#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name	i_deletion_substructures	i_domain	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_header	i_normal_VAF	i_normal_ref_reads	i_normal_var_reads	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_tier	i_title	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_VAF	i_tumor_ref_reads	i_tumor_var_reads	i_type	i_ucsc_cons	i_variant
AASDH	132949	genome.wustl.edu	37	4	57220226	57220226	+	Silent	SNP	A	A	G			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr4:57220226A>G	ENST00000205214.6	-	8	1542	c.1362T>C	c.(1360-1362)ctT>ctC	p.L454L	AASDH_ENST00000510762.1_5'Flank|AASDH_ENST00000513376.1_Silent_p.L354L|AASDH_ENST00000502617.1_Silent_p.L454L|AASDH_ENST00000434343.2_Intron|AASDH_ENST00000602986.1_Silent_p.L301L|AASDH_ENST00000451613.1_Silent_p.L454L	NM_181806.2	NP_861522.2	Q4L235	ACSF4_HUMAN	aminoadipate-semialdehyde dehydrogenase	454					fatty acid metabolic process (GO:0006631)		acid-thiol ligase activity (GO:0016878)|ATP binding (GO:0005524)			endometrium(2)|kidney(2)|large_intestine(8)|lung(17)|ovary(4)|prostate(3)|skin(2)|stomach(1)|urinary_tract(1)	40	Glioma(25;0.08)|all_neural(26;0.101)	all_hematologic(202;0.0017)				GTTCAATGTTAAGACGTTTGC	0.383																																																	0													93.0	86.0	89.0					4																	57220226		2202	4300	6502	SO:0001819	synonymous_variant	0			AF516672	CCDS3504.1, CCDS68705.1, CCDS68706.1, CCDS75126.1, CCDS75127.1	4q12	2010-12-14			ENSG00000157426	ENSG00000157426	1.2.1.31	"""Acyl-CoA synthetase family"""	23993	protein-coding gene	gene with protein product	"""acyl-CoA synthetase family member 4"""	614365				15865210, 12712191, 17762044	Standard	XM_005265721		Approved	NRPS998, LYS2, ACSF4	uc003hbn.3	Q4L235	OTTHUMG00000128841	ENST00000205214.6:c.1362T>C	4.37:g.57220226A>G			A5D8V3|A5PL22|Q63HK2|Q63HR7|Q6IPP8|Q6TFZ6|Q7Z5Y3|Q96BW4|Q9P064	Silent	SNP	pfam_AMP-dep_Synth/Lig,pfam_Acyl_carrier_prot-like,superfamily_Quinonprotein_ADH-like_supfam,superfamily_Acyl_carrier_prot-like,smart_PQQ_beta_propeller_repeat,pfscan_Acyl_carrier_prot-like	p.L454	ENST00000205214.6	37	c.1362	CCDS3504.1	4																																																																																			AASDH	-	pfam_AMP-dep_Synth/Lig	ENSG00000157426		0.383	AASDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AASDH	HGNC	protein_coding	OTTHUMT00000250780.1		0.00	65	0	A	NM_181806		57220226	-1			no_errors	ENST00000205214	ensembl	human	known	74_37	silent	6.67	56	4	SNP	0.996	G
ACACA	31	genome.wustl.edu	37	17	35581952	35581952	+	Silent	SNP	A	A	T			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr17:35581952A>T	ENST00000394406.2	-	27	3514	c.3324T>A	c.(3322-3324)atT>atA	p.I1108I	ACACA_ENST00000335166.5_Silent_p.I1030I|ACACA_ENST00000360679.3_Silent_p.I1050I|ACACA_ENST00000353139.5_Silent_p.I1145I	NM_198836.1	NP_942133.1	Q13085	ACACA_HUMAN	acetyl-CoA carboxylase alpha	1108					acetyl-CoA metabolic process (GO:0006084)|biotin metabolic process (GO:0006768)|carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|lipid homeostasis (GO:0055088)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|malonyl-CoA biosynthetic process (GO:2001295)|multicellular organismal protein metabolic process (GO:0044268)|positive regulation of cellular metabolic process (GO:0031325)|protein homotetramerization (GO:0051289)|small molecule metabolic process (GO:0044281)|tissue homeostasis (GO:0001894)|triglyceride biosynthetic process (GO:0019432)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	acetyl-CoA carboxylase activity (GO:0003989)|ATP binding (GO:0005524)|biotin carboxylase activity (GO:0004075)|metal ion binding (GO:0046872)			NS(2)|breast(5)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(24)|lung(23)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	83		Breast(25;0.00157)|Ovarian(249;0.15)			Biotin(DB00121)	CATACATGTCAATAGCTGATA	0.378																																					Colon(23;82 258 739 2117 10493 24037 27661 34815 35438 36249)												0													118.0	108.0	111.0					17																	35581952		2203	4300	6503	SO:0001819	synonymous_variant	0			U19822	CCDS11317.1, CCDS11318.1, CCDS42302.1, CCDS42303.1	17q21	2014-05-06	2010-04-30		ENSG00000132142	ENSG00000278540	6.4.1.2		84	protein-coding gene	gene with protein product	"""acetyl-CoA carboxylase 1"""	200350	"""acetyl-Coenzyme A carboxylase alpha"""	ACAC, ACC			Standard	NM_198837		Approved	ACC1	uc002hno.3	Q13085	OTTHUMG00000188463	ENST00000394406.2:c.3324T>A	17.37:g.35581952A>T			B2RP68|Q6KEV6|Q6XDA8|Q7Z2G8|Q7Z561|Q7Z563|Q7Z564|Q86WB2|Q86WB3	Silent	SNP	pfam_AcCoA_COase_cen,pfam_Carboxyl_trans,pfam_CbamoylP_synth_lsu-like_ATP-bd,pfam_CarbamoylP_synth_lsu_N,pfam_Biotin_COase_C,pfam_Biotin_lipoyl,pfam_Dala_Dala_lig_C,pfam_ATP-grasp_carboxylate-amine,superfamily_PreATP-grasp_dom,superfamily_Rudment_hybrid_motif,superfamily_Single_hybrid_motif,smart_Biotin_COase_C,pfscan_ATP-grasp,pfscan_Biotin_carboxylation_dom,pfscan_COA_CT_N,pfscan_COA_CT_C,pfscan_Biotin_lipoyl	p.I1145	ENST00000394406.2	37	c.3435	CCDS11317.1	17																																																																																			ACACA	-	pfam_AcCoA_COase_cen	ENSG00000132142		0.378	ACACA-009	KNOWN	basic|appris_principal|CCDS	protein_coding	ACACA	HGNC	protein_coding	OTTHUMT00000256696.1	-	0.00	70	0	A	NM_198836		35581952	-1	tier1	-	no_errors	ENST00000353139	ensembl	human	known	74_37	silent	6.45	58	4	SNP	1.000	T
ACSL3	2181	genome.wustl.edu	37	2	223791822	223791822	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr2:223791822G>T	ENST00000357430.3	+	12	1911	c.1380G>T	c.(1378-1380)caG>caT	p.Q460H	ACSL3_ENST00000392066.3_Missense_Mutation_p.Q460H	NM_004457.3	NP_004448.2	O95573	ACSL3_HUMAN	acyl-CoA synthetase long-chain family member 3	460					brain development (GO:0007420)|fatty acid biosynthetic process (GO:0006633)|long-chain fatty acid import (GO:0044539)|positive regulation of Golgi to plasma membrane protein transport (GO:0042998)|positive regulation of phosphatidylcholine biosynthetic process (GO:2001247)|positive regulation of secretion (GO:0051047)|response to nutrient (GO:0007584)|response to organic cyclic compound (GO:0014070)|very-low-density lipoprotein particle assembly (GO:0034379)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lipid particle (GO:0005811)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|perinuclear region of cytoplasm (GO:0048471)|peroxisome (GO:0005777)	ATP binding (GO:0005524)|long-chain fatty acid-CoA ligase activity (GO:0004467)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			cervix(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(5)|ovary(2)|prostate(1)|skin(2)	22		Renal(207;0.0183)		Epithelial(121;1.28e-10)|all cancers(144;8.06e-08)|Lung(261;0.00834)|LUSC - Lung squamous cell carcinoma(224;0.00864)	Icosapent(DB00159)	CAACCACGCAGCGATTCATGA	0.483			T	ETV1	prostate																																			Dom	yes		2	2q36	2181	acyl-CoA synthetase long-chain family member 3		E	0													129.0	119.0	122.0					2																	223791822		2203	4300	6503	SO:0001583	missense	0			D89053	CCDS2455.1	2q34-q35	2008-02-05	2004-02-19	2004-02-20	ENSG00000123983	ENSG00000123983		"""Acyl-CoA synthetase family"""	3570	protein-coding gene	gene with protein product		602371	"""fatty-acid-Coenzyme A ligase, long-chain 3"""	FACL3			Standard	NM_004457		Approved	ACS3, PRO2194	uc002vnj.3	O95573	OTTHUMG00000133160	ENST00000357430.3:c.1380G>T	2.37:g.223791822G>T	ENSP00000350012:p.Gln460His		Q60I92|Q8IUM9	Missense_Mutation	SNP	pfam_AMP-dep_Synth/Lig	p.Q460H	ENST00000357430.3	37	c.1380	CCDS2455.1	2	.	.	.	.	.	.	.	.	.	.	G	13.08	2.131220	0.37630	.	.	ENSG00000123983	ENST00000357430;ENST00000392066	T;T	0.41400	1.0;1.0	5.88	5.01	0.66863	AMP-dependent synthetase/ligase (1);	0.000000	0.85682	D	0.000000	T	0.44435	0.1293	M	0.67517	2.055	0.80722	D	1	B	0.31730	0.337	B	0.36766	0.232	T	0.36065	-0.9763	10	0.33940	T	0.23	-13.3487	12.0077	0.53270	0.1384:0.0:0.8616:0.0	.	460	O95573	ACSL3_HUMAN	H	460	ENSP00000350012:Q460H;ENSP00000375918:Q460H	ENSP00000350012:Q460H	Q	+	3	2	ACSL3	223500066	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	5.789000	0.69029	1.501000	0.48654	0.591000	0.81541	CAG	ACSL3	-	pfam_AMP-dep_Synth/Lig	ENSG00000123983		0.483	ACSL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACSL3	HGNC	protein_coding	OTTHUMT00000256862.2	-	0.00	56	0	G	NM_004457		223791822	+1	tier1	-	no_errors	ENST00000357430	ensembl	human	known	74_37	missense	51.28	19	20	SNP	1.000	T
ACTB	60	genome.wustl.edu	37	7	5568131	5568131	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr7:5568131C>T	ENST00000331789.5	-	4	774	c.583G>A	c.(583-585)Gag>Aag	p.E195K	ACTB_ENST00000464611.1_5'Flank|AC006483.1_ENST00000579427.1_RNA	NM_001101.3	NP_001092.1	P63261	ACTG_HUMAN	actin, beta	195					adherens junction organization (GO:0034332)|axon guidance (GO:0007411)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cellular component movement (GO:0006928)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|membrane organization (GO:0061024)|platelet aggregation (GO:0070527)|retina homeostasis (GO:0001895)|sarcomere organization (GO:0045214)	blood microparticle (GO:0072562)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|membrane (GO:0016020)|myofibril (GO:0030016)|nucleus (GO:0005634)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|central_nervous_system(1)|large_intestine(2)|lung(2)|prostate(2)	8		Ovarian(82;0.0606)		UCEC - Uterine corpus endometrioid carcinoma (126;0.175)|OV - Ovarian serous cystadenocarcinoma(56;4.24e-37)		TAGCCGCGCTCGGTGAGGATC	0.612																																																	0													56.0	56.0	56.0					7																	5568131		2203	4299	6502	SO:0001583	missense	0			M28424	CCDS5341.1	7p22	2014-09-17			ENSG00000075624	ENSG00000075624			132	protein-coding gene	gene with protein product		102630				1505215	Standard	NM_001101		Approved		uc003sot.4	P60709	OTTHUMG00000023268	ENST00000331789.5:c.583G>A	7.37:g.5568131C>T	ENSP00000349960:p.Glu195Lys		A8K7C2|P02571|P14104|P99022|Q5U032|Q96E67	Missense_Mutation	SNP	pfam_Actin-related,smart_Actin-related,prints_Actin-related	p.E195K	ENST00000331789.5	37	c.583	CCDS5341.1	7	.	.	.	.	.	.	.	.	.	.	C	12.51	1.958525	0.34565	.	.	ENSG00000075624	ENST00000331789;ENST00000445914;ENST00000400179;ENST00000320713	D	0.94376	-3.41	5.55	3.73	0.42828	.	0.000000	0.56097	U	0.000028	D	0.94328	0.8177	M	0.70275	2.135	0.44309	D	0.997183	B	0.27625	0.183	P	0.44897	0.463	D	0.93816	0.7114	10	0.87932	D	0	.	10.6607	0.45700	0.0:0.8386:0.0:0.1614	.	195	P60709	ACTB_HUMAN	K	195;171;167;114	ENSP00000349960:E195K	ENSP00000440549:E114K	E	-	1	0	ACTB	5534657	1.000000	0.71417	0.853000	0.33588	0.654000	0.38779	4.708000	0.61859	1.358000	0.45922	-0.141000	0.14075	GAG	ACTB	-	pfam_Actin-related,smart_Actin-related	ENSG00000075624		0.612	ACTB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACTB	HGNC	protein_coding	OTTHUMT00000059589.4	-	0.00	102	0	C	NM_001101		5568131	-1	tier1	-	no_errors	ENST00000331789	ensembl	human	known	74_37	missense	28.24	61	24	SNP	0.993	T
ACY1	95	genome.wustl.edu	37	3	52020476	52020476	+	Missense_Mutation	SNP	G	G	T	rs202098129		TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr3:52020476G>T	ENST00000404366.2	+	7	628	c.482G>T	c.(481-483)cGg>cTg	p.R161L	ACY1_ENST00000476351.1_Missense_Mutation_p.R126L|ACY1_ENST00000476854.1_Missense_Mutation_p.R161L|ACY1_ENST00000494103.1_Intron|ABHD14A-ACY1_ENST00000463937.1_Missense_Mutation_p.R262L|ACY1_ENST00000458031.2_Missense_Mutation_p.R251L	NM_000666.2|NM_001198895.1	NP_000657.1|NP_001185824.1	Q03154	ACY1_HUMAN	aminoacylase 1	161					cellular amino acid metabolic process (GO:0006520)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	aminoacylase activity (GO:0004046)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)	p.R161Q(1)		breast(1)|endometrium(1)|large_intestine(3)|lung(4)|ovary(1)|skin(1)	11				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.000534)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)	Acetylcysteine(DB06151)|L-Aspartic Acid(DB00128)	TTCGTGCAGCGGCCTGAGTTC	0.632																																																	1	Substitution - Missense(1)	endometrium(1)											47.0	47.0	47.0					3																	52020476		2203	4299	6502	SO:0001583	missense	0			L07548	CCDS2844.1, CCDS56261.1, CCDS56262.1, CCDS56263.1	3p21.2	2006-02-02			ENSG00000243989	ENSG00000243989	3.5.1.14		177	protein-coding gene	gene with protein product		104620				1707030, 6948533	Standard	NM_000666		Approved		uc003dcq.3	Q03154	OTTHUMG00000157815	ENST00000404366.2:c.482G>T	3.37:g.52020476G>T	ENSP00000384296:p.Arg161Leu		C9J6I6|C9J9D8|C9JWD4	Missense_Mutation	SNP	pfam_Peptidase_M20,pfam_Peptidase_M20_dimer,superfamily_Peptidase_M20_dimer,tigrfam_N-acyl_aa_amidohydrolase	p.R251L	ENST00000404366.2	37	c.752	CCDS2844.1	3	.	.	.	.	.	.	.	.	.	.	G	15.24	2.773784	0.49786	.	.	ENSG00000114786;ENSG00000114786;ENSG00000114786;ENSG00000243989;ENSG00000243989;ENSG00000243989;ENSG00000243989	ENST00000458031;ENST00000463937;ENST00000232907;ENST00000476854;ENST00000476351;ENST00000404366;ENST00000469863	T;T;T;T;T;T	0.51817	0.69;0.69;0.69;0.69;0.69;0.69	5.41	4.54	0.55810	.	0.127254	0.53938	D	0.000054	T	0.32585	0.0834	L	0.41906	1.305	0.32897	D	0.512642	B;P;B	0.35456	0.012;0.502;0.113	B;B;B	0.25884	0.021;0.064;0.021	T	0.45396	-0.9264	10	0.27082	T	0.32	-1.7827	10.0494	0.42205	0.155:0.0:0.845:0.0	.	161;251;161	B4DPC3;B4DNW0;Q03154	.;.;ACY1_HUMAN	L	251;262;161;161;126;161;170	ENSP00000390557:R251L;ENSP00000420487:R262L;ENSP00000419262:R161L;ENSP00000417056:R126L;ENSP00000384296:R161L;ENSP00000419830:R170L	ENSP00000384296:R161L	R	+	2	0	ACY1;RP11-155D18.11	51995516	1.000000	0.71417	0.796000	0.32109	0.910000	0.53928	3.609000	0.54117	1.287000	0.44583	-0.136000	0.14681	CGG	ACY1	-	pfam_Peptidase_M20,tigrfam_N-acyl_aa_amidohydrolase	ENSG00000243989		0.632	ACY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACY1	HGNC	protein_coding	OTTHUMT00000349657.1		0.00	107	0	G	NM_000666		52020476	+1			no_errors	ENST00000458031	ensembl	human	known	74_37	missense	6.38	44	3	SNP	0.999	T
ADAM18	8749	genome.wustl.edu	37	8	39466616	39466616	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr8:39466616C>A	ENST00000265707.5	+	4	289	c.244C>A	c.(244-246)Cat>Aat	p.H82N	ADAM18_ENST00000379866.1_Missense_Mutation_p.H82N|ADAM18_ENST00000520772.1_Missense_Mutation_p.H82N|ADAM18_ENST00000541111.1_5'UTR	NM_014237.2	NP_055052.1	Q9Y3Q7	ADA18_HUMAN	ADAM metallopeptidase domain 18	82					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(2)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(31)|ovary(1)|prostate(1)|skin(12)|stomach(1)|upper_aerodigestive_tract(3)	71		all_cancers(7;1.32e-05)|all_epithelial(6;3.08e-10)|all_lung(54;0.00187)|Hepatocellular(245;0.00745)|Lung NSC(58;0.00769)|Breast(189;0.0112)	LUSC - Lung squamous cell carcinoma(45;0.000199)			TGGATCTTTGCATTCTGTGTC	0.259																																																	0													56.0	59.0	58.0					8																	39466616		2198	4287	6485	SO:0001583	missense	0			AJ133004	CCDS6113.1, CCDS55225.1	8p11.22	2008-08-07	2005-08-18		ENSG00000168619	ENSG00000168619		"""ADAM metallopeptidase domain containing"""	196	protein-coding gene	gene with protein product			"""a disintegrin and metalloproteinase domain 18"""			12200459	Standard	NM_014237		Approved	tMDCIII, ADAM27	uc003xni.3	Q9Y3Q7	OTTHUMG00000164040	ENST00000265707.5:c.244C>A	8.37:g.39466616C>A	ENSP00000265707:p.His82Asn		B2R9Y0|Q0VAI4|Q6IRW9|Q6UXJ9	Missense_Mutation	SNP	pfam_Peptidase_M12B,pfam_Peptidase_M12B_N,pfam_ADAM_Cys-rich,pfam_Blood-coag_inhib_Disintegrin,superfamily_Blood-coag_inhib_Disintegrin,smart_Blood-coag_inhib_Disintegrin,smart_ADAM_Cys-rich,pfscan_Blood-coag_inhib_Disintegrin,pfscan_Peptidase_M12B	p.H82N	ENST00000265707.5	37	c.244	CCDS6113.1	8	.	.	.	.	.	.	.	.	.	.	C	0.003	-2.457856	0.00173	.	.	ENSG00000168619	ENST00000265707;ENST00000379866;ENST00000520772;ENST00000522198	T;T;T	0.05649	3.41;3.41;3.41	5.09	1.04	0.20106	Peptidase M12B, propeptide (1);	0.306566	0.23883	N	0.043635	T	0.04815	0.0130	L	0.35644	1.08	0.09310	N	0.999997	B;B;B	0.24882	0.004;0.005;0.113	B;B;B	0.30401	0.022;0.038;0.115	T	0.37502	-0.9703	10	0.27082	T	0.32	.	3.2216	0.06717	0.1855:0.5139:0.0:0.3006	.	82;82;82	Q9Y3Q7-2;Q9Y3Q7;Q6IRW9	.;ADA18_HUMAN;.	N	82;82;82;38	ENSP00000265707:H82N;ENSP00000369195:H82N;ENSP00000429908:H82N	ENSP00000265707:H82N	H	+	1	0	ADAM18	39585773	0.001000	0.12720	0.036000	0.18154	0.140000	0.21249	0.047000	0.14056	0.401000	0.25424	0.655000	0.94253	CAT	ADAM18	-	pfam_Peptidase_M12B_N	ENSG00000168619		0.259	ADAM18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAM18	HGNC	protein_coding	OTTHUMT00000376916.1	-	0.00	34	0	C	NM_014237		39466616	+1	tier1	-	no_errors	ENST00000265707	ensembl	human	known	74_37	missense	41.67	14	10	SNP	0.006	A
ADAMTS18	170692	genome.wustl.edu	37	16	77327044	77327044	+	Nonsense_Mutation	SNP	G	G	A			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr16:77327044G>A	ENST00000282849.5	-	20	3536	c.3118C>T	c.(3118-3120)Cag>Tag	p.Q1040*	RP11-538I12.3_ENST00000561672.1_RNA	NM_199355.2	NP_955387.1	Q8TE60	ATS18_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 18	1040	TSP type-1 3. {ECO:0000255|PROSITE- ProRule:PRU00210}.				eye development (GO:0001654)|negative regulation of platelet aggregation (GO:0090331)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.Q1040K(1)		NS(1)|breast(5)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(9)|large_intestine(26)|lung(44)|ovary(2)|pancreas(1)|prostate(1)|skin(19)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	118						CAGCCCTCCTGCAGCTCAGGT	0.607																																																	1	Substitution - Missense(1)	haematopoietic_and_lymphoid_tissue(1)											85.0	80.0	82.0					16																	77327044		2198	4300	6498	SO:0001587	stop_gained	0			AJ311903	CCDS10926.1	16q23	2008-07-29	2005-08-19		ENSG00000140873	ENSG00000140873		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17110	protein-coding gene	gene with protein product		607512	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 18"""	ADAMTS21		11867212, 17546048	Standard	NM_199355		Approved		uc002ffc.4	Q8TE60	OTTHUMG00000137619	ENST00000282849.5:c.3118C>T	16.37:g.77327044G>A	ENSP00000282849:p.Gln1040*		Q6P4R5|Q6ZWJ9	Nonsense_Mutation	SNP	pfam_Peptidase_M12B_N,pfam_ADAM_spacer1,pfam_Thrombospondin_1_rpt,pfam_Peptidase_M12B,pfam_PLAC,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Peptidase_M12B_ADAM-TS	p.Q1040*	ENST00000282849.5	37	c.3118	CCDS10926.1	16	.	.	.	.	.	.	.	.	.	.	G	41	9.103688	0.99066	.	.	ENSG00000140873	ENST00000282849	.	.	.	6.16	5.2	0.72013	.	0.123859	0.56097	D	0.000032	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.32370	T	0.25	.	13.726	0.62759	0.0:0.0:0.7196:0.2804	.	.	.	.	X	1040	.	ENSP00000282849:Q1040X	Q	-	1	0	ADAMTS18	75884545	1.000000	0.71417	0.899000	0.35326	0.000000	0.00434	7.127000	0.77210	1.603000	0.50134	-0.188000	0.12872	CAG	ADAMTS18	-	superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	ENSG00000140873		0.607	ADAMTS18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS18	HGNC	protein_coding	OTTHUMT00000269037.1		0.00	34	0	G			77327044	-1			no_errors	ENST00000282849	ensembl	human	known	74_37	nonsense	7.69	36	3	SNP	0.993	A
ADAMTS20	80070	genome.wustl.edu	37	12	43858461	43858461	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr12:43858461G>A	ENST00000389420.3	-	10	1441	c.1442C>T	c.(1441-1443)tCa>tTa	p.S481L	ADAMTS20_ENST00000553158.1_Missense_Mutation_p.S481L	NM_025003.3	NP_079279.3	P59510	ATS20_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 20	481	Disintegrin.				extracellular matrix organization (GO:0030198)|negative regulation of apoptotic process (GO:0043066)|positive regulation of melanocyte differentiation (GO:0045636)|positive regulation of signal transduction (GO:0009967)	extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.S481L(2)		breast(1)|central_nervous_system(6)|endometrium(3)|kidney(4)|large_intestine(11)|liver(1)|lung(43)|ovary(4)|pancreas(3)|prostate(5)|skin(12)|upper_aerodigestive_tract(1)|urinary_tract(1)	95	all_cancers(12;2.6e-05)|Lung SC(27;0.184)	Lung NSC(34;0.0569)|all_lung(34;0.129)		GBM - Glioblastoma multiforme(48;0.0473)		ATCATATCGTGATCCAGGAAG	0.378																																																	2	Substitution - Missense(2)	skin(2)											112.0	104.0	107.0					12																	43858461		2203	4300	6503	SO:0001583	missense	0			AF488804	CCDS31778.2	12q12	2005-08-19	2005-08-19			ENSG00000173157		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17178	protein-coding gene	gene with protein product		611681	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 20"""			12514189, 12562771	Standard	NM_025003		Approved	GON-1	uc010skx.2	P59510		ENST00000389420.3:c.1442C>T	12.37:g.43858461G>A	ENSP00000374071:p.Ser481Leu		A6NNC9|J3QT00	Missense_Mutation	SNP	pfam_Pept_M12B_GON-ADAMTSs,pfam_Thrombospondin_1_rpt,pfam_Peptidase_M12B_N,pfam_ADAM_spacer1,pfam_Peptidase_M12B,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Pept_M12B_GON-ADAMTSs,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Peptidase_M12B_ADAM-TS	p.S481L	ENST00000389420.3	37	c.1442	CCDS31778.2	12	.	.	.	.	.	.	.	.	.	.	G	2.368	-0.345101	0.05208	.	.	ENSG00000173157	ENST00000389420;ENST00000553158;ENST00000389417	T;T	0.03553	3.89;3.89	4.75	-0.122	0.13531	Metallopeptidase, catalytic domain (1);	0.629156	0.13197	N	0.406244	T	0.01661	0.0053	N	0.02658	-0.545	0.09310	N	0.999993	B	0.02656	0.0	B	0.04013	0.001	T	0.48387	-0.9040	10	0.23891	T	0.37	.	10.2452	0.43336	0.5341:0.0:0.4659:0.0	.	481	P59510	ATS20_HUMAN	L	481	ENSP00000374071:S481L;ENSP00000448341:S481L	ENSP00000374068:S481L	S	-	2	0	ADAMTS20	42144728	0.025000	0.19082	0.149000	0.22428	0.066000	0.16364	1.493000	0.35605	0.069000	0.16605	-0.469000	0.05056	TCA	ADAMTS20	-	NULL	ENSG00000173157		0.378	ADAMTS20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS20	HGNC	protein_coding	OTTHUMT00000403643.1		0.00	75	0	G	NM_025003		43858461	-1			no_errors	ENST00000389420	ensembl	human	known	74_37	missense	5.00	38	2	SNP	0.014	A
ADNP2	22850	genome.wustl.edu	37	18	77896383	77896383	+	Silent	SNP	T	T	C			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr18:77896383T>C	ENST00000262198.4	+	4	3542	c.3087T>C	c.(3085-3087)ccT>ccC	p.P1029P		NM_014913.3	NP_055728.1	Q6IQ32	ADNP2_HUMAN	ADNP homeobox 2	1029					cellular response to oxidative stress (GO:0034599)|cellular response to retinoic acid (GO:0071300)|negative regulation of cell death (GO:0060548)|neuron differentiation (GO:0030182)|positive regulation of cell growth (GO:0030307)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(9)|liver(1)|lung(15)|ovary(5)|prostate(2)	42		all_cancers(4;1.06e-15)|all_epithelial(4;2.36e-10)|all_lung(4;0.000302)|Lung NSC(4;0.000518)|Esophageal squamous(42;0.0212)|Ovarian(4;0.0256)|all_hematologic(56;0.15)|Melanoma(33;0.2)		Epithelial(2;1.1e-11)|OV - Ovarian serous cystadenocarcinoma(15;7.54e-09)|BRCA - Breast invasive adenocarcinoma(31;0.00247)|STAD - Stomach adenocarcinoma(84;0.164)		CAGAGGGACCTATTGTCAAGG	0.418																																																	0													49.0	54.0	53.0					18																	77896383		2201	4299	6500	SO:0001819	synonymous_variant	0			AB020670	CCDS32853.1	18q23	2013-01-07	2007-07-17	2007-07-17	ENSG00000101544	ENSG00000101544		"""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	23803	protein-coding gene	gene with protein product			"""zinc finger protein 508"""	ZNF508			Standard	NM_014913		Approved	KIAA0863	uc002lnw.3	Q6IQ32	OTTHUMG00000172535	ENST00000262198.4:c.3087T>C	18.37:g.77896383T>C			A8K951|O94943|Q9H9P3	Silent	SNP	superfamily_Homeodomain-like,smart_Znf_C2H2-like,smart_Homeobox_dom,pfscan_Znf_C2H2	p.P1029	ENST00000262198.4	37	c.3087	CCDS32853.1	18																																																																																			ADNP2	-	NULL	ENSG00000101544		0.418	ADNP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADNP2	HGNC	protein_coding	OTTHUMT00000418979.1	-	0.00	121	0	T	NM_014913		77896383	+1	tier1	-	no_errors	ENST00000262198	ensembl	human	known	74_37	silent	7.84	47	4	SNP	0.000	C
AGO2	27161	genome.wustl.edu	37	8	141561493	141561493	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr8:141561493G>A	ENST00000220592.5	-	11	1424	c.1312C>T	c.(1312-1314)Cgg>Tgg	p.R438W	AGO2_ENST00000519980.1_Missense_Mutation_p.R438W	NM_012154.3	NP_036286.2	Q9UKV8	AGO2_HUMAN	argonaute RISC catalytic component 2	438					epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|innate immune response (GO:0045087)|mRNA cleavage involved in gene silencing by miRNA (GO:0035279)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|negative regulation of translational initiation (GO:0045947)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|post-embryonic development (GO:0009791)|pre-miRNA processing (GO:0031054)|regulation of transcription, DNA-templated (GO:0006355)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|transcription, DNA-templated (GO:0006351)|translation (GO:0006412)|translational initiation (GO:0006413)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|membrane (GO:0016020)|micro-ribonucleoprotein complex (GO:0035068)|mRNA cap binding complex (GO:0005845)|nucleus (GO:0005634)|polysome (GO:0005844)|ribonucleoprotein complex (GO:0030529)|RISC complex (GO:0016442)	endoribonuclease activity (GO:0004521)|endoribonuclease activity, cleaving siRNA-paired mRNA (GO:0070551)|metal ion binding (GO:0046872)|miRNA binding (GO:0035198)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|RNA 7-methylguanosine cap binding (GO:0000340)|siRNA binding (GO:0035197)|translation initiation factor activity (GO:0003743)	p.R438W(2)									TGCTTGTTCCGCATGTCCCAG	0.532																																																	2	Substitution - Missense(2)	urinary_tract(1)|lung(1)											92.0	87.0	89.0					8																	141561493		2203	4300	6503	SO:0001583	missense	0			AF121255	CCDS6380.1, CCDS55279.1	8q24.3	2013-02-15	2013-02-15	2013-02-15	ENSG00000123908	ENSG00000123908		"""Argonaute/PIWI family"""	3263	protein-coding gene	gene with protein product	"""argonaute 2"""	606229	"""eukaryotic translation initiation factor 2C, 2"""	EIF2C2		10534406, 12906857	Standard	NM_012154		Approved	hAGO2, Q10	uc003yvn.3	Q9UKV8	OTTHUMG00000164232	ENST00000220592.5:c.1312C>T	8.37:g.141561493G>A	ENSP00000220592:p.Arg438Trp		Q8TCZ5|Q8WV58|Q96ID1	Missense_Mutation	SNP	pfam_Piwi,pfam_PAZ_dom,pfam_DUF1785,superfamily_RNaseH-like_dom,superfamily_PAZ_dom,smart_PAZ_dom,smart_Piwi,pfscan_PAZ_dom,pfscan_Piwi	p.R438W	ENST00000220592.5	37	c.1312	CCDS6380.1	8	.	.	.	.	.	.	.	.	.	.	G	19.75	3.885644	0.72410	.	.	ENSG00000123908	ENST00000220592;ENST00000519980	T;T	0.06218	3.33;3.33	5.16	-3.12	0.05282	.	0.000000	0.85682	D	0.000000	T	0.23965	0.0580	M	0.93283	3.4	0.58432	D	0.999998	D;P	0.61080	0.989;0.949	P;P	0.54346	0.749;0.447	T	0.52555	-0.8560	10	0.66056	D	0.02	-4.779	17.1264	0.86715	0.0:0.0:0.6446:0.3554	.	438;438	Q9UKV8-2;Q9UKV8	.;AGO2_HUMAN	W	438	ENSP00000220592:R438W;ENSP00000430176:R438W	ENSP00000220592:R438W	R	-	1	2	EIF2C2	141630675	1.000000	0.71417	0.873000	0.34254	0.917000	0.54804	0.932000	0.28884	-0.724000	0.04908	-0.573000	0.04149	CGG	AGO2	-	NULL	ENSG00000123908		0.532	AGO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AGO2	HGNC	protein_coding	OTTHUMT00000377866.4		0.00	95	0	G			141561493	-1			no_errors	ENST00000220592	ensembl	human	known	74_37	missense	5.71	66	4	SNP	1.000	A
AKAP6	9472	genome.wustl.edu	37	14	33293482	33293482	+	Frame_Shift_Del	DEL	T	T	-			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr14:33293482delT	ENST00000280979.4	+	13	6633	c.6463delT	c.(6463-6465)tttfs	p.F2156fs	AKAP6_ENST00000557272.1_Intron	NM_004274.4	NP_004265.3	Q13023	AKAP6_HUMAN	A kinase (PRKA) anchor protein 6	2156					action potential (GO:0001508)|cAMP-mediated signaling (GO:0019933)|cellular response to cAMP (GO:0071320)|cellular response to cytokine stimulus (GO:0071345)|negative regulation of cAMP biosynthetic process (GO:0030818)|positive regulation of calcineurin-NFAT signaling cascade (GO:0070886)|positive regulation of cell growth (GO:0030307)|positive regulation of cell growth involved in cardiac muscle cell development (GO:0061051)|positive regulation of delayed rectifier potassium channel activity (GO:1902261)|positive regulation of NFAT protein import into nucleus (GO:0051533)|positive regulation of potassium ion transmembrane transport (GO:1901381)|positive regulation of protein phosphatase type 2B activity (GO:0032514)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|protein targeting (GO:0006605)|regulation of membrane repolarization (GO:0060306)|regulation of protein kinase A signaling (GO:0010738)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)	calcium channel complex (GO:0034704)|caveola (GO:0005901)|cytoplasm (GO:0005737)|intercalated disc (GO:0014704)|junctional sarcoplasmic reticulum membrane (GO:0014701)|nuclear envelope (GO:0005635)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)	adenylate cyclase binding (GO:0008179)|ion channel binding (GO:0044325)|protein anchor (GO:0043495)|protein complex scaffold (GO:0032947)|protein kinase A binding (GO:0051018)|protein kinase A regulatory subunit binding (GO:0034237)			NS(2)|breast(10)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(25)|lung(42)|ovary(5)|pancreas(2)|prostate(3)|skin(9)|urinary_tract(2)	122	Breast(36;0.0388)|Prostate(35;0.15)		LUAD - Lung adenocarcinoma(48;0.00107)|Lung(238;0.00677)|STAD - Stomach adenocarcinoma(7;0.116)	GBM - Glioblastoma multiforme(265;0.019)		TATTGAATGCTTTTTTGAGGC	0.483																																					Melanoma(49;821 1200 7288 13647 42351)												0													83.0	78.0	80.0					14																	33293482		2203	4300	6503	SO:0001589	frameshift_variant	0			AB002309	CCDS9644.1	14q12	2008-08-11			ENSG00000151320	ENSG00000151320		"""A-kinase anchor proteins"""	376	protein-coding gene	gene with protein product	"""protein kinase A anchoring protein 6"""	604691				7721854, 9205841	Standard	NM_004274		Approved	KIAA0311, mAKAP, AKAP100, PRKA6, ADAP6	uc001wrq.3	Q13023	OTTHUMG00000140207	ENST00000280979.4:c.6463delT	14.37:g.33293482delT	ENSP00000280979:p.Phe2156fs		A7E242|A7E2D4|O15028	Frame_Shift_Del	DEL	smart_Spectrin/alpha-actinin	p.F2156fs	ENST00000280979.4	37	c.6463	CCDS9644.1	14																																																																																			AKAP6	-	NULL	ENSG00000151320		0.483	AKAP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AKAP6	HGNC	protein_coding	OTTHUMT00000276617.2		0.00	17	0	T	NM_004274		33293482	+1	tier1		no_errors	ENST00000280979	ensembl	human	known	74_37	frame_shift_del	8.70	21	2	DEL	0.998	-
AHNAK2	113146	genome.wustl.edu	37	14	105414400	105414400	+	Missense_Mutation	SNP	G	G	A	rs199976398	byFrequency	TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr14:105414400G>A	ENST00000333244.5	-	7	7507	c.7388C>T	c.(7387-7389)gCg>gTg	p.A2463V	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	2463						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)				cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			CTCCAGCCACGCACCATCCAG	0.607													.|||	2	0.000399361	0.0	0.0	5008	,	,		17510	0.0		0.002	False		,,,				2504	0.0																0													123.0	145.0	138.0					14																	105414400		2061	4194	6255	SO:0001583	missense	0			AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.7388C>T	14.37:g.105414400G>A	ENSP00000353114:p.Ala2463Val		Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Missense_Mutation	SNP	superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.A2463V	ENST00000333244.5	37	c.7388	CCDS45177.1	14	2	9.157509157509158E-4	0	0.0	0	0.0	0	0.0	2	0.002638522427440633	-	13.14	2.147590	0.37923	.	.	ENSG00000185567	ENST00000333244	T	0.00912	5.55	1.88	-3.75	0.04372	.	.	.	.	.	T	0.00384	0.0012	N	0.03917	-0.325	0.09310	N	1	P	0.52170	0.951	B	0.37047	0.24	T	0.47005	-0.9150	9	0.21540	T	0.41	.	1.6255	0.02722	0.4811:0.0:0.2289:0.2899	.	2463	Q8IVF2	AHNK2_HUMAN	V	2463	ENSP00000353114:A2463V	ENSP00000353114:A2463V	A	-	2	0	AHNAK2	104485445	0.112000	0.22096	0.000000	0.03702	0.000000	0.00434	0.923000	0.28757	-0.658000	0.05366	-0.674000	0.03794	GCG	AHNAK2	-	NULL	ENSG00000185567		0.607	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AHNAK2	HGNC	protein_coding	OTTHUMT00000410300.1		0.00	121	0	G	NM_138420		105414400	-1			no_errors	ENST00000333244	ensembl	human	known	74_37	missense	5.00	76	4	SNP	0.000	A
ALG12	79087	genome.wustl.edu	37	22	50303571	50303571	+	Missense_Mutation	SNP	T	T	C			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr22:50303571T>C	ENST00000330817.6	-	5	908	c.635A>G	c.(634-636)cAc>cGc	p.H212R		NM_024105.3	NP_077010.1	Q9BV10	ALG12_HUMAN	ALG12, alpha-1,6-mannosyltransferase	212					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|mannosylation (GO:0097502)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	alpha-1,6-mannosyltransferase activity (GO:0000009)|dol-P-Man:Man(7)GlcNAc(2)-PP-Dol alpha-1,6-mannosyltransferase activity (GO:0052917)			endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|prostate(3)	12		all_cancers(38;8.58e-10)|all_epithelial(38;1.15e-08)|all_lung(38;0.000109)|Lung NSC(38;0.0018)|Breast(42;0.00191)|Ovarian(80;0.0164)|Lung SC(80;0.164)		BRCA - Breast invasive adenocarcinoma(115;0.199)|LUAD - Lung adenocarcinoma(64;0.247)		CGGGACGGCGTGGCGAAGGGC	0.532																																																	0													71.0	71.0	71.0					22																	50303571		2203	4300	6503	SO:0001583	missense	0			AJ303120	CCDS14081.1	22q13.33	2013-02-26	2013-02-26		ENSG00000182858	ENSG00000182858	2.4.1.260	"""Dolichyl D-mannosyl phosphate dependent mannosyltransferases"""	19358	protein-coding gene	gene with protein product	"""dolichyl-P-Man:Man(7)GlcNAc(2)-PP-dolichol alpha-1,6-mannosyltransferase"", ""dol-P-Man dependent alpha-1,6-mannosyltransferase"""	607144	"""asparagine-linked glycosylation 12 homolog (yeast, alpha-1,6-mannosyltransferase)"", ""asparagine-linked glycosylation 12, alpha-1,6-mannosyltransferase homolog (S. cerevisiae)"""			11983712	Standard	NM_024105		Approved	ECM39	uc003biy.3	Q9BV10	OTTHUMG00000150289	ENST00000330817.6:c.635A>G	22.37:g.50303571T>C	ENSP00000333813:p.His212Arg		A6PWM1|Q4KMH4|Q8NG10|Q96AA4	Missense_Mutation	SNP	pfam_GPI_mannosylTrfase	p.H212R	ENST00000330817.6	37	c.635	CCDS14081.1	22	.	.	.	.	.	.	.	.	.	.	T	12.84	2.057908	0.36277	.	.	ENSG00000182858	ENST00000330817	T	0.61510	0.1	4.44	2.22	0.28083	.	0.218956	0.46442	D	0.000284	T	0.58264	0.2110	L	0.58428	1.81	0.35446	D	0.795293	P	0.45240	0.854	P	0.50314	0.637	T	0.61652	-0.7019	10	0.25106	T	0.35	-10.1956	9.5543	0.39328	0.0:0.1093:0.0:0.8907	.	212	Q9BV10	ALG12_HUMAN	R	212	ENSP00000333813:H212R	ENSP00000333813:H212R	H	-	2	0	ALG12	48689575	0.995000	0.38212	0.002000	0.10522	0.005000	0.04900	2.709000	0.47160	0.351000	0.24027	0.529000	0.55759	CAC	ALG12	-	pfam_GPI_mannosylTrfase	ENSG00000182858		0.532	ALG12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALG12	HGNC	protein_coding	OTTHUMT00000317405.2		0.00	138	0	T	NM_024105		50303571	-1			no_errors	ENST00000330817	ensembl	human	known	74_37	missense	5.06	74	4	SNP	0.497	C
AMMECR1L	83607	genome.wustl.edu	37	2	128624513	128624513	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr2:128624513G>A	ENST00000272647.5	-	7	1042	c.782C>T	c.(781-783)cCa>cTa	p.P261L	AMMECR1L_ENST00000393001.1_Missense_Mutation_p.P261L	NM_001199140.1	NP_001186069.1	Q6DCA0	AMERL_HUMAN	AMMECR1-like	261	AMMECR1. {ECO:0000255|PROSITE- ProRule:PRU00467}.									central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(3)|prostate(1)	9	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.07)		ACTGGTAATTGGAGCTTTAAA	0.433																																																	0													149.0	142.0	144.0					2																	128624513		2203	4300	6503	SO:0001583	missense	0				CCDS2152.1	2q21	2012-11-15	2012-11-15		ENSG00000144233	ENSG00000144233			28658	protein-coding gene	gene with protein product			"""AMME chromosomal region gene 1-like"""				Standard	NM_001199140		Approved	MGC4268	uc002tpl.3	Q6DCA0	OTTHUMG00000131535	ENST00000272647.5:c.782C>T	2.37:g.128624513G>A	ENSP00000272647:p.Pro261Leu		B4E276	Missense_Mutation	SNP	pfam_AMMECR1_domain,superfamily_AMMECR1_domain,pfscan_AMMECR1_domain,tigrfam_AMMECR1	p.P261L	ENST00000272647.5	37	c.782	CCDS2152.1	2	.	.	.	.	.	.	.	.	.	.	G	15.61	2.883786	0.51908	.	.	ENSG00000144233	ENST00000272647;ENST00000393001	.	.	.	5.33	5.33	0.75918	AMMECR1 domain (2);	0.080070	0.53938	N	0.000060	T	0.52041	0.1710	N	0.22421	0.69	0.80722	D	1	B	0.18166	0.026	B	0.21708	0.036	T	0.43621	-0.9380	9	0.32370	T	0.25	-28.6285	19.0547	0.93058	0.0:0.0:1.0:0.0	.	261	Q6DCA0	AMERL_HUMAN	L	261	.	ENSP00000272647:P261L	P	-	2	0	AMMECR1L	128340983	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.476000	0.97823	2.480000	0.83734	0.650000	0.86243	CCA	AMMECR1L	-	pfam_AMMECR1_domain,superfamily_AMMECR1_domain,pfscan_AMMECR1_domain,tigrfam_AMMECR1	ENSG00000144233		0.433	AMMECR1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AMMECR1L	HGNC	protein_coding	OTTHUMT00000254392.1		0.00	107	0	G	NM_031445		128624513	-1			no_errors	ENST00000272647	ensembl	human	known	74_37	missense	6.49	71	5	SNP	1.000	A
ANGPTL2	23452	genome.wustl.edu	37	9	129854026	129854026	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr9:129854026C>T	ENST00000373425.3	-	4	1822	c.1205G>A	c.(1204-1206)gGc>gAc	p.G402D	RALGPS1_ENST00000373434.1_Intron|RALGPS1_ENST00000373436.1_Intron|RALGPS1_ENST00000259351.5_Intron|ANGPTL2_ENST00000373417.1_Missense_Mutation_p.G100D|RALGPS1_ENST00000424082.2_Intron|RALGPS1_ENST00000394022.3_Intron	NM_012098.2	NP_036230.1	Q9UKU9	ANGL2_HUMAN	angiopoietin-like 2	402	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				multicellular organismal development (GO:0007275)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	receptor binding (GO:0005102)			breast(1)|endometrium(2)|kidney(1)|large_intestine(8)|lung(4)|ovary(1)|urinary_tract(1)	18						ACCCGCATTGCCATGGTAGCG	0.542																																																	0													179.0	175.0	177.0					9																	129854026		2203	4300	6503	SO:0001583	missense	0			AF125175	CCDS6868.1	9q34	2013-02-06			ENSG00000136859	ENSG00000136859		"""Fibrinogen C domain containing"""	490	protein-coding gene	gene with protein product		605001				10473614	Standard	NM_012098		Approved	ARP2, HARP	uc004bqr.1	Q9UKU9	OTTHUMG00000020695	ENST00000373425.3:c.1205G>A	9.37:g.129854026C>T	ENSP00000362524:p.Gly402Asp		Q5JT58|Q8NCH7	Missense_Mutation	SNP	pfam_Fibrinogen_a/b/g_C_dom,superfamily_Fibrinogen_a/b/g_C_dom,smart_Fibrinogen_a/b/g_C_dom	p.G402D	ENST00000373425.3	37	c.1205	CCDS6868.1	9	.	.	.	.	.	.	.	.	.	.	C	29.8	5.038749	0.93630	.	.	ENSG00000136859	ENST00000373425;ENST00000373417	D;D	0.89485	-2.52;-2.52	5.2	5.2	0.72013	Fibrinogen, alpha/beta/gamma chain, C-terminal globular (4);Fibrinogen, alpha/beta/gamma chain, C-terminal globular, subdomain 1 (1);	0.000000	0.85682	D	0.000000	D	0.96562	0.8878	H	0.96301	3.8	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97698	1.0183	10	0.87932	D	0	.	19.1061	0.93296	0.0:1.0:0.0:0.0	.	402	Q9UKU9	ANGL2_HUMAN	D	402;100	ENSP00000362524:G402D;ENSP00000362516:G100D	ENSP00000362516:G100D	G	-	2	0	ANGPTL2	128893847	1.000000	0.71417	1.000000	0.80357	0.795000	0.44927	7.776000	0.85560	2.574000	0.86865	0.655000	0.94253	GGC	ANGPTL2	-	pfam_Fibrinogen_a/b/g_C_dom,superfamily_Fibrinogen_a/b/g_C_dom,smart_Fibrinogen_a/b/g_C_dom	ENSG00000136859		0.542	ANGPTL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANGPTL2	HGNC	protein_coding	OTTHUMT00000054129.1	-	0.00	57	0	C	NM_012098		129854026	-1	tier1	-	no_errors	ENST00000373425	ensembl	human	known	74_37	missense	12.12	29	4	SNP	1.000	T
AOX1	316	genome.wustl.edu	37	2	201467012	201467012	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr2:201467012C>A	ENST00000374700.2	+	6	683	c.442C>A	c.(442-444)Ctg>Atg	p.L148M		NM_001159.3	NP_001150.3	Q06278	AOXA_HUMAN	aldehyde oxidase 1	148					inflammatory response (GO:0006954)|reactive oxygen species metabolic process (GO:0072593)|small molecule metabolic process (GO:0044281)|vitamin B6 metabolic process (GO:0042816)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	2 iron, 2 sulfur cluster binding (GO:0051537)|aldehyde oxidase activity (GO:0004031)|electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|iron ion binding (GO:0005506)|molybdopterin cofactor binding (GO:0043546)|NAD binding (GO:0051287)|UDP-N-acetylmuramate dehydrogenase activity (GO:0008762)|xanthine dehydrogenase activity (GO:0004854)			breast(5)|endometrium(3)|kidney(4)|large_intestine(13)|lung(38)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	81					Allopurinol(DB00437)|Aminocaproic Acid(DB00513)|Brimonidine(DB00484)|Famciclovir(DB00426)|Menadione(DB00170)|Mercaptopurine(DB01033)|Methotrexate(DB00563)|Pyrazinamide(DB00339)|Raloxifene(DB00481)|Zaleplon(DB00962)|Zonisamide(DB00909)	TTCAGGTAACCTGTGCCGTTG	0.463																																																	0													181.0	158.0	166.0					2																	201467012		2203	4300	6503	SO:0001583	missense	0			AF017060	CCDS33360.1	2q33	2008-05-20			ENSG00000138356	ENSG00000138356			553	protein-coding gene	gene with protein product		602841				7570184	Standard	NM_001159		Approved	AO, AOH1	uc002uvx.3	Q06278	OTTHUMG00000154536	ENST00000374700.2:c.442C>A	2.37:g.201467012C>A	ENSP00000363832:p.Leu148Met		O14765|Q53RR8|Q53TV3|Q9BYF0|Q9UPG6	Missense_Mutation	SNP	pfam_AldOxase/xan_DH_Mopterin-bd,pfam_Mopterin_DH_FAD-bd,pfam_Ald_Oxase/Xan_DH_a/b,pfam_2Fe-2S-bd,pfam_CO_DH_flav_C,pfam_2Fe-2S_ferredoxin-type,superfamily_AldOxase/xan_DH_Mopterin-bd,superfamily_FAD-bd_2,superfamily_Ald_Oxase/Xan_DH_a/b,superfamily_2Fe-2S-bd,superfamily_CO_DH_flav_C,superfamily_2Fe-2S_ferredoxin-type,pirsf_Ald_Oxase/xanthine_DH,pfscan_2Fe-2S_ferredoxin-type,tigrfam_Aldehyde_oxidase	p.L148M	ENST00000374700.2	37	c.442	CCDS33360.1	2	.	.	.	.	.	.	.	.	.	.	C	17.30	3.353873	0.61293	.	.	ENSG00000138356	ENST00000374700;ENST00000454629	T;T	0.72167	-0.63;-0.63	5.65	2.72	0.32119	[2Fe-2S]-binding (3);	0.000000	0.64402	D	0.000002	D	0.86556	0.5961	H	0.96333	3.805	0.58432	D	0.999993	D	0.89917	1.0	D	0.91635	0.999	D	0.86369	0.1722	10	0.87932	D	0	-30.6966	7.3906	0.26907	0.0:0.6475:0.0:0.3525	.	148	Q06278	ADO_HUMAN	M	148;123	ENSP00000363832:L148M;ENSP00000392485:L123M	ENSP00000363832:L148M	L	+	1	2	AOX1	201175257	0.997000	0.39634	1.000000	0.80357	0.956000	0.61745	0.640000	0.24705	0.950000	0.37743	0.655000	0.94253	CTG	AOX1	-	pfam_2Fe-2S-bd,superfamily_2Fe-2S-bd,pirsf_Ald_Oxase/xanthine_DH,tigrfam_Aldehyde_oxidase	ENSG00000138356		0.463	AOX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AOX1	HGNC	protein_coding	OTTHUMT00000335844.1	-	0.00	73	0	C	NM_001159		201467012	+1	tier1	-	no_errors	ENST00000374700	ensembl	human	known	74_37	missense	16.67	20	4	SNP	0.998	A
AQP12B	653437	genome.wustl.edu	37	2	241615877	241615877	+	3'UTR	SNP	C	C	T			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr2:241615877C>T	ENST00000407834.3	-	0	1071				AQP12B_ENST00000459806.1_5'UTR	NM_001102467.1	NP_001095937.1	A6NM10	AQ12B_HUMAN	aquaporin 12B							integral component of membrane (GO:0016021)	transporter activity (GO:0005215)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|lung(8)|ovary(1)	13		all_epithelial(40;1.71e-15)|Breast(86;2.14e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0294)|all_neural(83;0.0459)|Lung NSC(271;0.094)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;2.2e-31)|all cancers(36;1.08e-28)|OV - Ovarian serous cystadenocarcinoma(60;2.13e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;7.52e-06)|Lung(119;0.00163)|LUSC - Lung squamous cell carcinoma(224;0.008)|Colorectal(34;0.0124)|COAD - Colon adenocarcinoma(134;0.0757)		GGGGAGGGGGCCAGGATTCCC	0.602																																																	0																																										SO:0001624	3_prime_UTR_variant	0			BC041460	CCDS46560.1	2q37.3	2007-12-14	2005-05-26	2005-05-26	ENSG00000185176	ENSG00000185176		"""Ion channels / Aquaporins"""	6096	protein-coding gene	gene with protein product			"""insulin synthesis associated 3"""	INSSA3			Standard	NM_001102467		Approved		uc010fzj.3	A6NM10	OTTHUMG00000152263	ENST00000407834.3:c.*85G>A	2.37:g.241615877C>T			A4QPB9	RNA	SNP	-	NULL	ENST00000407834.3	37	NULL	CCDS46560.1	2																																																																																			AQP12B	-	-	ENSG00000185176		0.602	AQP12B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AQP12B	HGNC	protein_coding	OTTHUMT00000325625.1	-	0.00	20	0	C			241615877	-1	tier1	-	no_errors	ENST00000459806	ensembl	human	putative	74_37	rna	25.00	9	3	SNP	0.000	T
ARHGEF16	27237	genome.wustl.edu	37	1	3389659	3389659	+	Missense_Mutation	SNP	A	A	T			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr1:3389659A>T	ENST00000378378.4	+	7	1445	c.1040A>T	c.(1039-1041)gAg>gTg	p.E347V	ARHGEF16_ENST00000378373.1_Missense_Mutation_p.E59V|ARHGEF16_ENST00000413250.2_Missense_Mutation_p.E51V|ARHGEF16_ENST00000378371.2_Missense_Mutation_p.E59V	NM_014448.3	NP_055263.2	Q5VV41	ARHGG_HUMAN	Rho guanine nucleotide exchange factor (GEF) 16	347	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.|Required for RHOG activation and mediates interaction with EPHA2.				activation of Cdc42 GTPase activity (GO:0032864)|activation of Rac GTPase activity (GO:0032863)|apoptotic signaling pathway (GO:0097190)|cell chemotaxis (GO:0060326)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	PDZ domain binding (GO:0030165)|receptor tyrosine kinase binding (GO:0030971)|Rho GTPase binding (GO:0017048)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			lung(6)|ovary(1)	7	all_cancers(77;0.00276)|all_epithelial(69;0.00102)|Ovarian(185;0.0634)|Lung NSC(156;0.0969)|all_lung(157;0.101)	all_epithelial(116;7.14e-21)|all_lung(118;2.24e-08)|Lung NSC(185;3.55e-06)|Breast(487;0.000765)|Renal(390;0.00121)|Hepatocellular(190;0.0046)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0308)|Lung SC(97;0.0847)|Medulloblastoma(700;0.211)		Epithelial(90;8.62e-38)|OV - Ovarian serous cystadenocarcinoma(86;3.62e-22)|GBM - Glioblastoma multiforme(42;2.49e-12)|Colorectal(212;4.25e-05)|COAD - Colon adenocarcinoma(227;0.000196)|Kidney(185;0.000342)|BRCA - Breast invasive adenocarcinoma(365;0.000681)|KIRC - Kidney renal clear cell carcinoma(229;0.00549)|STAD - Stomach adenocarcinoma(132;0.00644)|Lung(427;0.201)		GAGGACCTGGAGCAGCGGCAC	0.622																																																	0													103.0	78.0	86.0					1																	3389659		2203	4300	6503	SO:0001583	missense	0			D89016	CCDS46.2	1p36.3	2013-01-10	2010-04-13		ENSG00000130762	ENSG00000130762		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	15515	protein-coding gene	gene with protein product	"""putative neuroblastoma protein"""						Standard	NM_014448		Approved	NBR, GEF16	uc001akg.4	Q5VV41	OTTHUMG00000000625	ENST00000378378.4:c.1040A>T	1.37:g.3389659A>T	ENSP00000367629:p.Glu347Val		Q86TF0|Q99434	Missense_Mutation	SNP	pfam_DH-domain,pfam_SH3_domain,pfam_Pleckstrin_homology,superfamily_DH-domain,superfamily_SH3_domain,smart_DH-domain,smart_Pleckstrin_homology,smart_SH3_domain,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_DH-domain	p.E347V	ENST00000378378.4	37	c.1040	CCDS46.2	1	.	.	.	.	.	.	.	.	.	.	A	21.1	4.105602	0.77096	.	.	ENSG00000130762	ENST00000378378;ENST00000378373;ENST00000378371;ENST00000445297;ENST00000418137;ENST00000413250	T;T;T;T;T;T	0.68765	-0.35;-0.35;-0.35;-0.35;-0.35;-0.35	4.38	4.38	0.52667	Dbl homology (DH) domain (5);	0.000000	0.85682	D	0.000000	D	0.83899	0.5354	M	0.90595	3.13	0.80722	D	1	D;D;D	0.76494	0.998;0.999;0.977	D;D;P	0.79784	0.984;0.993;0.893	D	0.87604	0.2499	10	0.87932	D	0	-32.71	13.7484	0.62890	1.0:0.0:0.0:0.0	.	51;51;347	B4DJM7;B0QZD4;Q5VV41	.;.;ARHGG_HUMAN	V	347;59;59;59;51;51	ENSP00000367629:E347V;ENSP00000367624:E59V;ENSP00000367622:E59V;ENSP00000411936:E59V;ENSP00000390853:E51V;ENSP00000408887:E51V	ENSP00000367622:E59V	E	+	2	0	ARHGEF16	3379519	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.535000	0.90623	1.843000	0.53566	0.459000	0.35465	GAG	ARHGEF16	-	pfam_DH-domain,superfamily_DH-domain,smart_DH-domain,pfscan_DH-domain	ENSG00000130762		0.622	ARHGEF16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGEF16	HGNC	protein_coding	OTTHUMT00000001515.1	-	0.00	42	0	A	NM_014448		3389659	+1	tier1	-	no_errors	ENST00000378378	ensembl	human	known	74_37	missense	67.65	11	23	SNP	1.000	T
ARHGEF33	100271715	genome.wustl.edu	37	2	39164609	39164609	+	Silent	SNP	C	C	T	rs372530806		TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr2:39164609C>T	ENST00000536934.1	+	7	784	c.699C>T	c.(697-699)taC>taT	p.Y233Y	ARHGEF33_ENST00000409978.1_Silent_p.Y233Y|ARHGEF33_ENST00000398800.4_Silent_p.Y233Y|RN7SL96P_ENST00000582641.1_RNA			A8MVX0	ARG33_HUMAN	Rho guanine nucleotide exchange factor (GEF) 33	233							Rho guanyl-nucleotide exchange factor activity (GO:0005089)			endometrium(3)|pancreas(1)|prostate(1)	5						GTGAAGAATACGTCACAAAAG	0.502													C|||	1	0.000199681	0.0	0.0	5008	,	,		15204	0.0		0.0	False		,,,				2504	0.001																0													78.0	71.0	73.0					2																	39164609		692	1591	2283	SO:0001819	synonymous_variant	0				CCDS46263.1, CCDS46263.2	2p22.1	2012-07-24			ENSG00000214694	ENSG00000214694		"""Rho guanine nucleotide exchange factors"""	37252	protein-coding gene	gene with protein product							Standard	NM_001145451		Approved		uc021vgd.1	A8MVX0	OTTHUMG00000153540	ENST00000536934.1:c.699C>T	2.37:g.39164609C>T			J3KPX2	Silent	SNP	pfam_DH-domain,superfamily_DH-domain,superfamily_Prefoldin,smart_DH-domain,pfscan_DH-domain	p.Y233	ENST00000536934.1	37	c.699		2																																																																																			ARHGEF33	-	NULL	ENSG00000214694		0.502	ARHGEF33-202	KNOWN	basic	protein_coding	ARHGEF33	HGNC	protein_coding		-	0.00	80	0	C	NM_001145451		39164609	+1	tier1	-	no_errors	ENST00000398800	ensembl	human	known	74_37	silent	7.69	48	4	SNP	0.998	T
ATAD5	79915	genome.wustl.edu	37	17	29161257	29161257	+	Frame_Shift_Del	DEL	T	T	-			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr17:29161257delT	ENST00000321990.4	+	2	536	c.158delT	c.(157-159)gttfs	p.V53fs	CTD-2349P21.11_ENST00000580873.1_RNA	NM_024857.3	NP_079133.3	Q96QE3	ATAD5_HUMAN	ATPase family, AAA domain containing 5	53					cellular response to DNA damage stimulus (GO:0006974)	nucleus (GO:0005634)	ATP binding (GO:0005524)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(8)|kidney(3)|large_intestine(18)|lung(13)|ovary(3)|pancreas(1)	51		all_hematologic(16;0.0202)|Acute lymphoblastic leukemia(14;0.0238)|Myeloproliferative disorder(56;0.0393)				AGAGACAGGGTTTTTGCTCCA	0.368																																																	0													85.0	90.0	88.0					17																	29161257		2203	4300	6503	SO:0001589	frameshift_variant	0				CCDS11260.1	17q11.2	2010-04-21	2007-02-08	2007-02-08	ENSG00000176208	ENSG00000176208		"""ATPases / AAA-type"""	25752	protein-coding gene	gene with protein product	"""enhanced level of genomic instability 1 homolog (S. cerevisiae)"""	609534	"""chromosome 17 open reading frame 41"""	C17orf41		15983387, 11468690, 19755857	Standard	NM_024857		Approved	FLJ12735, FRAG1, ELG1	uc002hfs.1	Q96QE3	OTTHUMG00000132794	ENST00000321990.4:c.158delT	17.37:g.29161257delT	ENSP00000313171:p.Val53fs		Q05DH0|Q69YR6|Q9H9I1	Frame_Shift_Del	DEL	pfam_ATPase_AAA_core,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.F54fs	ENST00000321990.4	37	c.158	CCDS11260.1	17																																																																																			ATAD5	-	NULL	ENSG00000176208		0.368	ATAD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATAD5	HGNC	protein_coding	OTTHUMT00000256206.2		0.00	53	0	T	NM_024857		29161257	+1	tier1		no_errors	ENST00000321990	ensembl	human	known	74_37	frame_shift_del	8.57	32	3	DEL	0.997	-
ATG7	10533	genome.wustl.edu	37	3	11389409	11389409	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr3:11389409C>T	ENST00000354449.3	+	12	1209	c.1184C>T	c.(1183-1185)cCt>cTt	p.P395L	ATG7_ENST00000446450.2_Missense_Mutation_p.P356L|ATG7_ENST00000354956.5_Missense_Mutation_p.P395L	NM_006395.2	NP_006386.1	O95352	ATG7_HUMAN	autophagy related 7	395					adult walking behavior (GO:0007628)|C-terminal protein lipidation (GO:0006501)|cardiac muscle cell development (GO:0055013)|cellular amino acid metabolic process (GO:0006520)|cellular protein modification process (GO:0006464)|cellular response to hyperoxia (GO:0071455)|cellular response to nitrogen starvation (GO:0006995)|cellular response to starvation (GO:0009267)|central nervous system neuron axonogenesis (GO:0021955)|cerebellar Purkinje cell layer development (GO:0021680)|cerebral cortex development (GO:0021987)|late nucleophagy (GO:0044805)|liver development (GO:0001889)|membrane fusion (GO:0061025)|mitochondrion degradation (GO:0000422)|mitochondrion organization (GO:0007005)|negative regulation of apoptotic process (GO:0043066)|negative stranded viral RNA replication (GO:0039689)|neurological system process (GO:0050877)|piecemeal microautophagy of nucleus (GO:0034727)|positive regulation of apoptotic process (GO:0043065)|positive regulation of autophagy (GO:0010508)|positive regulation of macroautophagy (GO:0016239)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein modification process (GO:0031401)|post-embryonic development (GO:0009791)|protein catabolic process (GO:0030163)|protein lipidation (GO:0006497)|protein modification by small protein conjugation (GO:0032446)|protein transport (GO:0015031)|pyramidal neuron development (GO:0021860)|regulation of protein ubiquitination (GO:0031396)	axoneme (GO:0005930)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|pre-autophagosomal structure (GO:0000407)	Atg12 activating enzyme activity (GO:0019778)|Atg8 activating enzyme (GO:0019779)|protein homodimerization activity (GO:0042803)|transcription factor binding (GO:0008134)|ubiquitin activating enzyme activity (GO:0004839)			central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(4)|lung(14)|prostate(1)|skin(2)|urinary_tract(1)	34						TACTCCAATCCTGTGAGGCAG	0.522																																																	0													117.0	108.0	111.0					3																	11389409		2203	4300	6503	SO:0001583	missense	0			AF094516	CCDS2605.1, CCDS46752.1, CCDS46753.1	3p25.3-p25.2	2014-02-18	2012-06-06	2005-09-11	ENSG00000197548	ENSG00000197548		"""Ubiquitin-like modifier activating enzymes"""	16935	protein-coding gene	gene with protein product	"""ubiquitin-activating enzyme E1-like protein"""	608760	"""APG7 autophagy 7-like (S. cerevisiae)"", ""ATG7 autophagy related 7 homolog (S. cerevisiae)"""	APG7L		10233149	Standard	NM_006395		Approved	GSA7, DKFZp434N0735	uc003bwc.3	O95352	OTTHUMG00000129740	ENST00000354449.3:c.1184C>T	3.37:g.11389409C>T	ENSP00000346437:p.Pro395Leu		B4E170|E9PB95|Q7L8L0|Q9BWP2|Q9UFH4	Missense_Mutation	SNP	pfam_ThiF_NAD_FAD-bd,superfamily_Molybdenum_cofac_synth_MoeB,tigrfam_Atg7	p.P395L	ENST00000354449.3	37	c.1184	CCDS2605.1	3	.	.	.	.	.	.	.	.	.	.	C	35	5.513012	0.96402	.	.	ENSG00000197548	ENST00000446450;ENST00000354956;ENST00000354449	T;T;T	0.14516	2.5;2.5;2.5	5.99	5.99	0.97316	UBA/THIF-type NAD/FAD binding fold (1);Molybdenum cofactor biosynthesis, MoeB (1);NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	T	0.32071	0.0817	L	0.38953	1.18	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	T	0.00812	-1.1556	10	0.87932	D	0	-19.073	20.4777	0.99188	0.0:1.0:0.0:0.0	.	356;395;395	E9PB95;O95352-2;O95352	.;.;ATG7_HUMAN	L	356;395;395	ENSP00000412580:P356L;ENSP00000347042:P395L;ENSP00000346437:P395L	ENSP00000346437:P395L	P	+	2	0	ATG7	11364409	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.367000	0.79558	2.840000	0.97914	0.655000	0.94253	CCT	ATG7	-	pfam_ThiF_NAD_FAD-bd,superfamily_Molybdenum_cofac_synth_MoeB,tigrfam_Atg7	ENSG00000197548		0.522	ATG7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATG7	HGNC	protein_coding	OTTHUMT00000251951.3	-	0.00	43	0	C	NM_006395		11389409	+1	tier1	-	no_errors	ENST00000354449	ensembl	human	known	74_37	missense	18.75	13	3	SNP	1.000	T
B4GALT7	11285	genome.wustl.edu	37	5	177036004	177036004	+	Missense_Mutation	SNP	G	G	T	rs538600624		TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr5:177036004G>T	ENST00000029410.5	+	5	928	c.817G>T	c.(817-819)Gct>Tct	p.A273S	RP11-1277A3.1_ENST00000499900.2_RNA	NM_007255.2	NP_009186.1	Q9UBV7	B4GT7_HUMAN	xylosylprotein beta 1,4-galactosyltransferase, polypeptide 7	273					carbohydrate metabolic process (GO:0005975)|cellular protein modification process (GO:0006464)|chondroitin sulfate metabolic process (GO:0030204)|extracellular fibril organization (GO:0043206)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|negative regulation of fibroblast proliferation (GO:0048147)|protein N-linked glycosylation (GO:0006487)|proteoglycan metabolic process (GO:0006029)|small molecule metabolic process (GO:0044281)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	beta-N-acetylglucosaminylglycopeptide beta-1,4-galactosyltransferase activity (GO:0003831)|galactosyltransferase activity (GO:0008378)|manganese ion binding (GO:0030145)|xylosylprotein 4-beta-galactosyltransferase activity (GO:0046525)			endometrium(2)|large_intestine(1)|lung(1)|pancreas(1)|skin(1)|urinary_tract(1)	7	all_cancers(89;0.00033)|Renal(175;0.000269)|Lung NSC(126;0.00161)|all_lung(126;0.00286)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GCGCATCGCAGCTCAAAAACA	0.592																																																	0													49.0	47.0	48.0					5																	177036004		2203	4300	6503	SO:0001583	missense	0			AB028600	CCDS4429.1	5q35.1-q35.3	2013-02-19	2012-07-18		ENSG00000027847	ENSG00000027847		"""Beta 4-glycosyltransferases"""	930	protein-coding gene	gene with protein product	"""galactosyltransferase I"""	604327				10438455, 10473568	Standard	NM_007255		Approved	XGALT-1, beta4Gal-T7	uc003mhy.3	Q9UBV7	OTTHUMG00000130851	ENST00000029410.5:c.817G>T	5.37:g.177036004G>T	ENSP00000029410:p.Ala273Ser		B3KN39|Q9UHN2	Missense_Mutation	SNP	pfam_Galactosyl_T_C,prints_Galactosyl_T	p.A273S	ENST00000029410.5	37	c.817	CCDS4429.1	5	.	.	.	.	.	.	.	.	.	.	G	7.593	0.671106	0.14776	.	.	ENSG00000027847	ENST00000029410;ENST00000541139	T	0.34667	1.35	5.55	4.65	0.58169	.	0.101746	0.64402	D	0.000003	T	0.22437	0.0541	N	0.22421	0.69	0.58432	D	0.999999	B	0.09022	0.002	B	0.09377	0.004	T	0.04976	-1.0914	10	0.07990	T	0.79	-14.7393	13.5758	0.61873	0.0:0.0:0.8443:0.1557	.	273	Q9UBV7	B4GT7_HUMAN	S	273;159	ENSP00000029410:A273S	ENSP00000029410:A273S	A	+	1	0	B4GALT7	176968610	0.989000	0.36119	0.994000	0.49952	0.316000	0.28119	2.117000	0.41939	2.615000	0.88500	0.455000	0.32223	GCT	B4GALT7	-	pfam_Galactosyl_T_C	ENSG00000027847		0.592	B4GALT7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	B4GALT7	HGNC	protein_coding	OTTHUMT00000253421.1		0.00	65	0	G	NM_007255		177036004	+1			no_errors	ENST00000029410	ensembl	human	known	74_37	missense	6.45	29	2	SNP	0.977	T
BANK1	55024	genome.wustl.edu	37	4	102942701	102942701	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr4:102942701G>C	ENST00000322953.4	+	8	1511	c.1237G>C	c.(1237-1239)Gaa>Caa	p.E413Q	BANK1_ENST00000444316.2_Missense_Mutation_p.E383Q|BANK1_ENST00000508653.1_Missense_Mutation_p.E280Q|BANK1_ENST00000504592.1_Missense_Mutation_p.E398Q|BANK1_ENST00000510950.1_3'UTR|RP11-498M5.2_ENST00000505091.1_RNA|BANK1_ENST00000428908.1_Missense_Mutation_p.E280Q	NM_017935.4	NP_060405	Q8NDB2	BANK1_HUMAN	B-cell scaffold protein with ankyrin repeats 1	413					B cell activation (GO:0042113)					NS(1)|breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|liver(2)|lung(16)|ovary(2)|skin(2)|urinary_tract(1)	44		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;2.7e-07)		TAATGAGCAAGAAAATGATTA	0.249																																																	0													28.0	32.0	31.0					4																	102942701		2168	4243	6411	SO:0001583	missense	0			AB063170	CCDS34038.1, CCDS47115.1, CCDS47116.1	4q23	2013-01-11						"""Ankyrin repeat domain containing"""	18233	protein-coding gene	gene with protein product		610292				11782428, 21208380, 21480188	Standard	NM_017935		Approved	BANK, FLJ20706	uc003hvy.4	Q8NDB2		ENST00000322953.4:c.1237G>C	4.37:g.102942701G>C	ENSP00000320509:p.Glu413Gln		A8K7W8|B0F3S2|Q8N5K8|Q8NB56|Q8WYN5|Q9NWP2	Missense_Mutation	SNP	superfamily_Ankyrin_rpt-contain_dom	p.E413Q	ENST00000322953.4	37	c.1237	CCDS34038.1	4	.	.	.	.	.	.	.	.	.	.	G	15.17	2.753413	0.49362	.	.	ENSG00000153064	ENST00000504592;ENST00000322953;ENST00000428908;ENST00000508653;ENST00000444316	T;T;T;T;T	0.18960	2.87;2.86;2.18;2.18;2.87	4.25	3.38	0.38709	.	0.453819	0.19630	N	0.109698	T	0.33265	0.0857	L	0.47716	1.5	0.25820	N	0.984292	D;D;D	0.76494	0.999;0.994;0.994	D;P;P	0.69479	0.964;0.827;0.827	T	0.06625	-1.0816	10	0.28530	T	0.3	.	9.8106	0.40820	0.0:0.0:0.7939:0.2061	.	280;413;398	Q8NDB2-4;Q8NDB2;Q8NDB2-2	.;BANK1_HUMAN;.	Q	398;413;280;280;383	ENSP00000421443:E398Q;ENSP00000320509:E413Q;ENSP00000412748:E280Q;ENSP00000422314:E280Q;ENSP00000388817:E383Q	ENSP00000320509:E413Q	E	+	1	0	BANK1	103161724	1.000000	0.71417	0.929000	0.37066	0.975000	0.68041	2.186000	0.42593	1.059000	0.40554	0.655000	0.94253	GAA	BANK1	-	NULL	ENSG00000153064		0.249	BANK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BANK1	HGNC	protein_coding	OTTHUMT00000363161.1	-	0.00	43	0	G	NM_017935		102942701	+1	tier1	-	no_errors	ENST00000322953	ensembl	human	known	74_37	missense	31.25	33	15	SNP	0.991	C
BCAS3	54828	genome.wustl.edu	37	17	59067400	59067400	+	Silent	SNP	C	C	T	rs200886855		TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr17:59067400C>T	ENST00000390652.5	+	15	1321	c.1290C>T	c.(1288-1290)caC>caT	p.H430H	BCAS3_ENST00000588874.1_Silent_p.H201H|BCAS3_ENST00000408905.3_Silent_p.H430H|BCAS3_ENST00000588462.1_Silent_p.H430H|BCAS3_ENST00000585744.1_Silent_p.H201H|BCAS3_ENST00000589222.1_Silent_p.H430H|BCAS3_ENST00000407086.3_Silent_p.H430H	NM_001099432.1	NP_001092902.1			breast carcinoma amplified sequence 3											NS(1)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(24)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	44			BRCA - Breast invasive adenocarcinoma(1;3.11e-12)|Epithelial(12;8.2e-07)|all cancers(12;5.33e-06)			GTACTTCCCACGTTTTCCCCA	0.483																																																	0								C	,	0,3898		0,0,1949	107.0	106.0	106.0		1290,1290	-7.8	0.7	17		106	2,8278		0,2,4138	no	coding-synonymous,coding-synonymous	BCAS3	NM_001099432.1,NM_017679.3	,	0,2,6087	TT,TC,CC		0.0242,0.0,0.0164	,	430/929,430/914	59067400	2,12176	1949	4140	6089	SO:0001819	synonymous_variant	0			AF361219	CCDS11626.1, CCDS45749.1	17q23.2	2013-06-25			ENSG00000141376	ENSG00000141376		"""WD repeat domain containing"""	14347	protein-coding gene	gene with protein product		607470				12378525	Standard	NM_017679		Approved	FLJ20128	uc002iyv.4	Q9H6U6	OTTHUMG00000180064	ENST00000390652.5:c.1290C>T	17.37:g.59067400C>T				Silent	SNP	pfam_BCAS3,pfam_WD40_repeat	p.H430	ENST00000390652.5	37	c.1290	CCDS45749.1	17																																																																																			BCAS3	-	NULL	ENSG00000141376		0.483	BCAS3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BCAS3	HGNC	protein_coding	OTTHUMT00000449578.1		0.00	90	0	C	NM_017679		59067400	+1			no_errors	ENST00000390652	ensembl	human	known	74_37	silent	5.41	70	4	SNP	0.918	T
BHLHE41	79365	genome.wustl.edu	37	12	26277481	26277481	+	Missense_Mutation	SNP	T	T	G			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr12:26277481T>G	ENST00000242728.4	-	2	444	c.97A>C	c.(97-99)Aaa>Caa	p.K33Q	RP11-283G6.3_ENST00000545819.1_RNA|RP11-283G6.3_ENST00000535914.1_RNA	NM_030762.2	NP_110389.1	Q9C0J9	BHE41_HUMAN	basic helix-loop-helix family, member e41	33					cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|circadian regulation of gene expression (GO:0032922)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of transcription by competitive promoter binding (GO:0010944)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|organ morphogenesis (GO:0009887)	nucleus (GO:0005634)	bHLH transcription factor binding (GO:0043425)|E-box binding (GO:0070888)|histone deacetylase binding (GO:0042826)|MRF binding (GO:0043426)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|transcription corepressor activity (GO:0003714)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(1)	5						ATGCTCCTTTTGGGTTTACAC	0.468																																																	0													193.0	177.0	182.0					12																	26277481		2203	4300	6503	SO:0001583	missense	0			AB044088	CCDS8706.1	12p12.1	2011-12-05	2009-01-12	2009-01-12	ENSG00000123095	ENSG00000123095		"""Basic helix-loop-helix proteins"""	16617	protein-coding gene	gene with protein product	"""differentially expressed in chondrocytes 2"", ""Enhancer-of-split and hairy-related protein 1"""	606200	"""basic helix-loop-helix domain containing, class B, 3"""	BHLHB3		11162494, 18557763	Standard	NM_030762		Approved	DEC2, SHARP-1, SHARP1, bHLHe41	uc001rhb.3	Q9C0J9	OTTHUMG00000169174	ENST00000242728.4:c.97A>C	12.37:g.26277481T>G	ENSP00000242728:p.Lys33Gln		A2I2N8	Missense_Mutation	SNP	pfam_bHLH_dom,pfam_Orange,superfamily_bHLH_dom,smart_bHLH_dom,smart_Orange_subgr,pfscan_Orange,pfscan_bHLH_dom	p.K33Q	ENST00000242728.4	37	c.97	CCDS8706.1	12	.	.	.	.	.	.	.	.	.	.	T	19.32	3.805617	0.70682	.	.	ENSG00000123095	ENST00000242728;ENST00000540731	T	0.58210	0.35	4.2	4.2	0.49525	.	0.134423	0.49916	U	0.000138	T	0.53110	0.1776	L	0.27053	0.805	0.80722	D	1	D	0.61697	0.99	P	0.58577	0.841	T	0.57481	-0.7804	10	0.72032	D	0.01	-1.8461	11.0604	0.47944	0.0:0.0:0.0:1.0	.	33	Q9C0J9	BHE41_HUMAN	Q	33	ENSP00000242728:K33Q	ENSP00000242728:K33Q	K	-	1	0	BHLHE41	26168748	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.007000	0.76335	1.895000	0.54865	0.459000	0.35465	AAA	BHLHE41	-	NULL	ENSG00000123095		0.468	BHLHE41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BHLHE41	HGNC	protein_coding	OTTHUMT00000402714.1		0.00	78	0	T	NM_030762		26277481	-1			no_errors	ENST00000242728	ensembl	human	known	74_37	missense	7.55	49	4	SNP	1.000	G
BRAP	8315	genome.wustl.edu	37	12	112093423	112093423	+	Silent	SNP	G	G	T			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr12:112093423G>T	ENST00000327551.6	-	10	1308	c.1168C>A	c.(1168-1170)Cga>Aga	p.R390R	BRAP_ENST00000539060.1_Silent_p.R241R|BRAP_ENST00000419234.4_Silent_p.R420R			Q6UWU4	CF089_HUMAN	BRCA1 associated protein	0					epithelial cell proliferation (GO:0050673)|positive regulation of cell cycle (GO:0045787)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.R420*(1)		cervix(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(5)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	20						CAGTAGATTCGCTGAGATTCC	0.413																																					Pancreas(146;846 1904 7830 25130 26065)												1	Substitution - Nonsense(1)	large_intestine(1)											174.0	147.0	156.0					12																	112093423		2203	4300	6503	SO:0001819	synonymous_variant	0			AF035620	CCDS9154.1	12q24.12	2014-09-11			ENSG00000089234	ENSG00000089234		"""RING-type (C3HC4) zinc fingers"""	1099	protein-coding gene	gene with protein product	"""impedes mitogenic signal propagation"", ""galectin-2-binding protein"""	604986				9497340, 19198608	Standard	XM_005253944		Approved	BRAP2, RNF52, IMP	uc001tsn.4	Q7Z569	OTTHUMG00000169600	ENST00000327551.6:c.1168C>A	12.37:g.112093423G>T			B4DTT1|F4NAR0|F4NAR1|Q6ZMG5|Q7Z356|Q8IZ35	Silent	SNP	pfam_BRAP2,pfam_Znf_UBP,pfam_Znf_C3HC4_RING-type,superfamily_Znf_FYVE_PHD,smart_Znf_RING,smart_Znf_UBP,pfscan_Znf_RING,pfscan_Znf_UBP	p.R420	ENST00000327551.6	37	c.1258		12																																																																																			BRAP	-	NULL	ENSG00000089234		0.413	BRAP-002	PUTATIVE	basic|exp_conf	protein_coding	BRAP	HGNC	protein_coding	OTTHUMT00000404994.2		0.00	68	0	G			112093423	-1			no_errors	ENST00000419234	ensembl	human	known	74_37	silent	7.69	36	3	SNP	1.000	T
BRWD1	54014	genome.wustl.edu	37	21	40571465	40571465	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr21:40571465C>T	ENST00000333229.2	-	40	5204	c.4877G>A	c.(4876-4878)cGa>cAa	p.R1626Q	BRWD1_ENST00000342449.3_Missense_Mutation_p.R1626Q|BRWD1_ENST00000380800.3_Missense_Mutation_p.R1626Q	NM_018963.4	NP_061836.2	Q9NSI6	BRWD1_HUMAN	bromodomain and WD repeat domain containing 1	1626					cytoskeleton organization (GO:0007010)|regulation of cell shape (GO:0008360)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				cervix(2)|endometrium(6)|kidney(8)|large_intestine(14)|liver(2)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(7)|urinary_tract(2)	58		Prostate(19;8.44e-08)|all_epithelial(19;0.223)				TAAGACTTTTCGGTTATTTCC	0.403											OREG0003861	type=REGULATORY REGION|Gene=BRWD1|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																									Melanoma(170;988 1986 4794 16843 39731)												0													87.0	90.0	89.0					21																	40571465		2203	4300	6503	SO:0001583	missense	0			AJ002572	CCDS13662.1, CCDS13663.1, CCDS33557.1	21q22.2	2013-05-21	2005-05-13	2005-05-13	ENSG00000185658	ENSG00000185658		"""WD repeat domain containing"""	12760	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 107"", ""WD repeat domain 9"""	C21orf107, WDR9			Standard	NM_033656		Approved	FLJ11315, N143	uc002yxk.2	Q9NSI6	OTTHUMG00000066030	ENST00000333229.2:c.4877G>A	21.37:g.40571465C>T	ENSP00000330753:p.Arg1626Gln	894	C9JK25|O43721|Q5R2V0|Q5R2V1|Q6P2D1|Q8TCV3|Q96QG9|Q96QH0|Q9NUK1	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_Bromodomain,superfamily_WD40_repeat_dom,superfamily_Bromodomain,smart_WD40_repeat,smart_Bromodomain,pfscan_Bromodomain,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_Bromodomain	p.R1626Q	ENST00000333229.2	37	c.4877	CCDS13662.1	21	.	.	.	.	.	.	.	.	.	.	C	24.1	4.490339	0.84962	.	.	ENSG00000185658	ENST00000333229;ENST00000342449;ENST00000380800	T;T;T	0.60548	0.18;0.46;0.54	5.38	5.38	0.77491	.	0.663319	0.13500	N	0.383298	T	0.74374	0.3708	M	0.71581	2.175	0.80722	D	1	D;D	0.76494	0.999;0.999	D;P	0.77557	0.99;0.886	T	0.73550	-0.3947	10	0.62326	D	0.03	-5.4253	12.4962	0.55929	0.0:0.9239:0.0:0.0761	.	1626;1626	Q9NSI6-2;Q9NSI6	.;BRWD1_HUMAN	Q	1626	ENSP00000330753:R1626Q;ENSP00000344333:R1626Q;ENSP00000370178:R1626Q	ENSP00000330753:R1626Q	R	-	2	0	BRWD1	39493335	0.795000	0.28851	0.978000	0.43139	0.961000	0.63080	2.690000	0.47001	2.524000	0.85096	0.563000	0.77884	CGA	BRWD1	-	NULL	ENSG00000185658		0.403	BRWD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRWD1	HGNC	protein_coding	OTTHUMT00000141398.3		0.00	64	0	C	NM_033656		40571465	-1			no_errors	ENST00000333229	ensembl	human	known	74_37	missense	6.90	27	2	SNP	0.986	T
C10orf67	256815	genome.wustl.edu	37	10	23622110	23622110	+	Splice_Site	SNP	G	G	T			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr10:23622110G>T	ENST00000323327.4	-	2	278	c.211C>A	c.(211-213)Ctt>Att	p.L71I		NM_153714.2	NP_714925.2	Q8IYJ2	CJ067_HUMAN	chromosome 10 open reading frame 67	71										central_nervous_system(1)|endometrium(1)|lung(2)|pancreas(1)	5						GAAATGTTAAGTCTGAAAACA	0.303																																																	0													91.0	88.0	89.0					10																	23622110		1846	4084	5930	SO:0001630	splice_region_variant	0			BC035732	CCDS44365.1	10p12.31	2012-05-31			ENSG00000179133	ENSG00000179133			28716	protein-coding gene	gene with protein product						12477932	Standard	NM_153714		Approved	MGC46732	uc010qcx.2	Q8IYJ2	OTTHUMG00000017818	ENST00000323327.4:c.210-1C>A	10.37:g.23622110G>T			A8MUP9|Q5SWD4	Missense_Mutation	SNP	NULL	p.L71I	ENST00000323327.4	37	c.211	CCDS44365.1	10	.	.	.	.	.	.	.	.	.	.	G	9.655	1.142615	0.21205	.	.	ENSG00000179133	ENST00000376500;ENST00000323327	.	.	.	4.53	-4.15	0.03881	.	1.186530	0.06101	N	0.665353	T	0.22205	0.0535	L	0.43152	1.355	0.09310	N	1	B	0.28713	0.22	B	0.25614	0.062	T	0.20874	-1.0262	9	0.26408	T	0.33	0.0585	1.0188	0.01513	0.3271:0.2742:0.2607:0.138	.	71	Q8IYJ2	CJ067_HUMAN	I	21;71	.	ENSP00000321464:L71I	L	-	1	0	C10orf67	23662116	0.032000	0.19561	0.004000	0.12327	0.082000	0.17680	-0.096000	0.11059	-0.528000	0.06366	-0.176000	0.13171	CTT	C10orf67	-	NULL	ENSG00000179133		0.303	C10orf67-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C10orf67	HGNC	protein_coding	OTTHUMT00000047213.1		0.00	65	0	G	NM_153714	Missense_Mutation	23622110	-1			no_errors	ENST00000323327	ensembl	human	known	74_37	missense	6.25	30	2	SNP	0.001	T
C14orf1	11161	genome.wustl.edu	37	14	76117945	76117945	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr14:76117945G>A	ENST00000256319.6	-	5	821	c.376C>T	c.(376-378)Cgg>Tgg	p.R126W	FLVCR2_ENST00000556241.1_Intron|FLVCR2_ENST00000553587.1_Intron	NM_007176.3	NP_009107.1	Q9UKR5	ERG28_HUMAN	chromosome 14 open reading frame 1	126					sterol biosynthetic process (GO:0016126)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|transport vesicle (GO:0030133)				central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(2)	6		all_epithelial(191;0.125)|all_neural(303;0.13)|Myeloproliferative disorder(585;0.163)		BRCA - Breast invasive adenocarcinoma(234;0.00147)		TCTAGATACCGGAGCCCGACC	0.463																																																	0													170.0	167.0	168.0					14																	76117945		2203	4300	6503	SO:0001583	missense	0			AF134159	CCDS9845.1	14q24.3	2012-08-16			ENSG00000133935	ENSG00000133935			1187	protein-coding gene	gene with protein product		604576				10449901, 12958361, 11160377	Standard	NM_007176		Approved	NET51, ERG28	uc001xrt.3	Q9UKR5	OTTHUMG00000171488	ENST00000256319.6:c.376C>T	14.37:g.76117945G>A	ENSP00000256319:p.Arg126Trp		Q9P093|Q9UPI2	Missense_Mutation	SNP	pfam_Erg28	p.R126W	ENST00000256319.6	37	c.376	CCDS9845.1	14	.	.	.	.	.	.	.	.	.	.	G	15.39	2.817998	0.50633	.	.	ENSG00000133935	ENST00000256319	.	.	.	5.69	3.88	0.44766	.	0.273735	0.42548	N	0.000685	T	0.41789	0.1174	N	0.19112	0.55	0.37887	D	0.930579	B	0.02656	0.0	B	0.01281	0.0	T	0.32955	-0.9887	9	0.46703	T	0.11	-5.1913	11.9093	0.52729	0.1419:0.0:0.8581:0.0	.	126	Q9UKR5	ERG28_HUMAN	W	126	.	ENSP00000256319:R126W	R	-	1	2	C14orf1	75187698	1.000000	0.71417	0.954000	0.39281	0.872000	0.50106	5.178000	0.65037	0.765000	0.33221	0.650000	0.86243	CGG	C14orf1	-	NULL	ENSG00000133935		0.463	C14orf1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C14orf1	HGNC	protein_coding	OTTHUMT00000413683.1		0.00	70	0	G	NM_007176		76117945	-1			no_errors	ENST00000256319	ensembl	human	known	74_37	missense	5.71	33	2	SNP	1.000	A
C5	727	genome.wustl.edu	37	9	123759888	123759888	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr9:123759888G>T	ENST00000223642.1	-	21	2756	c.2727C>A	c.(2725-2727)aaC>aaA	p.N909K	C5_ENST00000466280.1_5'Flank	NM_001735.2	NP_001726.2	P01031	CO5_HUMAN	complement component 5	909					activation of MAPK activity (GO:0000187)|cell chemotaxis (GO:0060326)|cell surface receptor signaling pathway (GO:0007166)|cellular calcium ion homeostasis (GO:0006874)|chemotaxis (GO:0006935)|complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose homeostasis (GO:0042593)|in utero embryonic development (GO:0001701)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|leukocyte migration involved in inflammatory response (GO:0002523)|negative regulation of dopamine secretion (GO:0033602)|negative regulation of macrophage chemotaxis (GO:0010760)|negative regulation of norepinephrine secretion (GO:0010700)|positive regulation of angiogenesis (GO:0045766)|positive regulation of chemokine secretion (GO:0090197)|positive regulation of chemotaxis (GO:0050921)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of complement activation (GO:0030449)|response to stress (GO:0006950)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane attack complex (GO:0005579)	chemokine activity (GO:0008009)|endopeptidase inhibitor activity (GO:0004866)|receptor binding (GO:0005102)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(14)|lung(5)|ovary(2)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	46				OV - Ovarian serous cystadenocarcinoma(323;4.98e-53)|GBM - Glioblastoma multiforme(294;0.0242)	Eculizumab(DB01257)|Intravenous Immunoglobulin(DB00028)	AAAAATTGATGTTGTGAAGGC	0.408																																																	0													71.0	66.0	67.0					9																	123759888		2203	4300	6503	SO:0001583	missense	0			M57729	CCDS6826.1	9q33-q34	2014-09-17			ENSG00000106804	ENSG00000106804		"""Complement system"", ""Endogenous ligands"""	1331	protein-coding gene	gene with protein product	"""prepro-C5"", ""C5a anaphylatoxin"""	120900					Standard	NM_001735		Approved	CPAMD4, C5a, C5b	uc004bkv.3	P01031	OTTHUMG00000020579	ENST00000223642.1:c.2727C>A	9.37:g.123759888G>T	ENSP00000223642:p.Asn909Lys		Q14CJ0|Q27I61	Missense_Mutation	SNP	pfam_A2M_comp,pfam_Macroglobln_a2,pfam_A2M_N_2,pfam_A-macroglobulin_rcpt-bd,pfam_Netrin_module_non-TIMP,pfam_A2M_N,pfam_Anaphylatoxin/fibulin,superfamily_Terpenoid_cyclase/PrenylTrfase,superfamily_TIMP-like_OB-fold,superfamily_A-macroglobulin_rcpt-bd,superfamily_Anaphylatoxin_comp_syst,smart_Anaphylatoxin/fibulin,smart_Netrin_module_non-TIMP,pfscan_Anaphylatoxin/fibulin,pfscan_Netrin_domain,prints_Anaphylatoxn_comp_syst_dom	p.N909K	ENST00000223642.1	37	c.2727	CCDS6826.1	9	.	.	.	.	.	.	.	.	.	.	G	11.62	1.693826	0.30052	.	.	ENSG00000106804	ENST00000223642;ENST00000430906	T	0.33865	1.39	5.53	-1.39	0.08997	.	0.402484	0.27851	N	0.017599	T	0.21103	0.0508	L	0.48362	1.52	0.09310	N	0.999999	B	0.14438	0.01	B	0.11329	0.006	T	0.24190	-1.0167	10	0.10111	T	0.7	.	4.4994	0.11856	0.5142:0.0:0.3268:0.159	.	909	P01031	CO5_HUMAN	K	909;980	ENSP00000223642:N909K	ENSP00000223642:N909K	N	-	3	2	C5	122799709	0.013000	0.17824	0.654000	0.29608	0.900000	0.52787	-0.927000	0.03984	-0.094000	0.12374	0.655000	0.94253	AAC	C5	-	NULL	ENSG00000106804		0.408	C5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C5	HGNC	protein_coding	OTTHUMT00000053844.1	-	0.00	67	0	G	NM_001735		123759888	-1	tier1	-	no_errors	ENST00000223642	ensembl	human	known	74_37	missense	5.41	70	4	SNP	0.140	T
CYSRT1	375791	genome.wustl.edu	37	9	140120472	140120472	+	Nonsense_Mutation	SNP	C	C	A			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr9:140120472C>A	ENST00000359069.2	+	2	449	c.399C>A	c.(397-399)tgC>tgA	p.C133*	C9orf169_ENST00000409414.1_Nonsense_Mutation_p.C173*|RNF224_ENST00000445101.2_5'Flank	NM_199001.2	NP_945352.2	A8MQ03	CRTP1_HUMAN		133	Cys-rich.					extracellular vesicular exosome (GO:0070062)				central_nervous_system(1)	1						cccccttctgccgctgccaca	0.687																																																	0													2.0	3.0	2.0					9																	140120472		391	1115	1506	SO:0001587	stop_gained	0																														ENST00000359069.2:c.399C>A	9.37:g.140120472C>A	ENSP00000351967:p.Cys133*		Q86UY7	Nonsense_Mutation	SNP	pfam_UPF0574	p.C133*	ENST00000359069.2	37	c.399	CCDS48064.1	9	.	.	.	.	.	.	.	.	.	.	C	37	6.090275	0.97271	.	.	ENSG00000197191	ENST00000409414;ENST00000359069	.	.	.	4.07	2.03	0.26663	.	0.000000	0.37393	U	0.002113	.	.	.	.	.	.	0.36603	D	0.874797	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	4.9004	0.13771	0.0:0.6574:0.2184:0.1242	.	.	.	.	X	173;133	.	ENSP00000351967:C133X	C	+	3	2	C9orf169	139240293	1.000000	0.71417	1.000000	0.80357	0.363000	0.29612	2.199000	0.42715	0.697000	0.31718	0.313000	0.20887	TGC	C9orf169	-	pfam_UPF0574	ENSG00000197191		0.687	C9orf169-201	KNOWN	basic|appris_principal|CCDS	protein_coding	C9orf169	HGNC	protein_coding			0.00	51	0	C			140120472	+1			no_errors	ENST00000359069	ensembl	human	known	74_37	nonsense	12.90	27	4	SNP	1.000	A
