#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name	i_deletion_substructures	i_domain	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_header	i_normal_VAF	i_normal_ref_reads	i_normal_var_reads	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_tier	i_title	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_VAF	i_tumor_ref_reads	i_tumor_var_reads	i_type	i_ucsc_cons	i_variant
AASDH	132949	genome.wustl.edu	37	4	57216134	57216134	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr4:57216134G>A	ENST00000205214.6	-	11	1963	c.1783C>T	c.(1783-1785)Ctc>Ttc	p.L595F	AASDH_ENST00000434343.2_Missense_Mutation_p.L110F|AASDH_ENST00000602986.1_Missense_Mutation_p.L442F|AASDH_ENST00000502617.1_Missense_Mutation_p.L595F|AASDH_ENST00000513376.1_Missense_Mutation_p.L495F|AASDH_ENST00000451613.1_Missense_Mutation_p.L595F	NM_181806.2	NP_861522.2	Q4L235	ACSF4_HUMAN	aminoadipate-semialdehyde dehydrogenase	595	Acyl carrier. {ECO:0000255|PROSITE- ProRule:PRU00258}.				fatty acid metabolic process (GO:0006631)		acid-thiol ligase activity (GO:0016878)|ATP binding (GO:0005524)			endometrium(2)|kidney(2)|large_intestine(8)|lung(17)|ovary(4)|prostate(3)|skin(2)|stomach(1)|urinary_tract(1)	40	Glioma(25;0.08)|all_neural(26;0.101)	all_hematologic(202;0.0017)				TCACTGAGGAGCCGGATGGAC	0.403																																																	0													38.0	39.0	39.0					4																	57216134		2198	4300	6498	SO:0001583	missense	0			AF516672	CCDS3504.1, CCDS68705.1, CCDS68706.1, CCDS75126.1, CCDS75127.1	4q12	2010-12-14			ENSG00000157426	ENSG00000157426	1.2.1.31	"""Acyl-CoA synthetase family"""	23993	protein-coding gene	gene with protein product	"""acyl-CoA synthetase family member 4"""	614365				15865210, 12712191, 17762044	Standard	XM_005265721		Approved	NRPS998, LYS2, ACSF4	uc003hbn.3	Q4L235	OTTHUMG00000128841	ENST00000205214.6:c.1783C>T	4.37:g.57216134G>A	ENSP00000205214:p.Leu595Phe		A5D8V3|A5PL22|Q63HK2|Q63HR7|Q6IPP8|Q6TFZ6|Q7Z5Y3|Q96BW4|Q9P064	Missense_Mutation	SNP	pfam_AMP-dep_Synth/Lig,pfam_Acyl_carrier_prot-like,superfamily_Quinonprotein_ADH-like_supfam,superfamily_Acyl_carrier_prot-like,smart_PQQ_beta_propeller_repeat,pfscan_Acyl_carrier_prot-like	p.L595F	ENST00000205214.6	37	c.1783	CCDS3504.1	4	.	.	.	.	.	.	.	.	.	.	G	10.94	1.493745	0.26774	.	.	ENSG00000157426	ENST00000205214;ENST00000513376;ENST00000434343;ENST00000451613;ENST00000503808;ENST00000502617	T;T;T;T;T	0.56776	0.44;0.44;0.44;0.44;0.44	5.92	3.24	0.37175	Acyl carrier protein-like (2);Phosphopantetheine-binding (1);	0.161068	0.56097	N	0.000029	T	0.42108	0.1188	L	0.41356	1.27	0.43632	D	0.996026	P;P;B;B	0.38420	0.63;0.458;0.228;0.145	B;B;B;B	0.42522	0.39;0.255;0.163;0.094	T	0.17776	-1.0358	10	0.25751	T	0.34	-5.5371	6.0846	0.19960	0.4067:0.0:0.5933:0.0	.	442;595;595;595	E9PH98;Q4L235-4;Q4L235-3;Q4L235	.;.;.;ACSF4_HUMAN	F	595;495;110;595;442;595	ENSP00000205214:L595F;ENSP00000423760:L495F;ENSP00000392158:L110F;ENSP00000409656:L595F;ENSP00000421171:L595F	ENSP00000205214:L595F	L	-	1	0	AASDH	56910891	1.000000	0.71417	0.999000	0.59377	0.501000	0.33797	2.220000	0.42908	1.513000	0.48852	0.655000	0.94253	CTC	AASDH	-	pfam_Acyl_carrier_prot-like,superfamily_Acyl_carrier_prot-like,pfscan_Acyl_carrier_prot-like	ENSG00000157426		0.403	AASDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AASDH	HGNC	protein_coding	OTTHUMT00000250780.1	-	0.00	94	0	G	NM_181806		57216134	-1	tier1	-	no_errors	ENST00000205214	ensembl	human	known	74_37	missense	20.97	47	13	SNP	0.993	A
ABCA10	10349	genome.wustl.edu	37	17	67197721	67197721	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr17:67197721C>A	ENST00000269081.4	-	11	2004	c.1095G>T	c.(1093-1095)gaG>gaT	p.E365D	ABCA10_ENST00000432313.2_Missense_Mutation_p.E365D|ABCA10_ENST00000416101.2_Missense_Mutation_p.E365D	NM_080282.3	NP_525021.3	Q8WWZ4	ABCAA_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 10	365					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(20)|lung(34)|ovary(2)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(4)	81	Breast(10;6.95e-12)					TTATTTCATTCTCAAAGATTT	0.338																																																	0													83.0	86.0	85.0					17																	67197721		2203	4299	6502	SO:0001583	missense	0			AY247065	CCDS11684.1	17q24	2012-03-14			ENSG00000154263	ENSG00000154263		"""ATP binding cassette transporters / subfamily A"""	30	protein-coding gene	gene with protein product		612508				12821155, 11435397	Standard	NM_080282		Approved	EST698739	uc010dfa.1	Q8WWZ4	OTTHUMG00000164716	ENST00000269081.4:c.1095G>T	17.37:g.67197721C>A	ENSP00000269081:p.Glu365Asp		C9JZH2|C9K035|Q6PIQ6|Q7Z2I9|Q7Z7P7|Q86TD2	Missense_Mutation	SNP	pfam_ABC_transporter-like,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.E365D	ENST00000269081.4	37	c.1095	CCDS11684.1	17	.	.	.	.	.	.	.	.	.	.	C	4.633	0.117674	0.08881	.	.	ENSG00000154263	ENST00000269081;ENST00000416101;ENST00000432313	D;D;D	0.87650	-2.28;-2.08;-1.8	2.78	1.79	0.24919	.	.	.	.	.	T	0.79021	0.4376	L	0.38838	1.175	0.49299	D	0.999774	B	0.14438	0.01	B	0.17722	0.019	T	0.70368	-0.4891	9	0.52906	T	0.07	.	6.5677	0.22521	0.0:0.7698:0.0:0.2302	.	365	Q8WWZ4	ABCAA_HUMAN	D	365	ENSP00000269081:E365D;ENSP00000407772:E365D;ENSP00000387674:E365D	ENSP00000269081:E365D	E	-	3	2	ABCA10	64709316	0.128000	0.22383	0.061000	0.19648	0.148000	0.21650	0.584000	0.23864	0.370000	0.24538	-0.357000	0.07601	GAG	ABCA10	-	NULL	ENSG00000154263		0.338	ABCA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA10	HGNC	protein_coding	OTTHUMT00000379881.4	-	0.00	103	0	C	NM_080282		67197721	-1	tier1	-	no_errors	ENST00000269081	ensembl	human	known	74_37	missense	5.88	64	4	SNP	0.800	A
ABCA7	10347	genome.wustl.edu	37	19	1044733	1044733	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr19:1044733G>T	ENST00000263094.6	+	11	1436	c.1205G>T	c.(1204-1206)cGa>cTa	p.R402L	ABCA7_ENST00000435683.2_Missense_Mutation_p.R264L|ABCA7_ENST00000433129.1_Missense_Mutation_p.R402L	NM_019112.3	NP_061985.2	Q8IZY2	ABCA7_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 7	402					apolipoprotein A-I-mediated signaling pathway (GO:0038027)|ATP catabolic process (GO:0006200)|cholesterol efflux (GO:0033344)|high-density lipoprotein particle assembly (GO:0034380)|memory (GO:0007613)|negative regulation of amyloid precursor protein biosynthetic process (GO:0042985)|negative regulation of ATPase activity (GO:0032780)|negative regulation of beta-amyloid formation (GO:1902430)|peptide cross-linking (GO:0018149)|phagocytosis (GO:0006909)|phospholipid efflux (GO:0033700)|phospholipid scrambling (GO:0017121)|positive regulation of ATPase activity (GO:0032781)|positive regulation of beta-amyloid clearance (GO:1900223)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of engulfment of apoptotic cell (GO:1901076)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phagocytosis (GO:0050766)|positive regulation of phospholipid efflux (GO:1902995)|protein localization to nucleus (GO:0034504)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|ATP-binding cassette (ABC) transporter complex (GO:0043190)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|phagocytic cup (GO:0001891)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	apolipoprotein A-I receptor activity (GO:0034188)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|phospholipid transporter activity (GO:0005548)|transporter activity (GO:0005215)			NS(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(7)|lung(22)|ovary(1)|pancreas(7)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	65		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		ACGCTGGGCCGAGTGACGGAG	0.672																																																	0													31.0	29.0	30.0					19																	1044733		2191	4293	6484	SO:0001583	missense	0			AF328787	CCDS12055.1	19p13.3	2012-03-14			ENSG00000064687	ENSG00000064687		"""ATP binding cassette transporters / subfamily A"""	37	protein-coding gene	gene with protein product		605414					Standard	NM_019112		Approved	ABCX	uc002lqw.4	Q8IZY2	OTTHUMG00000167547	ENST00000263094.6:c.1205G>T	19.37:g.1044733G>T	ENSP00000263094:p.Arg402Leu		Q96S58|Q9BZC4|Q9NR73|Q9UKP8	Missense_Mutation	SNP	pfam_ABC_transporter-like,superfamily_P-loop_NTPase,superfamily_GroES-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.R402L	ENST00000263094.6	37	c.1205	CCDS12055.1	19	.	.	.	.	.	.	.	.	.	.	G	12.58	1.981217	0.34942	.	.	ENSG00000064687	ENST00000263094;ENST00000433129	D;D	0.97455	-4.39;-4.39	4.04	-6.09	0.02145	.	.	.	.	.	D	0.92916	0.7746	L	0.49778	1.585	0.09310	N	1	B;B	0.14438	0.01;0.003	B;B	0.15870	0.014;0.004	D	0.83554	0.0103	9	0.66056	D	0.02	.	4.0607	0.09837	0.5033:0.0:0.2072:0.2895	.	264;402	Q8IZY2-2;Q8IZY2	.;ABCA7_HUMAN	L	402	ENSP00000263094:R402L;ENSP00000414062:R402L	ENSP00000263094:R402L	R	+	2	0	ABCA7	995733	0.000000	0.05858	0.001000	0.08648	0.005000	0.04900	-0.473000	0.06615	-0.916000	0.03818	-1.436000	0.01078	CGA	ABCA7	-	NULL	ENSG00000064687		0.672	ABCA7-001	KNOWN	basic|CCDS	protein_coding	ABCA7	HGNC	protein_coding	OTTHUMT00000394993.1	-	0.00	198	0	G	NM_019112		1044733	+1	tier1	-	no_errors	ENST00000263094	ensembl	human	known	74_37	missense	5.00	95	5	SNP	0.001	T
ABCC9	10060	genome.wustl.edu	37	12	22013930	22013930	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr12:22013930C>G	ENST00000261201.4	-	19	2398	c.2399G>C	c.(2398-2400)gGa>gCa	p.G800A	ABCC9_ENST00000261200.4_Missense_Mutation_p.G800A|RP11-729I10.2_ENST00000539874.1_RNA|ABCC9_ENST00000345162.2_Missense_Mutation_p.G764A	NM_005691.2	NP_005682.2	O60706	ABCC9_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 9	800	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				defense response to virus (GO:0051607)|potassium ion import (GO:0010107)|potassium ion transport (GO:0006813)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	ATP-sensitive potassium channel complex (GO:0008282)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcomere (GO:0030017)|voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|ion channel binding (GO:0044325)|potassium channel activity (GO:0005267)|potassium channel regulator activity (GO:0015459)|sulfonylurea receptor activity (GO:0008281)|transporter activity (GO:0005215)			NS(2)|breast(5)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(15)|lung(56)|ovary(4)|pancreas(1)|prostate(4)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(5)	118					Adenosine triphosphate(DB00171)|Glyburide(DB01016)	AGTTTGATCTCCAAATGGTAA	0.323																																																	0													109.0	107.0	107.0					12																	22013930		2203	4299	6502	SO:0001583	missense	0			AF061323	CCDS8693.1, CCDS8694.1	12p12.1	2014-09-17			ENSG00000069431	ENSG00000069431		"""ATP binding cassette transporters / subfamily C"""	60	protein-coding gene	gene with protein product	"""sulfonylurea receptor 2"""	601439				9457174, 15034580	Standard	NM_020297		Approved	SUR2, CMD1O	uc001rfh.3	O60706	OTTHUMG00000169094	ENST00000261201.4:c.2399G>C	12.37:g.22013930C>G	ENSP00000261201:p.Gly800Ala		O60707	Missense_Mutation	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_P-loop_NTPase,superfamily_ABC1_TM_dom,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC1_TM_dom,prints_Sulphorea_rcpt,prints_Sulphonylurea_rcpt-2	p.G800A	ENST00000261201.4	37	c.2399	CCDS8694.1	12	.	.	.	.	.	.	.	.	.	.	C	26.2	4.717807	0.89205	.	.	ENSG00000069431	ENST00000261200;ENST00000544039;ENST00000261201;ENST00000345162	D;D;D;D	0.92495	-3.05;-3.05;-3.05;-3.05	5.03	5.03	0.67393	ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.000000	0.85682	D	0.000000	D	0.96744	0.8937	M	0.88979	2.995	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.97341	0.9957	10	0.87932	D	0	-14.1768	18.5546	0.91079	0.0:1.0:0.0:0.0	.	800;800	O60706;O60706-2	ABCC9_HUMAN;.	A	800;427;800;764	ENSP00000261200:G800A;ENSP00000440521:G427A;ENSP00000261201:G800A;ENSP00000261202:G764A	ENSP00000261200:G800A	G	-	2	0	ABCC9	21905197	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.560000	0.82277	2.614000	0.88457	0.563000	0.77884	GGA	ABCC9	-	pfam_ABC_transporter-like,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like	ENSG00000069431		0.323	ABCC9-002	KNOWN	not_organism_supported|basic|CCDS	protein_coding	ABCC9	HGNC	protein_coding	OTTHUMT00000402230.1	-	0.00	76	0	C	NM_005691		22013930	-1	tier1	-	no_errors	ENST00000261200	ensembl	human	known	74_37	missense	19.05	34	8	SNP	1.000	G
ABCD3	5825	genome.wustl.edu	37	1	94946009	94946009	+	Intron	SNP	A	A	G			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr1:94946009A>G	ENST00000370214.4	+	9	708				ABCD3_ENST00000454898.2_Intron|ABCD3_ENST00000394233.2_Intron|ABCD3_ENST00000536817.1_Intron	NM_002858.3	NP_002849.1	P28288	ABCD3_HUMAN	ATP-binding cassette, sub-family D (ALD), member 3						ATP catabolic process (GO:0006200)|fatty acid beta-oxidation (GO:0006635)|peroxisome organization (GO:0007031)|transmembrane transport (GO:0055085)|very long-chain fatty acid catabolic process (GO:0042760)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|peroxisomal matrix (GO:0005782)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|protein homodimerization activity (GO:0042803)			breast(1)|endometrium(1)|kidney(3)|large_intestine(5)|liver(2)|lung(10)|ovary(1)|pancreas(1)|skin(2)	26		all_lung(203;0.000434)|Lung NSC(277;0.0019)		all cancers(265;0.0261)|Epithelial(280;0.165)		TTTCTCTCCCAATAATAATAG	0.358																																																	0													82.0	81.0	81.0					1																	94946009		2203	4300	6503	SO:0001627	intron_variant	0			M81182	CCDS749.1, CCDS44175.1	1p21.3	2012-05-16			ENSG00000117528	ENSG00000117528		"""ATP binding cassette transporters / subfamily D"""	67	protein-coding gene	gene with protein product		170995		PXMP1		1301993, 8449508	Standard	NM_002858		Approved	PMP70, ZWS2	uc001dqn.4	P28288	OTTHUMG00000010717	ENST00000370214.4:c.685-11A>G	1.37:g.94946009A>G			D3DT46|Q15271|Q6NUN5|Q96DA3|Q9H529	RNA	SNP	-	NULL	ENST00000370214.4	37	NULL	CCDS749.1	1																																																																																			ABCD3	-	-	ENSG00000117528		0.358	ABCD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCD3	HGNC	protein_coding	OTTHUMT00000029597.1	-	0.00	110	0	A	NM_002858		94946009	+1	tier1	-	no_errors	ENST00000493416	ensembl	human	known	74_37	rna	45.59	37	31	SNP	0.000	G
ABHD6	57406	genome.wustl.edu	37	3	58256768	58256768	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr3:58256768G>T	ENST00000478253.1	+	6	1001	c.500G>T	c.(499-501)aGc>aTc	p.S167I	ABHD6_ENST00000295962.4_Missense_Mutation_p.S167I			Q9BV23	ABHD6_HUMAN	abhydrolase domain containing 6	167					long term synaptic depression (GO:0060292)|negative regulation of cell migration (GO:0030336)|regulation of endocannabinoid signaling pathway (GO:2000124)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	acylglycerol lipase activity (GO:0047372)			NS(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(5)|ovary(2)|prostate(1)|skin(1)	16				BRCA - Breast invasive adenocarcinoma(55;0.000225)|KIRC - Kidney renal clear cell carcinoma(284;0.0471)|Kidney(284;0.0589)|OV - Ovarian serous cystadenocarcinoma(275;0.209)		GATGTCTCCAGCCTGTGTCTC	0.527																																																	0													162.0	117.0	132.0					3																	58256768		2203	4300	6503	SO:0001583	missense	0			AF225418	CCDS2887.1	3p21.2	2006-03-10			ENSG00000163686	ENSG00000163686		"""Abhydrolase domain containing"""	21398	protein-coding gene	gene with protein product							Standard	NM_020676		Approved		uc003djs.4	Q9BV23	OTTHUMG00000159150	ENST00000478253.1:c.500G>T	3.37:g.58256768G>T	ENSP00000420315:p.Ser167Ile		B2R7Y9|Q6ZMF7	Missense_Mutation	SNP	pfam_AB_hydrolase_1,pfam_Ndr,prints_AB_hydrolase_1,prints_Epox_hydrolase-like	p.S167I	ENST00000478253.1	37	c.500	CCDS2887.1	3	.	.	.	.	.	.	.	.	.	.	G	21.9	4.214310	0.79352	.	.	ENSG00000163686	ENST00000478253;ENST00000295962;ENST00000511761;ENST00000463756;ENST00000485900	T;T;T;T	0.69926	-0.44;-0.44;-0.44;-0.44	6.17	6.17	0.99709	Alpha/beta hydrolase fold-1 (1);	0.036407	0.85682	D	0.000000	T	0.75027	0.3794	M	0.84846	2.72	0.51482	D	0.999923	P;P	0.50443	0.889;0.935	B;B	0.43575	0.412;0.424	T	0.77816	-0.2447	10	0.48119	T	0.1	-6.4187	20.4898	0.99202	0.0:0.0:1.0:0.0	.	167;167	Q9BV23;F5H7L1	ABHD6_HUMAN;.	I	167	ENSP00000420315:S167I;ENSP00000295962:S167I;ENSP00000420408:S167I;ENSP00000418934:S167I	ENSP00000295962:S167I	S	+	2	0	ABHD6	58231808	1.000000	0.71417	1.000000	0.80357	0.361000	0.29550	9.315000	0.96313	2.941000	0.99782	0.655000	0.94253	AGC	ABHD6	-	pfam_AB_hydrolase_1,pfam_Ndr,prints_AB_hydrolase_1,prints_Epox_hydrolase-like	ENSG00000163686		0.527	ABHD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABHD6	HGNC	protein_coding	OTTHUMT00000353511.1	-	0.00	84	0	G	NM_020676		58256768	+1	tier1	-	no_errors	ENST00000295962	ensembl	human	known	74_37	missense	14.29	24	4	SNP	1.000	T
AGRN	375790	genome.wustl.edu	37	1	987191	987191	+	Nonsense_Mutation	SNP	G	G	T	rs139415524	byFrequency	TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr1:987191G>T	ENST00000379370.2	+	33	5697	c.5647G>T	c.(5647-5649)Gag>Tag	p.E1883*		NM_198576.3	NP_940978.2	O00468	AGRIN_HUMAN	agrin	1887	Laminin G-like 3. {ECO:0000255|PROSITE- ProRule:PRU00122}.				axon guidance (GO:0007411)|carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|clustering of voltage-gated sodium channels (GO:0045162)|extracellular matrix organization (GO:0030198)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|neuromuscular junction development (GO:0007528)|neurotransmitter receptor metabolic process (GO:0045213)|phototransduction, visible light (GO:0007603)|plasma membrane organization (GO:0007009)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of synaptic growth at neuromuscular junction (GO:0045887)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|receptor clustering (GO:0043113)|retinoid metabolic process (GO:0001523)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synapse organization (GO:0050808)	basal lamina (GO:0005605)|cell junction (GO:0030054)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)|synapse (GO:0045202)	acetylcholine receptor regulator activity (GO:0030548)|calcium ion binding (GO:0005509)|chondroitin sulfate binding (GO:0035374)|dystroglycan binding (GO:0002162)|heparan sulfate proteoglycan binding (GO:0043395)|laminin binding (GO:0043236)|sialic acid binding (GO:0033691)|structural constituent of cytoskeleton (GO:0005200)			breast(1)|central_nervous_system(2)|endometrium(8)|kidney(3)|large_intestine(2)|lung(20)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	42	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		UCEC - Uterine corpus endometrioid carcinoma (11;0.00462)|Epithelial(90;5.98e-38)|OV - Ovarian serous cystadenocarcinoma(86;5.43e-23)|Colorectal(212;5.97e-05)|COAD - Colon adenocarcinoma(227;0.000201)|Kidney(185;0.0024)|BRCA - Breast invasive adenocarcinoma(365;0.00246)|STAD - Stomach adenocarcinoma(132;0.00645)|KIRC - Kidney renal clear cell carcinoma(229;0.0354)|Lung(427;0.201)		CGCTGTGACCGAGAGGTAACG	0.652																																																	0													123.0	97.0	106.0					1																	987191		2203	4300	6503	SO:0001587	stop_gained	0			XM_372195	CCDS30551.1	1p36.33	2014-09-17		2007-02-16	ENSG00000188157	ENSG00000188157		"""Proteoglycans / Extracellular Matrix : Other"""	329	protein-coding gene	gene with protein product	"""agrin proteoglycan"""	103320				1851019, 12270958	Standard	NM_198576		Approved	AGRIN	uc001ack.2	O00468	OTTHUMG00000040778	ENST00000379370.2:c.5647G>T	1.37:g.987191G>T	ENSP00000368678:p.Glu1883*		Q5SVA1|Q5SVA2|Q60FE1|Q7KYS8|Q8N4J5|Q96IC1|Q9BTD4	Nonsense_Mutation	SNP	pfam_Laminin_G,pfam_Agrin_NtA,pfam_Kazal_dom,pfam_EGF_laminin,pfam_SEA_dom,pfam_EG-like_dom,superfamily_TIMP-like_OB-fold,superfamily_ConA-like_lec_gl_sf,smart_FacI_MAC,smart_Fol_N,smart_Kazal_dom,smart_EG-like_dom,smart_EGF_laminin,smart_SEA_dom,smart_EGF-like_Ca-bd_dom,smart_Laminin_G,pfscan_EG-like_dom,pfscan_EGF_laminin,pfscan_Laminin_G,pfscan_Agrin_NtA,pfscan_SEA_dom	p.E1883*	ENST00000379370.2	37	c.5647	CCDS30551.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	44|44	11.030906|11.030906	0.99505|0.99505	.|.	.|.	ENSG00000188157|ENSG00000188157	ENST00000379370;ENST00000379364|ENST00000419249	.|.	.|.	.|.	5.11|5.11	2.94|2.94	0.34122|0.34122	.|.	0.286819|.	0.27284|.	N|.	0.020069|.	.|T	.|0.29620	.|0.0739	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.25779	.|-1.0122	.|3	0.05436|.	T|.	0.98|.	-14.0265|-14.0265	2.7521|2.7521	0.05284|0.05284	0.183:0.0:0.5371:0.2798|0.183:0.0:0.5371:0.2798	.|.	.|.	.|.	.|.	X|L	1883;226|185	.|.	ENSP00000368671:E226X|.	E|R	+|+	1|2	0|0	AGRN|AGRN	977054|977054	1.000000|1.000000	0.71417|0.71417	0.960000|0.960000	0.40013|0.40013	0.238000|0.238000	0.25445|0.25445	4.838000|4.838000	0.62803|0.62803	2.409000|2.409000	0.81822|0.81822	0.555000|0.555000	0.69702|0.69702	GAG|CGA	AGRN	-	superfamily_ConA-like_lec_gl_sf,pfscan_Laminin_G	ENSG00000188157		0.652	AGRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AGRN	HGNC	protein_coding	OTTHUMT00000097990.2	-	0.00	102	0	G	NM_198576		987191	+1	tier1	-	no_errors	ENST00000379370	ensembl	human	known	74_37	nonsense	33.33	26	13	SNP	0.970	T
AKAP12	9590	genome.wustl.edu	37	6	151672917	151672917	+	Nonsense_Mutation	SNP	G	G	T	rs142987485		TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr6:151672917G>T	ENST00000253332.1	+	3	3580	c.3391G>T	c.(3391-3393)Gag>Tag	p.E1131*	AKAP12_ENST00000402676.2_Nonsense_Mutation_p.E1131*|AKAP12_ENST00000359755.5_Nonsense_Mutation_p.E1026*|AKAP12_ENST00000354675.6_Nonsense_Mutation_p.E1033*			Q02952	AKA12_HUMAN	A kinase (PRKA) anchor protein 12	1131					G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of protein kinase A signaling (GO:0010739)|protein targeting (GO:0006605)|regulation of protein kinase C signaling (GO:0090036)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|focal adhesion (GO:0005925)	adenylate cyclase binding (GO:0008179)|protein kinase A binding (GO:0051018)			breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(22)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	68		Ovarian(120;0.125)	BRCA - Breast invasive adenocarcinoma(37;0.175)	OV - Ovarian serous cystadenocarcinoma(155;2.98e-11)		AGAGAGCATAGAGTCCAGTGA	0.512																																					Melanoma(141;1616 1805 10049 24534 51979)												0													58.0	58.0	58.0					6																	151672917		2203	4300	6503	SO:0001587	stop_gained	0			U81607	CCDS5229.1, CCDS5230.1	6q24-q25	2011-07-01	2008-08-29		ENSG00000131016	ENSG00000131016		"""A-kinase anchor proteins"""	370	protein-coding gene	gene with protein product	"""gravin"", ""Src-Suppressed C Kinase Substrate"""	604698	"""A kinase (PRKA) anchor protein (gravin) 12"""			9000000	Standard	NM_144497		Approved	AKAP250, SSeCKS	uc011eep.2	Q02952	OTTHUMG00000015833	ENST00000253332.1:c.3391G>T	6.37:g.151672917G>T	ENSP00000253332:p.Glu1131*		O00310|O00498|Q4LE68|Q5SZ80|Q5TGN1|Q68D82|Q99970	Nonsense_Mutation	SNP	pfam_Pkinase-A_anch_WSK-motif,pfam_RII_binding_1	p.E1131*	ENST00000253332.1	37	c.3391	CCDS5229.1	6	.	.	.	.	.	.	.	.	.	.	G	38	6.898957	0.97920	.	.	ENSG00000131016	ENST00000402676;ENST00000253332;ENST00000354675;ENST00000359755	.	.	.	5.19	2.21	0.28008	.	0.388400	0.18933	N	0.127147	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.13470	T	0.59	.	11.3654	0.49668	0.0715:0.488:0.4404:0.0	.	.	.	.	X	1131;1131;1033;1026	.	ENSP00000253332:E1131X	E	+	1	0	AKAP12	151714610	0.003000	0.15002	0.001000	0.08648	0.029000	0.11900	0.960000	0.29253	0.539000	0.28788	0.455000	0.32223	GAG	AKAP12	-	NULL	ENSG00000131016		0.512	AKAP12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AKAP12	HGNC	protein_coding	OTTHUMT00000042712.1		0.00	67	0	G			151672917	+1			no_errors	ENST00000253332	ensembl	human	known	74_37	nonsense	5.56	34	2	SNP	0.000	T
ALS2	57679	genome.wustl.edu	37	2	202625891	202625891	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr2:202625891G>T	ENST00000264276.6	-	4	1198	c.826C>A	c.(826-828)Ctc>Atc	p.L276I	ALS2_ENST00000467448.1_Missense_Mutation_p.L276I|ALS2_ENST00000496244.1_5'Flank	NM_020919.3	NP_065970.2	Q96Q42	ALS2_HUMAN	amyotrophic lateral sclerosis 2 (juvenile)	276					behavioral fear response (GO:0001662)|cell death (GO:0008219)|endosomal transport (GO:0016197)|endosome organization (GO:0007032)|locomotory behavior (GO:0007626)|neuromuscular junction development (GO:0007528)|neuron projection morphogenesis (GO:0048812)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of Rab GTPase activity (GO:0032851)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rac protein signal transduction (GO:0035022)|positive regulation of Ran GTPase activity (GO:0032853)|protein localization (GO:0008104)|receptor recycling (GO:0001881)|regulation of endosome size (GO:0051036)|response to oxidative stress (GO:0006979)|synaptic transmission, glutamatergic (GO:0035249)|vesicle organization (GO:0016050)	centrosome (GO:0005813)|cytosol (GO:0005829)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|early endosome (GO:0005769)|growth cone (GO:0030426)|lamellipodium (GO:0030027)|postsynaptic density (GO:0014069)|protein complex (GO:0043234)|ruffle (GO:0001726)|vesicle (GO:0031982)	protein homodimerization activity (GO:0042803)|protein serine/threonine kinase activator activity (GO:0043539)|Rab GTPase binding (GO:0017137)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|Ran guanyl-nucleotide exchange factor activity (GO:0005087)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(22)|ovary(1)|prostate(4)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)	72						GAGGGGCTGAGAGCAGTGCTG	0.453																																																	0													133.0	133.0	133.0					2																	202625891		2070	4207	6277	SO:0001583	missense	0			AB053305	CCDS42800.1, CCDS46492.1	2q33-q35	2014-09-17	2004-06-23		ENSG00000003393	ENSG00000003393		"""Rho guanine nucleotide exchange factors"""	443	protein-coding gene	gene with protein product	"""alsin"""	606352	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 6"""	ALS2CR6		11586298	Standard	NM_020919		Approved		uc002uyo.3	Q96Q42	OTTHUMG00000154507	ENST00000264276.6:c.826C>A	2.37:g.202625891G>T	ENSP00000264276:p.Leu276Ile		Q53TT1|Q53TV2|Q8N1E0|Q96PC4|Q96Q41|Q9H973|Q9HCK9	Missense_Mutation	SNP	pfam_Reg_chr_condens,pfam_MORN,pfam_VPS9,pfam_DH-domain,superfamily_RCC1/BLIP-II,superfamily_DH-domain,smart_MORN,pfscan_VPS9,pfscan_Reg_chr_condens,pfscan_DH-domain,prints_Reg_chr_condens	p.L276I	ENST00000264276.6	37	c.826	CCDS42800.1	2	.	.	.	.	.	.	.	.	.	.	G	6.487	0.458087	0.12342	.	.	ENSG00000003393	ENST00000264276;ENST00000467448	T;T	0.55052	0.54;0.82	6.17	-2.17	0.07059	.	1.005780	0.07986	N	0.986370	T	0.23649	0.0572	N	0.08118	0	0.39717	D	0.971411	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.01281	0.0;0.0;0.0;0.0	T	0.34800	-0.9814	10	0.15066	T	0.55	.	2.0439	0.03556	0.1096:0.1983:0.3237:0.3684	.	276;276;276;276	Q96Q42-2;Q96Q42-3;Q6IQ41;Q96Q42	.;.;.;ALS2_HUMAN	I	276	ENSP00000264276:L276I;ENSP00000429223:L276I	ENSP00000264276:L276I	L	-	1	0	ALS2	202334136	0.000000	0.05858	0.858000	0.33744	0.868000	0.49771	-0.426000	0.07008	-0.252000	0.09528	-0.262000	0.10625	CTC	ALS2	-	NULL	ENSG00000003393		0.453	ALS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALS2	HGNC	protein_coding	OTTHUMT00000335562.3		0.00	43	0	G	NM_020919		202625891	-1			no_errors	ENST00000264276	ensembl	human	known	74_37	missense	9.68	28	3	SNP	0.558	T
ANHX	647589	genome.wustl.edu	37	12	133795907	133795907	+	Missense_Mutation	SNP	A	A	C			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr12:133795907A>C	ENST00000545940.1	-	7	2753	c.1015T>G	c.(1015-1017)Tct>Gct	p.S339A	ANHX_ENST00000419717.1_Missense_Mutation_p.S339A			E9PGG2	ANHX_HUMAN	anomalous homeobox	339					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)										TCCATGGCAGACACAGGGCCG	0.597																																																	0																																										SO:0001583	missense	0				CCDS53855.1	12q24.33	2012-05-18			ENSG00000227059	ENSG00000227059			40024	protein-coding gene	gene with protein product							Standard	NM_001191054		Approved		uc010tci.2	E9PGG2	OTTHUMG00000167949	ENST00000545940.1:c.1015T>G	12.37:g.133795907A>C	ENSP00000439513:p.Ser339Ala		Q96MC1	Missense_Mutation	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom	p.S339A	ENST00000545940.1	37	c.1015	CCDS53855.1	12	.	.	.	.	.	.	.	.	.	.	A	12.08	1.831610	0.32329	.	.	ENSG00000227059	ENST00000545940;ENST00000419717	T;T	0.32753	1.44;1.44	3.83	1.4	0.22301	.	.	.	.	.	T	0.17238	0.0414	L	0.27053	0.805	0.09310	N	1	P	0.52842	0.956	B	0.39419	0.299	T	0.10847	-1.0612	8	.	.	.	.	5.7024	0.17889	0.7744:0.0:0.2256:0.0	.	339	E9PGG2	.	A	339	ENSP00000439513:S339A;ENSP00000409950:S339A	.	S	-	1	0	AC226150.2	.	0.004000	0.15560	0.009000	0.14445	0.416000	0.31233	0.166000	0.16583	0.296000	0.22592	0.533000	0.62120	TCT	ANHX	-	NULL	ENSG00000227059		0.597	ANHX-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	ANHX	HGNC	protein_coding	OTTHUMT00000397203.1	-	0.00	33	0	A			133795907	-1	tier1	-	no_errors	ENST00000419717	ensembl	human	known	74_37	missense	52.17	11	12	SNP	0.010	C
ANKRD36B	57730	genome.wustl.edu	37	2	98167802	98167802	+	RNA	SNP	G	G	C			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr2:98167802G>C	ENST00000443455.1	-	0	1435							Q8N2N9	AN36B_HUMAN	ankyrin repeat domain 36B																		ATTCGAAAAAGAATCTTTCTC	0.313																																																	0													13.0	13.0	13.0					2																	98167802		1021	2275	3296			0			AK024934	CCDS74543.1	2q11.2	2013-01-11	2008-03-25	2008-03-25	ENSG00000196912	ENSG00000196912		"""Ankyrin repeat domain containing"""	29333	protein-coding gene	gene with protein product	"""melanoma-associated antigen"", ""CLL-associated antigen KW-1"""		"""KIAA1641"""	KIAA1641		10997877	Standard	NM_025190		Approved	FLJ21281	uc010yvc.1	Q8N2N9	OTTHUMG00000130547		2.37:g.98167802G>C			Q08AK5|Q6IPR0|Q6PI49|Q8IZM7|Q8TDH6|Q96N30|Q9H759	RNA	SNP	-	NULL	ENST00000443455.1	37	NULL		2																																																																																			ANKRD36B	-	-	ENSG00000196912		0.313	ANKRD36B-003	KNOWN	basic	processed_transcript	ANKRD36B	HGNC	pseudogene	OTTHUMT00000328967.2	-	0.00	297	0	G	NM_025190		98167802	-1	tier1	-	no_errors	ENST00000419390	ensembl	human	known	74_37	rna	13.07	132	20	SNP	0.034	C
ANXA7	310	genome.wustl.edu	37	10	75147469	75147469	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr10:75147469G>T	ENST00000372921.5	-	7	667	c.611C>A	c.(610-612)gCa>gAa	p.A204E	ANXA7_ENST00000492380.1_5'UTR|ANXA7_ENST00000535178.1_Missense_Mutation_p.A74E	NM_001156.3	NP_001147.1	P20073	ANXA7_HUMAN	annexin A7	226					autophagy (GO:0006914)|cell proliferation (GO:0008283)|cellular calcium ion homeostasis (GO:0006874)|cellular water homeostasis (GO:0009992)|epithelial cell differentiation (GO:0030855)|hemostasis (GO:0007599)|membrane fusion (GO:0061025)|negative regulation of gene expression (GO:0010629)|regulation of cell shape (GO:0008360)|response to calcium ion (GO:0051592)|response to organic cyclic compound (GO:0014070)|response to salt stress (GO:0009651)|social behavior (GO:0035176)	cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|calcium-dependent protein binding (GO:0048306)|integrin binding (GO:0005178)|poly(A) RNA binding (GO:0044822)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(7)|ovary(2)|prostate(1)|stomach(2)|upper_aerodigestive_tract(1)	26	Prostate(51;0.0119)					GGTCTTAAATGCTGCTTTAAT	0.433																																																	0													225.0	213.0	217.0					10																	75147469		2203	4300	6503	SO:0001583	missense	0			J04543	CCDS7325.1, CCDS7326.1	10q22.2	2005-11-09			ENSG00000138279	ENSG00000138279		"""Annexins"""	545	protein-coding gene	gene with protein product		186360		ANX7		7515686	Standard	NM_001156		Approved		uc001jtz.2	P20073	OTTHUMG00000018463	ENST00000372921.5:c.611C>A	10.37:g.75147469G>T	ENSP00000362012:p.Ala204Glu		Q5F2H3|Q5T0M6|Q5T0M7	Missense_Mutation	SNP	pfam_Annexin_repeat,smart_Annexin_repeat,prints_Annexin,prints_AnnexinVII,prints_AnnexinIV	p.A226E	ENST00000372921.5	37	c.677	CCDS7325.1	10	.	.	.	.	.	.	.	.	.	.	G	17.88	3.496760	0.64186	.	.	ENSG00000138279	ENST00000372921;ENST00000372919;ENST00000535178	T;T;T	0.03301	3.98;3.98;3.98	5.96	5.06	0.68205	Annexin repeat, conserved site (1);	0.073510	0.56097	D	0.000029	T	0.05181	0.0138	L	0.41632	1.29	0.58432	D	0.999997	B;B;B;B;B	0.30193	0.107;0.183;0.223;0.152;0.272	B;B;B;B;B	0.34346	0.111;0.111;0.12;0.067;0.18	T	0.47471	-0.9115	10	0.33940	T	0.23	.	13.1697	0.59591	0.0771:0.0:0.9229:0.0	.	204;204;131;204;226	Q53HM8;B2R7L2;B4DWU2;P20073-2;P20073	.;.;.;.;ANXA7_HUMAN	E	204;226;74	ENSP00000362012:A204E;ENSP00000362010:A226E;ENSP00000442864:A74E	ENSP00000362010:A226E	A	-	2	0	ANXA7	74817475	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.631000	0.61304	1.532000	0.49169	0.650000	0.86243	GCA	ANXA7	-	pfam_Annexin_repeat,smart_Annexin_repeat,prints_AnnexinIV	ENSG00000138279		0.433	ANXA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANXA7	HGNC	protein_coding	OTTHUMT00000048646.2		0.00	68	0	G	NM_001156		75147469	-1			no_errors	ENST00000372919	ensembl	human	known	74_37	missense	5.17	55	3	SNP	1.000	T
APC	324	genome.wustl.edu	37	5	112174217	112174217	+	Missense_Mutation	SNP	A	A	G	rs587782846		TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr5:112174217A>G	ENST00000457016.1	+	16	3306	c.2926A>G	c.(2926-2928)Aga>Gga	p.R976G	CTC-554D6.1_ENST00000520401.1_Intron|APC_ENST00000508376.2_Missense_Mutation_p.R976G|APC_ENST00000257430.4_Missense_Mutation_p.R976G			P25054	APC_HUMAN	adenomatous polyposis coli	976	Responsible for down-regulation through a process mediated by direct ubiquitination.|Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.R976fs*9(3)|p.?(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		TTATGGTAAAAGAGGTCAAAT	0.353		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)		yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	4	Insertion - Frameshift(3)|Unknown(1)	large_intestine(2)|ovary(1)|skin(1)	GRCh37	CD011090|CI991959	APC	D|I							77.0	72.0	74.0					5																	112174217		2202	4300	6502	SO:0001583	missense	0	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.2926A>G	5.37:g.112174217A>G	ENSP00000413133:p.Arg976Gly		D3DT03|Q15162|Q15163|Q93042	Missense_Mutation	SNP	pfam_APC_basic_dom,pfam_EB1-bd,pfam_APC_Cys-rich_rpt,pfam_Armadillo,pfam_APC_dom,pfam_SAMP,pfam_APC_15aa_rpt,superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo	p.R976G	ENST00000457016.1	37	c.2926	CCDS4107.1	5	.	.	.	.	.	.	.	.	.	.	A	14.75	2.627350	0.46944	.	.	ENSG00000134982	ENST00000457016;ENST00000507379;ENST00000257430;ENST00000508376;ENST00000512211	D;D;D;D;D	0.96136	-3.18;-3.92;-3.18;-3.18;-3.37	5.75	4.58	0.56647	.	0.000000	0.85682	D	0.000000	D	0.95239	0.8456	L	0.55481	1.735	0.53688	D	0.999979	D;D	0.60575	0.988;0.988	P;P	0.52793	0.709;0.709	D	0.94649	0.7837	10	0.87932	D	0	-24.0414	11.858	0.52449	0.7219:0.2781:0.0:0.0	.	978;976	Q4LE70;P25054	.;APC_HUMAN	G	976;958;976;976;976	ENSP00000413133:R976G;ENSP00000423224:R958G;ENSP00000257430:R976G;ENSP00000427089:R976G;ENSP00000423828:R976G	ENSP00000257430:R976G	R	+	1	2	APC	112202116	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.861000	0.48380	0.993000	0.38866	0.528000	0.53228	AGA	APC	-	NULL	ENSG00000134982		0.353	APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	APC	HGNC	protein_coding	OTTHUMT00000250738.2		0.00	75	0	A	NM_000038		112174217	+1			no_errors	ENST00000257430	ensembl	human	known	74_37	missense	5.13	37	2	SNP	1.000	G
APCDD1	147495	genome.wustl.edu	37	18	10487902	10487902	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr18:10487902C>T	ENST00000355285.5	+	5	1766	c.1412C>T	c.(1411-1413)cCg>cTg	p.P471L		NM_153000.4	NP_694545.1			adenomatosis polyposis coli down-regulated 1											NS(1)|breast(1)|endometrium(3)|large_intestine(5)|lung(7)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22				READ - Rectum adenocarcinoma(15;0.08)		TCCTCTTCGCCGAGGGCAGAG	0.647																																																	0													68.0	66.0	67.0					18																	10487902		2203	4300	6503	SO:0001583	missense	0			AB056722	CCDS11849.1	18p11.21	2006-07-07			ENSG00000154856	ENSG00000154856			15718	protein-coding gene	gene with protein product		607479				12384519	Standard	NM_153000		Approved	B7323	uc002kom.4	Q8J025	OTTHUMG00000131635	ENST00000355285.5:c.1412C>T	18.37:g.10487902C>T	ENSP00000347433:p.Pro471Leu			Missense_Mutation	SNP	NULL	p.P471L	ENST00000355285.5	37	c.1412	CCDS11849.1	18	.	.	.	.	.	.	.	.	.	.	C	16.70	3.196215	0.58126	.	.	ENSG00000154856	ENST00000355285;ENST00000423585	T	0.35789	1.29	5.62	4.76	0.60689	.	0.373428	0.29355	N	0.012395	T	0.26629	0.0651	L	0.34521	1.04	0.51012	D	0.999902	B	0.24186	0.099	B	0.14023	0.01	T	0.04811	-1.0925	10	0.36615	T	0.2	-28.6874	10.8761	0.46913	0.0:0.8563:0.0:0.1437	.	471	Q8J025	APCD1_HUMAN	L	471;522	ENSP00000347433:P471L	ENSP00000347433:P471L	P	+	2	0	APCDD1	10477902	0.423000	0.25482	0.003000	0.11579	0.219000	0.24729	2.264000	0.43302	1.383000	0.46405	-0.244000	0.11960	CCG	APCDD1	-	NULL	ENSG00000154856		0.647	APCDD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APCDD1	HGNC	protein_coding	OTTHUMT00000254529.2	-	0.00	54	0	C	NM_153000		10487902	+1	tier1	-	no_errors	ENST00000355285	ensembl	human	known	74_37	missense	35.48	20	11	SNP	0.502	T
APEH	327	genome.wustl.edu	37	3	49713493	49713493	+	Frame_Shift_Del	DEL	C	C	-			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr3:49713493delC	ENST00000296456.5	+	6	847	c.447delC	c.(445-447)tgcfs	p.C149fs	APEH_ENST00000438011.1_Frame_Shift_Del_p.C149fs	NM_001640.3	NP_001631.3	P13798	ACPH_HUMAN	acylaminoacyl-peptide hydrolase	149					beta-amyloid metabolic process (GO:0050435)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nuclear membrane (GO:0031965)	omega peptidase activity (GO:0008242)|poly(A) RNA binding (GO:0044822)|serine-type endopeptidase activity (GO:0004252)			endometrium(3)|large_intestine(1)|lung(6)|ovary(1)|skin(1)|stomach(2)|urinary_tract(1)	15				BRCA - Breast invasive adenocarcinoma(193;4.53e-05)|Kidney(197;0.00218)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		ACCCAGACTGCTTTGGCTGCC	0.622																																																	0													67.0	74.0	72.0					3																	49713493		2203	4300	6503	SO:0001589	frameshift_variant	0			D38441	CCDS2801.1	3p21	2013-05-29	2013-05-29		ENSG00000164062	ENSG00000164062	3.4.19.1		586	protein-coding gene	gene with protein product	"""acylaminoacyl-peptidase"""	102645	"""N-acylaminoacyl-peptide hydrolase"""	D3F15S2, DNF15S2, D3S48E		2392324	Standard	NM_001640		Approved		uc003cxf.3	P13798	OTTHUMG00000156882	ENST00000296456.5:c.447delC	3.37:g.49713493delC	ENSP00000296456:p.Cys149fs		Q9BQ33|Q9P0Y2	Frame_Shift_Del	DEL	pfam_Peptidase_S9,pfam_AB_hydrolase_1,pfam_Dienelactn_hydro	p.F150fs	ENST00000296456.5	37	c.447	CCDS2801.1	3																																																																																			APEH	-	NULL	ENSG00000164062		0.622	APEH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APEH	HGNC	protein_coding	OTTHUMT00000346415.2		0.00	116	0	C			49713493	+1	tier1		no_errors	ENST00000296456	ensembl	human	known	74_37	frame_shift_del	10.00	18	2	DEL	1.000	-
APOBEC1	339	genome.wustl.edu	37	12	7803631	7803631	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr12:7803631G>T	ENST00000229304.4	-	4	569	c.549C>A	c.(547-549)caC>caA	p.H183Q		NM_001644.3	NP_001635.2	P41238	ABEC1_HUMAN	apolipoprotein B mRNA editing enzyme, catalytic polypeptide 1	183	Leu-rich.				cellular response to insulin stimulus (GO:0032869)|cytidine deamination (GO:0009972)|cytidine to uridine editing (GO:0016554)|defense response to virus (GO:0051607)|DNA demethylation (GO:0080111)|gene expression (GO:0010467)|lipid metabolic process (GO:0006629)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein transport (GO:0042953)|mRNA modification (GO:0016556)|mRNA processing (GO:0006397)|mRNA stabilization (GO:0048255)|negative regulation of methylation-dependent chromatin silencing (GO:0090310)|regulation of cell proliferation (GO:0042127)|response to calcium ion (GO:0051592)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to gamma radiation (GO:0010332)|response to osmotic stress (GO:0006970)|response to zinc ion (GO:0010043)|RNA processing (GO:0006396)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	AU-rich element binding (GO:0017091)|cytidine deaminase activity (GO:0004126)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			kidney(2)|large_intestine(2)|lung(10)|prostate(1)|skin(1)|stomach(1)	17						GAATTATGCAGTGCAGCTCCA	0.438																																					Pancreas(135;929 1826 4531 10527 41012)												0													157.0	144.0	148.0					12																	7803631		2203	4300	6503	SO:0001583	missense	0			U72891	CCDS8579.1	12p13.1	2007-02-01			ENSG00000111701	ENSG00000111701		"""Apolipoprotein B mRNA editing enzymes"""	604	protein-coding gene	gene with protein product		600130					Standard	XM_005253355		Approved	BEDP, CDAR1, APOBEC-1, HEPR	uc001qtb.3	P41238	OTTHUMG00000141288	ENST00000229304.4:c.549C>A	12.37:g.7803631G>T	ENSP00000229304:p.His183Gln		Q9UE64|Q9UM71	Missense_Mutation	SNP	pfam_APOBEC_N,pfam_APOBEC_C,superfamily_Cytidine_deaminase-like	p.H183Q	ENST00000229304.4	37	c.549	CCDS8579.1	12	.	.	.	.	.	.	.	.	.	.	G	14.38	2.517305	0.44763	.	.	ENSG00000111701	ENST00000229304	T	0.64260	-0.09	4.9	3.98	0.46160	.	0.397332	0.21555	N	0.072662	T	0.65657	0.2712	L	0.57536	1.79	0.22835	N	0.998678	D	0.54397	0.966	P	0.52109	0.69	T	0.57106	-0.7868	10	0.34782	T	0.22	-3.7265	11.4168	0.49956	0.0:0.1828:0.8172:0.0	.	183	P41238	ABEC1_HUMAN	Q	183	ENSP00000229304:H183Q	ENSP00000229304:H183Q	H	-	3	2	APOBEC1	7694898	0.602000	0.26916	0.999000	0.59377	0.531000	0.34715	0.297000	0.19101	1.145000	0.42336	0.655000	0.94253	CAC	APOBEC1	-	NULL	ENSG00000111701		0.438	APOBEC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APOBEC1	HGNC	protein_coding	OTTHUMT00000280523.1	-	0.00	71	0	G	NM_001644		7803631	-1	tier1	-	no_errors	ENST00000229304	ensembl	human	known	74_37	missense	9.52	38	4	SNP	1.000	T
AQR	9716	genome.wustl.edu	37	15	35210573	35210573	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr15:35210573G>T	ENST00000156471.5	-	15	1453	c.1228C>A	c.(1228-1230)Cgt>Agt	p.R410S		NM_014691.2	NP_055506.1	O60306	AQR_HUMAN	aquarius intron-binding spliceosomal factor	410					mRNA splicing, via spliceosome (GO:0000398)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.R410S(1)		breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(10)|lung(18)|ovary(1)|prostate(6)|skin(4)|upper_aerodigestive_tract(2)	57		Lung NSC(122;8.7e-10)|all_lung(180;1.47e-08)		all cancers(64;4.34e-18)|GBM - Glioblastoma multiforme(113;4.59e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0283)		CGTTCATGACGAGATACCTAA	0.338																																																	1	Substitution - Missense(1)	lung(1)											78.0	70.0	73.0					15																	35210573		1837	4090	5927	SO:0001583	missense	0			AB011132	CCDS42013.1	15q13	2013-09-12	2013-09-12			ENSG00000021776			29513	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 164"""	610548	"""aquarius homolog (mouse)"""			9626505, 16949364	Standard	NM_014691		Approved	KIAA0560, fSAP164, IBP160	uc001ziv.3	O60306		ENST00000156471.5:c.1228C>A	15.37:g.35210573G>T	ENSP00000156471:p.Arg410Ser		A0JP17|A5YKK3|Q2YDX9|Q6IRU8|Q6PIC8	Missense_Mutation	SNP	superfamily_P-loop_NTPase	p.R410S	ENST00000156471.5	37	c.1228	CCDS42013.1	15	.	.	.	.	.	.	.	.	.	.	G	26.2	4.718289	0.89205	.	.	ENSG00000021776	ENST00000156471;ENST00000543879	D	0.93247	-3.19	4.74	4.74	0.60224	.	0.097598	0.64402	D	0.000001	D	0.91727	0.7384	M	0.66939	2.045	0.53005	D	0.99996	P	0.42735	0.788	B	0.41466	0.358	D	0.90171	0.4235	10	0.07813	T	0.8	-13.4226	17.925	0.88980	0.0:0.0:1.0:0.0	.	410	O60306	AQR_HUMAN	S	410	ENSP00000156471:R410S	ENSP00000156471:R410S	R	-	1	0	AQR	32997865	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.572000	0.82409	2.474000	0.83562	0.491000	0.48974	CGT	AQR	-	NULL	ENSG00000021776		0.338	AQR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AQR	HGNC	protein_coding	OTTHUMT00000417526.2		0.00	55	0	G	NM_014691		35210573	-1			no_errors	ENST00000156471	ensembl	human	known	74_37	missense	6.00	47	3	SNP	1.000	T
ARHGAP44	9912	genome.wustl.edu	37	17	12823098	12823098	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr17:12823098G>T	ENST00000379672.5	+	6	714	c.414G>T	c.(412-414)caG>caT	p.Q138H	MIR1269B_ENST00000580405.1_RNA|ARHGAP44_ENST00000340825.3_Missense_Mutation_p.Q138H|ARHGAP44_ENST00000262444.9_Missense_Mutation_p.Q138H	NM_014859.4	NP_055674.4	Q17R89	RHG44_HUMAN	Rho GTPase activating protein 44	138	BAR. {ECO:0000255|PROSITE- ProRule:PRU00361}.				exocytosis (GO:0006887)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytosol (GO:0005829)|endosome (GO:0005768)|leading edge membrane (GO:0031256)|synapse (GO:0045202)	GTPase activator activity (GO:0005096)|phospholipid binding (GO:0005543)			NS(2)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(7)|skin(1)|urinary_tract(1)	31						TTCAAAAGCAGAGGAAACACT	0.388																																																	0													101.0	94.0	96.0					17																	12823098		1869	4105	5974	SO:0001583	missense	0				CCDS45616.1	17p12	2011-06-29			ENSG00000006740	ENSG00000006740		"""Rho GTPase activating proteins"""	29096	protein-coding gene	gene with protein product						19273615	Standard	NM_014859		Approved	KIAA0672, RICH-2, RICH2	uc002gnr.4	Q17R89	OTTHUMG00000058765	ENST00000379672.5:c.414G>T	17.37:g.12823098G>T	ENSP00000368994:p.Gln138His		A6NCP5|A8MQB2|O75160|Q7Z5Z7|Q9Y4Q4	Missense_Mutation	SNP	pfam_BAR_dom,pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_BAR_dom,smart_RhoGAP_dom,pfscan_BAR_dom,pfscan_RhoGAP_dom	p.Q138H	ENST00000379672.5	37	c.414	CCDS45616.1	17	.	.	.	.	.	.	.	.	.	.	G	11.23	1.576257	0.28092	.	.	ENSG00000006740	ENST00000379672;ENST00000340825	T;T	0.62105	0.05;0.05	5.48	2.33	0.28932	BAR (3);	0.000000	0.85682	D	0.000000	T	0.67869	0.2939	L	0.45698	1.435	0.51233	D	0.999919	D;P	0.76494	0.999;0.927	D;P	0.87578	0.998;0.759	T	0.61955	-0.6956	10	0.22706	T	0.39	.	9.7083	0.40229	0.2382:0.0:0.7618:0.0	.	138;138	A6NCP5;Q17R89	.;RHG44_HUMAN	H	138	ENSP00000368994:Q138H;ENSP00000342566:Q138H	ENSP00000342566:Q138H	Q	+	3	2	ARHGAP44	12763823	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	0.848000	0.27710	0.674000	0.31244	0.655000	0.94253	CAG	ARHGAP44	-	pfam_BAR_dom,smart_BAR_dom,pfscan_BAR_dom	ENSG00000006740		0.388	ARHGAP44-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ARHGAP44	HGNC	protein_coding	OTTHUMT00000441566.1	-	0.00	93	0	G	NM_014859		12823098	+1	tier1	-	no_errors	ENST00000379672	ensembl	human	known	74_37	missense	5.63	67	4	SNP	1.000	T
ARHGAP44	9912	genome.wustl.edu	37	17	12877410	12877410	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr17:12877410G>T	ENST00000379672.5	+	18	1846	c.1546G>T	c.(1546-1548)Ggt>Tgt	p.G516C	RN7SL550P_ENST00000583299.1_RNA|ARHGAP44_ENST00000578087.1_3'UTR|ARHGAP44_ENST00000340825.3_Missense_Mutation_p.G510C|ARHGAP44_ENST00000262444.9_Missense_Mutation_p.G516C	NM_014859.4	NP_055674.4	Q17R89	RHG44_HUMAN	Rho GTPase activating protein 44	516					exocytosis (GO:0006887)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytosol (GO:0005829)|endosome (GO:0005768)|leading edge membrane (GO:0031256)|synapse (GO:0045202)	GTPase activator activity (GO:0005096)|phospholipid binding (GO:0005543)			NS(2)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(7)|skin(1)|urinary_tract(1)	31						CGCCAGCATGGGTGTGAGGGT	0.642																																																	0													21.0	26.0	24.0					17																	12877410		2057	4173	6230	SO:0001583	missense	0				CCDS45616.1	17p12	2011-06-29			ENSG00000006740	ENSG00000006740		"""Rho GTPase activating proteins"""	29096	protein-coding gene	gene with protein product						19273615	Standard	NM_014859		Approved	KIAA0672, RICH-2, RICH2	uc002gnr.4	Q17R89	OTTHUMG00000058765	ENST00000379672.5:c.1546G>T	17.37:g.12877410G>T	ENSP00000368994:p.Gly516Cys		A6NCP5|A8MQB2|O75160|Q7Z5Z7|Q9Y4Q4	Missense_Mutation	SNP	pfam_BAR_dom,pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_BAR_dom,smart_RhoGAP_dom,pfscan_BAR_dom,pfscan_RhoGAP_dom	p.G516C	ENST00000379672.5	37	c.1546	CCDS45616.1	17	.	.	.	.	.	.	.	.	.	.	G	27.1	4.801820	0.90538	.	.	ENSG00000006740	ENST00000379672;ENST00000544416;ENST00000340825	T;T	0.25414	1.8;1.99	5.29	5.29	0.74685	.	0.000000	0.85682	D	0.000000	T	0.47637	0.1456	L	0.54323	1.7	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.996;0.982	T	0.44128	-0.9348	10	0.72032	D	0.01	.	16.4391	0.83894	0.0:0.0:1.0:0.0	.	510;172;516	A6NCP5;F5H6L3;Q17R89	.;.;RHG44_HUMAN	C	516;172;510	ENSP00000368994:G516C;ENSP00000342566:G510C	ENSP00000342566:G510C	G	+	1	0	ARHGAP44	12818135	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	7.758000	0.85224	2.481000	0.83766	0.557000	0.71058	GGT	ARHGAP44	-	NULL	ENSG00000006740		0.642	ARHGAP44-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ARHGAP44	HGNC	protein_coding	OTTHUMT00000441566.1	-	0.00	96	0	G	NM_014859		12877410	+1	tier1	-	no_errors	ENST00000379672	ensembl	human	known	74_37	missense	7.94	58	5	SNP	1.000	T
ARHGEF16	27237	genome.wustl.edu	37	1	3380122	3380122	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr1:3380122G>T	ENST00000378378.4	+	2	879	c.474G>T	c.(472-474)atG>atT	p.M158I	ARHGEF16_ENST00000378373.1_5'Flank	NM_014448.3	NP_055263.2	Q5VV41	ARHGG_HUMAN	Rho guanine nucleotide exchange factor (GEF) 16	158				AM -> RG (in Ref. 4; AAH02681). {ECO:0000305}.	activation of Cdc42 GTPase activity (GO:0032864)|activation of Rac GTPase activity (GO:0032863)|apoptotic signaling pathway (GO:0097190)|cell chemotaxis (GO:0060326)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	PDZ domain binding (GO:0030165)|receptor tyrosine kinase binding (GO:0030971)|Rho GTPase binding (GO:0017048)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			lung(6)|ovary(1)	7	all_cancers(77;0.00276)|all_epithelial(69;0.00102)|Ovarian(185;0.0634)|Lung NSC(156;0.0969)|all_lung(157;0.101)	all_epithelial(116;7.14e-21)|all_lung(118;2.24e-08)|Lung NSC(185;3.55e-06)|Breast(487;0.000765)|Renal(390;0.00121)|Hepatocellular(190;0.0046)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0308)|Lung SC(97;0.0847)|Medulloblastoma(700;0.211)		Epithelial(90;8.62e-38)|OV - Ovarian serous cystadenocarcinoma(86;3.62e-22)|GBM - Glioblastoma multiforme(42;2.49e-12)|Colorectal(212;4.25e-05)|COAD - Colon adenocarcinoma(227;0.000196)|Kidney(185;0.000342)|BRCA - Breast invasive adenocarcinoma(365;0.000681)|KIRC - Kidney renal clear cell carcinoma(229;0.00549)|STAD - Stomach adenocarcinoma(132;0.00644)|Lung(427;0.201)		GGGCGGCCATGAAGGGCCTGG	0.652																																																	0													9.0	13.0	12.0					1																	3380122		691	1583	2274	SO:0001583	missense	0			D89016	CCDS46.2	1p36.3	2013-01-10	2010-04-13		ENSG00000130762	ENSG00000130762		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	15515	protein-coding gene	gene with protein product	"""putative neuroblastoma protein"""						Standard	NM_014448		Approved	NBR, GEF16	uc001akg.4	Q5VV41	OTTHUMG00000000625	ENST00000378378.4:c.474G>T	1.37:g.3380122G>T	ENSP00000367629:p.Met158Ile		Q86TF0|Q99434	Missense_Mutation	SNP	pfam_DH-domain,pfam_SH3_domain,pfam_Pleckstrin_homology,superfamily_DH-domain,superfamily_SH3_domain,smart_DH-domain,smart_Pleckstrin_homology,smart_SH3_domain,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_DH-domain	p.M158I	ENST00000378378.4	37	c.474	CCDS46.2	1	.	.	.	.	.	.	.	.	.	.	G	3.836	-0.034804	0.07543	.	.	ENSG00000130762	ENST00000378378	T	0.61627	0.09	4.03	3.11	0.35812	.	0.077022	0.50627	D	0.000107	T	0.49338	0.1551	L	0.50919	1.6	0.80722	D	1	B	0.17268	0.021	B	0.10450	0.005	T	0.42310	-0.9459	10	0.30854	T	0.27	-34.3719	12.1549	0.54070	0.0858:0.0:0.9142:0.0	.	158	Q5VV41	ARHGG_HUMAN	I	158	ENSP00000367629:M158I	ENSP00000367629:M158I	M	+	3	0	ARHGEF16	3369982	1.000000	0.71417	0.981000	0.43875	0.447000	0.32167	3.226000	0.51254	0.822000	0.34565	-0.698000	0.03680	ATG	ARHGEF16	-	NULL	ENSG00000130762		0.652	ARHGEF16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGEF16	HGNC	protein_coding	OTTHUMT00000001515.1	-	0.00	110	0	G	NM_014448		3380122	+1	tier1	-	no_errors	ENST00000378378	ensembl	human	known	74_37	missense	6.15	60	4	SNP	1.000	T
ARHGEF2	9181	genome.wustl.edu	37	1	155920753	155920753	+	Missense_Mutation	SNP	C	C	T	rs533748068	byFrequency	TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr1:155920753C>T	ENST00000361247.4	-	20	2669	c.2570G>A	c.(2569-2571)cGa>cAa	p.R857Q	ARHGEF2_ENST00000462460.2_Missense_Mutation_p.R902Q|ARHGEF2_ENST00000313667.4_Missense_Mutation_p.R856Q|ARHGEF2_ENST00000368315.4_Missense_Mutation_p.R858Q|ARHGEF2_ENST00000368316.1_Missense_Mutation_p.R829Q|ARHGEF2_ENST00000477754.2_Intron|ARHGEF2_ENST00000313695.7_Missense_Mutation_p.R829Q	NM_001162383.1|NM_001162384.1	NP_001155855.1|NP_001155856.1	Q92974	ARHG2_HUMAN	Rho/Rac guanine nucleotide exchange factor (GEF) 2	857					actin filament organization (GO:0007015)|apoptotic signaling pathway (GO:0097190)|cell morphogenesis (GO:0000902)|cellular hyperosmotic response (GO:0071474)|cellular response to muramyl dipeptide (GO:0071225)|cellular response to tumor necrosis factor (GO:0071356)|establishment of mitotic spindle orientation (GO:0000132)|innate immune response (GO:0045087)|intracellular protein transport (GO:0006886)|mitotic nuclear division (GO:0007067)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of intrinsic apoptotic signaling pathway in response to osmotic stress (GO:1902219)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of necroptotic process (GO:0060546)|negative regulation of neurogenesis (GO:0050768)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of cell proliferation (GO:0042127)|regulation of Rho protein signal transduction (GO:0035023)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|neuronal cell body (GO:0043025)|protein complex (GO:0043234)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)|vesicle (GO:0031982)	microtubule binding (GO:0008017)|Rac GTPase binding (GO:0048365)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|Rho GTPase binding (GO:0017048)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			breast(4)|cervix(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(6)|lung(15)|ovary(1)|skin(2)	40	Hepatocellular(266;0.133)|all_hematologic(923;0.145)|all_neural(408;0.195)					CAGCTGCCTTCGAGCCTCTTC	0.726													C|||	2	0.000399361	0.0	0.0	5008	,	,		10697	0.001		0.0	False		,,,				2504	0.001				Melanoma(178;35 2768 6610 28839)												0													11.0	14.0	13.0					1																	155920753		2133	4176	6309	SO:0001583	missense	0			AB014551	CCDS1125.1, CCDS53375.1, CCDS53376.1	1q21-q22	2013-01-10	2009-06-12		ENSG00000116584	ENSG00000116584		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	682	protein-coding gene	gene with protein product		607560	"""rho/rac guanine nucleotide exchange factor (GEF) 2"""			9857026, 9734811	Standard	NM_004723		Approved	LFP40, GEF-H1, KIAA0651, P40	uc001fmt.2	Q92974	OTTHUMG00000017464	ENST00000361247.4:c.2570G>A	1.37:g.155920753C>T	ENSP00000354837:p.Arg857Gln		D3DVA6|O75142|Q15079|Q5VY92|Q8TDA3|Q8WUG4|Q9H023	Missense_Mutation	SNP	pfam_DH-domain,pfam_Pleckstrin_homology,superfamily_DH-domain,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_DH-domain,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_DH-domain	p.R858Q	ENST00000361247.4	37	c.2573	CCDS53376.1	1	.	.	.	.	.	.	.	.	.	.	C	13.80	2.345526	0.41498	.	.	ENSG00000116584	ENST00000313695;ENST00000361247;ENST00000368315;ENST00000368316;ENST00000313667	T;T;T;T;T	0.26067	1.76;1.76;1.76;1.76;1.76	5.12	4.18	0.49190	.	0.201302	0.25264	N	0.031928	T	0.04182	0.0116	N	0.08118	0	0.09310	N	0.999999	B;B;B;B	0.26318	0.052;0.008;0.014;0.146	B;B;B;B	0.12156	0.002;0.002;0.004;0.007	T	0.24476	-1.0159	10	0.32370	T	0.25	-21.7401	7.9756	0.30153	0.0:0.821:0.0:0.179	.	901;857;856;858	D3DVA5;Q92974;Q92974-2;Q5VY93	.;ARHG2_HUMAN;.;.	Q	829;857;858;829;856	ENSP00000315325:R829Q;ENSP00000354837:R857Q;ENSP00000357298:R858Q;ENSP00000357299:R829Q;ENSP00000314787:R856Q	ENSP00000314787:R856Q	R	-	2	0	ARHGEF2	154187377	0.022000	0.18835	0.960000	0.40013	0.800000	0.45204	0.760000	0.26475	2.660000	0.90430	0.655000	0.94253	CGA	ARHGEF2	-	NULL	ENSG00000116584		0.726	ARHGEF2-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	ARHGEF2	HGNC	protein_coding	OTTHUMT00000046204.2		0.00	21	0	C	NM_004723		155920753	-1			no_errors	ENST00000368315	ensembl	human	known	74_37	missense	30.00	7	3	SNP	0.301	T
ARID2	196528	genome.wustl.edu	37	12	46244203	46244203	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr12:46244203C>A	ENST00000334344.6	+	15	2469	c.2297C>A	c.(2296-2298)cCa>cAa	p.P766Q	ARID2_ENST00000457135.1_5'Flank|ARID2_ENST00000422737.1_Missense_Mutation_p.P617Q|ARID2_ENST00000444670.1_Missense_Mutation_p.P376Q|ARID2_ENST00000479608.1_3'UTR	NM_152641.2	NP_689854.2	Q68CP9	ARID2_HUMAN	AT rich interactive domain 2 (ARID, RFX-like)	766					chromatin modification (GO:0016568)|nucleosome disassembly (GO:0006337)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(21)|liver(20)|lung(34)|ovary(7)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	116	Lung SC(27;0.192)|Renal(347;0.236)	Lung NSC(34;0.106)|all_lung(34;0.22)	OV - Ovarian serous cystadenocarcinoma(5;0.00691)	GBM - Glioblastoma multiforme(48;0.0153)		CTTCACCATCCATCTGTAATT	0.473			"""N, S, F"""		hepatocellular carcinoma																																			Rec	yes		12	12q12	196528	AT rich interactive domain 2		E	0													84.0	72.0	76.0					12																	46244203		2203	4300	6503	SO:0001583	missense	0				CCDS31783.1	12q13.11	2013-02-07			ENSG00000189079	ENSG00000189079		"""-"""	18037	protein-coding gene	gene with protein product		609539					Standard	NM_152641		Approved	KIAA1557, DKFZp686G052, FLJ30619, BAF200	uc001ros.1	Q68CP9	OTTHUMG00000150487	ENST00000334344.6:c.2297C>A	12.37:g.46244203C>A	ENSP00000335044:p.Pro766Gln		Q15KG9|Q5EB51|Q645I3|Q6ZRY5|Q7Z3I5|Q86T28|Q96SJ6|Q9HCL5	Missense_Mutation	SNP	pfam_ARID/BRIGHT_DNA-bd,pfam_DNA-bd_RFX,superfamily_ARID/BRIGHT_DNA-bd,superfamily_ARM-type_fold,smart_ARID/BRIGHT_DNA-bd,pfscan_ARID/BRIGHT_DNA-bd	p.P766Q	ENST00000334344.6	37	c.2297	CCDS31783.1	12	.	.	.	.	.	.	.	.	.	.	C	12.05	1.821556	0.32237	.	.	ENSG00000189079	ENST00000334344;ENST00000422737;ENST00000444670	T	0.34472	1.36	5.97	5.97	0.96955	.	0.106321	0.64402	D	0.000004	T	0.26412	0.0645	N	0.17082	0.46	0.80722	D	1	B;B;B	0.22746	0.074;0.074;0.016	B;B;B	0.23574	0.047;0.047;0.014	T	0.03957	-1.0989	10	0.41790	T	0.15	-9.6831	15.0559	0.71912	0.175:0.8249:0.0:0.0	.	766;376;766	Q68CP9-3;F8W108;Q68CP9	.;.;ARID2_HUMAN	Q	766;617;376	ENSP00000335044:P766Q	ENSP00000335044:P766Q	P	+	2	0	ARID2	44530470	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.548000	0.60718	2.837000	0.97791	0.655000	0.94253	CCA	ARID2	-	NULL	ENSG00000189079		0.473	ARID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARID2	HGNC	protein_coding	OTTHUMT00000318380.2		0.00	36	0	C	XM_350875		46244203	+1			no_errors	ENST00000334344	ensembl	human	known	74_37	missense	9.52	19	2	SNP	1.000	A
ARPP21	10777	genome.wustl.edu	37	3	35833701	35833701	+	Intron	SNP	T	T	C			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr3:35833701T>C	ENST00000187397.4	+	19	2488				ARPP21_ENST00000337271.5_Intron|ARPP21_ENST00000417925.1_Intron|ARPP21_ENST00000476052.1_3'UTR|ARPP21_ENST00000458225.1_Intron|ARPP21_ENST00000444190.1_Intron	NM_016300.4	NP_057384.2	Q9UBL0	ARP21_HUMAN	cAMP-regulated phosphoprotein, 21kDa						cellular response to heat (GO:0034605)	cytoplasm (GO:0005737)	nucleic acid binding (GO:0003676)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(31)|ovary(3)|prostate(4)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	61						TGTTCACTCTTAGAAGTAAAA	0.328																																																	0																																										SO:0001627	intron_variant	0			AA733082	CCDS2661.1, CCDS43063.1, CCDS58823.1, CCDS58824.1	3p24.3	2010-08-12			ENSG00000172995	ENSG00000172995			16968	protein-coding gene	gene with protein product	"""R3H domain containing 3"""	605488				8120638	Standard	NM_198399		Approved	ARPP-21, TARPP, R3HDM3	uc011axy.2	Q9UBL0	OTTHUMG00000130795	ENST00000187397.4:c.2033-173T>C	3.37:g.35833701T>C			B4DG96|Q49AK3|Q49AS6|Q4G0V4|Q6NYC3|Q86V31|Q9UF93	RNA	SNP	-	NULL	ENST00000187397.4	37	NULL	CCDS2661.1	3																																																																																			ARPP21	-	-	ENSG00000172995		0.328	ARPP21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARPP21	HGNC	protein_coding	OTTHUMT00000253334.2	-	0.00	43	0	T	NM_198399		35833701	+1	tier1	-	no_errors	ENST00000476052	ensembl	human	known	74_37	rna	73.33	4	11	SNP	0.000	C
ARV1	64801	genome.wustl.edu	37	1	231124099	231124099	+	Nonsense_Mutation	SNP	G	G	T	rs144095931		TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr1:231124099G>T	ENST00000310256.2	+	2	265	c.208G>T	c.(208-210)Gag>Tag	p.E70*	ARV1_ENST00000497753.1_3'UTR|ARV1_ENST00000366658.2_Intron|AL844165.1_ENST00000516322.1_RNA	NM_022786.1	NP_073623.1	Q9H2C2	ARV1_HUMAN	ARV1 homolog (S. cerevisiae)	70					bile acid metabolic process (GO:0008206)|cholesterol transport (GO:0030301)|regulation of cholesterol metabolic process (GO:0090181)|sphingolipid metabolic process (GO:0006665)	integral component of membrane (GO:0016021)				breast(3)|large_intestine(2)|lung(2)	7	Breast(184;0.0871)|Ovarian(103;0.183)	Prostate(94;0.178)		COAD - Colon adenocarcinoma(196;0.211)|Colorectal(1306;0.233)		CAAATATATCGAGTATGATCC	0.308																																																	0													139.0	152.0	147.0					1																	231124099		2202	4295	6497	SO:0001587	stop_gained	0			AF271780	CCDS1589.1	1q42.2	2014-02-03	2006-04-04		ENSG00000173409	ENSG00000173409			29561	protein-coding gene	gene with protein product		611647	"""ARV1 homolog (yeast)"""			11063737, 12145310, 20663892	Standard	NM_022786		Approved		uc001huh.3	Q9H2C2	OTTHUMG00000037837	ENST00000310256.2:c.208G>T	1.37:g.231124099G>T	ENSP00000312458:p.Glu70*		A8KAI4|Q5VSN7|Q5VSN8|Q5VSN9|Q5VSP0|Q5VSP2|Q9H2H2|Q9H5V6|Q9UFF5	Nonsense_Mutation	SNP	pfam_Arv1	p.E70*	ENST00000310256.2	37	c.208	CCDS1589.1	1	.	.	.	.	.	.	.	.	.	.	G	17.05	3.289102	0.59976	.	.	ENSG00000173409	ENST00000310256	.	.	.	5.91	4.02	0.46733	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-21.1153	13.299	0.60313	0.0:0.122:0.7508:0.1272	.	.	.	.	X	70	.	ENSP00000312458:E70X	E	+	1	0	ARV1	229190722	1.000000	0.71417	0.764000	0.31436	0.186000	0.23388	9.184000	0.94893	0.819000	0.34492	-0.165000	0.13383	GAG	ARV1	-	pfam_Arv1	ENSG00000173409		0.308	ARV1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARV1	HGNC	protein_coding	OTTHUMT00000092362.2	-	0.00	80	0	G	NM_022786		231124099	+1	tier1	-	no_errors	ENST00000310256	ensembl	human	known	74_37	nonsense	5.97	63	4	SNP	0.998	T
ASIC4	55515	genome.wustl.edu	37	2	220396490	220396490	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr2:220396490G>T	ENST00000347842.3	+	2	988	c.974G>T	c.(973-975)cGc>cTc	p.R325L	ASIC4_ENST00000358078.4_Missense_Mutation_p.R325L|ASIC4_ENST00000473709.1_3'UTR	NM_182847.2	NP_878267.2	Q96FT7	ASIC4_HUMAN	acid-sensing (proton-gated) ion channel family member 4	325					ion transmembrane transport (GO:0034220)|sodium ion transmembrane transport (GO:0035725)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)	ion channel activity (GO:0005216)|sodium channel activity (GO:0005272)|sodium ion transmembrane transporter activity (GO:0015081)										GTCTATACTCGCTATGGGAAG	0.632																																																	0													62.0	65.0	64.0					2																	220396490		2203	4300	6503	SO:0001583	missense	0			AJ271643	CCDS2442.1	2q36.1	2012-02-22	2012-02-22	2012-02-22	ENSG00000072182	ENSG00000072182		"""Ion channels / Acid-sensing (proton-gated) ion channels"""	21263	protein-coding gene	gene with protein product		606715	"""amiloride-sensitive cation channel 4, pituitary"", ""amiloride-sensitive cation channel family member 4, pituitary"""	ACCN4		10852210	Standard	NM_182847		Approved	BNAC4	uc002vma.3	Q96FT7	OTTHUMG00000058928	ENST00000347842.3:c.974G>T	2.37:g.220396490G>T	ENSP00000326627:p.Arg325Leu		Q53SB7|Q6GMS1|Q6PIN9|Q9NQA4	Missense_Mutation	SNP	pfam_Na+channel_ASC,prints_Na+channel_ASC	p.R325L	ENST00000347842.3	37	c.974	CCDS2442.1	2	.	.	.	.	.	.	.	.	.	.	G	17.26	3.344069	0.61073	.	.	ENSG00000072182	ENST00000347842;ENST00000358078	T;T	0.65364	-0.15;-0.15	3.16	3.16	0.36331	.	0.000000	0.85682	D	0.000000	T	0.66005	0.2746	M	0.83603	2.65	0.58432	D	0.999999	B;B;P	0.42584	0.034;0.388;0.784	B;B;B	0.40534	0.035;0.332;0.117	T	0.75836	-0.3177	10	0.56958	D	0.05	-1.1816	15.1743	0.72899	0.0:0.0:1.0:0.0	.	325;325;325	Q96FT7;Q96FT7-4;Q96FT7-2	ACCN4_HUMAN;.;.	L	325	ENSP00000326627:R325L;ENSP00000350786:R325L	ENSP00000326627:R325L	R	+	2	0	ACCN4	220104734	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.551000	0.98112	2.079000	0.62486	0.561000	0.74099	CGC	ASIC4	-	pfam_Na+channel_ASC	ENSG00000072182		0.632	ASIC4-001	KNOWN	basic|CCDS	protein_coding	ASIC4	HGNC	protein_coding	OTTHUMT00000130263.1		0.00	68	0	G	NM_018674		220396490	+1			no_errors	ENST00000347842	ensembl	human	known	74_37	missense	5.13	37	2	SNP	1.000	T
ASIC5	51802	genome.wustl.edu	37	4	156764980	156764980	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr4:156764980C>A	ENST00000537611.2	-	5	760	c.714G>T	c.(712-714)gaG>gaT	p.E238D		NM_017419.2	NP_059115.1	Q9NY37	ASIC5_HUMAN	acid-sensing (proton-gated) ion channel family member 5	238					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	hydrogen ion channel activity (GO:0015252)|ligand-gated sodium channel activity (GO:0015280)										CAGTGAATGCCTCCTGAAACA	0.383																																																	0													92.0	78.0	83.0					4																	156764980		2203	4300	6503	SO:0001583	missense	0			AJ252011	CCDS3793.1	4q32.1	2012-10-03	2012-03-02	2012-03-02	ENSG00000256394	ENSG00000256394			17537	protein-coding gene	gene with protein product			"""amiloride-sensitive cation channel 5, intestinal"""	ACCN5		10767424	Standard	NM_017419		Approved	INAC, HINAC	uc003ipe.1	Q9NY37	OTTHUMG00000161941	ENST00000537611.2:c.714G>T	4.37:g.156764980C>A	ENSP00000442477:p.Glu238Asp			Missense_Mutation	SNP	pfam_Na+channel_ASC,prints_Na+channel_ASC	p.E238D	ENST00000537611.2	37	c.714	CCDS3793.1	4	.	.	.	.	.	.	.	.	.	.	C	3.788	-0.044352	0.07452	.	.	ENSG00000256394	ENST00000537611	T	0.61980	0.06	4.58	-0.86	0.10680	.	0.455403	0.21826	N	0.068544	T	0.35856	0.0946	N	0.21373	0.66	0.09310	N	1	B	0.02656	0.0	B	0.09377	0.004	T	0.07501	-1.0769	10	0.18710	T	0.47	-8.913	2.5238	0.04686	0.1218:0.2848:0.1203:0.4731	.	238	Q9NY37	ACCN5_HUMAN	D	238	ENSP00000442477:E238D	ENSP00000264432:E238D	E	-	3	2	ACCN5	156984430	0.781000	0.28676	0.651000	0.29564	0.881000	0.50899	0.007000	0.13174	-0.108000	0.12066	-0.229000	0.12294	GAG	ASIC5	-	pfam_Na+channel_ASC,prints_Na+channel_ASC	ENSG00000256394		0.383	ASIC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASIC5	HGNC	protein_coding	OTTHUMT00000366464.1	-	0.00	107	0	C			156764980	-1	tier1	-	no_errors	ENST00000537611	ensembl	human	known	74_37	missense	8.93	51	5	SNP	0.085	A
ATG2A	23130	genome.wustl.edu	37	11	64679849	64679849	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr11:64679849G>T	ENST00000377264.3	-	7	984	c.872C>A	c.(871-873)cCg>cAg	p.P291Q	ATG2A_ENST00000421419.2_Missense_Mutation_p.P291Q	NM_015104.2	NP_055919.2	Q2TAZ0	ATG2A_HUMAN	autophagy related 2A	291					autophagic vacuole assembly (GO:0000045)|cellular response to nitrogen starvation (GO:0006995)|mitochondrion degradation (GO:0000422)|nucleophagy (GO:0044804)	extrinsic component of membrane (GO:0019898)|lipid particle (GO:0005811)|pre-autophagosomal structure (GO:0000407)				breast(3)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(19)|ovary(3)|prostate(5)|skin(1)|stomach(1)|urinary_tract(3)	55						GAGCTGCCTCGGGGTCAGGAG	0.682																																																	0													23.0	24.0	23.0					11																	64679849		2179	4266	6445	SO:0001583	missense	0				CCDS31602.1	11q13.1	2014-02-12	2012-06-06		ENSG00000110046	ENSG00000110046			29028	protein-coding gene	gene with protein product			"""ATG2 autophagy related 2 homolog A (S. cerevisiae)"""			21887408	Standard	NM_015104		Approved	KIAA0404	uc001obx.3	Q2TAZ0	OTTHUMG00000066831	ENST00000377264.3:c.872C>A	11.37:g.64679849G>T	ENSP00000366475:p.Pro291Gln		O43154|Q14DM2|Q6ZTV2|Q7Z6K8|Q8IVY5|Q8TAI8|Q96HH7	Missense_Mutation	SNP	pfam_Autophagy-rel_C	p.P291Q	ENST00000377264.3	37	c.872	CCDS31602.1	11	.	.	.	.	.	.	.	.	.	.	G	15.60	2.881506	0.51908	.	.	ENSG00000110046	ENST00000421419;ENST00000377264;ENST00000227459	T;T	0.54071	0.59;0.6	3.96	3.96	0.45880	.	0.000000	0.85682	D	0.000000	T	0.70859	0.3272	M	0.75615	2.305	0.53688	D	0.999973	D	0.89917	1.0	D	0.91635	0.999	T	0.75569	-0.3272	10	0.87932	D	0	.	13.91	0.63860	0.0:0.0:1.0:0.0	.	291	Q2TAZ0	ATG2A_HUMAN	Q	291	ENSP00000410522:P291Q;ENSP00000366475:P291Q	ENSP00000227459:P291Q	P	-	2	0	ATG2A	64436425	1.000000	0.71417	0.869000	0.34112	0.039000	0.13416	6.539000	0.73856	2.224000	0.72417	0.561000	0.74099	CCG	ATG2A	-	NULL	ENSG00000110046		0.682	ATG2A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ATG2A	HGNC	protein_coding	OTTHUMT00000143224.1		0.00	54	0	G	NM_015104		64679849	-1			no_errors	ENST00000421419	ensembl	human	known	74_37	missense	6.25	30	2	SNP	0.996	T
ATG9B	285973	genome.wustl.edu	37	7	150715097	150715097	+	Missense_Mutation	SNP	G	G	T	rs374715533		TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr7:150715097G>T	ENST00000377974.2	-	8	1988	c.1913C>A	c.(1912-1914)cCg>cAg	p.P638Q	ATG9B_ENST00000605938.1_Missense_Mutation_p.P638Q|ATG9B_ENST00000444312.1_Missense_Mutation_p.P124Q|ATG9B_ENST00000494791.1_5'UTR			Q674R7	ATG9B_HUMAN	autophagy related 9B	638					autophagic vacuole assembly (GO:0000045)	autophagic vacuole (GO:0005776)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)				cervix(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(1)|ovary(4)|prostate(1)	14	all_neural(206;0.219)		OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		CAGAAACAGCGGGGTGAGGAG	0.612											OREG0018444	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													39.0	47.0	44.0					7																	150715097		2034	4166	6200	SO:0001583	missense	0			AK027791		7q36	2014-02-12	2012-06-06	2005-09-11	ENSG00000181652	ENSG00000181652			21899	protein-coding gene	gene with protein product		612205	"""nitric oxide synthase 3 antisense"", ""ATG9 autophagy related 9 homolog B (S. cerevisiae)"""	NOS3AS		15234981, 15755735	Standard	NM_173681		Approved	FLJ14885, APG9L2, SONE	uc011kvc.2	Q674R7	OTTHUMG00000158634	ENST00000377974.2:c.1913C>A	7.37:g.150715097G>T	ENSP00000475005:p.Pro638Gln	1734	A1A5D3|Q6JRW5|Q8N8I8	Missense_Mutation	SNP	pfam_Autophagy-rel_prot_9	p.P638Q	ENST00000377974.2	37	c.1913		7	.	.	.	.	.	.	.	.	.	.	G	13.17	2.157963	0.38119	.	.	ENSG00000248602	ENST00000377974;ENST00000444312;ENST00000397266	.	.	.	5.0	5.0	0.66597	.	0.000000	0.85682	D	0.000000	T	0.79423	0.4443	.	.	.	.	.	.	D	0.89917	1.0	D	0.97110	1.0	T	0.83164	-0.0097	7	0.87932	D	0	.	15.8391	0.78831	0.0:0.0:1.0:0.0	.	638	Q674R7	ATG9B_HUMAN	Q	638;124;638	.	ENSP00000444232:P638Q	P	-	2	0	AC010973.1	150346030	1.000000	0.71417	0.910000	0.35882	0.371000	0.29859	9.541000	0.98083	2.586000	0.87340	0.563000	0.77884	CCG	ATG9B	-	pfam_Autophagy-rel_prot_9	ENSG00000181652		0.612	ATG9B-201	KNOWN	basic|appris_principal	protein_coding	ATG9B	HGNC	protein_coding		-	0.00	136	0	G	NM_173681		150715097	-1	tier1	-	no_errors	ENST00000377974	ensembl	human	known	74_37	missense	6.56	57	4	SNP	0.999	T
ATP10D	57205	genome.wustl.edu	37	4	47548721	47548721	+	Missense_Mutation	SNP	A	A	G			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr4:47548721A>G	ENST00000273859.3	+	10	1746	c.1477A>G	c.(1477-1479)Atg>Gtg	p.M493V	ATP10D_ENST00000504445.1_Missense_Mutation_p.M478V	NM_020453.3	NP_065186.3	Q9P241	AT10D_HUMAN	ATPase, class V, type 10D	493					cation transport (GO:0006812)|ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(2)|endometrium(5)|kidney(5)|large_intestine(14)|liver(2)|lung(26)|ovary(2)|pancreas(1)|prostate(5)|skin(2)|stomach(1)|urinary_tract(1)	66						CCTCAGCAATATGGCAAAACC	0.478																																																	0													116.0	120.0	119.0					4																	47548721		2203	4300	6503	SO:0001583	missense	0			AB040920	CCDS3476.1	4p12	2010-04-20	2007-09-19		ENSG00000145246	ENSG00000145246		"""ATPases / P-type"""	13549	protein-coding gene	gene with protein product			"""ATPase, Class V, type 10D"""			12532265	Standard	NM_020453		Approved	ATPVD, KIAA1487	uc003gxk.1	Q9P241	OTTHUMG00000160784	ENST00000273859.3:c.1477A>G	4.37:g.47548721A>G	ENSP00000273859:p.Met493Val		A2RRC8|D6REN2|Q8NC70|Q96SR3	Missense_Mutation	SNP	pfam_ATPase_P-typ_transduc_dom_A,pfam_HAD-like_dom,superfamily_HAD-like_dom,superfamily_ATPase_P-typ_cyto_domN,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Plipid-transp,tigrfam_Cation_transp_P_typ_ATPase	p.M493V	ENST00000273859.3	37	c.1477	CCDS3476.1	4	.	.	.	.	.	.	.	.	.	.	A	1.042	-0.678652	0.03378	.	.	ENSG00000145246	ENST00000273859;ENST00000504445	T;T	0.67865	-0.29;4.12	4.78	-2.06	0.07298	HAD-like domain (1);	0.430440	0.22233	N	0.062787	T	0.50480	0.1618	L	0.40543	1.245	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.09377	0.004;0.001	T	0.34378	-0.9831	10	0.27785	T	0.31	-4.0805	10.4237	0.44365	0.517:0.0:0.483:0.0	.	493;478	Q9P241;Q6PEW3	AT10D_HUMAN;.	V	493;478	ENSP00000273859:M493V;ENSP00000420909:M478V	ENSP00000273859:M493V	M	+	1	0	ATP10D	47243478	0.219000	0.23619	0.002000	0.10522	0.588000	0.36517	0.682000	0.25335	-0.499000	0.06623	0.402000	0.26972	ATG	ATP10D	-	superfamily_HAD-like_dom,tigrfam_ATPase_P-typ_Plipid-transp	ENSG00000145246		0.478	ATP10D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP10D	HGNC	protein_coding	OTTHUMT00000216900.1	-	0.00	67	0	A	NM_020453		47548721	+1	tier1	-	no_errors	ENST00000273859	ensembl	human	known	74_37	missense	43.48	11	10	SNP	0.005	G
ATP13A1	57130	genome.wustl.edu	37	19	19764654	19764654	+	Missense_Mutation	SNP	C	C	A	rs374539785		TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr19:19764654C>A	ENST00000357324.6	-	15	2065	c.2039G>T	c.(2038-2040)cGg>cTg	p.R680L	ATP13A1_ENST00000496082.1_5'UTR|ATP13A1_ENST00000291503.5_Missense_Mutation_p.R562L	NM_020410.2	NP_065143.2	Q9HD20	AT131_HUMAN	ATPase type 13A1	680						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|metal ion binding (GO:0046872)			central_nervous_system(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|liver(2)|lung(7)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	29						GGCTCCTTCCCGGGAGATCTC	0.682																																					Esophageal Squamous(142;920 1789 9047 14684 24777)												0													38.0	39.0	39.0					19																	19764654		2184	4271	6455	SO:0001583	missense	0			AK056420	CCDS32970.2	19p13.11	2010-04-20	2005-01-12	2005-01-12	ENSG00000105726	ENSG00000105726		"""ATPases / P-type"""	24215	protein-coding gene	gene with protein product	"""cation transporting ATPase"""		"""ATPase type 13A"""	ATP13A		11347906	Standard	NM_020410		Approved	KIAA1825, FLJ31858, CGI-152	uc002nnh.4	Q9HD20	OTTHUMG00000153016	ENST00000357324.6:c.2039G>T	19.37:g.19764654C>A	ENSP00000349877:p.Arg680Leu		B3KPJ2|B3KTA7|Q6NT90|Q6ZMG7|Q9H6C6	Missense_Mutation	SNP	pfam_ATPase_P-typ_transduc_dom_A,pfam_HAD-like_dom,superfamily_HAD-like_dom,superfamily_ATPase_P-typ_cyto_domN,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Cation_typ_V,tigrfam_Cation_transp_P_typ_ATPase	p.R680L	ENST00000357324.6	37	c.2039	CCDS32970.2	19	.	.	.	.	.	.	.	.	.	.	C	31	5.096788	0.94197	.	.	ENSG00000105726	ENST00000291503;ENST00000357324	T;T	0.71341	-0.56;-0.56	5.17	5.17	0.71159	ATPase, cation-transporting, domain N (1);HAD-like domain (1);ATPase, P-type, cytoplasmic domain N (1);	0.051941	0.85682	D	0.000000	T	0.74891	0.3776	M	0.83483	2.645	0.80722	D	1	B;B	0.34061	0.436;0.01	B;B	0.35770	0.21;0.01	T	0.77945	-0.2397	10	0.54805	T	0.06	-31.5144	16.1525	0.81632	0.0:1.0:0.0:0.0	.	680;562	Q9HD20;Q9HD20-2	AT131_HUMAN;.	L	562;680	ENSP00000291503:R562L;ENSP00000349877:R680L	ENSP00000291503:R562L	R	-	2	0	ATP13A1	19625654	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.683000	0.68189	2.423000	0.82170	0.561000	0.74099	CGG	ATP13A1	-	pfam_HAD-like_dom,superfamily_HAD-like_dom,superfamily_ATPase_P-typ_cyto_domN,tigrfam_ATPase_P-typ_Cation_typ_V	ENSG00000105726		0.682	ATP13A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP13A1	HGNC	protein_coding	OTTHUMT00000329005.1		0.00	98	0	C	NM_020410		19764654	-1			no_errors	ENST00000357324	ensembl	human	known	74_37	missense	7.14	26	2	SNP	1.000	A
ATP13A4	84239	genome.wustl.edu	37	3	193272452	193272452	+	Intron	SNP	T	T	C			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr3:193272452T>C	ENST00000342695.4	-	1	383				ATP13A4_ENST00000295548.3_Intron|ATP13A4-AS1_ENST00000426459.1_RNA|ATP13A4-AS1_ENST00000431512.1_RNA|ATP13A4_ENST00000392443.3_Intron	NM_032279.2	NP_115655.2	Q4VNC1	AT134_HUMAN	ATPase type 13A4							integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(9)|lung(27)|ovary(2)|prostate(3)|skin(11)|upper_aerodigestive_tract(2)	71	all_cancers(143;1.76e-08)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;2.72e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;0.000109)		cgtgtgtgtgtgtgtgtgtgt	0.438																																																	0																																										SO:0001627	intron_variant	0			AK095277	CCDS3304.2	3q29	2010-04-20			ENSG00000127249	ENSG00000127249		"""ATPases / P-type"""	25422	protein-coding gene	gene with protein product		609556				14702039, 12975309	Standard	XM_005247829		Approved	DKFZp761I1011, FLJ37958	uc003ftd.3	Q4VNC1	OTTHUMG00000074067	ENST00000342695.4:c.60+76A>G	3.37:g.193272452T>C			B7WPC7|Q6UY23|Q8N1Q9|Q9H043	RNA	SNP	-	NULL	ENST00000342695.4	37	NULL	CCDS3304.2	3																																																																																			ATP13A4-AS1	-	-	ENSG00000225473		0.438	ATP13A4-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP13A4-AS1	HGNC	protein_coding	OTTHUMT00000157244.4	-	0.00	38	0	T	NM_032279		193272452	+1	tier1	-	no_errors	ENST00000426459	ensembl	human	known	74_37	rna	12.50	28	4	SNP	0.000	C
ATXN10	25814	genome.wustl.edu	37	22	46125395	46125395	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr22:46125395G>T	ENST00000252934.5	+	7	1084	c.819G>T	c.(817-819)gaG>gaT	p.E273D	ATXN10_ENST00000381061.4_Missense_Mutation_p.E209D	NM_013236.3	NP_037368.1	Q9UBB4	ATX10_HUMAN	ataxin 10	273					cell death (GO:0008219)|nervous system development (GO:0007399)|neuron projection development (GO:0031175)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|extracellular space (GO:0005615)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)				central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(3)|ovary(1)|skin(1)	10		Ovarian(80;0.00973)|all_neural(38;0.0417)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0223)		GGCATGCTGAGTTGATTGCAA	0.478																																																	0													183.0	137.0	153.0					22																	46125395		2203	4300	6503	SO:0001583	missense	0			AK095309	CCDS14070.1, CCDS54540.1	22q13	2013-02-15	2004-08-12	2004-08-12	ENSG00000130638	ENSG00000130638		"""Ataxins"""	10549	protein-coding gene	gene with protein product		611150	"""spinocerebellar ataxia 10"""	SCA10		9973298	Standard	NM_013236		Approved	E46L, FLJ37990	uc003bgm.2	Q9UBB4	OTTHUMG00000150451	ENST00000252934.5:c.819G>T	22.37:g.46125395G>T	ENSP00000252934:p.Glu273Asp		A6NLC4|B4DG05|O14998|O15009|Q6I9X4	Missense_Mutation	SNP	pfam_Ataxin-10_domain,superfamily_ARM-type_fold	p.E273D	ENST00000252934.5	37	c.819	CCDS14070.1	22	.	.	.	.	.	.	.	.	.	.	G	3.862	-0.029709	0.07589	.	.	ENSG00000130638	ENST00000381061;ENST00000252934;ENST00000396011;ENST00000435026	.	.	.	5.13	2.95	0.34219	Armadillo-type fold (1);	0.328345	0.34200	N	0.004164	T	0.18841	0.0452	L	0.34521	1.04	0.09310	N	1	B;B	0.16396	0.017;0.009	B;B	0.15052	0.012;0.007	T	0.10706	-1.0618	9	0.12103	T	0.63	-9.8025	1.4316	0.02335	0.1917:0.169:0.464:0.1753	.	209;273	A6NLC4;Q9UBB4	.;ATX10_HUMAN	D	209;273;273;25	.	ENSP00000252934:E273D	E	+	3	2	ATXN10	44504059	0.599000	0.26891	0.468000	0.27192	0.025000	0.11179	0.426000	0.21363	1.395000	0.46643	0.561000	0.74099	GAG	ATXN10	-	superfamily_ARM-type_fold	ENSG00000130638		0.478	ATXN10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATXN10	HGNC	protein_coding	OTTHUMT00000318142.2		0.00	93	0	G	NM_013236		46125395	+1			no_errors	ENST00000252934	ensembl	human	known	74_37	missense	5.08	56	3	SNP	0.109	T
CMC1	152100	genome.wustl.edu	37	3	28364174	28364174	+	3'UTR	SNP	T	T	C			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr3:28364174T>C	ENST00000466830.1	+	0	3574				AZI2_ENST00000295748.3_5'UTR|AZI2_ENST00000479665.1_3'UTR	NM_182523.1	NP_872329.1	Q7Z7K0	COXM1_HUMAN	C-x(9)-C motif containing 1							mitochondrion (GO:0005739)	metal ion binding (GO:0046872)			central_nervous_system(1)|kidney(1)|large_intestine(3)	5						GTCAGCTGTGTTCATTGGTCA	0.373																																																	0																																										SO:0001624	3_prime_UTR_variant	0			BC052644	CCDS33722.1	3p24.1	2013-10-18	2013-10-18	2008-06-20	ENSG00000187118	ENSG00000187118			28783	protein-coding gene	gene with protein product		615166	"""chromosome 3 open reading frame 68"", ""COX assembly mitochondrial protein 1 homolog (S. cerevisiae)"""	C3orf68		18443040	Standard	NM_182523		Approved	MGC61571	uc003cea.3	Q7Z7K0	OTTHUMG00000155660	ENST00000466830.1:c.*3054T>C	3.37:g.28364174T>C			Q68DJ7	RNA	SNP	-	NULL	ENST00000466830.1	37	NULL	CCDS33722.1	3																																																																																			AZI2	-	-	ENSG00000163512		0.373	CMC1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	AZI2	HGNC	protein_coding	OTTHUMT00000341087.1	-	0.00	50	0	T	NM_182523		28364174	-1	tier1	-	no_errors	ENST00000295748	ensembl	human	known	74_37	rna	18.18	36	8	SNP	0.999	C
BBS1	582	genome.wustl.edu	37	11	66288790	66288790	+	Missense_Mutation	SNP	A	A	C			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr11:66288790A>C	ENST00000318312.7	+	9	824	c.773A>C	c.(772-774)gAt>gCt	p.D258A	ZDHHC24_ENST00000526986.1_3'UTR|CTD-3074O7.11_ENST00000419755.3_Missense_Mutation_p.D295A|BBS1_ENST00000393994.2_Intron|BBS1_ENST00000529766.1_3'UTR|BBS1_ENST00000537537.1_Missense_Mutation_p.D146A|BBS1_ENST00000455748.2_Missense_Mutation_p.D161A	NM_024649.4	NP_078925.3	Q8NFJ9	BBS1_HUMAN	Bardet-Biedl syndrome 1	258					cilium assembly (GO:0042384)|Golgi to plasma membrane protein transport (GO:0043001)|nonmotile primary cilium assembly (GO:0035058)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|retina homeostasis (GO:0001895)|visual perception (GO:0007601)	BBSome (GO:0034464)|cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)	patched binding (GO:0005113)|RNA polymerase II repressing transcription factor binding (GO:0001103)|smoothened binding (GO:0005119)			NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|kidney(5)|large_intestine(5)|lung(5)|ovary(1)|prostate(2)|skin(2)|stomach(2)|urinary_tract(1)	28						GGCCAGTTTGATGTTGAGTTC	0.567									Bardet-Biedl syndrome																												GBM(152;173 2612 9770 10137)												0													111.0	98.0	102.0					11																	66288790		2200	4295	6495	SO:0001583	missense	0	Familial Cancer Database	BBS, Bardet-Biedl syndrome, type 1-12: BBS1-12,Laurence-Moon-Biedl syndrome	AF503941	CCDS8142.1	11q13	2013-01-08			ENSG00000174483	ENSG00000174483			966	protein-coding gene	gene with protein product		209901				9039982, 12567324	Standard	NM_024649		Approved	FLJ23590	uc001oij.1	Q8NFJ9	OTTHUMG00000167110	ENST00000318312.7:c.773A>C	11.37:g.66288790A>C	ENSP00000317469:p.Asp258Ala		Q32MM9|Q32MN0|Q96SN4	Missense_Mutation	SNP	superfamily_Quinonprotein_ADH-like_supfam	p.D295A	ENST00000318312.7	37	c.884	CCDS8142.1	11	.	.	.	.	.	.	.	.	.	.	A	21.0	4.077364	0.76415	.	.	ENSG00000256349;ENSG00000174483;ENSG00000174483;ENSG00000174483;ENSG00000174483	ENST00000419755;ENST00000318312;ENST00000537537;ENST00000525809;ENST00000455748	T;T;D;D;D	0.90620	0.73;0.73;-2.7;-2.7;-2.7	5.72	5.72	0.89469	WD40/YVTN repeat-like-containing domain (1);Quinonprotein alcohol dehydrogenase-like (1);	.	.	.	.	D	0.92328	0.7566	M	0.87180	2.865	0.80722	D	1	P;B;B;B	0.45474	0.859;0.238;0.238;0.238	B;B;B;B	0.43889	0.435;0.247;0.113;0.159	D	0.93015	0.6435	9	0.56958	D	0.05	.	13.9495	0.64106	1.0:0.0:0.0:0.0	.	161;146;258;295	E7EQH1;Q4G0L2;Q8NFJ9;Q8NFJ9-2	.;.;BBS1_HUMAN;.	A	295;258;146;167;161	ENSP00000398526:D295A;ENSP00000317469:D258A;ENSP00000439873:D146A;ENSP00000431187:D167A;ENSP00000405764:D161A	ENSP00000317469:D258A	D	+	2	0	BBS1;CTD-3074O7.11	66045366	1.000000	0.71417	0.979000	0.43373	0.898000	0.52572	8.150000	0.89634	2.182000	0.69389	0.528000	0.53228	GAT	CTD-3074O7.11	-	superfamily_Quinonprotein_ADH-like_supfam	ENSG00000256349		0.567	BBS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BBS1	Clone_based_vega_gene	protein_coding	OTTHUMT00000393235.2	-	0.00	105	0	A			66288790	+1	tier1	-	no_errors	ENST00000419755	ensembl	human	known	74_37	missense	20.34	47	12	SNP	1.000	C
BCAR3	8412	genome.wustl.edu	37	1	94033320	94033320	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr1:94033320C>T	ENST00000370244.1	-	12	2351	c.2063G>A	c.(2062-2064)aGc>aAc	p.S688N	BCAR3_ENST00000539242.1_Missense_Mutation_p.S364N|BCAR3_ENST00000370243.1_Missense_Mutation_p.S688N|BCAR3_ENST00000260502.6_Missense_Mutation_p.S688N|BCAR3_ENST00000370247.3_Missense_Mutation_p.S597N	NM_001261408.1	NP_001248337.1	O75815	BCAR3_HUMAN	breast cancer anti-estrogen resistance 3	688	Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00168}.				lens morphogenesis in camera-type eye (GO:0002089)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|response to drug (GO:0042493)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)		guanyl-nucleotide exchange factor activity (GO:0005085)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(3)|lung(11)|ovary(1)|prostate(1)|skin(1)	25		all_lung(203;0.00145)|Lung NSC(277;0.00662)		all cancers(265;0.0126)|GBM - Glioblastoma multiforme(16;0.0467)|Epithelial(280;0.166)		CAGGAGTTTGCTGAAGGGCTT	0.537																																																	0													103.0	100.0	101.0					1																	94033320		2203	4300	6503	SO:0001583	missense	0			U92715	CCDS745.1, CCDS58010.1	1p22.1	2013-02-14			ENSG00000137936	ENSG00000137936		"""SH2 domain containing"""	973	protein-coding gene	gene with protein product		604704				9582273	Standard	NM_001261408		Approved	NSP2, SH2D3B	uc001dpz.4	O75815	OTTHUMG00000010301	ENST00000370244.1:c.2063G>A	1.37:g.94033320C>T	ENSP00000359264:p.Ser688Asn		D3DT43|Q5TEW3|Q6UW40|Q9BR50	Missense_Mutation	SNP	pfam_SH2,pfam_RasGRF_CDC25,superfamily_Ras_GEF_dom,smart_SH2,smart_RasGRF_CDC25,pfscan_SH2,pfscan_RasGRF_CDC25	p.S688N	ENST00000370244.1	37	c.2063	CCDS745.1	1	.	.	.	.	.	.	.	.	.	.	C	19.44	3.827919	0.71143	.	.	ENSG00000137936	ENST00000370247;ENST00000260502;ENST00000370244;ENST00000370243;ENST00000539242	T;T;T;T;T	0.32515	1.45;1.45;1.45;1.45;1.45	5.39	5.39	0.77823	Guanine-nucleotide dissociation stimulator CDC25 (4);Ras guanine nucleotide exchange factor, domain (1);	0.131804	0.64402	D	0.000001	T	0.34279	0.0892	L	0.57536	1.79	0.43885	D	0.996502	P;D	0.59767	0.919;0.986	P;P	0.50490	0.595;0.642	T	0.16748	-1.0392	10	0.66056	D	0.02	-26.0744	19.1489	0.93479	0.0:1.0:0.0:0.0	.	688;597	O75815;Q5TEW3	BCAR3_HUMAN;.	N	597;688;688;688;364	ENSP00000359267:S597N;ENSP00000260502:S688N;ENSP00000359264:S688N;ENSP00000359263:S688N;ENSP00000441343:S364N	ENSP00000260502:S688N	S	-	2	0	BCAR3	93805908	1.000000	0.71417	1.000000	0.80357	0.887000	0.51463	2.398000	0.44486	2.517000	0.84864	0.561000	0.74099	AGC	BCAR3	-	superfamily_Ras_GEF_dom,smart_RasGRF_CDC25,pfscan_RasGRF_CDC25	ENSG00000137936		0.537	BCAR3-003	NOVEL	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	BCAR3	HGNC	protein_coding	OTTHUMT00000028420.1		0.00	52	0	C			94033320	-1			no_errors	ENST00000260502	ensembl	human	known	74_37	missense	10.71	25	3	SNP	1.000	T
BCAT2	587	genome.wustl.edu	37	19	49299887	49299887	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr19:49299887G>A	ENST00000316273.6	-	9	1025	c.1013C>T	c.(1012-1014)tCg>tTg	p.S338L	BCAT2_ENST00000402551.1_Missense_Mutation_p.S298L|BCAT2_ENST00000597011.1_Missense_Mutation_p.S298L|BCAT2_ENST00000599246.1_Missense_Mutation_p.S246L|BCAT2_ENST00000545387.2_Missense_Mutation_p.S246L|BCAT2_ENST00000598162.1_Missense_Mutation_p.S338L	NM_001190.3	NP_001181.2	O15382	BCAT2_HUMAN	branched chain amino-acid transaminase 2, mitochondrial	338					branched-chain amino acid biosynthetic process (GO:0009082)|branched-chain amino acid catabolic process (GO:0009083)|cellular nitrogen compound metabolic process (GO:0034641)|isoleucine catabolic process (GO:0006550)|leucine metabolic process (GO:0006551)|regulation of hormone levels (GO:0010817)|small molecule metabolic process (GO:0044281)|valine metabolic process (GO:0006573)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	branched-chain-amino-acid transaminase activity (GO:0004084)|L-isoleucine transaminase activity (GO:0052656)|L-leucine transaminase activity (GO:0052654)|L-valine transaminase activity (GO:0052655)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(5)|ovary(2)|skin(1)	12		all_epithelial(76;7e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000138)|all cancers(93;0.000366)|Epithelial(262;0.0195)|GBM - Glioblastoma multiforme(486;0.0224)	L-Isoleucine(DB00167)|L-Leucine(DB00149)	AGCGGTGCCCGAGCCAAAGAC	0.662																																																	0													52.0	53.0	53.0					19																	49299887		2203	4300	6503	SO:0001583	missense	0			U68418	CCDS12735.1, CCDS54290.1, CCDS74416.1	19q13.33	2013-09-20	2010-05-07		ENSG00000105552	ENSG00000105552	2.6.1.42		977	protein-coding gene	gene with protein product		113530	"""branched chain aminotransferase 2, mitochondrial"""	BCT2		9165094	Standard	NM_001190		Approved	BCAM	uc002pkr.3	O15382	OTTHUMG00000183327	ENST00000316273.6:c.1013C>T	19.37:g.49299887G>A	ENSP00000322991:p.Ser338Leu		B2RB87|O00269|Q96KG1|Q9BTB6|Q9BUU6	Missense_Mutation	SNP	pfam_Aminotrans_IV,superfamily_Aminotrans_IV,pirsf_B_amino_transII,tigrfam_B_amino_transII	p.S338L	ENST00000316273.6	37	c.1013	CCDS12735.1	19	.	.	.	.	.	.	.	.	.	.	G	26.2	4.716059	0.89205	.	.	ENSG00000105552	ENST00000316273;ENST00000545387;ENST00000402551	T;T;T	0.21361	2.01;2.01;2.01	4.7	4.7	0.59300	.	0.150880	0.44285	D	0.000464	T	0.52451	0.1735	M	0.90650	3.135	0.58432	D	0.999999	D;D;D;D	0.89917	1.0;1.0;0.996;1.0	D;D;P;D	0.68039	0.938;0.955;0.897;0.955	T	0.62586	-0.6823	10	0.72032	D	0.01	-8.0395	15.5312	0.75964	0.0:0.0:1.0:0.0	.	298;338;246;338	B3KSI3;Q53EW7;O15382-2;O15382	.;.;.;BCAT2_HUMAN	L	338;246;298	ENSP00000322991:S338L;ENSP00000440973:S246L;ENSP00000385161:S298L	ENSP00000322991:S338L	S	-	2	0	BCAT2	53991699	1.000000	0.71417	0.974000	0.42286	0.620000	0.37586	8.713000	0.91408	2.607000	0.88179	0.561000	0.74099	TCG	BCAT2	-	pfam_Aminotrans_IV,superfamily_Aminotrans_IV,pirsf_B_amino_transII,tigrfam_B_amino_transII	ENSG00000105552		0.662	BCAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCAT2	HGNC	protein_coding	OTTHUMT00000466202.1	-	0.00	108	0	G			49299887	-1	tier1	-	no_errors	ENST00000316273	ensembl	human	known	74_37	missense	25.00	35	12	SNP	0.998	A
BCL2L10	10017	genome.wustl.edu	37	15	52402143	52402143	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr15:52402143G>T	ENST00000561198.1	-	2	628	c.587C>A	c.(586-588)cCc>cAc	p.P196H	BCL2L10_ENST00000260442.3_Missense_Mutation_p.P173T			Q9HD36	B2L10_HUMAN	BCL2-like 10 (apoptosis facilitator)	0					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|female gamete generation (GO:0007292)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|positive regulation of apoptotic process (GO:0043065)|spermatogenesis (GO:0007283)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)	2				all cancers(107;0.0148)		AGTGGAAAGGGGGTCCTGAAG	0.453																																																	0													84.0	93.0	90.0					15																	52402143		2195	4293	6488	SO:0001583	missense	0			AF285092	CCDS10148.1	15q21	2007-03-02			ENSG00000137875	ENSG00000137875			993	protein-coding gene	gene with protein product		606910				9829980, 9878060	Standard	NM_020396		Approved	Diva, Boo, BCL-B	uc002abq.3	Q9HD36	OTTHUMG00000131893	ENST00000561198.1:c.587C>A	15.37:g.52402143G>T	ENSP00000453562:p.Pro196His		Q3SX80|Q52LQ9|Q8TCS9	Missense_Mutation	SNP	pfam_Blc2_fam,pfscan_Bcl2-like	p.P173T	ENST00000561198.1	37	c.517		15	.	.	.	.	.	.	.	.	.	.	G	2.968	-0.213042	0.06140	.	.	ENSG00000137875	ENST00000260442	T	0.33216	1.42	3.4	0.456	0.16655	.	0.816495	0.10608	N	0.654784	T	0.16557	0.0398	N	0.24115	0.695	0.09310	N	1	P	0.44241	0.829	B	0.38378	0.272	T	0.12344	-1.0551	10	0.49607	T	0.09	.	3.6546	0.08215	0.2372:0.2083:0.5545:0.0	.	163	Q9HD36	B2L10_HUMAN	T	173	ENSP00000260442:P173T	ENSP00000260442:P173T	P	-	1	0	BCL2L10	50189435	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.399000	0.07250	0.109000	0.17891	-0.254000	0.11334	CCC	BCL2L10	-	NULL	ENSG00000137875		0.453	BCL2L10-002	PUTATIVE	basic|exp_conf	protein_coding	BCL2L10	HGNC	protein_coding	OTTHUMT00000419386.1	-	0.00	49	0	G			52402143	-1	tier1	-	no_errors	ENST00000260442	ensembl	human	known	74_37	missense	8.00	46	4	SNP	0.000	T
BCL9	607	genome.wustl.edu	37	1	147091533	147091533	+	Silent	SNP	A	A	G			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr1:147091533A>G	ENST00000234739.3	+	8	2312	c.1572A>G	c.(1570-1572)gaA>gaG	p.E524E		NM_004326.2	NP_004317.2	O00512	BCL9_HUMAN	B-cell CLL/lymphoma 9	524	Pro-rich.				canonical Wnt signaling pathway (GO:0060070)|myotube differentiation involved in skeletal muscle regeneration (GO:0014908)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|skeletal muscle cell differentiation (GO:0035914)|somatic stem cell maintenance (GO:0035019)	cis-Golgi network (GO:0005801)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)				breast(1)|large_intestine(2)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	7	all_hematologic(923;0.115)					CCCCTAGTGAAGGCTGGGCAC	0.612			T	"""IGH@, IGL@"""	B-ALL																																			Dom	yes		1	1q21	607	B-cell CLL/lymphoma 9		L	0													61.0	70.0	67.0					1																	147091533		2203	4300	6503	SO:0001819	synonymous_variant	0			Y13620	CCDS30833.1	1q21	2008-02-05			ENSG00000116128	ENSG00000116128			1008	protein-coding gene	gene with protein product		602597				9490669	Standard	NM_004326		Approved		uc001epq.3	O00512	OTTHUMG00000014031	ENST00000234739.3:c.1572A>G	1.37:g.147091533A>G			Q5T489	Silent	SNP	pfam_BCL9_beta-catenin-bd_dom	p.E524	ENST00000234739.3	37	c.1572	CCDS30833.1	1																																																																																			BCL9	-	NULL	ENSG00000116128		0.612	BCL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCL9	HGNC	protein_coding	OTTHUMT00000039468.1	-	0.00	65	0	A	NM_004326		147091533	+1	tier1	-	no_errors	ENST00000234739	ensembl	human	known	74_37	silent	42.42	19	14	SNP	0.911	G
BZRAP1	9256	genome.wustl.edu	37	17	56383220	56383220	+	Nonsense_Mutation	SNP	G	G	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr17:56383220G>T	ENST00000343736.4	-	27	5394	c.5231C>A	c.(5230-5232)tCg>tAg	p.S1744*	BZRAP1_ENST00000268893.6_Nonsense_Mutation_p.S1684*|BZRAP1_ENST00000355701.3_Nonsense_Mutation_p.S1744*			O95153	RIMB1_HUMAN	benzodiazepine receptor (peripheral) associated protein 1	1744						cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	benzodiazepine receptor binding (GO:0030156)			cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|liver(2)|lung(16)|ovary(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	54	Medulloblastoma(34;0.127)|all_neural(34;0.237)					AGGGCCTTCCGACTCAGCTGT	0.667																																																	0													46.0	45.0	45.0					17																	56383220		2203	4300	6503	SO:0001587	stop_gained	0			AB014512	CCDS11605.1, CCDS45742.1	17q22-q23	2014-01-09	2014-01-09						16831	protein-coding gene	gene with protein product		610764				9734811, 9915832	Standard	NM_004758		Approved	PRAX-1, KIAA0612, RIM-BP1, RIMBP1	uc002ivx.5	O95153		ENST00000343736.4:c.5231C>A	17.37:g.56383220G>T	ENSP00000345824:p.Ser1744*		O75111|Q8N5W3	Nonsense_Mutation	SNP	pfam_SH3_2,superfamily_SH3_domain,superfamily_Fibronectin_type3,smart_SH3_domain,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_SH3_domain	p.S1744*	ENST00000343736.4	37	c.5231	CCDS11605.1	17	.	.	.	.	.	.	.	.	.	.	G	8.239	0.806310	0.16467	.	.	ENSG00000005379	ENST00000355701;ENST00000343736;ENST00000268893	.	.	.	5.02	-5.59	0.02505	.	3.477390	0.00447	N	0.000096	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07990	T	0.79	.	2.5045	0.04641	0.4619:0.1199:0.2963:0.1219	.	.	.	.	X	1744;1744;1684	.	ENSP00000268893:S1684X	S	-	2	0	BZRAP1	53738219	0.000000	0.05858	0.000000	0.03702	0.107000	0.19398	-0.456000	0.06754	-1.368000	0.02149	0.561000	0.74099	TCG	BZRAP1	-	NULL	ENSG00000005379		0.667	BZRAP1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	BZRAP1	HGNC	protein_coding	OTTHUMT00000443980.1	-	0.00	82	0	G	NM_004758		56383220	-1	tier1	-	no_errors	ENST00000355701	ensembl	human	known	74_37	nonsense	8.33	44	4	SNP	0.000	T
EDRF1	26098	genome.wustl.edu	37	10	127438041	127438041	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr10:127438041G>A	ENST00000356792.4	+	22	3416	c.3184G>A	c.(3184-3186)Gcc>Acc	p.A1062T	C10orf137_ENST00000337623.3_Missense_Mutation_p.A1028T|RP11-383C5.7_ENST00000594025.1_RNA|RP11-383C5.7_ENST00000449436.1_RNA|RP11-383C5.7_ENST00000602030.1_RNA|RP11-383C5.7_ENST00000593871.1_RNA|RP11-383C5.7_ENST00000601363.1_RNA|RP11-383C5.7_ENST00000600784.1_RNA	NM_001202438.1	NP_001189367.1	Q3B7T1	EDRF1_HUMAN		1062					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(5)|large_intestine(12)|lung(20)|ovary(8)|pancreas(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	61		all_lung(145;0.0096)|Lung NSC(174;0.0145)|Colorectal(57;0.0846)|all_neural(114;0.0936)				TTACAGCAAGGCCGCAAAGCT	0.463																																																	0													148.0	131.0	136.0					10																	127438041		2203	4300	6503	SO:0001583	missense	0																														ENST00000356792.4:c.3184G>A	10.37:g.127438041G>A	ENSP00000349244:p.Ala1062Thr		B2RC65|Q3KR40|Q4G190|Q5VZQ4|Q8IZ74|Q9Y3W4	Missense_Mutation	SNP	NULL	p.A1062T	ENST00000356792.4	37	c.3184	CCDS55733.1	10	.	.	.	.	.	.	.	.	.	.	G	21.3	4.121976	0.77436	.	.	ENSG00000107938	ENST00000356792;ENST00000337623	.	.	.	5.55	5.55	0.83447	.	0.000000	0.85682	D	0.000000	T	0.80253	0.4589	M	0.73598	2.24	0.80722	D	1	D;P;D	0.71674	0.998;0.934;0.998	D;P;D	0.81914	0.995;0.594;0.995	T	0.81957	-0.0695	9	0.87932	D	0	.	19.5003	0.95091	0.0:0.0:1.0:0.0	.	1062;409;1028	Q3B7T1;Q5VZQ1;Q3B7T1-5	EDRF1_HUMAN;.;.	T	1062;1028	.	ENSP00000336727:A1028T	A	+	1	0	C10orf137	127428031	1.000000	0.71417	0.935000	0.37517	0.055000	0.15305	9.411000	0.97342	2.594000	0.87642	0.585000	0.79938	GCC	C10orf137	-	NULL	ENSG00000107938		0.463	C10orf137-007	KNOWN	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	C10orf137	HGNC	protein_coding	OTTHUMT00000388539.1	-	0.00	62	0	G			127438041	+1	tier1	-	no_errors	ENST00000356792	ensembl	human	known	74_37	missense	7.41	50	4	SNP	1.000	A
C14orf39	317761	genome.wustl.edu	37	14	60950412	60950412	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr14:60950412C>A	ENST00000321731.3	-	4	389	c.230G>T	c.(229-231)aGa>aTa	p.R77I		NM_174978.2	NP_777638	Q8N1H7	S6OS1_HUMAN	chromosome 14 open reading frame 39	77					multicellular organismal development (GO:0007275)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)					breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(5)|lung(7)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	30				OV - Ovarian serous cystadenocarcinoma(108;0.0448)		TACTCACTTTCTACAGTTGTC	0.294																																																	0													125.0	112.0	117.0					14																	60950412		2199	4297	6496	SO:0001583	missense	0			AK098187	CCDS9746.1	14q23.1	2012-11-05	2012-11-05	2012-11-05	ENSG00000179008	ENSG00000179008			19849	protein-coding gene	gene with protein product							Standard	NM_174978		Approved	SIX6OS1	uc001xez.4	Q8N1H7	OTTHUMG00000140332	ENST00000321731.3:c.230G>T	14.37:g.60950412C>A	ENSP00000324920:p.Arg77Ile		Q08AQ4	Missense_Mutation	SNP	NULL	p.R77I	ENST00000321731.3	37	c.230	CCDS9746.1	14	.	.	.	.	.	.	.	.	.	.	C	11.82	1.752439	0.31046	.	.	ENSG00000179008	ENST00000321731;ENST00000555476;ENST00000556799	T;T	0.41758	1.97;0.99	5.73	-1.5	0.08691	.	0.514295	0.20878	N	0.084052	T	0.12433	0.0302	N	0.02539	-0.55	0.35848	D	0.826542	B	0.06786	0.001	B	0.06405	0.002	T	0.05241	-1.0897	10	0.36615	T	0.2	.	0.6737	0.00863	0.1816:0.3146:0.2546:0.2492	.	77	Q8N1H7	S6OS1_HUMAN	I	77;48;77	ENSP00000324920:R77I;ENSP00000451665:R48I	ENSP00000324920:R77I	R	-	2	0	C14orf39	60020165	0.371000	0.25056	0.984000	0.44739	0.706000	0.40770	-0.768000	0.04715	-0.057000	0.13199	-0.150000	0.13652	AGA	C14orf39	-	NULL	ENSG00000179008		0.294	C14orf39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C14orf39	HGNC	protein_coding	OTTHUMT00000276948.1		0.00	58	0	C	NM_174978		60950412	-1			no_errors	ENST00000321731	ensembl	human	known	74_37	missense	5.13	37	2	SNP	0.977	A
C6	729	genome.wustl.edu	37	5	41199895	41199895	+	Nonsense_Mutation	SNP	G	G	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr5:41199895G>T	ENST00000263413.3	-	4	684	c.420C>A	c.(418-420)tgC>tgA	p.C140*	C6_ENST00000337836.5_Nonsense_Mutation_p.C140*	NM_001115131.1	NP_001108603.2	P13671	CO6_HUMAN	complement component 6	140	LDL-receptor class A. {ECO:0000255|PROSITE-ProRule:PRU00124}.				complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane attack complex (GO:0005579)				central_nervous_system(2)|cervix(2)|endometrium(2)|kidney(7)|large_intestine(16)|liver(1)|lung(51)|ovary(3)|prostate(1)|skin(9)|upper_aerodigestive_tract(2)	96		Breast(839;1.07e-05)|Ovarian(839;0.0228)|Lung SC(612;0.0548)|Lung NSC(810;0.128)|all_neural(839;0.157)				ATTTATTCTTGCAGTCAGCCT	0.428																																																	0													120.0	120.0	120.0					5																	41199895		2203	4300	6503	SO:0001587	stop_gained	0			J05024	CCDS3936.1	5p13.1	2014-09-17			ENSG00000039537	ENSG00000039537		"""Complement system"""	1339	protein-coding gene	gene with protein product		217050					Standard	NM_001115131		Approved		uc003jmk.3	P13671	OTTHUMG00000094781	ENST00000263413.3:c.420C>A	5.37:g.41199895G>T	ENSP00000263413:p.Cys140*			Nonsense_Mutation	SNP	pfam_MACPF,pfam_Sushi_SCR_CCP,pfam_Thrombospondin_1_rpt,pfam_LDrepeatLR_classA_rpt,pfam_Kazal_dom,superfamily_Sushi_SCR_CCP,superfamily_Thrombospondin_1_rpt,superfamily_LDrepeatLR_classA_rpt,smart_Thrombospondin_1_rpt,smart_LDrepeatLR_classA_rpt,smart_MACPF,smart_Sushi_SCR_CCP,smart_FacI_MAC,prints_MAC_perforin,pfscan_LDrepeatLR_classA_rpt,pfscan_Sushi_SCR_CCP,pfscan_Thrombospondin_1_rpt	p.C140*	ENST00000263413.3	37	c.420	CCDS3936.1	5	.	.	.	.	.	.	.	.	.	.	G	36	5.669248	0.96754	.	.	ENSG00000039537	ENST00000337836;ENST00000263413	.	.	.	6.02	6.02	0.97574	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-14.6735	9.3356	0.38049	0.1514:0.0:0.8486:0.0	.	.	.	.	X	140	.	ENSP00000263413:C140X	C	-	3	2	C6	41235652	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	4.642000	0.61383	2.857000	0.98124	0.650000	0.86243	TGC	C6	-	pfam_LDrepeatLR_classA_rpt,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,pfscan_LDrepeatLR_classA_rpt	ENSG00000039537		0.428	C6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C6	HGNC	protein_coding	OTTHUMT00000211592.1	-	0.00	103	0	G			41199895	-1	tier1	-	no_errors	ENST00000263413	ensembl	human	known	74_37	nonsense	7.02	53	4	SNP	1.000	T
CFAP69	79846	genome.wustl.edu	37	7	89894642	89894642	+	Silent	SNP	G	G	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr7:89894642G>T	ENST00000389297.4	+	5	635	c.384G>T	c.(382-384)tcG>tcT	p.S128S	C7orf63_ENST00000463311.1_3'UTR|C7orf63_ENST00000316089.8_Silent_p.S128S|AC002064.4_ENST00000420245.1_RNA|C7orf63_ENST00000497910.1_Silent_p.S128S	NM_001039706.2|NM_001160138.1	NP_001034795.2|NP_001153610.1	A5D8W1	CG063_HUMAN		128										breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(12)|lung(14)|ovary(1)|prostate(3)	37						AGAAAGTGTCGGATGAAATAA	0.323																																																	0													150.0	146.0	147.0					7																	89894642		1818	4088	5906	SO:0001819	synonymous_variant	0																														ENST00000389297.4:c.384G>T	7.37:g.89894642G>T			A3KMP9|B4DYW6|B4DZP7|B9EIM7|Q6V705|Q8IY89|Q9H7C2	Silent	SNP	superfamily_ARM-type_fold	p.S128	ENST00000389297.4	37	c.384	CCDS43613.2	7																																																																																			C7orf63	-	NULL	ENSG00000105792		0.323	C7orf63-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	C7orf63	HGNC	protein_coding	OTTHUMT00000139891.4		0.00	103	0	G			89894642	+1			no_errors	ENST00000389297	ensembl	human	known	74_37	silent	6.45	58	4	SNP	0.513	T
C8orf34	116328	genome.wustl.edu	37	8	69699681	69699681	+	Nonsense_Mutation	SNP	G	G	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr8:69699681G>T	ENST00000539993.1	+	12	1750	c.1201G>T	c.(1201-1203)Gaa>Taa	p.E401*	C8orf34_ENST00000325233.3_Nonsense_Mutation_p.E145*|C8orf34_ENST00000337103.4_Nonsense_Mutation_p.E376*|C8orf34_ENST00000518698.1_Nonsense_Mutation_p.E487*			Q49A92	CH034_HUMAN	chromosome 8 open reading frame 34	401								p.E376K(1)		NS(1)|breast(2)|endometrium(3)|kidney(2)|large_intestine(9)|lung(12)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	36			Epithelial(68;0.0117)|OV - Ovarian serous cystadenocarcinoma(28;0.0227)|all cancers(69;0.0502)			TTTGCAGGATGAATCCTTAAA	0.358																																																	1	Substitution - Missense(1)	skin(1)											106.0	100.0	102.0					8																	69699681		2203	4300	6503	SO:0001587	stop_gained	0			AB056652	CCDS6203.1, CCDS6203.2	8q13	2009-10-01			ENSG00000165084	ENSG00000165084			30905	protein-coding gene	gene with protein product	"""vestibule 1"""						Standard	NM_052958		Approved	vest-1, VEST1	uc010lyz.3	Q49A92	OTTHUMG00000164438	ENST00000539993.1:c.1201G>T	8.37:g.69699681G>T	ENSP00000438159:p.Glu401*		A8K5X1|G3XAM6|Q8N1X0|Q8N9M7|Q8ND19|Q96Q28	Nonsense_Mutation	SNP	superfamily_cAMP_dep_PK_reg_su_I/II_a/b	p.E487*	ENST00000539993.1	37	c.1459		8	.	.	.	.	.	.	.	.	.	.	G	38	6.685629	0.97759	.	.	ENSG00000165084	ENST00000518698;ENST00000539993;ENST00000337103;ENST00000325233	.	.	.	5.36	5.36	0.76844	.	0.528567	0.19765	N	0.106580	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-14.2579	16.3753	0.83383	0.0:0.0:1.0:0.0	.	.	.	.	X	487;401;376;145	.	.	E	+	1	0	C8orf34	69862235	1.000000	0.71417	1.000000	0.80357	0.198000	0.23893	4.306000	0.59117	2.657000	0.90304	0.655000	0.94253	GAA	C8orf34	-	NULL	ENSG00000165084		0.358	C8orf34-201	KNOWN	basic|appris_candidate	protein_coding	C8orf34	HGNC	protein_coding			0.00	48	0	G	NM_052958		69699681	+1			no_errors	ENST00000518698	ensembl	human	known	74_37	nonsense	8.00	23	2	SNP	1.000	T
