	CGC	CDR2	-	NULL	ENSG00000140743		0.562	CDR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDR2	HGNC	protein_coding	OTTHUMT00000430081.1	-	0.00	46	0	C			22358728	-1	tier1	-	no_errors	ENST00000268383	ensembl	human	known	74_37	missense	10.17	53	6	SNP	1.000	T
CELSR2	1952	genome.wustl.edu	37	1	109801662	109801662	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr1:109801662G>A	ENST00000271332.3	+	2	3980	c.3919G>A	c.(3919-3921)Gag>Aag	p.E1307K		NM_001408.2	NP_001399.1	Q9HCU4	CELR2_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 2	1307	EGF-like 2; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				cerebrospinal fluid secretion (GO:0033326)|cilium assembly (GO:0042384)|cilium movement (GO:0003341)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|neural plate anterior/posterior regionalization (GO:0021999)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|regulation of cell-cell adhesion (GO:0022407)|regulation of protein localization (GO:0032880)|regulation of transcription, DNA-templated (GO:0006355)|ventricular system development (GO:0021591)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(27)|ovary(5)|prostate(1)|skin(3)|urinary_tract(2)	82		all_epithelial(167;0.000114)|all_lung(203;0.000321)|Lung NSC(277;0.000626)|Breast(1374;0.244)		Colorectal(144;0.0296)|Lung(183;0.067)|COAD - Colon adenocarcinoma(174;0.114)|Epithelial(280;0.193)|all cancers(265;0.219)		CCGCAGCCGCGAGGGCGGCTA	0.701																																					NSCLC(158;1285 2011 34800 34852 42084)												0													7.0	10.0	9.0					1																	109801662		2098	4120	6218	SO:0001583	missense	0			D87469	CCDS796.1	1p13.3	2014-08-08	2013-02-18		ENSG00000143126	ENSG00000143126		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	3231	protein-coding gene	gene with protein product		604265	"""cadherin, EGF LAG seven-pass G-type receptor 2, flamingo (Drosophila) homolog"""	EGFL2		9693030, 10907856	Standard	NM_001408		Approved	KIAA0279, MEGF3, Flamingo1, CDHF10	uc001dxa.4	Q9HCU4	OTTHUMG00000012003	ENST00000271332.3:c.3919G>A	1.37:g.109801662G>A	ENSP00000271332:p.Glu1307Lys		Q5T2Y7|Q92566	Missense_Mutation	SNP	pfam_Cadherin,pfam_DUF3497,pfam_Laminin_G,pfam_GPCR_2_secretin-like,pfam_GPS_dom,pfam_EG-like_dom,pfam_EGF_laminin,superfamily_ConA-like_lec_gl_sf,superfamily_Cadherin-like,smart_Cadherin,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_Laminin_G,smart_EGF_laminin,smart_GPCR_2_extracellular_dom,smart_GPS_dom,pfscan_EG-like_dom,pfscan_EGF_laminin,pfscan_GPS_dom,pfscan_Laminin_G,pfscan_Cadherin,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_Cadherin,prints_GPCR_2_secretin-like	p.E1307K	ENST00000271332.3	37	c.3919	CCDS796.1	1	.	.	.	.	.	.	.	.	.	.	G	29.2	4.986251	0.93044	.	.	ENSG00000143126	ENST00000271332	D	0.87334	-2.24	4.65	4.65	0.58169	EGF-like, laminin (1);EGF-like calcium-binding (1);Epidermal growth factor-like, type 3 (1);	.	.	.	.	D	0.86037	0.5837	N	0.20610	0.595	0.58432	D	0.999998	D	0.89917	1.0	D	0.68353	0.957	D	0.87756	0.2595	9	0.52906	T	0.07	.	17.6775	0.88234	0.0:0.0:1.0:0.0	.	1307	Q9HCU4	CELR2_HUMAN	K	1307	ENSP00000271332:E1307K	ENSP00000271332:E1307K	E	+	1	0	CELSR2	109603185	1.000000	0.71417	0.999000	0.59377	0.999000	0.98932	7.515000	0.81761	2.587000	0.87381	0.563000	0.77884	GAG	CELSR2	-	smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom	ENSG00000143126		0.701	CELSR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CELSR2	HGNC	protein_coding	OTTHUMT00000033200.1		0.00	15	0	G	NM_001408		109801662	+1			no_errors	ENST00000271332	ensembl	human	known	74_37	missense	16.67	10	2	SNP	0.998	A
CENPE	1062	genome.wustl.edu	37	4	104065534	104065534	+	Missense_Mutation	SNP	A	A	G			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr4:104065534A>G	ENST00000265148.3	-	33	5188	c.5099T>C	c.(5098-5100)gTa>gCa	p.V1700A	CENPE_ENST00000380026.3_Missense_Mutation_p.V1675A	NM_001813.2	NP_001804.2	Q02224	CENPE_HUMAN	centromere protein E, 312kDa	1700					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|kinetochore assembly (GO:0051382)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic chromosome movement towards spindle pole (GO:0007079)|mitotic metaphase plate congression (GO:0007080)|multicellular organismal development (GO:0007275)|positive regulation of protein kinase activity (GO:0045860)|regulation of mitotic metaphase/anaphase transition (GO:0030071)	chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|condensed chromosome outer kinetochore (GO:0000940)|condensed chromosome, centromeric region (GO:0000779)|condensed nuclear chromosome kinetochore (GO:0000778)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|midbody (GO:0030496)|mitotic spindle midzone (GO:1990023)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|kinetochore binding (GO:0043515)|microtubule motor activity (GO:0003777)			NS(3)|breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(20)|lung(34)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(5)|urinary_tract(3)	101				OV - Ovarian serous cystadenocarcinoma(123;2.95e-08)		GTCTCTCTCTACTTTGAGAGT	0.383																																																	0													156.0	154.0	155.0					4																	104065534		2203	4300	6503	SO:0001583	missense	0			Z15005	CCDS34042.1, CCDS68768.1	4q24-q25	2013-11-05	2002-08-29			ENSG00000138778		"""Kinesins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1856	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 61"""	117143	"""centromere protein E (312kD)"""			7851898	Standard	NM_001286734		Approved	KIF10, PPP1R61	uc003hxb.1	Q02224		ENST00000265148.3:c.5099T>C	4.37:g.104065534A>G	ENSP00000265148:p.Val1700Ala		A6NKY9|A8K2U7|Q4LE75	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,superfamily_STAT_TF_coiled-coil,superfamily_Signal_recog_particl_SRP54_hlx,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.V1700A	ENST00000265148.3	37	c.5099	CCDS34042.1	4	.	.	.	.	.	.	.	.	.	.	A	1.056	-0.674355	0.03378	.	.	ENSG00000138778	ENST00000265148;ENST00000394771;ENST00000380026	T;T	0.70399	-0.48;-0.48	5.13	-0.0551	0.13811	.	.	.	.	.	T	0.50154	0.1599	L	0.35723	1.085	0.09310	N	1	B;B	0.26081	0.141;0.001	B;B	0.21151	0.033;0.002	T	0.32188	-0.9916	9	0.07175	T	0.84	.	5.2816	0.15678	0.3724:0.0:0.4661:0.1615	.	1675;1700	Q02224-3;Q02224	.;CENPE_HUMAN	A	1700;1700;1675	ENSP00000265148:V1700A;ENSP00000369365:V1675A	ENSP00000265148:V1700A	V	-	2	0	CENPE	104284983	0.000000	0.05858	0.012000	0.15200	0.650000	0.38633	-0.433000	0.06948	-0.005000	0.14395	0.445000	0.29226	GTA	CENPE	-	NULL	ENSG00000138778		0.383	CENPE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	CENPE	HGNC	protein_coding		-	0.00	48	0	A			104065534	-1	tier1	-	no_errors	ENST00000265148	ensembl	human	known	74_37	missense	40.00	33	22	SNP	0.001	G
CFP	5199	genome.wustl.edu	37	X	47486320	47486320	+	Silent	SNP	G	G	A			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chrX:47486320G>A	ENST00000396992.3	-	6	912	c.792C>T	c.(790-792)ggC>ggT	p.G264G	CFP_ENST00000377005.2_Silent_p.G264G|CFP_ENST00000480317.1_5'Flank|CFP_ENST00000247153.3_Silent_p.G264G	NM_001145252.1	NP_001138724.1	P27918	PROP_HUMAN	complement factor properdin	264	TSP type-1 4. {ECO:0000255|PROSITE- ProRule:PRU00210}.				complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|defense response to bacterium (GO:0042742)|immune response (GO:0006955)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	extracellular region (GO:0005576)|extracellular space (GO:0005615)				breast(3)|endometrium(4)|kidney(2)|large_intestine(3)|lung(4)|ovary(1)|skin(1)	18						GGCTCACAGGGCCCCAAGGCC	0.642																																																	0													13.0	14.0	13.0					X																	47486320		2169	4236	6405	SO:0001819	synonymous_variant	0			M83652	CCDS14282.1	Xp11.4	2014-09-17	2006-03-02	2006-03-02	ENSG00000126759	ENSG00000126759		"""Complement system"""	8864	protein-coding gene	gene with protein product		300383	"""properdin P factor, complement"""	PFC		1783405	Standard	NM_001145252		Approved		uc004dih.3	P27918	OTTHUMG00000021451	ENST00000396992.3:c.792C>T	X.37:g.47486320G>A			O15134|O15135|O15136|O75826	Silent	SNP	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	p.G264	ENST00000396992.3	37	c.792	CCDS14282.1	X																																																																																			CFP	-	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	ENSG00000126759		0.642	CFP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CFP	HGNC	protein_coding	OTTHUMT00000056435.2	-	0.00	22	0	G	NM_002621		47486320	-1	tier1	-	no_errors	ENST00000247153	ensembl	human	known	74_37	silent	55.56	8	10	SNP	0.000	A
CHD5	26038	genome.wustl.edu	37	1	6202187	6202187	+	Splice_Site	SNP	C	C	T			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr1:6202187C>T	ENST00000262450.3	-	15	2536		c.e15+1		CHD5_ENST00000378021.1_Splice_Site	NM_015557.2	NP_056372.1	O00258	WRB_HUMAN	chromodomain helicase DNA binding protein 5						tail-anchored membrane protein insertion into ER membrane (GO:0071816)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)				breast(3)|central_nervous_system(3)|liver(1)|lung(1)|ovary(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	16	Ovarian(185;0.0634)	all_cancers(23;5.36e-32)|all_epithelial(116;2.32e-17)|all_neural(13;3.68e-06)|all_lung(118;3.94e-06)|all_hematologic(16;2.39e-05)|Lung NSC(185;5.33e-05)|Acute lymphoblastic leukemia(12;0.000372)|Glioma(11;0.00127)|Renal(390;0.00188)|Colorectal(325;0.00342)|Breast(487;0.00373)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.15)		Epithelial(90;3.08e-37)|GBM - Glioblastoma multiforme(13;1.36e-31)|OV - Ovarian serous cystadenocarcinoma(86;7.7e-19)|Colorectal(212;9.97e-08)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(185;6.16e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.00109)|BRCA - Breast invasive adenocarcinoma(365;0.0012)|STAD - Stomach adenocarcinoma(132;0.00346)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.193)		CGAGCCCTCACCTTCATACGG	0.597																																																	0													143.0	137.0	139.0					1																	6202187		2203	4300	6503	SO:0001630	splice_region_variant	0			AF425231	CCDS57.1	1p36.3	2013-01-28			ENSG00000116254	ENSG00000116254		"""Zinc fingers, PHD-type"""	16816	protein-coding gene	gene with protein product		610771				11889561, 12592387	Standard	NM_015557		Approved		uc001amb.2	Q8TDI0	OTTHUMG00000000952	ENST00000262450.3:c.2436+1G>A	1.37:g.6202187C>T			A8KAP8|A8MQ44|D3DSH9|O60740	Splice_Site	SNP	-	e15+1	ENST00000262450.3	37	c.2436+1	CCDS57.1	1	.	.	.	.	.	.	.	.	.	.	C	16.59	3.167071	0.57476	.	.	ENSG00000116254	ENST00000262450;ENST00000378006;ENST00000536802;ENST00000538279	.	.	.	4.07	4.07	0.47477	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.6218	0.84932	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	CHD5	6124774	1.000000	0.71417	0.998000	0.56505	0.591000	0.36615	7.693000	0.84214	1.977000	0.57605	0.561000	0.74099	.	CHD5	-	-	ENSG00000116254		0.597	CHD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHD5	HGNC	protein_coding	OTTHUMT00000002823.2	-	0.00	39	0	C	NM_015557	Intron	6202187	-1	tier1	-	no_errors	ENST00000262450	ensembl	human	known	74_37	splice_site	48.39	16	15	SNP	1.000	T
CGN	57530	genome.wustl.edu	37	1	151491113	151491113	+	Nonsense_Mutation	SNP	C	C	T	rs376940080		TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr1:151491113C>T	ENST00000271636.7	+	2	251	c.118C>T	c.(118-120)Cga>Tga	p.R40*		NM_020770.2	NP_065821.1	Q9P2M7	CING_HUMAN	cingulin	34	Head.				transforming growth factor beta receptor signaling pathway (GO:0007179)	cell junction (GO:0030054)|myosin complex (GO:0016459)|tight junction (GO:0005923)	actin binding (GO:0003779)|motor activity (GO:0003774)			NS(1)|central_nervous_system(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|liver(1)|lung(14)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	45	Ovarian(49;0.0273)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		LUSC - Lung squamous cell carcinoma(543;0.181)			TCGAGGTGGACGACGCCCAGC	0.607																																																	0								C	stop/ARG	0,4406		0,0,2203	117.0	108.0	111.0		118	2.8	0.6	1		111	1,8599	1.2+/-3.3	0,1,4299	no	stop-gained	CGN	NM_020770.2		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		40/1204	151491113	1,13005	2203	4300	6503	SO:0001587	stop_gained	0			AB037740	CCDS999.1	1q21	2008-02-05			ENSG00000143375	ENSG00000143375			17429	protein-coding gene	gene with protein product		609473				11042084, 12529927	Standard	NM_020770		Approved	KIAA1319	uc009wmw.3	Q9P2M7	OTTHUMG00000012497	ENST00000271636.7:c.118C>T	1.37:g.151491113C>T	ENSP00000271636:p.Arg40*		A6H8L3|A7MD22|Q5T386|Q9NR25	Nonsense_Mutation	SNP	pfam_Myosin_tail	p.R40*	ENST00000271636.7	37	c.118	CCDS999.1	1	.	.	.	.	.	.	.	.	.	.	C	29.6	5.016651	0.93404	0.0	1.16E-4	ENSG00000143375	ENST00000505188;ENST00000502442;ENST00000427934;ENST00000271636	.	.	.	4.75	2.78	0.32641	.	0.221292	0.40064	N	0.001199	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-10.2588	10.2974	0.43631	0.1531:0.6995:0.1475:0.0	.	.	.	.	X	40	.	ENSP00000271636:R40X	R	+	1	2	CGN	149757737	0.595000	0.26857	0.585000	0.28666	0.953000	0.61014	1.045000	0.30341	0.667000	0.31107	0.655000	0.94253	CGA	CGN	-	NULL	ENSG00000143375		0.607	CGN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CGN	HGNC	protein_coding	OTTHUMT00000034900.3	-	0.00	57	0	C	NM_020770		151491113	+1	tier1	-	no_errors	ENST00000271636	ensembl	human	known	74_37	nonsense	12.70	55	8	SNP	0.869	T
CIZ1	25792	genome.wustl.edu	37	9	130931405	130931405	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr9:130931405C>T	ENST00000393608.1	-	14	2423	c.2221G>A	c.(2221-2223)Gag>Aag	p.E741K	CIZ1_ENST00000476727.2_5'UTR|CIZ1_ENST00000277465.4_Missense_Mutation_p.E713K|CIZ1_ENST00000538431.1_Missense_Mutation_p.E767K|CIZ1_ENST00000372938.5_Missense_Mutation_p.E741K|CIZ1_ENST00000357558.5_Missense_Mutation_p.E713K|CIZ1_ENST00000325721.8_Missense_Mutation_p.E712K|CIZ1_ENST00000372948.3_Missense_Mutation_p.E685K|CIZ1_ENST00000372954.1_Missense_Mutation_p.E661K|CIZ1_ENST00000541172.1_Missense_Mutation_p.E640K	NM_012127.2	NP_036259.2	Q9ULV3	CIZ1_HUMAN	CDKN1A interacting zinc finger protein 1	741	Glu-rich.				maintenance of protein location in nucleus (GO:0051457)|positive regulation of DNA-dependent DNA replication initiation (GO:0032298)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(8)|liver(1)|lung(9)|ovary(3)|prostate(2)|urinary_tract(2)	35						tcatcaccctcGAAGCAACCC	0.547																																																	0													298.0	279.0	286.0					9																	130931405		2203	4300	6503	SO:0001583	missense	0			AB030835	CCDS6894.1, CCDS48033.1, CCDS48034.1, CCDS75910.1	9q34.1	2012-10-05			ENSG00000148337	ENSG00000148337			16744	protein-coding gene	gene with protein product		611420				10529385	Standard	NM_001131015		Approved	LSFR1, ZNF356	uc011mas.2	Q9ULV3	OTTHUMG00000020735	ENST00000393608.1:c.2221G>A	9.37:g.130931405C>T	ENSP00000377232:p.Glu741Lys		A8K9J8|B4E131|B7ZAS8|Q5SYW3|Q5SYW5|Q8WU72|Q9H868|Q9NYM8|Q9UHK4|Q9Y3F9|Q9Y3G0	Missense_Mutation	SNP	pfam_Znf_C2H2_jaz,smart_Znf_U1,smart_Znf_C2H2-like,pfscan_Znf_C2H2_matrin	p.E767K	ENST00000393608.1	37	c.2299	CCDS6894.1	9	.	.	.	.	.	.	.	.	.	.	C	25.7	4.664455	0.88251	.	.	ENSG00000148337	ENST00000372954;ENST00000393608;ENST00000538431;ENST00000357558;ENST00000325721;ENST00000537314;ENST00000541172;ENST00000277465;ENST00000372948;ENST00000372938;ENST00000415526	T;T;T;T;T;T;T;T;T;T	0.37584	1.19;1.37;1.34;1.52;1.36;1.78;1.52;1.2;1.37;1.94	5.81	5.81	0.92471	.	0.000000	0.48286	D	0.000198	T	0.43722	0.1260	L	0.43152	1.355	0.47862	D	0.999534	P;D;D;D;D;D;D	0.64830	0.939;0.984;0.994;0.964;0.984;0.964;0.984	B;B;P;P;B;P;B	0.50490	0.231;0.359;0.642;0.454;0.359;0.454;0.359	T	0.10730	-1.0617	10	0.38643	T	0.18	-22.965	19.0668	0.93114	0.0:1.0:0.0:0.0	.	767;680;685;661;741;712;713	B7Z3U7;B4E0A3;Q9ULV3-4;Q9ULV3-3;Q9ULV3;Q9ULV3-2;Q5SYW2	.;.;.;.;CIZ1_HUMAN;.;.	K	661;741;767;713;712;680;640;713;685;741;663	ENSP00000362045:E661K;ENSP00000377232:E741K;ENSP00000439244:E767K;ENSP00000350169:E713K;ENSP00000320374:E712K;ENSP00000445057:E640K;ENSP00000277465:E713K;ENSP00000362039:E685K;ENSP00000362029:E741K;ENSP00000398011:E663K	ENSP00000277465:E713K	E	-	1	0	CIZ1	129971226	1.000000	0.71417	1.000000	0.80357	0.885000	0.51271	4.947000	0.63583	2.757000	0.94681	0.462000	0.41574	GAG	CIZ1	-	NULL	ENSG00000148337		0.547	CIZ1-203	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CIZ1	HGNC	protein_coding	OTTHUMT00000054399.1	-	0.00	63	0	C	NM_012127		130931405	-1	tier1	-	no_errors	ENST00000538431	ensembl	human	known	74_37	missense	29.79	33	14	SNP	1.000	T
CLINT1	9685	genome.wustl.edu	37	5	157214829	157214829	+	Missense_Mutation	SNP	T	T	C			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr5:157214829T>C	ENST00000411809.2	-	12	1907	c.1703A>G	c.(1702-1704)aAt>aGt	p.N568S	CLINT1_ENST00000523908.1_Missense_Mutation_p.N586S|CLINT1_ENST00000523094.1_Missense_Mutation_p.N568S|CLINT1_ENST00000296951.5_Missense_Mutation_p.N568S|CLINT1_ENST00000530742.1_Missense_Mutation_p.N568S	NM_014666.3	NP_055481.1	Q14677	EPN4_HUMAN	clathrin interactor 1	568	Met-rich.				clathrin coat assembly (GO:0048268)|endocytosis (GO:0006897)|membrane organization (GO:0061024)|post-Golgi vesicle-mediated transport (GO:0006892)	clathrin-coated vesicle (GO:0030136)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)	clathrin binding (GO:0030276)|lipid binding (GO:0008289)			breast(1)|endometrium(2)|kidney(3)|large_intestine(2)|lung(9)|ovary(2)|pancreas(1)|urinary_tract(1)	21	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.138)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			CATCGGAGTATTTCCAAGAGG	0.542																																					Colon(22;427 587 2170 6147 14291)												0													107.0	103.0	104.0					5																	157214829		2016	4191	6207	SO:0001583	missense	0			AF434813	CCDS47330.1, CCDS56388.1, CCDS56389.1	5q33.3	2006-06-13			ENSG00000113282	ENSG00000113282			23186	protein-coding gene	gene with protein product		607265				12213833, 12429846	Standard	NM_014666		Approved	ENTH, KIAA0171, EPNR, CLINT	uc011ddv.2	Q14677	OTTHUMG00000163527	ENST00000411809.2:c.1703A>G	5.37:g.157214829T>C	ENSP00000388340:p.Asn568Ser		B7Z6F8|D3DQJ6|Q8NAF1|Q96E05	Missense_Mutation	SNP	pfam_Epsin_dom_N,pfam_ANTH_dom,superfamily_ENTH_VHS,smart_Epsin-like_N,pfscan_Epsin-like_N	p.N568S	ENST00000411809.2	37	c.1703	CCDS47330.1	5	.	.	.	.	.	.	.	.	.	.	T	0.108	-1.143050	0.01728	.	.	ENSG00000113282	ENST00000523094;ENST00000530742;ENST00000411809;ENST00000296951;ENST00000523908	T;T;T;T;T	0.35048	1.33;1.33;1.33;1.33;1.33	5.67	1.95	0.26073	.	0.724137	0.14699	N	0.303698	T	0.13586	0.0329	N	0.08118	0	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.20371	-1.0277	10	0.15952	T	0.53	-18.5315	1.2118	0.01906	0.1299:0.211:0.3015:0.3576	.	586;568	B7Z6F8;Q14677	.;EPN4_HUMAN	S	568;568;568;568;586	ENSP00000429345:N568S;ENSP00000433419:N568S;ENSP00000388340:N568S;ENSP00000296951:N568S;ENSP00000429824:N586S	ENSP00000296951:N568S	N	-	2	0	CLINT1	157147407	0.208000	0.23494	0.631000	0.29282	0.818000	0.46254	0.385000	0.20685	0.493000	0.27837	0.477000	0.44152	AAT	CLINT1	-	NULL	ENSG00000113282		0.542	CLINT1-001	KNOWN	basic|CCDS	protein_coding	CLINT1	HGNC	protein_coding	OTTHUMT00000374001.1	-	0.00	54	0	T	NM_014666		157214829	-1	tier1	-	no_errors	ENST00000296951	ensembl	human	known	74_37	missense	60.42	19	29	SNP	0.065	C
COBLL1	22837	genome.wustl.edu	37	2	165559719	165559719	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr2:165559719G>A	ENST00000392717.2	-	10	1355	c.1351C>T	c.(1351-1353)Cct>Tct	p.P451S	COBLL1_ENST00000491126.2_Intron|COBLL1_ENST00000342193.4_Missense_Mutation_p.P413S|COBLL1_ENST00000375458.2_Intron|COBLL1_ENST00000194871.6_Missense_Mutation_p.P479S|COBLL1_ENST00000409184.3_Intron			Q53SF7	COBL1_HUMAN	cordon-bleu WH2 repeat protein-like 1	451						extracellular vesicular exosome (GO:0070062)				central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(12)|liver(1)|lung(12)|ovary(3)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)	47						GAAAGCCCAGGGTGAAAGGTT	0.478																																																	0													94.0	90.0	91.0					2																	165559719		2203	4300	6503	SO:0001583	missense	0			AB023194	CCDS2223.2, CCDS63045.1	2q24.3	2012-12-07	2012-12-07		ENSG00000082438	ENSG00000082438			23571	protein-coding gene	gene with protein product		610318	"""COBL-like 1"""				Standard	NM_001278458		Approved	KIAA0977	uc002ucp.3	Q53SF7	OTTHUMG00000074019	ENST00000392717.2:c.1351C>T	2.37:g.165559719G>A	ENSP00000376478:p.Pro451Ser		A6NMZ3|Q6IQ33|Q7Z3I6|Q9BRH4|Q9UG88|Q9Y2I3	Missense_Mutation	SNP	pfam_Cordon-bleu_ubiquitin_domain,pfscan_WH2_dom	p.P479S	ENST00000392717.2	37	c.1435		2	.	.	.	.	.	.	.	.	.	.	G	8.141	0.785164	0.16189	.	.	ENSG00000082438	ENST00000342193;ENST00000392717;ENST00000194871	.	.	.	4.77	1.93	0.25924	.	0.326457	0.26851	N	0.022174	T	0.17874	0.0429	L	0.29908	0.895	0.19575	N	0.999967	P	0.42827	0.791	B	0.40864	0.342	T	0.06698	-1.0812	9	0.33940	T	0.23	-2.5093	3.1081	0.06348	0.2577:0.0:0.5422:0.2001	.	479	B7Z2P5	.	S	413;451;479	.	ENSP00000194871:P479S	P	-	1	0	COBLL1	165267965	0.793000	0.28825	0.234000	0.24042	0.012000	0.07955	0.883000	0.28200	0.696000	0.31696	0.650000	0.86243	CCT	COBLL1	-	NULL	ENSG00000082438		0.478	COBLL1-202	KNOWN	basic|appris_candidate	protein_coding	COBLL1	HGNC	protein_coding		-	0.00	37	0	G	NM_014900		165559719	-1	tier1	-	no_errors	ENST00000194871	ensembl	human	known	74_37	missense	29.27	29	12	SNP	0.276	A
COL4A3	1285	genome.wustl.edu	37	2	228111451	228111451	+	Silent	SNP	C	C	T			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr2:228111451C>T	ENST00000396578.3	+	7	600	c.438C>T	c.(436-438)atC>atT	p.I146I	AC097662.2_ENST00000437673.1_RNA|AC097662.2_ENST00000396588.2_RNA|AC097662.2_ENST00000439598.2_RNA|AC097662.2_ENST00000606119.1_RNA	NM_000091.4	NP_000082.2	Q01955	CO4A3_HUMAN	collagen, type IV, alpha 3 (Goodpasture antigen)	146	Triple-helical region.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|axon guidance (GO:0007411)|blood circulation (GO:0008015)|cell adhesion (GO:0007155)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|collagen catabolic process (GO:0030574)|endothelial cell apoptotic process (GO:0072577)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glomerular basement membrane development (GO:0032836)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell proliferation (GO:0008285)|negative regulation of endopeptidase activity (GO:0010951)|sensory perception of sound (GO:0007605)	basement membrane (GO:0005604)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)|integrin binding (GO:0005178)|metalloendopeptidase inhibitor activity (GO:0008191)|structural molecule activity (GO:0005198)			NS(4)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(24)|ovary(1)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	55		all_lung(227;0.00101)|Lung NSC(271;0.00278)|Renal(207;0.0112)|Ovarian(221;0.0129)|all_hematologic(139;0.211)|Esophageal squamous(248;0.247)		Epithelial(121;1.17e-46)|all cancers(144;6.87e-42)|Lung(261;0.0137)|LUSC - Lung squamous cell carcinoma(224;0.0187)		ACCCAGGGATCCCGGTAGGTT	0.438																																																	0													63.0	62.0	62.0					2																	228111451		1841	4086	5927	SO:0001819	synonymous_variant	0				CCDS42829.1	2q36-q37	2014-09-17			ENSG00000169031	ENSG00000169031		"""Collagens"""	2204	protein-coding gene	gene with protein product	"""tumstatin"""	120070				1737849	Standard	NM_000091		Approved		uc002vom.2	Q01955	OTTHUMG00000149891	ENST00000396578.3:c.438C>T	2.37:g.228111451C>T			Q53QQ1|Q53R14|Q53RW8|Q9BQT2|Q9NYC4|Q9UDJ9|Q9UDK9|Q9UDL0|Q9UDL1	Silent	SNP	pfam_Collagen,pfam_Collagen_VI_NC,superfamily_C-type_lectin_fold,smart_Collagen_VI_NC	p.I146	ENST00000396578.3	37	c.438	CCDS42829.1	2																																																																																			COL4A3	-	pfam_Collagen	ENSG00000169031		0.438	COL4A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL4A3	HGNC	protein_coding	OTTHUMT00000331409.2	-	0.00	48	0	C	NM_000091		228111451	+1	tier1	-	no_errors	ENST00000396578	ensembl	human	known	74_37	silent	25.00	45	15	SNP	0.785	T
CORO2B	10391	genome.wustl.edu	37	15	68987554	68987554	+	Missense_Mutation	SNP	T	T	A			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr15:68987554T>A	ENST00000566799.1	+	3	321	c.292T>A	c.(292-294)Ttc>Atc	p.F98I	CORO2B_ENST00000261861.5_Missense_Mutation_p.F93I|CORO2B_ENST00000543950.1_Missense_Mutation_p.F93I|CORO2B_ENST00000540068.1_Missense_Mutation_p.F93I			Q9UQ03	COR2B_HUMAN	coronin, actin binding protein, 2B	98					actin cytoskeleton organization (GO:0030036)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|membrane (GO:0016020)	actin binding (GO:0003779)|actin filament binding (GO:0051015)			kidney(3)|large_intestine(13)|lung(11)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	36						ATGGAACCCCTTCATCGACAA	0.592																																																	0													139.0	118.0	125.0					15																	68987554		2200	4298	6498	SO:0001583	missense	0			AB010098	CCDS53952.1, CCDS10229.2	15q22.31	2013-01-10	2001-11-28		ENSG00000103647	ENSG00000103647		"""Coronins"", ""WD repeat domain containing"""	2256	protein-coding gene	gene with protein product	"""clipin C"", ""coronin, actin-binding, 2B"""	605002	"""coronin, actin-binding protein, 2B"""			10224093, 10231032	Standard	NM_001190456		Approved	ClipinC, KIAA0925	uc021spj.1	Q9UQ03	OTTHUMG00000133288	ENST00000566799.1:c.292T>A	15.37:g.68987554T>A	ENSP00000454783:p.Phe98Ile		A8K0W3|O94767|Q8TAN1	Missense_Mutation	SNP	pfam_DUF1900,pfam_DUF1899,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.F98I	ENST00000566799.1	37	c.292	CCDS10229.2	15	.	.	.	.	.	.	.	.	.	.	T	23.5	4.422921	0.83559	.	.	ENSG00000103647	ENST00000261861;ENST00000540068;ENST00000543950	T;T	0.60424	0.19;0.19	5.14	4.01	0.46588	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.045821	0.85682	N	0.000000	T	0.71863	0.3390	M	0.71206	2.165	0.58432	D	0.999992	D	0.89917	1.0	D	0.97110	1.0	T	0.72010	-0.4419	10	0.54805	T	0.06	-34.6823	10.0744	0.42351	0.0:0.0809:0.0:0.9191	.	98	Q9UQ03	COR2B_HUMAN	I	98;93;93	ENSP00000446250:F93I;ENSP00000443819:F93I	ENSP00000261861:F98I	F	+	1	0	CORO2B	66774608	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.808000	0.86044	0.923000	0.37045	-0.388000	0.06559	TTC	CORO2B	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000103647		0.592	CORO2B-203	KNOWN	basic|CCDS	protein_coding	CORO2B	HGNC	protein_coding		-	0.00	22	0	T	NM_006091		68987554	+1	tier1	-	no_errors	ENST00000566799	ensembl	human	known	74_37	missense	29.17	17	7	SNP	1.000	A
CXADR	1525	genome.wustl.edu	37	21	18938008	18938008	+	Nonstop_Mutation	SNP	T	T	C			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr21:18938008T>C	ENST00000284878.7	+	7	1844	c.1096T>C	c.(1096-1098)Tag>Cag	p.*366Q	CXADR_ENST00000400169.1_Intron|CXADR_ENST00000306618.10_Nonstop_Mutation_p.*325Q|CXADR_ENST00000400166.1_3'UTR	NM_001338.4	NP_001329.1	P78310	CXAR_HUMAN	coxsackie virus and adenovirus receptor	0					actin cytoskeleton reorganization (GO:0031532)|AV node cell to bundle of His cell communication (GO:0086067)|blood coagulation (GO:0007596)|cardiac muscle fiber development (GO:0048739)|cell-cell junction organization (GO:0045216)|defense response to virus (GO:0051607)|epithelial structure maintenance (GO:0010669)|gamma-delta T cell activation (GO:0046629)|germ cell migration (GO:0008354)|heart development (GO:0007507)|heterophilic cell-cell adhesion (GO:0007157)|homotypic cell-cell adhesion (GO:0034109)|leukocyte migration (GO:0050900)|mitochondrion organization (GO:0007005)|neutrophil chemotaxis (GO:0030593)|regulation of immune response (GO:0050776)|transepithelial transport (GO:0070633)|viral process (GO:0016032)	acrosomal vesicle (GO:0001669)|adherens junction (GO:0005912)|apicolateral plasma membrane (GO:0016327)|basolateral plasma membrane (GO:0016323)|cell body (GO:0044297)|cell junction (GO:0030054)|cell-cell junction (GO:0005911)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|filopodium (GO:0030175)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|membrane raft (GO:0045121)|neuromuscular junction (GO:0031594)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|cell adhesion molecule binding (GO:0050839)|connexin binding (GO:0071253)|identical protein binding (GO:0042802)|integrin binding (GO:0005178)|PDZ domain binding (GO:0030165)|receptor binding (GO:0005102)|virus receptor activity (GO:0001618)			endometrium(2)|large_intestine(5)|lung(1)|ovary(1)|prostate(2)	11				Epithelial(23;0.000206)|all cancers(11;0.000302)|OV - Ovarian serous cystadenocarcinoma(11;0.0194)|Lung(58;0.0233)|COAD - Colon adenocarcinoma(22;0.0389)|Colorectal(24;0.0483)|LUSC - Lung squamous cell carcinoma(23;0.0782)		GTCTATAGTATAGAGCCTCCA	0.438																																																	0													43.0	43.0	43.0					21																	18938008		2201	4290	6491	SO:0001578	stop_lost	0			Y07593	CCDS33519.1, CCDS56204.1, CCDS56205.1, CCDS56206.1, CCDS56207.1	21q21.1	2013-01-29			ENSG00000154639	ENSG00000154639		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	2559	protein-coding gene	gene with protein product		602621				9036860, 9096397	Standard	NM_001338		Approved	CAR	uc002yki.3	P78310	OTTHUMG00000074508	ENST00000284878.7:c.1096T>C	21.37:g.18938008T>C	ENSP00000284878:p.*366Glnext*19		B2R8V8|B7WPI3|D3YHP0|O00694|Q8WWT6|Q8WWT7|Q8WWT8|Q9UKV4	Nonstop_Mutation	SNP	pfam_Ig_V-set,pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,pfscan_Ig-like_dom	p.*366Q	ENST00000284878.7	37	c.1096	CCDS33519.1	21	.	.	.	.	.	.	.	.	.	.	T	16.91	3.252488	0.59212	.	.	ENSG00000154639	ENST00000284878;ENST00000306618	.	.	.	5.43	5.43	0.79202	.	.	.	.	.	.	.	.	.	.	.	0.21527	N	0.999656	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.9905	0.71384	0.0:0.0:0.0:1.0	.	.	.	.	Q	366;325	.	.	X	+	1	0	CXADR	17859879	1.000000	0.71417	0.968000	0.41197	0.353000	0.29299	7.451000	0.80668	2.191000	0.70037	0.533000	0.62120	TAG	CXADR	-	NULL	ENSG00000154639		0.438	CXADR-001	KNOWN	basic|CCDS	protein_coding	CXADR	HGNC	protein_coding	OTTHUMT00000158209.1	-	0.00	40	0	T			18938008	+1	tier1	-	no_errors	ENST00000284878	ensembl	human	known	74_37	nonstop	30.77	26	12	SNP	0.999	C
CXCR4	7852	genome.wustl.edu	37	2	136872988	136872988	+	Silent	SNP	G	G	A			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr2:136872988G>A	ENST00000241393.3	-	2	614	c.510C>T	c.(508-510)ccC>ccT	p.P170P	CXCR4_ENST00000466288.1_5'UTR|CXCR4_ENST00000409817.1_Silent_p.P174P	NM_003467.2	NP_003458.1	P61073	CXCR4_HUMAN	chemokine (C-X-C motif) receptor 4	170					activation of MAPK activity (GO:0000187)|ameboidal cell migration (GO:0001667)|apoptotic process (GO:0006915)|brain development (GO:0007420)|calcium-mediated signaling (GO:0019722)|cellular response to cytokine stimulus (GO:0071345)|chemokine-mediated signaling pathway (GO:0070098)|dendritic cell chemotaxis (GO:0002407)|entry into host cell (GO:0030260)|G-protein coupled receptor signaling pathway (GO:0007186)|germ cell development (GO:0007281)|germ cell migration (GO:0008354)|inflammatory response (GO:0006954)|motor neuron axon guidance (GO:0008045)|myelin maintenance (GO:0043217)|neural precursor cell proliferation (GO:0061351)|neuron migration (GO:0001764)|neutrophil activation (GO:0042119)|patterning of blood vessels (GO:0001569)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of oligodendrocyte differentiation (GO:0048714)|regulation of cell migration (GO:0030334)|regulation of chemotaxis (GO:0050920)|response to hypoxia (GO:0001666)|response to virus (GO:0009615)|T cell proliferation (GO:0042098)|viral process (GO:0016032)	cell leading edge (GO:0031252)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|lysosome (GO:0005764)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|C-X-C chemokine receptor activity (GO:0016494)|coreceptor activity (GO:0015026)|G-protein coupled receptor activity (GO:0004930)|myosin light chain binding (GO:0032027)|ubiquitin binding (GO:0043130)|ubiquitin protein ligase binding (GO:0031625)|virus receptor activity (GO:0001618)			haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(14)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25				BRCA - Breast invasive adenocarcinoma(221;0.155)	Framycetin(DB00452)|Plerixafor(DB06809)	AGATGAAGTCGGGAATAGTCA	0.527																																																	0													153.0	132.0	139.0					2																	136872988		2203	4300	6503	SO:0001819	synonymous_variant	0			AF005058	CCDS33295.1, CCDS46420.1	2q21	2014-09-17	2002-08-22		ENSG00000121966	ENSG00000121966		"""CD molecules"", ""GPCR / Class A : Chemokine receptors : C-X-C motif"""	2561	protein-coding gene	gene with protein product		162643	"""chemokine (C-X-C motif), receptor 4 (fusin)"""			9599023, 9379028	Standard	NM_001008540		Approved	LESTR, NPY3R, HM89, NPYY3R, D2S201E, fusin, HSY3RR, NPYR, CD184	uc002tuz.3	P61073	OTTHUMG00000153583	ENST00000241393.3:c.510C>T	2.37:g.136872988G>A			B2R5N0|O60835|P30991|P56438|Q53S69|Q9BXA0|Q9UKN2	Silent	SNP	pfam_GPCR_Rhodpsn,pfam_Chemokine_CXCR4_N_dom,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Chemokine_CXCR4,prints_GPCR_Rhodpsn,prints_Chemokine_rcpt	p.P174	ENST00000241393.3	37	c.522	CCDS46420.1	2																																																																																			CXCR4	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000121966		0.527	CXCR4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CXCR4	HGNC	protein_coding	OTTHUMT00000331732.1	-	0.00	58	0	G			136872988	-1	tier1	-	no_errors	ENST00000409817	ensembl	human	known	74_37	silent	42.55	27	20	SNP	0.015	A
CYP2B6	1555	genome.wustl.edu	37	19	41515957	41515957	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr19:41515957C>T	ENST00000324071.4	+	6	888	c.881C>T	c.(880-882)tCg>tTg	p.S294L	CYP2B6_ENST00000593831.1_Intron|CYP2B6_ENST00000330446.5_Intron	NM_000767.4	NP_000758.1	P20813	CP2B6_HUMAN	cytochrome P450, family 2, subfamily B, polypeptide 6	294					cellular ketone metabolic process (GO:0042180)|drug metabolic process (GO:0017144)|exogenous drug catabolic process (GO:0042738)|oxidation-reduction process (GO:0055114)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen (GO:0016712)			NS(1)|breast(1)|endometrium(5)|kidney(1)|lung(14)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	28			LUSC - Lung squamous cell carcinoma(20;0.00322)		Amitriptyline(DB00321)|Amlodipine(DB00381)|Amprenavir(DB00701)|Antipyrine(DB01435)|Artemether(DB06697)|Atorvastatin(DB01076)|Azelastine(DB00972)|Benzphetamine(DB00865)|Benzyl alcohol(DB06770)|Bifonazole(DB04794)|Brompheniramine(DB00835)|Bupropion(DB01156)|Carbamazepine(DB00564)|Carbinoxamine(DB00748)|Cholecalciferol(DB00169)|Cinnarizine(DB00568)|Cisapride(DB00604)|Cisplatin(DB00515)|Citalopram(DB00215)|Clobazam(DB00349)|Clofibrate(DB00636)|Clopidogrel(DB00758)|Clotiazepam(DB01559)|Clotrimazole(DB00257)|Colchicine(DB01394)|Cyclophosphamide(DB00531)|Desipramine(DB01151)|Dexamethasone(DB01234)|Dextromethorphan(DB00514)|Diazepam(DB00829)|Diclofenac(DB00586)|Diphenhydramine(DB01075)|Domperidone(DB01184)|Doxorubicin(DB00997)|Efavirenz(DB00625)|Enzalutamide(DB08899)|Epinastine(DB00751)|Erythromycin(DB00199)|Estrone(DB00655)|Ethanol(DB00898)|Ethylmorphine(DB01466)|Flunarizine(DB04841)|Flunitrazepam(DB01544)|Fluoxetine(DB00472)|Fluvastatin(DB01095)|Fluvoxamine(DB00176)|Fosphenytoin(DB01320)|Halothane(DB01159)|Ifosfamide(DB01181)|Imipramine(DB00458)|Irinotecan(DB00762)|Isoflurane(DB00753)|Itraconazole(DB01167)|Ketamine(DB01221)|Ketobemidone(DB06738)|Ketoconazole(DB01026)|Lidocaine(DB00281)|Loperamide(DB00836)|Lopinavir(DB01601)|Lorcaserin(DB04871)|Malathion(DB00772)|Memantine(DB01043)|Methadone(DB00333)|Methimazole(DB00763)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyltestosterone(DB06710)|Mexiletine(DB00379)|Mianserin(DB06148)|Miconazole(DB01110)|Midazolam(DB00683)|Modafinil(DB00745)|Nelfinavir(DB00220)|Nevirapine(DB00238)|Nicardipine(DB00622)|Nicotine(DB00184)|Nifedipine(DB01115)|Nilotinib(DB04868)|Nitric Oxide(DB00435)|Orphenadrine(DB01173)|Ospemifene(DB04938)|Paroxetine(DB00715)|Perhexiline(DB01074)|Permethrin(DB04930)|Perphenazine(DB00850)|Pethidine(DB00454)|Phenobarbital(DB01174)|Phenytoin(DB00252)|Prasugrel(DB06209)|Primidone(DB00794)|Promethazine(DB01069)|Propofol(DB00818)|Quinidine(DB00908)|Raloxifene(DB00481)|Regorafenib(DB08896)|Rifampicin(DB01045)|Rilpivirine(DB08864)|Ritonavir(DB00503)|Ropivacaine(DB00296)|Roxithromycin(DB00778)|Selegiline(DB01037)|Sertraline(DB01104)|Sevoflurane(DB01236)|Simvastatin(DB00641)|Sorafenib(DB00398)|Sulfaphenazole(DB06729)|Sulfinpyrazone(DB01138)|Tamoxifen(DB00675)|Temazepam(DB00231)|Testosterone(DB00624)|Thiotepa(DB04572)|Ticlopidine(DB00208)|Tramadol(DB00193)|Tretinoin(DB00755)|Valproic Acid(DB00313)|Venlafaxine(DB00285)|Verapamil(DB00661)	AACACGCTCTCGCTCTTCTTT	0.582																																																	0													170.0	121.0	138.0					19																	41515957		2203	4300	6503	SO:0001583	missense	0			AF182277	CCDS12570.1	19q13.2	2013-07-25	2003-01-14		ENSG00000197408	ENSG00000197408		"""Cytochrome P450s"""	2615	protein-coding gene	gene with protein product		123930	"""cytochrome P450, subfamily IIB (phenobarbital-inducible), polypeptide 6"", ""cytochrome P450, family 2, subfamily B"", ""cytochrome P450, subfamily IIB (phenobarbital-inducible)"""	CYP2B		7668294, 15128046	Standard	NM_000767		Approved	CPB6, CYPIIB6	uc002opr.1	P20813	OTTHUMG00000182714	ENST00000324071.4:c.881C>T	19.37:g.41515957C>T	ENSP00000324648:p.Ser294Leu		B4DWP3|Q2V565|Q9UK46	Missense_Mutation	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_E_grp-I_CYP2B-like,prints_Cyt_P450,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450_E_grp-I_CYP2A-like	p.S294L	ENST00000324071.4	37	c.881	CCDS12570.1	19	.	.	.	.	.	.	.	.	.	.	.	24.3	4.511995	0.85389	.	.	ENSG00000197408	ENST00000324071	T	0.68181	-0.31	4.58	1.04	0.20106	.	0.222627	0.36555	N	0.002521	T	0.75860	0.3907	M	0.81341	2.54	0.09310	N	1	D	0.89917	1.0	D	0.78314	0.991	T	0.63332	-0.6661	10	0.87932	D	0	.	2.9495	0.05856	0.3145:0.4416:0.1533:0.0906	.	294	P20813	CP2B6_HUMAN	L	294	ENSP00000324648:S294L	ENSP00000324648:S294L	S	+	2	0	CYP2B6	46207797	0.000000	0.05858	0.075000	0.20258	0.903000	0.53119	0.548000	0.23314	0.563000	0.29222	0.550000	0.68814	TCG	CYP2B6	-	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I	ENSG00000197408		0.582	CYP2B6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP2B6	HGNC	protein_coding	OTTHUMT00000463260.1	-	0.00	114	0	C	NM_000767		41515957	+1	tier1	-	no_errors	ENST00000324071	ensembl	human	known	74_37	missense	49.57	58	57	SNP	0.001	T
DAAM1	23002	genome.wustl.edu	37	14	59834304	59834304	+	Missense_Mutation	SNP	G	G	A	rs199742099		TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr14:59834304G>A	ENST00000395125.1	+	24	3037	c.3014G>A	c.(3013-3015)cGc>cAc	p.R1005H	DAAM1_ENST00000553966.1_3'UTR|DAAM1_ENST00000360909.3_Missense_Mutation_p.R995H|DAAM1_ENST00000351081.1_Missense_Mutation_p.R1005H	NM_014992.2	NP_055807.1	Q9Y4D1	DAAM1_HUMAN	dishevelled associated activator of morphogenesis 1	1005	FH2. {ECO:0000255|PROSITE- ProRule:PRU00774}.				actin cytoskeleton organization (GO:0030036)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)|stress fiber (GO:0001725)	identical protein binding (GO:0042802)			breast(3)|cervix(3)|endometrium(5)|kidney(5)|large_intestine(4)|lung(7)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	37				OV - Ovarian serous cystadenocarcinoma(108;0.165)		CGTCGAGCTCGCATGGAAGCT	0.418																																																	0								G	HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	87.0	82.0	84.0		3014	5.9	1.0	14		84	1,8599	1.2+/-3.3	0,1,4299	no	missense	DAAM1	NM_014992.1	29	0,2,6501	AA,AG,GG		0.0116,0.0227,0.0154	probably-damaging	1005/1079	59834304	2,13004	2203	4300	6503	SO:0001583	missense	0			AB014566	CCDS9737.1, CCDS58323.1	14q22.3	2008-08-11			ENSG00000100592	ENSG00000100592			18142	protein-coding gene	gene with protein product		606626				11779461, 18162551	Standard	NM_014992		Approved	KIAA0666	uc031qou.1	Q9Y4D1	OTTHUMG00000140326	ENST00000395125.1:c.3014G>A	14.37:g.59834304G>A	ENSP00000378557:p.Arg1005His		Q86U34|Q8N1Z8|Q8TB39	Missense_Mutation	SNP	pfam_FH2_Formin,pfam_FH3_dom,pfam_GTPase-bd,superfamily_ARM-type_fold,superfamily_tRNA-bd_arm,smart_FH2_Formin	p.R1005H	ENST00000395125.1	37	c.3014	CCDS9737.1	14	.	.	.	.	.	.	.	.	.	.	G	25.8	4.675546	0.88445	2.27E-4	1.16E-4	ENSG00000100592	ENST00000360909;ENST00000351081;ENST00000395125	T;T;T	0.81330	-1.48;-1.47;-1.47	5.87	5.87	0.94306	Actin-binding FH2/DRF autoregulatory (1);Actin-binding FH2 (1);	0.103249	0.64402	D	0.000003	D	0.90841	0.7123	M	0.85373	2.75	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.66351	0.923;0.943	D	0.90728	0.4640	10	0.62326	D	0.03	.	20.5827	0.99408	0.0:0.0:1.0:0.0	.	995;1005	Q9Y4D1-2;Q9Y4D1	.;DAAM1_HUMAN	H	995;1005;1005	ENSP00000354162:R995H;ENSP00000247170:R1005H;ENSP00000378557:R1005H	ENSP00000247170:R1005H	R	+	2	0	DAAM1	58904057	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.289000	0.72696	2.941000	0.99782	0.655000	0.94253	CGC	DAAM1	-	smart_FH2_Formin	ENSG00000100592		0.418	DAAM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DAAM1	HGNC	protein_coding	OTTHUMT00000276942.2	-	0.00	24	0	G	NM_014992		59834304	+1	tier1	rs199742099	no_errors	ENST00000351081	ensembl	human	known	74_37	missense	40.00	21	14	SNP	1.000	A
DDX39B	7919	genome.wustl.edu	37	6	31498374	31498374	+	Intron	SNP	G	G	A			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr6:31498374G>A	ENST00000396172.1	-	11	1901				ATP6V1G2-DDX39B_ENST00000376185.1_Intron|DDX39B_ENST00000417556.2_Intron|DDX39B_ENST00000376177.2_Intron|DDX39B_ENST00000458640.1_Intron|DDX39B_ENST00000415382.2_Intron|DDX39B_ENST00000462421.1_5'UTR	NM_004640.6	NP_004631.1	Q13838	DX39B_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 39B						ATP catabolic process (GO:0006200)|mRNA export from nucleus (GO:0006406)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of DNA damage checkpoint (GO:2000002)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|RNA secondary structure unwinding (GO:0010501)|RNA splicing (GO:0008380)|spliceosomal complex assembly (GO:0000245)|viral mRNA export from host cell nucleus (GO:0046784)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|transcription export complex (GO:0000346)	ATP binding (GO:0005524)|ATP-dependent protein binding (GO:0043008)|ATP-dependent RNA helicase activity (GO:0004004)|poly(A) RNA binding (GO:0044822)|RNA-dependent ATPase activity (GO:0008186)|U4 snRNA binding (GO:0030621)|U6 snRNA binding (GO:0017070)			NS(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	19						TATGATGAGAGAAGACAAGAC	0.512																																																	0																																										SO:0001627	intron_variant	0			Z37166	CCDS4697.1	6p21.33	2011-02-09	2011-02-08	2011-02-08	ENSG00000198563	ENSG00000198563		"""DEAD-boxes"""	13917	protein-coding gene	gene with protein product	"""U2AF65-associated protein 56"""	142560	"""HLA-B associated transcript 1"""	BAT1		7601445, 2813433	Standard	NM_004640		Approved	D6S81E, UAP56	uc003ntu.3	Q13838	OTTHUMG00000031165	ENST00000396172.1:c.1271-147C>T	6.37:g.31498374G>A			B0S8C0|O43496|Q0EFA1|Q2L6F9|Q53GL9|Q5RJ64|Q5RJ66|Q5ST94|Q5STB4|Q5STB5|Q5STB7|Q5STB8|Q5STU4|Q5STU5|Q5STU6|Q5STU8|Q71V76	RNA	SNP	-	NULL	ENST00000396172.1	37	NULL	CCDS4697.1	6																																																																																			DDX39B	-	-	ENSG00000198563		0.512	DDX39B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX39B	HGNC	protein_coding	OTTHUMT00000259083.1	-	0.00	15	0	G	NM_004640		31498374	-1	tier1	-	no_errors	ENST00000462421	ensembl	human	putative	74_37	rna	55.56	8	10	SNP	0.000	A
DDAH2	23564	genome.wustl.edu	37	6	31696815	31696815	+	Nonsense_Mutation	SNP	G	G	A			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr6:31696815G>A	ENST00000375789.2	-	1	754	c.124C>T	c.(124-126)Caa>Taa	p.Q42*	DDAH2_ENST00000375787.2_Nonsense_Mutation_p.Q42*|DDAH2_ENST00000480913.1_Intron|DDAH2_ENST00000375792.3_Nonsense_Mutation_p.Q42*			O95865	DDAH2_HUMAN	dimethylarginine dimethylaminohydrolase 2	42					arginine catabolic process (GO:0006527)|citrulline metabolic process (GO:0000052)|negative regulation of apoptotic process (GO:0043066)|nitric oxide biosynthetic process (GO:0006809)|nitric oxide mediated signal transduction (GO:0007263)|positive regulation of nitric oxide biosynthetic process (GO:0045429)	extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	amino acid binding (GO:0016597)|catalytic activity (GO:0003824)|dimethylargininase activity (GO:0016403)			endometrium(1)|large_intestine(3)|lung(5)|prostate(1)|upper_aerodigestive_tract(1)	11					L-Citrulline(DB00155)	TGCTCCCTTTGAGCTTTGGCC	0.662																																																	0													93.0	68.0	77.0					6																	31696815		1511	2709	4220	SO:0001587	stop_gained	0			AF070667	CCDS4718.1	6p21	2010-02-17			ENSG00000213722	ENSG00000213722	3.5.3.18		2716	protein-coding gene	gene with protein product		604744				10493931	Standard	XM_005248974		Approved		uc003nwq.3	O95865	OTTHUMG00000031212	ENST00000375789.2:c.124C>T	6.37:g.31696815G>A	ENSP00000364945:p.Gln42*		A2BEZ7	Nonsense_Mutation	SNP	pfam_Amidino_trans	p.Q42*	ENST00000375789.2	37	c.124	CCDS4718.1	6	.	.	.	.	.	.	.	.	.	.	G	38	7.195339	0.98129	.	.	ENSG00000213722	ENST00000375789;ENST00000375787;ENST00000375792;ENST00000416410;ENST00000436437	.	.	.	5.1	5.1	0.69264	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-1.9682	16.0632	0.80853	0.0:0.0:1.0:0.0	.	.	.	.	X	42	.	.	Q	-	1	0	DDAH2	31804794	1.000000	0.71417	1.000000	0.80357	0.914000	0.54420	4.301000	0.59086	2.641000	0.89580	0.650000	0.86243	CAA	DDAH2	-	NULL	ENSG00000213722		0.662	DDAH2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	DDAH2	HGNC	protein_coding	OTTHUMT00000076432.2	-	0.00	52	0	G			31696815	-1	tier1	-	no_errors	ENST00000375787	ensembl	human	known	74_37	nonsense	14.81	46	8	SNP	1.000	A
DECR2	26063	genome.wustl.edu	37	16	460221	460221	+	Intron	SNP	C	C	T			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr16:460221C>T	ENST00000219481.5	+	5	475				DECR2_ENST00000424398.2_Intron|DECR2_ENST00000397710.1_Missense_Mutation_p.S168F|DECR2_ENST00000461947.1_Intron	NM_020664.3	NP_065715.1	Q9NUI1	DECR2_HUMAN	2,4-dienoyl CoA reductase 2, peroxisomal						unsaturated fatty acid biosynthetic process (GO:0006636)	peroxisomal membrane (GO:0005778)	2,4-dienoyl-CoA reductase (NADPH) activity (GO:0008670)|receptor binding (GO:0005102)|trans-2-enoyl-CoA reductase (NADPH) activity (GO:0019166)			central_nervous_system(1)|endometrium(3)|large_intestine(1)|lung(4)	9		Hepatocellular(16;0.00015)				TCCAGCAGCTCCTGCGGTCTC	0.662																																																	0													29.0	26.0	27.0					16																	460221		2200	4299	6499	SO:0001627	intron_variant	0			AJ293009	CCDS10409.1	16p13.3	2011-09-14			ENSG00000242612	ENSG00000242612	1.3.1.34	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 1"""	2754	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 17C, member 1"""	615839				11514237, 19027726	Standard	NM_020664		Approved	PDCR, SDR17C1	uc002chb.3	Q9NUI1	OTTHUMG00000047846	ENST00000219481.5:c.338-22C>T	16.37:g.460221C>T			Q6ZRS7|Q96ET0	Missense_Mutation	SNP	pfam_DH_sc/Rdtase_SDR	p.S168F	ENST00000219481.5	37	c.503	CCDS10409.1	16	.	.	.	.	.	.	.	.	.	.	C	11.41	1.630888	0.28978	.	.	ENSG00000242612	ENST00000397710	.	.	.	4.93	-9.51	0.00581	.	.	.	.	.	T	0.23572	0.0570	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.40534	-0.9558	5	0.87932	D	0	.	1.2878	0.02054	0.1686:0.3088:0.2683:0.2543	.	.	.	.	F	168	.	ENSP00000380822:S168F	S	+	2	0	DECR2	400222	0.000000	0.05858	0.000000	0.03702	0.050000	0.14768	-2.636000	0.00867	-1.685000	0.01441	-0.218000	0.12543	TCC	DECR2	-	NULL	ENSG00000242612		0.662	DECR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DECR2	HGNC	protein_coding	OTTHUMT00000109069.4	-	0.00	37	0	C	NM_020664		460221	+1	tier1	-	no_errors	ENST00000397710	ensembl	human	known	74_37	missense	43.48	13	10	SNP	0.000	T
DIP2A	23181	genome.wustl.edu	37	21	47970533	47970533	+	Silent	SNP	C	C	T	rs369236341		TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr21:47970533C>T	ENST00000417564.2	+	23	2736	c.2715C>T	c.(2713-2715)ctC>ctT	p.L905L	DIP2A_ENST00000318711.7_Silent_p.L906L|DIP2A_ENST00000400274.1_Silent_p.L901L|DIP2A_ENST00000427143.2_Silent_p.L841L			Q14689	DIP2A_HUMAN	DIP2 disco-interacting protein 2 homolog A (Drosophila)	905					multicellular organismal development (GO:0007275)|negative regulation of gene expression (GO:0010629)|regulation of apoptotic process (GO:0042981)	cell surface (GO:0009986)|nucleus (GO:0005634)	catalytic activity (GO:0003824)			cervix(1)|endometrium(7)|kidney(2)|large_intestine(6)|lung(22)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	Breast(49;0.0933)			Epithelial(3;3.12e-06)|OV - Ovarian serous cystadenocarcinoma(3;5.68e-06)|all cancers(3;4.08e-05)|Colorectal(79;0.0129)|COAD - Colon adenocarcinoma(84;0.0824)		AGGCTCCTCTCGGAGGGATTC	0.557																																																	0								C	,,	1,4007		0,1,2003	65.0	67.0	66.0		2523,2703,2715	-10.5	0.0	21		66	0,8364		0,0,4182	no	coding-synonymous,coding-synonymous,coding-synonymous	DIP2A	NM_001146114.1,NM_001146116.1,NM_015151.3	,,	0,1,6185	TT,TC,CC		0.0,0.025,0.0081	,,	841/1111,901/1568,905/1572	47970533	1,12371	2004	4182	6186	SO:0001819	synonymous_variant	0			AF490768	CCDS46655.1, CCDS46656.1, CCDS46657.1, CCDS54490.1, CCDS54491.1	21q22.3	2010-08-20	2006-01-13	2006-01-13	ENSG00000160305	ENSG00000160305			17217	protein-coding gene	gene with protein product		607711	"""chromosome 21 open reading frame 106"""	C21orf106			Standard	NM_015151		Approved	Dip2, KIAA0184	uc002zjo.2	Q14689	OTTHUMG00000090717	ENST00000417564.2:c.2715C>T	21.37:g.47970533C>T			A6P4T3|B4E0F0|E7EMA5|Q8IVA3|Q8N4S2|Q8TD89|Q96ML9	Silent	SNP	pfam_AMP-dep_Synth/Lig,pfam_DMAP1-bd	p.L906	ENST00000417564.2	37	c.2718	CCDS46655.1	21																																																																																			DIP2A	-	NULL	ENSG00000160305		0.557	DIP2A-012	KNOWN	basic|CCDS	protein_coding	DIP2A	HGNC	protein_coding	OTTHUMT00000376736.1	-	0.00	67	0	C	NM_015151		47970533	+1	tier1	-	no_errors	ENST00000318711	ensembl	human	known	74_37	silent	30.23	30	13	SNP	0.003	T
DNAH8	1769	genome.wustl.edu	37	6	38743696	38743696	+	Missense_Mutation	SNP	T	T	C			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr6:38743696T>C	ENST00000359357.3	+	11	1534	c.1280T>C	c.(1279-1281)tTa>tCa	p.L427S	DNAH8_ENST00000441566.1_Missense_Mutation_p.L427S|DNAH8_ENST00000449981.2_Missense_Mutation_p.L644S			Q96JB1	DYH8_HUMAN	dynein, axonemal, heavy chain 8	427					cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(7)|breast(9)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(16)|large_intestine(44)|liver(4)|lung(101)|ovary(7)|pancreas(2)|prostate(8)|skin(28)|stomach(4)|upper_aerodigestive_tract(6)|urinary_tract(4)	260						ACAGATTTCTTAGATTTCATG	0.303																																																	0													82.0	96.0	91.0					6																	38743696		2200	4281	6481	SO:0001583	missense	0			Z83806	CCDS75447.1	6p21.2	2012-04-19	2006-09-04		ENSG00000124721	ENSG00000124721		"""Axonemal dyneins"""	2952	protein-coding gene	gene with protein product		603337	"""dynein, axonemal, heavy polypeptide 8"""			9373155	Standard	NM_001206927		Approved	hdhc9	uc021yzh.1	Q96JB1	OTTHUMG00000016253	ENST00000359357.3:c.1280T>C	6.37:g.38743696T>C	ENSP00000352312:p.Leu427Ser		O00438|Q5JYI2|Q5T2M3|Q5T2M4|Q5TG00|Q9UEM4	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.L427S	ENST00000359357.3	37	c.1280		6	.	.	.	.	.	.	.	.	.	.	T	0.008	-1.913763	0.00503	.	.	ENSG00000124721	ENST00000449981;ENST00000327475;ENST00000359357;ENST00000441566	T;T;T;T	0.65549	-0.16;0.55;0.55;0.55	5.77	0.706	0.18133	Dynein heavy chain, domain-1 (1);	1.117230	0.06766	N	0.782738	T	0.23370	0.0565	L	0.34521	1.04	0.09310	N	1	B	0.02656	0.0	B	0.08055	0.003	T	0.23297	-1.0192	10	0.09590	T	0.72	.	9.2328	0.37448	0.0:0.3825:0.0:0.6175	.	427	Q96JB1	DYH8_HUMAN	S	632;632;427;427	ENSP00000415331:L632S;ENSP00000333363:L632S;ENSP00000352312:L427S;ENSP00000402294:L427S	ENSP00000333363:L632S	L	+	2	0	DNAH8	38851674	0.016000	0.18221	0.072000	0.20136	0.013000	0.08279	0.544000	0.23253	-0.084000	0.12595	-0.924000	0.02725	TTA	DNAH8	-	pfam_Dynein_heavy_dom-1	ENSG00000124721		0.303	DNAH8-001	KNOWN	basic|appris_principal	protein_coding	DNAH8	HGNC	protein_coding	OTTHUMT00000043574.1		0.00	44	0	T	NM_001206927		38743696	+1			no_errors	ENST00000359357	ensembl	human	known	74_37	missense	11.11	32	4	SNP	0.072	C
DNM1	1759	genome.wustl.edu	37	9	130996366	130996366	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr9:130996366G>A	ENST00000372923.3	+	11	1494	c.1402G>A	c.(1402-1404)Gag>Aag	p.E468K	DNM1_ENST00000341179.7_Missense_Mutation_p.E468K|DNM1_ENST00000475805.1_Missense_Mutation_p.E468K|DNM1_ENST00000393594.3_Missense_Mutation_p.E468K|DNM1_ENST00000486160.1_Missense_Mutation_p.E468K	NM_004408.2	NP_004399.2	Q05193	DYN1_HUMAN	dynamin 1	468					endocytosis (GO:0006897)|endosome organization (GO:0007032)|GTP catabolic process (GO:0006184)|receptor internalization (GO:0031623)|receptor-mediated endocytosis (GO:0006898)	extracellular vesicular exosome (GO:0070062)|membrane coat (GO:0030117)|microtubule (GO:0005874)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(15)|lung(6)|ovary(2)|urinary_tract(2)	32						CCGGGAGCGCGAGGGCCGCAC	0.701																																					GBM(113;146 1575 2722 28670 29921)												0													20.0	18.0	19.0					9																	130996366		2173	4271	6444	SO:0001583	missense	0			L07807	CCDS6895.1, CCDS43882.1, CCDS75911.1, CCDS75912.1	9q34	2013-01-10			ENSG00000106976	ENSG00000106976		"""Pleckstrin homology (PH) domain containing"""	2972	protein-coding gene	gene with protein product		602377		DNM		2144893, 9143509	Standard	XM_005251763		Approved		uc022bob.1	Q05193	OTTHUMG00000020733	ENST00000372923.3:c.1402G>A	9.37:g.130996366G>A	ENSP00000362014:p.Glu468Lys		A6NLM6|Q5SYX0|Q5SYX2|Q6P3T6|Q86VD2	Missense_Mutation	SNP	pfam_Dynamin_central,pfam_Dynamin_GTPase,pfam_GED,pfam_Pleckstrin_homology,superfamily_P-loop_NTPase,smart_Dynamin_GTPase,smart_Pleckstrin_homology,smart_GED,pfscan_Pleckstrin_homology,prints_Dynamin_SF	p.E468K	ENST00000372923.3	37	c.1402	CCDS6895.1	9	.	.	.	.	.	.	.	.	.	.	G	25.0	4.591817	0.86953	.	.	ENSG00000106976	ENST00000475805;ENST00000341179;ENST00000372923;ENST00000393589;ENST00000393594;ENST00000486160;ENST00000543158	T;T;T;T;T	0.73363	-0.74;-0.74;-0.74;-0.74;-0.74	5.0	5.0	0.66597	Dynamin central domain (1);Pleckstrin homology-type (1);	0.000000	0.85682	D	0.000000	T	0.75391	0.3843	M	0.83692	2.655	0.80722	D	1	P;P;B	0.43909	0.821;0.785;0.043	B;B;B	0.35312	0.2;0.127;0.012	T	0.80320	-0.1432	10	0.45353	T	0.12	-6.2815	18.2964	0.90147	0.0:0.0:1.0:0.0	.	468;468;468	Q05193;Q05193-3;Q05193-2	DYN1_HUMAN;.;.	K	468;468;468;463;468;468;13	ENSP00000419225:E468K;ENSP00000345680:E468K;ENSP00000362014:E468K;ENSP00000377219:E468K;ENSP00000420045:E468K	ENSP00000345680:E468K	E	+	1	0	DNM1	130036187	1.000000	0.71417	0.981000	0.43875	0.977000	0.68977	9.468000	0.97676	2.304000	0.77564	0.455000	0.32223	GAG	DNM1	-	pfam_Dynamin_central	ENSG00000106976		0.701	DNM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DNM1	HGNC	protein_coding	OTTHUMT00000054367.1	-	0.00	62	0	G	NM_004408		130996366	+1	tier1	-	no_errors	ENST00000372923	ensembl	human	known	74_37	missense	36.84	24	14	SNP	1.000	A
DOK4	55715	genome.wustl.edu	37	16	57513551	57513551	+	5'UTR	SNP	C	C	G			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr16:57513551C>G	ENST00000340099.4	-	0	240				DOK4_ENST00000566936.1_5'UTR|DOK4_ENST00000569548.1_5'UTR|DOK4_ENST00000561918.1_5'UTR	NM_018110.3	NP_060580.2	Q8TEW6	DOK4_HUMAN	docking protein 4						MAPK cascade (GO:0000165)|nervous system development (GO:0007399)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)		receptor signaling protein activity (GO:0005057)			kidney(1)|large_intestine(1)|lung(1)|skin(1)|urinary_tract(2)	6						GGCTGCTCCTCACCTCACCCG	0.602																																																	0																																										SO:0001623	5_prime_UTR_variant	0			BC003541	CCDS10783.1	16q13	2013-01-10			ENSG00000125170	ENSG00000125170		"""Pleckstrin homology (PH) domain containing"""	19868	protein-coding gene	gene with protein product		608333				10493829	Standard	NM_018110		Approved	FLJ10488	uc002elv.4	Q8TEW6	OTTHUMG00000133460	ENST00000340099.4:c.-132G>C	16.37:g.57513551C>G			O75209|Q9BTP2|Q9NVV3	RNA	SNP	-	NULL	ENST00000340099.4	37	NULL	CCDS10783.1	16																																																																																			DOK4	-	-	ENSG00000125170		0.602	DOK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOK4	HGNC	protein_coding	OTTHUMT00000257335.3	-	0.00	104	0	C			57513551	-1	tier1	-	no_errors	ENST00000561918	ensembl	human	known	74_37	rna	28.74	62	25	SNP	1.000	G
DSPP	1834	genome.wustl.edu	37	4	88536238	88536238	+	Silent	SNP	T	T	C	rs555978267	byFrequency	TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr4:88536238T>C	ENST00000282478.7	+	4	2457	c.2424T>C	c.(2422-2424)gaT>gaC	p.D808D	RP11-742B18.1_ENST00000506480.1_RNA|DSPP_ENST00000399271.1_Silent_p.D808D			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	808	Asp/Ser-rich.				biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		acagcagtgatagcagtgata	0.488																																																	0													98.0	115.0	109.0					4																	88536238		1660	2960	4620	SO:0001819	synonymous_variant	0			AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.2424T>C	4.37:g.88536238T>C			A8MUI0|O95815	Silent	SNP	NULL	p.D808	ENST00000282478.7	37	c.2424	CCDS43248.1	4																																																																																			DSPP	-	NULL	ENSG00000152591		0.488	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	DSPP	HGNC	protein_coding	OTTHUMT00000363616.3	-	0.00	176	0	T	NM_014208		88536238	+1	tier1	-	no_errors	ENST00000282478	ensembl	human	known	74_37	silent	5.04	113	6	SNP	0.012	C