CASD1	64921	genome.wustl.edu	37	7	94167097	94167097	+	Missense_Mutation	SNP	G	G	A	rs371554475		TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr7:94167097G>A	ENST00000297273.4	+	9	1444	c.1157G>A	c.(1156-1158)cGt>cAt	p.R386H		NM_022900.4	NP_075051.4	Q96PB1	CASD1_HUMAN	CAS1 domain containing 1	386			R -> S (in dbSNP:rs17855797). {ECO:0000269|PubMed:15489334}.			integral component of membrane (GO:0016021)		p.R386H(1)		NS(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(13)|ovary(3)|stomach(2)|upper_aerodigestive_tract(1)	31	all_cancers(62;6.71e-10)|all_epithelial(64;5e-09)|Lung NSC(181;0.188)|all_lung(186;0.215)		STAD - Stomach adenocarcinoma(171;0.0031)			ATGTGTGACCGTGCAAATCTG	0.289													G|||	1	0.000199681	0.0008	0.0	5008	,	,		18079	0.0		0.0	False		,,,				2504	0.0																1	Substitution - Missense(1)	large_intestine(1)						G	HIS/ARG	0,4404		0,0,2202	97.0	108.0	104.0		1157	4.6	1.0	7		104	1,8599	1.2+/-3.3	0,1,4299	no	missense	CASD1	NM_022900.4	29	0,1,6501	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	386/798	94167097	1,13003	2202	4300	6502	SO:0001583	missense	0			AF355594	CCDS5636.1	7q22	2006-03-09			ENSG00000127995	ENSG00000127995			16014	protein-coding gene	gene with protein product	"""chromosome 7 open reading frame 12"""	611686				11703667, 11528394	Standard	NM_022900		Approved	FLJ21213, FLJ21879, C7orf12	uc003uni.4	Q96PB1	OTTHUMG00000023356	ENST00000297273.4:c.1157G>A	7.37:g.94167097G>A	ENSP00000297273:p.Arg386His		B3KW13|O14574|Q3LIE2|Q6P4R4|Q9H6T9|Q9H770	Missense_Mutation	SNP	pfam_Cas1_AcylTrans_dom,superfamily_Cyclin-like	p.R386H	ENST00000297273.4	37	c.1157	CCDS5636.1	7	.	.	.	.	.	.	.	.	.	.	G	24.9	4.586622	0.86851	0.0	1.16E-4	ENSG00000127995	ENST00000297273	T	0.64438	-0.1	5.51	4.63	0.57726	.	0.049300	0.85682	N	0.000000	T	0.65933	0.2739	M	0.79693	2.465	0.58432	D	0.999998	B;B	0.17038	0.02;0.02	B;B	0.19946	0.027;0.027	T	0.67577	-0.5635	10	0.87932	D	0	.	14.4995	0.67711	0.0709:0.0:0.9291:0.0	.	386;386	Q8WZ77;Q96PB1	.;CASD1_HUMAN	H	386	ENSP00000297273:R386H	ENSP00000297273:R386H	R	+	2	0	CASD1	94005033	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.606000	0.98325	1.475000	0.48197	0.585000	0.79938	CGT	CASD1	-	pfam_Cas1_AcylTrans_dom	ENSG00000127995		0.289	CASD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CASD1	HGNC	protein_coding	OTTHUMT00000255216.1		0.00	50	0	G	NM_022900		94167097	+1			no_errors	ENST00000297273	ensembl	human	known	74_37	missense	5.88	32	2	SNP	1.000	A
CD109	135228	genome.wustl.edu	37	6	74519854	74519854	+	Missense_Mutation	SNP	T	T	C			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr6:74519854T>C	ENST00000287097.5	+	27	3615	c.3503T>C	c.(3502-3504)cTa>cCa	p.L1168P	CD109_ENST00000437994.2_Missense_Mutation_p.L1168P|CD109_ENST00000422508.2_Missense_Mutation_p.L1091P			Q6YHK3	CD109_HUMAN	CD109 molecule	1168					negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|negative regulation of wound healing (GO:0061045)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)	serine-type endopeptidase inhibitor activity (GO:0004867)|transforming growth factor beta binding (GO:0050431)	p.L1168P(1)		NS(2)|biliary_tract(1)|breast(1)|endometrium(4)|kidney(2)|large_intestine(18)|liver(2)|lung(26)|ovary(2)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	63						ATGAGGTGGCTAAGCAGGCAA	0.393																																																	1	Substitution - Missense(1)	endometrium(1)											63.0	61.0	62.0					6																	74519854		2203	4299	6502	SO:0001583	missense	0			AF410459	CCDS4982.1, CCDS55038.1, CCDS55039.1	6q14.1	2008-02-05	2006-03-28		ENSG00000156535	ENSG00000156535		"""CD molecules"""	21685	protein-coding gene	gene with protein product		608859	"""CD109 antigen (Gov platelet alloantigens)"""			11861284, 11861285	Standard	XM_005248659		Approved	FLJ38569, DKFZp762L1111, CPAMD7	uc003php.3	Q6YHK3	OTTHUMG00000015040	ENST00000287097.5:c.3503T>C	6.37:g.74519854T>C	ENSP00000287097:p.Leu1168Pro		A5YKK4|B2R948|B3KW25|Q0P6K7|Q5SYA8|Q5XUM7|Q5XUM9|Q6MZI7|Q8N3A7|Q8N915|Q8TDJ2|Q8TDJ3	Missense_Mutation	SNP	pfam_A2M_comp,pfam_A2M_N_2,pfam_Macroglobln_a2,pfam_A-macroglobulin_rcpt-bd,pfam_A2M_N,pfam_MacrogloblnA2_thiol-ester-bond,superfamily_Terpenoid_cyclase/PrenylTrfase,superfamily_A-macroglobulin_rcpt-bd	p.L1168P	ENST00000287097.5	37	c.3503	CCDS4982.1	6	.	.	.	.	.	.	.	.	.	.	T	20.2	3.948824	0.73787	.	.	ENSG00000156535	ENST00000437994;ENST00000422508;ENST00000287097	T;T;T	0.68479	-0.33;-0.33;-0.33	5.3	5.3	0.74995	Terpenoid cylases/protein prenyltransferase alpha-alpha toroid (1);A-macroglobulin complement component (1);	0.000000	0.64402	D	0.000001	D	0.85539	0.5720	H	0.96518	3.835	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.97110	1.0;0.999;0.996	D	0.90224	0.4274	10	0.87932	D	0	.	15.4015	0.74843	0.0:0.0:0.0:1.0	.	1091;1168;1168	Q6YHK3-2;Q6YHK3-4;Q6YHK3	.;.;CD109_HUMAN	P	1168;1091;1168	ENSP00000388062:L1168P;ENSP00000404475:L1091P;ENSP00000287097:L1168P	ENSP00000287097:L1168P	L	+	2	0	CD109	74576575	1.000000	0.71417	0.906000	0.35671	0.850000	0.48378	7.257000	0.78362	2.225000	0.72522	0.533000	0.62120	CTA	CD109	-	pfam_A2M_comp,superfamily_Terpenoid_cyclase/PrenylTrfase	ENSG00000156535		0.393	CD109-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CD109	HGNC	protein_coding	OTTHUMT00000041230.3		0.00	33	0	T	NM_133493		74519854	+1			no_errors	ENST00000287097	ensembl	human	known	74_37	missense	10.00	18	2	SNP	0.992	C
CDCA7L	55536	genome.wustl.edu	37	7	21945184	21945184	+	Silent	SNP	G	G	A	rs113584859		TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr7:21945184G>A	ENST00000406877.3	-	7	1266	c.987C>T	c.(985-987)acC>acT	p.T329T	CDCA7L_ENST00000373934.4_Silent_p.T283T|CDCA7L_ENST00000356195.5_Silent_p.T295T|CDCA7L_ENST00000465490.1_5'UTR	NM_018719.4	NP_061189.2	Q96GN5	CDA7L_HUMAN	cell division cycle associated 7-like	329					positive regulation of cell proliferation (GO:0008284)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)				NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(8)|prostate(2)|skin(1)|urinary_tract(1)	29						AGTCCTCTTCGGTGATATCCT	0.413													G|||	1	0.000199681	0.0	0.0	5008	,	,		17688	0.0		0.001	False		,,,				2504	0.0																0													94.0	90.0	91.0					7																	21945184		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS5374.1, CCDS47558.1, CCDS47559.1	7p15.3	2007-04-27			ENSG00000164649	ENSG00000164649			30777	protein-coding gene	gene with protein product		609685				16829576	Standard	NM_018719		Approved	RAM2, R1, JPO2	uc010kuk.3	Q96GN5	OTTHUMG00000128429	ENST00000406877.3:c.987C>T	7.37:g.21945184G>A			A4D141|A6NF50|B3KTR5|B4DUT3|C9K0Y1|Q6PIL4|Q86YT0|Q8IXN5|Q96C70|Q9H9A2|Q9NPV2	Silent	SNP	pfam_Znf-4CXXC_R1	p.T329	ENST00000406877.3	37	c.987	CCDS5374.1	7																																																																																			CDCA7L	-	NULL	ENSG00000164649		0.413	CDCA7L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDCA7L	HGNC	protein_coding	OTTHUMT00000250218.4		0.00	42	0	G	NM_018719		21945184	-1			no_errors	ENST00000406877	ensembl	human	known	74_37	silent	6.67	28	2	SNP	0.646	A
CDH15	1013	genome.wustl.edu	37	16	89259946	89259946	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr16:89259946G>T	ENST00000289746.2	+	12	1989	c.1924G>T	c.(1924-1926)Ggc>Tgc	p.G642C		NM_004933.2	NP_004924.1	P55291	CAD15_HUMAN	cadherin 15, type 1, M-cadherin (myotubule)	642					adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|muscle cell differentiation (GO:0042692)|positive regulation of muscle cell differentiation (GO:0051149)	caveola (GO:0005901)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(9)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	18				BRCA - Breast invasive adenocarcinoma(80;0.0261)		GCTGCTGCACGGCCCCCAGGA	0.682																																																	0													26.0	26.0	26.0					16																	89259946		2182	4288	6470	SO:0001583	missense	0			D83542	CCDS10976.1	16q24.3	2010-01-26	2008-10-30		ENSG00000129910	ENSG00000129910		"""Cadherins / Major cadherins"""	1754	protein-coding gene	gene with protein product		114019	"""cadherin 15, M-cadherin (myotubule)"""	CDH3, CDH14		1427864	Standard	NM_004933		Approved		uc002fmt.3	P55291	OTTHUMG00000138045	ENST00000289746.2:c.1924G>T	16.37:g.89259946G>T	ENSP00000289746:p.Gly642Cys			Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.G642C	ENST00000289746.2	37	c.1924	CCDS10976.1	16	.	.	.	.	.	.	.	.	.	.	G	11.96	1.795822	0.31777	.	.	ENSG00000129910	ENST00000289746	T	0.77358	-1.09	4.47	2.5	0.30297	Cadherin, cytoplasmic domain (1);	0.124835	0.34484	U	0.003928	D	0.83312	0.5227	M	0.69463	2.115	0.26392	N	0.97656	D	0.76494	0.999	D	0.67382	0.951	T	0.74019	-0.3799	10	0.41790	T	0.15	.	9.6914	0.40131	0.1768:0.0:0.8232:0.0	.	642	P55291	CAD15_HUMAN	C	642	ENSP00000289746:G642C	ENSP00000289746:G642C	G	+	1	0	CDH15	87787447	0.010000	0.17322	0.008000	0.14137	0.050000	0.14768	0.434000	0.21494	0.330000	0.23485	-0.252000	0.11476	GGC	CDH15	-	pfam_Cadherin_cytoplasmic-dom	ENSG00000129910		0.682	CDH15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH15	HGNC	protein_coding	OTTHUMT00000269920.1		0.00	71	0	G	NM_004933		89259946	+1			no_errors	ENST00000289746	ensembl	human	known	74_37	missense	5.00	38	2	SNP	0.483	T
CDHR4	389118	genome.wustl.edu	37	3	49834363	49834363	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr3:49834363C>T	ENST00000412678.2	-	5	606	c.598G>A	c.(598-600)Gct>Act	p.A200T		NM_001007540.2	NP_001007541.2	A6H8M9	CDHR4_HUMAN	cadherin-related family member 4	200					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(3)|large_intestine(3)|lung(3)	11						ACCTTTTGAGCCTGGCCTAGG	0.522																																																	0													72.0	67.0	69.0					3																	49834363		692	1591	2283	SO:0001583	missense	0				CCDS46829.1	3p21.31	2011-07-01	2010-01-25	2010-01-25	ENSG00000187492	ENSG00000187492		"""Cadherins / Cadherin-related"""	34527	protein-coding gene	gene with protein product			"""cadherin-like 29"""	CDH29			Standard	NM_001007540		Approved	VLLR9392	uc010hkz.3	A6H8M9	OTTHUMG00000158198	ENST00000412678.2:c.598G>A	3.37:g.49834363C>T	ENSP00000391409:p.Ala200Thr		Q6UXT0	Missense_Mutation	SNP	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.A200T	ENST00000412678.2	37	c.598	CCDS46829.1	3	.	.	.	.	.	.	.	.	.	.	C	12.44	1.939913	0.34283	.	.	ENSG00000187492	ENST00000412678	T	0.56776	0.44	5.25	3.45	0.39498	.	.	.	.	.	T	0.36276	0.0961	L	0.32530	0.975	0.58432	D	0.999998	P	0.37061	0.58	B	0.37601	0.254	T	0.05750	-1.0866	9	0.15066	T	0.55	-4.2962	7.0473	0.25052	0.1702:0.7412:0.0:0.0887	.	200	A6H8M9	CDHR4_HUMAN	T	200	ENSP00000391409:A200T	ENSP00000391409:A200T	A	-	1	0	CDHR4	49809367	1.000000	0.71417	0.771000	0.31576	0.016000	0.09150	2.052000	0.41316	0.725000	0.32318	-0.142000	0.14014	GCT	CDHR4	-	NULL	ENSG00000187492		0.522	CDHR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDHR4	HGNC	protein_coding	OTTHUMT00000350387.1	-	0.00	103	0	C	NM_001007540		49834363	-1	tier1	-	no_errors	ENST00000412678	ensembl	human	known	74_37	missense	9.09	40	4	SNP	0.841	T
CDS2	8760	genome.wustl.edu	37	20	5107779	5107779	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr20:5107779C>T	ENST00000460006.1	+	1	348	c.41C>T	c.(40-42)gCg>gTg	p.A14V	CDS2_ENST00000379062.4_Missense_Mutation_p.R5C|PCNA_ENST00000379160.3_5'Flank	NM_003818.3	NP_003809.1	O95674	CDS2_HUMAN	CDP-diacylglycerol synthase (phosphatidate cytidylyltransferase) 2	14					CDP-diacylglycerol biosynthetic process (GO:0016024)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylglycerol biosynthetic process (GO:0006655)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)	phosphatidate cytidylyltransferase activity (GO:0004605)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(4)|prostate(1)|stomach(1)	14						GAGCCGGTTGCGCCACCCGAG	0.726																																																	0													10.0	9.0	9.0					20																	5107779		1867	3595	5462	SO:0001583	missense	0			AF069532	CCDS13088.1	20p13	2006-03-28			ENSG00000101290	ENSG00000101290	2.7.7.41		1801	protein-coding gene	gene with protein product		603549				9806839, 9889000	Standard	NM_003818		Approved		uc002wls.3	O95674	OTTHUMG00000031801	ENST00000460006.1:c.41C>T	20.37:g.5107779C>T	ENSP00000419879:p.Ala14Val		B2RDC6|D3DW04|Q5TDY2|Q5TDY3|Q5TDY4|Q5TDY5|Q9BYK5|Q9NTT2	Missense_Mutation	SNP	pfam_PC_trans,pirsf_PC_Trfase_euk	p.A14V	ENST00000460006.1	37	c.41	CCDS13088.1	20	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	14.94|14.94	2.685141|2.685141	0.47991|0.47991	.|.	.|.	ENSG00000101290|ENSG00000101290	ENST00000460006|ENST00000450570;ENST00000379062	T|T	0.46063|0.47869	0.88|0.83	4.99|4.99	1.6|1.6	0.23607|0.23607	.|.	0.433316|.	0.23260|.	N|.	0.050151|.	T|T	0.33556|0.33556	0.0867|0.0867	L|L	0.29908|0.29908	0.895|0.895	0.18873|0.18873	N|N	0.999986|0.999986	B|B	0.25486|0.33940	0.127|0.433	B|B	0.14023|0.34931	0.01|0.192	T|T	0.26503|0.26503	-1.0101|-1.0101	10|9	0.28530|0.66056	T|D	0.3|0.02	.|.	6.1184|6.1184	0.20139|0.20139	0.0:0.53:0.3637:0.1063|0.0:0.53:0.3637:0.1063	.|.	14|5	O95674|E7EQ83	CDS2_HUMAN|.	V|C	14|5	ENSP00000419879:A14V|ENSP00000403205:R5C	ENSP00000419879:A14V|ENSP00000368352:R5C	A|R	+|+	2|1	0|0	CDS2|CDS2	5055779|5055779	0.634000|0.634000	0.27190|0.27190	0.205000|0.205000	0.23548|0.23548	0.827000|0.827000	0.46813|0.46813	0.923000|0.923000	0.28757|0.28757	0.704000|0.704000	0.31869|0.31869	0.579000|0.579000	0.79373|0.79373	GCG|CGC	CDS2	-	pirsf_PC_Trfase_euk	ENSG00000101290		0.726	CDS2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	CDS2	HGNC	protein_coding	OTTHUMT00000077858.2	-	0.00	22	0	C			5107779	+1	tier1	-	no_errors	ENST00000460006	ensembl	human	known	74_37	missense	19.05	17	4	SNP	0.020	T
CELA2B	51032	genome.wustl.edu	37	1	15807634	15807634	+	Silent	SNP	C	C	A			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr1:15807634C>A	ENST00000375910.3	+	3	196	c.171C>A	c.(169-171)acC>acA	p.T57T	CELA2B_ENST00000494280.1_3'UTR	NM_015849.2	NP_056933	P08218	CEL2B_HUMAN	chymotrypsin-like elastase family, member 2B	57	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)			breast(1)|endometrium(1)|large_intestine(1)|lung(4)|ovary(1)	8						GGTACCACACCTGCGGAGGGT	0.622																																																	0													129.0	113.0	118.0					1																	15807634		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS30605.1	1p36.21	2009-07-09			ENSG00000215704	ENSG00000215704			29995	protein-coding gene	gene with protein product	"""pancreatic elastase IIB"""	609444				3646943, 16327289	Standard	NM_015849		Approved	RP11-265F14.2, ELA2B	uc001awl.3	P08218	OTTHUMG00000002259	ENST00000375910.3:c.171C>A	1.37:g.15807634C>A			Q14D16|Q6ISM5|Q96QV5	Silent	SNP	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1,prints_Peptidase_S1A	p.T57	ENST00000375910.3	37	c.171	CCDS30605.1	1																																																																																			CELA2B	-	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1	ENSG00000215704		0.622	CELA2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CELA2B	HGNC	protein_coding	OTTHUMT00000006448.1		0.00	71	0	C	NM_015849		15807634	+1			no_errors	ENST00000375910	ensembl	human	known	74_37	silent	7.27	51	4	SNP	1.000	A
CEP152	22995	genome.wustl.edu	37	15	49054609	49054609	+	Missense_Mutation	SNP	A	A	T			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr15:49054609A>T	ENST00000380950.2	-	18	2728	c.2541T>A	c.(2539-2541)caT>caA	p.H847Q	CEP152_ENST00000325747.5_Missense_Mutation_p.H754Q|CEP152_ENST00000399334.3_Missense_Mutation_p.H847Q	NM_001194998.1|NM_014985.3	NP_001181927.1|NP_055800.2	O94986	CE152_HUMAN	centrosomal protein 152kDa	847					cell projection organization (GO:0030030)|centriole replication (GO:0007099)|centrosome duplication (GO:0051298)|de novo centriole assembly (GO:0098535)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytosol (GO:0005829)|deuterosome (GO:0098536)|nucleus (GO:0005634)	protein kinase binding (GO:0019901)			breast(3)|cervix(3)|endometrium(3)|kidney(3)|large_intestine(16)|lung(30)|ovary(1)|prostate(2)|skin(2)	63		all_lung(180;0.0428)		all cancers(107;1.08e-07)|GBM - Glioblastoma multiforme(94;2.32e-06)		TATTTTCACAATGTTTGAGTT	0.358																																																	0													142.0	125.0	130.0					15																	49054609		1817	4079	5896	SO:0001583	missense	0			AB020719	CCDS42033.1, CCDS58361.1	15q21.1	2014-02-20							29298	protein-coding gene	gene with protein product	"""asterless"""	613529	"""microcephaly, primary autosomal recessive 4"""	MCPH4		14654843, 21131973	Standard	NM_014985		Approved	KIAA0912, SCKL5	uc001zwz.3	O94986		ENST00000380950.2:c.2541T>A	15.37:g.49054609A>T	ENSP00000370337:p.His847Gln		E7ER66|Q17RV1|Q6NTA0	Missense_Mutation	SNP	NULL	p.H847Q	ENST00000380950.2	37	c.2541	CCDS58361.1	15	.	.	.	.	.	.	.	.	.	.	A	9.076	0.998120	0.19043	.	.	ENSG00000103995	ENST00000380950;ENST00000325747;ENST00000399334	T;T;T	0.55413	0.54;0.55;0.52	5.18	-4.58	0.03410	.	0.211100	0.42420	D	0.000703	T	0.33556	0.0867	L	0.27053	0.805	0.25575	N	0.986856	P;B;B	0.34757	0.467;0.118;0.256	B;B;B	0.31686	0.134;0.094;0.132	T	0.15122	-1.0448	10	0.54805	T	0.06	-6.8208	14.496	0.67688	0.4171:0.0:0.5829:0.0	.	754;847;847	O94986-1;E7ER66;O94986	.;.;CE152_HUMAN	Q	847;754;847	ENSP00000370337:H847Q;ENSP00000321000:H754Q;ENSP00000382271:H847Q	ENSP00000321000:H754Q	H	-	3	2	CEP152	46841901	0.981000	0.34729	0.789000	0.31954	0.124000	0.20399	0.188000	0.17018	-0.970000	0.03569	-0.297000	0.09499	CAT	CEP152	-	NULL	ENSG00000103995		0.358	CEP152-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CEP152	HGNC	protein_coding	OTTHUMT00000417365.1	-	0.00	47	0	A	NM_014985		49054609	-1	tier1	-	no_errors	ENST00000380950	ensembl	human	known	74_37	missense	10.26	35	4	SNP	0.364	T
CILP2	148113	genome.wustl.edu	37	19	19654602	19654602	+	Silent	SNP	C	C	A	rs149322116		TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr19:19654602C>A	ENST00000291495.5	+	8	1333	c.1248C>A	c.(1246-1248)ccC>ccA	p.P416P	CILP2_ENST00000586018.1_Silent_p.P422P	NM_153221.2	NP_694953.2	Q8IUL8	CILP2_HUMAN	cartilage intermediate layer protein 2	416						extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)				NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(3)|lung(17)|ovary(2)|prostate(2)|skin(1)|urinary_tract(1)	32						GCCTCTGTCCCGACACCCGCT	0.687																																																	0													58.0	65.0	63.0					19																	19654602		2203	4300	6503	SO:0001819	synonymous_variant	0			AF542080	CCDS12405.1	19p13.11	2013-01-14				ENSG00000160161		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	24213	protein-coding gene	gene with protein product		612419				12477932	Standard	NM_153221		Approved	MGC45771	uc002nmv.4	Q8IUL8		ENST00000291495.5:c.1248C>A	19.37:g.19654602C>A			Q6NV88|Q8N4A6|Q8WV21	Silent	SNP	pfam_Thrombospondin_1_rpt,pfam_Ig_I-set,superfamily_Thrombospondin_1_rpt,superfamily_CarboxyPept-like_regulatory,superfamily_Carb-bd-like_fold,smart_Thrombospondin_1_rpt,smart_Ig_sub,smart_Ig_sub2,pfscan_Thrombospondin_1_rpt,pfscan_Ig-like_dom	p.P416	ENST00000291495.5	37	c.1248	CCDS12405.1	19																																																																																			CILP2	-	NULL	ENSG00000160161		0.687	CILP2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	CILP2	HGNC	protein_coding	OTTHUMT00000459738.3		0.00	72	0	C	NM_153221		19654602	+1			no_errors	ENST00000291495	ensembl	human	known	74_37	silent	5.45	51	3	SNP	0.010	A
CLPTM1L	81037	genome.wustl.edu	37	5	1341903	1341903	+	Silent	SNP	G	G	A			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr5:1341903G>A	ENST00000320895.5	-	3	593	c.336C>T	c.(334-336)caC>caT	p.H112H	CLPTM1L_ENST00000320927.6_Silent_p.H112H|CLPTM1L_ENST00000507807.1_5'Flank	NM_030782.3	NP_110409.2	Q96KA5	CLP1L_HUMAN	CLPTM1-like	112					apoptotic process (GO:0006915)	integral component of membrane (GO:0016021)|membrane (GO:0016020)				breast(2)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(2)|lung(6)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	24	Lung NSC(6;5.78e-14)|all_lung(6;4.47e-13)|all_epithelial(6;4.47e-09)		Epithelial(17;0.00931)|OV - Ovarian serous cystadenocarcinoma(19;0.0116)|all cancers(22;0.0181)	KIRC - Kidney renal clear cell carcinoma(5;0.177)|Kidney(13;0.208)		GGACCCCAGCGTGATGGAGGA	0.512																																																	0													139.0	109.0	120.0					5																	1341903		2203	4300	6503	SO:0001819	synonymous_variant	0			AK027306	CCDS3862.1	5p15.33	2008-02-05			ENSG00000049656	ENSG00000049656			24308	protein-coding gene	gene with protein product	"""cisplatin resistance related protein"""	612585				11162647	Standard	NM_030782		Approved	FLJ14400, CRR9	uc003jch.3	Q96KA5	OTTHUMG00000131015	ENST00000320895.5:c.336C>T	5.37:g.1341903G>A			D3DTC1|Q658W6|Q7LG29|Q96AZ0|Q9H3N4	Silent	SNP	pfam_CLPTM1	p.H112	ENST00000320895.5	37	c.336	CCDS3862.1	5																																																																																			CLPTM1L	-	pfam_CLPTM1	ENSG00000049656		0.512	CLPTM1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLPTM1L	HGNC	protein_coding	OTTHUMT00000253649.2	-	0.00	60	0	G	NM_030782		1341903	-1	tier1	rs138976877	no_errors	ENST00000320895	ensembl	human	known	74_37	silent	35.71	27	15	SNP	0.161	A
COL12A1	1303	genome.wustl.edu	37	6	75892984	75892984	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr6:75892984C>A	ENST00000322507.8	-	10	1982	c.1673G>T	c.(1672-1674)aGa>aTa	p.R558I	COL12A1_ENST00000483888.2_Missense_Mutation_p.R558I|COL12A1_ENST00000345356.6_Intron|COL12A1_ENST00000416123.2_Missense_Mutation_p.R558I	NM_004370.5	NP_004361.3	Q99715	COCA1_HUMAN	collagen, type XII, alpha 1	558	VWFA 2. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	collagen type XII trimer (GO:0005595)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|vesicle (GO:0031982)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)			breast(7)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(44)|liver(1)|lung(77)|ovary(7)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	169						CGCAGGATCTCTGAAAGCATC	0.428																																																	0													169.0	160.0	163.0					6																	75892984		1919	4136	6055	SO:0001583	missense	0			U73779	CCDS43481.1, CCDS43482.1	6q12-q13	2013-02-11	2003-07-24		ENSG00000111799	ENSG00000111799		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"", ""Fibronectin type III domain containing"""	2188	protein-coding gene	gene with protein product	"""collagen type XII proteoglycan"""	120320	"""collagen, type XII, alpha 1-like"""	COL12A1L		9143499	Standard	XM_006715334		Approved		uc003phs.3	Q99715	OTTHUMG00000015051	ENST00000322507.8:c.1673G>T	6.37:g.75892984C>A	ENSP00000325146:p.Arg558Ile		O43853|Q15955|Q5VYK1|Q5VYK2|Q71UR3|Q99716	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_VWF_A,pfam_Collagen,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_VWF_A,smart_Laminin_G,pfscan_Fibronectin_type3,pfscan_VWF_A	p.R558I	ENST00000322507.8	37	c.1673	CCDS43482.1	6	.	.	.	.	.	.	.	.	.	.	C	16.26	3.074075	0.55646	.	.	ENSG00000111799	ENST00000322507;ENST00000432784;ENST00000416123;ENST00000483888	D;D;D	0.83419	-1.72;-1.72;-1.72	5.56	4.68	0.58851	von Willebrand factor, type A (3);	0.074841	0.56097	D	0.000024	T	0.64627	0.2615	N	0.25201	0.72	0.45502	D	0.998463	P;P	0.49696	0.927;0.927	P;P	0.45998	0.5;0.5	T	0.72151	-0.4377	10	0.72032	D	0.01	.	5.573	0.17208	0.0:0.7346:0.0:0.2654	.	558;558	D6RGG3;Q99715	.;COCA1_HUMAN	I	558	ENSP00000325146:R558I;ENSP00000412864:R558I;ENSP00000421216:R558I	ENSP00000325146:R558I	R	-	2	0	COL12A1	75949704	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.544000	0.45761	2.777000	0.95525	0.655000	0.94253	AGA	COL12A1	-	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	ENSG00000111799		0.428	COL12A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL12A1	HGNC	protein_coding	OTTHUMT00000041249.3		0.00	84	0	C	NM_004370		75892984	-1			no_errors	ENST00000322507	ensembl	human	known	74_37	missense	6.38	43	3	SNP	1.000	A
COL18A1	80781	genome.wustl.edu	37	21	46893894	46893894	+	Splice_Site	SNP	G	G	T			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr21:46893894G>T	ENST00000359759.4	+	3	2003	c.1982G>T	c.(1981-1983)gGg>gTg	p.G661V	COL18A1_ENST00000355480.5_Splice_Site_p.G426V|COL18A1_ENST00000400337.2_Splice_Site_p.G246V			P39060	COIA1_HUMAN	collagen, type XVIII, alpha 1	661	Nonhelical region 1 (NC1).				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|endothelial cell morphogenesis (GO:0001886)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of cell proliferation (GO:0008285)|organ morphogenesis (GO:0009887)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell apoptotic process (GO:2000353)|response to drug (GO:0042493)|response to hydrostatic pressure (GO:0051599)|visual perception (GO:0007601)	basement membrane (GO:0005604)|collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|structural molecule activity (GO:0005198)			breast(1)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	25				Colorectal(79;0.0157)|READ - Rectum adenocarcinoma(84;0.0929)		GACTCAGATGGGGTGAGTGAC	0.592																																																	0													24.0	26.0	25.0					21																	46893894		2018	4158	6176	SO:0001630	splice_region_variant	0				CCDS42971.1, CCDS42972.1	21q22.3	2013-01-16			ENSG00000182871	ENSG00000182871		"""Collagens"""	2195	protein-coding gene	gene with protein product	"""endostatin"""	120328	"""Knobloch syndrome, type 1"""	KNO		8188291, 8776601, 10942434, 17546652	Standard	NM_130445		Approved	KS, KNO1	uc002zhi.3	P39060	OTTHUMG00000090407	ENST00000359759.4:c.1983+1G>T	21.37:g.46893894G>T			A8MVI4|Q58EX6|Q6RZ39|Q6RZ40|Q6RZ41|Q8N4S4|Q8WXI5|Q96T70|Q9UK38|Q9Y6Q7|Q9Y6Q8	Missense_Mutation	SNP	pfam_Collagenase_NC10/endostatin,pfam_DUF959_COL18_N,pfam_Collagen,pfam_Frizzled_dom,superfamily_C-type_lectin_fold,superfamily_ConA-like_lec_gl_sf,superfamily_Frizzled_dom,smart_Frizzled_dom,smart_Laminin_G,pfscan_Frizzled_dom	p.G661V	ENST00000359759.4	37	c.1982		21	.	.	.	.	.	.	.	.	.	.	G	7.520	0.656546	0.14580	.	.	ENSG00000182871	ENST00000400337;ENST00000400347;ENST00000355480;ENST00000359759;ENST00000539645	T;T;T	0.39787	1.06;1.06;1.06	2.93	2.93	0.34026	.	1.716240	0.03739	N	0.254638	T	0.38026	0.1025	L	0.32530	0.975	0.46564	D	0.999108	B;P;P	0.36535	0.421;0.557;0.557	B;B;B	0.38683	0.145;0.279;0.279	T	0.32134	-0.9918	10	0.39692	T	0.17	.	9.6143	0.39681	0.0:0.0:1.0:0.0	.	661;426;246	P39060;P39060-1;P39060-2	COIA1_HUMAN;.;.	V	246;246;426;661;661	ENSP00000383191:G246V;ENSP00000347665:G426V;ENSP00000352798:G661V	ENSP00000347665:G426V	G	+	2	0	COL18A1	45718322	0.980000	0.34600	0.898000	0.35279	0.371000	0.29859	1.637000	0.37155	1.963000	0.57068	0.186000	0.17326	GGG	COL18A1	-	NULL	ENSG00000182871		0.592	COL18A1-201	KNOWN	basic|appris_principal	protein_coding	COL18A1	HGNC	protein_coding	OTTHUMT00000206827.1	-	0.00	76	0	G		Missense_Mutation	46893894	+1	tier1	-	no_errors	ENST00000359759	ensembl	human	known	74_37	missense	26.47	25	9	SNP	0.896	T
COQ10B	80219	genome.wustl.edu	37	2	198318586	198318586	+	Intron	SNP	C	C	G			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr2:198318586C>G	ENST00000263960.2	+	1	242				COQ10B_ENST00000488445.1_3'UTR|COQ10B_ENST00000409398.1_Intron|COQ10B_ENST00000409010.1_5'UTR|COQ10B_ENST00000545340.1_5'UTR	NM_025147.3	NP_079423.1	Q9H8M1	CQ10B_HUMAN	coenzyme Q10 homolog B (S. cerevisiae)							mitochondrial inner membrane (GO:0005743)				endometrium(1)|large_intestine(2)|lung(3)	6			Epithelial(96;0.231)|OV - Ovarian serous cystadenocarcinoma(117;0.246)			AGGCTGTGTTCGTGGCTCGTT	0.562																																																	0																																										SO:0001627	intron_variant	0			AK023510	CCDS2319.1	2q33.1	2008-02-05	2006-04-04		ENSG00000115520	ENSG00000115520			25819	protein-coding gene	gene with protein product			"""coenzyme Q10 homolog B (yeast)"""				Standard	NM_025147		Approved	FLJ13448	uc002uuh.1	Q9H8M1	OTTHUMG00000132745	ENST00000263960.2:c.104+198C>G	2.37:g.198318586C>G			B7Z1Y4	RNA	SNP	-	NULL	ENST00000263960.2	37	NULL	CCDS2319.1	2																																																																																			COQ10B	-	-	ENSG00000115520		0.562	COQ10B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COQ10B	HGNC	protein_coding	OTTHUMT00000256105.2	-	0.00	54	0	C	NM_025147		198318586	+1	tier1	-	no_errors	ENST00000488445	ensembl	human	known	74_37	rna	32.26	21	10	SNP	0.000	G
COX6B2	125965	genome.wustl.edu	37	19	55865104	55865104	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr19:55865104G>T	ENST00000593184.1	-	4	331	c.252C>A	c.(250-252)ttC>ttA	p.F84L	COX6B2_ENST00000326529.4_Missense_Mutation_p.F84L|COX6B2_ENST00000589467.1_Missense_Mutation_p.F84L|COX6B2_ENST00000588572.2_Missense_Mutation_p.F84L|COX6B2_ENST00000590900.1_Missense_Mutation_p.F84L|CTD-2105E13.6_ENST00000591954.3_3'UTR|COX6B2_ENST00000589879.1_5'Flank			Q6YFQ2	CX6B2_HUMAN	cytochrome c oxidase subunit VIb polypeptide 2 (testis)	84						mitochondrial crista (GO:0030061)	cytochrome-c oxidase activity (GO:0004129)			endometrium(1)|kidney(1)|lung(2)|pancreas(1)	5	Breast(117;0.191)	Renal(1328;0.245)	BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0449)		TTTTGCCGGCGAAAATCCCGT	0.622																																					NSCLC(77;1057 1395 2148 36198 42783)												0													40.0	41.0	41.0					19																	55865104		1884	4106	5990	SO:0001583	missense	0			AK057427	CCDS42630.1	19q13.42	2011-07-04						"""Mitochondrial respiratory chain complex / Complex IV"""	24380	protein-coding gene	gene with protein product	"""cytochrome c oxidase subunit VIb, testes specific"", ""cancer/testis antigen 59"""					12874793	Standard	NM_144613		Approved	COXVIB2, FLJ32865, CT59	uc002qkn.3	Q6YFQ2		ENST00000593184.1:c.252C>A	19.37:g.55865104G>T	ENSP00000467266:p.Phe84Leu		Q7L1R4|Q96DL5	Missense_Mutation	SNP	pfam_Cyt_c_oxidase_su6B,superfamily_Cyt_c_oxidase_su6B,pirsf_Cyt_c_oxidase_su6B	p.F84L	ENST00000593184.1	37	c.252	CCDS42630.1	19	.	.	.	.	.	.	.	.	.	.	g	14.70	2.614607	0.46631	.	.	ENSG00000160471	ENST00000326529	D	0.86097	-2.07	3.85	-1.21	0.09524	.	.	.	.	.	T	0.81143	0.4761	.	.	.	0.09310	N	0.999999	P	0.50710	0.938	P	0.49226	0.603	T	0.70733	-0.4791	8	0.87932	D	0	-10.3955	0.8276	0.01124	0.2949:0.1603:0.3813:0.1635	.	84	Q6YFQ2	CX6B2_HUMAN	L	84	ENSP00000320672:F84L	ENSP00000320672:F84L	F	-	3	2	COX6B2	60556916	1.000000	0.71417	0.030000	0.17652	0.155000	0.21991	1.079000	0.30766	-0.187000	0.10516	0.561000	0.74099	TTC	COX6B2	-	superfamily_Cyt_c_oxidase_su6B,pirsf_Cyt_c_oxidase_su6B	ENSG00000160471		0.622	COX6B2-003	KNOWN	alternative_3_UTR|NMD_exception|basic|appris_principal|CCDS	protein_coding	COX6B2	HGNC	protein_coding	OTTHUMT00000452965.2		0.00	81	0	G	NM_144613		55865104	-1			no_errors	ENST00000326529	ensembl	human	known	74_37	missense	5.56	68	4	SNP	0.019	T
CSMD2	114784	genome.wustl.edu	37	1	34025005	34025005	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr1:34025005C>T	ENST00000373381.4	-	54	8625	c.8449G>A	c.(8449-8451)Gat>Aat	p.D2817N		NM_001281956.1|NM_052896.3	NP_001268885.1|NP_443128.2	Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	2794	Sushi 19. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(5)|breast(5)|central_nervous_system(3)|cervix(2)|endometrium(20)|haematopoietic_and_lymphoid_tissue(4)|kidney(9)|large_intestine(43)|lung(114)|ovary(8)|pancreas(1)|prostate(6)|skin(20)|upper_aerodigestive_tract(5)|urinary_tract(1)	246		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				TTGACCACATCGTTGAGGTTA	0.542																																																	0																																										SO:0001583	missense	0			AY210418	CCDS380.1, CCDS60082.1	1p34.3	2014-01-28			ENSG00000121904	ENSG00000121904			19290	protein-coding gene	gene with protein product		608398				11472063, 11572484	Standard	NM_001281956		Approved	KIAA1884	uc001bxn.1	Q7Z408	OTTHUMG00000011135	ENST00000373381.4:c.8449G>A	1.37:g.34025005C>T	ENSP00000362479:p.Asp2817Asn		B1AM50|E7EUA6|Q53TY4|Q5VT59|Q8N963|Q96Q03|Q9H4V7|Q9H4V8|Q9H4V9|Q9H4W0|Q9H4W1|Q9H4W2|Q9H4W3|Q9H4W4|Q9HCY5|Q9HCY6|Q9HCY7	Missense_Mutation	SNP	pfam_CUB_dom,pfam_Sushi_SCR_CCP,superfamily_CUB_dom,superfamily_Sushi_SCR_CCP,smart_CUB_dom,smart_Sushi_SCR_CCP,pfscan_CUB_dom,pfscan_Sushi_SCR_CCP	p.D2817N	ENST00000373381.4	37	c.8449		1	.	.	.	.	.	.	.	.	.	.	C	35	5.532448	0.96446	.	.	ENSG00000121904	ENST00000373381	T	0.66280	-0.2	5.36	5.36	0.76844	.	0.000000	0.85682	U	0.000000	T	0.79516	0.4459	.	.	.	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.78940	-0.2006	9	0.45353	T	0.12	.	18.4465	0.90686	0.0:1.0:0.0:0.0	.	2817	E7EUA6	.	N	2817	ENSP00000362479:D2817N	ENSP00000362479:D2817N	D	-	1	0	CSMD2	33797592	1.000000	0.71417	0.991000	0.47740	0.917000	0.54804	7.742000	0.85008	2.665000	0.90641	0.563000	0.77884	GAT	CSMD2	-	pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	ENSG00000121904		0.542	CSMD2-201	KNOWN	basic|appris_principal	protein_coding	CSMD2	HGNC	protein_coding		-	0.00	75	0	C	NM_052896		34025005	-1	tier1	-	no_errors	ENST00000373381	ensembl	human	known	74_37	missense	35.58	67	37	SNP	1.000	T
CSPP1	79848	genome.wustl.edu	37	8	68092096	68092096	+	Splice_Site	SNP	A	A	G			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr8:68092096A>G	ENST00000262210.5	+	26	3172		c.e26-1		ARFGEF1_ENST00000520381.1_Intron|CSPP1_ENST00000412460.1_Splice_Site|CSPP1_ENST00000521168.1_Splice_Site	NM_024790.6	NP_079066.5	Q1MSJ5	CSPP1_HUMAN	centrosome and spindle pole associated protein 1						positive regulation of cell division (GO:0051781)|positive regulation of cytokinesis (GO:0032467)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|spindle (GO:0005819)|spindle pole (GO:0000922)				NS(1)|breast(3)|endometrium(4)|kidney(3)|large_intestine(11)|lung(17)|ovary(5)|prostate(3)|skin(1)|urinary_tract(1)	49	Breast(64;0.214)	Lung NSC(129;0.0908)|all_lung(136;0.152)	Epithelial(68;0.00145)|OV - Ovarian serous cystadenocarcinoma(28;0.00589)|all cancers(69;0.0069)|BRCA - Breast invasive adenocarcinoma(89;0.153)			TGTTTCTTTTAGCCCAGAGAT	0.294																																																	0													95.0	91.0	92.0					8																	68092096		1813	4069	5882	SO:0001630	splice_region_variant	0			AJ583433	CCDS43744.1	8q13.2	2014-02-24			ENSG00000104218	ENSG00000104218			26193	protein-coding gene	gene with protein product		611654				15580290, 24360807	Standard	NM_024790		Approved	FLJ22490, CSPP, JBTS21	uc003xxj.3	Q1MSJ5	OTTHUMG00000164564	ENST00000262210.5:c.3142-1A>G	8.37:g.68092096A>G			A6ND63|Q70F00|Q8TBC1	Splice_Site	SNP	-	e26-2	ENST00000262210.5	37	c.3142-2	CCDS43744.1	8	.	.	.	.	.	.	.	.	.	.	A	18.75	3.690315	0.68271	.	.	ENSG00000104218	ENST00000262210;ENST00000389042;ENST00000412460;ENST00000519668	.	.	.	5.56	5.56	0.83823	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.6886	0.69068	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CSPP1	68254650	1.000000	0.71417	1.000000	0.80357	0.897000	0.52465	6.000000	0.70678	2.110000	0.64415	0.402000	0.26972	.	CSPP1	-	-	ENSG00000104218		0.294	CSPP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CSPP1	HGNC	protein_coding	OTTHUMT00000379254.1	-	0.00	42	0	A	NM_024790	Intron	68092096	+1	tier1	-	no_errors	ENST00000262210	ensembl	human	known	74_37	splice_site	10.81	33	4	SNP	1.000	G
CWF19L1	55280	genome.wustl.edu	37	10	102016226	102016226	+	Silent	SNP	T	T	C			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr10:102016226T>C	ENST00000354105.4	-	5	383	c.297A>G	c.(295-297)aaA>aaG	p.K99K	CWF19L1_ENST00000478047.1_5'Flank|RNU6-422P_ENST00000384632.1_RNA	NM_018294.4	NP_060764.3	Q69YN2	C19L1_HUMAN	CWF19-like 1, cell cycle control (S. pombe)	99							catalytic activity (GO:0003824)			cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|liver(1)|lung(4)|pancreas(1)|prostate(1)|stomach(2)	17		Colorectal(252;0.117)		Epithelial(162;3.78e-10)|all cancers(201;3.1e-08)		TGAAGATACCTTTACGACCTG	0.433																																																	0													75.0	77.0	76.0					10																	102016226		2203	4300	6503	SO:0001819	synonymous_variant	0			AK001860	CCDS7489.1	10q24.31	2008-11-24			ENSG00000095485	ENSG00000095485			25613	protein-coding gene	gene with protein product						14702039	Standard	NM_018294		Approved	FLJ10998	uc001kqq.1	Q69YN2	OTTHUMG00000018901	ENST00000354105.4:c.297A>G	10.37:g.102016226T>C			B4DHX1|D3DR66|Q5W0I3|Q96HC3|Q9H865|Q9NV13	Silent	SNP	pfam_Cwf19-like_C_dom-1,pfam_Cwf19-like_C_dom-2,superfamily_HIT-like	p.K99	ENST00000354105.4	37	c.297	CCDS7489.1	10																																																																																			CWF19L1	-	NULL	ENSG00000095485		0.433	CWF19L1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	CWF19L1	HGNC	protein_coding		-	0.00	62	0	T	NM_018294		102016226	-1	tier1	-	no_errors	ENST00000354105	ensembl	human	known	74_37	silent	32.65	33	16	SNP	0.999	C
DBN1	1627	genome.wustl.edu	37	5	176885170	176885170	+	Silent	SNP	A	A	T			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr5:176885170A>T	ENST00000309007.5	-	12	1884	c.1665T>A	c.(1663-1665)gcT>gcA	p.A555A	DBN1_ENST00000292385.5_Silent_p.A557A|DBN1_ENST00000393563.4_Silent_p.A287A|DBN1_ENST00000512501.1_Silent_p.A287A|DBN1_ENST00000393565.1_Silent_p.A601A	NM_004395.3	NP_004386	Q16643	DREB_HUMAN	drebrin 1	555					actin filament organization (GO:0007015)|cell communication by chemical coupling (GO:0010643)|cell communication by electrical coupling (GO:0010644)|maintenance of protein location in cell (GO:0032507)|neural precursor cell proliferation (GO:0061351)|regulation of dendrite development (GO:0050773)|regulation of neuronal synaptic plasticity (GO:0048168)	actin cytoskeleton (GO:0015629)|actomyosin (GO:0042641)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|gap junction (GO:0005921)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|profilin binding (GO:0005522)			breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(1)|lung(12)|ovary(1)|skin(2)	25	all_cancers(89;2.17e-05)|Renal(175;0.000269)|Lung NSC(126;0.0014)|all_lung(126;0.0025)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			TCTGGGGGGCAGCCAGGGACT	0.637																																																	0													30.0	36.0	34.0					5																	176885170		2199	4293	6492	SO:0001819	synonymous_variant	0				CCDS4420.1, CCDS4421.1	5q35.3	2008-02-05			ENSG00000113758	ENSG00000113758			2695	protein-coding gene	gene with protein product		126660		D0S117E		8216329	Standard	NM_004395		Approved		uc003mgy.2	Q16643	OTTHUMG00000130856	ENST00000309007.5:c.1665T>A	5.37:g.176885170A>T			A8MV58|B2RBG0|Q9UFZ5	Silent	SNP	pfam_Actin-bd_cofilin/tropomyosin,smart_Actin-bd_cofilin/tropomyosin	p.A557	ENST00000309007.5	37	c.1671	CCDS4420.1	5																																																																																			DBN1	-	NULL	ENSG00000113758		0.637	DBN1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	DBN1	HGNC	protein_coding	OTTHUMT00000253429.2	-	0.00	128	0	A	NM_080881		176885170	-1	tier1	-	no_errors	ENST00000292385	ensembl	human	known	74_37	silent	8.89	41	4	SNP	0.958	T
DCAF8	50717	genome.wustl.edu	37	1	160201124	160201124	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr1:160201124G>T	ENST00000368073.3	-	7	1467	c.1033C>A	c.(1033-1035)Cac>Aac	p.H345N	DCAF8_ENST00000608310.1_Missense_Mutation_p.H499N|DCAF8_ENST00000556710.1_Missense_Mutation_p.H499N|DCAF8_ENST00000368074.1_Missense_Mutation_p.H345N|DCAF8_ENST00000326837.2_Missense_Mutation_p.H345N			Q5TAQ9	DCAF8_HUMAN	DDB1 and CUL4 associated factor 8	345					protein ubiquitination (GO:0016567)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)|cytoplasm (GO:0005737)|nucleus (GO:0005634)				cervix(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(16)|skin(3)|upper_aerodigestive_tract(1)	33						GCAAACTGGTGGGTATTGGCA	0.423																																																	0													263.0	236.0	245.0					1																	160201124		2203	4300	6503	SO:0001583	missense	0			AK093176	CCDS1200.1	1q22-q23	2013-01-09	2009-07-17	2009-07-17	ENSG00000132716	ENSG00000132716		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	24891	protein-coding gene	gene with protein product		615820	"""WD repeat domain 42A"""	WDR42A		11401431	Standard	NM_015726		Approved	H326, FLJ35857	uc010pjb.1	Q5TAQ9	OTTHUMG00000031604	ENST00000368073.3:c.1033C>A	1.37:g.160201124G>T	ENSP00000357052:p.His345Asn		D3DVE6|Q12839|Q4QQI6|Q53F14|Q66K50|Q68CS7|Q96E00	Missense_Mutation	SNP	pfam_Pex19,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.H499N	ENST00000368073.3	37	c.1495	CCDS1200.1	1	.	.	.	.	.	.	.	.	.	.	G	12.25	1.882134	0.33255	.	.	ENSG00000132716;ENSG00000132716;ENSG00000132716;ENSG00000132716;ENSG00000132716;ENSG00000258465	ENST00000368073;ENST00000326837;ENST00000368074;ENST00000555195;ENST00000540855;ENST00000556710	T;T;T;T;T	0.79940	-1.32;-1.32;-1.32;-1.32;-1.32	4.73	4.73	0.59995	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.147474	0.44285	U	0.000470	T	0.44222	0.1283	N	0.08118	0	0.50313	D	0.999863	P;B	0.36535	0.557;0.006	B;B	0.32864	0.154;0.002	T	0.52495	-0.8568	10	0.22109	T	0.4	-7.9133	10.2627	0.43436	0.0924:0.0:0.9076:0.0	.	499;345	G3V3G9;Q5TAQ9	.;DCAF8_HUMAN	N	345;345;345;499;326;499	ENSP00000357052:H345N;ENSP00000318227:H345N;ENSP00000357053:H345N;ENSP00000451989:H499N;ENSP00000451235:H499N	ENSP00000318227:H345N	H	-	1	0	RP11-574F21.3;DCAF8	158467748	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.927000	0.70080	2.457000	0.83068	0.591000	0.81541	CAC	DCAF8	-	superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000132716		0.423	DCAF8-001	KNOWN	basic|CCDS	protein_coding	DCAF8	HGNC	protein_coding	OTTHUMT00000077402.2		0.00	99	0	G	NM_015726		160201124	-1			no_errors	ENST00000608310	ensembl	human	known	74_37	missense	5.13	74	4	SNP	1.000	T
DCAF8L1	139425	genome.wustl.edu	37	X	27998247	27998247	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chrX:27998247C>T	ENST00000441525.1	-	1	1319	c.1205G>A	c.(1204-1206)gGc>gAc	p.G402D		NM_001017930.1	NP_001017930.1	A6NGE4	DC8L1_HUMAN	DDB1 and CUL4 associated factor 8-like 1	402										NS(1)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(24)|ovary(3)|prostate(1)|skin(4)|stomach(1)|urinary_tract(1)	56						GAGCTCTGTGCCATCGTGGCT	0.423																																																	0													98.0	89.0	92.0					X																	27998247		2202	4300	6502	SO:0001583	missense	0				CCDS35222.1	Xp22.11	2013-01-09	2009-07-17	2009-07-17	ENSG00000226372	ENSG00000226372		"""WD repeat domain containing"""	31810	protein-coding gene	gene with protein product			"""WD repeat domain 42B"""	WDR42B			Standard	NM_001017930		Approved		uc004dbx.1	A6NGE4	OTTHUMG00000021312	ENST00000441525.1:c.1205G>A	X.37:g.27998247C>T	ENSP00000405222:p.Gly402Asp		B3KXX1	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.G402D	ENST00000441525.1	37	c.1205	CCDS35222.1	X	.	.	.	.	.	.	.	.	.	.	C	20.2	3.949111	0.73787	.	.	ENSG00000226372	ENST00000441525	D	0.84730	-1.89	1.08	1.08	0.20341	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	D	0.92205	0.7528	M	0.92604	3.325	0.58432	D	0.999997	D	0.89917	1.0	D	0.85130	0.997	D	0.90862	0.4739	10	0.66056	D	0.02	-6.2969	7.7157	0.28702	0.0:1.0:0.0:0.0	.	402	A6NGE4	DC8L1_HUMAN	D	402	ENSP00000405222:G402D	ENSP00000405222:G402D	G	-	2	0	DCAF8L1	27908168	1.000000	0.71417	0.979000	0.43373	0.654000	0.38779	2.998000	0.49465	0.825000	0.34637	0.284000	0.19432	GGC	DCAF8L1	-	superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000226372		0.423	DCAF8L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCAF8L1	HGNC	protein_coding	OTTHUMT00000056150.2	-	0.00	42	0	C	XM_066690		27998247	-1	tier1	-	no_errors	ENST00000441525	ensembl	human	known	74_37	missense	14.81	23	4	SNP	1.000	T
DCLRE1A	9937	genome.wustl.edu	37	10	115608957	115608957	+	Missense_Mutation	SNP	T	T	A			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr10:115608957T>A	ENST00000361384.2	-	2	2824	c.1907A>T	c.(1906-1908)aAg>aTg	p.K636M	DCLRE1A_ENST00000369305.1_Missense_Mutation_p.K636M	NM_014881.3	NP_055696.3	Q6PJP8	DCR1A_HUMAN	DNA cross-link repair 1A	636					mitotic nuclear division (GO:0007067)|nucleotide-excision repair (GO:0006289)	nucleus (GO:0005634)				breast(2)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(10)|lung(8)|prostate(1)|skin(2)|urinary_tract(1)	31				Epithelial(162;0.0157)|all cancers(201;0.0171)		TCTACATCTCTTTTTTTGACG	0.368								Other identified genes with known or suspected DNA repair function																																									0													169.0	172.0	171.0					10																	115608957		2203	4300	6503	SO:0001583	missense	0				CCDS7584.1	10q25.1	2010-06-24	2010-06-24		ENSG00000198924	ENSG00000198924			17660	protein-coding gene	gene with protein product	"""PSO2 homolog (S. cerevisiae)"""	609682	"""DNA cross-link repair 1A (PSO2 homolog, S. cerevisiae)"""			9806498, 17804464	Standard	NM_014881		Approved	SNM1, PSO2, KIAA0086, hSNM1	uc031pxf.1	Q6PJP8	OTTHUMG00000019077	ENST00000361384.2:c.1907A>T	10.37:g.115608957T>A	ENSP00000355185:p.Lys636Met		D3DRC1|Q14701|Q6P5Y3|Q6PKL4	Missense_Mutation	SNP	pfam_DRMBL	p.K636M	ENST00000361384.2	37	c.1907	CCDS7584.1	10	.	.	.	.	.	.	.	.	.	.	T	20.5	4.001175	0.74818	.	.	ENSG00000198924	ENST00000361384;ENST00000369305	T;T	0.71817	-0.6;-0.6	5.73	5.73	0.89815	.	0.146049	0.64402	D	0.000007	D	0.83096	0.5180	M	0.71581	2.175	0.46113	D	0.998878	D	0.89917	1.0	D	0.91635	0.999	D	0.85001	0.0900	10	0.87932	D	0	-19.7382	14.8902	0.70604	0.0:0.0:0.0:1.0	.	636	Q6PJP8	DCR1A_HUMAN	M	636	ENSP00000355185:K636M;ENSP00000358311:K636M	ENSP00000355185:K636M	K	-	2	0	DCLRE1A	115598947	1.000000	0.71417	1.000000	0.80357	0.675000	0.39556	5.462000	0.66707	2.302000	0.77476	0.533000	0.62120	AAG	DCLRE1A	-	NULL	ENSG00000198924		0.368	DCLRE1A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	DCLRE1A	HGNC	protein_coding	OTTHUMT00000050444.1		0.00	30	0	T	NM_014881		115608957	-1			no_errors	ENST00000361384	ensembl	human	known	74_37	missense	7.14	26	2	SNP	1.000	A
DDX60L	91351	genome.wustl.edu	37	4	169340523	169340523	+	Missense_Mutation	SNP	A	A	T			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr4:169340523A>T	ENST00000511577.1	-	19	2787	c.2540T>A	c.(2539-2541)tTt>tAt	p.F847Y	DDX60L_ENST00000505890.1_Missense_Mutation_p.F847Y|DDX60L_ENST00000260184.7_Missense_Mutation_p.F847Y			Q5H9U9	DDX6L_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 60-like	847	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.						ATP binding (GO:0005524)|helicase activity (GO:0004386)|RNA binding (GO:0003723)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|lung(23)|ovary(2)|prostate(1)|skin(1)|stomach(1)	43		Prostate(90;0.00876)|Renal(120;0.0183)|all_neural(102;0.0837)|Melanoma(52;0.132)		GBM - Glioblastoma multiforme(119;0.175)		CAGGATTTCAAAACATTCCGG	0.363																																																	0													53.0	53.0	53.0					4																	169340523		2194	4300	6494	SO:0001583	missense	0			AK092461	CCDS47161.1	4q32.3	2008-01-08				ENSG00000181381			26429	protein-coding gene	gene with protein product							Standard	XM_005263341		Approved	FLJ31033	uc003irq.4	Q5H9U9		ENST00000511577.1:c.2540T>A	4.37:g.169340523A>T	ENSP00000422423:p.Phe847Tyr		Q96ND6	Missense_Mutation	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.F847Y	ENST00000511577.1	37	c.2540		4	.	.	.	.	.	.	.	.	.	.	A	20.1	3.936208	0.73442	.	.	ENSG00000181381	ENST00000260184;ENST00000511577;ENST00000505890	T;T;T	0.15603	2.41;2.41;2.41	3.64	3.64	0.41730	DEAD-like helicase (2);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.324362	0.19167	U	0.121043	T	0.35941	0.0949	M	0.66939	2.045	0.24342	N	0.994951	D;D	0.71674	0.991;0.998	D;P	0.63957	0.92;0.901	T	0.08911	-1.0699	10	0.66056	D	0.02	.	12.2389	0.54532	1.0:0.0:0.0:0.0	.	847;847	D6R906;Q5H9U9	.;DDX6L_HUMAN	Y	847	ENSP00000260184:F847Y;ENSP00000422423:F847Y;ENSP00000422202:F847Y	ENSP00000260184:F847Y	F	-	2	0	DDX60L	169577098	0.960000	0.32886	0.372000	0.25991	0.326000	0.28443	5.229000	0.65316	1.422000	0.47177	0.383000	0.25322	TTT	DDX60L	-	pfam_DNA/RNA_helicase_DEAD/DEAH_N,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,pfscan_Helicase_ATP-bd	ENSG00000181381		0.363	DDX60L-001	KNOWN	basic|appris_principal	protein_coding	DDX60L	HGNC	protein_coding	OTTHUMT00000364839.1		0.00	70	0	A	NM_001012967		169340523	-1			no_errors	ENST00000260184	ensembl	human	known	74_37	missense	6.45	29	2	SNP	0.998	T
DLD	1738	genome.wustl.edu	37	7	107542770	107542770	+	Splice_Site	SNP	A	A	T			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr7:107542770A>T	ENST00000205402.5	+	4	480	c.199A>T	c.(199-201)Aca>Tca	p.T67S	DLD_ENST00000537148.1_Intron|DLD_ENST00000437604.2_Splice_Site_p.T67S|DLD_ENST00000440410.1_Intron|DLD_ENST00000494441.1_3'UTR	NM_000108.3	NP_000099.2	P09622	DLDH_HUMAN	dihydrolipoamide dehydrogenase	67					branched-chain amino acid catabolic process (GO:0009083)|cell redox homeostasis (GO:0045454)|cellular metabolic process (GO:0044237)|cellular nitrogen compound metabolic process (GO:0034641)|gastrulation (GO:0007369)|lysine catabolic process (GO:0006554)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|proteolysis (GO:0006508)|pyruvate metabolic process (GO:0006090)|regulation of acetyl-CoA biosynthetic process from pyruvate (GO:0010510)|regulation of membrane potential (GO:0042391)|small molecule metabolic process (GO:0044281)|sperm capacitation (GO:0048240)|tricarboxylic acid cycle (GO:0006099)	acrosomal matrix (GO:0043159)|cilium (GO:0005929)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	dihydrolipoyl dehydrogenase activity (GO:0004148)|flavin adenine dinucleotide binding (GO:0050660)			NS(1)|breast(1)|central_nervous_system(1)|kidney(5)|large_intestine(1)|lung(10)|prostate(1)	20					Flavin adenine dinucleotide(DB03147)	TTGGTTGTAGACAGTCTGCAT	0.338																																																	0													271.0	238.0	249.0					7																	107542770		2203	4300	6503	SO:0001630	splice_region_variant	0			AB209703	CCDS5749.1	7q31-q32	2006-05-22	2006-05-22		ENSG00000091140	ENSG00000091140	1.8.1.4		2898	protein-coding gene	gene with protein product	"""E3 component of pyruvate dehydrogenase complex, 2-oxo-glutarate complex, branched chain keto acid dehydrogenase complex"""	238331	"""dihydrolipoamide dehydrogenase (E3 component of pyruvate dehydrogenase complex, 2-oxo-glutarate complex, branched chain keto acid dehydrogenase complex)"""	LAD, GCSL			Standard	NM_000108		Approved	DLDH	uc003vet.3	P09622	OTTHUMG00000154813	ENST00000205402.5:c.199-1A>T	7.37:g.107542770A>T			B2R5X0|B4DHG0|B4DT69|Q14131|Q14167|Q59EV8|Q8WTS4	Missense_Mutation	SNP	pfam_Pyr_nucl-diS_OxRdtase_FAD/NAD,pfam_Pyr_nucl-diS_OxRdtase_dimer,pfam_Pyr_OxRdtase_NAD-bd_dom,pfam_FAD_bind_dom,pfam_GIDA-rel,superfamily_FAD/NAD-linked_Rdtase_dimer,prints_FAD_pyr_nucl-diS_OxRdtase,prints_Hg_reductase,prints_Pyridine_nuc-diS_OxRdtase_2,tigrfam_Lipoamide_DH	p.T67S	ENST00000205402.5	37	c.199	CCDS5749.1	7	.	.	.	.	.	.	.	.	.	.	A	17.52	3.410966	0.62399	.	.	ENSG00000091140	ENST00000205402;ENST00000417551;ENST00000437604;ENST00000539590	T;T;T	0.67865	-0.29;-0.29;0.78	6.04	4.88	0.63580	Pyridine nucleotide-disulphide oxidoreductase, FAD/NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	T	0.76772	0.4034	M	0.92026	3.265	0.80722	D	1	B;B	0.21905	0.062;0.007	B;B	0.36922	0.236;0.079	T	0.73949	-0.3821	9	.	.	.	-18.7893	11.619	0.51106	0.9308:0.0:0.0692:0.0	.	67;67	B4DT69;P09622	.;DLDH_HUMAN	S	67;67;67;17	ENSP00000205402:T67S;ENSP00000390667:T67S;ENSP00000387542:T67S	.	T	+	1	0	DLD	107330006	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.266000	0.58871	1.102000	0.41551	0.459000	0.35465	ACA	DLD	-	pfam_Pyr_nucl-diS_OxRdtase_FAD/NAD,pfam_FAD_bind_dom,pfam_GIDA-rel,prints_Hg_reductase,tigrfam_Lipoamide_DH	ENSG00000091140		0.338	DLD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DLD	HGNC	protein_coding	OTTHUMT00000337194.3	-	0.00	82	0	A	NM_000108	Missense_Mutation	107542770	+1	tier1	-	no_errors	ENST00000205402	ensembl	human	known	74_37	missense	5.80	65	4	SNP	1.000	T
DGKI	9162	genome.wustl.edu	37	7	137255958	137255958	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr7:137255958C>T	ENST00000288490.5	-	19	1910	c.1910G>A	c.(1909-1911)gGt>gAt	p.G637D	DGKI_ENST00000446122.1_Missense_Mutation_p.G637D|DGKI_ENST00000424189.2_Missense_Mutation_p.G637D|DGKI_ENST00000453654.2_Missense_Mutation_p.G337D	NM_004717.2	NP_004708.1	O75912	DGKI_HUMAN	diacylglycerol kinase, iota	637					blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|positive regulation of Ras protein signal transduction (GO:0046579)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of Rap GTPase activity (GO:0032317)	cytoplasm (GO:0005737)|guanyl-nucleotide exchange factor complex (GO:0032045)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol kinase activity (GO:0004143)|GTPase inhibitor activity (GO:0005095)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)			breast(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(46)|ovary(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	84						TTCAATATAACCATCATCATG	0.378																																																	0													94.0	92.0	93.0					7																	137255958		2203	4300	6503	SO:0001583	missense	0			AF061936	CCDS5845.1	7q32.3-q33	2013-01-10			ENSG00000157680	ENSG00000157680		"""Ankyrin repeat domain containing"""	2855	protein-coding gene	gene with protein product		604072				9830018	Standard	NM_004717		Approved	DGK-IOTA	uc003vtt.3	O75912	OTTHUMG00000155697	ENST00000288490.5:c.1910G>A	7.37:g.137255958C>T	ENSP00000288490:p.Gly637Asp		A4D1Q9|Q9NZ49	Missense_Mutation	SNP	pfam_Diacylglycerol_kin_accessory,pfam_Diacylglycerol_kinase_cat_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Diacylglycerol_kinase_cat_dom,smart_Diacylglycerol_kin_accessory,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.G637D	ENST00000288490.5	37	c.1910	CCDS5845.1	7	.	.	.	.	.	.	.	.	.	.	C	33	5.237043	0.95240	.	.	ENSG00000157680	ENST00000453654;ENST00000540376;ENST00000424189;ENST00000288490;ENST00000446122	T;T;T	0.60672	0.17;0.17;0.17	6.17	6.17	0.99709	Diacylglycerol kinase, accessory domain (2);	0.000000	0.85682	D	0.000000	D	0.83672	0.5305	M	0.93898	3.47	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.86317	0.1690	10	0.87932	D	0	.	20.4898	0.99202	0.0:1.0:0.0:0.0	.	337;637	E9PFX6;O75912	.;DGKI_HUMAN	D	337;585;637;637;637	ENSP00000392161:G337D;ENSP00000288490:G637D;ENSP00000399131:G637D	ENSP00000288490:G637D	G	-	2	0	DGKI	136906498	1.000000	0.71417	0.985000	0.45067	0.969000	0.65631	7.292000	0.78731	2.941000	0.99782	0.655000	0.94253	GGT	DGKI	-	pfam_Diacylglycerol_kin_accessory,smart_Diacylglycerol_kin_accessory	ENSG00000157680		0.378	DGKI-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DGKI	HGNC	protein_coding	OTTHUMT00000341286.3	-	0.00	69	0	C	NM_004717		137255958	-1	tier1	-	no_errors	ENST00000288490	ensembl	human	known	74_37	missense	8.33	44	4	SNP	1.000	T
DLGAP3	58512	genome.wustl.edu	37	1	35370962	35370962	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr1:35370962C>T	ENST00000373347.1	-	3	291	c.23G>A	c.(22-24)cGa>cAa	p.R8Q	DLGAP3_ENST00000495979.1_5'UTR|DLGAP3_ENST00000235180.4_Missense_Mutation_p.R8Q			O95886	DLGP3_HUMAN	discs, large (Drosophila) homolog-associated protein 3	8					cell-cell signaling (GO:0007267)	cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)	beta-amyloid binding (GO:0001540)			central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(23)|ovary(4)|prostate(3)|skin(3)|urinary_tract(1)	46		Myeloproliferative disorder(586;0.0393)				ATGGCTGCCTCGGTCGCCATG	0.612																																																	0																																										SO:0001583	missense	0			AF131778	CCDS30670.1	1p35.3-p34.1	2008-02-05			ENSG00000116544	ENSG00000116544			30368	protein-coding gene	gene with protein product		611413				8619474, 9110174	Standard	NM_001080418		Approved	SAPAP3, DAP3	uc001byc.3	O95886	OTTHUMG00000004049	ENST00000373347.1:c.23G>A	1.37:g.35370962C>T	ENSP00000362444:p.Arg8Gln		Q5TDD5|Q9H3X7	Missense_Mutation	SNP	pfam_GKAP	p.R8Q	ENST00000373347.1	37	c.23	CCDS30670.1	1	.	.	.	.	.	.	.	.	.	.	c	15.96	2.987911	0.53934	.	.	ENSG00000116544	ENST00000373347;ENST00000235180	T;T	0.29917	1.55;1.55	4.49	3.51	0.40186	.	0.096989	0.41938	D	0.000782	T	0.26702	0.0653	M	0.68317	2.08	0.31043	N	0.716116	D	0.59357	0.985	B	0.34722	0.188	T	0.51044	-0.8755	10	0.87932	D	0	-3.2945	11.5417	0.50669	0.1784:0.8215:0.0:0.0	.	8	O95886	DLGP3_HUMAN	Q	8	ENSP00000362444:R8Q;ENSP00000235180:R8Q	ENSP00000235180:R8Q	R	-	2	0	DLGAP3	35143549	0.988000	0.35896	1.000000	0.80357	0.990000	0.78478	1.408000	0.34668	2.054000	0.61138	0.457000	0.33378	CGA	DLGAP3	-	NULL	ENSG00000116544		0.612	DLGAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DLGAP3	HGNC	protein_coding	OTTHUMT00000011554.1	-	0.00	68	0	C	NM_021234		35370962	-1	tier1	-	no_errors	ENST00000235180	ensembl	human	known	74_37	missense	13.48	77	12	SNP	1.000	T
DLGAP4	22839	genome.wustl.edu	37	20	35154319	35154319	+	Silent	SNP	G	G	T			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr20:35154319G>T	ENST00000373907.2	+	11	2869	c.2670G>T	c.(2668-2670)ctG>ctT	p.L890L	RP5-977B1.7_ENST00000425233.1_RNA|DLGAP4_ENST00000401952.2_Silent_p.L887L|DLGAP4_ENST00000340491.4_Silent_p.L351L|DLGAP4_ENST00000475894.1_3'UTR|DLGAP4_ENST00000339266.5_Silent_p.L890L|DLGAP4_ENST00000373913.3_Silent_p.L887L|RP5-977B1.7_ENST00000433238.1_RNA|RP5-977B1.7_ENST00000439595.1_RNA			Q9Y2H0	DLGP4_HUMAN	discs, large (Drosophila) homolog-associated protein 4	890					cell-cell signaling (GO:0007267)	membrane (GO:0016020)|synapse (GO:0045202)				breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(3)|lung(20)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	37	Breast(12;0.0192)	Myeloproliferative disorder(115;0.00878)				TGCTACAGCTGTCCATCGAGG	0.602																																																	0													86.0	81.0	83.0					20																	35154319		2203	4300	6503	SO:0001819	synonymous_variant	0			AF088030	CCDS13274.1, CCDS13275.1	20q11.23	2010-02-05			ENSG00000080845	ENSG00000080845			24476	protein-coding gene	gene with protein product						9115257	Standard	XM_005260329		Approved	DAP4, KIAA0964, SAPAP4	uc010zvp.2	Q9Y2H0	OTTHUMG00000032390	ENST00000373907.2:c.2670G>T	20.37:g.35154319G>T			E1P5T5|Q5QPG4|Q5T2Y4|Q5T2Y5|Q9H137|Q9H138|Q9H1L7	Silent	SNP	pfam_GKAP	p.L890	ENST00000373907.2	37	c.2670		20																																																																																			DLGAP4	-	pfam_GKAP	ENSG00000080845		0.602	DLGAP4-007	KNOWN	basic|appris_candidate_longest	protein_coding	DLGAP4	HGNC	protein_coding	OTTHUMT00000079025.2		0.00	58	0	G	NM_014902		35154319	+1			no_errors	ENST00000339266	ensembl	human	known	74_37	silent	6.98	40	3	SNP	1.000	T
DNAH10	196385	genome.wustl.edu	37	12	124267779	124267779	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr12:124267779G>T	ENST00000409039.3	+	7	809	c.784G>T	c.(784-786)Gcg>Tcg	p.A262S		NM_207437.3	NP_997320.2	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	262	Stem. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		GATATCCACAGCGGTTGAGGC	0.547																																																	0													105.0	97.0	100.0					12																	124267779		2203	4300	6503	SO:0001583	missense	0			AJ132089	CCDS9255.2	12q24	2008-02-05	2006-09-04		ENSG00000197653	ENSG00000197653		"""Axonemal dyneins"""	2941	protein-coding gene	gene with protein product		605884	"""dynein, axonemal, heavy polypeptide 10"""				Standard	NM_207437		Approved	FLJ43808	uc001uft.4	Q8IVF4	OTTHUMG00000154477	ENST00000409039.3:c.784G>T	12.37:g.124267779G>T	ENSP00000386770:p.Ala262Ser		C9JMF5|O95495|Q6ZUC9|Q6ZUP6|Q8N761	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,pfam_Dynein_heavy_dom-1,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,superfamily_PyrdxlP-dep_Trfase,smart_AAA+_ATPase	p.A262S	ENST00000409039.3	37	c.784	CCDS9255.2	12	.	.	.	.	.	.	.	.	.	.	G	23.7	4.450527	0.84101	.	.	ENSG00000197653	ENST00000409039	T	0.55930	0.49	6.01	5.12	0.69794	Dynein heavy chain, domain-1 (1);	0.162287	0.40728	N	0.001037	T	0.66137	0.2759	M	0.78801	2.425	0.33641	D	0.607257	D	0.53462	0.96	P	0.52343	0.696	T	0.80158	-0.1499	10	0.87932	D	0	.	15.0798	0.72106	0.0684:0.0:0.9316:0.0	.	262	Q8IVF4	DYH10_HUMAN	S	262	ENSP00000386770:A262S	ENSP00000386770:A262S	A	+	1	0	DNAH10	122833732	1.000000	0.71417	0.071000	0.20095	0.002000	0.02628	5.154000	0.64894	1.558000	0.49541	0.650000	0.86243	GCG	DNAH10	-	pfam_Dynein_heavy_dom-1	ENSG00000197653		0.547	DNAH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH10	HGNC	protein_coding	OTTHUMT00000335420.3	-	0.00	99	0	G			124267779	+1	tier1	-	no_errors	ENST00000409039	ensembl	human	known	74_37	missense	6.06	62	4	SNP	0.934	T
DNAH6	1768	genome.wustl.edu	37	2	85046517	85046517	+	Silent	SNP	C	C	T			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr2:85046517C>T	ENST00000237449.6	+	76	12470	c.12462C>T	c.(12460-12462)tgC>tgT	p.C4154C	TRABD2A_ENST00000479944.1_5'Flank|DNAH6_ENST00000389394.3_Silent_p.C4154C			Q9C0G6	DYH6_HUMAN	dynein, axonemal, heavy chain 6	4154					cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(2)|breast(9)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(3)|lung(14)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	57						CTTTGCTCTGCCAGCTGAGCG	0.453																																																	0													101.0	92.0	95.0					2																	85046517		692	1591	2283	SO:0001819	synonymous_variant	0			U61736	CCDS46348.1	2p11.2	2011-05-24	2006-09-04		ENSG00000115423	ENSG00000115423		"""Axonemal dyneins"""	2951	protein-coding gene	gene with protein product		603336	"""dynein, axonemal, heavy polypeptide 6"", ""dynein heavy chain-like 1"""	DNHL1		8812413	Standard	NM_001370		Approved	Dnahc6, HL-2, FLJ37357	uc010fgb.3	Q9C0G6	OTTHUMG00000128957	ENST00000237449.6:c.12462C>T	2.37:g.85046517C>T			A0PJN9|B5MEE0|B7ZL99|O95493|Q53QZ1|Q53TE5|Q8N1W6|Q92861|Q96BL6|Q9H030|Q9H5E1	Silent	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.C4154	ENST00000237449.6	37	c.12462	CCDS46348.1	2																																																																																			DNAH6	-	pfam_Dynein_heavy_dom	ENSG00000115423		0.453	DNAH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH6	HGNC	protein_coding	OTTHUMT00000328537.2	-	0.00	70	0	C	NM_001370		85046517	+1	tier1	-	no_errors	ENST00000237449	ensembl	human	known	74_37	silent	7.84	47	4	SNP	1.000	T
DSC2	1824	genome.wustl.edu	37	18	28662348	28662348	+	Silent	SNP	G	G	T			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr18:28662348G>T	ENST00000280904.6	-	9	1562	c.1119C>A	c.(1117-1119)atC>atA	p.I373I	DSC2_ENST00000251081.6_Silent_p.I373I	NM_024422.3	NP_077740.1	Q02487	DSC2_HUMAN	desmocollin 2	373	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				bundle of His cell to Purkinje myocyte communication (GO:0086069)|cardiac muscle cell-cardiac muscle cell adhesion (GO:0086042)|cell adhesion (GO:0007155)|cellular response to starvation (GO:0009267)|homophilic cell adhesion (GO:0007156)|regulation of heart rate by cardiac conduction (GO:0086091)|ventricular cardiac muscle cell action potential (GO:0086005)	cell-cell adherens junction (GO:0005913)|cytoplasmic vesicle (GO:0031410)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(2)|kidney(1)|large_intestine(2)|lung(12)|ovary(2)|prostate(1)|skin(1)	21			OV - Ovarian serous cystadenocarcinoma(10;0.0241)			TAACTCGTAAGATTTCCACAT	0.313																																																	0													92.0	87.0	89.0					18																	28662348		2201	4299	6500	SO:0001819	synonymous_variant	0			X56807	CCDS11892.1, CCDS11893.1	18q12.1	2014-09-17			ENSG00000134755	ENSG00000134755		"""Cadherins / Major cadherins"""	3036	protein-coding gene	gene with protein product		125645		DSC3		7774948	Standard	NM_024422		Approved	CDHF2	uc002kwl.4	Q02487	OTTHUMG00000131981	ENST00000280904.6:c.1119C>A	18.37:g.28662348G>T				Silent	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,pfam_Cadherin_pro_dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin,prints_Cadherin/Desmocollin,prints_Desmosomal_cadherin	p.I373	ENST00000280904.6	37	c.1119	CCDS11892.1	18																																																																																			DSC2	-	pfam_Cadherin,superfamily_Cadherin-like,pfscan_Cadherin	ENSG00000134755		0.313	DSC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DSC2	HGNC	protein_coding	OTTHUMT00000254943.1	-	0.00	101	0	G	NM_004949		28662348	-1	tier1	-	no_errors	ENST00000280904	ensembl	human	known	74_37	silent	14.00	86	14	SNP	0.473	T
DTWD1	56986	genome.wustl.edu	37	15	49926993	49926994	+	Splice_Site	INS	-	-	A	rs111446752	byFrequency	TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr15:49926993_49926994insA	ENST00000251250.6	+	5	874		c.e5+2		DTWD1_ENST00000415425.1_Splice_Site|DTWD1_ENST00000558653.1_Splice_Site|DTWD1_ENST00000403028.3_Splice_Site	NM_020234.5	NP_064619.2	Q8N5C7	DTWD1_HUMAN	DTW domain containing 1									p.?(1)		endometrium(1)|large_intestine(4)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)	9		all_lung(180;0.0384)		all cancers(107;3.27e-08)|GBM - Glioblastoma multiforme(94;7.6e-05)		GACTTCAAGGTAAAAAAAAAAT	0.327																																																	1	Unknown(1)	ovary(1)																																								SO:0001630	splice_region_variant	0			BC032535	CCDS10132.1	15q21.2	2005-08-09			ENSG00000104047	ENSG00000104047			30926	protein-coding gene	gene with protein product							Standard	NM_020234		Approved	MDS009, MGC111207	uc001zxs.3	Q8N5C7	OTTHUMG00000131567	ENST00000251250.6:c.667+2->A	15.37:g.49927003_49927003dupA			Q567Q3|Q8WVG9|Q9NRU6	Splice_Site	INS	-	e3+2	ENST00000251250.6	37	c.667+2_667+1	CCDS10132.1	15																																																																																			DTWD1	-	-	ENSG00000104047		0.327	DTWD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DTWD1	HGNC	protein_coding	OTTHUMT00000254431.2		0.00	31	0	-	NM_020234	Intron	49926994	+1	tier1		no_errors	ENST00000251250	ensembl	human	known	74_37	splice_site_ins	13.33	26	4	INS	1.000:1.000	A
DTX2	113878	genome.wustl.edu	37	7	76110027	76110027	+	Silent	SNP	G	G	A			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr7:76110027G>A	ENST00000324432.5	+	4	711	c.201G>A	c.(199-201)caG>caA	p.Q67Q	DTX2_ENST00000446820.2_Silent_p.Q67Q|DTX2_ENST00000446600.1_Intron|DTX2_ENST00000307569.8_Silent_p.Q67Q|DTX2_ENST00000413936.2_Silent_p.Q67Q|AC007078.4_ENST00000479299.2_RNA|DTX2_ENST00000430490.2_Silent_p.Q67Q|DTX2_ENST00000472426.1_3'UTR	NM_020892.2	NP_065943.2	Q86UW9	DTX2_HUMAN	deltex 2, E3 ubiquitin ligase	67	WWE 1. {ECO:0000255|PROSITE- ProRule:PRU00248}.				Notch signaling pathway (GO:0007219)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(14)|ovary(1)|skin(1)|stomach(2)	27						CCTTGGGCCAGGCAGACCCCT	0.612																																																	0													23.0	24.0	24.0					7																	76110027		2202	4300	6502	SO:0001819	synonymous_variant	0				CCDS5587.1, CCDS43605.1	7q11.23	2014-01-28	2014-01-28		ENSG00000091073	ENSG00000091073		"""RING-type (C3HC4) zinc fingers"""	15973	protein-coding gene	gene with protein product		613141	"""deltex (Drosophila) homolog 2"", ""deltex homolog 2 (Drosophila)"""			12670957	Standard	NM_020892		Approved	RNF58, KIAA1528	uc003ufh.4	Q86UW9	OTTHUMG00000162594	ENST00000324432.5:c.201G>A	7.37:g.76110027G>A			Q6XM87|Q6XM88|Q96H69|Q9H890|Q9P200	Silent	SNP	pfam_WWE-dom,smart_WWE-dom_subgr,smart_Znf_RING,pfscan_WWE-dom,pfscan_Znf_RING	p.Q67	ENST00000324432.5	37	c.201	CCDS5587.1	7																																																																																			DTX2	-	pfam_WWE-dom,smart_WWE-dom_subgr,pfscan_WWE-dom	ENSG00000091073		0.612	DTX2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DTX2	HGNC	protein_coding	OTTHUMT00000253104.2	-	0.00	72	0	G			76110027	+1	tier1	-	no_errors	ENST00000324432	ensembl	human	known	74_37	silent	10.26	35	4	SNP	0.507	A
EBF2	64641	genome.wustl.edu	37	8	25744358	25744358	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr8:25744358G>A	ENST00000520164.1	-	10	1459	c.922C>T	c.(922-924)Cgg>Tgg	p.R308W	EBF2_ENST00000408929.3_Missense_Mutation_p.R160W|EBF2_ENST00000535548.1_Missense_Mutation_p.R39W	NM_022659.3	NP_073150.2	Q9HAK2	COE2_HUMAN	early B-cell factor 2	308	IPT/TIG.				adipose tissue development (GO:0060612)|brown fat cell differentiation (GO:0050873)|cell fate determination (GO:0001709)|positive regulation of chromatin binding (GO:0035563)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|kidney(2)|large_intestine(3)|lung(22)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	39		all_cancers(63;0.0989)|Ovarian(32;2.74e-05)|all_epithelial(46;0.0608)|Prostate(55;0.0845)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0277)|Epithelial(17;3.29e-10)|Colorectal(74;0.00383)|COAD - Colon adenocarcinoma(73;0.00738)		GGGATGTGCCGGGGAGGAGTC	0.458																																					Esophageal Squamous(166;1018 1046 3854 8328 13429 13634 14071 26624 32918)												0													82.0	81.0	82.0					8																	25744358		1918	4142	6060	SO:0001583	missense	0			AK021562, AK001144	CCDS43726.1	8p21.1	2007-07-26			ENSG00000221818	ENSG00000221818			19090	protein-coding gene	gene with protein product		609934				9151732	Standard	NM_022659		Approved	FLJ11500, COE2	uc003xes.2	Q9HAK2	OTTHUMG00000163838	ENST00000520164.1:c.922C>T	8.37:g.25744358G>A	ENSP00000430241:p.Arg308Trp		A0PJM4|A6NMF7|F5H645|Q66VZ3|Q6DK36|Q6IS86|Q6ISA4	Missense_Mutation	SNP	pfam_IPT,superfamily_Ig_E-set,smart_IPT	p.R308W	ENST00000520164.1	37	c.922	CCDS43726.1	8	.	.	.	.	.	.	.	.	.	.	G	24.0	4.479564	0.84747	.	.	ENSG00000221818	ENST00000520164;ENST00000408929;ENST00000535548	T;T;T	0.46063	0.88;0.88;0.88	5.58	5.58	0.84498	Cell surface receptor IPT/TIG (2);Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.63721	0.2535	M	0.72118	2.19	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.66264	-0.5967	10	0.87932	D	0	0.1833	14.4259	0.67215	0.0:0.0:0.8527:0.1473	.	308	Q9HAK2	COE2_HUMAN	W	308;160;39	ENSP00000430241:R308W;ENSP00000386178:R160W;ENSP00000437909:R39W	ENSP00000386178:R160W	R	-	1	2	EBF2	25800275	1.000000	0.71417	1.000000	0.80357	0.907000	0.53573	5.454000	0.66651	2.641000	0.89580	0.563000	0.77884	CGG	EBF2	-	pfam_IPT,superfamily_Ig_E-set,smart_IPT	ENSG00000221818		0.458	EBF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EBF2	HGNC	protein_coding	OTTHUMT00000375886.2	-	0.00	136	0	G	NM_022659		25744358	-1	tier1	-	no_errors	ENST00000520164	ensembl	human	known	74_37	missense	5.56	68	4	SNP	1.000	A
ENOX2	10495	genome.wustl.edu	37	X	129803957	129803957	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chrX:129803957C>T	ENST00000370927.1	-	5	784	c.763G>A	c.(763-765)Gtt>Att	p.V255I	ENOX2_ENST00000394363.1_Missense_Mutation_p.V226I|ENOX2_ENST00000338144.3_Missense_Mutation_p.V255I|ENOX2_ENST00000370935.1_Missense_Mutation_p.V226I			Q16206	ENOX2_HUMAN	ecto-NOX disulfide-thiol exchanger 2	255					cell growth (GO:0016049)|oxidation-reduction process (GO:0055114)|regulation of growth (GO:0040008)|ultradian rhythm (GO:0007624)	cytosol (GO:0005829)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)	nucleic acid binding (GO:0003676)|nucleotide binding (GO:0000166)|protein disulfide oxidoreductase activity (GO:0015035)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(17)|ovary(1)|prostate(3)	33						TTTTCAGCAACAATGCTGCAT	0.403																																					Ovarian(101;828 1506 2951 9500 35258)												0													150.0	120.0	130.0					X																	129803957		2203	4300	6503	SO:0001583	missense	0			AF207881	CCDS14626.1, CCDS14627.1	Xq25	2013-02-12	2007-03-23	2007-03-23	ENSG00000165675	ENSG00000165675		"""RNA binding motif (RRM) containing"""	2259	protein-coding gene	gene with protein product		300282	"""cytosolic ovarian carcinoma antigen 1"""	COVA1		8150545, 11888291	Standard	NM_006375		Approved	APK1, tNOX	uc004evw.3	Q16206	OTTHUMG00000022401	ENST00000370927.1:c.763G>A	X.37:g.129803957C>T	ENSP00000359965:p.Val255Ile		A8K197|A8K1C2|Q5VTJ1|Q5VTJ2|Q8WUX0|Q9NTP6|Q9UH82	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.V255I	ENST00000370927.1	37	c.763	CCDS14626.1	X	.	.	.	.	.	.	.	.	.	.	C	12.81	2.050605	0.36181	.	.	ENSG00000165675	ENST00000538435;ENST00000370935;ENST00000338144;ENST00000394363;ENST00000350369;ENST00000370927;ENST00000432489	.	.	.	5.31	5.31	0.75309	.	0.075591	0.56097	D	0.000037	T	0.23054	0.0557	N	0.11201	0.11	0.26525	N	0.974369	B;B	0.15719	0.014;0.004	B;B	0.17722	0.019;0.01	T	0.12192	-1.0557	8	.	.	.	-9.7821	10.8738	0.46899	0.0:0.8152:0.1848:0.0	.	255;283	Q16206;A4QPE1	ENOX2_HUMAN;.	I	226;226;255;226;283;255;226	.	.	V	-	1	0	ENOX2	129631638	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.978000	0.49305	2.463000	0.83235	0.600000	0.82982	GTT	ENOX2	-	NULL	ENSG00000165675		0.403	ENOX2-004	KNOWN	basic|CCDS	protein_coding	ENOX2	HGNC	protein_coding	OTTHUMT00000058277.1	-	0.00	21	0	C	NM_182314		129803957	-1	tier1	-	no_errors	ENST00000338144	ensembl	human	known	74_37	missense	25.00	9	3	SNP	1.000	T
TMEM132C	92293	genome.wustl.edu	37	12	129154486	129154486	+	Intron	SNP	A	A	G			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr12:129154486A>G	ENST00000435159.2	+	5	1449				AC107020.1_ENST00000408822.1_RNA|TMEM132C_ENST00000315208.8_Intron	NM_001136103.2	NP_001129575.2	Q8N3T6	T132C_HUMAN	transmembrane protein 132C							integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(4)|lung(2)|prostate(2)|skin(1)	13						cagaatccacaattacttttg	0.299																																																	0																																										SO:0001627	intron_variant	0			AK126715		12q24.32	2014-06-13				ENSG00000181234			25436	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 152"""						Standard	NM_001136103		Approved	DKFZp761O2018, PPP1R152	uc021rgn.1	Q8N3T6		ENST00000435159.2:c.1449+381A>G	12.37:g.129154486A>G			Q69YX8	RNA	SNP	-	NULL	ENST00000435159.2	37	NULL		12																																																																																			AC107020.1	-	-	ENSG00000221749		0.299	TMEM132C-201	KNOWN	basic|appris_principal	protein_coding	ENSG00000221749	Clone_based_ensembl_gene	protein_coding		-	0.00	72	0	A	XM_044062		129154486	-1	tier1	-	no_errors	ENST00000408822	ensembl	human	novel	74_37	rna	47.06	18	16	SNP	0.391	G
HAVCR2	84868	genome.wustl.edu	37	5	156531839	156531839	+	Intron	DEL	A	A	-			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr5:156531839delA	ENST00000307851.4	-	3	1125				CTB-120L21.1_ENST00000517708.1_RNA|HAVCR2_ENST00000522593.1_Intron|HAVCR2_ENST00000517358.1_5'Flank	NM_032782.4	NP_116171.3	Q8TDQ0	HAVR2_HUMAN	hepatitis A virus cellular receptor 2							extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				cervix(1)|large_intestine(4)|lung(12)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	22	Renal(175;0.00212)	Medulloblastoma(196;0.0354)|all_neural(177;0.0999)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			GGGCAGCAAGAAAAAAATGCG	0.418																																																	0																																										SO:0001627	intron_variant	0			AK027334	CCDS4333.1	5q34	2014-01-14			ENSG00000135077	ENSG00000135077		"""Immunoglobulin superfamily / V-set domain containing"""	18437	protein-coding gene	gene with protein product	"""T-cell immunoglobulin mucin family member 3"""	606652				11823861	Standard	NM_032782		Approved	Tim-3, TIM3, FLJ14428, TIMD3	uc003lwk.2	Q8TDQ0	OTTHUMG00000130249	ENST00000307851.4:c.395-79T>-	5.37:g.156531839delA			B2RAY2|Q8WW60|Q96K94	RNA	DEL	-	NULL	ENST00000307851.4	37	NULL	CCDS4333.1	5																																																																																			CTB-120L21.1	-	-	ENSG00000254246		0.418	HAVCR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000254246	Clone_based_vega_gene	protein_coding	OTTHUMT00000252574.2		0.00	55	0	A			156531839	+1	tier1		no_errors	ENST00000517708	ensembl	human	known	74_37	rna	10.34	26	3	DEL	0.000	-
NFAT5	10725	genome.wustl.edu	37	16	69738348	69738348	+	3'UTR	SNP	A	A	T			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr16:69738348A>T	ENST00000354436.2	+	0	13008				NFAT5_ENST00000393742.2_3'UTR|NFAT5_ENST00000432919.1_3'UTR|RP11-311C24.1_ENST00000561622.1_RNA|NFAT5_ENST00000349945.1_3'UTR	NM_006599.3	NP_006590.1	O94916	NFAT5_HUMAN	nuclear factor of activated T-cells 5, tonicity-responsive						cytokine production (GO:0001816)|excretion (GO:0007588)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of calcineurin-NFAT signaling cascade (GO:0070884)|signal transduction (GO:0007165)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(11)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	37						TTTTGTGTATATGGCTTTCAT	0.343																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AF134870	CCDS10881.1, CCDS10882.1, CCDS45519.1	16q22.1	2009-11-24			ENSG00000102908	ENSG00000102908		"""Nuclear factor of activated T-cells"""	7774	protein-coding gene	gene with protein product		604708				10377394	Standard	NM_173214		Approved	TONEBP, KIAA0827, NFATL1, OREBP, NFATZ, NF-AT5	uc002exl.2	O94916	OTTHUMG00000137572	ENST00000354436.2:c.*8094A>T	16.37:g.69738348A>T			A2RRB4|A6H8V5|E9PHR7|O95693|Q7LA65|Q969Q8|Q96QH3|Q9UN18	RNA	SNP	-	NULL	ENST00000354436.2	37	NULL	CCDS10881.1	16																																																																																			RP11-311C24.1	-	-	ENSG00000260772		0.343	NFAT5-001	KNOWN	basic|CCDS	protein_coding	ENSG00000260772	Clone_based_vega_gene	protein_coding	OTTHUMT00000268952.2	-	0.00	81	0	A	NM_138714		69738348	+1	tier1	-	no_errors	ENST00000561622	ensembl	human	known	74_37	rna	30.16	44	19	SNP	1.000	T
ERCC3	2071	genome.wustl.edu	37	2	128036799	128036799	+	Silent	SNP	G	G	T			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr2:128036799G>T	ENST00000285398.2	-	10	1774	c.1680C>A	c.(1678-1680)gtC>gtA	p.V560V	ERCC3_ENST00000493187.2_Silent_p.V496V	NM_000122.1	NP_000113.1	P19447	ERCC3_HUMAN	excision repair cross-complementation group 3	560	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				7-methylguanosine mRNA capping (GO:0006370)|apoptotic process (GO:0006915)|DNA repair (GO:0006281)|DNA topological change (GO:0006265)|gene expression (GO:0010467)|hair cell differentiation (GO:0035315)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|nucleotide-excision repair, DNA duplex unwinding (GO:0000717)|nucleotide-excision repair, DNA incision (GO:0033683)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of viral transcription (GO:0050434)|protein localization (GO:0008104)|regulation of mitotic cell cycle phase transition (GO:1901990)|response to hypoxia (GO:0001666)|response to oxidative stress (GO:0006979)|response to UV (GO:0009411)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|UV protection (GO:0009650)|viral process (GO:0016032)	holo TFIIH complex (GO:0005675)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	3'-5' DNA helicase activity (GO:0043138)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|ATPase activity (GO:0016887)|damaged DNA binding (GO:0003684)|dATP binding (GO:0032564)|DNA binding (GO:0003677)|GTP binding (GO:0005525)|peptide binding (GO:0042277)|protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)|RNA polymerase II carboxy-terminal domain kinase activity (GO:0008353)|transcription factor binding (GO:0008134)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(12)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	31	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.073)		TGTCAGCAAAGACAATAATCT	0.413			"""Mis, S"""			"""skin basal cell, skin squamous cell, melanoma"""		Nucleotide excision repair (NER)	Xeroderma Pigmentosum																														yes	Rec		Xeroderma pigmentosum (B)	2	2q21	2071	"""excision repair cross-complementing rodent repair deficiency, complementation group 3 (xeroderma pigmentosum group B complementing)"""		E	0													134.0	119.0	124.0					2																	128036799		2203	4300	6503	SO:0001819	synonymous_variant	0	Familial Cancer Database	incl. XPA, XPB, XPC, XPD, XPE, XPF, XPG, XP Variant, XPV	M31899	CCDS2144.1	2q21	2014-09-17	2014-03-07		ENSG00000163161	ENSG00000163161		"""General transcription factors"", ""General transcription factor IIH complex subunits"""	3435	protein-coding gene	gene with protein product	"""xeroderma pigmentosum group B complementing"""	133510	"""excision repair cross-complementing rodent repair deficiency, complementation group 3"""			8202161	Standard	NM_000122		Approved	XPB, BTF2, RAD25, TFIIH, GTF2H	uc002toh.1	P19447	OTTHUMG00000131530	ENST00000285398.2:c.1680C>A	2.37:g.128036799G>T			Q53QM0	Silent	SNP	pfam_Helicase/UvrB_dom,pfam_Helicase_C,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,prints_Helicase_Ercc3,tigrfam_Helicase_Ercc3	p.V560	ENST00000285398.2	37	c.1680	CCDS2144.1	2																																																																																			ERCC3	-	superfamily_P-loop_NTPase,pfscan_Helicase_C,prints_Helicase_Ercc3,tigrfam_Helicase_Ercc3	ENSG00000163161		0.413	ERCC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ERCC3	HGNC	protein_coding	OTTHUMT00000331028.1	-	0.00	103	0	G	NM_000122		128036799	-1	tier1	-	no_errors	ENST00000285398	ensembl	human	known	74_37	silent	34.62	34	18	SNP	0.849	T