CACNA2D2	9254	genome.wustl.edu	37	3	50431572	50431572	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr3:50431572G>T	ENST00000479441.1	-	4	432	c.433C>A	c.(433-435)Cag>Aag	p.Q145K	CACNA2D2_ENST00000395083.1_Missense_Mutation_p.Q145K|CACNA2D2_ENST00000435965.1_Missense_Mutation_p.Q145K|CACNA2D2_ENST00000429770.1_Missense_Mutation_p.Q145K|CACNA2D2_ENST00000423994.2_Missense_Mutation_p.Q145K|CACNA2D2_ENST00000360963.3_Missense_Mutation_p.Q76K|CACNA2D2_ENST00000266039.3_Missense_Mutation_p.Q145K|CACNA2D2_ENST00000424201.2_Missense_Mutation_p.Q145K			Q9NY47	CA2D2_HUMAN	calcium channel, voltage-dependent, alpha 2/delta subunit 2	145					energy reserve metabolic process (GO:0006112)|muscle fiber development (GO:0048747)|neuromuscular junction development (GO:0007528)|positive regulation of organ growth (GO:0046622)|regulation of insulin secretion (GO:0050796)|regulation of multicellular organism growth (GO:0040014)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			breast(3)|cervix(1)|endometrium(4)|large_intestine(4)|lung(8)|ovary(2)|prostate(4)|skin(4)|urinary_tract(1)	31				BRCA - Breast invasive adenocarcinoma(193;0.000365)|KIRC - Kidney renal clear cell carcinoma(197;0.00862)|Kidney(197;0.01)	Amiodarone(DB01118)|Bepridil(DB01244)|Felodipine(DB01023)|Gabapentin(DB00996)|Isradipine(DB00270)|Nitrendipine(DB01054)|Spironolactone(DB00421)	TGTGCTTTCTGGAAGTTCTCT	0.597																																																	0													171.0	149.0	157.0					3																	50431572		2203	4300	6503	SO:0001583	missense	0			AF040709	CCDS33763.1, CCDS54588.1, CCDS63647.1	3p21.3	2004-02-27			ENSG00000007402	ENSG00000007402		"""Calcium channel subunits"""	1400	protein-coding gene	gene with protein product	"""gene 26"""	607082					Standard	XM_005265581		Approved	KIAA0558	uc003daq.3	Q9NY47	OTTHUMG00000156887	ENST00000479441.1:c.433C>A	3.37:g.50431572G>T	ENSP00000418081:p.Gln145Lys		A7MD15|Q9NY48|Q9UEW0|Q9Y268	Missense_Mutation	SNP	pfam_VWA_N,pfam_VDCC_a2/dsu,pfam_Cache_domain,pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	p.Q145K	ENST00000479441.1	37	c.433	CCDS54588.1	3	.	.	.	.	.	.	.	.	.	.	G	23.3	4.397219	0.83120	.	.	ENSG00000007402	ENST00000423994;ENST00000429770;ENST00000266039;ENST00000360963;ENST00000435965;ENST00000395083;ENST00000424201;ENST00000479441	T;T;T;T;T;T;T;T	0.05649	3.42;3.41;3.41;3.42;3.42;3.41;3.41;3.41	4.32	4.32	0.51571	VWA N-terminal (1);	0.000000	0.64402	D	0.000002	T	0.20941	0.0504	M	0.66939	2.045	0.41254	D	0.98673	D;D	0.67145	0.996;0.995	D;D	0.66196	0.932;0.942	T	0.01235	-1.1410	10	0.36615	T	0.2	-14.9789	15.9954	0.80234	0.0:0.0:1.0:0.0	.	145;145	Q9NY47;Q9NY47-2	CA2D2_HUMAN;.	K	145;145;145;76;145;145;145;145	ENSP00000407393:Q145K;ENSP00000404631:Q145K;ENSP00000266039:Q145K;ENSP00000354228:Q76K;ENSP00000390526:Q145K;ENSP00000378519:Q145K;ENSP00000390329:Q145K;ENSP00000418081:Q145K	ENSP00000266039:Q145K	Q	-	1	0	CACNA2D2	50406576	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.124000	0.77185	2.233000	0.73108	0.491000	0.48974	CAG	CACNA2D2	-	pfam_VWA_N	ENSG00000007402		0.597	CACNA2D2-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	CACNA2D2	HGNC	protein_coding	OTTHUMT00000346457.1	-	0.00	74	0	G	NM_006030		50431572	-1	tier1	-	no_errors	ENST00000435965	ensembl	human	known	74_37	missense	15.79	16	3	SNP	1.000	T
CAD	790	genome.wustl.edu	37	2	27447238	27447238	+	Silent	SNP	C	C	A			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr2:27447238C>A	ENST00000403525.1	+	9	1278	c.1134C>A	c.(1132-1134)ctC>ctA	p.L378L	CAD_ENST00000264705.4_Silent_p.L378L			O76075	DFFB_HUMAN	carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase	0					apoptotic chromosome condensation (GO:0030263)|apoptotic DNA fragmentation (GO:0006309)|apoptotic process (GO:0006915)|brain development (GO:0007420)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)	cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	deoxyribonuclease activity (GO:0004536)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)			NS(1)|breast(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(40)|ovary(6)|pancreas(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	92	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CTGAGCGCCTCTGTCCCCCTG	0.577																																																	0													56.0	57.0	57.0					2																	27447238		2203	4300	6503	SO:0001819	synonymous_variant	0			D78586	CCDS1742.1	2p22-p21	2012-10-02			ENSG00000084774	ENSG00000084774	2.1.3.2, 3.5.2.-		1424	protein-coding gene	gene with protein product		114010				8619816, 2565865	Standard	NM_004341		Approved		uc002rji.3	P27708	OTTHUMG00000097070	ENST00000403525.1:c.1134C>A	2.37:g.27447238C>A			O60521|Q5SR22|Q9BYI4|Q9BYI5|Q9BYI6	Silent	SNP	pfam_CbamoylP_synth_lsu-like_ATP-bd,pfam_CarbamoylP_synth_ssu_N,pfam_Asp/Orn_carbamoyltranf_P-bd,pfam_GATASE,pfam_Asp_carbamoyltransf_Asp/Orn-bd,pfam_CarbamoylP_synth_lsu_oligo,pfam_CarbamoylP_synth_lsu_N,pfam_ATP-grasp_carboxylate-amine,pfam_MGS-like_dom,pfam_Dala_Dala_lig_C,pfam_Amidohydro_1,superfamily_Asp/Orn_carbamoylTrfase,superfamily_CarbamoylP_synth_lsu_oligo,superfamily_CarbamoylP_synth_ssu_N,superfamily_PreATP-grasp_dom,superfamily_MGS-like_dom,superfamily_Metal-dep_hydrolase_composite,smart_MGS-like_dom,pfscan_ATP-grasp,prints_CbamoylP_synth_lsu_CPSase_dom,prints_Asp_carbamoyltransf,prints_Asp/Orn_carbamoylTrfase,tigrfam_CarbamoylP_synth_lsu,tigrfam_CarbamoylP_synth_ssu,tigrfam_Asp_carbamoyltransf	p.L378	ENST00000403525.1	37	c.1134		2																																																																																			CAD	-	NULL	ENSG00000084774		0.577	CAD-002	NOVEL	basic|exp_conf	protein_coding	CAD	HGNC	protein_coding	OTTHUMT00000324970.1		0.00	66	0	C			27447238	+1			no_errors	ENST00000264705	ensembl	human	known	74_37	silent	11.11	24	3	SNP	0.987	A
CAMSAP2	23271	genome.wustl.edu	37	1	200817688	200817688	+	Silent	SNP	T	T	G			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr1:200817688T>G	ENST00000236925.4	+	12	1873	c.1824T>G	c.(1822-1824)ggT>ggG	p.G608G	CAMSAP2_ENST00000358823.2_Silent_p.G597G|CAMSAP2_ENST00000413307.2_Silent_p.G581G			Q08AD1	CAMP2_HUMAN	calmodulin regulated spectrin-associated protein family, member 2	608					microtubule cytoskeleton organization (GO:0000226)|regulation of organelle organization (GO:0033043)	cytoplasm (GO:0005737)|microtubule minus-end (GO:0036449)	microtubule minus-end binding (GO:0051011)										ATACGAAAGGTGCCTTGAGTC	0.358																																																	0													78.0	73.0	74.0					1																	200817688		2203	4299	6502	SO:0001819	synonymous_variant	0			AB029001	CCDS1404.1, CCDS72998.1, CCDS72999.1	1q32	2011-08-18	2011-08-18	2011-08-18	ENSG00000118200	ENSG00000118200			29188	protein-coding gene	gene with protein product		613775	"""calmodulin regulated spectrin-associated protein 1-like 1"""	CAMSAP1L1		15897902, 19508979	Standard	XM_005245040		Approved	KIAA1078	uc001gvk.3	Q08AD1	OTTHUMG00000035740	ENST00000236925.4:c.1824T>G	1.37:g.200817688T>G			B1APG6|Q08AD2|Q6PGN8|Q96FB3|Q9UG20|Q9UPS4	Silent	SNP	pfam_CKK_domain,pfam_CAMSAP_CH,pfam_CH-domain,superfamily_PRC_barrel-like,superfamily_CH-domain	p.G608	ENST00000236925.4	37	c.1824		1																																																																																			CAMSAP2	-	NULL	ENSG00000118200		0.358	CAMSAP2-001	KNOWN	basic|appris_candidate_longest	protein_coding	CAMSAP2	HGNC	protein_coding	OTTHUMT00000086956.2	-	0.00	64	0	T	NM_203459		200817688	+1	tier1	-	no_errors	ENST00000236925	ensembl	human	known	74_37	silent	35.29	21	12	SNP	0.992	G
CAPN1	823	genome.wustl.edu	37	11	64953781	64953781	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr11:64953781G>T	ENST00000527323.1	+	5	971	c.731G>T	c.(730-732)cGg>cTg	p.R244L	CAPN1_ENST00000533129.1_Missense_Mutation_p.R244L|CAPN1_ENST00000533820.1_Missense_Mutation_p.R244L|CAPN1_ENST00000279247.6_Missense_Mutation_p.R244L|CAPN1_ENST00000524773.1_Missense_Mutation_p.R244L			P07384	CAN1_HUMAN	calpain 1, (mu/I) large subunit	244	Calpain catalytic. {ECO:0000255|PROSITE- ProRule:PRU00239}.				extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of cell proliferation (GO:0008284)|proteolysis (GO:0006508)|receptor catabolic process (GO:0032801)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)			breast(2)|endometrium(1)|large_intestine(2)|lung(5)|ovary(1)|prostate(1)|skin(1)	13		Lung NSC(402;0.094)|Melanoma(852;0.16)		Lung(977;0.00168)|LUSC - Lung squamous cell carcinoma(976;0.00813)		GCGCTGGAGCGGGGCTCCCTG	0.582																																																	0													29.0	35.0	33.0					11																	64953781		1986	4160	6146	SO:0001583	missense	0			X04366	CCDS44644.1	11q13	2013-01-10			ENSG00000014216	ENSG00000014216	3.4.22.52	"""EF-hand domain containing"""	1476	protein-coding gene	gene with protein product		114220				3017764, 2209092	Standard	NM_005186		Approved	muCANP, muCL, CANP, CANPL1	uc009yqd.2	P07384	OTTHUMG00000165614	ENST00000527323.1:c.731G>T	11.37:g.64953781G>T	ENSP00000431984:p.Arg244Leu		Q2TTR0|Q6DHV4	Missense_Mutation	SNP	pfam_Peptidase_C2_calpain_cat,pfam_Calpain_domain_III,superfamily_Calpain_domain_III,smart_Peptidase_C2_calpain_cat,smart_Calpain_III,pfscan_EF_hand_dom,pfscan_Peptidase_C2_calpain_cat,prints_Calpain_cysteine_protease	p.R244L	ENST00000527323.1	37	c.731	CCDS44644.1	11	.	.	.	.	.	.	.	.	.	.	G	24.5	4.539403	0.85917	.	.	ENSG00000014216	ENST00000533820;ENST00000533129;ENST00000524773;ENST00000279247;ENST00000259755;ENST00000527323;ENST00000526468	D;D;D;D;D;D	0.88509	-2.39;-2.39;-2.39;-2.39;-2.39;-2.39	4.53	3.62	0.41486	Peptidase C2, calpain, catalytic domain (3);	0.000000	0.85682	D	0.000000	D	0.93350	0.7880	M	0.86651	2.83	0.80722	D	1	P	0.49862	0.929	P	0.59221	0.854	D	0.93008	0.6429	10	0.62326	D	0.03	.	10.387	0.44145	0.0975:0.0:0.9025:0.0	.	244	P07384	CAN1_HUMAN	L	244;244;244;244;190;244;139	ENSP00000435272:R244L;ENSP00000431686:R244L;ENSP00000434176:R244L;ENSP00000279247:R244L;ENSP00000431984:R244L;ENSP00000433366:R139L	ENSP00000259755:R190L	R	+	2	0	CAPN1	64710357	1.000000	0.71417	0.410000	0.26471	0.980000	0.70556	5.712000	0.68407	0.913000	0.36797	0.563000	0.77884	CGG	CAPN1	-	pfam_Peptidase_C2_calpain_cat,smart_Peptidase_C2_calpain_cat,pfscan_Peptidase_C2_calpain_cat	ENSG00000014216		0.582	CAPN1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	CAPN1	HGNC	protein_coding	OTTHUMT00000385325.1	-	0.00	74	0	G			64953781	+1	tier1	-	no_errors	ENST00000279247	ensembl	human	known	74_37	missense	7.84	47	4	SNP	0.985	T
CC2D1B	200014	genome.wustl.edu	37	1	52826727	52826727	+	Silent	SNP	G	G	A			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr1:52826727G>A	ENST00000371586.2	-	5	534	c.396C>T	c.(394-396)ggC>ggT	p.G132G	CC2D1B_ENST00000438831.1_5'UTR|CC2D1B_ENST00000460261.1_5'UTR|CC2D1B_ENST00000284376.3_Silent_p.G132G	NM_032449.2	NP_115825.1	Q5T0F9	C2D1B_HUMAN	coiled-coil and C2 domain containing 1B	132	Glu-rich.					nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)			breast(1)|large_intestine(6)|lung(13)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	27						CCTCCTCAGAGCCGCCTGGGT	0.607																																																	0													104.0	98.0	100.0					1																	52826727		2203	4300	6503	SO:0001819	synonymous_variant	0			AB058739	CCDS30714.1	1p32.3	2008-02-05			ENSG00000154222	ENSG00000154222			29386	protein-coding gene	gene with protein product						11347906	Standard	NM_032449		Approved	KIAA1836	uc001ctq.2	Q5T0F9	OTTHUMG00000008102	ENST00000371586.2:c.396C>T	1.37:g.52826727G>A			Q49AE8|Q5T0F8|Q5T0G0|Q6ZNQ1|Q96AP3|Q96I04|Q96JJ1	Silent	SNP	pfam_C2_dom,superfamily_C2_dom,smart_DM14,smart_C2_dom	p.G132	ENST00000371586.2	37	c.396	CCDS30714.1	1	.	.	.	.	.	.	.	.	.	.	G	4.823	0.152937	0.09185	.	.	ENSG00000154222	ENST00000450942	.	.	.	4.71	2.81	0.32909	.	.	.	.	.	T	0.32734	0.0839	.	.	.	0.18873	N	0.999985	.	.	.	.	.	.	T	0.19811	-1.0294	4	.	.	.	0.8033	6.7468	0.23466	0.0968:0.1778:0.7255:0.0	.	.	.	.	V	73	.	.	A	-	2	0	CC2D1B	52599315	0.026000	0.19158	0.002000	0.10522	0.076000	0.17211	2.346000	0.44027	0.691000	0.31592	0.655000	0.94253	GCT	CC2D1B	-	NULL	ENSG00000154222		0.607	CC2D1B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CC2D1B	HGNC	protein_coding	OTTHUMT00000022189.1		0.00	51	0	G	NM_032449		52826727	-1			no_errors	ENST00000371586	ensembl	human	known	74_37	silent	10.53	34	4	SNP	0.007	A
CCDC110	256309	genome.wustl.edu	37	4	186379789	186379789	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr4:186379789G>T	ENST00000307588.3	-	6	2027	c.1952C>A	c.(1951-1953)tCt>tAt	p.S651Y	CCDC110_ENST00000510617.1_Missense_Mutation_p.S651Y|CCDC110_ENST00000507501.1_5'Flank|CCDC110_ENST00000393540.3_Missense_Mutation_p.S614Y	NM_152775.3	NP_689988.1	Q8TBZ0	CC110_HUMAN	coiled-coil domain containing 110	651						nucleus (GO:0005634)		p.S651Y(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(6)|kidney(3)|large_intestine(8)|lung(9)	30		all_lung(41;1.3e-11)|Lung NSC(41;2.25e-11)|Melanoma(20;7.86e-05)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|Colorectal(36;0.0381)|all_hematologic(60;0.0749)		OV - Ovarian serous cystadenocarcinoma(60;1.13e-10)|BRCA - Breast invasive adenocarcinoma(30;8.01e-05)|GBM - Glioblastoma multiforme(59;0.00014)|STAD - Stomach adenocarcinoma(60;0.000777)|LUSC - Lung squamous cell carcinoma(40;0.00921)|COAD - Colon adenocarcinoma(29;0.0105)|READ - Rectum adenocarcinoma(43;0.164)		GGCAGCAGTAGATTCTTGTAA	0.323																																																	1	Substitution - Missense(1)	large_intestine(1)											87.0	93.0	91.0					4																	186379789		2202	4295	6497	SO:0001583	missense	0			AB080722	CCDS3843.1, CCDS47170.1	4q35.1	2010-12-24			ENSG00000168491	ENSG00000168491			28504	protein-coding gene	gene with protein product	"""cancer/testis antigen 52"""	609488				18160854	Standard	NM_152775		Approved	KM-HN-1, MGC33607, CT52	uc003ixu.4	Q8TBZ0	OTTHUMG00000160415	ENST00000307588.3:c.1952C>A	4.37:g.186379789G>T	ENSP00000306776:p.Ser651Tyr		Q86YI9|Q8N7W0	Missense_Mutation	SNP	superfamily_4_helix_cytokine-like_core	p.S651Y	ENST00000307588.3	37	c.1952	CCDS3843.1	4	.	.	.	.	.	.	.	.	.	.	G	0.124	-1.122043	0.01785	.	.	ENSG00000168491	ENST00000393540;ENST00000307588;ENST00000510617	T;T;T	0.35048	1.33;1.33;1.33	5.54	3.77	0.43336	.	0.500539	0.18618	N	0.135963	T	0.40670	0.1126	L	0.60455	1.87	0.09310	N	1	D;D;D	0.56035	0.974;0.974;0.974	P;P;P	0.54312	0.748;0.748;0.748	T	0.26950	-1.0088	10	0.02654	T	1	-1.1126	10.5552	0.45112	0.0:0.2703:0.5899:0.1399	.	651;614;651	B4DZA2;Q8TBZ0-2;Q8TBZ0	.;.;CC110_HUMAN	Y	614;651;651	ENSP00000377172:S614Y;ENSP00000306776:S651Y;ENSP00000427246:S651Y	ENSP00000306776:S651Y	S	-	2	0	CCDC110	186616783	0.448000	0.25681	0.892000	0.35008	0.685000	0.39939	1.430000	0.34914	0.768000	0.33290	0.650000	0.86243	TCT	CCDC110	-	NULL	ENSG00000168491		0.323	CCDC110-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CCDC110	HGNC	protein_coding	OTTHUMT00000360519.2		0.00	55	0	G	NM_152775		186379789	-1			no_errors	ENST00000307588	ensembl	human	known	74_37	missense	12.00	22	3	SNP	0.007	T
CCDC132	55610	genome.wustl.edu	37	7	92882065	92882065	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr7:92882065G>T	ENST00000305866.5	+	3	330	c.202G>T	c.(202-204)Gat>Tat	p.D68Y	CCDC132_ENST00000535481.1_Intron|CCDC132_ENST00000317751.6_5'UTR|CCDC132_ENST00000541136.1_Intron|CCDC132_ENST00000251739.5_Missense_Mutation_p.D68Y|CCDC132_ENST00000544910.1_Missense_Mutation_p.D38Y	NM_017667.3	NP_060137.2	Q96JG6	CC132_HUMAN	coiled-coil domain containing 132	68						extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)				endometrium(1)|large_intestine(2)|lung(5)	8	all_cancers(62;2.64e-11)|all_epithelial(64;1.4e-10)|Breast(17;0.000675)|Lung NSC(181;0.0618)|all_lung(186;0.0837)		STAD - Stomach adenocarcinoma(171;0.000302)			GGATTCATTTGATATTGTTAA	0.328																																																	0													88.0	96.0	94.0					7																	92882065		2203	4299	6502	SO:0001583	missense	0			AL833112, AK055965, AL832393	CCDS5630.1, CCDS43617.1, CCDS59065.1	7q21.3	2007-07-23			ENSG00000004766	ENSG00000004766			25956	protein-coding gene	gene with protein product						11347906	Standard	NM_024553		Approved	KIAA1861, FLJ20097, DKFZp313I2429	uc003umo.4	Q96JG6	OTTHUMG00000131733	ENST00000305866.5:c.202G>T	7.37:g.92882065G>T	ENSP00000307666:p.Asp68Tyr		B3KX22|D1MQ00|F5H5U7|Q75N07|Q8WVK3|Q9H5C6	Missense_Mutation	SNP	pfam_Vacuolar_sorting-assoc_54,pfam_DUF2451_C	p.D68Y	ENST00000305866.5	37	c.202	CCDS43617.1	7	.	.	.	.	.	.	.	.	.	.	G	24.8	4.572516	0.86542	.	.	ENSG00000004766	ENST00000251739;ENST00000305866;ENST00000544910;ENST00000458530	.	.	.	5.42	5.42	0.78866	Vacuolar protein sorting-associated protein 54 (1);	0.000000	0.85682	D	0.000000	T	0.79787	0.4506	M	0.72118	2.19	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.997;0.998;0.996	T	0.81123	-0.1076	9	0.87932	D	0	-3.4479	19.5943	0.95527	0.0:0.0:1.0:0.0	.	38;68;68	F5H5U7;Q96JG6;Q96JG6-2	.;CC132_HUMAN;.	Y	68;68;38;68	.	ENSP00000251739:D68Y	D	+	1	0	CCDC132	92720001	1.000000	0.71417	1.000000	0.80357	0.928000	0.56348	8.879000	0.92398	2.723000	0.93209	0.591000	0.81541	GAT	CCDC132	-	pfam_Vacuolar_sorting-assoc_54	ENSG00000004766		0.328	CCDC132-019	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC132	HGNC	protein_coding	OTTHUMT00000341687.1		0.00	113	0	G	NM_017667		92882065	+1			no_errors	ENST00000305866	ensembl	human	known	74_37	missense	6.56	57	4	SNP	1.000	T
CCDC74B	91409	genome.wustl.edu	37	2	130900736	130900736	+	Intron	SNP	G	G	A			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr2:130900736G>A	ENST00000310463.6	-	2	433				CCDC74B_ENST00000409234.3_Missense_Mutation_p.P134L|CCDC74B_ENST00000409128.1_Intron|CCDC74B_ENST00000392984.3_5'UTR|CCDC74B_ENST00000409943.3_Intron	NM_207310.2	NP_997193.1	Q96LY2	CC74B_HUMAN	coiled-coil domain containing 74B											endometrium(2)|large_intestine(1)|lung(3)	6	Colorectal(110;0.1)					GTCCCCACTGGGTTGGCATAC	0.622																																																	0																																										SO:0001627	intron_variant	0				CCDS2155.1, CCDS58726.1	2q21.1	2006-11-29		2006-02-16	ENSG00000152076	ENSG00000152076			25267	protein-coding gene	gene with protein product							Standard	NM_001258307		Approved	DKFZp434E2321	uc002tqn.2	Q96LY2	OTTHUMG00000131629	ENST00000310463.6:c.295+105C>T	2.37:g.130900736G>A			Q6NW18	Missense_Mutation	SNP	NULL	p.P134L	ENST00000310463.6	37	c.401	CCDS2155.1	2	.	.	.	.	.	.	.	.	.	.	.	15.51	2.853539	0.51270	.	.	ENSG00000152076	ENST00000409234	.	.	.	2.04	2.04	0.26737	.	.	.	.	.	T	0.57695	0.2071	.	.	.	0.24669	N	0.993423	D	0.76494	0.999	D	0.76575	0.988	T	0.40117	-0.9580	7	0.87932	D	0	.	7.5139	0.27590	0.0:0.0:1.0:0.0	.	134	E9PG54	.	L	134	.	ENSP00000386303:P134L	P	-	2	0	CCDC74B	130617206	0.155000	0.22806	0.158000	0.22627	0.457000	0.32468	1.341000	0.33907	1.127000	0.42034	0.298000	0.19748	CCC	CCDC74B	-	NULL	ENSG00000152076		0.622	CCDC74B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CCDC74B	HGNC	protein_coding	OTTHUMT00000254522.3	-	0.00	113	0	G	NM_207310		130900736	-1	tier1	-	no_errors	ENST00000409234	ensembl	human	putative	74_37	missense	34.55	36	19	SNP	0.142	A
CCNDBP1	23582	genome.wustl.edu	37	15	43481479	43481479	+	Splice_Site	SNP	G	G	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr15:43481479G>T	ENST00000300213.4	+	4	573		c.e4+1		CCNDBP1_ENST00000356633.5_Splice_Site|EPB42_ENST00000563128.1_Intron	NM_012142.4	NP_036274.3	O95273	CCDB1_HUMAN	cyclin D-type binding-protein 1						cell cycle (GO:0007049)|regulation of cell cycle (GO:0051726)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(4)|ovary(1)	13		all_cancers(109;3.31e-14)|all_epithelial(112;1.26e-12)|Lung NSC(122;2.46e-08)|all_lung(180;2.75e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;8.42e-07)		AAGGATCAGGGTAAGCCACAT	0.383																																																	0													101.0	84.0	90.0					15																	43481479		2203	4299	6502	SO:0001630	splice_region_variant	0			AF082569	CCDS10092.1	15q14-q15	2008-07-18			ENSG00000166946	ENSG00000166946			1587	protein-coding gene	gene with protein product	"""D-type cyclin-interacting protein 1"", ""MAID protein"", ""HHM Protein"", ""grap2 cyclin interacting protein"""	607089				10801854	Standard	NM_012142		Approved	DIP1, GCIP	uc001zqv.3	O95273	OTTHUMG00000130703	ENST00000300213.4:c.331+1G>T	15.37:g.43481479G>T			A8K3Q0|A8K3U2|Q6ZQN9|Q7Z519|Q8NBS7|Q8NBY2|Q9NS19|Q9NYH3|Q9UHX9	Splice_Site	SNP	-	e4+1	ENST00000300213.4	37	c.331+1	CCDS10092.1	15	.	.	.	.	.	.	.	.	.	.	G	8.871	0.949291	0.18356	.	.	ENSG00000166946	ENST00000300213	.	.	.	4.96	4.96	0.65561	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.152	0.81629	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CCNDBP1	41268771	1.000000	0.71417	1.000000	0.80357	0.008000	0.06430	5.706000	0.68362	2.749000	0.94314	0.579000	0.79373	.	CCNDBP1	-	-	ENSG00000166946		0.383	CCNDBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCNDBP1	HGNC	protein_coding	OTTHUMT00000253203.1		0.00	48	0	G	NM_012142	Intron	43481479	+1			no_errors	ENST00000300213	ensembl	human	known	74_37	splice_site	7.02	53	4	SNP	1.000	T
CCNK	8812	genome.wustl.edu	37	14	99969314	99969314	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr14:99969314G>A	ENST00000389879.5	+	8	1127	c.1004G>A	c.(1003-1005)cGa>cAa	p.R335Q	CCNK_ENST00000555049.1_Missense_Mutation_p.R335Q	NM_001099402.1	NP_001092872.1	O75909	CCNK_HUMAN	cyclin K	335					cellular response to DNA damage stimulus (GO:0006974)|in utero embryonic development (GO:0001701)|mitotic nuclear division (GO:0007067)|negative regulation of cell cycle arrest (GO:0071157)|protein phosphorylation (GO:0006468)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	cyclin K-CDK12 complex (GO:0002944)|cyclin K-CDK13 complex (GO:0002945)|nucleus (GO:0005634)	cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|protein kinase binding (GO:0019901)|RNA polymerase II carboxy-terminal domain kinase activity (GO:0008353)			NS(1)|endometrium(2)|lung(3)	6		all_cancers(154;0.224)|all_epithelial(191;0.0643)|Melanoma(154;0.0866)				CAGGTTAAGCGAGCCGTGGTG	0.622																																																	0													75.0	96.0	89.0					14																	99969314		2039	4200	6239	SO:0001583	missense	0			AF060515	CCDS45160.1	14q32.2	2014-07-03			ENSG00000090061	ENSG00000090061			1596	protein-coding gene	gene with protein product		603544				9632813, 10574912	Standard	NM_001099402		Approved	CPR4	uc001ygi.4	O75909	OTTHUMG00000171495	ENST00000389879.5:c.1004G>A	14.37:g.99969314G>A	ENSP00000374529:p.Arg335Gln		Q59FT6|Q86U16|Q96B63|Q9NNY9	Missense_Mutation	SNP	pfam_Cyclin_N,superfamily_Cyclin-like,smart_Cyclin-like	p.R335Q	ENST00000389879.5	37	c.1004	CCDS45160.1	14	.	.	.	.	.	.	.	.	.	.	G	9.719	1.159235	0.21454	.	.	ENSG00000090061	ENST00000437596;ENST00000380246;ENST00000389879;ENST00000555049	T;D	0.91686	2.22;-2.89	5.95	5.05	0.67936	.	0.136363	0.49916	D	0.000139	D	0.89054	0.6606	L	0.51422	1.61	0.52099	D	0.999945	B	0.13145	0.007	B	0.09377	0.004	D	0.84144	0.0419	10	0.27785	T	0.31	-17.5291	15.5679	0.76309	0.0669:0.0:0.9331:0.0	.	335	O75909	CCNK_HUMAN	Q	335;337;335;335	ENSP00000374529:R335Q;ENSP00000452307:R335Q	ENSP00000369596:R337Q	R	+	2	0	CCNK	99039067	1.000000	0.71417	0.215000	0.23724	0.101000	0.19017	6.647000	0.74354	2.824000	0.97209	0.655000	0.94253	CGA	CCNK	-	NULL	ENSG00000090061		0.622	CCNK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCNK	HGNC	protein_coding	OTTHUMT00000413721.1	-	0.00	77	0	G			99969314	+1	tier1	-	no_errors	ENST00000389879	ensembl	human	known	74_37	missense	29.31	40	17	SNP	0.969	A
CCNL2	81669	genome.wustl.edu	37	1	1330816	1330816	+	Silent	SNP	G	G	C			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr1:1330816G>C	ENST00000400809.3	-	4	557	c.552C>G	c.(550-552)ctC>ctG	p.L184L	CCNL2_ENST00000408918.4_Silent_p.L184L|CCNL2_ENST00000408952.5_5'UTR	NM_030937.4	NP_112199.2	Q96S94	CCNL2_HUMAN	cyclin L2	184	Cyclin-like 1.				regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of transcription, DNA-templated (GO:0006355)|RNA processing (GO:0006396)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(3)|ovary(2)|prostate(2)	13	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;2.03e-36)|OV - Ovarian serous cystadenocarcinoma(86;4.17e-22)|Colorectal(212;0.000159)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.0023)|BRCA - Breast invasive adenocarcinoma(365;0.00465)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0342)|Lung(427;0.146)		CCAACTCTTTGAGAACTCGTC	0.542																																																	0													126.0	127.0	126.0					1																	1330816		2203	4300	6503	SO:0001819	synonymous_variant	0			AF251294	CCDS30557.1, CCDS30558.1	1p36.33	2014-07-03			ENSG00000221978	ENSG00000221978			20570	protein-coding gene	gene with protein product	"""cyclin S"""	613482	"""cyclin M"""	CCNM		14725631	Standard	NM_030937		Approved	ania-6b, PCEE, SB138, HLA-ISO, CCNS	uc001afi.2	Q96S94	OTTHUMG00000002917	ENST00000400809.3:c.552C>G	1.37:g.1330816G>C			A8K8A3|B1B152|Q5T2N5|Q5T2N6|Q6IQ12|Q7Z4Z8|Q8N3C9|Q8N3D5|Q8NHE3|Q8TEL0|Q96B00	Silent	SNP	pfam_Cyclin_N,pfam_Cyclin_C-dom,superfamily_Cyclin-like,smart_Cyclin-like,pirsf_Cyclin_L	p.L184	ENST00000400809.3	37	c.552	CCDS30557.1	1																																																																																			CCNL2	-	pfam_Cyclin_N,superfamily_Cyclin-like,smart_Cyclin-like,pirsf_Cyclin_L	ENSG00000221978		0.542	CCNL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCNL2	HGNC	protein_coding	OTTHUMT00000008146.2	-	0.00	71	0	G	NM_030937		1330816	-1	tier1	-	no_errors	ENST00000400809	ensembl	human	known	74_37	silent	20.41	39	10	SNP	0.981	C
CD22	933	genome.wustl.edu	37	19	35832675	35832675	+	Silent	SNP	G	G	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr19:35832675G>T	ENST00000085219.5	+	9	1908	c.1842G>T	c.(1840-1842)ctG>ctT	p.L614L	CD22_ENST00000594250.1_Silent_p.L437L|CD22_ENST00000544992.2_Silent_p.L614L|CD22_ENST00000270311.6_Silent_p.L494L|CD22_ENST00000341773.6_Silent_p.L437L|CD22_ENST00000419549.2_Silent_p.L442L|CD22_ENST00000536635.2_Silent_p.L526L	NM_001771.3	NP_001762.2	P20273	CD22_HUMAN	CD22 molecule	614	Ig-like C2-type 6.				cell adhesion (GO:0007155)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)			breast(2)|endometrium(2)|kidney(3)|large_intestine(14)|lung(21)|ovary(5)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	54	all_lung(56;9.78e-09)|Lung NSC(56;1.46e-08)|Esophageal squamous(110;0.162)		Epithelial(14;5.83e-19)|OV - Ovarian serous cystadenocarcinoma(14;3.19e-18)|all cancers(14;3.41e-16)|LUSC - Lung squamous cell carcinoma(66;0.0417)			GTGCAACCCTGACCTGTGAGA	0.622																																					Ovarian(42;1009 1133 23674 26041)												0													128.0	103.0	111.0					19																	35832675		2203	4300	6503	SO:0001819	synonymous_variant	0			X52785	CCDS12457.1, CCDS54247.1, CCDS54248.1, CCDS54249.1, CCDS62634.1	19q13.1	2013-01-29	2006-03-28		ENSG00000012124	ENSG00000012124		"""CD molecules"", ""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1643	protein-coding gene	gene with protein product	"""sialic acid binding Ig-like lectin 2"""	107266	"""CD22 antigen"""			8496602, 1691828	Standard	NM_001185099		Approved	SIGLEC-2, SIGLEC2	uc010edt.3	P20273		ENST00000085219.5:c.1842G>T	19.37:g.35832675G>T			F5GYU4|F5H7U3|O95699|O95701|O95702|O95703|Q01665|Q32M46|Q92872|Q92873|Q9UQA6|Q9UQA7|Q9UQA8|Q9UQA9|Q9UQB0|Q9Y2A6	Silent	SNP	pfam_Immunoglobulin,pfam_Ig_I-set,pfam_CD80_C2-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.L614	ENST00000085219.5	37	c.1842	CCDS12457.1	19																																																																																			CD22	-	pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000012124		0.622	CD22-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CD22	HGNC	protein_coding	OTTHUMT00000466099.1	-	0.00	134	0	G	NM_001771		35832675	+1	tier1	-	no_errors	ENST00000085219	ensembl	human	known	74_37	silent	8.70	42	4	SNP	0.469	T
CDIPT	10423	genome.wustl.edu	37	16	29872754	29872754	+	Intron	SNP	C	C	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr16:29872754C>T	ENST00000219789.6	-	3	1057				CDIPT-AS1_ENST00000398859.3_RNA|CDIPT_ENST00000569956.1_Intron|CDIPT_ENST00000561555.1_Missense_Mutation_p.G26D|CDIPT_ENST00000570016.1_Intron|CDIPT-AS1_ENST00000565014.1_RNA|CDIPT_ENST00000563415.1_Intron|CDIPT_ENST00000567459.1_5'Flank|CDIPT_ENST00000566113.1_Intron	NM_006319.3	NP_006310.1	O14735	CDIPT_HUMAN	CDP-diacylglycerol--inositol 3-phosphatidyltransferase						CDP-diacylglycerol metabolic process (GO:0046341)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	alcohol binding (GO:0043178)|carbohydrate binding (GO:0030246)|CDP-diacylglycerol-inositol 3-phosphatidyltransferase activity (GO:0003881)|diacylglycerol binding (GO:0019992)|manganese ion binding (GO:0030145)			endometrium(1)|lung(3)	4						GCAAAGGTCACCATGGCATGA	0.547																																																	0																																										SO:0001627	intron_variant	0			AF014807	CCDS10657.1, CCDS67002.1	16p11.2	2012-11-19	2010-04-29		ENSG00000103502	ENSG00000103502	2.7.8.11		1769	protein-coding gene	gene with protein product	"""phosphatidylinositol synthase"""	605893	"""CDP-diacylglycerol--inositol 3-phosphatidyltransferase (phosphatidylinositol synthase)"""			9407135	Standard	NM_006319		Approved	PIS1, PIS	uc002dum.3	O14735	OTTHUMG00000177144	ENST00000219789.6:c.179-174G>A	16.37:g.29872754C>T			B4DUV0|H3BTV1|Q6FGU1|Q6ZN70	Missense_Mutation	SNP	pirsf_CDP_diag_ino_3_P_euk	p.G26D	ENST00000219789.6	37	c.77	CCDS10657.1	16																																																																																			CDIPT	-	pirsf_CDP_diag_ino_3_P_euk	ENSG00000103502		0.547	CDIPT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDIPT	HGNC	protein_coding	OTTHUMT00000255147.3	-	0.00	69	0	C	NM_006319		29872754	-1	tier1	-	no_errors	ENST00000561555	ensembl	human	putative	74_37	missense	7.02	53	4	SNP	0.008	T
CDK11A	728642	genome.wustl.edu	37	1	1635409	1635409	+	Intron	SNP	G	G	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr1:1635409G>T	ENST00000378633.1	-	17	1883				CDK11A_ENST00000358779.5_Intron|RP1-283E3.8_ENST00000598846.1_RNA|CDK11A_ENST00000378638.2_Intron|CDK11A_ENST00000404249.3_Intron|CDK11A_ENST00000357760.2_Intron|CDK11A_ENST00000495016.1_5'UTR|CDK11A_ENST00000356200.3_Intron			Q9UQ88	CD11A_HUMAN	cyclin-dependent kinase 11A						apoptotic process (GO:0006915)|mitotic nuclear division (GO:0007067)|protein phosphorylation (GO:0006468)|regulation of cell growth (GO:0001558)|regulation of mRNA processing (GO:0050684)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			central_nervous_system(1)|cervix(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(4)|stomach(1)|urinary_tract(1)	18						GTTCAGGAAGGCCAGTGCCCG	0.637																																					Pancreas(186;965 2119 30274 40311 50569)												0													35.0	42.0	40.0					1																	1635409		2047	4186	6233	SO:0001627	intron_variant	0			AF067522	CCDS44042.1, CCDS44043.1	1p36.33	2011-11-08	2009-12-16	2009-12-16	ENSG00000008128	ENSG00000008128		"""Cyclin-dependent kinases"""	1730	protein-coding gene	gene with protein product		116951	"""cell division cycle 2-like 2"", ""cell division cycle 2-like 2 (PITSLRE proteins)"""	CDC2L3, CDC2L2		7920654, 9750192, 19884882	Standard	NM_033529		Approved	PITSLRE, CDK11-p110, CDK11-p58, CDK11-p46, p58GTA		Q9UQ88	OTTHUMG00000000703	ENST00000378633.1:c.1804-30C>A	1.37:g.1635409G>T			O95227|O95228|O96012|Q12821|Q12853|Q12854|Q2TAJ0|Q5QPR0|Q5QPR1|Q5QPR2|Q9UBC4|Q9UBI3|Q9UEI1|Q9UEI2|Q9UP53|Q9UP54|Q9UP55|Q9UP56|Q9UQ86|Q9UQ87|Q9UQ89	RNA	SNP	-	NULL	ENST00000378633.1	37	NULL		1																																																																																			CDK11A	-	-	ENSG00000008128		0.637	CDK11A-005	NOVEL	basic	protein_coding	CDK11A	HGNC	protein_coding	OTTHUMT00000001735.1	-	0.00	175	0	G	NM_024011		1635409	-1	tier1	-	no_errors	ENST00000495016	ensembl	human	known	74_37	rna	21.05	75	20	SNP	0.012	T
CELF6	60677	genome.wustl.edu	37	15	72608242	72608242	+	Silent	SNP	G	G	T	rs377177378		TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr15:72608242G>T	ENST00000569547.1	-	2	360	c.289C>A	c.(289-291)Cgg>Agg	p.R97R	CELF6_ENST00000567083.1_Silent_p.R97R|CELF6_ENST00000539635.1_5'UTR|CELF6_ENST00000287202.5_Silent_p.R97R|RP11-106M3.3_ENST00000570175.1_RNA|RP11-106M3.2_ENST00000379915.4_RNA			Q96J87	CELF6_HUMAN	CUGBP, Elav-like family member 6	97	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				mRNA processing (GO:0006397)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			breast(1)|central_nervous_system(2)|kidney(2)|large_intestine(2)|lung(2)|ovary(1)|prostate(1)|skin(2)	13						GCAGAGTCCCGGGCGCAGTAG	0.597																																																	0													33.0	34.0	34.0					15																	72608242		2199	4297	6496	SO:0001819	synonymous_variant	0			AF425606	CCDS10242.1, CCDS53955.1, CCDS53956.1	15q24	2013-02-12	2010-02-19	2010-02-19	ENSG00000140488	ENSG00000140488		"""RNA binding motif (RRM) containing"""	14059	protein-coding gene	gene with protein product		612681	"""Bruno (Drosophila) -like 6, RNA binding protein"", ""bruno-like 6, RNA binding protein (Drosophila)"""	BRUNOL6		10893231	Standard	NM_052840		Approved		uc002auh.2	Q96J87	OTTHUMG00000133444	ENST00000569547.1:c.289C>A	15.37:g.72608242G>T			B4DG28|B4DJB6|Q6PII4|Q6ZNJ7|Q8N607	Silent	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.R97	ENST00000569547.1	37	c.289	CCDS10242.1	15																																																																																			CELF6	-	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	ENSG00000273025		0.597	CELF6-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	nonsense_mediated_decay	CELF6	Uniprot_gn	protein_coding	OTTHUMT00000420180.1	-	0.00	84	0	G	NM_052840		72608242	-1	tier1	-	no_errors	ENST00000569547	ensembl	human	known	74_37	silent	12.22	79	11	SNP	1.000	T
CHCHD6	84303	genome.wustl.edu	37	3	126633522	126633522	+	Splice_Site	SNP	G	G	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr3:126633522G>T	ENST00000290913.3	+	6	588		c.e6-1		CHCHD6_ENST00000508789.1_Splice_Site|CHCHD6_ENST00000515867.1_Splice_Site	NM_032343.2	NP_115719.1	Q9BRQ6	MIC25_HUMAN	coiled-coil-helix-coiled-coil-helix domain containing 6						cellular response to DNA damage stimulus (GO:0006974)|cristae formation (GO:0042407)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)				endometrium(2)|large_intestine(3)|lung(3)	8						TCTCCTTGTAGAATGCTGAGA	0.358																																																	0													103.0	113.0	110.0					3																	126633522		2203	4300	6503	SO:0001630	splice_region_variant	0			BC006123	CCDS3041.1	3q21.3	2012-04-17			ENSG00000159685	ENSG00000159685		"""Coiled-coil-helix-coiled-coil-helix domain containing"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	28184	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 23"", ""coiled-coil-helix cristae morphology 1"""	615634				17624330, 22228767	Standard	NM_032343		Approved	MGC13016, PPP1R23, CHCM1	uc003ejf.2	Q9BRQ6	OTTHUMG00000159601	ENST00000290913.3:c.496-1G>T	3.37:g.126633522G>T			D6R9U0|D6RIB4|H8Y0Y7	Splice_Site	SNP	-	e6-1	ENST00000290913.3	37	c.496-1	CCDS3041.1	3	.	.	.	.	.	.	.	.	.	.	G	12.14	1.849052	0.32699	.	.	ENSG00000159685	ENST00000290913;ENST00000508789;ENST00000513253	.	.	.	4.43	4.43	0.53597	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.556	0.68101	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CHCHD6	128116212	1.000000	0.71417	0.928000	0.36995	0.340000	0.28889	5.880000	0.69698	2.190000	0.69967	0.563000	0.77884	.	CHCHD6	-	-	ENSG00000159685		0.358	CHCHD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHCHD6	HGNC	protein_coding	OTTHUMT00000356432.1		0.00	60	0	G	NM_032343	Intron	126633522	+1			no_errors	ENST00000290913	ensembl	human	known	74_37	splice_site	6.38	44	3	SNP	1.000	T
CHMP3	51652	genome.wustl.edu	37	2	86733063	86733063	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr2:86733063C>T	ENST00000263856.4	-	6	661	c.533G>A	c.(532-534)gGc>gAc	p.G178D	CHMP3_ENST00000409727.1_Missense_Mutation_p.G138D|CHMP3_ENST00000409225.2_Missense_Mutation_p.G112D|CHMP3_ENST00000494623.1_5'Flank|RNF103-CHMP3_ENST00000604011.1_Missense_Mutation_p.G207D|CHMP3_ENST00000439940.2_Missense_Mutation_p.G207D	NM_001193517.1|NM_016079.3	NP_001180446.1|NP_057163.1	Q9Y3E7	CHMP3_HUMAN	charged multivesicular body protein 3	178	Interaction with VPS4A.|Intramolecular interaction with N- terminus.				apoptotic process (GO:0006915)|cell cycle (GO:0007049)|cell division (GO:0051301)|endosomal transport (GO:0016197)|membrane organization (GO:0061024)|positive regulation of viral release from host cell (GO:1902188)|protein transport (GO:0015031)|regulation of viral process (GO:0050792)|viral life cycle (GO:0019058)|viral process (GO:0016032)	cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)											GGGTGCTTTGCCCAAGGCCCC	0.542																																																	0													55.0	50.0	52.0					2																	86733063		2203	4300	6503	SO:0001583	missense	0			AF219226	CCDS33236.1, CCDS42707.1, CCDS54375.1	2p11.2	2011-09-21	2011-09-21	2011-09-21	ENSG00000115561	ENSG00000115561		"""Charged multivesicular body proteins"""	29865	protein-coding gene	gene with protein product		610052	"""vacuolar protein sorting 24 (yeast)"", ""vacuolar protein sorting 24 homolog (S. cerevisiae)"""	VPS24		11549700, 12878588	Standard	NM_016079		Approved	NEDF, CGI-149		Q9Y3E7	OTTHUMG00000153189	ENST00000263856.4:c.533G>A	2.37:g.86733063C>T	ENSP00000263856:p.Gly178Asp		A8K3W0|B4DG34|B8ZZM0|B8ZZX5|Q3ZTS9|Q53S71|Q53SU5|Q9NZ51	Missense_Mutation	SNP	pfam_Snf7	p.G207D	ENST00000263856.4	37	c.620	CCDS33236.1	2	.	.	.	.	.	.	.	.	.	.	C	27.2	4.810480	0.90707	.	.	ENSG00000115561	ENST00000263856;ENST00000409727;ENST00000409225;ENST00000439940	T;T;T;T	0.72167	-0.63;-0.63;-0.63;-0.63	6.0	5.13	0.70059	.	0.000000	0.85682	D	0.000000	D	0.82421	0.5033	M	0.67953	2.075	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.994;0.999;0.997	D	0.83983	0.0333	10	0.59425	D	0.04	-22.7894	14.9262	0.70881	0.0:0.9313:0.0:0.0687	.	207;138;178	Q9Y3E7-3;Q9Y3E7-4;Q9Y3E7	.;.;CHMP3_HUMAN	D	178;138;112;207	ENSP00000263856:G178D;ENSP00000387045:G138D;ENSP00000386590:G112D;ENSP00000405575:G207D	ENSP00000263856:G178D	G	-	2	0	VPS24	86586574	1.000000	0.71417	1.000000	0.80357	0.941000	0.58515	7.488000	0.81441	1.572000	0.49736	0.555000	0.69702	GGC	CHMP3	-	pfam_Snf7	ENSG00000115561		0.542	CHMP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHMP3	HGNC	protein_coding	OTTHUMT00000330015.2	-	0.00	26	0	C	NM_016079		86733063	-1	tier1	-	no_errors	ENST00000439940	ensembl	human	known	74_37	missense	16.67	20	4	SNP	1.000	T
CLCN1	1180	genome.wustl.edu	37	7	143027934	143027934	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr7:143027934C>T	ENST00000343257.2	+	8	1010	c.923C>T	c.(922-924)gCa>gTa	p.A308V	CLCN1_ENST00000495612.1_3'UTR	NM_000083.2	NP_000074	P35523	CLCN1_HUMAN	chloride channel, voltage-sensitive 1	308					chloride transmembrane transport (GO:1902476)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|neuronal action potential propagation (GO:0019227)|regulation of anion transport (GO:0044070)|transmembrane transport (GO:0055085)|transport (GO:0006810)	chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)	adenyl nucleotide binding (GO:0030554)|chloride channel activity (GO:0005254)|voltage-gated chloride channel activity (GO:0005247)			breast(4)|central_nervous_system(1)|endometrium(1)|large_intestine(11)|lung(26)|ovary(3)|prostate(2)|skin(7)|stomach(1)|upper_aerodigestive_tract(2)	58	Melanoma(164;0.205)					GGATTCTTTGCAGCCACGTTC	0.532																																																	0													158.0	130.0	139.0					7																	143027934		2203	4300	6503	SO:0001583	missense	0			Z25884	CCDS5881.1	7q12	2012-09-26	2012-02-23		ENSG00000188037	ENSG00000188037		"""Ion channels / Chloride channels : Voltage-sensitive"""	2019	protein-coding gene	gene with protein product	"""Thomsen disease, autosomal dominant"""	118425	"""chloride channel 1, skeletal muscle"""			1379744	Standard	NM_000083		Approved	CLC1, ClC-1	uc003wcr.1	P35523	OTTHUMG00000152695	ENST00000343257.2:c.923C>T	7.37:g.143027934C>T	ENSP00000339867:p.Ala308Val		A4D2H5|Q2M202	Missense_Mutation	SNP	pfam_Cl-channel_volt-gated,pfam_CBS_dom,superfamily_Cl-channel_core,prints_Cl-channel_volt-gated,prints_Cl_channel-1	p.A308V	ENST00000343257.2	37	c.923	CCDS5881.1	7	.	.	.	.	.	.	.	.	.	.	C	33	5.275550	0.95459	.	.	ENSG00000188037	ENST00000343257	D	0.95788	-3.81	4.57	4.57	0.56435	Chloride channel, core (2);	0.000000	0.85682	D	0.000000	D	0.97005	0.9022	L	0.60845	1.875	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	D	0.97905	1.0305	10	0.87932	D	0	.	17.355	0.87333	0.0:1.0:0.0:0.0	.	308	P35523	CLCN1_HUMAN	V	308	ENSP00000339867:A308V	ENSP00000339867:A308V	A	+	2	0	CLCN1	142738056	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	7.789000	0.85783	2.087000	0.62958	0.453000	0.30009	GCA	CLCN1	-	pfam_Cl-channel_volt-gated,superfamily_Cl-channel_core	ENSG00000188037		0.532	CLCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLCN1	HGNC	protein_coding	OTTHUMT00000327420.1	-	0.00	77	0	C	NM_000083		143027934	+1	tier1	-	no_errors	ENST00000343257	ensembl	human	known	74_37	missense	10.81	33	4	SNP	1.000	T
CLCN2	1181	genome.wustl.edu	37	3	184075234	184075234	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr3:184075234C>G	ENST00000265593.4	-	8	985	c.814G>C	c.(814-816)Gtg>Ctg	p.V272L	CLCN2_ENST00000457512.1_Missense_Mutation_p.V272L|CLCN2_ENST00000423355.2_5'UTR|CLCN2_ENST00000475279.1_5'Flank|CLCN2_ENST00000434054.2_Missense_Mutation_p.V228L|EIF2B5_ENST00000444495.1_Intron|CLCN2_ENST00000344937.7_Missense_Mutation_p.V272L	NM_004366.5	NP_004357.3	P51788	CLCN2_HUMAN	chloride channel, voltage-sensitive 2	272					cell differentiation involved in salivary gland development (GO:0060689)|ion transmembrane transport (GO:0034220)|regulation of anion transport (GO:0044070)|retina development in camera-type eye (GO:0060041)|transmembrane transport (GO:0055085)|transport (GO:0006810)	chloride channel complex (GO:0034707)|plasma membrane (GO:0005886)	adenyl nucleotide binding (GO:0030554)|voltage-gated chloride channel activity (GO:0005247)			breast(2)|central_nervous_system(4)|endometrium(1)|kidney(3)|large_intestine(4)|lung(9)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	27	all_cancers(143;6.66e-11)|Ovarian(172;0.0339)		Epithelial(37;2.22e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)		Lubiprostone(DB01046)	TAGTTCCGCACTGCAAAGAAG	0.632																																																	0													91.0	102.0	98.0					3																	184075234		2203	4300	6503	SO:0001583	missense	0			S77770	CCDS3263.1, CCDS54690.1, CCDS54691.1, CCDS54692.1	3q27.1	2013-09-19	2012-02-23		ENSG00000114859	ENSG00000114859		"""Ion channels / Chloride channels : Voltage-sensitive"""	2020	protein-coding gene	gene with protein product		600570	"""chloride channel 2"""			7795595	Standard	NM_004366		Approved	CLC2, EJM6, ClC-2	uc003foi.4	P51788	OTTHUMG00000156747	ENST00000265593.4:c.814G>C	3.37:g.184075234C>G	ENSP00000265593:p.Val272Leu		B4DQT9|B4DZ58|E9PBD9|E9PCD2|O14864|Q6IPA9|Q8WU13	Missense_Mutation	SNP	pfam_Cl-channel_volt-gated,pfam_CBS_dom,superfamily_Cl-channel_core,prints_Cl-channel_volt-gated,prints_Cl-channel-2	p.V272L	ENST00000265593.4	37	c.814	CCDS3263.1	3	.	.	.	.	.	.	.	.	.	.	c	24.3	4.517808	0.85495	.	.	ENSG00000114859	ENST00000265593;ENST00000344937;ENST00000434054;ENST00000457512	D;D;D;D	0.93906	-3.31;-3.31;-3.31;-3.31	5.53	5.53	0.82687	Chloride channel, core (2);	0.000000	0.85682	D	0.000000	D	0.95207	0.8446	L	0.40543	1.245	0.80722	D	1	D;D;P;P;D	0.89917	0.988;1.0;0.752;0.694;0.999	D;D;P;B;D	0.87578	0.919;0.998;0.56;0.25;0.975	D	0.95702	0.8750	10	0.87932	D	0	-22.2061	18.2313	0.89936	0.0:1.0:0.0:0.0	.	272;228;272;272;272	B4DYE3;E9PBD9;E9PCD2;P51788-3;P51788	.;.;.;.;CLCN2_HUMAN	L	272;272;228;272	ENSP00000265593:V272L;ENSP00000345056:V272L;ENSP00000400425:V228L;ENSP00000391928:V272L	ENSP00000265593:V272L	V	-	1	0	CLCN2	185557928	1.000000	0.71417	0.220000	0.23810	0.777000	0.43975	7.805000	0.86005	2.596000	0.87737	0.561000	0.74099	GTG	CLCN2	-	pfam_Cl-channel_volt-gated,superfamily_Cl-channel_core	ENSG00000114859		0.632	CLCN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CLCN2	HGNC	protein_coding	OTTHUMT00000345571.1	-	0.00	122	0	C			184075234	-1	tier1	-	no_errors	ENST00000265593	ensembl	human	known	74_37	missense	89.62	11	95	SNP	1.000	G
CMAS	55907	genome.wustl.edu	37	12	22218096	22218096	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr12:22218096C>A	ENST00000229329.2	+	8	1286	c.1156C>A	c.(1156-1158)Cta>Ata	p.L386I		NM_018686.4	NP_061156.1	Q8NFW8	NEUA_HUMAN	cytidine monophosphate N-acetylneuraminic acid synthetase	386					lipopolysaccharide biosynthetic process (GO:0009103)|N-acetylneuraminate metabolic process (GO:0006054)	membrane (GO:0016020)|nucleus (GO:0005634)	N-acylneuraminate cytidylyltransferase activity (GO:0008781)			autonomic_ganglia(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(6)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	24						GAGAGTGGGCCTAAGTGGCGC	0.428																																																	0													194.0	199.0	197.0					12																	22218096		2203	4300	6503	SO:0001583	missense	0			AF271388	CCDS8696.1	12p12.1	2008-08-04			ENSG00000111726	ENSG00000111726			18290	protein-coding gene	gene with protein product	"""CMP-Neu5Ac synthetase"""	603316				8889549, 7566098	Standard	NM_018686		Approved		uc001rfm.4	Q8NFW8	OTTHUMG00000169097	ENST00000229329.2:c.1156C>A	12.37:g.22218096C>A	ENSP00000229329:p.Leu386Ile		Q96AX5|Q9NQZ0	Missense_Mutation	SNP	pfam_Cytidylyl_trans,superfamily_HAD-like_dom	p.L386I	ENST00000229329.2	37	c.1156	CCDS8696.1	12	.	.	.	.	.	.	.	.	.	.	C	12.39	1.922399	0.33908	.	.	ENSG00000111726	ENST00000229329	T	0.14266	2.52	5.53	3.54	0.40534	HAD-like domain (2);	0.127232	0.52532	D	0.000063	T	0.10121	0.0248	L	0.37750	1.13	0.80722	D	1	B	0.14805	0.011	B	0.18263	0.021	T	0.12091	-1.0561	10	0.37606	T	0.19	-19.8469	6.1652	0.20386	0.3101:0.5918:0.0:0.0981	.	386	Q8NFW8	NEUA_HUMAN	I	386	ENSP00000229329:L386I	ENSP00000229329:L386I	L	+	1	2	CMAS	22109363	0.992000	0.36948	0.955000	0.39395	0.982000	0.71751	1.354000	0.34056	1.326000	0.45319	0.557000	0.71058	CTA	CMAS	-	superfamily_HAD-like_dom	ENSG00000111726		0.428	CMAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CMAS	HGNC	protein_coding	OTTHUMT00000402235.1	-	0.00	106	0	C	NM_018686		22218096	+1	tier1	-	no_errors	ENST00000229329	ensembl	human	known	74_37	missense	9.30	39	4	SNP	1.000	A
CNNM2	54805	genome.wustl.edu	37	10	104835858	104835858	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr10:104835858C>G	ENST00000369878.4	+	7	2437	c.2249C>G	c.(2248-2250)cCt>cGt	p.P750R	CNNM2_ENST00000475511.1_3'UTR|CNNM2_ENST00000433628.2_Missense_Mutation_p.P728R	NM_017649.4	NP_060119.3	Q9H8M5	CNNM2_HUMAN	cyclin and CBS domain divalent metal cation transport mediator 2	750					magnesium ion homeostasis (GO:0010960)|magnesium ion transport (GO:0015693)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)	adenyl nucleotide binding (GO:0030554)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(7)|ovary(1)|prostate(2)|urinary_tract(1)	19		Colorectal(252;0.103)|all_hematologic(284;0.152)|Breast(234;0.198)		Epithelial(162;7.89e-09)|all cancers(201;1.82e-07)|BRCA - Breast invasive adenocarcinoma(275;0.215)		AATAAGTCCCCTCCTCGCCCA	0.438																																																	0													47.0	47.0	47.0					10																	104835858		1934	4155	6089	SO:0001583	missense	0			AF216962	CCDS7543.1, CCDS44474.1, CCDS44475.1	10q24.32	2014-08-08	2014-08-07		ENSG00000148842	ENSG00000148842			103	protein-coding gene	gene with protein product		607803	"""cyclin M2"""	ACDP2		21393841, 24699222	Standard	NM_017649		Approved		uc001kwm.3	Q9H8M5	OTTHUMG00000018976	ENST00000369878.4:c.2249C>G	10.37:g.104835858C>G	ENSP00000358894:p.Pro750Arg		Q5T569|Q5T570|Q8WU59|Q9H952|Q9NRK5|Q9NXT4	Missense_Mutation	SNP	pfam_DUF21,superfamily_cNMP-bd-like	p.P750R	ENST00000369878.4	37	c.2249	CCDS44474.1	10	.	.	.	.	.	.	.	.	.	.	C	27.6	4.845492	0.91197	.	.	ENSG00000148842	ENST00000457502;ENST00000433628;ENST00000369878;ENST00000345419	T;T	0.32515	1.78;1.45	5.62	5.62	0.85841	.	0.052790	0.85682	D	0.000000	T	0.52789	0.1756	M	0.71036	2.16	0.58432	D	0.999999	P;P	0.52577	0.954;0.923	P;P	0.56916	0.809;0.71	T	0.52653	-0.8547	10	0.59425	D	0.04	.	19.6519	0.95819	0.0:1.0:0.0:0.0	.	728;750	Q9H8M5-2;Q9H8M5	.;CNNM2_HUMAN	R	751;729;750;728	ENSP00000392875:P729R;ENSP00000358894:P750R	ENSP00000286899:P728R	P	+	2	0	CNNM2	104825848	1.000000	0.71417	0.916000	0.36221	0.990000	0.78478	7.814000	0.86154	2.639000	0.89480	0.561000	0.74099	CCT	CNNM2	-	NULL	ENSG00000148842		0.438	CNNM2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CNNM2	HGNC	protein_coding	OTTHUMT00000050113.3	-	0.00	130	0	C	NM_017649		104835858	+1	tier1	-	no_errors	ENST00000369878	ensembl	human	known	74_37	missense	16.67	50	10	SNP	1.000	G
CNOT4	4850	genome.wustl.edu	37	7	135047903	135047903	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr7:135047903G>T	ENST00000451834.1	-	12	2150	c.1867C>A	c.(1867-1869)Ctt>Att	p.L623I	CNOT4_ENST00000361528.4_Missense_Mutation_p.L552I|CNOT4_ENST00000423368.2_Missense_Mutation_p.L555I|CNOT4_ENST00000473470.1_5'UTR|CNOT4_ENST00000541284.1_Missense_Mutation_p.L626I			O95628	CNOT4_HUMAN	CCR4-NOT transcription complex, subunit 4	0					gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|protein autoubiquitination (GO:0051865)|RNA metabolic process (GO:0016070)	cytosol (GO:0005829)|nucleus (GO:0005634)	ligase activity (GO:0016874)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(10)|prostate(1)|skin(1)	22						TCATCTTGAAGAGAGTCTAAA	0.493																																					Ovarian(51;766 1130 5502 35047 50875)												0													132.0	135.0	134.0					7																	135047903		1949	4154	6103	SO:0001583	missense	0			AF180475	CCDS43650.1, CCDS47719.1, CCDS55164.1, CCDS55165.1, CCDS55166.1, CCDS55167.1	7q33	2013-09-19			ENSG00000080802	ENSG00000080802		"""RNA binding motif (RRM) containing"""	7880	protein-coding gene	gene with protein product		604911		NOT4		10637334	Standard	NM_013316		Approved	CLONE243, NOT4H	uc011kpy.2	O95628	OTTHUMG00000155568	ENST00000451834.1:c.1867C>A	7.37:g.135047903G>T	ENSP00000388491:p.Leu623Ile		B7Z6I4|E7ET38|F8VQP3|O95339|O95627|Q8IYM7|Q8NCL0|Q9NPQ1|Q9NZN6	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom_euk,pfscan_Znf_RING,pfscan_RRM_dom	p.L626I	ENST00000451834.1	37	c.1876	CCDS55167.1	7	.	.	.	.	.	.	.	.	.	.	G	17.43	3.388747	0.61956	.	.	ENSG00000080802	ENST00000541284;ENST00000451834;ENST00000423368;ENST00000262563;ENST00000361528	T;T;T;T	0.61158	0.69;0.68;0.14;0.13	5.85	4.95	0.65309	.	0.054798	0.85682	N	0.000000	T	0.64046	0.2563	L	0.29908	0.895	0.80722	D	1	P;P;D;D	0.56035	0.456;0.592;0.974;0.974	B;B;D;D	0.70487	0.093;0.191;0.953;0.969	T	0.60026	-0.7343	10	0.22109	T	0.4	-5.0716	15.9223	0.79586	0.0:0.0:0.8599:0.1401	.	623;626;555;552	E7ET38;F8VQP3;O95628-4;O95628-8	.;.;.;.	I	626;623;555;626;552	ENSP00000445508:L626I;ENSP00000388491:L623I;ENSP00000406777:L555I;ENSP00000354673:L552I	ENSP00000262563:L626I	L	-	1	0	CNOT4	134698443	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.358000	0.73055	1.414000	0.47017	0.557000	0.71058	CTT	CNOT4	-	NULL	ENSG00000080802		0.493	CNOT4-003	NOVEL	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	CNOT4	HGNC	protein_coding	OTTHUMT00000340670.1	-	0.00	47	0	G	NM_013316		135047903	-1	tier1	-	no_errors	ENST00000541284	ensembl	human	known	74_37	missense	12.50	21	3	SNP	1.000	T
COL1A1	1277	genome.wustl.edu	37	17	48276617	48276617	+	Frame_Shift_Del	DEL	G	G	-			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr17:48276617delG	ENST00000225964.5	-	5	559	c.441delC	c.(439-441)cccfs	p.P147fs		NM_000088.3	NP_000079	P02452	CO1A1_HUMAN	collagen, type I, alpha 1	147					blood coagulation (GO:0007596)|blood vessel development (GO:0001568)|bone trabecula formation (GO:0060346)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|cellular response to amino acid stimulus (GO:0071230)|cellular response to mechanical stimulus (GO:0071260)|cellular response to retinoic acid (GO:0071300)|cellular response to transforming growth factor beta stimulus (GO:0071560)|collagen biosynthetic process (GO:0032964)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|embryonic skeletal system development (GO:0048706)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|face morphogenesis (GO:0060325)|intramembranous ossification (GO:0001957)|leukocyte migration (GO:0050900)|negative regulation of cell-substrate adhesion (GO:0010812)|osteoblast differentiation (GO:0001649)|platelet activation (GO:0030168)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of transcription, DNA-templated (GO:0045893)|protein heterotrimerization (GO:0070208)|protein localization to nucleus (GO:0034504)|protein transport (GO:0015031)|response to cAMP (GO:0051591)|response to corticosteroid (GO:0031960)|response to estradiol (GO:0032355)|response to hydrogen peroxide (GO:0042542)|response to nutrient (GO:0007584)|response to peptide hormone (GO:0043434)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|skin morphogenesis (GO:0043589)|tooth mineralization (GO:0034505)|visual perception (GO:0007601)	collagen type I trimer (GO:0005584)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	extracellular matrix structural constituent (GO:0005201)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)		COL1A1/PDGFB(429)	NS(1)|breast(3)|central_nervous_system(8)|endometrium(3)|kidney(4)|large_intestine(17)|liver(3)|lung(18)|ovary(1)|pancreas(1)|prostate(4)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	71					Collagenase(DB00048)	cgggaggtccggggggtccgg	0.652			T	"""PDGFB, USP6"""	"""dermatofibrosarcoma protuberans, aneurysmal bone cyst """		Osteogenesis imperfecta																																	Dom	yes		17	17q21.31-q22	1277	"""collagen, type I, alpha 1"""	yes	M	0													1.0	1.0	1.0					17																	48276617		1234	2663	3897	SO:0001589	frameshift_variant	0			Z74615	CCDS11561.1	17q21.33	2014-09-17			ENSG00000108821	ENSG00000108821		"""Collagens"""	2197	protein-coding gene	gene with protein product		120150				3178743, 2857713	Standard	NM_000088		Approved	OI4	uc002iqm.3	P02452	OTTHUMG00000148674	ENST00000225964.5:c.441delC	17.37:g.48276617delG	ENSP00000225964:p.Pro147fs		O76045|P78441|Q13896|Q13902|Q13903|Q14037|Q14992|Q15176|Q15201|Q16050|Q59F64|Q7KZ30|Q7KZ34|Q8IVI5|Q8N473|Q9UML6|Q9UMM7	Frame_Shift_Del	DEL	pfam_Collagen,pfam_Fib_collagen_C,pfam_VWF_C,superfamily_Fibrinogen_a/b/g_C_dom,smart_VWF_C,smart_Fib_collagen_C,pfscan_VWF_C	p.G148fs	ENST00000225964.5	37	c.441	CCDS11561.1	17																																																																																			COL1A1	-	pfam_Collagen	ENSG00000108821		0.652	COL1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL1A1	HGNC	protein_coding	OTTHUMT00000309036.2		0.00	8	0	G			48276617	-1			no_errors	ENST00000225964	ensembl	human	known	74_37	frame_shift_del	33.33	4	2	DEL	0.198	0
COL27A1	85301	genome.wustl.edu	37	9	116994111	116994111	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr9:116994111G>T	ENST00000356083.3	+	16	2921	c.2530G>T	c.(2530-2532)Ggc>Tgc	p.G844C		NM_032888.2	NP_116277.2	Q8IZC6	CORA1_HUMAN	collagen, type XXVII, alpha 1	844	Collagen-like 4.|Pro-rich.|Triple-helical region.				extracellular matrix organization (GO:0030198)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|fibrillar collagen trimer (GO:0005583)	extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)			central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(17)|lung(30)|ovary(4)|prostate(6)|skin(3)|soft_tissue(1)|stomach(1)|urinary_tract(3)	80						GGGACTGATGGGCAGCGTGGG	0.582																																																	0													243.0	221.0	228.0					9																	116994111		2203	4300	6503	SO:0001583	missense	0			AB058773	CCDS6802.1	9q33.1	2013-01-16			ENSG00000196739	ENSG00000196739		"""Collagens"""	22986	protein-coding gene	gene with protein product		608461				12766169	Standard	NM_032888		Approved	KIAA1870, MGC11337, FLJ11895	uc011lxl.2	Q8IZC6	OTTHUMG00000020537	ENST00000356083.3:c.2530G>T	9.37:g.116994111G>T	ENSP00000348385:p.Gly844Cys		Q66K43|Q96JF7	Missense_Mutation	SNP	pfam_Collagen,pfam_Fib_collagen_C,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,smart_Fib_collagen_C	p.G844C	ENST00000356083.3	37	c.2530	CCDS6802.1	9	.	.	.	.	.	.	.	.	.	.	G	14.96	2.690560	0.48097	.	.	ENSG00000196739	ENST00000356083;ENST00000357257	D	0.99369	-5.78	5.07	5.07	0.68467	.	.	.	.	.	D	0.99697	0.9885	H	0.99312	4.51	0.58432	D	0.999997	D	0.89917	1.0	D	0.97110	1.0	D	0.97207	0.9868	9	0.87932	D	0	.	14.302	0.66359	0.0:0.0:1.0:0.0	.	844	Q8IZC6	CORA1_HUMAN	C	844	ENSP00000348385:G844C	ENSP00000348385:G844C	G	+	1	0	COL27A1	116033932	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.309000	0.78937	2.514000	0.84764	0.563000	0.77884	GGC	COL27A1	-	pfam_Collagen	ENSG00000196739		0.582	COL27A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL27A1	HGNC	protein_coding	OTTHUMT00000053763.1	-	0.00	108	0	G	NM_032888		116994111	+1	tier1	-	no_errors	ENST00000356083	ensembl	human	known	74_37	missense	5.97	63	4	SNP	1.000	T
COL2A1	1280	genome.wustl.edu	37	12	48372118	48372118	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr12:48372118C>A	ENST00000380518.3	-	43	3123	c.2959G>T	c.(2959-2961)Ggg>Tgg	p.G987W	COL2A1_ENST00000337299.6_Missense_Mutation_p.G918W|COL2A1_ENST00000493991.1_5'UTR	NM_001844.4|NM_033150.2	NP_001835.3|NP_149162.2	P02458	CO2A1_HUMAN	collagen, type II, alpha 1	987	Triple-helical region.				axon guidance (GO:0007411)|cartilage condensation (GO:0001502)|cartilage development (GO:0051216)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|cellular response to BMP stimulus (GO:0071773)|central nervous system development (GO:0007417)|chondrocyte differentiation (GO:0002062)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|embryonic skeletal joint morphogenesis (GO:0060272)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart morphogenesis (GO:0003007)|inner ear morphogenesis (GO:0042472)|limb bud formation (GO:0060174)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|notochord development (GO:0030903)|otic vesicle development (GO:0071599)|palate development (GO:0060021)|proteoglycan metabolic process (GO:0006029)|regulation of gene expression (GO:0010468)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|tissue homeostasis (GO:0001894)|visual perception (GO:0007601)	basement membrane (GO:0005604)|collagen type II trimer (GO:0005585)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(9)|lung(25)|ovary(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(3)	64		Acute lymphoblastic leukemia(13;0.108)|all_hematologic(14;0.214)			Collagenase(DB00048)	CCACGTTGCCCAGGCAGACCG	0.637																																																	0													133.0	83.0	100.0					12																	48372118		2203	4300	6503	SO:0001583	missense	0			X16468	CCDS8759.1, CCDS41778.1	12q12-q13.2	2013-11-14	2008-02-04		ENSG00000139219	ENSG00000139219		"""Collagens"""	2200	protein-coding gene	gene with protein product		120140	"""collagen, type II, alpha 1 (primary osteoarthritis, spondyloepiphyseal dysplasia, congenital)"", ""arthroophthalmopathy, progressive (Stickler syndrome)"""	SEDC, AOM		1677770	Standard	NM_033150		Approved	STL1	uc001rqu.3	P02458	OTTHUMG00000149896	ENST00000380518.3:c.2959G>T	12.37:g.48372118C>A	ENSP00000369889:p.Gly987Trp		A6NGA0|Q12985|Q14009|Q14044|Q14045|Q14046|Q14047|Q14056|Q14058|Q16672|Q1JQ82|Q2V4X7|Q6LBY1|Q6LBY2|Q6LBY3|Q96IT5|Q99227|Q9UE38|Q9UE39|Q9UE40|Q9UE41|Q9UE42|Q9UE43	Missense_Mutation	SNP	pfam_Collagen,pfam_Fib_collagen_C,pfam_VWF_C,superfamily_Fibrinogen_a/b/g_C_dom,smart_VWF_C,smart_Fib_collagen_C,pfscan_VWF_C	p.G987W	ENST00000380518.3	37	c.2959	CCDS41778.1	12	.	.	.	.	.	.	.	.	.	.	C	20.7	4.034237	0.75617	.	.	ENSG00000139219	ENST00000380518;ENST00000395281;ENST00000337299	D;D	0.99194	-5.54;-5.54	5.44	5.44	0.79542	.	0.000000	0.85682	D	0.000000	D	0.99674	0.9878	H	0.99312	4.51	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.97243	0.9892	10	0.87932	D	0	.	18.8574	0.92259	0.0:1.0:0.0:0.0	.	918;987	P02458-1;P02458	.;CO2A1_HUMAN	W	987;918;918	ENSP00000369889:G987W;ENSP00000338213:G918W	ENSP00000338213:G918W	G	-	1	0	COL2A1	46658385	1.000000	0.71417	0.943000	0.38184	0.920000	0.55202	7.482000	0.81143	2.550000	0.86006	0.462000	0.41574	GGG	COL2A1	-	pfam_Collagen	ENSG00000139219		0.637	COL2A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL2A1	HGNC	protein_coding	OTTHUMT00000313810.2	-	0.00	59	0	C	NM_001844		48372118	-1	tier1	-	no_errors	ENST00000380518	ensembl	human	known	74_37	missense	13.64	19	3	SNP	1.000	A
COL6A5	256076	genome.wustl.edu	37	3	130124990	130124990	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr3:130124990G>T	ENST00000432398.2	+	16	4890	c.4396G>T	c.(4396-4398)Gat>Tat	p.D1466Y	COL6A5_ENST00000265379.6_Missense_Mutation_p.D1466Y	NM_153264.5	NP_694996.5	A8TX70	CO6A5_HUMAN	collagen, type VI, alpha 5	1466	Triple-helical region.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				endometrium(6)|kidney(4)|large_intestine(8)|lung(19)|pancreas(2)|prostate(3)|stomach(1)|urinary_tract(1)	44						TCATGGAGACGATGGGATTGA	0.403																																																	0													155.0	124.0	134.0					3																	130124990		692	1591	2283	SO:0001583	missense	0			AK093199		3q21.3	2013-01-16	2010-05-24	2010-05-24	ENSG00000172752	ENSG00000172752		"""Collagens"""	26674	protein-coding gene	gene with protein product	"""von Willebrand factor A domain containing 4"""	611916	"""collagen, type XXIX, alpha 1"""	COL29A1		17850181	Standard	NM_153264		Approved	FLJ35880, VWA4	uc010htk.2	A8TX70	OTTHUMG00000159712	ENST00000432398.2:c.4396G>T	3.37:g.130124990G>T	ENSP00000390895:p.Asp1466Tyr		A9J6L2|A9J6L4|A9J6L6|A9J6L7|A9J6M0|A9J6M1|A9J6M2|B5MEA7|Q6ZW26|Q8NA36	Missense_Mutation	SNP	pfam_VWF_A,pfam_Collagen,smart_VWF_A,pfscan_VWF_A	p.D1466Y	ENST00000432398.2	37	c.4396		3	.	.	.	.	.	.	.	.	.	.	G	10.98	1.503341	0.26949	.	.	ENSG00000172752	ENST00000432398;ENST00000265379	D;D	0.93547	-3.24;-3.24	5.86	-5.14	0.02875	.	.	.	.	.	D	0.89777	0.6813	M	0.72624	2.21	0.09310	N	1	B	0.33477	0.413	B	0.36608	0.229	T	0.81247	-0.1019	9	0.51188	T	0.08	.	3.3012	0.06984	0.2626:0.3338:0.3113:0.0922	.	1466	A8TX70-2	.	Y	1466	ENSP00000390895:D1466Y;ENSP00000265379:D1466Y	ENSP00000265379:D1466Y	D	+	1	0	COL6A5	131607680	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-0.191000	0.09601	-0.757000	0.04697	-0.181000	0.13052	GAT	COL6A5	-	pfam_Collagen	ENSG00000172752		0.403	COL6A5-202	KNOWN	basic|appris_principal	protein_coding	COL6A5	HGNC	protein_coding		-	0.00	136	0	G	NM_153264		130124990	+1	tier1	-	no_errors	ENST00000265379	ensembl	human	known	74_37	missense	7.69	48	4	SNP	0.000	T
COPB1	1315	genome.wustl.edu	37	11	14486508	14486508	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr11:14486508C>T	ENST00000249923.3	-	18	2659	c.2359G>A	c.(2359-2361)Gct>Act	p.A787T	COPB1_ENST00000439561.2_Missense_Mutation_p.A787T	NM_016451.4	NP_057535.1	P53618	COPB_HUMAN	coatomer protein complex, subunit beta 1	787					COPI coating of Golgi vesicle (GO:0048205)|intra-Golgi vesicle-mediated transport (GO:0006891)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|viral process (GO:0016032)	COPI vesicle coat (GO:0030126)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi-associated vesicle (GO:0005798)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|plasma membrane (GO:0005886)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(12)|ovary(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(2)	36						TTGACGTTAGCTTTAATATTT	0.348																																																	0													108.0	104.0	105.0					11																	14486508		2200	4294	6494	SO:0001583	missense	0			BC037280	CCDS7815.1	11p15.2	2011-05-20	2006-06-30	2006-06-30	ENSG00000129083	ENSG00000129083			2231	protein-coding gene	gene with protein product		600959	"""coatomer protein complex, subunit beta"""	COPB		7982906	Standard	NM_016451		Approved		uc001mlg.2	P53618	OTTHUMG00000165824	ENST00000249923.3:c.2359G>A	11.37:g.14486508C>T	ENSP00000249923:p.Ala787Thr		D3DQX0|Q6GTT7|Q9NTK2|Q9UNW7	Missense_Mutation	SNP	pfam_Coatomer_bsu_C,pfam_Clathrin/coatomer_adapt-like_N,superfamily_ARM-type_fold,pirsf_COPB1	p.A787T	ENST00000249923.3	37	c.2359	CCDS7815.1	11	.	.	.	.	.	.	.	.	.	.	C	34	5.328711	0.95733	.	.	ENSG00000129083	ENST00000249923;ENST00000439561	T;T	0.51574	0.7;0.7	5.68	5.68	0.88126	Coatomer, beta subunit, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.70150	0.3191	M	0.74881	2.28	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.66736	-0.5848	10	0.35671	T	0.21	.	19.8595	0.96778	0.0:1.0:0.0:0.0	.	787	P53618	COPB_HUMAN	T	787	ENSP00000249923:A787T;ENSP00000397873:A787T	ENSP00000249923:A787T	A	-	1	0	COPB1	14443084	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.524000	0.81866	2.691000	0.91804	0.650000	0.86243	GCT	COPB1	-	pfam_Coatomer_bsu_C,pirsf_COPB1	ENSG00000129083		0.348	COPB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COPB1	HGNC	protein_coding	OTTHUMT00000386410.1	-	0.00	87	0	C	NM_016451		14486508	-1	tier1	-	no_errors	ENST00000249923	ensembl	human	known	74_37	missense	11.39	70	9	SNP	1.000	T
CSF1R	1436	genome.wustl.edu	37	5	149436898	149436898	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr5:149436898G>T	ENST00000286301.3	-	17	2562	c.2271C>A	c.(2269-2271)caC>caA	p.H757Q	CSF1R_ENST00000515239.1_5'Flank	NM_005211.3	NP_005202.2	P07333	CSF1R_HUMAN	colony stimulating factor 1 receptor	757	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell proliferation (GO:0008283)|cell-cell junction maintenance (GO:0045217)|cellular response to cytokine stimulus (GO:0071345)|cellular response to macrophage colony-stimulating factor stimulus (GO:0036006)|cytokine-mediated signaling pathway (GO:0019221)|hemopoiesis (GO:0030097)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|macrophage differentiation (GO:0030225)|mammary gland duct morphogenesis (GO:0060603)|monocyte differentiation (GO:0030224)|multicellular organismal development (GO:0007275)|osteoclast differentiation (GO:0030316)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol metabolic process (GO:0046488)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell migration (GO:0030335)|positive regulation of cell motility (GO:2000147)|positive regulation of cell proliferation (GO:0008284)|positive regulation of chemokine secretion (GO:0090197)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|protein autophosphorylation (GO:0046777)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of bone resorption (GO:0045124)|regulation of cell shape (GO:0008360)|ruffle organization (GO:0031529)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|cytokine binding (GO:0019955)|macrophage colony-stimulating factor receptor activity (GO:0005011)|protein homodimerization activity (GO:0042803)			NS(2)|breast(2)|central_nervous_system(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(38)|kidney(2)|large_intestine(6)|liver(3)|lung(23)|ovary(2)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(2)|urinary_tract(3)	93			KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)		Imatinib(DB00619)|Sunitinib(DB01268)	GGCTGGAGAAGTGAAGCAGGT	0.642																																																	0													59.0	50.0	53.0					5																	149436898		2203	4300	6503	SO:0001583	missense	0			U63963	CCDS4302.1	5q32	2013-01-11	2008-08-01		ENSG00000182578	ENSG00000182578		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	2433	protein-coding gene	gene with protein product		164770	"""McDonough feline sarcoma viral (v-fms) oncogene homolog"""	FMS		1611909	Standard	NM_005211		Approved	C-FMS, CSFR, CD115	uc003lrm.3	P07333	OTTHUMG00000130050	ENST00000286301.3:c.2271C>A	5.37:g.149436898G>T	ENSP00000286301:p.His757Gln		B5A955|D3DQG2|Q6LDW5|Q6LDY4|Q86VW7	Missense_Mutation	SNP	pirsf_Tyr_kinase_CSF1/PDGF_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_Immunoglobulin,superfamily_Kinase-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.H757Q	ENST00000286301.3	37	c.2271	CCDS4302.1	5	.	.	.	.	.	.	.	.	.	.	G	4.570	0.105876	0.08780	.	.	ENSG00000182578	ENST00000286301	D	0.81739	-1.53	5.42	0.503	0.16940	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.438258	0.21739	N	0.069842	T	0.56819	0.2011	N	0.10874	0.06	0.80722	D	1	B	0.13145	0.007	B	0.09377	0.004	T	0.25847	-1.0120	10	0.21014	T	0.42	.	6.1353	0.20227	0.3583:0.2808:0.3609:0.0	.	757	P07333	CSF1R_HUMAN	Q	757	ENSP00000286301:H757Q	ENSP00000286301:H757Q	H	-	3	2	CSF1R	149417091	0.852000	0.29690	0.997000	0.53966	0.158000	0.22134	-0.123000	0.10611	0.024000	0.15214	-1.331000	0.01271	CAC	CSF1R	-	pirsf_Tyr_kinase_CSF1/PDGF_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000182578		0.642	CSF1R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSF1R	HGNC	protein_coding	OTTHUMT00000252329.2	-	0.00	111	0	G	NM_005211		149436898	-1	tier1	-	no_errors	ENST00000286301	ensembl	human	known	74_37	missense	6.90	54	4	SNP	0.988	T
CSNK2B	1460	genome.wustl.edu	37	6	31637232	31637232	+	Silent	SNP	C	C	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr6:31637232C>T	ENST00000375882.2	+	6	660	c.504C>T	c.(502-504)ttC>ttT	p.F168F	LY6G5B_ENST00000409525.1_5'Flank|CSNK2B_ENST00000375885.4_Silent_p.F187F|LY6G5B_ENST00000375864.4_5'Flank|CSNK2B_ENST00000375865.2_Silent_p.F168F|CSNK2B_ENST00000375866.2_Silent_p.F168F|CSNK2B-LY6G5B-1181_ENST00000375880.2_Silent_p.F168F	NM_001282385.1|NM_001320.5	NP_001269314.1|NP_001311.3	P67870	CSK2B_HUMAN	casein kinase 2, beta polypeptide	168					adiponectin-activated signaling pathway (GO:0033211)|axon guidance (GO:0007411)|cellular protein complex assembly (GO:0043623)|endothelial tube morphogenesis (GO:0061154)|mitotic cell cycle (GO:0000278)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|negative regulation of cell proliferation (GO:0008285)|positive regulation of activin receptor signaling pathway (GO:0032927)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|protein phosphorylation (GO:0006468)|regulation of DNA binding (GO:0051101)|regulation of protein kinase activity (GO:0045859)|signal transduction (GO:0007165)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|protein kinase CK2 complex (GO:0005956)	identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein domain specific binding (GO:0019904)|protein kinase regulator activity (GO:0019887)|receptor binding (GO:0005102)|transcription factor binding (GO:0008134)			central_nervous_system(5)|endometrium(1)|large_intestine(2)|liver(1)|urinary_tract(1)	10						ACATGCTCTTCATGGTGCATC	0.547																																																	0													119.0	108.0	112.0					6																	31637232		2203	4300	6503	SO:0001819	synonymous_variant	0			M30448	CCDS4712.1	6p21.33	2013-01-17			ENSG00000204435	ENSG00000204435	2.7.11.1		2460	protein-coding gene	gene with protein product		115441				2276748, 9503014	Standard	NM_001320		Approved		uc003nvr.1	P67870	OTTHUMG00000177888	ENST00000375882.2:c.504C>T	6.37:g.31637232C>T			B0UXA9|P07312|P13862|Q4VX47	Silent	SNP	pfam_Casein_kinase_II_reg-sub,superfamily_Casein_kinase_II_reg-sub,prints_Casein_kinase_II_reg-sub	p.F168	ENST00000375882.2	37	c.504	CCDS4712.1	6																																																																																			CSNK2B	-	pfam_Casein_kinase_II_reg-sub,superfamily_Casein_kinase_II_reg-sub,prints_Casein_kinase_II_reg-sub	ENSG00000204435		0.547	CSNK2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSNK2B	HGNC	protein_coding	OTTHUMT00000076063.8	-	0.00	35	0	C	NM_001320		31637232	+1	tier1	-	no_errors	ENST00000375865	ensembl	human	known	74_37	silent	23.81	16	5	SNP	1.000	T
CSPG4P13	100302666	genome.wustl.edu	37	15	78196325	78196325	+	RNA	SNP	G	G	A	rs535281947	byFrequency	TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr15:78196325G>A	ENST00000565545.1	+	0	380									chondroitin sulfate proteoglycan 4 pseudogene 13																		CACGGACGGCGACTCTGGGTC	0.672													G|||	2	0.000399361	0.0	0.0	5008	,	,		15506	0.002		0.0	False		,,,				2504	0.0																0																																												0					15q24.3	2013-09-26			ENSG00000260139	ENSG00000260139			49195	pseudogene	pseudogene							Standard	NG_012725		Approved				OTTHUMG00000172978		15.37:g.78196325G>A				RNA	SNP	-	NULL	ENST00000565545.1	37	NULL		15																																																																																			CSPG4P13	-	-	ENSG00000260139		0.672	CSPG4P13-002	KNOWN	basic	processed_transcript	CSPG4P13	HGNC	pseudogene	OTTHUMT00000421581.1	-	0.00	149	0	G			78196325	+1	tier1	-	no_errors	ENST00000565545	ensembl	human	known	74_37	rna	34.00	66	34	SNP	0.885	A
CTNNB1	1499	genome.wustl.edu	37	3	41266472	41266472	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr3:41266472G>T	ENST00000349496.5	+	4	549	c.269G>T	c.(268-270)cGa>cTa	p.R90L	CTNNB1_ENST00000453024.1_Missense_Mutation_p.R83L|CTNNB1_ENST00000405570.1_Missense_Mutation_p.R90L|CTNNB1_ENST00000396185.3_Missense_Mutation_p.R90L|CTNNB1_ENST00000396183.3_Missense_Mutation_p.R90L	NM_001904.3	NP_001895.1	P35222	CTNB1_HUMAN	catenin (cadherin-associated protein), beta 1, 88kDa	90					adherens junction assembly (GO:0034333)|androgen receptor signaling pathway (GO:0030521)|anterior/posterior axis specification (GO:0009948)|apoptotic process (GO:0006915)|bone resorption (GO:0045453)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cell maturation (GO:0048469)|cell-matrix adhesion (GO:0007160)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to growth factor stimulus (GO:0071363)|cellular response to indole-3-methanol (GO:0071681)|cellular response to mechanical stimulus (GO:0071260)|central nervous system vasculogenesis (GO:0022009)|cytoskeletal anchoring at plasma membrane (GO:0007016)|determination of dorsal/ventral asymmetry (GO:0048262)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic foregut morphogenesis (GO:0048617)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal limb joint morphogenesis (GO:0036023)|endodermal cell fate commitment (GO:0001711)|endothelial tube morphogenesis (GO:0061154)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|fungiform papilla formation (GO:0061198)|gastrulation with mouth forming second (GO:0001702)|genitalia morphogenesis (GO:0035112)|glial cell fate determination (GO:0007403)|hair cell differentiation (GO:0035315)|hair follicle morphogenesis (GO:0031069)|hair follicle placode formation (GO:0060789)|hindbrain development (GO:0030902)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|layer formation in cerebral cortex (GO:0021819)|lens morphogenesis in camera-type eye (GO:0002089)|liver development (GO:0001889)|lung cell differentiation (GO:0060479)|lung induction (GO:0060492)|lung-associated mesenchyme development (GO:0060484)|male genitalia development (GO:0030539)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|midgut development (GO:0007494)|muscle cell differentiation (GO:0042692)|myoblast differentiation (GO:0045445)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of neuron death (GO:1901215)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephron tubule formation (GO:0072079)|neural plate development (GO:0001840)|neuron migration (GO:0001764)|odontogenesis of dentin-containing tooth (GO:0042475)|oocyte development (GO:0048599)|osteoclast differentiation (GO:0030316)|oviduct development (GO:0060066)|pancreas development (GO:0031016)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of branching involved in lung morphogenesis (GO:0061047)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of epithelial cell proliferation involved in prostate gland development (GO:0060769)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein heterooligomerization (GO:0051291)|protein localization to cell surface (GO:0034394)|proximal/distal pattern formation (GO:0009954)|regulation of angiogenesis (GO:0045765)|regulation of calcium ion import (GO:0090279)|regulation of centriole-centriole cohesion (GO:0030997)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of fibroblast proliferation (GO:0048145)|regulation of myelination (GO:0031641)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of protein localization to cell surface (GO:2000008)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of T cell proliferation (GO:0042129)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|renal vesicle formation (GO:0072033)|response to cadmium ion (GO:0046686)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|Schwann cell proliferation (GO:0014010)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle cell differentiation (GO:0051145)|synapse organization (GO:0050808)|synaptic vesicle transport (GO:0048489)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tongue morphogenesis (GO:0043587)|trachea formation (GO:0060440)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|beta-catenin destruction complex (GO:0030877)|beta-catenin-TCF7L2 complex (GO:0070369)|catenin complex (GO:0016342)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell periphery (GO:0071944)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Scrib-APC-beta-catenin complex (GO:0034750)|synapse (GO:0045202)|tight junction (GO:0005923)|transcription factor complex (GO:0005667)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|androgen receptor binding (GO:0050681)|cadherin binding (GO:0045296)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|I-SMAD binding (GO:0070411)|ion channel binding (GO:0044325)|kinase binding (GO:0019900)|nuclear hormone receptor binding (GO:0035257)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.A5_Q143del(7)|p.Q28_H134del(5)|p.W25_I140del(3)|p.T3_A126del(2)|p.?(2)|p.L10_N141del(2)|p.A5_Y142>D(2)|p.M5_N141>D(2)|p.M1_V173del(1)|p.A5_Q143>E(1)|p.A13_R151del(1)|p.A20_S111del(1)|p.I35_K170del(1)|p.Y30_A97del(1)|p.E15_I140>V(1)|p.V22_T102del(1)|p.H24_M131del(1)|p.A20_N141del(1)|p.D11_Y142>H(1)|p.P16_K133del(1)	CTNNB1/PLAG1(60)	NS(4)|adrenal_gland(103)|biliary_tract(43)|bone(21)|breast(7)|central_nervous_system(260)|cervix(9)|endometrium(293)|eye(1)|haematopoietic_and_lymphoid_tissue(60)|kidney(202)|large_intestine(269)|liver(1010)|lung(63)|oesophagus(6)|ovary(106)|pancreas(126)|parathyroid(11)|pituitary(111)|pleura(2)|prostate(31)|salivary_gland(13)|skin(103)|small_intestine(17)|soft_tissue(792)|stomach(165)|thyroid(55)|upper_aerodigestive_tract(2)|urinary_tract(8)	3893				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)		GCAATGACTCGAGCTCAGAGG	0.433		15	"""H, Mis, T"""	PLAG1	"""colorectal, cvarian,  hepatoblastoma, others, pleomorphic salivary adenoma"""				Pilomatrixoma, Familial Clustering of																												Colon(6;3 56 14213 18255)			Dom	yes		3	3p22-p21.3	1499	"""catenin (cadherin-associated protein), beta 1"""		"""E, M, O"""	37	Deletion - In frame(28)|Complex - deletion inframe(7)|Unknown(2)	liver(30)|stomach(5)|adrenal_gland(1)|skin(1)											191.0	169.0	176.0					3																	41266472		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Pilomatricoma, Familial Clustering of, Epithelioma Calcificans of Malherbe	X87838	CCDS2694.1	3p21	2013-02-15	2002-08-29		ENSG00000168036	ENSG00000168036		"""Armadillo repeat containing"""	2514	protein-coding gene	gene with protein product		116806	"""catenin (cadherin-associated protein), beta 1 (88kD)"""	CTNNB		7829088	Standard	NM_001098210		Approved	beta-catenin, armadillo	uc003ckr.2	P35222	OTTHUMG00000131393	ENST00000349496.5:c.269G>T	3.37:g.41266472G>T	ENSP00000344456:p.Arg90Leu		A8K1L7|Q8NEW9|Q8NI94|Q9H391	Missense_Mutation	SNP	pfam_Armadillo,superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo,prints_Beta-catenin	p.R90L	ENST00000349496.5	37	c.269	CCDS2694.1	3	.	.	.	.	.	.	.	.	.	.	G	27.8	4.866669	0.91511	.	.	ENSG00000168036	ENST00000405570;ENST00000431914;ENST00000396183;ENST00000349496;ENST00000453024;ENST00000396185;ENST00000450969;ENST00000441708	T;T;T;T;T;T;T;T	0.58506	0.33;0.33;0.33;0.33;0.33;0.33;0.33;0.33	5.7	5.7	0.88788	.	0.000000	0.85682	D	0.000000	T	0.78941	0.4363	M	0.80183	2.485	0.80722	D	1	D;D	0.76494	0.999;0.998	D;D	0.78314	0.991;0.965	T	0.80837	-0.1204	10	0.87932	D	0	-4.3016	19.8405	0.96681	0.0:0.0:1.0:0.0	.	18;90	B4DSW9;P35222	.;CTNB1_HUMAN	L	90;90;90;90;83;90;90;90	ENSP00000385604:R90L;ENSP00000412219:R90L;ENSP00000379486:R90L;ENSP00000344456:R90L;ENSP00000411226:R83L;ENSP00000379488:R90L;ENSP00000409302:R90L;ENSP00000401599:R90L	ENSP00000344456:R90L	R	+	2	0	CTNNB1	41241476	1.000000	0.71417	0.998000	0.56505	0.996000	0.88848	9.869000	0.99810	2.692000	0.91855	0.655000	0.94253	CGA	CTNNB1	-	prints_Beta-catenin	ENSG00000168036		0.433	CTNNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTNNB1	HGNC	protein_coding	OTTHUMT00000254182.2	-	0.00	51	0	G	NM_001098210		41266472	+1	tier1	-	no_errors	ENST00000349496	ensembl	human	known	74_37	missense	18.18	18	4	SNP	1.000	T
CTNS	1497	genome.wustl.edu	37	17	3560044	3560044	+	Silent	SNP	G	G	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr17:3560044G>T	ENST00000046640.3	+	9	1229	c.636G>T	c.(634-636)gcG>gcT	p.A212A	CTNS_ENST00000441220.2_Silent_p.A104A|CTNS_ENST00000381870.3_Silent_p.A212A|RP11-235E17.6_ENST00000575741.1_RNA|CTNS_ENST00000414524.2_Silent_p.A65A	NM_004937.2	NP_004928.2	O60931	CTNS_HUMAN	cystinosin, lysosomal cystine transporter	212					adult walking behavior (GO:0007628)|ATP metabolic process (GO:0046034)|brain development (GO:0007420)|cellular amino acid metabolic process (GO:0006520)|cognition (GO:0050890)|glutathione metabolic process (GO:0006749)|grooming behavior (GO:0007625)|L-cystine transport (GO:0015811)|lens development in camera-type eye (GO:0002088)|long-term memory (GO:0007616)|visual learning (GO:0008542)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intermediate filament cytoskeleton (GO:0045111)|intracellular membrane-bounded organelle (GO:0043231)|late endosome (GO:0005770)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)	L-cystine transmembrane transporter activity (GO:0015184)			NS(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(2)	10				COAD - Colon adenocarcinoma(5;0.0829)	L-Cystine(DB00138)	GCCTGCACGCGGTTGTCCTCA	0.612																																																	0													144.0	115.0	125.0					17																	3560044		2203	4300	6503	SO:0001819	synonymous_variant	0			AJ222967	CCDS11031.1, CCDS32530.1	17p13	2011-06-07	2011-06-07		ENSG00000040531	ENSG00000040531			2518	protein-coding gene	gene with protein product		606272	"""cystinosis, nephropathic"""			9537412, 15128704	Standard	NM_004937		Approved	CTNS-LSB, PQLC4	uc002fwa.3	O60931	OTTHUMG00000090693	ENST00000046640.3:c.636G>T	17.37:g.3560044G>T			D3DTJ5|Q8IZ01|Q9UNK6	Silent	SNP	smart_CTNS,tigrfam_LC_transporter	p.A212	ENST00000046640.3	37	c.636	CCDS11031.1	17																																																																																			CTNS	-	tigrfam_LC_transporter	ENSG00000040531		0.612	CTNS-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	CTNS	HGNC	protein_coding	OTTHUMT00000317696.1		0.00	64	0	G	NM_004937		3560044	+1			no_errors	ENST00000381870	ensembl	human	known	74_37	silent	6.67	28	2	SNP	0.002	T
DAPP1	27071	genome.wustl.edu	37	4	100784193	100784193	+	Silent	SNP	G	G	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr4:100784193G>T	ENST00000512369.1	+	6	632	c.564G>T	c.(562-564)ctG>ctT	p.L188L	DAPP1_ENST00000296414.7_Silent_p.L188L	NM_014395.2	NP_055210.2	Q9UN19	DAPP1_HUMAN	dual adaptor of phosphotyrosine and 3-phosphoinositides	188	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				protein dephosphorylation (GO:0006470)|signal transduction (GO:0007165)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|phospholipid binding (GO:0005543)			endometrium(1)|kidney(1)|lung(4)	6				OV - Ovarian serous cystadenocarcinoma(123;7.04e-09)		GGTTTACTCTGCACAGGAATG	0.333																																																	0													60.0	60.0	60.0					4																	100784193		1836	4094	5930	SO:0001819	synonymous_variant	0			AF186022	CCDS47112.1	4q25-q27	2013-02-14			ENSG00000070190	ENSG00000070190		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	16500	protein-coding gene	gene with protein product		605768				10432293	Standard	NM_014395		Approved	BAM32	uc003hvf.4	Q9UN19	OTTHUMG00000160974	ENST00000512369.1:c.564G>T	4.37:g.100784193G>T			Q8TCK5|Q9UHF2	Silent	SNP	pfam_SH2,pfam_Pleckstrin_homology,smart_SH2,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_SH2,prints_SH2	p.L188	ENST00000512369.1	37	c.564	CCDS47112.1	4																																																																																			DAPP1	-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	ENSG00000070190		0.333	DAPP1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DAPP1	HGNC	protein_coding	OTTHUMT00000363215.1	-	0.00	178	0	G			100784193	+1	tier1	-	no_errors	ENST00000512369	ensembl	human	known	74_37	silent	42.35	49	36	SNP	1.000	T
DCC	1630	genome.wustl.edu	37	18	50731606	50731606	+	Nonsense_Mutation	SNP	G	G	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr18:50731606G>T	ENST00000442544.2	+	10	2210	c.1594G>T	c.(1594-1596)Gaa>Taa	p.E532*	DCC_ENST00000412726.1_Nonsense_Mutation_p.E380*|DCC_ENST00000581580.1_Nonsense_Mutation_p.E187*	NM_005215.3	NP_005206.2	P43146	DCC_HUMAN	DCC netrin 1 receptor	532	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|axonogenesis (GO:0007409)|dorsal/ventral axon guidance (GO:0033563)|negative regulation of collateral sprouting (GO:0048671)|negative regulation of dendrite development (GO:2000171)|negative regulation of neuron projection development (GO:0010977)|neuron migration (GO:0001764)|positive regulation of apoptotic process (GO:0043065)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neuron projection development (GO:0010976)|regulation of apoptotic process (GO:0042981)|response to amphetamine (GO:0001975)|spinal cord ventral commissure morphogenesis (GO:0021965)	axon (GO:0030424)|cytosol (GO:0005829)|growth cone membrane (GO:0032584)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	netrin receptor activity (GO:0005042)|transcription coactivator activity (GO:0003713)|transmembrane signaling receptor activity (GO:0004888)			NS(3)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(23)|liver(1)|lung(56)|ovary(7)|pancreas(3)|prostate(2)|skin(16)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(6)	148		all_cancers(7;0.11)|all_epithelial(6;0.00126)		Colorectal(16;0.0251)|COAD - Colon adenocarcinoma(17;0.0942)		AGGGCCAGTAGAAAACCTGCA	0.388																																																	0													167.0	173.0	171.0					18																	50731606		2203	4300	6503	SO:0001587	stop_gained	0			X76132	CCDS11952.1	18q21.1	2014-06-20	2014-06-20		ENSG00000187323	ENSG00000187323		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2701	protein-coding gene	gene with protein product	"""immunoglobulin superfamily, DCC subclass, member 1"""	120470	"""deleted in colorectal carcinoma"""			2294591, 24400119	Standard	NM_005215		Approved	IGDCC1, NTN1R1	uc002lfe.2	P43146	OTTHUMG00000132698	ENST00000442544.2:c.1594G>T	18.37:g.50731606G>T	ENSP00000389140:p.Glu532*			Nonsense_Mutation	SNP	pfam_Neogenin_C,pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.E532*	ENST00000442544.2	37	c.1594	CCDS11952.1	18	.	.	.	.	.	.	.	.	.	.	G	39	7.664688	0.98419	.	.	ENSG00000187323	ENST00000442544;ENST00000304775;ENST00000412726	.	.	.	5.78	5.78	0.91487	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	18.7793	0.91925	0.0:0.0:1.0:0.0	.	.	.	.	X	532;465;380	.	ENSP00000304146:E465X	E	+	1	0	DCC	48985604	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.957000	0.56730	2.722000	0.93159	0.655000	0.94253	GAA	DCC	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000187323		0.388	DCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCC	HGNC	protein_coding	OTTHUMT00000255996.3		0.00	41	0	G	NM_005215		50731606	+1			no_errors	ENST00000442544	ensembl	human	known	74_37	nonsense	9.09	30	3	SNP	1.000	T
DCC	1630	genome.wustl.edu	37	18	50936977	50936977	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr18:50936977G>T	ENST00000442544.2	+	20	3707	c.3091G>T	c.(3091-3093)Ggg>Tgg	p.G1031W	DCC_ENST00000412726.1_Missense_Mutation_p.G859W|DCC_ENST00000581580.1_Missense_Mutation_p.G666W	NM_005215.3	NP_005206.2	P43146	DCC_HUMAN	DCC netrin 1 receptor	1031	Fibronectin type-III 6. {ECO:0000255|PROSITE-ProRule:PRU00316}.				anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|axonogenesis (GO:0007409)|dorsal/ventral axon guidance (GO:0033563)|negative regulation of collateral sprouting (GO:0048671)|negative regulation of dendrite development (GO:2000171)|negative regulation of neuron projection development (GO:0010977)|neuron migration (GO:0001764)|positive regulation of apoptotic process (GO:0043065)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neuron projection development (GO:0010976)|regulation of apoptotic process (GO:0042981)|response to amphetamine (GO:0001975)|spinal cord ventral commissure morphogenesis (GO:0021965)	axon (GO:0030424)|cytosol (GO:0005829)|growth cone membrane (GO:0032584)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	netrin receptor activity (GO:0005042)|transcription coactivator activity (GO:0003713)|transmembrane signaling receptor activity (GO:0004888)			NS(3)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(23)|liver(1)|lung(56)|ovary(7)|pancreas(3)|prostate(2)|skin(16)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(6)	148		all_cancers(7;0.11)|all_epithelial(6;0.00126)		Colorectal(16;0.0251)|COAD - Colon adenocarcinoma(17;0.0942)		AAAAGGAGTGGGGCCACTCTC	0.378																																																	0													100.0	98.0	98.0					18																	50936977		2203	4300	6503	SO:0001583	missense	0			X76132	CCDS11952.1	18q21.1	2014-06-20	2014-06-20		ENSG00000187323	ENSG00000187323		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2701	protein-coding gene	gene with protein product	"""immunoglobulin superfamily, DCC subclass, member 1"""	120470	"""deleted in colorectal carcinoma"""			2294591, 24400119	Standard	NM_005215		Approved	IGDCC1, NTN1R1	uc002lfe.2	P43146	OTTHUMG00000132698	ENST00000442544.2:c.3091G>T	18.37:g.50936977G>T	ENSP00000389140:p.Gly1031Trp			Missense_Mutation	SNP	pfam_Neogenin_C,pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.G1031W	ENST00000442544.2	37	c.3091	CCDS11952.1	18	.	.	.	.	.	.	.	.	.	.	G	10.20	1.284892	0.23392	.	.	ENSG00000187323	ENST00000442544;ENST00000412726	T;T	0.64085	-0.08;-0.08	5.87	5.87	0.94306	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.87051	0.6081	H	0.96720	3.87	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.90345	0.4362	10	0.87932	D	0	-9.1903	19.3531	0.94398	0.0:0.0:1.0:0.0	.	859;859;1031	E7EQM8;B4DYX2;P43146	.;.;DCC_HUMAN	W	1031;859	ENSP00000389140:G1031W;ENSP00000397322:G859W	ENSP00000397322:G859W	G	+	1	0	DCC	49190975	1.000000	0.71417	0.998000	0.56505	0.046000	0.14306	9.660000	0.98599	2.941000	0.99782	0.655000	0.94253	GGG	DCC	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000187323		0.378	DCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCC	HGNC	protein_coding	OTTHUMT00000255996.3	-	0.00	78	0	G	NM_005215		50936977	+1	tier1	-	no_errors	ENST00000442544	ensembl	human	known	74_37	missense	10.53	34	4	SNP	1.000	T
DCDC1	341019	genome.wustl.edu	37	11	31112992	31112992	+	Missense_Mutation	SNP	T	T	C			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr11:31112992T>C	ENST00000597505.1	-	15	2184	c.2185A>G	c.(2185-2187)Aag>Gag	p.K729E	DCDC1_ENST00000437348.1_5'UTR			P59894	DCDC1_HUMAN	doublecortin domain containing 1	0					intracellular signal transduction (GO:0035556)					central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(17)|pancreas(2)|prostate(1)|skin(1)|stomach(1)	31	Lung SC(675;0.225)					TCAGCAGCCTTGACTCTGATA	0.393																																																	0													67.0	60.0	63.0					11																	31112992		1862	4114	5976	SO:0001583	missense	0			AY247970	CCDS7872.1	11p14.1	2013-05-22			ENSG00000170959	ENSG00000170959			20625	protein-coding gene	gene with protein product		608062				12820024	Standard	NM_181807		Approved		uc001msv.3	P59894	OTTHUMG00000150144	ENST00000597505.1:c.2185A>G	11.37:g.31112992T>C	ENSP00000472625:p.Lys729Glu		A6PVL6|B7WNX6|Q6ZU04	Missense_Mutation	SNP	pfam_Ricin_B_lectin,superfamily_Ricin_B_lectin,smart_Doublecortin_dom,pfscan_Doublecortin_dom,pfscan_Ricin_B_lectin	p.K729E	ENST00000597505.1	37	c.2185		11																																																																																			DCDC1	-	superfamily_Ricin_B_lectin,pfscan_Ricin_B_lectin	ENSG00000170959		0.393	DCDC1-010	PUTATIVE	basic	protein_coding	DCDC1	HGNC	protein_coding	OTTHUMT00000463167.1	-	0.00	84	0	T	NM_181807		31112992	-1	tier1	-	no_errors	ENST00000597505	ensembl	human	putative	74_37	missense	20.69	23	6	SNP	0.250	C
DCDC1	341019	genome.wustl.edu	37	11	31128366	31128366	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr11:31128366C>A	ENST00000597505.1	-	11	1728	c.1729G>T	c.(1729-1731)Gtc>Ttc	p.V577F	DCDC1_ENST00000437348.1_5'UTR			P59894	DCDC1_HUMAN	doublecortin domain containing 1	237					intracellular signal transduction (GO:0035556)					central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(17)|pancreas(2)|prostate(1)|skin(1)|stomach(1)	31	Lung SC(675;0.225)					CCATAAGAGACCCAAATTTTT	0.423											OREG0020856	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													109.0	105.0	106.0					11																	31128366		1826	4100	5926	SO:0001583	missense	0			AY247970	CCDS7872.1	11p14.1	2013-05-22			ENSG00000170959	ENSG00000170959			20625	protein-coding gene	gene with protein product		608062				12820024	Standard	NM_181807		Approved		uc001msv.3	P59894	OTTHUMG00000150144	ENST00000597505.1:c.1729G>T	11.37:g.31128366C>A	ENSP00000472625:p.Val577Phe	822	A6PVL6|B7WNX6|Q6ZU04	Missense_Mutation	SNP	pfam_Ricin_B_lectin,superfamily_Ricin_B_lectin,smart_Doublecortin_dom,pfscan_Doublecortin_dom,pfscan_Ricin_B_lectin	p.V577F	ENST00000597505.1	37	c.1729		11																																																																																			DCDC1	-	NULL	ENSG00000170959		0.423	DCDC1-010	PUTATIVE	basic	protein_coding	DCDC1	HGNC	protein_coding	OTTHUMT00000463167.1	-	0.00	152	0	C	NM_181807		31128366	-1	tier1	-	no_errors	ENST00000597505	ensembl	human	putative	74_37	missense	11.39	70	9	SNP	1.000	A
DDX59	83479	genome.wustl.edu	37	1	200635444	200635444	+	Frame_Shift_Del	DEL	T	T	-			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr1:200635444delT	ENST00000331314.6	-	2	638	c.425delA	c.(424-426)aagfs	p.K142fs	DDX59_ENST00000447706.2_Frame_Shift_Del_p.K142fs|DDX59_ENST00000367348.3_Frame_Shift_Del_p.K142fs	NM_001031725.4	NP_001026895.2	Q5T1V6	DDX59_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 59	142						cytoplasm (GO:0005737)|intracellular (GO:0005622)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(2)|liver(1)|lung(9)|ovary(3)	21						TTTCTCTTCCTTTTCCTTAAC	0.408																																																	0													94.0	96.0	95.0					1																	200635444		2203	4300	6503	SO:0001589	frameshift_variant	0			BC041801	CCDS30964.1	1q32.1	2010-07-14			ENSG00000118197	ENSG00000118197		"""Zinc fingers, HIT-type"", ""DEAD-boxes"""	25360	protein-coding gene	gene with protein product		615464					Standard	NM_001031725		Approved	DKFZP564B1023, ZNHIT5	uc009wzk.3	Q5T1V6	OTTHUMG00000035725	ENST00000331314.6:c.425delA	1.37:g.200635444delT	ENSP00000330460:p.Lys142fs		Q6PJL2|Q8IVW3|Q9H0W3	Frame_Shift_Del	DEL	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,pfam_Znf_HIT,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_RNA_helicase_DEAD_Q_motif	p.K142fs	ENST00000331314.6	37	c.425	CCDS30964.1	1																																																																																			DDX59	-	NULL	ENSG00000118197		0.408	DDX59-002	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX59	HGNC	protein_coding	OTTHUMT00000086883.2		0.00	55	0	T	NM_001031725.4		200635444	-1	tier1		no_errors	ENST00000331314	ensembl	human	known	74_37	frame_shift_del	6.06	31	2	DEL	0.005	-
DMD	1756	genome.wustl.edu	37	X	32382799	32382799	+	Missense_Mutation	SNP	T	T	C			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chrX:32382799T>C	ENST00000357033.4	-	36	5260	c.5054A>G	c.(5053-5055)gAc>gGc	p.D1685G	DMD_ENST00000378677.2_Missense_Mutation_p.D1681G	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin	1685	Interaction with SYNM. {ECO:0000250}.				cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				CACATTCTGGTCAAAAGTTTC	0.368																																																	0													205.0	158.0	173.0					X																	32382799		2202	4300	6502	SO:0001583	missense	0			AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.5054A>G	X.37:g.32382799T>C	ENSP00000354923:p.Asp1685Gly		E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_EF-hand_dom_typ1,pfam_EF-hand_dom_typ2,pfam_CH-domain,pfam_Znf_ZZ,pfam_WW_dom,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_WW_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_WW_dom,smart_Znf_ZZ,pirsf_Dystrophin/utrophin,pfscan_CH-domain,pfscan_WW_dom,pfscan_Znf_ZZ	p.D1685G	ENST00000357033.4	37	c.5054	CCDS14233.1	X	.	.	.	.	.	.	.	.	.	.	T	12.54	1.968936	0.34754	.	.	ENSG00000198947	ENST00000534884;ENST00000378682;ENST00000378684;ENST00000378677;ENST00000357033;ENST00000542849;ENST00000535280;ENST00000420596;ENST00000448370	T;T	0.50813	0.73;0.73	5.38	4.2	0.49525	.	0.450410	0.15215	U	0.274281	T	0.63260	0.2496	M	0.69823	2.125	0.80722	D	1	B;D;B;B;B	0.61080	0.253;0.989;0.297;0.192;0.192	B;P;B;B;B	0.62560	0.088;0.904;0.142;0.092;0.092	T	0.61252	-0.7100	10	0.59425	D	0.04	.	10.3463	0.43907	0.0:0.0787:0.0:0.9213	.	1677;1685;1681;344;341	P11532-4;P11532;E9PDN5;E7EQS7;E7EQS6	.;DMD_HUMAN;.;.;.	G	1677;344;341;1681;1685;1685;1562;101;41	ENSP00000367948:D1681G;ENSP00000354923:D1685G	ENSP00000354923:D1685G	D	-	2	0	DMD	32292720	1.000000	0.71417	0.999000	0.59377	0.904000	0.53231	3.944000	0.56629	0.769000	0.33313	0.437000	0.28790	GAC	DMD	-	pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin,pirsf_Dystrophin/utrophin	ENSG00000198947		0.368	DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DMD	HGNC	protein_coding	OTTHUMT00000056182.2	-	0.00	26	0	T	NM_004006		32382799	-1	tier1	-	no_errors	ENST00000357033	ensembl	human	known	74_37	missense	19.35	25	6	SNP	1.000	C
DNAAF2	55172	genome.wustl.edu	37	14	50094817	50094817	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr14:50094817G>T	ENST00000298292.8	-	2	2000	c.1920C>A	c.(1918-1920)agC>agA	p.S640R	RP11-649E7.7_ENST00000556657.1_RNA|DNAAF2_ENST00000406043.3_Intron	NM_018139.2	NP_060609.2	Q9NVR5	KTU_HUMAN	dynein, axonemal, assembly factor 2	640					axonemal dynein complex assembly (GO:0070286)|bacterial-type flagellum-dependent cell motility (GO:0071973)|cilium-dependent cell motility (GO:0060285)|response to retinoic acid (GO:0032526)	cytoplasm (GO:0005737)				kidney(1)|lung(4)	5						TGAATGGAGAGCTCAGGACCT	0.333																																																	0													55.0	53.0	54.0					14																	50094817		2201	4299	6500	SO:0001583	missense	0			AK001425	CCDS9691.2, CCDS45100.1	14q21.3	2012-05-03	2011-06-09	2011-06-09	ENSG00000165506	ENSG00000165506			20188	protein-coding gene	gene with protein product	"""kintoun"""	612517	"""chromosome 14 open reading frame 104"""	C14orf104			Standard	NM_001083908		Approved	FLJ10563, KTU, PF13, CILD10	uc001wws.4	Q9NVR5	OTTHUMG00000152331	ENST00000298292.8:c.1920C>A	14.37:g.50094817G>T	ENSP00000298292:p.Ser640Arg		B9WS54|C0JAP7|Q86TR1|Q86TY8|Q969Z5	Missense_Mutation	SNP	pfam_PIH	p.S640R	ENST00000298292.8	37	c.1920	CCDS9691.2	14	.	.	.	.	.	.	.	.	.	.	G	11.87	1.768458	0.31320	.	.	ENSG00000165506	ENST00000298292	T	0.15603	2.41	5.47	3.6	0.41247	.	0.813983	0.10857	N	0.626547	T	0.12263	0.0298	N	0.19112	0.55	0.25716	N	0.985426	B	0.15473	0.013	B	0.14023	0.01	T	0.21211	-1.0252	10	0.30078	T	0.28	.	11.8753	0.52544	0.15:0.0:0.85:0.0	.	640	Q9NVR5	KTU_HUMAN	R	640	ENSP00000298292:S640R	ENSP00000298292:S640R	S	-	3	2	DNAAF2	49164567	0.544000	0.26441	0.568000	0.28447	0.983000	0.72400	1.513000	0.35823	1.434000	0.47414	0.558000	0.71614	AGC	DNAAF2	-	NULL	ENSG00000165506		0.333	DNAAF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DNAAF2	HGNC	protein_coding	OTTHUMT00000276813.1		0.00	106	0	G			50094817	-1			no_errors	ENST00000298292	ensembl	human	known	74_37	missense	5.56	67	4	SNP	0.183	T
DNAH2	146754	genome.wustl.edu	37	17	7727989	7727989	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr17:7727989G>T	ENST00000572933.1	+	77	13257	c.11797G>T	c.(11797-11799)Gac>Tac	p.D3933Y	DNAH2_ENST00000389173.2_Missense_Mutation_p.D3933Y			Q9P225	DYH2_HUMAN	dynein, axonemal, heavy chain 2	3933	AAA 6. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(3)|breast(11)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(53)|liver(2)|lung(49)|ovary(7)|prostate(7)|skin(15)|upper_aerodigestive_tract(1)|urinary_tract(1)	189		all_cancers(10;4.66e-07)|Prostate(122;0.081)				CCCCCACCCAGACTTCCCTAT	0.552																																																	0													132.0	113.0	120.0					17																	7727989		2203	4300	6503	SO:0001583	missense	0			U83570, AK128517	CCDS32551.1	17p13.1	2007-10-05	2006-09-04			ENSG00000183914		"""Axonemal dyneins"""	2948	protein-coding gene	gene with protein product		603333	"""dynein, axonemal, heavy polypeptide 2"", ""dynein heavy chain domain 3"""	DNHD3		9256245	Standard	XM_005256470		Approved	KIAA1503, FLJ46675	uc002giu.1	Q9P225		ENST00000572933.1:c.11797G>T	17.37:g.7727989G>T	ENSP00000458355:p.Asp3933Tyr		A8K992|B5MDX5|O15434|Q6PIH3|Q6ZR42	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,pfam_Dynein_heavy_dom-1,pfam_ATPase_dyneun-rel_AAA,pfam_ATPase_AAA_core,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.D3933Y	ENST00000572933.1	37	c.11797	CCDS32551.1	17	.	.	.	.	.	.	.	.	.	.	G	21.7	4.181129	0.78677	.	.	ENSG00000183914	ENST00000360606;ENST00000389173	T	0.08807	3.05	4.41	4.41	0.53225	Dynein heavy chain (1);	0.260612	0.36815	N	0.002385	T	0.20861	0.0502	L	0.58354	1.805	0.80722	D	1	P;P	0.36222	0.488;0.544	B;P	0.50896	0.393;0.653	T	0.01081	-1.1458	10	0.59425	D	0.04	.	15.9206	0.79562	0.0:0.0:1.0:0.0	.	3894;3933	Q9P225-2;Q9P225	.;DYH2_HUMAN	Y	3894;3933	ENSP00000373825:D3933Y	ENSP00000353818:D3894Y	D	+	1	0	DNAH2	7668714	1.000000	0.71417	0.999000	0.59377	0.970000	0.65996	5.066000	0.64351	2.292000	0.77174	0.505000	0.49811	GAC	DNAH2	-	pfam_Dynein_heavy_dom	ENSG00000183914		0.552	DNAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH2	HGNC	protein_coding	OTTHUMT00000440241.1	-	0.00	45	0	G	NM_020877		7727989	+1	tier1	-	no_errors	ENST00000389173	ensembl	human	known	74_37	missense	10.53	34	4	SNP	1.000	T
DNAH3	55567	genome.wustl.edu	37	16	20975118	20975118	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr16:20975118C>T	ENST00000261383.3	-	53	10087	c.10088G>A	c.(10087-10089)cGt>cAt	p.R3363H	DNAH3_ENST00000415178.1_3'UTR	NM_017539.1	NP_060009.1	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	3363					cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			NS(3)|autonomic_ganglia(1)|breast(12)|central_nervous_system(3)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(42)|liver(2)|lung(57)|ovary(14)|pancreas(1)|prostate(7)|skin(11)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(6)	202				GBM - Glioblastoma multiforme(48;0.207)		AAACAGAGAACGGCACACGTT	0.478																																																	0													147.0	114.0	125.0					16																	20975118		2201	4300	6501	SO:0001583	missense	0			U83574	CCDS10594.1	16p12.2	2008-08-01	2006-09-04		ENSG00000158486	ENSG00000158486		"""Axonemal dyneins"""	2949	protein-coding gene	gene with protein product		603334	"""dynein, axonemal, heavy polypeptide 3"""			9256245, 9373155	Standard	NM_017539		Approved	Dnahc3b, DLP3, Hsadhc3, DKFZp434N074	uc010vbe.2	Q8TD57	OTTHUMG00000090677	ENST00000261383.3:c.10088G>A	16.37:g.20975118C>T	ENSP00000261383:p.Arg3363His		O00437|O15437|O43326|Q3C0H2|Q8WUP9|Q9UEM3|Q9UEM5|Q9UG35	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,superfamily_Prefoldin,smart_AAA+_ATPase	p.R3363H	ENST00000261383.3	37	c.10088	CCDS10594.1	16	.	.	.	.	.	.	.	.	.	.	C	25.1	4.604646	0.87157	.	.	ENSG00000158486	ENST00000261383	T	0.80566	-1.39	5.78	5.78	0.91487	.	0.000000	0.85682	D	0.000000	D	0.94443	0.8212	H	0.98559	4.265	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.96080	0.9053	10	0.87932	D	0	.	20.0137	0.97470	0.0:1.0:0.0:0.0	.	3363	Q8TD57	DYH3_HUMAN	H	3363	ENSP00000261383:R3363H	ENSP00000261383:R3363H	R	-	2	0	DNAH3	20882619	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	7.818000	0.86416	2.734000	0.93682	0.563000	0.77884	CGT	DNAH3	-	NULL	ENSG00000158486		0.478	DNAH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH3	HGNC	protein_coding	OTTHUMT00000207361.1	-	0.00	74	0	C	NM_017539		20975118	-1	tier1	-	no_errors	ENST00000261383	ensembl	human	known	74_37	missense	28.30	38	15	SNP	1.000	T
DNAH9	1770	genome.wustl.edu	37	17	11809043	11809043	+	Nonsense_Mutation	SNP	C	C	A			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr17:11809043C>A	ENST00000262442.4	+	61	11734	c.11666C>A	c.(11665-11667)tCa>tAa	p.S3889*	DNAH9_ENST00000396001.2_3'UTR|DNAH9_ENST00000608377.1_Nonsense_Mutation_p.S201*|DNAH9_ENST00000454412.2_Nonsense_Mutation_p.S3889*	NM_001372.3	NP_001363.2	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9	3889	AAA 6. {ECO:0000250}.				cell projection organization (GO:0030030)|cellular component movement (GO:0006928)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|spermatogenesis (GO:0007283)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(2)|autonomic_ganglia(1)|breast(15)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(6)|kidney(17)|large_intestine(49)|liver(2)|lung(123)|ovary(6)|pancreas(1)|prostate(6)|skin(21)|stomach(2)|upper_aerodigestive_tract(13)|urinary_tract(4)	290		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		TTTGCAACCTCATTTGAAGAA	0.438																																																	0													80.0	81.0	80.0					17																	11809043		2203	4300	6503	SO:0001587	stop_gained	0			U61740	CCDS11160.1, CCDS11161.1	17p12	2009-05-07	2006-09-04		ENSG00000007174	ENSG00000007174		"""Axonemal dyneins"""	2953	protein-coding gene	gene with protein product		603330	"""dynein, axonemal, heavy polypeptide 17-like"", ""dynein, axonemal, heavy polypeptide 9"""	DNAH17L		8812413, 11247663	Standard	NM_001372		Approved	Dnahc9, KIAA0357, HL20, HL-20, DNAL1, DYH9	uc002gne.3	Q9NYC9	OTTHUMG00000130383	ENST00000262442.4:c.11666C>A	17.37:g.11809043C>A	ENSP00000262442:p.Ser3889*		A2VCQ8|O15064|O95494|Q9NQ28	Nonsense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.S3889*	ENST00000262442.4	37	c.11666	CCDS11160.1	17	.	.	.	.	.	.	.	.	.	.	C	52	18.990491	0.99913	.	.	ENSG00000007174	ENST00000262442;ENST00000454412;ENST00000413703;ENST00000396001;ENST00000361801	.	.	.	4.81	4.81	0.61882	.	0.120955	0.64402	D	0.000015	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	18.4172	0.90574	0.0:1.0:0.0:0.0	.	.	.	.	X	3889;3889;2471;201;242	.	ENSP00000262442:S3889X	S	+	2	0	DNAH9	11749768	1.000000	0.71417	0.099000	0.21106	0.076000	0.17211	4.725000	0.61979	2.665000	0.90641	0.655000	0.94253	TCA	DNAH9	-	pfam_Dynein_heavy_dom	ENSG00000007174		0.438	DNAH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH9	HGNC	protein_coding	OTTHUMT00000252756.2	-	0.00	64	0	C	NM_001372		11809043	+1	tier1	-	no_errors	ENST00000262442	ensembl	human	known	74_37	nonsense	9.76	37	4	SNP	0.990	A
DNAJC2	27000	genome.wustl.edu	37	7	102957429	102957429	+	Silent	SNP	C	C	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr7:102957429C>T	ENST00000379263.3	-	13	1525	c.1275G>A	c.(1273-1275)gaG>gaA	p.E425E	DNAJC2_ENST00000249270.7_Silent_p.E372E|PMPCB_ENST00000420236.2_Intron	NM_014377.1	NP_055192.1	Q99543	DNJC2_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 2	425					'de novo' cotranslational protein folding (GO:0051083)|chromatin modification (GO:0016568)|DNA replication (GO:0006260)|negative regulation of cell growth (GO:0030308)|negative regulation of DNA biosynthetic process (GO:2000279)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone binding (GO:0042393)|Hsp70 protein binding (GO:0030544)|poly(A) RNA binding (GO:0044822)|ubiquitin binding (GO:0043130)			endometrium(1)|kidney(9)|large_intestine(6)|lung(4)|ovary(1)	21						CTTCCTCTTTCTCTTTTCTGA	0.393																																																	0													127.0	117.0	120.0					7																	102957429		1860	4098	5958	SO:0001819	synonymous_variant	0			X98260	CCDS43628.1, CCDS47679.1	7q22-q32	2011-09-02	2008-07-01	2008-07-01	ENSG00000105821	ENSG00000105821		"""Heat shock proteins / DNAJ (HSP40)"""	13192	protein-coding gene	gene with protein product		605502	"""zuotin related factor 1"""	ZRF1		8885239	Standard	NM_001129887		Approved	MPP11, MPHOSPH11, ZUO1, zuotin	uc003vbo.3	Q99543	OTTHUMG00000157202	ENST00000379263.3:c.1275G>A	7.37:g.102957429C>T			A4VCI0|Q9BVX1	Silent	SNP	pfam_SANT/Myb,pfam_DnaJ_domain,superfamily_DnaJ_domain,superfamily_Homeodomain-like,smart_DnaJ_domain,smart_SANT/Myb,pfscan_Myb-like_dom,pfscan_DnaJ_domain	p.E425	ENST00000379263.3	37	c.1275	CCDS43628.1	7																																																																																			DNAJC2	-	NULL	ENSG00000105821		0.393	DNAJC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAJC2	HGNC	protein_coding	OTTHUMT00000347891.1	-	0.00	55	0	C			102957429	-1	tier1	-	no_errors	ENST00000379263	ensembl	human	known	74_37	silent	19.35	25	6	SNP	1.000	T