DSPP	1834	genome.wustl.edu	37	4	88536271	88536271	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr4:88536271C>A	ENST00000282478.7	+	4	2490	c.2457C>A	c.(2455-2457)gaC>gaA	p.D819E	RP11-742B18.1_ENST00000506480.1_RNA|DSPP_ENST00000399271.1_Missense_Mutation_p.D819E			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	819	Asp/Ser-rich.				biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		gtgatagcgacagcagcaata	0.507																																																	0													96.0	117.0	110.0					4																	88536271		1644	2955	4599	SO:0001583	missense	0			AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.2457C>A	4.37:g.88536271C>A	ENSP00000282478:p.Asp819Glu		A8MUI0|O95815	Missense_Mutation	SNP	NULL	p.D819E	ENST00000282478.7	37	c.2457	CCDS43248.1	4	.	.	.	.	.	.	.	.	.	.	c	2.350	-0.349120	0.05208	.	.	ENSG00000152591	ENST00000399271;ENST00000282478	D;D	0.87887	-2.31;-2.31	1.11	0.169	0.15017	.	.	.	.	.	T	0.77219	0.4098	L	0.43923	1.385	0.09310	N	1	B	0.31655	0.334	B	0.20384	0.029	T	0.65845	-0.6069	9	0.62326	D	0.03	.	3.5268	0.07762	0.0:0.7069:0.0:0.2931	.	819	Q9NZW4	DSPP_HUMAN	E	819	ENSP00000382213:D819E;ENSP00000282478:D819E	ENSP00000282478:D819E	D	+	3	2	DSPP	88755295	0.001000	0.12720	0.000000	0.03702	0.002000	0.02628	-0.493000	0.06459	0.034000	0.15491	0.165000	0.16767	GAC	DSPP	-	NULL	ENSG00000152591		0.507	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	DSPP	HGNC	protein_coding	OTTHUMT00000363616.3	-	0.00	176	0	C	NM_014208		88536271	+1	tier1	-	no_errors	ENST00000282478	ensembl	human	known	74_37	missense	5.88	96	6	SNP	0.000	A
DYNC2H1	79659	genome.wustl.edu	37	11	103158284	103158284	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr11:103158284G>C	ENST00000375735.2	+	75	11189	c.11045G>C	c.(11044-11046)aGa>aCa	p.R3682T	DYNC2H1_ENST00000398093.3_Missense_Mutation_p.R3689T|DYNC2H1_ENST00000334267.7_Intron	NM_001080463.1|NM_001377.2	NP_001073932.1|NP_001368.2	Q8NCM8	DYHC2_HUMAN	dynein, cytoplasmic 2, heavy chain 1	3682					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|asymmetric protein localization (GO:0008105)|cilium assembly (GO:0042384)|determination of left/right symmetry (GO:0007368)|dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|forebrain development (GO:0030900)|Golgi organization (GO:0007030)|intraciliary retrograde transport (GO:0035721)|positive regulation of smoothened signaling pathway (GO:0045880)|protein processing (GO:0016485)|spinal cord motor neuron differentiation (GO:0021522)	apical part of cell (GO:0045177)|axoneme (GO:0005930)|cytosol (GO:0005829)|dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|motile primary cilium (GO:0031512)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(1)|endometrium(4)|kidney(5)|large_intestine(9)|lung(9)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)	33		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00348)		BRCA - Breast invasive adenocarcinoma(274;0.000177)|Epithelial(105;0.0785)		CAGGCGCTAAGACCGGACAGA	0.333																																																	0													96.0	90.0	92.0					11																	103158284		1827	4081	5908	SO:0001583	missense	0			AB082528	CCDS44717.1, CCDS53701.1	11q21-q22.1	2011-06-02	2005-11-24	2005-11-24	ENSG00000187240	ENSG00000187240		"""Cytoplasmic dyneins"""	2962	protein-coding gene	gene with protein product		603297	"""dynein, cytoplasmic, heavy polypeptide 2"""	DNCH2		9763680, 9373155	Standard	NM_001080463		Approved	hdhc11, DHC2, DHC1b, DYH1B	uc001phn.1	Q8NCM8	OTTHUMG00000165941	ENST00000375735.2:c.11045G>C	11.37:g.103158284G>C	ENSP00000364887:p.Arg3682Thr		O00432|Q16693|Q3C1U8|Q4AC93|Q6ZMX7|Q6ZUM6|Q7Z363|Q8N977|Q92815|Q9HAE4	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,pfam_Dynein_heavy_dom-1,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.R3689T	ENST00000375735.2	37	c.11066	CCDS53701.1	11	.	.	.	.	.	.	.	.	.	.	G	28.1	4.892712	0.91889	.	.	ENSG00000187240	ENST00000375735;ENST00000398093	T;T	0.18657	2.2;2.2	5.79	5.79	0.91817	Dynein heavy chain (1);	0.000000	0.85682	D	0.000000	T	0.58380	0.2118	M	0.91818	3.245	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.996	T	0.66292	-0.5960	10	0.72032	D	0.01	.	19.6264	0.95679	0.0:0.0:1.0:0.0	.	3682;3689	Q8NCM8;Q8NCM8-2	DYHC2_HUMAN;.	T	3682;3689	ENSP00000364887:R3682T;ENSP00000381167:R3689T	ENSP00000364887:R3682T	R	+	2	0	DYNC2H1	102663494	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.711000	0.84669	2.746000	0.94184	0.655000	0.94253	AGA	DYNC2H1	-	pfam_Dynein_heavy_dom	ENSG00000187240		0.333	DYNC2H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DYNC2H1	HGNC	protein_coding	OTTHUMT00000387196.1	-	0.00	42	0	G	XM_370652		103158284	+1	tier1	-	no_errors	ENST00000398093	ensembl	human	known	74_37	missense	67.86	9	19	SNP	1.000	C
E2F3	1871	genome.wustl.edu	37	6	20490452	20490452	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr6:20490452C>G	ENST00000346618.3	+	7	1255	c.1189C>G	c.(1189-1191)Ctt>Gtt	p.L397V	E2F3_ENST00000535432.1_Missense_Mutation_p.L266V	NM_001949.4	NP_001940.1	O00716	E2F3_HUMAN	E2F transcription factor 3	397	Transactivation. {ECO:0000255}.				mitotic cell cycle (GO:0000278)|Notch signaling pathway (GO:0007219)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	core promoter binding (GO:0001047)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(3)	7	all_cancers(95;0.154)|all_epithelial(95;0.0585)|Breast(50;0.146)|Ovarian(93;0.148)		OV - Ovarian serous cystadenocarcinoma(7;0.0068)|all cancers(50;0.0148)|Epithelial(50;0.0562)			TATGGGAAACCTTTCTCCTCT	0.443																																																	0													72.0	70.0	71.0					6																	20490452		2203	4300	6503	SO:0001583	missense	0			Y10479	CCDS4545.1, CCDS58999.1	6p22	2008-08-29			ENSG00000112242	ENSG00000112242			3115	protein-coding gene	gene with protein product		600427				8246996	Standard	NM_001949		Approved		uc003nda.2	O00716	OTTHUMG00000016389	ENST00000346618.3:c.1189C>G	6.37:g.20490452C>G	ENSP00000262904:p.Leu397Val		Q15000|Q68DT0|Q9BZ44	Missense_Mutation	SNP	pfam_E2F_TDP	p.L397V	ENST00000346618.3	37	c.1189	CCDS4545.1	6	.	.	.	.	.	.	.	.	.	.	C	11.03	1.518998	0.27211	.	.	ENSG00000112242	ENST00000346618;ENST00000535432	T;T	0.08984	3.03;3.13	5.49	5.49	0.81192	.	0.251802	0.40469	N	0.001094	T	0.03305	0.0096	L	0.48362	1.52	0.39606	D	0.9698	B	0.30584	0.286	B	0.25884	0.064	T	0.38824	-0.9643	10	0.16420	T	0.52	.	12.8237	0.57708	0.2697:0.7303:0.0:0.0	.	397	O00716	E2F3_HUMAN	V	397;266	ENSP00000262904:L397V;ENSP00000443418:L266V	ENSP00000262904:L397V	L	+	1	0	E2F3	20598431	0.308000	0.24509	0.998000	0.56505	0.978000	0.69477	0.451000	0.21779	2.746000	0.94184	0.561000	0.74099	CTT	E2F3	-	NULL	ENSG00000112242		0.443	E2F3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	E2F3	HGNC	protein_coding	OTTHUMT00000043828.1	-	0.00	83	0	C			20490452	+1	tier1	-	no_errors	ENST00000346618	ensembl	human	known	74_37	missense	37.84	46	28	SNP	0.960	G
EAF2	55840	genome.wustl.edu	37	3	121591519	121591519	+	Missense_Mutation	SNP	C	C	G	rs200859609	byFrequency	TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr3:121591519C>G	ENST00000273668.2	+	5	691	c.620C>G	c.(619-621)tCt>tGt	p.S207C	EAF2_ENST00000451944.2_Missense_Mutation_p.S207C	NM_018456.4	NP_060926.2	Q96CJ1	EAF2_HUMAN	ELL associated factor 2	207	Necessary for transactivation activity.|Ser-rich.				apoptotic process (GO:0006915)|negative regulation of cell growth (GO:0030308)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	ELL-EAF complex (GO:0032783)|transcription elongation factor complex (GO:0008023)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)			endometrium(1)|kidney(2)|large_intestine(1)|lung(4)|prostate(1)	9				GBM - Glioblastoma multiforme(114;0.0972)		TCCTCTACTTCTGATACAGGG	0.398																																					Esophageal Squamous(194;1942 2097 24663 29345 31866)												0													114.0	107.0	109.0					3																	121591519		2203	4300	6503	SO:0001583	missense	0			AF517829	CCDS3006.1	3q21.1	2007-08-01			ENSG00000145088	ENSG00000145088			23115	protein-coding gene	gene with protein product		607659				12446457, 12907652	Standard	NM_018456		Approved	BM040, TRAITS, U19	uc003een.3	Q96CJ1	OTTHUMG00000159424	ENST00000273668.2:c.620C>G	3.37:g.121591519C>G	ENSP00000273668:p.Ser207Cys		Q9NZ82	Missense_Mutation	SNP	pfam_Tscrpt_elong_fac_Eaf_N	p.S207C	ENST00000273668.2	37	c.620	CCDS3006.1	3	.	.	.	.	.	.	.	.	.	.	C	10.80	1.453355	0.26161	.	.	ENSG00000145088	ENST00000273668;ENST00000451944	.	.	.	4.75	3.86	0.44501	.	0.553824	0.18969	N	0.126177	T	0.45276	0.1334	M	0.61703	1.905	0.09310	N	1	D	0.60575	0.988	P	0.46975	0.533	T	0.40496	-0.9560	9	0.62326	D	0.03	-0.0485	11.1447	0.48424	0.0:0.9077:0.0:0.0922	.	207	Q96CJ1	EAF2_HUMAN	C	207	.	ENSP00000273668:S207C	S	+	2	0	EAF2	123074209	0.410000	0.25376	0.077000	0.20336	0.070000	0.16714	3.332000	0.52083	1.186000	0.42985	0.313000	0.20887	TCT	EAF2	-	NULL	ENSG00000145088		0.398	EAF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EAF2	HGNC	protein_coding	OTTHUMT00000355247.1	-	0.00	37	0	C	NM_018456		121591519	+1	tier1	-	no_errors	ENST00000273668	ensembl	human	known	74_37	missense	35.48	19	11	SNP	0.129	G
ENO1	2023	genome.wustl.edu	37	1	8928111	8928111	+	Silent	SNP	C	C	T			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr1:8928111C>T	ENST00000234590.4	-	5	365	c.246G>A	c.(244-246)ctG>ctA	p.L82L		NM_001428.3	NP_001419.1	P06733	ENOA_HUMAN	enolase 1, (alpha)	82					carbohydrate metabolic process (GO:0005975)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|negative regulation of cell growth (GO:0030308)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|response to virus (GO:0009615)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)|phosphopyruvate hydratase complex (GO:0000015)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|magnesium ion binding (GO:0000287)|phosphopyruvate hydratase activity (GO:0004634)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(2)|stomach(1)|upper_aerodigestive_tract(1)	10	Ovarian(185;0.0661)|all_lung(157;0.127)	all_epithelial(116;2.54e-20)|all_lung(118;2.99e-06)|Lung NSC(185;6.25e-06)|Renal(390;0.000147)|Breast(348;0.00086)|Colorectal(325;0.00205)|Hepatocellular(190;0.00825)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;2.42e-07)|COAD - Colon adenocarcinoma(227;2.78e-05)|Kidney(185;0.000249)|KIRC - Kidney renal clear cell carcinoma(229;0.000911)|STAD - Stomach adenocarcinoma(132;0.00177)|BRCA - Breast invasive adenocarcinoma(304;0.00185)|READ - Rectum adenocarcinoma(331;0.0642)		CTGTGACGTTCAGTTTCTACG	0.473																																					Esophageal Squamous(21;302 608 19946 22210 33560)												0													348.0	338.0	341.0					1																	8928111		2203	4300	6503	SO:0001819	synonymous_variant	0			BC022545	CCDS97.1	1p36.2	2010-03-11			ENSG00000074800	ENSG00000074800	4.2.1.11		3350	protein-coding gene	gene with protein product		172430		ENO1L1, MPB1		9653645, 9691177	Standard	NM_001428		Approved	PPH, MBP-1	uc001apj.2	P06733	OTTHUMG00000001773	ENST00000234590.4:c.246G>A	1.37:g.8928111C>T			B2RD59|P22712|Q16704|Q4TUS4|Q53FT9|Q53HR3|Q658M5|Q6GMP2|Q71V37|Q7Z3V6|Q8WU71|Q96GV1|Q9BT62|Q9UCH6|Q9UM55	Silent	SNP	pfam_Enolase_C,pfam_Enolase_N,pirsf_Enolase,prints_Enolase,tigrfam_Enolase	p.L82	ENST00000234590.4	37	c.246	CCDS97.1	1																																																																																			ENO1	-	pfam_Enolase_N,pirsf_Enolase,tigrfam_Enolase	ENSG00000074800		0.473	ENO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENO1	HGNC	protein_coding	OTTHUMT00000004945.1	-	0.00	49	0	C	NM_001428		8928111	-1	tier1	-	no_errors	ENST00000234590	ensembl	human	known	74_37	silent	16.67	35	7	SNP	0.875	T
HSPB6	126393	genome.wustl.edu	37	19	36243179	36243179	+	IGR	SNP	G	G	A	rs375974881		TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr19:36243179G>A	ENST00000592984.1	-	0	1634				AC002398.11_ENST00000591091.1_RNA|LIN37_ENST00000301159.9_Intron|AC002398.9_ENST00000591613.2_Intron|AC002398.12_ENST00000587767.1_RNA			O14558	HSPB6_HUMAN	heat shock protein, alpha-crystallin-related, B6						regulation of muscle contraction (GO:0006937)|response to stress (GO:0006950)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein homodimerization activity (GO:0042803)|structural constituent of eye lens (GO:0005212)			lung(1)	1	all_lung(56;3.33e-07)|Lung NSC(56;5.02e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			TCACAGGGCCGGGCACCCTGG	0.622													G|||	1	0.000199681	0.0008	0.0	5008	,	,		18012	0.0		0.0	False		,,,				2504	0.0																0								G		0,3984		0,0,1992	26.0	30.0	29.0			-9.6	0.0	19		29	2,8278		0,2,4138	no	intron	LIN37	NM_019104.2		0,2,6130	AA,AG,GG		0.0242,0.0,0.0163			36243179	2,12262	1992	4140	6132	SO:0001628	intergenic_variant	0			AJ278121	CCDS12475.1	19q13.13	2014-06-12			ENSG00000004776	ENSG00000004776		"""Heat shock proteins / HSPB"""	26511	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 91"""	610695				12820654, 14717697	Standard	NM_144617		Approved	FLJ32389, Hsp20, PPP1R91	uc002obn.2	O14558	OTTHUMG00000048122		19.37:g.36243179G>A			O14551|Q6NVI3|Q96MG9	RNA	SNP	-	NULL	ENST00000592984.1	37	NULL	CCDS12475.1	19																																																																																			AC002398.11	-	-	ENSG00000267439		0.622	HSPB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000267439	Clone_based_vega_gene	protein_coding	OTTHUMT00000109498.3	-	0.00	59	0	G	NM_144617		36243179	-1	tier1	-	no_errors	ENST00000591091	ensembl	human	known	74_37	rna	29.63	19	8	SNP	0.000	A
AGBL5	60509	genome.wustl.edu	37	2	27276570	27276570	+	Intron	SNP	C	C	T			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr2:27276570C>T	ENST00000360131.4	+	3	546				RP11-503P10.1_ENST00000607407.1_RNA|AGBL5_ENST00000323064.8_Intron	NM_021831.5	NP_068603.4	Q8NDL9	CBPC5_HUMAN	ATP/GTP binding protein-like 5						protein branching point deglutamylation (GO:0035611)|protein deglutamylation (GO:0035608)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	metallocarboxypeptidase activity (GO:0004181)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|large_intestine(5)|lung(8)|ovary(3)|pancreas(1)|prostate(2)|skin(1)	28	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GCTTTTTCTCCAGTGTTAGCT	0.438																																																	0																																										SO:0001627	intron_variant	0			BC007415	CCDS1732.3, CCDS42665.1	2p23.3	2014-06-23			ENSG00000084693	ENSG00000084693			26147	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase 5"""	615900				24022482	Standard	NM_001035507		Approved	FLJ21839, CCP5	uc002rie.3	Q8NDL9	OTTHUMG00000128406	ENST00000360131.4:c.387+129C>T	2.37:g.27276570C>T			A2VDI7|B7WPG9|B7Z7I7|D6W548|Q53SW0|Q53SZ0|Q96IK8|Q9H6V0|Q9H8P8	RNA	SNP	-	NULL	ENST00000360131.4	37	NULL	CCDS1732.3	2																																																																																			RP11-503P10.1	-	-	ENSG00000272056		0.438	AGBL5-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ENSG00000272056	Clone_based_vega_gene	protein_coding	OTTHUMT00000309033.1	-	0.00	46	0	C	NM_021831		27276570	-1	tier1	-	no_errors	ENST00000607407	ensembl	human	known	74_37	rna	32.00	17	8	SNP	0.000	T
MRPS22	56945	genome.wustl.edu	37	3	139068148	139068149	+	Intron	INS	-	-	T			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr3:139068148_139068149insT	ENST00000495075.1	+	6	936				MRPS22_ENST00000478464.1_Intron|MRPS22_ENST00000465056.1_Intron|MRPS22_ENST00000310776.4_Intron|RP11-219D15.3_ENST00000608472.1_RNA			P82650	RT22_HUMAN	mitochondrial ribosomal protein S22							mitochondrial ribosome (GO:0005761)|mitochondrial small ribosomal subunit (GO:0005763)|mitochondrion (GO:0005739)	structural constituent of ribosome (GO:0003735)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	12						TTGGCATGTGCTTTTTTTTTTT	0.351																																																	0																																										SO:0001627	intron_variant	0			AF226045	CCDS3107.1	3q23	2012-09-13			ENSG00000175110	ENSG00000175110		"""Mitochondrial ribosomal proteins / small subunits"""	14508	protein-coding gene	gene with protein product		605810				11175783	Standard	NM_020191		Approved	MRP-S22, GK002, C3orf5, GIBT	uc003etb.3	P82650	OTTHUMG00000159910	ENST00000495075.1:c.505-872->T	3.37:g.139068159_139068159dupT			Q9H3I1	RNA	INS	-	NULL	ENST00000495075.1	37	NULL	CCDS3107.1	3																																																																																			RP11-219D15.3	-	-	ENSG00000272656		0.351	MRPS22-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ENSG00000272656	Clone_based_vega_gene	protein_coding	OTTHUMT00000358120.1		0.00	46	0	-	NM_020191		139068149	-1	tier1		no_errors	ENST00000608472	ensembl	human	known	74_37	rna	10.71	25	3	INS	0.000:0.000	T
EPS8L3	79574	genome.wustl.edu	37	1	110300579	110300580	+	Frame_Shift_Ins	INS	-	-	T			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr1:110300579_110300580insT	ENST00000361965.4	-	9	924_925	c.818_819insA	c.(817-819)aacfs	p.N273fs	EPS8L3_ENST00000494151.1_5'Flank|RP4-735C1.4_ENST00000431955.1_RNA|EPS8L3_ENST00000361852.4_Frame_Shift_Ins_p.N273fs|EPS8L3_ENST00000369805.3_Frame_Shift_Ins_p.N274fs	NM_133181.3	NP_573444.2	Q8TE67	ES8L3_HUMAN	EPS8-like 3	273						cytoplasm (GO:0005737)		p.N274fs*33(2)		breast(1)|endometrium(3)|large_intestine(6)|lung(15)|ovary(5)|skin(1)|upper_aerodigestive_tract(1)	32		all_epithelial(167;1.95e-05)|all_lung(203;0.000135)|Lung NSC(277;0.000269)		Lung(183;0.0245)|Colorectal(144;0.0365)|all cancers(265;0.103)|Epithelial(280;0.109)|LUSC - Lung squamous cell carcinoma(189;0.137)|COAD - Colon adenocarcinoma(174;0.141)		CCTGGTCCTTGTTTTTTTTCCC	0.545																																																	2	Deletion - Frameshift(2)	ovary(1)|large_intestine(1)							,,	1,4261		0,1,2130					,,	-3.4	0.0			208	4,8246		0,4,4121	no	frameshift,frameshift,frameshift	EPS8L3	NM_139053.2,NM_133181.3,NM_024526.3	,,	0,5,6251	A1A1,A1R,RR		0.0485,0.0235,0.04	,,	,,		5,12507				SO:0001589	frameshift_variant	0			AK025175	CCDS813.1, CCDS814.1, CCDS815.1	1p13.2	2008-02-05			ENSG00000198758	ENSG00000198758			21297	protein-coding gene	gene with protein product		614989				12620401	Standard	NM_139053		Approved	FLJ21522, MGC16817	uc001dyq.2	Q8TE67	OTTHUMG00000011651	ENST00000361965.4:c.819dupA	1.37:g.110300587_110300587dupT	ENSP00000355255:p.Asn273fs		A8K833|Q5T8Q6|Q5T8Q7|Q5T8Q8|Q96E47|Q9H719	Frame_Shift_Ins	INS	pfam_PTB,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,superfamily_SAM/pointed,smart_SH3_domain,pfscan_SH3_domain	p.N274fs	ENST00000361965.4	37	c.822_821	CCDS814.1	1																																																																																			EPS8L3	-	NULL	ENSG00000198758		0.545	EPS8L3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	EPS8L3	HGNC	protein_coding	OTTHUMT00000032234.1		0.00	125	0	-	NM_024526		110300580	-1	tier1		no_errors	ENST00000369805	ensembl	human	known	74_37	frame_shift_ins	14.75	104	18	INS	0.016:0.352	T
ERCC4	2072	genome.wustl.edu	37	16	14029602	14029602	+	Splice_Site	SNP	C	C	A			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr16:14029602C>A	ENST00000311895.7	+	8	1820		c.e8+2		CTD-2135D7.2_ENST00000570663.1_RNA|CTD-2135D7.2_ENST00000575137.1_RNA	NM_005236.2	NP_005227.1	Q92889	XPF_HUMAN	excision repair cross-complementation group 4						DNA catabolic process, endonucleolytic (GO:0000737)|DNA repair (GO:0006281)|double-strand break repair via homologous recombination (GO:0000724)|negative regulation of telomere maintenance (GO:0032205)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair involved in interstrand cross-link repair (GO:1901255)|nucleotide-excision repair, DNA damage removal (GO:0000718)|nucleotide-excision repair, DNA incision (GO:0033683)|nucleotide-excision repair, DNA incision, 3'-to lesion (GO:0006295)|nucleotide-excision repair, DNA incision, 5'-to lesion (GO:0006296)|resolution of meiotic recombination intermediates (GO:0000712)|response to UV (GO:0009411)|telomere maintenance (GO:0000723)|telomere maintenance via telomere shortening (GO:0010834)|transcription-coupled nucleotide-excision repair (GO:0006283)|UV protection (GO:0009650)	chromosome, telomeric region (GO:0000781)|nuclear chromosome, telomeric region (GO:0000784)|nucleoplasm (GO:0005654)|nucleotide-excision repair complex (GO:0000109)|nucleotide-excision repair factor 1 complex (GO:0000110)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)	damaged DNA binding (GO:0003684)|endodeoxyribonuclease activity (GO:0004520)|protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)|single-stranded DNA binding (GO:0003697)|single-stranded DNA endodeoxyribonuclease activity (GO:0000014)			NS(1)|breast(1)|endometrium(7)|kidney(3)|large_intestine(5)|lung(12)|ovary(4)|pancreas(1)|prostate(1)|skin(3)	38						ACCTCTGAGGCAAGTTATAAA	0.418			"""Mis, N, F"""			"""skin basal cell, skin squamous cell, melanoma"""		Nucleotide excision repair (NER)	Xeroderma Pigmentosum																														yes	Rec		Xeroderma pigmentosum (F)	16	16p13.3-p13.13	2072	"""excision repair cross-complementing rodent repair deficiency, complementation group 4"""		E	0													61.0	61.0	61.0					16																	14029602		2196	4300	6496	SO:0001630	splice_region_variant	0	Familial Cancer Database	incl. XPA, XPB, XPC, XPD, XPE, XPF, XPG, XP Variant, XPV	L76568	CCDS32390.1	16p13.3	2014-09-17	2014-03-07		ENSG00000175595	ENSG00000175595			3436	protein-coding gene	gene with protein product	"""xeroderma pigmentosum, complementation group F"""	133520	"""excision repair cross-complementing rodent repair deficiency, complementation group 4"""	XPF		9579555, 8887684	Standard	NM_005236		Approved	RAD1, FANCQ	uc002dce.2	Q92889	OTTHUMG00000048194	ENST00000311895.7:c.1811+2C>A	16.37:g.14029602C>A			A5PKV6|A8K111|O00140|Q8TD83	Splice_Site	SNP	-	e8+2	ENST00000311895.7	37	c.1811+2	CCDS32390.1	16	.	.	.	.	.	.	.	.	.	.	C	13.13	2.144766	0.37825	.	.	ENSG00000175595	ENST00000311895;ENST00000389138	.	.	.	5.33	3.37	0.38596	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	6.0207	0.19628	0.0:0.6365:0.1407:0.2229	.	.	.	.	.	-1	.	.	.	+	.	.	ERCC4	13937103	1.000000	0.71417	1.000000	0.80357	0.850000	0.48378	1.468000	0.35332	0.729000	0.32403	0.591000	0.81541	.	ERCC4	-	-	ENSG00000175595		0.418	ERCC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ERCC4	HGNC	protein_coding	OTTHUMT00000109634.2	-	0.00	42	0	C	NM_005236	Intron	14029602	+1	tier1	-	no_errors	ENST00000311895	ensembl	human	known	74_37	splice_site	16.13	26	5	SNP	1.000	A
EXOC1	55763	genome.wustl.edu	37	4	56737000	56737000	+	Nonsense_Mutation	SNP	G	G	T			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr4:56737000G>T	ENST00000381295.2	+	6	1108	c.760G>T	c.(760-762)Gaa>Taa	p.E254*	EXOC1_ENST00000346134.7_Nonsense_Mutation_p.E254*|EXOC1_ENST00000349598.6_Nonsense_Mutation_p.E254*	NM_001024924.1	NP_001020095.1	Q9NV70	EXOC1_HUMAN	exocyst complex component 1	254					cellular protein metabolic process (GO:0044267)|exocytosis (GO:0006887)|membrane organization (GO:0061024)|protein transport (GO:0015031)	exocyst (GO:0000145)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(3)|lung(14)|ovary(2)|skin(4)|upper_aerodigestive_tract(1)	35	Glioma(25;0.08)|all_neural(26;0.101)					TCAGATCTCTGAAAGCAACCA	0.353																																																	0													100.0	103.0	102.0					4																	56737000		2203	4300	6503	SO:0001587	stop_gained	0			AK027047	CCDS3502.1, CCDS3503.1	4q12	2013-01-22	2005-11-01	2005-11-01	ENSG00000090989	ENSG00000090989			30380	protein-coding gene	gene with protein product		607879	"""SEC3-like 1 (S. cerevisiae)"""	SEC3L1		11042152, 11406615	Standard	XM_005265747		Approved	SEC3, FLJ10893, BM-102, Sec3p	uc003hbf.1	Q9NV70	OTTHUMG00000102165	ENST00000381295.2:c.760G>T	4.37:g.56737000G>T	ENSP00000370695:p.Glu254*		Q504V4|Q8WUE7|Q96T15|Q9NZE4	Nonsense_Mutation	SNP	pfam_Exocyst_Exoc1/SEC3	p.E254*	ENST00000381295.2	37	c.760	CCDS3502.1	4	.	.	.	.	.	.	.	.	.	.	G	40	8.127440	0.98667	.	.	ENSG00000090989	ENST00000381295;ENST00000346134;ENST00000349598	.	.	.	5.85	4.96	0.65561	.	0.099859	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.23302	T	0.38	.	16.4649	0.84076	0.0:0.131:0.869:0.0	.	.	.	.	X	254	.	ENSP00000326514:E254X	E	+	1	0	EXOC1	56431757	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.395000	0.66291	2.768000	0.95171	0.655000	0.94253	GAA	EXOC1	-	pfam_Exocyst_Exoc1/SEC3	ENSG00000090989		0.353	EXOC1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	EXOC1	HGNC	protein_coding	OTTHUMT00000361799.1	-	0.00	35	0	G	NM_018261		56737000	+1	tier1	-	no_errors	ENST00000346134	ensembl	human	known	74_37	nonsense	15.00	17	3	SNP	0.999	T
EXOC8	149371	genome.wustl.edu	37	1	231472549	231472549	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr1:231472549C>T	ENST00000360394.2	-	1	1029	c.943G>A	c.(943-945)Gac>Aac	p.D315N	SPRTN_ENST00000391858.4_5'Flank|EXOC8_ENST00000366645.1_Missense_Mutation_p.D311N|SPRTN_ENST00000008440.9_5'Flank|SPRTN_ENST00000295050.7_5'Flank	NM_175876.3	NP_787072.2	Q8IYI6	EXOC8_HUMAN	exocyst complex component 8	315					cellular protein localization (GO:0034613)|cellular protein metabolic process (GO:0044267)|exocytosis (GO:0006887)|membrane organization (GO:0061024)|protein transport (GO:0015031)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|exocyst (GO:0000145)|membrane (GO:0016020)|plasma membrane (GO:0005886)				cervix(2)|endometrium(1)|large_intestine(2)|liver(1)|lung(5)|prostate(1)|skin(1)|stomach(1)	14	Breast(184;0.0871)	all_cancers(173;0.151)|Prostate(94;0.183)				TCTTCTTCGTCATCCTCAAAT	0.562																																																	0													132.0	115.0	120.0					1																	231472549		2203	4300	6503	SO:0001583	missense	0			AL117352	CCDS1593.1	1q42.2	2013-01-22			ENSG00000116903	ENSG00000116903			24659	protein-coding gene	gene with protein product		615283				12477932	Standard	NM_175876		Approved	SEC84, EXO84, Exo84p	uc001huq.3	Q8IYI6	OTTHUMG00000038025	ENST00000360394.2:c.943G>A	1.37:g.231472549C>T	ENSP00000353564:p.Asp315Asn		B3KU33|Q5TE82	Missense_Mutation	SNP	superfamily_Cullin_repeat-like_dom,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.D315N	ENST00000360394.2	37	c.943	CCDS1593.1	1	.	.	.	.	.	.	.	.	.	.	C	12.21	1.869588	0.33069	.	.	ENSG00000116903	ENST00000360394;ENST00000366645	T;T	0.77358	-1.09;-1.09	5.28	5.28	0.74379	.	0.242758	0.40385	N	0.001104	T	0.69842	0.3156	L	0.41824	1.3	0.09310	N	0.999998	B	0.10296	0.003	B	0.06405	0.002	T	0.53208	-0.8471	10	0.18710	T	0.47	-3.8042	16.7031	0.85364	0.0:1.0:0.0:0.0	.	315	Q8IYI6	EXOC8_HUMAN	N	315;311	ENSP00000353564:D315N;ENSP00000355605:D311N	ENSP00000353564:D315N	D	-	1	0	EXOC8	229539172	1.000000	0.71417	0.060000	0.19600	0.791000	0.44710	5.881000	0.69706	2.440000	0.82611	0.561000	0.74099	GAC	EXOC8	-	NULL	ENSG00000116903		0.562	EXOC8-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EXOC8	HGNC	protein_coding		-	0.00	47	0	C	NM_175876		231472549	-1	tier1	-	no_errors	ENST00000360394	ensembl	human	known	74_37	missense	25.93	40	14	SNP	0.160	T
F2	2147	genome.wustl.edu	37	11	46749672	46749672	+	Silent	SNP	G	G	A			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr11:46749672G>A	ENST00000311907.5	+	10	1313	c.1257G>A	c.(1255-1257)gaG>gaA	p.E419E	F2_ENST00000530231.1_Silent_p.E419E	NM_000506.3	NP_000497.1	P00734	THRB_HUMAN	coagulation factor II (thrombin)	419	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				acute-phase response (GO:0006953)|blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell surface receptor signaling pathway (GO:0007166)|cellular protein metabolic process (GO:0044267)|cytosolic calcium ion homeostasis (GO:0051480)|fibrinolysis (GO:0042730)|leukocyte migration (GO:0050900)|multicellular organismal development (GO:0007275)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of fibrinolysis (GO:0051918)|negative regulation of platelet activation (GO:0010544)|negative regulation of proteolysis (GO:0045861)|peptidyl-glutamic acid carboxylation (GO:0017187)|platelet activation (GO:0030168)|positive regulation of blood coagulation (GO:0030194)|positive regulation of cell growth (GO:0030307)|positive regulation of cell proliferation (GO:0008284)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C-activating G-protein coupled receptor signaling pathway (GO:1900738)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|post-translational protein modification (GO:0043687)|proteolysis (GO:0006508)|regulation of blood coagulation (GO:0030193)|regulation of cell shape (GO:0008360)|response to wounding (GO:0009611)	blood microparticle (GO:0072562)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|growth factor activity (GO:0008083)|receptor binding (GO:0005102)|serine-type endopeptidase activity (GO:0004252)|thrombospondin receptor activity (GO:0070053)			endometrium(3)|kidney(2)|large_intestine(4)|lung(10)|ovary(3)|prostate(2)|stomach(2)|upper_aerodigestive_tract(1)	27		all_lung(304;0.000414)|Lung NSC(402;0.0011)		BRCA - Breast invasive adenocarcinoma(625;0.146)	Antihemophilic Factor(DB00025)|Argatroban(DB00278)|ART-123(DB05777)|Bivalirudin(DB00006)|Coagulation Factor IX(DB00100)|Dabigatran etexilate(DB06695)|Drotrecogin alfa(DB00055)|Lepirudin(DB00001)|Menadione(DB00170)|Proflavine(DB01123)|Suramin(DB04786)|Ximelagatran(DB04898)	ACTTCACCGAGAATGACCTTC	0.632																																					Esophageal Squamous(147;1147 1808 2148 38609 51144)												0													46.0	40.0	42.0					11																	46749672		2201	4299	6500	SO:0001819	synonymous_variant	0			M33031	CCDS31476.1	11p11.2	2013-02-28			ENSG00000180210	ENSG00000180210	3.4.21.5	"""Endogenous ligands"""	3535	protein-coding gene	gene with protein product	"""prepro-coagulation factor II"""	176930					Standard	NM_000506		Approved		uc001ndf.4	P00734	OTTHUMG00000150344	ENST00000311907.5:c.1257G>A	11.37:g.46749672G>A			B2R7F7|B4E1A7|Q4QZ40|Q53H04|Q53H06|Q69EZ7|Q7Z7P3|Q9UCA1	Silent	SNP	pfam_Peptidase_S1,pfam_Kringle,pfam_Thrombin_light_chain,pfam_GLA_domain,superfamily_Trypsin-like_Pept_dom,superfamily_Kringle-like,superfamily_GLA_domain,smart_GLA_domain,smart_Kringle,smart_Peptidase_S1,pirsf_Prothrombin/thrombin,pfscan_GLA_domain,pfscan_Kringle,pfscan_Peptidase_S1,prints_Prothrombin/thrombin,prints_Peptidase_S1A,prints_GLA_domain	p.E419	ENST00000311907.5	37	c.1257	CCDS31476.1	11																																																																																			F2	-	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pirsf_Prothrombin/thrombin,pfscan_Peptidase_S1,prints_Prothrombin/thrombin	ENSG00000180210		0.632	F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	F2	HGNC	protein_coding	OTTHUMT00000317706.1	-	0.00	39	0	G			46749672	+1	tier1	-	no_errors	ENST00000311907	ensembl	human	known	74_37	silent	37.50	25	15	SNP	0.000	A
FADD	8772	genome.wustl.edu	37	11	70049577	70049577	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr11:70049577C>G	ENST00000301838.4	+	1	309	c.12C>G	c.(10-12)ttC>ttG	p.F4L	RP11-805J14.5_ENST00000526174.1_RNA	NM_003824.3	NP_003815.1	Q13158	FADD_HUMAN	Fas (TNFRSF6)-associated via death domain	4	DED. {ECO:0000255|PROSITE- ProRule:PRU00065}.				activation of cysteine-type endopeptidase activity (GO:0097202)|activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cellular response to mechanical stimulus (GO:0071260)|defense response to virus (GO:0051607)|extrinsic apoptotic signaling pathway (GO:0097191)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|innate immune response (GO:0045087)|lymph node development (GO:0048535)|motor neuron apoptotic process (GO:0097049)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|necroptotic signaling pathway (GO:0097527)|negative regulation of activation-induced cell death of T cells (GO:0070236)|negative regulation of necroptotic process (GO:0060546)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of adaptive immune response (GO:0002821)|positive regulation of apoptotic process (GO:0043065)|positive regulation of CD8-positive, alpha-beta cytotoxic T cell extravasation (GO:2000454)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of proteolysis (GO:0045862)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of type I interferon-mediated signaling pathway (GO:0060340)|protein heterooligomerization (GO:0051291)|regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001239)|spleen development (GO:0048536)|T cell differentiation in thymus (GO:0033077)|T cell homeostasis (GO:0043029)|thymus development (GO:0048538)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRAIL-activated apoptotic signaling pathway (GO:0036462)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|viral process (GO:0016032)	CD95 death-inducing signaling complex (GO:0031265)|cell body (GO:0044297)|cytosol (GO:0005829)|death-inducing signaling complex (GO:0031264)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|ripoptosome (GO:0097342)	death effector domain binding (GO:0035877)|death receptor binding (GO:0005123)|identical protein binding (GO:0042802)|protease binding (GO:0002020)|tumor necrosis factor receptor superfamily binding (GO:0032813)			endometrium(1)|lung(4)|ovary(1)|pancreas(1)|urinary_tract(2)	9	Esophageal squamous(2;1.19e-45)		LUSC - Lung squamous cell carcinoma(11;1.46e-14)|STAD - Stomach adenocarcinoma(18;0.0513)			TGGACCCGTTCCTGGTGCTGC	0.716																																																	0																																										SO:0001583	missense	0			U24231	CCDS8196.1	11q13.3	2014-09-17			ENSG00000168040	ENSG00000168040			3573	protein-coding gene	gene with protein product	"""Fas-associating protein with death domain"", ""Fas-associating death domain-containing protein"", ""mediator of receptor-induced toxicity"", ""growth-inhibiting gene 3 protein"""	602457				7536190, 7538907	Standard	NM_003824		Approved	MORT1, GIG3	uc001opm.2	Q13158	OTTHUMG00000167264	ENST00000301838.4:c.12C>G	11.37:g.70049577C>G	ENSP00000301838:p.Phe4Leu		Q14866|Q6IBR4	Missense_Mutation	SNP	pfam_Death_domain,pfam_DED,superfamily_DEATH-like_dom,smart_DED,smart_Death_domain,pirsf_FADD,pfscan_Death_domain,pfscan_DED	p.F4L	ENST00000301838.4	37	c.12	CCDS8196.1	11	.	.	.	.	.	.	.	.	.	.	C	18.13	3.555794	0.65425	.	.	ENSG00000168040	ENST00000301838	D	0.88354	-2.37	4.39	3.45	0.39498	DEATH-like (2);Death effector (3);	0.186314	0.46442	D	0.000295	D	0.89273	0.6668	M	0.84948	2.725	0.33603	D	0.602551	P	0.41313	0.745	B	0.42995	0.404	D	0.92535	0.6037	10	0.87932	D	0	-29.3963	7.5674	0.27887	0.0:0.8817:0.0:0.1183	.	4	Q13158	FADD_HUMAN	L	4	ENSP00000301838:F4L	ENSP00000301838:F4L	F	+	3	2	FADD	69727225	0.999000	0.42202	0.979000	0.43373	0.743000	0.42351	1.099000	0.31013	2.158000	0.67659	0.491000	0.48974	TTC	FADD	-	pfam_DED,superfamily_DEATH-like_dom,smart_DED,pirsf_FADD,pfscan_DED	ENSG00000168040		0.716	FADD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FADD	HGNC	protein_coding	OTTHUMT00000393902.1	-	0.00	59	0	C	NM_003824		70049577	+1	tier1	-	no_errors	ENST00000301838	ensembl	human	known	74_37	missense	5.38	246	14	SNP	0.868	G
FADD	8772	genome.wustl.edu	37	11	70049640	70049640	+	Silent	SNP	C	C	T			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr11:70049640C>T	ENST00000301838.4	+	1	372	c.75C>T	c.(73-75)ttC>ttT	p.F25F	RP11-805J14.5_ENST00000526174.1_RNA	NM_003824.3	NP_003815.1	Q13158	FADD_HUMAN	Fas (TNFRSF6)-associated via death domain	25	DED. {ECO:0000255|PROSITE- ProRule:PRU00065}.				activation of cysteine-type endopeptidase activity (GO:0097202)|activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cellular response to mechanical stimulus (GO:0071260)|defense response to virus (GO:0051607)|extrinsic apoptotic signaling pathway (GO:0097191)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|innate immune response (GO:0045087)|lymph node development (GO:0048535)|motor neuron apoptotic process (GO:0097049)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|necroptotic signaling pathway (GO:0097527)|negative regulation of activation-induced cell death of T cells (GO:0070236)|negative regulation of necroptotic process (GO:0060546)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of adaptive immune response (GO:0002821)|positive regulation of apoptotic process (GO:0043065)|positive regulation of CD8-positive, alpha-beta cytotoxic T cell extravasation (GO:2000454)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of proteolysis (GO:0045862)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of type I interferon-mediated signaling pathway (GO:0060340)|protein heterooligomerization (GO:0051291)|regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001239)|spleen development (GO:0048536)|T cell differentiation in thymus (GO:0033077)|T cell homeostasis (GO:0043029)|thymus development (GO:0048538)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRAIL-activated apoptotic signaling pathway (GO:0036462)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|viral process (GO:0016032)	CD95 death-inducing signaling complex (GO:0031265)|cell body (GO:0044297)|cytosol (GO:0005829)|death-inducing signaling complex (GO:0031264)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|ripoptosome (GO:0097342)	death effector domain binding (GO:0035877)|death receptor binding (GO:0005123)|identical protein binding (GO:0042802)|protease binding (GO:0002020)|tumor necrosis factor receptor superfamily binding (GO:0032813)			endometrium(1)|lung(4)|ovary(1)|pancreas(1)|urinary_tract(2)	9	Esophageal squamous(2;1.19e-45)		LUSC - Lung squamous cell carcinoma(11;1.46e-14)|STAD - Stomach adenocarcinoma(18;0.0513)			AGCTCAAGTTCCTATGCCTCG	0.677																																																	0													16.0	16.0	16.0					11																	70049640		2187	4265	6452	SO:0001819	synonymous_variant	0			U24231	CCDS8196.1	11q13.3	2014-09-17			ENSG00000168040	ENSG00000168040			3573	protein-coding gene	gene with protein product	"""Fas-associating protein with death domain"", ""Fas-associating death domain-containing protein"", ""mediator of receptor-induced toxicity"", ""growth-inhibiting gene 3 protein"""	602457				7536190, 7538907	Standard	NM_003824		Approved	MORT1, GIG3	uc001opm.2	Q13158	OTTHUMG00000167264	ENST00000301838.4:c.75C>T	11.37:g.70049640C>T			Q14866|Q6IBR4	Silent	SNP	pfam_Death_domain,pfam_DED,superfamily_DEATH-like_dom,smart_DED,smart_Death_domain,pirsf_FADD,pfscan_Death_domain,pfscan_DED	p.F25	ENST00000301838.4	37	c.75	CCDS8196.1	11																																																																																			FADD	-	pfam_DED,superfamily_DEATH-like_dom,smart_DED,pirsf_FADD,pfscan_DED	ENSG00000168040		0.677	FADD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FADD	HGNC	protein_coding	OTTHUMT00000393902.1	-	0.00	70	0	C	NM_003824		70049640	+1	tier1	-	no_errors	ENST00000301838	ensembl	human	known	74_37	silent	6.76	331	24	SNP	0.999	T
FAM162A	26355	genome.wustl.edu	37	3	122121698	122121698	+	Silent	SNP	A	A	C			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr3:122121698A>C	ENST00000477892.1	+	2	210	c.126A>C	c.(124-126)acA>acC	p.T42T	FAM162A_ENST00000232125.5_Silent_p.T32T|FAM162A_ENST00000469967.1_Silent_p.T42T	NM_014367.3	NP_055182.3	Q96A26	F162A_HUMAN	family with sequence similarity 162, member A	42					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|cellular response to hypoxia (GO:0071456)|neuron apoptotic process (GO:0051402)|positive regulation of apoptotic process (GO:0043065)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|transformed cell apoptotic process (GO:0006927)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|nucleus (GO:0005634)				breast(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(1)	6						GATTTTGCACAAAACCACAGG	0.378																																																	0													85.0	80.0	82.0					3																	122121698		1831	4073	5904	SO:0001819	synonymous_variant	0			AF191020	CCDS43139.1	3q21.1	2008-06-05	2008-06-05	2008-06-05	ENSG00000114023	ENSG00000114023			17865	protein-coding gene	gene with protein product		608017	"""chromosome 3 open reading frame 28"""	C3orf28		11085516	Standard	NM_014367		Approved	E2IG5	uc003eez.3	Q96A26	OTTHUMG00000159494	ENST00000477892.1:c.126A>C	3.37:g.122121698A>C			Q9NRN6|Q9UJX8	Silent	SNP	pfam_DUF1075	p.T42	ENST00000477892.1	37	c.126	CCDS43139.1	3																																																																																			FAM162A	-	pfam_DUF1075	ENSG00000114023		0.378	FAM162A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM162A	HGNC	protein_coding	OTTHUMT00000355766.1	-	0.00	54	0	A	NM_014367		122121698	+1	tier1	-	no_errors	ENST00000477892	ensembl	human	known	74_37	silent	17.31	43	9	SNP	0.916	C
FAM179B	23116	genome.wustl.edu	37	14	45515859	45515859	+	Intron	SNP	A	A	G			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr14:45515859A>G	ENST00000361577.3	+	13	4368				FAM179B_ENST00000382233.2_3'UTR|FAM179B_ENST00000361462.2_Missense_Mutation_p.I1422M	NM_015091.2	NP_055906.2	Q9Y4F4	F179B_HUMAN	family with sequence similarity 179, member B											endometrium(4)|kidney(5)|large_intestine(12)|lung(16)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	45						CTGAACGCATATTACCAGCTG	0.373																																																	0																																										SO:0001627	intron_variant	0			AB007883	CCDS9681.1	14q21.3	2008-07-21	2008-07-21	2008-07-21	ENSG00000198718	ENSG00000198718			19959	protein-coding gene	gene with protein product			"""KIAA0423"""	KIAA0423			Standard	XM_005267451		Approved		uc001wvv.3	Q9Y4F4	OTTHUMG00000140264	ENST00000361577.3:c.4154+1786A>G	14.37:g.45515859A>G			Q68D66|Q6PG27	Missense_Mutation	SNP	pfam_CLASP_N_dom,superfamily_ARM-type_fold	p.I1422M	ENST00000361577.3	37	c.4266	CCDS9681.1	14	.	.	.	.	.	.	.	.	.	.	A	12.83	2.055393	0.36277	.	.	ENSG00000198718	ENST00000361462	T	0.69561	-0.41	5.6	1.86	0.25419	.	0.313947	0.25068	U	0.033385	T	0.50599	0.1625	.	.	.	0.80722	D	1	P	0.40144	0.704	B	0.36244	0.22	T	0.42050	-0.9474	9	0.54805	T	0.06	-7.2452	2.6747	0.05078	0.3534:0.1195:0.0713:0.4558	.	1422	G3XAE9	.	M	1422	ENSP00000354917:I1422M	ENSP00000354917:I1422M	I	+	3	3	FAM179B	44585609	0.995000	0.38212	0.997000	0.53966	0.982000	0.71751	0.375000	0.20518	0.059000	0.16252	0.533000	0.62120	ATA	FAM179B	-	pfam_CLASP_N_dom,superfamily_ARM-type_fold	ENSG00000198718		0.373	FAM179B-001	KNOWN	basic|CCDS	protein_coding	FAM179B	HGNC	protein_coding	OTTHUMT00000276791.1	-	0.00	44	0	A	XM_113781		45515859	+1	tier1	-	no_errors	ENST00000361462	ensembl	human	novel	74_37	missense	36.21	37	21	SNP	0.934	G
ERICH6B	220081	genome.wustl.edu	37	13	46124142	46124142	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr13:46124142G>A	ENST00000298738.2	-	13	1696	c.1532C>T	c.(1531-1533)gCg>gTg	p.A511V	FAM194B_ENST00000504261.1_5'UTR|RNA5SP27_ENST00000363839.1_RNA	NM_182542.2	NP_872348.2	Q5W0A0	ERI6B_HUMAN		511										breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)	5						TTTCATTTTCGCATATAAGAT	0.463																																																	0													126.0	103.0	110.0					13																	46124142		692	1591	2283	SO:0001583	missense	0																														ENST00000298738.2:c.1532C>T	13.37:g.46124142G>A	ENSP00000298738:p.Ala511Val		Q96MB5	Missense_Mutation	SNP	NULL	p.A511V	ENST00000298738.2	37	c.1532	CCDS45045.1	13	.	.	.	.	.	.	.	.	.	.	G	8.575	0.880873	0.17467	.	.	ENSG00000165837	ENST00000298738	T	0.11385	2.78	5.65	-4.14	0.03892	.	.	.	.	.	T	0.04048	0.0113	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.40683	-0.9550	9	0.87932	D	0	-0.5256	1.0857	0.01652	0.3344:0.1072:0.3311:0.2274	.	511	Q5W0A0	F194B_HUMAN	V	511	ENSP00000298738:A511V	ENSP00000298738:A511V	A	-	2	0	FAM194B	45022143	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.539000	0.06113	-0.448000	0.07128	-0.904000	0.02843	GCG	FAM194B	-	NULL	ENSG00000165837		0.463	FAM194B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM194B	HGNC	protein_coding	OTTHUMT00000044781.3	-	0.00	83	0	G			46124142	-1	tier1	-	no_errors	ENST00000298738	ensembl	human	known	74_37	missense	52.70	35	39	SNP	0.000	A
FAM195B	348262	genome.wustl.edu	37	17	79782177	79782177	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr17:79782177C>T	ENST00000576730.1	-	2	2268	c.113G>A	c.(112-114)cGc>cAc	p.R38H	FAM195B_ENST00000576679.1_Missense_Mutation_p.A42T|FAM195B_ENST00000575061.1_Missense_Mutation_p.R59H|FAM195B_ENST00000455127.2_Missense_Mutation_p.R38H|FAM195B_ENST00000574190.1_Missense_Mutation_p.R38H|FAM195B_ENST00000573478.1_Missense_Mutation_p.R38H|FAM195B_ENST00000570507.1_Missense_Mutation_p.R33H|FAM195B_ENST00000572645.1_Missense_Mutation_p.R59H|AC174470.1_ENST00000457257.1_3'UTR|FAM195B_ENST00000576431.1_Missense_Mutation_p.R38H|FAM195B_ENST00000538396.1_Missense_Mutation_p.R38H|FAM195B_ENST00000575090.1_5'Flank			C9JLW8	F195B_HUMAN	family with sequence similarity 195, member B	38																	GTAAATGAAGCGGACGTTCTC	0.652																																																	0													29.0	33.0	32.0					17																	79782177		692	1591	2283	SO:0001583	missense	0				CCDS45814.1, CCDS74178.1, CCDS74179.1	17q25.3	2010-02-17			ENSG00000225663	ENSG00000225663			28007	protein-coding gene	gene with protein product							Standard	NM_001093767		Approved		uc010wuz.1	C9JLW8		ENST00000576730.1:c.113G>A	17.37:g.79782177C>T	ENSP00000458707:p.Arg38His		Q6ZUL0	Missense_Mutation	SNP	NULL	p.R38H	ENST00000576730.1	37	c.113	CCDS45814.1	17	.	.	.	.	.	.	.	.	.	.	C	24.9	4.584978	0.86748	.	.	ENSG00000225663	ENST00000455127;ENST00000538396	.	.	.	4.75	4.75	0.60458	.	.	.	.	.	T	0.79246	0.4413	.	.	.	0.58432	D	0.999999	D	0.89917	1.0	D	0.74674	0.984	T	0.82596	-0.0379	7	0.72032	D	0.01	.	16.5218	0.84319	0.0:1.0:0.0:0.0	.	38	C9JLW8	F195B_HUMAN	H	38	.	ENSP00000409009:R38H	R	-	2	0	FAM195B	.	1.000000	0.71417	1.000000	0.80357	0.911000	0.54048	4.807000	0.62576	2.202000	0.70862	0.561000	0.74099	CGC	FAM195B	-	NULL	ENSG00000225663		0.652	FAM195B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM195B	HGNC	protein_coding	OTTHUMT00000439682.1	-	0.00	159	0	C	NM_001093767		79782177	-1	tier1	-	no_errors	ENST00000455127	ensembl	human	known	74_37	missense	10.66	109	13	SNP	1.000	T
FAP	2191	genome.wustl.edu	37	2	163031461	163031461	+	Missense_Mutation	SNP	C	C	T	rs141879753	byFrequency	TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr2:163031461C>T	ENST00000188790.4	-	22	2092	c.1885G>A	c.(1885-1887)Gtt>Att	p.V629I	AC007750.5_ENST00000418968.3_RNA|FAP_ENST00000443424.1_Missense_Mutation_p.V604I	NM_004460.2	NP_004451.2			fibroblast activation protein, alpha											NS(2)|breast(1)|central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(5)|lung(34)|ovary(4)|prostate(3)|skin(2)|upper_aerodigestive_tract(4)	63						AGTGATGAAACGTATCCTCCA	0.418													C|||	2	0.000399361	0.0008	0.0014	5008	,	,		17989	0.0		0.0	False		,,,				2504	0.0																0								C	ILE/VAL	1,4405	2.1+/-5.4	0,1,2202	117.0	101.0	106.0		1885	3.6	0.9	2	dbSNP_134	106	2,8598	2.2+/-6.3	0,2,4298	no	missense	FAP	NM_004460.2	29	0,3,6500	TT,TC,CC		0.0233,0.0227,0.0231	benign	629/761	163031461	3,13003	2203	4300	6503	SO:0001583	missense	0			U09278	CCDS33311.1	2q23	2008-02-05			ENSG00000078098	ENSG00000078098			3590	protein-coding gene	gene with protein product	"""seprase"""	600403				9247085, 14707457	Standard	NM_004460		Approved	DPPIV	uc002ucd.3	Q12884	OTTHUMG00000153890	ENST00000188790.4:c.1885G>A	2.37:g.163031461C>T	ENSP00000188790:p.Val629Ile			Missense_Mutation	SNP	pfam_Peptidase_S9B,pfam_Peptidase_S9	p.V629I	ENST00000188790.4	37	c.1885	CCDS33311.1	2	.	.	.	.	.	.	.	.	.	.	C	15.01	2.706322	0.48412	2.27E-4	2.33E-4	ENSG00000078098	ENST00000188790;ENST00000443424	T;T	0.29917	1.55;1.55	5.42	3.63	0.41609	Peptidase S9, prolyl oligopeptidase, catalytic domain (1);	0.057139	0.64402	N	0.000001	T	0.45875	0.1364	M	0.62723	1.935	0.58432	D	0.999992	B;D;B	0.71674	0.08;0.998;0.015	B;P;B	0.61328	0.12;0.887;0.03	T	0.28235	-1.0050	10	0.29301	T	0.29	-24.2985	12.2495	0.54589	0.0:0.8616:0.0:0.1384	.	604;108;629	B4DLR2;Q12884-2;Q12884	.;.;SEPR_HUMAN	I	629;604	ENSP00000188790:V629I;ENSP00000411391:V604I	ENSP00000188790:V629I	V	-	1	0	FAP	162739707	1.000000	0.71417	0.887000	0.34795	0.832000	0.47134	3.693000	0.54735	0.786000	0.33708	-0.137000	0.14449	GTT	FAP	-	pfam_Peptidase_S9	ENSG00000078098		0.418	FAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAP	HGNC	protein_coding	OTTHUMT00000332852.2	-	0.00	50	0	C			163031461	-1	tier1	rs141879753	no_errors	ENST00000188790	ensembl	human	known	74_37	missense	18.75	26	6	SNP	1.000	T
FMN1	342184	genome.wustl.edu	37	15	33096524	33096525	+	Missense_Mutation	DNP	TC	TC	AA			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	T|C	T|C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr15:33096524_33096525TC>AA	ENST00000559047.1	-	15	3936_3937	c.3937_3938GA>TT	c.(3937-3939)GAg>TTg	p.E1313L	FMN1_ENST00000334528.9_Missense_Mutation_p.E1090L|FMN1_ENST00000561249.1_Missense_Mutation_p.E1215L			Q68DA7	FMN1_HUMAN	formin 1	1313	FH2. {ECO:0000255|PROSITE- ProRule:PRU00774}.				actin nucleation (GO:0045010)	actin filament (GO:0005884)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|lung(14)|ovary(2)|prostate(1)|upper_aerodigestive_tract(3)	29		all_lung(180;1.14e-07)		all cancers(64;3.05e-15)|Epithelial(43;1.67e-10)|GBM - Glioblastoma multiforme(186;4.95e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0262)		CATCTTATGCTCTTTTTTGGCT	0.356																																																	0																																										SO:0001583	missense	0			AH002864	CCDS45209.1, CCDS61581.1, CCDS61582.1	15q13.3	2013-06-13	2005-01-20	2005-01-22	ENSG00000248905	ENSG00000248905			3768	protein-coding gene	gene with protein product	"""limb deformity protein"""	136535	"""formin (limb deformity)"""	LD, FMN		1673046	Standard	NM_001277313		Approved	DKFZP686C2281, FLJ45135, MGC125288, MGC125289	uc031qrh.1	Q68DA7	OTTHUMG00000172201	ENST00000559047.1:c.3937_3938delinsAA	15.37:g.33096524_33096525delinsAA	ENSP00000454047:p.Glu1313Leu		Q3B7I6|Q3ZAR4|Q6ZSY1	Missense_Mutation|Nonsense_Mutation	SNP	pfam_FH2_Formin,smart_FH2_Formin,prints_Formin_Cappuccino_subfam	p.E1090V|p.E1090*	ENST00000559047.1	37	c.3269|c.3268		15																																																																																			FMN1	-	pfam_FH2_Formin,smart_FH2_Formin	ENSG00000248905		0.356	FMN1-005	NOVEL	basic|exp_conf	protein_coding	FMN1	HGNC	protein_coding	OTTHUMT00000417414.1	-	0.00	67	0	T|C	NM_001103184		33096524|33096525	-1	tier1	-	no_errors	ENST00000334528	ensembl	human	known	74_37	missense|nonsense	16.22	31	6	SNP	1.000	A
FBN1	2200	genome.wustl.edu	37	15	48936865	48936865	+	Silent	SNP	C	C	T			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr15:48936865C>T	ENST00000316623.5	-	2	557	c.102G>A	c.(100-102)gtG>gtA	p.V34V	FBN1_ENST00000560355.1_Silent_p.V34V|RP11-227D13.1_ENST00000558061.1_lincRNA	NM_000138.4	NP_000129	P35555	FBN1_HUMAN	fibrillin 1	34					extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|kidney development (GO:0001822)|sequestering of BMP in extracellular matrix (GO:0035582)|sequestering of TGFbeta in extracellular matrix (GO:0035583)|skeletal system development (GO:0001501)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(5)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|liver(1)|lung(49)|ovary(4)|pancreas(1)|prostate(9)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	139		all_lung(180;0.00279)		all cancers(107;4.24e-07)|GBM - Glioblastoma multiforme(94;1.41e-05)		TGGTTTCCTTCACGTTCCCAG	0.602																																																	0													172.0	164.0	167.0					15																	48936865		2197	4296	6493	SO:0001819	synonymous_variant	0			X63556	CCDS32232.1	15q21.1	2014-09-17	2006-04-25			ENSG00000166147			3603	protein-coding gene	gene with protein product	"""Marfan syndrome"""	134797	"""fibrillin 1 (Marfan syndrome)"""	FBN, MFS1, WMS		10036187, 12525539	Standard	NM_000138		Approved	MASS, OCTD, SGS	uc001zwx.2	P35555		ENST00000316623.5:c.102G>A	15.37:g.48936865C>T			B2RUU0|D2JYH6|Q15972|Q75N87	Silent	SNP	pfam_EGF-like_Ca-bd_dom,pfam_EG-like_dom,pfam_TB_dom,superfamily_TB_dom,superfamily_Growth_fac_rcpt_N_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,pirsf_FBN,pfscan_EG-like_dom	p.V34	ENST00000316623.5	37	c.102	CCDS32232.1	15																																																																																			FBN1	-	pirsf_FBN	ENSG00000166147		0.602	FBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBN1	HGNC	protein_coding	OTTHUMT00000417355.1	-	0.00	70	0	C			48936865	-1	tier1	-	no_errors	ENST00000316623	ensembl	human	known	74_37	silent	46.27	36	31	SNP	0.993	T
FREM3	166752	genome.wustl.edu	37	4	144620474	144620474	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr4:144620474G>T	ENST00000329798.5	-	1	1354	c.1355C>A	c.(1354-1356)tCc>tAc	p.S452Y	RP13-578N3.3_ENST00000499587.2_RNA	NM_001168235.1	NP_001161707.1	P0C091	FREM3_HUMAN	FRAS1 related extracellular matrix 3	452					cell adhesion (GO:0007155)|cell communication (GO:0007154)	basement membrane (GO:0005604)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)			NS(1)|breast(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|lung(2)|prostate(1)	8						GTGGGTGCTGGACAAGGGCCT	0.502																																																	0													86.0	71.0	76.0					4																	144620474		692	1591	2283	SO:0001583	missense	0			BX091796	CCDS54808.1	4q31.21	2011-06-09			ENSG00000183090	ENSG00000183090			25172	protein-coding gene	gene with protein product		608946				15345741	Standard	NM_001168235		Approved		uc021xsj.1	P0C091	OTTHUMG00000161577	ENST00000329798.5:c.1355C>A	4.37:g.144620474G>T	ENSP00000332886:p.Ser452Tyr			Missense_Mutation	SNP	pfam_Calx_beta,superfamily_Cadherin-like,smart_Calx_beta	p.S452Y	ENST00000329798.5	37	c.1355	CCDS54808.1	4	.	.	.	.	.	.	.	.	.	.	G	13.48	2.248812	0.39797	.	.	ENSG00000183090	ENST00000329798	T	0.22743	1.94	4.16	4.16	0.48862	.	0.072360	0.56097	D	0.000026	T	0.43389	0.1245	M	0.78456	2.415	0.54753	D	0.999989	.	.	.	.	.	.	T	0.47560	-0.9108	8	0.59425	D	0.04	-4.9188	15.3842	0.74684	0.0:0.0:1.0:0.0	.	.	.	.	Y	452	ENSP00000332886:S452Y	ENSP00000332886:S452Y	S	-	2	0	FREM3	144839924	1.000000	0.71417	0.171000	0.22900	0.135000	0.20990	6.871000	0.75531	2.146000	0.66826	0.655000	0.94253	TCC	FREM3	-	NULL	ENSG00000183090		0.502	FREM3-001	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	FREM3	HGNC	protein_coding	OTTHUMT00000365391.1		0.00	100	0	G	XM_094074		144620474	-1			no_errors	ENST00000329798	ensembl	human	putative	74_37	missense	5.26	72	4	SNP	1.000	T
FSTL5	56884	genome.wustl.edu	37	4	162680564	162680564	+	Splice_Site	SNP	G	G	C			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr4:162680564G>C	ENST00000306100.5	-	6	1162	c.726C>G	c.(724-726)ttC>ttG	p.F242L	FSTL5_ENST00000379164.4_Splice_Site_p.F241L|FSTL5_ENST00000536695.1_Splice_Site_p.F241L|FSTL5_ENST00000427802.2_Splice_Site_p.F241L	NM_001128427.2|NM_020116.4	NP_001121899.1|NP_064501.2	Q8N475	FSTL5_HUMAN	follistatin-like 5	242	EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.					extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(18)|lung(43)|ovary(4)|pancreas(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	91	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.179)		TGTACTCACGGAATGCTCTAT	0.353																																																	0													93.0	98.0	96.0					4																	162680564		2203	4299	6502	SO:0001630	splice_region_variant	0			BC036502	CCDS3802.1, CCDS47157.1, CCDS47158.1	4q32.3	2013-01-11			ENSG00000168843	ENSG00000168843		"""EF-hand domain containing"", ""Immunoglobulin superfamily / I-set domain containing"""	21386	protein-coding gene	gene with protein product						10574462, 15527507	Standard	NM_020116		Approved	DKFZp566D234, KIAA1263	uc003iqh.4	Q8N475	OTTHUMG00000161397	ENST00000306100.5:c.727+1C>G	4.37:g.162680564G>C			E9PCP6|Q9NSW7|Q9ULF7	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Kazal_dom,pfam_Ig_V-set,smart_Kazal_dom,smart_Ig_sub,smart_Ig_sub2,pfscan_EF_hand_dom,pfscan_Ig-like_dom	p.F242L	ENST00000306100.5	37	c.726	CCDS3802.1	4	.	.	.	.	.	.	.	.	.	.	G	13.84	2.358604	0.41801	.	.	ENSG00000168843	ENST00000306100;ENST00000379164;ENST00000427802;ENST00000536695	T;T;T;T	0.22336	1.96;1.96;1.96;1.96	5.37	2.66	0.31614	EF-hand-like domain (1);	0.049611	0.85682	D	0.000000	T	0.24314	0.0589	M	0.79123	2.44	0.54753	D	0.999984	B;B;B	0.33288	0.022;0.406;0.058	B;B;B	0.36504	0.011;0.226;0.028	T	0.02313	-1.1178	10	0.39692	T	0.17	.	6.0777	0.19925	0.4706:0.0:0.5294:0.0	.	241;241;242	E9PCP6;F8VZ90;Q8N475	.;.;FSTL5_HUMAN	L	242;241;241;241	ENSP00000305334:F242L;ENSP00000368462:F241L;ENSP00000389270:F241L;ENSP00000440409:F241L	ENSP00000305334:F242L	F	-	3	2	FSTL5	162900014	1.000000	0.71417	1.000000	0.80357	0.621000	0.37620	2.379000	0.44318	0.617000	0.30160	0.579000	0.79373	TTC	FSTL5	-	NULL	ENSG00000168843		0.353	FSTL5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FSTL5	HGNC	protein_coding	OTTHUMT00000364773.2	-	0.00	38	0	G	NM_020116	Missense_Mutation	162680564	-1	tier1	-	no_errors	ENST00000306100	ensembl	human	known	74_37	missense	25.00	33	11	SNP	1.000	C
GFM1	85476	genome.wustl.edu	37	3	158363966	158363966	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr3:158363966G>C	ENST00000486715.1	+	3	604	c.247G>C	c.(247-249)Gat>Cat	p.D83H	GFM1_ENST00000478576.1_Missense_Mutation_p.D83H|GFM1_ENST00000264263.5_Missense_Mutation_p.D83H	NM_024996.5	NP_079272.4			G elongation factor, mitochondrial 1											breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(5)|lung(9)|ovary(3)|urinary_tract(2)	22			Lung(72;0.00309)|LUSC - Lung squamous cell carcinoma(72;0.0043)			GAAAGGTAAAGATGGAGTTGG	0.418																																																	0													163.0	152.0	156.0					3																	158363966		2203	4300	6503	SO:0001583	missense	0			AF309777	CCDS33885.1	3q25	2008-02-05			ENSG00000168827	ENSG00000168827			13780	protein-coding gene	gene with protein product		606639	"""G translation elongation factor, mitochondrial"""			11374907, 11735030	Standard	NM_024996		Approved	EFGM, GFM, EGF1	uc003fce.3	Q96RP9	OTTHUMG00000158804	ENST00000486715.1:c.247G>C	3.37:g.158363966G>C	ENSP00000419038:p.Asp83His			Missense_Mutation	SNP	pfam_EF_GTP-bd_dom,pfam_Transl_elong_EFG/EF2_IV,pfam_EFG_V,pfam_Transl_elong_EFTu/EF1A_2,superfamily_P-loop_NTPase,superfamily_Ribosomal_S5_D2-typ_fold,superfamily_Transl_B-barrel,superfamily_EFG_III-V,smart_Transl_elong_EFG/EF2_IV,smart_EFG_V,prints_EF_GTP-bd_dom,tigrfam_Transl_elong_EFG/EF2,tigrfam_Small_GTP-bd_dom	p.D83H	ENST00000486715.1	37	c.247	CCDS33885.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	27.8|27.8	4.860101|4.860101	0.91433|0.91433	.|.	.|.	ENSG00000168827|ENSG00000079257	ENST00000486715;ENST00000478576;ENST00000264263;ENST00000464732|ENST00000482640	T;T;T;T|.	0.71579|.	-0.58;-0.58;-0.58;-0.53|.	5.53|5.53	5.53|5.53	0.82687|0.82687	Small GTP-binding protein domain (1);Protein synthesis factor, GTP-binding (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.87617|0.87617	0.6222|0.6222	H|H	0.94462|0.94462	3.54|3.54	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.97110|.	1.0;1.0|.	D|D	0.90687|0.90687	0.4610|0.4610	10|5	0.87932|.	D|.	0|.	-8.9786|-8.9786	19.4895|19.4895	0.95044|0.95044	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	83;83|.	Q96RP9;C9IZ01|.	EFGM_HUMAN;.|.	H|V	83;83;83;8|132	ENSP00000419038:D83H;ENSP00000418755:D83H;ENSP00000264263:D83H;ENSP00000417532:D8H|.	ENSP00000264263:D83H|.	D|L	+|-	1|1	0|0	GFM1|LXN	159846660|159846660	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	9.336000|9.336000	0.96533|0.96533	2.596000|2.596000	0.87737|0.87737	0.655000|0.655000	0.94253|0.94253	GAT|CTT	GFM1	-	pfam_EF_GTP-bd_dom,superfamily_P-loop_NTPase,tigrfam_Transl_elong_EFG/EF2,tigrfam_Small_GTP-bd_dom	ENSG00000168827		0.418	GFM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GFM1	HGNC	protein_coding	OTTHUMT00000352271.1	-	0.00	95	0	G	NM_024996		158363966	+1	tier1	-	no_errors	ENST00000486715	ensembl	human	known	74_37	missense	25.90	103	36	SNP	1.000	C