FA2H	79152	genome.wustl.edu	37	16	74752979	74752979	+	Silent	SNP	G	G	A			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr16:74752979G>A	ENST00000219368.3	-	5	762	c.693C>T	c.(691-693)taC>taT	p.Y231Y	FA2H_ENST00000544337.1_Silent_p.Y18Y	NM_024306.4	NP_077282.3	Q7L5A8	FA2H_HUMAN	fatty acid 2-hydroxylase	231					cell death (GO:0008219)|central nervous system myelin maintenance (GO:0032286)|fatty acid biosynthetic process (GO:0006633)|lipid modification (GO:0030258)|peripheral nervous system myelin maintenance (GO:0032287)|regulation of cell proliferation (GO:0042127)|regulation of hair cycle (GO:0042634)|sebaceous gland cell differentiation (GO:0001949)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	fatty acid alpha-hydroxylase activity (GO:0080132)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			endometrium(2)|large_intestine(4)|lung(3)|skin(1)	10						GGTGGATGAGGTACTCGATGA	0.597																																																	0													93.0	81.0	85.0					16																	74752979		2198	4300	6498	SO:0001819	synonymous_variant	0			BC002679	CCDS10911.1	16q23	2013-03-04	2003-10-29	2003-10-31	ENSG00000103089	ENSG00000103089		"""Fatty acid hydroxylase domain containing"""	21197	protein-coding gene	gene with protein product	"""fatty acid hydroxylase"""	611026	"""fatty acid hydroxylase domain containing 1"", ""spastic paraplegia 35 (autosomal recessive)"""	FAXDC1, SPG35		20104589	Standard	NM_024306		Approved	FAAH, FLJ25287	uc002fde.2	Q7L5A8	OTTHUMG00000137603	ENST00000219368.3:c.693C>T	16.37:g.74752979G>A			B7Z8T6|O75213|Q96DK1|Q9H1A5	Missense_Mutation	SNP	pfam_Cyt_B5-like_heme/steroid-bd,superfamily_Cyt_B5-like_heme/steroid-bd,pfscan_Cyt_B5-like_heme/steroid-bd,prints_Cyt_B5-like_heme/steroid-bd	p.T148I	ENST00000219368.3	37	c.443	CCDS10911.1	16																																																																																			FA2H	-	NULL	ENSG00000103089		0.597	FA2H-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FA2H	HGNC	protein_coding	OTTHUMT00000269015.2	-	0.00	55	0	G	NM_024306		74752979	-1	tier1	-	no_errors	ENST00000567683	ensembl	human	known	74_37	missense	7.69	48	4	SNP	1.000	A
OTULIN	90268	genome.wustl.edu	37	5	14687651	14687651	+	Nonsense_Mutation	SNP	A	A	T			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr5:14687651A>T	ENST00000284274.4	+	5	568	c.490A>T	c.(490-492)Aaa>Taa	p.K164*		NM_138348.4	NP_612357.4	Q96BN8	OTUL_HUMAN		164	OTU.				canonical Wnt signaling pathway (GO:0060070)|innate immune response (GO:0045087)|negative regulation of inflammatory response (GO:0050728)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|nucleotide-binding oligomerization domain containing 2 signaling pathway (GO:0070431)|protein linear deubiquitination (GO:1990108)|sprouting angiogenesis (GO:0002040)	cytoplasm (GO:0005737)|LUBAC complex (GO:0071797)	cysteine-type peptidase activity (GO:0008234)|ubiquitin-specific protease activity (GO:0004843)			breast(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(2)|upper_aerodigestive_tract(1)	14	Lung NSC(4;0.00696)					ACTCATAAGCAAATACAACTG	0.373																																																	0													129.0	133.0	132.0					5																	14687651		1837	4094	5931	SO:0001587	stop_gained	0																														ENST00000284274.4:c.490A>T	5.37:g.14687651A>T	ENSP00000284274:p.Lys164*		D3DTD3|Q8NAS0|Q96IA3	Nonsense_Mutation	SNP	prints_FAM105,prints_FAM105B,prints_FAM105A	p.K164*	ENST00000284274.4	37	c.490	CCDS43302.1	5	.	.	.	.	.	.	.	.	.	.	A	34	5.411051	0.96072	.	.	ENSG00000154124	ENST00000284274	.	.	.	6.04	6.04	0.98038	.	0.362601	0.33772	N	0.004571	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-13.291	14.3294	0.66545	1.0:0.0:0.0:0.0	.	.	.	.	X	164	.	ENSP00000284274:K164X	K	+	1	0	FAM105B	14740651	0.999000	0.42202	0.107000	0.21349	0.955000	0.61496	6.015000	0.70791	2.317000	0.78254	0.460000	0.39030	AAA	FAM105B	-	prints_FAM105B	ENSG00000154124		0.373	FAM105B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM105B	HGNC	protein_coding	OTTHUMT00000366012.1		0.00	87	0	A			14687651	+1			no_errors	ENST00000284274	ensembl	human	known	74_37	nonsense	5.63	66	4	SNP	0.352	T
FAM155A	728215	genome.wustl.edu	37	13	108518145	108518145	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr13:108518145G>C	ENST00000375915.2	-	1	938	c.800C>G	c.(799-801)gCt>gGt	p.A267G		NM_001080396.2	NP_001073865.1	B1AL88	F155A_HUMAN	family with sequence similarity 155, member A	267						integral component of membrane (GO:0016021)				breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(11)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	33						GTCCTGGTAAGCCTCGACGCA	0.512																																																	0													142.0	125.0	130.0					13																	108518145		2203	4300	6503	SO:0001583	missense	0			L10374	CCDS32006.1	13q33.3	2008-04-15			ENSG00000204442	ENSG00000204442			33877	protein-coding gene	gene with protein product							Standard	NM_001080396		Approved		uc001vql.3	B1AL88	OTTHUMG00000017326	ENST00000375915.2:c.800C>G	13.37:g.108518145G>C	ENSP00000365080:p.Ala267Gly		B2RUV1|B7Z334	Missense_Mutation	SNP	NULL	p.A267G	ENST00000375915.2	37	c.800	CCDS32006.1	13	.	.	.	.	.	.	.	.	.	.	G	16.52	3.145186	0.57044	.	.	ENSG00000204442	ENST00000375915	T	0.47869	0.83	5.9	5.9	0.94986	.	0.000000	0.85682	D	0.000000	T	0.65668	0.2713	L	0.50333	1.59	0.54753	D	0.999983	D	0.89917	1.0	D	0.85130	0.997	T	0.62992	-0.6736	10	0.51188	T	0.08	.	19.2604	0.93966	0.0:0.0:1.0:0.0	.	267	B1AL88	F155A_HUMAN	G	267	ENSP00000365080:A267G	ENSP00000365080:A267G	A	-	2	0	FAM155A	107316146	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.439000	0.97543	2.793000	0.96121	0.563000	0.77884	GCT	FAM155A	-	NULL	ENSG00000204442		0.512	FAM155A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM155A	HGNC	protein_coding	OTTHUMT00000045736.2	-	0.00	55	0	G	NM_001080396		108518145	-1	tier1	-	no_errors	ENST00000375915	ensembl	human	known	74_37	missense	29.73	26	11	SNP	1.000	C
FAM161A	84140	genome.wustl.edu	37	2	62080999	62080999	+	Missense_Mutation	SNP	C	C	T	rs561436916		TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr2:62080999C>T	ENST00000405894.3	-	1	279	c.178G>A	c.(178-180)Gca>Aca	p.A60T	FAM161A_ENST00000404929.1_Missense_Mutation_p.A60T	NM_032180.2	NP_115556.2	Q3B820	F161A_HUMAN	family with sequence similarity 161, member A	60					cilium assembly (GO:0042384)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|photoreceptor connecting cilium (GO:0032391)				breast(1)|endometrium(5)|large_intestine(8)|lung(4)|ovary(3)|pancreas(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	25						ATTACCGATGCCCCAGCGGGC	0.667																																																	0													41.0	42.0	41.0					2																	62080999		1568	3582	5150	SO:0001583	missense	0				CCDS42687.2, CCDS56120.1	2p15	2011-03-15			ENSG00000170264	ENSG00000170264			25808	protein-coding gene	gene with protein product		613596	"""retinitis pigmentosa 28 (autosomal recessive)"""	RP28		10507729, 20705278, 20705279	Standard	NM_032180		Approved	FLJ13305	uc002sbm.4	Q3B820	OTTHUMG00000152165	ENST00000405894.3:c.178G>A	2.37:g.62080999C>T	ENSP00000385893:p.Ala60Thr		B4DJV7|Q9H8R2	Missense_Mutation	SNP	pfam_UPF0564	p.A60T	ENST00000405894.3	37	c.178	CCDS42687.2	2	.	.	.	.	.	.	.	.	.	.	C	16.05	3.013987	0.54468	.	.	ENSG00000170264	ENST00000404929;ENST00000405894	T;T	0.63096	-0.02;-0.02	4.17	2.33	0.28932	.	.	.	.	.	T	0.37598	0.1009	N	0.08118	0	0.09310	N	1	B;P	0.35107	0.352;0.484	B;B	0.33254	0.077;0.16	T	0.26677	-1.0096	9	0.87932	D	0	.	5.2186	0.15356	0.201:0.694:0.0:0.1051	.	60;60	Q3B820;Q3B820-3	F161A_HUMAN;.	T	60	ENSP00000385158:A60T;ENSP00000385893:A60T	ENSP00000303170:A60T	A	-	1	0	FAM161A	61934503	0.852000	0.29690	0.057000	0.19452	0.028000	0.11728	1.818000	0.39012	0.679000	0.31345	-0.150000	0.13652	GCA	FAM161A	-	NULL	ENSG00000170264		0.667	FAM161A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	FAM161A	HGNC	protein_coding	OTTHUMT00000325537.2		0.00	91	0	C	NM_032180		62080999	-1			no_errors	ENST00000405894	ensembl	human	known	74_37	missense	7.84	47	4	SNP	0.060	T
FAM214A	56204	genome.wustl.edu	37	15	52879367	52879367	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr15:52879367G>T	ENST00000261844.7	-	11	3010	c.2858C>A	c.(2857-2859)cCt>cAt	p.P953H	FAM214A_ENST00000546305.2_Missense_Mutation_p.P960H|RP11-23N2.4_ENST00000566344.1_RNA|RP11-23N2.4_ENST00000562062.1_RNA	NM_019600.2	NP_062546.2	Q32MH5	F214A_HUMAN	family with sequence similarity 214, member A	953																	TGTTCCTGAAGGAGGTACTCG	0.368																																																	0													145.0	134.0	138.0					15																	52879367		1850	4095	5945	SO:0001583	missense	0			AB037791	CCDS45263.1, CCDS66773.1	15q21.2-q21.3	2011-12-01	2011-12-01	2011-12-01	ENSG00000047346	ENSG00000047346			25609	protein-coding gene	gene with protein product			"""KIAA1370"""	KIAA1370		10718198	Standard	XM_005254547		Approved	FLJ10980	uc002acg.4	Q32MH5		ENST00000261844.7:c.2858C>A	15.37:g.52879367G>T	ENSP00000261844:p.Pro953His		A8KA52|B4DEP5|B4DF40|F5H8G0|Q32MH6|Q4G0R7|Q5XJ16|Q6PDA3|Q9NV24|Q9P2H7	Missense_Mutation	SNP	NULL	p.P953H	ENST00000261844.7	37	c.2858	CCDS45263.1	15	.	.	.	.	.	.	.	.	.	.	G	21.8	4.199850	0.79015	.	.	ENSG00000047346	ENST00000261844;ENST00000399202;ENST00000534964;ENST00000546305	T;T;T	0.67345	1.42;-0.26;1.42	5.17	5.17	0.71159	.	0.000000	0.85682	D	0.000000	T	0.81612	0.4859	M	0.71581	2.175	0.80722	D	1	D;D	0.69078	0.997;0.994	D;D	0.80764	0.994;0.985	T	0.83257	-0.0050	10	0.62326	D	0.03	.	18.7072	0.91643	0.0:0.0:1.0:0.0	.	960;953	F5H8G0;Q32MH5	.;K1370_HUMAN	H	953;953;952;960	ENSP00000261844:P953H;ENSP00000444447:P952H;ENSP00000443598:P960H	ENSP00000261844:P953H	P	-	2	0	KIAA1370	50666659	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.400000	0.97290	2.405000	0.81733	0.650000	0.86243	CCT	FAM214A	-	NULL	ENSG00000047346		0.368	FAM214A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM214A	HGNC	protein_coding	OTTHUMT00000419914.1	-	0.00	106	0	G	NM_019600		52879367	-1	tier1	-	no_errors	ENST00000261844	ensembl	human	known	74_37	missense	6.67	56	4	SNP	1.000	T
FAM49A	81553	genome.wustl.edu	37	2	16745363	16745363	+	Splice_Site	SNP	C	C	A			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr2:16745363C>A	ENST00000381323.3	-	5	413		c.e5-1		FAM49A_ENST00000406434.1_Splice_Site|FAM49A_ENST00000355549.2_Splice_Site	NM_030797.3	NP_110424.1	Q9H0Q0	FA49A_HUMAN	family with sequence similarity 49, member A							intracellular (GO:0005622)		p.?(1)		breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(4)|liver(1)|lung(11)|skin(3)|upper_aerodigestive_tract(1)	23	Acute lymphoblastic leukemia(172;0.0734)|all_hematologic(175;0.088)		GBM - Glioblastoma multiforme(3;0.00969)			TTTGAATTGCCTGCAAAAACA	0.373																																																	1	Unknown(1)	skin(1)											79.0	74.0	76.0					2																	16745363		2203	4300	6503	SO:0001630	splice_region_variant	0			AK001942	CCDS1688.1	2p24.3	2008-02-05			ENSG00000197872	ENSG00000197872			25373	protein-coding gene	gene with protein product							Standard	NM_030797		Approved	DKFZP566A1524, FLJ11080	uc002rck.2	Q9H0Q0	OTTHUMG00000090615	ENST00000381323.3:c.193-1G>T	2.37:g.16745363C>A			B3KNZ1|Q53QW2	Splice_Site	SNP	-	e3-1	ENST00000381323.3	37	c.193-1	CCDS1688.1	2	.	.	.	.	.	.	.	.	.	.	C	19.90	3.912037	0.72983	.	.	ENSG00000197872	ENST00000381323;ENST00000406434;ENST00000355549;ENST00000445605;ENST00000451689	.	.	.	5.75	5.75	0.90469	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.319	0.94229	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	FAM49A	16608844	1.000000	0.71417	0.998000	0.56505	0.637000	0.38172	7.564000	0.82326	2.894000	0.99253	0.655000	0.94253	.	FAM49A	-	-	ENSG00000197872		0.373	FAM49A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM49A	HGNC	protein_coding	OTTHUMT00000207203.2		0.00	69	0	C	NM_030797	Intron	16745363	-1			no_errors	ENST00000355549	ensembl	human	known	74_37	splice_site	5.71	33	2	SNP	1.000	A
FBXO38	81545	genome.wustl.edu	37	5	147793797	147793798	+	Frame_Shift_Ins	INS	-	-	T			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr5:147793797_147793798insT	ENST00000340253.5	+	10	1360_1361	c.1192_1193insT	c.(1192-1194)gttfs	p.V398fs	FBXO38_ENST00000513826.1_Frame_Shift_Ins_p.V398fs|FBXO38_ENST00000296701.6_Frame_Shift_Ins_p.V398fs|FBXO38_ENST00000394370.3_Frame_Shift_Ins_p.V398fs			Q6PIJ6	FBX38_HUMAN	F-box protein 38	398					cell death (GO:0008219)	cytoplasm (GO:0005737)|nucleus (GO:0005634)			ATG4C/FBXO38(2)	NS(1)|breast(2)|endometrium(7)|kidney(5)|large_intestine(9)|lung(15)|ovary(5)|prostate(2)|skin(2)|stomach(2)|urinary_tract(1)	51			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGTCAATGAAGTTTTTTCCTGT	0.386																																																	0																																										SO:0001589	frameshift_variant	0			BC005873	CCDS43384.1, CCDS64285.1	5q33.1	2008-02-05			ENSG00000145868	ENSG00000145868		"""F-boxes /  ""other"""""	28844	protein-coding gene	gene with protein product		608533				12477932	Standard	NM_030793		Approved	MOKA, SP329, FLJ13962, Fbx38	uc003lpg.2	Q6PIJ6	OTTHUMG00000129929	ENST00000340253.5:c.1198dupT	5.37:g.147793803_147793803dupT	ENSP00000342023:p.Val398fs		Q6PK72|Q7Z2U0|Q86VN3|Q9BXY6|Q9H837|Q9HC40	Frame_Shift_Ins	INS	superfamily_F-box_dom	p.S400fs	ENST00000340253.5	37	c.1192_1193		5																																																																																			FBXO38	-	NULL	ENSG00000145868		0.386	FBXO38-002	KNOWN	basic|appris_principal	protein_coding	FBXO38	HGNC	protein_coding	OTTHUMT00000252185.2		0.00	37	0	-	NM_030793		147793798	+1	tier1		no_errors	ENST00000340253	ensembl	human	known	74_37	frame_shift_ins	8.70	21	2	INS	1.000:1.000	T
FBXO8	26269	genome.wustl.edu	37	4	175158640	175158640	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr4:175158640C>A	ENST00000393674.2	-	6	1745	c.883G>T	c.(883-885)Gct>Tct	p.A295S	FBXO8_ENST00000503293.1_Missense_Mutation_p.A254S	NM_012180.2	NP_036312.2	Q9NRD0	FBX8_HUMAN	F-box protein 8	295					actin cytoskeleton organization (GO:0030036)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)|ubiquitin-dependent protein catabolic process (GO:0006511)	cell junction (GO:0030054)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)			breast(3)|endometrium(1)|kidney(1)|large_intestine(5)|lung(2)|prostate(1)|urinary_tract(1)	14		Prostate(90;0.00201)|Melanoma(52;0.012)|Renal(120;0.0183)|all_neural(102;0.0887)|all_hematologic(60;0.107)		all cancers(43;7.29e-18)|Epithelial(43;1.85e-15)|OV - Ovarian serous cystadenocarcinoma(60;5.62e-09)|GBM - Glioblastoma multiforme(59;0.00115)|STAD - Stomach adenocarcinoma(60;0.00299)|LUSC - Lung squamous cell carcinoma(193;0.1)		TTTTGAGCAGCGCGACGGGTA	0.383																																																	0													95.0	95.0	95.0					4																	175158640		2203	4300	6503	SO:0001583	missense	0			AF174596	CCDS3820.1	4q34.1	2008-02-05	2004-06-15			ENSG00000164117		"""F-boxes /  ""other"""""	13587	protein-coding gene	gene with protein product		605649	"""F-box only protein 8"""			10531035, 10531037	Standard	NM_012180		Approved	FBX8, FBS	uc003itp.3	Q9NRD0		ENST00000393674.2:c.883G>T	4.37:g.175158640C>A	ENSP00000377280:p.Ala295Ser		B2RB40|D3DP41|G5E9Z0|Q6UWN4|Q8IWE1|Q9NRP5|Q9UKC4	Missense_Mutation	SNP	pfam_Sec7_dom,superfamily_Sec7_dom,superfamily_F-box_dom,smart_Sec7_dom,pfscan_F-box_dom,pfscan_Sec7_dom	p.A295S	ENST00000393674.2	37	c.883	CCDS3820.1	4	.	.	.	.	.	.	.	.	.	.	C	23.5	4.421796	0.83559	.	.	ENSG00000164117	ENST00000393674;ENST00000503293;ENST00000296517	T;T	0.53640	0.61;0.61	5.52	5.52	0.82312	SEC7-like, alpha orthogonal bundle (1);SEC7-like (4);	0.000000	0.85682	D	0.000000	T	0.62270	0.2414	L	0.56199	1.76	0.80722	D	1	D;D	0.57899	0.977;0.981	P;P	0.58721	0.688;0.844	T	0.61559	-0.7038	10	0.51188	T	0.08	.	19.442	0.94824	0.0:1.0:0.0:0.0	.	254;295	G5E9Z0;Q9NRD0	.;FBX8_HUMAN	S	295;254;208	ENSP00000377280:A295S;ENSP00000422905:A254S	ENSP00000296517:A208S	A	-	1	0	FBXO8	175395215	1.000000	0.71417	0.996000	0.52242	0.997000	0.91878	7.001000	0.76297	2.593000	0.87608	0.655000	0.94253	GCT	FBXO8	-	pfam_Sec7_dom,superfamily_Sec7_dom,smart_Sec7_dom,pfscan_Sec7_dom	ENSG00000164117		0.383	FBXO8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXO8	HGNC	protein_coding	OTTHUMT00000362085.2		0.00	42	0	C	NM_012180		175158640	-1			no_errors	ENST00000393674	ensembl	human	known	74_37	missense	11.11	16	2	SNP	1.000	A
FEM1C	56929	genome.wustl.edu	37	5	114860292	114860292	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr5:114860292C>T	ENST00000274457.3	-	3	2128	c.1567G>A	c.(1567-1569)Gtc>Atc	p.V523I		NM_020177.2	NP_064562.1	Q96JP0	FEM1C_HUMAN	fem-1 homolog c (C. elegans)	523					protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)				breast(5)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(1)|liver(1)|lung(4)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	18		all_cancers(142;0.000575)|all_epithelial(76;9.98e-06)|Prostate(80;0.00955)|Ovarian(225;0.0443)|all_lung(232;0.132)|Breast(839;0.195)		OV - Ovarian serous cystadenocarcinoma(64;2.5e-07)|Epithelial(69;2.66e-07)|all cancers(49;1.39e-05)		GAGTCTCTGACGTTCACATCA	0.428																																																	0													204.0	190.0	195.0					5																	114860292		2202	4300	6502	SO:0001583	missense	0				CCDS4118.1	5q22	2013-01-10	2006-11-08		ENSG00000145780	ENSG00000145780		"""Ankyrin repeat domain containing"""	16933	protein-coding gene	gene with protein product		608767				14527725, 11733146	Standard	NM_020177		Approved	KIAA1785, EUROIMAGE686608, EUROIMAGE783647, FEM1A	uc003krb.1	Q96JP0	OTTHUMG00000128895	ENST00000274457.3:c.1567G>A	5.37:g.114860292C>T	ENSP00000274457:p.Val523Ile		B2RE47|Q8N3V8|Q9H704|Q9NPL6|Q9NPL9	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.V523I	ENST00000274457.3	37	c.1567	CCDS4118.1	5	.	.	.	.	.	.	.	.	.	.	C	13.70	2.314804	0.40996	.	.	ENSG00000145780	ENST00000274457	T	0.63913	-0.07	5.55	5.55	0.83447	Ankyrin repeat-containing domain (4);	0.111463	0.64402	D	0.000007	T	0.52419	0.1733	N	0.21324	0.655	0.38170	D	0.939309	B	0.13145	0.007	B	0.12156	0.007	T	0.49643	-0.8918	10	0.42905	T	0.14	-22.2614	19.5061	0.95116	0.0:1.0:0.0:0.0	.	523	Q96JP0	FEM1C_HUMAN	I	523	ENSP00000274457:V523I	ENSP00000274457:V523I	V	-	1	0	FEM1C	114888191	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.522000	0.45572	2.591000	0.87537	0.655000	0.94253	GTC	FEM1C	-	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000145780		0.428	FEM1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FEM1C	HGNC	protein_coding	OTTHUMT00000250857.3		0.00	77	0	C	NM_020177		114860292	-1			no_errors	ENST00000274457	ensembl	human	known	74_37	missense	6.45	29	2	SNP	1.000	T
TMEM258	746	genome.wustl.edu	37	11	61562992	61562992	+	5'Flank	SNP	G	G	A			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr11:61562992G>A	ENST00000537328.1	-	0	0				FADS2_ENST00000574708.1_Intron|MIR611_ENST00000384869.1_RNA|TMEM258_ENST00000543510.1_5'Flank|FEN1_ENST00000305885.2_Silent_p.L53L	NM_014206.3	NP_055021.1	P61165	TM258_HUMAN	transmembrane protein 258							integral component of membrane (GO:0016021)											GGGATGTGCTGCAGAATGAGG	0.517																																																	0													90.0	79.0	83.0					11																	61562992		2202	4299	6501	SO:0001631	upstream_gene_variant	0				CCDS8009.1	11q12.2	2012-12-03	2012-12-03	2012-12-03	ENSG00000134825	ENSG00000134825			1164	protein-coding gene	gene with protein product			"""chromosome 11 open reading frame 10"""	C11orf10		12427278	Standard	NM_014206		Approved		uc001nsf.3	P61165	OTTHUMG00000168172		11.37:g.61562992G>A	Exception_encountered		A8K6L8|Q9D953|Q9Y2Q7	Silent	SNP	pfam_XPG_DNA_repair_N,pfam_XPG-I_dom,superfamily_5-3_exonuclease_C,smart_XPG_DNA_repair_N,smart_XPG-I_dom,smart_HhH2,prints_XPG/Rad2	p.L53	ENST00000537328.1	37	c.159	CCDS8009.1	11																																																																																			FEN1	-	pfam_XPG_DNA_repair_N,smart_XPG_DNA_repair_N	ENSG00000168496		0.517	TMEM258-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FEN1	HGNC	protein_coding	OTTHUMT00000398577.1	-	0.00	92	0	G	NM_014206		61562992	+1	tier1	-	no_errors	ENST00000305885	ensembl	human	known	74_37	silent	6.78	55	4	SNP	0.993	A
FGF5	2250	genome.wustl.edu	37	4	81189430	81189430	+	Intron	SNP	C	C	A			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr4:81189430C>A	ENST00000312465.7	+	1	581				FGF5_ENST00000503413.1_3'UTR|FGF5_ENST00000456523.3_Intron	NM_004464.3	NP_004455.2	P12034	FGF5_HUMAN	fibroblast growth factor 5						cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glial cell differentiation (GO:0010001)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|signal transduction involved in regulation of gene expression (GO:0023019)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	fibroblast growth factor receptor binding (GO:0005104)			breast(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	22						TCAGTAGGGCCAGATCGCTCT	0.627																																																	0																																										SO:0001627	intron_variant	0			M23534	CCDS3586.1, CCDS34021.1	4q21	2014-01-30			ENSG00000138675	ENSG00000138675		"""Endogenous ligands"""	3683	protein-coding gene	gene with protein product		165190				3211147, 2577873	Standard	NM_001291812		Approved		uc003hmd.3	P12034	OTTHUMG00000130288	ENST00000312465.7:c.355+1097C>A	4.37:g.81189430C>A			B2R554|O75846|Q3Y8M3|Q8NF90	RNA	SNP	-	NULL	ENST00000312465.7	37	NULL	CCDS34021.1	4																																																																																			FGF5	-	-	ENSG00000138675		0.627	FGF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FGF5	HGNC	protein_coding	OTTHUMT00000252627.2	-	0.00	29	0	C			81189430	+1	tier1	-	no_errors	ENST00000503413	ensembl	human	known	74_37	rna	28.57	10	4	SNP	0.004	A
FGF5	2250	genome.wustl.edu	37	4	81208235	81208236	+	3'UTR	INS	-	-	T	rs35279668|rs33946030		TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr4:81208235_81208236insT	ENST00000312465.7	+	0	1442_1443				FGF5_ENST00000503413.1_3'UTR|FGF5_ENST00000456523.3_3'UTR	NM_004464.3	NP_004455.2	P12034	FGF5_HUMAN	fibroblast growth factor 5						cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glial cell differentiation (GO:0010001)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|signal transduction involved in regulation of gene expression (GO:0023019)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	fibroblast growth factor receptor binding (GO:0005104)			breast(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	22						GTTAACTTTTGTTTTTTTTTGT	0.233																																																	0																																										SO:0001624	3_prime_UTR_variant	0			M23534	CCDS3586.1, CCDS34021.1	4q21	2014-01-30			ENSG00000138675	ENSG00000138675		"""Endogenous ligands"""	3683	protein-coding gene	gene with protein product		165190				3211147, 2577873	Standard	NM_001291812		Approved		uc003hmd.3	P12034	OTTHUMG00000130288	ENST00000312465.7:c.*410->T	4.37:g.81208244_81208244dupT			B2R554|O75846|Q3Y8M3|Q8NF90	RNA	INS	-	NULL	ENST00000312465.7	37	NULL	CCDS34021.1	4																																																																																			FGF5	-	-	ENSG00000138675		0.233	FGF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FGF5	HGNC	protein_coding	OTTHUMT00000252627.2		0.00	58	0	-			81208236	+1	tier1		no_errors	ENST00000503413	ensembl	human	known	74_37	rna	9.76	37	4	INS	0.109:0.035	T
FKBP9	11328	genome.wustl.edu	37	7	33044838	33044838	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr7:33044838C>G	ENST00000242209.4	+	10	1757	c.1588C>G	c.(1588-1590)Cct>Gct	p.P530A	AVL9_ENST00000404479.1_Intron|FKBP9_ENST00000538336.1_Missense_Mutation_p.P583A|FKBP9_ENST00000538443.1_Missense_Mutation_p.P392A|FKBP9_ENST00000490776.2_Missense_Mutation_p.P298A	NM_001284343.1|NM_007270.3	NP_001271272.1|NP_009201.2	O95302	FKBP9_HUMAN	FK506 binding protein 9, 63 kDa	530					chaperone-mediated protein folding (GO:0061077)|protein folding (GO:0006457)|protein peptidyl-prolyl isomerization (GO:0000413)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)	calcium ion binding (GO:0005509)|FK506 binding (GO:0005528)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)			central_nervous_system(13)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(6)|lung(9)|ovary(2)|upper_aerodigestive_tract(1)	39			GBM - Glioblastoma multiforme(11;0.0156)			GAAACTCGCTCCTGGCTTTGA	0.502																																																	0													65.0	57.0	60.0					7																	33044838		2202	4281	6483	SO:0001583	missense	0			AF089745	CCDS5439.1, CCDS64622.1, CCDS64623.1	7p11.1	2013-01-10	2002-08-29		ENSG00000122642	ENSG00000122642		"""EF-hand domain containing"""	3725	protein-coding gene	gene with protein product			"""FK506-binding protein 9 (63 kD)"""			12036304	Standard	NM_007270		Approved	FKBP60, FKBP63	uc003tdh.3	O95302	OTTHUMG00000097847	ENST00000242209.4:c.1588C>G	7.37:g.33044838C>G	ENSP00000242209:p.Pro530Ala		B3KY35|B7Z1G9|B7Z6H3|Q2M2A1|Q3MIR7|Q6IN76|Q6P2N1|Q96EX5|Q96IJ9	Missense_Mutation	SNP	pfam_PPIase_FKBP_dom,smart_EF_hand_dom,pfscan_EF_hand_dom,pfscan_PPIase_FKBP_dom	p.P583A	ENST00000242209.4	37	c.1747	CCDS5439.1	7	.	.	.	.	.	.	.	.	.	.	C	19.11	3.764180	0.69878	.	.	ENSG00000122642	ENST00000242209;ENST00000538336;ENST00000538443;ENST00000490776	T;T;T;T	0.53640	0.61;0.61;0.61;2.33	5.07	5.07	0.68467	EF-hand-like domain (1);	0.000000	0.85682	D	0.000000	T	0.70141	0.3190	M	0.75615	2.305	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.996;0.997;0.999	T	0.74210	-0.3739	10	0.72032	D	0.01	-11.8545	18.4683	0.90763	0.0:1.0:0.0:0.0	.	298;583;530	B7Z1G9;B7Z6H3;O95302	.;.;FKBP9_HUMAN	A	530;583;392;298	ENSP00000242209:P530A;ENSP00000439250:P583A;ENSP00000437504:P392A;ENSP00000441317:P298A	ENSP00000242209:P530A	P	+	1	0	FKBP9	33011363	1.000000	0.71417	0.981000	0.43875	0.725000	0.41563	7.727000	0.84838	2.371000	0.80710	0.555000	0.69702	CCT	FKBP9	-	NULL	ENSG00000122642		0.502	FKBP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FKBP9	HGNC	protein_coding	OTTHUMT00000215137.1		0.00	135	0	C	NM_007270		33044838	+1			no_errors	ENST00000538336	ensembl	human	known	74_37	missense	7.22	90	7	SNP	0.994	G
FKBP9P1	360132	genome.wustl.edu	37	7	55750467	55750467	+	RNA	SNP	G	G	C			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr7:55750467G>C	ENST00000455909.1	-	0	750					NR_027340.1|NR_027342.1		Q75LS8	FKB9L_HUMAN							protein folding (GO:0006457)		calcium ion binding (GO:0005509)			endometrium(1)|kidney(1)|lung(3)	5						TCAAAGCCAGGAGCGAGTTTC	0.493																																																	0													87.0	74.0	78.0					7																	55750467		692	1578	2270			0																															7.37:g.55750467G>C			B2R7H1	RNA	SNP	-	NULL	ENST00000455909.1	37	NULL		7																																																																																			FKBP9L	-	-	ENSG00000176826		0.493	FKBP9L-002	KNOWN	basic	processed_transcript	FKBP9L	HGNC	pseudogene	OTTHUMT00000251473.2	-	0.00	78	0	G			55750467	-1	tier1	-	no_errors	ENST00000455909	ensembl	human	known	74_37	rna	24.32	28	9	SNP	0.998	C
DMBT1P1	375940	genome.wustl.edu	37	10	124536328	124536328	+	RNA	SNP	A	A	G			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr10:124536328A>G	ENST00000439464.2	+	0	1187					NR_003570.1																						TTGTATCCACAGCCATCCCGA	0.473																																																	0																																												0																															10.37:g.124536328A>G				Splice_Site	SNP	-	NULL	ENST00000439464.2	37	c.NULL		10																																																																																			RP11-318C4.2	-	-	ENSG00000176584		0.473	RP11-318C4.2-001	KNOWN	basic	processed_transcript	FLJ46361	Clone_based_vega_gene	pseudogene	OTTHUMT00000471298.1		0.00	57	0	A			124536328	+1			no_errors	ENST00000439464	ensembl	human	known	74_37	splice_site	6.67	42	3	SNP	1.000	G
FOXM1	2305	genome.wustl.edu	37	12	2983434	2983434	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr12:2983434G>A	ENST00000359843.3	-	2	279	c.211C>T	c.(211-213)Ccc>Tcc	p.P71S	FOXM1_ENST00000361953.3_Missense_Mutation_p.P71S|FOXM1_ENST00000342628.2_Missense_Mutation_p.P71S|RHNO1_ENST00000461997.2_5'Flank|FOXM1_ENST00000537018.1_5'Flank|RHNO1_ENST00000489288.2_5'Flank	NM_021953.3	NP_068772.2	Q08050	FOXM1_HUMAN	forkhead box M1	71					cell cycle (GO:0007049)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA repair (GO:0006281)|G2/M transition of mitotic cell cycle (GO:0000086)|liver development (GO:0001889)|mitotic cell cycle (GO:0000278)|negative regulation of cell aging (GO:0090344)|negative regulation of stress-activated MAPK cascade (GO:0032873)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)|positive regulation of double-strand break repair (GO:2000781)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell cycle (GO:0051726)|regulation of cell cycle arrest (GO:0071156)|regulation of cell growth (GO:0001558)|regulation of cell proliferation (GO:0042127)|regulation of Ras protein signal transduction (GO:0046578)|regulation of reactive oxygen species metabolic process (GO:2000377)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)|transcription, DNA-templated (GO:0006351)|vasculogenesis (GO:0001570)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|protein kinase binding (GO:0019901)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(7)|lung(9)|prostate(1)|skin(1)|urinary_tract(3)	24			OV - Ovarian serous cystadenocarcinoma(31;0.000622)			TGCGTGTTGGGCATGGTGGGG	0.507																																																	0													148.0	130.0	136.0					12																	2983434		2203	4300	6503	SO:0001583	missense	0			Y12773	CCDS8515.1, CCDS8516.1, CCDS8517.1	12p13	2007-09-18			ENSG00000111206	ENSG00000111206		"""Forkhead boxes"""	3818	protein-coding gene	gene with protein product	"""M-phase phosphoprotein 2"""	602341		FKHL16		9032290, 9441747	Standard	NM_202002		Approved	HFH-11, trident, HNF-3, INS-1, MPP2, MPHOSPH2, TGT3	uc001qlf.3	Q08050	OTTHUMG00000168118	ENST00000359843.3:c.211C>T	12.37:g.2983434G>A	ENSP00000352901:p.Pro71Ser		O43258|O43259|O43260|Q4ZGG7|Q9BRL2	Missense_Mutation	SNP	pfam_TF_fork_head,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head	p.P71S	ENST00000359843.3	37	c.211	CCDS8515.1	12	.	.	.	.	.	.	.	.	.	.	G	9.234	1.036586	0.19669	.	.	ENSG00000111206	ENST00000342628;ENST00000361953;ENST00000359843	D;D;D	0.92965	-3.02;-3.14;-3.08	5.15	2.18	0.27775	.	0.237964	0.43919	N	0.000510	D	0.88466	0.6444	L	0.53729	1.69	0.35019	D	0.757616	B;B;B;B;B	0.20052	0.001;0.01;0.004;0.01;0.041	B;B;B;B;B	0.20955	0.009;0.016;0.02;0.016;0.032	T	0.82999	-0.0178	10	0.30078	T	0.28	.	11.9144	0.52757	0.0684:0.2287:0.7029:0.0	.	71;71;71;71;71	A8K591;Q53Y49;Q08050-2;Q08050;Q08050-3	.;.;.;FOXM1_HUMAN;.	S	71	ENSP00000342307:P71S;ENSP00000354492:P71S;ENSP00000352901:P71S	ENSP00000342307:P71S	P	-	1	0	FOXM1	2853695	1.000000	0.71417	0.998000	0.56505	0.870000	0.49936	2.797000	0.47877	0.033000	0.15463	-0.797000	0.03246	CCC	FOXM1	-	NULL	ENSG00000111206		0.507	FOXM1-002	KNOWN	basic|CCDS	protein_coding	FOXM1	HGNC	protein_coding	OTTHUMT00000398272.1	-	0.00	60	0	G	NM_021953		2983434	-1	tier1	-	no_errors	ENST00000342628	ensembl	human	known	74_37	missense	8.33	44	4	SNP	1.000	A
FRAS1	80144	genome.wustl.edu	37	4	79432599	79432599	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr4:79432599G>A	ENST00000264895.6	+	64	10392	c.9952G>A	c.(9952-9954)Gct>Act	p.A3318T		NM_025074.6	NP_079350.5	Q86XX4	FRAS1_HUMAN	Fraser extracellular matrix complex subunit 1	3314					cell communication (GO:0007154)|embryonic limb morphogenesis (GO:0030326)|metanephros morphogenesis (GO:0003338)|morphogenesis of an epithelium (GO:0002009)|palate development (GO:0060021)|protein transport (GO:0015031)|skin development (GO:0043588)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sublamina densa (GO:0061618)	metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(5)|lung(54)|prostate(7)|skin(2)|urinary_tract(4)	103						AGGCTTCCAGGCTCAGTCCTT	0.522																																																	0													65.0	65.0	65.0					4																	79432599		2005	4186	6191	SO:0001583	missense	0			AB040933	CCDS54772.1	4q21.21	2014-06-25	2014-06-25		ENSG00000138759	ENSG00000138759			19185	protein-coding gene	gene with protein product		607830	"""Fraser syndrome 1"""			12766769, 3118036	Standard	NM_025074		Approved	FLJ22031, FLJ14927, KIAA1500	uc003hlb.2	Q86XX4	OTTHUMG00000160856	ENST00000264895.6:c.9952G>A	4.37:g.79432599G>A	ENSP00000264895:p.Ala3318Thr		A2RRR8|Q86UZ4|Q8N3U9|Q8NAU7|Q96JW7|Q9H6N9|Q9P228	Missense_Mutation	SNP	pfam_Calx_beta,pfam_VWF_C,superfamily_Growth_fac_rcpt_N_dom,superfamily_Cadherin-like,smart_VWC_out,smart_VWF_C,smart_Furin_repeat,smart_EG-like_dom,smart_Calx_beta,pfscan_VWF_C	p.A3318T	ENST00000264895.6	37	c.9952	CCDS54771.1	4	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	36|36	5.619967|5.619967	0.96660|0.96660	.|.	.|.	ENSG00000138759|ENSG00000138759	ENST00000264895|ENST00000512123	T|.	0.16897|.	2.31|.	5.86|5.86	5.86|5.86	0.93980|0.93980	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.82898|0.82898	0.5137|0.5137	M|M	0.83118|0.83118	2.625|2.625	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.91635|.	0.999;0.998|.	T|T	0.82851|0.82851	-0.0253|-0.0253	10|5	0.87932|.	D|.	0|.	.|.	20.1882|20.1882	0.98224|0.98224	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	3317;3318|.	Q86XX4-2;E9PHH6|.	.;.|.	T|D	3318|1546	ENSP00000264895:A3318T|.	ENSP00000264895:A3318T|.	A|G	+|+	1|2	0|0	FRAS1|FRAS1	79651623|79651623	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	9.657000|9.657000	0.98554|0.98554	2.783000|2.783000	0.95769|0.95769	0.591000|0.591000	0.81541|0.81541	GCT|GGC	FRAS1	-	NULL	ENSG00000138759		0.522	FRAS1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	FRAS1	HGNC	protein_coding		-	0.00	74	0	G			79432599	+1	tier1	-	no_errors	ENST00000264895	ensembl	human	known	74_37	missense	9.09	40	4	SNP	1.000	A
DDX42	11325	genome.wustl.edu	37	17	61899154	61899155	+	IGR	INS	-	-	CTC			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr17:61899154_61899155insCTC	ENST00000578681.1	+	0	4337				FTSJ3_ENST00000427159.2_In_Frame_Ins_p.508_509insE	NM_007372.2	NP_031398.2	Q86XP3	DDX42_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 42						protein localization (GO:0008104)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(12)|kidney(3)|large_intestine(6)|lung(12)|ovary(2)|prostate(2)|skin(3)	46						AGCAGTGGATTCTCCTCCTCCT	0.54																																																	0																																										SO:0001628	intergenic_variant	0			BC015505	CCDS32704.1	17q23	2014-02-14	2013-05-13			ENSG00000198231		"""DEAD-boxes"""	18676	protein-coding gene	gene with protein product	"""splicing factor 3b, subunit 8"""	613369	"""DEAD (Asp-Glu-Ala-Asp) box polypeptide 42"""			10727850, 16397294	Standard	NM_007372		Approved	RNAHP, RHELP, SF3b125, SF3B8	uc002jbv.3	Q86XP3			17.37:g.61899161_61899163dupCTC			A6NML1|A8KA43|O75619|Q68G51|Q96BK1|Q96HR7|Q9Y3V8	In_Frame_Ins	INS	pfam_rRNA_MeTfrase_Spb1_C,pfam_rRNA_MeTrfase_FtsJ_dom,pfam_rRNA_MeTfrase_Spb1_DUF3381	p.508in_frame_insE	ENST00000578681.1	37	c.1525_1524	CCDS32704.1	17																																																																																			FTSJ3	-	NULL	ENSG00000108592		0.540	DDX42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FTSJ3	HGNC	protein_coding	OTTHUMT00000444368.1		0.00	32	0	-	NM_007372		61899155	-1	tier1		no_errors	ENST00000427159	ensembl	human	known	74_37	in_frame_ins	19.05	17	4	INS	1.000:0.886	CTC
FSCN2	25794	genome.wustl.edu	37	17	79502107	79502107	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr17:79502107G>A	ENST00000417245.2	+	2	992	c.856G>A	c.(856-858)Gaa>Aaa	p.E286K	FSCN2_ENST00000334850.7_Missense_Mutation_p.E286K	NM_001077182.2|NM_012418.3	NP_001070650.1|NP_036550.1	O14926	FSCN2_HUMAN	fascin actin-bundling protein 2, retinal	286					actin cytoskeleton organization (GO:0030036)|actin filament bundle assembly (GO:0051017)|anatomical structure morphogenesis (GO:0009653)|eye photoreceptor cell development (GO:0042462)|visual perception (GO:0007601)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|stereocilium (GO:0032420)	actin binding (GO:0003779)|actin filament binding (GO:0051015)			endometrium(1)|lung(1)|prostate(1)|urinary_tract(1)	4	all_neural(118;0.0878)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0282)|OV - Ovarian serous cystadenocarcinoma(97;0.0371)			TCAGGATGATGAACTAGACCA	0.572																																																	0													118.0	107.0	110.0					17																	79502107		692	1591	2283	SO:0001583	missense	0			AF030165	CCDS45810.1, CCDS45811.1	17q25	2014-02-03	2014-02-03		ENSG00000186765	ENSG00000186765		"""Fascins"""	3960	protein-coding gene	gene with protein product		607643	"""fascin (Strongylocentrotus purpuratus) homolog 2 (actin-bundling protein, retinal)"", ""fascin homolog 2, actin-bundling protein, retinal (Strongylocentrotus purpuratus)"""			10234509	Standard	NM_012418		Approved	RP30, RFSN	uc010wuo.2	O14926	OTTHUMG00000167477	ENST00000417245.2:c.856G>A	17.37:g.79502107G>A	ENSP00000388716:p.Glu286Lys		A0AVC4|A8MRA6	Missense_Mutation	SNP	pfam_Fascin-domain,superfamily_Actin_cross-linking	p.E286K	ENST00000417245.2	37	c.856	CCDS45811.1	17	.	.	.	.	.	.	.	.	.	.	g	31	5.099185	0.94197	.	.	ENSG00000186765	ENST00000417245;ENST00000334850	T;T	0.33654	1.42;1.4	5.01	5.01	0.66863	Fascin domain (1);Actin cross-linking (1);	.	.	.	.	T	0.65533	0.2700	M	0.84846	2.72	0.58432	D	0.999992	P;D	0.76494	0.864;0.999	B;D	0.85130	0.273;0.997	T	0.70894	-0.4748	9	0.54805	T	0.06	.	17.9	0.88900	0.0:0.0:1.0:0.0	.	286;286	O14926;A8MRA6	FSCN2_HUMAN;.	K	286	ENSP00000388716:E286K;ENSP00000334665:E286K	ENSP00000334665:E286K	E	+	1	0	FSCN2	.	1.000000	0.71417	0.996000	0.52242	0.931000	0.56810	9.171000	0.94802	2.319000	0.78375	0.472000	0.43445	GAA	FSCN2	-	pfam_Fascin-domain,superfamily_Actin_cross-linking	ENSG00000186765		0.572	FSCN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FSCN2	HGNC	protein_coding	OTTHUMT00000394746.1	-	0.00	29	0	G	NM_012418		79502107	+1	tier1	-	no_errors	ENST00000334850	ensembl	human	known	74_37	missense	42.11	11	8	SNP	1.000	A
FYTTD1	84248	genome.wustl.edu	37	3	197508914	197508915	+	3'UTR	INS	-	-	T			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr3:197508914_197508915insT	ENST00000241502.4	+	0	1313_1314				FYTTD1_ENST00000415708.2_3'UTR|FYTTD1_ENST00000424384.2_3'UTR|FYTTD1_ENST00000428395.2_3'UTR|FYTTD1_ENST00000492360.1_3'UTR	NM_032288.6	NP_115664.2	Q96QD9	UIF_HUMAN	forty-two-three domain containing 1						mRNA export from nucleus (GO:0006406)	nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)			kidney(1)|large_intestine(3)|lung(7)|prostate(1)|skin(1)	13	all_cancers(143;1.15e-09)|Ovarian(172;0.0418)|Breast(254;0.0976)	Lung NSC(153;0.132)	Epithelial(36;2.19e-23)|all cancers(36;1.39e-21)|OV - Ovarian serous cystadenocarcinoma(49;1.21e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(93;0.175)		ATTTTTGAAGGttttttttttt	0.287																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AJ344094	CCDS3329.1, CCDS43196.1, CCDS43196.2	3q29	2011-03-03			ENSG00000122068	ENSG00000122068			25407	protein-coding gene	gene with protein product	"""UAP56-interacting factor"""					19836239	Standard	NM_001011537		Approved	DKFZp761B1514, UIF	uc003fyi.2	Q96QD9	OTTHUMG00000155453	ENST00000241502.4:c.*135->T	3.37:g.197508925_197508925dupT			A8MY74|B2RCB2|B7Z3R4|B7Z7V1|B7Z8I0|B7ZAJ3|C9J7P6|C9JNG6|C9JTH3|C9JY50|Q96SL9|Q9BQI8	RNA	INS	-	NULL	ENST00000241502.4	37	NULL	CCDS3329.1	3																																																																																			FYTTD1	-	-	ENSG00000122068		0.287	FYTTD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FYTTD1	HGNC	protein_coding	OTTHUMT00000340185.3		0.00	8	0	-	NM_032288		197508915	+1	tier1		no_errors	ENST00000492360	ensembl	human	putative	74_37	rna	18.52	22	5	INS	0.017:0.208	T
GAD1	2571	genome.wustl.edu	37	2	171687588	171687588	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr2:171687588C>T	ENST00000358196.3	+	5	983	c.433C>T	c.(433-435)Cac>Tac	p.H145Y	GAD1_ENST00000344257.5_Missense_Mutation_p.H145Y|GAD1_ENST00000375272.1_Missense_Mutation_p.H145Y|GAD1_ENST00000429023.1_3'UTR	NM_000817.2	NP_000808.2	Q99259	DCE1_HUMAN	glutamate decarboxylase 1 (brain, 67kDa)	145					gamma-aminobutyric acid biosynthetic process (GO:0009449)|glutamate catabolic process (GO:0006538)|glutamate decarboxylation to succinate (GO:0006540)|neurotransmitter biosynthetic process (GO:0042136)|neurotransmitter secretion (GO:0007269)|protein-pyridoxal-5-phosphate linkage (GO:0018352)|response to drug (GO:0042493)|synaptic transmission (GO:0007268)	clathrin-sculpted gamma-aminobutyric acid transport vesicle membrane (GO:0061202)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|vesicle membrane (GO:0012506)	glutamate binding (GO:0016595)|glutamate decarboxylase activity (GO:0004351)|pyridoxal phosphate binding (GO:0030170)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(11)|lung(15)|ovary(1)|urinary_tract(2)	35						TCATCACCCACACCAGTTGCT	0.537																																																	0													115.0	101.0	106.0					2																	171687588		2203	4300	6503	SO:0001583	missense	0				CCDS2239.1, CCDS2240.1	2q31	2008-02-05	2002-08-29		ENSG00000128683	ENSG00000128683	4.1.1.15		4092	protein-coding gene	gene with protein product		605363	"""glutamate decarboxylase 1 (brain, 67kD)"""	GAD		1549570	Standard	XM_005246443		Approved		uc002ugi.3	Q99259	OTTHUMG00000044175	ENST00000358196.3:c.433C>T	2.37:g.171687588C>T	ENSP00000350928:p.His145Tyr		Q49AK1|Q53TQ7|Q9BU91|Q9UHH4	Missense_Mutation	SNP	pfam_PyrdxlP-dep_de-COase,pfam_Aminotrans_V/Cys_dSase,pfam_ArAA_b-elim_lyase/Thr_aldolase,superfamily_PyrdxlP-dep_Trfase	p.H145Y	ENST00000358196.3	37	c.433	CCDS2239.1	2	.	.	.	.	.	.	.	.	.	.	C	30	5.051527	0.93793	.	.	ENSG00000128683	ENST00000358196;ENST00000375272;ENST00000344257	T;T;T	0.38240	1.15;1.15;1.15	5.9	5.9	0.94986	Pyridoxal phosphate-dependent transferase, major domain (1);	0.000000	0.85682	D	0.000000	T	0.60650	0.2285	M	0.64170	1.965	0.80722	D	1	D;D	0.89917	0.988;1.0	P;D	0.73708	0.907;0.981	T	0.60276	-0.7295	10	0.87932	D	0	-19.2543	20.2673	0.98463	0.0:1.0:0.0:0.0	.	145;145	Q99259;Q99259-3	DCE1_HUMAN;.	Y	145	ENSP00000350928:H145Y;ENSP00000364421:H145Y;ENSP00000341167:H145Y	ENSP00000341167:H145Y	H	+	1	0	GAD1	171395834	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.487000	0.81328	2.786000	0.95864	0.643000	0.83706	CAC	GAD1	-	superfamily_PyrdxlP-dep_Trfase	ENSG00000128683		0.537	GAD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GAD1	HGNC	protein_coding	OTTHUMT00000102664.2	-	0.00	84	0	C			171687588	+1	tier1	-	no_errors	ENST00000358196	ensembl	human	known	74_37	missense	6.25	60	4	SNP	1.000	T
GADD45B	4616	genome.wustl.edu	37	19	2476577	2476577	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr19:2476577G>A	ENST00000215631.4	+	2	327	c.95G>A	c.(94-96)cGc>cAc	p.R32H	GADD45B_ENST00000587345.1_Missense_Mutation_p.R32H	NM_015675.3	NP_056490.2	O75293	GA45B_HUMAN	growth arrest and DNA-damage-inducible, beta	32					activation of MAPKK activity (GO:0000186)|activation of MAPKKK activity (GO:0000185)|apoptotic process (GO:0006915)|cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|negative regulation of protein kinase activity (GO:0006469)|positive regulation of apoptotic process (GO:0043065)|positive regulation of JNK cascade (GO:0046330)|positive regulation of p38MAPK cascade (GO:1900745)|regulation of cell cycle (GO:0051726)|response to stress (GO:0006950)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				cervix(2)|lung(1)|ovary(1)	4		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GCCGCTCAGCGCCAGGATCGC	0.662																																																	0													66.0	61.0	63.0					19																	2476577		2203	4300	6503	SO:0001583	missense	0			AF090950	CCDS32868.1	19p13.3	2012-10-02			ENSG00000099860	ENSG00000099860			4096	protein-coding gene	gene with protein product	"""myeloid differentiation primary response"", ""growth arrest and DNA-damage-inducible beta"""	604948		MYD118		1899477, 9827804	Standard	NM_015675		Approved	GADD45BETA, DKFZP566B133	uc002lwb.2	O75293	OTTHUMG00000180434	ENST00000215631.4:c.95G>A	19.37:g.2476577G>A	ENSP00000215631:p.Arg32His		A8KAM2|O75960|Q17R46	Missense_Mutation	SNP	pfam_Ribosomal_L7Ae/L30e/S12e/Gad45	p.R32H	ENST00000215631.4	37	c.95	CCDS32868.1	19	.	.	.	.	.	.	.	.	.	.	G	26.8	4.767925	0.90020	.	.	ENSG00000099860	ENST00000215631	T	0.59224	0.28	5.08	2.86	0.33363	Ribosomal protein L7Ae/L30e/S12e/Gadd45 (1);	0.245701	0.39759	N	0.001276	T	0.63745	0.2537	M	0.79475	2.455	0.42677	D	0.99353	D	0.64830	0.994	P	0.50860	0.652	T	0.64253	-0.6451	10	0.45353	T	0.12	.	9.8067	0.40797	0.0:0.1528:0.6887:0.1585	.	32	O75293	GA45B_HUMAN	H	32	ENSP00000215631:R32H	ENSP00000215631:R32H	R	+	2	0	GADD45B	2427577	0.999000	0.42202	0.998000	0.56505	0.992000	0.81027	2.930000	0.48924	0.504000	0.28082	0.491000	0.48974	CGC	GADD45B	-	pfam_Ribosomal_L7Ae/L30e/S12e/Gad45	ENSG00000099860		0.662	GADD45B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GADD45B	HGNC	protein_coding	OTTHUMT00000451337.1	-	0.00	62	0	G	NM_015675		2476577	+1	tier1	-	no_errors	ENST00000215631	ensembl	human	known	74_37	missense	7.84	47	4	SNP	1.000	A
GARS	2617	genome.wustl.edu	37	7	30642730	30642730	+	Missense_Mutation	SNP	T	T	C			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr7:30642730T>C	ENST00000389266.3	+	5	891	c.650T>C	c.(649-651)cTa>cCa	p.L217P		NM_002047.2	NP_002038.2	P41250	SYG_HUMAN	glycyl-tRNA synthetase	217					cell death (GO:0008219)|diadenosine tetraphosphate biosynthetic process (GO:0015966)|gene expression (GO:0010467)|glycyl-tRNA aminoacylation (GO:0006426)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|nucleus (GO:0005634)|secretory granule (GO:0030141)	ATP binding (GO:0005524)|glycine-tRNA ligase activity (GO:0004820)|protein dimerization activity (GO:0046983)			breast(3)|endometrium(2)|kidney(1)|large_intestine(4)|lung(9)|ovary(1)|skin(3)|urinary_tract(1)	24					Glycine(DB00145)	GCTGACCATCTATTAAAAGGT	0.353																																																	0													126.0	115.0	119.0					7																	30642730		1855	4096	5951	SO:0001583	missense	0			AK074524	CCDS43564.1	7p15	2014-09-17	2004-02-13		ENSG00000106105	ENSG00000106105	6.1.1.14	"""Aminoacyl tRNA synthetases / Class II"""	4162	protein-coding gene	gene with protein product	"""glycine tRNA ligase"""	600287	"""Charcot-Marie-Tooth neuropathy 2D"""	CMT2D		8595897, 8872480	Standard	NM_002047		Approved	GlyRS, DSMAV, SMAD1	uc003tbm.3	P41250	OTTHUMG00000152769	ENST00000389266.3:c.650T>C	7.37:g.30642730T>C	ENSP00000373918:p.Leu217Pro		B3KQA2|B4DIA0|Q969Y1	Missense_Mutation	SNP	pfam_aa-tRNA-synt_IIb_cons-dom,pfam_Anticodon-bd,pfam_WHEP-TRS,superfamily_Anticodon-bd,superfamily_S15_NS1_RNA-bd,prints_tRNA-synt_gly,pfscan_aa-tRNA-synth_II,pfscan_WHEP-TRS,tigrfam_tRNA-synt_gly	p.L217P	ENST00000389266.3	37	c.650	CCDS43564.1	7	.	.	.	.	.	.	.	.	.	.	T	25.4	4.634087	0.87660	.	.	ENSG00000106105	ENST00000389266	T	0.70869	-0.52	5.72	5.72	0.89469	Aminoacyl-tRNA synthetase, class II (G/ H/ P/ S), conserved domain (1);	0.000000	0.85682	D	0.000000	D	0.88179	0.6367	H	0.94264	3.515	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.91169	0.4967	10	0.87932	D	0	-9.7127	14.2653	0.66113	0.0:0.0:0.0:1.0	.	217	P41250	SYG_HUMAN	P	217	ENSP00000373918:L217P	ENSP00000373918:L217P	L	+	2	0	GARS	30609255	1.000000	0.71417	0.933000	0.37362	0.938000	0.57974	7.953000	0.87836	2.320000	0.78422	0.528000	0.53228	CTA	GARS	-	pfam_aa-tRNA-synt_IIb_cons-dom,tigrfam_tRNA-synt_gly	ENSG00000106105		0.353	GARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GARS	HGNC	protein_coding	OTTHUMT00000327735.1		0.00	107	0	T	NM_002047		30642730	+1			no_errors	ENST00000389266	ensembl	human	known	74_37	missense	5.48	69	4	SNP	0.998	C
GGCX	2677	genome.wustl.edu	37	2	85778646	85778646	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr2:85778646G>A	ENST00000233838.4	-	12	1777	c.1697C>T	c.(1696-1698)gCa>gTa	p.A566V	GGCX_ENST00000473665.1_5'Flank|GGCX_ENST00000430215.3_Missense_Mutation_p.A509V	NM_000821.5	NP_000812.2	P38435	VKGC_HUMAN	gamma-glutamyl carboxylase	566					blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|cellular protein modification process (GO:0006464)|peptidyl-glutamic acid carboxylation (GO:0017187)|post-translational protein modification (GO:0043687)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	gamma-glutamyl carboxylase activity (GO:0008488)			endometrium(3)|large_intestine(5)|lung(3)|ovary(1)|stomach(1)|urinary_tract(2)	15					Anisindione(DB01125)|Coagulation Factor IX(DB00100)|Coagulation factor VIIa(DB00036)|Drotrecogin alfa(DB00055)|Menadione(DB00170)|Phylloquinone(DB01022)	CTTCTGTTCTGCCACAAGCTC	0.498																																																	0													128.0	126.0	127.0					2																	85778646		2203	4300	6503	SO:0001583	missense	0				CCDS1978.1, CCDS46353.1	2p12	2008-05-21			ENSG00000115486	ENSG00000115486			4247	protein-coding gene	gene with protein product	"""vitamin K-dependent gamma-carboxylase"""	137167				1749935	Standard	NM_000821		Approved	VKCFD1	uc002sps.3	P38435	OTTHUMG00000130173	ENST00000233838.4:c.1697C>T	2.37:g.85778646G>A	ENSP00000233838:p.Ala566Val		B4DMC5|E9PEE1|Q14415|Q6GU45	Missense_Mutation	SNP	pfam_VKG_COase,superfamily_RmlC_Cupin,smart_HTTM	p.A566V	ENST00000233838.4	37	c.1697	CCDS1978.1	2	.	.	.	.	.	.	.	.	.	.	G	13.59	2.282340	0.40394	.	.	ENSG00000115486	ENST00000233838;ENST00000430215	D;D	0.85955	-2.05;-2.05	5.87	5.87	0.94306	Cupin, RmlC-type (1);RmlC-like jelly roll fold (1);	0.163866	0.53938	D	0.000047	T	0.72211	0.3432	N	0.19112	0.55	0.37114	D	0.900506	P;P;P	0.40000	0.698;0.454;0.531	B;B;B	0.32211	0.142;0.105;0.093	T	0.75969	-0.3130	10	0.33141	T	0.24	-7.1374	12.9508	0.58399	0.0:0.0:0.8383:0.1617	.	509;382;566	E9PEE1;B4DQW4;P38435	.;.;VKGC_HUMAN	V	566;509	ENSP00000233838:A566V;ENSP00000408045:A509V	ENSP00000233838:A566V	A	-	2	0	GGCX	85632157	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.139000	0.64801	2.941000	0.99782	0.655000	0.94253	GCA	GGCX	-	superfamily_RmlC_Cupin	ENSG00000115486		0.498	GGCX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GGCX	HGNC	protein_coding	OTTHUMT00000252490.3	-	0.00	64	0	G	NM_000821		85778646	-1	tier1	-	no_errors	ENST00000233838	ensembl	human	known	74_37	missense	16.00	21	4	SNP	1.000	A
GIGYF2	26058	genome.wustl.edu	37	2	233681605	233681605	+	Nonsense_Mutation	SNP	G	G	T			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr2:233681605G>T	ENST00000409547.1	+	22	2544	c.2233G>T	c.(2233-2235)Gaa>Taa	p.E745*	GIGYF2_ENST00000452341.2_Nonsense_Mutation_p.E576*|GIGYF2_ENST00000409480.1_Nonsense_Mutation_p.E767*|GIGYF2_ENST00000373566.3_Nonsense_Mutation_p.E767*|GIGYF2_ENST00000373563.4_Nonsense_Mutation_p.E745*|GIGYF2_ENST00000409451.3_Nonsense_Mutation_p.E766*|GIGYF2_ENST00000409196.3_Nonsense_Mutation_p.E739*	NM_015575.3	NP_056390.2	Q6Y7W6	PERQ2_HUMAN	GRB10 interacting GYF protein 2	745	Gln-rich.|Glu-rich.				adult locomotory behavior (GO:0008344)|cell death (GO:0008219)|cellular protein metabolic process (GO:0044267)|feeding behavior (GO:0007631)|homeostasis of number of cells within a tissue (GO:0048873)|insulin-like growth factor receptor signaling pathway (GO:0048009)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|musculoskeletal movement (GO:0050881)|negative regulation of translation (GO:0017148)|neuromuscular process controlling balance (GO:0050885)|post-embryonic development (GO:0009791)|spinal cord motor neuron differentiation (GO:0021522)	membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(4)|cervix(1)|endometrium(11)|kidney(2)|large_intestine(17)|lung(11)|ovary(5)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	63		Breast(86;0.00279)|all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0271)|Lung NSC(271;0.0839)		Epithelial(121;7.37e-16)|BRCA - Breast invasive adenocarcinoma(100;0.000472)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Lung(119;0.0118)|GBM - Glioblastoma multiforme(43;0.0145)		AAGAGAGGCAGAAATGAGGGC	0.468																																																	0													122.0	112.0	115.0					2																	233681605		2203	4300	6503	SO:0001587	stop_gained	0			U80751	CCDS33401.1, CCDS46542.1, CCDS46543.1	2q37.1	2011-07-06	2008-02-11	2008-02-11	ENSG00000204120	ENSG00000204120		"""Trinucleotide (CAG) repeat containing"""	11960	protein-coding gene	gene with protein product	"""GYF domain containing 2"""	612003	"""PERQ amino acid rich, with GYF domain 2"", ""PERQ amino acid rich, with GYF domain 3"", ""trinucleotide repeat containing 15"", ""Parkinson disease (autosomal recessive, early onset) 11"""	PERQ2, PERQ3, TNRC15, PARK11		9225980, 9734811, 12771153, 18358451, 19279319	Standard	NM_015575		Approved	KIAA0642, GYF2	uc002vtk.4	Q6Y7W6	OTTHUMG00000153237	ENST00000409547.1:c.2233G>T	2.37:g.233681605G>T	ENSP00000386537:p.Glu745*		A6H8W4|B9EG55|E9PBB0|O75137|Q7Z2Z8|Q7Z3I2|Q96HU4|Q9NV82	Nonsense_Mutation	SNP	pfam_GYF,superfamily_GYF,smart_GYF,pfscan_GYF	p.E767*	ENST00000409547.1	37	c.2299	CCDS33401.1	2	.	.	.	.	.	.	.	.	.	.	G	22.7	4.323348	0.81580	.	.	ENSG00000204120	ENST00000373566;ENST00000414511;ENST00000373563;ENST00000409480;ENST00000409547;ENST00000535418;ENST00000423659;ENST00000409196;ENST00000409451;ENST00000440945;ENST00000452341	.	.	.	3.8	3.8	0.43715	.	0.119054	0.56097	D	0.000026	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.34782	T	0.22	-15.7996	15.8175	0.78615	0.0:0.0:1.0:0.0	.	.	.	.	X	767;688;745;767;745;745;688;739;766;739;576	.	ENSP00000362664:E745X	E	+	1	0	GIGYF2	233389849	1.000000	0.71417	1.000000	0.80357	0.016000	0.09150	7.596000	0.82721	2.122000	0.65172	0.561000	0.74099	GAA	GIGYF2	-	NULL	ENSG00000204120		0.468	GIGYF2-001	KNOWN	basic|CCDS	protein_coding	GIGYF2	HGNC	protein_coding	OTTHUMT00000330316.2	-	0.00	55	0	G	NM_001103146		233681605	+1	tier1	-	no_errors	ENST00000373566	ensembl	human	known	74_37	nonsense	13.04	20	3	SNP	1.000	T
GIGYF2	26058	genome.wustl.edu	37	2	233681731	233681731	+	Nonsense_Mutation	SNP	C	C	T			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr2:233681731C>T	ENST00000409547.1	+	22	2670	c.2359C>T	c.(2359-2361)Cga>Tga	p.R787*	GIGYF2_ENST00000452341.2_Nonsense_Mutation_p.R618*|GIGYF2_ENST00000409480.1_Nonsense_Mutation_p.R809*|GIGYF2_ENST00000373566.3_Nonsense_Mutation_p.R809*|GIGYF2_ENST00000373563.4_Nonsense_Mutation_p.R787*|GIGYF2_ENST00000409451.3_Nonsense_Mutation_p.R808*|GIGYF2_ENST00000409196.3_Nonsense_Mutation_p.R781*	NM_015575.3	NP_056390.2	Q6Y7W6	PERQ2_HUMAN	GRB10 interacting GYF protein 2	787	Gln-rich.|Glu-rich.				adult locomotory behavior (GO:0008344)|cell death (GO:0008219)|cellular protein metabolic process (GO:0044267)|feeding behavior (GO:0007631)|homeostasis of number of cells within a tissue (GO:0048873)|insulin-like growth factor receptor signaling pathway (GO:0048009)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|musculoskeletal movement (GO:0050881)|negative regulation of translation (GO:0017148)|neuromuscular process controlling balance (GO:0050885)|post-embryonic development (GO:0009791)|spinal cord motor neuron differentiation (GO:0021522)	membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)	p.R787R(1)|p.R808R(1)		NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(4)|cervix(1)|endometrium(11)|kidney(2)|large_intestine(17)|lung(11)|ovary(5)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	63		Breast(86;0.00279)|all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0271)|Lung NSC(271;0.0839)		Epithelial(121;7.37e-16)|BRCA - Breast invasive adenocarcinoma(100;0.000472)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Lung(119;0.0118)|GBM - Glioblastoma multiforme(43;0.0145)		AGAACTTGCCCGAAGGAAACA	0.468																																																	2	Substitution - coding silent(2)	lung(2)											234.0	223.0	227.0					2																	233681731		2203	4300	6503	SO:0001587	stop_gained	0			U80751	CCDS33401.1, CCDS46542.1, CCDS46543.1	2q37.1	2011-07-06	2008-02-11	2008-02-11	ENSG00000204120	ENSG00000204120		"""Trinucleotide (CAG) repeat containing"""	11960	protein-coding gene	gene with protein product	"""GYF domain containing 2"""	612003	"""PERQ amino acid rich, with GYF domain 2"", ""PERQ amino acid rich, with GYF domain 3"", ""trinucleotide repeat containing 15"", ""Parkinson disease (autosomal recessive, early onset) 11"""	PERQ2, PERQ3, TNRC15, PARK11		9225980, 9734811, 12771153, 18358451, 19279319	Standard	NM_015575		Approved	KIAA0642, GYF2	uc002vtk.4	Q6Y7W6	OTTHUMG00000153237	ENST00000409547.1:c.2359C>T	2.37:g.233681731C>T	ENSP00000386537:p.Arg787*		A6H8W4|B9EG55|E9PBB0|O75137|Q7Z2Z8|Q7Z3I2|Q96HU4|Q9NV82	Nonsense_Mutation	SNP	pfam_GYF,superfamily_GYF,smart_GYF,pfscan_GYF	p.R809*	ENST00000409547.1	37	c.2425	CCDS33401.1	2	.	.	.	.	.	.	.	.	.	.	C	36	5.794742	0.96952	.	.	ENSG00000204120	ENST00000373566;ENST00000373563;ENST00000409480;ENST00000409547;ENST00000409196;ENST00000409451;ENST00000440945;ENST00000452341	.	.	.	3.89	-0.449	0.12226	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-8.8124	7.5372	0.27717	0.4181:0.5043:0.0:0.0776	.	.	.	.	X	809;787;809;787;781;808;781;618	.	ENSP00000362664:R787X	R	+	1	2	GIGYF2	233389975	0.956000	0.32656	0.826000	0.32828	0.465000	0.32709	1.961000	0.40432	-0.208000	0.10171	-0.258000	0.10820	CGA	GIGYF2	-	NULL	ENSG00000204120		0.468	GIGYF2-001	KNOWN	basic|CCDS	protein_coding	GIGYF2	HGNC	protein_coding	OTTHUMT00000330316.2		0.00	81	0	C	NM_001103146		233681731	+1			no_errors	ENST00000373566	ensembl	human	known	74_37	nonsense	5.41	35	2	SNP	0.993	T
GJA8	2703	genome.wustl.edu	37	1	147380384	147380384	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr1:147380384G>T	ENST00000369235.1	+	1	302	c.302G>T	c.(301-303)cGc>cTc	p.R101L	GJA8_ENST00000240986.4_Missense_Mutation_p.R101L			P48165	CXA8_HUMAN	gap junction protein, alpha 8, 50kDa	101					cell-cell signaling (GO:0007267)|lens development in camera-type eye (GO:0002088)|protein homooligomerization (GO:0051260)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	connexon complex (GO:0005922)|integral component of plasma membrane (GO:0005887)	channel activity (GO:0015267)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(12)|ovary(2)|pancreas(1)|prostate(3)|skin(1)|stomach(1)	37	all_hematologic(923;0.0276)					CACTACGTCCGCATGGAGGAG	0.662																																					Melanoma(76;1255 1795 8195 52096)												0													79.0	71.0	74.0					1																	147380384		2203	4300	6503	SO:0001583	missense	0			U34802	CCDS30834.1	1q21.1	2008-02-05	2007-01-16		ENSG00000121634	ENSG00000121634		"""Ion channels / Gap junction proteins (connexins)"""	4281	protein-coding gene	gene with protein product	"""connexin 50"""	600897	"""gap junction protein, alpha 8, 50kD (connexin 50)"", ""gap junction protein, alpha 8, 50kDa (connexin 50)"""	CAE1, CZP1, CAE		9497259, 7796604	Standard	NM_005267		Approved	CX50	uc001epu.2	P48165	OTTHUMG00000024085	ENST00000369235.1:c.302G>T	1.37:g.147380384G>T	ENSP00000358238:p.Arg101Leu		A7L5M5|Q5VVN9|Q9NP25	Missense_Mutation	SNP	pfam_Connexin_N,pfam_Connexin50,pfam_Connexin_CCC,smart_Connexin_N,prints_Connexin,prints_Connexin50	p.R101L	ENST00000369235.1	37	c.302	CCDS30834.1	1	.	.	.	.	.	.	.	.	.	.	g	21.3	4.131788	0.77662	.	.	ENSG00000121634	ENST00000240986;ENST00000369235	D;D	0.99113	-5.44;-5.44	5.2	5.2	0.72013	Connexin, N-terminal (1);	0.053963	0.85682	D	0.000000	D	0.99309	0.9758	M	0.85945	2.785	0.53005	D	0.999968	D	0.69078	0.997	D	0.69142	0.962	D	0.99323	1.0907	10	0.72032	D	0.01	.	18.721	0.91692	0.0:0.0:1.0:0.0	.	101	P48165	CXA8_HUMAN	L	101	ENSP00000240986:R101L;ENSP00000358238:R101L	ENSP00000240986:R101L	R	+	2	0	GJA8	145847008	1.000000	0.71417	1.000000	0.80357	0.814000	0.46013	7.499000	0.81566	2.409000	0.81822	0.491000	0.48974	CGC	GJA8	-	pfam_Connexin_N	ENSG00000121634		0.662	GJA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GJA8	HGNC	protein_coding	OTTHUMT00000060647.1	-	0.00	31	0	G	NM_005267		147380384	+1	tier1	-	no_errors	ENST00000240986	ensembl	human	known	74_37	missense	52.78	16	19	SNP	1.000	T
GON4L	54856	genome.wustl.edu	37	1	155735075	155735075	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr1:155735075G>C	ENST00000368331.1	-	21	4237	c.4189C>G	c.(4189-4191)Cct>Gct	p.P1397A	GON4L_ENST00000271883.5_Missense_Mutation_p.P1397A|GON4L_ENST00000361040.5_Missense_Mutation_p.P1397A|GON4L_ENST00000437809.1_Missense_Mutation_p.P1397A|GON4L_ENST00000471341.1_5'UTR	NM_001282858.1|NM_001282860.1	NP_001269787.1|NP_001269789.1	Q3T8J9	GON4L_HUMAN	gon-4-like (C. elegans)	1397					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)	p.P1397S(3)		NS(2)|breast(4)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(7)|lung(10)|ovary(3)|prostate(3)|skin(2)|stomach(1)|urinary_tract(1)	45	Hepatocellular(266;0.0997)|all_hematologic(923;0.145)|all_neural(408;0.195)					CCTTCATCAGGGGGCTCTTGA	0.488																																																	3	Substitution - Missense(3)	lung(3)											86.0	81.0	83.0					1																	155735075		2203	4300	6503	SO:0001583	missense	0			AB046826	CCDS1121.1, CCDS44242.1, CCDS60296.1	1q22	2013-10-31	2006-11-08	2006-02-16	ENSG00000116580	ENSG00000116580			25973	protein-coding gene	gene with protein product		610393	"""gon-4 homolog (C.elegans)"""	GON4		16545939, 21454521	Standard	XM_005245283		Approved	FLJ20203, GON-4	uc001fly.1	Q3T8J9	OTTHUMG00000014106	ENST00000368331.1:c.4189C>G	1.37:g.155735075G>C	ENSP00000357315:p.Pro1397Ala		B7ZBL4|Q14C93|Q3T8J8|Q5VYZ5|Q5W0D5|Q6AWA6|Q6P1Q6|Q7Z3L3|Q8IY79|Q9BQI1|Q9HCG6	Missense_Mutation	SNP	pfam_PAH,superfamily_PAH,superfamily_Homeodomain-like,pfscan_Myb-like_dom	p.P1397A	ENST00000368331.1	37	c.4189		1	.	.	.	.	.	.	.	.	.	.	G	7.313	0.615422	0.14129	.	.	ENSG00000116580	ENST00000437809;ENST00000368331;ENST00000271883;ENST00000361040	T;T;T;T	0.11712	2.96;2.96;2.96;2.75	4.64	-0.915	0.10494	.	0.669254	0.13548	N	0.379685	T	0.01627	0.0052	N	0.25647	0.755	0.09310	N	1	B;B;B;B	0.06786	0.001;0.001;0.001;0.001	B;B;B;B	0.08055	0.001;0.001;0.001;0.003	T	0.47837	-0.9086	10	0.15066	T	0.55	.	6.6908	0.23169	0.0678:0.3497:0.4623:0.1202	.	1397;593;1397;1397	Q3T8J9-2;Q1ED43;Q3T8J9;Q3T8J9-3	.;.;GON4L_HUMAN;.	A	1397	ENSP00000396117:P1397A;ENSP00000357315:P1397A;ENSP00000271883:P1397A;ENSP00000354322:P1397A	ENSP00000271883:P1397A	P	-	1	0	GON4L	154001699	0.001000	0.12720	0.001000	0.08648	0.036000	0.12997	-1.088000	0.03379	-0.333000	0.08476	0.650000	0.86243	CCT	GON4L	-	NULL	ENSG00000116580		0.488	GON4L-201	KNOWN	basic|appris_candidate_longest	protein_coding	GON4L	HGNC	protein_coding			0.00	40	0	G	NM_032292		155735075	-1			no_errors	ENST00000368331	ensembl	human	known	74_37	missense	6.90	27	2	SNP	0.003	C
GPC6	10082	genome.wustl.edu	37	13	94482729	94482729	+	Silent	SNP	C	C	A			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr13:94482729C>A	ENST00000377047.4	+	3	1257	c.642C>A	c.(640-642)gcC>gcA	p.A214A	GPC6-AS2_ENST00000445540.1_RNA	NM_005708.3	NP_005699.1	Q9Y625	GPC6_HUMAN	glypican 6	214					carbohydrate metabolic process (GO:0005975)|cell migration (GO:0016477)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	anchored component of membrane (GO:0031225)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)				NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(13)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	38	all_neural(89;0.0684)|Medulloblastoma(90;0.163)	all_cancers(2;5.48e-07)|all_epithelial(2;5.69e-08)|all_lung(2;2.19e-05)|Lung NSC(4;6.09e-05)|Breast(118;0.0395)|Renal(2;0.0568)|Hepatocellular(115;0.217)				TTACCCGCGCCTTCATTGCTG	0.498																																																	0													56.0	54.0	55.0					13																	94482729		2203	4300	6503	SO:0001819	synonymous_variant	0			AF111178	CCDS9469.1	13q32	2008-02-05			ENSG00000183098	ENSG00000183098		"""Proteoglycans / Cell Surface : Glypicans"""	4454	protein-coding gene	gene with protein product	"""glypican proteoglycan 6"""	604404				10329016	Standard	NM_005708		Approved		uc001vlt.3	Q9Y625	OTTHUMG00000017205	ENST00000377047.4:c.642C>A	13.37:g.94482729C>A			A8K279|Q96SG5|Q96SG8|Q9H1P4	Silent	SNP	pfam_Glypican	p.A214	ENST00000377047.4	37	c.642	CCDS9469.1	13																																																																																			GPC6	-	pfam_Glypican	ENSG00000183098		0.498	GPC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPC6	HGNC	protein_coding	OTTHUMT00000045460.4	-	0.00	127	0	C	NM_005708		94482729	+1	tier1	-	no_errors	ENST00000377047	ensembl	human	known	74_37	silent	41.46	48	34	SNP	0.996	A
GRPEL2	134266	genome.wustl.edu	37	5	148725164	148725164	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr5:148725164C>T	ENST00000329271.3	+	1	172	c.62C>T	c.(61-63)gCc>gTc	p.A21V	GRPEL2_ENST00000513661.1_Missense_Mutation_p.A21V|GRPEL2_ENST00000416916.2_Missense_Mutation_p.A21V|GRPEL2-AS1_ENST00000521295.1_RNA	NM_152407.3	NP_689620.2	Q8TAA5	GRPE2_HUMAN	GrpE-like 2, mitochondrial (E. coli)	21					cellular protein metabolic process (GO:0044267)|protein folding (GO:0006457)|protein targeting to mitochondrion (GO:0006626)	mitochondrial inner membrane (GO:0005743)	adenyl-nucleotide exchange factor activity (GO:0000774)			breast(1)|endometrium(1)|large_intestine(1)|lung(2)|ovary(1)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCCTGGAGTGCCGCGTGGGAG	0.677																																																	0													15.0	18.0	17.0					5																	148725164		2200	4299	6499	SO:0001583	missense	0			AL832325	CCDS4295.1	5q33.1	2008-02-05			ENSG00000164284	ENSG00000164284			21060	protein-coding gene	gene with protein product							Standard	NM_152407		Approved	DKFZp451C205, Mt-GrpE#2, FLJ23713	uc003lqj.3	Q8TAA5	OTTHUMG00000130048	ENST00000329271.3:c.62C>T	5.37:g.148725164C>T	ENSP00000329558:p.Ala21Val		B4DFA6|Q49AJ6	Missense_Mutation	SNP	pfam_GrpE,superfamily_GrpE_head,prints_GrpE	p.A21V	ENST00000329271.3	37	c.62	CCDS4295.1	5	.	.	.	.	.	.	.	.	.	.	C	14.37	2.515324	0.44763	.	.	ENSG00000164284	ENST00000513661;ENST00000329271;ENST00000416916	.	.	.	4.96	3.17	0.36434	.	0.299164	0.27122	N	0.020837	T	0.22666	0.0547	L	0.27053	0.805	0.09310	N	1	B;B	0.33612	0.419;0.013	B;B	0.34452	0.183;0.007	T	0.10870	-1.0611	9	0.31617	T	0.26	-3.6847	7.0275	0.24948	0.0:0.7334:0.1736:0.093	.	21;21	B4DFA6;Q8TAA5	.;GRPE2_HUMAN	V	21	.	ENSP00000329558:A21V	A	+	2	0	GRPEL2	148705357	0.003000	0.15002	0.001000	0.08648	0.011000	0.07611	1.109000	0.31135	0.789000	0.33779	0.561000	0.74099	GCC	GRPEL2	-	NULL	ENSG00000164284		0.677	GRPEL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRPEL2	HGNC	protein_coding	OTTHUMT00000252327.1		0.00	84	0	C	NM_152407		148725164	+1			no_errors	ENST00000329271	ensembl	human	known	74_37	missense	9.76	37	4	SNP	0.001	T
GYS1	2997	genome.wustl.edu	37	19	49488805	49488805	+	Frame_Shift_Del	DEL	T	T	-			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr19:49488805delT	ENST00000323798.3	-	5	932	c.736delA	c.(736-738)aggfs	p.R246fs	GYS1_ENST00000544287.1_Intron|GYS1_ENST00000540532.1_Frame_Shift_Del_p.R166fs|GYS1_ENST00000263276.6_Frame_Shift_Del_p.R182fs|GYS1_ENST00000457974.1_5'Flank|GYS1_ENST00000541188.1_Frame_Shift_Del_p.R166fs	NM_002103.4	NP_002094.2	P13807	GYS1_HUMAN	glycogen synthase 1 (muscle)	246					carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|heart development (GO:0007507)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|inclusion body (GO:0016234)|membrane (GO:0016020)	glucose binding (GO:0005536)|glycogen (starch) synthase activity (GO:0004373)|glycogen synthase activity, transferring glucose-1-phosphate (GO:0061547)|protein kinase binding (GO:0019901)			breast(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(5)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	22		all_lung(116;4.89e-05)|Lung NSC(112;8.3e-05)|all_epithelial(76;8.64e-05)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000164)|all cancers(93;0.000226)|GBM - Glioblastoma multiforme(486;0.00561)|Epithelial(262;0.0286)		GCTGCCGCCCTTTCCATGCAG	0.597																																																	0													134.0	100.0	111.0					19																	49488805		2203	4300	6503	SO:0001589	frameshift_variant	0				CCDS12747.1, CCDS54292.1	19q13.3	2013-02-22			ENSG00000104812	ENSG00000104812	2.4.1.11	"""Glycosyltransferase group 1 domain containing"""	4706	protein-coding gene	gene with protein product		138570		GYS			Standard	NM_002103		Approved	GSY	uc002plp.3	P13807	OTTHUMG00000150723	ENST00000323798.3:c.736delA	19.37:g.49488805delT	ENSP00000317904:p.Arg246fs		Q9BTT9	Frame_Shift_Del	DEL	pfam_Glycogen_synth,pfam_Glyco_trans_1,pfam_Starch_synth_cat_dom	p.R246fs	ENST00000323798.3	37	c.736	CCDS12747.1	19																																																																																			GYS1	-	pfam_Glycogen_synth,pfam_Starch_synth_cat_dom	ENSG00000104812		0.597	GYS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GYS1	HGNC	protein_coding	OTTHUMT00000319791.1		0.00	42	0	T	NM_002103		49488805	-1	tier1		no_errors	ENST00000323798	ensembl	human	known	74_37	frame_shift_del	6.25	30	2	DEL	1.000	-
HHIPL2	79802	genome.wustl.edu	37	1	222713615	222713615	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr1:222713615C>A	ENST00000343410.6	-	4	1245	c.1187G>T	c.(1186-1188)cGa>cTa	p.R396L		NM_024746.3	NP_079022.2	Q6UWX4	HIPL2_HUMAN	HHIP-like 2	396					carbohydrate metabolic process (GO:0005975)	extracellular region (GO:0005576)	oxidoreductase activity, acting on the CH-OH group of donors, quinone or similar compound as acceptor (GO:0016901)|quinone binding (GO:0048038)			NS(2)|endometrium(8)|kidney(4)|large_intestine(7)|lung(28)|ovary(1)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	59				GBM - Glioblastoma multiforme(131;0.0185)		CGAGGGGACTCGGTACCGCTT	0.542																																																	0													73.0	69.0	71.0					1																	222713615		2203	4300	6503	SO:0001583	missense	0			BC007638	CCDS1530.2	1q41	2008-02-05	2008-01-16	2008-01-16	ENSG00000143512	ENSG00000143512			25842	protein-coding gene	gene with protein product			"""KIAA1822-like"""	KIAA1822L		12975309	Standard	NM_024746		Approved	FLJ13840	uc001hnh.1	Q6UWX4	OTTHUMG00000037545	ENST00000343410.6:c.1187G>T	1.37:g.222713615C>A	ENSP00000342118:p.Arg396Leu		Q6GU65|Q96BT4|Q96BU5|Q9H8A0	Missense_Mutation	SNP	pfam_Folate_rcpt-like,pfam_Glc/Sorbosone_DH,superfamily_Quinoprot_gluc/sorb_DH,superfamily_Saposin-like	p.R396L	ENST00000343410.6	37	c.1187	CCDS1530.2	1	.	.	.	.	.	.	.	.	.	.	C	16.81	3.225894	0.58668	.	.	ENSG00000143512	ENST00000343410	T	0.11712	2.75	4.95	4.04	0.47022	Soluble quinoprotein glucose/sorbosone dehydrogenase (1);Six-bladed beta-propeller, TolB-like (1);	0.211701	0.40554	N	0.001068	T	0.22044	0.0531	L	0.58669	1.825	0.38868	D	0.956634	P	0.51147	0.942	P	0.56088	0.791	T	0.01824	-1.1266	10	0.37606	T	0.19	-5.2665	12.7244	0.57162	0.0:0.9191:0.0:0.0809	.	396	Q6UWX4	HIPL2_HUMAN	L	396	ENSP00000342118:R396L	ENSP00000342118:R396L	R	-	2	0	HHIPL2	220780238	0.763000	0.28462	0.933000	0.37362	0.650000	0.38633	1.408000	0.34668	1.058000	0.40530	0.313000	0.20887	CGA	HHIPL2	-	superfamily_Quinoprot_gluc/sorb_DH	ENSG00000143512		0.542	HHIPL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HHIPL2	HGNC	protein_coding	OTTHUMT00000091499.2	-	0.00	87	0	C	NM_024746		222713615	-1	tier1	-	no_errors	ENST00000343410	ensembl	human	known	74_37	missense	5.26	72	4	SNP	1.000	A
HIP1	3092	genome.wustl.edu	37	7	75182803	75182803	+	Silent	SNP	G	G	T			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr7:75182803G>T	ENST00000336926.6	-	22	2270	c.2244C>A	c.(2242-2244)gcC>gcA	p.A748A	HIP1_ENST00000434438.2_Silent_p.A748A	NM_005338.5	NP_005329.3	O00291	HIP1_HUMAN	huntingtin interacting protein 1	748					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cell differentiation (GO:0030154)|clathrin coat assembly (GO:0048268)|endocytosis (GO:0006897)|positive regulation of receptor-mediated endocytosis (GO:0048260)|regulation of apoptotic process (GO:0042981)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	clathrin-coated vesicle (GO:0030136)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)	clathrin binding (GO:0030276)|phosphatidylinositol binding (GO:0035091)|structural constituent of cytoskeleton (GO:0005200)			breast(3)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(25)|ovary(2)|pancreas(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51						CTGTGCTGTCGGCATTCTCAA	0.552			T	PDGFRB	CMML																																			Dom	yes		7	7q11.23	3092	huntingtin interacting protein 1		L	0													156.0	127.0	137.0					7																	75182803		2203	4300	6503	SO:0001819	synonymous_variant	0			AF052288	CCDS34669.1, CCDS59060.1	7q11.23	2008-07-18			ENSG00000127946	ENSG00000127946			4913	protein-coding gene	gene with protein product		601767				9140394, 9147654	Standard	NM_005338		Approved	ILWEQ	uc003uds.2	O00291	OTTHUMG00000156050	ENST00000336926.6:c.2244C>A	7.37:g.75182803G>T			B4E3I7|E7ES17|O00328|Q2TB58|Q8TDL4	Silent	SNP	pfam_ANTH_dom,pfam_ILWEQ_dom,pfam_Epsin_dom_N,superfamily_ENTH_VHS,superfamily_ARM-type_fold,superfamily_Prefoldin,smart_Epsin-like_N,smart_ILWEQ_dom,pfscan_Epsin-like_N,pfscan_ILWEQ_dom	p.A748	ENST00000336926.6	37	c.2244	CCDS34669.1	7																																																																																			HIP1	-	NULL	ENSG00000127946		0.552	HIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIP1	HGNC	protein_coding	OTTHUMT00000342863.2	-	0.00	64	0	G	NM_005338		75182803	-1	tier1	-	no_errors	ENST00000336926	ensembl	human	known	74_37	silent	6.90	54	4	SNP	0.544	T
HLA-DRB1	3123	genome.wustl.edu	37	6	32551952	32551953	+	Frame_Shift_Del	DEL	CC	CC	-	rs9281873|rs370743542|rs67187877|rs17883297|rs17884749		TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	CC	CC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr6:32551952_32551953delCC	ENST00000360004.5	-	2	408_409	c.303_304delGG	c.(301-306)cgggccfs	p.A103fs		NM_002124.3	NP_002115.2	Q30167	2B1A_HUMAN	major histocompatibility complex, class II, DR beta 1	103	Beta-1.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)	clathrin-coated endocytic vesicle membrane (GO:0030669)|endocytic vesicle membrane (GO:0030666)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|late endosome membrane (GO:0031902)|lysosomal membrane (GO:0005765)|MHC class II protein complex (GO:0042613)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)|transport vesicle membrane (GO:0030658)				large_intestine(3)|lung(2)|ovary(1)|prostate(1)|skin(2)|stomach(1)	10						TCCACCGCGGCCCGCGCCTGCT	0.683										Multiple Myeloma(14;0.17)																																							0																																										SO:0001589	frameshift_variant	0			AJ297583	CCDS47409.1	6p21.3	2013-01-11			ENSG00000196126	ENSG00000196126		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4948	protein-coding gene	gene with protein product		142857		HLA-DR1B			Standard	NM_001243965		Approved		uc011eri.2	P01911	OTTHUMG00000031196	ENST00000360004.5:c.303_304delGG	6.37:g.32551952_32551953delCC	ENSP00000353099:p.Ala103fs		P01914|Q9MYF5	Frame_Shift_Del	DEL	pfam_MHC_II_b_N,pfam_Ig_C1-set,superfamily_MHC_I/II-like_Ag-recog,smart_MHC_II_b_N,smart_Ig_C1-set,pfscan_Ig-like_dom	p.A102fs	ENST00000360004.5	37	c.304_303	CCDS47409.1	6																																																																																			HLA-DRB1	-	pfam_MHC_II_b_N,superfamily_MHC_I/II-like_Ag-recog,smart_MHC_II_b_N	ENSG00000196126		0.683	HLA-DRB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HLA-DRB1	HGNC	protein_coding	OTTHUMT00000076393.3		0.00	10	0	CC	NM_002124		32551953	-1	tier1		no_errors	ENST00000360004	ensembl	human	known	74_37	frame_shift_del	33.33	4	2	DEL	0.195:0.185	-
HOMER1	9456	genome.wustl.edu	37	5	78671920	78671921	+	Frame_Shift_Ins	INS	-	-	T			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr5:78671920_78671921insT	ENST00000334082.6	-	9	2418_2419	c.976_977insA	c.(976-978)ctgfs	p.L326fs	HOMER1_ENST00000535690.1_Frame_Shift_Ins_p.L152fs|HOMER1_ENST00000508576.1_3'UTR|HOMER1_ENST00000282260.6_Frame_Shift_Ins_p.L196fs	NM_004272.3	NP_004263.1	Q86YM7	HOME1_HUMAN	homer homolog 1 (Drosophila)	326					behavioral response to cocaine (GO:0048148)|chemical homeostasis within a tissue (GO:0048875)|circadian rhythm (GO:0007623)|phospholipase C-activating G-protein coupled glutamate receptor signaling pathway (GO:0007206)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of signal transduction (GO:0009967)|protein localization to synapse (GO:0035418)|regulation of calcium ion import (GO:0090279)|regulation of cation channel activity (GO:2001257)|regulation of store-operated calcium entry (GO:2001256)|response to calcium ion (GO:0051592)|response to nicotine (GO:0035094)|skeletal muscle contraction (GO:0003009)|skeletal muscle fiber development (GO:0048741)|synaptic transmission (GO:0007268)	apical part of cell (GO:0045177)|axon (GO:0030424)|cell junction (GO:0030054)|costamere (GO:0043034)|dendritic shaft (GO:0043198)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|neuronal postsynaptic density (GO:0097481)|postsynaptic membrane (GO:0045211)|Z disc (GO:0030018)	ion channel binding (GO:0044325)|signaling adaptor activity (GO:0035591)			endometrium(2)|kidney(1)|large_intestine(5)|lung(3)|prostate(2)|skin(1)	14		Lung NSC(167;0.00131)|all_lung(232;0.00151)|Ovarian(174;0.0261)|Prostate(461;0.191)		OV - Ovarian serous cystadenocarcinoma(54;1.87e-44)|Epithelial(54;7.07e-41)|all cancers(79;5.5e-36)		GAGTGTCTTCAGGTTATTGCGA	0.396																																																	0																																										SO:0001589	frameshift_variant	0			BC015502	CCDS43335.1, CCDS64188.1, CCDS64189.1	5q14.2	2008-02-05			ENSG00000152413	ENSG00000152413			17512	protein-coding gene	gene with protein product		604798				9808459, 9808458	Standard	NM_004272		Approved	Ves-1, SYN47, HOMER-1B	uc003kfy.4	Q86YM7	OTTHUMG00000134278	ENST00000334082.6:c.976_977insA	5.37:g.78671920_78671921insT	ENSP00000334382:p.Leu326fs		B2R688|O96003|Q86YM5	Frame_Shift_Ins	INS	pfam_WH1/EVH1,smart_WH1/EVH1,pfscan_WH1/EVH1	p.L326fs	ENST00000334082.6	37	c.977_976	CCDS43335.1	5																																																																																			HOMER1	-	NULL	ENSG00000152413		0.396	HOMER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HOMER1	HGNC	protein_coding	OTTHUMT00000258856.1		0.00	56	0	-	NM_004272		78671921	-1	tier1		no_errors	ENST00000334082	ensembl	human	known	74_37	frame_shift_ins	11.11	16	2	INS	1.000:1.000	T