DOCK1	1793	genome.wustl.edu	37	10	129216774	129216774	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr10:129216774C>T	ENST00000280333.6	+	45	4707	c.4598C>T	c.(4597-4599)gCt>gTt	p.A1533V		NM_001380.3	NP_001371.1	Q14185	DOCK1_HUMAN	dedicator of cytokinesis 1	1533	DHR-2.				apoptotic process (GO:0006915)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell migration (GO:0016477)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|hematopoietic progenitor cell differentiation (GO:0002244)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|phagocytosis, engulfment (GO:0006911)|positive regulation of GTPase activity (GO:0043547)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)			NS(2)|breast(1)|central_nervous_system(7)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(10)|lung(15)|ovary(4)|prostate(3)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	72		all_epithelial(44;2.3e-07)|all_lung(145;0.00466)|Lung NSC(174;0.00685)|Colorectal(57;0.0107)|Renal(717;0.0113)|Breast(234;0.0492)|all_neural(114;0.108)|all_hematologic(284;0.14)		BRCA - Breast invasive adenocarcinoma(275;0.0221)|Colorectal(40;0.115)		GTGGACCCAGCTGTCATGGGG	0.592																																																	0													60.0	71.0	67.0					10																	129216774		2203	4300	6503	SO:0001583	missense	0			D50857	CCDS73222.1	10q26.13-q26.3	2009-10-28			ENSG00000150760	ENSG00000150760			2987	protein-coding gene	gene with protein product	"""DOwnstream of CrK"""	601403	"""dedicator of cyto-kinesis 1"""			8657152, 8661160	Standard	XM_006717681		Approved	DOCK180, ced5	uc001ljt.3	Q14185	OTTHUMG00000019249	ENST00000280333.6:c.4598C>T	10.37:g.129216774C>T	ENSP00000280333:p.Ala1533Val		A9Z1Z5	Missense_Mutation	SNP	pfam_DOCK_C,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,superfamily_ARM-type_fold,superfamily_Cyt_c-like_dom,smart_SH3_domain,pfscan_SH3_domain	p.A1533V	ENST00000280333.6	37	c.4598		10	.	.	.	.	.	.	.	.	.	.	C	23.8	4.456519	0.84317	.	.	ENSG00000150760	ENST00000280333	T	0.18174	2.23	4.8	4.8	0.61643	.	0.000000	0.85682	D	0.000000	T	0.51958	0.1705	M	0.90870	3.155	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.78314	0.991;0.964;0.977	T	0.64668	-0.6353	10	0.87932	D	0	.	18.0621	0.89380	0.0:1.0:0.0:0.0	.	1533;1599;1533	B2RUU3;A8MU08;Q14185	.;.;DOCK1_HUMAN	V	1533	ENSP00000280333:A1533V	ENSP00000280333:A1533V	A	+	2	0	DOCK1	129106764	1.000000	0.71417	0.940000	0.37924	0.391000	0.30476	7.604000	0.82830	2.492000	0.84095	0.555000	0.69702	GCT	DOCK1	-	pfam_DOCK_C,superfamily_Cyt_c-like_dom	ENSG00000150760		0.592	DOCK1-001	KNOWN	basic|appris_principal	protein_coding	DOCK1	HGNC	protein_coding	OTTHUMT00000050979.2	-	0.00	77	0	C	NM_001380		129216774	+1	tier1	-	no_errors	ENST00000280333	ensembl	human	known	74_37	missense	10.00	36	4	SNP	1.000	T
DPP10	57628	genome.wustl.edu	37	2	116485404	116485404	+	Nonsense_Mutation	SNP	G	G	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr2:116485404G>T	ENST00000410059.1	+	8	1069	c.589G>T	c.(589-591)Gaa>Taa	p.E197*	DPP10_ENST00000310323.8_Nonsense_Mutation_p.E190*|DPP10_ENST00000409163.1_Nonsense_Mutation_p.E147*|DPP10_ENST00000488208.1_3'UTR|DPP10_ENST00000393147.2_Nonsense_Mutation_p.E201*	NM_001178037.1|NM_020868.3	NP_001171508.1|NP_065919	Q8N608	DPP10_HUMAN	dipeptidyl-peptidase 10 (non-functional)	197						integral component of membrane (GO:0016021)|membrane (GO:0016020)	serine-type peptidase activity (GO:0008236)	p.E190K(1)|p.E197K(1)		breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(24)|liver(2)|lung(48)|ovary(6)|prostate(1)|skin(5)|soft_tissue(1)	101						TTATATTTTTGAAAATAATAT	0.308																																																	2	Substitution - Missense(2)	lung(2)											35.0	40.0	38.0					2																	116485404		2174	4276	6450	SO:0001587	stop_gained	0			AY172661	CCDS33278.1, CCDS46400.1, CCDS54388.1, CCDS54389.1	2q14.1	2010-05-04	2010-05-04		ENSG00000175497	ENSG00000175497			20823	protein-coding gene	gene with protein product		608209	"""dipeptidylpeptidase 10"", ""dipeptidyl-peptidase 10"""			10819331, 12662155	Standard	NM_020868		Approved	DPRP3	uc002tle.3	Q8N608	OTTHUMG00000153294	ENST00000410059.1:c.589G>T	2.37:g.116485404G>T	ENSP00000386565:p.Glu197*		A8K1Q2|J3KPP2|J3KQ46|Q0GLB8|Q53QT3|Q53S86|Q53SL8|Q53SS4|Q6TTV4|Q86YR9|Q9P236	Nonsense_Mutation	SNP	pfam_Peptidase_S9B,pfam_Peptidase_S9	p.E201*	ENST00000410059.1	37	c.601	CCDS46400.1	2	.	.	.	.	.	.	.	.	.	.	G	40	8.111696	0.98659	.	.	ENSG00000175497	ENST00000410059;ENST00000409163;ENST00000393146;ENST00000393147;ENST00000310323;ENST00000476155	.	.	.	5.16	5.16	0.70880	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.42905	T	0.14	-29.2224	17.9983	0.89191	0.0:0.0:1.0:0.0	.	.	.	.	X	197;147;193;201;190;147	.	ENSP00000309066:E190X	E	+	1	0	DPP10	116201874	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.576000	0.98192	2.570000	0.86706	0.591000	0.81541	GAA	DPP10	-	pfam_Peptidase_S9B	ENSG00000175497		0.308	DPP10-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	DPP10	HGNC	protein_coding	OTTHUMT00000330580.4		0.00	90	0	G	NM_020868		116485404	+1			no_errors	ENST00000393147	ensembl	human	known	74_37	nonsense	6.06	31	2	SNP	1.000	T
DPPA2	151871	genome.wustl.edu	37	3	109027896	109027896	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr3:109027896G>A	ENST00000478945.1	-	5	619	c.373C>T	c.(373-375)Cat>Tat	p.H125Y		NM_138815.3	NP_620170.3	Q7Z7J5	DPPA2_HUMAN	developmental pluripotency associated 2	125	SAP. {ECO:0000255|PROSITE- ProRule:PRU00186}.				lung-associated mesenchyme development (GO:0060484)|positive regulation of stem cell proliferation (GO:2000648)|regulation of histone methylation (GO:0031060)|regulation of transcription, DNA-templated (GO:0006355)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|nucleic acid binding (GO:0003676)			breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(19)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						GGGTAAGCATGCCTATGAAGC	0.433																																																	0													181.0	161.0	168.0					3																	109027896		2203	4300	6503	SO:0001583	missense	0			AY283672	CCDS2956.1	3q13.13	2010-05-04			ENSG00000163530	ENSG00000163530			19197	protein-coding gene	gene with protein product	"""cancer/testis antigen 100"""	614445				15583978	Standard	NM_138815		Approved	PESCRG1, CT100	uc003dxo.3	Q7Z7J5	OTTHUMG00000159227	ENST00000478945.1:c.373C>T	3.37:g.109027896G>A	ENSP00000417710:p.His125Tyr		Q8WVF0	Missense_Mutation	SNP	pfscan_SAP_dom	p.H125Y	ENST00000478945.1	37	c.373	CCDS2956.1	3	.	.	.	.	.	.	.	.	.	.	G	2.168	-0.390657	0.04932	.	.	ENSG00000163530	ENST00000478945	T	0.72051	-0.62	3.89	3.01	0.34805	DNA-binding SAP (2);	0.490245	0.18970	N	0.126153	T	0.52141	0.1716	L	0.31804	0.96	0.09310	N	1	B	0.25521	0.128	B	0.26969	0.075	T	0.30707	-0.9969	10	0.11485	T	0.65	-7.1849	7.4214	0.27073	0.1172:0.0:0.8828:0.0	.	125	Q7Z7J5	DPPA2_HUMAN	Y	125	ENSP00000417710:H125Y	ENSP00000417710:H125Y	H	-	1	0	DPPA2	110510586	0.000000	0.05858	0.122000	0.21767	0.040000	0.13550	0.159000	0.16442	1.222000	0.43521	0.462000	0.41574	CAT	DPPA2	-	pfscan_SAP_dom	ENSG00000163530		0.433	DPPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DPPA2	HGNC	protein_coding	OTTHUMT00000353938.1	-	0.00	74	0	G	NM_138815		109027896	-1	tier1	-	no_errors	ENST00000478945	ensembl	human	known	74_37	missense	28.12	23	9	SNP	0.141	A
DSCR3	10311	genome.wustl.edu	37	21	38639762	38639763	+	5'UTR	INS	-	-	C	rs35672675|rs397760805		TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr21:38639762_38639763insC	ENST00000309117.6	-	0	70_71				DSCR3_ENST00000288304.5_5'UTR|DSCR3_ENST00000476950.1_5'Flank|DSCR3_ENST00000399001.1_5'Flank|DSCR3_ENST00000398998.1_5'UTR|DSCR3_ENST00000539844.1_5'Flank|DSCR3_ENST00000399000.3_5'UTR|AP001412.1_ENST00000608405.1_RNA	NM_006052.1	NP_006043.1	O14972	DSCR3_HUMAN	Down syndrome critical region gene 3							nucleus (GO:0005634)				endometrium(2)|kidney(1)|large_intestine(3)|lung(3)	9						GAGGGGCGAATGCCCACGCCTT	0.693																																																	0																																										SO:0001623	5_prime_UTR_variant	0			D87343	CCDS33553.1	21q22.2	2008-05-22			ENSG00000157538	ENSG00000157538			3044	protein-coding gene	gene with protein product		605298				9399594	Standard	NM_006052		Approved	DCRA	uc002ywf.1	O14972	OTTHUMG00000086659	ENST00000309117.6:c.-168->G	21.37:g.38639762_38639763insC			B2R6T8|B7Z6B1|D3DSH4|Q2TAY6	RNA	INS	-	NULL	ENST00000309117.6	37	NULL	CCDS33553.1	21																																																																																			DSCR3	-	-	ENSG00000157538		0.693	DSCR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DSCR3	HGNC	protein_coding	OTTHUMT00000194807.1		0.00	18	0	-			38639763	-1	tier1		no_errors	ENST00000399000	ensembl	human	known	74_37	rna	28.57	5	2	INS	0.001:0.001	C
DZANK1	55184	genome.wustl.edu	37	20	18370413	18370413	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr20:18370413C>A	ENST00000358866.6	-	18	1972	c.1950G>T	c.(1948-1950)atG>atT	p.M650I	DZANK1_ENST00000262547.5_Missense_Mutation_p.M650I|DZANK1_ENST00000487128.1_5'UTR|DZANK1_ENST00000357236.4_Missense_Mutation_p.M536I|DZANK1_ENST00000329494.5_Missense_Mutation_p.M628I			Q9NVP4	DZAN1_HUMAN	double zinc ribbon and ankyrin repeat domains 1	650							zinc ion binding (GO:0008270)			NS(1)|cervix(1)|endometrium(2)|large_intestine(5)|lung(10)	19						GGTGCTTATTCATAACAGCCA	0.512																																																	0													146.0	149.0	148.0					20																	18370413		2064	4209	6273	SO:0001583	missense	0			AK001462	CCDS46582.1	20p11.23	2013-01-11	2011-10-03	2011-10-03	ENSG00000089091	ENSG00000089091		"""Ankyrin repeat domain containing"""	15858	protein-coding gene	gene with protein product	"""ankyrin repeat domain 64"""		"""chromosome 20 open reading frame 12"""	C20orf84, C20orf12			Standard	NM_001099407		Approved	FLJ10600, dJ568F9.2, FLJ30892, bA189K21.8, ANKRD64	uc002wqq.4	Q9NVP4	OTTHUMG00000031968	ENST00000358866.6:c.1950G>T	20.37:g.18370413C>A	ENSP00000351734:p.Met650Ile		B7ZLZ4|Q4F7X1|Q5QPD9|Q5QPE0|Q68DN8|Q6ZMX9|Q96NF0|Q9H1E0|Q9H442	Missense_Mutation	SNP	superfamily_Ankyrin_rpt-contain_dom,pfscan_Ankyrin_rpt-contain_dom	p.M650I	ENST00000358866.6	37	c.1950	CCDS46582.1	20	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	9.334|9.334	1.061398|1.061398	0.19987|0.19987	.|.	.|.	ENSG00000089091|ENSG00000089091	ENST00000377630;ENST00000262547;ENST00000329494;ENST00000414623;ENST00000377637;ENST00000357236|ENST00000358866	T;T;T;T|.	0.62788|.	-0.0;-0.0;-0.0;-0.0|.	5.88|5.88	2.47|2.47	0.30058|0.30058	.|.	0.620830|.	0.16229|.	N|.	0.223708|.	T|.	0.26340|.	0.0643|.	L|L	0.33668|0.33668	1.02|1.02	0.24949|0.24949	N|N	0.991808|0.991808	B;B;B;B|.	0.11235|.	0.001;0.004;0.002;0.001|.	B;B;B;B|.	0.10450|.	0.005;0.004;0.003;0.005|.	T|.	0.19386|.	-1.0307|.	10|.	0.46703|.	T|.	0.11|.	-0.8076|-0.8076	4.1168|4.1168	0.10086|0.10086	0.1414:0.4448:0.3164:0.0974|0.1414:0.4448:0.3164:0.0974	.|.	669;536;650;435|.	B7Z631;Q9NVP4-4;Q9NVP4;A6NKD0|.	.;.;DZAN1_HUMAN;.|.	I|L	483;650;628;482;435;536|449	ENSP00000366857:M483I;ENSP00000262547:M650I;ENSP00000328866:M628I;ENSP00000349774:M536I|.	ENSP00000262547:M650I|.	M|X	-|-	3|2	0|2	C20orf12|C20orf12	18318413|18318413	0.187000|0.187000	0.23238|0.23238	0.974000|0.974000	0.42286|0.42286	0.051000|0.051000	0.14879|0.14879	-0.153000|-0.153000	0.10144|0.10144	0.764000|0.764000	0.33197|0.33197	0.655000|0.655000	0.94253|0.94253	ATG|TGA	DZANK1	-	superfamily_Ankyrin_rpt-contain_dom,pfscan_Ankyrin_rpt-contain_dom	ENSG00000089091		0.512	DZANK1-011	KNOWN	basic|appris_principal|CCDS	protein_coding	DZANK1	HGNC	protein_coding	OTTHUMT00000471926.1	-	0.00	43	0	C	NM_001099407		18370413	-1	tier1	-	no_errors	ENST00000262547	ensembl	human	known	74_37	missense	10.53	33	4	SNP	0.993	A
EBPL	84650	genome.wustl.edu	37	13	50235205	50235205	+	Missense_Mutation	SNP	C	C	A	rs200901347		TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr13:50235205C>A	ENST00000242827.6	-	4	570	c.520G>T	c.(520-522)Ggt>Tgt	p.G174C	EBPL_ENST00000495963.2_5'UTR|EBPL_ENST00000378270.5_3'UTR|EBPL_ENST00000378272.5_3'UTR|EBPL_ENST00000378284.2_3'UTR	NM_032565.3	NP_115954.1	Q9BY08	EBPL_HUMAN	emopamil binding protein-like	174					sterol metabolic process (GO:0016125)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	cholestenol delta-isomerase activity (GO:0047750)			endometrium(8)|kidney(6)|lung(3)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	21		Lung NSC(96;0.000468)|Breast(56;0.0011)|Prostate(109;0.00243)|Hepatocellular(98;0.0556)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(99;2.06e-09)		ACCCACACACCGTTAAAAAAA	0.488																																					NSCLC(39;857 1083 36109 42364 51411)												0													64.0	62.0	62.0					13																	50235205		2203	4300	6503	SO:0001583	missense	0			AF243433	CCDS9420.1, CCDS61334.1	13q12-q13	2008-02-05			ENSG00000123179	ENSG00000123179			18061	protein-coding gene	gene with protein product							Standard	NM_032565		Approved	EBRP	uc001vdg.3	Q9BY08	OTTHUMG00000016920	ENST00000242827.6:c.520G>T	13.37:g.50235205C>A	ENSP00000242827:p.Gly174Cys		A6NJ59|Q569H7|Q5JVN2|Q5JVN3|Q5JVN4|Q5JVN5|Q5JVN6	Missense_Mutation	SNP	pfam_EBP	p.G174C	ENST00000242827.6	37	c.520	CCDS9420.1	13	.	.	.	.	.	.	.	.	.	.	C	14.84	2.656866	0.47467	.	.	ENSG00000123179	ENST00000242827	D	0.98150	-4.75	5.61	3.77	0.43336	.	0.147928	0.64402	D	0.000015	D	0.98340	0.9449	M	0.79693	2.465	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.97567	1.0102	10	0.38643	T	0.18	-18.6412	11.2218	0.48860	0.0:0.8765:0.0:0.1235	.	174	Q9BY08	EBPL_HUMAN	C	174	ENSP00000242827:G174C	ENSP00000242827:G174C	G	-	1	0	EBPL	49133206	1.000000	0.71417	0.904000	0.35570	0.430000	0.31655	3.667000	0.54547	0.716000	0.32124	0.650000	0.86243	GGT	EBPL	-	pfam_EBP	ENSG00000123179		0.488	EBPL-002	KNOWN	basic|appris_principal|CCDS	protein_coding	EBPL	HGNC	protein_coding	OTTHUMT00000044932.2		0.00	66	0	C	NM_032565		50235205	-1			no_errors	ENST00000242827	ensembl	human	known	74_37	missense	7.41	25	2	SNP	1.000	A
EMC1	23065	genome.wustl.edu	37	1	19547286	19547286	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr1:19547286G>T	ENST00000477853.1	-	21	2686	c.2644C>A	c.(2644-2646)Cgc>Agc	p.R882S	EMC1_ENST00000480380.1_5'UTR|EMC1_ENST00000375208.3_Missense_Mutation_p.R860S|RP1-43E13.2_ENST00000437898.1_RNA|EMC1_ENST00000375199.3_Missense_Mutation_p.R881S	NM_001271427.1|NM_001271428.1|NM_015047.2	NP_001258356.1|NP_001258357.1|NP_055862.1	Q8N766	EMC1_HUMAN	ER membrane protein complex subunit 1	882						ER membrane protein complex (GO:0072546)|integral component of membrane (GO:0016021)											ATCTCGGGGCGGCGGGGATCC	0.512																																																	0													98.0	90.0	93.0					1																	19547286		2203	4300	6503	SO:0001583	missense	0				CCDS190.1, CCDS59190.1, CCDS59191.1	1p36.13	2012-05-23	2012-05-23	2012-05-23	ENSG00000127463	ENSG00000127463			28957	protein-coding gene	gene with protein product			"""KIAA0090"""	KIAA0090		22119785	Standard	NM_015047		Approved		uc001bbo.4	Q8N766	OTTHUMG00000002497	ENST00000477853.1:c.2644C>A	1.37:g.19547286G>T	ENSP00000420608:p.Arg882Ser		A8K6F3|Q14700|Q5TG62|Q63HL0|Q63HL3|Q8NBH8	Missense_Mutation	SNP	pfam_DUF1620,superfamily_Quinonprotein_ADH-like_supfam	p.R882S	ENST00000477853.1	37	c.2644	CCDS190.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	23.0|23.0	4.367895|4.367895	0.82463|0.82463	.|.	.|.	ENSG00000127463|ENSG00000127463	ENST00000486405|ENST00000477853;ENST00000375199;ENST00000375208	.|T;T;T	.|0.59364	.|0.27;0.28;0.29	5.83|5.83	5.83|5.83	0.93111|0.93111	.|Domain of unknown function DUF1620 (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.81569|0.81569	0.4850|0.4850	M|M	0.90759|0.90759	3.145|3.145	0.80722|0.80722	D|D	1|1	.|D;D;D;D	.|0.89917	.|1.0;1.0;1.0;1.0	.|D;D;D;D	.|0.91635	.|0.999;0.999;0.999;0.999	D|D	0.84646|0.84646	0.0698|0.0698	6|10	0.10902|0.87932	T|D	0.67|0	.|.	18.679|18.679	0.91540|0.91540	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|860;881;881;882	.|Q8N766-4;Q8N766-2;Q8N766-3;Q8N766	.|.;.;.;K0090_HUMAN	Q|S	114|882;881;860	.|ENSP00000420608:R882S;ENSP00000364345:R881S;ENSP00000364354:R860S	ENSP00000419345:P114Q|ENSP00000364345:R881S	P|R	-|-	2|1	0|0	KIAA0090|KIAA0090	19419873|19419873	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.978000|0.978000	0.69477|0.69477	4.423000|4.423000	0.59861|0.59861	2.750000|2.750000	0.94351|0.94351	0.655000|0.655000	0.94253|0.94253	CCG|CGC	EMC1	-	pfam_DUF1620	ENSG00000127463		0.512	EMC1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EMC1	HGNC	protein_coding	OTTHUMT00000007076.2		0.00	84	0	G	NM_015047		19547286	-1			no_errors	ENST00000477853	ensembl	human	known	74_37	missense	5.41	35	2	SNP	1.000	T
EIF4G3	8672	genome.wustl.edu	37	1	21324111	21324111	+	Intron	SNP	G	G	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr1:21324111G>T	ENST00000264211.8	-	2	225				EIF4G3_ENST00000374937.3_Intron|EIF4G3_ENST00000374935.3_Intron|EIF4G3_ENST00000400422.1_Intron|EIF4G3_ENST00000374927.4_Intron|EIF4G3_ENST00000356916.3_Silent_p.R16R|EIF4G3_ENST00000602326.1_Intron	NM_003760.4	NP_003751.2	O43432	IF4G3_HUMAN	eukaryotic translation initiation factor 4 gamma, 3						cytokine-mediated signaling pathway (GO:0019221)|positive regulation of meiosis I (GO:0060903)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of translation (GO:0045727)|regulation of translational initiation (GO:0006446)|spermatogenesis (GO:0007283)|viral process (GO:0016032)	cytosol (GO:0005829)|eukaryotic translation initiation factor 4F complex (GO:0016281)	poly(A) RNA binding (GO:0044822)|RNA cap binding (GO:0000339)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)			endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(18)|lung(20)|ovary(1)|prostate(4)|skin(3)|stomach(1)|urinary_tract(3)	70		all_lung(284;2.61e-06)|Lung NSC(340;2.81e-06)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00149)|Ovarian(437;0.00338)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.023)|COAD - Colon adenocarcinoma(152;5.42e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000327)|GBM - Glioblastoma multiforme(114;0.000696)|Kidney(64;0.0018)|STAD - Stomach adenocarcinoma(196;0.00644)|KIRC - Kidney renal clear cell carcinoma(64;0.0185)|READ - Rectum adenocarcinoma(331;0.124)|Lung(427;0.191)		TGGGGAGGTCGAGGCCCCGCT	0.453																																																	0																																										SO:0001627	intron_variant	0			AF012072	CCDS214.1, CCDS55580.1, CCDS59192.1, CCDS72723.1	1p36.12	2008-02-05			ENSG00000075151	ENSG00000075151			3298	protein-coding gene	gene with protein product		603929				9418880	Standard	NM_001198801		Approved	eIF4GII	uc001bef.3	O43432	OTTHUMG00000002624	ENST00000264211.8:c.30+5094C>A	1.37:g.21324111G>T			B9EGQ7|Q15597|Q504Z1|Q5SWC3|Q8NEN1	Silent	SNP	NULL	p.R16	ENST00000264211.8	37	c.46	CCDS214.1	1																																																																																			EIF4G3	-	NULL	ENSG00000075151		0.453	EIF4G3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	EIF4G3	HGNC	protein_coding	OTTHUMT00000007467.3		0.00	77	0	G	NM_003760		21324111	-1			no_errors	ENST00000356916	ensembl	human	known	74_37	silent	6.67	56	4	SNP	1.000	T
EML1	2009	genome.wustl.edu	37	14	100361061	100361061	+	Nonsense_Mutation	SNP	G	G	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr14:100361061G>T	ENST00000262233.6	+	6	782	c.643G>T	c.(643-645)Gaa>Taa	p.E215*	EML1_ENST00000327921.9_Nonsense_Mutation_p.E203*|EML1_ENST00000334192.4_Nonsense_Mutation_p.E234*	NM_004434.2	NP_004425.2	O00423	EMAL1_HUMAN	echinoderm microtubule associated protein like 1	215	Tandem atypical propeller in EMLs.				brain development (GO:0007420)|hematopoietic progenitor cell differentiation (GO:0002244)|microtubule cytoskeleton organization (GO:0000226)|mitotic spindle organization (GO:0007052)|neuroblast proliferation (GO:0007405)	cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)	calcium ion binding (GO:0005509)|microtubule binding (GO:0008017)|tubulin binding (GO:0015631)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(9)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	42		Melanoma(154;0.0879)|all_epithelial(191;0.216)				AGCAAAAGTAGAACTTCCAAC	0.398																																																	0													113.0	101.0	105.0					14																	100361061		2203	4300	6503	SO:0001587	stop_gained	0			AK023861	CCDS32154.1, CCDS32155.1	14q32	2013-01-10		2002-02-15		ENSG00000066629		"""WD repeat domain containing"""	3330	protein-coding gene	gene with protein product		602033		EMAPL		9226380, 10521658	Standard	XM_005267397		Approved	EMAP, HuEMAP, ELP79	uc001ygr.3	O00423		ENST00000262233.6:c.643G>T	14.37:g.100361061G>T	ENSP00000262233:p.Glu215*		Q86U15|Q8N536|Q8N5C4|Q8WWL6	Nonsense_Mutation	SNP	pfam_HELP,pfam_WD40_repeat,superfamily_Quinonprotein_ADH-like_supfam,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.E234*	ENST00000262233.6	37	c.700	CCDS32155.1	14	.	.	.	.	.	.	.	.	.	.	G	49	14.958168	0.99817	.	.	ENSG00000066629	ENST00000554479;ENST00000327921;ENST00000262233;ENST00000334192;ENST00000542138;ENST00000556714	.	.	.	5.32	5.32	0.75619	.	0.298968	0.40728	N	0.001038	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.22109	T	0.4	-27.697	18.9766	0.92740	0.0:0.0:1.0:0.0	.	.	.	.	X	202;203;215;234;234;184	.	ENSP00000262233:E215X	E	+	1	0	EML1	99430814	1.000000	0.71417	0.049000	0.19019	0.998000	0.95712	9.869000	0.99810	2.471000	0.83476	0.585000	0.79938	GAA	EML1	-	pfam_HELP,superfamily_Quinonprotein_ADH-like_supfam	ENSG00000066629		0.398	EML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EML1	HGNC	protein_coding	OTTHUMT00000413943.1		0.00	104	0	G	NM_001008707		100361061	+1			no_errors	ENST00000334192	ensembl	human	known	74_37	nonsense	5.00	76	4	SNP	1.000	T
AC018755.1	0	genome.wustl.edu	37	19	52096164	52096164	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr19:52096164G>T	ENST00000301439.3	-	2	569	c.514C>A	c.(514-516)Cct>Act	p.P172T	AC018755.16_ENST00000598755.1_RNA																							GTCTCCTGAGGCTTGGAAGTT	0.557																																																	0																																										SO:0001583	missense	0																														ENST00000301439.3:c.514C>A	19.37:g.52096164G>T	ENSP00000301439:p.Pro172Thr			Missense_Mutation	SNP	NULL	p.P172T	ENST00000301439.3	37	c.514		19	.	.	.	.	.	.	.	.	.	.	G	8.778	0.927449	0.18056	.	.	ENSG00000167765	ENST00000301439	.	.	.	1.9	-0.527	0.11909	.	.	.	.	.	T	0.36771	0.0979	.	.	.	0.09310	N	1	P	0.44659	0.84	P	0.49597	0.616	T	0.27434	-1.0074	7	0.87932	D	0	.	4.2019	0.10471	0.439:0.0:0.561:0.0	.	172	Q96NP5	.	T	172	.	ENSP00000301439:P172T	P	-	1	0	AC018755.11	56787976	0.000000	0.05858	0.001000	0.08648	0.895000	0.52256	-1.306000	0.02735	-0.038000	0.13624	0.395000	0.25975	CCT	AC018755.1	-	NULL	ENSG00000167765		0.557	AC018755.1-201	KNOWN	basic|appris_principal|exp_conf	protein_coding	ENSG00000167765	Clone_based_ensembl_gene	protein_coding		-	0.00	97	0	G			52096164	-1	tier1	-	no_errors	ENST00000301439	ensembl	human	known	74_37	missense	49.09	28	27	SNP	0.001	T
AC007486.1	0	genome.wustl.edu	37	X	120466463	120466463	+	RNA	SNP	C	C	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chrX:120466463C>T	ENST00000390743.2	-	0	29																											tagcaaaaaccacaattactt	0.363																																																	0																																												0																															X.37:g.120466463C>T				RNA	SNP	-	NULL	ENST00000390743.2	37	NULL		X																																																																																			AC007486.1	-	-	ENSG00000212032		0.363	AC007486.1-201	NOVEL	basic	miRNA	ENSG00000212032	Clone_based_ensembl_gene	miRNA		-	0.00	37	0	C			120466463	-1	tier1	-	no_errors	ENST00000390743	ensembl	human	novel	74_37	rna	29.03	22	9	SNP	0.001	T
KIF1C	10749	genome.wustl.edu	37	17	4922558	4922558	+	Intron	SNP	C	C	A			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr17:4922558C>A	ENST00000320785.5	+	19	2023				AC109333.10_ENST00000438266.1_RNA|KIF1C_ENST00000573815.1_Intron	NM_006612.5	NP_006603.2	O43896	KIF1C_HUMAN	kinesin family member 1C						ATP catabolic process (GO:0006200)|cell death (GO:0008219)|cytoskeleton-dependent intracellular transport (GO:0030705)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|motor activity (GO:0003774)|plus-end-directed microtubule motor activity (GO:0008574)|poly(A) RNA binding (GO:0044822)			NS(2)|breast(4)|endometrium(4)|kidney(2)|large_intestine(8)|lung(6)|skin(1)|urinary_tract(3)	30						AACCACTCTTCATTcagactt	0.363																																					Melanoma(96;1023 1447 10250 19259 33730)												0																																										SO:0001627	intron_variant	0			U91329	CCDS11065.1	17p13.2	2014-03-03			ENSG00000129250	ENSG00000129250		"""Kinesins"""	6317	protein-coding gene	gene with protein product		603060	"""spastic ataxia 2 (autosomal recessive)"""	SAX2		9685376, 24319291, 24482476	Standard	NM_006612		Approved	SPAX2, SPG58	uc002gan.2	O43896	OTTHUMG00000099451	ENST00000320785.5:c.1667-733C>A	17.37:g.4922558C>A			D3DTL6|O75186|Q5U618	RNA	SNP	-	NULL	ENST00000320785.5	37	NULL	CCDS11065.1	17																																																																																			AC109333.10	-	-	ENSG00000227495		0.363	KIF1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000227495	Clone_based_vega_gene	protein_coding	OTTHUMT00000216916.1	-	0.00	47	0	C			4922558	-1	tier1	-	no_errors	ENST00000438266	ensembl	human	known	74_37	rna	12.50	21	3	SNP	0.020	A
HDHD2	84064	genome.wustl.edu	37	18	44634276	44634276	+	3'UTR	SNP	T	T	C			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr18:44634276T>C	ENST00000300605.6	-	0	1709				RP11-49K24.8_ENST00000591183.1_RNA|HDHD2_ENST00000587841.1_5'Flank	NM_032124.4	NP_115500.1	Q9H0R4	HDHD2_HUMAN	haloacid dehalogenase-like hydrolase domain containing 2							extracellular vesicular exosome (GO:0070062)	enzyme binding (GO:0019899)|metal ion binding (GO:0046872)			kidney(2)|large_intestine(2)|lung(1)|skin(1)	6						gcactgttcctgttaataaca	0.294																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AL136681	CCDS32829.1	18q21.1	2008-02-05				ENSG00000167220			25364	protein-coding gene	gene with protein product						11230166	Standard	NM_032124		Approved	DKFZP564D1378	uc002lcs.3	Q9H0R4		ENST00000300605.6:c.*777A>G	18.37:g.44634276T>C			A8K7T3|Q96NV4	RNA	SNP	-	NULL	ENST00000300605.6	37	NULL	CCDS32829.1	18																																																																																			RP11-49K24.8	-	-	ENSG00000267724		0.294	HDHD2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ENSG00000267724	Clone_based_vega_gene	protein_coding	OTTHUMT00000450668.2	-	0.00	95	0	T	NM_032124		44634276	+1	tier1	-	no_errors	ENST00000591183	ensembl	human	known	74_37	rna	13.04	40	6	SNP	1.000	C
PARD6G-AS1	100130522	genome.wustl.edu	37	18	77906059	77906059	+	Silent	SNP	G	G	C			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr18:77906059G>C	ENST00000586421.1	+	1	252	c.18G>C	c.(16-18)ctG>ctC	p.L6L	AC139100.2_ENST00000589574.1_Silent_p.L6L|AC139100.2_ENST00000587254.1_Silent_p.L6L|AC139100.2_ENST00000588226.1_Silent_p.L6L|AC139100.2_ENST00000585422.1_Silent_p.L6L																							ctccgaggctgagctccagtt	0.627																																																	0																																										SO:0001819	synonymous_variant	0																														ENST00000586421.1:c.18G>C	18.37:g.77906059G>C				Silent	SNP	NULL	p.L6	ENST00000586421.1	37	c.18		18																																																																																			AC139100.2	-	NULL	ENSG00000267270		0.627	AC139100.2-001	PUTATIVE	basic|exp_conf	protein_coding	ENSG00000267270	Clone_based_vega_gene	protein_coding	OTTHUMT00000451060.1	-	0.00	49	0	G			77906059	+1	tier1	-	no_errors	ENST00000586421	ensembl	human	putative	74_37	silent	29.63	19	8	SNP	0.005	C
CCDC85A	114800	genome.wustl.edu	37	2	56612244	56612244	+	3'UTR	SNP	T	T	A			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr2:56612244T>A	ENST00000407595.2	+	0	2918				RP11-482H16.1_ENST00000607540.1_RNA	NM_001080433.1	NP_001073902.1	Q96PX6	CC85A_HUMAN	coiled-coil domain containing 85A											breast(6)|cervix(2)|endometrium(5)|kidney(1)|lung(18)|ovary(2)|pancreas(1)|prostate(3)	38			LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)			CATACCAACCTTCATATTCAT	0.289																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AB067499	CCDS46290.1	2p16.1	2006-03-29			ENSG00000055813	ENSG00000055813			29400	protein-coding gene	gene with protein product						11572484	Standard	NM_001080433		Approved	KIAA1912	uc002rzn.3	Q96PX6	OTTHUMG00000152033	ENST00000407595.2:c.*754T>A	2.37:g.56612244T>A				RNA	SNP	-	NULL	ENST00000407595.2	37	NULL	CCDS46290.1	2																																																																																			RP11-482H16.1	-	-	ENSG00000271894		0.289	CCDC85A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000271894	Clone_based_vega_gene	protein_coding	OTTHUMT00000324993.1	-	0.00	47	0	T			56612244	+1	tier1	-	no_errors	ENST00000607540	ensembl	human	known	74_37	rna	50.00	6	6	SNP	0.007	A
EPC1	80314	genome.wustl.edu	37	10	32575675	32575675	+	Silent	SNP	G	G	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr10:32575675G>T	ENST00000263062.8	-	9	1607	c.1338C>A	c.(1336-1338)acC>acA	p.T446T	EPC1_ENST00000375110.2_Silent_p.T396T|EPC1_ENST00000319778.6_Silent_p.T446T	NM_025209.2	NP_079485.1	Q9H2F5	EPC1_HUMAN	enhancer of polycomb homolog 1 (Drosophila)	446					chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|negative regulation of gene expression, epigenetic (GO:0045814)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of growth (GO:0040008)|transcription, DNA-templated (GO:0006351)	NuA4 histone acetyltransferase complex (GO:0035267)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Piccolo NuA4 histone acetyltransferase complex (GO:0032777)				breast(2)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(8)|ovary(5)|urinary_tract(1)	24		Prostate(175;0.0199)				TTTGGGGTACGGTGAGAGTAG	0.463																																																	0													119.0	100.0	107.0					10																	32575675		2203	4300	6503	SO:0001819	synonymous_variant	0			AF277374	CCDS7172.1, CCDS60511.1, CCDS73083.1	10p11	2005-12-12			ENSG00000120616	ENSG00000120616			19876	protein-coding gene	gene with protein product		610999				10976108	Standard	NM_025209		Approved	Epl1	uc001iwg.2	Q9H2F5	OTTHUMG00000017925	ENST00000263062.8:c.1338C>A	10.37:g.32575675G>T			B4DSC3|D3DRX7|Q5VW54|Q5VW56|Q5VW58|Q8NAQ4|Q8NE21|Q96LF4|Q96RR6|Q9H7T7	Silent	SNP	pfam_Enhancer_polycomb_C,pfam_Enhancer_polycomb-like_N	p.T446	ENST00000263062.8	37	c.1338	CCDS7172.1	10																																																																																			EPC1	-	NULL	ENSG00000120616		0.463	EPC1-004	KNOWN	basic|CCDS	protein_coding	EPC1	HGNC	protein_coding	OTTHUMT00000047484.1	-	0.00	92	0	G			32575675	-1	tier1	-	no_errors	ENST00000263062	ensembl	human	known	74_37	silent	5.63	67	4	SNP	0.726	T
EPHB4	2050	genome.wustl.edu	37	7	100419977	100419977	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr7:100419977C>A	ENST00000358173.3	-	4	1192	c.724G>T	c.(724-726)Gat>Tat	p.D242Y	EPHB4_ENST00000360620.3_Missense_Mutation_p.D242Y|EPHB4_ENST00000477446.1_5'UTR|RN7SL750P_ENST00000582814.1_RNA	NM_004444.4	NP_004435.3	P54760	EPHB4_HUMAN	EPH receptor B4	242	Cys-rich.				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell migration involved in sprouting angiogenesis (GO:0002042)|ephrin receptor signaling pathway (GO:0048013)|heart morphogenesis (GO:0003007)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein autophosphorylation (GO:0046777)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(1)|central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(7)|lung(20)|ovary(3)|prostate(2)|skin(3)|stomach(3)	47	Lung NSC(181;0.041)|all_lung(186;0.0581)					CACTGGCCATCCTCACGGCAG	0.692																																					GBM(200;2113 3072 25865 52728)												0													9.0	10.0	9.0					7																	100419977		2170	4237	6407	SO:0001583	missense	0			AY056047	CCDS5706.1	7q22	2013-02-11	2004-10-28		ENSG00000196411	ENSG00000196411		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3395	protein-coding gene	gene with protein product		600011	"""EphB4"""	HTK		8188704	Standard	NM_004444		Approved	Tyro11	uc003uwn.1	P54760	OTTHUMG00000157040	ENST00000358173.3:c.724G>T	7.37:g.100419977C>A	ENSP00000350896:p.Asp242Tyr		B5A970|B5A971|B5A972|Q7Z635|Q9BTA5|Q9BXP0	Missense_Mutation	SNP	pirsf_Tyr_kinase_ephrin_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ephrin_rcpt_lig-bd_dom,pfam_Prot_kinase_dom,pfam_Fibronectin_type3,pfam_SAM_type1,pfam_SAM_2,pfam_Tyr-kin_ephrin_A/B_rcpt-like,superfamily_Kinase-like_dom,superfamily_Galactose-bd-like,superfamily_Fibronectin_type3,superfamily_SAM/pointed,superfamily_Growth_fac_rcpt_N_dom,smart_Ephrin_rcpt_lig-bd_dom,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_SAM,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_SAM,pfscan_Prot_kinase_dom	p.D242Y	ENST00000358173.3	37	c.724	CCDS5706.1	7	.	.	.	.	.	.	.	.	.	.	C	19.82	3.897937	0.72639	.	.	ENSG00000196411	ENST00000360620;ENST00000358173	T;T	0.76186	-1.0;-0.99	5.62	5.62	0.85841	Tyrosine-protein kinase, receptor class V, conserved site (1);	0.000000	0.56097	D	0.000031	D	0.86606	0.5973	M	0.78049	2.395	0.80722	D	1	D;P;D;D;D	0.89917	1.0;0.861;1.0;1.0;1.0	D;B;D;D;D	0.91635	0.999;0.361;0.999;0.998;0.999	D	0.87817	0.2635	10	0.87932	D	0	.	17.1367	0.86742	0.0:1.0:0.0:0.0	.	242;242;242;242;242	B5A972;B5A971;B5A970;Q96L35;P54760	.;.;.;.;EPHB4_HUMAN	Y	242	ENSP00000353833:D242Y;ENSP00000350896:D242Y	ENSP00000350896:D242Y	D	-	1	0	EPHB4	100257913	1.000000	0.71417	0.989000	0.46669	0.330000	0.28571	7.818000	0.86416	2.647000	0.89833	0.561000	0.74099	GAT	EPHB4	-	pirsf_Tyr_kinase_ephrin_rcpt	ENSG00000196411		0.692	EPHB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPHB4	HGNC	protein_coding	OTTHUMT00000347222.1	-	0.00	58	0	C	NM_004444		100419977	-1	tier1	-	no_errors	ENST00000358173	ensembl	human	known	74_37	missense	27.78	26	10	SNP	1.000	A
ERVH48-1	90625	genome.wustl.edu	37	21	44338539	44338539	+	lincRNA	SNP	G	G	A			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr21:44338539G>A	ENST00000447535.1	-	0	1163							M5A8F1	SUPYN_HUMAN	endogenous retrovirus group 48, member 1						syncytium formation (GO:0006949)	extracellular space (GO:0005615)											AAGCTCCCCCGCATACCCAAC	0.473																																																	0																																												0			BC005107, CR591419		21q22.3	2011-06-16	2011-05-05	2011-05-05	ENSG00000233056	ENSG00000233056			17216	other	endogenous retrovirus			"""chromosome 21 open reading frame 105"", ""NDUFV3 antisense RNA 1 (non-protein coding)"""	C21orf105, NDUFV3-AS1		21542922	Standard			Approved			M5A8F1	OTTHUMG00000086835		21.37:g.44338539G>A				RNA	SNP	-	NULL	ENST00000447535.1	37	NULL		21																																																																																			ERVH48-1	-	-	ENSG00000233056		0.473	ERVH48-1-001	KNOWN	basic	lincRNA	ERVH48-1	HGNC	lincRNA	OTTHUMT00000195540.1	-	0.00	20	0	G			44338539	-1	tier1	-	no_errors	ENST00000447535	ensembl	human	known	74_37	rna	33.33	6	3	SNP	0.012	A
ERVW-1	30816	genome.wustl.edu	37	7	92098694	92098694	+	Silent	SNP	A	A	G			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr7:92098694A>G	ENST00000493463.2	-	1	1925	c.1002T>C	c.(1000-1002)ggT>ggC	p.G334G	AC007566.10_ENST00000427458.1_RNA|ERVW-1_ENST00000603053.1_Silent_p.G334G|ERVW-1_ENST00000604270.1_Intron	NM_014590.3	NP_055405.3	Q9UQF0	SYCY1_HUMAN	endogenous retrovirus group W, member 1	334	Fusion peptide. {ECO:0000255}.				anatomical structure morphogenesis (GO:0009653)|syncytium formation (GO:0006949)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|viral envelope (GO:0019031)				endometrium(1)|large_intestine(1)|lung(15)	17						caatgccagtacctagtgcac	0.458																																																	0													131.0	134.0	133.0					7																	92098694		2203	4300	6503	SO:0001819	synonymous_variant	0			AF208161	CCDS5626.1	7q21.2	2011-06-16	2011-05-05	2011-05-05	ENSG00000242950	ENSG00000242950			13525	other	endogenous retrovirus	"""envelope protein"", ""HERV-W Env glycoprotein"", ""enverin"", ""syncytin-1"", ""HERV-tryptophan envelope protein"", ""HERV-W{7q21.1} provirus ancestral Env polyprotein"", ""HERV-7q envelope protein"", ""envelope glycoprotein"", ""syncytin"""	604659	"""endogenous retroviral family W, env(C7), member 1"""	ERVWE1		9835022, 9882319, 21542922	Standard	NM_001130925		Approved	HERV-W, HERV-W-ENV, HERVW, HERV-7q	uc022ahe.1	Q9UQF0	OTTHUMG00000131249	ENST00000493463.2:c.1002T>C	7.37:g.92098694A>G			B2RPD4|O95244|O95245|Q8NHY7|Q9NRZ2|Q9NZG3	Silent	SNP	pfam_TLV/ENV_coat_polyprotein	p.G334	ENST00000493463.2	37	c.1002	CCDS5626.1	7																																																																																			ERVW-1	-	pfam_TLV/ENV_coat_polyprotein	ENSG00000242950		0.458	ERVW-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ERVW-1	HGNC	protein_coding	OTTHUMT00000254009.2	-	0.00	72	0	A	NM_014590		92098694	-1	tier1	-	no_errors	ENST00000493463	ensembl	human	known	74_37	silent	44.19	24	19	SNP	0.357	G
ESX1	80712	genome.wustl.edu	37	X	103499092	103499092	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chrX:103499092C>A	ENST00000372588.4	-	2	332	c.249G>T	c.(247-249)gaG>gaT	p.E83D		NM_153448.3	NP_703149.1	Q8N693	ESX1_HUMAN	ESX homeobox 1	83					labyrinthine layer blood vessel development (GO:0060716)|labyrinthine layer morphogenesis (GO:0060713)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of cell cycle (GO:0051726)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding (GO:0043565)			endometrium(2)|large_intestine(10)|lung(12)|ovary(1)|skin(2)	27						CCTGCTGTTGCTCCGGCTCGT	0.662																																					Pancreas(200;1705 2227 25194 28471 45274)												0													60.0	69.0	66.0					X																	103499092		2192	4233	6425	SO:0001583	missense	0			AL049631	CCDS14516.1	Xq22.2	2011-06-20	2007-07-11	2006-02-08	ENSG00000123576	ENSG00000123576		"""Homeoboxes / PRD class"""	14865	protein-coding gene	gene with protein product		300154	"""extraembryonic, spermatogenesis, homeobox 1 homolog (mouse)"""	ESX1L		11374906, 17242862	Standard	NM_153448		Approved	ESXR1	uc004ely.3	Q8N693	OTTHUMG00000022125	ENST00000372588.4:c.249G>T	X.37:g.103499092C>A	ENSP00000361669:p.Glu83Asp		B0QYU3|Q7Z6K7	Missense_Mutation	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom,prints_POU	p.E83D	ENST00000372588.4	37	c.249	CCDS14516.1	X	.	.	.	.	.	.	.	.	.	.	c	10.52	1.372695	0.24857	.	.	ENSG00000123576	ENST00000372588	D	0.91011	-2.77	2.54	0.709	0.18150	.	.	.	.	.	T	0.75627	0.3875	N	0.08118	0	0.09310	N	1	B	0.23058	0.079	B	0.14578	0.011	T	0.60752	-0.7201	9	0.14252	T	0.57	0.6192	6.0921	0.20001	0.0:0.7002:0.0:0.2998	.	83	Q8N693	ESX1_HUMAN	D	83	ENSP00000361669:E83D	ENSP00000361669:E83D	E	-	3	2	ESX1	103385748	0.009000	0.17119	0.000000	0.03702	0.006000	0.05464	0.140000	0.16056	0.078000	0.16900	-0.467000	0.05162	GAG	ESX1	-	NULL	ENSG00000123576		0.662	ESX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ESX1	HGNC	protein_coding	OTTHUMT00000057763.2		0.00	14	0	C	NM_153448		103499092	-1			no_errors	ENST00000372588	ensembl	human	known	74_37	missense	25.00	9	3	SNP	0.000	A
ESYT3	83850	genome.wustl.edu	37	3	138191476	138191476	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr3:138191476G>T	ENST00000389567.4	+	18	2198	c.2012G>T	c.(2011-2013)aGt>aTt	p.S671I		NM_031913.3	NP_114119.2	A0FGR9	ESYT3_HUMAN	extended synaptotagmin-like protein 3	671					lipid transport (GO:0006869)	extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|integral component of plasma membrane (GO:0005887)|intrinsic component of endoplasmic reticulum membrane (GO:0031227)|organelle membrane contact site (GO:0044232)	lipid binding (GO:0008289)|metal ion binding (GO:0046872)			breast(1)|endometrium(5)|large_intestine(7)|lung(9)|prostate(1)|skin(1)|urinary_tract(1)	25						GGCAAGGACAGTGCCAAAAGG	0.582																																																	0													118.0	138.0	132.0					3																	138191476		2123	4229	6352	SO:0001583	missense	0			AJ303366	CCDS3101.2	3q22.3	2014-07-02	2009-06-23	2009-06-23	ENSG00000158220	ENSG00000158220		"""Synaptotagmins"""	24295	protein-coding gene	gene with protein product			"""family with sequence similarity 62 (C2 domain containing), member C"""	FAM62C		11543631, 17672888	Standard	NM_031913		Approved	CHR3SYT	uc003esk.3	A0FGR9	OTTHUMG00000147354	ENST00000389567.4:c.2012G>T	3.37:g.138191476G>T	ENSP00000374218:p.Ser671Ile		A8K0G5|Q6ZV21|Q8NDZ5|Q9BQR9	Missense_Mutation	SNP	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,prints_C2_dom,pfscan_C2_dom	p.S671I	ENST00000389567.4	37	c.2012	CCDS3101.2	3	.	.	.	.	.	.	.	.	.	.	G	13.68	2.309905	0.40895	.	.	ENSG00000158220	ENST00000389567	T	0.43294	0.95	4.63	1.84	0.25277	.	0.747636	0.12671	N	0.448796	T	0.35068	0.0919	L	0.51422	1.61	0.80722	D	1	P	0.37864	0.61	B	0.38106	0.265	T	0.06516	-1.0822	10	0.41790	T	0.15	-29.5187	6.5078	0.22204	0.1727:0.1482:0.679:0.0	.	671	A0FGR9	ESYT3_HUMAN	I	671	ENSP00000374218:S671I	ENSP00000374218:S671I	S	+	2	0	ESYT3	139674166	0.995000	0.38212	0.989000	0.46669	0.971000	0.66376	0.475000	0.22164	0.191000	0.20236	-0.448000	0.05591	AGT	ESYT3	-	NULL	ENSG00000158220		0.582	ESYT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ESYT3	HGNC	protein_coding	OTTHUMT00000303993.1	-	0.00	61	0	G	NM_031913		138191476	+1	tier1	-	no_errors	ENST00000389567	ensembl	human	known	74_37	missense	10.26	35	4	SNP	0.999	T
FAM184A	79632	genome.wustl.edu	37	6	119345270	119345270	+	Nonsense_Mutation	SNP	C	C	A			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr6:119345270C>A	ENST00000338891.7	-	2	1311	c.868G>T	c.(868-870)Gaa>Taa	p.E290*	RP11-351A11.1_ENST00000518570.1_RNA|FAM184A_ENST00000352896.5_Nonsense_Mutation_p.E170*|FAM184A_ENST00000368475.4_Nonsense_Mutation_p.E170*|FAM184A_ENST00000522284.1_Nonsense_Mutation_p.E170*|FAM184A_ENST00000521531.1_Nonsense_Mutation_p.E290*	NM_024581.4	NP_078857.5	Q8NB25	F184A_HUMAN	family with sequence similarity 184, member A	290						extracellular space (GO:0005615)		p.E290K(1)		breast(2)|central_nervous_system(2)|endometrium(2)|kidney(5)|large_intestine(19)|lung(13)|ovary(2)|pancreas(1)|prostate(1)|skin(5)	52						CCCTGAAATTCTTTTCTAAGA	0.378																																																	1	Substitution - Missense(1)	skin(1)											104.0	98.0	100.0					6																	119345270		1816	4072	5888	SO:0001587	stop_gained	0			BC009055	CCDS43499.1, CCDS43500.1, CCDS75508.1	6q22.31	2008-08-14	2008-08-14	2008-08-14	ENSG00000111879	ENSG00000111879			20991	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 60"""	C6orf60		11230166	Standard	NM_024581		Approved	FLJ13942	uc003pyj.3	Q8NB25	OTTHUMG00000015471	ENST00000338891.7:c.868G>T	6.37:g.119345270C>A	ENSP00000342604:p.Glu290*		B9DI75|F8W8D6|Q5TBS9|Q7Z323|Q96GY8|Q9H0J8|Q9H851	Nonsense_Mutation	SNP	superfamily_Prefoldin	p.E290*	ENST00000338891.7	37	c.868	CCDS43499.1	6	.	.	.	.	.	.	.	.	.	.	C	27.6	4.842582	0.91197	.	.	ENSG00000111879	ENST00000338891;ENST00000352896;ENST00000368475;ENST00000521531;ENST00000522284	.	.	.	5.04	5.04	0.67666	.	0.051515	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.38643	T	0.18	-16.1661	18.7409	0.91773	0.0:1.0:0.0:0.0	.	.	.	.	X	290;170;170;290;170	.	ENSP00000342604:E290X	E	-	1	0	FAM184A	119386969	1.000000	0.71417	1.000000	0.80357	0.164000	0.22412	7.189000	0.77747	2.506000	0.84524	0.460000	0.39030	GAA	FAM184A	-	NULL	ENSG00000111879		0.378	FAM184A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM184A	HGNC	protein_coding	OTTHUMT00000042009.3		0.00	70	0	C	NM_024581		119345270	-1			no_errors	ENST00000338891	ensembl	human	known	74_37	nonsense	6.25	30	2	SNP	1.000	A
FAM230C	26080	genome.wustl.edu	37	22	21663201	21663201	+	lincRNA	SNP	A	A	G			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr22:21663201A>G	ENST00000436681.1	-	0	969																											GATGCCCTGGACGGCGTCCTC	0.721																																																	0																																												0																															22.37:g.21663201A>G				RNA	SNP	-	NULL	ENST00000436681.1	37	NULL		22																																																																																			KB-1183D5.13	-	-	ENSG00000206142		0.721	KB-1183D5.13-003	KNOWN	basic	lincRNA	FAM230C	Clone_based_vega_gene	lincRNA	OTTHUMT00000320109.1	-	0.00	8	0	A			21663201	-1	tier1	-	no_errors	ENST00000436681	ensembl	human	known	74_37	rna	44.44	5	4	SNP	0.096	G
FANCD2	2177	genome.wustl.edu	37	3	10108913	10108913	+	Missense_Mutation	SNP	G	G	T	rs80258959		TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr3:10108913G>T	ENST00000419585.1	+	26	2567	c.2406G>T	c.(2404-2406)caG>caT	p.Q802H	FANCD2_ENST00000383807.1_Missense_Mutation_p.Q802H|FANCD2_ENST00000287647.3_Missense_Mutation_p.Q802H|FANCD2_ENST00000383806.1_Missense_Mutation_p.Q802H			Q9BXW9	FACD2_HUMAN	Fanconi anemia, complementation group D2	802					DNA repair (GO:0006281)|gamete generation (GO:0007276)|response to gamma radiation (GO:0010332)|synapsis (GO:0007129)	condensed chromosome (GO:0000793)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA polymerase binding (GO:0070182)	p.Q802H(2)		NS(1)|breast(3)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(10)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	51				OV - Ovarian serous cystadenocarcinoma(96;0.148)		CCTTCTGCCAGGAAACATCAC	0.378			"""D, Mis, N, F"""			"""AML, leukemia"""		Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																														yes	Rec		Fanconi anaemia D2	3	3p26	2177	"""Fanconi anemia, complementation group D2"""		L	2	Substitution - Missense(2)	prostate(2)											82.0	72.0	75.0					3																	10108913		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	AF340183	CCDS2595.1, CCDS33696.1	3p25.3	2014-09-17		2001-10-05	ENSG00000144554	ENSG00000144554		"""Fanconi anemia, complementation groups"""	3585	protein-coding gene	gene with protein product		613984		FACD, FANCD		7581463, 11239453, 18475298	Standard	XM_005264946		Approved	FAD, FA-D2	uc003buw.3	Q9BXW9	OTTHUMG00000128670	ENST00000419585.1:c.2406G>T	3.37:g.10108913G>T	ENSP00000398754:p.Gln802His		Q2LA86|Q69YP9|Q6PJN7|Q9BQ06|Q9H9T9	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.Q802H	ENST00000419585.1	37	c.2406	CCDS33696.1	3	.	.	.	.	.	.	.	.	.	.	G	17.37	3.373535	0.61624	.	.	ENSG00000144554	ENST00000287647;ENST00000383807;ENST00000383806;ENST00000419585	T;T;T;T	0.52983	0.64;0.64;0.64;0.64	5.44	1.83	0.25207	.	0.551240	0.20789	N	0.085651	T	0.50240	0.1604	M	0.63428	1.95	0.30837	N	0.736052	P;P	0.50710	0.938;0.938	P;P	0.53988	0.739;0.739	T	0.53229	-0.8468	10	0.54805	T	0.06	.	3.6289	0.08124	0.3156:0.0:0.4962:0.1881	.	802;802	Q9BXW9-2;Q9BXW9	.;FACD2_HUMAN	H	802	ENSP00000287647:Q802H;ENSP00000373318:Q802H;ENSP00000373317:Q802H;ENSP00000398754:Q802H	ENSP00000287647:Q802H	Q	+	3	2	FANCD2	10083913	0.804000	0.28969	0.409000	0.26459	0.904000	0.53231	1.055000	0.30467	0.519000	0.28406	0.585000	0.79938	CAG	FANCD2	-	NULL	ENSG00000144554		0.378	FANCD2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	FANCD2	HGNC	protein_coding	OTTHUMT00000339873.1		0.00	56	0	G			10108913	+1			no_errors	ENST00000287647	ensembl	human	known	74_37	missense	7.14	26	2	SNP	0.852	T
FARP1	10160	genome.wustl.edu	37	13	99063029	99063029	+	Silent	SNP	G	G	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr13:99063029G>T	ENST00000319562.6	+	15	1909	c.1644G>T	c.(1642-1644)gtG>gtT	p.V548V	FARP1_ENST00000595437.1_Silent_p.V548V|FARP1_ENST00000376586.2_Silent_p.V548V	NM_005766.2	NP_005757.1	Q9Y4F1	FARP1_HUMAN	FERM, RhoGEF (ARHGEF) and pleckstrin domain protein 1 (chondrocyte-derived)	548	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				dendrite morphogenesis (GO:0048813)|negative regulation of phosphatase activity (GO:0010923)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|synapse assembly (GO:0007416)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite (GO:0030425)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|synapse (GO:0045202)	Rac guanyl-nucleotide exchange factor activity (GO:0030676)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(3)|endometrium(6)|kidney(6)|large_intestine(13)|lung(16)|ovary(1)|skin(3)|urinary_tract(1)	49	all_neural(89;0.0982)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)		BRCA - Breast invasive adenocarcinoma(86;0.233)			CTAAGGAAGTGTCTACCACCG	0.408																																																	0													140.0	119.0	126.0					13																	99063029		2203	4300	6503	SO:0001819	synonymous_variant	0			AB008430	CCDS9487.1, CCDS32000.1, CCDS66572.1	13q32.2	2013-01-10			ENSG00000152767	ENSG00000152767		"""Rho guanine nucleotide exchange factors"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Pleckstrin homology (PH) domain containing"""	3591	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 75"""	602654				9425278	Standard	NM_005766		Approved	CDEP, PLEKHC2, MGC87400, PPP1R75	uc001vnj.3	Q9Y4F1	OTTHUMG00000017248	ENST00000319562.6:c.1644G>T	13.37:g.99063029G>T			Q5JVI9|Q6IQ29	Silent	SNP	pfam_DH-domain,pfam_Pleckstrin_homology,pfam_FERM_PH-like_C,pfam_FERM_N,pfam_FERM-adjacent,pfam_FERM_central,superfamily_DH-domain,superfamily_FERM_central,smart_Band_41_domain,smart_DH-domain,smart_Pleckstrin_homology,pfscan_FERM_domain,pfscan_Pleckstrin_homology,pfscan_DH-domain,prints_Band_41_fam,prints_Ez/rad/moesin_like	p.V548	ENST00000319562.6	37	c.1644	CCDS9487.1	13	.	.	.	.	.	.	.	.	.	.	G	0.242	-1.012680	0.02095	.	.	ENSG00000152767	ENST00000457029	.	.	.	5.79	-11.6	0.00059	.	.	.	.	.	T	0.40815	0.1132	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.52646	-0.8548	4	.	.	.	.	5.2672	0.15605	0.1106:0.3277:0.3776:0.1841	.	.	.	.	F	77	.	.	C	+	2	0	FARP1	97861030	0.001000	0.12720	0.068000	0.19968	0.027000	0.11550	-1.782000	0.01772	-3.425000	0.00166	-0.302000	0.09304	TGT	FARP1	-	pfam_DH-domain,superfamily_DH-domain,smart_DH-domain,pfscan_DH-domain	ENSG00000152767		0.408	FARP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FARP1	HGNC	protein_coding	OTTHUMT00000045541.3	-	0.00	65	0	G	NM_005766		99063029	+1	tier1	-	no_errors	ENST00000376586	ensembl	human	known	74_37	silent	8.51	43	4	SNP	0.023	T
FAT4	79633	genome.wustl.edu	37	4	126336313	126336313	+	Silent	SNP	T	T	C			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr4:126336313T>C	ENST00000394329.3	+	5	6208	c.6195T>C	c.(6193-6195)atT>atC	p.I2065I	FAT4_ENST00000335110.5_Silent_p.I363I	NM_024582.4	NP_078858.4	Q6V0I7	FAT4_HUMAN	FAT atypical cadherin 4	2065	Cadherin 20. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|cerebral cortex development (GO:0021987)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|inner ear receptor stereocilium organization (GO:0060122)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|plasma membrane organization (GO:0007009)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(93)|liver(3)|lung(120)|ovary(9)|pancreas(2)|prostate(21)|skin(31)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(6)	355						ATACACCTATTGATACTGTTG	0.398																																																	0													144.0	146.0	145.0					4																	126336313		2203	4300	6503	SO:0001819	synonymous_variant	0			AY356402	CCDS3732.3	4q28.1	2013-05-31	2013-05-31		ENSG00000196159	ENSG00000196159		"""Cadherins / Cadherin-related"""	23109	protein-coding gene	gene with protein product	"""cadherin-related family member 11"""	612411	"""FAT tumor suppressor homolog 4 (Drosophila)"""			15003449	Standard	NM_024582		Approved	CDHF14, FAT-J, CDHR11	uc003ifj.4	Q6V0I7	OTTHUMG00000133100	ENST00000394329.3:c.6195T>C	4.37:g.126336313T>C			A8K5Z6|B5MDG4|Q3LIA6|Q8TCK7|Q9H5T6	Silent	SNP	pfam_Cadherin,pfam_Laminin_G,pfam_EG-like_dom,pfam_EGF-like_Ca-bd_dom,superfamily_Cadherin-like,superfamily_ConA-like_lec_gl_sf,smart_Cadherin,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_Laminin_G,pfscan_EG-like_dom,pfscan_Laminin_G,pfscan_Cadherin,prints_Cadherin	p.I2065	ENST00000394329.3	37	c.6195	CCDS3732.3	4																																																																																			FAT4	-	pfam_Cadherin,superfamily_Cadherin-like,pfscan_Cadherin	ENSG00000196159		0.398	FAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAT4	HGNC	protein_coding	OTTHUMT00000256765.2	-	0.00	59	0	T	NM_024582		126336313	+1	tier1	-	no_errors	ENST00000394329	ensembl	human	known	74_37	silent	26.92	19	7	SNP	0.874	C
FBXO15	201456	genome.wustl.edu	37	18	71740731	71740731	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr18:71740731C>T	ENST00000419743.2	-	10	1577	c.1498G>A	c.(1498-1500)Gca>Aca	p.A500T	FBXO15_ENST00000269500.5_Missense_Mutation_p.A424T|FBXO15_ENST00000580806.1_5'UTR	NM_001142958.1	NP_001136430.1	Q8NCQ5	FBX15_HUMAN	F-box protein 15	500						SCF ubiquitin ligase complex (GO:0019005)		p.A424T(1)		autonomic_ganglia(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(8)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(2)	27		Esophageal squamous(42;0.103)|Prostate(75;0.173)		BRCA - Breast invasive adenocarcinoma(31;0.143)		TTGATTTTTGCGATACTAAGA	0.408																																																	1	Substitution - Missense(1)	large_intestine(1)											166.0	164.0	165.0					18																	71740731		2203	4300	6503	SO:0001583	missense	0			AK094215	CCDS45884.1	18q22.3	2006-03-09	2004-06-15		ENSG00000141665	ENSG00000141665		"""F-boxes /  ""other"""""	13617	protein-coding gene	gene with protein product		609093	"""F-box only protein 15"""			12665572	Standard	NM_152676		Approved	MGC39671, FBX15	uc002llf.2	Q8NCQ5	OTTHUMG00000132842	ENST00000419743.2:c.1498G>A	18.37:g.71740731C>T	ENSP00000393154:p.Ala500Thr		B3KST3	Missense_Mutation	SNP	pfam_F-box_dom,superfamily_F-box_dom,smart_F-box_dom,pfscan_F-box_dom	p.A500T	ENST00000419743.2	37	c.1498	CCDS45884.1	18	.	.	.	.	.	.	.	.	.	.	c	9.804	1.181231	0.21787	.	.	ENSG00000141665	ENST00000269500;ENST00000419743	T;T	0.42131	0.98;0.98	5.78	3.05	0.35203	.	0.532611	0.21485	N	0.073761	T	0.35219	0.0924	L	0.59436	1.845	0.09310	N	1	B;B	0.22480	0.07;0.041	B;B	0.13407	0.009;0.003	T	0.30268	-0.9984	10	0.52906	T	0.07	-25.1684	6.7033	0.23236	0.0:0.6066:0.1229:0.2705	.	500;424	B3KST3;Q8NCQ5	.;FBX15_HUMAN	T	424;500	ENSP00000269500:A424T;ENSP00000393154:A500T	ENSP00000269500:A424T	A	-	1	0	FBXO15	69891711	0.000000	0.05858	0.006000	0.13384	0.113000	0.19764	0.112000	0.15479	0.810000	0.34279	0.651000	0.88453	GCA	FBXO15	-	NULL	ENSG00000141665		0.408	FBXO15-002	KNOWN	basic|CCDS	protein_coding	FBXO15	HGNC	protein_coding	OTTHUMT00000444223.1	-	0.00	69	0	C	NM_152676		71740731	-1	tier1	-	no_errors	ENST00000419743	ensembl	human	known	74_37	missense	17.86	23	5	SNP	0.008	T
FDFT1	2222	genome.wustl.edu	37	8	11666396	11666396	+	Missense_Mutation	SNP	A	A	G			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr8:11666396A>G	ENST00000220584.4	+	2	415	c.193A>G	c.(193-195)Atg>Gtg	p.M65V	FDFT1_ENST00000443614.2_Missense_Mutation_p.M65V|FDFT1_ENST00000525900.1_Missense_Mutation_p.M58V|FDFT1_ENST00000446331.2_Intron|FDFT1_ENST00000528812.1_Start_Codon_SNP_p.M1V|FDFT1_ENST00000525777.1_5'Flank|FDFT1_ENST00000538689.1_5'UTR|FDFT1_ENST00000530664.1_Start_Codon_SNP_p.M1V|FDFT1_ENST00000528643.1_5'Flank	NM_004462.3	NP_004453.3	P37268	FDFT_HUMAN	farnesyl-diphosphate farnesyltransferase 1	65					cellular lipid metabolic process (GO:0044255)|cholesterol biosynthetic process (GO:0006695)|isoprenoid biosynthetic process (GO:0008299)|small molecule metabolic process (GO:0044281)|steroid biosynthetic process (GO:0006694)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	farnesyl-diphosphate farnesyltransferase activity (GO:0004310)|oxidoreductase activity (GO:0016491)|squalene synthase activity (GO:0051996)			breast(1)|endometrium(1)|large_intestine(3)|lung(2)|prostate(1)|stomach(2)|upper_aerodigestive_tract(2)	12	all_epithelial(15;0.234)		STAD - Stomach adenocarcinoma(15;0.00225)	COAD - Colon adenocarcinoma(149;0.18)		GGATGGGGAAATGCGGTGAGT	0.547																																																	0													61.0	53.0	55.0					8																	11666396		2203	4300	6503	SO:0001583	missense	0			X69141	CCDS5985.1, CCDS75696.1, CCDS75697.1	8p23.1-p22	2005-03-07			ENSG00000079459	ENSG00000079459	2.5.1.21		3629	protein-coding gene	gene with protein product	"""squalene synthase"""	184420					Standard	NM_001287742		Approved		uc003wui.3	P37268	OTTHUMG00000090801	ENST00000220584.4:c.193A>G	8.37:g.11666396A>G	ENSP00000220584:p.Met65Val		B3KQ95|B4DJE5|B4DT56|B7Z1J3|Q96GT0	Missense_Mutation	SNP	pfam_Squ/phyt_synthse,superfamily_Terpenoid_synth,tigrfam_Squal_synth	p.M65V	ENST00000220584.4	37	c.193	CCDS5985.1	8	.	.	.	.	.	.	.	.	.	.	A	15.50	2.852858	0.51270	.	.	ENSG00000079459	ENST00000530337;ENST00000220584;ENST00000443614;ENST00000525900;ENST00000528812;ENST00000530664	T;T;T;T;T;T	0.81330	-1.48;-1.48;-1.48;-1.48;-1.48;-1.48	4.83	2.33	0.28932	Terpenoid synthase (2);	0.185499	0.49305	D	0.000143	T	0.60483	0.2272	N	0.11427	0.14	0.80722	D	1	B;B;B;B	0.09022	0.0;0.002;0.0;0.0	B;B;B;B	0.11329	0.0;0.006;0.001;0.001	T	0.55496	-0.8132	10	0.62326	D	0.03	-11.4684	6.2273	0.20716	0.4321:0.4319:0.0:0.136	.	65;122;58;65	B4DJE5;B4DND3;E9PNM1;P37268	.;.;.;FDFT_HUMAN	V	65;65;65;58;1;1	ENSP00000431852:M65V;ENSP00000220584:M65V;ENSP00000390367:M65V;ENSP00000434714:M58V;ENSP00000431749:M1V;ENSP00000432331:M1V	ENSP00000220584:M65V	M	+	1	0	FDFT1	11703805	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	2.570000	0.45981	0.839000	0.34971	0.454000	0.30748	ATG	FDFT1	-	pfam_Squ/phyt_synthse,superfamily_Terpenoid_synth,tigrfam_Squal_synth	ENSG00000079459		0.547	FDFT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FDFT1	HGNC	protein_coding	OTTHUMT00000207588.2		0.00	54	0	A			11666396	+1			no_errors	ENST00000220584	ensembl	human	known	74_37	missense	22.73	17	5	SNP	1.000	G
FER1L6	654463	genome.wustl.edu	37	8	125115512	125115512	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr8:125115512C>A	ENST00000522917.1	+	39	5457	c.5251C>A	c.(5251-5253)Cgt>Agt	p.R1751S	FER1L6_ENST00000399018.1_Missense_Mutation_p.R1751S|FER1L6-AS2_ENST00000520031.1_RNA	NM_001039112.2	NP_001034201.2	Q2WGJ9	FR1L6_HUMAN	fer-1-like family member 6	1751						integral component of membrane (GO:0016021)				NS(2)|breast(3)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(18)|liver(1)|lung(49)|ovary(5)|prostate(3)|skin(8)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(1)	118	Lung NSC(37;4.1e-12)|Ovarian(258;0.00438)|all_neural(195;0.0741)		STAD - Stomach adenocarcinoma(47;0.00186)			AAAACGTGTGCGTGGCTGGTG	0.483																																																	0													141.0	137.0	139.0					8																	125115512		1926	4151	6077	SO:0001583	missense	0			AB196633	CCDS43767.1	8q24.13	2014-06-27	2014-06-27		ENSG00000214814	ENSG00000214814			28065	protein-coding gene	gene with protein product			"""fer-1-like 6 (C. elegans)"""				Standard	NM_001039112		Approved	C8ORFK23	uc003yqw.3	Q2WGJ9	OTTHUMG00000164998	ENST00000522917.1:c.5251C>A	8.37:g.125115512C>A	ENSP00000428280:p.Arg1751Ser			Missense_Mutation	SNP	pfam_C2_dom,pfam_Ferlin_B-domain,pfam_FerIin-domain,superfamily_C2_dom,superfamily_ABC1_TM_dom,smart_C2_dom,pfscan_C2_dom	p.R1751S	ENST00000522917.1	37	c.5251	CCDS43767.1	8	.	.	.	.	.	.	.	.	.	.	C	20.1	3.937692	0.73557	.	.	ENSG00000214814	ENST00000522917;ENST00000399018	D;D	0.81996	-1.56;-1.56	5.58	3.5	0.40072	.	0.056479	0.64402	U	0.000002	D	0.90679	0.7076	M	0.83223	2.63	0.45035	D	0.998057	D	0.89917	1.0	D	0.77557	0.99	D	0.92007	0.5615	10	0.72032	D	0.01	-19.1959	13.5565	0.61761	0.3859:0.6141:0.0:0.0	.	1751	Q2WGJ9	FR1L6_HUMAN	S	1751	ENSP00000428280:R1751S;ENSP00000381982:R1751S	ENSP00000381982:R1751S	R	+	1	0	FER1L6	125184693	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.088000	0.50175	1.475000	0.48197	0.655000	0.94253	CGT	FER1L6	-	NULL	ENSG00000214814		0.483	FER1L6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FER1L6	HGNC	protein_coding	OTTHUMT00000381400.1		0.00	67	0	C	NM_001039112		125115512	+1			no_errors	ENST00000399018	ensembl	human	known	74_37	missense	7.02	52	4	SNP	0.999	A
FHOD1	29109	genome.wustl.edu	37	16	67265688	67265688	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr16:67265688C>T	ENST00000258201.4	-	15	2484	c.2237G>A	c.(2236-2238)cGg>cAg	p.R746Q		NM_013241.2	NP_037373.2	Q9Y613	FHOD1_HUMAN	formin homology 2 domain containing 1	746	FH2. {ECO:0000255|PROSITE- ProRule:PRU00774}.|Interaction with ROCK1.				positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|membrane (GO:0016020)|nucleus (GO:0005634)	identical protein binding (GO:0042802)			breast(4)|endometrium(3)|kidney(3)|large_intestine(5)|lung(7)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	34		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.000691)|Epithelial(162;0.00462)|all cancers(182;0.0434)		AATCTTCTGCCGCTCTTCCTC	0.602																																																	0													69.0	65.0	66.0					16																	67265688		2198	4300	6498	SO:0001583	missense	0			AF113615	CCDS10834.1	16q22	2008-02-22			ENSG00000135723	ENSG00000135723			17905	protein-coding gene	gene with protein product		606881				10352228, 16112087	Standard	NM_013241		Approved	FHOS	uc002esl.3	Q9Y613	OTTHUMG00000137521	ENST00000258201.4:c.2237G>A	16.37:g.67265688C>T	ENSP00000258201:p.Arg746Gln		Q59F76|Q6Y1F2|Q76MS8|Q8N521	Missense_Mutation	SNP	pfam_FH2_Formin,superfamily_ARM-type_fold,smart_FH2_Formin	p.R746Q	ENST00000258201.4	37	c.2237	CCDS10834.1	16	.	.	.	.	.	.	.	.	.	.	C	20.5	4.002808	0.74932	.	.	ENSG00000135723	ENST00000258201	T	0.16897	2.31	5.45	-3.86	0.04230	Actin-binding FH2/DRF autoregulatory (1);Actin-binding FH2 (3);	0.457276	0.25101	N	0.033136	T	0.08891	0.0220	N	0.19112	0.55	0.31431	N	0.673073	B	0.10296	0.003	B	0.13407	0.009	T	0.18085	-1.0348	10	0.29301	T	0.29	.	11.622	0.51124	0.0:0.3745:0.0:0.6255	.	746	Q9Y613	FHOD1_HUMAN	Q	746	ENSP00000258201:R746Q	ENSP00000258201:R746Q	R	-	2	0	FHOD1	65823189	1.000000	0.71417	0.211000	0.23655	0.759000	0.43091	1.328000	0.33758	-0.449000	0.07117	-1.152000	0.01820	CGG	FHOD1	-	pfam_FH2_Formin,smart_FH2_Formin	ENSG00000135723		0.602	FHOD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FHOD1	HGNC	protein_coding	OTTHUMT00000268844.2	-	0.00	40	0	C			67265688	-1	tier1	-	no_errors	ENST00000258201	ensembl	human	known	74_37	missense	34.62	17	9	SNP	0.972	T
FOXP2	93986	genome.wustl.edu	37	7	114269985	114269985	+	Silent	SNP	A	A	G	rs368614280		TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr7:114269985A>G	ENST00000393494.2	+	5	801	c.522A>G	c.(520-522)caA>caG	p.Q174Q	FOXP2_ENST00000393489.3_Silent_p.Q82Q|FOXP2_ENST00000408937.3_Silent_p.Q199Q|FOXP2_ENST00000390668.3_Silent_p.Q198Q|FOXP2_ENST00000403559.4_Silent_p.Q191Q|AC020606.1_ENST00000580664.1_RNA|FOXP2_ENST00000393498.2_Silent_p.Q154Q|FOXP2_ENST00000378237.3_Silent_p.Q174Q|FOXP2_ENST00000360232.4_Silent_p.Q174Q|FOXP2_ENST00000393500.3_Silent_p.Q99Q|FOXP2_ENST00000350908.4_Silent_p.Q174Q|FOXP2_ENST00000393491.3_Silent_p.Q82Q			O15409	FOXP2_HUMAN	forkhead box P2	174	Gln-rich.				camera-type eye development (GO:0043010)|caudate nucleus development (GO:0021757)|cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|growth (GO:0040007)|lung alveolus development (GO:0048286)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of epithelial cell proliferation involved in lung morphogenesis (GO:0060501)|positive regulation of mesenchymal cell proliferation (GO:0002053)|post-embryonic development (GO:0009791)|putamen development (GO:0021758)|righting reflex (GO:0060013)|skeletal muscle tissue development (GO:0007519)|smooth muscle tissue development (GO:0048745)|vocal learning (GO:0042297)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.Q199Q(1)		breast(3)|endometrium(7)|kidney(4)|large_intestine(7)|lung(22)|ovary(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	52						aacaacaacaacagcagcaac	0.502																																																	1	Substitution - coding silent(1)	endometrium(1)						G	,,,,,	0,4398		0,0,2199	39.0	36.0	37.0		522,597,522,597,522,573	-1.2	1.0	7		37	1,8583		0,1,4291	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	FOXP2	NM_001172766.2,NM_001172767.2,NM_014491.3,NM_148898.3,NM_148899.3,NM_148900.3	,,,,,	0,1,6490	GG,GA,AA		0.0116,0.0,0.0077	,,,,,	174/715,199/458,174/716,199/741,174/433,191/733	114269985	1,12981	2199	4292	6491	SO:0001819	synonymous_variant	0			U80741	CCDS5760.1, CCDS5761.1, CCDS43635.1, CCDS5761.2, CCDS55154.1	7q31	2008-07-18			ENSG00000128573	ENSG00000128573		"""Forkhead boxes"""	13875	protein-coding gene	gene with protein product	"""trinucleotide repeat containing 10"", ""forkhead/winged-helix transcription factor"", ""speech and language disorder 1"", ""CAG repeat protein 44"""	605317		TNRC10, SPCH1		11586359, 9225980	Standard	NM_014491		Approved	CAGH44	uc003vgz.3	O15409	OTTHUMG00000023131	ENST00000393494.2:c.522A>G	7.37:g.114269985A>G			A0AUV6|A4D0U8|A6NNW4|B4DLD9|Q6ZND1|Q75MJ3|Q8IZE0|Q8N0W2|Q8N6B7|Q8N6B8|Q8NFQ1|Q8NFQ2|Q8NFQ3|Q8NFQ4|Q8TD74	Silent	SNP	pfam_TF_fork_head,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head	p.Q199	ENST00000393494.2	37	c.597	CCDS5760.1	7																																																																																			FOXP2	-	NULL	ENSG00000128573		0.502	FOXP2-014	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	FOXP2	HGNC	protein_coding	OTTHUMT00000317366.1		0.00	45	0	A	NM_014491		114269985	+1			no_errors	ENST00000408937	ensembl	human	known	74_37	silent	11.76	15	2	SNP	0.894	G
GAB4	128954	genome.wustl.edu	37	22	17443733	17443733	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr22:17443733C>G	ENST00000400588.1	-	10	1722	c.1615G>C	c.(1615-1617)Gtg>Ctg	p.V539L		NM_001037814.1	NP_001032903.1	Q2WGN9	GAB4_HUMAN	GRB2-associated binding protein family, member 4	539										breast(2)|endometrium(2)|kidney(2)|large_intestine(6)|lung(24)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	44		all_epithelial(15;0.112)|Lung NSC(13;0.248)				ACATAGTCCACCTTCTTGCCG	0.607																																																	0													51.0	53.0	52.0					22																	17443733		2200	4300	6500	SO:0001583	missense	0			AK057252	CCDS42976.1	22q11.2	2013-01-10			ENSG00000215568	ENSG00000215568		"""Pleckstrin homology (PH) domain containing"""	18325	protein-coding gene	gene with protein product							Standard	NM_001037814		Approved		uc002zlw.3	Q2WGN9	OTTHUMG00000149992	ENST00000400588.1:c.1615G>C	22.37:g.17443733C>G	ENSP00000383431:p.Val539Leu			Missense_Mutation	SNP	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.V539L	ENST00000400588.1	37	c.1615	CCDS42976.1	22	.	.	.	.	.	.	.	.	.	.	C	14.79	2.641765	0.47153	.	.	ENSG00000215568	ENST00000400588	T	0.22134	1.97	2.55	2.55	0.30701	.	0.000000	0.85682	D	0.000000	T	0.38692	0.1050	M	0.63843	1.955	0.30926	N	0.727499	D	0.58970	0.984	D	0.67548	0.952	T	0.38714	-0.9648	10	0.87932	D	0	.	11.2067	0.48773	0.0:1.0:0.0:0.0	.	539	Q2WGN9	GAB4_HUMAN	L	539	ENSP00000383431:V539L	ENSP00000383431:V539L	V	-	1	0	GAB4	15823733	1.000000	0.71417	0.996000	0.52242	0.009000	0.06853	6.882000	0.75589	1.722000	0.51474	0.609000	0.83330	GTG	GAB4	-	NULL	ENSG00000215568		0.607	GAB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GAB4	HGNC	protein_coding	OTTHUMT00000315426.1		0.00	37	0	C	XM_372882		17443733	-1			no_errors	ENST00000400588	ensembl	human	known	74_37	missense	18.18	18	4	SNP	1.000	G
GABBR1	2550	genome.wustl.edu	37	6	29588992	29588992	+	Silent	SNP	G	G	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr6:29588992G>T	ENST00000377034.4	-	11	1544	c.1209C>A	c.(1207-1209)atC>atA	p.I403I	GABBR1_ENST00000376977.3_Silent_p.I403I|GABBR1_ENST00000355973.3_Silent_p.I286I|GABBR1_ENST00000377012.4_Silent_p.I286I|GABBR1_ENST00000377016.4_Silent_p.I341I	NM_001470.2	NP_001461.1	Q9UBS5	GABR1_HUMAN	gamma-aminobutyric acid (GABA) B receptor, 1	403					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|gamma-aminobutyric acid signaling pathway (GO:0007214)|negative regulation of adenylate cyclase activity (GO:0007194)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|G-protein coupled receptor heterodimeric complex (GO:0038039)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	G-protein coupled GABA receptor activity (GO:0004965)			endometrium(3)|kidney(1)|large_intestine(13)|liver(1)|lung(16)|ovary(5)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	47					Baclofen(DB00181)|Progabide(DB00837)|Vigabatrin(DB01080)	AAGGGTCGTAGATCTTGAACC	0.498																																																	0													174.0	137.0	150.0					6																	29588992		1511	2709	4220	SO:0001819	synonymous_variant	0			Y11044	CCDS4663.1, CCDS4664.1, CCDS4665.1	6p21.3	2012-08-29			ENSG00000204681	ENSG00000204681		"""GABA receptors"", ""GPCR / Class C : GABA(B) receptors"""	4070	protein-coding gene	gene with protein product	"""GABA-B receptor"""	603540				9753614, 9798068	Standard	NM_001470		Approved	hGB1a, GPRC3A	uc003nmt.4	Q9UBS5	OTTHUMG00000031095	ENST00000377034.4:c.1209C>A	6.37:g.29588992G>T			B0UXY7|O95375|O95468|O95975|O96022|Q5STL4|Q5SUJ8|Q5SUL3|Q71SG6|Q86W60|Q9UQQ0	Silent	SNP	pfam_ANF_lig-bd_rcpt,pfam_GPCR_3_C,pfam_Sushi_SCR_CCP,superfamily_Peripla_BP_I,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,prints_GPCR_3_GABA_rcpt_B,prints_GPCR_3_GABA_rcpt_B1,pfscan_Sushi_SCR_CCP,pfscan_GPCR_3_C	p.I403	ENST00000377034.4	37	c.1209	CCDS4663.1	6																																																																																			GABBR1	-	pfam_ANF_lig-bd_rcpt,superfamily_Peripla_BP_I	ENSG00000204681		0.498	GABBR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GABBR1	HGNC	protein_coding	OTTHUMT00000076141.3	-	0.00	58	0	G			29588992	-1	tier1	-	no_errors	ENST00000377034	ensembl	human	known	74_37	silent	18.18	36	8	SNP	0.998	T
GART	2618	genome.wustl.edu	37	21	34894556	34894556	+	Silent	SNP	G	G	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr21:34894556G>T	ENST00000381831.3	-	12	1595	c.1332C>A	c.(1330-1332)atC>atA	p.I444I	GART_ENST00000381839.3_Silent_p.I444I|GART_ENST00000381815.4_Silent_p.I444I|GART_ENST00000543717.1_5'UTR	NM_001136005.1	NP_001129477.1	P22102	PUR2_HUMAN	phosphoribosylglycinamide formyltransferase, phosphoribosylglycinamide synthetase, phosphoribosylaminoimidazole synthetase	444	AIRS.				'de novo' IMP biosynthetic process (GO:0006189)|brainstem development (GO:0003360)|cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|glycine metabolic process (GO:0006544)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase biosynthetic process (GO:0009113)|purine nucleobase metabolic process (GO:0006144)|purine ribonucleoside monophosphate biosynthetic process (GO:0009168)|response to inorganic substance (GO:0010035)|response to organic substance (GO:0010033)|small molecule metabolic process (GO:0044281)|tetrahydrofolate biosynthetic process (GO:0046654)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)|phosphoribosylamine-glycine ligase activity (GO:0004637)|phosphoribosylformylglycinamidine cyclo-ligase activity (GO:0004641)|phosphoribosylglycinamide formyltransferase activity (GO:0004644)			NS(2)|breast(1)|endometrium(3)|large_intestine(3)|lung(13)|ovary(3)|prostate(5)|urinary_tract(1)	31					Pemetrexed(DB00642)	TTCCAGCTGCGATATCTACTC	0.333																																																	0													105.0	93.0	97.0					21																	34894556		2203	4300	6503	SO:0001819	synonymous_variant	0			M32082	CCDS13627.1, CCDS13628.1	21q22.11	2012-10-02			ENSG00000159131	ENSG00000159131	2.1.2.2, 6.3.3.1, 6.3.4.13		4163	protein-coding gene	gene with protein product		138440		PRGS, PGFT		2050105	Standard	NM_001136005		Approved		uc002yrx.3	P22102	OTTHUMG00000065628	ENST00000381831.3:c.1332C>A	21.37:g.34894556G>T			A8K945|A8KA32|D3DSF3|D3DSF4|O14659|Q52M77	Silent	SNP	pfam_PRibGlycinamid_synth_ATP-grasp,pfam_Formyl_transf_N,pfam_PRibGlycinamide_synth_N,pfam_AIR_synth_C_dom,pfam_PRibGlycinamide_synth_C-dom,pfam_AIR_synth_N_dom,pfam_ATP-grasp_carboxylate-amine,pfam_CbamoylP_synth_lsu-like_ATP-bd,superfamily_Formyl_transf_N,superfamily_AIR_synth_C_dom,superfamily_PurM_N-like,superfamily_PreATP-grasp_dom,superfamily_Rudment_hybrid_motif,pfscan_ATP-grasp,tigrfam_PRibGlycinamide_synth,tigrfam_PurM_cligase,tigrfam_PurN_trans	p.I444	ENST00000381831.3	37	c.1332	CCDS13627.1	21																																																																																			GART	-	superfamily_PurM_N-like,tigrfam_PurM_cligase	ENSG00000159131		0.333	GART-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GART	HGNC	protein_coding	OTTHUMT00000140626.3		0.00	90	0	G	NM_000819		34894556	-1			no_errors	ENST00000381815	ensembl	human	known	74_37	silent	10.34	26	3	SNP	0.997	T
GBP1	2633	genome.wustl.edu	37	1	89521730	89521730	+	Frame_Shift_Del	DEL	T	T	-			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr1:89521730delT	ENST00000370473.4	-	8	1556	c.1337delA	c.(1336-1338)aagfs	p.K446fs	GBP1_ENST00000484970.1_5'Flank	NM_002053.2	NP_002044.2	P32455	GBP1_HUMAN	guanylate binding protein 1, interferon-inducible	446					cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|interferon-gamma-mediated signaling pathway (GO:0060333)	cytosol (GO:0005829)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)			endometrium(7)|kidney(4)|large_intestine(8)|lung(6)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	30		Lung NSC(277;0.123)		all cancers(265;0.0156)|Epithelial(280;0.0291)		CTCATAGTACTTTTTCTTCAG	0.443																																																	0													209.0	214.0	212.0					1																	89521730		2203	4300	6503	SO:0001589	frameshift_variant	0			BC002666	CCDS718.1	1p22.2	2011-03-09	2011-03-09		ENSG00000117228	ENSG00000117228			4182	protein-coding gene	gene with protein product		600411	"""guanylate binding protein 1, interferon-inducible, 67kDa"""			7518790	Standard	NM_002053		Approved		uc001dmx.2	P32455	OTTHUMG00000010614	ENST00000370473.4:c.1337delA	1.37:g.89521730delT	ENSP00000359504:p.Lys446fs		D3DT26|Q5T8M1	Frame_Shift_Del	DEL	pfam_Guanylate-bd_C,pfam_Guanylate-bd_N,superfamily_Guanylate-bd_C,superfamily_P-loop_NTPase	p.K446fs	ENST00000370473.4	37	c.1337	CCDS718.1	1																																																																																			GBP1	-	pfam_Guanylate-bd_C,superfamily_Guanylate-bd_C	ENSG00000117228		0.443	GBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GBP1	HGNC	protein_coding	OTTHUMT00000029289.3		0.00	243	0	T	NM_002053		89521730	-1	tier1		no_errors	ENST00000370473	ensembl	human	known	74_37	frame_shift_del	22.62	130	38	DEL	0.036	-
GIGYF2	26058	genome.wustl.edu	37	2	233697612	233697612	+	Missense_Mutation	SNP	C	C	A	rs199672111		TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr2:233697612C>A	ENST00000409547.1	+	24	2886	c.2575C>A	c.(2575-2577)Cgt>Agt	p.R859S	GIGYF2_ENST00000409196.3_Missense_Mutation_p.R853S|GIGYF2_ENST00000409451.3_Missense_Mutation_p.R880S|GIGYF2_ENST00000409480.1_Missense_Mutation_p.R881S|GIGYF2_ENST00000373563.4_Missense_Mutation_p.R859S|GIGYF2_ENST00000373566.3_Missense_Mutation_p.R881S|GIGYF2_ENST00000452341.2_Missense_Mutation_p.R690S	NM_015575.3	NP_056390.2	Q6Y7W6	PERQ2_HUMAN	GRB10 interacting GYF protein 2	859	Gln-rich.|Glu-rich.				adult locomotory behavior (GO:0008344)|cell death (GO:0008219)|cellular protein metabolic process (GO:0044267)|feeding behavior (GO:0007631)|homeostasis of number of cells within a tissue (GO:0048873)|insulin-like growth factor receptor signaling pathway (GO:0048009)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|musculoskeletal movement (GO:0050881)|negative regulation of translation (GO:0017148)|neuromuscular process controlling balance (GO:0050885)|post-embryonic development (GO:0009791)|spinal cord motor neuron differentiation (GO:0021522)	membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(4)|cervix(1)|endometrium(11)|kidney(2)|large_intestine(17)|lung(11)|ovary(5)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	63		Breast(86;0.00279)|all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0271)|Lung NSC(271;0.0839)		Epithelial(121;7.37e-16)|BRCA - Breast invasive adenocarcinoma(100;0.000472)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Lung(119;0.0118)|GBM - Glioblastoma multiforme(43;0.0145)		AGAAGCCCAGCGTCGATTAGA	0.498																																																	0													17.0	19.0	18.0					2																	233697612		2178	4260	6438	SO:0001583	missense	0			U80751	CCDS33401.1, CCDS46542.1, CCDS46543.1	2q37.1	2011-07-06	2008-02-11	2008-02-11	ENSG00000204120	ENSG00000204120		"""Trinucleotide (CAG) repeat containing"""	11960	protein-coding gene	gene with protein product	"""GYF domain containing 2"""	612003	"""PERQ amino acid rich, with GYF domain 2"", ""PERQ amino acid rich, with GYF domain 3"", ""trinucleotide repeat containing 15"", ""Parkinson disease (autosomal recessive, early onset) 11"""	PERQ2, PERQ3, TNRC15, PARK11		9225980, 9734811, 12771153, 18358451, 19279319	Standard	NM_015575		Approved	KIAA0642, GYF2	uc002vtk.4	Q6Y7W6	OTTHUMG00000153237	ENST00000409547.1:c.2575C>A	2.37:g.233697612C>A	ENSP00000386537:p.Arg859Ser		A6H8W4|B9EG55|E9PBB0|O75137|Q7Z2Z8|Q7Z3I2|Q96HU4|Q9NV82	Missense_Mutation	SNP	pfam_GYF,superfamily_GYF,smart_GYF,pfscan_GYF	p.R881S	ENST00000409547.1	37	c.2641	CCDS33401.1	2	.	.	.	.	.	.	.	.	.	.	C	18.51	3.639807	0.67244	.	.	ENSG00000204120	ENST00000373566;ENST00000373563;ENST00000409480;ENST00000409547;ENST00000409196;ENST00000409451;ENST00000452341	T;T;T;T;T;T;T	0.78481	-1.18;-1.18;-1.18;-1.18;-0.95;-0.9;-0.88	4.98	4.98	0.66077	.	0.000000	0.85682	D	0.000000	D	0.85940	0.5814	M	0.61703	1.905	0.58432	D	0.999998	D;D;D;D	0.67145	0.996;0.993;0.993;0.993	D;D;D;D	0.79108	0.992;0.972;0.972;0.972	D	0.83404	0.0024	10	0.28530	T	0.3	-9.0969	18.0315	0.89286	0.0:1.0:0.0:0.0	.	690;880;859;853	E9PC50;A6H8W4;Q6Y7W6;E9PBB0	.;.;PERQ2_HUMAN;.	S	881;859;881;859;853;880;690	ENSP00000362667:R881S;ENSP00000362664:R859S;ENSP00000386765:R881S;ENSP00000386537:R859S;ENSP00000387070:R853S;ENSP00000387170:R880S;ENSP00000411505:R690S	ENSP00000362664:R859S	R	+	1	0	GIGYF2	233405856	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.563000	0.53784	2.580000	0.87095	0.655000	0.94253	CGT	GIGYF2	-	NULL	ENSG00000204120		0.498	GIGYF2-001	KNOWN	basic|CCDS	protein_coding	GIGYF2	HGNC	protein_coding	OTTHUMT00000330316.2	-	0.00	139	0	C	NM_001103146		233697612	+1	tier1	-	no_errors	ENST00000373566	ensembl	human	known	74_37	missense	5.33	71	4	SNP	1.000	A
GIPC1	10755	genome.wustl.edu	37	19	14593663	14593664	+	Frame_Shift_Ins	INS	-	-	C			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr19:14593663_14593664insC	ENST00000393033.4	-	4	394_395	c.125_126insG	c.(124-126)ggcfs	p.G42fs	GIPC1_ENST00000345425.2_Frame_Shift_Ins_p.G42fs|GIPC1_ENST00000586027.1_Frame_Shift_Ins_p.G42fs|GIPC1_ENST00000393028.1_Intron|GIPC1_ENST00000591349.1_Intron|GIPC1_ENST00000393029.3_Intron	NM_005716.3	NP_005707.1	O14908	GIPC1_HUMAN	GIPC PDZ domain containing family, member 1	42	Poly-Gly.				endothelial cell migration (GO:0043542)|G-protein coupled receptor signaling pathway (GO:0007186)|glutamate secretion (GO:0014047)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|positive regulation of cytokinesis (GO:0032467)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|protein targeting (GO:0006605)|regulation of protein stability (GO:0031647)|regulation of synaptic plasticity (GO:0048167)|synaptic transmission (GO:0007268)	brush border (GO:0005903)|cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|endocytic vesicle (GO:0030139)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|synaptic vesicle (GO:0008021)|vesicle membrane (GO:0012506)	actin binding (GO:0003779)|myosin binding (GO:0017022)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)			endometrium(1)|lung(4)|upper_aerodigestive_tract(1)	6						CCATTTGGGGGCCCCCCGACCC	0.718																																					Pancreas(33;78 923 2910 41023 52850)												0									,,,,,	186,3326		49,88,1619					,,,,,	-3.4	0.1			5	148,6918		28,92,3413	no	intron,frameshift,intron,frameshift,intron,frameshift	GIPC1	NM_202494.1,NM_202470.1,NM_202469.1,NM_202468.1,NM_202467.1,NM_005716.2	,,,,,	77,180,5032	A1A1,A1R,RR		2.0945,5.2961,3.1575	,,,,,	,,,,,		334,10244				SO:0001589	frameshift_variant	0			AF089816	CCDS12310.1, CCDS12311.1	19p13.1	2009-09-22	2005-06-28	2005-06-28					1226	protein-coding gene	gene with protein product		605072	"""chromosome 19 open reading frame 3"", ""regulator of G-protein signalling 19 interacting protein 1"""	C19orf3, RGS19IP1		9770488, 9482110	Standard	NM_005716		Approved	TIP-2, Hs.6454, GIPC, SEMCAP, GLUT1CBP, SYNECTIN, NIP	uc002myx.4	O14908		ENST00000393033.4:c.126dupG	19.37:g.14593669_14593669dupC	ENSP00000376753:p.Gly42fs		A8K4I3|A8MZG3|Q9BTC9	Frame_Shift_Ins	INS	pfam_PDZ,superfamily_PDZ,smart_PDZ,pirsf_UCP038083_PDZ,pfscan_PDZ	p.Q44fs	ENST00000393033.4	37	c.126_125	CCDS12310.1	19																																																																																			GIPC1	-	pirsf_UCP038083_PDZ	ENSG00000123159		0.718	GIPC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GIPC1	HGNC	protein_coding	OTTHUMT00000460239.2		0.00	15	0	0			14593664	-1			no_errors	ENST00000345425	ensembl	human	known	74_37	frame_shift_ins	33.33	4	2	INS	0.668:0.951	C
GNAQ	2776	genome.wustl.edu	37	9	80430560	80430560	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr9:80430560C>T	ENST00000286548.4	-	3	670	c.448G>A	c.(448-450)Gaa>Aaa	p.E150K	GNAQ_ENST00000397476.3_5'UTR	NM_002072.3	NP_002063.2	P50148	GNAQ_HUMAN	guanine nucleotide binding protein (G protein), q polypeptide	150					action potential (GO:0001508)|activation of phospholipase C activity (GO:0007202)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|blood coagulation (GO:0007596)|developmental pigmentation (GO:0048066)|embryonic digit morphogenesis (GO:0042733)|forebrain neuron development (GO:0021884)|glutamate receptor signaling pathway (GO:0007215)|heart development (GO:0007507)|maternal behavior (GO:0042711)|negative regulation of protein kinase activity (GO:0006469)|neuron remodeling (GO:0016322)|phospholipase C-activating dopamine receptor signaling pathway (GO:0060158)|platelet activation (GO:0030168)|positive regulation of GTPase activity (GO:0043547)|post-embryonic development (GO:0009791)|protein stabilization (GO:0050821)|regulation of catenin import into nucleus (GO:0035412)|regulation of melanocyte differentiation (GO:0045634)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|lysosomal membrane (GO:0005765)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	G-protein beta/gamma-subunit complex binding (GO:0031683)|GTP binding (GO:0005525)|GTPase activator activity (GO:0005096)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)|type 2A serotonin receptor binding (GO:0031826)			NS(1)|endometrium(3)|eye(229)|kidney(1)|large_intestine(4)|lung(6)|meninges(11)|ovary(1)|prostate(1)|skin(44)|upper_aerodigestive_tract(1)	302						AATTGATATTCTCGTCGTCTA	0.373			Mis		uveal melanoma																																			Dom	yes		9	9q21	2776	"""guanine nucleotide binding protein (G protein), q polypeptide"""		E	0													121.0	110.0	114.0					9																	80430560		2203	4300	6503	SO:0001583	missense	0				CCDS6658.1	9q21	2010-03-17			ENSG00000156052	ENSG00000156052			4390	protein-coding gene	gene with protein product		600998				8825633	Standard	NM_002072		Approved	G-ALPHA-q, GAQ	uc004akw.3	P50148	OTTHUMG00000020059	ENST00000286548.4:c.448G>A	9.37:g.80430560C>T	ENSP00000286548:p.Glu150Lys		O15108|Q13462|Q6NT27|Q92471|Q9BZB9	Missense_Mutation	SNP	pfam_Gprotein_alpha_su,pfam_Small_GTPase_ARF/SAR,superfamily_P-loop_NTPase,superfamily_GproteinA_insert,smart_Gprotein_alpha_su,prints_Gprotein_alpha_su,prints_Gprotein_alpha_Q,prints_Fungi_Gprotein_alpha	p.E150K	ENST00000286548.4	37	c.448	CCDS6658.1	9	.	.	.	.	.	.	.	.	.	.	C	36	5.959947	0.97145	.	.	ENSG00000156052	ENST00000286548;ENST00000411677	D;D	0.87729	-2.29;-2.29	6.01	6.01	0.97437	G protein alpha subunit, helical insertion (2);	0.000000	0.85682	D	0.000000	D	0.93510	0.7929	M	0.82923	2.615	0.80722	D	1	P	0.51449	0.945	P	0.58266	0.836	D	0.93449	0.6800	10	0.87932	D	0	.	20.5211	0.99222	0.0:1.0:0.0:0.0	.	150	P50148	GNAQ_HUMAN	K	150;121	ENSP00000286548:E150K;ENSP00000391501:E121K	ENSP00000286548:E150K	E	-	1	0	GNAQ	79620380	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.814000	0.86154	2.861000	0.98227	0.650000	0.86243	GAA	GNAQ	-	pfam_Gprotein_alpha_su,superfamily_P-loop_NTPase,superfamily_GproteinA_insert,smart_Gprotein_alpha_su	ENSG00000156052		0.373	GNAQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GNAQ	HGNC	protein_coding	OTTHUMT00000052761.1	-	0.00	89	0	C	NM_002072		80430560	-1	tier1	-	no_errors	ENST00000286548	ensembl	human	known	74_37	missense	31.58	26	12	SNP	1.000	T
GOLGA3	2802	genome.wustl.edu	37	12	133372506	133372506	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr12:133372506C>T	ENST00000450791.2	-	10	2584	c.2401G>A	c.(2401-2403)Gaa>Aaa	p.E801K	GOLGA3_ENST00000537452.1_Missense_Mutation_p.E801K|GOLGA3_ENST00000204726.3_Missense_Mutation_p.E801K|GOLGA3_ENST00000456883.2_Missense_Mutation_p.E801K|GOLGA3_ENST00000545875.1_Missense_Mutation_p.E801K			Q08378	GOGA3_HUMAN	golgin A3	801					intra-Golgi vesicle-mediated transport (GO:0006891)	cytosol (GO:0005829)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extrinsic component of Golgi membrane (GO:0090498)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi transport complex (GO:0017119)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	transporter activity (GO:0005215)			breast(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(4)|lung(33)|ovary(3)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0176)|Lung NSC(355;0.204)		OV - Ovarian serous cystadenocarcinoma(86;2.27e-08)|Epithelial(86;3.34e-07)|all cancers(50;9.4e-06)		TCGGTACCTTCTTCCAAGCGT	0.488																																																	0													104.0	104.0	104.0					12																	133372506		2203	4300	6503	SO:0001583	missense	0			AF485338	CCDS9281.1, CCDS53846.1	12q24.33	2010-02-12	2010-02-12		ENSG00000090615	ENSG00000090615			4426	protein-coding gene	gene with protein product	"""SY2/SY10 protein"", ""Golgi complex-associated protein of 170 kD"""	602581	"""golgi autoantigen, golgin subfamily a, 3"""			8315394, 15829563	Standard	NM_001172557		Approved	golgin-160, GCP170, MEA-2	uc001ukz.1	Q08378	OTTHUMG00000168023	ENST00000450791.2:c.2401G>A	12.37:g.133372506C>T	ENSP00000410378:p.Glu801Lys		A5PKX6|O43241|Q6P9C7|Q86XW3|Q8TDA9|Q8WZA3	Missense_Mutation	SNP	superfamily_Prefoldin	p.E801K	ENST00000450791.2	37	c.2401	CCDS9281.1	12	.	.	.	.	.	.	.	.	.	.	C	17.62	3.435108	0.62955	.	.	ENSG00000090615	ENST00000204726;ENST00000450791;ENST00000456883;ENST00000537452;ENST00000545875	T;T;T;T;T	0.35789	1.75;1.75;1.76;1.29;1.29	5.32	4.42	0.53409	.	0.000000	0.85682	D	0.000000	T	0.57403	0.2051	M	0.74258	2.255	0.80722	D	1	D;D;D	0.89917	0.999;0.999;1.0	D;D;D	0.91635	0.995;0.995;0.999	T	0.53528	-0.8426	10	0.24483	T	0.36	.	14.362	0.66779	0.0:0.927:0.0:0.073	.	801;801;801	Q08378-4;Q08378-2;Q08378	.;.;GOGA3_HUMAN	K	801	ENSP00000204726:E801K;ENSP00000410378:E801K;ENSP00000409303:E801K;ENSP00000442143:E801K;ENSP00000442603:E801K	ENSP00000204726:E801K	E	-	1	0	GOLGA3	131882579	1.000000	0.71417	0.086000	0.20670	0.011000	0.07611	6.084000	0.71335	2.503000	0.84419	0.655000	0.94253	GAA	GOLGA3	-	NULL	ENSG00000090615		0.488	GOLGA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GOLGA3	HGNC	protein_coding	OTTHUMT00000397569.2	-	0.00	41	0	C	NM_005895		133372506	-1	tier1	-	no_errors	ENST00000204726	ensembl	human	known	74_37	missense	31.25	11	5	SNP	1.000	T
GPR21	2844	genome.wustl.edu	37	9	125796992	125796992	+	Silent	SNP	G	G	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr9:125796992G>T	ENST00000373642.1	+	1	187	c.147G>T	c.(145-147)gtG>gtT	p.V49V	RABGAP1_ENST00000493854.1_Intron|RABGAP1_ENST00000373647.4_Intron|RABGAP1_ENST00000373643.5_Intron	NM_005294.1	NP_005285.1	Q99679	GPR21_HUMAN	G protein-coupled receptor 21	49					G-protein coupled receptor signaling pathway (GO:0007186)|glucose homeostasis (GO:0042593)|negative regulation of insulin receptor signaling pathway (GO:0046627)|positive regulation of multicellular organism growth (GO:0040018)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)			endometrium(3)|large_intestine(3)|lung(4)|ovary(1)|skin(1)|stomach(1)|urinary_tract(2)	15						ACATCATTGTGATTTTTGTAT	0.363																																																	0													212.0	184.0	193.0					9																	125796992		2203	4300	6503	SO:0001819	synonymous_variant	0			BC066885	CCDS6849.1	9q33	2012-08-21			ENSG00000188394	ENSG00000188394		"""GPCR / Class A : Orphans"""	4476	protein-coding gene	gene with protein product		601909					Standard	NM_005294		Approved		uc011lzk.3	Q99679	OTTHUMG00000020631	ENST00000373642.1:c.147G>T	9.37:g.125796992G>T			B2R8W9|Q6NXU2	Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	p.V49	ENST00000373642.1	37	c.147	CCDS6849.1	9																																																																																			GPR21	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000188394		0.363	GPR21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR21	HGNC	protein_coding	OTTHUMT00000053965.1	-	0.00	50	0	G	NM_005294		125796992	+1	tier1	-	no_errors	ENST00000373642	ensembl	human	known	74_37	silent	12.50	21	3	SNP	1.000	T
GPR52	9293	genome.wustl.edu	37	1	174417375	174417375	+	Missense_Mutation	SNP	C	C	G	rs145259584		TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr1:174417375C>G	ENST00000367685.2	+	1	164	c.126C>G	c.(124-126)ttC>ttG	p.F42L	RABGAP1L_ENST00000251507.4_Intron|RABGAP1L_ENST00000367689.3_Intron|RABGAP1L_ENST00000357444.6_Intron	NM_005684.4	NP_005675.3	Q9Y2T5	GPR52_HUMAN	G protein-coupled receptor 52	42					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)			breast(3)|kidney(3)|large_intestine(3)|liver(1)|lung(7)|prostate(1)|skin(2)	20						TCTGCATCTTCGAGACAGTGG	0.453																																					Ovarian(92;924 1390 1930 16467 40583)												0													227.0	193.0	204.0					1																	174417375		2203	4300	6503	SO:0001583	missense	0			AF096784	CCDS30941.1	1q24	2012-08-21			ENSG00000203737	ENSG00000203737		"""GPCR / Class A : Orphans"""	4508	protein-coding gene	gene with protein product		604106				9931487	Standard	NM_005684		Approved		uc001gka.1	Q9Y2T5	OTTHUMG00000034901	ENST00000367685.2:c.126C>G	1.37:g.174417375C>G	ENSP00000356658:p.Phe42Leu		O75654|Q4VBL6|Q6ISM0	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	p.F42L	ENST00000367685.2	37	c.126	CCDS30941.1	1	.	.	.	.	.	.	.	.	.	.	C	0.546	-0.851575	0.02651	.	.	ENSG00000203737	ENST00000367685	T	0.34072	1.38	5.68	-1.76	0.08006	.	0.219325	0.31531	N	0.007495	T	0.08537	0.0212	N	0.01352	-0.895	0.25587	N	0.986733	B	0.02656	0.0	B	0.01281	0.0	T	0.38178	-0.9673	10	0.02654	T	1	-9.8021	7.5453	0.27764	0.0:0.2355:0.1806:0.5839	.	42	Q9Y2T5	GPR52_HUMAN	L	42	ENSP00000356658:F42L	ENSP00000356658:F42L	F	+	3	2	GPR52	172683998	1.000000	0.71417	0.997000	0.53966	0.995000	0.86356	0.608000	0.24223	-0.165000	0.10908	-0.137000	0.14449	TTC	GPR52	-	prints_GPCR_Rhodpsn	ENSG00000203737		0.453	GPR52-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR52	HGNC	protein_coding	OTTHUMT00000084511.1	-	0.00	60	0	C	NM_005684		174417375	+1	tier1	-	no_errors	ENST00000367685	ensembl	human	known	74_37	missense	17.39	37	8	SNP	0.990	G
GRIP2	80852	genome.wustl.edu	37	3	14567437	14567437	+	RNA	SNP	G	G	A	rs369716360		TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr3:14567437G>A	ENST00000273083.3	-	0	107							Q9C0E4	GRIP2_HUMAN	glutamate receptor interacting protein 2						synaptic transmission (GO:0007268)	cytosol (GO:0005829)|plasma membrane (GO:0005886)				endometrium(5)|large_intestine(4)|lung(8)|ovary(1)|pancreas(1)|prostate(5)|skin(1)	25						AGGGCCCATCGTCTGCAGGAG	0.567																																																	0								G		1,3841		0,1,1920	23.0	26.0	25.0		333	1.9	1.0	3		25	0,8188		0,0,4094	no	coding-synonymous-near-splice	GRIP2	NM_001080423.2		0,1,6014	AA,AG,GG		0.0,0.026,0.0083		111/1141	14567437	1,12029	1921	4094	6015			0			AB051506		3p24-p23	2012-02-08			ENSG00000144596	ENSG00000144596			23841	protein-coding gene	gene with protein product							Standard	NM_001080423		Approved	KIAA1719	uc021wtn.1	Q9C0E4	OTTHUMG00000155544		3.37:g.14567437G>A			Q8TEH9|Q9H7H3	RNA	SNP	-	NULL	ENST00000273083.3	37	NULL		3																																																																																			GRIP2	-	-	ENSG00000144596		0.567	GRIP2-001	KNOWN	basic	processed_transcript	GRIP2	HGNC	processed_transcript	OTTHUMT00000340582.2	-	0.00	34	0	G	NM_001080423		14567437	-1	tier1	-	no_errors	ENST00000273083	ensembl	human	known	74_37	rna	42.86	8	6	SNP	1.000	A
HAO1	54363	genome.wustl.edu	37	20	7894903	7894903	+	Silent	SNP	G	G	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr20:7894903G>T	ENST00000378789.3	-	3	504	c.453C>A	c.(451-453)ggC>ggA	p.G151G		NM_017545.2	NP_060015.1	Q9UJM8	HAOX1_HUMAN	hydroxyacid oxidase (glycolate oxidase) 1	151	FMN hydroxy acid dehydrogenase. {ECO:0000255|PROSITE-ProRule:PRU00683}.				cellular nitrogen compound metabolic process (GO:0034641)|fatty acid alpha-oxidation (GO:0001561)|glycolate catabolic process (GO:0046296)|glyoxylate metabolic process (GO:0046487)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)	peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	(S)-2-hydroxy-acid oxidase activity (GO:0003973)|FMN binding (GO:0010181)|glycolate oxidase activity (GO:0008891)|glyoxylate oxidase activity (GO:0047969)|long-chain-(S)-2-hydroxy-long-chain-acid oxidase activity (GO:0052853)|medium-chain-(S)-2-hydroxy-acid oxidase activity (GO:0052854)|receptor binding (GO:0005102)|very-long-chain-(S)-2-hydroxy-acid oxidase activity (GO:0052852)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(19)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	36						TGGCCTTGTAGCCCATCTTCT	0.522																																																	0													236.0	146.0	176.0					20																	7894903		2203	4300	6503	SO:0001819	synonymous_variant	0			AL021879	CCDS13100.1	20p12	2005-01-10			ENSG00000101323	ENSG00000101323	1.1.3.15		4809	protein-coding gene	gene with protein product		605023		GOX1		9891009	Standard	NM_017545		Approved	GOX	uc002wmw.1	Q9UJM8	OTTHUMG00000031841	ENST00000378789.3:c.453C>A	20.37:g.7894903G>T			Q14CQ0|Q9UPZ0|Q9Y3I7	Silent	SNP	pfam_FMN-dep_DH,pfam_Glu_synth_centr_C,pirsf_Alpha-hydoxy_acid_DH_FMN	p.G151	ENST00000378789.3	37	c.453	CCDS13100.1	20																																																																																			HAO1	-	pfam_FMN-dep_DH,pirsf_Alpha-hydoxy_acid_DH_FMN	ENSG00000101323		0.522	HAO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HAO1	HGNC	protein_coding	OTTHUMT00000077926.2	-	0.00	80	0	G			7894903	-1	tier1	-	no_errors	ENST00000378789	ensembl	human	known	74_37	silent	11.76	45	6	SNP	0.970	T
HELB	92797	genome.wustl.edu	37	12	66716526	66716526	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr12:66716526G>A	ENST00000247815.4	+	9	2319	c.2260G>A	c.(2260-2262)Gac>Aac	p.D754N		NM_033647.3	NP_387467.2	Q8NG08	HELB_HUMAN	helicase (DNA) B	754					DNA duplex unwinding (GO:0032508)|DNA replication (GO:0006260)|DNA replication, synthesis of RNA primer (GO:0006269)		ATP binding (GO:0005524)|ATP-dependent 5'-3' DNA helicase activity (GO:0043141)|single-stranded DNA-dependent ATP-dependent DNA helicase activity (GO:0017116)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(15)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)	40			GBM - Glioblastoma multiforme(2;0.000142)	GBM - Glioblastoma multiforme(28;0.0265)		TCTAATTAATGACTGCTGCTG	0.413																																																	0													139.0	138.0	138.0					12																	66716526		2203	4300	6503	SO:0001583	missense	0			AF319995	CCDS8976.1	12q14.2	2009-01-15			ENSG00000127311	ENSG00000127311			17196	protein-coding gene	gene with protein product		614539				12181327	Standard	NM_033647		Approved		uc001sti.3	Q8NG08	OTTHUMG00000169006	ENST00000247815.4:c.2260G>A	12.37:g.66716526G>A	ENSP00000247815:p.Asp754Asn		A8K4C9|Q4G0T2|Q9H7L5	Missense_Mutation	SNP	superfamily_P-loop_NTPase	p.D754N	ENST00000247815.4	37	c.2260	CCDS8976.1	12	.	.	.	.	.	.	.	.	.	.	G	12.05	1.821177	0.32237	.	.	ENSG00000127311	ENST00000247815	T	0.12255	2.7	5.37	3.54	0.40534	.	0.377613	0.25302	N	0.031655	T	0.11196	0.0273	L	0.51422	1.61	0.30032	N	0.813391	P	0.34462	0.454	B	0.24974	0.057	T	0.08391	-1.0724	9	.	.	.	-5.124	9.7012	0.40187	0.0773:0.155:0.7677:0.0	.	754	Q8NG08	HELB_HUMAN	N	754	ENSP00000247815:D754N	.	D	+	1	0	HELB	65002793	1.000000	0.71417	0.998000	0.56505	0.125000	0.20455	2.318000	0.43779	0.768000	0.33290	0.650000	0.86243	GAC	HELB	-	superfamily_P-loop_NTPase	ENSG00000127311		0.413	HELB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HELB	HGNC	protein_coding	OTTHUMT00000401919.1	-	0.00	70	0	G			66716526	+1	tier1	-	no_errors	ENST00000247815	ensembl	human	known	74_37	missense	35.71	27	15	SNP	1.000	A
HELZ	9931	genome.wustl.edu	37	17	65190128	65190128	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr17:65190128G>T	ENST00000358691.5	-	9	678	c.512C>A	c.(511-513)cCa>cAa	p.P171Q	HELZ_ENST00000580168.1_Missense_Mutation_p.P171Q|HELZ_ENST00000580662.1_Intron	NM_014877.3	NP_055692	P42694	HELZ_HUMAN	helicase with zinc finger	171						membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(5)|endometrium(9)|kidney(3)|large_intestine(11)|liver(1)|lung(24)|ovary(1)|pancreas(1)|prostate(1)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(2)	69	all_cancers(12;1.24e-11)|Breast(2;1.05e-17)|all_epithelial(3;3.87e-13)					TCCCCTAGGTGGTGGGCGGAA	0.368																																																	0													65.0	63.0	63.0					17																	65190128		1852	4088	5940	SO:0001583	missense	0			D29677	CCDS42374.1	17q24.2	2013-01-18			ENSG00000198265	ENSG00000198265		"""Zinc fingers, CCCH-type domain containing"""	16878	protein-coding gene	gene with protein product	"""down-regulated in human cancers"""	606699				10471385, 12691822	Standard	NM_014877		Approved	KIAA0054, HUMORF5, DHRC	uc002jfx.4	P42694	OTTHUMG00000179555	ENST00000358691.5:c.512C>A	17.37:g.65190128G>T	ENSP00000351524:p.Pro171Gln		I6L9H4	Missense_Mutation	SNP	pfam_Znf_CCCH,superfamily_P-loop_NTPase,smart_Znf_CCCH	p.P171Q	ENST00000358691.5	37	c.512	CCDS42374.1	17	.	.	.	.	.	.	.	.	.	.	G	15.09	2.729592	0.48833	.	.	ENSG00000198265	ENST00000358691;ENST00000417253	D;T	0.88124	-2.34;0.89	4.86	4.86	0.63082	.	0.000000	0.85682	D	0.000000	D	0.93877	0.8041	M	0.82716	2.605	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.76071	0.96;0.987	D	0.94583	0.7781	10	0.66056	D	0.02	-10.9663	18.3351	0.90285	0.0:0.0:1.0:0.0	.	171;171	B7ZLW2;P42694	.;HELZ_HUMAN	Q	171	ENSP00000351524:P171Q;ENSP00000411144:P171Q	ENSP00000351524:P171Q	P	-	2	0	HELZ	62620590	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.535000	0.82014	2.411000	0.81874	0.585000	0.79938	CCA	HELZ	-	NULL	ENSG00000198265		0.368	HELZ-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	HELZ	HGNC	protein_coding	OTTHUMT00000447068.1	-	0.00	75	0	G	NM_014877		65190128	-1	tier1	-	no_errors	ENST00000358691	ensembl	human	known	74_37	missense	7.84	47	4	SNP	1.000	T
HEPHL1	341208	genome.wustl.edu	37	11	93779036	93779036	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr11:93779036C>A	ENST00000315765.9	+	2	376	c.368C>A	c.(367-369)cCt>cAt	p.P123H		NM_001098672.1	NP_001092142.1	Q6MZM0	HPHL1_HUMAN	hephaestin-like 1	123	Plastocyanin-like 1.				copper ion transport (GO:0006825)|oxidation-reduction process (GO:0055114)	integral component of membrane (GO:0016021)	copper ion binding (GO:0005507)|ferroxidase activity (GO:0004322)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(11)|lung(25)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	61		Acute lymphoblastic leukemia(157;2.34e-05)|all_hematologic(158;0.00824)				GCTTCTCGACCTTACTCTCTG	0.438																																																	0													88.0	88.0	88.0					11																	93779036		1876	4112	5988	SO:0001583	missense	0			BX641008	CCDS44710.1	11q21	2008-02-05			ENSG00000181333	ENSG00000181333			30477	protein-coding gene	gene with protein product							Standard	NM_001098672		Approved	DKFZp686F22190	uc001pep.2	Q6MZM0	OTTHUMG00000167751	ENST00000315765.9:c.368C>A	11.37:g.93779036C>A	ENSP00000313699:p.Pro123His		Q3C1W7	Missense_Mutation	SNP	pfam_Cu-oxidase_3,pfam_Cu-oxidase_2,superfamily_Cupredoxin	p.P123H	ENST00000315765.9	37	c.368	CCDS44710.1	11	.	.	.	.	.	.	.	.	.	.	C	16.44	3.122610	0.56613	.	.	ENSG00000181333	ENST00000315765	D	0.99214	-5.57	4.97	4.97	0.65823	Cupredoxin (2);Multicopper oxidase, type 3 (1);	0.327214	0.33235	N	0.005132	D	0.99414	0.9793	M	0.92833	3.35	0.20638	N	0.999877	P	0.52463	0.953	P	0.61533	0.89	D	0.97376	0.9979	10	0.66056	D	0.02	.	12.6435	0.56721	0.1654:0.8346:0.0:0.0	.	123	Q6MZM0	HPHL1_HUMAN	H	123	ENSP00000313699:P123H	ENSP00000313699:P123H	P	+	2	0	HEPHL1	93418684	0.612000	0.27000	0.935000	0.37517	0.976000	0.68499	2.792000	0.47837	2.446000	0.82766	0.650000	0.86243	CCT	HEPHL1	-	pfam_Cu-oxidase_3,superfamily_Cupredoxin	ENSG00000181333		0.438	HEPHL1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	HEPHL1	HGNC	protein_coding	OTTHUMT00000396103.2	-	0.00	95	0	C	XM_291947		93779036	+1	tier1	-	no_errors	ENST00000315765	ensembl	human	known	74_37	missense	6.06	62	4	SNP	0.273	A
HERC2P3	283755	genome.wustl.edu	37	15	20613980	20613980	+	RNA	SNP	G	G	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr15:20613980G>T	ENST00000428453.1	-	0	4041							Q9BVR0	HRC23_HUMAN	hect domain and RLD 2 pseudogene 3								metal ion binding (GO:0046872)|ubiquitin-protein transferase activity (GO:0004842)			central_nervous_system(1)|endometrium(11)|kidney(2)|large_intestine(1)|lung(14)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	35						ATAATCTAAAGGGCTGAAATG	0.388																																																	0																																												0			AF041081		15q11.2	2010-08-02			ENSG00000180229	ENSG00000180229			4871	pseudogene	pseudogene						9730612	Standard	NR_036432		Approved	D15F37S4, LOC283755	uc001ytg.3	Q9BVR0	OTTHUMG00000157175		15.37:g.20613980G>T				RNA	SNP	-	NULL	ENST00000428453.1	37	NULL		15																																																																																			HERC2P3	-	-	ENSG00000180229		0.388	HERC2P3-014	KNOWN	basic	processed_transcript	HERC2P3	HGNC	pseudogene	OTTHUMT00000347772.2	-	0.00	79	0	G	NG_008269		20613980	-1	tier1	-	no_errors	ENST00000430598	ensembl	human	known	74_37	rna	7.81	59	5	SNP	0.978	T
HMCN1	83872	genome.wustl.edu	37	1	185902946	185902946	+	Silent	SNP	C	C	G			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr1:185902946C>G	ENST00000271588.4	+	11	2047	c.1818C>G	c.(1816-1818)ctC>ctG	p.L606L	HMCN1_ENST00000367492.2_Silent_p.L606L	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	606	Ig-like C2-type 2.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						CAGTTTTCCTCACAGTGCAAG	0.403																																																	0													139.0	136.0	137.0					1																	185902946		2203	4300	6503	SO:0001819	synonymous_variant	0			AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.1818C>G	1.37:g.185902946C>G			A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Silent	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_G2_nidogen/fibulin_G2F,pfam_EGF-like_Ca-bd_dom,pfam_Thrombospondin_1_rpt,superfamily_GFP,superfamily_Thrombospondin_1_rpt,superfamily_Growth_fac_rcpt_N_dom,superfamily_Cadherin-like,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Thrombospondin_1_rpt,smart_G2_nidogen/fibulin_G2F,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_G2_nidogen/fibulin_G2F,pfscan_Thrombospondin_1_rpt,pfscan_Ig-like_dom	p.L606	ENST00000271588.4	37	c.1818	CCDS30956.1	1																																																																																			HMCN1	-	pfam_Ig_I-set,smart_Ig_sub,pfscan_Ig-like_dom	ENSG00000143341		0.403	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HMCN1	HGNC	protein_coding	OTTHUMT00000131848.1	-	0.00	110	0	C	NM_031935		185902946	+1	tier1	-	no_errors	ENST00000271588	ensembl	human	known	74_37	silent	19.30	46	11	SNP	0.901	G
IDE	3416	genome.wustl.edu	37	10	94274767	94274767	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr10:94274767G>T	ENST00000265986.6	-	5	750	c.694C>A	c.(694-696)Caa>Aaa	p.Q232K		NM_004969.3	NP_004960.2	P14735	IDE_HUMAN	insulin-degrading enzyme	232					beta-amyloid metabolic process (GO:0050435)|bradykinin catabolic process (GO:0010815)|determination of adult lifespan (GO:0008340)|hormone catabolic process (GO:0042447)|insulin catabolic process (GO:1901143)|insulin metabolic process (GO:1901142)|insulin receptor signaling pathway (GO:0008286)|negative regulation of proteolysis (GO:0045861)|positive regulation of protein oligomerization (GO:0032461)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|protein homotetramerization (GO:0051289)|proteolysis (GO:0006508)|proteolysis involved in cellular protein catabolic process (GO:0051603)|ubiquitin homeostasis (GO:0010992)|viral process (GO:0016032)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic proteasome complex (GO:0031597)|extracellular space (GO:0005615)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|beta-amyloid binding (GO:0001540)|beta-endorphin binding (GO:0031626)|glycoprotein binding (GO:0001948)|insulin binding (GO:0043559)|metalloendopeptidase activity (GO:0004222)|peptide binding (GO:0042277)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|ubiquitin binding (GO:0043130)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(10)|liver(1)|lung(10)|ovary(2)|urinary_tract(2)	33					"""""""Insulin(DB00071)|Bacitracin(DB00626)|Insulin Regular(DB00030)"""	ATGCCTTCTTGGTTTGGTCTA	0.358																																																	0													180.0	187.0	185.0					10																	94274767		2203	4300	6503	SO:0001583	missense	0			M21188	CCDS7421.1, CCDS53554.1	10q23-q25	2007-03-27			ENSG00000119912	ENSG00000119912			5381	protein-coding gene	gene with protein product	"""insulysin"""	146680				2293021	Standard	NM_004969		Approved		uc001kia.3	P14735	OTTHUMG00000018759	ENST00000265986.6:c.694C>A	10.37:g.94274767G>T	ENSP00000265986:p.Gln232Lys		B2R721|B7ZAU2|D3DR35|Q5T5N2	Missense_Mutation	SNP	pfam_Pept_M16_N,pfam_Peptidase_M16_C,superfamily_Metalloenz_LuxS/M16	p.Q232K	ENST00000265986.6	37	c.694	CCDS7421.1	10	.	.	.	.	.	.	.	.	.	.	G	8.040	0.763753	0.15914	.	.	ENSG00000119912	ENST00000265986;ENST00000436178	T	0.27720	1.65	6.06	5.1	0.69264	Peptidase M16, core (1);Metalloenzyme, LuxS/M16 peptidase-like, metal-binding (1);	0.234051	0.41823	D	0.000809	T	0.15912	0.0383	N	0.11364	0.135	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.06570	-1.0819	10	0.06757	T	0.87	-15.9461	15.3707	0.74560	0.0:0.0:0.7604:0.2396	.	232	P14735	IDE_HUMAN	K	232;218	ENSP00000265986:Q232K	ENSP00000265986:Q232K	Q	-	1	0	IDE	94264747	0.983000	0.35010	1.000000	0.80357	0.997000	0.91878	0.623000	0.24447	2.882000	0.98803	0.655000	0.94253	CAA	IDE	-	superfamily_Metalloenz_LuxS/M16	ENSG00000119912		0.358	IDE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IDE	HGNC	protein_coding	OTTHUMT00000049393.1	-	0.00	102	0	G	NM_004969		94274767	-1	tier1	-	no_errors	ENST00000265986	ensembl	human	known	74_37	missense	7.02	53	4	SNP	1.000	T