GPR112	139378	genome.wustl.edu	37	X	135429365	135429365	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chrX:135429365C>T	ENST00000394143.1	+	6	3791	c.3500C>T	c.(3499-3501)aCa>aTa	p.T1167I	GPR112_ENST00000394141.1_Missense_Mutation_p.T962I|GPR112_ENST00000412101.1_Missense_Mutation_p.T962I|GPR112_ENST00000370652.1_Missense_Mutation_p.T1167I|GPR112_ENST00000287534.4_Missense_Mutation_p.T1104I	NM_153834.3	NP_722576.3	Q8IZF6	GP112_HUMAN	G protein-coupled receptor 112	1167					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(33)|lung(97)|ovary(5)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(2)	199	Acute lymphoblastic leukemia(192;0.000127)					ACTACGTCTACACCAGAAGCA	0.478																																																	0													189.0	150.0	163.0					X																	135429365		2203	4300	6503	SO:0001583	missense	0			AY140954	CCDS35409.1	Xq26.3	2014-08-08			ENSG00000156920	ENSG00000156920		"""-"", ""GPCR / Class B : Orphans"""	18992	protein-coding gene	gene with protein product						12435584	Standard	XM_005262367		Approved	RP1-299I16, PGR17	uc004ezu.1	Q8IZF6	OTTHUMG00000022508	ENST00000394143.1:c.3500C>T	X.37:g.135429365C>T	ENSP00000377699:p.Thr1167Ile		A2A2J1|A2A2J2|Q5EGP2|Q86SM6	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_GPS_dom,pfam_Pentaxin,superfamily_ConA-like_lec_gl_sf,smart_Pentaxin,smart_GPS_dom,pfscan_GPS_dom,pfscan_GPCR_2-like,prints_GPCR_2_secretin-like	p.T1167I	ENST00000394143.1	37	c.3500	CCDS35409.1	X	.	.	.	.	.	.	.	.	.	.	C	12.97	2.097112	0.37048	.	.	ENSG00000156920	ENST00000394143;ENST00000370652;ENST00000412101;ENST00000287534;ENST00000394141	T;T;T;T;T	0.39056	1.14;1.14;1.1;1.21;1.1	2.86	-0.274	0.12910	.	.	.	.	.	T	0.40546	0.1121	L	0.32530	0.975	0.09310	N	1	D;D;D	0.65815	0.995;0.99;0.983	P;P;P	0.61003	0.882;0.744;0.559	T	0.21348	-1.0248	9	0.34782	T	0.22	.	2.7906	0.05387	0.2199:0.4916:0.0:0.2885	.	1104;962;1167	Q8IZF6-2;Q8IZF6-3;Q8IZF6	.;.;GP112_HUMAN	I	1167;1167;962;1104;962	ENSP00000377699:T1167I;ENSP00000359686:T1167I;ENSP00000416526:T962I;ENSP00000287534:T1104I;ENSP00000377697:T962I	ENSP00000287534:T1104I	T	+	2	0	GPR112	135257031	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-0.419000	0.07071	-0.355000	0.08199	0.436000	0.28706	ACA	GPR112	-	NULL	ENSG00000156920		0.478	GPR112-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GPR112	HGNC	protein_coding	OTTHUMT00000286639.1	-	0.00	38	0	C			135429365	+1	tier1	-	no_errors	ENST00000370652	ensembl	human	known	74_37	missense	18.42	31	7	SNP	0.000	T
GPR89A	653519	genome.wustl.edu	37	1	145811926	145811927	+	Frame_Shift_Ins	INS	-	-	A			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr1:145811926_145811927insA	ENST00000313835.9	-	4	425_426	c.282_283insT	c.(280-285)attggcfs	p.G95fs	GPR89A_ENST00000462900.2_Frame_Shift_Ins_p.G70fs|GPR89A_ENST00000454423.3_5'UTR|GPR89A_ENST00000534502.1_Frame_Shift_Ins_p.G70fs			B7ZAQ6	GPHRA_HUMAN	G protein-coupled receptor 89A	95					intracellular pH reduction (GO:0051452)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|protein transport (GO:0015031)|regulation of anion transport (GO:0044070)|signal transduction (GO:0007165)	Golgi cisterna membrane (GO:0032580)|Golgi-associated vesicle membrane (GO:0030660)|integral component of membrane (GO:0016021)	signal transducer activity (GO:0004871)|voltage-gated anion channel activity (GO:0008308)			breast(1)|large_intestine(3)|lung(1)|skin(1)	6	all_hematologic(18;0.00473)|Acute lymphoblastic leukemia(18;0.0786)		KIRC - Kidney renal clear cell carcinoma(6;0.0764)|Kidney(552;0.118)|Colorectal(543;0.229)			ATAAAATAGCCAATGTAAAAAG	0.371																																																	0																																										SO:0001589	frameshift_variant	0			AB097024	CCDS72857.1, CCDS72858.1	1q21.1	2008-12-17	2007-06-06	2007-06-06	ENSG00000117262	ENSG00000117262			31984	protein-coding gene	gene with protein product		612821					Standard	NM_001097612		Approved	UNQ192	uc001eot.2	B7ZAQ6	OTTHUMG00000013738	ENST00000313835.9:c.283dupT	1.37:g.145811928_145811928dupA	ENSP00000319673:p.Gly95fs		A6NN37|B2RUV3|B3KMN3|B4DLT3|B4DXE7|Q53FQ9|Q5T2V8|Q5T5P5|Q659E2|Q6NVY5|Q9P0S4|Q9Y302	Frame_Shift_Ins	INS	pfam_ABA_GPCR_dom,pfam_Golgi_pH-regulator_cons_dom	p.G94fs	ENST00000313835.9	37	c.283_282	CCDS41377.1	1																																																																																			GPR89A	-	NULL	ENSG00000117262		0.371	GPR89A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR89A	HGNC	protein_coding	OTTHUMT00000038507.2		0.00	29	0	-	NM_001097612		145811927	-1	tier1		no_errors	ENST00000313835	ensembl	human	known	74_37	frame_shift_ins	25.53	35	12	INS	1.000:1.000	A
GTF2F1	2962	genome.wustl.edu	37	19	6380476	6380476	+	Missense_Mutation	SNP	T	T	G			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr19:6380476T>G	ENST00000394456.5	-	13	1834	c.1370A>C	c.(1369-1371)gAt>gCt	p.D457A	GTF2F1_ENST00000429701.2_Missense_Mutation_p.D372A|PSPN_ENST00000597721.1_5'Flank	NM_002096.2	NP_002087.2	P35269	T2FA_HUMAN	general transcription factor IIF, polypeptide 1, 74kDa	457					7-methylguanosine mRNA capping (GO:0006370)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|positive regulation of catalytic activity (GO:0043085)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of viral transcription (GO:0050434)|response to virus (GO:0009615)|RNA splicing (GO:0008380)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cell junction (GO:0030054)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIIF complex (GO:0005674)	catalytic activity (GO:0003824)|DNA binding (GO:0003677)|phosphatase activator activity (GO:0019211)|poly(A) RNA binding (GO:0044822)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)			breast(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(4)	16						GCGCACGGCATCCTCAGTCAC	0.607																																																	0													160.0	146.0	151.0					19																	6380476		2203	4300	6503	SO:0001583	missense	0				CCDS12165.1	19p13.3	2010-03-23	2002-08-29		ENSG00000125651	ENSG00000125651		"""General transcription factors"""	4652	protein-coding gene	gene with protein product		189968	"""general transcription factor IIF, polypeptide 1 (74kD subunit)"""			1734284	Standard	NM_002096		Approved	TFIIF, BTF4, RAP74, TF2F1	uc002meq.2	P35269	OTTHUMG00000168087	ENST00000394456.5:c.1370A>C	19.37:g.6380476T>G	ENSP00000377969:p.Asp457Ala		B2RCS0|Q9BWN0	Missense_Mutation	SNP	pfam_TFIIF-alpha,superfamily_TFIIF_interaction	p.D457A	ENST00000394456.5	37	c.1370	CCDS12165.1	19	.	.	.	.	.	.	.	.	.	.	T	17.52	3.410343	0.62399	.	.	ENSG00000125651	ENST00000394456;ENST00000429701	T;T	0.50001	0.76;0.76	4.52	3.51	0.40186	Winged helix-turn-helix transcription repressor DNA-binding (1);	0.190950	0.42420	D	0.000702	T	0.39886	0.1095	L	0.46157	1.445	0.58432	D	0.999998	P;B;B	0.44090	0.826;0.201;0.393	B;B;B	0.42462	0.388;0.197;0.197	T	0.11275	-1.0594	10	0.27785	T	0.31	-38.3083	9.233	0.37448	0.0:0.0883:0.0:0.9117	.	372;355;457	E7EUG6;B4DDB5;P35269	.;.;T2FA_HUMAN	A	457;372	ENSP00000377969:D457A;ENSP00000392107:D372A	ENSP00000377969:D457A	D	-	2	0	GTF2F1	6331476	1.000000	0.71417	0.490000	0.27465	0.679000	0.39708	7.236000	0.78154	0.885000	0.36088	0.533000	0.62120	GAT	GTF2F1	-	pfam_TFIIF-alpha	ENSG00000125651		0.607	GTF2F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GTF2F1	HGNC	protein_coding	OTTHUMT00000398033.1	-	0.00	138	0	T	NM_002096		6380476	-1	tier1	-	no_errors	ENST00000394456	ensembl	human	known	74_37	missense	41.74	67	48	SNP	0.994	G
GTF3C1	2975	genome.wustl.edu	37	16	27481557	27481557	+	Silent	SNP	G	G	A	rs576044105		TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr16:27481557G>A	ENST00000356183.4	-	31	4701	c.4686C>T	c.(4684-4686)gaC>gaT	p.D1562D	GTF3C1_ENST00000561623.1_Silent_p.D1562D	NM_001520.3	NP_001511.2	Q12789	TF3C1_HUMAN	general transcription factor IIIC, polypeptide 1, alpha 220kDa	1562					5S class rRNA transcription from RNA polymerase III type 1 promoter (GO:0042791)|gene expression (GO:0010467)|rRNA transcription (GO:0009303)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)|tRNA transcription (GO:0009304)|tRNA transcription from RNA polymerase III promoter (GO:0042797)	membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|transcription factor TFIIIC complex (GO:0000127)	DNA binding (GO:0003677)			breast(2)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(14)|liver(3)|lung(28)|ovary(2)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)	80						CTCCAGGGCCGTCCAGTGAAA	0.547																																																	0													121.0	118.0	119.0					16																	27481557		2197	4300	6497	SO:0001819	synonymous_variant	0			U06485	CCDS32414.1, CCDS66988.1	16p12	2010-03-23	2002-08-29			ENSG00000077235		"""General transcription factors"""	4664	protein-coding gene	gene with protein product		603246	"""general transcription factor IIIC, polypeptide 1 (alpha subunit, 220kD )"""			8164661, 8127861	Standard	NM_001520		Approved	TFIIIC220	uc002dov.2	Q12789		ENST00000356183.4:c.4686C>T	16.37:g.27481557G>A			B2RP21|Q12838|Q6DKN9|Q9Y4W9	Silent	SNP	pfam_TFIIIC_Bblock-bd	p.D1562	ENST00000356183.4	37	c.4686	CCDS32414.1	16																																																																																			GTF3C1	-	NULL	ENSG00000077235		0.547	GTF3C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GTF3C1	HGNC	protein_coding	OTTHUMT00000433856.1	-	0.00	63	0	G	NM_001520		27481557	-1	tier1	-	no_errors	ENST00000356183	ensembl	human	known	74_37	silent	30.67	52	23	SNP	0.955	A
HAUS5	23354	genome.wustl.edu	37	19	36110935	36110935	+	Silent	SNP	C	C	A			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr19:36110935C>A	ENST00000203166.5	+	16	1453	c.1428C>A	c.(1426-1428)gtC>gtA	p.V476V	HAUS5_ENST00000379045.2_3'UTR	NM_015302.1	NP_056117.1	O94927	HAUS5_HUMAN	HAUS augmin-like complex, subunit 5	476					centrosome organization (GO:0051297)|mitotic nuclear division (GO:0007067)|spindle assembly (GO:0051225)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|HAUS complex (GO:0070652)|microtubule (GO:0005874)				NS(1)|breast(2)|cervix(3)|endometrium(1)|large_intestine(2)|lung(5)|skin(2)	16						TGCCCACGGTCCTCCCATCCA	0.672																																																	0													86.0	98.0	94.0					19																	36110935		1987	4142	6129	SO:0001819	synonymous_variant	0			AB020648	CCDS42550.1	19q13.12	2012-02-22	2009-04-20	2009-04-20	ENSG00000249115	ENSG00000249115		"""HAUS augmin-like complex subunits"""	29130	protein-coding gene	gene with protein product		613432	"""KIAA0841"""	KIAA0841		10048485, 19427217	Standard	NM_015302		Approved	dgt5	uc002oam.1	O94927	OTTHUMG00000048110	ENST00000203166.5:c.1428C>A	19.37:g.36110935C>A			B2RXK1|Q6P2P7|Q7L3D5|Q96CT8	Silent	SNP	NULL	p.V476	ENST00000203166.5	37	c.1428	CCDS42550.1	19																																																																																			HAUS5	-	NULL	ENSG00000249115		0.672	HAUS5-005	KNOWN	basic|appris_principal|CCDS	protein_coding	HAUS5	HGNC	protein_coding	OTTHUMT00000459055.2		0.00	70	0	C			36110935	+1			no_errors	ENST00000203166	ensembl	human	known	74_37	silent	5.56	51	3	SNP	0.696	A
HDAC4	9759	genome.wustl.edu	37	2	239975285	239975285	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr2:239975285C>G	ENST00000345617.3	-	26	3877	c.3086G>C	c.(3085-3087)cGc>cCc	p.R1029P	HDAC4_ENST00000543185.1_Missense_Mutation_p.R613P	NM_006037.3	NP_006028.2	P56524	HDAC4_HUMAN	histone deacetylase 4	1029	Histone deacetylase.				B cell activation (GO:0042113)|B cell differentiation (GO:0030183)|cardiac muscle hypertrophy in response to stress (GO:0014898)|chromatin remodeling (GO:0006338)|histone deacetylation (GO:0016575)|histone H3 deacetylation (GO:0070932)|histone H4 deacetylation (GO:0070933)|inflammatory response (GO:0006954)|negative regulation of cell proliferation (GO:0008285)|negative regulation of glycolytic process (GO:0045820)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|osteoblast development (GO:0002076)|peptidyl-lysine deacetylation (GO:0034983)|positive regulation of cell proliferation (GO:0008284)|positive regulation of protein sumoylation (GO:0033235)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of gene expression, epigenetic (GO:0040029)|regulation of protein binding (GO:0043393)|regulation of skeletal muscle fiber development (GO:0048742)|response to denervation involved in regulation of muscle adaptation (GO:0014894)|response to drug (GO:0042493)|response to interleukin-1 (GO:0070555)|skeletal system development (GO:0001501)|transcription, DNA-templated (GO:0006351)	A band (GO:0031672)|actomyosin (GO:0042641)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|histone deacetylase complex (GO:0000118)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)|Z disc (GO:0030018)	activating transcription factor binding (GO:0033613)|core promoter binding (GO:0001047)|histone deacetylase activity (GO:0004407)|histone deacetylase binding (GO:0042826)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|potassium ion binding (GO:0030955)|protein deacetylase activity (GO:0033558)|repressing transcription factor binding (GO:0070491)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(1)|biliary_tract(1)|breast(4)|endometrium(5)|kidney(2)|large_intestine(7)|lung(27)|ovary(3)|pancreas(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(5)	62		all_epithelial(40;1.45e-17)|Breast(86;1.53e-05)|Renal(207;0.000355)|all_lung(227;0.0121)|Ovarian(221;0.0183)|Lung NSC(271;0.0413)|Melanoma(123;0.0749)|all_hematologic(139;0.159)		Epithelial(121;6.38e-25)|OV - Ovarian serous cystadenocarcinoma(60;2.48e-12)|Kidney(56;6.04e-08)|KIRC - Kidney renal clear cell carcinoma(57;1.18e-06)|BRCA - Breast invasive adenocarcinoma(100;3.99e-05)|Lung(119;0.00942)|LUSC - Lung squamous cell carcinoma(224;0.04)		CTGCAGGCAGCGCCAGTACTT	0.632																																																	0													29.0	33.0	32.0					2																	239975285		2203	4300	6503	SO:0001583	missense	0			AB006626	CCDS2529.1	2q37.3	2014-02-12			ENSG00000068024	ENSG00000068024			14063	protein-coding gene	gene with protein product		605314	"""brachydactyly-mental retardation syndrome"""	BDMR		10206986, 10220385, 20691407	Standard	NM_006037		Approved	KIAA0288, HDAC-A, HDACA, HD4, HA6116, HDAC-4	uc002vyk.4	P56524	OTTHUMG00000133344	ENST00000345617.3:c.3086G>C	2.37:g.239975285C>G	ENSP00000264606:p.Arg1029Pro		Q9UND6	Missense_Mutation	SNP	pfam_His_deacetylse_dom,pfam_Hist_deacetylase_Gln_rich_N,pfam_Arb2_domain,pirsf_Histone_deAcase_II_euk,prints_His_deacetylse	p.R1029P	ENST00000345617.3	37	c.3086	CCDS2529.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	3.327|3.327	-0.137400|-0.137400	0.06711|0.06711	.|.	.|.	ENSG00000068024|ENSG00000068024	ENST00000430200|ENST00000345617;ENST00000456922;ENST00000543185	.|T;T	.|0.46451	.|0.87;0.87	4.38|4.38	4.38|4.38	0.52667|0.52667	.|Histone deacetylase domain (1);Arb2 domain (1);	.|0.176210	.|0.51477	.|D	.|0.000089	T|T	0.20292|0.20292	0.0488|0.0488	N|N	0.16602|0.16602	0.42|0.42	0.41281|0.41281	D|D	0.986918|0.986918	.|B;B	.|0.02656	.|0.0;0.0	.|B;B	.|0.10450	.|0.001;0.005	T|T	0.12091|0.12091	-1.0561|-1.0561	5|10	.|0.02654	.|T	.|1	.|.	7.0307|7.0307	0.24965|0.24965	0.0:0.8378:0.0:0.1622|0.0:0.8378:0.0:0.1622	.|.	.|997;1029	.|Q53SM2;P56524	.|.;HDAC4_HUMAN	P|P	120|1029;917;613	.|ENSP00000264606:R1029P;ENSP00000440481:R613P	.|ENSP00000264606:R1029P	A|R	-|-	1|2	0|0	HDAC4|HDAC4	239640222|239640222	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.806000|0.806000	0.45545|0.45545	2.232000|2.232000	0.43018|0.43018	2.150000|2.150000	0.67090|0.67090	0.650000|0.650000	0.86243|0.86243	GCT|CGC	HDAC4	-	pfam_Arb2_domain,pirsf_Histone_deAcase_II_euk	ENSG00000068024		0.632	HDAC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HDAC4	HGNC	protein_coding	OTTHUMT00000257174.2	-	0.00	103	0	C	NM_006037		239975285	-1	tier1	-	no_errors	ENST00000345617	ensembl	human	known	74_37	missense	48.98	50	48	SNP	1.000	G
HEATR6	63897	genome.wustl.edu	37	17	58153567	58153567	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr17:58153567C>A	ENST00000184956.6	-	2	267	c.251G>T	c.(250-252)cGa>cTa	p.R84L	HEATR6_ENST00000585712.1_5'Flank|HEATR6_ENST00000585976.1_Missense_Mutation_p.R84L	NM_022070.4	NP_071353.4	Q6AI08	HEAT6_HUMAN	HEAT repeat containing 6	84							poly(A) RNA binding (GO:0044822)			NS(1)|breast(4)|endometrium(5)|kidney(2)|large_intestine(4)|lung(7)|ovary(2)|pancreas(1)|prostate(4)|skin(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	44	all_cancers(5;2.25e-13)|Breast(5;4.84e-25)|all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		BRCA - Breast invasive adenocarcinoma(1;5.93e-19)|Epithelial(12;7.59e-12)|all cancers(12;1.26e-10)			AGGTACCAGTCGGCAAGCCTG	0.378																																																	0													72.0	63.0	66.0					17																	58153567		2203	4300	6503	SO:0001583	missense	0			BX640819	CCDS11623.1	17q23.2	2007-05-01				ENSG00000068097			24076	protein-coding gene	gene with protein product	"""amplified in breast cancer 1"""					12755490	Standard	NM_022070		Approved	ABC1, FLJ22087	uc002iyk.1	Q6AI08		ENST00000184956.6:c.251G>T	17.37:g.58153567C>A	ENSP00000184956:p.Arg84Leu		B3KXP3|Q6MZX1|Q6MZY2|Q8TDM9|Q9H6B3|Q9H6M7	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.R84L	ENST00000184956.6	37	c.251	CCDS11623.1	17	.	.	.	.	.	.	.	.	.	.	C	7.911	0.736400	0.15574	.	.	ENSG00000068097	ENST00000184956	T	0.42513	0.97	5.1	0.822	0.18806	Armadillo-like helical (1);	0.283280	0.36066	N	0.002813	T	0.29716	0.0742	L	0.56769	1.78	0.36077	D	0.842543	P	0.37276	0.589	B	0.23150	0.044	T	0.32534	-0.9903	10	0.54805	T	0.06	-1.2382	8.4685	0.32971	0.0:0.5894:0.0:0.4106	.	84	Q6AI08	HEAT6_HUMAN	L	84	ENSP00000184956:R84L	ENSP00000184956:R84L	R	-	2	0	HEATR6	55508349	0.995000	0.38212	0.998000	0.56505	0.863000	0.49368	0.841000	0.27613	0.268000	0.21939	-0.149000	0.13747	CGA	HEATR6	-	NULL	ENSG00000068097		0.378	HEATR6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HEATR6	HGNC	protein_coding	OTTHUMT00000449165.1	-	0.00	25	0	C	NM_022070		58153567	-1	tier1	-	no_errors	ENST00000184956	ensembl	human	known	74_37	missense	55.56	12	15	SNP	0.988	A
HEYL	26508	genome.wustl.edu	37	1	40092514	40092514	+	Nonsense_Mutation	SNP	G	G	A			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr1:40092514G>A	ENST00000372852.3	-	5	971	c.652C>T	c.(652-654)Cga>Tga	p.R218*	HEYL_ENST00000535435.1_Nonsense_Mutation_p.R190*	NM_014571.3	NP_055386	Q9NQ87	HEYL_HUMAN	hes-related family bHLH transcription factor with YRPW motif-like	218	Pro-rich.				atrioventricular valve morphogenesis (GO:0003181)|cardiac epithelial to mesenchymal transition (GO:0060317)|cardiac ventricle morphogenesis (GO:0003208)|cellular response to BMP stimulus (GO:0071773)|endocardial cushion morphogenesis (GO:0003203)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|glomerulus development (GO:0032835)|mesenchymal cell development (GO:0014031)|negative regulation of androgen receptor activity (GO:2000824)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|outflow tract morphogenesis (GO:0003151)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|proximal tubule development (GO:0072014)|pulmonary valve morphogenesis (GO:0003184)|skeletal muscle cell differentiation (GO:0035914)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	AF-1 domain binding (GO:0050683)|microsatellite binding (GO:0035939)|protein binding transcription factor activity (GO:0000988)|protein heterodimerization activity (GO:0046982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity (GO:0000983)|RNA polymerase II transcription corepressor activity (GO:0001106)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)			breast(1)|endometrium(1)|large_intestine(2)|lung(2)|ovary(1)	7	Lung NSC(20;3.81e-06)|Ovarian(52;0.00769)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;1.1e-18)|Epithelial(16;2.77e-17)|all cancers(16;5.64e-16)|LUSC - Lung squamous cell carcinoma(16;0.000261)|Lung(16;0.000457)			GGAGCGGTTCGGAGGGCTGGG	0.682																																																	0													27.0	28.0	28.0					1																	40092514		2192	4290	6482	SO:0001587	stop_gained	0			BC006087	CCDS439.1	1p34.3	2013-10-17	2013-10-17		ENSG00000163909	ENSG00000163909		"""Basic helix-loop-helix proteins"""	4882	protein-coding gene	gene with protein product	"""hairy/enhancer-of-split related with YRPW motif 3"""	609034	"""hairy/enhancer-of-split related with YRPW motif-like"""			10415358, 10860664	Standard	NM_014571		Approved	bHLHb33, HEY3, HESR3	uc001cdp.3	Q9NQ87	OTTHUMG00000000458	ENST00000372852.3:c.652C>T	1.37:g.40092514G>A	ENSP00000361943:p.Arg218*		Q5TG99	Nonsense_Mutation	SNP	pfam_bHLH_dom,pfam_Orange,superfamily_bHLH_dom,smart_bHLH_dom,smart_Orange_subgr,pfscan_Orange,pfscan_bHLH_dom	p.R218*	ENST00000372852.3	37	c.652	CCDS439.1	1	.	.	.	.	.	.	.	.	.	.	G	36	5.633248	0.96682	.	.	ENSG00000163909	ENST00000372852;ENST00000535435	.	.	.	5.02	0.538	0.17150	.	2.287770	0.02182	N	0.060571	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.07325	T	0.83	-25.6861	14.2411	0.65956	0.0:0.0:0.4046:0.5954	.	.	.	.	X	218;190	.	ENSP00000361943:R218X	R	-	1	2	HEYL	39865101	0.980000	0.34600	0.194000	0.23346	0.949000	0.60115	0.890000	0.28295	0.115000	0.18071	0.462000	0.41574	CGA	HEYL	-	NULL	ENSG00000163909		0.682	HEYL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HEYL	HGNC	protein_coding	OTTHUMT00000001179.2	-	0.00	71	0	G	NM_014571		40092514	-1	tier1	-	no_errors	ENST00000372852	ensembl	human	known	74_37	nonsense	41.79	39	28	SNP	0.066	A
HIBCH	26275	genome.wustl.edu	37	2	191161574	191161574	+	Missense_Mutation	SNP	G	G	A	rs544400387	byFrequency	TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr2:191161574G>A	ENST00000359678.5	-	3	478	c.184C>T	c.(184-186)Ctt>Ttt	p.L62F	HIBCH_ENST00000392332.3_Missense_Mutation_p.L62F	NM_014362.3|NM_198047.2	NP_055177.2|NP_932164.1	Q6NVY1	HIBCH_HUMAN	3-hydroxyisobutyryl-CoA hydrolase	62					branched-chain amino acid catabolic process (GO:0009083)|cellular nitrogen compound metabolic process (GO:0034641)|small molecule metabolic process (GO:0044281)|valine catabolic process (GO:0006574)	extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)	3-hydroxyisobutyryl-CoA hydrolase activity (GO:0003860)			NS(1)|breast(2)|endometrium(1)|large_intestine(1)|lung(5)|skin(1)|soft_tissue(1)|upper_aerodigestive_tract(1)	13			OV - Ovarian serous cystadenocarcinoma(117;0.000586)|Epithelial(96;0.0286)|all cancers(119;0.0814)			ATCATATTAAGAGTCAGTGCA	0.363													G|||	2	0.000399361	0.0	0.0	5008	,	,		18755	0.0		0.0	False		,,,				2504	0.002																0													137.0	132.0	134.0					2																	191161574		2203	4300	6503	SO:0001583	missense	0			U66669	CCDS2304.1, CCDS46475.1	2q32.3	2010-04-29	2010-04-29		ENSG00000198130	ENSG00000198130	3.1.2.4		4908	protein-coding gene	gene with protein product		610690	"""3-hydroxyisobutyryl-Coenzyme A hydrolase"""			8824301	Standard	NM_014362		Approved		uc002uru.3	Q6NVY1	OTTHUMG00000132673	ENST00000359678.5:c.184C>T	2.37:g.191161574G>A	ENSP00000352706:p.Leu62Phe		D3DPI4|Q53GA8|Q53GF2|Q53RF7|Q53TC6|Q92931|Q9BS94	Missense_Mutation	SNP	pfam_Crotonase_core_superfam	p.L62F	ENST00000359678.5	37	c.184	CCDS2304.1	2	.	.	.	.	.	.	.	.	.	.	G	7.090	0.571914	0.13623	.	.	ENSG00000198130	ENST00000392332;ENST00000359678;ENST00000409934	T;T;T	0.73152	-0.32;-0.72;-0.32	5.33	-2.75	0.05914	Crotonase, core (1);	0.310767	0.35525	N	0.003147	T	0.59459	0.2195	M	0.68593	2.085	0.31953	N	0.60942	B;B	0.29253	0.239;0.093	B;B	0.34418	0.182;0.061	T	0.50800	-0.8785	10	0.35671	T	0.21	-1.6272	2.2134	0.03954	0.371:0.1148:0.3967:0.1175	.	62;62	Q6NVY1-2;Q6NVY1	.;HIBCH_HUMAN	F	62;62;116	ENSP00000376144:L62F;ENSP00000352706:L62F;ENSP00000387247:L116F	ENSP00000352706:L62F	L	-	1	0	HIBCH	190869819	0.015000	0.18098	0.001000	0.08648	0.162000	0.22319	-0.129000	0.10515	-0.533000	0.06323	-0.743000	0.03520	CTT	HIBCH	-	pfam_Crotonase_core_superfam	ENSG00000198130		0.363	HIBCH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIBCH	HGNC	protein_coding	OTTHUMT00000255933.1	-	0.00	87	0	G			191161574	-1	tier1	-	no_errors	ENST00000359678	ensembl	human	known	74_37	missense	20.00	60	15	SNP	0.148	A
HIST1H3B	8358	genome.wustl.edu	37	6	26031889	26031889	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr6:26031889C>G	ENST00000244661.2	-	1	399	c.400G>C	c.(400-402)Gaa>Caa	p.E134Q		NM_003537.3	NP_003528.1	P68431	H31_HUMAN	histone cluster 1, H3b	134					blood coagulation (GO:0007596)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|regulation of gene silencing (GO:0060968)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)			breast(3)|central_nervous_system(10)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(4)|ovary(2)|skin(1)	25						TACGCTCTTTCTCCGCGAATG	0.458																																																	0													58.0	61.0	60.0					6																	26031889		2203	4300	6503	SO:0001583	missense	0			X00090	CCDS4573.1	6p22.1	2011-01-27	2006-10-11	2003-03-14	ENSG00000124693	ENSG00000274267		"""Histones / Replication-dependent"""	4776	protein-coding gene	gene with protein product		602819	"""H3 histone family, member L"", ""histone 1, H3b"""	H3FL		6647026, 9119399, 12408966	Standard	NM_003537		Approved	H3/l	uc003nfs.1	P68431	OTTHUMG00000014415	ENST00000244661.2:c.400G>C	6.37:g.26031889C>G	ENSP00000244661:p.Glu134Gln		A0PJT7|A5PLR1|P02295|P02296|P16106|Q6ISV8|Q6NWP8|Q6NWP9|Q6NXU4|Q71DJ3|Q93081	Missense_Mutation	SNP	pfam_Histone_core_D,superfamily_Histone-fold,smart_Histone_H3,prints_Histone_H3	p.E134Q	ENST00000244661.2	37	c.400	CCDS4573.1	6	.	.	.	.	.	.	.	.	.	.	c	14.81	2.646170	0.47258	.	.	ENSG00000124693	ENST00000244661	T	0.48201	0.82	5.17	5.17	0.71159	.	.	.	.	.	T	0.60676	0.2287	.	.	.	0.41871	D	0.990276	.	.	.	.	.	.	T	0.65647	-0.6117	6	0.87932	D	0	.	18.0207	0.89253	0.0:1.0:0.0:0.0	.	.	.	.	Q	134	ENSP00000244661:E134Q	ENSP00000244661:E134Q	E	-	1	0	HIST1H3B	26139868	1.000000	0.71417	0.976000	0.42696	0.130000	0.20726	7.492000	0.81482	2.545000	0.85829	0.561000	0.74099	GAA	HIST1H3B	-	superfamily_Histone-fold,smart_Histone_H3,prints_Histone_H3	ENSG00000124693		0.458	HIST1H3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H3B	HGNC	protein_coding	OTTHUMT00000040077.1	-	0.00	61	0	C	NM_003537		26031889	-1	tier1	-	no_errors	ENST00000244661	ensembl	human	known	74_37	missense	25.53	35	12	SNP	1.000	G
HMCN1	83872	genome.wustl.edu	37	1	186106700	186106700	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr1:186106700G>C	ENST00000271588.4	+	88	13882	c.13653G>C	c.(13651-13653)aaG>aaC	p.K4551N	HMCN1_ENST00000367492.2_Missense_Mutation_p.K4551N	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	4551	TSP type-1 1. {ECO:0000255|PROSITE- ProRule:PRU00210}.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						GCATCCAAAAGAGGAGTCGTC	0.483																																																	0													72.0	72.0	72.0					1																	186106700		2203	4300	6503	SO:0001583	missense	0			AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.13653G>C	1.37:g.186106700G>C	ENSP00000271588:p.Lys4551Asn		A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_G2_nidogen/fibulin_G2F,pfam_EGF-like_Ca-bd_dom,pfam_Thrombospondin_1_rpt,superfamily_GFP,superfamily_Thrombospondin_1_rpt,superfamily_Growth_fac_rcpt_N_dom,superfamily_Cadherin-like,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Thrombospondin_1_rpt,smart_G2_nidogen/fibulin_G2F,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_G2_nidogen/fibulin_G2F,pfscan_Thrombospondin_1_rpt,pfscan_Ig-like_dom	p.K4551N	ENST00000271588.4	37	c.13653	CCDS30956.1	1	.	.	.	.	.	.	.	.	.	.	G	17.07	3.295531	0.60086	.	.	ENSG00000143341	ENST00000271588;ENST00000367492	T;T	0.53857	0.6;0.6	5.78	3.7	0.42460	.	0.090481	0.85682	D	0.000000	T	0.49813	0.1579	L	0.33485	1.01	0.37625	D	0.921443	D	0.54772	0.968	P	0.56960	0.81	T	0.48198	-0.9056	10	0.16420	T	0.52	.	8.8408	0.35140	0.2728:0.0:0.7272:0.0	.	4551	Q96RW7	HMCN1_HUMAN	N	4551	ENSP00000271588:K4551N;ENSP00000356462:K4551N	ENSP00000271588:K4551N	K	+	3	2	HMCN1	184373323	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	1.431000	0.34925	1.448000	0.47680	0.650000	0.86243	AAG	HMCN1	-	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	ENSG00000143341		0.483	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HMCN1	HGNC	protein_coding	OTTHUMT00000131848.1	-	0.00	44	0	G	NM_031935		186106700	+1	tier1	-	no_errors	ENST00000271588	ensembl	human	known	74_37	missense	10.53	34	4	SNP	1.000	C
HNRNPA0	10949	genome.wustl.edu	37	5	137089438	137089438	+	Silent	SNP	T	T	C			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr5:137089438T>C	ENST00000314940.4	-	1	601	c.318A>G	c.(316-318)aaA>aaG	p.K106K		NM_006805.3	NP_006796.1	Q13151	ROA0_HUMAN	heterogeneous nuclear ribonucleoprotein A0	106	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				3'-UTR-mediated mRNA stabilization (GO:0070935)|gene expression (GO:0010467)|inflammatory response (GO:0006954)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|response to lipopolysaccharide (GO:0032496)|RNA splicing (GO:0008380)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	AU-rich element binding (GO:0017091)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|RNA binding (GO:0003723)			large_intestine(1)|lung(2)|skin(1)	4			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			CCACGTCTCCTTTAAGGCCTC	0.612																																																	0													75.0	76.0	75.0					5																	137089438		2203	4300	6503	SO:0001819	synonymous_variant	0			U23803	CCDS4193.1	5q31	2013-02-12		2007-08-16	ENSG00000177733	ENSG00000177733		"""RNA binding motif (RRM) containing"""	5030	protein-coding gene	gene with protein product		609409		HNRPA0		7585247	Standard	NM_006805		Approved	hnRNPA0	uc003lbt.3	Q13151	OTTHUMG00000129156	ENST00000314940.4:c.318A>G	5.37:g.137089438T>C			Q6IB18	Silent	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.K106	ENST00000314940.4	37	c.318	CCDS4193.1	5																																																																																			HNRNPA0	-	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	ENSG00000177733		0.612	HNRNPA0-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HNRNPA0	HGNC	protein_coding	OTTHUMT00000251221.1	-	0.00	26	0	T	NM_006805		137089438	-1	tier1	-	no_errors	ENST00000314940	ensembl	human	known	74_37	silent	54.55	15	18	SNP	0.824	C
HYDIN	54768	genome.wustl.edu	37	16	70841857	70841857	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr16:70841857C>T	ENST00000393567.2	-	86	15142	c.14992G>A	c.(14992-14994)Gag>Aag	p.E4998K		NM_001270974.1	NP_001257903.1	Q4G0P3	HYDIN_HUMAN	HYDIN, axonemal central pair apparatus protein	4998					cilium assembly (GO:0042384)|cilium movement (GO:0003341)|epithelial cell development (GO:0002064)|trachea development (GO:0060438)|ventricular system development (GO:0021591)	cell projection (GO:0042995)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(12)|ovary(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	43		Ovarian(137;0.0654)				CCCTTGGTCTCACCCAGGTGG	0.557																																																	0													78.0	81.0	80.0					16																	70841857		1996	4163	6159	SO:0001583	missense	0			AK074472	CCDS10897.1, CCDS56004.1, CCDS56005.1, CCDS59269.1	16q22.2	2014-02-05	2012-01-06		ENSG00000157423	ENSG00000157423		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	19368	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 31"""	610812	"""hydrocephalus inducing"", ""hydrocephalus inducing homolog (mouse)"""			12719380, 23022101	Standard	NM_001198542		Approved	DKFZp434D0513, KIAA1864, PPP1R31, CILD5	uc031qwy.1	Q4G0P3	OTTHUMG00000137584	ENST00000393567.2:c.14992G>A	16.37:g.70841857C>T	ENSP00000377197:p.Glu4998Lys		A6NC70|A6NLZ0|B4DQY4|B4DRN4|F5H6V3|Q8N3H8|Q8N3P6|Q8TC08|Q96JG3|Q96SS4|Q9H5U3|Q9H9B8|Q9NTI0|Q9UBE5	Missense_Mutation	SNP	superfamily_P-loop_NTPase,superfamily_PapD-like	p.E4998K	ENST00000393567.2	37	c.14992	CCDS59269.1	16	.	.	.	.	.	.	.	.	.	.	C	36	5.685371	0.96784	.	.	ENSG00000157423	ENST00000393567;ENST00000316490	T	0.01099	5.34	6.17	6.17	0.99709	.	0.000000	0.31797	U	0.007056	T	0.06735	0.0172	M	0.84846	2.72	0.80722	D	1	D	0.55172	0.97	P	0.56434	0.798	T	0.44544	-0.9321	10	0.23302	T	0.38	.	20.4745	0.99168	0.0:1.0:0.0:0.0	.	4997	F8WD23	.	K	4998;4997	ENSP00000377197:E4998K	ENSP00000313052:E4997K	E	-	1	0	HYDIN	69399358	1.000000	0.71417	0.993000	0.49108	0.802000	0.45316	5.776000	0.68924	2.941000	0.99782	0.655000	0.94253	GAG	HYDIN	-	NULL	ENSG00000157423		0.557	HYDIN-001	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	HYDIN	HGNC	protein_coding	OTTHUMT00000398624.3	-	0.00	58	0	C			70841857	-1	tier1	-	no_errors	ENST00000393567	ensembl	human	putative	74_37	missense	50.00	18	18	SNP	0.999	T
IGFL2	147920	genome.wustl.edu	37	19	46664041	46664041	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr19:46664041G>C	ENST00000377693.4	+	3	280	c.244G>C	c.(244-246)Gat>Cat	p.D82H	IGFL2_ENST00000434646.2_Missense_Mutation_p.D93H|IGFL2_ENST00000600243.1_3'UTR|AC007193.6_ENST00000597989.1_lincRNA	NM_001135113.1	NP_001128585.1	Q6UWQ7	IGFL2_HUMAN	IGF-like family member 2	82						extracellular region (GO:0005576)				cervix(1)|lung(5)	6		Ovarian(192;0.0908)|all_neural(266;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.00493)|GBM - Glioblastoma multiforme(486;0.031)|Epithelial(262;0.247)		CTGCTGTCTTGATTCCTTTGG	0.527																																																	0													181.0	188.0	186.0					19																	46664041		2199	4299	6498	SO:0001583	missense	0			AY672112	CCDS46121.1, CCDS46122.1	19q13.32	2006-07-14							32929	protein-coding gene	gene with protein product		610545				14702039	Standard	NM_001002915		Approved	UNQ645	uc010xxv.2	Q6UWQ7		ENST00000377693.4:c.244G>C	19.37:g.46664041G>C	ENSP00000366922:p.Asp82His		E9PAV1|Q6B9Z3	Missense_Mutation	SNP	NULL	p.D93H	ENST00000377693.4	37	c.277	CCDS46121.1	19	.	.	.	.	.	.	.	.	.	.	G	9.249	1.040244	0.19669	.	.	ENSG00000204866	ENST00000434646;ENST00000377693	T;T	0.23754	1.89;1.89	2.6	0.25	0.15535	.	.	.	.	.	T	0.16769	0.0403	N	0.14661	0.345	0.09310	N	1	P;P	0.41569	0.731;0.755	B;B	0.44224	0.256;0.444	T	0.16867	-1.0388	9	0.59425	D	0.04	-26.8739	6.9972	0.24789	0.0:0.0:0.5089:0.4911	.	82;93	Q6UWQ7;Q6UWQ7-2	IGFL2_HUMAN;.	H	93;82	ENSP00000395219:D93H;ENSP00000366922:D82H	ENSP00000366922:D82H	D	+	1	0	IGFL2	51355881	0.000000	0.05858	0.000000	0.03702	0.026000	0.11368	-0.387000	0.07361	0.156000	0.19299	0.405000	0.27470	GAT	IGFL2	-	NULL	ENSG00000204866		0.527	IGFL2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	IGFL2	HGNC	protein_coding	OTTHUMT00000461705.1	-	0.00	79	0	G	NM_001002915		46664041	+1	tier1	-	no_errors	ENST00000434646	ensembl	human	known	74_37	missense	35.44	51	28	SNP	0.000	C
IL1B	3553	genome.wustl.edu	37	2	113593181	113593181	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr2:113593181C>T	ENST00000263341.2	-	3	271	c.61G>A	c.(61-63)Gac>Aac	p.D21N	IL1B_ENST00000491056.1_5'UTR	NM_000576.2	NP_000567.1	P01584	IL1B_HUMAN	interleukin 1, beta	21					activation of MAPK activity (GO:0000187)|apoptotic process (GO:0006915)|cell-cell signaling (GO:0007267)|cellular response to drug (GO:0035690)|cellular response to mechanical stimulus (GO:0071260)|cellular response to organic cyclic compound (GO:0071407)|cellular response to organic substance (GO:0071310)|cytokine-mediated signaling pathway (GO:0019221)|ectopic germ cell programmed cell death (GO:0035234)|embryo implantation (GO:0007566)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|fever generation (GO:0001660)|hyaluronan biosynthetic process (GO:0030213)|immune response (GO:0006955)|inflammatory response (GO:0006954)|interleukin-1 beta production (GO:0032611)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|MAPK cascade (GO:0000165)|monocyte aggregation (GO:0070487)|negative regulation of adiponectin secretion (GO:0070164)|negative regulation of cell proliferation (GO:0008285)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of glucose transport (GO:0010829)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of lipid catabolic process (GO:0050995)|negative regulation of lipid metabolic process (GO:0045833)|negative regulation of MAP kinase activity (GO:0043407)|neutrophil chemotaxis (GO:0030593)|positive regulation of angiogenesis (GO:0045766)|positive regulation of calcidiol 1-monooxygenase activity (GO:0060559)|positive regulation of cell adhesion molecule production (GO:0060355)|positive regulation of cell division (GO:0051781)|positive regulation of chemokine biosynthetic process (GO:0045080)|positive regulation of fever generation (GO:0031622)|positive regulation of gene expression (GO:0010628)|positive regulation of granulocyte macrophage colony-stimulating factor production (GO:0032725)|positive regulation of heterotypic cell-cell adhesion (GO:0034116)|positive regulation of histone acetylation (GO:0035066)|positive regulation of histone phosphorylation (GO:0033129)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of interleukin-6 biosynthetic process (GO:0045410)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of JNK cascade (GO:0046330)|positive regulation of lipid catabolic process (GO:0050996)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|positive regulation of mitosis (GO:0045840)|positive regulation of monocyte chemotactic protein-1 production (GO:0071639)|positive regulation of myosin light chain kinase activity (GO:0035505)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of prostaglandin secretion (GO:0032308)|positive regulation of protein export from nucleus (GO:0046827)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of T cell mediated immunity (GO:0002711)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|positive regulation vascular endothelial growth factor production (GO:0010575)|protein kinase B signaling (GO:0043491)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of insulin secretion (GO:0050796)|response to ATP (GO:0033198)|response to carbohydrate (GO:0009743)|sequestering of triglyceride (GO:0030730)|signal transduction (GO:0007165)|smooth muscle adaptation (GO:0014805)	cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|secretory granule (GO:0030141)	cytokine activity (GO:0005125)|interleukin-1 receptor binding (GO:0005149)|protein domain specific binding (GO:0019904)			breast(2)|central_nervous_system(1)|large_intestine(1)|lung(8)	12					Canakinumab(DB06168)|Gallium nitrate(DB05260)|Minocycline(DB01017)|Rilonacept(DB06372)	AAGAACAAGTCATCCTCATTG	0.408																																																	0													135.0	118.0	123.0					2																	113593181		2203	4300	6503	SO:0001583	missense	0			M15330	CCDS2102.1	2q14	2014-01-30			ENSG00000125538	ENSG00000125538		"""Interleukins and interleukin receptors"", ""Endogenous ligands"""	5992	protein-coding gene	gene with protein product		147720				2954882, 2989698	Standard	NM_000576		Approved	IL1F2, IL-1B, IL1-BETA	uc002tii.1	P01584	OTTHUMG00000131344	ENST00000263341.2:c.61G>A	2.37:g.113593181C>T	ENSP00000263341:p.Asp21Asn		Q53X59|Q53XX2|Q7M4S7|Q7RU01|Q96HE5|Q9UCT6	Missense_Mutation	SNP	pfam_IL-1,pfam_IL-1_propep,superfamily_Cytokine_IL1-like,smart_IL-1,prints_IL-1_beta,prints_IL-1_alpha/beta,prints_IL-1,prints_IL-1_fam/FGF_fam,prints_IL-1RA/IL-36	p.D21N	ENST00000263341.2	37	c.61	CCDS2102.1	2	.	.	.	.	.	.	.	.	.	.	C	13.12	2.143172	0.37825	.	.	ENSG00000125538	ENST00000263341;ENST00000418817;ENST00000432018;ENST00000416750	T;T;T;T	0.51817	0.69;0.69;0.69;0.69	4.64	1.8	0.24995	Interleukin-1 propeptide (1);	0.825816	0.11362	N	0.571784	T	0.41305	0.1153	L	0.61387	1.9	0.09310	N	1	B	0.23990	0.095	B	0.27608	0.081	T	0.39231	-0.9624	10	0.41790	T	0.15	0.3505	3.5732	0.07925	0.1999:0.5946:0.0:0.2055	.	21	P01584	IL1B_HUMAN	N	21	ENSP00000263341:D21N;ENSP00000407219:D21N;ENSP00000409680:D21N;ENSP00000400854:D21N	ENSP00000263341:D21N	D	-	1	0	IL1B	113309652	0.885000	0.30320	0.321000	0.25320	0.839000	0.47603	0.580000	0.23803	0.648000	0.30732	0.563000	0.77884	GAC	IL1B	-	pfam_IL-1_propep,prints_IL-1_beta	ENSG00000125538		0.408	IL1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL1B	HGNC	protein_coding	OTTHUMT00000254125.2	-	0.00	72	0	C	NM_000576		113593181	-1	tier1	-	no_errors	ENST00000263341	ensembl	human	known	74_37	missense	50.00	21	21	SNP	0.097	T
IL1B	3553	genome.wustl.edu	37	2	113593774	113593774	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr2:113593774C>T	ENST00000263341.2	-	2	243	c.33G>A	c.(31-33)atG>atA	p.M11I	IL1B_ENST00000491056.1_5'UTR	NM_000576.2	NP_000567.1	P01584	IL1B_HUMAN	interleukin 1, beta	11					activation of MAPK activity (GO:0000187)|apoptotic process (GO:0006915)|cell-cell signaling (GO:0007267)|cellular response to drug (GO:0035690)|cellular response to mechanical stimulus (GO:0071260)|cellular response to organic cyclic compound (GO:0071407)|cellular response to organic substance (GO:0071310)|cytokine-mediated signaling pathway (GO:0019221)|ectopic germ cell programmed cell death (GO:0035234)|embryo implantation (GO:0007566)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|fever generation (GO:0001660)|hyaluronan biosynthetic process (GO:0030213)|immune response (GO:0006955)|inflammatory response (GO:0006954)|interleukin-1 beta production (GO:0032611)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|MAPK cascade (GO:0000165)|monocyte aggregation (GO:0070487)|negative regulation of adiponectin secretion (GO:0070164)|negative regulation of cell proliferation (GO:0008285)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of glucose transport (GO:0010829)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of lipid catabolic process (GO:0050995)|negative regulation of lipid metabolic process (GO:0045833)|negative regulation of MAP kinase activity (GO:0043407)|neutrophil chemotaxis (GO:0030593)|positive regulation of angiogenesis (GO:0045766)|positive regulation of calcidiol 1-monooxygenase activity (GO:0060559)|positive regulation of cell adhesion molecule production (GO:0060355)|positive regulation of cell division (GO:0051781)|positive regulation of chemokine biosynthetic process (GO:0045080)|positive regulation of fever generation (GO:0031622)|positive regulation of gene expression (GO:0010628)|positive regulation of granulocyte macrophage colony-stimulating factor production (GO:0032725)|positive regulation of heterotypic cell-cell adhesion (GO:0034116)|positive regulation of histone acetylation (GO:0035066)|positive regulation of histone phosphorylation (GO:0033129)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of interleukin-6 biosynthetic process (GO:0045410)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of JNK cascade (GO:0046330)|positive regulation of lipid catabolic process (GO:0050996)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|positive regulation of mitosis (GO:0045840)|positive regulation of monocyte chemotactic protein-1 production (GO:0071639)|positive regulation of myosin light chain kinase activity (GO:0035505)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of prostaglandin secretion (GO:0032308)|positive regulation of protein export from nucleus (GO:0046827)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of T cell mediated immunity (GO:0002711)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|positive regulation vascular endothelial growth factor production (GO:0010575)|protein kinase B signaling (GO:0043491)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of insulin secretion (GO:0050796)|response to ATP (GO:0033198)|response to carbohydrate (GO:0009743)|sequestering of triglyceride (GO:0030730)|signal transduction (GO:0007165)|smooth muscle adaptation (GO:0014805)	cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|secretory granule (GO:0030141)	cytokine activity (GO:0005125)|interleukin-1 receptor binding (GO:0005149)|protein domain specific binding (GO:0019904)			breast(2)|central_nervous_system(1)|large_intestine(1)|lung(8)	12					Canakinumab(DB06168)|Gallium nitrate(DB05260)|Minocycline(DB01017)|Rilonacept(DB06372)	AATAAGCCATCATTTCACTGG	0.473																																																	0													116.0	100.0	106.0					2																	113593774		2203	4300	6503	SO:0001583	missense	0			M15330	CCDS2102.1	2q14	2014-01-30			ENSG00000125538	ENSG00000125538		"""Interleukins and interleukin receptors"", ""Endogenous ligands"""	5992	protein-coding gene	gene with protein product		147720				2954882, 2989698	Standard	NM_000576		Approved	IL1F2, IL-1B, IL1-BETA	uc002tii.1	P01584	OTTHUMG00000131344	ENST00000263341.2:c.33G>A	2.37:g.113593774C>T	ENSP00000263341:p.Met11Ile		Q53X59|Q53XX2|Q7M4S7|Q7RU01|Q96HE5|Q9UCT6	Missense_Mutation	SNP	pfam_IL-1,pfam_IL-1_propep,superfamily_Cytokine_IL1-like,smart_IL-1,prints_IL-1_beta,prints_IL-1_alpha/beta,prints_IL-1,prints_IL-1_fam/FGF_fam,prints_IL-1RA/IL-36	p.M11I	ENST00000263341.2	37	c.33	CCDS2102.1	2	.	.	.	.	.	.	.	.	.	.	C	5.135	0.210577	0.09757	.	.	ENSG00000125538	ENST00000263341;ENST00000418817;ENST00000432018;ENST00000416750	T;T;T;T	0.43294	0.95;0.95;0.95;0.95	4.44	2.6	0.31112	Interleukin-1 propeptide (1);	0.877706	0.10279	N	0.693706	T	0.31888	0.0811	L	0.39566	1.225	0.09310	N	1	B	0.18310	0.027	B	0.19666	0.026	T	0.27331	-1.0077	10	0.23302	T	0.38	0.1814	7.115	0.25411	0.0:0.7902:0.0:0.2098	.	11	P01584	IL1B_HUMAN	I	11	ENSP00000263341:M11I;ENSP00000407219:M11I;ENSP00000409680:M11I;ENSP00000400854:M11I	ENSP00000263341:M11I	M	-	3	0	IL1B	113310245	0.000000	0.05858	0.001000	0.08648	0.672000	0.39443	0.320000	0.19540	0.590000	0.29694	0.655000	0.94253	ATG	IL1B	-	pfam_IL-1_propep	ENSG00000125538		0.473	IL1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL1B	HGNC	protein_coding	OTTHUMT00000254125.2	-	0.00	33	0	C	NM_000576		113593774	-1	tier1	-	no_errors	ENST00000263341	ensembl	human	known	74_37	missense	43.48	13	10	SNP	0.003	T
TAF1	6872	genome.wustl.edu	37	X	70712092	70712092	+	Intron	SNP	G	G	C			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chrX:70712092G>C	ENST00000461764.1	+	9	1008				Y_RNA_ENST00000362881.1_RNA|INGX_ENST00000489074.2_RNA			P21675	TAF1_HUMAN	TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 250kDa						cellular response to DNA damage stimulus (GO:0006974)|DNA-templated transcription, initiation (GO:0006352)|gene expression (GO:0010467)|histone acetylation (GO:0016573)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|protein autophosphorylation (GO:0046777)|regulation of transcription involved in G2/M transition of mitotic cell cycle (GO:0000117)|RNA polymerase II transcriptional preinitiation complex assembly (GO:0051123)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	MLL1 complex (GO:0071339)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)	ATP binding (GO:0005524)|histone acetyltransferase activity (GO:0004402)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|protein serine/threonine kinase activity (GO:0004674)|sequence-specific DNA binding (GO:0043565)|TBP-class protein binding (GO:0017025)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)			breast(13)|central_nervous_system(6)|cervix(1)|endometrium(25)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(16)|lung(34)|ovary(9)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(3)	124	Renal(35;0.156)	all_lung(315;0.000321)				TGTCGCAGCGGATCATCTCCC	0.597																																																	0																																										SO:0001627	intron_variant	0				CCDS14412.1, CCDS35325.1, CCDS69783.1	Xq13.1	2011-07-01	2002-08-29	2001-12-07	ENSG00000147133	ENSG00000147133		"""Chromatin-modifying enzymes / K-acetyltransferases"""	11535	protein-coding gene	gene with protein product		313650	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, A, 250kD"", ""dystonia 3 (with Parkinsonism)"""	TAF2A, BA2R, CCG1, CCGS, DYT3		3556424, 12928496, 17952504	Standard	XM_005262295		Approved	NSCL2, TAFII250, KAT4, DYT3/TAF1	uc004dzt.4	P21675	OTTHUMG00000022723	ENST00000461764.1:c.1008+31439G>C	X.37:g.70712092G>C			A5CVC8|A5CVC9|A5CVD0|A5CVD1|B1Q2X3|Q59FZ3|Q6IUZ1|Q70Q86|Q70Q87|Q70T00|Q70T01|Q70T02|Q70T03	RNA	SNP	-	NULL	ENST00000461764.1	37	NULL		X																																																																																			INGX	-	-	ENSG00000243468		0.597	TAF1-021	KNOWN	mRNA_end_NF|basic	processed_transcript	INGX	HGNC	protein_coding	OTTHUMT00000081821.1	-	0.00	27	0	G	NM_004606		70712092	-1	tier1	-	no_errors	ENST00000489074	ensembl	human	known	74_37	rna	36.36	14	8	SNP	1.000	C
ISM1	140862	genome.wustl.edu	37	20	13280008	13280009	+	Frame_Shift_Ins	INS	-	-	A			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr20:13280008_13280009insA	ENST00000262487.4	+	6	1303_1304	c.1297_1298insA	c.(1297-1299)tatfs	p.Y433fs	TASP1_ENST00000539805.1_Intron	NM_080826.1	NP_543016.1	B1AKI9	ISM1_HUMAN	isthmin 1, angiogenesis inhibitor	433	AMOP. {ECO:0000255|PROSITE- ProRule:PRU00347}.					extracellular region (GO:0005576)				NS(1)|autonomic_ganglia(1)|endometrium(1)|large_intestine(8)|lung(5)|urinary_tract(1)	17						CTGGAGCAGGTATAACGAGGCC	0.584																																																	0																																										SO:0001589	frameshift_variant	0			AL133463	CCDS46579.1	20p12.1	2013-05-15	2013-05-15	2008-12-23	ENSG00000101230	ENSG00000101230			16213	protein-coding gene	gene with protein product		615793	"""chromosome 20 open reading frame 82"", ""isthmin 1 homolog (zebrafish)"""	C20orf82			Standard	NM_080826		Approved	bA149I18.1	uc010gce.1	B1AKI9		ENST00000262487.4:c.1298dupA	20.37:g.13280009_13280009dupA	ENSP00000262487:p.Tyr433fs		Q8WVH9	Frame_Shift_Ins	INS	pfam_AMOP,pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,smart_AMOP,pfscan_AMOP,pfscan_Thrombospondin_1_rpt	p.Y433fs	ENST00000262487.4	37	c.1297_1298	CCDS46579.1	20																																																																																			ISM1	-	pfam_AMOP,smart_AMOP,pfscan_AMOP	ENSG00000101230		0.584	ISM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ISM1	HGNC	protein_coding	OTTHUMT00000078039.2		0.00	25	0	-			13280009	+1	tier1		no_errors	ENST00000262487	ensembl	human	known	74_37	frame_shift_ins	45.45	6	5	INS	1.000:1.000	A
JUP	3728	genome.wustl.edu	37	17	39921275	39921275	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr17:39921275G>C	ENST00000393931.3	-	6	1072	c.954C>G	c.(952-954)atC>atG	p.I318M	JUP_ENST00000540235.1_Intron|JUP_ENST00000393930.1_Missense_Mutation_p.I318M|JUP_ENST00000310706.5_Missense_Mutation_p.I318M	NM_002230.2	NP_002221.1	P14923	PLAK_HUMAN	junction plakoglobin	318					adherens junction organization (GO:0034332)|atrioventricular valve morphogenesis (GO:0003181)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cell junction assembly (GO:0034329)|cell migration (GO:0016477)|cell morphogenesis (GO:0000902)|cell-cell junction organization (GO:0045216)|cellular response to indole-3-methanol (GO:0071681)|cytoskeletal anchoring at plasma membrane (GO:0007016)|desmosome assembly (GO:0002159)|detection of mechanical stimulus (GO:0050982)|ectoderm development (GO:0007398)|endothelial cell-cell adhesion (GO:0071603)|establishment of protein localization to plasma membrane (GO:0090002)|gastrulation (GO:0007369)|morphogenesis of embryonic epithelium (GO:0016331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of Wnt signaling pathway involved in heart development (GO:0003308)|nervous system development (GO:0007399)|oocyte development (GO:0048599)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein heterooligomerization (GO:0051291)|regulation of cell proliferation (GO:0042127)|regulation of heart rate by cardiac conduction (GO:0086091)|single organismal cell-cell adhesion (GO:0016337)|skin development (GO:0043588)|ventricular cardiac muscle cell action potential (GO:0086005)	actin cytoskeleton (GO:0015629)|apicolateral plasma membrane (GO:0016327)|basolateral plasma membrane (GO:0016323)|catenin complex (GO:0016342)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|gamma-catenin-TCF7L2 complex (GO:0071665)|intercalated disc (GO:0014704)|intermediate filament (GO:0005882)|lateral plasma membrane (GO:0016328)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|cadherin binding (GO:0045296)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|structural constituent of cell wall (GO:0005199)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(4)|lung(6)|ovary(3)|upper_aerodigestive_tract(1)	23		Breast(137;0.000162)	BRCA - Breast invasive adenocarcinoma(4;0.233)	BRCA - Breast invasive adenocarcinoma(366;0.15)		AGTTACGCATGATCTGCACGA	0.537																																					Colon(16;42 520 6044 17852 28530)												0													135.0	111.0	119.0					17																	39921275		2203	4300	6503	SO:0001583	missense	0			AF233882	CCDS11407.1	17q21	2014-09-17	2004-08-09		ENSG00000173801	ENSG00000173801		"""Armadillo repeat containing"""	6207	protein-coding gene	gene with protein product		173325	"""catenin (cadherin-associated protein), gamma 80kDa"""	CTNNG		1889810, 7604000	Standard	NM_021991		Approved	DP3, PDGB, PKGB, DPIII	uc002hxs.2	P14923	OTTHUMG00000133494	ENST00000393931.3:c.954C>G	17.37:g.39921275G>C	ENSP00000377508:p.Ile318Met		Q15093|Q15151|Q7L3S5|Q86W21|Q9BWC4|Q9HCX9	Missense_Mutation	SNP	pfam_Armadillo,superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo,prints_Beta-catenin	p.I318M	ENST00000393931.3	37	c.954	CCDS11407.1	17	.	.	.	.	.	.	.	.	.	.	G	24.4	4.522462	0.85600	.	.	ENSG00000173801	ENST00000393930;ENST00000310706;ENST00000393931	T;T;T	0.65364	-0.15;-0.15;-0.15	6.08	5.11	0.69529	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.81927	0.4926	M	0.88310	2.945	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.85744	0.1339	10	0.87932	D	0	-50.974	14.4491	0.67372	0.0712:0.0:0.9288:0.0	.	318	P14923	PLAK_HUMAN	M	318	ENSP00000377507:I318M;ENSP00000311113:I318M;ENSP00000377508:I318M	ENSP00000311113:I318M	I	-	3	3	JUP	37174801	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.988000	0.56951	1.586000	0.49944	0.655000	0.94253	ATC	JUP	-	superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo,prints_Beta-catenin	ENSG00000173801		0.537	JUP-008	KNOWN	basic|appris_principal|CCDS	protein_coding	JUP	HGNC	protein_coding	OTTHUMT00000257406.1		0.00	27	0	G			39921275	-1			no_errors	ENST00000310706	ensembl	human	known	74_37	missense	10.00	27	3	SNP	1.000	C
ADGB	79747	genome.wustl.edu	37	6	147123814	147123815	+	Intron	INS	-	-	A	rs542629056|rs112256903	byFrequency	TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr6:147123814_147123815insA	ENST00000397944.3	+	35	4894				KATNBL1P6_ENST00000562413.2_RNA|ADGB_ENST00000367493.3_Intron|ADGB_ENST00000367488.1_Intron	NM_024694.3	NP_078970.3	Q8N7X0	ADGB_HUMAN	androglobin						oxygen transport (GO:0015671)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)	calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)			breast(1)|endometrium(2)|kidney(2)	5						CTTTTTAAAAGAAAAAATAGTT	0.332													AAAAAA|AAAAAA|AAAAAAA|insertion	23	0.00459265	0.0166	0.0014	5008	,	,		16790	0.0		0.0	False		,,,				2504	0.0																0																																										SO:0001627	intron_variant	0			AK026774		6q24.2	2012-02-03	2012-02-03	2012-02-03	ENSG00000118492	ENSG00000118492			21212	protein-coding gene	gene with protein product		614630	"""chromosome 6 open reading frame 103"""	C6orf103		22115833	Standard	NM_024694		Approved	FLJ23121, dJ408K24.1	uc010khx.3	Q8N7X0	OTTHUMG00000015758	ENST00000397944.3:c.4818+667->A	6.37:g.147123820_147123820dupA			Q5T402|Q5T904|Q5T905	RNA	INS	-	NULL	ENST00000397944.3	37	NULL		6																																																																																			KATNBL1P6	-	-	ENSG00000228283		0.332	ADGB-009	KNOWN	basic|appris_principal	protein_coding	KATNBL1P6	HGNC	protein_coding	OTTHUMT00000376350.2		0.00	57	0	-	NM_024694		147123815	-1	tier1		no_errors	ENST00000562413	ensembl	human	known	74_37	rna	16.13	26	5	INS	0.020:0.033	A
KCNA4	3739	genome.wustl.edu	37	11	30034490	30034490	+	5'UTR	SNP	C	C	T	rs557468064	byFrequency	TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr11:30034490C>T	ENST00000328224.6	-	0	969				KCNA4_ENST00000526518.1_5'UTR	NM_002233.3	NP_002224.1	P22459	KCNA4_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 4						potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	potassium ion binding (GO:0030955)|voltage-gated potassium channel activity (GO:0005249)			central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(17)|lung(39)|ovary(3)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	78					Dalfampridine(DB06637)	CTAAGAAGTCCGAAAATGCTG	0.463													C|||	8	0.00159744	0.0	0.0	5008	,	,		16457	0.001		0.0	False		,,,				2504	0.0072																0																																										SO:0001623	5_prime_UTR_variant	0			M55514	CCDS41629.1	11p14	2012-07-05	2002-07-10			ENSG00000182255		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6222	protein-coding gene	gene with protein product		176266	"""potassium voltage-gated channel, shaker-related subfamily, member 4-like"""	KCNA4L		2263489, 16382104	Standard	NM_002233		Approved	Kv1.4, HK1, HPCN2	uc001msk.3	P22459		ENST00000328224.6:c.-265G>A	11.37:g.30034490C>T				RNA	SNP	-	NULL	ENST00000328224.6	37	NULL	CCDS41629.1	11																																																																																			KCNA4	-	-	ENSG00000182255		0.463	KCNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNA4	HGNC	protein_coding	OTTHUMT00000388074.2	-	0.00	47	0	C	NM_002233		30034490	-1	tier1	-	no_errors	ENST00000526518	ensembl	human	putative	74_37	rna	50.00	14	14	SNP	0.029	T