HRC	3270	genome.wustl.edu	37	19	49656964	49656964	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr19:49656964G>A	ENST00000252825.4	-	1	1717	c.1531C>T	c.(1531-1533)Cat>Tat	p.H511Y	HRC_ENST00000595625.1_Missense_Mutation_p.H511Y	NM_002152.2	NP_002143.1	P23327	SRCH_HUMAN	histidine rich calcium binding protein	511					cytosolic calcium ion homeostasis (GO:0051480)|muscle contraction (GO:0006936)|positive regulation of heart contraction (GO:0045823)|positive regulation of heart rate (GO:0010460)|positive regulation of relaxation of cardiac muscle (GO:1901899)|regulation of calcium ion transmembrane transport (GO:1903169)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cell communication by electrical coupling involved in cardiac conduction (GO:1901844)|regulation of heart rate (GO:0002027)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)	sarcoplasmic reticulum lumen (GO:0033018)|sarcoplasmic reticulum membrane (GO:0033017)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|calcium ion binding (GO:0005509)|ion channel binding (GO:0044325)			endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(10)|lung(10)|ovary(1)|prostate(3)|urinary_tract(2)	34		all_lung(116;3.16e-06)|Lung NSC(112;6.25e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)		all cancers(93;2.01e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.00019)|GBM - Glioblastoma multiforme(486;0.00279)|Epithelial(262;0.00622)		CGGCTGCCATGATGGGTGCCT	0.557																																					Melanoma(37;75 1097 24567 25669 30645)												0													100.0	79.0	87.0					19																	49656964		2203	4300	6503	SO:0001583	missense	0				CCDS12759.1	19q13.3	2008-07-16	2001-11-28			ENSG00000130528			5178	protein-coding gene	gene with protein product		142705	"""histidine-rich calcium-binding protein"""			2037293	Standard	XR_243928		Approved	MGC133236	uc002pmv.3	P23327		ENST00000252825.4:c.1531C>T	19.37:g.49656964G>A	ENSP00000252825:p.His511Tyr		Q504Y6	Missense_Mutation	SNP	pfam_Hist_rich_Ca-bd	p.H511Y	ENST00000252825.4	37	c.1531	CCDS12759.1	19	.	.	.	.	.	.	.	.	.	.	G	7.242	0.601405	0.13939	.	.	ENSG00000130528	ENST00000252825;ENST00000391863	T	0.52754	0.65	3.29	0.649	0.17806	.	.	.	.	.	T	0.39759	0.1090	L	0.38175	1.15	0.09310	N	1	D	0.53885	0.963	P	0.46796	0.527	T	0.24548	-1.0157	9	0.59425	D	0.04	.	7.012	0.24867	0.0:0.0:0.4857:0.5143	.	511	P23327	SRCH_HUMAN	Y	511;210	ENSP00000252825:H511Y	ENSP00000252825:H511Y	H	-	1	0	HRC	54348776	0.000000	0.05858	0.001000	0.08648	0.005000	0.04900	0.519000	0.22862	0.610000	0.30035	0.462000	0.41574	CAT	HRC	-	NULL	ENSG00000130528		0.557	HRC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HRC	HGNC	protein_coding	OTTHUMT00000465649.1	-	0.00	22	0	G	NM_002152		49656964	-1	tier1	-	no_errors	ENST00000252825	ensembl	human	known	74_37	missense	48.15	14	13	SNP	0.000	A
IARS	3376	genome.wustl.edu	37	9	95009691	95009691	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr9:95009691C>T	ENST00000375643.3	-	26	3025	c.2759G>A	c.(2758-2760)aGc>aAc	p.S920N	IARS_ENST00000375627.1_5'Flank|IARS_ENST00000447699.2_Missense_Mutation_p.S810N|IARS_ENST00000375629.3_5'UTR|IARS_ENST00000443024.2_Missense_Mutation_p.S920N	NM_013417.2	NP_038203.2	P41252	SYIC_HUMAN	isoleucyl-tRNA synthetase	920					gene expression (GO:0010467)|isoleucyl-tRNA aminoacylation (GO:0006428)|osteoblast differentiation (GO:0001649)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	aminoacyl-tRNA editing activity (GO:0002161)|ATP binding (GO:0005524)|isoleucine-tRNA ligase activity (GO:0004822)			breast(3)|endometrium(2)|kidney(4)|large_intestine(7)|lung(14)|ovary(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	35					L-Isoleucine(DB00167)	CTCCTCACTGCTCAACTGCTT	0.507																																																	0													155.0	127.0	136.0					9																	95009691		2203	4300	6503	SO:0001583	missense	0			AB209234	CCDS6694.1	9q21	2011-07-01	2007-02-26		ENSG00000196305	ENSG00000196305	6.1.1.5	"""Aminoacyl tRNA synthetases / Class I"""	5330	protein-coding gene	gene with protein product	"""isoleucine tRNA ligase 1, cytoplasmic"""	600709				8812440	Standard	NM_002161		Approved	ILRS, IARS1	uc004aru.4	P41252	OTTHUMG00000020219	ENST00000375643.3:c.2759G>A	9.37:g.95009691C>T	ENSP00000364794:p.Ser920Asn		A8KAE9|Q5TCD0|Q7Z3T4|Q9H588	Missense_Mutation	SNP	pfam_aa-tRNA-synth_Ia,pfam_V/L/I-tRNA-synth_anticodon-bd,pfam_Methionyl/Leucyl_tRNA_Synth,superfamily_Val/Leu/Ile-tRNA-synth_edit,superfamily_tRNAsynth_1a_anticodon-bd,prints_Ile-tRNA-ligase,tigrfam_Ile-tRNA-ligase	p.S920N	ENST00000375643.3	37	c.2759	CCDS6694.1	9	.	.	.	.	.	.	.	.	.	.	C	11.03	1.520356	0.27211	.	.	ENSG00000196305	ENST00000375643;ENST00000443024;ENST00000447699;ENST00000375660;ENST00000449893	T;T;T	0.12039	2.72;2.72;2.72	5.66	-0.921	0.10472	.	0.400472	0.31495	N	0.007543	T	0.16769	0.0403	M	0.83223	2.63	0.58432	D	0.999998	B;B;B	0.23058	0.079;0.007;0.015	B;B;B	0.26202	0.067;0.021;0.013	T	0.05007	-1.0912	10	0.72032	D	0.01	-3.6666	6.2908	0.21059	0.0:0.221:0.3519:0.4271	.	430;920;765	F5H1M4;P41252;Q6P0M4	.;SYIC_HUMAN;.	N	920;920;810;920;152	ENSP00000364794:S920N;ENSP00000406448:S920N;ENSP00000415020:S810N	ENSP00000364794:S920N	S	-	2	0	IARS	94049512	0.954000	0.32549	0.429000	0.26710	0.421000	0.31385	0.079000	0.14782	0.078000	0.16900	-0.253000	0.11424	AGC	IARS	-	NULL	ENSG00000196305		0.507	IARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IARS	HGNC	protein_coding	OTTHUMT00000053059.2		0.00	35	0	C	NM_002161		95009691	-1			no_errors	ENST00000375643	ensembl	human	known	74_37	missense	19.05	17	4	SNP	0.064	T
ING3	54556	genome.wustl.edu	37	7	120595654	120595654	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr7:120595654G>T	ENST00000315870.5	+	4	391	c.243G>T	c.(241-243)caG>caT	p.Q81H	ING3_ENST00000445699.1_Missense_Mutation_p.Q81H|ING3_ENST00000431467.1_Missense_Mutation_p.Q66H|ING3_ENST00000339121.5_Missense_Mutation_p.Q81H	NM_019071.2	NP_061944.2	Q9NXR8	ING3_HUMAN	inhibitor of growth family, member 3	81					chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|positive regulation of apoptotic process (GO:0043065)|regulation of growth (GO:0040008)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|NuA4 histone acetyltransferase complex (GO:0035267)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Piccolo NuA4 histone acetyltransferase complex (GO:0032777)|Swr1 complex (GO:0000812)	methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)			NS(1)|large_intestine(2)|lung(7)|ovary(1)|urinary_tract(1)	12	all_neural(327;0.117)					AGAAGGTTCAGTTGGCAAACC	0.284																																																	0													86.0	90.0	88.0					7																	120595654		2203	4300	6503	SO:0001583	missense	0			AF074968	CCDS5778.1, CCDS35497.1	7q31	2013-01-28			ENSG00000071243	ENSG00000071243		"""Zinc fingers, PHD-type"""	14587	protein-coding gene	gene with protein product		607493				12080476	Standard	NM_019071		Approved	p47ING3, FLJ20089, Eaf4, MEAF4	uc003vjn.3	Q9NXR8	OTTHUMG00000141270	ENST00000315870.5:c.243G>T	7.37:g.120595654G>T	ENSP00000320566:p.Gln81His		A8K790|O60394|Q567P3|Q6GMT3|Q7Z762|Q969G0|Q96DT4|Q9HC99|Q9P081	Missense_Mutation	SNP	pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,pfscan_Znf_PHD-finger	p.Q81H	ENST00000315870.5	37	c.243	CCDS5778.1	7	.	.	.	.	.	.	.	.	.	.	G	15.41	2.826788	0.50739	.	.	ENSG00000071243	ENST00000315870;ENST00000339121;ENST00000445699;ENST00000431467	D;D	0.95885	-3.76;-3.84	5.54	2.07	0.26955	Inhibitor of growth protein, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.95443	0.8520	L	0.44542	1.39	0.54753	D	0.999988	B;D;D;B;B	0.67145	0.007;0.996;0.991;0.006;0.005	B;D;D;B;B	0.81914	0.027;0.995;0.986;0.016;0.011	D	0.92629	0.6114	10	0.33940	T	0.23	-13.6499	10.0503	0.42212	0.2787:0.0:0.7213:0.0	.	81;81;81;81;81	B7ZKQ7;Q5GRH6;Q9NXR8;Q9NXR8-2;C9JUT0	.;.;ING3_HUMAN;.;.	H	81;81;81;66	ENSP00000320566:Q81H;ENSP00000388506:Q66H	ENSP00000320566:Q81H	Q	+	3	2	ING3	120382890	0.999000	0.42202	0.998000	0.56505	0.992000	0.81027	1.111000	0.31159	0.293000	0.22520	0.650000	0.86243	CAG	ING3	-	NULL	ENSG00000071243		0.284	ING3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ING3	HGNC	protein_coding	OTTHUMT00000280453.2		0.00	47	0	G	NM_019071		120595654	+1			no_errors	ENST00000315870	ensembl	human	known	74_37	missense	6.06	31	2	SNP	1.000	T
INSIG1	3638	genome.wustl.edu	37	7	155094456	155094456	+	Splice_Site	SNP	G	G	A	rs112769976		TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr7:155094456G>A	ENST00000340368.4	+	5	915		c.e5-1		INSIG1_ENST00000344756.4_Splice_Site|INSIG1_ENST00000342407.5_Splice_Site	NM_005542.4	NP_005533.2	O15503	INSI1_HUMAN	insulin induced gene 1						cell proliferation (GO:0008283)|cholesterol biosynthetic process (GO:0006695)|cranial suture morphogenesis (GO:0060363)|inner ear morphogenesis (GO:0042472)|metabolic process (GO:0008152)|middle ear morphogenesis (GO:0042474)|negative regulation of cargo loading into COPII-coated vesicle (GO:1901303)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of fatty acid biosynthetic process (GO:0045717)|negative regulation of steroid biosynthetic process (GO:0010894)|palate development (GO:0060021)|small molecule metabolic process (GO:0044281)|SREBP signaling pathway (GO:0032933)|triglyceride metabolic process (GO:0006641)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|SREBP-SCAP-Insig complex (GO:0032937)				endometrium(2)|kidney(2)|large_intestine(1)|lung(11)|prostate(1)|upper_aerodigestive_tract(2)	19	all_neural(206;0.119)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.011)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		TCTCGCTCCAGGTATACATCC	0.448																																																	0													164.0	155.0	158.0					7																	155094456		2203	4300	6503	SO:0001630	splice_region_variant	0				CCDS5938.1, CCDS5939.1	7q36	2008-07-18			ENSG00000186480	ENSG00000186480			6083	protein-coding gene	gene with protein product	"""INSIG-1 membrane protein"""	602055				9268630	Standard	NM_005542		Approved	CL-6, MGC1405	uc003wly.3	O15503	OTTHUMG00000151330	ENST00000340368.4:c.705-1G>A	7.37:g.155094456G>A			A4D2N1|A8K6L0|Q53XW8|Q9BUV5	Splice_Site	SNP	-	e4-1	ENST00000340368.4	37	c.705-1	CCDS5938.1	7	.	.	.	.	.	.	.	.	.	.	G	14.43	2.533081	0.45073	.	.	ENSG00000186480	ENST00000340368;ENST00000344756;ENST00000342407;ENST00000476756	.	.	.	4.65	4.65	0.58169	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.9022	0.88907	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	INSIG1	154725391	1.000000	0.71417	0.915000	0.36163	0.290000	0.27261	7.624000	0.83124	2.297000	0.77311	0.650000	0.86243	.	INSIG1	-	-	ENSG00000186480		0.448	INSIG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INSIG1	HGNC	protein_coding	OTTHUMT00000322244.3	-	0.00	123	0	G	NM_198336	Intron	155094456	+1	tier1	rs112769976	no_errors	ENST00000340368	ensembl	human	known	74_37	splice_site	7.46	62	5	SNP	1.000	A
IQGAP3	128239	genome.wustl.edu	37	1	156508933	156508933	+	Intron	SNP	C	C	T			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr1:156508933C>T	ENST00000361170.2	-	26	3067				IQGAP3_ENST00000498755.1_5'UTR	NM_178229.4	NP_839943.2	Q86VI3	IQGA3_HUMAN	IQ motif containing GTPase activating protein 3						activation of MAPK activity (GO:0000187)|cellular response to organic substance (GO:0071310)|ERK1 and ERK2 cascade (GO:0070371)|G1/S transition of mitotic cell cycle (GO:0000082)|negative regulation of gene expression (GO:0010629)|positive regulation of gene expression (GO:0010628)|positive regulation of mammary gland epithelial cell proliferation (GO:0033601)|Ras protein signal transduction (GO:0007265)|regulation of cell size (GO:0008361)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|lateral plasma membrane (GO:0016328)	Ras GTPase activator activity (GO:0005099)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(14)|lung(29)|ovary(5)|prostate(5)|skin(5)|urinary_tract(3)	75	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					GGTGTCCCCGCTCTTAAGGAA	0.468																																																	0																																										SO:0001627	intron_variant	0			AY253300	CCDS1144.1	1q21.3	2008-02-05			ENSG00000183856	ENSG00000183856			20669	protein-coding gene	gene with protein product							Standard	NM_178229		Approved		uc001fpf.3	Q86VI3	OTTHUMG00000033114	ENST00000361170.2:c.3057-108G>A	1.37:g.156508933C>T			Q5T3H8	RNA	SNP	-	NULL	ENST00000361170.2	37	NULL	CCDS1144.1	1																																																																																			IQGAP3	-	-	ENSG00000183856		0.468	IQGAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IQGAP3	HGNC	protein_coding	OTTHUMT00000080657.1	-	0.00	19	0	C	NM_178229		156508933	-1	tier1	-	no_errors	ENST00000498755	ensembl	human	putative	74_37	rna	62.50	3	5	SNP	0.000	T
JAKMIP2	9832	genome.wustl.edu	37	5	147024553	147024553	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr5:147024553G>A	ENST00000265272.5	-	6	1410	c.943C>T	c.(943-945)Cgt>Tgt	p.R315C	JAKMIP2_ENST00000507386.1_Missense_Mutation_p.R315C|JAKMIP2_ENST00000333010.6_Missense_Mutation_p.R273C	NM_001270941.1|NM_014790.4	NP_001257870.1|NP_055605.2	Q96AA8	JKIP2_HUMAN	janus kinase and microtubule interacting protein 2	315			R -> C (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.			Golgi apparatus (GO:0005794)		p.R315C(1)		NS(1)|autonomic_ganglia(1)|breast(3)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(22)|lung(18)|ovary(3)|pancreas(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)	64			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TCCCGCACACGTTTTAACTGG	0.507																																																	1	Substitution - Missense(1)	large_intestine(1)											126.0	127.0	127.0					5																	147024553		2203	4300	6503	SO:0001583	missense	0			AB011127	CCDS4285.1, CCDS59495.1, CCDS64284.1, CCDS75352.1	5q32	2009-08-13	2009-08-13		ENSG00000176049	ENSG00000176049			29067	protein-coding gene	gene with protein product		611197				9628581	Standard	NM_001270941		Approved	JAMIP2, KIAA0555	uc010jgo.2	Q96AA8	OTTHUMG00000129731	ENST00000265272.5:c.943C>T	5.37:g.147024553G>A	ENSP00000265272:p.Arg315Cys		A4ZZA7|A8K5G5|B4DSG0|G5E9Y0|O60302|Q548S1	Missense_Mutation	SNP	NULL	p.R315C	ENST00000265272.5	37	c.943	CCDS4285.1	5	.	.	.	.	.	.	.	.	.	.	G	24.7	4.564585	0.86439	.	.	ENSG00000176049	ENST00000507386;ENST00000265272;ENST00000333010;ENST00000539401	D;D;D	0.83755	-1.76;-1.76;-1.76	5.48	5.48	0.80851	.	0.000000	0.85682	D	0.000000	D	0.90297	0.6965	M	0.75615	2.305	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.76575	0.988;0.988;0.988;0.988	D	0.90925	0.4786	10	0.87932	D	0	.	14.5666	0.68182	0.0:0.0:0.8539:0.1461	.	273;315;315;315	B4DSG0;Q96AA8-3;G5E9Y0;Q96AA8	.;.;.;JKIP2_HUMAN	C	315;315;273;315	ENSP00000421398:R315C;ENSP00000265272:R315C;ENSP00000328989:R273C	ENSP00000265272:R315C	R	-	1	0	JAKMIP2	147004746	1.000000	0.71417	0.998000	0.56505	0.982000	0.71751	7.406000	0.80017	2.741000	0.93983	0.585000	0.79938	CGT	JAKMIP2	-	NULL	ENSG00000176049		0.507	JAKMIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	JAKMIP2	HGNC	protein_coding	OTTHUMT00000251941.1		0.00	55	0	G	NM_014790		147024553	-1			no_errors	ENST00000265272	ensembl	human	known	74_37	missense	5.71	33	2	SNP	1.000	A
KARS	3735	genome.wustl.edu	37	16	75670405	75670405	+	Silent	SNP	G	G	T			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr16:75670405G>T	ENST00000302445.3	-	4	468	c.429C>A	c.(427-429)atC>atA	p.I143I	KARS_ENST00000319410.5_Silent_p.I171I|KARS_ENST00000568378.1_Intron	NM_005548.2	NP_005539.1	Q15046	SYK_HUMAN	lysyl-tRNA synthetase	143					cell death (GO:0008219)|diadenosine tetraphosphate biosynthetic process (GO:0015966)|gene expression (GO:0010467)|lysyl-tRNA aminoacylation (GO:0006430)|tRNA aminoacylation for protein translation (GO:0006418)|tRNA processing (GO:0008033)|viral process (GO:0016032)	aminoacyl-tRNA synthetase multienzyme complex (GO:0017101)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|microtubule cytoskeleton (GO:0015630)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	amino acid binding (GO:0016597)|ATP binding (GO:0005524)|lysine-tRNA ligase activity (GO:0004824)|metal ion binding (GO:0046872)|tRNA binding (GO:0000049)			kidney(1)|large_intestine(3)|lung(8)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	18					L-Lysine(DB00123)	GATCATAGAAGATGAGCTTTC	0.443																																																	0													144.0	145.0	145.0					16																	75670405		2198	4300	6498	SO:0001819	synonymous_variant	0			AF285758	CCDS10923.1, CCDS45532.1	16q23.1	2014-09-17			ENSG00000065427	ENSG00000065427	6.1.1.6	"""Aminoacyl tRNA synthetases / Class II"""	6215	protein-coding gene	gene with protein product	"""lysine tRNA ligase"""	601421	"""deafness, autosomal recessive 89"""	DFNB89		8812440, 9278442, 23768514	Standard	NM_005548		Approved	KARS2, KARS1	uc002fer.3	Q15046	OTTHUMG00000137609	ENST00000302445.3:c.429C>A	16.37:g.75670405G>T			A8MSK1|D3DUK4|O14946|Q96J25|Q9HB23	Missense_Mutation	SNP	NULL	p.S116Y	ENST00000302445.3	37	c.347	CCDS10923.1	16																																																																																			KARS	-	NULL	ENSG00000065427		0.443	KARS-001	KNOWN	basic|CCDS	protein_coding	KARS	HGNC	protein_coding	OTTHUMT00000269023.1		0.00	78	0	G	NM_005548		75670405	-1			no_errors	ENST00000564578	ensembl	human	known	74_37	missense	8.11	34	3	SNP	1.000	T
KBTBD12	166348	genome.wustl.edu	37	3	127642922	127642922	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr3:127642922G>A	ENST00000405109.1	+	2	1485	c.1018G>A	c.(1018-1020)Gca>Aca	p.A340T	KBTBD12_ENST00000343941.4_Intron|KBTBD12_ENST00000407609.3_Intron|KBTBD12_ENST00000405256.1_Missense_Mutation_p.A340T			Q3ZCT8	KBTBC_HUMAN	kelch repeat and BTB (POZ) domain containing 12	340										endometrium(1)|large_intestine(6)|lung(5)|ovary(1)	13						GGCTGGAGAAGCAAGTGCCTC	0.353																																																	0													105.0	103.0	103.0					3																	127642922		1885	4092	5977	SO:0001583	missense	0				CCDS33848.2	3q21.3	2013-01-08	2009-10-01	2009-10-01	ENSG00000187715	ENSG00000187715		"""BTB/POZ domain containing"""	25731	protein-coding gene	gene with protein product			"""kelch domain containing 6"""	KLHDC6			Standard	NM_207335		Approved	FLJ46299	uc010hsr.3	Q3ZCT8	OTTHUMG00000150508	ENST00000405109.1:c.1018G>A	3.37:g.127642922G>A	ENSP00000385957:p.Ala340Thr		B5MCC6|Q6ZRK1	Missense_Mutation	SNP	pfam_Kelch_1,pfam_BACK,pfam_BTB_POZ,pfam_Kelch_2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.A340T	ENST00000405109.1	37	c.1018	CCDS33848.2	3	.	.	.	.	.	.	.	.	.	.	G	17.69	3.451178	0.63290	.	.	ENSG00000187715	ENST00000405109;ENST00000405256	T;T	0.65916	-0.18;-0.18	5.62	5.62	0.85841	Kelch-type beta propeller (1);	.	.	.	.	T	0.70272	0.3205	L	0.54323	1.7	0.34491	D	0.705025	D	0.56521	0.976	P	0.52481	0.7	T	0.75436	-0.3318	9	0.44086	T	0.13	.	20.0333	0.97547	0.0:0.0:1.0:0.0	.	340	Q3ZCT8	KBTBC_HUMAN	T	340	ENSP00000385957:A340T;ENSP00000385879:A340T	ENSP00000385957:A340T	A	+	1	0	KBTBD12	129125612	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.115000	0.71566	2.810000	0.96702	0.585000	0.79938	GCA	KBTBD12	-	pirsf_Kelch-like_gigaxonin	ENSG00000187715		0.353	KBTBD12-006	KNOWN	basic|appris_principal|CCDS	protein_coding	KBTBD12	HGNC	protein_coding	OTTHUMT00000318682.1	-	0.00	63	0	G	NM_207335		127642922	+1	tier1	-	no_errors	ENST00000405109	ensembl	human	known	74_37	missense	9.52	38	4	SNP	1.000	A
KBTBD4	55709	genome.wustl.edu	37	11	47599482	47599482	+	Missense_Mutation	SNP	G	G	A	rs372890651		TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr11:47599482G>A	ENST00000526005.1	-	2	223	c.70C>T	c.(70-72)Cgg>Tgg	p.R24W	NDUFS3_ENST00000529276.1_5'Flank|NDUFS3_ENST00000534208.1_5'Flank|KBTBD4_ENST00000395288.2_Missense_Mutation_p.R24W|NDUFS3_ENST00000533507.1_Intron|NDUFS3_ENST00000534716.2_5'Flank|KBTBD4_ENST00000525720.1_Missense_Mutation_p.R73W|NDUFS3_ENST00000528192.1_5'Flank|KBTBD4_ENST00000450908.1_3'UTR|KBTBD4_ENST00000430070.2_Missense_Mutation_p.R40W|KBTBD4_ENST00000533290.1_Missense_Mutation_p.R49W|RNU5E-10P_ENST00000363506.1_RNA|NDUFS3_ENST00000263774.4_5'Flank			Q9NVX7	KBTB4_HUMAN	kelch repeat and BTB (POZ) domain containing 4	24										NS(1)|breast(1)|central_nervous_system(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(2)|lung(5)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	24						GAATGTGACCGATCTTTGAAA	0.502																																																	0								G	TRP/ARG,TRP/ARG	2,4400	4.2+/-10.8	0,2,2199	97.0	91.0	93.0		70,118	3.2	1.0	11		93	0,8596		0,0,4298	no	missense,missense	KBTBD4	NM_016506.5,NM_018095.4	101,101	0,2,6497	AA,AG,GG		0.0,0.0454,0.0154	probably-damaging,probably-damaging	24/519,40/535	47599482	2,12996	2201	4298	6499	SO:0001583	missense	0			AF151086	CCDS7940.1, CCDS44594.1	11p11.2	2013-01-08	2003-12-12	2003-12-17	ENSG00000123444	ENSG00000123444		"""BTB/POZ domain containing"""	23761	protein-coding gene	gene with protein product			"""BTB and kelch domain containing 4"""	BKLHD4		11042152	Standard	NM_018095		Approved	FLJ10450, HSPC252	uc001nfz.3	Q9NVX7	OTTHUMG00000166894	ENST00000526005.1:c.70C>T	11.37:g.47599482G>A	ENSP00000433340:p.Arg24Trp		D3DQS1|D3DQS2|Q6IA85|Q9BUC3|Q9NV76	Missense_Mutation	SNP	pfam_BTB_POZ,pfam_BACK,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,pfscan_BTB/POZ-like	p.R40W	ENST00000526005.1	37	c.118	CCDS7940.1	11	.	.	.	.	.	.	.	.	.	.	G	22.6	4.309490	0.81247	4.54E-4	0.0	ENSG00000123444	ENST00000526005;ENST00000533290;ENST00000395288;ENST00000359900;ENST00000430070;ENST00000525720;ENST00000529499;ENST00000531067;ENST00000529946;ENST00000534239	T;T;T;T;T;T;T;T;T	0.78003	-0.66;-0.73;-0.66;-0.73;-0.62;-0.76;-1.14;-1.14;-0.97	5.13	3.2	0.36748	BTB/POZ fold (2);	0.000000	0.85682	D	0.000000	T	0.81029	0.4738	L	0.29908	0.895	0.58432	D	0.999999	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.80764	0.994;0.985;0.985	T	0.82030	-0.0659	10	0.72032	D	0.01	-17.5753	14.1605	0.65443	0.0:0.0:0.72:0.28	.	40;24;49	Q9NVX7-2;Q9NVX7;B3KRH9	.;KBTB4_HUMAN;.	W	24;49;24;40;40;73;24;24;24;49	ENSP00000433340:R24W;ENSP00000436713:R49W;ENSP00000378703:R24W;ENSP00000415106:R40W;ENSP00000434477:R73W;ENSP00000433404:R24W;ENSP00000433653:R24W;ENSP00000435651:R24W;ENSP00000433124:R49W	ENSP00000352971:R40W	R	-	1	2	KBTBD4	47556058	1.000000	0.71417	0.992000	0.48379	0.990000	0.78478	4.426000	0.59882	0.607000	0.29982	0.561000	0.74099	CGG	KBTBD4	-	superfamily_BTB/POZ_fold	ENSG00000123444		0.502	KBTBD4-003	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	KBTBD4	HGNC	protein_coding	OTTHUMT00000391763.1	-	0.00	45	0	G	NM_016506		47599482	-1	tier1	-	no_errors	ENST00000430070	ensembl	human	known	74_37	missense	40.54	22	15	SNP	1.000	A
KCNH5	27133	genome.wustl.edu	37	14	63246448	63246448	+	Silent	SNP	G	G	T			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr14:63246448G>T	ENST00000322893.7	-	10	2285	c.2017C>A	c.(2017-2019)Cgg>Agg	p.R673R	KCNH5_ENST00000420622.2_Intron|KCNH5_ENST00000394968.1_Silent_p.R615R	NM_139318.3	NP_647479.2	Q8NCM2	KCNH5_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 5	673					potassium ion transmembrane transport (GO:0071805)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	phosphorelay sensor kinase activity (GO:0000155)|voltage-gated potassium channel activity (GO:0005249)	p.R673W(2)		NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(33)|ovary(5)|prostate(2)|skin(17)|upper_aerodigestive_tract(4)|urinary_tract(2)	99				OV - Ovarian serous cystadenocarcinoma(108;0.00958)|BRCA - Breast invasive adenocarcinoma(234;0.168)		GAACATACCCGTTTCCTCAGA	0.398																																																	2	Substitution - Missense(2)	kidney(1)|central_nervous_system(1)											111.0	113.0	112.0					14																	63246448		2203	4300	6503	SO:0001819	synonymous_variant	0			U69185	CCDS9756.1, CCDS45122.1	14q23.1	2012-07-05			ENSG00000140015	ENSG00000140015		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6254	protein-coding gene	gene with protein product		605716				9738473, 16382104	Standard	NM_139318		Approved	Kv10.2, H-EAG2, eag2	uc001xfx.3	Q8NCM2	OTTHUMG00000029041	ENST00000322893.7:c.2017C>A	14.37:g.63246448G>T			C9JP98	Silent	SNP	pfam_Ion_trans_dom,pfam_2pore_dom_K_chnl_dom,pfam_cNMP-bd_dom,pfam_PAS_fold,superfamily_cNMP-bd-like,superfamily_PAS,smart_PAC,smart_cNMP-bd_dom,prints_K_chnl_volt-dep_EAG,prints_K_chnl_volt-dep_EAG/ELK/ERG,prints_K_chnl_volt-dep_ERG,pfscan_cNMP-bd_dom,pfscan_PAS-assoc_C,tigrfam_PAS	p.R673	ENST00000322893.7	37	c.2017	CCDS9756.1	14																																																																																			KCNH5	-	prints_K_chnl_volt-dep_EAG	ENSG00000140015		0.398	KCNH5-004	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNH5	HGNC	protein_coding	OTTHUMT00000411747.1		0.00	69	0	G	NM_139318		63246448	-1			no_errors	ENST00000322893	ensembl	human	known	74_37	silent	5.13	37	2	SNP	0.976	T
KCNH7	90134	genome.wustl.edu	37	2	163253371	163253371	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr2:163253371C>T	ENST00000332142.5	-	11	2591	c.2492G>A	c.(2491-2493)tGt>tAt	p.C831Y		NM_033272.3	NP_150375.2	Q9NS40	KCNH7_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 7	831					circadian rhythm (GO:0007623)|potassium ion transmembrane transport (GO:0071805)|protein heterooligomerization (GO:0051291)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	inward rectifier potassium channel activity (GO:0005242)|signal transducer activity (GO:0004871)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|biliary_tract(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(22)|lung(53)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	108					Doxazosin(DB00590)|Ibutilide(DB00308)|Miconazole(DB01110)|Prazosin(DB00457)|Terazosin(DB01162)	ATGCAAGTCACAGTATGTGAG	0.353																																					GBM(196;1492 2208 17507 24132 45496)												0													89.0	89.0	89.0					2																	163253371		2203	4300	6503	SO:0001583	missense	0			AF032897	CCDS2219.1, CCDS2220.1	2q24.3	2012-07-05			ENSG00000184611	ENSG00000184611		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	18863	protein-coding gene	gene with protein product		608169				16382104	Standard	NM_173162		Approved	Kv11.3, HERG3, erg3	uc002uch.2	Q9NS40	OTTHUMG00000132069	ENST00000332142.5:c.2492G>A	2.37:g.163253371C>T	ENSP00000331727:p.Cys831Tyr		Q53QU4|Q53TB7|Q53TP9|Q8IV15	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_cNMP-bd_dom,pfam_2pore_dom_K_chnl_dom,pfam_PAS_fold_3,superfamily_cNMP-bd-like,superfamily_PAS,smart_cNMP-bd_dom,prints_K_chnl_volt-dep_EAG/ELK/ERG,prints_K_chnl_volt-dep_ERG,pfscan_cNMP-bd_dom,tigrfam_PAS	p.C831Y	ENST00000332142.5	37	c.2492	CCDS2219.1	2	.	.	.	.	.	.	.	.	.	.	C	25.6	4.656541	0.88154	.	.	ENSG00000184611	ENST00000332142	D	0.97352	-4.35	5.67	5.67	0.87782	Cyclic nucleotide-binding-like (1);RmlC-like jelly roll fold (1);Cyclic nucleotide-binding domain (3);	0.000000	0.85682	D	0.000000	D	0.99152	0.9707	H	0.97491	4.015	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.98985	1.0806	10	0.87932	D	0	.	19.7712	0.96366	0.0:1.0:0.0:0.0	.	831	Q9NS40	KCNH7_HUMAN	Y	831	ENSP00000331727:C831Y	ENSP00000331727:C831Y	C	-	2	0	KCNH7	162961617	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.818000	0.86416	2.677000	0.91161	0.585000	0.79938	TGT	KCNH7	-	pfam_cNMP-bd_dom,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,prints_K_chnl_volt-dep_EAG/ELK/ERG,pfscan_cNMP-bd_dom	ENSG00000184611		0.353	KCNH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNH7	HGNC	protein_coding	OTTHUMT00000255093.1		0.00	50	0	C	NM_033272		163253371	-1			no_errors	ENST00000332142	ensembl	human	known	74_37	missense	5.13	37	2	SNP	1.000	T
KDR	3791	genome.wustl.edu	37	4	55958878	55958878	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr4:55958878G>T	ENST00000263923.4	-	22	3270	c.2975C>A	c.(2974-2976)cCt>cAt	p.P992H	RP11-530I17.1_ENST00000511222.1_RNA	NM_002253.2	NP_002244.1	P35968	VGFR2_HUMAN	kinase insert domain receptor (a type III receptor tyrosine kinase)	992	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				angiogenesis (GO:0001525)|branching morphogenesis of an epithelial tube (GO:0048754)|calcium ion homeostasis (GO:0055074)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|cell fate commitment (GO:0045165)|cell maturation (GO:0048469)|cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|embryonic hemopoiesis (GO:0035162)|endothelial cell differentiation (GO:0045446)|endothelium development (GO:0003158)|extracellular matrix organization (GO:0030198)|lung alveolus development (GO:0048286)|lymph vessel development (GO:0001945)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endothelial cell apoptotic process (GO:2000352)|ovarian follicle development (GO:0001541)|peptidyl-tyrosine autophosphorylation (GO:0038083)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of vasculogenesis (GO:2001214)|protein autophosphorylation (GO:0046777)|regulation of cell shape (GO:0008360)|signal transduction by phosphorylation (GO:0023014)|surfactant homeostasis (GO:0043129)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|vascular endothelial growth factor signaling pathway (GO:0038084)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sorting endosome (GO:0097443)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|Hsp90 protein binding (GO:0051879)|integrin binding (GO:0005178)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor binding (GO:0038085)|vascular endothelial growth factor-activated receptor activity (GO:0005021)			NS(1)|breast(3)|central_nervous_system(4)|endometrium(2)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(16)|lung(71)|ovary(2)|prostate(2)|skin(10)|soft_tissue(4)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	135	all_cancers(7;0.0255)|all_lung(4;0.00175)|Lung NSC(11;0.00384)|all_epithelial(27;0.034)|Glioma(25;0.08)|all_neural(26;0.101)		Epithelial(7;0.189)		Axitinib(DB06626)|Cabozantinib(DB08875)|Pazopanib(DB06589)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	CAGATCTTCAGGAGCTGTCCA	0.438			Mis		"""NSCLC, angiosarcoma"""					TSP Lung(20;0.16)																														Dom	yes		4	4q11-q12	3791	vascular endothelial growth factor receptor 2		E	0													85.0	75.0	78.0					4																	55958878		2203	4300	6503	SO:0001583	missense	0			AF035121	CCDS3497.1	4q11-q12	2013-01-29			ENSG00000128052	ENSG00000128052	2.7.10.1	"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6307	protein-coding gene	gene with protein product		191306				1417831	Standard	NM_002253		Approved	FLK1, VEGFR, VEGFR2, CD309	uc003has.3	P35968	OTTHUMG00000128734	ENST00000263923.4:c.2975C>A	4.37:g.55958878G>T	ENSP00000263923:p.Pro992His		A2RRS0|B5A925|C5IFA0|O60723|Q14178	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ig_I-set,pfam_Prot_kinase_dom,pfam_Ig_V-set,pfam_Immunoglobulin,pfam_CD80_C2-set,superfamily_Kinase-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom,prints_VEGFR2_rcpt	p.P992H	ENST00000263923.4	37	c.2975	CCDS3497.1	4	.	.	.	.	.	.	.	.	.	.	G	16.50	3.140492	0.56936	.	.	ENSG00000128052	ENST00000263923	D	0.89050	-2.46	5.95	5.95	0.96441	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.398007	0.28414	N	0.015438	D	0.85986	0.5825	N	0.17838	0.53	0.32716	N	0.511013	B	0.30793	0.295	B	0.41299	0.353	T	0.82432	-0.0460	10	0.17832	T	0.49	.	20.3802	0.98930	0.0:0.0:1.0:0.0	.	992	P35968	VGFR2_HUMAN	H	992	ENSP00000263923:P992H	ENSP00000263923:P992H	P	-	2	0	KDR	55653635	1.000000	0.71417	0.995000	0.50966	0.646000	0.38490	5.241000	0.65384	2.822000	0.97130	0.563000	0.77884	CCT	KDR	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000128052		0.438	KDR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KDR	HGNC	protein_coding	OTTHUMT00000250645.1	-	0.00	75	0	G			55958878	-1	tier1	-	no_errors	ENST00000263923	ensembl	human	known	74_37	missense	7.14	51	4	SNP	0.997	T
KIF17	57576	genome.wustl.edu	37	1	20998548	20998548	+	Missense_Mutation	SNP	G	G	T	rs141369367	byFrequency	TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr1:20998548G>T	ENST00000247986.2	-	12	2915	c.2605C>A	c.(2605-2607)Cgc>Agc	p.R869S	KIF17_ENST00000490034.1_5'UTR|KIF17_ENST00000400463.3_Missense_Mutation_p.R869S|KIF17_ENST00000375044.1_Missense_Mutation_p.R769S			Q9P2E2	KIF17_HUMAN	kinesin family member 17	869					ATP catabolic process (GO:0006200)|cell projection organization (GO:0030030)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|neurogenesis (GO:0022008)|protein complex localization (GO:0031503)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|intraciliary transport particle B (GO:0030992)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|plus-end-directed microtubule motor activity (GO:0008574)			NS(2)|endometrium(3)|kidney(3)|large_intestine(9)|liver(1)|lung(23)|ovary(4)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	50		all_lung(284;2.99e-05)|Lung NSC(340;3.26e-05)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00179)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|COAD - Colon adenocarcinoma(152;1.43e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000168)|Kidney(64;0.000221)|GBM - Glioblastoma multiforme(114;0.000651)|KIRC - Kidney renal clear cell carcinoma(64;0.0031)|STAD - Stomach adenocarcinoma(196;0.00336)|READ - Rectum adenocarcinoma(331;0.0686)|Lung(427;0.209)		CAGTCCCTGCGAATCAGGGGC	0.557																																																	0													91.0	84.0	87.0					1																	20998548		2203	4300	6503	SO:0001583	missense	0			AB037826	CCDS213.1, CCDS44079.1, CCDS72722.1	1p36.13	2012-08-01			ENSG00000117245	ENSG00000117245		"""Kinesins"""	19167	protein-coding gene	gene with protein product	"""kinesin-like protein KIF17"", ""KIF3-related motor protein"", ""KIF17 variant protein"""	605037				10846156	Standard	XR_241202		Approved	KIAA1405, KIF3X, KIF17B, OSM-3, KLP-2	uc001bdr.4	Q9P2E2	OTTHUMG00000002863	ENST00000247986.2:c.2605C>A	1.37:g.20998548G>T	ENSP00000247986:p.Arg869Ser		A2A3Q7|A2A3Q8|O95077|Q53YS6|Q5VWA9|Q6GSA8|Q8N411	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.R869S	ENST00000247986.2	37	c.2605	CCDS213.1	1	.	.	.	.	.	.	.	.	.	.	G	27.3	4.820860	0.90873	.	.	ENSG00000117245	ENST00000375044;ENST00000400463;ENST00000247986;ENST00000321188	T;T;T	0.75050	-0.9;-0.76;-0.75	5.94	5.03	0.67393	.	0.000000	0.32901	U	0.005518	T	0.80717	0.4676	M	0.77616	2.38	0.36733	D	0.881797	P;P;P	0.51537	0.91;0.946;0.91	B;P;B	0.48795	0.385;0.59;0.385	D	0.86805	0.1994	10	0.72032	D	0.01	.	16.3632	0.83280	0.0:0.1318:0.8682:0.0	.	869;869;869	B0I1R5;Q9P2E2-3;Q9P2E2	.;.;KIF17_HUMAN	S	769;869;869;250	ENSP00000364184:R769S;ENSP00000383311:R869S;ENSP00000247986:R869S	ENSP00000247986:R869S	R	-	1	0	KIF17	20871135	1.000000	0.71417	0.999000	0.59377	0.992000	0.81027	8.995000	0.93534	1.512000	0.48834	0.561000	0.74099	CGC	KIF17	-	NULL	ENSG00000117245		0.557	KIF17-009	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIF17	HGNC	protein_coding	OTTHUMT00000276995.1		0.00	61	0	G	NM_020816		20998548	-1			no_errors	ENST00000247986	ensembl	human	known	74_37	missense	5.00	38	2	SNP	1.000	T
KLK10	5655	genome.wustl.edu	37	19	51518085	51518085	+	Missense_Mutation	SNP	A	A	G			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr19:51518085A>G	ENST00000309958.3	-	6	1020	c.802T>C	c.(802-804)Tgg>Cgg	p.W268R	KLK10_ENST00000391805.1_Missense_Mutation_p.W268R|CTB-147C22.9_ENST00000594512.1_RNA|KLK10_ENST00000358789.3_Missense_Mutation_p.W268R|CTC-518B2.12_ENST00000596286.1_RNA	NM_002776.4	NP_002767.2	O43240	KLK10_HUMAN	kallikrein-related peptidase 10	268	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				cell cycle (GO:0007049)	extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(6)|ovary(1)|prostate(1)	13		all_neural(266;0.026)		OV - Ovarian serous cystadenocarcinoma(262;0.00328)|GBM - Glioblastoma multiforme(134;0.00885)		TTATTGATCCAGGACATGTAT	0.537																																																	0													145.0	132.0	136.0					19																	51518085		2203	4300	6503	SO:0001583	missense	0			AF024605	CCDS12817.1	19q13	2011-03-07	2006-10-27			ENSG00000129451		"""Kallikreins"""	6358	protein-coding gene	gene with protein product		602673	"""kallikrein 10"""	PRSSL1		8764136, 9533035, 16800724, 16800723, 10675891	Standard	NM_145888		Approved	NES1	uc002pva.3	O43240		ENST00000309958.3:c.802T>C	19.37:g.51518085A>G	ENSP00000311746:p.Trp268Arg		A6NC12|Q53YL3|Q99920|Q9GZW9	Missense_Mutation	SNP	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1,prints_Peptidase_S1A	p.W268R	ENST00000309958.3	37	c.802	CCDS12817.1	19	.	.	.	.	.	.	.	.	.	.	a	14.69	2.611644	0.46631	.	.	ENSG00000129451	ENST00000391805;ENST00000309958;ENST00000358789	D;D;D	0.99121	-5.45;-5.45;-5.45	4.66	4.66	0.58398	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	.	.	.	.	D	0.99536	0.9834	H	0.98111	4.15	0.46113	D	0.998871	D	0.89917	1.0	D	0.97110	1.0	D	0.98001	1.0360	9	0.87932	D	0	.	12.3436	0.55107	1.0:0.0:0.0:0.0	.	268	O43240	KLK10_HUMAN	R	268	ENSP00000375681:W268R;ENSP00000311746:W268R;ENSP00000351640:W268R	ENSP00000311746:W268R	W	-	1	0	KLK10	56209897	1.000000	0.71417	0.866000	0.34008	0.040000	0.13550	8.563000	0.90723	1.879000	0.54435	0.260000	0.18958	TGG	KLK10	-	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1	ENSG00000129451		0.537	KLK10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLK10	HGNC	protein_coding	OTTHUMT00000464337.2		0.00	81	0	A	NM_002776		51518085	-1			no_errors	ENST00000309958	ensembl	human	known	74_37	missense	8.57	32	3	SNP	1.000	G
KLK11	11012	genome.wustl.edu	37	19	51530744	51530744	+	Frame_Shift_Del	DEL	C	C	-			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr19:51530744delC	ENST00000594768.1	-	1	215	c.30delG	c.(28-30)tggfs	p.W10fs	KLK11_ENST00000594458.1_5'Flank|KLK11_ENST00000319720.7_Intron|KLK11_ENST00000600362.1_5'Flank|KLK11_ENST00000391804.3_Intron|CTC-518B2.9_ENST00000594910.1_RNA|KLK11_ENST00000453757.3_5'Flank	NM_144947.1	NP_659196.1	Q9UBX7	KLK11_HUMAN	kallikrein-related peptidase 11	10						extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			breast(1)|endometrium(2)|large_intestine(1)|lung(2)|skin(1)	7		all_neural(266;0.026)		OV - Ovarian serous cystadenocarcinoma(262;0.00327)|GBM - Glioblastoma multiforme(134;0.00878)		CCGATGACTTCCAGTCCCGCA	0.607																																																	0													92.0	93.0	93.0					19																	51530744		2203	4300	6503	SO:0001589	frameshift_variant	0			AB012917	CCDS12818.1, CCDS12819.1, CCDS54297.1	19q13.33	2011-09-07	2006-10-27			ENSG00000167757		"""Kallikreins"", ""Serine peptidases / Serine peptidases"""	6359	protein-coding gene	gene with protein product		604434	"""kallikrein 11"""	PRSS20		9765601, 10662548, 16800724, 16800723	Standard	NM_006853		Approved	TLSP	uc002pvb.2	Q9UBX7		ENST00000594768.1:c.30delG	19.37:g.51530744delC	ENSP00000473047:p.Trp10fs		O75837|Q0WXX5|Q8IXD7|Q9NS65	Frame_Shift_Del	DEL	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,prints_Peptidase_S1A,pfscan_Peptidase_S1	p.W10fs	ENST00000594768.1	37	c.30	CCDS12818.1	19																																																																																			KLK11	-	NULL	ENSG00000167757		0.607	KLK11-002	KNOWN	basic|CCDS	protein_coding	KLK11	HGNC	protein_coding	OTTHUMT00000464314.2		0.00	102	0	C	NM_006853		51530744	-1	tier1		no_errors	ENST00000594768	ensembl	human	known	74_37	frame_shift_del	22.22	42	12	DEL	0.055	-
KPNA1	3836	genome.wustl.edu	37	3	122168479	122168479	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr3:122168479C>T	ENST00000344337.6	-	9	1035	c.859G>A	c.(859-861)Gat>Aat	p.D287N	KPNA1_ENST00000466923.1_5'UTR	NM_002264.3	NP_002255.3	P52294	IMA5_HUMAN	karyopherin alpha 1 (importin alpha 5)	287	Binding to RAG1.				apoptotic DNA fragmentation (GO:0006309)|apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cytokine-mediated signaling pathway (GO:0019221)|intracellular transport of virus (GO:0075733)|NLS-bearing protein import into nucleus (GO:0006607)|positive regulation of protein import into nucleus (GO:0042307)|regulation of DNA recombination (GO:0000018)|viral life cycle (GO:0019058)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|nuclear pore (GO:0005643)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nuclear localization sequence binding (GO:0008139)|protein transporter activity (GO:0008565)	p.D287H(1)		NS(1)|breast(1)|cervix(2)|endometrium(2)|kidney(1)|large_intestine(7)|lung(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	21				GBM - Glioblastoma multiforme(114;0.0898)		TGAATTTTATCATTGGGTCCA	0.458																																					Melanoma(12;340 801 11196 19797)												1	Substitution - Missense(1)	urinary_tract(1)											85.0	79.0	81.0					3																	122168479		2203	4300	6503	SO:0001583	missense	0			S75295	CCDS3013.1	3q21	2013-02-14			ENSG00000114030	ENSG00000114030		"""Importins"", ""Armadillo repeat containing"""	6394	protein-coding gene	gene with protein product		600686				8052633	Standard	NM_002264		Approved	SRP1, RCH2, NPI-1, IPOA5	uc003efe.2	P52294	OTTHUMG00000159487	ENST00000344337.6:c.859G>A	3.37:g.122168479C>T	ENSP00000343701:p.Asp287Asn		D3DN93|Q6IBQ9|Q9BQ56	Missense_Mutation	SNP	pfam_Armadillo,pfam_Importin-a_IBB,pfam_HEAT,superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo,pfscan_Importin-a_IBB	p.D287N	ENST00000344337.6	37	c.859	CCDS3013.1	3	.	.	.	.	.	.	.	.	.	.	C	35	5.464588	0.96257	.	.	ENSG00000114030	ENST00000344337;ENST00000465882	T;T	0.32988	1.43;1.43	5.1	5.1	0.69264	Armadillo-like helical (1);Armadillo-type fold (1);	0.046607	0.85682	D	0.000000	T	0.48205	0.1487	L	0.49350	1.555	0.80722	D	1	P	0.43314	0.803	P	0.57679	0.825	T	0.37314	-0.9711	10	0.54805	T	0.06	-19.7872	17.703	0.88301	0.0:1.0:0.0:0.0	.	287	P52294	IMA1_HUMAN	N	287	ENSP00000343701:D287N;ENSP00000419890:D287N	ENSP00000343701:D287N	D	-	1	0	KPNA1	123651169	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.320000	0.79064	2.644000	0.89710	0.563000	0.77884	GAT	KPNA1	-	pfam_Armadillo,superfamily_ARM-type_fold,smart_Armadillo	ENSG00000114030		0.458	KPNA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KPNA1	HGNC	protein_coding	OTTHUMT00000355740.1		0.00	45	0	C	NM_002264		122168479	-1			no_errors	ENST00000344337	ensembl	human	known	74_37	missense	6.90	27	2	SNP	1.000	T
L3MBTL4	91133	genome.wustl.edu	37	18	6215816	6215816	+	Missense_Mutation	SNP	T	T	A	rs139480207	byFrequency	TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr18:6215816T>A	ENST00000284898.6	-	11	1003	c.803A>T	c.(802-804)aAt>aTt	p.N268I	L3MBTL4_ENST00000400104.3_Missense_Mutation_p.N268I|L3MBTL4_ENST00000400105.2_Missense_Mutation_p.N268I|L3MBTL4_ENST00000317931.7_Missense_Mutation_p.N268I|L3MBTL4_ENST00000535782.1_Missense_Mutation_p.N81I	NM_173464.3	NP_775735.2	Q8NA19	LMBL4_HUMAN	l(3)mbt-like 4 (Drosophila)	268					chromatin modification (GO:0016568)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(17)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	39		Colorectal(10;0.0249)				CCAGGAAAAATTTTCTGGATT	0.338																																					Esophageal Squamous(41;748 902 17366 28959 43175)												0								T	ILE/ASN	1,4403		0,1,2201	41.0	43.0	42.0		803	5.3	0.9	18	dbSNP_134	42	2,8598		0,2,4298	no	missense	L3MBTL4	NM_173464.3	149	0,3,6499	AA,AT,TT		0.0233,0.0227,0.0231	benign	268/624	6215816	3,13001	2202	4300	6502	SO:0001583	missense	0			BC039316	CCDS11839.2	18p11.31-p11.23	2013-01-10			ENSG00000154655	ENSG00000154655		"""Sterile alpha motif (SAM) domain containing"""	26677	protein-coding gene	gene with protein product						14702039	Standard	NM_173464		Approved	FLJ35936, HsT1031	uc010dkt.3	Q8NA19	OTTHUMG00000131573	ENST00000284898.6:c.803A>T	18.37:g.6215816T>A	ENSP00000284898:p.Asn268Ile		A8MTL8|Q8IXS3	Missense_Mutation	SNP	pfam_Mbt,pfam_SAM_type1,pfam_Znf_C2HC,pfam_SAM_2,superfamily_SAM/pointed,smart_Mbt,smart_SAM,pfscan_Mbt,pfscan_SAM	p.N268I	ENST00000284898.6	37	c.803	CCDS11839.2	18	.	.	.	.	.	.	.	.	.	.	T	13.15	2.151882	0.38021	2.27E-4	2.33E-4	ENSG00000154655	ENST00000400105;ENST00000317931;ENST00000284898;ENST00000535782;ENST00000400104	T;T;T;T;T	0.40225	1.04;1.04;1.04;1.04;1.04	5.3	5.3	0.74995	.	0.507275	0.18702	N	0.133553	T	0.35799	0.0944	N	0.22421	0.69	0.25328	N	0.989057	B;B	0.31009	0.303;0.143	B;B	0.39771	0.309;0.105	T	0.34775	-0.9815	10	0.39692	T	0.17	.	11.903	0.52694	0.0:0.0:0.0:1.0	.	268;268	Q8NA19;F8W9S8	LMBL4_HUMAN;.	I	268;268;268;81;268	ENSP00000382976:N268I;ENSP00000318543:N268I;ENSP00000284898:N268I;ENSP00000444774:N81I;ENSP00000382975:N268I	ENSP00000284898:N268I	N	-	2	0	L3MBTL4	6205816	1.000000	0.71417	0.942000	0.38095	0.668000	0.39293	2.612000	0.46343	2.134000	0.65973	0.533000	0.62120	AAT	L3MBTL4	-	NULL	ENSG00000154655		0.338	L3MBTL4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	L3MBTL4	HGNC	protein_coding	OTTHUMT00000254448.2	-	0.00	79	0	T	NM_173464		6215816	-1	tier1	rs139480207	no_errors	ENST00000284898	ensembl	human	known	74_37	missense	16.18	57	11	SNP	0.983	A
LAMA3	3909	genome.wustl.edu	37	18	21393048	21393048	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr18:21393048G>A	ENST00000313654.9	+	14	2010	c.1769G>A	c.(1768-1770)gGt>gAt	p.G590D	LAMA3_ENST00000399516.3_Missense_Mutation_p.G590D	NM_198129.1	NP_937762.1	Q16787	LAMA3_HUMAN	laminin, alpha 3	590	Domain V.|Laminin EGF-like 6. {ECO:0000255|PROSITE- ProRule:PRU00460}.				cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-5 complex (GO:0005610)	structural molecule activity (GO:0005198)			NS(2)|breast(4)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(24)|lung(54)|ovary(8)|prostate(6)|skin(7)|urinary_tract(4)	128	all_cancers(21;7.81e-05)|all_epithelial(16;4.45e-07)|Lung NSC(20;0.00156)|all_lung(20;0.00508)|Colorectal(14;0.0202)|Ovarian(20;0.17)					GACCCAGCTGGTACCATCAAC	0.343																																																	0													93.0	88.0	90.0					18																	21393048		1828	4071	5899	SO:0001583	missense	0			L34155	CCDS11880.1, CCDS42419.1, CCDS45838.1, CCDS59307.1	18q11.2	2013-03-01	2002-08-29		ENSG00000053747	ENSG00000053747		"""Laminins"""	6483	protein-coding gene	gene with protein product		600805	"""laminin, alpha 3 (nicein (150kD), kalinin (165kD), BM600 (150kD), epilegrin)"""	LAMNA		8077230	Standard	NM_000227		Approved	nicein-150kDa, kalinin-165kDa, BM600-150kDa, epiligrin	uc002kuq.3	Q16787	OTTHUMG00000131874	ENST00000313654.9:c.1769G>A	18.37:g.21393048G>A	ENSP00000324532:p.Gly590Asp		B0YJ33|Q13679|Q13680|Q6VU67|Q6VU68|Q6VU69|Q76E14|Q96TG0	Missense_Mutation	SNP	pfam_EGF_laminin,pfam_Laminin_G,pfam_Laminin_I,pfam_Laminin_N,pfam_Laminin_II,pfam_Laminin_B_type_IV,superfamily_ConA-like_lec_gl_sf,superfamily_Growth_fac_rcpt_N_dom,superfamily_Galactose-bd-like,superfamily_STAT_TF_coiled-coil,smart_Laminin_N,smart_EGF_laminin,smart_EG-like_dom,smart_Laminin_B_subgr,smart_Laminin_G,pfscan_Laminin_B_type_IV,pfscan_EGF_laminin,pfscan_Laminin_G,pfscan_Laminin_N	p.G590D	ENST00000313654.9	37	c.1769	CCDS42419.1	18	.	.	.	.	.	.	.	.	.	.	G	15.73	2.920015	0.52653	.	.	ENSG00000053747	ENST00000313654;ENST00000399516;ENST00000416669	T;T	0.58358	0.34;0.34	5.11	5.11	0.69529	EGF-like, laminin (2);	.	.	.	.	D	0.83344	0.5234	H	0.98646	4.29	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.77557	0.981;0.99	D	0.89798	0.3973	9	0.66056	D	0.02	.	17.0835	0.86604	0.0:0.0:1.0:0.0	.	590;590	Q6VU67;Q16787	.;LAMA3_HUMAN	D	590;590;588	ENSP00000324532:G590D;ENSP00000382432:G590D	ENSP00000324532:G590D	G	+	2	0	LAMA3	19647046	1.000000	0.71417	0.323000	0.25347	0.304000	0.27724	5.712000	0.68407	2.519000	0.84933	0.655000	0.94253	GGT	LAMA3	-	pfam_EGF_laminin,smart_EGF_laminin	ENSG00000053747		0.343	LAMA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMA3	HGNC	protein_coding	OTTHUMT00000254824.3		0.00	30	0	G	NM_000227, NM_198129		21393048	+1			no_errors	ENST00000313654	ensembl	human	known	74_37	missense	8.70	21	2	SNP	0.959	A
CCER1	196477	genome.wustl.edu	37	12	91340252	91340253	+	Intron	INS	-	-	T	rs5799966|rs397849978		TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr12:91340252_91340253insT	ENST00000548187.1	-	3	193				LINC00615_ENST00000546725.1_lincRNA			Q8TC90	CCER1_HUMAN	coiled-coil glutamate-rich protein 1																		AAAAGCCTTCCttttttttttt	0.421																																																	0																																										SO:0001627	intron_variant	0			BC024183	CCDS9036.1	12q21.33	2012-05-30	2012-05-30	2012-05-30	ENSG00000197651	ENSG00000197651			28373	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 12"""	C12orf12		17967063	Standard	NM_152638		Approved	MGC26598	uc001tbj.3	Q8TC90	OTTHUMG00000170070	ENST00000548187.1:c.283-5398->A	12.37:g.91340263_91340263dupT			Q8TC47	RNA	INS	-	NULL	ENST00000548187.1	37	NULL		12																																																																																			LINC00615	-	-	ENSG00000196243		0.421	CCER1-001	KNOWN	basic	processed_transcript	LINC00615	HGNC	protein_coding	OTTHUMT00000407141.1		0.00	37	0	-	NM_152638		91340253	+1	tier1		no_errors	ENST00000546725	ensembl	human	known	74_37	rna	13.64	19	3	INS	0.092:0.148	T
LINC01410	103352539	genome.wustl.edu	37	9	66457322	66457322	+	lincRNA	SNP	G	G	C	rs11262292	byFrequency	TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr9:66457322G>C	ENST00000424345.1	+	0	34				RNA5SP283_ENST00000365604.1_RNA																							tggagcgacagcgacagagcc	0.632																																																	0																																												0																															9.37:g.66457322G>C				RNA	SNP	-	NULL	ENST00000424345.1	37	NULL		9																																																																																			RP11-262H14.1	-	-	ENSG00000238113		0.632	RP11-262H14.1-001	KNOWN	basic	lincRNA	LOC100996870	Clone_based_vega_gene	lincRNA	OTTHUMT00000128851.1		0.00	77	0	G			66457322	+1			no_errors	ENST00000424345	ensembl	human	known	74_37	rna	7.23	77	6	SNP	0.168	C
LINC01410	103352539	genome.wustl.edu	37	9	66466650	66466650	+	lincRNA	SNP	G	G	C	rs1133399	byFrequency	TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr9:66466650G>C	ENST00000424345.1	+	0	1283																											gctaataaaggactccttaat	0.478																																																	0																																												0																															9.37:g.66466650G>C				RNA	SNP	-	NULL	ENST00000424345.1	37	NULL		9																																																																																			RP11-262H14.1	-	-	ENSG00000238113		0.478	RP11-262H14.1-001	KNOWN	basic	lincRNA	LOC100996870	Clone_based_vega_gene	lincRNA	OTTHUMT00000128851.1	-	0.00	21	0	G			66466650	+1	tier1	rs1133399	no_errors	ENST00000424345	ensembl	human	known	74_37	rna	25.00	12	4	SNP	0.105	C
CCDC192	728586	genome.wustl.edu	37	5	127133824	127133824	+	lincRNA	DEL	A	A	-			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr5:127133824delA	ENST00000514853.2	+	0	437																											AAGCTGAAGTAAAAGCTTCCC	0.353																																																	0																																												0																															5.37:g.127133824delA				RNA	DEL	-	NULL	ENST00000514853.2	37	NULL		5																																																																																			CTC-228N24.1	-	-	ENSG00000230561		0.353	CTC-228N24.1-001	KNOWN	not_organism_supported|basic	lincRNA	LOC728586	Clone_based_vega_gene	lincRNA	OTTHUMT00000372464.3		0.00	87	0	A			127133824	+1	tier1		no_errors	ENST00000514853	ensembl	human	known	74_37	rna	6.45	29	2	DEL	0.951	-
LRRC37A	9884	genome.wustl.edu	37	17	44408828	44408828	+	Missense_Mutation	SNP	T	T	A			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr17:44408828T>A	ENST00000320254.5	+	9	4188	c.4185T>A	c.(4183-4185)aaT>aaA	p.N1395K	LRRC37A_ENST00000496930.1_Missense_Mutation_p.N433K|ARL17B_ENST00000570618.1_Intron|LRRC37A_ENST00000393465.3_Missense_Mutation_p.N1395K|ARL17B_ENST00000575698.1_Intron|ARL17B_ENST00000434041.2_Intron|ARL17B_ENST00000575960.1_Intron	NM_014834.4	NP_055649.4	A6NMS7	L37A1_HUMAN	leucine rich repeat containing 37A	1395						integral component of membrane (GO:0016021)				endometrium(1)|lung(2)|pancreas(6)|prostate(1)|skin(1)	11		Melanoma(429;0.211)		BRCA - Breast invasive adenocarcinoma(366;0.232)		CTGCAAGAAATGCCTTTGAAG	0.383																																																	0													18.0	12.0	14.0					17																	44408828		1955	3323	5278	SO:0001583	missense	0			BC040501	CCDS11504.2	17q21.31	2014-04-01			ENSG00000176681	ENSG00000176681			29069	protein-coding gene	gene with protein product						9628581, 15533724	Standard	NM_014834		Approved	KIAA0563	uc031rbr.1	A6NMS7	OTTHUMG00000149841	ENST00000320254.5:c.4185T>A	17.37:g.44408828T>A	ENSP00000326324:p.Asn1395Lys		Q68DY2|Q8IWC7	Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.N1395K	ENST00000320254.5	37	c.4185	CCDS11504.2	17	.	.	.	.	.	.	.	.	.	.	t	7.795	0.712447	0.15306	.	.	ENSG00000176681	ENST00000496930;ENST00000393466;ENST00000393465;ENST00000320254	T;T;T	0.59224	1.51;0.29;0.28	2.15	-1.77	0.07982	.	.	.	.	.	T	0.59555	0.2202	L	0.50333	1.59	0.09310	N	1	B;P;D	0.57899	0.092;0.588;0.981	B;B;D	0.65140	0.035;0.032;0.932	T	0.49437	-0.8940	9	0.40728	T	0.16	.	2.1219	0.03728	0.2511:0.3344:0.0:0.4145	.	433;515;1395	E9PP10;Q5YKG5;A6NMS7	.;.;L37A1_HUMAN	K	433;1395;1395;1395	ENSP00000437021:N433K;ENSP00000377108:N1395K;ENSP00000326324:N1395K	ENSP00000326324:N1395K	N	+	3	2	LRRC37A	41764589	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	0.032000	0.13732	-0.495000	0.06659	0.347000	0.21830	AAT	LRRC37A	-	NULL	ENSG00000176681		0.383	LRRC37A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LRRC37A	HGNC	protein_coding	OTTHUMT00000313519.3	-	0.00	92	0	T	NM_014834		44408828	+1	tier1	-	no_errors	ENST00000320254	ensembl	human	known	74_37	missense	5.63	67	4	SNP	0.000	A
MADD	8567	genome.wustl.edu	37	11	47306054	47306054	+	Missense_Mutation	SNP	C	C	T	rs375478508		TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr11:47306054C>T	ENST00000311027.5	+	12	2260	c.2095C>T	c.(2095-2097)Cgc>Tgc	p.R699C	MADD_ENST00000406482.1_Missense_Mutation_p.R699C|MADD_ENST00000395336.3_Missense_Mutation_p.R699C|MADD_ENST00000395344.3_Missense_Mutation_p.R699C|MADD_ENST00000402799.1_Missense_Mutation_p.R699C|MADD_ENST00000402192.2_Missense_Mutation_p.R699C|MADD_ENST00000342922.4_Missense_Mutation_p.R699C|MADD_ENST00000407859.3_Missense_Mutation_p.R699C|MADD_ENST00000349238.3_Missense_Mutation_p.R699C	NM_003682.3	NP_003673.3			MAP-kinase activating death domain											breast(7)|central_nervous_system(2)|endometrium(9)|kidney(3)|large_intestine(19)|lung(26)|ovary(6)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	84				Lung(87;0.182)		CCCCCCACTGCGCTCCAGCTC	0.592																																																	0													60.0	65.0	64.0					11																	47306054		2201	4298	6499	SO:0001583	missense	0			AB002356	CCDS7930.1, CCDS7931.1, CCDS7932.1, CCDS41642.1, CCDS44586.1, CCDS44587.1, CCDS44588.1, CCDS44589.1, CCDS44590.1	11p11.2	2012-10-04			ENSG00000110514	ENSG00000110514		"""DENN/MADD domain containing"""	6766	protein-coding gene	gene with protein product		603584				9115275, 9796103	Standard	NM_130476		Approved	DENN, KIAA0358, RAB3GEP	uc001ner.1	Q8WXG6	OTTHUMG00000150350	ENST00000311027.5:c.2095C>T	11.37:g.47306054C>T	ENSP00000310933:p.Arg699Cys			Missense_Mutation	SNP	pfam_DENN_dom,pfam_uDENN_dom,pfam_dDENN_dom,smart_uDENN_dom,smart_DENN_dom,smart_dDENN_dom,pfscan_DENN_dom,pfscan_uDENN_dom,pfscan_dDENN_dom	p.R699C	ENST00000311027.5	37	c.2095	CCDS7930.1	11	.	.	.	.	.	.	.	.	.	.	C	26.7	4.767284	0.90020	.	.	ENSG00000110514	ENST00000342922;ENST00000395342;ENST00000402799;ENST00000406482;ENST00000349238;ENST00000311027;ENST00000407859;ENST00000395344;ENST00000395336;ENST00000402192	T;T;T;T;T;T;T;T;T	0.06687	3.3;3.28;3.28;3.34;3.36;3.28;3.27;3.35;3.3	5.96	5.05	0.67936	.	0.196702	0.56097	N	0.000030	T	0.26774	0.0655	M	0.63428	1.95	0.80722	D	1	D;D;D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D;D;D	0.91635	0.983;0.997;0.999;0.978;0.989;0.999;0.999;0.999;0.991;0.999	T	0.01062	-1.1464	10	0.72032	D	0.01	-3.3904	14.9232	0.70856	0.0:0.9319:0.0:0.0681	.	699;699;699;699;699;699;699;699;699;699	B5MEE5;A8K8S7;Q8WXG6-7;F8W9P9;Q8WXG6-6;Q8WXG6-5;Q8WXG6-2;Q8WXG6-4;Q8WXG6;Q8WXG6-3	.;.;.;.;.;.;.;.;MADD_HUMAN;.	C	699	ENSP00000343902:R699C;ENSP00000385585:R699C;ENSP00000384435:R699C;ENSP00000304505:R699C;ENSP00000310933:R699C;ENSP00000384204:R699C;ENSP00000378753:R699C;ENSP00000378745:R699C;ENSP00000384287:R699C	ENSP00000310933:R699C	R	+	1	0	MADD	47262630	1.000000	0.71417	0.723000	0.30687	0.994000	0.84299	5.753000	0.68736	1.526000	0.49068	0.655000	0.94253	CGC	MADD	-	NULL	ENSG00000110514		0.592	MADD-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MADD	HGNC	protein_coding	OTTHUMT00000317746.1		0.00	32	0	C			47306054	+1			no_errors	ENST00000311027	ensembl	human	known	74_37	missense	6.25	30	2	SNP	1.000	T
MAP4	4134	genome.wustl.edu	37	3	47950671	47950671	+	Intron	SNP	C	C	T			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr3:47950671C>T	ENST00000360240.6	-	8	2518				MAP4_ENST00000395734.3_Intron|MAP4_ENST00000383737.4_Missense_Mutation_p.G347E|MAP4_ENST00000426837.2_Missense_Mutation_p.G1764E|MAP4_ENST00000264724.11_Missense_Mutation_p.G354E	NM_002375.4	NP_002366.2	P27816	MAP4_HUMAN	microtubule-associated protein 4						cell division (GO:0051301)|establishment of spindle orientation (GO:0051294)|microtubule sliding (GO:0051012)|mitotic spindle organization (GO:0007052)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|microtubule cytoskeleton (GO:0015630)|mitotic spindle (GO:0072686)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)|structural molecule activity (GO:0005198)			breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(10)|ovary(2)|pancreas(1)|skin(2)	32				BRCA - Breast invasive adenocarcinoma(193;0.000721)|KIRC - Kidney renal clear cell carcinoma(197;0.00641)|Kidney(197;0.00736)	Docetaxel(DB01248)|Paclitaxel(DB01229)	TTTCCCTTCTCCTGGTGTCTT	0.433																																																	0													206.0	187.0	193.0					3																	47950671		1855	4107	5962	SO:0001627	intron_variant	0				CCDS33750.1, CCDS46818.1, CCDS46821.1	3p21	2008-07-18			ENSG00000047849	ENSG00000047849			6862	protein-coding gene	gene with protein product		157132				1905296	Standard	NM_002375		Approved		uc003csb.2	P27816	OTTHUMG00000156828	ENST00000360240.6:c.1999+5635G>A	3.37:g.47950671C>T			Q13082|Q59FT2|Q68D74|Q6ZUW9|Q86V26|Q96A76|Q96NS9	Missense_Mutation	SNP	pfam_MAP_tubulin-bd_rpt	p.G354E	ENST00000360240.6	37	c.1061	CCDS33750.1	3	.	.	.	.	.	.	.	.	.	.	C	8.794	0.931258	0.18131	.	.	ENSG00000047849	ENST00000383737;ENST00000264724;ENST00000426837;ENST00000383736	T;T;T	0.29397	3.24;1.57;3.3	5.52	1.59	0.23543	.	.	.	.	.	T	0.18002	0.0432	.	.	.	0.09310	N	1	B;B	0.14012	0.009;0.001	B;B	0.19946	0.027;0.004	T	0.30621	-0.9972	8	0.24483	T	0.36	.	5.5276	0.16967	0.0:0.5047:0.2676:0.2277	.	354;354	P27816-4;E9PGM5	.;.	E	347;354;1764;354	ENSP00000373243:G347E;ENSP00000264724:G354E;ENSP00000407602:G1764E	ENSP00000264724:G354E	G	-	2	0	MAP4	47925675	0.000000	0.05858	0.074000	0.20217	0.574000	0.36063	0.407000	0.21049	0.064000	0.16427	-0.263000	0.10527	GGA	MAP4	-	NULL	ENSG00000047849		0.433	MAP4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MAP4	HGNC	protein_coding	OTTHUMT00000346085.1	-	0.00	78	0	C	NM_002375		47950671	-1	tier1	-	no_errors	ENST00000264724	ensembl	human	known	74_37	missense	11.54	23	3	SNP	0.010	T
MAS1L	116511	genome.wustl.edu	37	6	29455082	29455082	+	Frame_Shift_Del	DEL	G	G	-			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr6:29455082delG	ENST00000377127.3	-	1	656	c.598delC	c.(598-600)ctgfs	p.L200fs		NM_052967.1	NP_443199.1	P35410	MAS1L_HUMAN	MAS1 proto-oncogene like, G protein-coupled receptor	200					G-protein coupled receptor signaling pathway (GO:0007186)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(7)|ovary(7)|pancreas(1)|prostate(2)|skin(2)	28						CAAAAAGGCAGGCCCCAGATG	0.458																																					NSCLC(153;755 1987 3859 11251 32945)												0													64.0	58.0	60.0					6																	29455082		2203	4300	6503	SO:0001589	frameshift_variant	0			S78653	CCDS4661.1	6p22.1	2014-06-26	2014-06-26		ENSG00000204687	ENSG00000204687		"""GPCR / Class A : Orphans"""	13961	protein-coding gene	gene with protein product		607235	"""MAS1 oncogene-like"""				Standard	NM_052967		Approved	MAS-L, MRG, dJ994E9.2	uc011dlq.2	P35410	OTTHUMG00000031089	ENST00000377127.3:c.598delC	6.37:g.29455082delG	ENSP00000366331:p.Leu200fs		Q5SUN5	Frame_Shift_Del	DEL	pfam_GPCR_Rhodpsn,prints_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	p.L200fs	ENST00000377127.3	37	c.598	CCDS4661.1	6																																																																																			MAS1L	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000204687		0.458	MAS1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAS1L	HGNC	protein_coding	OTTHUMT00000076126.2		0.00	51	0	G	NM_052967		29455082	-1	tier1		no_errors	ENST00000377127	ensembl	human	known	74_37	frame_shift_del	10.53	17	2	DEL	0.008	-
MAST4	375449	genome.wustl.edu	37	5	66396405	66396405	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr5:66396405G>A	ENST00000403625.2	+	8	1350	c.1055G>A	c.(1054-1056)cGt>cAt	p.R352H	MAST4_ENST00000405643.1_Missense_Mutation_p.R173H|MAST4_ENST00000261569.7_Missense_Mutation_p.R158H|MAST4_ENST00000490016.2_Missense_Mutation_p.R163H|MAST4_ENST00000404260.3_Missense_Mutation_p.R355H|MAST4_ENST00000403666.1_Missense_Mutation_p.R163H	NM_001164664.1	NP_001158136.1	O15021	MAST4_HUMAN	microtubule associated serine/threonine kinase family member 4	355						cytoplasm (GO:0005737)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(1)|kidney(2)|lung(6)|ovary(2)	13		Lung NSC(167;8.56e-06)|Prostate(74;0.00637)|Ovarian(174;0.0563)|Breast(144;0.0586)|Colorectal(97;0.245)		Lung(70;0.011)		ATGCGCCCCCGTTCCCGAAGT	0.473																																																	0													73.0	75.0	75.0					5																	66396405		2056	4182	6238	SO:0001583	missense	0			AY830839	CCDS47224.1, CCDS47225.1, CCDS54861.1, CCDS75254.1	5q12.3	2007-06-20			ENSG00000069020	ENSG00000069020			19037	protein-coding gene	gene with protein product						9205841	Standard	NM_198828		Approved	KIAA0303	uc021xzk.1	O15021	OTTHUMG00000152471	ENST00000403625.2:c.1055G>A	5.37:g.66396405G>A	ENSP00000385727:p.Arg352His		A6NL49|B5ME48|Q05EE6|Q6ZN07|Q8N4X4|Q96LY3	Missense_Mutation	SNP	pfam_MA_Ser/Thr_Kinase_dom,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_PDZ,superfamily_Kinase-like_dom,superfamily_MAST_pre-PK_dom,superfamily_PDZ,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_PDZ,pfscan_PDZ,pfscan_Prot_kinase_dom	p.R355H	ENST00000403625.2	37	c.1064	CCDS54861.1	5	.	.	.	.	.	.	.	.	.	.	G	35	5.476616	0.96291	.	.	ENSG00000069020	ENST00000404260;ENST00000403625;ENST00000490016;ENST00000403666;ENST00000405643;ENST00000380908;ENST00000261569;ENST00000436277;ENST00000432399	T;T;T;T;T;T;T	0.47528	0.84;0.84;0.84;0.84;0.84;0.84;0.84	6.17	6.17	0.99709	Microtubule-associated serine/threonine-protein kinase, domain (1);	0.000000	0.64402	U	0.000006	T	0.78477	0.4289	M	0.92738	3.34	0.48830	D	0.999715	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;0.999;1.0;1.0;1.0	T	0.81797	-0.0768	10	0.87932	D	0	-8.329	20.8794	0.99867	0.0:0.0:1.0:0.0	.	173;355;158;163;163	E7EWQ5;O15021;O15021-2;O15021-3;D6RAK1	.;MAST4_HUMAN;.;.;.	H	355;352;163;163;173;173;158;158;158	ENSP00000385048:R355H;ENSP00000385727:R352H;ENSP00000421739:R163H;ENSP00000384313:R163H;ENSP00000384099:R173H;ENSP00000261569:R158H;ENSP00000392478:R158H	ENSP00000261569:R158H	R	+	2	0	MAST4	66432161	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.476000	0.97823	2.941000	0.99782	0.655000	0.94253	CGT	MAST4	-	pfam_MA_Ser/Thr_Kinase_dom	ENSG00000069020		0.473	MAST4-001	NOVEL	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	MAST4	HGNC	protein_coding	OTTHUMT00000326324.2		0.00	87	0	G			66396405	+1			no_errors	ENST00000404260	ensembl	human	known	74_37	missense	6.06	31	2	SNP	1.000	A
MBD4	8930	genome.wustl.edu	37	3	129151300	129151300	+	Intron	SNP	C	C	A			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr3:129151300C>A	ENST00000249910.1	-	7	1841				MBD4_ENST00000503197.1_Intron|MBD4_ENST00000429544.2_Intron|MBD4_ENST00000507208.1_Missense_Mutation_p.A571S|MBD4_ENST00000393278.2_Intron|MBD4_ENST00000509587.1_5'Flank	NM_003925.1	NP_003916.1	O95243	MBD4_HUMAN	methyl-CpG binding domain protein 4						base-excision repair (GO:0006284)|base-excision repair, AP site formation (GO:0006285)|depyrimidination (GO:0045008)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|mitotic G2 DNA damage checkpoint (GO:0007095)|response to radiation (GO:0009314)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	endodeoxyribonuclease activity (GO:0004520)|pyrimidine-specific mismatch base pair DNA N-glycosylase activity (GO:0008263)|satellite DNA binding (GO:0003696)			NS(1)|breast(1)|endometrium(2)|kidney(3)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)	22						ACTTATTTTGCCTCAGAGACC	0.428								Base excision repair (BER), DNA glycosylases																																									0													82.0	75.0	77.0					3																	129151300		2203	4300	6503	SO:0001627	intron_variant	0			AF072250	CCDS3058.1, CCDS63766.1, CCDS63767.1, CCDS63768.1, CCDS63769.1	3q21.3	2004-03-02			ENSG00000129071	ENSG00000129071			6919	protein-coding gene	gene with protein product		603574				9774669, 10097147	Standard	NM_003925		Approved	MED1	uc003emh.2	O95243	OTTHUMG00000159463	ENST00000249910.1:c.1665+45G>T	3.37:g.129151300C>A			B4DZN2|D3DNC3|D3DNC4|E9PEE4|Q2MD36|Q7Z4T3|Q96F09	Missense_Mutation	SNP	pfam_Methyl_CpG_DNA-bd,pfam_HhH-GPD_domain,superfamily_DNA-bd_dom,superfamily_DNA_glycosylase,smart_Methyl_CpG_DNA-bd,pirsf_Me_CpG-bd_MBD4,pfscan_Methyl_CpG_DNA-bd	p.A571S	ENST00000249910.1	37	c.1711	CCDS3058.1	3	.	.	.	.	.	.	.	.	.	.	C	18.17	3.565426	0.65651	.	.	ENSG00000129071	ENST00000507208	D	0.93076	-3.16	4.41	-0.178	0.13303	.	.	.	.	.	D	0.86410	0.5926	.	.	.	0.09310	N	0.999999	B	0.18461	0.028	B	0.16722	0.016	T	0.75631	-0.3251	8	0.87932	D	0	.	1.0609	0.01600	0.1527:0.4057:0.15:0.2916	.	571	E9PEE4	.	S	571	ENSP00000422327:A571S	ENSP00000422327:A571S	A	-	1	0	MBD4	130633990	0.000000	0.05858	0.003000	0.11579	0.640000	0.38277	-0.787000	0.04618	0.034000	0.15491	0.650000	0.86243	GCA	MBD4	-	NULL	ENSG00000129071		0.428	MBD4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MBD4	HGNC	protein_coding	OTTHUMT00000355529.1	-	0.00	55	0	C	NM_003925		129151300	-1	tier1	-	no_errors	ENST00000507208	ensembl	human	novel	74_37	missense	12.12	29	4	SNP	0.001	A
MCMDC2	157777	genome.wustl.edu	37	8	67796185	67796185	+	Silent	SNP	C	C	T			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr8:67796185C>T	ENST00000422365.2	+	9	1200	c.1029C>T	c.(1027-1029)tgC>tgT	p.C343C	MCMDC2_ENST00000541540.1_Silent_p.C280C|MCMDC2_ENST00000396592.3_Silent_p.C343C|MCMDC2_ENST00000492775.1_Silent_p.C343C|MCMDC2_ENST00000313616.5_Silent_p.C343C	NM_173518.4	NP_775789.3	Q4G0Z9	MCMD2_HUMAN	minichromosome maintenance domain containing 2	343					DNA replication (GO:0006260)		ATP binding (GO:0005524)|DNA binding (GO:0003677)	p.C338C(1)		endometrium(2)|kidney(2)|lung(5)	9						TGGAAGATTGCCTGGATATTT	0.353																																																	1	Substitution - coding silent(1)	large_intestine(1)											60.0	59.0	60.0					8																	67796185		2203	4300	6503	SO:0001819	synonymous_variant	0			BC034576	CCDS6197.2, CCDS47868.1, CCDS47869.1	8q13.1	2012-04-13	2012-04-13	2012-04-13	ENSG00000178460	ENSG00000178460			26368	protein-coding gene	gene with protein product			"""chromosome 8 open reading frame 45"""	C8orf45			Standard	NM_173518		Approved	FLJ25692	uc003xwz.4	Q4G0Z9	OTTHUMG00000157068	ENST00000422365.2:c.1029C>T	8.37:g.67796185C>T			B4DYZ3|B4DZM4|B4E293|Q6P533|Q7Z3P4	Silent	SNP	pfam_MCM_DNA-dep_ATPase,superfamily_NA-bd_OB-fold,superfamily_P-loop_NTPase,smart_MCM_DNA-dep_ATPase	p.C343	ENST00000422365.2	37	c.1029	CCDS6197.2	8																																																																																			MCMDC2	-	smart_MCM_DNA-dep_ATPase	ENSG00000178460		0.353	MCMDC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MCMDC2	HGNC	protein_coding	OTTHUMT00000347350.1		0.00	40	0	C	NM_173518		67796185	+1			no_errors	ENST00000422365	ensembl	human	known	74_37	silent	8.33	32	3	SNP	0.593	T
MED13	9969	genome.wustl.edu	37	17	60129928	60129928	+	Missense_Mutation	SNP	T	T	C			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr17:60129928T>C	ENST00000397786.2	-	3	516	c.440A>G	c.(439-441)tAt>tGt	p.Y147C		NM_005121.2	NP_005112.2	Q9UHV7	MED13_HUMAN	mediator complex subunit 13	147					androgen receptor signaling pathway (GO:0030521)|gene expression (GO:0010467)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|receptor activity (GO:0004872)|RNA polymerase II transcription cofactor activity (GO:0001104)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			breast(4)|central_nervous_system(1)|endometrium(10)|kidney(24)|large_intestine(15)|liver(1)|lung(20)|ovary(1)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	88						ATCTTTTTCATAAGGCTTTAC	0.328																																																	0													128.0	124.0	125.0					17																	60129928		1805	4080	5885	SO:0001583	missense	0			AB011165	CCDS42366.1	17q22-q23	2007-07-30	2007-07-30	2007-07-30		ENSG00000108510			22474	protein-coding gene	gene with protein product		603808	"""thyroid hormone receptor associated protein 1"""	THRAP1		1019863	Standard	NM_005121		Approved	KIAA0593, TRAP240	uc002izo.3	Q9UHV7		ENST00000397786.2:c.440A>G	17.37:g.60129928T>C	ENSP00000380888:p.Tyr147Cys		B2RU05|O60334	Missense_Mutation	SNP	pfam_Mediator_Med13,pfam_Mediator_Med13_N_met/fun	p.Y147C	ENST00000397786.2	37	c.440	CCDS42366.1	17	.	.	.	.	.	.	.	.	.	.	T	17.79	3.476889	0.63849	.	.	ENSG00000108510	ENST00000397786;ENST00000262436	T	0.78595	-1.19	5.53	5.53	0.82687	Mediator complex, subunit Med13, N-terminal, metazoa/fungi (1);	0.000000	0.85682	D	0.000000	D	0.84110	0.5400	L	0.45422	1.42	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.84963	0.0878	10	0.54805	T	0.06	-4.4312	15.9388	0.79736	0.0:0.0:0.0:1.0	.	147	Q9UHV7	MED13_HUMAN	C	147;146	ENSP00000380888:Y147C	ENSP00000262436:Y146C	Y	-	2	0	MED13	57484710	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.655000	0.83696	2.229000	0.72834	0.533000	0.62120	TAT	MED13	-	pfam_Mediator_Med13_N_met/fun	ENSG00000108510		0.328	MED13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MED13	HGNC	protein_coding	OTTHUMT00000445461.1	-	0.00	81	0	T	NM_005121		60129928	-1	tier1	-	no_errors	ENST00000397786	ensembl	human	known	74_37	missense	8.33	44	4	SNP	1.000	C
MED20	9477	genome.wustl.edu	37	6	41888792	41888792	+	5'UTR	SNP	A	A	G			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr6:41888792A>G	ENST00000265350.4	-	0	45				BYSL_ENST00000230340.4_5'Flank|MED20_ENST00000409060.1_5'UTR|MED20_ENST00000409312.1_5'UTR|MED20_ENST00000467535.1_5'Flank	NM_004275.3	NP_004266.2	Q9H944	MED20_HUMAN	mediator complex subunit 20						gene expression (GO:0010467)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)	mediator complex (GO:0016592)|nucleoplasm (GO:0005654)	DNA-directed RNA polymerase activity (GO:0003899)|RNA polymerase II transcription cofactor activity (GO:0001104)			haematopoietic_and_lymphoid_tissue(2)|large_intestine(1)|lung(1)|pancreas(1)	5	Colorectal(47;0.121)		STAD - Stomach adenocarcinoma(11;0.000204)|Epithelial(12;0.000367)|Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)			ATCACACAGTAGAAACGCAGG	0.567																																																	0													78.0	75.0	76.0					6																	41888792		2203	4300	6503	SO:0001623	5_prime_UTR_variant	0			AF097725	CCDS4862.1	6p21.1	2008-02-05	2007-07-30	2007-07-30	ENSG00000124641	ENSG00000124641			16840	protein-coding gene	gene with protein product		612915	"""Trf (TATA binding protein-related factor)-proximal homolog (Drosophila)"""	TRFP		9933582, 15175163	Standard	NM_004275		Approved	DKFZp586D2223, PRO0213	uc011dui.3	Q9H944	OTTHUMG00000014689	ENST00000265350.4:c.-36T>C	6.37:g.41888792A>G			B4DE08|O95821|Q5T8J4|Q9Y429	RNA	SNP	-	NULL	ENST00000265350.4	37	NULL	CCDS4862.1	6																																																																																			MED20	-	-	ENSG00000124641		0.567	MED20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MED20	HGNC	protein_coding	OTTHUMT00000040539.1	-	0.00	49	0	A	NM_004275		41888792	-1	tier1	-	no_errors	ENST00000482361	ensembl	human	known	74_37	rna	53.12	15	17	SNP	0.000	G
MIER3	166968	genome.wustl.edu	37	5	56234765	56234765	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr5:56234765G>T	ENST00000381199.3	-	4	270	c.260C>A	c.(259-261)gCa>gAa	p.A87E	MIER3_ENST00000381226.3_Missense_Mutation_p.A92E|MIER3_ENST00000381213.3_Missense_Mutation_p.A87E|AC016644.1_ENST00000438553.1_RNA|MIER3_ENST00000409421.1_Missense_Mutation_p.A24E			Q7Z3K6	MIER3_HUMAN	mesoderm induction early response 1, family member 3	87					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|liver(1)|lung(2)|urinary_tract(1)	19		Lung NSC(810;4.65e-05)|Prostate(74;0.0253)|Breast(144;0.0503)|Ovarian(174;0.223)		OV - Ovarian serous cystadenocarcinoma(10;1.24e-37)		GGAACTATTTGCACTGGAATT	0.418																																																	0													178.0	169.0	172.0					5																	56234765		2203	4300	6503	SO:0001583	missense	0			BX537798	CCDS3973.2, CCDS75248.1	5q11.2	2009-03-19			ENSG00000155545	ENSG00000155545			26678	protein-coding gene	gene with protein product						12477932	Standard	XM_005248448		Approved	FLJ35954, DKFZp686L09111, DKFZp781I1119	uc003jra.1	Q7Z3K6	OTTHUMG00000059589	ENST00000381199.3:c.260C>A	5.37:g.56234765G>T	ENSP00000370596:p.Ala87Glu		B4DRI9|B8ZZQ0|Q5CZI0|Q68CS3|Q6MZS7|Q86YG8|Q8NA13	Missense_Mutation	SNP	pfam_ELM2_dom,superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_ELM2_dom	p.A87E	ENST00000381199.3	37	c.260		5	.	.	.	.	.	.	.	.	.	.	G	17.92	3.507211	0.64410	.	.	ENSG00000155545	ENST00000381226;ENST00000381213;ENST00000381199;ENST00000409421;ENST00000336942	T;T;T;T;T	0.26223	1.75;1.75;1.75;1.75;1.75	5.63	5.63	0.86233	.	0.096990	0.64402	D	0.000001	T	0.20820	0.0501	N	0.16368	0.405	0.49915	D	0.999834	P;P;B	0.47910	0.675;0.902;0.264	B;P;B	0.46718	0.133;0.525;0.09	T	0.01566	-1.1323	10	0.02654	T	1	-23.3989	19.6818	0.95967	0.0:0.0:1.0:0.0	.	87;92;87	Q7Z3K6;Q7Z3K6-2;Q7Z3K6-3	MIER3_HUMAN;.;.	E	92;87;87;24;60	ENSP00000370624:A92E;ENSP00000370611:A87E;ENSP00000370596:A87E;ENSP00000386584:A24E;ENSP00000337027:A60E	ENSP00000337027:A60E	A	-	2	0	MIER3	56270522	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.366000	0.59492	2.650000	0.89964	0.563000	0.77884	GCA	MIER3	-	NULL	ENSG00000155545		0.418	MIER3-004	KNOWN	basic|appris_candidate	protein_coding	MIER3	HGNC	protein_coding	OTTHUMT00000132523.2	-	0.00	79	0	G	NM_152622		56234765	-1	tier1	-	no_errors	ENST00000381199	ensembl	human	known	74_37	missense	10.00	36	4	SNP	1.000	T
MKKS	8195	genome.wustl.edu	37	20	10388353	10388353	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr20:10388353G>T	ENST00000347364.3	-	5	1945	c.1183C>A	c.(1183-1185)Cat>Aat	p.H395N	MKKS_ENST00000399054.2_Missense_Mutation_p.H395N	NM_170784.2	NP_740754.1	Q9NPJ1	MKKS_HUMAN	McKusick-Kaufman syndrome	395					artery smooth muscle contraction (GO:0014824)|brain morphogenesis (GO:0048854)|cartilage development (GO:0051216)|cerebral cortex development (GO:0021987)|chaperone-mediated protein complex assembly (GO:0051131)|cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|convergent extension involved in gastrulation (GO:0060027)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|determination of left/right symmetry (GO:0007368)|fat cell differentiation (GO:0045444)|gonad development (GO:0008406)|heart development (GO:0007507)|heart looping (GO:0001947)|hippocampus development (GO:0021766)|intracellular transport (GO:0046907)|melanosome transport (GO:0032402)|negative regulation of appetite by leptin-mediated signaling pathway (GO:0038108)|negative regulation of blood pressure (GO:0045776)|negative regulation of gene expression (GO:0010629)|nonmotile primary cilium assembly (GO:0035058)|photoreceptor cell maintenance (GO:0045494)|pigment granule aggregation in cell center (GO:0051877)|positive regulation of multicellular organism growth (GO:0040018)|protein folding (GO:0006457)|regulation of cilium beat frequency involved in ciliary motility (GO:0060296)|sensory perception of smell (GO:0007608)|social behavior (GO:0035176)|spermatid development (GO:0007286)|striatum development (GO:0021756)|vasodilation (GO:0042311)|visual perception (GO:0007601)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|intracellular (GO:0005622)|motile cilium (GO:0031514)	ATP binding (GO:0005524)|RNA polymerase II repressing transcription factor binding (GO:0001103)|unfolded protein binding (GO:0051082)			kidney(2)|large_intestine(2)|lung(8)|prostate(1)|skin(1)|stomach(2)	16						TGCAGGACATGCAGTGCCGTC	0.418																																					Melanoma(79;1979 2212 6640)												0													110.0	80.0	90.0					20																	10388353		2203	4300	6503	SO:0001583	missense	0			AF221993	CCDS13111.1	20p12	2013-01-08			ENSG00000125863	ENSG00000125863		"""Heat Shock Proteins / Chaperonins"""	7108	protein-coding gene	gene with protein product		604896		BBS6		9467007	Standard	NR_072977		Approved		uc002wnu.2	Q9NPJ1	OTTHUMG00000031868	ENST00000347364.3:c.1183C>A	20.37:g.10388353G>T	ENSP00000246062:p.His395Asn		A8K7B0|D3DW18	Missense_Mutation	SNP	pfam_Cpn60/TCP-1,superfamily_Cpn60/TCP-1,superfamily_GroEL-like_apical_dom	p.H395N	ENST00000347364.3	37	c.1183	CCDS13111.1	20	.	.	.	.	.	.	.	.	.	.	G	19.48	3.834672	0.71373	.	.	ENSG00000125863	ENST00000347364;ENST00000399054	T;T	0.76968	-1.06;-1.06	6.04	5.08	0.68730	.	0.157901	0.56097	N	0.000029	T	0.80193	0.4578	M	0.61703	1.905	0.46260	D	0.998958	P	0.43826	0.818	P	0.48304	0.573	T	0.77376	-0.2611	10	0.22706	T	0.39	-15.9463	16.2669	0.82588	0.0:0.0:0.8663:0.1337	.	395	Q9NPJ1	MKKS_HUMAN	N	395	ENSP00000246062:H395N;ENSP00000382008:H395N	ENSP00000246062:H395N	H	-	1	0	MKKS	10336353	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	4.786000	0.62425	1.524000	0.49035	0.563000	0.77884	CAT	MKKS	-	pfam_Cpn60/TCP-1,superfamily_Cpn60/TCP-1	ENSG00000125863		0.418	MKKS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MKKS	HGNC	protein_coding	OTTHUMT00000077991.3	-	0.00	50	0	G			10388353	-1	tier1	-	no_errors	ENST00000347364	ensembl	human	known	74_37	missense	9.76	37	4	SNP	1.000	T
MLIP	90523	genome.wustl.edu	37	6	54002293	54002293	+	Intron	DEL	C	C	-			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr6:54002293delC	ENST00000274897.5	+	4	725				MLIP_ENST00000358276.5_Intron|MLIP_ENST00000509997.1_Intron|MLIP_ENST00000370876.2_Intron|MLIP_ENST00000514921.1_Frame_Shift_Del_p.P465fs|MLIP_ENST00000511744.1_3'UTR|MLIP_ENST00000370877.2_Intron|MLIP_ENST00000502396.1_Frame_Shift_Del_p.P476fs	NM_138569.2	NP_612636.2	Q5VWP3	MLIP_HUMAN	muscular LMNA-interacting protein							nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|PML body (GO:0016605)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(16)|ovary(8)|skin(4)|stomach(1)|urinary_tract(1)	34						AGCCGGGTCACCAGATCAAGG	0.532																																																	0																																										SO:0001627	intron_variant	0			AK055530	CCDS4954.1, CCDS64448.1, CCDS64449.1	6p12.2-p12.1	2011-04-29	2011-04-29	2011-04-29	ENSG00000146147	ENSG00000146147			21355	protein-coding gene	gene with protein product	"""muscle-enriched A-type lamin interacting protein"""	614106	"""chromosome 6 open reading frame 142"""	C6orf142		21498514	Standard	NM_138569		Approved	MGC18257	uc011dxa.2	Q5VWP3	OTTHUMG00000014891	ENST00000274897.5:c.613-11561C>-	6.37:g.54002293delC			B7Z2N0|D6RE05|Q96H08|Q96NF7	Frame_Shift_Del	DEL	NULL	p.P476fs	ENST00000274897.5	37	c.1426	CCDS4954.1	6																																																																																			MLIP	-	NULL	ENSG00000146147		0.532	MLIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MLIP	HGNC	protein_coding	OTTHUMT00000040979.3		0.00	59	0	C	NM_138569		54002293	+1	tier1		no_errors	ENST00000502396	ensembl	human	putative	74_37	frame_shift_del	10.53	17	2	DEL	0.424	-