IDO1	3620	genome.wustl.edu	37	8	39785379	39785379	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr8:39785379G>C	ENST00000518237.1	+	10	1526	c.887G>C	c.(886-888)aGa>aCa	p.R296T	RP11-44K6.3_ENST00000517623.1_RNA|IDO1_ENST00000522495.1_Missense_Mutation_p.R296T	NM_002164.5	NP_002155.1	P14902	I23O1_HUMAN	indoleamine 2,3-dioxygenase 1	296					cellular nitrogen compound metabolic process (GO:0034641)|cytokine production involved in inflammatory response (GO:0002534)|female pregnancy (GO:0007565)|kynurenic acid biosynthetic process (GO:0034276)|multicellular organismal response to stress (GO:0033555)|negative regulation of activated T cell proliferation (GO:0046007)|negative regulation of interleukin-10 production (GO:0032693)|negative regulation of T cell apoptotic process (GO:0070233)|positive regulation of apoptotic process (GO:0043065)|positive regulation of chronic inflammatory response (GO:0002678)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of T cell tolerance induction (GO:0002666)|positive regulation of type 2 immune response (GO:0002830)|response to lipopolysaccharide (GO:0032496)|small molecule metabolic process (GO:0044281)|swimming behavior (GO:0036269)|tryptophan catabolic process (GO:0006569)|tryptophan catabolic process to kynurenine (GO:0019441)	cytosol (GO:0005829)|smooth muscle contractile fiber (GO:0030485)|stereocilium bundle (GO:0032421)	electron carrier activity (GO:0009055)|heme binding (GO:0020037)|indoleamine 2,3-dioxygenase activity (GO:0033754)|metal ion binding (GO:0046872)|tryptophan 2,3-dioxygenase activity (GO:0004833)			central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(2)	12					L-Tryptophan(DB00150)|Melatonin(DB01065)	CAGGACATGAGAAGATATATG	0.488																																																	0													37.0	35.0	36.0					8																	39785379		1967	4173	6140	SO:0001583	missense	0			M34455	CCDS47847.1	8p12-p11	2009-01-07	2009-01-07	2009-01-07		ENSG00000131203	1.13.11.52		6059	protein-coding gene	gene with protein product		147435	"""indoleamine-pyrrole 2,3 dioxygenase"""	IDO, INDO		2109605, 8404046	Standard	NM_002164		Approved		uc003xnm.3	P14902		ENST00000518237.1:c.887G>C	8.37:g.39785379G>C	ENSP00000430950:p.Arg296Thr		Q540B4	Missense_Mutation	SNP	pfam_Indolamine_dOase	p.R296T	ENST00000518237.1	37	c.887	CCDS47847.1	8	.	.	.	.	.	.	.	.	.	.	G	21.6	4.166091	0.78339	.	.	ENSG00000131203	ENST00000522495;ENST00000518237	T;T	0.53640	0.61;0.61	5.37	5.37	0.77165	.	0.000000	0.85682	D	0.000000	T	0.76737	0.4029	H	0.94503	3.545	0.45979	D	0.998792	D	0.89917	1.0	D	0.97110	1.0	T	0.82717	-0.0319	9	.	.	.	-35.6034	14.4859	0.67616	0.0:0.0:1.0:0.0	.	296	P14902	I23O1_HUMAN	T	296	ENSP00000430505:R296T;ENSP00000430950:R296T	.	R	+	2	0	IDO1	39904536	1.000000	0.71417	0.985000	0.45067	0.769000	0.43574	6.840000	0.75369	2.793000	0.96121	0.563000	0.77884	AGA	IDO1	-	pfam_Indolamine_dOase	ENSG00000131203		0.488	IDO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IDO1	HGNC	protein_coding	OTTHUMT00000376987.1	-	0.00	65	0	G	NM_002164		39785379	+1	tier1	-	no_errors	ENST00000518237	ensembl	human	known	74_37	missense	18.75	39	9	SNP	0.997	C
IFNA7	3444	genome.wustl.edu	37	9	21201640	21201640	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr9:21201640G>T	ENST00000239347.3	-	1	564	c.525C>A	c.(523-525)ttC>ttA	p.F175L		NM_021057.2	NP_066401.2	P01567	IFNA7_HUMAN	interferon, alpha 7	175					adaptive immune response (GO:0002250)|B cell differentiation (GO:0030183)|B cell proliferation (GO:0042100)|blood coagulation (GO:0007596)|cell-cell signaling (GO:0007267)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|humoral immune response (GO:0006959)|innate immune response (GO:0045087)|natural killer cell activation involved in immune response (GO:0002323)|positive regulation of peptidyl-serine phosphorylation of STAT protein (GO:0033141)|regulation of MHC class I biosynthetic process (GO:0045343)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|response to exogenous dsRNA (GO:0043330)|response to virus (GO:0009615)|T cell activation involved in immune response (GO:0002286)|type I interferon signaling pathway (GO:0060337)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	cytokine activity (GO:0005125)|type I interferon receptor binding (GO:0005132)			endometrium(3)|kidney(1)|large_intestine(1)|liver(1)|lung(6)	12				GBM - Glioblastoma multiforme(5;4.75e-197)|Lung(24;1.26e-23)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)		TTGAAAAAGAGAAGGATCTCA	0.378																																																	0													220.0	226.0	224.0					9																	21201640		2203	4300	6503	SO:0001583	missense	0				CCDS34995.1	9p22	2010-12-10			ENSG00000214042	ENSG00000214042		"""Interferons"""	5428	protein-coding gene	gene with protein product		147567				1385305	Standard	NM_021057		Approved	IFNA-J, IFN-alphaJ	uc003zop.1	P01567	OTTHUMG00000019662	ENST00000239347.3:c.525C>A	9.37:g.21201640G>T	ENSP00000239347:p.Phe175Leu		Q14607|Q5VV14	Missense_Mutation	SNP	pfam_Interferon_alpha/beta/delta,superfamily_4_helix_cytokine-like_core,smart_Interferon_alpha/beta/delta,prints_Interferon_alpha/beta/delta	p.F175L	ENST00000239347.3	37	c.525	CCDS34995.1	9	.	.	.	.	.	.	.	.	.	.	G	0.026	-1.371904	0.01214	.	.	ENSG00000214042	ENST00000239347	T	0.03772	3.81	3.71	0.642	0.17765	Four-helical cytokine-like, core (1);Four-helical cytokine, core (1);	0.509670	0.20302	N	0.095013	T	0.02342	0.0072	N	0.17872	0.535	0.09310	N	1	B	0.11235	0.004	B	0.18871	0.023	T	0.47971	-0.9075	10	0.02654	T	1	.	5.0109	0.14312	0.1983:0.1802:0.6215:0.0	.	175	P01567	IFNA7_HUMAN	L	175	ENSP00000239347:F175L	ENSP00000239347:F175L	F	-	3	2	IFNA7	21191640	0.000000	0.05858	0.000000	0.03702	0.024000	0.10985	-0.081000	0.11321	-0.093000	0.12396	0.586000	0.80456	TTC	IFNA7	-	pfam_Interferon_alpha/beta/delta,superfamily_4_helix_cytokine-like_core,smart_Interferon_alpha/beta/delta	ENSG00000214042		0.378	IFNA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IFNA7	HGNC	protein_coding	OTTHUMT00000051891.1	-	0.00	152	0	G	NM_021057		21201640	-1	tier1	-	no_errors	ENST00000239347	ensembl	human	known	74_37	missense	5.56	68	4	SNP	0.001	T
IGFN1	91156	genome.wustl.edu	37	1	201183353	201183353	+	Missense_Mutation	SNP	C	C	A	rs200414774	byFrequency	TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr1:201183353C>A	ENST00000335211.4	+	13	8907	c.8777C>A	c.(8776-8778)cCg>cAg	p.P2926Q	IGFN1_ENST00000451870.2_Missense_Mutation_p.P469Q|IGFN1_ENST00000295591.8_Missense_Mutation_p.P86Q	NM_001164586.1	NP_001158058.1	Q86VF2	IGFN1_HUMAN	immunoglobulin-like and fibronectin type III domain containing 1	469						nucleus (GO:0005634)|Z disc (GO:0030018)				autonomic_ganglia(2)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	45						GAAGTGCAGCCGGGGGAGGCC	0.652																																																	0													40.0	33.0	36.0					1																	201183353		2203	4300	6503	SO:0001583	missense	0			AY245430	CCDS53455.1	1q32.1	2013-02-11			ENSG00000163395	ENSG00000163395		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	24607	protein-coding gene	gene with protein product							Standard	NM_001164586		Approved	DKFZp434B1231, EEF1A2BP1	uc001gwc.3	Q86VF2	OTTHUMG00000035728	ENST00000335211.4:c.8777C>A	1.37:g.201183353C>A	ENSP00000334714:p.Pro2926Gln		F8WAI1|Q9NT72	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.P2926Q	ENST00000335211.4	37	c.8777	CCDS53455.1	1	.	.	.	.	.	.	.	.	.	.	C	3.963	-0.009864	0.07727	.	.	ENSG00000163395	ENST00000335211;ENST00000451870;ENST00000295591	T;T;T	0.40756	1.02;1.02;1.02	3.39	-4.78	0.03209	.	1.418710	0.05198	N	0.504422	T	0.15176	0.0366	N	0.05306	-0.075	0.09310	N	1	B	0.18166	0.026	B	0.14023	0.01	T	0.11567	-1.0582	10	0.12430	T	0.62	.	0.5798	0.00710	0.4347:0.1402:0.1382:0.2869	.	2926	F8WAI1	.	Q	2926;469;86	ENSP00000334714:P2926Q;ENSP00000398386:P469Q;ENSP00000295591:P86Q	ENSP00000295591:P86Q	P	+	2	0	IGFN1	199449976	0.008000	0.16893	0.001000	0.08648	0.105000	0.19272	0.506000	0.22658	-1.405000	0.02048	-0.875000	0.02981	CCG	IGFN1	-	pfam_Ig_I-set,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000163395		0.652	IGFN1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	IGFN1	HGNC	protein_coding			0.00	43	0	C	NM_178275		201183353	+1			no_errors	ENST00000335211	ensembl	human	known	74_37	missense	5.71	33	2	SNP	0.007	A
IL5RA	3568	genome.wustl.edu	37	3	3139822	3139822	+	Splice_Site	SNP	T	T	A			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr3:3139822T>A	ENST00000446632.2	-	6	1094	c.520A>T	c.(520-522)Agg>Tgg	p.R174W	IL5RA_ENST00000311981.8_Splice_Site_p.R174W|IL5RA_ENST00000383846.1_Splice_Site_p.R174W|IL5RA_ENST00000418488.2_Splice_Site_p.R174W|IL5RA_ENST00000445864.2_Intron|IL5RA_ENST00000430514.2_Splice_Site_p.R174W|IL5RA_ENST00000456302.1_Splice_Site_p.R174W|IL5RA_ENST00000438560.1_Splice_Site_p.R174W|IL5RA_ENST00000256452.3_Splice_Site_p.R174W	NM_175726.3	NP_783853.1	Q01344	IL5RA_HUMAN	interleukin 5 receptor, alpha	174					cell proliferation (GO:0008283)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-5-mediated signaling pathway (GO:0038043)|regulation of interleukin-5 production (GO:0032674)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	interleukin-5 receptor activity (GO:0004914)	p.R174G(1)		cervix(1)|endometrium(2)|large_intestine(7)|lung(9)|ovary(1)|prostate(2)|skin(2)	24				Epithelial(13;0.00278)|all cancers(10;0.00809)|OV - Ovarian serous cystadenocarcinoma(96;0.00944)		AGTACTAACCTATAGTAGAGA	0.418																																					GBM(169;430 2801 24955 28528)												1	Substitution - Missense(1)	lung(1)											149.0	155.0	153.0					3																	3139822		2203	4300	6503	SO:0001630	splice_region_variant	0			M96652	CCDS2559.1, CCDS2560.1, CCDS46739.1, CCDS58813.1	3p26-p24	2008-01-11			ENSG00000091181	ENSG00000091181		"""Interleukins and interleukin receptors"", ""CD molecules"""	6017	protein-coding gene	gene with protein product		147851		IL5R		1732409	Standard	NM_175727		Approved	CDw125, CD125	uc010hbs.3	Q01344	OTTHUMG00000090245	ENST00000446632.2:c.521+1A>T	3.37:g.3139822T>A			B3IU77|B4E2G0|Q14633|Q15469|Q6ISX9	Missense_Mutation	SNP	pfam_IL-6_rcpt_alpha-bd,superfamily_Fibronectin_type3	p.R174W	ENST00000446632.2	37	c.520	CCDS2559.1	3	.	.	.	.	.	.	.	.	.	.	T	19.67	3.871484	0.72065	.	.	ENSG00000091181	ENST00000446632;ENST00000438560;ENST00000256452;ENST00000418488;ENST00000383846;ENST00000311981;ENST00000430514;ENST00000456302;ENST00000445701	D;D;D;D;D;D;D;D;D	0.84146	-1.81;-1.81;-1.81;-1.81;-1.81;-1.81;-1.81;-1.81;-1.81	5.91	5.91	0.95273	Interleukin-6 receptor alpha chain, binding (1);Fibronectin, type III (1);Short hematopoietin receptor, family 2, conserved site (1);Immunoglobulin-like fold (1);	0.278888	0.36854	N	0.002365	D	0.89054	0.6606	L	0.41961	1.31	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.999;0.999;0.998;0.999;0.999	D	0.88822	0.3299	10	0.46703	T	0.11	-30.3775	13.7215	0.62730	0.0:0.0:0.0:1.0	.	174;174;174;174;174	B4E2G0;Q01344-3;Q01344-2;Q01344;E7ERY4	.;.;.;IL5RA_HUMAN;.	W	174	ENSP00000412209:R174W;ENSP00000390753:R174W;ENSP00000256452:R174W;ENSP00000388858:R174W;ENSP00000373358:R174W;ENSP00000309196:R174W;ENSP00000400400:R174W;ENSP00000392059:R174W;ENSP00000398117:R174W	ENSP00000256452:R174W	R	-	1	2	IL5RA	3114822	1.000000	0.71417	0.910000	0.35882	0.717000	0.41224	4.960000	0.63673	2.254000	0.74563	0.533000	0.62120	AGG	IL5RA	-	pfam_IL-6_rcpt_alpha-bd,superfamily_Fibronectin_type3	ENSG00000091181		0.418	IL5RA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	IL5RA	HGNC	protein_coding	OTTHUMT00000337537.2	-	0.00	116	0	T		Missense_Mutation	3139822	-1	tier1	-	no_errors	ENST00000256452	ensembl	human	known	74_37	missense	60.98	16	25	SNP	0.981	A
INHBE	83729	genome.wustl.edu	37	12	57849605	57849605	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr12:57849605G>T	ENST00000266646.2	+	1	502	c.286G>T	c.(286-288)Gct>Tct	p.A96S	INHBE_ENST00000551553.1_Intron	NM_031479.3	NP_113667.1	P58166	INHBE_HUMAN	inhibin, beta E	96					growth (GO:0040007)	extracellular region (GO:0005576)				breast(2)|central_nervous_system(1)|large_intestine(2)|lung(7)|prostate(1)|skin(2)	15						CATCAGCTTTGCTACTGTCAC	0.612											OREG0021944	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									GBM(191;1808 2166 15720 36624 50371)												0													52.0	58.0	56.0					12																	57849605		2203	4300	6503	SO:0001583	missense	0				CCDS8939.1	12q13.2	2008-02-05				ENSG00000139269			24029	protein-coding gene	gene with protein product		612031				12242034	Standard	NM_031479		Approved	activin, MGC4638	uc001snw.3	P58166		ENST00000266646.2:c.286G>T	12.37:g.57849605G>T	ENSP00000266646:p.Ala96Ser	1026		Missense_Mutation	SNP	pfam_TGF-b_C,pfam_TGF-b_N,smart_TGF-b_C,prints_Inhibin_betaC,prints_Inhibin_asu	p.A96S	ENST00000266646.2	37	c.286	CCDS8939.1	12	.	.	.	.	.	.	.	.	.	.	G	19.09	3.759212	0.69763	.	.	ENSG00000139269	ENST00000547970;ENST00000266646	D;T	0.88124	-2.34;-0.27	4.4	4.4	0.53042	Transforming growth factor-beta, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.92665	0.7669	M	0.81942	2.565	0.49483	D	0.999791	D	0.76494	0.999	D	0.81914	0.995	D	0.92586	0.6079	10	0.51188	T	0.08	-5.2039	12.6813	0.56924	0.0:0.0:1.0:0.0	.	96	P58166	INHBE_HUMAN	S	41;96	ENSP00000450212:A41S;ENSP00000266646:A96S	ENSP00000266646:A96S	A	+	1	0	INHBE	56135872	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	2.083000	0.41615	2.438000	0.82558	0.655000	0.94253	GCT	INHBE	-	pfam_TGF-b_N	ENSG00000139269		0.612	INHBE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INHBE	HGNC	protein_coding	OTTHUMT00000406773.1	-	0.00	39	0	G	NM_031479		57849605	+1	tier1	-	no_errors	ENST00000266646	ensembl	human	known	74_37	missense	18.75	13	3	SNP	1.000	T
ITGA6	3655	genome.wustl.edu	37	2	173338951	173338951	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr2:173338951C>T	ENST00000264106.6	+	7	1264	c.1061C>T	c.(1060-1062)tCa>tTa	p.S354L	ITGA6_ENST00000409532.1_Missense_Mutation_p.S196L|ITGA6_ENST00000343713.4_Missense_Mutation_p.S310L|ITGA6_ENST00000409080.1_Missense_Mutation_p.S315L|ITGA6_ENST00000375221.2_Missense_Mutation_p.S354L|ITGA6_ENST00000264107.7_Missense_Mutation_p.S315L			P23229	ITA6_HUMAN	integrin, alpha 6	354					amelogenesis (GO:0097186)|blood coagulation (GO:0007596)|brown fat cell differentiation (GO:0050873)|cell adhesion mediated by integrin (GO:0033627)|cell junction assembly (GO:0034329)|cell-matrix adhesion (GO:0007160)|cell-substrate adhesion (GO:0031589)|cell-substrate junction assembly (GO:0007044)|cellular response to extracellular stimulus (GO:0031668)|cellular response to organic cyclic compound (GO:0071407)|digestive tract development (GO:0048565)|ectodermal cell differentiation (GO:0010668)|extracellular matrix organization (GO:0030198)|filopodium assembly (GO:0046847)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|nail development (GO:0035878)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of phosphorylation (GO:0042327)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|renal system development (GO:0072001)|single organismal cell-cell adhesion (GO:0016337)|skin development (GO:0043588)	basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell surface (GO:0009986)|cell-cell adherens junction (GO:0005913)|external side of plasma membrane (GO:0009897)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integrin alpha6-beta4 complex (GO:0034676)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)			NS(1)|breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|liver(1)|lung(18)|ovary(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	44			OV - Ovarian serous cystadenocarcinoma(117;0.0979)			CTGGCCTCTTCATTTGGCTAT	0.478																																																	0													115.0	102.0	106.0					2																	173338951		2203	4300	6503	SO:0001583	missense	0				CCDS2249.1, CCDS46451.1	2q31.1	2010-09-20			ENSG00000091409	ENSG00000091409		"""CD molecules"", ""Integrins"""	6142	protein-coding gene	gene with protein product		147556					Standard	NM_001079818		Approved	CD49f	uc002uhp.1	P23229	OTTHUMG00000132277	ENST00000264106.6:c.1061C>T	2.37:g.173338951C>T	ENSP00000264106:p.Ser354Leu		B2RMU9|B4DG69|B4DKB8|C4AM96|G5E9H1|Q08443|Q0MRC7|Q14646|Q16508|Q53RX7|Q59HB7|Q86VL6|Q9UCT1|Q9UN03	Missense_Mutation	SNP	pfam_Integrin_alpha-2,pfam_FG-GAP,smart_Int_alpha_beta-p,prints_Integrin_alpha	p.S354L	ENST00000264106.6	37	c.1061		2	.	.	.	.	.	.	.	.	.	.	C	33	5.269003	0.95429	.	.	ENSG00000091409	ENST00000412899;ENST00000409532;ENST00000264107;ENST00000264106;ENST00000375221;ENST00000343713;ENST00000409080;ENST00000442250;ENST00000458358	T;T;T;T;T;T;T;T;T	0.71461	-0.57;-0.57;-0.57;-0.57;-0.57;-0.57;-0.57;-0.57;-0.57	5.36	5.36	0.76844	.	0.000000	0.85682	D	0.000000	T	0.81654	0.4868	L	0.53617	1.68	0.80722	D	1	D;D;D	0.71674	0.991;0.998;0.998	D;D;D	0.74023	0.93;0.976;0.982	T	0.81326	-0.0983	10	0.48119	T	0.1	.	19.0937	0.93240	0.0:1.0:0.0:0.0	.	310;315;315	P23229-4;G5E9H1;P23229-2	.;.;.	L	201;196;315;354;354;310;315;354;310	ENSP00000413470:S201L;ENSP00000386614:S196L;ENSP00000264107:S315L;ENSP00000264106:S354L;ENSP00000364369:S354L;ENSP00000341078:S310L;ENSP00000386896:S315L;ENSP00000406694:S354L;ENSP00000394169:S310L	ENSP00000264106:S354L	S	+	2	0	ITGA6	173047197	1.000000	0.71417	0.991000	0.47740	0.989000	0.77384	4.969000	0.63735	2.505000	0.84491	0.655000	0.94253	TCA	ITGA6	-	smart_Int_alpha_beta-p,prints_Integrin_alpha	ENSG00000091409		0.478	ITGA6-201	KNOWN	basic	protein_coding	ITGA6	HGNC	protein_coding		-	0.00	72	0	C			173338951	+1	tier1	-	no_errors	ENST00000264106	ensembl	human	known	74_37	missense	19.23	21	5	SNP	1.000	T
ITGAV	3685	genome.wustl.edu	37	2	187516791	187516791	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr2:187516791C>T	ENST00000261023.3	+	15	1754	c.1480C>T	c.(1480-1482)Cct>Tct	p.P494S	ITGAV_ENST00000433736.2_Missense_Mutation_p.P448S|ITGAV_ENST00000374907.3_Missense_Mutation_p.P458S|AC017101.10_ENST00000453665.1_RNA	NM_002210.3	NP_002201	P06756	ITAV_HUMAN	integrin, alpha V	494					angiogenesis (GO:0001525)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apolipoprotein A-I-mediated signaling pathway (GO:0038027)|apoptotic cell clearance (GO:0043277)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|cell adhesion (GO:0007155)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cell-substrate adhesion (GO:0031589)|endodermal cell differentiation (GO:0035987)|entry of symbiont into host cell by promotion of host phagocytosis (GO:0052066)|ERK1 and ERK2 cascade (GO:0070371)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|negative chemotaxis (GO:0050919)|negative regulation of entry of bacterium into host cell (GO:2000536)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of lipid storage (GO:0010888)|negative regulation of lipid transport (GO:0032369)|negative regulation of lipoprotein metabolic process (GO:0050748)|negative regulation of low-density lipoprotein particle receptor biosynthetic process (GO:0045715)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of osteoblast proliferation (GO:0033690)|regulation of apoptotic cell clearance (GO:2000425)|regulation of phagocytosis (GO:0050764)|substrate adhesion-dependent cell spreading (GO:0034446)|viral entry into host cell (GO:0046718)	alphav-beta3 integrin-IGF-1-IGF1R complex (GO:0035867)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|integrin alphav-beta3 complex (GO:0034683)|integrin alphav-beta5 complex (GO:0034684)|integrin alphav-beta8 complex (GO:0034686)|integrin complex (GO:0008305)|lamellipodium membrane (GO:0031258)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	extracellular matrix binding (GO:0050840)|extracellular matrix protein binding (GO:1990430)|fibronectin binding (GO:0001968)|metal ion binding (GO:0046872)|protease binding (GO:0002020)|transforming growth factor beta binding (GO:0050431)|virus receptor activity (GO:0001618)|voltage-gated calcium channel activity (GO:0005245)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(19)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	47			OV - Ovarian serous cystadenocarcinoma(117;0.0185)|Epithelial(96;0.072)|all cancers(119;0.189)	STAD - Stomach adenocarcinoma(3;0.106)|COAD - Colon adenocarcinoma(31;0.108)	Antithymocyte globulin(DB00098)	CTGCTCACTGCCTGGAACAGC	0.388																																					Melanoma(58;108 1995 6081)												0													70.0	72.0	71.0					2																	187516791		2203	4300	6503	SO:0001583	missense	0				CCDS2292.1, CCDS46470.1, CCDS46471.1	2q31-q32	2012-04-20	2012-04-20		ENSG00000138448	ENSG00000138448		"""CD molecules"", ""Integrins"""	6150	protein-coding gene	gene with protein product		193210	"""antigen identified by monoclonal antibody L230"", ""vitronectin receptor"", ""integrin, alpha V (vitronectin receptor, alpha polypeptide, antigen CD51)"""	VNRA, MSK8, VTNR		2454952	Standard	NM_001144999		Approved	CD51	uc002upq.4	P06756	OTTHUMG00000132635	ENST00000261023.3:c.1480C>T	2.37:g.187516791C>T	ENSP00000261023:p.Pro494Ser		A0AV67|B0LPF4|B7Z883|B7ZLX0|D3DPG8|E7EWZ6|Q53SK4|Q59EB7|Q6LD15	Missense_Mutation	SNP	pfam_Integrin_alpha-2,pfam_FG-GAP,pfam_Integrin_alpha_C_CS,smart_Int_alpha_beta-p,prints_Integrin_alpha	p.P494S	ENST00000261023.3	37	c.1480	CCDS2292.1	2	.	.	.	.	.	.	.	.	.	.	C	15.18	2.756559	0.49362	.	.	ENSG00000138448	ENST00000261023;ENST00000374907;ENST00000433736	T;T;T	0.45276	0.9;0.9;0.9	5.32	4.39	0.52855	Integrin alpha-2 (1);	0.157234	0.64402	D	0.000020	T	0.36138	0.0956	L	0.45228	1.405	0.46874	D	0.999234	B;B;B	0.29552	0.248;0.036;0.248	B;B;B	0.30179	0.067;0.018;0.112	T	0.27640	-1.0068	10	0.52906	T	0.07	.	12.7965	0.57562	0.1642:0.8358:0.0:0.0	.	448;458;494	E7EWZ6;P06756-2;P06756	.;.;ITAV_HUMAN	S	494;458;448	ENSP00000261023:P494S;ENSP00000364042:P458S;ENSP00000404291:P448S	ENSP00000261023:P494S	P	+	1	0	ITGAV	187225036	0.986000	0.35501	0.997000	0.53966	0.962000	0.63368	0.552000	0.23376	2.634000	0.89283	0.655000	0.94253	CCT	ITGAV	-	pfam_Integrin_alpha-2	ENSG00000138448		0.388	ITGAV-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGAV	HGNC	protein_coding	OTTHUMT00000255882.2	-	0.00	78	0	C	NM_002210		187516791	+1	tier1	-	no_errors	ENST00000261023	ensembl	human	known	74_37	missense	9.76	37	4	SNP	0.997	T
ITPKB	3707	genome.wustl.edu	37	1	226822416	226822416	+	Missense_Mutation	SNP	C	C	T	rs554325553		TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr1:226822416C>T	ENST00000272117.3	-	7	2796	c.2797G>A	c.(2797-2799)Gtc>Atc	p.V933I	ITPKB_ENST00000429204.1_Missense_Mutation_p.V933I			P27987	IP3KB_HUMAN	inositol-trisphosphate 3-kinase B	933					cell surface receptor signaling pathway (GO:0007166)|inositol phosphate metabolic process (GO:0043647)|MAPK cascade (GO:0000165)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of Ras protein signal transduction (GO:0046579)|positive thymic T cell selection (GO:0045059)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	ATP binding (GO:0005524)|inositol-1,4,5-trisphosphate 3-kinase activity (GO:0008440)			central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(4)|lung(13)|ovary(4)|prostate(1)|skin(1)	30		Prostate(94;0.0773)				AGGATGTCGACGAGGTTATTG	0.667													T|||	1	0.000199681	0.0	0.0	5008	,	,		17392	0.001		0.0	False		,,,				2504	0.0				Colon(84;110 1851 5306 33547)												0													62.0	53.0	56.0					1																	226822416		2203	4300	6503	SO:0001583	missense	0			AJ242780	CCDS1555.1	1q42.12	2011-04-28	2011-04-28		ENSG00000143772	ENSG00000143772	2.7.1.127		6179	protein-coding gene	gene with protein product		147522	"""inositol 1,4,5-trisphosphate 3-kinase B"""			1654894, 1330886	Standard	NM_002221		Approved	IP3KB, IP3-3KB	uc010pvo.2	P27987	OTTHUMG00000037582	ENST00000272117.3:c.2797G>A	1.37:g.226822416C>T	ENSP00000272117:p.Val933Ile		Q5VWL9|Q5VWM0|Q96BZ2|Q96JS1|Q9UH47	Missense_Mutation	SNP	pfam_IPK	p.V933I	ENST00000272117.3	37	c.2797	CCDS1555.1	1	.	.	.	.	.	.	.	.	.	.	T	0.609	-0.825775	0.02734	.	.	ENSG00000143772	ENST00000272117;ENST00000429204	T;T	0.14144	2.53;2.53	5.06	3.91	0.45181	.	0.052233	0.64402	N	0.000001	T	0.02380	0.0073	N	0.00175	-1.925	0.09310	N	0.999994	B	0.02656	0.0	B	0.06405	0.002	T	0.44742	-0.9308	10	0.02654	T	1	-13.4995	9.6474	0.39877	0.0:0.1443:0.0:0.8557	.	933	P27987	IP3KB_HUMAN	I	933	ENSP00000272117:V933I;ENSP00000411152:V933I	ENSP00000272117:V933I	V	-	1	0	ITPKB	224889039	1.000000	0.71417	1.000000	0.80357	0.300000	0.27592	2.003000	0.40844	0.266000	0.21894	-0.361000	0.07541	GTC	ITPKB	-	pfam_IPK	ENSG00000143772		0.667	ITPKB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITPKB	HGNC	protein_coding	OTTHUMT00000091632.1	-	0.00	52	0	C	NM_002221		226822416	-1	tier1	-	no_errors	ENST00000272117	ensembl	human	known	74_37	missense	10.53	34	4	SNP	1.000	T
KCNH4	23415	genome.wustl.edu	37	17	40321642	40321642	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr17:40321642C>A	ENST00000264661.3	-	9	1775	c.1443G>T	c.(1441-1443)atG>atT	p.M481I	KCNH4_ENST00000607371.1_Missense_Mutation_p.M481I	NM_012285.2	NP_036417.1	Q9UQ05	KCNH4_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 4	481					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	phosphorelay sensor kinase activity (GO:0000155)|voltage-gated potassium channel activity (GO:0005249)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(15)|skin(2)|urinary_tract(1)	32		all_cancers(22;1.24e-06)|all_epithelial(22;4.33e-05)|Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.126)		GGCGCGAGTACATGCGCTGGA	0.657																																					NSCLC(117;707 1703 2300 21308 31858)												0													90.0	73.0	79.0					17																	40321642		2203	4300	6503	SO:0001583	missense	0			AB022698	CCDS11420.1	17q21	2012-07-05				ENSG00000089558		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6253	protein-coding gene	gene with protein product		604528				10455180, 16382104	Standard	NM_012285		Approved	Kv12.3, elk1	uc002hzb.2	Q9UQ05		ENST00000264661.3:c.1443G>T	17.37:g.40321642C>A	ENSP00000264661:p.Met481Ile			Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_2pore_dom_K_chnl_dom,pfam_PAS_fold_3,pfam_PAS_fold,pfam_PAS_4,pfam_cNMP-bd_dom,superfamily_cNMP-bd-like,superfamily_PAS,smart_PAC,smart_cNMP-bd_dom,prints_K_chnl_volt-dep_EAG/ELK/ERG,prints_K_chnl_volt-dep_ELK,prints_K_chnl_volt-dep_ERG,pfscan_cNMP-bd_dom,pfscan_PAS,pfscan_PAS-assoc_C,tigrfam_PAS	p.M481I	ENST00000264661.3	37	c.1443	CCDS11420.1	17	.	.	.	.	.	.	.	.	.	.	C	20.3	3.971454	0.74246	.	.	ENSG00000089558	ENST00000264661	D	0.97404	-4.37	4.36	4.36	0.52297	.	0.000000	0.44483	D	0.000455	D	0.95717	0.8607	L	0.55103	1.725	0.80722	D	1	B	0.25563	0.129	B	0.29176	0.099	D	0.94931	0.8082	10	0.72032	D	0.01	.	17.084	0.86605	0.0:1.0:0.0:0.0	.	481	Q9UQ05	KCNH4_HUMAN	I	481	ENSP00000264661:M481I	ENSP00000264661:M481I	M	-	3	0	KCNH4	37575168	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.616000	0.83018	2.255000	0.74692	0.462000	0.41574	ATG	KCNH4	-	NULL	ENSG00000089558		0.657	KCNH4-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	KCNH4	HGNC	protein_coding	OTTHUMT00000449791.2	-	0.00	61	0	C	NM_012285		40321642	-1	tier1	-	no_errors	ENST00000264661	ensembl	human	known	74_37	missense	10.26	35	4	SNP	1.000	A
KCNIP3	30818	genome.wustl.edu	37	2	95963122	95963122	+	5'UTR	SNP	G	G	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr2:95963122G>T	ENST00000295225.5	+	0	71				KCNIP3_ENST00000377181.2_3'UTR	NM_013434.4	NP_038462.1	Q9Y2W7	CSEN_HUMAN	Kv channel interacting protein 3, calsenilin						apoptotic process (GO:0006915)|behavioral response to pain (GO:0048266)|intracellular protein transport (GO:0006886)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of neuron apoptotic process (GO:0043523)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|sensory perception of pain (GO:0019233)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	axon terminus (GO:0043679)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)	calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|potassium channel activity (GO:0005267)|potassium channel regulator activity (GO:0015459)|sequence-specific DNA binding (GO:0043565)|transcription corepressor activity (GO:0003714)|voltage-gated ion channel activity (GO:0005244)			NS(1)|breast(2)|endometrium(1)|large_intestine(2)|lung(3)|ovary(3)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	16				READ - Rectum adenocarcinoma(193;0.13)		CAGCCGGCCTGGGCAGTCTTG	0.642																																																	0													13.0	20.0	18.0					2																	95963122		690	1584	2274	SO:0001623	5_prime_UTR_variant	0			AF199599	CCDS2013.1, CCDS33245.1	2q21.1	2013-01-10	2006-02-11	2006-02-11	ENSG00000115041	ENSG00000115041		"""EF-hand domain containing"""	15523	protein-coding gene	gene with protein product		604662	"""calsenilin, presenilin-binding protein, EF hand transcription factor"""	CSEN		9771752, 10078534	Standard	NM_013434		Approved	DREAM, KCHIP3, calsenilin	uc002sup.3	Q9Y2W7	OTTHUMG00000130392	ENST00000295225.5:c.-65G>T	2.37:g.95963122G>T			H7BY46|Q3YAC3|Q3YAC4|Q53TJ5|Q96T40|Q9UJ84|Q9UJ85	RNA	SNP	-	NULL	ENST00000295225.5	37	NULL	CCDS2013.1	2																																																																																			KCNIP3	-	-	ENSG00000115041		0.642	KCNIP3-001	KNOWN	basic|CCDS	protein_coding	KCNIP3	HGNC	protein_coding	OTTHUMT00000252770.1	-	0.00	206	0	G	NM_013434		95963122	+1	tier1	-	no_errors	ENST00000377181	ensembl	human	known	74_37	rna	6.17	76	5	SNP	0.016	T
KDM4A	9682	genome.wustl.edu	37	1	44134920	44134920	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr1:44134920G>T	ENST00000372396.3	+	10	1447	c.1313G>T	c.(1312-1314)aGg>aTg	p.R438M		NM_014663.2	NP_055478.2	O75164	KDM4A_HUMAN	lysine (K)-specific demethylase 4A	438					cardiac muscle hypertrophy in response to stress (GO:0014898)|histone demethylation (GO:0016577)|histone H3-K36 demethylation (GO:0070544)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	histone demethylase activity (H3-K36 specific) (GO:0051864)|methylated histone binding (GO:0035064)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(13)|prostate(1)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(1)	37						GCCCCTGTGAGGCCCACCCAT	0.532																																																	0													145.0	136.0	139.0					1																	44134920		2203	4300	6503	SO:0001583	missense	0			AB014577	CCDS491.1	1p34.1	2013-01-23	2009-04-06	2009-04-06	ENSG00000066135	ENSG00000066135		"""Chromatin-modifying enzymes / K-demethylases"", ""Tudor domain containing"""	22978	protein-coding gene	gene with protein product	"""jumonji C domain-containing histone demethylase 3A"", ""tudor domain containing 14A"""	609764	"""jumonji domain containing 2"", ""jumonji domain containing 2A"""	JMJD2, JMJD2A		9734811, 15138608	Standard	XM_005271354		Approved	KIAA0677, JHDM3A, TDRD14A	uc001cjx.3	O75164	OTTHUMG00000007560	ENST00000372396.3:c.1313G>T	1.37:g.44134920G>T	ENSP00000361473:p.Arg438Met		Q5VVB1	Missense_Mutation	SNP	pfam_JmjC_dom,pfam_TF_JmjN,superfamily_Znf_FYVE_PHD,smart_TF_JmjN,smart_JmjC_dom,smart_Znf_PHD,smart_Tudor,pfscan_TF_JmjN,pfscan_JmjC_dom	p.R438M	ENST00000372396.3	37	c.1313	CCDS491.1	1	.	.	.	.	.	.	.	.	.	.	G	16.34	3.096180	0.56075	.	.	ENSG00000066135	ENST00000372396	T	0.16073	2.37	5.23	4.07	0.47477	.	0.801478	0.12491	N	0.464270	T	0.18718	0.0449	L	0.53249	1.67	0.33002	D	0.526318	P;P	0.47350	0.894;0.875	B;B	0.41510	0.339;0.359	T	0.14980	-1.0453	10	0.45353	T	0.12	-26.2744	10.7163	0.46015	0.1257:0.0:0.8743:0.0	.	438;438	B4DT38;O75164	.;KDM4A_HUMAN	M	438	ENSP00000361473:R438M	ENSP00000361473:R438M	R	+	2	0	KDM4A	43907507	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	1.655000	0.37345	2.596000	0.87737	0.561000	0.74099	AGG	KDM4A	-	NULL	ENSG00000066135		0.532	KDM4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KDM4A	HGNC	protein_coding	OTTHUMT00000019960.1	-	0.00	85	0	G	NM_014663		44134920	+1	tier1	-	no_errors	ENST00000372396	ensembl	human	known	74_37	missense	7.14	52	4	SNP	1.000	T
KIAA1107	23285	genome.wustl.edu	37	1	92643979	92643979	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr1:92643979G>A	ENST00000370378.4	+	7	1336	c.1238G>A	c.(1237-1239)aGt>aAt	p.S413N	KIAA1107_ENST00000409154.4_Missense_Mutation_p.S468N	NM_015237.2	NP_056052.2	Q9UPP5	K1107_HUMAN	KIAA1107	468										breast(4)|central_nervous_system(1)|endometrium(3)|kidney(2)|prostate(1)|skin(3)	14						AGGACAAAGAGTACCCCATCT	0.393																																																	0													165.0	149.0	154.0					1																	92643979		692	1591	2283	SO:0001583	missense	0			AB029030	CCDS44172.1	1p22.1	2008-02-05			ENSG00000069712	ENSG00000069712			29192	protein-coding gene	gene with protein product						10470851	Standard	NM_015237		Approved		uc010otd.2	Q9UPP5	OTTHUMG00000010292	ENST00000370378.4:c.1238G>A	1.37:g.92643979G>A	ENSP00000359404:p.Ser413Asn		O14767|Q8N3X7	Missense_Mutation	SNP	NULL	p.S468N	ENST00000370378.4	37	c.1403	CCDS44172.1	1	.	.	.	.	.	.	.	.	.	.	G	5.361	0.251808	0.10185	.	.	ENSG00000069712	ENST00000409154;ENST00000370378	T;T	0.06371	3.34;3.31	5.74	1.52	0.23074	.	0.485209	0.22891	N	0.054389	T	0.01092	0.0036	N	0.24115	0.695	0.23546	N	0.997442	B	0.12013	0.005	B	0.13407	0.009	T	0.47995	-0.9073	10	0.12103	T	0.63	.	8.6691	0.34138	0.5081:0.0:0.4919:0.0	.	413	E9PEZ5	.	N	468;413	ENSP00000386957:S468N;ENSP00000359404:S413N	ENSP00000359404:S413N	S	+	2	0	KIAA1107	92416567	0.999000	0.42202	0.084000	0.20598	0.209000	0.24338	1.127000	0.31357	0.012000	0.14892	0.561000	0.74099	AGT	KIAA1107	-	NULL	ENSG00000069712		0.393	KIAA1107-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1107	HGNC	protein_coding	OTTHUMT00000028375.3	-	0.00	98	0	G	XM_034086		92643979	+1	tier1	-	no_errors	ENST00000409154	ensembl	human	known	74_37	missense	37.84	46	28	SNP	0.715	A
KDM5B	10765	genome.wustl.edu	37	1	202742369	202742369	+	Silent	SNP	T	T	C			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr1:202742369T>C	ENST00000367265.3	-	4	1617	c.453A>G	c.(451-453)aaA>aaG	p.K151K	KDM5B_ENST00000367264.2_Silent_p.K151K	NM_006618.3	NP_006609.3	Q9UGL1	KDM5B_HUMAN	lysine (K)-specific demethylase 5B	151	ARID. {ECO:0000255|PROSITE- ProRule:PRU00355}.				histone H3-K4 demethylation (GO:0034720)|histone H3-K4 demethylation, trimethyl-H3-K4-specific (GO:0034721)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone demethylase activity (H3-dimethyl-K4 specific) (GO:0034648)|histone demethylase activity (H3-trimethyl-K4 specific) (GO:0034647)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			breast(2)|ovary(2)|skin(1)|urinary_tract(1)	6						TTTTGGTCCATTTTCTATCCT	0.393																																																	0													153.0	134.0	141.0					1																	202742369		2203	4300	6503	SO:0001819	synonymous_variant	0			AJ243706	CCDS30974.1	1q32.1	2014-06-12	2009-04-06	2009-04-06	ENSG00000117139	ENSG00000117139		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	18039	protein-coding gene	gene with protein product	"""cancer/testis antigen 31"", ""protein phosphatase 1, regulatory subunit 98"""	605393	"""Jumonji, AT rich interactive domain 1B (RBP2-like)"", ""jumonji, AT rich interactive domain 1B"""	JARID1B		11483573, 11478881	Standard	NM_006618		Approved	RBBP2H1A, PLU-1, CT31, PPP1R98	uc001gyf.3	Q9UGL1	OTTHUMG00000041401	ENST00000367265.3:c.453A>G	1.37:g.202742369T>C			O95811|Q15752|Q9Y3Q5	Silent	SNP	pfam_Lys_sp_deMease_like_dom,pfam_JmjC_dom,pfam_Znf_PHD-finger,pfam_ARID/BRIGHT_DNA-bd,pfam_Znf_C5HC2,pfam_TF_JmjN,superfamily_ARID/BRIGHT_DNA-bd,superfamily_Znf_FYVE_PHD,smart_TF_JmjN,smart_ARID/BRIGHT_DNA-bd,smart_Znf_PHD,smart_JmjC_dom,pfscan_TF_JmjN,pfscan_JmjC_dom,pfscan_Znf_PHD-finger,pfscan_ARID/BRIGHT_DNA-bd	p.K151	ENST00000367265.3	37	c.453	CCDS30974.1	1																																																																																			KDM5B	-	pfam_ARID/BRIGHT_DNA-bd,superfamily_ARID/BRIGHT_DNA-bd,smart_ARID/BRIGHT_DNA-bd,pfscan_ARID/BRIGHT_DNA-bd	ENSG00000117139		0.393	KDM5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KDM5B	HGNC	protein_coding	OTTHUMT00000099184.2	-	0.00	56	0	T	NM_006618		202742369	-1	tier1	-	no_errors	ENST00000367264	ensembl	human	known	74_37	silent	41.38	17	12	SNP	1.000	C
KIAA1549	57670	genome.wustl.edu	37	7	138522658	138522658	+	Missense_Mutation	SNP	T	T	C			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr7:138522658T>C	ENST00000422774.1	-	20	5894	c.5846A>G	c.(5845-5847)cAc>cGc	p.H1949R	TMEM213_ENST00000413208.1_Missense_Mutation_p.W67R|KIAA1549_ENST00000440172.1_Missense_Mutation_p.H1933R|KIAA1549_ENST00000242365.4_Missense_Mutation_p.H1883R			Q9HCM3	K1549_HUMAN	KIAA1549	1949						integral component of membrane (GO:0016021)			KIAA1549/BRAF(703)	large_intestine(4)|pancreas(1)|upper_aerodigestive_tract(2)	7						CGATCAGCTGTGGAAGTTCTG	0.562			O	BRAF	pilocytic astrocytoma																																NSCLC(119;1534 1718 44213 46230 50068)			Dom	yes		7	7q34	57670	KIAA1549		O	0													45.0	47.0	46.0					7																	138522658		1960	4150	6110	SO:0001583	missense	0				CCDS47723.1, CCDS47723.2, CCDS56513.1	7q34	2009-10-09			ENSG00000122778	ENSG00000122778			22219	protein-coding gene	gene with protein product		613344					Standard	NM_020910		Approved		uc011kql.2	Q9HCM3	OTTHUMG00000157214	ENST00000422774.1:c.5846A>G	7.37:g.138522658T>C	ENSP00000416040:p.His1949Arg		B6HY55|B6HY56|B6HY58|B6HY60|B6HY61|B6HY62|B6HY63|B6HY64|B6HY65|B6HY66|Q5BJD6|Q8IY15|Q9H0M3	Missense_Mutation	SNP	NULL	p.H1949R	ENST00000422774.1	37	c.5846	CCDS56513.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	21.8|21.8	4.203214|4.203214	0.79127|0.79127	.|.	.|.	ENSG00000122778|ENSG00000214128	ENST00000440172;ENST00000242365;ENST00000422774|ENST00000413208	T;T;T|.	0.53857|.	0.6;0.63;0.78|.	5.54|5.54	5.54|5.54	0.83059|0.83059	.|.	0.049735|.	0.85682|.	D|.	0.000000|.	T|T	0.59918|0.59918	0.2229|0.2229	L|L	0.34521|0.34521	1.04|1.04	0.80722|0.80722	D|D	1|1	D;D;D;D|.	0.89917|.	0.999;0.996;1.0;0.996|.	D;D;D;D|.	0.91635|.	0.997;0.99;0.999;0.99|.	T|T	0.64097|0.64097	-0.6487|-0.6487	10|6	0.66056|0.87932	D|D	0.02|0	.|.	14.8635|14.8635	0.70399|0.70399	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	1949;733;1933;717|.	Q9HCM3;Q9HCM3-4;Q9HCM3-2;Q9HCM3-3|.	K1549_HUMAN;.;.;.|.	R|R	1933;1883;1949|67	ENSP00000406661:H1933R;ENSP00000242365:H1883R;ENSP00000416040:H1949R|.	ENSP00000242365:H1883R|ENSP00000401570:W67R	H|W	-|+	2|1	0|0	KIAA1549|TMEM213	138173198|138173198	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.807000|0.807000	0.45602|0.45602	4.395000|4.395000	0.59678|0.59678	2.093000|2.093000	0.63338|0.63338	0.533000|0.533000	0.62120|0.62120	CAC|TGG	KIAA1549	-	NULL	ENSG00000122778		0.562	KIAA1549-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIAA1549	HGNC	protein_coding	OTTHUMT00000348092.1		0.00	54	0	T			138522658	-1			no_errors	ENST00000422774	ensembl	human	known	74_37	missense	12.12	29	4	SNP	1.000	C
KIDINS220	57498	genome.wustl.edu	37	2	8943200	8943200	+	Nonsense_Mutation	SNP	C	C	A			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr2:8943200C>A	ENST00000256707.3	-	8	842	c.661G>T	c.(661-663)Gaa>Taa	p.E221*	KIDINS220_ENST00000319688.5_Nonsense_Mutation_p.E222*|KIDINS220_ENST00000418530.1_Nonsense_Mutation_p.E179*|KIDINS220_ENST00000473731.1_Nonsense_Mutation_p.E221*|KIDINS220_ENST00000427284.1_Nonsense_Mutation_p.E221*	NM_020738.2	NP_065789.1	Q9ULH0	KDIS_HUMAN	kinase D-interacting substrate, 220kDa	221					activation of MAPKK activity (GO:0000186)|cellular response to nerve growth factor stimulus (GO:1990090)|cytoplasmic transport (GO:0016482)|dendrite morphogenesis (GO:0048813)|in utero embryonic development (GO:0001701)|nerve growth factor signaling pathway (GO:0038180)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of neuron projection development (GO:0010976)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|membrane (GO:0016020)|protein complex (GO:0043234)	PDZ domain binding (GO:0030165)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(11)|lung(25)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	60	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)					TTCAAAATTTCTTTTACTGAC	0.363																																																	0													122.0	109.0	113.0					2																	8943200		1873	4093	5966	SO:0001587	stop_gained	0			AK025528	CCDS42650.1	2p24	2013-01-10			ENSG00000134313	ENSG00000134313		"""Ankyrin repeat domain containing"""	29508	protein-coding gene	gene with protein product	"""ankyrin repeat-rich membrane-spanning protein"""	615759				10998417, 10574462	Standard	NM_020738		Approved	ARMS	uc002qzc.2	Q9ULH0	OTTHUMG00000151658	ENST00000256707.3:c.661G>T	2.37:g.8943200C>A	ENSP00000256707:p.Glu221*		A1L4N4|Q4VC08|Q6MZU2|Q9H889|Q9H9E4|Q9NT37|Q9UF42	Nonsense_Mutation	SNP	pfam_KAP_NTPase,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,superfamily_SAM/pointed,superfamily_P-loop_NTPase,smart_Ankyrin_rpt,prints_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.E221*	ENST00000256707.3	37	c.661	CCDS42650.1	2	.	.	.	.	.	.	.	.	.	.	C	40	8.271595	0.98737	.	.	ENSG00000134313	ENST00000256707;ENST00000427284;ENST00000418530;ENST00000473731;ENST00000489024;ENST00000319688	.	.	.	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.3431	0.98773	0.0:1.0:0.0:0.0	.	.	.	.	X	221;221;179;221;222;222	.	.	E	-	1	0	KIDINS220	8860651	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	7.398000	0.79919	2.880000	0.98712	0.650000	0.86243	GAA	KIDINS220	-	superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000134313		0.363	KIDINS220-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIDINS220	HGNC	protein_coding	OTTHUMT00000323408.2		0.00	53	0	C	NM_020738		8943200	-1			no_errors	ENST00000256707	ensembl	human	known	74_37	nonsense	15.79	16	3	SNP	1.000	A
KIF2B	84643	genome.wustl.edu	37	17	51901127	51901127	+	Missense_Mutation	SNP	A	A	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr17:51901127A>T	ENST00000268919.4	+	1	889	c.733A>T	c.(733-735)Atg>Ttg	p.M245L		NM_032559.4	NP_115948.4	Q8N4N8	KIF2B_HUMAN	kinesin family member 2B	245	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule depolymerization (GO:0007019)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|regulation of chromosome segregation (GO:0051983)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|kinetochore (GO:0000776)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(1)|breast(2)|endometrium(7)|kidney(2)|large_intestine(15)|lung(58)|ovary(5)|prostate(4)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	104						CAATGTGGTTATGGTGCATGA	0.537																																																	0													125.0	103.0	110.0					17																	51901127		2203	4300	6503	SO:0001583	missense	0			AF333335	CCDS32685.1	17q22	2014-08-12			ENSG00000141200	ENSG00000141200		"""Kinesins"""	29443	protein-coding gene	gene with protein product		615142				11416179	Standard	NM_032559		Approved		uc002iua.2	Q8N4N8	OTTHUMG00000177756	ENST00000268919.4:c.733A>T	17.37:g.51901127A>T	ENSP00000268919:p.Met245Leu		Q96MA2|Q9BXG6	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.M245L	ENST00000268919.4	37	c.733	CCDS32685.1	17	.	.	.	.	.	.	.	.	.	.	A	9.894	1.204986	0.22205	.	.	ENSG00000141200	ENST00000268919	T	0.14893	2.47	5.63	4.49	0.54785	Kinesin, motor domain (4);	0.197164	0.35349	N	0.003264	T	0.04048	0.0113	N	0.00395	-1.55	0.30871	N	0.732478	B	0.02656	0.0	B	0.11329	0.006	T	0.18116	-1.0347	10	0.06365	T	0.9	.	11.9688	0.53051	0.8554:0.1445:0.0:0.0	.	245	Q8N4N8	KIF2B_HUMAN	L	245	ENSP00000268919:M245L	ENSP00000268919:M245L	M	+	1	0	KIF2B	49256126	0.999000	0.42202	1.000000	0.80357	0.989000	0.77384	2.344000	0.44010	2.258000	0.74832	0.533000	0.62120	ATG	KIF2B	-	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom	ENSG00000141200		0.537	KIF2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF2B	HGNC	protein_coding	OTTHUMT00000438854.1	-	0.00	62	0	A	NM_032559		51901127	+1	tier1	-	no_errors	ENST00000268919	ensembl	human	known	74_37	missense	14.71	29	5	SNP	1.000	T
KLK1	3816	genome.wustl.edu	37	19	51324991	51324991	+	Silent	SNP	G	G	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr19:51324991G>T	ENST00000301420.2	-	2	218	c.183C>A	c.(181-183)ctC>ctA	p.L61L	KLK1_ENST00000448701.2_5'UTR|CTD-2568A17.5_ENST00000326989.5_lincRNA	NM_002257.2	NP_002248.1	P06870	KLK1_HUMAN	kallikrein 1	61	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	serine-type endopeptidase activity (GO:0004252)			breast(1)|large_intestine(4)|lung(7)|urinary_tract(1)	13		all_neural(266;0.0199)		OV - Ovarian serous cystadenocarcinoma(262;0.00224)|GBM - Glioblastoma multiforme(134;0.00399)	Aprotinin(DB06692)	GAGCAGCTGTGAGCACCCACT	0.617																																																	0													37.0	32.0	34.0					19																	51324991		2203	4300	6503	SO:0001819	synonymous_variant	0			L10038	CCDS12804.1	19q13.3	2008-02-05	2006-10-27			ENSG00000167748	3.4.21.35	"""Kallikreins"""	6357	protein-coding gene	gene with protein product		147910	"""kallikrein 1, renal/pancreas/salivary"""			1684954, 16800724, 16800723	Standard	NM_002257		Approved	Klk6	uc002ptk.1	P06870		ENST00000301420.2:c.183C>A	19.37:g.51324991G>T			Q66US9|Q86U61|Q8TCV8|Q9BS53|Q9NQU4|Q9UD19|Q9UMJ1	Silent	SNP	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,prints_Peptidase_S1A,pfscan_Peptidase_S1	p.L61	ENST00000301420.2	37	c.183	CCDS12804.1	19																																																																																			KLK1	-	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,prints_Peptidase_S1A,pfscan_Peptidase_S1	ENSG00000167748		0.617	KLK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLK1	HGNC	protein_coding	OTTHUMT00000464135.2	-	0.00	94	0	G	NM_002257		51324991	-1	tier1	-	no_errors	ENST00000301420	ensembl	human	known	74_37	silent	16.67	20	4	SNP	1.000	T
KLRF2	100431172	genome.wustl.edu	37	12	10048295	10048295	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr12:10048295G>T	ENST00000535540.1	+	6	594	c.487G>T	c.(487-489)Gtg>Ttg	p.V163L		NM_001190765.1	NP_001177694.1	D3W0D1	KLRF2_HUMAN	killer cell lectin-like receptor subfamily F, member 2	163	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				cytokine secretion (GO:0050663)|natural killer cell degranulation (GO:0043320)	integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)|protein homodimerization activity (GO:0042803)										TAGGTTTTCAGTGATTGGACC	0.378																																																	0																																										SO:0001583	missense	0				CCDS53743.1	12p13.31	2010-06-30				ENSG00000256797		"""Killer cell lectin-like receptors"", ""C-type lectin domain containing"""	37646	protein-coding gene	gene with protein product						20194751	Standard	NM_001190765		Approved	NKp65	uc021quy.1	D3W0D1		ENST00000535540.1:c.487G>T	12.37:g.10048295G>T	ENSP00000438244:p.Val163Leu			Missense_Mutation	SNP	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin,prints_AntifreezeII	p.V163L	ENST00000535540.1	37	c.487	CCDS53743.1	12	.	.	.	.	.	.	.	.	.	.	G	9.459	1.092548	0.20471	.	.	ENSG00000256797	ENST00000535540	T	0.18502	2.21	1.98	-3.22	0.05125	.	.	.	.	.	T	0.07548	0.0190	N	0.11064	0.09	0.09310	N	1	.	.	.	.	.	.	T	0.31223	-0.9951	7	0.54805	T	0.06	.	2.8025	0.05418	0.4514:0.0:0.3401:0.2085	.	.	.	.	L	163	ENSP00000438244:V163L	ENSP00000438244:V163L	V	+	1	0	KLRF2	9939562	0.000000	0.05858	0.000000	0.03702	0.205000	0.24178	-1.393000	0.02521	-0.931000	0.03746	0.313000	0.20887	GTG	KLRF2	-	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin	ENSG00000256797		0.378	KLRF2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	KLRF2	HGNC	protein_coding		-	0.00	74	0	G	NM_001190765		10048295	+1	tier1	-	no_errors	ENST00000535540	ensembl	human	known	74_37	missense	7.55	49	4	SNP	0.000	T
KMT2D	8085	genome.wustl.edu	37	12	49435318	49435318	+	Splice_Site	SNP	G	G	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr12:49435318G>T	ENST00000301067.7	-	31	6234	c.6235C>A	c.(6235-6237)Cag>Aag	p.Q2079K		NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	2079					chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)										CTCTCAGCCTGCTACAGGGGG	0.642																																																	0													64.0	70.0	68.0					12																	49435318		2068	4203	6271	SO:0001630	splice_region_variant	0			AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.6235-1C>A	12.37:g.49435318G>T			O14687	Missense_Mutation	SNP	pfam_Znf_PHD-finger,pfam_SET_dom,pfam_FYrich_C,pfam_FYrich_N,superfamily_Znf_FYVE_PHD,superfamily_HMG_box_dom,smart_Znf_PHD,smart_Znf_RING,smart_HMG_box_dom,smart_FYrich_N,smart_FYrich_C,smart_SET_dom,smart_Post-SET_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_PHD-finger,pfscan_Znf_RING	p.Q2079K	ENST00000301067.7	37	c.6235	CCDS44873.1	12	.	.	.	.	.	.	.	.	.	.	G	11.69	1.714344	0.30413	.	.	ENSG00000167548	ENST00000301067	T	0.79749	-1.3	4.28	4.28	0.50868	High mobility group, HMG1/HMG2 (1);	0.000000	0.34555	N	0.003867	D	0.82435	0.5036	N	0.19112	0.55	0.51767	D	0.999931	D	0.69078	0.997	D	0.73380	0.98	D	0.85324	0.1086	10	0.87932	D	0	.	16.6937	0.85328	0.0:0.0:1.0:0.0	.	2079	O14686	MLL2_HUMAN	K	2079	ENSP00000301067:Q2079K	ENSP00000301067:Q2079K	Q	-	1	0	MLL2	47721585	.	.	1.000000	0.80357	0.976000	0.68499	.	.	2.686000	0.91538	0.561000	0.74099	CAG	KMT2D	-	smart_HMG_box_dom	ENSG00000167548		0.642	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KMT2D	HGNC	protein_coding	OTTHUMT00000390183.2	-	0.00	45	0	G		Missense_Mutation	49435318	-1	tier1	-	no_errors	ENST00000301067	ensembl	human	known	74_37	missense	12.90	27	4	SNP	1.000	T
KNCN	148930	genome.wustl.edu	37	1	47015625	47015625	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr1:47015625G>T	ENST00000481882.2	-	2	512	c.201C>A	c.(199-201)gaC>gaA	p.D67E	KNCN_ENST00000524908.1_5'Flank|KNCN_ENST00000396314.3_Intron|MKNK1-AS1_ENST00000602433.1_RNA			A6PVL3	KNCN_HUMAN	kinocilin	67						apical plasma membrane (GO:0016324)|ciliary basal body (GO:0036064)|cuticular plate (GO:0032437)|integral component of membrane (GO:0016021)|kinocilium (GO:0060091)|neuronal cell body (GO:0043025)				central_nervous_system(1)|endometrium(1)|lung(1)|ovary(1)	4	Acute lymphoblastic leukemia(166;0.155)					GCAGGATGTGGTCCAGGTTGA	0.592																																																	0																																										SO:0001583	missense	0			AK056573	CCDS44133.1	1p33	2014-02-12	2006-10-26		ENSG00000162456	ENSG00000162456			26488	protein-coding gene	gene with protein product		611455				15855039	Standard	NM_001097611		Approved	FLJ32011, KINO, L5	uc001cpy.2	A6PVL3	OTTHUMG00000007987	ENST00000481882.2:c.201C>A	1.37:g.47015625G>T	ENSP00000419705:p.Asp67Glu		A8MXE3	Missense_Mutation	SNP	NULL	p.D67E	ENST00000481882.2	37	c.201		1	.	.	.	.	.	.	.	.	.	.	G	16.58	3.161970	0.57368	.	.	ENSG00000162456	ENST00000481882	T	0.68903	-0.36	4.54	-1.9	0.07665	.	.	.	.	.	T	0.60222	0.2252	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.60026	-0.7343	6	0.87932	D	0	-5.6867	0.5282	0.00624	0.3772:0.1775:0.2653:0.18	.	.	.	.	E	67	ENSP00000419705:D67E	ENSP00000419705:D67E	D	-	3	2	KNCN	46788212	1.000000	0.71417	0.995000	0.50966	0.900000	0.52787	0.702000	0.25631	-0.215000	0.10063	-0.268000	0.10319	GAC	KNCN	-	NULL	ENSG00000162456		0.592	KNCN-002	KNOWN	not_organism_supported|basic	protein_coding	KNCN	HGNC	protein_coding	OTTHUMT00000316334.2	-	0.00	37	0	G	NM_182516		47015625	-1	tier1	-	no_errors	ENST00000481882	ensembl	human	known	74_37	missense	31.82	15	7	SNP	0.976	T
JUP	3728	genome.wustl.edu	37	17	39785011	39785011	+	Intron	SNP	G	G	A			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr17:39785011G>A	ENST00000540235.1	-	5	909				KRT42P_ENST00000438131.1_RNA			P14923	PLAK_HUMAN	junction plakoglobin						adherens junction organization (GO:0034332)|atrioventricular valve morphogenesis (GO:0003181)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cell junction assembly (GO:0034329)|cell migration (GO:0016477)|cell morphogenesis (GO:0000902)|cell-cell junction organization (GO:0045216)|cellular response to indole-3-methanol (GO:0071681)|cytoskeletal anchoring at plasma membrane (GO:0007016)|desmosome assembly (GO:0002159)|detection of mechanical stimulus (GO:0050982)|ectoderm development (GO:0007398)|endothelial cell-cell adhesion (GO:0071603)|establishment of protein localization to plasma membrane (GO:0090002)|gastrulation (GO:0007369)|morphogenesis of embryonic epithelium (GO:0016331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of Wnt signaling pathway involved in heart development (GO:0003308)|nervous system development (GO:0007399)|oocyte development (GO:0048599)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein heterooligomerization (GO:0051291)|regulation of cell proliferation (GO:0042127)|regulation of heart rate by cardiac conduction (GO:0086091)|single organismal cell-cell adhesion (GO:0016337)|skin development (GO:0043588)|ventricular cardiac muscle cell action potential (GO:0086005)	actin cytoskeleton (GO:0015629)|apicolateral plasma membrane (GO:0016327)|basolateral plasma membrane (GO:0016323)|catenin complex (GO:0016342)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|gamma-catenin-TCF7L2 complex (GO:0071665)|intercalated disc (GO:0014704)|intermediate filament (GO:0005882)|lateral plasma membrane (GO:0016328)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|cadherin binding (GO:0045296)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|structural constituent of cell wall (GO:0005199)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(4)|lung(6)|ovary(3)|upper_aerodigestive_tract(1)	23		Breast(137;0.000162)	BRCA - Breast invasive adenocarcinoma(4;0.233)	BRCA - Breast invasive adenocarcinoma(366;0.15)		ctaggataccggagatactca	0.468																																					Colon(16;42 520 6044 17852 28530)												0																																										SO:0001627	intron_variant	0			AF233882	CCDS11407.1	17q21	2014-09-17	2004-08-09		ENSG00000173801	ENSG00000173801		"""Armadillo repeat containing"""	6207	protein-coding gene	gene with protein product		173325	"""catenin (cadherin-associated protein), gamma 80kDa"""	CTNNG		1889810, 7604000	Standard	NM_021991		Approved	DP3, PDGB, PKGB, DPIII	uc002hxs.2	P14923	OTTHUMG00000133494	ENST00000540235.1:c.910-5727C>T	17.37:g.39785011G>A			Q15093|Q15151|Q7L3S5|Q86W21|Q9BWC4|Q9HCX9	RNA	SNP	-	NULL	ENST00000540235.1	37	NULL		17																																																																																			KRT42P	-	-	ENSG00000214514		0.468	JUP-201	KNOWN	basic	protein_coding	KRT42P	HGNC	protein_coding		-	0.00	133	0	G			39785011	-1	tier1	-	no_errors	ENST00000438131	ensembl	human	known	74_37	rna	20.69	46	12	SNP	0.000	A
LATS2	26524	genome.wustl.edu	37	13	21562128	21562128	+	Nonsense_Mutation	SNP	G	G	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr13:21562128G>T	ENST00000382592.4	-	4	2196	c.1791C>A	c.(1789-1791)taC>taA	p.Y597*	LATS2_ENST00000472754.1_5'Flank|LATS2_ENST00000542899.1_Nonsense_Mutation_p.Y597*	NM_014572.2	NP_055387.2			large tumor suppressor kinase 2											breast(4)|central_nervous_system(3)|endometrium(2)|kidney(2)|large_intestine(7)|lung(19)|ovary(3)|pancreas(1)|prostate(2)|urinary_tract(2)	45		all_cancers(29;4.74e-22)|all_epithelial(30;1.45e-18)|all_lung(29;4.69e-16)|Lung SC(185;0.0262)|Hepatocellular(188;0.244)		all cancers(112;0.000781)|Epithelial(112;0.00144)|OV - Ovarian serous cystadenocarcinoma(117;0.0183)|Lung(94;0.0375)|LUSC - Lung squamous cell carcinoma(192;0.104)		CGTATGGCGAGTAGCTCTTGA	0.498																																																	0													261.0	264.0	263.0					13																	21562128		2203	4300	6503	SO:0001587	stop_gained	0			AB028019	CCDS9294.1	13q11-q12	2013-04-25	2013-04-25		ENSG00000150457	ENSG00000150457			6515	protein-coding gene	gene with protein product		604861	"""LATS (large tumor suppressor, Drosophila) homolog 2"", ""LATS, large tumor suppressor, homolog 2 (Drosophila)"""			10673337	Standard	NM_014572		Approved		uc001unr.4	Q9NRM7	OTTHUMG00000016531	ENST00000382592.4:c.1791C>A	13.37:g.21562128G>T	ENSP00000372035:p.Tyr597*			Nonsense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Pkinase_C,superfamily_Kinase-like_dom,superfamily_UBA-like,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Prot_kinase_dom	p.Y597*	ENST00000382592.4	37	c.1791	CCDS9294.1	13	.	.	.	.	.	.	.	.	.	.	G	42	9.189821	0.99094	.	.	ENSG00000150457	ENST00000382592;ENST00000542899	.	.	.	5.12	3.4	0.38934	.	0.096906	0.45361	D	0.000370	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	11.3923	0.49822	0.1454:0.0:0.8546:0.0	.	.	.	.	X	597	.	ENSP00000372035:Y597X	Y	-	3	2	LATS2	20460128	1.000000	0.71417	0.999000	0.59377	0.990000	0.78478	1.537000	0.36083	0.772000	0.33382	-0.274000	0.10170	TAC	LATS2	-	NULL	ENSG00000150457		0.498	LATS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LATS2	HGNC	protein_coding	OTTHUMT00000044102.1	-	0.00	104	0	G			21562128	-1	tier1	-	no_errors	ENST00000382592	ensembl	human	known	74_37	nonsense	9.30	39	4	SNP	1.000	T
LDHAL6A	160287	genome.wustl.edu	37	11	18500366	18500366	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr11:18500366G>T	ENST00000280706.2	+	7	1745	c.948G>T	c.(946-948)ttG>ttT	p.L316F	LDHAL6A_ENST00000396213.3_Missense_Mutation_p.L316F|TSG101_ENST00000536719.1_Intron	NM_144972.4	NP_659409.2	Q6ZMR3	LDH6A_HUMAN	lactate dehydrogenase A-like 6A	316					cellular carbohydrate metabolic process (GO:0044262)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	L-lactate dehydrogenase activity (GO:0004459)			large_intestine(3)|lung(9)|urinary_tract(1)	13						AGGCCTGCTTGCAAAAGAGTG	0.383																																																	0													154.0	167.0	162.0					11																	18500366		2199	4293	6492	SO:0001583	missense	0			AK131523	CCDS7841.1	11p15.1	2011-01-27			ENSG00000166800	ENSG00000166800			28335	protein-coding gene	gene with protein product						12477932	Standard	NM_001144071		Approved	MGC23940, LDH6A	uc001mop.1	Q6ZMR3	OTTHUMG00000167724	ENST00000280706.2:c.948G>T	11.37:g.18500366G>T	ENSP00000280706:p.Leu316Phe		D3DQY5	Missense_Mutation	SNP	pfam_Lactate/malate_DH_N,pfam_Lactate/malate_DH_C,superfamily_Lactate_DH/Glyco_Ohase_4_C,pirsf_L-lactate/malate_DH,prints_L-lactate/malate_DH,tigrfam_L-lactate_DH	p.L316F	ENST00000280706.2	37	c.948	CCDS7841.1	11	.	.	.	.	.	.	.	.	.	.	G	11.14	1.551901	0.27739	.	.	ENSG00000166800	ENST00000396213;ENST00000280706	T;T	0.70164	-0.46;-0.46	4.33	0.276	0.15663	Lactate/malate dehydrogenase, C-terminal (1);Lactate dehydrogenase/glycoside hydrolase, family 4, C-terminal (2);	0.125195	0.33631	U	0.004715	T	0.51890	0.1701	L	0.43598	1.365	0.37234	D	0.905835	B	0.16802	0.019	B	0.24974	0.057	T	0.38351	-0.9665	10	0.31617	T	0.26	.	5.8113	0.18467	0.2889:0.1604:0.5507:0.0	.	316	Q6ZMR3	LDH6A_HUMAN	F	316	ENSP00000379516:L316F;ENSP00000280706:L316F	ENSP00000280706:L316F	L	+	3	2	LDHAL6A	18456942	0.978000	0.34361	0.025000	0.17156	0.732000	0.41865	0.113000	0.15499	0.172000	0.19760	0.555000	0.69702	TTG	LDHAL6A	-	pfam_Lactate/malate_DH_C,superfamily_Lactate_DH/Glyco_Ohase_4_C,pirsf_L-lactate/malate_DH,tigrfam_L-lactate_DH	ENSG00000166800		0.383	LDHAL6A-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	LDHAL6A	HGNC	protein_coding	OTTHUMT00000395904.1	-	0.00	106	0	G	NM_144972		18500366	+1	tier1	-	no_errors	ENST00000280706	ensembl	human	known	74_37	missense	6.15	61	4	SNP	0.575	T
LGALS3	3958	genome.wustl.edu	37	14	55604782	55604782	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr14:55604782G>T	ENST00000254301.9	+	3	299	c.38G>T	c.(37-39)gGg>gTg	p.G13V	LGALS3_ENST00000554715.1_Missense_Mutation_p.G13V|LGALS3_ENST00000553755.1_3'UTR	NM_002306.3	NP_002297.2	P17931	LEG3_HUMAN	lectin, galactoside-binding, soluble, 3	13					eosinophil chemotaxis (GO:0048245)|epithelial cell differentiation (GO:0030855)|extracellular matrix organization (GO:0030198)|innate immune response (GO:0045087)|macrophage chemotaxis (GO:0048246)|monocyte chemotaxis (GO:0002548)|mononuclear cell migration (GO:0071674)|mRNA processing (GO:0006397)|negative regulation of endocytosis (GO:0045806)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of immunological synapse formation (GO:2000521)|negative regulation of T cell activation via T cell receptor contact with antigen bound to MHC molecule on antigen presenting cell (GO:2001189)|negative regulation of T cell receptor signaling pathway (GO:0050860)|neutrophil chemotaxis (GO:0030593)|positive chemotaxis (GO:0050918)|positive regulation of calcium ion import (GO:0090280)|positive regulation of mononuclear cell migration (GO:0071677)|regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902041)|regulation of T cell apoptotic process (GO:0070232)|regulation of T cell proliferation (GO:0042129)|RNA splicing (GO:0008380)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)|spliceosomal complex (GO:0005681)	carbohydrate binding (GO:0030246)|chemoattractant activity (GO:0042056)|IgE binding (GO:0019863)|laminin binding (GO:0043236)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|endometrium(1)|prostate(1)	3						GCGTTATCTGGGTCTGGAAAC	0.527																																																	0													43.0	44.0	44.0					14																	55604782		1875	4108	5983	SO:0001583	missense	0			M64303	CCDS41956.1	14q22.3	2014-03-19	2007-02-01		ENSG00000131981	ENSG00000131981		"""Lectins, galactoside-binding"", ""Endogenous ligands"""	6563	protein-coding gene	gene with protein product	"""galectin 3"""	153619		LGALS2		2009535, 8063692	Standard	NR_003225		Approved	MAC-2, GALIG	uc001xbr.3	P17931	OTTHUMG00000171030	ENST00000254301.9:c.38G>T	14.37:g.55604782G>T	ENSP00000254301:p.Gly13Val		B2RC38|Q16005|Q6IBA7|Q96J47	Missense_Mutation	SNP	pfam_Galectin_CRD,superfamily_ConA-like_lec_gl_sf,smart_Galectin_CRD	p.G13V	ENST00000254301.9	37	c.38	CCDS41956.1	14	.	.	.	.	.	.	.	.	.	.	G	16.53	3.148930	0.57151	.	.	ENSG00000131981	ENST00000553493;ENST00000254301;ENST00000554715	T;T;T	0.55588	0.51;3.54;2.6	5.31	5.31	0.75309	.	0.402261	0.25456	N	0.030541	T	0.71879	0.3392	M	0.70595	2.14	0.58432	D	0.999992	D	0.89917	1.0	D	0.91635	0.999	T	0.74645	-0.3596	10	0.72032	D	0.01	-1.5769	15.9006	0.79373	0.0:0.0:1.0:0.0	.	13	P17931	LEG3_HUMAN	V	13	ENSP00000451526:G13V;ENSP00000254301:G13V;ENSP00000451381:G13V	ENSP00000254301:G13V	G	+	2	0	LGALS3	54674535	1.000000	0.71417	1.000000	0.80357	0.901000	0.52897	5.321000	0.65846	2.466000	0.83321	0.655000	0.94253	GGG	LGALS3	-	NULL	ENSG00000131981		0.527	LGALS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LGALS3	HGNC	protein_coding	OTTHUMT00000411309.1	-	0.00	43	0	G	NM_002306		55604782	+1	tier1	-	no_errors	ENST00000254301	ensembl	human	known	74_37	missense	13.33	25	4	SNP	1.000	T
LGR5	8549	genome.wustl.edu	37	12	71978061	71978061	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr12:71978061G>T	ENST00000266674.5	+	18	2582	c.2271G>T	c.(2269-2271)gaG>gaT	p.E757D	LGR5_ENST00000536515.1_Missense_Mutation_p.E685D|RP11-186F10.2_ENST00000546601.1_RNA|LGR5_ENST00000540815.2_Missense_Mutation_p.E733D			O75473	LGR5_HUMAN	leucine-rich repeat containing G protein-coupled receptor 5	757					G-protein coupled receptor signaling pathway (GO:0007186)|inner ear development (GO:0048839)|positive regulation of canonical Wnt signaling pathway (GO:0090263)	integral component of plasma membrane (GO:0005887)|trans-Golgi network membrane (GO:0032588)	G-protein coupled receptor activity (GO:0004930)|transmembrane signaling receptor activity (GO:0004888)		NUP107/LGR5(2)	endometrium(2)|kidney(3)|large_intestine(2)|lung(24)|ovary(1)|pancreas(2)|prostate(1)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(3)	48						GAGACCTGGAGAATATTTGGG	0.468																																																	0													119.0	114.0	116.0					12																	71978061		2203	4300	6503	SO:0001583	missense	0			AF062006	CCDS9000.1, CCDS61194.1, CCDS61195.1	12q22-q23	2012-08-21	2011-01-25	2004-11-12				"""GPCR / Class A : Orphans"""	4504	protein-coding gene	gene with protein product		606667	"""G protein-coupled receptor 49"", ""leucine-rich repeat-containing G protein-coupled receptor 5"""	GPR67, GPR49		9642114	Standard	NM_003667		Approved	HG38, FEX	uc001swl.4	O75473	OTTHUMG00000169543	ENST00000266674.5:c.2271G>T	12.37:g.71978061G>T	ENSP00000266674:p.Glu757Asp		D8MCT0|Q4VAM0|Q4VAM2|Q9UP75	Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_GPCR_Rhodpsn,pfam_LRR-contain_N,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,prints_Gphrmn_rcpt_fam,prints_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	p.E757D	ENST00000266674.5	37	c.2271	CCDS9000.1	12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	8.117|8.117	0.780028|0.780028	0.16120|0.16120	.|.	.|.	ENSG00000139292|ENSG00000139292	ENST00000266674;ENST00000536515;ENST00000540815|ENST00000451585	T;T;T|.	0.39056|.	1.1;1.1;1.1|.	5.75|5.75	3.46|3.46	0.39613|0.39613	GPCR, rhodopsin-like superfamily (1);|.	0.308416|0.308416	0.28016|0.28016	N|N	0.016921|0.016921	T|.	0.23611|.	0.0571|.	N|N	0.12569|0.12569	0.235|0.235	0.27924|0.27924	N|N	0.938153|0.938153	B;B|.	0.11235|.	0.003;0.004|.	B;B|.	0.11329|.	0.005;0.006|.	T|.	0.14008|.	-1.0488|.	10|.	0.12103|0.87932	T|D	0.63|0	.|.	8.1909|8.1909	0.31368|0.31368	0.1382:0.4225:0.4393:0.0|0.1382:0.4225:0.4393:0.0	.|.	733;757|.	O75473-2;O75473|.	.;LGR5_HUMAN|.	D|X	757;685;733|737	ENSP00000266674:E757D;ENSP00000443033:E685D;ENSP00000441035:E733D|.	ENSP00000266674:E757D|ENSP00000414152:E737X	E|E	+|+	3|1	2|0	LGR5|LGR5	70264328|70264328	0.997000|0.997000	0.39634|0.39634	0.964000|0.964000	0.40570|0.40570	0.952000|0.952000	0.60782|0.60782	0.475000|0.475000	0.22164|0.22164	1.246000|1.246000	0.43901|0.43901	0.655000|0.655000	0.94253|0.94253	GAG|GAA	LGR5	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000139292		0.468	LGR5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LGR5	HGNC	protein_coding	OTTHUMT00000404744.1	-	0.00	72	0	G	NM_003667		71978061	+1	tier1	-	no_errors	ENST00000266674	ensembl	human	known	74_37	missense	6.90	54	4	SNP	0.913	T
LHFPL5	222662	genome.wustl.edu	37	6	35787239	35787239	+	3'UTR	SNP	C	C	T	rs368091965		TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr6:35787239C>T	ENST00000360215.1	+	0	1052				LHFPL5_ENST00000496656.1_3'UTR	NM_182548.3	NP_872354.1	Q8TAF8	TMHS_HUMAN	lipoma HMGIC fusion partner-like 5						auditory receptor cell stereocilium organization (GO:0060088)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|ion transport (GO:0006811)	apical plasma membrane (GO:0016324)|integral component of membrane (GO:0016021)|stereocilium bundle tip (GO:0032426)				endometrium(4)|large_intestine(4)|lung(7)|prostate(2)|skin(2)|urinary_tract(1)	20						GCTGAAGGGTCGGTGAGTAAT	0.502													C|||	1	0.000199681	0.0	0.0014	5008	,	,		18813	0.0		0.0	False		,,,				2504	0.0																0								C		3,4403	6.2+/-15.9	0,3,2200	178.0	154.0	162.0			-3.5	0.0	6		162	0,8600		0,0,4300	no	utr-3	LHFPL5	NM_182548.3		0,3,6500	TT,TC,CC		0.0,0.0681,0.0231			35787239	3,13003	2203	4300	6503	SO:0001624	3_prime_UTR_variant	0			BC028630	CCDS4812.1	6p21.31	2014-01-28				ENSG00000197753			21253	protein-coding gene	gene with protein product		609427	"""deafness, autosomal recessive 67"""	DFNB67		16459341	Standard	NM_182548		Approved	MGC33835, dJ510O8.8, Tmhs	uc003olg.1	Q8TAF8		ENST00000360215.1:c.*15C>T	6.37:g.35787239C>T			B3KX66	RNA	SNP	-	NULL	ENST00000360215.1	37	NULL	CCDS4812.1	6																																																																																			LHFPL5	-	-	ENSG00000197753		0.502	LHFPL5-201	KNOWN	basic|appris_principal|CCDS	protein_coding	LHFPL5	HGNC	protein_coding		-	0.00	90	0	C	NM_182548		35787239	+1	tier1	-	no_errors	ENST00000496656	ensembl	human	known	74_37	rna	16.98	44	9	SNP	0.006	T
LIG1	3978	genome.wustl.edu	37	19	48640270	48640270	+	Silent	SNP	G	G	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr19:48640270G>T	ENST00000263274.7	-	14	1745	c.1326C>A	c.(1324-1326)atC>atA	p.I442I	LIG1_ENST00000427526.2_Silent_p.I411I|LIG1_ENST00000536218.1_Silent_p.I374I	NM_000234.1	NP_000225.1	P18858	DNLI1_HUMAN	ligase I, DNA, ATP-dependent	442					anatomical structure morphogenesis (GO:0009653)|base-excision repair (GO:0006284)|cell division (GO:0051301)|DNA biosynthetic process (GO:0071897)|DNA ligation involved in DNA repair (GO:0051103)|DNA metabolic process (GO:0006259)|DNA repair (GO:0006281)|DNA strand elongation involved in DNA replication (GO:0006271)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|double-strand break repair via nonhomologous end joining (GO:0006303)|lagging strand elongation (GO:0006273)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|response to hydrogen peroxide (GO:0042542)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	chromosome (GO:0005694)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA ligase (ATP) activity (GO:0003910)|DNA ligase activity (GO:0003909)|metal ion binding (GO:0046872)			breast(1)|cervix(1)|endometrium(7)|kidney(1)|large_intestine(9)|lung(22)|prostate(2)|skin(1)	44		all_epithelial(76;3.1e-06)|all_lung(116;4.39e-06)|Lung NSC(112;8.96e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)|Breast(70;0.203)		OV - Ovarian serous cystadenocarcinoma(262;8.45e-05)|all cancers(93;0.000423)|Epithelial(262;0.0177)|GBM - Glioblastoma multiforme(486;0.0329)	Bleomycin(DB00290)	CTTACCTAGCGATGAACCGGG	0.582								Nucleotide excision repair (NER)																																									0													55.0	42.0	47.0					19																	48640270		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS12711.1, CCDS74409.1, CCDS74410.1	19q13.2-q13.3	2014-09-17				ENSG00000105486	6.5.1.1		6598	protein-coding gene	gene with protein product		126391					Standard	XM_005258934		Approved		uc002pia.1	P18858		ENST00000263274.7:c.1326C>A	19.37:g.48640270G>T			B2RAI8|Q2TB12|Q32P23	Silent	SNP	pfam_DNA_ligase_ATP-dep_cent,pfam_DNA_ligase_ATP-dep_N,pfam_DNA_ligase_ATP-dep_C,superfamily_DNA_ligase_ATP-dep_N,superfamily_NA-bd_OB-fold,pfscan_DNA_ligase_ATP-dep_cent,tigrfam_DNA_ligase_ATP-dep	p.I442	ENST00000263274.7	37	c.1326	CCDS12711.1	19																																																																																			LIG1	-	pfam_DNA_ligase_ATP-dep_N,superfamily_DNA_ligase_ATP-dep_N,tigrfam_DNA_ligase_ATP-dep	ENSG00000105486		0.582	LIG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LIG1	HGNC	protein_coding	OTTHUMT00000465575.1	-	0.00	72	0	G	NM_000234		48640270	-1	tier1	-	no_errors	ENST00000263274	ensembl	human	known	74_37	silent	9.76	37	4	SNP	0.986	T
LOC63930	63930	genome.wustl.edu	37	20	61665949	61665949	+	lincRNA	SNP	A	A	G			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr20:61665949A>G	ENST00000607802.1	+	0	91				LINC00029_ENST00000370341.3_lincRNA	NR_033370.1																						AATAAGCCACAGAAGAGAAAT	0.517																																																	0																																												0																															20.37:g.61665949A>G				RNA	SNP	-	NULL	ENST00000607802.1	37	NULL		20																																																																																			LINC00029	-	-	ENSG00000125514		0.517	RP11-305P22.9-001	KNOWN	basic	lincRNA	LINC00029	HGNC	lincRNA	OTTHUMT00000470475.1	-	0.00	61	0	A			61665949	-1	tier1	-	no_errors	ENST00000370341	ensembl	human	known	74_37	rna	7.69	48	4	SNP	0.004	G
GOLGA6L10	647042	genome.wustl.edu	37	15	82637293	82637293	+	Missense_Mutation	SNP	A	A	G			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr15:82637293A>G	ENST00000439287.4	-	6	892	c.793T>C	c.(793-795)Tgt>Cgt	p.C265R		NM_001164465.1	NP_001157937.1	A6NI86	GG6LA_HUMAN	golgin A6 family-like 10	265										endometrium(1)|kidney(4)	5						TCCTGTTCACATAGCCTCTCC	0.572																																																	0																																										SO:0001583	missense	0				CCDS45325.1	15q25.2	2014-08-13	2010-02-12		ENSG00000278662				37228	protein-coding gene	gene with protein product			"""golgi autoantigen, golgin subfamily a, 6-like 10"", ""golgin A6 family-like 18"""	GOLGA6L18			Standard	XM_006720643		Approved		uc021ssn.1	A6NI86	OTTHUMG00000172580	ENST00000439287.4:c.793T>C	15.37:g.82637293A>G	ENSP00000388606:p.Cys265Arg			Missense_Mutation	SNP	NULL	p.C265R	ENST00000439287.4	37	c.793	CCDS45325.1	15	.	.	.	.	.	.	.	.	.	.	.	0.001	-2.995914	0.00044	.	.	ENSG00000205281	ENST00000439287;ENST00000430944	T	0.20463	2.07	0.256	0.256	0.15567	.	.	.	.	.	T	0.06462	0.0166	N	0.03608	-0.345	0.80722	P	0.0	.	.	.	.	.	.	T	0.41787	-0.9489	6	0.09843	T	0.71	.	3.922	0.09248	0.6036:0.0:0.3964:0.0	.	.	.	.	R	265	ENSP00000388606:C265R	ENSP00000390083:C265R	C	-	1	0	GOLGA6L10	80424348	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.604000	0.00890	-1.108000	0.03000	-1.100000	0.02121	TGT	GOLGA6L10	-	NULL	ENSG00000205281		0.572	GOLGA6L10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC101927601	Uniprot_gn	protein_coding	OTTHUMT00000419403.2	-	0.00	37	0	A	NM_001164465		82637293	-1	tier1	-	no_errors	ENST00000439287	ensembl	human	known	74_37	missense	16.67	10	2	SNP	0.000	G
TPTE2P2	644623	genome.wustl.edu	37	13	52857389	52857389	+	RNA	SNP	G	G	A			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr13:52857389G>A	ENST00000451298.1	-	0	316																											ATATCCTTAAGAAACTTAACG	0.284																																																	0																																												0																															13.37:g.52857389G>A				RNA	SNP	-	NULL	ENST00000451298.1	37	NULL		13																																																																																			RP11-248G5.8	-	-	ENSG00000217576		0.284	RP11-248G5.8-001	KNOWN	basic|readthrough_transcript	processed_transcript	LOC101930578	Clone_based_vega_gene	processed_transcript	OTTHUMT00000471093.1	-	0.00	116	0	G			52857389	-1	tier1	-	no_errors	ENST00000451298	ensembl	human	known	74_37	rna	19.51	99	24	SNP	0.000	A
LINGO1	84894	genome.wustl.edu	37	15	77938714	77938714	+	Intron	SNP	G	G	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr15:77938714G>T	ENST00000561030.1	-	4	446				RP11-307C19.3_ENST00000558691.1_RNA|RP11-307C19.3_ENST00000558887.1_RNA|RP11-307C19.3_ENST00000560265.1_RNA			Q96FE5	LIGO1_HUMAN	leucine rich repeat and Ig domain containing 1						central nervous system neuron development (GO:0021954)|negative regulation of axonogenesis (GO:0050771)|negative regulation of oligodendrocyte differentiation (GO:0048715)|neuron projection development (GO:0031175)|neurotrophin TRK receptor signaling pathway (GO:0048011)|protein kinase B signaling (GO:0043491)|regulation of axonogenesis (GO:0050770)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(16)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	31						GGCACCCTCTGGTCTTGTCCC	0.632																																																	0																																										SO:0001627	intron_variant	0			AK027500	CCDS45313.1, CCDS73766.1	15q24	2013-01-11	2007-02-01	2007-02-01		ENSG00000169783		"""Immunoglobulin superfamily / I-set domain containing"""	21205	protein-coding gene	gene with protein product		609791	"""leucine rich repeat neuronal 6A"""	LRRN6A		14686891	Standard	XM_006720723		Approved	FLJ14594, LERN1	uc002bct.1	Q96FE5		ENST00000561030.1:c.12-30472C>A	15.37:g.77938714G>T			D3DW80|Q6NUK3|Q6UXM3|Q6VVG0|Q6VVG1|Q6VVG2|Q8N3K5|Q96K52	RNA	SNP	-	NULL	ENST00000561030.1	37	NULL		15																																																																																			RP11-307C19.3	-	-	ENSG00000259666		0.632	LINGO1-002	KNOWN	basic	protein_coding	LOC253044	Clone_based_vega_gene	protein_coding	OTTHUMT00000419548.2	-	0.00	65	0	G	NM_032808		77938714	+1	tier1	-	no_errors	ENST00000558887	ensembl	human	known	74_37	rna	7.27	51	4	SNP	0.025	T
LRCH2	57631	genome.wustl.edu	37	X	114398259	114398259	+	Silent	SNP	C	C	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chrX:114398259C>T	ENST00000317135.8	-	11	1473	c.1443G>A	c.(1441-1443)ttG>ttA	p.L481L	LRCH2_ENST00000538422.1_Silent_p.L481L	NM_020871.3	NP_065922.3	Q5VUJ6	LRCH2_HUMAN	leucine-rich repeats and calponin homology (CH) domain containing 2	481										breast(1)|endometrium(4)|kidney(3)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)	19						GTTCTTGCTGCAATAACTGAG	0.323																																																	0													141.0	110.0	120.0					X																	114398259		1862	4090	5952	SO:0001819	synonymous_variant	0			AB040928	CCDS48155.1, CCDS59175.1	Xq24	2008-02-05			ENSG00000130224	ENSG00000130224			29292	protein-coding gene	gene with protein product						10819331	Standard	NM_020871		Approved	KIAA1495	uc010nqe.3	Q5VUJ6	OTTHUMG00000022233	ENST00000317135.8:c.1443G>A	X.37:g.114398259C>T			F5H2T1|Q08AD5|Q9HA88|Q9P233	Silent	SNP	pfam_Leu-rich_rpt,pfam_CH-domain,superfamily_CH-domain,superfamily_NA-bd_OB-fold,smart_Leu-rich_rpt_typical-subtyp,smart_CH-domain,pfscan_CH-domain	p.L481	ENST00000317135.8	37	c.1443	CCDS48155.1	X																																																																																			LRCH2	-	superfamily_NA-bd_OB-fold	ENSG00000130224		0.323	LRCH2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LRCH2	HGNC	protein_coding	OTTHUMT00000057971.2	-	0.00	67	0	C	NM_020871		114398259	-1	tier1	-	no_errors	ENST00000317135	ensembl	human	known	74_37	silent	31.58	38	18	SNP	1.000	T
LRRC27	80313	genome.wustl.edu	37	10	134174993	134174993	+	Silent	SNP	G	G	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr10:134174993G>T	ENST00000368614.3	+	9	1308	c.1203G>T	c.(1201-1203)ctG>ctT	p.L401L	LRRC27_ENST00000475747.1_3'UTR|LRRC27_ENST00000392638.2_3'UTR|LRRC27_ENST00000368610.3_Silent_p.L339L|LRRC27_ENST00000368612.1_Silent_p.L339L|LRRC27_ENST00000432555.2_Silent_p.L274L|LRRC27_ENST00000368613.4_Silent_p.L401L	NM_030626.2	NP_085129.1	Q9C0I9	LRC27_HUMAN	leucine rich repeat containing 27	401										breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(8)|ovary(1)|pancreas(1)	18		all_cancers(35;6.28e-08)|all_epithelial(44;6.75e-06)|Lung NSC(174;0.0108)|all_lung(145;0.0173)|all_neural(114;0.0726)|Glioma(114;0.172)|Melanoma(40;0.175)|Colorectal(31;0.19)		OV - Ovarian serous cystadenocarcinoma(35;9.12e-05)|Epithelial(32;0.000116)|all cancers(32;0.000145)|BRCA - Breast invasive adenocarcinoma(275;0.218)		CCACAGATCTGATAGATAACA	0.418																																																	0													126.0	128.0	127.0					10																	134174993		2203	4300	6503	SO:0001819	synonymous_variant	0			AB051461	CCDS31316.1, CCDS44496.1	10q26.3	2013-09-20			ENSG00000148814	ENSG00000148814			29346	protein-coding gene	gene with protein product						11214970	Standard	NM_030626		Approved	KIAA1674	uc010quw.1	Q9C0I9	OTTHUMG00000019284	ENST00000368614.3:c.1203G>T	10.37:g.134174993G>T			A6NE72|A6NJB4|A6NKD3|D3DRH0|Q5SZH6|Q5SZH8|Q5SZH9|Q86XT5|Q8N7C8|Q8NA21	Silent	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.L401	ENST00000368614.3	37	c.1203	CCDS31316.1	10																																																																																			LRRC27	-	NULL	ENSG00000148814		0.418	LRRC27-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LRRC27	HGNC	protein_coding	OTTHUMT00000051058.2	-	0.00	42	0	G	XM_290462		134174993	+1	tier1	-	no_errors	ENST00000368613	ensembl	human	known	74_37	silent	9.76	37	4	SNP	0.001	T
LRRC57	255252	genome.wustl.edu	37	15	42840557	42840557	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr15:42840557G>T	ENST00000323443.2	-	1	443	c.76C>A	c.(76-78)Ctg>Atg	p.L26M	HAUS2_ENST00000260372.3_5'Flank|LRRC57_ENST00000397130.3_Missense_Mutation_p.L26M|HAUS2_ENST00000568876.1_5'Flank|HAUS2_ENST00000568846.2_5'Flank|LRRC57_ENST00000563454.1_Missense_Mutation_p.L26M			Q8N9N7	LRC57_HUMAN	leucine rich repeat containing 57	26						extracellular vesicular exosome (GO:0070062)				breast(1)|kidney(1)|lung(5)|prostate(1)	8		all_cancers(109;1.99e-12)|all_epithelial(112;5.11e-11)|Lung NSC(122;4.53e-07)|all_lung(180;1.64e-06)|Melanoma(134;0.0262)		GBM - Glioblastoma multiforme(94;6.87e-07)		ACCTCGGTCAGCCCTCGGTCC	0.627																																																	0													83.0	67.0	72.0					15																	42840557		2203	4299	6502	SO:0001583	missense	0			AK094891	CCDS10089.1	15q15.1	2006-02-13			ENSG00000180979	ENSG00000180979			26719	protein-coding gene	gene with protein product							Standard	NM_153260		Approved	FLJ36812	uc001zqc.3	Q8N9N7	OTTHUMG00000130679	ENST00000323443.2:c.76C>A	15.37:g.42840557G>T	ENSP00000326817:p.Leu26Met		Q7Z2Z6|Q8N1T6	Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.L26M	ENST00000323443.2	37	c.76	CCDS10089.1	15	.	.	.	.	.	.	.	.	.	.	G	20.3	3.968970	0.74131	.	.	ENSG00000180979	ENST00000323443;ENST00000397130	T;T	0.60299	0.2;0.2	5.03	4.11	0.48088	.	0.000000	0.85682	D	0.000000	T	0.74038	0.3664	M	0.71036	2.16	0.80722	D	1	D	0.76494	0.999	D	0.74023	0.982	T	0.78347	-0.2239	10	0.72032	D	0.01	.	15.366	0.74523	0.0:0.0:0.8594:0.1406	.	26	Q8N9N7	LRC57_HUMAN	M	26	ENSP00000326817:L26M;ENSP00000380319:L26M	ENSP00000326817:L26M	L	-	1	2	LRRC57	40627849	1.000000	0.71417	0.998000	0.56505	0.985000	0.73830	4.506000	0.60428	1.475000	0.48197	-0.152000	0.13540	CTG	LRRC57	-	NULL	ENSG00000180979		0.627	LRRC57-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC57	HGNC	protein_coding	OTTHUMT00000253174.1		0.00	93	0	G	NM_153260		42840557	-1			no_errors	ENST00000323443	ensembl	human	known	74_37	missense	6.90	54	4	SNP	0.997	T
LRRC7	57554	genome.wustl.edu	37	1	70484450	70484450	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr1:70484450C>A	ENST00000035383.5	+	13	1285	c.1255C>A	c.(1255-1257)Caa>Aaa	p.Q419K	RP11-181B18.1_ENST00000425754.1_RNA|LRRC7_ENST00000310961.5_Missense_Mutation_p.Q424K|LRRC7_ENST00000415775.2_5'UTR|RP11-181B18.1_ENST00000414132.1_RNA	NM_020794.2	NP_065845.1	Q96NW7	LRRC7_HUMAN	leucine rich repeat containing 7	419						cell junction (GO:0030054)|cytoplasm (GO:0005737)|postsynaptic membrane (GO:0045211)				breast(11)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(25)|liver(3)|lung(81)|ovary(9)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	162						AGAAACAAAGCAAAGAGTATT	0.353																																																	0													114.0	107.0	109.0					1																	70484450		2203	4300	6503	SO:0001583	missense	0				CCDS645.1	1p31.1	2008-02-05			ENSG00000033122	ENSG00000033122			18531	protein-coding gene	gene with protein product		614453				12525888	Standard	NM_020794		Approved	KIAA1365, densin-180	uc001dep.3	Q96NW7	OTTHUMG00000059194	ENST00000035383.5:c.1255C>A	1.37:g.70484450C>A	ENSP00000035383:p.Gln419Lys		Q5VXC2|Q5VXC3|Q68D07|Q86VE8|Q8WX20|Q9P2I2	Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_PDZ,superfamily_PDZ,smart_Leu-rich_rpt_typical-subtyp,smart_PDZ,pfscan_PDZ	p.Q419K	ENST00000035383.5	37	c.1255	CCDS645.1	1	.	.	.	.	.	.	.	.	.	.	C	15.99	2.996824	0.54147	.	.	ENSG00000033122	ENST00000310961;ENST00000035383;ENST00000370957	T;T	0.39056	1.1;1.1	6.08	6.08	0.98989	.	0.000000	0.85682	D	0.000000	T	0.13543	0.0328	N	0.14661	0.345	0.80722	D	1	B	0.19935	0.04	B	0.21546	0.035	T	0.15037	-1.0451	10	0.05525	T	0.97	.	19.6516	0.95815	0.0:1.0:0.0:0.0	.	419	Q96NW7	LRRC7_HUMAN	K	424;419;242	ENSP00000309245:Q424K;ENSP00000035383:Q419K	ENSP00000035383:Q419K	Q	+	1	0	LRRC7	70257038	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.654000	0.61469	2.894000	0.99253	0.655000	0.94253	CAA	LRRC7	-	NULL	ENSG00000033122		0.353	LRRC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC7	HGNC	protein_coding	OTTHUMT00000131261.1	-	0.00	118	0	C	NM_020794		70484450	+1	tier1	-	no_errors	ENST00000035383	ensembl	human	known	74_37	missense	14.67	64	11	SNP	1.000	A
LRRC9	341883	genome.wustl.edu	37	14	60448632	60448632	+	Nonsense_Mutation	SNP	G	G	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr14:60448632G>T	ENST00000445360.1	+	16	2149	c.1945G>T	c.(1945-1947)Gaa>Taa	p.E649*	RP11-16B13.1_ENST00000555432.1_RNA|RP11-16B13.1_ENST00000554123.1_RNA			Q6ZRR7	LRRC9_HUMAN	leucine rich repeat containing 9	649																	AAAAAACCCAGAAGTATCAGT	0.318																																																	0																																										SO:0001587	stop_gained	0			AK128037		14q23.1	2013-01-29	2003-11-19		ENSG00000131951	ENSG00000131951			19848	other	unknown			"""leucine-rich repeat-containing 9"""				Standard	NR_075071		Approved	FLJ46156	uc001xep.1	Q6ZRR7	OTTHUMG00000028948	ENST00000445360.1:c.1945G>T	14.37:g.60448632G>T	ENSP00000454748:p.Glu649*			Nonsense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.E649*	ENST00000445360.1	37	c.1945		14																																																																																			LRRC9	-	NULL	ENSG00000131951		0.318	LRRC9-001	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	LRRC9	HGNC	protein_coding	OTTHUMT00000072281.3	-	0.00	116	0	G			60448632	+1	tier1	-	no_errors	ENST00000254271	ensembl	human	known	74_37	nonsense	5.33	71	4	SNP	0.962	T
MAP1B	4131	genome.wustl.edu	37	5	71482557	71482557	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr5:71482557C>G	ENST00000296755.7	+	4	784	c.486C>G	c.(484-486)ttC>ttG	p.F162L		NM_005909.3	NP_005900.2	P46821	MAP1B_HUMAN	microtubule-associated protein 1B	162					axon extension (GO:0048675)|cellular process (GO:0009987)|dendrite development (GO:0016358)|establishment of monopolar cell polarity (GO:0061162)|microtubule bundle formation (GO:0001578)|mitochondrion transport along microtubule (GO:0047497)|negative regulation of intracellular transport (GO:0032387)|positive regulation of axon extension (GO:0045773)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|plasma membrane (GO:0005886)|synapse (GO:0045202)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(42)|liver(1)|lung(28)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	104		Lung NSC(167;0.00202)|Ovarian(174;0.0175)|Prostate(461;0.142)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;7.99e-54)		TCCAGAACTTCATAGAGATTT	0.512																																					Melanoma(17;367 822 11631 31730 47712)												0													99.0	102.0	101.0					5																	71482557		2203	4300	6503	SO:0001583	missense	0			L06237	CCDS4012.1	5q13	2014-06-12			ENSG00000131711	ENSG00000131711			6836	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 102"""	157129				1881920	Standard	NM_005909		Approved	MAP5, PPP1R102	uc003kbw.4	P46821	OTTHUMG00000100952	ENST00000296755.7:c.486C>G	5.37:g.71482557C>G	ENSP00000296755:p.Phe162Leu		A2BDK5	Missense_Mutation	SNP	pfam_MAP1B_neuraxin	p.F162L	ENST00000296755.7	37	c.486	CCDS4012.1	5	.	.	.	.	.	.	.	.	.	.	C	22.8	4.336729	0.81801	.	.	ENSG00000131711	ENST00000296755;ENST00000511641;ENST00000504492	T;T;T	0.04015	3.73;3.73;3.73	5.72	5.72	0.89469	.	0.000000	0.64402	D	0.000001	T	0.07773	0.0195	L	0.49350	1.555	0.80722	D	1	P;P	0.43750	0.816;0.816	B;B	0.43809	0.432;0.31	T	0.01805	-1.1270	10	0.87932	D	0	-20.777	10.3132	0.43721	0.0:0.855:0.0:0.145	.	36;162	A2BDK6;P46821	.;MAP1B_HUMAN	L	162;162;36	ENSP00000296755:F162L;ENSP00000423444:F162L;ENSP00000423416:F36L	ENSP00000296755:F162L	F	+	3	2	MAP1B	71518313	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.117000	0.41939	2.691000	0.91804	0.655000	0.94253	TTC	MAP1B	-	NULL	ENSG00000131711		0.512	MAP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAP1B	HGNC	protein_coding	OTTHUMT00000218561.6	-	0.00	54	0	C	NM_005909		71482557	+1	tier1	-	no_errors	ENST00000296755	ensembl	human	known	74_37	missense	33.33	14	7	SNP	1.000	G
MAP3K14-AS1	100133991	genome.wustl.edu	37	17	43348439	43348439	+	RNA	SNP	G	G	A			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr17:43348439G>A	ENST00000586450.1	+	0	1886				MAP3K14-AS1_ENST00000590100.1_RNA|MAP3K14-AS1_ENST00000592422.1_RNA|MAP3K14-AS1_ENST00000588698.1_RNA|MAP3K14_ENST00000344686.2_RNA|MAP3K14-AS1_ENST00000585351.1_RNA					MAP3K14 antisense RNA 1																		AGGCAGAGCGGCCCTCGGAAG	0.672											OREG0024479	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													26.0	29.0	28.0					17																	43348439		2110	4222	6332			0			AK311429, BC031942		17q21.31	2014-06-16			ENSG00000267278	ENSG00000267278		"""Long non-coding RNAs"""	44359	non-coding RNA	RNA, long non-coding							Standard	NR_024435		Approved		uc002iit.4		OTTHUMG00000180362		17.37:g.43348439G>A		915		RNA	SNP	-	NULL	ENST00000586450.1	37	NULL		17	.	.	.	.	.	.	.	.	.	.	G	18.53	3.643496	0.67244	.	.	ENSG00000006062	ENST00000344686;ENST00000376926	.	.	.	5.04	5.04	0.67666	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.053759	0.64402	D	0.000001	T	0.55657	0.1934	N	0.10837	0.055	0.38104	D	0.937359	D;D	0.89917	1.0;0.999	D;D	0.79784	0.993;0.976	T	0.66340	-0.5948	8	0.52906	T	0.07	.	17.3752	0.87390	0.0:0.0:1.0:0.0	.	603;133	Q99558;Q6ZMZ1	M3K14_HUMAN;.	S	602;386	.	ENSP00000342059:P602S	P	-	1	0	MAP3K14	40704222	1.000000	0.71417	0.990000	0.47175	0.683000	0.39861	6.057000	0.71119	2.342000	0.79632	0.462000	0.41574	CCG	MAP3K14	-	-	ENSG00000006062		0.672	MAP3K14-AS1-010	KNOWN	basic	antisense	MAP3K14	HGNC	antisense	OTTHUMT00000450942.1		0.00	64	0	G	NR_024434		43348439	-1			no_errors	ENST00000344686	ensembl	human	known	74_37	rna	13.33	26	4	SNP	0.802	A
MAP7D2	256714	genome.wustl.edu	37	X	20043083	20043083	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chrX:20043083C>A	ENST00000379651.3	-	9	1293	c.1275G>T	c.(1273-1275)aaG>aaT	p.K425N	MAP7D2_ENST00000466145.1_5'UTR|MAP7D2_ENST00000379643.5_Missense_Mutation_p.K466N|MAP7D2_ENST00000452324.3_Missense_Mutation_p.K373N|MAP7D2_ENST00000543767.1_Missense_Mutation_p.K310N|MAP7D2_ENST00000443379.3_Missense_Mutation_p.K380N	NM_152780.3	NP_689993.2	Q96T17	MA7D2_HUMAN	MAP7 domain containing 2	425					microtubule cytoskeleton organization (GO:0000226)	microtubule (GO:0005874)				NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(9)|lung(13)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	37						CTTGTTCTTCCTTCTCCAGTC	0.493																																																	0													369.0	284.0	313.0					X																	20043083		2203	4300	6503	SO:0001583	missense	0			BC089400	CCDS14195.1, CCDS55384.1, CCDS55385.1, CCDS55386.1	Xp22.12	2008-02-05			ENSG00000184368	ENSG00000184368			25899	protein-coding gene	gene with protein product						12477932	Standard	NM_152780		Approved	FLJ14503	uc010nfo.2	Q96T17	OTTHUMG00000021228	ENST00000379651.3:c.1275G>T	X.37:g.20043083C>A	ENSP00000368972:p.Lys425Asn		B7Z2J8|B7Z3S7|B9EGC7|C9JMA4|C9JYW0|Q5EBN1|Q5JPS7|Q6PIC7|Q8N792	Missense_Mutation	SNP	pfam_MAP7	p.K466N	ENST00000379651.3	37	c.1398	CCDS14195.1	X	.	.	.	.	.	.	.	.	.	.	C	13.09	2.133259	0.37630	.	.	ENSG00000184368	ENST00000379651;ENST00000379643;ENST00000543767;ENST00000443379;ENST00000544957;ENST00000452324	T;T;T;T;T	0.26223	1.75;1.75;1.75;1.75;1.75	5.44	0.699	0.18093	.	0.155258	0.42821	D	0.000647	T	0.44052	0.1275	M	0.79258	2.445	0.30544	N	0.76621	D;D;D;D;D	0.69078	0.997;0.993;0.996;0.997;0.996	D;P;P;D;P	0.65874	0.939;0.827;0.899;0.939;0.899	T	0.45352	-0.9267	10	0.49607	T	0.09	-17.5757	8.7272	0.34476	0.0:0.4781:0.0:0.5219	.	380;373;466;425;310	B7Z3S7;C9JYW0;Q96T17-2;Q96T17;F5GYC2	.;.;.;MA7D2_HUMAN;.	N	425;466;310;380;108;373	ENSP00000368972:K425N;ENSP00000368964:K466N;ENSP00000440691:K310N;ENSP00000388239:K380N;ENSP00000413301:K373N	ENSP00000368964:K466N	K	-	3	2	MAP7D2	19953004	0.991000	0.36638	0.787000	0.31911	0.745000	0.42441	0.247000	0.18179	-0.331000	0.08501	-0.312000	0.09012	AAG	MAP7D2	-	pfam_MAP7	ENSG00000184368		0.493	MAP7D2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MAP7D2	HGNC	protein_coding	OTTHUMT00000056001.1	-	0.00	27	0	C	NM_152780		20043083	-1	tier1	-	no_errors	ENST00000379643	ensembl	human	known	74_37	missense	20.00	20	5	SNP	1.000	A
MAP9	79884	genome.wustl.edu	37	4	156283237	156283237	+	Silent	SNP	A	A	G			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr4:156283237A>G	ENST00000311277.4	-	6	1028	c.765T>C	c.(763-765)tcT>tcC	p.S255S	AC097467.2_ENST00000597831.1_RNA|AC097467.2_ENST00000609716.1_RNA|AC097467.2_ENST00000608406.1_RNA|AC097467.2_ENST00000608544.1_RNA|AC097467.2_ENST00000598890.1_RNA|AC097467.2_ENST00000596754.1_RNA|AC097467.2_ENST00000608762.1_RNA|AC097467.2_ENST00000609254.1_RNA|AC097467.2_ENST00000600928.1_RNA|AC097467.2_ENST00000594492.1_RNA|AC097467.2_ENST00000598252.1_RNA|AC097467.2_ENST00000596165.1_RNA|AC097467.2_ENST00000417474.1_RNA|MAP9_ENST00000515654.1_Silent_p.S255S|AC097467.2_ENST00000594666.1_RNA	NM_001039580.1	NP_001034669.1	Q49MG5	MAP9_HUMAN	microtubule-associated protein 9	255					cytokinesis (GO:0000910)|regulation of mitosis (GO:0007088)|spindle assembly involved in mitosis (GO:0090307)	astral microtubule (GO:0000235)|mitotic spindle midzone (GO:1990023)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(8)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	26	all_hematologic(180;0.24)	Renal(120;0.0458)		COAD - Colon adenocarcinoma(41;0.143)		CTGGTGAAAAAGAATCTCCAA	0.323																																																	0													95.0	100.0	98.0					4																	156283237		2203	4300	6503	SO:0001819	synonymous_variant	0			AK024812	CCDS35493.1	4q32.1	2008-02-05			ENSG00000164114	ENSG00000164114			26118	protein-coding gene	gene with protein product	"""aster-associated protein"""	610070				16049101	Standard	XM_006714306		Approved	ASAP, FLJ21159	uc003ios.3	Q49MG5	OTTHUMG00000133628	ENST00000311277.4:c.765T>C	4.37:g.156283237A>G			Q4W5I7|Q68DU1|Q9H781|Q9H7B6	Silent	SNP	NULL	p.S255	ENST00000311277.4	37	c.765	CCDS35493.1	4																																																																																			MAP9	-	NULL	ENSG00000164114		0.323	MAP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAP9	HGNC	protein_coding	OTTHUMT00000257771.3	-	0.00	78	0	A	NM_001039580		156283237	-1	tier1	-	no_errors	ENST00000311277	ensembl	human	known	74_37	silent	10.71	25	3	SNP	0.000	G
MAPK1	5594	genome.wustl.edu	37	22	22127181	22127181	+	Missense_Mutation	SNP	T	T	C			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr22:22127181T>C	ENST00000215832.6	-	7	1135	c.947A>G	c.(946-948)tAt>tGt	p.Y316C	MAPK1_ENST00000544786.1_Missense_Mutation_p.Y272C|MAPK1_ENST00000398822.3_Missense_Mutation_p.Y316C	NM_002745.4	NP_002736.3	P28482	MK01_HUMAN	mitogen-activated protein kinase 1	316					activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|caveolin-mediated endocytosis (GO:0072584)|cell cycle (GO:0007049)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to granulocyte macrophage colony-stimulating factor stimulus (GO:0097011)|chemotaxis (GO:0006935)|cytosine metabolic process (GO:0019858)|epidermal growth factor receptor signaling pathway (GO:0007173)|ERBB signaling pathway (GO:0038127)|ERK1 and ERK2 cascade (GO:0070371)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|labyrinthine layer blood vessel development (GO:0060716)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|mammary gland epithelial cell proliferation (GO:0033598)|MAPK cascade (GO:0000165)|MAPK import into nucleus (GO:0000189)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of cell differentiation (GO:0045596)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ morphogenesis (GO:0009887)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|platelet activation (GO:0030168)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of translation (GO:0045727)|Ras protein signal transduction (GO:0007265)|regulation of cytoskeleton organization (GO:0051493)|regulation of early endosome to late endosome transport (GO:2000641)|regulation of Golgi inheritance (GO:0090170)|regulation of protein stability (GO:0031647)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|regulation of stress-activated MAPK cascade (GO:0032872)|response to epidermal growth factor (GO:0070849)|response to estrogen (GO:0043627)|response to exogenous dsRNA (GO:0043330)|response to stress (GO:0006950)|response to toxic substance (GO:0009636)|sensory perception of pain (GO:0019233)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|stress-activated MAPK cascade (GO:0051403)|synaptic transmission (GO:0007268)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription, DNA-templated (GO:0006351)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|viral process (GO:0016032)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite cytoplasm (GO:0032839)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|late endosome (GO:0005770)|microtubule cytoskeleton (GO:0015630)|mitochondrion (GO:0005739)|mitotic spindle (GO:0072686)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perikaryon (GO:0043204)|protein complex (GO:0043234)|pseudopodium (GO:0031143)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|MAP kinase activity (GO:0004707)|phosphatase binding (GO:0019902)|protein serine/threonine kinase activity (GO:0004674)|RNA polymerase II carboxy-terminal domain kinase activity (GO:0008353)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	17	Colorectal(54;0.105)	all_lung(157;3.89e-05)		READ - Rectum adenocarcinoma(21;0.0689)	Arsenic trioxide(DB01169)|Isoprenaline(DB01064)	CGGGTCGTAATACTGCTCCAG	0.473																																																	0													198.0	159.0	172.0					22																	22127181		2203	4300	6503	SO:0001583	missense	0			M84489	CCDS13795.1	22q11.2	2014-09-17			ENSG00000100030	ENSG00000100030	2.7.11.1	"""Mitogen-activated protein kinase cascade / Kinases"""	6871	protein-coding gene	gene with protein product		176948		PRKM2, PRKM1			Standard	NM_138957		Approved	ERK, ERK2, p41mapk, MAPK2	uc002zvn.3	P28482	OTTHUMG00000030508	ENST00000215832.6:c.947A>G	22.37:g.22127181T>C	ENSP00000215832:p.Tyr316Cys		A8CZ64	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,prints_MAPK_ERK1/2,prints_MAPK_ERK3/4	p.Y316C	ENST00000215832.6	37	c.947	CCDS13795.1	22	.	.	.	.	.	.	.	.	.	.	T	22.1	4.246515	0.80024	.	.	ENSG00000100030	ENST00000215832;ENST00000415911;ENST00000398822;ENST00000544786	T;T;T	0.45276	0.9;0.9;0.9	4.96	4.96	0.65561	Protein kinase-like domain (1);	0.000000	0.85682	D	0.000000	T	0.75664	0.3880	H	0.96748	3.875	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.81914	0.995;0.995	D	0.84702	0.0729	10	0.87932	D	0	-2.3719	15.087	0.72162	0.0:0.0:0.0:1.0	.	272;316	A8CZ64;P28482	.;MK01_HUMAN	C	316;304;316;272	ENSP00000215832:Y316C;ENSP00000381803:Y316C;ENSP00000440842:Y272C	ENSP00000215832:Y316C	Y	-	2	0	MAPK1	20457181	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	7.778000	0.85637	2.201000	0.70794	0.533000	0.62120	TAT	MAPK1	-	superfamily_Kinase-like_dom,prints_MAPK_ERK1/2	ENSG00000100030		0.473	MAPK1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	MAPK1	HGNC	protein_coding	OTTHUMT00000075396.2	-	0.00	80	0	T			22127181	-1	tier1	-	no_errors	ENST00000215832	ensembl	human	known	74_37	missense	12.12	58	8	SNP	1.000	C
MAPKBP1	23005	genome.wustl.edu	37	15	42106776	42106776	+	Missense_Mutation	SNP	A	A	G			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr15:42106776A>G	ENST00000456763.2	+	11	1223	c.1027A>G	c.(1027-1029)Agg>Ggg	p.R343G	MAPKBP1_ENST00000514566.1_Missense_Mutation_p.R337G|MAPKBP1_ENST00000221214.6_Intron|MAPKBP1_ENST00000260357.7_Missense_Mutation_p.R225G|MAPKBP1_ENST00000457542.2_Missense_Mutation_p.R337G	NM_001128608.1	NP_001122080.1	O60336	MABP1_HUMAN	mitogen-activated protein kinase binding protein 1	343										breast(6)|central_nervous_system(5)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(11)|ovary(1)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	56		all_cancers(109;7.71e-14)|all_epithelial(112;5.15e-12)|Lung NSC(122;3.74e-08)|all_lung(180;1.81e-07)|Melanoma(134;0.0262)		OV - Ovarian serous cystadenocarcinoma(18;3.95e-17)|GBM - Glioblastoma multiforme(94;5.71e-07)|Lung(196;0.0436)|BRCA - Breast invasive adenocarcinoma(123;0.203)|LUSC - Lung squamous cell carcinoma(244;0.225)		GGCGAATGCCAGGTATCCAGA	0.498																																																	0													228.0	190.0	203.0					15																	42106776		2203	4300	6503	SO:0001583	missense	0			AB011168	CCDS32201.1, CCDS45239.1, CCDS58359.1	15q15.1	2013-01-10	2008-01-30		ENSG00000137802	ENSG00000137802		"""WD repeat domain containing"""	29536	protein-coding gene	gene with protein product			"""mitogen activated protein kinase binding protein 1"""			9628581, 10471813	Standard	NM_014994		Approved	KIAA0596	uc001zok.4	O60336	OTTHUMG00000160227	ENST00000456763.2:c.1027A>G	15.37:g.42106776A>G	ENSP00000393099:p.Arg343Gly		A6NM93|A8K8P9|Q14CB5|Q14CD8|Q49AJ8|Q5W9G9	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.R343G	ENST00000456763.2	37	c.1027	CCDS45239.1	15	.	.	.	.	.	.	.	.	.	.	a	18.32	3.597398	0.66332	.	.	ENSG00000137802	ENST00000457542;ENST00000260357;ENST00000456763;ENST00000514566	T;T;T;T	0.53640	1.04;0.61;5.07;5.07	6.06	6.06	0.98353	WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.144113	0.64402	D	0.000008	T	0.50274	0.1606	L	0.53249	1.67	0.36199	D	0.850594	B;P;B;B	0.37663	0.096;0.604;0.073;0.057	B;B;B;B	0.42771	0.088;0.397;0.04;0.046	T	0.55211	-0.8176	10	0.22706	T	0.39	-13.7859	16.6165	0.84917	1.0:0.0:0.0:0.0	.	225;337;343;337	F8WC21;O60336-2;O60336;O60336-6	.;.;MABP1_HUMAN;.	G	337;225;343;337	ENSP00000397570:R337G;ENSP00000260357:R225G;ENSP00000393099:R343G;ENSP00000426154:R337G	ENSP00000260357:R225G	R	+	1	2	MAPKBP1	39894068	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	6.902000	0.75699	2.323000	0.78572	0.529000	0.55759	AGG	MAPKBP1	-	superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000137802		0.498	MAPKBP1-002	KNOWN	basic|CCDS	protein_coding	MAPKBP1	HGNC	protein_coding	OTTHUMT00000359745.1	-	0.00	82	0	A	NM_014994		42106776	+1	tier1	-	no_errors	ENST00000456763	ensembl	human	known	74_37	missense	12.77	41	6	SNP	1.000	G
MARCH1	55016	genome.wustl.edu	37	4	164466807	164466807	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr4:164466807C>A	ENST00000503008.1	-	7	1488	c.512G>T	c.(511-513)tGg>tTg	p.W171L	MARCH1_ENST00000339875.5_Missense_Mutation_p.W154L|MARCH1_ENST00000514618.1_Missense_Mutation_p.W427L|MARCH1_ENST00000274056.7_Missense_Mutation_p.W171L	NM_001166373.1	NP_001159845.1	Q8TCQ1	MARH1_HUMAN	membrane-associated ring finger (C3HC4) 1, E3 ubiquitin protein ligase	171					antigen processing and presentation of peptide antigen via MHC class II (GO:0002495)|immune response (GO:0006955)|protein polyubiquitination (GO:0000209)	cytoplasmic vesicle (GO:0031410)|early endosome membrane (GO:0031901)|endoplasmic reticulum membrane (GO:0005789)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|late endosome membrane (GO:0031902)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)	ligase activity (GO:0016874)|MHC protein binding (GO:0042287)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(3)|large_intestine(3)|lung(20)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	36	all_hematologic(180;0.166)	Prostate(90;0.0959)|all_neural(102;0.223)				ATACAAAGACCAAACCACACA	0.438																																																	0													270.0	204.0	226.0					4																	164466807		2203	4300	6503	SO:0001583	missense	0			AK000675	CCDS3806.1, CCDS54814.1	4q32.2	2013-01-09	2012-02-23			ENSG00000145416		"""MARCH membrane-associated ring fingers"", ""RING-type (C3HC4) zinc fingers"""	26077	protein-coding gene	gene with protein product		613331	"""membrane-associated ring finger (C3HC4) 1"""			14722266	Standard	NM_017923		Approved	FLJ20668, MARCH-I, RNF171	uc003iqs.2	Q8TCQ1		ENST00000503008.1:c.512G>T	4.37:g.164466807C>A	ENSP00000427223:p.Trp171Leu		D3DP29|Q9NWR0	Missense_Mutation	SNP	pfam_Znf_C3HC4_RING-type,smart_Znf_RING-CH,pfscan_Znf_RING	p.W171L	ENST00000503008.1	37	c.512	CCDS54814.1	4	.	.	.	.	.	.	.	.	.	.	C	20.2	3.945069	0.73672	.	.	ENSG00000145416	ENST00000274056;ENST00000503008;ENST00000514618;ENST00000339875	T;T;T;T	0.33216	1.85;1.85;1.42;1.46	4.91	4.91	0.64330	.	0.000000	0.64402	D	0.000004	T	0.43033	0.1229	L	0.61218	1.895	0.80722	D	1	P;P	0.49783	0.928;0.48	P;B	0.49387	0.609;0.204	T	0.34179	-0.9839	10	0.40728	T	0.16	-18.5732	18.0874	0.89462	0.0:1.0:0.0:0.0	.	171;154	Q8TCQ1;Q8TCQ1-2	MARH1_HUMAN;.	L	171;171;427;154	ENSP00000274056:W171L;ENSP00000427223:W171L;ENSP00000421322:W427L;ENSP00000345676:W154L	ENSP00000274056:W171L	W	-	2	0	MARCH1	164686257	1.000000	0.71417	0.996000	0.52242	0.913000	0.54294	7.487000	0.81328	2.270000	0.75569	0.655000	0.94253	TGG	MARCH1	-	NULL	ENSG00000145416		0.438	MARCH1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	MARCH1	HGNC	protein_coding	OTTHUMT00000364493.2	-	0.00	68	0	C	NM_017923		164466807	-1	tier1	-	no_errors	ENST00000274056	ensembl	human	known	74_37	missense	20.83	19	5	SNP	1.000	A
MARCH10	162333	genome.wustl.edu	37	17	60865948	60865948	+	Nonsense_Mutation	SNP	G	G	A	rs200814272		TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr17:60865948G>A	ENST00000311269.5	-	3	377	c.103C>T	c.(103-105)Cga>Tga	p.R35*	MARCH10_ENST00000583600.1_Nonsense_Mutation_p.R35*|MARCH10_ENST00000456609.2_Nonsense_Mutation_p.R35*|MARCH10_ENST00000544856.2_Nonsense_Mutation_p.R35*	NM_152598.2	NP_689811.2	Q8NA82	MARHA_HUMAN	membrane-associated ring finger (C3HC4) 10, E3 ubiquitin protein ligase	35					protein ubiquitination (GO:0016567)		ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(11)|liver(1)|lung(15)	38						TATTCCTGTCGTCTCAGACAA	0.433													G|||	1	0.000199681	0.0	0.0	5008	,	,		17640	0.001		0.0	False		,,,				2504	0.0																0													123.0	107.0	113.0					17																	60865948		2203	4300	6503	SO:0001587	stop_gained	0			AK093076	CCDS11635.1, CCDS74122.1, CCDS74123.1	17q23.3	2013-01-09	2012-02-23	2007-08-20		ENSG00000173838		"""RING-type (C3HC4) zinc fingers"", ""MARCH membrane-associated ring fingers"""	26655	protein-coding gene	gene with protein product		613337	"""ring finger protein 190"", ""membrane-associated ring finger (C3HC4) 10"""	RNF190		17604280	Standard	XM_005257103		Approved	FLJ35757, MARCH-X	uc002jag.4	Q8NA82		ENST00000311269.5:c.103C>T	17.37:g.60865948G>A	ENSP00000311496:p.Arg35*		D3DU09|Q8IYS7|Q8N7Z7	Nonsense_Mutation	SNP	pfam_Znf_C3HC4_RING-type,smart_Znf_RING-CH	p.R35*	ENST00000311269.5	37	c.103	CCDS11635.1	17	.	.	.	.	.	.	.	.	.	.	G	33	5.204529	0.95033	.	.	ENSG00000173838	ENST00000456609;ENST00000311269;ENST00000544856	.	.	.	5.28	3.04	0.35103	.	0.237015	0.22083	N	0.064868	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-3.608	9.0739	0.36508	0.0:0.149:0.6778:0.1732	.	.	.	.	X	35	.	ENSP00000311496:R35X	R	-	1	2	MARCH10	58219680	1.000000	0.71417	1.000000	0.80357	0.820000	0.46376	1.474000	0.35398	1.193000	0.43086	0.561000	0.74099	CGA	MARCH10	-	NULL	ENSG00000173838		0.433	MARCH10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MARCH10	HGNC	protein_coding	OTTHUMT00000445252.1	-	0.00	77	0	G	NM_152598		60865948	-1	tier1	rs200814272	no_errors	ENST00000311269	ensembl	human	known	74_37	nonsense	17.78	36	8	SNP	1.000	A
MARCH2	51257	genome.wustl.edu	37	19	8491528	8491528	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr19:8491528C>T	ENST00000602117.1	+	3	667	c.212C>T	c.(211-213)gCg>gTg	p.A71V	RP11-886P16.6_ENST00000595706.1_RNA|MARCH2_ENST00000601283.1_Intron|MARCH2_ENST00000393944.1_Missense_Mutation_p.A71V|MARCH2_ENST00000215555.2_Missense_Mutation_p.A71V|MARCH2_ENST00000381035.4_Missense_Mutation_p.A71V			Q9P0N8	MARH2_HUMAN	membrane-associated ring finger (C3HC4) 2, E3 ubiquitin protein ligase	71					endocytosis (GO:0006897)|protein ubiquitination (GO:0016567)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(1)|lung(3)|ovary(3)|skin(1)|urinary_tract(1)	10						CATGAGGGAGCGAACGGGGAG	0.567																																																	0													114.0	89.0	97.0					19																	8491528		2203	4300	6503	SO:0001583	missense	0			AF151074	CCDS12202.1, CCDS32894.1	19p13.2	2013-01-09	2012-02-23			ENSG00000099785		"""MARCH membrane-associated ring fingers"", ""RING-type (C3HC4) zinc fingers"""	28038	protein-coding gene	gene with protein product		613332	"""membrane-associated ring finger (C3HC4) 2"""			11042152, 14722266	Standard	NM_016496		Approved	HSPC240, MARCH-II, RNF172	uc002mjw.3	Q9P0N8		ENST00000602117.1:c.212C>T	19.37:g.8491528C>T	ENSP00000471536:p.Ala71Val		A6NP10|Q5H785|Q8N5A3|Q96B78	Missense_Mutation	SNP	pfam_Znf_C3HC4_RING-type,smart_Znf_RING-CH,pfscan_Znf_RING	p.A71V	ENST00000602117.1	37	c.212	CCDS12202.1	19	.	.	.	.	.	.	.	.	.	.	c	13.41	2.227824	0.39399	.	.	ENSG00000099785	ENST00000393944;ENST00000215555;ENST00000381035	T;T;T	0.45276	0.9;0.9;0.9	5.41	4.32	0.51571	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-CH-type (2);	0.265034	0.34484	N	0.003925	T	0.30696	0.0773	L	0.35723	1.085	0.24415	N	0.994649	P;P	0.51791	0.948;0.924	B;B	0.38296	0.182;0.27	T	0.34800	-0.9814	10	0.52906	T	0.07	-9.964	12.5194	0.56050	0.0:0.6805:0.3195:0.0	.	71;71	Q9P0N8-2;Q9P0N8	.;MARH2_HUMAN	V	71	ENSP00000377518:A71V;ENSP00000215555:A71V;ENSP00000370423:A71V	ENSP00000215555:A71V	A	+	2	0	MARCH2	8397528	1.000000	0.71417	0.534000	0.28014	0.280000	0.26924	5.628000	0.67791	2.562000	0.86427	0.574000	0.79327	GCG	MARCH2	-	pfam_Znf_C3HC4_RING-type,smart_Znf_RING-CH,pfscan_Znf_RING	ENSG00000099785		0.567	MARCH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MARCH2	HGNC	protein_coding	OTTHUMT00000460361.2		0.00	88	0	C	NM_016496		8491528	+1			no_errors	ENST00000215555	ensembl	human	known	74_37	missense	10.26	35	4	SNP	0.824	T