ICE1	23379	genome.wustl.edu	37	5	5465103	5465103	+	Nonsense_Mutation	SNP	G	G	T			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr5:5465103G>T	ENST00000296564.7	+	13	5878	c.5656G>T	c.(5656-5658)Gaa>Taa	p.E1886*		NM_015325.2	NP_056140.1	Q9Y2F5	ICE1_HUMAN		1886					positive regulation of intracellular protein transport (GO:0090316)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|snRNA transcription from RNA polymerase II promoter (GO:0042795)|snRNA transcription from RNA polymerase III promoter (GO:0042796)	Cajal body (GO:0015030)|histone locus body (GO:0035363)|transcription elongation factor complex (GO:0008023)|transcriptionally active chromatin (GO:0035327)	protein homodimerization activity (GO:0042803)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(14)|ovary(1)|prostate(4)|upper_aerodigestive_tract(1)	35						AACAAATGAGGAAAGAAGTTG	0.493																																																	0													74.0	72.0	73.0					5																	5465103		1891	4114	6005	SO:0001587	stop_gained	0																														ENST00000296564.7:c.5656G>T	5.37:g.5465103G>T	ENSP00000296564:p.Glu1886*		Q68DE1|Q6ZT40|Q7L587|Q7Z3A9|Q9NTH9	Nonsense_Mutation	SNP	superfamily_Vitellinogen_superhlx	p.E1886*	ENST00000296564.7	37	c.5656	CCDS47187.1	5	.	.	.	.	.	.	.	.	.	.	G	46	12.732059	0.99692	.	.	ENSG00000164151	ENST00000296564	.	.	.	5.6	3.82	0.43975	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.33940	T	0.23	-2.1019	9.5887	0.39532	0.0786:0.1426:0.7788:0.0	.	.	.	.	X	1886	.	ENSP00000296564:E1886X	E	+	1	0	KIAA0947	5518103	0.008000	0.16893	0.002000	0.10522	0.240000	0.25518	1.727000	0.38095	0.733000	0.32492	0.467000	0.42956	GAA	KIAA0947	-	NULL	ENSG00000164151		0.493	KIAA0947-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0947	HGNC	protein_coding	OTTHUMT00000365575.1	-	0.00	33	0	G			5465103	+1	tier1	-	no_errors	ENST00000296564	ensembl	human	known	74_37	nonsense	10.64	42	5	SNP	0.011	T
ICE1	23379	genome.wustl.edu	37	5	5473686	5473686	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr5:5473686G>A	ENST00000296564.7	+	16	6460	c.6238G>A	c.(6238-6240)Gtt>Att	p.V2080I		NM_015325.2	NP_056140.1	Q9Y2F5	ICE1_HUMAN		2080					positive regulation of intracellular protein transport (GO:0090316)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|snRNA transcription from RNA polymerase II promoter (GO:0042795)|snRNA transcription from RNA polymerase III promoter (GO:0042796)	Cajal body (GO:0015030)|histone locus body (GO:0035363)|transcription elongation factor complex (GO:0008023)|transcriptionally active chromatin (GO:0035327)	protein homodimerization activity (GO:0042803)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(14)|ovary(1)|prostate(4)|upper_aerodigestive_tract(1)	35						CCCGGTAGATGTTGGCTTCAT	0.333																																																	0													54.0	51.0	52.0					5																	5473686		1831	4084	5915	SO:0001583	missense	0																														ENST00000296564.7:c.6238G>A	5.37:g.5473686G>A	ENSP00000296564:p.Val2080Ile		Q68DE1|Q6ZT40|Q7L587|Q7Z3A9|Q9NTH9	Missense_Mutation	SNP	superfamily_Vitellinogen_superhlx	p.V2080I	ENST00000296564.7	37	c.6238	CCDS47187.1	5	.	.	.	.	.	.	.	.	.	.	G	17.13	3.311931	0.60414	.	.	ENSG00000164151	ENST00000296564	T	0.12465	2.68	5.43	5.43	0.79202	.	.	.	.	.	T	0.16171	0.0389	L	0.45581	1.43	0.33239	D	0.557007	P	0.40638	0.725	B	0.42827	0.399	T	0.11324	-1.0592	9	0.48119	T	0.1	-13.1055	10.2218	0.43201	0.09:0.0:0.91:0.0	.	2080	Q9Y2F5	K0947_HUMAN	I	2080	ENSP00000296564:V2080I	ENSP00000296564:V2080I	V	+	1	0	KIAA0947	5526686	1.000000	0.71417	0.999000	0.59377	0.979000	0.70002	2.259000	0.43259	2.558000	0.86282	0.650000	0.86243	GTT	KIAA0947	-	NULL	ENSG00000164151		0.333	KIAA0947-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0947	HGNC	protein_coding	OTTHUMT00000365575.1	-	0.00	29	0	G			5473686	+1	tier1	-	no_errors	ENST00000296564	ensembl	human	known	74_37	missense	12.07	51	7	SNP	1.000	A
KIF2C	11004	genome.wustl.edu	37	1	45228229	45228229	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr1:45228229G>C	ENST00000372224.4	+	19	1983	c.1870G>C	c.(1870-1872)Gag>Cag	p.E624Q	RP11-269F19.2_ENST00000428791.1_RNA|RP11-269F19.2_ENST00000440985.1_RNA|KIF2C_ENST00000372218.4_Missense_Mutation_p.E583Q|KIF2C_ENST00000372217.1_Missense_Mutation_p.E570Q|KIF2C_ENST00000372222.3_Missense_Mutation_p.E511Q	NM_006845.3	NP_006836.2	Q99661	KIF2C_HUMAN	kinesin family member 2C	624					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|cell proliferation (GO:0008283)|chromosome segregation (GO:0007059)|establishment or maintenance of microtubule cytoskeleton polarity (GO:0030951)|metabolic process (GO:0008152)|microtubule depolymerization (GO:0007019)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|regulation of chromosome segregation (GO:0051983)	chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|centromeric DNA binding (GO:0019237)|microtubule motor activity (GO:0003777)|microtubule plus-end binding (GO:0051010)			breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(16)|ovary(1)|skin(1)|urinary_tract(1)	34	Acute lymphoblastic leukemia(166;0.155)					ATCCAAGGAAGAGGAGGAACT	0.517																																																	0													103.0	93.0	96.0					1																	45228229		2203	4300	6503	SO:0001583	missense	0			U63743	CCDS512.1, CCDS72774.1	1p34.1	2014-01-21	2003-01-13	2003-01-17	ENSG00000142945	ENSG00000142945		"""Kinesins"""	6393	protein-coding gene	gene with protein product		604538	"""kinesin-like 6 (mitotic centromere-associated kinesin)"""	KNSL6		9434124	Standard	NM_006845		Approved	MCAK, CT139	uc001cmg.4	Q99661	OTTHUMG00000008416	ENST00000372224.4:c.1870G>C	1.37:g.45228229G>C	ENSP00000361298:p.Glu624Gln		B3ITR9|Q5JR88|Q6ICU1|Q96C18|Q96HB8|Q9BWV8	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.E624Q	ENST00000372224.4	37	c.1870	CCDS512.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.68|19.68	3.873121|3.873121	0.72180|0.72180	.|.	.|.	ENSG00000142945|ENSG00000142945	ENST00000372224;ENST00000372218;ENST00000372222;ENST00000372217|ENST00000423289	T;T;T;T|.	0.76060|.	-0.99;-0.79;-0.97;-0.99|.	6.17|6.17	6.17|6.17	0.99709|0.99709	.|.	0.133374|.	0.51477|.	D|.	0.000084|.	T|T	0.49236|0.49236	0.1545|0.1545	N|N	0.08118|0.08118	0|0	0.80722|0.80722	D|D	1|1	P;P;P|.	0.47910|.	0.651;0.571;0.902|.	B;B;B|.	0.41571|.	0.136;0.266;0.36|.	T|T	0.41680|0.41680	-0.9495|-0.9495	10|5	0.87932|.	D|.	0|.	.|.	20.8794|20.8794	0.99867|0.99867	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	583;570;624|.	B7Z6Q6;Q99661-2;Q99661|.	.;.;KIF2C_HUMAN|.	Q|N	624;583;511;570|88	ENSP00000361298:E624Q;ENSP00000361292:E583Q;ENSP00000361296:E511Q;ENSP00000361291:E570Q|.	ENSP00000361291:E570Q|.	E|K	+|+	1|3	0|2	KIF2C|KIF2C	45000816|45000816	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.707000|0.707000	0.40811|0.40811	6.697000|6.697000	0.74603|0.74603	2.941000|2.941000	0.99782|0.99782	0.655000|0.655000	0.94253|0.94253	GAG|AAG	KIF2C	-	NULL	ENSG00000142945		0.517	KIF2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF2C	HGNC	protein_coding	OTTHUMT00000023180.1	-	0.00	33	0	G	NM_006845		45228229	+1	tier1	-	no_errors	ENST00000372224	ensembl	human	known	74_37	missense	21.43	22	6	SNP	1.000	C
KPNA3	3839	genome.wustl.edu	37	13	50366638	50366638	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr13:50366638G>T	ENST00000261667.3	-	1	419	c.5C>A	c.(4-6)gCc>gAc	p.A2D		NM_002267.3	NP_002258.2	O00505	IMA4_HUMAN	karyopherin alpha 3 (importin alpha 4)	2	IBB. {ECO:0000255|PROSITE- ProRule:PRU00561}.				cytokine-mediated signaling pathway (GO:0019221)|NLS-bearing protein import into nucleus (GO:0006607)|protein complex assembly (GO:0006461)|viral entry into host cell (GO:0046718)|viral penetration into host nucleus (GO:0075732)	cytosol (GO:0005829)|nuclear pore (GO:0005643)|nucleoplasm (GO:0005654)	nuclear localization sequence binding (GO:0008139)|protein transporter activity (GO:0008565)			cervix(1)|endometrium(3)|large_intestine(4)|liver(1)|lung(5)|ovary(1)|skin(1)|stomach(1)|urinary_tract(4)	21		Lung NSC(96;2.46e-05)|Breast(56;9.7e-05)|Prostate(109;0.00174)|Hepatocellular(98;0.0207)|Myeloproliferative disorder(33;0.163)|Lung SC(185;0.187)|all_neural(104;0.19)		GBM - Glioblastoma multiforme(99;1.42e-09)		GGGGTTCTCGGCCATGGCTGC	0.711																																																	0													56.0	57.0	56.0					13																	50366638		2203	4300	6503	SO:0001583	missense	0			D89618	CCDS9421.1	13q14.3	2013-02-14			ENSG00000102753	ENSG00000102753		"""Importins"", ""Armadillo repeat containing"""	6396	protein-coding gene	gene with protein product		601892				9154134, 9435235	Standard	NM_002267		Approved	SRP1gamma, SRP4, hSRP1, IPOA4	uc001vdj.2	O00505	OTTHUMG00000016922	ENST00000261667.3:c.5C>A	13.37:g.50366638G>T	ENSP00000261667:p.Ala2Asp		O00191|O43195|Q5JVM9|Q96AA7	Missense_Mutation	SNP	pfam_Armadillo,pfam_Importin-a_IBB,pfam_HEAT,superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo,pfscan_Importin-a_IBB	p.A2D	ENST00000261667.3	37	c.5	CCDS9421.1	13	.	.	.	.	.	.	.	.	.	.	G	21.1	4.103646	0.76983	.	.	ENSG00000102753	ENST00000261667	T	0.09445	2.98	3.87	2.08	0.27032	Importin-alpha, importin-beta-binding domain (1);	0.066672	0.64402	U	0.000016	T	0.08088	0.0202	N	0.08118	0	0.58432	D	0.999994	D	0.54047	0.964	P	0.50970	0.655	T	0.30297	-0.9983	10	0.87932	D	0	-3.8665	7.056	0.25099	0.0964:0.0:0.7332:0.1703	.	2	O00505	IMA3_HUMAN	D	2	ENSP00000261667:A2D	ENSP00000261667:A2D	A	-	2	0	KPNA3	49264639	1.000000	0.71417	0.983000	0.44433	0.935000	0.57460	7.242000	0.78210	0.140000	0.18849	0.446000	0.29264	GCC	KPNA3	-	pfscan_Importin-a_IBB	ENSG00000102753		0.711	KPNA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KPNA3	HGNC	protein_coding	OTTHUMT00000044939.2	-	0.00	61	0	G	NM_002267		50366638	-1	tier1	-	no_errors	ENST00000261667	ensembl	human	known	74_37	missense	8.70	42	4	SNP	1.000	T
KRTAP5-5	439915	genome.wustl.edu	37	11	1651712	1651712	+	Silent	SNP	A	A	G			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr11:1651712A>G	ENST00000399676.2	+	1	680	c.642A>G	c.(640-642)caA>caG	p.Q214Q		NM_001001480.2	NP_001001480.2	Q701N2	KRA55_HUMAN	keratin associated protein 5-5	214	8 X 4 AA repeats of C-C-X-P.					keratin filament (GO:0045095)				endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(17)|ovary(2)|prostate(5)|urinary_tract(1)	33		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		CCTGCTGCCAATCCAGCTGCT	0.592																																																	0													113.0	119.0	117.0					11																	1651712		2202	4299	6501	SO:0001819	synonymous_variant	0			AB125074	CCDS41592.1	11p15.5	2008-10-30			ENSG00000185940	ENSG00000185940		"""Keratin associated proteins"""	23601	protein-coding gene	gene with protein product						15144888	Standard	NM_001001480		Approved	KRTAP5.5, KRTAP5-11	uc001lty.3	Q701N2	OTTHUMG00000057554	ENST00000399676.2:c.642A>G	11.37:g.1651712A>G			A8MWN2	Silent	SNP	NULL	p.Q214	ENST00000399676.2	37	c.642	CCDS41592.1	11																																																																																			KRTAP5-5	-	NULL	ENSG00000185940		0.592	KRTAP5-5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP5-5	HGNC	protein_coding	OTTHUMT00000127919.1	-	0.00	179	0	A			1651712	+1	tier1	-	no_errors	ENST00000399676	ensembl	human	known	74_37	silent	10.81	132	16	SNP	0.996	G
KRTAP5-5	439915	genome.wustl.edu	37	11	1651723	1651724	+	Missense_Mutation	DNP	AC	AC	GT			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	A|C	A|C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr11:1651723_1651724AC>GT	ENST00000399676.2	+	1	691_692	c.653_654AC>GT	c.(652-654)tAC>tGT	p.Y218C		NM_001001480.2	NP_001001480.2	Q701N2	KRA55_HUMAN	keratin associated protein 5-5	218	8 X 4 AA repeats of C-C-X-P.					keratin filament (GO:0045095)				endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(17)|ovary(2)|prostate(5)|urinary_tract(1)	33		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		TCCAGCTGCTACAAGCCCTGCT	0.594																																																	0																																										SO:0001583	missense	0			AB125074	CCDS41592.1	11p15.5	2008-10-30			ENSG00000185940	ENSG00000185940		"""Keratin associated proteins"""	23601	protein-coding gene	gene with protein product						15144888	Standard	NM_001001480		Approved	KRTAP5.5, KRTAP5-11	uc001lty.3	Q701N2	OTTHUMG00000057554	Exception_encountered	11.37:g.1651723_1651724delinsGT	ENSP00000382584:p.Tyr218Cys		A8MWN2	Missense_Mutation|Silent	SNP	NULL	p.Y218C|p.Y218	ENST00000399676.2	37	c.653|c.654	CCDS41592.1	11																																																																																			KRTAP5-5	-	NULL	ENSG00000185940		0.594	KRTAP5-5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP5-5	HGNC	protein_coding	OTTHUMT00000127919.1	-	0.00	182|180	0	A|C			1651723|1651724	+1	tier1	-	no_errors	ENST00000399676	ensembl	human	known	74_37	missense|silent	10.97|10.26	138|140	17|16	SNP	0.999	G|T
KTN1	3895	genome.wustl.edu	37	14	56120290	56120290	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr14:56120290C>T	ENST00000395314.3	+	28	2845	c.2777C>T	c.(2776-2778)tCa>tTa	p.S926L	Y_RNA_ENST00000363872.1_RNA|KTN1_ENST00000413890.2_Missense_Mutation_p.S903L|KTN1_ENST00000395309.3_Missense_Mutation_p.S926L|KTN1_ENST00000395308.1_Missense_Mutation_p.S903L|KTN1_ENST00000438792.2_Missense_Mutation_p.S926L|KTN1_ENST00000395311.1_Missense_Mutation_p.S903L|KTN1_ENST00000554507.1_Missense_Mutation_p.S221L|KTN1_ENST00000416613.1_Missense_Mutation_p.S926L	NM_001079521.1	NP_001072989.1	Q86UP2	KTN1_HUMAN	kinectin 1 (kinesin receptor)	926					microtubule-based movement (GO:0007018)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)			breast(4)|central_nervous_system(1)|large_intestine(8)|lung(1)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	19						TCTTCTGCATCACAGTTTGAA	0.343			T	RET	papillary thryoid																																			Dom	yes		14	14q22.1	3895	kinectin 1 (kinesin receptor)		E	0													93.0	89.0	91.0					14																	56120290		2203	4299	6502	SO:0001583	missense	0				CCDS41957.1, CCDS41958.1, CCDS41959.1	14q22.1	2008-05-02			ENSG00000126777	ENSG00000126777			6467	protein-coding gene	gene with protein product		600381				9605849	Standard	NM_001079521		Approved	KIAA0004, CG1	uc001xcc.3	Q86UP2	OTTHUMG00000140312	ENST00000395314.3:c.2777C>T	14.37:g.56120290C>T	ENSP00000378725:p.Ser926Leu		B4DZ88|Q13999|Q14707|Q15387|Q17RZ5|Q5GGW3|Q86W57	Missense_Mutation	SNP	NULL	p.S926L	ENST00000395314.3	37	c.2777	CCDS41957.1	14	.	.	.	.	.	.	.	.	.	.	C	10.97	1.501687	0.26949	.	.	ENSG00000126777	ENST00000413890;ENST00000395309;ENST00000438792;ENST00000395314;ENST00000395308;ENST00000395311;ENST00000416613;ENST00000554507	T;T;T;T;T;T;T;T	0.46819	1.4;1.46;1.45;1.46;1.4;1.4;1.46;0.86	5.07	4.17	0.49024	.	0.169925	0.28057	N	0.016768	T	0.36771	0.0979	N	0.21448	0.665	0.30807	N	0.739216	B;B;P;B;B	0.40875	0.041;0.186;0.731;0.041;0.019	B;B;P;B;B	0.45232	0.032;0.106;0.474;0.032;0.023	T	0.25745	-1.0123	10	0.24483	T	0.36	-0.9758	10.6415	0.45596	0.0:0.9106:0.0:0.0894	.	926;221;926;903;926	B4DZ88;G3V4Y7;Q86UP2-2;Q17RZ5;Q86UP2	.;.;.;.;KTN1_HUMAN	L	903;926;926;926;903;903;926;221	ENSP00000394992:S903L;ENSP00000378720:S926L;ENSP00000391964:S926L;ENSP00000378725:S926L;ENSP00000378719:S903L;ENSP00000378722:S903L;ENSP00000388807:S926L;ENSP00000452073:S221L	ENSP00000378719:S903L	S	+	2	0	KTN1	55190043	1.000000	0.71417	0.947000	0.38551	0.415000	0.31203	2.199000	0.42715	2.509000	0.84616	0.557000	0.71058	TCA	KTN1	-	NULL	ENSG00000126777		0.343	KTN1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KTN1	HGNC	protein_coding	OTTHUMT00000276912.2	-	0.00	29	0	C			56120290	+1	tier1	-	no_errors	ENST00000395309	ensembl	human	known	74_37	missense	30.43	16	7	SNP	1.000	T
LEPR	3953	genome.wustl.edu	37	1	66075661	66075661	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr1:66075661C>T	ENST00000349533.6	+	13	1969	c.1784C>T	c.(1783-1785)tCt>tTt	p.S595F	LEPR_ENST00000406510.3_Intron|LEPR_ENST00000462765.1_3'UTR|LEPR_ENST00000371059.3_Missense_Mutation_p.S595F|LEPR_ENST00000371060.3_Missense_Mutation_p.S595F|LEPR_ENST00000371058.1_Missense_Mutation_p.S595F|LEPR_ENST00000344610.8_Missense_Mutation_p.S595F	NM_002303.5	NP_002294.2	O15243	OBRG_HUMAN	leptin receptor	0					negative regulation of growth hormone receptor signaling pathway (GO:0060400)|negative regulation of JAK-STAT cascade (GO:0046426)|negative regulation of protein localization to cell surface (GO:2000009)	endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	receptor binding (GO:0005102)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(22)|skin(2)	36				OV - Ovarian serous cystadenocarcinoma(397;0.00722)|KIRC - Kidney renal clear cell carcinoma(1967;0.094)		AAATCAAAATCTGTCAGTCTC	0.408																																																	0													176.0	173.0	174.0					1																	66075661		2203	4300	6503	SO:0001583	missense	0			U43168	CCDS631.1, CCDS30740.1, CCDS30741.1, CCDS55604.1	1p31	2014-09-17			ENSG00000116678	ENSG00000116678		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6554	protein-coding gene	gene with protein product		601007				8548812, 8812446	Standard	NM_001003680		Approved	OBR, CD295	uc001dci.3	P48357	OTTHUMG00000009115	ENST00000349533.6:c.1784C>T	1.37:g.66075661C>T	ENSP00000330393:p.Ser595Phe		Q6FHL5	Missense_Mutation	SNP	pfam_IgC2-like_lig-bd,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.S595F	ENST00000349533.6	37	c.1784	CCDS631.1	1	.	.	.	.	.	.	.	.	.	.	C	4.309	0.056585	0.08291	.	.	ENSG00000116678	ENST00000344610;ENST00000349533;ENST00000371060;ENST00000371059;ENST00000371058	T;T;T;T;T	0.57107	0.42;0.42;0.42;0.42;0.42	5.31	4.4	0.53042	Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.531595	0.21594	N	0.072054	T	0.25568	0.0622	M	0.64676	1.99	0.23865	N	0.996623	B;B;B	0.26547	0.012;0.081;0.152	B;B;B	0.33750	0.022;0.169;0.135	T	0.28170	-1.0052	10	0.10902	T	0.67	-14.6057	6.0909	0.19993	0.1409:0.6512:0.1356:0.0722	.	595;595;595	P48357;P48357-2;P48357-3	LEPR_HUMAN;.;.	F	595	ENSP00000340884:S595F;ENSP00000330393:S595F;ENSP00000360099:S595F;ENSP00000360098:S595F;ENSP00000360097:S595F	ENSP00000340884:S595F	S	+	2	0	LEPR	65848249	0.542000	0.26426	0.021000	0.16686	0.077000	0.17291	1.513000	0.35823	1.215000	0.43411	-0.158000	0.13435	TCT	LEPR	-	superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000116678		0.408	LEPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LEPR	HGNC	protein_coding	OTTHUMT00000025275.1	-	0.00	86	0	C	NM_002303		66075661	+1	tier1	-	no_errors	ENST00000349533	ensembl	human	known	74_37	missense	49.32	37	36	SNP	0.121	T
LILRA5	353514	genome.wustl.edu	37	19	54823234	54823234	+	Silent	SNP	G	G	T			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr19:54823234G>T	ENST00000301219.3	-	4	428	c.309C>A	c.(307-309)atC>atA	p.I103I	LILRA5_ENST00000346508.3_Silent_p.I91I|LILRA5_ENST00000446712.3_Silent_p.I91I|AC008984.2_ENST00000507363.1_RNA|LILRA5_ENST00000432233.3_Silent_p.I103I	NM_021250.2	NP_067073.1	A6NI73	LIRA5_HUMAN	leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 5	103	Ig-like C2-type 1.				innate immune response (GO:0045087)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|large_intestine(4)|lung(6)|ovary(1)|prostate(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	20	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		TCATGGATGGGATGGAGAATC	0.592																																																	0													354.0	307.0	323.0					19																	54823234		2203	4300	6503	SO:0001819	synonymous_variant	0			AF212842	CCDS12888.1, CCDS12889.1	19q13.4	2013-01-11	2005-05-13	2005-05-13	ENSG00000187116	ENSG00000187116		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	16309	protein-coding gene	gene with protein product		606047		LILRB7		10941842	Standard	NM_181986		Approved	ILT11, LIR9, CD85, CD85f	uc002qfe.3	A6NI73	OTTHUMG00000065357	ENST00000301219.3:c.309C>A	19.37:g.54823234G>T			A6NHI3	Silent	SNP	smart_Ig_sub,smart_Ig_sub2	p.I103	ENST00000301219.3	37	c.309	CCDS12888.1	19																																																																																			LILRA5	-	smart_Ig_sub,smart_Ig_sub2	ENSG00000187116		0.592	LILRA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LILRA5	HGNC	protein_coding	OTTHUMT00000140231.1	-	0.00	71	0	G	NM_181985		54823234	-1	tier1	-	no_errors	ENST00000301219	ensembl	human	known	74_37	silent	9.09	50	5	SNP	0.000	T
LLGL1	3996	genome.wustl.edu	37	17	18133339	18133339	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr17:18133339G>A	ENST00000316843.4	+	2	262	c.166G>A	c.(166-168)Ggg>Agg	p.G56R		NM_004140.3	NP_004131	Q15334	L2GL1_HUMAN	lethal giant larvae homolog 1 (Drosophila)	56					axonogenesis (GO:0007409)|cortical actin cytoskeleton organization (GO:0030866)|exocytosis (GO:0006887)|Golgi to plasma membrane transport (GO:0006893)|maintenance of apical/basal cell polarity (GO:0035090)|positive regulation of Rab GTPase activity (GO:0032851)|protein complex assembly (GO:0006461)	cell projection (GO:0042995)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|early endosome membrane (GO:0031901)|Golgi cis cisterna (GO:0000137)|myelin sheath abaxonal region (GO:0035748)|trans-Golgi network membrane (GO:0032588)	protein kinase binding (GO:0019901)|Rab GTPase activator activity (GO:0005097)|structural molecule activity (GO:0005198)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(6)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	21	all_neural(463;0.228)					CACCAGGTCTGGGGCTGTCAA	0.607																																																	0													89.0	76.0	80.0					17																	18133339		2203	4300	6503	SO:0001583	missense	0				CCDS32586.1	17p11.2	2013-01-10	2001-11-28		ENSG00000131899	ENSG00000131899		"""WD repeat domain containing"""	6628	protein-coding gene	gene with protein product		600966	"""lethal giant larvae (Drosophila) homolog 1"""	DLG4, LLGL, HUGL, HUGL-1		7542763, 8565641	Standard	XM_005256643		Approved		uc002gsp.3	Q15334	OTTHUMG00000059396	ENST00000316843.4:c.166G>A	17.37:g.18133339G>A	ENSP00000321537:p.Gly56Arg		A7MBM7|O00188|Q58F11|Q86UK6	Missense_Mutation	SNP	pfam_LLGL2,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,prints_Lethal2_giant	p.G56R	ENST00000316843.4	37	c.166	CCDS32586.1	17	.	.	.	.	.	.	.	.	.	.	G	32	5.189487	0.94923	.	.	ENSG00000131899	ENST00000316843	T	0.74421	-0.84	5.26	5.26	0.73747	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	D	0.87935	0.6303	M	0.84683	2.71	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.89549	0.3798	10	0.87932	D	0	-35.4314	18.061	0.89377	0.0:0.0:1.0:0.0	.	56	Q15334	L2GL1_HUMAN	R	56	ENSP00000321537:G56R	ENSP00000321537:G56R	G	+	1	0	LLGL1	18074064	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	9.549000	0.98106	2.641000	0.89580	0.558000	0.71614	GGG	LLGL1	-	superfamily_WD40_repeat_dom,smart_WD40_repeat	ENSG00000131899		0.607	LLGL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LLGL1	HGNC	protein_coding	OTTHUMT00000132067.3	-	0.00	68	0	G			18133339	+1	tier1	-	no_errors	ENST00000316843	ensembl	human	known	74_37	missense	64.58	17	31	SNP	1.000	A
LYG1	129530	genome.wustl.edu	37	2	99912118	99912118	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr2:99912118G>T	ENST00000409448.1	-	4	332	c.16C>A	c.(16-18)Ctg>Atg	p.L6M	LYG1_ENST00000308528.4_Missense_Mutation_p.L6M			Q8N1E2	LYG1_HUMAN	lysozyme G-like 1	6					cell wall macromolecule catabolic process (GO:0016998)|peptidoglycan catabolic process (GO:0009253)	extracellular region (GO:0005576)	lysozyme activity (GO:0003796)	p.L6M(1)		endometrium(2)|kidney(1)|large_intestine(3)|lung(1)	7						CCCAGCAGCAGCCACAATGCA	0.428																																																	1	Substitution - Missense(1)	large_intestine(1)											134.0	139.0	138.0					2																	99912118		2203	4300	6503	SO:0001583	missense	0			BC029126	CCDS2043.1	2q11.2	2008-02-05			ENSG00000144214	ENSG00000144214			27014	protein-coding gene	gene with protein product						12574869	Standard	NM_174898		Approved	SALW1939	uc002szy.3	Q8N1E2	OTTHUMG00000130639	ENST00000409448.1:c.16C>A	2.37:g.99912118G>T	ENSP00000386923:p.Leu6Met		Q53RV9	Missense_Mutation	SNP	superfamily_Lysozyme-like_dom,pirsf_Glyco_hydro_23,prints_Glyco_hydro_23	p.L6M	ENST00000409448.1	37	c.16	CCDS2043.1	2	.	.	.	.	.	.	.	.	.	.	G	15.74	2.923880	0.52653	.	.	ENSG00000144214	ENST00000308528;ENST00000409448	.	.	.	4.67	4.67	0.58626	.	0.142348	0.32372	N	0.006195	T	0.66982	0.2845	L	0.58101	1.795	0.31872	N	0.61955	D	0.89917	1.0	D	0.91635	0.999	T	0.70230	-0.4929	8	.	.	.	-9.2733	13.2611	0.60106	0.0:0.0:1.0:0.0	.	6	Q8N1E2	LYG1_HUMAN	M	6	.	.	L	-	1	2	LYG1	99278550	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	2.044000	0.41241	2.587000	0.87381	0.650000	0.86243	CTG	LYG1	-	pirsf_Glyco_hydro_23	ENSG00000144214		0.428	LYG1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	LYG1	HGNC	protein_coding	OTTHUMT00000330315.1		0.00	36	0	G	NM_174898		99912118	-1			no_errors	ENST00000308528	ensembl	human	known	74_37	missense	5.13	37	2	SNP	1.000	T
LYST	1130	genome.wustl.edu	37	1	235922855	235922855	+	Missense_Mutation	SNP	T	T	C			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr1:235922855T>C	ENST00000389794.3	-	23	6472	c.6298A>G	c.(6298-6300)Atg>Gtg	p.M2100V	LYST_ENST00000389793.2_Missense_Mutation_p.M2100V|LYST_ENST00000536965.1_3'UTR			Q99698	LYST_HUMAN	lysosomal trafficking regulator	2100					blood coagulation (GO:0007596)|defense response to bacterium (GO:0042742)|defense response to protozoan (GO:0042832)|defense response to virus (GO:0051607)|endosome to lysosome transport via multivesicular body sorting pathway (GO:0032510)|leukocyte chemotaxis (GO:0030595)|lysosome organization (GO:0007040)|mast cell secretory granule organization (GO:0033364)|melanosome organization (GO:0032438)|microtubule-based process (GO:0007017)|natural killer cell mediated cytotoxicity (GO:0042267)|neutrophil mediated immunity (GO:0002446)|phospholipid homeostasis (GO:0055091)|phospholipid metabolic process (GO:0006644)|pigmentation (GO:0043473)|positive regulation of natural killer cell activation (GO:0032816)|response to drug (GO:0042493)|secretion of lysosomal enzymes (GO:0033299)|T cell mediated immunity (GO:0002456)	cytosol (GO:0005829)|microtubule cytoskeleton (GO:0015630)				NS(1)|breast(13)|central_nervous_system(3)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(27)|lung(66)|ovary(7)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	162	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00246)|Prostate(94;0.0771)|Acute lymphoblastic leukemia(190;0.228)	OV - Ovarian serous cystadenocarcinoma(106;0.000674)			GAACGCAGCATATGGGCGGCC	0.403																																																	0													57.0	57.0	57.0					1																	235922855		2203	4300	6503	SO:0001583	missense	0			U70064	CCDS31062.1	1q42.1-q42.2	2014-09-17	2004-12-09	2004-12-10	ENSG00000143669	ENSG00000143669		"""WD repeat domain containing"""	1968	protein-coding gene	gene with protein product		606897	"""Chediak-Higashi syndrome 1"""	CHS1		8717042, 8896560	Standard	NM_000081		Approved	CHS	uc001hxj.3	Q99698	OTTHUMG00000040527	ENST00000389794.3:c.6298A>G	1.37:g.235922855T>C	ENSP00000374444:p.Met2100Val		O43274|Q5T2U9|Q96TD7|Q96TD8|Q99709|Q9H133	Missense_Mutation	SNP	pfam_BEACH_dom,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_BEACH_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.M2100V	ENST00000389794.3	37	c.6298	CCDS31062.1	1	.	.	.	.	.	.	.	.	.	.	T	3.850	-0.032076	0.07543	.	.	ENSG00000143669	ENST00000389794;ENST00000389793	T;T	0.60171	0.21;0.21	4.72	3.58	0.41010	.	.	.	.	.	T	0.37865	0.1019	N	0.16478	0.41	0.09310	N	0.999999	B	0.09022	0.002	B	0.06405	0.002	T	0.19976	-1.0289	9	0.30854	T	0.27	.	6.9367	0.24470	0.0:0.0792:0.169:0.7518	.	2100	Q99698	LYST_HUMAN	V	2100	ENSP00000374444:M2100V;ENSP00000374443:M2100V	ENSP00000374443:M2100V	M	-	1	0	LYST	233989478	0.000000	0.05858	0.022000	0.16811	0.758000	0.43043	0.115000	0.15540	0.830000	0.34757	0.456000	0.33151	ATG	LYST	-	superfamily_ARM-type_fold	ENSG00000143669		0.403	LYST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LYST	HGNC	protein_coding	OTTHUMT00000097533.5	-	0.00	21	0	T			235922855	-1	tier1	-	no_errors	ENST00000389793	ensembl	human	known	74_37	missense	20.69	23	6	SNP	0.005	C
MALAT1	378938	genome.wustl.edu	37	11	65266086	65266086	+	lincRNA	SNP	G	G	T			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr11:65266086G>T	ENST00000534336.1	+	0	854				AP000769.7_ENST00000602344.1_lincRNA	NR_002819.2		Q9UHZ2	MALAT_HUMAN	metastasis associated lung adenocarcinoma transcript 1 (non-protein coding)																		TCCCTGCAAGGCTGGGGCTCA	0.488																																																	0													75.0	77.0	76.0					11																	65266086		874	1988	2862			0			AF001540		11q13.1	2013-12-11	2007-11-20		ENSG00000251562	ENSG00000251562		"""Long non-coding RNAs"", ""-"""	29665	non-coding RNA	RNA, long non-coding	"""metastasis associated in lung adenocarcinoma transcript 1"", ""non-protein coding RNA 47"", ""hepcarcin"", ""nuclear enriched abundant transcript 2"", ""nuclear paraspeckle assembly transcript 2 (non-protein coding)"", ""long intergenic non-protein coding RNA 47"""	607924				12970751, 22560368	Standard	NR_002819		Approved	PRO1073, MALAT-1, NCRNA00047, HCN, NEAT2, LINC00047, mascRNA	uc010roh.3	Q9UHZ2	OTTHUMG00000166322		11.37:g.65266086G>T				RNA	SNP	-	NULL	ENST00000534336.1	37	NULL		11																																																																																			MALAT1	-	-	ENSG00000251562		0.488	MALAT1-001	KNOWN	basic	lincRNA	MALAT1	HGNC	lincRNA	OTTHUMT00000389143.1	-	0.00	33	0	G	NR_002819		65266086	+1	tier1	-	no_errors	ENST00000534336	ensembl	human	known	74_37	rna	14.29	18	3	SNP	0.002	T
MAP3K5	4217	genome.wustl.edu	37	6	137019722	137019722	+	Silent	SNP	G	G	A			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr6:137019722G>A	ENST00000359015.4	-	4	1071	c.711C>T	c.(709-711)ctC>ctT	p.L237L		NM_005923.3	NP_005914.1	Q99683	M3K5_HUMAN	mitogen-activated protein kinase kinase kinase 5	237					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of JUN kinase activity (GO:0007257)|activation of MAPKK activity (GO:0000186)|apoptotic signaling pathway (GO:0097190)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to reactive nitrogen species (GO:1902170)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|JNK cascade (GO:0007254)|MAPK cascade (GO:0000165)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of neuron death (GO:1901216)|programmed necrotic cell death (GO:0097300)|protein phosphorylation (GO:0006468)|response to ischemia (GO:0002931)|viral process (GO:0016032)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|protein kinase complex (GO:1902911)	ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|magnesium ion binding (GO:0000287)|MAP kinase kinase kinase activity (GO:0004709)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein phosphatase binding (GO:0019903)			NS(1)|breast(1)|cervix(1)|endometrium(8)|kidney(6)|large_intestine(6)|lung(24)|ovary(2)|prostate(1)|skin(4)|urinary_tract(4)	58	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00137)|OV - Ovarian serous cystadenocarcinoma(155;0.00569)		TCGGTTGCATGAGCTCTGTCA	0.448																																																	0													147.0	126.0	133.0					6																	137019722		2203	4300	6503	SO:0001819	synonymous_variant	0			U67156	CCDS5179.1	6q22.33	2011-06-09			ENSG00000197442	ENSG00000197442		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6857	protein-coding gene	gene with protein product	"""apoptosis signal regulating kinase 1"""	602448		MEKK5		9465908	Standard	NM_005923		Approved	MAPKKK5, ASK1	uc003qhc.3	Q99683	OTTHUMG00000015647	ENST00000359015.4:c.711C>T	6.37:g.137019722G>A			A6NIA0|B4DGB2|Q5THN3|Q99461	Silent	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_SAM/pointed,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.L237	ENST00000359015.4	37	c.711	CCDS5179.1	6																																																																																			MAP3K5	-	NULL	ENSG00000197442		0.448	MAP3K5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAP3K5	HGNC	protein_coding	OTTHUMT00000042383.1	-	0.00	30	0	G			137019722	-1	tier1	-	no_errors	ENST00000359015	ensembl	human	known	74_37	silent	54.05	17	20	SNP	0.997	A
MED1	5469	genome.wustl.edu	37	17	37566025	37566025	+	Nonsense_Mutation	SNP	G	G	A			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr17:37566025G>A	ENST00000300651.6	-	17	2672	c.2449C>T	c.(2449-2451)Cag>Tag	p.Q817*	MED1_ENST00000394287.3_Intron	NM_004774.3	NP_004765.2	O95243	MBD4_HUMAN	mediator complex subunit 1	0					base-excision repair (GO:0006284)|base-excision repair, AP site formation (GO:0006285)|depyrimidination (GO:0045008)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|mitotic G2 DNA damage checkpoint (GO:0007095)|response to radiation (GO:0009314)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	endodeoxyribonuclease activity (GO:0004520)|pyrimidine-specific mismatch base pair DNA N-glycosylase activity (GO:0008263)|satellite DNA binding (GO:0003696)			NS(1)|breast(2)|cervix(3)|kidney(3)|large_intestine(7)|lung(25)|ovary(2)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(7)|urinary_tract(1)	59		Ovarian(249;1.78e-06)|Lung SC(565;0.0262)	Lung(15;0.0178)|LUAD - Lung adenocarcinoma(14;0.146)	UCEC - Uterine corpus endometrioid carcinoma (308;6.64e-05)|BRCA - Breast invasive adenocarcinoma(366;0.00136)|READ - Rectum adenocarcinoma(1115;0.0649)		AGGGTACTCTGAGAATGCCCA	0.453										HNSCC(31;0.082)																											Pancreas(21;279 768 2492 4877 24026)												0													79.0	81.0	80.0					17																	37566025		2203	4300	6503	SO:0001587	stop_gained	0			L40366	CCDS11336.1	17q12	2007-07-30	2007-07-30	2007-07-30	ENSG00000125686	ENSG00000125686			9234	protein-coding gene	gene with protein product		604311	"""PPAR binding protein"""	TRIP2, PPARGBP, PPARBP		9325263, 10485914	Standard	NM_004774		Approved	PBP, TRAP220, RB18A, DRIP230, CRSP200, CRSP1	uc002hrv.4	Q15648	OTTHUMG00000133216	ENST00000300651.6:c.2449C>T	17.37:g.37566025G>A	ENSP00000300651:p.Gln817*		B4DZN2|D3DNC3|D3DNC4|E9PEE4|Q2MD36|Q7Z4T3|Q96F09	Nonsense_Mutation	SNP	pfam_Mediator_Med1_met/fun	p.Q817*	ENST00000300651.6	37	c.2449	CCDS11336.1	17	.	.	.	.	.	.	.	.	.	.	G	38	6.859846	0.97893	.	.	ENSG00000125686	ENST00000300651	.	.	.	6.03	6.03	0.97812	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.34782	T	0.22	-6.5751	20.5666	0.99351	0.0:0.0:1.0:0.0	.	.	.	.	X	817	.	ENSP00000300651:Q817X	Q	-	1	0	MED1	34819551	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.473000	0.73572	2.854000	0.98071	0.655000	0.94253	CAG	MED1	-	NULL	ENSG00000125686		0.453	MED1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MED1	HGNC	protein_coding	OTTHUMT00000256943.3	-	0.00	70	0	G	NM_004774		37566025	-1	tier1	-	no_errors	ENST00000300651	ensembl	human	known	74_37	nonsense	22.92	37	11	SNP	1.000	A
MORC1	27136	genome.wustl.edu	37	3	108776315	108776315	+	Missense_Mutation	SNP	T	T	G			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr3:108776315T>G	ENST00000483760.1	-	13	1093	c.1050A>C	c.(1048-1050)agA>agC	p.R350S	MORC1_ENST00000232603.5_Missense_Mutation_p.R350S					MORC family CW-type zinc finger 1											breast(7)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(14)|lung(47)|ovary(3)|prostate(6)|skin(12)|upper_aerodigestive_tract(3)	105						GGGAGAGCGTTCTTGCTGTTT	0.318																																																	0													95.0	88.0	91.0					3																	108776315		2203	4300	6503	SO:0001583	missense	0			AF084946	CCDS2955.1	3q13	2011-10-26	2005-06-15	2005-06-15	ENSG00000114487	ENSG00000114487			7198	protein-coding gene	gene with protein product	"""cancer/testis antigen 33"""	603205	"""microrchidia (mouse) homolog"", ""microrchidia homolog (mouse)"""	MORC		10369865	Standard	NM_014429		Approved	ZCW6, CT33	uc003dxl.3	Q86VD1	OTTHUMG00000159209	ENST00000483760.1:c.1050A>C	3.37:g.108776315T>G	ENSP00000417282:p.Arg350Ser			Missense_Mutation	SNP	pfam_Znf_CW,superfamily_HATPase_ATP-bd,pfscan_Znf_CW	p.R350S	ENST00000483760.1	37	c.1050		3	.	.	.	.	.	.	.	.	.	.	T	9.306	1.054260	0.19907	.	.	ENSG00000114487	ENST00000232603;ENST00000483760	T;T	0.05649	3.41;3.41	4.3	2.08	0.27032	.	1.064490	0.07330	N	0.879028	T	0.07728	0.0194	M	0.63428	1.95	0.25197	N	0.990084	P;B	0.43094	0.799;0.147	B;B	0.35931	0.214;0.024	T	0.35201	-0.9798	10	0.62326	D	0.03	-8.1024	5.3297	0.15926	0.0:0.3312:0.0:0.6688	.	350;350	E7ERX1;Q86VD1	.;MORC1_HUMAN	S	350	ENSP00000232603:R350S;ENSP00000417282:R350S	ENSP00000232603:R350S	R	-	3	2	MORC1	110259005	1.000000	0.71417	0.998000	0.56505	0.251000	0.25915	1.512000	0.35812	0.858000	0.35431	0.528000	0.53228	AGA	MORC1	-	NULL	ENSG00000114487		0.318	MORC1-002	NOVEL	basic|appris_candidate|exp_conf	protein_coding	MORC1	HGNC	protein_coding	OTTHUMT00000353844.1		0.00	23	0	T			108776315	-1			no_errors	ENST00000232603	ensembl	human	known	74_37	missense	16.67	20	4	SNP	0.999	G
MPC1	51660	genome.wustl.edu	37	6	166778737	166778737	+	3'UTR	SNP	T	T	C			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr6:166778737T>C	ENST00000360961.6	-	0	631				MPC1_ENST00000487218.1_5'UTR|MPC1_ENST00000341756.6_3'UTR	NM_001270879.1|NM_016098.3	NP_001257808.1|NP_057182.1	Q9Y5U8	MPC1_HUMAN	mitochondrial pyruvate carrier 1						cellular metabolic process (GO:0044237)|mitochondrial pyruvate transport (GO:0006850)|pyruvate metabolic process (GO:0006090)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	pyruvate transmembrane transporter activity (GO:0050833)										AAATATTTAATACTTGTAAGG	0.284																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AF125101	CCDS5293.1, CCDS75547.1	6q27	2012-08-01	2012-07-30	2012-07-30	ENSG00000060762	ENSG00000060762			21606	protein-coding gene	gene with protein product		614738	"""brain protein 44-like"""	BRP44L		22628558	Standard	NM_016098		Approved	dJ68L15.3, CGI-129	uc031sra.1	Q9Y5U8	OTTHUMG00000015999	ENST00000360961.6:c.*180A>G	6.37:g.166778737T>C			B2R5I7|Q5TI66|Q9HB67|Q9UQN4	RNA	SNP	-	NULL	ENST00000360961.6	37	NULL	CCDS5293.1	6																																																																																			MPC1	-	-	ENSG00000060762		0.284	MPC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MPC1	HGNC	protein_coding	OTTHUMT00000043052.1	-	0.00	35	0	T	NM_016098		166778737	-1	tier1	-	no_errors	ENST00000487218	ensembl	human	known	74_37	rna	55.56	8	10	SNP	0.018	C
MUC4	4585	genome.wustl.edu	37	3	195511236	195511236	+	Missense_Mutation	SNP	G	G	T	rs534701413		TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr3:195511236G>T	ENST00000463781.3	-	2	7674	c.7215C>A	c.(7213-7215)gaC>gaA	p.D2405E	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.D2405E	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		CTGAGGAAGTGTCGGTGACAG	0.587																																																	0													35.0	37.0	37.0					3																	195511236		689	1589	2278	SO:0001583	missense	0			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.7215C>A	3.37:g.195511236G>T	ENSP00000417498:p.Asp2405Glu		O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	pfam_Nidogen_extracell_dom,pfam_AMOP,pfam_VWF_type-D,smart_Nidogen_extracell_dom,smart_AMOP,smart_VWF_type-D,smart_EG-like_dom,pfscan_AMOP,pfscan_EG-like_dom	p.D2405E	ENST00000463781.3	37	c.7215	CCDS54700.1	3	.	.	.	.	.	.	.	.	.	.	G	8.514	0.867217	0.17250	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.29655	1.58;1.56	.	.	.	.	.	.	.	.	T	0.31199	0.0789	N	0.19112	0.55	0.09310	N	1	P	0.37781	0.608	P	0.55508	0.777	T	0.36163	-0.9759	7	.	.	.	.	6.6894	0.23163	2.0E-4:0.0:0.9998:0.0	.	2405	E7ESK3	.	E	2405	ENSP00000417498:D2405E;ENSP00000420243:D2405E	.	D	-	3	2	MUC4	196995631	0.000000	0.05858	0.004000	0.12327	0.079000	0.17450	-3.039000	0.00633	0.482000	0.27582	0.000000	0.15137	GAC	MUC4	-	NULL	ENSG00000145113		0.587	MUC4-001	KNOWN	basic|CCDS	protein_coding	MUC4	HGNC	protein_coding	OTTHUMT00000324081.6	-	0.00	500	0	G	NM_018406		195511236	-1	tier1	-	no_errors	ENST00000463781	ensembl	human	known	74_37	missense	8.58	586	55	SNP	0.492	T
MYO7B	4648	genome.wustl.edu	37	2	128350402	128350402	+	Nonsense_Mutation	SNP	C	C	T			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr2:128350402C>T	ENST00000409816.2	+	16	2058	c.2026C>T	c.(2026-2028)Cga>Tga	p.R676*	MYO7B_ENST00000389524.4_Nonsense_Mutation_p.R676*|MYO7B_ENST00000428314.1_Nonsense_Mutation_p.R676*			Q6PIF6	MYO7B_HUMAN	myosin VIIB	676	Myosin motor.					extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(46)|ovary(3)|pancreas(1)|prostate(3)|urinary_tract(1)	75	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0753)		GCGGCAGCTGCGATACTCGGG	0.667																																																	0													20.0	28.0	25.0					2																	128350402		2054	4184	6238	SO:0001587	stop_gained	0				CCDS46405.1	2q21.1	2011-09-27			ENSG00000169994	ENSG00000169994		"""Myosins / Myosin superfamily : Class VII"""	7607	protein-coding gene	gene with protein product		606541				8022818, 8884266	Standard	NM_001080527		Approved		uc002top.3	Q6PIF6	OTTHUMG00000153419	ENST00000409816.2:c.2026C>T	2.37:g.128350402C>T	ENSP00000386461:p.Arg676*		Q14786|Q8TEE1	Nonsense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_MyTH4_dom,pfam_FERM_central,pfam_IQ_motif_EF-hand-BS,pfam_SH3_2,superfamily_P-loop_NTPase,superfamily_FERM_central,superfamily_SH3_domain,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,smart_MyTH4_dom,smart_Band_41_domain,smart_SH3_domain,pfscan_FERM_domain,pfscan_IQ_motif_EF-hand-BS,pfscan_MyTH4_dom,pfscan_SH3_domain,prints_Myosin_head_motor_dom	p.R676*	ENST00000409816.2	37	c.2026	CCDS46405.1	2	.	.	.	.	.	.	.	.	.	.	C	41	8.939273	0.99010	.	.	ENSG00000169994	ENST00000389524;ENST00000428314;ENST00000409816	.	.	.	4.93	4.93	0.64822	.	0.064020	0.64402	D	0.000005	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	18.494	0.90858	0.0:1.0:0.0:0.0	.	.	.	.	X	676	.	ENSP00000374175:R676X	R	+	1	2	MYO7B	128066872	1.000000	0.71417	0.999000	0.59377	0.988000	0.76386	3.926000	0.56491	2.447000	0.82792	0.655000	0.94253	CGA	MYO7B	-	pfam_Myosin_head_motor_dom,superfamily_P-loop_NTPase,smart_Myosin_head_motor_dom	ENSG00000169994		0.667	MYO7B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MYO7B	HGNC	protein_coding	OTTHUMT00000331124.3	-	0.00	83	0	C	XM_291001		128350402	+1	tier1	-	no_errors	ENST00000389524	ensembl	human	known	74_37	nonsense	25.00	45	15	SNP	1.000	T
NDN	4692	genome.wustl.edu	37	15	23931422	23931422	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr15:23931422G>A	ENST00000331837.4	-	1	1028	c.943C>T	c.(943-945)Cgc>Tgc	p.R315C		NM_002487.2	NP_002478.1	Q99608	NECD_HUMAN	necdin, melanoma antigen (MAGE) family member	315					axon extension (GO:0048675)|axonal fasciculation (GO:0007413)|central nervous system development (GO:0007417)|genetic imprinting (GO:0071514)|glial cell migration (GO:0008347)|multicellular organismal homeostasis (GO:0048871)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neuron migration (GO:0001764)|neurotrophin TRK receptor signaling pathway (GO:0048011)|post-embryonic development (GO:0009791)|regulation of growth (GO:0040008)|regulation of transcription, DNA-templated (GO:0006355)|respiratory system process (GO:0003016)|sensory perception of pain (GO:0019233)|transcription, DNA-templated (GO:0006351)	cell projection (GO:0042995)|centrosome (GO:0005813)|cytosol (GO:0005829)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(2)|endometrium(3)|kidney(2)|large_intestine(5)|lung(23)|ovary(1)|prostate(2)|skin(1)	39		all_cancers(20;1.78e-24)|all_epithelial(15;7.75e-22)|Lung NSC(15;2.96e-18)|all_lung(15;2.8e-17)|Breast(32;0.000625)|Colorectal(260;0.14)		all cancers(64;8.37e-11)|Epithelial(43;9.29e-10)|BRCA - Breast invasive adenocarcinoma(123;0.00179)|GBM - Glioblastoma multiforme(186;0.018)|Lung(196;0.153)		ACACTGCTGCGAGGGTAGTGG	0.572									Prader-Willi syndrome																																								0													52.0	55.0	54.0					15																	23931422		2193	4284	6477	SO:0001583	missense	0	Familial Cancer Database	Prader-Labhart-Willi syndrome	U35139	CCDS10014.1	15q11-q12	2012-12-07	2012-12-07		ENSG00000182636	ENSG00000182636			7675	protein-coding gene	gene with protein product	"""Prader-Willi syndrome chromosome region"""	602117	"""necdin (mouse) homolog"", ""necdin homolog (mouse)"""			9302265	Standard	NM_002487		Approved	HsT16328, PWCR	uc001ywk.3	Q99608	OTTHUMG00000129161	ENST00000331837.4:c.943C>T	15.37:g.23931422G>A	ENSP00000332643:p.Arg315Cys		B2R6Z5	Missense_Mutation	SNP	pfam_MAGE,pfscan_MAGE	p.R315C	ENST00000331837.4	37	c.943	CCDS10014.1	15	.	.	.	.	.	.	.	.	.	.	G	6.352	0.433078	0.12045	.	.	ENSG00000182636	ENST00000331837	T	0.02812	4.15	3.5	3.5	0.40072	.	0.242758	0.21715	N	0.070220	T	0.03959	0.0111	N	0.08118	0	0.26606	N	0.972929	D	0.89917	1.0	P	0.58928	0.848	T	0.43540	-0.9385	10	0.54805	T	0.06	.	10.8057	0.46516	0.0:0.0:1.0:0.0	.	315	Q99608	NECD_HUMAN	C	315	ENSP00000332643:R315C	ENSP00000332643:R315C	R	-	1	0	NDN	21482515	1.000000	0.71417	0.425000	0.26659	0.082000	0.17680	2.282000	0.43461	2.239000	0.73571	0.655000	0.94253	CGC	NDN	-	NULL	ENSG00000182636		0.572	NDN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NDN	HGNC	protein_coding	OTTHUMT00000251226.2	-	0.00	40	0	G	NM_002487		23931422	-1	tier1	-	no_errors	ENST00000331837	ensembl	human	known	74_37	missense	25.71	26	9	SNP	0.347	A
NEURL4	84461	genome.wustl.edu	37	17	7221920	7221920	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr17:7221920G>A	ENST00000399464.2	-	23	3773	c.3758C>T	c.(3757-3759)tCt>tTt	p.S1253F	NEURL4_ENST00000570460.1_Missense_Mutation_p.S1229F|NEURL4_ENST00000315614.7_Missense_Mutation_p.S1251F|NEURL4_ENST00000574120.1_5'UTR|RP11-542C16.2_ENST00000575474.1_Silent_p.L67L	NM_032442.2	NP_115818.2	Q96JN8	NEUL4_HUMAN	neuralized E3 ubiquitin protein ligase 4	1253	NHR 6. {ECO:0000255|PROSITE- ProRule:PRU00400}.					cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(12)|ovary(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						CAGCCCCCCAGAGCTGTCCAG	0.612																																																	0													48.0	55.0	52.0					17																	7221920		2036	4182	6218	SO:0001583	missense	0				CCDS42251.1, CCDS42252.1	17p13	2013-10-24	2013-10-24		ENSG00000215041	ENSG00000215041			34410	protein-coding gene	gene with protein product		615865	"""neuralized homolog 4 (Drosophila)"""			22261722, 22441691	Standard	NM_001005408		Approved	KIAA1787	uc002gga.1	Q96JN8	OTTHUMG00000132319	ENST00000399464.2:c.3758C>T	17.37:g.7221920G>A	ENSP00000382390:p.Ser1253Phe		Q6GPI8|Q96IU9|Q9H0B0	Missense_Mutation	SNP	pfam_Neu_Z,superfamily_ConA-like_lec_gl_sf,smart_Neu_Z,pfscan_Neu_Z	p.S1253F	ENST00000399464.2	37	c.3758	CCDS42251.1	17	.	.	.	.	.	.	.	.	.	.	g	10.88	1.476381	0.26511	.	.	ENSG00000215041	ENST00000315614;ENST00000399464	T;T	0.33216	1.42;1.42	5.36	3.37	0.38596	NEUZ (1);	0.211175	0.41605	D	0.000845	T	0.35278	0.0926	M	0.62723	1.935	0.21897	N	0.999488	P;B	0.34826	0.471;0.34	B;B	0.40285	0.325;0.174	T	0.27088	-1.0084	10	0.72032	D	0.01	-0.487	10.7316	0.46100	0.0:0.2664:0.5958:0.1378	.	1251;1253	Q96JN8-2;Q96JN8	.;NEUL4_HUMAN	F	1251;1253	ENSP00000319826:S1251F;ENSP00000382390:S1253F	ENSP00000319826:S1251F	S	-	2	0	NEURL4	7162644	0.603000	0.26924	0.976000	0.42696	0.004000	0.04260	1.079000	0.30766	0.632000	0.30432	-0.216000	0.12614	TCT	NEURL4	-	pfscan_Neu_Z	ENSG00000215041		0.612	NEURL4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NEURL4	HGNC	protein_coding	OTTHUMT00000255434.2	-	0.00	101	0	G	NM_032442		7221920	-1	tier1	-	no_errors	ENST00000399464	ensembl	human	known	74_37	missense	45.24	46	38	SNP	0.773	A
NFE2L2	4780	genome.wustl.edu	37	2	178098810	178098810	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr2:178098810C>G	ENST00000397062.3	-	2	789	c.235G>C	c.(235-237)Gag>Cag	p.E79Q	NFE2L2_ENST00000423513.1_Missense_Mutation_p.E63Q|NFE2L2_ENST00000446151.2_Missense_Mutation_p.E63Q|NFE2L2_ENST00000464747.1_Missense_Mutation_p.E63Q|NFE2L2_ENST00000397063.4_Missense_Mutation_p.E63Q	NM_006164.4	NP_006155.2	Q16236	NF2L2_HUMAN	nuclear factor, erythroid 2-like 2	79					cellular response to hydrogen peroxide (GO:0070301)|cellular response to laminar fluid shear stress (GO:0071499)|cellular response to tumor necrosis factor (GO:0071356)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902176)|positive regulation of blood coagulation (GO:0030194)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to stress (GO:0036003)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination (GO:0016567)|regulation of embryonic development (GO:0045995)|regulation of removal of superoxide radicals (GO:2000121)|transcription from RNA polymerase II promoter (GO:0006366)	centrosome (GO:0005813)|chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|protein domain specific binding (GO:0019904)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.E79K(10)|p.E79Q(10)		central_nervous_system(1)|cervix(4)|endometrium(14)|kidney(5)|large_intestine(4)|liver(13)|lung(71)|oesophagus(29)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	158			Epithelial(96;0.00442)|OV - Ovarian serous cystadenocarcinoma(117;0.00739)|all cancers(119;0.0195)|LUSC - Lung squamous cell carcinoma(2;0.036)|Lung(16;0.0935)			TCACCTGTCTCTTCATCTAGT	0.443			Mis		"""NSCLC, HNSCC"""					HNSCC(56;0.16)																														Dom	yes		2	2q31	4780	nuclear factor (erythroid-derived 2)-like 2 (NRF2)		E	20	Substitution - Missense(20)	lung(13)|oesophagus(4)|upper_aerodigestive_tract(1)|urinary_tract(1)|cervix(1)											147.0	146.0	146.0					2																	178098810		1899	4107	6006	SO:0001583	missense	0				CCDS42782.1, CCDS46457.1, CCDS46458.1	2q31	2013-08-23	2013-08-23		ENSG00000116044	ENSG00000116044		"""basic leucine zipper proteins"""	7782	protein-coding gene	gene with protein product	"""NF-E2-related factor 2"""	600492	"""nuclear factor (erythroid-derived 2)-like 2"""			7937919	Standard	NM_006164		Approved	NRF2	uc002ulh.5	Q16236	OTTHUMG00000133620	ENST00000397062.3:c.235G>C	2.37:g.178098810C>G	ENSP00000380252:p.Glu79Gln		B2RBU2|B4E338|E9PGJ7|Q53RW6|Q59HH2|Q96F71	Missense_Mutation	SNP	pfam_bZIP,superfamily_TF_DNA-bd,superfamily_Serpin_dom,smart_bZIP,pfscan_bZIP	p.E79Q	ENST00000397062.3	37	c.235	CCDS42782.1	2	.	.	.	.	.	.	.	.	.	.	C	18.55	3.647218	0.67358	.	.	ENSG00000116044	ENST00000397063;ENST00000397062;ENST00000446151;ENST00000449627;ENST00000448782;ENST00000421929;ENST00000423513	T;T;T;T;T;T;T	0.30448	1.53;1.53;1.53;1.53;1.53;1.53;1.53	5.78	5.78	0.91487	.	0.000000	0.85682	D	0.000000	T	0.64327	0.2588	M	0.87180	2.865	0.80722	D	1	D;D;D;D	0.89917	1.0;0.999;1.0;1.0	D;D;D;D	0.87578	0.996;0.994;0.998;0.996	T	0.69087	-0.5238	10	0.87932	D	0	.	19.9976	0.97389	0.0:1.0:0.0:0.0	.	63;63;63;79	E9PGJ7;B4DNB0;C9JFL6;Q16236	.;.;.;NF2L2_HUMAN	Q	63;79;63;63;63;63;63	ENSP00000380253:E63Q;ENSP00000380252:E79Q;ENSP00000411575:E63Q;ENSP00000391590:E63Q;ENSP00000400073:E63Q;ENSP00000412191:E63Q;ENSP00000410015:E63Q	ENSP00000380252:E79Q	E	-	1	0	NFE2L2	177807056	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.298000	0.78815	2.737000	0.93849	0.563000	0.77884	GAG	NFE2L2	-	NULL	ENSG00000116044		0.443	NFE2L2-001	KNOWN	basic|CCDS	protein_coding	NFE2L2	HGNC	protein_coding	OTTHUMT00000257752.4	-	0.00	132	0	C	NM_006164		178098810	-1	tier1	-	no_errors	ENST00000397062	ensembl	human	known	74_37	missense	23.62	97	30	SNP	1.000	G
NFXL1	152518	genome.wustl.edu	37	4	47900008	47900008	+	Frame_Shift_Del	DEL	T	T	-			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr4:47900008delT	ENST00000507489.1	-	9	1356	c.1180delA	c.(1180-1182)aggfs	p.R394fs	NFXL1_ENST00000329043.3_Frame_Shift_Del_p.R394fs|NFXL1_ENST00000381538.3_Frame_Shift_Del_p.R394fs	NM_001278624.1	NP_001265553.1	Q6ZNB6	NFXL1_HUMAN	nuclear transcription factor, X-box binding-like 1	394						integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			NS(1)|endometrium(2)|kidney(2)|large_intestine(8)|lung(8)|ovary(1)|prostate(1)|skin(4)	27						GGACAGAACCTTTTCCCAGAT	0.373																																																	0													96.0	89.0	91.0					4																	47900008		2203	4300	6503	SO:0001589	frameshift_variant	0			AY134856	CCDS3478.2	4p12	2008-02-05			ENSG00000170448	ENSG00000170448			18726	protein-coding gene	gene with protein product	"""ovarian zinc finger protein"""						Standard	NM_152995		Approved	HOZFP	uc003gxp.3	Q6ZNB6	OTTHUMG00000128621	ENST00000507489.1:c.1180delA	4.37:g.47900008delT	ENSP00000422037:p.Arg394fs		B1Q2K1|Q86VG1|Q8WVH1	Frame_Shift_Del	DEL	pfam_Znf_NFX1,smart_Znf_NFX1,pfscan_Znf_RING	p.R394fs	ENST00000507489.1	37	c.1180	CCDS3478.2	4																																																																																			NFXL1	-	NULL	ENSG00000170448		0.373	NFXL1-002	NOVEL	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	NFXL1	HGNC	protein_coding	OTTHUMT00000361636.1		0.00	14	0	T	NM_152995		47900008	-1	tier1		no_errors	ENST00000381538	ensembl	human	known	74_37	frame_shift_del	12.50	21	3	DEL	1.000	-
NGEF	25791	genome.wustl.edu	37	2	233752783	233752783	+	Missense_Mutation	SNP	C	C	T	rs572634482		TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr2:233752783C>T	ENST00000264051.3	-	9	1585	c.1307G>A	c.(1306-1308)cGg>cAg	p.R436Q	NGEF_ENST00000539537.1_Missense_Mutation_p.R159Q|NGEF_ENST00000373552.4_Missense_Mutation_p.R344Q	NM_019850.2	NP_062824.2	Q8N5V2	NGEF_HUMAN	neuronal guanine nucleotide exchange factor	436	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				apoptotic signaling pathway (GO:0097190)|ephrin receptor signaling pathway (GO:0048013)|negative regulation of dendritic spine morphogenesis (GO:0061002)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of GTPase activity (GO:0043087)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell projection (GO:0042995)|cytosol (GO:0005829)|membrane (GO:0016020)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			central_nervous_system(4)|endometrium(8)|kidney(2)|large_intestine(3)|lung(10)|ovary(3)|pancreas(1)|skin(4)	35		Breast(86;0.00279)|Renal(207;0.00339)|all_hematologic(139;0.00793)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0271)|Lung NSC(271;0.0839)		Epithelial(121;8.65e-17)|BRCA - Breast invasive adenocarcinoma(100;0.00037)|LUSC - Lung squamous cell carcinoma(224;0.00813)|Lung(119;0.00984)|GBM - Glioblastoma multiforme(43;0.0604)		AGTGCACTCCCGCTCAGACCT	0.493													C|||	1	0.000199681	0.0	0.0	5008	,	,		22086	0.0		0.0	False		,,,				2504	0.001																0													185.0	155.0	165.0					2																	233752783		2203	4300	6503	SO:0001583	missense	0			AJ238899	CCDS2500.1, CCDS46544.1	2q37	2012-07-24			ENSG00000066248	ENSG00000066248		"""Rho guanine nucleotide exchange factors"""	7807	protein-coding gene	gene with protein product	"""ephexin"""	605991				10777665	Standard	NM_019850		Approved	ARHGEF27	uc002vts.2	Q8N5V2	OTTHUMG00000133272	ENST00000264051.3:c.1307G>A	2.37:g.233752783C>T	ENSP00000264051:p.Arg436Gln		B4DMB8|B9A045|E9PC42|Q53QQ4|Q53ST7|Q6GMQ5|Q9NQD6	Missense_Mutation	SNP	pfam_DH-domain,pfam_SH3_domain,pfam_SH3_2,superfamily_DH-domain,superfamily_SH3_domain,smart_DH-domain,smart_Pleckstrin_homology,smart_SH3_domain,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_DH-domain	p.R436Q	ENST00000264051.3	37	c.1307	CCDS2500.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	c|c	18.09|18.09	3.545124|3.545124	0.65198|0.65198	.|.	.|.	ENSG00000066248|ENSG00000066248	ENST00000424488|ENST00000264051;ENST00000373552;ENST00000541023;ENST00000539537;ENST00000416114	.|T;T;T;T	.|0.29142	.|1.58;1.58;1.58;1.58	5.21|5.21	4.33|4.33	0.51752|0.51752	.|Dbl homology (DH) domain (5);	.|0.136513	.|0.53938	.|D	.|0.000044	T|T	0.42743|0.42743	0.1216|0.1216	L|L	0.37800|0.37800	1.135|1.135	0.37605|0.37605	D|D	0.920726|0.920726	.|D;D	.|0.76494	.|0.991;0.999	.|P;D	.|0.66196	.|0.739;0.942	T|T	0.45483|0.45483	-0.9258|-0.9258	5|10	.|0.46703	.|T	.|0.11	-17.1153|-17.1153	13.704|13.704	0.62627|0.62627	0.0:0.9254:0.0:0.0746|0.0:0.9254:0.0:0.0746	.|.	.|344;436	.|E9PC42;Q8N5V2	.|.;NGEF_HUMAN	R|Q	28|436;344;326;159;159	.|ENSP00000264051:R436Q;ENSP00000362653:R344Q;ENSP00000439035:R159Q;ENSP00000401063:R159Q	.|ENSP00000264051:R436Q	G|R	-|-	1|2	0|0	NGEF|NGEF	233461027|233461027	0.364000|0.364000	0.24997|0.24997	0.732000|0.732000	0.30844|0.30844	0.960000|0.960000	0.62799|0.62799	1.139000|1.139000	0.31504|0.31504	1.211000|1.211000	0.43351|0.43351	0.537000|0.537000	0.68136|0.68136	GGG|CGG	NGEF	-	pfam_DH-domain,superfamily_DH-domain,smart_DH-domain,pfscan_DH-domain	ENSG00000066248		0.493	NGEF-001	KNOWN	basic|CCDS	protein_coding	NGEF	HGNC	protein_coding	OTTHUMT00000257051.2	-	0.00	89	0	C	XM_044799		233752783	-1	tier1	-	no_errors	ENST00000264051	ensembl	human	known	74_37	missense	24.73	70	23	SNP	0.636	T
NIN	51199	genome.wustl.edu	37	14	51224041	51224041	+	Missense_Mutation	SNP	T	T	A			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr14:51224041T>A	ENST00000382041.3	-	18	3897	c.3707A>T	c.(3706-3708)aAg>aTg	p.K1236M	NIN_ENST00000245441.5_Missense_Mutation_p.K1236M|NIN_ENST00000324330.9_Missense_Mutation_p.K1236M|NIN_ENST00000453196.1_Missense_Mutation_p.K1236M|NIN_ENST00000389868.3_Intron|NIN_ENST00000382043.4_Intron|NIN_ENST00000530997.2_Missense_Mutation_p.K1236M	NM_016350.4|NM_182946.1	NP_057434.4|NP_891991	Q8N4C6	NIN_HUMAN	ninein (GSK3B interacting protein)	1236					centrosome localization (GO:0051642)|centrosome-templated microtubule nucleation (GO:0090222)|microtubule anchoring at centrosome (GO:0034454)	centriole (GO:0005814)|centrosome (GO:0005813)|microtubule (GO:0005874)|nucleolus (GO:0005730)|spindle pole (GO:0000922)	calcium ion binding (GO:0005509)|GTP binding (GO:0005525)			breast(4)|central_nervous_system(1)|cervix(2)|endometrium(10)|kidney(5)|large_intestine(13)|lung(16)|ovary(1)|pancreas(1)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(5)	71	all_epithelial(31;0.00244)|Breast(41;0.127)					CTCAAGCATCTTCAGTTTCTT	0.418			T	PDGFRB	MPD																																			Dom	yes		14	14q24	51199	ninein (GSK3B interacting protein)		L	0													114.0	119.0	117.0					14																	51224041		2203	4300	6503	SO:0001583	missense	0			AF212162	CCDS32078.1, CCDS32079.1, CCDS32078.2	14q21-q22	2013-01-10			ENSG00000100503	ENSG00000100503		"""EF-hand domain containing"""	14906	protein-coding gene	gene with protein product		608684				11004522, 11162463	Standard	NM_020921		Approved		uc001wyi.3	Q8N4C6	OTTHUMG00000029569	ENST00000382041.3:c.3707A>T	14.37:g.51224041T>A	ENSP00000371472:p.Lys1236Met		A6NDB8|B7WPA3|C9JSB6|C9JSG2|C9JXL2|Q5BKU3|Q6P0P6|Q9BWU6|Q9C012|Q9C013|Q9C014|Q9H5I6|Q9HAT7|Q9HBY5|Q9HCK7|Q9UH61	Missense_Mutation	SNP	superfamily_tRNA-bd_arm,pfscan_EF_hand_dom	p.K1236M	ENST00000382041.3	37	c.3707	CCDS32079.1	14	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	13.93|13.93	2.382935|2.382935	0.42207|0.42207	.|.	.|.	ENSG00000100503|ENSG00000100503	ENST00000530997;ENST00000389869;ENST00000530853|ENST00000245441;ENST00000311149;ENST00000324292;ENST00000382041;ENST00000324330;ENST00000453196	T|T;T;T;T	0.05855|0.10005	3.38|3.19;2.93;2.92;2.93	6.06|6.06	3.7|3.7	0.42460|0.42460	.|.	.|0.443695	.|0.24089	.|N	.|0.041643	T|T	0.24851|0.24851	0.0603|0.0603	M|M	0.67953|0.67953	2.075|2.075	0.09310|0.09310	N|N	1|1	.|D;D;D;D	.|0.76494	.|0.999;0.997;0.998;0.999	.|D;P;P;D	.|0.65874	.|0.919;0.891;0.847;0.939	T|T	0.05869|0.05869	-1.0859|-1.0859	6|10	.|0.62326	.|D	.|0.03	-11.4047|-11.4047	6.903|6.903	0.24293|0.24293	0.0:0.288:0.0:0.712|0.0:0.288:0.0:0.712	.|.	.|1242;1236;1236;1236	.|Q8N4C6-5;C9J066;Q8N4C6;Q8N4C6-7	.|.;.;NIN_HUMAN;.	D|M	726|1236;1219;1242;1236;1236;1236	ENSP00000436092:E726D|ENSP00000245441:K1236M;ENSP00000371472:K1236M;ENSP00000324210:K1236M;ENSP00000412391:K1236M	.|ENSP00000245441:K1236M	E|K	-|-	3|2	2|0	NIN|NIN	50293791|50293791	0.059000|0.059000	0.20769|0.20769	0.040000|0.040000	0.18447|0.18447	0.815000|0.815000	0.46073|0.46073	0.646000|0.646000	0.24797|0.24797	0.528000|0.528000	0.28580|0.28580	0.533000|0.533000	0.62120|0.62120	GAA|AAG	NIN	-	NULL	ENSG00000100503		0.418	NIN-016	KNOWN	basic|CCDS	protein_coding	NIN	HGNC	protein_coding	OTTHUMT00000395207.2	-	0.00	30	0	T	NM_182946		51224041	-1	tier1	-	no_errors	ENST00000245441	ensembl	human	known	74_37	missense	30.00	28	12	SNP	0.052	A