MPV17	4358	genome.wustl.edu	37	2	27532772	27532772	+	3'UTR	SNP	A	A	G			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr2:27532772A>G	ENST00000380044.1	-	0	594				MPV17_ENST00000233545.2_3'UTR|MPV17_ENST00000405076.1_3'UTR|MPV17_ENST00000357186.6_3'UTR|UCN_ENST00000296099.2_5'Flank|MPV17_ENST00000402722.1_3'UTR|MPV17_ENST00000405983.1_3'UTR|MPV17_ENST00000402310.1_Silent_p.P162P	NM_002437.4	NP_002428.1	P39210	MPV17_HUMAN	MpV17 mitochondrial inner membrane protein						cellular response to reactive oxygen species (GO:0034614)|glomerular basement membrane development (GO:0032836)|homeostatic process (GO:0042592)|inner ear development (GO:0048839)|mitochondrial genome maintenance (GO:0000002)|reactive oxygen species metabolic process (GO:0072593)|regulation of reactive oxygen species metabolic process (GO:2000377)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|peroxisome (GO:0005777)				lung(4)	4	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CGATGGAGTGAGGCAGGCTTA	0.527																																																	0													132.0	95.0	108.0					2																	27532772		2203	4300	6503	SO:0001624	3_prime_UTR_variant	0				CCDS1748.1	2p23.3	2008-02-05	2006-05-12		ENSG00000115204	ENSG00000115204			7224	protein-coding gene	gene with protein product	"""glomerulosclerosis"""	137960	"""MpV17 transgene, murine homolog, glomerulosclerosis"""			8281143, 16582910	Standard	XM_005264326		Approved	SYM1	uc002rjs.3	P39210	OTTHUMG00000097074	ENST00000380044.1:c.*8T>C	2.37:g.27532772A>G			D6W555|Q53SY2|Q96B08	Silent	SNP	NULL	p.P162	ENST00000380044.1	37	c.486	CCDS1748.1	2																																																																																			MPV17	-	NULL	ENSG00000115204		0.527	MPV17-002	KNOWN	basic|appris_principal|CCDS	protein_coding	MPV17	HGNC	protein_coding	OTTHUMT00000214193.1	-	0.00	46	0	A	NM_002437		27532772	-1	tier1	-	no_errors	ENST00000402310	ensembl	human	novel	74_37	silent	9.76	37	4	SNP	0.007	G
MRPS18A	55168	genome.wustl.edu	37	6	43655404	43655404	+	Splice_Site	SNP	C	C	G			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr6:43655404C>G	ENST00000372133.3	-	1	124		c.e1+1		MRPS18A_ENST00000372116.1_Splice_Site	NM_018135.3	NP_060605.1	Q9NVS2	RT18A_HUMAN	mitochondrial ribosomal protein S18A						translation (GO:0006412)	mitochondrial small ribosomal subunit (GO:0005763)	structural constituent of ribosome (GO:0003735)			kidney(3)|large_intestine(1)	4	all_cancers(18;6.56e-06)|Lung NSC(15;0.00161)|all_lung(25;0.004)		all cancers(41;0.000479)|Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|STAD - Stomach adenocarcinoma(11;0.0102)|OV - Ovarian serous cystadenocarcinoma(102;0.137)			GCATGACTCACCTTCCCTGAA	0.632																																																	0													11.0	12.0	11.0					6																	43655404		2183	4256	6439	SO:0001630	splice_region_variant	0			AB049952	CCDS4906.1, CCDS55006.1	6p21.3	2012-09-13			ENSG00000096080	ENSG00000096080		"""Mitochondrial ribosomal proteins / small subunits"""	14515	protein-coding gene	gene with protein product		611981				11279123, 11543634	Standard	NM_018135		Approved	FLJ10548, MRPS18-3	uc003ovy.2	Q9NVS2	OTTHUMG00000014750	ENST00000372133.3:c.112+1G>C	6.37:g.43655404C>G			A6XND3|Q5QPA4	Splice_Site	SNP	-	e1+1	ENST00000372133.3	37	c.112+1	CCDS4906.1	6	.	.	.	.	.	.	.	.	.	.	C	20.5	3.999506	0.74818	.	.	ENSG00000096080	ENST00000372133;ENST00000372118;ENST00000372116;ENST00000427312	.	.	.	5.09	5.09	0.68999	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.8607	0.63559	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	MRPS18A	43763382	1.000000	0.71417	1.000000	0.80357	0.886000	0.51366	3.513000	0.53414	2.658000	0.90341	0.655000	0.94253	.	MRPS18A	-	-	ENSG00000096080		0.632	MRPS18A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	MRPS18A	HGNC	protein_coding	OTTHUMT00000040697.1		0.00	145	0	C	NM_018135	Intron	43655404	-1			no_errors	ENST00000372133	ensembl	human	known	74_37	splice_site	7.14	65	5	SNP	1.000	G
MST1R	4486	genome.wustl.edu	37	3	49933711	49933712	+	Frame_Shift_Ins	INS	-	-	A			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr3:49933711_49933712insA	ENST00000296474.3	-	10	2592_2593	c.2565_2566insT	c.(2563-2568)cctggcfs	p.G856fs	MST1R_ENST00000344206.4_Frame_Shift_Ins_p.G856fs	NM_002447.2	NP_002438	Q04912	RON_HUMAN	macrophage stimulating 1 receptor (c-met-related tyrosine kinase)	856	IPT/TIG 3.				cellular component movement (GO:0006928)|defense response (GO:0006952)|innate immune response (GO:0045087)|macrophage colony-stimulating factor signaling pathway (GO:0038145)|multicellular organismal development (GO:0007275)|positive regulation of cell proliferation (GO:0008284)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein kinase B signaling (GO:0051897)|response to virus (GO:0009615)|signal transduction (GO:0007165)|single fertilization (GO:0007338)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|stress fiber (GO:0001725)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|macrophage colony-stimulating factor receptor activity (GO:0005011)			cervix(1)|endometrium(5)|large_intestine(3)|lung(17)|ovary(5)|prostate(2)|skin(1)|urinary_tract(3)	37				BRCA - Breast invasive adenocarcinoma(193;4.65e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.00553)|Kidney(197;0.00625)		AAGCGAAAGCCAGGCAGTGTAA	0.574																																																	0																																										SO:0001589	frameshift_variant	0			X70040	CCDS2807.1, CCDS58833.1	3p21	2008-08-18			ENSG00000164078	ENSG00000164078		"""CD molecules"""	7381	protein-coding gene	gene with protein product		600168	"""PTK8 protein tyrosine kinase 8"""	RON, PTK8		8386824	Standard	NM_002447		Approved	CDw136, CD136	uc003cxy.4	Q04912	OTTHUMG00000156709	ENST00000296474.3:c.2566dupT	3.37:g.49933712_49933712dupA	ENSP00000296474:p.Gly856fs		B5A944|B5A945|B5A946|B5A947	Frame_Shift_Ins	INS	pirsf_Tyr_kinase_HGF/MSP_rcpt,pfam_Semap_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_IPT,superfamily_Semap_dom,superfamily_Kinase-like_dom,superfamily_Ig_E-set,superfamily_Plexin-like_fold,smart_Semap_dom,smart_Plexin-like_fold,smart_IPT,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Semap_dom,pfscan_Prot_kinase_dom	p.G855fs	ENST00000296474.3	37	c.2566_2565	CCDS2807.1	3																																																																																			MST1R	-	pirsf_Tyr_kinase_HGF/MSP_rcpt,superfamily_Ig_E-set,smart_IPT	ENSG00000164078		0.574	MST1R-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MST1R	HGNC	protein_coding	OTTHUMT00000345403.1		0.00	43	0	-			49933712	-1	tier1		no_errors	ENST00000296474	ensembl	human	known	74_37	frame_shift_ins	14.29	12	2	INS	0.073:0.000	A
MT-ND2	4536	genome.wustl.edu	37	M	1832	1832	+	5'Flank	SNP	A	A	T			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chrM:1832A>T	ENST00000361453.3	+	0	0				MT-ND1_ENST00000361390.2_5'Flank|MT-TF_ENST00000387314.1_RNA|MT-TI_ENST00000387365.1_RNA|MT-RNR1_ENST00000389680.2_RNA|MT-TM_ENST00000387377.1_RNA|MT-TL1_ENST00000386347.1_RNA|MT-TV_ENST00000387342.1_RNA|MT-RNR2_ENST00000387347.2_RNA|MT-TQ_ENST00000387372.1_RNA			P03891	NU2M_HUMAN	mitochondrially encoded NADH dehydrogenase 2						cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|reactive oxygen species metabolic process (GO:0072593)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(2)|lung(1)	3						AATATAGCAAGGACTAACCCC	0.388																																																	0																																										SO:0001631	upstream_gene_variant	0					mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198763	ENSG00000198763	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7456	protein-coding gene	gene with protein product	"""complex I ND2 subunit"", ""NADH-ubiquinone oxidoreductase chain 2"""	516001	"""NADH dehydrogenase 2"""	MTND2			Standard			Approved	ND2, NAD2		P03891			M.37:g.1832A>T	Exception_encountered		Q34769|Q9TGI0|Q9TGI1|Q9TGI2|Q9TGI3|Q9TGI4	RNA	SNP	-	NULL	ENST00000361453.3	37	NULL		MT																																																																																			MT-RNR2	-	-	ENSG00000210082		0.388	MT-ND2-201	KNOWN	basic|appris_principal	protein_coding	MT-RNR2	HGNC	protein_coding		-	0.00	15	0	A	YP_003024027		1832	+1	tier1	-	no_errors	ENST00000387347	ensembl	human	known	74_37	rna	28.57	5	2	SNP	NULL	T
MTTP	4547	genome.wustl.edu	37	4	100540133	100540133	+	Missense_Mutation	SNP	A	A	T			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr4:100540133A>T	ENST00000265517.5	+	16	2423	c.2220A>T	c.(2218-2220)gaA>gaT	p.E740D	MTTP_ENST00000457717.1_Missense_Mutation_p.E740D|RP11-766F14.1_ENST00000508578.1_RNA|MTTP_ENST00000511045.1_Missense_Mutation_p.E767D			P55157	MTP_HUMAN	microsomal triglyceride transfer protein	740					cholesterol homeostasis (GO:0042632)|lipid metabolic process (GO:0006629)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|protein lipidation (GO:0006497)|response to calcium ion (GO:0051592)|small molecule metabolic process (GO:0044281)|triglyceride metabolic process (GO:0006641)	basolateral plasma membrane (GO:0016323)|brush border membrane (GO:0031526)|endoplasmic reticulum lumen (GO:0005788)|Golgi apparatus (GO:0005794)|membrane-bounded vesicle (GO:0031988)|microvillus membrane (GO:0031528)|receptor complex (GO:0043235)|rough endoplasmic reticulum (GO:0005791)	lipid binding (GO:0008289)|lipid transporter activity (GO:0005319)			breast(3)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(14)|lung(19)|ovary(4)|prostate(5)|skin(1)|urinary_tract(1)	57				OV - Ovarian serous cystadenocarcinoma(123;6.04e-09)	Hesperetin(DB01094)|Lomitapide(DB08827)	TCTTCTAGGAACTTCAGTTAC	0.358																																																	0													106.0	109.0	108.0					4																	100540133		2203	4300	6503	SO:0001583	missense	0				CCDS3651.1, CCDS75169.1	4q24	2008-02-05	2005-11-04	2005-11-04	ENSG00000138823	ENSG00000138823			7467	protein-coding gene	gene with protein product		157147	"""microsomal triglyceride transfer protein (large polypeptide, 88kD)"", ""microsomal triglyceride transfer protein (large polypeptide, 88kDa)"""	MTP		8111381	Standard	XM_005263025		Approved	ABL	uc003hvc.4	P55157	OTTHUMG00000131023	ENST00000265517.5:c.2220A>T	4.37:g.100540133A>T	ENSP00000265517:p.Glu740Asp		A8K428|Q08AM4|Q6P5T3	Missense_Mutation	SNP	pfam_Lipid_transpt_N,superfamily_Vitellinogen_superhlx,superfamily_Lipid_transp_b-sht_shell,smart_Lipid_transpt_N,pfscan_Lipid_transpt_N	p.E740D	ENST00000265517.5	37	c.2220	CCDS3651.1	4	.	.	.	.	.	.	.	.	.	.	A	8.172	0.791890	0.16258	.	.	ENSG00000138823	ENST00000511045;ENST00000457717;ENST00000265517	T;T;T	0.61859	0.07;0.09;0.09	5.68	1.92	0.25849	.	0.307416	0.35235	N	0.003344	T	0.33352	0.0860	N	0.22421	0.69	0.24560	N	0.993976	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.14868	-1.0457	10	0.12430	T	0.62	-30.8072	4.1763	0.10353	0.3454:0.0:0.4027:0.2519	.	767;740	E9PBP6;P55157	.;MTP_HUMAN	D	767;740;740	ENSP00000427679:E767D;ENSP00000400821:E740D;ENSP00000265517:E740D	ENSP00000265517:E740D	E	+	3	2	MTTP	100759156	0.811000	0.29063	0.998000	0.56505	0.865000	0.49528	-0.075000	0.11431	0.041000	0.15688	-0.242000	0.12053	GAA	MTTP	-	NULL	ENSG00000138823		0.358	MTTP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTTP	HGNC	protein_coding	OTTHUMT00000253662.3	-	0.00	90	0	A			100540133	+1	tier1	-	no_errors	ENST00000265517	ensembl	human	known	74_37	missense	19.67	49	12	SNP	0.948	T
MUC4	4585	genome.wustl.edu	37	3	195508454	195508455	+	Frame_Shift_Ins	INS	-	-	C	rs201319965	byFrequency	TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr3:195508454_195508455insC	ENST00000463781.3	-	2	10455_10456	c.9996_9997insG	c.(9994-9999)accagcfs	p.S3333fs	MUC4_ENST00000475231.1_Frame_Shift_Ins_p.S3333fs|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.V3305_S3336delVSTGHATPLLVTDASSASTGHATPLHVTSPSS(1)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GAGGAAGGGCTGGTGACATGAA	0.594																																																	1	Deletion - In frame(1)	stomach(1)																																								SO:0001589	frameshift_variant	0			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.9996_9997insG	3.37:g.195508454_195508455insC	ENSP00000417498:p.Ser3333fs		O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Frame_Shift_Ins	INS	pfam_Nidogen_extracell_dom,pfam_AMOP,pfam_VWF_type-D,smart_Nidogen_extracell_dom,smart_AMOP,smart_VWF_type-D,smart_EG-like_dom,pfscan_AMOP,pfscan_EG-like_dom	p.S3332fs	ENST00000463781.3	37	c.9997_9996	CCDS54700.1	3																																																																																			MUC4	-	NULL	ENSG00000145113		0.594	MUC4-001	KNOWN	basic|CCDS	protein_coding	MUC4	HGNC	protein_coding	OTTHUMT00000324081.6		0.00	100	0	0	NM_018406		195508455	-1			no_errors	ENST00000463781	ensembl	human	known	74_37	frame_shift_ins	5.88	160	10	INS	0.512:0.562	C
MVP	9961	genome.wustl.edu	37	16	29845364	29845364	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr16:29845364G>A	ENST00000357402.5	+	5	692	c.554G>A	c.(553-555)cGg>cAg	p.R185Q	MVP_ENST00000395353.1_Missense_Mutation_p.R185Q|MVP_ENST00000452209.2_Intron	NM_005115.4|NM_017458.3	NP_005106.2|NP_059447.2	Q14764	MVP_HUMAN	major vault protein	185					cell proliferation (GO:0008283)|ERBB signaling pathway (GO:0038127)|mRNA transport (GO:0051028)|negative regulation of protein autophosphorylation (GO:0031953)|negative regulation of protein tyrosine kinase activity (GO:0061099)|negative regulation of signaling (GO:0023057)|protein activation cascade (GO:0072376)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear pore (GO:0005643)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|ribonucleoprotein complex (GO:0030529)	protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)			central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(7)|ovary(2)|skin(3)|soft_tissue(1)|stomach(1)	27						TGCTGGGACCGGGACGGCAAG	0.652																																																	0													41.0	35.0	37.0					16																	29845364		2197	4300	6497	SO:0001583	missense	0			X79882	CCDS10656.1	16p11.2	2012-04-25			ENSG00000013364	ENSG00000013364			7531	protein-coding gene	gene with protein product	"""lung resistance-related protein"""	605088				7585126	Standard	NM_005115		Approved	LRP, VAULT1	uc002dui.3	Q14764	OTTHUMG00000048227	ENST00000357402.5:c.554G>A	16.37:g.29845364G>A	ENSP00000349977:p.Arg185Gln		Q96BG4|Q9BPW6|Q9BQT1|Q9UBD1	Missense_Mutation	SNP	pfam_Vault_N,pfam_MVP_shoulder	p.R185Q	ENST00000357402.5	37	c.554	CCDS10656.1	16	.	.	.	.	.	.	.	.	.	.	G	27.6	4.845308	0.91197	.	.	ENSG00000013364	ENST00000357402;ENST00000395353	T;T	0.33438	1.41;1.41	5.95	5.95	0.96441	.	0.000000	0.85682	D	0.000000	T	0.65417	0.2689	M	0.91972	3.26	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.69669	-0.5083	10	0.49607	T	0.09	-1.0571	17.8657	0.88794	0.0:0.0:1.0:0.0	.	185	Q14764	MVP_HUMAN	Q	185	ENSP00000349977:R185Q;ENSP00000378760:R185Q	ENSP00000349977:R185Q	R	+	2	0	MVP	29752865	1.000000	0.71417	1.000000	0.80357	0.428000	0.31595	7.926000	0.87569	2.826000	0.97356	0.491000	0.48974	CGG	MVP	-	pfam_Vault_N	ENSG00000013364		0.652	MVP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MVP	HGNC	protein_coding	OTTHUMT00000109711.3	-	0.00	28	0	G	NM_005115		29845364	+1	tier1	-	no_errors	ENST00000357402	ensembl	human	known	74_37	missense	27.27	16	6	SNP	1.000	A
MYBPH	4608	genome.wustl.edu	37	1	203144850	203144850	+	Missense_Mutation	SNP	A	A	T			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr1:203144850A>T	ENST00000255416.4	-	1	91	c.34T>A	c.(34-36)Tgc>Agc	p.C12S		NM_004997.2	NP_004988.2	Q13203	MYBPH_HUMAN	myosin binding protein H	12					cell adhesion (GO:0007155)|regulation of striated muscle contraction (GO:0006942)	myosin filament (GO:0032982)	structural constituent of muscle (GO:0008307)			endometrium(5)|large_intestine(6)|lung(7)|skin(1)|urinary_tract(1)	20			BRCA - Breast invasive adenocarcinoma(75;0.153)	Colorectal(1306;0.0306)		TCTGGACTGCAGGCAGGGCCC	0.627																																					NSCLC(32;174 1025 14462 23899 42933)												0													66.0	76.0	73.0					1																	203144850		2203	4300	6503	SO:0001583	missense	0			BC044226	CCDS30975.1	1q32.1	2013-02-11	2001-11-28		ENSG00000133055	ENSG00000133055		"""Myosin binding proteins"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7552	protein-coding gene	gene with protein product		160795	"""myosin-binding protein H"""			8486381	Standard	NM_004997		Approved		uc001gzh.1	Q13203	OTTHUMG00000042121	ENST00000255416.4:c.34T>A	1.37:g.203144850A>T	ENSP00000255416:p.Cys12Ser		Q16886|Q86YC5	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.C12S	ENST00000255416.4	37	c.34	CCDS30975.1	1	.	.	.	.	.	.	.	.	.	.	A	1.748	-0.490073	0.04322	.	.	ENSG00000133055	ENST00000255416	T	0.44083	0.93	4.9	-0.349	0.12609	.	1.034180	0.07718	N	0.943211	T	0.21062	0.0507	N	0.19112	0.55	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.25293	-1.0136	10	0.06099	T	0.92	.	4.7559	0.13085	0.4827:0.3341:0.1831:0.0	.	12	Q13203	MYBPH_HUMAN	S	12	ENSP00000255416:C12S	ENSP00000255416:C12S	C	-	1	0	MYBPH	201411473	0.000000	0.05858	0.000000	0.03702	0.196000	0.23810	-0.435000	0.06931	-0.054000	0.13266	0.379000	0.24179	TGC	MYBPH	-	NULL	ENSG00000133055		0.627	MYBPH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYBPH	HGNC	protein_coding	OTTHUMT00000100264.1	-	0.00	100	0	A	NM_004997		203144850	-1	tier1	-	no_errors	ENST00000255416	ensembl	human	known	74_37	missense	5.13	74	4	SNP	0.000	T
MYH6	4624	genome.wustl.edu	37	14	23871799	23871799	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr14:23871799C>T	ENST00000356287.3	-	11	1044	c.1015G>A	c.(1015-1017)Gtg>Atg	p.V339M	MYH6_ENST00000405093.3_Missense_Mutation_p.V339M			P13533	MYH6_HUMAN	myosin, heavy chain 6, cardiac muscle, alpha	339	Myosin motor.				adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|atrial cardiac muscle tissue morphogenesis (GO:0055009)|BMP signaling pathway (GO:0030509)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle fiber development (GO:0048739)|in utero embryonic development (GO:0001701)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|myofibril assembly (GO:0030239)|regulation of ATPase activity (GO:0043462)|regulation of blood pressure (GO:0008217)|regulation of heart contraction (GO:0008016)|regulation of heart growth (GO:0060420)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|sarcomere organization (GO:0045214)|striated muscle contraction (GO:0006941)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visceral muscle development (GO:0007522)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin complex (GO:0016459)|myosin filament (GO:0032982)|nucleus (GO:0005634)|sarcomere (GO:0030017)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|protein kinase binding (GO:0019901)			breast(4)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(16)|liver(1)|lung(60)|ovary(2)|pancreas(3)|prostate(6)|skin(6)|stomach(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	119	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00764)|READ - Rectum adenocarcinoma(4;0.0289)|Colorectal(4;0.0441)		AAGCCCAGCACGTCAAAGGCA	0.617																																																	0													89.0	85.0	86.0					14																	23871799		2203	4300	6503	SO:0001583	missense	0			D00943	CCDS9600.1	14q11.2-q13	2014-09-17	2008-08-01		ENSG00000197616	ENSG00000197616		"""Myosins / Myosin superfamily : Class II"""	7576	protein-coding gene	gene with protein product	"""cardiomyopathy, hypertrophic 1"""	160710	"""myosin, heavy polypeptide 6, cardiac muscle, alpha (cardiomyopathy, hypertrophic 1)"""			2144212	Standard	NM_002471		Approved		uc001wjv.3	P13533	OTTHUMG00000028753	ENST00000356287.3:c.1015G>A	14.37:g.23871799C>T	ENSP00000348634:p.Val339Met		A2RTX1|D9YZU2|Q13943|Q14906|Q14907	Missense_Mutation	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_P-loop_NTPase,superfamily_Prefoldin,smart_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.V339M	ENST00000356287.3	37	c.1015	CCDS9600.1	14	.	.	.	.	.	.	.	.	.	.	.	16.39	3.109921	0.56398	.	.	ENSG00000197616	ENST00000405093;ENST00000356287	T;T	0.73363	-0.74;-0.74	3.83	2.84	0.33178	Myosin head, motor domain (2);	.	.	.	.	T	0.80560	0.4646	M	0.87180	2.865	0.46586	D	0.99911	P;P	0.47677	0.899;0.899	P;P	0.51229	0.663;0.663	T	0.82532	-0.0410	9	0.87932	D	0	.	7.2292	0.26033	0.1692:0.733:0.0:0.0977	.	339;339	D9YZU2;P13533	.;MYH6_HUMAN	M	339	ENSP00000386041:V339M;ENSP00000348634:V339M	ENSP00000348634:V339M	V	-	1	0	MYH6	22941639	0.021000	0.18746	0.991000	0.47740	0.787000	0.44495	0.342000	0.19926	1.869000	0.54173	0.313000	0.20887	GTG	MYH6	-	pfam_Myosin_head_motor_dom,superfamily_P-loop_NTPase,smart_Myosin_head_motor_dom	ENSG00000197616		0.617	MYH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH6	HGNC	protein_coding	OTTHUMT00000071796.3	-	0.00	45	0	C			23871799	-1	tier1	-	no_errors	ENST00000356287	ensembl	human	known	74_37	missense	50.00	14	14	SNP	0.970	T
MYPN	84665	genome.wustl.edu	37	10	69934313	69934313	+	Missense_Mutation	SNP	C	C	T	rs529221329		TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr10:69934313C>T	ENST00000358913.5	+	11	2952	c.2464C>T	c.(2464-2466)Cgg>Tgg	p.R822W	MYPN_ENST00000540630.1_Missense_Mutation_p.R822W|MYPN_ENST00000354393.2_Missense_Mutation_p.R547W	NM_001256267.1|NM_032578.3	NP_001243196.1|NP_115967.2	Q86TC9	MYPN_HUMAN	myopalladin	822	Pro-rich.				sarcomere organization (GO:0045214)	I band (GO:0031674)|nucleus (GO:0005634)|Z disc (GO:0030018)	cytoskeletal protein binding (GO:0008092)|muscle alpha-actinin binding (GO:0051371)|SH3 domain binding (GO:0017124)			breast(2)|central_nervous_system(1)|endometrium(13)|kidney(6)|large_intestine(13)|liver(1)|lung(43)|ovary(3)|prostate(1)|skin(6)|upper_aerodigestive_tract(5)	94						TCCTACCAGCCGGATTCAGAA	0.557																																																	0													111.0	105.0	107.0					10																	69934313		2203	4300	6503	SO:0001583	missense	0			AL834247	CCDS7275.1, CCDS73142.1	10q22.1	2014-09-17			ENSG00000138347	ENSG00000138347		"""Immunoglobulin superfamily / I-set domain containing"""	23246	protein-coding gene	gene with protein product	"""sarcomeric protein myopalladin, 145 kDa"""	608517				11309420, 12482578	Standard	NM_032578		Approved	MYOP	uc001jnm.5	Q86TC9	OTTHUMG00000018344	ENST00000358913.5:c.2464C>T	10.37:g.69934313C>T	ENSP00000351790:p.Arg822Trp		Q5VV35|Q5VV36|Q86T37|Q8N3L4|Q96K90|Q96KF5	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.R822W	ENST00000358913.5	37	c.2464	CCDS7275.1	10	.	.	.	.	.	.	.	.	.	.	C	15.18	2.756830	0.49362	.	.	ENSG00000138347	ENST00000354393;ENST00000542332;ENST00000358913;ENST00000540630	T;T;T	0.60299	0.2;0.3;0.28	5.86	3.94	0.45596	.	0.281026	0.35378	N	0.003250	T	0.32496	0.0831	N	0.08118	0	0.29922	N	0.822681	B;B;B	0.25007	0.116;0.116;0.039	B;B;B	0.16722	0.016;0.016;0.005	T	0.20505	-1.0273	9	.	.	.	.	10.4164	0.44325	0.2391:0.6971:0.0:0.0638	.	822;547;822	F5GWA6;Q86TC9-2;Q86TC9	.;.;MYPN_HUMAN	W	547;547;822;822	ENSP00000346369:R547W;ENSP00000351790:R822W;ENSP00000441668:R822W	.	R	+	1	2	MYPN	69604319	1.000000	0.71417	0.996000	0.52242	0.990000	0.78478	2.909000	0.48758	1.473000	0.48159	0.655000	0.94253	CGG	MYPN	-	NULL	ENSG00000138347		0.557	MYPN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MYPN	HGNC	protein_coding	OTTHUMT00000048307.1	-	0.00	35	0	C	NM_032578		69934313	+1	tier1	-	no_errors	ENST00000358913	ensembl	human	known	74_37	missense	20.00	24	6	SNP	0.999	T
NAV2	89797	genome.wustl.edu	37	11	20067059	20067059	+	Missense_Mutation	SNP	A	A	G			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr11:20067059A>G	ENST00000396087.3	+	15	3913	c.3814A>G	c.(3814-3816)Aca>Gca	p.T1272A	NAV2_ENST00000540292.1_Missense_Mutation_p.T1203A|NAV2_ENST00000527559.2_Missense_Mutation_p.T1201A|NAV2_ENST00000311043.8_Missense_Mutation_p.T335A|NAV2_ENST00000533917.1_Missense_Mutation_p.T335A|NAV2_ENST00000396085.1_Missense_Mutation_p.T1249A|NAV2-AS2_ENST00000533767.1_RNA|NAV2_ENST00000360655.4_Missense_Mutation_p.T1185A|NAV2_ENST00000349880.4_Missense_Mutation_p.T1249A	NM_001244963.1	NP_001231892.1	Q8IVL1	NAV2_HUMAN	neuron navigator 2	1272					glossopharyngeal nerve development (GO:0021563)|locomotory behavior (GO:0007626)|optic nerve development (GO:0021554)|regulation of systemic arterial blood pressure by baroreceptor feedback (GO:0003025)|sensory perception of smell (GO:0007608)|sensory perception of sound (GO:0007605)|vagus nerve development (GO:0021564)	interstitial matrix (GO:0005614)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|heparin binding (GO:0008201)			NS(1)|breast(2)|central_nervous_system(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(26)|lung(38)|ovary(3)|pancreas(1)|prostate(7)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	116						GGTCAACCAAACAGACAAGGA	0.552																																																	0													66.0	63.0	64.0					11																	20067059		2203	4300	6503	SO:0001583	missense	0			AB037840	CCDS7850.1, CCDS7851.2, CCDS44552.1, CCDS53612.1, CCDS58126.1	11p15.1	2008-07-18			ENSG00000166833	ENSG00000166833	3.6.1.1		15997	protein-coding gene	gene with protein product	"""pore membrane and/or filament interacting like protein 2"", ""retinoic acid inducible gene in neuroblastoma 1"", ""helicase, APC down-regulated 1"""	607026				12079279, 12062803	Standard	NM_145117		Approved	FLJ10633, FLJ11030, HELAD1, KIAA1419, POMFIL2, RAINB1, FLJ23707	uc010rdm.2	Q8IVL1	OTTHUMG00000151837	ENST00000396087.3:c.3814A>G	11.37:g.20067059A>G	ENSP00000379396:p.Thr1272Ala		A6NEC1|Q8IVK3|Q8IVK4|Q8IVK5|Q8IVK6|Q8IVK7|Q8IVK8|Q8NHC9|Q8NHD0|Q8TDE9|Q8TDF0|Q8TEB3|Q96B30|Q9NUZ6|Q9NVM7|Q9P2C8	Missense_Mutation	SNP	pfam_CH-domain,superfamily_CH-domain,superfamily_P-loop_NTPase,smart_CH-domain,smart_AAA+_ATPase,pfscan_CH-domain	p.T1272A	ENST00000396087.3	37	c.3814	CCDS58126.1	11	.	.	.	.	.	.	.	.	.	.	A	25.9	4.683951	0.88639	.	.	ENSG00000166833	ENST00000360655;ENST00000396085;ENST00000349880;ENST00000396087;ENST00000527559;ENST00000540292;ENST00000533917;ENST00000525322;ENST00000311043;ENST00000536595	T;T;T;T;T;T;T;T;T	0.62941	0.55;0.63;0.64;0.06;-0.01;-0.01;2.37;0.95;2.37	5.91	5.91	0.95273	.	0.000000	0.64402	D	0.000002	T	0.78457	0.4286	M	0.72894	2.215	0.80722	D	1	D;D;D;D;D	0.89917	0.999;0.996;0.997;1.0;0.999	D;D;D;D;D	0.91635	0.993;0.987;0.99;0.999;0.995	T	0.78666	-0.2115	9	.	.	.	.	16.3453	0.83126	1.0:0.0:0.0:0.0	.	1272;335;335;1249;1185	Q8IVL1;Q8IVL1-5;E9PNV5;Q8IVL1-3;Q8IVL1-4	NAV2_HUMAN;.;.;.;.	A	1185;1249;1249;1272;1201;1203;335;335;335;335	ENSP00000353871:T1185A;ENSP00000379394:T1249A;ENSP00000309577:T1249A;ENSP00000379396:T1272A;ENSP00000435395:T1201A;ENSP00000443489:T1203A;ENSP00000437316:T335A;ENSP00000437136:T335A;ENSP00000312169:T335A	.	T	+	1	0	NAV2	20023635	1.000000	0.71417	0.999000	0.59377	0.955000	0.61496	9.108000	0.94275	2.261000	0.74972	0.533000	0.62120	ACA	NAV2	-	NULL	ENSG00000166833		0.552	NAV2-001	KNOWN	basic|CCDS	protein_coding	NAV2	HGNC	protein_coding	OTTHUMT00000324112.1	-	0.00	33	0	A	NM_145117		20067059	+1	tier1	-	no_errors	ENST00000396087	ensembl	human	known	74_37	missense	25.81	23	8	SNP	1.000	G
NEK2	4751	genome.wustl.edu	37	1	211846999	211846999	+	Silent	SNP	G	G	A			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr1:211846999G>A	ENST00000366999.4	-	3	519	c.381C>T	c.(379-381)tgC>tgT	p.C127C	NEK2_ENST00000462283.1_5'Flank|NEK2_ENST00000366998.3_Silent_p.C127C|RP11-122M14.1_ENST00000415202.1_RNA|NEK2_ENST00000540251.1_Silent_p.C84C	NM_002497.3	NP_002488.1	P51955	NEK2_HUMAN	NIMA-related kinase 2	127	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				blastocyst development (GO:0001824)|centrosome separation (GO:0051299)|chromosome segregation (GO:0007059)|G2/M transition of mitotic cell cycle (GO:0000086)|meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic sister chromatid segregation (GO:0000070)|negative regulation of centriole-centriole cohesion (GO:1903126)|negative regulation of DNA binding (GO:0043392)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of mitosis (GO:0007088)|regulation of mitotic centrosome separation (GO:0046602)|spindle assembly (GO:0051225)|spindle assembly involved in mitosis (GO:0090307)	centrosome (GO:0005813)|condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intercellular bridge (GO:0045171)|kinetochore (GO:0000776)|microtubule (GO:0005874)|midbody (GO:0030496)|nucleus (GO:0005634)|protein complex (GO:0043234)|spindle pole (GO:0000922)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein phosphatase binding (GO:0019903)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|stomach(1)	3				OV - Ovarian serous cystadenocarcinoma(81;0.00203)|all cancers(67;0.0339)|Epithelial(68;0.0546)		TTCGTCTGTGGCATTCCTTCA	0.443																																																	0													99.0	83.0	89.0					1																	211846999		2203	4300	6503	SO:0001819	synonymous_variant	0			U11050	CCDS1500.1, CCDS55682.1, CCDS73024.1	1q32.3	2014-06-12	2012-11-15		ENSG00000117650	ENSG00000117650			7745	protein-coding gene	gene with protein product	"""HsPK 21"", ""protein phosphatase 1, regulatory subunit 111"""	604043	"""NIMA (never in mitosis gene a)-related kinase 2"""			8274451, 24043777	Standard	NM_002497		Approved	NLK1, NEK2A, RP67, PPP1R111	uc001hir.2	P51955	OTTHUMG00000037121	ENST00000366999.4:c.381C>T	1.37:g.211846999G>A			Q53FD6|Q5I1Z9|Q5VXZ1|Q6NZX8|Q7Z634|Q86XH2|Q96QN9	Silent	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Tyr_kinase_cat_dom,smart_Ser/Thr_dual-sp_kinase_dom,pfscan_Prot_kinase_dom	p.C84	ENST00000366999.4	37	c.252	CCDS1500.1	1																																																																																			NEK2	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Tyr_kinase_cat_dom,smart_Ser/Thr_dual-sp_kinase_dom,pfscan_Prot_kinase_dom	ENSG00000117650		0.443	NEK2-001	NOVEL	basic|appris_principal|CCDS	protein_coding	NEK2	HGNC	protein_coding	OTTHUMT00000090154.1		0.00	52	0	G	NM_002497		211846999	-1			no_errors	ENST00000540251	ensembl	human	known	74_37	silent	8.00	45	4	SNP	1.000	A
NEO1	4756	genome.wustl.edu	37	15	73590734	73590734	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr15:73590734C>T	ENST00000339362.5	+	28	4394	c.3947C>T	c.(3946-3948)tCg>tTg	p.S1316L	NEO1_ENST00000261908.6_Missense_Mutation_p.S1316L|NEO1_ENST00000558964.1_Missense_Mutation_p.S1305L|NEO1_ENST00000560262.1_Missense_Mutation_p.S1263L			Q92859	NEO1_HUMAN	neogenin 1	1316					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|iron ion homeostasis (GO:0055072)|muscle cell differentiation (GO:0042692)|myoblast fusion (GO:0007520)|positive regulation of muscle cell differentiation (GO:0051149)|regulation of transcription, DNA-templated (GO:0006355)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			NS(1)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(3)|large_intestine(9)|lung(26)|pancreas(2)|prostate(1)|skin(3)|urinary_tract(2)	57						CCAGCCTCTTCGTCTCAAACA	0.493																																																	0													93.0	88.0	89.0					15																	73590734		2198	4297	6495	SO:0001583	missense	0			U61262	CCDS10247.1, CCDS53957.1, CCDS58378.1	15q22.3-q23	2014-06-20	2010-06-24		ENSG00000067141	ENSG00000067141		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7754	protein-coding gene	gene with protein product	"""immunoglobulin superfamily, DCC subclass, member 2"""	601907	"""neogenin (chicken) homolog 1"""			9121761	Standard	NM_002499		Approved	NGN, HsT17534, IGDCC2, NTN1R2	uc002avm.4	Q92859	OTTHUMG00000133509	ENST00000339362.5:c.3947C>T	15.37:g.73590734C>T	ENSP00000341198:p.Ser1316Leu		B7ZKM9|B7ZKN0|O00340|Q17RX1	Missense_Mutation	SNP	pfam_Neogenin_C,pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.S1316L	ENST00000339362.5	37	c.3947	CCDS10247.1	15	.	.	.	.	.	.	.	.	.	.	C	20.8	4.049018	0.75846	.	.	ENSG00000067141	ENST00000339362;ENST00000379842;ENST00000261908	T	0.44881	0.91	5.22	5.22	0.72569	Neogenin, C-terminal (1);	0.121933	0.56097	D	0.000022	T	0.54481	0.1861	L	0.54323	1.7	0.58432	D	0.999997	P;B;D;D	0.61697	0.726;0.02;0.973;0.99	B;B;P;P	0.54499	0.189;0.016;0.616;0.754	T	0.57435	-0.7812	10	0.62326	D	0.03	-7.4355	18.3946	0.90494	0.0:1.0:0.0:0.0	.	1263;1305;1027;1316	B7ZKM9;B7ZKN0;E7EUX3;Q92859	.;.;.;NEO1_HUMAN	L	1263;1027;1316	ENSP00000261908:S1316L	ENSP00000261908:S1316L	S	+	2	0	NEO1	71377787	1.000000	0.71417	0.993000	0.49108	0.910000	0.53928	5.412000	0.66392	2.443000	0.82685	0.655000	0.94253	TCG	NEO1	-	pfam_Neogenin_C	ENSG00000067141		0.493	NEO1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NEO1	HGNC	protein_coding	OTTHUMT00000257472.2		0.00	69	0	C	NM_002499		73590734	+1			no_errors	ENST00000261908	ensembl	human	known	74_37	missense	6.25	30	2	SNP	1.000	T
NFE2L2	4780	genome.wustl.edu	37	2	178098804	178098804	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr2:178098804C>T	ENST00000397062.3	-	2	795	c.241G>A	c.(241-243)Ggt>Agt	p.G81S	NFE2L2_ENST00000464747.1_Missense_Mutation_p.G65S|NFE2L2_ENST00000397063.4_Missense_Mutation_p.G65S|NFE2L2_ENST00000423513.1_Missense_Mutation_p.G65S|NFE2L2_ENST00000446151.2_Missense_Mutation_p.G65S	NM_006164.4	NP_006155.2	Q16236	NF2L2_HUMAN	nuclear factor, erythroid 2-like 2	81					cellular response to hydrogen peroxide (GO:0070301)|cellular response to laminar fluid shear stress (GO:0071499)|cellular response to tumor necrosis factor (GO:0071356)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902176)|positive regulation of blood coagulation (GO:0030194)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to stress (GO:0036003)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination (GO:0016567)|regulation of embryonic development (GO:0045995)|regulation of removal of superoxide radicals (GO:2000121)|transcription from RNA polymerase II promoter (GO:0006366)	centrosome (GO:0005813)|chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|protein domain specific binding (GO:0019904)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.G81S(2)|p.G81_F83delGEF(1)|p.G81C(1)		central_nervous_system(1)|cervix(4)|endometrium(14)|kidney(5)|large_intestine(4)|liver(13)|lung(71)|oesophagus(29)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	158			Epithelial(96;0.00442)|OV - Ovarian serous cystadenocarcinoma(117;0.00739)|all cancers(119;0.0195)|LUSC - Lung squamous cell carcinoma(2;0.036)|Lung(16;0.0935)			AGAAATTCACCTGTCTCTTCA	0.438			Mis		"""NSCLC, HNSCC"""					HNSCC(56;0.16)																														Dom	yes		2	2q31	4780	nuclear factor (erythroid-derived 2)-like 2 (NRF2)		E	4	Substitution - Missense(3)|Deletion - In frame(1)	lung(2)|liver(1)|endometrium(1)											143.0	142.0	142.0					2																	178098804		1901	4105	6006	SO:0001583	missense	0				CCDS42782.1, CCDS46457.1, CCDS46458.1	2q31	2013-08-23	2013-08-23		ENSG00000116044	ENSG00000116044		"""basic leucine zipper proteins"""	7782	protein-coding gene	gene with protein product	"""NF-E2-related factor 2"""	600492	"""nuclear factor (erythroid-derived 2)-like 2"""			7937919	Standard	NM_006164		Approved	NRF2	uc002ulh.5	Q16236	OTTHUMG00000133620	ENST00000397062.3:c.241G>A	2.37:g.178098804C>T	ENSP00000380252:p.Gly81Ser		B2RBU2|B4E338|E9PGJ7|Q53RW6|Q59HH2|Q96F71	Missense_Mutation	SNP	pfam_bZIP,superfamily_TF_DNA-bd,superfamily_Serpin_dom,smart_bZIP,pfscan_bZIP	p.G81S	ENST00000397062.3	37	c.241	CCDS42782.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	20.4|20.4	3.986306|3.986306	0.74589|0.74589	.|.	.|.	ENSG00000116044|ENSG00000116044	ENST00000449627|ENST00000397063;ENST00000397062;ENST00000446151;ENST00000448782;ENST00000421929;ENST00000423513	T|T;T;T;T;T;T	0.29397|0.52057	1.57|1.22;1.22;1.22;0.68;0.68;1.22	5.78|5.78	5.78|5.78	0.91487|0.91487	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.75064|0.75064	0.3799|0.3799	M|M	0.87180|0.87180	2.865|2.865	0.80722|0.80722	D|D	1|1	.|D;D;D;D	.|0.89917	.|1.0;1.0;1.0;1.0	.|D;D;D;D	.|0.97110	.|0.999;0.998;1.0;0.999	T|T	0.78275|0.78275	-0.2267|-0.2267	7|10	0.23891|0.72032	T|D	0.37|0.01	.|.	19.9976|19.9976	0.97389|0.97389	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|65;65;65;81	.|E9PGJ7;B4DNB0;C9JFL6;Q16236	.|.;.;.;NF2L2_HUMAN	T|S	65|65;81;65;65;65;65	ENSP00000391590:A65T|ENSP00000380253:G65S;ENSP00000380252:G81S;ENSP00000411575:G65S;ENSP00000400073:G65S;ENSP00000412191:G65S;ENSP00000410015:G65S	ENSP00000391590:A65T|ENSP00000380252:G81S	A|G	-|-	1|1	0|0	NFE2L2|NFE2L2	177807050|177807050	1.000000|1.000000	0.71417|0.71417	0.994000|0.994000	0.49952|0.49952	0.995000|0.995000	0.86356|0.86356	7.298000|7.298000	0.78815|0.78815	2.737000|2.737000	0.93849|0.93849	0.563000|0.563000	0.77884|0.77884	GCA|GGT	NFE2L2	-	NULL	ENSG00000116044		0.438	NFE2L2-001	KNOWN	basic|CCDS	protein_coding	NFE2L2	HGNC	protein_coding	OTTHUMT00000257752.4	-	0.00	90	0	C	NM_006164		178098804	-1	tier1	-	no_errors	ENST00000397062	ensembl	human	known	74_37	missense	28.24	61	24	SNP	1.000	T
NEU2	4759	genome.wustl.edu	37	2	233897431	233897431	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr2:233897431C>T	ENST00000233840.3	+	1	50	c.50C>T	c.(49-51)gCc>gTc	p.A17V		NM_005383.2	NP_005374.2	Q9Y3R4	NEUR2_HUMAN	sialidase 2 (cytosolic sialidase)	17					ganglioside catabolic process (GO:0006689)|glycosphingolipid metabolic process (GO:0006687)|oligosaccharide catabolic process (GO:0009313)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	exo-alpha-(2->3)-sialidase activity (GO:0052794)|exo-alpha-(2->6)-sialidase activity (GO:0052795)|exo-alpha-(2->8)-sialidase activity (GO:0052796)			endometrium(3)|large_intestine(2)|lung(10)|skin(2)|urinary_tract(1)	18		Breast(86;0.00279)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0271)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0839)		Epithelial(121;7.17e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000311)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00942)|GBM - Glioblastoma multiforme(43;0.0488)	Oseltamivir(DB00198)|Zanamivir(DB00558)	CAGTCGGGAGCCCATGCCTAC	0.627																																																	0													134.0	113.0	120.0					2																	233897431		2203	4300	6503	SO:0001583	missense	0			Y16535	CCDS2501.1	2q37	2008-05-27			ENSG00000115488	ENSG00000115488			7759	protein-coding gene	gene with protein product	"""N-acetyl-alpha-neuraminidase 2"""	605528				10191093, 14613940	Standard	NM_005383		Approved	SIAL2	uc010zmn.2	Q9Y3R4	OTTHUMG00000133274	ENST00000233840.3:c.50C>T	2.37:g.233897431C>T	ENSP00000233840:p.Ala17Val		Q3KNW4|Q6NTB4	Missense_Mutation	SNP	superfamily_Sialidases	p.A17V	ENST00000233840.3	37	c.50	CCDS2501.1	2	.	.	.	.	.	.	.	.	.	.	C	13.92	2.381399	0.42207	.	.	ENSG00000115488	ENST00000233840	D	0.82526	-1.62	5.48	0.0849	0.14439	Neuraminidase (2);	0.905275	0.09399	N	0.807451	T	0.63319	0.2501	N	0.13043	0.29	0.09310	N	1	B	0.12630	0.006	B	0.04013	0.001	T	0.43327	-0.9398	10	0.16420	T	0.52	-6.5071	3.3107	0.07016	0.2931:0.3565:0.27:0.0804	.	17	Q9Y3R4	NEUR2_HUMAN	V	17	ENSP00000233840:A17V	ENSP00000233840:A17V	A	+	2	0	NEU2	233605675	0.000000	0.05858	0.000000	0.03702	0.683000	0.39861	-0.644000	0.05415	-0.333000	0.08476	0.655000	0.94253	GCC	NEU2	-	superfamily_Sialidases	ENSG00000115488		0.627	NEU2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NEU2	HGNC	protein_coding	OTTHUMT00000257053.2	-	0.00	29	0	C	NM_005383		233897431	+1	tier1	-	no_errors	ENST00000233840	ensembl	human	known	74_37	missense	23.53	13	4	SNP	0.007	T
NOTCH4	4855	genome.wustl.edu	37	6	32183074	32183074	+	Silent	SNP	G	G	C			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr6:32183074G>C	ENST00000375023.3	-	12	2088	c.1950C>G	c.(1948-1950)ctC>ctG	p.L650L	NOTCH4_ENST00000465528.1_5'Flank	NM_004557.3	NP_004548.3	Q99466	NOTC4_HUMAN	notch 4	650	EGF-like 16. {ECO:0000255|PROSITE- ProRule:PRU00076}.				cell differentiation (GO:0030154)|cell fate determination (GO:0001709)|embryo development (GO:0009790)|endothelial cell morphogenesis (GO:0001886)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|mammary gland development (GO:0030879)|morphogenesis of a branching structure (GO:0001763)|negative regulation of cell differentiation (GO:0045596)|negative regulation of endothelial cell differentiation (GO:0045602)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|patterning of blood vessels (GO:0001569)|positive regulation of transcription of Notch receptor target (GO:0007221)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell surface (GO:0009986)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|protein heterodimerization activity (GO:0046982)|receptor activity (GO:0004872)			NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(4)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(47)|ovary(5)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(1)	100						CATCAGGACAGAGGCAGTTGG	0.602																																																	0													110.0	67.0	82.0					6																	32183074		1511	2709	4220	SO:0001819	synonymous_variant	0				CCDS34420.1	6p21.3	2013-01-10	2010-06-24		ENSG00000204301	ENSG00000204301		"""Ankyrin repeat domain containing"""	7884	protein-coding gene	gene with protein product		164951	"""Notch (Drosophila) homolog 4"", ""Notch homolog 4 (Drosophila)"""	INT3		7835890	Standard	NM_004557		Approved		uc003obb.3	Q99466	OTTHUMG00000031044	ENST00000375023.3:c.1950C>G	6.37:g.32183074G>C			B0V183|B0V1X5|O00306|Q5SSY7|Q99458|Q99940|Q9H3S8|Q9UII9|Q9UIJ0	Silent	SNP	pirsf_Notch,pfam_EG-like_dom,pfam_Ankyrin_rpt,pfam_EGF-like_Ca-bd_dom,pfam_Notch_dom,pfam_Notch_NODP_dom,superfamily_Ankyrin_rpt-contain_dom,superfamily_Notch_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_Notch_dom,smart_Ankyrin_rpt,prints_Notch_4,prints_Notch_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_EG-like_dom,pfscan_Notch_dom	p.L650	ENST00000375023.3	37	c.1950	CCDS34420.1	6																																																																																			NOTCH4	-	pirsf_Notch,smart_EG-like_dom	ENSG00000204301		0.602	NOTCH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOTCH4	HGNC	protein_coding	OTTHUMT00000076045.2	-	0.00	76	0	G			32183074	-1	tier1	-	no_errors	ENST00000375023	ensembl	human	known	74_37	silent	32.43	25	12	SNP	0.998	C
OR52A4	390053	genome.wustl.edu	37	11	5142488	5142488	+	RNA	SNP	G	G	A			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr11:5142488G>A	ENST00000498233.1	-	0	910							A6NMU1	O52A4_HUMAN	olfactory receptor, family 52, subfamily A, member 4							integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(2)|kidney(1)|lung(12)|ovary(3)|prostate(2)|upper_aerodigestive_tract(1)	22		Medulloblastoma(188;0.0049)|all_neural(188;0.0442)|Breast(177;0.0675)		Epithelial(150;1.7e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)|LUSC - Lung squamous cell carcinoma(625;0.2)		ATGTGTGGATGAGCCACATCT	0.448																																																	0													59.0	52.0	54.0					11																	5142488		2201	4298	6499			0					11p15.4	2012-10-03	2012-10-03	2012-10-03	ENSG00000205494	ENSG00000205494		"""GPCR / Class A : Olfactory receptors"""	19579	pseudogene	pseudogene							Standard	NG_029079		Approved			A6NMU1	OTTHUMG00000066610		11.37:g.5142488G>A				RNA	SNP	-	NULL	ENST00000498233.1	37	NULL		11																																																																																			OR52A4	-	-	ENSG00000205494		0.448	OR52A4-002	KNOWN	basic	processed_transcript	OR52A4	HGNC	pseudogene	OTTHUMT00000268565.1	-	0.00	40	0	G	NG_029079		5142488	-1	tier1	-	no_errors	ENST00000481634	ensembl	human	known	74_37	rna	30.30	23	10	SNP	0.993	A
OR4C15	81309	genome.wustl.edu	37	11	55322411	55322411	+	Missense_Mutation	SNP	T	T	A			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr11:55322411T>A	ENST00000314644.2	+	1	629	c.629T>A	c.(628-630)aTg>aAg	p.M210K		NM_001001920.1	NP_001001920.1	Q8NGM1	OR4CF_HUMAN	olfactory receptor, family 4, subfamily C, member 15	156						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.M210K(1)		central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|lung(31)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(5)	56						TTGCATTCCATGATACAAATT	0.483										HNSCC(20;0.049)																																							1	Substitution - Missense(1)	upper_aerodigestive_tract(1)											90.0	83.0	85.0					11																	55322411		2201	4296	6497	SO:0001583	missense	0			BK004319	CCDS31501.1	11q11	2012-08-09			ENSG00000181939	ENSG00000181939		"""GPCR / Class A : Olfactory receptors"""	15171	protein-coding gene	gene with protein product							Standard	NM_001001920		Approved		uc010rig.2	Q8NGM1	OTTHUMG00000166714	ENST00000314644.2:c.629T>A	11.37:g.55322411T>A	ENSP00000324958:p.Met210Lys		Q6IFE2	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.M210K	ENST00000314644.2	37	c.629	CCDS31501.1	11	.	.	.	.	.	.	.	.	.	.	T	5.566	0.289326	0.10513	.	.	ENSG00000181939	ENST00000314644	T	0.00145	8.67	5.02	-1.77	0.07982	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00210	0.0006	M	0.81497	2.545	0.09310	N	1	B	0.27264	0.173	B	0.35770	0.21	T	0.20405	-1.0276	9	0.66056	D	0.02	.	4.9062	0.13799	0.1358:0.349:0.0:0.5153	.	156	Q8NGM1	OR4CF_HUMAN	K	210	ENSP00000324958:M210K	ENSP00000324958:M210K	M	+	2	0	OR4C15	55078987	0.000000	0.05858	0.010000	0.14722	0.442000	0.32017	-0.113000	0.10774	-0.496000	0.06650	-0.578000	0.04140	ATG	OR4C15	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000181939		0.483	OR4C15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4C15	HGNC	protein_coding	OTTHUMT00000391164.1		0.00	35	0	T	NM_001001920		55322411	+1			no_errors	ENST00000314644	ensembl	human	known	74_37	missense	10.00	18	2	SNP	0.000	A
OR5R1	219479	genome.wustl.edu	37	11	56185550	56185550	+	Silent	SNP	A	A	C			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr11:56185550A>C	ENST00000312253.1	-	1	158	c.159T>G	c.(157-159)acT>acG	p.T53T		NM_001004744.1	NP_001004744.1	Q8NH85	OR5R1_HUMAN	olfactory receptor, family 5, subfamily R, member 1	53						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|liver(1)|lung(17)|ovary(2)|prostate(3)|stomach(1)|upper_aerodigestive_tract(1)	37	Esophageal squamous(21;0.00448)					TGTGGAGTCGAGTATCAATCT	0.453																																																	0													137.0	131.0	133.0					11																	56185550		2201	4296	6497	SO:0001819	synonymous_variant	0			AB065504	CCDS31530.1	11q11	2012-08-09		2004-03-10	ENSG00000174942	ENSG00000174942		"""GPCR / Class A : Olfactory receptors"""	14841	protein-coding gene	gene with protein product				OR5R1P			Standard	NM_001004744		Approved		uc010rji.2	Q8NH85	OTTHUMG00000154219	ENST00000312253.1:c.159T>G	11.37:g.56185550A>C				Silent	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.T53	ENST00000312253.1	37	c.159	CCDS31530.1	11																																																																																			OR5R1	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM	ENSG00000174942		0.453	OR5R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5R1	HGNC	protein_coding	OTTHUMT00000334444.1	-	0.00	47	0	A	NM_001004744		56185550	-1	tier1	-	no_errors	ENST00000312253	ensembl	human	known	74_37	silent	11.43	31	4	SNP	0.000	C
OR6K6	128371	genome.wustl.edu	37	1	158725227	158725227	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr1:158725227G>A	ENST00000368144.2	+	1	718	c.622G>A	c.(622-624)Gat>Aat	p.D208N		NM_001005184.1	NP_001005184.1	Q8NGW6	OR6K6_HUMAN	olfactory receptor, family 6, subfamily K, member 6	208						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|large_intestine(5)|lung(17)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29	all_hematologic(112;0.0378)					GATATTCTGTGATTTCACACC	0.498																																																	0													119.0	101.0	107.0					1																	158725227		2203	4300	6503	SO:0001583	missense	0			BK004198	CCDS30904.1	1q23.1	2012-08-09			ENSG00000180433	ENSG00000180433		"""GPCR / Class A : Olfactory receptors"""	15033	protein-coding gene	gene with protein product							Standard	NM_001005184		Approved		uc001fsw.1	Q8NGW6	OTTHUMG00000022772	ENST00000368144.2:c.622G>A	1.37:g.158725227G>A	ENSP00000357126:p.Asp208Asn		B9EIM8|Q5VUU9|Q6IFR4	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.D208N	ENST00000368144.2	37	c.622	CCDS30904.1	1	.	.	.	.	.	.	.	.	.	.	G	24.1	4.494451	0.85069	.	.	ENSG00000180433	ENST00000368144	T	0.00188	8.59	5.48	5.48	0.80851	GPCR, rhodopsin-like superfamily (1);	0.000000	0.46442	D	0.000295	T	0.00496	0.0016	M	0.90019	3.08	0.42735	D	0.993726	D	0.89917	1.0	D	0.97110	1.0	T	0.70436	-0.4872	10	0.87932	D	0	-17.09	18.27	0.90065	0.0:0.0:1.0:0.0	.	208	Q8NGW6	OR6K6_HUMAN	N	208	ENSP00000357126:D208N	ENSP00000357126:D208N	D	+	1	0	OR6K6	156991851	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	5.291000	0.65667	2.848000	0.98002	0.655000	0.94253	GAT	OR6K6	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt	ENSG00000180433		0.498	OR6K6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR6K6	HGNC	protein_coding	OTTHUMT00000059065.2	-	0.00	26	0	G	NM_001005184		158725227	+1	tier1	-	no_errors	ENST00000368144	ensembl	human	known	74_37	missense	23.81	16	5	SNP	1.000	A
OR8H1	219469	genome.wustl.edu	37	11	56058080	56058080	+	Silent	SNP	G	G	A			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr11:56058080G>A	ENST00000313022.2	-	1	486	c.459C>T	c.(457-459)atC>atT	p.I153I		NM_001005199.1	NP_001005199.1	Q8NGG4	OR8H1_HUMAN	olfactory receptor, family 8, subfamily H, member 1	153						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(2)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(18)|ovary(1)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	Esophageal squamous(21;0.00448)					CAAAGGAGTTGATAAAGCTAA	0.448																																																	0													84.0	79.0	81.0					11																	56058080		2201	4296	6497	SO:0001819	synonymous_variant	0			AB065836	CCDS31526.1	11q11	2012-08-09			ENSG00000181693	ENSG00000181693		"""GPCR / Class A : Olfactory receptors"""	14824	protein-coding gene	gene with protein product							Standard	NM_001005199		Approved		uc010rje.2	Q8NGG4	OTTHUMG00000162671	ENST00000313022.2:c.459C>T	11.37:g.56058080G>A			B2RNI7|Q6IFC5	Silent	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.I153	ENST00000313022.2	37	c.459	CCDS31526.1	11																																																																																			OR8H1	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM	ENSG00000181693		0.448	OR8H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR8H1	HGNC	protein_coding	OTTHUMT00000370019.1	-	0.00	47	0	G	NM_001005199		56058080	-1	tier1	-	no_errors	ENST00000313022	ensembl	human	known	74_37	silent	31.91	32	15	SNP	0.000	A
OSTF1	26578	genome.wustl.edu	37	9	77742518	77742518	+	Missense_Mutation	SNP	A	A	G			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr9:77742518A>G	ENST00000346234.6	+	3	265	c.115A>G	c.(115-117)Atc>Gtc	p.I39V		NM_012383.4	NP_036515.4	Q92882	OSTF1_HUMAN	osteoclast stimulating factor 1	39	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				ossification (GO:0001503)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)				endometrium(1)|skin(1)	2						AGGTGATATTATCTACATTAC	0.264																																																	0													70.0	70.0	70.0					9																	77742518		2201	4275	6476	SO:0001583	missense	0			U63717	CCDS6651.1	9q13-q21.2	2013-01-10			ENSG00000134996	ENSG00000134996		"""Ankyrin repeat domain containing"""	8510	protein-coding gene	gene with protein product		610180				10092216	Standard	NM_012383		Approved	SH3P2, OSF, bA235O14.1	uc004ajv.4	Q92882	OTTHUMG00000020033	ENST00000346234.6:c.115A>G	9.37:g.77742518A>G	ENSP00000340836:p.Ile39Val		Q5W126|Q96IJ4	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_SH3_domain,pfam_SH3_2,superfamily_Ankyrin_rpt-contain_dom,superfamily_SH3_domain,smart_SH3_domain,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_SH3_domain,prints_SH3_domain,prints_p67phox,prints_Ankyrin_rpt	p.I39V	ENST00000346234.6	37	c.115	CCDS6651.1	9	.	.	.	.	.	.	.	.	.	.	A	13.14	2.149528	0.37923	.	.	ENSG00000134996	ENST00000346234	T	0.56103	0.48	5.47	5.47	0.80525	Src homology-3 domain (5);	0.056356	0.64402	D	0.000001	T	0.32041	0.0816	N	0.17872	0.535	0.45087	D	0.998107	B;B	0.12630	0.002;0.006	B;B	0.15052	0.002;0.012	T	0.16129	-1.0413	10	0.02654	T	1	-16.6358	10.9212	0.47165	0.843:0.157:0.0:0.0	.	39;39	A8K646;Q92882	.;OSTF1_HUMAN	V	39	ENSP00000340836:I39V	ENSP00000340836:I39V	I	+	1	0	OSTF1	76932338	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.392000	0.44433	2.216000	0.71823	0.528000	0.53228	ATC	OSTF1	-	pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain,prints_SH3_domain,prints_p67phox	ENSG00000134996		0.264	OSTF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OSTF1	HGNC	protein_coding	OTTHUMT00000052704.1	-	0.00	109	0	A	NM_012383		77742518	+1	tier1	-	no_errors	ENST00000346234	ensembl	human	known	74_37	missense	7.55	98	8	SNP	1.000	G
OTUD7A	161725	genome.wustl.edu	37	15	31796012	31796012	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr15:31796012G>T	ENST00000307050.4	-	7	974	c.882C>A	c.(880-882)aaC>aaA	p.N294K	OTUD7A_ENST00000382902.1_Missense_Mutation_p.N301K	NM_130901.1	NP_570971.1	Q8TE49	OTU7A_HUMAN	OTU deubiquitinase 7A	294	Catalytic. {ECO:0000250}.|OTU. {ECO:0000255|PROSITE- ProRule:PRU00139}.|TRAF-binding. {ECO:0000250}.				protein K11-linked deubiquitination (GO:0035871)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)	p.N294K(1)		endometrium(7)|large_intestine(4)|lung(11)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(4)	30		all_lung(180;1.6e-09)		all cancers(64;2.44e-19)|Epithelial(43;6.82e-14)|GBM - Glioblastoma multiforme(186;1.49e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00189)|Lung(196;0.208)		GGTCCTCAGAGTTGTCCACAC	0.502																																																	1	Substitution - Missense(1)	large_intestine(1)											78.0	74.0	75.0					15																	31796012		2202	4300	6502	SO:0001583	missense	0			AJ430383	CCDS10026.1	15q13.1	2014-02-24	2014-02-24	2006-07-07	ENSG00000169918	ENSG00000169918		"""OTU domain containing"""	20718	protein-coding gene	gene with protein product		612024	"""chromosome 15 open reading frame 16"", ""OTU domain containing 7"", ""OTU domain containing 7A"""	C15orf16, OTUD7		23827681	Standard	NM_130901		Approved	CEZANNE2	uc001zfq.3	Q8TE49	OTTHUMG00000129275	ENST00000307050.4:c.882C>A	15.37:g.31796012G>T	ENSP00000305926:p.Asn294Lys		Q8IWK5	Missense_Mutation	SNP	pfam_OTU,superfamily_UBA-like,smart_Znf_A20,pfscan_OTU,pfscan_Znf_A20	p.N301K	ENST00000307050.4	37	c.903	CCDS10026.1	15	.	.	.	.	.	.	.	.	.	.	G	15.48	2.846758	0.51164	.	.	ENSG00000169918	ENST00000307050;ENST00000382902	T;T	0.32023	1.48;1.47	4.67	1.21	0.21127	Ovarian tumour, otubain (2);	0.091150	0.64402	D	0.000001	T	0.42585	0.1209	L	0.59436	1.845	0.54753	D	0.999986	D;D	0.71674	0.998;0.998	D;D	0.69654	0.941;0.965	T	0.26608	-1.0098	10	0.62326	D	0.03	-39.3718	5.5081	0.16866	0.6176:0.0:0.3824:0.0	.	301;294	Q8TE49-2;Q8TE49	.;OTU7A_HUMAN	K	294;301	ENSP00000305926:N294K;ENSP00000372358:N301K	ENSP00000305926:N294K	N	-	3	2	OTUD7A	29583304	1.000000	0.71417	0.980000	0.43619	0.710000	0.40934	2.082000	0.41605	0.507000	0.28148	-0.136000	0.14681	AAC	OTUD7A	-	pfam_OTU,pfscan_OTU	ENSG00000169918		0.502	OTUD7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OTUD7A	HGNC	protein_coding	OTTHUMT00000251393.2		0.00	36	0	G	NM_130901		31796012	-1			no_errors	ENST00000382902	ensembl	human	known	74_37	missense	5.56	34	2	SNP	1.000	T
PAPD7	11044	genome.wustl.edu	37	5	6755013	6755014	+	Frame_Shift_Del	DEL	AC	AC	-			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	AC	AC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr5:6755013_6755014delAC	ENST00000230859.6	+	13	1713_1714	c.1584_1585delAC	c.(1582-1587)aaacacfs	p.H529fs		NM_001171805.1|NM_001171806.1|NM_006999.4	NP_001165276.1|NP_001165277.1|NP_008930.1	Q5XG87	PAPD7_HUMAN	PAP associated domain containing 7	759					double-strand break repair (GO:0006302)|mitotic chromosome condensation (GO:0007076)|response to drug (GO:0042493)|sister chromatid cohesion (GO:0007062)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|polynucleotide adenylyltransferase activity (GO:0004652)|SMC family protein binding (GO:0043221)			cervix(1)|endometrium(2)|large_intestine(8)|lung(10)|ovary(2)|pancreas(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	27						GGAGGAAAAAACACACACACAC	0.653																																					NSCLC(7;212 333 5667 23379 46547)												0																																										SO:0001589	frameshift_variant	0			AF089896	CCDS3871.1	5p15	2010-11-18	2010-01-19	2010-01-19	ENSG00000112941	ENSG00000112941			16705	protein-coding gene	gene with protein product	"""topoisomerase-related function protein 4-1"", ""polymerase (DNA-directed) sigma"", ""DNA polymerase kappa"", ""TUTase5"""	605198	"""polymerase (DNA directed) sigma"""	POLS		10066793, 10926539	Standard	NM_006999		Approved	POLK, TRF4, LAK-1, TRF4-1	uc003jdx.1	Q5XG87	OTTHUMG00000090457	ENST00000230859.6:c.1584_1585delAC	5.37:g.6755023_6755024delAC	ENSP00000230859:p.His529fs		A8K1E2|M1JCE6|O43289|Q17RZ1|Q9Y6C1	Frame_Shift_Del	DEL	pfam_PAP_assoc,pfam_Nucleotidyltransferase	p.T532fs	ENST00000230859.6	37	c.1584_1585	CCDS3871.1	5																																																																																			PAPD7	-	NULL	ENSG00000112941		0.653	PAPD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAPD7	HGNC	protein_coding	OTTHUMT00000206904.1		0.00	50	0	AC	NM_006999		6755014	+1	tier1		no_errors	ENST00000230859	ensembl	human	known	74_37	frame_shift_del	9.09	30	3	DEL	1.000:1.000	-
ACP7	390928	genome.wustl.edu	37	19	39591447	39591447	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr19:39591447G>C	ENST00000331256.5	+	7	1035	c.761G>C	c.(760-762)cGc>cCc	p.R254P	PAPL_ENST00000594229.1_Missense_Mutation_p.A213P	NM_001004318.2	NP_001004318.2	Q6ZNF0	PAPL_HUMAN		254						extracellular region (GO:0005576)	acid phosphatase activity (GO:0003993)|metal ion binding (GO:0046872)										CATTATGGCCGCCACTTGGTA	0.617																																																	0													43.0	47.0	46.0					19																	39591447		2203	4300	6503	SO:0001583	missense	0																														ENST00000331256.5:c.761G>C	19.37:g.39591447G>C	ENSP00000327557:p.Arg254Pro		B2RN68	Missense_Mutation	SNP	pfam_PEstase_dom,superfamily_Purple_acid_Pase-like_N	p.R254P	ENST00000331256.5	37	c.761	CCDS33018.1	19	.	.	.	.	.	.	.	.	.	.	G	12.87	2.068210	0.36470	.	.	ENSG00000183760	ENST00000331256	D	0.85339	-1.97	5.63	0.995	0.19838	Metallophosphoesterase domain (1);	0.529794	0.20619	N	0.088814	T	0.69780	0.3149	N	0.25332	0.735	0.32735	N	0.508476	B	0.16166	0.016	B	0.18871	0.023	T	0.59096	-0.7518	10	0.36615	T	0.2	-8.8629	1.5511	0.02575	0.2392:0.1444:0.467:0.1494	.	254	Q6ZNF0	PAPL_HUMAN	P	254	ENSP00000327557:R254P	ENSP00000327557:R254P	R	+	2	0	AC011443.1	44283287	0.584000	0.26766	0.973000	0.42090	0.973000	0.67179	0.113000	0.15499	0.036000	0.15547	0.655000	0.94253	CGC	PAPL	-	pfam_PEstase_dom	ENSG00000183760		0.617	PAPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAPL	Uniprot_gn	protein_coding	OTTHUMT00000463810.1		0.00	36	0	G			39591447	+1			no_errors	ENST00000331256	ensembl	human	known	74_37	missense	7.69	24	2	SNP	0.996	C
PAPPA2	60676	genome.wustl.edu	37	1	176659289	176659289	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr1:176659289C>A	ENST00000367662.3	+	5	3318	c.2154C>A	c.(2152-2154)agC>agA	p.S718R	PAPPA2_ENST00000367661.3_Missense_Mutation_p.S718R	NM_020318.2	NP_064714.2	Q9BXP8	PAPP2_HUMAN	pappalysin 2	718	Metalloprotease.				bone morphogenesis (GO:0060349)|cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|proteolysis (GO:0006508)|regulation of cell growth (GO:0001558)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(3)|breast(3)|central_nervous_system(7)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(19)|lung(136)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|upper_aerodigestive_tract(8)|urinary_tract(1)	226						TTGTCCTCAGCCCAGCATATT	0.433																																																	0													104.0	98.0	100.0					1																	176659289		2055	4236	6291	SO:0001583	missense	0			BG354569	CCDS41438.1, CCDS41439.1	1q23-q25	2008-05-23	2004-07-07	2004-07-09	ENSG00000116183	ENSG00000116183			14615	protein-coding gene	gene with protein product			"""placenta-specific 3"""	PLAC3		11018262, 11264294	Standard	NM_021936		Approved	PAPPE, PAPP-A2	uc001gkz.3	Q9BXP8	OTTHUMG00000035025	ENST00000367662.3:c.2154C>A	1.37:g.176659289C>A	ENSP00000356634:p.Ser718Arg		A9Z1Y8|Q96PH7|Q96PH8|Q9H4C9	Missense_Mutation	SNP	pfam_Notch_dom,pfam_Sushi_SCR_CCP,pfam_Peptidase_M43,superfamily_ConA-like_lec_gl_sf,superfamily_Sushi_SCR_CCP,superfamily_Fibronectin_type3,superfamily_Notch_dom,smart_LamG-like,smart_Notch_dom,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP,tigrfam_Myxo_disulph_rpt	p.S718R	ENST00000367662.3	37	c.2154	CCDS41438.1	1	.	.	.	.	.	.	.	.	.	.	C	7.527	0.657837	0.14645	.	.	ENSG00000116183	ENST00000367662;ENST00000367661	T;T	0.79653	-1.29;1.56	5.23	2.35	0.29111	Peptidase M43, pregnancy-associated plasma-A (1);Metallopeptidase, catalytic domain (1);	0.143954	0.64402	D	0.000011	T	0.63698	0.2533	N	0.16708	0.43	0.32331	N	0.561051	B;B	0.28783	0.006;0.222	B;B	0.24394	0.016;0.053	T	0.63355	-0.6656	10	0.51188	T	0.08	-19.949	9.1527	0.36973	0.0:0.6986:0.0:0.3014	.	718;718	Q9BXP8;A9Z1Y8	PAPP2_HUMAN;.	R	718	ENSP00000356634:S718R;ENSP00000356633:S718R	ENSP00000356633:S718R	S	+	3	2	PAPPA2	174925912	0.683000	0.27633	0.985000	0.45067	0.066000	0.16364	-0.091000	0.11146	0.216000	0.20781	0.563000	0.77884	AGC	PAPPA2	-	pfam_Peptidase_M43	ENSG00000116183		0.433	PAPPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAPPA2	HGNC	protein_coding	OTTHUMT00000084763.1	-	0.00	39	0	C			176659289	+1	tier1	-	no_errors	ENST00000367662	ensembl	human	known	74_37	missense	14.29	36	6	SNP	1.000	A
PARM1	25849	genome.wustl.edu	37	4	75938361	75938361	+	Splice_Site	SNP	G	G	T			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr4:75938361G>T	ENST00000307428.7	+	2	981		c.e2+1		RP11-44F21.2_ENST00000513770.1_RNA|PARM1_ENST00000513238.1_Intron	NM_015393.3	NP_056208.2	Q6UWI2	PARM1_HUMAN	prostate androgen-regulated mucin-like protein 1						positive regulation of telomerase activity (GO:0051973)	early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|plasma membrane (GO:0005886)				cervix(1)|endometrium(2)|lung(4)|ovary(1)	8						TTAAGTTCAGGTGAGTCTCTA	0.428																																																	0													86.0	85.0	85.0					4																	75938361		1996	4166	6162	SO:0001630	splice_region_variant	0			AK022311	CCDS47077.1	4q13.3-q21.3	2010-02-17	2009-09-28		ENSG00000169116	ENSG00000169116			24536	protein-coding gene	gene with protein product	"""Prostatic androgen-repressed message 1"", ""Castration-induced prostatic apoptosis-related protein 1"", ""WSC4, cell wall integrity and stress response component 4 homolog (S. cerevisiae)"""					10499539, 12772192, 18027867	Standard	NM_015393		Approved	DKFZP564O0823, Cipar1, WSC4	uc003hih.2	Q6UWI2	OTTHUMG00000160827	ENST00000307428.7:c.769+1G>T	4.37:g.75938361G>T			B3KMQ9|Q96DV8|Q9Y4S1	Splice_Site	SNP	-	e2+1	ENST00000307428.7	37	c.769+1	CCDS47077.1	4	.	.	.	.	.	.	.	.	.	.	G	12.52	1.963764	0.34659	.	.	ENSG00000169116	ENST00000307428	.	.	.	5.41	5.41	0.78517	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.6752	0.68975	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	PARM1	76157385	1.000000	0.71417	1.000000	0.80357	0.260000	0.26232	4.681000	0.61663	2.546000	0.85860	0.557000	0.71058	.	PARM1	-	-	ENSG00000169116		0.428	PARM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PARM1	HGNC	protein_coding	OTTHUMT00000362494.1		0.00	26	0	G	NM_015393	Intron	75938361	+1			no_errors	ENST00000307428	ensembl	human	known	74_37	splice_site	6.25	30	2	SNP	1.000	T
PAXBP1	94104	genome.wustl.edu	37	21	34120808	34120808	+	Splice_Site	SNP	A	A	G			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr21:34120808A>G	ENST00000331923.4	-	11	2113		c.e11+1		PAXBP1_ENST00000290178.4_Splice_Site	NM_016631.3	NP_057715.2	Q9Y5B6	PAXB1_HUMAN	PAX3 and PAX7 binding protein 1						muscle organ development (GO:0007517)|positive regulation of histone methylation (GO:0031062)|positive regulation of myoblast proliferation (GO:2000288)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of satellite cell proliferation (GO:0014842)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)										GAAGCCACTCACCTCAAGAGG	0.383																																																	0													65.0	65.0	65.0					21																	34120808		2203	4300	6503	SO:0001630	splice_region_variant	0			AF231920	CCDS13619.1, CCDS33541.1	21q22.11	2014-01-23	2013-01-08	2013-01-08	ENSG00000159086	ENSG00000159086			13579	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 105"", ""GC-rich sequence DNA-binding factor candidate"""		"""chromosome 21 open reading frame 66"", ""GC-rich sequence DNA-binding factor 1"""	C21orf66, GCFC1		11707072, 22862948	Standard	NM_016631		Approved	GCFC, fSAP105	uc002yqn.3	Q9Y5B6	OTTHUMG00000064980	ENST00000331923.4:c.1923+1T>C	21.37:g.34120808A>G			D3DSE7|Q96DU8|Q9NYQ0	Splice_Site	SNP	-	e11+2	ENST00000331923.4	37	c.1923+2	CCDS13619.1	21	.	.	.	.	.	.	.	.	.	.	A	19.47	3.833079	0.71258	.	.	ENSG00000159086	ENST00000331923;ENST00000290178	.	.	.	6.16	5.01	0.66863	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.9501	0.52950	0.9321:0.0:0.0679:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	GCFC1	33042679	1.000000	0.71417	0.830000	0.32933	0.965000	0.64279	7.144000	0.77357	1.148000	0.42385	0.528000	0.53228	.	PAXBP1	-	-	ENSG00000159086		0.383	PAXBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAXBP1	HGNC	protein_coding	OTTHUMT00000139563.1	-	0.00	47	0	A	NM_013329	Intron	34120808	-1	tier1	-	no_errors	ENST00000331923	ensembl	human	known	74_37	splice_site	8.89	41	4	SNP	0.982	G
PCBP4	57060	genome.wustl.edu	37	3	51992252	51992252	+	Frame_Shift_Del	DEL	A	A	-			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr3:51992252delA	ENST00000461554.1	-	14	1368	c.1037delT	c.(1036-1038)ctgfs	p.L346fs	PCBP4_ENST00000395013.3_Frame_Shift_Del_p.L186fs|PCBP4_ENST00000322099.7_Frame_Shift_Del_p.L346fs|PCBP4_ENST00000484633.1_Frame_Shift_Del_p.L303fs|PCBP4_ENST00000395014.2_Frame_Shift_Del_p.L367fs|RP11-155D18.12_ENST00000488257.1_RNA|PCBP4_ENST00000355852.2_Frame_Shift_Del_p.L346fs|PCBP4_ENST00000428823.2_Frame_Shift_Del_p.L303fs|PCBP4_ENST00000471622.1_Intron	NM_001174100.1	NP_001167571.1	P57723	PCBP4_HUMAN	poly(rC) binding protein 4	346						cytoplasm (GO:0005737)|ribonucleoprotein complex (GO:0030529)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			endometrium(2)|large_intestine(2)|lung(2)|prostate(1)|stomach(1)	8				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.000534)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)		GGGTGTGCCCAGCAGGCCAGG	0.687																																																	0													55.0	65.0	61.0					3																	51992252		2203	4300	6503	SO:0001589	frameshift_variant	0			AF176330	CCDS2839.1, CCDS2840.1, CCDS2840.2	3p21	2013-07-16	2001-11-28		ENSG00000090097	ENSG00000090097			8652	protein-coding gene	gene with protein product	"""RNA binding protein MCG10"", ""LYST-interacting protein"", ""alphaCP-4 protein"""	608503	"""poly(rC)-binding protein 4"""			10936052	Standard	NM_033008		Approved	MCG10, LIP4	uc003dch.2	P57723	OTTHUMG00000157366	ENST00000461554.1:c.1037delT	3.37:g.51992252delA	ENSP00000417196:p.Leu346fs		Q96AH7	Frame_Shift_Del	DEL	pfam_KH_dom_type_1,smart_KH_dom,pfscan_KH_dom_type_1	p.L367fs	ENST00000461554.1	37	c.1100	CCDS2839.1	3																																																																																			PCBP4	-	NULL	ENSG00000090097		0.687	PCBP4-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PCBP4	HGNC	protein_coding	OTTHUMT00000348597.1		0.00	56	0	A	NM_020418		51992252	-1	tier1		no_errors	ENST00000395014	ensembl	human	known	74_37	frame_shift_del	10.53	17	2	DEL	1.000	-
PCDH15	65217	genome.wustl.edu	37	10	55581113	55581113	+	3'UTR	SNP	G	G	A			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr10:55581113G>A	ENST00000320301.6	-	0	6767				PCDH15_ENST00000409834.1_Intron|PCDH15_ENST00000395440.1_Intron|PCDH15_ENST00000395442.1_Intron|PCDH15_ENST00000463095.1_5'UTR|PCDH15_ENST00000395432.2_3'UTR|PCDH15_ENST00000395445.1_Intron|PCDH15_ENST00000373957.3_3'UTR|PCDH15_ENST00000414778.1_Intron|PCDH15_ENST00000395433.1_3'UTR|PCDH15_ENST00000373965.2_Intron|PCDH15_ENST00000395430.1_3'UTR|PCDH15_ENST00000395438.1_Intron|PCDH15_ENST00000395446.1_Intron|PCDH15_ENST00000361849.3_3'UTR	NM_033056.3	NP_149045.3	Q96QU1	PCD15_HUMAN	protocadherin-related 15						equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|synapse (GO:0045202)	calcium ion binding (GO:0005509)			NS(3)|breast(6)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(39)|lung(108)|ovary(5)|pancreas(6)|prostate(6)|skin(12)|upper_aerodigestive_tract(12)|urinary_tract(1)	237		Melanoma(3;0.117)|Lung SC(717;0.238)				CTACAATCTAGGTACATTATA	0.299										HNSCC(58;0.16)																																							0																																										SO:0001624	3_prime_UTR_variant	0			AY029205	CCDS7248.1, CCDS44400.1, CCDS44401.1, CCDS44403.1, CCDS44404.1, CCDS73134.1, CCDS73135.1, CCDS73136.1, CCDS73137.1, CCDS73138.1	10q21.1	2013-01-08	2010-01-25		ENSG00000150275	ENSG00000150275		"""Cadherins / Cadherin-related"""	14674	protein-coding gene	gene with protein product	"""cadherin-related family member 15"""	605514	"""deafness, autosomal recessive 23"", ""protocadherin 15"""	USH1F, DFNB23		11398101, 14570705	Standard	NM_033056		Approved	CDHR15	uc010qhy.1	Q96QU1	OTTHUMG00000018259	ENST00000320301.6:c.*505C>T	10.37:g.55581113G>A			A6NL19|C6ZEF5|C6ZEF6|C6ZEF7|Q5VY38|Q5VY39|Q6TRH8|Q8NDB9|Q96QT8	RNA	SNP	-	NULL	ENST00000320301.6	37	NULL	CCDS7248.1	10																																																																																			PCDH15	-	-	ENSG00000150275		0.299	PCDH15-001	KNOWN	basic|CCDS	protein_coding	PCDH15	HGNC	protein_coding	OTTHUMT00000048121.2	-	0.00	25	0	G	NM_033056		55581113	-1	tier1	-	no_errors	ENST00000463095	ensembl	human	known	74_37	rna	28.00	18	7	SNP	0.000	A
PCF11	51585	genome.wustl.edu	37	11	82880460	82880460	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr11:82880460G>T	ENST00000298281.4	+	8	3535	c.3083G>T	c.(3082-3084)gGt>gTt	p.G1028V		NM_015885.3	NP_056969.2	O94913	PCF11_HUMAN	PCF11 cleavage and polyadenylation factor subunit	1028	Gly-rich.				gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA cleavage (GO:0006379)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	mRNA cleavage factor complex (GO:0005849)|nucleoplasm (GO:0005654)				cervix(1)|endometrium(3)|kidney(4)|large_intestine(1)|lung(22)|ovary(1)|urinary_tract(1)	33						GGTCAAGGTGGTCCAAGATTT	0.507																																																	0													71.0	70.0	71.0					11																	82880460		1974	4154	6128	SO:0001583	missense	0			AB020631	CCDS44689.1	11q13	2013-07-02	2013-07-02		ENSG00000165494	ENSG00000165494			30097	protein-coding gene	gene with protein product		608876	"""PCF11, cleavage and polyadenylation factor II subunit, homolog (S. cerevisiae)"", ""PCF11, cleavage and polyadenylation factor subunit, homolog (S. cerevisiae)"""			11060040	Standard	NM_015885		Approved	KIAA0824	uc001ozx.4	O94913	OTTHUMG00000167031	ENST00000298281.4:c.3083G>T	11.37:g.82880460G>T	ENSP00000298281:p.Gly1028Val		A6H8W7|O43671|Q6P0X8	Missense_Mutation	SNP	pfam_RNA_pol_II-bd,superfamily_ENTH_VHS,smart_CID_dom	p.G1028V	ENST00000298281.4	37	c.3083	CCDS44689.1	11	.	.	.	.	.	.	.	.	.	.	G	26.0	4.691097	0.88735	.	.	ENSG00000165494	ENST00000298281	T	0.26067	1.76	5.92	5.92	0.95590	.	0.000000	0.64402	D	0.000011	T	0.46619	0.1402	L	0.52573	1.65	0.58432	D	0.999999	D	0.69078	0.997	D	0.66196	0.942	T	0.07139	-1.0788	9	.	.	.	-12.5917	20.3811	0.98930	0.0:0.0:1.0:0.0	.	1028	O94913	PCF11_HUMAN	V	1028	ENSP00000298281:G1028V	.	G	+	2	0	PCF11	82558108	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.387000	0.73191	2.821000	0.97095	0.650000	0.86243	GGT	PCF11	-	NULL	ENSG00000165494		0.507	PCF11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCF11	HGNC	protein_coding	OTTHUMT00000392548.2		0.00	78	0	G	NM_015885		82880460	+1			no_errors	ENST00000298281	ensembl	human	known	74_37	missense	5.88	64	4	SNP	1.000	T
PCNT	5116	genome.wustl.edu	37	21	47766842	47766842	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr21:47766842G>T	ENST00000359568.5	+	5	1013	c.906G>T	c.(904-906)gaG>gaT	p.E302D	PCNT_ENST00000480896.1_3'UTR	NM_006031.5	NP_006022.3	O95613	PCNT_HUMAN	pericentrin	302	Glu-rich.				brain morphogenesis (GO:0048854)|cerebellar cortex morphogenesis (GO:0021696)|cilium assembly (GO:0042384)|G2/M transition of mitotic cell cycle (GO:0000086)|in utero embryonic development (GO:0001701)|limb morphogenesis (GO:0035108)|microtubule cytoskeleton organization (GO:0000226)|mitotic cell cycle (GO:0000278)|multicellular organism growth (GO:0035264)|negative regulation of apoptotic process (GO:0043066)|neural precursor cell proliferation (GO:0061351)|neuron migration (GO:0001764)|olfactory bulb development (GO:0021772)|positive regulation of intracellular protein transport (GO:0090316)|spindle organization (GO:0007051)	centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intercellular bridge (GO:0045171)|membrane (GO:0016020)|microtubule (GO:0005874)|motile cilium (GO:0031514)|pericentriolar material (GO:0000242)				NS(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(15)|liver(2)|lung(41)|ovary(5)|pancreas(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	104	Breast(49;0.112)					AGCAGCACGAGCTGGAGCTCC	0.652																																																	0													34.0	26.0	28.0					21																	47766842		2201	4299	6500	SO:0001583	missense	0			AB007862	CCDS33592.1	21q22.3	2014-02-20	2008-01-30	2005-11-03	ENSG00000160299	ENSG00000160299			16068	protein-coding gene	gene with protein product	"""kendrin"", ""Seckel syndrome 4"""	605925	"""pericentrin 2 (kendrin)"""	PCNT2		8812505, 9455477	Standard	NM_006031		Approved	KEN, KIAA0402, PCN, PCNTB, SCKL4	uc002zji.4	O95613	OTTHUMG00000090665	ENST00000359568.5:c.906G>T	21.37:g.47766842G>T	ENSP00000352572:p.Glu302Asp		O43152|Q7Z7C9	Missense_Mutation	SNP	pfam_PACT_domain	p.E302D	ENST00000359568.5	37	c.906	CCDS33592.1	21	.	.	.	.	.	.	.	.	.	.	G	19.52	3.842459	0.71488	.	.	ENSG00000160299	ENST00000359568;ENST00000337772	T	0.31769	1.48	5.35	1.46	0.22682	.	0.000000	0.32608	N	0.005877	T	0.48607	0.1509	M	0.70275	2.135	0.22017	N	0.999413	D;D	0.89917	1.0;0.999	D;D	0.85130	0.997;0.994	T	0.29971	-0.9994	10	0.62326	D	0.03	.	8.1396	0.31076	0.3953:0.0:0.6047:0.0	.	184;302	O95613-2;O95613	.;PCNT_HUMAN	D	302;289	ENSP00000352572:E302D	ENSP00000338675:E289D	E	+	3	2	PCNT	46591270	1.000000	0.71417	0.988000	0.46212	0.783000	0.44284	0.756000	0.26419	0.232000	0.21100	0.563000	0.77884	GAG	PCNT	-	NULL	ENSG00000160299		0.652	PCNT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCNT	HGNC	protein_coding	OTTHUMT00000207336.1		0.00	21	0	G	NM_006031		47766842	+1			no_errors	ENST00000359568	ensembl	human	known	74_37	missense	10.53	17	2	SNP	1.000	T
PDE6A	5145	genome.wustl.edu	37	5	149324057	149324057	+	Silent	SNP	G	G	T			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr5:149324057G>T	ENST00000255266.5	-	1	299	c.180C>A	c.(178-180)atC>atA	p.I60I		NM_000440.2	NP_000431.2	P16499	PDE6A_HUMAN	phosphodiesterase 6A, cGMP-specific, rod, alpha	60					cytosolic calcium ion homeostasis (GO:0051480)|GMP metabolic process (GO:0046037)|phototransduction, visible light (GO:0007603)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|retina development in camera-type eye (GO:0060041)|rhodopsin mediated signaling pathway (GO:0016056)|visual perception (GO:0007601)	photoreceptor disc membrane (GO:0097381)|plasma membrane (GO:0005886)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|metal ion binding (GO:0046872)			breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(13)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|stomach(3)|upper_aerodigestive_tract(2)	44			KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)		Caffeine(DB00201)	GATCAAAGATGATTTCGCTCT	0.542																																																	0													73.0	71.0	71.0					5																	149324057		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS4299.1	5q31.2-q34	2013-02-14			ENSG00000132915	ENSG00000132915	3.1.4.17	"""Phosphodiesterases"""	8785	protein-coding gene	gene with protein product		180071		PDEA		2155175	Standard	NM_000440		Approved	RP43	uc003lrg.4	P16499	OTTHUMG00000130047	ENST00000255266.5:c.180C>A	5.37:g.149324057G>T			Q0P638	Silent	SNP	pfam_PDEase_catalytic_dom,pfam_GAF,smart_GAF,smart_HD/PDEase_dom,prints_PDEase	p.I60	ENST00000255266.5	37	c.180	CCDS4299.1	5																																																																																			PDE6A	-	NULL	ENSG00000132915		0.542	PDE6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDE6A	HGNC	protein_coding	OTTHUMT00000252326.2	-	0.00	26	0	G			149324057	-1	tier1	-	no_errors	ENST00000255266	ensembl	human	known	74_37	silent	20.00	12	3	SNP	0.979	T
PFAS	5198	genome.wustl.edu	37	17	8161134	8161134	+	Missense_Mutation	SNP	T	T	A			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr17:8161134T>A	ENST00000314666.6	+	10	1218	c.1085T>A	c.(1084-1086)cTg>cAg	p.L362Q	PFAS_ENST00000545834.1_5'UTR	NM_012393.2	NP_036525.1	O15067	PUR4_HUMAN	phosphoribosylformylglycinamidine synthase	362					'de novo' IMP biosynthetic process (GO:0006189)|glutamine metabolic process (GO:0006541)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine ribonucleoside monophosphate biosynthetic process (GO:0009168)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|phosphoribosylformylglycinamidine synthase activity (GO:0004642)			central_nervous_system(3)|endometrium(8)|kidney(2)|large_intestine(2)|lung(9)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)	35					L-Glutamine(DB00130)	GGTTACAATCTGCCCTGGGAG	0.537																																																	0													62.0	59.0	60.0					17																	8161134		2203	4300	6503	SO:0001583	missense	0			AB002359	CCDS11136.1	17p13.1	2008-07-31	2008-07-31		ENSG00000178921	ENSG00000178921	6.3.5.3		8863	protein-coding gene	gene with protein product	"""FGAR amidotransferase"""	602133				8110788	Standard	NM_012393		Approved	PURL, FGARAT, KIAA0361	uc002gkr.3	O15067	OTTHUMG00000108188	ENST00000314666.6:c.1085T>A	17.37:g.8161134T>A	ENSP00000313490:p.Leu362Gln		A6H8V8	Missense_Mutation	SNP	pfam_AIR_synth_C_dom,pfam_AIR_synth_N_dom,superfamily_PurM_N-like,superfamily_AIR_synth_C_dom,tigrfam_PRibForGlyAmidine_synth	p.L362Q	ENST00000314666.6	37	c.1085	CCDS11136.1	17	.	.	.	.	.	.	.	.	.	.	T	14.61	2.586678	0.46110	.	.	ENSG00000178921	ENST00000314666	T	0.44881	0.91	5.79	5.79	0.91817	PurM, N-terminal-like (1);AIR synthase-related protein (1);	0.070525	0.56097	D	0.000030	T	0.39733	0.1089	L	0.38692	1.165	0.80722	D	1	P	0.47106	0.89	P	0.50791	0.65	T	0.22591	-1.0212	10	0.02654	T	1	-9.9092	14.0723	0.64868	0.0:0.0:0.0:1.0	.	362	O15067	PUR4_HUMAN	Q	362	ENSP00000313490:L362Q	ENSP00000313490:L362Q	L	+	2	0	PFAS	8101859	1.000000	0.71417	0.978000	0.43139	0.518000	0.34316	6.997000	0.76270	2.219000	0.72066	0.459000	0.35465	CTG	PFAS	-	pfam_AIR_synth_N_dom,superfamily_PurM_N-like,tigrfam_PRibForGlyAmidine_synth	ENSG00000178921		0.537	PFAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PFAS	HGNC	protein_coding	OTTHUMT00000226994.2		0.00	76	0	T			8161134	+1			no_errors	ENST00000314666	ensembl	human	known	74_37	missense	7.32	38	3	SNP	0.990	A
PHACTR4	65979	genome.wustl.edu	37	1	28696279	28696279	+	5'UTR	DEL	G	G	-			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr1:28696279delG	ENST00000373839.3	+	0	166				PHACTR4_ENST00000493669.1_3'UTR	NM_001048183.1	NP_001041648.1	Q8IZ21	PHAR4_HUMAN	phosphatase and actin regulator 4						actin cytoskeleton organization (GO:0030036)|closure of optic fissure (GO:0061386)|enteric nervous system development (GO:0048484)|negative regulation of integrin-mediated signaling pathway (GO:2001045)|neural crest cell migration (GO:0001755)|neural tube closure (GO:0001843)|positive regulation of catalytic activity (GO:0043085)|regulation of cell cycle (GO:0051726)|Rho protein signal transduction (GO:0007266)	cytoplasm (GO:0005737)|lamellipodium (GO:0030027)	actin binding (GO:0003779)|protein phosphatase 1 binding (GO:0008157)|protein phosphatase type 1 activator activity (GO:0071862)			NS(1)|biliary_tract(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(6)|lung(10)|ovary(3)|skin(1)|urinary_tract(1)	32		Colorectal(325;3.46e-05)|Lung NSC(340;4.37e-05)|all_lung(284;7.01e-05)|Renal(390;0.00121)|Breast(348;0.00345)|all_neural(195;0.0208)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0261)		OV - Ovarian serous cystadenocarcinoma(117;1.35e-21)|Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00273)|STAD - Stomach adenocarcinoma(196;0.00299)|BRCA - Breast invasive adenocarcinoma(304;0.0144)|READ - Rectum adenocarcinoma(331;0.0649)		CAACGGGCCAGGTAGGATTTC	0.682																																																	0													3.0	3.0	3.0					1																	28696279		809	1884	2693	SO:0001623	5_prime_UTR_variant	0			AF130081	CCDS41293.1, CCDS41294.1	1p35.2	2014-06-13			ENSG00000204138	ENSG00000204138		"""Phosphatase and actin regulators"""	25793	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 124"""	608726				11483580, 15107502	Standard	NM_023923		Approved	FLJ13171, PPP1R124	uc001bpy.3	Q8IZ21	OTTHUMG00000003541	ENST00000373839.3:c.-96G>-	1.37:g.28696279delG			A2APK6|B9ZVW0|D3DPM3|Q68DD4|Q6NUN6|Q8N384|Q9H395|Q9H6X0|Q9H8W6	RNA	DEL	-	NULL	ENST00000373839.3	37	NULL	CCDS41293.1	1																																																																																			PHACTR4	-	-	ENSG00000204138		0.682	PHACTR4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PHACTR4	HGNC	protein_coding	OTTHUMT00000009868.4		0.00	82	0	G	NM_023923		28696279	+1	tier1		no_errors	ENST00000463428	ensembl	human	known	74_37	rna	26.92	57	21	DEL	0.983	-