MARK1	4139	genome.wustl.edu	37	1	220808825	220808825	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr1:220808825G>T	ENST00000366917.4	+	12	1496	c.1230G>T	c.(1228-1230)caG>caT	p.Q410H	MARK1_ENST00000402574.1_Missense_Mutation_p.Q275H|MARK1_ENST00000366918.4_Missense_Mutation_p.Q388H					MAP/microtubule affinity-regulating kinase 1											central_nervous_system(2)|endometrium(9)|kidney(6)|large_intestine(12)|lung(22)|ovary(4)|pancreas(1)|skin(3)|stomach(3)|urinary_tract(1)	63				GBM - Glioblastoma multiforme(131;0.0407)		TGAAGGTCCAGAGAAGTATCT	0.483																																																	0													81.0	76.0	78.0					1																	220808825		2203	4300	6503	SO:0001583	missense	0			AF154845	CCDS31029.2, CCDS65789.1, CCDS73033.1, CCDS73034.1	1q41	2013-06-27			ENSG00000116141	ENSG00000116141			6896	protein-coding gene	gene with protein product		606511				9108484	Standard	NM_018650		Approved	MARK, PAR-1C	uc001hmn.4	Q9P0L2	OTTHUMG00000037351	ENST00000366917.4:c.1230G>T	1.37:g.220808825G>T	ENSP00000355884:p.Gln410His			Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_KA1_dom,superfamily_Kinase-like_dom,superfamily_KA1/Ssp2_C,superfamily_UBA-like,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_UBA/transl_elong_EF1B_N_euk,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Prot_kinase_dom	p.Q410H	ENST00000366917.4	37	c.1230	CCDS31029.2	1	.	.	.	.	.	.	.	.	.	.	G	15.08	2.726819	0.48833	.	.	ENSG00000116141	ENST00000402574;ENST00000366918;ENST00000366917	T;T;T	0.56103	0.48;0.48;0.48	5.92	5.01	0.66863	.	0.121890	0.64402	D	0.000020	T	0.44159	0.1280	L	0.39147	1.195	0.44485	D	0.997427	B;B;B;B	0.23316	0.002;0.014;0.083;0.065	B;B;B;B	0.21151	0.006;0.02;0.033;0.033	T	0.25363	-1.0134	10	0.31617	T	0.26	.	14.5228	0.67863	0.0697:0.0:0.9303:0.0	.	410;275;410;388	B4DIB3;Q9P0L2-2;Q9P0L2;Q9P0L2-3	.;.;MARK1_HUMAN;.	H	275;388;410	ENSP00000386017:Q275H;ENSP00000355885:Q388H;ENSP00000355884:Q410H	ENSP00000355884:Q410H	Q	+	3	2	MARK1	218875448	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	2.420000	0.44679	2.813000	0.96785	0.561000	0.74099	CAG	MARK1	-	NULL	ENSG00000116141		0.483	MARK1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	MARK1	HGNC	protein_coding	OTTHUMT00000090899.1		0.00	84	0	G			220808825	+1			no_errors	ENST00000366917	ensembl	human	known	74_37	missense	6.35	59	4	SNP	1.000	T
MARVELD3	91862	genome.wustl.edu	37	16	71674801	71674801	+	Silent	SNP	G	G	A			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr16:71674801G>A	ENST00000299952.4	+	3	1147	c.1104G>A	c.(1102-1104)gtG>gtA	p.V368V	PHLPP2_ENST00000540628.1_3'UTR|MARVELD3_ENST00000561682.1_Intron|MARVELD3_ENST00000565261.1_3'UTR	NM_001017967.3|NM_001271329.1	NP_001017967.2|NP_001258258.1	Q96A59	MALD3_HUMAN	MARVEL domain containing 3	371	MARVEL. {ECO:0000255|PROSITE- ProRule:PRU00581}.				cell-cell junction organization (GO:0045216)|tight junction assembly (GO:0070830)	cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|tight junction (GO:0005923)				NS(1)|endometrium(3)|large_intestine(5)|lung(6)|skin(2)	17		Ovarian(137;0.125)				GTCTTCTCGTGATCATGTACG	0.592																																																	0													60.0	49.0	53.0					16																	71674801		2198	4300	6498	SO:0001819	synonymous_variant	0			BC013376	CCDS10904.1, CCDS32478.1, CCDS59270.1	16q22.2	2008-02-05	2004-07-12	2004-07-14	ENSG00000140832	ENSG00000140832			30525	protein-coding gene	gene with protein product		614094	"""MARVEL (membrane-associating) domain containing 3"""	MRVLDC3			Standard	NM_001017967		Approved		uc002fat.4	Q96A59	OTTHUMG00000137591	ENST00000299952.4:c.1104G>A	16.37:g.71674801G>A			A8K820|H3BQM5|Q96MJ4	Silent	SNP	NULL	p.V368	ENST00000299952.4	37	c.1104	CCDS32478.1	16																																																																																			MARVELD3	-	NULL	ENSG00000140832		0.592	MARVELD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MARVELD3	HGNC	protein_coding	OTTHUMT00000268990.1	-	0.00	42	0	G	NM_052858		71674801	+1	tier1	-	no_errors	ENST00000299952	ensembl	human	known	74_37	silent	22.22	14	4	SNP	0.941	A
MASP1	5648	genome.wustl.edu	37	3	186974517	186974517	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr3:186974517G>T	ENST00000337774.5	-	5	1068	c.679C>A	c.(679-681)Cag>Aag	p.Q227K	MASP1_ENST00000296280.6_Missense_Mutation_p.Q227K|MASP1_ENST00000392472.2_Missense_Mutation_p.Q114K|MASP1_ENST00000392470.2_Missense_Mutation_p.Q201K|MASP1_ENST00000169293.6_Missense_Mutation_p.Q227K|MASP1_ENST00000495249.1_Intron	NM_001879.5	NP_001870.3	P48740	MASP1_HUMAN	mannan-binding lectin serine peptidase 1 (C4/C2 activating component of Ra-reactive factor)	227	CUB 2. {ECO:0000255|PROSITE- ProRule:PRU00059}.|Interaction with FCN2.				complement activation (GO:0006956)|complement activation, lectin pathway (GO:0001867)|innate immune response (GO:0045087)|negative regulation of complement activation (GO:0045916)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	calcium ion binding (GO:0005509)|calcium-dependent protein binding (GO:0048306)|peptidase activity (GO:0008233)|protein homodimerization activity (GO:0042803)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|liver(2)|lung(27)|ovary(2)|pancreas(1)|prostate(3)|urinary_tract(1)	60	all_cancers(143;5.33e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;3.49e-18)	GBM - Glioblastoma multiforme(93;0.0366)		TCCTCAAACTGCAGGTTGACC	0.522																																																	0													195.0	160.0	172.0					3																	186974517		2203	4300	6503	SO:0001583	missense	0			D28593	CCDS33907.1, CCDS33908.1, CCDS33909.1	3q27-q28	2014-09-17	2005-08-17		ENSG00000127241	ENSG00000127241		"""Serine peptidases / Serine peptidases"""	6901	protein-coding gene	gene with protein product		600521	"""mannan-binding lectin serine protease 1 (C4/C2 activating component of Ra-reactive factor)"""	CRARF, PRSS5		8018603, 8240317	Standard	NR_033519		Approved	MASP	uc003fri.3	P48740	OTTHUMG00000156461	ENST00000337774.5:c.679C>A	3.37:g.186974517G>T	ENSP00000336792:p.Gln227Lys		A8K542|A8K6M1|B4E2L7|O95570|Q68D21|Q8IUV8|Q96RS4|Q9UF09	Missense_Mutation	SNP	pfam_Peptidase_S1,pfam_CUB_dom,pfam_Sushi_SCR_CCP,pfam_EGF-like_Ca-bd_dom,superfamily_Trypsin-like_Pept_dom,superfamily_CUB_dom,superfamily_Sushi_SCR_CCP,smart_CUB_dom,smart_EGF-like_Ca-bd_dom,smart_Sushi_SCR_CCP,smart_Peptidase_S1,prints_Peptidase_S1A,pfscan_CUB_dom,pfscan_Sushi_SCR_CCP,pfscan_Peptidase_S1	p.Q227K	ENST00000337774.5	37	c.679	CCDS33907.1	3	.	.	.	.	.	.	.	.	.	.	G	4.786	0.146175	0.09134	.	.	ENSG00000127241	ENST00000337774;ENST00000296280;ENST00000392472;ENST00000541896;ENST00000169293;ENST00000392470	T;T;T;T;T	0.17213	2.29;2.29;2.29;2.29;2.29	5.53	5.53	0.82687	CUB (5);	0.265717	0.39687	N	0.001290	T	0.11580	0.0282	N	0.21324	0.655	0.36923	D	0.891491	B;B;B;B;B	0.22800	0.009;0.004;0.075;0.004;0.005	B;B;B;B;B	0.25291	0.004;0.003;0.059;0.004;0.005	T	0.09907	-1.0653	10	0.07482	T	0.82	.	13.9951	0.64392	0.0:0.0:0.839:0.161	.	201;227;114;227;227	F8W876;P48740-3;P48740-4;P48740-2;P48740	.;.;.;.;MASP1_HUMAN	K	227;227;114;114;227;201	ENSP00000336792:Q227K;ENSP00000296280:Q227K;ENSP00000376264:Q114K;ENSP00000169293:Q227K;ENSP00000376262:Q201K	ENSP00000169293:Q227K	Q	-	1	0	MASP1	188457211	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.101000	0.41787	2.588000	0.87417	0.561000	0.74099	CAG	MASP1	-	pfam_CUB_dom,superfamily_CUB_dom,smart_CUB_dom,pfscan_CUB_dom	ENSG00000127241		0.522	MASP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MASP1	HGNC	protein_coding	OTTHUMT00000344262.1	-	0.00	81	0	G	NM_001879		186974517	-1	tier1	-	no_errors	ENST00000296280	ensembl	human	known	74_37	missense	5.71	66	4	SNP	1.000	T
MAT2B	27430	genome.wustl.edu	37	5	162940973	162940973	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr5:162940973G>A	ENST00000321757.6	+	4	638	c.499G>A	c.(499-501)Gaa>Aaa	p.E167K	MAT2B_ENST00000518095.1_Missense_Mutation_p.E167K|MAT2B_ENST00000280969.5_Missense_Mutation_p.E156K	NM_013283.3	NP_037415.1	Q9NZL9	MAT2B_HUMAN	methionine adenosyltransferase II, beta	167					cellular nitrogen compound metabolic process (GO:0034641)|extracellular polysaccharide biosynthetic process (GO:0045226)|methylation (GO:0032259)|one-carbon metabolic process (GO:0006730)|regulation of catalytic activity (GO:0050790)|S-adenosylmethionine biosynthetic process (GO:0006556)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|methionine adenosyltransferase complex (GO:0048269)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	dTDP-4-dehydrorhamnose reductase activity (GO:0008831)|enzyme binding (GO:0019899)|methionine adenosyltransferase regulator activity (GO:0048270)			endometrium(3)|large_intestine(4)|lung(6)|upper_aerodigestive_tract(1)	14	Renal(175;0.000281)	Medulloblastoma(196;0.0208)|all_neural(177;0.0765)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.027)|OV - Ovarian serous cystadenocarcinoma(192;0.0406)|Epithelial(171;0.0797)	L-Methionine(DB00134)	ATTAGATGGAGAAAAGGCTGT	0.343																																																	0													67.0	66.0	67.0					5																	162940973		2203	4300	6503	SO:0001583	missense	0			AF182814	CCDS4364.1, CCDS4365.1	5q34-q35	2011-09-14			ENSG00000038274	ENSG00000038274		"""Short chain dehydrogenase/reductase superfamily / Extended SDR fold"""	6905	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 23E, member 1"""	605527				9055605, 10644686, 19027726	Standard	NM_182796		Approved	MATIIbeta, SDR23E1	uc003lzk.4	Q9NZL9	OTTHUMG00000130379	ENST00000321757.6:c.499G>A	5.37:g.162940973G>A	ENSP00000325425:p.Glu167Lys		B2R5Y6|Q1WAI7|Q27J92|Q3LIE8|Q567T7|Q6NYC7|Q9BS89|Q9H3E1|Q9UJ54	Missense_Mutation	SNP	pfam_dTDP_dehydrorham_reduct,pfam_Epimerase_deHydtase,pfam_Polysac_CapD-like,pfam_3Beta_OHSteriod_DH/Estase	p.E167K	ENST00000321757.6	37	c.499	CCDS4365.1	5	.	.	.	.	.	.	.	.	.	.	G	35	5.500904	0.96371	.	.	ENSG00000038274	ENST00000280969;ENST00000321757;ENST00000421814;ENST00000518095;ENST00000415433	T;T;T;T	0.67865	0.11;0.11;-0.29;0.11	5.66	5.66	0.87406	NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.87708	0.6245	H	0.94658	3.565	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.968;0.998;0.996	D	0.90501	0.4474	10	0.87932	D	0	.	19.7538	0.96281	0.0:0.0:1.0:0.0	.	167;167;156	Q9NZL9-3;Q9NZL9;Q9NZL9-2	.;MAT2B_HUMAN;.	K	156;167;102;167;61	ENSP00000280969:E156K;ENSP00000325425:E167K;ENSP00000397371:E102K;ENSP00000428046:E167K	ENSP00000280969:E156K	E	+	1	0	MAT2B	162873551	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.435000	0.97529	2.690000	0.91761	0.655000	0.94253	GAA	MAT2B	-	pfam_dTDP_dehydrorham_reduct,pfam_Epimerase_deHydtase,pfam_3Beta_OHSteriod_DH/Estase	ENSG00000038274		0.343	MAT2B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	MAT2B	HGNC	protein_coding	OTTHUMT00000252749.2	-	0.00	92	0	G	NM_013283		162940973	+1	tier1	-	no_errors	ENST00000321757	ensembl	human	known	74_37	missense	23.68	29	9	SNP	1.000	A
MBD5	55777	genome.wustl.edu	37	2	149226327	149226327	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr2:149226327C>A	ENST00000407073.1	+	9	1812	c.815C>A	c.(814-816)cCt>cAt	p.P272H	MBD5_ENST00000404807.1_Missense_Mutation_p.P272H	NM_018328.4	NP_060798.2	Q9P267	MBD5_HUMAN	methyl-CpG binding domain protein 5	272					glucose homeostasis (GO:0042593)|nervous system development (GO:0007399)|positive regulation of growth hormone receptor signaling pathway (GO:0060399)|regulation of multicellular organism growth (GO:0040014)|single-organism behavior (GO:0044708)	chromocenter (GO:0010369)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	chromatin binding (GO:0003682)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(8)|kidney(1)|large_intestine(16)|lung(22)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)	62				BRCA - Breast invasive adenocarcinoma(221;0.0569)		AATAGGACTCCTCTTTCTCCA	0.453																																																	0													91.0	95.0	94.0					2																	149226327		2203	4300	6503	SO:0001583	missense	0			AB040894	CCDS33302.1	2q23.2	2009-04-17			ENSG00000204406	ENSG00000204406			20444	protein-coding gene	gene with protein product		611472				12529184	Standard	NM_018328		Approved	FLJ11113, KIAA1461	uc002twm.4	Q9P267	OTTHUMG00000150440	ENST00000407073.1:c.815C>A	2.37:g.149226327C>A	ENSP00000386049:p.Pro272His		A5HMQ4|A7E2B1|Q53SR1|Q9NUV6	Missense_Mutation	SNP	superfamily_DNA-bd_dom,smart_Methyl_CpG_DNA-bd,pfscan_Methyl_CpG_DNA-bd,pfscan_PWWP_dom	p.P272H	ENST00000407073.1	37	c.815	CCDS33302.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.26|16.26	3.072495|3.072495	0.55646|0.55646	.|.	.|.	ENSG00000204406|ENSG00000204406	ENST00000416015|ENST00000407073;ENST00000404807	.|T;T	.|0.61158	.|0.13;0.13	5.16|5.16	5.16|5.16	0.70880|0.70880	.|.	.|0.000000	.|0.64402	.|D	.|0.000014	T|T	0.65471|0.65471	0.2694|0.2694	N|N	0.19112|0.19112	0.55|0.55	0.80722|0.80722	D|D	1|1	.|D	.|0.89917	.|1.0	.|D	.|0.91635	.|0.999	T|T	0.70992|0.70992	-0.4721|-0.4721	5|10	.|0.87932	.|D	.|0	-5.8045|-5.8045	19.0076|19.0076	0.92857|0.92857	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|272	.|Q9P267	.|MBD5_HUMAN	I|H	12|272	.|ENSP00000386049:P272H;ENSP00000384672:P272H	.|ENSP00000384672:P272H	L|P	+|+	1|2	0|0	MBD5|MBD5	148942797|148942797	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	7.445000|7.445000	0.80570|0.80570	2.571000|2.571000	0.86741|0.86741	0.591000|0.591000	0.81541|0.81541	CTC|CCT	MBD5	-	NULL	ENSG00000204406		0.453	MBD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MBD5	HGNC	protein_coding	OTTHUMT00000318111.2	-	0.00	51	0	C			149226327	+1	tier1	-	no_errors	ENST00000407073	ensembl	human	known	74_37	missense	10.71	25	3	SNP	1.000	A
MCOLN2	255231	genome.wustl.edu	37	1	85405236	85405236	+	Splice_Site	SNP	C	C	A			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr1:85405236C>A	ENST00000370608.3	-	9	1177	c.1110G>T	c.(1108-1110)aaG>aaT	p.K370N	MCOLN2_ENST00000531325.1_5'UTR|MCOLN2_ENST00000284027.5_Splice_Site_p.K342N	NM_153259.2	NP_694991.2	Q8IZK6	MCLN2_HUMAN	mucolipin 2	370			K -> Q (in dbSNP:rs6704203).		calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(3)|prostate(1)|upper_aerodigestive_tract(2)	18				all cancers(265;0.0111)|Epithelial(280;0.0263)|OV - Ovarian serous cystadenocarcinoma(397;0.217)		CTTCCCTCACCTTTGCTTTGA	0.453																																																	0													93.0	90.0	91.0					1																	85405236		2203	4300	6503	SO:0001630	splice_region_variant	0			AK094010	CCDS30762.1	1p22	2011-12-16			ENSG00000153898	ENSG00000153898		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	13357	protein-coding gene	gene with protein product		607399				16382100	Standard	XM_005270719		Approved	TRPML2, FLJ36691, TRP-ML2	uc001dkm.3	Q8IZK6	OTTHUMG00000009954	ENST00000370608.3:c.1110+1G>T	1.37:g.85405236C>A			A6NI99|Q2M3I6|Q5TAG5|Q8N9R3	Missense_Mutation	SNP	pfam_PKD1_2_channel	p.K370N	ENST00000370608.3	37	c.1110	CCDS30762.1	1	.	.	.	.	.	.	.	.	.	.	C	20.9	4.074133	0.76415	.	.	ENSG00000153898	ENST00000370608;ENST00000284027	D;D	0.85339	-1.97;-1.96	5.18	4.27	0.50696	.	0.049543	0.85682	D	0.000000	D	0.90363	0.6984	M	0.82517	2.595	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.91090	0.4906	9	.	.	.	-32.2348	13.5554	0.61757	0.0:0.9245:0.0:0.0755	.	370	Q8IZK6	MCLN2_HUMAN	N	370;342	ENSP00000359640:K370N;ENSP00000284027:K342N	.	K	-	3	2	MCOLN2	85177824	1.000000	0.71417	1.000000	0.80357	0.874000	0.50279	4.689000	0.61723	1.169000	0.42739	0.563000	0.77884	AAG	MCOLN2	-	NULL	ENSG00000153898		0.453	MCOLN2-001	KNOWN	basic|CCDS	protein_coding	MCOLN2	HGNC	protein_coding	OTTHUMT00000027567.2		0.00	39	0	C	NM_153259	Missense_Mutation	85405236	-1			no_errors	ENST00000370608	ensembl	human	known	74_37	missense	5.56	34	2	SNP	1.000	A
MDGA2	161357	genome.wustl.edu	37	14	47770688	47770688	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr14:47770688C>T	ENST00000399232.2	-	2	503	c.139G>A	c.(139-141)Gaa>Aaa	p.E47K	MDGA2_ENST00000426342.1_5'UTR|MDGA2_ENST00000472499.2_5'UTR|MDGA2_ENST00000357362.3_5'UTR|MDGA2_ENST00000439988.3_Missense_Mutation_p.E116K	NM_001113498.2	NP_001106970.3	Q7Z553	MDGA2_HUMAN	MAM domain containing glycosylphosphatidylinositol anchor 2	47	Ig-like 1.				pattern specification process (GO:0007389)|spinal cord motor neuron differentiation (GO:0021522)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)				breast(3)|endometrium(4)|kidney(2)|large_intestine(14)|lung(41)|ovary(4)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(5)	76						TAGACCCTTTCGGAGTAGCGC	0.522																																																	0													154.0	143.0	146.0					14																	47770688		692	1591	2283	SO:0001583	missense	0			AI859192	CCDS41948.1, CCDS45098.1, CCDS45098.2, CCDS45098.3	14q21.2	2013-01-29	2007-04-03	2007-04-03	ENSG00000139915	ENSG00000139915		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	19835	protein-coding gene	gene with protein product		611128	"""MAM domain containing 1"""	MAMDC1		15019943	Standard	NM_001113498		Approved		uc001wwj.4	Q7Z553	OTTHUMG00000029429	ENST00000399232.2:c.139G>A	14.37:g.47770688C>T	ENSP00000382178:p.Glu47Lys		F6W3S7|J3KPX6	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_MAM_dom,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_MAM_dom,pfscan_MAM_dom,pfscan_Ig-like_dom	p.E116K	ENST00000399232.2	37	c.346		14	.	.	.	.	.	.	.	.	.	.	C	19.38	3.816018	0.70912	.	.	ENSG00000139915	ENST00000439988;ENST00000399232;ENST00000486952	T;T;T	0.52057	0.68;0.68;0.68	5.2	5.2	0.72013	Immunoglobulin-like (1);	0.000000	0.35708	U	0.003034	T	0.59851	0.2224	L	0.33668	1.02	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.61342	-0.7082	10	0.56958	D	0.05	.	17.7007	0.88293	0.0:1.0:0.0:0.0	.	47	Q7Z553	MDGA2_HUMAN	K	47;116;71	ENSP00000400011:E47K;ENSP00000382178:E116K;ENSP00000452515:E71K	ENSP00000382178:E116K	E	-	1	0	MDGA2	46840438	1.000000	0.71417	0.902000	0.35471	0.012000	0.07955	7.471000	0.80985	2.591000	0.87537	0.650000	0.86243	GAA	MDGA2	-	smart_Ig_sub,pfscan_Ig-like_dom	ENSG00000272781		0.522	MDGA2-001	KNOWN	upstream_ATG|basic|appris_principal	protein_coding	MDGA2	Uniprot_gn	protein_coding	OTTHUMT00000073352.5	-	0.00	54	0	C	NM_182830		47770688	-1	tier1	-	no_errors	ENST00000439988	ensembl	human	known	74_37	missense	29.73	26	11	SNP	1.000	T
MDM2	4193	genome.wustl.edu	37	12	69233544	69233544	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr12:69233544G>A	ENST00000350057.5	+	9	1316	c.1316G>A	c.(1315-1317)tGt>tAt	p.C439Y	RP11-611O2.5_ENST00000553141.1_RNA|MDM2_ENST00000545204.1_3'UTR|MDM2_ENST00000258149.5_Missense_Mutation_p.C409Y|MDM2_ENST00000393413.3_Missense_Mutation_p.C191Y|MDM2_ENST00000299252.4_Missense_Mutation_p.C294Y|MDM2_ENST00000393412.3_Missense_Mutation_p.C191Y|MDM2_ENST00000462284.1_Missense_Mutation_p.C470Y|MDM2_ENST00000258148.7_Missense_Mutation_p.C415Y|MDM2_ENST00000544561.1_Missense_Mutation_p.M62I|MDM2_ENST00000478070.1_3'UTR|MDM2_ENST00000348801.2_Missense_Mutation_p.C238Y|MDM2_ENST00000517852.1_Missense_Mutation_p.C103Y|MDM2_ENST00000356290.4_Missense_Mutation_p.C294Y|MDM2_ENST00000393410.1_Missense_Mutation_p.C216Y|MDM2_ENST00000360430.2_Missense_Mutation_p.C269Y|MDM2_ENST00000428863.2_Missense_Mutation_p.C243Y|MDM2_ENST00000540827.1_Missense_Mutation_p.C269Y			Q00987	MDM2_HUMAN	MDM2 proto-oncogene, E3 ubiquitin protein ligase	464	Necessary for interaction with USP2.				cellular response to acid chemical (GO:0071229)|cellular response to alkaloid (GO:0071312)|cellular response to antibiotic (GO:0071236)|cellular response to estrogen stimulus (GO:0071391)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to hypoxia (GO:0071456)|cellular response to peptide hormone stimulus (GO:0071375)|cellular response to UV-C (GO:0071494)|cellular response to vitamin B1 (GO:0071301)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|epidermal growth factor receptor signaling pathway (GO:0007173)|establishment of protein localization (GO:0045184)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell cycle arrest (GO:0071157)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043518)|negative regulation of protein processing (GO:0010955)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-lysine modification (GO:0018205)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein export from nucleus (GO:0046827)|protein complex assembly (GO:0006461)|protein destabilization (GO:0031648)|protein localization to nucleus (GO:0034504)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of protein catabolic process (GO:0042176)|response to antibiotic (GO:0046677)|response to carbohydrate (GO:0009743)|response to cocaine (GO:0042220)|response to drug (GO:0042493)|response to ether (GO:0045472)|response to iron ion (GO:0010039)|response to magnesium ion (GO:0032026)|response to morphine (GO:0043278)|synaptic transmission (GO:0007268)|traversing start control point of mitotic cell cycle (GO:0007089)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|synapse (GO:0045202)	enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|ligase activity (GO:0016874)|p53 binding (GO:0002039)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|liver(2)|lung(8)|prostate(1)|urinary_tract(1)	19	all_cancers(1;8.46e-121)|all_epithelial(5;3.21e-36)|Lung NSC(4;2.16e-33)|all_lung(4;3.03e-31)|Glioma(1;1.9e-09)|Breast(13;1.59e-06)|all_neural(1;1.03e-05)|Melanoma(1;0.0171)|Renal(347;0.0684)		all cancers(2;8.67e-65)|GBM - Glioblastoma multiforme(2;8.89e-62)|BRCA - Breast invasive adenocarcinoma(5;2.43e-08)|Lung(24;1.5e-05)|LUAD - Lung adenocarcinoma(15;8.5e-05)|STAD - Stomach adenocarcinoma(21;0.00372)|Kidney(9;0.143)			TGCTTTACATGTGCAAAGAAG	0.408			A		"""sarcoma, glioma, colorectal, other"""																																			Dom	yes		12	12q15	4193	Mdm2 p53 binding protein homolog		"""M, O, E, L"""	0													104.0	97.0	99.0					12																	69233544		1897	4127	6024	SO:0001583	missense	0				CCDS8986.2, CCDS61189.1	12q13-q14	2014-06-26	2014-06-26		ENSG00000135679	ENSG00000135679			6973	protein-coding gene	gene with protein product		164785	"""mouse double minute 2, human homolog of; p53-binding protein"", ""Mdm2, transformed 3T3 cell double minute 2, p53 binding protein (mouse)"", ""Mdm2 p53 binding protein homolog (mouse)"""			1614537, 16905769	Standard	NM_002392		Approved	HDM2, MGC5370	uc001sui.4	Q00987	OTTHUMG00000142827	ENST00000350057.5:c.1316G>A	12.37:g.69233544G>A	ENSP00000266624:p.Cys439Tyr		A6NL51|A8K2S6|Q13226|Q13297|Q13298|Q13299|Q13300|Q13301|Q53XW0|Q71TW9|Q8WYJ1|Q8WYJ2|Q9UGI3|Q9UMT8	Missense_Mutation	SNP	pfam_SWIB_MDM2_domain,pfam_Znf_RanBP2,superfamily_SWIB_MDM2_domain,pirsf_p53_neg-reg_MDM_2/4,pfscan_Znf_RanBP2,pfscan_Znf_RING	p.C470Y	ENST00000350057.5	37	c.1409		12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.57|14.57	2.574882|2.574882	0.45902|0.45902	.|.	.|.	ENSG00000135679|ENSG00000135679	ENST00000462284;ENST00000544648;ENST00000258149;ENST00000356290;ENST00000540827;ENST00000428863;ENST00000393412;ENST00000311420;ENST00000258148;ENST00000393413;ENST00000350057;ENST00000393410;ENST00000299252;ENST00000360430;ENST00000517852;ENST00000348801|ENST00000544561	D;D;D;D;D;D;D;D;D;D;D;D;D;D|.	0.97066|.	-4.23;-4.23;-4.23;-4.23;-4.23;-4.23;-4.23;-4.23;-4.23;-4.23;-4.23;-4.23;-4.23;-4.23|.	5.46|5.46	3.61|3.61	0.41365|0.41365	Zinc finger, RING-type (2);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.87951|0.87951	0.6307|0.6307	H|H	0.98295|0.98295	4.195|4.195	0.80722|0.80722	D|D	1|1	D;D;D;D;D;D;D;D;D;D|.	0.89917|.	1.0;1.0;1.0;1.0;1.0;0.999;1.0;1.0;1.0;1.0|.	D;D;D;D;D;D;D;D;D;D|.	0.97110|.	1.0;1.0;1.0;1.0;1.0;0.998;1.0;1.0;0.999;0.999|.	D|D	0.91787|0.91787	0.5440|0.5440	9|5	.|.	.|.	.|.	-27.0149|-27.0149	12.911|12.911	0.58181|0.58181	0.1396:0.0:0.8604:0.0|0.1396:0.0:0.8604:0.0	.|.	419;243;191;216;294;464;415;269;103;470|.	Q00987-9;Q00987-3;Q00987-4;Q9H4C5;Q00987-5;Q00987;G3XA89;Q00987-2;Q9H4C3;Q00987-11|.	.;.;.;.;.;MDM2_HUMAN;.;.;.;.|.	Y|I	470;419;409;294;269;243;191;425;415;191;439;216;294;269;103;238|62	ENSP00000417281:C470Y;ENSP00000258149:C409Y;ENSP00000348637:C294Y;ENSP00000440932:C269Y;ENSP00000410694:C243Y;ENSP00000377064:C191Y;ENSP00000258148:C415Y;ENSP00000377065:C191Y;ENSP00000266624:C439Y;ENSP00000377062:C216Y;ENSP00000299252:C294Y;ENSP00000353611:C269Y;ENSP00000430257:C103Y;ENSP00000335096:C238Y|.	.|.	C|M	+|+	2|3	0|0	MDM2|MDM2	67519811|67519811	1.000000|1.000000	0.71417|0.71417	0.995000|0.995000	0.50966|0.50966	0.156000|0.156000	0.22039|0.22039	7.450000|7.450000	0.80656|0.80656	1.452000|1.452000	0.47756|0.47756	-0.136000|-0.136000	0.14681|0.14681	TGT|ATG	MDM2	-	pirsf_p53_neg-reg_MDM_2/4,pfscan_Znf_RING	ENSG00000135679		0.408	MDM2-033	NOVEL	basic|exp_conf	protein_coding	MDM2	HGNC	protein_coding	OTTHUMT00000402665.1	-	0.00	128	0	G	NM_006880		69233544	+1	tier1	-	no_errors	ENST00000462284	ensembl	human	known	74_37	missense	21.92	57	16	SNP	1.000	A
MFAP3	4238	genome.wustl.edu	37	5	153432766	153432766	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr5:153432766G>T	ENST00000436816.1	+	3	801	c.582G>T	c.(580-582)gaG>gaT	p.E194D	MFAP3_ENST00000439768.2_Missense_Mutation_p.E48D|MFAP3_ENST00000322602.5_Missense_Mutation_p.E194D	NM_001242336.1|NM_005927.4	NP_001229265.1|NP_005918.1	P55082	MFAP3_HUMAN	microfibrillar-associated protein 3	194					extracellular matrix organization (GO:0030198)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|kidney(2)|large_intestine(1)|lung(2)|pancreas(1)	7	Renal(175;0.00488)	Lung NSC(249;0.00145)|all_lung(500;0.00226)|all_neural(177;0.122)|Breast(839;0.14)	Kidney(363;0.000173)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)	OV - Ovarian serous cystadenocarcinoma(192;9.69e-06)|GBM - Glioblastoma multiforme(465;0.0201)		AAGGGGCTGAGAAACTTCAGA	0.458																																																	0													71.0	70.0	70.0					5																	153432766		2203	4299	6502	SO:0001583	missense	0				CCDS4324.1, CCDS47319.1	5q32-q33.2	2013-01-11			ENSG00000037749	ENSG00000037749		"""Immunoglobulin superfamily / I-set domain containing"""	7034	protein-coding gene	gene with protein product		600491				7782085	Standard	NM_005927		Approved		uc010jib.2	P55082	OTTHUMG00000130149	ENST00000436816.1:c.582G>T	5.37:g.153432766G>T	ENSP00000409933:p.Glu194Asp		B2RDK0|B4DKA1|Q9NXA7	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.E194D	ENST00000436816.1	37	c.582	CCDS4324.1	5	.	.	.	.	.	.	.	.	.	.	G	24.4	4.522496	0.85600	.	.	ENSG00000037749	ENST00000439768;ENST00000436816;ENST00000322602	T;T	0.32023	1.47;1.47	5.52	5.52	0.82312	.	0.000000	0.85682	D	0.000000	T	0.56108	0.1963	M	0.65975	2.015	0.53688	D	0.999976	D	0.76494	0.999	D	0.78314	0.991	T	0.50617	-0.8807	9	.	.	.	-17.9673	19.8034	0.96518	0.0:0.0:1.0:0.0	.	194	P55082	MFAP3_HUMAN	D	48;194;194	ENSP00000409933:E194D;ENSP00000322956:E194D	.	E	+	3	2	MFAP3	153412959	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.385000	0.73182	2.760000	0.94817	0.655000	0.94253	GAG	MFAP3	-	NULL	ENSG00000037749		0.458	MFAP3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	MFAP3	HGNC	protein_coding	OTTHUMT00000252457.2	-	0.00	49	0	G	NM_005927		153432766	+1	tier1	-	no_errors	ENST00000322602	ensembl	human	known	74_37	missense	20.00	12	3	SNP	1.000	T
MGP	4256	genome.wustl.edu	37	12	15035090	15035090	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr12:15035090G>A	ENST00000539261.1	-	4	429	c.295C>T	c.(295-297)Cgc>Tgc	p.R99C	C12orf60_ENST00000527783.1_Intron|MGP_ENST00000228938.5_Missense_Mutation_p.R124C	NM_000900.3	NP_000891.2	P08493	MGP_HUMAN	matrix Gla protein	99					cartilage condensation (GO:0001502)|cell differentiation (GO:0030154)|ossification (GO:0001503)|regulation of bone mineralization (GO:0030500)	extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)|structural constituent of bone (GO:0008147)			large_intestine(1)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	7						GTCCCTCGGCGCTTCCTGAAG	0.463																																																	0													123.0	122.0	122.0					12																	15035090		2203	4300	6503	SO:0001583	missense	0			M58549	CCDS8669.1, CCDS53752.1	12p12.3	2006-12-15			ENSG00000111341	ENSG00000111341			7060	protein-coding gene	gene with protein product		154870				2394711	Standard	NM_000900		Approved		uc021qvr.1	P08493	OTTHUMG00000168740	ENST00000539261.1:c.295C>T	12.37:g.15035090G>A	ENSP00000445907:p.Arg99Cys		A0M8W5|B2R519|J3KMX7|Q2TU41|Q567P9|Q6ICN5	Missense_Mutation	SNP	pfam_GLA_domain,superfamily_GLA_domain,smart_GLA_domain,pfscan_GLA_domain,prints_Osteocalcin/MGP	p.R99C	ENST00000539261.1	37	c.295	CCDS8669.1	12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.39|14.39	2.520838|2.520838	0.44866|0.44866	.|.	.|.	ENSG00000111341|ENSG00000111341	ENST00000545199|ENST00000539261;ENST00000228938	.|T;T	.|0.42513	.|0.97;1.03	5.12|5.12	4.23|4.23	0.50019|0.50019	.|Gamma-carboxyglutamic acid-rich (GLA) domain (1);	.|0.191537	.|0.41823	.|N	.|0.000801	T|T	0.50837|0.50837	0.1639|0.1639	M|M	0.66939|0.66939	2.045|2.045	0.53688|0.53688	D|D	0.999971|0.999971	.|D	.|0.89917	.|1.0	.|P	.|0.53146	.|0.719	T|T	0.55897|0.55897	-0.8068|-0.8068	5|10	.|0.87932	.|D	.|0	-7.3604|-7.3604	9.7333|9.7333	0.40374|0.40374	0.0939:0.0:0.9061:0.0|0.0939:0.0:0.9061:0.0	.|.	.|99	.|P08493	.|MGP_HUMAN	V|C	53|99;124	.|ENSP00000445907:R99C;ENSP00000228938:R124C	.|ENSP00000228938:R124C	A|R	-|-	2|1	0|0	MGP|MGP	14926357|14926357	1.000000|1.000000	0.71417|0.71417	0.979000|0.979000	0.43373|0.43373	0.035000|0.035000	0.12851|0.12851	2.408000|2.408000	0.44574|0.44574	1.528000|1.528000	0.49103|0.49103	-0.145000|-0.145000	0.13849|0.13849	GCG|CGC	MGP	-	superfamily_GLA_domain	ENSG00000111341		0.463	MGP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MGP	HGNC	protein_coding	OTTHUMT00000400864.1	-	0.00	66	0	G	NM_000900		15035090	-1	tier1	-	no_errors	ENST00000539261	ensembl	human	known	74_37	missense	18.00	41	9	SNP	0.977	A
PPP3CA	5530	genome.wustl.edu	37	4	102251465	102251465	+	Intron	SNP	G	G	C			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr4:102251465G>C	ENST00000394854.3	-	1	742				MIR1255A_ENST00000408338.1_RNA|PPP3CA_ENST00000512215.1_Intron|PPP3CA_ENST00000523694.2_Intron|PPP3CA_ENST00000323055.6_Intron|PPP3CA_ENST00000394853.4_Intron|PPP3CA_ENST00000507176.1_Intron	NM_000944.4	NP_000935.1	Q08209	PP2BA_HUMAN	protein phosphatase 3, catalytic subunit, alpha isozyme						calcineurin-NFAT signaling cascade (GO:0033173)|calcium ion transport (GO:0006816)|cellular response to drug (GO:0035690)|cellular response to glucose stimulus (GO:0071333)|dephosphorylation (GO:0016311)|Fc-epsilon receptor signaling pathway (GO:0038095)|G1/S transition of mitotic cell cycle (GO:0000082)|innate immune response (GO:0045087)|multicellular organismal response to stress (GO:0033555)|negative regulation of insulin secretion (GO:0046676)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein dephosphorylation (GO:0006470)|protein import into nucleus (GO:0006606)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of synaptic transmission (GO:0050804)|response to amphetamine (GO:0001975)|response to calcium ion (GO:0051592)|skeletal muscle fiber development (GO:0048741)|T cell activation (GO:0042110)|transition between fast and slow fiber (GO:0014883)	calcineurin complex (GO:0005955)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|calmodulin-dependent protein phosphatase activity (GO:0033192)|drug binding (GO:0008144)|enzyme binding (GO:0019899)|protein dimerization activity (GO:0046983)|protein serine/threonine phosphatase activity (GO:0004722)			breast(1)|cervix(1)|endometrium(3)|large_intestine(4)|lung(8)|ovary(1)|skin(1)|urinary_tract(1)	20				OV - Ovarian serous cystadenocarcinoma(123;6.79e-08)		aattttaatggataaggagtt	0.338																																																	0													16.0	18.0	17.0					4																	102251465		1542	3526	5068	SO:0001627	intron_variant	0				CCDS34037.1, CCDS47113.1, CCDS47114.1	4q24	2010-03-17	2010-03-05		ENSG00000138814	ENSG00000138814	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase, catalytic subunits"""	9314	protein-coding gene	gene with protein product	"""calcineurin A alpha"", ""protein phosphatase 2B, catalytic subunit, alpha isoform"""	114105	"""protein phosphatase 3 (formerly 2B), catalytic subunit, alpha isoform (calcineurin A alpha)"", ""protein phosphatase 3 (formerly 2B), catalytic subunit, alpha isoform"""	CALN, CALNA		2848250, 1659808	Standard	NM_000944		Approved	CNA1, PPP2B	uc011cen.1	Q08209	OTTHUMG00000133839	ENST00000394854.3:c.58+16430C>G	4.37:g.102251465G>C			A1A441|A8K3B7|A8W6Z7|A8W6Z8|B5BUA2|Q8TAW9	RNA	SNP	-	NULL	ENST00000394854.3	37	NULL	CCDS34037.1	4																																																																																			MIR1255A	-	-	ENSG00000221265		0.338	PPP3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	MIR1255A	HGNC	protein_coding	OTTHUMT00000258379.2	-	0.00	137	0	G	NM_000944		102251465	-1	tier1	-	no_errors	ENST00000408338	ensembl	human	known	74_37	rna	20.55	58	15	SNP	0.000	C
GRID1	2894	genome.wustl.edu	37	10	88024517	88024517	+	Intron	SNP	C	C	A			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr10:88024517C>A	ENST00000327946.7	-	3	321				MIR346_ENST00000362234.2_RNA	NM_017551.2	NP_060021.1	Q9ULK0	GRID1_HUMAN	glutamate receptor, ionotropic, delta 1						ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|social behavior (GO:0035176)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|ionotropic glutamate receptor complex (GO:0008328)|postsynaptic membrane (GO:0045211)	extracellular-glutamate-gated ion channel activity (GO:0005234)|ionotropic glutamate receptor activity (GO:0004970)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(24)|lung(46)|ovary(5)|prostate(4)|skin(5)|stomach(4)|upper_aerodigestive_tract(5)	106						GGCAGGCATGCGGGCAGACAG	0.647										Multiple Myeloma(13;0.14)																																							0													23.0	35.0	31.0					10																	88024517		1551	3550	5101	SO:0001627	intron_variant	0			AB033046	CCDS31236.1	10q22	2012-08-29			ENSG00000182771	ENSG00000182771		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4575	protein-coding gene	gene with protein product		610659					Standard	NM_017551		Approved	GluD1, KIAA1220	uc001kdl.1	Q9ULK0	OTTHUMG00000018650	ENST00000327946.7:c.236-58112G>T	10.37:g.88024517C>A			B3KXD5|B7Z7L0|Q8IXT3	RNA	SNP	-	NULL	ENST00000327946.7	37	NULL	CCDS31236.1	10																																																																																			MIR346	-	-	ENSG00000199104		0.647	GRID1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	MIR346	HGNC	protein_coding	OTTHUMT00000049148.3	-	0.00	47	0	C	XM_043613		88024517	-1	tier1	-	no_errors	ENST00000362234	ensembl	human	known	74_37	rna	22.22	14	4	SNP	0.998	A
MIR506	574511	genome.wustl.edu	37	X	146312548	146312548	+	RNA	SNP	C	C	G			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chrX:146312548C>G	ENST00000384998.1	-	0	0				MIR507_ENST00000385234.1_RNA	NR_030233.1				microRNA 506																		AAACATATTTCTAGACACATG	0.438																																																	0													228.0	185.0	198.0					X																	146312548		1568	3582	5150			0					Xq27.3	2011-09-12		2008-12-18	ENSG00000207731	ENSG00000207731		"""ncRNAs / Micro RNAs"""	32143	non-coding RNA	RNA, micro		300877		MIRN506			Standard	NR_030233		Approved	hsa-mir-506	uc022cfu.1				X.37:g.146312548C>G				RNA	SNP	-	NULL	ENST00000384998.1	37	NULL		X																																																																																			MIR507	-	-	ENSG00000207969		0.438	MIR506-201	KNOWN	basic	miRNA	MIR507	HGNC	miRNA		-	0.00	38	0	C	NR_030233		146312548	-1	tier1	-	no_errors	ENST00000385234	ensembl	human	known	74_37	rna	29.17	17	7	SNP	0.000	G
MIR518F	574472	genome.wustl.edu	37	19	54203326	54203326	+	RNA	SNP	C	C	A	rs557837040		TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr19:54203326C>A	ENST00000384973.1	+	0	58				MIR523_ENST00000385281.1_RNA|MIR525_ENST00000384978.1_RNA|MIR520B_ENST00000384989.1_RNA|MIR518B_ENST00000385127.1_RNA	NR_030194.1				microRNA 518f																		GAAAAGAAAGCGCTTCTCTTT	0.388																																																	0													89.0	88.0	88.0					19																	54203326		1568	3582	5150			0					19q13.42	2011-09-12		2008-12-18	ENSG00000207706	ENSG00000207706		"""ncRNAs / Micro RNAs"""	32104	non-coding RNA	RNA, micro				MIRN518F			Standard	NR_030194		Approved	hsa-mir-518f	uc021uzx.1				19.37:g.54203326C>A				RNA	SNP	-	NULL	ENST00000384973.1	37	NULL		19																																																																																			MIR518F	-	-	ENSG00000207706		0.388	MIR518F-201	KNOWN	basic	miRNA	MIR518F	HGNC	miRNA		-	0.00	155	0	C	NR_030194		54203326	+1	tier1	-	no_errors	ENST00000384973	ensembl	human	known	74_37	rna	16.83	84	17	SNP	0.002	A
LIN7A	8825	genome.wustl.edu	37	12	81226363	81226363	+	Intron	SNP	T	T	C			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr12:81226363T>C	ENST00000552864.1	-	4	686				MIR617_ENST00000385030.1_RNA	NM_004664.2	NP_004655.1	O14910	LIN7A_HUMAN	lin-7 homolog A (C. elegans)						exocytosis (GO:0006887)|inner ear development (GO:0048839)|neurotransmitter secretion (GO:0007269)|protein complex assembly (GO:0006461)|protein transport (GO:0015031)|synaptic vesicle transport (GO:0048489)	basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|neuron projection (GO:0043005)|postsynaptic membrane (GO:0045211)|tight junction (GO:0005923)	L27 domain binding (GO:0097016)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|ovary(2)|skin(2)	15						TTGAAGGTGGTAGGAAATGGC	0.443																																																	0													47.0	42.0	44.0					12																	81226363		1563	3560	5123	SO:0001627	intron_variant	0			AF028826	CCDS9021.1	12q21.31	2014-09-04			ENSG00000111052	ENSG00000111052			17787	protein-coding gene	gene with protein product	"""mammalian LIN-7 1"""	603380				10341223, 17237226	Standard	NM_004664		Approved	MALS-1, TIP-33, LIN-7A, VELI1	uc001szj.1	O14910	OTTHUMG00000170168	ENST00000552864.1:c.483+13145A>G	12.37:g.81226363T>C			A4FTY3|Q147W1|Q6LES3|Q7LDS4	RNA	SNP	-	NULL	ENST00000552864.1	37	NULL	CCDS9021.1	12																																																																																			MIR617	-	-	ENSG00000207763		0.443	LIN7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MIR617	HGNC	protein_coding	OTTHUMT00000407760.1	-	0.00	23	0	T			81226363	-1	tier1	-	no_errors	ENST00000385030	ensembl	human	known	74_37	rna	35.29	11	6	SNP	0.166	C
MPPED2	744	genome.wustl.edu	37	11	30516943	30516943	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr11:30516943G>T	ENST00000358117.5	-	3	558	c.436C>A	c.(436-438)Cca>Aca	p.P146T	MPPED2_ENST00000448418.2_Missense_Mutation_p.P146T	NM_001584.2	NP_001575.1	Q15777	MPPD2_HUMAN	metallophosphoesterase domain containing 2	146					nervous system development (GO:0007399)		hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)	p.P146T(1)		NS(1)|breast(2)|endometrium(4)|kidney(2)|large_intestine(4)|liver(1)|lung(15)|skin(2)|upper_aerodigestive_tract(2)	33						AAGTCCTCTGGTTTCAATTTG	0.428																																																	1	Substitution - Missense(1)	large_intestine(1)											150.0	140.0	143.0					11																	30516943		2202	4299	6501	SO:0001583	missense	0			U57911	CCDS7870.1, CCDS44560.1	11p13	2008-07-18	2005-10-10	2005-10-10	ENSG00000066382	ENSG00000066382			1180	protein-coding gene	gene with protein product		600911	"""chromosome 11 open reading frame 8"""	C11orf8		8666403, 9266672	Standard	NM_001584		Approved	239FB, D11S302E, Hs.46638, FAM1B, dJ873F21.1, dJ1024C24.1	uc001msr.3	Q15777	OTTHUMG00000166159	ENST00000358117.5:c.436C>A	11.37:g.30516943G>T	ENSP00000350833:p.Pro146Thr		D3DQZ5|E9PB10|Q59GE6	Missense_Mutation	SNP	pfam_PEstase_dom	p.P146T	ENST00000358117.5	37	c.436	CCDS7870.1	11	.	.	.	.	.	.	.	.	.	.	G	16.53	3.148210	0.57151	.	.	ENSG00000066382	ENST00000448418;ENST00000358117	D;D	0.85411	-1.98;-1.98	5.7	5.7	0.88788	Metallophosphoesterase domain (1);	0.000000	0.85682	D	0.000000	T	0.80071	0.4556	N	0.20574	0.59	0.80722	D	1	B;P	0.36222	0.034;0.544	B;B	0.42738	0.111;0.396	T	0.75028	-0.3462	10	0.09843	T	0.71	-6.3859	19.8478	0.96722	0.0:0.0:1.0:0.0	.	146;146	Q15777;E9PB10	MPPD2_HUMAN;.	T	146	ENSP00000388258:P146T;ENSP00000350833:P146T	ENSP00000350833:P146T	P	-	1	0	MPPED2	30473519	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.869000	0.99810	2.698000	0.92095	0.655000	0.94253	CCA	MPPED2	-	pfam_PEstase_dom	ENSG00000066382		0.428	MPPED2-005	KNOWN	basic|appris_principal|CCDS	protein_coding	MPPED2	HGNC	protein_coding	OTTHUMT00000388155.2		0.00	112	0	G	NM_001584		30516943	-1			no_errors	ENST00000358117	ensembl	human	known	74_37	missense	5.17	55	3	SNP	1.000	T
MRPS34	65993	genome.wustl.edu	37	16	1822500	1822500	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr16:1822500C>G	ENST00000397375.2	-	3	414	c.379G>C	c.(379-381)Gag>Cag	p.E127Q	MRPS34_ENST00000177742.3_Missense_Mutation_p.E134Q|EME2_ENST00000568449.1_5'Flank|NME3_ENST00000563498.1_5'Flank|EME2_ENST00000307394.7_5'Flank|NME3_ENST00000219302.3_5'Flank	NM_023936.1	NP_076425.1	P82930	RT34_HUMAN	mitochondrial ribosomal protein S34	127						mitochondrion (GO:0005739)|ribosome (GO:0005840)				breast(1)|skin(2)	3						TCCCGCGCCTCGCTCTCAGTC	0.647																																																	0													72.0	77.0	75.0					16																	1822500		2198	4300	6498	SO:0001583	missense	0			BC001182	CCDS10444.1, CCDS73805.1	16p13.3	2012-09-13			ENSG00000074071	ENSG00000074071		"""Mitochondrial ribosomal proteins / small subunits"""	16618	protein-coding gene	gene with protein product		611994					Standard	NM_023936		Approved	MRP-S12, MGC2616	uc002cmo.3	P82930	OTTHUMG00000128636	ENST00000397375.2:c.379G>C	16.37:g.1822500C>G	ENSP00000380531:p.Glu127Gln		Q9BVI7	Missense_Mutation	SNP	NULL	p.E127Q	ENST00000397375.2	37	c.379	CCDS10444.1	16	.	.	.	.	.	.	.	.	.	.	C	12.13	1.845956	0.32606	.	.	ENSG00000074071	ENST00000397375;ENST00000177742	T;T	0.55760	0.5;0.5	4.02	1.89	0.25635	.	0.234663	0.42420	D	0.000712	T	0.37320	0.0999	L	0.33189	0.99	0.51767	D	0.999932	B;B	0.21753	0.06;0.024	B;B	0.21708	0.036;0.019	T	0.15780	-1.0425	10	0.34782	T	0.22	-1.7028	8.5187	0.33262	0.0:0.7228:0.1711:0.1061	.	134;127	C9JJ19;P82930	.;RT34_HUMAN	Q	127;134	ENSP00000380531:E127Q;ENSP00000177742:E134Q	ENSP00000177742:E134Q	E	-	1	0	MRPS34	1762501	0.025000	0.19082	0.344000	0.25628	0.243000	0.25628	0.315000	0.19451	0.873000	0.35799	0.561000	0.74099	GAG	MRPS34	-	NULL	ENSG00000074071		0.647	MRPS34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRPS34	HGNC	protein_coding	OTTHUMT00000250506.1	-	0.00	38	0	C	NM_023936		1822500	-1	tier1	-	no_errors	ENST00000397375	ensembl	human	known	74_37	missense	26.47	25	9	SNP	0.385	G
MTHFD1L	25902	genome.wustl.edu	37	6	151293122	151293122	+	Missense_Mutation	SNP	A	A	G			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr6:151293122A>G	ENST00000367321.3	+	20	2327	c.2053A>G	c.(2053-2055)Att>Gtt	p.I685V	MTHFD1L_ENST00000478643.1_3'UTR	NM_001242767.1|NM_001242768.1|NM_015440.4	NP_001229696.1|NP_001229697.1|NP_056255.2	Q6UB35	C1TM_HUMAN	methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1-like	685	Formyltetrahydrofolate synthetase.				folic acid-containing compound biosynthetic process (GO:0009396)|folic acid-containing compound metabolic process (GO:0006760)|formate metabolic process (GO:0015942)|one-carbon metabolic process (GO:0006730)|oxidation-reduction process (GO:0055114)|tetrahydrofolate interconversion (GO:0035999)|tetrahydrofolate metabolic process (GO:0046653)	membrane (GO:0016020)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|formate-tetrahydrofolate ligase activity (GO:0004329)|protein homodimerization activity (GO:0042803)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(12)|lung(8)|ovary(3)|prostate(1)|upper_aerodigestive_tract(2)	29		Ovarian(120;0.128)		OV - Ovarian serous cystadenocarcinoma(155;8.7e-12)		TTTTGCTAACATTGCTCACGG	0.408																																																	0													135.0	125.0	129.0					6																	151293122		2203	4300	6503	SO:0001583	missense	0			BC017477	CCDS5228.1, CCDS56457.1, CCDS75535.1, CCDS75536.1	6q25.1	2010-07-19	2004-12-13	2004-12-14	ENSG00000120254	ENSG00000120254	6.3.4.3		21055	protein-coding gene	gene with protein product	"""10-formyl-THF synthetase"", ""mitochondrial C1-tetrahydrofolate synthase"", ""monofunctional C1-tetrahydrofolate synthase, mitochondrial"""	611427	"""formyltetrahydrofolate synthetase domain containing 1"""	FTHFSDC1		18804703	Standard	NM_015440		Approved	DKFZP586G1517, FLJ21145	uc021zgs.1	Q6UB35	OTTHUMG00000015828	ENST00000367321.3:c.2053A>G	6.37:g.151293122A>G	ENSP00000356290:p.Ile685Val		Q2TBF3|Q8WVW0|Q96HG8|Q9H789|Q9UFU8	Missense_Mutation	SNP	pfam_Formate_THF_ligase,pfam_THF_DH/CycHdrlase_NAD-bd_dom,pfam_THF_DH/CycHdrlase_cat_dom,superfamily_P-loop_NTPase,prints_THF_DH/CycHdrlase	p.I685V	ENST00000367321.3	37	c.2053	CCDS5228.1	6	.	.	.	.	.	.	.	.	.	.	A	22.6	4.307657	0.81247	.	.	ENSG00000120254	ENST00000367321	T	0.35789	1.29	5.95	5.95	0.96441	.	0.000000	0.85682	D	0.000000	T	0.65471	0.2694	H	0.94503	3.545	0.80722	D	1	D;D;D	0.89917	0.999;1.0;0.998	D;D;D	0.91635	0.997;0.999;0.996	T	0.75986	-0.3124	10	0.62326	D	0.03	.	15.4063	0.74881	1.0:0.0:0.0:0.0	.	686;440;685	B7ZM99;B2RD24;Q6UB35	.;.;C1TM_HUMAN	V	685	ENSP00000356290:I685V	ENSP00000356290:I685V	I	+	1	0	MTHFD1L	151334815	1.000000	0.71417	0.950000	0.38849	0.727000	0.41649	8.904000	0.92590	2.279000	0.76181	0.533000	0.62120	ATT	MTHFD1L	-	pfam_Formate_THF_ligase,superfamily_P-loop_NTPase	ENSG00000120254		0.408	MTHFD1L-003	KNOWN	basic|appris_principal|CCDS	protein_coding	MTHFD1L	HGNC	protein_coding	OTTHUMT00000042699.1	-	0.00	109	0	A	NM_015440		151293122	+1	tier1	-	no_errors	ENST00000367321	ensembl	human	known	74_37	missense	21.05	30	8	SNP	1.000	G
MYH15	22989	genome.wustl.edu	37	3	108189003	108189003	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr3:108189003G>T	ENST00000273353.3	-	15	1556	c.1500C>A	c.(1498-1500)ttC>ttA	p.F500L		NM_014981.1	NP_055796.1	Q9Y2K3	MYH15_HUMAN	myosin, heavy chain 15	500	Myosin motor.					cytoplasm (GO:0005737)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(1)|breast(3)|central_nervous_system(2)|cervix(4)|endometrium(10)|kidney(4)|large_intestine(14)|lung(47)|ovary(5)|pancreas(2)|prostate(6)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	105						GCCAATTGAAGAATTGTTGTA	0.328																																																	0													103.0	94.0	97.0					3																	108189003		1810	4088	5898	SO:0001583	missense	0			AB023217	CCDS43127.1	3q13	2011-09-27	2006-09-29		ENSG00000144821	ENSG00000144821		"""Myosins / Myosin superfamily : Class II"""	31073	protein-coding gene	gene with protein product		609929	"""myosin, heavy polypeptide 15"""			15014174, 15042088	Standard	NM_014981		Approved	KIAA1000	uc003dxa.1	Q9Y2K3	OTTHUMG00000159226	ENST00000273353.3:c.1500C>A	3.37:g.108189003G>T	ENSP00000273353:p.Phe500Leu			Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_Myosin_tail,pfam_Myosin_N,superfamily_P-loop_NTPase,superfamily_Prefoldin,superfamily_Lambda_DNA-bd_dom,smart_Myosin_head_motor_dom,prints_Myosin_head_motor_dom	p.F500L	ENST00000273353.3	37	c.1500	CCDS43127.1	3	.	.	.	.	.	.	.	.	.	.	G	8.306	0.821062	0.16678	.	.	ENSG00000144821	ENST00000273353	T	0.71461	-0.57	6.16	0.173	0.15036	Myosin head, motor domain (2);	.	.	.	.	T	0.58680	0.2139	L	0.52011	1.625	0.42581	D	0.993215	B	0.19200	0.034	B	0.28139	0.086	T	0.52953	-0.8506	9	0.72032	D	0.01	.	0.6353	0.00801	0.3562:0.1201:0.2786:0.245	.	500	Q9Y2K3	MYH15_HUMAN	L	500	ENSP00000273353:F500L	ENSP00000273353:F500L	F	-	3	2	MYH15	109671693	1.000000	0.71417	0.050000	0.19076	0.069000	0.16628	0.817000	0.27281	-0.250000	0.09555	-0.142000	0.14014	TTC	MYH15	-	pfam_Myosin_head_motor_dom,superfamily_P-loop_NTPase,smart_Myosin_head_motor_dom	ENSG00000144821		0.328	MYH15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH15	HGNC	protein_coding	OTTHUMT00000353935.1	-	0.00	107	0	G	XM_036988		108189003	-1	tier1	-	no_errors	ENST00000273353	ensembl	human	known	74_37	missense	7.84	46	4	SNP	0.967	T
MYH8	4626	genome.wustl.edu	37	17	10301805	10301805	+	Nonsense_Mutation	SNP	G	G	T	rs200411635	byFrequency	TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr17:10301805G>T	ENST00000403437.2	-	30	4228	c.4134C>A	c.(4132-4134)taC>taA	p.Y1378*	CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA|RP11-799N11.1_ENST00000399342.2_RNA	NM_002472.2	NP_002463.2	P13535	MYH8_HUMAN	myosin, heavy chain 8, skeletal muscle, perinatal	1378				KY -> NT (in Ref. 3; CAA35941). {ECO:0000305}.	ATP catabolic process (GO:0006200)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|skeletal muscle contraction (GO:0003009)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|myosin light chain binding (GO:0032027)|structural constituent of muscle (GO:0008307)			NS(3)|breast(8)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(61)|ovary(3)|prostate(3)|skin(10)|upper_aerodigestive_tract(2)|urinary_tract(2)	134						CATCCGTCTCGTATTTGGTTC	0.542									Trismus-Pseudocamptodactyly Syndrome with Cardiac Myxoma and Freckling																																								0													207.0	191.0	196.0					17																	10301805		2203	4300	6503	SO:0001587	stop_gained	0	Familial Cancer Database	Carney Complex Variant		CCDS11153.1	17p13.1	2013-09-19	2006-09-29		ENSG00000133020	ENSG00000133020		"""Myosins / Myosin superfamily : Class II"""	7578	protein-coding gene	gene with protein product		160741	"""myosin, heavy polypeptide 8, skeletal muscle, perinatal"""			2373371	Standard	NM_002472		Approved	MyHC-peri, MyHC-pn	uc002gmm.2	P13535	OTTHUMG00000130361	ENST00000403437.2:c.4134C>A	17.37:g.10301805G>T	ENSP00000384330:p.Tyr1378*		Q14910	Nonsense_Mutation	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_P-loop_NTPase,superfamily_Prefoldin,superfamily_t-SNARE,smart_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.Y1378*	ENST00000403437.2	37	c.4134	CCDS11153.1	17	.	.	.	.	.	.	.	.	.	.	G	39	7.844853	0.98522	.	.	ENSG00000133020	ENST00000252173;ENST00000403437	.	.	.	5.21	-8.71	0.00848	.	0.000000	0.38005	U	0.001847	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	20.1235	0.97970	0.8246:0.0:0.1754:0.0	.	.	.	.	X	1378	.	ENSP00000252173:Y1378X	Y	-	3	2	MYH8	10242530	0.000000	0.05858	0.701000	0.30321	0.682000	0.39822	-2.344000	0.01098	-1.594000	0.01615	-0.794000	0.03295	TAC	MYH8	-	pfam_Myosin_tail,superfamily_Prefoldin	ENSG00000133020		0.542	MYH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH8	HGNC	protein_coding	OTTHUMT00000252724.2		0.00	76	0	G	NM_002472		10301805	-1			no_errors	ENST00000403437	ensembl	human	known	74_37	nonsense	5.26	36	2	SNP	0.807	T
N4BP2L1	90634	genome.wustl.edu	37	13	32978401	32978401	+	Intron	SNP	T	T	A			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr13:32978401T>A	ENST00000380133.2	-	4	524				N4BP2L1_ENST00000459716.1_Intron|N4BP2L1_ENST00000380130.2_Intron|N4BP2L1_ENST00000380139.4_Missense_Mutation_p.Q135L|N4BP2L1_ENST00000530622.2_Intron			Q5TBK1	N42L1_HUMAN	NEDD4 binding protein 2-like 1											large_intestine(1)|lung(2)|ovary(1)|skin(1)	5		Lung SC(185;0.0262)		all cancers(112;6.3e-06)|Epithelial(112;3.51e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00607)|BRCA - Breast invasive adenocarcinoma(63;0.0171)		TTGTTCGGTCTGAAATACCTG	0.363																																																	0													91.0	87.0	89.0					13																	32978401		2203	4300	6503	SO:0001627	intron_variant	0			U50527	CCDS9345.2, CCDS41877.1	13q13.1	2008-11-05			ENSG00000139597	ENSG00000139597			25037	protein-coding gene	gene with protein product	"""hypothetical gene CG018"""					8812419	Standard	NM_052818		Approved	CG018	uc001uuc.3	Q5TBK1	OTTHUMG00000016697	ENST00000380133.2:c.473+56A>T	13.37:g.32978401T>A			A4QN21|Q5TBK0	Missense_Mutation	SNP	pfam_Zeta_toxin_domain,superfamily_P-loop_NTPase	p.Q135L	ENST00000380133.2	37	c.404	CCDS9345.2	13	.	.	.	.	.	.	.	.	.	.	T	16.32	3.088894	0.55968	.	.	ENSG00000139597	ENST00000380139	.	.	.	5.74	5.74	0.90152	.	.	.	.	.	T	0.52092	0.1713	.	.	.	0.80722	D	1	P	0.35139	0.486	B	0.36922	0.236	T	0.56007	-0.8050	7	0.56958	D	0.05	.	11.2124	0.48806	0.0:0.0:0.1528:0.8472	.	135	Q5TBK1-2	.	L	135	.	ENSP00000369484:Q135L	Q	-	2	0	N4BP2L1	31876401	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.496000	0.53288	2.193000	0.70182	0.533000	0.62120	CAG	N4BP2L1	-	NULL	ENSG00000139597		0.363	N4BP2L1-002	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	N4BP2L1	HGNC	protein_coding	OTTHUMT00000044412.2	-	0.00	101	0	T	NM_052818		32978401	-1	tier1	-	no_errors	ENST00000380139	ensembl	human	novel	74_37	missense	64.71	18	33	SNP	0.998	A
NAV3	89795	genome.wustl.edu	37	12	78574660	78574660	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr12:78574660G>C	ENST00000397909.2	+	30	5700	c.5527G>C	c.(5527-5529)Gaa>Caa	p.E1843Q	NAV3_ENST00000536525.2_Missense_Mutation_p.E1821Q|NAV3_ENST00000266692.7_Missense_Mutation_p.E1644Q|NAV3_ENST00000552300.1_3'UTR|NAV3_ENST00000228327.6_Missense_Mutation_p.E1821Q			Q8IVL0	NAV3_HUMAN	neuron navigator 3	1843						membrane (GO:0016020)|nuclear envelope (GO:0005635)				NS(2)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(13)|kidney(16)|large_intestine(39)|liver(2)|lung(126)|ovary(5)|pancreas(3)|prostate(6)|skin(5)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(1)	236						GAATGAAATTGAAATACTGAA	0.393										HNSCC(70;0.22)																																							0													46.0	45.0	46.0					12																	78574660		1866	4087	5953	SO:0001583	missense	0			AB023155	CCDS41815.1, CCDS66432.1	12q14.3	2008-08-05				ENSG00000067798			15998	protein-coding gene	gene with protein product	"""pore membrane and/or filament interacting like protein 1"", ""steerin 3"""	611629				12079279, 12062803	Standard	XM_005269215		Approved	KIAA0938, POMFIL1	uc001syo.3	Q8IVL0	OTTHUMG00000170001	ENST00000397909.2:c.5527G>C	12.37:g.78574660G>C	ENSP00000381007:p.Glu1843Gln		Q8NFW7|Q9Y2E7	Missense_Mutation	SNP	pfam_CH-domain,pfam_ATPase_AAA_core,superfamily_CH-domain,superfamily_P-loop_NTPase,smart_CH-domain,smart_AAA+_ATPase,pfscan_CH-domain	p.E1843Q	ENST00000397909.2	37	c.5527		12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	28.2|28.2	4.902239|4.902239	0.92035|0.92035	.|.	.|.	ENSG00000067798|ENSG00000067798	ENST00000536525;ENST00000397909;ENST00000228327;ENST00000266692;ENST00000378640;ENST00000550788|ENST00000552895	T;T;T;T;T|.	0.29655|.	1.61;1.59;1.6;1.56;2.42|.	6.02|6.02	6.02|6.02	0.97574|0.97574	.|.	0.000000|.	0.40818|.	U|.	0.001009|.	T|.	0.77356|.	0.4118|.	M|M	0.72118|0.72118	2.19|2.19	0.80722|0.80722	D|D	1|1	D;D;D;D|.	0.89917|.	1.0;0.996;1.0;0.998|.	D;D;D;D|.	0.85130|.	0.98;0.991;0.997;0.994|.	T|.	0.74250|.	-0.3726|.	10|.	0.62326|.	D|.	0.03|.	-25.6707|-25.6707	20.547|20.547	0.99278|0.99278	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	1821;1644;1843;1821|.	E7EUC6;Q8IVL0-3;Q8IVL0;Q8IVL0-2|.	.;.;NAV3_HUMAN;.|.	Q|S	1821;1843;1821;1644;435;443|715	ENSP00000446132:E1821Q;ENSP00000381007:E1843Q;ENSP00000228327:E1821Q;ENSP00000266692:E1644Q;ENSP00000448303:E443Q|.	ENSP00000228327:E1821Q|.	E|X	+|+	1|2	0|2	NAV3|NAV3	77098791|77098791	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.988000|0.988000	0.76386|0.76386	9.476000|9.476000	0.97823|0.97823	2.850000|2.850000	0.98022|0.98022	0.650000|0.650000	0.86243|0.86243	GAA|TGA	NAV3	-	NULL	ENSG00000067798		0.393	NAV3-001	KNOWN	basic	protein_coding	NAV3	HGNC	protein_coding	OTTHUMT00000406812.1	-	0.00	54	0	G	NM_001024383		78574660	+1	tier1	-	no_errors	ENST00000397909	ensembl	human	known	74_37	missense	14.63	35	6	SNP	1.000	C
NCOA6	23054	genome.wustl.edu	37	20	33329257	33329257	+	Silent	SNP	G	G	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr20:33329257G>T	ENST00000374796.2	-	12	7373	c.4803C>A	c.(4801-4803)gtC>gtA	p.V1601V	NCOA6_ENST00000359003.2_Silent_p.V1601V			Q14686	NCOA6_HUMAN	nuclear receptor coactivator 6	1601					brain development (GO:0007420)|cellular lipid metabolic process (GO:0044255)|cellular response to DNA damage stimulus (GO:0006974)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA-templated transcription, initiation (GO:0006352)|glucocorticoid receptor signaling pathway (GO:0042921)|heart development (GO:0007507)|intracellular estrogen receptor signaling pathway (GO:0030520)|labyrinthine layer blood vessel development (GO:0060716)|myeloid cell differentiation (GO:0030099)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|response to hormone (GO:0009725)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)	histone methyltransferase complex (GO:0035097)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|retinoid X receptor binding (GO:0046965)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)			NS(2)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(9)|kidney(8)|large_intestine(16)|lung(37)|ovary(4)|prostate(5)|skin(13)|upper_aerodigestive_tract(2)|urinary_tract(1)	107						GATTGGAAGTGACAAATACAG	0.463																																																	0													116.0	106.0	109.0					20																	33329257		2203	4300	6503	SO:0001819	synonymous_variant	0			AF128458	CCDS13241.1, CCDS74720.1	20q11	2008-08-01			ENSG00000198646	ENSG00000198646			15936	protein-coding gene	gene with protein product	"""nuclear receptor coactivator RAP250"", ""activating signal cointegrator-2"", ""peroxisome proliferator-activated receptor interacting protein"""	605299				8724849, 8263591	Standard	NM_014071		Approved	KIAA0181, RAP250, ASC2, AIB3, PRIP, TRBP, NRC	uc002xaw.3	Q14686	OTTHUMG00000032311	ENST00000374796.2:c.4803C>A	20.37:g.33329257G>T			A6NLF1|B2RMN5|E1P5P7|Q9NTZ9|Q9UH74|Q9UK86	Silent	SNP	NULL	p.V1601	ENST00000374796.2	37	c.4803	CCDS13241.1	20																																																																																			NCOA6	-	NULL	ENSG00000198646		0.463	NCOA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCOA6	HGNC	protein_coding	OTTHUMT00000078811.2	-	0.00	79	0	G	NM_014071		33329257	-1	tier1	-	no_errors	ENST00000359003	ensembl	human	known	74_37	silent	6.25	60	4	SNP	0.498	T
NDST1	3340	genome.wustl.edu	37	5	149929312	149929312	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr5:149929312G>T	ENST00000261797.6	+	13	2891	c.2389G>T	c.(2389-2391)Ggg>Tgg	p.G797W	NDST1_ENST00000523767.1_Missense_Mutation_p.G740W	NM_001543.4	NP_001534.1	P52848	NDST1_HUMAN	N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 1	797	Heparan sulfate N-sulfotransferase 1.				carbohydrate metabolic process (GO:0005975)|embryonic neurocranium morphogenesis (GO:0048702)|embryonic viscerocranium morphogenesis (GO:0048703)|fibroblast growth factor receptor signaling pathway (GO:0008543)|forebrain development (GO:0030900)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparin biosynthetic process (GO:0030210)|inflammatory response (GO:0006954)|MAPK cascade (GO:0000165)|midbrain development (GO:0030901)|polysaccharide biosynthetic process (GO:0000271)|respiratory gaseous exchange (GO:0007585)|small molecule metabolic process (GO:0044281)|smoothened signaling pathway (GO:0007224)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine N-sulfotransferase activity (GO:0015016)|deacetylase activity (GO:0019213)			breast(2)|central_nervous_system(3)|endometrium(5)|kidney(1)|large_intestine(6)|lung(10)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)	34		all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			GAAGTTCCTTGGGGTGACCAA	0.512																																																	0													134.0	108.0	117.0					5																	149929312		2203	4300	6503	SO:0001583	missense	0			U18918	CCDS34277.1, CCDS75358.1	5q33.1	2008-02-05				ENSG00000070614		"""Sulfotransferases, membrane-bound"""	7680	protein-coding gene	gene with protein product		600853		HSST		7601448, 9230113	Standard	NM_001543		Approved	NST1	uc003lsk.4	P52848		ENST00000261797.6:c.2389G>T	5.37:g.149929312G>T	ENSP00000261797:p.Gly797Trp		Q96E57	Missense_Mutation	SNP	pfam_Heparan_SO4_deacetylase,pfam_Sulfotransferase_dom,superfamily_P-loop_NTPase	p.G797W	ENST00000261797.6	37	c.2389	CCDS34277.1	5	.	.	.	.	.	.	.	.	.	.	G	21.1	4.097134	0.76870	.	.	ENSG00000070614	ENST00000523767;ENST00000261797	T;D	0.90004	-0.32;-2.6	5.01	5.01	0.66863	Sulfotransferase domain (1);	0.144833	0.64402	D	0.000007	D	0.96241	0.8774	H	0.94306	3.52	0.50039	D	0.999849	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.97346	0.9960	10	0.87932	D	0	.	18.6686	0.91501	0.0:0.0:1.0:0.0	.	740;797	E7EVJ3;P52848	.;NDST1_HUMAN	W	740;797	ENSP00000428604:G740W;ENSP00000261797:G797W	ENSP00000261797:G797W	G	+	1	0	NDST1	149909505	1.000000	0.71417	0.988000	0.46212	0.996000	0.88848	6.611000	0.74183	2.489000	0.83994	0.591000	0.81541	GGG	NDST1	-	pfam_Sulfotransferase_dom,superfamily_P-loop_NTPase	ENSG00000070614		0.512	NDST1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	NDST1	HGNC	protein_coding	OTTHUMT00000374314.2	-	0.00	137	0	G	NM_001543		149929312	+1	tier1	-	no_errors	ENST00000261797	ensembl	human	known	74_37	missense	5.19	73	4	SNP	0.992	T
NEB	4703	genome.wustl.edu	37	2	152348691	152348691	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr2:152348691G>T	ENST00000172853.10	-	145	19557	c.19410C>A	c.(19408-19410)gaC>gaA	p.D6470E	NEB_ENST00000498015.2_5'UTR|NEB_ENST00000397336.2_Missense_Mutation_p.D301E|NEB_ENST00000509223.2_Missense_Mutation_p.D239E|NEB_ENST00000427231.2_Missense_Mutation_p.D8326E|RIF1_ENST00000457745.1_Intron|NEB_ENST00000603639.1_Missense_Mutation_p.D8326E|NEB_ENST00000409198.1_Missense_Mutation_p.D6470E|NEB_ENST00000397345.3_Missense_Mutation_p.D8326E|NEB_ENST00000604864.1_Missense_Mutation_p.D8326E			P20929	NEBU_HUMAN	nebulin	6470	Interaction with SVIL.				muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|regulation of actin filament length (GO:0030832)|somatic muscle development (GO:0007525)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)			NS(5)|autonomic_ganglia(3)|breast(9)|central_nervous_system(5)|cervix(3)|endometrium(35)|kidney(16)|large_intestine(77)|liver(1)|lung(99)|ovary(9)|pancreas(3)|prostate(13)|skin(7)|stomach(8)|upper_aerodigestive_tract(6)|urinary_tract(2)	301				BRCA - Breast invasive adenocarcinoma(221;0.219)		GGTAGTTAATGTCACTGAAGT	0.433																																																	0													213.0	203.0	206.0					2																	152348691		1945	4143	6088	SO:0001583	missense	0			X83957	CCDS46424.1, CCDS54407.1, CCDS54408.1, CCDS74588.1	2q22	2014-09-17			ENSG00000183091	ENSG00000183091			7720	protein-coding gene	gene with protein product	"""nemaline myopathy type 2"""	161650		NEM2		10051637, 9359044	Standard	NM_001164507		Approved	NEB177D	uc010fnx.3	P20929	OTTHUMG00000153784	ENST00000172853.10:c.19410C>A	2.37:g.152348691G>T	ENSP00000172853:p.Asp6470Glu		F8WCL5|F8WCP0|Q15346|Q53QQ2|Q53TG8	Missense_Mutation	SNP	pfam_Nebulin_35r-motif,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,superfamily_Adhesion_dom,superfamily_6-PGluconate_DH_C-like,smart_Nebulin_35r-motif,smart_SH3_domain,pfscan_Nebulin_35r-motif,pfscan_SH3_domain,prints_Nebulin	p.D8326E	ENST00000172853.10	37	c.24978		2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	21.8|21.8	4.198119|4.198119	0.79015|0.79015	.|.	.|.	ENSG00000183091|ENSG00000183091	ENST00000409198;ENST00000397345;ENST00000427231;ENST00000397342;ENST00000413693;ENST00000172853;ENST00000397336;ENST00000509223|ENST00000397337;ENST00000434685	T;T;T;T;T;T;T|.	0.08896|.	3.18;3.28;3.28;3.04;3.18;3.56;3.73|.	4.97|4.97	4.97|4.97	0.65823|0.65823	.|.	0.139045|.	0.64402|.	D|.	0.000006|.	T|T	0.72558|0.72558	0.3475|0.3475	M|M	0.73962|0.73962	2.25|2.25	0.58432|0.58432	D|D	0.999998|0.999998	B;D;P;P;D;P|.	0.76494|.	0.131;0.995;0.887;0.774;0.999;0.648|.	B;D;P;B;D;P|.	0.78314|.	0.171;0.967;0.463;0.41;0.991;0.709|.	T|T	0.72874|0.72874	-0.4160|-0.4160	10|5	0.45353|.	T|.	0.12|.	.|.	12.4624|12.4624	0.55738|0.55738	0.0815:0.0:0.9185:0.0|0.0815:0.0:0.9185:0.0	.|.	239;301;239;6470;2808;8326|.	B7Z6B9;B7Z6P9;B7Z6N8;P20929;Q14215;F8WCL5|.	.;.;.;NEBU_HUMAN;.;.|.	E|K	6470;8326;8326;2426;2808;6470;301;239|460;567	ENSP00000386259:D6470E;ENSP00000380505:D8326E;ENSP00000416578:D8326E;ENSP00000410961:D2808E;ENSP00000172853:D6470E;ENSP00000380497:D301E;ENSP00000427083:D239E|.	ENSP00000172853:D6470E|.	D|T	-|-	3|2	2|0	NEB|NEB	152056937|152056937	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	4.406000|4.406000	0.59748|0.59748	2.570000|2.570000	0.86706|0.86706	0.563000|0.563000	0.77884|0.77884	GAC|ACA	NEB	-	smart_Nebulin_35r-motif	ENSG00000183091		0.433	NEB-201	KNOWN	basic	protein_coding	NEB	HGNC	protein_coding			0.00	92	0	G	NM_004543		152348691	-1			no_errors	ENST00000397345	ensembl	human	known	74_37	missense	8.11	34	3	SNP	1.000	T
NES	10763	genome.wustl.edu	37	1	156642109	156642109	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr1:156642109G>T	ENST00000368223.3	-	4	2003	c.1871C>A	c.(1870-1872)aCa>aAa	p.T624K		NM_006617.1	NP_006608.1	P48681	NEST_HUMAN	nestin	624	Tail.				brain development (GO:0007420)|cell projection morphogenesis (GO:0048858)|central nervous system development (GO:0007417)|embryonic camera-type eye development (GO:0031076)|G2/M transition of mitotic cell cycle (GO:0000086)|negative regulation of catalytic activity (GO:0043086)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of protein binding (GO:0032091)|positive regulation of intermediate filament depolymerization (GO:0030844)|positive regulation of neural precursor cell proliferation (GO:2000179)|stem cell proliferation (GO:0072089)	cytoplasm (GO:0005737)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)	intermediate filament binding (GO:0019215)|structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(30)|ovary(6)|prostate(1)|skin(3)|stomach(1)|urinary_tract(4)	64	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					GGATTGCAATGTCTGTGTGTC	0.378																																																	0													95.0	96.0	96.0					1																	156642109		2203	4300	6503	SO:0001583	missense	0			X65964	CCDS1151.1	1q23	2013-01-16			ENSG00000132688	ENSG00000132688		"""Intermediate filaments type IV"""	7756	protein-coding gene	gene with protein product		600915				1478958, 9104587	Standard	NM_006617		Approved	FLJ21841	uc001fpq.3	P48681	OTTHUMG00000034299	ENST00000368223.3:c.1871C>A	1.37:g.156642109G>T	ENSP00000357206:p.Thr624Lys		O00552|Q3LIF5|Q5SYZ6	Missense_Mutation	SNP	pfam_IF	p.T624K	ENST00000368223.3	37	c.1871	CCDS1151.1	1	.	.	.	.	.	.	.	.	.	.	G	13.69	2.312199	0.40895	.	.	ENSG00000132688	ENST00000368223	D	0.86097	-2.07	5.0	0.329	0.15924	.	0.580848	0.13267	N	0.400818	T	0.65903	0.2736	M	0.72894	2.215	0.09310	N	1	B	0.30763	0.294	B	0.24974	0.057	T	0.60409	-0.7269	10	0.87932	D	0	.	2.4043	0.04409	0.1877:0.1255:0.5089:0.1779	.	624	P48681	NEST_HUMAN	K	624	ENSP00000357206:T624K	ENSP00000357206:T624K	T	-	2	0	NES	154908733	0.000000	0.05858	0.004000	0.12327	0.471000	0.32888	-0.218000	0.09240	0.136000	0.18733	0.467000	0.42956	ACA	NES	-	NULL	ENSG00000132688		0.378	NES-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NES	HGNC	protein_coding	OTTHUMT00000082844.2	-	0.00	75	0	G	NM_006617		156642109	-1	tier1	-	no_errors	ENST00000368223	ensembl	human	known	74_37	missense	9.09	40	4	SNP	0.001	T
NHLRC3	387921	genome.wustl.edu	37	13	39621263	39621263	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr13:39621263C>A	ENST00000379600.3	+	6	1087	c.765C>A	c.(763-765)ttC>ttA	p.F255L	NHLRC3_ENST00000470258.1_Missense_Mutation_p.F58L|NHLRC3_ENST00000379599.2_Missense_Mutation_p.F188L	NM_001012754.3	NP_001012772.1	Q5JS37	NHLC3_HUMAN	NHL repeat containing 3	255						extracellular vesicular exosome (GO:0070062)		p.F255F(1)		breast(1)|kidney(1)|large_intestine(3)|lung(4)|skin(2)	11		Lung NSC(96;6.01e-07)|Breast(139;0.00394)|Prostate(109;0.00676)|Lung SC(185;0.0548)|Hepatocellular(188;0.114)		all cancers(112;2.37e-08)|Epithelial(112;3.14e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.00101)|BRCA - Breast invasive adenocarcinoma(63;0.00335)|GBM - Glioblastoma multiforme(144;0.0128)		ATAATTGTTTCACAGAAGAGG	0.393																																																	1	Substitution - coding silent(1)	lung(1)											139.0	139.0	139.0					13																	39621263		2203	4300	6503	SO:0001583	missense	0				CCDS31961.1, CCDS31962.1	13q13.3	2007-12-18			ENSG00000188811	ENSG00000188811			33751	protein-coding gene	gene with protein product							Standard	NM_001017370		Approved		uc001uxc.4	Q5JS37	OTTHUMG00000016765	ENST00000379600.3:c.765C>A	13.37:g.39621263C>A	ENSP00000368920:p.Phe255Leu		B2RTZ2|B4DTL0|Q69YI9	Missense_Mutation	SNP	pfam_NHL_repeat,pfscan_NHL_repeat_subgr	p.F255L	ENST00000379600.3	37	c.765	CCDS31961.1	13	.	.	.	.	.	.	.	.	.	.	C	19.57	3.852959	0.71719	.	.	ENSG00000188811	ENST00000470258;ENST00000379600;ENST00000379599	D;D;D	0.89343	-2.5;-2.5;-2.5	5.58	3.87	0.44632	Six-bladed beta-propeller, TolB-like (1);	0.049726	0.85682	D	0.000000	D	0.92322	0.7564	M	0.65498	2.005	0.37054	D	0.897749	D;D	0.89917	0.999;1.0	D;D	0.83275	0.994;0.996	D	0.92184	0.5754	9	.	.	.	-20.3162	9.2144	0.37337	0.0:0.7541:0.0:0.2459	.	188;255	B4DTL0;Q5JS37	.;NHLC3_HUMAN	L	58;255;188	ENSP00000418127:F58L;ENSP00000368920:F255L;ENSP00000368919:F188L	.	F	+	3	2	NHLRC3	38519263	0.706000	0.27856	0.998000	0.56505	0.996000	0.88848	0.863000	0.27913	0.841000	0.35020	0.563000	0.77884	TTC	NHLRC3	-	NULL	ENSG00000188811		0.393	NHLRC3-005	KNOWN	basic|appris_principal|CCDS	protein_coding	NHLRC3	HGNC	protein_coding	OTTHUMT00000044616.2		0.00	122	0	C	NM_001012754		39621263	+1			no_errors	ENST00000379600	ensembl	human	known	74_37	missense	7.69	36	3	SNP	1.000	A
NLRP14	338323	genome.wustl.edu	37	11	7083694	7083694	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr11:7083694G>A	ENST00000299481.4	+	10	3281	c.2935G>A	c.(2935-2937)Gat>Aat	p.D979N		NM_176822.3	NP_789792.1	Q86W24	NAL14_HUMAN	NLR family, pyrin domain containing 14	979					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)		ATP binding (GO:0005524)			breast(3)|large_intestine(7)|lung(1)|ovary(3)|pancreas(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	21				Epithelial(150;4.62e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0871)		AATTCTGTGTGATGCTTTGAG	0.413																																																	0													161.0	150.0	154.0					11																	7083694		2201	4296	6497	SO:0001583	missense	0			BK001107	CCDS7776.1	11p15.4	2006-12-08	2006-12-08	2006-12-08		ENSG00000158077		"""Nucleotide-binding domain and leucine rich repeat containing"""	22939	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 14"""	609665	"""NACHT, leucine rich repeat and PYD containing 14"""	NALP14		12563287	Standard	NM_176822		Approved	NOD5, GC-LRR, Nalp-iota, PAN8, CLR11.2	uc001mfb.1	Q86W24		ENST00000299481.4:c.2935G>A	11.37:g.7083694G>A	ENSP00000299481:p.Asp979Asn		Q7RTR6	Missense_Mutation	SNP	pfam_DAPIN,superfamily_DEATH-like_dom,superfamily_P-loop_NTPase,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,pfscan_DAPIN	p.D979N	ENST00000299481.4	37	c.2935	CCDS7776.1	11	.	.	.	.	.	.	.	.	.	.	G	13.70	2.314225	0.40996	.	.	ENSG00000158077	ENST00000299481	T	0.38240	1.15	4.84	2.96	0.34315	.	0.543636	0.15275	N	0.270998	T	0.33206	0.0855	L	0.40543	1.245	0.30881	N	0.731457	P	0.40970	0.734	B	0.44315	0.446	T	0.35968	-0.9767	10	0.87932	D	0	.	7.5729	0.27918	0.1956:0.0:0.8044:0.0	.	979	Q86W24	NAL14_HUMAN	N	979	ENSP00000299481:D979N	ENSP00000299481:D979N	D	+	1	0	NLRP14	7040270	1.000000	0.71417	0.434000	0.26772	0.050000	0.14768	4.509000	0.60448	0.757000	0.33036	-0.150000	0.13652	GAT	NLRP14	-	smart_Leu-rich_rpt_RNase_inh_sub-typ	ENSG00000158077		0.413	NLRP14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NLRP14	HGNC	protein_coding	OTTHUMT00000384551.1	-	0.00	116	0	G	NM_176822		7083694	+1	tier1	-	no_errors	ENST00000299481	ensembl	human	known	74_37	missense	11.86	51	7	SNP	0.973	A
NOC4L	79050	genome.wustl.edu	37	12	132629489	132629489	+	Nonsense_Mutation	SNP	C	C	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr12:132629489C>T	ENST00000330579.1	+	2	249	c.208C>T	c.(208-210)Cag>Tag	p.Q70*	DDX51_ENST00000397333.3_5'Flank	NM_024078.1	NP_076983.1	Q9BVI4	NOC4L_HUMAN	nucleolar complex associated 4 homolog (S. cerevisiae)	70					rRNA processing (GO:0006364)	integral component of membrane (GO:0016021)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(2)|kidney(2)|large_intestine(1)|lung(7)|skin(2)	14	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;7.2e-08)|Epithelial(86;3.34e-07)|all cancers(50;1.97e-05)		GTTTGTGGGCCAGCTGCCCTC	0.637																																																	0													42.0	38.0	39.0					12																	132629489		2186	4291	6477	SO:0001587	stop_gained	0				CCDS9277.1	12q24.33	2011-08-12			ENSG00000184967	ENSG00000184967			28461	protein-coding gene	gene with protein product		612819				12446671	Standard	NM_024078		Approved	MGC3162, NET49, UTP19	uc001ujz.1	Q9BVI4	OTTHUMG00000168260	ENST00000330579.1:c.208C>T	12.37:g.132629489C>T	ENSP00000328854:p.Gln70*		Q8N2S5|Q96I14	Nonsense_Mutation	SNP	pfam_CCAAT-binding_factor,superfamily_ARM-type_fold	p.Q70*	ENST00000330579.1	37	c.208	CCDS9277.1	12	.	.	.	.	.	.	.	.	.	.	C	16.66	3.184226	0.57800	.	.	ENSG00000184967	ENST00000330579	.	.	.	4.59	2.71	0.32032	.	0.952132	0.08802	N	0.891587	.	.	.	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-9.7149	5.7896	0.18353	0.3394:0.5665:0.0:0.0941	.	.	.	.	X	70	.	ENSP00000328854:Q70X	Q	+	1	0	NOC4L	131195442	0.130000	0.22417	0.145000	0.22337	0.147000	0.21601	1.477000	0.35431	0.335000	0.23614	0.491000	0.48974	CAG	NOC4L	-	superfamily_ARM-type_fold	ENSG00000184967		0.637	NOC4L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOC4L	HGNC	protein_coding	OTTHUMT00000398999.1	-	0.00	54	0	C	NM_024078		132629489	+1	tier1	-	no_errors	ENST00000330579	ensembl	human	known	74_37	nonsense	18.18	18	4	SNP	0.003	T
NOP56	10528	genome.wustl.edu	37	20	2638990	2638990	+	3'UTR	SNP	G	G	A			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr20:2638990G>A	ENST00000329276.5	+	0	2351				SNORD56_ENST00000413522.1_RNA|NOP56_ENST00000492135.1_3'UTR|SNORD86_ENST00000391196.1_RNA|SNORD57_ENST00000448188.1_RNA|IDH3B_ENST00000488299.1_5'Flank	NM_006392.3	NP_006383.2	O00567	NOP56_HUMAN	NOP56 ribonucleoprotein						cell death (GO:0008219)|rRNA processing (GO:0006364)	box C/D snoRNP complex (GO:0031428)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|pre-snoRNP complex (GO:0070761)|small nucleolar ribonucleoprotein complex (GO:0005732)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|snoRNA binding (GO:0030515)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(6)|ovary(2)|pancreas(1)|skin(2)|urinary_tract(1)	25						AGCCCAAGGTGACATTTCCCA	0.448																																																	0													17.0	18.0	18.0					20																	2638990		2203	4299	6502	SO:0001624	3_prime_UTR_variant	0			Y12065	CCDS13030.1	20p13	2012-12-10	2012-12-10	2009-01-13	ENSG00000101361	ENSG00000101361			15911	protein-coding gene	gene with protein product	"""spinocerebellar ataxia 36"""	614154	"""nucleolar protein 5A (56kD with KKE/D repeat)"", ""nucleolar protein 5A (56kDa with KKE/D repeat)"", ""NOP56 ribonucleoprotein homolog (yeast)"""	NOL5A		9372940, 21683323	Standard	NR_027700		Approved	SCA36	uc002wgh.3	O00567	OTTHUMG00000031703	ENST00000329276.5:c.*50G>A	20.37:g.2638990G>A			Q2M3T6|Q9NQ05	RNA	SNP	-	NULL	ENST00000329276.5	37	NULL	CCDS13030.1	20																																																																																			NOP56	-	-	ENSG00000101361		0.448	NOP56-009	KNOWN	basic|appris_principal|CCDS	protein_coding	NOP56	HGNC	protein_coding	OTTHUMT00000077631.2	-	0.00	76	0	G	NM_006392		2638990	+1	tier1	-	no_errors	ENST00000462630	ensembl	human	known	74_37	rna	23.88	51	16	SNP	0.000	A
NPY1R	4886	genome.wustl.edu	37	4	164247139	164247139	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr4:164247139C>A	ENST00000296533.2	-	2	1099	c.568G>T	c.(568-570)Gat>Tat	p.D190Y	NPY1R_ENST00000509586.1_Intron	NM_000909.5	NP_000900.1	P25929	NPY1R_HUMAN	neuropeptide Y receptor Y1	190					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|feeding behavior (GO:0007631)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|glucose metabolic process (GO:0006006)|locomotory behavior (GO:0007626)|neuropeptide signaling pathway (GO:0007218)|outflow tract morphogenesis (GO:0003151)|regulation of blood pressure (GO:0008217)|regulation of multicellular organism growth (GO:0040014)|sensory perception of pain (GO:0019233)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	neuropeptide Y receptor activity (GO:0004983)|pancreatic polypeptide receptor activity (GO:0001602)|peptide YY receptor activity (GO:0001601)			breast(1)|cervix(1)|large_intestine(4)|lung(18)|pancreas(1)|skin(1)|upper_aerodigestive_tract(4)	30	all_hematologic(180;0.166)	Prostate(90;0.0959)|all_neural(102;0.223)				TTGTACGCATCAAGTGTTACA	0.433																																																	0													122.0	108.0	113.0					4																	164247139		2203	4300	6503	SO:0001583	missense	0				CCDS34089.1	4q31.3-q32	2012-08-08				ENSG00000164128		"""GPCR / Class A : Neuropeptide receptors : Y"""	7956	protein-coding gene	gene with protein product		162641		NPYR		8095935	Standard	NM_000909		Approved		uc003iqm.2	P25929		ENST00000296533.2:c.568G>T	4.37:g.164247139C>A	ENSP00000354652:p.Asp190Tyr		B2R6H5	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_Glucose_rcpt_Git3_N,pfscan_GPCR_Rhodpsn_7TM,prints_NPY1_rcpt,prints_GPCR_Rhodpsn,prints_NPY_rcpt	p.D190Y	ENST00000296533.2	37	c.568	CCDS34089.1	4	.	.	.	.	.	.	.	.	.	.	C	10.22	1.291234	0.23564	.	.	ENSG00000164128	ENST00000296533;ENST00000512819	T;T	0.72505	1.2;-0.66	5.84	4.96	0.65561	GPCR, rhodopsin-like superfamily (1);	0.509670	0.19234	N	0.119339	T	0.74215	0.3687	L	0.46819	1.47	0.09310	N	0.999993	P	0.48016	0.904	P	0.50378	0.639	T	0.67929	-0.5543	10	0.48119	T	0.1	.	18.6015	0.91249	0.0:0.8735:0.1265:0.0	.	190	P25929	NPY1R_HUMAN	Y	190;12	ENSP00000354652:D190Y;ENSP00000421618:D12Y	ENSP00000354652:D190Y	D	-	1	0	NPY1R	164466589	0.027000	0.19231	0.041000	0.18516	0.489000	0.33432	2.050000	0.41297	2.771000	0.95319	0.655000	0.94253	GAT	NPY1R	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_Glucose_rcpt_Git3_N,pfscan_GPCR_Rhodpsn_7TM,prints_NPY1_rcpt	ENSG00000164128		0.433	NPY1R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPY1R	HGNC	protein_coding	OTTHUMT00000364685.1		0.00	84	0	C			164247139	-1			no_errors	ENST00000296533	ensembl	human	known	74_37	missense	7.14	39	3	SNP	0.001	A
NRCAM	4897	genome.wustl.edu	37	7	107872819	107872819	+	Silent	SNP	C	C	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr7:107872819C>T	ENST00000425651.2	-	4	377	c.378G>A	c.(376-378)agG>agA	p.R126R	NRCAM_ENST00000379022.4_Silent_p.R126R|NRCAM_ENST00000379024.4_Silent_p.R126R|NRCAM_ENST00000413765.2_Silent_p.R126R|NRCAM_ENST00000379028.3_Silent_p.R126R|NRCAM_ENST00000351718.4_Silent_p.R120R	NM_001037132.2	NP_001032209.1	Q92823	NRCAM_HUMAN	neuronal cell adhesion molecule	126	Ig-like 1.				angiogenesis (GO:0001525)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|axonogenesis (GO:0007409)|central nervous system development (GO:0007417)|clustering of voltage-gated sodium channels (GO:0045162)|heterotypic cell-cell adhesion (GO:0034113)|neuron migration (GO:0001764)|neuronal action potential propagation (GO:0019227)|positive regulation of neuron differentiation (GO:0045666)|protein localization (GO:0008104)|regulation of axon extension (GO:0030516)|retinal ganglion cell axon guidance (GO:0031290)|single organismal cell-cell adhesion (GO:0016337)|synapse assembly (GO:0007416)	axon initial segment (GO:0043194)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|synapse (GO:0045202)	ankyrin binding (GO:0030506)			breast(4)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(8)|liver(1)|lung(36)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(4)	65						CGCGTTCGTTCCTTGCTGTAC	0.458																																																	0													198.0	178.0	185.0					7																	107872819		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS5751.1, CCDS47686.1, CCDS55153.1, CCDS75652.1	7q31	2013-02-11			ENSG00000091129	ENSG00000091129		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7994	protein-coding gene	gene with protein product	"""NgCAM-related cell adhesion molecule"""	601581				8812479	Standard	NM_001037132		Approved	KIAA0343, Bravo	uc022aka.1	Q92823	OTTHUMG00000154973	ENST00000425651.2:c.378G>A	7.37:g.107872819C>T			A4D0S3|E9PDA4|O15051|O15179|Q14BM2|Q9UHI3|Q9UHI4	Silent	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.R126	ENST00000425651.2	37	c.378	CCDS47686.1	7																																																																																			NRCAM	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000091129		0.458	NRCAM-006	KNOWN	basic|appris_principal|CCDS	protein_coding	NRCAM	HGNC	protein_coding	OTTHUMT00000337942.2	-	0.00	62	0	C	NM_001037132		107872819	-1	tier1	-	no_errors	ENST00000379028	ensembl	human	known	74_37	silent	23.68	29	9	SNP	0.981	T
NTSR1	4923	genome.wustl.edu	37	20	61389685	61389685	+	Silent	SNP	C	C	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr20:61389685C>T	ENST00000370501.3	+	3	1355	c.984C>T	c.(982-984)taC>taT	p.Y328Y	NTSR1_ENST00000482259.1_3'UTR	NM_002531.2	NP_002522.2	P30989	NTR1_HUMAN	neurotensin receptor 1 (high affinity)	328	Neurotensin binding. {ECO:0000250}.				adult locomotory behavior (GO:0008344)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of apoptotic process (GO:0043066)|neuropeptide signaling pathway (GO:0007218)|synaptic transmission (GO:0007268)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	G-protein coupled neurotensin receptor activity (GO:0016492)|G-protein coupled receptor activity (GO:0004930)	p.Y328*(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(16)|prostate(1)|skin(3)	27	Breast(26;3.65e-08)		BRCA - Breast invasive adenocarcinoma(19;3.63e-06)			TGTTCTGCTACATCTCGGATG	0.592																																					GBM(37;400 780 6403 19663 35669)												1	Substitution - Nonsense(1)	lung(1)											146.0	103.0	118.0					20																	61389685		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS13502.1	20q13	2012-08-08			ENSG00000101188	ENSG00000101188		"""GPCR / Class A : Neurotensin receptors"""	8039	protein-coding gene	gene with protein product		162651				8075503	Standard	NM_002531		Approved	NTR	uc002ydf.3	P30989	OTTHUMG00000032932	ENST00000370501.3:c.984C>T	20.37:g.61389685C>T			Q9H4H1|Q9H4T5	Silent	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_serpentine_rcpt_Srv,pfscan_GPCR_Rhodpsn_7TM,prints_NT1_rcpt,prints_GPCR_Rhodpsn,prints_NT_rcpt	p.Y328	ENST00000370501.3	37	c.984	CCDS13502.1	20																																																																																			NTSR1	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_serpentine_rcpt_Srv,pfscan_GPCR_Rhodpsn_7TM,prints_NT_rcpt	ENSG00000101188		0.592	NTSR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NTSR1	HGNC	protein_coding	OTTHUMT00000080061.1		0.00	37	0	C			61389685	+1			no_errors	ENST00000370501	ensembl	human	known	74_37	silent	7.41	25	2	SNP	0.993	T
OR10R2	343406	genome.wustl.edu	37	1	158449927	158449927	+	Nonsense_Mutation	SNP	C	C	A			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr1:158449927C>A	ENST00000368152.1	+	1	260	c.260C>A	c.(259-261)tCa>tAa	p.S87*	RP11-144L1.4_ENST00000419738.1_RNA|RP11-144L1.4_ENST00000426251.1_RNA	NM_001004472.1	NP_001004472.1	Q8NGX6	O10R2_HUMAN	olfactory receptor, family 10, subfamily R, member 2	87						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.S87L(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|liver(1)|lung(26)|pancreas(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	41	all_hematologic(112;0.0378)					GGCATTCTCTCAACATCTGAG	0.433																																																	1	Substitution - Missense(1)	endometrium(1)											292.0	248.0	263.0					1																	158449927		2203	4300	6503	SO:0001587	stop_gained	0			AB065640	CCDS30898.1	1q23.1	2012-08-09			ENSG00000198965	ENSG00000198965		"""GPCR / Class A : Olfactory receptors"""	14820	protein-coding gene	gene with protein product							Standard	NM_001004472		Approved	OR10R2Q	uc010pik.2	Q8NGX6	OTTHUMG00000019632	ENST00000368152.1:c.260C>A	1.37:g.158449927C>A	ENSP00000357134:p.Ser87*		Q5VWM8|Q6IFS1|Q96R61	Nonsense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.S87*	ENST00000368152.1	37	c.260	CCDS30898.1	1	.	.	.	.	.	.	.	.	.	.	c	17.48	3.400100	0.62177	.	.	ENSG00000198965	ENST00000368152	.	.	.	4.28	4.28	0.50868	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.6427	0.77020	0.0:1.0:0.0:0.0	.	.	.	.	X	87	.	ENSP00000357134:S87X	S	+	2	0	OR10R2	156716551	0.016000	0.18221	0.404000	0.26397	0.810000	0.45777	2.622000	0.46427	2.170000	0.68504	0.655000	0.94253	TCA	OR10R2	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000198965		0.433	OR10R2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10R2	HGNC	protein_coding	OTTHUMT00000051847.2		0.00	37	0	C	NM_001004472		158449927	+1			no_errors	ENST00000368152	ensembl	human	known	74_37	nonsense	10.71	25	3	SNP	0.039	A
OR2C3	81472	genome.wustl.edu	37	1	247695440	247695440	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr1:247695440G>T	ENST00000366487.3	-	2	735	c.374C>A	c.(373-375)gCt>gAt	p.A125D	GCSAML_ENST00000366490.3_Intron|GCSAML_ENST00000366491.2_Intron|GCSAML_ENST00000527084.1_Intron|GCSAML_ENST00000463359.1_Intron|GCSAML_ENST00000527541.1_Intron|GCSAML_ENST00000366489.1_Intron|GCSAML_ENST00000531662.1_Intron	NM_198074.4	NP_932340	Q8N628	OR2C3_HUMAN	olfactory receptor, family 2, subfamily C, member 3	125						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.A124D(1)		breast(1)|endometrium(5)|large_intestine(2)|lung(31)|ovary(1)|prostate(1)|skin(2)	43	all_cancers(71;4.51e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.0242)	OV - Ovarian serous cystadenocarcinoma(106;0.0241)			GCAGATGGCAGCGTAGCGGTC	0.567																																																	1	Substitution - Missense(1)	lung(1)											73.0	74.0	74.0					1																	247695440		2203	4300	6503	SO:0001583	missense	0			BC030717	CCDS1634.2	1q44	2014-02-19	2002-02-28		ENSG00000196242	ENSG00000196242		"""GPCR / Class A : Olfactory receptors"""	15005	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily C, member 4"""	OR2C4, OR2C5P			Standard	NM_198074		Approved	OST742	uc009xgy.3	Q8N628	OTTHUMG00000040579	ENST00000366487.3:c.374C>A	1.37:g.247695440G>T	ENSP00000355443:p.Ala125Asp		Q5JQS4|Q6IEZ1|Q8NGW7	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_serpentine_rcpt_Srv,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.A125D	ENST00000366487.3	37	c.374	CCDS1634.2	1	.	.	.	.	.	.	.	.	.	.	G	20.0	3.930607	0.73327	.	.	ENSG00000196242	ENST00000366487	T	0.01902	4.57	3.89	2.0	0.26442	GPCR, rhodopsin-like superfamily (1);	0.238056	0.21479	U	0.073861	T	0.06416	0.0165	M	0.88906	2.99	0.25094	N	0.990838	P	0.50943	0.94	P	0.48030	0.564	T	0.14117	-1.0484	10	0.87932	D	0	.	5.1891	0.15199	0.3407:0.0:0.6593:0.0	.	125	Q8N628	OR2C3_HUMAN	D	125	ENSP00000355443:A125D	ENSP00000355443:A125D	A	-	2	0	OR2C3	245762063	0.002000	0.14202	0.861000	0.33841	0.972000	0.66771	1.695000	0.37763	0.971000	0.38288	0.650000	0.86243	GCT	OR2C3	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_serpentine_rcpt_Srv,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000196242		0.567	OR2C3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2C3	HGNC	protein_coding	OTTHUMT00000097626.2		0.00	43	0	G	NM_198074		247695440	-1			no_errors	ENST00000366487	ensembl	human	known	74_37	missense	5.56	34	2	SNP	0.985	T
OR2T5	401993	genome.wustl.edu	37	1	248651977	248651977	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr1:248651977C>G	ENST00000366473.2	+	1	93	c.88C>G	c.(88-90)Cta>Gta	p.L30V		NM_001004697.1	NP_001004697.1	Q6IEZ7	OR2T5_HUMAN	olfactory receptor, family 2, subfamily T, member 5	30						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L30I(1)		breast(1)|haematopoietic_and_lymphoid_tissue(1)|lung(2)|ovary(2)|pancreas(1)|skin(2)	9	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			ACATCCAGCTCTACTTAGTGT	0.498																																																	1	Substitution - Missense(1)	lung(1)											152.0	166.0	162.0					1																	248651977		2199	4298	6497	SO:0001583	missense	0			BK004465	CCDS31118.1	1q44	2012-08-09			ENSG00000203661	ENSG00000203661		"""GPCR / Class A : Olfactory receptors"""	15017	protein-coding gene	gene with protein product							Standard	NM_001004697		Approved		uc001iem.1	Q6IEZ7	OTTHUMG00000040481	ENST00000366473.2:c.88C>G	1.37:g.248651977C>G	ENSP00000355429:p.Leu30Val			Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L30V	ENST00000366473.2	37	c.88	CCDS31118.1	1	.	.	.	.	.	.	.	.	.	.	c	2.639	-0.284621	0.05605	.	.	ENSG00000203661	ENST00000366473	T	0.00631	6.09	2.64	0.415	0.16411	.	0.186913	0.26136	N	0.026121	T	0.00524	0.0017	L	0.33245	0.995	0.09310	N	1	B	0.15719	0.014	B	0.18871	0.023	T	0.49254	-0.8959	10	0.31617	T	0.26	.	0.6677	0.00853	0.2017:0.3704:0.1985:0.2294	.	30	Q6IEZ7	OR2T5_HUMAN	V	30	ENSP00000355429:L30V	ENSP00000355429:L30V	L	+	1	2	OR2T5	246718600	0.000000	0.05858	0.023000	0.16930	0.007000	0.05969	-4.510000	0.00223	-0.179000	0.10654	-0.891000	0.02926	CTA	OR2T5	-	prints_GPCR_Rhodpsn	ENSG00000203661		0.498	OR2T5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2T5	HGNC	protein_coding	OTTHUMT00000097422.1		0.00	73	0	C	NM_001004697		248651977	+1			no_errors	ENST00000366473	ensembl	human	known	74_37	missense	8.62	53	5	SNP	0.000	G
OR52D1	390066	genome.wustl.edu	37	11	5510628	5510628	+	Missense_Mutation	SNP	T	T	C			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr11:5510628T>C	ENST00000322641.5	+	1	714	c.692T>C	c.(691-693)cTt>cCt	p.L231P	AC104389.28_ENST00000415970.1_RNA|HBG2_ENST00000380259.2_Intron|HBE1_ENST00000380237.1_Intron|HBG2_ENST00000380252.1_Intron	NM_001005163.2	NP_001005163.1	Q9H346	O52D1_HUMAN	olfactory receptor, family 52, subfamily D, member 1	231					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L231H(1)		central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(5)|lung(8)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	22		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)		Epithelial(150;3.46e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GTCTTTCATCTTCCATCTCAT	0.488																																																	1	Substitution - Missense(1)	cervix(1)											229.0	200.0	210.0					11																	5510628		2201	4297	6498	SO:0001583	missense	0			BK004276	CCDS31384.1	11p15.4	2012-08-09			ENSG00000181609	ENSG00000181609		"""GPCR / Class A : Olfactory receptors"""	15212	protein-coding gene	gene with protein product							Standard	NM_001005163		Approved		uc010qzg.2	Q9H346	OTTHUMG00000066895	ENST00000322641.5:c.692T>C	11.37:g.5510628T>C	ENSP00000326232:p.Leu231Pro		B9EGY9|Q6IFI6	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L231P	ENST00000322641.5	37	c.692	CCDS31384.1	11	.	.	.	.	.	.	.	.	.	.	T	7.944	0.743334	0.15642	.	.	ENSG00000181609	ENST00000322641	T	0.00169	8.63	5.58	4.46	0.54185	GPCR, rhodopsin-like superfamily (1);	0.000000	0.56097	D	0.000026	T	0.00637	0.0021	M	0.88704	2.975	0.20764	N	0.999854	D	0.89917	1.0	D	0.97110	1.0	T	0.24048	-1.0171	10	0.87932	D	0	.	10.7702	0.46319	0.0:0.0744:0.0:0.9256	.	231	Q9H346	O52D1_HUMAN	P	231	ENSP00000326232:L231P	ENSP00000326232:L231P	L	+	2	0	OR52D1	5467204	0.565000	0.26610	0.004000	0.12327	0.003000	0.03518	2.171000	0.42453	1.132000	0.42129	-0.263000	0.10527	CTT	OR52D1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000181609		0.488	OR52D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR52D1	HGNC	protein_coding	OTTHUMT00000143372.1		0.00	63	0	T	NM_001005163		5510628	+1			no_errors	ENST00000322641	ensembl	human	known	74_37	missense	8.33	22	2	SNP	0.001	C
OR4A16	81327	genome.wustl.edu	37	11	55111057	55111057	+	Silent	SNP	G	G	T	rs76791457	byFrequency	TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr11:55111057G>T	ENST00000314721.2	+	1	431	c.381G>T	c.(379-381)ccG>ccT	p.P127P		NM_001005274.1	NP_001005274.1	Q8NH70	O4A16_HUMAN	olfactory receptor, family 4, subfamily A, member 16	127						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.P127P(1)		NS(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(28)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	51						TCTCTAAGCCGCTGCACTATT	0.468																																																	1	Substitution - coding silent(1)	lung(1)											182.0	166.0	171.0					11																	55111057		2201	4296	6497	SO:0001819	synonymous_variant	0			AB065519	CCDS31499.1	11q11	2012-08-09			ENSG00000181961	ENSG00000181961		"""GPCR / Class A : Olfactory receptors"""	15153	protein-coding gene	gene with protein product							Standard	NM_001005274		Approved	OR4A16Q	uc010rie.2	Q8NH70	OTTHUMG00000166710	ENST00000314721.2:c.381G>T	11.37:g.55111057G>T			Q6IFL3	Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.P127	ENST00000314721.2	37	c.381	CCDS31499.1	11																																																																																			OR4A16	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt	ENSG00000181961		0.468	OR4A16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4A16	HGNC	protein_coding	OTTHUMT00000391160.1		0.00	71	0	G	NM_001005274		55111057	+1			no_errors	ENST00000314721	ensembl	human	known	74_37	silent	5.71	33	2	SNP	0.998	T
OR5M9	390162	genome.wustl.edu	37	11	56230677	56230677	+	Silent	SNP	C	C	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr11:56230677C>T	ENST00000279791.1	-	1	200	c.201G>A	c.(199-201)gcG>gcA	p.A67A		NM_001004743.1	NP_001004743.1	Q8NGP3	OR5M9_HUMAN	olfactory receptor, family 5, subfamily M, member 9	67						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(17)|ovary(1)|prostate(1)|skin(4)|urinary_tract(2)	36	Esophageal squamous(21;0.00448)					AGCACACGTCCGCAAAAGACA	0.428																																																	0													83.0	84.0	84.0					11																	56230677		2201	4296	6497	SO:0001819	synonymous_variant	0			AB065747	CCDS31531.1	11q11	2012-08-09			ENSG00000150269	ENSG00000150269		"""GPCR / Class A : Olfactory receptors"""	15294	protein-coding gene	gene with protein product							Standard	NM_001004743		Approved		uc010rjj.2	Q8NGP3	OTTHUMG00000166874	ENST00000279791.1:c.201G>A	11.37:g.56230677C>T			Q6IEW5|Q96RB9	Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.A67	ENST00000279791.1	37	c.201	CCDS31531.1	11																																																																																			OR5M9	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000150269		0.428	OR5M9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5M9	HGNC	protein_coding	OTTHUMT00000391638.1	-	0.00	41	0	C	NM_001004743		56230677	-1	tier1	-	no_errors	ENST00000279791	ensembl	human	known	74_37	silent	11.11	32	4	SNP	0.001	T
PARP4	143	genome.wustl.edu	37	13	25009294	25009294	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr13:25009294G>T	ENST00000381989.3	-	31	4090	c.3985C>A	c.(3985-3987)Ccg>Acg	p.P1329T		NM_006437.3	NP_006428.2	Q9UKK3	PARP4_HUMAN	poly (ADP-ribose) polymerase family, member 4	1329					cell death (GO:0008219)|cellular protein modification process (GO:0006464)|cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|inflammatory response (GO:0006954)|protein ADP-ribosylation (GO:0006471)|response to drug (GO:0042493)|transport (GO:0006810)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|spindle microtubule (GO:0005876)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)|NAD+ ADP-ribosyltransferase activity (GO:0003950)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(14)|lung(18)|ovary(3)|prostate(2)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	63		all_epithelial(30;7.67e-16)|Lung SC(185;0.0225)|Breast(139;0.052)		all cancers(112;0.000127)|Epithelial(112;0.000778)|Kidney(163;0.039)|OV - Ovarian serous cystadenocarcinoma(117;0.0578)|KIRC - Kidney renal clear cell carcinoma(186;0.135)|Lung(94;0.195)		CGGGCAGTCGGGGGAAGATAG	0.488																																																	0													84.0	91.0	89.0					13																	25009294		2203	4300	6503	SO:0001583	missense	0			AF057160	CCDS9307.1	13q11	2010-09-29	2004-08-20	2004-08-26	ENSG00000102699	ENSG00000102699		"""Poly (ADP-ribose) polymerases"""	271	protein-coding gene	gene with protein product	"""von Willebrand factor A domain containing 5C"""	607519	"""ADP-ribosyltransferase (NAD+; poly (ADP-ribose) polymerase)-like 1"""	ADPRTL1		10644454	Standard	NM_006437		Approved	VAULT3, p193, VPARP, VWA5C	uc001upl.3	Q9UKK3	OTTHUMG00000016582	ENST00000381989.3:c.3985C>A	13.37:g.25009294G>T	ENSP00000371419:p.Pro1329Thr		O75903|Q14682|Q5QNZ9|Q9H1M6	Missense_Mutation	SNP	pfam_Poly(ADP-ribose)pol_cat_dom,pfam_VIT,pfam_VWF_A,pfam_BRCT_dom,superfamily_Poly(ADP-ribose)pol_reg_dom,superfamily_BRCT_dom,smart_BRCT_dom,smart_VIT,smart_VWF_A,pfscan_BRCT_dom,pfscan_VWF_A,pfscan_Poly(ADP-ribose)pol_cat_dom,pfscan_Poly(ADP-ribose)pol_reg_dom	p.P1329T	ENST00000381989.3	37	c.3985	CCDS9307.1	13	.	.	.	.	.	.	.	.	.	.	g	0.036	-1.305651	0.01353	.	.	ENSG00000102699	ENST00000381989	T	0.01854	4.6	2.24	0.323	0.15893	.	27.309900	0.00757	U	0.001115	T	0.01730	0.0055	N	0.14661	0.345	0.09310	N	1	B	0.18968	0.032	B	0.18871	0.023	T	0.45056	-0.9287	10	0.18710	T	0.47	.	3.4381	0.07453	0.1787:0.3018:0.5195:0.0	.	1329	Q9UKK3	PARP4_HUMAN	T	1329	ENSP00000371419:P1329T	ENSP00000371419:P1329T	P	-	1	0	PARP4	23907294	0.004000	0.15560	0.000000	0.03702	0.001000	0.01503	0.632000	0.24583	-0.096000	0.12329	0.313000	0.20887	CCG	PARP4	-	NULL	ENSG00000102699		0.488	PARP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PARP4	HGNC	protein_coding	OTTHUMT00000044189.1	-	0.00	84	0	G	NM_006437		25009294	-1	tier1	-	no_errors	ENST00000381989	ensembl	human	known	74_37	missense	13.33	26	4	SNP	0.000	T
PBXIP1	57326	genome.wustl.edu	37	1	154924318	154924318	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr1:154924318G>T	ENST00000368463.3	-	3	202	c.131C>A	c.(130-132)cCc>cAc	p.P44H	PBXIP1_ENST00000539880.1_Intron|PBXIP1_ENST00000368460.3_Missense_Mutation_p.P44H|PBXIP1_ENST00000368465.1_Missense_Mutation_p.P15H|PBXIP1_ENST00000542459.1_Intron|PBXIP1_ENST00000498553.1_Intron	NM_020524.2	NP_065385.2	Q96AQ6	PBIP1_HUMAN	pre-B-cell leukemia homeobox interacting protein 1	44					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|negative regulation of transcription, DNA-templated (GO:0045892)	cytosol (GO:0005829)|microtubule (GO:0005874)|nucleus (GO:0005634)	transcription corepressor activity (GO:0003714)			breast(1)|kidney(2)|large_intestine(6)|lung(13)|prostate(1)|urinary_tract(1)	24	all_epithelial(22;4.9e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00034)			TGTCTTGGAGGGGCTGTGAGG	0.562																																																	0													138.0	144.0	142.0					1																	154924318		2203	4300	6503	SO:0001583	missense	0			AF221521	CCDS1074.1	1q22	2008-02-05	2007-01-30		ENSG00000163346	ENSG00000163346			21199	protein-coding gene	gene with protein product			"""pre-B-cell leukemia transcription factor interacting protein 1"""			7505766, 10825160	Standard	NM_020524		Approved	HPIP	uc001ffr.3	Q96AQ6	OTTHUMG00000037369	ENST00000368463.3:c.131C>A	1.37:g.154924318G>T	ENSP00000357448:p.Pro44His		Q5T174|Q5T176|Q9H8X6|Q9HA02|Q9HD85	Missense_Mutation	SNP	NULL	p.P44H	ENST00000368463.3	37	c.131	CCDS1074.1	1	.	.	.	.	.	.	.	.	.	.	G	13.17	2.156561	0.38119	.	.	ENSG00000163346	ENST00000368465;ENST00000368463;ENST00000351146;ENST00000368460	T;T	0.13307	2.6;2.62	3.53	0.137	0.14787	.	0.917903	0.09144	N	0.842575	T	0.09291	0.0229	L	0.51422	1.61	0.09310	N	0.999997	D	0.61697	0.99	P	0.56474	0.799	T	0.14811	-1.0459	10	0.87932	D	0	0.9675	3.0983	0.06317	0.2606:0.0:0.5368:0.2026	.	44	Q96AQ6	PBIP1_HUMAN	H	15;44;44;44	ENSP00000357450:P15H;ENSP00000357448:P44H	ENSP00000295523:P44H	P	-	2	0	PBXIP1	153190942	0.106000	0.21978	0.001000	0.08648	0.009000	0.06853	0.861000	0.27885	0.044000	0.15775	0.555000	0.69702	CCC	PBXIP1	-	NULL	ENSG00000163346		0.562	PBXIP1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	PBXIP1	HGNC	protein_coding	OTTHUMT00000090943.1		0.00	41	0	G	NM_020524		154924318	-1			no_errors	ENST00000490230	ensembl	human	known	74_37	missense	16.67	10	2	SNP	0.001	T
PCDHA3	56145	genome.wustl.edu	37	5	140183243	140183243	+	Intron	SNP	C	C	A			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr5:140183243C>A	ENST00000522353.2	+	1	2394				PCDHA3_ENST00000532566.2_Missense_Mutation_p.L821M|PCDHA1_ENST00000394633.3_Intron|PCDHA2_ENST00000520672.2_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000526136.1_Intron	NM_018906.2	NP_061729.1	Q9Y5H8	PCDA3_HUMAN	protocadherin alpha 3						cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(16)|kidney(3)|large_intestine(19)|lung(36)|ovary(7)|prostate(8)|skin(3)|stomach(1)	95			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TTCCACTCCTCTGGAAATACA	0.313																																																	0													26.0	33.0	31.0					5																	140183243		2184	4294	6478	SO:0001627	intron_variant	0			AF152481	CCDS54915.1	5q31	2010-11-26				ENSG00000255408		"""Cadherins / Protocadherins : Clustered"""	8669	other	complex locus constituent	"""KIAA0345-like 11"""	606309				10380929	Standard	NM_018906		Approved	PCDH-ALPHA3		Q9Y5H8		ENST00000522353.2:c.2394+67C>A	5.37:g.140183243C>A			O75286	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.L821M	ENST00000522353.2	37	c.2461	CCDS54915.1	5	.	.	.	.	.	.	.	.	.	.	N	6.440	0.449307	0.12223	.	.	ENSG00000255408	ENST00000532566	T	0.55234	0.53	4.53	2.07	0.26955	.	1.448130	0.05675	U	0.589309	T	0.36331	0.0963	N	0.08118	0	0.09310	N	1	P	0.39624	0.681	B	0.41946	0.371	T	0.32508	-0.9904	9	.	.	.	.	8.876	0.35345	0.0:0.1732:0.0:0.8268	.	821	Q9Y5H8-2	.	M	821	ENSP00000434086:L821M	.	L	+	1	2	PCDHA3	140163427	0.076000	0.21285	0.067000	0.19924	0.004000	0.04260	0.633000	0.24598	0.697000	0.31718	-0.374000	0.07098	CTG	PCDHA3	-	NULL	ENSG00000255408		0.313	PCDHA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA3	HGNC	protein_coding	OTTHUMT00000372848.2	-	0.00	41	0	C	NM_018906		140183243	+1	tier1	-	no_errors	ENST00000532566	ensembl	human	known	74_37	missense	10.00	27	3	SNP	0.000	A
PCDHA9	9752	genome.wustl.edu	37	5	140229864	140229864	+	Missense_Mutation	SNP	G	G	A	rs140634296		TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr5:140229864G>A	ENST00000532602.1	+	1	2817	c.1784G>A	c.(1783-1785)cGc>cAc	p.R595H	PCDHA4_ENST00000512229.2_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA9_ENST00000378122.3_Missense_Mutation_p.R595H|PCDHA5_ENST00000529619.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000526136.1_Intron	NM_031857.1	NP_114063.1	Q9Y5H5	PCDA9_HUMAN	protocadherin alpha 9	595	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(18)|ovary(4)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	59			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGGAAGGTGCGCGCAGTGGAC	0.692																																					Melanoma(55;1800 1972 14909)												0													60.0	67.0	64.0					5																	140229864		2196	4267	6463	SO:0001583	missense	0			AF152487	CCDS54920.1	5q31	2010-11-26				ENSG00000204961		"""Cadherins / Protocadherins : Clustered"""	8675	other	complex locus constituent	"""KIAA0345-like 5"""	606315				10380929	Standard	NM_031857		Approved	KIAA0345, PCDH-ALPHA9		Q9Y5H5		ENST00000532602.1:c.1784G>A	5.37:g.140229864G>A	ENSP00000436042:p.Arg595His		O15053|Q2M3S5	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.R595H	ENST00000532602.1	37	c.1784	CCDS54920.1	5	.	.	.	.	.	.	.	.	.	.	G	9.761	1.169963	0.21621	.	.	ENSG00000204961	ENST00000532602;ENST00000378122	T;T	0.52526	0.66;0.66	3.36	2.49	0.30216	Cadherin (4);Cadherin-like (1);	0.000000	0.31660	U	0.007279	T	0.56891	0.2016	L	0.54908	1.71	0.23440	N	0.997671	P;D	0.89917	0.589;1.0	B;D	0.87578	0.235;0.998	T	0.42396	-0.9454	10	0.66056	D	0.02	.	5.3705	0.16136	0.0996:0.0:0.542:0.3585	.	595;595	Q9Y5H5;Q9Y5H5-2	PCDA9_HUMAN;.	H	595	ENSP00000436042:R595H;ENSP00000367362:R595H	ENSP00000367362:R595H	R	+	2	0	PCDHA9	140210048	0.000000	0.05858	1.000000	0.80357	0.287000	0.27160	0.091000	0.15046	0.727000	0.32360	-0.649000	0.03915	CGC	PCDHA9	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000204961		0.692	PCDHA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA9	HGNC	protein_coding	OTTHUMT00000372896.2	-	0.00	41	0	G	NM_031857		140229864	+1	tier1	-	no_errors	ENST00000532602	ensembl	human	known	74_37	missense	45.83	13	11	SNP	1.000	A
PCDHGA9	56107	genome.wustl.edu	37	5	140782780	140782780	+	Silent	SNP	G	G	A			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr5:140782780G>A	ENST00000573521.1	+	1	261	c.261G>A	c.(259-261)gcG>gcA	p.A87A	PCDHGA4_ENST00000571252.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA1_ENST00000517417.1_Intron	NM_018921.2|NM_032089.1	NP_061744.1|NP_114478.1	Q9Y5G4	PCDG9_HUMAN	protocadherin gamma subfamily A, 9	87	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)			endometrium(1)|kidney(1)|lung(3)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGGTCACCGCGGGTAGGATAG	0.592																																																	0													51.0	58.0	56.0					5																	140782780		2022	4208	6230	SO:0001819	synonymous_variant	0			AF152516	CCDS58981.1, CCDS75341.1	5q31	2010-01-26						"""Cadherins / Protocadherins : Clustered"""	8707	other	protocadherin		606296				10380929	Standard	NM_018921		Approved	PCDH-GAMMA-A9		Q9Y5G4		ENST00000573521.1:c.261G>A	5.37:g.140782780G>A			A2RU65|Q9Y5C9	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.A87	ENST00000573521.1	37	c.261	CCDS58981.1	5																																																																																			PCDHGA9	-	pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	ENSG00000261934		0.592	PCDHGA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGA9	HGNC	protein_coding	OTTHUMT00000437105.1	-	0.00	51	0	G	NM_018921		140782780	+1	tier1	-	no_errors	ENST00000573521	ensembl	human	known	74_37	silent	30.56	25	11	SNP	0.954	A
PDE1C	5137	genome.wustl.edu	37	7	32249105	32249105	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr7:32249105G>T	ENST00000396193.1	-	2	725	c.132C>A	c.(130-132)ttC>ttA	p.F44L		NM_001191058.1	NP_001177987.1	Q14123	PDE1C_HUMAN	phosphodiesterase 1C, calmodulin-dependent 70kDa	0					activation of phospholipase C activity (GO:0007202)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|metabolic process (GO:0008152)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)	cytosol (GO:0005829)	calmodulin-dependent cyclic-nucleotide phosphodiesterase activity (GO:0004117)|metal ion binding (GO:0046872)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(38)|prostate(4)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	81			GBM - Glioblastoma multiforme(11;0.216)		Caffeine(DB00201)	ACTCACGAGAGAAGCGGGCCA	0.418																																																	0													10.0	10.0	10.0					7																	32249105		875	1989	2864	SO:0001583	missense	0			U40371	CCDS5437.1, CCDS55099.1, CCDS55100.1	7p15.1-p14.3	2008-05-15	2002-08-29		ENSG00000154678	ENSG00000154678	3.1.4.17	"""Phosphodiesterases"""	8776	protein-coding gene	gene with protein product		602987	"""phosphodiesterase 1C, calmodulin-dependent (70kD)"""			8557689	Standard	XM_005249769		Approved	Hcam3	uc003tco.2	Q14123	OTTHUMG00000023836	ENST00000396193.1:c.132C>A	7.37:g.32249105G>T	ENSP00000379496:p.Phe44Leu		B3KPC6|E9PE92|Q14124|Q8NB10	Missense_Mutation	SNP	pfam_PDEase_catalytic_dom,pfam_PDEase_N,smart_HD/PDEase_dom,prints_PDEase	p.F44L	ENST00000396193.1	37	c.132	CCDS55100.1	7	.	.	.	.	.	.	.	.	.	.	G	19.05	3.751117	0.69533	.	.	ENSG00000154678	ENST00000396193	T	0.74106	-0.81	5.04	3.24	0.37175	.	7739.210000	0.00166	N	0.000000	T	0.74129	0.3676	N	0.14661	0.345	0.80722	D	1	P	0.49447	0.924	P	0.57776	0.827	T	0.61417	-0.7067	10	0.49607	T	0.09	.	7.3576	0.26727	0.1957:0.0:0.8043:0.0	.	44	E9PE92	.	L	44	ENSP00000379496:F44L	ENSP00000379496:F44L	F	-	3	2	PDE1C	32215630	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	0.649000	0.24843	0.720000	0.32209	0.655000	0.94253	TTC	PDE1C	-	NULL	ENSG00000154678		0.418	PDE1C-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	PDE1C	HGNC	protein_coding	OTTHUMT00000215075.1	-	0.00	39	0	G			32249105	-1	tier1	-	no_errors	ENST00000396193	ensembl	human	novel	74_37	missense	17.39	19	4	SNP	1.000	T