NLRC3	197358	genome.wustl.edu	37	16	3593431	3593431	+	RNA	SNP	A	A	G			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr16:3593431A>G	ENST00000301749.7	-	0	3338				NLRC3_ENST00000448023.2_RNA|NLRC3_ENST00000359128.5_RNA|NLRC3_ENST00000419350.2_RNA|NLRC3_ENST00000603507.1_RNA|LA16c-390H2.4_ENST00000573820.1_RNA	NM_178844.2	NP_849172.2	Q7RTR2	NLRC3_HUMAN	NLR family, CARD domain containing 3						I-kappaB kinase/NF-kappaB signaling (GO:0007249)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|regulation of protein ubiquitination (GO:0031396)|response to lipopolysaccharide (GO:0032496)|T cell activation (GO:0042110)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)			breast(1)|central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(1)|liver(1)|lung(16)|ovary(2)|pancreas(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						TTACTCGAGAATCTCCAAGGT	0.493																																																	0													42.0	45.0	44.0					16																	3593431		1917	4133	6050			0			BK001112	CCDS73817.1	16p13.3	2014-03-25			ENSG00000167984	ENSG00000167984		"""Nucleotide-binding domain and leucine rich repeat containing"""	29889	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 3"", ""NOD-like receptor C3"""	615648				15705585, 12766759	Standard	NM_178844		Approved	CLR16.2, FLJ00348, NOD3	uc010btn.3	Q7RTR2	OTTHUMG00000177561		16.37:g.3593431A>G			Q5EY36|Q8NF48|Q8NI01|Q8NI02|Q8TEL3	Missense_Mutation	SNP	superfamily_P-loop_NTPase,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase	p.I1024T	ENST00000301749.7	37	c.3071		16	.	.	.	.	.	.	.	.	.	.	A	4.640	0.118956	0.08881	.	.	ENSG00000167984	ENST00000301749;ENST00000359128;ENST00000448023	T;T;T	0.50813	0.73;0.73;0.73	4.86	4.86	0.63082	.	0.401659	0.25332	N	0.031439	T	0.16896	0.0406	N	0.00750	-1.22	0.23435	N	0.997681	B	0.11235	0.004	B	0.17098	0.017	T	0.15435	-1.0437	10	0.10111	T	0.7	.	11.005	0.47629	1.0:0.0:0.0:0.0	.	1024	C9JLH9	.	T	978;949;1024	ENSP00000301749:I978T;ENSP00000352039:I949T;ENSP00000414415:I1024T	ENSP00000301749:I978T	I	-	2	0	NLRC3	3533432	0.996000	0.38824	0.998000	0.56505	0.720000	0.41350	1.870000	0.39529	2.160000	0.67779	0.459000	0.35465	ATT	NLRC3	-	smart_Leu-rich_rpt_RNase_inh_sub-typ	ENSG00000167984		0.493	NLRC3-201	KNOWN	basic|appris_principal	protein_coding	NLRC3	HGNC	polymorphic_pseudogene		-	0.00	53	0	A	NM_178844		3593431	-1	tier1	-	no_errors	ENST00000448023	ensembl	human	known	74_37	missense	24.49	37	12	SNP	1.000	G
NSD1	64324	genome.wustl.edu	37	5	176719054	176719054	+	Nonsense_Mutation	SNP	G	G	T			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr5:176719054G>T	ENST00000439151.2	+	22	6403	c.6358G>T	c.(6358-6360)Gag>Tag	p.E2120*	NSD1_ENST00000354179.4_Nonsense_Mutation_p.E1851*|NSD1_ENST00000347982.4_Nonsense_Mutation_p.E1851*|NSD1_ENST00000361032.4_Nonsense_Mutation_p.E2017*	NM_022455.4	NP_071900.2	Q96L73	NSD1_HUMAN	nuclear receptor binding SET domain protein 1	2120					gastrulation with mouth forming second (GO:0001702)|histone H3-K36 methylation (GO:0010452)|histone H4-K20 methylation (GO:0034770)|histone methylation (GO:0016571)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|estrogen receptor binding (GO:0030331)|histone methyltransferase activity (H3-K36 specific) (GO:0046975)|histone methyltransferase activity (H4-K20 specific) (GO:0042799)|retinoic acid receptor binding (GO:0042974)|retinoid X receptor binding (GO:0046965)|thyroid hormone receptor binding (GO:0046966)|transcription cofactor activity (GO:0003712)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(18)|lung(24)|ovary(2)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(3)	96	all_cancers(89;1.57e-05)|Renal(175;0.000269)|Lung NSC(126;0.00111)|all_lung(126;0.002)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)|Epithelial(233;0.198)	Kidney(146;0.235)		GCGAGAAGATGAGTGTTTTAG	0.498			T	NUP98	AML		Sotos Syndrome		Weaver syndrome;Sotos syndrome;Beckwith-Wiedemann syndrome	HNSCC(47;0.14)																														Dom	yes		5	5q35	64324	nuclear receptor binding SET domain protein 1	yes	L	0													93.0	76.0	82.0					5																	176719054		2203	4300	6503	SO:0001587	stop_gained	0	Familial Cancer Database	Weaver-Smith syndrome;Cerebral Gigantism;BWS, Exomphalos-Macroglossia-Gigantism (EMG) syndrome, Wiedemann-Beckwith syndrome, WBS	AK026066	CCDS4412.1, CCDS4413.1	5q35	2014-09-17	2003-03-12		ENSG00000165671	ENSG00000165671		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	14234	protein-coding gene	gene with protein product		606681	"""Sotos syndrome"""	STO		9628876, 11896389	Standard	NM_022455		Approved	ARA267, FLJ22263, KMT3B	uc003mfr.4	Q96L73	OTTHUMG00000130846	ENST00000439151.2:c.6358G>T	5.37:g.176719054G>T	ENSP00000395929:p.Glu2120*		Q96PD8|Q96RN7	Nonsense_Mutation	SNP	pfam_PWWP_dom,pfam_SET_dom,pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_PWWP_dom,smart_Znf_PHD,smart_AWS,smart_SET_dom,smart_Post-SET_dom,pfscan_AWS,pfscan_PWWP_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_PHD-finger	p.E2120*	ENST00000439151.2	37	c.6358	CCDS4412.1	5	.	.	.	.	.	.	.	.	.	.	G	46	12.540597	0.99676	.	.	ENSG00000165671	ENST00000354179;ENST00000439151;ENST00000347982;ENST00000361032	.	.	.	5.44	5.44	0.79542	.	0.000000	0.64402	D	0.000011	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.51188	T	0.08	.	19.3518	0.94392	0.0:0.0:1.0:0.0	.	.	.	.	X	1851;2120;1851;2017	.	ENSP00000343209:E1851X	E	+	1	0	NSD1	176651660	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.865000	0.99609	2.571000	0.86741	0.650000	0.86243	GAG	NSD1	-	superfamily_Znf_FYVE_PHD,smart_Znf_PHD	ENSG00000165671		0.498	NSD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NSD1	HGNC	protein_coding	OTTHUMT00000253412.2	-	0.00	47	0	G	NM_172349		176719054	+1	tier1	-	no_errors	ENST00000439151	ensembl	human	known	74_37	nonsense	47.06	18	16	SNP	1.000	T
NT5DC2	64943	genome.wustl.edu	37	3	52559074	52559074	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr3:52559074C>T	ENST00000307076.4	-	12	1541	c.1141G>A	c.(1141-1143)Gag>Aag	p.E381K	NT5DC2_ENST00000422318.2_Missense_Mutation_p.E418K|NT5DC2_ENST00000307092.4_Missense_Mutation_p.E322K|NT5DC2_ENST00000459839.1_Missense_Mutation_p.E393K	NM_022908.2	NP_075059.1	Q9H857	NT5D2_HUMAN	5'-nucleotidase domain containing 2	381							hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)			endometrium(1)|lung(3)|prostate(1)|stomach(1)	6				BRCA - Breast invasive adenocarcinoma(193;1.7e-05)|Kidney(197;0.00177)|KIRC - Kidney renal clear cell carcinoma(197;0.002)|OV - Ovarian serous cystadenocarcinoma(275;0.0476)		CGCTCCAGCTCGGGGATGATG	0.682																																																	0													13.0	13.0	13.0					3																	52559074		2181	4293	6474	SO:0001583	missense	0			AF131781	CCDS2858.1, CCDS46843.1	3p21.1	2006-02-03			ENSG00000168268	ENSG00000168268			25717	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_022908		Approved	FLJ12442	uc003den.3	Q9H857	OTTHUMG00000158626	ENST00000307076.4:c.1141G>A	3.37:g.52559074C>T	ENSP00000302468:p.Glu381Lys		C9JTZ6|E9PAL9|O95888|Q96C80|Q9H9Z8	Missense_Mutation	SNP	pfam_HAD-SF_hydro_IG_5-nucl,superfamily_HAD-like_dom,pirsf_Pur_nucleotidase,tigrfam_HAD-SF_hydro_IG_5-nucl	p.E418K	ENST00000307076.4	37	c.1252	CCDS2858.1	3	.	.	.	.	.	.	.	.	.	.	C	33	5.290981	0.95546	.	.	ENSG00000168268	ENST00000307092;ENST00000463947;ENST00000307076;ENST00000422318;ENST00000459839	T;T;T;T;T	0.77877	-1.13;-1.13;-1.13;-1.13;-1.13	5.12	4.23	0.50019	HAD-like domain (1);	0.102268	0.64402	D	0.000002	D	0.90707	0.7084	M	0.93328	3.405	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.81914	0.995;0.991;0.995	D	0.93125	0.6528	10	0.87932	D	0	-39.5043	15.5917	0.76534	0.0:0.8616:0.1384:0.0	.	393;381;418	C9JTZ6;Q9H857;E9PAL9	.;NT5D2_HUMAN;.	K	322;95;381;418;393	ENSP00000306017:E322K;ENSP00000418780:E95K;ENSP00000302468:E381K;ENSP00000406933:E418K;ENSP00000419547:E393K	ENSP00000302468:E381K	E	-	1	0	NT5DC2	52534114	1.000000	0.71417	0.974000	0.42286	0.692000	0.40212	7.707000	0.84623	1.137000	0.42214	0.491000	0.48974	GAG	NT5DC2	-	pfam_HAD-SF_hydro_IG_5-nucl,superfamily_HAD-like_dom,pirsf_Pur_nucleotidase,tigrfam_HAD-SF_hydro_IG_5-nucl	ENSG00000168268		0.682	NT5DC2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	NT5DC2	HGNC	protein_coding	OTTHUMT00000351509.1	-	0.00	13	0	C	NM_022908		52559074	-1	tier1	-	no_errors	ENST00000422318	ensembl	human	known	74_37	missense	57.14	3	4	SNP	0.999	T
OR1M1	125963	genome.wustl.edu	37	19	9204692	9204692	+	Missense_Mutation	SNP	G	G	A	rs144608760		TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr19:9204692G>A	ENST00000429566.3	+	1	838	c.772G>A	c.(772-774)Gtc>Atc	p.V258I		NM_001004456.1	NP_001004456.1	Q8NGA1	OR1M1_HUMAN	olfactory receptor, family 1, subfamily M, member 1	258						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.V258I(2)		breast(1)|endometrium(4)|large_intestine(3)|lung(17)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	32						CACCATTGGCGTCTATCTGTG	0.557																																																	2	Substitution - Missense(2)	lung(2)							ILE/VAL	0,4406		0,0,2203	164.0	148.0	153.0		772	3.7	0.0	19	dbSNP_134	153	1,8599	1.2+/-3.3	0,1,4299	no	missense	OR1M1	NM_001004456.1	29	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	258/314	9204692	1,13005	2203	4300	6503	SO:0001583	missense	0				CCDS32896.1	19p13.2	2013-09-20			ENSG00000170929	ENSG00000170929		"""GPCR / Class A : Olfactory receptors"""	8220	protein-coding gene	gene with protein product							Standard	NM_001004456		Approved	OR19-6	uc010xkj.2	Q8NGA1	OTTHUMG00000179930	ENST00000429566.3:c.772G>A	19.37:g.9204692G>A	ENSP00000401966:p.Val258Ile		B9EHA6|Q6IFJ3|Q96R91	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.V258I	ENST00000429566.3	37	c.772	CCDS32896.1	19	.	.	.	.	.	.	.	.	.	.	g	16.75	3.208312	0.58343	0.0	1.16E-4	ENSG00000170929	ENST00000305465;ENST00000429566	T	0.00091	8.74	3.71	3.71	0.42584	GPCR, rhodopsin-like superfamily (1);	0.151400	0.31507	N	0.007525	T	0.00271	0.0008	L	0.38175	1.15	0.09310	N	1	D	0.76494	0.999	D	0.79784	0.993	T	0.57165	-0.7858	10	0.72032	D	0.01	.	8.6151	0.33826	0.1093:0.0:0.8907:0.0	.	258	Q8NGA1	OR1M1_HUMAN	I	261;258	ENSP00000401966:V258I	ENSP00000303195:V261I	V	+	1	0	OR1M1	9065692	0.000000	0.05858	0.039000	0.18376	0.478000	0.33099	0.054000	0.14205	2.083000	0.62718	0.580000	0.79431	GTC	OR1M1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000170929		0.557	OR1M1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR1M1	HGNC	protein_coding	OTTHUMT00000448993.1	-	0.00	47	0	G			9204692	+1	tier1	rs144608760	no_errors	ENST00000429566	ensembl	human	known	74_37	missense	17.78	37	8	SNP	0.001	A
NWD1	284434	genome.wustl.edu	37	19	16884031	16884031	+	Silent	SNP	G	G	A			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr19:16884031G>A	ENST00000552788.1	+	9	2505	c.2505G>A	c.(2503-2505)caG>caA	p.Q835Q	NWD1_ENST00000549814.1_Silent_p.Q835Q|NWD1_ENST00000379808.3_Silent_p.Q835Q|NWD1_ENST00000524140.2_Silent_p.Q835Q|NWD1_ENST00000339803.6_Silent_p.Q700Q|NWD1_ENST00000523826.1_Silent_p.Q629Q			Q149M9	NWD1_HUMAN	NACHT and WD repeat domain containing 1	835							ATP binding (GO:0005524)			NS(3)|breast(2)|cervix(1)|endometrium(8)|large_intestine(17)|lung(18)|ovary(2)|pancreas(3)|prostate(5)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	67						AACAGGCCCAGAGCTGGTTCC	0.622																																																	0													66.0	63.0	64.0					19																	16884031		2203	4299	6502	SO:0001819	synonymous_variant	0			BX648940	CCDS32945.1, CCDS32945.2	19p13.11	2013-01-09				ENSG00000188039		"""WD repeat domain containing"""	27619	protein-coding gene	gene with protein product							Standard	NM_001007525		Approved		uc002neu.4	Q149M9		ENST00000552788.1:c.2505G>A	19.37:g.16884031G>A			C9J021|Q68CT3	Silent	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,superfamily_P-loop_NTPase,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.Q835	ENST00000552788.1	37	c.2505		19																																																																																			NWD1	-	NULL	ENSG00000188039		0.622	NWD1-005	NOVEL	basic|appris_candidate_longest	protein_coding	NWD1	HGNC	protein_coding	OTTHUMT00000403569.1	-	0.00	55	0	G	NM_001007525		16884031	+1	tier1	-	no_errors	ENST00000379808	ensembl	human	known	74_37	silent	50.00	20	20	SNP	0.916	A
OR2M4	26245	genome.wustl.edu	37	1	248402808	248402808	+	Missense_Mutation	SNP	C	C	A	rs374565024		TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr1:248402808C>A	ENST00000306687.1	+	1	578	c.578C>A	c.(577-579)tCt>tAt	p.S193Y		NM_017504.1	NP_059974.1	Q96R27	OR2M4_HUMAN	olfactory receptor, family 2, subfamily M, member 4	193					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(27)|skin(3)|upper_aerodigestive_tract(2)	50	all_cancers(71;0.000124)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0245)			ACAGAAACATCTGCATTTGAA	0.413																																																	0													134.0	131.0	132.0					1																	248402808		2203	4300	6503	SO:0001583	missense	0			X64992	CCDS31108.1	1q44	2012-08-09			ENSG00000171180	ENSG00000171180		"""GPCR / Class A : Olfactory receptors"""	8270	protein-coding gene	gene with protein product						1370859, 9119360	Standard	NM_017504		Approved	HTPCRX18, TPCR100, HSHTPCRX18, OST710	uc010pzh.2	Q96R27	OTTHUMG00000040456	ENST00000306687.1:c.578C>A	1.37:g.248402808C>A	ENSP00000306688:p.Ser193Tyr		Q15611|Q8NG82	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.S193Y	ENST00000306687.1	37	c.578	CCDS31108.1	1	.	.	.	.	.	.	.	.	.	.	c	12.51	1.958728	0.34565	.	.	ENSG00000171180	ENST00000306687	T	0.00044	8.83	3.34	1.2	0.21068	GPCR, rhodopsin-like superfamily (1);	1.726390	0.03917	N	0.282935	T	0.00241	0.0007	L	0.27053	0.805	0.09310	N	1	D	0.57257	0.979	D	0.67725	0.953	T	0.52230	-0.8603	10	0.45353	T	0.12	.	4.2534	0.10705	0.4017:0.4705:0.0:0.1277	.	193	Q96R27	OR2M4_HUMAN	Y	193	ENSP00000306688:S193Y	ENSP00000306688:S193Y	S	+	2	0	OR2M4	246469431	0.000000	0.05858	0.710000	0.30468	0.949000	0.60115	-2.842000	0.00737	0.716000	0.32124	0.543000	0.68304	TCT	OR2M4	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM	ENSG00000171180		0.413	OR2M4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2M4	HGNC	protein_coding	OTTHUMT00000097352.1	-	0.00	78	0	C	NM_017504		248402808	+1	tier1	-	no_errors	ENST00000306687	ensembl	human	known	74_37	missense	28.89	64	26	SNP	0.000	A
PAPLN	89932	genome.wustl.edu	37	14	73739372	73739372	+	Nonstop_Mutation	SNP	G	G	T			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr14:73739372G>T	ENST00000554301.1	+	26	4000	c.3837G>T	c.(3835-3837)taG>taT	p.*1279Y	PAPLN_ENST00000555445.1_Nonstop_Mutation_p.*1263Y|RP4-647C14.3_ENST00000556578.1_RNA|PAPLN_ENST00000340738.5_Nonstop_Mutation_p.*1252Y|PAPLN_ENST00000427855.1_Nonstop_Mutation_p.*1279Y|PAPLN_ENST00000381166.3_3'UTR			O95428	PPN_HUMAN	papilin, proteoglycan-like sulfated glycoprotein	0						basement membrane (GO:0005604)	metalloendopeptidase activity (GO:0004222)|serine-type endopeptidase inhibitor activity (GO:0004867)|zinc ion binding (GO:0008270)			NS(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(4)|lung(11)|ovary(3)|pancreas(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(3)	42				BRCA - Breast invasive adenocarcinoma(234;0.00394)|OV - Ovarian serous cystadenocarcinoma(108;0.0468)		TCTGGCAGTAGGGATGAAGGC	0.537																																																	0													85.0	80.0	82.0					14																	73739372		2203	4300	6503	SO:0001578	stop_lost	0			BC042057	CCDS32114.1	14q24.2	2013-01-11				ENSG00000100767		"""Immunoglobulin superfamily / I-set domain containing"""	19262	protein-coding gene	gene with protein product						11076767, 19734141	Standard	NM_173462		Approved	MGC50452	uc001xnw.4	O95428		ENST00000554301.1:c.3837G>T	14.37:g.73739372G>T	ENSP00000451803:p.*1279Tyrext*2		B4DES8|B4DGE6|Q659F2|Q6UXJ4|Q6ZNM1|Q6ZUJ0|Q7Z681|Q8IVU0	Nonstop_Mutation	SNP	pfam_Ig_I-set,pfam_ADAM_spacer1,pfam_Thrombospondin_1_rpt,pfam_Ig_V-set,pfam_Immunoglobulin,pfam_Prot_inh_Kunz-m,pfam_PLAC,superfamily_Prot_inh_Kunz-m,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,smart_Prot_inh_Kunz-m,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Prot_inh_Kunz-m,pfscan_Ig-like_dom,prints_Peptidase_M12B_ADAM-TS,prints_Prot_inh_Kunz-m	p.*1279Y	ENST00000554301.1	37	c.3837		14	.	.	.	.	.	.	.	.	.	.	G	14.53	2.562621	0.45694	.	.	ENSG00000100767	ENST00000340738;ENST00000427855;ENST00000554301;ENST00000555445	.	.	.	5.21	3.3	0.37823	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	3.9857	0.09514	0.2036:0.0:0.6127:0.1837	.	.	.	.	Y	1252;1279;1279;1263	.	.	X	+	3	2	PAPLN	72809125	0.719000	0.27986	1.000000	0.80357	0.883000	0.51084	-0.152000	0.10159	0.705000	0.31890	-0.345000	0.07892	TAG	PAPLN	-	NULL	ENSG00000100767		0.537	PAPLN-002	KNOWN	basic|appris_principal	protein_coding	PAPLN	HGNC	protein_coding	OTTHUMT00000413182.1	-	0.00	57	0	G	NM_173462		73739372	+1	tier1	-	no_errors	ENST00000427855	ensembl	human	known	74_37	nonstop	9.30	39	4	SNP	1.000	T
PAPPA2	60676	genome.wustl.edu	37	1	176564460	176564460	+	Missense_Mutation	SNP	A	A	C			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr1:176564460A>C	ENST00000367662.3	+	3	2884	c.1720A>C	c.(1720-1722)Aat>Cat	p.N574H	PAPPA2_ENST00000367661.3_Missense_Mutation_p.N574H	NM_020318.2	NP_064714.2	Q9BXP8	PAPP2_HUMAN	pappalysin 2	574	Metalloprotease.				bone morphogenesis (GO:0060349)|cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|proteolysis (GO:0006508)|regulation of cell growth (GO:0001558)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(3)|breast(3)|central_nervous_system(7)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(19)|lung(136)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|upper_aerodigestive_tract(8)|urinary_tract(1)	226						CCAGGTCCACAATTCCACCCT	0.567																																																	0													93.0	96.0	95.0					1																	176564460		2129	4244	6373	SO:0001583	missense	0			BG354569	CCDS41438.1, CCDS41439.1	1q23-q25	2008-05-23	2004-07-07	2004-07-09	ENSG00000116183	ENSG00000116183			14615	protein-coding gene	gene with protein product			"""placenta-specific 3"""	PLAC3		11018262, 11264294	Standard	NM_021936		Approved	PAPPE, PAPP-A2	uc001gkz.3	Q9BXP8	OTTHUMG00000035025	ENST00000367662.3:c.1720A>C	1.37:g.176564460A>C	ENSP00000356634:p.Asn574His		A9Z1Y8|Q96PH7|Q96PH8|Q9H4C9	Missense_Mutation	SNP	pfam_Notch_dom,pfam_Sushi_SCR_CCP,pfam_Peptidase_M43,superfamily_ConA-like_lec_gl_sf,superfamily_Sushi_SCR_CCP,superfamily_Fibronectin_type3,superfamily_Notch_dom,smart_LamG-like,smart_Notch_dom,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP,tigrfam_Myxo_disulph_rpt	p.N574H	ENST00000367662.3	37	c.1720	CCDS41438.1	1	.	.	.	.	.	.	.	.	.	.	A	13.44	2.236418	0.39498	.	.	ENSG00000116183	ENST00000367662;ENST00000367661	T;T	0.46451	0.87;0.87	5.11	3.99	0.46301	Notch domain (1);	0.049907	0.85682	D	0.000000	T	0.56572	0.1994	M	0.79693	2.465	0.40407	D	0.979713	D;P	0.54964	0.969;0.788	P;B	0.55087	0.768;0.389	T	0.64424	-0.6411	10	0.87932	D	0	-27.5674	9.9733	0.41768	0.9197:0.0:0.0803:0.0	.	574;574	Q9BXP8;A9Z1Y8	PAPP2_HUMAN;.	H	574	ENSP00000356634:N574H;ENSP00000356633:N574H	ENSP00000356633:N574H	N	+	1	0	PAPPA2	174831083	1.000000	0.71417	1.000000	0.80357	0.681000	0.39784	6.230000	0.72301	1.921000	0.55644	0.455000	0.32223	AAT	PAPPA2	-	smart_Notch_dom	ENSG00000116183		0.567	PAPPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAPPA2	HGNC	protein_coding	OTTHUMT00000084763.1	-	0.00	65	0	A			176564460	+1	tier1	-	no_errors	ENST00000367662	ensembl	human	known	74_37	missense	28.30	38	15	SNP	1.000	C
PARP10	84875	genome.wustl.edu	37	8	145057845	145057845	+	Nonsense_Mutation	SNP	C	C	A			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr8:145057845C>A	ENST00000313028.7	-	8	2006	c.1912G>T	c.(1912-1914)Gag>Tag	p.E638*	PARP10_ENST00000524918.1_Nonsense_Mutation_p.E629*|PARP10_ENST00000525773.1_Nonsense_Mutation_p.E650*|PARP10_ENST00000533665.1_5'Flank	NM_032789.3	NP_116178.2	Q53GL7	PAR10_HUMAN	poly (ADP-ribose) polymerase family, member 10	638	Glu-rich.				negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of gene expression (GO:0010629)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein import into nucleus, translocation (GO:0033159)|negative regulation of protein K63-linked ubiquitination (GO:1900045)|negative regulation of viral genome replication (GO:0045071)|protein ADP-ribosylation (GO:0006471)|protein auto-ADP-ribosylation (GO:0070213)|protein poly-ADP-ribosylation (GO:0070212)|regulation of chromatin assembly (GO:0010847)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	K63-linked polyubiquitin binding (GO:0070530)|NAD+ ADP-ribosyltransferase activity (GO:0003950)			NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(5)|lung(9)|ovary(4)|pancreas(1)|upper_aerodigestive_tract(2)	27	all_cancers(97;8.2e-11)|all_epithelial(106;1.1e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.31e-40)|Epithelial(56;1.16e-39)|all cancers(56;6.43e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			GCCACAGGCTCCTCCTCCTCA	0.687																																																	0													21.0	20.0	20.0					8																	145057845		2196	4283	6479	SO:0001587	stop_gained	0			AK027370	CCDS34960.1	8q24	2010-02-16				ENSG00000178685		"""Poly (ADP-ribose) polymerases"""	25895	protein-coding gene	gene with protein product		609564				15273990	Standard	NM_032789		Approved	FLJ14464	uc003zal.4	Q53GL7		ENST00000313028.7:c.1912G>T	8.37:g.145057845C>A	ENSP00000325618:p.Glu638*		Q8N2I0|Q8WV05|Q96CH7|Q96K72	Nonsense_Mutation	SNP	pfam_Poly(ADP-ribose)pol_cat_dom,pfscan_Poly(ADP-ribose)pol_cat_dom	p.E638*	ENST00000313028.7	37	c.1912	CCDS34960.1	8	.	.	.	.	.	.	.	.	.	.	C	17.79	3.474998	0.63737	.	.	ENSG00000178685	ENST00000524918;ENST00000534861;ENST00000313028;ENST00000525773	.	.	.	4.53	0.214	0.15249	.	0.630703	0.14017	N	0.347037	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.17369	T	0.5	.	3.9869	0.09519	0.0:0.5011:0.1786:0.3203	.	.	.	.	X	629;344;638;650	.	ENSP00000325618:E638X	E	-	1	0	PARP10	145129833	0.000000	0.05858	0.005000	0.12908	0.022000	0.10575	0.678000	0.25277	0.360000	0.24265	0.479000	0.44913	GAG	PARP10	-	NULL	ENSG00000178685		0.687	PARP10-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PARP10	HGNC	protein_coding	OTTHUMT00000383866.1	-	0.00	82	0	C	NM_032789		145057845	-1	tier1	-	no_errors	ENST00000313028	ensembl	human	known	74_37	nonsense	46.60	55	48	SNP	0.000	A
PARP4	143	genome.wustl.edu	37	13	25058793	25058793	+	Silent	SNP	G	G	A			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr13:25058793G>A	ENST00000381989.3	-	12	1551	c.1446C>T	c.(1444-1446)ctC>ctT	p.L482L		NM_006437.3	NP_006428.2	Q9UKK3	PARP4_HUMAN	poly (ADP-ribose) polymerase family, member 4	482	PARP catalytic. {ECO:0000255|PROSITE- ProRule:PRU00397}.				cell death (GO:0008219)|cellular protein modification process (GO:0006464)|cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|inflammatory response (GO:0006954)|protein ADP-ribosylation (GO:0006471)|response to drug (GO:0042493)|transport (GO:0006810)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|spindle microtubule (GO:0005876)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)|NAD+ ADP-ribosyltransferase activity (GO:0003950)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(14)|lung(18)|ovary(3)|prostate(2)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	63		all_epithelial(30;7.67e-16)|Lung SC(185;0.0225)|Breast(139;0.052)		all cancers(112;0.000127)|Epithelial(112;0.000778)|Kidney(163;0.039)|OV - Ovarian serous cystadenocarcinoma(117;0.0578)|KIRC - Kidney renal clear cell carcinoma(186;0.135)|Lung(94;0.195)		GAACATACCTGAGCGAATCAC	0.418																																																	0													185.0	167.0	173.0					13																	25058793		2203	4300	6503	SO:0001819	synonymous_variant	0			AF057160	CCDS9307.1	13q11	2010-09-29	2004-08-20	2004-08-26	ENSG00000102699	ENSG00000102699		"""Poly (ADP-ribose) polymerases"""	271	protein-coding gene	gene with protein product	"""von Willebrand factor A domain containing 5C"""	607519	"""ADP-ribosyltransferase (NAD+; poly (ADP-ribose) polymerase)-like 1"""	ADPRTL1		10644454	Standard	NM_006437		Approved	VAULT3, p193, VPARP, VWA5C	uc001upl.3	Q9UKK3	OTTHUMG00000016582	ENST00000381989.3:c.1446C>T	13.37:g.25058793G>A			O75903|Q14682|Q5QNZ9|Q9H1M6	Silent	SNP	pfam_Poly(ADP-ribose)pol_cat_dom,pfam_VIT,pfam_VWF_A,pfam_BRCT_dom,superfamily_Poly(ADP-ribose)pol_reg_dom,superfamily_BRCT_dom,smart_BRCT_dom,smart_VIT,smart_VWF_A,pfscan_BRCT_dom,pfscan_VWF_A,pfscan_Poly(ADP-ribose)pol_cat_dom,pfscan_Poly(ADP-ribose)pol_reg_dom	p.L482	ENST00000381989.3	37	c.1446	CCDS9307.1	13																																																																																			PARP4	-	pfam_Poly(ADP-ribose)pol_cat_dom,pfscan_Poly(ADP-ribose)pol_cat_dom	ENSG00000102699		0.418	PARP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PARP4	HGNC	protein_coding	OTTHUMT00000044189.1	-	0.00	89	0	G	NM_006437		25058793	-1	tier1	-	no_errors	ENST00000381989	ensembl	human	known	74_37	silent	26.44	64	23	SNP	0.998	A
PCCB	5096	genome.wustl.edu	37	3	136045208	136045208	+	Intron	SNP	G	G	A			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr3:136045208G>A	ENST00000251654.4	+	11	1160				PCCB_ENST00000474833.1_Intron|PCCB_ENST00000482086.1_Intron|PCCB_ENST00000468777.1_Intron|PCCB_ENST00000471595.1_Intron|PCCB_ENST00000483687.1_Intron|PCCB_ENST00000490504.1_Intron|PCCB_ENST00000478469.1_Intron|PCCB_ENST00000466072.1_Silent_p.Q377Q|PCCB_ENST00000469217.1_Intron|PCCB_ENST00000462637.1_Intron	NM_000532.4	NP_000523.2	P05166	PCCB_HUMAN	propionyl CoA carboxylase, beta polypeptide						biotin metabolic process (GO:0006768)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|short-chain fatty acid catabolic process (GO:0019626)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|propionyl-CoA carboxylase activity (GO:0004658)			breast(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(10)|ovary(1)|urinary_tract(1)	25					Biotin(DB00121)|L-Valine(DB00161)	ctaggaggcagtatcgtccct	0.438																																																	0																																										SO:0001627	intron_variant	0				CCDS3089.1, CCDS54643.1	3q21-q22	2010-07-01	2010-04-30		ENSG00000114054	ENSG00000114054	6.4.1.3		8654	protein-coding gene	gene with protein product		232050	"""propionyl Coenzyme A carboxylase, beta polypeptide"""			2895916	Standard	NM_000532		Approved		uc003eqy.2	P05166	OTTHUMG00000159792	ENST00000251654.4:c.1091-437G>A	3.37:g.136045208G>A			B7Z2Z4|Q16813|Q96CX0	Silent	SNP	pfam_Carboxyl_trans,pfscan_COA_CT_N,pfscan_COA_CT_C	p.Q377	ENST00000251654.4	37	c.1131	CCDS3089.1	3																																																																																			PCCB	-	pfam_Carboxyl_trans,pfscan_COA_CT_C	ENSG00000114054		0.438	PCCB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PCCB	HGNC	protein_coding	OTTHUMT00000357335.1	-	0.00	107	0	G			136045208	+1	tier1	-	no_errors	ENST00000466072	ensembl	human	putative	74_37	silent	54.22	38	45	SNP	0.000	A
PCDHGA7	56108	genome.wustl.edu	37	5	140764474	140764474	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr5:140764474G>A	ENST00000518325.1	+	1	2008	c.2008G>A	c.(2008-2010)Gaa>Aaa	p.E670K	PCDHGB1_ENST00000523390.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGB4_ENST00000519479.1_5'Flank|PCDHGA2_ENST00000394576.2_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA3_ENST00000253812.6_Intron	NM_018920.2	NP_061743.1	Q9Y5G6	PCDG7_HUMAN	protocadherin gamma subfamily A, 7	670	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|biliary_tract(1)|endometrium(8)|kidney(4)|large_intestine(10)|lung(19)|ovary(1)|skin(1)|stomach(3)|urinary_tract(1)	49			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CAGCATCCCCGAAGTCTTGGC	0.637																																																	0													43.0	51.0	48.0					5																	140764474		2201	4297	6498	SO:0001583	missense	0			AF152514	CCDS54927.1, CCDS75336.1	5q31	2010-01-26				ENSG00000253537		"""Cadherins / Protocadherins : Clustered"""	8705	other	protocadherin		606294				10380929	Standard	NM_018920		Approved	PCDH-GAMMA-A7		Q9Y5G6		ENST00000518325.1:c.2008G>A	5.37:g.140764474G>A	ENSP00000430024:p.Glu670Lys		B2RN87|Q9Y5D0	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.E670K	ENST00000518325.1	37	c.2008	CCDS54927.1	5	.	.	.	.	.	.	.	.	.	.	.	16.77	3.214028	0.58452	.	.	ENSG00000253537	ENST00000518325	T	0.52295	0.67	5.12	4.24	0.50183	Cadherin (1);	.	.	.	.	T	0.43255	0.1239	M	0.67397	2.05	0.23620	N	0.997272	B;P	0.40032	0.017;0.699	B;B	0.33254	0.024;0.16	T	0.43909	-0.9362	9	0.87932	D	0	.	9.5644	0.39389	0.0767:0.1418:0.7815:0.0	.	670;670	Q9Y5G6;Q9Y5G6-2	PCDG7_HUMAN;.	K	670	ENSP00000430024:E670K	ENSP00000430024:E670K	E	+	1	0	PCDHGA7	140744658	0.992000	0.36948	0.009000	0.14445	0.083000	0.17756	2.327000	0.43858	1.264000	0.44198	0.655000	0.94253	GAA	PCDHGA7	-	pfscan_Cadherin	ENSG00000253537		0.637	PCDHGA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGA7	HGNC	protein_coding	OTTHUMT00000374744.1	-	0.00	109	0	G	NM_018920		140764474	+1	tier1	-	no_errors	ENST00000518325	ensembl	human	known	74_37	missense	57.14	27	36	SNP	0.689	A
PDCL	5082	genome.wustl.edu	37	9	125582567	125582567	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr9:125582567C>A	ENST00000259467.4	-	4	868	c.703G>T	c.(703-705)Gcc>Tcc	p.A235S		NM_005388.4	NP_005379.3	Q13371	PHLP_HUMAN	phosducin-like	235					heterotrimeric G-protein complex assembly (GO:1902605)|intracellular signal transduction (GO:0035556)|negative regulation of protein refolding (GO:0061084)|protein folding (GO:0006457)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|signal transduction (GO:0007165)|visual perception (GO:0007601)	cytoplasm (GO:0005737)	receptor signaling protein activity (GO:0005057)			endometrium(1)|large_intestine(2)|lung(5)|skin(1)|stomach(1)	10						ATCAGCAGGGCAGGAAGGGCA	0.507																																																	0													78.0	69.0	72.0					9																	125582567		2203	4300	6503	SO:0001583	missense	0			AF083325	CCDS6845.1	9q12-q13	2008-07-21			ENSG00000136940	ENSG00000136940			8770	protein-coding gene	gene with protein product		604421				10095058	Standard	NM_005388		Approved	PhLP, DKFZp564M1863	uc004bmz.2	Q13371	OTTHUMG00000020624	ENST00000259467.4:c.703G>T	9.37:g.125582567C>A	ENSP00000259467:p.Ala235Ser		Q4VXB6|Q96AF1|Q9UEW7|Q9UFL0|Q9UNX1|Q9UNX2	Missense_Mutation	SNP	pfam_Phosducin_thioredoxin-like_dom,superfamily_Thioredoxin-like_fold,prints_Phosducin	p.A235S	ENST00000259467.4	37	c.703	CCDS6845.1	9	.	.	.	.	.	.	.	.	.	.	C	22.2	4.256965	0.80246	.	.	ENSG00000136940	ENST00000259467	T	0.14391	2.51	5.96	5.07	0.68467	Phosducin, thioredoxin-like domain (1);Thioredoxin-like fold (2);	0.044772	0.85682	D	0.000000	T	0.32585	0.0834	L	0.61387	1.9	0.80722	D	1	D	0.71674	0.998	D	0.65323	0.934	T	0.04320	-1.0960	10	0.66056	D	0.02	-10.8711	14.0171	0.64531	0.0:0.9283:0.0:0.0717	.	235	Q13371	PHLP_HUMAN	S	235	ENSP00000259467:A235S	ENSP00000259467:A235S	A	-	1	0	PDCL	124622388	1.000000	0.71417	0.999000	0.59377	0.998000	0.95712	4.652000	0.61454	1.526000	0.49068	0.655000	0.94253	GCC	PDCL	-	pfam_Phosducin_thioredoxin-like_dom,superfamily_Thioredoxin-like_fold,prints_Phosducin	ENSG00000136940		0.507	PDCL-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PDCL	HGNC	protein_coding	OTTHUMT00000053956.1	-	0.00	35	0	C	NM_005388		125582567	-1	tier1	-	no_errors	ENST00000259467	ensembl	human	known	74_37	missense	17.24	24	5	SNP	1.000	A
PDLIM5	10611	genome.wustl.edu	37	4	95497125	95497125	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr4:95497125C>T	ENST00000317968.4	+	5	786	c.650C>T	c.(649-651)tCt>tTt	p.S217F	PDLIM5_ENST00000514743.1_Missense_Mutation_p.S108F|PDLIM5_ENST00000437932.1_Missense_Mutation_p.S108F|PDLIM5_ENST00000538141.1_Intron|PDLIM5_ENST00000318007.5_Intron|PDLIM5_ENST00000450793.1_Missense_Mutation_p.S108F|PDLIM5_ENST00000508216.1_Missense_Mutation_p.S108F|PDLIM5_ENST00000380180.3_Missense_Mutation_p.S108F|PDLIM5_ENST00000542407.1_Missense_Mutation_p.S95F	NM_001256428.1|NM_006457.4	NP_001243357.1|NP_006448	Q96HC4	PDLI5_HUMAN	PDZ and LIM domain 5	217					regulation of dendritic spine morphogenesis (GO:0061001)|regulation of synapse assembly (GO:0051963)	actin cytoskeleton (GO:0015629)|cell junction (GO:0030054)|cytosol (GO:0005829)|membrane (GO:0016020)|neuron projection (GO:0043005)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	actin binding (GO:0003779)|actinin binding (GO:0042805)|protein kinase C binding (GO:0005080)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(3)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	22		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;1.84e-09)		TCCGAGACTTCTCAGGAGCTA	0.507																																																	0													68.0	67.0	67.0					4																	95497125		2203	4300	6503	SO:0001583	missense	0			AF061258	CCDS3641.1, CCDS47103.1, CCDS47104.1, CCDS58915.1, CCDS58916.1, CCDS58917.1, CCDS75166.1	4q22	2006-04-12			ENSG00000163110	ENSG00000163110			17468	protein-coding gene	gene with protein product		605904				15346770	Standard	NM_006457		Approved	LIM, Enh	uc003htk.4	Q96HC4	OTTHUMG00000130973	ENST00000317968.4:c.650C>T	4.37:g.95497125C>T	ENSP00000321746:p.Ser217Phe		A8K6F9|D6RB78|E9PBF5|O60705|Q56VN4|Q5UW38|Q8WVK0	Missense_Mutation	SNP	pfam_Znf_LIM,pfam_PDZ,superfamily_PDZ,smart_PDZ,smart_Znf_LIM,pfscan_Znf_LIM,pfscan_PDZ	p.S217F	ENST00000317968.4	37	c.650	CCDS3641.1	4	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.87|16.87	3.243122|3.243122	0.58995|0.58995	.|.	.|.	ENSG00000163110|ENSG00000163110	ENST00000513341|ENST00000437932;ENST00000380180;ENST00000450793;ENST00000317968;ENST00000503974;ENST00000542407;ENST00000508216;ENST00000514743	.|T;T;T;T;T;T;T;T	.|0.58506	.|0.45;1.68;1.68;0.73;0.47;0.33;1.68;0.46	5.27|5.27	4.37|4.37	0.52481|0.52481	.|.	.|0.181160	.|0.48286	.|D	.|0.000186	T|T	0.38054|0.38054	0.1026|0.1026	N|N	0.08118|0.08118	0|0	0.32618|0.32618	N|N	0.523665|0.523665	.|P;B;P;B;B	.|0.35821	.|0.523;0.022;0.523;0.078;0.004	.|B;B;B;B;B	.|0.33799	.|0.17;0.026;0.165;0.078;0.016	T|T	0.57063|0.57063	-0.7875|-0.7875	5|10	.|0.59425	.|D	.|0.04	.|.	15.3287|15.3287	0.74190|0.74190	0.0:0.86:0.14:0.0|0.0:0.86:0.14:0.0	.|.	.|108;108;217;108;108	.|E9PBF5;D6RB78;Q96HC4;Q96HC4-4;Q96HC4-2	.|.;.;PDLI5_HUMAN;.;.	F|F	76|108;108;108;217;108;95;108;108	.|ENSP00000398469:S108F;ENSP00000369527:S108F;ENSP00000401579:S108F;ENSP00000321746:S217F;ENSP00000424297:S108F;ENSP00000442187:S95F;ENSP00000426804:S108F;ENSP00000424360:S108F	.|ENSP00000321746:S217F	L|S	+|+	1|2	0|0	PDLIM5|PDLIM5	95716148|95716148	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	3.731000|3.731000	0.55013|0.55013	2.444000|2.444000	0.82710|0.82710	0.650000|0.650000	0.86243|0.86243	CTC|TCT	PDLIM5	-	NULL	ENSG00000163110		0.507	PDLIM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDLIM5	HGNC	protein_coding	OTTHUMT00000253586.1	-	0.00	36	0	C			95497125	+1	tier1	-	no_errors	ENST00000317968	ensembl	human	known	74_37	missense	22.22	21	6	SNP	1.000	T
PIGW	284098	genome.wustl.edu	37	17	34893992	34893992	+	Missense_Mutation	SNP	A	A	G			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr17:34893992A>G	ENST00000592983.1	+	2	1622	c.1042A>G	c.(1042-1044)Att>Gtt	p.I348V	MYO19_ENST00000590081.1_Intron|PIGW_ENST00000328396.2_Missense_Mutation_p.I348V			Q7Z7B1	PIGW_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class W	348					C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|preassembly of GPI anchor in ER membrane (GO:0016254)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	transferase activity, transferring acyl groups (GO:0016746)			breast(2)|endometrium(3)|kidney(1)|large_intestine(1)|lung(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	13		Breast(25;0.00957)|Ovarian(249;0.17)	Kidney(155;0.104)	UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		ACTGGCAGCTATTAGCCTCTT	0.363																																																	0													85.0	78.0	80.0					17																	34893992		2203	4300	6503	SO:0001583	missense	0			AB097818	CCDS11313.1	17q21.1	2014-05-06	2006-06-28		ENSG00000184886	ENSG00000277161		"""Phosphatidylinositol glycan anchor biosynthesis"""	23213	protein-coding gene	gene with protein product		610275	"""phosphatidylinositol glycan, class W"""			14517336, 12714589	Standard	XM_005257238		Approved	Gwt1, FLJ37433	uc002hmz.1	Q7Z7B1	OTTHUMG00000188438	ENST00000592983.1:c.1042A>G	17.37:g.34893992A>G	ENSP00000468778:p.Ile348Val		Q8N9G3	Missense_Mutation	SNP	pfam_GWT1,pirsf_GWT1	p.I348V	ENST00000592983.1	37	c.1042	CCDS11313.1	17	.	.	.	.	.	.	.	.	.	.	A	0.278	-0.988103	0.02162	.	.	ENSG00000184886	ENST00000328396	.	.	.	5.49	-0.858	0.10689	.	0.568294	0.18988	N	0.125678	T	0.14056	0.0340	N	0.12961	0.28	0.09310	N	1	B	0.09022	0.002	B	0.08055	0.003	T	0.11155	-1.0599	8	.	.	.	-4.5546	1.1745	0.01832	0.3027:0.1377:0.3394:0.2202	.	348	Q7Z7B1	PIGW_HUMAN	V	348	.	.	I	+	1	0	PIGW	31968105	0.717000	0.27966	0.170000	0.22879	0.915000	0.54546	0.288000	0.18939	0.124000	0.18369	0.459000	0.35465	ATT	PIGW	-	pfam_GWT1,pirsf_GWT1	ENSG00000184886		0.363	PIGW-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PIGW	HGNC	protein_coding	OTTHUMT00000451318.1		0.00	43	0	A	NM_178517		34893992	+1			no_errors	ENST00000328396	ensembl	human	known	74_37	missense	21.62	29	8	SNP	0.001	G
PLBD1	79887	genome.wustl.edu	37	12	14659951	14659951	+	Missense_Mutation	SNP	A	A	C			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr12:14659951A>C	ENST00000240617.5	-	9	1940	c.1288T>G	c.(1288-1290)Tta>Gta	p.L430V		NM_024829.5	NP_079105.4	Q6P4A8	PLBL1_HUMAN	phospholipase B domain containing 1	430					glycerophospholipid biosynthetic process (GO:0046474)|lipid catabolic process (GO:0016042)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|lysosome (GO:0005764)	hydrolase activity (GO:0016787)			central_nervous_system(1)|cervix(2)|endometrium(3)|kidney(3)|large_intestine(2)|lung(3)|prostate(1)|upper_aerodigestive_tract(1)	16						CGTGGAGCTAAATCATAAGAG	0.428																																																	0													126.0	116.0	119.0					12																	14659951		2203	4300	6503	SO:0001583	missense	0			BC000909	CCDS31751.1	12p13.1	2013-10-11			ENSG00000121316	ENSG00000121316			26215	protein-coding gene	gene with protein product	"""PLB homolog 1 (Dictyostelium)"""					15193148, 19019078	Standard	NM_024829		Approved	FLJ22662	uc001rcc.1	Q6P4A8	OTTHUMG00000168821	ENST00000240617.5:c.1288T>G	12.37:g.14659951A>C	ENSP00000240617:p.Leu430Val		A8K4E9|Q9BVV3|Q9H625	Missense_Mutation	SNP	pfam_PLipase_B-like	p.L430V	ENST00000240617.5	37	c.1288	CCDS31751.1	12	.	.	.	.	.	.	.	.	.	.	A	20.5	4.004011	0.74932	.	.	ENSG00000121316	ENST00000240617	T	0.17528	2.27	5.54	2.26	0.28386	.	0.129438	0.53938	D	0.000053	T	0.35307	0.0927	M	0.90595	3.13	0.35326	D	0.785151	P	0.45768	0.866	P	0.54174	0.744	T	0.39292	-0.9621	10	0.59425	D	0.04	-3.5604	4.9011	0.13775	0.1323:0.0:0.2228:0.645	.	430	Q6P4A8	PLBL1_HUMAN	V	430	ENSP00000240617:L430V	ENSP00000240617:L430V	L	-	1	2	PLBD1	14551218	0.995000	0.38212	0.973000	0.42090	0.987000	0.75469	2.368000	0.44222	0.093000	0.17368	0.533000	0.62120	TTA	PLBD1	-	pfam_PLipase_B-like	ENSG00000121316		0.428	PLBD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLBD1	HGNC	protein_coding	OTTHUMT00000401203.1	-	0.00	35	0	A	NM_024829		14659951	-1	tier1	-	no_errors	ENST00000240617	ensembl	human	known	74_37	missense	15.52	49	9	SNP	0.963	C
PLEKHA8	84725	genome.wustl.edu	37	7	30118277	30118277	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr7:30118277G>C	ENST00000449726.1	+	14	1784	c.1434G>C	c.(1432-1434)caG>caC	p.Q478H	PLEKHA8_ENST00000396259.1_Intron|PLEKHA8_ENST00000258679.7_Intron|PLEKHA8_ENST00000396257.2_Intron	NM_001197027.1	NP_001183956.1	Q96JA3	PKHA8_HUMAN	pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 8	478	Glycolipid transfer protein homology domain.			Q -> R (in Ref. 1; AAK55424). {ECO:0000305}.	ER to Golgi ceramide transport (GO:0035621)|lipid transport (GO:0006869)|protein transport (GO:0015031)	membrane (GO:0016020)|trans-Golgi network (GO:0005802)	ceramide binding (GO:0097001)|glycolipid binding (GO:0051861)|glycolipid transporter activity (GO:0017089)|phosphatidylinositol-4-phosphate binding (GO:0070273)			breast(4)|large_intestine(3)|lung(8)|ovary(1)|prostate(1)	17						GTGACCACCAGAAAGAAGCTT	0.488																																																	0													116.0	108.0	110.0					7																	30118277		876	1991	2867	SO:0001583	missense	0			BC053990	CCDS5424.1, CCDS56473.1, CCDS75574.1	7p21-p11.2	2013-01-10			ENSG00000106086	ENSG00000106086		"""Pleckstrin homology (PH) domain containing"""	30037	protein-coding gene	gene with protein product		608639				11001876	Standard	NM_001197027		Approved	FAPP2, MGC3358	uc003taq.3	Q96JA3	OTTHUMG00000097751	ENST00000449726.1:c.1434G>C	7.37:g.30118277G>C	ENSP00000397947:p.Gln478His		B4DH00|Q7Z5V8|Q9BU78|Q9H274|Q9H8Z7	Missense_Mutation	SNP	pfam_Glycolipid_transfer_prot_dom,pfam_Pleckstrin_homology,superfamily_Glycolipid_transfer_prot_dom,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.Q478H	ENST00000449726.1	37	c.1434	CCDS56473.1	7	.	.	.	.	.	.	.	.	.	.	G	11.34	1.609006	0.28623	.	.	ENSG00000106086	ENST00000449726;ENST00000440706	.	.	.	5.33	2.21	0.28008	.	0.206543	0.42821	D	0.000653	T	0.27900	0.0687	N	0.12182	0.205	0.32676	N	0.516155	B	0.02656	0.0	B	0.04013	0.001	T	0.25257	-1.0137	9	0.44086	T	0.13	-25.6166	10.9038	0.47067	0.0:0.3823:0.4872:0.1305	.	478	B4DH00	.	H	478;504	.	ENSP00000407802:Q504H	Q	+	3	2	PLEKHA8	30084802	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.433000	0.44793	0.680000	0.31366	0.655000	0.94253	CAG	PLEKHA8	-	superfamily_Glycolipid_transfer_prot_dom	ENSG00000106086		0.488	PLEKHA8-201	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEKHA8	HGNC	protein_coding		-	0.00	91	0	G	NM_032639		30118277	+1	tier1	-	no_errors	ENST00000449726	ensembl	human	known	74_37	missense	19.19	138	33	SNP	1.000	C
PLEKHN1	84069	genome.wustl.edu	37	1	908636	908636	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr1:908636G>A	ENST00000379409.2	+	11	1409	c.1379G>A	c.(1378-1380)cGg>cAg	p.R460Q	PLEKHN1_ENST00000379407.3_Intron|PLEKHN1_ENST00000379410.3_Missense_Mutation_p.R408Q			Q494U1	PKHN1_HUMAN	pleckstrin homology domain containing, family N member 1	460										central_nervous_system(1)|endometrium(3)|kidney(1)|lung(2)|skin(1)|urinary_tract(1)	9	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		UCEC - Uterine corpus endometrioid carcinoma (11;0.00459)|Epithelial(90;4.31e-38)|OV - Ovarian serous cystadenocarcinoma(86;5.93e-23)|Colorectal(212;0.000159)|COAD - Colon adenocarcinoma(227;0.000193)|BRCA - Breast invasive adenocarcinoma(365;0.00095)|Kidney(185;0.0023)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0342)|Lung(427;0.199)		GGCAGCAGCCGGTCACCCGGG	0.692																																																	0													5.0	7.0	6.0					1																	908636		1942	3792	5734	SO:0001583	missense	0			AL136730	CCDS4.1, CCDS53256.1	1p36.33	2013-01-11			ENSG00000187583	ENSG00000187583		"""Pleckstrin homology (PH) domain containing"""	25284	protein-coding gene	gene with protein product						11230166	Standard	NM_032129		Approved	DKFZP434H2010	uc001acd.3	Q494U1	OTTHUMG00000040756	ENST00000379409.2:c.1379G>A	1.37:g.908636G>A	ENSP00000368719:p.Arg460Gln		Q494U2|Q5SV98|Q9H0M7	Missense_Mutation	SNP	smart_Pleckstrin_homology	p.R460Q	ENST00000379409.2	37	c.1379		1	.	.	.	.	.	.	.	.	.	.	G	7.396	0.631697	0.14322	.	.	ENSG00000187583	ENST00000379410;ENST00000379409	T;T	0.49720	0.79;0.77	4.46	0.393	0.16294	.	0.622381	0.15579	N	0.255003	T	0.20251	0.0487	N	0.19112	0.55	0.09310	N	1	P;B	0.38078	0.617;0.18	B;B	0.21360	0.034;0.013	T	0.11131	-1.0600	10	0.27785	T	0.31	.	4.1308	0.10148	0.3872:0.1694:0.4434:0.0	.	460;408	Q494U1;Q494U1-2	PKHN1_HUMAN;.	Q	408;460	ENSP00000368720:R408Q;ENSP00000368719:R460Q	ENSP00000368719:R460Q	R	+	2	0	PLEKHN1	898499	0.030000	0.19436	0.011000	0.14972	0.080000	0.17528	0.724000	0.25954	-0.078000	0.12730	-0.373000	0.07131	CGG	PLEKHN1	-	NULL	ENSG00000187583		0.692	PLEKHN1-005	KNOWN	basic	protein_coding	PLEKHN1	HGNC	protein_coding	OTTHUMT00000473256.1	-	0.00	52	0	G	NM_032129		908636	+1	tier1	-	no_errors	ENST00000379409	ensembl	human	known	74_37	missense	24.00	19	6	SNP	0.000	A
PLSCR2	57047	genome.wustl.edu	37	3	146213729	146213729	+	5'UTR	SNP	C	C	G			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr3:146213729C>G	ENST00000474418.1	-	0	12				PLSCR2_ENST00000336685.2_5'Flank			Q9NRY7	PLS2_HUMAN	phospholipid scramblase 2						phospholipid scrambling (GO:0017121)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|phospholipid scramblase activity (GO:0017128)			endometrium(2)|large_intestine(5)|lung(7)|stomach(1)	15						GGCCCACAATCCAGAGTCTCT	0.413																																																	0																																										SO:0001623	5_prime_UTR_variant	0				CCDS56284.1, CCDS3134.1, CCDS75029.1	3q24	2008-07-18			ENSG00000163746	ENSG00000163746			16494	protein-coding gene	gene with protein product		607610				10930526	Standard	NM_001199978		Approved		uc003evw.2	Q9NRY7	OTTHUMG00000159429	ENST00000474418.1:c.-487G>C	3.37:g.146213729C>G			B4DXC3|J3KR76|Q0VAQ1|Q6NSW9|Q7Z4L7	RNA	SNP	-	NULL	ENST00000474418.1	37	NULL		3	.	.	.	.	.	.	.	.	.	.	C	5.742	0.321386	0.10845	.	.	ENSG00000163746	ENST00000535500	.	.	.	2.36	2.36	0.29203	.	.	.	.	.	T	0.34279	0.0892	.	.	.	0.21184	N	0.999768	.	.	.	.	.	.	T	0.18650	-1.0330	4	.	.	.	.	8.3152	0.32095	0.0:1.0:0.0:0.0	.	.	.	.	A	17	.	.	G	-	2	0	PLSCR2	147696419	0.000000	0.05858	0.010000	0.14722	0.053000	0.15095	-0.453000	0.06778	1.630000	0.50440	0.591000	0.81541	GGA	PLSCR2	-	-	ENSG00000163746		0.413	PLSCR2-004	PUTATIVE	basic	processed_transcript	PLSCR2	HGNC	protein_coding	OTTHUMT00000355266.1	-	0.00	41	0	C	NM_020359		146213729	-1	tier1	-	no_errors	ENST00000474418	ensembl	human	putative	74_37	rna	22.22	21	6	SNP	0.011	G
PMS2	5395	genome.wustl.edu	37	7	6026532	6026532	+	Missense_Mutation	SNP	T	T	A	rs370853512	byFrequency	TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr7:6026532T>A	ENST00000265849.7	-	11	1969	c.1864A>T	c.(1864-1866)Atg>Ttg	p.M622L	PMS2_ENST00000382321.4_Intron|PMS2_ENST00000469652.1_Intron|PMS2_ENST00000406569.3_Intron|PMS2_ENST00000441476.2_Missense_Mutation_p.M516L	NM_000535.5	NP_000526	P54278	PMS2_HUMAN	PMS2 postmeiotic segregation increased 2 (S. cerevisiae)	622			M -> I (may be associated with increased susceptibility to colorectal cancer; significantly reduced interaction with MLH1; dbSNP:rs1805324). {ECO:0000269|PubMed:10480359, ECO:0000269|PubMed:15489334}.		ATP catabolic process (GO:0006200)|mismatch repair (GO:0006298)|response to drug (GO:0042493)|somatic hypermutation of immunoglobulin genes (GO:0016446)|somatic recombination of immunoglobulin gene segments (GO:0016447)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|MutLalpha complex (GO:0032389)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|endonuclease activity (GO:0004519)|single base insertion or deletion binding (GO:0032138)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(6)|kidney(2)|large_intestine(11)|lung(13)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	46		Ovarian(82;0.0694)		UCEC - Uterine corpus endometrioid carcinoma (126;0.101)|OV - Ovarian serous cystadenocarcinoma(56;4.39e-15)		AAAGAACTCATAGAAAAGTCC	0.388			"""Mis, N, F"""			"""colorectal, endometrial, ovarian, medulloblastoma, glioma"""		Direct reversal of damage;Mismatch excision repair (MMR)	Turcot syndrome;Lynch syndrome;Constitutional Mismatch Repair Deficiency Syndrome																														yes	Rec		"""Hereditary non-polyposis colorectal cancer, Turcot syndrome"""	7	7p22	5395	PMS2 postmeiotic segregation increased 2 (S. cerevisiae)		E	0													97.0	95.0	95.0					7																	6026532		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Hereditary Non-Polyposis Colorectal Cancer, HNPCC, Lynch syndromes 1 and 2 (= Cancer Family Syndrome), Hereditary Mismatch Repair Deficiency syndrome, HMRDS;Mismatch Repair Cancer syndrome, MMRCS, Childhood Cancer Syndrome, CCS, Biallelic Mismatch Repair Gene Mutations Associated Early Onset Cancer, Lynch syndrome type III		CCDS5343.1	7p22.1	2014-09-17	2001-11-28		ENSG00000122512	ENSG00000122512			9122	protein-coding gene	gene with protein product		600259	"""postmeiotic segregation increased (S. cerevisiae) 2"""	PMSL2		8072530	Standard	NM_000535		Approved	H_DJ0042M02.9, HNPCC4	uc003spl.3	P54278	OTTHUMG00000023135	ENST00000265849.7:c.1864A>T	7.37:g.6026532T>A	ENSP00000265849:p.Met622Leu		B2R610|Q52LH6|Q5FBW9|Q5FBX1|Q5FBX2|Q75MR2	Missense_Mutation	SNP	pfam_MutL_C,pfam_DNA_mismatch_repair_C,pfam_HATPase_ATP-bd,superfamily_HATPase_ATP-bd,superfamily_Ribosomal_S5_D2-typ_fold,smart_MutL_C,tigrfam_DNA_mismatch_repair_N	p.M622L	ENST00000265849.7	37	c.1864	CCDS5343.1	7	.	.	.	.	.	.	.	.	.	.	t	0.027	-1.366222	0.01235	.	.	ENSG00000122512	ENST00000265849;ENST00000382322;ENST00000441476	T;T	0.34472	1.36;1.36	5.81	2.02	0.26589	.	0.212273	0.49305	N	0.000142	T	0.18964	0.0455	N	0.13272	0.32	0.20196	N	0.999921	B;B	0.09022	0.0;0.002	B;B	0.11329	0.001;0.006	T	0.28427	-1.0044	10	0.02654	T	1	-11.6137	14.8812	0.70534	0.0:0.0:0.5252:0.4748	.	622;516	P54278;C9J167	PMS2_HUMAN;.	L	622;575;516	ENSP00000265849:M622L;ENSP00000392843:M516L	ENSP00000265849:M622L	M	-	1	0	PMS2	5993058	0.858000	0.29795	0.111000	0.21465	0.453000	0.32348	1.180000	0.32005	0.100000	0.17581	-0.416000	0.06073	ATG	PMS2	-	NULL	ENSG00000122512		0.388	PMS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PMS2	HGNC	protein_coding	OTTHUMT00000207353.3	-	0.00	66	0	T	NM_000535		6026532	-1	tier1	-	no_errors	ENST00000265849	ensembl	human	known	74_37	missense	60.67	35	54	SNP	0.165	A
POLB	5423	genome.wustl.edu	37	8	42196087	42196087	+	5'UTR	SNP	G	G	C			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr8:42196087G>C	ENST00000265421.4	+	0	115				POLB_ENST00000530566.1_3'UTR|POLB_ENST00000538005.1_5'UTR	NM_002690.2	NP_002681.1	P06746	DPOLB_HUMAN	polymerase (DNA directed), beta						base-excision repair (GO:0006284)|base-excision repair, gap-filling (GO:0006287)|cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|DNA-dependent DNA replication (GO:0006261)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|neuron apoptotic process (GO:0051402)|pyrimidine dimer repair (GO:0006290)|response to ethanol (GO:0045471)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)	damaged DNA binding (GO:0003684)|DNA-directed DNA polymerase activity (GO:0003887)|enzyme binding (GO:0019899)|lyase activity (GO:0016829)|metal ion binding (GO:0046872)|microtubule binding (GO:0008017)			breast(1)|endometrium(3)|kidney(2)|large_intestine(3)|liver(1)|lung(5)|ovary(1)	16	all_cancers(6;1.42e-24)|all_epithelial(6;1.02e-25)|all_lung(13;2.58e-12)|Lung NSC(13;4.24e-11)|Ovarian(28;0.00769)|Prostate(17;0.0119)|Colorectal(14;0.1)|Lung SC(25;0.211)	all_lung(54;0.00671)|Lung NSC(58;0.0184)|Esophageal squamous(32;0.131)|Hepatocellular(245;0.133)|Renal(179;0.151)	BRCA - Breast invasive adenocarcinoma(8;3.18e-11)|Lung(22;0.00467)|OV - Ovarian serous cystadenocarcinoma(14;0.00523)|LUSC - Lung squamous cell carcinoma(45;0.024)		Cytarabine(DB00987)	TTCAAGCTGGGAGAGGGCTCT	0.657								DNA polymerases (catalytic subunits)																																									0													40.0	47.0	45.0					8																	42196087		692	1591	2283	SO:0001623	5_prime_UTR_variant	0				CCDS6129.1	8p12-p11	2012-10-02			ENSG00000070501	ENSG00000070501	2.7.7.7	"""DNA polymerases"""	9174	protein-coding gene	gene with protein product		174760					Standard	NM_002690		Approved		uc003xoz.2	P06746	OTTHUMG00000164093	ENST00000265421.4:c.-56G>C	8.37:g.42196087G>C			B2RC78|Q3KP48|Q6FI34	RNA	SNP	-	NULL	ENST00000265421.4	37	NULL	CCDS6129.1	8																																																																																			POLB	-	-	ENSG00000070501		0.657	POLB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POLB	HGNC	protein_coding	OTTHUMT00000377242.1	-	0.00	114	0	G	NM_002690		42196087	+1	tier1	-	no_errors	ENST00000530566	ensembl	human	known	74_37	rna	41.89	43	31	SNP	0.002	C
POTEB2	100287399	genome.wustl.edu	37	15	21071350	21071350	+	Silent	SNP	G	G	A			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr15:21071350G>A	ENST00000454856.4	-	1	293	c.261C>T	c.(259-261)gaC>gaT	p.D87D		NM_001277303.1	NP_001264232.1	H3BUK9	POTB2_HUMAN	POTE ankyrin domain family, member B2	87																	AGGCGCTGTCGTCGTAGTCTC	0.592																																																	0													1.0	2.0	1.0					15																	21071350		54	417	471	SO:0001819	synonymous_variant	0				CCDS59248.1	15q11.2	2014-01-29			ENSG00000230031	ENSG00000230031		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	48327	protein-coding gene	gene with protein product							Standard	NM_001277303		Approved			H3BUK9	OTTHUMG00000185829	ENST00000454856.4:c.261C>T	15.37:g.21071350G>A				Silent	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.D87	ENST00000454856.4	37	c.261	CCDS59248.1	15																																																																																			POTEB2	-	NULL	ENSG00000230031		0.592	POTEB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POTEB2	HGNC	protein_coding	OTTHUMT00000471435.1	-	0.00	82	0	G			21071350	-1	tier1	-	no_errors	ENST00000454856	ensembl	human	known	74_37	silent	13.33	64	10	SNP	0.001	A
PPOX	5498	genome.wustl.edu	37	1	161140351	161140352	+	Intron	INS	-	-	TCCT			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr1:161140351_161140352insTCCT	ENST00000367999.4	+	10	1364				PPOX_ENST00000535223.1_Intron|PPOX_ENST00000352210.5_Intron|PPOX_ENST00000432542.2_Intron|B4GALT3_ENST00000470882.1_5'Flank|PPOX_ENST00000495483.1_Intron|PPOX_ENST00000544598.1_Intron	NM_001122764.1	NP_001116236.1	P50336	PPOX_HUMAN	protoporphyrinogen oxidase						heme biosynthetic process (GO:0006783)|oxidation-reduction process (GO:0055114)|porphyrin-containing compound biosynthetic process (GO:0006779)|porphyrin-containing compound metabolic process (GO:0006778)|protoporphyrinogen IX biosynthetic process (GO:0006782)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)	integral component of mitochondrial inner membrane (GO:0031305)|intrinsic component of mitochondrial inner membrane (GO:0031304)|mitochondrial intermembrane space (GO:0005758)|mitochondrial membrane (GO:0031966)	flavin adenine dinucleotide binding (GO:0050660)|oxygen-dependent protoporphyrinogen oxidase activity (GO:0004729)			breast(1)|cervix(1)|endometrium(1)|large_intestine(3)|lung(5)|ovary(1)|urinary_tract(3)	15	all_cancers(52;3.73e-19)|Breast(13;0.000577)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00275)			TTCCAGAGGGCTCCTCTGTGCT	0.55																																																	0																																										SO:0001627	intron_variant	0			BC002357	CCDS1221.1	1q22	2008-02-05			ENSG00000143224	ENSG00000143224	1.3.3.4		9280	protein-coding gene	gene with protein product		600923	"""variegate porphyria"""	VP		8575762, 10457135	Standard	NM_000309		Approved	PPO	uc001fyg.2	P50336	OTTHUMG00000034342	ENST00000367999.4:c.1098+42->TCCT	1.37:g.161140352_161140355dupTCCT			D3DVG0|Q5VTW8	RNA	INS	-	NULL	ENST00000367999.4	37	NULL	CCDS1221.1	1																																																																																			PPOX	-	-	ENSG00000143224		0.550	PPOX-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PPOX	HGNC	protein_coding	OTTHUMT00000082993.1		0.00	80	0	-	NM_000309		161140352	+1	tier1		no_errors	ENST00000466452	ensembl	human	known	74_37	rna	35.71	36	20	INS	0.001:0.000	TCCT
PRB4	5545	genome.wustl.edu	37	12	11461530	11461530	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr12:11461530G>T	ENST00000535904.1	-	3	420	c.387C>A	c.(385-387)aaC>aaA	p.N129K	PRB4_ENST00000279575.1_Missense_Mutation_p.N129K|PRB4_ENST00000445719.2_Intron			P10163	PRB4_HUMAN	proline-rich protein BstNI subfamily 4	150	9.5 X 21 AA tandem repeats of K-P-[EQ]- [GR]-[PR]-[PR]-P-Q-G-G-N-Q-[PS]-[QH]- [RG]-[PT]-P-P-[PH]-P-G.		Missing (in allele M and allele S).	H -> N (in Ref. 7; CAA30542). {ECO:0000305}.		extracellular region (GO:0005576)				breast(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(12)|ovary(1)|skin(4)|upper_aerodigestive_tract(3)	30						GGTGGGACTGGTTGCCTCCTT	0.602										HNSCC(22;0.051)																																							0													172.0	192.0	185.0					12																	11461530		2203	4300	6503	SO:0001583	missense	0				CCDS8641.1, CCDS58208.1	12p13.2	2012-10-02			ENSG00000230657	ENSG00000230657			9340	protein-coding gene	gene with protein product		180990					Standard	NM_002723		Approved		uc001qzt.4	P10163	OTTHUMG00000169116	ENST00000535904.1:c.387C>A	12.37:g.11461530G>T	ENSP00000442834:p.Asn129Lys		A1L439|O00600|P02813|P10161|P10162|P81489	Missense_Mutation	SNP	NULL	p.N129K	ENST00000535904.1	37	c.387	CCDS8641.1	12	.	.	.	.	.	.	.	.	.	.	.	1.058	-0.673676	0.03403	.	.	ENSG00000230657	ENST00000279575;ENST00000535904	T;T	0.04502	3.61;3.61	0.904	-0.863	0.10669	.	.	.	.	.	T	0.04634	0.0126	L	0.57536	1.79	0.09310	N	1	P	0.44344	0.833	B	0.38194	0.267	T	0.33240	-0.9876	9	0.33940	T	0.23	.	3.219	0.06708	0.5474:0.0:0.4526:0.0	.	129	E9PAL0	.	K	129	ENSP00000279575:N129K;ENSP00000442834:N129K	ENSP00000279575:N129K	N	-	3	2	PRB4	11352797	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.907000	0.04067	-0.292000	0.08999	0.394000	0.25966	AAC	PRB4	-	NULL	ENSG00000230657		0.602	PRB4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PRB4	HGNC	protein_coding	OTTHUMT00000402308.1	-	0.00	109	0	G	NM_002723		11461530	-1	tier1	-	no_errors	ENST00000279575	ensembl	human	known	74_37	missense	13.77	144	23	SNP	0.000	T