PHLPP2	23035	genome.wustl.edu	37	16	71736521	71736521	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr16:71736521C>T	ENST00000568954.1	-	3	776	c.398G>A	c.(397-399)tGt>tAt	p.C133Y	PHLPP2_ENST00000567016.1_Missense_Mutation_p.C168Y|PHLPP2_ENST00000360429.3_Missense_Mutation_p.C133Y|PHLPP2_ENST00000356272.3_Missense_Mutation_p.C133Y|PHLPP2_ENST00000393524.2_Missense_Mutation_p.C133Y			Q6ZVD8	PHLP2_HUMAN	PH domain and leucine rich repeat protein phosphatase 2	133					epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment membrane (GO:0042622)	metal ion binding (GO:0046872)|protein serine/threonine phosphatase activity (GO:0004722)			central_nervous_system(1)|endometrium(5)|kidney(5)|large_intestine(7)|lung(15)|ovary(1)|prostate(1)|skin(1)|stomach(1)	37						TCGAATCATACAGCCGAGGTC	0.413																																																	0													95.0	89.0	91.0					16																	71736521		2198	4300	6498	SO:0001583	missense	0			BX647823	CCDS32479.1, CCDS73910.1	16q22.2	2013-01-11	2009-05-26	2009-05-26	ENSG00000040199	ENSG00000040199		"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"", ""Pleckstrin homology (PH) domain containing"""	29149	protein-coding gene	gene with protein product		611066	"""PH domain and leucine rich repeat protein phosphatase-like"""	PHLPPL		17386267	Standard	NM_001289003		Approved	KIAA0931	uc002fax.3	Q6ZVD8		ENST00000568954.1:c.398G>A	16.37:g.71736521C>T	ENSP00000457991:p.Cys133Tyr		A1L374|Q9NV17|Q9Y2E3	Missense_Mutation	SNP	pfam_PP2C-like_dom,pfam_Leu-rich_rpt,superfamily_PP2C-like_dom,smart_Leu-rich_rpt_typical-subtyp,smart_PP2C-like_dom	p.C133Y	ENST00000568954.1	37	c.398	CCDS32479.1	16	.	.	.	.	.	.	.	.	.	.	C	22.6	4.306773	0.81247	.	.	ENSG00000040199	ENST00000360429;ENST00000356272;ENST00000393524;ENST00000538126	T;T;T	0.33654	1.4;1.4;1.4	5.61	5.61	0.85477	.	0.000000	0.85682	D	0.000000	T	0.58337	0.2115	M	0.66939	2.045	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.91635	0.999;0.996	T	0.49808	-0.8900	10	0.21014	T	0.42	-9.3891	18.22	0.89898	0.0:1.0:0.0:0.0	.	133;133	Q6ZVD8-3;Q6ZVD8	.;PHLP2_HUMAN	Y	133	ENSP00000353610:C133Y;ENSP00000348611:C133Y;ENSP00000377159:C133Y	ENSP00000348611:C133Y	C	-	2	0	PHLPP2	70294022	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.007000	0.76335	2.639000	0.89480	0.555000	0.69702	TGT	PHLPP2	-	NULL	ENSG00000040199		0.413	PHLPP2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PHLPP2	HGNC	protein_coding	OTTHUMT00000434139.1	-	0.00	99	0	C	NM_015020		71736521	-1	tier1	-	no_errors	ENST00000356272	ensembl	human	known	74_37	missense	6.56	57	4	SNP	1.000	T
PIK3C3	5289	genome.wustl.edu	37	18	39647366	39647366	+	Silent	SNP	C	C	T			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr18:39647366C>T	ENST00000262039.4	+	24	2624	c.2538C>T	c.(2536-2538)ttC>ttT	p.F846F	PIK3C3_ENST00000588156.1_Silent_p.F70F|PIK3C3_ENST00000587328.1_Silent_p.F24F|PIK3C3_ENST00000593098.1_Silent_p.F331F|PIK3C3_ENST00000398870.3_Silent_p.F783F	NM_002647.2	NP_002638.2	Q8NEB9	PK3C3_HUMAN	phosphatidylinositol 3-kinase, catalytic subunit type 3	846	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.				autophagic vacuole assembly (GO:0000045)|cytokinesis (GO:0000910)|early endosome to late endosome transport (GO:0045022)|endosome organization (GO:0007032)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|protein processing (GO:0016485)|regulation of protein secretion (GO:0050708)|response to leucine (GO:0043201)|small molecule metabolic process (GO:0044281)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)	axoneme (GO:0005930)|cytosol (GO:0005829)|late endosome (GO:0005770)|membrane (GO:0016020)|midbody (GO:0030496)|phagocytic vesicle (GO:0045335)|phosphatidylinositol 3-kinase complex (GO:0005942)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|ATP binding (GO:0005524)|protein kinase activity (GO:0004672)	p.F846F(1)		breast(2)|cervix(2)|endometrium(3)|kidney(2)|large_intestine(10)|liver(1)|lung(25)|ovary(1)|skin(2)|urinary_tract(1)	49						AGGATAAATTCCGCTTAGACC	0.408										TSP Lung(28;0.18)																											NSCLC(37;552 1060 2683 16430 37914)												1	Substitution - coding silent(1)	large_intestine(1)											136.0	121.0	126.0					18																	39647366		2203	4300	6503	SO:0001819	synonymous_variant	0			Z46973	CCDS11920.1	18q12.3	2012-07-13	2012-07-13		ENSG00000078142	ENSG00000078142	2.7.1.137		8974	protein-coding gene	gene with protein product		602609	"""phosphoinositide-3-kinase, class 3"""			7628435	Standard	NM_002647		Approved	Vps34	uc002lap.3	Q8NEB9	OTTHUMG00000132593	ENST00000262039.4:c.2538C>T	18.37:g.39647366C>T			Q15134	Silent	SNP	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_C2_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pirsf_PI3K_Vps34,pfscan_PI3/4_kinase_cat_dom	p.F846	ENST00000262039.4	37	c.2538	CCDS11920.1	18																																																																																			PIK3C3	-	superfamily_Kinase-like_dom,smart_PI3/4_kinase_cat_dom,pirsf_PI3K_Vps34,pfscan_PI3/4_kinase_cat_dom	ENSG00000078142		0.408	PIK3C3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIK3C3	HGNC	protein_coding	OTTHUMT00000255804.1		0.00	107	0	C	NM_002647		39647366	+1			no_errors	ENST00000262039	ensembl	human	known	74_37	silent	5.00	38	2	SNP	0.999	T
PIK3R1	5295	genome.wustl.edu	37	5	67588172	67588172	+	Nonsense_Mutation	SNP	C	C	A			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr5:67588172C>A	ENST00000521381.1	+	8	1618	c.1002C>A	c.(1000-1002)taC>taA	p.Y334*	PIK3R1_ENST00000523872.1_5'Flank|PIK3R1_ENST00000320694.8_Nonsense_Mutation_p.Y34*|PIK3R1_ENST00000336483.5_Nonsense_Mutation_p.Y64*|PIK3R1_ENST00000396611.1_Nonsense_Mutation_p.Y334*|PIK3R1_ENST00000521657.1_Nonsense_Mutation_p.Y334*|PIK3R1_ENST00000274335.5_Nonsense_Mutation_p.Y334*	NM_181523.2	NP_852664.1	P27986	P85A_HUMAN	phosphoinositide-3-kinase, regulatory subunit 1 (alpha)	334	SH2 1. {ECO:0000255|PROSITE- ProRule:PRU00191}.				B cell differentiation (GO:0030183)|blood coagulation (GO:0007596)|cellular response to UV (GO:0034644)|epidermal growth factor receptor signaling pathway (GO:0007173)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|growth hormone receptor signaling pathway (GO:0060396)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|leukocyte migration (GO:0050900)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of osteoclast differentiation (GO:0045671)|neurotrophin TRK receptor signaling pathway (GO:0048011)|NFAT protein import into nucleus (GO:0051531)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of cell migration (GO:0030335)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of glucose import (GO:0046326)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|protein phosphorylation (GO:0006468)|regulation of phosphatidylinositol 3-kinase activity (GO:0043551)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|viral process (GO:0016032)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|membrane (GO:0016020)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	ErbB-3 class receptor binding (GO:0043125)|insulin binding (GO:0043559)|insulin receptor binding (GO:0005158)|insulin receptor substrate binding (GO:0043560)|insulin-like growth factor receptor binding (GO:0005159)|neurotrophin TRKA receptor binding (GO:0005168)|phosphatidylinositol 3-kinase binding (GO:0043548)|phosphatidylinositol 3-kinase regulator activity (GO:0035014)|protein phosphatase binding (GO:0019903)|transmembrane receptor protein tyrosine kinase adaptor activity (GO:0005068)	p.Y334*(1)|p.0?(1)|p.?(1)		breast(12)|central_nervous_system(31)|cervix(1)|endometrium(68)|haematopoietic_and_lymphoid_tissue(5)|kidney(1)|large_intestine(32)|lung(10)|ovary(9)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	178		Lung NSC(167;1.99e-05)|Prostate(74;0.00308)|Ovarian(174;0.00473)|Colorectal(97;0.0176)		OV - Ovarian serous cystadenocarcinoma(47;3.76e-51)|Lung(70;0.0211)	Isoprenaline(DB01064)	CTGAATGGTACTGGGGAGATA	0.393			"""Mis, F, O"""		"""gliobastoma, ovarian, colorectal"""					TCGA GBM(4;<1E-08)																														Rec	yes		5	5q13.1	5295	"""phosphoinositide-3-kinase, regulatory subunit 1 (alpha)"""		"""E, O"""	3	Substitution - Nonsense(1)|Whole gene deletion(1)|Unknown(1)	large_intestine(1)|lung(1)|endometrium(1)											157.0	147.0	150.0					5																	67588172		2203	4300	6503	SO:0001587	stop_gained	0			M61906	CCDS3993.1, CCDS3994.1, CCDS3995.1, CCDS56374.1	5q13.1	2014-09-17	2008-02-04		ENSG00000145675	ENSG00000145675		"""SH2 domain containing"""	8979	protein-coding gene	gene with protein product		171833				1314371, 18387942	Standard	NM_181524		Approved	GRB1, p85-ALPHA, p85	uc003jva.3	P27986	OTTHUMG00000131251	ENST00000521381.1:c.1002C>A	5.37:g.67588172C>A	ENSP00000428056:p.Tyr334*		B3KT19|D3DWA0|E7EX19|Q15747|Q4VBZ7|Q53EM6|Q8IXA2|Q8N1C5	Nonsense_Mutation	SNP	pfam_SH2,pfam_RhoGAP_dom,pfam_SH3_2,superfamily_Rho_GTPase_activation_prot,superfamily_SH3_domain,superfamily_Guanylate-bd_C,smart_SH3_domain,smart_RhoGAP_dom,smart_SH2,pfscan_SH2,pfscan_SH3_domain,pfscan_RhoGAP_dom,prints_PI3kinase_P85,prints_SH2	p.Y334*	ENST00000521381.1	37	c.1002	CCDS3993.1	5	.	.	.	.	.	.	.	.	.	.	C	38	6.676016	0.97755	.	.	ENSG00000145675	ENST00000521381;ENST00000521657;ENST00000396611;ENST00000274335;ENST00000523807;ENST00000522084;ENST00000320694;ENST00000336483	.	.	.	5.13	5.13	0.70059	.	0.057954	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-10.0037	19.115	0.93334	0.0:1.0:0.0:0.0	.	.	.	.	X	334;334;334;334;64;64;34;64	.	ENSP00000274335:Y334X	Y	+	3	2	PIK3R1	67623928	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.882000	0.69714	2.822000	0.97130	0.563000	0.77884	TAC	PIK3R1	-	pfam_SH2,smart_SH2,pfscan_SH2,prints_PI3kinase_P85,prints_SH2	ENSG00000145675		0.393	PIK3R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIK3R1	HGNC	protein_coding	OTTHUMT00000254013.2		0.00	99	0	C	NM_181504		67588172	+1			no_errors	ENST00000396611	ensembl	human	known	74_37	nonsense	5.00	38	2	SNP	1.000	A
PIKFYVE	200576	genome.wustl.edu	37	2	209207315	209207315	+	Nonsense_Mutation	SNP	C	C	T			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr2:209207315C>T	ENST00000264380.4	+	32	5127	c.4969C>T	c.(4969-4971)Cga>Tga	p.R1657*		NM_015040.3	NP_055855.2	Q9Y2I7	FYV1_HUMAN	phosphoinositide kinase, FYVE finger containing	1657					cellular protein metabolic process (GO:0044267)|intracellular signal transduction (GO:0035556)|myelin assembly (GO:0032288)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phospholipid metabolic process (GO:0006644)|protein localization to nucleus (GO:0034504)|retrograde transport, endosome to Golgi (GO:0042147)|small molecule metabolic process (GO:0044281)	cell-cell junction (GO:0005911)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|early endosome membrane (GO:0031901)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|late endosome membrane (GO:0031902)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|vesicle membrane (GO:0012506)	1-phosphatidylinositol-3-phosphate 5-kinase activity (GO:0000285)|1-phosphatidylinositol-4-phosphate 5-kinase activity (GO:0016308)|ATP binding (GO:0005524)|phosphatidylinositol-3,5-bisphosphate 5-phosphatase activity (GO:0043813)|zinc ion binding (GO:0008270)	p.R1657*(1)		NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(14)|kidney(6)|large_intestine(25)|lung(40)|ovary(7)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	107						TGAACATGAACGAGTGCCCAT	0.338																																																	1	Substitution - Nonsense(1)	large_intestine(1)											174.0	156.0	162.0					2																	209207315		2203	4300	6503	SO:0001587	stop_gained	0			AB023198	CCDS2382.1, CCDS33368.1, CCDS54431.1	2q34	2014-01-15	2009-04-17	2009-04-17	ENSG00000115020	ENSG00000115020		"""Zinc fingers, FYVE domain containing"""	23785	protein-coding gene	gene with protein product	"""zinc finger, FYVE domain containing 29"""	609414	"""phosphatidylinositol-3-phosphate/phosphatidylinositol 5-kinase, type III"""	PIP5K3		9858586, 12270933	Standard	NM_015040		Approved	MGC40423, KIAA0981, PIKfyve, PIP5K, p235, ZFYVE29, FAB1	uc002vcz.3	Q9Y2I7	OTTHUMG00000132945	ENST00000264380.4:c.4969C>T	2.37:g.209207315C>T	ENSP00000264380:p.Arg1657*		Q08AR7|Q08AR8|Q53ST3|Q53T36|Q8N5H0|Q8NB67	Nonsense_Mutation	SNP	pfam_PInositol-4-P-5-kinase_core,pfam_Cpn60/TCP-1,pfam_DEP_dom,pfam_Znf_FYVE,superfamily_GroEL-like_apical_dom,superfamily_Znf_FYVE_PHD,smart_Znf_FYVE,smart_DEP_dom,smart_PInositol-4P-5-kinase_core_sub,pfscan_DEP_dom,pfscan_Znf_FYVE-rel	p.R1657*	ENST00000264380.4	37	c.4969	CCDS2382.1	2	.	.	.	.	.	.	.	.	.	.	C	46	12.107369	0.99636	.	.	ENSG00000115020	ENST00000264380	.	.	.	5.42	5.42	0.78866	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.14252	T	0.57	-16.3541	19.5723	0.95425	0.0:1.0:0.0:0.0	.	.	.	.	X	1657	.	ENSP00000264380:R1657X	R	+	1	2	PIKFYVE	208915560	1.000000	0.71417	1.000000	0.80357	0.917000	0.54804	4.178000	0.58284	2.695000	0.91970	0.557000	0.71058	CGA	PIKFYVE	-	NULL	ENSG00000115020		0.338	PIKFYVE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIKFYVE	HGNC	protein_coding	OTTHUMT00000256477.2		0.00	89	0	C	NM_015040		209207315	+1			no_errors	ENST00000264380	ensembl	human	known	74_37	nonsense	5.41	35	2	SNP	1.000	T
PIR	8544	genome.wustl.edu	37	X	15402994	15402994	+	3'UTR	SNP	T	T	C			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chrX:15402994T>C	ENST00000380421.3	-	0	1465				PIR_ENST00000380420.5_3'UTR|FIGF_ENST00000297904.3_5'Flank	NM_001018109.2|NM_003662.3	NP_001018119.1|NP_003653.1	O00625	PIR_HUMAN	pirin (iron-binding nuclear protein)						monocyte differentiation (GO:0030224)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|quercetin 2,3-dioxygenase activity (GO:0008127)|transcription cofactor activity (GO:0003712)			endometrium(1)|large_intestine(1)|lung(3)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	9	Hepatocellular(33;0.183)					ACAAAAACCATGTTATCACGT	0.328																																					Ovarian(180;1587 2015 10555 34192 51653)												0																																										SO:0001624	3_prime_UTR_variant	0			Y07868	CCDS14167.1	Xp22.31	2008-02-05			ENSG00000087842	ENSG00000087842			30048	protein-coding gene	gene with protein product		300931				9079676	Standard	NM_003662		Approved		uc004cwv.3	O00625	OTTHUMG00000021176	ENST00000380421.3:c.*132A>G	X.37:g.15402994T>C			Q5U0G0|Q6FHD2	RNA	SNP	-	NULL	ENST00000380421.3	37	NULL	CCDS14167.1	X																																																																																			PIR	-	-	ENSG00000087842		0.328	PIR-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PIR	HGNC	protein_coding	OTTHUMT00000055863.1	-	0.00	12	0	T	NM_003662		15402994	-1	tier1	-	no_errors	ENST00000492432	ensembl	human	known	74_37	rna	83.33	1	5	SNP	0.000	C
PLD1	5337	genome.wustl.edu	37	3	171379880	171379880	+	Missense_Mutation	SNP	T	T	C	rs568658302		TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr3:171379880T>C	ENST00000351298.4	-	20	2436	c.2310A>G	c.(2308-2310)atA>atG	p.I770M	PLD1_ENST00000356327.5_Missense_Mutation_p.I732M|PLD1_ENST00000340989.4_Missense_Mutation_p.I770M|PLD1_ENST00000342215.6_3'UTR	NM_002662.4	NP_002653.1	Q13393	PLD1_HUMAN	phospholipase D1, phosphatidylcholine-specific	770	Catalytic.				chemotaxis (GO:0006935)|defense response to Gram-positive bacterium (GO:0050830)|glycerophospholipid biosynthetic process (GO:0046474)|lipid catabolic process (GO:0016042)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylglycerol biosynthetic process (GO:0006655)|phospholipid metabolic process (GO:0006644)|Ras protein signal transduction (GO:0007265)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)	N-acylphosphatidylethanolamine-specific phospholipase D activity (GO:0070290)|phosphatidylinositol binding (GO:0035091)|phospholipase D activity (GO:0004630)			breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(15)|lung(27)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	63	all_cancers(22;4.53e-19)|Ovarian(172;0.00197)|Breast(254;0.186)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)		Choline(DB00122)	TGCTGTTCTCTATCACATGGA	0.448													T|||	1	0.000199681	0.0008	0.0	5008	,	,		20880	0.0		0.0	False		,,,				2504	0.0				NSCLC(149;2174 3517 34058)												0													117.0	111.0	113.0					3																	171379880		2203	4300	6503	SO:0001583	missense	0			U38545	CCDS3216.1, CCDS46957.1	3q26	2013-01-10	2006-02-17		ENSG00000075651	ENSG00000075651	3.1.4.4	"""Pleckstrin homology (PH) domain containing"""	9067	protein-coding gene	gene with protein product	"""choline phosphatase 1"""	602382				9858822, 8530346	Standard	NM_002662		Approved		uc003fhs.3	Q13393	OTTHUMG00000156947	ENST00000351298.4:c.2310A>G	3.37:g.171379880T>C	ENSP00000342793:p.Ile770Met			Missense_Mutation	SNP	pfam_Phox,pfam_PLipase_D/transphosphatidylase,pfam_Pleckstrin_homology,superfamily_Phox,smart_Phox,smart_Pleckstrin_homology,smart_PLipase_D/transphosphatidylase,pirsf_PLipase_D_euk,pfscan_Phox,pfscan_PLipase_D/transphosphatidylase	p.I770M	ENST00000351298.4	37	c.2310	CCDS3216.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	16.57|16.57	3.159047|3.159047	0.57368|0.57368	.|.	.|.	ENSG00000075651|ENSG00000075651	ENST00000356327;ENST00000351298;ENST00000340989|ENST00000446289	T;T;T|.	0.44083|.	0.93;0.93;0.93|.	5.51|5.51	-0.163|-0.163	0.13363|0.13363	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|.	0.85622|.	0.5739|.	H|H	0.98426|0.98426	4.23|4.23	0.80722|0.80722	D|D	1|1	D;D;D;D|.	0.89917|.	1.0;1.0;1.0;1.0|.	D;D;D;D|.	0.97110|.	1.0;0.999;1.0;1.0|.	D|.	0.84068|.	0.0378|.	10|.	0.87932|.	D|.	0|.	-23.703|-23.703	8.5713|8.5713	0.33572|0.33572	0.1219:0.0:0.3798:0.4983|0.1219:0.0:0.3798:0.4983	.|.	732;770;755;770|.	Q13393-2;Q13393-4;Q59EA4;Q13393|.	.;.;.;PLD1_HUMAN|.	M|W	732;770;770|33	ENSP00000348681:I732M;ENSP00000342793:I770M;ENSP00000340326:I770M|.	ENSP00000340326:I770M|.	I|X	-|-	3|2	3|0	PLD1|PLD1	172862574|172862574	1.000000|1.000000	0.71417|0.71417	0.978000|0.978000	0.43139|0.43139	0.638000|0.638000	0.38207|0.38207	1.560000|1.560000	0.36331|0.36331	-0.253000|-0.253000	0.09514|0.09514	0.383000|0.383000	0.25322|0.25322	ATA|TAG	PLD1	-	pirsf_PLipase_D_euk	ENSG00000075651		0.448	PLD1-001	KNOWN	basic|CCDS	protein_coding	PLD1	HGNC	protein_coding	OTTHUMT00000346730.2	-	0.00	63	0	T	NM_002662		171379880	-1	tier1	-	no_errors	ENST00000351298	ensembl	human	known	74_37	missense	10.00	36	4	SNP	0.999	C
PLXNB2	23654	genome.wustl.edu	37	22	50718132	50718132	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr22:50718132G>A	ENST00000449103.1	-	27	4456	c.4316C>T	c.(4315-4317)gCg>gTg	p.A1439V	PLXNB2_ENST00000359337.4_Missense_Mutation_p.A1439V			O15031	PLXB2_HUMAN	plexin B2	1439					brain development (GO:0007420)|neural tube closure (GO:0001843)|neuroblast proliferation (GO:0007405)|positive regulation of axonogenesis (GO:0050772)|regulation of cell shape (GO:0008360)|regulation of neuron migration (GO:2001222)|regulation of protein phosphorylation (GO:0001932)|regulation of Rho GTPase activity (GO:0032319)|semaphorin-plexin signaling pathway (GO:0071526)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)	GTPase activator activity (GO:0005096)|semaphorin receptor activity (GO:0017154)			breast(2)|central_nervous_system(4)|cervix(2)|endometrium(11)|kidney(4)|large_intestine(3)|liver(1)|lung(20)|ovary(5)|prostate(6)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	66		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		CTTCTGTACCGCATCCACCGG	0.617																																																	0													151.0	171.0	164.0					22																	50718132		1996	4140	6136	SO:0001583	missense	0				CCDS43035.1	22q13.33	2008-06-12			ENSG00000196576	ENSG00000196576		"""Plexins"""	9104	protein-coding gene	gene with protein product		604293				10520995, 12183458	Standard	NM_012401		Approved	MM1, KIAA0315, PLEXB2	uc003bkv.4	O15031	OTTHUMG00000150219	ENST00000449103.1:c.4316C>T	22.37:g.50718132G>A	ENSP00000409171:p.Ala1439Val		A6QRH0|Q7KZU3|Q9BSU7	Missense_Mutation	SNP	pfam_Plexin_cytoplasmic_RasGAP_dom,pfam_IPT,pfam_Semap_dom,pfam_Plexin_repeat,superfamily_Semap_dom,superfamily_Rho_GTPase_activation_prot,superfamily_Ig_E-set,superfamily_Plexin-like_fold,smart_Semap_dom,smart_Plexin-like_fold,smart_IPT,pfscan_Semap_dom	p.A1439V	ENST00000449103.1	37	c.4316	CCDS43035.1	22	.	.	.	.	.	.	.	.	.	.	G	17.21	3.331777	0.60853	.	.	ENSG00000196576	ENST00000449103;ENST00000359337;ENST00000399964	T;T	0.15139	2.45;2.45	4.17	4.17	0.49024	Plexin, cytoplasmic RasGAP domain (1);Rho GTPase activation protein (1);	0.000000	0.64402	D	0.000002	T	0.35098	0.0920	L	0.55103	1.725	0.80722	D	1	D	0.76494	0.999	D	0.65987	0.94	T	0.04509	-1.0946	10	0.36615	T	0.2	.	17.0055	0.86392	0.0:0.0:1.0:0.0	.	1439	O15031	PLXB2_HUMAN	V	1439;1439;71	ENSP00000409171:A1439V;ENSP00000352288:A1439V	ENSP00000352288:A1439V	A	-	2	0	PLXNB2	49060259	0.999000	0.42202	0.952000	0.39060	0.168000	0.22595	3.644000	0.54381	2.306000	0.77630	0.462000	0.41574	GCG	PLXNB2	-	pfam_Plexin_cytoplasmic_RasGAP_dom,superfamily_Rho_GTPase_activation_prot	ENSG00000196576		0.617	PLXNB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLXNB2	HGNC	protein_coding	OTTHUMT00000316874.3		0.00	97	0	G	NM_012401		50718132	-1			no_errors	ENST00000359337	ensembl	human	known	74_37	missense	5.00	55	3	SNP	1.000	A
PMFBP1	83449	genome.wustl.edu	37	16	72188212	72188212	+	Silent	SNP	C	C	T			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr16:72188212C>T	ENST00000237353.10	-	4	573	c.312G>A	c.(310-312)ttG>ttA	p.L104L	PMFBP1_ENST00000355636.6_5'UTR|PMFBP1_ENST00000537465.1_Silent_p.L104L|PMFBP1_ENST00000543746.1_5'UTR	NM_031293.2	NP_112583.2	Q8TBY8	PMFBP_HUMAN	polyamine modulated factor 1 binding protein 1	104						cytoplasm (GO:0005737)				NS(1)|breast(3)|endometrium(1)|kidney(2)|large_intestine(7)|lung(25)|ovary(2)|skin(3)|urinary_tract(1)	45		Ovarian(137;0.179)				AAGAAGTCTGCAACTCCTCTG	0.448																																																	0													204.0	184.0	191.0					16																	72188212		2198	4300	6498	SO:0001819	synonymous_variant	0			AF239683	CCDS32483.1	16q23.1	2008-08-04			ENSG00000118557	ENSG00000118557			17728	protein-coding gene	gene with protein product						11468771	Standard	NM_031293		Approved		uc002fcd.3	Q8TBY8	OTTHUMG00000167827	ENST00000237353.10:c.312G>A	16.37:g.72188212C>T			B3KVI9|H7BY07|Q8NA09|Q9BY16|Q9H0H4	Silent	SNP	NULL	p.L104	ENST00000237353.10	37	c.312	CCDS32483.1	16																																																																																			PMFBP1	-	NULL	ENSG00000118557		0.448	PMFBP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PMFBP1	HGNC	protein_coding	OTTHUMT00000396473.2		0.00	88	0	C	NM_031293		72188212	-1			no_errors	ENST00000537465	ensembl	human	known	74_37	silent	9.30	39	4	SNP	0.978	T
POM121	9883	genome.wustl.edu	37	7	72413094	72413094	+	Silent	SNP	C	C	T			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr7:72413094C>T	ENST00000434423.2	+	11	2562	c.2562C>T	c.(2560-2562)acC>acT	p.T854T	POM121_ENST00000446813.1_Silent_p.T589T|POM121_ENST00000257622.4_Silent_p.T589T|POM121_ENST00000395270.1_Silent_p.T589T|POM121_ENST00000358357.3_Silent_p.T589T			Q96HA1	P121A_HUMAN	POM121 transmembrane nucleoporin	854	Pore side. {ECO:0000255}.|Thr-rich.				carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	endoplasmic reticulum (GO:0005783)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)				NS(1)|breast(1)|endometrium(9)|kidney(4)|large_intestine(6)|lung(12)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	41		Lung NSC(55;0.163)				CGACCAGCACCGCCACTGCCG	0.602																																																	0													1.0	1.0	1.0					7																	72413094		376	1026	1402	SO:0001819	synonymous_variant	0			AB014518	CCDS5542.1, CCDS59059.1	7q11.23	2013-01-08	2012-03-13		ENSG00000196313	ENSG00000196313		"""-"""	19702	protein-coding gene	gene with protein product		615753	"""POM121 membrane glycoprotein (rat)"", ""POM121 membrane glycoprotein"""			8335683, 9734811, 17900573	Standard	NM_172020		Approved	KIAA0618, DKFZP586G1822, DKFZP586P2220, POM121A	uc003twk.2	Q96HA1	OTTHUMG00000023527	ENST00000434423.2:c.2562C>T	7.37:g.72413094C>T			A6NFS9|A8CDT4|A8K933|A8MXF9|O75115|Q96DI0|Q9H9X1|Q9Y2N3|Q9Y4S7	Silent	SNP	NULL	p.T854	ENST00000434423.2	37	c.2562		7																																																																																			POM121	-	NULL	ENSG00000196313		0.602	POM121-001	KNOWN	basic|appris_candidate_longest	protein_coding	POM121	HGNC	protein_coding	OTTHUMT00000347344.1	-	0.00	25	0	C			72413094	+1	tier1	-	no_errors	ENST00000434423	ensembl	human	known	74_37	silent	24.00	19	6	SNP	0.028	T
PPP1R18	170954	genome.wustl.edu	37	6	30652836	30652836	+	Silent	SNP	T	T	C			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr6:30652836T>C	ENST00000274853.3	-	1	2836	c.960A>G	c.(958-960)gaA>gaG	p.E320E	PPP1R18_ENST00000399199.3_Silent_p.E320E|PPP1R18_ENST00000488324.1_Intron|NRM_ENST00000470733.1_5'Flank	NM_133471.3	NP_597728.1	Q6NYC8	PPR18_HUMAN	protein phosphatase 1, regulatory subunit 18	320						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)											TCTCGCCATCTTCCACAGGCC	0.582																																																	0													84.0	100.0	94.0					6																	30652836		1454	2687	4141	SO:0001819	synonymous_variant	0			AK097089	CCDS43444.1	6p21.3	2012-04-17	2011-10-11	2011-10-11	ENSG00000146112	ENSG00000146112		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	29413	protein-coding gene	gene with protein product	"""protein phosphatase 1 F-actin cytoskeleton targeting subunit"""	610990	"""KIAA1949"""	KIAA1949		11853319	Standard	NM_001134870		Approved	phostensin	uc003nra.3	Q6NYC8	OTTHUMG00000031237	ENST00000274853.3:c.960A>G	6.37:g.30652836T>C			A2AB01|A2AIB8|A4UBI6|A6NCB7|A8MSS7|B7ZCV7|Q68CK8|Q6ZTV1|Q6ZUJ6|Q8NDQ4|Q8TF52|Q9BRL9	Silent	SNP	NULL	p.E320	ENST00000274853.3	37	c.960	CCDS43444.1	6																																																																																			PPP1R18	-	NULL	ENSG00000146112		0.582	PPP1R18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1R18	HGNC	protein_coding	OTTHUMT00000076498.2	-	0.00	25	0	T	NM_133471		30652836	-1	tier1	-	no_errors	ENST00000274853	ensembl	human	known	74_37	silent	44.44	5	4	SNP	0.987	C
GRIN3A	116443	genome.wustl.edu	37	9	104356841	104356841	+	Intron	SNP	G	G	T			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr9:104356841G>T	ENST00000361820.3	-	7	3367				PPP3R2_ENST00000374806.1_Silent_p.G124G	NM_133445.2	NP_597702.2	Q8TCU5	NMD3A_HUMAN	glutamate receptor, ionotropic, N-methyl-D-aspartate 3A						calcium ion transport (GO:0006816)|dendrite development (GO:0016358)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|prepulse inhibition (GO:0060134)|response to ethanol (GO:0045471)|rhythmic process (GO:0048511)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glycine binding (GO:0016594)|identical protein binding (GO:0042802)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|neurotransmitter binding (GO:0042165)|protein phosphatase 2A binding (GO:0051721)			breast(2)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(12)|lung(44)|ovary(4)|pancreas(1)|skin(7)|upper_aerodigestive_tract(1)	80		Acute lymphoblastic leukemia(62;0.0568)			Acamprosate(DB00659)|Acetylcysteine(DB06151)|Amantadine(DB00915)|Atomoxetine(DB00289)|Chloroprocaine(DB01161)|Dextromethorphan(DB00514)|Ethanol(DB00898)|Ethopropazine(DB00392)|Felbamate(DB00949)|Gabapentin(DB00996)|Halothane(DB01159)|Ketamine(DB01221)|Ketobemidone(DB06738)|Memantine(DB01043)|Methadone(DB00333)|Milnacipran(DB04896)|Orphenadrine(DB01173)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Procaine(DB00721)|Secobarbital(DB00418)|Tramadol(DB00193)	TCAGGTTGTTGCCCACCATCA	0.502																																																	0													121.0	108.0	113.0					9																	104356841		2203	4300	6503	SO:0001627	intron_variant	0				CCDS6758.1	9q31.1	2012-08-29			ENSG00000198785	ENSG00000198785		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	16767	protein-coding gene	gene with protein product		606650					Standard	NM_133445		Approved	GluN3A	uc004bbp.2	Q8TCU5	OTTHUMG00000020387	ENST00000361820.3:c.2767-15199C>A	9.37:g.104356841G>T			B3DLF9|Q5VTR3|Q8TF29|Q8WXI6	Silent	SNP	pfam_EF_hand_dom,smart_EF_hand_dom,pfscan_EF_hand_dom,prints_Recoverin	p.G124	ENST00000361820.3	37	c.372	CCDS6758.1	9																																																																																			PPP3R2	-	pfscan_EF_hand_dom,prints_Recoverin	ENSG00000188386		0.502	GRIN3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP3R2	HGNC	protein_coding	OTTHUMT00000053453.1	-	0.00	48	0	G			104356841	-1	tier1	-	no_errors	ENST00000374806	ensembl	human	known	74_37	silent	7.69	48	4	SNP	0.001	T
PRAMEF13	400736	genome.wustl.edu	37	1	13448426	13448426	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr1:13448426G>C	ENST00000376132.3	-	4	1151	c.1049C>G	c.(1048-1050)tCt>tGt	p.S350C		NM_001024661.1	NP_001019832.1	Q5VWM6	PRA13_HUMAN	PRAME family member 13	350					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)					breast(1)|large_intestine(1)|lung(3)|skin(2)	7	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.00224)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;9.86e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|COAD - Colon adenocarcinoma(227;0.000502)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		GGTTTCGAGAGAGGCAGCAAT	0.552																																																	0													9.0	9.0	9.0					1																	13448426		2004	4139	6143	SO:0001583	missense	0					1p36.21	2013-01-17			ENSG00000204495			"""-"""	13262	protein-coding gene	gene with protein product							Standard	NG_005159		Approved	OTTHUMG00000008034	uc010obi.1	Q5VWM6	OTTHUMG00000008034	ENST00000376132.3:c.1049C>G	1.37:g.13448426G>C	ENSP00000365302:p.Ser350Cys			Missense_Mutation	SNP	NULL	p.S350C	ENST00000376132.3	37	c.1049	CCDS41257.1	1	.	.	.	.	.	.	.	.	.	.	G	7.992	0.753499	0.15778	.	.	ENSG00000204495	ENST00000376132	T	0.09630	2.96	1.2	1.2	0.21068	.	0.310944	0.29159	N	0.012966	T	0.11410	0.0278	L	0.27053	0.805	0.09310	N	1	B;P	0.35872	0.343;0.525	P;B	0.48524	0.58;0.305	T	0.11155	-1.0599	10	0.87932	D	0	.	5.7735	0.18267	0.0:0.0:1.0:0.0	.	350;350	Q5VWM6;A6NFR9	PRA13_HUMAN;.	C	350	ENSP00000365302:S350C	ENSP00000365302:S350C	S	-	2	0	PRAMEF13	13321013	0.017000	0.18338	0.007000	0.13788	0.022000	0.10575	1.418000	0.34782	0.947000	0.37659	0.298000	0.19748	TCT	PRAMEF13	-	NULL	ENSG00000204495		0.552	PRAMEF13-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	PRAMEF13	HGNC	protein_coding	OTTHUMT00000022040.1	-	0.00	38	0	G	XM_375688		13448426	-1	tier1	-	no_errors	ENST00000376132	ensembl	human	known	74_37	missense	55.00	9	11	SNP	0.009	C
PROSER2	254427	genome.wustl.edu	37	10	11911789	11911789	+	Frame_Shift_Del	DEL	G	G	-			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr10:11911789delG	ENST00000277570.5	+	4	846	c.692delG	c.(691-693)cggfs	p.R231fs	PROSER2-AS1_ENST00000453242.1_RNA|PROSER2-AS1_ENST00000445498.1_RNA|PROSER2_ENST00000379200.1_Frame_Shift_Del_p.R35fs	NM_153256.3	NP_694988.3	Q86WR7	PRSR2_HUMAN	proline and serine rich 2	231	Pro-rich.																CCTGCCGCCCGGGGGCCCCGC	0.736																																																	0										21,3521		5,11,1755	3.0	4.0	4.0			-10.1	0.0	10		4	44,7050		10,24,3513	no	frameshift	C10orf47	NM_153256.3		15,35,5268	A1A1,A1R,RR		0.6202,0.5929,0.6111			11911789	65,10571	1932	3859	5791	SO:0001589	frameshift_variant	0			BC017269	CCDS7085.1	10p14	2014-02-19	2014-02-19	2012-12-05	ENSG00000148426	ENSG00000148426			23728	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 47"", ""proline and serine-rich protein 2"""	C10orf47		12477932	Standard	NM_153256		Approved	MGC35403	uc001ikx.3	Q86WR7	OTTHUMG00000017673	ENST00000277570.5:c.692delG	10.37:g.11911789delG	ENSP00000277570:p.Arg231fs		D3DRR8|Q5W0J9|Q5W0K0|Q5W0K1|Q5W0K2|Q6PJC8|Q8N317	Frame_Shift_Del	DEL	NULL	p.R234fs	ENST00000277570.5	37	c.692	CCDS7085.1	10																																																																																			PROSER2	-	NULL	ENSG00000148426		0.736	PROSER2-005	KNOWN	basic|appris_principal|CCDS	protein_coding	PROSER2	HGNC	protein_coding	OTTHUMT00000090189.2		0.00	8	0	G	NM_153256		11911789	+1			no_errors	ENST00000277570	ensembl	human	known	74_37	frame_shift_del	33.33	4	2	DEL	0.000	0
PSD2	84249	genome.wustl.edu	37	5	139192910	139192910	+	Nonsense_Mutation	SNP	G	G	T			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr5:139192910G>T	ENST00000274710.3	+	3	593	c.388G>T	c.(388-390)Gag>Tag	p.E130*		NM_032289.2	NP_115665.1	Q9BQI7	PSD2_HUMAN	pleckstrin and Sec7 domain containing 2	130					neuron differentiation (GO:0030182)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|phospholipid binding (GO:0005543)			breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(10)|liver(2)|lung(15)|ovary(1)|prostate(2)	38			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGGTCCCGGGGAGCCAGATGT	0.602																																																	0													77.0	77.0	77.0					5																	139192910		2203	4299	6502	SO:0001587	stop_gained	0			AL136559	CCDS4216.1	5q31.3	2013-01-10			ENSG00000146005	ENSG00000146005		"""Pleckstrin homology (PH) domain containing"""	19092	protein-coding gene	gene with protein product							Standard	NM_032289		Approved	DKFZp761B0514	uc003leu.1	Q9BQI7	OTTHUMG00000129240	ENST00000274710.3:c.388G>T	5.37:g.139192910G>T	ENSP00000274710:p.Glu130*		D3DQD3|Q8N3J8	Nonsense_Mutation	SNP	pfam_Sec7_dom,pfam_Pleckstrin_homology,superfamily_Sec7_dom,smart_Sec7_dom,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_Sec7_dom,prints_PH_dom-spectrin-type	p.E130*	ENST00000274710.3	37	c.388	CCDS4216.1	5	.	.	.	.	.	.	.	.	.	.	G	36	5.730311	0.96856	.	.	ENSG00000146005	ENST00000274710	.	.	.	3.99	3.99	0.46301	.	0.376328	0.20847	N	0.084594	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.30854	T	0.27	.	13.2809	0.60214	0.0:0.0:1.0:0.0	.	.	.	.	X	130	.	ENSP00000274710:E130X	E	+	1	0	PSD2	139173094	1.000000	0.71417	0.989000	0.46669	0.658000	0.38924	5.722000	0.68485	2.214000	0.71695	0.462000	0.41574	GAG	PSD2	-	NULL	ENSG00000146005		0.602	PSD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSD2	HGNC	protein_coding	OTTHUMT00000251339.1	-	0.00	107	0	G	NM_032289		139192910	+1	tier1	-	no_errors	ENST00000274710	ensembl	human	known	74_37	nonsense	52.94	16	18	SNP	0.986	T
PTGS1	5742	genome.wustl.edu	37	9	125143816	125143816	+	Silent	SNP	G	G	A			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr9:125143816G>A	ENST00000362012.2	+	6	668	c.663G>A	c.(661-663)aaG>aaA	p.K221K	PTGS1_ENST00000223423.4_Silent_p.K221K|PTGS1_ENST00000373698.5_Silent_p.K112K|PTGS1_ENST00000540753.1_Silent_p.K196K	NM_000962.3|NM_001271164.1|NM_001271367.1|NM_080591.2	NP_000953.2|NP_001258093.1|NP_001258296.1|NP_542158.1	P23219	PGH1_HUMAN	prostaglandin-endoperoxide synthase 1 (prostaglandin G/H synthase and cyclooxygenase)	221					arachidonic acid metabolic process (GO:0019369)|cyclooxygenase pathway (GO:0019371)|inflammatory response (GO:0006954)|lipid metabolic process (GO:0006629)|prostaglandin biosynthetic process (GO:0001516)|regulation of blood pressure (GO:0008217)|regulation of cell proliferation (GO:0042127)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|photoreceptor outer segment (GO:0001750)	dioxygenase activity (GO:0051213)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)|prostaglandin-endoperoxide synthase activity (GO:0004666)			large_intestine(3)|ovary(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	8					Acetaminophen(DB00316)|Acetylsalicylic acid(DB00945)|Antipyrine(DB01435)|Antrafenine(DB01419)|Balsalazide(DB01014)|Bortezomib(DB00188)|Bromfenac(DB00963)|Candesartan(DB00796)|Carprofen(DB00821)|Carvedilol(DB01136)|Chlorpropamide(DB00672)|Dapsone(DB00250)|Desmopressin(DB00035)|Diazepam(DB00829)|Diclofenac(DB00586)|Diethylcarbamazine(DB00711)|Diflunisal(DB00861)|Dihomo-gamma-linolenic acid(DB00154)|Diphenhydramine(DB01075)|Dronabinol(DB00470)|Eletriptan(DB00216)|Eszopiclone(DB00402)|Etodolac(DB00749)|Etoposide(DB00773)|Fenoprofen(DB00573)|Flurbiprofen(DB00712)|Hexobarbital(DB01355)|Hydromorphone(DB00327)|Ibuprofen(DB01050)|Icosapent(DB00159)|Ifosfamide(DB01181)|Imatinib(DB00619)|Indomethacin(DB00328)|Irbesartan(DB01029)|Ketamine(DB01221)|Ketobemidone(DB06738)|Ketoprofen(DB01009)|Ketorolac(DB00465)|Lornoxicam(DB06725)|Lumiracoxib(DB01283)|Magnesium salicylate(DB01397)|Meclofenamic acid(DB00939)|Mefenamic acid(DB00784)|Meloxicam(DB00814)|Mesalazine(DB00244)|Minoxidil(DB00350)|Montelukast(DB00471)|Nabumetone(DB00461)|Naproxen(DB00788)|Nateglinide(DB00731)|Nepafenac(DB06802)|Niflumic Acid(DB04552)|Nortriptyline(DB00540)|Oxaprozin(DB00991)|Phenylbutazone(DB00812)|Pioglitazone(DB01132)|Piroxicam(DB00554)|Rosiglitazone(DB00412)|Salicylate-sodium(DB01398)|Salicylic acid(DB00936)|Salsalate(DB01399)|Sulfamethoxazole(DB01015)|Sulfasalazine(DB00795)|Sulindac(DB00605)|Suprofen(DB00870)|Tenoxicam(DB00469)|Terbinafine(DB00857)|Thalidomide(DB01041)|Tiaprofenic acid(DB01600)|Tolmetin(DB00500)|Torasemide(DB00214)|Trabectedin(DB05109)|Triflusal(DB08814)|Trisalicylate-choline(DB01401)|Valproic Acid(DB00313)|Voriconazole(DB00582)|Zafirlukast(DB00549)|Zileuton(DB00744)|Zolpidem(DB00425)|Zopiclone(DB01198)	GCTTCACCAAGGCCTTGGGCC	0.567																																																	0													59.0	64.0	62.0					9																	125143816		2203	4300	6503	SO:0001819	synonymous_variant	0			M59979	CCDS6842.1, CCDS6843.1, CCDS59520.1, CCDS59521.1, CCDS75895.1	9q32-q33.3	2008-02-05			ENSG00000095303	ENSG00000095303	1.14.99.1		9604	protein-coding gene	gene with protein product		176805				2512924, 1907252	Standard	NM_000962		Approved	COX1, PGHS-1, PTGHS	uc004bmg.2	P23219	OTTHUMG00000020605	ENST00000362012.2:c.663G>A	9.37:g.125143816G>A			A8K1V7|B4DHQ2|B4E2S5|Q15122|Q3HY28|Q3HY29|Q5T7T6|Q5T7T7|Q5T7T8	Silent	SNP	pfam_Haem_peroxidase_animal,superfamily_Haem_peroxidase,pfscan_EG-like_dom,pfscan_Haem_peroxidase_animal,prints_Haem_peroxidase_animal_subgr	p.K221	ENST00000362012.2	37	c.663	CCDS6842.1	9																																																																																			PTGS1	-	pfam_Haem_peroxidase_animal,superfamily_Haem_peroxidase,pfscan_Haem_peroxidase_animal	ENSG00000095303		0.567	PTGS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTGS1	HGNC	protein_coding	OTTHUMT00000053933.1	-	0.00	79	0	G			125143816	+1	tier1	-	no_errors	ENST00000362012	ensembl	human	known	74_37	silent	10.39	69	8	SNP	0.998	A
PTPN4	5775	genome.wustl.edu	37	2	120709667	120709667	+	Missense_Mutation	SNP	G	G	T	rs549949257		TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr2:120709667G>T	ENST00000263708.2	+	19	2546	c.1775G>T	c.(1774-1776)aGa>aTa	p.R592I	PTPN4_ENST00000544261.1_Missense_Mutation_p.R225I	NM_002830.3	NP_002821.1	P29074	PTN4_HUMAN	protein tyrosine phosphatase, non-receptor type 4 (megakaryocyte)	592					peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytoskeleton (GO:0005856)	non-membrane spanning protein tyrosine phosphatase activity (GO:0004726)			endometrium(3)|kidney(2)|large_intestine(7)|lung(15)|ovary(2)|urinary_tract(1)	30					Alendronate(DB00630)	AGTTGTGAGAGACATTCTGGG	0.398																																																	0													170.0	159.0	162.0					2																	120709667		2203	4300	6503	SO:0001583	missense	0				CCDS2129.1	2q14.2	2011-06-09			ENSG00000088179	ENSG00000088179		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9656	protein-coding gene	gene with protein product		176878				1648233	Standard	NM_002830		Approved	PTPMEG	uc002tmf.2	P29074	OTTHUMG00000131436	ENST00000263708.2:c.1775G>T	2.37:g.120709667G>T	ENSP00000263708:p.Arg592Ile		B2RBV8|Q9UDA7	Missense_Mutation	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_FERM_PH-like_C,pfam_FERM_central,pfam_FERM_N,pfam_PDZ,pfam_FERM-adjacent,superfamily_FERM_central,superfamily_PDZ,smart_Band_41_domain,smart_PDZ,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pirsf_Tyr_Pase_non-rcpt_typ-3/4,pfscan_FERM_domain,pfscan_PDZ,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt,prints_Band_41_fam,prints_Ez/rad/moesin_like	p.R592I	ENST00000263708.2	37	c.1775	CCDS2129.1	2	.	.	.	.	.	.	.	.	.	.	G	16.45	3.127008	0.56721	.	.	ENSG00000088179	ENST00000263708;ENST00000544261	T;T	0.72725	-0.68;2.87	6.07	2.23	0.28157	PDZ/DHR/GLGF (3);	0.157318	0.64402	D	0.000001	T	0.56470	0.1987	N	0.20685	0.6	0.45318	D	0.998312	P	0.38863	0.65	B	0.41691	0.364	T	0.53975	-0.8362	10	0.59425	D	0.04	.	9.5864	0.39519	0.1205:0.2184:0.6611:0.0	.	592	P29074	PTN4_HUMAN	I	592;225	ENSP00000263708:R592I;ENSP00000445841:R225I	ENSP00000263708:R592I	R	+	2	0	PTPN4	120426137	1.000000	0.71417	0.998000	0.56505	0.999000	0.98932	1.120000	0.31271	0.132000	0.18615	0.655000	0.94253	AGA	PTPN4	-	pfam_PDZ,superfamily_PDZ,smart_PDZ,pirsf_Tyr_Pase_non-rcpt_typ-3/4	ENSG00000088179		0.398	PTPN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPN4	HGNC	protein_coding	OTTHUMT00000254233.2	-	0.00	78	0	G			120709667	+1	tier1	-	no_errors	ENST00000263708	ensembl	human	known	74_37	missense	6.06	62	4	SNP	1.000	T
PVRL3	25945	genome.wustl.edu	37	3	110841020	110841020	+	Frame_Shift_Del	DEL	A	A	-			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr3:110841020delA	ENST00000485303.1	+	4	1127	c.852delA	c.(850-852)agafs	p.R284fs	PVRL3_ENST00000493615.1_Frame_Shift_Del_p.R261fs|PVRL3_ENST00000319792.3_Frame_Shift_Del_p.R284fs	NM_001243286.1|NM_015480.2	NP_001230215.1|NP_056295.1	Q9NQS3	PVRL3_HUMAN	poliovirus receptor-related 3	284	Ig-like C2-type 2.			R -> G (in Ref. 2; BAC11404). {ECO:0000305}.	adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|fertilization (GO:0009566)|homophilic cell adhesion (GO:0007156)|lens morphogenesis in camera-type eye (GO:0002089)|retina morphogenesis in camera-type eye (GO:0060042)|single organismal cell-cell adhesion (GO:0016337)	apical junction complex (GO:0043296)|cell-cell adherens junction (GO:0005913)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	cell adhesion molecule binding (GO:0050839)|protein homodimerization activity (GO:0042803)			breast(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(3)|lung(7)|upper_aerodigestive_tract(3)	19						TTGTAGGAAGAAAAGGTGTTA	0.343																																																	0													95.0	93.0	93.0					3																	110841020		2203	4300	6503	SO:0001589	frameshift_variant	0			AF282874	CCDS2957.1, CCDS58842.1, CCDS58843.1	3q13	2013-01-29			ENSG00000177707	ENSG00000177707		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17664	protein-coding gene	gene with protein product		607147				11024295	Standard	NM_015480		Approved	nectin-3, PPR3, PVRR3, DKFZP566B0846, CDw113, CD113	uc003dxt.2	Q9NQS3	OTTHUMG00000159239	ENST00000485303.1:c.852delA	3.37:g.110841020delA	ENSP00000418070:p.Arg284fs		E9PFR0|Q6NVZ3|Q8NC05|Q8WVU4|Q9BVA9|Q9Y412	Frame_Shift_Del	DEL	pfam_CD80_C2-set,pfam_Ig_V-set,pfam_Ig_I-set,smart_Ig_sub,pfscan_Ig-like_dom	p.G286fs	ENST00000485303.1	37	c.852	CCDS2957.1	3																																																																																			PVRL3	-	pfscan_Ig-like_dom	ENSG00000177707		0.343	PVRL3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PVRL3	HGNC	protein_coding	OTTHUMT00000354045.1		0.00	63	0	A	NM_015480		110841020	+1	tier1		no_errors	ENST00000485303	ensembl	human	known	74_37	frame_shift_del	8.70	21	2	DEL	1.000	-
QRICH2	84074	genome.wustl.edu	37	17	74287108	74287108	+	Silent	SNP	G	G	A			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr17:74287108G>A	ENST00000262765.5	-	4	3381	c.3202C>T	c.(3202-3204)Ctg>Ttg	p.L1068L		NM_032134.1	NP_115510.1	Q9H0J4	QRIC2_HUMAN	glutamine rich 2	1068										breast(3)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(17)|ovary(4)|pancreas(2)|prostate(3)|skin(2)|stomach(4)	62						ATCTGTGCCAGCAGGAACTGG	0.542																																																	0													83.0	79.0	80.0					17																	74287108		2203	4300	6503	SO:0001819	synonymous_variant	0			AK058102	CCDS32741.1	17q25.1	2009-03-19			ENSG00000129646	ENSG00000129646			25326	protein-coding gene	gene with protein product							Standard	NM_032134		Approved	DKFZP434P0316	uc002jrd.1	Q9H0J4	OTTHUMG00000167578	ENST00000262765.5:c.3202C>T	17.37:g.74287108G>A			A2RRE1|Q96LM3	Silent	SNP	NULL	p.L1068	ENST00000262765.5	37	c.3202	CCDS32741.1	17																																																																																			QRICH2	-	NULL	ENSG00000129646		0.542	QRICH2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	QRICH2	HGNC	protein_coding	OTTHUMT00000395140.1		0.00	73	0	G	NM_032134		74287108	-1			no_errors	ENST00000262765	ensembl	human	known	74_37	silent	6.25	44	3	SNP	0.009	A
RAD9B	144715	genome.wustl.edu	37	12	110956488	110956488	+	Silent	SNP	C	C	T			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr12:110956488C>T	ENST00000409778.3	+	5	420	c.396C>T	c.(394-396)agC>agT	p.S132S	RAD9B_ENST00000409300.1_Silent_p.S201S|RAD9B_ENST00000433301.1_3'UTR|RAD9B_ENST00000392672.4_Silent_p.S201S|RAD9B_ENST00000409425.1_Silent_p.S129S|RAD9B_ENST00000409246.1_Silent_p.S129S			Q6WBX8	RAD9B_HUMAN	RAD9 homolog B (S. pombe)	152					DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|DNA replication (GO:0006260)	checkpoint clamp complex (GO:0030896)|nucleoplasm (GO:0005654)				endometrium(1)|large_intestine(2)|lung(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	7						CAGATTTGAGCAATGCTGTAC	0.333																																																	0													69.0	69.0	69.0					12																	110956488		2203	4299	6502	SO:0001819	synonymous_variant	0				CCDS9148.2, CCDS66469.1, CCDS73526.1, CCDS73527.1	12q24.13	2008-12-15	2008-12-15		ENSG00000151164	ENSG00000151164			21700	protein-coding gene	gene with protein product		608368					Standard	NM_152442		Approved	FLJ40346	uc001trf.4	Q6WBX8	OTTHUMG00000152952	ENST00000409778.3:c.396C>T	12.37:g.110956488C>T			Q5U5K0|Q6NVJ1|Q6ZVT7|Q8N7T9|Q96LI8	Silent	SNP	pfam_Rad9/Ddc1,pirsf_Rad9	p.S201	ENST00000409778.3	37	c.603		12																																																																																			RAD9B	-	pfam_Rad9/Ddc1,pirsf_Rad9	ENSG00000151164		0.333	RAD9B-009	NOVEL	basic|exp_conf	protein_coding	RAD9B	HGNC	protein_coding	OTTHUMT00000404634.1		0.00	82	0	C	NM_152442		110956488	+1			no_errors	ENST00000392672	ensembl	human	known	74_37	silent	5.97	63	4	SNP	0.004	T
RAP1GAP2	23108	genome.wustl.edu	37	17	2929399	2929399	+	Missense_Mutation	SNP	T	T	A			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr17:2929399T>A	ENST00000254695.8	+	20	1939	c.1849T>A	c.(1849-1851)Tgc>Agc	p.C617S	RAP1GAP2_ENST00000542807.1_Missense_Mutation_p.C617S|RAP1GAP2_ENST00000366401.4_Missense_Mutation_p.C602S|RAP1GAP2_ENST00000540393.2_Missense_Mutation_p.C598S	NM_015085.4	NP_055900.4	Q684P5	RPGP2_HUMAN	RAP1 GTPase activating protein 2	617	Ser-rich.				negative regulation of neuron projection development (GO:0010977)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|neuron projection (GO:0043005)|nuclear membrane (GO:0031965)	Rap GTPase activator activity (GO:0046582)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)	11						TCCGGAAATCTGCCCCAACAA	0.582																																																	0													45.0	48.0	47.0					17																	2929399		2031	4186	6217	SO:0001583	missense	0			AB028962	CCDS45573.1, CCDS45574.1	17p13.3	2009-09-14	2009-09-14	2009-09-14		ENSG00000132359			29176	protein-coding gene	gene with protein product			"""GTPase activating RANGAP domain-like 4"", ""GTPase activating Rap/RanGAP domain-like 4"""	GARNL4		15632203	Standard	NM_015085		Approved	KIAA1039	uc010ckd.3	Q684P5		ENST00000254695.8:c.1849T>A	17.37:g.2929399T>A	ENSP00000254695:p.Cys617Ser		B2RTY5|Q684P4|Q6AI00|Q6ZVF0|Q9UPW2	Missense_Mutation	SNP	pfam_Rap_GAP_dom,pfscan_Rap_GAP_dom	p.C617S	ENST00000254695.8	37	c.1849	CCDS45573.1	17	.	.	.	.	.	.	.	.	.	.	T	15.05	2.718842	0.48622	.	.	ENSG00000132359	ENST00000254695;ENST00000366401;ENST00000540393;ENST00000542807	D;D;D;D	0.88586	-2.4;-2.39;-2.4;-2.4	5.48	4.4	0.53042	.	0.084181	0.85682	D	0.000000	D	0.83640	0.5298	M	0.63428	1.95	0.37026	D	0.896466	P;P	0.41848	0.763;0.651	B;B	0.39840	0.311;0.165	T	0.79748	-0.1673	10	0.09084	T	0.74	-22.0793	6.8396	0.23955	0.0:0.0771:0.1508:0.7721	.	602;617	Q684P5-2;Q684P5	.;RPGP2_HUMAN	S	617;602;598;617	ENSP00000254695:C617S;ENSP00000389824:C602S;ENSP00000439688:C598S;ENSP00000444890:C617S	ENSP00000254695:C617S	C	+	1	0	RAP1GAP2	2876149	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	4.324000	0.59228	0.923000	0.37045	0.459000	0.35465	TGC	RAP1GAP2	-	NULL	ENSG00000132359		0.582	RAP1GAP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RAP1GAP2	HGNC	protein_coding	OTTHUMT00000438208.2	-	0.00	60	0	T			2929399	+1	tier1	-	no_errors	ENST00000254695	ensembl	human	known	74_37	missense	7.02	53	4	SNP	1.000	A
RAP1GAP2	23108	genome.wustl.edu	37	17	2929685	2929685	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr17:2929685G>T	ENST00000254695.8	+	21	1997	c.1907G>T	c.(1906-1908)cGc>cTc	p.R636L	RAP1GAP2_ENST00000542807.1_Missense_Mutation_p.R636L|RAP1GAP2_ENST00000366401.4_Missense_Mutation_p.R621L|RAP1GAP2_ENST00000540393.2_Missense_Mutation_p.R617L	NM_015085.4	NP_055900.4	Q684P5	RPGP2_HUMAN	RAP1 GTPase activating protein 2	636	Ser-rich.				negative regulation of neuron projection development (GO:0010977)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|neuron projection (GO:0043005)|nuclear membrane (GO:0031965)	Rap GTPase activator activity (GO:0046582)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)	11						GCCATCTCCCGCTCCTCCTCC	0.667																																																	0													16.0	19.0	18.0					17																	2929685		2010	4068	6078	SO:0001583	missense	0			AB028962	CCDS45573.1, CCDS45574.1	17p13.3	2009-09-14	2009-09-14	2009-09-14		ENSG00000132359			29176	protein-coding gene	gene with protein product			"""GTPase activating RANGAP domain-like 4"", ""GTPase activating Rap/RanGAP domain-like 4"""	GARNL4		15632203	Standard	NM_015085		Approved	KIAA1039	uc010ckd.3	Q684P5		ENST00000254695.8:c.1907G>T	17.37:g.2929685G>T	ENSP00000254695:p.Arg636Leu		B2RTY5|Q684P4|Q6AI00|Q6ZVF0|Q9UPW2	Missense_Mutation	SNP	pfam_Rap_GAP_dom,pfscan_Rap_GAP_dom	p.R636L	ENST00000254695.8	37	c.1907	CCDS45573.1	17	.	.	.	.	.	.	.	.	.	.	G	27.4	4.825087	0.90955	.	.	ENSG00000132359	ENST00000254695;ENST00000366401;ENST00000540393;ENST00000542807	D;D;D;D	0.94613	-3.47;-3.45;-3.46;-3.47	5.35	5.35	0.76521	.	0.000000	0.85682	D	0.000000	D	0.97102	0.9053	M	0.82630	2.6	0.53005	D	0.999968	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.997	D	0.97447	1.0025	10	0.87932	D	0	-33.9952	13.4508	0.61169	0.0781:0.0:0.9219:0.0	.	621;636	Q684P5-2;Q684P5	.;RPGP2_HUMAN	L	636;621;617;636	ENSP00000254695:R636L;ENSP00000389824:R621L;ENSP00000439688:R617L;ENSP00000444890:R636L	ENSP00000254695:R636L	R	+	2	0	RAP1GAP2	2876435	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	6.901000	0.75693	2.530000	0.85305	0.462000	0.41574	CGC	RAP1GAP2	-	NULL	ENSG00000132359		0.667	RAP1GAP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RAP1GAP2	HGNC	protein_coding	OTTHUMT00000438208.2	-	0.00	61	0	G			2929685	+1	tier1	-	no_errors	ENST00000254695	ensembl	human	known	74_37	missense	6.78	55	4	SNP	1.000	T
RFX3	5991	genome.wustl.edu	37	9	3248085	3248085	+	Nonsense_Mutation	SNP	C	C	A			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr9:3248085C>A	ENST00000382004.3	-	16	2226	c.1915G>T	c.(1915-1917)Gaa>Taa	p.E639*	RFX3_ENST00000358730.2_Nonsense_Mutation_p.E639*|RFX3_ENST00000302303.1_Nonsense_Mutation_p.E639*	NM_001282116.1|NM_134428.1	NP_001269045.1|NP_602304.1	P48380	RFX3_HUMAN	regulatory factor X, 3 (influences HLA class II expression)	639					cell maturation (GO:0048469)|cilium assembly (GO:0042384)|cilium-dependent cell motility (GO:0060285)|endocrine pancreas development (GO:0031018)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type B pancreatic cell development (GO:2000078)|regulation of insulin secretion (GO:0050796)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)|type B pancreatic cell maturation (GO:0072560)	nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(11)|large_intestine(3)|lung(14)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	40				GBM - Glioblastoma multiforme(50;0.00124)|Lung(2;0.0337)		ACACGATGTTCTACTAAGTAA	0.458																																																	0													86.0	85.0	86.0					9																	3248085		2203	4299	6502	SO:0001587	stop_gained	0			AI811824	CCDS6449.1, CCDS6450.1, CCDS75809.1	9p24.2	2008-02-05			ENSG00000080298	ENSG00000080298			9984	protein-coding gene	gene with protein product		601337				8289803	Standard	XM_005251534		Approved		uc003zhr.3	P48380	OTTHUMG00000019456	ENST00000382004.3:c.1915G>T	9.37:g.3248085C>A	ENSP00000371434:p.Glu639*		A8K0H5|D3DRH8|D3DRH9|Q5JTL7|Q5JTL8|Q6NW13|Q8WTU4|Q95HL5|Q95HL6	Nonsense_Mutation	SNP	pfam_RFX1_trans_act,pfam_DNA-bd_RFX	p.E639*	ENST00000382004.3	37	c.1915	CCDS6449.1	9	.	.	.	.	.	.	.	.	.	.	C	42	9.688179	0.99238	.	.	ENSG00000080298	ENST00000382004;ENST00000358730;ENST00000302303;ENST00000449234;ENST00000381986	.	.	.	5.77	5.77	0.91146	.	0.049934	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-16.6198	19.9926	0.97371	0.0:1.0:0.0:0.0	.	.	.	.	X	639;639;639;104;118	.	ENSP00000303847:E639X	E	-	1	0	RFX3	3238085	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.757000	0.85209	2.729000	0.93468	0.467000	0.42956	GAA	RFX3	-	NULL	ENSG00000080298		0.458	RFX3-006	KNOWN	basic|appris_principal|CCDS	protein_coding	RFX3	HGNC	protein_coding	OTTHUMT00000051545.1	-	0.00	27	0	C	NM_002919		3248085	-1	tier1	-	no_errors	ENST00000382004	ensembl	human	known	74_37	nonsense	17.39	19	4	SNP	1.000	A
RFK	55312	genome.wustl.edu	37	9	79003557	79003557	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr9:79003557G>A	ENST00000376736.1	-	3	583	c.250C>T	c.(250-252)Cat>Tat	p.H84Y	RFK_ENST00000479197.1_5'UTR	NM_018339.5	NP_060809.3	Q969G6	RIFK_HUMAN	riboflavin kinase	84					apoptotic process (GO:0006915)|FMN biosynthetic process (GO:0009398)|positive regulation of NAD(P)H oxidase activity (GO:0033864)|reactive oxygen species metabolic process (GO:0072593)|riboflavin biosynthetic process (GO:0009231)|riboflavin metabolic process (GO:0006771)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|riboflavin kinase activity (GO:0008531)			pancreas(1)|prostate(1)|urinary_tract(1)	3					Riboflavin(DB00140)	TTGAAGGTATGCATGATATGT	0.363																																																	0													103.0	99.0	100.0					9																	79003557		2203	4300	6503	SO:0001583	missense	0			AK002011	CCDS35044.1, CCDS35044.2	9q21.31	2010-11-16			ENSG00000135002	ENSG00000135002			30324	protein-coding gene	gene with protein product		613010				14580199	Standard	NM_018339		Approved	FLJ11149, RIFK	uc004akd.2	Q969G6	OTTHUMG00000020040	ENST00000376736.1:c.250C>T	9.37:g.79003557G>A	ENSP00000365926:p.His84Tyr		Q5JSG9|Q9NUT7	Missense_Mutation	SNP	pfam_Riboflavin_kinase_bac/euk,superfamily_Riboflavin_kinase_bac/euk,smart_Riboflavin_kinase_bac/euk	p.H84Y	ENST00000376736.1	37	c.250	CCDS35044.2	9	.	.	.	.	.	.	.	.	.	.	G	16.25	3.069698	0.55539	.	.	ENSG00000135002	ENST00000376736;ENST00000257452;ENST00000490113	.	.	.	4.54	4.54	0.55810	Riboflavin kinase domain (1);Riboflavin kinase domain, bacterial/eukaryotic (3);	0.000000	0.85682	D	0.000000	T	0.73361	0.3577	M	0.78916	2.43	0.80722	D	1	B;B	0.25563	0.129;0.073	B;B	0.38921	0.285;0.285	T	0.76399	-0.2973	9	0.87932	D	0	-15.222	14.2178	0.65805	0.0:0.0:0.8503:0.1497	.	91;84	B2RDZ2;Q969G6	.;RIFK_HUMAN	Y	84;91;71	.	ENSP00000257452:H91Y	H	-	1	0	RFK	78193377	1.000000	0.71417	0.997000	0.53966	0.956000	0.61745	6.545000	0.73883	2.246000	0.74042	0.491000	0.48974	CAT	RFK	-	pfam_Riboflavin_kinase_bac/euk,superfamily_Riboflavin_kinase_bac/euk,smart_Riboflavin_kinase_bac/euk	ENSG00000135002		0.363	RFK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RFK	HGNC	protein_coding	OTTHUMT00000052720.1	-	0.00	42	0	G	NM_018339		79003557	-1	tier1	-	no_errors	ENST00000376736	ensembl	human	known	74_37	missense	7.14	52	4	SNP	1.000	A
RNF213	57674	genome.wustl.edu	37	17	78247183	78247183	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr17:78247183G>T	ENST00000582970.1	+	3	384	c.241G>T	c.(241-243)Gcc>Tcc	p.A81S	RNF213_ENST00000319921.4_Missense_Mutation_p.A81S|RNF213_ENST00000508628.2_Missense_Mutation_p.A81S|RNF213_ENST00000456466.1_Missense_Mutation_p.A81S	NM_001256071.1	NP_001243000.1	Q63HN8	RN213_HUMAN	ring finger protein 213	81					ATP catabolic process (GO:0006200)|protein autoubiquitination (GO:0051865)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ATPase activity (GO:0016887)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|central_nervous_system(1)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(23)|lung(36)|ovary(11)|pancreas(2)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	130	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0252)|OV - Ovarian serous cystadenocarcinoma(97;0.057)			CTGTTCCAAAGCCTCCTGGAC	0.622																																																	0													65.0	61.0	63.0					17																	78247183		2203	4299	6502	SO:0001583	missense	0			AK074030	CCDS58606.1	17q25.3	2013-01-09	2007-02-08	2007-02-08		ENSG00000173821		"""RING-type (C3HC4) zinc fingers"""	14539	protein-coding gene	gene with protein product		613768	"""chromosome 17 open reading frame 27"", ""KIAA1618"", ""moyamoya disease 2"", ""Moyamoya disease 2"""	C17orf27, KIAA1618, MYMY2		10997877, 21048783, 21799892	Standard	NM_020954		Approved	KIAA1554, NET57	uc021uen.2	Q63HN8		ENST00000582970.1:c.241G>T	17.37:g.78247183G>T	ENSP00000464087:p.Ala81Ser		C9JCP4|D6RI12|F8WKS1|Q658P6|Q69YK7|Q6MZR1|Q8IWF4|Q8IZX1|Q8IZX2|Q8N406|Q8TEU0|Q9H6C9|Q9H6H9|Q9H6P3|Q9H8A9|Q9HCF4|Q9HCL8	Missense_Mutation	SNP	superfamily_P-loop_NTPase,smart_AAA+_ATPase,smart_Znf_RING,pfscan_Znf_RING	p.A81S	ENST00000582970.1	37	c.241	CCDS58606.1	17	.	.	.	.	.	.	.	.	.	.	G	7.074	0.568955	0.13560	.	.	ENSG00000173821	ENST00000508628;ENST00000411702;ENST00000456466;ENST00000319921	T	0.30981	1.51	3.07	0.995	0.19838	.	.	.	.	.	T	0.19565	0.0470	L	0.40543	1.245	0.09310	N	0.999995	B	0.33612	0.419	B	0.30646	0.118	T	0.17806	-1.0357	9	0.23302	T	0.38	.	5.0456	0.14483	0.2875:0.0:0.7125:0.0	.	81	Q9HCF4-2	.	S	81	ENSP00000425956:A81S	ENSP00000324392:A81S	A	+	1	0	RNF213	75861778	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.853000	0.04303	0.299000	0.22661	0.650000	0.86243	GCC	RNF213	-	NULL	ENSG00000173821		0.622	RNF213-020	KNOWN	basic|appris_candidate|CCDS	protein_coding	RNF213	HGNC	protein_coding	OTTHUMT00000443298.1		0.00	46	0	G	NM_020914		78247183	+1			no_errors	ENST00000582970	ensembl	human	known	74_37	missense	11.11	32	4	SNP	0.000	T
RNPEP	6051	genome.wustl.edu	37	1	201966644	201966644	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr1:201966644C>T	ENST00000295640.4	+	5	1095	c.1052C>T	c.(1051-1053)aCc>aTc	p.T351I	RNPEP_ENST00000471105.1_3'UTR|RP11-465N4.4_ENST00000415582.1_RNA|RP11-465N4.5_ENST00000608886.1_RNA|RP11-465N4.4_ENST00000419190.1_RNA|RNPEP_ENST00000367286.3_Missense_Mutation_p.T312I	NM_020216.3	NP_064601.3	Q9H4A4	AMPB_HUMAN	arginyl aminopeptidase (aminopeptidase B)	351					leukotriene biosynthetic process (GO:0019370)|proteolysis (GO:0006508)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	aminopeptidase activity (GO:0004177)|epoxide hydrolase activity (GO:0004301)|metalloexopeptidase activity (GO:0008235)|zinc ion binding (GO:0008270)			breast(1)|endometrium(4)|large_intestine(4)|lung(6)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	21				KIRC - Kidney renal clear cell carcinoma(1967;3.23e-08)|Colorectal(1306;0.005)		GAAGGTTTCACCATGTACGCC	0.532																																					GBM(19;39 479 7473 13131 19462)												0													96.0	83.0	88.0					1																	201966644		2203	4300	6503	SO:0001583	missense	0			BC001064	CCDS1418.1	1q32	2008-02-05			ENSG00000176393	ENSG00000176393	3.4.11.6		10078	protein-coding gene	gene with protein product		602675				9533033, 10467730	Standard	NM_020216		Approved		uc001gxd.3	Q9H4A4	OTTHUMG00000035866	ENST00000295640.4:c.1052C>T	1.37:g.201966644C>T	ENSP00000295640:p.Thr351Ile		Q9BVM9|Q9H1D4|Q9NPT7	Missense_Mutation	SNP	pfam_Peptidase_M1_N,pfam_Peptidase_M1_C,superfamily_ARM-type_fold,prints_Peptidase_M1_N	p.T351I	ENST00000295640.4	37	c.1052	CCDS1418.1	1	.	.	.	.	.	.	.	.	.	.	C	28.0	4.882492	0.91740	.	.	ENSG00000176393	ENST00000295640;ENST00000367286;ENST00000447312;ENST00000449524	T;T;T;T	0.07688	3.17;3.17;3.17;3.17	5.1	5.1	0.69264	Peptidase M1, membrane alanine aminopeptidase, N-terminal (2);	0.000000	0.85682	D	0.000000	T	0.40522	0.1120	M	0.93978	3.48	0.80722	D	1	D;D	0.71674	0.998;0.998	D;D	0.79108	0.992;0.992	T	0.56062	-0.8041	10	0.87932	D	0	-30.2658	17.2948	0.87168	0.0:1.0:0.0:0.0	.	359;351	Q7RU04;Q9H4A4	.;AMPB_HUMAN	I	351;312;220;97	ENSP00000295640:T351I;ENSP00000356255:T312I;ENSP00000389602:T220I;ENSP00000407614:T97I	ENSP00000295640:T351I	T	+	2	0	RNPEP	200233267	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.306000	0.78905	2.361000	0.80049	0.643000	0.83706	ACC	RNPEP	-	pfam_Peptidase_M1_N,prints_Peptidase_M1_N	ENSG00000176393		0.532	RNPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNPEP	HGNC	protein_coding	OTTHUMT00000087345.1	-	0.00	66	0	C	NM_020216		201966644	+1	tier1	-	no_errors	ENST00000295640	ensembl	human	known	74_37	missense	9.52	38	4	SNP	1.000	T
ROBO4	54538	genome.wustl.edu	37	11	124761263	124761263	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr11:124761263C>T	ENST00000306534.3	-	12	2365	c.1880G>A	c.(1879-1881)cGc>cAc	p.R627H	RP11-664I21.6_ENST00000524433.1_5'UTR|ROBO4_ENST00000533054.1_Missense_Mutation_p.R482H	NM_019055.5	NP_061928.4	Q8WZ75	ROBO4_HUMAN	roundabout, axon guidance receptor, homolog 4 (Drosophila)	627					angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|negative regulation of cell migration (GO:0030336)|regulation of cell migration (GO:0030334)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)	p.R627H(1)		NS(2)|breast(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(42)|ovary(1)|prostate(4)|skin(5)|urinary_tract(3)	76	all_hematologic(175;0.215)	Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|Breast(109;0.171)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.5e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0301)		GAGTCCCCTGCGGCTGCAGAG	0.637																																																	1	Substitution - Missense(1)	lung(1)											33.0	36.0	35.0					11																	124761263		2201	4299	6500	SO:0001583	missense	0			AF361473	CCDS8455.1, CCDS73409.1	11q24.2	2013-02-11	2011-12-09		ENSG00000154133	ENSG00000154133		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	17985	protein-coding gene	gene with protein product	"""magic roundabout"""	607528	"""roundabout homolog 4 (Drosophila)"""			11076864	Standard	NM_019055		Approved	FLJ20798, MRB, ECSM4	uc001qbg.3	Q8WZ75	OTTHUMG00000165936	ENST00000306534.3:c.1880G>A	11.37:g.124761263C>T	ENSP00000304945:p.Arg627His		A8K154|Q14DU7|Q8TEG1|Q96JV6|Q9H718|Q9NWJ8	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.R627H	ENST00000306534.3	37	c.1880	CCDS8455.1	11	.	.	.	.	.	.	.	.	.	.	C	8.171	0.791687	0.16258	.	.	ENSG00000154133	ENST00000306534;ENST00000374963;ENST00000533054	T;T	0.63255	-0.03;0.34	5.92	0.184	0.15086	.	0.612195	0.13767	N	0.364170	T	0.45895	0.1365	L	0.36672	1.1	0.09310	N	1	B;B;B	0.19935	0.008;0.025;0.04	B;B;B	0.09377	0.003;0.004;0.003	T	0.32161	-0.9917	10	0.45353	T	0.12	.	6.2064	0.20606	0.0:0.5206:0.137:0.3423	.	627;517;627	Q8WZ75-2;Q8WZ75-3;Q8WZ75	.;.;ROBO4_HUMAN	H	627;517;482	ENSP00000304945:R627H;ENSP00000437129:R482H	ENSP00000304945:R627H	R	-	2	0	ROBO4	124266473	0.001000	0.12720	0.212000	0.23672	0.464000	0.32679	-0.365000	0.07573	0.095000	0.17434	-1.106000	0.02097	CGC	ROBO4	-	NULL	ENSG00000154133		0.637	ROBO4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ROBO4	HGNC	protein_coding	OTTHUMT00000387111.1		0.00	54	0	C	NM_019055		124761263	-1			no_errors	ENST00000306534	ensembl	human	known	74_37	missense	6.25	45	3	SNP	0.004	T
RP1	6101	genome.wustl.edu	37	8	55537775	55537775	+	Missense_Mutation	SNP	C	C	A	rs575855591		TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr8:55537775C>A	ENST00000220676.1	+	4	1481	c.1333C>A	c.(1333-1335)Cgt>Agt	p.R445S		NM_006269.1	NP_006260.1	P56715	RP1_HUMAN	retinitis pigmentosa 1 (autosomal dominant)	445					axoneme assembly (GO:0035082)|cellular response to light stimulus (GO:0071482)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|photoreceptor cell outer segment organization (GO:0035845)|phototransduction, visible light (GO:0007603)|retinal cone cell development (GO:0046549)|retinal rod cell development (GO:0046548)|visual perception (GO:0007601)	axoneme (GO:0005930)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|photoreceptor connecting cilium (GO:0032391)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)	microtubule binding (GO:0008017)			NS(4)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(29)|lung(69)|ovary(6)|pancreas(1)|prostate(9)|skin(17)|upper_aerodigestive_tract(3)|urinary_tract(2)	169		all_lung(136;0.0831)|Lung NSC(129;0.109)|all_epithelial(80;0.123)	OV - Ovarian serous cystadenocarcinoma(7;4.4e-07)|Epithelial(17;3.37e-05)|all cancers(17;0.000285)			AGCAAAGCATCGTTTTTATAG	0.438																																					Colon(91;1014 1389 7634 14542 40420)												0													85.0	87.0	86.0					8																	55537775		2203	4300	6503	SO:0001583	missense	0			AF146592	CCDS6160.1	8q12.1	2013-01-08				ENSG00000104237			10263	protein-coding gene	gene with protein product		603937				1783394	Standard	NM_006269		Approved	DCDC4A	uc003xsd.1	P56715		ENST00000220676.1:c.1333C>A	8.37:g.55537775C>A	ENSP00000220676:p.Arg445Ser			Missense_Mutation	SNP	pfam_Doublecortin_dom,smart_Doublecortin_dom,pfscan_Doublecortin_dom	p.R445S	ENST00000220676.1	37	c.1333	CCDS6160.1	8	.	.	.	.	.	.	.	.	.	.	C	10.26	1.300363	0.23650	.	.	ENSG00000104237	ENST00000220676	T	0.30981	1.51	5.25	4.36	0.52297	.	1.463730	0.04110	N	0.314533	T	0.31136	0.0787	L	0.34521	1.04	0.09310	N	1	B	0.26081	0.141	B	0.22753	0.041	T	0.40117	-0.9580	10	0.38643	T	0.18	.	15.1321	0.72533	0.1425:0.8575:0.0:0.0	.	445	P56715	RP1_HUMAN	S	445	ENSP00000220676:R445S	ENSP00000220676:R445S	R	+	1	0	RP1	55700328	0.313000	0.24554	0.080000	0.20451	0.893000	0.52053	4.503000	0.60407	1.196000	0.43129	0.650000	0.86243	CGT	RP1	-	NULL	ENSG00000104237		0.438	RP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RP1	HGNC	protein_coding	OTTHUMT00000378532.2		0.00	49	0	C	NM_006269		55537775	+1			no_errors	ENST00000220676	ensembl	human	known	74_37	missense	6.25	30	2	SNP	0.034	A
RPLP0	6175	genome.wustl.edu	37	12	120638796	120638796	+	5'UTR	SNP	G	G	A			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr12:120638796G>A	ENST00000551150.1	-	0	106				PXN-AS1_ENST00000542314.1_RNA|RPLP0_ENST00000313104.5_Intron|PXN-AS1_ENST00000538804.1_RNA|PXN-AS1_ENST00000542265.1_RNA|RPLP0_ENST00000550296.1_5'Flank|PXN-AS1_ENST00000535200.1_RNA|RPLP0_ENST00000546989.1_Intron|PXN-AS1_ENST00000539446.1_RNA|RPLP0_ENST00000392514.4_Intron|RPLP0_ENST00000228306.4_Intron			P05388	RLA0_HUMAN	ribosomal protein, large, P0						cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|ribosome biogenesis (GO:0042254)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|prostate(1)	15	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					AGGCGGAACAGAATAGGACTC	0.667											OREG0022184	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0																																										SO:0001623	5_prime_UTR_variant	0			AB007187	CCDS9193.1	12q24.2	2011-07-29			ENSG00000089157	ENSG00000089157		"""L ribosomal proteins"""	10371	protein-coding gene	gene with protein product	"""acidic ribosomal phosphoprotein P0"""	180510				9582194	Standard	NM_053275		Approved	PRLP0, P0, L10E, RPP0, LP0	uc001txq.3	P05388	OTTHUMG00000169317	ENST00000551150.1:c.-210C>T	12.37:g.120638796G>A		1505	Q3B7A4|Q9BVK4	RNA	SNP	-	NULL	ENST00000551150.1	37	NULL	CCDS9193.1	12																																																																																			RPLP0	-	-	ENSG00000089157		0.667	RPLP0-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	RPLP0	HGNC	protein_coding	OTTHUMT00000403448.3	-	0.00	107	0	G	NM_053275		120638796	-1	tier1	-	no_errors	ENST00000551336	ensembl	human	putative	74_37	rna	27.50	57	22	SNP	0.000	A
RTKN2	219790	genome.wustl.edu	37	10	63964713	63964713	+	Silent	SNP	A	A	G			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr10:63964713A>G	ENST00000373789.3	-	10	1185	c.1089T>C	c.(1087-1089)ccT>ccC	p.P363P	RTKN2_ENST00000315289.2_Silent_p.P165P|RTKN2_ENST00000395265.1_Silent_p.P384P	NM_145307.2	NP_660350.2	Q8IZC4	RTKN2_HUMAN	rhotekin 2	363	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				hemopoiesis (GO:0030097)|positive regulation of cell proliferation (GO:0008284)|signal transduction (GO:0007165)	plasma membrane (GO:0005886)				endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(3)|lung(6)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21	Prostate(12;0.0297)|all_hematologic(501;0.215)					GTCCAGGAACAGGATTGATGA	0.378																																																	0													92.0	95.0	94.0					10																	63964713		2203	4300	6503	SO:0001819	synonymous_variant	0			BC025765	CCDS7263.1, CCDS73140.1	10q21.3	2013-01-10	2007-12-14	2007-12-14	ENSG00000182010	ENSG00000182010		"""Pleckstrin homology (PH) domain containing"""	19364	protein-coding gene	gene with protein product			"""pleckstrin homology domain containing, family K member 1"""	PLEKHK1		15504364	Standard	NM_001282941		Approved	Em:AC024597.2, bA531F24.1, FLJ39352	uc001jlw.3	Q8IZC4	OTTHUMG00000018299	ENST00000373789.3:c.1089T>C	10.37:g.63964713A>G			Q3ZCR1|Q68DZ6|Q8N8K1|Q8TAV2	Silent	SNP	pfam_Pleckstrin_homology,superfamily_HR1_rho-bd,smart_HR1_rho-bd,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.P363	ENST00000373789.3	37	c.1089	CCDS7263.1	10																																																																																			RTKN2	-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	ENSG00000182010		0.378	RTKN2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RTKN2	HGNC	protein_coding	OTTHUMT00000091618.1	-	0.00	66	0	A	NM_145307		63964713	-1	tier1	-	no_errors	ENST00000373789	ensembl	human	known	74_37	silent	9.76	37	4	SNP	0.285	G
RTN2	6253	genome.wustl.edu	37	19	45997462	45997462	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr19:45997462G>A	ENST00000245923.4	-	4	1011	c.776C>T	c.(775-777)aCg>aTg	p.T259M	RTN2_ENST00000344680.4_Missense_Mutation_p.T259M|RTN2_ENST00000590526.1_De_novo_Start_InFrame|RTN2_ENST00000589384.1_5'Flank|PPM1N_ENST00000401705.1_Intron|RTN2_ENST00000430715.2_5'Flank	NM_005619.4	NP_005610.1	O75298	RTN2_HUMAN	reticulon 2	259					cell death (GO:0008219)|intracellular protein transmembrane transport (GO:0065002)|regulation of glucose import (GO:0046324)	endoplasmic reticulum (GO:0005783)|integral component of endoplasmic reticulum membrane (GO:0030176)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)				cervix(1)|endometrium(2)|kidney(3)|large_intestine(2)|lung(6)|ovary(4)|skin(1)|urinary_tract(1)	20		Ovarian(192;0.051)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00829)|Epithelial(262;0.184)|GBM - Glioblastoma multiforme(486;0.246)		TAATTGGTCCGTGCTATCGAG	0.537																																																	0													150.0	132.0	138.0					19																	45997462		2203	4300	6503	SO:0001583	missense	0			AF038540	CCDS12665.1, CCDS12666.1, CCDS46114.1	19q13.2-q13.3	2012-03-30				ENSG00000125744			10468	protein-coding gene	gene with protein product	"""NSP-like protein 1"", ""Neuroendocrine-specific protein-like 1"""	603183	"""spastic paraplegia 12 (autosomal dominant)"""	SPG12		8812484, 9530622, 22232211	Standard	NM_005619		Approved	NSP2, NSPL1	uc002pcb.4	O75298		ENST00000245923.4:c.776C>T	19.37:g.45997462G>A	ENSP00000245923:p.Thr259Met		O60509|Q7RTM6|Q7RTN1|Q7RTN2	Missense_Mutation	SNP	pfam_Reticulon,pfscan_Reticulon	p.T259M	ENST00000245923.4	37	c.776	CCDS12665.1	19	.	.	.	.	.	.	.	.	.	.	G	14.29	2.491913	0.44352	.	.	ENSG00000125744	ENST00000344680;ENST00000245923	T;T	0.52057	0.83;0.68	5.63	3.34	0.38264	.	0.128010	0.36002	N	0.002856	T	0.25382	0.0617	N	0.17082	0.46	0.80722	D	1	P;B	0.34780	0.468;0.27	B;B	0.24269	0.052;0.016	T	0.09271	-1.0682	10	0.45353	T	0.12	-5.6737	8.3739	0.32432	0.0:0.1706:0.6525:0.1768	.	259;259	O75298-2;O75298	.;RTN2_HUMAN	M	259	ENSP00000345127:T259M;ENSP00000245923:T259M	ENSP00000245923:T259M	T	-	2	0	RTN2	50689302	0.148000	0.22702	0.987000	0.45799	0.931000	0.56810	0.125000	0.15749	1.349000	0.45751	0.563000	0.77884	ACG	RTN2	-	NULL	ENSG00000125744		0.537	RTN2-001	KNOWN	basic|CCDS	protein_coding	RTN2	HGNC	protein_coding	OTTHUMT00000459574.1	-	0.00	75	0	G	NM_005619		45997462	-1	tier1	-	no_errors	ENST00000245923	ensembl	human	known	74_37	missense	28.21	28	11	SNP	0.938	A
SCG2	7857	genome.wustl.edu	37	2	224463668	224463668	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr2:224463668C>T	ENST00000305409.2	-	2	565	c.333G>A	c.(331-333)atG>atA	p.M111I		NM_003469.4	NP_003460.2	O00255	MEN1_HUMAN	secretogranin II	0					brain development (GO:0007420)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|chromatin remodeling (GO:0006338)|DNA repair (GO:0006281)|embryonic skeletal system morphogenesis (GO:0048704)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|histone lysine methylation (GO:0034968)|leukocyte homeostasis (GO:0001776)|MAPK cascade (GO:0000165)|maternal process involved in female pregnancy (GO:0060135)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of JNK cascade (GO:0046329)|negative regulation of organ growth (GO:0046621)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of telomerase activity (GO:0051974)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|osteoblast development (GO:0002076)|osteoblast fate commitment (GO:0002051)|palate development (GO:0060021)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell division (GO:0051781)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of histone methylation (GO:0031062)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein binding (GO:0032092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of activin receptor signaling pathway (GO:0032925)|response to gamma radiation (GO:0010332)|response to UV (GO:0009411)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	chromatin (GO:0000785)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|histone methyltransferase complex (GO:0035097)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|four-way junction DNA binding (GO:0000400)|protein binding, bridging (GO:0030674)|protein N-terminus binding (GO:0047485)|R-SMAD binding (GO:0070412)|sequence-specific DNA binding (GO:0043565)|transcription regulatory region DNA binding (GO:0044212)|Y-form DNA binding (GO:0000403)			NS(1)|breast(1)|endometrium(1)|kidney(6)|large_intestine(10)|liver(1)|lung(16)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(4)	44		Renal(207;0.0112)|Lung NSC(271;0.0185)|all_lung(227;0.0271)		Epithelial(121;8.16e-11)|all cancers(144;4.66e-08)|Lung(261;0.00714)|LUSC - Lung squamous cell carcinoma(224;0.008)		GTATTATTCTCATCCAGTCTT	0.438																																																	0													132.0	133.0	133.0					2																	224463668		2203	4300	6503	SO:0001583	missense	0			M25756	CCDS2457.1	2q35-q36	2010-04-27	2010-04-27		ENSG00000171951	ENSG00000171951			10575	protein-coding gene	gene with protein product	"""secretoneurin"", ""chromogranin C"""	118930				8617499, 16101435	Standard	NM_003469		Approved	CHGC, SgII, SN	uc002vnm.3	P13521	OTTHUMG00000133166	ENST00000305409.2:c.333G>A	2.37:g.224463668C>T	ENSP00000304133:p.Met111Ile		A5HBC6|A5HBC7|A5HBC8|A5HBC9|A5HBD0|A5HBD1|A5HBD2|O00632|Q9BUF0|Q9BUK2	Missense_Mutation	SNP	pfam_Granin	p.M111I	ENST00000305409.2	37	c.333	CCDS2457.1	2	.	.	.	.	.	.	.	.	.	.	C	13.41	2.229906	0.39399	.	.	ENSG00000171951	ENST00000305409;ENST00000421386;ENST00000433889	T;T;T	0.01613	4.73;4.73;4.73	5.5	4.58	0.56647	.	0.273285	0.40554	N	0.001062	T	0.02083	0.0065	L	0.29908	0.895	0.42328	D	0.992284	B	0.11235	0.004	B	0.14578	0.011	T	0.59825	-0.7381	10	0.32370	T	0.25	.	15.3825	0.74669	0.1923:0.8077:0.0:0.0	.	111	P13521	SCG2_HUMAN	I	111	ENSP00000304133:M111I;ENSP00000394702:M111I;ENSP00000415468:M111I	ENSP00000304133:M111I	M	-	3	0	SCG2	224171912	0.026000	0.19158	1.000000	0.80357	0.990000	0.78478	-0.015000	0.12634	2.741000	0.93983	0.585000	0.79938	ATG	SCG2	-	pfam_Granin	ENSG00000171951		0.438	SCG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCG2	HGNC	protein_coding	OTTHUMT00000256870.2	-	0.00	44	0	C	NM_003469		224463668	-1	tier1	-	no_errors	ENST00000305409	ensembl	human	known	74_37	missense	15.00	17	3	SNP	1.000	T
SCG2	7857	genome.wustl.edu	37	2	224463671	224463671	+	Nonsense_Mutation	SNP	C	C	T			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr2:224463671C>T	ENST00000305409.2	-	2	562	c.330G>A	c.(328-330)tgG>tgA	p.W110*		NM_003469.4	NP_003460.2	O00255	MEN1_HUMAN	secretogranin II	0			G -> E (in MEN1). {ECO:0000269|PubMed:15730416}.		brain development (GO:0007420)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|chromatin remodeling (GO:0006338)|DNA repair (GO:0006281)|embryonic skeletal system morphogenesis (GO:0048704)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|histone lysine methylation (GO:0034968)|leukocyte homeostasis (GO:0001776)|MAPK cascade (GO:0000165)|maternal process involved in female pregnancy (GO:0060135)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of JNK cascade (GO:0046329)|negative regulation of organ growth (GO:0046621)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of telomerase activity (GO:0051974)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|osteoblast development (GO:0002076)|osteoblast fate commitment (GO:0002051)|palate development (GO:0060021)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell division (GO:0051781)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of histone methylation (GO:0031062)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein binding (GO:0032092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of activin receptor signaling pathway (GO:0032925)|response to gamma radiation (GO:0010332)|response to UV (GO:0009411)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	chromatin (GO:0000785)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|histone methyltransferase complex (GO:0035097)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|four-way junction DNA binding (GO:0000400)|protein binding, bridging (GO:0030674)|protein N-terminus binding (GO:0047485)|R-SMAD binding (GO:0070412)|sequence-specific DNA binding (GO:0043565)|transcription regulatory region DNA binding (GO:0044212)|Y-form DNA binding (GO:0000403)			NS(1)|breast(1)|endometrium(1)|kidney(6)|large_intestine(10)|liver(1)|lung(16)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(4)	44		Renal(207;0.0112)|Lung NSC(271;0.0185)|all_lung(227;0.0271)		Epithelial(121;8.16e-11)|all cancers(144;4.66e-08)|Lung(261;0.00714)|LUSC - Lung squamous cell carcinoma(224;0.008)		TTATTCTCATCCAGTCTTCTT	0.433																																																	0													132.0	133.0	132.0					2																	224463671		2203	4300	6503	SO:0001587	stop_gained	0			M25756	CCDS2457.1	2q35-q36	2010-04-27	2010-04-27		ENSG00000171951	ENSG00000171951			10575	protein-coding gene	gene with protein product	"""secretoneurin"", ""chromogranin C"""	118930				8617499, 16101435	Standard	NM_003469		Approved	CHGC, SgII, SN	uc002vnm.3	P13521	OTTHUMG00000133166	ENST00000305409.2:c.330G>A	2.37:g.224463671C>T	ENSP00000304133:p.Trp110*		A5HBC6|A5HBC7|A5HBC8|A5HBC9|A5HBD0|A5HBD1|A5HBD2|O00632|Q9BUF0|Q9BUK2	Nonsense_Mutation	SNP	pfam_Granin	p.W110*	ENST00000305409.2	37	c.330	CCDS2457.1	2	.	.	.	.	.	.	.	.	.	.	C	37	6.037096	0.97226	.	.	ENSG00000171951	ENST00000305409;ENST00000421386;ENST00000433889	.	.	.	5.5	5.5	0.81552	.	0.067251	0.64402	D	0.000006	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	19.775	0.96388	0.0:1.0:0.0:0.0	.	.	.	.	X	110	.	ENSP00000304133:W110X	W	-	3	0	SCG2	224171915	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	5.260000	0.65490	2.741000	0.93983	0.585000	0.79938	TGG	SCG2	-	pfam_Granin	ENSG00000171951		0.433	SCG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCG2	HGNC	protein_coding	OTTHUMT00000256870.2	-	0.00	46	0	C	NM_003469		224463671	-1	tier1	-	no_errors	ENST00000305409	ensembl	human	known	74_37	nonsense	15.00	17	3	SNP	1.000	T