PCLO	27445	genome.wustl.edu	37	7	82579102	82579102	+	Nonsense_Mutation	SNP	G	G	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr7:82579102G>T	ENST00000333891.9	-	6	11139	c.10802C>A	c.(10801-10803)tCa>tAa	p.S3601*	PCLO_ENST00000437081.1_Nonsense_Mutation_p.S321*|PCLO_ENST00000423517.2_Nonsense_Mutation_p.S3601*	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein											breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						GAGGTGAGATGAATAACCAAT	0.488																																																	0													125.0	122.0	123.0					7																	82579102		2065	4218	6283	SO:0001587	stop_gained	0			AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.10802C>A	7.37:g.82579102G>T	ENSP00000334319:p.Ser3601*			Nonsense_Mutation	SNP	pfam_Znf_piccolo,pfam_C2_dom,pfam_PDZ,superfamily_C2_dom,superfamily_PDZ,superfamily_Znf_FYVE_PHD,smart_PDZ,smart_C2_dom,pfscan_C2_dom,pfscan_PDZ	p.S3601*	ENST00000333891.9	37	c.10802	CCDS47630.1	7	.	.	.	.	.	.	.	.	.	.	G	36	5.711988	0.96830	.	.	ENSG00000186472	ENST00000431819;ENST00000333891;ENST00000423517;ENST00000437081	.	.	.	5.62	5.62	0.85841	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	19.6592	0.95857	0.0:0.0:1.0:0.0	.	.	.	.	X	3532;3601;3601;321	.	ENSP00000334319:S3601X	S	-	2	0	PCLO	82417038	1.000000	0.71417	0.996000	0.52242	0.981000	0.71138	5.225000	0.65294	2.651000	0.90000	0.585000	0.79938	TCA	PCLO	-	NULL	ENSG00000186472		0.488	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	PCLO	HGNC	protein_coding	OTTHUMT00000337368.5	-	0.00	57	0	G	NM_014510		82579102	-1	tier1	-	no_errors	ENST00000333891	ensembl	human	known	74_37	nonsense	12.50	28	4	SNP	0.998	T
PDZD2	23037	genome.wustl.edu	37	5	32108223	32108223	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr5:32108223G>T	ENST00000438447.1	+	25	8890	c.8502G>T	c.(8500-8502)aaG>aaT	p.K2834N	CTD-2152M20.2_ENST00000503441.1_RNA|PDZD2_ENST00000513490.1_3'UTR|PDZD2_ENST00000282493.3_Missense_Mutation_p.K2834N			O15018	PDZD2_HUMAN	PDZ domain containing 2	2834	PDZ 6. {ECO:0000255|PROSITE- ProRule:PRU00143}.				cell adhesion (GO:0007155)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|nucleus (GO:0005634)				NS(2)|breast(4)|central_nervous_system(5)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(31)|lung(58)|ovary(6)|prostate(2)|skin(8)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	148						TAATTAGAAAGCATAGGAATT	0.363																																																	0													76.0	79.0	78.0					5																	32108223		2203	4300	6503	SO:0001583	missense	0			AB002298	CCDS34137.1	5p14.1	2008-02-05	2006-01-24	2006-01-24		ENSG00000133401			18486	protein-coding gene	gene with protein product		610697	"""PDZ domain containing 3"""	PDZK3		9205841	Standard	XM_005248271		Approved	KIAA0300	uc003jhm.3	O15018		ENST00000438447.1:c.8502G>T	5.37:g.32108223G>T	ENSP00000402033:p.Lys2834Asn		Q9BXD4	Missense_Mutation	SNP	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.K2834N	ENST00000438447.1	37	c.8502	CCDS34137.1	5	.	.	.	.	.	.	.	.	.	.	G	20.5	4.006479	0.74932	.	.	ENSG00000133401	ENST00000438447;ENST00000382161;ENST00000282493	T;T	0.39406	1.08;1.08	5.75	5.75	0.90469	PDZ/DHR/GLGF (3);	0.000000	0.64402	D	0.000020	T	0.65333	0.2681	M	0.72479	2.2	0.40261	D	0.978175	D	0.89917	1.0	D	0.87578	0.998	T	0.67237	-0.5721	10	0.62326	D	0.03	.	17.4372	0.87555	0.0:0.0:1.0:0.0	.	2834	O15018	PDZD2_HUMAN	N	2834;2635;2834	ENSP00000402033:K2834N;ENSP00000282493:K2834N	ENSP00000282493:K2834N	K	+	3	2	PDZD2	32143980	1.000000	0.71417	1.000000	0.80357	0.897000	0.52465	3.354000	0.52254	2.710000	0.92621	0.563000	0.77884	AAG	PDZD2	-	superfamily_PDZ,smart_PDZ,pfscan_PDZ	ENSG00000133401		0.363	PDZD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDZD2	HGNC	protein_coding	OTTHUMT00000366608.1	-	0.00	77	0	G			32108223	+1	tier1	-	no_errors	ENST00000282493	ensembl	human	known	74_37	missense	7.27	51	4	SNP	1.000	T
PEX5L	51555	genome.wustl.edu	37	3	179525562	179525562	+	Nonsense_Mutation	SNP	C	C	A			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr3:179525562C>A	ENST00000467460.1	-	14	1906	c.1576G>T	c.(1576-1578)Gaa>Taa	p.E526*	PEX5L_ENST00000465751.1_Nonsense_Mutation_p.E502*|PEX5L_ENST00000467440.2_5'UTR|PEX5L_ENST00000464614.1_Nonsense_Mutation_p.E418*|PEX5L_ENST00000485199.1_Nonsense_Mutation_p.E491*|PEX5L_ENST00000263962.8_Nonsense_Mutation_p.E524*|PEX5L_ENST00000472994.1_Nonsense_Mutation_p.E467*|PEX5L_ENST00000476138.1_Nonsense_Mutation_p.E483*|PEX5L_ENST00000392649.3_Nonsense_Mutation_p.E418*|PEX5L_ENST00000468741.1_Nonsense_Mutation_p.E334*	NM_001256751.1|NM_016559.2	NP_001243680.1|NP_057643.1	Q8IYB4	PEX5R_HUMAN	peroxisomal biogenesis factor 5-like	526					maintenance of protein location (GO:0045185)|protein import into peroxisome matrix (GO:0016558)|protein import into peroxisome matrix, docking (GO:0016560)|regulation of cAMP-mediated signaling (GO:0043949)|regulation of membrane potential (GO:0042391)	cytosol (GO:0005829)|dendrite (GO:0030425)|peroxisomal membrane (GO:0005778)|receptor complex (GO:0043235)	peroxisome matrix targeting signal-1 binding (GO:0005052)|peroxisome targeting sequence binding (GO:0000268)|small GTPase binding (GO:0031267)	p.E526K(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(23)|ovary(3)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49	all_cancers(143;3.94e-14)|Ovarian(172;0.0338)|Breast(254;0.183)		OV - Ovarian serous cystadenocarcinoma(80;1.75e-26)|GBM - Glioblastoma multiforme(14;0.000518)			TCCACGGCTTCCTCGCTGCGG	0.542																																																	1	Substitution - Missense(1)	lung(1)											135.0	140.0	138.0					3																	179525562		2203	4300	6503	SO:0001587	stop_gained	0			AJ245503	CCDS3236.1, CCDS58861.1, CCDS58862.1, CCDS58863.1, CCDS58864.1, CCDS58865.1, CCDS58866.1, CCDS58867.1	3q27.1	2013-01-10			ENSG00000114757	ENSG00000114757		"""Tetratricopeptide (TTC) repeat domain containing"""	30024	protein-coding gene	gene with protein product		611058				11463335	Standard	NM_016559		Approved	PEX5R, PXR2	uc003fki.2	Q8IYB4	OTTHUMG00000157363	ENST00000467460.1:c.1576G>T	3.37:g.179525562C>A	ENSP00000419975:p.Glu526*		B7Z2A5|B7Z305|B7Z318|B7Z5Z5|B7Z8P2|E7EUV8|E7EUZ0|E9PEC1|E9PH97|Q9NQD1|Q9P2U3|Q9P2U4	Nonsense_Mutation	SNP	pfam_TPR_1,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.E526*	ENST00000467460.1	37	c.1576	CCDS3236.1	3	.	.	.	.	.	.	.	.	.	.	C	37	6.298002	0.97453	.	.	ENSG00000114757	ENST00000467460;ENST00000263962;ENST00000485199;ENST00000382596;ENST00000392649;ENST00000468741;ENST00000476138;ENST00000467440;ENST00000472994;ENST00000464614;ENST00000465751	.	.	.	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-27.0475	20.6525	0.99598	0.0:1.0:0.0:0.0	.	.	.	.	X	526;524;491;524;418;334;483;414;467;418;502	.	ENSP00000263962:E524X	E	-	1	0	PEX5L	181008256	1.000000	0.71417	1.000000	0.80357	0.852000	0.48524	7.747000	0.85070	2.890000	0.99128	0.585000	0.79938	GAA	PEX5L	-	pfam_TPR_1,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	ENSG00000114757		0.542	PEX5L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PEX5L	HGNC	protein_coding	OTTHUMT00000348577.1		0.00	53	0	C	NM_016559		179525562	-1			no_errors	ENST00000467460	ensembl	human	known	74_37	nonsense	5.00	38	2	SNP	1.000	A
PHF20	51230	genome.wustl.edu	37	20	34459023	34459023	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr20:34459023G>T	ENST00000374012.3	+	8	1198	c.1069G>T	c.(1069-1071)Gac>Tac	p.D357Y	PHF20_ENST00000439301.1_3'UTR|PHF20_ENST00000481202.1_3'UTR			Q9BVI0	PHF20_HUMAN	PHD finger protein 20	357					chromatin organization (GO:0006325)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|MLL1 complex (GO:0071339)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(5)|endometrium(1)|kidney(7)|large_intestine(6)|lung(11)|ovary(3)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	39	Breast(12;0.00631)|all_lung(11;0.0145)					TCCTTTGCAAGACACGTTGTC	0.448																																																	0													184.0	163.0	170.0					20																	34459023		2203	4300	6503	SO:0001583	missense	0			AL109965	CCDS13268.1	20q11.22-q11.23	2013-01-28	2004-12-01	2004-12-01	ENSG00000025293	ENSG00000025293		"""Tudor domain containing"", ""Zinc fingers, PHD-type"""	16098	protein-coding gene	gene with protein product	"""tudor domain containing 20A"""	610335	"""chromosome 20 open reading frame 104"""	C20orf104			Standard	NM_016436		Approved	dJ1121G12.1, TDRD20A	uc002xek.1	Q9BVI0	OTTHUMG00000032367	ENST00000374012.3:c.1069G>T	20.37:g.34459023G>T	ENSP00000363124:p.Asp357Tyr		A7E235|B2RB56|E1P5S3|Q566Q2|Q5JWY9|Q66K49|Q9BWV4|Q9BXA3|Q9BZW3|Q9H421|Q9H4J6|Q9NZ22	Missense_Mutation	SNP	pfam_DUF3776,pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Tudor,smart_Znf_PHD,pfscan_Znf_C2H2	p.D357Y	ENST00000374012.3	37	c.1069	CCDS13268.1	20	.	.	.	.	.	.	.	.	.	.	G	15.78	2.934888	0.52866	.	.	ENSG00000025293	ENST00000374012;ENST00000339089;ENST00000374000	T;T;T	0.50813	1.34;0.73;0.73	5.41	3.31	0.37934	.	0.845571	0.10743	N	0.639259	T	0.47544	0.1451	L	0.47716	1.5	0.22684	N	0.99885	P;D	0.56287	0.799;0.975	B;P	0.50659	0.425;0.647	T	0.34700	-0.9818	10	0.66056	D	0.02	.	4.8146	0.13360	0.1372:0.2242:0.6386:0.0	.	357;357	Q9BVI0;Q66K49	PHF20_HUMAN;.	Y	357	ENSP00000363124:D357Y;ENSP00000341900:D357Y;ENSP00000363112:D357Y	ENSP00000341900:D357Y	D	+	1	0	PHF20	33922437	1.000000	0.71417	0.528000	0.27938	0.937000	0.57800	2.243000	0.43115	0.499000	0.27970	0.591000	0.81541	GAC	PHF20	-	NULL	ENSG00000025293		0.448	PHF20-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PHF20	HGNC	protein_coding	OTTHUMT00000078949.2	-	0.00	112	0	G	NM_016436		34459023	+1	tier1	-	no_errors	ENST00000374012	ensembl	human	known	74_37	missense	5.71	66	4	SNP	0.029	T
PHLDB2	90102	genome.wustl.edu	37	3	111603841	111603841	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr3:111603841C>T	ENST00000431670.2	+	2	1328	c.917C>T	c.(916-918)tCt>tTt	p.S306F	PHLDB2_ENST00000412622.1_Missense_Mutation_p.S306F|PHLDB2_ENST00000393923.3_Missense_Mutation_p.S333F|PHLDB2_ENST00000477695.1_Missense_Mutation_p.S306F|PHLDB2_ENST00000478922.1_Missense_Mutation_p.S306F|PHLDB2_ENST00000481953.1_Missense_Mutation_p.S306F|PHLDB2_ENST00000393925.3_Missense_Mutation_p.S306F	NM_001134438.1	NP_001127910.1	Q86SQ0	PHLB2_HUMAN	pleckstrin homology-like domain, family B, member 2	306						cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(7)|large_intestine(8)|lung(23)|ovary(6)|skin(7)|stomach(1)	55						AATTTTTCTTCTTTGAGCTCA	0.448																																																	0													70.0	74.0	73.0					3																	111603841		2203	4300	6503	SO:0001583	missense	0				CCDS2962.1, CCDS46885.1, CCDS46886.1	3q13.13	2013-01-10			ENSG00000144824	ENSG00000144824		"""Pleckstrin homology (PH) domain containing"""	29573	protein-coding gene	gene with protein product		610298				12376540	Standard	NM_145753		Approved	LL5beta, FLJ21791, LL5b	uc003dyg.3	Q86SQ0	OTTHUMG00000159282	ENST00000431670.2:c.917C>T	3.37:g.111603841C>T	ENSP00000405405:p.Ser306Phe		A5PKZ3|Q59EA8|Q68CY3|Q6NT98|Q8N8U8|Q8NAB1|Q8NCU5	Missense_Mutation	SNP	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.S306F	ENST00000431670.2	37	c.917	CCDS46886.1	3	.	.	.	.	.	.	.	.	.	.	C	20.1	3.936105	0.73442	.	.	ENSG00000144824	ENST00000359729;ENST00000393923;ENST00000431670;ENST00000412622;ENST00000498699;ENST00000478922;ENST00000477695;ENST00000393925;ENST00000481953	T;T;T;T;T;T	0.47177	0.91;0.95;0.93;0.85;0.95;0.93	5.61	5.61	0.85477	.	0.057876	0.64402	D	0.000001	T	0.67933	0.2946	M	0.68593	2.085	0.44660	D	0.997645	D;D;D;D;D	0.89917	0.996;1.0;1.0;0.998;0.998	P;D;D;D;P	0.91635	0.804;0.999;0.999;0.935;0.904	T	0.69098	-0.5235	10	0.72032	D	0.01	.	16.9138	0.86146	0.0:1.0:0.0:0.0	.	306;306;306;306;333	Q86SQ0;G5E9V3;E9PDY7;Q86SQ0-2;Q86SQ0-3	PHLB2_HUMAN;.;.;.;.	F	333;333;306;306;306;306;306;306;306	ENSP00000377500:S333F;ENSP00000405405:S306F;ENSP00000405292:S306F;ENSP00000418296:S306F;ENSP00000377502:S306F;ENSP00000418319:S306F	ENSP00000352764:S333F	S	+	2	0	PHLDB2	113086531	1.000000	0.71417	0.998000	0.56505	0.998000	0.95712	5.068000	0.64364	2.813000	0.96785	0.655000	0.94253	TCT	PHLDB2	-	NULL	ENSG00000144824		0.448	PHLDB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHLDB2	HGNC	protein_coding	OTTHUMT00000354337.1		0.00	51	0	C	NM_145753		111603841	+1			no_errors	ENST00000393925	ensembl	human	known	74_37	missense	7.14	26	2	SNP	0.998	T
PKHD1L1	93035	genome.wustl.edu	37	8	110439330	110439330	+	Missense_Mutation	SNP	G	G	T	rs367893430		TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr8:110439330G>T	ENST00000378402.5	+	25	3049	c.2945G>T	c.(2944-2946)gGc>gTc	p.G982V		NM_177531.4	NP_803875.2	Q86WI1	PKHL1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1	982					immune response (GO:0006955)	cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			NS(4)|breast(13)|central_nervous_system(6)|cervix(1)|endometrium(19)|kidney(17)|large_intestine(34)|lung(122)|ovary(11)|pancreas(3)|prostate(9)|skin(3)|stomach(4)|upper_aerodigestive_tract(13)|urinary_tract(4)	263			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			ACCTGTGCTGGCTACGCGTGG	0.517										HNSCC(38;0.096)																																							0								G	VAL/GLY	0,3886		0,0,1943	68.0	71.0	70.0		2945	4.6	0.8	8		70	1,8319		0,1,4159	no	missense	PKHD1L1	NM_177531.4	109	0,1,6102	TT,TG,GG		0.012,0.0,0.0082	benign	982/4244	110439330	1,12205	1943	4160	6103	SO:0001583	missense	0			AY219181	CCDS47911.1	8q23	2003-03-28			ENSG00000205038	ENSG00000205038			20313	protein-coding gene	gene with protein product		607843				12620974	Standard	NM_177531		Approved		uc003yne.3	Q86WI1	OTTHUMG00000164934	ENST00000378402.5:c.2945G>T	8.37:g.110439330G>T	ENSP00000367655:p.Gly982Val		Q567P2|Q9UF27	Missense_Mutation	SNP	pfam_IPT,pfam_G8_domain,pfam_PA14,superfamily_Ig_E-set,superfamily_Pectin_lyase_fold/virulence,superfamily_Cupredoxin,smart_IPT,smart_PA14,smart_PbH1	p.G982V	ENST00000378402.5	37	c.2945	CCDS47911.1	8	.	.	.	.	.	.	.	.	.	.	G	11.46	1.645910	0.29246	0.0	1.2E-4	ENSG00000205038	ENST00000378402	D	0.87887	-2.31	5.45	4.55	0.56014	.	0.465045	0.18859	N	0.129186	D	0.91294	0.7255	M	0.66939	2.045	0.49798	D	0.999822	D	0.69078	0.997	D	0.63597	0.916	D	0.91035	0.4867	10	0.62326	D	0.03	.	12.0081	0.53272	0.0:0.1743:0.8257:0.0	.	982	Q86WI1	PKHL1_HUMAN	V	982	ENSP00000367655:G982V	ENSP00000367655:G982V	G	+	2	0	PKHD1L1	110508506	0.999000	0.42202	0.835000	0.33067	0.095000	0.18619	3.633000	0.54295	1.237000	0.43756	0.591000	0.81541	GGC	PKHD1L1	-	NULL	ENSG00000205038		0.517	PKHD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PKHD1L1	HGNC	protein_coding	OTTHUMT00000381017.1	-	0.00	73	0	G	NM_177531		110439330	+1	tier1	-	no_errors	ENST00000378402	ensembl	human	known	74_37	missense	5.63	67	4	SNP	0.938	T
PKP1	5317	genome.wustl.edu	37	1	201297936	201297936	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr1:201297936G>T	ENST00000352845.3	+	14	2216	c.2216G>T	c.(2215-2217)aGc>aTc	p.S739I	PKP1_ENST00000263946.3_Missense_Mutation_p.S739I|PKP1_ENST00000367324.3_Missense_Mutation_p.S718I			Q13835	PKP1_HUMAN	plakophilin 1	739					apoptotic process (GO:0006915)|cell adhesion (GO:0007155)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|intermediate filament bundle assembly (GO:0045110)|multicellular organismal development (GO:0007275)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)	desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	intermediate filament binding (GO:0019215)|lamin binding (GO:0005521)|signal transducer activity (GO:0004871)|structural constituent of epidermis (GO:0030280)			NS(2)|breast(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(4)|ovary(5)|prostate(1)	22						GGGGCCAACAGCCTCAGGAAC	0.522																																																	0													179.0	169.0	172.0					1																	201297936		2203	4300	6503	SO:0001583	missense	0			X79293	CCDS30966.1, CCDS30967.1	1q32	2014-06-18	2014-06-18		ENSG00000081277	ENSG00000081277		"""Armadillo repeat containing"""	9023	protein-coding gene	gene with protein product	"""ectodermal dysplasia/skin fragility syndrome"""	601975	"""plakophilin 1 (ectodermal dysplasia/skin fragility syndrome)"""			9272178	Standard	NM_001005337		Approved	B6P	uc001gwd.3	Q13835	OTTHUMG00000035729	ENST00000352845.3:c.2216G>T	1.37:g.201297936G>T	ENSP00000295597:p.Ser739Ile		O00645|Q14CA0|Q15152	Missense_Mutation	SNP	pfam_Armadillo,superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo	p.S739I	ENST00000352845.3	37	c.2216	CCDS30966.1	1	.	.	.	.	.	.	.	.	.	.	G	13.94	2.387385	0.42308	.	.	ENSG00000081277	ENST00000367324;ENST00000263946;ENST00000352845	T;T;T	0.74526	-0.85;-0.76;-0.76	4.52	0.645	0.17782	.	0.694139	0.14375	N	0.323510	T	0.48021	0.1477	N	0.08118	0	0.24856	N	0.992373	B;B;B	0.16396	0.002;0.005;0.017	B;B;B	0.16289	0.008;0.015;0.006	T	0.41088	-0.9528	10	0.87932	D	0	-21.7456	2.2818	0.04116	0.163:0.3992:0.3086:0.1292	.	326;718;739	Q14BN3;Q13835-2;Q13835	.;.;PKP1_HUMAN	I	718;739;739	ENSP00000356293:S718I;ENSP00000263946:S739I;ENSP00000295597:S739I	ENSP00000263946:S739I	S	+	2	0	PKP1	199564559	0.995000	0.38212	0.999000	0.59377	0.997000	0.91878	1.687000	0.37680	0.677000	0.31305	0.511000	0.50034	AGC	PKP1	-	NULL	ENSG00000081277		0.522	PKP1-004	KNOWN	basic|CCDS	protein_coding	PKP1	HGNC	protein_coding	OTTHUMT00000086897.1		0.00	134	0	G	NM_000299		201297936	+1			no_errors	ENST00000263946	ensembl	human	known	74_37	missense	6.90	54	4	SNP	0.991	T
PKP4	8502	genome.wustl.edu	37	2	159314668	159314668	+	Intron	SNP	C	C	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr2:159314668C>T	ENST00000389759.3	+	1	107				CCDC148_ENST00000491563.1_5'Flank|CCDC148_ENST00000536771.1_5'Flank|CCDC148_ENST00000283233.5_5'Flank|CCDC148_ENST00000409889.1_5'Flank|PKP4_ENST00000389757.3_Intron	NM_003628.3	NP_003619.2	Q99569	PKP4_HUMAN	plakophilin 4						cell-cell junction assembly (GO:0007043)|cell-cell signaling (GO:0007267)|positive regulation of cytokinesis (GO:0032467)|positive regulation of gene expression (GO:0010628)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell adhesion (GO:0030155)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytoskeleton (GO:0005856)|desmosome (GO:0030057)|midbody (GO:0030496)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|spindle midzone (GO:0051233)|spindle pole (GO:0000922)				breast(2)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(9)|lung(21)|ovary(6)|skin(5)|upper_aerodigestive_tract(6)|urinary_tract(1)	61						GGGGGACGCGCGCTGCCGGCT	0.721										HNSCC(62;0.18)																																							0																																										SO:0001627	intron_variant	0			X81889	CCDS33305.1, CCDS33306.1	2q24.1	2013-02-14			ENSG00000144283	ENSG00000144283		"""Armadillo repeat containing"""	9026	protein-coding gene	gene with protein product		604276				9342840, 8937994	Standard	NM_003628		Approved	p0071	uc002tzv.3	Q99569	OTTHUMG00000153969	ENST00000389759.3:c.-6+938C>T	2.37:g.159314668C>T			Q86W91	RNA	SNP	-	NULL	ENST00000389759.3	37	NULL	CCDS33305.1	2																																																																																			PKP4	-	-	ENSG00000144283		0.721	PKP4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PKP4	HGNC	protein_coding	OTTHUMT00000333250.1	-	0.00	22	0	C			159314668	+1	tier1	-	no_errors	ENST00000479398	ensembl	human	known	74_37	rna	50.00	5	5	SNP	0.287	T
PLCD4	84812	genome.wustl.edu	37	2	219492940	219492940	+	Nonsense_Mutation	SNP	G	G	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr2:219492940G>T	ENST00000450993.2	+	7	1300	c.961G>T	c.(961-963)Gag>Tag	p.E321*	PLCD4_ENST00000432688.1_Nonsense_Mutation_p.E321*|PLCD4_ENST00000417849.1_Nonsense_Mutation_p.E321*	NM_032726.3	NP_116115.1	Q9BRC7	PLCD4_HUMAN	phospholipase C, delta 4	321	PI-PLC X-box. {ECO:0000255|PROSITE- ProRule:PRU00270}.				acrosome reaction (GO:0007340)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|phosphatidylinositol metabolic process (GO:0046488)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|phosphatidylinositol phospholipase C activity (GO:0004435)|signal transducer activity (GO:0004871)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(2)|lung(7)|ovary(3)|prostate(1)|urinary_tract(3)	23		Renal(207;0.0915)		Epithelial(149;5.11e-07)|all cancers(144;0.000104)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)		GAGCAGCGTCGAGGGATATAT	0.507																																																	0													133.0	127.0	129.0					2																	219492940		2034	4184	6218	SO:0001587	stop_gained	0			AI366170	CCDS46516.1	2q35	2013-01-10			ENSG00000115556	ENSG00000115556	3.1.4.11	"""EF-hand domain containing"""	9062	protein-coding gene	gene with protein product		605939				10702683, 9056492	Standard	NM_032726		Approved		uc021vwx.1	Q9BRC7	OTTHUMG00000154743	ENST00000450993.2:c.961G>T	2.37:g.219492940G>T	ENSP00000388631:p.Glu321*		Q53FS8	Nonsense_Mutation	SNP	pfam_PLipase_C_PInositol-sp_X_dom,pfam_PLipase_C_Pinositol-sp_Y,pfam_PLipase_C_EF-hand-like,pfam_C2_dom,superfamily_PLC-like_Pdiesterase_TIM-brl,superfamily_C2_dom,smart_Pleckstrin_homology,smart_EF_hand_dom,smart_PLipase_C_PInositol-sp_X_dom,smart_PLipase_C_Pinositol-sp_Y,smart_C2_dom,pfscan_EF_hand_dom,pfscan_C2_dom,pfscan_Pleckstrin_homology,pfscan_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_Pinositol-sp_Y,prints_Pinositol_PLipase_C	p.E321*	ENST00000450993.2	37	c.961	CCDS46516.1	2	.	.	.	.	.	.	.	.	.	.	G	39	7.767657	0.98477	.	.	ENSG00000115556	ENST00000450993;ENST00000251959;ENST00000417849;ENST00000432688	.	.	.	4.7	4.7	0.59300	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	17.467	0.87635	0.0:0.0:1.0:0.0	.	.	.	.	X	321	.	ENSP00000251959:E321X	E	+	1	0	PLCD4	219201184	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.594000	0.98254	2.438000	0.82558	0.557000	0.71058	GAG	PLCD4	-	pfam_PLipase_C_PInositol-sp_X_dom,superfamily_PLC-like_Pdiesterase_TIM-brl,smart_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_PInositol-sp_X_dom,prints_Pinositol_PLipase_C	ENSG00000115556		0.507	PLCD4-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	PLCD4	HGNC	protein_coding	OTTHUMT00000336876.1	-	0.00	97	0	G			219492940	+1	tier1	-	no_errors	ENST00000417849	ensembl	human	known	74_37	nonsense	5.41	70	4	SNP	1.000	T
PLCE1	51196	genome.wustl.edu	37	10	96022423	96022423	+	Silent	SNP	C	C	G			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr10:96022423C>G	ENST00000371380.3	+	13	4222	c.3987C>G	c.(3985-3987)ctC>ctG	p.L1329L	PLCE1_ENST00000371385.3_Silent_p.L1021L|PLCE1_ENST00000260766.3_Silent_p.L1329L|PLCE1_ENST00000371375.1_Silent_p.L1021L			Q9P212	PLCE1_HUMAN	phospholipase C, epsilon 1	1329					activation of MAPK activity (GO:0000187)|calcium-mediated signaling (GO:0019722)|cell proliferation (GO:0008283)|cytoskeleton organization (GO:0007010)|diacylglycerol biosynthetic process (GO:0006651)|epidermal growth factor receptor signaling pathway (GO:0007173)|glomerulus development (GO:0032835)|heart development (GO:0007507)|inositol phosphate metabolic process (GO:0043647)|inositol phosphate-mediated signaling (GO:0048016)|lipid catabolic process (GO:0016042)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|phospholipid metabolic process (GO:0006644)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of GTPase activity (GO:0043547)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|Ras protein signal transduction (GO:0007265)|regulation of cell growth (GO:0001558)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|regulation of protein kinase activity (GO:0045859)|regulation of Ras protein signal transduction (GO:0046578)|regulation of smooth muscle contraction (GO:0006940)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|enzyme binding (GO:0019899)|guanyl-nucleotide exchange factor activity (GO:0005085)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|Ras GTPase binding (GO:0017016)|receptor signaling protein activity (GO:0005057)			liver(1)|ovary(2)|skin(4)|upper_aerodigestive_tract(1)	8		Colorectal(252;0.0458)				TACTTCAGCTCAACGATTTCC	0.478																																																	0													195.0	191.0	193.0					10																	96022423		2008	4184	6192	SO:0001819	synonymous_variant	0				CCDS41552.1, CCDS53555.1	10q23	2010-02-22			ENSG00000138193	ENSG00000138193	3.1.4.11		17175	protein-coding gene	gene with protein product	"""nephrosis type 3"""	608414				11022047, 11022048	Standard	NM_016341		Approved	KIAA1516, PLCE, NPHS3	uc001kjk.3	Q9P212	OTTHUMG00000018789	ENST00000371380.3:c.3987C>G	10.37:g.96022423C>G			A6NGW0|A6NLA1|A7MBN7|A8K1D7|B9EIJ6|Q1X6H8|Q5VWL4|Q5VWL5|Q9H9X8|Q9HBX6|Q9HC53|Q9UHV3	Silent	SNP	pfam_PLipase_C_PInositol-sp_X_dom,pfam_PLipase_C_Pinositol-sp_Y,pfam_Ras-assoc,pfam_RasGRF_CDC25,pfam_PLipase_C_EF-hand-like,pfam_C2_dom,superfamily_PLC-like_Pdiesterase_TIM-brl,superfamily_Ras_GEF_dom,superfamily_C2_dom,smart_RasGRF_CDC25,smart_PLipase_C_PInositol-sp_X_dom,smart_PLipase_C_Pinositol-sp_Y,smart_C2_dom,smart_Ras-assoc,pfscan_C2_dom,pfscan_Ras-assoc,pfscan_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_Pinositol-sp_Y,pfscan_RasGRF_CDC25,prints_Pinositol_PLipase_C	p.L1329	ENST00000371380.3	37	c.3987	CCDS41552.1	10																																																																																			PLCE1	-	pfam_PLipase_C_EF-hand-like	ENSG00000138193		0.478	PLCE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PLCE1	HGNC	protein_coding	OTTHUMT00000049469.3	-	0.00	67	0	C	NM_016341		96022423	+1	tier1	-	no_errors	ENST00000260766	ensembl	human	known	74_37	silent	20.34	46	12	SNP	1.000	G
PLEC	5339	genome.wustl.edu	37	8	145004664	145004664	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr8:145004664G>A	ENST00000322810.4	-	20	2925	c.2756C>T	c.(2755-2757)tCa>tTa	p.S919L	PLEC_ENST00000354589.3_Missense_Mutation_p.S782L|PLEC_ENST00000357649.2_Missense_Mutation_p.S786L|PLEC_ENST00000436759.2_Missense_Mutation_p.S809L|PLEC_ENST00000345136.3_Missense_Mutation_p.S782L|PLEC_ENST00000356346.3_Missense_Mutation_p.S768L|PLEC_ENST00000527096.1_Missense_Mutation_p.S805L|PLEC_ENST00000354958.2_Missense_Mutation_p.S760L|PLEC_ENST00000398774.2_Missense_Mutation_p.S750L	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	919	Globular 1.				apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						GGCCAGGCCTGAGAGGTGGCC	0.697																																																	0													15.0	20.0	19.0					8																	145004664		1968	4130	6098	SO:0001583	missense	0			U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.2756C>T	8.37:g.145004664G>A	ENSP00000323856:p.Ser919Leu		Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Missense_Mutation	SNP	pfam_Plectin_repeat,pfam_CH-domain,pfam_S10_plectin_N,superfamily_CH-domain,superfamily_Chorismate_mutase_type_II,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Plectin_repeat,pfscan_CH-domain	p.S919L	ENST00000322810.4	37	c.2756	CCDS43772.1	8	.	.	.	.	.	.	.	.	.	.	G	5.098	0.203673	0.09704	.	.	ENSG00000178209	ENST00000345136;ENST00000357649;ENST00000354589;ENST00000398774;ENST00000322810;ENST00000354958;ENST00000356346;ENST00000436759;ENST00000527096	D;D;D;D;D;D;D;D;D	0.94537	-3.45;-3.45;-3.45;-3.45;-3.45;-3.45;-3.45;-3.45;-3.45	3.75	0.63	0.17693	.	1.638050	0.04119	U	0.316050	D	0.87474	0.6186	N	0.11255	0.115	0.09310	N	1	B;B;B;B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0;0.0;0.0;0.0	B;B;B;B;B;B;B;B	0.06405	0.001;0.001;0.001;0.0;0.001;0.002;0.001;0.001	T	0.77688	-0.2494	10	0.54805	T	0.06	.	6.1877	0.20506	0.2938:0.144:0.5622:0.0	.	809;768;760;919;750;782;786;782	Q15149-2;Q15149-9;Q15149-8;Q15149;Q15149-7;Q15149-5;Q15149-6;Q15149-4	.;.;.;PLEC_HUMAN;.;.;.;.	L	782;786;782;750;919;760;768;809;805	ENSP00000344848:S782L;ENSP00000350277:S786L;ENSP00000346602:S782L;ENSP00000381756:S750L;ENSP00000323856:S919L;ENSP00000347044:S760L;ENSP00000348702:S768L;ENSP00000388180:S809L;ENSP00000434583:S805L	ENSP00000323856:S919L	S	-	2	0	PLEC	145076652	0.105000	0.21958	0.020000	0.16555	0.353000	0.29299	1.331000	0.33793	0.287000	0.22375	0.289000	0.19496	TCA	PLEC	-	smart_Spectrin/alpha-actinin	ENSG00000178209		0.697	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEC	HGNC	protein_coding	OTTHUMT00000383281.1	-	0.00	61	0	G	NM_000445		145004664	-1	tier1	-	no_errors	ENST00000322810	ensembl	human	known	74_37	missense	17.39	38	8	SNP	0.017	A
PLK3	1263	genome.wustl.edu	37	1	45270786	45270787	+	Intron	INS	-	-	AAT			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr1:45270786_45270787insAAT	ENST00000372201.4	+	14	1874				PLK3_ENST00000465443.1_Intron	NM_004073.2	NP_004064.2	Q9H4B4	PLK3_HUMAN	polo-like kinase 3						apoptotic process (GO:0006915)|cellular response to DNA damage stimulus (GO:0006974)|cytoplasmic microtubule organization (GO:0031122)|endomitotic cell cycle (GO:0007113)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|Golgi disassembly (GO:0090166)|mitotic cell cycle checkpoint (GO:0007093)|mitotic G1/S transition checkpoint (GO:0044819)|negative regulation of apoptotic process (GO:0043066)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process involved in cellular response to hypoxia (GO:2000777)|protein kinase B signaling (GO:0043491)|protein phosphorylation (GO:0006468)|regulation of cell division (GO:0051302)|regulation of cytokinesis (GO:0032465)|response to osmotic stress (GO:0006970)|response to radiation (GO:0009314)|response to reactive oxygen species (GO:0000302)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|Golgi stack (GO:0005795)|neuronal cell body (GO:0043025)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|p53 binding (GO:0002039)|protein serine/threonine kinase activity (GO:0004674)			endometrium(4)|large_intestine(2)|lung(8)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19	Acute lymphoblastic leukemia(166;0.155)					tcaaaaaaaaaaaataaagaaa	0.505																																																	0																																										SO:0001627	intron_variant	0			AJ293866	CCDS515.1	1p34.1	2013-01-18	2010-06-24	2004-01-28	ENSG00000173846	ENSG00000173846			2154	protein-coding gene	gene with protein product		602913	"""cytokine-inducible kinase"", ""polo-like kinase 3 (Drosophila)"""	CNK		8702627	Standard	NM_004073		Approved	FNK, PRK	uc001cmn.3	Q9H4B4	OTTHUMG00000008491	ENST00000372201.4:c.1636-151->AAT	1.37:g.45270786_45270787insAAT			Q15767|Q5JR99|Q96CV1	RNA	INS	-	NULL	ENST00000372201.4	37	NULL	CCDS515.1	1																																																																																			PLK3	-	-	ENSG00000173846		0.505	PLK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLK3	HGNC	protein_coding	OTTHUMT00000023429.1		0.00	27	0	-	NM_004073		45270787	+1	tier1		no_errors	ENST00000461769	ensembl	human	known	74_37	rna	15.38	11	2	INS	0.003:0.003	AAT
POLR3B	55703	genome.wustl.edu	37	12	106827518	106827518	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr12:106827518G>T	ENST00000228347.4	+	16	1871	c.1649G>T	c.(1648-1650)cGa>cTa	p.R550L	POLR3B_ENST00000539066.1_Missense_Mutation_p.R492L	NM_018082.5	NP_060552.4	Q9NW08	RPC2_HUMAN	polymerase (RNA) III (DNA directed) polypeptide B	550					defense response to virus (GO:0051607)|gene expression (GO:0010467)|innate immune response (GO:0045087)|positive regulation of innate immune response (GO:0045089)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of type I interferon production (GO:0032481)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase III promoter (GO:0006383)	cytosol (GO:0005829)|DNA-directed RNA polymerase III complex (GO:0005666)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|metal ion binding (GO:0046872)|ribonucleoside binding (GO:0032549)	p.R550Q(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(14)|lung(22)|ovary(1)|prostate(3)|skin(3)|urinary_tract(2)	57						GGTGTCATTCGAGACCACAAA	0.328																																																	1	Substitution - Missense(1)	large_intestine(1)											106.0	103.0	104.0					12																	106827518		2203	4300	6503	SO:0001583	missense	0			AY092084	CCDS9105.1, CCDS53824.1	12q23.3	2014-08-12			ENSG00000013503	ENSG00000013503		"""RNA polymerase subunits"""	30348	protein-coding gene	gene with protein product		614366				12391170	Standard	NM_018082		Approved	RPC2, FLJ10388	uc001tlp.3	Q9NW08	OTTHUMG00000170077	ENST00000228347.4:c.1649G>T	12.37:g.106827518G>T	ENSP00000228347:p.Arg550Leu		A8K6H0|B3KV73|F5H1E6|Q9NW59	Missense_Mutation	SNP	pfam_DNA-dir_RNA_pol_su2_6,pfam_RNA_pol_bsu_protrusion,pfam_RNA_pol_Rpb2_7,pfam_RNA_pol_Rpb2_2,pfam_RNA_pol_Rpb2_3,pfam_RNA_pol_Rpb2_4,pfam_RNA_pol_Rpb2_5	p.R550L	ENST00000228347.4	37	c.1649	CCDS9105.1	12	.	.	.	.	.	.	.	.	.	.	G	20.8	4.046473	0.75846	.	.	ENSG00000013503	ENST00000228347;ENST00000551370;ENST00000539066	T;T	0.77750	-1.12;-1.12	6.03	6.03	0.97812	RNA polymerase Rpb2, domain 4 (1);	0.000000	0.85682	D	0.000000	T	0.79684	0.4488	M	0.67397	2.05	0.80722	D	1	B	0.12630	0.006	B	0.22753	0.041	T	0.73757	-0.3882	10	0.54805	T	0.06	-11.3506	20.5666	0.99351	0.0:0.0:1.0:0.0	.	550	Q9NW08	RPC2_HUMAN	L	550;550;492	ENSP00000228347:R550L;ENSP00000445721:R492L	ENSP00000228347:R550L	R	+	2	0	POLR3B	105351648	1.000000	0.71417	1.000000	0.80357	0.933000	0.57130	7.588000	0.82629	2.854000	0.98071	0.655000	0.94253	CGA	POLR3B	-	pfam_RNA_pol_Rpb2_4	ENSG00000013503		0.328	POLR3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POLR3B	HGNC	protein_coding	OTTHUMT00000407166.1		0.00	91	0	G	NM_018082		106827518	+1			no_errors	ENST00000228347	ensembl	human	known	74_37	missense	6.12	46	3	SNP	1.000	T
POPDC2	64091	genome.wustl.edu	37	3	119367470	119367470	+	Frame_Shift_Del	DEL	G	G	-			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr3:119367470delG	ENST00000264231.3	-	3	812	c.646delC	c.(646-648)cggfs	p.R216fs	POPDC2_ENST00000474523.1_5'UTR|POPDC2_ENST00000468801.1_Frame_Shift_Del_p.R216fs|POPDC2_ENST00000538678.1_Frame_Shift_Del_p.R216fs|POPDC2_ENST00000493094.1_Frame_Shift_Del_p.R216fs	NM_022135.2	NP_071418.2	Q9HBU9	POPD2_HUMAN	popeye domain containing 2	216					regulation of heart rate (GO:0002027)|regulation of membrane potential (GO:0042391)|sinoatrial node cell development (GO:0060931)	integral component of membrane (GO:0016021)	cAMP binding (GO:0030552)			breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(7)|prostate(1)|upper_aerodigestive_tract(1)	13				GBM - Glioblastoma multiforme(114;0.242)		AGACTTTTCCGGGGCCAGGAA	0.468																																																	0													43.0	47.0	45.0					3																	119367470		2203	4300	6503	SO:0001589	frameshift_variant	0			AF204173	CCDS2992.1	3q13.33	2004-01-15			ENSG00000121577	ENSG00000121577			17648	protein-coding gene	gene with protein product		605823				10882522	Standard	NM_022135		Approved	POP2	uc031sbc.1	Q9HBU9	OTTHUMG00000159438	ENST00000264231.3:c.646delC	3.37:g.119367470delG	ENSP00000264231:p.Arg216fs		Q86UE7	Frame_Shift_Del	DEL	pfam_Popeye_prot,superfamily_cNMP-bd-like	p.R216fs	ENST00000264231.3	37	c.646	CCDS2992.1	3																																																																																			POPDC2	-	pfam_Popeye_prot,superfamily_cNMP-bd-like	ENSG00000121577		0.468	POPDC2-002	KNOWN	basic|CCDS	protein_coding	POPDC2	HGNC	protein_coding	OTTHUMT00000355378.1		0.00	47	0	G	NM_022135		119367470	-1	tier1		no_errors	ENST00000341124	ensembl	human	known	74_37	frame_shift_del	6.25	30	2	DEL	1.000	-
POU2F1	5451	genome.wustl.edu	37	1	167343528	167343528	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr1:167343528G>C	ENST00000541643.3	+	7	679	c.517G>C	c.(517-519)Gca>Cca	p.A173P	POU2F1_ENST00000429375.2_Intron|POU2F1_ENST00000452019.1_Missense_Mutation_p.A173P|POU2F1_ENST00000367866.2_Missense_Mutation_p.A196P|POU2F1_ENST00000367862.5_Missense_Mutation_p.A185P|POU2F1_ENST00000420254.3_Missense_Mutation_p.A173P|POU2F1_ENST00000367865.1_3'UTR			P14859	PO2F1_HUMAN	POU class 2 homeobox 1	173					gene expression (GO:0010467)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription from RNA polymerase III promoter (GO:0006383)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(3)|liver(2)|lung(7)|ovary(2)|prostate(2)|skin(3)|urinary_tract(1)	30						CATACAGATCGCACAGGTGAG	0.532																																																	0													25.0	26.0	26.0					1																	167343528		2201	4300	6501	SO:0001583	missense	0			BC001664	CCDS1259.1, CCDS1259.2, CCDS55655.1, CCDS55656.1	1q24.2	2011-06-20	2007-07-13		ENSG00000143190	ENSG00000143190		"""Homeoboxes / POU class"""	9212	protein-coding gene	gene with protein product		164175	"""POU domain class 2, transcription factor 1"""	OTF1		1887216	Standard	NM_002697		Approved	OCT1	uc001gee.3	P14859	OTTHUMG00000034436	ENST00000541643.3:c.517G>C	1.37:g.167343528G>C	ENSP00000441285:p.Ala173Pro		B1AL91|B1AL93|B4E029|J3KP77|Q5TBT7|Q6PK46|Q8NEU9|Q9BPV1	Missense_Mutation	SNP	pfam_POU_specific,pfam_Homeobox_dom,superfamily_Lambda_DNA-bd_dom,superfamily_Homeodomain-like,smart_POU_specific,smart_Homeobox_dom,pfscan_Homeobox_dom,pfscan_POU_specific,prints_POU,prints_TF_octamer	p.A196P	ENST00000541643.3	37	c.586		1	.	.	.	.	.	.	.	.	.	.	G	18.01	3.527453	0.64860	.	.	ENSG00000143190	ENST00000367866;ENST00000452019;ENST00000492850;ENST00000367865;ENST00000420254;ENST00000541643;ENST00000367862;ENST00000443275	D;D;D;D;D;D	0.87966	-2.32;-2.32;-2.32;-2.31;-2.3;-2.16	5.77	5.77	0.91146	.	0.114774	0.36555	N	0.002539	D	0.90796	0.7110	L	0.52573	1.65	0.53005	D	0.999962	D;D;D;D	0.76494	0.999;0.993;0.993;0.966	D;P;P;P	0.70487	0.969;0.74;0.883;0.554	D	0.90325	0.4347	10	0.56958	D	0.05	.	20.0589	0.97667	0.0:0.0:1.0:0.0	.	173;185;171;173	P14859-4;P14859-2;P14859-3;P14859	.;.;.;PO2F1_HUMAN	P	196;173;50;171;173;173;185;81	ENSP00000356840:A196P;ENSP00000356839:A171P;ENSP00000414660:A173P;ENSP00000441285:A173P;ENSP00000356836:A185P;ENSP00000415993:A81P	ENSP00000356836:A185P	A	+	1	0	POU2F1	165610152	1.000000	0.71417	0.997000	0.53966	0.995000	0.86356	2.653000	0.46691	2.732000	0.93576	0.650000	0.86243	GCA	POU2F1	-	NULL	ENSG00000143190		0.532	POU2F1-203	KNOWN	basic|appris_candidate	protein_coding	POU2F1	HGNC	protein_coding		-	0.00	57	0	G	NM_002697		167343528	+1	tier1	-	no_errors	ENST00000367866	ensembl	human	known	74_37	missense	24.00	19	6	SNP	1.000	C
POU3F3	5455	genome.wustl.edu	37	2	105473134	105473134	+	Nonsense_Mutation	SNP	C	C	G			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr2:105473134C>G	ENST00000361360.2	+	1	1166	c.1166C>G	c.(1165-1167)tCa>tGa	p.S389*	RP11-13J10.1_ENST00000598623.1_RNA	NM_006236.1	NP_006227.1	P20264	PO3F3_HUMAN	POU class 3 homeobox 3	389					central nervous system development (GO:0007417)|cerebral cortex radially oriented cell migration (GO:0021799)|forebrain ventricular zone progenitor cell division (GO:0021869)|metanephric ascending thin limb development (GO:0072218)|metanephric DCT cell differentiation (GO:0072240)|metanephric loop of Henle development (GO:0072236)|metanephric macula densa development (GO:0072227)|metanephric thick ascending limb development (GO:0072233)|negative regulation of apoptotic process (GO:0043066)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|liver(1)|lung(4)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	12						GAGGCGGACTCAAGCACCGGC	0.632																																																	0													49.0	48.0	48.0					2																	105473134		2203	4300	6503	SO:0001587	stop_gained	0				CCDS33265.1	2q12.1	2011-06-20	2007-07-13		ENSG00000198914	ENSG00000198914		"""Homeoboxes / POU class"""	9216	protein-coding gene	gene with protein product		602480	"""POU domain class 3, transcription factor 3"""				Standard	NM_006236		Approved	BRN1, OTF8	uc010ywg.2	P20264	OTTHUMG00000153067	ENST00000361360.2:c.1166C>G	2.37:g.105473134C>G	ENSP00000355001:p.Ser389*		P78379|Q4ZG25	Nonsense_Mutation	SNP	pfam_POU_specific,pfam_Homeobox_dom,superfamily_Lambda_DNA-bd_dom,superfamily_Homeodomain-like,smart_POU_specific,smart_Homeobox_dom,pirsf_Transcription_factor_POU,pfscan_Homeobox_dom,pfscan_POU_specific,prints_POU	p.S389*	ENST00000361360.2	37	c.1166	CCDS33265.1	2	.	.	.	.	.	.	.	.	.	.	C	37	6.295352	0.97449	.	.	ENSG00000198914	ENST00000361360	.	.	.	4.14	4.14	0.48551	.	0.000000	0.64402	U	0.000007	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	15.1857	0.72999	0.0:1.0:0.0:0.0	.	.	.	.	X	389	.	ENSP00000355001:S389X	S	+	2	0	POU3F3	104839566	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	5.415000	0.66411	1.858000	0.53909	0.462000	0.41574	TCA	POU3F3	-	superfamily_Lambda_DNA-bd_dom,pirsf_Transcription_factor_POU	ENSG00000198914		0.632	POU3F3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	POU3F3	HGNC	protein_coding	OTTHUMT00000329335.2	-	0.00	86	0	C			105473134	+1	tier1	-	no_errors	ENST00000361360	ensembl	human	known	74_37	nonsense	31.58	26	12	SNP	1.000	G
PPP1R3A	5506	genome.wustl.edu	37	7	113518436	113518436	+	Nonsense_Mutation	SNP	G	G	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr7:113518436G>T	ENST00000284601.3	-	4	2779	c.2711C>A	c.(2710-2712)tCa>tAa	p.S904*		NM_002711.3	NP_002702.2	Q16821	PPR3A_HUMAN	protein phosphatase 1, regulatory subunit 3A	904					glycogen metabolic process (GO:0005977)	integral component of membrane (GO:0016021)				NS(2)|breast(8)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|liver(1)|lung(43)|ovary(10)|pancreas(7)|prostate(3)|skin(15)|stomach(1)|upper_aerodigestive_tract(2)	121						ATTAGTGTCTGAGTTAAAAGC	0.378																																																	0													88.0	86.0	87.0					7																	113518436		2203	4299	6502	SO:0001587	stop_gained	0			AF024578	CCDS5759.1	7q31.1	2012-04-17	2011-10-04	2001-07-02	ENSG00000154415	ENSG00000154415	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9291	protein-coding gene	gene with protein product	"""glycogen-associated regulatory subunit of protein phosphatase-1"", ""protein phosphatase 1 regulatory subunit GM"""	600917	"""protein phosphatase 1, regulatory (inhibitor) subunit 3A (glycogen and sarcoplasmic reticulum binding subunit, skeletal muscle)"", ""protein phosphatase 1, regulatory (inhibitor) subunit 3A"""	PPP1R3		7926294	Standard	NM_002711		Approved	GM	uc010ljy.1	Q16821	OTTHUMG00000156944	ENST00000284601.3:c.2711C>A	7.37:g.113518436G>T	ENSP00000284601:p.Ser904*		A0AVQ2|A4D0T6|O43476|Q75LN8|Q7KYM8|Q86UI6	Nonsense_Mutation	SNP	pfam_CBM_21,pfscan_CBM_21	p.S904*	ENST00000284601.3	37	c.2711	CCDS5759.1	7	.	.	.	.	.	.	.	.	.	.	G	26.8	4.772982	0.90108	.	.	ENSG00000154415	ENST00000284601	.	.	.	5.64	5.64	0.86602	.	0.255425	0.28279	N	0.015935	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-11.505	14.8792	0.70519	0.0:0.2157:0.7843:0.0	.	.	.	.	X	904	.	ENSP00000284601:S904X	S	-	2	0	PPP1R3A	113305672	0.983000	0.35010	0.999000	0.59377	0.406000	0.30931	1.324000	0.33712	2.646000	0.89796	0.603000	0.83216	TCA	PPP1R3A	-	NULL	ENSG00000154415		0.378	PPP1R3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1R3A	HGNC	protein_coding	OTTHUMT00000346724.1		0.00	34	0	G	NM_002711		113518436	-1			no_errors	ENST00000284601	ensembl	human	known	74_37	nonsense	10.53	17	2	SNP	0.961	T
PPP2R5B	5526	genome.wustl.edu	37	11	64697849	64697849	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr11:64697849G>A	ENST00000164133.2	+	7	1400	c.778G>A	c.(778-780)Gga>Aga	p.G260R		NM_006244.3	NP_006235.1	Q15173	2A5B_HUMAN	protein phosphatase 2, regulatory subunit B', beta	260					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|protein phosphatase type 2A complex (GO:0000159)	protein phosphatase type 2A regulator activity (GO:0008601)			central_nervous_system(2)|endometrium(4)|kidney(1)|large_intestine(3)|lung(9)|ovary(2)	21						GGAGATCCTAGGAAGGTGATT	0.567																																																	0													111.0	99.0	103.0					11																	64697849		2200	4296	6496	SO:0001583	missense	0			L42374	CCDS8085.1	11q12	2010-06-18	2010-04-14		ENSG00000068971	ENSG00000068971		"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"""	9310	protein-coding gene	gene with protein product	"""PP2A, B subunit, B' beta isoform"", ""PP2A, B subunit, B56 beta isoform"", ""PP2A, B subunit, PR61 beta isoform"", ""PP2A, B subunit, R5 beta isoform"", ""serine/threonine protein phosphatase 2A, 56 kDa regulatory subunit, beta isoform"""	601644	"""protein phosphatase 2, regulatory subunit B (B56), beta isoform"", ""protein phosphatase 2, regulatory subunit B', beta isoform"""			7592815	Standard	NM_006244		Approved	FLJ35411, B56B, PR61B	uc001oby.3	Q15173	OTTHUMG00000150043	ENST00000164133.2:c.778G>A	11.37:g.64697849G>A	ENSP00000164133:p.Gly260Arg		Q13853	Missense_Mutation	SNP	pfam_PP2A_B56,superfamily_ARM-type_fold,pirsf_PP2A_B56	p.G260R	ENST00000164133.2	37	c.778	CCDS8085.1	11	.	.	.	.	.	.	.	.	.	.	G	28.0	4.879012	0.91740	.	.	ENSG00000068971	ENST00000164133;ENST00000359279;ENST00000527441	.	.	.	3.81	3.81	0.43845	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.87229	0.6125	H	0.97540	4.025	0.80722	D	1	D	0.76494	0.999	D	0.80764	0.994	D	0.91305	0.5070	9	0.87932	D	0	-9.0602	14.0102	0.64490	0.0:0.0:1.0:0.0	.	260	Q15173	2A5B_HUMAN	R	260;287;260	.	ENSP00000164133:G260R	G	+	1	0	PPP2R5B	64454425	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.126000	0.94411	2.422000	0.82143	0.655000	0.94253	GGA	PPP2R5B	-	pfam_PP2A_B56,superfamily_ARM-type_fold,pirsf_PP2A_B56	ENSG00000068971		0.567	PPP2R5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP2R5B	HGNC	protein_coding	OTTHUMT00000385465.1	-	0.00	55	0	G	NM_006244		64697849	+1	tier1	-	no_errors	ENST00000164133	ensembl	human	known	74_37	missense	45.00	11	9	SNP	1.000	A
PRDM16	63976	genome.wustl.edu	37	1	3348663	3348663	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr1:3348663G>C	ENST00000270722.5	+	16	3704	c.3655G>C	c.(3655-3657)Gag>Cag	p.E1219Q	PRDM16_ENST00000512462.1_3'UTR|PRDM16_ENST00000378391.2_Missense_Mutation_p.E1219Q|PRDM16_ENST00000511072.1_Intron|PRDM16_ENST00000442529.2_Missense_Mutation_p.E1218Q|PRDM16_ENST00000378398.3_Missense_Mutation_p.E1219Q|PRDM16_ENST00000514189.1_Intron|PRDM16_ENST00000441472.2_Missense_Mutation_p.E1218Q			Q9HAZ2	PRD16_HUMAN	PR domain containing 16	1219	Mediates interaction with SKI and regulation of TGF-beta signaling.				brown fat cell differentiation (GO:0050873)|negative regulation of granulocyte differentiation (GO:0030853)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neurogenesis (GO:0022008)|palate development (GO:0060021)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cellular respiration (GO:0043457)|somatic stem cell maintenance (GO:0035019)|tongue development (GO:0043586)|transcription, DNA-templated (GO:0006351)|white fat cell differentiation (GO:0050872)	nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|transcription coactivator activity (GO:0003713)			breast(4)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(7)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(3)	59	all_cancers(77;0.00208)|all_epithelial(69;0.000732)|Ovarian(185;0.0634)|Lung NSC(156;0.109)|all_lung(157;0.111)	all_epithelial(116;2.03e-21)|all_lung(118;7.55e-09)|Lung NSC(185;1.28e-06)|Breast(487;0.000792)|Renal(390;0.00137)|Hepatocellular(190;0.00515)|Myeloproliferative disorder(586;0.0267)|Ovarian(437;0.0365)|Lung SC(97;0.114)|Medulloblastoma(700;0.134)		Epithelial(90;5.59e-35)|OV - Ovarian serous cystadenocarcinoma(86;1.99e-20)|GBM - Glioblastoma multiforme(42;3.72e-11)|Colorectal(212;0.000425)|BRCA - Breast invasive adenocarcinoma(365;0.000946)|COAD - Colon adenocarcinoma(227;0.000968)|Kidney(185;0.00155)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0175)|Lung(427;0.137)		CTTAGATTCTGAGGCTTTAAA	0.552			T	EVI1	"""MDS, AML"""																																			Dom	yes		1	1p36.23-p33	63976	PR domain containing 16		L	0													81.0	89.0	86.0					1																	3348663		1952	4149	6101	SO:0001583	missense	0			AF294278	CCDS41236.1, CCDS44048.1, CCDS41236.2, CCDS44048.2	1p36.23-p33	2013-01-08			ENSG00000142611	ENSG00000142611		"""Zinc fingers, C2H2-type"""	14000	protein-coding gene	gene with protein product	"""MDS1/EVI1-like"", ""PR-domain zinc finger protein 16"", ""transcription factor MEL1"""	605557				11050005	Standard	NM_199454		Approved	MEL1, PFM13, KIAA1675, MGC166915	uc001akf.3	Q9HAZ2	OTTHUMG00000000581	ENST00000270722.5:c.3655G>C	1.37:g.3348663G>C	ENSP00000270722:p.Glu1219Gln		A6NHQ8|B1AJP7|B1AJP8|B1AJP9|B1WB48|Q8WYJ9|Q9C0I8	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Znf_BED_prd,smart_SET_dom,smart_Znf_C2H2-like,pfscan_SET_dom,pfscan_Znf_C2H2	p.E1219Q	ENST00000270722.5	37	c.3655	CCDS41236.2	1	.	.	.	.	.	.	.	.	.	.	G	29.7	5.026603	0.93518	.	.	ENSG00000142611	ENST00000378398;ENST00000441472;ENST00000442529;ENST00000378391;ENST00000270722;ENST00000512462;ENST00000408992;ENST00000509860	T;T;T;T;T;T;T	0.11169	2.84;2.85;2.93;2.93;2.85;2.8;2.81	5.01	5.01	0.66863	.	0.000000	0.48767	U	0.000166	T	0.35595	0.0937	M	0.73598	2.24	0.58432	D	0.99999	D;D;D;D	0.89917	0.999;0.963;1.0;0.999	D;P;D;D	0.91635	0.994;0.852;0.999;0.994	T	0.15492	-1.0435	10	0.72032	D	0.01	.	18.2948	0.90141	0.0:0.0:1.0:0.0	.	1219;1219;1218;1218	Q9HAZ2;Q9HAZ2-2;F8WEV3;D3YTA5	PRD16_HUMAN;.;.;.	Q	1219;1218;1218;1219;1219;1035;1035;1027	ENSP00000367651:E1219Q;ENSP00000407968:E1218Q;ENSP00000405253:E1218Q;ENSP00000367643:E1219Q;ENSP00000270722:E1219Q;ENSP00000422504:E1035Q;ENSP00000425796:E1027Q	ENSP00000270722:E1219Q	E	+	1	0	PRDM16	3338523	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.539000	0.82063	2.318000	0.78349	0.585000	0.79938	GAG	PRDM16	-	NULL	ENSG00000142611		0.552	PRDM16-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PRDM16	HGNC	protein_coding	OTTHUMT00000001382.3	-	0.00	33	0	G	NM_022114		3348663	+1	tier1	-	no_errors	ENST00000270722	ensembl	human	known	74_37	missense	27.27	16	6	SNP	1.000	C
AGXT2	64902	genome.wustl.edu	37	5	35049407	35049407	+	5'Flank	SNP	C	C	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr5:35049407C>T	ENST00000231420.6	-	0	0				PRLR_ENST00000542609.1_Intron|PRLR_ENST00000397391.3_Silent_p.L193L|PRLR_ENST00000513753.1_3'UTR|PRLR_ENST00000231423.3_Silent_p.L372L|PRLR_ENST00000348262.3_Silent_p.L264L|AC010368.2_ENST00000594869.1_5'Flank	NM_031900.3	NP_114106.1	Q9BYV1	AGT2_HUMAN	alanine--glyoxylate aminotransferase 2						cellular nitrogen compound metabolic process (GO:0034641)|glycine biosynthetic process, by transamination of glyoxylate (GO:0019265)|glyoxylate catabolic process (GO:0009436)|glyoxylate metabolic process (GO:0046487)|L-alanine catabolic process, by transamination (GO:0019481)|nucleobase-containing small molecule metabolic process (GO:0055086)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	(R)-3-amino-2-methylpropionate-pyruvate transaminase activity (GO:0047305)|alanine-glyoxylate transaminase activity (GO:0008453)|beta-alanine-pyruvate transaminase activity (GO:0016223)|pyridoxal phosphate binding (GO:0030170)			NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(18)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	41	all_lung(31;4.52e-05)		COAD - Colon adenocarcinoma(61;0.174)|Colorectal(62;0.229)	GBM - Glioblastoma multiforme(108;0.181)	Glycine(DB00145)|L-Alanine(DB00160)|Pyruvic acid(DB00119)	GGACTGTGGTCAATGTTGCCT	0.458																																																	0																																										SO:0001631	upstream_gene_variant	0			AJ292204	CCDS3908.1	5p13	2010-05-07	2010-05-07		ENSG00000113492	ENSG00000113492	2.6.1.44		14412	protein-coding gene	gene with protein product	"""beta-alanine-pyruvate aminotransferase"", ""beta-ALAAT II"""	612471	"""alanine-glyoxylate aminotransferase 2"""			15240345	Standard	NM_031900		Approved	AGT2	uc003jjf.3	Q9BYV1	OTTHUMG00000090788		5.37:g.35049407C>T	Exception_encountered		B7ZM47|E9PDL7|Q53FB4|Q53FY7|Q53G03|Q5W7Q1	Silent	SNP	pfam_Growth/epo_recpt_lig-bind,pfam_IL-6_rcpt_alpha-bd,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	p.L372	ENST00000231420.6	37	c.1116	CCDS3908.1	5																																																																																			PRLR	-	NULL	ENSG00000113494		0.458	AGXT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRLR	HGNC	protein_coding	OTTHUMT00000207574.2	-	0.00	83	0	C	NM_031900		35049407	-1	tier1	-	no_errors	ENST00000231423	ensembl	human	known	74_37	silent	12.50	56	8	SNP	0.000	T
PRKAA1	5562	genome.wustl.edu	37	5	40767573	40767573	+	Silent	SNP	A	A	G			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr5:40767573A>G	ENST00000397128.2	-	6	824	c.816T>C	c.(814-816)gaT>gaC	p.D272D	PRKAA1_ENST00000354209.3_Silent_p.D287D	NM_006251.5|NM_206907.3	NP_006242.5|NP_996790.3	Q13131	AAPK1_HUMAN	protein kinase, AMP-activated, alpha 1 catalytic subunit	272	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|autophagy (GO:0006914)|cell cycle arrest (GO:0007050)|cellular response to ethanol (GO:0071361)|cellular response to glucose starvation (GO:0042149)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to hypoxia (GO:0071456)|cellular response to nutrient levels (GO:0031669)|cholesterol biosynthetic process (GO:0006695)|cold acclimation (GO:0009631)|fatty acid biosynthetic process (GO:0006633)|fatty acid homeostasis (GO:0055089)|fatty acid oxidation (GO:0019395)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|insulin receptor signaling pathway (GO:0008286)|lipid biosynthetic process (GO:0008610)|negative regulation of apoptotic process (GO:0043066)|negative regulation of glucose import in response to insulin stimulus (GO:2001274)|negative regulation of glucosylceramide biosynthetic process (GO:0046318)|negative regulation of lipid catabolic process (GO:0050995)|negative regulation of TOR signaling (GO:0032007)|positive regulation of autophagy (GO:0010508)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cholesterol biosynthetic process (GO:0045542)|positive regulation of gene expression (GO:0010628)|positive regulation of glycolytic process (GO:0045821)|protein heterooligomerization (GO:0051291)|protein phosphorylation (GO:0006468)|regulation of circadian rhythm (GO:0042752)|regulation of energy homeostasis (GO:2000505)|regulation of transcription, DNA-templated (GO:0006355)|regulation of vesicle-mediated transport (GO:0060627)|response to activity (GO:0014823)|response to caffeine (GO:0031000)|response to camptothecin (GO:1901563)|response to gamma radiation (GO:0010332)|response to hypoxia (GO:0001666)|response to UV (GO:0009411)|rhythmic process (GO:0048511)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	AMP-activated protein kinase complex (GO:0031588)|apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular (GO:0005622)|nucleus (GO:0005634)	[acetyl-CoA carboxylase] kinase activity (GO:0050405)|[hydroxymethylglutaryl-CoA reductase (NADPH)] kinase activity (GO:0047322)|AMP-activated protein kinase activity (GO:0004679)|ATP binding (GO:0005524)|cAMP-dependent protein kinase activity (GO:0004691)|chromatin binding (GO:0003682)|histone serine kinase activity (GO:0035174)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|tau-protein kinase activity (GO:0050321)			breast(1)	1					Acetylsalicylic acid(DB00945)|Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)|Phenformin(DB00914)	ATTACCTGATATCTTTGATTG	0.348																																																	0													78.0	73.0	75.0					5																	40767573		1819	4078	5897	SO:0001819	synonymous_variant	0				CCDS3932.2, CCDS3933.2	5p13.1	2012-10-03			ENSG00000132356	ENSG00000132356			9376	protein-coding gene	gene with protein product	"""AMPK, alpha, 1"""	602739				8557660	Standard	XM_006714481		Approved	AMPKa1	uc003jmb.3	Q13131	OTTHUMG00000162269	ENST00000397128.2:c.816T>C	5.37:g.40767573A>G			A8MTQ6|B2R7E1|O00286|Q5D0E1|Q86VS1|Q9UNQ4	Silent	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_KA1/Ssp2_C,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.D287	ENST00000397128.2	37	c.861	CCDS3932.2	5																																																																																			PRKAA1	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000132356		0.348	PRKAA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKAA1	HGNC	protein_coding	OTTHUMT00000253833.2	-	0.00	55	0	A	NM_006251		40767573	-1	tier1	-	no_errors	ENST00000354209	ensembl	human	known	74_37	silent	32.14	38	18	SNP	0.996	G
PRR12	57479	genome.wustl.edu	37	19	50117865	50117865	+	Nonsense_Mutation	SNP	G	G	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr19:50117865G>T	ENST00000418929.2	+	7	4861	c.4849G>T	c.(4849-4851)Gag>Tag	p.E1617*		NM_020719.1	NP_065770.1	Q9ULL5	PRR12_HUMAN	proline rich 12	796							DNA binding (GO:0003677)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(2)|pancreas(1)|prostate(2)	11		all_lung(116;2.45e-07)|Lung NSC(112;1.24e-06)|Ovarian(192;0.0728)|all_neural(266;0.0887)		OV - Ovarian serous cystadenocarcinoma(262;0.00319)|GBM - Glioblastoma multiforme(134;0.0132)		ATTCACTCCGGAGATCAAGGA	0.617																																																	0													25.0	26.0	26.0					19																	50117865		1915	4106	6021	SO:0001587	stop_gained	0			AB033031	CCDS46143.1	19q13.33	2008-07-02	2006-02-06	2006-02-06		ENSG00000126464			29217	protein-coding gene	gene with protein product			"""KIAA1205"""	KIAA1205		10574462	Standard	NM_020719		Approved		uc002poo.4	Q9ULL5		ENST00000418929.2:c.4849G>T	19.37:g.50117865G>T	ENSP00000394510:p.Glu1617*		E9PB06|Q8N4J6	Nonsense_Mutation	SNP	NULL	p.E1617*	ENST00000418929.2	37	c.4849	CCDS46143.1	19	.	.	.	.	.	.	.	.	.	.	G	43	9.979913	0.99309	.	.	ENSG00000126464	ENST00000418929;ENST00000246798;ENST00000314734	.	.	.	4.12	4.12	0.48240	.	0.000000	0.41001	D	0.000971	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-32.1752	15.3097	0.74023	0.0:0.0:1.0:0.0	.	.	.	.	X	1617;797;797	.	ENSP00000246798:E797X	E	+	1	0	PRR12	54809677	1.000000	0.71417	0.957000	0.39632	0.461000	0.32589	8.848000	0.92172	2.147000	0.66899	0.467000	0.42956	GAG	PRR12	-	NULL	ENSG00000126464		0.617	PRR12-001	NOVEL	basic|appris_principal|CCDS	protein_coding	PRR12	HGNC	protein_coding	OTTHUMT00000465915.1	-	0.00	100	0	G	NM_020719		50117865	+1	tier1	-	no_errors	ENST00000418929	ensembl	human	novel	74_37	nonsense	8.16	45	4	SNP	0.998	T
PSD4	23550	genome.wustl.edu	37	2	113940984	113940984	+	Silent	SNP	C	C	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr2:113940984C>T	ENST00000245796.6	+	2	1146	c.951C>T	c.(949-951)acC>acT	p.T317T	PSD4_ENST00000441564.3_Silent_p.T317T	NM_012455.2	NP_036587.2	Q8NDX1	PSD4_HUMAN	pleckstrin and Sec7 domain containing 4	317					neuron differentiation (GO:0030182)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|phospholipid binding (GO:0005543)			cervix(1)|endometrium(2)|large_intestine(4)|lung(13)|ovary(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						GGCATTGTACCCCTCCATTCC	0.617																																																	0													61.0	52.0	55.0					2																	113940984		2203	4300	6503	SO:0001819	synonymous_variant	0			U63127	CCDS33276.1	2q13	2013-01-10			ENSG00000125637	ENSG00000125637		"""Pleckstrin homology (PH) domain containing"""	19096	protein-coding gene	gene with protein product		614442				12082148	Standard	XM_005263634		Approved	TIC, EFA6B	uc002tjc.3	Q8NDX1	OTTHUMG00000153339	ENST00000245796.6:c.951C>T	2.37:g.113940984C>T			A6NEG7|A8K1Y0|O95621|Q4ZG34|Q6GPH8|Q8IYP4	Silent	SNP	pfam_Sec7_dom,pfam_Pleckstrin_homology,superfamily_Sec7_dom,smart_Sec7_dom,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_Sec7_dom,prints_PH_dom-spectrin-type	p.T317	ENST00000245796.6	37	c.951	CCDS33276.1	2																																																																																			PSD4	-	NULL	ENSG00000125637		0.617	PSD4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PSD4	HGNC	protein_coding	OTTHUMT00000330789.1	-	0.00	68	0	C	NM_012455		113940984	+1	tier1	-	no_errors	ENST00000245796	ensembl	human	known	74_37	silent	33.33	25	13	SNP	0.001	T
PSMD2	5708	genome.wustl.edu	37	3	184019770	184019770	+	Silent	SNP	C	C	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr3:184019770C>T	ENST00000310118.4	+	5	1173	c.615C>T	c.(613-615)tgC>tgT	p.C205C	PSMD2_ENST00000435761.1_Silent_p.C46C|EIF2B5_ENST00000444495.1_Intron|PSMD2_ENST00000439383.1_Silent_p.C75C	NM_002808.3	NP_002799.3	Q13200	PSMD2_HUMAN	proteasome (prosome, macropain) 26S subunit, non-ATPase, 2	205					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of protein catabolic process (GO:0042176)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)|proteasome regulatory particle (GO:0005838)	enzyme regulator activity (GO:0030234)			breast(1)|central_nervous_system(1)|cervix(1)|kidney(1)|large_intestine(5)|liver(1)|lung(12)|prostate(3)|upper_aerodigestive_tract(2)	27	all_cancers(143;1.54e-10)|Ovarian(172;0.0339)		Epithelial(37;1.53e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)		Bortezomib(DB00188)	ATGAGGCTTGCGACCTGCTTA	0.507																																					Colon(24;313 636 6917 9932 15554)												0													115.0	106.0	109.0					3																	184019770		2203	4300	6503	SO:0001819	synonymous_variant	0			AK095245	CCDS3258.1, CCDS63853.1, CCDS63854.1	3q27.3	2008-05-22			ENSG00000175166	ENSG00000175166		"""Proteasome (prosome, macropain) subunits"""	9559	protein-coding gene	gene with protein product		606223				8774743	Standard	NM_002808		Approved	S2, P97, TRAP2, MGC14274, Rpn1	uc003fnn.1	Q13200	OTTHUMG00000156796	ENST00000310118.4:c.615C>T	3.37:g.184019770C>T			B4DX07|B4DXY1|E7EW34|E9PCS3|Q12932|Q15321|Q53XQ4|Q96I12	Silent	SNP	pfam_Proteasome/cyclosome_rpt,superfamily_ARM-type_fold,pirsf_26S_Psome_Rpn1	p.C205	ENST00000310118.4	37	c.615	CCDS3258.1	3																																																																																			PSMD2	-	superfamily_ARM-type_fold,pirsf_26S_Psome_Rpn1	ENSG00000175166		0.507	PSMD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSMD2	HGNC	protein_coding	OTTHUMT00000345843.1		0.00	62	0	C	NM_002808		184019770	+1			no_errors	ENST00000310118	ensembl	human	known	74_37	silent	6.35	59	4	SNP	0.996	T
PTPN2	5771	genome.wustl.edu	37	18	12825906	12825906	+	Missense_Mutation	SNP	T	T	A			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr18:12825906T>A	ENST00000309660.5	-	5	491	c.398A>T	c.(397-399)gAg>gTg	p.E133V	PTPN2_ENST00000327283.3_Missense_Mutation_p.E133V|PTPN2_ENST00000591115.1_Missense_Mutation_p.E133V|PTPN2_ENST00000591497.1_Missense_Mutation_p.E104V|PTPN2_ENST00000353319.4_Missense_Mutation_p.E133V	NM_002828.3	NP_002819.2	P17706	PTN2_HUMAN	protein tyrosine phosphatase, non-receptor type 2	133	Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.				B cell differentiation (GO:0030183)|cytokine-mediated signaling pathway (GO:0019221)|erythrocyte differentiation (GO:0030218)|glucose homeostasis (GO:0042593)|insulin receptor signaling pathway (GO:0008286)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chemotaxis (GO:0050922)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of inflammatory response (GO:0050728)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of interferon-gamma-mediated signaling pathway (GO:0060336)|negative regulation of interleukin-2-mediated signaling pathway (GO:1902206)|negative regulation of interleukin-4-mediated signaling pathway (GO:1902215)|negative regulation of interleukin-6-mediated signaling pathway (GO:0070104)|negative regulation of lipid storage (GO:0010888)|negative regulation of macrophage colony-stimulating factor signaling pathway (GO:1902227)|negative regulation of macrophage differentiation (GO:0045650)|negative regulation of platelet-derived growth factor receptor-beta signaling pathway (GO:2000587)|negative regulation of positive thymic T cell selection (GO:1902233)|negative regulation of prolactin signaling pathway (GO:1902212)|negative regulation of T cell receptor signaling pathway (GO:0050860)|negative regulation of tumor necrosis factor-mediated signaling pathway (GO:0010804)|negative regulation of type I interferon-mediated signaling pathway (GO:0060339)|negative regulation of tyrosine phosphorylation of Stat1 protein (GO:0042512)|negative regulation of tyrosine phosphorylation of Stat3 protein (GO:0042518)|negative regulation of tyrosine phosphorylation of Stat5 protein (GO:0042524)|negative regulation of tyrosine phosphorylation of Stat6 protein (GO:0042527)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of gluconeogenesis (GO:0045722)|regulation of hepatocyte growth factor receptor signaling pathway (GO:1902202)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|T cell differentiation (GO:0030217)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	integrin binding (GO:0005178)|protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)|receptor tyrosine kinase binding (GO:0030971)|syntaxin binding (GO:0019905)			breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(2)|prostate(1)|skin(3)	13		Lung NSC(161;8.94e-06)				AAACAGCATCTCTTGGTCATC	0.308																																																	0													81.0	74.0	76.0					18																	12825906		2203	4300	6503	SO:0001583	missense	0			M25393	CCDS11863.1, CCDS11864.1, CCDS11865.1, CCDS59306.1	18p11.3-p11.2	2011-06-09			ENSG00000175354	ENSG00000175354		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9650	protein-coding gene	gene with protein product		176887		PTPT		2164224	Standard	NM_002828		Approved	TCELLPTP, TC-PTP, TCPTP	uc002krp.3	P17706	OTTHUMG00000131702	ENST00000309660.5:c.398A>T	18.37:g.12825906T>A	ENSP00000311857:p.Glu133Val		A8K955|A8MXU3|K7ENG3|Q96AU5|Q96HR2	Missense_Mutation	SNP	pirsf_Ptpn1/Ptpn2,pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,prints_Tyr_Pase_rcpt/non-rcpt,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt	p.E133V	ENST00000309660.5	37	c.398	CCDS11865.1	18	.	.	.	.	.	.	.	.	.	.	T	11.79	1.743704	0.30865	.	.	ENSG00000175354	ENST00000327283;ENST00000353319;ENST00000341361;ENST00000309660	D;D;D	0.84660	-1.88;-1.88;-1.88	4.38	3.13	0.36017	Protein-tyrosine phosphatase, receptor/non-receptor type (3);	0.154190	0.28895	N	0.013793	T	0.72415	0.3457	N	0.25144	0.715	0.35209	D	0.775009	B;B;B;B;B	0.09022	0.002;0.001;0.0;0.002;0.001	B;B;B;B;B	0.09377	0.004;0.003;0.003;0.004;0.004	T	0.73889	-0.3840	10	0.72032	D	0.01	.	6.0911	0.19995	0.2009:0.0:0.1305:0.6687	.	133;133;110;133;133	P17706;P17706-2;Q59F91;Q96AU5;A8K3N4	PTN2_HUMAN;.;.;.;.	V	133;133;110;133	ENSP00000320298:E133V;ENSP00000320546:E133V;ENSP00000311857:E133V	ENSP00000311857:E133V	E	-	2	0	PTPN2	12815906	0.863000	0.29885	0.995000	0.50966	0.992000	0.81027	2.860000	0.48372	1.962000	0.57031	0.456000	0.33151	GAG	PTPN2	-	pirsf_Ptpn1/Ptpn2,pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_rcpt/non-rcpt,pfscan_Tyr_Pase_rcpt/non-rcpt	ENSG00000175354		0.308	PTPN2-002	KNOWN	basic|CCDS	protein_coding	PTPN2	HGNC	protein_coding	OTTHUMT00000254613.3	-	0.00	65	0	T	NM_002828, NM_080422, NM_080423		12825906	-1	tier1	-	no_errors	ENST00000309660	ensembl	human	known	74_37	missense	14.29	30	5	SNP	0.976	A
PTPN4	5775	genome.wustl.edu	37	2	120723146	120723146	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr2:120723146G>T	ENST00000263708.2	+	25	3254	c.2483G>T	c.(2482-2484)aGt>aTt	p.S828I	PTPN4_ENST00000544261.1_Missense_Mutation_p.S461I	NM_002830.3	NP_002821.1	P29074	PTN4_HUMAN	protein tyrosine phosphatase, non-receptor type 4 (megakaryocyte)	828	Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.				peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytoskeleton (GO:0005856)	non-membrane spanning protein tyrosine phosphatase activity (GO:0004726)			endometrium(3)|kidney(2)|large_intestine(7)|lung(15)|ovary(2)|urinary_tract(1)	30					Alendronate(DB00630)	GATGATTCGAGTGACTTTCTA	0.428																																																	0													159.0	139.0	146.0					2																	120723146		2203	4300	6503	SO:0001583	missense	0				CCDS2129.1	2q14.2	2011-06-09			ENSG00000088179	ENSG00000088179		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9656	protein-coding gene	gene with protein product		176878				1648233	Standard	NM_002830		Approved	PTPMEG	uc002tmf.2	P29074	OTTHUMG00000131436	ENST00000263708.2:c.2483G>T	2.37:g.120723146G>T	ENSP00000263708:p.Ser828Ile		B2RBV8|Q9UDA7	Missense_Mutation	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_FERM_PH-like_C,pfam_FERM_central,pfam_FERM_N,pfam_PDZ,pfam_FERM-adjacent,superfamily_FERM_central,superfamily_PDZ,smart_Band_41_domain,smart_PDZ,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pirsf_Tyr_Pase_non-rcpt_typ-3/4,pfscan_FERM_domain,pfscan_PDZ,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt,prints_Band_41_fam,prints_Ez/rad/moesin_like	p.S828I	ENST00000263708.2	37	c.2483	CCDS2129.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	22.9|22.9	4.351633|4.351633	0.82132|0.82132	.|.	.|.	ENSG00000088179|ENSG00000088179	ENST00000441089|ENST00000263708;ENST00000544261	.|D;D	.|0.84146	.|-1.81;-1.81	5.62|5.62	5.62|5.62	0.85841|0.85841	.|Protein-tyrosine phosphatase, receptor/non-receptor type (3);Protein-tyrosine/Dual-specificity phosphatase (1);	.|0.038937	.|0.85682	.|D	.|0.000000	D|D	0.86414|0.86414	0.5927|0.5927	M|M	0.72894|0.72894	2.215|2.215	0.48135|0.48135	D|D	0.999595|0.999595	.|P	.|0.42993	.|0.797	.|B	.|0.40864	.|0.342	D|D	0.87790|0.87790	0.2618|0.2618	5|10	.|0.62326	.|D	.|0.03	.|.	19.6764|19.6764	0.95936|0.95936	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|828	.|P29074	.|PTN4_HUMAN	D|I	111|828;461	.|ENSP00000263708:S828I;ENSP00000445841:S461I	.|ENSP00000263708:S828I	E|S	+|+	3|2	2|0	PTPN4|PTPN4	120439616|120439616	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.974000|0.974000	0.67602|0.67602	6.783000|6.783000	0.75078|0.75078	2.660000|2.660000	0.90430|0.90430	0.655000|0.655000	0.94253|0.94253	GAG|AGT	PTPN4	-	pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pirsf_Tyr_Pase_non-rcpt_typ-3/4,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt	ENSG00000088179		0.428	PTPN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPN4	HGNC	protein_coding	OTTHUMT00000254233.2		0.00	158	0	G			120723146	+1			no_errors	ENST00000263708	ensembl	human	known	74_37	missense	5.19	73	4	SNP	1.000	T
PUF60	22827	genome.wustl.edu	37	8	144898893	144898893	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr8:144898893C>T	ENST00000526683.1	-	12	2032	c.1477G>A	c.(1477-1479)Gtg>Atg	p.V493M	SCRIB_ENST00000320476.3_5'Flank|PUF60_ENST00000453551.2_Missense_Mutation_p.V450M|PUF60_ENST00000456095.2_Missense_Mutation_p.V464M|SCRIB_ENST00000356994.2_5'Flank|PUF60_ENST00000527197.1_Missense_Mutation_p.V447M|SCRIB_ENST00000377533.3_5'Flank|PUF60_ENST00000524570.1_5'Flank|PUF60_ENST00000349157.6_Missense_Mutation_p.V476M|PUF60_ENST00000313352.7_Missense_Mutation_p.V433M	NM_001271098.1|NM_078480.2	NP_001258027.1|NP_510965.1	Q9UHX1	PUF60_HUMAN	poly-U binding splicing factor 60KDa	493	Inhibits homodimerization.|Inhibits transcriptional repression, interaction with ERCC3 and apoptosis induction.|RRM 3; atypical. {ECO:0000255|PROSITE- ProRule:PRU00176}.				apoptotic process (GO:0006915)|mRNA processing (GO:0006397)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.V493M(1)		NS(1)|endometrium(1)|kidney(3)|lung(7)|prostate(2)	14	all_cancers(97;2.31e-11)|all_epithelial(106;1.58e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;1.23e-39)|all cancers(56;6.82e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.18)			ACGCGGTTCACGGCCCCGAAC	0.517																																																	1	Substitution - Missense(1)	kidney(1)											250.0	269.0	263.0					8																	144898893		2132	4219	6351	SO:0001583	missense	0			AF114818	CCDS47933.1, CCDS47934.1, CCDS47935.1, CCDS59514.1, CCDS59515.1, CCDS59516.1	8q24.3	2013-02-12	2007-07-27		ENSG00000179950	ENSG00000179950		"""RNA binding motif (RRM) containing"""	17042	protein-coding gene	gene with protein product	"""siah binding protein 1"", ""FBP interacting repressor"", ""pyrimidine tract binding splicing factor"", ""Ro ribonucleoprotein binding protein 1"""	604819				10668799, 10882074, 17579712	Standard	NM_078480		Approved	FIR, SIAHBP1, RoBPI	uc003yzs.4	Q9UHX1	OTTHUMG00000165155	ENST00000526683.1:c.1477G>A	8.37:g.144898893C>T	ENSP00000434359:p.Val493Met		A8K8K8|Q969E7|Q96D94|Q96H63|Q99628|Q9NZA0|Q9UJY7	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom_euk,smart_RRM_dom,pfscan_RRM_dom,tigrfam_PolyU-bd	p.V493M	ENST00000526683.1	37	c.1477	CCDS47934.1	8	.	.	.	.	.	.	.	.	.	.	C	24.4	4.522691	0.85600	.	.	ENSG00000179950	ENST00000526683;ENST00000453551;ENST00000313352;ENST00000456095;ENST00000349157;ENST00000527197	T;T;T;T;T;T	0.09255	3.0;3.0;3.0;3.0;3.0;3.0	5.41	5.41	0.78517	RNA recognition motif domain, eukaryote (1);Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (1);	0.000000	0.85682	D	0.000000	T	0.51550	0.1681	H	0.98089	4.145	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.77004	0.989;0.975	T	0.71391	-0.4607	10	0.87932	D	0	.	18.1632	0.89716	0.0:1.0:0.0:0.0	.	476;493	Q9UHX1-2;Q9UHX1	.;PUF60_HUMAN	M	493;450;433;464;476;447	ENSP00000434359:V493M;ENSP00000402953:V450M;ENSP00000322016:V433M;ENSP00000395417:V464M;ENSP00000322036:V476M;ENSP00000431960:V447M	ENSP00000322016:V433M	V	-	1	0	PUF60	144970881	1.000000	0.71417	0.998000	0.56505	0.928000	0.56348	5.393000	0.66279	2.537000	0.85549	0.551000	0.68910	GTG	PUF60	-	smart_RRM_dom_euk,smart_RRM_dom,pfscan_RRM_dom	ENSG00000179950		0.517	PUF60-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PUF60	HGNC	protein_coding	OTTHUMT00000382222.1		0.00	59	0	C	NM_014281		144898893	-1			no_errors	ENST00000526683	ensembl	human	known	74_37	missense	5.41	35	2	SNP	1.000	T
PVRL3	25945	genome.wustl.edu	37	3	110831057	110831057	+	Missense_Mutation	SNP	A	A	G			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr3:110831057A>G	ENST00000485303.1	+	2	616	c.341A>G	c.(340-342)cAa>cGa	p.Q114R	PVRL3_ENST00000488016.1_3'UTR|PVRL3_ENST00000493615.1_Missense_Mutation_p.Q91R|PVRL3_ENST00000319792.3_Missense_Mutation_p.Q114R	NM_001243286.1|NM_015480.2	NP_001230215.1|NP_056295.1	Q9NQS3	PVRL3_HUMAN	poliovirus receptor-related 3	114	Ig-like V-type.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|fertilization (GO:0009566)|homophilic cell adhesion (GO:0007156)|lens morphogenesis in camera-type eye (GO:0002089)|retina morphogenesis in camera-type eye (GO:0060042)|single organismal cell-cell adhesion (GO:0016337)	apical junction complex (GO:0043296)|cell-cell adherens junction (GO:0005913)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	cell adhesion molecule binding (GO:0050839)|protein homodimerization activity (GO:0042803)			breast(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(3)|lung(7)|upper_aerodigestive_tract(3)	19						TTCTCTGTTCAAGGAGAATAT	0.363																																																	0													106.0	101.0	103.0					3																	110831057		2203	4300	6503	SO:0001583	missense	0			AF282874	CCDS2957.1, CCDS58842.1, CCDS58843.1	3q13	2013-01-29			ENSG00000177707	ENSG00000177707		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17664	protein-coding gene	gene with protein product		607147				11024295	Standard	NM_015480		Approved	nectin-3, PPR3, PVRR3, DKFZP566B0846, CDw113, CD113	uc003dxt.2	Q9NQS3	OTTHUMG00000159239	ENST00000485303.1:c.341A>G	3.37:g.110831057A>G	ENSP00000418070:p.Gln114Arg		E9PFR0|Q6NVZ3|Q8NC05|Q8WVU4|Q9BVA9|Q9Y412	Missense_Mutation	SNP	pfam_CD80_C2-set,pfam_Ig_V-set,pfam_Ig_I-set,smart_Ig_sub,pfscan_Ig-like_dom	p.Q114R	ENST00000485303.1	37	c.341	CCDS2957.1	3	.	.	.	.	.	.	.	.	.	.	A	18.36	3.607139	0.66558	.	.	ENSG00000177707	ENST00000461477;ENST00000485303;ENST00000319792;ENST00000493615;ENST00000481766	T;T;T;T;T	0.65732	-0.17;-0.17;-0.17;-0.17;-0.17	5.84	5.84	0.93424	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.369914	0.31577	N	0.007418	T	0.57989	0.2091	L	0.27053	0.805	0.28291	N	0.923546	D;P	0.61697	0.99;0.912	P;B	0.53593	0.73;0.41	T	0.52185	-0.8609	10	0.11794	T	0.64	.	14.1823	0.65583	1.0:0.0:0.0:0.0	.	91;114	E9PFR0;Q9NQS3	.;PVRL3_HUMAN	R	67;114;114;91;99	ENSP00000418327:Q67R;ENSP00000418070:Q114R;ENSP00000321514:Q114R;ENSP00000420579:Q91R;ENSP00000420479:Q99R	ENSP00000321514:Q114R	Q	+	2	0	PVRL3	112313747	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.822000	0.69265	2.228000	0.72767	0.533000	0.62120	CAA	PVRL3	-	pfam_Ig_V-set,pfam_Ig_I-set,smart_Ig_sub,pfscan_Ig-like_dom	ENSG00000177707		0.363	PVRL3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PVRL3	HGNC	protein_coding	OTTHUMT00000354045.1	-	0.00	89	0	A	NM_015480		110831057	+1	tier1	-	no_errors	ENST00000485303	ensembl	human	known	74_37	missense	27.03	27	10	SNP	1.000	G
PVRL3	25945	genome.wustl.edu	37	3	110852913	110852913	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr3:110852913C>A	ENST00000485303.1	+	6	1776	c.1501C>A	c.(1501-1503)Ctc>Atc	p.L501I	PVRL3_ENST00000493615.1_Intron	NM_001243286.1|NM_015480.2	NP_001230215.1|NP_056295.1	Q9NQS3	PVRL3_HUMAN	poliovirus receptor-related 3	501					adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|fertilization (GO:0009566)|homophilic cell adhesion (GO:0007156)|lens morphogenesis in camera-type eye (GO:0002089)|retina morphogenesis in camera-type eye (GO:0060042)|single organismal cell-cell adhesion (GO:0016337)	apical junction complex (GO:0043296)|cell-cell adherens junction (GO:0005913)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	cell adhesion molecule binding (GO:0050839)|protein homodimerization activity (GO:0042803)			breast(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(3)|lung(7)|upper_aerodigestive_tract(3)	19						TGTAGAAAATCTCAATAGGTT	0.308																																																	0													41.0	44.0	43.0					3																	110852913		2201	4298	6499	SO:0001583	missense	0			AF282874	CCDS2957.1, CCDS58842.1, CCDS58843.1	3q13	2013-01-29			ENSG00000177707	ENSG00000177707		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17664	protein-coding gene	gene with protein product		607147				11024295	Standard	NM_015480		Approved	nectin-3, PPR3, PVRR3, DKFZP566B0846, CDw113, CD113	uc003dxt.2	Q9NQS3	OTTHUMG00000159239	ENST00000485303.1:c.1501C>A	3.37:g.110852913C>A	ENSP00000418070:p.Leu501Ile		E9PFR0|Q6NVZ3|Q8NC05|Q8WVU4|Q9BVA9|Q9Y412	Missense_Mutation	SNP	pfam_CD80_C2-set,pfam_Ig_V-set,pfam_Ig_I-set,smart_Ig_sub,pfscan_Ig-like_dom	p.L501I	ENST00000485303.1	37	c.1501	CCDS2957.1	3	.	.	.	.	.	.	.	.	.	.	C	7.440	0.640585	0.14386	.	.	ENSG00000177707	ENST00000485303	T	0.14640	2.49	5.8	4.89	0.63831	.	0.366370	0.29002	N	0.013443	T	0.09555	0.0235	L	0.43152	1.355	0.80722	D	1	B	0.31077	0.307	B	0.24155	0.051	T	0.13072	-1.0523	10	0.14252	T	0.57	.	7.6988	0.28611	0.1631:0.7546:0.0:0.0823	.	501	Q9NQS3	PVRL3_HUMAN	I	501	ENSP00000418070:L501I	ENSP00000418070:L501I	L	+	1	0	PVRL3	112335603	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	1.472000	0.35376	2.734000	0.93682	0.460000	0.39030	CTC	PVRL3	-	NULL	ENSG00000177707		0.308	PVRL3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PVRL3	HGNC	protein_coding	OTTHUMT00000354045.1	-	0.00	49	0	C	NM_015480		110852913	+1	tier1	-	no_errors	ENST00000485303	ensembl	human	known	74_37	missense	14.29	18	3	SNP	1.000	A
PYGB	5834	genome.wustl.edu	37	20	25262690	25262690	+	Silent	SNP	G	G	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr20:25262690G>T	ENST00000216962.4	+	12	1535	c.1425G>T	c.(1423-1425)ctG>ctT	p.L475L		NM_002862.3	NP_002853.2	P11216	PYGB_HUMAN	phosphorylase, glycogen; brain	475					carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	glycogen phosphorylase activity (GO:0008184)|pyridoxal phosphate binding (GO:0030170)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(12)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	31						TTTATGAACTGGAGCCAGAGA	0.527																																																	0													72.0	76.0	75.0					20																	25262690		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS13171.1	20p11.21	2013-03-01			ENSG00000100994	ENSG00000100994	2.4.1.1	"""Glycogen phosphorylases"""	9723	protein-coding gene	gene with protein product	"""glycogen phosphorylase, brain form"""	138550					Standard	NM_002862		Approved		uc002wup.3	P11216	OTTHUMG00000032117	ENST00000216962.4:c.1425G>T	20.37:g.25262690G>T			Q96AK1|Q9NPX8	Silent	SNP	pfam_Glyco_trans_35,pirsf_Glyco_trans_35,tigrfam_Glycg_phsphrylas	p.L475	ENST00000216962.4	37	c.1425	CCDS13171.1	20																																																																																			PYGB	-	pfam_Glyco_trans_35,pirsf_Glyco_trans_35,tigrfam_Glycg_phsphrylas	ENSG00000100994		0.527	PYGB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PYGB	HGNC	protein_coding	OTTHUMT00000078415.2	-	0.00	112	0	G	NM_002862		25262690	+1	tier1	-	no_errors	ENST00000216962	ensembl	human	known	74_37	silent	5.71	66	4	SNP	0.978	T
R3HDM2	22864	genome.wustl.edu	37	12	57652736	57652736	+	Nonsense_Mutation	SNP	G	G	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr12:57652736G>T	ENST00000347140.3	-	20	2586	c.2196C>A	c.(2194-2196)taC>taA	p.Y732*	R3HDM2_ENST00000403821.2_Nonsense_Mutation_p.Y766*|RP11-123K3.4_ENST00000548184.1_3'UTR|R3HDM2_ENST00000402412.1_Nonsense_Mutation_p.Y746*|R3HDM2_ENST00000441731.2_Nonsense_Mutation_p.Y427*|R3HDM2_ENST00000546843.1_5'UTR|R3HDM2_ENST00000358907.2_Nonsense_Mutation_p.Y732*|R3HDM2_ENST00000413953.2_Nonsense_Mutation_p.Y459*			Q9Y2K5	R3HD2_HUMAN	R3H domain containing 2	732						nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(3)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	22						CCATGCTGTAGTATTTACAAT	0.567																																																	0													81.0	76.0	78.0					12																	57652736		2203	4300	6503	SO:0001587	stop_gained	0			AB023219	CCDS8937.2	12q13.3	2012-11-19			ENSG00000179912	ENSG00000179912			29167	protein-coding gene	gene with protein product							Standard	NM_014925		Approved	KIAA1002	uc009zpm.1	Q9Y2K5	OTTHUMG00000171568	ENST00000347140.3:c.2196C>A	12.37:g.57652736G>T	ENSP00000317903:p.Tyr732*		Q2M1T9|Q3ZCT5	Nonsense_Mutation	SNP	pfam_R3H_ss-bd,smart_R3H_ss-bd,pfscan_R3H_ss-bd	p.Y732*	ENST00000347140.3	37	c.2196	CCDS8937.2	12	.	.	.	.	.	.	.	.	.	.	G	26.7	4.765100	0.90020	.	.	ENSG00000179912	ENST00000413953;ENST00000393811;ENST00000347140;ENST00000402412;ENST00000358907;ENST00000441731;ENST00000429355;ENST00000403821;ENST00000548161	.	.	.	5.22	-3.72	0.04411	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-7.6038	14.4188	0.67168	0.379:0.0:0.621:0.0	.	.	.	.	X	459;459;732;746;732;427;497;766;121	.	ENSP00000317903:Y732X	Y	-	3	2	R3HDM2	55939003	0.961000	0.32948	0.979000	0.43373	0.993000	0.82548	0.151000	0.16283	-0.534000	0.06315	-0.302000	0.09304	TAC	R3HDM2	-	NULL	ENSG00000179912		0.567	R3HDM2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	R3HDM2	HGNC	protein_coding	OTTHUMT00000326570.2	-	0.00	73	0	G	NM_014925		57652736	-1	tier1	-	no_errors	ENST00000347140	ensembl	human	known	74_37	nonsense	7.27	51	4	SNP	0.972	T
RAD17	5884	genome.wustl.edu	37	5	68689059	68689059	+	Nonsense_Mutation	SNP	G	G	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr5:68689059G>T	ENST00000509734.1	+	13	1978	c.1300G>T	c.(1300-1302)Gaa>Taa	p.E434*	RAD17_ENST00000358030.2_Nonsense_Mutation_p.E258*|RAD17_ENST00000305138.4_Nonsense_Mutation_p.E423*|RAD17_ENST00000361732.2_Nonsense_Mutation_p.E423*|RAD17_ENST00000504177.1_Intron|RAD17_ENST00000354868.5_Nonsense_Mutation_p.E423*|RAD17_ENST00000521422.1_Nonsense_Mutation_p.E258*|RAD17_ENST00000345306.6_Nonsense_Mutation_p.E423*|RAD17_ENST00000354312.3_Nonsense_Mutation_p.E423*|RAD17_ENST00000282891.6_Nonsense_Mutation_p.E337*|RAD17_ENST00000380774.3_Nonsense_Mutation_p.E434*			O75943	RAD17_HUMAN	RAD17 homolog (S. pombe)	434	Interaction with MCM7.				cellular response to DNA damage stimulus (GO:0006974)|DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA replication checkpoint (GO:0000076)|mitotic cell cycle checkpoint (GO:0007093)|negative regulation of DNA replication (GO:0008156)|regulation of phosphorylation (GO:0042325)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)						Lung NSC(167;5.19e-05)|Prostate(74;0.0143)|Ovarian(174;0.0448)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;9.36e-57)|Epithelial(20;1.21e-52)|all cancers(19;3.34e-48)|Lung(70;0.0183)		ATTACTTGTTGAACCTGAGGT	0.323								Other conserved DNA damage response genes																																									0													82.0	81.0	81.0					5																	68689059		2203	4297	6500	SO:0001587	stop_gained	0			AF085736	CCDS4003.1, CCDS4004.1, CCDS4005.1, CCDS47226.1	5q13	2010-09-24	2001-11-28		ENSG00000152942	ENSG00000152942			9807	protein-coding gene	gene with protein product		603139	"""RAD1 (S. pombe) homolog"""			9869296, 9660800	Standard	NM_133343		Approved	Rad24, RAD17Sp, CCYC	uc003jwo.3	O75943	OTTHUMG00000099357	ENST00000509734.1:c.1300G>T	5.37:g.68689059G>T	ENSP00000426191:p.Glu434*		A8K8X2|D3DWA5|O75714|Q7Z3S4|Q9UNK7|Q9UNR7|Q9UNR8|Q9UPF5	Nonsense_Mutation	SNP	superfamily_P-loop_NTPase,tigrfam_Checkpoint_prot_Rad24_fun/met	p.E434*	ENST00000509734.1	37	c.1300	CCDS4003.1	5	.	.	.	.	.	.	.	.	.	.	G	42	9.406003	0.99161	.	.	ENSG00000152942	ENST00000361732;ENST00000509734;ENST00000354868;ENST00000521422;ENST00000354312;ENST00000345306;ENST00000305138;ENST00000282891;ENST00000358030;ENST00000380774;ENST00000513214	.	.	.	5.45	3.55	0.40652	.	0.736603	0.13582	N	0.377275	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07482	T	0.82	-21.5834	16.2442	0.82434	0.0:0.6676:0.3324:0.0	.	.	.	.	X	423;434;423;258;423;423;423;337;258;434;42	.	ENSP00000282891:E337X	E	+	1	0	RAD17	68724815	0.983000	0.35010	1.000000	0.80357	0.945000	0.59286	0.962000	0.29280	1.285000	0.44548	-0.499000	0.04595	GAA	RAD17	-	tigrfam_Checkpoint_prot_Rad24_fun/met	ENSG00000152942		0.323	RAD17-008	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	RAD17	HGNC	protein_coding	OTTHUMT00000369171.1	-	0.00	77	0	G	NM_133344		68689059	+1	tier1	-	no_errors	ENST00000380774	ensembl	human	known	74_37	nonsense	10.26	35	4	SNP	0.674	T
RAG1	5896	genome.wustl.edu	37	11	36596307	36596307	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr11:36596307C>A	ENST00000299440.5	+	2	1565	c.1453C>A	c.(1453-1455)Cac>Aac	p.H485N		NM_000448.2	NP_000439	P15918	RAG1_HUMAN	recombination activating gene 1	485					adaptive immune response (GO:0002250)|B cell differentiation (GO:0030183)|DNA recombination (GO:0006310)|histone monoubiquitination (GO:0010390)|immune response (GO:0006955)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of thymocyte apoptotic process (GO:0070244)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|pre-B cell allelic exclusion (GO:0002331)|protein autoubiquitination (GO:0051865)|regulation of T cell differentiation (GO:0045580)|T cell differentiation in thymus (GO:0033077)|T cell homeostasis (GO:0043029)|thymus development (GO:0048538)|V(D)J recombination (GO:0033151)	nucleus (GO:0005634)	acid-amino acid ligase activity (GO:0016881)|DNA binding (GO:0003677)|endonuclease activity (GO:0004519)|histone binding (GO:0042393)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding (GO:0043565)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|liver(1)|lung(33)|ovary(1)|pancreas(1)|prostate(1)|skin(5)|urinary_tract(1)	65	all_lung(20;0.226)	all_hematologic(20;0.107)				CAGTCAGTACCACAAGATGTA	0.537									Familial Hemophagocytic Lymphohistiocytosis																												Pancreas(43;321 1249 3212 48200)|Esophageal Squamous(38;49 1003 17530 24363)												0													93.0	82.0	86.0					11																	36596307		2202	4298	6500	SO:0001583	missense	0	Familial Cancer Database	FHLH, FHL, Familial Hemophagocytic Reticulosis, FHR	M29474	CCDS7902.1	11p13	2014-09-17				ENSG00000166349		"""RING-type (C3HC4) zinc fingers"""	9831	protein-coding gene	gene with protein product	"""recombination activating protein 1"", ""RING finger protein 74"", ""V(D)J recombination-activating protein 1"""	179615				1612612, 1283330	Standard	NM_000448		Approved	RNF74, MGC43321	uc001mwu.4	P15918		ENST00000299440.5:c.1453C>A	11.37:g.36596307C>A	ENSP00000299440:p.His485Asn		E9PPC4|Q8IY72|Q8NER2	Missense_Mutation	SNP	pfam_Znf_VDJ_recomb-activ_1,smart_Znf_RING,pfscan_Znf_RING	p.H485N	ENST00000299440.5	37	c.1453	CCDS7902.1	11	.	.	.	.	.	.	.	.	.	.	C	19.52	3.842893	0.71488	.	.	ENSG00000166349	ENST00000534663;ENST00000299440	T;T	0.72615	-0.67;-0.66	5.58	5.58	0.84498	.	0.000000	0.85682	D	0.000000	D	0.84800	0.5552	M	0.81682	2.555	0.80722	D	1	P	0.51933	0.949	D	0.63381	0.914	D	0.86203	0.1620	10	0.87932	D	0	.	19.6271	0.95682	0.0:1.0:0.0:0.0	.	485	P15918	RAG1_HUMAN	N	485	ENSP00000434610:H485N;ENSP00000299440:H485N	ENSP00000299440:H485N	H	+	1	0	RAG1	36552883	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.487000	0.81328	2.649000	0.89929	0.650000	0.86243	CAC	RAG1	-	NULL	ENSG00000166349		0.537	RAG1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	RAG1	HGNC	protein_coding	OTTHUMT00000389535.1	-	0.00	36	0	C	NM_000448		36596307	+1	tier1	-	no_errors	ENST00000299440	ensembl	human	known	74_37	missense	13.79	25	4	SNP	1.000	A
RAP1GAP2	23108	genome.wustl.edu	37	17	2923853	2923853	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr17:2923853C>T	ENST00000254695.8	+	19	1805	c.1715C>T	c.(1714-1716)aCg>aTg	p.T572M	RAP1GAP2_ENST00000540393.2_Missense_Mutation_p.T553M|RAP1GAP2_ENST00000366401.4_Missense_Mutation_p.T557M|RAP1GAP2_ENST00000542807.1_Missense_Mutation_p.T572M	NM_015085.4	NP_055900.4	Q684P5	RPGP2_HUMAN	RAP1 GTPase activating protein 2	572					negative regulation of neuron projection development (GO:0010977)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|neuron projection (GO:0043005)|nuclear membrane (GO:0031965)	Rap GTPase activator activity (GO:0046582)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)	11						CGCCTGCACACGGGCTCAGAA	0.632																																																	0													26.0	33.0	31.0					17																	2923853		1941	4122	6063	SO:0001583	missense	0			AB028962	CCDS45573.1, CCDS45574.1	17p13.3	2009-09-14	2009-09-14	2009-09-14		ENSG00000132359			29176	protein-coding gene	gene with protein product			"""GTPase activating RANGAP domain-like 4"", ""GTPase activating Rap/RanGAP domain-like 4"""	GARNL4		15632203	Standard	NM_015085		Approved	KIAA1039	uc010ckd.3	Q684P5		ENST00000254695.8:c.1715C>T	17.37:g.2923853C>T	ENSP00000254695:p.Thr572Met		B2RTY5|Q684P4|Q6AI00|Q6ZVF0|Q9UPW2	Missense_Mutation	SNP	pfam_Rap_GAP_dom,pfscan_Rap_GAP_dom	p.T572M	ENST00000254695.8	37	c.1715	CCDS45573.1	17	.	.	.	.	.	.	.	.	.	.	C	16.49	3.136695	0.56936	.	.	ENSG00000132359	ENST00000254695;ENST00000366401;ENST00000540393;ENST00000542807	D;D;D;D	0.89050	-2.45;-2.46;-2.45;-2.45	5.16	4.19	0.49359	.	0.201381	0.52532	D	0.000079	T	0.76147	0.3947	N	0.08118	0	0.44807	D	0.997816	B;B	0.32939	0.391;0.271	B;B	0.26969	0.075;0.034	T	0.75227	-0.3392	10	0.42905	T	0.14	-14.0006	12.7582	0.57347	0.0:0.9211:0.0:0.0789	.	557;572	Q684P5-2;Q684P5	.;RPGP2_HUMAN	M	572;557;553;572	ENSP00000254695:T572M;ENSP00000389824:T557M;ENSP00000439688:T553M;ENSP00000444890:T572M	ENSP00000254695:T572M	T	+	2	0	RAP1GAP2	2870603	1.000000	0.71417	0.994000	0.49952	0.900000	0.52787	4.960000	0.63673	1.186000	0.42985	0.561000	0.74099	ACG	RAP1GAP2	-	NULL	ENSG00000132359		0.632	RAP1GAP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RAP1GAP2	HGNC	protein_coding	OTTHUMT00000438208.2	-	0.00	94	0	C			2923853	+1	tier1	-	no_errors	ENST00000254695	ensembl	human	known	74_37	missense	8.89	41	4	SNP	1.000	T
RASSF2	9770	genome.wustl.edu	37	20	4764195	4764195	+	3'UTR	SNP	T	T	A			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr20:4764195T>A	ENST00000379400.3	-	0	1900				RASSF2_ENST00000379376.2_3'UTR|RASSF2_ENST00000478553.1_5'UTR	NM_014737.2	NP_055552.1	P50749	RASF2_HUMAN	Ras association (RalGDS/AF-6) domain family member 2						bone remodeling (GO:0046849)|cell cycle (GO:0007049)|epidermal growth factor receptor signaling pathway via I-kappaB kinase/NF-kappaB cascade (GO:0038168)|homeostasis of number of cells (GO:0048872)|negative regulation of NIK/NF-kappaB signaling (GO:1901223)|ossification (GO:0001503)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(3)|kidney(2)|large_intestine(8)|lung(12)|ovary(3)|pancreas(2)|prostate(2)|skin(2)	34						GGTTTCCACATAGAACATCAC	0.428																																					Melanoma(158;1891 3343 50738)												0																																										SO:0001624	3_prime_UTR_variant	0			D79990	CCDS13083.1	20p13	2011-08-12	2008-02-22		ENSG00000101265	ENSG00000101265			9883	protein-coding gene	gene with protein product	"""centromere protein 34"""	609492				8724849, 15806169	Standard	NM_014737		Approved	KIAA0168, CENP-34	uc002wld.3	P50749	OTTHUMG00000031790	ENST00000379400.3:c.*724A>T	20.37:g.4764195T>A			A6NIX9|A8K5Z3|Q17S06|Q53HD0|Q6AHZ2|Q8IZA5	RNA	SNP	-	NULL	ENST00000379400.3	37	NULL	CCDS13083.1	20																																																																																			RASSF2	-	-	ENSG00000101265		0.428	RASSF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RASSF2	HGNC	protein_coding	OTTHUMT00000077828.1	-	0.00	43	0	T	NM_014737		4764195	-1	tier1	-	no_errors	ENST00000478553	ensembl	human	known	74_37	rna	28.00	18	7	SNP	0.000	A
RBM15	64783	genome.wustl.edu	37	1	110883406	110883406	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr1:110883406G>C	ENST00000369784.3	+	1	2279	c.1379G>C	c.(1378-1380)gGa>gCa	p.G460A	RP5-1074L1.1_ENST00000449169.1_RNA|RBM15_ENST00000487146.2_Missense_Mutation_p.G460A|RBM15_ENST00000602849.1_Missense_Mutation_p.G460A	NM_022768.4	NP_073605.4	Q96T37	RBM15_HUMAN	RNA binding motif protein 15	460	RRM 3. {ECO:0000255|PROSITE- ProRule:PRU00176}.				negative regulation of myeloid cell differentiation (GO:0045638)|patterning of blood vessels (GO:0001569)|placenta blood vessel development (GO:0060674)|positive regulation of transcription of Notch receptor target (GO:0007221)|spleen development (GO:0048536)|ventricular septum morphogenesis (GO:0060412)|viral process (GO:0016032)	membrane (GO:0016020)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			ovary(3)	3		all_cancers(81;2.89e-06)|all_epithelial(167;2.96e-06)|all_lung(203;0.000116)|Lung NSC(277;0.000233)|Breast(1374;0.0634)		BRCA - Breast invasive adenocarcinoma(282;0.000224)|Epithelial(280;0.000476)|Kidney(133;0.000539)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|all cancers(265;0.00144)|Lung(183;0.0238)|Colorectal(144;0.103)|LUSC - Lung squamous cell carcinoma(189;0.135)		CTCTGGGTGGGAGGCCTGGGA	0.498			T	MKL1	acute megakaryocytic leukemia																																			Dom	yes		1	1p13	64783	RNA binding motif protein 15		L	0													67.0	72.0	71.0					1																	110883406		2203	4300	6503	SO:0001583	missense	0			AF368063	CCDS822.1, CCDS59198.1	1p13	2013-02-12			ENSG00000162775	ENSG00000162775		"""RNA binding motif (RRM) containing"""	14959	protein-coding gene	gene with protein product	"""one twenty-two"""	606077				11431691, 11344311	Standard	NM_001201545		Approved	OTT, OTT1	uc001dzl.1	Q96T37	OTTHUMG00000011284	ENST00000369784.3:c.1379G>C	1.37:g.110883406G>C	ENSP00000358799:p.Gly460Ala		A1A693|Q3ZB86|Q4V760|Q5D058|Q5T613|Q86VW9|Q96PE4|Q96SC5|Q96SC6|Q96SC9|Q96SD0|Q96T38|Q9BRA5|Q9H6R8|Q9H9Y0	Missense_Mutation	SNP	pfam_SPOC_C,pfam_RRM_dom,superfamily_SPOC_like_C_dom,smart_RRM_dom,pfscan_SPOC_met,pfscan_RRM_dom	p.G460A	ENST00000369784.3	37	c.1379	CCDS822.1	1	.	.	.	.	.	.	.	.	.	.	G	19.95	3.921729	0.73213	.	.	ENSG00000162775	ENST00000369784	T	0.08546	3.08	4.94	4.94	0.65067	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (2);	0.000000	0.47455	D	0.000230	T	0.28499	0.0705	M	0.87758	2.905	0.80722	D	1	P;D	0.76494	0.864;0.999	P;D	0.91635	0.706;0.999	T	0.14587	-1.0467	10	0.72032	D	0.01	-9.0998	18.3212	0.90239	0.0:0.0:1.0:0.0	.	460;460	Q96T37-3;Q96T37	.;RBM15_HUMAN	A	460	ENSP00000358799:G460A	ENSP00000358799:G460A	G	+	2	0	RBM15	110684929	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	9.263000	0.95617	2.563000	0.86464	0.655000	0.94253	GGA	RBM15	-	smart_RRM_dom,pfscan_RRM_dom	ENSG00000162775		0.498	RBM15-001	KNOWN	basic|CCDS	protein_coding	RBM15	HGNC	protein_coding	OTTHUMT00000031114.2		0.00	45	0	G	NM_022768		110883406	+1			no_errors	ENST00000369784	ensembl	human	known	74_37	missense	13.64	19	3	SNP	1.000	C
RBM26	64062	genome.wustl.edu	37	13	79915342	79915342	+	Missense_Mutation	SNP	G	G	T	rs537025965		TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr13:79915342G>T	ENST00000438737.2	-	18	2888	c.2448C>A	c.(2446-2448)gaC>gaA	p.D816E	RBM26_ENST00000438724.1_Missense_Mutation_p.D792E|RBM26_ENST00000267229.7_Missense_Mutation_p.D789E			Q5T8P6	RBM26_HUMAN	RNA binding motif protein 26	816					mRNA processing (GO:0006397)|negative regulation of phosphatase activity (GO:0010923)		metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|biliary_tract(1)|breast(2)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(6)|lung(7)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	33		Acute lymphoblastic leukemia(28;0.0279)		GBM - Glioblastoma multiforme(99;0.0188)		CCAGTTCTGTGTCAAGTAATT	0.308																																																	0													119.0	109.0	113.0					13																	79915342		2202	4298	6500	SO:0001583	missense	0			AF116667	CCDS9462.1, CCDS66566.1, CCDS73591.1	13q31.1	2014-06-13	2006-06-22	2006-06-22	ENSG00000139746	ENSG00000139746		"""Zinc fingers, CCCH-type domain containing"", ""RNA binding motif (RRM) containing"""	20327	protein-coding gene	gene with protein product	"""acidic rich RS domain containing 2"", ""protein phosphatase 1, regulatory 132"""		"""chromosome 13 open reading frame 10"""	C13orf10		11149944, 15741184	Standard	XM_005266497		Approved	PRO1777, SE70-2, FLJ20957, ZC3H17, ARRS2, PPP1R132	uc001vky.2	Q5T8P6	OTTHUMG00000017133	ENST00000438737.2:c.2448C>A	13.37:g.79915342G>T	ENSP00000387531:p.Asp816Glu		B4DZE0|Q2NKM2|Q2NKQ2|Q5CZH8|Q5T8P5|Q5T8P8|Q5U5P5|Q5W0G7|Q8N3H5|Q96K92|Q96SZ3|Q9H2F8|Q9H7F9|Q9P1G7	Missense_Mutation	SNP	pfam_PWI_dom,superfamily_PWI_dom,smart_Znf_CCCH,smart_RRM_dom,pfscan_RRM_dom	p.D792E	ENST00000438737.2	37	c.2376		13	.	.	.	.	.	.	.	.	.	.	G	18.97	3.735868	0.69189	.	.	ENSG00000139746	ENST00000449987;ENST00000267229;ENST00000438737;ENST00000327303;ENST00000438724	T;T	0.46063	0.88;0.88	5.3	4.44	0.53790	.	0.000000	0.85682	D	0.000000	T	0.62270	0.2414	M	0.84326	2.69	0.54753	D	0.999983	D;P;P;P	0.64830	0.994;0.935;0.893;0.935	D;P;B;P	0.72625	0.978;0.648;0.446;0.648	T	0.64984	-0.6278	9	.	.	.	-12.0226	8.1133	0.30928	0.1836:0.0:0.8164:0.0	.	173;792;816;789	B4DZH7;Q5T8P6-2;Q5T8P6;Q5T8P6-3	.;.;RBM26_HUMAN;.	E	2;789;817;816;792	ENSP00000267229:D789E;ENSP00000390222:D792E	.	D	-	3	2	RBM26	78813343	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	1.142000	0.31540	2.477000	0.83638	0.650000	0.86243	GAC	RBM26	-	NULL	ENSG00000139746		0.308	RBM26-004	NOVEL	not_organism_supported|basic	protein_coding	RBM26	HGNC	protein_coding	OTTHUMT00000045373.4		0.00	54	0	G	NM_022118		79915342	-1			no_errors	ENST00000438724	ensembl	human	known	74_37	missense	10.53	17	2	SNP	1.000	T
RIMS2	9699	genome.wustl.edu	37	8	104780629	104780629	+	Intron	SNP	C	C	G			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr8:104780629C>G	ENST00000406091.3	+	3	698					NM_001100117.2	NP_001093587.1	Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2						calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cAMP-mediated signaling (GO:0019933)|insulin secretion (GO:0030073)|intracellular protein transport (GO:0006886)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|regulation of exocytosis (GO:0017157)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	metal ion binding (GO:0046872)			NS(1)|breast(4)|central_nervous_system(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(22)|liver(1)|lung(68)|ovary(6)|pancreas(2)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(10)|urinary_tract(1)	144			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			TGCTGATGCTCTGGTTGAAGA	0.483										HNSCC(12;0.0054)																																							0																																										SO:0001627	intron_variant	0			AB018294	CCDS43761.1, CCDS64948.1, CCDS64949.1	8q22.3	2008-08-08	2002-06-12	2002-06-14					17283	protein-coding gene	gene with protein product		606630	"""RAB3 interacting protein 3"""	RAB3IP3		9872452, 12578829	Standard	NM_014677		Approved	KIAA0751, RIM2, OBOE	uc003ylp.3	Q9UQ26		ENST00000406091.3:c.698+1864C>G	8.37:g.104780629C>G			B3KX91|F8WD47|O43413|Q86XL9|Q8IWV9|Q8IWW1	RNA	SNP	-	NULL	ENST00000406091.3	37	NULL	CCDS55269.1	8																																																																																			RIMS2	-	-	ENSG00000176406		0.483	RIMS2-202	KNOWN	basic|appris_principal|CCDS	protein_coding	RIMS2	HGNC	protein_coding		-	0.00	40	0	C	NM_001100117		104780629	+1	tier1	-	no_errors	ENST00000395361	ensembl	human	known	74_37	rna	20.00	20	5	SNP	1.000	G
RNF175	285533	genome.wustl.edu	37	4	154631573	154631573	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr4:154631573G>T	ENST00000347063.4	-	9	1307	c.935C>A	c.(934-936)cCt>cAt	p.P312H		NM_173662.2	NP_775933	Q8N4F7	RN175_HUMAN	ring finger protein 175	312						integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|large_intestine(5)|lung(1)|ovary(1)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)	13	all_hematologic(180;0.093)	Renal(120;0.118)				TATCACCACAGGTTGCCAGGC	0.448																																																	0													77.0	71.0	73.0					4																	154631573		1925	4136	6061	SO:0001583	missense	0			BC034385	CCDS47149.1	4q31.3	2008-02-05			ENSG00000145428	ENSG00000145428		"""RING-type (C3HC4) zinc fingers"""	27735	protein-coding gene	gene with protein product							Standard	NM_173662		Approved	FLJ34190	uc003int.3	Q8N4F7	OTTHUMG00000161557	ENST00000347063.4:c.935C>A	4.37:g.154631573G>T	ENSP00000340979:p.Pro312His		C9JL66|Q8NB61	Missense_Mutation	SNP	smart_Znf_RING,pfscan_Znf_RING	p.P312H	ENST00000347063.4	37	c.935	CCDS47149.1	4	.	.	.	.	.	.	.	.	.	.	G	23.6	4.435844	0.83885	.	.	ENSG00000145428	ENST00000347063	T	0.65549	-0.16	4.26	4.26	0.50523	.	0.000000	0.64402	D	0.000001	D	0.82545	0.5060	M	0.91140	3.18	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.86458	0.1777	10	0.87932	D	0	-14.2741	15.001	0.71473	0.0:0.0:1.0:0.0	.	312	Q8N4F7	RN175_HUMAN	H	312	ENSP00000340979:P312H	ENSP00000340979:P312H	P	-	2	0	RNF175	154851023	1.000000	0.71417	0.995000	0.50966	0.997000	0.91878	5.745000	0.68672	2.646000	0.89796	0.655000	0.94253	CCT	RNF175	-	NULL	ENSG00000145428		0.448	RNF175-001	KNOWN	non_canonical_TEC|basic|appris_principal|CCDS	protein_coding	RNF175	HGNC	protein_coding	OTTHUMT00000365286.1	-	0.00	95	0	G	NM_173662		154631573	-1	tier1	-	no_errors	ENST00000347063	ensembl	human	known	74_37	missense	8.70	42	4	SNP	1.000	T
RPL7A	6130	genome.wustl.edu	37	9	136217061	136217061	+	Intron	SNP	C	C	A			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr9:136217061C>A	ENST00000323345.6	+	5	445				MED22_ENST00000471524.1_5'Flank|SNORD36C_ENST00000516733.1_RNA|MED22_ENST00000371999.1_5'Flank|MED22_ENST00000491289.1_5'Flank|SNORD36A_ENST00000362874.1_RNA|MED22_ENST00000344469.5_5'Flank|MED22_ENST00000476080.1_5'Flank|SURF1_ENST00000495952.1_5'Flank|RPL7A_ENST00000463740.1_Intron|SNORD36B_ENST00000363961.1_RNA|RPL7A_ENST00000315731.4_Intron|MED22_ENST00000343730.5_5'Flank|SNORD24_ENST00000383884.1_RNA	NM_000972.2	NP_000963.1	P62424	RL7A_HUMAN	ribosomal protein L7a						cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|ribosome biogenesis (GO:0042254)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleus (GO:0005634)|polysomal ribosome (GO:0042788)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			cervix(1)|endometrium(1)|kidney(1)|lung(3)|upper_aerodigestive_tract(1)	7				OV - Ovarian serous cystadenocarcinoma(145;4.93e-07)|Epithelial(140;4.09e-06)|all cancers(34;3.78e-05)		AGAGCAGGCCCTGTGAGTGCT	0.478																																																	0													75.0	62.0	67.0					9																	136217061		2203	4300	6503	SO:0001627	intron_variant	0			BC005128	CCDS6965.1	9q34	2011-04-06			ENSG00000148303	ENSG00000148303		"""L ribosomal proteins"""	10364	protein-coding gene	gene with protein product	"""surfeit 3"", ""PLA-X polypeptide"", ""surfeit locus protein 3"", ""60S ribosomal protein L7a"", "";"", ""thyroid hormone receptor uncoupling protein"""	185640				2403926, 2966065	Standard	NM_000972		Approved	SURF3, TRUP, L7A	uc004cde.1	P62424	OTTHUMG00000020864	ENST00000323345.6:c.416-34C>A	9.37:g.136217061C>A			P11518|Q5T8U4	RNA	SNP	-	NULL	ENST00000323345.6	37	NULL	CCDS6965.1	9																																																																																			RPL7A	-	-	ENSG00000148303		0.478	RPL7A-009	KNOWN	basic|appris_principal|CCDS	protein_coding	RPL7A	HGNC	protein_coding	OTTHUMT00000054869.1	-	0.00	61	0	C	NM_000972		136217061	+1	tier1	-	no_errors	ENST00000485706	ensembl	human	known	74_37	rna	8.51	43	4	SNP	0.000	A
RYR2	6262	genome.wustl.edu	37	1	237787161	237787161	+	Missense_Mutation	SNP	A	A	G	rs373235823		TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr1:237787161A>G	ENST00000366574.2	+	39	6330	c.6013A>G	c.(6013-6015)Aca>Gca	p.T2005A	RYR2_ENST00000360064.6_Missense_Mutation_p.T2003A|RYR2_ENST00000542537.1_Missense_Mutation_p.T1989A	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	2005	4 X approximate repeats.				BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			AGATTTGATGACACATTGTGG	0.308																																																	0								A	ALA/THR	0,3642		0,0,1821	108.0	105.0	105.0		6013	0.4	1.0	1		105	1,8151		0,1,4075	no	missense	RYR2	NM_001035.2	58	0,1,5896	GG,GA,AA		0.0123,0.0,0.0085	possibly-damaging	2005/4968	237787161	1,11793	1821	4076	5897	SO:0001583	missense	0			X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.6013A>G	1.37:g.237787161A>G	ENSP00000355533:p.Thr2005Ala		Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	pfam_Ca-rel_channel,pfam_Ryanodine_rcpt,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR_motif,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR_motif,superfamily_ConA-like_lec_gl_sf,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_EF_hand_dom,pfscan_MIR_motif	p.T2003A	ENST00000366574.2	37	c.6007	CCDS55691.1	1	.	.	.	.	.	.	.	.	.	.	A	0.677	-0.799577	0.02841	0.0	1.23E-4	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537	T;T;T	0.71698	-0.59;-0.59;-0.59	5.34	0.396	0.16309	.	0.298226	0.27509	N	0.019047	T	0.33933	0.0880	N	0.02247	-0.625	0.80722	D	1	B	0.12630	0.006	B	0.08055	0.003	T	0.18555	-1.0333	10	0.06625	T	0.88	.	5.5188	0.16921	0.5191:0.0:0.3546:0.1263	.	2005	Q92736	RYR2_HUMAN	A	2005;2003;1989	ENSP00000355533:T2005A;ENSP00000353174:T2003A;ENSP00000443798:T1989A	ENSP00000353174:T2003A	T	+	1	0	RYR2	235853784	0.386000	0.25180	0.981000	0.43875	0.911000	0.54048	0.406000	0.21032	-0.105000	0.12132	-0.296000	0.09543	ACA	RYR2	-	NULL	ENSG00000198626		0.308	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	RYR2	HGNC	protein_coding	OTTHUMT00000095402.2		0.00	106	0	A	NM_001035		237787161	+1			no_errors	ENST00000360064	ensembl	human	known	74_37	missense	5.19	73	4	SNP	0.771	G