PSMC4	5704	genome.wustl.edu	37	19	40487135	40487135	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr19:40487135G>T	ENST00000157812.2	+	11	1378	c.1180G>T	c.(1180-1182)Gtc>Ttc	p.V394F	PSMC4_ENST00000455878.2_Missense_Mutation_p.V363F	NM_006503.3|NM_153001.2	NP_006494.1|NP_694546.1	P43686	PRS6B_HUMAN	proteasome (prosome, macropain) 26S subunit, ATPase, 4	394					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|blastocyst development (GO:0001824)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|proteolysis (GO:0006508)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic proteasome complex (GO:0031597)|inclusion body (GO:0016234)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(2)|large_intestine(3)|lung(7)|ovary(1)|prostate(2)|urinary_tract(1)	19	all_cancers(60;9.55e-06)|all_lung(34;1.17e-07)|Lung NSC(34;1.41e-07)|Ovarian(47;0.0925)					CCGCTACATTGTCCTGGCCAA	0.493																																					Colon(105;1478 1543 4034 6132 38638)												0													202.0	164.0	177.0					19																	40487135		2203	4300	6503	SO:0001583	missense	0			U27515	CCDS12547.1, CCDS46076.1	19q13.11-q13.13	2010-04-21			ENSG00000013275	ENSG00000013275		"""Proteasome (prosome, macropain) subunits"", ""ATPases / AAA-type"""	9551	protein-coding gene	gene with protein product	"""protease 26S subunit 6"", ""Tat-binding protein 7"", ""MB67 interacting protein"""	602707		MIP224		9473509, 8603043	Standard	NM_006503		Approved	TBP7, S6, MGC8570, MGC13687, MGC23214, TBP-7	uc002omq.4	P43686		ENST00000157812.2:c.1180G>T	19.37:g.40487135G>T	ENSP00000157812:p.Val394Phe		Q96FV5|Q9UBM3|Q9UEX3	Missense_Mutation	SNP	pfam_ATPase_AAA_core,pfam_ATPase_dyneun-rel_AAA,pfam_ATPase_AAA-2,pfam_DNA_helicase_Holl-junc_RuvB_N,superfamily_P-loop_NTPase,smart_AAA+_ATPase,tigrfam_26S_Psome_P45	p.V394F	ENST00000157812.2	37	c.1180	CCDS12547.1	19	.	.	.	.	.	.	.	.	.	.	g	18.47	3.631838	0.67015	.	.	ENSG00000013275	ENST00000157812;ENST00000455878	D;D	0.95554	-3.74;-3.74	5.08	5.08	0.68730	.	0.000000	0.85682	D	0.000000	D	0.97034	0.9031	H	0.96691	3.865	0.80722	D	1	P;B	0.35600	0.511;0.028	B;B	0.37047	0.24;0.031	D	0.97962	1.0338	10	0.87932	D	0	-14.7818	16.0109	0.80402	0.0:0.0:1.0:0.0	.	363;394	P43686-2;P43686	.;PRS6B_HUMAN	F	394;363	ENSP00000157812:V394F;ENSP00000413869:V363F	ENSP00000157812:V394F	V	+	1	0	PSMC4	45178975	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.486000	0.90451	2.646000	0.89796	0.561000	0.74099	GTC	PSMC4	-	superfamily_P-loop_NTPase,tigrfam_26S_Psome_P45	ENSG00000013275		0.493	PSMC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSMC4	HGNC	protein_coding	OTTHUMT00000462485.1	-	0.00	36	0	G	NM_006503		40487135	+1	tier1	-	no_errors	ENST00000157812	ensembl	human	known	74_37	missense	11.11	32	4	SNP	1.000	T
PSG2	5670	genome.wustl.edu	37	19	43579505	43579505	+	Splice_Site	SNP	C	C	A	rs148538148	byFrequency	TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr19:43579505C>A	ENST00000406487.1	-	3	808		c.e3+1			NM_031246.3	NP_112536.2	P11465	PSG2_HUMAN	pregnancy specific beta-1-glycoprotein 2						cell migration (GO:0016477)|female pregnancy (GO:0007565)	extracellular region (GO:0005576)		p.?(1)		central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(24)|ovary(1)|pancreas(2)|prostate(6)|stomach(2)|urinary_tract(2)	49		Prostate(69;0.00682)				AAGATACTCACGGAGGAGATT	0.532																																																	1	Unknown(1)	prostate(1)											189.0	201.0	197.0					19																	43579505		2202	4299	6501	SO:0001630	splice_region_variant	0				CCDS12616.1	19q13.1-q13.2	2013-01-29			ENSG00000242221	ENSG00000242221		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9519	protein-coding gene	gene with protein product	"""pregnancy-specific beta-1 glycoprotein"", ""pregnancy-specific beta-1-glycoprotein 7"", ""carcinoembryonic antigen SG8"""	176391		PSBG2		2377620	Standard	NM_031246		Approved	PSGGB, PSG1, CEA	uc002ovr.3	P11465	OTTHUMG00000151547	ENST00000406487.1:c.709+1G>T	19.37:g.43579505C>A			Q8TCD9|Q9UEA4|Q9UQ78	Splice_Site	SNP	-	e3+1	ENST00000406487.1	37	c.709+1	CCDS12616.1	19	.	.	.	.	.	.	.	.	.	.	C	2.582	-0.297170	0.05532	.	.	ENSG00000242221	ENST00000406487;ENST00000329509;ENST00000401942;ENST00000406917	.	.	.	1.33	0.149	0.14863	.	.	.	.	.	.	.	.	.	.	.	0.29837	N	0.829554	.	.	.	.	.	.	.	.	.	.	.	.	.	.	3.9368	0.09309	0.0:0.7437:0.0:0.2563	.	.	.	.	.	-1	.	.	.	-	.	.	PSG2	48271345	0.734000	0.28142	0.006000	0.13384	0.003000	0.03518	0.992000	0.29667	-0.088000	0.12506	-0.391000	0.06502	.	PSG2	-	-	ENSG00000242221		0.532	PSG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSG2	HGNC	protein_coding	OTTHUMT00000323083.1	-	0.00	231	0	C	NM_031246	Intron	43579505	-1	tier1	-	no_errors	ENST00000406487	ensembl	human	known	74_37	splice_site	19.30	184	44	SNP	0.048	A
PSMD11	5717	genome.wustl.edu	37	17	30807535	30807535	+	Silent	SNP	G	G	C			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr17:30807535G>C	ENST00000261712.3	+	13	1418	c.1155G>C	c.(1153-1155)ctG>ctC	p.L385L	PSMD11_ENST00000457654.2_Silent_p.L385L	NM_001270482.1|NM_002815.3	NP_001257411.1|NP_002806.2	O00231	PSD11_HUMAN	proteasome (prosome, macropain) 26S subunit, non-ATPase, 11	385	PCI.				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|proteasome assembly (GO:0043248)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|stem cell differentiation (GO:0048863)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)|proteasome regulatory particle (GO:0005838)				breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)	19		Breast(31;0.159)|Ovarian(249;0.182)	BRCA - Breast invasive adenocarcinoma(9;0.109)			AGGGTGTCCTGATTATTTTCG	0.453																																					Ovarian(130;1038 1716 9294 11987 19279)												0													99.0	97.0	98.0					17																	30807535		2203	4300	6503	SO:0001819	synonymous_variant	0			AB003102	CCDS11272.1	17q12	2008-05-22			ENSG00000108671	ENSG00000108671		"""Proteasome (prosome, macropain) subunits"""	9556	protein-coding gene	gene with protein product		604449				9426256, 9119060	Standard	NM_001270482		Approved	S9, p44.5, MGC3844, Rpn6	uc010cta.2	O00231	OTTHUMG00000132811	ENST00000261712.3:c.1155G>C	17.37:g.30807535G>C			A8K3I7|E1P663|O00495|Q53FT5	Silent	SNP	pfam_PCI_dom,smart_PAM,smart_PCI_dom	p.L385	ENST00000261712.3	37	c.1155	CCDS11272.1	17	.	.	.	.	.	.	.	.	.	.	G	3.243	-0.154836	0.06544	.	.	ENSG00000108671	ENST00000457654	.	.	.	5.55	5.55	0.83447	.	.	.	.	.	T	0.61652	0.2364	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.58272	-0.7665	4	.	.	.	-4.2165	10.2602	0.43423	0.0868:0.0:0.9132:0.0	.	.	.	.	H	123	.	.	D	+	1	0	PSMD11	27831648	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.948000	0.56660	2.894000	0.99253	0.655000	0.94253	GAT	PSMD11	-	pfam_PCI_dom,smart_PCI_dom	ENSG00000108671		0.453	PSMD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSMD11	HGNC	protein_coding	OTTHUMT00000256252.2	-	0.00	49	0	G	NM_002815		30807535	+1	tier1	-	no_errors	ENST00000261712	ensembl	human	known	74_37	silent	21.21	26	7	SNP	1.000	C
PTEN	5728	genome.wustl.edu	37	10	89712008	89712008	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr10:89712008G>C	ENST00000371953.3	+	6	1983	c.626G>C	c.(625-627)gGa>gCa	p.G209A	PTEN_ENST00000472832.1_3'UTR	NM_000314.4	NP_000305.3	P60484	PTEN_HUMAN	phosphatase and tensin homolog	209	C2 tensin-type. {ECO:0000255|PROSITE- ProRule:PRU00589}.				activation of mitotic anaphase-promoting complex activity (GO:0007092)|aging (GO:0007568)|angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|brain morphogenesis (GO:0048854)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle tissue development (GO:0048738)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|central nervous system development (GO:0007417)|central nervous system myelin maintenance (GO:0032286)|central nervous system neuron axonogenesis (GO:0021955)|dendritic spine morphogenesis (GO:0060997)|dentate gyrus development (GO:0021542)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|innate immune response (GO:0045087)|inositol phosphate dephosphorylation (GO:0046855)|inositol phosphate metabolic process (GO:0043647)|learning or memory (GO:0007611)|locomotor rhythm (GO:0045475)|locomotory behavior (GO:0007626)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|male mating behavior (GO:0060179)|maternal behavior (GO:0042711)|memory (GO:0007613)|multicellular organismal response to stress (GO:0033555)|negative regulation of apoptotic process (GO:0043066)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell aging (GO:0090344)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031658)|negative regulation of dendritic spine morphogenesis (GO:0061002)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of myelination (GO:0031642)|negative regulation of organ growth (GO:0046621)|negative regulation of phagocytosis (GO:0050765)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of ribosome biogenesis (GO:0090071)|negative regulation of synaptic vesicle clustering (GO:2000808)|neuron-neuron synaptic transmission (GO:0007270)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell proliferation (GO:0008284)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|postsynaptic density assembly (GO:0097107)|prepulse inhibition (GO:0060134)|presynaptic membrane assembly (GO:0097105)|prostate gland growth (GO:0060736)|protein dephosphorylation (GO:0006470)|protein kinase B signaling (GO:0043491)|protein stabilization (GO:0050821)|regulation of B cell apoptotic process (GO:0002902)|regulation of cellular component size (GO:0032535)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of myeloid cell apoptotic process (GO:0033032)|regulation of neuron projection development (GO:0010975)|regulation of protein stability (GO:0031647)|response to arsenic-containing substance (GO:0046685)|response to ATP (GO:0033198)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to glucose (GO:0009749)|response to nutrient (GO:0007584)|response to zinc ion (GO:0010043)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synapse maturation (GO:0060074)|T cell receptor signaling pathway (GO:0050852)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|myelin sheath adaxonal region (GO:0035749)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|Schmidt-Lanterman incisure (GO:0043220)	anaphase-promoting complex binding (GO:0010997)|enzyme binding (GO:0019899)|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity (GO:0051717)|lipid binding (GO:0008289)|magnesium ion binding (GO:0000287)|PDZ domain binding (GO:0030165)|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity (GO:0016314)|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity (GO:0051800)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|phosphoprotein phosphatase activity (GO:0004721)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.0?(37)|p.R55fs*1(5)|p.?(4)|p.G165fs*9(3)|p.Y27fs*1(2)|p.G165_*404del(1)		NS(28)|autonomic_ganglia(2)|biliary_tract(6)|bone(5)|breast(92)|central_nervous_system(676)|cervix(26)|endometrium(1068)|eye(8)|haematopoietic_and_lymphoid_tissue(137)|kidney(24)|large_intestine(98)|liver(20)|lung(91)|meninges(2)|oesophagus(2)|ovary(82)|pancreas(6)|prostate(129)|salivary_gland(5)|skin(127)|soft_tissue(19)|stomach(30)|testis(1)|thyroid(29)|upper_aerodigestive_tract(29)|urinary_tract(12)|vulva(17)	2771		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		TTCAGTGGCGGAACTTGCAGT	0.328		31	"""D, Mis, N, F, S"""		"""glioma,  prostate, endometrial"""	"""harmartoma, glioma,  prostate, endometrial"""			Proteus syndrome;Juvenile Polyposis;Hereditary Mixed Polyposis Syndrome type 1;Cowden syndrome;Bannayan-Riley-Ruvalcaba syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)																													yes	Rec	yes	"""Cowden Syndrome, Bannayan-Riley-Ruvalcaba syndrome"""	10	10q23.3	5728	phosphatase and tensin homolog gene		"""L, E, M, O"""	52	Whole gene deletion(37)|Deletion - Frameshift(10)|Unknown(4)|Deletion - In frame(1)	prostate(16)|central_nervous_system(13)|skin(8)|lung(4)|haematopoietic_and_lymphoid_tissue(3)|breast(3)|ovary(3)|soft_tissue(1)|urinary_tract(1)											144.0	143.0	144.0					10																	89712008		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Incl.: Encephalocraniocutaneous Lipomatosis, ECCL, Proteus-like s.;incl.: Juvenile Polyposis of the Stomach;HMPS1, Colorectal Adenoma Carcinoma syndrome, CRAC, CRAC1;CS, Cowden disease, Multiple Hamartoma Syndrome, incl.: Lhermitte-Duclos; part of PTEN hamartoma tumour syndrome (PHTS) / PTEN-MATCHS, Cowden-like syndrome;subset of PTEN-Hamartoma Tumor Syndrome; incl.: Ruvalcaba-Myhre-Smith s.	U92436	CCDS31238.1	10q23	2014-09-17	2008-07-31		ENSG00000171862	ENSG00000171862		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	9588	protein-coding gene	gene with protein product	"""mutated in multiple advanced cancers 1"""	601728		BZS, MHAM		9090379	Standard	NM_000314		Approved	MMAC1, TEP1, PTEN1	uc001kfb.3	P60484	OTTHUMG00000018688	ENST00000371953.3:c.626G>C	10.37:g.89712008G>C	ENSP00000361021:p.Gly209Ala		B2R904|F2YHV0|O00633|O02679|Q6ICT7	Missense_Mutation	SNP	pfam_Tensin_phosphatase_C2-dom,pfam_Dual-sp_phosphatase_cat-dom,pfam_Tyr_Pase_rcpt/non-rcpt,superfamily_C2_dom,smart_Tyr_Pase_cat,pirsf_Bifunc_PIno_P3_Pase/Pase_PTEN,pfscan_Tyr/Dual-sp_Pase,pfscan_Phosphatase_tensin-typ,pfscan_Tensin_phosphatase_C2-dom	p.G209A	ENST00000371953.3	37	c.626	CCDS31238.1	10	.	.	.	.	.	.	.	.	.	.	G	20.5	3.993229	0.74703	.	.	ENSG00000171862	ENST00000371953	D	0.86562	-2.14	5.85	5.85	0.93711	Tensin phosphatase, C2 domain (2);C2 calcium/lipid-binding domain, CaLB (1);	0.150567	0.64402	D	0.000011	D	0.86301	0.5900	M	0.64567	1.98	0.80722	D	1	B	0.17852	0.024	B	0.28139	0.086	T	0.80765	-0.1236	9	.	.	.	-2.4963	15.6283	0.76882	0.0:0.1366:0.8634:0.0	.	209	P60484	PTEN_HUMAN	A	209	ENSP00000361021:G209A	.	G	+	2	0	PTEN	89701988	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.412000	0.80091	2.777000	0.95525	0.585000	0.79938	GGA	PTEN	-	pfam_Tensin_phosphatase_C2-dom,superfamily_C2_dom,pirsf_Bifunc_PIno_P3_Pase/Pase_PTEN,pfscan_Tensin_phosphatase_C2-dom	ENSG00000171862		0.328	PTEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTEN	HGNC	protein_coding	OTTHUMT00000049241.1		0.00	19	0	G	NM_000314		89712008	+1			no_errors	ENST00000371953	ensembl	human	known	74_37	missense	25.00	12	4	SNP	1.000	C
PTGER2	5732	genome.wustl.edu	37	14	52782053	52782053	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr14:52782053C>G	ENST00000245457.5	+	1	941	c.787C>G	c.(787-789)Ctc>Gtc	p.L263V	PTGER2_ENST00000557436.1_Missense_Mutation_p.L8V	NM_000956.3	NP_000947.2	P43116	PE2R2_HUMAN	prostaglandin E receptor 2 (subtype EP2), 53kDa	263					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|cellular response to prostaglandin E stimulus (GO:0071380)|G-protein coupled receptor signaling pathway (GO:0007186)|regulation of cell proliferation (GO:0042127)|response to lipopolysaccharide (GO:0032496)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	prostaglandin E receptor activity (GO:0004957)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	15	Breast(41;0.0639)|all_epithelial(31;0.0729)				Alprostadil(DB00770)|Dinoprostone(DB00917)|Misoprostol(DB00929)	GACGGACCACCTCATTCTCCT	0.657																																																	0													51.0	56.0	54.0					14																	52782053		2203	4299	6502	SO:0001583	missense	0				CCDS9708.1	14q22	2012-08-08	2002-08-29		ENSG00000125384	ENSG00000125384		"""GPCR / Class A : Prostanoid receptors"""	9594	protein-coding gene	gene with protein product		176804	"""prostaglandin E receptor 2 (subtype EP2), 53kD"""			8250933, 7759114	Standard	NM_000956		Approved	EP2	uc001wzr.3	P43116	OTTHUMG00000140300	ENST00000245457.5:c.787C>G	14.37:g.52782053C>G	ENSP00000245457:p.Leu263Val		D3DSC0|Q52LG8	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_7TM,prints_Prostglndn_EP2_rcpt,prints_Prostanoid_rcpt,prints_GPCR_Rhodpsn	p.L263V	ENST00000245457.5	37	c.787	CCDS9708.1	14	.	.	.	.	.	.	.	.	.	.	C	20.2	3.950195	0.73787	.	.	ENSG00000125384	ENST00000557436;ENST00000245457	T;T	0.71934	-0.61;-0.61	4.73	4.73	0.59995	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.77260	0.4104	L	0.41824	1.3	0.50039	D	0.999841	D	0.76494	0.999	D	0.68943	0.961	T	0.77456	-0.2581	10	0.45353	T	0.12	-23.7471	15.5772	0.76400	0.0:1.0:0.0:0.0	.	263	P43116	PE2R2_HUMAN	V	8;263	ENSP00000450933:L8V;ENSP00000245457:L263V	ENSP00000245457:L263V	L	+	1	0	PTGER2	51851803	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	3.155000	0.50700	2.359000	0.80004	0.561000	0.74099	CTC	PTGER2	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000125384		0.657	PTGER2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTGER2	HGNC	protein_coding	OTTHUMT00000276890.1	-	0.00	32	0	C			52782053	+1	tier1	-	no_errors	ENST00000245457	ensembl	human	known	74_37	missense	24.24	25	8	SNP	1.000	G
PTPLB	201562	genome.wustl.edu	37	3	123301073	123301073	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr3:123301073C>T	ENST00000383657.5	-	2	416	c.259G>A	c.(259-261)Gga>Aga	p.G87R		NM_198402.3	NP_940684.1	Q6Y1H2	HACD2_HUMAN	protein tyrosine phosphatase-like (proline instead of catalytic arginine), member b	87					fatty acid biosynthetic process (GO:0006633)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	lyase activity (GO:0016829)			kidney(2)	2				GBM - Glioblastoma multiforme(114;0.1)		AATAAGGCTCCAGTTTGAAAG	0.388																																																	0													44.0	40.0	41.0					3																	123301073		1815	4075	5890	SO:0001583	missense	0			AK074605	CCDS46895.1	3q21.1	2010-04-30			ENSG00000206527	ENSG00000206527			9640	protein-coding gene	gene with protein product		615939				15024066	Standard	NM_198402		Approved		uc003egj.2	Q6Y1H2	OTTHUMG00000159529	ENST00000383657.5:c.259G>A	3.37:g.123301073C>T	ENSP00000373153:p.Gly87Arg			Missense_Mutation	SNP	pfam_Tyr_Pase-like_PTPLA	p.G87R	ENST00000383657.5	37	c.259	CCDS46895.1	3	.	.	.	.	.	.	.	.	.	.	C	21.6	4.168012	0.78339	.	.	ENSG00000206527	ENST00000383657	T	0.29655	1.56	5.76	4.88	0.63580	.	0.000000	0.85682	D	0.000000	T	0.43456	0.1248	M	0.64170	1.965	0.80722	D	1	P	0.47677	0.899	P	0.51657	0.676	T	0.28870	-1.0030	10	0.36615	T	0.2	-12.2845	14.7027	0.69166	0.0:0.9303:0.0:0.0697	.	87	Q6Y1H2	HACD2_HUMAN	R	87	ENSP00000373153:G87R	ENSP00000373153:G87R	G	-	1	0	PTPLB	124783763	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.259000	0.78381	1.436000	0.47453	0.591000	0.81541	GGA	PTPLB	-	pfam_Tyr_Pase-like_PTPLA	ENSG00000206527		0.388	PTPLB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPLB	HGNC	protein_coding	OTTHUMT00000356021.3	-	0.00	19	0	C	NM_198402		123301073	-1	tier1	-	no_errors	ENST00000383657	ensembl	human	known	74_37	missense	28.57	15	6	SNP	1.000	T
PTPRO	5800	genome.wustl.edu	37	12	15739974	15739974	+	Silent	SNP	C	C	T			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr12:15739974C>T	ENST00000281171.4	+	24	3729	c.3399C>T	c.(3397-3399)atC>atT	p.I1133I	PTPRO_ENST00000544244.1_Silent_p.I294I|PTPRO_ENST00000542557.1_Silent_p.I294I|PTPRO_ENST00000348962.2_Silent_p.I1105I|PTPRO_ENST00000442921.2_Silent_p.I322I|PTPRO_ENST00000445537.2_Silent_p.I322I	NM_030667.2	NP_109592.1	Q16827	PTPRO_HUMAN	protein tyrosine phosphatase, receptor type, O	1133	Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.				axon guidance (GO:0007411)|cell morphogenesis (GO:0000902)|glomerular visceral epithelial cell differentiation (GO:0072112)|glomerulus development (GO:0032835)|lamellipodium assembly (GO:0030032)|monocyte chemotaxis (GO:0002548)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of glomerular filtration (GO:0003105)|negative regulation of neuron projection development (GO:0010977)|negative regulation of retinal ganglion cell axon guidance (GO:0090260)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of glomerular filtration (GO:0003093)|slit diaphragm assembly (GO:0036060)	apical plasma membrane (GO:0016324)|axon (GO:0030424)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	phosphatase activity (GO:0016791)|protein homodimerization activity (GO:0042803)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)|Wnt-protein binding (GO:0017147)			NS(2)|central_nervous_system(1)|endometrium(7)|kidney(2)|large_intestine(11)|lung(30)|ovary(2)|prostate(1)|skin(17)|upper_aerodigestive_tract(1)	74		Hepatocellular(102;0.244)				GTCCCATGATCATTCACTGCA	0.453																																																	0													130.0	105.0	114.0					12																	15739974		2203	4300	6503	SO:0001819	synonymous_variant	0			U20489	CCDS8674.1, CCDS8675.1, CCDS44837.1, CCDS53754.1	12p13-p12	2013-02-11			ENSG00000151490	ENSG00000151490		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9678	protein-coding gene	gene with protein product	"""osteoclastic transmembrane protein-tyrosine phosphatase"""	600579				7519601, 7665166, 21722858	Standard	NM_030667		Approved	PTPU2, GLEPP1, PTP-U2, PTP-oc, NPHS6	uc001rcv.2	Q16827	OTTHUMG00000168786	ENST00000281171.4:c.3399C>T	12.37:g.15739974C>T			A0AV39|Q13101|Q8IYG3|Q9UBF0|Q9UBT5	Silent	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt	p.I1133	ENST00000281171.4	37	c.3399	CCDS8675.1	12																																																																																			PTPRO	-	pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt	ENSG00000151490		0.453	PTPRO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPRO	HGNC	protein_coding	OTTHUMT00000401079.1	-	0.00	44	0	C			15739974	+1	tier1	-	no_errors	ENST00000281171	ensembl	human	known	74_37	silent	21.88	25	7	SNP	1.000	T
PTPRT	11122	genome.wustl.edu	37	20	41419957	41419957	+	Missense_Mutation	SNP	C	C	T	rs369230837		TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr20:41419957C>T	ENST00000373187.1	-	3	363	c.364G>A	c.(364-366)Gtc>Atc	p.V122I	PTPRT_ENST00000373193.3_Missense_Mutation_p.V122I|PTPRT_ENST00000373190.1_Missense_Mutation_p.V122I|PTPRT_ENST00000373198.4_Missense_Mutation_p.V122I|PTPRT_ENST00000373201.1_Missense_Mutation_p.V122I|PTPRT_ENST00000373184.1_Missense_Mutation_p.V122I|PTPRT_ENST00000356100.2_Missense_Mutation_p.V122I			O14522	PTPRT_HUMAN	protein tyrosine phosphatase, receptor type, T	122	MAM. {ECO:0000255|PROSITE- ProRule:PRU00128}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-catenin binding (GO:0045294)|beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|delta-catenin binding (GO:0070097)|gamma-catenin binding (GO:0045295)|protein tyrosine phosphatase activity (GO:0004725)			NS(2)|breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(12)|large_intestine(26)|liver(1)|lung(63)|ovary(8)|pancreas(2)|prostate(5)|skin(35)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	176		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)				TTCACGTAGACGTTCAAGGCC	0.592																																																	0								C	ILE/VAL,ILE/VAL	0,3932		0,0,1966	71.0	75.0	74.0		364,364	5.7	1.0	20		74	1,8327		0,1,4163	no	missense,missense	PTPRT	NM_007050.5,NM_133170.3	29,29	0,1,6129	TT,TC,CC		0.012,0.0,0.0082	possibly-damaging,possibly-damaging	122/1442,122/1461	41419957	1,12259	1966	4164	6130	SO:0001583	missense	0			AF043644	CCDS42874.1, CCDS68127.1	20q12-q13	2013-02-11			ENSG00000196090	ENSG00000196090		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9682	protein-coding gene	gene with protein product		608712				9486824, 9602027	Standard	NM_133170		Approved	RPTPrho, KIAA0283	uc010ggj.3	O14522	OTTHUMG00000033040	ENST00000373187.1:c.364G>A	20.37:g.41419957C>T	ENSP00000362283:p.Val122Ile		A8E4R6|O43655|O75664|Q5W0X9|Q5W0Y1|Q9BR24|Q9BR28|Q9H0Y8|Q9NTL1|Q9NU72|Q9UBD2|Q9UJL7	Missense_Mutation	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_MAM_dom,pfam_Fibronectin_type3,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_MAM_dom,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_MAM_dom,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,pfscan_Ig-like_dom,prints_Tyr_Pase_rcpt/non-rcpt,prints_MAM_dom	p.V122I	ENST00000373187.1	37	c.364	CCDS42874.1	20	.	.	.	.	.	.	.	.	.	.	C	16.52	3.147172	0.57151	0.0	1.2E-4	ENSG00000196090	ENST00000373190;ENST00000373187;ENST00000373193;ENST00000356100;ENST00000373198;ENST00000373184;ENST00000373201	T;T;T;T;T;T;T	0.03553	3.89;3.89;3.89;3.89;3.89;3.89;3.89	5.67	5.67	0.87782	Concanavalin A-like lectin/glucanase (1);MAM domain (3);	0.000000	0.85682	D	0.000000	T	0.04137	0.0115	L	0.28649	0.875	0.80722	D	1	P;P	0.35551	0.453;0.509	B;B	0.30943	0.075;0.122	T	0.57768	-0.7754	10	0.23891	T	0.37	.	19.7626	0.96329	0.0:1.0:0.0:0.0	.	122;122	O14522-1;O14522	.;PTPRT_HUMAN	I	122	ENSP00000362286:V122I;ENSP00000362283:V122I;ENSP00000362289:V122I;ENSP00000348408:V122I;ENSP00000362294:V122I;ENSP00000362280:V122I;ENSP00000362297:V122I	ENSP00000348408:V122I	V	-	1	0	PTPRT	40853371	1.000000	0.71417	1.000000	0.80357	0.901000	0.52897	6.070000	0.71220	2.676000	0.91093	0.561000	0.74099	GTC	PTPRT	-	pfam_MAM_dom,superfamily_ConA-like_lec_gl_sf,smart_MAM_dom,pfscan_MAM_dom	ENSG00000196090		0.592	PTPRT-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	PTPRT	HGNC	protein_coding	OTTHUMT00000080315.1	-	0.00	39	0	C			41419957	-1	tier1	-	no_errors	ENST00000373198	ensembl	human	known	74_37	missense	9.52	38	4	SNP	1.000	T
PYGO2	90780	genome.wustl.edu	37	1	154932041	154932041	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr1:154932041G>C	ENST00000368457.2	-	3	606	c.435C>G	c.(433-435)ttC>ttG	p.F145L	PYGO2_ENST00000368456.1_Missense_Mutation_p.F108L|PYGO2_ENST00000483463.1_5'Flank|RP11-307C12.12_ENST00000605085.1_RNA	NM_138300.3	NP_612157.1	Q9BRQ0	PYGO2_HUMAN	pygopus family PHD finger 2	145	Pro-rich.				brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|developmental growth (GO:0048589)|in utero embryonic development (GO:0001701)|kidney development (GO:0001822)|lens development in camera-type eye (GO:0002088)|mammary gland development (GO:0030879)|palate development (GO:0060021)|positive regulation of chromatin binding (GO:0035563)|post-embryonic development (GO:0009791)|regulation of histone H3-K4 methylation (GO:0051569)|regulation of mammary gland epithelial cell proliferation (GO:0033599)|spermatid nucleus differentiation (GO:0007289)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|histone acetyltransferase regulator activity (GO:0035034)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(2)|lung(3)|skin(2)|urinary_tract(1)	10	all_epithelial(22;4.9e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00034)			GGGGCATGTTGAAAGCAGGGC	0.632																																					NSCLC(87;357 1460 1955 21029 23522)												0													35.0	42.0	39.0					1																	154932041		2203	4300	6503	SO:0001583	missense	0			BC006132	CCDS1075.1	1q22	2013-10-09	2013-10-09		ENSG00000163348	ENSG00000163348		"""Zinc fingers, PHD-type"""	30257	protein-coding gene	gene with protein product		606903	"""pygopus homolog 2 (Drosophila)"""			11988739	Standard	NM_138300		Approved		uc001fft.3	Q9BRQ0	OTTHUMG00000037370	ENST00000368457.2:c.435C>G	1.37:g.154932041G>C	ENSP00000357442:p.Phe145Leu		Q8WYZ4|Q96CY2	Missense_Mutation	SNP	pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,pfscan_Znf_PHD-finger	p.F145L	ENST00000368457.2	37	c.435	CCDS1075.1	1	.	.	.	.	.	.	.	.	.	.	G	13.29	2.194542	0.38806	.	.	ENSG00000163348	ENST00000368457;ENST00000368456	T;T	0.48201	0.82;0.84	4.66	3.73	0.42828	.	0.160260	0.43416	D	0.000568	T	0.15046	0.0363	L	0.27053	0.805	0.30819	N	0.73802	B	0.13594	0.008	B	0.08055	0.003	T	0.08554	-1.0716	10	0.42905	T	0.14	-4.8253	7.6884	0.28554	0.1995:0.0:0.8005:0.0	.	145	Q9BRQ0	PYGO2_HUMAN	L	145;108	ENSP00000357442:F145L;ENSP00000357441:F108L	ENSP00000357441:F108L	F	-	3	2	PYGO2	153198665	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	0.942000	0.29017	1.147000	0.42369	0.462000	0.41574	TTC	PYGO2	-	NULL	ENSG00000163348		0.632	PYGO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PYGO2	HGNC	protein_coding	OTTHUMT00000090949.1		0.00	22	0	G	NM_138300		154932041	-1			no_errors	ENST00000368457	ensembl	human	known	74_37	missense	13.33	13	2	SNP	1.000	C
RABIF	5877	genome.wustl.edu	37	1	202858168	202858168	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr1:202858168G>A	ENST00000367262.3	-	1	95	c.59C>T	c.(58-60)gCg>gTg	p.A20V		NM_002871.4	NP_002862.2	P47224	MSS4_HUMAN	RAB interacting factor	20					membrane fusion (GO:0061025)|positive regulation of GTPase activity (GO:0043547)|protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)		guanyl-nucleotide exchange factor activity (GO:0005085)|zinc ion binding (GO:0008270)			large_intestine(1)|lung(2)|ovary(1)	4			BRCA - Breast invasive adenocarcinoma(75;0.166)			GCACAGCACCGCCTTCCGGTT	0.682																																																	0													30.0	29.0	30.0					1																	202858168		2202	4299	6501	SO:0001583	missense	0			S78873	CCDS1428.1	1q32.1	2008-05-14			ENSG00000183155	ENSG00000183155			9797	protein-coding gene	gene with protein product		603417		RASGRF3		9441742, 7619808	Standard	NM_002871		Approved	mss4	uc001gyl.3	P47224	OTTHUMG00000041400	ENST00000367262.3:c.59C>T	1.37:g.202858168G>A	ENSP00000356231:p.Ala20Val		B2R4P4|Q92992	Missense_Mutation	SNP	pfam_Mss4,superfamily_Mss4-like	p.A20V	ENST00000367262.3	37	c.59	CCDS1428.1	1	.	.	.	.	.	.	.	.	.	.	G	15.77	2.930094	0.52759	.	.	ENSG00000183155	ENST00000367262	.	.	.	4.69	2.84	0.33178	Mss4-like (1);Mss4/translationally controlled tumour-associated TCTP (1);	0.128004	0.52532	D	0.000075	T	0.40423	0.1116	L	0.45581	1.43	0.48040	D	0.999575	D	0.67145	0.996	B	0.40199	0.322	T	0.18871	-1.0323	9	0.37606	T	0.19	-54.0987	8.9207	0.35610	0.1735:0.0:0.8265:0.0	.	20	P47224	MSS4_HUMAN	V	20	.	ENSP00000356231:A20V	A	-	2	0	RABIF	201124791	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.132000	0.71676	0.592000	0.29728	0.655000	0.94253	GCG	RABIF	-	pfam_Mss4,superfamily_Mss4-like	ENSG00000183155		0.682	RABIF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RABIF	HGNC	protein_coding	OTTHUMT00000099183.1	-	0.00	21	0	G			202858168	-1	tier1	-	no_errors	ENST00000367262	ensembl	human	known	74_37	missense	38.10	13	8	SNP	1.000	A
RBM4	5936	genome.wustl.edu	37	11	66407231	66407231	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr11:66407231G>C	ENST00000409406.1	+	1	826	c.49G>C	c.(49-51)Gag>Cag	p.E17Q	RBM4_ENST00000514361.3_Intron|RBM4_ENST00000506523.2_Missense_Mutation_p.E17Q|RBM4_ENST00000310092.7_Missense_Mutation_p.E17Q|RBM4_ENST00000396053.4_Missense_Mutation_p.E17Q|RBM4_ENST00000398692.4_Missense_Mutation_p.E17Q|RBM4_ENST00000483858.1_Missense_Mutation_p.E17Q|RBM4_ENST00000408993.2_Missense_Mutation_p.E17Q|RBM4_ENST00000578778.1_Missense_Mutation_p.E17Q|RBM4_ENST00000503028.2_Missense_Mutation_p.E17Q|RBM4_ENST00000532968.1_Missense_Mutation_p.E17Q|RBM14-RBM4_ENST00000500635.2_Intron|RBM4_ENST00000530235.1_Missense_Mutation_p.E17Q|RBM14-RBM4_ENST00000412278.2_Intron			Q9BWF3	RBM4_HUMAN	RNA binding motif protein 4	17	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				cap-independent translational initiation (GO:0002190)|cell differentiation (GO:0030154)|circadian regulation of translation (GO:0097167)|entrainment of circadian clock by photoperiod (GO:0043153)|IRES-dependent translational initiation (GO:0002192)|mRNA processing (GO:0006397)|negative regulation of translation (GO:0017148)|negative regulation of translation in response to stress (GO:0032055)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|negative regulation of translational initiation (GO:0045947)|positive regulation of muscle cell differentiation (GO:0051149)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of nucleocytoplasmic transport (GO:0046822)|response to arsenic-containing substance (GO:0046685)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|stress-activated MAPK cascade (GO:0051403)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|nuclear speck (GO:0016607)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	miRNA binding (GO:0035198)|mRNA 3'-UTR binding (GO:0003730)|mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|pre-mRNA intronic binding (GO:0097157)|pre-mRNA intronic pyrimidine-rich binding (GO:0097158)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			endometrium(3)|large_intestine(4)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	13				Lung(977;0.0112)|LUSC - Lung squamous cell carcinoma(976;0.0266)		TACAGAGCAGGAGATTCGCTC	0.502																																																	0													94.0	97.0	96.0					11																	66407231		2200	4295	6495	SO:0001583	missense	0			U89505	CCDS41676.1, CCDS55776.1, CCDS55777.1	11q13	2013-02-12			ENSG00000173933	ENSG00000173933		"""Zinc fingers, CCHC domain containing"", ""RNA binding motif (RRM) containing"""	9901	protein-coding gene	gene with protein product		602571				9169144, 16260624	Standard	NM_002896		Approved	LARK, RBM4A, ZCRB3A, ZCCHC21		Q9BWF3	OTTHUMG00000154171	ENST00000409406.1:c.49G>C	11.37:g.66407231G>C	ENSP00000386894:p.Glu17Gln		B3KUN0|B4E1U0|E7EQS3|O02916|Q4VC48|Q6P1P2|Q8WU85	Missense_Mutation	SNP	pfam_RRM_dom,pfam_Znf_CCHC,smart_RRM_dom,smart_Znf_CCHC,pfscan_Znf_CCHC,pfscan_RRM_dom	p.E17Q	ENST00000409406.1	37	c.49	CCDS41676.1	11	.	.	.	.	.	.	.	.	.	.	G	29.2	4.982825	0.93044	.	.	ENSG00000248643;ENSG00000248643;ENSG00000173933;ENSG00000173933;ENSG00000173933;ENSG00000173933;ENSG00000173933;ENSG00000173933;ENSG00000173933;ENSG00000173933;ENSG00000173933;ENSG00000173933	ENST00000503028;ENST00000514361;ENST00000310092;ENST00000396053;ENST00000408993;ENST00000483858;ENST00000398692;ENST00000510173;ENST00000506523;ENST00000530235;ENST00000532968;ENST00000409406	T;T;T;T;T;T;T;T;T;T;T;T	0.75704	-0.96;2.22;-0.96;-0.96;-0.96;-0.96;-0.96;-0.96;-0.96;-0.96;-0.96;-0.96	4.82	4.82	0.62117	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.85682	U	0.000000	D	0.85137	0.5628	.	.	.	0.80722	D	1	D;D;D;D	0.89917	1.0;0.997;1.0;0.999	D;D;D;D	0.81914	0.99;0.988;0.995;0.976	D	0.85430	0.1148	9	0.45353	T	0.12	-7.594	15.8408	0.78842	0.0:0.0:1.0:0.0	.	17;17;17;17	E7EQS3;Q9BWF3-3;Q9BWF3;Q9BWF3-2	.;.;RBM4_HUMAN;.	Q	17	ENSP00000425760:E17Q;ENSP00000425446:E17Q;ENSP00000309166:E17Q;ENSP00000413497:E17Q;ENSP00000386561:E17Q;ENSP00000435821:E17Q;ENSP00000381680:E17Q;ENSP00000422301:E17Q;ENSP00000423572:E17Q;ENSP00000432150:E17Q;ENSP00000432020:E17Q;ENSP00000386894:E17Q	ENSP00000425760:E17Q	E	+	1	0	RBM4;RBM14-RBM4	66163807	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.819000	0.86621	2.416000	0.81992	0.556000	0.70494	GAG	RBM4	-	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	ENSG00000173933		0.502	RBM4-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	RBM4	HGNC	protein_coding	OTTHUMT00000334212.1	-	0.00	133	0	G	NM_002896		66407231	+1	tier1	-	no_errors	ENST00000310092	ensembl	human	known	74_37	missense	40.78	61	42	SNP	1.000	C
RFFL	117584	genome.wustl.edu	37	17	33348699	33348699	+	Silent	SNP	T	T	C			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr17:33348699T>C	ENST00000315249.7	-	3	504	c.282A>G	c.(280-282)acA>acG	p.T94T	RFFL_ENST00000447669.2_Silent_p.T94T|RFFL_ENST00000378516.2_Silent_p.T94T|RFFL_ENST00000413582.2_Silent_p.T94T|RFFL_ENST00000584655.1_Silent_p.T94T|RFFL_ENST00000394597.2_Silent_p.T94T|RFFL_ENST00000268850.7_Silent_p.T94T|RAD51L3-RFFL_ENST00000593039.1_Intron|RFFL_ENST00000415395.2_Silent_p.T94T					ring finger and FYVE-like domain containing E3 ubiquitin protein ligase											kidney(1)|large_intestine(2)|lung(3)	6		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0227)		GCTGAAAGGCTGTAGCTCGAA	0.512																																																	0													87.0	84.0	85.0					17																	33348699		2203	4300	6503	SO:0001819	synonymous_variant	0			AF434816	CCDS11286.1	17q12	2012-02-23	2012-02-23		ENSG00000092871	ENSG00000092871		"""RING-type (C3HC4) zinc fingers"""	24821	protein-coding gene	gene with protein product		609735	"""ring finger and FYVE-like domain containing"""			15229288	Standard	NR_037713		Approved	rififylin, fring, RNF189, RNF34L	uc002hin.1	Q8WZ73	OTTHUMG00000132933	ENST00000315249.7:c.282A>G	17.37:g.33348699T>C				Silent	SNP	superfamily_Znf_FYVE_PHD,smart_Znf_RING,pfscan_Znf_RING	p.T94	ENST00000315249.7	37	c.282	CCDS11286.1	17																																																																																			RFFL	-	superfamily_Znf_FYVE_PHD	ENSG00000092871		0.512	RFFL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RFFL	HGNC	protein_coding	OTTHUMT00000256460.2	-	0.00	44	0	T	NM_057178		33348699	-1	tier1	-	no_errors	ENST00000315249	ensembl	human	known	74_37	silent	38.46	8	5	SNP	1.000	C
RFPL4AL1	729974	genome.wustl.edu	37	19	56283325	56283325	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr19:56283325G>T	ENST00000341750.4	+	2	199	c.155G>T	c.(154-156)tGc>tTc	p.C52F		NM_001277397.1	NP_001264326.1	F8VTS6	RFAL1_HUMAN	ret finger protein-like 4A-like 1	52							zinc ion binding (GO:0008270)										TGCCGTTTCTGCTCTGTGGTC	0.512																																																	0																																										SO:0001583	missense	0				CCDS59425.1	19q13.42	2013-02-22			ENSG00000229292	ENSG00000229292			45147	protein-coding gene	gene with protein product							Standard	NM_001277397		Approved		uc031rnc.1	F8VTS6	OTTHUMG00000165450	ENST00000341750.4:c.155G>T	19.37:g.56283325G>T	ENSP00000345151:p.Cys52Phe			Missense_Mutation	SNP	pfam_RDM_domain_RFPL,pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl_sf,smart_PRY,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Znf_RING,prints_Butyrophylin	p.C52F	ENST00000341750.4	37	c.155	CCDS59425.1	19	.	.	.	.	.	.	.	.	.	.	G	10.08	1.251129	0.22880	.	.	ENSG00000229292	ENST00000341750	T	0.54866	0.55	1.67	0.614	0.17603	.	.	.	.	.	T	0.72423	0.3458	H	0.97611	4.04	.	.	.	.	.	.	.	.	.	T	0.71427	-0.4596	6	0.42905	T	0.14	-36.8607	3.9288	0.09275	0.2281:0.0:0.7719:0.0	.	.	.	.	F	52	ENSP00000345151:C52F	ENSP00000345151:C52F	C	+	2	0	CTD-2611O12.2	60975137	0.050000	0.20438	0.009000	0.14445	0.031000	0.12232	2.453000	0.44970	0.271000	0.22005	0.405000	0.27470	TGC	RFPL4AL1	-	pfam_RDM_domain_RFPL,pfscan_Znf_RING	ENSG00000229292		0.512	RFPL4AL1-001	NOVEL	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	RFPL4AL1	HGNC	protein_coding	OTTHUMT00000384186.1	-	0.00	20	0	G			56283325	+1	tier1	-	no_errors	ENST00000341750	ensembl	human	novel	74_37	missense	50.00	7	7	SNP	0.037	T
RFPL4AL1	729974	genome.wustl.edu	37	19	56283981	56283981	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr19:56283981C>G	ENST00000341750.4	+	3	344	c.300C>G	c.(298-300)ttC>ttG	p.F100L		NM_001277397.1	NP_001264326.1	F8VTS6	RFAL1_HUMAN	ret finger protein-like 4A-like 1	100	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.						zinc ion binding (GO:0008270)										ATATGACCTTCGATGTGGACA	0.458																																																	0																																										SO:0001583	missense	0				CCDS59425.1	19q13.42	2013-02-22			ENSG00000229292	ENSG00000229292			45147	protein-coding gene	gene with protein product							Standard	NM_001277397		Approved		uc031rnc.1	F8VTS6	OTTHUMG00000165450	ENST00000341750.4:c.300C>G	19.37:g.56283981C>G	ENSP00000345151:p.Phe100Leu			Missense_Mutation	SNP	pfam_RDM_domain_RFPL,pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl_sf,smart_PRY,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Znf_RING,prints_Butyrophylin	p.F100L	ENST00000341750.4	37	c.300	CCDS59425.1	19	.	.	.	.	.	.	.	.	.	.	G	0.419	-0.909442	0.02434	.	.	ENSG00000229292	ENST00000341750	T	0.02067	4.47	1.81	-2.08	0.07254	.	.	.	.	.	T	0.00384	0.0012	N	0.00037	-2.525	.	.	.	.	.	.	.	.	.	T	0.47071	-0.9145	6	0.02654	T	1	-10.4686	1.8962	0.03257	0.1363:0.1964:0.469:0.1983	.	.	.	.	L	100	ENSP00000345151:F100L	ENSP00000345151:F100L	F	+	3	2	CTD-2611O12.2	60975793	1.000000	0.71417	0.001000	0.08648	0.624000	0.37722	1.033000	0.30191	-0.422000	0.07405	-0.338000	0.08134	TTC	RFPL4AL1	-	superfamily_ConA-like_lec_gl_sf,smart_PRY,pfscan_B30.2/SPRY,prints_Butyrophylin	ENSG00000229292		0.458	RFPL4AL1-001	NOVEL	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	RFPL4AL1	HGNC	protein_coding	OTTHUMT00000384186.1	-	0.00	28	0	C			56283981	+1	tier1	-	no_errors	ENST00000341750	ensembl	human	novel	74_37	missense	63.89	13	23	SNP	0.343	G
RFX3	5991	genome.wustl.edu	37	9	3395586	3395586	+	Start_Codon_SNP	SNP	C	C	G			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr9:3395586C>G	ENST00000382004.3	-	3	314	c.3G>C	c.(1-3)atG>atC	p.M1I	RFX3_ENST00000381984.2_Start_Codon_SNP_p.M1I|RFX3_ENST00000302303.1_Start_Codon_SNP_p.M1I|RFX3_ENST00000358730.2_Start_Codon_SNP_p.M1I	NM_001282116.1|NM_134428.1	NP_001269045.1|NP_602304.1	P48380	RFX3_HUMAN	regulatory factor X, 3 (influences HLA class II expression)	1					cell maturation (GO:0048469)|cilium assembly (GO:0042384)|cilium-dependent cell motility (GO:0060285)|endocrine pancreas development (GO:0031018)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type B pancreatic cell development (GO:2000078)|regulation of insulin secretion (GO:0050796)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)|type B pancreatic cell maturation (GO:0072560)	nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(11)|large_intestine(3)|lung(14)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	40				GBM - Glioblastoma multiforme(50;0.00124)|Lung(2;0.0337)		CTGATGTCTGCATGATGGTCT	0.418																																																	0													110.0	104.0	106.0					9																	3395586		2203	4300	6503	SO:0001582	initiator_codon_variant	0			AI811824	CCDS6449.1, CCDS6450.1, CCDS75809.1	9p24.2	2008-02-05			ENSG00000080298	ENSG00000080298			9984	protein-coding gene	gene with protein product		601337				8289803	Standard	XM_005251534		Approved		uc003zhr.3	P48380	OTTHUMG00000019456	ENST00000382004.3:c.3G>C	9.37:g.3395586C>G	ENSP00000371434:p.Met1Ile		A8K0H5|D3DRH8|D3DRH9|Q5JTL7|Q5JTL8|Q6NW13|Q8WTU4|Q95HL5|Q95HL6	Missense_Mutation	SNP	pfam_RFX1_trans_act,pfam_DNA-bd_RFX	p.M1I	ENST00000382004.3	37	c.3	CCDS6449.1	9	.	.	.	.	.	.	.	.	.	.	C	21.0	4.089925	0.76756	.	.	ENSG00000080298	ENST00000382004;ENST00000381992;ENST00000358730;ENST00000302303;ENST00000457373;ENST00000451859;ENST00000381985;ENST00000449190;ENST00000381984	T;T;T;T;T;T;T	0.33438	1.41;1.41;1.41;1.41;1.41;1.41;1.41	5.13	5.13	0.70059	RFX1 transcription activation region (1);	0.000000	0.85682	D	0.000000	T	0.59059	0.2166	.	.	.	0.80722	D	1	P;B;D;D	0.59357	0.925;0.031;0.982;0.985	D;B;D;D	0.72338	0.932;0.187;0.961;0.977	T	0.63269	-0.6675	9	0.72032	D	0.01	-12.0262	18.9449	0.92618	0.0:1.0:0.0:0.0	.	1;1;1;1	B1ANP5;P48380-3;P48380-2;P48380	.;.;.;RFX3_HUMAN	I	1	ENSP00000371434:M1I;ENSP00000351574:M1I;ENSP00000303847:M1I;ENSP00000405664:M1I;ENSP00000411756:M1I;ENSP00000399352:M1I;ENSP00000371414:M1I	ENSP00000303847:M1I	M	-	3	0	RFX3	3385586	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.634000	0.67833	2.563000	0.86464	0.563000	0.77884	ATG	RFX3	-	pfam_RFX1_trans_act	ENSG00000080298		0.418	RFX3-006	KNOWN	basic|appris_principal|CCDS	protein_coding	RFX3	HGNC	protein_coding	OTTHUMT00000051545.1	-	0.00	47	0	C	NM_002919	Missense_Mutation	3395586	-1	tier1	-	no_errors	ENST00000382004	ensembl	human	known	74_37	missense	27.91	31	12	SNP	1.000	G
RNF17	56163	genome.wustl.edu	37	13	25418011	25418011	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr13:25418011G>T	ENST00000255324.5	+	20	2785	c.2733G>T	c.(2731-2733)caG>caT	p.Q911H	RNF17_ENST00000381921.1_Missense_Mutation_p.Q911H|RNF17_ENST00000339524.3_5'Flank	NM_001184993.1|NM_031277.2	NP_001171922.1|NP_112567.2	Q9BXT8	RNF17_HUMAN	ring finger protein 17	911					multicellular organismal development (GO:0007275)|spermatid development (GO:0007286)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	hydrolase activity, acting on ester bonds (GO:0016788)|nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(15)|ovary(1)|prostate(3)|skin(6)	36		Lung SC(185;0.0225)|Breast(139;0.077)		all cancers(112;0.0114)|OV - Ovarian serous cystadenocarcinoma(117;0.0311)|Epithelial(112;0.0524)		AGAATTTTCAGTCACTTTATA	0.318																																																	0													56.0	58.0	58.0					13																	25418011		2203	4293	6496	SO:0001583	missense	0			AF285602, AK001907	CCDS9308.2	13q12.13	2013-01-23			ENSG00000132972	ENSG00000132972		"""RING-type (C3HC4) zinc fingers"", ""Tudor domain containing"""	10060	protein-coding gene	gene with protein product	"""spermatogenesis associated 23"""	605793	"""tudor domain containing 4"""	TDRD4		11279525	Standard	NM_001184993		Approved	Mmip-2, SPATA23, FLJ11045	uc001upr.3	Q9BXT8	OTTHUMG00000016589	ENST00000255324.5:c.2733G>T	13.37:g.25418011G>T	ENSP00000255324:p.Gln911His		Q5T2J9|Q6P1W3|Q9BXT7|Q9NUY9	Missense_Mutation	SNP	pfam_Tudor,smart_Tudor,pfscan_Tudor,pfscan_Znf_RING	p.Q911H	ENST00000255324.5	37	c.2733	CCDS9308.2	13	.	.	.	.	.	.	.	.	.	.	G	15.40	2.821972	0.50739	.	.	ENSG00000132972	ENST00000255324;ENST00000381921;ENST00000429047;ENST00000418120	T;T;T	0.12569	3.45;3.45;2.67	4.72	-3.44	0.04796	.	0.309106	0.25674	N	0.029048	T	0.18964	0.0455	L	0.29908	0.895	0.80722	D	1	D;D;D	0.69078	0.996;0.997;0.993	P;D;P	0.68483	0.804;0.958;0.79	T	0.00025	-1.2320	10	0.40728	T	0.16	-10.0356	12.668	0.56853	0.7311:0.0:0.2689:0.0	.	911;911;911	B7Z7S1;Q9BXT8-5;Q9BXT8	.;.;RNF17_HUMAN	H	911;911;770;235	ENSP00000255324:Q911H;ENSP00000371346:Q911H;ENSP00000388892:Q235H	ENSP00000255324:Q911H	Q	+	3	2	RNF17	24316011	0.180000	0.23148	0.793000	0.32043	0.931000	0.56810	-0.481000	0.06552	-0.980000	0.03524	-0.218000	0.12543	CAG	RNF17	-	NULL	ENSG00000132972		0.318	RNF17-003	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF17	HGNC	protein_coding	OTTHUMT00000044217.1	-	0.00	59	0	G	NM_031994		25418011	+1	tier1	-	no_errors	ENST00000255324	ensembl	human	known	74_37	missense	7.02	53	4	SNP	0.827	T
RNF6	6049	genome.wustl.edu	37	13	26788056	26788056	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr13:26788056G>C	ENST00000381588.4	-	5	2715	c.1963C>G	c.(1963-1965)Cac>Gac	p.H655D	RNF6_ENST00000346166.3_Missense_Mutation_p.H655D|RNF6_ENST00000399762.2_Missense_Mutation_p.H299D|RNF6_ENST00000468480.1_Intron|RNF6_ENST00000381570.3_Missense_Mutation_p.H655D	NM_005977.3	NP_005968.1	Q9Y252	RNF6_HUMAN	ring finger protein (C3H2C3 type) 6	655	Required for polyubiquitination. {ECO:0000250}.				negative regulation of axon extension (GO:0030517)|positive regulation of transcription, DNA-templated (GO:0045893)|protein K27-linked ubiquitination (GO:0044314)|protein K48-linked ubiquitination (GO:0070936)|protein K6-linked ubiquitination (GO:0085020)|regulation of androgen receptor signaling pathway (GO:0060765)|regulation of transcription, DNA-templated (GO:0006355)|ubiquitin-dependent protein catabolic process (GO:0006511)	axon (GO:0030424)|cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|PML body (GO:0016605)	androgen receptor binding (GO:0050681)|DNA binding (GO:0003677)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|endometrium(2)|kidney(1)|large_intestine(9)|lung(3)|ovary(2)|prostate(2)|skin(2)	23	Colorectal(5;0.000442)	Lung SC(185;0.0156)|Breast(139;0.147)		all cancers(112;0.00893)|Epithelial(112;0.0481)|OV - Ovarian serous cystadenocarcinoma(117;0.148)|GBM - Glioblastoma multiforme(144;0.23)|Lung(94;0.245)		CAATGAATGTGAAATTCATGC	0.398																																																	0													146.0	132.0	137.0					13																	26788056		2203	4300	6503	SO:0001583	missense	0			AJ010346	CCDS9316.1	13q12.2	2013-01-09			ENSG00000127870	ENSG00000127870		"""RING-type (C3HC4) zinc fingers"""	10069	protein-coding gene	gene with protein product	"""RING-H2 protein RNF-6"""	604242				10331950	Standard	NM_005977		Approved	DKFZp686P0776	uc001uqq.3	Q9Y252	OTTHUMG00000016614	ENST00000381588.4:c.1963C>G	13.37:g.26788056G>C	ENSP00000371000:p.His655Asp		B4DDP0|Q5W0H0|Q9BZP5|Q9UF41	Missense_Mutation	SNP	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	p.H655D	ENST00000381588.4	37	c.1963	CCDS9316.1	13	.	.	.	.	.	.	.	.	.	.	G	20.7	4.033855	0.75504	.	.	ENSG00000127870	ENST00000346166;ENST00000381588;ENST00000381570;ENST00000399762	T;T;T;T	0.77358	-1.09;-1.09;-1.09;-1.09	4.95	4.95	0.65309	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (2);Zinc finger, C3HC4 RING-type (1);	0.000000	0.85682	D	0.000000	D	0.88764	0.6525	M	0.80183	2.485	0.80722	D	1	D;D	0.89917	1.0;0.997	D;D	0.80764	0.994;0.954	D	0.89952	0.4080	10	0.87932	D	0	-19.9229	18.7242	0.91708	0.0:0.0:1.0:0.0	.	299;655	B4DDP0;Q9Y252	.;RNF6_HUMAN	D	655;655;655;299	ENSP00000342121:H655D;ENSP00000371000:H655D;ENSP00000370982:H655D;ENSP00000382665:H299D	ENSP00000342121:H655D	H	-	1	0	RNF6	25686056	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.099000	0.94207	2.728000	0.93425	0.557000	0.71058	CAC	RNF6	-	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	ENSG00000127870		0.398	RNF6-006	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF6	HGNC	protein_coding	OTTHUMT00000044246.2	-	0.00	33	0	G	NM_005977		26788056	-1	tier1	-	no_errors	ENST00000346166	ensembl	human	known	74_37	missense	59.09	9	13	SNP	1.000	C
RNPC3	55599	genome.wustl.edu	37	1	104087666	104087666	+	Missense_Mutation	SNP	A	A	C			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr1:104087666A>C	ENST00000533099.1	+	11	1385	c.1149A>C	c.(1147-1149)gaA>gaC	p.E383D	RNPC3_ENST00000524631.1_Missense_Mutation_p.E382D|RNPC3_ENST00000423855.2_Missense_Mutation_p.E383D			Q96LT9	RBM40_HUMAN	RNA-binding region (RNP1, RRM) containing 3	383					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)|U12-type spliceosomal complex (GO:0005689)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	4		all_epithelial(167;3.05e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000451)		Lung(183;0.111)|Epithelial(280;0.122)|all cancers(265;0.125)|Colorectal(144;0.163)		ACTCTGATGAAATGCCTTCAG	0.358																																																	0													83.0	73.0	76.0					1																	104087666		692	1590	2282	SO:0001583	missense	0			AB058742, AY099329	CCDS781.1	1p21.1	2013-07-16			ENSG00000185946	ENSG00000185946		"""RNA binding motif (RRM) containing"""	18666	protein-coding gene	gene with protein product	"""U11/U12 snRNP 65K"""					14974681, 15146077	Standard	NM_017619		Approved	KIAA1839, FLJ20008, RBM40, SNRNP65	uc010oun.2	Q96LT9	OTTHUMG00000166613	ENST00000533099.1:c.1149A>C	1.37:g.104087666A>C	ENSP00000432886:p.Glu383Asp		A8K1C9|D3DT74|Q5TZ87|Q96FK7|Q96JI8|Q9NSU7|Q9NXX2	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.E383D	ENST00000533099.1	37	c.1149	CCDS781.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	7.230|7.230	0.599161|0.599161	0.13939|0.13939	.|.	.|.	ENSG00000185946|ENSG00000185946	ENST00000524631;ENST00000533099;ENST00000423855|ENST00000524641	T;T;T|.	0.19250|.	2.16;2.18;2.18|.	5.55|5.55	-1.23|-1.23	0.09465|0.09465	.|.	.|.	.|.	.|.	.|.	T|T	0.09291|0.09291	0.0229|0.0229	N|N	0.24115|0.24115	0.695|0.695	0.30914|0.30914	N|N	0.7288|0.7288	B;B|.	0.17465|.	0.022;0.001|.	B;B|.	0.12156|.	0.007;0.002|.	T|T	0.25606|0.25606	-1.0127|-1.0127	9|5	0.07990|.	T|.	0.79|.	.|.	2.0661|2.0661	0.03603|0.03603	0.4906:0.1202:0.273:0.1162|0.4906:0.1202:0.273:0.1162	.|.	382;383|.	A8K1C9;Q96LT9|.	.;RBM40_HUMAN|.	D|T	382;383;383|112	ENSP00000437278:E382D;ENSP00000432886:E383D;ENSP00000391432:E383D|.	ENSP00000391432:E383D|.	E|K	+|+	3|2	2|0	RNPC3|RNPC3	.|.	0.975000|0.975000	0.34042|0.34042	0.997000|0.997000	0.53966|0.53966	0.994000|0.994000	0.84299|0.84299	0.396000|0.396000	0.20867|0.20867	-0.178000|-0.178000	0.10672|0.10672	-0.323000|-0.323000	0.08544|0.08544	GAA|AAA	RNPC3	-	NULL	ENSG00000185946		0.358	RNPC3-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RNPC3	HGNC	protein_coding	OTTHUMT00000390812.1	-	0.00	54	0	A	NM_017619		104087666	+1	tier1	-	no_errors	ENST00000423855	ensembl	human	known	74_37	missense	19.05	34	8	SNP	0.991	C
ROBO2	6092	genome.wustl.edu	37	3	77681778	77681778	+	Intron	SNP	G	G	A			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr3:77681778G>A	ENST00000461745.1	+	24	4660				ROBO2_ENST00000487694.3_Intron|ROBO2_ENST00000332191.8_Missense_Mutation_p.R1305K	NM_002942.4	NP_002933.1	Q9HCK4	ROBO2_HUMAN	roundabout, axon guidance receptor, homolog 2 (Drosophila)						apoptotic process involved in luteolysis (GO:0061364)|axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|brain development (GO:0007420)|cellular response to hormone stimulus (GO:0032870)|central nervous system development (GO:0007417)|homophilic cell adhesion (GO:0007156)|metanephros development (GO:0001656)|negative regulation of negative chemotaxis (GO:0050925)|negative regulation of synapse assembly (GO:0051964)|olfactory bulb interneuron development (GO:0021891)|positive regulation of axonogenesis (GO:0050772)|retinal ganglion cell axon guidance (GO:0031290)|ureteric bud development (GO:0001657)	axolemma (GO:0030673)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	axon guidance receptor activity (GO:0008046)|identical protein binding (GO:0042802)			NS(1)|biliary_tract(5)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(23)|liver(1)|lung(52)|ovary(2)|pancreas(2)|prostate(5)|skin(8)|upper_aerodigestive_tract(1)	117				Epithelial(33;0.00199)|LUSC - Lung squamous cell carcinoma(21;0.008)|BRCA - Breast invasive adenocarcinoma(55;0.00884)|Lung(72;0.0183)|KIRC - Kidney renal clear cell carcinoma(39;0.0832)|Kidney(39;0.103)		GCTGGTTTTAGGCTGGATGGA	0.478																																																	0																																										SO:0001627	intron_variant	0			AF040991	CCDS43109.1, CCDS54609.1	3p12.3	2013-02-11	2001-11-28		ENSG00000185008	ENSG00000185008		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	10250	protein-coding gene	gene with protein product		602431	"""roundabout (axon guidance receptor, Drosophila) homolog 2"""			9458045	Standard	NM_002942		Approved	KIAA1568	uc003dpy.4	Q9HCK4	OTTHUMG00000158935	ENST00000461745.1:c.3761-2243G>A	3.37:g.77681778G>A			O43608|Q19AB4|Q19AB5	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.R1305K	ENST00000461745.1	37	c.3914	CCDS43109.1	3	.	.	.	.	.	.	.	.	.	.	G	7.846	0.722886	0.15439	.	.	ENSG00000185008	ENST00000332191	T	0.61742	0.08	5.49	5.49	0.81192	.	.	.	.	.	T	0.35595	0.0937	.	.	.	.	.	.	B	0.22080	0.064	B	0.21917	0.037	T	0.30475	-0.9977	7	0.02654	T	1	.	15.2495	0.73532	0.0:0.1399:0.8601:0.0	.	1305	F8W703	.	K	1305	ENSP00000327536:R1305K	ENSP00000327536:R1305K	R	+	2	0	ROBO2	77764468	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.207000	0.72159	2.734000	0.93682	0.655000	0.94253	AGG	ROBO2	-	NULL	ENSG00000185008		0.478	ROBO2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	ROBO2	HGNC	protein_coding	OTTHUMT00000352600.2		0.00	50	0	G	XM_031246		77681778	+1			no_errors	ENST00000332191	ensembl	human	novel	74_37	missense	21.88	25	7	SNP	1.000	A
RPS6KA5	9252	genome.wustl.edu	37	14	91341668	91341668	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr14:91341668G>C	ENST00000261991.3	-	15	2046	c.1873C>G	c.(1873-1875)Cat>Gat	p.H625D	RPS6KA5_ENST00000536315.2_Missense_Mutation_p.H546D	NM_004755.2	NP_004746.2	O75582	KS6A5_HUMAN	ribosomal protein S6 kinase, 90kDa, polypeptide 5	625	Protein kinase 2. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon guidance (GO:0007411)|epidermal growth factor receptor signaling pathway (GO:0007173)|histone H2A-S1 phosphorylation (GO:0043990)|histone H3-S10 phosphorylation (GO:0043987)|histone H3-S28 phosphorylation (GO:0043988)|histone phosphorylation (GO:0016572)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interleukin-1-mediated signaling pathway (GO:0070498)|intracellular signal transduction (GO:0035556)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of cytokine production (GO:0001818)|negative regulation of transcription, DNA-templated (GO:0045892)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of histone acetylation (GO:0035066)|positive regulation of histone phosphorylation (GO:0033129)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|regulation of transcription, DNA-templated (GO:0006355)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			endometrium(2)|large_intestine(8)|lung(8)|ovary(1)|prostate(1)|skin(2)|urinary_tract(2)	24		all_cancers(154;0.0148)|Melanoma(154;0.099)|all_epithelial(191;0.146)		Epithelial(152;0.182)|BRCA - Breast invasive adenocarcinoma(234;0.201)		CTTCGGTCATGAGATTGGAAG	0.413																																																	0													67.0	67.0	67.0					14																	91341668		2203	4300	6503	SO:0001583	missense	0			AF074393	CCDS9893.1, CCDS45149.1	14q31-q32.1	2011-04-05	2002-08-29			ENSG00000100784			10434	protein-coding gene	gene with protein product		603607	"""ribosomal protein S6 kinase, 90kD, polypeptide 5"""			9687510, 10702687	Standard	NM_004755		Approved	MSK1, RLPK	uc001xys.2	O75582		ENST00000261991.3:c.1873C>G	14.37:g.91341668G>C	ENSP00000261991:p.His625Asp		O95316|Q96AF7	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_LipoPS_kinase,pfam_Aminoglycoside_PTrfase,pfam_Pkinase_C,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_AGC-kinase_C,smart_Tyr_kinase_cat_dom,pirsf_Ribosomal_S6_kinase_II,pfscan_Prot_kinase_dom	p.H625D	ENST00000261991.3	37	c.1873	CCDS9893.1	14	.	.	.	.	.	.	.	.	.	.	G	16.48	3.134022	0.56828	.	.	ENSG00000100784	ENST00000261991;ENST00000536315	T;T	0.63913	-0.07;-0.07	5.43	5.43	0.79202	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.176392	0.52532	D	0.000068	T	0.38878	0.1057	N	0.01874	-0.695	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.25606	-1.0127	10	0.24483	T	0.36	.	19.5907	0.95509	0.0:0.0:1.0:0.0	.	625	O75582	KS6A5_HUMAN	D	625;546	ENSP00000261991:H625D;ENSP00000442803:H546D	ENSP00000261991:H625D	H	-	1	0	RPS6KA5	90411421	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	6.612000	0.74187	2.696000	0.92011	0.561000	0.74099	CAT	RPS6KA5	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Ribosomal_S6_kinase_II,pfscan_Prot_kinase_dom	ENSG00000100784		0.413	RPS6KA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPS6KA5	HGNC	protein_coding	OTTHUMT00000411442.2	-	0.00	32	0	G	NM_004755		91341668	-1	tier1	-	no_errors	ENST00000261991	ensembl	human	known	74_37	missense	34.29	23	12	SNP	1.000	C
RTL1	388015	genome.wustl.edu	37	14	101347784	101347784	+	Silent	SNP	C	C	A			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr14:101347784C>A	ENST00000534062.1	-	1	3400	c.3342G>T	c.(3340-3342)cgG>cgT	p.R1114R	MIR433_ENST00000384837.1_RNA|MIR127_ENST00000384876.1_RNA|MIR431_ENST00000385266.1_RNA	NM_001134888.2	NP_001128360.1	A6NKG5	RTL1_HUMAN	retrotransposon-like 1	1114					multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)				breast(1)|endometrium(5)|kidney(4)|large_intestine(1)|lung(5)|pancreas(1)|prostate(2)|skin(2)	21						GCCGAGCCACCCGCATGGCGG	0.667																																																	0													8.0	12.0	10.0					14																	101347784		680	1570	2250	SO:0001819	synonymous_variant	0				CCDS53910.1	14q32.2	2012-04-18			ENSG00000254656	ENSG00000254656			14665	protein-coding gene	gene with protein product		611896				16155747, 15854907, 12796779	Standard	NM_001134888		Approved	PEG11, MART1, Mar1	uc010txj.1	A6NKG5	OTTHUMG00000167573	ENST00000534062.1:c.3342G>T	14.37:g.101347784C>A			E9PKS8	Silent	SNP	pfam_Retrotrans_gag_dom,superfamily_Peptidase_aspartic_dom	p.R1114	ENST00000534062.1	37	c.3342	CCDS53910.1	14																																																																																			RTL1	-	NULL	ENSG00000254656		0.667	RTL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RTL1	HGNC	protein_coding	OTTHUMT00000395127.1	-	0.00	55	0	C	NM_001134888		101347784	-1	tier1	-	no_errors	ENST00000534062	ensembl	human	known	74_37	silent	22.45	38	11	SNP	0.000	A