SCML4	256380	genome.wustl.edu	37	6	108029193	108029193	+	Silent	SNP	C	C	T	rs530348685		TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr6:108029193C>T	ENST00000369020.3	-	7	1241	c.996G>A	c.(994-996)gcG>gcA	p.A332A	SCML4_ENST00000369025.2_Silent_p.A90A|SCML4_ENST00000369022.2_Silent_p.A274A	NM_198081.3	NP_932347.2	Q8N228	SCML4_HUMAN	sex comb on midleg-like 4 (Drosophila)	332	SAM.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(2)|large_intestine(7)|lung(11)|ovary(3)|prostate(1)|skin(1)	25		all_cancers(87;3.26e-06)|Acute lymphoblastic leukemia(125;3.08e-08)|all_hematologic(75;1.15e-06)|all_epithelial(87;0.00142)|Colorectal(196;0.0316)		BRCA - Breast invasive adenocarcinoma(108;0.01)|Epithelial(106;0.0509)|all cancers(137;0.0586)|OV - Ovarian serous cystadenocarcinoma(136;0.0758)		TGGCATCCTGCGCATCCTGAG	0.667													C|||	1	0.000199681	0.0	0.0	5008	,	,		18666	0.0		0.0	False		,,,				2504	0.001																0													39.0	48.0	46.0					6																	108029193		692	1591	2283	SO:0001819	synonymous_variant	0				CCDS5060.2, CCDS69163.1, CCDS75500.1	6q21	2013-01-10			ENSG00000146285	ENSG00000146285		"""Sterile alpha motif (SAM) domain containing"""	21397	protein-coding gene	gene with protein product							Standard	NM_001286409		Approved	dJ47M23.1	uc010kdf.3	Q8N228	OTTHUMG00000015313	ENST00000369020.3:c.996G>A	6.37:g.108029193C>T			B0QZ10|B0QZ11|B7ZBX3|Q5JXD0|Q5T0T6|Q8IYY6	Silent	SNP	pfam_SAM_type1,superfamily_SAM/pointed,smart_SAM	p.A90	ENST00000369020.3	37	c.270	CCDS5060.2	6																																																																																			SCML4	-	superfamily_SAM/pointed	ENSG00000146285		0.667	SCML4-005	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	SCML4	HGNC	protein_coding	OTTHUMT00000041700.3		0.00	44	0	C	XM_171128		108029193	-1			no_errors	ENST00000369025	ensembl	human	putative	74_37	silent	6.25	30	2	SNP	0.001	T
SEC24C	9632	genome.wustl.edu	37	10	75526909	75526909	+	Missense_Mutation	SNP	T	T	A			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr10:75526909T>A	ENST00000339365.2	+	15	2153	c.1991T>A	c.(1990-1992)aTc>aAc	p.I664N	SEC24C_ENST00000535742.1_Intron|SEC24C_ENST00000411652.2_Missense_Mutation_p.I545N|SEC24C_ENST00000345254.4_Missense_Mutation_p.I664N|SEC24C_ENST00000540668.1_Intron	NM_004922.3	NP_004913.2	P53992	SC24C_HUMAN	SEC24 family member C	664					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|COPII vesicle coating (GO:0048208)|ER to Golgi vesicle-mediated transport (GO:0006888)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|small molecule metabolic process (GO:0044281)	COPII vesicle coat (GO:0030127)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)	zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(3)|lung(12)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	32	Prostate(51;0.0112)					AGGAAGCTGATCAATACAGAC	0.498																																																	0													92.0	90.0	91.0					10																	75526909		2203	4300	6503	SO:0001583	missense	0			D38555	CCDS7332.1	10q22	2013-10-21	2013-10-21		ENSG00000176986	ENSG00000176986			10705	protein-coding gene	gene with protein product		607185	"""SEC24 (S. cerevisiae) related gene family, member C"", ""SEC24 family, member C (S. cerevisiae)"""			10214955, 7584044	Standard	NM_004922		Approved	KIAA0079	uc001jux.3	P53992	OTTHUMG00000018476	ENST00000339365.2:c.1991T>A	10.37:g.75526909T>A	ENSP00000343405:p.Ile664Asn		B4DZT4|Q8WV25	Missense_Mutation	SNP	pfam_Sec23/24_trunk_dom,pfam_Sec23/24_helical_dom,pfam_Sec23_24_beta_S,pfam_Znf_Sec23_Sec24,pfam_Gelsolin_dom,superfamily_Sec23/24_helical_dom,superfamily_Znf_Sec23_Sec24	p.I664N	ENST00000339365.2	37	c.1991	CCDS7332.1	10	.	.	.	.	.	.	.	.	.	.	T	21.1	4.100715	0.76983	.	.	ENSG00000176986	ENST00000345254;ENST00000339365;ENST00000411652	T;T;T	0.46819	0.86;0.86;0.86	5.57	5.57	0.84162	Sec23/Sec24, trunk domain (1);	0.145674	0.64402	D	0.000006	T	0.56891	0.2016	L	0.51422	1.61	0.80722	D	1	P;D;D	0.58268	0.927;0.982;0.965	B;P;P	0.56648	0.381;0.703;0.803	T	0.52859	-0.8519	10	0.30078	T	0.28	-13.9514	15.776	0.78220	0.0:0.0:0.0:1.0	.	545;664;664	E7EP00;G5EA31;P53992	.;.;SC24C_HUMAN	N	664;664;545	ENSP00000321845:I664N;ENSP00000343405:I664N;ENSP00000402913:I545N	ENSP00000343405:I664N	I	+	2	0	SEC24C	75196915	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	8.018000	0.88722	2.136000	0.66102	0.454000	0.30748	ATC	SEC24C	-	pfam_Sec23/24_trunk_dom	ENSG00000176986		0.498	SEC24C-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SEC24C	HGNC	protein_coding	OTTHUMT00000048679.1	-	0.00	43	0	T			75526909	+1	tier1	-	no_errors	ENST00000339365	ensembl	human	known	74_37	missense	14.81	23	4	SNP	1.000	A
SEL1L3	23231	genome.wustl.edu	37	4	25789889	25789889	+	Frame_Shift_Del	DEL	T	T	-			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr4:25789889delT	ENST00000399878.3	-	13	2296	c.2174delA	c.(2173-2175)gagfs	p.E725fs	SEL1L3_ENST00000502949.1_Frame_Shift_Del_p.E572fs|SEL1L3_ENST00000264868.5_Frame_Shift_Del_p.E690fs	NM_015187.3	NP_056002.2	Q68CR1	SE1L3_HUMAN	sel-1 suppressor of lin-12-like 3 (C. elegans)	725						integral component of membrane (GO:0016021)				breast(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(6)|prostate(1)|urinary_tract(2)	14						CGCAGGATCCTCCGTCTCCAG	0.498																																																	0													161.0	160.0	160.0					4																	25789889		1985	4155	6140	SO:0001589	frameshift_variant	0			BC009945	CCDS47037.1, CCDS75113.1	4p15.2	2009-09-24			ENSG00000091490	ENSG00000091490			29108	protein-coding gene	gene with protein product	"""KIAA0746 protein"""					9872452	Standard	XM_005248143		Approved	KIAA0746	uc003gru.4	Q68CR1	OTTHUMG00000160331	ENST00000399878.3:c.2174delA	4.37:g.25789889delT	ENSP00000382767:p.Glu725fs		A0PJH6|A8K0X2|O94847|Q6P999|Q96G59	Frame_Shift_Del	DEL	pfam_Sel1-like,superfamily_ConA-like_lec_gl_sf,smart_Sel1-like	p.E725fs	ENST00000399878.3	37	c.2174	CCDS47037.1	4																																																																																			SEL1L3	-	smart_Sel1-like	ENSG00000091490		0.498	SEL1L3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	SEL1L3	HGNC	protein_coding	OTTHUMT00000360261.1		0.00	56	0	T	NM_015187		25789889	-1	tier1		no_errors	ENST00000399878	ensembl	human	known	74_37	frame_shift_del	10.53	17	2	DEL	1.000	-
SEMA3D	223117	genome.wustl.edu	37	7	84647607	84647607	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr7:84647607G>T	ENST00000284136.6	-	13	1549	c.1506C>A	c.(1504-1506)caC>caA	p.H502Q	SEMA3D_ENST00000484038.1_5'UTR	NM_152754.2	NP_689967.2	O95025	SEM3D_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3D	502	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)	extracellular region (GO:0005576)|membrane (GO:0016020)	receptor activity (GO:0004872)			NS(1)|breast(2)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(19)|lung(29)|ovary(3)|pancreas(1)|prostate(4)|skin(2)	73						TGATTGATGAGTGCTGAAAAT	0.294																																					Ovarian(63;442 1191 17318 29975 31528)												0													45.0	46.0	46.0					7																	84647607		2202	4289	6491	SO:0001583	missense	0			BC029590	CCDS34676.1	7q21.11	2013-01-11			ENSG00000153993	ENSG00000153993		"""Semaphorins"", ""Immunoglobulin superfamily / V-set domain containing"""	10726	protein-coding gene	gene with protein product		609907					Standard	NM_152754		Approved	coll-2, Sema-Z2	uc003uic.3	O95025	OTTHUMG00000154569	ENST00000284136.6:c.1506C>A	7.37:g.84647607G>T	ENSP00000284136:p.His502Gln		A6NK46|Q6UW77|Q8NCQ1	Missense_Mutation	SNP	pfam_Semap_dom,pfam_Ig_V-set,superfamily_Semap_dom,superfamily_Plexin-like_fold,smart_Semap_dom,smart_Plexin-like_fold,smart_Ig_sub,pfscan_Semap_dom,pfscan_Ig-like_dom	p.H502Q	ENST00000284136.6	37	c.1506	CCDS34676.1	7	.	.	.	.	.	.	.	.	.	.	G	0.805	-0.754119	0.03041	.	.	ENSG00000153993	ENST00000284136	T	0.10382	2.88	5.69	3.6	0.41247	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.443843	0.27600	N	0.018648	T	0.04363	0.0120	N	0.05383	-0.06	0.80722	D	1	B	0.06786	0.001	B	0.08055	0.003	T	0.37267	-0.9713	10	0.14252	T	0.57	.	5.5594	0.17135	0.2646:0.0:0.5833:0.152	.	502	O95025	SEM3D_HUMAN	Q	502	ENSP00000284136:H502Q	ENSP00000284136:H502Q	H	-	3	2	SEMA3D	84485543	0.990000	0.36364	0.985000	0.45067	0.120000	0.20174	0.152000	0.16302	1.361000	0.45981	0.491000	0.48974	CAC	SEMA3D	-	pfam_Semap_dom,superfamily_Semap_dom,smart_Semap_dom,pfscan_Semap_dom	ENSG00000153993		0.294	SEMA3D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEMA3D	HGNC	protein_coding	OTTHUMT00000336084.2	-	0.00	64	0	G	NM_152754		84647607	-1	tier1	-	no_errors	ENST00000284136	ensembl	human	known	74_37	missense	21.43	22	6	SNP	0.998	T
SFI1	9814	genome.wustl.edu	37	22	32009191	32009191	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr22:32009191C>A	ENST00000400288.2	+	25	2659	c.2554C>A	c.(2554-2556)Ctg>Atg	p.L852M	SFI1_ENST00000400289.1_Missense_Mutation_p.L770M|SFI1_ENST00000443011.1_Missense_Mutation_p.L699M|SFI1_ENST00000432498.1_Missense_Mutation_p.L821M|SFI1_ENST00000443326.1_Missense_Mutation_p.L770M|SFI1_ENST00000540643.1_Missense_Mutation_p.L797M|SFI1_ENST00000414585.1_Missense_Mutation_p.L699M	NM_001007467.2	NP_001007468.1	A8K8P3	SFI1_HUMAN	Sfi1 homolog, spindle assembly associated (yeast)	852					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|negative regulation of phosphatase activity (GO:0010923)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)	phosphatase binding (GO:0019902)			NS(2)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|large_intestine(7)|liver(1)|lung(11)|ovary(1)|prostate(3)|upper_aerodigestive_tract(3)	38						GGCCTTCTCGCTGCAGGCAAA	0.637																																																	0													50.0	59.0	56.0					22																	32009191		2115	4240	6355	SO:0001583	missense	0			AB011114	CCDS43004.1, CCDS43005.1, CCDS58803.1, CCDS58804.1	22q12.2	2014-06-13			ENSG00000198089	ENSG00000198089			29064	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 139"""	612765				14504268	Standard	NM_001007467		Approved	KIAA0542, PISD, PPP1R139	uc003ale.4	A8K8P3	OTTHUMG00000030249	ENST00000400288.2:c.2554C>A	22.37:g.32009191C>A	ENSP00000383145:p.Leu852Met		A1L373|A1L387|A2A2L2|B1AKL9|B5MDB7|B7Z1V6|B7Z8G3|B7ZBE2|B7ZBE3|O60289|Q2TAN8|Q5W1B5|Q86TK0|Q8N4U8|Q8N8C1|Q8WU14	Missense_Mutation	SNP	superfamily_Cyclin-like	p.L852M	ENST00000400288.2	37	c.2554	CCDS43004.1	22	.	.	.	.	.	.	.	.	.	.	C	14.62	2.589224	0.46110	.	.	ENSG00000198089	ENST00000432498;ENST00000540643;ENST00000443326;ENST00000414585;ENST00000443011;ENST00000400289;ENST00000400288;ENST00000417682	T;T;T;T;T;T;T;T	0.60299	0.87;0.8;0.62;1.27;0.69;0.62;0.97;0.2	5.62	4.61	0.57282	.	0.000000	0.64402	D	0.000001	T	0.56093	0.1962	N	0.08118	0	0.22842	N	0.998666	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;0.999;0.999;1.0;0.998	T	0.53272	-0.8462	10	0.87932	D	0	.	11.4343	0.50060	0.0:0.9161:0.0:0.0839	.	797;758;770;821;852	A8K8P3-9;A8K8P3-10;A8K8P3-3;A8K8P3-2;A8K8P3	.;.;.;.;SFI1_HUMAN	M	821;797;770;699;699;770;852;435	ENSP00000402679:L821M;ENSP00000443025:L797M;ENSP00000416469:L770M;ENSP00000397148:L699M;ENSP00000401199:L699M;ENSP00000383146:L770M;ENSP00000383145:L852M;ENSP00000398871:L435M	ENSP00000383145:L852M	L	+	1	2	SFI1	30339191	0.554000	0.26522	0.035000	0.18076	0.378000	0.30076	1.440000	0.35024	1.385000	0.46445	0.563000	0.77884	CTG	SFI1	-	NULL	ENSG00000198089		0.637	SFI1-023	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SFI1	HGNC	protein_coding	OTTHUMT00000337180.3	-	0.00	65	0	C	NM_014775		32009191	+1	tier1	-	no_errors	ENST00000400288	ensembl	human	known	74_37	missense	6.78	55	4	SNP	0.306	A
SFXN5	94097	genome.wustl.edu	37	2	73268006	73268006	+	Missense_Mutation	SNP	G	G	A	rs372326606		TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr2:73268006G>A	ENST00000272433.2	-	3	356	c.226C>T	c.(226-228)Cgc>Tgc	p.R76C	SFXN5_ENST00000474528.1_5'UTR|SFXN5_ENST00000410065.1_Missense_Mutation_p.R76C	NM_144579.2	NP_653180.1	Q8TD22	SFXN5_HUMAN	sideroflexin 5	76					iron ion homeostasis (GO:0055072)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)	cation transmembrane transporter activity (GO:0008324)|citrate transmembrane transporter activity (GO:0015137)	p.R76C(1)		breast(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(1)|ovary(2)|prostate(1)	9						ACCCCCGGGCGCAGGGTCCCA	0.557																																																	1	Substitution - Missense(1)	ovary(1)						G	CYS/ARG	1,4405	2.1+/-5.4	0,1,2202	45.0	44.0	45.0		226	5.4	1.0	2		45	0,8600		0,0,4300	no	missense	SFXN5	NM_144579.2	180	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	possibly-damaging	76/341	73268006	1,13005	2203	4300	6503	SO:0001583	missense	0			AY044437	CCDS1922.1	2p13	2008-05-21			ENSG00000144040	ENSG00000144040		"""Sideroflexins"""	16073	protein-coding gene	gene with protein product		615572				12039050, 12150972	Standard	XM_005264648		Approved	BBG-TCC	uc002siq.3	Q8TD22	OTTHUMG00000129775	ENST00000272433.2:c.226C>T	2.37:g.73268006G>A	ENSP00000272433:p.Arg76Cys		A8K116|Q494Y3|Q53T29	Missense_Mutation	SNP	pfam_Mtc,tigrfam_Mtc	p.R76C	ENST00000272433.2	37	c.226	CCDS1922.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.80|16.80	3.222745|3.222745	0.58668|0.58668	2.27E-4|2.27E-4	0.0|0.0	ENSG00000144040|ENSG00000144040	ENST00000411783|ENST00000272433;ENST00000410065;ENST00000442582	.|T;T;T	.|0.30714	.|1.52;1.52;1.52	5.36|5.36	5.36|5.36	0.76844|0.76844	.|.	.|0.152130	.|0.64402	.|D	.|0.000017	T|T	0.40645|0.40645	0.1125|0.1125	L|L	0.38175|0.38175	1.15|1.15	0.46874|0.46874	D|D	0.99923|0.99923	.|D;P	.|0.64830	.|0.994;0.883	.|P;B	.|0.57548	.|0.823;0.139	T|T	0.13710|0.13710	-1.0499|-1.0499	5|10	.|0.59425	.|D	.|0.04	-0.9481|-0.9481	14.9562|14.9562	0.71116|0.71116	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|76;76	.|B8ZZJ6;Q8TD22	.|.;SFXN5_HUMAN	V|C	65|76	.|ENSP00000272433:R76C;ENSP00000387076:R76C;ENSP00000396825:R76C	.|ENSP00000272433:R76C	A|R	-|-	2|1	0|0	SFXN5|SFXN5	73121514|73121514	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.870000|0.870000	0.49936|0.49936	4.002000|4.002000	0.57053|0.57053	2.698000|2.698000	0.92095|0.92095	0.655000|0.655000	0.94253|0.94253	GCG|CGC	SFXN5	-	pfam_Mtc,tigrfam_Mtc	ENSG00000144040		0.557	SFXN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SFXN5	HGNC	protein_coding	OTTHUMT00000251991.1		0.00	44	0	G	NM_144579		73268006	-1			no_errors	ENST00000272433	ensembl	human	known	74_37	missense	9.09	30	3	SNP	0.998	A
SH3BP1	23616	genome.wustl.edu	37	22	38039752	38039754	+	In_Frame_Del	DEL	AGG	AGG	-			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	AGG	AGG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr22:38039752_38039754delAGG	ENST00000357436.4	+	7	888_890	c.575_577delAGG	c.(574-579)aaggag>aag	p.E197del	SH3BP1_ENST00000495174.1_3'UTR|SH3BP1_ENST00000442465.2_In_Frame_Del_p.E197del|SH3BP1_ENST00000336738.5_In_Frame_Del_p.E197del|Z83844.1_ENST00000456099.1_RNA|SH3BP1_ENST00000599616.1_In_Frame_Del_p.E133del	NM_018957.3	NP_061830.3	Q9Y3L3	3BP1_HUMAN	SH3-domain binding protein 1	197	BAR. {ECO:0000255|PROSITE- ProRule:PRU00361}.				signal transduction (GO:0007165)	cytoplasm (GO:0005737)	GTPase activator activity (GO:0005096)			breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(5)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	13	Melanoma(58;0.0574)					GAGACGCTGAAGGAGGAGGAGGA	0.606											OREG0026546	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0										1,4261		0,1,2130						5.1	1.0			112	1,8253		0,1,4126	no	coding	SH3BP1	NM_018957.3		0,2,6256	A1A1,A1R,RR		0.0121,0.0235,0.016				2,12514				SO:0001651	inframe_deletion	0				CCDS13952.2	22q13.1	2011-07-04			ENSG00000100092	ENSG00000100092		"""Rho GTPase activating proteins"""	10824	protein-coding gene	gene with protein product						10591208, 12029088	Standard	NM_018957		Approved	ARHGAP43	uc003ati.3	Q9Y3L3	OTTHUMG00000030996	ENST00000357436.4:c.575_577delAGG	22.37:g.38039761_38039763delAGG	ENSP00000350018:p.Glu197del	875	Q5R3N0|Q6IBZ2|Q6ZVL9|Q96HQ5|Q9NSQ9	In_Frame_Del	DEL	pfam_RhoGAP_dom,pfam_BAR_dom,superfamily_Rho_GTPase_activation_prot,smart_BAR_dom,smart_RhoGAP_dom,pfscan_BAR_dom,pfscan_RhoGAP_dom	p.E196in_frame_del	ENST00000357436.4	37	c.575_577	CCDS13952.2	22																																																																																			SH3BP1	-	pfam_BAR_dom,smart_BAR_dom,pfscan_BAR_dom	ENSG00000100092		0.606	SH3BP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SH3BP1	HGNC	protein_coding	OTTHUMT00000075884.4		0.00	62	0	AGG	NM_018957		38039754	+1	tier1		no_errors	ENST00000357436	ensembl	human	known	74_37	in_frame_del	9.30	39	4	DEL	1.000:1.000:1.000	-
SHC4	399694	genome.wustl.edu	37	15	49254947	49254947	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr15:49254947C>T	ENST00000332408.4	-	1	694	c.266G>A	c.(265-267)cGc>cAc	p.R89H		NM_203349.3	NP_976224.3	Q6S5L8	SHC4_HUMAN	SHC (Src homology 2 domain containing) family, member 4	89	CH2.				apoptotic process (GO:0006915)|intracellular signal transduction (GO:0035556)|positive regulation of cell proliferation (GO:0008284)|regulation of gene expression (GO:0010468)|stem cell differentiation (GO:0048863)	cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)				breast(1)|endometrium(2)|large_intestine(8)|lung(11)|ovary(3)|pancreas(2)|skin(1)|upper_aerodigestive_tract(1)	29		all_lung(180;0.00466)		all cancers(107;9.4e-08)|GBM - Glioblastoma multiforme(94;5.94e-07)		GCTTGCCATGCGGGGGATCAA	0.627																																																	0													44.0	48.0	47.0					15																	49254947		2197	4295	6492	SO:0001583	missense	0			AY358250	CCDS10130.1	15q21.1-q21.2	2013-02-14			ENSG00000185634	ENSG00000185634		"""SH2 domain containing"""	16743	protein-coding gene	gene with protein product	"""rai-like protein"""						Standard	NM_203349		Approved	RaLP	uc001zxb.1	Q6S5L8	OTTHUMG00000131513	ENST00000332408.4:c.266G>A	15.37:g.49254947C>T	ENSP00000329668:p.Arg89His		Q6UXQ3|Q8IYW3	Missense_Mutation	SNP	pfam_PTB/PI_dom,pfam_SH2,smart_PTB/PI_dom,smart_SH2,pfscan_PTB/PI_dom,pfscan_SH2,prints_PID_Shc-like,prints_SH2	p.R89H	ENST00000332408.4	37	c.266	CCDS10130.1	15	.	.	.	.	.	.	.	.	.	.	C	19.27	3.795960	0.70452	.	.	ENSG00000185634	ENST00000332408	T	0.52754	0.65	4.91	4.91	0.64330	.	0.106721	0.40554	N	0.001063	T	0.59985	0.2234	L	0.59436	1.845	0.80722	D	1	D	0.76494	0.999	P	0.62184	0.899	T	0.62774	-0.6783	10	0.87932	D	0	-16.4854	11.4039	0.49885	0.0:0.9168:0.0:0.0832	.	89	Q6S5L8	SHC4_HUMAN	H	89	ENSP00000329668:R89H	ENSP00000329668:R89H	R	-	2	0	SHC4	47042239	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.489000	0.53237	2.543000	0.85770	0.655000	0.94253	CGC	SHC4	-	NULL	ENSG00000185634		0.627	SHC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SHC4	HGNC	protein_coding	OTTHUMT00000254371.1	-	0.00	89	0	C	NM_203349		49254947	-1	tier1	-	no_errors	ENST00000332408	ensembl	human	known	74_37	missense	6.06	62	4	SNP	1.000	T
SLC6A19	340024	genome.wustl.edu	37	5	1216723	1216723	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr5:1216723C>T	ENST00000304460.10	+	7	994	c.938C>T	c.(937-939)aCa>aTa	p.T313I		NM_001003841.2	NP_001003841.1	Q695T7	S6A19_HUMAN	solute carrier family 6 (neutral amino acid transporter), member 19	313					amino acid transport (GO:0006865)|ion transport (GO:0006811)|response to nutrient (GO:0007584)|transmembrane transport (GO:0055085)	brush border membrane (GO:0031526)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	neurotransmitter:sodium symporter activity (GO:0005328)|neutral amino acid transmembrane transporter activity (GO:0015175)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|lung(25)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	44	all_cancers(3;3.55e-15)|Lung NSC(6;2.89e-14)|all_lung(6;2.2e-13)|all_epithelial(6;3.75e-10)		Epithelial(17;0.000356)|all cancers(22;0.00137)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|Lung(60;0.185)			AACGGCTTCACATCGGTGTAT	0.587																																																	0													303.0	216.0	246.0					5																	1216723		2203	4300	6503	SO:0001583	missense	0			AK096054	CCDS34130.1	5p15	2013-07-19			ENSG00000174358	ENSG00000174358		"""Solute carriers"""	27960	protein-coding gene	gene with protein product	"""Hartnup disease"""	608893					Standard	NM_001003841		Approved		uc003jbw.4	Q695T7	OTTHUMG00000161636	ENST00000304460.10:c.938C>T	5.37:g.1216723C>T	ENSP00000305302:p.Thr313Ile		A8K446	Missense_Mutation	SNP	pfam_Na/ntran_symport,pfscan_Na/ntran_symport,prints_Na/ntran_symport,prints_Na/ntran_symport_orphan	p.T313I	ENST00000304460.10	37	c.938	CCDS34130.1	5	.	.	.	.	.	.	.	.	.	.	C	18.28	3.588703	0.66105	.	.	ENSG00000174358	ENST00000304460	T	0.74526	-0.85	4.61	4.61	0.57282	.	0.048671	0.85682	D	0.000000	D	0.89241	0.6659	M	0.93106	3.38	0.80722	D	1	D	0.76494	0.999	D	0.74023	0.982	D	0.92352	0.5890	10	0.87932	D	0	.	17.4396	0.87562	0.0:1.0:0.0:0.0	.	313	Q695T7	S6A19_HUMAN	I	313	ENSP00000305302:T313I	ENSP00000305302:T313I	T	+	2	0	SLC6A19	1269723	1.000000	0.71417	0.916000	0.36221	0.018000	0.09664	7.583000	0.82559	2.112000	0.64535	0.491000	0.48974	ACA	SLC6A19	-	pfam_Na/ntran_symport,pfscan_Na/ntran_symport,prints_Na/ntran_symport	ENSG00000174358		0.587	SLC6A19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC6A19	HGNC	protein_coding	OTTHUMT00000365557.1	-	0.00	54	0	C	XM_291120		1216723	+1	tier1	-	no_errors	ENST00000304460	ensembl	human	known	74_37	missense	7.41	50	4	SNP	1.000	T
SLITRK5	26050	genome.wustl.edu	37	13	88329272	88329272	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr13:88329272G>T	ENST00000325089.6	+	2	1848	c.1629G>T	c.(1627-1629)ttG>ttT	p.L543F	SLITRK5_ENST00000400028.3_Missense_Mutation_p.L302F	NM_015567.1	NP_056382.1	O94991	SLIK5_HUMAN	SLIT and NTRK-like family, member 5	543					adult behavior (GO:0030534)|axonogenesis (GO:0007409)|cardiovascular system development (GO:0072358)|dendrite morphogenesis (GO:0048813)|grooming behavior (GO:0007625)|response to xenobiotic stimulus (GO:0009410)|skin development (GO:0043588)|striatum development (GO:0021756)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)		p.L543F(1)		breast(1)|central_nervous_system(2)|endometrium(6)|kidney(6)|large_intestine(14)|lung(40)|ovary(2)|pancreas(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(4)	81	all_neural(89;0.101)|Medulloblastoma(90;0.163)					TCACCTCCTTGCCAGTGAGTG	0.507																																																	1	Substitution - Missense(1)	large_intestine(1)											94.0	93.0	94.0					13																	88329272		2203	4300	6503	SO:0001583	missense	0			AB020725	CCDS9465.1	13q31.1	2004-04-16	2004-01-08		ENSG00000165300	ENSG00000165300			20295	protein-coding gene	gene with protein product		609680	"""leucine rich repeat containing 11"""	LRRC11		10048485, 14557068	Standard	NM_015567		Approved	bA364G4.2, KIAA0918	uc001vln.3	O94991	OTTHUMG00000017167	ENST00000325089.6:c.1629G>T	13.37:g.88329272G>T	ENSP00000366283:p.Leu543Phe		B3KNB8|B4DSH5|Q5VT81	Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C	p.L543F	ENST00000325089.6	37	c.1629	CCDS9465.1	13	.	.	.	.	.	.	.	.	.	.	G	13.68	2.309605	0.40895	.	.	ENSG00000165300	ENST00000325089;ENST00000400028	T;T	0.61510	0.1;0.1	5.22	4.34	0.51931	.	0.000000	0.64402	D	0.000004	T	0.59528	0.2200	L	0.31578	0.945	0.47698	D	0.999493	D;D	0.89917	0.998;1.0	D;D	0.87578	0.978;0.998	T	0.57631	-0.7778	9	.	.	.	-8.1908	6.1151	0.20122	0.1007:0.0:0.7178:0.1815	.	302;543	B4DSH5;O94991	.;SLIK5_HUMAN	F	543;302	ENSP00000366283:L543F;ENSP00000442244:L302F	.	L	+	3	2	SLITRK5	87127273	1.000000	0.71417	0.994000	0.49952	0.946000	0.59487	2.198000	0.42705	1.121000	0.41925	0.555000	0.69702	TTG	SLITRK5	-	smart_Leu-rich_rpt_typical-subtyp	ENSG00000165300		0.507	SLITRK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLITRK5	HGNC	protein_coding	OTTHUMT00000045416.3		0.00	50	0	G			88329272	+1			no_errors	ENST00000325089	ensembl	human	known	74_37	missense	7.41	25	2	SNP	1.000	T
EIF4A1	1973	genome.wustl.edu	37	17	7481397	7481397	+	Intron	SNP	G	G	A			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr17:7481397G>A	ENST00000293831.8	+	10	1012				SNORD10_ENST00000459579.1_RNA|SNORA67_ENST00000384423.1_RNA|EIF4A1_ENST00000577269.1_Intron|EIF4A1_ENST00000581808.1_Intron|CD68_ENST00000380498.6_5'Flank|EIF4A1_ENST00000582746.1_Intron|SENP3-EIF4A1_ENST00000579777.1_RNA|CD68_ENST00000250092.6_5'Flank	NM_001416.3	NP_001407.1	P60842	IF4A1_HUMAN	eukaryotic translation initiation factor 4A1						cellular protein metabolic process (GO:0044267)|cytokine-mediated signaling pathway (GO:0019221)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|organ regeneration (GO:0031100)|RNA metabolic process (GO:0016070)|translation (GO:0006412)|translational initiation (GO:0006413)|viral process (GO:0016032)	cytosol (GO:0005829)|eukaryotic translation initiation factor 4F complex (GO:0016281)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|RNA cap binding (GO:0000339)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)			NS(1)|breast(2)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|lung(8)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)	22						GCCTTCCTTGGCTGCCCACAT	0.522																																					Melanoma(120;278 1668 15796 27423 46368)												0													136.0	119.0	124.0					17																	7481397		876	1991	2867	SO:0001627	intron_variant	0			D13748	CCDS11113.1, CCDS58511.1	17p13	2012-02-23	2010-02-10		ENSG00000161960	ENSG00000161960		"""DEAD-boxes"""	3282	protein-coding gene	gene with protein product		602641	"""eukaryotic translation initiation factor 4A, isoform 1"""	EIF4A		8493113, 9790779	Standard	NM_001416		Approved	DDX2A, EIF-4A		P60842	OTTHUMG00000108149	ENST00000293831.8:c.997-86G>A	17.37:g.7481397G>A			B2R6L8|D3DTP9|J3QLC4|P04765|Q5U018|Q61516	RNA	SNP	-	NULL	ENST00000293831.8	37	NULL	CCDS11113.1	17																																																																																			SNORA67	-	-	ENSG00000264772		0.522	EIF4A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNORA67	HGNC	protein_coding	OTTHUMT00000226952.6	-	0.00	75	0	G	NM_001416		7481397	+1	tier1	-	no_errors	ENST00000384423	ensembl	human	known	74_37	rna	8.70	42	4	SNP	0.905	A
SP4	6671	genome.wustl.edu	37	7	21470395	21470395	+	Missense_Mutation	SNP	G	G	T	rs145286007		TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr7:21470395G>T	ENST00000222584.3	+	3	1830	c.1612G>T	c.(1612-1614)Gtt>Ttt	p.V538F		NM_003112.3	NP_003103.2	Q02446	SP4_HUMAN	Sp4 transcription factor	538					regulation of heart contraction (GO:0008016)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(6)|lung(11)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	35						GACAGTGAGCGTTGCCAACCT	0.478													G|||	1	0.000199681	0.0	0.0	5008	,	,		18952	0.0		0.001	False		,,,				2504	0.0																0													131.0	129.0	130.0					7																	21470395		2203	4300	6503	SO:0001583	missense	0				CCDS5373.1	7p15	2013-01-08			ENSG00000105866	ENSG00000105866		"""Specificity protein transcription factors"", ""Zinc fingers, C2H2-type"""	11209	protein-coding gene	gene with protein product		600540				1454515	Standard	XM_005249828		Approved	SPR-1, HF1B, MGC130008, MGC130009	uc003sva.3	Q02446	OTTHUMG00000094801	ENST00000222584.3:c.1612G>T	7.37:g.21470395G>T	ENSP00000222584:p.Val538Phe		O60402|Q32M52	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.V538F	ENST00000222584.3	37	c.1612	CCDS5373.1	7	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	16.64	3.178281	0.57692	.	.	ENSG00000105866	ENST00000222584	T	0.11821	2.74	5.25	5.25	0.73442	.	0.056773	0.64402	D	0.000001	T	0.28896	0.0717	L	0.54323	1.7	0.54753	D	0.999982	D	0.64830	0.994	P	0.55577	0.779	T	0.00173	-1.1957	10	0.49607	T	0.09	.	19.3982	0.94617	0.0:0.0:1.0:0.0	.	538	Q02446	SP4_HUMAN	F	538	ENSP00000222584:V538F	ENSP00000222584:V538F	V	+	1	0	SP4	21436920	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.849000	0.69465	2.894000	0.99253	0.655000	0.94253	GTT	SP4	-	NULL	ENSG00000105866		0.478	SP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SP4	HGNC	protein_coding	OTTHUMT00000211617.2		0.00	59	0	G	NM_003112		21470395	+1			no_errors	ENST00000222584	ensembl	human	known	74_37	missense	5.41	35	2	SNP	1.000	T
SPATA5	166378	genome.wustl.edu	37	4	124235188	124235188	+	Missense_Mutation	SNP	A	A	T			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr4:124235188A>T	ENST00000274008.4	+	16	2720	c.2651A>T	c.(2650-2652)tAt>tTt	p.Y884F		NM_145207.2	NP_660208.2	Q8NB90	SPAT5_HUMAN	spermatogenesis associated 5	884					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)			endometrium(2)|kidney(2)|large_intestine(6)|lung(10)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	24						TATGAAGATTATCAAGAGAAG	0.348																																																	0													81.0	75.0	77.0					4																	124235188		2203	4300	6503	SO:0001583	missense	0			AF361489	CCDS3730.1	4q28.1	2010-04-21			ENSG00000145375	ENSG00000145375		"""ATPases / AAA-type"""	18119	protein-coding gene	gene with protein product	"""ATPase family gene 2 homolog (S. cerevisiae)"""	613940				16465403	Standard	NM_145207		Approved	SPAF, AFG2	uc003iez.4	Q8NB90	OTTHUMG00000133074	ENST00000274008.4:c.2651A>T	4.37:g.124235188A>T	ENSP00000274008:p.Tyr884Phe		C9JT97|Q86XW1|Q8NI20|Q8TDL7	Missense_Mutation	SNP	pfam_ATPase_AAA_core,pfam_DNA_helicase_Holl-junc_RuvB_N,superfamily_P-loop_NTPase,superfamily_Asp_de-COase-like_dom,smart_AAA+_ATPase	p.Y884F	ENST00000274008.4	37	c.2651	CCDS3730.1	4	.	.	.	.	.	.	.	.	.	.	A	10.29	1.308746	0.23821	.	.	ENSG00000145375	ENST00000274008	D	0.94650	-3.48	5.5	4.3	0.51218	.	0.082046	0.50627	N	0.000111	D	0.87799	0.6268	N	0.04705	-0.18	0.38347	D	0.944227	P	0.45768	0.866	P	0.49252	0.604	D	0.84982	0.0889	10	0.06365	T	0.9	-24.4879	11.8409	0.52353	0.8688:0.0:0.0:0.1312	.	884	Q8NB90	SPAT5_HUMAN	F	884	ENSP00000274008:Y884F	ENSP00000274008:Y884F	Y	+	2	0	SPATA5	124454638	1.000000	0.71417	0.988000	0.46212	0.197000	0.23852	7.137000	0.77295	0.904000	0.36572	-0.490000	0.04691	TAT	SPATA5	-	superfamily_P-loop_NTPase	ENSG00000145375		0.348	SPATA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPATA5	HGNC	protein_coding	OTTHUMT00000256714.2		0.00	36	0	A	NM_145207		124235188	+1			no_errors	ENST00000274008	ensembl	human	known	74_37	missense	7.50	37	3	SNP	1.000	T
SPEN	23013	genome.wustl.edu	37	1	16256000	16256000	+	Nonsense_Mutation	SNP	G	G	T			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr1:16256000G>T	ENST00000375759.3	+	11	3469	c.3265G>T	c.(3265-3267)Gga>Tga	p.G1089*		NM_015001.2	NP_055816.2	Q96T58	MINT_HUMAN	spen family transcriptional repressor	1089					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|positive regulation of neurogenesis (GO:0050769)|positive regulation of transcription, DNA-templated (GO:0045893)|viral process (GO:0016032)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)|transcription corepressor activity (GO:0003714)			NS(1)|breast(13)|central_nervous_system(3)|cervix(5)|endometrium(16)|kidney(18)|large_intestine(27)|liver(2)|lung(37)|ovary(7)|prostate(7)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	149		Colorectal(325;0.000258)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(313;0.013)|READ - Rectum adenocarcinoma(331;0.0681)		AGCAAGACTGGGAGAACTAGC	0.473																																																	0													42.0	45.0	44.0					1																	16256000		2203	4300	6503	SO:0001587	stop_gained	0				CCDS164.1	1p36	2013-10-17	2013-10-17		ENSG00000065526	ENSG00000065526		"""RNA binding motif (RRM) containing"""	17575	protein-coding gene	gene with protein product		613484	"""SPEN homolog, transcriptional regulator (Drosophila)"", ""spen homolog, transcriptional regulator (Drosophila)"""			10451362, 11331609	Standard	NM_015001		Approved	KIAA0929, MINT, SHARP, RBM15C	uc001axk.1	Q96T58	OTTHUMG00000009376	ENST00000375759.3:c.3265G>T	1.37:g.16256000G>T	ENSP00000364912:p.Gly1089*		Q9H9A8|Q9NWH5|Q9UQ01|Q9Y556	Nonsense_Mutation	SNP	pfam_RRM_dom,pfam_SPOC_C,superfamily_SPOC_like_C_dom,smart_RRM_dom,pfscan_SPOC_met,pfscan_RRM_dom	p.G1089*	ENST00000375759.3	37	c.3265	CCDS164.1	1	.	.	.	.	.	.	.	.	.	.	G	40	8.027491	0.98616	.	.	ENSG00000065526	ENST00000375759	.	.	.	5.39	4.43	0.53597	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.14252	T	0.57	-8.4227	10.7356	0.46122	0.1732:0.0:0.8268:0.0	.	.	.	.	X	1089	.	ENSP00000364912:G1089X	G	+	1	0	SPEN	16128587	1.000000	0.71417	0.998000	0.56505	0.766000	0.43426	6.034000	0.70933	1.403000	0.46800	0.650000	0.86243	GGA	SPEN	-	NULL	ENSG00000065526		0.473	SPEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPEN	HGNC	protein_coding	OTTHUMT00000025993.1	-	0.00	34	0	G	NM_015001		16256000	+1	tier1	-	no_errors	ENST00000375759	ensembl	human	known	74_37	nonsense	18.75	13	3	SNP	0.988	T
SPNS2	124976	genome.wustl.edu	37	17	4435944	4435944	+	Silent	SNP	C	C	T			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr17:4435944C>T	ENST00000329078.3	+	6	1110	c.900C>T	c.(898-900)acC>acT	p.T300T		NM_001124758.1	NP_001118230.1	Q8IVW8	SPNS2_HUMAN	spinster homolog 2 (Drosophila)	300					B cell homeostasis (GO:0001782)|bone development (GO:0060348)|lymph node development (GO:0048535)|lymphocyte migration (GO:0072676)|regulation of eye pigmentation (GO:0048073)|regulation of humoral immune response (GO:0002920)|sphingolipid metabolic process (GO:0006665)|sphingosine-1-phosphate signaling pathway (GO:0003376)|T cell homeostasis (GO:0043029)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)	sphingolipid transporter activity (GO:0046624)			large_intestine(3)|lung(1)|prostate(1)|skin(1)	6						AGGCCCGGACCTCATGGCTCC	0.597																																																	0													72.0	72.0	72.0					17																	4435944		1568	3582	5150	SO:0001819	synonymous_variant	0			BC041772	CCDS42237.1	17p13.2	2008-12-15				ENSG00000183018			26992	protein-coding gene	gene with protein product		612584				12815463	Standard	NM_001124758		Approved		uc002fxx.2	Q8IVW8		ENST00000329078.3:c.900C>T	17.37:g.4435944C>T			B9A1T3	Silent	SNP	pfam_MFS,pfam_Sub_transporter,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.T300	ENST00000329078.3	37	c.900	CCDS42237.1	17																																																																																			SPNS2	-	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	ENSG00000183018		0.597	SPNS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPNS2	HGNC	protein_coding	OTTHUMT00000438802.1	-	0.00	25	0	C			4435944	+1	tier1	-	no_errors	ENST00000329078	ensembl	human	known	74_37	silent	36.00	16	9	SNP	1.000	T
SPTBN4	57731	genome.wustl.edu	37	19	41060531	41060531	+	Missense_Mutation	SNP	T	T	A			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr19:41060531T>A	ENST00000352632.3	+	24	5149	c.5063T>A	c.(5062-5064)cTg>cAg	p.L1688Q	SPTBN4_ENST00000338932.3_Missense_Mutation_p.L1688Q|SPTBN4_ENST00000595535.1_Missense_Mutation_p.L1688Q|SPTBN4_ENST00000598249.1_Missense_Mutation_p.L1688Q|SPTBN4_ENST00000392025.1_Missense_Mutation_p.L431Q|SPTBN4_ENST00000392023.1_Missense_Mutation_p.L364Q			Q9H254	SPTN4_HUMAN	spectrin, beta, non-erythrocytic 4	1688					actin filament capping (GO:0051693)|adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cardiac conduction (GO:0061337)|central nervous system projection neuron axonogenesis (GO:0021952)|clustering of voltage-gated sodium channels (GO:0045162)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization to plasma membrane (GO:0090002)|fertilization (GO:0009566)|negative regulation of heart rate (GO:0010459)|positive regulation of multicellular organism growth (GO:0040018)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of sodium ion transport (GO:0002028)|sensory perception of sound (GO:0007605)|transmission of nerve impulse (GO:0019226)|vesicle-mediated transport (GO:0016192)	adherens junction (GO:0005912)|axon hillock (GO:0043203)|axon initial segment (GO:0043194)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|nuclear matrix (GO:0016363)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|PML body (GO:0016605)|spectrin (GO:0008091)	actin binding (GO:0003779)|ankyrin binding (GO:0030506)|phosphatase binding (GO:0019902)|phospholipid binding (GO:0005543)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			breast(4)|central_nervous_system(1)|endometrium(6)|kidney(7)|large_intestine(9)|lung(32)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	73			Lung(22;0.000114)|LUSC - Lung squamous cell carcinoma(20;0.000384)			CGGGCGCTGCTGGAGATGGGG	0.652																																																	0													14.0	14.0	14.0					19																	41060531		2194	4290	6484	SO:0001583	missense	0			AF082075	CCDS12559.1, CCDS42569.1	19q13.13	2013-01-10				ENSG00000160460		"""Pleckstrin homology (PH) domain containing"""	14896	protein-coding gene	gene with protein product		606214				11086001	Standard	NM_020971		Approved	SPTBN3, KIAA1642	uc002onz.3	Q9H254		ENST00000352632.3:c.5063T>A	19.37:g.41060531T>A	ENSP00000263373:p.Leu1688Gln		E9PGQ5|Q9H1K7|Q9H1K8|Q9H1K9|Q9H253|Q9H3G8|Q9HCD0	Missense_Mutation	SNP	pirsf_Spectrin_bsu,pfam_Spectrin_repeat,pfam_CH-domain,pfam_Pleckstrin_homology,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Pleckstrin_homology,prints_PH_dom-spectrin-type,pfscan_CH-domain,pfscan_Pleckstrin_homology	p.L1688Q	ENST00000352632.3	37	c.5063	CCDS12559.1	19	.	.	.	.	.	.	.	.	.	.	T	22.6	4.309493	0.81247	.	.	ENSG00000160460	ENST00000428507;ENST00000352632;ENST00000338932;ENST00000392025;ENST00000392023	T;T;T;T	0.38560	1.13;1.13;1.13;1.13	4.62	4.62	0.57501	.	0.000000	0.48767	D	0.000165	T	0.54565	0.1866	L	0.46157	1.445	0.40943	D	0.984489	D;D;D;D;D	0.89917	0.998;1.0;0.999;1.0;0.998	D;D;P;D;D	0.85130	0.912;0.978;0.904;0.997;0.96	T	0.51284	-0.8725	10	0.25751	T	0.34	.	13.0253	0.58812	0.0:0.0:0.0:1.0	.	431;431;364;1688;1688	Q9H254-3;C9JY79;E9PGQ5;Q9H254;Q71S06	.;.;.;SPTN4_HUMAN;.	Q	1688;1688;1688;431;364	ENSP00000263373:L1688Q;ENSP00000340345:L1688Q;ENSP00000375879:L431Q;ENSP00000375877:L364Q	ENSP00000340345:L1688Q	L	+	2	0	SPTBN4	45752371	1.000000	0.71417	1.000000	0.80357	0.849000	0.48306	5.684000	0.68197	1.724000	0.51502	0.260000	0.18958	CTG	SPTBN4	-	pirsf_Spectrin_bsu,pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin	ENSG00000160460		0.652	SPTBN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPTBN4	HGNC	protein_coding	OTTHUMT00000462559.2	-	0.00	58	0	T			41060531	+1	tier1	-	no_errors	ENST00000352632	ensembl	human	known	74_37	missense	8.00	46	4	SNP	1.000	A
SRGAP1	57522	genome.wustl.edu	37	12	64456706	64456706	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr12:64456706C>A	ENST00000355086.3	+	7	1335	c.811C>A	c.(811-813)Ctt>Att	p.L271I	SRGAP1_ENST00000543397.1_Missense_Mutation_p.L231I|SRGAP1_ENST00000357825.3_Missense_Mutation_p.L271I|RP11-196H14.2_ENST00000535594.1_RNA	NM_020762.2	NP_065813.1	Q7Z6B7	SRGP1_HUMAN	SLIT-ROBO Rho GTPase activating protein 1	271	F-BAR domain.				axon guidance (GO:0007411)|cell migration (GO:0016477)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	Rho GTPase activator activity (GO:0005100)			breast(4)|central_nervous_system(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(26)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	65			GBM - Glioblastoma multiforme(3;0.000139)|BRCA - Breast invasive adenocarcinoma(9;0.225)	GBM - Glioblastoma multiforme(28;0.0608)		GTGCTGTGATCTTGGCTACCA	0.383																																																	0													75.0	67.0	70.0					12																	64456706		2203	4300	6503	SO:0001583	missense	0			AB037725	CCDS8967.1	12q13.13	2011-07-04			ENSG00000196935	ENSG00000196935		"""Rho GTPase activating proteins"""	17382	protein-coding gene	gene with protein product		606523				11672528	Standard	NM_020762		Approved	KIAA1304, ARHGAP13	uc010ssp.1	Q7Z6B7	OTTHUMG00000168750	ENST00000355086.3:c.811C>A	12.37:g.64456706C>A	ENSP00000347198:p.Leu271Ile		Q9H8A3|Q9P2P2	Missense_Mutation	SNP	pfam_RhoGAP_dom,pfam_FCH_dom,pfam_SH3_domain,pfam_SH3_2,superfamily_Rho_GTPase_activation_prot,superfamily_SH3_domain,superfamily_Fuc/Ara_isomerase_C,smart_FCH_dom,smart_RhoGAP_dom,smart_SH3_domain,pfscan_FCH_dom,pfscan_SH3_domain,pfscan_RhoGAP_dom	p.L271I	ENST00000355086.3	37	c.811	CCDS8967.1	12	.	.	.	.	.	.	.	.	.	.	C	23.2	4.385422	0.82792	.	.	ENSG00000196935	ENST00000355086;ENST00000357825;ENST00000543397	T;T;T	0.45276	0.9;0.9;2.49	4.78	4.78	0.61160	.	0.000000	0.31976	U	0.006779	T	0.66356	0.2781	M	0.79614	2.46	0.80722	D	1	D;D;P	0.76494	0.999;0.979;0.883	D;P;P	0.72625	0.978;0.905;0.755	T	0.66472	-0.5915	9	.	.	.	.	19.1337	0.93417	0.0:1.0:0.0:0.0	.	271;231;271	Q7Z6B7;G5EA48;Q7Z6B7-2	SRGP1_HUMAN;.;.	I	271;271;231	ENSP00000347198:L271I;ENSP00000350480:L271I;ENSP00000437948:L231I	.	L	+	1	0	SRGAP1	62742973	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	3.050000	0.49877	2.937000	0.99478	0.650000	0.86243	CTT	SRGAP1	-	NULL	ENSG00000196935		0.383	SRGAP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SRGAP1	HGNC	protein_coding	OTTHUMT00000400896.1		0.00	47	0	C			64456706	+1			no_errors	ENST00000355086	ensembl	human	known	74_37	missense	5.00	38	2	SNP	1.000	A
STAB2	55576	genome.wustl.edu	37	12	104063385	104063385	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr12:104063385C>A	ENST00000388887.2	+	21	2443	c.2239C>A	c.(2239-2241)Cca>Aca	p.P747T	RP11-341G23.3_ENST00000550175.1_RNA	NM_017564.9	NP_060034.9			stabilin 2											NS(4)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(15)|kidney(11)|large_intestine(26)|lung(77)|ovary(10)|pancreas(1)|prostate(5)|skin(14)|stomach(2)	174						CTTCTCAAATCCATGCTCAGG	0.408																																																	0													110.0	107.0	108.0					12																	104063385		2203	4300	6503	SO:0001583	missense	0			AF160476	CCDS31888.1	12q23.3	2007-01-29				ENSG00000136011			18629	protein-coding gene	gene with protein product	"""hyaluronic acid receptor for endocytosis"""	608561				11829752, 12077138	Standard	XR_429107		Approved	DKFZP434E0321, FELL, STAB-2, HARE, FEEL-2	uc001tjw.3	Q8WWQ8	OTTHUMG00000170056	ENST00000388887.2:c.2239C>A	12.37:g.104063385C>A	ENSP00000373539:p.Pro747Thr			Missense_Mutation	SNP	pfam_FAS1_domain,pfam_Link,superfamily_C-type_lectin_fold,superfamily_FAS1_domain,superfamily_Growth_fac_rcpt_N_dom,smart_EG-like_dom,smart_EGF_laminin,smart_EGF-like_Ca-bd_dom,smart_FAS1_domain,smart_Link,pfscan_EG-like_dom,pfscan_FAS1_domain,pfscan_Link	p.P747T	ENST00000388887.2	37	c.2239	CCDS31888.1	12	.	.	.	.	.	.	.	.	.	.	C	15.82	2.947444	0.53186	.	.	ENSG00000136011	ENST00000388887	D	0.83591	-1.74	5.44	4.55	0.56014	Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	0.058726	0.64402	D	0.000002	T	0.81912	0.4923	M	0.87456	2.885	0.51233	D	0.999914	P	0.38535	0.635	B	0.26517	0.07	T	0.82975	-0.0190	10	0.51188	T	0.08	.	12.9088	0.58169	0.0:0.9202:0.0:0.0798	.	747	Q8WWQ8	STAB2_HUMAN	T	747	ENSP00000373539:P747T	ENSP00000373539:P747T	P	+	1	0	STAB2	102587515	0.999000	0.42202	0.648000	0.29521	0.956000	0.61745	4.339000	0.59322	1.313000	0.45069	0.650000	0.86243	CCA	STAB2	-	smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom	ENSG00000136011		0.408	STAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STAB2	HGNC	protein_coding	OTTHUMT00000407089.1	-	0.00	47	0	C			104063385	+1	tier1	-	no_errors	ENST00000388887	ensembl	human	known	74_37	missense	23.91	35	11	SNP	1.000	A
STAT4	6775	genome.wustl.edu	37	2	191941041	191941041	+	Missense_Mutation	SNP	T	T	C			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr2:191941041T>C	ENST00000392320.2	-	4	598	c.284A>G	c.(283-285)cAt>cGt	p.H95R	STAT4_ENST00000358470.4_Missense_Mutation_p.H95R	NM_003151.3	NP_003142.1	Q14765	STAT4_HUMAN	signal transducer and activator of transcription 4	95					cell proliferation (GO:0008283)|cytokine-mediated signaling pathway (GO:0019221)|JAK-STAT cascade (GO:0007259)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			breast(4)|endometrium(1)|kidney(2)|large_intestine(6)|lung(19)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	42			OV - Ovarian serous cystadenocarcinoma(117;0.00854)|Epithelial(96;0.0864)|all cancers(119;0.204)			TGGATTTCCATGAAATTTTCC	0.328																																																	0													87.0	91.0	89.0					2																	191941041		2203	4300	6503	SO:0001583	missense	0				CCDS2310.1	2q32.2-q32.3	2013-02-14			ENSG00000138378	ENSG00000138378		"""SH2 domain containing"""	11365	protein-coding gene	gene with protein product		600558				8007943, 8700208	Standard	NM_003151		Approved		uc002usn.2	Q14765	OTTHUMG00000132700	ENST00000392320.2:c.284A>G	2.37:g.191941041T>C	ENSP00000376134:p.His95Arg		Q96NZ6	Missense_Mutation	SNP	pfam_STAT_TF_DNA-bd,pfam_STAT_TF_alpha,pfam_STAT_TF_prot_interaction,pfam_SH2,superfamily_p53-like_TF_DNA-bd,superfamily_STAT_TF_coiled-coil,superfamily_STAT_TF_prot_interaction,smart_STAT_TF_prot_interaction,pfscan_SH2	p.H95R	ENST00000392320.2	37	c.284	CCDS2310.1	2	.	.	.	.	.	.	.	.	.	.	T	7.129	0.579443	0.13686	.	.	ENSG00000138378	ENST00000358470;ENST00000392320;ENST00000413064	T;T;T	0.50001	0.76;0.76;0.76	5.58	4.42	0.53409	STAT transcription factor, protein interaction (4);	0.390174	0.27787	N	0.017852	T	0.26991	0.0661	N	0.14661	0.345	0.80722	D	1	P;B;B	0.35307	0.494;0.275;0.275	B;B;B	0.34722	0.188;0.082;0.082	T	0.07290	-1.0780	10	0.12103	T	0.63	-28.2491	10.3459	0.43906	0.0:0.0787:0.0:0.9213	.	95;95;95	B4DSY7;B4DV04;Q14765	.;.;STAT4_HUMAN	R	95;95;68	ENSP00000351255:H95R;ENSP00000376134:H95R;ENSP00000403238:H68R	ENSP00000351255:H95R	H	-	2	0	STAT4	191649286	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.790000	0.55461	2.248000	0.74166	0.528000	0.53228	CAT	STAT4	-	pfam_STAT_TF_prot_interaction,superfamily_STAT_TF_prot_interaction,smart_STAT_TF_prot_interaction	ENSG00000138378		0.328	STAT4-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	STAT4	HGNC	protein_coding	OTTHUMT00000335586.1		0.00	35	0	T	NM_003151		191941041	-1			no_errors	ENST00000358470	ensembl	human	known	74_37	missense	7.69	36	3	SNP	1.000	C
RNF217-AS1	7955	genome.wustl.edu	37	6	125232348	125232348	+	RNA	SNP	G	G	T			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr6:125232348G>T	ENST00000439075.1	-	0	2397					NR_026876.1																						CCCTTAAAATGGAAAGAATCA	0.433																																																	0													13.0	13.0	13.0					6																	125232348		876	1988	2864			0																															6.37:g.125232348G>T				RNA	SNP	-	NULL	ENST00000439075.1	37	NULL		6																																																																																			RP11-510H23.1	-	-	ENSG00000236548		0.433	RP11-510H23.1-001	KNOWN	basic	antisense	STL	Clone_based_vega_gene	antisense	OTTHUMT00000042059.1	-	0.00	48	0	G			125232348	-1	tier1	-	no_errors	ENST00000439075	ensembl	human	known	74_37	rna	7.41	50	4	SNP	0.000	T
SYNE2	23224	genome.wustl.edu	37	14	64492102	64492102	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr14:64492102G>T	ENST00000344113.4	+	41	6427	c.6215G>T	c.(6214-6216)gGc>gTc	p.G2072V	SYNE2_ENST00000357395.3_5'UTR|SYNE2_ENST00000554584.1_Missense_Mutation_p.G2072V|SYNE2_ENST00000358025.3_Missense_Mutation_p.G2072V	NM_015180.4	NP_055995.4	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	2072					centrosome localization (GO:0051642)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment or maintenance of cell polarity (GO:0007163)|fibroblast migration (GO:0010761)|nuclear envelope organization (GO:0006998)|nuclear migration (GO:0007097)|nuclear migration along microfilament (GO:0031022)|positive regulation of cell migration (GO:0030335)|protein localization to nucleus (GO:0034504)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intermediate filament cytoskeleton (GO:0045111)|lamellipodium membrane (GO:0031258)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)|SUN-KASH complex (GO:0034993)|Z disc (GO:0030018)	actin binding (GO:0003779)			NS(5)|breast(17)|central_nervous_system(3)|cervix(8)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(21)|large_intestine(34)|lung(75)|ovary(10)|pancreas(2)|prostate(8)|skin(8)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(4)	224				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		TCATCCGAAGGCAAAATGCCA	0.353																																																	0													60.0	56.0	58.0					14																	64492102		1812	4080	5892	SO:0001583	missense	0			AB023228	CCDS9761.2, CCDS41963.1, CCDS45124.1, CCDS45125.1	14q22.1-q22.3	2014-09-17			ENSG00000054654	ENSG00000054654			17084	protein-coding gene	gene with protein product	"""nuclear envelope spectrin repeat-2"", ""nucleus and actin connecting element"""	608442				10231032, 10878022	Standard	NM_182910		Approved	SYNE-2, DKFZP434H2235, Nesprin-2, NUANCE, NUA, KIAA1011, Nesp2	uc001xgl.3	Q8WXH0	OTTHUMG00000140349	ENST00000344113.4:c.6215G>T	14.37:g.64492102G>T	ENSP00000341781:p.Gly2072Val		Q540G1|Q8N1S3|Q8NF49|Q8TER7|Q8WWW3|Q8WWW4|Q8WWW5|Q8WXH1|Q9NU50|Q9UFQ4|Q9Y2L4|Q9Y4R1	Missense_Mutation	SNP	pfam_CH-domain,pfam_KASH,pfam_Spectrin_repeat,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,smart_Spectrin/alpha-actinin,pfscan_CH-domain,pfscan_KASH	p.G2072V	ENST00000344113.4	37	c.6215	CCDS41963.1	14	.	.	.	.	.	.	.	.	.	.	G	13.51	2.258897	0.39896	.	.	ENSG00000054654	ENST00000358025;ENST00000344113;ENST00000554584;ENST00000261678	T;T;T	0.71698	-0.59;-0.58;-0.42	5.9	5.01	0.66863	.	0.184065	0.38837	N	0.001547	T	0.56891	0.2016	L	0.27053	0.805	0.80722	D	1	B;B	0.32203	0.246;0.36	B;B	0.31442	0.061;0.13	T	0.57142	-0.7862	10	0.41790	T	0.15	.	11.3626	0.49653	0.0:0.1362:0.7222:0.1416	.	2072;2072	Q8WXH0;Q8WXH0-2	SYNE2_HUMAN;.	V	2072	ENSP00000350719:G2072V;ENSP00000341781:G2072V;ENSP00000452570:G2072V	ENSP00000261678:G2072V	G	+	2	0	SYNE2	63561855	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	2.576000	0.46033	1.496000	0.48567	0.455000	0.32223	GGC	SYNE2	-	smart_Spectrin/alpha-actinin	ENSG00000054654		0.353	SYNE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYNE2	HGNC	protein_coding	OTTHUMT00000276994.2	-	0.00	85	0	G	NM_182914		64492102	+1	tier1	-	no_errors	ENST00000358025	ensembl	human	known	74_37	missense	7.84	47	4	SNP	1.000	T
TAF1C	9013	genome.wustl.edu	37	16	84217308	84217308	+	Missense_Mutation	SNP	A	A	G			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr16:84217308A>G	ENST00000567759.1	-	3	397	c.215T>C	c.(214-216)cTc>cCc	p.L72P	TAF1C_ENST00000541676.1_Missense_Mutation_p.L5P|TAF1C_ENST00000565544.1_5'Flank|TAF1C_ENST00000570117.1_Intron|TAF1C_ENST00000341690.6_Missense_Mutation_p.L5P|TAF1C_ENST00000566732.1_Missense_Mutation_p.L72P|TAF1C_ENST00000378541.4_Missense_Mutation_p.L72P	NM_005679.3	NP_005670	Q15572	TAF1C_HUMAN	TATA box binding protein (TBP)-associated factor, RNA polymerase I, C, 110kDa	72					gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase I promoter (GO:0006361)	nucleoplasm (GO:0005654)	DNA binding (GO:0003677)			endometrium(1)|kidney(3)|large_intestine(3)|lung(11)|ovary(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	26						CTTACCGATGAGGGGAGGCAG	0.617																																																	0													69.0	68.0	68.0					16																	84217308		2200	4300	6500	SO:0001583	missense	0			L39059	CCDS32496.1, CCDS45535.1, CCDS58488.1, CCDS58489.1	16q24	2008-02-05	2002-08-29			ENSG00000103168			11534	protein-coding gene	gene with protein product		604905	"""TATA box binding protein (TBP)-associated factor, RNA polymerase I, C, 110kD"""			7801123	Standard	NM_005679		Approved	TAFI110, TAFI95, SL1, MGC:39976	uc010vnx.2	Q15572		ENST00000567759.1:c.215T>C	16.37:g.84217308A>G	ENSP00000455265:p.Leu72Pro		B7Z5K5|B7Z5S4|B7Z908|B7Z9L7|Q59F67|Q8N6V3	Missense_Mutation	SNP	superfamily_WD40_repeat_dom	p.L72P	ENST00000567759.1	37	c.215	CCDS32496.1	16	.	.	.	.	.	.	.	.	.	.	A	4.220	0.039742	0.08148	.	.	ENSG00000103168	ENST00000378541;ENST00000541676;ENST00000341690;ENST00000537450	T;T;T	0.43294	0.95;3.73;3.73	4.35	1.05	0.20165	.	0.841691	0.10145	N	0.710335	T	0.23171	0.0560	N	0.22421	0.69	0.09310	N	0.999997	B;B;P;B	0.38420	0.399;0.399;0.63;0.399	B;B;B;B	0.34652	0.095;0.134;0.187;0.092	T	0.12243	-1.0555	10	0.37606	T	0.19	0.0336	2.9563	0.05877	0.1775:0.539:0.18:0.1034	.	72;72;72;5	F5H7W6;Q15572-6;Q15572;Q15572-2	.;.;TAF1C_HUMAN;.	P	72;5;5;72	ENSP00000367802:L72P;ENSP00000437900:L5P;ENSP00000345305:L5P	ENSP00000345305:L5P	L	-	2	0	TAF1C	82774809	0.003000	0.15002	0.008000	0.14137	0.000000	0.00434	0.142000	0.16096	0.064000	0.16427	-1.074000	0.02243	CTC	TAF1C	-	NULL	ENSG00000103168		0.617	TAF1C-001	KNOWN	basic|CCDS	protein_coding	TAF1C	HGNC	protein_coding	OTTHUMT00000433045.2	-	0.00	61	0	A	NM_139353		84217308	-1	tier1	-	no_errors	ENST00000378541	ensembl	human	known	74_37	missense	7.84	47	4	SNP	0.027	G
TBR1	10716	genome.wustl.edu	37	2	162280507	162280507	+	Silent	SNP	C	C	T			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr2:162280507C>T	ENST00000389554.3	+	6	2135	c.1818C>T	c.(1816-1818)ccC>ccT	p.P606P	AC009487.4_ENST00000437683.1_RNA|AC009487.4_ENST00000444164.1_RNA|AC009487.5_ENST00000505579.1_RNA|TBR1_ENST00000410035.1_Silent_p.P319P	NM_006593.2	NP_006584.1	Q16650	TBR1_HUMAN	T-box, brain, 1	606					axon guidance (GO:0007411)|brain development (GO:0007420)|hindbrain development (GO:0030902)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of neuron projection development (GO:0010975)|specification of organ identity (GO:0010092)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(6)|lung(15)|ovary(1)|prostate(1)|skin(3)	30						ACGCCAAGCCCAAGGACCTGT	0.711																																																	0													10.0	11.0	11.0					2																	162280507		2173	4269	6442	SO:0001819	synonymous_variant	0			U49250	CCDS33310.1	2q24.2	2011-06-13			ENSG00000136535	ENSG00000136535		"""T-boxes"""	11590	protein-coding gene	gene with protein product		604616				7619531	Standard	NM_006593		Approved		uc002ubw.1	Q16650	OTTHUMG00000153888	ENST00000389554.3:c.1818C>T	2.37:g.162280507C>T			B0AZS4|B2R6G5|Q14DC5|Q53TH0|Q56A81	Silent	SNP	pfam_TF_T-box,superfamily_p53-like_TF_DNA-bd,smart_TF_T-box,pfscan_TF_T-box,prints_TF_T-box	p.P606	ENST00000389554.3	37	c.1818	CCDS33310.1	2																																																																																			TBR1	-	NULL	ENSG00000136535		0.711	TBR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBR1	HGNC	protein_coding	OTTHUMT00000332845.1	-	0.00	17	0	C	NM_006593		162280507	+1	tier1	-	no_errors	ENST00000389554	ensembl	human	known	74_37	silent	36.84	12	7	SNP	1.000	T
TFAP2B	7021	genome.wustl.edu	37	6	50789792	50789793	+	Intron	INS	-	-	T	rs36011604|rs182646289	byFrequency	TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr6:50789792_50789793insT	ENST00000393655.3	+	2	250				TFAP2B_ENST00000263046.4_Intron|TFAP2B_ENST00000489228.1_3'UTR	NM_003221.3	NP_003212.2	Q92481	AP2B_HUMAN	transcription factor AP-2 beta (activating enhancer binding protein 2 beta)						aorta morphogenesis (GO:0035909)|calcium ion homeostasis (GO:0055074)|cellular ammonia homeostasis (GO:0097275)|cellular creatinine homeostasis (GO:0097276)|cellular urea homeostasis (GO:0097277)|collecting duct development (GO:0072044)|distal tubule development (GO:0072017)|ductus arteriosus closure (GO:0097070)|fat cell differentiation (GO:0045444)|forelimb morphogenesis (GO:0035136)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|hindlimb morphogenesis (GO:0035137)|kidney development (GO:0001822)|magnesium ion homeostasis (GO:0010960)|metanephric nephron development (GO:0072210)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|phosphate ion homeostasis (GO:0055062)|positive regulation of cell proliferation (GO:0008284)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of urine volume (GO:0035810)|potassium ion homeostasis (GO:0055075)|regulation of BMP signaling pathway (GO:0030510)|regulation of cell differentiation (GO:0045595)|regulation of insulin secretion (GO:0050796)|regulation of transcription, DNA-templated (GO:0006355)|renal water homeostasis (GO:0003091)|response to drug (GO:0042493)|response to lithium ion (GO:0010226)|retina layer formation (GO:0010842)|skin development (GO:0043588)|sodium ion homeostasis (GO:0055078)|sympathetic nervous system development (GO:0048485)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|DNA binding (GO:0003677)|enhancer sequence-specific DNA binding (GO:0001158)|protein dimerization activity (GO:0046983)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity (GO:0000983)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription corepressor activity (GO:0001106)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			NS(1)|breast(2)|endometrium(6)|kidney(1)|large_intestine(11)|lung(16)|prostate(2)|upper_aerodigestive_tract(1)	40	Lung NSC(77;0.156)					GGACTCCTTGATTTTTTTTTTA	0.406																																					Pancreas(116;1373 2332 5475 10752)												0																																										SO:0001627	intron_variant	0			X95694	CCDS4934.2	6p12	2008-02-05	2001-11-28		ENSG00000008196	ENSG00000008196			11743	protein-coding gene	gene with protein product		601601	"""transcription factor AP-2 beta (activating enhancer-binding protein 2 beta)"""			7555706, 8661133	Standard	NM_003221		Approved	AP2-B	uc003pag.3	Q92481	OTTHUMG00000014836	ENST00000393655.3:c.82-1327->T	6.37:g.50789802_50789802dupT			Q5JYX6|Q9NQ63|Q9NU99|Q9UJI7|Q9Y214|Q9Y3K3	RNA	INS	-	NULL	ENST00000393655.3	37	NULL	CCDS4934.2	6																																																																																			TFAP2B	-	-	ENSG00000008196		0.406	TFAP2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TFAP2B	HGNC	protein_coding	OTTHUMT00000040886.3		0.00	41	0	-	NM_003221		50789793	+1	tier1		no_errors	ENST00000489228	ensembl	human	known	74_37	rna	6.45	29	2	INS	0.549:0.009	T
TFAP4	7023	genome.wustl.edu	37	16	4312652	4312652	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr16:4312652C>T	ENST00000204517.6	-	2	468	c.140G>A	c.(139-141)cGg>cAg	p.R47Q		NM_003223.2	NP_003214.1	Q01664	TFAP4_HUMAN	transcription factor AP-4 (activating enhancer binding protein 4)	47					cellular response to dexamethasone stimulus (GO:0071549)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|negative regulation by host of viral transcription (GO:0043922)|negative regulation of cell cycle arrest (GO:0071157)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of DNA binding (GO:0043392)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic signaling pathway (GO:2001269)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|E-box binding (GO:0070888)|histone deacetylase binding (GO:0042826)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|transcription regulatory region DNA binding (GO:0044212)	p.R47Q(1)		NS(1)|endometrium(2)|lung(8)|ovary(1)|prostate(1)|skin(1)	14						CCGCCGAATCCGCCGCTCCTG	0.622																																																	1	Substitution - Missense(1)	ovary(1)											88.0	91.0	90.0					16																	4312652		2197	4300	6497	SO:0001583	missense	0			X57435	CCDS10510.1	16p13	2013-05-21	2001-11-28		ENSG00000090447	ENSG00000090447		"""Basic helix-loop-helix proteins"""	11745	protein-coding gene	gene with protein product		600743	"""transcription factor AP-4 (activating enhancer-binding protein 4)"""			2123466	Standard	NM_003223		Approved	AP-4, bHLHc41	uc010uxg.2	Q01664	OTTHUMG00000129435	ENST00000204517.6:c.140G>A	16.37:g.4312652C>T	ENSP00000204517:p.Arg47Gln		O60409	Missense_Mutation	SNP	pfam_bHLH_dom,superfamily_bHLH_dom,smart_bHLH_dom,pfscan_bHLH_dom	p.R47Q	ENST00000204517.6	37	c.140	CCDS10510.1	16	.	.	.	.	.	.	.	.	.	.	C	27.4	4.829840	0.91036	.	.	ENSG00000090447	ENST00000204517	D	0.98876	-5.2	5.57	5.57	0.84162	Helix-loop-helix DNA-binding (2);	0.000000	0.64402	D	0.000001	D	0.97639	0.9226	N	0.08118	0	0.80722	D	1	D	0.69078	0.997	D	0.67725	0.953	D	0.99888	1.1127	10	0.62326	D	0.03	.	18.3242	0.90247	0.0:1.0:0.0:0.0	.	47	Q01664	TFAP4_HUMAN	Q	47	ENSP00000204517:R47Q	ENSP00000204517:R47Q	R	-	2	0	TFAP4	4252653	1.000000	0.71417	1.000000	0.80357	0.784000	0.44337	7.192000	0.77771	2.618000	0.88619	0.591000	0.81541	CGG	TFAP4	-	superfamily_bHLH_dom,pfscan_bHLH_dom	ENSG00000090447		0.622	TFAP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TFAP4	HGNC	protein_coding	OTTHUMT00000251595.2		0.00	36	0	C	NM_003223		4312652	-1			no_errors	ENST00000204517	ensembl	human	known	74_37	missense	7.69	24	2	SNP	1.000	T
TLN1	7094	genome.wustl.edu	37	9	35707164	35707164	+	Silent	SNP	G	G	A	rs554877602		TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr9:35707164G>A	ENST00000314888.9	-	37	5213	c.4860C>T	c.(4858-4860)ctC>ctT	p.L1620L	TLN1_ENST00000464379.1_Intron|TLN1_ENST00000540444.1_Silent_p.L1620L	NM_006289.3	NP_006280.3	Q9Y490	TLN1_HUMAN	talin 1	1620	Interaction with SYNM.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-cell junction assembly (GO:0007043)|cell-substrate junction assembly (GO:0007044)|cellular component movement (GO:0006928)|cellular protein metabolic process (GO:0044267)|cortical actin cytoskeleton organization (GO:0030866)|cytoskeletal anchoring at plasma membrane (GO:0007016)|endoplasmic reticulum unfolded protein response (GO:0030968)|muscle contraction (GO:0006936)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|microtubule organizing center (GO:0005815)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	integrin binding (GO:0005178)|LIM domain binding (GO:0030274)|structural constituent of cytoskeleton (GO:0005200)|vinculin binding (GO:0017166)			NS(2)|breast(8)|central_nervous_system(2)|endometrium(10)|kidney(5)|large_intestine(9)|lung(32)|ovary(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(6)	85	all_epithelial(49;0.167)		Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			GATTGACTGCGAGGGCCCGGG	0.607													G|||	1	0.000199681	0.0008	0.0	5008	,	,		17329	0.0		0.0	False		,,,				2504	0.0																0													50.0	58.0	55.0					9																	35707164		2203	4300	6503	SO:0001819	synonymous_variant	0			AB028950	CCDS35009.1	9p23-p21	2008-02-05			ENSG00000137076	ENSG00000137076			11845	protein-coding gene	gene with protein product		186745		TLN		7635475, 10610730	Standard	NM_006289		Approved	ILWEQ	uc003zxt.2	Q9Y490	OTTHUMG00000019874	ENST00000314888.9:c.4860C>T	9.37:g.35707164G>A			A6NMY0|Q86YD0|Q9NZQ2|Q9UHH8|Q9UPX3	Silent	SNP	pfam_Talin_cent,pfam_Vinculin-bd_dom,pfam_ILWEQ_dom,pfam_FERM_N,pfam_FERM_central,pfam_Insln_rcpt_S1,superfamily_Talin_cent,superfamily_Vinculin/catenin,superfamily_FERM_central,smart_Band_41_domain,smart_ILWEQ_dom,pfscan_FERM_domain,pfscan_ILWEQ_dom	p.L1620	ENST00000314888.9	37	c.4860	CCDS35009.1	9																																																																																			TLN1	-	superfamily_Vinculin/catenin	ENSG00000137076		0.607	TLN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TLN1	HGNC	protein_coding	OTTHUMT00000052353.2	-	0.00	99	0	G	NM_006289		35707164	-1	tier1	-	no_errors	ENST00000314888	ensembl	human	known	74_37	silent	13.19	79	12	SNP	0.271	A
TLN2	83660	genome.wustl.edu	37	15	63053890	63053890	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr15:63053890G>A	ENST00000561311.1	+	37	4879	c.4649G>A	c.(4648-4650)gGg>gAg	p.G1550E	TLN2_ENST00000306829.6_Missense_Mutation_p.G1550E|TLN2_ENST00000472902.1_5'UTR			Q9Y4G6	TLN2_HUMAN	talin 2	1550					cell adhesion (GO:0007155)|cell-cell junction assembly (GO:0007043)|cytoskeletal anchoring at plasma membrane (GO:0007016)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|synapse (GO:0045202)	actin binding (GO:0003779)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			NS(3)|breast(6)|central_nervous_system(3)|endometrium(8)|kidney(8)|large_intestine(20)|lung(34)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)	99						GCCCTGGATGGGGATTTCTCT	0.488																																																	0													114.0	111.0	112.0					15																	63053890		2203	4300	6503	SO:0001583	missense	0			AB002318	CCDS32261.1	15q15-q21	2008-07-03			ENSG00000171914	ENSG00000171914			15447	protein-coding gene	gene with protein product		607349				9205841, 11527381	Standard	NM_015059		Approved	KIAA0320, ILWEQ	uc002alb.4	Q9Y4G6	OTTHUMG00000133679	ENST00000561311.1:c.4649G>A	15.37:g.63053890G>A	ENSP00000453508:p.Gly1550Glu		A6NLB8	Missense_Mutation	SNP	pfam_Talin_cent,pfam_ILWEQ_dom,pfam_Vinculin-bd_dom,pfam_FERM_N,pfam_FERM_central,pfam_Insln_rcpt_S1,superfamily_Talin_cent,superfamily_Vinculin/catenin,superfamily_FERM_central,smart_Band_41_domain,smart_ILWEQ_dom,pfscan_FERM_domain,pfscan_ILWEQ_dom	p.G1550E	ENST00000561311.1	37	c.4649	CCDS32261.1	15	.	.	.	.	.	.	.	.	.	.	G	13.31	2.198571	0.38806	.	.	ENSG00000171914	ENST00000306829	T	0.28666	1.6	5.41	5.41	0.78517	.	0.093179	0.85682	D	0.000000	T	0.29652	0.0740	L	0.41710	1.295	0.80722	D	1	B	0.18310	0.027	B	0.24155	0.051	T	0.05784	-1.0864	10	0.20046	T	0.44	-10.8282	19.1929	0.93674	0.0:0.0:1.0:0.0	.	1550	Q9Y4G6	TLN2_HUMAN	E	1550	ENSP00000303476:G1550E	ENSP00000303476:G1550E	G	+	2	0	TLN2	60841182	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	7.706000	0.84615	2.535000	0.85469	0.563000	0.77884	GGG	TLN2	-	superfamily_Vinculin/catenin	ENSG00000171914		0.488	TLN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TLN2	HGNC	protein_coding	OTTHUMT00000257878.2	-	0.00	61	0	G			63053890	+1	tier1	-	no_errors	ENST00000306829	ensembl	human	known	74_37	missense	8.89	41	4	SNP	1.000	A
TMEM105	284186	genome.wustl.edu	37	17	79287626	79287626	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr17:79287626C>T	ENST00000332900.1	-	3	764	c.215G>A	c.(214-216)aGc>aAc	p.S72N		NM_178520.3	NP_848615.1	Q8N8V8	TM105_HUMAN	transmembrane protein 105	72						integral component of membrane (GO:0016021)				NS(1)|large_intestine(3)|lung(1)|ovary(2)	7	all_neural(118;0.0804)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0272)|OV - Ovarian serous cystadenocarcinoma(97;0.0892)			ACAGAGGCAGCTGGGCTCAGC	0.662																																																	0													43.0	53.0	49.0					17																	79287626		2202	4299	6501	SO:0001583	missense	0			AK096111	CCDS11781.1	17q25.3	2008-04-21	2008-04-21	2008-04-21		ENSG00000185332			26794	protein-coding gene	gene with protein product							Standard	NM_178520		Approved	FLJ38792	uc002kad.2	Q8N8V8		ENST00000332900.1:c.215G>A	17.37:g.79287626C>T	ENSP00000329795:p.Ser72Asn			Missense_Mutation	SNP	NULL	p.S72N	ENST00000332900.1	37	c.215	CCDS11781.1	17	.	.	.	.	.	.	.	.	.	.	C	10.17	1.277296	0.23307	.	.	ENSG00000185332	ENST00000332900	T	0.54071	0.59	2.24	-2.82	0.05787	.	.	.	.	.	T	0.25457	0.0619	N	0.08118	0	0.09310	N	1	B	0.23540	0.087	B	0.11329	0.006	T	0.13124	-1.0521	9	0.87932	D	0	.	3.388	0.07278	0.0:0.3486:0.2115:0.4399	.	72	Q8N8V8	TM105_HUMAN	N	72	ENSP00000329795:S72N	ENSP00000329795:S72N	S	-	2	0	TMEM105	76902221	0.000000	0.05858	0.000000	0.03702	0.360000	0.29518	-0.508000	0.06344	-0.682000	0.05197	-0.339000	0.08088	AGC	TMEM105	-	NULL	ENSG00000185332		0.662	TMEM105-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM105	HGNC	protein_coding	OTTHUMT00000439607.1	-	0.00	107	0	C	NM_178520		79287626	-1	tier1	-	no_errors	ENST00000332900	ensembl	human	known	74_37	missense	6.15	61	4	SNP	0.000	T
TMEM134	80194	genome.wustl.edu	37	11	67234982	67234984	+	In_Frame_Del	DEL	TGT	TGT	-			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	TGT	TGT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr11:67234982_67234984delTGT	ENST00000308022.2	-	3	358_360	c.317_319delACA	c.(316-321)aacacc>acc	p.N106del	TMEM134_ENST00000393877.3_In_Frame_Del_p.N106del|TMEM134_ENST00000541059.1_5'UTR|TMEM134_ENST00000452789.2_In_Frame_Del_p.N97del	NM_001078651.1|NM_025124.2	NP_001072119.1|NP_079400.1	Q9H6X4	TM134_HUMAN	transmembrane protein 134	106						integral component of membrane (GO:0016021)				endometrium(1)|lung(1)	2						CTGCAGCAGGTGTTGTAGGAGCG	0.66																																																	0																																										SO:0001651	inframe_deletion	0			AK025402	CCDS8167.1, CCDS41678.1	11q13.2	2006-03-09			ENSG00000172663	ENSG00000172663			26142	protein-coding gene	gene with protein product							Standard	NM_025124		Approved	FLJ21749	uc001olq.2	Q9H6X4	OTTHUMG00000168034	ENST00000308022.2:c.317_319delACA	11.37:g.67234985_67234987delTGT	ENSP00000312615:p.Asn106del		Q08AK4|Q6PJN3	In_Frame_Del	DEL	pfam_DUF872_TM	p.N106in_frame_del	ENST00000308022.2	37	c.319_317	CCDS8167.1	11																																																																																			TMEM134	-	pfam_DUF872_TM	ENSG00000172663		0.660	TMEM134-020	PUTATIVE	basic|appris_principal|CCDS	protein_coding	TMEM134	HGNC	protein_coding	OTTHUMT00000398994.1		0.00	72	0	TGT	NM_025124		67234984	-1	tier1		no_errors	ENST00000545682	ensembl	human	known	74_37	in_frame_del	24.00	38	12	DEL	0.429:0.280:0.315	-
TMEM138	51524	genome.wustl.edu	37	11	61135401	61135401	+	Missense_Mutation	SNP	C	C	T	rs202210746		TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr11:61135401C>T	ENST00000278826.6	+	4	866	c.307C>T	c.(307-309)Cgc>Tgc	p.R103C	TMEM138_ENST00000381787.2_Missense_Mutation_p.R45C|TMEM138_ENST00000542946.1_3'UTR	NM_016464.4	NP_057548.1	Q9NPI0	TM138_HUMAN	transmembrane protein 138	103					cilium assembly (GO:0042384)	cilium (GO:0005929)|integral component of membrane (GO:0016021)|vacuole (GO:0005773)		p.R103C(2)		central_nervous_system(1)|large_intestine(2)|lung(1)|upper_aerodigestive_tract(1)	5						TCAGAACTTACGCTGGAAAAA	0.443													C|||	1	0.000199681	0.0	0.0014	5008	,	,		20554	0.0		0.0	False		,,,				2504	0.0																2	Substitution - Missense(2)	large_intestine(1)|central_nervous_system(1)											224.0	228.0	227.0					11																	61135401		2203	4299	6502	SO:0001583	missense	0			AF151030	CCDS8005.1	11q12.2	2014-01-28			ENSG00000149483	ENSG00000149483			26944	protein-coding gene	gene with protein product		614459					Standard	NM_016464		Approved	HSPC196, JBTS16	uc001nrl.2	Q9NPI0	OTTHUMG00000168145	ENST00000278826.6:c.307C>T	11.37:g.61135401C>T	ENSP00000278826:p.Arg103Cys		A6NGA7|B4E044|Q5JPE1	Missense_Mutation	SNP	NULL	p.R103C	ENST00000278826.6	37	c.307	CCDS8005.1	11	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	C	26.9	4.785055	0.90282	.	.	ENSG00000149483	ENST00000278826;ENST00000381787	D;D	0.89875	-2.58;-2.58	5.91	5.91	0.95273	.	0.000000	0.85682	D	0.000000	D	0.95004	0.8383	M	0.80183	2.485	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.982	D	0.94888	0.8045	10	0.87932	D	0	-1.7267	19.9089	0.97019	0.0:1.0:0.0:0.0	.	103;103	B4E044;Q9NPI0	.;TM138_HUMAN	C	103;45	ENSP00000278826:R103C;ENSP00000371206:R45C	ENSP00000278826:R103C	R	+	1	0	TMEM138	60891977	1.000000	0.71417	1.000000	0.80357	0.927000	0.56198	3.336000	0.52113	2.793000	0.96121	0.655000	0.94253	CGC	TMEM138	-	NULL	ENSG00000149483		0.443	TMEM138-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM138	HGNC	protein_coding	OTTHUMT00000398399.2		0.00	77	0	C	NM_016464		61135401	+1			no_errors	ENST00000278826	ensembl	human	known	74_37	missense	5.00	38	2	SNP	1.000	T
TMEM155	132332	genome.wustl.edu	37	4	122682813	122682813	+	Missense_Mutation	SNP	G	G	A	rs566239107		TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr4:122682813G>A	ENST00000337677.5	-	5	650	c.92C>T	c.(91-93)gCg>gTg	p.A31V	TMEM155_ENST00000394394.1_Missense_Mutation_p.A31V|AC079341.1_ENST00000424958.1_5'Flank|TMEM155_ENST00000394396.1_Missense_Mutation_p.A31V	NM_152399.2	NP_689612.2	Q4W5P6	TM155_HUMAN	transmembrane protein 155	31						extracellular region (GO:0005576)				breast(1)|lung(5)	6						CTGTAGAATCGCACCAGATGG	0.423													G|||	1	0.000199681	0.0	0.0	5008	,	,		16724	0.0		0.0	False		,,,				2504	0.001																0													75.0	74.0	74.0					4																	122682813		2203	4300	6503	SO:0001583	missense	0			AK055396	CCDS3721.1	4q27	2008-02-05			ENSG00000164112	ENSG00000164112			26418	protein-coding gene	gene with protein product							Standard	NM_152399		Approved	FLJ30834	uc003idx.1	Q4W5P6	OTTHUMG00000133035	ENST00000337677.5:c.92C>T	4.37:g.122682813G>A	ENSP00000336987:p.Ala31Val		D3DNW9|Q96NI2	Missense_Mutation	SNP	NULL	p.A31V	ENST00000337677.5	37	c.92	CCDS3721.1	4	.	.	.	.	.	.	.	.	.	.	G	10.42	1.346109	0.24426	.	.	ENSG00000164112	ENST00000394396;ENST00000337677;ENST00000394394;ENST00000514885	T;T;T;T	0.57436	0.54;0.54;0.54;0.4	5.23	-1.09	0.09904	.	0.403409	0.18216	N	0.148047	T	0.22513	0.0543	N	0.01874	-0.695	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.25572	-1.0128	10	0.87932	D	0	-0.4822	8.6103	0.33797	0.5243:0.0:0.4757:0.0	.	31	Q4W5P6	TM155_HUMAN	V	31	ENSP00000377919:A31V;ENSP00000336987:A31V;ENSP00000377917:A31V;ENSP00000422869:A31V	ENSP00000336987:A31V	A	-	2	0	TMEM155	122902263	0.034000	0.19679	0.097000	0.21041	0.994000	0.84299	-0.255000	0.08769	-0.047000	0.13423	-0.238000	0.12139	GCG	TMEM155	-	NULL	ENSG00000164112		0.423	TMEM155-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM155	HGNC	protein_coding	OTTHUMT00000256637.2		0.00	57	0	G	NM_152399		122682813	-1			no_errors	ENST00000337677	ensembl	human	known	74_37	missense	5.26	36	2	SNP	0.062	A
TMEM168	64418	genome.wustl.edu	37	7	112415367	112415367	+	Missense_Mutation	SNP	T	T	A			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr7:112415367T>A	ENST00000312814.6	-	3	1695	c.1135A>T	c.(1135-1137)Aat>Tat	p.N379Y	TMEM168_ENST00000454074.1_Missense_Mutation_p.N379Y|TMEM168_ENST00000480969.1_5'UTR	NM_022484.4	NP_071929.3	Q9H0V1	TM168_HUMAN	transmembrane protein 168	379						integral component of membrane (GO:0016021)|transport vesicle (GO:0030133)				breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(10)|lung(12)|ovary(1)|prostate(2)|stomach(1)	32						AAAATTCCATTTGTTGGCTAA	0.348																																																	0													65.0	59.0	61.0					7																	112415367		2203	4300	6503	SO:0001583	missense	0				CCDS5757.1	7q31.32	2006-08-08			ENSG00000146802	ENSG00000146802			25826	protein-coding gene	gene with protein product						12477932	Standard	XM_005250527		Approved	DKFZp564C012,FLJ13576	uc003vgn.3	Q9H0V1	OTTHUMG00000155188	ENST00000312814.6:c.1135A>T	7.37:g.112415367T>A	ENSP00000323068:p.Asn379Tyr		A4D0T9|B4DDS0|Q8NEK4|Q9H8J2	Missense_Mutation	SNP	superfamily_ConA-like_lec_gl_sf	p.N379Y	ENST00000312814.6	37	c.1135	CCDS5757.1	7	.	.	.	.	.	.	.	.	.	.	T	23.2	4.387314	0.82902	.	.	ENSG00000146802	ENST00000312814;ENST00000454074;ENST00000418785;ENST00000441474	.	.	.	5.31	5.31	0.75309	.	0.040186	0.85682	D	0.000000	T	0.73953	0.3653	L	0.58101	1.795	0.80722	D	1	D	0.69078	0.997	P	0.62184	0.899	T	0.77230	-0.2664	9	0.87932	D	0	-17.717	15.556	0.76192	0.0:0.0:0.0:1.0	.	379	Q9H0V1	TM168_HUMAN	Y	379;379;19;31	.	ENSP00000323068:N379Y	N	-	1	0	TMEM168	112202603	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.473000	0.81007	2.146000	0.66826	0.533000	0.62120	AAT	TMEM168	-	NULL	ENSG00000146802		0.348	TMEM168-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM168	HGNC	protein_coding	OTTHUMT00000338696.4		0.00	40	0	T	NM_022484		112415367	-1			no_errors	ENST00000312814	ensembl	human	known	74_37	missense	5.13	37	2	SNP	1.000	A
TOM1	10043	genome.wustl.edu	37	22	35723300	35723300	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr22:35723300G>T	ENST00000449058.2	+	7	810	c.685G>T	c.(685-687)Ggg>Tgg	p.G229W	TOM1_ENST00000425375.1_Missense_Mutation_p.G184W|TOM1_ENST00000411850.1_Missense_Mutation_p.G229W|TOM1_ENST00000436462.2_Missense_Mutation_p.G191W|TOM1_ENST00000447733.1_Missense_Mutation_p.G196W|TOM1_ENST00000382034.5_Missense_Mutation_p.G162W	NM_005488.2	NP_005479.1	O60784	TOM1_HUMAN	target of myb1 (chicken)	229	GAT. {ECO:0000255|PROSITE- ProRule:PRU00373}.				endocytosis (GO:0006897)|endosomal transport (GO:0016197)|intracellular protein transport (GO:0006886)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	clathrin binding (GO:0030276)			NS(1)|breast(2)|kidney(2)|large_intestine(2)|lung(7)|ovary(3)|prostate(2)	19						GATGGTGAGTGGGAACGTGAG	0.617																																																	0													188.0	143.0	158.0					22																	35723300		2203	4300	6503	SO:0001583	missense	0			AJ006973	CCDS13913.1, CCDS46696.1, CCDS46697.1, CCDS46698.1	22q13.1	2011-01-31	2001-11-28		ENSG00000100284	ENSG00000100284			11982	protein-coding gene	gene with protein product		604700	"""target of myb1 (chicken) homolog"""			10329004, 15047686	Standard	NM_005488		Approved		uc003anp.3	O60784	OTTHUMG00000150958	ENST00000449058.2:c.685G>T	22.37:g.35723300G>T	ENSP00000394466:p.Gly229Trp		B4DEL9|B4DNA1|Q5TIJ6|Q86X74	Missense_Mutation	SNP	pfam_VHS,pfam_GAT,superfamily_ENTH_VHS,smart_VHS_subgr,pirsf_TOM1,pfscan_GAT,pfscan_VHS	p.G229W	ENST00000449058.2	37	c.685	CCDS13913.1	22	.	.	.	.	.	.	.	.	.	.	G	20.6	4.015752	0.75161	.	.	ENSG00000100284	ENST00000447733;ENST00000456128;ENST00000449058;ENST00000411850;ENST00000425375;ENST00000451197;ENST00000436462;ENST00000382034	T;T;T;T;T;T;T	0.47869	0.83;0.83;0.83;0.83;0.83;0.83;0.83	5.39	5.39	0.77823	GAT (2);	0.151170	0.64402	D	0.000013	T	0.73799	0.3633	M	0.84846	2.72	0.58432	D	0.999993	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	0.987;1.0;1.0;1.0;0.999	T	0.78347	-0.2239	10	0.87932	D	0	-8.1605	19.165	0.93553	0.0:0.0:1.0:0.0	.	184;191;238;229;229	O60784-3;E7EPD0;B4DKQ5;O60784-2;O60784	.;.;.;.;TOM1_HUMAN	W	196;223;229;229;184;238;191;162	ENSP00000398876:G196W;ENSP00000393714:G223W;ENSP00000394466:G229W;ENSP00000413697:G229W;ENSP00000394924:G184W;ENSP00000402556:G191W;ENSP00000371465:G162W	ENSP00000371465:G162W	G	+	1	0	TOM1	34053300	1.000000	0.71417	0.999000	0.59377	0.992000	0.81027	4.524000	0.60552	2.519000	0.84933	0.655000	0.94253	GGG	TOM1	-	pfam_GAT,pirsf_TOM1,pfscan_GAT	ENSG00000100284		0.617	TOM1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	TOM1	HGNC	protein_coding	OTTHUMT00000320641.1		0.00	47	0	G	NM_005488		35723300	+1			no_errors	ENST00000411850	ensembl	human	known	74_37	missense	5.00	38	2	SNP	0.990	T