SAMD9L	219285	genome.wustl.edu	37	7	92761639	92761639	+	Missense_Mutation	SNP	A	A	G			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr7:92761639A>G	ENST00000318238.4	-	5	4862	c.3646T>C	c.(3646-3648)Ttt>Ctt	p.F1216L	SAMD9L_ENST00000437805.1_Missense_Mutation_p.F1216L|SAMD9L_ENST00000411955.1_Missense_Mutation_p.F1216L	NM_152703.2	NP_689916.2	Q8IVG5	SAM9L_HUMAN	sterile alpha motif domain containing 9-like	1216					common myeloid progenitor cell proliferation (GO:0035726)|endosomal vesicle fusion (GO:0034058)|hematopoietic progenitor cell differentiation (GO:0002244)|regulation of protein catabolic process (GO:0042176)|spleen development (GO:0048536)|stem cell division (GO:0017145)	early endosome (GO:0005769)				central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(23)|liver(2)|lung(31)|ovary(5)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	88	all_cancers(62;4.15e-11)|all_epithelial(64;2.29e-10)|Breast(17;0.000675)|Lung NSC(181;0.0755)|all_lung(186;0.0989)		STAD - Stomach adenocarcinoma(171;0.000302)			TTGTGGAAAAAGGGAGTGAGC	0.378																																																	0													105.0	100.0	101.0					7																	92761639		2203	4299	6502	SO:0001583	missense	0			AB095926	CCDS34681.1	7q21.2	2013-01-10		2005-04-26	ENSG00000177409	ENSG00000177409		"""Sterile alpha motif (SAM) domain containing"""	1349	protein-coding gene	gene with protein product		611170	"""chromosome 7 open reading frame 6"""	C7orf6			Standard	NM_152703		Approved	KIAA2005, FLJ39885	uc003umh.1	Q8IVG5	OTTHUMG00000155807	ENST00000318238.4:c.3646T>C	7.37:g.92761639A>G	ENSP00000326247:p.Phe1216Leu		A0JP23|A0JP24|A0PJG8|A4D1G8|D6W5Q6|Q2TV71|Q2TV75|Q2UZV8|Q8IWI4|Q8N3L9|Q8N875	Missense_Mutation	SNP	superfamily_SAM/pointed,superfamily_P-loop_NTPase,pfscan_SAM	p.F1216L	ENST00000318238.4	37	c.3646	CCDS34681.1	7	.	.	.	.	.	.	.	.	.	.	A	0.131	-1.113678	0.01799	.	.	ENSG00000177409	ENST00000318238;ENST00000411955;ENST00000437805	T;T;T	0.20598	2.06;2.06;2.06	4.77	0.449	0.16619	.	0.919380	0.09292	N	0.822145	T	0.06735	0.0172	N	0.02202	-0.64	0.09310	N	0.99999	B	0.02656	0.0	B	0.04013	0.001	T	0.38329	-0.9666	10	0.05721	T	0.95	-0.1325	7.8979	0.29717	0.6565:0.0:0.3435:0.0	.	1216	Q8IVG5	SAM9L_HUMAN	L	1216	ENSP00000326247:F1216L;ENSP00000405760:F1216L;ENSP00000408796:F1216L	ENSP00000326247:F1216L	F	-	1	0	SAMD9L	92599575	0.000000	0.05858	0.218000	0.23776	0.607000	0.37147	0.079000	0.14782	-0.005000	0.14395	0.383000	0.25322	TTT	SAMD9L	-	NULL	ENSG00000177409		0.378	SAMD9L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SAMD9L	HGNC	protein_coding	OTTHUMT00000341730.1	-	0.00	92	0	A	NM_152703		92761639	-1	tier1	-	no_errors	ENST00000318238	ensembl	human	known	74_37	missense	8.93	51	5	SNP	0.381	G
SCAF4	57466	genome.wustl.edu	37	21	33043731	33043731	+	Missense_Mutation	SNP	G	G	T	rs199740634	byFrequency	TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr21:33043731G>T	ENST00000286835.7	-	20	3807	c.3425C>A	c.(3424-3426)gCa>gAa	p.A1142E	SCAF4_ENST00000434667.3_Missense_Mutation_p.A1127E|SCAF4_ENST00000399804.1_Missense_Mutation_p.A1120E	NM_020706.2	NP_065757.1	O95104	SFR15_HUMAN	SR-related CTD-associated factor 4	1142						nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|endometrium(9)|kidney(9)|large_intestine(11)|lung(15)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	54						AGCCTCTGCTGCTGAGCCAGA	0.498																																																	0													58.0	51.0	54.0					21																	33043731		2203	4300	6503	SO:0001583	missense	0			AB032998	CCDS33537.1, CCDS46644.1, CCDS54482.1	21q22.1	2013-02-12	2011-01-10	2011-01-10	ENSG00000156304	ENSG00000156304		"""RNA binding motif (RRM) containing"""	19304	protein-coding gene	gene with protein product			"""splicing factor, arginine/serine-rich 15"""	SFRS15		10574461	Standard	NM_020706		Approved	KIAA1172, DKFZp434E098, SRA4	uc002ypd.2	O95104	OTTHUMG00000084903	ENST00000286835.7:c.3425C>A	21.37:g.33043731G>T	ENSP00000286835:p.Ala1142Glu		C9JLZ0|Q0P5W8|Q6P1M5|Q8N3I8|Q9UFM1|Q9ULP8	Missense_Mutation	SNP	pfam_RNA_pol_II-bd,pfam_RRM_dom,superfamily_ENTH_VHS,smart_CID_dom,smart_RRM_dom,pfscan_RRM_dom	p.A1142E	ENST00000286835.7	37	c.3425	CCDS33537.1	21	.	.	.	.	.	.	.	.	.	.	G	16.27	3.076972	0.55753	.	.	ENSG00000156304	ENST00000434667;ENST00000286835;ENST00000399804	T;T;T	0.51817	0.73;0.69;0.7	5.93	5.01	0.66863	.	0.312729	0.27778	N	0.017893	T	0.50205	0.1602	N	0.19112	0.55	0.29237	N	0.872882	D;P;B	0.71674	0.998;0.467;0.337	D;B;B	0.73708	0.981;0.215;0.107	T	0.47787	-0.9090	10	0.72032	D	0.01	-15.4045	9.6631	0.39967	0.103:0.1596:0.7374:0.0	.	1127;1120;1142	C9JLZ0;O95104-2;O95104	.;.;SFR15_HUMAN	E	1127;1142;1120	ENSP00000402377:A1127E;ENSP00000286835:A1142E;ENSP00000382703:A1120E	ENSP00000286835:A1142E	A	-	2	0	SCAF4	31965602	0.998000	0.40836	1.000000	0.80357	0.998000	0.95712	1.233000	0.32648	2.826000	0.97356	0.655000	0.94253	GCA	SCAF4	-	NULL	ENSG00000156304		0.498	SCAF4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SCAF4	HGNC	protein_coding	OTTHUMT00000192659.1	-	0.00	74	0	G	XM_047889		33043731	-1	tier1	-	no_errors	ENST00000286835	ensembl	human	known	74_37	missense	13.64	19	3	SNP	0.958	T
SCN10A	6336	genome.wustl.edu	37	3	38805007	38805007	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr3:38805007G>T	ENST00000449082.2	-	5	679	c.680C>A	c.(679-681)tCt>tAt	p.S227Y		NM_006514.2	NP_006505.2	Q9Y5Y9	SCNAA_HUMAN	sodium channel, voltage-gated, type X, alpha subunit	227					AV node cell to bundle of His cell communication (GO:0086067)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of cardiac muscle contraction (GO:0055117)|regulation of heart rate (GO:0002027)|regulation of ion transmembrane transport (GO:0034765)|sensory perception (GO:0007600)|sensory perception of pain (GO:0019233)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	C-fiber (GO:0044299)|extracellular vesicular exosome (GO:0070062)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)	p.S227Y(1)		NS(5)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(14)|kidney(5)|large_intestine(33)|lung(54)|ovary(5)|pancreas(1)|prostate(5)|skin(13)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	150				KIRC - Kidney renal clear cell carcinoma(284;0.0769)|Kidney(284;0.0945)	Benzocaine(DB01086)|Bupivacaine(DB00297)|Chloroprocaine(DB01161)|Cinchocaine(DB00527)|Cocaine(DB00907)|Dyclonine(DB00645)|Hexylcaine(DB00473)|Lacosamide(DB06218)|Levobupivacaine(DB01002)|Lidocaine(DB00281)|Mepivacaine(DB00961)|Orphenadrine(DB01173)|Oxybuprocaine(DB00892)|Procaine(DB00721)|Proparacaine(DB00807)|Ropivacaine(DB00296)|Valproic Acid(DB00313)	TGGGATCACAGAAACTGTTTT	0.443																																																	1	Substitution - Missense(1)	large_intestine(1)											162.0	159.0	160.0					3																	38805007		2203	4300	6503	SO:0001583	missense	0			AF117907	CCDS33736.1	3p22.2	2012-02-26	2007-01-23		ENSG00000185313	ENSG00000185313		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10582	protein-coding gene	gene with protein product		604427	"""sodium channel, voltage-gated, type X, alpha polypeptide"""			9839820, 10198179, 16382098	Standard	NM_006514		Approved	Nav1.8, hPN3, SNS, PN3	uc003ciq.3	Q9Y5Y9	OTTHUMG00000048245	ENST00000449082.2:c.680C>A	3.37:g.38805007G>T	ENSP00000390600:p.Ser227Tyr		A6NDQ1	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_Na_trans_assoc,pfam_PKD1_2_channel,prints_Na_channel_asu,prints_PKD_2	p.S227Y	ENST00000449082.2	37	c.680	CCDS33736.1	3	.	.	.	.	.	.	.	.	.	.	G	18.75	3.691059	0.68271	.	.	ENSG00000185313	ENST00000449082	D	0.98807	-5.15	4.42	3.53	0.40419	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.99432	0.9799	H	0.97491	4.015	0.48040	D	0.999574	D	0.89917	1.0	D	0.91635	0.999	D	0.98383	1.0559	10	0.87932	D	0	.	14.6754	0.68975	0.0:0.1463:0.8537:0.0	.	227	Q9Y5Y9	SCNAA_HUMAN	Y	227	ENSP00000390600:S227Y	ENSP00000390600:S227Y	S	-	2	0	SCN10A	38780011	1.000000	0.71417	0.944000	0.38274	0.881000	0.50899	9.477000	0.97925	1.176000	0.42840	-0.312000	0.09012	TCT	SCN10A	-	pfam_Ion_trans_dom	ENSG00000185313		0.443	SCN10A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	SCN10A	HGNC	protein_coding	OTTHUMT00000109745.3		0.00	82	0	G	NM_006514		38805007	-1			no_errors	ENST00000449082	ensembl	human	known	74_37	missense	5.71	33	2	SNP	1.000	T
SCN2A	6326	genome.wustl.edu	37	2	166231377	166231377	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr2:166231377G>C	ENST00000375437.2	+	22	4445	c.4155G>C	c.(4153-4155)gaG>gaC	p.E1385D	SCN2A_ENST00000375427.2_Missense_Mutation_p.E1385D|SCN2A_ENST00000283256.6_Missense_Mutation_p.E1385D|SCN2A_ENST00000357398.3_Missense_Mutation_p.E1385D	NM_001040142.1	NP_001035232.1	Q99250	SCN2A_HUMAN	sodium channel, voltage-gated, type II, alpha subunit	1385					intrinsic apoptotic signaling pathway in response to osmotic stress (GO:0008627)|membrane depolarization during action potential (GO:0086010)|myelination (GO:0042552)|neuron apoptotic process (GO:0051402)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon (GO:0030424)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intrinsic component of plasma membrane (GO:0031226)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|sodium channel complex (GO:0034706)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(1)|breast(7)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(27)|liver(2)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	118					Lamotrigine(DB00555)|Propofol(DB00818)|Valproic Acid(DB00313)|Zonisamide(DB00909)	ACTACAGTGAGTGCAAAGCTC	0.398																																																	0													102.0	97.0	99.0					2																	166231377		2203	4299	6502	SO:0001583	missense	0			AB208888	CCDS33313.1, CCDS33314.1	2q24.3	2012-02-26	2007-01-23	2007-01-23	ENSG00000136531	ENSG00000136531		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10588	protein-coding gene	gene with protein product		182390	"""sodium channel, voltage-gated, type II, alpha 2 polypeptide"", ""sodium channel, voltage-gated, type II, alpha 1 polypeptide"""	SCN2A1, SCN2A2		1317301, 16382098	Standard	XM_005246753		Approved	Nav1.2, HBSCII, HBSCI	uc002ude.3	Q99250	OTTHUMG00000044172	ENST00000375437.2:c.4155G>C	2.37:g.166231377G>C	ENSP00000364586:p.Glu1385Asp		A6NC14|A6NIQ5|Q14472|Q53T77|Q9BZC9|Q9BZD0	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_Na_trans_assoc,pfam_DUF3451,pfam_PKD1_2_channel,smart_IQ_motif_EF-hand-BS,prints_Na_channel_asu,prints_PKD_2,pfscan_IQ_motif_EF-hand-BS	p.E1385D	ENST00000375437.2	37	c.4155	CCDS33314.1	2	.	.	.	.	.	.	.	.	.	.	G	0.012	-1.651194	0.00785	.	.	ENSG00000136531	ENST00000375437;ENST00000357398;ENST00000283256;ENST00000375427	D;D;D;D	0.95885	-3.84;-3.83;-3.84;-3.83	4.41	-1.08	0.09936	Ion transport (1);	0.097532	0.44688	D	0.000426	D	0.83151	0.5192	N	0.11000	0.08	0.31260	N	0.693037	B;B	0.02656	0.0;0.0	B;B	0.09377	0.004;0.002	T	0.73799	-0.3869	10	0.02654	T	1	.	4.6996	0.12820	0.5387:0.0:0.3258:0.1354	.	1385;1385	Q99250-2;Q99250	.;SCN2A_HUMAN	D	1385	ENSP00000364586:E1385D;ENSP00000349973:E1385D;ENSP00000283256:E1385D;ENSP00000364576:E1385D	ENSP00000283256:E1385D	E	+	3	2	SCN2A	165939623	0.017000	0.18338	0.987000	0.45799	0.241000	0.25554	-0.787000	0.04618	-0.398000	0.07679	-0.373000	0.07131	GAG	SCN2A	-	pfam_Ion_trans_dom	ENSG00000136531		0.398	SCN2A-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SCN2A	HGNC	protein_coding	OTTHUMT00000102659.2	-	0.00	55	0	G	NM_021007		166231377	+1	tier1	-	no_errors	ENST00000283256	ensembl	human	known	74_37	missense	19.35	25	6	SNP	0.998	C
SEC16A	9919	genome.wustl.edu	37	9	139369032	139369032	+	Silent	SNP	G	G	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr9:139369032G>T	ENST00000371706.3	-	1	2535	c.2502C>A	c.(2500-2502)tcC>tcA	p.S834S	SEC16A_ENST00000431893.2_Silent_p.S834S|SEC16A_ENST00000313050.7_Silent_p.S1012S|SEC16A_ENST00000290037.6_Silent_p.S834S			O15027	SC16A_HUMAN	SEC16 homolog A (S. cerevisiae)	834					COPII vesicle coating (GO:0048208)|endoplasmic reticulum organization (GO:0007029)|protein transport (GO:0015031)|substantia nigra development (GO:0021762)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)				breast(1)|central_nervous_system(3)|endometrium(7)|kidney(5)|large_intestine(15)|lung(14)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51		Myeloproliferative disorder(178;0.0511)		Epithelial(140;2.9e-06)|OV - Ovarian serous cystadenocarcinoma(145;5.88e-06)		TGTCAGAATGGGACGGGTTGT	0.498																																																	0													25.0	26.0	26.0					9																	139369032		1938	4138	6076	SO:0001819	synonymous_variant	0			AK074565	CCDS55351.1, CCDS75936.1	9q34.3	2007-06-20	2007-06-20	2007-06-20	ENSG00000148396	ENSG00000148396			29006	protein-coding gene	gene with protein product		612854	"""KIAA0310"""	KIAA0310		9205841	Standard	NM_014866		Approved	p250	uc004chx.3	O15027	OTTHUMG00000020932	ENST00000371706.3:c.2502C>A	9.37:g.139369032G>T			A1YCA4|Q4G0D7|Q5SXP0|Q5SXP1|Q8N347|Q96HP1	Silent	SNP	NULL	p.S1012	ENST00000371706.3	37	c.3036		9																																																																																			SEC16A	-	NULL	ENSG00000148396		0.498	SEC16A-001	KNOWN	basic	protein_coding	SEC16A	HGNC	protein_coding	OTTHUMT00000055077.1	-	0.00	95	0	G	XM_088459		139369032	-1	tier1	-	no_errors	ENST00000313050	ensembl	human	known	74_37	silent	8.70	42	4	SNP	0.001	T
SEMA6D	80031	genome.wustl.edu	37	15	48059241	48059241	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr15:48059241G>T	ENST00000316364.5	+	17	2155	c.1716G>T	c.(1714-1716)ttG>ttT	p.L572F	SEMA6D_ENST00000536845.2_Missense_Mutation_p.L572F|SEMA6D_ENST00000558816.1_Intron|SEMA6D_ENST00000389432.2_Missense_Mutation_p.L585F|SEMA6D_ENST00000537942.1_Intron|SEMA6D_ENST00000355997.3_Intron|SEMA6D_ENST00000389433.2_Intron|SEMA6D_ENST00000389428.3_Intron|SEMA6D_ENST00000558014.1_Intron|SEMA6D_ENST00000354744.4_Missense_Mutation_p.L572F|SEMA6D_ENST00000358066.4_Intron	NM_153618.1	NP_705871.1	Q8NFY4	SEM6D_HUMAN	sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6D	572					axon guidance (GO:0007411)|negative regulation of smooth muscle cell migration (GO:0014912)|positive regulation of smooth muscle cell migration (GO:0014911)|ventricular system development (GO:0021591)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			biliary_tract(1)|breast(4)|endometrium(4)|kidney(5)|large_intestine(10)|lung(42)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	77		all_lung(180;0.000635)|Myeloproliferative disorder(241;0.116)|Melanoma(134;0.18)		all cancers(107;1.2e-11)|GBM - Glioblastoma multiforme(94;1.2e-06)		TAGAAATTTTGCCTACTTCAA	0.259																																																	0													62.0	67.0	65.0					15																	48059241		2198	4297	6495	SO:0001583	missense	0			AF389430	CCDS32224.1, CCDS32225.1, CCDS32226.1, CCDS32227.1, CCDS32228.1, CCDS32229.1	15q21.1	2006-09-18				ENSG00000137872		"""Semaphorins"""	16770	protein-coding gene	gene with protein product		609295				12110693, 14977921	Standard	NM_020858		Approved	KIAA1479, FLJ11598	uc001zvy.3	Q8NFY4		ENST00000316364.5:c.1716G>T	15.37:g.48059241G>T	ENSP00000324857:p.Leu572Phe		A6NF10|A6NM95|A6NNK1|A7E2A0|Q8NFY3|Q8NFY5|Q8NFY6|Q8NFY7|Q9P249	Missense_Mutation	SNP	pfam_Semap_dom,pfam_Plexin_repeat,superfamily_Semap_dom,superfamily_Plexin-like_fold,smart_Semap_dom,smart_Plexin-like_fold,pfscan_Semap_dom	p.L572F	ENST00000316364.5	37	c.1716	CCDS32225.1	15	.	.	.	.	.	.	.	.	.	.	G	15.21	2.764943	0.49574	.	.	ENSG00000137872	ENST00000536845;ENST00000316364;ENST00000389432;ENST00000354744	T;T;T;T	0.19394	2.15;2.15;2.19;2.24	5.36	5.36	0.76844	.	0.357352	0.27682	N	0.018289	T	0.23289	0.0563	L	0.48642	1.525	0.80722	D	1	B;B	0.31752	0.338;0.001	B;B	0.36244	0.22;0.013	T	0.03157	-1.1066	10	0.09843	T	0.71	.	19.3562	0.94414	0.0:0.0:1.0:0.0	.	572;572	Q8NFY4-4;Q8NFY4	.;SEM6D_HUMAN	F	572;572;585;572	ENSP00000446152:L572F;ENSP00000324857:L572F;ENSP00000374083:L585F;ENSP00000346786:L572F	ENSP00000324857:L572F	L	+	3	2	SEMA6D	45846533	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.942000	0.92970	2.810000	0.96702	0.650000	0.86243	TTG	SEMA6D	-	NULL	ENSG00000137872		0.259	SEMA6D-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SEMA6D	HGNC	protein_coding	OTTHUMT00000416868.1	-	0.00	97	0	G	NM_024966		48059241	+1	tier1	-	no_errors	ENST00000316364	ensembl	human	known	74_37	missense	6.45	58	4	SNP	1.000	T
SEPT14	346288	genome.wustl.edu	37	7	55902220	55902220	+	Silent	SNP	C	C	A			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr7:55902220C>A	ENST00000388975.3	-	6	734	c.618G>T	c.(616-618)acG>acT	p.T206T		NM_207366.2	NP_997249.2	Q6ZU15	SEP14_HUMAN	septin 14	206	Septin-type G.				cell cycle (GO:0007049)|cell division (GO:0051301)	septin complex (GO:0031105)	GTP binding (GO:0005525)	p.T206T(1)		haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(15)|skin(2)	23	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)			TATTCTTAAACGTCTGTAAAT	0.348																																																	1	Substitution - coding silent(1)	haematopoietic_and_lymphoid_tissue(1)											106.0	98.0	101.0					7																	55902220		2203	4300	6503	SO:0001819	synonymous_variant	0			AK126048	CCDS5519.2	7p11.2	2013-01-21			ENSG00000154997	ENSG00000154997		"""Septins"""	33280	protein-coding gene	gene with protein product		612140					Standard	NM_207366		Approved	FLJ44060	uc003tqz.2	Q6ZU15	OTTHUMG00000129341	ENST00000388975.3:c.618G>T	7.37:g.55902220C>A			A6NCC2|B4DXD6	Silent	SNP	pfam_Cell_div_GTP-bd,superfamily_P-loop_NTPase,pirsf_Septin	p.T206	ENST00000388975.3	37	c.618	CCDS5519.2	7																																																																																			SEPT14	-	pfam_Cell_div_GTP-bd,superfamily_P-loop_NTPase,pirsf_Septin	ENSG00000154997		0.348	SEPT14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEPT14	HGNC	protein_coding	OTTHUMT00000251489.2		0.00	87	0	C	NM_207366		55902220	-1			no_errors	ENST00000388975	ensembl	human	known	74_37	silent	6.00	47	3	SNP	0.993	A
SERPINA7	6906	genome.wustl.edu	37	X	105277737	105277737	+	Intron	SNP	G	G	A			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chrX:105277737G>A	ENST00000327674.4	-	4	1380				SERPINA7_ENST00000372563.1_Intron|SERPINA7_ENST00000487487.1_5'UTR			P05543	THBG_HUMAN	serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 7						aging (GO:0007568)|negative regulation of endopeptidase activity (GO:0010951)|post-embryonic development (GO:0009791)|regulation of proteolysis (GO:0030162)|response to corticosterone (GO:0051412)|response to drug (GO:0042493)|response to peptide hormone (GO:0043434)|response to prostaglandin E (GO:0034695)|response to vitamin A (GO:0033189)|thyroid hormone transport (GO:0070327)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	hormone binding (GO:0042562)|serine-type endopeptidase inhibitor activity (GO:0004867)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(14)|ovary(1)|skin(3)	24					Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)	GAAGAAACAGGAACAGTCTTT	0.498																																																	0													48.0	50.0	50.0					X																	105277737		2203	4298	6501	SO:0001627	intron_variant	0			M14091	CCDS14518.1	Xq21-q22	2014-02-18	2005-08-18		ENSG00000123561	ENSG00000123561		"""Serine (or cysteine) peptidase inhibitors"""	11583	protein-coding gene	gene with protein product	"""thyroxin-binding globulin"", ""thyroxine-binding globulin"", ""alpha-1 antiproteinase, antitrypsin"""	314200	"""serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 7"""	TBG		24172014	Standard	NM_000354		Approved		uc004eme.2	P05543	OTTHUMG00000022144	ENST00000327674.4:c.1045-43C>T	X.37:g.105277737G>A			D3DUX1	RNA	SNP	-	NULL	ENST00000327674.4	37	NULL	CCDS14518.1	X																																																																																			SERPINA7	-	-	ENSG00000123561		0.498	SERPINA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SERPINA7	HGNC	protein_coding	OTTHUMT00000057790.1	-	0.00	32	0	G	NM_000354		105277737	-1	tier1	-	no_errors	ENST00000487487	ensembl	human	known	74_37	rna	27.03	27	10	SNP	0.000	A
SERPINB12	89777	genome.wustl.edu	37	18	61231232	61231232	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr18:61231232G>T	ENST00000269491.1	+	5	524	c.524G>T	c.(523-525)aGc>aTc	p.S175I	SERPINB12_ENST00000382768.1_Missense_Mutation_p.S195I	NM_080474.1	NP_536722.1	Q96P63	SPB12_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 12	175					hematopoietic progenitor cell differentiation (GO:0002244)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of protein catabolic process (GO:0042177)|regulation of proteolysis (GO:0030162)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	enzyme binding (GO:0019899)|serine-type endopeptidase inhibitor activity (GO:0004867)			kidney(1)|large_intestine(5)|lung(19)|skin(1)	26						GAACTCTTCAGCAAGGACGCT	0.353																																																	0													176.0	157.0	164.0					18																	61231232		2203	4300	6503	SO:0001583	missense	0			AF411191	CCDS11984.1	18q21.33	2014-02-18	2005-08-18		ENSG00000166634	ENSG00000166634		"""Serine (or cysteine) peptidase inhibitors"""	14220	protein-coding gene	gene with protein product		615662	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 12"""			24172014	Standard	NM_080474		Approved	YUKOPIN	uc010xen.2	Q96P63	OTTHUMG00000132789	ENST00000269491.1:c.524G>T	18.37:g.61231232G>T	ENSP00000269491:p.Ser175Ile		Q3SYB4	Missense_Mutation	SNP	pfam_Serpin_dom,superfamily_Serpin_dom,smart_Serpin_dom	p.S175I	ENST00000269491.1	37	c.524	CCDS11984.1	18	.	.	.	.	.	.	.	.	.	.	G	13.77	2.335359	0.41398	.	.	ENSG00000166634	ENST00000269491;ENST00000382768	D;D	0.85411	-1.98;-1.98	5.57	1.01	0.19927	Serpin domain (3);	0.994123	0.08177	N	0.986049	D	0.85915	0.5808	M	0.87682	2.9	0.09310	N	1	P;P	0.42161	0.772;0.655	B;B	0.41036	0.346;0.346	T	0.75196	-0.3403	10	0.72032	D	0.01	.	5.2259	0.15393	0.3445:0.1364:0.5191:0.0	.	195;175	Q3SYB4;Q96P63	.;SPB12_HUMAN	I	175;195	ENSP00000269491:S175I;ENSP00000372218:S195I	ENSP00000269491:S175I	S	+	2	0	SERPINB12	59382212	0.000000	0.05858	0.858000	0.33744	0.943000	0.58893	-1.421000	0.02455	0.248000	0.21435	0.655000	0.94253	AGC	SERPINB12	-	pfam_Serpin_dom,superfamily_Serpin_dom,smart_Serpin_dom	ENSG00000166634		0.353	SERPINB12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SERPINB12	HGNC	protein_coding	OTTHUMT00000256197.1	-	0.00	102	0	G	NM_080474		61231232	+1	tier1	-	no_errors	ENST00000269491	ensembl	human	known	74_37	missense	6.15	61	4	SNP	0.019	T
SERPINF1	5176	genome.wustl.edu	37	17	1674466	1674466	+	Missense_Mutation	SNP	G	G	C	rs548418598	byFrequency	TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr17:1674466G>C	ENST00000254722.4	+	4	590	c.427G>C	c.(427-429)Gtc>Ctc	p.V143L	SERPINF1_ENST00000571870.1_3'UTR	NM_002615.5	NP_002606.3	P36955	PEDF_HUMAN	serpin peptidase inhibitor, clade F (alpha-2 antiplasmin, pigment epithelium derived factor), member 1	143					aging (GO:0007568)|cell proliferation (GO:0008283)|kidney development (GO:0001822)|multicellular organismal development (GO:0007275)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of inflammatory response (GO:0050728)|positive regulation of neurogenesis (GO:0050769)|regulation of proteolysis (GO:0030162)|response to glucocorticoid (GO:0051384)|response to retinoic acid (GO:0032526)|short-term memory (GO:0007614)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	serine-type endopeptidase inhibitor activity (GO:0004867)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(2)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(1)	16						CTCCCGGATCGTCTTTGAGAA	0.532																																																	0													42.0	38.0	40.0					17																	1674466		2203	4300	6503	SO:0001583	missense	0			M76979	CCDS11012.1	17p13.3	2014-02-18	2005-08-18		ENSG00000132386	ENSG00000132386		"""Serine (or cysteine) peptidase inhibitors"""	8824	protein-coding gene	gene with protein product	"""pigment epithelium-derived factor"", ""proliferation-inducing protein 35"""	172860	"""serine (or cysteine) proteinase inhibitor, clade F (alpha-2 antiplasmin, pigment epithelium derived factor), member 1"""	PEDF		8434014, 24172014	Standard	NM_002615		Approved	EPC-1, PIG35	uc002ftl.3	P36955	OTTHUMG00000090571	ENST00000254722.4:c.427G>C	17.37:g.1674466G>C	ENSP00000254722:p.Val143Leu		F1T092|Q13236|Q2TU83|Q96CT1|Q96R01|Q9BWA4	Missense_Mutation	SNP	pfam_Serpin_dom,superfamily_Serpin_dom,smart_Serpin_dom	p.V143L	ENST00000254722.4	37	c.427	CCDS11012.1	17	.	.	.	.	.	.	.	.	.	.	G	1.100	-0.661264	0.03454	.	.	ENSG00000132386	ENST00000254722	D	0.84070	-1.8	5.41	-10.8	0.00216	Serpin domain (3);	1.048210	0.07322	N	0.877762	T	0.72898	0.3518	L	0.34521	1.04	0.32314	N	0.563356	B	0.02656	0.0	B	0.04013	0.001	T	0.51521	-0.8695	10	0.54805	T	0.06	.	17.7116	0.88323	0.2519:0.0:0.6693:0.0788	.	143	P36955	PEDF_HUMAN	L	143	ENSP00000254722:V143L	ENSP00000254722:V143L	V	+	1	0	SERPINF1	1621216	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.773000	0.04689	-2.529000	0.00492	-1.225000	0.01585	GTC	SERPINF1	-	pfam_Serpin_dom,superfamily_Serpin_dom,smart_Serpin_dom	ENSG00000132386		0.532	SERPINF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SERPINF1	HGNC	protein_coding	OTTHUMT00000207109.4		0.00	67	0	G	NM_002615		1674466	+1			no_errors	ENST00000254722	ensembl	human	known	74_37	missense	8.33	33	3	SNP	0.000	C
SET	6418	genome.wustl.edu	37	9	131446208	131446208	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr9:131446208C>G	ENST00000372692.4	+	1	275	c.34C>G	c.(34-36)Caa>Gaa	p.Q12E	SET_ENST00000409104.3_5'Flank	NM_001122821.1	NP_001116293.1	Q01105	SET_HUMAN	SET nuclear proto-oncogene	12					DNA replication (GO:0006260)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of catalytic activity (GO:0043086)|negative regulation of histone acetylation (GO:0035067)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleocytoplasmic transport (GO:0006913)|nucleosome assembly (GO:0006334)|nucleosome disassembly (GO:0006337)|regulation of catalytic activity (GO:0050790)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|protein complex (GO:0043234)	DNA binding (GO:0003677)|histone binding (GO:0042393)|protein phosphatase inhibitor activity (GO:0004864)|protein phosphatase type 2A regulator activity (GO:0008601)			endometrium(2)|kidney(1)|lung(2)	5		Myeloproliferative disorder(178;0.204)		GBM - Glioblastoma multiforme(294;3.1e-09)		ACTCCCGCCTCAAAAGAAGAA	0.582			T	NUP214	AML																																			Dom	yes		9	9q34	6418	SET translocation		L	0													22.0	23.0	23.0					9																	131446208		1550	3529	5079	SO:0001583	missense	0			M93651	CCDS6907.1, CCDS48037.1, CCDS59149.1, CCDS59150.1	9q34	2014-06-25	2014-06-25		ENSG00000119335	ENSG00000119335			10760	protein-coding gene	gene with protein product	"""protein phosphatase type 2A inhibitor"", ""Template-Activating Factor-I, chromatin remodelling factor"""	600960	"""SET translocation (myeloid leukemia-associated)"""			1630450, 8626647	Standard	NM_003011		Approved	PHAPII, 2PP2A, IPP2A2	uc022bol.1	Q01105	OTTHUMG00000020755	ENST00000372692.4:c.34C>G	9.37:g.131446208C>G	ENSP00000361777:p.Gln12Glu		A5A5H4|A6NGV1|B4DUE2|Q15541|Q5VXV1|Q5VXV2|Q6FHZ5	Missense_Mutation	SNP	pfam_NAP_family	p.Q12E	ENST00000372692.4	37	c.34	CCDS48037.1	9	.	.	.	.	.	.	.	.	.	.	C	14.18	2.457922	0.43634	.	.	ENSG00000119335	ENST00000454747;ENST00000372692	T	0.30182	1.54	3.9	3.9	0.45041	.	0.349609	0.22080	N	0.064910	T	0.18257	0.0438	N	0.24115	0.695	0.49389	D	0.999784	B	0.06786	0.001	B	0.09377	0.004	T	0.04767	-1.0928	10	0.10636	T	0.68	.	11.6983	0.51556	0.0:1.0:0.0:0.0	.	12	Q01105	SET_HUMAN	E	12	ENSP00000361777:Q12E	ENSP00000361777:Q12E	Q	+	1	0	SET	130486029	0.018000	0.18449	0.021000	0.16686	0.050000	0.14768	2.957000	0.49137	2.465000	0.83290	0.591000	0.81541	CAA	SET	-	NULL	ENSG00000119335		0.582	SET-001	KNOWN	basic|CCDS	protein_coding	SET	HGNC	protein_coding	OTTHUMT00000054476.2	-	0.00	84	0	C	NM_001122821		131446208	+1	tier1	-	no_errors	ENST00000372692	ensembl	human	known	74_37	missense	26.19	31	11	SNP	0.024	G
SFTPA1	653509	genome.wustl.edu	37	10	81372184	81372184	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr10:81372184C>A	ENST00000398636.3	+	4	427	c.289C>A	c.(289-291)Cca>Aca	p.P97T	SFTPA1_ENST00000419470.2_Missense_Mutation_p.P112T|SFTPA1_ENST00000428376.2_Missense_Mutation_p.P97T|SFTPA1_ENST00000372313.5_Missense_Mutation_p.P38T|SFTPA1_ENST00000372308.3_Missense_Mutation_p.P97T	NM_001164644.1|NM_001164646.1|NM_005411.4	NP_001158116.1|NP_001158118.1|NP_005402.3	Q8IWL2	SFTA1_HUMAN	surfactant protein A1	97	Collagen-like.				lipid transport (GO:0006869)|respiratory gaseous exchange (GO:0007585)	collagen trimer (GO:0005581)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	carbohydrate binding (GO:0030246)|lipid transporter activity (GO:0005319)			endometrium(1)|lung(8)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	12	all_cancers(46;0.197)|Breast(12;0.000326)|Prostate(51;0.00985)|all_epithelial(25;0.0149)		Epithelial(14;0.00957)|all cancers(16;0.0179)|Colorectal(32;0.229)			GAGGGGCCCTCCAGGTGAGCA	0.607																																																	0													82.0	93.0	89.0					10																	81372184		2203	4296	6499	SO:0001583	missense	0			BC026229	CCDS44444.1, CCDS44445.1, CCDS44444.2	10q22.3	2012-11-02	2008-08-26			ENSG00000122852		"""Collectins"""	10798	protein-coding gene	gene with protein product	"""surfactant, pulmonary-associated protein A1A"""	178630	"""surfactant, pulmonary-associated protein A1"""	SFTP1			Standard	NM_001093770		Approved	SP-A, SP-A1, COLEC4	uc009xry.3	Q8IWL2		ENST00000398636.3:c.289C>A	10.37:g.81372184C>A	ENSP00000381633:p.Pro97Thr		A8K3T8|B7ZW50|E3VLD8|E3VLD9|E3VLE0|E3VLE1|G5E9J3|P07714|Q14DV4|Q5RIR5|Q5RIR7|Q6PIT0|Q8TC19	Missense_Mutation	SNP	pfam_C-type_lectin,pfam_Collagen,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin	p.P112T	ENST00000398636.3	37	c.334	CCDS44445.1	10	.	.	.	.	.	.	.	.	.	.	.	11.85	1.760194	0.31137	.	.	ENSG00000122852	ENST00000372308;ENST00000398636;ENST00000428376;ENST00000372313;ENST00000419470;ENST00000394569;ENST00000429958;ENST00000439264	D;D;D;D;D;D;D	0.90900	-2.56;-2.51;-2.51;-2.75;-2.51;-2.75;-2.75	2.73	2.73	0.32206	.	0.000000	0.64402	D	0.000018	D	0.87418	0.6172	M	0.78223	2.4	0.31958	N	0.608837	P;B	0.35793	0.521;0.437	B;B	0.31191	0.067;0.125	D	0.87228	0.2258	10	0.37606	T	0.19	-3.9562	9.1161	0.36758	0.0:1.0:0.0:0.0	.	112;97	G5E9J3;Q8IWL2	.;SFTA1_HUMAN	T	97;97;97;38;112;97;97;97	ENSP00000361382:P97T;ENSP00000381633:P97T;ENSP00000411102:P97T;ENSP00000361387:P38T;ENSP00000397082:P112T;ENSP00000395527:P97T;ENSP00000401649:P97T	ENSP00000361382:P97T	P	+	1	0	SFTPA1	81042190	0.996000	0.38824	0.983000	0.44433	0.928000	0.56348	1.577000	0.36515	1.840000	0.53500	0.448000	0.29417	CCA	SFTPA1	-	NULL	ENSG00000122852		0.607	SFTPA1-203	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SFTPA1	HGNC	protein_coding		-	0.00	77	0	C	NM_005411		81372184	+1	tier1	-	no_errors	ENST00000419470	ensembl	human	known	74_37	missense	22.86	27	8	SNP	0.986	A
SHPRH	257218	genome.wustl.edu	37	6	146266723	146266723	+	Nonsense_Mutation	SNP	C	C	A			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr6:146266723C>A	ENST00000367505.2	-	8	1636	c.1372G>T	c.(1372-1374)Gga>Tga	p.G458*	SHPRH_ENST00000275233.7_Nonsense_Mutation_p.G458*|SHPRH_ENST00000438092.2_Nonsense_Mutation_p.G458*|SHPRH_ENST00000367503.3_Nonsense_Mutation_p.G458*			Q149N8	SHPRH_HUMAN	SNF2 histone linker PHD RING helicase, E3 ubiquitin protein ligase	458	H15. {ECO:0000255|PROSITE- ProRule:PRU00837}.				DNA repair (GO:0006281)|nucleosome assembly (GO:0006334)|protein polyubiquitination (GO:0000209)	nucleosome (GO:0000786)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(15)|lung(33)|ovary(3)|pancreas(2)|prostate(7)|skin(1)|urinary_tract(1)	79		Ovarian(120;0.0365)		OV - Ovarian serous cystadenocarcinoma(155;1.47e-07)|GBM - Glioblastoma multiforme(68;0.0124)		ATGGACACTCCTTTTTTTCCA	0.328																																																	0													65.0	59.0	60.0					6																	146266723		1836	4099	5935	SO:0001587	stop_gained	0			AB095943	CCDS43513.1, CCDS47496.1, CCDS43513.2	6q24.2	2012-02-23	2012-02-23		ENSG00000146414	ENSG00000146414		"""RING-type (C3HC4) zinc fingers"""	19336	protein-coding gene	gene with protein product		608048	"""SNF2 histone linker PHD RING helicase"""			12837266	Standard	NM_001042683		Approved	FLJ90837, KIAA2023, bA545I5.2	uc003qlf.3	Q149N8	OTTHUMG00000015750	ENST00000367505.2:c.1372G>T	6.37:g.146266723C>A	ENSP00000356475:p.Gly458*		Q149N9|Q5VV79|Q68DS5|Q7Z5J5|Q8IVE8|Q8IWQ9|Q8N1S8|Q8NBR7	Nonsense_Mutation	SNP	pfam_SNF2_N,pfam_Histone_H1/H5_H15,superfamily_P-loop_NTPase,superfamily_Znf_FYVE_PHD,superfamily_WW_dom,smart_Helicase_ATP-bd,smart_Histone_H1/H5_H15,smart_Znf_PHD,smart_Znf_RING,smart_Helicase_C,pfscan_Znf_RING,pfscan_Helicase_C	p.G458*	ENST00000367505.2	37	c.1372	CCDS43513.2	6	.	.	.	.	.	.	.	.	.	.	C	40	8.280802	0.98740	.	.	ENSG00000146414	ENST00000367505;ENST00000367503;ENST00000438092;ENST00000275233;ENST00000444767	.	.	.	5.52	5.52	0.82312	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.56958	D	0.05	-23.1209	19.4495	0.94861	0.0:1.0:0.0:0.0	.	.	.	.	X	458;458;458;458;347	.	ENSP00000275233:G458X	G	-	1	0	SHPRH	146308416	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.996000	0.76263	2.608000	0.88229	0.585000	0.79938	GGA	SHPRH	-	pfam_Histone_H1/H5_H15,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Histone_H1/H5_H15	ENSG00000146414		0.328	SHPRH-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SHPRH	HGNC	protein_coding	OTTHUMT00000042571.2		0.00	65	0	C	NM_173082		146266723	-1			no_errors	ENST00000367503	ensembl	human	known	74_37	nonsense	5.13	37	2	SNP	1.000	A
SIMC1	375484	genome.wustl.edu	37	5	175763794	175763794	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr5:175763794G>T	ENST00000443967.1	+	10	2593	c.2186G>T	c.(2185-2187)aGc>aTc	p.S729I	SIMC1_ENST00000341199.6_Missense_Mutation_p.S314I|SIMC1_ENST00000430704.2_Missense_Mutation_p.S314I|SIMC1_ENST00000332772.4_Missense_Mutation_p.S190I			Q8NDZ2	SIMC1_HUMAN	SUMO-interacting motifs containing 1	729							SUMO polymer binding (GO:0032184)										TTCCTCCACAGCTGTGAGACA	0.478																																																	0													108.0	110.0	109.0					5																	175763794		2203	4300	6503	SO:0001583	missense	0			BC037298	CCDS4398.2	5q35.2	2013-08-14	2012-11-14	2012-11-14	ENSG00000170085	ENSG00000170085			24779	protein-coding gene	gene with protein product	"""oocyte maturation associated 1"", ""platform element for inhibition of autolytic degradation"""		"""chromosome 5 open reading frame 25"""	C5orf25		23086935, 23707407	Standard	NM_198567		Approved	FLJ44216, OOMA1, PLEIAD	uc003mds.4	Q8NDZ2	OTTHUMG00000130663	ENST00000443967.1:c.2186G>T	5.37:g.175763794G>T	ENSP00000406571:p.Ser729Ile		J3KQQ8|Q6NXN8|Q6ZTU4|Q8IZ15	Missense_Mutation	SNP	NULL	p.S729I	ENST00000443967.1	37	c.2186		5	.	.	.	.	.	.	.	.	.	.	G	20.4	3.981520	0.74474	.	.	ENSG00000170085	ENST00000341199;ENST00000430704;ENST00000443967;ENST00000332772	T;T;T;T	0.40476	1.65;1.65;1.91;1.03	4.72	4.72	0.59763	.	0.213505	0.39407	N	0.001366	T	0.58409	0.2120	L	0.52573	1.65	0.80722	D	1	D;D;D	0.76494	0.999;0.997;0.999	D;D;D	0.83275	0.996;0.994;0.996	T	0.61287	-0.7093	10	0.87932	D	0	-15.2933	14.5339	0.67947	0.0:0.0:1.0:0.0	.	190;314;729	Q8NDZ2-4;Q8NDZ2-3;Q8NDZ2	.;.;CE025_HUMAN	I	314;314;729;190	ENSP00000342075:S314I;ENSP00000409287:S314I;ENSP00000406571:S729I;ENSP00000331311:S190I	ENSP00000331311:S190I	S	+	2	0	C5orf25	175696400	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	5.026000	0.64103	2.441000	0.82636	0.467000	0.42956	AGC	SIMC1	-	NULL	ENSG00000170085		0.478	SIMC1-001	KNOWN	basic	protein_coding	SIMC1	HGNC	protein_coding	OTTHUMT00000253155.2	-	0.00	52	0	G	NM_198567		175763794	+1	tier1	-	no_errors	ENST00000443967	ensembl	human	known	74_37	missense	15.38	22	4	SNP	1.000	T
SIRPG	55423	genome.wustl.edu	37	20	1615975	1615975	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr20:1615975C>T	ENST00000303415.3	-	4	1083	c.1019G>A	c.(1018-1020)aGc>aAc	p.S340N	SIRPG_ENST00000381583.2_Intron|RP11-77C3.3_ENST00000437384.1_RNA|RP11-77C3.3_ENST00000456177.1_RNA|SIRPG_ENST00000344103.4_Intron|SIRPG_ENST00000216927.4_Intron|SIRPG_ENST00000381580.1_Missense_Mutation_p.S307N	NM_018556.3	NP_061026.2	Q9P1W8	SIRPG_HUMAN	signal-regulatory protein gamma	340	Ig-like C1-type 2.				blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|intracellular signal transduction (GO:0035556)|leukocyte migration (GO:0050900)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of T cell activation (GO:0050870)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(14)|ovary(1)|prostate(2)|stomach(1)	27						AAGGCGTTTGCTGACCGCCAG	0.498																																																	0													112.0	92.0	98.0					20																	1615975		2203	4300	6503	SO:0001583	missense	0			AB042624	CCDS13020.2, CCDS13021.2, CCDS33434.1	20p13	2013-01-11	2006-02-03	2006-02-03	ENSG00000089012	ENSG00000089012		"""Signal-regulatory proteins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C1-set domain containing"""	15757	protein-coding gene	gene with protein product		605466	"""signal-regulatory protein beta 2"""	SIRPB2		11185750, 16339511	Standard	XM_005260749		Approved	bA77C3.1, SIRP-B2, SIRPgamma, CD172g	uc002wfm.1	Q9P1W8	OTTHUMG00000031680	ENST00000303415.3:c.1019G>A	20.37:g.1615975C>T	ENSP00000305529:p.Ser340Asn		B1AKP6|Q5D051|Q5JV25|Q5MKL4|Q8WWA5|Q9NQK8	Missense_Mutation	SNP	pfam_Ig_C1-set,pfam_CD80_C2-set,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_V-set_subgr,smart_Ig_C1-set,pfscan_Ig-like_dom	p.S340N	ENST00000303415.3	37	c.1019	CCDS13020.2	20	.	.	.	.	.	.	.	.	.	.	.	3.140	-0.176426	0.06380	.	.	ENSG00000089012	ENST00000381580;ENST00000303415	T;T	0.12039	3.15;2.72	1.6	-2.48	0.06423	Immunoglobulin-like (1);Immunoglobulin-like fold (1);	1.015180	0.07876	N	0.968769	T	0.09423	0.0232	L	0.35723	1.085	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.38542	-0.9656	10	0.33141	T	0.24	.	4.7498	0.13056	0.0:0.4559:0.3162:0.2278	.	340	Q9P1W8	SIRPG_HUMAN	N	307;340	ENSP00000370992:S307N;ENSP00000305529:S340N	ENSP00000305529:S340N	S	-	2	0	SIRPG	1563975	0.051000	0.20477	0.003000	0.11579	0.015000	0.08874	-0.321000	0.08018	-0.626000	0.05596	-1.076000	0.02234	AGC	SIRPG	-	smart_Ig_sub,pfscan_Ig-like_dom	ENSG00000089012		0.498	SIRPG-005	KNOWN	basic|appris_principal|CCDS	protein_coding	SIRPG	HGNC	protein_coding	OTTHUMT00000077566.2		0.00	100	0	C	NM_018556		1615975	-1			no_errors	ENST00000303415	ensembl	human	known	74_37	missense	5.00	76	4	SNP	0.005	T
SLC12A2	6558	genome.wustl.edu	37	5	127450359	127450359	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr5:127450359G>T	ENST00000262461.2	+	4	1223	c.1034G>T	c.(1033-1035)gGa>gTa	p.G345V	SLC12A2_ENST00000343225.4_Missense_Mutation_p.G345V	NM_001046.2	NP_001037.1	P55011	S12A2_HUMAN	solute carrier family 12 (sodium/potassium/chloride transporter), member 2	345					ammonium transmembrane transport (GO:0072488)|ammonium transport (GO:0015696)|branching involved in mammary gland duct morphogenesis (GO:0060444)|chloride transmembrane transport (GO:1902476)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|gamma-aminobutyric acid signaling pathway (GO:0007214)|hyperosmotic response (GO:0006972)|ion transport (GO:0006811)|mammary duct terminal end bud growth (GO:0060763)|multicellular organism growth (GO:0035264)|positive regulation of cell volume (GO:0045795)|potassium ion transport (GO:0006813)|sodium ion transport (GO:0006814)|transepithelial ammonium transport (GO:0070634)|transepithelial chloride transport (GO:0030321)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	ammonium transmembrane transporter activity (GO:0008519)|sodium:potassium:chloride symporter activity (GO:0008511)			breast(3)|endometrium(5)|kidney(5)|large_intestine(12)|lung(16)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	48		all_cancers(142;0.0972)|Prostate(80;0.151)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	Epithelial(69;0.0433)|OV - Ovarian serous cystadenocarcinoma(64;0.0978)	Bumetanide(DB00887)|Potassium Chloride(DB00761)|Quinethazone(DB01325)	GCAACTAATGGATTTGTAAGA	0.318																																																	0													122.0	116.0	118.0					5																	127450359		2203	4300	6503	SO:0001583	missense	0				CCDS4144.1, CCDS58965.1	5q23.3	2014-06-13	2013-07-18		ENSG00000064651	ENSG00000064651		"""Solute carriers"""	10911	protein-coding gene	gene with protein product	"""bumetanide-sensitive sodium-(potassium)-chloride cotransporter 1"", ""basolateral Na-K-Cl symporter"", ""protein phosphatase 1, regulatory subunit 141"""	600840				7629105	Standard	NM_001256461		Approved	NKCC1, BSC, BSC2, PPP1R141	uc003kus.3	P55011	OTTHUMG00000128983	ENST00000262461.2:c.1034G>T	5.37:g.127450359G>T	ENSP00000262461:p.Gly345Val		Q8N713|Q8WWH7	Missense_Mutation	SNP	pfam_AA-permease/SLC12A_dom,pfam_AA_permease_N,prints_Na/K/Cl_cotranspt1,prints_Na/K/Cl_cotranspt,tigrfam_Na/K/Cl_cotransptS	p.G345V	ENST00000262461.2	37	c.1034	CCDS4144.1	5	.	.	.	.	.	.	.	.	.	.	G	23.9	4.466634	0.84425	.	.	ENSG00000064651	ENST00000262461;ENST00000343225	D;D	0.98666	-5.06;-5.06	5.36	5.36	0.76844	Amino acid permease domain (1);	0.000000	0.85682	D	0.000000	D	0.99429	0.9798	H	0.95114	3.625	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.98556	1.0639	10	0.87932	D	0	.	18.0132	0.89230	0.0:0.0:1.0:0.0	.	345;345	P55011-3;P55011	.;S12A2_HUMAN	V	345	ENSP00000262461:G345V;ENSP00000340878:G345V	ENSP00000262461:G345V	G	+	2	0	SLC12A2	127478258	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.838000	0.92115	2.779000	0.95612	0.650000	0.86243	GGA	SLC12A2	-	pfam_AA-permease/SLC12A_dom,tigrfam_Na/K/Cl_cotransptS	ENSG00000064651		0.318	SLC12A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC12A2	HGNC	protein_coding	OTTHUMT00000250972.1		0.00	84	0	G	NM_001046		127450359	+1			no_errors	ENST00000262461	ensembl	human	known	74_37	missense	10.00	36	4	SNP	1.000	T
SLC12A8	84561	genome.wustl.edu	37	3	124826791	124826791	+	Silent	SNP	G	G	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr3:124826791G>T	ENST00000393469.4	-	9	1288	c.1239C>A	c.(1237-1239)acC>acA	p.T413T	SLC12A8_ENST00000430155.2_Silent_p.T214T|SLC12A8_ENST00000423114.2_Silent_p.T442T|SLC12A8_ENST00000465475.1_5'UTR|SLC12A8_ENST00000469902.1_Silent_p.T413T|SLC12A8_ENST00000314584.7_Silent_p.T166T	NM_001195483.1	NP_001182412	A0AV02	S12A8_HUMAN	solute carrier family 12, member 8	413					potassium ion transport (GO:0006813)	integral component of membrane (GO:0016021)	symporter activity (GO:0015293)			endometrium(2)|kidney(2)|lung(12)	16						CAGGCACCGGGGTCAGGCTGC	0.582																																																	0													36.0	38.0	38.0					3																	124826791		2074	4219	6293	SO:0001819	synonymous_variant	0				CCDS43143.1	3q21.2	2013-07-18	2013-07-18		ENSG00000221955	ENSG00000221955		"""Solute carriers"""	15595	protein-coding gene	gene with protein product	"""solute carrier family 12 (sodium/potassium/chloride transporters), member 8"", ""cation-chloride cotransporter 9"""	611316				11863360	Standard	NM_024628		Approved	CCC9	uc003ehv.4	A0AV02	OTTHUMG00000159483	ENST00000393469.4:c.1239C>A	3.37:g.124826791G>T			C9JJJ2|Q68D04|Q6I9Z2|Q6P4C0|Q7Z3A6|Q86WK0|Q8NFX9|Q8WUI3|Q96RF9|Q9H5P9	Silent	SNP	pfam_AA-permease/SLC12A_dom,superfamily_ABC1_TM_dom	p.T442	ENST00000393469.4	37	c.1326	CCDS43143.1	3																																																																																			SLC12A8	-	NULL	ENSG00000221955		0.582	SLC12A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC12A8	HGNC	protein_coding	OTTHUMT00000355711.4	-	0.00	75	0	G	NM_024628		124826791	-1	tier1	-	no_errors	ENST00000423114	ensembl	human	known	74_37	silent	17.65	28	6	SNP	0.007	T
SLC22A24	283238	genome.wustl.edu	37	11	62910850	62910850	+	Splice_Site	SNP	C	C	G			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr11:62910850C>G	ENST00000417740.1	-	1	843	c.402G>C	c.(400-402)gaG>gaC	p.E134D	SLC22A10_ENST00000525620.1_Intron|SLC22A24_ENST00000326192.5_Splice_Site_p.E134D	NM_001136506.2	NP_001129978.2	Q8N4F4	S22AO_HUMAN	solute carrier family 22, member 24	134					ion transport (GO:0006811)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)				kidney(1)|stomach(1)	2						GGCCTCTTATCTCAGTCACGA	0.448																																																	0													35.0	34.0	35.0					11																	62910850		692	1591	2283	SO:0001630	splice_region_variant	0				CCDS73308.1	11q12.3	2013-05-22			ENSG00000197658	ENSG00000197658		"""Solute carriers"""	28542	protein-coding gene	gene with protein product		611698				17714910	Standard	NM_001136506		Approved	MGC34821, NET46	uc021qkp.1	Q8N4F4	OTTHUMG00000165372	ENST00000417740.1:c.402+1G>C	11.37:g.62910850C>G				Missense_Mutation	SNP	pfam_MFS,pfam_Sub_transporter,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.E134D	ENST00000417740.1	37	c.402		11	.	.	.	.	.	.	.	.	.	.	C	12.18	1.860818	0.32884	.	.	ENSG00000197658	ENST00000417740;ENST00000531535;ENST00000326192	T;T	0.57273	0.41;0.41	2.29	2.29	0.28610	.	0.862971	0.09770	U	0.758110	T	0.69522	0.3120	M	0.83483	2.645	0.80722	D	1	P	0.50156	0.932	P	0.58520	0.84	T	0.69124	-0.5228	9	.	.	.	.	10.3962	0.44203	0.0:1.0:0.0:0.0	.	134	C9JC66	.	D	134	ENSP00000396586:E134D;ENSP00000321549:E134D	.	E	-	3	2	SLC22A24	62667426	0.997000	0.39634	0.356000	0.25785	0.076000	0.17211	0.711000	0.25764	1.314000	0.45095	0.383000	0.25322	GAG	SLC22A24	-	pfam_Sub_transporter,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	ENSG00000197658		0.448	SLC22A24-003	PUTATIVE	non_canonical_polymorphism|basic|appris_principal|exp_conf	protein_coding	SLC22A24	HGNC	protein_coding	OTTHUMT00000383747.1	-	0.00	89	0	C	NM_173586	Missense_Mutation	62910850	-1	tier1	-	no_errors	ENST00000326192	ensembl	human	known	74_37	missense	15.00	51	9	SNP	1.000	G
SLC2A13	114134	genome.wustl.edu	37	12	40345077	40345077	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr12:40345077G>A	ENST00000280871.4	-	4	1066	c.1016C>T	c.(1015-1017)tCa>tTa	p.S339L	SLC2A13_ENST00000380858.1_Missense_Mutation_p.S339L	NM_052885.3	NP_443117.3	Q96QE2	MYCT_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 13	339					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	substrate-specific transmembrane transporter activity (GO:0022891)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(12)|ovary(1)|prostate(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	29		Lung NSC(34;0.105)|all_lung(34;0.123)				GTTAATGCCTGAGAGCTGCTG	0.383										HNSCC(50;0.14)																																							0													92.0	90.0	91.0					12																	40345077		2203	4300	6503	SO:0001583	missense	0			AJ315644	CCDS8736.2	12q12	2013-05-22			ENSG00000151229	ENSG00000151229		"""Solute carriers"""	15956	protein-coding gene	gene with protein product	"""H(+)-myo-inositol symporter"""	611036				11500374	Standard	NM_052885		Approved	HMIT	uc010skm.2	Q96QE2	OTTHUMG00000059743	ENST00000280871.4:c.1016C>T	12.37:g.40345077G>A	ENSP00000280871:p.Ser339Leu		Q17S07	Missense_Mutation	SNP	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,superfamily_Plexin-like_fold,prints_Sugar/inositol_transpt,pfscan_MFS_dom,tigrfam_Sugar/inositol_transpt	p.S339L	ENST00000280871.4	37	c.1016	CCDS8736.2	12	.	.	.	.	.	.	.	.	.	.	G	26.6	4.751170	0.89753	.	.	ENSG00000151229	ENST00000280871;ENST00000380858	T;T	0.75704	-0.96;-0.96	5.21	5.21	0.72293	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.304360	0.33161	N	0.005216	D	0.82481	0.5046	M	0.87758	2.905	0.80722	D	1	B;P	0.38473	0.062;0.633	B;B	0.43155	0.11;0.41	D	0.85416	0.1140	10	0.72032	D	0.01	-8.3133	18.9337	0.92577	0.0:0.0:1.0:0.0	.	339;339	Q96QE2;E9PE47	MYCT_HUMAN;.	L	339	ENSP00000280871:S339L;ENSP00000370239:S339L	ENSP00000280871:S339L	S	-	2	0	SLC2A13	38631344	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	8.619000	0.90938	2.706000	0.92434	0.555000	0.69702	TCA	SLC2A13	-	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,prints_Sugar/inositol_transpt,pfscan_MFS_dom,tigrfam_Sugar/inositol_transpt	ENSG00000151229		0.383	SLC2A13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC2A13	HGNC	protein_coding	OTTHUMT00000132849.2	-	0.00	175	0	G			40345077	-1	tier1	-	no_errors	ENST00000280871	ensembl	human	known	74_37	missense	5.68	83	5	SNP	1.000	A
SLC35A1	10559	genome.wustl.edu	37	6	88221148	88221148	+	Silent	SNP	A	A	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr6:88221148A>T	ENST00000369552.4	+	8	945	c.918A>T	c.(916-918)gtA>gtT	p.V306V	SLC35A1_ENST00000369557.5_3'UTR|SLC35A1_ENST00000369556.3_Silent_p.V247V|C6orf165_ENST00000506888.1_3'UTR|SLC35A1_ENST00000464978.1_3'UTR|SLC35A1_ENST00000544441.1_Silent_p.V172V	NM_006416.4	NP_006407.1	P78382	S35A1_HUMAN	solute carrier family 35 (CMP-sialic acid transporter), member A1	306					carbohydrate metabolic process (GO:0005975)|cellular protein modification process (GO:0006464)|CMP-N-acetylneuraminate transport (GO:0015782)|transmembrane transport (GO:0055085)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)	CMP-N-acetylneuraminate transmembrane transporter activity (GO:0005456)|sugar:proton symporter activity (GO:0005351)			breast(1)|kidney(3)|large_intestine(2)|lung(3)	9		all_cancers(76;3.93e-06)|Acute lymphoblastic leukemia(125;3.55e-10)|Prostate(29;3.51e-09)|all_hematologic(105;3.29e-06)|all_epithelial(107;0.00575)		BRCA - Breast invasive adenocarcinoma(108;0.0429)		CTCTTCTTGTATGTGTTTCCA	0.358																																					NSCLC(183;214 2117 17033 22638 44782)|Ovarian(87;1008 1343 9644 42916 50932)												0													109.0	99.0	102.0					6																	88221148		2203	4300	6503	SO:0001819	synonymous_variant	0			D87969	CCDS5010.1, CCDS55043.1	6q15	2013-05-22			ENSG00000164414	ENSG00000164414		"""Solute carriers"""	11021	protein-coding gene	gene with protein product		605634	"""solute carrier family 35 (UDP-galactose transporter), member 1"""			9010752, 9644260	Standard	NM_006416		Approved	CMPST, hCST	uc011dzj.2	P78382	OTTHUMG00000015177	ENST00000369552.4:c.918A>T	6.37:g.88221148A>T			Q5W1L8	Silent	SNP	pfam_Nuc_sug_transpt,pfam_UAA,pirsf_UDP/CMP-sugar_transptr,tigrfam_UDPgal_transpt	p.V306	ENST00000369552.4	37	c.918	CCDS5010.1	6																																																																																			SLC35A1	-	pfam_Nuc_sug_transpt,pfam_UAA,pirsf_UDP/CMP-sugar_transptr,tigrfam_UDPgal_transpt	ENSG00000164414		0.358	SLC35A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC35A1	HGNC	protein_coding	OTTHUMT00000041446.1	-	0.00	99	0	A			88221148	+1	tier1	-	no_errors	ENST00000369552	ensembl	human	known	74_37	silent	5.88	64	4	SNP	0.994	T
SLC41A3	54946	genome.wustl.edu	37	3	125775273	125775273	+	Intron	SNP	G	G	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr3:125775273G>T	ENST00000315891.6	-	3	512				SLC41A3_ENST00000508835.1_Intron|SLC41A3_ENST00000346785.5_Intron|SLC41A3_ENST00000514023.1_Intron|SLC41A3_ENST00000383598.2_Nonsense_Mutation_p.C41*|SLC41A3_ENST00000360370.4_Intron|RP11-158I23.1_ENST00000508263.1_RNA	NM_001008485.1|NM_017836.3	NP_001008485|NP_060306.3	Q96GZ6	S41A3_HUMAN	solute carrier family 41, member 3							integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cation transmembrane transporter activity (GO:0008324)			breast(1)|endometrium(4)|large_intestine(6)|lung(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	18				GBM - Glioblastoma multiforme(114;0.167)		CCACGACCTGGCACATGATGG	0.557																																																	0													121.0	100.0	107.0					3																	125775273		2203	4300	6503	SO:0001627	intron_variant	0				CCDS33842.1, CCDS33843.1, CCDS33844.1, CCDS43144.1, CCDS54635.1	3q21.2	2013-09-02			ENSG00000114544	ENSG00000114544		"""Solute carriers"""	31046	protein-coding gene	gene with protein product		610803					Standard	NM_001164475		Approved	FLJ20473	uc003eij.3	Q96GZ6	OTTHUMG00000162678	ENST00000315891.6:c.274-5380C>A	3.37:g.125775273G>T			A6ND60|B3KSD9|B7Z4Y2|C9JE96|E7ENY4|Q8N342|Q8NB27|Q9H9I6|Q9HAB1|Q9NX30	Nonsense_Mutation	SNP	pfam_SLC41_membr_dom	p.C41*	ENST00000315891.6	37	c.123	CCDS33843.1	3	.	.	.	.	.	.	.	.	.	.	G	32	5.152507	0.94645	.	.	ENSG00000114544	ENST00000383598;ENST00000513723	.	.	.	5.2	3.39	0.38822	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.36615	T	0.2	.	8.9195	0.35604	0.1829:0.0:0.8171:0.0	.	.	.	.	X	41;119	.	ENSP00000373092:C41X	C	-	3	2	SLC41A3	127257963	0.979000	0.34478	0.876000	0.34364	0.230000	0.25150	0.813000	0.27225	1.176000	0.42840	0.585000	0.79938	TGC	SLC41A3	-	NULL	ENSG00000114544		0.557	SLC41A3-024	KNOWN	basic|CCDS	protein_coding	SLC41A3	HGNC	protein_coding	OTTHUMT00000370886.1	-	0.00	63	0	G	NM_017836		125775273	-1	tier1	-	no_errors	ENST00000383598	ensembl	human	known	74_37	nonsense	12.12	29	4	SNP	0.888	T
SLC8A3	6547	genome.wustl.edu	37	14	70512793	70512793	+	Silent	SNP	C	C	A	rs199883587		TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr14:70512793C>A	ENST00000381269.2	-	8	3408	c.2655G>T	c.(2653-2655)ccG>ccT	p.P885P	SLC8A3_ENST00000394330.2_Silent_p.P242P|SLC8A3_ENST00000216568.7_Silent_p.P256P|SLC8A3_ENST00000528359.1_Silent_p.P883P|SLC8A3_ENST00000534137.1_Silent_p.P882P|SLC8A3_ENST00000356921.2_Silent_p.P879P|SLC8A3_ENST00000533541.1_3'UTR|SLC8A3_ENST00000357887.3_Silent_p.P883P	NM_058240.2|NM_183002.1	NP_489479.1|NP_892114.1	P57103	NAC3_HUMAN	solute carrier family 8 (sodium/calcium exchanger), member 3	885					blood coagulation (GO:0007596)|calcium ion export from cell (GO:1990034)|calcium ion import into cell (GO:1990035)|calcium ion transport into cytosol (GO:0060402)|cell communication (GO:0007154)|cellular response to cAMP (GO:0071320)|hematopoietic progenitor cell differentiation (GO:0002244)|ion transport (GO:0006811)|telencephalon development (GO:0021537)|transmembrane transport (GO:0055085)	dendritic spine (GO:0043197)|integral component of membrane (GO:0016021)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)	calcium:sodium antiporter activity (GO:0005432)	p.P885P(1)		NS(1)|breast(3)|central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(12)|lung(18)|ovary(2)|pancreas(2)|prostate(3)|skin(6)	54				BRCA - Breast invasive adenocarcinoma(234;0.0079)|all cancers(60;0.0102)|OV - Ovarian serous cystadenocarcinoma(108;0.0555)		CTCCCAGGTGCGGCCGCCTTC	0.597											OREG0022773	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					1	Substitution - coding silent(1)	large_intestine(1)											31.0	31.0	31.0					14																	70512793		2203	4300	6503	SO:0001819	synonymous_variant	0			AJ304852	CCDS9799.1, CCDS9800.1, CCDS35498.1, CCDS41967.1, CCDS45131.1, CCDS53904.1	14q24.1	2013-05-22	2008-09-02		ENSG00000100678	ENSG00000100678		"""Solute carriers"""	11070	protein-coding gene	gene with protein product		607991				8798769	Standard	XM_005268017		Approved	NCX3	uc001xly.3	P57103	OTTHUMG00000152342	ENST00000381269.2:c.2655G>T	14.37:g.70512793C>A		1122	Q5K3P6|Q5K3P7|Q8IUE9|Q8IUF0|Q8NFI7|Q96QG1|Q96QG2	Silent	SNP	pfam_NaCa_Exmemb,pfam_Calx_beta,smart_Calx_beta,prints_Na_Ca_Ex,tigrfam_Na_Ca_Ex	p.P885	ENST00000381269.2	37	c.2655	CCDS35498.1	14																																																																																			SLC8A3	-	pfam_NaCa_Exmemb,tigrfam_Na_Ca_Ex	ENSG00000100678		0.597	SLC8A3-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SLC8A3	HGNC	protein_coding	OTTHUMT00000390736.1		0.00	59	0	C			70512793	-1			no_errors	ENST00000381269	ensembl	human	known	74_37	silent	7.69	24	2	SNP	0.981	A
SLC9A1	6548	genome.wustl.edu	37	1	27425903	27425904	+	3'UTR	INS	-	-	G			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr1:27425903_27425904insG	ENST00000263980.3	-	0	3917_3918				SLC9A1_ENST00000490329.1_5'UTR	NM_003047.4	NP_003038.2	P19634	SL9A1_HUMAN	solute carrier family 9, subfamily A (NHE1, cation proton antiporter 1), member 1						carbohydrate metabolic process (GO:0005975)|cardiac muscle cell differentiation (GO:0055007)|cell growth (GO:0016049)|cellular response to acidic pH (GO:0071468)|glycosaminoglycan metabolic process (GO:0030203)|hyaluronan catabolic process (GO:0030214)|hyaluronan metabolic process (GO:0030212)|hydrogen ion transmembrane transport (GO:1902600)|ion transport (GO:0006811)|negative regulation of apoptotic process (GO:0043066)|neuron death (GO:0070997)|positive regulation of action potential (GO:0045760)|positive regulation of cell growth (GO:0030307)|positive regulation of mitochondrial membrane permeability (GO:0035794)|protein oligomerization (GO:0051259)|regulation of intracellular pH (GO:0051453)|regulation of pH (GO:0006885)|regulation of sensory perception of pain (GO:0051930)|regulation of the force of heart contraction (GO:0002026)|response to acidic pH (GO:0010447)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|small molecule metabolic process (GO:0044281)|sodium ion export (GO:0071436)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium-dependent protein binding (GO:0048306)|sodium:proton antiporter activity (GO:0015385)|solute:proton antiporter activity (GO:0015299)			central_nervous_system(1)|cervix(3)|endometrium(3)|kidney(2)|large_intestine(4)|liver(1)|lung(7)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	27				UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Epithelial(14;2.19e-50)|OV - Ovarian serous cystadenocarcinoma(117;1.8e-29)|Colorectal(126;7.61e-09)|COAD - Colon adenocarcinoma(152;9.32e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000521)|KIRC - Kidney renal clear cell carcinoma(1967;0.00079)|STAD - Stomach adenocarcinoma(196;0.00125)|READ - Rectum adenocarcinoma(331;0.046)	Amiloride(DB00594)	CAGAGAGACGTGGGGGAGGGGT	0.525																																																	0																																										SO:0001624	3_prime_UTR_variant	0			M81768	CCDS295.1	1p36.1-p35	2014-06-13	2012-03-22		ENSG00000090020	ENSG00000090020		"""Solute carriers"""	11071	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 143"""	107310	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 1 (antiporter, Na+/H+, amiloride sensitive)"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 1"""	APNH, NHE1		8283968	Standard	NM_003047		Approved	PPP1R143	uc001bnm.4	P19634	OTTHUMG00000004271	ENST00000263980.3:c.*895->C	1.37:g.27425908_27425908dupG			B1ALD6|D3DPL4|Q96EM2	RNA	INS	-	NULL	ENST00000263980.3	37	NULL	CCDS295.1	1																																																																																			SLC9A1	-	-	ENSG00000090020		0.525	SLC9A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC9A1	HGNC	protein_coding	OTTHUMT00000012336.2		0.00	107	0	-	NM_003047		27425904	-1	tier1		no_errors	ENST00000490329	ensembl	human	known	74_37	rna	15.69	43	8	INS	0.000:0.000	G
SMARCA4	6597	genome.wustl.edu	37	19	11100016	11100016	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr19:11100016G>T	ENST00000429416.3	+	8	1423	c.1142G>T	c.(1141-1143)cGa>cTa	p.R381L	SMARCA4_ENST00000358026.2_Missense_Mutation_p.R381L|SMARCA4_ENST00000344626.4_Missense_Mutation_p.R381L|SMARCA4_ENST00000541122.2_Missense_Mutation_p.R381L|SMARCA4_ENST00000444061.3_Missense_Mutation_p.R381L|SMARCA4_ENST00000413806.3_Missense_Mutation_p.R381L|SMARCA4_ENST00000590574.1_Missense_Mutation_p.R381L|SMARCA4_ENST00000589677.1_Missense_Mutation_p.R381L|SMARCA4_ENST00000450717.3_Missense_Mutation_p.R381L	NM_001128844.1	NP_001122316.1	P51532	SMCA4_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4	381					aortic smooth muscle cell differentiation (GO:0035887)|ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|blastocyst growth (GO:0001832)|blastocyst hatching (GO:0001835)|cell morphogenesis (GO:0000902)|chromatin remodeling (GO:0006338)|definitive erythrocyte differentiation (GO:0060318)|DNA methylation on cytosine within a CG sequence (GO:0010424)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic organ morphogenesis (GO:0048562)|epidermis morphogenesis (GO:0048730)|extracellular matrix organization (GO:0030198)|forebrain development (GO:0030900)|glial cell fate determination (GO:0007403)|heart trabecula formation (GO:0060347)|hindbrain development (GO:0030902)|histone H3 acetylation (GO:0043966)|keratinocyte differentiation (GO:0030216)|lens fiber cell development (GO:0070307)|liver development (GO:0001889)|methylation-dependent chromatin silencing (GO:0006346)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of cell growth (GO:0030308)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription, DNA-templated (GO:0045892)|neural retina development (GO:0003407)|nucleosome disassembly (GO:0006337)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of DNA binding (GO:0043388)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|vasculogenesis (GO:0001570)	extracellular space (GO:0005615)|heterochromatin (GO:0000792)|membrane (GO:0016020)|nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nuclear euchromatin (GO:0005719)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perichromatin fibrils (GO:0005726)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|protein N-terminus binding (GO:0047485)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription coactivator activity (GO:0001105)|Tat protein binding (GO:0030957)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)	p.R381Q(2)|p.?(1)		adrenal_gland(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(23)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|liver(4)|lung(60)|ovary(10)|pancreas(7)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	163		all_lung(6;0.0512)|Lung NSC(9;0.0568)				ATCGCACACCGAATTCAGGAA	0.607			"""F, N, Mis"""		NSCLC																																			Rec	yes		19	19p13.2	6597	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4"""		E	3	Substitution - Missense(2)|Unknown(1)	large_intestine(2)|lung(1)											88.0	90.0	89.0					19																	11100016		2203	4300	6503	SO:0001583	missense	0			D26156	CCDS12253.1, CCDS45972.1, CCDS45973.1, CCDS54217.1, CCDS54218.1	19p13.3	2014-09-17	2006-11-09		ENSG00000127616	ENSG00000127616			11100	protein-coding gene	gene with protein product	"""SNF2-like 4"", ""global transcription activator homologous sequence"", ""sucrose nonfermenting-like 4"", ""mitotic growth and transcription activator"", ""BRM/SWI2-related gene 1"", ""homeotic gene regulator"", ""nuclear protein GRB1"", ""brahma protein-like 1"", ""ATP-dependent helicase SMARCA4"""	603254		SNF2L4		8208605	Standard	NM_003072		Approved	hSNF2b, BRG1, BAF190, SNF2, SWI2, SNF2-BETA, SNF2LB, FLJ39786	uc010dxo.3	P51532	OTTHUMG00000169272	ENST00000429416.3:c.1142G>T	19.37:g.11100016G>T	ENSP00000395654:p.Arg381Leu		B1A8Z4|B1A8Z5|B1A8Z6|B1A8Z7|E9PBR8|O95052|Q9HBD3	Missense_Mutation	SNP	pfam_SNF2_N,pfam_Bromodomain,pfam_BRK_domain,pfam_Helicase/SANT-assoc_DNA-bd,pfam_Helicase_C,pfam_Gln-Leu-Gln_QLQ,superfamily_P-loop_NTPase,superfamily_Bromodomain,smart_Gln-Leu-Gln_QLQ,smart_HAS_subgr,smart_BRK_domain,smart_Helicase_ATP-bd,smart_Helicase_C,smart_Bromodomain,prints_Bromodomain,pfscan_Helicase/SANT-assoc_DNA-bd,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Bromodomain	p.R381L	ENST00000429416.3	37	c.1142	CCDS12253.1	19	.	.	.	.	.	.	.	.	.	.	G	28.3	4.910643	0.92107	.	.	ENSG00000127616	ENST00000429416;ENST00000358026;ENST00000421844;ENST00000344626;ENST00000541122;ENST00000444061;ENST00000450717;ENST00000413806	D;D;D;D;D;D;D	0.92965	-3.14;-3.14;-3.14;-3.11;-3.11;-3.11;-3.11	4.18	4.18	0.49190	.	0.000000	0.64402	D	0.000001	D	0.96153	0.8746	M	0.85542	2.76	0.58432	D	0.999998	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	1.0;1.0;1.0;0.999;0.998;1.0;1.0	D	0.96891	0.9653	10	0.87932	D	0	-8.8962	15.4489	0.75257	0.0:0.0:1.0:0.0	.	381;381;381;381;381;381;381	B1A8Z6;B1A8Z4;B1A8Z7;Q9HBD4;B1A8Z5;A7E2E1;P51532	.;.;.;.;.;.;SMCA4_HUMAN	L	381	ENSP00000395654:R381L;ENSP00000350720:R381L;ENSP00000343896:R381L;ENSP00000445036:R381L;ENSP00000392837:R381L;ENSP00000397783:R381L;ENSP00000414727:R381L	ENSP00000343896:R381L	R	+	2	0	SMARCA4	10961016	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	9.657000	0.98554	2.188000	0.69820	0.462000	0.41574	CGA	SMARCA4	-	NULL	ENSG00000127616		0.607	SMARCA4-007	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	SMARCA4	HGNC	protein_coding	OTTHUMT00000452638.2		0.00	94	0	G	NM_003072		11100016	+1			no_errors	ENST00000358026	ensembl	human	known	74_37	missense	6.67	28	2	SNP	1.000	T
SNHG14	104472715	genome.wustl.edu	37	15	25328597	25328597	+	RNA	SNP	C	C	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr15:25328597C>T	ENST00000546682.1	+	0	243				SNORD116-17_ENST00000383929.1_RNA|SNHG14_ENST00000553108.1_RNA|SNORD116-18_ENST00000383961.1_RNA|SNORD116-16_ENST00000384533.1_RNA|SNHG14_ENST00000549804.2_RNA|SNORD116-15_ENST00000384445.1_RNA	NR_003361.1				small nucleolar RNA host gene 14 (non-protein coding)																		TCTTCTTGTGCGATCCTTGGA	0.502																																																	0																																												0					15q11.2	2014-01-17	2011-08-22	2011-08-22	ENSG00000224078	ENSG00000224078		"""Long non-coding RNAs"""	37462	non-coding RNA	RNA, long non-coding	"""non-protein coding RNA 214"""		"""UBE3A antisense RNA 1 (non-protein coding)"""	UBE3A-AS1		23771028	Standard			Approved	NCRNA00214, UBE3A-AS			OTTHUMG00000056661		15.37:g.25328597C>T				RNA	SNP	-	NULL	ENST00000546682.1	37	NULL		15																																																																																			SNHG14	-	-	ENSG00000224078		0.502	SNHG14-022	KNOWN	basic	antisense	SNHG14	HGNC	processed_transcript	OTTHUMT00000408281.1	-	0.00	114	0	C			25328597	+1	tier1	-	no_errors	ENST00000383025	ensembl	human	known	74_37	rna	6.33	74	5	SNP	0.003	T
RPL30	6156	genome.wustl.edu	37	8	99054503	99054504	+	Intron	INS	-	-	T	rs534352583|rs367741409	byFrequency	TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr8:99054503_99054504insT	ENST00000521291.1	-	3	445				RPL30_ENST00000287038.3_Intron|RPL30_ENST00000396070.2_Intron|RPL30_ENST00000523172.1_Intron|KB-1208A12.3_ENST00000501016.2_RNA|SNORA72_ENST00000384339.1_RNA|RPL30_ENST00000518164.1_Intron			P62888	RL30_HUMAN	ribosomal protein L30						cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			kidney(2)|lung(4)|skin(1)	7	Breast(36;1.43e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.192)			TTTTTTGGCACTTTTTTTTTTC	0.312																																																	0																																										SO:0001627	intron_variant	0				CCDS34928.1	8q22	2013-05-09			ENSG00000156482	ENSG00000156482		"""L ribosomal proteins"""	10333	protein-coding gene	gene with protein product		180467				1577483	Standard	NM_000989		Approved	L30	uc003yif.3	P62888	OTTHUMG00000164796	ENST00000521291.1:c.298+368->A	8.37:g.99054513_99054513dupT			B2R591|P04645|Q502Z6	RNA	INS	-	NULL	ENST00000521291.1	37	NULL	CCDS34928.1	8																																																																																			KB-1208A12.3	-	-	ENSG00000245970		0.312	RPL30-007	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SNORA72	Clone_based_vega_gene	protein_coding	OTTHUMT00000380450.1		0.00	36	0	-			99054504	+1	tier1		no_errors	ENST00000501016	ensembl	human	known	74_37	rna	12.12	29	4	INS	0.000:0.001	T
SNORD3B-1	26851	genome.wustl.edu	37	17	18965497	18965497	+	lincRNA	SNP	C	C	A	rs546484579	byFrequency	TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr17:18965497C>A	ENST00000363359.1	+	0	432				SNORD3B-2_ENST00000364880.1_lincRNA					small nucleolar RNA, C/D box 3B-1																		CGGGCCGTTTCCGGGCTGTTC	0.532																																																	0																																												0			AF020534, AF020533, AF020532		17p11.2	2013-09-05	2006-11-28	2006-11-28	ENSG00000200229	ENSG00000265185			10168	non-coding RNA	RNA, small nucleolar			"""RNA, U3A1 small nucleolar, RNA, U3A1 small nucleolar"""	RNU3A1		9365252	Standard	NR_003271		Approved	U3a, U3b1, U3b2					17.37:g.18965497C>A				RNA	SNP	-	NULL	ENST00000363359.1	37	NULL		17																																																																																			SNORD3B-1	-	-	ENSG00000265185		0.532	SNORD3B-1-201	KNOWN	basic	snoRNA	SNORD3B-1	HGNC	lincRNA		-	0.00	51	0	C	NR_003271		18965497	+1	tier1	-	no_errors	ENST00000577988	ensembl	human	known	74_37	rna	29.41	24	10	SNP	0.000	A
SPECC1L	23384	genome.wustl.edu	37	22	24718602	24718602	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr22:24718602C>A	ENST00000314328.9	+	5	1939	c.1654C>A	c.(1654-1656)Cag>Aag	p.Q552K	SPECC1L_ENST00000416735.1_Intron|SPECC1L_ENST00000541492.1_Missense_Mutation_p.Q552K|SPECC1L_ENST00000437398.1_Missense_Mutation_p.Q552K|SPECC1L-ADORA2A_ENST00000358654.2_Missense_Mutation_p.Q552K	NM_001254733.1|NM_015330.3	NP_001241662.1|NP_056145	Q69YQ0	CYTSA_HUMAN	sperm antigen with calponin homology and coiled-coil domains 1-like	552					actin cytoskeleton organization (GO:0030036)|cell cycle (GO:0007049)|cell division (GO:0051301)|cell migration (GO:0016477)|negative regulation of actin filament depolymerization (GO:0030835)|negative regulation of microtubule depolymerization (GO:0007026)	cytoplasm (GO:0005737)|filamentous actin (GO:0031941)|gap junction (GO:0005921)|microtubule organizing center (GO:0005815)				breast(1)|endometrium(1)|kidney(4)|large_intestine(7)|lung(6)|ovary(1)|prostate(1)|skin(3)|stomach(2)|urinary_tract(1)	27						TGAGTCTGAGCAGAAAGGAAA	0.463																																																	0													54.0	52.0	52.0					22																	24718602		2203	4300	6503	SO:0001583	missense	0			AK025531	CCDS33619.1, CCDS58797.1	22q11.23	2012-12-20	2010-09-17	2010-09-17	ENSG00000100014	ENSG00000100014			29022	protein-coding gene	gene with protein product	"""cytokinesis and spindle organization A"", ""cytospin A"""	614140	"""SPECC1-like"""			9205841	Standard	NM_001254733		Approved	KIAA0376, CYTSA	uc002zzv.4	Q69YQ0	OTTHUMG00000171450	ENST00000314328.9:c.1654C>A	22.37:g.24718602C>A	ENSP00000325785:p.Gln552Lys		B7Z758|F5H1H6|O15081	Missense_Mutation	SNP	pfam_CH-domain,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_bHLH_dom,smart_CH-domain,pfscan_CH-domain	p.Q552K	ENST00000314328.9	37	c.1654	CCDS33619.1	22	.	.	.	.	.	.	.	.	.	.	C	13.82	2.350162	0.41599	.	.	ENSG00000100014	ENST00000398280;ENST00000437398;ENST00000421374;ENST00000314328;ENST00000541492	T;T;T;T	0.58797	0.31;2.79;0.31;3.31	5.5	5.5	0.81552	.	0.049245	0.85682	D	0.000000	T	0.45175	0.1329	N	0.17474	0.49	0.46279	D	0.998969	B;B	0.25667	0.061;0.131	B;B	0.26202	0.067;0.058	T	0.31530	-0.9940	10	0.32370	T	0.25	-24.3307	18.3864	0.90468	0.0:1.0:0.0:0.0	.	552;552	F5H1H6;Q69YQ0	.;CYTSA_HUMAN	K	580;552;552;552;552	ENSP00000393363:Q552K;ENSP00000405671:Q552K;ENSP00000325785:Q552K;ENSP00000439633:Q552K	ENSP00000325785:Q552K	Q	+	1	0	SPECC1L	23048602	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	2.896000	0.48656	2.597000	0.87782	0.655000	0.94253	CAG	SPECC1L	-	NULL	ENSG00000100014		0.463	SPECC1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPECC1L	HGNC	protein_coding	OTTHUMT00000319986.2		0.00	76	0	C	NM_015330		24718602	+1			no_errors	ENST00000314328	ensembl	human	known	74_37	missense	5.26	54	3	SNP	1.000	A
SPEN	23013	genome.wustl.edu	37	1	16254623	16254623	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr1:16254623C>A	ENST00000375759.3	+	11	2092	c.1888C>A	c.(1888-1890)Cgt>Agt	p.R630S		NM_015001.2	NP_055816.2	Q96T58	MINT_HUMAN	spen family transcriptional repressor	630	Arg-rich.|Tyr-rich.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|positive regulation of neurogenesis (GO:0050769)|positive regulation of transcription, DNA-templated (GO:0045893)|viral process (GO:0016032)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)|transcription corepressor activity (GO:0003714)			NS(1)|breast(13)|central_nervous_system(3)|cervix(5)|endometrium(16)|kidney(18)|large_intestine(27)|liver(2)|lung(37)|ovary(7)|prostate(7)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	149		Colorectal(325;0.000258)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(313;0.013)|READ - Rectum adenocarcinoma(331;0.0681)		TAACCAAGATCGTACATATTA	0.408																																																	0													79.0	80.0	80.0					1																	16254623		2203	4300	6503	SO:0001583	missense	0				CCDS164.1	1p36	2013-10-17	2013-10-17		ENSG00000065526	ENSG00000065526		"""RNA binding motif (RRM) containing"""	17575	protein-coding gene	gene with protein product		613484	"""SPEN homolog, transcriptional regulator (Drosophila)"", ""spen homolog, transcriptional regulator (Drosophila)"""			10451362, 11331609	Standard	NM_015001		Approved	KIAA0929, MINT, SHARP, RBM15C	uc001axk.1	Q96T58	OTTHUMG00000009376	ENST00000375759.3:c.1888C>A	1.37:g.16254623C>A	ENSP00000364912:p.Arg630Ser		Q9H9A8|Q9NWH5|Q9UQ01|Q9Y556	Missense_Mutation	SNP	pfam_RRM_dom,pfam_SPOC_C,superfamily_SPOC_like_C_dom,smart_RRM_dom,pfscan_SPOC_met,pfscan_RRM_dom	p.R630S	ENST00000375759.3	37	c.1888	CCDS164.1	1	.	.	.	.	.	.	.	.	.	.	C	16.38	3.107023	0.56291	.	.	ENSG00000065526	ENST00000375759	T	0.11169	2.8	4.54	4.54	0.55810	.	.	.	.	.	T	0.23926	0.0579	L	0.34521	1.04	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.01440	-1.1354	9	0.46703	T	0.11	-7.2375	17.8431	0.88720	0.0:1.0:0.0:0.0	.	630	Q96T58	MINT_HUMAN	S	630	ENSP00000364912:R630S	ENSP00000364912:R630S	R	+	1	0	SPEN	16127210	1.000000	0.71417	0.996000	0.52242	0.993000	0.82548	4.465000	0.60141	2.514000	0.84764	0.563000	0.77884	CGT	SPEN	-	NULL	ENSG00000065526		0.408	SPEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPEN	HGNC	protein_coding	OTTHUMT00000025993.1		0.00	54	0	C	NM_015001		16254623	+1			no_errors	ENST00000375759	ensembl	human	known	74_37	missense	10.71	25	3	SNP	1.000	A
SSPO	23145	genome.wustl.edu	37	7	149474349	149474349	+	RNA	SNP	C	C	A			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr7:149474349C>A	ENST00000378016.2	+	0	393							A2VEC9	SSPO_HUMAN	SCO-spondin						cell adhesion (GO:0007155)	extracellular space (GO:0005615)	peptidase inhibitor activity (GO:0030414)					Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			CAGCTAATGCCTCAGCAGGAA	0.662																																																	0													11.0	14.0	13.0					7																	149474349		1981	4120	6101			0			AK093431		7q36.1	2013-08-07	2013-08-06		ENSG00000197558	ENSG00000197558			21998	protein-coding gene	gene with protein product	"""subcommissural organ spondin"", ""SCO protein, thrombospondin domain containing"""		"""SCO-spondin homolog (Bos taurus)"""			8743952, 11008217	Standard	NM_198455		Approved	SCO-spondin, KIAA0543, FLJ36112	uc010lpk.3	A2VEC9	OTTHUMG00000157884		7.37:g.149474349C>A			Q76B61	RNA	SNP	-	NULL	ENST00000378016.2	37	NULL		7																																																																																			SSPO	-	-	ENSG00000197558		0.662	SSPO-202	KNOWN	basic	processed_transcript	SSPO	HGNC	processed_transcript			0.00	62	0	C			149474349	+1			no_errors	ENST00000262089	ensembl	human	known	74_37	rna	9.52	38	4	SNP	0.462	A
SSUH2	51066	genome.wustl.edu	37	3	8677490	8677490	+	5'UTR	SNP	G	G	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr3:8677490G>T	ENST00000317371.4	-	0	1095				SSUH2_ENST00000415132.1_5'UTR|SSUH2_ENST00000544814.1_Missense_Mutation_p.L28I|SSUH2_ENST00000341795.3_5'UTR			Q9Y2M2	SSUH2_HUMAN	ssu-2 homolog (C. elegans)							cytoplasm (GO:0005737)											CTCTCCAGGAGCTCTGTGGGG	0.582																																																	0																																										SO:0001623	5_prime_UTR_variant	0			AB024705	CCDS2568.1, CCDS58815.1	3p25.3	2012-11-05	2012-11-05	2012-11-05	ENSG00000125046	ENSG00000125046			24809	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 32"""	C3orf32		20205943	Standard	NM_001256748		Approved	fls485, ssu-2	uc011atg.3	Q9Y2M2	OTTHUMG00000122075	ENST00000317371.4:c.-131C>A	3.37:g.8677490G>T			A6NFA9|B3KS84|B7Z6E3|F5H2S5|Q7Z7K4	Missense_Mutation	SNP	superfamily_HSP_DnaJ_Cys-rich_dom	p.L28I	ENST00000317371.4	37	c.82	CCDS2568.1	3	.	.	.	.	.	.	.	.	.	.	G	18.42	3.619886	0.66787	.	.	ENSG00000125046	ENST00000544814;ENST00000427408	T;T	0.48522	0.86;0.81	5.27	4.38	0.52667	.	.	.	.	.	T	0.67287	0.2877	.	.	.	0.24027	N	0.99612	D	0.76494	0.999	D	0.80764	0.994	T	0.59156	-0.7507	8	0.87932	D	0	.	11.8568	0.52441	0.0:0.1764:0.8236:0.0	.	28	F5H2S5	.	I	28	ENSP00000439378:L28I;ENSP00000401289:L28I	ENSP00000388845:L28I	L	-	1	0	C3orf32	8652490	1.000000	0.71417	0.932000	0.37286	0.781000	0.44180	4.736000	0.62059	1.197000	0.43143	0.536000	0.68110	CTC	SSUH2	-	NULL	ENSG00000125046		0.582	SSUH2-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	SSUH2	HGNC	protein_coding	OTTHUMT00000337900.1	-	0.00	99	0	G	NM_015931		8677490	-1	tier1	-	no_errors	ENST00000544814	ensembl	human	known	74_37	missense	6.90	54	4	SNP	0.973	T
SUOX	6821	genome.wustl.edu	37	12	56398569	56398569	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr12:56398569G>T	ENST00000394109.3	+	3	2120	c.1396G>T	c.(1396-1398)Ggg>Tgg	p.G466W	SUOX_ENST00000548274.1_Missense_Mutation_p.G466W|SUOX_ENST00000266971.3_Missense_Mutation_p.G466W|SUOX_ENST00000394115.2_Missense_Mutation_p.G466W|IKZF4_ENST00000262032.5_5'Flank|SUOX_ENST00000356124.4_Missense_Mutation_p.G466W			P51687	SUOX_HUMAN	sulfite oxidase	466	Homodimerization. {ECO:0000250}.				cellular nitrogen compound metabolic process (GO:0034641)|small molecule metabolic process (GO:0044281)|sulfide oxidation, using sulfide:quinone oxidoreductase (GO:0070221)|sulfur amino acid catabolic process (GO:0000098)|sulfur amino acid metabolic process (GO:0000096)	mitochondrial matrix (GO:0005759)	electron carrier activity (GO:0009055)|heme binding (GO:0020037)|molybdenum ion binding (GO:0030151)|molybdopterin cofactor binding (GO:0043546)|sulfite oxidase activity (GO:0008482)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(6)	15			UCEC - Uterine corpus endometrioid carcinoma (6;0.0471)|OV - Ovarian serous cystadenocarcinoma(18;0.119)			GTCTCTGGATGGGGGCCTAAC	0.617																																																	0													182.0	161.0	168.0					12																	56398569		2203	4300	6503	SO:0001583	missense	0			BC065193	CCDS8901.2	12q13.13	2011-02-10			ENSG00000139531	ENSG00000139531	1.8.3.1		11460	protein-coding gene	gene with protein product		606887				7599189	Standard	XM_005269112		Approved		uc001siz.3	P51687	OTTHUMG00000128503	ENST00000394109.3:c.1396G>T	12.37:g.56398569G>T	ENSP00000377668:p.Gly466Trp			Missense_Mutation	SNP	pfam_OxRdtase_Mopterin-bd_dom,pfam_MoCF_OxRdtse_dimer,pfam_Cyt_B5-like_heme/steroid-bd,superfamily_OxRdtase_Mopterin-bd_dom,superfamily_Ig_E-set,superfamily_Cyt_B5-like_heme/steroid-bd,pfscan_Cyt_B5-like_heme/steroid-bd,prints_Mopterin_OxRdtase_euk,prints_Cyt_B5-like_heme/steroid-bd	p.G466W	ENST00000394109.3	37	c.1396	CCDS8901.2	12	.	.	.	.	.	.	.	.	.	.	G	21.1	4.091927	0.76756	.	.	ENSG00000139531	ENST00000356124;ENST00000266971;ENST00000394115;ENST00000548274;ENST00000394109	D;D;D;D;D	0.85702	-2.02;-2.02;-2.02;-2.02;-2.02	4.96	4.96	0.65561	Immunoglobulin E-set (1);Moybdenum cofactor oxidoreductase, dimerisation (2);	0.000000	0.85682	D	0.000000	D	0.95639	0.8582	H	0.98738	4.315	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97025	0.9746	10	0.87932	D	0	-29.071	15.604	0.76649	0.0:0.0:1.0:0.0	.	466	P51687	SUOX_HUMAN	W	466	ENSP00000348440:G466W;ENSP00000266971:G466W;ENSP00000377674:G466W;ENSP00000450245:G466W;ENSP00000377668:G466W	ENSP00000266971:G466W	G	+	1	0	SUOX	54684836	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.741000	0.91583	2.752000	0.94435	0.467000	0.42956	GGG	SUOX	-	pfam_MoCF_OxRdtse_dimer,superfamily_Ig_E-set,prints_Mopterin_OxRdtase_euk	ENSG00000139531		0.617	SUOX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SUOX	HGNC	protein_coding	OTTHUMT00000250309.1	-	0.00	121	0	G	NM_000456		56398569	+1	tier1	-	no_errors	ENST00000266971	ensembl	human	known	74_37	missense	6.15	61	4	SNP	1.000	T
SUSD4	55061	genome.wustl.edu	37	1	223465838	223465838	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr1:223465838G>T	ENST00000343846.3	-	2	937	c.304C>A	c.(304-306)Cat>Aat	p.H102N	SUSD4_ENST00000366878.4_Missense_Mutation_p.H102N|SUSD4_ENST00000454695.2_5'UTR|SUSD4_ENST00000484758.2_Intron|SUSD4_ENST00000478605.1_5'UTR|SUSD4_ENST00000344029.6_Missense_Mutation_p.H102N|SUSD4_ENST00000494793.2_Missense_Mutation_p.H102N			Q5VX71	SUSD4_HUMAN	sushi domain containing 4	102	Sushi 1. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)				cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(5)|liver(1)|lung(5)|skin(1)	17				GBM - Glioblastoma multiforme(131;0.0611)		CCATTAAAATGCTTCAAACAC	0.488																																																	0													136.0	137.0	136.0					1																	223465838		2203	4300	6503	SO:0001583	missense	0			AK096265	CCDS31034.1, CCDS41471.1	1q41	2008-05-14			ENSG00000143502	ENSG00000143502			25470	protein-coding gene	gene with protein product		615827				12477932	Standard	NM_017982		Approved	FLJ10052	uc001hny.4	Q5VX71	OTTHUMG00000037936	ENST00000343846.3:c.304C>A	1.37:g.223465838G>T	ENSP00000344219:p.His102Asn		D3DTB9|Q6UX62|Q9BSR0|Q9NWG0	Missense_Mutation	SNP	pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	p.H102N	ENST00000343846.3	37	c.304	CCDS41471.1	1	.	.	.	.	.	.	.	.	.	.	G	1.951	-0.441146	0.04604	.	.	ENSG00000143502	ENST00000343846;ENST00000366878;ENST00000271787;ENST00000344029	T;T;T	0.60424	0.19;0.19;0.19	5.36	3.46	0.39613	Complement control module (2);Sushi/SCR/CCP (3);	0.282514	0.25319	N	0.031524	T	0.49355	0.1552	L	0.45137	1.4	0.18873	N	0.999989	B;B	0.27316	0.019;0.175	B;B	0.30179	0.019;0.112	T	0.28396	-1.0045	10	0.21014	T	0.42	-4.3472	13.8471	0.63474	0.0653:0.1116:0.8232:0.0	.	102;102	Q5VX71-3;Q5VX71	.;SUSD4_HUMAN	N	102	ENSP00000344219:H102N;ENSP00000355843:H102N;ENSP00000339926:H102N	ENSP00000271787:H102N	H	-	1	0	SUSD4	221532461	0.983000	0.35010	0.001000	0.08648	0.060000	0.15804	2.052000	0.41316	0.249000	0.21456	-1.134000	0.01955	CAT	SUSD4	-	pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	ENSG00000143502		0.488	SUSD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SUSD4	HGNC	protein_coding	OTTHUMT00000092592.2	-	0.00	90	0	G	NM_017982		223465838	-1	tier1	-	no_errors	ENST00000343846	ensembl	human	known	74_37	missense	5.19	73	4	SNP	0.006	T
SYCE1L	100130958	genome.wustl.edu	37	16	77240393	77240393	+	Silent	SNP	G	G	A			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr16:77240393G>A	ENST00000378644.4	+	2	172	c.117G>A	c.(115-117)caG>caA	p.Q39Q	RP11-538I12.2_ENST00000569032.1_RNA	NM_001129979.1	NP_001123451.1	A8MT33	SYC1L_HUMAN	synaptonemal complex central element protein 1-like	39					synaptonemal complex assembly (GO:0007130)	synaptonemal complex (GO:0000795)				breast(1)|prostate(1)	2						TAAAGCTGCAGAAAGGTCATG	0.453																																																	0													172.0	151.0	158.0					16																	77240393		692	1591	2283	SO:0001819	synonymous_variant	0				CCDS45533.1	16q23.1	2009-10-06			ENSG00000205078	ENSG00000205078			37236	protein-coding gene	gene with protein product	"""meiosis-related protein"""					16328886	Standard	NM_001129979		Approved	MRP2	uc010vnh.1	A8MT33		ENST00000378644.4:c.117G>A	16.37:g.77240393G>A			A6NF23	Silent	SNP	NULL	p.Q39	ENST00000378644.4	37	c.117	CCDS45533.1	16																																																																																			SYCE1L	-	NULL	ENSG00000205078		0.453	SYCE1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYCE1L	HGNC	protein_coding	OTTHUMT00000433889.1	-	0.00	84	0	G	NM_001129979		77240393	+1	tier1	-	no_errors	ENST00000378644	ensembl	human	known	74_37	silent	23.08	30	9	SNP	1.000	A
SYCE2	256126	genome.wustl.edu	37	19	13015389	13015389	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr19:13015389G>T	ENST00000293695.7	-	3	241	c.223C>A	c.(223-225)Cag>Aag	p.Q75K	SYCE2_ENST00000591229.1_5'UTR	NM_001105578.1	NP_001099048.1	Q6PIF2	SYCE2_HUMAN	synaptonemal complex central element protein 2	75					synaptonemal complex assembly (GO:0007130)	central element (GO:0000801)				endometrium(1)|kidney(1)|large_intestine(2)|lung(3)|urinary_tract(1)	8						ATCAGCTCCTGGGCTCTCTTC	0.542																																																	0													214.0	216.0	215.0					19																	13015389		2089	4223	6312	SO:0001583	missense	0			AK097443	CCDS42509.1	19p13.13	2008-02-05				ENSG00000161860			27411	protein-coding gene	gene with protein product	"""central element synaptonemal complex 1"""	611487				15944401	Standard	NM_001105578		Approved	CESC1	uc002mvr.2	Q6PIF2		ENST00000293695.7:c.223C>A	19.37:g.13015389G>T	ENSP00000293695:p.Gln75Lys		B4DYD3	Missense_Mutation	SNP	NULL	p.Q75K	ENST00000293695.7	37	c.223	CCDS42509.1	19	.	.	.	.	.	.	.	.	.	.	G	19.00	3.741144	0.69304	.	.	ENSG00000161860	ENST00000293695	T	0.80393	-1.37	4.88	3.81	0.43845	.	0.156108	0.43260	D	0.000590	D	0.85452	0.5700	L	0.55481	1.735	0.32503	N	0.538566	D	0.67145	0.996	D	0.72982	0.979	D	0.87578	0.2482	10	0.66056	D	0.02	-0.0058	10.7711	0.46323	0.0:0.1921:0.8079:0.0	.	75	Q6PIF2	SYCE2_HUMAN	K	75	ENSP00000293695:Q75K	ENSP00000293695:Q75K	Q	-	1	0	SYCE2	12876389	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.059000	0.57470	1.231000	0.43661	0.561000	0.74099	CAG	SYCE2	-	NULL	ENSG00000161860		0.542	SYCE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYCE2	HGNC	protein_coding	OTTHUMT00000451913.1	-	0.00	60	0	G	XM_497609		13015389	-1	tier1	-	no_errors	ENST00000293695	ensembl	human	known	74_37	missense	15.79	16	3	SNP	1.000	T
SYT8	90019	genome.wustl.edu	37	11	1857174	1857174	+	Missense_Mutation	SNP	G	G	T	rs190754396		TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr11:1857174G>T	ENST00000381968.3	+	4	487	c.359G>T	c.(358-360)tGc>tTc	p.C120F	SYT8_ENST00000535046.1_Missense_Mutation_p.C258F|SYT8_ENST00000341958.3_Missense_Mutation_p.C106F|SYT8_ENST00000483280.1_3'UTR|SYT8_ENST00000436964.2_Missense_Mutation_p.C106F	NM_138567.3	NP_612634	Q8NBV8	SYT8_HUMAN	synaptotagmin VIII	120	C2 1. {ECO:0000255|PROSITE- ProRule:PRU00041}.		C -> R (in dbSNP:rs564271). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:17974005}.		acrosome reaction (GO:0007340)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	transporter activity (GO:0005215)			breast(1)|large_intestine(1)|lung(2)|ovary(1)|skin(1)	6		all_epithelial(84;0.000138)|Breast(177;0.000962)|Ovarian(85;0.0014)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00136)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		CAATGGGGGTGCCTGCAGCTC	0.632																																																	0													47.0	50.0	49.0					11																	1857174		2202	4299	6501	SO:0001583	missense	0			AL137708	CCDS7726.2	11p15.5	2013-01-21			ENSG00000149043	ENSG00000149043		"""Synaptotagmins"""	19264	protein-coding gene	gene with protein product		607719				7791877	Standard	XM_005253216		Approved	DKFZp434K0322	uc001lue.1	Q8NBV8	OTTHUMG00000009026	ENST00000381968.3:c.359G>T	11.37:g.1857174G>T	ENSP00000371394:p.Cys120Phe		A6NFJ4|Q9NSV9	Missense_Mutation	SNP	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom,prints_Synaptotagmin	p.C120F	ENST00000381968.3	37	c.359	CCDS7726.2	11	.	.	.	.	.	.	.	.	.	.	g	6.469	0.454703	0.12283	.	.	ENSG00000149043	ENST00000436964;ENST00000535046;ENST00000381968;ENST00000341958	T;T;T;T	0.18174	2.27;2.23;3.19;3.19	3.54	1.32	0.21799	C2 calcium/lipid-binding domain, CaLB (1);	.	.	.	.	T	0.09158	0.0226	N	0.14661	0.345	0.09310	N	1	B;B;B	0.28584	0.216;0.001;0.005	B;B;B	0.24701	0.055;0.0;0.0	T	0.28839	-1.0031	9	0.87932	D	0	.	5.5656	0.17168	0.1981:0.1618:0.64:0.0	.	106;120;106	C9JSK3;Q8NBV8;A6NCR4	.;SYT8_HUMAN;.	F	106;258;120;106	ENSP00000414626:C106F;ENSP00000443325:C258F;ENSP00000371394:C120F;ENSP00000343691:C106F	ENSP00000343691:C106F	C	+	2	0	SYT8	1813750	0.002000	0.14202	0.585000	0.28666	0.233000	0.25261	1.297000	0.33400	0.579000	0.29504	0.305000	0.20034	TGC	SYT8	-	superfamily_C2_dom	ENSG00000149043		0.632	SYT8-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYT8	HGNC	protein_coding	OTTHUMT00000025013.4		0.00	62	0	G			1857174	+1			no_errors	ENST00000381968	ensembl	human	known	74_37	missense	7.69	24	2	SNP	0.015	T
TANK	10010	genome.wustl.edu	37	2	162091891	162091891	+	Silent	SNP	G	G	T	rs368794946		TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr2:162091891G>T	ENST00000392749.2	+	8	1379	c.1140G>T	c.(1138-1140)tcG>tcT	p.S380S	TANK_ENST00000406287.1_3'UTR|TANK_ENST00000259075.2_Silent_p.S380S|AC009299.2_ENST00000421122.2_RNA|TANK_ENST00000402568.1_3'UTR|AC009299.2_ENST00000445372.1_RNA|TANK_ENST00000405852.1_Missense_Mutation_p.R406L	NM_001199135.1	NP_001186064.1	Q92844	TANK_HUMAN	TRAF family member-associated NFKB activator	380					I-kappaB kinase/NF-kappaB signaling (GO:0007249)|innate immune response (GO:0045087)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	metal ion binding (GO:0046872)|ubiquitin protein ligase binding (GO:0031625)	p.S380S(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(7)|ovary(1)|prostate(1)	21						ACAGTGACTCGGTGGTACTAA	0.423																																																	1	Substitution - coding silent(1)	kidney(1)											173.0	165.0	168.0					2																	162091891		2203	4300	6503	SO:0001819	synonymous_variant	0			U59863	CCDS2215.1, CCDS46436.1	2q24-q31	2008-02-05			ENSG00000136560	ENSG00000136560			11562	protein-coding gene	gene with protein product		603893		TRAF2		8710854, 8855313	Standard	NM_004180		Approved	I-TRAF	uc002ubr.2	Q92844	OTTHUMG00000132037	ENST00000392749.2:c.1140G>T	2.37:g.162091891G>T			D3DPB5|Q7Z4J6|Q92885	Missense_Mutation	SNP	NULL	p.R406L	ENST00000392749.2	37	c.1217	CCDS2215.1	2	.	.	.	.	.	.	.	.	.	.	G	10.27	1.303238	0.23736	.	.	ENSG00000136560	ENST00000405852	T	0.34072	1.38	5.63	4.49	0.54785	.	.	.	.	.	T	0.30916	0.0780	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.10730	-1.0617	6	0.25106	T	0.35	-4.8203	4.3339	0.11076	0.6812:0.0:0.1711:0.1477	.	.	.	.	L	406	ENSP00000385487:R406L	ENSP00000385487:R406L	R	+	2	0	TANK	161800137	1.000000	0.71417	0.992000	0.48379	0.848000	0.48234	2.037000	0.41174	0.974000	0.38366	-0.469000	0.05056	CGG	TANK	-	NULL	ENSG00000136560		0.423	TANK-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TANK	HGNC	protein_coding	OTTHUMT00000324232.1	-	0.00	92	0	G	NM_133484		162091891	+1	tier1	-	no_errors	ENST00000405852	ensembl	human	novel	74_37	missense	7.14	52	4	SNP	0.998	T
TBC1D31	93594	genome.wustl.edu	37	8	124094947	124094947	+	Missense_Mutation	SNP	A	A	G			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr8:124094947A>G	ENST00000287380.1	+	3	320	c.230A>G	c.(229-231)aAt>aGt	p.N77S	TBC1D31_ENST00000521676.1_Intron|TBC1D31_ENST00000327098.5_Missense_Mutation_p.N77S|TBC1D31_ENST00000309336.3_Missense_Mutation_p.N77S|TBC1D31_ENST00000378080.2_Intron|TBC1D31_ENST00000522420.1_Intron	NM_145647.3	NP_663622.2	Q96DN5	TBC31_HUMAN	TBC1 domain family, member 31	77						centrosome (GO:0005813)	Rab GTPase activator activity (GO:0005097)										AATAGGTTCAATCTTGTTCAG	0.373																																																	0													99.0	91.0	94.0					8																	124094947		2203	4300	6503	SO:0001583	missense	0			AK094612	CCDS6338.1, CCDS47916.1	8q24.13	2013-07-10	2013-07-10	2013-07-10	ENSG00000156787	ENSG00000156787		"""WD repeat domain containing"""	30888	protein-coding gene	gene with protein product			"""WD repeat domain 67"""	WDR67		12477932	Standard	NM_001145088		Approved	MGC21654, Gm85	uc003ypp.2	Q96DN5	OTTHUMG00000165081	ENST00000287380.1:c.230A>G	8.37:g.124094947A>G	ENSP00000287380:p.Asn77Ser		B7ZL19|Q2M2J9|Q3MIR6|Q8TBP9	Missense_Mutation	SNP	pfam_Rab-GTPase-TBC_dom,pfam_WD40_repeat,superfamily_WD40_repeat_dom,superfamily_Rab-GTPase-TBC_dom,smart_WD40_repeat,pfscan_Rab-GTPase-TBC_dom,pfscan_WD40_repeat_dom	p.N77S	ENST00000287380.1	37	c.230	CCDS6338.1	8	.	.	.	.	.	.	.	.	.	.	A	2.835	-0.241815	0.05906	.	.	ENSG00000156787	ENST00000287380;ENST00000309336;ENST00000327098;ENST00000522276	T;T;T;T	0.69806	-0.14;1.64;1.64;-0.43	5.7	3.38	0.38709	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.333575	0.36234	N	0.002701	T	0.28234	0.0697	N	0.00268	-1.735	0.80722	D	1	B;B;B	0.15141	0.004;0.012;0.0	B;B;B	0.08055	0.003;0.003;0.001	T	0.16600	-1.0397	10	0.12103	T	0.63	-31.4325	13.754	0.62926	0.7159:0.2841:0.0:0.0	.	77;77;77	B7ZL19;Q96DN5;Q3KRB0	.;WDR67_HUMAN;.	S	77;77;77;67	ENSP00000287380:N77S;ENSP00000308358:N77S;ENSP00000312701:N77S;ENSP00000428891:N67S	ENSP00000287380:N77S	N	+	2	0	WDR67	124164128	0.431000	0.25546	1.000000	0.80357	0.934000	0.57294	0.392000	0.20801	0.962000	0.38057	0.482000	0.46254	AAT	TBC1D31	-	superfamily_WD40_repeat_dom,smart_WD40_repeat	ENSG00000156787		0.373	TBC1D31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBC1D31	HGNC	protein_coding	OTTHUMT00000381721.1	-	0.00	59	0	A	NM_145647		124094947	+1	tier1	-	no_errors	ENST00000287380	ensembl	human	known	74_37	missense	21.88	50	14	SNP	0.980	G
TCF20	6942	genome.wustl.edu	37	22	42608243	42608243	+	Missense_Mutation	SNP	G	G	T	rs140878533		TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr22:42608243G>T	ENST00000359486.3	-	1	3205	c.3069C>A	c.(3067-3069)agC>agA	p.S1023R	TCF20_ENST00000335626.4_Missense_Mutation_p.S1023R|TCF20_ENST00000404876.1_5'Flank	NM_005650.1	NP_005641.1	Q9UGU0	TCF20_HUMAN	transcription factor 20 (AR1)	1023					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(7)|large_intestine(13)|lung(22)|ovary(5)|prostate(1)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(5)	66						CTGGGCCTCTGCTCCGCCCAG	0.537																																																	0													51.0	54.0	53.0					22																	42608243		2203	4300	6503	SO:0001583	missense	0			U19345	CCDS14032.1, CCDS14033.1	22q13.3	2011-02-08			ENSG00000100207	ENSG00000100207			11631	protein-coding gene	gene with protein product	"""stromelysin-1 platelet-derived growth factor-responsive element binding protein"""	603107				9730594, 10995766	Standard	NM_005650		Approved	AR1, SPBP	uc003bcj.1	Q9UGU0	OTTHUMG00000150920	ENST00000359486.3:c.3069C>A	22.37:g.42608243G>T	ENSP00000352463:p.Ser1023Arg		A9JX12|O14528|Q13078|Q4V353|Q9H4M0	Missense_Mutation	SNP	smart_Znf_PHD	p.S1023R	ENST00000359486.3	37	c.3069	CCDS14033.1	22	.	.	.	.	.	.	.	.	.	.	G	17.75	3.466351	0.63625	.	.	ENSG00000100207	ENST00000359486;ENST00000335626	T;T	0.64438	-0.09;-0.1	5.92	2.29	0.28610	.	0.000000	0.85682	D	0.000000	T	0.63153	0.2487	N	0.24115	0.695	0.80722	D	1	D;D	0.76494	0.999;0.998	D;D	0.80764	0.994;0.986	T	0.59156	-0.7507	10	0.30854	T	0.27	-17.5783	11.7287	0.51724	0.2703:0.0:0.7296:0.0	.	1023;1023	Q9UGU0-2;Q9UGU0	.;TCF20_HUMAN	R	1023	ENSP00000352463:S1023R;ENSP00000335561:S1023R	ENSP00000335561:S1023R	S	-	3	2	TCF20	40938187	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.474000	0.35398	0.851000	0.35264	0.655000	0.94253	AGC	TCF20	-	NULL	ENSG00000100207		0.537	TCF20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TCF20	HGNC	protein_coding	OTTHUMT00000320531.1		0.00	63	0	G	NM_181492		42608243	-1			no_errors	ENST00000359486	ensembl	human	known	74_37	missense	8.51	43	4	SNP	1.000	T
TECPR1	25851	genome.wustl.edu	37	7	97867827	97867827	+	Silent	SNP	G	G	A			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr7:97867827G>A	ENST00000447648.2	-	9	1328	c.1029C>T	c.(1027-1029)aaC>aaT	p.N343N	TECPR1_ENST00000542604.1_Silent_p.N273N|TECPR1_ENST00000379795.3_Silent_p.N343N			Q7Z6L1	TCPR1_HUMAN	tectonin beta-propeller repeat containing 1	343					autophagic vacuole fusion (GO:0000046)|autophagy (GO:0006914)	autophagic vacuole membrane (GO:0000421)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)	phosphatidylinositol-3-phosphate binding (GO:0032266)			central_nervous_system(2)|endometrium(8)|kidney(1)|large_intestine(1)|lung(9)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	26						ACACCTGGTCGTTCATTCCCA	0.577																																																	0													60.0	64.0	62.0					7																	97867827		2061	4163	6224	SO:0001819	synonymous_variant	0				CCDS47648.1	7q21.3	2009-01-30			ENSG00000205356	ENSG00000205356			22214	protein-coding gene	gene with protein product		614781					Standard	NM_015395		Approved	DKFZP434B0335, FLJ23419, FLJ90593, KIAA1358	uc003upg.4	Q7Z6L1	OTTHUMG00000154273	ENST00000447648.2:c.1029C>T	7.37:g.97867827G>A			A8KAD1|B3KPZ1|C9J024|F5GX57|Q96EB0|Q9P2I9|Q9UFR6	Silent	SNP	pfam_Beta-propeller_rpt_TECPR,superfamily_RCC1/BLIP-II,smart_Beta-propeller_rpt_TECPR,smart_Peroxin/Ferlin	p.N343	ENST00000447648.2	37	c.1029	CCDS47648.1	7																																																																																			TECPR1	-	smart_Beta-propeller_rpt_TECPR	ENSG00000205356		0.577	TECPR1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	TECPR1	HGNC	protein_coding	OTTHUMT00000334661.1	-	0.00	69	0	G	NM_015395		97867827	-1	tier1	-	no_errors	ENST00000379795	ensembl	human	known	74_37	silent	10.81	33	4	SNP	0.371	A
TENM4	26011	genome.wustl.edu	37	11	78387402	78387402	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr11:78387402G>T	ENST00000278550.7	-	30	5753	c.5291C>A	c.(5290-5292)gCc>gAc	p.A1764D		NM_001098816.2	NP_001092286.2	Q6N022	TEN4_HUMAN	teneurin transmembrane protein 4	1764					cardiac cell fate specification (GO:0060912)|cardiac muscle cell proliferation (GO:0060038)|central nervous system myelin formation (GO:0032289)|gastrulation with mouth forming second (GO:0001702)|neuron development (GO:0048666)|positive regulation of gastrulation (GO:2000543)|positive regulation of myelination (GO:0031643)|positive regulation of oligodendrocyte differentiation (GO:0048714)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)	protein homodimerization activity (GO:0042803)										GGAGCCATCGGCCCCGATGTA	0.632																																																	0													29.0	35.0	33.0					11																	78387402		2132	4245	6377	SO:0001583	missense	0			AB037723	CCDS44688.1	11q13	2012-10-02	2012-10-02	2012-10-02		ENSG00000149256			29945	protein-coding gene	gene with protein product		610084	"""odz, odd Oz/ten-m homolog 4 (Drosophila)"""	ODZ4		12000766, 10625539	Standard	NM_001098816		Approved	KIAA1302, Ten-M4	uc001ozl.4	Q6N022		ENST00000278550.7:c.5291C>A	11.37:g.78387402G>T	ENSP00000278550:p.Ala1764Asp		A6ND26|Q7Z3C7|Q96MS6|Q9P2P4|Q9Y4S2	Missense_Mutation	SNP	pfam_Ten_N,pfam_EGF_extracell,pfam_YD,superfamily_CarboxyPept-like_regulatory,smart_EG-like_dom,pfscan_EG-like_dom,tigrfam_YD,tigrfam_Rhs_assc_core	p.A1764D	ENST00000278550.7	37	c.5291	CCDS44688.1	11	.	.	.	.	.	.	.	.	.	.	G	15.88	2.962256	0.53400	.	.	ENSG00000149256	ENST00000278550;ENST00000530738	D;T	0.90004	-2.6;0.85	4.71	4.71	0.59529	.	0.132855	0.51477	D	0.000095	D	0.82958	0.5150	N	0.12182	0.205	0.42021	D	0.99098	D	0.57257	0.979	P	0.47299	0.543	T	0.82831	-0.0263	9	.	.	.	.	18.2069	0.89858	0.0:0.0:1.0:0.0	.	1764	Q6N022	TEN4_HUMAN	D	1764;228	ENSP00000278550:A1764D;ENSP00000431711:A228D	.	A	-	2	0	ODZ4	78065050	0.898000	0.30612	0.883000	0.34634	0.549000	0.35272	5.039000	0.64185	2.584000	0.87258	0.650000	0.86243	GCC	TENM4	-	NULL	ENSG00000149256		0.632	TENM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TENM4	HGNC	protein_coding	OTTHUMT00000391406.2		0.00	79	0	G			78387402	-1			no_errors	ENST00000278550	ensembl	human	known	74_37	missense	5.00	76	4	SNP	0.979	T
TEX15	56154	genome.wustl.edu	37	8	30700967	30700967	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr8:30700967C>A	ENST00000256246.2	-	1	5641	c.5567G>T	c.(5566-5568)tGg>tTg	p.W1856L		NM_031271.3	NP_112561.2	Q9BXT5	TEX15_HUMAN	testis expressed 15	1856					fertilization (GO:0009566)|homeostasis of number of cells within a tissue (GO:0048873)|male genitalia development (GO:0030539)|male meiosis (GO:0007140)|protein localization to chromosome (GO:0034502)|regulation of double-strand break repair via homologous recombination (GO:0010569)|regulation of protein localization (GO:0032880)|spermatogenesis (GO:0007283)|synaptonemal complex assembly (GO:0007130)					NS(2)|breast(3)|cervix(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(38)|lung(56)|ovary(5)|pancreas(1)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	138				KIRC - Kidney renal clear cell carcinoma(542;0.0918)|Kidney(114;0.111)		TATGATAATCCACAGATGGTC	0.343																																																	0													86.0	90.0	89.0					8																	30700967		2203	4300	6503	SO:0001583	missense	0			AF285605	CCDS6080.1	8p22	2009-03-25	2007-03-13			ENSG00000133863			11738	protein-coding gene	gene with protein product	"""cancer/testis antigen 42"""	605795	"""testis expressed sequence 15"""			11279525	Standard	NM_031271		Approved	CT42	uc003xil.3	Q9BXT5		ENST00000256246.2:c.5567G>T	8.37:g.30700967C>A	ENSP00000256246:p.Trp1856Leu			Missense_Mutation	SNP	NULL	p.W1856L	ENST00000256246.2	37	c.5567	CCDS6080.1	8	.	.	.	.	.	.	.	.	.	.	C	16.71	3.198650	0.58126	.	.	ENSG00000133863	ENST00000256246	T	0.11604	2.76	5.68	5.68	0.88126	.	0.255913	0.28338	N	0.015708	T	0.30885	0.0779	L	0.56769	1.78	0.38323	D	0.943595	D	0.89917	1.0	D	0.75484	0.986	T	0.02026	-1.1227	10	0.87932	D	0	.	16.7085	0.85378	0.0:1.0:0.0:0.0	.	1856	Q9BXT5	TEX15_HUMAN	L	1856	ENSP00000256246:W1856L	ENSP00000256246:W1856L	W	-	2	0	TEX15	30820509	1.000000	0.71417	0.998000	0.56505	0.998000	0.95712	2.544000	0.45761	2.685000	0.91497	0.650000	0.86243	TGG	TEX15	-	NULL	ENSG00000133863		0.343	TEX15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TEX15	HGNC	protein_coding	OTTHUMT00000376193.1		0.00	34	0	C			30700967	-1			no_errors	ENST00000256246	ensembl	human	known	74_37	missense	10.00	27	3	SNP	1.000	A
TEX2	55852	genome.wustl.edu	37	17	62228304	62228304	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr17:62228304G>T	ENST00000583097.1	-	11	3330	c.3158C>A	c.(3157-3159)cCa>cAa	p.P1053Q	TEX2_ENST00000258991.3_Missense_Mutation_p.P1060Q|TEX2_ENST00000584379.1_Missense_Mutation_p.P1053Q|TEX2_ENST00000581812.1_5'UTR			Q8IWB9	TEX2_HUMAN	testis expressed 2	1053					signal transduction (GO:0007165)|sphingolipid metabolic process (GO:0006665)	integral component of membrane (GO:0016021)				breast(3)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(15)|ovary(1)|pancreas(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	41			BRCA - Breast invasive adenocarcinoma(8;1.33e-10)	READ - Rectum adenocarcinoma(1115;0.0689)		CACATGTGGTGGCTTTCGGAA	0.423																																																	0													134.0	124.0	128.0					17																	62228304		2203	4300	6503	SO:0001583	missense	0			AB051525	CCDS11658.1, CCDS74131.1	17q23.3	2007-03-13	2007-03-13			ENSG00000136478			30884	protein-coding gene	gene with protein product	"""transmembrane protein 96"""		"""testis expressed sequence 2"""			11214970	Standard	XM_005257507		Approved	HT008, TMEM96, KIAA1738	uc002jee.3	Q8IWB9		ENST00000583097.1:c.3158C>A	17.37:g.62228304G>T	ENSP00000462665:p.Pro1053Gln		Q6AHZ5|Q8N3L0|Q9C0C5	Missense_Mutation	SNP	pfam_DUF2404	p.P1060Q	ENST00000583097.1	37	c.3179		17	.	.	.	.	.	.	.	.	.	.	G	16.32	3.090668	0.55968	.	.	ENSG00000136478	ENST00000258991	T	0.44083	0.93	5.56	5.56	0.83823	.	0.000000	0.85682	D	0.000000	T	0.67979	0.2951	M	0.79926	2.475	0.80722	D	1	D;D	0.69078	0.997;0.997	D;D	0.69307	0.963;0.92	T	0.71820	-0.4477	10	0.87932	D	0	-8.6094	19.5451	0.95291	0.0:0.0:1.0:0.0	.	1060;1053	Q8IWB9-2;Q8IWB9	.;TEX2_HUMAN	Q	1060	ENSP00000258991:P1060Q	ENSP00000258991:P1060Q	P	-	2	0	TEX2	59582036	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.869000	0.99810	2.629000	0.89072	0.655000	0.94253	CCA	TEX2	-	NULL	ENSG00000136478		0.423	TEX2-003	KNOWN	alternative_5_UTR|basic|appris_candidate	protein_coding	TEX2	HGNC	protein_coding	OTTHUMT00000443745.1	-	0.00	78	0	G	NM_018469		62228304	-1	tier1	-	no_errors	ENST00000258991	ensembl	human	known	74_37	missense	10.20	44	5	SNP	1.000	T
TFCP2	7024	genome.wustl.edu	37	12	51566125	51566125	+	Silent	SNP	G	G	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr12:51566125G>T	ENST00000257915.5	-	1	539	c.81C>A	c.(79-81)tcC>tcA	p.S27S	TFCP2_ENST00000548115.1_Silent_p.S27S|TFCP2_ENST00000307660.4_Silent_p.S27S|TFCP2_ENST00000549867.1_Silent_p.S27S	NM_001173452.1|NM_005653.4	NP_001166923.1|NP_005644.2	Q12800	TFCP2_HUMAN	transcription factor CP2	27					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(12)|ovary(1)	23						GGCCGATCCCGGACAGGCTAG	0.557																																																	0													133.0	128.0	129.0					12																	51566125		2203	4300	6503	SO:0001819	synonymous_variant	0			U03494	CCDS8808.1, CCDS55827.1	12q13	2004-01-05				ENSG00000135457			11748	protein-coding gene	gene with protein product		189889				8157699	Standard	NM_005653		Approved	CP2, LSF, LBP-1C, TFCP2C	uc001rxw.3	Q12800	OTTHUMG00000169621	ENST00000257915.5:c.81C>A	12.37:g.51566125G>T			A8K5E9|Q12801|Q9UD75|Q9UD77	Silent	SNP	pfam_CP2,superfamily_SAM/pointed	p.S27	ENST00000257915.5	37	c.81	CCDS8808.1	12																																																																																			TFCP2	-	NULL	ENSG00000135457		0.557	TFCP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TFCP2	HGNC	protein_coding	OTTHUMT00000405119.1	-	0.00	64	0	G	NM_005653		51566125	-1	tier1	-	no_errors	ENST00000257915	ensembl	human	known	74_37	silent	11.43	31	4	SNP	0.877	T
THBS4	7060	genome.wustl.edu	37	5	79354543	79354543	+	Missense_Mutation	SNP	G	G	A	rs553602331		TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr5:79354543G>A	ENST00000350881.2	+	5	852	c.662G>A	c.(661-663)cGg>cAg	p.R221Q	THBS4_ENST00000511733.1_Missense_Mutation_p.R130Q|CTD-2201I18.1_ENST00000503007.1_RNA	NM_003248.4	NP_003239.2	P35443	TSP4_HUMAN	thrombospondin 4	221					behavioral response to pain (GO:0048266)|endothelial cell-cell adhesion (GO:0071603)|myoblast migration (GO:0051451)|negative regulation of angiogenesis (GO:0016525)|positive regulation of cell division (GO:0051781)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|regulation of tissue remodeling (GO:0034103)|response to endoplasmic reticulum stress (GO:0034976)|response to unfolded protein (GO:0006986)|tissue remodeling (GO:0048771)	basement membrane (GO:0005604)|endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|sarcoplasmic reticulum (GO:0016529)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)|integrin binding (GO:0005178)	p.R221Q(1)		breast(1)|endometrium(4)|kidney(2)|large_intestine(9)|lung(14)|ovary(1)|stomach(3)	34		Lung NSC(167;0.00328)|all_lung(232;0.00355)|Ovarian(174;0.0261)		OV - Ovarian serous cystadenocarcinoma(54;6.3e-45)|Epithelial(54;1.77e-39)|all cancers(79;3.2e-34)		GACTTTAACCGGCAGTTCTTG	0.443													G|||	1	0.000199681	0.0	0.0	5008	,	,		17229	0.001		0.0	False		,,,				2504	0.0																1	Substitution - Missense(1)	large_intestine(1)											66.0	67.0	67.0					5																	79354543		2203	4300	6503	SO:0001583	missense	0				CCDS4049.1	5q13	2008-05-15			ENSG00000113296	ENSG00000113296			11788	protein-coding gene	gene with protein product		600715				7852353	Standard	NM_003248		Approved		uc021yaw.1	P35443	OTTHUMG00000108173	ENST00000350881.2:c.662G>A	5.37:g.79354543G>A	ENSP00000339730:p.Arg221Gln		B2R909|Q86TG2	Missense_Mutation	SNP	pfam_Thrombospondin_C,pfam_Thbs/COMP_coiled-coil,pfam_Thrombospondin_3-like_rpt,pfam_EGF-like_Ca-bd_dom,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,pfscan_EG-like_dom	p.R221Q	ENST00000350881.2	37	c.662	CCDS4049.1	5	.	.	.	.	.	.	.	.	.	.	G	19.79	3.893489	0.72639	.	.	ENSG00000113296	ENST00000350881;ENST00000511733	T;T	0.30182	1.54;1.54	5.75	5.75	0.90469	Thrombospondin/cartilage oligomeric matrix protein, coiled-coil domain (1);	0.108147	0.64402	D	0.000009	T	0.27134	0.0665	L	0.44542	1.39	0.43885	D	0.996509	P	0.46142	0.873	B	0.37015	0.239	T	0.02958	-1.1089	10	0.21540	T	0.41	-22.2693	18.936	0.92586	0.0:0.0:1.0:0.0	.	221	P35443	TSP4_HUMAN	Q	221;130	ENSP00000339730:R221Q;ENSP00000422298:R130Q	ENSP00000339730:R221Q	R	+	2	0	THBS4	79390299	1.000000	0.71417	0.986000	0.45419	0.991000	0.79684	5.437000	0.66544	2.712000	0.92718	0.591000	0.81541	CGG	THBS4	-	pfam_Thbs/COMP_coiled-coil	ENSG00000113296		0.443	THBS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THBS4	HGNC	protein_coding	OTTHUMT00000226977.1	-	0.00	81	0	G			79354543	+1	tier1	-	no_errors	ENST00000350881	ensembl	human	known	74_37	missense	38.24	21	13	SNP	1.000	A