RYR2	6262	genome.wustl.edu	37	1	237863703	237863703	+	Silent	SNP	G	G	A			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr1:237863703G>A	ENST00000366574.2	+	65	9620	c.9303G>A	c.(9301-9303)ctG>ctA	p.L3101L	RYR2_ENST00000542537.1_Silent_p.L3085L|RYR2_ENST00000609119.1_3'UTR|RYR2_ENST00000360064.6_Silent_p.L3099L	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	3101					BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			CAGTGGCCCTGCTGCCAATGC	0.418																																																	0													38.0	38.0	38.0					1																	237863703		1892	4116	6008	SO:0001819	synonymous_variant	0			X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.9303G>A	1.37:g.237863703G>A			Q15411|Q546N8|Q5T3P2	Silent	SNP	pfam_Ca-rel_channel,pfam_Ryanodine_rcpt,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR_motif,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR_motif,superfamily_ConA-like_lec_gl_sf,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_EF_hand_dom,pfscan_MIR_motif	p.L3099	ENST00000366574.2	37	c.9297	CCDS55691.1	1																																																																																			RYR2	-	NULL	ENSG00000198626		0.418	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	RYR2	HGNC	protein_coding	OTTHUMT00000095402.2	-	0.00	54	0	G	NM_001035		237863703	+1	tier1	-	no_errors	ENST00000360064	ensembl	human	known	74_37	silent	20.90	53	14	SNP	0.990	A
SACS	26278	genome.wustl.edu	37	13	23914586	23914586	+	Missense_Mutation	SNP	T	T	A			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr13:23914586T>A	ENST00000382292.3	-	9	3702	c.3429A>T	c.(3427-3429)caA>caT	p.Q1143H	SACS_ENST00000382298.3_Missense_Mutation_p.Q1143H|SACS_ENST00000402364.1_Missense_Mutation_p.Q393H			Q9NZJ4	SACS_HUMAN	sacsin molecular chaperone	1143					cell death (GO:0008219)|negative regulation of inclusion body assembly (GO:0090084)|protein folding (GO:0006457)	axon (GO:0030424)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chaperone binding (GO:0051087)|Hsp70 protein binding (GO:0030544)|proteasome binding (GO:0070628)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(54)|lung(49)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(11)	189		all_cancers(29;1.51e-22)|all_epithelial(30;7.82e-19)|all_lung(29;4.71e-18)|Lung SC(185;0.0225)|Breast(139;0.128)		all cancers(112;0.00197)|Epithelial(112;0.00854)|OV - Ovarian serous cystadenocarcinoma(117;0.0298)|Lung(94;0.189)		CTTCAGATGATTGCAACAGTG	0.418																																																	0													100.0	102.0	101.0					13																	23914586		2203	4300	6503	SO:0001583	missense	0			AF193556	CCDS9300.2	13q11	2014-06-13	2014-01-30		ENSG00000151835	ENSG00000151835		"""Heat shock proteins / DNAJ (HSP40)"""	10519	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 138"""	604490	"""spastic ataxia of Charlevoix-Saguenay (sacsin)"""			10610707, 15057823, 21726565	Standard	NM_001278055		Approved	ARSACS, KIAA0730, DKFZp686B15167, DNAJC29, SPAX6, PPP1R138	uc001uon.3	Q9NZJ4	OTTHUMG00000016562	ENST00000382292.3:c.3429A>T	13.37:g.23914586T>A	ENSP00000371729:p.Gln1143His		O94835|Q5T9J5|Q5T9J7|Q5T9J8|Q68DF5|Q6MZR4|Q8NBF9	Missense_Mutation	SNP	pfam_HEPN,pfam_Ubiquitin_dom,superfamily_HATPase_ATP-bd,superfamily_DnaJ_domain,smart_HEPN,pfscan_HEPN,pfscan_DnaJ_domain,pfscan_Ubiquitin_supergroup	p.Q1143H	ENST00000382292.3	37	c.3429	CCDS9300.2	13	.	.	.	.	.	.	.	.	.	.	T	3.342	-0.134294	0.06711	.	.	ENSG00000151835	ENST00000382292;ENST00000402364;ENST00000382298	D;D;D	0.88201	-2.2;-2.35;-2.2	6.16	1.48	0.22813	.	0.237683	0.44285	N	0.000472	T	0.77678	0.4166	L	0.31294	0.92	0.28073	N	0.932499	B	0.02656	0.0	B	0.04013	0.001	T	0.63730	-0.6571	10	0.40728	T	0.16	.	2.5099	0.04654	0.1058:0.4481:0.2059:0.2402	.	1143	Q9NZJ4	SACS_HUMAN	H	1143;393;1143	ENSP00000371729:Q1143H;ENSP00000385844:Q393H;ENSP00000371735:Q1143H	ENSP00000371729:Q1143H	Q	-	3	2	SACS	22812586	0.973000	0.33851	0.804000	0.32291	0.099000	0.18886	0.166000	0.16583	-0.037000	0.13646	-1.090000	0.02178	CAA	SACS	-	NULL	ENSG00000151835		0.418	SACS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SACS	HGNC	protein_coding	OTTHUMT00000044148.3	-	0.00	27	0	T	NM_014363		23914586	-1	tier1	-	no_errors	ENST00000382292	ensembl	human	known	74_37	missense	32.50	27	13	SNP	0.975	A
SATB2	23314	genome.wustl.edu	37	2	200246514	200246514	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr2:200246514G>C	ENST00000417098.1	-	4	1192	c.376C>G	c.(376-378)Ctc>Gtc	p.L126V	SATB2_ENST00000260926.5_Missense_Mutation_p.L126V|SATB2_ENST00000457245.1_Missense_Mutation_p.L126V|SATB2_ENST00000428695.1_Intron|SATB2_ENST00000443023.1_Missense_Mutation_p.L67V|SATB2_ENST00000484124.1_5'UTR	NM_001172509.1	NP_001165980.1	Q9UPW6	SATB2_HUMAN	SATB homeobox 2	126					cartilage development (GO:0051216)|cellular response to organic substance (GO:0071310)|chromatin remodeling (GO:0006338)|embryonic pattern specification (GO:0009880)|embryonic skeletal system morphogenesis (GO:0048704)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|osteoblast development (GO:0002076)|palate development (GO:0060021)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|histone deacetylase complex (GO:0000118)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|sequence-specific DNA binding (GO:0043565)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(40)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	62						CTGAGGGGGAGAGGGTTCCAC	0.428																																					Colon(30;262 767 11040 24421 36230)												0													91.0	86.0	87.0					2																	200246514		2203	4300	6503	SO:0001583	missense	0			AB028957	CCDS2327.1	2q33.1	2011-06-20	2007-02-15		ENSG00000119042	ENSG00000119042		"""Homeoboxes / CUT class"""	21637	protein-coding gene	gene with protein product		608148	"""SATB family member 2"""				Standard	NM_015265		Approved	KIAA1034, FLJ21474	uc002uva.2	Q9UPW6	OTTHUMG00000132767	ENST00000417098.1:c.376C>G	2.37:g.200246514G>C	ENSP00000401112:p.Leu126Val		A8K5Z8|Q3ZB87|Q4V763	Missense_Mutation	SNP	pfam_Hmoeo_CUT,pfam_Homeobox_dom,superfamily_Lambda_DNA-bd_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom,pfscan_Hmoeo_CUT	p.L126V	ENST00000417098.1	37	c.376	CCDS2327.1	2	.	.	.	.	.	.	.	.	.	.	G	3.834	-0.035171	0.07543	.	.	ENSG00000119042	ENST00000417098;ENST00000443023;ENST00000260926;ENST00000457245	T;T;T;T	0.74209	-0.82;-0.82;-0.82;-0.82	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	T	0.60534	0.2276	N	0.13168	0.305	0.47994	D	0.999568	B	0.19445	0.036	B	0.26517	0.07	T	0.57323	-0.7831	10	0.07175	T	0.84	-17.124	19.9759	0.97304	0.0:0.0:1.0:0.0	.	126	Q9UPW6	SATB2_HUMAN	V	126;67;126;126	ENSP00000401112:L126V;ENSP00000388764:L67V;ENSP00000260926:L126V;ENSP00000405420:L126V	ENSP00000260926:L126V	L	-	1	0	SATB2	199954759	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.756000	0.55205	2.713000	0.92767	0.655000	0.94253	CTC	SATB2	-	NULL	ENSG00000119042		0.428	SATB2-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SATB2	HGNC	protein_coding	OTTHUMT00000256140.1	-	0.00	40	0	G	NM_015265		200246514	-1	tier1	-	no_errors	ENST00000260926	ensembl	human	known	74_37	missense	17.24	24	5	SNP	1.000	C
SDHAF2	54949	genome.wustl.edu	37	11	61205246	61205246	+	Silent	SNP	C	C	T			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr11:61205246C>T	ENST00000543265.1	+	2	189	c.186C>T	c.(184-186)tcC>tcT	p.S62S	SDHAF2_ENST00000301761.2_Silent_p.S62S|RP11-286N22.8_ENST00000544880.1_3'UTR|SDHAF2_ENST00000542074.1_Intron|SDHAF2_ENST00000537782.1_Silent_p.S62S|SDHAF2_ENST00000534878.1_Silent_p.S62S|RP11-286N22.8_ENST00000543044.1_Silent_p.S50S					succinate dehydrogenase complex assembly factor 2											large_intestine(3)|lung(4)|ovary(2)	9						CTGATGAATCCATAGAAACCA	0.448																																																	0													107.0	115.0	112.0					11																	61205246		2202	4299	6501	SO:0001819	synonymous_variant	0			AK000494	CCDS8007.1	11q12.2	2014-09-17	2009-08-10	2009-08-10	ENSG00000167985	ENSG00000167985		"""Mitochondrial respiratory chain complex assembly factors"""	26034	protein-coding gene	gene with protein product		613019	"""paraganglioma or familial glomus tumors 2"", ""chromosome 11 open reading frame 79"""	PGL2, C11orf79		19628817	Standard	NM_017841		Approved	FLJ20487, SDH5	uc001nrt.3	Q9NX18	OTTHUMG00000168279	ENST00000543265.1:c.186C>T	11.37:g.61205246C>T				Silent	SNP	pfam_SDH,superfamily_SDH	p.S62	ENST00000543265.1	37	c.186		11																																																																																			SDHAF2	-	superfamily_SDH	ENSG00000167985		0.448	SDHAF2-007	PUTATIVE	basic|exp_conf	protein_coding	SDHAF2	HGNC	protein_coding	OTTHUMT00000398484.1		0.00	12	0	C	NM_017841		61205246	+1			no_errors	ENST00000301761	ensembl	human	known	74_37	silent	41.18	10	7	SNP	0.996	T
SEMA4B	10509	genome.wustl.edu	37	15	90768989	90768989	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr15:90768989G>T	ENST00000411539.2	+	12	1878	c.1618G>T	c.(1618-1620)Gac>Tac	p.D540Y	SEMA4B_ENST00000379122.3_Missense_Mutation_p.D535Y|SEMA4B_ENST00000332496.6_Missense_Mutation_p.D540Y	NM_198925.2	NP_945119.1	Q9NPR2	SEM4B_HUMAN	sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4B	535	PSI.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synapse (GO:0045202)	receptor activity (GO:0004872)			NS(1)|breast(2)|endometrium(1)|kidney(2)|large_intestine(2)|lung(2)|ovary(1)|stomach(1)	12	Melanoma(11;0.00551)|Lung NSC(78;0.0125)|all_lung(78;0.0272)		BRCA - Breast invasive adenocarcinoma(143;0.0107)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|STAD - Stomach adenocarcinoma(125;0.217)			CCTCGCCCGGGACCCCTACTG	0.657																																																	0													13.0	16.0	15.0					15																	90768989		2051	4182	6233	SO:0001583	missense	0			AB051532	CCDS45347.1	15q25	2008-07-18						"""Semaphorins"""	10730	protein-coding gene	gene with protein product				SEMAC		7748561	Standard	NM_020210		Approved	SemC, KIAA1745, MGC131831	uc002boz.3	Q9NPR2		ENST00000411539.2:c.1618G>T	15.37:g.90768989G>T	ENSP00000394720:p.Asp540Tyr		Q6UXE3|Q8WVP9|Q96FK5|Q9C0B8|Q9H691|Q9NPM8|Q9NPN0	Missense_Mutation	SNP	pfam_Semap_dom,pfam_Plexin_repeat,superfamily_Semap_dom,superfamily_Plexin-like_fold,smart_Semap_dom,smart_Plexin-like_fold,pfscan_Semap_dom	p.D540Y	ENST00000411539.2	37	c.1618	CCDS45347.1	15	.	.	.	.	.	.	.	.	.	.	G	28.6	4.935069	0.92458	.	.	ENSG00000185033	ENST00000332496;ENST00000379122;ENST00000411539	T;T;T	0.52983	0.64;0.64;0.64	5.7	5.7	0.88788	.	0.141085	0.64402	D	0.000007	T	0.79845	0.4516	H	0.96015	3.755	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.997;0.998;0.998	D	0.85921	0.1446	10	0.87932	D	0	.	18.3974	0.90502	0.0:0.0:1.0:0.0	.	535;540;535	Q9NPR2-2;Q2NL81;Q9NPR2	.;.;SEM4B_HUMAN	Y	540;535;540	ENSP00000332204:D540Y;ENSP00000368417:D535Y;ENSP00000394720:D540Y	ENSP00000332204:D540Y	D	+	1	0	SEMA4B	88569993	1.000000	0.71417	1.000000	0.80357	0.847000	0.48162	9.674000	0.98633	2.701000	0.92244	0.561000	0.74099	GAC	SEMA4B	-	pfam_Plexin_repeat,superfamily_Plexin-like_fold,smart_Plexin-like_fold	ENSG00000185033		0.657	SEMA4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEMA4B	HGNC	protein_coding	OTTHUMT00000416810.1	-	0.00	85	0	G	NM_198925		90768989	+1	tier1	-	no_errors	ENST00000332496	ensembl	human	known	74_37	missense	33.33	62	31	SNP	1.000	T
SERINC3	10955	genome.wustl.edu	37	20	43135470	43135470	+	Nonsense_Mutation	SNP	G	G	A			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr20:43135470G>A	ENST00000342374.4	-	6	938	c.781C>T	c.(781-783)Cag>Tag	p.Q261*	SERINC3_ENST00000541235.1_Nonsense_Mutation_p.Q206*|SERINC3_ENST00000255175.1_Nonsense_Mutation_p.Q261*	NM_006811.2	NP_006802.1	Q13530	SERC3_HUMAN	serine incorporator 3	261					phosphatidylserine metabolic process (GO:0006658)|positive regulation of endoplasmic reticulum stress-induced intrinsic apoptotic signaling pathway (GO:1902237)|sphingolipid metabolic process (GO:0006665)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	L-serine transmembrane transporter activity (GO:0015194)			endometrium(4)|large_intestine(2)|lung(8)|skin(3)|urinary_tract(1)	18		Myeloproliferative disorder(115;0.0122)	Colorectal(3;0.000291)|COAD - Colon adenocarcinoma(18;0.00189)			AATCATACCTGAATTTTTGGG	0.348																																																	0													89.0	84.0	85.0					20																	43135470		2203	4300	6503	SO:0001587	stop_gained	0			U49188	CCDS13333.1	20q13.12	2008-05-14	2005-11-15	2005-11-15	ENSG00000132824	ENSG00000132824			11699	protein-coding gene	gene with protein product		607165	"""tumor differentially expressed 1"""	TDE1		10559794	Standard	NM_006811		Approved	DIFF33, TDE, SBBI99, TMS-1, AIGP1	uc002xme.3	Q13530	OTTHUMG00000033087	ENST00000342374.4:c.781C>T	20.37:g.43135470G>A	ENSP00000340243:p.Gln261*		B4DUE9|O43717|Q9BR33	Nonsense_Mutation	SNP	pfam_TMS_TDE	p.Q261*	ENST00000342374.4	37	c.781	CCDS13333.1	20	.	.	.	.	.	.	.	.	.	.	G	39	7.374012	0.98245	.	.	ENSG00000132824	ENST00000255175;ENST00000342374;ENST00000538937;ENST00000541235	.	.	.	4.75	4.75	0.60458	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	.	18.3044	0.90175	0.0:0.0:1.0:0.0	.	.	.	.	X	261;261;228;206	.	ENSP00000255175:Q261X	Q	-	1	0	SERINC3	42568884	1.000000	0.71417	1.000000	0.80357	0.838000	0.47535	9.483000	0.97937	2.638000	0.89438	0.467000	0.42956	CAG	SERINC3	-	pfam_TMS_TDE	ENSG00000132824		0.348	SERINC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SERINC3	HGNC	protein_coding	OTTHUMT00000080544.3	-	0.00	33	0	G	NM_006811		43135470	-1	tier1	-	no_errors	ENST00000255175	ensembl	human	known	74_37	nonsense	38.10	13	8	SNP	1.000	A
SERTAD3	29946	genome.wustl.edu	37	19	40947559	40947559	+	Silent	SNP	C	C	T			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr19:40947559C>T	ENST00000322354.3	-	2	925	c.429G>A	c.(427-429)ggG>ggA	p.G143G	SERTAD3_ENST00000392028.4_Silent_p.G143G|CTC-492K19.4_ENST00000599050.1_RNA|SERTAD3_ENST00000601217.1_5'Flank	NM_203344.2	NP_976219.1	Q9UJW9	SRTD3_HUMAN	SERTA domain containing 3	143					negative regulation of cell growth (GO:0030308)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				kidney(1)|large_intestine(4)|lung(2)	7			Lung(22;6.24e-05)|LUSC - Lung squamous cell carcinoma(20;0.000384)			GGCCAGAGTCCCCCAAGTACC	0.572																																																	0													72.0	77.0	76.0					19																	40947559		2203	4300	6503	SO:0001819	synonymous_variant	0			AF192529	CCDS12558.1	19q13.2	2008-02-05				ENSG00000167565			17931	protein-coding gene	gene with protein product	"""RPA-binding trans-activator"""	612125				10982866, 11331592	Standard	NM_013368		Approved	RBT1	uc002onv.4	Q9UJW9		ENST00000322354.3:c.429G>A	19.37:g.40947559C>T			B3KQB3|Q96CQ2	Silent	SNP	pfam_SERTA,pfscan_SERTA	p.G143	ENST00000322354.3	37	c.429	CCDS12558.1	19																																																																																			SERTAD3	-	NULL	ENSG00000167565		0.572	SERTAD3-001	KNOWN	upstream_uORF|basic|appris_principal|CCDS	protein_coding	SERTAD3	HGNC	protein_coding	OTTHUMT00000462573.1	-	0.00	64	0	C	NM_013368		40947559	-1	tier1	-	no_errors	ENST00000322354	ensembl	human	known	74_37	silent	37.78	28	17	SNP	0.365	T
SETD7	80854	genome.wustl.edu	37	4	140454373	140454373	+	Silent	SNP	G	G	A			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr4:140454373G>A	ENST00000274031.3	-	3	954	c.318C>T	c.(316-318)ttC>ttT	p.F106F	SETD7_ENST00000506866.2_Silent_p.F106F|SETD7_ENST00000406354.1_3'UTR|SETD7_ENST00000404104.3_Silent_p.F106F	NM_030648.2	NP_085151.1	Q8WTS6	SETD7_HUMAN	SET domain containing (lysine methyltransferase) 7	106					chromatin modification (GO:0016568)|peptidyl-lysine dimethylation (GO:0018027)|peptidyl-lysine monomethylation (GO:0018026)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)|p53 binding (GO:0002039)|protein-lysine N-methyltransferase activity (GO:0016279)			central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(1)|ovary(1)|upper_aerodigestive_tract(1)	8	all_hematologic(180;0.156)					ACTGCCCCTTGAAGATCAGTC	0.473																																																	0													184.0	158.0	167.0					4																	140454373		2203	4300	6503	SO:0001819	synonymous_variant	0			AB051504	CCDS3748.1	4q31.1	2011-07-01			ENSG00000145391	ENSG00000145391		"""Chromatin-modifying enzymes / K-methyltransferases"""	30412	protein-coding gene	gene with protein product		606594				11850410, 11779497	Standard	NM_030648		Approved	KIAA1717, SET7, SET7/9, Set9, KMT7	uc003ihw.3	Q8WTS6	OTTHUMG00000133385	ENST00000274031.3:c.318C>T	4.37:g.140454373G>A			B5WWL3|Q0VAH3|Q4W5A9|Q9C0E6	Silent	SNP	pfam_MORN,pfam_SET_dom,smart_SET_dom,pirsf_Hist-Lys_N-MeTrfase_SET,pfscan_SET_dom	p.F106	ENST00000274031.3	37	c.318	CCDS3748.1	4																																																																																			SETD7	-	pfam_MORN,pirsf_Hist-Lys_N-MeTrfase_SET	ENSG00000145391		0.473	SETD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SETD7	HGNC	protein_coding	OTTHUMT00000257236.1	-	0.00	124	0	G	NM_030648		140454373	-1	tier1	-	no_errors	ENST00000274031	ensembl	human	known	74_37	silent	44.76	58	47	SNP	1.000	A
SGIP1	84251	genome.wustl.edu	37	1	67147594	67147594	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr1:67147594C>A	ENST00000371037.4	+	15	934	c.857C>A	c.(856-858)cCa>cAa	p.P286Q	SGIP1_ENST00000371036.3_Intron|SGIP1_ENST00000237247.6_Missense_Mutation_p.P290Q|SGIP1_ENST00000371035.3_Intron|SGIP1_ENST00000371039.1_Intron	NM_032291.2	NP_115667.2	Q9BQI5	SGIP1_HUMAN	SH3-domain GRB2-like (endophilin) interacting protein 1	286	Pro-rich.				endocytosis (GO:0006897)|membrane tubulation (GO:0097320)|positive regulation of energy homeostasis (GO:2000507)|positive regulation of feeding behavior (GO:2000253)|positive regulation of receptor-mediated endocytosis (GO:0048260)|response to dietary excess (GO:0002021)	AP-2 adaptor complex (GO:0030122)|clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	microtubule binding (GO:0008017)|phospholipid binding (GO:0005543)|SH3 domain binding (GO:0017124)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(43)|ovary(4)|pancreas(1)|prostate(1)|skin(3)|stomach(1)	71						GAAAAACTACCATCCATCAAT	0.393																																																	0													116.0	115.0	115.0					1																	67147594		2203	4300	6503	SO:0001583	missense	0			AL136561	CCDS30744.1	1p31.3	2008-02-05			ENSG00000118473	ENSG00000118473			25412	protein-coding gene	gene with protein product		611540				11230166	Standard	NM_032291		Approved	DKFZp761D221	uc001dcr.3	Q9BQI5	OTTHUMG00000009161	ENST00000371037.4:c.857C>A	1.37:g.67147594C>A	ENSP00000360076:p.Pro286Gln		A6NL81|A6NLD1|Q4LE32|Q5VYE2|Q5VYE3|Q5VYE4|Q68D76|Q6MZY6|Q8IWC2	Missense_Mutation	SNP	pfam_Muniscin_C-term_mu_dom,pfam_Clathrin_mu_C,superfamily_Clathrin_mu_C	p.P290Q	ENST00000371037.4	37	c.869	CCDS30744.1	1	.	.	.	.	.	.	.	.	.	.	C	23.2	4.383575	0.82792	.	.	ENSG00000118473	ENST00000237247;ENST00000371038;ENST00000407289;ENST00000371037	T;T	0.02890	4.12;4.12	5.45	5.45	0.79879	.	0.181451	0.48767	D	0.000167	T	0.08537	0.0212	L	0.55481	1.735	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.83275	0.994;0.996	T	0.19679	-1.0298	10	0.48119	T	0.1	-9.4414	19.6597	0.95861	0.0:1.0:0.0:0.0	.	289;286	A6NEV3;Q9BQI5	.;SGIP1_HUMAN	Q	290;289;289;286	ENSP00000237247:P290Q;ENSP00000360076:P286Q	ENSP00000237247:P290Q	P	+	2	0	SGIP1	66920182	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.306000	0.78905	2.708000	0.92522	0.650000	0.86243	CCA	SGIP1	-	NULL	ENSG00000118473		0.393	SGIP1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SGIP1	HGNC	protein_coding	OTTHUMT00000025395.4	-	0.00	50	0	C	NM_032291		67147594	+1	tier1	-	no_errors	ENST00000237247	ensembl	human	known	74_37	missense	30.56	25	11	SNP	1.000	A
SIGLEC6	946	genome.wustl.edu	37	19	52032987	52032987	+	Missense_Mutation	SNP	A	A	G			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr19:52032987A>G	ENST00000425629.3	-	5	1157	c.1003T>C	c.(1003-1005)Ttt>Ctt	p.F335L	SIGLEC6_ENST00000474054.1_5'Flank|SIGLEC6_ENST00000359982.4_Missense_Mutation_p.F346L|SIGLEC6_ENST00000346477.3_Missense_Mutation_p.F319L|SIGLEC6_ENST00000436458.1_Missense_Mutation_p.F283L|SIGLEC6_ENST00000391797.3_Missense_Mutation_p.F324L|SIGLEC6_ENST00000343300.4_Missense_Mutation_p.F335L	NM_001245.5	NP_001236.4	O43699	SIGL6_HUMAN	sialic acid binding Ig-like lectin 6	335					cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)			endometrium(3)|kidney(1)|large_intestine(6)|liver(1)|lung(15)|ovary(1)|stomach(1)	28		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.00115)|OV - Ovarian serous cystadenocarcinoma(262;0.0165)		CAATGCACAAAGAGACTCAGA	0.582																																																	0													35.0	38.0	37.0					19																	52032987		2152	4275	6427	SO:0001583	missense	0			D86358	CCDS12834.3, CCDS12835.3, CCDS12836.3, CCDS54307.1, CCDS54308.1, CCDS59417.1	19q13.3	2013-01-29			ENSG00000105492	ENSG00000105492		"""Sialic acid binding Ig-like lectins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10875	protein-coding gene	gene with protein product		604405		CD33L, CD33L1		9465907	Standard	NM_001245		Approved	OB-BP1, SIGLEC-6, CD327	uc002pwy.3	O43699	OTTHUMG00000133571	ENST00000425629.3:c.1003T>C	19.37:g.52032987A>G	ENSP00000401502:p.Phe335Leu		A8MV71|B2RTS8|C9JBE5|F8WA78|O15388|O43700	Missense_Mutation	SNP	pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.F335L	ENST00000425629.3	37	c.1003	CCDS12834.3	19	.	.	.	.	.	.	.	.	.	.	A	0.331	-0.955971	0.02267	.	.	ENSG00000105492	ENST00000346477;ENST00000391797;ENST00000425629;ENST00000359982;ENST00000436458;ENST00000343300	T;T;T;T	0.66280	-0.2;-0.2;-0.2;-0.2	3.71	2.68	0.31781	Immunoglobulin I-set (1);Immunoglobulin-like fold (1);	0.191890	0.25732	N	0.028665	T	0.31796	0.0808	N	0.02721	-0.515	0.09310	N	1	B;B;B;B;B;B	0.15719	0.003;0.005;0.002;0.006;0.014;0.008	B;B;B;B;B;B	0.20577	0.01;0.013;0.01;0.008;0.018;0.03	T	0.15435	-1.0437	10	0.26408	T	0.33	.	5.645	0.17584	0.8712:0.0:0.1288:0.0	.	346;283;324;335;319;335	F8WA78;C9JBE5;O43699-4;O43699-2;O43699-3;O43699	.;.;.;.;.;SIGL6_HUMAN	L	308;319;335;346;283;335	ENSP00000401502:F335L;ENSP00000353071:F346L;ENSP00000410679:F283L;ENSP00000345907:F335L	ENSP00000345907:F335L	F	-	1	0	SIGLEC6	56724799	0.154000	0.22792	0.025000	0.17156	0.043000	0.13939	0.853000	0.27777	0.605000	0.29947	0.421000	0.28195	TTT	SIGLEC6	-	pfam_Ig_I-set,smart_Ig_sub	ENSG00000105492		0.582	SIGLEC6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SIGLEC6	HGNC	protein_coding	OTTHUMT00000257670.3	-	0.00	73	0	A	NM_001245		52032987	-1	tier1	-	no_errors	ENST00000425629	ensembl	human	known	74_37	missense	37.78	28	17	SNP	0.044	G
SLC12A7	10723	genome.wustl.edu	37	5	1079523	1079523	+	Silent	SNP	C	C	T			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr5:1079523C>T	ENST00000264930.5	-	10	1429	c.1386G>A	c.(1384-1386)acG>acA	p.T462T		NM_006598.2	NP_006589.2	Q9Y666	S12A7_HUMAN	solute carrier family 12 (potassium/chloride transporter), member 7	462					cell volume homeostasis (GO:0006884)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transport (GO:0006811)|potassium ion transport (GO:0006813)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	potassium:chloride symporter activity (GO:0015379)|protein kinase binding (GO:0019901)			breast(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(14)|ovary(2)|prostate(1)|skin(4)|urinary_tract(2)	32	Lung NSC(6;2.47e-13)|all_lung(6;1.67e-12)|all_epithelial(6;5.44e-09)		Epithelial(17;0.000497)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|all cancers(22;0.00241)|Lung(60;0.165)		Potassium Chloride(DB00761)	AGATGAAAGACGTCGTCACTA	0.627																																																	0													155.0	140.0	145.0					5																	1079523		2202	4300	6502	SO:0001819	synonymous_variant	0			AF105365	CCDS34129.1	5p15	2013-07-18	2013-07-18		ENSG00000113504	ENSG00000113504		"""Solute carriers"""	10915	protein-coding gene	gene with protein product		604879				10347194	Standard	NM_006598		Approved	KCC4, DKFZP434F076	uc003jbu.3	Q9Y666	OTTHUMG00000161931	ENST00000264930.5:c.1386G>A	5.37:g.1079523C>T			A6NDS8|Q4G0F3|Q96I81|Q9H7I3|Q9H7I7|Q9UFW2	Silent	SNP	pfam_AA-permease/SLC12A_dom,prints_KCL_cotranspt,tigrfam_Na/K/Cl_cotransptS	p.T462	ENST00000264930.5	37	c.1386	CCDS34129.1	5																																																																																			SLC12A7	-	pfam_AA-permease/SLC12A_dom,tigrfam_Na/K/Cl_cotransptS	ENSG00000113504		0.627	SLC12A7-001	KNOWN	non_canonical_TEC|basic|appris_principal|CCDS	protein_coding	SLC12A7	HGNC	protein_coding	OTTHUMT00000366446.2	-	0.00	38	0	C	NM_006598		1079523	-1	tier1	-	no_errors	ENST00000264930	ensembl	human	known	74_37	silent	11.11	64	8	SNP	0.949	T
SLC35E2B	728661	genome.wustl.edu	37	1	1601102	1601102	+	Splice_Site	DEL	C	C	-			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr1:1601102delC	ENST00000378662.1	-	8	1595		c.e8+1		SLC35E2B_ENST00000234800.6_Splice_Site|RP11-345P4.7_ENST00000596308.1_RNA			P0CK96	S352B_HUMAN	solute carrier family 35, member E2B							integral component of membrane (GO:0016021)				kidney(1)|lung(1)	2						CTGAAACCCACCGTAAAGAAA	0.642																																																	0													48.0	60.0	56.0					1																	1601102		692	1591	2283	SO:0001630	splice_region_variant	0				CCDS44041.1	1p36.33	2013-05-22			ENSG00000189339	ENSG00000189339		"""Solute carriers"""	33941	protein-coding gene	gene with protein product							Standard	XM_006710870		Approved		uc001ahg.4	P0CK96	OTTHUMG00000078639	ENST00000378662.1:c.834+1G>-	1.37:g.1601102delC			B3KWR0|O75035|Q2TAY8|Q569F8|Q5CZA4|Q9Y3J8	Splice_Site	DEL	-	e6+1	ENST00000378662.1	37	c.834+1	CCDS44041.1	1																																																																																			SLC35E2B	-	-	ENSG00000189339		0.642	SLC35E2B-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SLC35E2B	HGNC	protein_coding	OTTHUMT00000171589.1		0.00	54	0	C		Intron	1601102	-1	tier1		no_errors	ENST00000234800	ensembl	human	known	74_37	splice_site_del	21.43	33	9	DEL	1.000	-
SNX13	23161	genome.wustl.edu	37	7	17931220	17931220	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr7:17931220C>G	ENST00000409389.1	-	4	439	c.267G>C	c.(265-267)aaG>aaC	p.K89N	SNX13_ENST00000428135.3_Missense_Mutation_p.K89N|SNX13_ENST00000409604.1_Missense_Mutation_p.K89N			Q9Y5W8	SNX13_HUMAN	sorting nexin 13	89					intracellular protein transport (GO:0006886)|positive regulation of GTPase activity (GO:0043547)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	early endosome (GO:0005769)|membrane (GO:0016020)	phosphatidylinositol binding (GO:0035091)			breast(1)|central_nervous_system(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(10)|lung(13)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	38	Lung NSC(10;0.0261)|all_lung(11;0.0521)					TTCTATCAATCTTAATAGTCC	0.348																																																	0													100.0	95.0	97.0					7																	17931220		1819	4083	5902	SO:0001583	missense	0			AF420470	CCDS47551.1	7p21.1	2008-03-11			ENSG00000071189	ENSG00000071189		"""Sorting nexins"""	21335	protein-coding gene	gene with protein product		606589				11485546, 11729322	Standard	NM_015132		Approved	RGS-PX1, KIAA0713	uc003stv.3	Q9Y5W8	OTTHUMG00000152730	ENST00000409389.1:c.267G>C	7.37:g.17931220C>G	ENSP00000386705:p.Lys89Asn		B2RCI9|O94821|Q8WVZ2|Q8WXH8	Missense_Mutation	SNP	pfam_Phox_assoc,pfam_Sorting_nexin_C,pfam_Phox,pfam_RGS_dom,superfamily_Regulat_G_prot_signal_superfam,superfamily_Phox,superfamily_Cyt_c_oxidase_su5A/6,smart_PX_assoc_Snx13,smart_Regulat_G_prot_signal_superfam,smart_Phox,pfscan_Phox,pfscan_Phox_assoc,pfscan_Regulat_G_prot_signal_superfam	p.K89N	ENST00000409389.1	37	c.267		7	.	.	.	.	.	.	.	.	.	.	C	17.14	3.313359	0.60414	.	.	ENSG00000071189	ENST00000409389;ENST00000428135;ENST00000242044;ENST00000409604	T;T	0.19532	2.14;2.4	5.5	4.63	0.57726	.	0.000000	0.85682	D	0.000000	T	0.26919	0.0659	N	0.24115	0.695	0.80722	D	1	D;D;P;D	0.65815	0.981;0.995;0.934;0.991	P;P;P;P	0.58820	0.617;0.844;0.53;0.846	T	0.02345	-1.1173	10	0.29301	T	0.29	-11.3239	14.4078	0.67093	0.0:0.9287:0.0:0.0713	.	89;89;89;89	Q9NSH0;Q9Y5W8;B8ZZT9;Q9Y5W8-2	.;SNX13_HUMAN;.;.	N	89;89;137;89	ENSP00000386705:K89N;ENSP00000398789:K89N	ENSP00000242044:K137N	K	-	3	2	SNX13	17897745	1.000000	0.71417	1.000000	0.80357	0.496000	0.33645	3.513000	0.53414	1.329000	0.45376	0.650000	0.86243	AAG	SNX13	-	NULL	ENSG00000071189		0.348	SNX13-002	NOVEL	basic|exp_conf	protein_coding	SNX13	HGNC	protein_coding	OTTHUMT00000327608.1		0.00	12	0	C	NM_015132		17931220	-1			no_errors	ENST00000428135	ensembl	human	known	74_37	missense	18.75	13	3	SNP	1.000	G
SPATA31A6	389730	genome.wustl.edu	37	9	43628235	43628235	+	Missense_Mutation	SNP	G	G	A	rs199884594	byFrequency	TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr9:43628235G>A	ENST00000332857.6	-	4	480	c.452C>T	c.(451-453)cCg>cTg	p.P151L	SPATA31A6_ENST00000496386.1_5'UTR	NM_001145196.1	NP_001138668.1	Q5VVP1	S31A6_HUMAN	SPATA31 subfamily A, member 6	151	Pro-rich.				cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											GGAAGCTAACGGGGAGAGAAT	0.607													G|||	745	0.148762	0.1014	0.1729	5008	,	,		9168	0.1984		0.1471	False		,,,				2504	0.1462																0													1.0	1.0	1.0					9																	43628235		25	134	159	SO:0001583	missense	0				CCDS75837.1	9p11.2	2012-10-15	2012-10-12	2012-10-12	ENSG00000185775	ENSG00000185775			32006	protein-coding gene	gene with protein product			"""family with sequence similarity 75, member A6"""	FAM75A6		20850414	Standard	NM_001145196		Approved	OTTHUMG00000013224	uc011lrb.2	Q5VVP1	OTTHUMG00000013224	ENST00000332857.6:c.452C>T	9.37:g.43628235G>A	ENSP00000329825:p.Pro151Leu			Missense_Mutation	SNP	NULL	p.P151L	ENST00000332857.6	37	c.452	CCDS47973.1	9	.	.	.	.	.	.	.	.	.	.	g	3.315	-0.140074	0.06669	.	.	ENSG00000185775	ENST00000332857	T	0.04551	3.6	1.93	-0.328	0.12690	.	0.929591	0.08817	N	0.889351	T	0.04543	0.0124	M	0.67397	2.05	0.80722	P	0.0	P	0.38582	0.638	B	0.28991	0.097	T	0.40251	-0.9573	9	0.18710	T	0.47	.	4.1931	0.10430	0.5006:0.0:0.4994:0.0	.	151	Q5VVP1	F75A6_HUMAN	L	151	ENSP00000329825:P151L	ENSP00000329825:P151L	P	-	2	0	FAM75A6	43568231	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-1.634000	0.02020	-0.086000	0.12550	-0.558000	0.04189	CCG	SPATA31A6	-	NULL	ENSG00000185775		0.607	SPATA31A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPATA31A6	HGNC	protein_coding	OTTHUMT00000036987.1	-	0.00	18	0	G	NM_001145196		43628235	-1	tier1	rs199884594	no_errors	ENST00000332857	ensembl	human	known	74_37	missense	66.67	1	2	SNP	0.000	A
SRRM1	10250	genome.wustl.edu	37	1	24993374	24993374	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr1:24993374C>A	ENST00000323848.9	+	13	2012	c.1697C>A	c.(1696-1698)cCt>cAt	p.P566H	SRRM1_ENST00000374389.4_Missense_Mutation_p.P575H|SRRM1_ENST00000447431.2_Missense_Mutation_p.P578H|SRRM1_ENST00000479034.1_3'UTR|snoU13_ENST00000459464.1_RNA|SRRM1_ENST00000537199.1_3'UTR	NM_005839.3	NP_005830.2	Q8IYB3	SRRM1_HUMAN	serine/arginine repetitive matrix 1	566	Arg-rich.|Necessary for speckles and matrix localization.|Pro-rich.|Ser-rich.				gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	catalytic step 2 spliceosome (GO:0071013)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)	p.P566H(2)		breast(1)|central_nervous_system(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(12)|lung(9)|ovary(2)|prostate(1)|urinary_tract(2)	36		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.000946)|all_lung(284;0.00125)|Ovarian(437;0.00764)|Breast(348;0.0148)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.19)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0422)|OV - Ovarian serous cystadenocarcinoma(117;1.01e-24)|Colorectal(126;5.95e-08)|COAD - Colon adenocarcinoma(152;3.24e-06)|GBM - Glioblastoma multiforme(114;0.000148)|BRCA - Breast invasive adenocarcinoma(304;0.00177)|KIRC - Kidney renal clear cell carcinoma(1967;0.00348)|STAD - Stomach adenocarcinoma(196;0.00483)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.138)		CCCGCCCCTCCTCCTCGACGG	0.542																																					Ovarian(68;897 1494 3282 17478)												2	Substitution - Missense(2)	urinary_tract(1)|central_nervous_system(1)											53.0	45.0	48.0					1																	24993374		2203	4300	6503	SO:0001583	missense	0			AF048977	CCDS255.1	1p36	2010-04-22			ENSG00000133226	ENSG00000133226			16638	protein-coding gene	gene with protein product	"""Ser/Arg-related nuclear matrix protein"", ""plenty of prolines 101-like"""	605975				9531537	Standard	NM_005839		Approved	SRM160, POP101, MGC39488	uc001bjm.3	Q8IYB3	OTTHUMG00000003320	ENST00000323848.9:c.1697C>A	1.37:g.24993374C>A	ENSP00000326261:p.Pro566His		O60585|Q5VVN4	Missense_Mutation	SNP	pfam_PWI_dom,superfamily_PWI_dom,smart_PWI_dom	p.P578H	ENST00000323848.9	37	c.1733	CCDS255.1	1	.	.	.	.	.	.	.	.	.	.	C	21.6	4.173271	0.78452	.	.	ENSG00000133226	ENST00000323848;ENST00000447431;ENST00000374389	T;T;T	0.56776	0.44;0.65;0.71	5.66	5.66	0.87406	.	0.000000	0.64402	D	0.000007	T	0.70613	0.3244	L	0.58101	1.795	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.996	T	0.68074	-0.5505	10	0.42905	T	0.14	-3.0627	19.3453	0.94361	0.0:1.0:0.0:0.0	.	578;566	E9PCT1;Q8IYB3	.;SRRM1_HUMAN	H	566;578;575	ENSP00000326261:P566H;ENSP00000391430:P578H;ENSP00000363510:P575H	ENSP00000326261:P566H	P	+	2	0	SRRM1	24865961	1.000000	0.71417	1.000000	0.80357	0.909000	0.53808	4.865000	0.62998	2.654000	0.90174	0.650000	0.86243	CCT	SRRM1	-	NULL	ENSG00000133226		0.542	SRRM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRRM1	HGNC	protein_coding	OTTHUMT00000009292.2		0.00	53	0	C	NM_005839		24993374	+1			no_errors	ENST00000447431	ensembl	human	known	74_37	missense	5.17	55	3	SNP	1.000	A
SRRM1	10250	genome.wustl.edu	37	1	24993386	24993386	+	Missense_Mutation	SNP	G	G	T	rs78787676		TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr1:24993386G>T	ENST00000323848.9	+	13	2024	c.1709G>T	c.(1708-1710)cGc>cTc	p.R570L	SRRM1_ENST00000374389.4_Missense_Mutation_p.R579L|SRRM1_ENST00000447431.2_Missense_Mutation_p.R582L|SRRM1_ENST00000479034.1_3'UTR|snoU13_ENST00000459464.1_RNA|SRRM1_ENST00000537199.1_3'UTR	NM_005839.3	NP_005830.2	Q8IYB3	SRRM1_HUMAN	serine/arginine repetitive matrix 1	570	Arg-rich.|Necessary for speckles and matrix localization.|Pro-rich.|Ser-rich.				gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	catalytic step 2 spliceosome (GO:0071013)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)	p.R570L(2)		breast(1)|central_nervous_system(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(12)|lung(9)|ovary(2)|prostate(1)|urinary_tract(2)	36		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.000946)|all_lung(284;0.00125)|Ovarian(437;0.00764)|Breast(348;0.0148)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.19)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0422)|OV - Ovarian serous cystadenocarcinoma(117;1.01e-24)|Colorectal(126;5.95e-08)|COAD - Colon adenocarcinoma(152;3.24e-06)|GBM - Glioblastoma multiforme(114;0.000148)|BRCA - Breast invasive adenocarcinoma(304;0.00177)|KIRC - Kidney renal clear cell carcinoma(1967;0.00348)|STAD - Stomach adenocarcinoma(196;0.00483)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.138)		CCTCGACGGCGCAGGACTCCC	0.557																																					Ovarian(68;897 1494 3282 17478)												2	Substitution - Missense(2)	urinary_tract(1)|central_nervous_system(1)											54.0	45.0	48.0					1																	24993386		2203	4300	6503	SO:0001583	missense	0			AF048977	CCDS255.1	1p36	2010-04-22			ENSG00000133226	ENSG00000133226			16638	protein-coding gene	gene with protein product	"""Ser/Arg-related nuclear matrix protein"", ""plenty of prolines 101-like"""	605975				9531537	Standard	NM_005839		Approved	SRM160, POP101, MGC39488	uc001bjm.3	Q8IYB3	OTTHUMG00000003320	ENST00000323848.9:c.1709G>T	1.37:g.24993386G>T	ENSP00000326261:p.Arg570Leu		O60585|Q5VVN4	Missense_Mutation	SNP	pfam_PWI_dom,superfamily_PWI_dom,smart_PWI_dom	p.R582L	ENST00000323848.9	37	c.1745	CCDS255.1	1	.	.	.	.	.	.	.	.	.	.	G	26.0	4.693027	0.88735	.	.	ENSG00000133226	ENST00000323848;ENST00000447431;ENST00000374389	T;T;T	0.34667	1.35;1.35;1.35	5.66	5.66	0.87406	.	0.000000	0.64402	D	0.000007	T	0.58104	0.2099	L	0.54323	1.7	0.80722	D	1	D;D	0.67145	0.996;0.993	D;D	0.76575	0.988;0.972	T	0.57318	-0.7832	10	0.62326	D	0.03	-1.2563	19.3453	0.94361	0.0:0.0:1.0:0.0	.	582;570	E9PCT1;Q8IYB3	.;SRRM1_HUMAN	L	570;582;579	ENSP00000326261:R570L;ENSP00000391430:R582L;ENSP00000363510:R579L	ENSP00000326261:R570L	R	+	2	0	SRRM1	24865973	1.000000	0.71417	1.000000	0.80357	0.917000	0.54804	7.773000	0.85462	2.654000	0.90174	0.650000	0.86243	CGC	SRRM1	-	NULL	ENSG00000133226		0.557	SRRM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRRM1	HGNC	protein_coding	OTTHUMT00000009292.2		0.00	51	0	G	NM_005839		24993386	+1			no_errors	ENST00000447431	ensembl	human	known	74_37	missense	6.12	46	3	SNP	1.000	T
SSPN	8082	genome.wustl.edu	37	12	26383707	26383707	+	Frame_Shift_Del	DEL	G	G	-	rs374423870		TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr12:26383707delG	ENST00000242729.2	+	3	607	c.430delG	c.(430-432)gccfs	p.A144fs	RP11-283G6.5_ENST00000537525.1_RNA|SSPN_ENST00000422622.2_Frame_Shift_Del_p.A41fs|RP11-283G6.5_ENST00000541940.1_RNA|RP11-283G6.4_ENST00000540392.1_RNA|SSPN_ENST00000535504.1_Intron|SSPN_ENST00000540266.1_Frame_Shift_Del_p.A41fs|RP11-283G6.5_ENST00000540625.1_RNA	NM_005086.4	NP_005077.2	Q14714	SSPN_HUMAN	sarcospan	144					cell adhesion (GO:0007155)|muscle contraction (GO:0006936)	cell junction (GO:0030054)|dystrophin-associated glycoprotein complex (GO:0016010)|integral component of plasma membrane (GO:0005887)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|transport vesicle (GO:0030133)				kidney(1)|large_intestine(2)|lung(5)|skin(1)|stomach(1)	10	Colorectal(261;0.0847)					GGCCTTTGCCGCCCACCACTA	0.547																																																	0													91.0	85.0	87.0					12																	26383707		2203	4300	6503	SO:0001589	frameshift_variant	0			AF016028	CCDS8707.1, CCDS44850.1	12p11.2	2014-09-17	2012-03-14			ENSG00000123096			11322	protein-coding gene	gene with protein product		601599	"""Kras oncogene-associated gene"""	KRAG		9395445, 8661122	Standard	NM_005086		Approved	SPN1, SPN2	uc001rhe.3	Q14714		ENST00000242729.2:c.430delG	12.37:g.26383707delG	ENSP00000242729:p.Ala144fs		B3KS67	Frame_Shift_Del	DEL	pfam_CD20-like	p.A144fs	ENST00000242729.2	37	c.430	CCDS8707.1	12																																																																																			SSPN	-	pfam_CD20-like	ENSG00000123096		0.547	SSPN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SSPN	HGNC	protein_coding	OTTHUMT00000402654.2		0.00	36	0	G	NM_005086		26383707	+1	tier1		no_errors	ENST00000242729	ensembl	human	known	74_37	frame_shift_del	19.61	41	10	DEL	0.998	-
STK17B	9262	genome.wustl.edu	37	2	197010768	197010768	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr2:197010768C>T	ENST00000263955.4	-	4	633	c.347G>A	c.(346-348)gGa>gAa	p.G116E	STK17B_ENST00000409228.1_Missense_Mutation_p.G116E	NM_004226.3	NP_004217.1	O94768	ST17B_HUMAN	serine/threonine kinase 17b	116	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|intracellular signal transduction (GO:0035556)|positive regulation of fibroblast apoptotic process (GO:2000271)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	actin cytoskeleton (GO:0015629)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|cervix(1)|kidney(2)|large_intestine(1)|lung(10)	15			OV - Ovarian serous cystadenocarcinoma(117;0.141)			GAAAATTTCTCCACCTGCAGC	0.313																																																	0													53.0	51.0	51.0					2																	197010768		2203	4300	6503	SO:0001583	missense	0			AB011421	CCDS2315.1	2q33.1	2008-02-05	2007-02-12		ENSG00000081320	ENSG00000081320			11396	protein-coding gene	gene with protein product	"""death-associated protein kinase-related 2"""	604727	"""serine/threonine kinase 17b (apoptosis-inducing)"""			9786912	Standard	NM_004226		Approved	DRAK2	uc002utk.3	O94768	OTTHUMG00000132735	ENST00000263955.4:c.347G>A	2.37:g.197010768C>T	ENSP00000263955:p.Gly116Glu			Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.G116E	ENST00000263955.4	37	c.347	CCDS2315.1	2	.	.	.	.	.	.	.	.	.	.	C	25.5	4.647176	0.87958	.	.	ENSG00000081320	ENST00000263955;ENST00000409228	T;T	0.61274	0.12;0.12	4.79	4.79	0.61399	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.48767	D	0.000166	T	0.80555	0.4645	M	0.88181	2.935	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.84515	0.0624	10	0.87932	D	0	.	18.3895	0.90477	0.0:1.0:0.0:0.0	.	116	O94768	ST17B_HUMAN	E	116	ENSP00000263955:G116E;ENSP00000386853:G116E	ENSP00000263955:G116E	G	-	2	0	STK17B	196719013	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.179000	0.77665	2.661000	0.90470	0.655000	0.94253	GGA	STK17B	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000081320		0.313	STK17B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STK17B	HGNC	protein_coding	OTTHUMT00000256092.2	-	0.00	29	0	C			197010768	-1	tier1	-	no_errors	ENST00000263955	ensembl	human	known	74_37	missense	33.33	14	7	SNP	1.000	T
STX17	55014	genome.wustl.edu	37	9	102713526	102713526	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr9:102713526C>G	ENST00000259400.6	+	4	510	c.374C>G	c.(373-375)aCt>aGt	p.T125S	STX17_ENST00000534052.1_Missense_Mutation_p.T125S|STX17_ENST00000525640.1_Missense_Mutation_p.T125S|STX17_ENST00000525847.1_3'UTR	NM_017919.2	NP_060389.2	P56962	STX17_HUMAN	syntaxin 17	125					autophagic vacuole fusion (GO:0000046)|endoplasmic reticulum-Golgi intermediate compartment organization (GO:0097111)|ER to Golgi vesicle-mediated transport (GO:0006888)|exocytosis (GO:0006887)|Golgi organization (GO:0007030)|intracellular protein transport (GO:0006886)|protein localization to pre-autophagosomal structure (GO:0034497)	autophagic vacuole membrane (GO:0000421)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|ER to Golgi transport vesicle (GO:0030134)|ER-mitochondrion membrane contact site (GO:0044233)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|smooth endoplasmic reticulum membrane (GO:0030868)|SNARE complex (GO:0031201)	protein phosphatase binding (GO:0019903)|SNAP receptor activity (GO:0005484)|SNARE binding (GO:0000149)			endometrium(2)|large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)	7		Acute lymphoblastic leukemia(62;0.0559)|all_hematologic(171;0.189)				GATGAAGAAACTTTGCTACAG	0.383																																																	0													110.0	107.0	108.0					9																	102713526		2203	4299	6502	SO:0001583	missense	0			AL834371	CCDS6745.1	9q31.1	2008-02-05			ENSG00000136874	ENSG00000136874			11432	protein-coding gene	gene with protein product		604204				9852078	Standard	NM_017919		Approved	FLJ20651	uc004bal.4	P56962	OTTHUMG00000020359	ENST00000259400.6:c.374C>G	9.37:g.102713526C>G	ENSP00000259400:p.Thr125Ser		Q4VXC2	Missense_Mutation	SNP	pfam_T_SNARE_dom,superfamily_t-SNARE,smart_T_SNARE_dom,pfscan_T_SNARE_dom	p.T125S	ENST00000259400.6	37	c.374	CCDS6745.1	9	.	.	.	.	.	.	.	.	.	.	C	2.334	-0.352654	0.05173	.	.	ENSG00000136874	ENST00000259400;ENST00000525640;ENST00000534052	T;T;T	0.21734	1.99;1.99;1.99	5.37	2.52	0.30459	t-SNARE (1);	0.406811	0.26963	N	0.021612	T	0.05823	0.0152	N	0.02011	-0.69	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.0;0.001	T	0.39187	-0.9626	10	0.09590	T	0.72	-0.2573	4.8957	0.13749	0.1499:0.6241:0.1447:0.0813	.	125;125	P56962;B4DJ69	STX17_HUMAN;.	S	125	ENSP00000259400:T125S;ENSP00000435981:T125S;ENSP00000433484:T125S	ENSP00000259400:T125S	T	+	2	0	STX17	101753347	0.033000	0.19621	0.091000	0.20842	0.521000	0.34408	0.662000	0.25038	0.231000	0.21079	-2.673000	0.00144	ACT	STX17	-	superfamily_t-SNARE	ENSG00000136874		0.383	STX17-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	STX17	HGNC	protein_coding	OTTHUMT00000053398.3	-	0.00	63	0	C	NM_017919		102713526	+1	tier1	-	no_errors	ENST00000259400	ensembl	human	known	74_37	missense	24.53	39	13	SNP	0.052	G
SYNE2	23224	genome.wustl.edu	37	14	64588838	64588838	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr14:64588838G>A	ENST00000344113.4	+	69	13479	c.13267G>A	c.(13267-13269)Gaa>Aaa	p.E4423K	SYNE2_ENST00000358025.3_Missense_Mutation_p.E4423K|ESR2_ENST00000542956.1_Intron|SYNE2_ENST00000555002.1_Missense_Mutation_p.E1057K|SYNE2_ENST00000357395.3_Missense_Mutation_p.E808K|SYNE2_ENST00000394768.2_Missense_Mutation_p.E808K|SYNE2_ENST00000554584.1_Missense_Mutation_p.E4438K|SYNE2_ENST00000553455.1_Missense_Mutation_p.E142K	NM_015180.4	NP_055995.4	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	4423					centrosome localization (GO:0051642)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment or maintenance of cell polarity (GO:0007163)|fibroblast migration (GO:0010761)|nuclear envelope organization (GO:0006998)|nuclear migration (GO:0007097)|nuclear migration along microfilament (GO:0031022)|positive regulation of cell migration (GO:0030335)|protein localization to nucleus (GO:0034504)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intermediate filament cytoskeleton (GO:0045111)|lamellipodium membrane (GO:0031258)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)|SUN-KASH complex (GO:0034993)|Z disc (GO:0030018)	actin binding (GO:0003779)			NS(5)|breast(17)|central_nervous_system(3)|cervix(8)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(21)|large_intestine(34)|lung(75)|ovary(10)|pancreas(2)|prostate(8)|skin(8)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(4)	224				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		TACAACTCAGGAATCATCTGC	0.323																																																	0													86.0	88.0	87.0					14																	64588838		2203	4300	6503	SO:0001583	missense	0			AB023228	CCDS9761.2, CCDS41963.1, CCDS45124.1, CCDS45125.1	14q22.1-q22.3	2014-09-17			ENSG00000054654	ENSG00000054654			17084	protein-coding gene	gene with protein product	"""nuclear envelope spectrin repeat-2"", ""nucleus and actin connecting element"""	608442				10231032, 10878022	Standard	NM_182910		Approved	SYNE-2, DKFZP434H2235, Nesprin-2, NUANCE, NUA, KIAA1011, Nesp2	uc001xgl.3	Q8WXH0	OTTHUMG00000140349	ENST00000344113.4:c.13267G>A	14.37:g.64588838G>A	ENSP00000341781:p.Glu4423Lys		Q540G1|Q8N1S3|Q8NF49|Q8TER7|Q8WWW3|Q8WWW4|Q8WWW5|Q8WXH1|Q9NU50|Q9UFQ4|Q9Y2L4|Q9Y4R1	Missense_Mutation	SNP	pfam_CH-domain,pfam_KASH,pfam_Spectrin_repeat,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,smart_Spectrin/alpha-actinin,pfscan_CH-domain,pfscan_KASH	p.E4423K	ENST00000344113.4	37	c.13267	CCDS41963.1	14	.	.	.	.	.	.	.	.	.	.	G	13.82	2.352631	0.41700	.	.	ENSG00000054654	ENST00000358025;ENST00000357395;ENST00000344113;ENST00000554584;ENST00000261678;ENST00000555002;ENST00000394768;ENST00000553455	T;T;T;T;T;T	0.56275	0.79;4.08;0.79;0.47;4.13;4.08	4.84	0.508	0.16972	.	0.823715	0.10640	N	0.651126	T	0.20941	0.0504	N	0.03324	-0.35	0.54753	D	0.999981	B;B;B	0.06786	0.0;0.001;0.0	B;B;B	0.10450	0.005;0.001;0.003	T	0.35500	-0.9786	10	0.05833	T	0.94	.	4.0956	0.09990	0.3268:0.1767:0.4965:0.0	.	808;4423;4423	Q8WXH0-7;Q8WXH0;Q8WXH0-2	.;SYNE2_HUMAN;.	K	4423;808;4423;4438;4438;1057;808;142	ENSP00000350719:E4423K;ENSP00000349969:E808K;ENSP00000341781:E4423K;ENSP00000452570:E4438K;ENSP00000450831:E1057K;ENSP00000378249:E808K	ENSP00000261678:E4438K	E	+	1	0	SYNE2	63658591	0.033000	0.19621	0.342000	0.25602	0.654000	0.38779	-0.014000	0.12656	0.109000	0.17891	0.650000	0.86243	GAA	SYNE2	-	NULL	ENSG00000054654		0.323	SYNE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYNE2	HGNC	protein_coding	OTTHUMT00000276994.2	-	0.00	39	0	G	NM_182914		64588838	+1	tier1	-	no_errors	ENST00000358025	ensembl	human	known	74_37	missense	30.56	25	11	SNP	0.854	A
TBC1D32	221322	genome.wustl.edu	37	6	121481218	121481218	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr6:121481218G>A	ENST00000398212.2	-	24	2760	c.2711C>T	c.(2710-2712)tCa>tTa	p.S904L	TBC1D32_ENST00000398197.2_5'UTR|TBC1D32_ENST00000275159.6_Missense_Mutation_p.S945L	NM_152730.4	NP_689943.4	Q96NH3	BROMI_HUMAN	TBC1 domain family, member 32	904					cilium morphogenesis (GO:0060271)|embryonic digit morphogenesis (GO:0042733)|lens development in camera-type eye (GO:0002088)|protein localization to cilium (GO:0061512)|retinal pigment epithelium development (GO:0003406)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)	cilium (GO:0005929)|cytoplasm (GO:0005737)	Rab GTPase activator activity (GO:0005097)										TGGATATGATGAAAACATTGG	0.303																																																	0													115.0	109.0	111.0					6																	121481218		1817	4082	5899	SO:0001583	missense	0			AK055461	CCDS43501.1	6q22.31	2014-02-20	2013-07-10	2013-07-10	ENSG00000146350	ENSG00000146350			21485	protein-coding gene	gene with protein product	"""broad-minded homolog"""	615867	"""chromosome 6 open reading frame 171"", ""chromosome 6 open reading frame 170"""	C6orf171, C6orf170		20159594, 24285566	Standard	NM_152730		Approved	FLJ30899, dJ310J6.1, FLJ34235, bA57L9.1, BROMI	uc003pyo.1	Q96NH3	OTTHUMG00000015474	ENST00000398212.2:c.2711C>T	6.37:g.121481218G>A	ENSP00000381270:p.Ser904Leu		Q5SZD6|Q5SZM6|Q6ZMY4|Q6ZUR7|Q8NB47	Missense_Mutation	SNP	superfamily_Rab-GTPase-TBC_dom	p.S945L	ENST00000398212.2	37	c.2834	CCDS43501.1	6	.	.	.	.	.	.	.	.	.	.	G	18.59	3.657172	0.67586	.	.	ENSG00000146350	ENST00000275159;ENST00000398212	T;T	0.25085	1.82;1.82	5.03	5.03	0.67393	.	0.134415	0.52532	D	0.000075	T	0.25419	0.0618	M	0.71581	2.175	0.54753	D	0.999985	P;P	0.38827	0.649;0.576	B;B	0.40066	0.273;0.318	T	0.13818	-1.0495	10	0.72032	D	0.01	.	18.7188	0.91686	0.0:0.0:1.0:0.0	.	945;904	Q96NH3-4;Q96NH3	.;BROMI_HUMAN	L	945;904	ENSP00000275159:S945L;ENSP00000381270:S904L	ENSP00000275159:S945L	S	-	2	0	C6orf170	121522917	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	7.274000	0.78538	2.479000	0.83701	0.460000	0.39030	TCA	TBC1D32	-	NULL	ENSG00000146350		0.303	TBC1D32-005	PUTATIVE	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	TBC1D32	HGNC	protein_coding	OTTHUMT00000380937.2	-	0.00	45	0	G	NM_152730		121481218	-1	tier1	-	no_errors	ENST00000275159	ensembl	human	putative	74_37	missense	52.00	12	13	SNP	1.000	A
TAGAP	117289	genome.wustl.edu	37	6	159459233	159459233	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr6:159459233C>A	ENST00000367066.3	-	9	1142	c.811G>T	c.(811-813)Gat>Tat	p.D271Y	TAGAP_ENST00000326965.6_Missense_Mutation_p.D93Y|RP1-111C20.4_ENST00000606466.1_RNA|RP1-111C20.4_ENST00000607391.1_RNA|RP1-111C20.4_ENST00000607796.1_RNA|RP1-111C20.4_ENST00000606470.1_RNA	NM_001278733.1|NM_054114.3	NP_001265662.1|NP_473455.2	Q8N103	TAGAP_HUMAN	T-cell activation RhoGTPase activating protein	271	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	guanyl-nucleotide exchange factor activity (GO:0005085)			NS(1)|autonomic_ganglia(1)|endometrium(3)|large_intestine(8)|lung(7)|ovary(2)|skin(1)	23		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;2.16e-16)|BRCA - Breast invasive adenocarcinoma(81;5.87e-06)		AAGCAGTTATCAATGAGGAAT	0.398																																																	0													122.0	115.0	117.0					6																	159459233		2203	4300	6503	SO:0001583	missense	0			AF385429	CCDS5261.1, CCDS5262.1, CCDS5263.1	6q25.3	2011-09-07	2008-03-25		ENSG00000164691	ENSG00000164691		"""Rho GTPase activating proteins"""	15669	protein-coding gene	gene with protein product		609667	"""T-cell activation GTPase activating protein"""			16375659, 18311140, 18356936	Standard	NM_152133		Approved	FLJ32631, IDDM21, ARHGAP47	uc003qrz.3	Q8N103	OTTHUMG00000015923	ENST00000367066.3:c.811G>T	6.37:g.159459233C>A	ENSP00000356033:p.Asp271Tyr		Q2NKM8|Q8NI40|Q96KZ2|Q96QA2	Missense_Mutation	SNP	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	p.D271Y	ENST00000367066.3	37	c.811	CCDS5261.1	6	.	.	.	.	.	.	.	.	.	.	C	22.2	4.251616	0.80135	.	.	ENSG00000164691	ENST00000367066;ENST00000326965	T;T	0.23950	1.88;1.88	6.17	6.17	0.99709	Rho GTPase-activating protein domain (3);Rho GTPase activation protein (1);	0.134503	0.50627	D	0.000114	T	0.43656	0.1257	M	0.74881	2.28	0.80722	D	1	D	0.89917	1.0	D	0.70227	0.968	T	0.33854	-0.9852	10	0.87932	D	0	-23.6641	14.6223	0.68594	0.0:0.9304:0.0:0.0696	.	271	Q8N103	TAGAP_HUMAN	Y	271;93	ENSP00000356033:D271Y;ENSP00000322650:D93Y	ENSP00000322650:D93Y	D	-	1	0	TAGAP	159379221	1.000000	0.71417	0.509000	0.27700	0.957000	0.61999	3.707000	0.54838	2.941000	0.99782	0.655000	0.94253	GAT	TAGAP	-	superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	ENSG00000164691		0.398	TAGAP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TAGAP	HGNC	protein_coding	OTTHUMT00000042890.1		0.00	31	0	C	NM_054114		159459233	-1			no_errors	ENST00000367066	ensembl	human	known	74_37	missense	8.70	21	2	SNP	0.465	A
TIGD3	220359	genome.wustl.edu	37	11	65124656	65124656	+	Silent	SNP	C	C	T			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr11:65124656C>T	ENST00000309880.5	+	2	1584	c.1377C>T	c.(1375-1377)taC>taT	p.Y459Y		NM_145719.2	NP_663771.1	Q6B0B8	TIGD3_HUMAN	tigger transposable element derived 3	459						nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(3)|large_intestine(1)|lung(9)|prostate(2)|skin(2)	17						AAAAATTCTACGACTGTGAGG	0.567																																																	0													46.0	49.0	48.0					11																	65124656		2201	4297	6498	SO:0001819	synonymous_variant	0				CCDS8101.1	11q13.1	2008-07-21				ENSG00000173825			18334	protein-coding gene	gene with protein product							Standard	NM_145719		Approved		uc001odo.4	Q6B0B8		ENST00000309880.5:c.1377C>T	11.37:g.65124656C>T				Silent	SNP	pfam_HTH_CenpB_DNA-bd_dom,pfam_DDE_SF_endonuclease_CENPB-like,pfam_HTH_Psq,superfamily_Homeodomain-like,smart_HTH_CenpB_DNA-bd_dom,pfscan_HTH_Psq	p.Y459	ENST00000309880.5	37	c.1377	CCDS8101.1	11																																																																																			TIGD3	-	NULL	ENSG00000173825		0.567	TIGD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TIGD3	HGNC	protein_coding	OTTHUMT00000387310.1	-	0.00	57	0	C	NM_145719		65124656	+1	tier1	-	no_errors	ENST00000309880	ensembl	human	known	74_37	silent	20.00	32	8	SNP	0.939	T
TLL2	7093	genome.wustl.edu	37	10	98136519	98136519	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr10:98136519G>T	ENST00000357947.3	-	18	2603	c.2378C>A	c.(2377-2379)cCt>cAt	p.P793H		NM_012465.3	NP_036597.1	Q9Y6L7	TLL2_HUMAN	tolloid-like 2	793	CUB 4. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cell differentiation (GO:0030154)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)	extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(15)|lung(22)|ovary(1)|pancreas(1)|prostate(1)|skin(3)	58		Colorectal(252;0.0846)		Epithelial(162;1.51e-07)|all cancers(201;7.59e-06)		GTATTTGTCAGGCCAGTTGGG	0.537																																																	0													76.0	76.0	76.0					10																	98136519		2203	4300	6503	SO:0001583	missense	0			AF059516	CCDS7449.1	10q23-q24	2008-07-29			ENSG00000095587	ENSG00000095587			11844	protein-coding gene	gene with protein product		606743				10516436	Standard	NM_012465		Approved		uc001kml.2	Q9Y6L7	OTTHUMG00000018833	ENST00000357947.3:c.2378C>A	10.37:g.98136519G>T	ENSP00000350630:p.Pro793His		A6NDK0|Q2M1H1|Q6PJN5|Q9UQ00	Missense_Mutation	SNP	pirsf_BMP_1/tolloid-like,pfam_CUB_dom,pfam_Peptidase_M12A,pfam_EGF-like_Ca-bd_dom,superfamily_CUB_dom,smart_Peptidase_Metallo,smart_CUB_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,prints_Peptidase_M12A,pfscan_CUB_dom,pfscan_EG-like_dom	p.P793H	ENST00000357947.3	37	c.2378	CCDS7449.1	10	.	.	.	.	.	.	.	.	.	.	G	29.7	5.032162	0.93575	.	.	ENSG00000095587	ENST00000357947	T	0.66099	-0.19	4.98	4.98	0.66077	CUB (5);	0.000000	0.45361	D	0.000366	D	0.89065	0.6609	H	0.99689	4.705	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.93764	0.7069	10	0.87932	D	0	.	17.7923	0.88558	0.0:0.0:1.0:0.0	.	793	Q9Y6L7	TLL2_HUMAN	H	793	ENSP00000350630:P793H	ENSP00000350630:P793H	P	-	2	0	TLL2	98126509	1.000000	0.71417	0.997000	0.53966	0.986000	0.74619	9.601000	0.98297	2.746000	0.94184	0.655000	0.94253	CCT	TLL2	-	pirsf_BMP_1/tolloid-like,pfam_CUB_dom,superfamily_CUB_dom,smart_CUB_dom,pfscan_CUB_dom	ENSG00000095587		0.537	TLL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TLL2	HGNC	protein_coding	OTTHUMT00000049608.1	-	0.00	72	0	G			98136519	-1	tier1	-	no_errors	ENST00000357947	ensembl	human	known	74_37	missense	51.85	26	28	SNP	1.000	T
TMEM70	54968	genome.wustl.edu	37	8	74891032	74891032	+	Silent	SNP	G	G	T			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr8:74891032G>T	ENST00000312184.5	+	2	325	c.252G>T	c.(250-252)acG>acT	p.T84T	TMEM70_ENST00000517439.1_Silent_p.T84T|Y_RNA_ENST00000365350.1_RNA	NM_001040613.2|NM_017866.5	NP_001035703.1|NP_060336.3	Q9BUB7	TMM70_HUMAN	transmembrane protein 70	84					mitochondrial proton-transporting ATP synthase complex assembly (GO:0033615)	integral component of mitochondrial membrane (GO:0032592)|mitochondrial inner membrane (GO:0005743)				breast(1)|kidney(1)|large_intestine(2)|lung(1)|ovary(2)|skin(1)	8	Breast(64;0.0311)		Epithelial(68;0.0186)|BRCA - Breast invasive adenocarcinoma(89;0.0499)|all cancers(69;0.0564)			TCTTAAATACGCCATCTGACA	0.353																																																	0													139.0	147.0	144.0					8																	74891032		2203	4300	6503	SO:0001819	synonymous_variant	0			BC002748	CCDS6215.1, CCDS47876.1	8q21.11	2013-05-23				ENSG00000175606			26050	protein-coding gene	gene with protein product		612418				21945727, 22986587	Standard	NM_017866		Approved	FLJ20533	uc003yab.3	Q9BUB7		ENST00000312184.5:c.252G>T	8.37:g.74891032G>T			E9PDY9|Q9NWY5	Silent	SNP	pfam_DUF1301_TMEM70	p.T84	ENST00000312184.5	37	c.252	CCDS6215.1	8																																																																																			TMEM70	-	NULL	ENSG00000175606		0.353	TMEM70-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM70	HGNC	protein_coding	OTTHUMT00000379028.1	-	0.00	74	0	G	NM_017866		74891032	+1	tier1	-	no_errors	ENST00000312184	ensembl	human	known	74_37	silent	7.27	51	4	SNP	0.406	T