TOP2B	7155	genome.wustl.edu	37	3	25648797	25648799	+	In_Frame_Del	DEL	TCA	TCA	-			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	TCA	TCA					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr3:25648797_25648799delTCA	ENST00000264331.4	-	31	4160_4162	c.4161_4163delTGA	c.(4159-4164)gatgac>gac	p.1387_1388DD>D	TOP2B_ENST00000540199.1_In_Frame_Del_p.239_240DD>D|TOP2B_ENST00000542520.1_In_Frame_Del_p.239_240DD>D|TOP2B_ENST00000435706.2_In_Frame_Del_p.1382_1383DD>D	NM_001068.2	NP_001059.2	Q02880	TOP2B_HUMAN	topoisomerase (DNA) II beta 180kDa	1387					ATP catabolic process (GO:0006200)|axonogenesis (GO:0007409)|DNA topological change (GO:0006265)|DNA unwinding involved in DNA replication (GO:0006268)|forebrain development (GO:0030900)|mitotic DNA integrity checkpoint (GO:0044774)|mitotic recombination (GO:0006312)|neuron migration (GO:0001764)|resolution of meiotic recombination intermediates (GO:0000712)|sister chromatid segregation (GO:0000819)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|DNA topoisomerase complex (ATP-hydrolyzing) (GO:0009330)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding, bending (GO:0008301)|DNA topoisomerase type II (ATP-hydrolyzing) activity (GO:0003918)|enzyme binding (GO:0019899)|histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)|protein heterodimerization activity (GO:0046982)|protein kinase C binding (GO:0005080)			breast(2)|endometrium(5)|kidney(1)|large_intestine(10)|lung(14)|ovary(1)|skin(2)|stomach(1)	36					Dactinomycin(DB00970)|Daunorubicin(DB00694)|Dexrazoxane(DB00380)|Etoposide(DB00773)	atcattattgtcatcatcatcat	0.33																																																	0										29,3619		4,21,1799						2.5	1.0			81	87,7745		17,53,3846	no	coding	TOP2B	NM_001068.2		21,74,5645	A1A1,A1R,RR		1.1108,0.795,1.0105				116,11364				SO:0001651	inframe_deletion	0			X68060	CCDS46776.1	3p24.2	2012-08-30	2002-08-29		ENSG00000077097	ENSG00000077097	5.99.1.3		11990	protein-coding gene	gene with protein product		126431	"""topoisomerase (DNA) II beta (180kD)"""			1309226, 1333583	Standard	NM_001068		Approved		uc003cdj.3	Q02880	OTTHUMG00000155596	ENST00000264331.4:c.4161_4163delTGA	3.37:g.25648806_25648808delTCA	ENSP00000264331:p.Asp1388del		Q13600|Q9UMG8|Q9UQP8	In_Frame_Del	DEL	pfam_Topo_IIA_A/C,pfam_Topo_IIA_bsu_dom2,pfam_DTHCT,pfam_HATPase_ATP-bd,superfamily_Topo_IIA_like_dom,superfamily_HATPase_ATP-bd,superfamily_Ribosomal_S5_D2-typ_fold,smart_Topo_IIA,smart_Topo_IIA_A/C,prints_TopoII_euk,prints_Topo_IIA,prints_Transcrpt_fac_NFYB/HAP3	p.D1388in_frame_del	ENST00000264331.4	37	c.4163_4161		3																																																																																			TOP2B	-	NULL	ENSG00000077097		0.330	TOP2B-201	KNOWN	basic|appris_candidate_longest	protein_coding	TOP2B	HGNC	protein_coding			0.00	68	0	TCA			25648799	-1	tier1		no_errors	ENST00000264331	ensembl	human	known	74_37	in_frame_del	6.90	27	2	DEL	1.000:1.000:0.992	-
TP53	7157	genome.wustl.edu	37	17	7577120	7577120	+	Missense_Mutation	SNP	C	C	T	rs28934576		TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr17:7577120C>T	ENST00000269305.4	-	8	1007	c.818G>A	c.(817-819)cGt>cAt	p.R273H	TP53_ENST00000359597.4_Missense_Mutation_p.R273H|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000413465.2_Intron|TP53_ENST00000420246.2_Missense_Mutation_p.R273H|TP53_ENST00000455263.2_Missense_Mutation_p.R273H|TP53_ENST00000445888.2_Missense_Mutation_p.R273H	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	273	Interaction with AXIN1. {ECO:0000250}.|Interaction with DNA.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		R -> C (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:17224074, ECO:0000269|PubMed:7887414, ECO:0000269|PubMed:9450901}.|R -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> H (in LFS; germline mutation and in sporadic cancers; somatic mutation; abolishes sequence-specific DNA binding; does not induce SNAI1 degradation; dbSNP:rs28934576). {ECO:0000269|PubMed:1394225, ECO:0000269|PubMed:1565144, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:1699228, ECO:0000269|PubMed:1868473, ECO:0000269|PubMed:7682763, ECO:0000269|Ref.14}.|R -> L (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974}.|R -> N (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in sporadic cancers; somatic mutation).|R -> S (in a familial cancer not matching LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> Y (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R273H(521)|p.R273L(93)|p.R273P(32)|p.0?(8)|p.?(2)|p.R273fs*32(2)|p.R273_C275delRVC(1)|p.L265_K305del41(1)|p.S269fs*21(1)|p.R273S(1)|p.E258fs*71(1)|p.R273fs*72(1)|p.R273fs*71(1)|p.F270_D281del12(1)|p.R273fs*33(1)|p.E271_R273delEVR(1)|p.V272_K292del21(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GGCACAAACACGCACCTCAAA	0.542	R273H(EN_ENDOMETRIUM)|R273H(HEC59_ENDOMETRIUM)|R273H(HEC6_ENDOMETRIUM)|R273H(HT29_LARGE_INTESTINE)|R273H(HT_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(MDAMB468_BREAST)|R273H(MOLT13_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(NCIH1155_LUNG)|R273H(NCIH1793_LUNG)|R273H(NCIH1975_LUNG)|R273H(NCIH2405_LUNG)|R273H(NCIH508_LARGE_INTESTINE)|R273H(OC314_OVARY)|R273H(PANC1_PANCREAS)|R273H(PF382_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(SKMEL30_SKIN)|R273H(SNB19_CENTRAL_NERVOUS_SYSTEM)|R273H(SUDHL1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(SUIT2_PANCREAS)|R273H(SUPT1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(SW1783_CENTRAL_NERVOUS_SYSTEM)|R273H(SW480_LARGE_INTESTINE)|R273H(SW620_LARGE_INTESTINE)|R273H(U251MG_CENTRAL_NERVOUS_SYSTEM)	111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			C|||	1	0.000199681	0.0	0.0	5008	,	,		18620	0.0		0.001	False		,,,				2504	0.0				Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	669	Substitution - Missense(647)|Whole gene deletion(8)|Deletion - Frameshift(6)|Deletion - In frame(5)|Unknown(2)|Insertion - Frameshift(1)	large_intestine(136)|lung(99)|breast(74)|ovary(59)|upper_aerodigestive_tract(55)|central_nervous_system(46)|oesophagus(35)|haematopoietic_and_lymphoid_tissue(30)|stomach(26)|urinary_tract(25)|pancreas(15)|endometrium(13)|liver(12)|skin(11)|bone(9)|biliary_tract(7)|penis(4)|cervix(2)|genital_tract(2)|NS(2)|soft_tissue(2)|vulva(1)|thyroid(1)|fallopian_tube(1)|prostate(1)|thymus(1)	GRCh37	CM004342|CM010472|CM920677	TP53	M	rs28934576						67.0	58.0	61.0					17																	7577120		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.818G>A	17.37:g.7577120C>T	ENSP00000269305:p.Arg273His		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.R273H	ENST00000269305.4	37	c.818	CCDS11118.1	17	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	18.03	3.532510	0.64972	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D	0.99868	-7.32;-7.32;-7.32;-7.32;-7.32;-7.32	4.92	4.92	0.64577	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99822	0.9921	M	0.79475	2.455	0.80722	A	1	P;D;P;P	0.89917	0.631;1.0;0.831;0.48	B;D;P;B	0.77004	0.274;0.989;0.516;0.242	D	0.96531	0.9393	9	0.72032	D	0.01	-11.9995	15.662	0.77193	0.0:1.0:0.0:0.0	rs28934576	273;273;273;273	P04637-2;P04637-3;P04637;Q1MSW8	.;.;P53_HUMAN;.	H	273;273;273;273;273;262;141	ENSP00000352610:R273H;ENSP00000269305:R273H;ENSP00000398846:R273H;ENSP00000391127:R273H;ENSP00000391478:R273H;ENSP00000425104:R141H	ENSP00000269305:R273H	R	-	2	0	TP53	7517845	1.000000	0.71417	0.068000	0.19968	0.665000	0.39181	7.587000	0.82613	2.556000	0.86216	0.462000	0.41574	CGT	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor	ENSG00000141510		0.542	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	GMAF=0.0005	0.00	22	0	C	NM_000546		7577120	-1	tier1	rs28934576	no_errors	ENST00000269305	ensembl	human	known	74_37	missense	40.00	15	10	SNP	0.864	T
TP53	7157	genome.wustl.edu	37	17	7577124	7577124	+	Missense_Mutation	SNP	C	C	T	rs121912657		TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr17:7577124C>T	ENST00000269305.4	-	8	1003	c.814G>A	c.(814-816)Gtg>Atg	p.V272M	TP53_ENST00000359597.4_Missense_Mutation_p.V272M|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000413465.2_Intron|TP53_ENST00000420246.2_Missense_Mutation_p.V272M|TP53_ENST00000455263.2_Missense_Mutation_p.V272M|TP53_ENST00000445888.2_Missense_Mutation_p.V272M	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	272	Interaction with AXIN1. {ECO:0000250}.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		V -> A (in a familial cancer not matching LFS; germline mutation and in sporadic cancers; somatic mutation).|V -> E (in sporadic cancers; somatic mutation).|V -> G (in sporadic cancers; somatic mutation).|V -> L (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:1737852}.|V -> M (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.V272M(82)|p.V272L(26)|p.0?(8)|p.V272fs*73(4)|p.?(2)|p.F270fs*72(1)|p.E271fs*73(1)|p.V272fs*34(1)|p.L265_K305del41(1)|p.S269fs*21(1)|p.E258fs*71(1)|p.G266_E271delGRNSFE(1)|p.V272fs*74(1)|p.F270_D281del12(1)|p.E271_R273delEVR(1)|p.V272_K292del21(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CAAACACGCACCTCAAAGCTG	0.527		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	133	Substitution - Missense(108)|Whole gene deletion(8)|Deletion - Frameshift(8)|Deletion - In frame(5)|Insertion - Frameshift(2)|Unknown(2)	large_intestine(23)|ovary(16)|lung(14)|breast(14)|oesophagus(11)|upper_aerodigestive_tract(9)|haematopoietic_and_lymphoid_tissue(9)|central_nervous_system(7)|bone(5)|stomach(4)|pancreas(4)|liver(4)|kidney(3)|urinary_tract(3)|endometrium(2)|thyroid(1)|vulva(1)|soft_tissue(1)|testis(1)|skin(1)	GRCh37	CM920676	TP53	M	rs121912657						62.0	54.0	57.0					17																	7577124		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.814G>A	17.37:g.7577124C>T	ENSP00000269305:p.Val272Met		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.V272M	ENST00000269305.4	37	c.814	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	22.7	4.318455	0.81469	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D	0.99833	-7.03;-7.03;-7.03;-7.03;-7.03;-7.03	5.13	5.13	0.70059	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.057604	0.64402	D	0.000002	D	0.99843	0.9928	M	0.90309	3.105	0.58432	D	0.999996	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.87578	0.998;0.998;0.998;0.998	D	0.96721	0.9532	10	0.87932	D	0	-27.8222	16.1198	0.81342	0.0:1.0:0.0:0.0	.	272;272;272;272	P04637-2;P04637-3;P04637;Q1MSW8	.;.;P53_HUMAN;.	M	272;272;272;272;272;261;140	ENSP00000352610:V272M;ENSP00000269305:V272M;ENSP00000398846:V272M;ENSP00000391127:V272M;ENSP00000391478:V272M;ENSP00000425104:V140M	ENSP00000269305:V272M	V	-	1	0	TP53	7517849	1.000000	0.71417	0.986000	0.45419	0.849000	0.48306	5.871000	0.69628	2.667000	0.90743	0.462000	0.41574	GTG	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor	ENSG00000141510		0.527	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	-	0.00	21	0	C	NM_000546		7577124	-1	tier1	-	no_errors	ENST00000269305	ensembl	human	known	74_37	missense	29.17	17	7	SNP	1.000	T
TP53BP2	7159	genome.wustl.edu	37	1	223976780	223976780	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr1:223976780G>T	ENST00000343537.7	-	16	3384	c.3093C>A	c.(3091-3093)gaC>gaA	p.D1031E	TP53BP2_ENST00000391878.2_Missense_Mutation_p.D902E|TP53BP2_ENST00000391879.2_Missense_Mutation_p.D264E|TP53BP2_ENST00000498843.1_5'UTR	NM_001031685.2	NP_001026855.2	Q13625	ASPP2_HUMAN	tumor protein p53 binding protein 2	1025	Mediates interaction with APC2.				cell cycle (GO:0007049)|central nervous system development (GO:0007417)|embryo development ending in birth or egg hatching (GO:0009792)|heart development (GO:0007507)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|negative regulation of cell cycle (GO:0045786)|positive regulation of signal transduction (GO:0009967)|response to ionizing radiation (GO:0010212)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	identical protein binding (GO:0042802)|NF-kappaB binding (GO:0051059)|SH3/SH2 adaptor activity (GO:0005070)			NS(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(9)|ovary(2)|prostate(1)|skin(2)	29				GBM - Glioblastoma multiforme(131;0.0958)		CAGTCTGCATGTCACTGTAGG	0.453																																																	0													211.0	181.0	191.0					1																	223976780		2203	4300	6503	SO:0001583	missense	0			U09582	CCDS1538.1, CCDS44319.1	1q41	2014-06-24	2014-06-24		ENSG00000143514	ENSG00000143514		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ankyrin repeat domain containing"""	12000	protein-coding gene	gene with protein product		602143	"""tumor protein p53-binding protein, 2"""			8668206, 8016121	Standard	NM_005426		Approved	PPP1R13A, ASPP2, 53BP2	uc010pvb.2	Q13625	OTTHUMG00000037379	ENST00000343537.7:c.3093C>A	1.37:g.223976780G>T	ENSP00000341957:p.Asp1031Glu		B4DG66|Q12892|Q86X75|Q96KQ3	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_SH3_domain,pfam_SH3_2,superfamily_Ankyrin_rpt-contain_dom,superfamily_SH3_domain,smart_Ankyrin_rpt,smart_SH3_domain,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_SH3_domain,prints_Spectrin_alpha_SH3	p.D1031E	ENST00000343537.7	37	c.3093	CCDS44319.1	1	.	.	.	.	.	.	.	.	.	.	G	26.8	4.776103	0.90195	.	.	ENSG00000143514	ENST00000391878;ENST00000343537;ENST00000391879	T;T;T	0.54866	0.64;0.82;0.55	5.74	3.85	0.44370	Src homology-3 domain (1);Ankyrin repeat-containing domain (2);	0.000000	0.85682	D	0.000000	T	0.68787	0.3039	M	0.75615	2.305	0.80722	D	1	D;P	0.65815	0.995;0.944	D;D	0.72625	0.978;0.944	T	0.70920	-0.4741	10	0.66056	D	0.02	.	11.2441	0.48987	0.1717:0.0:0.8283:0.0	.	1031;1025	B4DG66;Q13625	.;ASPP2_HUMAN	E	902;1031;264	ENSP00000375750:D902E;ENSP00000341957:D1031E;ENSP00000375751:D264E	ENSP00000341957:D1031E	D	-	3	2	TP53BP2	222043403	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.546000	0.53656	2.716000	0.92895	0.591000	0.81541	GAC	TP53BP2	-	superfamily_Ankyrin_rpt-contain_dom,superfamily_SH3_domain	ENSG00000143514		0.453	TP53BP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53BP2	HGNC	protein_coding	OTTHUMT00000090985.3	-	0.00	84	0	G	NM_001031685, NM_005426		223976780	-1	tier1	-	no_errors	ENST00000343537	ensembl	human	known	74_37	missense	8.33	66	6	SNP	1.000	T
TPD52	7163	genome.wustl.edu	37	8	80992548	80992548	+	Splice_Site	SNP	A	A	G			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr8:80992548A>G	ENST00000379097.3	-	1	502		c.e1+1		TPD52_ENST00000520527.1_Splice_Site|TPD52_ENST00000519303.2_Intron|TPD52_ENST00000537855.1_Splice_Site|TPD52_ENST00000518937.1_Intron|TPD52_ENST00000517427.1_Splice_Site|TPD52_ENST00000448733.2_Splice_Site|TPD52_ENST00000379096.5_Intron	NM_001025252.1	NP_001020423.1	P55327	TPD52_HUMAN	tumor protein D52						anatomical structure morphogenesis (GO:0009653)|B cell differentiation (GO:0030183)|positive regulation of cell proliferation (GO:0008284)|secretion (GO:0046903)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|perinuclear region of cytoplasm (GO:0048471)	calcium ion binding (GO:0005509)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			endometrium(1)|large_intestine(2)|lung(3)|ovary(1)|prostate(1)	8	all_epithelial(4;1.13e-09)|Lung NSC(7;9.71e-07)|all_lung(9;3.75e-06)	Lung NSC(129;3.55e-06)|all_lung(136;1.53e-05)|Acute lymphoblastic leukemia(644;0.158)	BRCA - Breast invasive adenocarcinoma(6;0.00181)|Epithelial(68;0.0149)|all cancers(69;0.0612)			ATTAGTAGTTACCAAATTTCT	0.388																																																	0													61.0	62.0	62.0					8																	80992548		2203	4300	6503	SO:0001630	splice_region_variant	0			U18914	CCDS34912.1, CCDS47879.1, CCDS55249.1, CCDS75757.1, CCDS75758.1, CCDS75759.1	8q21.13	2014-06-24			ENSG00000076554	ENSG00000076554			12005	protein-coding gene	gene with protein product		604068				7796418	Standard	NM_001287144		Approved	D52, hD52, N8L	uc003ybr.1	P55327	OTTHUMG00000164565	ENST00000379097.3:c.139+1T>C	8.37:g.80992548A>G			B7Z414|C9J502|D0UFD1|D0UFD2|D0UFD3|D0UFD4|D0UFD5|E5RKB4|Q13056|Q53EK8|Q6FGP3|Q6FGS3|Q86YZ2|Q9UCX8	Splice_Site	SNP	-	e1+2	ENST00000379097.3	37	c.139+2	CCDS34912.1	8	.	.	.	.	.	.	.	.	.	.	A	18.23	3.577412	0.65878	.	.	ENSG00000076554	ENST00000537855;ENST00000520527;ENST00000517427;ENST00000448733;ENST00000543691;ENST00000379097	.	.	.	5.38	5.38	0.77491	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.5576	0.76208	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	TPD52	81155103	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	6.178000	0.71968	2.266000	0.75297	0.472000	0.43445	.	TPD52	-	-	ENSG00000076554		0.388	TPD52-006	KNOWN	basic|CCDS	protein_coding	TPD52	HGNC	protein_coding	OTTHUMT00000379539.2		0.00	70	0	A	NM_005079	Intron	80992548	-1			no_errors	ENST00000537855	ensembl	human	known	74_37	splice_site	5.77	49	3	SNP	1.000	G
TRIP10	9322	genome.wustl.edu	37	19	6751251	6751251	+	3'UTR	DEL	T	T	-			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr19:6751251delT	ENST00000313244.9	+	0	1870				TRIP10_ENST00000596758.1_Frame_Shift_Del_p.C566fs|TRIP10_ENST00000600428.1_3'UTR|TRIP10_ENST00000313285.8_3'UTR|CTD-3128G10.6_ENST00000594056.1_RNA			Q15642	CIP4_HUMAN	thyroid hormone receptor interactor 10						actin cytoskeleton organization (GO:0030036)|cell communication (GO:0007154)|endocytosis (GO:0006897)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|lysosome (GO:0005764)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)|lipid binding (GO:0008289)			NS(1)|breast(1)|endometrium(1)|large_intestine(1)|liver(2)|lung(7)|ovary(1)|prostate(1)|urinary_tract(1)	16						AGAGGGGGGCTGTCGGCTGCT	0.642																																																	0													41.0	46.0	44.0					19																	6751251		2202	4298	6500	SO:0001624	3_prime_UTR_variant	0			AB072596	CCDS12172.1, CCDS74271.1, CCDS74272.1	19p13.3	2008-02-05			ENSG00000125733	ENSG00000125733			12304	protein-coding gene	gene with protein product	"""Cdc42-interacting protein"""	604504	"""salt tolerator"""	STOT		7776974, 9210375, 11294612	Standard	XM_005259683		Approved	STP, HSTP, CIP4	uc002mfr.3	Q15642	OTTHUMG00000150255	ENST00000313244.9:c.*29T>-	19.37:g.6751251delT			B2R8A6|B7WP22|D6W645|O15184|Q53G22|Q5TZN1|Q6FI24|Q8NFL1|Q8TCY1|Q8TDX3|Q96RJ1	Frame_Shift_Del	DEL	pfam_FCH_dom,smart_FCH_dom,pfscan_FCH_dom	p.C566fs	ENST00000313244.9	37	c.1696		19																																																																																			TRIP10	-	NULL	ENSG00000125733		0.642	TRIP10-003	KNOWN	basic	protein_coding	TRIP10	HGNC	protein_coding	OTTHUMT00000317129.2		0.00	53	0	T			6751251	+1	tier1		no_errors	ENST00000596758	ensembl	human	known	74_37	frame_shift_del	29.17	17	7	DEL	0.419	-
TRO	7216	genome.wustl.edu	37	X	54950123	54950123	+	Silent	SNP	C	C	T			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chrX:54950123C>T	ENST00000173898.7	+	3	1270	c.1158C>T	c.(1156-1158)gtC>gtT	p.V386V	TRO_ENST00000319167.8_Silent_p.V386V|TRO_ENST00000375041.2_Intron|TRO_ENST00000420798.2_Intron|TRO_ENST00000375022.4_Silent_p.V386V|TRO_ENST00000484031.1_Intron|TRO_ENST00000399736.1_Intron	NM_001039705.2	NP_001034794.1	Q12816	TROP_HUMAN	trophinin	386					embryo implantation (GO:0007566)|homophilic cell adhesion (GO:0007156)|negative regulation of cell growth (GO:0030308)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(19)|ovary(2)|skin(2)|urinary_tract(1)	37						CTGCTGCTGTCCAGGCCCTGG	0.562																																																	0													38.0	42.0	41.0					X																	54950123		1991	4169	6160	SO:0001819	synonymous_variant	0			U04811	CCDS43958.1, CCDS43959.1, CCDS59527.1, CCDS59528.1, CCDS59529.1	Xp11.22-p11.21	2008-02-05			ENSG00000067445	ENSG00000067445			12326	protein-coding gene	gene with protein product		300132				9533028, 11454705	Standard	NM_001039705		Approved	MAGE-D3, KIAA1114, MAGED3	uc004dtq.4	Q12816	OTTHUMG00000021640	ENST00000173898.7:c.1158C>T	X.37:g.54950123C>T			B1AKE9|B1AKF1|F5GY27|Q96SX2|Q9NU89|Q9UPN8	Silent	SNP	pfam_MAGE,pfscan_MAGE	p.V386	ENST00000173898.7	37	c.1158	CCDS43959.1	X																																																																																			TRO	-	NULL	ENSG00000067445		0.562	TRO-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRO	HGNC	protein_coding	OTTHUMT00000056837.3	-	0.00	49	0	C	NM_016157		54950123	+1	tier1	-	no_errors	ENST00000173898	ensembl	human	known	74_37	silent	13.33	26	4	SNP	1.000	T
TSNAX	7257	genome.wustl.edu	37	1	231672957	231672957	+	Splice_Site	SNP	A	A	G			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr1:231672957A>G	ENST00000366639.4	+	3	279		c.e3-1		TSNAX-DISC1_ENST00000602962.1_Splice_Site|TSNAX_ENST00000602825.1_Splice_Site	NM_005999.2	NP_005990.1	Q99598	TSNAX_HUMAN	translin-associated factor X						cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|protein transport (GO:0015031)|spermatogenesis (GO:0007283)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|protein transporter activity (GO:0008565)|sequence-specific DNA binding (GO:0043565)			endometrium(1)|kidney(1)|large_intestine(2)|lung(5)	9		all_cancers(173;0.0395)|Acute lymphoblastic leukemia(190;3.76e-06)|Prostate(94;0.116)				ATGTGTTTTTAGCATTTCAGC	0.368																																																	0													99.0	98.0	99.0					1																	231672957		2203	4300	6503	SO:0001630	splice_region_variant	0			X95073	CCDS1596.1	1q42.2	2008-02-05			ENSG00000116918	ENSG00000116918			12380	protein-coding gene	gene with protein product		602964				9013868	Standard	NM_005999		Approved	TRAX	uc001huw.3	Q99598	OTTHUMG00000039486	ENST00000366639.4:c.122-1A>G	1.37:g.231672957A>G			B1APC6	Splice_Site	SNP	-	e3-2	ENST00000366639.4	37	c.122-2	CCDS1596.1	1	.	.	.	.	.	.	.	.	.	.	A	19.79	3.893582	0.72639	.	.	ENSG00000116918	ENST00000366639;ENST00000413309	.	.	.	5.22	5.22	0.72569	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.3897	0.74731	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	TSNAX	229739580	1.000000	0.71417	0.991000	0.47740	0.886000	0.51366	8.657000	0.91106	2.087000	0.62958	0.460000	0.39030	.	TSNAX	-	-	ENSG00000116918		0.368	TSNAX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSNAX	HGNC	protein_coding	OTTHUMT00000095267.2	-	0.00	90	0	A	NM_005999	Intron	231672957	+1	tier1	-	no_errors	ENST00000366639	ensembl	human	known	74_37	splice_site	5.88	64	4	SNP	1.000	G
TSPAN6	7105	genome.wustl.edu	37	X	99888429	99888429	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chrX:99888429C>A	ENST00000373020.4	-	5	669	c.558G>T	c.(556-558)caG>caT	p.Q186H	TSPAN6_ENST00000496771.1_5'UTR	NM_001278740.1|NM_001278741.1|NM_003270.2	NP_001265669.1|NP_001265670.1|NP_003261.1	O43657	TSN6_HUMAN	tetraspanin 6	186					negative regulation of NIK/NF-kappaB signaling (GO:1901223)|negative regulation of viral-induced cytoplasmic pattern recognition receptor signaling pathway (GO:0039532)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	signal transducer activity (GO:0004871)			endometrium(2)|kidney(3)|large_intestine(6)|ovary(1)	12						CTGCATCTCTCTGTGGAGTAC	0.338																																																	0													79.0	74.0	75.0					X																	99888429		2203	4300	6503	SO:0001583	missense	0			AF043906	CCDS14470.1, CCDS76001.1	Xq22	2013-02-14	2005-03-21	2005-03-21	ENSG00000000003	ENSG00000000003		"""Tetraspanins"""	11858	protein-coding gene	gene with protein product		300191	"""transmembrane 4 superfamily member 6"""	TM4SF6		9782095	Standard	NM_003270		Approved	T245, TSPAN-6	uc004ega.1	O43657	OTTHUMG00000022002	ENST00000373020.4:c.558G>T	X.37:g.99888429C>A	ENSP00000362111:p.Gln186His		Q54A42|Q6IAN9	Missense_Mutation	SNP	pfam_Tetraspanin/Peripherin,superfamily_Tetraspanin_EC2,prints_Tetraspanin	p.Q186H	ENST00000373020.4	37	c.558	CCDS14470.1	X	.	.	.	.	.	.	.	.	.	.	C	5.359	0.251428	0.10130	.	.	ENSG00000000003	ENST00000373020;ENST00000431386	D	0.87029	-2.2	4.96	0.0075	0.14071	Tetraspanin, EC2 domain (1);	0.285058	0.26627	U	0.023337	T	0.73426	0.3585	N	0.24115	0.695	0.18873	N	0.999988	B	0.19935	0.04	B	0.22386	0.039	T	0.56842	-0.7912	9	.	.	.	.	6.2214	0.20683	0.0:0.5023:0.2641:0.2336	.	186	O43657	TSN6_HUMAN	H	186;168	ENSP00000362111:Q186H	.	Q	-	3	2	TSPAN6	99775085	0.871000	0.30034	0.001000	0.08648	0.108000	0.19459	0.955000	0.29188	-0.275000	0.09219	-0.218000	0.12543	CAG	TSPAN6	-	pfam_Tetraspanin/Peripherin,superfamily_Tetraspanin_EC2	ENSG00000000003		0.338	TSPAN6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSPAN6	HGNC	protein_coding	OTTHUMT00000057483.1	-	0.00	95	0	C			99888429	-1	tier1	-	no_errors	ENST00000373020	ensembl	human	known	74_37	missense	44.00	28	22	SNP	0.204	A
TSPO	706	genome.wustl.edu	37	22	43558932	43558932	+	Missense_Mutation	SNP	A	A	G			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr22:43558932A>G	ENST00000396265.3	+	3	339	c.164A>G	c.(163-165)cAc>cGc	p.H55R	TSPO_ENST00000583777.1_Missense_Mutation_p.T45A|TSPO_ENST00000329563.4_Missense_Mutation_p.T149A|TSPO_ENST00000337554.3_Missense_Mutation_p.T149A			B1AH88	TSPOB_HUMAN	translocator protein (18kDa)	55					adrenal gland development (GO:0030325)|aging (GO:0007568)|behavioral response to pain (GO:0048266)|cellular hypotonic response (GO:0071476)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to zinc ion (GO:0071294)|chloride transport (GO:0006821)|contact inhibition (GO:0060242)|glial cell migration (GO:0008347)|negative regulation of glial cell proliferation (GO:0060253)|negative regulation of nitric oxide biosynthetic process (GO:0045019)|negative regulation of tumor necrosis factor production (GO:0032720)|peripheral nervous system axon regeneration (GO:0014012)|positive regulation of apoptotic process (GO:0043065)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of glial cell proliferation (GO:0060252)|positive regulation of mitochondrial depolarization (GO:0051901)|positive regulation of necrotic cell death (GO:0010940)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|regulation of steroid biosynthetic process (GO:0050810)|response to drug (GO:0042493)|response to manganese ion (GO:0010042)|response to progesterone (GO:0032570)|response to testosterone (GO:0033574)|response to vitamin B1 (GO:0010266)|steroid biosynthetic process (GO:0006694)	mitochondrial outer membrane (GO:0005741)	androgen binding (GO:0005497)|benzodiazepine receptor activity (GO:0008503)			endometrium(1)|prostate(1)	2		Ovarian(80;0.0694)				CTTCACGACCACACTCAACTA	0.701																																																	0													32.0	26.0	28.0					22																	43558932		2200	4297	6497	SO:0001583	missense	0			AF075589	CCDS33661.1	22q13.3	2006-07-12	2006-07-12	2006-07-12	ENSG00000100300	ENSG00000100300			1158	protein-coding gene	gene with protein product	"""peripheral-type benzodiazepine receptor/recognition site"""	109610	"""benzodiazapine receptor (peripheral)"""	BZRP		1326278, 1847678, 16822554	Standard	NM_000714		Approved	PBR, MBR, PKBS, mDRC, DBI, IBP, pk18	uc003bdo.4	B1AH88	OTTHUMG00000150573	ENST00000396265.3:c.164A>G	22.37:g.43558932A>G	ENSP00000379563:p.His55Arg		Q13849|Q6IAZ7	Missense_Mutation	SNP	pfam_TspO_MBR,pirsf_TspO_MBR	p.T149A	ENST00000396265.3	37	c.445		22	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	0.007|0.007	-1.975325|-1.975325	0.00452|0.00452	.|.	.|.	ENSG00000100300|ENSG00000100300	ENST00000396265|ENST00000337554;ENST00000329563	T|T;T	0.52295|0.38560	0.67|1.13;1.13	4.68|4.68	-7.42|-7.42	0.01388|0.01388	.|.	.|1.272910	.|0.04986	.|N	.|0.466474	T|T	0.15305|0.15305	0.0369|0.0369	N|N	0.02103|0.02103	-0.685|-0.685	0.09310|0.09310	N|N	1|1	B|B	0.10296|0.02656	0.003|0.0	B|B	0.06405|0.06405	0.002|0.002	T|T	0.39418|0.39418	-0.9615|-0.9615	9|10	0.87932|0.08599	D|T	0|0.76	-19.2769|-19.2769	12.8288|12.8288	0.57735|0.57735	0.1637:0.2126:0.6238:0.0|0.1637:0.2126:0.6238:0.0	.|.	55|149	B1AH88|P30536	TSPOB_HUMAN|TSPOA_HUMAN	R|A	55|149	ENSP00000379563:H55R|ENSP00000338004:T149A;ENSP00000328973:T149A	ENSP00000379563:H55R|ENSP00000328973:T149A	H|T	+|+	2|1	0|0	TSPO|TSPO	41888876|41888876	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.058000|0.058000	0.15608|0.15608	-0.684000|-0.684000	0.05173|0.05173	-2.116000|-2.116000	0.00830|0.00830	-0.256000|-0.256000	0.11100|0.11100	CAC|ACA	TSPO	-	pfam_TspO_MBR,pirsf_TspO_MBR	ENSG00000100300		0.701	TSPO-201	KNOWN	basic	protein_coding	TSPO	HGNC	protein_coding		-	0.00	60	0	A	NM_007311		43558932	+1	tier1	-	no_errors	ENST00000329563	ensembl	human	known	74_37	missense	9.76	37	4	SNP	0.000	G
TSSC4	10078	genome.wustl.edu	37	11	2423907	2423907	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr11:2423907G>A	ENST00000333256.6	+	3	487	c.44G>A	c.(43-45)gGc>gAc	p.G15D	TSSC4_ENST00000380996.5_Intron|TSSC4_ENST00000451491.2_Missense_Mutation_p.G15D|AC124057.5_ENST00000433035.1_RNA|TSSC4_ENST00000380992.1_Intron			Q9Y5U2	TSSC4_HUMAN	tumor suppressing subtransferable candidate 4	15										endometrium(3)|large_intestine(1)|lung(4)	8		all_epithelial(84;0.000161)|Breast(177;0.000962)|Medulloblastoma(188;0.00106)|Ovarian(85;0.0014)|all_neural(188;0.0137)|Lung NSC(207;0.209)		BRCA - Breast invasive adenocarcinoma(625;0.00145)|LUSC - Lung squamous cell carcinoma(625;0.19)		AGCGTGGAGGGCGAACACGGG	0.597																																																	0													59.0	43.0	49.0					11																	2423907		2185	4292	6477	SO:0001583	missense	0			AF125568	CCDS7735.1, CCDS73241.1	11p15.5	2008-02-05			ENSG00000184281	ENSG00000184281			12386	protein-coding gene	gene with protein product		603852				10072438	Standard	XM_005252722		Approved		uc001lwl.3	Q9Y5U2	OTTHUMG00000009895	ENST00000333256.6:c.44G>A	11.37:g.2423907G>A	ENSP00000331087:p.Gly15Asp		C9JS66|Q86VL2|Q9BRS6	Missense_Mutation	SNP	NULL	p.G15D	ENST00000333256.6	37	c.44	CCDS7735.1	11	.	.	.	.	.	.	.	.	.	.	G	11.90	1.777993	0.31502	.	.	ENSG00000184281	ENST00000333256;ENST00000437110;ENST00000435795;ENST00000485682;ENST00000496468;ENST00000451491	T;T;T;T;T;T	0.47177	2.44;1.44;0.85;0.86;1.46;2.44	2.67	-2.66	0.06077	.	1.746520	0.04149	U	0.320906	T	0.23926	0.0579	N	0.08118	0	0.09310	N	1	B	0.30361	0.277	B	0.23574	0.047	T	0.10154	-1.0642	9	.	.	.	.	7.5304	0.27679	0.0:0.5928:0.1748:0.2324	.	15	Q9Y5U2	TSSC4_HUMAN	D	15	ENSP00000331087:G15D;ENSP00000396925:G15D;ENSP00000403475:G15D;ENSP00000431430:G15D;ENSP00000435013:G15D;ENSP00000411224:G15D	.	G	+	2	0	TSSC4	2380483	0.000000	0.05858	0.000000	0.03702	0.020000	0.10135	-0.061000	0.11693	-0.578000	0.05959	0.462000	0.41574	GGC	TSSC4	-	NULL	ENSG00000184281		0.597	TSSC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSSC4	HGNC	protein_coding	OTTHUMT00000027369.3	-	0.00	77	0	G	NM_005706		2423907	+1	tier1	-	no_errors	ENST00000333256	ensembl	human	known	74_37	missense	48.89	23	22	SNP	0.000	A
TTC24	164118	genome.wustl.edu	37	1	156551465	156551465	+	Silent	SNP	G	G	A			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr1:156551465G>A	ENST00000368237.3	+	1	309	c.309G>A	c.(307-309)ctG>ctA	p.L103L	TTC24_ENST00000368236.3_Silent_p.L103L			A2A3L6	TTC24_HUMAN	tetratricopeptide repeat domain 24	103										breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(10)|pancreas(1)|prostate(1)	20	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					AGCTACTCCTGCGAGCCCACC	0.622																																																	0													36.0	43.0	41.0					1																	156551465		692	1591	2283	SO:0001819	synonymous_variant	0				CCDS53379.1	1q22	2013-01-10			ENSG00000187862	ENSG00000187862		"""Tetratricopeptide (TTC) repeat domain containing"""	32348	protein-coding gene	gene with protein product							Standard	NM_001105669		Approved		uc021pbf.1	A2A3L6	OTTHUMG00000033202	ENST00000368237.3:c.309G>A	1.37:g.156551465G>A			Q5T3H7	Silent	SNP	pfam_TPR_1,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.L103	ENST00000368237.3	37	c.309	CCDS53379.1	1																																																																																			TTC24	-	pfscan_TPR-contain_dom	ENSG00000187862		0.622	TTC24-006	NOVEL	basic|appris_principal|CCDS	protein_coding	TTC24	HGNC	protein_coding	OTTHUMT00000158547.1		0.00	74	0	G	XM_089384		156551465	+1			no_errors	ENST00000368236	ensembl	human	known	74_37	silent	5.63	67	4	SNP	0.032	A
TTC25	83538	genome.wustl.edu	37	17	40092767	40092767	+	RNA	DEL	T	T	-	rs543001676	byFrequency	TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr17:40092767delT	ENST00000591658.1	+	0	507							Q96NG3	TTC25_HUMAN	tetratricopeptide repeat domain 25							cytoplasm (GO:0005737)				endometrium(2)|large_intestine(3)|lung(5)|ovary(1)|urinary_tract(1)	12		all_cancers(22;8.16e-06)|Breast(137;0.000143)|all_epithelial(22;0.000236)				GGACCTCTCCTTCTTAAGCAA	0.547																																																	0													61.0	61.0	61.0					17																	40092767		1929	4119	6048			0			AK055498	CCDS74063.1	17q21.2	2014-08-12			ENSG00000204815	ENSG00000204815		"""Tetratricopeptide (TTC) repeat domain containing"""	25280	protein-coding gene	gene with protein product							Standard	XM_006722129		Approved	DKFZP434H0115	uc002hyj.4	Q96NG3	OTTHUMG00000175837		17.37:g.40092767delT			Q6NX40|Q6PJ04|Q9H0K5	RNA	DEL	-	NULL	ENST00000591658.1	37	NULL		17																																																																																			TTC25	-	-	ENSG00000204815		0.547	TTC25-001	KNOWN	basic	processed_transcript	TTC25	HGNC	processed_transcript	OTTHUMT00000449237.1		0.00	43	0	T	NM_031421		40092767	+1	tier1		no_errors	ENST00000377540	ensembl	human	known	74_37	rna	11.76	15	2	DEL	0.999	-
TTTY5	83863	genome.wustl.edu	37	Y	24443605	24443605	+	lincRNA	DEL	A	A	-			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chrY:24443605delA	ENST00000400581.2	-	0	901					NR_001541.1				testis-specific transcript, Y-linked 5 (non-protein coding)																		TTCAGGGAAGAAGCAACAGAA	0.532																																																	0																																												0			AF332236		Yq11.222	2012-10-12	2009-08-21		ENSG00000215560	ENSG00000215560		"""Long non-coding RNAs"""	16482	non-coding RNA	RNA, long non-coding	"""long intergenic non-protein coding RNA 126"""	400038	"""testis-specific transcript, Y-linked 5"""				Standard	NR_001541		Approved	TTY5, LINC00126	uc004fvb.3		OTTHUMG00000043578		Y.37:g.24443605delA				RNA	DEL	-	NULL	ENST00000400581.2	37	NULL		Y																																																																																			TTTY5	-	-	ENSG00000215560		0.532	TTTY5-001	KNOWN	basic	lincRNA	TTTY5	HGNC	lincRNA	OTTHUMT00000101917.1		0.00	38	0	A	NR_001541		24443605	-1	tier1		no_errors	ENST00000400581	ensembl	human	known	74_37	rna	40.00	3	2	DEL	0.040	-
HYAL2	8692	genome.wustl.edu	37	3	50357934	50357934	+	De_novo_Start_OutOfFrame	SNP	G	G	T			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr3:50357934G>T	ENST00000447092.1	-	0	2279				HYAL2_ENST00000442581.1_De_novo_Start_OutOfFrame|HYAL2_ENST00000395139.3_De_novo_Start_OutOfFrame|HYAL2_ENST00000357750.4_De_novo_Start_OutOfFrame|TUSC2_ENST00000462137.1_5'UTR			Q12891	HYAL2_HUMAN	hyaluronoglucosaminidase 2						carbohydrate metabolic process (GO:0005975)|cartilage development (GO:0051216)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to interleukin-1 (GO:0071347)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cellular response to tumor necrosis factor (GO:0071356)|cellular response to UV-B (GO:0071493)|defense response to virus (GO:0051607)|fusion of virus membrane with host plasma membrane (GO:0019064)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|hematopoietic progenitor cell differentiation (GO:0002244)|hyaluronan catabolic process (GO:0030214)|hyaluronan metabolic process (GO:0030212)|kidney development (GO:0001822)|monocyte activation (GO:0042117)|multicellular organismal aging (GO:0010259)|multicellular organismal iron ion homeostasis (GO:0060586)|negative regulation of cell growth (GO:0030308)|negative regulation of fibroblast migration (GO:0010764)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein tyrosine kinase activity (GO:0061099)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interleukin-6 secretion (GO:2000778)|positive regulation of interleukin-8 secretion (GO:2000484)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of urine volume (GO:0035810)|renal water absorption (GO:0070295)|response to antibiotic (GO:0046677)|response to reactive oxygen species (GO:0000302)|response to virus (GO:0009615)|skeletal system morphogenesis (GO:0048705)|small molecule metabolic process (GO:0044281)|transformation of host cell by virus (GO:0019087)|viral entry into host cell (GO:0046718)	anchored component of external side of plasma membrane (GO:0031362)|anchored component of plasma membrane (GO:0046658)|apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|Golgi membrane (GO:0000139)|lysosome (GO:0005764)|membrane raft (GO:0045121)|microvillus (GO:0005902)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|hyaluronic acid binding (GO:0005540)|hyaluronoglucuronidase activity (GO:0033906)|hyalurononglucosaminidase activity (GO:0004415)|receptor signaling protein tyrosine kinase inhibitor activity (GO:0030294)|receptor tyrosine kinase binding (GO:0030971)|transforming growth factor beta binding (GO:0050431)|virus receptor activity (GO:0001618)			breast(1)|endometrium(2)|kidney(1)|ovary(1)|prostate(1)|skin(1)	7				BRCA - Breast invasive adenocarcinoma(193;0.000272)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00605)		GGGGGCTGCAGGAGGTGTCAC	0.627																																																	0													10.0	10.0	10.0					3																	50357934		2183	4277	6460			0			AJ000099	CCDS2818.1	3p21.3	2008-07-18			ENSG00000068001	ENSG00000068001			5321	protein-coding gene	gene with protein product	"""lysosomal hyaluronidase"", ""PH-20 homolog"", ""hyaluronidase 2"""	603551				9712871, 9790770	Standard	NM_003773		Approved	LuCa-2, LUCA2	uc003czv.3	Q12891	OTTHUMG00000156876	ENST00000447092.1:c.-14C>A	3.37:g.50357934G>T			B3KRZ2|O15177|Q9BW29	RNA	SNP	-	NULL	ENST00000447092.1	37	NULL	CCDS2818.1	3																																																																																			TUSC2	-	-	ENSG00000114383		0.627	HYAL2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	TUSC2	HGNC	protein_coding	OTTHUMT00000346391.1	-	0.00	37	0	G	NM_003773		50357934	-1	tier1	-	no_errors	ENST00000462137	ensembl	human	putative	74_37	rna	25.00	12	4	SNP	0.006	T
UACA	55075	genome.wustl.edu	37	15	70976776	70976776	+	Silent	SNP	G	G	T	rs145754980		TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr15:70976776G>T	ENST00000322954.6	-	8	797	c.612C>A	c.(610-612)ctC>ctA	p.L204L	UACA_ENST00000559183.1_5'Flank|UACA_ENST00000379983.2_Silent_p.L191L|UACA_ENST00000560441.1_Silent_p.L191L|UACA_ENST00000539319.1_Intron	NM_018003.2	NP_060473.2	Q9BZF9	UACA_HUMAN	uveal autoantigen with coiled-coil domains and ankyrin repeats	204					intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|negative regulation of inflammatory response (GO:0050728)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of protein import into nucleus (GO:0042307)|response to UV (GO:0009411)	apoptosome (GO:0043293)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)				breast(2)|endometrium(7)|kidney(4)|large_intestine(13)|lung(17)|ovary(2)|pancreas(1)|prostate(2)|skin(2)	50						AACCTAGCATGAGGGCAGTTC	0.393																																																	0													118.0	114.0	115.0					15																	70976776		2199	4297	6496	SO:0001819	synonymous_variant	0			AF322916	CCDS10235.1, CCDS32280.1	15q22-q24	2013-01-10			ENSG00000137831	ENSG00000137831		"""Ankyrin repeat domain containing"""	15947	protein-coding gene	gene with protein product		612516				11162650, 10997877	Standard	NM_001008224		Approved	FLJ10128, KIAA1561	uc002asr.3	Q9BZF9	OTTHUMG00000133363	ENST00000322954.6:c.612C>A	15.37:g.70976776G>T			G3XAG2|Q14DD3|Q8N3B8|Q96NH6|Q9HCL1|Q9NWC6	Silent	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,superfamily_Prefoldin,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_T_SNARE_dom,prints_Ankyrin_rpt	p.L204	ENST00000322954.6	37	c.612	CCDS10235.1	15																																																																																			UACA	-	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000137831		0.393	UACA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	UACA	HGNC	protein_coding	OTTHUMT00000257199.2	-	0.00	47	0	G			70976776	-1	tier1	-	no_errors	ENST00000322954	ensembl	human	known	74_37	silent	11.54	23	3	SNP	0.986	T
UGT2A3	79799	genome.wustl.edu	37	4	69796326	69796326	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr4:69796326G>T	ENST00000251566.4	-	5	1272	c.1242C>A	c.(1240-1242)aaC>aaA	p.N414K	UGT2A3_ENST00000420231.2_Missense_Mutation_p.N125K	NM_024743.3	NP_079019.3	Q6UWM9	UD2A3_HUMAN	UDP glucuronosyltransferase 2 family, polypeptide A3	414					cellular glucuronidation (GO:0052695)	integral component of membrane (GO:0016021)	glucuronosyltransferase activity (GO:0015020)			NS(1)|breast(1)|central_nervous_system(1)|kidney(5)|large_intestine(7)|lung(16)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	36						TAGTTTTGAAGTTTATTTCTA	0.418																																																	0													148.0	151.0	150.0					4																	69796326		2203	4300	6503	SO:0001583	missense	0				CCDS3525.1	4q13.2	2010-12-14			ENSG00000135220	ENSG00000135220		"""UDP glucuronosyltransferases"""	28528	protein-coding gene	gene with protein product							Standard	NM_024743		Approved	FLJ21934	uc003hef.2	Q6UWM9	OTTHUMG00000129408	ENST00000251566.4:c.1242C>A	4.37:g.69796326G>T	ENSP00000251566:p.Asn414Lys		Q9H6S4	Missense_Mutation	SNP	pfam_UDP_glucos_trans,pfam_Glyco_trans_28_C	p.N414K	ENST00000251566.4	37	c.1242	CCDS3525.1	4	.	.	.	.	.	.	.	.	.	.	G	14.52	2.560899	0.45590	.	.	ENSG00000135220	ENST00000251566;ENST00000420231	T;T	0.61274	0.12;3.3	1.99	1.99	0.26369	.	0.430732	0.24398	N	0.038868	T	0.62612	0.2442	M	0.77486	2.375	0.09310	N	0.999999	P	0.50066	0.931	P	0.52343	0.696	T	0.55623	-0.8112	10	0.87932	D	0	.	4.5189	0.11949	0.2009:0.0:0.7991:0.0	.	414	Q6UWM9	UD2A3_HUMAN	K	414;125	ENSP00000251566:N414K;ENSP00000440115:N125K	ENSP00000251566:N414K	N	-	3	2	UGT2A3	69830915	0.031000	0.19500	0.007000	0.13788	0.070000	0.16714	0.452000	0.21795	1.094000	0.41399	0.491000	0.48974	AAC	UGT2A3	-	pfam_UDP_glucos_trans,pfam_Glyco_trans_28_C	ENSG00000135220		0.418	UGT2A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UGT2A3	HGNC	protein_coding	OTTHUMT00000251564.1		0.00	77	0	G	NM_024743		69796326	-1			no_errors	ENST00000251566	ensembl	human	known	74_37	missense	6.35	59	4	SNP	0.279	T
UFSP2	55325	genome.wustl.edu	37	4	186336464	186336464	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr4:186336464G>T	ENST00000264689.6	-	6	645	c.529C>A	c.(529-531)Cta>Ata	p.L177I	Y_RNA_ENST00000384502.1_RNA|UFSP2_ENST00000502282.1_5'Flank	NM_018359.3	NP_060829.2	Q9NUQ7	UFSP2_HUMAN	UFM1-specific peptidase 2	177						cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)	small conjugating protein-specific protease activity (GO:0019783)|thiolester hydrolase activity (GO:0016790)			endometrium(3)|kidney(1)|large_intestine(3)|lung(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	12		all_lung(41;1.3e-11)|Lung NSC(41;2.25e-11)|Melanoma(20;0.00109)|Colorectal(36;0.0215)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|all_hematologic(60;0.0749)		all cancers(43;3.4e-25)|Epithelial(43;2.23e-22)|OV - Ovarian serous cystadenocarcinoma(60;1.54e-11)|BRCA - Breast invasive adenocarcinoma(30;8.1e-05)|GBM - Glioblastoma multiforme(59;0.000148)|STAD - Stomach adenocarcinoma(60;0.000782)|LUSC - Lung squamous cell carcinoma(40;0.00939)|COAD - Colon adenocarcinoma(29;0.0108)|READ - Rectum adenocarcinoma(43;0.166)		ATGTCAGTTAGTTGATTATGA	0.323																																																	0													53.0	52.0	52.0					4																	186336464		2203	4300	6503	SO:0001583	missense	0			AK002062	CCDS3842.1	4q35.1	2008-03-25	2008-03-25	2008-03-25	ENSG00000109775	ENSG00000109775			25640	protein-coding gene	gene with protein product		611482	"""chromosome 4 open reading frame 20"""	C4orf20		17182609	Standard	NM_018359		Approved	FLJ11200	uc003ixo.2	Q9NUQ7	OTTHUMG00000160441	ENST00000264689.6:c.529C>A	4.37:g.186336464G>T	ENSP00000264689:p.Leu177Ile		Q6IA77|Q96FS3	Missense_Mutation	SNP	pfam_Peptidase_C78_UfSP1/2	p.L177I	ENST00000264689.6	37	c.529	CCDS3842.1	4	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.04|17.04	3.286220|3.286220	0.59867|0.59867	.|.	.|.	ENSG00000109775|ENSG00000109775	ENST00000264689|ENST00000511485	T|.	0.47869|.	0.83|.	5.69|5.69	5.69|5.69	0.88448|0.88448	.|.	0.087523|.	0.48286|.	D|.	0.000187|.	T|T	0.61986|0.61986	0.2391|0.2391	L|L	0.48362|0.48362	1.52|1.52	0.52099|0.52099	D|D	0.999944|0.999944	P;B|.	0.43169|.	0.8;0.414|.	B;B|.	0.42361|.	0.177;0.385|.	T|T	0.57952|0.57952	-0.7722|-0.7722	10|5	0.32370|.	T|.	0.25|.	-20.6591|-20.6591	14.0338|14.0338	0.64632|0.64632	0.0744:0.0:0.9256:0.0|0.0744:0.0:0.9256:0.0	.|.	177;77|.	Q9NUQ7;B3KRI4|.	UFSP2_HUMAN;.|.	I|N	177|90	ENSP00000264689:L177I|.	ENSP00000264689:L177I|.	L|T	-|-	1|2	2|0	UFSP2|UFSP2	186573458|186573458	1.000000|1.000000	0.71417|0.71417	0.986000|0.986000	0.45419|0.45419	0.992000|0.992000	0.81027|0.81027	3.199000|3.199000	0.51043|0.51043	2.681000|2.681000	0.91329|0.91329	0.650000|0.650000	0.86243|0.86243	CTA|ACT	UFSP2	-	NULL	ENSG00000109775		0.323	UFSP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UFSP2	HGNC	protein_coding	OTTHUMT00000360589.2	-	0.00	171	0	G	NM_018359		186336464	-1	tier1	-	no_errors	ENST00000264689	ensembl	human	known	74_37	missense	5.71	66	4	SNP	1.000	T
UNC119	9094	genome.wustl.edu	37	17	26875695	26875695	+	Silent	SNP	G	G	T			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr17:26875695G>T	ENST00000335765.4	-	2	359	c.249C>A	c.(247-249)atC>atA	p.I83I	UNC119_ENST00000484980.1_5'UTR|UNC119_ENST00000301032.4_Silent_p.I83I|UNC119_ENST00000470125.1_5'UTR	NM_005148.3	NP_005139.1	Q13432	U119A_HUMAN	unc-119 homolog (C. elegans)	83					cytokinesis, completion of separation (GO:0007109)|endocytosis (GO:0006897)|lipoprotein transport (GO:0042953)|negative regulation of caveolin-mediated endocytosis (GO:2001287)|negative regulation of clathrin-mediated endocytosis (GO:1900186)|phototransduction (GO:0007602)|positive regulation of protein tyrosine kinase activity (GO:0061098)|synaptic transmission (GO:0007268)|visual perception (GO:0007601)	centrosome (GO:0005813)|cytosol (GO:0005829)|intercellular bridge (GO:0045171)|spindle midzone (GO:0051233)|spindle pole (GO:0000922)	lipid binding (GO:0008289)			breast(1)|large_intestine(1)|lung(3)|prostate(1)|stomach(1)	7	Lung NSC(42;0.00431)					CGATCTTGTAGATATTCTCCT	0.552											OREG0024277	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													90.0	90.0	90.0					17																	26875695		2203	4300	6503	SO:0001819	synonymous_variant	0			U40998	CCDS11233.1, CCDS11234.1	17q11.2	2014-09-17	2001-11-28		ENSG00000109103	ENSG00000109103			12565	protein-coding gene	gene with protein product	"""POC7 centriolar protein homolog A (Chlamydomonas)"""	604011	"""unc119 (C.elegans) homolog"""			8576185, 9538874	Standard	NM_005148		Approved	HRG4, POC7, POC7A	uc002hbk.2	Q13432	OTTHUMG00000132606	ENST00000335765.4:c.249C>A	17.37:g.26875695G>T		790	A8K8G4|F1T095|O95126	Silent	SNP	pfam_GMP_PDE_delta,superfamily_Ig_E-set	p.I83	ENST00000335765.4	37	c.249	CCDS11233.1	17																																																																																			UNC119	-	pfam_GMP_PDE_delta,superfamily_Ig_E-set	ENSG00000109103		0.552	UNC119-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UNC119	HGNC	protein_coding	OTTHUMT00000255842.2	-	0.00	60	0	G			26875695	-1	tier1	-	no_errors	ENST00000335765	ensembl	human	known	74_37	silent	9.09	40	4	SNP	0.885	T
UNC80	285175	genome.wustl.edu	37	2	210698843	210698843	+	Frame_Shift_Del	DEL	A	A	-	rs34015244		TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr2:210698843delA	ENST00000439458.1	+	17	2973	c.2893delA	c.(2893-2895)aaafs	p.K966fs	UNC80_ENST00000272845.6_Frame_Shift_Del_p.K961fs	NM_032504.1	NP_115893.1	Q8N2C7	UNC80_HUMAN	unc-80 homolog (C. elegans)	966					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(1)|prostate(1)	20						AGCACCAGGGAAAAAGGTGGA	0.478																																																	0													126.0	122.0	123.0					2																	210698843		692	1591	2283	SO:0001589	frameshift_variant	0			AK090815	CCDS2387.1, CCDS46504.1, CCDS2387.2	2q35	2009-08-17	2009-08-17	2009-08-17	ENSG00000144406	ENSG00000144406			26582	protein-coding gene	gene with protein product		612636	"""chromosome 2 open reading frame 21"""	C2orf21		19092807	Standard	NM_032504		Approved	FLJ33496, KIAA1843, UNC-80	uc010zjc.1	Q8N2C7	OTTHUMG00000132963	ENST00000439458.1:c.2893delA	2.37:g.210698843delA	ENSP00000391088:p.Lys966fs		B2RN50|B4DQY9|B4DZB3|C4IXS8|C9J1U3|Q96JI4|Q96SS0	Frame_Shift_Del	DEL	NULL	p.K966fs	ENST00000439458.1	37	c.2893	CCDS46504.1	2																																																																																			UNC80	-	NULL	ENSG00000144406		0.478	UNC80-201	KNOWN	basic|appris_principal|CCDS	protein_coding	UNC80	HGNC	protein_coding			0.00	84	0	A	NM_182587		210698843	+1	tier1		no_errors	ENST00000439458	ensembl	human	known	74_37	frame_shift_del	10.34	26	3	DEL	1.000	-
USP14	9097	genome.wustl.edu	37	18	203115	203115	+	Silent	SNP	G	G	T			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr18:203115G>T	ENST00000261601.7	+	12	1051	c.960G>T	c.(958-960)ctG>ctT	p.L320L	USP14_ENST00000383589.2_Silent_p.L274L|USP14_ENST00000400266.3_Silent_p.L309L|USP14_ENST00000582707.1_Silent_p.L285L	NM_005151.3	NP_005142.1	P54578	UBP14_HUMAN	ubiquitin specific peptidase 14 (tRNA-guanine transglycosylase)	320	USP.				negative regulation of endopeptidase activity (GO:0010951)|protein deubiquitination (GO:0016579)|regulation of chemotaxis (GO:0050920)|regulation of proteasomal protein catabolic process (GO:0061136)|synaptic transmission (GO:0007268)|ubiquitin-dependent protein catabolic process (GO:0006511)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|proteasome complex (GO:0000502)|synapse (GO:0045202)	cysteine-type endopeptidase activity (GO:0004197)|endopeptidase inhibitor activity (GO:0004866)|proteasome binding (GO:0070628)|tRNA guanylyltransferase activity (GO:0008193)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			endometrium(1)|large_intestine(1)|lung(5)|ovary(2)|skin(2)	11		all_cancers(4;0.0896)|Myeloproliferative disorder(11;0.0412)				TCAGCCGGCTGCCTGCTTACT	0.338																																																	0													76.0	79.0	78.0					18																	203115		2203	4300	6503	SO:0001819	synonymous_variant	0			U30888	CCDS32780.1, CCDS32781.1	18p11.32	2006-10-06	2005-08-08			ENSG00000101557		"""Ubiquitin-specific peptidases"""	12612	protein-coding gene	gene with protein product		607274	"""ubiquitin specific protease 14 (tRNA-guanine transglycosylase)"""			12838346	Standard	NM_001037334		Approved	TGT	uc002kkf.1	P54578		ENST00000261601.7:c.960G>T	18.37:g.203115G>T			J3QRZ5|Q53XY5	Silent	SNP	pfam_Peptidase_C19/C67,smart_Ubiquitin_dom,pfscan_Peptidase_C19/C67,pfscan_Ubiquitin_supergroup	p.L320	ENST00000261601.7	37	c.960	CCDS32780.1	18																																																																																			USP14	-	pfam_Peptidase_C19/C67,pfscan_Peptidase_C19/C67	ENSG00000101557		0.338	USP14-003	KNOWN	basic|appris_principal|CCDS	protein_coding	USP14	HGNC	protein_coding	OTTHUMT00000440305.3	-	0.00	60	0	G	NM_005151		203115	+1	tier1	-	no_errors	ENST00000261601	ensembl	human	known	74_37	silent	8.51	43	4	SNP	0.849	T
VWF	7450	genome.wustl.edu	37	12	6125355	6125355	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr12:6125355C>T	ENST00000261405.5	-	31	5609	c.5355G>A	c.(5353-5355)atG>atA	p.M1785I		NM_000552.3	NP_000543	P04275	VWF_HUMAN	von Willebrand factor	1785	VWFA 3; main binding site for collagens type I and III. {ECO:0000255|PROSITE- ProRule:PRU00219}.				blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|cell-substrate adhesion (GO:0031589)|extracellular matrix organization (GO:0030198)|hemostasis (GO:0007599)|liver development (GO:0001889)|placenta development (GO:0001890)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|protein homooligomerization (GO:0051260)|response to wounding (GO:0009611)	endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|proteinaceous extracellular matrix (GO:0005578)|Weibel-Palade body (GO:0033093)	chaperone binding (GO:0051087)|collagen binding (GO:0005518)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|immunoglobulin binding (GO:0019865)|integrin binding (GO:0005178)|protease binding (GO:0002020)|protein homodimerization activity (GO:0042803)|protein N-terminus binding (GO:0047485)			NS(1)|breast(6)|central_nervous_system(5)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(25)|lung(41)|ovary(7)|pancreas(2)|prostate(6)|skin(15)|stomach(1)|upper_aerodigestive_tract(5)	129					Antihemophilic Factor(DB00025)	TGGCACCATGCATTTCTGAAG	0.577																																																	0													83.0	72.0	76.0					12																	6125355		2203	4300	6503	SO:0001583	missense	0				CCDS8539.1	12p13.3	2014-09-17			ENSG00000110799	ENSG00000110799		"""Endogenous ligands"""	12726	protein-coding gene	gene with protein product		613160		F8VWF		2251280	Standard	NM_000552		Approved		uc001qnn.1	P04275	OTTHUMG00000168265	ENST00000261405.5:c.5355G>A	12.37:g.6125355C>T	ENSP00000261405:p.Met1785Ile		Q8TCE8|Q99806	Missense_Mutation	SNP	pirsf_VWF,pfam_VWF_type-D,pfam_VWF_A,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,pfam_VWF_C,superfamily_TIL_dom,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_VWF_C,smart_VWF_A,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_VWF_A,pfscan_VWF_C	p.M1785I	ENST00000261405.5	37	c.5355	CCDS8539.1	12	.	.	.	.	.	.	.	.	.	.	.	4.886	0.164704	0.09287	.	.	ENSG00000110799	ENST00000261405	D	0.83250	-1.7	4.58	-2.62	0.06152	von Willebrand factor, type A (3);	1.546720	0.04341	N	0.354002	T	0.61173	0.2326	N	0.01048	-1.04	0.46654	D	0.999148	B	0.02656	0.0	B	0.01281	0.0	T	0.34700	-0.9818	10	0.19590	T	0.45	.	15.7845	0.78291	0.0:0.6853:0.2119:0.1028	.	1785	P04275	VWF_HUMAN	I	1785	ENSP00000261405:M1785I	ENSP00000261405:M1785I	M	-	3	0	VWF	5995616	0.043000	0.20138	0.003000	0.11579	0.664000	0.39144	-0.458000	0.06737	-0.801000	0.04427	-0.314000	0.08810	ATG	VWF	-	pirsf_VWF,pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	ENSG00000110799		0.577	VWF-002	KNOWN	basic|appris_principal|CCDS	protein_coding	VWF	HGNC	protein_coding	OTTHUMT00000399020.1	-	0.00	54	0	C	NM_000552		6125355	-1	tier1	-	no_errors	ENST00000261405	ensembl	human	known	74_37	missense	7.69	48	4	SNP	0.026	T
XIST	7503	genome.wustl.edu	37	X	73070803	73070803	+	lincRNA	SNP	C	C	T			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chrX:73070803C>T	ENST00000429829.1	-	0	1785					NR_001564.2				X inactive specific transcript (non-protein coding)																		GGGAGACATACACGTGGCCCC	0.522																																																	0													46.0	42.0	43.0					X																	73070803		876	1991	2867			0			M97168		Xq13.2	2013-12-18	2013-02-07		ENSG00000229807	ENSG00000229807		"""Long non-coding RNAs"", ""-"""	12810	non-coding RNA	RNA, long non-coding	"""long intergenic non-protein coding RNA 1"""	314670	"""X (inactive)-specific transcript"", ""X (inactive)-specific transcript (non-protein coding)"""	DXS399E		1985261, 2034279	Standard	NR_001564		Approved	NCRNA00001, DXS1089, swd66, LINC00001	uc004ebm.2		OTTHUMG00000021839		X.37:g.73070803C>T				RNA	SNP	-	NULL	ENST00000429829.1	37	NULL		X																																																																																			XIST	-	-	ENSG00000229807		0.522	XIST-001	KNOWN	basic	lincRNA	XIST	HGNC	lincRNA	OTTHUMT00000057239.1	-	0.00	23	0	C	NR_001564		73070803	-1	tier1	-	no_errors	ENST00000429829	ensembl	human	known	74_37	rna	76.19	5	16	SNP	0.000	T
YY1	7528	genome.wustl.edu	37	14	100743822	100743822	+	Missense_Mutation	SNP	A	A	G			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr14:100743822A>G	ENST00000262238.4	+	5	1390	c.1130A>G	c.(1129-1131)cAt>cGt	p.H377R	AL157871.2_ENST00000553954.1_RNA	NM_003403.3	NP_003394.1	P25490	TYY1_HUMAN	YY1 transcription factor	377	Binding to DNA.|Involved in masking transactivation domain.				anterior/posterior pattern specification (GO:0009952)|camera-type eye morphogenesis (GO:0048593)|cell differentiation (GO:0030154)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|chromosome organization (GO:0051276)|double-strand break repair via homologous recombination (GO:0000724)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to prostaglandin F (GO:0034696)|response to UV-C (GO:0010225)|RNA localization (GO:0006403)|spermatogenesis (GO:0007283)	Ino80 complex (GO:0031011)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|four-way junction DNA binding (GO:0000400)|RNA binding (GO:0003723)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(1)|large_intestine(1)|liver(2)|lung(1)|prostate(4)|skin(1)	11		Melanoma(154;0.152)				GTGCGAATCCATACCGGAGAC	0.478																																																	0													132.0	116.0	121.0					14																	100743822		2203	4300	6503	SO:0001583	missense	0			BC020324	CCDS9957.1	14q	2013-01-08			ENSG00000100811	ENSG00000100811		"""INO80 complex subunits"", ""Zinc fingers, C2H2-type"""	12856	protein-coding gene	gene with protein product	"""INO80 complex subunit S"", ""Yin and Yang 1 protein"""	600013				1655281, 7912122	Standard	NM_003403		Approved	NF-E1, DELTA, UCRBP, YIN-YANG-1, INO80S	uc001ygy.2	P25490	OTTHUMG00000150479	ENST00000262238.4:c.1130A>G	14.37:g.100743822A>G	ENSP00000262238:p.His377Arg		Q14935	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pirsf_TF_Yin_yang,pfscan_Znf_C2H2	p.H377R	ENST00000262238.4	37	c.1130	CCDS9957.1	14	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	19.51|19.51	3.840572|3.840572	0.71488|0.71488	.|.	.|.	ENSG00000100811|ENSG00000100811	ENST00000262238|ENST00000554804	T|.	0.67523|.	-0.27|.	5.65|5.65	5.65|5.65	0.86999|0.86999	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);|.	0.000000|.	0.85682|.	U|.	0.000000|.	D|D	0.85630|0.85630	0.5741|0.5741	M|M	0.92649|0.92649	3.33|3.33	0.80722|0.80722	D|D	1|1	D|.	0.71674|.	0.998|.	D|.	0.64776|.	0.929|.	D|D	0.89212|0.89212	0.3565|0.3565	10|5	0.87932|.	D|.	0|.	.|.	16.1778|16.1778	0.81874|0.81874	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	377|.	P25490|.	TYY1_HUMAN|.	R|V	377|153	ENSP00000262238:H377R|.	ENSP00000262238:H377R|.	H|I	+|+	2|1	0|0	YY1|YY1	99813575|99813575	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.996000|0.996000	0.88848|0.88848	9.255000|9.255000	0.95524|0.95524	2.279000|2.279000	0.76181|0.76181	0.533000|0.533000	0.62120|0.62120	CAT|ATA	YY1	-	smart_Znf_C2H2-like,pirsf_TF_Yin_yang,pfscan_Znf_C2H2	ENSG00000100811		0.478	YY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	YY1	HGNC	protein_coding	OTTHUMT00000318277.1	-	0.00	35	0	A	NM_003403		100743822	+1	tier1	-	no_errors	ENST00000262238	ensembl	human	known	74_37	missense	32.14	19	9	SNP	1.000	G
ZBTB16	7704	genome.wustl.edu	37	11	113934619	113934619	+	Silent	SNP	C	C	A			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr11:113934619C>A	ENST00000335953.4	+	2	977	c.597C>A	c.(595-597)acC>acA	p.T199T	ZBTB16_ENST00000392996.2_Silent_p.T199T	NM_006006.4	NP_005997.2	Q05516	ZBT16_HUMAN	zinc finger and BTB domain containing 16	199					anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|cartilage development (GO:0051216)|central nervous system development (GO:0007417)|embryonic digit morphogenesis (GO:0042733)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic pattern specification (GO:0009880)|forelimb morphogenesis (GO:0035136)|hemopoiesis (GO:0030097)|male germ-line stem cell asymmetric division (GO:0048133)|mesonephros development (GO:0001823)|myeloid cell differentiation (GO:0030099)|negative regulation of cell proliferation (GO:0008285)|negative regulation of myeloid cell differentiation (GO:0045638)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cartilage development (GO:0061036)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of NK T cell differentiation (GO:0051138)|positive regulation of ossification (GO:0045778)|positive regulation of transcription, DNA-templated (GO:0045893)|protein localization to nucleus (GO:0034504)|protein ubiquitination (GO:0016567)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|nuclear body (GO:0016604)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|PML body (GO:0016605)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|large_intestine(2)|skin(1)|upper_aerodigestive_tract(2)	6		all_cancers(61;3.79e-18)|all_epithelial(67;2.32e-10)|all_hematologic(158;2.96e-05)|Melanoma(852;0.000362)|Acute lymphoblastic leukemia(157;0.00108)|Breast(348;0.0104)|all_neural(223;0.0294)|Prostate(24;0.0318)|Medulloblastoma(222;0.0438)		BRCA - Breast invasive adenocarcinoma(274;6.75e-06)|Epithelial(105;0.000181)|all cancers(92;0.0018)		TGAGTCCCACCAAGGCTGCAG	0.597																																																	0													44.0	48.0	46.0					11																	113934619		2201	4296	6497	SO:0001819	synonymous_variant	0			Z19002	CCDS8367.1	11q23	2013-10-17	2004-07-16	2004-07-16	ENSG00000109906	ENSG00000109906		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	12930	protein-coding gene	gene with protein product	"""promyelocytic leukaemia zinc finger"""	176797	"""zinc finger protein 145 (Kruppel-like, expressed in promyelocytic leukemia)"""	ZNF145			Standard	XM_006718899		Approved	PLZF	uc001poq.3	Q05516	OTTHUMG00000168243	ENST00000335953.4:c.597C>A	11.37:g.113934619C>A			Q8TAL4	Silent	SNP	pfam_Znf_C2H2,pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.T199	ENST00000335953.4	37	c.597	CCDS8367.1	11																																																																																			ZBTB16	-	NULL	ENSG00000109906		0.597	ZBTB16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBTB16	HGNC	protein_coding	OTTHUMT00000398940.1		0.00	17	0	C	NM_006006		113934619	+1			no_errors	ENST00000335953	ensembl	human	known	74_37	silent	7.41	25	2	SNP	1.000	A
ZC2HC1C	79696	genome.wustl.edu	37	14	75537781	75537781	+	Nonsense_Mutation	SNP	G	G	T			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr14:75537781G>T	ENST00000524913.1	+	2	994	c.505G>T	c.(505-507)Gag>Tag	p.E169*	ACYP1_ENST00000555463.1_5'Flank|ZC2HC1C_ENST00000439583.2_Nonsense_Mutation_p.E169*|ZC2HC1C_ENST00000238686.8_Nonsense_Mutation_p.E169*|ZC2HC1C_ENST00000526748.1_Intron	NM_024643.2	NP_078919.2	Q53FD0	ZC21C_HUMAN	zinc finger, C2HC-type containing 1C	169							metal ion binding (GO:0046872)										AAGGCCCCCTGAGCCGAGAGA	0.562																																																	0													107.0	108.0	107.0					14																	75537781		1921	4119	6040	SO:0001587	stop_gained	0			AK026746	CCDS41972.1, CCDS45138.1	14q24.3	2013-01-10	2012-02-03	2012-02-03	ENSG00000119703	ENSG00000119703		"""Zinc fingers, C2HC-type containing"""	20354	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 140"", ""family with sequence similarity 164, member C"""	C14orf140, FAM164C			Standard	XM_005268062		Approved		uc001xrh.3	Q53FD0	OTTHUMG00000167439	ENST00000524913.1:c.505G>T	14.37:g.75537781G>T	ENSP00000435550:p.Glu169*		E9PJQ0|Q9BTA8|Q9H5S9	Nonsense_Mutation	SNP	NULL	p.E169*	ENST00000524913.1	37	c.505	CCDS41972.1	14	.	.	.	.	.	.	.	.	.	.	G	12.89	2.073185	0.36566	.	.	ENSG00000119703	ENST00000524913;ENST00000238686;ENST00000439583;ENST00000526130	.	.	.	4.72	4.72	0.59763	.	0.202400	0.29126	N	0.013066	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-8.7456	8.1843	0.31330	0.0855:0.1602:0.7543:0.0	.	.	.	.	X	169	.	ENSP00000238686:E169X	E	+	1	0	FAM164C	74607534	0.023000	0.18921	0.926000	0.36857	0.114000	0.19823	1.063000	0.30567	2.463000	0.83235	0.557000	0.71058	GAG	ZC2HC1C	-	NULL	ENSG00000119703		0.562	ZC2HC1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZC2HC1C	HGNC	protein_coding	OTTHUMT00000394616.4	-	0.00	53	0	G	NM_001042430		75537781	+1	tier1	-	no_errors	ENST00000524913	ensembl	human	known	74_37	nonsense	9.76	37	4	SNP	0.625	T
ZFAND1	79752	genome.wustl.edu	37	8	82629519	82629519	+	Nonsense_Mutation	SNP	C	C	A			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr8:82629519C>A	ENST00000220669.5	-	3	121	c.103G>T	c.(103-105)Gaa>Taa	p.E35*	ZFAND1_ENST00000519523.1_Nonsense_Mutation_p.E35*|ZFAND1_ENST00000521895.1_Intron|ZFAND1_ENST00000521287.1_Intron|ZFAND1_ENST00000522520.1_Intron|ZFAND1_ENST00000523096.1_Nonsense_Mutation_p.E35*|ZFAND1_ENST00000517588.1_Intron	NM_024699.2	NP_078975.2	Q8TCF1	ZFAN1_HUMAN	zinc finger, AN1-type domain 1	35							zinc ion binding (GO:0008270)			kidney(1)|large_intestine(1)|lung(7)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	13						CTTCTGTGTTCAAGGCTTAAA	0.289																																																	0													93.0	95.0	94.0					8																	82629519		2203	4296	6499	SO:0001587	stop_gained	0				CCDS6232.1, CCDS55250.1, CCDS55251.1	8q21.13	2006-07-07						"""Zinc fingers, AN1-type domain containing"""	25858	protein-coding gene	gene with protein product						12477932	Standard	NM_024699		Approved	FLJ14007	uc003ycj.2	Q8TCF1		ENST00000220669.5:c.103G>T	8.37:g.82629519C>A	ENSP00000220669:p.Glu35*		E5RIG0|E5RJ99|Q658R7|Q6IA32|Q6PGQ6|Q9H810	Nonsense_Mutation	SNP	pfam_Znf_AN1,smart_Znf_AN1,pfscan_Znf_AN1	p.E35*	ENST00000220669.5	37	c.103	CCDS6232.1	8	.	.	.	.	.	.	.	.	.	.	C	22.3	4.267594	0.80469	.	.	ENSG00000104231	ENST00000523096;ENST00000220669;ENST00000519523	.	.	.	5.71	5.71	0.89125	.	0.099707	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.42905	T	0.14	.	16.3558	0.83235	0.0:0.8594:0.1406:0.0	.	.	.	.	X	35	.	ENSP00000220669:E35X	E	-	1	0	ZFAND1	82792074	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.217000	0.65252	2.700000	0.92200	0.557000	0.71058	GAA	ZFAND1	-	pfam_Znf_AN1,smart_Znf_AN1,pfscan_Znf_AN1	ENSG00000104231		0.289	ZFAND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFAND1	HGNC	protein_coding	OTTHUMT00000379739.1		0.00	42	0	C	NM_024699		82629519	-1			no_errors	ENST00000220669	ensembl	human	known	74_37	nonsense	10.00	18	2	SNP	1.000	A
ZFX	7543	genome.wustl.edu	37	X	24197367	24197367	+	Silent	SNP	A	A	G			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chrX:24197367A>G	ENST00000379177.1	+	6	553	c.126A>G	c.(124-126)tcA>tcG	p.S42S	ZFX_ENST00000304543.5_Silent_p.S42S|ZFX_ENST00000540034.1_Silent_p.S81S|ZFX_ENST00000338565.3_Silent_p.S42S|ZFX_ENST00000459724.1_Intron|ZFX_ENST00000379188.3_Silent_p.S42S|ZFX_ENST00000539115.1_Intron	NM_001178085.1|NM_003410.3	NP_001171556.1|NP_003401.2	P17010	ZFX_HUMAN	zinc finger protein, X-linked	42					death (GO:0016265)|fertilization (GO:0009566)|homeostasis of number of cells (GO:0048872)|multicellular organism growth (GO:0035264)|oocyte development (GO:0048599)|ovarian follicle development (GO:0001541)|parental behavior (GO:0060746)|post-embryonic development (GO:0009791)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|transcription coactivator activity (GO:0003713)			cervix(1)|endometrium(4)|kidney(3)|large_intestine(7)|liver(2)|lung(4)|ovary(2)|prostate(1)	24						TTTTTGTTTCAGATGTTGTGG	0.348																																					Esophageal Squamous(20;306 562 7346 32868 37983)												0													244.0	210.0	221.0					X																	24197367		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS14211.1, CCDS55390.1	Xp22.1-p21.3	2013-01-08			ENSG00000005889	ENSG00000005889		"""Zinc fingers, C2H2-type"""	12869	protein-coding gene	gene with protein product		314980					Standard	NM_003410		Approved	ZNF926	uc022bua.1	P17010	OTTHUMG00000021264	ENST00000379177.1:c.126A>G	X.37:g.24197367A>G			B9EG97|O43668|Q8WYJ8	Silent	SNP	pfam_Transcrp_activ_Zfx/Zfy-dom,pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S81	ENST00000379177.1	37	c.243	CCDS14211.1	X																																																																																			ZFX	-	NULL	ENSG00000005889		0.348	ZFX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFX	HGNC	protein_coding	OTTHUMT00000056084.1	-	0.00	44	0	A	NM_003410		24197367	+1	tier1	-	no_errors	ENST00000540034	ensembl	human	known	74_37	silent	10.34	26	3	SNP	1.000	G
ZNF267	10308	genome.wustl.edu	37	16	31927437	31927437	+	Missense_Mutation	SNP	C	C	T	rs145439451		TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr16:31927437C>T	ENST00000300870.10	+	4	2076	c.1867C>T	c.(1867-1869)Cgg>Tgg	p.R623W		NM_001265588.1|NM_003414.5	NP_001252517.1|NP_003405	Q14586	ZN267_HUMAN	zinc finger protein 267	623					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R623W(1)		breast(3)|endometrium(5)|kidney(1)|large_intestine(14)|lung(11)|ovary(2)|skin(3)|upper_aerodigestive_tract(2)	41						TATTCAGCATCGGAGAATTCA	0.423																																																	1	Substitution - Missense(1)	large_intestine(1)						C	TRP/ARG	1,4393		0,1,2196	72.0	75.0	74.0		1867	0.5	0.2	16	dbSNP_134	74	0,8600		0,0,4300	no	missense	ZNF267	NM_003414.4	101	0,1,6496	TT,TC,CC		0.0,0.0228,0.0077	probably-damaging	623/744	31927437	1,12993	2197	4300	6497	SO:0001583	missense	0			X78925	CCDS32440.1	16p11.2	2013-01-08			ENSG00000185947	ENSG00000185947		"""Zinc fingers, C2H2-type"", ""-"""	13060	protein-coding gene	gene with protein product		604752				7865130	Standard	NM_003414		Approved	HZF2	uc002ecs.5	Q14586		ENST00000300870.10:c.1867C>T	16.37:g.31927437C>T	ENSP00000300870:p.Arg623Trp		A0JNZ9|Q8NE41|Q9NRJ0	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R623W	ENST00000300870.10	37	c.1867	CCDS32440.1	16	.	.	.	.	.	.	.	.	.	.	.	13.38	2.219099	0.39201	2.28E-4	0.0	ENSG00000185947	ENST00000300870	T	0.18810	2.19	0.468	0.468	0.16732	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.13457	0.0326	L	0.52573	1.65	0.80722	D	1	P	0.39311	0.667	B	0.28849	0.095	T	0.11817	-1.0572	9	0.72032	D	0.01	.	4.1882	0.10409	1.0E-4:0.5524:0.4475:0.0	.	623	Q14586	ZN267_HUMAN	W	623	ENSP00000300870:R623W	ENSP00000300870:R623W	R	+	1	2	ZNF267	31834938	0.000000	0.05858	0.246000	0.24233	0.228000	0.25075	-0.112000	0.10791	0.488000	0.27723	0.491000	0.48974	CGG	ZNF267	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000185947		0.423	ZNF267-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF267	HGNC	protein_coding	OTTHUMT00000432446.2		0.00	67	0	C	NM_003414		31927437	+1			no_errors	ENST00000300870	ensembl	human	known	74_37	missense	5.71	33	2	SNP	0.999	T
ZNF407	55628	genome.wustl.edu	37	18	72632586	72632586	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr18:72632586G>A	ENST00000299687.5	+	7	5366	c.5366G>A	c.(5365-5367)cGg>cAg	p.R1789Q	ZNF407_ENST00000577538.1_Missense_Mutation_p.R1789Q	NM_017757.2	NP_060227.2	Q9C0G0	ZN407_HUMAN	zinc finger protein 407	1789					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(6)|kidney(7)|large_intestine(21)|lung(23)|ovary(4)|prostate(3)|upper_aerodigestive_tract(2)	67		Esophageal squamous(42;0.131)|Prostate(75;0.173)		BRCA - Breast invasive adenocarcinoma(31;0.184)		GTGGAGTTCCGGAACCATTTG	0.483																																																	0													74.0	73.0	74.0					18																	72632586		1954	4145	6099	SO:0001583	missense	0			AB051490	CCDS45885.1, CCDS54191.1, CCDS58634.1	18q23	2013-01-08			ENSG00000215421	ENSG00000215421		"""Zinc fingers, C2H2-type"""	19904	protein-coding gene	gene with protein product		615894				11214970	Standard	NM_017757		Approved	FLJ20307, FLJ13839, KIAA1703	uc002llw.2	Q9C0G0		ENST00000299687.5:c.5366G>A	18.37:g.72632586G>A	ENSP00000299687:p.Arg1789Gln		B5MD54|Q96MY0|Q9H8A1|Q9NXD4|Q9NXD7	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,smart_Znf_U1,pfscan_Znf_C2H2	p.R1789Q	ENST00000299687.5	37	c.5366	CCDS45885.1	18	.	.	.	.	.	.	.	.	.	.	G	22.1	4.242632	0.79912	.	.	ENSG00000215421	ENST00000299687	T	0.10477	2.87	5.57	5.57	0.84162	Zinc finger, C2H2-like (1);	0.000000	0.53938	D	0.000057	T	0.25044	0.0608	N	0.26042	0.785	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.00989	-1.1489	10	0.59425	D	0.04	.	18.1016	0.89507	0.0:0.0:1.0:0.0	.	1789;1789	Q9C0G0-2;Q9C0G0	.;ZN407_HUMAN	Q	1789	ENSP00000299687:R1789Q	ENSP00000299687:R1789Q	R	+	2	0	ZNF407	70761574	1.000000	0.71417	0.269000	0.24586	0.072000	0.16883	9.722000	0.98770	-2.218000	0.00730	-0.302000	0.09304	CGG	ZNF407	-	smart_Znf_C2H2-like	ENSG00000215421		0.483	ZNF407-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF407	HGNC	protein_coding	OTTHUMT00000444903.1		0.00	72	0	G	NM_017757		72632586	+1			no_errors	ENST00000299687	ensembl	human	known	74_37	missense	6.67	28	2	SNP	0.008	A
ZNF436	80818	genome.wustl.edu	37	1	23689412	23689412	+	Silent	SNP	G	G	T			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr1:23689412G>T	ENST00000314011.4	-	4	599	c.463C>A	c.(463-465)Cga>Aga	p.R155R	ZNF436_ENST00000374608.3_Silent_p.R155R	NM_001077195.1	NP_001070663.1	Q9C0F3	ZN436_HUMAN	zinc finger protein 436	155					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(8)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	19		Colorectal(325;3.46e-05)|Lung NSC(340;4.15e-05)|all_lung(284;6.64e-05)|Renal(390;0.000219)|Breast(348;0.00262)|Ovarian(437;0.00539)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;6.44e-26)|Colorectal(126;5.5e-08)|COAD - Colon adenocarcinoma(152;3.09e-06)|GBM - Glioblastoma multiforme(114;5.97e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000977)|KIRC - Kidney renal clear cell carcinoma(1967;0.00336)|STAD - Stomach adenocarcinoma(196;0.0127)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.0853)|LUSC - Lung squamous cell carcinoma(448;0.187)		TTCTGATGTCGATTAAGGTCT	0.438																																																	0													103.0	91.0	95.0					1																	23689412		2203	4300	6503	SO:0001819	synonymous_variant	0			AB051497	CCDS233.1	1p36	2013-01-08			ENSG00000125945	ENSG00000125945		"""Zinc fingers, C2H2-type"", ""-"""	20814	protein-coding gene	gene with protein product		611703				11214970	Standard	NM_001077195		Approved	KIAA1710, Zfp46	uc001bgt.3	Q9C0F3	OTTHUMG00000003232	ENST00000314011.4:c.463C>A	1.37:g.23689412G>T			Q658I9	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R155	ENST00000314011.4	37	c.463	CCDS233.1	1																																																																																			ZNF436	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000125945		0.438	ZNF436-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF436	HGNC	protein_coding	OTTHUMT00000008908.1		0.00	55	0	G	NM_030634		23689412	-1			no_errors	ENST00000314011	ensembl	human	known	74_37	silent	5.00	38	2	SNP	0.001	T
ZNF479	90827	genome.wustl.edu	37	7	57188204	57188204	+	Frame_Shift_Del	DEL	A	A	-			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr7:57188204delA	ENST00000331162.4	-	5	1188	c.918delT	c.(916-918)tttfs	p.F306fs		NM_033273.1	NP_150376.1	Q96JC4	ZN479_HUMAN	zinc finger protein 479	306					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(14)|lung(53)|ovary(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	84			GBM - Glioblastoma multiforme(1;9.18e-12)			AGGATACGCTAAAGGCTTTGC	0.478																																																	0													21.0	21.0	21.0					7																	57188204		1941	4124	6065	SO:0001589	frameshift_variant	0			AF277624	CCDS43590.1	7p11.2	2013-01-08			ENSG00000185177	ENSG00000185177		"""Zinc fingers, C2H2-type"", ""-"""	23258	protein-coding gene	gene with protein product						11410164	Standard	NM_033273		Approved	KR19	uc010kzo.3	Q96JC4	OTTHUMG00000156682	ENST00000331162.4:c.918delT	7.37:g.57188204delA	ENSP00000333776:p.Phe306fs			Frame_Shift_Del	DEL	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.F306fs	ENST00000331162.4	37	c.918	CCDS43590.1	7																																																																																			ZNF479	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000185177		0.478	ZNF479-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF479	HGNC	protein_coding	OTTHUMT00000345302.1		0.00	116	0	A	XM_291202		57188204	-1	tier1		no_errors	ENST00000331162	ensembl	human	known	74_37	frame_shift_del	6.67	84	6	DEL	0.022	-
ZNF720	124411	genome.wustl.edu	37	16	31765275	31765275	+	Intron	SNP	A	A	T			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr16:31765275A>T	ENST00000316491.9	+	4	560				ZNF720_ENST00000531864.2_Intron|ZNF720_ENST00000398696.3_Missense_Mutation_p.T69S|ZNF720_ENST00000399681.3_Intron|ZNF720_ENST00000539915.1_Intron|ZNF720_ENST00000534369.1_Intron	NM_001130913.1	NP_001124385.1	Q7Z2F6	ZN720_HUMAN	zinc finger protein 720						regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	nucleic acid binding (GO:0003676)			endometrium(1)|kidney(1)|lung(1)|stomach(1)	4						ATGTAAGACAACTACCTATAA	0.353																																																	0																																										SO:0001627	intron_variant	0			AK128671	CCDS45473.1	16p11.2	2013-01-08				ENSG00000197302		"""Zinc fingers, C2H2-type"", ""-"""	26987	protein-coding gene	gene with protein product							Standard	NM_001130913		Approved		uc002ecq.3	Q7Z2F6		ENST00000316491.9:c.361+54A>T	16.37:g.31765275A>T			Q6ZQX1	Missense_Mutation	SNP	NULL	p.T69S	ENST00000316491.9	37	c.205	CCDS45473.1	16	.	.	.	.	.	.	.	.	.	.	a	7.249	0.602927	0.13939	.	.	ENSG00000197302	ENST00000398696	T	0.02916	4.11	0.826	0.826	0.18829	.	.	.	.	.	T	0.06188	0.0160	.	.	.	0.09310	N	1	P	0.49696	0.927	P	0.56563	0.801	T	0.35226	-0.9797	8	0.45353	T	0.12	.	3.9112	0.09204	1.0:0.0:0.0:0.0	.	69	Q7Z2F6-2	.	S	69	ENSP00000443758:T69S	ENSP00000443758:T69S	T	+	1	0	ZNF720	31672776	0.082000	0.21442	0.012000	0.15200	0.155000	0.21991	0.373000	0.20484	0.634000	0.30469	0.374000	0.22700	ACT	ZNF720	-	NULL	ENSG00000197302		0.353	ZNF720-001	KNOWN	basic|CCDS	protein_coding	ZNF720	HGNC	protein_coding	OTTHUMT00000394883.3	-	0.00	40	0	A	NM_001004300		31765275	+1	tier1	-	no_errors	ENST00000398696	ensembl	human	known	74_37	missense	7.41	50	4	SNP	0.013	T
ZNF99	7652	genome.wustl.edu	37	19	22941058	22941058	+	Silent	SNP	G	G	T			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chr19:22941058G>T	ENST00000596209.1	-	4	1743	c.1653C>A	c.(1651-1653)acC>acA	p.T551T	ZNF99_ENST00000397104.3_Silent_p.T460T	NM_001080409.2	NP_001073878.2	A8MXY4	ZNF99_HUMAN	zinc finger protein 99	551					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(20)|lung(55)|ovary(2)|prostate(10)|skin(5)|stomach(9)|upper_aerodigestive_tract(2)|urinary_tract(3)	124		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.102)				GTTTCATAAGGGTTGAGGAAT	0.333																																																	0													41.0	43.0	42.0					19																	22941058		2048	4208	6256	SO:0001819	synonymous_variant	0			BC021822	CCDS59369.1	19p12	2013-01-08	2006-01-17		ENSG00000213973	ENSG00000213973		"""Zinc fingers, C2H2-type"", ""-"""	13175	protein-coding gene	gene with protein product		603981	"""zinc finger protein 99 (F8281)"", ""chromosome 19 open reading frame 9"""	C19orf9			Standard	NM_001080409		Approved	MGC24986	uc021urt.1	A8MXY4		ENST00000596209.1:c.1653C>A	19.37:g.22941058G>T			M0R335	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.T460	ENST00000596209.1	37	c.1380	CCDS59369.1	19																																																																																			ZNF99	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000213973		0.333	ZNF99-001	NOVEL	not_best_in_genome_evidence|basic|CCDS	protein_coding	ZNF99	HGNC	protein_coding	OTTHUMT00000464591.1	-	0.00	87	0	G	XM_065124		22941058	-1	tier1	-	no_errors	ENST00000397104	ensembl	human	known	74_37	silent	25.45	41	14	SNP	0.000	T
ZXDB	158586	genome.wustl.edu	37	X	57619666	57619666	+	Silent	SNP	C	C	T			TCGA-LN-A8I0-01A-11D-A36J-09	TCGA-LN-A8I0-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3d0906d6-e09d-4a51-b193-df76f464bf2b	ac64b984-1741-431e-adc0-9141658224a6	g.chrX:57619666C>T	ENST00000374888.1	+	1	1398	c.1185C>T	c.(1183-1185)tgC>tgT	p.C395C		NM_007157.3	NP_009088.1	P98169	ZXDB_HUMAN	zinc finger, X-linked, duplicated B	395	Required for interaction with ZXDC. {ECO:0000250}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			NS(1)|central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(1)|lung(7)|ovary(2)|prostate(2)|skin(6)	27						CTTACCAGTGCGCGTTTTCTG	0.542																																																	0													87.0	80.0	82.0					X																	57619666		2203	4297	6500	SO:0001819	synonymous_variant	0			L14788	CCDS35313.1	Xp11.1	2013-01-08			ENSG00000198455	ENSG00000198455		"""Zinc fingers, C2H2-type"""	13199	protein-coding gene	gene with protein product		300236				8268913	Standard	NM_007157		Approved	ZNF905	uc004dvd.3	P98169	OTTHUMG00000021685	ENST00000374888.1:c.1185C>T	X.37:g.57619666C>T			A8K151|Q9UBB3	Silent	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.C395	ENST00000374888.1	37	c.1185	CCDS35313.1	X																																																																																			ZXDB	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000198455		0.542	ZXDB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZXDB	HGNC	protein_coding	OTTHUMT00000056922.1	-	0.00	55	0	C	NM_007157		57619666	+1	tier1	-	no_errors	ENST00000374888	ensembl	human	known	74_37	silent	10.00	36	4	SNP	0.994	T