TJP1	7082	genome.wustl.edu	37	15	30058538	30058538	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr15:30058538G>A	ENST00000346128.6	-	5	994	c.520C>T	c.(520-522)Cgg>Tgg	p.R174W	TJP1_ENST00000545208.2_Missense_Mutation_p.R174W|TJP1_ENST00000400011.2_Missense_Mutation_p.R178W|TJP1_ENST00000495972.2_Missense_Mutation_p.R174W|TJP1_ENST00000356107.6_Missense_Mutation_p.R174W	NM_003257.3|NM_175610.2	NP_003248.3|NP_783297.2	Q07157	ZO1_HUMAN	tight junction protein 1	174					apoptotic process (GO:0006915)|blastocyst formation (GO:0001825)|cell-cell junction assembly (GO:0007043)|cell-cell signaling involved in cell-cell junction organization (GO:1901350)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to glucose stimulus (GO:0071333)|hippo signaling (GO:0035329)|membrane organization (GO:0061024)|negative regulation of vascular permeability (GO:0043116)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to lipopolysaccharide (GO:0032496)|response to magnetism (GO:0071000)|sensory perception of sound (GO:0007605)	apical junction complex (GO:0043296)|apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|apicolateral plasma membrane (GO:0016327)|basolateral plasma membrane (GO:0016323)|cell junction (GO:0030054)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|gap junction (GO:0005921)|intercalated disc (GO:0014704)|intercellular canaliculus (GO:0046581)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|tight junction (GO:0005923)				breast(4)|central_nervous_system(2)|endometrium(8)|kidney(3)|large_intestine(12)|liver(1)|lung(29)|ovary(4)|pancreas(1)|prostate(3)|urinary_tract(1)	68		all_lung(180;7.48e-11)|Breast(32;0.000153)		all cancers(64;3.29e-10)|Epithelial(43;5.34e-09)|BRCA - Breast invasive adenocarcinoma(123;0.0034)|GBM - Glioblastoma multiforme(186;0.0139)|Lung(196;0.186)		GCCACTGACCGCCTGTCTGAC	0.507																																					Melanoma(77;681 1843 6309 6570)												0													95.0	99.0	98.0					15																	30058538		1955	4150	6105	SO:0001583	missense	0				CCDS42007.1, CCDS45199.1, CCDS73702.1	15q13	2012-07-12	2012-07-12		ENSG00000104067	ENSG00000104067			11827	protein-coding gene	gene with protein product	"""zona occludens 1"", ""tight junction protein ZO-1"""	601009				8825647	Standard	XM_005254616		Approved	ZO-1, MGC133289, DKFZp686M05161	uc001zcr.3	Q07157	OTTHUMG00000137397	ENST00000346128.6:c.520C>T	15.37:g.30058538G>A	ENSP00000281537:p.Arg174Trp		B4E3K1|Q2NKP3|Q4ZGJ6	Missense_Mutation	SNP	pfam_PDZ,pfam_ZU5,pfam_GK/Ca_channel_bsu,pfam_SH3_2,superfamily_PDZ,superfamily_P-loop_NTPase,superfamily_SH3_domain,smart_PDZ,smart_GK/Ca_channel_bsu,smart_ZU5,pfscan_PDZ,pfscan_SH3_domain,pfscan_ZU5,pfscan_Guanylate_kin-like,prints_ZonOcculS1,prints_ZonOcculdens	p.R174W	ENST00000346128.6	37	c.520	CCDS42007.1	15	.	.	.	.	.	.	.	.	.	.	G	20.5	4.000460	0.74818	.	.	ENSG00000104067	ENST00000346128;ENST00000400011;ENST00000545208;ENST00000400007;ENST00000356107	T;T;T;T	0.38887	1.11;1.11;1.11;1.11	5.59	4.59	0.56863	PDZ/DHR/GLGF (1);	0.000000	0.85682	D	0.000000	T	0.59636	0.2208	M	0.64997	1.995	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.991;0.987;0.998;0.999	T	0.57797	-0.7749	9	.	.	.	.	13.2122	0.59832	0.0:0.0:0.725:0.275	.	167;174;174;178	A9CQZ8;Q07157-2;Q07157;G5E9E7	.;.;ZO1_HUMAN;.	W	174;178;174;174;174	ENSP00000281537:R174W;ENSP00000382890:R178W;ENSP00000441202:R174W;ENSP00000348416:R174W	.	R	-	1	2	TJP1	27845830	1.000000	0.71417	0.521000	0.27850	0.806000	0.45545	3.715000	0.54897	2.630000	0.89119	0.655000	0.94253	CGG	TJP1	-	superfamily_PDZ	ENSG00000104067		0.507	TJP1-001	KNOWN	basic|CCDS	protein_coding	TJP1	HGNC	protein_coding	OTTHUMT00000268237.3	-	0.00	59	0	G	NM_003257		30058538	-1	tier1	-	no_errors	ENST00000346128	ensembl	human	known	74_37	missense	56.14	25	32	SNP	1.000	A
TM4SF19	116211	genome.wustl.edu	37	3	196050665	196050665	+	3'UTR	SNP	C	C	A			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr3:196050665C>A	ENST00000273695.3	-	0	778				TM4SF19_ENST00000442633.1_3'UTR|TM4SF19_ENST00000454715.1_3'UTR|TM4SF19-AS1_ENST00000444939.1_RNA|TM4SF19_ENST00000446879.1_Missense_Mutation_p.A217S|TM4SF19-AS1_ENST00000452051.1_RNA|TM4SF19-AS1_ENST00000420226.1_RNA	NM_001204897.1|NM_138461.3	NP_001191826.1|NP_612470.2	Q96DZ7	T4S19_HUMAN	transmembrane 4 L six family member 19							integral component of membrane (GO:0016021)				endometrium(2)|kidney(2)|large_intestine(3)|lung(5)	12	all_cancers(143;1.19e-08)|Ovarian(172;0.0634)|Breast(254;0.206)		Epithelial(36;3.94e-24)|all cancers(36;4.34e-22)|OV - Ovarian serous cystadenocarcinoma(49;8.53e-19)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00314)		AACACCCATGCTTGCAAGTGA	0.483																																																	0													52.0	54.0	53.0					3																	196050665		2203	4300	6503	SO:0001624	3_prime_UTR_variant	0			BC013113	CCDS3316.1, CCDS56299.1	3q29	2005-08-09			ENSG00000145107	ENSG00000145107			25167	protein-coding gene	gene with protein product						12477932	Standard	NM_138461		Approved		uc021xjs.1	Q96DZ7	OTTHUMG00000155675	ENST00000273695.3:c.*23G>T	3.37:g.196050665C>A			B2RV20|E9PH22|Q336K7	Missense_Mutation	SNP	pfam_L6_membrane	p.A217S	ENST00000273695.3	37	c.649	CCDS3316.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	9.661|9.661	1.144257|1.144257	0.21205|0.21205	.|.	.|.	ENSG00000145107|ENSG00000145107	ENST00000446879|ENST00000440822	T|.	0.33654|.	1.4|.	2.42|2.42	-1.98|-1.98	0.07480|0.07480	.|.	.|.	.|.	.|.	.|.	T|T	0.13756|0.13756	0.0333|0.0333	N|N	0.08118|0.08118	0|0	0.09310|0.09310	N|N	0.999999|0.999999	B|.	0.26809|.	0.16|.	B|.	0.20577|.	0.03|.	T|T	0.24190|0.24190	-1.0167|-1.0167	9|5	0.06891|.	T|.	0.86|.	0.068|0.068	3.3931|3.3931	0.07297|0.07297	0.0:0.3045:0.2183:0.4772|0.0:0.3045:0.2183:0.4772	.|.	217|.	C9JCD5|.	.|.	S|N	217|84	ENSP00000395280:A217S|.	ENSP00000395280:A217S|.	A|K	-|-	1|3	0|2	TM4SF19|TM4SF19	197535062|197535062	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.010000|0.010000	0.07245|0.07245	-0.287000|-0.287000	0.08388|0.08388	-0.560000|-0.560000	0.06102|0.06102	0.563000|0.563000	0.77884|0.77884	GCA|AAG	TM4SF19	-	NULL	ENSG00000145107		0.483	TM4SF19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TM4SF19	HGNC	protein_coding	OTTHUMT00000341174.1	-	0.00	62	0	C	NM_138461		196050665	-1	tier1	-	no_errors	ENST00000446879	ensembl	human	putative	74_37	missense	35.71	36	20	SNP	0.000	A
TMEM168	64418	genome.wustl.edu	37	7	112424456	112424456	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr7:112424456C>A	ENST00000312814.6	-	2	985	c.425G>T	c.(424-426)aGa>aTa	p.R142I	TMEM168_ENST00000454074.1_Missense_Mutation_p.R142I	NM_022484.4	NP_071929.3	Q9H0V1	TM168_HUMAN	transmembrane protein 168	142						integral component of membrane (GO:0016021)|transport vesicle (GO:0030133)				breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(10)|lung(12)|ovary(1)|prostate(2)|stomach(1)	32						ACCAGAAATTCTCTCCACCAG	0.388																																																	0													81.0	79.0	80.0					7																	112424456		2203	4300	6503	SO:0001583	missense	0				CCDS5757.1	7q31.32	2006-08-08			ENSG00000146802	ENSG00000146802			25826	protein-coding gene	gene with protein product						12477932	Standard	XM_005250527		Approved	DKFZp564C012,FLJ13576	uc003vgn.3	Q9H0V1	OTTHUMG00000155188	ENST00000312814.6:c.425G>T	7.37:g.112424456C>A	ENSP00000323068:p.Arg142Ile		A4D0T9|B4DDS0|Q8NEK4|Q9H8J2	Missense_Mutation	SNP	superfamily_ConA-like_lec_gl_sf	p.R142I	ENST00000312814.6	37	c.425	CCDS5757.1	7	.	.	.	.	.	.	.	.	.	.	C	24.6	4.546875	0.86022	.	.	ENSG00000146802	ENST00000312814;ENST00000454074	.	.	.	6.06	6.06	0.98353	.	0.000000	0.85682	D	0.000000	T	0.79233	0.4411	L	0.61218	1.895	0.80722	D	1	D	0.76494	0.999	D	0.87578	0.998	T	0.78851	-0.2041	9	0.87932	D	0	-26.0427	20.6397	0.99537	0.0:1.0:0.0:0.0	.	142	Q9H0V1	TM168_HUMAN	I	142	.	ENSP00000323068:R142I	R	-	2	0	TMEM168	112211692	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.818000	0.86416	2.880000	0.98712	0.650000	0.86243	AGA	TMEM168	-	NULL	ENSG00000146802		0.388	TMEM168-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM168	HGNC	protein_coding	OTTHUMT00000338696.4		0.00	75	0	C	NM_022484		112424456	-1			no_errors	ENST00000312814	ensembl	human	known	74_37	missense	6.06	31	2	SNP	1.000	A
TMEM200C	645369	genome.wustl.edu	37	18	5890378	5890378	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr18:5890378G>A	ENST00000581347.2	-	3	2330	c.1685C>T	c.(1684-1686)gCt>gTt	p.A562V	TMEM200C_ENST00000383490.2_Missense_Mutation_p.A562V|RP11-945C19.4_ENST00000582939.1_RNA|RP11-945C19.4_ENST00000580845.1_RNA|RP11-945C19.4_ENST00000577694.1_RNA			A6NKL6	T200C_HUMAN	transmembrane protein 200C	562						integral component of membrane (GO:0016021)				autonomic_ganglia(1)|endometrium(1)|large_intestine(4)|lung(5)|stomach(1)	12						GGCGGCCACAGCAGAGTCTCG	0.672																																																	0													24.0	27.0	26.0					18																	5890378		1904	4105	6009	SO:0001583	missense	0				CCDS45825.1	18p11.31	2009-09-08			ENSG00000206432	ENSG00000206432			37208	protein-coding gene	gene with protein product						15722956	Standard	NM_001080209		Approved	TTMA	uc002kmx.1	A6NKL6		ENST00000581347.2:c.1685C>T	18.37:g.5890378G>A	ENSP00000463375:p.Ala562Val			Missense_Mutation	SNP	pfam_DUF2371_TMEM200	p.A562V	ENST00000581347.2	37	c.1685	CCDS45825.1	18	.	.	.	.	.	.	.	.	.	.	-	9.858	1.195498	0.22037	.	.	ENSG00000206432	ENST00000383490	.	.	.	.	.	.	.	.	.	.	.	T	0.15696	0.0378	N	0.08118	0	0.09310	N	1	P	0.42584	0.784	B	0.42959	0.403	T	0.13656	-1.0501	6	0.44086	T	0.13	.	.	.	.	.	562	A6NKL6	T200C_HUMAN	V	562	.	ENSP00000372982:A562V	A	-	2	0	TMEM200C	5880378	0.001000	0.12720	0.002000	0.10522	0.005000	0.04900	0.000000	0.12993	0.000000	0.14550	0.000000	0.15137	GCT	TMEM200C	-	NULL	ENSG00000206432		0.672	TMEM200C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM200C	HGNC	protein_coding	OTTHUMT00000441917.4	-	0.00	57	0	G	NM_001080209		5890378	-1	tier1	-	no_errors	ENST00000383490	ensembl	human	known	74_37	missense	15.38	22	4	SNP	0.001	A
TMEM235	283999	genome.wustl.edu	37	17	76227867	76227868	+	5'Flank	INS	-	-	CTTC			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr17:76227867_76227868insCTTC	ENST00000551068.3	+	0	0				TMEM235_ENST00000586400.1_5'UTR|TMEM235_ENST00000374946.3_5'UTR|TMEM235_ENST00000550981.3_5'Flank|TMEM235_ENST00000421688.1_Frame_Shift_Ins_p.-107fs			A6NFC5	TM235_HUMAN	transmembrane protein 235							endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|tight junction (GO:0005923)	structural molecule activity (GO:0005198)			lung(1)	1						gcggctctcGACTTCCTCTCCT	0.713																																																	0																																										SO:0001631	upstream_gene_variant	0			BC042066	CCDS56048.1, CCDS56046.1, CCDS56047.1	17q25.3	2011-02-18	2011-02-18	2011-02-18	ENSG00000204278	ENSG00000204278			27563	protein-coding gene	gene with protein product							Standard	NM_001204210		Approved		uc002jvk.3	A6NFC5			17.37:g.76227868_76227871dupCTTC	Exception_encountered		C9JRE6	Frame_Shift_Ins	INS	NULL	p.S107fs	ENST00000551068.3	37	c.313_314	CCDS56046.1	17																																																																																			TMEM235	-	NULL	ENSG00000204278		0.713	TMEM235-003	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM235	HGNC	protein_coding	OTTHUMT00000408606.1		0.00	98	0	-	NM_001204211		76227868	+1	tier1		no_errors	ENST00000421688	ensembl	human	known	74_37	frame_shift_ins	27.91	31	12	INS	0.001:0.001	CTTC
TMEM39A	55254	genome.wustl.edu	37	3	119156840	119156840	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr3:119156840G>A	ENST00000319172.5	-	6	1106	c.686C>T	c.(685-687)tCg>tTg	p.S229L	TMEM39A_ENST00000486159.1_5'UTR	NM_018266.1	NP_060736.1	Q9NV64	TM39A_HUMAN	transmembrane protein 39A	229						integral component of membrane (GO:0016021)				NS(1)|breast(1)|endometrium(1)|large_intestine(2)|lung(5)|ovary(2)|skin(1)	13				GBM - Glioblastoma multiforme(114;0.244)		TCCCACAGTCGAGGCACTTTC	0.463																																																	0													72.0	68.0	70.0					3																	119156840		2203	4300	6503	SO:0001583	missense	0			BC021277	CCDS2987.1	3q13.33	2005-01-10			ENSG00000176142	ENSG00000176142			25600	protein-coding gene	gene with protein product						12477932	Standard	NM_018266		Approved	FLJ10902	uc003eck.2	Q9NV64	OTTHUMG00000159361	ENST00000319172.5:c.686C>T	3.37:g.119156840G>A	ENSP00000326063:p.Ser229Leu		D3DN80|Q53FN4|Q53GI1|Q6PKB5	Missense_Mutation	SNP	pfam_Uncharacterised_TMEM39	p.S229L	ENST00000319172.5	37	c.686	CCDS2987.1	3	.	.	.	.	.	.	.	.	.	.	G	13.05	2.120308	0.37436	.	.	ENSG00000176142	ENST00000319172;ENST00000491685	T	0.46063	0.88	5.65	4.72	0.59763	.	0.229185	0.30920	N	0.008620	T	0.23926	0.0579	N	0.08118	0	0.37818	D	0.928286	B	0.06786	0.001	B	0.04013	0.001	T	0.09840	-1.0656	10	0.41790	T	0.15	-8.2176	12.5312	0.56115	0.0:0.0:0.7141:0.2859	.	229	Q9NV64	TM39A_HUMAN	L	229;75	ENSP00000326063:S229L	ENSP00000326063:S229L	S	-	2	0	TMEM39A	120639530	0.998000	0.40836	0.992000	0.48379	0.963000	0.63663	3.182000	0.50910	2.665000	0.90641	0.650000	0.86243	TCG	TMEM39A	-	pfam_Uncharacterised_TMEM39	ENSG00000176142		0.463	TMEM39A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM39A	HGNC	protein_coding	OTTHUMT00000354941.3		0.00	29	0	G	NM_018266		119156840	-1			no_errors	ENST00000319172	ensembl	human	known	74_37	missense	11.11	24	3	SNP	0.956	A
TNFAIP6	7130	genome.wustl.edu	37	2	152226702	152226702	+	Missense_Mutation	SNP	G	G	A	rs375122098		TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr2:152226702G>A	ENST00000243347.3	+	4	638	c.563G>A	c.(562-564)tGc>tAc	p.C188Y	RN7SL124P_ENST00000498656.2_RNA|MIR4773-1_ENST00000585225.1_RNA	NM_007115.3	NP_009046.2	P98066	TSG6_HUMAN	tumor necrosis factor, alpha-induced protein 6	188	CUB. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|inflammatory response (GO:0006954)|signal transduction (GO:0007165)		hyaluronic acid binding (GO:0005540)			endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	13				BRCA - Breast invasive adenocarcinoma(221;0.131)	Hyaluronan(DB08818)	GACCCAGGTTGCTTGGCTGAT	0.418																																																	0													223.0	218.0	220.0					2																	152226702		2203	4300	6503	SO:0001583	missense	0				CCDS2193.1	2q23.3	2008-11-18			ENSG00000123610	ENSG00000123610			11898	protein-coding gene	gene with protein product		600410				1730767, 8568267, 15060082	Standard	NM_007115		Approved	TSG6, TSG-6	uc002txk.3	P98066	OTTHUMG00000131884	ENST00000243347.3:c.563G>A	2.37:g.152226702G>A	ENSP00000243347:p.Cys188Tyr		Q53TI7|Q8WWI9	Missense_Mutation	SNP	pfam_CUB_dom,pfam_Link,superfamily_CUB_dom,superfamily_C-type_lectin_fold,smart_Link,smart_CUB_dom,pfscan_CUB_dom,pfscan_Link,prints_Link	p.C188Y	ENST00000243347.3	37	c.563	CCDS2193.1	2	.	.	.	.	.	.	.	.	.	.	G	24.7	4.565676	0.86439	.	.	ENSG00000123610	ENST00000243347	T	0.31510	1.49	5.49	5.49	0.81192	CUB (5);	0.000000	0.85682	D	0.000000	T	0.73179	0.3554	H	0.98295	4.195	0.80722	D	1	D	0.89917	1.0	D	0.75020	0.985	D	0.84690	0.0722	10	0.87932	D	0	.	19.3531	0.94398	0.0:0.0:1.0:0.0	.	188	P98066	TSG6_HUMAN	Y	188	ENSP00000243347:C188Y	ENSP00000243347:C188Y	C	+	2	0	TNFAIP6	151934948	1.000000	0.71417	0.968000	0.41197	0.991000	0.79684	7.643000	0.83403	2.563000	0.86464	0.555000	0.69702	TGC	TNFAIP6	-	pfam_CUB_dom,superfamily_CUB_dom,smart_CUB_dom,pfscan_CUB_dom	ENSG00000123610		0.418	TNFAIP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNFAIP6	HGNC	protein_coding	OTTHUMT00000254834.2	-	0.00	74	0	G	NM_007115		152226702	+1	tier1	-	no_errors	ENST00000243347	ensembl	human	known	74_37	missense	33.93	37	19	SNP	1.000	A
TNRC18	84629	genome.wustl.edu	37	7	5430248	5430248	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr7:5430248G>T	ENST00000430969.1	-	4	703	c.355C>A	c.(355-357)Ctg>Atg	p.L119M	TNRC18_ENST00000399537.4_Missense_Mutation_p.L119M|TNRC18_ENST00000399434.2_Missense_Mutation_p.L45M	NM_001080495.2	NP_001073964.2	O15417	TNC18_HUMAN	trinucleotide repeat containing 18	119							chromatin binding (GO:0003682)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(8)	11		Ovarian(82;0.142)		UCEC - Uterine corpus endometrioid carcinoma (126;0.195)|OV - Ovarian serous cystadenocarcinoma(56;5.32e-15)		CCACTGGGCAGGTGGGAGAAG	0.577																																																	0													13.0	17.0	16.0					7																	5430248		1846	4094	5940	SO:0001583	missense	0			U80753	CCDS47534.1	7p22.1	2012-04-17			ENSG00000182095	ENSG00000182095		"""Trinucleotide (CAG) repeat containing"""	11962	protein-coding gene	gene with protein product						9225980	Standard	NM_001080495		Approved	CAGL79, TNRC18A, KIAA1856	uc003soi.4	O15417	OTTHUMG00000151831	ENST00000430969.1:c.355C>A	7.37:g.5430248G>T	ENSP00000395538:p.Leu119Met		A8MX41|Q96JH1|Q96K91	Missense_Mutation	SNP	pfam_BAH_dom,smart_BAH_dom,pfscan_BAH_dom	p.L119M	ENST00000430969.1	37	c.355	CCDS47534.1	7	.	.	.	.	.	.	.	.	.	.	G	12.50	1.955774	0.34471	.	.	ENSG00000182095	ENST00000399537;ENST00000430969;ENST00000434361;ENST00000399434	T;T	0.19669	2.13;2.13	4.34	3.42	0.39159	.	.	.	.	.	T	0.15825	0.0381	L	0.34521	1.04	0.31542	N	0.659768	P;P	0.46912	0.886;0.459	B;B	0.37888	0.26;0.094	T	0.08229	-1.0732	9	0.59425	D	0.04	.	11.6402	0.51228	0.0:0.0:0.8056:0.1944	.	45;119	A8MTZ4;O15417	.;TNC18_HUMAN	M	119;119;45;45	ENSP00000382452:L119M;ENSP00000395538:L119M	ENSP00000382364:L45M	L	-	1	2	TNRC18	5396774	1.000000	0.71417	1.000000	0.80357	0.700000	0.40528	2.335000	0.43929	0.874000	0.35823	0.491000	0.48974	CTG	TNRC18	-	NULL	ENSG00000182095		0.577	TNRC18-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TNRC18	HGNC	protein_coding			0.00	152	0	G			5430248	-1			no_errors	ENST00000399537	ensembl	human	known	74_37	missense	5.19	73	4	SNP	1.000	T
TP53	7157	genome.wustl.edu	37	17	7577124	7577124	+	Missense_Mutation	SNP	C	C	T	rs121912657		TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr17:7577124C>T	ENST00000269305.4	-	8	1003	c.814G>A	c.(814-816)Gtg>Atg	p.V272M	TP53_ENST00000574684.1_5'Flank|TP53_ENST00000413465.2_Intron|TP53_ENST00000455263.2_Missense_Mutation_p.V272M|TP53_ENST00000359597.4_Missense_Mutation_p.V272M|TP53_ENST00000420246.2_Missense_Mutation_p.V272M|TP53_ENST00000445888.2_Missense_Mutation_p.V272M	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	272	Interaction with AXIN1. {ECO:0000250}.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		V -> A (in a familial cancer not matching LFS; germline mutation and in sporadic cancers; somatic mutation).|V -> E (in sporadic cancers; somatic mutation).|V -> G (in sporadic cancers; somatic mutation).|V -> L (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:1737852}.|V -> M (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.V272M(82)|p.V272L(26)|p.0?(8)|p.V272fs*73(4)|p.?(2)|p.F270fs*72(1)|p.E271fs*73(1)|p.V272fs*34(1)|p.L265_K305del41(1)|p.S269fs*21(1)|p.E258fs*71(1)|p.G266_E271delGRNSFE(1)|p.V272fs*74(1)|p.F270_D281del12(1)|p.E271_R273delEVR(1)|p.V272_K292del21(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CAAACACGCACCTCAAAGCTG	0.527		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	133	Substitution - Missense(108)|Whole gene deletion(8)|Deletion - Frameshift(8)|Deletion - In frame(5)|Insertion - Frameshift(2)|Unknown(2)	large_intestine(23)|ovary(16)|lung(14)|breast(14)|oesophagus(11)|upper_aerodigestive_tract(9)|haematopoietic_and_lymphoid_tissue(9)|central_nervous_system(7)|bone(5)|stomach(4)|pancreas(4)|liver(4)|kidney(3)|urinary_tract(3)|endometrium(2)|thyroid(1)|vulva(1)|soft_tissue(1)|testis(1)|skin(1)	GRCh37	CM920676	TP53	M	rs121912657						62.0	54.0	57.0					17																	7577124		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.814G>A	17.37:g.7577124C>T	ENSP00000269305:p.Val272Met		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.V272M	ENST00000269305.4	37	c.814	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	22.7	4.318455	0.81469	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D	0.99833	-7.03;-7.03;-7.03;-7.03;-7.03;-7.03	5.13	5.13	0.70059	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.057604	0.64402	D	0.000002	D	0.99843	0.9928	M	0.90309	3.105	0.58432	D	0.999996	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.87578	0.998;0.998;0.998;0.998	D	0.96721	0.9532	10	0.87932	D	0	-27.8222	16.1198	0.81342	0.0:1.0:0.0:0.0	.	272;272;272;272	P04637-2;P04637-3;P04637;Q1MSW8	.;.;P53_HUMAN;.	M	272;272;272;272;272;261;140	ENSP00000352610:V272M;ENSP00000269305:V272M;ENSP00000398846:V272M;ENSP00000391127:V272M;ENSP00000391478:V272M;ENSP00000425104:V140M	ENSP00000269305:V272M	V	-	1	0	TP53	7517849	1.000000	0.71417	0.986000	0.45419	0.849000	0.48306	5.871000	0.69628	2.667000	0.90743	0.462000	0.41574	GTG	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor	ENSG00000141510		0.527	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	-	0.00	41	0	C	NM_000546		7577124	-1	tier1	-	no_errors	ENST00000269305	ensembl	human	known	74_37	missense	33.33	20	10	SNP	1.000	T
TP53	7157	genome.wustl.edu	37	17	7578410	7578410	+	Missense_Mutation	SNP	T	T	A			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr17:7578410T>A	ENST00000269305.4	-	5	709	c.520A>T	c.(520-522)Agg>Tgg	p.R174W	TP53_ENST00000574684.1_5'UTR|TP53_ENST00000413465.2_Missense_Mutation_p.R174W|TP53_ENST00000455263.2_Missense_Mutation_p.R174W|TP53_ENST00000359597.4_Missense_Mutation_p.R174W|TP53_ENST00000420246.2_Missense_Mutation_p.R174W|TP53_ENST00000445888.2_Missense_Mutation_p.R174W	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	174	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		R -> G (in LFS; germline mutation and in a sporadic cancer; somatic mutation).|R -> K (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:7682763}.|R -> M (in sporadic cancers; somatic mutation).|R -> S (in sporadic cancers; somatic mutation).|R -> T (in a sporadic cancer; somatic mutation).|R -> W (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R174W(12)|p.0?(8)|p.V173fs*59(2)|p.R174fs*1(2)|p.V157_C176del20(1)|p.V172_R174delVVR(1)|p.V173fs*69(1)|p.E171fs*61(1)|p.V173fs*23(1)|p.V172_E180delVVRRCPHHE(1)|p.R174_H179delRRCPHH(1)|p.E171fs*1(1)|p.R81W(1)|p.R174_C176delRRC(1)|p.H168fs*69(1)|p.R174fs*73(1)|p.R174fs*70(1)|p.R174G(1)|p.R42W(1)|p.E171_H179delEVVRRCPHH(1)|p.S149fs*72(1)|p.R174fs*3(1)|p.R174fs*7(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GGGCAGCGCCTCACAACCTCC	0.657		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	43	Substitution - Missense(15)|Deletion - Frameshift(13)|Whole gene deletion(8)|Deletion - In frame(6)|Insertion - Frameshift(1)	liver(11)|breast(7)|lung(4)|oesophagus(4)|bone(4)|large_intestine(3)|stomach(2)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|upper_aerodigestive_tract(1)|urinary_tract(1)|ovary(1)|prostate(1)	GRCh37	CM942119	TP53	M							50.0	50.0	50.0					17																	7578410		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.520A>T	17.37:g.7578410T>A	ENSP00000269305:p.Arg174Trp		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.R174W	ENST00000269305.4	37	c.520	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	T	19.94	3.919495	0.73098	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99820	-6.93;-6.93;-6.93;-6.93;-6.93;-6.93;-6.93;-6.93	5.59	1.97	0.26223	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.297542	0.32190	N	0.006445	D	0.99764	0.9904	M	0.84585	2.705	0.39545	D	0.968872	D;D;D;D;D;D;D	0.89917	1.0;0.996;0.998;1.0;0.997;0.997;1.0	D;D;D;D;D;D;D	0.91635	0.998;0.978;0.977;0.999;0.997;0.987;0.998	D	0.98344	1.0540	10	0.87932	D	0	-14.7463	12.0783	0.53657	0.0:0.0:0.417:0.583	.	135;174;174;81;174;174;174	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	W	174;174;174;174;174;174;163;81;42;81;42	ENSP00000410739:R174W;ENSP00000352610:R174W;ENSP00000269305:R174W;ENSP00000398846:R174W;ENSP00000391127:R174W;ENSP00000391478:R174W;ENSP00000425104:R42W;ENSP00000423862:R81W	ENSP00000269305:R174W	R	-	1	2	TP53	7519135	0.002000	0.14202	0.176000	0.23000	0.618000	0.37518	1.330000	0.33781	0.094000	0.17404	0.533000	0.62120	AGG	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor	ENSG00000141510		0.657	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	-	0.00	58	0	T	NM_000546		7578410	-1	tier1	-	no_errors	ENST00000269305	ensembl	human	known	74_37	missense	37.50	15	9	SNP	0.986	A
TP63	8626	genome.wustl.edu	37	3	189585728	189585728	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr3:189585728G>A	ENST00000264731.3	+	7	1078	c.989G>A	c.(988-990)aGa>aAa	p.R330K	TP63_ENST00000418709.2_Missense_Mutation_p.R330K|TP63_ENST00000437221.1_Missense_Mutation_p.R236K|TP63_ENST00000456148.1_Missense_Mutation_p.R236K|TP63_ENST00000320472.5_Missense_Mutation_p.R330K|TP63_ENST00000392463.2_Missense_Mutation_p.R236K|TP63_ENST00000354600.5_Missense_Mutation_p.R236K|TP63_ENST00000449992.1_Missense_Mutation_p.R151K|TP63_ENST00000382063.4_Missense_Mutation_p.R245K|TP63_ENST00000440651.2_Missense_Mutation_p.R330K|TP63_ENST00000392460.3_Missense_Mutation_p.R330K|TP63_ENST00000392461.3_Missense_Mutation_p.R236K	NM_001114978.1|NM_003722.4	NP_001108450.1|NP_003713.3	Q9H3D4	P63_HUMAN	tumor protein p63	330					apoptotic process (GO:0006915)|cell aging (GO:0007569)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|chromatin remodeling (GO:0006338)|cloacal septation (GO:0060197)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|ectoderm and mesoderm interaction (GO:0007499)|embryonic limb morphogenesis (GO:0030326)|epidermal cell division (GO:0010481)|epithelial cell development (GO:0002064)|establishment of planar polarity (GO:0001736)|establishment of skin barrier (GO:0061436)|female genitalia morphogenesis (GO:0048807)|hair follicle morphogenesis (GO:0031069)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|keratinocyte differentiation (GO:0030216)|keratinocyte proliferation (GO:0043616)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organismal aging (GO:0010259)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular senescence (GO:2000773)|negative regulation of keratinocyte differentiation (GO:0045617)|negative regulation of mesoderm development (GO:2000381)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|odontogenesis of dentin-containing tooth (GO:0042475)|polarized epithelial cell differentiation (GO:0030859)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell cycle G1/S phase transition (GO:1902808)|positive regulation of fibroblast apoptotic process (GO:2000271)|positive regulation of keratinocyte proliferation (GO:0010838)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|post-anal tail morphogenesis (GO:0036342)|prostatic bud formation (GO:0060513)|protein homotetramerization (GO:0051289)|proximal/distal pattern formation (GO:0009954)|regulation of epidermal cell division (GO:0010482)|regulation of neuron apoptotic process (GO:0043523)|response to gamma radiation (GO:0010332)|response to X-ray (GO:0010165)|skeletal system development (GO:0001501)|smooth muscle tissue development (GO:0048745)|squamous basal epithelial stem cell differentiation involved in prostate gland acinus development (GO:0060529)|sympathetic nervous system development (GO:0048485)|urinary bladder development (GO:0060157)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|p53 binding (GO:0002039)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding transcription factor activity (GO:0000989)|transcription regulatory region DNA binding (GO:0044212)|WW domain binding (GO:0050699)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(7)|kidney(5)|large_intestine(12)|lung(15)|ovary(2)|skin(9)|upper_aerodigestive_tract(6)	61	all_cancers(143;3.35e-10)|Ovarian(172;0.0925)		Lung(62;3.33e-05)	GBM - Glioblastoma multiforme(93;0.0227)		CTGGAAACCAGAGAGTAAGTG	0.398										HNSCC(45;0.13)																																							0													75.0	68.0	70.0					3																	189585728		2203	4300	6503	SO:0001583	missense	0			AB010153	CCDS3293.1, CCDS46976.1, CCDS46977.1, CCDS46978.1, CCDS46979.1, CCDS46980.1	3q27-q29	2014-09-17			ENSG00000073282	ENSG00000073282			15979	protein-coding gene	gene with protein product		603273	"""tumor protein p73-like"", ""tumor protein p53-like"", ""tumor protein p53-competing protein"""	TP73L, TP53L, TP53CP		9774969, 9662378, 11181441, 11181451	Standard	NM_003722		Approved	p51, SHFM4, EEC3, p63, p73L, OFC8, KET, p73H, NBP, p53CP	uc003fry.2	Q9H3D4	OTTHUMG00000156313	ENST00000264731.3:c.989G>A	3.37:g.189585728G>A	ENSP00000264731:p.Arg330Lys		O75080|O75195|O75922|O76078|Q6VEG2|Q6VEG3|Q6VEG4|Q6VFJ1|Q6VFJ2|Q6VFJ3|Q6VH20|Q7LDI3|Q7LDI4|Q7LDI5|Q96KR0|Q9H3D2|Q9H3D3|Q9H3P8|Q9NPH7|Q9P1B4|Q9P1B5|Q9P1B6|Q9P1B7|Q9UBV9|Q9UE10|Q9UP26|Q9UP27|Q9UP28|Q9UP74	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_SAM_2,superfamily_p53-like_TF_DNA-bd,superfamily_SAM/pointed,superfamily_p53_tetrameristn,smart_SAM,prints_p53_tumour_suppressor	p.R330K	ENST00000264731.3	37	c.989	CCDS3293.1	3	.	.	.	.	.	.	.	.	.	.	G	19.42	3.824797	0.71143	.	.	ENSG00000073282	ENST00000264731;ENST00000418709;ENST00000320472;ENST00000392460;ENST00000440651;ENST00000382063;ENST00000354600;ENST00000437221;ENST00000392463;ENST00000392461;ENST00000449992;ENST00000456148	D;D;D;D;D;D;D;D;D;D;D;D	0.99732	-6.56;-6.56;-6.56;-6.56;-6.56;-6.56;-6.56;-6.56;-6.56;-6.56;-6.57;-6.56	5.61	5.61	0.85477	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99118	0.9696	N	0.11724	0.165	0.80722	D	1	B;P;P;P;P;P;P;B;P;P	0.52842	0.099;0.946;0.946;0.946;0.946;0.946;0.956;0.099;0.956;0.946	B;D;D;P;D;P;P;B;D;D	0.67103	0.367;0.914;0.914;0.895;0.914;0.848;0.906;0.367;0.949;0.914	D	0.99744	1.1016	9	.	.	.	-11.7963	18.6204	0.91319	0.0:0.0:1.0:0.0	.	151;330;330;236;236;236;236;330;330;330	Q9H3D4-10;Q9H3D4-7;Q9H3D4-11;Q9H3D4-4;Q9H3D4-2;Q9H3D4-6;C9D7C9;Q9H3D4-3;Q9H3D4;Q9H3D4-5	.;.;.;.;.;.;.;.;P63_HUMAN;.	K	330;330;330;330;330;245;236;236;236;236;151;236	ENSP00000264731:R330K;ENSP00000407144:R330K;ENSP00000317510:R330K;ENSP00000376253:R330K;ENSP00000394337:R330K;ENSP00000371495:R245K;ENSP00000346614:R236K;ENSP00000392488:R236K;ENSP00000376256:R236K;ENSP00000376254:R236K;ENSP00000387839:R151K;ENSP00000389485:R236K	.	R	+	2	0	TP63	191068422	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.869000	0.99810	2.652000	0.90054	0.655000	0.94253	AGA	TP63	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd	ENSG00000073282		0.398	TP63-001	KNOWN	basic|CCDS	protein_coding	TP63	HGNC	protein_coding	OTTHUMT00000343865.1	-	0.00	96	0	G	NM_003722		189585728	+1	tier1	-	no_errors	ENST00000264731	ensembl	human	known	74_37	missense	16.18	56	11	SNP	1.000	A
TPTE	7179	genome.wustl.edu	37	21	10998232	10998232	+	5'UTR	SNP	C	C	G			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr21:10998232C>G	ENST00000415664.2	-	0	1320							P56180	TPTE_HUMAN	transmembrane phosphatase with tensin homology						peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	ion channel activity (GO:0005216)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(19)|lung(76)|ovary(2)|prostate(2)|skin(8)|urinary_tract(1)	130			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		TCCTTTTTCTCTTTTTGACAC	0.378																																																	0																																										SO:0001623	5_prime_UTR_variant	0			AF007118	CCDS74771.1, CCDS74772.1, CCDS74773.1	21p11	2011-06-09			ENSG00000166157	ENSG00000274391		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	12023	protein-coding gene	gene with protein product	"""PTEN-related tyrosine phosphatase"", ""cancer/testis antigen 44"""	604336				10830953, 14659893	Standard	NM_001290224		Approved	PTEN2, CT44	uc002yip.1	P56180	OTTHUMG00000074127	ENST00000415664.2:c.-2016G>C	21.37:g.10998232C>G			B2RAP7|C9J6D6|C9JKK8|Q6XPS4|Q6XPS5|Q71JA8|Q8NCS8	RNA	SNP	-	NULL	ENST00000415664.2	37	NULL		21																																																																																			TPTE	-	-	ENSG00000166157		0.378	TPTE-006	KNOWN	basic	processed_transcript	TPTE	HGNC	protein_coding	OTTHUMT00000340030.1	-	0.00	215	0	C			10998232	-1	tier1	-	no_errors	ENST00000415664	ensembl	human	known	74_37	rna	8.33	121	11	SNP	1.000	G
TRAF5	7188	genome.wustl.edu	37	1	211526731	211526731	+	Silent	SNP	G	G	A			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr1:211526731G>A	ENST00000261464.5	+	2	204	c.150G>A	c.(148-150)tcG>tcA	p.S50S	TRAF5_ENST00000336184.2_Silent_p.S50S|TRAF5_ENST00000367004.3_Silent_p.S50S|TRAF5_ENST00000462410.1_3'UTR|TRAF5_ENST00000427925.2_Silent_p.S50S	NM_001033910.2	NP_001029082.1	O00463	TRAF5_HUMAN	TNF receptor-associated factor 5	50					apoptotic process (GO:0006915)|positive regulation of cell proliferation (GO:0008284)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)	CD40 receptor complex (GO:0035631)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)	signal transducer activity (GO:0004871)|thioesterase binding (GO:0031996)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.S50S(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(8)|lung(6)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29				OV - Ovarian serous cystadenocarcinoma(81;0.00946)|all cancers(67;0.0808)|Epithelial(68;0.144)		TCTGCCACTCGGTGCTTCACA	0.567																																																	1	Substitution - coding silent(1)	lung(1)											81.0	67.0	72.0					1																	211526731		2203	4300	6503	SO:0001819	synonymous_variant	0			AB000509	CCDS1497.1	1q32	2008-02-05			ENSG00000082512	ENSG00000082512		"""RING-type (C3HC4) zinc fingers"""	12035	protein-coding gene	gene with protein product		602356				9126477	Standard	NM_001033910		Approved	RNF84	uc001hii.3	O00463	OTTHUMG00000036997	ENST00000261464.5:c.150G>A	1.37:g.211526731G>A			B4DIS9|B4E0A2|Q6FHY1	Silent	SNP	pfam_MATH,superfamily_TRAF-like,smart_Znf_RING,smart_MATH,pirsf_TNF_rcpt--assoc_TRAF,pfscan_MATH,pfscan_Znf_RING,pfscan_Znf_TRAF	p.S50	ENST00000261464.5	37	c.150	CCDS1497.1	1																																																																																			TRAF5	-	smart_Znf_RING,pirsf_TNF_rcpt--assoc_TRAF,pfscan_Znf_RING	ENSG00000082512		0.567	TRAF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRAF5	HGNC	protein_coding	OTTHUMT00000089825.1		0.00	22	0	G	NM_004619		211526731	+1			no_errors	ENST00000261464	ensembl	human	known	74_37	silent	8.00	23	2	SNP	0.001	A
TRAPPC11	60684	genome.wustl.edu	37	4	184601286	184601286	+	Nonsense_Mutation	SNP	G	G	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr4:184601286G>T	ENST00000334690.6	+	10	1181	c.979G>T	c.(979-981)Gga>Tga	p.G327*	TRAPPC11_ENST00000357207.4_Nonsense_Mutation_p.G327*	NM_021942.5	NP_068761.4	Q7Z392	TPC11_HUMAN	trafficking protein particle complex 11	327					vesicle-mediated transport (GO:0016192)	Golgi apparatus (GO:0005794)											CCAGGCCTTTGGAGATTTATT	0.368																																																	0													68.0	70.0	70.0					4																	184601286		2202	4300	6502	SO:0001587	stop_gained	0				CCDS34112.1, CCDS47166.1	4q35.1	2011-12-12	2011-12-12	2011-12-12	ENSG00000168538	ENSG00000168538		"""Trafficking protein particle complex"""	25751	protein-coding gene	gene with protein product	"""gryzun homolog (Drosophila)"", ""foie gras homolog (zebrafish)"""	614138	"""chromosome 4 open reading frame 41"""	C4orf41		19942856, 21525244	Standard	NM_021942		Approved	FLJ12716, gry, foigr	uc003ivx.3	Q7Z392	OTTHUMG00000160673	ENST00000334690.6:c.979G>T	4.37:g.184601286G>T	ENSP00000335371:p.Gly327*		A4QPB8|B2RCD6|Q5U5I7|Q6FI73|Q86T25|Q9H0L1|Q9H5K9|Q9H8Q1|Q9H9I7	Nonsense_Mutation	SNP	pfam_Foie-gras_1,pfam_DUF1683_C	p.G327*	ENST00000334690.6	37	c.979	CCDS34112.1	4	.	.	.	.	.	.	.	.	.	.	G	41	8.692337	0.98916	.	.	ENSG00000168538	ENST00000334690;ENST00000357207;ENST00000360109	.	.	.	5.96	5.96	0.96718	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	20.4192	0.99033	0.0:0.0:1.0:0.0	.	.	.	.	X	327	.	ENSP00000335371:G327X	G	+	1	0	C4orf41	184838280	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.864000	0.99589	2.831000	0.97527	0.650000	0.86243	GGA	TRAPPC11	-	pfam_Foie-gras_1	ENSG00000168538		0.368	TRAPPC11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRAPPC11	HGNC	protein_coding	OTTHUMT00000361654.2	-	0.00	53	0	G	NM_021942		184601286	+1	tier1	-	no_errors	ENST00000334690	ensembl	human	known	74_37	nonsense	9.38	29	3	SNP	1.000	T
TRHDE	29953	genome.wustl.edu	37	12	72771779	72771779	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr12:72771779G>T	ENST00000261180.4	+	3	1154	c.1058G>T	c.(1057-1059)cGa>cTa	p.R353L		NM_013381.2	NP_037513.1	Q9UKU6	TRHDE_HUMAN	thyrotropin-releasing hormone degrading enzyme	353					cell-cell signaling (GO:0007267)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.R353Q(1)		NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(8)|kidney(3)|large_intestine(13)|lung(38)|ovary(2)|skin(4)|soft_tissue(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	79						aattaGGTACGATTATATGCA	0.313																																																	1	Substitution - Missense(1)	large_intestine(1)											33.0	35.0	34.0					12																	72771779		2203	4293	6496	SO:0001583	missense	0			AF126372	CCDS9004.1	12q15-q21	2012-07-25		2005-08-09		ENSG00000072657	3.4.19.6		30748	protein-coding gene	gene with protein product	"""pyroglutamyl-peptidase II"", ""pyroglutamyl aminopeptidase II"", ""TRH-specific aminopeptidase"""	606950				10491199, 12975309	Standard	NM_013381		Approved	PGPEP2, TRH-DE, PAP-II	uc001sxa.3	Q9UKU6		ENST00000261180.4:c.1058G>T	12.37:g.72771779G>T	ENSP00000261180:p.Arg353Leu		A5PL19|Q6UWJ4	Missense_Mutation	SNP	pfam_Peptidase_M1_N,prints_Peptidase_M1_N	p.R353L	ENST00000261180.4	37	c.1058	CCDS9004.1	12	.	.	.	.	.	.	.	.	.	.	G	24.1	4.489594	0.84962	.	.	ENSG00000072657	ENST00000261180	T	0.03272	3.99	5.57	5.57	0.84162	Peptidase M1, membrane alanine aminopeptidase, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.23766	0.0575	M	0.86651	2.83	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	T	0.00804	-1.1559	10	0.51188	T	0.08	.	19.5437	0.95283	0.0:0.0:1.0:0.0	.	353	Q9UKU6	TRHDE_HUMAN	L	353	ENSP00000261180:R353L	ENSP00000261180:R353L	R	+	2	0	TRHDE	71058046	1.000000	0.71417	0.983000	0.44433	0.988000	0.76386	9.235000	0.95353	2.645000	0.89757	0.585000	0.79938	CGA	TRHDE	-	pfam_Peptidase_M1_N	ENSG00000072657		0.313	TRHDE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRHDE	HGNC	protein_coding	OTTHUMT00000405380.1		0.00	107	0	G	NM_013381		72771779	+1			no_errors	ENST00000261180	ensembl	human	known	74_37	missense	6.12	46	3	SNP	1.000	T
TSHZ2	128553	genome.wustl.edu	37	20	51871834	51871834	+	Nonsense_Mutation	SNP	G	G	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr20:51871834G>T	ENST00000371497.5	+	2	2724	c.1837G>T	c.(1837-1839)Gag>Tag	p.E613*	TSHZ2_ENST00000603338.2_Nonsense_Mutation_p.E610*|RP4-678D15.1_ENST00000606932.1_RNA|TSHZ2_ENST00000329613.6_Nonsense_Mutation_p.E610*	NM_001193421.1|NM_173485.5	NP_001180350.1|NP_775756.3	Q9NRE2	TSH2_HUMAN	teashirt zinc finger homeobox 2	613					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(16)|lung(38)|ovary(5)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	84			STAD - Stomach adenocarcinoma(23;0.1)			AGCGGTGAAGGAGTGTGGGAA	0.493																																																	0													89.0	90.0	90.0					20																	51871834		2203	4300	6503	SO:0001587	stop_gained	0			AF230201	CCDS33490.1, CCDS54474.1	20q13.2	2013-11-20	2007-07-16	2006-03-14	ENSG00000182463	ENSG00000182463		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	13010	protein-coding gene	gene with protein product		614118	"""chromosome 20 open reading frame 17"", ""zinc finger protein 218"", ""teashirt family zinc finger 2"""	C20orf17, ZNF218		9671742	Standard	NM_173485		Approved	ZABC2, OVC10-2, TSH2	uc021wex.1	Q9NRE2	OTTHUMG00000033058	ENST00000371497.5:c.1837G>T	20.37:g.51871834G>T	ENSP00000360552:p.Glu613*		B7Z7W1|J3KNQ0|Q4VXM4|Q6N003|Q8N260	Nonsense_Mutation	SNP	superfamily_Homeodomain-like,smart_Znf_C2H2-like,smart_Homeobox_dom,pfscan_Znf_C2H2	p.E613*	ENST00000371497.5	37	c.1837	CCDS33490.1	20	.	.	.	.	.	.	.	.	.	.	G	42	9.442975	0.99172	.	.	ENSG00000182463	ENST00000371497;ENST00000329613;ENST00000450262	.	.	.	5.44	3.43	0.39272	.	0.260506	0.39341	N	0.001392	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.13470	T	0.59	0.4583	9.1113	0.36730	0.0779:0.1473:0.7748:0.0	.	.	.	.	X	613;610;139	.	ENSP00000333114:E610X	E	+	1	0	TSHZ2	51305241	1.000000	0.71417	0.863000	0.33907	0.201000	0.24016	5.052000	0.64263	0.621000	0.30232	0.643000	0.83706	GAG	TSHZ2	-	NULL	ENSG00000182463		0.493	TSHZ2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSHZ2	HGNC	protein_coding	OTTHUMT00000080398.6		0.00	56	0	G	NM_173485		51871834	+1			no_errors	ENST00000371497	ensembl	human	known	74_37	nonsense	6.25	30	2	SNP	1.000	T
TTC24	164118	genome.wustl.edu	37	1	156551436	156551436	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr1:156551436G>T	ENST00000368237.3	+	1	280	c.280G>T	c.(280-282)Gac>Tac	p.D94Y	TTC24_ENST00000368236.3_Missense_Mutation_p.D94Y			A2A3L6	TTC24_HUMAN	tetratricopeptide repeat domain 24	94										breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(10)|pancreas(1)|prostate(1)	20	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					GGAGACTGGGGACCCAGCCAG	0.627																																																	0													33.0	40.0	38.0					1																	156551436		692	1591	2283	SO:0001583	missense	0				CCDS53379.1	1q22	2013-01-10			ENSG00000187862	ENSG00000187862		"""Tetratricopeptide (TTC) repeat domain containing"""	32348	protein-coding gene	gene with protein product							Standard	NM_001105669		Approved		uc021pbf.1	A2A3L6	OTTHUMG00000033202	ENST00000368237.3:c.280G>T	1.37:g.156551436G>T	ENSP00000357220:p.Asp94Tyr		Q5T3H7	Missense_Mutation	SNP	pfam_TPR_1,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.D94Y	ENST00000368237.3	37	c.280	CCDS53379.1	1	.	.	.	.	.	.	.	.	.	.	G	16.57	3.158907	0.57368	.	.	ENSG00000187862	ENST00000368236;ENST00000368237	T;T	0.78126	-1.15;-1.15	4.54	2.61	0.31194	.	0.159787	0.29501	N	0.011962	T	0.56659	0.2000	L	0.32530	0.975	0.31466	N	0.668966	.	.	.	.	.	.	T	0.56854	-0.7910	8	0.87932	D	0	-26.0945	6.3089	0.21154	0.3686:0.0:0.6314:0.0	.	.	.	.	Y	94	ENSP00000357219:D94Y;ENSP00000357220:D94Y	ENSP00000357219:D94Y	D	+	1	0	TTC24	154818060	0.997000	0.39634	1.000000	0.80357	0.852000	0.48524	0.931000	0.28871	1.130000	0.42092	0.462000	0.41574	GAC	TTC24	-	pfscan_TPR-contain_dom	ENSG00000187862		0.627	TTC24-006	NOVEL	basic|appris_principal|CCDS	protein_coding	TTC24	HGNC	protein_coding	OTTHUMT00000158547.1	-	0.00	73	0	G	XM_089384		156551436	+1	tier1	-	no_errors	ENST00000368236	ensembl	human	known	74_37	missense	12.50	28	4	SNP	0.999	T
TTC38	55020	genome.wustl.edu	37	22	46671246	46671246	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr22:46671246G>T	ENST00000381031.3	+	5	543	c.467G>T	c.(466-468)gGc>gTc	p.G156V	TTC38_ENST00000445282.2_Intron	NM_017931.2	NP_060401	Q5R3I4	TTC38_HUMAN	tetratricopeptide repeat domain 38	156						extracellular vesicular exosome (GO:0070062)				endometrium(4)|large_intestine(3)|lung(4)|ovary(1)	12						TTTTACCTGGGCTATCAGGAA	0.463																																																	0													115.0	112.0	113.0					22																	46671246		1867	4109	5976	SO:0001583	missense	0				CCDS43030.1	22q13	2013-01-11			ENSG00000075234	ENSG00000075234		"""Tetratricopeptide (TTC) repeat domain containing"""	26082	protein-coding gene	gene with protein product							Standard	NM_017931		Approved	FLJ20699	uc003bhi.3	Q5R3I4	OTTHUMG00000150494	ENST00000381031.3:c.467G>T	22.37:g.46671246G>T	ENSP00000370419:p.Gly156Val		Q8WV27|Q9NWP8	Missense_Mutation	SNP	NULL	p.G156V	ENST00000381031.3	37	c.467	CCDS43030.1	22	.	.	.	.	.	.	.	.	.	.	G	24.0	4.483141	0.84747	.	.	ENSG00000075234	ENST00000381031;ENST00000421359	T;T	0.69040	1.11;-0.37	5.7	5.7	0.88788	Tetratricopeptide-like helical (1);	0.000000	0.85682	D	0.000000	D	0.84279	0.5437	M	0.86028	2.79	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.85218	0.1025	9	.	.	.	-18.6356	18.8363	0.92164	0.0:0.0:1.0:0.0	.	156	Q5R3I4	TTC38_HUMAN	V	156	ENSP00000370419:G156V;ENSP00000410095:G156V	.	G	+	2	0	TTC38	45049910	1.000000	0.71417	1.000000	0.80357	0.760000	0.43138	9.189000	0.94928	2.705000	0.92388	0.650000	0.86243	GGC	TTC38	-	NULL	ENSG00000075234		0.463	TTC38-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	TTC38	HGNC	protein_coding	OTTHUMT00000318469.1		0.00	79	0	G	NM_017931		46671246	+1			no_errors	ENST00000381031	ensembl	human	novel	74_37	missense	5.80	65	4	SNP	1.000	T
TUBB1	81027	genome.wustl.edu	37	20	57598917	57598917	+	Silent	SNP	C	C	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr20:57598917C>T	ENST00000217133.1	+	4	704	c.435C>T	c.(433-435)tcC>tcT	p.S145S		NM_030773.3	NP_110400.1	Q9H4B7	TBB1_HUMAN	tubulin, beta 1 class VI	145					'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|protein folding (GO:0006457)|protein polymerization (GO:0051258)|spindle assembly (GO:0051225)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|prostate(2)|skin(2)	16	all_lung(29;0.00711)		Colorectal(105;0.109)		Cabazitaxel(DB06772)|Colchicine(DB01394)|Docetaxel(DB01248)|Paclitaxel(DB01229)|Vindesine(DB00309)	GCACAGGCTCCGGGATGGGCA	0.582																																																	0													87.0	97.0	94.0					20																	57598917		2203	4300	6503	SO:0001819	synonymous_variant	0			AJ292757	CCDS13475.1	20q13.32	2014-09-17	2011-10-10		ENSG00000101162	ENSG00000101162		"""Tubulins"""	16257	protein-coding gene	gene with protein product	"""class VI beta-tubulin"""	612901	"""tubulin, beta 1"""				Standard	NM_030773		Approved	dJ543J19.4	uc002yak.3	Q9H4B7	OTTHUMG00000032860	ENST00000217133.1:c.435C>T	20.37:g.57598917C>T				Silent	SNP	pfam_Tubulin_FtsZ_GTPase,pfam_Tubulin/FtsZ_2-layer-sand-dom,pfam_Misato_II_tubulin-like,superfamily_Tubulin_FtsZ_GTPase,superfamily_Tub_FtsZ_C,smart_Tubulin_FtsZ_GTPase,smart_Tubulin/FtsZ_2-layer-sand-dom,prints_Beta_tubulin,prints_Tubulin,prints_Epsilon_tubulin,prints_Delta_tubulin,prints_Gamma_tubulin,prints_Alpha_tubulin	p.S145	ENST00000217133.1	37	c.435	CCDS13475.1	20																																																																																			TUBB1	-	pfam_Tubulin_FtsZ_GTPase,superfamily_Tubulin_FtsZ_GTPase,smart_Tubulin_FtsZ_GTPase,prints_Tubulin	ENSG00000101162		0.582	TUBB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TUBB1	HGNC	protein_coding	OTTHUMT00000079903.1	-	0.00	55	0	C	NM_030773		57598917	+1	tier1	-	no_errors	ENST00000217133	ensembl	human	known	74_37	silent	18.00	41	9	SNP	0.000	T
UBE2O	63893	genome.wustl.edu	37	17	74395935	74395935	+	Missense_Mutation	SNP	C	C	A	rs149178826		TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr17:74395935C>A	ENST00000319380.7	-	9	1287	c.1223G>T	c.(1222-1224)cGg>cTg	p.R408L	UBE2O_ENST00000587581.1_5'Flank	NM_022066.3	NP_071349.3	Q9C0C9	UBE2O_HUMAN	ubiquitin-conjugating enzyme E2O	408					positive regulation of BMP signaling pathway (GO:0030513)|protein K63-linked ubiquitination (GO:0070534)|protein monoubiquitination (GO:0006513)|retrograde transport, endosome to Golgi (GO:0042147)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	acid-amino acid ligase activity (GO:0016881)|ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(17)|ovary(2)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	36						GGAATGGTCCCGGGAACACTG	0.597																																																	0													112.0	117.0	116.0					17																	74395935		2203	4300	6503	SO:0001583	missense	0			AB051521	CCDS32742.1	17q25.1	2013-10-09			ENSG00000175931	ENSG00000175931			29554	protein-coding gene	gene with protein product						11311559, 11214970	Standard	NM_022066		Approved	E2-230K	uc002jrm.4	Q9C0C9	OTTHUMG00000180178	ENST00000319380.7:c.1223G>T	17.37:g.74395935C>A	ENSP00000323687:p.Arg408Leu		A6NDU5|Q69YP4|Q6PIZ2|Q86UA4|Q8N425|Q8TBN1|Q9BSW1|Q9H6E6|Q9H7E4|Q9H9B2	Missense_Mutation	SNP	pfam_UBQ-conjugat_E2,superfamily_UBQ-conjugating_enzyme/RWD,pfscan_UBQ-conjugat_E2	p.R408L	ENST00000319380.7	37	c.1223	CCDS32742.1	17	.	.	.	.	.	.	.	.	.	.	C	11.97	1.797996	0.31777	.	.	ENSG00000175931	ENST00000319380	T	0.72282	-0.64	5.19	4.22	0.49857	.	0.725885	0.13059	N	0.417028	T	0.49133	0.1539	N	0.08118	0	0.09310	N	0.999997	B	0.18610	0.029	B	0.10450	0.005	T	0.33137	-0.9880	10	0.25751	T	0.34	-24.9209	10.0159	0.42014	0.0:0.642:0.2795:0.0785	.	408	Q9C0C9	UBE2O_HUMAN	L	408	ENSP00000323687:R408L	ENSP00000323687:R408L	R	-	2	0	UBE2O	71907530	0.004000	0.15560	0.779000	0.31741	0.995000	0.86356	0.018000	0.13422	1.190000	0.43042	0.563000	0.77884	CGG	UBE2O	-	NULL	ENSG00000175931		0.597	UBE2O-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBE2O	HGNC	protein_coding	OTTHUMT00000450123.1	-	0.00	45	0	C	NM_022066		74395935	-1	tier1	-	no_errors	ENST00000319380	ensembl	human	known	74_37	missense	27.78	13	5	SNP	0.185	A
UFL1	23376	genome.wustl.edu	37	6	97001214	97001214	+	Silent	SNP	C	C	G			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr6:97001214C>G	ENST00000369278.4	+	19	2286	c.2220C>G	c.(2218-2220)gtC>gtG	p.V740V		NM_015323.4	NP_056138.1	O94874	UFL1_HUMAN	UFM1-specific ligase 1	740					negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein ubiquitination (GO:0031397)|osteoblast differentiation (GO:0001649)|protein ufmylation (GO:0071569)|regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032434)|response to endoplasmic reticulum stress (GO:0034976)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nucleus (GO:0005634)	UFM1 conjugating enzyme activity (GO:0071568)										AGCAGCTAGTCAGTCAAAGTA	0.368																																																	0													111.0	102.0	105.0					6																	97001214		2203	4300	6503	SO:0001819	synonymous_variant	0			BC036379	CCDS5034.1	6q16.3	2011-08-18	2011-08-18	2011-08-18	ENSG00000014123	ENSG00000014123			23039	protein-coding gene	gene with protein product	"""novel LZAP-binding protein"", ""Regulator of CDK5RAP3 and DDRGK1"""	613372	"""KIAA0776"""	KIAA0776		20018847, 20164180, 20228063, 20531390	Standard	NM_015323		Approved	NLBP, Maxer, RCAD	uc003por.3	O94874	OTTHUMG00000015238	ENST00000369278.4:c.2220C>G	6.37:g.97001214C>G			A0PJ53|B4DJ57|C0H5X5|Q8N765|Q9NTQ0	Silent	SNP	pfam_E3_UFM1_ligase_1	p.V740	ENST00000369278.4	37	c.2220	CCDS5034.1	6																																																																																			UFL1	-	NULL	ENSG00000014123		0.368	UFL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UFL1	HGNC	protein_coding	OTTHUMT00000041557.1	-	0.00	69	0	C	NM_015323		97001214	+1	tier1	-	no_errors	ENST00000369278	ensembl	human	known	74_37	silent	11.11	32	4	SNP	0.107	G
USP10	9100	genome.wustl.edu	37	16	84778244	84778244	+	Nonsense_Mutation	SNP	G	G	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr16:84778244G>T	ENST00000219473.7	+	4	270	c.157G>T	c.(157-159)Gaa>Taa	p.E53*	USP10_ENST00000562743.1_3'UTR|USP10_ENST00000570191.1_Nonsense_Mutation_p.E57*	NM_001272075.1|NM_005153.2	NP_001259004.1|NP_005144.2	Q14694	UBP10_HUMAN	ubiquitin specific peptidase 10	53	Interaction with p53/TP53.				autophagy (GO:0006914)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA repair (GO:0006281)|protein deubiquitination (GO:0016579)|regulation of autophagy (GO:0010506)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|ion channel binding (GO:0044325)|p53 binding (GO:0002039)|poly(A) RNA binding (GO:0044822)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			endometrium(3)|kidney(1)|large_intestine(7)|lung(3)|prostate(1)|stomach(1)|urinary_tract(1)	17						AACAGGACAAGAATATCAGAG	0.378																																																	0													38.0	36.0	36.0					16																	84778244		1842	4080	5922	SO:0001587	stop_gained	0			D80012	CCDS45537.1, CCDS62004.1	16q	2008-03-25	2005-08-08			ENSG00000103194		"""Ubiquitin-specific peptidases"""	12608	protein-coding gene	gene with protein product		609818	"""ubiquitin specific protease 10"""			12838346	Standard	NM_005153		Approved	UBPO, KIAA0190	uc002fii.3	Q14694		ENST00000219473.7:c.157G>T	16.37:g.84778244G>T	ENSP00000219473:p.Glu53*		B2RDJ8|B4DS84|Q9BWG7|Q9NSL7	Nonsense_Mutation	SNP	pfam_Peptidase_C19/C67,pfam_Ataxin-2_C,pfscan_Peptidase_C19/C67	p.E57*	ENST00000219473.7	37	c.169	CCDS45537.1	16	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	34|34	5.336694|5.336694	0.95758|0.95758	.|.	.|.	ENSG00000103194|ENSG00000103194	ENST00000219473|ENST00000540269	.|.	.|.	.|.	5.06|5.06	5.06|5.06	0.68205|0.68205	.|.	0.836985|.	0.10914|.	N|.	0.620264|.	.|T	.|0.74558	.|0.3732	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.80970	.|-0.1144	.|4	0.72032|0.72032	D|D	0.01|0.01	-2.9273|-2.9273	15.5777|15.5777	0.76404|0.76404	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	X|N	53|32	.|.	ENSP00000219473:E53X|ENSP00000445589:K32N	E|K	+|+	1|3	0|2	USP10|USP10	83335745|83335745	1.000000|1.000000	0.71417|0.71417	0.320000|0.320000	0.25306|0.25306	0.867000|0.867000	0.49689|0.49689	8.713000|8.713000	0.91408|0.91408	2.331000|2.331000	0.79229|0.79229	0.491000|0.491000	0.48974|0.48974	GAA|AAG	USP10	-	NULL	ENSG00000103194		0.378	USP10-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	USP10	HGNC	protein_coding	OTTHUMT00000433660.1	-	0.00	93	0	G			84778244	+1	tier1	-	no_errors	ENST00000570191	ensembl	human	known	74_37	nonsense	7.84	47	4	SNP	1.000	T
UTRN	7402	genome.wustl.edu	37	6	144780469	144780469	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr6:144780469C>A	ENST00000367545.3	+	20	2686	c.2686C>A	c.(2686-2688)Cgt>Agt	p.R896S		NM_007124.2	NP_009055.2	P46939	UTRO_HUMAN	utrophin	896	Interaction with SYNM.				aging (GO:0007568)|muscle cell differentiation (GO:0042692)|muscle contraction (GO:0006936)|muscle organ development (GO:0007517)|neuron projection morphogenesis (GO:0048812)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of sodium ion transmembrane transporter activity (GO:2000649)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dystrophin-associated glycoprotein complex (GO:0016010)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane (GO:0016020)|membrane raft (GO:0045121)|myofibril (GO:0030016)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|protein kinase binding (GO:0019901)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)	p.R896C(1)		NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(1)|cervix(2)|endometrium(21)|kidney(10)|large_intestine(29)|lung(56)|ovary(5)|pancreas(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	148		Ovarian(120;0.218)		OV - Ovarian serous cystadenocarcinoma(155;5.72e-07)|GBM - Glioblastoma multiforme(68;4.9e-05)|Colorectal(48;0.213)		TGTAGAGGATCGTCAACAACA	0.463																																																	1	Substitution - Missense(1)	skin(1)											71.0	70.0	70.0					6																	144780469		2203	4300	6503	SO:0001583	missense	0			AK023675	CCDS34547.1	6q24	2008-02-05	2006-12-13		ENSG00000152818	ENSG00000152818			12635	protein-coding gene	gene with protein product		128240	"""utrophin (homologous to dystrophin)"""	DMDL		1426262	Standard	NM_007124		Approved	DRP, DRP1	uc003qkt.3	P46939	OTTHUMG00000015746	ENST00000367545.3:c.2686C>A	6.37:g.144780469C>A	ENSP00000356515:p.Arg896Ser		Q5SYY1|Q5SZ57|Q9UJ40	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_EF-hand_dom_typ1,pfam_EF-hand_dom_typ2,pfam_CH-domain,pfam_Znf_ZZ,pfam_WW_dom,superfamily_CH-domain,superfamily_WW_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_WW_dom,smart_Znf_ZZ,pirsf_Dystrophin/utrophin,pfscan_CH-domain,pfscan_WW_dom,pfscan_Znf_ZZ	p.R896S	ENST00000367545.3	37	c.2686	CCDS34547.1	6	.	.	.	.	.	.	.	.	.	.	C	6.745	0.506268	0.12883	.	.	ENSG00000152818	ENST00000367529;ENST00000367545	T	0.50277	0.75	5.44	1.02	0.19986	.	0.953527	0.08666	N	0.911614	T	0.12178	0.0296	N	0.24115	0.695	0.09310	N	1	B	0.26195	0.144	B	0.19148	0.024	T	0.25293	-1.0136	10	0.33940	T	0.23	.	5.6451	0.17584	0.1296:0.4228:0.0:0.4475	.	896	P46939	UTRO_HUMAN	S	896	ENSP00000356515:R896S	ENSP00000356499:R896S	R	+	1	0	UTRN	144822162	0.000000	0.05858	0.000000	0.03702	0.012000	0.07955	-0.059000	0.11731	0.364000	0.24374	0.650000	0.86243	CGT	UTRN	-	pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin,pirsf_Dystrophin/utrophin	ENSG00000152818		0.463	UTRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UTRN	HGNC	protein_coding	OTTHUMT00000042551.1		0.00	73	0	C			144780469	+1			no_errors	ENST00000367545	ensembl	human	known	74_37	missense	5.00	38	2	SNP	0.000	A
VAMP5	10791	genome.wustl.edu	37	2	85818866	85818866	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr2:85818866C>T	ENST00000306384.4	+	2	105	c.22C>T	c.(22-24)Cgg>Tgg	p.R8W		NM_006634.2	NP_006625.1	O95183	VAMP5_HUMAN	vesicle-associated membrane protein 5	8	v-SNARE coiled-coil homology. {ECO:0000255|PROSITE-ProRule:PRU00290}.				cell differentiation (GO:0030154)|Golgi to plasma membrane protein transport (GO:0043001)|muscle organ development (GO:0007517)|skeletal muscle tissue development (GO:0007519)	cell surface (GO:0009986)|cytoplasmic vesicle membrane (GO:0030659)|extracellular vesicular exosome (GO:0070062)|integral component of organelle membrane (GO:0031301)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|late endosome (GO:0005770)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)		p.R8W(1)		NS(1)|large_intestine(3)|lung(1)	5						AGAGTTGGAGCGGTGCCAGCA	0.602																																																	1	Substitution - Missense(1)	large_intestine(1)											99.0	86.0	90.0					2																	85818866		2203	4300	6503	SO:0001583	missense	0			AF054825	CCDS1980.1	2p11.2	2013-02-13	2012-10-17		ENSG00000168899	ENSG00000168899		"""Vesicle-associated membrane proteins"""	12646	protein-coding gene	gene with protein product	"""myobrevin"""	607029				9725904	Standard	NM_006634		Approved		uc002spu.1	O95183	OTTHUMG00000130169	ENST00000306384.4:c.22C>T	2.37:g.85818866C>T	ENSP00000305647:p.Arg8Trp		Q9P0T2	Missense_Mutation	SNP	pfam_Synaptobrevin,pirsf_Synaptobrevin_met/fun,prints_Synaptobrevin,pfscan_Synaptobrevin	p.R8W	ENST00000306384.4	37	c.22	CCDS1980.1	2	.	.	.	.	.	.	.	.	.	.	C	20.3	3.966516	0.74131	.	.	ENSG00000168899	ENST00000306384	T	0.46451	0.87	4.84	3.86	0.44501	Synaptobrevin (2);	0.510677	0.16936	N	0.193481	T	0.58163	0.2103	M	0.78456	2.415	0.26041	N	0.981608	D	0.76494	0.999	P	0.57846	0.828	T	0.52895	-0.8514	10	0.87932	D	0	.	11.017	0.47696	0.199:0.801:0.0:0.0	.	8	O95183	VAMP5_HUMAN	W	8	ENSP00000305647:R8W	ENSP00000305647:R8W	R	+	1	2	VAMP5	85672377	0.838000	0.29461	0.993000	0.49108	0.993000	0.82548	1.643000	0.37217	2.240000	0.73641	0.561000	0.74099	CGG	VAMP5	-	pfam_Synaptobrevin,pirsf_Synaptobrevin_met/fun,pfscan_Synaptobrevin	ENSG00000168899		0.602	VAMP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VAMP5	HGNC	protein_coding	OTTHUMT00000252484.2		0.00	73	0	C	NM_006634		85818866	+1			no_errors	ENST00000306384	ensembl	human	known	74_37	missense	7.41	25	2	SNP	0.882	T
VPS11	55823	genome.wustl.edu	37	11	118947656	118947656	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr11:118947656G>T	ENST00000300793.6	+	9	1327	c.1285G>T	c.(1285-1287)Gcc>Tcc	p.A429S	VPS11_ENST00000527798.1_3'UTR	NM_021729.4	NP_068375.3	Q9H270	VPS11_HUMAN	vacuolar protein sorting 11 homolog (S. cerevisiae)	430					intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	endocytic vesicle (GO:0030139)|endosome (GO:0005768)|HOPS complex (GO:0030897)|lysosomal membrane (GO:0005765)	nucleotide binding (GO:0000166)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(7)|ovary(2)|prostate(1)|skin(2)|urinary_tract(2)	29	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.88e-05)		GTTTCTGGATGCCCAGCGCAT	0.537																																																	0													88.0	94.0	92.0					11																	118947656		2142	4237	6379	SO:0001583	missense	0			AB027508	CCDS73404.1	11q23	2008-02-05	2006-12-19			ENSG00000160695		"""RING-type (C3HC4) zinc fingers"""	14583	protein-coding gene	gene with protein product		608549	"""vacuolar protein sorting 11 (yeast homolog)"""				Standard	NM_021729		Approved	RNF108, PEP5	uc010ryx.2	Q9H270		ENST00000300793.6:c.1285G>T	11.37:g.118947656G>T	ENSP00000475301:p.Ala429Ser		Q8WY89|Q96EP8|Q9H6D9|Q9HCS6	Missense_Mutation	SNP	pfam_VPS11_C,pfam_Clathrin_H-chain/VPS_repeat,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_Znf_RING,pirsf_VPS11,pfscan_Znf_RING	p.A429S	ENST00000300793.6	37	c.1285		11																																																																																			VPS11	-	pfam_Clathrin_H-chain/VPS_repeat,superfamily_ARM-type_fold,pirsf_VPS11	ENSG00000160695		0.537	VPS11-201	KNOWN	basic|appris_principal	protein_coding	VPS11	HGNC	protein_coding		-	0.00	46	0	G	NM_021729		118947656	+1	tier1	-	no_errors	ENST00000300793	ensembl	human	known	74_37	missense	18.75	13	3	SNP	1.000	T
VPS26A	9559	genome.wustl.edu	37	10	70893327	70893327	+	Intron	SNP	A	A	G			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr10:70893327A>G	ENST00000373382.1	+	3	806				VPS26A_ENST00000263559.6_Intron|VPS26A_ENST00000541711.1_Intron|VPS26A_ENST00000546041.1_Silent_p.L22L|VPS26A_ENST00000395098.1_Intron|VPS26A_ENST00000489794.1_Intron|VPS26A_ENST00000490696.1_Intron			O75436	VP26A_HUMAN	vacuolar protein sorting 26 homolog A (S. pombe)						retrograde transport, endosome to Golgi (GO:0042147)	cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|vesicle (GO:0031982)	protein transporter activity (GO:0008565)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(2)	8						GGATGTGTCTATGCATGGTCA	0.363																																					Colon(90;545 1358 4729 6702 16773)												0																																										SO:0001627	intron_variant	0			AF054179	CCDS7286.1, CCDS41536.1	10q21.1	2007-01-12	2007-01-12	2005-10-11	ENSG00000122958	ENSG00000122958			12711	protein-coding gene	gene with protein product		605506	"""vacuolar protein sorting 26 (yeast homolog)"", ""vacuolar protein sorting 26 (yeast)"", ""vacuolar protein sorting 26 homolog A (yeast)"""	VPS26		1638986, 9653160	Standard	NM_004896		Approved	Hbeta58, PEP8A	uc001jpb.3	O75436	OTTHUMG00000018376	ENST00000373382.1:c.153+524A>G	10.37:g.70893327A>G			A8MZ56|B2RDD3|Q8TBH4|Q9H982	Silent	SNP	pfam_VPS26	p.L22	ENST00000373382.1	37	c.66	CCDS7286.1	10																																																																																			VPS26A	-	NULL	ENSG00000122958		0.363	VPS26A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VPS26A	HGNC	protein_coding	OTTHUMT00000048403.1	-	0.00	81	0	A	NM_004896		70893327	+1	tier1	-	no_errors	ENST00000546041	ensembl	human	known	74_37	silent	54.17	22	26	SNP	0.000	G
VPS9D1	9605	genome.wustl.edu	37	16	89782964	89782964	+	Missense_Mutation	SNP	G	G	T	rs369012100		TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr16:89782964G>T	ENST00000389386.3	-	4	461	c.337C>A	c.(337-339)Cgt>Agt	p.R113S	VPS9D1-AS1_ENST00000562298.1_RNA|VPS9D1-AS1_ENST00000562866.1_RNA|VPS9D1_ENST00000561976.1_Missense_Mutation_p.R43S	NM_004913.2	NP_004904.2	Q9Y2B5	VP9D1_HUMAN	VPS9 domain containing 1	113					ATP synthesis coupled proton transport (GO:0015986)		GTPase activator activity (GO:0005096)|transporter activity (GO:0005215)										GAGTATACACGGCGGTGTCGG	0.572																																																	0													130.0	150.0	143.0					16																	89782964		2010	4179	6189	SO:0001583	missense	0			AB018551	CCDS42220.1	16q24.3	2012-10-09	2012-10-09	2012-10-09	ENSG00000075399	ENSG00000075399			13526	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 7"""	C16orf7		10231027	Standard	NM_004913		Approved	ATP-BL	uc002fom.1	Q9Y2B5	OTTHUMG00000173219	ENST00000389386.3:c.337C>A	16.37:g.89782964G>T	ENSP00000374037:p.Arg113Ser			Missense_Mutation	SNP	pfam_VPS9,smart_VPS9_subgr,pfscan_VPS9	p.R113S	ENST00000389386.3	37	c.337	CCDS42220.1	16	.	.	.	.	.	.	.	.	.	.	g	13.52	2.260263	0.39995	.	.	ENSG00000075399	ENST00000389386;ENST00000261625	.	.	.	5.28	3.14	0.36123	.	0.048614	0.85682	D	0.000000	T	0.67571	0.2907	M	0.72894	2.215	0.41139	D	0.985943	D	0.60575	0.988	P	0.56563	0.801	T	0.72669	-0.4223	9	0.87932	D	0	-10.8402	11.7532	0.51859	0.0:0.0:0.6317:0.3682	.	113	Q9Y2B5	CP007_HUMAN	S	113;144	.	ENSP00000261625:R144S	R	-	1	0	C16orf7	88310465	1.000000	0.71417	0.995000	0.50966	0.034000	0.12701	1.568000	0.36418	1.183000	0.42943	0.486000	0.48141	CGT	VPS9D1	-	NULL	ENSG00000075399		0.572	VPS9D1-002	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	VPS9D1	HGNC	protein_coding	OTTHUMT00000422508.1	-	0.00	97	0	G	NM_004913		89782964	-1	tier1	-	no_errors	ENST00000389386	ensembl	human	known	74_37	missense	6.90	54	4	SNP	0.996	T
VSX1	30813	genome.wustl.edu	37	20	25058370	25058370	+	Silent	SNP	G	G	A			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr20:25058370G>A	ENST00000376709.4	-	4	1022	c.759C>T	c.(757-759)ctC>ctT	p.L253L	VSX1_ENST00000424574.1_Silent_p.L253L|VSX1_ENST00000451258.1_Intron|VSX1_ENST00000444511.2_Intron|VSX1_ENST00000429762.3_Silent_p.L253L	NM_014588.5	NP_055403.2	Q9NZR4	VSX1_HUMAN	visual system homeobox 1	253	CVC. {ECO:0000255|PROSITE- ProRule:PRU00829}.				neuron maturation (GO:0042551)|response to stimulus (GO:0050896)|retinal bipolar neuron differentiation (GO:0060040)|transcription, DNA-templated (GO:0006351)|visual perception (GO:0007601)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|large_intestine(3)|lung(2)	6						CGGCGGAGTTGAGCACGGAGT	0.711											OREG0032118	type=REGULATORY REGION|TFbs=RELA|Dataset=RELA (p65) ChIP-PET Binding Sites|EvidenceSubtype=Chromatin immunoprecipitation with paired-end diTag sequencing (ChIP-PET)																																					0													9.0	11.0	10.0					20																	25058370		2018	3924	5942	SO:0001819	synonymous_variant	0			AF176797	CCDS13168.1, CCDS13169.1, CCDS58766.1, CCDS58767.1	20p11.21	2014-02-14	2007-07-12		ENSG00000100987	ENSG00000100987		"""Homeoboxes / PRD class"""	12723	protein-coding gene	gene with protein product		605020	"""posterior polymorphous corneal dystrophy"", ""visual system homeobox 1 homolog, CHX10-like (zebrafish)"""	PPCD		10673340	Standard	NM_001256272		Approved	PPD, PPCD1	uc002wuf.4	Q9NZR4	OTTHUMG00000032111	ENST00000376709.4:c.759C>T	20.37:g.25058370G>A		776	B9EGJ4|D1MF28|Q0GM60|Q0GM61|Q0GM62|Q0GM63|Q0GM64|Q0GM65|Q5TF40|Q5TF41|Q9HCU3|Q9NU27	Silent	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom	p.L253	ENST00000376709.4	37	c.759	CCDS13168.1	20																																																																																			VSX1	-	NULL	ENSG00000100987		0.711	VSX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VSX1	HGNC	protein_coding	OTTHUMT00000078384.3	-	0.00	33	0	G			25058370	-1	tier1	-	no_errors	ENST00000376709	ensembl	human	known	74_37	silent	25.00	21	7	SNP	0.995	A
WBSCR16	81554	genome.wustl.edu	37	7	74486515	74486515	+	Silent	SNP	G	G	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr7:74486515G>T	ENST00000329959.4	-	2	448	c.393C>A	c.(391-393)gtC>gtA	p.V131V	WBSCR16_ENST00000543840.1_Silent_p.V131V|WBSCR16_ENST00000503250.2_Silent_p.V131V	NM_030798.3	NP_110425.2	Q96I51	WBS16_HUMAN	Williams-Beuren syndrome chromosome region 16	131							poly(A) RNA binding (GO:0044822)			kidney(1)|lung(1)|skin(1)|upper_aerodigestive_tract(1)	4						CCATCCCCCAGACTTTCGTAA	0.483																																																	0													116.0	111.0	113.0					7																	74486515		2203	4300	6503	SO:0001819	synonymous_variant	0			AF410455	CCDS5577.1, CCDS64683.1, CCDS64684.1	7q11.23	2008-08-14			ENSG00000174374	ENSG00000274523			14948	protein-coding gene	gene with protein product						12073013	Standard	NM_030798		Approved		uc003ubr.3	Q96I51	OTTHUMG00000130373	ENST00000329959.4:c.393C>A	7.37:g.74486515G>T			D3DXK0|F5GX55|F5H6C7|Q548B1|Q8IW88|Q8N572|Q9H0G7	Silent	SNP	pfam_Reg_chr_condens,superfamily_RCC1/BLIP-II,pfscan_Reg_chr_condens,prints_Reg_chr_condens	p.V131	ENST00000329959.4	37	c.393	CCDS5577.1	7																																																																																			WBSCR16	-	pfam_Reg_chr_condens,superfamily_RCC1/BLIP-II,pfscan_Reg_chr_condens	ENSG00000174374		0.483	WBSCR16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WBSCR16	HGNC	protein_coding	OTTHUMT00000252740.1	-	0.00	96	0	G	NM_030798		74486515	-1	tier1	-	no_errors	ENST00000329959	ensembl	human	known	74_37	silent	5.68	83	5	SNP	0.861	T
WDFY3	23001	genome.wustl.edu	37	4	85724488	85724488	+	Silent	SNP	G	G	A			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr4:85724488G>A	ENST00000295888.4	-	16	2969	c.2562C>T	c.(2560-2562)gcC>gcT	p.A854A	WDFY3_ENST00000512267.1_5'UTR|WDFY3-AS1_ENST00000510449.1_RNA|WDFY3_ENST00000322366.6_Silent_p.A854A	NM_014991.4	NP_055806.2	Q8IZQ1	WDFY3_HUMAN	WD repeat and FYVE domain containing 3	854					aggrephagy (GO:0035973)|positive regulation of macroautophagy (GO:0016239)	autophagic vacuole (GO:0005776)|cytoplasm (GO:0005737)|extrinsic component of membrane (GO:0019898)|inclusion body (GO:0016234)|nuclear envelope (GO:0005635)|PML body (GO:0016605)	1-phosphatidylinositol binding (GO:0005545)|beta-N-acetylglucosaminylglycopeptide beta-1,4-galactosyltransferase activity (GO:0003831)|metal ion binding (GO:0046872)			breast(5)|central_nervous_system(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(32)|lung(50)|ovary(3)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	134		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000808)		GGTCCAGCATGGCAAGCATGG	0.453																																																	0													77.0	71.0	73.0					4																	85724488		2203	4300	6503	SO:0001819	synonymous_variant	0			AB023210	CCDS3609.1	4q21.3	2013-01-09			ENSG00000163625	ENSG00000163625		"""Zinc fingers, FYVE domain containing"", ""WD repeat domain containing"""	20751	protein-coding gene	gene with protein product						10231032	Standard	NM_014991		Approved	KIAA0993, ALFY, ZFYVE25	uc003hpd.3	Q8IZQ1	OTTHUMG00000130424	ENST00000295888.4:c.2562C>T	4.37:g.85724488G>A			Q4W5K5|Q6P0Q5|Q8N1T2|Q8NAV6|Q96BS7|Q96D33|Q96N85|Q9Y2J7	Silent	SNP	pfam_BEACH_dom,pfam_Znf_FYVE,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_WD40_repeat_dom,superfamily_Znf_FYVE_PHD,superfamily_ConA-like_lec_gl_sf,superfamily_Cyclin-like,superfamily_ARM-type_fold,smart_WD40_repeat,smart_Znf_FYVE,pfscan_BEACH_dom,pfscan_Znf_FYVE-rel,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.A854	ENST00000295888.4	37	c.2562	CCDS3609.1	4																																																																																			WDFY3	-	superfamily_ARM-type_fold	ENSG00000163625		0.453	WDFY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDFY3	HGNC	protein_coding	OTTHUMT00000252811.2	-	0.00	68	0	G	NM_014991		85724488	-1	tier1	-	no_errors	ENST00000295888	ensembl	human	known	74_37	silent	7.02	53	4	SNP	0.255	A
WDFY3	23001	genome.wustl.edu	37	4	85729487	85729487	+	Splice_Site	SNP	C	C	G			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr4:85729487C>G	ENST00000295888.4	-	15	2836	c.2429G>C	c.(2428-2430)aGg>aCg	p.R810T	WDFY3-AS1_ENST00000510449.1_RNA|WDFY3_ENST00000322366.6_Splice_Site_p.R810T	NM_014991.4	NP_055806.2	Q8IZQ1	WDFY3_HUMAN	WD repeat and FYVE domain containing 3	810					aggrephagy (GO:0035973)|positive regulation of macroautophagy (GO:0016239)	autophagic vacuole (GO:0005776)|cytoplasm (GO:0005737)|extrinsic component of membrane (GO:0019898)|inclusion body (GO:0016234)|nuclear envelope (GO:0005635)|PML body (GO:0016605)	1-phosphatidylinositol binding (GO:0005545)|beta-N-acetylglucosaminylglycopeptide beta-1,4-galactosyltransferase activity (GO:0003831)|metal ion binding (GO:0046872)			breast(5)|central_nervous_system(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(32)|lung(50)|ovary(3)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	134		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000808)		TGATCAGTACCTTTTCCTGGA	0.418																																																	0													166.0	164.0	165.0					4																	85729487		2203	4300	6503	SO:0001630	splice_region_variant	0			AB023210	CCDS3609.1	4q21.3	2013-01-09			ENSG00000163625	ENSG00000163625		"""Zinc fingers, FYVE domain containing"", ""WD repeat domain containing"""	20751	protein-coding gene	gene with protein product						10231032	Standard	NM_014991		Approved	KIAA0993, ALFY, ZFYVE25	uc003hpd.3	Q8IZQ1	OTTHUMG00000130424	ENST00000295888.4:c.2429+1G>C	4.37:g.85729487C>G			Q4W5K5|Q6P0Q5|Q8N1T2|Q8NAV6|Q96BS7|Q96D33|Q96N85|Q9Y2J7	Missense_Mutation	SNP	pfam_BEACH_dom,pfam_Znf_FYVE,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_WD40_repeat_dom,superfamily_Znf_FYVE_PHD,superfamily_ConA-like_lec_gl_sf,superfamily_Cyclin-like,superfamily_ARM-type_fold,smart_WD40_repeat,smart_Znf_FYVE,pfscan_BEACH_dom,pfscan_Znf_FYVE-rel,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.R810T	ENST00000295888.4	37	c.2429	CCDS3609.1	4	.	.	.	.	.	.	.	.	.	.	C	18.18	3.566626	0.65651	.	.	ENSG00000163625	ENST00000322366;ENST00000295888	T;T	0.64085	-0.08;-0.08	5.73	5.73	0.89815	.	0.000000	0.85682	D	0.000000	T	0.59142	0.2172	L	0.47716	1.5	0.80722	D	1	P	0.40398	0.716	B	0.38655	0.278	T	0.56860	-0.7909	9	.	.	.	.	19.9155	0.97058	0.0:1.0:0.0:0.0	.	810	Q8IZQ1	WDFY3_HUMAN	T	810	ENSP00000318466:R810T;ENSP00000295888:R810T	.	R	-	2	0	WDFY3	85948511	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.380000	0.79704	2.699000	0.92147	0.650000	0.86243	AGG	WDFY3	-	superfamily_ARM-type_fold	ENSG00000163625		0.418	WDFY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDFY3	HGNC	protein_coding	OTTHUMT00000252811.2	-	0.00	142	0	C	NM_014991	Missense_Mutation	85729487	-1	tier1	-	no_errors	ENST00000295888	ensembl	human	known	74_37	missense	12.50	70	10	SNP	1.000	G
YLPM1	56252	genome.wustl.edu	37	14	75265542	75265542	+	Missense_Mutation	SNP	A	A	G			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr14:75265542A>G	ENST00000325680.7	+	5	3666	c.3542A>G	c.(3541-3543)tAt>tGt	p.Y1181C	YLPM1_ENST00000552421.1_Intron|YLPM1_ENST00000238571.3_Missense_Mutation_p.Y986C	NM_019589.2	NP_062535.2	P49750	YLPM1_HUMAN	YLP motif containing 1	986	Arg-rich.				regulation of telomere maintenance (GO:0032204)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)			breast(4)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(12)|lung(24)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	62			KIRC - Kidney renal clear cell carcinoma(43;0.238)	BRCA - Breast invasive adenocarcinoma(234;0.00162)		GAAAAAATGTATCCATATCAC	0.507																																																	0													65.0	66.0	66.0					14																	75265542		1921	4120	6041	SO:0001583	missense	0			AK090435	CCDS45135.1	14q24.3	2014-06-13	2004-07-15	2004-07-15	ENSG00000119596	ENSG00000119596			17798	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 169"""		"""chromosome 14 open reading frame 170"""	C14orf170		7596406	Standard	NM_019589		Approved	ZAP, PPP1R169	uc001xqj.4	P49750	OTTHUMG00000172503	ENST00000325680.7:c.3542A>G	14.37:g.75265542A>G	ENSP00000324463:p.Tyr1181Cys		P49752|Q96I64|Q9P1V7	Missense_Mutation	SNP	superfamily_P-loop_NTPase	p.Y1181C	ENST00000325680.7	37	c.3542	CCDS45135.1	14	.	.	.	.	.	.	.	.	.	.	A	7.005	0.555725	0.13436	.	.	ENSG00000119596	ENST00000325680;ENST00000238571;ENST00000423680	.	.	.	5.66	3.12	0.35913	.	0.421745	0.22557	N	0.058504	T	0.31544	0.0800	N	0.22421	0.69	0.26028	N	0.981778	P	0.37548	0.599	B	0.39379	0.298	T	0.13737	-1.0498	9	0.38643	T	0.18	-3.8837	13.6138	0.62094	0.6795:0.3205:0.0:0.0	.	1181	P49750-4	.	C	1181;986;894	.	ENSP00000238571:Y986C	Y	+	2	0	YLPM1	74335295	0.998000	0.40836	1.000000	0.80357	0.990000	0.78478	2.346000	0.44027	0.959000	0.37980	0.450000	0.29827	TAT	YLPM1	-	NULL	ENSG00000119596		0.507	YLPM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	YLPM1	HGNC	protein_coding	OTTHUMT00000404451.1	-	0.00	91	0	A	NM_019589		75265542	+1	tier1	-	no_errors	ENST00000325680	ensembl	human	known	74_37	missense	27.94	49	19	SNP	0.996	G
ZDHHC18	84243	genome.wustl.edu	37	1	27159089	27159089	+	Frame_Shift_Del	DEL	A	A	-			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr1:27159089delA	ENST00000374142.4	+	2	582	c.487delA	c.(487-489)aaafs	p.K163fs		NM_032283.2	NP_115659.1	Q9NUE0	ZDH18_HUMAN	zinc finger, DHHC-type containing 18	163					cellular protein localization (GO:0034613)|protein palmitoylation (GO:0018345)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(2)	3		all_cancers(24;5.82e-22)|all_epithelial(13;9.91e-20)|Colorectal(325;0.000147)|Breast(348;0.000706)|all_lung(284;0.00122)|Lung NSC(340;0.00128)|Renal(390;0.00211)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0707)|all_neural(195;0.0966)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;5.71e-53)|Epithelial(14;4.73e-52)|OV - Ovarian serous cystadenocarcinoma(117;1.53e-29)|Colorectal(126;1.9e-09)|COAD - Colon adenocarcinoma(152;4.2e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000548)|STAD - Stomach adenocarcinoma(196;0.00065)|KIRC - Kidney renal clear cell carcinoma(1967;0.000779)|GBM - Glioblastoma multiforme(114;0.0265)|READ - Rectum adenocarcinoma(331;0.0455)|Lung(427;0.163)|LUSC - Lung squamous cell carcinoma(448;0.237)		CGCCCTGGAGAAACAGATCGG	0.557																																																	0													48.0	51.0	50.0					1																	27159089		2203	4300	6503	SO:0001589	frameshift_variant	0			AK056427	CCDS30650.1	1p36.11	2008-05-02			ENSG00000204160	ENSG00000204160		"""Zinc fingers, DHHC-type"""	20712	protein-coding gene	gene with protein product							Standard	NM_032283		Approved	DKFZp667O2416	uc001bnb.3	Q9NUE0	OTTHUMG00000004092	ENST00000374142.4:c.487delA	1.37:g.27159089delA	ENSP00000363257:p.Lys163fs		A6NHY9|B4DQ84|Q5JYH0|Q9H020	Frame_Shift_Del	DEL	pfam_Znf_DHHC_palmitoyltrfase,pfscan_Znf_DHHC_palmitoyltrfase	p.K163fs	ENST00000374142.4	37	c.487	CCDS30650.1	1																																																																																			ZDHHC18	-	NULL	ENSG00000204160		0.557	ZDHHC18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZDHHC18	HGNC	protein_coding	OTTHUMT00000011706.3		0.00	28	0	A	NM_032283		27159089	+1	tier1		no_errors	ENST00000374142	ensembl	human	known	74_37	frame_shift_del	20.00	8	2	DEL	1.000	-
ZFHX4	79776	genome.wustl.edu	37	8	77767813	77767813	+	Missense_Mutation	SNP	T	T	G			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr8:77767813T>G	ENST00000521891.2	+	10	9104	c.8656T>G	c.(8656-8658)Ttt>Gtt	p.F2886V	ZFHX4_ENST00000455469.2_Missense_Mutation_p.F2841V|ZFHX4_ENST00000050961.6_Missense_Mutation_p.F2841V|ZFHX4_ENST00000518282.1_Missense_Mutation_p.F2860V	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	2841					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			CGACCAAAGCTTTTACATCAC	0.517										HNSCC(33;0.089)																																							0													86.0	86.0	86.0					8																	77767813		1995	4164	6159	SO:0001583	missense	0				CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.8656T>G	8.37:g.77767813T>G	ENSP00000430497:p.Phe2886Val		G3V138|Q18PS0|Q6ZN20	Missense_Mutation	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,superfamily_Adenylate_cyclase-assoc_CAP_N,smart_Znf_C2H2-like,smart_Znf_U1,smart_Homeobox_dom,pfscan_Homeobox_dom,pfscan_Znf_C2H2	p.F2886V	ENST00000521891.2	37	c.8656	CCDS47878.2	8	.	.	.	.	.	.	.	.	.	.	T	9.186	1.024794	0.19433	.	.	ENSG00000091656	ENST00000521891;ENST00000399468;ENST00000455469;ENST00000050961;ENST00000518282	T;T;T;T	0.46819	0.86;0.9;0.87;0.86	5.25	5.25	0.73442	.	0.170215	0.27976	U	0.017098	T	0.26085	0.0636	N	0.08118	0	0.28890	N	0.893883	B;B;B	0.14438	0.0;0.0;0.01	B;B;B	0.12837	0.001;0.002;0.008	T	0.12553	-1.0543	10	0.17369	T	0.5	.	11.3361	0.49505	0.0:0.0:0.1517:0.8482	.	2841;2841;2886	Q86UP3;Q86UP3-4;G3V138	ZFHX4_HUMAN;.;.	V	2886;2870;2841;2841;2860	ENSP00000430497:F2886V;ENSP00000399605:F2841V;ENSP00000050961:F2841V;ENSP00000430848:F2860V	ENSP00000050961:F2841V	F	+	1	0	ZFHX4	77930368	1.000000	0.71417	0.998000	0.56505	0.669000	0.39330	4.511000	0.60462	2.207000	0.71202	0.459000	0.35465	TTT	ZFHX4	-	NULL	ENSG00000091656		0.517	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZFHX4	HGNC	protein_coding	OTTHUMT00000379197.2	-	0.00	26	0	T	NM_024721		77767813	+1	tier1	-	no_errors	ENST00000521891	ensembl	human	known	74_37	missense	57.14	12	16	SNP	1.000	G
ZMIZ1	57178	genome.wustl.edu	37	10	81072411	81072411	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr10:81072411C>G	ENST00000334512.5	+	25	3681	c.3109C>G	c.(3109-3111)Ctc>Gtc	p.L1037V	ZMIZ1_ENST00000446377.2_Missense_Mutation_p.L103V	NM_020338.3	NP_065071.1	Q9ULJ6	ZMIZ1_HUMAN	zinc finger, MIZ-type containing 1	1037					artery morphogenesis (GO:0048844)|cell aging (GO:0007569)|developmental growth (GO:0048589)|heart morphogenesis (GO:0003007)|in utero embryonic development (GO:0001701)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)|vasculogenesis (GO:0001570)|vitellogenesis (GO:0007296)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(14)|ovary(2)|prostate(3)|skin(1)	30	all_cancers(46;0.0292)|Breast(12;8.52e-05)|all_epithelial(25;0.000854)|Prostate(51;0.00985)		Epithelial(14;0.00256)|all cancers(16;0.00726)|Colorectal(32;0.229)			CCTTCCCGAACTCACAAATCC	0.572																																																	0													200.0	184.0	189.0					10																	81072411		2203	4300	6503	SO:0001583	missense	0			AB033050	CCDS7357.1	10q22.3	2012-11-30	2006-10-24	2006-10-24	ENSG00000108175	ENSG00000108175		"""Zinc fingers, MIZ-type"""	16493	protein-coding gene	gene with protein product		607159	"""retinoic acid induced 17"""	RAI17		15626329	Standard	NM_020338		Approved	RP11-519K18.1, KIAA1224, FLJ13541, hZIMP10, Zimp10, MIZ	uc001kaf.2	Q9ULJ6	OTTHUMG00000018560	ENST00000334512.5:c.3109C>G	10.37:g.81072411C>G	ENSP00000334474:p.Leu1037Val		Q5JSH9|Q7Z7E6	Missense_Mutation	SNP	pfam_Znf_MIZ,pfscan_Znf_MIZ	p.L1037V	ENST00000334512.5	37	c.3109	CCDS7357.1	10	.	.	.	.	.	.	.	.	.	.	C	26.1	4.703694	0.88924	.	.	ENSG00000108175	ENST00000334512;ENST00000360331;ENST00000372347;ENST00000446377	T	0.34072	1.38	5.16	5.16	0.70880	.	0.000000	0.37623	N	0.002019	T	0.52191	0.1719	L	0.43152	1.355	0.37216	D	0.905023	D;D	0.69078	0.974;0.997	D;D	0.85130	0.953;0.997	T	0.46555	-0.9183	10	0.19147	T	0.46	-26.0769	19.0003	0.92830	0.0:1.0:0.0:0.0	.	103;1037	B4DSG4;Q9ULJ6	.;ZMIZ1_HUMAN	V	1037;967;938;103	ENSP00000334474:L1037V	ENSP00000334474:L1037V	L	+	1	0	ZMIZ1	80742417	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.419000	0.80179	2.559000	0.86315	0.491000	0.48974	CTC	ZMIZ1	-	NULL	ENSG00000108175		0.572	ZMIZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZMIZ1	HGNC	protein_coding	OTTHUMT00000048944.2	-	0.00	121	0	C	NM_020338		81072411	+1	tier1	-	no_errors	ENST00000334512	ensembl	human	known	74_37	missense	44.07	33	26	SNP	1.000	G
ZNF10	7556	genome.wustl.edu	37	12	133732691	133732691	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr12:133732691C>A	ENST00000248211.6	+	5	1081	c.859C>A	c.(859-861)Cat>Aat	p.H287N	ZNF10_ENST00000426665.2_Missense_Mutation_p.H287N|CTD-2140B24.4_ENST00000540096.2_Intron|ZNF268_ENST00000416488.1_Intron|ZNF10_ENST00000402932.2_Missense_Mutation_p.H153N	NM_015394.4	NP_056209.2	P21506	ZNF10_HUMAN	zinc finger protein 10	287					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(9)|prostate(1)|skin(5)|urinary_tract(1)	26	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_cancers(7;1.28e-06)|all_epithelial(31;0.0051)|Lung NSC(355;0.00948)		OV - Ovarian serous cystadenocarcinoma(86;3.58e-08)|Epithelial(86;6.6e-07)|all cancers(50;2.28e-05)		TCAGCTTATTCATACTGGAGA	0.418																																																	0													66.0	73.0	71.0					12																	133732691		2203	4299	6502	SO:0001583	missense	0			X52332, BC024182	CCDS9283.1	12q24.33	2013-01-08	2005-05-22		ENSG00000256223	ENSG00000256223		"""Zinc fingers, C2H2-type"", ""-"""	12879	protein-coding gene	gene with protein product		194538	"""zinc finger protein 10 (KOX 1)"""			7865130, 8262519	Standard	NM_015394		Approved	KOX1	uc001ulq.3	P21506	OTTHUMG00000167944	ENST00000248211.6:c.859C>A	12.37:g.133732691C>A	ENSP00000248211:p.His287Asn		B2RBS1|Q8TC91	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.H287N	ENST00000248211.6	37	c.859	CCDS9283.1	12	.	.	.	.	.	.	.	.	.	.	C	20.3	3.963982	0.74131	.	.	ENSG00000256223	ENST00000248211;ENST00000426665;ENST00000402932	T;T;T	0.67345	-0.26;-0.26;-0.26	3.93	3.93	0.45458	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.40640	N	0.001044	D	0.83658	0.5302	M	0.88906	2.99	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.86980	0.2103	9	.	.	.	.	15.2497	0.73536	0.0:1.0:0.0:0.0	.	287	P21506	ZNF10_HUMAN	N	287;287;153	ENSP00000248211:H287N;ENSP00000393814:H287N;ENSP00000384893:H153N	.	H	+	1	0	ZNF10	132242764	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	5.302000	0.65733	2.199000	0.70637	0.591000	0.81541	CAT	ZNF10	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000256223		0.418	ZNF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF10	HGNC	protein_coding	OTTHUMT00000397182.1		0.00	77	0	C	NM_015394		133732691	+1			no_errors	ENST00000248211	ensembl	human	known	74_37	missense	6.06	30	2	SNP	1.000	A
ZNF223	7766	genome.wustl.edu	37	19	44570526	44570526	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr19:44570526G>T	ENST00000434772.3	+	5	800	c.545G>T	c.(544-546)gGa>gTa	p.G182V	ZNF223_ENST00000591793.1_Missense_Mutation_p.G292V	NM_013361.4	NP_037493.3	Q9UK11	ZN223_HUMAN	zinc finger protein 223	182					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|kidney(3)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	18		Prostate(69;0.0352)				GATGAGTGTGGAAAAAGCTTC	0.428																																																	0													164.0	162.0	163.0					19																	44570526		2203	4300	6503	SO:0001583	missense	0			AF187989	CCDS12635.1	19q13.2	2013-01-08				ENSG00000178386		"""Zinc fingers, C2H2-type"", ""-"""	13016	protein-coding gene	gene with protein product							Standard	XM_006723365		Approved		uc002oyf.1	Q9UK11		ENST00000434772.3:c.545G>T	19.37:g.44570526G>T	ENSP00000401947:p.Gly182Val		Q15736|Q8TBJ3|Q9HCA9	Missense_Mutation	SNP	pfam_Krueppel-associated_box,pfam_Znf_C2H2,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.G292V	ENST00000434772.3	37	c.875	CCDS12635.1	19	.	.	.	.	.	.	.	.	.	.	G	20.7	4.029776	0.75504	.	.	ENSG00000178386	ENST00000434772	T	0.37235	1.21	2.46	1.39	0.22231	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.63593	0.2524	H	0.96301	3.8	0.80722	D	1	D	0.71674	0.998	P	0.61003	0.882	T	0.67577	-0.5635	9	0.87932	D	0	.	8.0151	0.30376	0.1348:0.0:0.8652:0.0	.	182	Q9UK11	ZN223_HUMAN	V	182	ENSP00000401947:G182V	ENSP00000401947:G182V	G	+	2	0	ZNF223	49262366	0.955000	0.32602	0.608000	0.28969	0.941000	0.58515	1.502000	0.35704	0.352000	0.24053	0.313000	0.20887	GGA	ZNF223	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000267022		0.428	ZNF223-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF223	Uniprot_gn	protein_coding	OTTHUMT00000460469.2	-	0.00	107	0	G			44570526	+1	tier1	-	no_errors	ENST00000591793	ensembl	human	known	74_37	missense	5.88	64	4	SNP	1.000	T
ZNF273	10793	genome.wustl.edu	37	7	64388069	64388069	+	Silent	SNP	G	G	A			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr7:64388069G>A	ENST00000476120.1	+	4	434	c.363G>A	c.(361-363)aaG>aaA	p.K121K	ZNF273_ENST00000527278.1_3'UTR|ZNF273_ENST00000319636.5_Silent_p.K56K	NM_021148.2	NP_066971.2	Q14593	ZN273_HUMAN	zinc finger protein 273	121					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(3)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	16		Lung NSC(55;0.0295)|all_lung(88;0.0691)				TTTGGCCAAAGCAGGGCTTAA	0.338																																					Ovarian(154;605 895 6696 7659 15316 19321 21716 23848 32322 36932)												0													59.0	63.0	61.0					7																	64388069		2202	4300	6502	SO:0001819	synonymous_variant	0			X78932	CCDS5528.2	7q11.21	2013-01-08				ENSG00000198039		"""Zinc fingers, C2H2-type"", ""-"""	13067	protein-coding gene	gene with protein product		604756				7865130	Standard	NR_003099		Approved	HZF9	uc003tto.3	Q14593		ENST00000476120.1:c.363G>A	7.37:g.64388069G>A			B3KQZ5|Q6P3V4	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.K121	ENST00000476120.1	37	c.363	CCDS5528.2	7																																																																																			ZNF273	-	NULL	ENSG00000198039		0.338	ZNF273-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF273	HGNC	protein_coding	OTTHUMT00000313502.1		0.00	122	0	G			64388069	+1			no_errors	ENST00000476120	ensembl	human	known	74_37	silent	6.15	61	4	SNP	0.011	A
ZNF320	162967	genome.wustl.edu	37	19	53384797	53384797	+	Nonsense_Mutation	SNP	G	G	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr19:53384797G>T	ENST00000595635.1	-	8	1083	c.582C>A	c.(580-582)tgC>tgA	p.C194*	ZNF320_ENST00000597909.1_Intron|ZNF320_ENST00000391781.2_Nonsense_Mutation_p.C194*|ZNF320_ENST00000600930.1_Intron	NM_207333.2	NP_997216.2	A2RRD8	ZN320_HUMAN	zinc finger protein 320	194					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(2)|kidney(4)|large_intestine(5)|liver(1)|lung(10)|urinary_tract(1)	24				GBM - Glioblastoma multiforme(134;0.0534)		AAGCCTTGTCGCAAACCTTAC	0.358																																																	0													86.0	79.0	81.0					19																	53384797		2203	4300	6503	SO:0001587	stop_gained	0			AF086262	CCDS33095.1	19q13.41	2014-09-04			ENSG00000182986	ENSG00000182986		"""Zinc fingers, C2H2-type"", ""-"""	13842	protein-coding gene	gene with protein product		606427				11536051	Standard	XM_006723059		Approved	ZFPL, DKFZp686G16228	uc002qag.3	A2RRD8	OTTHUMG00000182797	ENST00000595635.1:c.582C>A	19.37:g.53384797G>T	ENSP00000473091:p.Cys194*		Q8NDR6	Nonsense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.C194*	ENST00000595635.1	37	c.582	CCDS33095.1	19	.	.	.	.	.	.	.	.	.	.	-	18.20	3.571988	0.65765	.	.	ENSG00000182986	ENST00000391781	.	.	.	1.75	1.75	0.24633	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	5.2561	0.15548	0.6831:0.0:0.3169:0.0	.	.	.	.	X	194	.	ENSP00000375660:C194X	C	-	3	2	ZNF320	58076609	0.014000	0.17966	0.006000	0.13384	0.229000	0.25112	0.190000	0.17057	-0.022000	0.13986	-1.220000	0.01600	TGC	ZNF320	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000182986		0.358	ZNF320-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF320	HGNC	protein_coding	OTTHUMT00000463771.1		0.00	98	0	G	NM_207333		53384797	-1			no_errors	ENST00000391781	ensembl	human	known	74_37	nonsense	6.52	43	3	SNP	0.993	T
ZNF341	84905	genome.wustl.edu	37	20	32332933	32332933	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr20:32332933G>T	ENST00000375200.1	+	3	532	c.167G>T	c.(166-168)gGg>gTg	p.G56V	ZNF341_ENST00000342427.2_Missense_Mutation_p.G56V	NM_001282933.1	NP_001269862.1	Q9BYN7	ZN341_HUMAN	zinc finger protein 341	56					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(3)|kidney(4)|large_intestine(3)|lung(8)|ovary(2)|prostate(3)|skin(1)|urinary_tract(3)	31						TTTCTCTGCGGGAAGTGTAAG	0.522																																																	0													79.0	77.0	77.0					20																	32332933		2203	4300	6503	SO:0001583	missense	0			AK027550	CCDS13227.1, CCDS74719.1	20q11.22	2013-01-08			ENSG00000131061	ENSG00000131061		"""Zinc fingers, C2H2-type"""	15992	protein-coding gene	gene with protein product							Standard	NM_001282933		Approved	dJ553F4.3	uc002wzx.3	Q9BYN7	OTTHUMG00000032275	ENST00000375200.1:c.167G>T	20.37:g.32332933G>T	ENSP00000364346:p.Gly56Val		A2RUF4|B2RXE5|B7ZM09|Q5JXM8|Q96ST5	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.G56V	ENST00000375200.1	37	c.167		20	.	.	.	.	.	.	.	.	.	.	G	29.6	5.018983	0.93404	.	.	ENSG00000131061	ENST00000342427;ENST00000375200	T;T	0.37915	1.17;1.17	5.58	5.58	0.84498	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (1);	0.000000	0.85682	D	0.000000	T	0.52517	0.1739	L	0.36672	1.1	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.43458	-0.9390	10	0.38643	T	0.18	-25.7077	19.5711	0.95419	0.0:0.0:1.0:0.0	.	56;56	Q9BYN7;Q9BYN7-2	ZN341_HUMAN;.	V	56	ENSP00000344308:G56V;ENSP00000364346:G56V	ENSP00000344308:G56V	G	+	2	0	ZNF341	31796594	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.365000	0.97139	2.638000	0.89438	0.563000	0.77884	GGG	ZNF341	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000131061		0.522	ZNF341-201	KNOWN	basic	protein_coding	ZNF341	HGNC	protein_coding		-	0.00	56	0	G			32332933	+1	tier1	-	no_errors	ENST00000375200	ensembl	human	known	74_37	missense	8.51	43	4	SNP	1.000	T
ZNF451	26036	genome.wustl.edu	37	6	57012272	57012272	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr6:57012272G>T	ENST00000370706.4	+	10	1633	c.1389G>T	c.(1387-1389)caG>caT	p.Q463H	ZNF451_ENST00000357489.3_Missense_Mutation_p.Q463H|RP11-203B9.4_ENST00000586432.1_RNA|RP11-203B9.4_ENST00000416069.2_RNA|RP11-203B9.4_ENST00000586668.1_RNA|ZNF451_ENST00000491832.2_Missense_Mutation_p.Q463H|RP11-203B9.4_ENST00000588811.1_RNA|RP11-203B9.4_ENST00000586053.1_RNA|RP11-203B9.4_ENST00000589549.1_RNA|RP11-203B9.4_ENST00000592038.1_RNA|RP11-203B9.4_ENST00000592500.1_RNA|RP11-203B9.4_ENST00000585792.1_RNA|RP11-203B9.4_ENST00000591553.1_RNA|RP11-203B9.4_ENST00000587815.1_RNA	NM_001031623.2	NP_001026794.1	Q9Y4E5	ZN451_HUMAN	zinc finger protein 451	463					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.Q463H(1)		central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(12)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	32	Lung NSC(77;0.145)		LUSC - Lung squamous cell carcinoma(124;0.0785)|Lung(124;0.13)			CTTGTGTCCAGAAAGAAAAAT	0.378																																																	1	Substitution - Missense(1)	large_intestine(1)											66.0	66.0	66.0					6																	57012272		2203	4299	6502	SO:0001583	missense	0			AB011148	CCDS4960.1, CCDS43477.1, CCDS59026.1	6p12.1	2012-08-08			ENSG00000112200	ENSG00000112200		"""Zinc fingers, C2H2-type"""	21091	protein-coding gene	gene with protein product		615708				9628581	Standard	NM_001031623		Approved	KIAA0576, COASTER, dJ417I1.1, KIAA1702	uc003pdm.2	Q9Y4E5	OTTHUMG00000014916	ENST00000370706.4:c.1389G>T	6.37:g.57012272G>T	ENSP00000359740:p.Gln463His		Q5VVE9|Q5VVF1|Q86YE4|Q8N380|Q8TD15|Q9C0G1|Q9NQM1	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.Q463H	ENST00000370706.4	37	c.1389	CCDS43477.1	6	.	.	.	.	.	.	.	.	.	.	G	9.531	1.110766	0.20714	.	.	ENSG00000112200	ENST00000370706;ENST00000357489;ENST00000491832	T;T;T	0.07114	3.22;3.22;3.22	5.3	3.17	0.36434	.	0.542263	0.19625	N	0.109819	T	0.06554	0.0168	M	0.63428	1.95	0.22888	N	0.99861	D;P;P;P	0.53151	0.958;0.855;0.883;0.855	P;P;B;P	0.51135	0.66;0.459;0.438;0.459	T	0.14172	-1.0482	10	0.56958	D	0.05	-13.1019	6.7931	0.23711	0.2397:0.1397:0.6205:0.0	.	463;463;463;463	Q9Y4E5-2;Q9Y4E5;E9PH99;Q4KMR5	.;ZN451_HUMAN;.;.	H	463	ENSP00000359740:Q463H;ENSP00000350083:Q463H;ENSP00000421645:Q463H	ENSP00000350083:Q463H	Q	+	3	2	ZNF451	57120231	0.873000	0.30073	0.403000	0.26384	0.728000	0.41692	2.748000	0.47483	1.231000	0.43661	-0.145000	0.13849	CAG	ZNF451	-	NULL	ENSG00000112200		0.378	ZNF451-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF451	HGNC	protein_coding	OTTHUMT00000041035.2		0.00	107	0	G	NM_015555		57012272	+1			no_errors	ENST00000370706	ensembl	human	known	74_37	missense	6.00	47	3	SNP	0.038	T
ZNF585B	92285	genome.wustl.edu	37	19	37677429	37677429	+	Missense_Mutation	SNP	T	T	C			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr19:37677429T>C	ENST00000532828.2	-	5	1261	c.1010A>G	c.(1009-1011)aAt>aGt	p.N337S	CTC-454I21.3_ENST00000585860.2_Intron|ZNF585B_ENST00000531805.1_Missense_Mutation_p.N282S|ZNF585B_ENST00000312908.5_5'UTR|ZNF585B_ENST00000527838.1_3'UTR	NM_152279.3	NP_689492.3	Q52M93	Z585B_HUMAN	zinc finger protein 585B	337					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(3)|endometrium(1)|large_intestine(9)|lung(13)|ovary(1)|prostate(1)	29			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			GTTGGAATTATTGCTGAAGAC	0.408																																					Melanoma(93;882 1454 18863 28917 48427)												0													168.0	153.0	158.0					19																	37677429		2203	4300	6503	SO:0001583	missense	0			AK027834	CCDS12500.1	19q13.13	2013-01-08				ENSG00000245680		"""Zinc fingers, C2H2-type"", ""-"""	30948	protein-coding gene	gene with protein product						12477932	Standard	NM_152279		Approved	FLJ14928, SZFP41	uc002ofq.3	Q52M93		ENST00000532828.2:c.1010A>G	19.37:g.37677429T>C	ENSP00000433773:p.Asn337Ser		Q8IZD3|Q96JW6	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.N337S	ENST00000532828.2	37	c.1010	CCDS12500.1	19	.	.	.	.	.	.	.	.	.	.	T	0.052	-1.247645	0.01469	.	.	ENSG00000245680	ENST00000531805;ENST00000532828	T;T	0.07216	3.21;3.21	2.93	-2.09	0.07232	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.809357	0.10398	N	0.679486	T	0.07908	0.0198	N	0.04203	-0.255	0.09310	N	0.999999	P;B	0.38767	0.646;0.004	P;B	0.61722	0.893;0.004	T	0.41378	-0.9512	10	0.20519	T	0.43	.	4.3313	0.11064	0.1628:0.416:0.0:0.4211	.	282;337	E9PQH3;Q52M93	.;Z585B_HUMAN	S	282;337	ENSP00000436774:N282S;ENSP00000433773:N337S	ENSP00000436774:N282S	N	-	2	0	ZNF585B	42369269	0.000000	0.05858	0.000000	0.03702	0.320000	0.28249	-1.819000	0.01716	-0.695000	0.05105	0.374000	0.22700	AAT	ZNF585B	-	pfscan_Znf_C2H2	ENSG00000245680		0.408	ZNF585B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF585B	HGNC	protein_coding	OTTHUMT00000388272.2	-	0.00	82	0	T	NM_152279		37677429	-1	tier1	-	no_errors	ENST00000532828	ensembl	human	known	74_37	missense	45.16	17	14	SNP	0.000	C
ZNF623	9831	genome.wustl.edu	37	8	144733632	144733632	+	Silent	SNP	G	G	T			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr8:144733632G>T	ENST00000501748.2	+	1	1679	c.1590G>T	c.(1588-1590)ggG>ggT	p.G530G	ZNF623_ENST00000526926.1_Silent_p.G490G|ZNF623_ENST00000458270.2_Silent_p.G490G	NM_014789.3	NP_055604	O75123	ZN623_HUMAN	zinc finger protein 623	530					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.G530G(1)		endometrium(2)|kidney(3)|large_intestine(6)|lung(11)|prostate(1)|stomach(1)|urinary_tract(3)	27	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;5.28e-40)|all cancers(56;5.23e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.146)			TAGATAAGGGGGAACACACAG	0.413																																																	1	Substitution - coding silent(1)	large_intestine(1)											65.0	68.0	67.0					8																	144733632		2203	4300	6503	SO:0001819	synonymous_variant	0			AB014528	CCDS34957.1, CCDS47931.1	8q24.3	2013-01-08				ENSG00000183309		"""Zinc fingers, C2H2-type"""	29084	protein-coding gene	gene with protein product						9734811	Standard	NM_014789		Approved	KIAA0628	uc003yzd.2	O75123		ENST00000501748.2:c.1590G>T	8.37:g.144733632G>T			A4FU80|B4DGP3|E7ENV5	Silent	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.G530	ENST00000501748.2	37	c.1590	CCDS34957.1	8																																																																																			ZNF623	-	NULL	ENSG00000183309		0.413	ZNF623-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF623	HGNC	protein_coding	OTTHUMT00000382522.3		0.00	83	0	G	NM_014789		144733632	+1			no_errors	ENST00000501748	ensembl	human	known	74_37	silent	6.67	56	4	SNP	0.001	T
ZNF626	199777	genome.wustl.edu	37	19	20808428	20808428	+	Silent	SNP	A	A	C			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr19:20808428A>C	ENST00000601440.1	-	4	401	c.255T>G	c.(253-255)ctT>ctG	p.L85L	CTC-513N18.7_ENST00000595094.1_lincRNA	NM_001076675.2	NP_001070143.1	Q68DY1	ZN626_HUMAN	zinc finger protein 626	85					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(1)|lung(3)|skin(1)	6						GCTCTGGCCAAAGGTCTTGGG	0.303																																																	0													48.0	54.0	52.0					19																	20808428		2168	4281	6449	SO:0001819	synonymous_variant	0			BC007116	CCDS32976.1, CCDS42535.1	19p13.11	2013-01-08				ENSG00000188171		"""Zinc fingers, C2H2-type"", ""-"""	30461	protein-coding gene	gene with protein product						12477932	Standard	NM_145297		Approved		uc002npb.1	Q68DY1		ENST00000601440.1:c.255T>G	19.37:g.20808428A>C			Q8N8T4|Q96QM1	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.L85	ENST00000601440.1	37	c.255	CCDS42535.1	19																																																																																			ZNF626	-	NULL	ENSG00000188171		0.303	ZNF626-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF626	HGNC	protein_coding	OTTHUMT00000447845.2	-	0.00	120	0	A	NM_145297		20808428	-1	tier1	-	no_errors	ENST00000601440	ensembl	human	known	74_37	silent	34.09	29	15	SNP	0.098	C
ZNF629	23361	genome.wustl.edu	37	16	30793915	30793915	+	Silent	SNP	G	G	A			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr16:30793915G>A	ENST00000262525.4	-	3	1941	c.1734C>T	c.(1732-1734)ttC>ttT	p.F578F	RP11-2C24.6_ENST00000575562.1_RNA	NM_001080417.1	NP_001073886.1	Q9UEG4	ZN629_HUMAN	zinc finger protein 629	578					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(3)|urinary_tract(1)	22			Colorectal(24;0.198)			CCTCGTCGTTGAAGCCCTTTC	0.637																																																	0													67.0	67.0	67.0					16																	30793915		2035	4156	6191	SO:0001819	synonymous_variant	0			AB002324	CCDS45463.1	16p11.2	2013-01-08				ENSG00000102870		"""Zinc fingers, C2H2-type"""	29008	protein-coding gene	gene with protein product			"""zinc finger protein 65"""	ZNF65		9205841	Standard	NM_001080417		Approved	KIAA0326	uc002dzs.1	Q9UEG4		ENST00000262525.4:c.1734C>T	16.37:g.30793915G>A			Q15938	Silent	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.F578	ENST00000262525.4	37	c.1734	CCDS45463.1	16																																																																																			ZNF629	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000102870		0.637	ZNF629-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF629	HGNC	protein_coding	OTTHUMT00000434291.1	-	0.00	43	0	G	NM_015309		30793915	-1	tier1	-	no_errors	ENST00000262525	ensembl	human	known	74_37	silent	25.00	18	6	SNP	1.000	A
ZNF709	163051	genome.wustl.edu	37	19	12576269	12576269	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr19:12576269C>A	ENST00000397732.3	-	4	638	c.467G>T	c.(466-468)cGa>cTa	p.R156L	ZNF709_ENST00000428311.1_Missense_Mutation_p.R156L|CTD-3105H18.18_ENST00000598753.1_Intron	NM_152601.3	NP_689814.1	Q8N972	ZN709_HUMAN	zinc finger protein 709	156					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			large_intestine(3)|upper_aerodigestive_tract(3)	6						TTCATGTATTCGAAATGAACT	0.353																																					GBM(33;565 669 12371 29134 51667)												0													82.0	86.0	85.0					19																	12576269		2183	4290	6473	SO:0001583	missense	0			AK095600	CCDS42504.1	19p13.2	2013-01-08			ENSG00000242852	ENSG00000242852		"""Zinc fingers, C2H2-type"", ""-"""	20629	protein-coding gene	gene with protein product							Standard	NM_152601		Approved	FLJ38281	uc002mtv.4	Q8N972	OTTHUMG00000156406	ENST00000397732.3:c.467G>T	19.37:g.12576269C>A	ENSP00000380840:p.Arg156Leu		A8K4E6	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,pfam_Znf_C2H2_jaz,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R156L	ENST00000397732.3	37	c.467	CCDS42504.1	19	.	.	.	.	.	.	.	.	.	.	C	11.09	1.536639	0.27475	.	.	ENSG00000242852;ENSG00000196826	ENST00000397732;ENST00000428311	T;T	0.07800	3.16;3.16	1.77	-2.59	0.06209	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.981184	0.08244	N	0.975706	T	0.05318	0.0141	N	0.05592	-0.015	0.09310	N	1	D	0.59767	0.986	P	0.54924	0.764	T	0.12553	-1.0543	10	0.07644	T	0.81	.	3.2615	0.06850	0.1957:0.4305:0.0:0.3737	.	156	Q8N972	ZN709_HUMAN	L	156	ENSP00000380840:R156L;ENSP00000404127:R156L	ENSP00000404127:R156L	R	-	2	0	ZNF709;CTD-2192J16.17	12437269	0.000000	0.05858	0.000000	0.03702	0.760000	0.43138	-1.395000	0.02516	-0.649000	0.05430	0.306000	0.20318	CGA	ZNF709	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000242852		0.353	ZNF709-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF709	HGNC	protein_coding	OTTHUMT00000344088.1		0.00	80	0	C	NM_152601		12576269	-1			no_errors	ENST00000397732	ensembl	human	known	74_37	missense	6.67	28	2	SNP	0.000	A
ZNF750	79755	genome.wustl.edu	37	17	80789490	80789490	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr17:80789490G>A	ENST00000269394.3	-	2	1674	c.841C>T	c.(841-843)Ccg>Tcg	p.P281S	TBCD_ENST00000539345.2_Intron|TBCD_ENST00000355528.4_Intron|ZNF750_ENST00000572562.1_Intron|TBCD_ENST00000397466.2_Intron	NM_024702.2	NP_078978.2	Q32MQ0	ZN750_HUMAN	zinc finger protein 750	281					cell differentiation (GO:0030154)|epidermis development (GO:0008544)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(3)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|large_intestine(4)|lung(12)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	31	Breast(20;0.000523)|all_neural(118;0.0779)	all_cancers(8;0.0514)|all_epithelial(8;0.0748)	OV - Ovarian serous cystadenocarcinoma(97;0.0868)|BRCA - Breast invasive adenocarcinoma(99;0.149)			AAGTGTCTCGGGTCTTGGGTT	0.592																																																	0													110.0	120.0	116.0					17																	80789490		2203	4300	6503	SO:0001583	missense	0			AK023903	CCDS11819.1	17q25.3	2008-05-02				ENSG00000141579			25843	protein-coding gene	gene with protein product		610226				16751772	Standard	NM_024702		Approved	FLJ13841, Zfp750	uc002kga.3	Q32MQ0		ENST00000269394.3:c.841C>T	17.37:g.80789490G>A	ENSP00000269394:p.Pro281Ser		Q9H899	Missense_Mutation	SNP	NULL	p.P281S	ENST00000269394.3	37	c.841	CCDS11819.1	17	.	.	.	.	.	.	.	.	.	.	G	15.09	2.730754	0.48939	.	.	ENSG00000141579	ENST00000269394	T	0.12984	2.63	5.34	5.34	0.76211	.	0.179199	0.38605	N	0.001640	T	0.10465	0.0256	N	0.22421	0.69	0.80722	D	1	B	0.32467	0.372	B	0.27796	0.083	T	0.23048	-1.0199	9	.	.	.	-8.2435	18.0265	0.89270	0.0:0.0:1.0:0.0	.	281	Q32MQ0	ZN750_HUMAN	S	281	ENSP00000269394:P281S	.	P	-	1	0	ZNF750	78382779	1.000000	0.71417	0.935000	0.37517	0.289000	0.27227	6.809000	0.75211	2.507000	0.84556	0.655000	0.94253	CCG	ZNF750	-	NULL	ENSG00000141579		0.592	ZNF750-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF750	HGNC	protein_coding	OTTHUMT00000439074.2	-	0.00	152	0	G	NM_024702		80789490	-1	tier1	-	no_errors	ENST00000269394	ensembl	human	known	74_37	missense	49.37	40	39	SNP	1.000	A
ZNF780B	163131	genome.wustl.edu	37	19	40540576	40540576	+	Silent	SNP	G	G	A	rs376431224		TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr19:40540576G>A	ENST00000434248.1	-	5	2255	c.2190C>T	c.(2188-2190)tgC>tgT	p.C730C	ZNF780B_ENST00000221355.6_Silent_p.C582C	NM_001005851.2	NP_001005851.1	Q9Y6R6	Z780B_HUMAN	zinc finger protein 780B	730					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|kidney(2)|large_intestine(3)|lung(12)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	23	all_cancers(60;9.55e-06)|all_lung(34;1.17e-07)|Lung NSC(34;1.41e-07)|Ovarian(47;0.0925)					AGGCCTTTCCGCATTCTTTAC	0.403																																																	0								G		1,4391	2.1+/-5.4	0,1,2195	57.0	62.0	60.0		2190	1.4	0.2	19		60	0,8594		0,0,4297	no	coding-synonymous	ZNF780B	NM_001005851.2		0,1,6492	AA,AG,GG		0.0,0.0228,0.0077		730/834	40540576	1,12985	2196	4297	6493	SO:0001819	synonymous_variant	0			AK127063	CCDS46077.1	19q13.2	2013-01-08	2006-08-15	2006-08-15	ENSG00000128000	ENSG00000128000		"""Zinc fingers, C2H2-type"", ""-"""	33109	protein-coding gene	gene with protein product			"""zinc finger protein 779"""	ZNF779			Standard	NM_001005851		Approved		uc002omu.3	Q9Y6R6	OTTHUMG00000155118	ENST00000434248.1:c.2190C>T	19.37:g.40540576G>A			B9EH00	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.C730	ENST00000434248.1	37	c.2190	CCDS46077.1	19																																																																																			ZNF780B	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000128000		0.403	ZNF780B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF780B	HGNC	protein_coding	OTTHUMT00000338466.1		0.00	84	0	G	NM_001005851		40540576	-1			no_errors	ENST00000434248	ensembl	human	known	74_37	silent	7.32	38	3	SNP	1.000	A
ZPLD1	131368	genome.wustl.edu	37	3	102187857	102187857	+	Missense_Mutation	SNP	C	C	T	rs147459423		TCGA-LN-A7HX-01A-11D-A33E-09	TCGA-LN-A7HX-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6873970b-b435-40cc-95a1-ed5d858dbef3	24122e83-d0d6-4e3c-9aaa-7d3edeae0b8e	g.chr3:102187857C>T	ENST00000491959.1	+	15	1693	c.811C>T	c.(811-813)Cgg>Tgg	p.R271W	ZPLD1_ENST00000306176.1_Missense_Mutation_p.R287W|ZPLD1_ENST00000466937.1_Missense_Mutation_p.R271W			Q8TCW7	ZPLD1_HUMAN	zona pellucida-like domain containing 1	271	ZP. {ECO:0000255|PROSITE- ProRule:PRU00375}.					integral component of membrane (GO:0016021)		p.R287W(1)		central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(18)|ovary(2)|skin(3)	35						CCGAAGCCAGCGGGGCCGGTT	0.473																																																	1	Substitution - Missense(1)	large_intestine(1)											74.0	75.0	75.0					3																	102187857		2203	4300	6503	SO:0001583	missense	0			AY090780	CCDS2947.1	3q12.3	2009-03-25			ENSG00000170044	ENSG00000170044			27022	protein-coding gene	gene with protein product		615915				18632209	Standard	NM_175056		Approved		uc003dvt.1	Q8TCW7	OTTHUMG00000159229	ENST00000491959.1:c.811C>T	3.37:g.102187857C>T	ENSP00000420265:p.Arg271Trp		Q49AS1|Q8WU36	Missense_Mutation	SNP	pfam_ZP_dom,smart_ZP_dom,pfscan_ZP_dom	p.R287W	ENST00000491959.1	37	c.859		3	.	.	.	.	.	.	.	.	.	.	C	20.7	4.040659	0.75732	.	.	ENSG00000170044	ENST00000491959;ENST00000306176;ENST00000466937	D;D;D	0.82893	-1.66;-1.66;-1.66	5.47	4.59	0.56863	Zona pellucida sperm-binding protein (3);	0.401538	0.28828	N	0.014011	T	0.78824	0.4344	L	0.38175	1.15	0.31381	N	0.679055	P;D	0.53619	0.924;0.961	B;P	0.49301	0.34;0.606	T	0.79427	-0.1808	10	0.49607	T	0.09	-11.9781	7.7632	0.28965	0.2651:0.6531:0.0:0.0818	.	287;271	Q8TCW7-2;Q8TCW7	.;ZPLD1_HUMAN	W	271;287;271	ENSP00000420265:R271W;ENSP00000307801:R287W;ENSP00000418253:R271W	ENSP00000307801:R287W	R	+	1	2	ZPLD1	103670547	1.000000	0.71417	0.863000	0.33907	0.961000	0.63080	4.658000	0.61497	1.313000	0.45069	0.462000	0.41574	CGG	ZPLD1	-	pfam_ZP_dom,smart_ZP_dom,pfscan_ZP_dom	ENSG00000170044		0.473	ZPLD1-001	KNOWN	basic|appris_principal	protein_coding	ZPLD1	HGNC	protein_coding	OTTHUMT00000353984.1		0.00	73	0	C	NM_175056		102187857	+1			no_errors	ENST00000306176	ensembl	human	known	74_37	missense	5.56	34	2	SNP	1.000	T