TOM1	10043	genome.wustl.edu	37	22	35734728	35734728	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr22:35734728G>T	ENST00000449058.2	+	12	1296	c.1171G>T	c.(1171-1173)Gca>Tca	p.A391S	TOM1_ENST00000436462.2_Missense_Mutation_p.A353S|MIR3909_ENST00000579518.1_RNA|TOM1_ENST00000447733.1_Missense_Mutation_p.A358S|TOM1_ENST00000411850.1_Missense_Mutation_p.A391S|TOM1_ENST00000382034.5_3'UTR|TOM1_ENST00000425375.1_Missense_Mutation_p.A346S	NM_005488.2	NP_005479.1	O60784	TOM1_HUMAN	target of myb1 (chicken)	391					endocytosis (GO:0006897)|endosomal transport (GO:0016197)|intracellular protein transport (GO:0006886)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	clathrin binding (GO:0030276)			NS(1)|breast(2)|kidney(2)|large_intestine(2)|lung(7)|ovary(3)|prostate(2)	19						AGCCCCCCAAGCAACAGACGG	0.647																																																	0													34.0	27.0	29.0					22																	35734728		2192	4297	6489	SO:0001583	missense	0			AJ006973	CCDS13913.1, CCDS46696.1, CCDS46697.1, CCDS46698.1	22q13.1	2011-01-31	2001-11-28		ENSG00000100284	ENSG00000100284			11982	protein-coding gene	gene with protein product		604700	"""target of myb1 (chicken) homolog"""			10329004, 15047686	Standard	NM_005488		Approved		uc003anp.3	O60784	OTTHUMG00000150958	ENST00000449058.2:c.1171G>T	22.37:g.35734728G>T	ENSP00000394466:p.Ala391Ser		B4DEL9|B4DNA1|Q5TIJ6|Q86X74	Missense_Mutation	SNP	pfam_VHS,pfam_GAT,superfamily_ENTH_VHS,smart_VHS_subgr,pirsf_TOM1,pfscan_GAT,pfscan_VHS	p.A391S	ENST00000449058.2	37	c.1171	CCDS13913.1	22	.	.	.	.	.	.	.	.	.	.	G	17.45	3.393690	0.62066	.	.	ENSG00000100284	ENST00000447733;ENST00000449058;ENST00000411850;ENST00000425375;ENST00000412456;ENST00000451197;ENST00000436462	T;T;T;T;T	0.26373	1.77;1.8;1.77;1.74;1.77	5.23	4.21	0.49690	.	0.065412	0.64402	D	0.000010	T	0.35422	0.0931	M	0.77103	2.36	0.80722	D	1	P;P;P;P;B	0.50528	0.668;0.936;0.491;0.849;0.03	B;P;B;P;B	0.47251	0.355;0.459;0.24;0.542;0.039	T	0.21449	-1.0245	10	0.23302	T	0.38	-13.8863	12.9121	0.58184	0.0799:0.0:0.9201:0.0	.	346;353;400;391;391	O60784-3;E7EPD0;B4DKQ5;O60784-2;O60784	.;.;.;.;TOM1_HUMAN	S	358;391;391;346;128;400;353	ENSP00000398876:A358S;ENSP00000394466:A391S;ENSP00000413697:A391S;ENSP00000394924:A346S;ENSP00000402556:A353S	ENSP00000413697:A391S	A	+	1	0	TOM1	34064728	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.717000	0.74707	1.171000	0.42768	0.655000	0.94253	GCA	TOM1	-	pirsf_TOM1	ENSG00000100284		0.647	TOM1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	TOM1	HGNC	protein_coding	OTTHUMT00000320641.1	-	0.00	113	0	G	NM_005488		35734728	+1	tier1	-	no_errors	ENST00000411850	ensembl	human	known	74_37	missense	20.43	74	19	SNP	1.000	T
TNRC6B	23112	genome.wustl.edu	37	22	40661412	40661412	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr22:40661412G>A	ENST00000454349.2	+	5	1389	c.1178G>A	c.(1177-1179)gGa>gAa	p.G393E	TNRC6B_ENST00000335727.9_Missense_Mutation_p.G393E|TNRC6B_ENST00000402203.1_Intron|TNRC6B_ENST00000301923.9_Intron	NM_001162501.1	NP_001155973.1	Q9UPQ9	TNR6B_HUMAN	trinucleotide repeat containing 6B	393	Interaction with argonaute proteins.				epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|innate immune response (GO:0045087)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|regulation of translation (GO:0006417)	cytosol (GO:0005829)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)	1						GAGAATAAGGGAATGCCCTTT	0.478																																																	0													64.0	64.0	64.0					22																	40661412		1931	4135	6066	SO:0001583	missense	0			AB029016	CCDS46712.1, CCDS46713.1, CCDS54533.1	22q13	2006-08-22			ENSG00000100354	ENSG00000100354		"""Trinucleotide (CAG) repeat containing"""	29190	protein-coding gene	gene with protein product		610740					Standard	NM_015088		Approved	KIAA1093	uc011aor.2	Q9UPQ9	OTTHUMG00000151114	ENST00000454349.2:c.1178G>A	22.37:g.40661412G>A	ENSP00000401946:p.Gly393Glu		B0QY73|B0QY78|B4DGC0|Q5TH52|Q8TBX2	Missense_Mutation	SNP	pfam_Argonaute_hook_dom,superfamily_UBA-like	p.G393E	ENST00000454349.2	37	c.1178	CCDS54533.1	22	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	9.512|9.512	1.106119|1.106119	0.20632|0.20632	.|.	.|.	ENSG00000100354|ENSG00000100354	ENST00000446273|ENST00000454349;ENST00000400140;ENST00000335727	.|T;T	.|0.61040	.|0.14;0.14	5.07|5.07	5.07|5.07	0.68467|0.68467	.|.	.|0.113265	.|0.64402	.|D	.|0.000018	T|T	0.60366|0.60366	0.2263|0.2263	N|N	0.17278|0.17278	0.47|0.47	0.44745|0.44745	D|D	0.997747|0.997747	.|D;D;P	.|0.89917	.|1.0;0.963;0.936	.|D;P;P	.|0.85130	.|0.997;0.531;0.722	T|T	0.55366|0.55366	-0.8152|-0.8152	5|10	.|0.13470	.|T	.|0.59	-2.9211|-2.9211	17.4698|17.4698	0.87642|0.87642	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|393;393;393	.|Q9UPQ9;A8MYY3;Q9UPQ9-1	.|TNR6B_HUMAN;.;.	K|E	136|393	.|ENSP00000401946:G393E;ENSP00000338371:G393E	.|ENSP00000338371:G393E	E|G	+|+	1|2	0|0	TNRC6B|TNRC6B	38991358|38991358	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	4.523000|4.523000	0.60545|0.60545	2.369000|2.369000	0.80426|0.80426	0.650000|0.650000	0.86243|0.86243	GAA|GGA	TNRC6B	-	NULL	ENSG00000100354		0.478	TNRC6B-202	KNOWN	basic|CCDS	protein_coding	TNRC6B	HGNC	protein_coding		-	0.00	28	0	G			40661412	+1	tier1	-	no_errors	ENST00000454349	ensembl	human	known	74_37	missense	18.18	18	4	SNP	1.000	A
TP53	7157	genome.wustl.edu	37	17	7578406	7578406	+	Missense_Mutation	SNP	C	C	T	rs28934578		TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr17:7578406C>T	ENST00000269305.4	-	5	713	c.524G>A	c.(523-525)cGc>cAc	p.R175H	TP53_ENST00000455263.2_Missense_Mutation_p.R175H|TP53_ENST00000420246.2_Missense_Mutation_p.R175H|TP53_ENST00000413465.2_Missense_Mutation_p.R175H|TP53_ENST00000359597.4_Missense_Mutation_p.R175H|TP53_ENST00000574684.1_5'UTR|TP53_ENST00000445888.2_Missense_Mutation_p.R175H	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	175	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		R -> C (in sporadic cancers; somatic mutation).|R -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> H (in LFS; germline mutation and in sporadic cancers; somatic mutation; does not induce SNAI1 degradation; reduces interaction with ZNF385A; dbSNP:rs28934578). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:1868473, ECO:0000269|PubMed:7887414, ECO:0000269|PubMed:8825920}.|R -> L (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in a sporadic cancer; somatic mutation).|R -> S (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R175H(847)|p.R43H(36)|p.R82H(36)|p.R175L(19)|p.0?(8)|p.R175P(6)|p.R174fs*24(3)|p.R175_E180delRCPHHE(3)|p.V173fs*59(2)|p.R174fs*1(2)|p.V157_C176del20(1)|p.V173fs*69(1)|p.E171fs*61(1)|p.V173fs*23(1)|p.R174_H178>S(1)|p.V172_E180delVVRRCPHHE(1)|p.R174_H179delRRCPHH(1)|p.E171fs*1(1)|p.R175_H178>X(1)|p.R175fs*5(1)|p.R42fs*24(1)|p.R174_C176delRRC(1)|p.H168fs*69(1)|p.R174fs*70(1)|p.E171_H179delEVVRRCPHH(1)|p.R81fs*24(1)|p.R174_E180>K(1)|p.R174fs*3(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GTGGGGGCAGCGCCTCACAAC	0.652	R175H(AU565_BREAST)|R175H(CAL33_UPPER_AERODIGESTIVE_TRACT)|R175H(DETROIT562_UPPER_AERODIGESTIVE_TRACT)|R175H(HCC1395_BREAST)|R175H(HUCCT1_BILIARY_TRACT)|R175H(KLE_ENDOMETRIUM)|R175H(KMS26_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R175H(LS123_LARGE_INTESTINE)|R175H(NCIH196_LUNG)|R175H(RKN_OVARY)|R175H(SKBR3_BREAST)|R175H(SKUT1_SOFT_TISSUE)|R175H(TYKNU_OVARY)	111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	980	Substitution - Missense(944)|Deletion - Frameshift(17)|Whole gene deletion(8)|Deletion - In frame(8)|Complex - deletion inframe(3)	large_intestine(350)|breast(103)|upper_aerodigestive_tract(74)|stomach(70)|central_nervous_system(69)|oesophagus(67)|ovary(58)|lung(40)|haematopoietic_and_lymphoid_tissue(39)|urinary_tract(22)|prostate(17)|liver(14)|pancreas(11)|endometrium(10)|biliary_tract(10)|bone(9)|kidney(4)|cervix(4)|skin(3)|vulva(2)|soft_tissue(2)|penis(1)|adrenal_gland(1)	GRCh37	CM062017|CM951224	TP53	M	rs28934578						50.0	50.0	50.0					17																	7578406		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.524G>A	17.37:g.7578406C>T	ENSP00000269305:p.Arg175His		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.R175H	ENST00000269305.4	37	c.524	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	31	5.079737	0.94050	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99889	-7.55;-7.55;-7.55;-7.55;-7.55;-7.55;-7.55;-7.55	5.41	5.41	0.78517	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.101149	0.64402	D	0.000008	D	0.99908	0.9956	M	0.92784	3.345	0.80722	A	1	D;P;D;D;P;B;D	0.89917	0.999;0.578;1.0;0.998;0.632;0.213;0.999	D;B;D;D;B;B;D	0.91635	0.985;0.26;0.999;0.921;0.378;0.144;0.939	D	0.96278	0.9204	9	0.87932	D	0	-11.8679	17.0767	0.86588	0.0:1.0:0.0:0.0	rs28934578	136;175;175;82;175;175;175	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	H	175;175;175;175;175;175;164;82;43;82;43	ENSP00000410739:R175H;ENSP00000352610:R175H;ENSP00000269305:R175H;ENSP00000398846:R175H;ENSP00000391127:R175H;ENSP00000391478:R175H;ENSP00000425104:R43H;ENSP00000423862:R82H	ENSP00000269305:R175H	R	-	2	0	TP53	7519131	1.000000	0.71417	0.989000	0.46669	0.795000	0.44927	6.042000	0.70996	2.702000	0.92279	0.655000	0.94253	CGC	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor	ENSG00000141510		0.652	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	-	0.00	30	0	C	NM_000546		7578406	-1	tier1	rs28934578	no_errors	ENST00000269305	ensembl	human	known	74_37	missense	57.69	11	15	SNP	1.000	T
TP53TG3D	729264	genome.wustl.edu	37	16	32264978	32264978	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr16:32264978C>T	ENST00000354614.3	+	1	317	c.304C>T	c.(304-306)Cct>Tct	p.P102S	TP53TG3D_ENST00000569631.1_Intron|RP11-56L13.7_ENST00000562604.1_RNA|TP53TG3D_ENST00000398664.3_Missense_Mutation_p.P102S			Q9ULZ0	T53G3_HUMAN	TP53 target 3D	102						cytoplasm (GO:0005737)|nucleus (GO:0005634)											AAGTTTGATACCTTGCAGATC	0.562																																																	0																																										SO:0001583	missense	0				CCDS58456.1	16p11.2	2012-12-11			ENSG00000205456	ENSG00000205456			44657	protein-coding gene	gene with protein product							Standard	NM_001243722		Approved		uc021tgy.1	Q9ULZ0	OTTHUMG00000132469	ENST00000354614.3:c.304C>T	16.37:g.32264978C>T	ENSP00000454339:p.Pro102Ser		B2R5K6|Q4KN31|Q9ULY9	Missense_Mutation	SNP	NULL	p.P102S	ENST00000354614.3	37	c.304		16																																																																																			TP53TG3D	-	NULL	ENSG00000205456		0.562	TP53TG3D-201	KNOWN	basic|appris_candidate_longest	protein_coding	TP53TG3D	HGNC	protein_coding		-	0.00	185	0	C	NM_001243722		32264978	+1	tier1	-	no_errors	ENST00000354614	ensembl	human	known	74_37	missense	18.29	143	32	SNP	0.034	T
TPTE	7179	genome.wustl.edu	37	21	10942941	10942941	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr21:10942941C>T	ENST00000361285.4	-	12	975	c.646G>A	c.(646-648)Gaa>Aaa	p.E216K	TPTE_ENST00000415664.2_5'UTR|TPTE_ENST00000342420.5_Missense_Mutation_p.E178K|TPTE_ENST00000298232.7_Missense_Mutation_p.E198K	NM_199261.2	NP_954870	P56180	TPTE_HUMAN	transmembrane phosphatase with tensin homology	216					peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	ion channel activity (GO:0005216)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(19)|lung(76)|ovary(2)|prostate(2)|skin(8)|urinary_tract(1)	130			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		ATCAGCTTTTCAAGTTGTCTT	0.323																																																	0													98.0	90.0	92.0					21																	10942941		2203	4299	6502	SO:0001583	missense	0			AF007118	CCDS74771.1, CCDS74772.1, CCDS74773.1	21p11	2011-06-09			ENSG00000166157	ENSG00000274391		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	12023	protein-coding gene	gene with protein product	"""PTEN-related tyrosine phosphatase"", ""cancer/testis antigen 44"""	604336				10830953, 14659893	Standard	NM_001290224		Approved	PTEN2, CT44	uc002yip.1	P56180	OTTHUMG00000074127	ENST00000361285.4:c.646G>A	21.37:g.10942941C>T	ENSP00000355208:p.Glu216Lys		B2RAP7|C9J6D6|C9JKK8|Q6XPS4|Q6XPS5|Q71JA8|Q8NCS8	Missense_Mutation	SNP	pfam_Tensin_phosphatase_C2-dom,pfam_Dual-sp_phosphatase_cat-dom,pfam_Ion_trans_dom,superfamily_C2_dom,pfscan_Tyr/Dual-sp_Pase,pfscan_Phosphatase_tensin-typ,pfscan_Tensin_phosphatase_C2-dom	p.E216K	ENST00000361285.4	37	c.646	CCDS13560.2	21	.	.	.	.	.	.	.	.	.	.	.	12.00	1.806714	0.31961	.	.	ENSG00000166157	ENST00000298232;ENST00000361285;ENST00000342420	D;D;D	0.98164	-4.76;-4.76;-4.76	2.07	2.07	0.26955	Ion transport (1);	0.000000	0.85682	U	0.000000	D	0.95818	0.8639	L	0.44542	1.39	0.58432	D	0.999997	P;B;B	0.36110	0.537;0.383;0.392	B;B;B	0.40134	0.32;0.32;0.173	D	0.93717	0.7029	10	0.31617	T	0.26	-25.1042	10.2257	0.43225	0.0:1.0:0.0:0.0	.	178;198;216	P56180-3;P56180-2;P56180	.;.;TPTE_HUMAN	K	198;216;178	ENSP00000298232:E198K;ENSP00000355208:E216K;ENSP00000344441:E178K	ENSP00000298232:E198K	E	-	1	0	TPTE	9964812	1.000000	0.71417	0.723000	0.30687	0.078000	0.17371	5.237000	0.65360	1.470000	0.48102	0.194000	0.17425	GAA	TPTE	-	pfam_Ion_trans_dom	ENSG00000166157		0.323	TPTE-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TPTE	HGNC	protein_coding	OTTHUMT00000157413.1	-	0.00	176	0	C			10942941	-1	tier1	-	no_errors	ENST00000361285	ensembl	human	known	74_37	missense	9.70	121	13	SNP	1.000	T
TRAF3	7187	genome.wustl.edu	37	14	103371584	103371584	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr14:103371584G>C	ENST00000560371.1	+	11	1387	c.1170G>C	c.(1168-1170)caG>caC	p.Q390H	TRAF3_ENST00000392745.2_Missense_Mutation_p.Q390H|TRAF3_ENST00000351691.5_Missense_Mutation_p.Q365H|TRAF3_ENST00000347662.4_Missense_Mutation_p.Q365H|TRAF3_ENST00000539721.1_Missense_Mutation_p.Q307H	NM_003300.3|NM_145725.2	NP_003291.2|NP_663777.1	Q13114	TRAF3_HUMAN	TNF receptor-associated factor 3	390					apoptotic process (GO:0006915)|innate immune response (GO:0045087)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of type I interferon production (GO:0032480)|regulation of apoptotic process (GO:0042981)|regulation of cytokine production (GO:0001817)|regulation of defense response to virus (GO:0050688)|regulation of interferon-beta production (GO:0032648)|regulation of proteolysis (GO:0030162)|signal transduction (GO:0007165)|Toll signaling pathway (GO:0008063)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	CD40 receptor complex (GO:0035631)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|endosome (GO:0005768)|mitochondrion (GO:0005739)	ligase activity (GO:0016874)|signal transducer activity (GO:0004871)|thioesterase binding (GO:0031996)|tumor necrosis factor receptor binding (GO:0005164)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(4)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(10)|liver(2)|lung(7)|ovary(1)|prostate(2)	30		all_cancers(154;7.87e-06)|all_epithelial(191;0.0024)		Epithelial(152;9.92e-24)|all cancers(159;2.23e-21)|OV - Ovarian serous cystadenocarcinoma(161;7.85e-12)|Colorectal(3;0.0971)		GGCATGACCAGATGCTGAGTG	0.582																																																	0													49.0	49.0	49.0					14																	103371584		2203	4300	6503	SO:0001583	missense	0			U21092	CCDS9975.1, CCDS9976.1, CCDS55946.1	14q32.32	2014-09-17				ENSG00000131323			12033	protein-coding gene	gene with protein product		601896				7530216, 7859281	Standard	NM_145725		Approved	CAP-1, CD40bp, CRAF1, LAP1	uc001ymd.2	Q13114		ENST00000560371.1:c.1170G>C	14.37:g.103371584G>C	ENSP00000454207:p.Gln390His		B7Z8C4|Q12990|Q13076|Q13947|Q6AZX1|Q9UNL1	Missense_Mutation	SNP	pfam_MATH,superfamily_TRAF-like,smart_MATH,pirsf_TNF_rcpt--assoc_TRAF,pfscan_MATH,pfscan_Znf_RING,pfscan_Znf_TRAF	p.Q390H	ENST00000560371.1	37	c.1170	CCDS9975.1	14	.	.	.	.	.	.	.	.	.	.	G	2.829	-0.243039	0.05906	.	.	ENSG00000131323	ENST00000392745;ENST00000347662;ENST00000351691;ENST00000539721	T;T;T	0.78481	-1.18;-1.18;1.52	5.32	5.32	0.75619	.	0.419375	0.29002	N	0.013453	T	0.78457	0.4286	L	0.27053	0.805	0.39891	D	0.973771	D;B;B	0.54397	0.966;0.03;0.005	P;B;B	0.54499	0.754;0.015;0.015	T	0.80815	-0.1214	10	0.51188	T	0.08	-38.552	19.0212	0.92916	0.0:0.0:1.0:0.0	.	307;365;390	Q13114-2;A6NHG8;Q13114	.;.;TRAF3_HUMAN	H	390;365;390;307	ENSP00000376500:Q390H;ENSP00000328003:Q365H;ENSP00000445998:Q307H	ENSP00000328003:Q365H	Q	+	3	2	TRAF3	102441337	1.000000	0.71417	1.000000	0.80357	0.003000	0.03518	3.376000	0.52417	2.489000	0.83994	0.563000	0.77884	CAG	TRAF3	-	pirsf_TNF_rcpt--assoc_TRAF	ENSG00000131323		0.582	TRAF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRAF3	HGNC	protein_coding	OTTHUMT00000415735.1	-	0.00	65	0	G	NM_145725		103371584	+1	tier1	-	no_errors	ENST00000392745	ensembl	human	known	74_37	missense	42.19	37	27	SNP	1.000	C
TRAK1	22906	genome.wustl.edu	37	3	42265157	42265157	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr3:42265157G>A	ENST00000327628.5	+	16	3190	c.2790G>A	c.(2788-2790)atG>atA	p.M930I	TRAK1_ENST00000396175.1_Missense_Mutation_p.M872I|RNU4-78P_ENST00000410940.1_RNA|TRAK1_ENST00000487159.1_3'UTR	NM_001042646.2	NP_001036111.1	Q9UPV9	TRAK1_HUMAN	trafficking protein, kinesin binding 1	930					endosome to lysosome transport (GO:0008333)|protein O-linked glycosylation (GO:0006493)|protein targeting (GO:0006605)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|mitochondrion (GO:0005739)|nucleus (GO:0005634)				central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(8)|lung(6)|ovary(1)|upper_aerodigestive_tract(2)	22						GCATGCAGATGAAAGCTCCTG	0.582																																					GBM(44;195 884 22595 31865 41850)												0													58.0	65.0	63.0					3																	42265157		2023	4184	6207	SO:0001583	missense	0				CCDS2695.1, CCDS43072.1, CCDS58826.1, CCDS74922.1	3p22.1	2012-03-05			ENSG00000182606	ENSG00000182606			29947	protein-coding gene	gene with protein product	"""OGT(O Glc NAc transferase) interacting protein 106 KDa"", ""O-linked N-acetylglucosamine transferase interacting protein 106"", ""milton homolog 1 (Drosophila)"""	608112				10470851, 12435728, 16380713, 20230862	Standard	NM_014965		Approved	OIP106, KIAA1042, MILT1	uc003cky.4	Q9UPV9	OTTHUMG00000131795	ENST00000327628.5:c.2790G>A	3.37:g.42265157G>A	ENSP00000328998:p.Met930Ile		E9PDS2|J3KNT7|Q63HR0|Q659B5|Q96B69	Missense_Mutation	SNP	pfam_HAP1_N,pfam_Traffickng_kinesin-bd_prot_dom	p.M872I	ENST00000327628.5	37	c.2616	CCDS43072.1	3	.	.	.	.	.	.	.	.	.	.	G	14.89	2.670094	0.47677	.	.	ENSG00000182606	ENST00000327628;ENST00000396175	T;T	0.09911	2.94;2.93	5.04	4.14	0.48551	.	0.046579	0.85682	N	0.000000	T	0.08626	0.0214	N	0.24115	0.695	0.80722	D	1	B;B	0.22276	0.067;0.067	B;B	0.15052	0.012;0.012	T	0.15435	-1.0437	10	0.40728	T	0.16	.	14.5204	0.67847	0.0:0.1473:0.8526:0.0	.	872;930	C9JC32;Q9UPV9	.;TRAK1_HUMAN	I	930;872	ENSP00000328998:M930I;ENSP00000379478:M872I	ENSP00000328998:M930I	M	+	3	0	TRAK1	42240161	1.000000	0.71417	1.000000	0.80357	0.848000	0.48234	8.938000	0.92943	1.329000	0.45376	0.655000	0.94253	ATG	TRAK1	-	NULL	ENSG00000182606		0.582	TRAK1-004	PUTATIVE	basic|appris_principal|CCDS	protein_coding	TRAK1	HGNC	protein_coding	OTTHUMT00000343413.1	-	0.00	43	0	G	NM_014965		42265157	+1	tier1	-	no_errors	ENST00000396175	ensembl	human	known	74_37	missense	50.00	12	12	SNP	1.000	A
TSGA10	80705	genome.wustl.edu	37	2	99634813	99634813	+	Splice_Site	SNP	C	C	T			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr2:99634813C>T	ENST00000393483.3	-	20	2767		c.e20-1		TSGA10_ENST00000539964.1_Splice_Site|TSGA10_ENST00000355053.4_Splice_Site|TSGA10_ENST00000410001.1_Splice_Site	NM_025244.2	NP_079520.1	Q9BZW7	TSG10_HUMAN	testis specific, 10						cell projection assembly (GO:0030031)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|membrane (GO:0016020)|motile cilium (GO:0031514)|neuron projection (GO:0043005)|nucleus (GO:0005634)				NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(10)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	34						GGCCCTCTCCCTAAAGCAAAA	0.318																																																	0													89.0	89.0	89.0					2																	99634813		2203	4300	6503	SO:0001630	splice_region_variant	0			AF254756	CCDS2037.1	2q11.2	2009-08-06			ENSG00000135951	ENSG00000135951			14927	protein-coding gene	gene with protein product	"""cancer/testis antigen 79"""	607166				11179690	Standard	NM_025244		Approved	CEP4L, CT79	uc002szi.4	Q9BZW7	OTTHUMG00000130637	ENST00000393483.3:c.1923-1G>A	2.37:g.99634813C>T			B7Z925|D3DVH7|Q8NEP0|Q9BWX0	Splice_Site	SNP	-	e15-1	ENST00000393483.3	37	c.1923-1	CCDS2037.1	2	.	.	.	.	.	.	.	.	.	.	C	21.4	4.141631	0.77775	.	.	ENSG00000135951	ENST00000393483;ENST00000410001;ENST00000355053;ENST00000539964;ENST00000409564;ENST00000393482	.	.	.	5.03	5.03	0.67393	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.4393	0.87561	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	TSGA10	99001245	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.075000	0.64407	2.770000	0.95276	0.650000	0.86243	.	TSGA10	-	-	ENSG00000135951		0.318	TSGA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSGA10	HGNC	protein_coding	OTTHUMT00000253125.1	-	0.00	43	0	C	NM_182911	Intron	99634813	-1	tier1	-	no_errors	ENST00000355053	ensembl	human	known	74_37	splice_site	17.65	27	6	SNP	1.000	T
TTN	7273	genome.wustl.edu	37	2	179486627	179486627	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr2:179486627C>T	ENST00000591111.1	-	194	40323	c.40099G>A	c.(40099-40101)Gaa>Aaa	p.E13367K	TTN_ENST00000342175.6_Missense_Mutation_p.E6135K|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.E5943K|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.E6068K|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000604956.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.E15008K|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.E12440K|TTN-AS1_ENST00000589907.1_RNA|TTN-AS1_ENST00000589487.1_RNA			Q8WZ42	TITIN_HUMAN	titin	13367	Ig-like 89.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TATTCAGCTTCATCATCCAGT	0.398																																																	0													145.0	134.0	138.0					2																	179486627		1942	4138	6080	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.40099G>A	2.37:g.179486627C>T	ENSP00000465570:p.Glu13367Lys		A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.E12440K	ENST00000591111.1	37	c.37318		2	.	.	.	.	.	.	.	.	.	.	C	16.67	3.187639	0.57909	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.68181	-0.31;-0.31;-0.31;-0.31	5.8	5.8	0.92144	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	D	0.84370	0.5457	M	0.83312	2.635	0.80722	D	1	D;D;D;D	0.76494	0.999;0.999;0.999;0.999	D;D;D;D	0.83275	0.996;0.996;0.996;0.996	D	0.85678	0.1299	9	0.87932	D	0	.	20.0499	0.97621	0.0:1.0:0.0:0.0	.	5943;6068;6135;13367	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	K	12440;5943;6135;6068;5943	ENSP00000343764:E12440K;ENSP00000434586:E5943K;ENSP00000340554:E6135K;ENSP00000352154:E6068K	ENSP00000340554:E6135K	E	-	1	0	TTN	179194872	1.000000	0.71417	1.000000	0.80357	0.749000	0.42624	7.767000	0.85331	2.734000	0.93682	0.650000	0.86243	GAA	TTN	-	pfam_Ig_I-set,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000155657		0.398	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	-	0.00	65	0	C	NM_133378		179486627	-1	tier1	-	no_errors	ENST00000342992	ensembl	human	known	74_37	missense	35.71	45	25	SNP	1.000	T
UBQLN2	29978	genome.wustl.edu	37	X	56590987	56590987	+	Frame_Shift_Del	DEL	C	C	-			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chrX:56590987delC	ENST00000338222.5	+	1	962	c.681delC	c.(679-681)aacfs	p.N227fs		NM_013444.3	NP_038472.2	Q9UHD9	UBQL2_HUMAN	ubiquilin 2	227					cell death (GO:0008219)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(2)|endometrium(3)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|skin(1)	21						TGCTCAACAACCCAGACATAA	0.453																																					Esophageal Squamous(104;218 1492 6022 10838 28884)												0													50.0	50.0	50.0					X																	56590987		2203	4300	6503	SO:0001589	frameshift_variant	0			AF189009	CCDS14374.1	Xp11.21	2014-09-17			ENSG00000188021	ENSG00000188021		"""Ubiquilin family"""	12509	protein-coding gene	gene with protein product	"""NEDD4 binding protein 4"""	300264				10675567	Standard	NM_013444		Approved	Chap1, Dsk2, RIHFB2157, LIC-2, CHAP1/DSK2, PLIC-2, N4BP4, PLIC2	uc004dus.3	Q9UHD9	OTTHUMG00000021669	ENST00000338222.5:c.681delC	X.37:g.56590987delC	ENSP00000345195:p.Asn227fs		O94798|Q5D027|Q9H3W6|Q9HAZ4	Frame_Shift_Del	DEL	pfam_Ubiquitin_dom,pfam_Rad60/SUMO_like,pfam_UBA/Ts_N,superfamily_UBA-like,superfamily_ARM-type_fold,superfamily_XPC-bd,smart_Ubiquitin_dom,smart_STI1_HS-bd,smart_UBA/transl_elong_EF1B_N_euk,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Ubiquitin_supergroup	p.P228fs	ENST00000338222.5	37	c.681	CCDS14374.1	X																																																																																			UBQLN2	-	superfamily_ARM-type_fold,smart_STI1_HS-bd	ENSG00000188021		0.453	UBQLN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBQLN2	HGNC	protein_coding	OTTHUMT00000056891.1		0.00	12	0	C	NM_013444		56590987	+1	tier1		no_errors	ENST00000338222	ensembl	human	known	74_37	frame_shift_del	33.33	10	5	DEL	1.000	-
UBR4	23352	genome.wustl.edu	37	1	19493660	19493660	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr1:19493660C>T	ENST00000375254.3	-	29	3992	c.3965G>A	c.(3964-3966)aGc>aAc	p.S1322N	UBR4_ENST00000375226.2_Missense_Mutation_p.S1322N|UBR4_ENST00000375267.2_Missense_Mutation_p.S1322N|UBR4_ENST00000375217.2_Missense_Mutation_p.S1322N	NM_020765.2	NP_065816.2	Q5T4S7	UBR4_HUMAN	ubiquitin protein ligase E3 component n-recognin 4	1322					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|viral process (GO:0016032)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(7)|central_nervous_system(1)|cervix(2)|endometrium(23)|kidney(25)|large_intestine(25)|liver(2)|lung(47)|ovary(10)|pancreas(2)|prostate(7)|skin(5)|stomach(5)|upper_aerodigestive_tract(4)|urinary_tract(6)	171		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)		ACTCTCAGTGCTTGATTCCAA	0.463																																																	0													138.0	129.0	132.0					1																	19493660		2203	4300	6503	SO:0001583	missense	0			AF348492	CCDS189.1	1p36.13	2008-06-23	2007-06-19	2007-06-19	ENSG00000127481	ENSG00000127481		"""Ubiquitin protein ligase E3 component n-recognins"""	30313	protein-coding gene	gene with protein product		609890	"""zinc finger, UBR1 type 1"""	ZUBR1		14702039, 10718198, 16055722	Standard	XM_005245802		Approved	KIAA1307, KIAA0462, RBAF600	uc001bbi.3	Q5T4S7	OTTHUMG00000002498	ENST00000375254.3:c.3965G>A	1.37:g.19493660C>T	ENSP00000364403:p.Ser1322Asn		A8MPT2|A8MQ33|A8MQB1|O60646|O75050|Q4QRK5|Q5T4S8|Q5T4S9|Q5TBN8|Q5TBP2|Q6DKH8|Q6P4A4|Q7L8P7|Q8IXJ4|Q8TDN5|Q8WV67|Q9HA46|Q9P2N9|Q9UG82	Missense_Mutation	SNP	superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_Znf_N-recognin_met,pfscan_Znf_N-recognin	p.S1322N	ENST00000375254.3	37	c.3965	CCDS189.1	1	.	.	.	.	.	.	.	.	.	.	C	25.4	4.636945	0.87760	.	.	ENSG00000127481	ENST00000375254;ENST00000375267;ENST00000375217;ENST00000375226;ENST00000417040;ENST00000419533	T;T;T;T;T	0.68331	-0.32;-0.32;-0.32;-0.32;-0.19	5.86	5.86	0.93980	.	0.000000	0.85682	D	0.000000	T	0.70902	0.3277	N	0.22421	0.69	0.80722	D	1	D	0.54601	0.967	P	0.60682	0.878	T	0.69778	-0.5053	10	0.40728	T	0.16	.	19.7902	0.96453	0.0:1.0:0.0:0.0	.	1322	Q5T4S7	UBR4_HUMAN	N	1322;1322;1322;1322;32;538	ENSP00000364403:S1322N;ENSP00000364416:S1322N;ENSP00000364365:S1322N;ENSP00000364374:S1322N;ENSP00000404897:S32N	ENSP00000364365:S1322N	S	-	2	0	UBR4	19366247	1.000000	0.71417	1.000000	0.80357	0.826000	0.46750	7.424000	0.80242	2.780000	0.95670	0.585000	0.79938	AGC	UBR4	-	superfamily_ARM-type_fold	ENSG00000127481		0.463	UBR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBR4	HGNC	protein_coding	OTTHUMT00000007085.1	-	0.00	54	0	C	NM_020765		19493660	-1	tier1	-	no_errors	ENST00000375267	ensembl	human	known	74_37	missense	38.89	22	14	SNP	1.000	T
URGCP	55665	genome.wustl.edu	37	7	43917445	43917445	+	Silent	SNP	C	C	T			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr7:43917445C>T	ENST00000453200.1	-	6	2110	c.1617G>A	c.(1615-1617)caG>caA	p.Q539Q	URGCP_ENST00000336086.6_Silent_p.Q496Q|URGCP_ENST00000223341.7_Silent_p.Q496Q|URGCP_ENST00000443736.1_Silent_p.Q496Q|URGCP_ENST00000497914.1_5'UTR|URGCP_ENST00000447717.3_Silent_p.Q496Q|URGCP-MRPS24_ENST00000603700.1_Intron|URGCP_ENST00000402306.3_Silent_p.Q530Q			Q8TCY9	URGCP_HUMAN	upregulator of cell proliferation	539					cell cycle (GO:0007049)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	GTP binding (GO:0005525)			breast(3)|endometrium(4)|kidney(2)|large_intestine(3)|liver(1)|lung(13)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						CATGGCCGTTCTGCTGCATTC	0.612																																																	0													40.0	45.0	43.0					7																	43917445		2026	4163	6189	SO:0001819	synonymous_variant	0				CCDS43572.1, CCDS47577.1, CCDS47578.1	7p13	2010-02-17			ENSG00000106608	ENSG00000106608			30890	protein-coding gene	gene with protein product	"""up-regulated gene 4"""	610337				10819331, 12082552	Standard	NM_017920		Approved	URG4, KIAA1507, FLJ20654, DKFZp666G166, DKFZp686O0457	uc003tiw.3	Q8TCY9	OTTHUMG00000155245	ENST00000453200.1:c.1617G>A	7.37:g.43917445C>T			E9PFF6|Q658M4|Q68DH6|Q6MZZ5|Q8WV98|Q9NWR7|Q9P221	Silent	SNP	superfamily_P-loop_NTPase,prints_GTP_binding_domain	p.Q539	ENST00000453200.1	37	c.1617	CCDS47578.1	7																																																																																			URGCP	-	NULL	ENSG00000106608		0.612	URGCP-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	URGCP	HGNC	protein_coding	OTTHUMT00000338995.1	-	0.00	55	0	C	NM_001077664		43917445	-1	tier1	-	no_errors	ENST00000453200	ensembl	human	known	74_37	silent	48.53	35	33	SNP	1.000	T
WDR90	197335	genome.wustl.edu	37	16	701947	701947	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr16:701947G>C	ENST00000293879.4	+	9	961	c.961G>C	c.(961-963)Gag>Cag	p.E321Q	AL022341.3_ENST00000455294.1_RNA|WDR90_ENST00000549091.1_Missense_Mutation_p.E321Q			Q96KV7	WDR90_HUMAN	WD repeat domain 90	321										endometrium(4)|kidney(3)|large_intestine(2)|lung(22)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	37		Hepatocellular(780;0.0218)				GGCCCAGCTGGAGGCCTCTGA	0.682																																																	0													12.0	16.0	15.0					16																	701947		2052	4175	6227	SO:0001583	missense	0			AB067511	CCDS42092.1	16p13.3	2013-01-09			ENSG00000161996	ENSG00000161996		"""WD repeat domain containing"""	26960	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 17"", ""chromosome 16 open reading frame 15"", ""chromosome 16 open reading frame 16"", ""chromosome 16 open reading frame 19"", ""chromosome 16 open reading frame 18"""	C16orf17, C16orf15, C16orf16, C16orf19, C16orf18		11572484, 11157797	Standard	XM_005255160		Approved	FLJ36483, KIAA1924	uc002cii.1	Q96KV7	OTTHUMG00000048040	ENST00000293879.4:c.961G>C	16.37:g.701947G>C	ENSP00000293879:p.Glu321Gln		Q0VA87|Q0VA88|Q6P048|Q6ZMS1|Q6ZTH1|Q8N202|Q8N221|Q8NBB8|Q96PW4|Q96S18	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_DUF667,pfam_Nucleoporin_Nup160,superfamily_Quinonprotein_ADH-like_supfam,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.E321Q	ENST00000293879.4	37	c.961	CCDS42092.1	16	.	.	.	.	.	.	.	.	.	.	G	5.730	0.319143	0.10845	.	.	ENSG00000161996	ENST00000549091;ENST00000293879	T;T	0.29397	1.61;1.57	4.08	-0.559	0.11792	.	7.488640	0.00799	U	0.001407	T	0.30634	0.0771	L	0.60455	1.87	0.09310	N	1	B;B;B	0.30973	0.047;0.18;0.302	B;B;B	0.28139	0.024;0.081;0.086	T	0.12578	-1.0542	10	0.37606	T	0.19	.	6.6791	0.23110	0.1797:0.2698:0.5505:0.0	.	321;322;321	Q96KV7;C9JMK1;Q96KV7-3	WDR90_HUMAN;.;.	Q	321	ENSP00000448122:E321Q;ENSP00000293879:E321Q	ENSP00000293879:E321Q	E	+	1	0	WDR90	641948	0.001000	0.12720	0.000000	0.03702	0.000000	0.00434	0.333000	0.19768	-0.628000	0.05582	-1.134000	0.01955	GAG	WDR90	-	NULL	ENSG00000161996		0.682	WDR90-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	WDR90	HGNC	protein_coding	OTTHUMT00000404335.1		0.00	24	0	G	NM_145294		701947	+1			no_errors	ENST00000549091	ensembl	human	novel	74_37	missense	14.29	12	2	SNP	0.000	C
WHSC1L1	54904	genome.wustl.edu	37	8	38173482	38173482	+	Nonsense_Mutation	SNP	G	G	T			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr8:38173482G>T	ENST00000317025.8	-	10	2451	c.1934C>A	c.(1933-1935)tCa>tAa	p.S645*	WHSC1L1_ENST00000525081.1_5'Flank|WHSC1L1_ENST00000433384.2_Nonsense_Mutation_p.S645*|WHSC1L1_ENST00000527502.1_Nonsense_Mutation_p.S645*	NM_023034.1	NP_075447.1	Q9BZ95	NSD3_HUMAN	Wolf-Hirschhorn syndrome candidate 1-like 1	645					histone lysine methylation (GO:0034968)|histone methylation (GO:0016571)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(3)|kidney(3)|large_intestine(2)|lung(10)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	24	Colorectal(12;0.000442)|Esophageal squamous(3;0.0725)	all_lung(54;0.00787)|Lung NSC(58;0.0295)|Hepatocellular(245;0.065)	Epithelial(3;3.12e-43)|all cancers(3;1.72e-38)|BRCA - Breast invasive adenocarcinoma(5;2.84e-27)|LUSC - Lung squamous cell carcinoma(2;2.79e-25)|Lung(2;5.03e-23)|COAD - Colon adenocarcinoma(9;0.0511)			TCTGTATGCTGAACTAGTCAT	0.418			T	NUP98	AML																																			Dom	yes		8	8p12	54904	Wolf-Hirschhorn syndrome candidate 1-like 1 (NSD3)		L	0													158.0	152.0	154.0					8																	38173482		2104	4224	6328	SO:0001587	stop_gained	0			AF332469	CCDS6105.1, CCDS43729.1	8p11.2	2013-05-20			ENSG00000147548	ENSG00000147548			12767	protein-coding gene	gene with protein product		607083				10802047, 23269674	Standard	NM_023034		Approved	FLJ20353, NSD3	uc003xli.3	Q9BZ95		ENST00000317025.8:c.1934C>A	8.37:g.38173482G>T	ENSP00000313983:p.Ser645*		B7ZL11|D3DSX1|Q1RMD3|Q3B796|Q6ZSA5|Q9BYU8|Q9BYU9|Q9H2M8|Q9H9W9|Q9NXA6	Nonsense_Mutation	SNP	pfam_PWWP_dom,pfam_SET_dom,superfamily_Znf_FYVE_PHD,smart_PWWP_dom,smart_Znf_PHD,smart_AWS,smart_SET_dom,smart_Post-SET_dom,pfscan_AWS,pfscan_PWWP_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_PHD-finger	p.S645*	ENST00000317025.8	37	c.1934	CCDS43729.1	8	.	.	.	.	.	.	.	.	.	.	G	42	9.728540	0.99249	.	.	ENSG00000147548	ENST00000433384;ENST00000317025;ENST00000446459;ENST00000527502	.	.	.	5.85	4.95	0.65309	.	0.525202	0.15033	U	0.284321	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.05833	T	0.94	.	16.5757	0.84637	0.0:0.1347:0.8653:0.0	.	.	.	.	X	645;645;582;645	.	ENSP00000313983:S645X	S	-	2	0	WHSC1L1	38292639	1.000000	0.71417	0.847000	0.33407	0.973000	0.67179	5.232000	0.65332	1.436000	0.47453	0.650000	0.86243	TCA	WHSC1L1	-	NULL	ENSG00000147548		0.418	WHSC1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WHSC1L1	HGNC	protein_coding	OTTHUMT00000381924.3		0.00	18	0	G	NM_023034		38173482	-1			no_errors	ENST00000317025	ensembl	human	known	74_37	nonsense	13.64	19	3	SNP	1.000	T
ZFX	7543	genome.wustl.edu	37	X	24190949	24190949	+	Intron	SNP	C	C	T			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chrX:24190949C>T	ENST00000379177.1	+	5	485				ZFX_ENST00000338565.3_Intron|ZFX_ENST00000540034.1_Intron|ZFX_ENST00000379188.3_Intron|ZFX_ENST00000304543.5_Intron|ZFX_ENST00000459724.1_Intron|ZFX_ENST00000539115.1_Intron	NM_001178085.1|NM_003410.3	NP_001171556.1|NP_003401.2	P17010	ZFX_HUMAN	zinc finger protein, X-linked						death (GO:0016265)|fertilization (GO:0009566)|homeostasis of number of cells (GO:0048872)|multicellular organism growth (GO:0035264)|oocyte development (GO:0048599)|ovarian follicle development (GO:0001541)|parental behavior (GO:0060746)|post-embryonic development (GO:0009791)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|transcription coactivator activity (GO:0003713)			cervix(1)|endometrium(4)|kidney(3)|large_intestine(7)|liver(2)|lung(4)|ovary(2)|prostate(1)	24						CACTTCCCATCTACCAGATTT	0.373																																					Esophageal Squamous(20;306 562 7346 32868 37983)												0													114.0	90.0	98.0					X																	24190949		2203	4300	6503	SO:0001627	intron_variant	0				CCDS14211.1, CCDS55390.1	Xp22.1-p21.3	2013-01-08			ENSG00000005889	ENSG00000005889		"""Zinc fingers, C2H2-type"""	12869	protein-coding gene	gene with protein product		314980					Standard	NM_003410		Approved	ZNF926	uc022bua.1	P17010	OTTHUMG00000021264	ENST00000379177.1:c.58+32C>T	X.37:g.24190949C>T			B9EG97|O43668|Q8WYJ8	RNA	SNP	-	NULL	ENST00000379177.1	37	NULL	CCDS14211.1	X																																																																																			ZFX	-	-	ENSG00000005889		0.373	ZFX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFX	HGNC	protein_coding	OTTHUMT00000056084.1	-	0.00	30	0	C	NM_003410		24190949	+1	tier1	-	no_errors	ENST00000480195	ensembl	human	known	74_37	rna	36.00	16	9	SNP	0.011	T
ZNF208	7757	genome.wustl.edu	37	19	22157331	22157331	+	Nonsense_Mutation	SNP	C	C	A	rs148173796		TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr19:22157331C>A	ENST00000397126.4	-	4	653	c.505G>T	c.(505-507)Gga>Tga	p.G169*	ZNF208_ENST00000599916.1_Intron|ZNF208_ENST00000601773.1_Intron	NM_007153.3	NP_009084.2	O43345	ZN208_HUMAN	zinc finger protein 208	169					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.G169R(1)		breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(18)|liver(1)|lung(71)|ovary(6)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	113		all_lung(12;0.0961)|Lung NSC(12;0.103)				TGTTTCTTTCCAGTATGCCTT	0.323																																																	1	Substitution - Missense(1)	skin(1)											107.0	104.0	105.0					19																	22157331		2036	4224	6260	SO:0001587	stop_gained	0			BC038199	CCDS54240.1	19p12	2013-01-08				ENSG00000160321		"""Zinc fingers, C2H2-type"", ""-"""	12999	protein-coding gene	gene with protein product	"""zinc finger protein 95"""	603977				9724325	Standard	NM_007153		Approved	PMIDP, ZNF95	uc021urr.1	O43345		ENST00000397126.4:c.505G>T	19.37:g.22157331C>A	ENSP00000380315:p.Gly169*			Nonsense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.G169*	ENST00000397126.4	37	c.505	CCDS54240.1	19	.	.	.	.	.	.	.	.	.	.	C	17.13	3.309891	0.60414	.	.	ENSG00000160321	ENST00000397126;ENST00000428290	.	.	.	1.41	0.0978	0.14495	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.35671	T	0.21	.	6.6671	0.23047	0.0:0.6994:0.3006:0.0	.	.	.	.	X	169	.	ENSP00000380315:G169X	G	-	1	0	ZNF208	21949171	0.007000	0.16637	0.000000	0.03702	0.477000	0.33069	1.292000	0.33342	-0.071000	0.12886	0.289000	0.19496	GGA	ZNF208	-	NULL	ENSG00000160321		0.323	ZNF208-001	NOVEL	basic|appris_principal|CCDS	protein_coding	ZNF208	HGNC	protein_coding	OTTHUMT00000464302.1	-	0.00	158	0	C	NM_007153		22157331	-1	tier1	-	no_errors	ENST00000397126	ensembl	human	novel	74_37	nonsense	19.71	110	27	SNP	0.361	A
ZNF443	10224	genome.wustl.edu	37	19	12541042	12541042	+	Silent	SNP	T	T	C	rs2112851		TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr19:12541042T>C	ENST00000301547.5	-	4	2141	c.1944A>G	c.(1942-1944)ccA>ccG	p.P648P	CTD-3105H18.16_ENST00000595562.1_Intron	NM_005815.4	NP_005806	Q9Y2A4	ZN443_HUMAN	zinc finger protein 443	648					apoptotic process (GO:0006915)|regulation of transcription, DNA-templated (GO:0006355)|response to stress (GO:0006950)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|endometrium(1)|kidney(1)|large_intestine(11)|lung(10)|pancreas(1)|prostate(1)	28						TACATTCATATGGGTTCTCTC	0.393																																																	0													136.0	138.0	137.0					19																	12541042		2203	4300	6503	SO:0001819	synonymous_variant	0			AB011414	CCDS32918.1	19p13.13	2013-01-08			ENSG00000180855	ENSG00000180855		"""Zinc fingers, C2H2-type"", ""-"""	20878	protein-coding gene	gene with protein product		606697				9731181	Standard	NM_005815		Approved	ZK1	uc002mtu.3	Q9Y2A4	OTTHUMG00000156404	ENST00000301547.5:c.1944A>G	19.37:g.12541042T>C				Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.P648	ENST00000301547.5	37	c.1944	CCDS32918.1	19																																																																																			ZNF443	-	pfscan_Znf_C2H2	ENSG00000180855		0.393	ZNF443-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF443	HGNC	protein_coding	OTTHUMT00000344084.1		0.00	133	0	T	NM_005815		12541042	-1			no_errors	ENST00000301547	ensembl	human	known	74_37	silent	10.87	82	10	SNP	0.000	C
ZNF429	353088	genome.wustl.edu	37	19	21712490	21712490	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr19:21712490G>A	ENST00000358491.4	+	2	242	c.34G>A	c.(34-36)Gaa>Aaa	p.E12K	ZNF429_ENST00000594022.1_3'UTR|ZNF429_ENST00000597078.1_Missense_Mutation_p.E12K	NM_001001415.2	NP_001001415.2	Q86V71	ZN429_HUMAN	zinc finger protein 429	12	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|kidney(2)|large_intestine(13)|lung(10)|ovary(2)|pancreas(1)|prostate(1)|soft_tissue(1)|upper_aerodigestive_tract(2)	34						TGTGGCCATAGAATTCTCTCT	0.443																																																	0													90.0	99.0	96.0					19																	21712490		2203	4299	6502	SO:0001583	missense	0			AY269786	CCDS42537.1	19p12	2014-02-14			ENSG00000197013	ENSG00000197013		"""Zinc fingers, C2H2-type"", ""-"""	20817	protein-coding gene	gene with protein product							Standard	NM_001001415		Approved		uc002nqd.1	Q86V71	OTTHUMG00000182848	ENST00000358491.4:c.34G>A	19.37:g.21712490G>A	ENSP00000351280:p.Glu12Lys		A6NLV7|Q9BZE6	Missense_Mutation	SNP	pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box	p.E12K	ENST00000358491.4	37	c.34	CCDS42537.1	19	.	.	.	.	.	.	.	.	.	.	.	9.727	1.161185	0.21538	.	.	ENSG00000197013	ENST00000358491	T	0.01767	4.65	0.926	0.926	0.19430	Krueppel-associated box (4);	.	.	.	.	T	0.07279	0.0184	M	0.79258	2.445	0.22918	N	0.998567	D	0.89917	1.0	D	0.87578	0.998	T	0.26573	-1.0099	9	0.62326	D	0.03	.	3.0573	0.06188	0.0:0.2907:0.4181:0.2912	.	12	Q86V71	ZN429_HUMAN	K	12	ENSP00000351280:E12K	ENSP00000351280:E12K	E	+	1	0	ZNF429	21504330	0.494000	0.26043	0.070000	0.20053	0.080000	0.17528	-0.167000	0.09940	0.308000	0.22923	0.313000	0.20887	GAA	ZNF429	-	pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box	ENSG00000197013		0.443	ZNF429-003	NOVEL	basic|appris_principal|CCDS	protein_coding	ZNF429	HGNC	protein_coding	OTTHUMT00000463981.1	-	0.00	97	0	G	NM_001001415		21712490	+1	tier1	-	no_errors	ENST00000597078	ensembl	human	putative	74_37	missense	34.34	65	34	SNP	0.940	A
ZNF428	126299	genome.wustl.edu	37	19	44112223	44112223	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr19:44112223G>A	ENST00000300811.3	-	3	559	c.113C>T	c.(112-114)tCa>tTa	p.S38L	SRRM5_ENST00000607544.1_Intron|SRRM5_ENST00000526798.1_Intron	NM_182498.3	NP_872304.2	Q96B54	ZN428_HUMAN	zinc finger protein 428	38	Glu-rich.						metal ion binding (GO:0046872)			endometrium(1)|kidney(1)|large_intestine(1)|lung(1)|prostate(1)	5		Prostate(69;0.0153)				GTCCGGCTCTGAGAGAGTGTA	0.552																																																	0													36.0	36.0	36.0					19																	44112223		2173	4219	6392	SO:0001583	missense	0			AY257197	CCDS12626.1	19q13.31	2008-05-02	2006-07-04	2006-07-04				"""Zinc fingers, C2H2-type"""	20804	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 37"""	C19orf37			Standard	NM_182498		Approved	MGC51082, Zfp428	uc002oxa.3	Q96B54		ENST00000300811.3:c.113C>T	19.37:g.44112223G>A	ENSP00000300811:p.Ser38Leu		O95054|Q6X3Y3	Missense_Mutation	SNP	pfscan_Znf_C2H2	p.S38L	ENST00000300811.3	37	c.113	CCDS12626.1	19	.	.	.	.	.	.	.	.	.	.	G	17.48	3.399185	0.62177	.	.	ENSG00000131116	ENST00000300811;ENST00000391964	.	.	.	4.77	4.77	0.60923	.	0.000000	0.36893	N	0.002352	T	0.54287	0.1849	N	0.14661	0.345	0.36112	D	0.844873	P	0.51449	0.945	D	0.66351	0.943	T	0.66348	-0.5946	9	0.87932	D	0	-1.2052	13.1514	0.59492	0.0:0.0:1.0:0.0	.	38	Q96B54	ZN428_HUMAN	L	38	.	ENSP00000300811:S38L	S	-	2	0	ZNF428	48804063	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	4.029000	0.57253	2.483000	0.83821	0.563000	0.77884	TCA	ZNF428	-	NULL	ENSG00000131116		0.552	ZNF428-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF428	HGNC	protein_coding	OTTHUMT00000463349.1	-	0.00	36	0	G	NM_182498		44112223	-1	tier1	-	no_errors	ENST00000300811	ensembl	human	known	74_37	missense	35.00	13	7	SNP	1.000	A
ZNF350	59348	genome.wustl.edu	37	19	52468501	52468501	+	Missense_Mutation	SNP	T	T	C	rs150778438		TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr19:52468501T>C	ENST00000243644.4	-	5	1432	c.1205A>G	c.(1204-1206)tAt>tGt	p.Y402C	HCCAT3_ENST00000595010.1_RNA|ZNF350_ENST00000600703.1_5'Flank|HCCAT3_ENST00000600253.1_RNA	NM_021632.3	NP_067645.3	Q9GZX5	ZN350_HUMAN	zinc finger protein 350	402					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(3)|kidney(3)|large_intestine(7)|lung(5)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	26		all_neural(266;0.0505)		GBM - Glioblastoma multiforme(134;0.00124)|OV - Ovarian serous cystadenocarcinoma(262;0.0179)		GTTACAGCCATAGGGTCTCTC	0.453																																																	0								T	CYS/TYR	0,4406		0,0,2203	81.0	74.0	77.0		1205	2.4	0.4	19	dbSNP_134	77	2,8598	2.2+/-6.3	0,2,4298	no	missense	ZNF350	NM_021632.3	194	0,2,6501	CC,CT,TT		0.0233,0.0,0.0154	probably-damaging	402/533	52468501	2,13004	2203	4300	6503	SO:0001583	missense	0			AF295096	CCDS12845.1	19q13.41	2013-05-23			ENSG00000256683	ENSG00000256683		"""Zinc fingers, C2H2-type"", ""-"""	16656	protein-coding gene	gene with protein product		605422				11090615, 11161714	Standard	NM_021632		Approved	ZBRK1, ZFQR	uc002pyd.3	Q9GZX5	OTTHUMG00000182538	ENST00000243644.4:c.1205A>G	19.37:g.52468501T>C	ENSP00000243644:p.Tyr402Cys		Q96G73|Q9HAQ4	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.Y402C	ENST00000243644.4	37	c.1205	CCDS12845.1	19	.	.	.	.	.	.	.	.	.	.	T	11.80	1.746486	0.30955	0.0	2.33E-4	ENSG00000256683	ENST00000243644	T	0.25414	1.8	3.52	2.42	0.29668	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.33515	N	0.004825	T	0.26774	0.0655	M	0.76433	2.335	0.09310	N	1	P	0.48016	0.904	B	0.41571	0.36	T	0.25916	-1.0118	10	0.87932	D	0	.	6.9089	0.24325	0.4422:0.0:0.0:0.5578	.	402	Q9GZX5	ZN350_HUMAN	C	402	ENSP00000243644:Y402C	ENSP00000243644:Y402C	Y	-	2	0	ZNF350	57160313	0.000000	0.05858	0.430000	0.26722	0.681000	0.39784	-0.420000	0.07062	1.483000	0.48342	0.482000	0.46254	TAT	ZNF350	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000256683		0.453	ZNF350-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF350	HGNC	protein_coding	OTTHUMT00000462278.1	-	0.00	74	0	T	NM_021632		52468501	-1	tier1	rs150778438	no_errors	ENST00000243644	ensembl	human	known	74_37	missense	38.00	31	19	SNP	0.046	C
ZNF512B	57473	genome.wustl.edu	37	20	62592679	62592679	+	Missense_Mutation	SNP	G	G	T	rs112150897		TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr20:62592679G>T	ENST00000450537.1	-	16	2470	c.2410C>A	c.(2410-2412)Ctg>Atg	p.L804M	ZNF512B_ENST00000369888.1_Missense_Mutation_p.L804M|ZNF512B_ENST00000217130.3_Missense_Mutation_p.L804M			Q96KM6	Z512B_HUMAN	zinc finger protein 512B	804					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|cervix(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|lung(16)|ovary(1)|prostate(4)|skin(1)	33	all_cancers(38;2.14e-11)|all_epithelial(29;3.41e-13)|Lung NSC(23;3.41e-09)|all_lung(23;1.06e-08)					TGGGTCTTCAGGATGTGGTAT	0.642																																																	0													93.0	80.0	85.0					20																	62592679		2203	4300	6503	SO:0001583	missense	0			AB033022	CCDS13548.1	20q13.33	2011-02-09			ENSG00000196700	ENSG00000196700			29212	protein-coding gene	gene with protein product						10574462	Standard	NM_020713		Approved	GM632, MGC149845, MGC149846	uc002yhl.2	Q96KM6	OTTHUMG00000033008	ENST00000450537.1:c.2410C>A	20.37:g.62592679G>T	ENSP00000393795:p.Leu804Met		Q08AK9|Q9ULM4	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.L804M	ENST00000450537.1	37	c.2410	CCDS13548.1	20	.	.	.	.	.	.	.	.	.	.	G	17.12	3.308006	0.60305	.	.	ENSG00000196700	ENST00000369888;ENST00000450537;ENST00000217130	T;T;T	0.24723	1.84;1.84;1.84	5.23	4.21	0.49690	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);	0.132495	0.49916	D	0.000130	T	0.38772	0.1053	L	0.40543	1.245	0.31519	N	0.662679	D	0.76494	0.999	D	0.80764	0.994	T	0.27400	-1.0075	10	0.36615	T	0.2	-31.1214	12.5207	0.56058	0.0:0.0:0.7437:0.2563	.	804	Q96KM6	Z512B_HUMAN	M	804	ENSP00000358904:L804M;ENSP00000393795:L804M;ENSP00000217130:L804M	ENSP00000217130:L804M	L	-	1	2	ZNF512B	62063123	1.000000	0.71417	1.000000	0.80357	0.923000	0.55619	2.519000	0.45546	2.448000	0.82819	0.591000	0.81541	CTG	ZNF512B	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000196700		0.642	ZNF512B-202	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF512B	HGNC	protein_coding	OTTHUMT00000080246.1	-	0.00	55	0	G	NM_020713		62592679	-1	tier1	-	no_errors	ENST00000217130	ensembl	human	known	74_37	missense	26.67	33	12	SNP	1.000	T
ZNF737	100129842	genome.wustl.edu	37	19	20736632	20736632	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr19:20736632G>T	ENST00000427401.4	-	2	107	c.13C>A	c.(13-15)Caa>Aaa	p.Q5K	ZNF737_ENST00000596797.1_Missense_Mutation_p.Q5K|CTC-513N18.7_ENST00000595094.1_lincRNA	NM_001159293.1	NP_001152765.1	O75373	ZN737_HUMAN	zinc finger protein 737	5	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|kidney(1)|lung(7)|ovary(1)|stomach(1)|urinary_tract(1)	13						TCTCTAAATTGCAATGGCCCC	0.408																																																	0													31.0	28.0	29.0					19																	20736632		692	1591	2283	SO:0001583	missense	0			BC015765	CCDS54238.1	19p12	2013-01-08						"""Zinc fingers, C2H2-type"", ""-"""	32468	protein-coding gene	gene with protein product		603984					Standard	NM_001159293		Approved	ZNF102	uc002npa.3	O75373		ENST00000427401.4:c.13C>A	19.37:g.20736632G>T	ENSP00000395733:p.Gln5Lys		C9JHM3	Nonsense_Mutation	SNP	NULL	p.C37*	ENST00000427401.4	37	c.111	CCDS54238.1	19	.	.	.	.	.	.	.	.	.	.	N	5.345	0.248921	0.10130	.	.	ENSG00000237440	ENST00000427401	T	0.01613	4.73	0.819	-1.64	0.08318	.	.	.	.	.	T	0.00666	0.0022	N	0.00801	-1.175	0.09310	N	0.999999	B	0.02656	0.0	B	0.08055	0.003	T	0.46857	-0.9161	9	0.66056	D	0.02	.	2.9567	0.05878	0.0:0.0:0.5111:0.4888	.	5	C9JHM3	.	K	5	ENSP00000395733:Q5K	ENSP00000395733:Q5K	Q	-	1	0	ZNF737	20528472	0.014000	0.17966	0.108000	0.21378	0.117000	0.20001	0.250000	0.18235	0.191000	0.20236	0.194000	0.17425	CAA	ZNF737	-	NULL	ENSG00000237440		0.408	ZNF737-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF737	HGNC	protein_coding	OTTHUMT00000447844.2	-	0.00	70	0	G	NM_145289		20736632	-1	tier1	-	no_errors	ENST00000597940	ensembl	human	known	74_37	nonsense	7.14	52	4	SNP	0.006	T
ZNF582	147948	genome.wustl.edu	37	19	56895658	56895658	+	Missense_Mutation	SNP	A	A	T			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr19:56895658A>T	ENST00000301310.4	-	5	1286	c.1128T>A	c.(1126-1128)ttT>ttA	p.F376L	ZNF582_ENST00000586929.1_Missense_Mutation_p.F376L	NM_144690.1	NP_653291.1	Q96NG8	ZN582_HUMAN	zinc finger protein 582	376					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(7)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	26		Colorectal(82;0.000256)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0547)		AGCTCACTCTAAAGGCCTTTC	0.443																																					Ovarian(183;1887 2032 4349 30507 51343)												0													98.0	95.0	96.0					19																	56895658		2203	4300	6503	SO:0001583	missense	0			AK055489	CCDS33121.1	19q13.43	2013-07-15			ENSG00000018869	ENSG00000018869		"""Zinc fingers, C2H2-type"", ""-"""	26421	protein-coding gene	gene with protein product		615600				12477932	Standard	NM_144690		Approved	FLJ30927	uc002qmz.1	Q96NG8	OTTHUMG00000181939	ENST00000301310.4:c.1128T>A	19.37:g.56895658A>T	ENSP00000301310:p.Phe376Leu		B4DQZ9|B7Z9R3|Q6PJT6	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.F376L	ENST00000301310.4	37	c.1128	CCDS33121.1	19	.	.	.	.	.	.	.	.	.	.	A	20.9	4.067009	0.76301	.	.	ENSG00000018869	ENST00000301310	T	0.46063	0.88	5.0	-6.28	0.02020	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.36409	N	0.002602	T	0.64405	0.2595	M	0.90425	3.115	0.09310	N	0.999991	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.993	T	0.65117	-0.6246	10	0.87932	D	0	.	15.4083	0.74897	0.3106:0.0:0.6894:0.0	.	376;407	Q96NG8;B4DQZ9	ZN582_HUMAN;.	L	376	ENSP00000301310:F376L	ENSP00000301310:F376L	F	-	3	2	ZNF582	61587470	0.000000	0.05858	0.001000	0.08648	0.114000	0.19823	-1.312000	0.02720	-0.987000	0.03494	0.533000	0.62120	TTT	ZNF582	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000018869		0.443	ZNF582-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF582	HGNC	protein_coding	OTTHUMT00000458387.2	-	0.00	35	0	A	NM_144690		56895658	-1	tier1	-	no_errors	ENST00000301310	ensembl	human	known	74_37	missense	45.71	19	16	SNP	0.004	T
ZNF788	388507	genome.wustl.edu	37	19	12203239	12203239	+	5'UTR	SNP	C	C	G			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr19:12203239C>G	ENST00000339302.4	+	0	162				ZNF788_ENST00000596883.1_5'UTR|ZNF788_ENST00000430298.2_5'UTR|ZNF788_ENST00000397755.2_3'UTR			Q6ZQV5	ZN788_HUMAN	zinc finger family member 788						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)	2						CTGTGTTCCTCTCTAGTCACA	0.587																																					Melanoma(116;440 1644 18510 25456 49479)												0																																										SO:0001623	5_prime_UTR_variant	0			AI566055		19p13.2	2013-01-08	2006-08-16		ENSG00000214189	ENSG00000214189		"""Zinc fingers, C2H2-type"""	33112	protein-coding gene	gene with protein product							Standard	NR_027049		Approved	FLJ46419	uc002mtd.3	Q6ZQV5	OTTHUMG00000156416	ENST00000339302.4:c.-476C>G	19.37:g.12203239C>G			Q6ZRE4	RNA	SNP	-	NULL	ENST00000339302.4	37	NULL		19																																																																																			ZNF788	-	-	ENSG00000214189		0.587	ZNF788-201	KNOWN	basic|appris_principal	protein_coding	ZNF788	HGNC	protein_coding		-	0.00	74	0	C	XM_930581		12203239	+1	tier1	-	no_errors	ENST00000397755	ensembl	human	known	74_37	rna	27.12	43	16	SNP	0.026	G
ZNF772	400720	genome.wustl.edu	37	19	57985077	57985077	+	Silent	SNP	A	A	T			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr19:57985077A>T	ENST00000343280.4	-	5	1295	c.1035T>A	c.(1033-1035)acT>acA	p.T345T	AC004076.9_ENST00000415705.3_Intron|ZNF772_ENST00000425074.3_3'UTR|ZNF772_ENST00000427512.2_Silent_p.T233T|ZNF772_ENST00000600175.1_Intron|AC004076.9_ENST00000596831.1_Intron|ZNF772_ENST00000601768.1_Intron|ZNF772_ENST00000356584.3_Silent_p.T304T	NM_001024596.2	NP_001019767.1	Q68DY9	ZN772_HUMAN	zinc finger protein 772	345					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(1)|large_intestine(4)|lung(3)	9		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)|Lung(386;0.174)		GCCTTGCTCCAGTGTGTACTC	0.418																																					Melanoma(5;289 436 14293 15924 30817)												0													118.0	109.0	112.0					19																	57985077		2203	4300	6503	SO:0001819	synonymous_variant	0			BX647068	CCDS33133.1, CCDS46210.1	19q13.43	2013-01-08				ENSG00000197128		"""Zinc fingers, C2H2-type"", ""-"""	33106	protein-coding gene	gene with protein product							Standard	NM_001024596		Approved	DKFZp686I1569	uc002qot.3	Q68DY9		ENST00000343280.4:c.1035T>A	19.37:g.57985077A>T			A6NJK9|B4DH56|B4DYS0	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.T345	ENST00000343280.4	37	c.1035	CCDS33133.1	19																																																																																			ZNF772	-	pfscan_Znf_C2H2	ENSG00000197128		0.418	ZNF772-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF772	HGNC	protein_coding	OTTHUMT00000397447.1	-	0.00	58	0	A	NM_001024596		57985077	-1	tier1	-	no_errors	ENST00000343280	ensembl	human	known	74_37	silent	40.58	41	28	SNP	0.998	T
ZSCAN25	221785	genome.wustl.edu	37	7	99226869	99226869	+	Silent	SNP	G	G	A			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr7:99226869G>A	ENST00000394152.2	+	8	1188	c.861G>A	c.(859-861)gcG>gcA	p.A287A	ZSCAN25_ENST00000262941.6_Silent_p.A215A|ZSCAN25_ENST00000334715.3_Silent_p.A287A|ZSCAN25_ENST00000466948.1_Intron	NM_145115.2	NP_660090.2	Q6NSZ9	ZSC25_HUMAN	zinc finger and SCAN domain containing 25	287					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)										TGAAAGGGGCGCTGGTGGCAC	0.602																																																	0													70.0	76.0	74.0					7																	99226869		2203	4300	6503	SO:0001819	synonymous_variant	0			AK057030	CCDS5671.2	7q22.1	2013-01-09	2013-01-09	2013-01-09	ENSG00000197037	ENSG00000197037		"""-"", ""Zinc fingers, C2H2-type"""	21961	protein-coding gene	gene with protein product			"""zinc finger protein 498"""	ZNF498		11179890	Standard	XM_005250194		Approved	FLJ32468	uc003url.1	Q6NSZ9	OTTHUMG00000074055	ENST00000394152.2:c.861G>A	7.37:g.99226869G>A			A4D290|D6W5T5|Q14C82|Q14C99|Q5EBM9|Q6DJZ0|Q6N032|Q6ZML3	Silent	SNP	pfam_Tscrpt_reg_SCAN,pfam_Znf_C2H2,superfamily_Retrov_capsid_C,superfamily_Krueppel-associated_box,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Tscrpt_reg_SCAN	p.A287	ENST00000394152.2	37	c.861	CCDS5671.2	7																																																																																			ZSCAN25	-	NULL	ENSG00000197037		0.602	ZSCAN25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZSCAN25	HGNC	protein_coding	OTTHUMT00000157203.4	-	0.00	45	0	G	NM_145115		99226869	+1	tier1	-	no_errors	ENST00000334715	ensembl	human	known	74_37	silent	34.62	17	9	SNP	0.230	A
ZZEF1	23140	genome.wustl.edu	37	17	3981250	3981250	+	Silent	SNP	T	T	C			TCGA-LN-A4MR-01A-11D-A28B-09	TCGA-LN-A4MR-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ecf994e6-048e-4018-9722-ea4933b798d4	59ed9bfb-00bb-41ef-ad61-c64a5dacb24d	g.chr17:3981250T>C	ENST00000381638.2	-	19	3040	c.2916A>G	c.(2914-2916)ctA>ctG	p.L972L	ZZEF1_ENST00000574474.1_5'UTR	NM_015113.3	NP_055928.3	O43149	ZZEF1_HUMAN	zinc finger, ZZ-type with EF-hand domain 1	972							calcium ion binding (GO:0005509)|zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(17)|lung(19)|ovary(3)|pancreas(1)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(3)	84						AGCACCAGGATAGCAGGCTGC	0.527																																																	0													78.0	73.0	75.0					17																	3981250		2203	4300	6503	SO:0001819	synonymous_variant	0			BC035319	CCDS11043.1	17p13.3	2013-01-10	2004-11-03		ENSG00000074755	ENSG00000074755		"""Zinc fingers, ZZ-type"", ""EF-hand domain containing"""	29027	protein-coding gene	gene with protein product			"""zinc finger, ZZ-type with EF hand domain 1"""			9455477	Standard	XM_005256560		Approved	KIAA0399, ZZZ4, FLJ10821	uc002fxe.3	O43149	OTTHUMG00000090741	ENST00000381638.2:c.2916A>G	17.37:g.3981250T>C			A7MBM5|Q6NXG0|Q6ZRA1|Q6ZSF4|Q9NVB9	Silent	SNP	pfam_Znf_ZZ,pfam_APC_su10/DOC_dom,superfamily_Galactose-bd-like,superfamily_CUB_dom,smart_EF_hand_dom,smart_Znf_ZZ,pfscan_EF_hand_dom,pfscan_Znf_ZZ	p.L972	ENST00000381638.2	37	c.2916	CCDS11043.1	17																																																																																			ZZEF1	-	NULL	ENSG00000074755		0.527	ZZEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZZEF1	HGNC	protein_coding	OTTHUMT00000207480.1	-	0.00	19	0	T	NM_015113		3981250	-1	tier1	-	no_errors	ENST00000381638	ensembl	human	known	74_37	silent	29.17	17	7	SNP	0.871	C
